Pyrrolo [2, 3-b]pyridine derivatives as protein kinase inhibitors

The present invention relates to kinase modulating compounds and their use. Particular variants provide disease indications that can be treated by modulating kinase activity with the compounds of this invention.

BACKGROUND OF THE INVENTION The information provided herein is intended solely to assist the reader in understanding the foregoing. None of the information or references cited herein are considered prior art for the present invention.

Receptor protein kinases regulate key signaling pathways that control or are involved in the control of a variety of physiological functions including cell growth and proliferation, cell differentiation, cell development, cell division, cell adhesion, stress response, short-range axon contact targeting, regulation transcription, aberrant mitogenesis, angiogenesis, abnormal cell-cell or cell-matrix interactions during vascular development, inflammation, lymphohematopoietic stem cell activity, protective immunity against specific bacteria, allergic asthma, aberrant tissue-specific responses to JNK signaling pathway activation, cell transformation, memory, apoptosis, competitive activity-dependent synapse modification, neuromuscular synapse, immune mediation and calcium regulation.

Specific disease states associated with aberrant regulation of protein kinases include, for example, without limitation, acrocephalo-syndactyly type I, acute myeloid leukemia, non-Hodgkin's lymphoma caused by AIDS, Alzheimer's disease, amyotrophic lateral sclerosis arthritis, asthma, atherosclerosis, atopic dermatitis, autoimmune diseases, bacterial infections, bladder cancer, breast cancer, central nervous system cancer, colon cancer, endometrial cancer, fallopian tube cancer, gastrointestinal tract cancer, ovarian cancer, cardiac

52010 Stoj stasis, chronic myeloid leukemia, colon cancer, colorectal cancer, chronic obstructive pulmonary disease (COPD), Crouzon syndrome, diabetes, diabetic nephropathy, emphysema, endometriosis, epidermoid cancer glostromloritis, fibrosis , Graves' disease, head injury, hepatocellular carcinoma, Hirschsprung's disease, human gliomas, immunodeficiency diseases, inflammatory diseases, ischemic stroke, Jackson-Weiss syndrome, leiomyosarcoma, leukemia, lupus nephritis, malignant melanoma, malignant nephrosclerosis, mastocytosis, mast cell tumors, colon meal, MEN2 syndromes, metabolic disorders, migraine, multiple sclerosis, neurodegenerative diseases , non-small cell lung cancer, organ transplant rejection, osteoporosis, pain, Parkinson's disease, Pfeiffer's syndrome, polycystic kidney disease, primary lymphoedema, prostate cancer, psoriasis, vascular restenosis, rheumatoid arthritis, skin and tissue scarring, selective T-cell defect (STD), severe combined immunodeficiency (SCID), small cell lung cancer, spinal cord injury, lupus erythematosus, squamous cell carcinoma erythematosus, testicular cancer, thrombotic microangiopathy syndromes, Wegener's granulomatosis, X-linked agammaglobulinemia, viral infection, diabetic retinopathy, alopecia, erectile dysfunction, macular degeneration, chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), neurofibromatosis, and tuberous sclerosis. Accordingly, there is a need in the art for additional compounds and methods for their use to modulate receptor protein kinases.

This application is related to the following published patent applications: WO 2004024895, US 20040142864, WO 2004078923, US 20050170431, WO 2005028624, US 20050164300 and WO 2005062795. WO 2004/016610 provides pyrrolo [2,3b] -pyridine compounds. Itk protein kinase inhibitors other than the compounds claimed herein by having an aromatic heterocyclic ring at the 2-position and having different substituents at the 3-position of the pyrrolopyridine ring

SUMMARY OF THE INVENTION The present invention relates to compounds that exhibit protein kinase activity in general, including, but not limited to, Abl, Aktl, Akt2, Akt3, ALK, Alk5, B-Raf, Brk, Btk, Cdk2 , CDK4, CDK5, CDK6, CHK1, c-Raf-1, Csk, EGFR, EphAl, EphA2, EphB2, EphB4, Erk2, Fak, FGFR1, FGFR2, FGFR3, FGFR4, Fltl, Flt3, Flt4, Fyn, , Gsk3a, Gsk3p, HCK, Her2 / Erbb2, Her4 / Erbb4, IGFIR, IKKbeta, Irak4, Itk, Jakl, Jak2, JakZ,

52010 Β

Jnkl, Jnk2, JpkZ, Kdr, Kit, LCK, MAP2K.1, MAP2K2, MAP4K4, MAPKAPK2, Met, Mnkl, MLKl, p38, PDGFRA, PDGFRB, PDPKl, Piml, Pim2, Pim3, PKCta alpha, PK , Plkl, Pyk2, Ret, ROCKl, ROCK2, Ron, Src, Stk6, Syk, TEC, Tic2, TrkA, Yes, and / or Zap70, including any mutation of these kinases, and their use in the treatment of diseases and conditions associated with regulation kinase activity. In particular, the invention relates to compounds of formula II as described below. Thus, the invention provides compounds for therapeutic methods involving protein kinase modulations, as well as novel compounds that can be used for therapeutic methods involving protein kinase modulations.

Compounds of Formula Illm having the structure are described herein

<img file="RS52010B_D0001.tif" />

<img file="RS52010B_D0002.tif" />

and their salts, where:

R is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -OH₂, -CN, -NO₂, -C (O) OH, -S (O)₂NH₂, -C (O) NH₂, -C (S) NH_2j NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NII₂, -OR⁶⁸, -SR⁶⁸, -NR⁶⁹R⁶⁹, -C (O) R⁶⁸, -C (S) R⁶⁸, C (O) OR⁶⁸, -C (O) NR⁶⁹R⁶⁸, -C (S) NR⁶⁹R⁶⁸, -S (O) 2NR⁶⁹R⁶⁸, -NR⁶⁹C (O) R⁶⁸, -NR⁶⁹C (S) R⁶⁸, NR⁶⁹S (O) 2R⁶⁸, -NR⁶⁹C (O) NH2, -NR⁶⁹C (O) NR⁶⁹R⁶⁸, -NR⁶⁹C (S) NH 2, -NR⁶⁹C (S) NR⁶⁹R⁶⁸, NII⁶⁹S (O) 2NH2, -NR⁶⁹S (O) 2NR⁶⁹R⁶⁸, -S (O) R⁶⁸ and -S (O)₂R⁶⁸;

R⁸³ is selected from the group consisting of hydrogen, fluoro and chloro;

52010 Β

112 ·

R is selected from the group consisting of optionally substituted C2-6 alkyl, optionally substituted aryl, optionally substituted heteroaryl and -NR⁷⁹R⁸⁰;

R⁶⁸ is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided that, however, when R⁶⁸ optionally substituted lower alkenyl, no carbon alkenyl atom is attached to N, S, O, S (O), S (O) 2, C (O) or C (S) from -OR⁶⁸, -SR⁶⁸, NR⁶⁹R⁶⁸, -C (O) R⁶⁸, -C (S) R⁶⁸, -C (O) OR⁶⁸, -C (O) NR⁶⁹R⁶⁸, -C (S) NR⁶⁹R⁶⁸, -S (O) 2NR⁶⁹R⁶⁸, NR⁶⁹C (O) R⁶⁸, -NR⁶⁹C (S) R⁶⁸, -NR⁶⁹S (O) 2R⁶⁸, -NR⁶⁹C (O) NH2, -NR⁶⁹C (O) NR⁶⁹R⁶⁸, NR⁶⁹C (S) NR2, -NR⁶⁹C (S) NR⁶⁹R⁶⁸, -NR⁶⁹S (O) 2NH₂, -NR⁶⁹S (O) 2NR⁶⁹R⁶⁸, -S (O) R⁶⁸, or S (O) 2R⁶⁸, optionally substituted lower alkynyl, provided, however, that when R⁶⁸ optionally substituted lower alkynyl, no carbon alkyne atom is attached to N, S, O, S (O), S (O) 2, C (O) or C (S) from -OR⁶⁸, -SR⁶⁸, -NR⁶⁹R⁶⁸, -C (O) R⁶⁸, -C (S) R⁶⁸, -C (O) OR⁶⁸, C (O) NR⁶⁹R⁶⁸, -C (S) NR⁶⁹R⁶⁸, -S (O) 2NR⁶⁹R⁶⁸, -NR⁶⁹C (O) R⁶⁸, -NR⁶⁹C (S) R⁶⁸, -NR⁶⁹S (O) 2R⁶⁸, NR⁶⁹C (O) NH2, -NR⁶⁹C (O) NR⁶⁹R⁶⁸, -NR⁶⁹C (S) NH 2, -NR⁶⁹C (S) NR⁶⁹R⁶⁸, -NR⁶⁹S (O) 2NH₂, NR⁶⁹S (O)₂NR⁶⁹R⁶⁸, -S (O) R⁶⁸, or -S (OhR⁶⁸, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl and optionally substituted heteroaryl;

R⁶⁹ is selected from the group consisting of hydrogen and optionally substituted lower alkyl; i

80 79 80

R and R are independently hydrogen or optionally substituted lower alkyl, or R and R are combined with the nitrogen to which they are attached to form optionally substituted 5-7 membered heterocycloalkyl. In some embodiments of the compounds of Formula No. 1, R is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted heteroaryl, -CN, -S (O)₂NH₂, C (O) NH₂, -OR⁶⁸, -SR⁶⁸, -NR⁶⁹R⁶⁸, -C (O) R⁶⁸, -C (S) R⁶⁸, -C (O) NR⁶⁹R⁶⁸, -S (O) 2NR⁶⁹R⁶⁸, -NR⁶⁹C (O) R⁶⁸, -NR⁶⁹S (O) 2R⁶⁸, -S (O) R⁶⁸ and -S (O)₂R⁶⁸.

The compounds of Formula IIm, and all subvariants detailed herein, may be used to treat a subject suffering from or at risk for any of the diseases or conditions provided herein by a protein kinase.

In some embodiments of the aforementioned compounds, the compounds are excluded in the case where N (except where N is a heteroaryl ring atom), O or S is attached to a carbon atom that is also attached to N (except where N is a heteroaryl ring atom) , O, or S; or wherein N is (except where N is a heteroaryl ring atom), O, C (S), C (O), or S (O)_n (n is 0-2) attached to the carbon alkene of the alkenyl group or attached to the carbon of the alkyne of the alkynyl group; accordingly, in some embodiments the compounds involving bonds such as those that follow are excluded from the present invention: -NR-CH₂-NR-, -OCH₂-NR-, -S-CH₂-NR-, -NR-CH₂-O-, -O-CH₂-O-, -S5

52010Β

CH₂-O-, -NR-CHa-S-, -O-CH₂-S-, -S-CII₂-S-, -NR-CH = CH-, -CHCH-NR-, -NR-C = C-, C = C-NR-, -O-CH = CH-, -CH = CH-O-, - O-OC-, -C = CO-, -S (O)₀.₂-CH = CH-, -CH = CHS (O) o_₂-, -S (O) O-2-C = C-, -C 1 CS (O) o-₂-, -C (O) -CH = CH-, -SNMZN-S (O) -, -C = CC (O) - or C (O) -C = C-, -C (S) -CH = CH -, -CII = CII-C (S) -, -C = CC (S) -, or -C (S) -OC.

With respect to the compounds provided herein, the specification of a compound or grape compound includes pharmaceutically acceptable salts of such compound (or more) unless otherwise indicated. In relation to compositions, kits, procedures for use, etc. the compounds of Formula Illm described herein are intended to include all of their subvariants, unless otherwise indicated.

In one aspect, the invention provides the use of a compound of Formula No for the manufacture of a medicament for treating a protein kinase mediated disease or condition in an animal subject, wherein the use comprises administering to the subject an effective amount of a compound of Formula IIIm and all subvariants thereof. The terms "treat," "therapy," and similar terms refer to the use of a material, e.g., a compound of Formula No., in an amount effective to prevent, alleviate, or ameliorate one or more symptoms of a disease or condition, i.e., indications, and / or to prolong the survival of the subject being treated. The term "protein kinase mediated disease or condition" refers to a disease or condition in which the biological function of a protein kinase affects the development and / or course of a disease or condition, and / or in which protein kinase modulation alters the development, course and / or symptoms of a disease or conditions. A protein kinase-mediated disease or condition includes a disease or condition for which modulation provides a therapeutic benefit, e.g. wherein treatment with protein kinase inhibitors, including the compounds described herein, provides a therapeutic benefit to a subject suffering from or at risk for a disease or condition. In one aspect, the use comprises administering to the subject an effective amount of a compound of Formula Illm in combination with one or more other therapies for a disease or condition.

In one aspect, the invention provides the use of a compound of Formula Illm for the manufacture of a medicament for treating a disease or condition mediated by Raf protein kinase in an animal subject, wherein the use comprises administering to the subject an effective amount of a compound of Formula Illm. The term "Raf protein kinase-mediated disease or condition," "Rafi-like disease or condition" refers to a disease or condition in which the biological function of Raf kinase, including any mutation thereof, affects the development and / or course of a disease or condition, and / or in which modulation of Raf protein kinase alters the development or course and / or symptoms of a disease or condition. Raf protein kinases include, but are not limited to, B-Raf, B-Raf mutations, c-Raf-1 mutations, and c-Raf-1 mutations. In some embodiments, the Raf protein kinase is a B-Raf mutation of V600E. In other embodiments, the disease or condition is a cancer that can be ameliorated by treatment with

52010 Β B-Raf mutant V600E inhibitor. A disease or condition mediated by Raf protein kinase includes a disease or condition for which Raf inhibition provides a therapeutic benefit, e.g. wherein treatment with Raf inhibitors, including the compounds described herein, provides a therapeutic benefit to a subject suffering from or at risk of a disease or condition. In one aspect, the use comprises administering to the subject an effective amount of a compound of Formula No. in combination with one or more other therapies for a disease or condition.

In one aspect, the method comprises administering to the subject an effective amount of a compound of Formula Illm in combination with one or more therapies for the disease. Raf protein kinase includes, but is not limited to, B-Raf, B-Raf mutations, c-Raf 1 mutations, and c-Raf-1 mutations. In some embodiments, the Raf protein kinase is a B-Raf mutation of V600E. In further embodiments, the disease or condition is a cancer that can be ameliorated by treatment with a B6-Raf mutant V600E inhibitor.

In some embodiments, the compound of Formula Illm is a Raf kinase inhibitor and has an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less of 1 nM as determined in a generally accepted assay for Raf kinase activity. In some embodiments, the compound of Formula Illm will have an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM relative to B- Raf, c-Raf 1 or B-Raf V600E mutant. In some embodiments, a compound of Formula Illm will selectively inhibit one Raf kinase over one or more other Raf kinases. In some embodiments, a compound of Formula IIIm will selectively inhibit a Raf kinase mutation relative to wild-type kinases, for example B-Raf V600E relative to wild-type B-Raf.

In addition to any of the aforementioned variants, the compound of the invention will also inhibit the effects of a kinase mutation, including, but not limited to, a mutation associated with a disease state, such as cancer. For example, the B-Raf V600B mutant is present in a high percentage in some cancers, such as melanoma, and the compounds of the invention will inhibit the kinase activity of this mutant.

In another embodiment, the compound of the invention may selectively inhibit one kinase relative to one or more other kinases, wherein the inhibition is preferably selective with respect to any other kinase, whether it is the kinase or other kinase considered herein. In some embodiments, the compound may selectively inhibit the effects of a kinase mutation compared to a wild-type kinase, for example B-Raf V600E over wild-type B-Raf. In some embodiments, the compound may selectively inhibit Fms relative to the Kit. The selective inhibition of one kinase relative to another is such that the IC50 for one kinase can be at least about 2-fold, also 5-fold,

52010 Β also 10-fold, also 20-fold, also 50-fold, or at least about 100-fold less than the IC50 for any other kinase as determined in the generally accepted kinase activity assay.

In another aspect, the invention provides compositions comprising a therapeutically effective amount of at least one compound of Formula III and at least one pharmaceutically acceptable carrier, excipient and / or diluent. The composition may include a plurality of different pharmacologically active compounds, which may include a plurality of compounds of Formula IIm, or may include at least one compound of Formula II together with one compound that is therapeutically effective for the same disease. In one aspect, at least one compound of Formula IHm and at least one compound that is therapeutically effective for the same disease have a synergistic effect on the disease. In one aspect, the composition comprises one or more compounds of Formula IIIm that are effective in treating cancer and one or more other compounds that are effective in treating cancer, further wherein the compounds are synergistically effective in treating cancer.

In one aspect, the invention provides the use of a composition comprising a compound of Formula IIIm for the manufacture of a medicament for treating a disease or condition mediated by B-Raf, c-Raf-1 or B-Raf V600E by administering to a subject an effective amount of the composition. In one aspect, the invention provides the use of a composition comprising a compound of Formula No. for the manufacture of a medicament for the treatment of a disease or condition mediated by B-Raf, cRaf-1 or B-Raf V600E by administering to a subject an effective amount of the composition in combination with one or more other suitable disease treatment therapy. In one aspect, the invention provides the use of a composition comprising a compound of Formula IIIm for the manufacture of a B-Raf V600E mutant-mediated cancer treatment drug by administering to a subject an effective amount of the composition in combination with one or more suitable anti-cancer therapies, such as one or more chemotherapeutic drug therapy.

In one aspect, the invention provides the use of a composition including a compound of Formula No for the manufacture of a medicament for treating cancer by administering to a subject an effective amount of the composition in combination with one or more therapies or medical procedures effective in treating cancer. Other therapies or medical procedures include suitable anticancer therapies (e.g., drug therapy, vaccine therapy, gene therapy, photodynamic therapy) or medical procedure (e.g. surgery, radiation treatment, hyperthermic heating, bone marrow or stem cell transplants). In one aspect, one or more suitable anti-cancer therapies or medical procedures are selected from the group consisting of chemotherapeutic agent treatment (e.g., chemotherapeutic drug), radiation therapy (e.g., x-ray, γ-radiation, or electron, proton, neutron radiation). or partially

52010 Β radiation), hyperthermic heating (eg microwave, ultrasound, radiofrequency ablation), vaccine therapy (eg AFP gene vaccine for hepatocellular carcinoma, vaccine with AFP adenoviral vector, AG-858, allogeneic GM-CSF vaccine secretion dendritic cell peptide vaccine), gene therapy (e.g. Ad5CMV-p53 vector, adenovector encoding MDA7, adenovirus 5-tumor necrosis factor alpha), photodynamic therapy (e.g. aminolevulinic acid, motexafin lutetium), surgery, and bone marrow and stem cell transplantation.

In a preferred embodiment, the invention provides the use of a composition comprising compounds of Formula III for the manufacture of a medicament for the treatment of cancer by administering to a subject an effective amount of the composition in combination with one or more suitable chemotherapeutic agents. In one aspect, one or more suitable chemotherapeutic agents are selected from an alkylating agent, including, but not limited to, adozelesin, altretamine, bizelesin, busulfan, carboplatin, carboquon, carmustine, chlorambucil, cisplatin, cyclophosphamide, ecarbamate, hepsulfam, ifosfamide, improsulfan, irofulven, lomustine, mechloretamine, mclfalan, oxaliplatin, piposulfan, semustine, streptozocin, temozolomide, thiotepa and treosulfan; antibiotics, including, but not limited to, bleomycin, dactinomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, menogaril, mitomycin, mitoxantrone, neocarzinostatin, pentostatin, and plicamycin; antimetabolites, including, but not limited to, azacitidine, capecitabine, cladribine, clofarabine, cytarabine, decitabine, floxuridine, fludarabine, 5-fluorouracil, fluorofur, gemcitabine, hydroxyurea, mercaptopurine, methotrexate, methotrexate ; immunotherapies, including, but not limited to, alcmtuzumab, bevacizumab, cetuximab, galiximab, gemtuzumab, panitumumab, pertuzumab, rituximab, tositumomab, trastuzumab, and 90 Y ibritumomab tiuxetan; a hormone or hormone agonist, including, but not limited to, anastrozole, androgen, buserelin, diethylstilbestrol, exemestane, flutamide, fulvestrant, goserelin, -idoxifene, letrozole, leuprolide, magestrol, raloxifene, tamoxifen, and toremifene; taxanes, including, but not limited to, DJ-927, docetaxel, TPI 287, paclitaxel, and DHApaclitaxel; retinoids, including, but not limited to, alitretinoin, bexarotene, phenretinide, isotretinoin, and tretinoin; alkaloids, including, but not limited to, etoposide, homoharyngtonin, teniposide, vinblastine, vincristine, vindesine, and vinorelbine; antiangiogenic agents, including, but not limited to, AE-941 (GW786034, Neovastat), ABT-510, 2-methoxyestradiol, lenalidomide, and thalidomide; topoisomerase inhibitors, including, but not limited to, amsacrine, edotecarin, exatecan, irinotecan (also the active metabolite SN-38 (7-ethyl-10-hydroxy-camptothecin)), rubitecan, topotecan, and 9-aminocamptothecin;

52010 Β kinase inhibitors, including, but not limited to, erlotinib, gefitinib, flavopiridol, imatinib mesylate, lapatinib, sorafenib, sunitinib malate, AEE-788, AG-013736, AMG706, ΑΜΝ107, BMS-354825, BMS-59 01 (7-hydroxystaurosporine) and vatalanib; a targeted signaling inhibitor including, but not limited to, bortezomib, geldanamycin and rapamycin; biological response modifiers, including, but not limited to, imihimod, interferon-α, and interluccin-2; and other chemotherapeutics, including, but not limited to, 3-AP (3-amino-2-carboxydehyde thiosemicarbazone), aminoglutethimide, asparaginase, briostatin-1, cilengitide, E7389, ixabepilone, procarbazine, sulindac, temifirol. Preferably, the method of treating cancer comprises administering to the subject an effective amount of a composition of Formula I (more preferably Formula III, and even more preferably Formula III, III or III) in combination with a chemotherapeutic agent selected from 5fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, pak -38, temozolomide, vinblastine, bevacizumab, cetuximab or erlotinib.

In another aspect, the invention provides compositions comprising a therapeutically effective amount of a compound of Formula III and at least one pharmaceutically acceptable carrier, excipient and / or diluent. The composition may include a variety of different pharmacologically active compounds, which may include a variety of compounds of Formula Illm.

In a related aspect, the invention provides kits comprising a composition as described herein. In some embodiments, the composition is packaged, e.g., in a bottle, flask, container, which may be further packaged, e.g., inside a box, envelope, or bag; the composition is approved by the US Food and Drug Administration or similar regulatory agencies for use in mammals, e.g., humans; the composition is approved for administration to a mammal, e.g., a human, for a protein kinase-mediated disease or condition; the kit of the invention includes written instructions for use and / or other indications for which the composition is suitable or approved for use in a mammal, e.g., a human, for a protein kinase mediated disease or condition; and the composition is packaged in unit or unit dosage form, e.g., pills, single dose capsules, or the like.

In one aspect, the compounds of Formula Illm may be used to prepare a medicament for the treatment of a disease or condition mediated by B-Raf, which is selected from the group consisting of neurological diseases, such as ischemic stroke, multi-infarct dementia, head injury , spinal cord injury, Alzheimer's disease (AD), Parkinson's disease; neoplastic diseases which include, but are not limited to, melanoma, glioma, sarcoma, cancer (e.g., lung, breast, pancreas, kidney), lymphoma (e.g. histiocytic lymphoma) and cancer of the thyroid gland, lung (eg cancer of small lung cells), liver, breast, ovary, and colon, neurofibromatosis,

52010 Β myelodysplastic syndrome, leukemia, tumor angiogenesis; pain of neuropathic or inflammatory origin, including acute pain, chronic pain, and migraine; cardiovascular diseases including heart failure, cardiac hypertrophy, thrombosis (e.g. thrombotic microangiopathy syndromes), atherosclerosis, reperfusion injury; inflammation including, but not limited to, psoriasis, polycystic kidney disease (PKD), arthritis and autoimmune diseases and conditions, osteoarthritis, endometriosis, scarring, vascular restnosis, fibrotic diseases, rheumatoid arthritis, inflammatory bowel disease (IBD); immunodeficiency diseases, organ transplant rejection, graft-versus-host disease; kidney or prostate diseases including diabetic nephropathy, nephrosclerosis, glomerulonephritis, prostate hyperplasia; metabolic disorders, obesity; infections, including, but not limited to, Helicobacter pylori and Influenza virus, fever, sepsis; pulmonary diseases including chronic obstructive pulmonary disease (COPD) and acute respiratory distress syndrome (ARDS); genetic developmental diseases such as Noonan syndrome, Costello syndrome, (facial-cutaneous-skeletal syndrome), leopard syndrome, cardio-facio-cutaneous syndrome (CFC), and abnormalities of the nerve crest syndrome caused by cardiovascular, skeletal, intestinal, skin, diseases hair and endocrine diseases. In a related aspect, the compounds of Formula IIIm can be used to prepare a medicament for the treatment of a disease or condition mediated by c-Raf-1 selected from the group consisting of colorectal, ovarian, lung and renal cell carcinoma, acute myeloid leukemia, myelodysplastic syndromes, tumor angiogenesis, and neuroendocrine tumors such as thyroid marrow cancer, carcinoid, small cell lung cancer, and pheochromocytoma.

Additional aspects and variants will be apparent from the following Detailed Description and Claims.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS As used herein, the following definitions apply unless otherwise indicated:

"Halogen" refers to all halogens, i.e., chloro (Cl), fluoro (F), bromo (Vg) or iodo (I).

"Hydroxyl" or "hydroxy" refers to the group -011.

"Thiol" refers to the group -SH.

"Lower alkyl" alone or in combination means a radical derived from an alkane containing 1 to 6 carbon atoms (unless specifically defined) which includes a non-branched chain or a branched alkyl. A non-branched chain or garnet alkyl group is attached to any available point to

52010 Β a stable unit is produced. In many embodiments, lower alkyl is a non-branched or garnet alkyl group containing from 1-6, 1-4, or 1-2, carbon atoms, such as methyl, ethyl, propyl, isopropyl, butyl, t-butyl, and the like. . "Substituted lower alkyl" means lower alkyl which is independently substituted, unless otherwise indicated, by one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, linked to any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of -F, -OH, -NH₂, NO₂, -CN, -C (O) OH, -C (S) OH, -C (O) NH₂, -C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, -OR °, -SR °, -OC (O) R °, -OC (S) R °, -C (O) R °, C (S) R °, -C (O) ORo, -C S) OR °, -S (O) R °, -S (O)₂R °, -C (O) NHR °, -C (S) NHR °, -C (O) NR °, C (S) NR ° R °, -S (O)₂NHR °, -S (O)₂NR ° R °, -C (NH) NHR °, -C (NH) NR^pR^c, -NHC (O) R °, NHC (S) R °, NR ° C (O) R °, NR ° C (S) R °, -NHS (O) 2R °, -NR ° S (O) 2R °, -NHC (O) NHR °, NHC (S) NHR °, -NR ° C (O) NH2, -NR ° C (S) NH2, -NR⁰C (O) NHR⁰, -NR ° C (S) NHR °, NHC (O) NR ° R °, -NHC (S) NR ° R °, -NR ° C (O) NR ° R °, -NR ° C (S) NR ° R °, -NHS (O) 2NHR °, NR ° S (O)₂NH₂, -NR^oS (O) 2NHR °, -NHS (O) 2NR ° R °, -NR ° S (O) 2NR ° R °, -NHR °, -NR ° R °, -R^e, R^f and -R^s. Further, possible substitutions include subgroups of these substitutions, as indicated herein, for example, in the description of a compound of Formula III, attached to any available atom to produce a stable compound. For example, "lower alkyl substituted with fluoro" means a lower alkyl group substituted with one or more fluorine atoms, such as perfluoroalkyl, where preferably lower alkyl is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is understood that the substitutions are attached to any available atom to produce a stable compound, when, optionally substituted alkyl is an R group of a moiety such as -OR (e.g. alkoxy), -SR (e.g. thioalkyl), -NHR ( e.g. alkylamino), -C (O) NHR, and the like, the substitution of the R alkyl group is such that the substitution of the carbon alkyl atom attached to any of the O, S or N groups (except where N is a ring heteroaryl atom) excludes substituents where any An O, S, or N substituent (except where N is a heteroaryl ring atom) attached to an alkyl carbon was attached to any 0, S, or N from the grape. "S2-b alkyl" means lower alkyl containing 2-6 carbon atoms. „Substituted C₂.6 alkyl "means optionally substituted lower alkyl containing 2-6 carbon atoms. "Substituted methyl" means methyl that is independently substituted, unless otherwise indicated, with 1, 2, or 3 substituents, wherein the substituents are selected from optionally substituted lower alkyl.

Lower alkenyl alone or in combination means a non-garnet or garnet hydrocarbon containing 2-6 carbon atoms (unless specifically indicated) and at least one, preferably 13, more preferably 1-2, most preferably one, double carbon-carbon bond. The carbon-carbon double bond may be within a part of a garnet or non-branched chain. Examples of lower alkenyl

52010 Β groups include ethenyl, propenyl, isopropenyl, butenyl, and the like. "Substituted lower alkenyl" means lower alkenyl which is independently substituted, unless otherwise indicated, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached to any available atom to would produce a stable compound, wherein the substituents are selected from the group consisting of -F, -OI, -NH₂, -NO₂, -CN, -C (O) OH, -C (S) O1I, -C (O) NH₂, -C (S) NH₂, S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, OR °, -SR °, -OC (O) R^h, -OC (S) R °, -C (O) R °, -C (S) R °, -C (O) OR °, -C (S) OR °, -S (O) R °, - S (O) 2R °, -C (O) NHR °, C (S) NHR °, -C (O) NR ° R °, -C (S) NR ° R °, -S (O) 2NHR °, -S (O) 2NR 0 R⁰, -C (NH) NHR 0, C (NII) NR^pR^c, -NHC (O) R °, -NHC (S) R °, -NR ° C (O) R °, -NR ° C (S) R °, -NHS (O) 2R °, NR ° S )₂R 0, -NHC (O) NHR 0, -NHC (S) NHR 0, -NR^oC (O) NH2, -NR^oC (S) NH2> NR ° C (O) NHR °, -NR ° C (S) NHR °, -NHC (O) NR ° R °, -NHC (S) NR ° R °, -NR ° C ( O) NR ° R °, NR ° C (S) NR^UR⁰, -NHS (O) 2NHR 0, -NR^oS (O) 2NH₂, NR^oS (O) 2NI IR ”, -NHS (O) 2NR ° R^o, NR ° S (O) 2NR °, -NHR °, -NR ° R °, -R^d, -R¹ and -R⁸. Further, possible substitutions include subgroups of these substitutions, as indicated herein, for example, in the description of the compounds of Formula III, attached to any available atom to produce a stable compound. For example, "lower alkenyl substituted with fluoro" means a lower alkenyl group substituted with one or more fluorine atoms, preferably lower alkenyl substituted with 1,2, 3, 4 or 5 fluorine atoms, also 1, 2, or 3 fluorine atoms . While it is assumed that the substitutions are attached to any available atom to produce a stable compound, the substitutions of alkenyl groups are such that -F, -C (O) -, C (S) -, -C (NH) -, -S (O) -, -S (O)₂-, -O-, -S-, or N (except where N is a heteroaryl ring atom), are not attached to their alkene carbon atom. Further, wherein the alkenyl substituent is a second group or an R group of a group such as -OR, -NHR, -C (O) R, and the like, the substitution of the group is such that any of their -C (O) -, -C ) -, -S (O) -, -S (O)₂-, -O-, -S-, or N (except where N is a heteroaryl ring atom) is not attached to the carbon alkene of the alkenyl substituent or R group. Further, wherein the alkenyl substituent is another group or an R group of a group such as -OR, -NHR, -C (O) NHR, and the like, the substitution of the alkenyl R group is such that the carbon substitution of the alkenyl attached to any O, S, or N from the group (except where N is a heteroaryl group atom) excludes substituents which would result in any 0, S, or N substituent (except where N is a heteroaryl group atom) being attached to an alkenyl carbon attached to O, S, or H groups. "Alkenyl carbon refers to any carbon within an alkenyl group, whether saturated or a carbon-carbon double bond. Alkene carbon refers to the carbon within the aleknyl group that is part of the carbon carbon of the double bond.

"Lower alkynyl" alone or in combination means a non-branched or garnet hydrocarbon containing 2-6 carbon atoms (unless specifically defined) containing at least one, preferably one, carbon carbon triple bond. Examples of alkynyl groups include ethynyl,

52010 Β Propynyl, butynyl, and the like. "Substituted lower alkynyl" means lower alkynyl which is independently substituted, unless otherwise indicated, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents attached to any available atom that a stable compound would be produced, wherein the substituents are selected from the group consisting of -F, -OH, -NII2, -NO₂, -CN, C (O) OH, -C (S) OH, -C (O) NH₂, -C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, NHS (O)₂NH₂, -C (NH) NH₂, -OR °, -SR °, -OC (O) R °, -OC (S) R °, -C (O) R °, -C (S) R °, -C (O) OR °, - C (S) OR °, -S (O) R °, -S (O)₂R °, -C (O) NHR °, -C (S) NFIR °, -C (O) NR ° R °, -C (S) NR ° R °, S (O)₂NHR °, -S (O)₂NR ° R^o, -C (NH) NHR 0, -C (NH) NR^pR^c, -NHC (O) R °, -NHC (S) R °, NR ° C (O) R °, -NR ° C (S) R °, -NHS (O) 2R °, -NR ° S ) 2R °, -NHC (O) NHR °, -NHC (S) NHR °, NR ° C (O) NH2, -NR ° C (S) NH2, -NR ° C (O) NHR °, -NR ° C (S) NHR °, -NHC (0) NR ° R °, NHC (S) NR ° R °, -NR ° C (O) NR ° R °, -NR ° C (S) NR ° R °, -NHS (O) 2NHR °, -NR ° S (O) 2NH2, NR ° S (O) 2NHR^u, -NHS (O) 2NR^oR °, -NR^oS (O) 2NR ° R⁰, -NHR, -NR ° R °, -R^d, -R^e and -R⁶. Further, possible substitutions include subgroups of these substitutions, as indicated herein, for example, in the description of a compound of Formula 111, attached to any available atom to produce a stable compound. For example, "lower alkynyl substituted with fluoro" means a lower alkynyl group substituted with one or more fluoro atoms, where preferably lower alkynyl substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms . While it is understood that substitutions are attached to any available atom to produce a stable compound, the substitution of the alkynyl group is such that -F, -C (O) -, -C (S) -, -C (NII) -, - S (O) -, -S (O) 2-, -O-, -S-, or N (except where g is the N atom of a heteroaryl ring) are not attached to their carbon alkyne. Further, wherein the alkynyl substituent of the second group or the R group is a group such as -OR, -NHR, -C (O) R, and the like, the substitution of the group is such that any of their -C (O) -, -C ) -, - S (O) -, -S (O)₂-, -O-, -S-, or N (except where N is a heteroaryl group atom) is not attached to a carbon alkyne alkynyl substituent or an R group. Further, wherein the alkynyl substituent of the second group or the R group is from a group such as -OR, -NHR, -C (O) NHR, and the like, the substitution of the alkynyl R group is such that the carbon substitution of the alkynyl attached to any 0, S, or N groups (except where N is an atom of a heteroaryl group) excludes substituents which would result in any O, S or N substituent (except where N is an atom of a heteroaryl group) being attached to an alkynyl carbon attached to any 0, S, or N from the group. "Alkynyl carbon" refers to any carbon within an alkynyl group, whether saturated or a carbon-carbon triangular bond. "Alkyne carbon" refers to carbon within an alkynyl group that is part of the carbon carbon of a triple bond.

"Cycloalkyl" refers to saturated or unsaturated, non-aromatic monocyclic, dicyclic or tricyclic carbon ring systems, from 3-10, also 3-8, more preferably 3-6, ring members per ring, such as cyclopropyl, cyclopentyl, cyclohexyl, adamantyl and the like.

52010 ““ Substituted cycloalkyl ”is cycloalkyl which is independently substituted, unless otherwise indicated, by one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached to any available atom to produced a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH₂, - NO₂, -CN, -C (O) OH, -C (S) OH, -C (O) NH₂, C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, -OR ', SR °, -OC (O) R °, -OC (S) R °, -C (O) R', -C (S) R °, -C (O) OR ', -C (S) OR °, -S (O) R °, -S (O)₂R °, C (O) NHR ', -C (S) NHR °, -C (O) NR ° R °, -C (S) NR ° R °, -S (O)₂NHR ', -S (O)₂NR ° R ", C (NH) MHR °, -C (NH) NRpRc, -NHC (O) R ', -NMC (S) R °, -NR'C (O) R °, -NR'C ( S) R ', NHS (O)₂R °, NR ”S (O)₂R °, -NHC (O) NHR °, -NHC (S) NHR °, -NR'C (O) NH₂, -NR'C (S) NH₂, NR “C (O) NHR °, -NR ° C (S) NHR ', -NHC (O) NR ° R”, NHC (S) NR ° R °, -NR ° C (O) NR ° R ° , NR ° C (S) NR ° R °, NIIS (O)₂NHR °, -NR ° S (O)₂NH₂, -NR ° S (O)₂NHR °, -NHS (O)₂NR ° R °, NR'S (O)₂NR ° R °, -NHR °, -NR ° R °, -R^d, -R^c, -R^f and -R⁸.

"Heterocycloalkyl" refers to a saturated or unsaturated non-aromatic cycloalkyl group having from 5 to 10 atoms in which from 1 to 3 ring carbon atoms are replaced by heteroatoms O, S or N, and are optionally fused to benzo or heteroaryl of 5-6 ring members. It is also intended that heterocycloalkyl include oxidized C or N, such as sulfinyl, sulfonyl, and tertiary nitrogen ring N-oxide. It is also intended that heterocycloalkyl include compounds in which the ring carbon may be oxo substituted, i. The carbon ring is a carbonyl group, such as lactones and lactams. The bonding site of the heterocycloalkyl ring is on a carbon or nitrogen atom so as to maintain ring stability. Examples of heterocycloalkyl groups include, but are not limited to, morpholino, tetrahydrofuranyl, dihydropyridinyl, piperidinyl, pyrrolidinyl, pyrrolidonyl, piperazinyl, dihydrobenzofuryl, and dihydroindolyl. "Substituted heterocycloalkyl" is heterocycloalkyl which is independently substituted, unless otherwise indicated, by one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached to any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NII₂, -NO₂, -CN, -C (O) OH, -C (S) OH, C (O) NH₂, -C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂. -NHS (O)₂NH₂, -C (NH) NH₂, -OR °, -SR ', -OC (O) R °, -OC (S) R °, -C (O) R ", -C (S) R', - C (O) OR ', - C (S) OR ', -S (O) R °, S (O)₂R °, -C (O) NHR °, -C (S) NHR ', -C (O) NR'R \ -C (S) NR'R \ -S (O)₂NHR °, -S (O)₂NR ° R^o, C (NH) NHR °, -C (NH) NRpRc, -NHC (O) R °, -NHC (S) R ", -NR ° C (O) R °, NR ° C (S) R", NHS (O)₂R °, NR'S (O)₂R 1 -NHC (O) NHR 0, -NHC (S) NHR 0, NR “C (O) NH₂, -NR'C (S) NH₂, NR ° C (O) NHR °, -NR ° C (S) NHR °, -NHC (O) NR ° R °, -NHC (S) NR'R ', - NR'C (O) NR'R \ NR ° C (S) NR ° R °, -NHS (O)₂NHR, -NR ° S (O)₂NH₂, -NR ° S (O)₂NHR °, -NHS (O)₂NR ° R °, -NR ° S (O)₂NR'R °, NHR °, -NR ° R °, -R^d, -R^c, -R^f and -R^s.

52010 Β

"Aryl" alone or in combination refers to a monocyclic or bicyclic ring system containing aromatic hydrocarbons such as phenyl or naphthyl, which may be optionally fused to cycloalkyl of preferably 5-7, more preferably 5-6, ring members. . "Arylene" is a divalent aryl. "Substituted aryl" is aryl which is independently substituted, unless otherwise indicated, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached to any available atom to produced a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, -C (O) OH, -C (S) OH, C (O) NH₂, -C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, -OR °, -SR °, -OC (O) R 1 -OC (S) R 0, -C (O) R 0, -C (S) R 3, -C (O) OR 1, -C (S) OR ', -S (O) R °, S (O)₂R °, -C (O) NHR °, -C (S) NHR °, -C (O) NR ° R °, -C (S) NR ° R 1 -S (O)₂NHR °, -S (O)₂NR ° R °, C (NH) NHR °, -C (NH) NR^pR^c, -NHC (O) R °, -NHC (S) R °, NR ° C (O) R ", NR ° C (S) R °, NHS (O) 2R °, -NR ° S (O) 2R °, -NHC (O) NHR °, -NHC (S) NHR ', -R'CC (O) NH2, -NR'C (S) NH2, NR'C (O) NHR °, -NR ° C S) NHR °, NHC (O) NTR ° R ”, -NHC (S) NR'R ', -NR“ C (O) NR ° R ”, NR ° C (S) NR ° R °, -NHS ( O) 2NHR 0, -NR^oS (O) 2NH₂, -NR'S (O)₂NHR °, -NHS (O)₂NR ° R °, NR ° S (O)₂NR ° R °, -NHR °, -NR ° R °, -R^d, -R^c, -R¹ and -R⁸. "Substituted arylene" is a divalent substituted aryl.

"Heteroaryl" alone or in combination refers to the structure of a monocyclic aromatic ring containing 5 or 6 ring atoms, or a bicyclic aromatic group having 8 to 10 atoms, containing one or more, preferably 1-4, even more preferably 1-3, even more preferably 1-2, heteroatoms independently selected from the group consisting of O, S and N. It is also intended that the heteroaryl includes oxidized S or N, such as sulfinyl, sulfonyl and N-oxide or tertiary nitrogen ring atom. A carbon or nitrogen atom is the site of attachment of a heteroaryl ring such as to produce a stable compound. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyridazinyl, pyrazinyl, quinaoxalyl, indolizinyl, benzo [b] thienyl, quinazolinyl, purinyl, indolyl, quinolinyl, pyrimidinyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, thiazolyl isothiazolyl, tetrazolyl, imidazolyl, triazolyl, furanyl, benzofuryl and indolyl. "Nitrogen-containing heteroaryl" refers to heteroaryl where any of the N atoms are. "Heteroarylene" is a divalent heteroaryl. "Substituted heteroaryl" is heteroaryl which is independently substituted, unless otherwise indicated, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached to any available atom to produced a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, C (O) OH, -C (S) OH, -C (O) NH₂, -C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, NHS (O)₂NH₂, -C (NH) NH₂, -OR °, -SR ', -OC (O) R', -OC (S) R °, -C (O) R °, -C (S) R °, -C (O) OR ', - C (S) OR 0, -S (O) R 0, -S (O) 2 R 1 -C (O) NHR ', -C (S) NHR ", -C (O) NR 0 R 0, -C (S) NR ° R °,

52010 Β

S (O)₂NHR °, -S (O)₂NR 0 R 1 -C (NH) NIIR 1, -C (NH) NR^pR^c, -NHC (O) R °, -NHC (S) R °, NR ° C (O) R °, -NR ° C (S) R °, -NHS (O)₂R °, -NR ° S (O)_ŽR °, -NHC (O) NHR °, -NHC (S) NHR ', NR'C (O) NH₂, -NR'C (S) NH₂, -NR'C (O) NHR °, -NR'C (S) NHR °, -NHC (O) MR ° R ', NHC (S) NR ° R °, -NR ° C (O) NR'R °, -NR ° C (S) NR ° R °, -NHS (O)₂NHR ”, -NR'S (O)₂NH₂, NR ° S (O)₂NHR ', -NHS (O)₂NR'R ', NR ° S (O)₂NR 0 R 0, -NHR, -NR 0 R 0, -R^d, -R^e, -R^r and -R⁸. "Substituted heteroarylene" is divalent substituted heteroaryl.

The variables R °, R^p, R^c, R^d, R^c, R^f and R^s as used in the description of optional substituents for alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are defined as follows:

each R °, R^p and R^c are independently selected from the group consisting of R^d, R^e, R^r, and R⁸, or R^p and R^ccombine with the nitrogen to which they are attached to form 5-7-membered heterocycloalkyl or 5 or 7 membered nitrogen-containing heteroaryl, wherein the 5-7-membered heterocycloalkyl or 5 or 7 membered nitrogen-containing heteroaryl are optionally substituted with one or more, preferably 1, 2, 3,4 or 5, also 1,2, or 3 substituents selected from the group consisting of halogen, -NO₂, -CN, -OH, -NH₂, -OR^U, SR^U, -NHR^U, -NR^UR^U, -R^x and -R^y;

each R^d is independently lower alkyl, wherein the lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH2, - NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, -S (O) 2NH2, NHC (O) NH2, -NHC ) NH2, NHS (O) 2NH2, -C (NH) NH2. -OR^k, -SR^k, -OC (O) R^k, -OC (S) R^k, C (O) R^k, -C (S) R^k, -C (O) OR^k, -C (S) OR^k, -S (O) R^k, -S (O) 2R^k, -C (O) NHR^k, -C (S) NHR^k, C (O) NR^kR^k, -C (S) NR^kR^k, -S (O) 2NHR^k, -S (O) 2NR^kR^k, -C (NII) NHR^k, -CWNR^mRⁿ, NHC (O) R^k, NHC (S) R^k, -NR^kC (O) R^k, -NR^kC (S) R^k, -NHS (O) 2R^k, -NR^kS (O) 2R^k, NHC (O) NHR^k, -NHC (S) NHR^k, -NR^kC (O) NII2, -NR^kC (S) NH 2, -NR^kC (O) NHR^k, NR^kC (S) NHR^k, NHC (O) NR^kR^k, NHC (S) NR^kR^k, NR^kC (O) NR^kR^k, NR^kC (S) NR^kR^k, NHS (O) 2 NHR^k, -NR^kS (O) 2NH₂, -NR^kS (O) 2 NHR^k, -NHS (O) 2NR^kR^k, -NR^kS (O)₂NR^kR^k, NHR^k, -NR^kR^k, -R¹ and R^j;

each R^c is independently lower alkenyl, wherein the lower alkenyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH2) - NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2j -S (O) 2NH2, NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, -C (NH) NH2, -OR^k, -SR^k, -OC (O) R^k, -OC (S) R^k, C (O) R^k, -C (S) R^k, -C (O) OR^k, -C (S) OR^k, -S (O) R^k, -S (O) 2R^k, -C (O) NIIR^k, -C (S) NHR^k, C (O) NR^kR^k, -C (S) NR^kR^k, -S (O) 2NHR^k, -S (O) 2NR^kR^k, -C (NII) NHR^k, -C (NH) NR^mRⁿ, NHC (O) R^k, -NHC (S) R^k, -NR^kC (O) R^k, -NR^kC (S) R^k, -NHS (O) 2R^k, -NR^kS (O) 2R^k, NHC (O) NHR^k, -NHC (S) NHR^k, -NR^kC (O) NH2, -NR^kC (S) NH 2, -NR^kC (O) NHR,

52010 Β

NR^kC (S) NHR^k, -NHC (O) NR^kR^k, -NHC (S) NR^kR^k, -NR^kC (O) NR^kR^k, -NR^kC (S) NR^kR^k, NHS (O) 2 NHR^k, -NR^kS (O) 2NH₂, -NR^kS (O) 2 NHR^k, -NHS (O) 2NR^kR^k, -NR^kS (O)₂NR^kR^k, MHR^k, -NR^kR^k, -R^h and -R^.;

each R is independently lower alkynyl, wherein lower alkynyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, NH₂, NO₂, -CN, -C (O) OH, -C (S) OH, -C (O) NH₂- -C (S) NH₂, -S (O)₂NH₂, NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NH₂, -C (NH) NH₂, -OR^k, -SR^k, -OC (O) R^k, -OC (S) R^k, C (O) R^k, -C (S) R^k, -C (O) OR^k, -C (S) OR^k, -S (O) R^k, -S (O)₂R^k, -C (O) NHR^k, -C (S) NHR^k, C (O) NR^kR^k, -C (S) NR^kR^k, -S (O) 2NHR^k, -S (O) 2NR^kR^k -C (NH) NHR^k, -C (NH) NR^mRⁿ, NIIC (O) R^k, -NHC (S) R^k, NR^kC (O) R^k, -NR^k(S) R^k, -NHS (O)₂R^k, -NR^kS (O) 2R^k, NHC (O) NHR^k, NHC (S) NHR^k, -NR^kC (O) NH2, -NR^kC (S) NH 2, -NR^kC (O) Nhr^k, NR^kC (S) NHR^k, -NHC (O) NR^kR^k, -NHC (S) NR^kR^k, -NR^kC (O) NR^kR^k, - NR^k-C (S) NR^kR^k, NHS (O) 2 NHR^k, -NR^kS (O)₂NH₂, -NR^kS (O) 2 NHR^k, -NHS (O) 2NR^kR^k, -NR^kS (O)₂NR^kR^k, NHR^k -N^kR^k, -R^h and -R^j;

each R⁸is independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein the cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, preferably, 1, 2, 3, 4 or 5, also 1, 2 or 3 a substituent selected from the group consisting of halogen, OH, -NH2, -NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, -S O) 2NH2, NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, -C (NH) NH2, -OR^k, -SR^k, -OC (O) R^k, -OC (S) R^k, C (O) R^k, -C (S) R^k, -C (O) OR^k, -C (S) OR^k, -S (O) R^k, -S (O) 2R^k, -C (O) NHR^k, -C (S) NHR^k, C (O) NR^kR^k, -C (S) NR^kR^k, -S (O) 2NHR^k, -S (O) 2NR^kR^k, -C (NH) NIIR^k, -C (NH) NR^mRⁿ, NHC (O) R^k, NHC (S) R^k, -NR^kC (O) R^k -NR^kC (S) R^k, -NHS (O) 2R^k, -NR^kS (O) 2R^k, NHC (O) NIIR^k, -NHC (S) NHR^k, -N^kkC (O) NH2, -NR^kC (S) NH 2, -NR^kC (O) NHR^k, NR^kC (S) NHR^k, -NHC (O) NR^kR^k, NHC (S) NR^kR^k, -NR^kC (O) NR^kR^k, -NR^KC (S) NR^kR^k, NHS (O) 2 NHR^k, -NR^kS (O) 2NH₂, NR^kS (O) 2 NHR^k, -NHS (O) 2NR^kR^k, -NR^kS (O)₂NR^kR^k, NHR^k, -NR^kR^k, -R^h, -R ', and -R^j;

where each R^k, R^m and R is independently selected from the group consisting of R^h, R 'and R^j, or R^m and Rⁿcombined with the nitrogen to which they are attached form a 5-7-membered heterocycloalkyl or 5 or 7-membered nitrogen-containing heteroaryl, wherein the 5-7-membered heterocycloalkyl or 5 or 7-membered nitrogen-containing heteroaryl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -NO₂, -CN, -OH, -NH₂, OR^U, -SR^U, -NHR^U, NR^UR^U, -R^x and -R^y;

where each R^h independently lower alkyl optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of fluoro, -OH, -NH₂, -NO₂, -CN,

52010 Β

-S (O) ON, -C (S) OH, -C (O) NH₂, -C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NII₂, NHS (O)₂NH₂, -C (NH) NH₂, -OR^r, -SR^r, -OC (O) R^r, -OC (S) R^r, -C (O) R^r, -C (S) R^r, -C (O) OR^r, C (S) OR^r, -S (O) R^r, -S (O) 2R^r, -C (O) NHR^r, -C (S) NIIR^r, -C (O) NR^rR^r, -C (S) NR^rR^r, -S (O) 2NHR^r, -S (O) 2NR^rR^r, -C (NII) NHR^r, -C (NH) NR^SR 1, -NHC (O) R^r, -NHC (S) R^r, -NR^rC (O) R^r, NR^rC (S) R^r, -NHS (O) 2R^r, -NR^rS (O) 2R^r, -NHC (O) NHR^r, -NHC (S) NHR^r, NR^rC (O) NII2, NR^rC (S) NH 2, -NR^rC (O) NHR^r, NR^rC (S) NHR^r, -NHC (O) NR^rR^r, -NHC (S) NR^rR^r, NR^rC (O) NR^rR^r, -NR^rC (S) NR^rR^r, -NIIS (O) 2NHR^r, -NR^rS (O) 2NH2, -NR^rS (O) 2 NHR^r, NHS (O) 2NR^rR^r, -NR^rS (O) 2NR^rR^r, -NHR^r, -NR^rR^r, -R 'and -F^j;

wherein each R 1 is independently selected from the group consisting of lower alkenyl and lower alkynyl, wherein the lower alkenyl or lower alkynyl is optionally substituted with one or more, preferably 1,2, 3,4 or 5, also 1, 2 or 3 substituents selected from a group consisting of fluoro, -OH, -NH₂, -NO₂, -CN, -C (O) OH, C (S) OH, -C (O) NH₂, -C (S) NH_2j -S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂, -NHS (O)₂NH₂, C (NH) NH₂, -OR^r, -SR^r, -OC (O) R^r, -OC (S) R^f, -C (O) R^r, -C (S) R^r, - C (O) OR^r, -C (S) OR^r, S (O) R^r, -S (O) 2R^r, -C (O) NHR^r, -C (S) NHR^r, -C (O) NR^rR^r, -C (S) NR^rR^r, -S (O) 2NHR^r, S (O) 2NR^rR^r, -C (NH) NHR^r, -C (NH) NR^SR 1, -NHC (O) R^r, NHC (S) R^r, -NR^rC (O) R^r, -NR^rC (S) R^r, -NHS (O) 2R^r, -NR^rS (O) 2R^r, -NHC (O) NHR^r, -NHC (S) NHR^r, -NR^rC (O) NII2, NR^rC (S) NH2, NR^rC (O) NHR^r, -NR^rC (S) NHR^r, -NHC (O) NR^rR^r, -NHC (S) NR^rR^r, -NR^rC (O) NR^rR^r, NR^rC (S) NR^rR^r, -NHS (O) 2NHR^r, -NR^rS (O) 2NH2, -NRS (O) 2NHR^r, -NHS (O) 2NR^rR^r, NR^rS (O)₂NR^rR^r, -NHR^r, -NR^rR^r and -R^j;

where each R^. independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein the cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from a group consisting of halogen, -OH, -NH2, -NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, -S (O) 2NH2, NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, -C (NH) NH2, -OR^r, -SR^r, -OC (O) R^r, -OC (S) R^r, C (O) R^r, -C (S) R^r, -C (O) OR^r, -C (S) OR^r, -S (O) R^r, -S (O) 2R^r, -C (O) NHR^r, -C (S) NHR^r, C (O) NR^rR^r, -C (S) NR^rR^r, -S (O) 2NHR^r, -S (O) 2NR^rR^r, -C (NH) NHR^r, -C (NH) NR^rR^r, NHC (O) R^r, -NHC (S) R^r, -NR^rC (O) R^r, -NR^rC (S) R^r, -NHS (O) 2 R^r, -NR^rS (O) 2R^r, NHC (O) NHR^r, -NHC (S) NHR^r, -NR^rC (O) NH2, -NR^rC (S) NH 2, -NR^rC (O) NHR^r, NR^rC (S) NHR^r, -NHC (O) NR^rR^r, -NHC (S) NR^rR^r, -NR^rC (O) NR^rR^r, -NR^rC (S) NR^rR^r, NFIS (O)₂NHR^r, -NR^rS (O) 2NH2, -NR^rS (O) 2-NHR^r, -NHS (O)₂NR^rR^r -NR^rS (O)₂NR^rR^r, -NHR^r, NR^rR^r, cycloalkylamino and -R^x;

where each R^r, R^r and R^l independently selected from the group consisting of lower alkyl, S 2-6 alkyl11, S 2-6 alkynyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein the lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of

52010 Β consists of -R ', fluoro, -OH, -NH₂, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, alkylthio substituted with fluoro, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any lower alkyl carbon substitution attached to any O, S, or N, from OR^r, -SR^r, -C (O) OR^r, -C (S) OR^r, -C (O) NHR^r, -C (S) NIIR^r, -C (O) N^rR^r, -C (S) NR^rR^r, S (O) 2 NHR^r, -S (O) 2NR^rR^r, -C (NH) NHR^r, -NR^rC (O) R^r, -NR^rC (S) R^r, -NR^rS (O)₂R^r, NHC (O) NHR^r, -NHC (S) NHR^r, -NR^rC (O) NH2, -NR^rC (S) NH2, NR^rC (O) NHR^r, NR^rC (S) NHR^r, -NHC (O) NR^rR^r, -NHC (S) NR^rR^r, -NR^rC (O) NR^rR^r, -NR^rC (S) NR^rR^r, NHS (O)₂NHR^r, -NR^rS (O) 2NH2, -NR^rS (O) 2 NHR^r, -NHS (O) 2NR^rR^r, -NR^rS (O) 2NR^rR^r, -NIIR^ror -NR^rR^r is selected from the group consisting of fluoro and -R ', and wherein S3.b is alkenyl or S3_b alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R ', fluoro, lower alkyl, lower alkyl substituted with fluoro, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, monoalkylamino, di-alkylamino, and cycloalkylamino, provided, however, ,, that any carbon substitution from C3-6 alkenyl or C3-6alkynyl bonded to any 0, S or N, from -OR^r, -SR^r, C (O) OR^r, -C (S) OR^r-C (O) NHR^r, -C (S) NHR^r, -C (O) NR^rR^r, -C (S) NR^rR^r, -S (O) 2NHR^r, S (O) 2NR^rR^r, -C (NH) NHR^r, -NR^rC (O) R^r, -NR^rC (S) R^r, -NR^rS (O) 2R^r, -NHC (O) NHR^r, NHC (S) MHR^r, -NR^rC (O) NH2, -NR^rC (S) NFI2, -NR^rC (O) NHR^r, -NR^rC (S) NHR^r, NHC (0) NR^rR^r, -NHC (S) NR^rR^r, -NR^rC (O) NR^rR^r, -NR^rC (S) NR^rR^r, -NHS (O) 2NHR^r, NR^rS (O) 2NH₂, -NR^rS (O)₂NHR^r, -NHS (O) 2NR^rR^r, -NR^rS (O) 2 NHR^rR^r, -NHR^r, or NR^rR^r is selected from the group consisting of fluoro, lower alkyl, lower alkyl substituted with fluoro, and -R ', and wherein the cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, preferably 1,

2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OR, -NH₂, NO₂, -CN, lower alkyl, lower alkyl substituted with fluoro, lower alkoxy, alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, mono-alkylamino, di-alkylamino, and cycloalkylamino, or R^s and R^l together with the nitrogen to which they are attached form a 5-7 membered heterocycloalkyl or 5 or 7 membered heteroaryl containing nitrogen, wherein, 5-7 membered heterocycloalkyl or 5 or 7 membered heteroaryl containing nitrogen are optionally substituted with one or more, preferably 1, 2,

3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -NO₂, -CN, -OH, -NH₂, OR^U, -SR^U, -NIIR^u, -NR^UR^U, -R * and -R '; where each R^u independently selected from the group consisting of lower alkyl, S₃-b alkenyl, C3-6 alkynyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein the lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of consisting of -R ', fluoro, -OH, -NH₂, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, mono-alkylamino, dialkylamino, and cycloalkylamino, provided, however, that any lower carbon substitution

52010 O alkyl bonded to O in -OR^U, S from -SR^U, or N from -NHR^U is fluoro or -R ', and wherein C3-6 alkenyl or C3-6 alkynyl are optionally substituted with one or more, preferably I, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of - R 1, fluoro, -OP, -NH 2, lower alkyl, lower alkyl substituted with fluoro, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, mono-alkylamino, di-alkylamino, and cycloalkylamino condition, however, that any carbon substitution of lower alkyl bound to C3-6 alkenyl or C3-6 alkynyl bound to O from -OR^U, S from -SR^U, or N from -NHR^U is fluoro, lower alkyl, lower alkyl substituted with fluoro, or -R^l, and wherein the cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, -NH2 , -NO₂, -CN, lower alkyl, lower alkyl substituted with fluoro, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, monoalkylamino, di-alkylamino, and cycloalkylamino; where each R^x selected from the group consisting of lower alkyl, lower alkenyl and lower alkynyl, wherein the lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents from the group consisting of -R ', fluoro, -OH, NH₂, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, mono-alkylamino, di-alkylamino, and cycloalkylamino, and wherein the lower alkenyl or lower alkynyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R ', fluoro, -OH, -NH₂, lower alkyl, lower alkyl substituted with fluoro, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, mono-alkylamino, di-alkylamino and cycloalkylamino; wherein each R 'is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, -NII₂, -NO₂, -CN, lower alkyl, lower alkyl substituted with fluoro, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, alkylthio substituted with fluoro, mono-alkylamino, di-alkylamino, and cycloalkylamino.

In some embodiments, all, optionally substituted lower alkyl, optionally substituted C₂-6 alkyl, optionally substituted lower alkenyl, or optionally substituted lower alkynyl are optionally substituted with one or more, also, 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -NO₂, -CN, -OR^la, -SR^U, -NR^{, a}R^la, -OC (O) R^la, -OC (S) R^la, -C (O) R^la, -C (S) R^la, C (O) OR^la, -C (S) OR^la, -C (O) NR^YesR^la, -C (S) NR^laR^u, -S (O) 2NR^laR^la, -C (NH) NR^laR^Yes, NR^laC (O) R^la, -NR^laC (S) R^la, -NR^laS (O) 2R^la, -NR^YesC (O) NR^laR^la, -NR^laC (S) NR^laR^la, NR^laS (O) 2NR^laR^la, -S (O) R^Yes, -S (O) 2R^la, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein the cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1, 2 or 3 grapes or substituents selected from the group consisting of halogen, -NO₂, -CN, -OR^Yes, -SR^la,

52010 Β

NR^laR^la, -OC (O) R^la, -OC (S) R2^la, -C (O) R^la, -C (S) R^la, -C (O) OR '^a, -C (S) OR^la, -C (O) NR^laR^la, -C (S) NR^laR^la, -S (O) 2NR^laR^Yes, -C (NH) -NR^laR^la, -NR^laC (O) R^{, a}, -NR^laC (S) R^la, NR^laS (O) 2R^la, -NR^laC (O) NR^laBR^la, -NR^IBC (S) NR^laR^la, -NR^laS (O) 2NR^laR^la, -S (O) R^la, S (O) 2R^la, -R^lb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, monoalkylamino, dialkylamino, and -R^lb, and all optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted 5-7 membered heterocycloalkyl, optionally substituted aryl, optionally substituted arylene, optionally substituted heteroaryl, optionally substituted heteroarylene, or optionally substituted 5 or 7-membered heteroaryl substituted with one or more, also 1, 2, or 3 groups or substituents selected from the group consisting of halogen, -NO2, CN, -OR^la, -SR^la, -NR¹⁸R^l8, - OC (O) R^la, -OC (S) R^la, -C (O) R^la, -C (S) R^la, -C (O) OR^la, C (S) OR^la, -C (O) NR^laR^la, -C (S) NR^laR^la, -S (O) 2NR^laR^la, -C (NH) NR^laR^la, -NR^laC (O) R^la, NR^laC (S) R^la -NR^laS (O) 2R^la, -NR^laC (O) NR^laR^la, -NR^laC (S) NR¹⁸R^la, -NR^laS (O) 2NR^laR^la, S (O) R^Yes, -S (O) 2R^la, -R^lb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro , mono-alkylamino, dialkylamino, and -R^lb, where, R^la is selected from the group consisting of hydrogen, provided, however, that hydrogen is not attached to any of C (S), C (O), S (O), or S (O) 2 of -OC (O) R^la, -OC (S) R^la, C (O) R^la, -C (S) R^la, -NTR^laC (O) R^la, -NR^laC (S) R^la, -NR^laS (O) 2R^la, -S (O) R^{, a} or -S (O) 2R¹⁸, R^lb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -ΟΙ1, NII2, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, mono-alkylamino, di-alkylamino, and -R^lb, provided, however, that any substitution of carbon alkyl attached to O, S, or N from -OR^la, SR^la, -NR^laR^la, -C (O) OR^la -C (S) OR^la, -C (O) NR^laR^la, -C (S) NR^l8R^la, -S (O) 2NR^laR^la, C (NH) NR^laR^ia, -NR¹⁸C (0) R^la, -NR^laC (S) R^la, -NR^laS (O) 2R^la, -NR^laC (O) NR^laR^la, NR^{, a}C (S) NR¹⁸R^la or -NR^laS (O) 2NR^laR^la, is fluoro or -R^lb, and where -R^lb selected from the group consisting of cycloalkyl, heterocycloalkyl aryl and heteroaryl, wherein the cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of halogen, -CN, -OH, -NH2, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, alkylthio substituted with fluoro, mono-alkylamino, di-alkylamino and cycloalkylamino.

In some embodiments, all optionally substituted lower alkyl, optionally substituted C₂.alkyl, optionally substituted lower alkenyl, or optionally substituted lower alkynyl are optionally

52010 Β substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -CN, -OR^la, -SR^la, -NR^laR^la, -C (O) R^la, -C (S) R^la, -C (O) OR^la, -C (O) NR^laR^la, C (S) NR^laR^la, -S (O) 2NR^laR^la, -NR^laC (O) R^la, -NR '^aC (S) R^la, -NR^laS (O) 2R^{, a}, -S (O) R^{, a}, S (O) 2R^ld, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of halogen, -CN, -OR^la, -SR^la, -NR^laR^la, -C (O) R^la, -C (S) R^la, C (O) OR^la, -C (O) NR^laR^la, -C (S) NR^laR^la, -S (O) 2NR^laR^la, -NR^laC (O) R^la, -NR^laC (S) R^la, NR^laS (O) 2R^la, -S (O) R^la, -S (O) 2R^la, -R^lb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro , mono-alkylamino, di-alkylamino, and -R^lb, and all optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted 5-7 membered heterocycloalkyl, optionally substituted aryl, optionally substituted arylene, optionally substituted heteroaryl, optionally substituted heteroarylene, or optionally substituted 5 or 7-membered substituted optionally with one or more, also 1, 2, or 3 groups or substituents selected from the group consisting of halogen, -CN, -OR^la, -SR^Yes, -NR^laR^la, -C (O) R^la, -C (S) R^la, -C (O) OR^la, C (O) NR^laR^la, -C (S) NR^laR^la, -S (O) 2NR^{, a}R^la, -NR^laC (O) R^la, -NR^laC (S) R^la, -NR^laS (O) 2R^la, S (O) R^ld, -S (O) 2R^la, -R^lb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro , monoalkylamino, dialkylamino, and -R^lb, where R^la selected from the group consisting of hydrogen, provided that the hydrogen is not bound to any C (S), C (O), S (O), or S (O) 2 of -C (O) R^la, -C (S) R^la, -NR^laC (O) R^la, NR^laC (S) R^la, -NR^laS (O) 2R^la, -S (O) R^la or -S (O) 2R^la, -R^lb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, NH2, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, mono-alkylamino, di-alkylamino, and -R^lb, provided, however, that any substitution of the alkyl carbon attached to O, S, or N from -OR^la, -SR^la, -NR^laR^la, -C (O) OR^la, -C (O) NR^YesR^la, C (S) NR^laR^la, -S (O) 2NR^laR^la, -NR^laC (O) R^la, -NR^laC (S) R^la or -NR^laS (O)₂R^la, is fluoro or R^lb, and where -R^lb selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of halogen, -CN, -OH, -N, lower alkoxy, lower alkoxy substituted with fluoro, lower alkylthio, lower alkylthio substituted with fluoro, monoalkylamino, di-alkylamino and cycloalkylamino.

52010 “" Lower alkoxy "means the group -OR^Z, where R^z lower alkyl. "Substituted lower alkoxy" means a lower alkoxy in which R is^z lower alkyl substituted with one or more substituents as indicated herein, for example, in the description of the compounds of Formula III, including descriptions of substituted cycloalkyl, cycloheteroalkyl, aryl and heteroaryl, attached to any available atom to produce a stable compound. Preferably, the lower alkoxy substitution is with 1, 2, 3, 4, or 5 substituents, also 1, 2, or 3 substituents. For example, "lower alkoxy substituted with fluoro" means lower alkoxy in which lower alkyl is substituted with one or more fluorine atoms, where preferably lower alkoxy is substituted with 1, 2, 3, 4 or 5 fluorine atoms, also 1, 2, or 3 fluorine atoms. While it is understood that the substitutions on alkoxy are attached to any available atom to produce a stable compound, the substitution of alkoxy is such that O, S, or N (except where N is a heteroaryl ring atom), are not attached to the carbon of the alkyl attached to Oh from alkoxy. Further, where alkoxy is described as a substituent of the second group, the oxygen from the alkoxy is not attached to a carbon atom attached to 0, S, or N of the second group (except where N is a heteroaryl ring atom), or to the carbon of the alkene or alkyne of the second group.

"Lower alkylthio" means the group -SR³/ where R^aa lower alkyl. "Substituted lower alkylthio" means lower alkylthio in which R is³³ lower alkyl substituted with one or more substituents as defined herein, for example, in the description of compounds of Formula III, including the description of substituted cycloalkyl, cycloheteroalkyl, aryl and heteroaryl, attached to any available atom to produce a stable compound. Preferably, the lower alkylthio substitution is with 1, 2, 3, 4, or 5 substituents, also 1, 2, or 3 substituents. For example, "lower alkylthio substituted with fluoro" means lower alkylthio in which lower alkyl is substituted by one or more fluorine atoms, gdc is preferably lower alkylthio substituted by 1,2, 3, 4 or 5 fluorine atoms, also 1, 2, or 3 fluorine atom. While it is understood that substitutions on alkylthio are attached to any available atom to produce a stable compound, the substitution of alkylthio is such that O, S, or N (except where N is a heteroaryl ring atom) are not attached via alkyl carbon to alkylthio S. Further, where alkylthio is described as a substituent of the second group, the sulfur from the alkylthio is not a carbon atom attached to O, S, or N of the second group (except where N is a heteroaryl ring atom), or to a carbon of the alkene or alkyne of the second group .

"Amino" or "amine" means -NH2. "Mono-alkylamino" means the group -NHR^bb where R^bb lower alkyl. "Di-alkylamino" means gmpu -NR^bbR^LL, where R^bb and R^cc independently lower alkyl. "Cycloalkylamino" means the group -NR^ddR^ee, where R^dd and R^ee combine with nitrogen to form 5-7 membered heterocycloalkyl, wherein the heterocycloalkyl may contain an additional heteroatom within the ring, such as N, N or S, and may be further substituted with lower alkyl. Examples of 57-membered heterocycloalkyl include, but are not limited to, piperidine, piperazine, 4

52010 Β methylpiperazine, morpholine, and thiomorpholine. While sc is meant that when mono-alkylamino, dialkylamino, or cycloalkylamino are substituents on other groups attached to any available atom to produce a stable compound, nitrogen from mono-alkylamino, dialkylamino, or cycloalkylamino as substituents is not attached to the carbon atom which is attached to O, S, or N of another group.

A "nitrogen protecting group" is a chemical group covalently attached to a nitrogen atom that is used to protect nitrogen from reaction during the synthesis step. The nitrogen protecting group can be added to the compound and removed in the next step by methods known to those skilled in the art. Nitrogen protecting groups include, without limitation, carbamates, amides, N-sulfonyl derivatives, groups of formula -C (O) OR, wherein R is, for example, methyl, ethyl, t-butyl, benzyl, phenylethyl, SN2, SNSNg- , and the like, groups of formula -C (O) R ', wherein R' is, for example, methyl, phenyl, trifluoromethyl, and the like, groups of formula -SO2R ", wherein R is, for example, tolyl, phenyl, trifluoromethyl, 2,2,5,7,8-pentamethylchroman6-yl, 2,3,6-trimethyl-4-methoxyphenyl, and the like, and silanyl-containing groups, such as 2-trimethylsilylethoxymethyl, t-butyldimethylsilyl, triisopropylsilyl, and the like. Other suitable nitrogen protecting groups can be found in texts such as TW Greene &amp; PGM Wuts, Protective Groups in Organic Synthesi.s, John Wilei &amp; Sons, l 991.

As used herein, the term "composition" refers to a formulation suitable for administration to an intended animal of a subject for therapeutic purposes containing at least one pharmaceutically active compound and at least one pharmaceutically acceptable carrier or excipient.

The term "pharmaceutically acceptable" means that said material does not have properties that would cause a medical professional to avoid administering the material to a patient, taking into account the disease or condition being treated and the appropriate route of administration. For example, it is generally required that such material be truly sterile, e.g., for injection.

In the present context, the term "therapeutically effective" or "effective amount" means that the material or amount of material is effective in preventing, alleviating or ameliorating one or more symptoms of a disease or medical condition, and / or prolonging the survival of the subject being treated.

In the present context, the terms "synergistically effective" or "synergistic effect" mean that two or more compounds that are therapeutically effective, when used in combination, provide improved therapeutic effects greater than the additive effect that would be expected based on the effect. of each compound specifically used.

As used herein, the terms "ligand" and "modulator" are used equivalently to denote a compound that alters (i.e., increases or decreases) the activity of a target biomolecule,

52010 Β e.g., an enzyme such as a kinase. In general, the ligand or modulator will be a small molecule, where "small molecule" refers to a compound with a molecular weight of 1500 daltons or less, or preferably 1000 daltons or less, 800 daltons or less, or 600 daltons or less. Thus, an "enhanced ligand" is one that has improved pharmacological and / or pharmacokinetic properties relative to the reference compound, where "better" can be defined by one skilled in the art for a particular biological system or therapeutic application.

The term "binding" in relation to the interaction between a target and a potentially binding compound means that the potentially binding compound binds to the target to a statistically significant degree compared to binding to proteins in the general case (i.e., non-specific binding). Thus, the term "binding compound" refers to a compound that has statistically significant binding to the target molecule. Preferably, the binding compound interacts with a specific target molecule with a dissociation constant (KD) of 1 mM or less, 1 μΜ or less, 100 nM or less, 10 nM or less, or 1 nM or less.

In the context of compounds that bind to target structures, the terms "higher affinity" and "selectively" mean that the compound binds more tightly than the reference compound, or from the same compound in the reference state, i.e., with a lower dissociation constant. In some embodiments, the higher affinity is at least 2, 3, 4, 5, 8, 10, 50, 100, 200, 400, 500, 1000, or 10,000 times the affinity.

As used herein in connection with the compounds of the invention, the term "synthesize" and similar terms denote the chemical synthesis of one or more precursor materials. Further, "testing" means creating experimental conditions and collecting data related to a particular result of experimental conditions. For example, enzymes can be tested based on their ability to act on a detectable substrate. A compound or ligand can be tested based on its ability to bind a specific target molecule or molecules.

As used herein, the term "modulating" or "modulating" refers to the effects of altering biological activity, particularly biological activity associated with a biological activity associated with a particular biomolecule such as a protein kinase. For example, an agonist or antagonist of a particular biomolecule modulates the activity of that molecule, e.g., an enzyme, by increasing (e.g., an agonist, activator) or decreasing (e.g., an antagonist, inhibitor) the activity of a biomolecule, such as an enzyme. Such activity is typically indicated by the inhibitory concentration (IC50) or excitation concentration (EC50) of the compound for inhibitor or activator, respectively, relative to, for example, the enzyme.

52010 00 In the context of the use, testing or screening of compounds that are or may be modulators, the term "contact" means that the compound (s) are brought in close proximity to a particular molecule, complex, cell, tissue, organism or other specific material, so that potential binding interactions and / or chemical reactions may occur between the compound and the other indicated material.

As used herein in connection with an amino acid or nucleic acid sequence, the term "isolate" means that the sequence is isolated from at least a portion of the amino acid and / or nucleic acid sequence to which it would normally be associated.

In relation to amino acid or nucleic acid sequences, the term "purified" means that the molecule in question constitutes a larger portion of the biomolecules in the composition than the portion observed in the previous composition, e.g., in cell culture. The larger part can be 2 times, 5 times, 10 times or more than 10 times larger than the part that was in the previous composition.

I. General The present invention relates to compounds of Formula IIIm and all subgeneric formulas that are modulators of protein kinases, for example, without limitation, the compounds are modulators of at least one of the kinases selected from the group consisting of Abl, Aktl, Akt2, Akt3, ALK, Alk5, B-Raf, Brk, Btk, Cdk2, CDK4, CDK.5, CDK6, CHK1, c-Raf-1, Csk, EGFR, EphAl, EphA2, EphB2, EphB4, Erk2, Fak, FGFR1, FGFR2, FGFR3, FGFR4, Fltl, Flt3, Flt4, Fms, Frk, Fin, Gsk3a, Gsk3p, HCK, Her2 / Erbb2, Her4 / Erbb4, IGFIR, IKK beta, Iraq4, Itk, Jakl, Jak2, JaskZ, fnkl, Jnk2, JpkZ, K.dr, Kit, LCK, ΜΑΡ2Κ1, MAP2K2, MAP4K4, MAPKAPK2, Met, Mnkl, MLKl, p38, PDGFRA, PDGFRB, PDPKl, P Pim3, PKC alpha, PKC beta, PKC theta, Plkl, Pik2, Ret, ROCKl, ROCK2, Ron, Src, Stk6, Sik, TEC, Tie2, TrkA, Ies, and Zap70, and the use of such compounds in the treatment of diseases or conditions.

II. Target kinase molecules and indications for the invention Protein kinases play key roles in the transmission of biochemical signals in various biological pathways. More than 500 kinases have been described, and specific kinases are included in a wide range of diseases or conditions (i.e., indications), including, for example, without limitation, cancer, cardiovascular disease, inflammatory disease, neurological disease, and other diseases. As such, kinases represent important control points for therapeutic intervention with the use of small molecules. The description of the specific target protein kinases provided by the present invention follows:

52010 -B-Raf: The target kinase B-Raf (i.e., v-raf viral oncogenic homologue of mouse sarcoma V1) is a 84.4 kDa serine / threonine kinase encoded by chromosome 7q34 (symbol: BRAF). The mature protein comprises the RBD (i.e., Ras binding domain), S1 (i.e., conserved region 1 protein kinase C 1) and STK (i.e., serine / threonine kinase) domains.

The B-Raf target kinase is involved in the transmission of mitogenic signals from the cell membrane to the nucleus and may play a role in the postsynaptic responses of hippocampal neurons. As such, RAP family genes encode kinases that are regulated via Ras and mediate cellular responses to growth signals. Indeed, B-Raf kinase is a key component of the RAS-> Raf-> MEK-> ERK / MAP signal transduction pathway, which plays a fundamental role in regulating cell growth, division, and proliferation, and when constitutively activated causes tumorigenesis. Of the several isoforms of Raf kinase, B-type or B-Raf is the strongest activator of downstream MAP kinase signaling.

The BRAF gene is often mutated in various human tumors, especially in malignant melanoma and colon cancer. The most commonly registered mutation was the "meaningless" conversion of thymine (T) to adenine (A) at nucleotide 1796 (Τ1796Α; amino acid change in B-Raf protein is Val <600> in Glu <600>) observed in 80% of malignant melanoma tumors . Functional analysis reveals that this transversion is the only mutation detected that induces constitutive activation of B-Raf kinase activity, independent of RAS activation, through the conversion of B-Raf to the dominant transforming protein.

Niihori et al., Reported that in 43 individuals with cardiofacio-cutaneous (CFC) syndrome, heterozygous KRAS mutations were identified in three individuals and eight BRAF mutations in 16 individuals, indicating that dysregulation of RAS- RAF-ERK times a common molecule basis for three related diseases (Niihori et al., Nat Genet. 2006, 38 (3): 294-6).

B-Raf inhibitors may be useful for treating neurological diseases such as ischemic stroke, multiinfarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson's disease; neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, cancer (e.g., lung, breast, pancreas, kidney), lymphoma (e.g., histiocytic lymphoma), and thyroid cancer, e.g. small cell lung cancer), liver, breast, ovary and colon, neurofibromatosis, myelodysplastic syndrome, leukemia, tumor angiogenesis; pain of neuropathic or inflammatory origin, including acute pain, chronic pain, and migraine; cardiovascular diseases including cardiac arrest, cardiac hypertrophy, thrombosis (e.g. thrombotic microangiopathy syndrome), atherosclerosis, reperfusion injury; inflammation including, but not limited to, psoriasis, polycystic kidney disease (PKD), arthritis and autoimmune diseases and conditions, osteoarthritis, endometriosis, scarring, vascular restenosis,

52010 Β fibrotic diseases, rheumatoid arthritis, inflammatory bowel disease (IBD); immunodeficiency diseases, organ transplant rejection, graft-versus-host disease; kidney or prostate diseases including diabetic nephropathy, nephrosclerosis, glomerulonephritis, prostate hyperplasia; metabolic disorders, obesity; infection, including but not limited to Helicobacter pylori and Influenza virus, fever, sepsis; lung diseases including chronic obstructive pulmonary disease (COPD) and acute respiratory distrcs syndrome (ARDS); genetic developmental diseases such as Noonan syndrome, Costello syndrome, (facio-cutaneous skeletal syndrome), leopard syndrome, cardiofaciocutaneous syndrome (CFC), and nerve crest abnormality that causes cardiovascular, skeletal, intestinal, skin, hair and endocrine diseases .

C-Raf-1: The target kinase of c-Raf-1 (i.e., homolog 1 of the viral oncogene v-raf mouse sarcoma) is 73.0 kDa STK encoded by the Zr25 chromosome (symbol: RAFl). c-Raf-1 can be targeted to mitochondria as a target site of rgeco BCL2 (i.e., B-cell leukemia 2 oncogene) which is a regulator of apoptotic cell death. Active c-Raf-1 enhances BCL2-mediated resistance to apoptosis, and c-Raf-1 phosphorylates BAD (i.e., BCL2-binding protein). cRaf-1 has been implicated in cancers, including colorectal cancer, ovarian, lung, and kidney cell carcinoma. C-Raf-1 is also involved as an important mediator of tumor angiogenesis (Hood, JD et al., 2002, Science 296, 2404). C-Raf-1 inhibitors may also be useful in the treatment of acute myeloid leukemia syndrome and myelodysplastic syndrome (Crump, Curr Pharm Des 2002, 8 (25): 2243-8). Raf-1 activators may be useful for the treatment of neuroendocrine tumors, such as thyroid brain cancer, carcinoid, small cell lung cancer, and pheochromocytoma (Kunnimalaiiaan et al., Anticancer Drugs 2006, 17 (2): 139-42). C-Raf1 inhibitors may be useful in the treatment of colorectal cancer, ovarian cancer, lung cancer and renal cell carcinoma, acute myeloid leukemia, myelodysplastic syndromes, tumor angiogenesis and neuroendocrine tumors such as thyroid medullary cancer and pharyngocytoid cancer.

Sh. Binding Assays The methods of the present invention may include assays that can detect binding of a compound to a target molecule. Such binding is at a statistically significant level, preferably with a confidence level of at least 90%, more preferably at least 95, 97, 98, 99% or a higher level of confidence that the test signal represents binding to the target molecule, i. which distinguishes it from the forest. Preferably, controls are used to distinguish the target binding from

52010 Β nonspecific binding. A large number of different binding assays for different types of target structures are known and can be used for the present invention.

Binding compounds can also be characterized by their effect on the target molecule. The compounds of the present invention can be tested against a particular kinase to assess the inhibitory concentration (IC50) or excitation concentration (EC50) of a compound relative to that kinase. The IC50 (or EC50) is defined as the concentration of compound at which 50% of the target kinase activity measured is lost (or gained), relative to the activity when the compound is not present. Activity can be measured using methods known to those skilled in the art, e.g., by measuring any detectable product or signal produced by an enzymatic reaction, or other protein activity being measured. The compounds will have an IC50 or EC50 of less than 10 mM, also less than 1 mM, also less than 100 nM, also less than 10 nM or less than 1 nM.

By "signal noise" in relation to a binding assay is meant a signal recorded under standard conditions for a particular assay in the absence of a test compound, molecular environment or ligand that binds to the target molecule. Those skilled in the art will appreciate that acceptable procedures exist and are available in a wide range for determining signal noise.

By "standard deviation" is meant the square root of the variance. A variation is on how wide the distribution is. It is calculated as the mean square deviation of each number from its mean. For example, for numbers 1, 2, and 3, the mean is 2, and the variance is:

σ²» (1-_2)²+(2-2) ²+ (3-2)² = 0.667.

IV. Kinase Activity Assay Several different assays for kinase activity can be used to test active modulators and / or to determine the specificity of modulators for a particular kinase or group of kinases. In addition to the test mentioned in the Examples below, the person skilled in the art will know other tests that can be used and can modify the test for a particular application. For example, numerous papers on kinases describe tests that can be used.

52010 00 Additional alternative tests may use binding assays, for example, this type of test may be formatted either in the format of fluorescent resonant energy transfer (FRET), or using the AlphaScrecn format ("amplified luminescent proximity homogenous assay") by varying donor responses and acceptance. which are bound to streptavidin or a phosphorus-specific antibody.

V. Organic Synthesis Techniques The diversity of computer-based modulator design lies in the diversity of structures whose screening is performed using computer programs. Computer programs can search databases that contain a very large number of molecules and can modify modulators that are already complexed with enzymes with a very large number of chemical functional groups. The consequence of this chemical diversity is that a potential modulator of kinase function may be in a chemical form that is not foreseeable. There is a wide range of organic synthesis techniques that meet the requirements for constructing potential modulators. Many of these organic synthesis procedures are described in detail in standard literature sources used by those skilled in the art. One example of such a reference is March, 1994, Advanced Organic Chemistry: Reactions, Mechanisms and Structure, New Lorq, McGraw NS. Therefore, techniques useful for synthesizing a potential kinase function modulator identified by computer-based methods are readily available to those skilled in the art of organic synthesis techniques.

With respect to the synthetic examples described herein, solvents include polar and non-polar solvents known to those skilled in the art, including aprotic poles and proton poles. Polar solvents, without limitation, protic solvents such as methanol, ethanol, isopropyl alcohol, t-butanol, n-butanol, acetic acid, formic acid or water, or aprotic solvents such as tetrahydrofuran (TF), acetonitrile, dioxane, melen chloride, dimethylsulfoxide (DMSO), acetone, N, N-dirnetylformamide (DMF), N, N-dimethylacetamide (DMA), ethyl acetate, 1,2-dimethoxyethane, 1,2-dichloroethane, chloroform, 1,2-dichloroethane or pyridine. Polar solvents include a mixture of water with any of the foregoing, or a mixture of any two or more of the foregoing. Non-polar solvents include, but are not limited to, toluene, benzene, chlorobenzene, xylene, and hexane.

With respect to the synthetic examples described herein, reducing agents include, without limitation, a reducing agent such as a catalytic reducing agent using hydrogen and transition metal catalysts such as palladium, platinum, rhodium, and the like. (e.g. Pt / acetic acid / Hh); a mixture of trifluoroacetic acid and triethylsilane, borane complex

52010 Β tetrahydrofuran, diborane, borane-dimethylsulfide complex and a combination of sodium borohydride and boron trifluoride; metals such as reduced iron, zinc powder, magnesium, etc .; hydrogen metal complex such as alkali metal and borohydride complexes (for example, potassium borohydride, sodium borohydride, lithium borohydride, zinc borohydride, sodium triacetoxyborohydride, etc.), aluminum lithium hydride, etc .; metal hydrides such as sodium hydride, etc .; organic compounds with tin (triphenyltin hydride, etc.); and metal salts such as nickel compounds, zinc compounds, tin compounds (for example tin (II) chloride) and samarium iodide / trimethylacetic acid / hexamethylphosphine triamide.

With respect to the synthetic examples described herein, oxidizing agents include, without limitation, oxidizing agents such as Dess-Martin reagent, N (2,2,6,6-tetramethylpiperidine-N-oxide), DDQ (2,3-dichloro- 5,6-dicyano-1,4-benzoquinone), PDC (pyridinium dichromate), PCC (pyridinium chlorochromate), pyridine.SO3, chromium trioxide, pnitroperbenzoic acid, magnesium monoperoxyphythalate, sodium periodate, peroxide, potassium potassium alkali metal bromates, cumene hydroperoxide, tert-butyl peroxide, peracids such as formic acid, peracetic acid, pertrifluoroacetic acid, perbenzoic acid, m-chloroperbenzoic acid, ocarboxyperbenzoic acid and the like; sodium metaperiodate, bichromic acid; bichromates such as sodium bichromate, potassium bichromate; permanganic acid; permanganates such as potassium permanganate, sodium permanganate; and lead salts such as lead tetraacetate.

VI. Forms and Derivatives of Alternative Compounds The compounds provided herein are described in relation to generic formulas and specific compounds. Additionally, the compounds of the invention may exist in a number of different forms and derivatives. These include, for example, tautomers, stereoisomers, racemic mixtures, regioisomers, salts, prodrugs (e.g., carboxylic acid esters), solvated forms, various crystalline forms or polymorphs, and active metabolites.

(a) Tautomers, stereoisoiners, regioisomers and solvated forms It is understood that some compounds may exhibit tautomerism. In such cases, the formulas given herein explicitly represent only one of the possible tautome forms. It is therefore to be understood that the formulas given herein are intended to represent any

52010 Β the tautome form of the compounds shown and should not be limited to the specific tautome forms shown in the drawings of the formula.

Similarly, some of the compounds of the present invention may exist as stereoisomers, i. they have the same bonded atoms in covalently bonded atoms, but on the other hand differ in the simple orientation of the atoms. For example, the compounds may be optical stereoisomers, which contain one or more chiral centers, and therefore, may exist in two or more stereoisomic forms (e.g., enantiomers or stereoisomers). Thus, such compounds may be present as individual stereoisomers (i.e., substantially free of other stereoisomers), racemates, and / or mixtures of enantiomers and / or diastereoisomers. As another example, stereoisomers include geometric isomers, such as cis- or / rara-orientation of substituents on adjacent double-bonded carbon atoms. It is intended that all such individual stereoisomers, racemates and mixtures thereof be within the scope of the present invention. Unless otherwise indicated, all such stereoisomeric forms are included within the formula provided herein.

In some embodiments, the chiral compound of the present invention is in a form comprising at least 80% of an isomer (60% of the enantiomeric excess) ("ee") or a diastereomeric excess ("d.e. or at least 85% (70% ee or de), 90% (80% ee or de), 95% (90% ee or de), 97.5% (95% ce or de) or 99% (98% ee or de). As will be generally understood by those skilled in the art, an optically pure compound having a chiral center is one that consists essentially of one of two possible enantiomers (i.e., the enantiomer is pure), and an optically pure compound having more than one chiral center is that which is both diastereomemo pure and enantiomerically pure. In some embodiments, the compound is present in optically pure form.

For compounds in which the synthesis comprises adding one group to the double bond, in particular a carbon-carbon double bond, the addition may occur on any of the atoms bonded by the double bond. For such compounds, the present invention encompasses both such regioisomers.

In addition, the formulas are defined to cover solvated as well as unsolvated forms of identical structures. For example, said structures include both hydrated and non-hydrated forms. Other examples of solvates include structures in combination with a suitable solvent such as isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid or ethanolamine.

52010 B (b) Prodrugs and Metabolites In addition to the formulas and compounds described herein, prodrugs (generally pharmaceutically acceptable prodrugs), active metabolic derivatives (active metabolites) and pharmaceutically acceptable salts thereof are also described.

Prodrugs are compounds or pharmaceutically acceptable salts thereof which, when metabolized under physiological conditions or when converted by solvolysis, produce the desired active compound. Prodrugs include, without limitation, esters, amides, carbamates, carbonates, ureides, solvates, or hydrates of the active compound. Typically, the prodrug is inactive, or less active than the active compound, but may provide one or more advantageous properties related to handling, administration and / or metabolic properties. For example, some prodrugs are esters of the active compound; during metabolism, the ester group is excised to produce the active drug. Also, some prodrugs are enzymatically activated to produce the active compound, or a compound that, after an additional chemical reaction, produces the active compound.

In this context, a common example or prodrug is a carboxylic acid alkyl ester. In connection with the compounds of Formula IIm, additional examples include, without limitation, an amide or carbamate derivative at the 1-position of the nitrogen of the azaindole nucleus.

As described in The Practice of Medicinal Chemistry Ch. 31-32 (Ed. Wermuth, Academic Press, San Dicgo, CA, 2001), prodrugs can be conceptually divided into two non-exclusive categories, bioprecursor prodrugs and carrier prodrugs. In general, bioprecursor prodrugs are compounds that are inactive or have low activity compared to the corresponding active drug compounds, which contain one or more protecting groups and are converted to the active form by metabolism or solvolysis. The active drug form and all metabolic products released should have acceptably low toxicity. Typically, the formation of an active drug compound involves a metabolic process or reaction that is one of the following types:

Oxidative reactions: Oxidative reactions are illustrated without limitation by reactions such as oxidation of alcoholic, carbonyl and acidic functional groups, hydroxylation of aliphatic carbons, hydroxylation of alicyclic carbon atoms, oxidation of aromatic carbon atoms, oxidation of carbon-carbon double groups containing oxides of functional bonds, phosphorus, arsenic and sulfur, oxidative N-dealkylation, oxidative O- and S-dealkylation, oxidative deamination, as well as other oxidative reactions.

Reductive reactions: Reductive reactions are illustrated without limitation by reactions such as reduction of carbonyl functional groups, reduction of alcohol functional groups and

52010 Β carbon-carbon double bonds, reduction of nitrogen-containing functional groups and other reduction reactions.

Reactions without change in oxidation state: Reactions without change in oxidation state are illustrated without limitation by reactions such as hydrolysis of esters and ethers, hydrolytic cleavage of carbon-nitrogen single bonds, hydrolytic cleavage of non-aromatic heterocycles, hydration and hydration , new atomic bonds resulting from dehydration reactions, hydrolytic dehalogenation, removal of hydrogen halide molecules and expensive such reactions.

Prodrug carriers are drug compounds that contain a transport group, e.g., one that enhances uptake and / or localized application to the site (s) of action. Preferably for such a prodrug carrier, the bond between the drug group and the transport group is a covalent bond, the prodrug is inactive or less active than the drug compound, the prodrug and each released transport group are acceptably non-toxic. For prodrugs in which the transport group is such as to enhance intake, the typical release of the transport group should be rapid. In other cases, it is desirable to use a group that provides a slow release, e.g., certain polymers or other groups, such as cyclodextrins. (See, e.g., Cheng et al., U.S. Patent Publication No. 20040077595, Application No. 10 / 656,838), Such prodrug carriers are often suitable for orally administered drugs. Prodrug carriers can, for example, be used to improve one or more of the following properties: increased lipophilicity, increased duration of pharmacological effects, increased site specificity, reduced toxicity and adverse reactions, and / or improved drug formulation (e.g., stability, solubility) in water, suppression of undesirable organoleptic or physicochemical properties). For example, lipophilicity can be increased by esterification of hydroxyl groups with lipophilic carboxylic acids, or carboxylic acid groups with alcohols, e.g., aliphatic alcohols. Wermuth, supra.

Prodrugs may change from a prodrug form to an active form in a single step, or they may have one or more intermediate forms that may themselves have activity or may be inactive.

Metabolites, e.g., active metabolites, overlap with prodrugs as described above, e.g., bioprecursor prodrugs. Thus, such metabolites are pharmacologically active compounds or compounds that are further metabolized to pharmacologically active compounds that are derivatives arising from metabolic processes in the body of the subject. Of these, the active metabolites are such pharmaceutically active derivatives. For prodrugs, the prodrug compound is generally inactive or has lower activity than the metabolic product. For

52010 Β active metabolites, the parent compound may be an active compound or may be an inactive prodrug.

Prodrugs and active metabolites can be identified using routine techniques known in the art. See, e.g., Bertolini et al, 1997, J Med Chem 40: 2011-2016; Shan ct al., J Pharm Sci 86: 756-757; Bagshawe, 1995, Drug Dev Rcs 34: 220-230; Wermuth, supra.

(c) Pharmaceutically acceptable salts The compounds may be formulated as pharmaceutically acceptable salts or may be in the form of pharmaceutically acceptable salts. Considered pharmaceutically acceptable salt forms include, without limitation, mono, bis, tris, tetrakis, and so on. Pharmaceutically acceptable salts are non-toxic in the amounts and concentrations in which they are administered. The preparation of such salts may facilitate pharmacological use by altering the physical characteristics of the compound without preventing it from exhibiting its physiological effect. Beneficial changes in physical properties include lowering the melting point to facilitate transmucosal administration and increasing solubility to facilitate the application of higher lcc concentrations.

Pharmaceutically acceptable salts include acid addition salts such as those containing sulfate, chloride, hydrochloride, fumarate, maleate, phosphate, sulfamate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfanate, quinate. Pharmaceutically acceptable salts may be derived from acids such as hydrochloric acid, maleic acid, sulfuric acid, phosphomic acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cyclohexylsulfamic acid, fumic acid and quinic acid.

Pharmaceutically acceptable salts also include base addition salts such as those containing benzathine, chloroprocaine, choline, diethanolamine, ethanolamine, t-butylamine, ethylenediamine, meglumine, procaine, aluminum, calcium, lithium, magnesium, potassium, potassium , alkylamine and zinc, when acidic functional groups, such as carboxylic acid or phenol, are present. For example, see Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Co., Easton, PA, Vol. 2, p. 1457, 1995. Such salts can be prepared using appropriate bases.

52010 00 Pharmaceutically acceptable salts can be prepared using standard techniques. For example, the free base form of the compound may be dissolved in a suitable solvent, such as an aqueous or aqueous-alcoholic solution containing the appropriate acid, and then isolated by evaporation of the solution. In another example, the salt may be prepared by reacting the free base and the acid in an organic solvent.

Thus, for example, if a particular base compound is, the desired pharmaceutically acceptable salt can be prepared by any suitable method available in the art, for example, by treating the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid , sulfuric acid, nitric acid, phosphomic acid and the like, or with an organic acid, such as acetic acid, maleic acid, amber acid, mandelic acid, fumic acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, pyranosidyl acid, such as glucuronic acid or galacturonic acid, alpha-hydroxy acid, such as citric acid or tartaric acid, amino acid, such as aspartic acid or glutamic acid, an aromatic acid such as benzoic acid or cinnamic acid, a sulfonic acid such as p-toluenesulfonic acid or ethanesulfonic acid or the like.

Similarly, if a particular acid compound is desired, the desired pharmaceutically acceptable salt may be prepared by any suitable method, for example, treatment of the free acid with an inorganic or organic base, such as an amine (primes, seconds or thirds), alkali hydroxide metal or alkaline earth metal hydroxide, or the like. Illustrative examples of suitable salts include organic salts derived from amino acids, such as L-glycine, Llysine and L-arginine, ammonia, primary, secondary and tertiary amines, and cyclic amines, such as hydroxyethylpyrrolidine, piperidine, morpholine or piperazine. salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum and lithium. Additional examples of pharmaceutically acceptable salts of the compounds of Formula I-III include, without limitation, their mono-sodium and bis-potassium salts.

A pharmaceutically acceptable salt of the various compounds may be present as a complex. Examples of the complexes include the 8-chlorotheophylline complex (analogous, e.g., dimenhydrinate: diphenhydramine to the 8-chlorotheophylline (1: 1) complex; Dramamine) and various cyclodextrin inclusion complexes.

Unless otherwise indicated, the specification of a compound herein includes pharmaceutically acceptable salts of such a compound.

52010 D (d) Polymorphic Forms In the case of solids, those skilled in the art will appreciate that the compounds and salts may exist in different crystalline or polymorphic forms, all of which are defined to be within the scope of the present invention; and specified formulas.

VII. Application Methods and compounds will typically be used in the treatment of human subjects. However, they can also be used to treat similar or identical indications in other animal subjects. In this context, the terms "subject", "animal subject" and the like refer to human and non-human vertebrates, e.g. mammals, such as non-human primates, sporting and commercial animals, e.g., horses, cattle, pigs, sheep, rodents, and pets, e.g., dogs and cats.

Suitable dosage forms depend, in part, on the use or route of administration, for example, oral, transdermal, transmucosal, by inhalation or injection (parenteral). Such dosage forms should allow the compound to reach the target cells. Other factors are well known in the art, and include considerations such as toxicity and dosage forms that retain the compound or composition in exhibiting its effects. Techniques and formulations can generally be found in The Sciencc and Practice of Rjagtas, 21st edition, Lippincott, Williams and Wilkins, Philadelphia, PA, 2005 (incorporated herein by reference).

The compounds according to the present invention, i. Formulas I, may be formulated as pharmaceutically acceptable salts.

Carriers or excipients can be used to make the compositions. Carriers or excipients can be selected easily to facilitate the administration of the compound. Examples of carriers include calcium carbonate, calcium phosphate, various sugars such as lactose, glucose or sucrose or starch types, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols and physiologically compatible solvents. Examples of physiologically compatible solvents include sterile water solutions for injection (WFI), saline and dextrose.

The compounds may be administered by a variety of routes including intravenously, intraperitoneally, subcutaneously, intramuscularly, orally, transmucosally, rectally, transdermally, or by inhalation. Oral administration is preferred. For oral administration, for example, the compounds may be formulated in conventional oral dosage forms such as capsules, tablets, and liquid preparations such as syrups, elixirs, and concentrated drops.

52010 For inhalants, the compounds of the invention may be formulated as a dry powder or a suitable solution, suspension or aerosol. Powders and solutions may be formulated with suitable additives known in the art. For example, powders may include a suitable powder base such as ictose or starch, and solutions may contain propylene glycol, sterile water, ethanol, sodium chloride, and other additives such as acids, banes, and buffer salts. Such solutions or suspensions may be administered by inhalation via a spray, pump, atomizer or nebulizer, and the like. The compounds of the invention may also be used in combination with other inhalation therapies, for example corticosteroids such as fluticasone proprionate, beclomethasone dipropionate, triamcinolone acetonide, budzzonide, and mometasone furoate; beta agonists such as albuterol, salmeterol and formoterol; anticholinergic agents such as ipratroprium bromide or tiotropium; vasodilators such as treprosteline and iloprost; enzymes such as DNase; therapeutic proteins; immunoglobulin antibodies; an oligonucleotide, such as single-stranded or double-stranded DNA or RNA, siRNA; antibiotics such as tobramycin; muscarinic receptor antagonists; lcucotriene antagonists; cytokine antagonists; protease inhibitors; cromolyn sodium; sodium nedocryl; and sodium cromoglycate.

Pharmaceutical compositions for oral use can be prepared, for example, by combining the active compounds with solid excipients, optionally grinding the resulting mixture, and treating the mixture of granules, after adding suitable excipients, if desired, to obtain tablets or cores. irritation. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations, for example, corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methyl cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose (CMC), and / or polyvinylpyrrolidone (PVP:. If desired, disintegrants, such as cross-linked polyvinylpyrrolidone, agar or alginic acid, or a salt thereof such as sodium alginate may be added.

The dragee cores are provided with suitable envelopes. For this purpose, concentrated sugar solutions may be used, which may optionally contain, for example, gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol (PEG), and / or titanium dioxide, varnish solutions, and suitable organic solvents or mixtures. solvent. Dyes or pigments may be added to tablets or dragee cores to identify or characterize different combinations of active compound doses.

Pharmaceutical compositions that can be used orally include capsules in a blister pack made of gelatin ("gel capsules"), as well as soft, closed capsules.

52010 Β Made of gelatin, and plasticizers, such as glycerol or sorbitol. Capsules in blister packs may contain the active ingredients in admixture with a filler such as lactose, binders such as starches and / or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin or liquid polyethylene glycols (PEGs). In addition, stabilizers can be added.

Alternatively, injection (parenteral administration) may be used, e.g., intramuscularly, intravenously, intraperitoneally, and / or subcutaneously. For injection, the compounds of the invention are formulated in sterile liquid solutions, preferably in physiologically compatible buffers or solutions, such as saline, Hank's solution or Ringer's solution. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to administration. Lyophilized forms can also be produced.

The administration may also be transmucosal, topical or transdermal. For transmucosal, topical or transdermal administration, penetrants appropriate to the barrier to be passed are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, bile acid salts and fusidic acid derivatives. In addition, detergents can be used to facilitate penetration. Transmucosal administration, for example, may be via nasal sprays or suppositories (rectal or vaginal). The topical compositions of the present invention are preferably formulated as oils, creams, lotions, ointments and the like by selecting suitable carriers known in the art. Suitable carriers include vegetable or mineral oils, white petrolatum (white soft paraffin), garnet chain fats or oils, animal fats and high molecular weight alcohol (greater than C12). Preferred carriers are those in which the active ingredient is soluble. Emulsifiers, stabilizers, wetting agents and antioxidants may also be included as well as coloring or odoring agents, if desired. Creams for topical application are preferably formulated from a mixture of mineral oil, self-emulsifying beeswax and water, the active ingredient being dissolved in a small amount of solvent (e.g., oil) in the mixture. In addition, administration by transdermal agents may comprise a transdermal patch or dressing such as a dressing impregnated with the active ingredient and optionally one or more carriers or diluents known in the art. For administration in the form of a transdermal administration system, the administration of the dose will, of course, be continuous rather than interrupted within the dosage regimen.

The amounts of the various compounds to be administered can be determined by standard methods taking into account factors such as the IC50 of the compound, the biological half-life of the compound, age, size and body weight of the subject, and the subject-related disorder. The significance of these and

52010Β other factors are well known to those skilled in the art. Generally, the dose will be between about 0.01 and 50 mg / kg, preferably 0.1 and 20 mg / kg of the subject being treated. Multiple doses can be used.

The compounds of the invention may also be used in combination with other therapies for the treatment of the same disease. Such a combination administration comprises administering the compound and one or more other drugs at different times, or co-administering the compound and one or more other therapies. In some embodiments, the dose may be modified together with one or more compounds of the invention or other drugs used in combination, e.g., reducing the dosage relative to the compound or therapy when used alone, using methods well known to those skilled in the art.

It is understood that use in combination includes use with other therapies, drugs, medical procedures, etc., where the second therapy or procedure may be administered at different times (e.g. within a short period of time, such as within a few hours ( e.g., 1, 2, 3, 4-24 hours), or within a longer period of time (e.g., 1-2 days, 2-4 days, 4-7 days, 1-4 weeks)) of the compounds of the present invention, or simultaneously with the compound of the invention. Use in combination also comprises use with a therapy or medical method administered once or infrequently, such as surgery, together with a compound of the invention administered within a short period of time or a longer period of time before or after another therapy or procedure. In some embodiments, the present invention provides the administration of a compound of the invention and one or more other drugs administered by another route or by the same route of administration. Use in combination for any route of administration comprises administering a compound of the invention and one or more other drugs administered by the same route administered together in any formulation, including formulations where the two compounds are chemically bonded so as to maintain their therapeutic activity when administered. In one aspect, the second drug may be co-administered with one or more compounds of the invention. Use in combination via co-administration involves the administration of co-formulations or formulations of chemically bound compounds, or the administration of two or more compounds in a separate formulation within a short time interval (eg within 1 hour, 2 hours, 3 hours, up to 24 hours) , applied in the same or different ways. Co-administration of special formulations includes co-administration via a single device, for example the same inhalation device, the same syringe, etc., or administration from special devices within a short period of time. Co-formulations of the compounds of the invention and one or more additional drugs administered by the same route comprise preparing the materials together so that they can be administered by a single device, including special compounds combined in one formulation, or compounds which are

52010 Β Modified so that they are chemically bonded, but still retain their biological activity. Such compounds may have a bond that is substantially retained in vivo, or the bond may be degraded in vivo, separating the two active components.

EXAMPLES Examples related to the present invention are described below. In most cases, alternative techniques can be used. The examples are intended to be illustrative and not restrictive or restrictive of the scope of the invention. In some examples, the mass spectrometry result indicated for a compound may have more than one value due to the isotopic distribution of atoms in the molecule, such as a compound having a bromo or chloro substituent.

Example 1: Synthesis of [3- (5-bromo-1H-pyrrolo] 2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] propane-1-sulfonic acid amide P-0773 and related compounds Compound P-0773 was synthesized in five cocoa from 2,4-difluoro-phenylamine 42 as shown in Scheme 13.

Scheme 13

<img file="RS52010B_D0003.tif" />

Step 2

<img file="RS52010B_D0004.tif" />

<img file="RS52010B_D0005.tif" />

Step 1 - Preparation of 3-amino-2,6-difluoro-benzoic acid benzyl ester (43):

In 2,4-difluoro-phenylamine (42, 5.11 mL, 50.7 mmol) in tetrahydrofuran (250 mL), which was cooled by a dry ice / acetone bath under a nitrogen atmosphere, was slightly

52010 N N-Butyl lithium (1.60 M in hexane, 34.0 mL, 54.4 mmol) was added. After 30 minutes, 1,2-Bis- (chloro-dimethyl-silyanyl) -ethane (11.5 g, 53.4 mmol) dissolved in tetrahydrofuran (40.0 mL) was added slowly to the reaction. After 1 h, n-butyl lithium (1.60 M in hexane, 31.9 mL, 51.0 mmol) was added slowly to the reaction. The reaction was stirred at -78 ° C for 30 minutes and then allowed to warm to room temperature over 40 minutes. The reaction was cooled to -78 ° C, followed by the slow addition of n-butyl lithium (1.60 M in hexane, 35.1 mL, 56.2 mmol). After 70 minutes, benzyl chloroformate (7.97 mL, 55.8 mmol) was added to the reaction. The reaction mixture was stirred at -78 ° C overnight, followed by the addition of 2 N HCl (120 mL). The reaction was allowed to warm to room temperature over 2 hours. The organic layer is separated. The aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate / hexane 20%) to give a colorless oil (43.10.6 g, 79.7%). MS (ESI) [M + H &amp; lt; + &amp; gt;]⁺ = 264.1.

Step 2 - Preparation of 2,6-difluoro-3- (propane-1-sulfonylamino) -benzoic acid benzyl ester (44):

To 3-amino-2,6-difluoro-benzoic acid benzyl ester (43.6.00 g, 22.8 mmol) in methylene chloride (150 mL) was added pyridine (2.76 mL, 34.2 mmol) and propane-1-sulfonyl. chloride (3.80 mL, 33.8 mmol). The reaction was stirred at room temperature overnight. The reaction was then poured into water, and extracted with ethyl acetate. The organic layer was washed with physiological

In solution, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography to give a colorless oil (44.7.0 g, 83.1%). MS (ESI) [M + G]⁺ = 370.1.

Step 3 - Preparation of 2,6-difluoro-3- (propane-1-sulfonylamino) -benzoic acid (45). ' To 2,6-difluoro-3- (propane-1-sulfonylamino) -benzoic acid benzyl ester (44, 2.0 g, mmol) in methanol (30 mL) was added 20% palladium hydroxide on carbon (100 mg). . The reaction was stirred under hydrogen at l atm for 15 minutes. The reaction was filtered and concentrated to give the white solid 45 which was used in the next step.

52010 Β

Step 4 - Preparation of 2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl chloride (46):

To 2,6-difluoro-3- (propane-1-sulfonylamino) -benzoic acid (45, 1.50 g, 5.4 mmol) was added toluene (7.0 mL) and thionyl chloride (15.0 mL, 0.21 mmol). The reaction was heated to reflux for 3 hours. The reaction was concentrated to give the crude compound which was used in the next step.

Step 5 - Preparation of propane-1-sulfonic acid (3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl) -amide (P-0773):

To aluminum trichloride (8.89 g, 66.7 mmol) was added methylene chloride (150 mL) under a nitrogen atmosphere below 5 ° C. To this, 5-bromo-7-azaindole (67, 1.64 g, 8.34 mmol) in methylene chloride (20 mL) was added. The reaction was stirred for 60.0 minutes and 2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl chloride (46, 3.50 g, 11.8 mmol) in methylene chloride (20 mL) was added. The reaction was stirred for 6 hours and warmed to room temperature overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (methylene chloride / methanol 5%) to give a white solid (P-0773, 1.2 g, 31.4%). MS (ESI) [M + H⁺]⁺ = 460.0,462.0.

N- [3- (5-Bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] benzenesulfonamide P-0798 and N- [3- (5) -bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenyl] -3-fluoro-benzenesulfonamide

<img file="RS52010B_D0006.tif" />

were prepared by following the protocol of Scheme 13, substituting propane-1-sulfonyl chloride with benzenesulfonyl chloride and 3-fluoro-benzenesulfonyl chloride, respectively, in Step 2. P-0798 MS (ESI) [Μ - 1Γ]^- = 489.9,491.9.

Propane-1-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -4-chloro-2-fluoro-phenyl] -amide P-0805

52010 Β

<img file="RS52010B_D0007.tif" />

was prepared by following the protocol of Scheme 13, substituting 2,4-difluoro-phenylamine with 4-chloro-2-fluoro-phenylamine in Step 1. MS (ESI) [M - H⁺]⁺ = 471.9, 473.9.

Propane-1-sulfonic acid [2,424-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide P-0007

<img file="RS52010B_D0008.tif" />

azaindole in Step 5. MS (ESI) [Μ + Η ψ ~ 380.1.

Propane-1- [2,4-Difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -anide

<img file="RS52010B_D0009.tif" />

was prepared by following the protocol of Scheme 13, substituting 5-bromo-7-azaindole with 5methoxy-7-azaindole 104 (prepared as described in Example 16) in Step 5. MS (ESI) [MH]⁺]' = 410.1.

Example 2: Synthesis of propane-1-sulfonic acid P-0955 and related compounds [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluorophenyl] -amide

52010 Compound II-0955 was synthesized in six steps from 4-chloro-2-fluoro-phenylamine 47 as shown in Scheme 14.

Scheme 14

<img file="RS52010B_D0010.tif" />

<img file="RS52010B_D0011.tif" />

Kogak4

<img file="RS52010B_D0012.tif" />

<img file="RS52010B_D0013.tif" />

<img file="RS52010B_D0014.tif" />

Step 1 - Preparation of 3-amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48):

To 4-chloro-2-fluoro-phenylamine (47, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), which was cooled by a dry ice / acetone bath under a nitrogen atmosphere, n-butyl lithium was added slowly. (2,500 M in hexane, 24.4 mL). After 20 minutes, 1,2-Bis- (chloro-dimethyl-silanyl) -ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was added slowly to the reaction. After 1 h, n-butyl lithium (2.50 M in hexane, 25.0 mL) was added slowly to the reaction. The reaction was stirred at -78 ° C for 20 minutes and allowed to warm to room temperature over 60 minutes. The reaction was cooled to -78 ° C, followed by the slow addition of n-butyl lithium (2.50 M in hexane, 26.0 mL). After 80 minutes, benzyl chloroformate (10.0 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 ° C overnight, followed by the addition of water (80 mL) and concentrated hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature over 2 hours. The organic layer was separated and the aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate / hexane 20%) to give a colorless oil (48.12.5 g, 78.3%).

52010Β

Step 2 - Preparation of 6-chloro-2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid henzyl ester (49):

To 3-amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48, 1.20 g, 4.3 mmol) in methylene chloride (28 mL) was added pyridine (0.52 mL, 6.4 mmol) and propane-1. -sulfonyl chloride (0.685 g, 4.8 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography to give a colorless oil (49.960 mg, 58.0%). MS (ESI) [MH⁺]' = 384.1.

KogakZ - Preparation of 6-chloro-2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (115):

To 6-chloro-2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid benzyl ester (49.6.00 g, 15.6 mmol) in tetrahydrofused (100 mL) was added a 1.0 M aqueous solution of potassium hydroxide ( 100 mL). The reaction was heated to reflux overnight. The reaction was poured into water, acidified to pH 2 with 1 N hydrochloric acid and extracted with ethyl acetate. The organic portion was dried over anhydrous sodium sulfate, filtered and concentrated to give a white solid 115 (3.95 g, 85.8%).

Step 4-Preparation of 2- (fluoro-3-propane-1-sulfonylamino) -benzoic acid (50):

To 6-chloro-2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (115, 0.69 g, 2.3 mmol) in methanol (10 mL) was added 20% palladium hydroxide on carbon (200 mg ). The reaction was stirred under hydrogen at 50 psi for 2 hours. The reaction was filtered and concentrated to give a white solid 50 which was used in the next step.

MS (ESI) [MH⁺]'=260.1.

Step 5 - Preparation of 2-fluoro-3- (propane-1-sulfonylamino) -benzoyl chloride (51):

Thionyl chloride (10.0 mL) was added to 2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (50, 1.17 g, 4.5 mmol). The reaction was heated to reflux for 3 hours. The reaction was concentrated to give crude compound 51 which was used in the next step.

52010 Β

Step 6 - Preparation of propane-1-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carb (mil) -2-fluoro-phenyl] -amide (P-0955):

Aluminum trichloride (2.52 g, 18.9 mmol) and methylene chloride (60.0 mL) were combined under a nitrogen atmosphere. To the reaction mixture was added 5-bromo-7-azaindole (67.630.0 mg, 3.2 mmol) in methylene dichloride (20.0 mL). The reaction was stirred at room temperature for 70 minutes, then 2-fluoro-3- (propane-1-sulfonylamino) -benzoyl chloride (51, 0.749 g, 2.68 mmol) in methylene chloride (20 mL) was added. The reaction was stirred at room temperature for 2 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give compound P-0955 (65 mg, 5.5%). MS (ESI) [M + H &amp; lt; + &amp; gt; f = 440.2,442.2.

Using the protocol of Scheme 14, substituting 5-bromo-azaindole with one of 5-chloro-7-azaindole (80, prepared as described in Example 9), 5-fluoro-7-azaindole (81, prepared as described in Example 9) or 7-azaindole in Step 6, propane-1-sulfone [3- (5-chloro-1-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluoro-phenyl] -amide was prepared acid P1013 (MS (ESI)) [M-H⁺] '= 394.1), Propane-1-sulfonic acid P-1028 [2-fluoro-3- (5-fluoro-1-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide ESI) [M - H⁺] '= 378.1) and Propane-1-sulfonic acid [2-fluoro-3 (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide P-1056 (MS (ESI)) [M + H⁺]⁺ = 362.2), respectively;

Example 3: Propane-1-sulfonic acid P-0088: 2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [23-b] pyridine-3-carbonyl) -phenyl] -amide Related compounds Compound P-0088 was synthesized in one step from propane- [3- (5-bromo-1H-pyrrolo [2,3b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide. of 1-sulfonic acid P-0773 by Suzuki coupling (Miuaiga and Suzuki, Chem. Rev. 1995,95: 2457) as shown in Scheme 15.

Sema 15

<img file="RS52010B_D0015.tif" />

<img file="RS52010B_D0016.tif" />

52010 Β

Step 1-Preparation of propane-1-sulfonic acid [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide -0088):

Propane-1-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide [P-0773], prepared as as described in Example 1, 65.0 mg, 0.14 mmol) in acetonitrile (4.0 mL) was added pyridine-3-organobomic acid (609, 25.0 mg, 0.20 mmol), tetrakis (triphenylphosphine) palladium (O) (11 mg, 1.0 % mmol) and aqueous potassium carbonate solution (1.0 M, 2.0 mL). The reaction was heated to 160 ° C for 10 minutes in a CEM Discover microwave instrument. The reaction was poured into water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (methylene chloride / methanoi 5%) to give a white solid (P-0088, 30 mg, 46.9%). MS (ESI) [M + N]⁺G = 457.2.

Additional compounds were prepared by following the protocol of Scheme 15, optionally substituting [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide propane-sulfonic acid P-0773 with the corresponding 5-bromo azaindole and / or pyridine-3-organobomic acid 609 with the corresponding organobomic acid or organobomic acid ester. Used 5-bromo azaindole synthesis as described in one of Examples 1, 2 or 5. The following compounds were prepared by following this procedure:

N- [2,4-Difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-0685), [4-chloro Propane-1-sulfonic acid (2-fluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-0753), [2 Propane-1-sulfonic acid 4-difluoro-3- (5-phenyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-0636), Propane-1-sulfonic acid (4-chloro-2-fluoro-3- (5-phenyl-1H-pyrrolo [2-b] pyridine-3-carbonyl) -phenyl] -amide (P-0776) {3- [5- Propane-1-sulfonic acid (4-chloro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluoro-phenyl} -amide (P-0956), {3- Propane-1-sulfonic acid [5- (4-dimethylamino phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluoro-phenyl} -amide (P-0989), {2 Propane-1-sulfonic acid, 4-difluoro-3- [5- (4-methoxy-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide (P-0877) ,,

52010 Propane-1-sulfonic acid Β {2,4-difluoro-3- [5- (4-trifluoromethyl-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide 0912), Propane-1-sulfonic acid {2,4-difluoro-3- [5- (3-methoxyphenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide P-0874), {3- [5- (3-dimethylamino-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluoro-phenyl} propane-1-sulfone} amide (P-0876), Propane-1-sulfonic acid [2-fluoro-3- (5-phenyl-111-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide ), Propane-1-sulfonic acid {3- [5- (4-chloro-phenyl) -1H-pyrrolo [2,3, b] pyridine-3-carbonyl] -2-fluorophenyl} -amide (P-1009), 5-phenyl -1H-pyrrolo [2,3-b] pyridine, [2-fluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide Propane-1-sulfonic acid (P-1251), {2,4-difluoro-3- [5 (3-fluoro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide propane-1-sulfonic acid (P-1259), Propane-1-sulfonic acid {2,4-difluoro-3- [5- (4-fluoro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide ), {3- [5- (3-chloro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl} propane-1-sulfonic acid amide (P) -1261), Propane-sulfonic acid [2,4-difluoro-3- (5-pyridin-4-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide -1262),

3- {3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl} benzoic acid (P-1266), { Propane-1-sulfonic acid [2,4-difluoro-3- [5- (3-morpholin-4-yl-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide -1873), {2,4-difluoro-3- [5- (3-morpholin-4-ylmethyl-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl} -amide propane- 1-Sulfonic acid (P-1878), {2,4-difluoro-3- [5- (6-methoxy-pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] Propane-1-sulfonic acid amphenyl} amide (P-1879), Propane-1- {2,4-difluoro-3- [5- (6-morpholin-4-yl-pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl} -amide sulfonic acid (P-1881), (2,4-difluoro-3- {5- [6- (4-methyl-piperazin-1-yl) -pyridin-3-yl] -1H-pyrrolo [2,3- b] Propane-1-sulfonic acid pyridine-3-carbonyl} -phenyl) -amide (P-1882), {3- [5- (4-cyano-3,5-dimethyl-phenyl) -1H-pyrrolo [2,3 Propane-1-sulfonic acid-b-pyridine-3-carbonyl] -2,4-difluorophenyl} -amide (P-1980),

52010 Β

N- {2,44) fluoro-3- [5- (1-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl} -4-trifluoromethylbenzenesulfonamide (P -1996),

N- (2,4-Difluoro-3- [5- (1-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl} -3-fluoro-benzenesulfonamide (P-1997), {2,4-difluoro-3- [5- (1-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl} propane-1-sulfonic acid amide (P-1864),

4- {3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl} benzamide (P-1546),

4- {3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl} N, N-dimethyl-benzamide (P -1547), (2,4-Difluoro-3- {5- [4- (morpholine-4-carbonyl) -phenyl] -1H-pyrrolo [2,3-b] pyridine-3-carbonyl} phenyl) -amide propane-3-sulfonic acid (P-1548),

3- {3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl} benzamide (P-1549), {2 Propane-3-sulfonic acid, 4-difluoro-3- [5- (4-methyl-1H-imidazol-2-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl} -amide (P-2006), i

N- {2,4-Difluoro-3- [5- (6-methoxy-pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl} -3-fluoro-benzenesul fonamide (P-2012).

The following table shows 5-bromo azaindole (column 2) and organobomic acid (column

3) used to prepare the compound (column 4). Column 1 shows the number of compounds and column 5 the recorded mass.

<td></td><td>5-Br azaindole</td><td>Organobomic acid</td><td>Uniting</td><td>MS (ESI) [M + H⁺] noted</td>

<td>P0685</td><td></td><td>B (OH)₂Q</td><td>Fv^N i °</td><td> 491.1</td>

<td>P- 0753</td><td></td><td>B (OH) 2 Q</td><td>ιίΧ ° vQ? I G 7 ^F Η Ο ^R n</td><td> 473.1</td>

52010Β

<td></td><td>5-Br azaindole</td><td>Organoboric acid</td><td>Uniting</td><td>MS (ESI) [Μ + (⁺] noted</td>

<td>Ρ0636</td><td></td><td>ΟΗ (ΟΗ) 2 ό</td><td>N fj</td><td> 456.1</td>

<td>Ρ0776</td><td></td><td>B (OHh ό</td><td></td><td> 472.1</td>

<td>Ρ- 0956</td><td>L G? ^F Η ο S / 'N^Ν Η</td><td>V (ON) g Cl</td><td>νθ $ ΓΙΛ ^F n ο Tea</td><td> 490.1</td>

<td>Ρ- 0889</td><td>ΤΠ ^F η ο ^Ν Η</td><td>V (ON) g f</td><td>ι Ύ &lt; Γ T? ^F η ο</td><td> 499.2</td>

<td>Ρ0877</td><td>γ_Rr JG&gt; - &lt;_Krs = o Ύπ ^Γ η ο</td><td>ШОIJз</td><td>Ν ΐΓ ν ^F η ο SYn^Ν Η</td><td> 486.3</td>

<td>Ρ0912</td><td>νΎ ΤΠ ^F η ο</td><td>V (ON)₂f CF₃</td><td>^YesΥ X io. ΘχζΓίθ °</td><td> 524.1</td>

<td>Ρ- 0874</td><td>^BrYTVΑ °</td><td>B (OH) z 1</td><td>η II J _ 7 r \ i'S == O Ϋγρ fh ί ΥΥν^Ν Η</td><td>484.3 [ΜΗ + 1-</td>

<td>Ρ0876</td><td>Γ Π ^F n ο ν-κ</td><td>V (ON)₂Φ</td><td>\ / O \ ^ vTc νΤ ° V in 3Q ^{F Η} °</td><td> 499.3</td>

52010Β

<td></td><td>5-Br azaindole</td><td>Organobomic acid</td><td>Uniting</td><td>MS (ESI) [M + H⁺] noted</td>

<td>Ρ0897</td><td></td><td>B (OH)₂ό</td><td>Ν '”' ° G Tv ^F Ο Ο 4Zn^N n</td><td> 438.3</td>

<td>Ρ- 1009</td><td></td><td>BIOHfe φ Cl</td><td></td><td> 472.2</td>

<td>Ρ- 0857</td><td>yQ Υ θ'γτγΙΤ^Ν Η</td><td>V (ON)₂ό</td><td>RX UL T rWO \ lTv ^F n o SAn</td><td>455.1 [Mn + 1-</td>

<td></td><td>^βΓΌ0</td><td>V (ON) 2 ό</td><td></td><td></td>

<td>Ρ1251</td><td></td><td>V (ON) 2 ά</td><td>liAJTVV » G] G&gt; ^F n ο</td><td> 439.3</td>

<td>Ρ- 1259</td><td>f6^F I &amp;^N fi</td><td>V (ON)₂α.</td><td>ЧЛи</td><td> 474.2</td>

<td>Ρ1260</td><td>Pg JZ / uS — O TD =% ΓΝ^N H</td><td>V (ON) 2 f F</td><td>1L T r- \_rs = o ΥΥ i &amp; ČLn</td><td> 474.2</td>

<td>Ρ- 1261</td><td>ID ^F n ο ^N Η</td><td>V (ON)₂</td><td>jOl “^ TTL f Η &amp; α</td><td> 490.2</td>

52010 Β

<td></td><td>5-Br azaindole</td><td>Organobomic acid</td><td>Uniting</td><td>MS (ESI) [M + H]⁺] noted</td>

<td>Ρ- 1262</td><td></td><td>Β (Β)₂ό N</td><td>N4 WrV fit ° N [j</td><td> 457.2</td>

<td>Ρ- 1266</td><td></td><td>13 (01¾ ΓΟΒη ό</td><td>F _ΗΓ^N i</td><td> 500.1</td>

<td>Ρ- 1873</td><td>Τ Ο ^F Η Ο N^Ν Η</td><td>Ά ' Ο._Β.Ο Ύ Go</td><td>Q&gt;</td><td> 541.2</td>

<td>Ρ- 1878</td><td>f'n'u⁰Ν Γ ν ^F n ο Vn</td><td>ο^νΝ</td><td>S? k,^N i</td><td> 555.3</td>

<td>Ρ- 1879</td><td>^Βγχ ^ ΜιΤ^ο</td><td>č £ o Α 4 ^ Ν χθ</td><td> 1 ^Fy ^ / оJЗ С XI Jn-vk Ap FS b</td><td> 487.3</td>

<td>Ρ- 1881</td><td>yQ 1_η</td><td>α &gt; = \ Μ Β-0</td><td>° Y ^F\ = ^ / L 1 _ 7y-4 s = o AfTS F fl b^N i</td><td> 542.3</td>

<td>Ρ- 1882</td><td></td><td> %</td><td>Yn_Yxn. qH L 1 JrAi-S = O ΥϊΛfN &amp; ΊΙ</td><td> 555.3</td>

<td>801980</td><td></td><td> 8(01¾ 4</td><td> “444°</td><td> 509.2</td>

52010 Β

<td></td><td>5-Br azaindole</td><td>Organobomic acid</td><td>Uniting</td><td>MS (ESI) [M + H]⁺] noted</td>

<td>61996</td><td></td><td>1 , Ν. ч в-о У</td><td>w NN 0</td><td> 562.2</td>

<td>Ρ- 1997</td><td></td><td>j No. ° Ά</td><td>L &amp; 0 ЧјА | ^{F ΗΝ}ό ^ °</td><td> 512.2</td>

<td>Ρ- 1864</td><td>^BrV^?Y'C 1 Π ^F Η ο Vn</td><td>, ι No. e-o ° Ά</td><td>\ U f Ό KI / gČA r hn-s ^ I did ⁰</td><td> 460.2</td>

<td>Ρ- 1546</td><td>čČI ^bytvo °</td><td>V (ON)₂oAmNg</td><td>NHž K. / Api vQ} „f i &amp;^N i</td><td> 497.2</td>

<td>Ρ- 1547</td><td>Sj^AN ^N H</td><td>V (ON) g oAa</td><td>ČA R. / .ι⁴) S-Cj ' liA T r \ rS == o Yfl5 ^F I 0</td><td> 527.3</td>

<td>Ρ- 1548</td><td></td><td>B (OHk (L | r) &lt;-O</td><td>HuANg</td><td> 569.3</td>

<td>Ρ- 1549</td><td>^ΒΓννΓτ ^Ν'ί' °^{F n} θ</td><td>BJOKh 0γΝΗ₂</td><td>no^N n</td><td> 499.3</td>

<td>Ρ- 2006</td><td>^v,gLNt °</td><td>Ύ ^ νη</td><td>N ^ f | Oh</td><td> 560.2</td>

52010 Β

<td></td><td>5-Br azaindoi</td><td>Organobomic acid</td><td>Uniting</td><td>MS (ESI) [M + H &amp; lt; + &amp; gt;] observed</td>

<td>P- 2012</td><td>ό⁰</td><td>V (ON)_g £</td><td></td><td> 632.1</td>

Example 4: Synthesis of N- [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] -ethanesulfonamide P-0728.

Compound P-0728 was synthesized in eight steps from 2,4-difluorophenylamine 42 as shown in Semi 16.

Scheme 16

<img file="RS52010B_D0017.tif" />

Step 1-Preparation of dibenzyl- (2,4-difluoro-phenyl) -amine (52):

To 2,4-difluoro-phenylamine (42, 10.0 g, 77.4 mmol) in N, N-dimethylformamide (130 mL) was added potassium carbonate (32.1 g, 0.23 mol) and benzyl bromide (21.2 mL, 0.18 mol). . The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel

52010 Β eluting with 10% ethyl acetate in hexane. The appropriate fractions were combined and concentrated to give the compound (52, 12.0 g, 50%). MS (ESI) = 310.2.

Step 2 - Preparation of 3-dibenzylamino-2,6-difluoro-hensaldehyde (53):

To dibenzyl- (2,4-difluoro-phenyl) -amine (52, 4.30 g, 13.9 mmol) in tetrahydrofuran (60 mL), under a nitrogen atmosphere, which was cooled by a dry ice / acetone bath at 78 ° C, Iagano was added n-butyl lithium (2.50 M in hexane, 6.1 mL, 15.3 mmol). The reaction was stirred for 1 hour, N, N-dimethylformamide (1.2 mL, 15.3 mmol) was added and the reaction was allowed to warm to room temperature over 1 hour. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over slightly anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% ethyl acetate in hexane to give the compound (53, 4.0 g, 85%). MS (ESI) [M + N &amp; lt; + &amp; gt; = 337.2.

Step 3 - Preparation of (3-dibenzylamino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3b] pyridin-3-yl) -methanol (54):

To 3-dibenzylamino-2,6-difluoro-benzaldehyde (53, 0.76 g, 2.3 mmol) in methanol (50 mL ·) was added 5-pyridin-3-yl-II-pyrrolo [2,3-b] pyridine (89, 0.40 g, 2.1 mmol, prepared as described in Example 17) and potassium hydroxide (0.50 g, 8.9 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% methanol in methylene chloride to give the compound (54.0.60 g, 50%). MS (ESI) [M + H⁺]⁺= 533.2.

Step 4 - Preparation of (3-dibenzylamino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3b] pyridin-3-yl) -methanone (55):

U (3-Dibenzylamino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) methanol (54, 0.90 g, 1.7 mmol) in methylene chloride (20 mL) under a nitrogen atmosphere was added Dess-Martin periodine (0.97 g, 2.3 mmol). The reaction was stirred at room temperature for 15 minutes. The reaction was poured into a solution of sodium bicarbonate and sodium thiosulfate and extracted

52010 Β ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give the compound (55, 0.70 g, 78%). MS (ESI) [M + 1G]⁺= 531.2.

Step 5 - Preparation of (3-dibenzylamino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1-triisopropylsilanylH-pyrrolo [2,3-b] pyridin-3-yl) -methanone (56) :

U (3-Dibenzylamino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) methanone (55, 0.84 g, 1.6 mmol) in tetrahydrofuran (150 mL) was added sodium hydride (210.0 mg, 60% in mineral oil, 5.3 mmol) under a nitrogen atmosphere. The reaction was stirred for 5 minutes. Triisopropylsilyl chloride (0.80 mL, 3.8 mmol) was added and the reaction was stirred at room temperature for 3 hours. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% ethyl acetate in hexane to give the compound (56.420 mg, 39%). MS (ESI) [M + H⁺]⁺ = 687.4.

Step 6 - Preparation of (3-amino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone (57):

U (3-Dibenzylamino-2,6-difluorophenyl) - (5-pyridin-3-yl-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone (56, 55.0 mg , 0.080 mmol) in methanol (15 mL) was added 20% palladium hydroxide on charcoal (20 mg) The reaction was stirred under a hydrogen atmosphere overnight.The reaction was filtered to remove the catalyst, and then concentrated to give the crude compound which was used in the next step.

Step 7 - Preparation of N- [2,4-difluoro-3- (5-pyridin-3-yl-1-triisopropylsilanyl-1H-pyrrolo [2,3b] pyridine-3-carbonyl) -phenyl] -ethanesulfonamide (58) ;

U (3-amino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1-triisopropylsilanyl-1H-pyrrolo [2,3b] pyridin-3-yl) -methanone (57 , 35.0 mg, 0.069 mmol) in methylene chloride (6 mL) was added methanesulfonyl chloride (0.30 mL, 3.9 mmol) and triethylamine (0.40 mL, 2.9 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl

52010 T acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated to give the crude compound used in the next step.

Step 8 - Preparation of N- [2,4-difluoro-3 ~ (5-pyridin-3-yl-1H-pyrrolo [2,3-h] pyridine-3-carbonyl) phenyl] -ethanesulfonamide (P-0728):

In N- [2,4-difluoro-3- (5-pyridin-3-yl-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -ethanesulfonamide (58, 35.0 mg, 0.060 mmol) in tetrahydrofuran (10 mL) was added tetra-n-butylammonium fluoride (19 mg, 0.072 mmol). The reaction was stirred at room temperature for 5 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give the compound (P-0728, 5.6 mg, 22%). MS (EST) [M + H⁺]⁺ = 443.1.

Example 5: Preparation of propane-2-sulfonic acid [2,4-difluoro-3- [(5-pyridin-3-yl-1H-pyrrolo] 2,3-b] pyridine-3-carbonyl) phenyl] -amide Compound P-0850 was synthesized in four steps from 2,4-difluorophenylamine 42 as shown in Scheme 17.

Scheme 17

<img file="RS52010B_D0018.tif" />

52010 Β

Step 1-Preparation of propane-2-sulfonic acid (2,4-difluoro-phenyl) -amide (59):

To 2,4-difluoro-phenylamine (42.4.0 mL, 40.0 mmol) in methylene chloride (50 mL) were added pyridine (3.37 mL, 42.3 mmol), propane-2-sulfonyl chloride (6.00 g, 42.3 mmol). ) and dimethylaminopyridine (0.20 g, 1.64 mmol) under a nitrogen atmosphere. The reaction was stirred at 45 ° C overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 3% methanol in methylene chloride to give a white solid (59, 8.0 g, 85%). MS (ESI) [MH⁺]' = 234.0.

Step 2 - Preparation of propane-2-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide (60):

Propane-2-sulfonic acid (2,4-difluoro-phenyl) -amide (59, 2.35 g, 9.95 mmol) in tetrahydrofuran (70 mL) under a nitrogen atmosphere, cooled by a dry ice / acetone bath 1.60 M n-butyl lithium (1.60 M in hexane, 6.53 mL, 10.45 mmol) was added. The reaction was stirred for 40 minutes, and then another portion of n-butyl lithium (1.60 M in hexane, 6.84 mL, 10.94 mmol) was added. The reaction was stirred for 1 h and N, N-dimethylformamide (0.92 mL, 11.9 mmol) was added. The reaction was allowed to warm to room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography (dichloromethane / methanol 5%) to give the compound (60.1.4 g, 53.4%). MS (ESI) [M-I⁺]'=263.4.

Step 3 - Preparation of {2,4-difluoro-3- [hydroxy- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) methyl] -phenyl} -amide 2-sulfonic acids (61):

Propane-2-sulfonic acid (2,4,220.0 mg, 0.83 mmol) in methanol (15 mL) was added to (2,4 mL) (2,4-difluoro-3-formyl-phenyl) -amide in 5-pyridin-3-yl- 12-pyrrolo [2,3-b] pyridine (89, 150.0 mg, 0.77 mmol, prepared as described in Example 17) and potassium hydroxide (537.0 mg, 9.6 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% methanol in dichloromethane to give the compound.

52010 Β (61, 160 mg, 45.3%). In this step, the second compound is 2,4-difluoro-3- [methoxy- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -amide -2-sulfonic acids were also formed and isolated.MS (ESI) [M + H^f]⁺=460.1.

Step 4 Preparation of [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl-amidapropane-2-sulfonic acid (P-0850) :

U {2,4-Difluoro-3- [hydroxy- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} amide propane- Dess-Martin peiodone (48.0 mg, 0.11 mmol) was added to 2-sulfonic acids (61, 40.0 mg, 0.087 mmol) in tetrahydrofuran (10 mL). The reaction was stirred at room temperature for 5 minutes. The reaction was poured into sodium thiosulfate and potassium carbonate solution and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% methanol in methylene chloride to give the compound (P-0850, 13.4 mg, 33.5%). MS (ESI) [M + H⁺]⁺=458.1.

N- (2,4-Difluoro-3-formyl-phenyl) -3-trifluoromethyl-benzenesulfonamide 579, N- (2,4-difluoro-3-formyl-phenyl) -4-trifluoromethyl-benzenesulfonamide 580, N- ( 2,4-Difluoro-3-formylphenyl) -4-fluoro-benzenesulfonamide 581 and 2,4-difluoro-3-formyl-phenyl) -carbamic acid benzyl ester were prepared by following Steps 1 and 2 of Scheme 17, by substituting propane-2-sulfonyl chloride with 3-trifluoromethylbenzenesulfonyl chloride, 4-trifluoromethyl-benzenesulfonyl chloride, 4-fluorobenzenesulfonyl chloride and benzyl chloroformate, respectively, in Step 1.

Propane-Sulfonic Acid P-1004 [4-Chloro-3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluoro-phenyl] -amide

52010 Β

<img file="RS52010B_D0019.tif" />

was prepared using the protocol of Scheme 17, substituting 2,4-difluoro-phenylamine with 4-chloro-2-fluoro-phenylamine and propane-2-sulfonyl chloride with propane-1-sulfonyl chloride in Step 1, and 5-pyridin-3-yl -1H-pyrrolo [2,3-b] pyridine 89 with 5-chloro-7-azaindole 80 (see Example 9) in Step 3. MS (ESI) [M + NT = 430.1.

Propan-1-sulfonic acid [4-Chloro-2-fluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide P-0904

<img file="RS52010B_D0020.tif" />

was prepared using the protocol of Scheme 17, substituting 2,4-difluoro-phenylamine with 4-chloro-2-fluoro-phenylamine and propane-2-sulfonyl chloride with propane-1-sulfonyl chloride in Step 1, and 5-pyridin-3-yl -1H-pyrrolo [2,3-b] pyridine 89 with 7-azaindole 94 in Step 3. MS (ESI) [M + N⁺]> 396.2.

Thiophene-2- [3- (5-Chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide

<img file="RS52010B_D0021.tif" />

was prepared using the protocols of Kogak 3 and 4 of Scheme 17, by substituting 5-chloro-7-azaindole 80 for 5-pyridin-3-ylH-pyrrolo [2,3-b] pyridine 89 (see Example 9) and (2, Propane-2-sulfonic acid 4-difluoro-3-formyl-phenyl-amide 60 with thiophene-2-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide 512 (see Example 21) in Step 3. MS ) [M + H ']' = 451.9. Thiophene-3-sulfonic acid [3- (5-Chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide P-1268

52010 Β

<img file="RS52010B_D0022.tif" />

was prepared using the protocols of Steps 3 and 4 of Scheme 17, by substituting 5-chloro-7-azaindole 80 for 5-pyridin-3-ylH-pyrrolo [2,3-b] pyridine 89 (see Example 9) and (2, Propane-2-sulfonic acid 4-difluoro-3-formyl-phenyl-amide 60 with thiophene-3-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide 513 (see Example 21) in Step 3. MS ) [M + N⁺G = 454.1. Additional compounds were prepared by following the protocol of Semc 17, optionally replacing propane-2 = sulfonyl chloride with the appropriate acid chloride in Step 1 and / or 5pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine with the appropriate with the azaindole in Step 3. The azaindols were purchased or synthesized as described in Examples 6, 13, 14, 16 and 17. Some compounds were isolated after Step 3, either as hydroxy or methoxy derivatives. Following this procedure, the following compounds were prepared:

Dimethylamine-1-sulfonic acid {3- [5- (4-Chloro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluoro-phenyl} -amide 1257),

N- [3- (5-Bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] benzenesulfonamide (P-0798), [3- (5-bromo- Propane-1-sulfonic acid (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-0773), [3- (5-bromo-1H-pyrrolo [2] Dimethylamine-1-sulfonic acid (3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-0898),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -benzenesulfonamide (P-0885),

N- [2,4-Difluoro-3- (5-fluoro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-0902), {2,4-difluoro-3 Propane-1-sulfonic acid - [hydroxy- (5-isopropenyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl-phenyl} -amide (P-1239), [2,4-difluoro- Propane-sulfonic acid 3- (5-isopropenyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-0991),

52010 Propane-1-sulfonic acid Β {2,4-difluoro-3- [hydroxy- (5-methyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -arnide -1240), Propane-1-sulfone, 2,4-difluoro-3- [methoxy- (5-methyl-1H-pyrrolo (2,3-b] pyridin-3-yl) -methyl] -phenyl} -amide (P-1241), {2,4-Difluoro-3- [hydroxy- (5-isopropyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -amide Propane-1-sulfonic acid 1-sulfonic acid (P-1242), (2,4-difluoro-3- (5-isopropyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide P-0997), Propane-1-sulfonic acid {2,4-difluoro-3- [hydroxy- (5-methoxy-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -amide 1243), Propane-1-sulfonic acid {2,4-difluoro-3- [methoxy- (5-methoxy-1H-pyrrolo (2,3-b] pyridin-3-yl) -methyl] -phenyl} -amide (P-1244), (2,4-Difluoro-3- {hydroxy- [5- (4-methyl-piperazin-1-yl) -1H-pyrrolo [2,3-b] pyridin-3-ylmethyl} - Propane-1-sulfonic acid phenyl) -amide (P-1245), [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] - sulfonic acid amide (P-0933), Sulphonic acid [2,4-difluoro-3- (5-fluoro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-0907), [3- (5-chloro) Propane-1-propane-1-propane-1-sulfonic acid-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1020),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-methoxybenzenesulfonamide (P-0983),

N- [3- (4-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -benzenesulfonamide (P-0954),

N- [2,4-Difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -acetamide (P-1002), [3- Dimethylamine-1-sulfonic acid (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-0950), [3- (5-pyridin-3-yl-) Dimethylamine-1-sulfonic acid 1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluoro-phenyl] -amide (P-0837), [3- (5-chloro-1H-pyrrolo] Dimethylamine-1-sulfonic acid [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1258), Butane-1-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1263),

52010 Butane-1-sulfonic acid [2,4-difluoro-3 '(5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-1264), [3- ( Butane-1-sulfonic acid 5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1265), [3- (5-ethoxy-1) Propane-1-sulfonic acid H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1252), {2,4-difluoro-3- [5- Propane-1-sulfonic acid (2-methoxy-ethoxy) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide (P-1253), Propane-1-sulfonic acid {P- [5- (2-diethylamino-ethoxy) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluoro-phenyl} -amide ),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-ethylbenzenesulfonamide (P-1700),

N- [3- (5-Ethyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-fluoromethylbenzenesulfonamide (PI 783), [3- (5-bromo- Thiophene-3-sulfonic acid 1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1798), [3- (5-chloro-1H-pyrrolo) Benzo [b] thiophene-2-sulfonic acid [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1799), [3- (5-chloro-111-pyrrolo [ 5-Pyridin-2-ylthiophene-2-sulfonic acid 2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1800),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-cyanobenzenesulfonamide (P-1822),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-fluoro-4-methylbenzenesulfonamide (P-1823),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -isopropylbenzenesulfonamide (P-1839),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-fluorobenzenesulfonamide (P-1840),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3,5-fluorobenzenesulfonamide (P-1841),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-methylbenzenesulfonamide (P-1842),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-oxazol-5-ylbenzenesulfonamide (P-1843),

52010 Β

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-fluorobenzenesulfonamide (P-1865),

N- {2,4-Difluoro-3- [5- (2-methoxy-ethoxy) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -3-fluoro-benzenesulfonamide (P-1871) ,,

N- {2,4-Difluoro-3- [5- (2-methoxy-ethoxy) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -4-fluoro-benzenesulfonamide (P-1872) Propane-1-sulfone, (2,4-difluoro-3- {5- [4- (2-methoxy-ethoxy) -phenyl] -1H-pyrrolo [2,3'b] pyridine-3-carbonyl) -phenyl) -amide acids (P-1998),

N- {2,4-Difluoro-3- [5- (2-methoxy-ethoxy) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -4-trifluoromethyl-benzenesulfonamide (P-2005) i

N- (2,4-Difluoro-3- {5- [4- (2-methoxy-ethoxy) -phenyl] -1H-pyrrolo [2,3-b] pyridine-3-carbonyl} phenyl) -4-trifluoromethyl -benzenesulfonamide (P-2013).

The following table shows the acid chloride (column 2) and azaindole (column 3) used to obtain the target compounds (column 4). Column 1 shows the number of compounds and column 5 the recorded mass. The compounds isolated after step 3 of Scheme 17 are shown in column 1.

<td></td><td>Sulfonyl chloride</td><td>Azaindole</td><td>Uniting</td><td>MS (ESI) [M + H⁺]⁺_fornotebooks</td>

<td>P-1257</td><td>, SO₂CI</td><td>'ζϊφ</td><td>Υ'Τν'Μ-Κ ~ Β</td><td> 415.1</td>

<td>P-0798</td><td></td><td>-οι</td><td>_Β^ν « °</td><td>489.9 491.1 [MH^F]-</td>

<td>P-0773</td><td></td><td>Υ ČL {j</td><td>π</td><td>455.9 457.9 [Μ-Η *] ·</td>

<td>P-0898</td><td>_ZSO₂CI 'N</td><td>^Ν Η</td><td></td><td> 497.0 499.1</td>

<td>P-0885</td><td>SOzCI ό</td><td>^cYo Η</td><td>Ν fj 0</td><td>446.1 448.1 [M-N *] -</td>

52010 Β

<td></td><td>Sulfonyl chloride</td><td>Azaindoi</td><td>Uniting</td><td>MS (ESI) [M + H] +_Zabeteženc |</td>

<td>Ρ-0902</td><td></td><td>JP^XZs ^</td><td>Ρ Μ f</td><td>430.1 [M-M⁺G</td>

<td>Ρ-1239 Step 3</td><td>/ ^ SOZCI</td><td>Hello ·^Ν I</td><td>ΑύΓ ^ γο^Ν 8 ⁰</td><td>422.2 (Μ-Η7</td>

<td>Ρ-0991</td><td></td><td>Αύ&gt;^Ν N</td><td>ΑύΓ ^^ ο °ί °</td><td> 420.2</td>

<td>Ρ-1240 Step 3</td><td>^^ SOjCI</td><td>γη</td><td>N fj 0</td><td>396.4 [Μ-Η *] -</td>

<td>Ρ-1241 Step 3</td><td>/ ^ / δο₂α</td><td>γη</td><td>γΑ ^^Ν'^ ο NN 0</td><td>410.3 [Μ-Η⁺]-</td>

52010 Β

<td></td><td>Sulfonyl chloride</td><td>Azaindole</td><td>Uniting</td><td>MS (ESI) [M + H] +</td>

<td>Ρ-1242 Step 3</td><td>; 'SOzCJ</td><td>• Υ^N i</td><td></td><td>424.3 [M-H'J-</td>

<td>Ρ-0997</td><td>^^ SOzCi</td><td>Go^N Β</td><td></td><td> 422.3</td>

<td>Ρ-1243 Step 3</td><td>/ ^ L °_g^s1</td><td>ο—</td><td>&gt;η&gt;^{ρ ην} Go NN ο</td><td>412.3 [M-H '] -</td>

<td>Ρ-1244 Kogak 3</td><td>S __ ^ SOjCI</td><td>S?^hC^z—Ο</td><td>γγ4 °</td><td>426.4 [Μ-Η *] -</td>

<td>Ρ-1245 Step 3</td><td></td><td>^Ν Η</td><td>Υ 00¾^{F Η}&gt;</td><td>480.3 [Μ-Η '] -</td>

52010 Β

<td></td><td>Sulfonyl chloride</td><td>Azaindole</td><td>Uniting</td><td>MS (ESI) [M + H &amp; lt; + &amp; gt;]</td>

<td>Ρ-0933</td><td>^ yS ° 2CI</td><td>^Clw^N Β</td><td>° ΎχΡ ^ · ^ ο N C 0</td><td> 414.2</td>

<td>Ρ-0907</td><td>/ ^ SOaCI</td><td>^FYY</td><td></td><td>396.1 [MH⁺J-</td>

<td>10-1020</td><td>SO, CI ό</td><td>^CIG3</td><td>° Υ ο Ν '⁷the ^{f HN}fο N Ο</td><td> 455.2</td>

<td>Ρ-0983</td><td>SO₂CI φ</td><td>° ~ CQ * i</td><td>F “TTV ^ To^N I ⁰</td><td>476.1 [Μ-Η⁺Γ</td>

<td>Ρ-0954</td><td>SO₂CI ό</td><td>Cl ćo</td><td>α (Μ F ΗΝ- ^₀^Ν Β °</td><td> 448.2</td>

52010 Β

<td></td><td>Sulfonyl chloride</td><td>Azaindole</td><td>Uniting</td><td>MS (ESI) [M + H]⁺]*_frogs| married</td>

<td>Ρ-1002</td><td>Ο Α_α</td><td></td><td>^ν'ιΡϊ7 ^{f ην}~ £ 00 0 Η</td><td> 393.2</td>

<td>Ρ-0950</td><td>, SO₂CI</td><td> 03</td><td>5¾ V-^{F m}f °</td><td> 381.2</td>

<td>Ρ-0837</td><td>, SO, CI Ν</td><td>'θ'ΊΠΟ «^li</td><td>Ε. ιΧ5^{F ΗΝ}'^ ο N Β ⁰</td><td> 458.1</td>

<td>Ρ-1258</td><td></td><td>Go</td><td>“ΊΟ ^ ίο</td><td> 415.1</td>

<td>Ρ-1263</td><td>.so₂a Γ</td><td>^Β,Ό3</td><td>⁸ίύΡ ™ · ^ ° Μ °</td><td> 472.1 474.1</td>

52010 Β

<td></td><td>Sulfonyl chloride</td><td>Azaindole</td><td>Uniting</td><td>MS (ESI) [M + H⁺]⁺notes</td>

<td>Ρ-1264</td><td>, SO₂C1 g</td><td>^N i</td><td>° ghR ™&gt; o N * 41 0</td><td> 424.2</td>

<td>Ρ-1265</td><td>.SO2C1 g</td><td>^c'w &gt;&gt;</td><td>^αγχΡ ^ ο P | ⁰</td><td>426.0 [MH *] ·</td>

<td>Ρ-1252</td><td>_/z - ^ _ Z^S°2^C1</td><td></td><td>¹ 0</td><td> 424.2</td>

<td>Ρ-1253</td><td>y ^ _ /^S02^CI</td><td>c</td><td>G ° \ / cw $ ₽ nn_Go</td><td> 454.2</td>

<td>Ρ-1254</td><td> ___ZSO_ZCI</td><td>r c</td><td>rC ₀&gt;. /</td><td> 495.3</td>

52010 Β

<td></td><td>Sulfonyl chloride</td><td>Azaindole</td><td>Uniting</td><td>MS (ESI) [M + H⁺]⁺_fort&gt; eležena</td>

<td>Ρ-1700</td><td>SOjCl ό</td><td>Ho NN^N H</td><td>^aYYp0o^N i °</td><td> 476.2</td>

<td>Ρ-1783</td><td>SO₂Cf φ CF₃</td><td>ч-Υι</td><td>^F r?³ⁿ i °</td><td> 510</td>

<td>Ρ-1798</td><td>SO₂Ct ά</td><td>⁶'Ό3^N i</td><td>uO c^s^BVij ^{f nm}- ^ o^N I ⁰</td><td>495.9 497.6 [M-H7</td>

<td>Ρ-1799</td><td>SO₂CI V /</td><td>^C,W</td><td>° ΥχΗ ™&gt; ο Μ ⁰</td><td> 502.0 (-)</td>

<td>Ρ-1800</td><td></td><td></td><td>^ονΟ CT ^clX ^ pi ^ fo N 9 0</td><td> 531.1</td>

52010 Β

<td></td><td>Sulfonyl chloride</td><td>Azaindole</td><td>Uniting</td><td>MS (ESI) (M + H +)</td>

<td>Ρ-1822</td><td>so₂a ψ CN</td><td>Hr</td><td>_F CN^αγνΡΧζ^N I °</td><td> 473.1</td>

<td>Ρ-1823</td><td>SO₂CJ Ϋ</td><td>^clTYb N f |</td><td>N $ 0</td><td> 480.1</td>

<td>Ρ-1839</td><td></td><td>^c,w N</td><td>^N you ⁰</td><td> 488</td>

<td>Ρ-1840</td><td>$ o, a f F</td><td>^CIYX ^</td><td>hH</td><td> 464</td>

<td>Ρ-1841</td><td>SO₂CI A</td><td>^Clw SrN ^N H</td><td></td><td> 482</td>

52010 Β

<td></td><td>Sulfonyl chloride</td><td>Azaindole</td><td>Uniting</td><td>MS (ESI) (M + H &amp; lt; + &amp; gt;)⁺]⁺noted &lt;^</td>

<td>Ρ-1842</td><td>SO_ZCI φ</td><td>^Clw</td><td>^ανχΡ4 * ο * R ⁰</td><td>460.0 [Μ-Η⁺]-</td>

<td>Ρ-1843</td><td>SOzCJ ο</td><td>^s'FSO¹⁴ H</td><td>Λ N D Ο</td><td>513.0 [Μ-Η⁺]·</td>

<td>Ρ-1865</td><td>SOjCI φ F</td><td></td><td>F (ΥΠΜζ^Ν I ⁰</td><td> 432.1</td>

<td>Ρ-1871</td><td>SO₂CJ ά.</td><td></td><td>Oh^F 0</td><td> 506.2</td>

<td>Ρ-1872</td><td>SO₂CJ f F</td><td></td><td>ο. ° THr ™ -K N $ 0</td><td> 506.2</td>

52010 Β

<td></td><td>Sulfonyl chloride</td><td>Azaindole</td><td>Uniting</td><td>MS (ESI) [M + H⁺]⁺_fornotebooks</td>

<td></td><td>so₂a f cf.₅</td><td>NN^N H</td><td>c CF₃ 0</td><td></td>

<td>P-1998</td><td>^^ Z^SO2^Cl</td><td>/ ~ l —Ο ο</td><td>NN</td><td> 530.3</td>

<td>P-2005</td><td>SOiC) ό CF₃</td><td>Ύ Go ^Ν Η</td><td>0 00) đ Vr&gt;^{F HN}~ f * o N 0</td><td> 556.0</td>

<td>P-2013</td><td>SOiCI f CF₃</td><td>'Η</td><td>ČH '</td><td> 539.2</td>

Example 6: Synthesis of propane-1-sulfonic acid P-0848 and related compounds [2,4-difluoro-3- (5-phenylamino-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] -amide Propane-sulfonic acid [2,459-difluoro-3- (5-phenylamino-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide P-0848 was synthesized in five steps of 5-bromo-7-azaindole 67 as shown in Scheme 18.

52010 Β

Šcma 18

<img file="RS52010B_D0023.tif" />

<img file="RS52010B_D0024.tif" />

Step 1 - Preparation of 5-chromo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (68):

To 5-bromo-7-azaindole (67, 1.5 g, 7.6 mmol) in N, N-dimethylformamide (20 mL) were added sodium hydride (60% in mineral oil, 0.27 g, 11.0 mmol) and triisopropylsilyl chloride. (2.6 mL, 12.0 mmol), under a nitrogen atmosphere. The reaction was stirred for 2 hours at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% ethyl acetate in hexane to give the compound (68.1.6 g, 59%). MS (ESI) [M + H⁺.⁺ = 352.3.

Step 2 - Preparation of 5-phenyl- (1-trifluoropropylsilanyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -amine (69):

To 5-bromo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (68.0.10 g, 0.3 mmol) in toluene (5 mL) was added aniline (0.04 mL, 0.42 mmol), sodium tert-butoxide (0.15 g, 1.56 mmol), tris (dibenzylideneacetone) dipalladium (0) (9.2 mg, 0.01 mmol) and (S) - (-) - 2,2'bis (diphenylphosphino) -1,1'-binaphthyl (6.3 mg, 0.01 mmol). The reaction was heated to 160 ° C for 10 minutes in a CEM Discover microwave instrument. The reaction was concentrated and purified by silica gel column chromatography eluting with 3% ethyl acetate in hexane to give the compound (69, 40 mg, 40%). MS (ESI) [M + H⁺]⁺= 366.6.

52010 Β

Step 3 Preparation of phenyl - (- 1H-pyrrolo [2,3-b] pyridin-5-yl) -amine (70):

To 5-phenyl- (1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -amine (69, 0.14 g, mmol) in tetrahydrofuran (3.0 mL) was added tetra-n. -butylammonium fluoride (0.197 g, 0.76 mmol). The reaction was stirred for 1 hour at room temperature. The reaction was concentrated and purified by silica gel column chromatography eluting with 3% ethyl acetate in hexane to give the compound (70, 60 mg, 76%). MS (ESI) [M + FT]⁺ = 210.3.

Step 4 - Preparation of propane-1-sulfonic acid {2,4-difluoro-3- [hydroxy- (5-phenylamino-1H-pyrrolo (2,3-b] pyridin-3-yl) methyl] -phenyl} -amide (71):

To phenyl - (- 1H-pyrrolo [2,3-b] pyridin-5-yl) -amine (70, 17.0 mg, 0.09 mmol) in methanol (5.0 mL) was added potassium hydroxide (92.0 mg, 1.6) mmol) and propane-1-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide (73.19.0 mg, 0.072 mmol, prepared as described in Example 7) under a nitrogen atmosphere. The reaction was stirred at room temperature for 12 hours. The reaction was concentrated and purified by silica gel column chromatography eluting with 1% methanol in dichloromethane to give the compound (71.17 mg, 50%). MS (ESI) [M + H⁺]⁺= 473.5.

Step 5 - Preparation of propane-1-sulfonic acid [2,4-difluoro-3- (5-phenylamino-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-0848):

Propane-1-sulfonic acid {{2,4-difluoro-3- [hydroxy- (5-phenylamino-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -amide (71, 7.5 mg, 0.016 mmol) in tetrahydrofuran (3 mL) was added Dess-Martin peiodone (6.70 mg, 0.0158 mmol) under a nitrogen atmosphere. The reaction was stirred for 20 minutes. The reaction was concentrated and purified by silica gel column chromatography eluting with 1% methanol in dichloromethane to give the compound (P-0848, 6.2 mg, 84%). MS (ESI) [M + H⁺]⁺=471.2.

Propane-1-sulfonic acid P- [2,4-Difluoro-3- (5-morpholin-4-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide 0853, Propane-1-sulfone {{2,4-difluoro-3- [5- (4-methyl-piperidin-1-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide Propane acid P-0860 and {2,4-difluoro-3- [5- (4-methyl-piperazin-1-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide sulfonic acid P-1246,

52010 Β

<img file="RS52010B_D0025.tif" />

respectively, were prepared using the protocol from the Scheme

18, by substituting aniline with morpholine, 4-methylpiperidine and 4-methylpiperazine, respectively, in Step 2. P-0853 MS (ESI) [M + H⁺]⁺= 465.2. P-0860 MS (ESI) [M + H⁺]⁺ = 477.3. P-1246 MS (ESI) [M - H]⁺]’ = 478.4.

Example 7: Synthesis of propane-1-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide 73.

Compound 73 was synthesized in two steps from 2,4-difluorophenylamine 42 as shown in Scheme 19.

Scheme 19

<img file="RS52010B_D0026.tif" />

<img file="RS52010B_D0027.tif" />

Step 1 - Preparation of propane-1-sulfonic acid (2,4-difluoro-phenyl) -amide (72):

To 2,4-difluoro-phenylamine (42, 3.0 mL, 29.8 mmol) in tetrahydrofuran (50 mL) were added triethylamine (9.13 mL, 65.5 mmol) and propane-1-sulfonyl chloride (2.90 mL, 25.8 mmol). floor

52010 Β nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into 1 M HCl and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the compound (72, 2.0 g, 28%) which was used in the next step.

Step 2 - Preparation of propane-1-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide (73):

Propane-1-sulfonic acid (2,4-difluoro-phenyl) -amide (72.1.5 g, 6.38 mmol) in tetrahydrofuran (10 mL) under a nitrogen atmosphere, cooled to -78 ° C by bath lithium diisopropylamide (0.80 M in tetrahydrofuran, 24 mL, freshly prepared from n-butyl lithium and diisopropylamine) was added with acetone / dry ice. After 30 minutes, N, N-dimethylformamide (542 [mu] L, 7.018 mmol) was added dropwise to the reaction. The reaction was stirred at -78 ° C for 30 minutes and then allowed to warm to room temperature over 40 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% ethyl acetate in hexane to give a light yellow solid (73, 300 mg, 18%). MS (ESI) [MH⁺[' = 262.3.

Example 8: Synthesis of 5-chloro-1H-pyrrolo [2,3-b [pyridine 80] Compound 80 was synthesized in two steps from 5-bromo-1-triisopropylsilyl-7-azaindole 68 as shown in Semi 21 .

Scheme 21

<img file="RS52010B_D0028.tif" />

Step 1 - Preparation of 5-chloro-14-isoisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (79):

To 5-bromo-1-triisopropylsilyl-7-azaindole (68, 1.60 g, 4.53 mmol, prepared as described in Example 6) in tetrahydrofuran (50.0 mL), under a nitrogen atmosphere at -78 ° C, was added is

52010 Β / erc-butyl lithium (1.70 M in hexane, 6.12 mL). The reaction was stirred for 1 h, then hexachloroethane (1.29 g, 5.43 mmol) was added. The reaction was stirred for 3 hours, poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the crude compound (79, 1.60 g). MS (ESI) [M + H^b]⁺ = 309.3.

Step 2 - Preparation of 5-chloro-1β-pyrrolo [2,3-h] pyridine (80):

To 5-chloro-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (79, 1.40 g, 4.53 mmol) in tetrahydrofuran (15 mL) was added N, N-ra-n-butylammonium fluoride (1.42 g, 5.43 mmol). The reaction mixture was stirred at room temperature for 10 minutes. The reaction mixture was concentrated and isolated by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound (80, 0.40 g, 58% in 2 steps). MS (ESI) [M-H &amp; lt; + &amp; gt;] = 153.1.

5-Fluoro-1H-pyrrolo [2,3-b] pyridine 81 was prepared using the protocol of Scheme 21, by substituting hexachloroethane with N-fluoroN- (phenylsulfonyl) benzenesulfonamide in Step 1. MS (ESI) [M + H⁺]⁺ = 137.1.

Example 9: Synthesis of N- [2,4-difluoro-3- (1H-pyrrolo [23-b] pyridine-3-carbonyl) phenyl] -3-methoxy-benzenesulfonamide P-0971 Compound P-0971 was synthesized in four steps of 2,4-difluorophenylamine 42 as shown in Semi 26.

52010 Β

V

Sema 26

<img file="RS52010B_D0029.tif" />

<img file="RS52010B_D0030.tif" />

Step 1 - Preparation of N- (2,4-difluoro-phenyl) -3-methoxy-benzenesulfonamide (91):

To 2,4-difluoro-phenylamine (42, 0.44 mL, 4.4 mmol) in methylene chloride (10.0 mL), under a nitrogen atmosphere, were added pyridine (1.00 mL, 12.4 mmol) and 3-methoxybenzenesulfonyl chloride (1.00 g). , 4.84 mmol). After 12 hours, the reaction was poured into cold 1M HCl and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a light yellow solid (91.0.90 g, 69%). MS (ESI) [MN G]⁺ = 300.

Step 2-Preparation of N- {2,4-difluoro-3- [hydroxy- (1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin3-yl) -methyl] -phenyl} -3-methoxy-benzenesulfonamide (92) :

In N- (2,4-difluoro-phenyl) -3-methoxy-benzenesulfonamide (91, 0.148 g, 0.494 mmol) in tetrahydrofuran (10.0 mL) cooled in a bath at -78 ° C with acetone / dry ice, under a nitrogen atmosphere, was added dropwise with lithium diisopropylamide (0.85 M in tetrahydrofuran, 1.45 mL, 1.23 mmol). After 30 minutes, 1-triisopropylsilane-1H-pyrrolo [2,3b] pyridine-3-carbaldehyde (96, 0.15 g, 0.500 mmol, prepared as described in Example 12) in tetrahydrofuran (2.0 mL) was added dropwise. in reaction. The reaction was then stirred for 1 hour at -78 ° C and allowed to reach room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by chromatography

52010 Β on a silica gel column eluting with 40% ethyl acetate in hexane to give a light yellow solid (92, 0.080 g, 26.8%). MS (ESI) [M + H⁺.⁺ = 602.

Step 3-Preparation of N- {2,4-difluoro-3- [hydroxy- (1H-pyrrolo [2,3-b] pyridin-3-yl) methyl] -phenyl} -3-methoxy-benzenesulfonamide (93):

N- {2,4-difluoro-3- [hydroxy- (1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-3-yl) methyl] -phenyl} -3-methoxybenzenesulfonamide , 0.075 g, 0.12 mmol) in tetrahydrofused (3.0 mL), tetra-n-butylamine fluoride (0.039 g, 0.15 mmol) was added. The reaction was stirred at room temperature for 20 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 3% methanol in dichloromethane to give a light yellow solid (93, 0.030 g, 55%). MS (ESI) [M + H⁺]⁺ = 446.

Step 4 - Preparation of N- (2,4-difluoro) (3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] -3-methoxybenzenesulfonamide (P-0971):

N- [2,4-difluoro-3- [hydroxy- (1H-pyrrolo [2,3-b] pyridin-3-yl) methyl] -phenyl} -3-methoxybenzenesulfonamide [93, 0.02 g, 0.05 mmol ) in tetrahydrofused (3.0 mL) was added DessMartin periodine (0.02 g, 0.015 mmol) under a nitrogen atmosphere. The reaction was stirred for 10 minutes at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 3% methanol in dichloromethane to give a light yellow solid (P-0971, 0.010 g, 50%). MS (ESI) [M + H⁺.⁺ = 444.

Additional compounds were prepared by following the protocol of Scheme 26, replacing 3 methoxy-benzene sulfonyl chloride with the appropriate sulfonyl chloride in Step 1. The following compounds were prepared by following this procedure:

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -2,5-dimethoxybenzenesulfonamide (Pl 131),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-methoxybenzenesulfonamide (P-0958),

52010 Piperidine-1-sulfonic acid 2,4 [2,4-difluoro-3- [1,2-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl] -amide (P-0952),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-trifluoromethylbenzenesulfonamide d (P-0931),

4-Butoxy-N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-1006),

4-Chloro-N- [2,4-difluoro-3- (1H-pyrrolo (2,3-b | pyridine-3-carbonyl) -phenyl] -benzenesulfonamide (P-0937),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -3,4-dimethoxybenzenesulfonamide, (P-1090), and

3,4-Dichloro-N- (2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-1015).

The following table shows the sulfonyl chloride (column 2) used to give the target compound (column 3). Column 1 gives the number of compounds and column 4 gives the recorded mass.

<td></td><td>Sulfonyl chloride</td><td>Uniting</td><td>MS (ESI) [M + H⁺f noted</td>

<td>P-1131</td><td>O— - &lt;G 0</td><td>0¼¾ o ° L 00^F</td><td> 474.2</td>

<td>P-0958</td><td>SO₂CI</td><td>\ SA * o</td><td> 444.2</td>

<td>P-0952</td><td>* O-SOzCI</td><td>F. Q . jP ° g ~ \ 00G0_F HN-Š-Nl) n</td><td> 421.2</td>

<td>P-0931</td><td>F₃CQ-SO₂C1</td><td>F HN-g-O0F₃</td><td> 482.2</td>

83;

52010Β

<td></td><td>Sulfonyl chloride</td><td>Uniting</td><td>MS (ESI) [M + H⁺f noted</td>

<td>P-1006</td><td>/ ° 0Y^S°^2CIno</td><td>(fjn F NI- | -0- °^N Μ 0</td><td> 486.2</td>

<td>P-0937</td><td>ci — 44 “ ^S°^2C1</td><td>F. 0. ΥΐΓΛ F HN-S-YY-CI Y 0</td><td>446.1 [M-H0</td>

<td>P-1090</td><td>—SO2CI</td><td>F \ _ w _ogPgL ^fΗΝ-δΌ^-0' Vn 0 H_o_</td><td> 474.2</td>

<td>P-1015</td><td>Cl — 4&gt; SO₂CI Cl</td><td></td><td>480.0 482.1 [M-N⁺]'</td>

<td>* Piperic reflux</td><td colspan="3">in-1-sulfonyl chloride prepared from sulfuryl chloride and piperidine in acetonitrile, for 8 hours, concentrated and used without further purification.</td>

Example 10: Synthesis of 1-triisopropylsilanyl-1H-pyrrolo [23-b] pyridine-3-carbaldehyde 96 Compound 96 was synthesized in two steps from 7-azaindole 94 as described in Scheme

27.

Scheme 27

<img file="RS52010B_D0031.tif" />

<img file="RS52010B_D0032.tif" />

<img file="RS52010B_D0033.tif" />

52010 Β

Step 1 - Preparation of 1H-pyrrolo [2,3-b] pyridine-3-carbaldehyde (95):

To 1 H-Pyrrolo [2,3-b] pyridine (94, 16.0 g, 135 mmol) in water (110 mL), hexamethylenetetramine (26.0 g, 185 mmol) and acetic acid (55.0 mL, 967) were added. mmol). The reaction was refluxed for 12 hours. Water (329 mL) was added and the reaction was cooled to room temperature. The reaction was filtered and washed with water to give the compound (95, 15.0 g, 76%). MS (ESI) [M + HT = 147.

Step 2-Preparation of 1-triisopropylsilanyl-11-pyrrolo [2,3-b] pyridine-3-carbaldehyde (96):

To 1H-Pyrrolo [2,3-b] pyridine-3-carbaldehyde (95, 4.05 g, 27.71 mmol) in tetrahydrofuran (30.0 mL) was added sodium hydride (60% in mineral oil, 1.5 g, 38 mmol). ) and triisopropylsilyl chloride (8.0 mL, 38 mmol) under a nitrogen atmosphere. The reaction was stirred for 2 hours at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% ethyl acetate in hexane to give the compound (96, 3.0 g, 36%). MS (ESI) [M + H⁺]⁺ = 303.

Example 11: Synthesis of 5-isopropyl-1H-pyrrolo [2,3-b] pyridine 99 Compound 98 was synthesized in three steps from 5-bromo-1-triisopropylsilyanyl-1H-pyrrolo [2,3-b] pyridine 68 which is described in Scheme 28.

Scheme 28

<img file="RS52010B_D0034.tif" />

Step 1-Preparation of 2- (1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -propan-2-ol (97):

In 5-bromo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (68, 2.0 g, 5.66 mmol, prepared as described in Example 6) in tetrahydrofuran (20.0 mL), cooled in bath at -78 ° C with acetone / dry ice, under a nitrogen atmosphere, a drop of tert

52010 Β butyl lithium (1.7 M in tetrahydrofuran, 7.3 mL, 12 mmol). After 20 minutes, acetone (0.830 mL, 11 mmol) was added to the reaction. The reaction was stirred for 30 minutes at -78 ° C and then allowed to reach room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% ethyl acetate in hexane to give the compound (97, 1.30 g, 69%). MS (ESI) [M + NT = 333.

Step 2 - Preparation of 5-isopropenyl-1H-pyrrolol2,3-b] pyridine (98):

To 2- (1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -propan-2-ol (97, 0.500 g, 1.5 mmol) in acetonitrile (10.0 mL) were added triethylsilane (1.00 mL, 6.3 mmol) and trifluoroacetic acid (0.50 mL, 6.5 mmol) under a nitrogen atmosphere. The reaction was refluxed for 3 hours, then cooled to room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 50% ethyl acetate in hexane to give the compound (98.0.200 g, 84%). MS (ESI) [M + H⁺]⁺=159.

KogakZ- Preparation of 5-isopropyl-1H-pyrrolo [2,3-b] pyridine (99):

To 5-isopropenyl-II-pyrrolo [2,3-b] pyridine (98, 0.080 g, 0.501 mmol) in tetrahydrofuran (5.0 mL) was added 20% palladium hydroxide on charcoal (5.0 mg). The reaction was stirred under hydrogen at 40 psi for 30 minutes. The reaction mixture was filtered and concentrated to give the compound (99.0.078 g, 96%). MS (ESI) [M + H⁺.⁺ =161.

Example 12: Synthesis of 5-Methyl-1H-pyrrolo [2,3-b] pyridine 101 Compound 101 was synthesized in two steps from 5-bromo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine 68 which is described in Semi 29.

52010 Β

Šcma 29

<img file="RS52010B_D0035.tif" />

Step I - Preparation of 5-Methyl-1-triisopropylsilanyl-11-pyrrolo [2,3-b] pyridine (100):

To PdChidppf) (0.04 g, 0.05 mmol) in toluene (10.0 mL) under nitrogen was added 5-bromo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (68, 0.3 g, 0.8 mmol, prepared as described in Example 6, 1.0 mL in toluene) and methylmagnesium bromide (1.0 M in tetrahydrofuran, 3.0 mL, 3.0 mmol). The reaction was stirred at 90 ° C for 2 hours and then allowed to reach room temperature. The reaction was poured into citric acid (0.1 M in water) and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 50% ethyl acetate in hexane to give the compound (100.0.16 g, 60.0%). MS (ESI) [M + H⁺]⁺ = 289.4.

Step 2 - Preparation of 5-Methyl-1H-pyrrolo [2,3-b] pyridine (101):

To 5-Methyl-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (100, 0.160 g, 0.55 mmol) in tetrahydrofuran (3.0 mL) was added tetra-n-butylammonium fluoride (0.145 g, 0.55 mmol). The reaction was stirred for 1 hour at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 3% methanol in dichloromethane to give a light yellow solid (101, 0.07 g, 95%). MS (ESI) [Μ + ΐΓ]⁺ =133.2.

5-Methyl-1H-pyrrolo [2,3-b] pyridine

<img file="RS52010B_D0036.tif" />

52010 Β was prepared by following the protocol from Scheme 29, substituting methylmagnesium bromide with ethylmagnesium bromide in Step 1.

Example 13: Synthesis of 5-Methoxy-1H-pyrrolo [2,3-b] pyridine 104 and related compounds Compound 104 was synthesized in one step from 5-bromo-1H-pyrrolo [2,3-b] pyridine 67 as described in Scheme 31.

Scheme 31

<img file="RS52010B_D0037.tif" />

104

Step 1 - Preparation of 5-Methoxy-1H-pyrrolo [2,3-h] pyridine (104):

To 5-bromo-7-azaindole (67, 500.0 mg, 2.53 mmol) in N, N-dimethylformamide (8 mL) were added copper (I) iodide (966 mg, 5.08 mmol) and sodium methoxide in methanol. 3 M, 5 mL). The reaction was stirred overnight at 120 ° C under argon. The reaction was poured into water, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a white solid (104, 140 mg, 28%). MS (ESI) [M + N *]⁺ = 149.1. In an alternative procedure, 2.3 g (11.7 mmol) of 5-bromo-7-azaindole (67, 2.3 g, 11.7 mmol) was dissolved in 75 mL of N, N-dimethylformamide and 50 mL of methanol (50 mL), with the addition of sodium methoxide (32 g, 0.6 mol) and copper - (I) bromide (3.2 g, 22.4 mmol) at room temperature. The reaction was stirred for three hours at 100 ° C under an argon atmosphere. The mixture was diluted with ethyl acetate and poured into a solution of ammonium chloride: ammonium hydroxide (4: 1). The organic layer was extracted with ammonium chloride: arnonium hydroxide (4: 1), washed with brine, dried over rehydrated anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography eluting with 30% to 70% ethyl acetate in hexanes to give a yellow solid (104, 0.27 g, 15.6%). MS (ESI) [M + H⁺]⁺= 149.2.

52010 5-Ethoxy-11-pyrrolo [2,3-b] pyridine 506 ^Ν Η was prepared using the protocol from Scheme 31, by substituting methanol with ethanol and sodium methoxide with sodium ethoxide.

5- (2-Methoxy-ethoxy) -1H-pyrrolo [2,3-b] pyridine 507

<img file="RS52010B_D0038.tif" />

was prepared using the protocol of Scheme 31, by substituting methanol with 2-Methoxyethanol and sodium methoxide with sodium 2-methoxy-ethoxide (prepared from 2-methoxyethanol and sodium hydride). MS (ESI) [M + H⁺]⁺ =193.3.

Diectyl- [2 (1H-pyrrolo [2,3-b] pyridin-5-yloxy) -ethyl] -amine 508

<img file="RS52010B_D0039.tif" />

was prepared using the protocol of Scheme 31, by substituting methanol with 2-diethylaminoethanol and sodium methoxide with sodium 2-diethylamino-ethoxide (prepared from 2,2-diethylamino-ethanol and sodium hydride). MS (ESI) | M + H]⁺ = 234.5.

Example 14: Synthesis of 5-Pyridin-3-yl-1H-pyrrolo [23-b] pyridine 89 5-Pyridin-3-yl-II-pyrrolo [2,3-b] pyridine 89 was synthesized in one step of 5-bromolH-pyrrolo [2,3-b] pyridine 67 as described in Scheme 32.

52010 Β

Scheme 32

<img file="RS52010B_D0040.tif" />

Step 1 - Preparation of 5-Pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine (89):

To 5-bromo-7-azaindole (67, 1.00 g, 5.08 mmol) in water (13.0 mL) and acetonitrile (36 mL) were added pyridine-3-organobomic acid (609, 1.0 g, 8.1 mmol), potassium carbonate (1.79 g, 0.0130 mol) and tetrakis (triphenylphosphine) palladium (O) (50.0 mg, 0.043 mmol) under a nitrogen atmosphere. The reaction mixture was heated to 170 ° C overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate and concentrated. The residue was purified by silica gel column chromatography eluting with 25% ethyl acetate in hexane to give a light yellow solid (89.820 mg, 82%). MS (ESI) [M + H⁺] = 196.1.

Additional compounds were prepared by following the protocol of Scheme 32, either by substitution of pyridine-3-organobomic acid with the appropriate organobomic acid or by substitution of 5-bromo-7-azaindole with 5- (4,4,5,5-tetramethyl- [1] , 3,2] dioxaborolan-2-yl) -1H-pyrrolo [2,3-b] pyridine and the reaction of a suitable aryl or heteroaryl halide (i.e., coupling with an organobomic acid ester on azaindole, and a halide on the group to be joined at the 5-position azaindole). The following compounds were prepared by this procedure:

5- (4-chloro-phenyl) -1H-pyrrolo [2,3-b] pyridine (514),

5- (4-Fluoro-phenyl) -1H-pyrrolo [2,3-b] pyridine (605),

5-Phenyl-1H-pyrrolo [2,3-b] pyridine, 5- (6-Methoxy-pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridine, 5- (2-Methoxy- pyrimidin-5-yl) -1H-pyrrolo [2,3-b] pyridine, 5-Pyridin-4-yl-1H-pyrrolo [2,3-b] pyridine,

4- (1H-Pyrrolo [2,3-b] pyridin-5-yl) -benzenesulfonamide, 3- (1H-Pyrrolo [2,3-b] pyridin-5-yl) -benzenesulfonamide,

5-Pyrimidin-5-yl-1H-pyrrolo [2,3-b] pyridine,

52010 Β

5- (3-Methanesulfonyl-phenyl) -1H-pyrrolo [2,3-b] pyridine (Ρ-0173), ί 3- (1H-Pyrrolo [2,3-b] pyridin-5-yl) -benzamide Ρ-1622).

The following table shows 5-bromo-7-azaindole or 5- (4,4,5,5-tetramethyl- [1,3,2] dioxaborolan-2-yl) -1H-pyrrolo [2,3-b pyridine starting material (column 1) and the corresponding reagent to be combined at the 5-position of the azaindole (column 2) to give the resulting compound (column 3), with the mass given in column 4.

<td>Initial azaindole</td><td>Reagent combined for position 5</td><td>Uniting</td><td>MS (ESI) [M + N⁺]⁺noted</td>

<td>^Brw</td><td>V (ON) g Cl</td><td></td><td> 229.1</td>

<td>^ΒΎΤΛ^N I</td><td>V (ON) g q</td><td></td><td> 213.1</td>

<td>^ΒΎΧ&gt;</td><td>V (ON) g ό</td><td></td><td> 195.2</td>

<td>NY</td><td>B (OH)₂γ 0—</td><td>^N n</td><td> 226.2</td>

<td>^BrO3</td><td>V (ON)₂</td><td></td><td> 227.2</td>

<td>° pz</td><td>Ο^-1</td><td></td><td> 196.2</td>

<td>⁰”You</td><td>X o%</td><td>Chj Η</td><td> 274.1</td>

52010 Β

<td>Initial azaindole</td><td>Reagent combined for position 5</td><td>Uniting</td><td>MS (ESI) [Μ + (⁺]⁺noted</td>

<td>° rn^N p</td><td>Br^zAbout NH₂ 0%</td><td>0 '0 «j / c</td><td> 274.1</td>

<td>⁰ w^N</td><td> (^Z Y&gt; “- Br</td><td>^N n</td><td> 197.2</td>

<td>^B'TG&gt;^N i</td><td>&lt;Γ / ΟΗ (ΗΒ)₂° '' Sz^s* o</td><td>¹⁴ Η</td><td> 273.1</td>

<td></td><td>O ~ B (0H)₂N₂mč7 0</td><td>ΠζΝ-ργρρχ Ο</td><td> 238.2</td>

Example 15: Synthesis of propane-1-sulfonic acid P-0955 and related compounds [3- (5-bromo-1H-pyrrolo [23-b] pyridine-3-carbonyl) -2-fluorophenyl] -2-related compounds As an alternative method to that of Example 2, compound P-0955 was synthesized in nine steps from 4-chloro-2-fluoro-phenylamine 47 as shown in Scheme 37.

Scheme 37

Step 1 VpO

Step 2 BnO

Step 3 HO '

<img file="RS52010B_D0041.tif" />

Step 5

Step 4

F HN-S '

504

P-0955, 0 Step 9 Art

F HN- ^ °

<img file="RS52010B_D0042.tif" />

Step 7

Step 6

9·

52010 Β

Step 1- Preparation of 3-amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48):

To 4-chloro-2-fluoro-phenylamine (47, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), which was cooled with a dry ice / acetone bath under a nitrogen atmosphere, n-butyl lithium was added slowly. (2.50 M in hexane, 24.4 mL). After 20 minutes, 1,2-Bis- (chloro-dimethyl-silanyl) -ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was added to the reaction. After 1 h, n-butyl lithium (2.50 M in hexane, 25.0 mL) was added slowly to the reaction. The reaction was stirred at -78 ° C for 20 minutes and then allowed to warm to room temperature over 60 minutes. The reaction was cooled to -78 ° C, followed by the slow addition of n-butyl lithium (2.50 M in hexane, 26.0 mL). After 80 minutes, benzyl chloroformate (10.0 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 ° C overnight, followed by the addition of water (80 mL) and concentrated hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature over 2 hours. The organic layer is separated. The aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give a colorless oil (48, 12.5 g, 78.3%). MS (ESI) [M + H⁺]⁺ = 280.0.

Step 2 - Preparation of 6-chloro-2-fluoro-3- (propane-1-sulfanylamino) -benzoic acid benzyl ester (49):

To 3-amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48, 1.20 g, 4.3 mmol) in methylene chloride (28 mL) was added pyridine (0.52 mL, 6.4 mmol) and propanesulfonyl chloride (48). 0.685 g, 4.8 mmol). The reaction was stirred at room temperature overnight, then poured into water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography to give a colorless oil (49.960 mg, 58.0%). MS (ESI) [MH⁺]' = 384.1.

KogakZ - Preparation of 6-chloro-2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (115):

To a 6-chloro-2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid benzyl ester (49.6.00 g, 15.6 mmol) in tetrahydrofuran (100 mL) was added a 1.0Μ aqueous solution of potassium

9?

52010 Β hydroxide (100 mL). The reaction was heated to reflux overnight. The reaction was poured into water, acidified to pH 2 with 1 N hydrochloric acid and extracted with ethyl acetate. The organic portion was dried over anhydrous sodium sulfate, filtered and concentrated to give a white solid 115 (3.95 g, 85.8%).

Step 4-Preparation of 2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (50):

To 6-chloro-2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (115, 0.69 g, 2.3 mmol) in methanol (10 mL) was added 20% palladium hydroxide on charcoal. ). The reaction was stirred under hydrogen at 50 psi for 2 hours. The reaction was filtered and concentrated to give a white solid 50 which was used in the next step. MS (ESI) [MH⁺] =260.1.

Step 5 - Preparation of 2-fluoro-3- (propane-1-sulfonylamino) -henzoic acid benzyl ester (501):

To 2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (50.5.05 g, 0.0193 mol) in methylene chloride (100 mL) was added N, N-dimethylformamide (0.075 mL, 0.97 mmol). under a nitrogen atmosphere. The reaction was cooled with ice / water, followed by the slow addition of oxalyl chloride (2.00 M in methylene chloride, 10.8 mL, 21.6 mmol). The reaction mixture was stirred at room temperature for 3.0 hours. The reaction was cooled with ice / water, followed by the slow addition of methanol (36.0 mL, 0.89 mol). The reaction was stirred at room temperature overnight. The reaction was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give a crude white solid of 4.0 g.

Step 6 - Preparation of propane-1-sulfonic acid (2-fluoro-3-hydroxymethyl-phenyl) -amide (502):

To 2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid methyl ester (501, 3.80 g, 13.8 mmol) in tetrahydrofuran (133 mL) was added lithium tetrahydroaluminate (1.00 M in tetrahydrofuran, 20.0 mL, 20.0 mmol) under a nitrogen atmosphere at room temperature. The reaction was stirred at room temperature for 8 hours, followed by the addition of 10 g NaSO / 10Hz. After 12 h, the reaction was filtered, concentrated and purified by silica gel column chromatography eluting with 5% methanol in methylene chloride to give a white solid (502, 3.0 g, 87.9%).

52010 Β

Step 7 - Preparation of propane-1-sulfonic acid (2-fluoro-3-formyl-phenyl) -amide (503):

Propane-1-sulfonic acid (502, 0.20 g, 0.81 mmol) in tetrahydrofuran (5.0 mL) was added to Dess-Martin periodinane (0.377 g, 0.89 mmol) to [220-fluoro-3-hydroxymethyl-phenyl) -amide. . The reaction was stirred at room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over organically anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a white solid (503, 100 mg, 50.0%). MS (ESI) [MH⁺]⁺= 244.1.

Step 8 - Preparation of {3 - [(5-bromo-1H-pyrrolo [2,3-b] pyridin-3-yl) -hydroxy-methyl] -2-fluorophenyl-amide propane-1-sulfonic acid (504):

Propane-1-sulfonic acid 2-fluoro-3-formyl-phenyl-amide was added to 5-bromo-7-azaindole 67 (312 mg, 1.58 mmol) in methanol (28 mL) (503, 370 mg, 1.5 mmol) and potassium hydroxide (422.8 mg, 7.5 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the desired compound as a white solid (504, 300 mg, 45.0%).

Step 9 - Preparation of propane-1-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-0955):

Propane-1-sulfonic acid U {3 - [(5-bromo-1H-pyrrolo [2,3-b] pyridin-3-yl) -hydroxy-methyl] -2-fluoro-phenyl} -amide , 0.650 g, 1.47 mmol) in ice / water cooled tetrahydrofuran (25.0 mL) was added Dess-Martin periodinane (0.748 g, 1.76 mmol). The reaction was stirred at room temperature for 15 minutes. The reaction was poured into water containing sodium thiosulfate and potassium carbonate and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane and washed with ethyl acetate to give a white solid. (P-0955.0.35 g, 54.1%). MS (ESI) [M + N⁺]⁺ = 460.0,462.0.

Butane-1-sulfonic acid [0209] [3- (5-Chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluorophenyl] -amide P-1250

52010 Β

<img file="RS52010B_D0043.tif" />

was prepared by following the protocol of Scheme 37, substituting propane-2-sulfonyl chloride with butane-1-sulfonyl chloride in Step 1 and 5-bromo-1H-pyrrolo [2,3-b] pyridine 67 with 5-chloro-1H-pyrrolo [2 , 3-b] pyridine 80 (see Example 9) in Step 8. MS (ESI) [M - H⁺]' = 408.1.

Propane-1-sulfonic acid [2-Fluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide P-1256

<img file="RS52010B_D0044.tif" />

protocol from was prepared by monitoring by substitution of 5-bromo-1H-pyrrolo [2,3-b] pyridine 67 with 5-methoxy-1H-pyrrolo] 2,3-b] pyridine 104 (see Example 16) in Step 8.

MS (ESI) [MH⁺]'=390.1.

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluoro-phenyl] benzenesulfonamide

P-1255

<img file="RS52010B_D0045.tif" />

was prepared following the protocol of Scheme 37, by substituting propane-2-sulfonyl chloride with benzenesulfonyl chloride in Step 1 and 5-bromo-1H-pyrrolo [2,3-b] pyridine 67 with 5-chloro-1H-pyrrolo [2,3-b ] pyridine 80 (see Example 9) in step 8. MS (ESI) [M - H⁺]’ = 428.0.

52010 Β

Example 16: Synthesis of 3-3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3b] pyridin-5-yl-propionic acid P-1270 [0212] Compound P-1270 was synthesized in three steps from [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amidapropane-1-sulfonic acid P- 0773 as shown in Scheme 38.

Scheme 38

<img file="RS52010B_D0046.tif" />

<img file="RS52010B_D0047.tif" />

<img file="RS52010B_D0048.tif" />

Step 1- Preparation of (E) -3-3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl-acrylic acid methyl ester (505):

Propane-1-sulfonic acid U [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide [P-0773, 125.0 mg , 0.27 mmol, prepared as described in Example 4) in N, N-dimethylformamide (4.0 mL) was added palladium acetate (15 mg, 0.068 mmol), triphenylphosphine (36 mg, 0.14 mmol), methyl acrylate (0.098 mL, 1.1 mmol) and triethylamine (0.114 mL, 0.82 mmol) under a nitrogen atmosphere. The reaction was stirred at 140 ° C overnight, then poured into water, acidified with water and extracted with ethyl acetate. To the filtrate in methylene chloride (5.0 mL) was added 1,8-diazabicyclo [5.4.0] undec-7-ene (0.50 mL, 3.3 mmol). The reaction was stirred at room temperature for 3 hours. The reaction was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give a light yellow oil which was used directly in the next step.

о52010Β

Step 2 - Preparation of 3-3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3 b] pyridin-5-yl-acrylic acid (P-1269) :

(E) -3-3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl- (methyl ester) acrylic acid (100.0 mg, 0.22 mmol) in tetrahydrofuran (5.0 mL) and water (1.50 mL) was added lithium hydroxide (21 mg, 0.86 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water, acidified with 1N HCl to pH about 1, and then extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a white solid (P-1269, 30 mg). MS (ESI) [MH⁺]' = 448.0.

Step 3-3- (2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl-propionic acid (P-1270):

U 3-3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-ylacrylic acid (P-1269, 20.0 mg, 0.045 mmol) in methanol (5.0 mL) was added 20% Pd (OH) 2 / C (10 mg) under a hydrogen atmosphere. The reaction was stirred at room temperature for 2 hours. The reaction mixture was filtered, concentrated and purified by silica gel column chromatography eluting with 10% methanol in methylene chloride to give a white solid (P-1270, 8.8 mg). MS (ESI) [M-1] + - 450.1.

Example 17: Synthesis of Thiophene-2-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide Compound 512 was synthesized in four steps from 2,4-difluorophenylamine 42 as shown in Scheme 39 .

Scheme 39

<img file="RS52010B_D0049.tif" />

52010Β

Step I - Preparation of 3-amino-4,2-difluoro-benzoic acid ethyl ester (509):

To 4,2-difluoro-phenylamine (42, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), which was cooled with a dry ice / acetone bath under a nitrogen atmosphere, n-butyl lithium was added slowly. M in hexane, 24.4 mL). After 20 minutes, 1,2-Bis- (chloro-dimethyl-silanyl) -ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was added slowly to the reaction. After 1 h, n-butyl lithium (2.50 M in hexane, 25.0 mL) was added slowly to the reaction. The reaction was stirred at -78 [deg.] C. for 20 minutes and then allowed to warm to room temperature over 60 minutes. The reaction was cooled to -78 ° C, followed by the slow addition of n-butyl lithium (2.50 M in hexane, 26.0 mL). After 80 minutes, ethyl chloroformate (6.69 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 ° C overnight, followed by the addition of water (80 mL) and concentrated hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature over 2 hours. The organic layer is separated. The aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give a colorless oil (509, 4.6 g, 39%). MS (ESI) [M + H⁺]⁺= 218.1.

Step 2 - Preparation of 2,6-difluoro-3- (thiophene-2-sulfonylamino) -benzoic acid ethyl ester (510):

Pyridine (0.52 mL, 6.4 mmol) and thiophene-2-sulfonyl were added to 3-amino-2,4-difluoro-benzoic acid ethyl ester (509, 1.20 g, 5.93 mmol) in methylene chloride (28 mL). chloride (0.97 g, 5.38 mmol). The reaction was stirred at room temperature overnight, then poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give a colorless oil (510, 1.2 g, 65.0%). MS (ESI) [M + H⁺]⁺= 348.2.

Step 3 - Preparation of thiophene-2-sulfonic acid (2,4-difluoro-3-hydroxymethyl-phenyl) -amide (511):

To 2,6-difluoro-3- (thiophene-2-sulfonylamino) -benzoic acid ethyl ester (510.1.6 g, 3.5 mmol) in tetrahydrofuran (25.0 mL) was added lithium tetrahydroaluminate (1.00 M uc?

52010 Β tetrahydrofuran, 8.08 mL, 8.08 mmol) under a nitrogen atmosphere at room temperature. The reaction was stirred at room temperature for 8 hours, followed by the addition of 10 g of NaSO 4. After 12 h, the reaction was filtered, concentrated and purified by silica gel column chromatography eluting with 5% methanol in methylene chloride to give a white solid (511, 300.0 mg, 21.0%).

Step 4 - Preparation of thiophene-2-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide (512):

Thiophene-2-sulfonic acid (511, 0.46 g, 1.52 mmol) in tetrahydrofuran (5.0 mL) was added to the (2,4-difluoro-3-hydroxymethyl-phenyl) -amide in tetrahydrofuran (5.0 mL) (0.71g, 1.67 mmol). The reaction was stirred at room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a white solid (512.100 mg, 21%). MS (ESI) [M + II⁺]⁺ = 304.2.

Thiophene-3-sulfonic acid (2,4-Difluoro-3-formyl-phenyl) -amide 513

<img file="RS52010B_D0050.tif" />

was prepared following the protocol of Scheme 39, by substituting thiophene-2-sulfonyl chloride with thiophene-3-sulfonyl chloride in Step 2. MS (ESI) [Μ + 11⁺]⁺ = 304.2.

N- (2,4-Difluoro-3-formyl-phenyl) -3-fluoro-benzenesulfonamide 578

<img file="RS52010B_D0051.tif" />

was prepared by following the protocol of Scheme 39, by substituting thiophene-2-sulfonyl chloride with 3 fluoro-benzenesulfonyl chloride in Step 2.

52010 Β

Example 18: Synthesis of (3-Benzyloxy-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [23 b] pyridin-3-yl) -methanone P-1467 and related compounds Compound P-1467 was synthesized in four steps from 2,4-difluorophenol 35 as shown in Scheme 43.

<img file="RS52010B_D0052.tif" />

Step 1 - Preparation of 1-Benzyl () xy-2,4-difluoro-benzene (525):

To 2,4-difluoro-phenol (35, 7.60 g, 0.0584 mol) in N, N-dirnethylfluoroamide (50.0 mL) were added benzyl bromide (8.0 mL, 0.067 mol) and potassium carbonate (9.00 g, 0.0651 mol). ) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound as a white solid (525, 3.20 g, 25%).

Step 2 - Preparation of 3-Benzyloxy-2,6-difluoro-benzaldehyde (526):

To 1-Benzyloxy-2,4-difluoro-benzene (525, 3.00 g, 13.6 mmol) in tetrahydrofuran (48 mL) under a nitrogen atmosphere and cooled with dry ice / acetone was added n-Butyl lithium (1.60 M in hexane, 8.94 mL). After 20 minutes, N, N-dimethylformamide (1.46 mL, 0.0189 mol) was added to the reaction. After another 20 minutes, the contents of the vessel were stirred at room temperature

101

52010 Β minutes. The reaction mixture was poured into water, acidified to pH = 1, and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound as a yellow solid (526.2.5g, 74%).

Step 3 - Preparation of (3-Benzyloxy-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanol (527):

To 5-Pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine (89, 750.0 mg, 0.003842 mol, prepared as in Example 17) in methanol (20.0 mL) was added 3-Benzyloxy- 2,6-Difluoro-benzaldehyde (526, 1.12 g, 4.5 mmol) and potassium hydroxide (1.50 g, 0.0267 mol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight and then poured into water, acidified with 1N HCl to pH about 2 and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound (527.700 mg, 35%).

Step 4 - Preparation of (3-Benzyloxy-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin3-yl) -methanone (P-1467):

U (3-Benzyloxy-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) methanol (527, 300.0 mg, 0.68 mmol) in tetrahydrofuran (10.0 mL) was added Dess-Martin peiodynan (344 mg, 0.81 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction mixture was concentrated on silica and purified by column chromatography on silica gel eluting with 10% methanol in dichloromethane to give the compound (P-1467,240 mg, 80%). MS (ESI) [M + H⁺]⁺ = 442.2.

Additional compounds were prepared by following steps 3 and 4 of Scheme 43, replacing 3-benzyloxy-2,6-difluorobenzaldehyde 526 with the appropriate aldehyde and / or pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine 89 with the appropriate azaindole in Step 3. The azaindols used were synthesized as described in Examples 9 or 16. The aldehydes used were synthesized as described in Example 5 or 21. Following this procedure, the following compounds were prepared:

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-trifluoromethylbenzenesulfonamide (P-1541),

102

52010Β

N- [2,4-Difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-trifluoromethyl-benzenesulfonamide (P-1542),

N- [2,4-Difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -3-fluorobenzenesulfonamide (P-1581),

N- [2,4-Difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-fluorobenzenesulfonamide (P-1582),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-fluorobenzenesulfonamide (P-1583),

N- [2,4-Difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -3-trifluoromethyl-benzenesulfonamide (P-1598), and

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-trifluoromethylbenzenesulfonamide (P-1599).

The following table shows the aldehyde (column 2) and azaindole (column 3) used to prepare the target compound (column 4). Column 1 gives the number of compounds and column 5 the recorded mass.

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Uniting</td><td>MS (ESI) [Μ + (⁺]⁺will notice η</td>

<td>P-1541</td><td>A HF Ν-θ = Ο n o</td><td>^N you</td><td>η ο Η</td><td> 516.2</td>

<td>P-1542</td><td>X ^{n F} ry °</td><td></td><td>”Αυ ”'¹ Η</td><td> 512.2</td>

<td>P-1581</td><td>h Cr^F1 FH 0</td><td>Ά *,</td><td>F 1 D ^F n ο f NN 'Η</td><td> 462.2</td>

<td>P-1582</td><td>F vn 9 N</td><td></td><td>ζ Γ) F η ο NN Η</td><td> 462.2</td>

103

52010 Β

<td>P-1583</td><td>T mFm-S = O ^H F Η O</td><td></td><td>'Nf] Η ο</td><td> 466.1</td>

<td>P-1598</td><td>_F Q^CF3 n \ R [G ^ o F Η O</td><td>Ο \</td><td>and W?_yes&lt;) G0Š CF, N I</td><td> 510.1</td>

<td>P-1599</td><td>GT^ST' T_oⁿ F iT</td><td>^Ν Η</td><td>_α^φ_yes-Ο ΥΠ F Η &lt;3CF, Μ</td><td> 514.0</td>

Example 19. Synthesis of 3- (3-Benzyloxy-2,6-difluoro-benzyl) -5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine P-1455:

Compound P-1455 was synthesized in four steps from 2,4-difluorophenol 35 as shown in Scheme 43a.

Scheme 43a

<img file="RS52010B_D0053.tif" />

Steps 1-3 are the same as Steps 1-3 of Scheme 43.

104

52010 Β

Step 4-Preparation of 3- (3-Benzyloxy-2,6-difluoro-benzyl) -5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine (P-1455):

U (3-Benzyloxy-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) methanol (527, 580.0 mg, 1.3 mmol) in acetonitrile (29.0 mL) was added trifluoroacetic acid (1.9 mL, 0.025 mol) and triethylsilane (3.9 mL, 0.024 mol). The reaction was stirred at 80 ° C for 1 hour. The reaction was poured into water, basified with 1 M potassium carbonate to pH = 4, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 50% ethyl acetate in hexane to give a yellow solid (P-1455, 530 mg). MS (ESI) [M + NT = 428.3.

Additional compounds were prepared by monitoring cognac 3 and 4 of Scheme 43a, replacing 3-benzyloxy-2,6-difluoro-benzaldehyde 526 with the corresponding aldehyde and / or pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine 89 with with the appropriate azaindole (see Example 9 or Example 16) in Step 3. The following compounds were prepared by following this procedure:

N- [2,4-Difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridin-3-ylmethyl) -phenyl] -3-trifluoromethylbenzenesulfonamide (P-1590), and

N- (2,4-Difluoro-3- (5-chloro-1H-pyrrolo [2,3-b] pyridin-3-ylmethyl) -phenyl [-3-trifluoromethylbenzenesulfonamide (P-1600).

The following table shows the aldehyde (column 2) and azaindole (column 3) used to prepare the target compound (column 4). Column 1 shows the number of compounds and column 5 the recorded mass.

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Product</td><td>MS (ESI) [M + H⁺]⁺observed</td>

<td>P- 1590</td><td>_F QCF₃nuuνΛ^{= Ο}F Η Ο</td><td>Α'ζχ C²o \</td><td></td><td></td>

<td>P- 1600</td><td>_o ύ (Υ * ' ⁿ / »V</td><td>^CIO3</td><td>Η</td><td></td>

105

52010 Β

Example 20: Synthesis of 3- (2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo] 2,3-b] pyridine-5-carboxylic acid ethylamide P-1630 Compound P- 1630 was synthesized in six steps from 5-bromo-1-triisopropylsilyl-7azaindole 68 as shown in Scheme 45.

Scheme 45

<img file="RS52010B_D0054.tif" />

<img file="RS52010B_D0055.tif" />

<img file="RS52010B_D0056.tif" />

Step 1-Preparation of 1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (531):

IJ 5-bromo-1-triisopropylsilyl-7-azaindole (68, 1.50 g, 4.2 mmol, prepared as described in Example 6) in tetrahydrofuran (20.0 mL) under a nitrogen atmosphere, cooled with dry ice / acetone, lightly n-Butyl lithium (10.0 M in hexane, 0.467 mL) was added. After 60 minutes, methyl chloroformate (0.394 mL, 5.1 mmol) was added to the reaction. After another hour, the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the crude compound as a light yellow solid which was used directly in the next step.

106

52010 Β

Step 2 - Preparation of 1H-Pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (532):

[0236 | To 1-triisopropylsilanyl-1H pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (531, 0.950 g, 2.9 mmol) in tetrahydrofuran (20.0 mL) was added tetrabutyl ammonium fluoride trihydrate (1.20 g, 3.8 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction was concentrated and purified by silica column chromatography eluting with 4% methanol in methylene chloride to give the compound as a white solid (532, 300 mg, 60%). MS (ESI) [M + H⁺]⁺ = 177.2.

Step 3 - Preparation of 3- [2,6-difluoro-3- (propane-1-sulfonylamino) -phenyl] -hydroxymethyl-1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (P-1545 ):

To 1H-Pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (532, 155.0 mg, 0.88 mmol) in methanol (15.0 mL) was added 2,4-difluoro-3-fornyl- Propane-1-sulfonic acid phenyl) -amide (73, 260.0 mg, 0.99 mrnol, prepared as described in Example 7) and potassium hydroxide (859 mg, 15.3 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound as a white solid (P-1545, 110 mg, 28%). MS (ESI) [M + H⁺]⁺ =

440.2.

Step 4 - Preparation of 3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (P-15S2):

3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -phenyl] -hydroxy-methyl-1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (P- 1545, 100.0 mg, 0.23 mmol) in tetrahydrofuran (1.0 mL) was added Dess-Martin periodinane (107 mg, 2.5 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction mixture was concentrated on silica gel and then purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give the compound as a white solid (P-1552, 80 mg, 80%). MS (ESI) [M + H⁺]⁺ =

438.2.

107

52010 Β

Step 5 - Preparation of 3- (2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3b] pyridine-5-carboxylic acid (P-1559):

3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3b] pyridine-5-carboxylic acid methyl ester (P-1552, 80.0 mg, 0.18 mmol) in tetrahydrofuran (10.0 mL) was added water (3.0 mL) and lithium hydroxide (82 mg, 3.4 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water, acidified with 1N HCl to pH about 1, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered, concentrated and washed with ethyl acetate to give an off-white solid (P1559, 60 mg, 77%) MS (ESI) [M + 1G]⁺ = 424.2.

Step 6: Preparation of 3-1,2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-h] pyridine-5-carboxylic acid ethylamide (P-1630):

In 3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid (P-1559, 38.0 mg, 0.090 mmol) ) in tetrahydrofuran (2.3 mL) was added a solution of ethylamine (2.0 M in tetrahydrofuran, 0.20 mL), bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (80.0 mg, 0.17 mmol) and triethylamine (0.30 mL, 2.2 mmol) under a nitrogen atmosphere. The reaction mixture was stirred overnight at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 40% ethyl acetate in hexane to give the compound as a white solid (P-1630, 13.2 mg, 33%). MS (ESI) [M-1E] = 449.0.

Example 21: Synthesis of N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenyl]

3,5-Difluorobenzenesulfonamide P141 Compound P-1841 was synthesized in six steps from 2,4-difluoroaniline 42 as shown in Sem 67.

108

52010 Β

Scheme 67

<img file="RS52010B_D0057.tif" />

<img file="RS52010B_D0058.tif" />

Step 1 - Preparation of 2,4-trifluoro-phenyl-carcamic acid henzyl ester (613):

To 2,4-difluoroaniline (42.7.0 mL, 0.070 mol) in 100 mL dichloromethane was added pyridine (11 mL, 0.14 mol) and benzyl chloroformate (11.9 mL, 0.0834 mol). The reaction mixture was stirred at ambient temperature for 1.5 hours. The reaction mixture was concentrated under reduced pressure and the residue was partitioned between ethyl acetate and KHSO solution.₄. The organic layer was dried (MgSO 4)₄), concentrated and crystallized from hexane to give compound 613 (15.6 g, 85%).

Step 2 - Preparation of 2,4-difluoro-3-formyl-phenyl-carbamic acid benzyl ester (614):

To a round bottom flask was added (2,4-difluoro-phenyl) -carbamic acid benzyl ester (613, 3.83 g, 14.5 mmol) in tetrahydrofuran (148 mL, 1.82 mol). The solution was cooled to -78 ° C and n-butyl lithium (1.60 M in hexane, 19.1 mL, 30.0 mmol) was added over 30 minutes, followed by the addition of N, N-dimethylformamide (1.12 mL, 14.5 mol). The reaction mixture was allowed to warm to ambient temperature and stirred overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and crystallized from ether to give compound 614 (3.0 g, 71%).

109

52010 Β

Step 3 Preparation of {2,4-difluoro-3- [hydroxy- (1H-pyrrolo [2,3-b] pyridin-3-yl) pyridin] -phenyl} -carbamic acid benzyl ester (615):

To a round bottom vessel was added 5-chloro-1H-pyrrolo [2,3-b] pyridine (80, 0.524 g, 3.43 mmol, prepared as described in Example 9) in methanol (5.00 mL, 0.123). mol). Potassium hydroxide (0.800 g, 14.2 mmol) and 2,4-difluoro-3-formyl-phenyl) carbamic acid benzyl ester (614.1.02 g, 3.5 mmol) were added and the reaction mixture was stirred overnight. The reaction mixture was poured into 1N HCl and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and crystallized from ethyl acetate to give compound 615 (710 mg, 46%). MS (ESI) [M + H⁺]⁺ - 444.

Step 4 - Preparation of 2,4-difluoro-3- [1H-pyrrolol2,3-b] pyridine-3-carbonyl) -phenyl] carbamic acid benzyl ester (616):

2,4-Difluoro-3- [hydroxy- (1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -carbamic acid benzyl ester was added to a round-bottomed vessel. , 1.01 g, 2.28 mmol) in tetrahydrofuran (5.00 mL, 0.0616 mol) Dess-Martin periodinane (1.20 g, 2.89 mmol) was added portionwise and the reaction mixture was stirred at ambient temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and purified by column chromatography on silica gel to give compound 616 (914 mg, 91%). MS (ESI) [M + H⁺]⁺ = 442.

Step 5 - Preparation of (3-Amino-2,6-difluoro-phenyl) - (5-chloro-1H-pyrrolo [2,3-b] pyridin-3-yl) methanone (P-1801):

[2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -carbamic acid benzyl ester (616, 800 mg, 1.81 mmol) was added in 10 M NaOH (15.00 mL) and heated to reflux overnight. The reaction mixture was diluted with 30 mL of water and extracted with ethyl acetate to give compound P-1801 (450 mg, 81%).

110

52010 Β

Step 6-Preparation of N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4 difluoro-phenyl] -3,5-difluorohenzenesulfonamide (P-1841) The microwave reaction vessel was coupled to (3-amino-2,6-difluoro-phenyl) - (5-chloro-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone (P-1801, 50 mg, 0.16 mmol). ), 3,5-difluorobenzenesulfonyl chloride (610, 103 mg, 0.49 mmol), pyridine (0.5 mL, 6.1820 mol) and tetrahydrofuran (3.0 mL). The reaction was heated in a CEM microwave at 300 watts, 130 ° C for 10 minutes. The reaction mixture was partitioned between ethyl acetate and brine. The organic layer was collected, dried over Na₂SO₄, filtered and concentrated. Compound (P-1841) was isolated by column chromatography (silica, hexanethyl acetate 70:30) to give 36 mg (46%) of the compound. MS = 482.0.

Additional compounds were prepared by following the protocol of Scheme 67 Step 6, optionally by substituting (3-Amino-2,6-difluoro-phenyl) - (5-chloro-1H-pyrrolo [2,3-b] pyridin-3- yl) -methanone P-1801 with (3-Amino-2,6-difluoro-phenyl) - (1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone P-2021 (prepared according to Scheme 67 Steps 1-5, by substituting 5-chloro-1H-pyrrolo [2,3-b] pyridine 80 with 1H-pyrrolo [2,3-b] pyridine 94 in Step 3) and / or 3,5-difluorobenzenesulfonyl chloride 610 with the appropriate sulfonyl chloride. The following compounds were prepared by this procedure:

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-isopropylbenzenesulfonamide (P-1839),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -benzenesulfonamide (P0913),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -3-nitro-benzenesulfonamide (P-1937),

N- {4- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenylsulfamoyl] -phenyl} acetamide (P-1938),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-methoxybenzenesulfonamide (P-0958),

5- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenylsulfamoyl] -furan2-carboxylic acid methyl ester (P-1941),

5- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenylsulfamoyl] -2-methyl-furan-3-carboxylic acid methyl ester (P-1942), [2, 5-Oxazol-5-yl-thiophene-2-sulfonic acid 4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-1943),

111

52010 5-Isoxazol-5-yl-thiophene-2-sulfonic acid (2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl-amide (P-1948),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -2,4-dimethoxybenzenesulfonamide (P-1951), f2,4-difluoro-3 2,5-Dimethyl-thiophene-3-sulfonic acid (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-1952), [2,4-difluoro-3- 2,5-Dimethyl-furan-3-sulfonic acid pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-1953),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -2-methyl-benzenesulfonamide (P-1954), [2,4-difluoro- 2,3-Dihydrobenzo [1,4] dioxine-6-sulfonic acid 3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-1955), [2,4 2,4-Dimethyl-thiazole-5-sulfonic acid-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-1956),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-trifluoromethylbenzenesulfonamide (P-0931),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -5-fluoro-2-methylbenzenesulfonamide (P-1961),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -3-methyl-benzenesulfonamide (P-1962),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-oxazol-5-ylbenzenesulfonamide (P-1963),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -2,5-dimethoxybenzenesulfonamide (P-1131),

2-Cyano-N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-1965),

3-Cyano-N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-1966),

N- [2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-isopropylbenzenesulfonamide (P-1968), [2,4-difluoro-3- Benzothiazole-6-sulfonic acid (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-1969),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-methoxybenzenesulfonamide (P-2011),

112

52010 Β

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -benzenesulfonamide (Ρ-0885), [3- (5-chloro) Thiophene-2-sulfonic acid-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1267),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-methylbenzenesulfonamide (P-1842),

N- {4- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenylsulfamoyl] phenyl} -acetamide (P-1905),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-methoxybenzenesulfonamide (P-0983),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-trifluoromethylbenzenesulfonamide (P-1599),

5- [3- (5-Chloro-11-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenylsulfamoyl] -furan-2-carboxylic acid methyl ester (P-1907),

M ethyl ester 5- [3- (5-chloro-l H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorofenilsulfamoil] -2-methylfuran-3-carboxylic acid (P-1908 ), 1,2-Dimethyl-1H-imidazole-4-sulfone] [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide acids (P-1911),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -2-fluorobenzenesulfonamide (P-1912),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-difluoromethoxybenzenesulfonamide (P-1916),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -2,4-dimethoxybenzenesulfonamide (P-1918), [3- 2,5-Dimethylthiophene-3-sulfonic acid (5-chloro-1H-pyrrolo [2,3, b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1919), 2,5-Dimethylfuran-3-sulfonic acid (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1920),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenyl] -2-methylbenzenesulfonamide (P-1921), [3- (5-chloro) 2,3-Dihydrobenzo [1,4] dioxine-6-sulfonic acid -1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1922), 2,4-Dimethylthiazole-5-sulfonic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1923) ,,

113

52010 Β

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -2,4-difluorobenzenesulfonamide (P-1926),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -5-fluoro-2-methylbenzenesulfonamide (P-1927),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-methylbenzenesulfonamide (P-1928),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -2,5-dimethoxybenzenesulfonamide (P-1929),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -2-cyanobenzenesulfonamide (P-1931), and

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-cyanobenzenesulfonamide (P-1932).

The following table shows the azaindole (column 2) and sulfonyl chloride (column 3) used to prepare the target compound (column 4). The number of compounds is given in column 1, with the recorded mass given in column 5.

<td></td><td>Azaindole</td><td>Sulfonyl chloride</td><td>Uniting</td><td>MS (ESI) [M + H¹] 'recorded</td>

<td>P1839</td><td>^ciYvTf ^NH2</td><td>s ^ a</td><td></td><td> 489.9</td>

<td>P- 0913</td><td></td><td>SO₂CI ό</td><td></td><td> 413.9</td>

<td>P1937</td><td>Fk fVVF ^NHz</td><td>bOgS! γ</td><td>au it ° NN</td><td> 459.1</td>

114

52010 Β

<td></td><td>Azaindole</td><td>Sulfonyl chloride</td><td>Uniting</td><td>MS (ESI) [M + H⁺]⁺observed</td>

<td>Ρ- 1938</td><td>Η.^ΝΗζ</td><td>SO₂CI 0 Ογ^ΝΗ</td><td>Η F 1 Λκ? ^Η ο NN</td><td> 471.1</td>

<td>Ρ0958</td><td>γΗ,</td><td>SO₂CI φ ζ °</td><td></td><td> 444.3</td>

<td>Ρ- 1941</td><td></td><td>so₂ci 00 ^ ζ °</td><td></td><td> 462.3</td>

<td>421942</td><td>N</td><td>SO_ZQ —0</td><td>&lt;Ο_νΟ ΓΧ $ ^F Η ο⁰• NN</td><td> 475.9</td>

<td>431943</td><td>Ύν</td><td>SO₂CI Ν ^ Ο</td><td>ΥΥ ιΥΥ-'ν, ρ 'Ν'θ'Ο ί £? ^F Η 0 NN</td><td> 487.1</td>

<td>481948</td><td>| Fγγ F νη_ζ</td><td>SO₂CI 4 p.m. N</td><td>Ν'Ν Ύ</td><td> 487.1</td>

<td>Ρ1951</td><td>f. fY $ F ΝΗ₂ν^ΛΝ</td><td>1 SOzCI ° χ</td><td>η Ύ ' W ° 10 ^{ρ HN}'^ o W ⁰</td><td> 473.9</td>

115

52010 Β

<td></td><td>Azaindole</td><td>Sulfonyl chloride</td><td>Uniting</td><td>MS (ESI) [m + n⁺]⁺observed</td>

<td>Ρ- 1952</td><td>sL ·</td><td>SO₂CI</td><td>NN</td><td> 447.9</td>

<td>Ρ- 1953</td><td></td><td>SO₂C1 X</td><td>(HGⁿNN</td><td> 432.3</td>

<td>Ρ1954</td><td>Ε. ρ ΝΗ₂</td><td>SO₂CI</td><td>| ίΜ&gt; ο</td><td> 427.9</td>

<td>Ρ1955</td><td>ΊΟ!</td><td>SO₂CI</td><td>F % -Ό Ύη Ύο ΥΓ'Ν 0</td><td> 472.3</td>

<td>Ρ- 1956</td><td>fV $ F ^ΝΗ2 ¹ν^λν</td><td>SO₂C1 S / V ) —N</td><td>- / v ° gm X m ^f «T ° NN</td><td> 448.7</td>

<td>Ρ0931</td><td></td><td>^ O₂CI CF₃</td><td>FP^F3 ^η ^^να? * ο N ⁰</td><td> 481.9</td>

<td>Ρ- 1961</td><td>e_^kN^AN</td><td>SO₂CI A</td><td>m N ⁰</td><td> 445.9</td>

<td>Ρ- 1962</td><td>ρΝΗ₂</td><td>SO₂C1 Ćk</td><td>ГгЧ ^{F ΗΝ}'** ο V^XNO</td><td> 427.9</td>

116

52010 Β

<td></td><td>Azaindole</td><td>Sulfonyl chloride</td><td>Uniting</td><td>MS (ESI) [m + nT] recorded</td>

<td>Ρ1963</td><td>F¹Μ^ΛΝ</td><td>SO2CI ό V ° N = /</td><td>_F l Qp ^^Nt °^Z</td><td> 481.1</td>

<td>Ρ- 1131</td><td>Ε.^ΝΗ2</td><td>. SO₂CI u 1</td><td>Vp ° Ό-₀ιίΜ&gt;</td><td> 473.9</td>

<td>Ρ- 1965</td><td></td><td>SO₂Ci Ćr “</td><td>° L&gt; Q V^XNO</td><td> 439.1</td>

<td>Ρ- 1966</td><td>F «_ Jun ^ΝΗζ</td><td>SO₂CI</td><td>Fv $ OCN F ^HN“^ O k n 0</td><td> 439.1</td>

<td>Ρ1968</td><td>Ε_ fV ^ F ^NH2</td><td></td><td></td><td> 456.3</td>

<td>Ρ- 1969</td><td>e_ fYS f^NHz</td><td>so₂o N = V</td><td>w da {fArA ^{F HN}'S''o ^ hF'N ⁰</td><td> 471.1</td>

<td>Ρ- 2011</td><td>^ciYVSf ^nh2</td><td>SO₂CI 1</td><td>ur Ђ ^αΞγξ fHN-S.'o No^Lm 0</td><td> 477.9</td>

<td>Ρ- 0885</td><td>R_ ^ciVyCf ^nh* SAn</td><td>so₂ci ό</td><td>Ο^{S, Č}AL Zhn-sC ^ Vn 0</td><td> 447.9</td>

117

52010 Β

<td></td><td>Azaindole</td><td>Sulfonyl chloride</td><td>Uniting</td><td>MS (ESI) [M + H⁺]⁺observed</td>

<td>Ρ- 1267</td><td></td><td>SO₂CI ό</td><td>Lj &amp; ° ^_{F St.}o</td><td> 453.9</td>

<td>Ρ1842</td><td></td><td>SO₂C1 Ψ</td><td>^α7η 7 * 7 * 0 * · | Γ · Ν ⁰</td><td> 462.3</td>

<td>Ρ1905</td><td>Ε_^ClF ^NH2</td><td>SO2CI f HN. _nr</td><td>d_F /^NH° γγν * 7 * ο WO</td><td> 505.1</td>

<td>Ρ0983</td><td></td><td>SO₂Cl f</td><td>\ F ζθ^C'YyVf ^ⁿ^ o</td><td> 477.9</td>

<td>Ρ1599</td><td>E_ Rope * '</td><td>so₂a</td><td>p CFj vO O Ύ 7 ^ 7¾</td><td> 515.9</td>

<td>Ρ- 1907</td><td>^kN ^ N</td><td>SO₂CI dz °</td><td>H 0 ° nn</td><td> 496.3</td>

<td>Ρ1908</td><td>R,^c,yyCp ^NHz</td><td>SO₂CI —0</td><td>-o_vo “Sad⁸1°</td><td> 509.9</td>

118

52010 Β

<td></td><td>Azaindole</td><td>Sulfonyl chloride</td><td>Jedinjenjc</td><td>MS (ESI) | Μ + (⁺]⁺observed</td>

<td>Ρ- 1911</td><td>ε,^no2</td><td>SO₂CI hA L \</td><td>^s,yes ^F ”T ° N ^N</td><td> 466.3</td>

<td>Ρ- 1912</td><td>^c,Y⁴ri ρ ^ΝΗ2</td><td>SO₂CI ćr</td><td>^FOh^agm&gt; VN 0</td><td> 465.9</td>

<td>161916</td><td>Sr ~ N</td><td>SO₂CI f, ° Ύ F</td><td>^Fο</td><td> 513.9</td>

<td>181918</td><td>^ciYyV ^^ΝΗζ</td><td>1 SO₂CI ° x</td><td>^C'io f ^ⁿS'O 0 * W ⁰</td><td></td>

<td>191919</td><td>^LN^AN</td><td>SO_ZCI 4</td><td>TH? ^Fnn</td><td> 481.9</td>

<td>201920</td><td></td><td>SO₂CI 4</td><td>000 ^ 0&gt; Cl \ / ixY0j M '8l-&gt; ΊΠη ^F «Δ NN</td><td> 465.9</td>

<td>Ρ- 1921</td><td>° όΑ '</td><td>SO₂CI Ćr</td><td> &lt;0 ^0,ϊΜ f ^hn'^ SeN O</td><td> 461.9</td>

<td>Ρ1922</td><td>Fv ^^CIY &gt;&gt; F ^NH2 004</td><td>SO₂CI 0</td><td>F. _ / ° L^0ΙΊΡγΛ Ζ · Η »ο V^xn ο</td><td> 505.9</td>

119

52010 Β

<td></td><td>Azaindole</td><td>Sulfonyl chloride</td><td>Uniting</td><td>MS (ESI) [m + nT] recorded</td>

<td>Ρ1923</td><td>Ε,^α.Ρ ^ΝΗ*</td><td>SO₂CI s / V) —N</td><td>\ ss \^S1G »°ί ° NN</td><td> 483.1</td>

<td>261926</td><td></td><td>so₂a f F</td><td>F &lt;_ p W * 0^{S |}tt4&gt; n-_zs,₀V% ⁰</td><td> 483.9</td>

<td>Ρ- 1927</td><td>Fv^C1YY $ F ^NH2</td><td>SO₂CI A</td><td>vO ^c,YYV ”^N^ o ^FV^xno</td><td> 479.9</td>

<td>Ρ1928</td><td>E. Vnf^NHz</td><td>SO₂CI a</td><td>uO 0. W 0</td><td> 461.9</td>

<td>Ρ- 1929</td><td>R.^cjYY5f nh₂</td><td>1 SO₂CI A 1</td><td>s ° Ό-ο Τη Τ * ®ο W 0</td><td> 507.9</td>

<td>311931</td><td>^{c /}YyVf^nh*</td><td>SO₂CI ćr</td><td>R _π &lt;bq γΜ&gt; f ™ -S »o^cnSrN Ο</td><td> 473.1</td>

<td>321932</td><td>Fk^αγγζ₽^ΝΗand</td><td>so₂ci a.</td><td>^FVx νΌ fi II Γ υ r ζζ'ο Vn 0</td><td> 473.1</td>

120

52010 Β

Example 22. Synthesis of {3- [5- (4-chloro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluorophenyl} -amide of propane-1-sulfonic acid P -0956 [0250 | Compound P-0956 was synthesized in three steps from propane-1-sulfonic acid 5- (4-chlorophenyl) -1H-pyrrolo [2,3b] pyridine 514 and (2,4-difluoro-3-formyl-phenyl) -amide 73 as shown in Semi 72.

Scheme 72

<img file="RS52010B_D0059.tif" />

Step 1 - Preparation of (3 - {[5- (4-chloro-phenyl) -1H-pyrrolo [2,3-b] pyridin-3-yl] -hydroxy-methyl} -2,4-difluoro-phenyl) -amidapropane- 1-sulfonic acid (632) and (3 - {[5- (4-chlorophenyl) -1H-pyrrolo [2,3b] pyridin-3-yl] -methoxy-methyl} -2,4-difluoro-phenyl) - amidapropane-1-sulfonic acid (633):

To a suspension of 5- (4-chloro-phenyl) -1H-pyrrolo [2,3-b] pyridine (514, 64.9 g, 158 mM, prepared as described in Example 17) and (2,4- Propane-1-sulfonic acid difluoro-3-formyl-phenyl) -amide (73, 90.4 g, 191 mM, prepared as described in Example 7) in methanol in a water bath was added potassium hydroxide (128.8 g, 1.28 M). The reaction was stirred for 72 hours at room temperature and then adjusted to pH 7 with 4N hydrochloric acid. The resulting mixture was evaporated in vacuo to remove methanol and extracted with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give a crude oil. The crude oil was triturated with 3: 1 MTBE / heptane to give a 1: 3 solid mixture of compounds 632 and 633 which was used directly for the next step.

121

52010 Β

Step 2 - Preparation of propane (3 - {[5- (4-chloro-phenyl) -1H-pyrrolo [2,3-b] pyridin-3-yl] -hydroxy-methyl} -2,4-difluoro-phenyl) -amide -1-sulfonic acids (632):

To a solution of compounds 632 and 633 (about 315 mM) in acetic acid was added 48% hydrobromic acid (final 8%). The resulting mixture was stirred overnight at room temperature and then evaporated in vacuo. The crude residue was absorbed with equal volumes of ethyl acetate and water, and adjusted to pH 7 with solid potassium carbonate. The layers were separated and the aqueous layer was extracted 2x with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give compound 632 as a viscous oil which was used directly for the next step.

Step 3 - Preparation of {3- [5- (4-chloro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluoro-phenyl} -amidapropane-1-sulfonic acid P-0956):

To a solution of compound 632 (pko 386 mM) in 1,4-dioxane was added 2,3-dichloro-5,6-dicyanobenzoquinone (83.8 g, 502 mM) followed by water (final 4.8%). The resulting mixture was stirred for 2 hours at room temperature and then quenched with one volume of saturated sodium bicarbonate. The mixture was evaporated in vacuo to remove 1,4-dioxane and extracted with Zh and ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give a crude solid which was purified on a silica gel column with 94: 5: 1 dichloromethane / methanol / ammonium hydroxide as eluent to give P-0956 (approximately 50 % yield in 3 steps) as a white solid.

Example 23: Synthesis of 3-Iodo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine 635 [0254] 3-Iodo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine 635 was synthesized in one step of 3-iodo-1H-pyrrolo [2,3-b] pyridine 634 as shown in Scheme 73.

Scheme 73

I

635

122

52010 Β

Step 1-Preparation of 3-Iodo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (635):

3-Iodo-1H-pyrrolo [2,3-b] pyridine 634 (2.00 g, 8.20 mmol) was dissolved in N, N-dimethylformamide (50 mL). Sodium hydride (60% dispersion in mineral oil, 390 mg, 9.8 mmol) was added. After 20 minutes, triisopropylsilyl chloride (1.74 mL, 8.20 mmol) was added dropwise. After 1.5 h, the reaction was poured into water and extracted with ethyl acetate, washed with saturated sodium bicarbonate and brine. The organics were dried over anhydrous sodium sulfate and concentrated. Purification by silica gel chromatography, with a 0-25% ethyl acetate / hexane gradient, gave compound 635 as a white solid (3.224 g, 98.2%). 1 N-NMR was consistent with the desired compound.

Example 24: Synthesis of 1- (tert-Butyl-dimethyl-silanyl) -3-iodo-1H-pyrrolo [2,3-b] pyridine 636 1- (tert-Butyl-dimethyl-silanyl) -3-iodo -1H pyrrolo [2,3-b] pyridine 636 was synthesized in one step from 3-iodo-1H-pyrrolo [2,3-b] pyridine 634 as shown in Scheme 74.

Scheme 74

<img file="RS52010B_D0060.tif" />

636

Step 1-Preparation of 1- (tert-Butyl-dimethyl-silanyl) -3-iodo-1H-pyrrolo [2,3-b] pyridine (636):

3-Iodo-1H-pyrrolo [2,3-b] pyridine 634 (1.1 μg, 4.6 mmol) was dissolved in tetrahydrofuran (120 mL). Sodium hydride (60% dispersion in mineral oil, 0.13 g, 5.5 mmol) was added followed by tert-butyldimethylsilyl chloride (0.85 g, 5.5 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic portion was washed with brine, dried over anhydrous sodium sulfate and filtered. Filtrate

123

52010 Β was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound as a white solid (636, 100 mg, 15%).

Example 25: Synthesis of 5- [4- (2-methoxyethoxy) -phenyl] -1H-pyrrolo [2,3-b] pyridine 648 [0258] 5- [4- (2-Methoxyethoxy) -phenyl] -1H-pyrrolo [2,3-b] pyridine 648 was synthesized in two steps from 4-bromophenol 646 as shown in Semi 77.

Scheme 77

<img file="RS52010B_D0061.tif" />

646

Vg

Step 1

<img file="RS52010B_D0062.tif" />

Step 1 - Preparation of 1-Bromo-4- (2-methoxy-ethoxy) -benzene (647):

To a solution of 4-bromophenol (646, 5.0 g, 28.9 mmol) in dimethylformamide (15 mL) was added potassium carbonate (4.40 g, 31.8 mmol) and 1-bromo-2-methoxyethane (5.00 g, 36.0 mmol) under nitrogen atmosphere. The reaction mixture was stirred at ambient temperature overnight and concentrated under reduced pressure. The residue was suspended in ethyl acetate (50 mL) and filtered. The filtrate was washed with saturated sodium bicarbonate solution, dried over magnesium sulfate and filtered. Silica gel column chromatography (0-10% ethyl acetate in hexanes) gave the desired compound as a colorless oil (647, 3.2 g, 48%).

Step 2 - Preparation of 5- [4- (2-Methoxy-ethoxy) -phenyl] -1H-pyrrolo [2,3-b] pyridine (648):

To a solution of 5- (4,4,5,5, -tetramethyl- [1,3,2] dioxaborolan-2-yl) -1H-pyrrolo [2,3-b] pyridine (1.1 g, 4.3 mmol) ) in tetrahydrofuran (40 mL) was added 1-bromo-4- (2-methoxy-ethoxy) -benzene (647, 1.50 g, 6.49 mmol) and tetrakis (triphenylphosphine) palladium (0) (0.25 g, 0.21 mmol).

The reaction mixture was stirred with potassium carbonate solution (10 mL, 1.0 M) and heated to reflux overnight. The biphasic reaction mixture was diluted with ethyl acetate (50 mL) and saturated sodium carbonate solution (20 mL). The organic layer was separated, washed with brine, dried over magnesium sulfate and purified by chromatography on

124

52010 Β Silica gel column (50-100% ethyl acetate in hexanes) to give the desired compound as a colorless solid (648, 782 mg, 67%). MS (ESI) [M + 1G]⁺= 267.4.

Example 25: Additional Compounds Additional compounds of the invention were synthesized by following the methods of the Examples above or similar methods, or by methods known to those skilled in the art, and are shown in the following Table 1.

P-1249

P-1670

P-1936

<img file="RS52010B_D0063.tif" />

Example 26: Kinase Activity Assays The effect of potential kinase activity modulators can be measured in various assays known in the art. For example, direct radiometric, indirect FRET, or AlphaScreen assays can be used to assess substrate phosphorylation levels in the presence of a test compound to determine the inhibitory effect of the compound on the kinase. Invitrogen (Carlsbad, CA) uses a FRET-based test for Btk, EGFR, EphB2, Flt3, Iraq4, Kdr, ΜΑΡ2Κ.1,

125

52010 Β

ΡΚΛΡΚΑΡΚΛΡΚ2, PDGFRB, PKCtheta, Stk6 and Yes. For these assays, the compounds of the invention were tested by Invitrogen using Z'-Lyte test kinase.

Briefly, the Invitrogen assay kinase comprises the administration of a specific peptide substrate optimized for each kinase, comprising a fluorophore at each end forming a FRET pair. The susceptibility of peptides to proteolytic cleavage depends on the phosphorylation of the peptide. The non-phosphorylated peptide was excised by protease, while the kinase phosphorylated peptide was not excised. Peptide cleavage breaks the FRET between the donor fluorophore (coumarin) and the recipient (fluorcscein), resulting in an increase in the ratio of donor to recipient emission. The ratio of coumarin emission to fluorescein was used to assess the progress of the reaction. The degree of phosphorylation is determined from the emission ratio, which is low when the kinase is active (phosphorylated peptide is not cut, FRET pair is bound) or high for inhibited kinase (non-phosphorylated peptide is cut, FRET pair is separated). Thus, the assay comprises a kinase reaction in the presence of various concentrations of a given compound, a developmental reaction with a site-specific protease, and the detection of the fluorescent emission ratio of coumarin and fluorscein. The emission ratio as a function of compound concentration was used to determine IC50 values. Reaction conditions for each kinase were determined to provide optimal reaction times, incubation temperature, kinase and ATP concentrations. Test samples were prepared in 1x kinase buffer (50 mM HEPES pH 7.5, 50 mM MgCl₂, 5 mM EGTA, 0.05% BRIJ-35) and the compound was prepared in the desired concentration in DMSO so that the final DMSO was equal to 1%. Test controls include 0% phosphorylation, which does not contain ATP, 100% phosphorylation control, which consists of a synthetically phosphorylated peptide, and 0% inhibition control, which contains active kinase conditions without compounds. Typically, test plates were prepared in a 10 μΐ final volume per sample, by adding 2.5 μΐ of compound at 4x desired concentrations in 4% DMSO (serial dilution of the compound provides a concentration curve), 5 μΐ of desired kinase mixed with Z'LYTE ™ peptide substrate (2x in 2x kinase buffer, final peptide in 2 μΜ), and 2.5 μΐ 4x ATP solution. All kinases except ΜΑΡ2Κ.1 were in 10 μΜ ATP in the kinase reaction, while ΜΑΡ2Κ1 was in 100 mM. The samples were mixed and the kinase reaction was incubated for 1 hour at room temperature, after which 5 μΐ of development solution was added and stirring was performed. After incubation for another 1 hour at room temperature, 5 μΐ stop reagent was added to each sample and mixed. Fluorescent signals were measured to determine the emission ratio.

The AlphaScreen assay was used to examine additional kinases. The assay is similarly dependent on the phosphorylation of the peptide substrate. In this assay, an antibody that recognizes a phosphorylated substrate is bound to an acceptor bead. The peptide substrate is bound to biotin, which binds to the streptavidin-containing donor bead. In this way, the phosphorylated substrate is bound to

126

52010 Β antibody and streptavidin, bringing the donor and recipient beads in close proximity when the kinase is not inhibited. The donor produces singlet oxygen which results in emissions from the receiver when they are in close proximity. Conversely, when the kinase is inhibited, the donor and recipient beads are not connected and the emission from the recipient is reduced. A fluorescent signal according to the concentration of the compound was used to determine the IC50 value.

Genetic Engineering Some kinase assays require kinase preparation. Plasmids encoding kinase enzyme selection were constructed using polymerase chain reaction (PCR) procedures. The relevant DNA sequences and coded protein sequences used in the assay are shown for each (see below). Complement DNA cloned from various human tissues was purchased from Invitrogen, and it was used as a substrate in PCR reactions. Specific conventional synthetic oligonucleotide primers (see Invitrogen below) are designed to initiate PCR product, and also to provide appropriate cut-off sites with a restriction enzyme for ligation with plasmids. In selected cases, additional oligonucleotide pairs (see below) were used to introduce mutations into the coding sequence to change the sequence for enzymatic activation (BRAF), to remove problematic surface Cys residues (FGFR1), or to disable ATR binding capacity. -a (MEK1 substrate).

In the case of KIT, the entire enzyme-encoding sequence is made via a genetic synthesis method, using conventional synthetic oligonucleotides covering the entire coding sequence (Invitrogen).

The plasmids used for ligation with kinase-encoding inserts were pET (Novagen) derivatives for expression using E. Coli or pFastBac (Invitrogen) for expression using baculovirus infection of insect cell cultures. In each of these cases, the kinase was constructed to include histidine marker for purification using metal affinity chromatography.

In some cases, plasmids encoding a kinase have been constructed as bicistronic mRNA to co-express another protein that modifies the kinase protein during its expression in the host cell. In the cases of Abl, FGFR1, Flt1, Kdr, Kit, Met, Ret and Src, the protein tyrosine phosphatase 1B (PTP) was co-expressed for phosphotyrosine dephosphorylation. In the case of ERK2, the activated form of ΜΕΚ.1 (MEKIDD) is co-expressed for phosphorylation and activation of ERK2. In the case of p38a, the activated form MEK.6 (MKK.6) is co-expressed for

127

52010Β phosphorylation and activation of p38a. In the case of BRAF, chaperone CDC37 was co-expressed for more efficient folding of the BRAF protein.

Plasmids encoding substrate phosphorylation proteins were expressed as non-terminal GST fusions and C-terminal biotinylation fusions, using pGEX vectors (Amersham) modified to include sequences encoding C-termination biotinylation markers. These substrates include ΜΕΚ1, a substrate for BRAF, and BAD, a substrate for Piml.

Protein expression in E. coli and purification For protein expression, plasmids containing genes of interest were transformed into E. coli strains BL21 (DE3) RIL or pLyS (Invitrogen) and transformants selected for growth on LB agarose plates containing the appropriate antibiotics. Individual colonies were grown overnight at 37 ° C in 200 ml TB (Terrific broth) medium. 16xlL of fresh TB medium in 2.8L dishes were inoculated with 10 ml overnight culture and grown with constant shaking at 37 ° C. After the cultures reached an absorbance of 1.0 at 600 nm, IPTG was added and the cultures were allowed to grow for an additional 12 to 18 hours at temperatures in the range of 1230 ° C. Cells were collected by centrifugation and pellets were frozen at -80 ° C until ready for lysis.

For protein purification; frozen precipitates of E. coli cells were suspended in lysis buffer and lysed using standard mechanical procedures. Soluble proteins were purified via poly-Histidine labels using immobilized metal affinity purification IMAC. In the case of all kinases described herein, all were purified using a 3-step purification procedure using IMAC, exclusion chromatography and ion exchange chromatography. In most cases, the poly-histidine label was removed using thrombin (Calbiochem).

In some cases, the purification protocol required modifications to stabilize the soluble protein during purification and concentration. In the case of Braf, 5 mM MgCl was required during purification₂. In the case of Ret, a combination of 1mM ATP and 5M MgCl₂ it was required during cell lysis and during purification. In the case of Zap70, a 5M excess of AMP-PCP relative to the protein was required as well as 5mM MgCl₂.

128

52010 Β

Baculovirus expression vector system

Virus production:

Transfection of Spodopler frugiperda cell monolayer (Sf9) was performed using a bacmid containing the gene of interest and Cellfectin (Invitrogen) transfection reagent in Grace's complete medium without antibiotics and without serum (Invitrogen). After a five-hour incubation, the transfection medium was removed, and the monolayer was filled with Grace medium containing 10% FBS and antibiotics. After incubation for 72 to 96 hours, a virus-containing cell supernatant was collected. The viral stock titer was then determined using a baculovirus (BD) titer kit. Viral stock was then expanded using cultures with a low multiplicity of infection (MOI of 0.1) and collected 48 hours after infection. The expanded viral stock titer was then determined for use in recombinant protein production.

Protein production:

Protein expression levels were optimized by changing MOI (1-10) and collection time (48-72 hours). Sf9 cells were adapted to serum-free SF-900 II medium and grown in suspension in spinner pots. The cell suspension was then used to inoculate a Wave bioreactor for a production scale of 25L. Cells were harvested 48-72 hours after infection and stored at -80 ° C until ready for lysis. Proteins were purified similarly to those expressed in E. coli.

Test kinases AlphaScreen assays were performed using compounds dissolved in DMSO to a concentration of 20 mM. The compounds were therefore diluted to the desired final concentrations in each sample chamber, using a 1: 3 serial dilution for a total of 8 concentration points. Plates were prepared so that each kinase reaction was 20 μΐ in 1x kinase buffer, 5% DMSO and 10 μΜ ATP. The kinase and test conditions (defined below) used for each kinase are shown in Table 3. After incubation of the kinase reaction for 1 hour at room temperature, 5 μΐ donor beads in stop buffer (50mM EDTA in 1x kinase buffer) were added, the sample was mixed and incubated for 20 minutes at room temperature by adding 5 μΐ recipient beads to stop buffer. Samples were incubated for 60 minutes in room temperature

129

52010 Β

Lubricant buffer

Substrate

Ball giver

The temperature receiver ball and the signal per chamber were read on an AlphaQuest reader. The phosphorylated substrate results in antibody binding and binding of donor and recipient beads so that the signal correlates with kinase activity. The signal according to the concentration of the compound was used to determine the IC50.

[0277] Test conditions A:

HEPES 50 mM, pH 7.2, 5 mM MgCl₂, 5 mM MnCl₂,

0.2% BSA, 0.01% NP-40 100MM biotin- (E4Y) 3 (Open Source Biotech, Inc.) pg / ml streptavidin-coated beads (Perkin Elmer Life Science).

pg / ml beads coated with ΡΥ20 (Perkin Elmer Life

Science) Test conditions B:

<td>Kinase buffer</td><td>50 mM HEPES pH 7.0, 50 mM NaCl, 2 mM MgCl₂, 1 mM MnCl₂, 1 mM DTT, 0.01% Tween-20.</td>

<td>Substrate</td><td>100 nM biotin-MEK1 (prepared as described above)</td>

<td>Ball giver</td><td>10 pg / ml streptavidin-coated beads (Perkin Elmer Lifc Science)</td>

<td>Ball receiver</td><td>10 pg / ml Protein A coated, bound to anti phospho ΜΕΚ1 / 2 antibody (CellSignal)</td>

[0279 | Test conditions C:

<td>Kinase buffer</td><td>8 mM HEPES pH 7.0, 4 mM MgCl₂, 1 mM DTT, 0.01% Tween-20.</td>

<td>Substrate Ball giver</td><td>100 pM biotin-MBP (Upstate Biotechnology, Waltham, MA). 10 pg / ml Streptavidin-coated beads (Perkin Elmcr Life Science).</td>

„· 10 pg / ml Protein A coated, bound to anti phospho MBP

Kughca pnmaoc _(Cellsignal) Test conditions D;

<td>Kinase buffer</td><td>8 mM MOPS pH 7.4.2 mM MgCl₂, 8 mM MnCl₂, 2 mM DTT, 0.01% Tween-20.</td>

<td>Substrate Ball giver</td><td>30 pM biotin- (E4Y) 10 (Upstate Biotechnology). 20 pg / ml Streptavidin-coated beads (Perkin Elmer Life Science).</td>

„. 20 ug / ml ΡΥ20 antibody coated (Perkin Elmer Life

Ball rptaos

130

52010 Β [0281] Test conditions E:

Kinase 20 mM HEPES pH 7.0.10 mM MgCl₂, 1 mM DTT, 0.01% Tween-20 buffer.

Substrate 30 nM biotin-ATF2 (Upstate Biotechnology).

Bead 10 pg / ml Streptavidin-coated beads (Perkin Elmer, Life Science donor).

Bead 10 pg / ml Protein A coated, bound to anti phospho ATF2 recipient antibody (CellSignal)] 0282] Test conditions F:

<td>Kinase buffer</td><td>8 mM HEPES pH 7.0, 4 mM MgCl₂, 1 mM DTT, 0.01% Tween-20.</td>

<td>Substrate</td><td>100 nM biotin-BAD (prepared as described above).</td>

<td>Ball giver</td><td>10 pg / ml Streptavidin-coated beads (Perkin Elmer Life Science).</td>

<td>Ball receiver</td><td>10 pg / ml Protein A coated, bound to anti phospho BAD (Serl 12) antibody (CellSignal)</td>

[0283] Test conditions G:

<td>Kinase buffer</td><td>MOPS 25 mM, pH 7.1, 0.1 mM MgCl₂, 5 mM MnCl₂, 0.2% BSA, 1 mM DTT, 0.01% Tween-20.</td>

<td>Substrate Ball giver</td><td>lOOnM biotin- (E4Y) 3 (Open Source Biotech, Inc.) 1 pg / ml Streptavidin-coated beads (Perkin Elmer Life Science).</td>

<td>Ball receiver</td><td>1 pg / ml Balls coated with ΡΥ20 (Perkin Elmcr Life Science)</td>

<td colspan="4">Table 3 Kinase reaction conditions (20 ml reaction volume '</td><td>7Ά kinase assay</td>

<td>Kinase</td><td>Manufacturer *</td><td>Number of plasmids</td><td>Expression host</td><td>Test conditions</td>

<td>Abl</td><td></td><td>Ρ1121</td><td>E. coli</td><td>A (1 ng kinase)</td>

<td>B-Raf</td><td>Upstate</td><td></td><td></td><td>B (0.1 ng kinase)</td>

<td>B-Raf V600E</td><td></td><td>P4254</td><td>Sf9</td><td>B (0.1 ng kinase)</td>

<td>c-Raf-1</td><td>Upstate</td><td></td><td></td><td>B (0.1 ng kinase)</td>

<td>Erk2</td><td></td><td>P4227</td><td>E. coli</td><td>C (4 ng kinase)</td>

<td>Fak</td><td></td><td>Ρ1358</td><td>Sf9</td><td>A (0.1 ng kinase)</td>

<td>FGFRl</td><td></td><td>Ρ1351</td><td>E. coli</td><td>A (0.1 ng kinase)</td>

<td>Fltl</td><td></td><td>Ρ1826</td><td>E. coli</td><td>A (0.1 ng kinase)</td>

131

52010 Β

<td>Flt4</td><td>ProQinase</td><td></td><td></td><td>A (0.1 ng kinazc)</td>

<td>Fms</td><td>Upstate</td><td></td><td></td><td>D (0.5 ng kinase)</td>

<td>Jnkl</td><td>Upstate</td><td></td><td></td><td>E (0.1 ng kinase)</td>

<td>Jnk2</td><td>Roche</td><td></td><td></td><td>E (0.05 ng kinase)</td>

<td>JpkZ</td><td>Upstate</td><td></td><td></td><td>E (0.1 ng kinase)</td>

<td>Kit</td><td></td><td>Ρ1332</td><td>E. coli</td><td>A (0.1 ng kinase)</td>

<td>Met</td><td></td><td>Ρ1818</td><td>E. coli</td><td>A (0.1 ng kinase)</td>

<td>p38</td><td></td><td>P4292</td><td>E. coli</td><td>E (6 ng kinase)</td>

<td>Piml</td><td></td><td>Ρ1215</td><td>E. coli</td><td>F (0.01 ng kinase)</td>

<td>Pyk2</td><td>Upstate</td><td></td><td></td><td>D (1 of kinase)</td>

<td>Ret</td><td></td><td>Ρ1378</td><td>E. coli</td><td>A (0.01 ng kinase)</td>

<td>Src</td><td></td><td>Ρ1144</td><td>E. coli</td><td>A (0.01 ng kinase)</td>

<td>Zap70</td><td></td><td>Ρ1868</td><td>Sf9</td><td>G (0.1 ng kinase)</td>

<td>* Upstate = Roche = Ro &lt;ProQinase =</td><td>(Jpstate Biotec: he Protein Exj ProQinase Gn</td><td colspan="3">inology iression Group (Indianapolis, IN) lbH (Freiburg, Germany)</td>

The kit was alternatively purchased from Ccll Signaling Technology. The kit and Fms assays were also performed at 100 mM ATP, where for Fms 1x buffer was 8 mM MOPS pH 7.0, 2 mM MgCh, 8 mM MnCl₂, 2 mM DTT, 50 tM NaCl, 0.01% BSA I 0.01% Tween-20 and stop buffer was 8 tM MOPS, pH 7.0, 100 mM EDTA, 0.01% BSA and 1 ng kinase was used for the kit and 1x buffer was 8 mM MOPS pH 7.0, 1 mM MgCl₂, 2 mM MnCl₂, 1 tM DTT, 0.001% BSA and 0.01% Tween-20, with a substrate of 30 nM biotin- (E4Y) io (Upstate Biotechnology) and beads were at 10 pg / ml in 8 mM MOPS stop buffer, pH 7.0, 100 mM EDTA, 0.3% BSA.

Compounds tested by at least one of the methods described above, or by similar methods, having an IC50 of less than 10 μΜ are shown in Tables 2a (Abl), 2b (B-Raf), 2c (B-Raf V600E ), 2d (Btk), 2e (c-Raf-1), 2f (EGFR), 2g (EphB2), 2h (Erk2), 2i (Fak), 2j (FGFR1), 2k (Flt1), 21 (Flt3) , 2m (Flt4), 2n (Fms), 2o (Iraq4), 2p (Jnkl), 2q (Jnk2), 2r (JpkZ), 2s (Kdr), 2t (Kit), 2u (ΜΑΡ2Κ.1), 2v MAPKAPK2), 2w (Met), 2x (p38), 2y (PDGFRB), 2z (Piml), 2aa (PKC theta), 2bb (Pyk2), 2cc (Ret), 2dd (Src), 2ee (Stk6) and 2ff (Yes), 2gg (Zap70), 2hh (Akt3), 2ii (ALK), 2jj (Cdk2), 2kk (Csk), 211 (EphA2), 2mm (EphB4), 2nn (Frk), 2oo (GskP), 2pp (Hck), 2qq (MAP4K4), 2rr (IGFIR), 2ss (IKK beta), 2tt (Itk), 2uu (JakZ) , 2w (MLKl), 2ww (TrkA), 2xx (PDGFRA), 2yy (Plkl), 2zz (Brk), 2ab (ROCKl), 2ac (Syk), 2ad (TEC) and 2ae (Tie2).

132

52010 Β

Table 2a. Compounds with Abl kinase activity with IC50 &lt;10 μΜ

<td>Abl</td><td>P-0001, P-0002, P-0003, P-0005, P-0007, P-0010, P-0011, P-0012, P-0019, P-0025, P-0028, P-0032, P-0033, P-0040, P-0041, P-0045, P-0047, P-0048, P-0050, P-0054, P-0056, P-0058, P-0068, P-0072, P-0074, P-0090, P-0093, P-0134, P-0140, P-0142, P-0167, P-0169, P-0196, P-0218, P-0224, P-0244, P-0316, P-0320, P-0448, P-0453, P-0501, P-0521, P-0529, P-0550, P-0559, P-0562, P-0579, P-0594, P-0599, P-0604, P-0611, P-0623, P-0624, P-0645, P-0656, P-0671, P-0675, P-0691, P-0693, P-0708, P-0738, P-0751, P-0762, P-0781, P-0794, P-0800, P-0806, P-0885, P-1011, P-1012, Pl 115, Pl 127, P-1318, P-1336, P-1394, P-1426</td>

133

52010 Β

Table 2b. Compounds with B-Raf kinase activity with IC 50 &lt;10 μΜ

<td>B-Raf</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P-0008, P-0009, P-0010, P-0016, P-0019, P-0021, P-0024, P-0025, P-0026, P-0027, P-0032, P-0034, P-0035, P-0036, P-0037, P-0038, P-0041, P-0042, P-0045, P-0050, P-0052, P-0054, P-0055, P-0056, P-0059, P-0060, P-0065, P-0066, P-0067, P-0068, P-0078, P-0079, P-0082, P-0088, P-0090, P-0093, P-0095, P-0102, P-0112, P-0114, P-0122, P-0126, P-0140, P-0143, P-0162, P-0165, P-0166, P-0171, P-0178, P-0180, P-0184, P-0188, P-0192, P-0196, P-0200, P-0210, P-0228, P-0257, P-0262, P-0265, P-0269, P-0271, P-0284, P-0293, P-0297, P-0302, P-0307, ​​P-0310, P-0351, P-0356, P-0369, P-0382, P-0396, P-0414, P-0448, P-0486, P-0521, P-0550, P-0556, P-0559, P-0579, P-0594, P-0599, P-0604, P-0613, P-0636, P-0683, P-0685, P-0693, P-0697, P-0700, P-0716, P-0721, P-0728, P-0734, P-0744, P-0745, P-0746, P-0753, P-0763, P-0773, P-0774, P-0776, P-0778, P-0779, P-0794, P-0798, P-0805, P-0806, P-0807, P-0818, P-0837, P-0841, P-0842, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P-0861, P-0863, P-0866, P-0867, P-0868, P-0874, P-0876, P-0877, P-0883, P-0885, P-0889, P-0894, P-0896, P-0897, P-0898, P-0902, P-0904, P-0907, P-0909, P-0910, P-0911, P-0912, P-0913, P-0919, P-0924, P-0928, P-0931, P-0932, P-0933, P-0937, P-0939, P-0941, P-0944, P-0946, P-0947, P-0952, P-0954, P-0955, P-0956, P-0958, P-0959, P-0973, P-0975, P-0978, P-0980, P-0983, P-0984, P-0987, P-0991, P-0997, P-0998, P-1003, P-1004, P-1006, P-1009, P-1013, P-1014, P-1020, P-1027, P-1028, P-1056, P-1076, P-1080, Pl 110, Pl 116, P-1243, P-1244, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1254, P-1255, P-1256, P-1257, P-1258, P-1259, P-1260, P-1261, P-1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1268, P-1269, P-1270, P-1279, P-1280, P-1281, P-1282, P-1288, P-1289, P-1317, P-1318, P-1336, P-1338, P-1341, P-1343, P-1346, P-1347, P-1348, P-1349, P-1365, P-1383, P-1384, P-1385, P-1386, P-1387, P-1388, P-1389, P-1390, P-1391, P-1395, P-1397, P-1419, P-1420, P-1429,</td>

134

52010 Β

<td></td><td>Ρ-1430, Ρ-1431, Ρ-1432, Ρ-1433, Ρ-1445, Ρ-1446, Ρ-1447, Ρ-1451, Ρ-1452, Ρ-1453, Ρ-1454, Ρ-1455, Ρ-1456, Ρ-1457, Ρ-1458, Ρ-1459, Ρ-1467, Ρ-1469, Ρ-1472, Ρ-1473, Ρ-1475, Ρ-1477, Ρ-1479, Ρ-1480, Ρ-1481, Ρ-1485, Ρ-1486, Ρ-1526, Ρ-1527, Ρ-1528, Ρ-1529, Ρ-1532, Ρ-1534, Ρ-1539, Ρ-1541, Ρ-1542, Ρ-1544, Ρ-1546, Ρ-1547, Ρ-1548, Ρ-1549, Ρ-1552, Ρ-1553, Ρ-1554, Ρ-1555, Ρ-1556, Ρ-1559, Ρ-1566, Ρ-1567, Ρ-1568, Ρ-1569, Ρ-1570, Ρ-1576, Ρ-1577, Ρ-1580, Ρ-1581, Ρ-1582, Ρ-1583, Ρ-1584, Ρ-1585, Ρ-1586, Ρ-1589, Ρ-1590, Ρ-1591, Ρ-1592, Ρ-1593, Ρ-1596, Ρ-1597, Ρ-1598, Ρ-1599, Ρ-1600, Ρ-1602, Ρ-1605, Ρ-1608, Ρ-1609, Ρ-1610, Ρ-1612, Ρ-1613, Ρ-1616, Ρ-1621, 16-1627, 16-1630, Ρ-1631, Ρ-1636, Ρ-1637, Ρ-1638, Ρ-1639, Ρ-1656, Ρ-1660, Ρ-1663, Ρ-1664, Ρ-1665, Ρ-1670, Ρ-1671, Ρ-1687, Ρ-1700, Ρ-1701, Ρ-1702, Ρ-1703, Ρ-1704, Ρ-1705, Ρ-1706, Ρ-1707, Ρ-1708, Ρ-1709, Ρ-1710, Ρ-1711, Ρ-1712, Ρ-1713, Ρ-Ι714, Ρ-1715, Ρ-1716, Ρ-1717, Ρ-1718, Ρ-1719, Ρ-1720, Ρ-1721, Ρ-1722, Ρ-1723, Ρ-1724, Ρ-1725, 17-1726, Ρ-1727, Ρ-1728, 17-1729, Ρ-1730, Ρ-1731, Ρ-1732, Ρ-1733, Ρ-1734, Ρ-1735, Ρ-1736, Ρ-1737, Ρ-1738, Ρ-1739, Ρ-1740, Ρ-1741, Ρ-1742, Ρ-1746, Ρ-1747, Ρ-1748, Ρ-1749, Ρ-1750, Ρ-1751, Ρ-1752, Ρ-1753, Ρ-1755, Ρ-1756, Ρ-1757, Ρ-1758, Ρ-1759, Ρ-1760, Ρ-1762, Ρ-1763, Ρ-1764, Ρ-1765, Ρ-1766, Ρ-1767, Ρ-1768, Ρ-1769, Ρ-1770, Ρ-1771, Ρ-1772, Ρ-1773, Ρ-1774, Ρ-1775, Ρ-1776, Ρ-1777, Ρ-1778, Ρ-1779, Ρ-1780, Ρ-1781, Ρ-1782, Ρ-1783, Ρ-1784, Ρ-1798, Ρ-1799, Ρ-1800, Ρ-1802, Ρ-1804, Ρ-1816, Ρ-1817, Ρ-1818, Ρ-1819, Ρ-1822, Ρ-1823, Ρ-1825, Ρ-1827, Ρ-1828, Ρ-1839, Ρ- 1840, Ρ-1841, Ρ-1842, Ρ-1864, Ρ-1865, Ρ-1871, Ρ-1872, Ρ-1873, Ρ-1878, Ρ-1879, Ρ-1881, Ρ-1882, Ρ-1907, Ρ-1912, Ρ-1916, Ρ-1980, Ρ-1996, Ρ-1997, Ρ-1998, Ρ-2005, 2006-2006, Ρ-2007, Ρ-2012, Ρ-2013</td>

135

52010 Β

Table 2c. Compounds with kinase activity B-Raf V600E with IC50S 10 μΜ

<td>B-Raf V600E</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P-0008, P-0009, P-0010, P-0011, P-0012, P-0013, P-0014, P-0015, P-0016, P-0017, P-0019, P-0021, P-0022, P-0024, P-0025, P-0026, P-0027, P-0028, P-0032, P-0033, P-0034, P-0035, P-0036, P-0037, P-0038, P-0039, P-0040, P-0041, P-0042, P-0043, P-0044, P-0045, P-0046, P-0047, P-0048, P-0049, P-0050, P-0051, P-0052, P-0053, P-0054, P-0055, P-0056, P-0059, P-0060, P-0062, P-0063, P-0066, P-0067, P-0068, P-0070, P-0071, P-0072, P-0073, P-0074, P-0075, P-0078, P-0079, P-0082, P-0085, P-0088, P-0089, P-0090, P-0092, P-0093, P-0095, P-0097, P-0099, P-0100, P-0102, P-0107, P-0108, P-0109, P-0110, P-0112, P-0114, P-0118, P-0119, P-0121, P-0122, P-0124, P-0126, P-0129, P-0134, P-0135, P-0137, P-0139, P-0140, P-0141, P-0146, P-0147, P-0148, P-0152, P-0I53, P-0156, P-0160, P-0162, Ρ0165, P-0166, P-0170, P-0171, P-0I74, P0175, P-0178, P-0180, P-0181, P-0184, P-0185, P-0186, P-0187, P-0188, P-0191, P-0192, P-0196, P-0199, P-0200, P-0205, P-0208, P-0210, P-0211, P-0215, P-0228, P-0231, P-0237, P-0242, P-0243, P-0244, P-0246, P-0248, P-0252, P-0255, P-0257, P-0261, P-0262, P-0265, P-0269, P-0271, P-0274, P-0284, P-0287, P-0293, P-0295, P-0297, P-0302, P-0307, ​​P-0308, P-0311, P-0318, P-0320, P-0325, P-0333, P-0344, P-0347, P-0351, P-0352, P-0355, P-0356, P-0358, P-0369, P-0373, P-0381, P0382, P0386, P-0388, P-0396, P-0409, P-0414, P-0418, P-0420, P-0421, P-0434, P-0441, P-0447, P-0448, P-0453, P-0472, P-0483, P-0486, P-0493, P-0515, P-0521, P-0535, P-0550, P-0552, P-0559, P-0573, P-0579, P-0592, P-0594, P-0599, P-0600, P-0603, P-0604, P-0613, P-0623, P-0624, P-0636, P-0638, P-0645, P-0646, P-0647, P-0651, P-0656, P-0668, P-0671, P-0679, P-0683, P-0685, P-0691, P-0693, P-0696, P-0698, P-0700, P-0710, P-0713, P-0716, P-0721, P-0728, P-0730, P-0734, P-0744, P-0745, P-0746, P-0751, P-0753, P-0762, P-0763, P-0771, P-0773, P-0774, P-0776, P-0777, P-0778, P-0779, P-0794, P-0798, P-0803, P-0805, P-0806, P-0807, P-0810, P-0811,</td>

136

52010 Β

<td></td><td>Ρ-0816, Ρ-0818, Ρ-0819, Ρ-0833, Ρ-0837, Ρ-0841, Ρ-0842, Ρ-0848, Ρ-0850, Ρ-0851, Ρ-0853, Ρ-0857, Ρ-0860, Ρ-0861, Ρ-0863, Ρ-0866, Ρ-0867, Ρ-0868, Ρ-0874, Ρ-0876, Ρ-0877, Ρ-0885, Ρ-0886, Ρ-0889, Ρ-0893, Ρ-0894, Ρ-0896, Ρ-0897, Ρ-0898, Ρ-0902, 09-0904, Ρ-0905, Ρ-0907, Ρ-0910, Ρ-0911, Ρ-0912, Ρ-0913, Ρ-0919, Ρ-0927, Ρ-0928, Ρ-0931, Ρ-0933, Ρ-0937, Ρ-0939, Ρ-0944, Ρ-0946, Ρ-0947, Ρ-0950, Ρ-0951, Ρ-0952, Ρ-0954, Ρ-0955, Ρ-0956, Ρ-0957, Ρ-0958, Ρ-0959, Ρ-0962, Ρ-0964, Ρ-0971, Ρ-0976, Ρ-0980, Ρ-0981, Ρ-0983, Ρ-0984, Ρ-0991, Ρ-0997, Ρ-0998, Ρ-1000, Ρ-1002, Ρ-1003, Ρ-1004, Ρ-1006, Ρ-1007, Ρ-1008, Ρ-1009, Ρ-1010, Ρ-1013, Ρ-1014, Ρ-1015, Ρ-1016, Ρ-1018, Ρ-1020, Ρ-1021, Ρ-1022, Ρ-1024, Ρ-1025, Ρ-1026, Ρ-1028, Ρ-1029, Ρ-1030, Ρ-1031, 10-1035, Ρ-1043, Ρ-1049, Ρ-1056, Ρ-1061, Ρ-1063, Ρ-1064, Ρ-1065, Ρ-1067, Ρ-1069, 10-1070, Ρ-1071, Ρ-1074, Ρ-1082, Ρ-1085, Ρ-1090, Ρ-1091, Ρ-1112, Ρ-1113, Ρ-1116, Ρ-1117, Ρ-1120, Ρ-1123, Ρ-1128, Ρ-1131, Ρ-1138, Ρ-1139, Ρ-1140, Ρ-1160, Ρ-1177, Ρ-1179, Ρ-1180, Ρ-1181, Ρ-1183, Ρ-1187, Ρ-1194, Ρ-1195, Ρ-1199, Ρ-1243, Ρ-1244, Ρ-1246, Ρ-1247, Ρ-1249, Ρ-1250, Ρ-1251, Ρ-1252, Ρ-1253, Ρ-1254, Ρ-1255, 12-1256, Ρ-1257, Ρ-1258, Ρ-1259, Ρ-1260, Ρ-1261, Ρ-1262, Ρ-1263, Ρ-1264, Ρ-1265, 12-1266, Ρ-1267, Ρ-1269, Ρ-1270, Ρ-1279, Ρ-1280, Ρ-1281, Ρ-1282, Ρ-1283, Ρ-1288, 12-1289, Ρ-1316, Ρ-1317, Ρ-1318, Ρ-1323, Ρ-1329, Ρ-1336, Ρ-1341, Ρ-1343, Ρ-1345, Ρ-1346, Ρ-1347, Ρ-1348, Ρ-1349, Ρ-1365, Ρ-1366, Ρ-1368, Ρ-1369, Ρ-1370, Ρ-1381, 13-1383, 13-1384, Ρ-1385, Ρ-1386, Ρ-1387, Ρ-1388, Ρ-1389, Ρ-1390, Ρ-1391, Ρ-1392, Ρ-1394, 13-1395, Ρ-1396, Ρ-1397, Ρ-1398, Ρ-1399, Ρ-1402, Ρ-1403, Ρ-1409, Ρ-1411, Ρ-1413, Ρ-1414, Ρ-1415, Ρ-1416, Ρ-1417, Ρ-1418, Ρ-1419, Ρ-1420, Ρ-1423, Ρ-1425, Ρ-1426, Ρ-1429, Ρ-1430, Ρ-1431, Ρ-1432, Ρ-1433, Ρ-1444, Ρ-1445, Ρ-1446, Ρ-1447, Ρ-1448, Ρ-1449, Ρ-1450, Ρ-1451, Ρ-1452, Ρ-1453, Ρ-Ι454, Ρ-1455, Ρ-1456, Ρ-1457, Ρ-1458, Ρ-1459, Ρ-1462, Ρ-1465, Ρ-1466, Ρ-1467, Ρ-1469, Ρ-1470, Ρ-1471, Ρ-1472, 14-1473, Ρ-1474, Ρ-1475, Ρ-1477, Ρ-1478, Ρ-1479, Ρ-1480, Ρ-1481, Ρ-1485, Ρ-1486,</td>

137

52010 Β

<td></td><td>Ρ-1495, Ρ-1505, Ρ-1506, Ρ-1516, Ρ-1526, Ρ-1527, Ρ-1528, Ρ-1529, Ρ-1530, Ρ-1531, Ρ-1532, Ρ-1534, Ρ-1539, Ρ-1540, Ρ-1541, Ρ-1542, Ρ-1544, Ρ-1545, Ρ-1546, Ρ-1547, Ρ-1548, Ρ-1549, Ρ-1550, Ρ-1552, Ρ-1553, Ρ-15554, Ρ-1556, Ρ-1558, Ρ-1559, Ρ-1561, Ρ-1564, Ρ-1566, Ρ-1567, Ρ-1568, Ρ-1569, Ρ-1570, Ρ-1572, Ρ-1575, Ρ-1576, Ρ-1577, Ρ-1578, Ρ-1579, Ρ-1581, Ρ-1582, Ρ-1583, Ρ-1584, Ρ-1585, Ρ-1586, Ρ-1589, Ρ-1590, Ρ-1591, Ρ-1592, Ρ-1594, Ρ-1596, Ρ-1597, Ρ-1598, Ρ-1599, Ρ-1600, Ρ-1601, Ρ-1602, Ρ-1605, 160-1606, 160-1607, Ρ-1608, Ρ-1609, Ρ-1610, Ρ-1611, Ρ-1612, Ρ-1613, Ρ-1614, Ρ-1621, Ρ-1627, Ρ-1630, Ρ-1631, Ρ-1636, Ρ-1637, Ρ-1638, Ρ-1639, Ρ1656, Ρ-1660, 16-1663, Ρ-1664, Ρ-1665, Ρ-1666, Ρ-1670, Ρ-1671, Ρ-1687, Ρ-1698, Ρ-1700, Ρ-1701, Ρ-1702, Ρ-1703, Ρ-1704, Ρ-1705, Ρ-1706, Ρ-1707, Ρ-1708, Ρ-1709, Ρ-1710, Ρ-1711, Ρ-1712, 17-1713, Ρ-1714, Ρ-1715, Ρ-1716, Ρ-1717, Ρ-1718, Ρ-1719, Ρ-1720, Ρ-1721, Ρ-1722, Ρ-1723, Ρ-1724, Ρ-1725, Ρ-1726, Ρ-1727, Ρ-1728, Ρ-1729, Ρ-1730, Ρ-1731, Ρ-1732, 17-1733, Ρ-1734, Ρ-1735, 17-1736, Ρ-1737, Ρ-1738, Ρ-1739, Ρ-1740, Ρ-1741, Ρ-1742, Ρ-1746, Ρ-1747, Ρ-1748, Ρ-1749, Ρ-1750, Ρ-1751, Ρ-1752, Ρ-1753, Ρ-1755, 17-1756, Ρ-1757, Ρ-1758, Ρ-1759, Ρ-1760, Ρ-1762, Ρ-1763, Ρ-1764, Ρ-1765, Ρ-1766, Ρ-1767, Ρ-1768, Ρ-1769, Ρ-1770, Ρ-1771, Ρ-1772, Ρ-1773, Ρ-1774, Ρ-1775, Ρ-1776, Ρ-1777, Ρ-1778, Ρ-1779, Ρ-1780, Ρ-1781, Ρ-1782, Ρ-1783, Ρ-1784, Ρ-1797, Ρ-1798, Ρ-1799, Ρ-1800, Ρ-1802, Ρ-1804, Ρ-1816, Ρ-1817, Ρ-1818, Ρ-1819, Ρ-1822, Ρ-1823, Ρ-1828, Ρ-1839, Ρ-1840, Ρ-1841, Ρ-1842, Ρ-1843, Ρ-1864, Ρ-1865, Ρ-1871, Ρ-1872, Ρ-1873, Ρ-1878, Ρ-1879, Ρ-1881, Ρ-1882, Ρ-1907, Ρ-1912, Ρ-1916, Ρ-1980, Ρ-1996, Ρ-1997, 1998-1998, Ρ-2005, Ρ-2006, Ρ-2007, Ρ-2012, Ρ-2013</td>

138

52010Β

Table 2d. Compounds with Btk kinase activity with IC50 &lt;10 μΜ

<td>Btk:</td><td>P-0005, P-0006, P-0007, P-0009, P-0010, P-0011, P-0012, P-0013, P-0014, P-0015, P-0016, P-0017, P-0019, P-0020, P-0021, P-0022, P-0024, P-0025, P-0026, P-0027, P-0028, P-0029, P-0031, R-OOZZ, P-0040, P-0041, P-0042, P-0043, P-0044, P-0045, P-0046, P-0047, P-0048, P-0049, P-0050, P-0051, P-0452, P-0053, P-0054, P-0055, P-0059, P-0060, P-0061, P-0062, P-0063, P-0067, P-0068, P-0070, P-0072, P-0073, P-0074, P-0075, P-0079, P-0081, P-0082, P-0083, P-0085, P-0088, P-0089, P-0090, P-0093, P-0094, P-0097, P-0102, P-0107, P-0108, P-0109, P-0112, P-0113, P-0125, P-0134, P-0135, P-0138, P-0139, P-0145, P-0148, P-0152, P-0156, P-0166, P-0171, P-0217, P-0228, P-0257, P-0280, P-0297, P-0302, P-0304, P-0314, P-0321, P-0325, P-0351, P-0418, P-0429, P-0763, P-0806, P-0807, P-0885, P-0897, P-0991, P-0997, P-1020, P-1262, P-1266, P-1267, P-I269, P-1317, P-1336, P-1343, P-1346, P-1388, P-1390, P-1420, P-1426, P-1459, P-1473, P-1475, P-1479, P-1480, P-1481, P-1389, P-1485, P-1486</td>

Table 2e. Compounds with c-Raf kinase activity with 1S $ o &lt;10 μΜ

<td>c-Raf-1:</td><td>P-0001, P-0002, P-0004, P-0005, P-0006, P-0007, P-0008, P-0009, P-0010, P-0015, P-0016, P-0021, P-0024, P-0025, P-0026, P-0027, P-0032, P-0034, P-0035, P-0036, P-0037, P-0038, P-0042, P-0045, P-0052, P-0055, P-0066, P-0078, P-0079, P-0082, P-0088, P-0090, P-0102, P-0112, P-0114, P-0121, P-0122, P-0137, P-0156, P-0162, P-0165, P-0166, P-0170, P-0178, P-0180, P-0184, P-0188, P-0210, P-0228, P-0257, P-0262, P-0265, P-0269, P-0297, P-0302, P-0307, ​​P-0356, P-0369, P-0382, P-0396, P-0418, P-0486, P-0521, P-0535, P-0542, P-0559, P-0604, P-0613, P-0636, P-0656, P-0685, P-0700, P-0716, P-0721, P-0728, P-0734, P-0744, P-0745, P-0746, P-0753, P-0763, P-0773, P-0774, P-0776, P-0778, P-0779, P-0794, P-0798, P-0805, P-0806, P-0807, P-0811, P-0818, P-0837, P-0841, P-0842, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P-0861, P-0863, P-0866, P-0867, P-0868, P-0874, P-0876,</td>

139

52010Β

<td></td><td>P-0877, P-0883, P-0885, P-0889, P-0890, P-0894, P-0896, P-0897, P-0898, P-0902, P-0904, P-0907, P-0909, P-091 0, P-0911, P-0912, P-0913, P-0919, P-0924, P-0928, P-0931, P-0933, P-0937, P-0939, P-0941, P-0944, P-0946, P-0947, P-0950, P-0952, P-0954, P-0955, P-0956, P-0957, P-0958, P-0959, P-0964, P-0971, P-0973, P-0974, P-0975, P-0978, P-0983, P-0987, P-0991, P-0997, P-0998, P-1002, P-1003, P-I004, P-1006, P-1009, P-1013, P-1014, P-1015, P-1017, P-1020, P-1027, P-1028, P-1047, P-1056, P-1061, P-1063, P-1064, P-1065, P-1070, P-1071, P-1076, P-1077, P-1078, P-1079, Pl 118, Pl 122, Pl 145, P-1243, P-1244, P-1246, P-1247, P-1249, P-1250, P-1251, P-1253, P-1254, P-1255, P-1256, P-1257, P-1258, P-1260, P-1261, P-1262, P-1265, P-1279, P-1283, P-1288, P-1289, P-1316, P-1317, P-1318, P-1336, P-1338, P-1365, P-1386, P-1387, P-1388, P-1389, P-1390, P-1391, P-1395, P-1396, P-1397, P-1398, P-1403, P-1413, P-1419, P-1431, P-1432, P-1433, P-1448, P-1451, P-1452, P-1453, P-1454, P-1455, P-1456, P-1458, P-1541, P-1542, P-1546, P-I547, P-1581, P-1583, P-1630, P-1671, P-1712, P-1713, P-1714, P-1733, P-1737, P-1738, P-1739, P-1740, P-1783, P-1839, P-1864, Ρ1871, P-1873, P-1878, P-1879, P-1881, P-1882</td>

Table 2f. Compounds with EGFR kinase activity with IC50 &lt;10 μΜ

<td>EGFR:</td><td>P-0001, P-0002, P-0003, P-0004, P-0025, P-0095, P-0153,</td>

<td></td><td>P-0877</td>

140

52010 Β

Table 2d. Compounds with EphB2 kinase activity with IC 50 &lt;10 μΜ

<td>EphB2:</td><td>P-0001, P-0003, P-0005, P-0006, P-0007, P-0009, P-001 0, P0011, P-0012, P-0013, P-0014, P-0015, P-0016, P-0017, P-0019, P-0020, P-0021, P0022, P-0025, P-0027, P-0028, P-0029, P-0032, R-OOZZ, P-0034, P-0035, P-0036, P0038, P-0040, P-0041, P-0042, P-0043, P-0044, P-0045, P-0048, P-0050, P-0052, P0053, P-0055, P-0056, P-0059, P-0062, P-0067, P-0068, P-0070, P-0072, P-0074, P0075, P-0078, P-0083, P-0088, P-0090, P-0093, P-0102, P-0107, P-0109, P-0114, P0124, P-0125, P-0126, P-0139, P-0145, P-0186</td>

Table 2x. Compounds with Erk2 kinase activity with IC 50 &lt;10 μΜ

<td>Erk2:</td><td>P-0031, P-0041, P-0058, P-0154, P-0550, P-0611, P-1336</td>

Table 2i. Compounds with Fak kinase activity with IC50 &lt;10 mM

<td>Fax:</td><td>P-0001, P-0002, P-0003, P-0004, P-0006, P-0007, P-0008, P-0009, P-0016, P-0018, P-0024, P-0025, P-0026, P-0027, P-0032, P-0034, P-0035, P-0036, P-0037, P-0045, P-0054, P-0055, P-0067, P-0078, P-0088, P-0102, P-0112, P-0114, P-0166, P-0196, P-0209, P-0210, P-0211, P-0224, P-0257, P-0269, P-0276, P-0293, P-0298, P-0302, P-0310, P-0333, P-0391, P-0396, P-0437, P-0486, P-0494, P-0501, P-0611, P-0668, P-0675, P-0685, P-0691, P-0700, P-0721, P-0774, P-0795, P-0797, P-0806, P-0811, P-0818, P-0837, P-0850, P-0851, P-0867, P-0885, P-0889, P-0910, P-0911, P-0933, P-0951, P-0955, P-0956, P-0986, P-0992, P-1002, P-1009, P-1013, P-1020, P-1054, P-1083, P-1114, P-1146, Pl 190, P-1247, P-1249, P-1250, P-1253, P-1255, P-1256, P-1263, P-1264, P-1266, P-1267, P-1269, P-1279, P-1280, P-1281, P-1282, P-1288, P-1289, P-1316, P-1318, P-1321, P-1323, P-1329, P-1336, P-1341, P-1346, P-1347, P-1348, P-1349, P-1359, P-1365, P-1383, P-1384, P-1385, P-1387, P-1388, P-1389, P-1390, P-1391, P-1392, P-1394, P-1396, P-1397, P-1400, P-1401, P-1402,</td>

141

52010Β

<td></td><td>P-1403, P-1411, P-1431, P-1432, P-1433, P-1445, P-1446, P-1447, P-1449, P-1450, P-1451, P-1452, P-1453, P-1455, P-1456, P-1457, P-1458, P-1459, P-1473, P-1474, P-1475, P-1477, P-1478, P-1479, P-1480, P-1481, P-1482, P-1485, P-1486, P-1492, P-1495, P-1500, P-1502, P-1685</td>

Table 2j. Compounds with FGFR kinase activity with IC 50 &lt;10 μΜ

<td>FGFR:</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P-0008, P-0009, P0010, P-0011, P-0012, P-0013, P-0015, P-0016, P-0017, P-0019, P-0020, P-0021, P0024, P-0025, P-0026, P-0027, P-0028, P-0029, P-0032, R-OOZZ, P-0034, P-0035, P0036, P-0037, P-0038, P-0039, P-0040, P-0041, P-0042, P-0043, P-0045, P-0050, P0052, P-0054, P-0055, P-0056, P-0058, P-0059, P-0066, P-0067, P-0068, P-0072, P0073, P-0078, P-0079, P0082, P-0088, P-0089, P-0090, P-0093, P-0096, P-0097, P0099, P-0101, P-0102, P-0103, P-0112, P-0114, P-0119, P-0121, P-0129, P-0132, P0134, P-0137, P-0140, P-0142, P-0149, P-0150, P-0152, P-0156, P-0158, P-0165, P0166, P-0167, P-0168, P-0170, P-0171, P-0175, P-0178, P-0180, P-0184, P-0189, P0192, P-0196, P-0198, P-0204, P-0205, P-0206, P-0210, P-0211, P-0215, P-0217, P0218, P-0219, P-0220, P-0227, P-0228, P-0232, P-0233, P-0239, P-0242, P-0244, P0246, P-0248, P-0257, P-0262, P-0265, P-0267, P-0269, P-0271, P-0274, P-0284, P0287, P-0289, P-0293, P-0294, P-0297, P-0298, P-0302, P-0304, P-0308, P-0309, P0316, P-0320, P-0321, P-0325, P-0326, P-0329, P-0335, P-0339, P-0341, P-0344, P0346, P-0351, P-0363, P-0368, P-0369, P-0371, P-0373, P-0374, P-0379, P-0383, P0385, P-0391, P-0392, P-0396, P-0400, P-0404, P-0409, P-0411, P-0418, P-0420, P0421, P-0424, P-0426, P-0442, P-0447, P-0448, P-0452, P-0453, P-0459, P-0473, P0474, P-0479, P-0483, P-0486, P-0489, P-0493, P-0495, P-0501, P-0507, P-0510, P0515, P-0520, P-0521, P-0535, P-0550, P-0556, P-0559, P-056I, P-0562, P-0563, P0575,</td>

142

52010 Β

Ρ-0579, Ρ-0594, Ρ-0599, Ρ-0611, Ρ-0613, Ρ-0615, Ρ-0623, Ρ-0624, Ρ-0632, Ρ0636,

Ρ-0640, Ρ-0645, Ρ-0647, Ρ-0656, Ρ-0658, Ρ-0668, Ρ-0671, Ρ-0679, Ρ-0683, Ρ0685,

Ρ-0691, Ρ-0693, Ρ-0697, Ρ-0698, Ρ-0699, Ρ-0700, Ρ-0708, Ρ-0710, Ρ-0721, Ρ0728,

Ρ-0730, Ρ-0734, Ρ-0737, Ρ-0744, Ρ-0745, Ρ-0746, Ρ-0749, Ρ-0751, Ρ-0753, Ρ0763,

07-0771, Ρ-0773, Ρ-0774, Ρ-0776, Ρ-0798, Ρ-0805, Ρ-0806, Ρ-0807, Ρ-0811, Ρ0818,

Ρ-0819, Ρ-0826, Ρ-0828, Ρ-0835, Ρ-0837, Ρ-0841, Ρ-0848, Ρ-0850, Ρ-0851, Ρ0853,

08-0854, Ρ-0857, Ρ-0860, Ρ-0865, Ρ-0867, Ρ-0868, Ρ-0874, Ρ-0876, Ρ-0877, Ρ0885,

Ρ-0889, Ρ-0894, Ρ-0896, Ρ-0897, Ρ-0898, Ρ-0902, Ρ-0904, Ρ-0907, Ρ-0910, Ρ0911,

Ρ-0912, Ρ-0913, Ρ-0919, Ρ-0927, Ρ-0933, Ρ-0935, Ρ-0937, Ρ-0944, Ρ-0947, Ρ0950,

Ρ-0951, Ρ-0952, Ρ-0954, Ρ-0955, Ρ-0956, Ρ-0958, Ρ-0964, Ρ-0974, Ρ-0976, Ρ0977,

Ρ-0979, Ρ-0983, Ρ-0991, Ρ-0997, Ρ-1002, Ρ-1004, Ρ-1008, Ρ-1009, Ρ-1015, Ρ1017,

10-1018, Ρ-1020, Ρ-1021, Ρ-1027, Ρ-1066, Ρ-1074, Ρ-1078, Ρ-1110, Ρ-1111, Ρ1116,

Ρ-1120, Ρ-1123, Ρ-1125, Ρ-1142, Ρ-1181, Ρ-1182, Ρ-1188, Ρ-1194, Ρ-1246, Ρ1249,

Ρ-1250, Ρ-1251, Ρ-1252, Ρ-1253, Ρ-1254, Ρ-1255, Ρ-1256, Ρ-1257, Ρ-1258, Ρ1259,

Ρ-1260, Ρ-1261, Ρ-1262, Ρ-1263, Ρ-1264, Ρ-1265, Ρ-1266, Ρ-1267, Ρ-1269, Ρ1270,

Ρ-1272, Ρ-1273, Ρ-1274, Ρ-1279, Ρ-1280, Ρ-1281, Ρ-1282, Ρ-1283, Ρ-1287, Ρ1288,

Ρ-1289, Ρ-1316, Ρ-1317, Ρ-1318, Ρ-1321, Ρ-1322, Ρ-1323, Ρ-1325, Ρ-1326, Ρ1327,

Ρ-1328, Ρ-1329, Ρ-1330, Ρ-1331, Ρ-1332, Ρ-1333, Ρ-1334, Ρ-1335, Ρ-1336, Ρ1337,

Ρ-1338, Ρ-1339, Ρ-1340, Ρ-1341, Ρ-1342, Ρ-1343, Ρ-1344, Ρ-1345, Ρ-1346, Ρ1347,

Ρ-1348, Ρ-1349, Ρ-1365, Ρ-1366, Ρ-1367, Ρ-1369, Ρ-1377, Ρ-1380, Ρ-1381, Ρ1382,

Ρ-1383, Ρ-1384, Ρ-1385, Ρ-1386, Ρ-1387, Ρ-1388, Ρ-1389, Ρ-1390, Ρ-1391, Ρ1392,

Ρ-1393, Ρ-1394, Ρ-1395, Ρ-Ι396, Ρ-1397, Ρ-1398, Ρ-1399, Ρ-1402, Ρ-1403, Ρ1404,

140-1406, Ρ-1407, Ρ-1409, Ρ-1411, Ρ-1415, Ρ-1416, Ρ-1418, Ρ-1419, Ρ-1420, Ρ1423,

Ρ-1424, Ρ-1426, Ρ-1428, Ρ-1429, Ρ-1430, Ρ-1431, Ρ-1433, Ρ-1445, Ρ-1446, Ρ1447,

Ρ-1448, Ρ-1451, Ρ-1452, Ρ-1453, Ρ-1454, Ρ-1455, Ρ-1456, Ρ-1458, Ρ-1459, Ρ1460,

143

52010 Β

<td></td><td>P-1461, P-1463, P-1464, P-1465, P-1467, P-1468, P-1469, P-1472, P-1473, P1474, P-1475, P-1476, P-1477, P-1478, P-1479, P-1480, P-1481, P-1482, P-1485, P1486, P-1512, P-1516, P-1522, P-1524, P-1525, P-1526, P-1527, P-1528, P-1529, P1530, P-1534, P-1538, P-1539, P-1542, P-1545, P-1546, P-1547, P-1548, P-1549, P1550, P-1554, P-1555, P-1556, P-1561, P-1564, P-1577, P-1581, P-1582, P-1583, P1584, P-1585, P-1589, P-1591, P-1592, P-1593, P-1595, P-1597, P-1603, P-1605, P1608, P-1609, P-1610, P-1614, P-1621, P-1622, P-1624, P-1625, P-1685</td>

Table 2k. Compounds with Flt1 kinase activity with IC50 &lt;10 μΜ

Fltl:

P-0001, P-0002, P-0003,

0013,

P-0016, P-0017, P-0018,

0032,

P-0033, P-0034, P-0036,

0056,

P-0067, P-0068, P-0072,

0103,

P-0112, P-0114, P-0127,

0184,

P-0194, P-0196, P-0206,

0278,

P-0287, P-0298, P-0302,

0373,

P-0383, P-0404, P-0409,

0483,

P-0486, P-0491, P-0514,

0624,

P-0629, P-0632, P-0636,

0691,

P-0700, P-0708, P-0721,

0771,

P-0773, P-0774, P-0777,

1002,

P-1008, P-1010, P-1018,

1160,

P-1181, P-l194, P-1246,

1260,

P-1261, P-1262, P-1266,

1366,

P-1370, P-1372, P-1373,

1411,

P-1415, P-1416, P-1417,

P-0004, P-0005, P-0008,

P-0019, P-0020, P-0021,

P-0037, P-0038, P-0039,

P-0078, P-0082, P-0088,

P-0134, P-0150, P-0154,

P-0211, P-0214, P-0224,

P-0315, P-0320, P-0325,

P-0421, P-0448, P-0455,

P-0515, P-0521, P-0550,

P-0640, P-0656, P-0668,

P-0733, P-0737, P-0749,

P-0805, P-0866, P-0868,

P-1021, P-1027, P-1082,

P-1247, P-1250, P-1251,

P-1269, P-1279, P-1289,

P-1383, P-1393, P-1395,

P-1418, P-1420, P-1422,

P-0009, P-0011, P-0012, PP-0024, P-0026, P-0027, PP-0041, P-0054, P-0055, PP-0090, P-0091, P-010l, PP- 0166, P-0177, P-0180, PP-0244, P-0269, P-0274, PP-0326, P-0337, P-0371, PP-0461, P-0470, P-0477, PP-0559, P-0579, P-0603, PP-0679, P-0683, P-0685, PP-0751, P-0757, P-0768, PP-0951, P-0958, P-0962, PP-1110, P- 1112, P-1147, PP-1255, P-1256, P-1259, PP-1317, P-1318, P-1365, PP-1403, P-1404, P-1406, PP-1423, P-1424, P-1425, P144

52010 Β

<td></td><td>1426, P-1427, P-1428, P-1429, P-1430, P-1431, P-1432, P-1433, P-1445, P-1446, P1447, P-1457, P-1460, P-1461, P-1462, P-1463, P-1464, P-1465, P-1467, P-1468, P- 1469, P-1472, P-1475, P-1486, P-1491, P-1492, P-1495, P-1497, P-1499, P-1502, P1505, P-1523, P-1526, P-1527, P-1528, P-1529, P-1530, P-1531, P-1532, P-1533, P1534, P-1541, P-1542, P-1544, P-1546, P-1547, P-I548, P-1549, P-1552, P-I553, P1554, P-1556, P-1557, P-1559, P-1564, P-1566, P-1567, P-1569, P-1570, P-1571, P1572, P-1575, P-1576, P-1577, P-1580, P-1581, P-1582, P-1583, P-1584, P-1585, P1586, P-1587, P-1589, P-1590, P-1591, P-1592, P-1593, P-1594, P-1595, P-1596, P- 1597, P-1598, P-1599, P-1600; P-1601, P-1602, P-1603, P-1605, P-1606, P-1608, P1609, P-1610, P-1612, P-1613, P-1614, P-1615, P-1618, P-1619, P-1621, P-1622, P1624, P-1625, P-1686</td>

Table 21. Compounds with Flt3 kinase activity with IC50 &lt;10 μΜ

<td>Flt3:</td><td>P-0088, P-0262, P-0409, P-0636, P-0806, P-1244, P-1280, P1318, P-1336, P-1394, P-1426</td>

Table 2m. Compounds with Flt4 kinase activity with IC 50 &lt;10 μΜ

<td>Flt4:</td><td>P-0001, P-0003, P-0005, P-0011, P-0012, P-0019, P-0024, P-0029, P-0032, P-0039, P-0040, P-0041, P-0090, P-0093, P-0097, P-0117, P-0142, P-0167, Ρ0190, P-0196, P-0204, P-0205, P-0206, P-0211, P-0215, P-0218, P-0224, P-0265, P-0316, P-0325, P-0335, P-0352, P-0418, P-0448, P-0452, P-0453, P-0495, P-0521, P-0544, P-0550, P-0559, P-0579, P-0594, P-0599, P-0617, P-0624, P-0632, P-0645, P-0656, P-0668, P-0679, P-0691, P-0703, P-0708, P-0737, P-0738, P-0751, P-0762, P-0771, P-0813</td>

145

52010 Β

Table 2η. Compounds with Fms kinase activity with IC50 &lt;10 μΜ

<td>Fms:</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P-0008, P-0009, P-0010, P-0012, P-0016, P-0019, P-0020, P-0021, P-0025, P-0026, P-0027, P-0032, P-0033, P-0034, P-0035, P-0036, P-0037, P-0038, P-0042, P-0045, P-0048, P-0054, P-0067, P-0068, P-0072, P-0078, P-0079, P-0082, P-0088, P-0090, P-0093, P-0101, P-0102, P-0103, P-0112, P-0114, P-0121, P-0129, P-0134, P-0145, P-0152, P-0166, P-0170, P-0175, P-0180, P-0184, P-0189, P-0196, P-0210, P-0211, P-0228, P-0233, P-0237, P-0239, P-0244, P-0257, P-0262, P-0269, P-0274, P-0284, P-0287, P-0291, P-0293, P-0297, P-0298, P-0302, P-0317, P-0325, P-0327, P-0333, P-0351, P-0369, P-0373, P-0383, P-0391, P-0396, P-0409, P-0418, P-0420, P-0421, P-0461, P-0483, P-0486, P-0491, P-0501, P-0515, P-0535, P-0559, P-0563, P-0613, P-0636, P-0656, P-0685, P-0721, P-0733, P-0753, P-0763, P-0771, P-0773, P-0774, P-0778, P-0798, P-0805, P-0806, P-0807, P-0811, P-0818, P-0835, P-0837, P-0848, P-0850, P-0851, P-0853, P-0854, P-0857, P-0867, P-0874, P-0876, P-0883, P-0885, P-0898, P-0911, P-0913, P-0919, P-0927, P-0931, P-0933, P-0952, P-0954, P-0955, P-0956, P-0958, P-1002, P-1008, P-1009, P-1013, P-1110, P-1112, P-1124, P-1194, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1255, P-1259, P-1260, P-1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1269, P-1279, P-1280, P-1281, P-1282, P-1289, P-1316, P-1317, P-1318, P-1321, P-1323, P-1324, P-1325, P-1326, P-1327, P-1328, P-1329, P-1330, P-1331, P-1332, P-1333, P-1334, P-1335, P-1336, P-1337, P-1338, P-1339, P-1340, P-1341, P-1342, P-1343, P-1344, P-1346, Pl 365, P-1366, P-1368, P-1369, P-1370, P-1372, P-1376, P-1380, P-1381, P-1384, P-1385, P-1386, P-1387, P-1388, P-1389, P-1390, P-1391, P-1392, P-1393, P-1394, P-1395, P-1397, P-1399, P-1400, P-1402, P-1403, P-1404, P-1405, P-1406, P-1409, P-1410, P-1411, P-1415, P-1416, P-1419, P-1420, P-1421, P-1423, P-1425, P-1426, P-1427, P-1428, P-1429,</td>

146

52010 Β

<td></td><td>Ρ-1430, Ρ-1431, Ρ-1432, Ρ-1433, Ρ-1445, Ρ-1447, Ρ-1448, Ρ-1449, Ρ-1450, Ρ-1451, Ρ-1452, 14-1453, Ρ-1454, Ρ-1455, Ρ-1456, Ρ-1457, Ρ-1458, Ρ-1459, Ρ-1460, Ρ-1461, 14-1462, Ρ-1463, Ρ-1464, Ρ-1465, Ρ-1466, Ρ-1467, Ρ-1468, Ρ-1469, Ρ-1470, Ρ-1471, 14-1472, Ρ-1473, Ρ-1474, Ρ-1475, Ρ-1476, Ρ-1477, Ρ-1478, Ρ-1479, Ρ-1480, Ρ-1481, 14-1482, Ρ-1483, Ρ-1485, Ρ-1486, Ρ-1488, Ρ-1489, Ρ-1490, Ρ-1491, Ρ-1492, Ρ-1493, 14-1494, Ρ-1495, Ρ-1496, Ρ-1497, Ρ-1498, Ρ-1499, Ρ-1500, Ρ-1501, Ρ-1502, Ρ-1503, 150-1504, 150-1505, Ρ-1506, Ρ-1511, Ρ-1522, Ρ-1525, Ρ-1526, Ρ-1527, Ρ-1528, Ρ-1529, Ρ-1530, Ρ-1532, Ρ-1534, Ρ-1541, Ρ-1542, Ρ-1544, Ρ-1545, Ρ-1546, Ρ-1547, Ρ-1548, Ρ-1549, Ρ-1552, Ρ-1553, Ρ-1554, Ρ-1555, Ρ-1556, Ρ-1558, Ρ-1559, Ρ-1564, Ρ-1566, Ρ-1567, Ρ-1568, Ρ-1569, Ρ-1570, Ρ-1571, Ρ-1572, Ρ-1575, Ρ-1576, Ρ-1580, Ρ-1581, Ρ-1583, Ρ-1586, Ρ-1587, Ρ-1589, Ρ-1591, Ρ-1594, Ρ-1595, Ρ-1596, Ρ-1597, Ρ-1598, Ρ-1599, Ρ-1602, Ρ-1606, Ρ-1608, Ρ-1609, Ρ-1610, Ρ-1611, Ρ-1612, Ρ-1613, Ρ-1615, Ρ-1616, 16-1618, Ρ-1621, Ρ-1625, 16-1627, Ρ-1630, Ρ-1631, Ρ-1636, Ρ-1637, Ρ-1638, 16-1639, Ρ-1652, Ρ-1653, Ρ-1654, Ρ-1656, Ρ-1657, Ρ-1660, Ρ-1663, Ρ-1664, Ρ-1665, Ρ-1670, Ρ-1671, Ρ-1685, Ρ-1687, Ρ-1700, Ρ-1701, Ρ-1702, Ρ-1703, Ρ-1704, Ρ-1705, 170-1706, Ρ-1707, Ρ-1708, Ρ-1709, Ρ-1710, Ρ-1711, Ρ-1712, Ρ-1713, Ρ-1714, Ρ-1715, Ρ-1716, Ρ-1717, Ρ-1718, Ρ-1719, Ρ-1720, Ρ-1721, Ρ-1722, Ρ-1723, Ρ-1724, Ρ-1725, Ρ-1726, Ρ-1727, Ρ-1728, Ρ-1729, Ρ-1730, Ρ-1731, Ρ-1732, Ρ-1733, Ρ-1734, Ρ-1735, Ρ-1736, 17-1737, Ρ-1738, Ρ-1739, Ρ-1740, Ρ-1741, Ρ-1742, Ρ-1746, Ρ-1747, Ρ-1748, Ρ-1749, Ρ-1750, Ρ-1751, Ρ-1753, Ρ-1754, Ρ-1755, Ρ-1756, Ρ-1757, Ρ-1758, Ρ-1759, Ρ-1760, Ρ-1761, Ρ-1762, Ρ-1763, Ρ-1764, Ρ-1765, Ρ-1766, Ρ-1767, Ρ-1768, Ρ-1769, Ρ-1771, Ρ-1772, Ρ-1773, Ρ-1774, Ρ-1775, Ρ-1776, Ρ-1778, Ρ-1779, Ρ-1780, Ρ-1781, Ρ-1782, Ρ-1783, Ρ-1784, Ρ-1796, Ρ-1798, Ρ-1799, Ρ-1800, Ρ-Ι802, Ρ-1803, Ρ-1804, Ρ-1816, Ρ-1817, Ρ-1818, Ρ-1819, Ρ-1821, Ρ-1822, Ρ-1827, Ρ-1828, Ρ-1839, Ρ-1840, Ρ-1864, Ρ-1871, Ρ-1872, Ρ-1873, Ρ-1878, Ρ-1879, Ρ-1881, Ρ-1882, 190-1907, Ρ-1912,</td>

147

52010 Β

<td></td><td>P-1916, P-1980, P-1996, P-1997, P-1998, P-2005, P-2006, P-2007, P-2012, P-2013</td>

Table 2ο. Compounds with kinase activity Iraq4 with IC50 &lt;10 μΜ

<td>Iraq4:</td><td>P-0002, P-0020, P-0076, P-0087, P-0091, P-</td>

<td></td><td> 0130</td>

Table 2p. Compounds with Jnkl kinase activity with IC50 &lt;10 μΜ

<td>Jnkl;</td><td>P-0001, P-0002, P-0003, P-0004, P-0006, P-0008, P-0009, P-0010, P-0015, P-0016, P-0021, P-0025, P-0026, P-0027, P-0032, P-0033, P-0034, P-0035, P-0036, P-0037, P-0038, P-0040, P-0042, P-0045, P-0052, P-0054, P-0056, P-0066, P-0078, P-0079, P-0082, P-0088, P-0090, P-0102, P-0112, P-0114, P-0121, P-0134, P-0140, P-0156, P-0184, P-0196, P-0204, P-0228, P-0244, P-0257, P-0269, P-0285, P-0297, P-0302, P-0308, P-0431, P-0448, P-0486, P-0521, P-0559, P-0579, P-0599, P-0624, P-0636, P-0668, P-0685, P-0691, P-0700, P-0721, P-0728, P-0734, P-0745, P-0753, P-0763, P-0774, P-0807, P-0848, P-0850, P-0851, P-0853, P-0860, P-0876, P-0897, P-0956, P-0958, P-0991, P-0997, P-1002, P-1008, P-1009, P-1021, P-1251, P-1253, P-1256, P-1260, P-1262, P-1266, P-1279, P-1280, P-1281, P-1288, P-1289, P-1317, P-1318, P-1336, P-1338, P-1343, P-1346, P-1347, P-1348, P-1349, P-1356, P-1359, P-1365, P-1366, P-1370, P-1384, P-1385, P-1390, P-1394, P-1400, P-1402, P-1432, P-1433, P-1445, P-1446, P-1447, P-1456, P-1458, P-1459, P-1465, P-1468, P-1473, P-1475, P-1486, P-1523, P-1534, P-1546, P-1547, P-1548, P-1549, P-1553, P-1554, P-1556, P-1566, P-1567, P-1570, P-1576, P-1577, P-1585, P-1589, P-1591, P-1592, P-1596, P-1602, P-1610, P-1611, P-1618, P-1621, P-1627, P-1631, P-1636, P-1637, P-1638, P-1639, P-1656, P-1660, P-1687, P-1702, P-1706, P-1707, P-1708, P-1720, P-1722, P-1723, P-1724, P-1725, P-1727, P-1730, P-1731, P-1742, P-1748, P-1749, P-1750, P-1751, P-1755, P-1756, P-1757, P-1759, P-1760, P-1764, P-1765, P-1767, P-1770, P-1775, P-1776, P-1777, P-1778, P-1779, P-1827, P-1828, P-1839, P-1842, P-1864,</td>

148

52010 Β

<td></td><td>P-1873, P-1878, P-1879, P-1896, P-1897, P-1898, P-2007</td>

<td colspan="2">Table 2q. Compounds with Jnk2 kinase activity with IC50 &lt;10 μΜ</td>

<td>Jnk2:</td><td>P-0001, P-0005, P-0006, P-0009, P-0013, P-0015, P-0016, P-0025, P-0027, R-OOZZ, P-0034, P-0035, P-0040, P-0042, P-0052, P-0054, P-0056, P-0066, P-0069, P-0079, P-0082, P-0088, P-0090, P-0121, P-0140, P-0142, P-0156, P-0184, P-0196, P-0204, P-0228, P-0238, P-0269, P-0285, P-0297, P-0308, P-0448, P-0486, P-0521, P-0579, P-0594, P-0599, P-0623, P-0685, P-0700, P-0721, P-0734, P-0744, P-0746, P-0774, P-1253, P-1318, P-1445, P-1447, P-1486, P-1547, P-1548, P-1554, P-1566, P-1567, P-1570, P-1575, P-1576, P-1589, P-1591, P-1602, P-1611, P-1621, P-1627, P-1656, P-1671, P-1687, P-1700, P-1702, P-1711, P-1720, P-1722, P-1723, P-1724, P-1727, P-1728, P-1729, P-1730, P-1731, P-1732, P-1737, P-1742, P-1748, P-1749, P-1750, P-1751, P-1753, P-1755, P-1756, P-1757, P-1759, P-1760, P-1764, P-1765, P-1767, P-1770, P-1776, P-1777, P-1778, P-1779, P-1827, P-1828, P-1864, P-2007</td>

<td colspan="2">Table 2r. Compounds with JpkZ kinase activity with IC50 &lt;10 μΜ</td>

<td>JpkZ:</td><td>P-0001, P-0002, P-0003, P-0004, P-0006, P-0008, P-0009, P-0010, P-0015, P-0016, P-0024, P-0025, P-0026, P-0027, P-0031, P-0032, P-0033, P-0034, P-0035, P-0036, P-0037, P-0038, P-0040, P-0041, P-0045, P-0047, P-0052, P-0054, P-0056, P-0058, P-0059, P-0066, P-0078, P-0079, P-0080, P-0088, P-0089, P-0090, P-0093, P-0102, P-0112, P-0114, P-0115, P-0117, P-0122, P-0132, P-0133, P-0134, P-0165, P-0166, P-0167, P-0176, P-0179, P-0184, P-0189, P-0190, P-0196, P-0204, P-0211, P-0213, P-0218, P-0228, P-0238, P-0244, P-0257, P-0263, P-0269, P-0279, P-0285, P-0300, P-0308, P-0313, P-O32O, P-0371, P-0378, P-0448, P-0483, P-0521, P-0550, P-0559, P-0562, P-0579, P-0594, P-0599, P-0604, P-0624, P-0625, P-0632, P-0636, P-0640, P-0645, P-0656, P-0659, P-0668, P-0671, P-0675, P-0682, P-0683, P-0691, P-0697, P-0698, P-0703, P-0710, P-0716, P-0734, P-0738, P-0753, P-0755, P-0757,</td>

149

52010 Β

<td></td><td>07-0763, 07-0774, Ρ-0778, Ρ-0807, Ρ-0822, Ρ-0851, Ρ-0951, Ρ-0962, Ρ-0991, Ρ-1002, Ρ-1005, Ρ-1008, Ρ-1010, Ρ-1011, Ρ-1016, Ρ-1018, Ρ-1021, Ρ-1022, Ρ-1032, Ρ-1082, Ρ-1087, 10-1088, Ρ-1253, Ρ-1279, Ρ-1280, Ρ-1289, Ρ-1317, Ρ-1318, Ρ-1346, Ρ-1347, 13-1348, Ρ-1349, Ρ-1355, Ρ-1356, Ρ-1359, Ρ-1372, Ρ-1375, Ρ-1384, Ρ-1385, Ρ-1394, 14-1400, Ρ-1445, Ρ-1447, Ρ-1458, Ρ-1465, Ρ-1468, Ρ-1473, Ρ-1475, Ρ-1477, Ρ-1485, 14-1486, Ρ-1489, Ρ-1490, Ρ-1505, Ρ-1529, Ρ-1534, Ρ-1546, Ρ-1547, Ρ-1548, Ρ-1554, Ρ-1561, Ρ-1566, Ρ-1567, Ρ-1570, Ρ-1576, Ρ-1577, Ρ-1585, Ρ-1589, Ρ-1591, Ρ-1592, Ρ-1610, Ρ-1611, Ρ-1618, Ρ-1621, Ρ-1636, Ρ-1687, Ρ-1702, Ρ-1703, Ρ-1704, Ρ-1706, Ρ-1707, Ρ-1713, Ρ-1716, Ρ-1720, Ρ-1722, Ρ-1724, Ρ-1742, Ρ-1748, Ρ-1749, Ρ-1750, 17-1753, Ρ-1756, Ρ-1757, Ρ-1759, Ρ-1764, Ρ-1765, Ρ-1767, Ρ-1770, Ρ-1775, Ρ-1776, Ρ-1777, Ρ-1827, Ρ-1828, Ρ-1864, Ρ-2007</td>

150

52010 Β

Table 2s. Compounds with Kdr kinase activity with IC50 &lt;10 μΜ

<td>Kdr:</td><td>P-0001, P-0003, P-0005, P-0006, P-0007, P-0009, P-0011, P-0012, P-0013, P-0014, P-0015, P-0016, P-0017, P-0018, P-0019, P-0020, P-0021, P-0022, P-0023, P-0024, P-0025, P-0027, P-0028, P-0029, P-0030, P-0031, P-0032, R-OOZZ, P-0039, P-0040, P-0041, P-0042, P-0043, P-0044, P-0045, P-0046, P-0048, P-0049, P-0050, P-0051, P-0052, P-0053, P-0054, P-0055, P-0056, P-0057, P-0059, P-0060, P-0061, P-0063, P-0064, P-0065, P-0067, P-0068, P-0069, P-0070, P-0071, P-0073, P-0074, P-0075, P-0076, P-0077, P-0078, P-0080, P-0081, P-0082, P-0084, P-0085, P-0086, P-0087, P-0088, P-0089, P-0090, P-0091, P-0092, P-0093, P-0096, P-0097, P-0098, P-0100, P-0101, P-0102, P-0103, P-0105, P-0106, P-0107, P-0108, P-0110, P-0111, P-0112, P-0113, P-0114, P-0115, P-0117, P-0120, P-0122, P-0125, P-0126, P-0127, P-0128, P-0129, P-0130, P-0131, P-0133, P-0134, P-0135, P-0136, P-0137, P-0139, P-0140, P-0141, P-0142, P-0143, P-0144, P-0145, P-0147, P-0149, P-0152, P-0157, P-0158, P-0161, P-0162, P-0163, P-0164, P-0165, P-0167, P-0168, P-0169, P-0170, P-0172, P-0173, P-0174, P-0175, P-0176, P-0177, P-0179, P-0180, P-0182, P-0184, P-0189, P-0190, P-0192, P-0194, P-0195, P-0196, P-0197, P-0198, P-0199, P-0202, P-0203, P-0204, P-0206, P-0212, P-0213, P-0216, P-0218, P-0224, P-0225, P-0226, P-0230, P-0234, P-0242, P-0243, P-0260, P-0261, P-0262, P-0267, P-0268, P-0269, P-0270, P-0274, P-0279, P-0287, P-0288, P-0289, P-0293, P-0295, P-0296, P-0299, P-0308, P-0316, P-0319, P-0320, P-0321, P-0322, P-0326, P-0337, P-0339, P-0369, P-0376, P-0379, P-0391, P-0409, P-0418, P-0427, P-0448, P-0455, P-0458, P-0473, P-0482, P-0495, P-0521, P-0550, P-0559, P-0562, P-0579, P-0611, P-0623, P-0624, P-0632, P-0640, P-0645, P-0668, P-0679, P-0683, P-0691, P-0703, P-0708, P-0730, P-0737, P-0738, P-0751, P-0762, P-0771, P-0777, P-0796, P-0806, P-0813, P-0933, P-0951, P-0956, P-0962, P-0981, P-1023, P-1244, P-1280, P-1318, P-1394, P-1426</td>

151

52010 Β

Table 2t. Compounds with kinase activity Kit with IC50S 10 μΜ

<td>Kit:</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P-0008, P-0009, P-0011, P-0012, P-0013, P-0016, P-0017, P-0018, P-0019, P-0020, P-0021, P-0024, P-0026, P-0027, P-0028, P-0029, P-0030, P-0031, P-0032, P-0033, P-0034, P-0035, P-0036, P-0037, P-0038, P-0039, P-0040, P-0041, P-0042, P-0050, P-0054, P-0056, P-0059, P-0064, P-0067, P-0069, P-0072, P-0078, P-0079, P-0080, P-0082, P-0086, P-0088, P-0090, P-0093, P-0097, P-0101, P-0102, P-0103, P-0112, P-0114, P-0115, P-0117, P-0120, P-0121, P-0122, P-0123, P-0127, P-0129, P-0132, P-0133, P-0134, P-0136, P-0140, P-0142, P-0152, P-0154, P-0157, P-0166, P-0167, P-0168, P-0171, P-0175, P-0176, P-0179, P-0180, P-0184, P-0189, P-0190, P-0195, P-0196, P-0204, P-0205, P-0206, P-0210, P-0211, P-0213, P-0216, P-021Ί, P-0218, P-0224, P-0233, P-0235, P-0237, P-0244, P-0248, P-0253, P-0257, P-0262, P-0263, P-0265, P-0269, P-0274, P-0279, P-0284, P-0287, P-0289, P-0293, P-0298, P-0300, P-0302, P-0304, P-0315, P-0316, P-0321, P-0323, P-0325, P-0326, P-0333, P-0341, P-0346, P-0352, P-0367, P-0369, P-0371, P-0373, P-0378, P-0384, P-0385, P-0391, P-0392, P-0396, P-0402, P-0404, P-0409, P-0411, P-0418, P-0420, P-0421, P-0427, P-0447, P-0448, P-0450, P-0453, P-0459, P-0461, P-0473, P-0483, P-0491, P-0495, P-0499, P-0501, P-0511, P-0519, P-0521, P-0535, P-0550, P-0554, P-0556, P-0559, P-0561, P-0562, P-0563, P-0579, P-0594, P-0599, P-0604, P-0611, P-0613, P-0617, P-0623, P-0624, P-0625, P-0626, P-0632, P-0636, P-0640, P-0644, P-0645, P-0647, P-0656, P-0658, P-0659, P-0668, P-0671, P-0679, P-0682, P-0683, P-0685, P-0690, P-0691, P-0693, P-0697, P-0699, P-0700, P-0703, P-0708, P-0721, P-0733, P-0736, P-0737, P-0738, P-0749, P-0751, P-0753, P-0755, P-0757, P-0762, P-0763, P-0771, P-0773, P-0774, P-0776, P-0778, P-0794, P-0796, P-0798, P-0800, P-0806, P-0810, P-0813, P-0815, P-0818, P-0825, P-0835, P-0837, P-0848, P-0850, P-0851, P-0853, P-0854, P-0857, P-0860, P-0861, P-0865, P-0866, P-0867, P-0874, P-0876, P-0877, P-0885, P-0889,</td>

152

52010 Β

<td></td><td>Ρ-0898, Ρ-0905, Ρ-0907, Ρ-0910, Ρ-0911, Ρ-0913, Ρ-0919, Ρ-0924, Ρ-0927, Ρ-0931, Ρ-0933, Ρ-0935, Ρ-0937, Ρ-0951, Ρ-0952, Ρ-0954, Ρ-0955, Ρ-0956, Ρ-0958, Ρ-0962, Ρ-0964, 09-0978, Ρ-0983, Ρ-1002, Ρ-1008, Ρ-1009, Ρ-1010, Ρ-1013, Ρ-1016, Ρ-1018, Ρ-1021, 10-1033, Ρ-1082, Ρ-1084, Ρ-1096, Ρ-1110, Ρ-1112, Ρ-1160, Ρ-1181, Ρ-1194, Ρ-1246, Ρ-1247, Ρ-1249, Ρ-1250, Ρ-1251, Ρ-1252, Ρ-1253, Ρ-1254, Ρ-1255, Ρ-1256, Ρ-1257, Ρ-1259, Ρ-1260, Ρ-1261, Ρ-1262, Ρ-1263, Ρ-1264, Ρ-1266, Ρ-1267, Ρ-1268, Ρ-1269, Ρ-1275, Ρ-1279, Ρ-1280, Ρ-1281, Ρ-1289, Ρ-1316, Ρ-1317, Ρ-1318, Ρ-1320, Ρ-1321, Ρ-1323, Ρ-1329, Ρ-1336, Ρ-1338, Ρ-1341, Ρ-1343, Ρ-1346, Ρ-1347, Ρ-1348, Ρ-1349, Ρ-1365, Ρ-1366, Ρ-1367, Ρ-1368, Ρ-1369, Ρ-1370, Ρ-1372, Ρ-1376, Ρ-1380, 13-1382, Ρ-1383, Ρ-1384, Ρ-1385, Ρ-1386, Ρ-1387, Ρ-1388, Ρ-1389, Ρ-1390, Ρ-1391, Ρ-1392, Ρ-1393, Ρ-1394, Ρ-1395, Ρ-1396, Ρ-1397, Ρ-1399, Ρ-1400, Ρ-1402, Ρ-1403, Ρ-1404, 140-1406, Ρ-1407, Ρ-1408, Ρ-1409, Ρ-1410, Ρ-1411, Ρ-1413, Ρ-1414, Ρ-1415, Ρ-1416, Ρ-1417, Ρ-1419, Ρ-1420, Ρ-1422, Ρ-Ι423, Ρ-1424, Ρ-1425, Ρ-1426, Ρ-1427, Ρ-1428, Ρ-1429, Ρ-1430, Ρ-1431, Ρ-1432, Ρ-1433, Ρ-1445, Ρ-1446, Ρ-1447, Ρ-1449, Ρ-1450, Ρ-1451, Ρ-1452, Ρ-1453, Ρ-1454, Ρ-1455, Ρ-1456, Ρ-1457, Ρ-1458, Ρ1460, Ρ-1461, Ρ-1462, Ρ-1463, Ρ-1464, Ρ-1465, Ρ-1466, Ρ-1467, Ρ-1468, Ρ-1469, Ρ-1470, 14-1471, Ρ-1472, Ρ-1474, Ρ-1475, Ρ-1476, Ρ-1478, Ρ-1479, Ρ-1480, Ρ-1481, Ρ-1482, Ρ-1483, Ρ-1484, Ρ-1486, Ρ-1488, Ρ-1489, Ρ-1490, Ρ-1493, Ρ-1495, Ρ-1497, Ρ-1498, Ρ-1499, 1500-1500, Ρ-1501, Ρ-1502, Ρ-1503, Ρ-1505, Ρ-1506, Ρ-1514, Ρ-1521, Ρ-1522, Ρ-1525, Ρ-1526, Ρ-1527, Ρ-1528, Ρ-1529, Ρ-1530, Ρ-1531, Ρ-1532, Ρ-1534, Ρ-1538, Ρ-1541, Ρ-1542, Ρ-1543, Ρ-1544, Ρ-1545, Ρ-1546, Ρ-1547, Ρ-1548, Ρ-1549, Ρ-1550, Ρ-1551, Ρ-1552, Ρ-1553, Ρ-1554, Ρ-1557, Ρ-1559, Ρ-Ι562, Ρ-1564, Ρ-1565, Ρ-1566, Ρ-1567, Ρ-1568, Ρ-1569, Ρ-1574, Ρ-1575, Ρ-1576, Ρ-1578, Ρ-1580, Ρ-1581, Ρ-1582, Ρ-1583, Ρ-1590, Ρ-1591, Ρ-1593, Ρ-1598, Ρ-1599, Ρ-1605, Ρ-1630, Ρ-1671, Ρ-1685, Ρ-1700, Ρ-1703, Ρ-1704, Ρ-1705, Ρ-1706, Ρ-1707, Ρ-1708, Ρ-1709, 17-1711, Ρ-1712,</td>

153

52010 Β

<td></td><td>P-1713, P-1714, P-1718, P-1719, P-1720, P-1733, P-1737, P-1739, P-1740, P-1767, P-1776, P-1783, P-1798, P-1822, P-1839, P-1840, P-1864, P-1865, P-1871, P-1872, P-1873, P-1878, P-1879, P-1881, P-1882, P-1980, P-1996, P-1997, P-1998</td>

Table 2u. Compounds with premaΑΡ2Κ1 kinase activity with IC50 &lt;10 μΜ

<td>ΡΑΡ2Κ.1:</td><td>P-0001, P-0002, P-0003, P-0005, P-0006, P-0008, P-0010, P0011, P-0012, P-0014, P-0015, P-0017, P-0018, P-0022, P-0023, P-0029, P-0031, P0041, P-0046, P-0051, P-0057, P-0058, P-0061, P-0076, P-0079, P-0081, P-0087, P0098, P-0099, P-0105, P-0108, P-0111, P-0120, P-0149, P-0152, P-0158, P-0167, P0170, P-0177, P-0194, P-0198, P-0331, P-0337, P-0568, P-0806</td>

Table 2c. Compounds with MAPKAPK2 kinase activity with IC 50 &lt;10 μΜ

<td>MAPKAPK 2:</td><td>P-0007, P-0041, P-0057, P-0058, P-0077, P-0086, P0104, P-0106, P-0151, P-0226</td>

Table 2w. Compounds with Met kinase activity with IC50 &lt;10 μΜ

<td>Met:</td><td>P-0001, P-0002, P-0004, P-0006, P-0008, P-0009, P-0015, P-0016, P-0020, P-0026, P-0027, P-0028, P-0034, P-0035, P-0037, P-0038, P-0041, P-0052, P-0054, P-0058, P-0066, P-0076, P-0078, P-0082, P-0101, P-0114, P-0117, P-0140, P-0146, P-0149, P-0156, P-0165, P-0184, P-0228, P-0262, P-0269, P-0320, P-0325, P-0369, P-0419, P-0542, P-0550, P-0675, P-0685, P-0700, P-0716, P-0721, P-0746, P-0761, P-0763, P-0773, P-0778, P-0781, P-0811, P-0822, P-0842, P-0951, P-0962, P-1008, P-1012, P-1023, P-1037, P-1068, P-1092, Pl 114, Pl 132, P-1280, P-1394, P-1465, P-1527</td>

154

52010 Β

Table 2χ. Compounds with p38 kinase activity with IC50 &lt;10 μΜ

<td>p38:</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0008, P0010, P-0016, P-0019, P-0025, P-0026, P-0027, P-0028, P-0032, P-0034, P-0035, P0036, P-0037, P-0038, P-0041, P-0045, P-0050, P-0056, P-0058, P-0059, P-0066, P0068, P-0079, P-0082, P-0088, P-0090, P-0093, P-0112, P-0114, P-0122, P-0134, P0155, P-0156, P-0158, P-0163, P-0167, P-0170, P-0184, P-0190, P-0196, P-0204, P0205, P-0210, P-0228, P-0244, P-0257, P-0262, P-0267, P-0297, P-0302, P-0308, P0369, P-0442, P-0448, P-0511, P-0519, P-0521, P-0550, P-0559, P-0579, P-0594, P0599, P-0604, P-0611, P-0624, P-0636, P-0645, P-0668, P-0671, P-0679, P-0685, P0691, P-0699, P-0700, P-0703, P-0708, P-0716, P-0721, P-0728, P-0734, P-0738, P0744, P-0745, P-0746, P-0751, P-0753, P-0757, P-0763, P-0773, P-0774, P-0776, P0798, P-0806, P-0807, P-0841, P-0842, P-0868, P-0884, P-0887, P-0933, P-1042, Ρ1046</td>

Table 2y. Compounds with PDGFRB kinase activity with IC50S 10 μΜ ~ PDGFRB: P-0088, P-0262

Table 2z. Compounds with Piml kinase activity with IC 50 &lt;10 μΜ

<td>Piml:</td><td>P-0024, P-0090</td>

Table 2aa. Compounds with PKC theta kinase activity with IC 50 &lt;1 0 μΜ

<td>PKC theta:</td><td>P-0001, P-0002, P-0003, P-0004, P-0006, P-0008, P-0011, P-0012, P-0013, P-0014, P-0017, P-0019, P-0020, P-0021, P-0022, P-0024, P-0025, P-0026, P-0030, P-0031, P-0039, P-0044, P-0046, P-0049, P-0051, P-0055, P-0057, P-0060, P-0063, P-0069, P-0070, P-0109, P-0112, P-0238, P-0270</td>

155

52010 Β

Table 2bb. Compounds with Pyk2 kinase activity with IC50 &lt;10 μΜ

<td>Pyk2:</td><td>P-0001, P-0010, P-0015, P-0018, P-0021, P-0024, P-0032, P-0041, P-0052, P-0056, P-0058, P-0069, P-0078, P-0086, P-0088, P-0095, P-0112, P-0116, P-0122, P-0137, P-0142, P-0166, P-0178, P-0188, P-0257, P-0262, P-0269, P-0287, P-0318, P-0320, P-0356, P-0369, P-0396, P-0486, P-0501, P-0521, P-0529, P-0550, P-0559, P-0562, P-0611, P-0636, P-0685, P-0697, P-0700, P-0728, P-0753, P-0806, P-0818, P-0837, P-0848, P-0850, P-0851, P-0857, P-0861, P-0866, P-0867, P-0874, P-0883, P-0897, P-0898, P-0910, P-0911, P-0912, P-0919, P-0924, P-0928, P-0944, P-0946, P-0947, P-0957, P-0964, P-0978, P-0991, P-0997, P-1002, P-1010, P-1418, P-1069, P-1280, P-1281, P-1282, P-1288, P-1316, P-1349, P-1365, P-1367, P-1368, P-1370, P-1372, P-1373, P-1375, P-1376, P-1377, P-1379, P-1380, P-1381</td>

Table 2cc. Compounds with Ret kinase activity with IC50 &lt;10 μΜ

<td>Ret:</td><td>P-0001, P-0001, P-0002, P-0003, P-0003, P-0004, P-0005, P-0005, P-0006, P-0008, P-0009, P-0010, P-0011, P-0012, P-0013, P-0014, P-0015, P-0016, P-0017, P-0019, P-0020, P-0022, P-0024, P-0025, P-0026, P-0027, P-0028, P-0028, P-0029, P-0032, P-0032, R-OOZZ, P-0034, P-0035, P-0036, P-0037, P-0038, P-0039, P-0040, P-0040, P-0041, P-0041, P-0042, P-0043, P-0044, P-0045, P-0046, P-0047, P-0048, P-0049, P-0050, P-0051, P-0052, P-0053, P-0054, P-0055, P-0056, P-0058, P-0059, P-0060, P-0061, P-0062, P-0063, P-0064, P-0065, P-0066, P-0069, P-0070, P-0071, P-0072, P-0073, P-0075, P-0078, P-0079, P-0082, P-0083, P-0085, P-0088, P-0089, P-0090, P-0094, P-0095, P-0096, P-0097, P-0099, P-0100, P-0101, P-0102, P-0103, P-0107, P-0108, P-0109, P-0110, P-0113, P-0114, P-0115, P-0116, P-0117, P-0119, P-0121, P-0122, P-0123, P-0124, P-0134, P-0135, P-0137, P-0138, P-0139, P-0140, P-0141, P-0142, P-0148, P-0152, P-0156, P-0158, P-0159, P-0165, P-0167, P-0171, P-0175, P-0179, P-0181, P-0184, P-0186, P-0190, P-0196, P-0196, P-0204, P-0205, P-0206,</td>

156

52010 Β

<td></td><td>Ρ-0210, Ρ-0211, Ρ-0215, Ρ-0218, Ρ-0224, Ρ-0228, Ρ-0231, Ρ-0232, Ρ-0236, Ρ-0244, Ρ-0244, Ρ-0245, Ρ-0246, Ρ-0248, Ρ-0250, Ρ-0257, Ρ-0262, Ρ-0265, Ρ-0269, Ρ-0280, Ρ-0286, Ρ-0289, Ρ-0293, Ρ-0297, Ρ-0302, Ρ-0304, Ρ-0307, ​​Ρ-0308, Ρ-0314, 03-0316, Ρ-0316, Ρ-0320, Ρ-0320, Ρ-0321, Ρ-0325, Ρ-0329, Ρ-0339, Ρ-0341, Ρ-0344, Ρ-0347, Ρ-0351, Ρ-0352, Ρ-0363, Ρ-0367, Ρ-0369, Ρ-0371, Ρ-0378, Ρ-0385, Ρ-0392, Ρ-0396, 04-0412, Ρ-0418, Ρ-0434, Ρ-0448, Ρ-0448, Ρ-0452, Ρ-0453, Ρ-0453, Ρ-0469, Ρ-0472, 04-0486, Ρ-0495, Ρ-0501, Ρ-0501, Ρ-0517, Ρ-0520, Ρ-0521, Ρ-0521, Ρ-0533, Ρ-0536, Ρ-0542, Ρ-0550, Ρ-0550, Ρ-0559, Ρ-0559, Ρ-0561, Ρ-0579, Ρ-0594, Ρ-0596, Ρ-0599, Ρ-0599, Ρ-0604, Ρ-0608, Ρ-0611, Ρ-0623, Ρ-0623, Ρ-0624, Ρ-0624, Ρ-0632, Ρ-0636, Ρ-0638, Ρ-0640, Ρ-0644, Ρ-0645, Ρ-0645, Ρ-0647, Ρ-0656, Ρ-0659, Ρ-0668, Ρ-0668, Ρ-0671, Ρ-0675, Ρ-0678, Ρ-0679, Ρ-0682, Ρ-0683, Ρ-0691, Ρ-0693, Ρ-0697, Ρ-0698, Ρ-0699, Ρ-0700, Ρ-0703, Ρ-0708, Ρ-0710, Ρ-0716, Ρ-0721, Ρ-0726, Ρ-0728, Ρ-0730, Ρ-0734, Ρ-0735, Ρ-0736, Ρ-0737, Ρ-0738, Ρ-0744, Ρ-0745, Ρ-0746, Ρ-0749, 07-0751, Ρ-0753, Ρ-0757, Ρ-0761, Ρ-0762, Ρ-0763, Ρ-0771, Ρ-0778, Ρ-0794, Ρ-0795, 07-0796, Ρ-0807, Ρ-0810, Ρ-0811, Ρ-0813, Ρ-0822, Ρ-0825, Ρ-0826, Ρ-0835, Ρ-0841, Ρ-0863, 08-0865, Ρ-0881, Ρ-0939, Ρ-0976, Ρ-0977, Ρ-0985, Ρ-0998, Ρ-1000, Ρ-1005, 100-1007, Ρ-1011, Ρ-1019, Ρ-1024, Ρ-1025, Ρ-1026, Ρ-1029, Ρ-1031, Ρ-1033, Ρ-1036, Ρ-1066, 10-1072, Ρ-1073, Ρ-1075, Ρ-1081, Ρ-1085, Ρ-1089, Ρ-1097, Ρ-1111, Ρ-1113, Ρ-1115, Ρ-1117, Ρ-1119, Ρ-1121, Ρ-1125, Ρ-1126, Ρ-1129, Ρ-1130, Ρ-1133, Ρ-1134, Ρ-1135, Ρ-1137, Ρ-1178, Ρ-1181, Ρ-1185, Ρ-1188, Ρ-1189, Ρ-1191, Ρ-1192, Ρ-1193, 11-1196, Ρ-1198, Ρ-1240, Ρ-1201</td>

157

52010Β

Tabcia 2dd. Compounds with Src kinase activity with IC50 &lt;10 μΜ

<td>Heart:</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P-0008, P-0009, P-0010, P-0016, P-0017, P-0021, P-0025, P-0026, P-0027, P-0028, P-0032, P-0034, P-0035, P-0036, P-0037, P-0038, P-0040, P-0041, P-0045, P-0055, P-0067, P-0068, P-0072, P-0078, P-0079, P-0082, P-0088, P-0090, P-0102, P-0112, P-0114, P-0134, P-0152, P-0166, P-0171, P-0196, P-0209, P-0210, P-0237, P-0244, P-0269, P-0302, P-0316, P-0320, P-0373, P-0396, P-0448, P-0453, P-0483, P-0501, P-0515, P-0521, P-0550, P-0559, P-0562, P-0599, P-0623, P-0624, P-0645, P-0647, P-0668, P-0685, P-0700, P-0721, P-0753, P-0763, P-0771, P-0774, P-0805, P-0806, P-0807, P-0818, P-0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0866, P-0874, P-0876, P-0877, P-0885, P-0889, P-0898, P-0907, P-0910, P-0933, P-0950, P-0952, P-0955, P-0956, P-0958, P-0997, P-1009, P-1010, P-1013, P-1020, P-1021, Pl 181, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1254, P-1255, P-1256, P-1257, P-1258, P-1261, P-1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1269, P-1280, P-1281, P-1288, P-1289, P-1316, P-1317, P-1318, P-1336, P-1338, P-1343, P-1345, P-1346, P-1347, P-1348, P-1349, P-1366, P-1383, P-1384, P-1385, P-1387, P-I388, P-1390, P-1391, P-1394, P-1396, P-1397, P-1398, P-1399, P-1403, P-1416, P-1417, P-1431, P-1432, P-1433, P-1445, P-1446, P-1447, P-1448, P-1451, P-1457, P-1459, P-1469, P-1472, P-1473, P-1475, P-1476, P-1477, P-1478, P-1479, P-1480, P-1481, P-1484, P-1485, P-1486, P-1495, P-1496, P-1506, P-1527, P-1530</td>

158

52010 Β

Table 2ee. Compounds with Stk6 kinase activity with IC50 &lt;10 μΜ

<td>Stk6:</td><td>P-0001, P-0002, P-0003, P-0007, P-0008, P-0009, P-0010, P-0011, P-0013, P-0014, P-00I5, P-0018, P-0020, P-0022, P-0023, P-0029, P-0030, P-0031, P-0032, P-0033, P-0035, P-0040, P-0041, P-0042, P-0043, P-0044, P-0045, P-0046, P-0049, P-0051, P-0052, P-0054, P-0056, P-0057, P-0058, P-0060, P-0061, P-0063, P-0064, P-0065, P-0069, P-0070, P-0071, P-0076, P-0077, P-0080, P-0081, P-0082, P-0086, P-0087, P-0088, P-0091, P-0092, P-0093, P-0094, P-0098, P-0099, P-0100, P-0101, P-0104, P-0105, P-0106, P-0110, P-0111, P-0115, P-0117, P-0118, P-0119, P-0120, P-0123, P-0127, P-0128, P-0129, P-0131, P-0132, P-0133, P-0136, P-0140, P-0143, P-0146, P-0147, P-0148, P-0153, P-0154, P-0155, P-0157, P-0160, P-0162, P-0163, P-0164, P-0169, P-0172, P-0173, P-0174, P-0176, P-0177, P-0179, P-0181, P-0185, P-0187, P-0188, P-0189, P-0191, P-0193, P-0199, P-0201, P-0202, P-0203, P-0206, P-0207, P-0208, P-0212, P-0213, P-0214, P-0221, P-0225, P-0235, P-0237, P-0249, P-0250, P-0251, P-0253, P-0260, P-0261, P-0269, P-0272, P-0276, P-0279, P-0281, P-0283, P-0287, P-0290, P-0295, P-0300, P-0313, P-0317, P-0319, P-0322, P-0345, P-0348, P-0355, P-0370, P-0372, P-0406, P-0407, P-0417, P-0419, P-0426, P-0436, P-0441, P-0445, P-0469, P-0471, P-0489, P-0546, P-0806, P-0885, P-0933, P-0955, P-1013, P-1280, P-1336, P-1394, P-1426</td>

159

52010 Β

Table 2ff. Compounds with Yes kinase activity with IC 50 &lt;10 μΜ

<td>Yes:</td><td>P-0005, P-0007, P-0010, P-0011, P-0012, P-0013, P-0014, P-0015, P-0016, P-0017, P-0019, P-0020, P-0021, P-0022, P-0024, P-0027, P-0028, P-0029, P-0031, P-0033, P-0036, P-0040, P-0042, P-0043, P-0044, P-0045, P-0046, P-0047, P-0048, P-0049, P-0050, P-0051, P-0052, P-0053, P-0055, P-0056, P-0059, P-0060, P-0061, P-0062, P-0063, P-0065, P-0067, P-0068, P-0070, P-0072, P-0074, P-0075, P-0081, P-0082, P-0083, P-0088, P-0090, P-0093, P-0095, P-0097, P-0101, P-0102, P-0107, P-0109, P-0112, P-0122, P-0124, P-0125, P-0126, P-0129, P-0134, P-0138, P-0139, P-0145, P-0152, P-0153, P-0161, P-0162, P-0166, P-0171, P-0175, P-0188, P-0202, P-0209, P-0210, P-0230, P-0237, P-0271, P-0283, P-0310, P-0327, P-0483, P-0636</td>

Table 2gg. Compounds with Zap70 kinase activity with 1Szo &lt;10 μΜ

<td>Zap70:</td><td>P-0001, P-0004, P-0015, P-0030, P-0032, P-0033, P-0034, P0035, P-0037, P-0038, P-0040, P-0041, P-0047, P-0058, P-0123, P-0193, P-0195, P0205, P-0218, P-0228, P-0249, P-0275, P-0296, P-0310, P-0320, P-0342, P-0348, P0359, P-0360, P-0378, P-0379, P-0387, P-0394, P-0434, P-0442, P-0456, P-0476, P0484, P-0495, P-0500, P-0507, P-0523, P-0550, P-0586, P-0602, P-0607, P-0611, P0624, P-0642, P-0649, P-0675, P-0676, P-0694, P-0698, P-0703, P-0716, P-0724, P0727, P-0755, P-0795, P-0808, P-0836, P-0842, P-0856, P-0859, P-0865, P-0875, P0878, P-0880, P-0888, P-0929, P-0930, P-0953, P-0982, P-0996, P-1000, P-1005, P1019, P-1051, P-1073, P-1081, P-1089, Pl 119, Pl 184, P-1197</td>

Table 2xh. Compounds with Akt3 kinase activity with IR₅₀ &lt;10 μΜ

<td>Act3:</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0008, P-0019, P-0021, P-0024, P-0025, P-0026, P-0027, P-0034, P-0035, P-0036, P-0037, P-0038, P-0041, P-0048, P-0055, P-0057, P-0058, P-0060, P-0067, P-0099, P-0112, P-0114, P-0122, P-0127, P-0154, P-0196, P-0270, P-0278, P-0307, ​​P-0329, P-0404, P-0436, P-0573, P-0861,</td>

160

52010 Β

<td></td><td>P-0866, P-0883, P-0890, P-0924, P-0936, P-0940, P-0951, P-0952, P-0958, P-0962, P-0978, P-0990, P-0995, P-1010, P-1016, P-1018, P-1021, P-1022, P-1027, P-1034, P-1039, P-1040, P-1043, P-1047, P-1060, P-1062, P-1082, P-1095, Pl 139, P-1145, P-1147, P-1150, P-1155, P-1158, P-1172, P-1224, P-1288, P-1459</td>

Table 2ii. Compounds with ALK kinase activity with IC50 &lt;10 μΜ

<td>ALK:</td><td>P-0806, P-1280, P-1244, P-1336, P-1394, P-</td>

<td></td><td> 1426</td>

Table 2jj. Compounds with Cdk2 kinase activity with IC 50 &lt;10 μΜ

<td>Cdk2:</td><td>P-0805, P-1280, P-1244, P-1394</td>

Table 2kk. Compounds with Csk kinase activity with IC 50 &lt;10 μΜ

<td>Csk:</td><td>P-0007, P-0805, P-0806, P-0885, P-0933, P-0955, P-0956, P1013, P-1020, P-1336, P-1394, P-1426</td>

Table 211. Compounds with EphA2 kinase activity with IC50 &lt;10 μΜ

<td>EphA2: 1</td><td>P-1336, P-1394</td>

Table 2rrun. Compounds with EphB4 kinase activity with IC50 &lt;10 μΜ

<td>EphB4:</td><td>P-0806, P-1336</td>

Table 2nn. Compounds with Frk kinase activity with IC 50 &lt;10 μΜ

<td>Frk:</td><td>P-0007, P-0805, P-0885, P-0933, P-0955, P-0956, P-1013, P1020, P-1244, P-1318, P-1336, P-1394</td>

Table 2oo. Compounds with Gsk3P kinase activity with IC50 &lt;10 μΜ

<td>Gsk3P:</td><td>P-0007, P-0015, P-0017, P-0053, P-0057, P-0079, P-0081, P-0085, P-0086, P-0094, P-0104, P-0106, P-0109, P-0123, P-0135, P-0148, P-0154, P-0159, P-0169, P-0180, P-0207, P-0226, P-0236, P-0252, P-0273, P-0462, P-0700, P-0728, P-0763, P-0850, P-0902, P-0913, P-0969, P-1002, P-l142, P-l181, P-1252, P-1317, P-1336, P-1372, P-1426</td>

161

52010 Β

Table 2ρρ. Compounds with Hck kinase activity with IC50 &lt;10 μΜ

<td>Hck:</td><td>P-0007, P-0806, P-0885, P-0933, P-1318, P-1336,</td>

<td></td><td>P-1394, P-1426</td>

Table 2qq. Compounds with MAP4K4 kinase activity with IC50 &lt;10 μιη

<td>MAP4K4:</td><td>P-0007, P-0057, P-0069, P-0079, P-0082, P-0088, P-0130, P-0131, P-0152, P-0174, P-0176, P-0198, P-0202, P-0214, P-0220, P-0256, P-0269, P-0287, P-0300, P-0317, P-0357, P-0367, P-0369, P-0391, P-0402, P-0442, P-0449, P-0477, P-0488, P-0495, P-0518, P-0527, P-0537, P-0573, P-0601, P-0685, P-0695, P-0700, P-0728, P-0734, P-0753, P-0800, P-0806, P-0811, P-0850, P-0851, P-0853, P-0862, P-0885, P-0896, P-0902, P-0904, P-0909, P-0913, P-0931, P-0933, P-0937, P-0954, P-0958, P-0971, P-0986, P-1017, P-1042, P-1056, P-1252, P-1253, P-1279, P-1280, P-1289, P-1317, P-1318, P-1336, P-1372, P-1383, P-1394, P-1406, P-1411, P-1414, P-1415, P-1417, P-1418, P-1426, P-1429, P-1685</td>

Table 2rr. Compounds with IGF1 R kinase activity with IC50 &lt;10 μΜ

<td>IGFIR:</td><td>P-0002, P-0003, P-0004, P-0009, P-0031, P-0079, P-0080, P-0084, P-0115, P-0136, P-0154, P-0157, P-0212, P-0213, P-0700, P-0716, P-0746, P-0850, P-1336, P-1337, P-1390, P-1394</td>

Table 2ss. Compounds with IKK beta kinase activity with IC50 &lt;10 μΜ

<td>IKK beta:</td><td>P-0007, P-0013, P-0014, P-0029, P-0057, P-0073, P-0084, P-0085, P-0086, P-0087, P-0096, P-0098, P-0I06, P-0111, P-0115, P-0120, P-0127, P-0128, P-0133, P-0135, P-0163, P-0164, P-0172, P-0177, P-0179, P-0216, P-0270, P-0272, P-0315, P-0376, P-0404, P-0410, P-0436, P-0629, P-0682, P-0690, P-0790, P-0896, P-0920, P-0962, P-1223</td>

162

52010 Β l'abela 2tt. Compounds with Itk kinase activity with IC50 &lt;1θ μΜ

<td>Itk:</td><td>P-0002, P-0003, P-0004, P-0006, P-0008, P-0009, P-0013, P-0016, P-0019, P-0020, P-0024, P-0025, P-0027, P-0031, P-0034, P-OO35, P-0036, P-0038, P-0067, P-0173, P-0196, P-0521, P-0579, P-0716, P-0778, P-0883, P-0951, P-1016, P-1067, P-1337, P-1385</td>

Table 2uu. Compounds with JakZ kinase activity with IC50 &lt;10 μΜ

<td>JakZ:</td><td>P-0003, P-0004, P-0009, P-0013, P-0014, P-0019, P-0020, P-0022, P-0024, P-0034, P-0039, P-0044, P-0046, P-0049, P-0051, P-0060, P-0061, P-0063, P-0070, P-0084, P-0101, P-0106, P-0108, P-0109, P-0119, P-0122, P-0124, P-0138, P-0141, P-0146, P-0171, P-0178, P-0187, P-0215, P-0318, P-0521, P-0730, P-0863, P-01367, P-01385</td>

Table 2vv. Compounds with MLK1sa kinase activity IC50 &lt;10 μΜ

<td>MLKl:</td><td>P-1336, P-1426</td>

Table 2ww. Compounds with TrkA kinase activity with IC50 &lt;10 μΜ

<td>TrkA:</td><td>P-0409, P-0806, P-1244, P-1426</td>

Table 2xx. Compounds with PDGFRA kinase activity with IC50 &lt;10 μΜ

<td>PDGFRA:</td><td>P-0007, P-0409, P-0806, P-0885, P-0933, P-1280, P-I336, P-1394, P-1426</td>

Table 2yy. Compounds with Plkl kinase activity with IC50 &lt;10 μΜ

<td>Plkl:</td><td>P-0018, P-0022, P-0031, P-0044, P-0046, P-0067, P-0075, P-0083, P-0085, P-0099, P-01113, P-0123, P-0128, P-0135, P-0146, P-0148, P-0154, P-0178, P-0286, P-0332, P-0345, P-0366, P-0480, P-0490, P-0581, P-0863, P-0954, Pl 138</td>

Table 2zz. Compounds with Brk kinase activity with IC50 &lt;10 μΜ

<td>Mustache:</td><td>P-0007, P-0805, P-0806, P-0885, P-0933, P-0955, P-0956, P-1013, P1020, P-1244, P-1318, P-1336, P-1394</td>

163

52010 Β

Table 2ab. Compounds with ROCKI kinase activity with 1C₅o &lt;10 μΜ

ROCKl: P-0057

Table 2ac. Compounds with Syk kinase activity, with IC50 &lt;10 μΜ

<td>Syk:</td><td>P-0002, P-0010, P-0033, P-0054, P-0056, P-0057, P-0089, P0196, P-0448, P-0521, P-0599, P-1336</td>

Table 2ad. Compounds with TEC kinase activity with IC50 &lt;10 μΜ

<td>TEC:</td><td>P-0033, P-0044, P-0088, P-0156, P-0166, P-0228, P0257, P-0297, P-0429, P-0017, P-0897, P-0954, P-0983, P-0991, P-0997, P-1020, P-1317</td>

Table 2ae. Compounds with Tie2 kinase activity with IC50 &lt;10 μΜ

<td>Tie2:</td><td>P-0806, P-1280, P-1336, P-1394, P-1426</td>

Plasmid sequence and PCR primer information:

Abl

PCR primers [0286]

<td>Abl</td><td>Abel-227</td><td>CACCACGGTGTGTCCCCCAACnACGA (SBQ ID N0; ___)</td><td> 1424</td>

<td></td><td>CABL-A</td><td>GT »CGTCGACT &lt;^ iGACGCCTTGT'l'rCCCCAGCT (SEQ ID NO: ___)</td><td> 736</td>

164

52010 Β

Ρ1121. pET-SPEC ΒΙ ΡΤΡ-Abl-G227 V51S-X taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccaccacggtgtgtcc MGHHHHHHGVS cccaactacgacaagtgggagatggaacgcacggacatcaccatgaagcacaagctgggc PNYDKWEMERTDITMKHKLG gggggccagtacggggaggtgtacgagggcgtgtggaagaaatacagcctgacggtggcc ggqygevyegvwkkysltva gtgaagaccttgaaggaggacaccatggaggtggaagagttcttgaaagaagctgcagtc VKTLKEDTMEVEEFLKEAAV atgaaagagatcaaacaccctaacctggtgcagctccttggggtctgcacccgggagccc MKEIKHPNLVQLLGVCTREP ccgttctatatcatcactgagttcatgacctacgggaacctcctggactacctgagggag PFYIITEFMTYGNLL DYIiRE tgcaaccggcaggaggtgaacgccgtggtgctgctgtacatggccactcagatctcgtca CNRQEV NAVVLLYMATQI SS gccatggagtacctggagaagaaaaacttcatccacagagatcttgctgcccgaaactgc AMEYLEKKNFIHRDLAARNC ctggtaggggagaaccacttggtgaaggtagctgattttggcctgagcaggttgatgaca LVGENHLVKVADFGLSRLMT ggggacacctacacagcccatgctggagccaagttccccatcaaatggactgcacccgag. GDTYTAHAGAKFPIKWTAPE agcctggcctacaacaagttctccatcaagtccgacgtctgggcatttggagtattgctt SLAYNKFSIKSDVWAFGVLL tgggaaattgctacctatggcatgtccccttacccgggaattgacctgtcccaggtgtat WEIATYGMS PYPGIDLS qvy gagctgctagagaaggactaccgcatggagcgcccagaaggctgcccagagaaggtctat ELLEKDYRMERPEGCPEKVY gaactcatgcgagcatgttggcagtggaatccctctgaccggccctcctttgctgaaatc ELMRACWQWNPSDRPSFAEI caccaagcctttgaaacaatgttccaggaatccagtratctcagacgaagtggaaaaggag HQAFETMFQESSISDEVEKE ctggggaaacaaggcgtctgagtcgac (SBQ XD 'axis)

I * GKQGV - (SEQ ID HOj)

B-RafV600E

PCR primers [0287]

<td>BRAF</td><td>BRAF437D-S</td><td>ACGOGACCATATGGATGATTGGGAGATTCCTGA (SBQ ID N0: ___)</td><td> 4783</td>

<td></td><td>BRAF722K-A</td><td>CACTGGTCGACTATTTTGGCAATGAGCGGGCCA (SBQ ID N0: .___)</td><td> 4784</td>

<td></td><td>BRAFV599B-S</td><td>3GTCTAGCTAaAGAAAAATCTCGATGGAG (SEQ ID NO: ___)</td><td> 893</td>

165

52010Β

<td></td><td></td><td>OTCCATCGAGATTTTTCTGTAGCTAGACC</td><td></td>

<td></td><td>BRAFV599E-A</td><td>(SBQ ID NOt___}</td><td> 894</td>

Ρ4254. pFastBacBD-CDC37 BRAF Ο437-Κ722-Χ, V600E tattccggattattcataccgtcccaccatcgggcgcggatctcggtccgaaacc atgtcgtactaccatcaccatcaccatcacgattacgatatcccaacgaccgaaaacctg MSYYHHHHHHDYJDIPTTEWL tattttcagggccatatggatgattgggagattcctgatgggcagattacagtgggacaa YFQGHMDDWEI PDG QITVGQ agaattggatctggatcatttggaacagtctacaagggaaagtggcatggtgatgtggca RIGSGSFGTVYKGKWHGDVA gtgaaaatgttgaatgtgacagcacctacacctcagcagttacaagccttcaaaaatgaa vkmlnvtaptpqqlqafkne gtaggagtactcaggaaaacacgacatgtgaatatcctactcttcatgggctattccaca VGVLRKTRHVNILLFMGYST aagccacaactggctattgttacccagtggtgtgagggctccagc.ttgtatcaccatctc KPQLAIVTQWCEGSSLYHHli catatcattgagaccaaatttgagatgatcaaacttatagatattgcacgacagactgca HIIETKFBMIKLIDIARQTA cagggcatggattacttacacgccaagtcaatcatccacagagacctcaagagtaataat QGMDYLHAKS I IHRDLKSNN atatttcttcatgaagacctcacagtaaaaataggtgattttggtctagctacagaaaaa IFLHEDLTVKIGDFGLATEK tctcgatggagtgggtcccatcagtttgaacagttgtctggatccattttgtggatggca SRWSGSH2FEQLSGSILWM A ccagaagtcatcagaatgcaagataaaaatccatacagctttcagtcagatgtatatgca PEVIRMQDKNPYSFQSDVYA tttggaattgttctgtatgaattgatgactggacagttaccttattcaaacatcaacaac fgivlyelmtgqlpysninn agggaccagataatttttatggtgggacgaggatacctgtctccagatctcagtaaggta RDQIIFMVGRGYLSPDLSKV cggagtaactgtccaaaagccatgaagagattaatggcagagtgcctcaaaaagaaaaga KBESRKAMKKVMAESVKKKV gatgagagaccactctttccccaaattctcgcctctattgagctgctggcccgctcattg ΡΕΚΡΒΡΡΟΙΒΑδΙΕΒΒΑΚΒΙ "ccaaaatagtcgactagagcctgcagtctcgaggcatgcggtaccaagctt (d seq kog__)

PK - (SEQ ID HD: ___)

Erk2

PCR primers [0288]

<td></td><td></td><td>ggcagcccatatggoggcggcggcggcggc</td><td></td>

<td>ERK2</td><td>ERG2-S</td><td>(SEO ID NO: ___)</td><td> 748</td>

166

52010 Β

<td></td><td></td><td>TGTCCGTCGACATl'rAAGATCTOTATCCTGG (SEQ ID NO:)</td><td></td>

<td></td><td>ERK2-A</td><td></td><td> 749</td>

P4227.pET15S ERK2 / MEK1DD taatacgac CACT ataggggaattgtgagcggataacaat t t cc cctct agaaat aat 11 tgtttaactttaagaaggagatataccatgggcagcagccatcatcatcatcatcacagc MGSSHHHHHHS agcggcctggtgccgcgcggcagccatatggcggcggcggcgggcgcgggcccggagatg SGLVPRGSHMAAAAGAGPEM gtccgcgggcaggtgttcgacgtggggccgcgctacaccaacctctcgtacatcggcgag VRGQVFDVGPRYTNLSYIGE ggcgcctacggcatggtgtgctctgcttatgataatgtcaacaaagttcgagtagctatc GAYGMVCSAY DN VNKVRVAI aagaaaatcagcccctttgagcaccagacctactgccagagaaccctgagggagataaaa KKISPFEHQTYCQ RTLREIK atcttactgcgcttcagacatgagaacatcattggaatcaatgacattattcgagcacca ILLRFRHENIIGINDI IRAP accatcgagcaaatgaaagatgtatatatagtacaggacctcatggaaacagatctttac TIEQMKDVYIVQDLMETDLY aagctcttgaagacacaacacctcagcaatgaccatatctgctattttctctaccagatc KLLKTQHLSNDHICYFLYQI ctcagagggttaaaatatatccattcagctaacgttctgcaccgtgacctcaagccttcc LRGLKYIHSANVLHRDLKPS aacctgctgctcaacaccacctgtgatctcaagatctgtgactttggcctggcccgtgtt NLLLN TTCDLKICDFGLARV gcagatccagaccatgatcacacagggttcctgacagaatatgtggccacacgttggtac ADPDHDHTGFLT EYVATRWY agggctccagaaattatgttgaattccaagggctacaccaagtccattgatatttggtct RAPEIMLNSKGYTKSIDIWS gtaggctgcattctggcagaaatgctttctaacaggcccatctttccagggaagcattat VGCILAEMLSNRPIFPGKHY cttgaccagctgaaccacattttgggtattcttggatccccatcacaagaagacctgaat LDQL NHILGILGSPSQEDLN tgtataataaatttaaaagctaggaactatttgctttctcttccacacaaaaataaggtg CIINLKARNYLLSLPHKNKV ccatggaacaggctgttcccaaatgctgactccaaagctctggacttattggacaaaatg ₽WNRI 'FP' NADSKALDLXiDKM ttgacattcaacccacacaagaggattgaagtagaacaggctctggcccacccatatctg LTFNPHKRIEVEQALAHPYL gagcagtattacgacccgagtgacgagcccatcgccgaagcaccattcaagttcgacatg EQYYDPSDEPIAEAPFKFDM gaattggatgacttgcctaaggaaaagctcaaagaactaatttttgaagagactgctaga ELDDLPKEtacataCLtEL_; )

FQPGYRS (SEQ ID NO:)

52010 Β

Fak

PCR primers

<td>FAK</td><td>FAK411</td><td>'GCTGGATCCACOUSGGATTATGAGATTCAAAG (SBQ ID N0: ___)</td><td> 2156</td>

<td></td><td>FAK686</td><td>GTTCTTGTCGACTACTGAGCCTTCTCTTCCTCCA &lt;SEQ ID NO: ___}</td><td> 2157</td>

P13S8 .pFastBacHtb FAK S411-Q686-X para 11 t Ccgg this ca 11 t ct accgt cccaccat cgggcgcggat cggt ccgaaacc atgtcgtactaccafccaccafccaccatcacgattacgatatcccaacgaccgaaaacctg MSyyHHHHHHDYDIPTTENL tattttcagggcgccatgggatccaccagggattatgagattcaaagagaaagaatagaa YFQGAMGSTRDYBIQRERIE cttggacgatgtattggagaaggccaatttggagatgtacatoaaggcatttatatgagt LGRCIGEGQFGDVHQGIYMS ccagagaatccagctttggcggttgcaattaaaacatgtaaaaactgtacttcggacagc PENPALAVAIKTCKNCTSDS gtgagagagaaatttcttcaagaagccttaacaatgcgtcagtttgaccatcctcatatt VREKFLOEALTMROFDHPHI gtgaagctgattggagtcatcacagagaatcctgtctggataatcatggagctgtgcaca VKLIGVITENPVMIIMELCT cttggagagctgaggtcatttttgcaagrtaaggaaatacagtttggatctagcatctttg LGELRS FLQVRKYSI "DLA8L atcctgtatgcctatcagcttagtacagctcttgcatatctagagagcaaaagatttgta ILYAYQLSTAI" AYLESKRFV cacagggacattgctgctcggaatgttctggtgtcctcaaatgattgtgtaaaattagga HRDIAARUVLVSSNDCVKLG gactttggattatcccgatatatggaagatagtacttactacaaagcttccaaaggaaaa DFGLSRYMEDSTYYKASKGK ttgcctattaaatggatggctccagagtcaatcaattttcgacgttttacctcagctagt LPIKHMAPESINFRRFTSAS gacgtatggatgtttggtgtgtgtatgtgggagatactgatgcatggtgtgaagcctttt DVNMFGVCMKEILMHGVKPF caaggagtgaagaacaatgatgtaatcggtcgaattgaaaatggggaaagattaccaatg OGVKNNDVIGRIENGERLPM cctccaaattgtcctcctaccctctacagccttatgacgaaatgctgggcctatgacccc PPNCPPTLYSI "MTKCWAYD₽ agcaggcggcccaggtttactgaacttaaagctcagctcagcacaatcctggaggaagag SRRPRFTELKAQLSTI] Yeah aaggctcagtagtcgacgagctcactagtcgcggccgctttcgaatctagagcctgcagt KAQ - STSSLVAAAFESRACS ctcgaggcatgcggtaccaagcttgtcgagaagtactagaggatcataatc (seq ip are: ) LEACGTKLVBKY- (SEQ ID HO; _)

168

52010 Β

FGFRl

PCR primers [0290]

<td>FGFR1</td><td>FGFR1-S</td><td>GACTCCTCATATGGCAGGGGTCTCTGAGTATGA (SEQ ID NO: ___)</td><td> 1237</td>

<td></td><td>FGFRSAL</td><td>caggtcgtcgactactcctggttggaggtcaagg (SEQ ID NO. * ___)</td><td> 1611</td>

<td></td><td>C488A-1</td><td>CTGGGAGAGGGCGCGTTTGGGCAGGTGG (SBQ XD N0: ___)</td><td> 2038</td>

<td></td><td>C488A-2</td><td>CCAC0TGCCCAAACX3CGCCCTCTCCCAG (SEQ ID NO: ___)</td><td> 2039</td>

<td></td><td>C584S-1</td><td>CAGGGCTGGAATACAGCTACAACCCCAGC (SBQ ID N0: ___&gt;</td><td> 2041</td>

<td></td><td>C584S-2</td><td>GCTGGGGTTGTAGCTGTATTCCAGCCCTG (SEQ ID NO: ___)</td><td> 2042</td>

169

52010 Β

P13Sl.pET N6 ΒΙ-ΡΤΡ FGFR Α458-Ε765-Χ C488A, C584S taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatggcaggg MGHHHHHHMAG gtctctgagtatgagcttcccgaagaccctcgctgggagctgcctcgggacagactggtc VSEYELPEDPRW.ELPRDR.IiV ttaggcaaacccctgggagagggcgcgtttgggcaggtggtgttggcagaggctatoggg LGKPLGEGAFGQVVLAEAIG ctggacaaggacaaacccaaccgtgtgaccaaagtggctgtgaagatgttgaagtcggac LDKDKPNR VTKVAVKMLKSD gcaacagagaaagacttgtcagacctgatctcagaaatggagatgatgaagatgatcggg atekdlsdlisememmkmig aagcataagaatatcatcaacctgctgggggcctgcacgcaggatggtcccttgtatgtc KHKNIINLLGACTQDGPLYV atcgtggagtatgcctceaagggcaacctgcgggagtacctgcaggcccggaggccccca IVEYASKGNLREYLQARRPP gggctggaatacagctacaaccccagccacaacccagaggagcagctctcctccaaggac GLEYSYNPSHNPEEQLSSKD ctggtgtcctgcgcctaccaggtggcccgaggcatggagtatctggcctccaagaagtgc LVSCAYQVARGMEYLASKKC atacaccgagacctggcagccaggaatgtcctggtgacagaggacaatgtgatgaagata IHRDLAARNVLVTEDNVMKI gcagactttggcctcgcacgggacattcaccacatcgactactataaaaagacaaccaac ADFGLARDI HHIDYYKKTTN ggccgactgcctgtgaagtggatggcacccgaggcattatttgaccggatctacacccac GRLPVKWMAPEALFDRIYTH cagagtgatgtgtggtctttcggggtgctcctgtgggagatcttcactctgggcggctcc QSDV WSFGVLLWEIFTLGGS ccataccccggtgtgcctgtggaggaacttttcaagctgctgaaggagggtcaccgcatg PYPGVPVEELFKLLKEGHRM gacaagcccagtaactgcaccaacgagctgtacatgatgatgcgggactgctggcatgca DKPSNCTNELYMMMRDCWHA gtgccctcacagagacccaccttcaagcagctggtggaagacctggaccgcatcgtggcc vpsqrptfkqlvedldriva ttgacctccaaccaggagtagtcgacgaaggagatatatcc (SBQ ίο no:)

LTSNQE - (SEQ ID NO:)

Fltl

PCR primers [0291]

<td>FLT1</td><td>FLT1-S</td><td>ATCAATTCATATGGACCCAGATGAAGTTCC (SEQ ID NO: ___)</td><td> 737</td>

<td></td><td>FLT1-A</td><td>ATGTAGTCGACCTAATCCTGTTGTACATTTGCTT (SEQ ID NO: ___}</td><td> 738</td>

170

52010Β

Ρ1826.ρΕΤΝ6 ΒΙ ΡΤΡ Fltl-M799-D1165-X WT taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatggaccca MGHHHHHHMDP gatgaagttcctttggatgagcagtgtgagcggctcccttatgatgccagcaagtgggag DEVPLDEQCERLPYDASKWE tttgcccgggagagacttaaactgggcaaatcacttggaagaggggcttttggaaaagrtg FARERIiKLGKSLGRGAFGKV gttcaagcatcagcatttggcattaagaaatcacctacgtgccggactgtggctgtgaaa VQASAFGIKKSPTCRTVAVK atgctgaaagagggggccacggccagcgagtacaaagctctgatgactgagctaaaaatc MLKEGATASEYKALMTELKI ttgacccacattggccaccatctgaacgtggttaacctgctgggagcctgcaccaagcaa LTHIGHHLNVVRLLGACTKQ ggagggcctctgatggtgattgttgaatactgcaaatatggaaatctctccaactacctc GGPLMVIVEYCKYGNLSNYL aagagcaaacgtgacttattttttctcaacaaggatgcagcactacacatggagcctaag KSKRDLFFLNKDAALHMBPK aaagaaaaaatggagccaggcctggaacaaggcaagaaaccaagactagatagcgtcacc KEKMEPGLEQGKKPRLD SVT agcagcgaaagctttgcgagctccggctttcaggaagataaaagtctgagtgatgttgag SSESFASSGFQEDKSLSDVE gaagaggaggattctgacggtttctacaaggagcccatcactatggaagatctgatttct EEEDSDGFYKBPITMEDLI With tacagttttcaagtggccagaggcatggagttcctgtcttccagaaagtgcattcatcgg YSFQVARGMEFLSSRKCIHR gacctggcagcgagaaacattcttttatctgagaacaacgtggtgaagatttgtgatttt DLAARNILLSENNVVKICDF ggccttgcccgggatatttataagaaccccgattatgtgagaaaaggagatactcgactt GLARDIYKNPDYVRKGDTRL cctctgaaatggatggctcccgaatctatctttgacaaaatctacagcaccaagagcgac PLKWMAPBSIFDKIYSTKSD gtgtggtcttacggagtattgctgtgggaaatcttctccttaggtgggtctccataccca VWSYGVLLWEIFSLGGS ΡΥΡ ggagtacaaatggatgaggacttttgcagtcgcctgagggaaggcatgaggatgagagct σνβΜΟΕΟΡΟβΚΐ, ΗΒβΜΚΜΚΑ cctgagtactctactcctgaaatctatcagatcatgctggactgctggcacagagaccca PEYSTPEIYQIMLDCWHRDP aaagaaaggccaagatttgcagaacttgtggaaaaactaggtgatttgcttca

VQQD - (SEQ ID N0: ___) ggccgaaaggaattcgaggccagcagggccaccgctgagcaataactagcataacccctt ggggcctctaaacgggtcttgaggggttttttg (seq xd no = __)

171

52010 Β

Kit

PCR primers [0292]

<td>KIT</td><td>8K1A</td><td>ATGTACGAAGTTCAGTGGAAAGTTGTTGAAGAAATCAACGG (SBQ ID SO: ___)</td><td> 1776</td>

<td></td><td>8K1B</td><td>SGTCGATGTAAACGTAGTTGTTACCGTnSATTTCTTCAACAACTTT (SEQ ID NO: ___)</td><td> 1777</td>

<td></td><td>8K2A</td><td>AACAACTACGTTTACATCGACCX2GACCCAGCTGCCGTACGAC (SEQ ID NO: ___)</td><td> 1779</td>

<td></td><td>BK2B</td><td>GTTACGCGGGAACTCCCATTTGTGGTCGraCGGCAGCTGGGTC (SEQ 1D N0: ___)</td><td> 1781</td>

<td></td><td>8K3A</td><td>AAATGGGAGTTCCCGCGTAACCGTCTGTCTTTCGGTAAAACCC (SBQ ID N0: ___)</td><td> 1782</td>

<td></td><td>8K3B</td><td>accgaacgcacccgcacccagggttttaccgaaagacasac (SEQ XD N0: ___&gt;</td><td> 1783</td>

<td></td><td>8K4A</td><td>ggtgcgggtgcgttcggtaaagttgttgaagcgaccgcgtacg (SEQ ID NO: ___)</td><td> 1784</td>

<td></td><td>8K4B</td><td>GCCGCGTCAGATITGATCAGACCGTAC! KKGTCGC? TTCAAC (SEQ ID NO: ___)</td><td> 1785</td>

<td></td><td>8K5A</td><td>ctgatcaaatctgacgcggcgatgaccgttgcggttaaaatgc (SEQ ID N0; ___)</td><td> 1786</td>

<td></td><td>8K5B</td><td>GTCAGGTGCGCAGACGGTTTCAGCATTTTAACCGCAACGGTCA (SEO IĐ N0: ___)</td><td> 1787</td>

<td></td><td>8K6A</td><td>AAACCGTCTGCGCACCTGACCGAACGTGAAGCGCTGATGTCTG (SEQ ID NO: ___)</td><td> 1788</td>

<td></td><td>8K6B</td><td>CCAGGTAAGACAGAACTTTCAGTTCAGACATCAGCGCTTCACGT (SEQ ID NO: ___)</td><td> 1789</td>

<td></td><td>8K7A</td><td>CTGAAAGTTCTGTCTOkCCIGGGTAACCACATGAACATCGTTAA (SBQ ID N0: ___)</td><td> 1791</td>

<td></td><td>8K7B</td><td>GGTGCACGCACCCAGCAGGTEAAOGATGTTCATGTOGTTAC (SEQ P&gt; N0: ___)</td><td> 1792</td>

<td></td><td>8K8A</td><td>^ VGCTGGGTGCGTGCACCA.TCGGTGGTCCGACCCTGGTTATCA (SBQ ID N0 «___)</td><td> 1793</td>

<td></td><td>8K8B</td><td>gtcaccgtagcagcactattcgktgaiaaccagggtcggacca (SEQ ID NO: ___)</td><td> 1794</td>

<td></td><td>8K9A</td><td>GAATACTGCTGCTACGGTGACCTGCTGAACTTCCTGCGTOSTA (SEQ ID NO: ___)</td><td> 1795</td>

<td></td><td>8K9B</td><td>AGAGCAGATGAAAGAGTCACGTTTACGACGCAGGBIAGTTCAGC (SEO ID NO: ___)</td><td> 1796</td>

172

52010 Β

<td></td><td>8Κ10Α</td><td>CGTGACTCTTTCATCTGCTCTAAACAGGAAGACCACGCGGAAG (8VD ID N0: ___)</td><td> 1797</td>

<td></td><td>8Κ10Β</td><td>CAG ^ GGTTTTTCTrACAGCGCCGCTTCCGCGTGGTCTTCCTGT (SBQ IP NOi___)</td><td> 1798</td>

<td></td><td>8Κ11Α</td><td>GCGCTGTACAAAAACCTGCTGCACTCTAAAGAATCTTCTTGCTC (SEQ ID NOs___)</td><td> 1799</td>

<td></td><td>8Κ11Β</td><td>ccatgtattcgttggtagagtcagagcaagaagattctttaoaot &lt;SEQ ID NO: ___)</td><td> 1811</td>

<td></td><td>8Κ11Α</td><td>gactctaccaacgaatacatggacatgaaaccgggtgtttctta (SEQ ID NOs___)</td><td> 1812</td>

<td></td><td>8Κ11Β</td><td>tccgctttggtcggaacaacgtaagaaacacccggtttcatgt (SSQ ID N0: ___)</td><td> 1813</td>

<td></td><td>8R12A</td><td>GTTOTTCCGACCAAAGCGGACAAACGTCGTTCTGTTCGrATCG &lt;SBQ 10 NOi__)</td><td> 1814</td>

<td></td><td>8Κ12Β</td><td>taacgtcactttcgatgtaagaaccgatacgaacagaacgacgttt (SBQ ID N0: ___)</td><td> 1815</td>

<td></td><td>8Κ13Α</td><td>TCTTACATCGAACGTGACGTTACCCCGGCGATCATGGAAGACG (SBQ ID N0: ___)</td><td> 1816</td>

<td></td><td>8Κ13Β</td><td>CCAGGTCCAGCGCCAGTTa? TCGTCTTCCATGATCGCCGG (SEO ID »Oi___)</td><td> 1817</td>

<td></td><td>8Κ14Α</td><td>GAACTGGCGCTGGACCTGGAAGACCTGCTGTCmCTCTrACC (SBQ 1D »Os___J</td><td> 1818</td>

<td></td><td>8Κ14Β</td><td>GAACGCCATACCTTTCGOACCTGGTAAGAGAAAGACAGCAGGT ~ (SEQ ID NOi___)</td><td> 1819</td>

<td></td><td>8Κ15Α</td><td>GTTGCGAAAGGTATGGCGTTCCTGGCGTCTAAAACTGCATCCA &lt;380 ID »O: ___)</td><td> 1821</td>

<td></td><td>8Κ15Β</td><td>CGCGCCGCCAGGTCACGGTGGATGCAGTTTTTAGACGCC (SBQ ID »0: ___)</td><td> 1822</td>

<td></td><td>8Κ16Α</td><td>C ^ TGACCTCGTOGCGCGTAACATCCTGCTGACCCAOGGTCG (SBQ ID NOi___)</td><td> 1823</td>

<td></td><td>8Κ16Β</td><td>ACCSAAGTCGCAGATTTTGGTGATACGACCGTGGGTCAGCAGG (SBQ ID N0: ___)</td><td> 1824</td>

<td></td><td>SK17A</td><td>ACCAAAATCTGCGACTTO3GTCTGGCGCGTGACATCAAAAACG (SEQ ID »0: ___)</td><td> 1825</td>

173

52010 Β

<td></td><td>8Κ17Β</td><td>GTTACCTTTAACAACGTAGTTAGAGTCGTTFrTGATGTCACGaSCC (SEQ ID IO: ___)</td><td> 1826</td>

<td></td><td>8Κ18Α</td><td>TCTAACTACCTTCTTAAAGOTAACCCGCGTCTGCCCCTTAAATa (SBQ U&gt; N0; ___)</td><td> 1827</td>

<td></td><td>8Κ18Β</td><td>GAAGATAGAITCCGGCGCCATCCATTTAACCGGCAGACGCGC (SEQ ID NO: ___)</td><td> 1829</td>

<td></td><td>8Κ19Α</td><td>ATGGCGCCGGAATCTATCTTCAACTGCGTTTACACCTTCGAATC (S®Q XD NOs___)</td><td> 1831</td>

<td></td><td>8Κ19Β</td><td>3ATACCGTAAGACCAAACGTCAGATTCGAAGGTGTAAACGCAG (SEQ XD NO: ___)</td><td> 1832</td>

<td></td><td>8Κ20Α</td><td>GACGTTTG6TCTTACGGTATCITCCTGTGGGAACTGTTCTCTC (SBQ ID N0: ___)</td><td> 1833</td>

<td></td><td>8Κ20Β</td><td>CCTCTGG3AACTGTrCTCTCTGGGTK ^ TCTCCGTAC? CCGG (SBQ ID HO: ___)</td><td> 1834</td>

<td></td><td>8Κ21Α</td><td>GGTTCTTCTCOTTACCCGGGTATGCCGGTTGACTCTAAATTCTAT tSEQ ID N0: ___)</td><td> 1835</td>

<td></td><td>8Κ21Β</td><td>CGGAAACCTTCmGATCATTTTGTAGAATTrAGAGTCAACCGGC 1SEQ ID N0: ___)</td><td> 1836</td>

<td></td><td>8Κ22Α</td><td>AAAATGATCAAAGAAGGTTTCCGTATGCTGTCTCCGGAACAOG (SEQ ID NO: ___)</td><td> 1837</td>

<td></td><td>8Κ22Β</td><td>ATOTCGTACATTTCCGCCGGCGCGTGTreCGGAGACAGCAIA (SBQ ID N0: ___)</td><td> 1838</td>

<td></td><td>8Κ23Α</td><td>CCX5GCGGAAATGTACGAC &amp; TCATGAAAACCTGCTG &lt;3GACGOG (SEQ ID NO: ___)</td><td> 1839</td>

<td></td><td>8Κ23Β</td><td>AAGGTOGGACGTTTCAGCGGGTCCGCGTCCCAGCAOGTTTTC (SEQ ID NO: ____)</td><td> 1841</td>

<td></td><td>8Κ24Α</td><td>CCGCTGAAACGTCCGACCTTCAAACAGATCGTTCAGCTGATCG (SEQ ID NOi____)</td><td> 1842</td>

<td></td><td>8Κ24Β</td><td>TTGGTAGATTCAGAGATCTGTTTTTCGATCAGCTGAACGATCTGTT (3BQ ID N0: ___)</td><td> 1843</td>

<td></td><td>8Κ25Α</td><td>AAACAGATCTCTGAATCTACCAACCACATCTACTCTAACCTGGC (SEQ PJ N0: ___)</td><td> 1844</td>

<td></td><td>SK25B</td><td>TGACGGTTCGGAGAGCAGTTCGCCAGGTTAGAGTAGATGTGG (SEQ ID NO: ___)</td><td> 1845</td>

174

52010 Β

<td></td><td>8Κ26Α</td><td>AACTGCTCTCCGAACCGTCAGAAACCGGTTGTTGACCACTCrG (SEQ ID NO: ___)</td><td> 1846</td>

<td></td><td>SK26B</td><td>GTAGAACCAACAGAGTTGATACGAACAGAGTGGTCAACAACCGGT (SBQ ID NO: ___}</td><td> 1847</td>

<td></td><td>8Κ27Α</td><td>CGTATCAACTCTGTfGGTTCTACCGCGTCTTCTTCTCAGCCG (SEQ ID NO: ___)</td><td> 1848</td>

<td></td><td>8Κ27Β</td><td>AACGTCGTCGTGAACCAGCASCGGCTGAfiAAGAAGACGCG (SSQ ID N0 »___)</td><td> 1849</td>

<td></td><td>8K-F</td><td>GTTGTTTCATATCTACGAAGTTCAGTGGAAAG (SEQ ID N0? ___)</td><td> 1851</td>

<td></td><td>8K-R</td><td>GTlGTTTGTCGACTAAAOGTCGTCGTGAACCAGKiAG (SBQ JD IfO; ____)</td><td> 1852</td>

<td></td><td>ΚΙΤ COD-K948X</td><td>GTTCTTGTCGACTATTTCTGACGGTTCGGASAGC (SEQ U&gt; HO: ___)</td><td> 3411</td>

175

52010 Β

Ρ1332.Ν6 ΒΙΡΤΡ ΚΓΓ Μ552-Κ948 Χ-COD taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatgtacgaa MGHHHHHHMYE gttcagtggaaagttgttgaagaaatcaacggtaacaactacgtttacatcgacccgacc VQWKVVEEINGNNYVYIDPT CAGCE tgccgt acgaccac Canstatin gggagtt cccgcgt aaccgt gt ct ct 11cggtaaaacc QLPYDHKWEFPRNRLSFGKT ctgggtgcgggtgcgttcggtaaagttgttgaagcgaccgcgtacggtctgatcaaatct LGAGAPGKVVEATATGLI HP gacgcggogatgaccgttgcggttaaaatgctgaaaccgtctgcgcacctgaccgaacgt DAAMTVAVKMLKPSAHLTER gaagcgctgatgtctgaactgaaagttctgtcttacctgggtaaccacatgaacatcgtt EALMSELKVI "SYI.GNHMNIV aacctgctgggtgcgtgcaccatcggtggtccgaccctggttatcaccgaatactgctgc NLLGACTIGGPTLVITEYCC tacggtgacctgctgaacttcctgcgtcgtaaacgtgactctttcatctgctctaaacag YGDLLNFLRRKRDSFICSKQ gaagaccacgcggaagcggcgctgtacaaaaacctgctgcactctaaagaatcttcttgc EDHAEAALYKNLLHSKES SC tctgactctaccaacgaatacatggacatgaaaccgggtgtttcttacgttgttccgacc SDSTNE ¥ MDMKPGVSYVVPT aaagcggacaaacgtcgttctgttcgtatcggttcttacatcgaacgtgacgttaccccg KADKRRSVRIGSYIERDVTP gcgatcatggaagacgacgaactggcgctggacctggaagacctgctgtctttctcttac aimeddelai "dledli.sfsy oaggttgcgaaaggtatggcgttcctggcgtctaaaaactgcatccaccgtgacctggcg QVAKGMAFLASKNCIHRDLA gcgcgtaacatcctgctgacccacggtcgtatcaccaaaatctgcgacttcggtctggcg ARNILLTHGRITKICDFGLA cgtgacatcaaaaacgactctaactacgttgttaaaggtaacgcgcgtctgccggttaaa RDIK.NDSNYVVKGNAR.LPVK tggatggcgccggaatctatcttcaactgcgtttacaccttcgaatctgacgtttggtct WMAPESIPNCVYTFESDVWS tacggtatcttcctgtgggaactgttctctctgggttcttctccgtacccgggtatgccg ygiflwelfslgsspypgmp gttgactctaaattctacaaaatgatcaaagaaggtttccgtatgctgtctccggaacac VDSKFYKMI KEGFRMLS PEH gcgccggcggaaatgtacgacatcatgaaaacctgctgggacgcggacccgctgaaacgt APAEM ¥ DIMKTCWDADPLKR ccgaccttcaaacagatcgttcagctgatcgaaaaacagatctctgaatctaccaaccac PTFKQIVQLIEKQISESTNH atctactctaacctggcgaactgctctccgaaccgtcagaaatagtcgactgaaaaagga IYSNLANCSPNRQK- (SEO 1D N0:) agagt (SEQ ID NO:)

176

52010Β

Met

PCR primers

<td>MET</td><td>G1056</td><td>&lt;^ T (XTA &lt;^ TATGGGGGACTCTQATATATCX »GTC (SEQ ID NO: ___)</td><td> 1223</td>

<td></td><td>G-1364</td><td>CTAGCAGGTCGACTACCCAATGAAAGTAGAGAAGATOGC (SEQ ID NO: ___}</td><td> 1318</td>

P1818.pETN6 BI-PTP MET G1056-G1364-X WT taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatgggggac MGHHHHHHMGD tctgatatatccagtccattactgcaaaatactgtccacattgacctcagtgctctaaat SDISSPLLQNTVHIDLSALN ccagagctggtccaggcagtgcagcatgtagtgattgggcccagtagcctgattgtgcat PELVQAVQHVVIGPSSLIVH ttcaatgaagtcataggaagagggcattttggttgtgtatatcatgggactttgttggac FNEVIGRGHFGCVYHGTLLD aatgatggcaagaaaattcactgtgctgtgaaatccttgaacagaatcactgacatagga NDGKKIHCAVKSLNRITDIG gaagtttcccaatttctgaccgagggaatcatcatgaaagattttagtcatcccaatgtc EVSQFLTEGIIMKDFSHPNV ctctcgctcctgggaatctgcctgcgaagtgaagggtctccgctggtggtcctaccatac H.ZBBvHSĐKBEOZRĐUUBRU atgaaacatggagatcttcgaaatttcattcgaaatgagactcataatccaactgtaaaa MKHGDLi RNFI RNETHNPTVK gatcttattggctttggtcttcaagtagccaaaggcatgaaatatcttgcaagcaaaaag DLIGFGLQVAKGMKYI "ASKK tttgtccacagagacttggctgcaagaaactgtatgctggatgaaaaattcacagtcaag FVHRDLAARNCMLDEKFTVK gttgctgattttggtcttgccagagacatgtatgataaagaatactatagtgtacacaac VADFGLARDMYDKEYYSVHN aaaacaggtgcaaagctgccagtgaagtggatggctttggaaagtctgcaaactcaaaag KTGAKLPVKWMALESLQTQK tttaccaccaagtcagatgtgtggtcctttggcgtgctcctctgggagctgatgacaaga FTTKSDVWSFGVLLWELMTR ggagccccaccttatcctgatgtaaacacctttgatataactgtttacttgttgcaaggg GAPPYPDVNTFDITVYLLQG agaagactcctacaacccgaatactgcccagaccccttatatgaagtaatgctaaaatgc RRLLQPEYCPDPLYEVMLKC tggcaccctaaagccgaaatgcgcccatccttttctgaactggtgtcccggatatcagcg WHPKAEMRPSFSELVSRISA atcttctctactttcattgggtagtcgac (SEQ ID NO:)

IFSTFIG- (SEQ TD N0:)

177

52010Β p38

PCR primers [0294]

<td>p38A</td><td>P38A-S</td><td>CCGGATCCATATGTCTCAGGAGAGGCCCAC (SEQ ID NO: ___)</td><td> 253</td>

<td></td><td>P38A-A</td><td>OAAACCCTCGAGTCAGGACTCCATCTCTTCTTG (SEQ ID NO: ___)</td><td> 254</td>

178

52010 Β

P4292.pET15S Ρ38Α Ml-S360-X taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt MKK6DD tgtttaactttaagaaggagatataccatgggcagcagccatcatcatcatcatcacagc MGSSHHHHHHS agcggcctggtgccgcgcggcagccatatgtctcaggagaggcccacgttctaccggcag sglvprgshmsqerptfyrq gagctgaacaagacaatctgggaggtgcccgagcgttaccagaacctgtctccagtgggc ELNKTIWEVPERYQNLSPVG tctggcgcctatggctctgtgtgtgctgcttttgacacaaaaacggggttacgtgtggca SGAYGSVCAAFDTKTGLRVA gtgaagaagctctccagaccatttcagtccatcattcatgcgaaaagaacctacagagaa VKKLSRPFQSIIHAKR TIRE ctgcggttacttaaacacatgaaacatgaaaatgtgattggtctgttggacgtfctttaca LRLI.KHMKHBNVIGIiI.DVFT cctgcaaggtctctggaggaattcaatgatgtgtatctggtgacccatctcatgggggca PARS LEEFNDVYLVTHLMGA gatctgaacaacattgtgaaatgtcagaagcttacagatgaccatgttcagttccttatc dlnnivkcqkltddhvqfli taccaaattctccgaggtctaaagtatatacattcagctgacataattcacagggaccta YQILRGLKYIHSADIIHRDL aaacctagtaatctagctgtgaatgaagactgtgagctgaagattctggattttggactg KPSNLAVNEDCELKILDFGL gctcggcacacagatgatgaaatgacaggcta'cgtggccactaggtggtacagggctcct ARHTDDEMTGYVATRWYRAP gagatcatgctgaactggatgcattacaaccagacagttgatatttggtcagtgggatgc EIMLNWMHYNQTVDIWSVGC ataatggccgagctgttgactggaagaacattgtttcctggtacagaccatattgatcag IMAELLTGRTLFPGTDHIDO ttgaagctcattttaagactcgttggaaccccaggggctgagcttttgaagaaaatctcc LKLI LRLVGTPGAELLKKIS tcagagcctgcaagaaactatattcagtctttgactcagatgccgaagatgaactttgcg SESARNYIQSLTQMPKMNFA aatgtatttattggtgccaatcccctggctgtcgacttgctggagaagatgcttgtattg NVFIGANPLAVDLLEK MLVL gactcagataagagaattacagcggcccaagcccttgcacatgcctactttgctcagt.ac DSDKR ITAAQALAHAYFAQY cacgatcctgatgatgaaccagtggccgatccttatgatcagtcctttgaaagcagggac HDPDDEPVADPYDQSFESRD ctccttatagatgagtggaaaagcctgacctatgatgaagtcatcagatttgtgccacca LLIDEWKSLTY

PLDOEEME S - (SEQ ID NO: _)

179

52010 Β

Piml

PCR primers [0295]

<td>PIM1</td><td>PIM-1S</td><td>GC7TGGCGCATATGAAGGAGAAGGAGCCCCTGGAG (SEQ ID NO: ___)</td><td> 233</td>

<td></td><td>PIM-1A</td><td>GAIU ^ GGGTCGACTTTGCT ^ ​​SGCCCCGGCGACAG (SEQ ID NO: ___)</td><td> 234</td>

Ρ1215.pET29SRI ΡΙΜ1 Β29 Κ313-HIS WT agatcgatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataa caattcccctctagaaataattttgtttaactttaagaaggagatatacatatgaaggag MK Ε aaggagcccctggagtcgcagtaccaggtgggcccgctactgggcagcggcggcttcggc KEPLESQYQVGPLLGSGGFG tcggtctactcaggcatccgcgtctccgacaacttgccggtggccatcaaacacgtggag SVYSGIRVSDNLPVAIXHVE aaggaccggatttccgactggggagagctgcctaatggcactcgagtgcccatggaagtg KDRISDKGELPNGTRVPMBV gtcctgctgaagaaggtgagctcgggtttctccggcgtcattaggctcctggactggttc VLLKKVSSGFSGVlRLIiDWF gagaggcccgacagtttcgtcctgatcctggagaggcccgagccggtgcaagatctcttc ERPDSFVLILERPEPVQDI "F gacttcatcacggaaaggggagccctgcaagaggagctggcccgcagcttcttctggcag DFITERGALQEELARSFFWQ gtgctggaggccgtgcggcactgccacaactgcggggtgctccaccgcgacatcaaggac VLEAVRHCH NCGVLHRDI KD gaaaacatccttatagacctcaategcggcgagctcaagctcatcgacttcgggtcgggg ENILIDLNRGELKLIDFGSG gcgctgctcaaggacaccgtctacacggacttcgatgggacccgagtgtatagccctcca AILKDTVYTDFDGTRVYSPP gagtggatccgctaccatcgctaccatggcaggtcggcggcagtctggtccctggggatc EWIRYHRYHGRSAAVWSLGI IR ctgctgtatgatatggtgtgtggagatattcctttcgagcatgacgaagagatcatcagg LLYDMVCGDIPFEHDEEI ggccaggttttcttcaggcagagggtctcttcagaatgtcagcatctcattagatggtgc GQVFFRQRVSSECQHLIRWC ttggccctgagaccatcagataggccaaccttcgaagaaatccagaaccatccatggatg LALRPSDRPTFEEIQNHPWM caagatgttctcctgccccaggaaactgctgagatccacctccacagcctgtcgccgggg QDVLLPQETAEIHLHSLSPG cccagcaaag cgaccaccaccaccacca c t gat c CACT by which time cggct gctaacaaagc PSKVDHHHHHH- (SBQ ID N0: ) aaggaattcgagttggctgctgccaccgctgagcaataactagcataaccccttggggcc tctaaacgggtcttgaggggttttttg (vvđ xj> no:)

180

52010 Β

Ret

PCR primers [0296]

<td>RET</td><td>RETH661</td><td>GTTCTTCATATGCACAAGTTTGCCCACAA.GCCA (SEQ ID MO; ___)</td><td> 2184</td>

<td></td><td>RE-1012-HIS</td><td>GTTCTTGTCGACCCTCTTAACCATCATCTTCTCCAGGTCT (SBQ ID N0: ___)</td><td> 2431</td>

181

52010 Β

P1378.pET-SP-ΒΙ ΡΤΡ RET H661-R1012 HIS taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataatttt gtttaactttaagaaggagatatacatatgcacaagtttgcccacaagccacccatctcc MHKFAHKPPIS tcagctgagatgaccttccggaggcccgcccaggccttcccggtcagctactcctcttcc SAEMTFRRPAQAFPVSYS SS ggtgcccgccggccctcgctggactccatggagaaccaggtctccgtggatgccttcaag GARRPSLDSMENQVSVDAFK atcctggaggatccaaagtgggaattccctcggaagaacttggttcttggaaaaactcta ILEDPKWEFPRKNLVLGKTL ggagaaggcgaatttggaaaagtggtcaaggcaacggccttccatctgaaaggcagagca GBGEFGKVVKATAFHL KGRA gggtacaccacggtggccgtgaagatgctgaaagagaacgcctccccgagtgagcttcga GYTTVAVKMLKENAS PS ELR gacctgctgtcagagttcaacgtcctgaagcaggtcaaccacccacatgtcatcaaattg DLLSEFNVLKQVNHPHVIKL · tatggggcctgcagccaggatggcccgctcctcctcatcgtggagtacgccaaatacggc YGACSQDGPLLLIVBYAKYG tccctgcggggcttcctccgcgagagccgcaaagtggggcctggctacctgggcagtgga SLRG FLRESRKVGPGVLGSG ggcagccgcaactccagctccctggaccacccggatgagcgggccctcaccatgggcgac GSRNSSS LDHPDERALTMGĐ ctcatctcatttgcctggcagatctcacaggggatgcagtatctggccgagatgaagctc LISFAWQISQGMQYLAEMKL · gttcatcgggacttggcagccagaaacatcctggtagctgaggggcggaagatgaagatt VHRDLAARNILVAEGRK MKI tcggatttcggcttgtcccgagatgtttatgaagaggattcctacgtgaagaggagccag SDFGLSRDVYEBDSYVKRSQ GGT cggatt ccagt t Canstatin GGAT ggcaat TgAA t CCCT 11 ttgat cat at ctacaccacg GRIPVKWMAIESLPDHIYTT caaagtgatgtatggtcttttggtgtcctgctgtgggagatcgtgaccetagggggaaac QSD VWS FGVLLWEIVTLGGN ccctatcctgggattcctcctgagcggctcttcaaccttctgaagaccggccaccggatg PYPGI PPERLFNLLKTGHRM gagaggccagacaactgcagcgaggagatgtaccgcctgatgctgcaatgctggaagcag ERPDNCSEEM YRLMLQCWKQ gagccggacaaaaggccggtgtttgcggacatcagcaaagacctggagaagatgatggtt EPDKRPVFADISKDLEKMMV aagagggtcgaccaccaccaccaccaccactgagatccggctggccctactggccgaaag KRVDHHHHHH- (SBQ ID My) gaattcgaggccagcagggccaccgctgageaataactagcataaccccttggggcctct aaacgggtcttgaggggttttttg (SEQ ID NO:)

182

52010Β

Src

PCR. primers [0297]

<td></td><td>GCTGGCCCATATGGTGACCACCTTTGTGGCCCT</td><td></td>

<td>SRC-86</td><td>(SBQ ID N0: ___)</td><td> 1452</td>

<td></td><td>GCTACTAGTOGACCT7kGAGGTTCTCCCCGGGCT</td><td></td>

<td>SRC-452 (L536)</td><td>(SBQ ID N0: ___)</td><td> 1453</td>

183

52010 Β

Ρ1144. ρΕΤ-Νβ ΒΙ ΡΤΡ-SRC V86-LS36-X taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatggtgacc MGHHHHHHMVT acctttgtggccctctatgactatgagtctaggacggagacagacctgtccttcaagaaa TFVALYDYBSRTETDLSFKK ggcgagcggctccagattgtcaacaacacagagggagactggtggctggcccactcgctc GERLOIVNNTEGDMCTLiAHSL agcacaggacagacaggctacatccccagcaactacgtggcgccctccgactccatccag STGQTGYIPSNYVAPSDSIQ gctgaggagtggtattttggcaagatcaccagacgggagtcagagcggttactgctcaat AEEWYFGKlTRRESERIiLLN gcagagaacccgagagggaccttcctcgtgcgagaaagtgagaccacgaaaggtgcctac AENPRGTFLVRESETTKGAY tgcctctcagtgtctgacttcgacaacgccaagggcctcaacgtgaagcactacaagatc CLSVSDFDNAKGLNVKHYKI cgcaagctggacagcggcggcttctacatcacctcccgcacccagttcaacagcctgcag RKLDSGGFYITSRTQFNSLQ cagctggtggcctactactccaaacacgccgatggcctgtgccaccgcctcaccaccgtg QLVAYYS KHADGLCHRLTTV tgccccacgtccaagccgcagactcagggcctggccaaggatgcctgggagatccctcgg CPTSKPQTQGLAKDAWBI PR gagtcgctgcggctggaggtcaagctgggccagggctgctttggcgaggtgtggatgggg ESLRLEVKLGQGCFGBVWMG acctggaacggtaccaccagggtggccatcaaaaccctgaagcctggcacgatgtctcca TWNGTTRVAIKTLKPGTMSP gaggc CCT 11 c and gcagg ggcccaggt gaagaagc ca t t t gaggc at gagaagc cag gg tg EA PLQEAQVMKKLRHEKLVQ ttgtatgctgtggtttcagaggagcccatttacatcgtcacggagtacatgagcaagggg LYAVVSBEPIYIVTBYMSKG agt gc t ggac 11 11 TCT caagggggagacaggcaagt ac ct gcc gcggct cagct t ggtg SLLDFLKGETGKYLRIjPQIjV gacatggctgctcagatcgcctcaggcatggcgtacgtggagcggatgaactaogtccac DMAAQIASGMAYVERMNYVH cgggaccttcgtgcagccaacatcctggtgggagagaacctggtgtgcaaagtggccgac RDLRAANlLVGENhVCKVAD tttgggctggctcggctcattgaagacaatgagtacacggcgcggcaaggtgccaaattc FGLARLIEDNEYTARQGAKF cccatcaagtggacggctccagaagctgccctctatggccgcttcaccatcaagtcggac PIKWTAPEAALYGRFTIKSD gtgtggtccttcgggatcctgctgactgagctcaccacaaagggacgggtgccctaccct VWSFGIL1iTEI * TTKGRVPYP gggatggtgaaccgcgaggtgctggaceaggtggagcggggctaccggatgccctgcccg GMVNREVLDQVBRGYRMPCP ccggagtgtcccgagtccctgcacgacctcatgtgccagtgctggcggaaggagcctgag RESREbiNOBMSOSMVKERE gagcggcccaccttcgagtacctgcaggccttcctggaggactacttcacgtccaccgag ERPTFBYLQAFLEDYFTSTE ccccagtaccagcccggggagaacctctaggtcgacgaaggagatatatcc (sbq id NO: __)

PQYQPGENL- (SEQ ID NO: _)

184

52010Β

Zap70

PCR primers [0298]

<td>ZAP70</td><td>ZAP70-D327-BAMHI-N</td><td>agagggatccgccaccatggacaagaagctcttcctgaa (SEQ XD N0: ___)</td><td> 5172</td>

<td></td><td>ZAP70-G606-HIS</td><td>ACGAATTCTAGTGGTGGTGGTGGTGGTGGTGCCCTTCCACCT TGCTG (SBQ ID N0: ___)</td><td> 5171</td>

P186S.pFastBacl ZAP70 D327-G606 HIS, WT agatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgtttt cgtaacagttttgtaataaaaaaacctataaatattccggcattcataccgtcccaccatcgg

MDKKLFLKRDNLL · atagctgacattgaacttggctgcggcaactttggctcagtgcgccagggcgtgtaccgc IADI ELGCGNFGSVRQGVYR atgcgcaagaagcagatcgacgtggccatcaaggtgctgaagcagggcacggagaaggca MRKKQIDVAIKVLKQGTEKA gacacggaagagatgatgcgcgaggcgcagatcatgcaccagctggacaacccctacatc DTBEMMREAQIMHQI "DNPYl gtgcggctcattggcgtctgccaggccgaggccctcatgctggtcatggagatggctggg VRLIGVCOAEALMLVMEMAG ggcgggccgctgcacaagttcctggtcggcaagagggaggagatccctgtgagcaatgtg GGPLHKFLVGKREEIPVSNV gccgagctgctgcaccaggtgtccatggggatgaagtacctggaggagaagaactttgtg AELLHQVSMGMKYLEEKNFV caccgtgacctggcggcccgcaacgtcctgctggttaaccggcactacgccaagatcagc HRDLAARNVLI "VNRHYAKIS gactttggcctctccaaagcactgggtgccgacgacagctactacactgcccgctcagca DFGLSKALGADDSYYTARSA gggaagtggccgctcaagtggtacgcacccgaatgcatcaacttccgcaagttctccagc GKWPLKWYAPECINFRKFSS cgcagcgatgtctggagctatggggtcaccatgtgggaggccttgtcctacggccagaag RSDVWSYGVTMWEAIjSYGQK ccctacaagaagatgaaagggccggaggtcatggccttcatcgagcagggcaagcggatg PYKKMKGPBVMAFIEQGKRM gaatgcccaccagagtgtccacccgaactgtacgcactcatgagtgactgctggatctac ECP₽ECPPELYALMSDCWIY aagtgggaggatcgccccgacttcctgaccgtggagcagcgcatgcgagcctgttactac KWEDRPDFLTVEQRMRACYY agcctggccagcaaggtggaagggcaccaccaccaccaccaccactqagaattc

SLASKVBGHHHHHHH - (SBQ ID NOi>

185

52010 Β

ΒΛΡ Substrate

PCR primers [0299J

<td>BAD</td><td>BAD-N</td><td>GTTGTGACATATGTTCCAGATCCCAGAGTTTG (SEQ ID NO: ___)</td><td> 1613</td>

<td></td><td>BAD-S</td><td>GTTGTGAGTCGACTCACTGGGAGGGGGCGGA (SEQ ID F&gt;: ___}</td><td> 1614</td>

P963.pBT-BH BAD Ml-Q168-X tacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgt ttaactttaagaaggagatataccatggctggttgcctgaacgacatcttcgaagctcag MAGCLNDIFBAQ aaaatcgaatggcaccatcaccatcaccatatgttccagatcccagagtttgagccgagt KIEWHHHHHHMFQI₽EFBPS gagcaggaagactccagctctgcagagaggggcctgggccccagccccgcaggggacggg BQEDSSSAERGLGPSPAGDG ccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac PSGSGKHHRQAPGLLWDASH cagcaggagcagccaaccagcagcagccatcatggaggcgctggggctgtggagatccgg QQEQPTSSSHHGGAGAVEIR agtcgccacagctcctaccccgcggggacggaggacgacgaagggatgggggaggagccc SRHSSTPAGTEDDBGMGEEP agccccttt cggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctat SPFRGRSRSAPPNLWAAQRY ggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcct GRELRRMSDEFVDSFKKGLP cgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagetggacgcgagtc RPKSAGTATQMRQSSSWTRV ttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgagtc FQSWWDRNLGRGSSAPSQ gaccaccaccaccaccaccactgagatccggctggccctactggccgaaaggaattcgag gccagcagggccaccgctgagcaataactagcataaccccttggggcctctaaacgggtc ttgaggggttttttg (sbq w ®ro: __>

Ipolypeptide SEQ ID N0: ___)

186

52010 Β

ΚΕΚ1 Substrate

PCR primers [03001

<td>MSK1</td><td>MEK1-S</td><td>cgggtcccatatgcccaagaagaagccgac (SSQ X © N0: ___)</td><td> 755</td>

<td></td><td>MEK-HIS</td><td>GTTCGTTGTCGACGACGCC3U3CAGCATGGGTTG (SEQ ΙΌ «Ot___)</td><td> 2127</td>

<td></td><td>K97A-1 (K104A)</td><td>CTAATTCAiCTGGAGAT (^&gt; CGCCCGCAATCCGG (SEQ ΙΓ N0: ___)</td><td> 2023</td>

<td></td><td>K97A-2 (K104A)</td><td>CCGGATTGCGGGCGCGATCTCCAGATGAATTAG (SEQ ID NO: ___)</td><td> 2024</td>

187

52010 Β

Ρ1277 .pGEX ΜΕΚ1 BIO-K97A atgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttctt MSPILGYWKIKGLVQPTRLL ttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaa LEYLEEKYEEHLYERDEGDK tggcgaaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatattgat WRNKKFELGLEFPNLPYYID ggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaac GDVKLTQSMAI IRYIADKHN atgttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttg MLGGCPKBRAEISMLBGAVL gatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagtt DIRYGVSR IAYSKDFETLKV gattttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcataaa DFLSKLPEMLKMFBDRLCHK acatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgat TYI, NGDHVTH₽DFMI.YDAI.D gttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaa VVLYMDPMCLDAFPKLVCFK aaacgtattgaagotatcccacaaattgataagtacttgaaatccagcaagkatatagca KRIEAIPQIDKYLKSSKYIA tggcctttgcagggctggcaagccacgtttggtggtggcgaccatcctccaaaatcggat WPLQGWQATFGGGDHPPKSD ctggttccgcgtggatctcatatgcccaagaagaagccgacgcccatccagctgaacccg LVPRGSHMPKKKPTPIOLNP gcccccgacggctctgcagttaacgggaccagctctgcggagaccaacttggaggccttg APDGSAVNGTSSAETNLBAL · cagaagaagctggaggagctagagcttgatgagcagcagcgaaagcgccttgaggccttt QKKI.B BLELDSQQRKRX.EAF ct t t acccagaagcagaaggt gggagaac gaagga tgacgac 111 gagaaga t cagt gag LTQKQKVGELKDDPFEKISE ctgggggc.tggcaatggcggtgtggtgttcaaggtctcccacaagccttctggcctggtc 1> Gagne GGVVPKVSHKP SGLV atggccagagcgctaattcatctggagatcaaacccgcaatccggaaccagatcataagg MANAB1NBE1KRA1II011K gagctgcaggttctgcatgagtgcaactctccgtacatcgtgggcttctatggt.gcgttc ELQVLHECNSPYIVGFYGAF tacagcgatggcgagatcagtatctgcatggagcacatggatggaggttctctggatcaa YSDGEIS ICMEHMDGGSLDQ gtcctgaagaaagctggaagaattcctgaacaaattttaggaaaagttagcattgctgta VLKKAGR. XPBQILGKVSIAV

188

52010 Β ataaaaggcctgacatatctgagggagaagcacaagatcatgcacagagatgtcaagccc IKGLTTLREKHKIMHRDVKP tccaacatcctagtcaactcccgtggggagatcaagctctgtgactttggggtcagcggg SNILVNSRGEIKLCDFGVSG cagctcatcgactccatggccaactccttcgtgggcacaaggtcctacatgtcgccagaa qlidsmansfvgtrsyms p e agactccaggggactcattactctgtgcagtcagacatctggagcatgggactgtctctg rlqgthysvqsdiwsmglsl "gtagagatggcggttgggaggtatcccatccctcctccagatgccaaggagctggagctg VEMAVGRYPIPPPDAKELEL atgtttgggtgccaggtggaaggagatgcggctgagaccccacccaggccaaggaccccc mfgcqvegdaaetpprprtp gggaggccccttagctcatacggaatggacagccgacctcccatggcaatttttgagttg GRPLSSYGMDSRPPMAIFEL · ttggattacatagtcaacgagcctcctccaaaactgcccagtggagtgttcagt

111 1111 gaat caaga gt AAT GC and 11 aa t c AAAAAACE ccgcagagagagcagat 11 Gaag FQDFVNKCLIKNPAERADLK caactcatggttcatgcttttatcaagagatctgatgctgaggaagtggattttgcaggt Q LM VHAFIKRSDAEEVDFAG tggctctgctccaccatcggccttaaccagcccagcacaccaacccatgctgctggcgtc WLCSTIGLNQPSTPTHAAGV gt cgacctgaacgacat ct tcgaagct cagaaaat cgaatggcaccgttagaat VDLNDIFEAQKIEWHR- tc <BBQ ID hot_>

(nucleic acid BBQ ID HOi___)

Example 27: Efficacy of compounds in combination with standard chemotherapeutic agents in four human cancer cell lines Compounds of the invention, such as compounds of Formula III, in combination with standard chemotherapeutic agents, such as 5-fluorouracil, carboplatin, dacarbazine, gefitin , oxaliplatin, paclitaxel, SN-38, temozolomide or vinblastine, can be evaluated for their efficacy in killing human tumor cells. Human tumor cell lines, such as A-375 (malignant melanoma), SK.-MEL-2 (malignant melanoma, skin metastasis), COLO 205 (colorectal adenocarcinoma, ascites metastasis) or SW-620 (colorectal adenocarcinoma, lymphatic metastasis) nodules) may be treated with a compound of Formula III alone, or in combination with one of the aforementioned chemotherapeutic agents.

Tumor cells were grown as a monolayer at 37 ° C in a humidified atmosphere (5% CO₂, 95% air). The cells were grown in a suitable culture medium, e.g. RPMI 1640 (Ref ΒΕ12702F, Cambrex, Verviers, Belgium) containing 2mML-glutamine and supplemented with 10% fetal bovine serum (Ref DEl 4-801E, Cambrex). For experimental use, tumor cells were separated from the culture vessel by a 5-minute treatment with trypsin

189

52010 Β versene (Ref 02-007E, Cambrex), diluted in Hank's medium without calcium or magnesium (Ref BE10-543F, Cambrex). Trypsin treatment was neutralized by adding culture medium. Cells were counted in a hemocytometer and their viability was estimated as 0.25% using the trypan blue exclusion test. Cell lines were checked for mycoplasma contamination with the Mycotect test kit (Rcf 15672-017, Invitrogen, Cergy-Pontoise, France) according to the manufacturer's instructions. The mycoplasma test was tested from cell line culture supplements and compared with negative and positive controls.

Tumor cells (10,000 per well) were placed in a 96-well flat-bottomed microtiter plate (Ref 055260, Nunc, Dutscher, Brumath, France) and incubated at 37 ° C for 24 hours before treatment in a 100 μΐ medium. for drug-free culture, supplemented with 10% FBS. In order to assess the IC50 of each compound to be used for each cell line, tumor cells were incubated in a 200 μΐ final volume of RPMI 1640 supplemented with 10% FBS and containing either a compound of Formula III or one of 5-fluorouracil, carboplatin, dacarbazine, gefitinib , oxaliplatin, paclitaxel, SN-38, temozolomide or vinblastine. The compounds are tested in a suitable concentration range, such as 10 '⁸ up to 10 '³ M for a compound of Formula III, 5-fluorouracil, dacarbazine or gefitinib, 10 '⁹ to 10⁴ M for carboplatin, oxaliplatin or temozolomide, 10 '¹¹ do ΙΟ '⁶ M for paclitaxel or SN-38 and 10 '¹⁵ up to 10 '¹⁰ M for vinblastine. The compounds of Formula III are dissolved in DMSO and diluted with culture medium to the desired concentrations. 5-fluorouracil (50 mg / ml, Dakota Pharm, LePlessis Robinson, Francc), carboplatin (10 mg / ml, Aguettant, Lyon, France) and paclitaxel (6 mg / ml, Bristol-Myers Squibb SpA, Rueil Malmaison, France) , are diluted with culture medium to desired concentrations. Dacarbazine (Sigma, Saint Quentin Fallavier, France) and vinblastine (Lilly France SA, Saint Cloud, France) were dissolved in NaCl 0.9% and diluted with culture medium to the desired concentrations. Gefitinib was dissolved in a mixed solution of RPMI 1640 and DMSO and diluted with culture medium to the desired concentrations (maximum final DMSO of 0.1% v / v). SN-38 (LKT Laboratories, Inc., St. Paul, Minnesota) was dissolved in DMSO and diluted with culture medium to desired concentrations (maximum final DMSO of 0.1% v / v). Temozolomide (LK.T Laboratories, Inc., St. Paul, Minnesota) was dissolved in water for injection and diluted with culture medium to the desired concentrations. The cells were incubated for 96 hours in the presence of test substances at 37 ° C under 5% CO2. At the end of treatment, cytotoxic activity was assessed by MTT test.

For the MTT test, at the end of cell treatment, 20 μΐ of a 5 mg / ml solution of a 0.22 pm solution of filtered tetrazolium reagent (MTT, Ref Μ2128, Sigma) in phosphate buffered saline (PBS, Ref BE17-) was added to each well. 517Q, Cambrex). The culture plates are

190

52010Β incubated for 2 hours at 37 ° C. The resulting supernatant was removed and the formaz crystals were dissolved in 200 μΐ DMSO per well. Absorbance (OD) was measured at 570 nm in each chamber using a VICTOR3 ™ 1420 multil-labeled reading device (Wallac, PerkinElmer, Courtaboeuf, France).

The IC50 for each compound on each cell line was determined from OD measurements of each sample. Inhibition of cell proliferation in response to a dose is expressed as:

GO ^s (OD cells exposed to drug f ODchambers without drug) x 100.

The mean value of multiple measurements for each concentration is shown on the graph by drug concentration. Dose and response curves are plotted using XLFit 3 (IDBS, United Kingdom). IC50 values ​​(lcc concentration required to obtain 50% inhibition of cell proliferation) were calculated using XLFit 3 from semi-log curves. The IC50 value determined for each compound in each cell line was used to determine the concentration of the compound of Formula III and the standard chemotherapeutic to be used in combination.

Cells were treated with a combination of five concentrations of a compound of Formula III and five concentrations of one of 5-fluorouracil, carbopyatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel, SN-38, temozolomide or vinblastine, based on IC50 results. Compounds and cells were treated according to the IC50 determination described above and tested by MTT assay.

The results were evaluated to determine whether the combination was synergistic or antagonistic. Compound interactions were calculated by multiple drug analysis and performed using the “median equation principle” according to the methodology described by Chou and Talalay (Adv. Enzyme Regul. 1984, 22: 27-55).

The combination index (CI) will be calculated using the equation given by Chou et al. (Adv. Enzyme Regul. 1984, 22: 27-55; Encyclopaedia of Human Biology, Academic Press, 1991,2: 371-9; Synergism and Antagonism in Chemotherapy, Academic Press, 1991, 61-102) which takes into account how potency (D_m or IC50) as well as the shape of the dose-effect curve (m value). The general equation for the CI of the two compounds is given by:

<img file="RS52010B_D0064.tif" />

191

52010 Β where:

(D_x) ii (D_x)₂ in the denominators are the doses (or concentrations) for compound 1 and compound 2 individually showing x% inhibition, while (D) ii (D)₂ in dose counters of both compounds (1 and 2) in a combination that also inhibits x% (iso-efficiently). CI <1, = 1 and> 1 indicate synergism, additive effect and antagonism, respectively.

[0309] (D_x) ii (Ђ_x)₂ can be calculated from the unit of mean effect given by Chou ct al. (J. Natl. Cancer Inst. 1994, 86: 1517-24):

<img file="RS52010B_D0065.tif" />

where:

D_m is the dose with the mean effect obtained from the anti-log section on the x axis from the graph of the mean cfckt, h = log (D) premay = log (/ a / / l_:/ a)}, or D_m = 10- (y-segment) / m; their slope of the mean effect graph and / a is the fraction of cells affected by the treatment. Each S1 will be calculated with CalcuSyn software (Biosoft, UK) from the mean affected fraction at each drug concentration ratio.

Additional examples. Unless specifically indicated otherwise, the numbering of formulas and R groups used in the following examples is not related to such numbering in other parts of this application. The reagents and solvents used in these examples can be readily substituted with suitable alternatives as known in the art and isolation of the product is readily accomplished by methods known in the art, including, but not limited to, extraction, crystallization, and chromatography methods. For the following examples, the following formulas are defined:

<img file="RS52010B_D0066.tif" />

<img file="RS52010B_D0067.tif" />

where:

R⁴ and R⁵ are as defined in paragraph [0008];

192

52010 Β

R¹², R¹³ and R¹⁶ are as defined in paragraph [0103];

R²⁸ is -SO2R²⁵, -C (= O) R²⁵, -C (-O) NR²⁵, -C (-O) OR²⁵, -C (= S) R²⁵, - (= S) NR²⁵, -C (= S) OR²⁵ or -SO2NR²⁵R²⁶; wherein, R²⁵ and R²⁶ are hydrogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl or optionally substituted heteroaryl, or

R²⁵ and R²⁶ together with nitrogen they form optionally substituted 5-7-membered heterocycloalkyl or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl.

R is hydrogen or optionally substituted lower alkyl; i

R³⁰ is optionally substituted lower alkyl or optionally substituted benzyl, wherein optionally substituted benzyl refers to optionally substituted aralkyl with an unsubstituted CH structure₂-phenyl.

Example 28. Synthesis of compounds of formula II, wherein R and R are independently fluoro or chloro [0311] _R1S

<img file="RS52010B_D0068.tif" />

R13

III where, R¹²iR¹⁶are F or Cl

<img file="RS52010B_D0069.tif" />

are F or S1

Step 1- Synthesis of Compounds of Formula II A compound of Formula II, wherein R¹² and R¹⁶ are fluoro or chloro, can be synthesized by reacting a compound of Formula III with an organolithium reagent (e.g., n-butyl lithium, lithium diisopropylamine) in an inert solvent (e.g., THF), followed by the addition of a formylation reagent (e.g., DMF). The reaction was allowed to proceed, typically at -78 ° C, for 1-2 hours and the desired product was isolated by standard methods (e.g. extraction, silica gel chromatography).

193

52010 Β

<img file="RS52010B_D0070.tif" />

Example 29. Synthesis of compounds of Formula III, wherein R¹³ is NR²⁸R²⁹ [0313]

<img file="RS52010B_D0071.tif" />

Step 1

R ^ 'R²⁸

III where R¹³equal to NR²⁸R²⁹

Step 1 - Synthesis of compounds of Formula III in which R¹³ is NR²⁸R²⁹ A compound of Formula III, wherein R is NR R, may be synthesized by reacting a compound of Formula IV with a base (e.g., pyridine, sodium hydride) in an inert solvent (e.g., DMF, CH₂C1₂) and then with the corresponding reagent (R²⁵SO2C1, e.g. propane-1-sulfonyl chloride; R²⁵C (= O) C1, e.g. acetyl chloride; R²⁵NCO, e.g. propyl isocyanate; R²⁵OC (= O) Cl, e.g. benzyl chloroformate; R²⁶R²⁵NSO2Cl, e.g. dimethylsulfamoyl chloride). The reaction is allowed to continue, typically at room temperature, for 8-12 hours and the desired product is isolated by standard procedures (e.g. extraction and chromatography on silica gel).

Example 30. Synthesis of Compounds of Formula VIII [0315] _R2S

Hn ' ^{Step 1}

R²⁸

IX? F

Cl-SN ^{% R2e}

VIII

Step 1 - Synlosis of Compounds of Formula VIII A compound of Formula VIII was synthesized by reacting a compound of Formula IX with a base (e.g. pyridine) in an inert solvent (e.g. CII2Cl2 followed by sulfuryl chloride). The reaction was left to

194

52010 It is continued, typically under reflux, for 8-12 hours and the desired product is isolated by standard procedures (eg evaporation).

Example 31. Synthesis of compounds of Formula X

<img file="RS52010B_D0072.tif" />

Step 1- Preparation of Compounds of Formula HPa and XIIb A suitable solvent (e.g. methanol) is added to the compound of Formula XVIII and the compound of Formula II, followed by the appropriate base (e.g. potassium hydroxide, sodium methoxide). The reaction was typically allowed to stir at room temperature overnight. Insulation by conventional means (e.g. extraction, washing and filtration) a mixture of compounds of Formula HPa and XIIb is obtained which can be separated by chromatography on silica gel if desired.

Step 2 - Preparation of Compounds of Formula X A reducing agent (e.g. trifluoroacetic acid and triethylsilane) is added to the compound of Formula HPa or XIIb in a suitable solvent (e.g. acetonitrile). Typically, the reaction is allowed to stir at room temperature overnight. Isolation by conventional means (e.g., silica gel column extraction and chromatography) affords the compounds of Formula X.

Example 32 Synthesis of Compounds of Formula I [0320]

195

52010 Β

<img file="RS52010B_D0073.tif" />

Step 1

<img file="RS52010B_D0074.tif" />

Step / - Preparation of Compounds of Formula I:

An oxidizing agent (e.g. Dess-Martin periodine, TEMPO, DDQ) was added to the Formula HPa compound in a suitable solvent (e.g. THF). Typically, the reaction is allowed to stir at room temperature for 20 minutes. Isolation by conventional means (eg extraction and column chromatography on silica gel) gives compounds of Formula L.

Example 33. Synthesis of a compound of formula XIII in komc R¹² and R¹⁶ they are independently chloro or fluoro

<img file="RS52010B_D0075.tif" />

XIV where, R¹²iR¹⁶are F or CI

<img file="RS52010B_D0076.tif" />

XIII where R¹² and R¹⁶are F or S1

Step 1 - Synthesis of compounds of Formula XIII, wherein R¹² and R¹⁶ are chloro or fluoro A compound of Formula XIII, wherein R and R are chloro or fluoro, is synthesized by reacting a compound of Formula XIV with an organolithium reagent (e.g. n-butyl lithium) and temporarily protected with a protecting group (e.g. 1,2-Bis - (chlorodimethyl-silanyl) -ethane) and DMF in an inert solvent (e.g.

196

52010 Β

THF) under an inert atmosphere (e.g. argon) at -78 ° C for 2-4 hours, followed by removal of the temporary protecting group using an acid (e.g. 1N HCl). The product was isolated by extraction and column chromatography on silica gel.

28

Example 34 Synthesis of a compound of formula XV, wherein R is NBR [0324]

<img file="RS52010B_D0077.tif" />

XIII

Kogak 3

<img file="RS52010B_D0078.tif" />

Step 2

<img file="RS52010B_D0079.tif" />

Step 1 - Synthesis of a compound of Formula XVI A compound of Formula XVI can be synthesized by reacting a compound of Formula XIII with a base (e.g. pyridine, sodium hydride) in an inert solvent (e.g. DMF, CH 2 Cl 2) followed by an appropriate reagent (R SO₂Cl, e.g., propane-1-sulfonyl chloride; RC (= O) Cl, e.g., acetyl chloride; R NCO, e.g., propyl isocyanate; R OC (= O) Cl, e.g., benzyl chloroformate; R²⁶R²⁵NSO₂C1, e.g., dimethylsulfamoyl chloride). The reaction is allowed to continue, typically at room temperature, for 8-12 hours and the desired product is isolated by standard procedures (e.g. extraction and chromatography on silica gel).

Step 2 - Synlosis of the compounds of Formula XVII

197

A compound of Formula XVII may be synthesized by hydrolysis of a compound of Formula XVI with an aqueous base solution (e.g., sodium hydroxide). The reaction is allowed to proceed, typically under reflux, for 8-12 hours and the desired product is isolated by standard procedures (e.g. extraction).

Step 3 - Synthesis of a compound of Formula XV, wherein R is NHR A compound of Formula XV, wherein R¹³ jc NHR²⁸, can be synthesized by reacting a compound of Formula XVII with thionyl chloride. The reaction was allowed to proceed, typically under reflux, for 3 hours and the desired product was isolated by standard procedures (e.g. evaporation).

Example 35. Synthesis of Formula XV Compounds [0328]

<img file="RS52010B_D0080.tif" />

Step 1 - Synthesis of Compounds of Formula XV A compound of Formula XV may be synthesized by reacting a compound of Formula XIX with thionyl chloride. The reaction is allowed to continue, typically under reflux, for 3 hours and the desired product is isolated by standard methods (e.g. evaporation).

Example 36 Synthesis of Compounds of Formula I [0330]

<img file="RS52010B_D0081.tif" />

R⁴

XVIII

<img file="RS52010B_D0082.tif" />

198

52010 Β

Step - / - Synthesis of Compounds of Formula I A compound of Formula I was synthesized by reacting a compound of Formula XVIII with a compound of Formula XV (Example 83, e.g. benzoyl chloride) in the presence of Lcwis acid (e.g. aluminum trichloride) in an inert solvent (methylene chloride) under an inert atmosphere (e.g. argon) at room temperature or with heating to reflux for 1-18 hours. The product was isolated by extraction and column chromatography on silica gel.

Example 37. Synthesis of a compound of Formula I wherein R⁵ is aryl or heteroaryl [0332]

<img file="RS52010B_D0083.tif" />

Kogak 1 where, R⁶jeBr

<img file="RS52010B_D0084.tif" />

where, R⁵is aryl or heteroaryl

Kogak 1: Synthesis of compounds of Formula I, at R⁵ is an aryl or heteroaryl Compound of Formula I, wherein R⁵ is aryl or heteroaryl, prepared by reacting a compound of Formula I, wherein R⁵ is bromo, under Suzuki coupling conditions, with an organobomic acid (e.g. phenyl organobomic acid) in the presence of a base (e.g., potassium carbonate) and a catalyst (e.g., Pd (Ph₃P)₄) in an aqueous / THF solvent system. After 4-12 hours with heating to 80 ° C or heating in a microwave instrument at 120 ° C for 15 minutes, the product is isolated by standard work-up procedures (eg silica gel column chromatography).

Example 38. Synthesis of Compounds of Formula 1 [0334J

199

52010 Β

<img file="RS52010B_D0085.tif" />

Ρ

<img file="RS52010B_D0086.tif" />

1. Step4

2. Kogak 5

XXII

<img file="RS52010B_D0087.tif" />

Step - / - Synthesis of Compound XX A compound of Formula XX can be synthesized by reacting a compound of Formula XVIII with hexamethyltetramine and acetic acid in water with heating to reflux for two hours. After cooling, the desired product precipitates and can be collected by filtration.

Step - 2 - Synthesis of Compounds of Formula XXI A compound of Formula XXI, wherein P is a protecting group, is synthesized by reacting compound XX with an appropriate reagent to introduce a protecting group (R-H, e.g., triisopropylsilyl chloride) and a base (e.g., sodium hydride). ) in a solvent (e.g. THF) typically at room temperature for 8-12 hours. The product is isolated by conventional means (eg extraction).

Step - 3 - Synthesis of Compounds of Formula XXII A compound of Formula XXII was synthesized by reacting a compound of Formula XXI in a solvent (e.g. THF) with an organolithium reagent (e.g. phenyl lithium) in a solvent (e.g. TIIF) under an inert atmosphere, ohl 78 ° C. A suitable organolithium reagent may also be prepared by reacting a compound of Formula III, wherein R and R are independently fluoro or chloro, with an organolithium reagent (e.g., butyl lithium) in a solvent (e.g., THF) under

200

52010 Β with an inert atmosphere, cooled to -78 ° C. The reaction was typically allowed to warm to room temperature and stirred for 30 minutes. The product is isolated by conventional means (e.g. extraction).

Step - 4 - Synthesis of an intermediate of a compound of Formula I An intermediate of a compound of Formula I was synthesized by reacting a compound of Formula XXII with an appropriate reagent to remove the protecting group, P, (e.g. tetra-n-butyl ammonium fluoride) in a suitable solvent (e.g. .THF). The final product is isolated by standard procedures (eg extraction).

Step - 5 - Synthesis of Compounds of Formula I A compound of Formula I was synthesized by reacting the intermediate of Step 4 with an oxidizing agent (e.g., Dess-Martin period, TEMPO) in an aprotic solvent (e.g., TFIF) typically at room temperature for 20 minutes. The product is isolated by conventional means (eg extraction and chromatography on silica gel).

Example 39. Synthesis of a compound of Formula I, wherein R⁴ and R⁵ with hydrogen [0340]

<img file="RS52010B_D0088.tif" />

Kogak 1

<img file="RS52010B_D0089.tif" />

where, R⁴and R⁵ with H

Step 1 - Preparation of a compound of Formula I in which R⁴ and R⁵ are hydrogen A compound of Formula I, wherein R⁴ and R⁵ are hydrogen, synthesized by hydrogenation of a compound of Formula I, in which R⁴ is hydrogen and R⁵ is bromo, in the presence of a suitable solvent (e.g. methanol) and catalyst (e.g. 10% Pd / C), under an atmosphere of hydrogen gas.

201

52010 Β

The reaction is typically allowed to stir at room temperature for 8-12 hours. Isolation by conventional means (e.g., extraction, washing, and filtration) affords compounds of Formula I, wherein R⁴ and R⁵ are hydrogen.

Synthesis of Formula Ia compounds:

Compounds of Formula Ia are compounds of Formula XVIII wherein R⁴ is hydrogen and R⁵ is the only substituent on the nucleus structure. Examples of synthetic schemes for groups of compounds within Formula Ia are shown in Examples 91 to 99 for different choices of R⁵.

<img file="RS52010B_D0090.tif" />

Example 40. Synthesis of compounds of Formula Ia in which R⁵ is aryl or heteroaryl [0343]

<img file="RS52010B_D0091.tif" />

Formula la gde, R⁵is an aryl or heteroaryl Compound of Formula Ia, wherein R⁵ is aryl or heteroaryl, synthesized from compound 1 under Suzuki reaction conditions using aryl or heteroaryl organobomic acids (e.g. phenyl organobomic acids) in the presence of a base (e.g. potassium carbonate) and a catalyst (e.g. Pd (PPh)₃) 4) in an aqueous / THF system with thermal heating (eg 80 ° C for 12 hours) or microwave heating (eg 120 ° C for 15 minutes). The product was isolated by conventional means (e.g. silica gel column chromatography).

Example 41. Synthesis of compounds of Formula Ia in which R⁵ is alkyl or cycloalkyl [0345]

202

52010 Β

<img file="RS52010B_D0092.tif" />

hey ^{Form, and you} wherein, R 8 is alkyl or cycloalkyl

Step-1- Synthesis of Compounds of Formula XXIII A compound of Formula XXIII, wherein P is a protecting group, is synthesized by reacting compound 1 with a base (e.g. sodium hydride) in an inert solvent (e.g. THF) followed by an appropriate reagent (R -H, e.g. "triisopropylsilyl chloride") to introduce a protecting group. The reaction was allowed to proceed, typically at room temperature, for 8-12 hours and the desired product was isolated by standard procedures (e.g. extraction) (Greene, T. W .; Wuts, PGM Protective Groups in Organic Synthesis I, 3rd ed .; John Wiley &amp; Sons: New York, 1981).

Step 2 - Synthesis of an intermediate of a compound of Formula Ia, wherein R⁵ is alkyl or cycloalkyl An intermediate of a compound of Formula Ia, wherein R⁵ is alkyl or cycloalkyl, is synthesized by reacting a compound of Formula XXIII with an alkyl or cycloalkyl Grignard reagent (e.g. ethyl magnesium bromide) in the presence of a catalyst [e.g. [1,1'-bis (diphenylphosphino) phenocene] dichloropalladium (II) in (e.g. toluene) at low temperature (e.g. 78 ° C) or under reflux for 2-8 hours The product was isolated by standard methods (e.g. extraction or silica gel column chromatography) as described in the literature. (T. Hayashi, M. Konishi, Y. Kobori, M. Kumada, T. Higuchi, K. Hirotsu; J. Am Chcm. Soc. 1984, 106, 158-163).

Step - 3 - Synthesis of compounds of Formula Ia, in which R⁵ is alkyl and cycloalkyl A compound of Formula Ia, wherein R⁵ is alkyl or cycloalkyl, is synthesized by reacting an intermediate of the compound of Formula Ia of Step 2 with an appropriate reagent to remove a protecting group (e.g. tetrabutylammonium fluoride) in a suitable solvent (e.g. tetrahydrofuran). The product was isolated by standard procedures (eg extraction and silica gel column chromatography).

203

52010Β

Example 42. Synthesis of Compounds of Formula Ia in Com⁵ is NR²²R²³10349]

<img file="RS52010B_D0093.tif" />

XXIII XXIV Formula la gde, R^s is NR ^ R²³

Step - 1 - Synthesis of an intermediate of a compound of Formula XXIV An intermediate of a compound of Formula XXIV was synthesized by reacting a compound of Formula XXIII with an amine of formula NHR²²R²³ (e.g. aniline) in a solvent (e.g. toluene), in the presence of a base (e.g. sodium / egs-butoxide) and a catalyst composed of a metal (e.g. Tris (dibenzylideneacetone) dipalladium (0)) and a ligand (e.g., three - (erc-butylphosphine) with heating, typically to 95 ° C, for 8-12 hours as described (Thomas, et. al., J. Am. Chem. Soc., 2001, 123, 9404) by substitution Compounds of Formula XXIII for N-substituted-3,6-dibromocarbazole. The desired compound was purified by silica gel column chromatography. This intermediate was used directly in Step 3 to give a compound of Formula Ia wherein R⁵ is NR²²R²³ and R²² and R²³ not -C (X) R²⁰, -C (X) NR¹⁷R¹⁸, -S (O) 2R²¹ or S (O) 2NR^,7R¹⁸ or alternatively, it may be further substituted as described in Step 2.

Step -2- Synthesis of Compounds of Formula XXIV The intermediate of Step 1 may be further modified when R or R is hydrogen. In this case, the intermediate of Step 1 can be reacted with a base (e.g., sodium hydride) in a solvent (e.g., N, N-dimethylformamide), followed by reaction with an alkylating agent (e.g., benzyl bromide) or an acylating reagent. benzoyl chloride, phenyl isocyanate, phenyl isothiocyanate, phenylsulfonyl chloride) typically at room temperature or with heating to 80'C for 1-12 hours. The desired product can be purified by conventional means (e.g., silica gel column chromatography). Alternatively, when R or R is a suitable protecting group (e.g. benzyl), it can be removed by an appropriate treatment (e.g. hydrogenation) to give a compound in which R²² and / or R²³ are hydrogen, which is suitable for

204

52010 Β further modification with an alkylating reagent or an acylating reagent as described herein.

Step -3- Synthesis of compounds of Formula Ia, wherein R⁵ is -NR²²R²³ A compound of Formula Ia, wherein R⁵ is -NR²²R²³, was synthesized by reacting a compound of Formula XXIV with an appropriate reagent to remove a protecting group (e.g., tetra-butylammonium fluoride) in an appropriate solvent (e.g., methanol). The final product can be isolated by standard procedures (eg extraction).

Example 43. Synthesis of a compound of Formula Ia in which R⁵ is C (O) NR^2SR²⁶[0353]

<img file="RS52010B_D0094.tif" />

Step 4

-------- ^2SR²⁶RNOC '' ^^i:'^x^'''^/

<img file="RS52010B_D0095.tif" />

Step 5

<td>XXVIII</td><td>The formula where, R'is CONR®⁵«²*</td>

Cortex -1- Synthesis of Compounds of Formula XXIII A compound of Formula XIII, wherein P is a protecting group, was synthesized by reacting compound 1 with a base (e.g., sodium hydride) in a solvent (e.g., THF) followed by the appropriate reagent (R -H, e.g. triisopropylsilyl chloride) to introduce a protecting group. The reaction is allowed to proceed, typically at room temperature for 8-12 hours, and the desired product is isolated by standard procedures (e.g. extraction and silica gel column chromatography) (Greene, TW; Wuts, PGM Protective Groups in Organic Synthesis 1, 3rd ed .; John Wiley &amp; Sons: New York, 1981).

205

52010Β

Step -2- Synthesis of Compounds of Formula XXVI A compound of Formula XXVI may be synthesized by reacting a compound of Formula XXIII with sodium cyanide in a polar aprotic solvent (e.g. DMF) under an inert atmosphere (e.g. argon), in the presence of a catalyst (e.g. or tris (dibenzylideneacetone (dipalladium (0)) followed by the procedure described by Buchwald et al. al., J. Am. Chem. Soc., 2003, 125, 2890-2891, by substituting 5-bromo-7-azaindole for 5-bromo-indole.

Step -3- Synlosis of Compounds of Formula XXVII A compound of Formula XXVII may be synthesized by heating a compound of Formula

XXVI with an aqueous base (e.g. aqueous K.OH solution) in the presence of alcohol (e.g. ethanol) at higher temperatures (e.g. 90 ° C) for the required time, typically 24 hours, as described in Org. Son. Collective Volume 2, 292 (1943). Alternatively, compounds of Formula

XXVII can be synthesized directly from the compound of Formula XXIII by reacting the compound of Formula XXIII with a strong base (e.g. n-butyl lithium) and benzyl chloroformate in an inert solvent (e.g. THF), and by additional debenzylation by hydrogenation of the obtained benzyl ester with hydrogen, in the presence of eg 20% ​​Pd (OH)₂/ C) at room temperature. The product can be isolated by filtration and evaporation.

Step -4 - Synthesis of Compounds of Formula XXVIII A compound of Formula XXVIII may be synthesized by reacting a compound of Formula XXVII with an amine (e.g., benzylamine) in a polar aprotic solvent (e.g., DMF) under an inert atmosphere, in the presence of an activating agent (e.g., RuVgoR). Bromotri ((pyrrolidino) phosphonium hexafluorophosphate) following the procedure described by Coste et al., J. Org. Chem., 1994, 59, 2437.

Step -5 -Synthesis of Compounds of Formula Ia A compound of Formula Ia, wherein, R⁵ is C (O) NR²⁵R²⁶, can be synthesized by excision of a protecting group (e.g., TIPS) of a compound of Formula XXVIII with appropriate reagents (e.g., TBAF) and isolation of the product (e.g., extraction and silica gel column chromatography).

206

52010 Β

Example 44. Synthesis of compounds of Formula Ia in which R⁵ is CH2NHR²⁵R²⁶[0359]

<img file="RS52010B_D0096.tif" />

P ^Kogak4 R «HN ^ XJC? -

XXX ^2!R²⁶RN

<img file="RS52010B_D0097.tif" />

Formuia fa gde.R'jeCHaNR²®^

Step -1- Synthesis of Compounds of Formula HHS A compound of Formula XXIII, wherein, P is a protecting group, was synthesized by reacting compound 1 with a base (e.g. sodium hydride) in a solvent (e.g. THF) followed by an appropriate reagent ( R-H, e.g. triisopropylsilyl chloride) to introduce a protecting group. The reaction is allowed to proceed, typically at room temperature, for 8-12 hours and the desired product is isolated by standard procedures (e.g. silica gel column extraction and chromatography) (Greene, TW; Wuts, PGM Protective Groups in Organic Synthesis I, 3rd ed .; John Wiley &amp; Sons: New York, 1981).

Step -2- Synthesis of Compounds of Formula XXVI A compound of Formula XXVI may be synthesized by reacting a compound of Formula with sodium cyanide in a polar aprotic solvent (e.g., DMF) under an inert atmosphere, in the presence of a catalyst (e.g., trylidene (dipylidene diben). or copper iodide) following the procedure described by Buchwald et. al., J Am. Chem. Soc., 2003, 125, 2890-2891, by substituting 5-bromo-7-azaindole for 5-bromo-indoI.

207

52010 Β

Step -3 - Synthesis of Compounds of Formula XXIX Compounds of Formula XXIX may be synthesized from compounds of Formula XXVI under hydrogenation conditions using a catalyst (e.g., PtO₂) in the atmosphere of H₂ as described by Secrist III et. al., J Org. Chem., 1972, 37, 335-336.

Step -4 - Synthesis of compounds of Formula XXX The compound of Formula XXX may be synthesized from the compound of Formula XXIX with an electrophilic reagent (e.g. benzyl bromide, benzenesulfonyl chloride, benzoyl chloride, phenyl isocyanate, phenyl isothiocyanate) in a polar aprotic solvent (eg DIMLY) in an inert base. K₂SO3, EtjN). The product can be isolated by standard procedures (e.g. water treatment and silica gel column chromatography).

Step -5 - Synthesis of Compounds of Formula Ia A compound of Formula Ia, wherein R⁵ is CH2NHR²⁵R²⁶, can be synthesized from a compound of Formula XXX with an electrophilic reagent (e.g. benzyl bromide, benzenesulfonyl chloride, benzoyl chloride, phenyl isocyanate, phenyl isothiocyanate) in a polar aprotic solvent (e.g. DMF) in an inert atmosphere, in the presence of a base, e.g. Et3N), followed by deprotection of the protecting group under appropriate conditions (e.g. tetra-n-butylammonium fluoride) and purification by conventional means (e.g. silica gel chromatography).

c

Example 45. Synthesis of Compounds of Formula Ia wherein R is OR [0365]

<img file="RS52010B_D0098.tif" />

Formula la where ^ jeOR²⁵

208

52010Β

25

Step Synthesis of a compound of Formula Ia, wherein R is OR A compound of Formula Ia, wherein R⁵ is OR²⁵, was synthesized by reacting compound 1 with a reagent of formula R²⁵OH (e.g. methanol) in the presence of a base (e.g. sodium methoxide) and copper (I) bromide in a solvent (e.g. N, N-dimethylformamide) typically heated to reflux for 2-8 hours as described by Mazeas, et. al. in Hcterocycles, 1999, 50: 1065. The desired intermediate is purified by conventional means (e.g., silica gel column chromatography).

Example 46. Synthesis of Compounds of Formula Ia wherein R 1 is SR *

<img file="RS52010B_D0099.tif" />

Formula la where, R® is SR²⁵ £ L £ _t A compound of Formula Ia, in which R is SR, may be prepared by reacting a compound with a strong base (e.g. potassium hydride or / -butyl lithium) and dialkyldisulfides (e.g. dimethyldisulfan) or thiophenols (e.g. 4-methoxythiophenol) in pole aprotic solvent (e.g., N, N-dimethylformamide) in an inert atmosphere following the procedure described by Yang et. al., Heterocycles, 1992, 34, 1669, by substituting 5-bromo-7-azaindole for 5-bromo-indole.

Example 47. Synthesis of compounds of Formula Ia in which R⁵ is S (O) R²⁵ or S (O)₂R²⁵

<img file="RS52010B_D0100.tif" />

Formula la gde, R^sIs SR²⁸

<img file="RS52010B_D0101.tif" />

Formula I where, R⁵yes (O) R²⁶

Formula la gde, R^sis SfOfeR²⁵ Compounds of Formula Ia, wherein R⁵ is S (O) R²⁵ or S (O)₂R²⁵ can be prepared by reacting a compound of Formula Ia, wherein R is SR, with 1 or 2 equivalents of oxidizing agent (e.g., oxone), respectively, in a polar solvent (e.g., DMF), using standard procedures.

Additional variants are within the following claims.