Pyrrolo [2,3-b]pyridine derivatives as protein kinase inhibitors

TECHNICAL MEMORY

PYRROLOf2,3-Bl PYRIDINE DERIVATIVES AS PROTEIN KINASE INHIBITORS

FIELD OF THE INVENTION

The present invention relates to kinases and kinase-modulating compounds, and uses thereof. Particular modalities contemplate disease indications which are responsive to treatment by modulation of kinase activity by the compounds of the present invention.

BACKGROUND OF THE INVENTION

The information provided herein is intended only to assist the reader's understanding. No information provided or references cited are admitted as prior art to the present invention. Each reference cited herein is incorporated in its entirety.

Receptor protein kinases regulate key signal transduction cascades that control or are involved in the control of a large number of physiological functions including cell growth and proliferation, cell differentiation, cell development, cell division, cell adhesion, stress response, guidance contact-mediated axonal short-range, regulation of transcription, aberrant mitogenesis, angiogenesis, abnormal endothelial cell-cell or cell-matrix interactions in the course of vascular development, inflammation, lymphohematopoietic stem cell activity, protective immunity against specific bacteria, allergic asthma, aberrant tissue-specific responses to activation of the JNK signal transduction pathway , cell transformation, memory, apoptosis, competitive activity-dependent synapse modification at the neuromuscular synapse, immune mediation of disease, and calcium regulation. As such, a variety of specific disease states are associated with aberrant regulation of protein kinases. Accordingly, there is a need in the art for additional compounds and methods of use thereof for the modulation of receptor protein kinases in the treatment of various diseases.

This application relates to the following published patent applications: WO 2004024895, US 20040142864, WO 2004078923, US 20050170431, WO 2005028624, US 20050164300, and WO 2005062795, each of which is hereby incorporated by reference herein in its entirety including all specifications, figures, and tables, and for all purposes.

SUMMARY OF THE INVENTION

The present invention relates to compounds active on protein kinases in general, including, but not limited to, B-Raf, c-Raf-1, Fms, Jnk1, Jnk2, Jnk3, and/or Kit, including any mutations of these. kinases, and the use thereof to treat disease and conditions associated with the regulation of kinase activity. In particular, the invention relates to compounds of Formula III as described below. Thus, the invention provides novel uses of compounds for therapeutic methods involving modulation of protein kinases, as well as novel compounds that can be used for therapeutic methods involving modulation of protein kinases.

Compounds of Formula III have the following structure:

<img file="ECSP088121A_D0001.tif" />

all salts, prodrugs, tautomers and isomers thereof, wherein:

Q has a structure selected from the group consisting of

<img file="ECSP088121A_D0002.tif" />

in which indicates the point of attachment of Q to A of Formula III;

z₂ is N or CR¹²; Z4 is N or CR¹⁴; Z5 is N or CR¹⁵; z₆ is N or CR¹⁶;

l_2 is selected from the group consisting of -(CR¹⁰R.¹¹)p-NR²⁵-(CR¹⁰R.¹¹)q-, -(CR¹⁰R.¹¹)_p-Op and q are independently 0,1 or 2 provided, however, that at least one of p and qesO;

s is 1 or 2;

X is O or S;

A is selected from the group consisting of -O-, -S-, -CR^toR.^b-, -NR¹-, -C(O)-, -C(S)-, -S(O)-, and S(O)₂-;

R.^to and R^b in each occurrence they are independently selected from the group consisting of hydrogen, fluoro, -OH, -NH2, lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino, and NR⁸R.⁹, wherein the alkyl chain(s) of loweralkyl, loweralkoxy, loweralkylthio, monoalkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, loweralkoxy, alkoxy fluorine-substituted lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon attached to O of alkoxy, S of thioalkyl, or N of mono- or di-alkylamino is fluorine; either

R.^to and R^b are combined to form 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, dialkylamino, and cycloalkylamino;

R.¹ is selected from the group consisting of hydrogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -C(O)R⁷, -C(S)R⁷, -S(O)2R⁷, -C(O)NHR⁷, -C(S)NHR⁷, and -S(O)2NHR⁷, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, NH2, lower alkoxy, lower alkylthio, monoalkylamino, di-alkylamino, and -NR⁸R.⁹, wherein the alkyl chain(s) of lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, lower alkoxy fluorine-substituted, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon attached to O of alkoxy, S of thioalkyl, or N of mono- or di-alkylamino is fluoro, further provided that, when R¹ is lower alkyl, any substitution on the lower alkyl carbon attached to the N of -NR¹- is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl, or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

R.⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, lower alkylthio , monoalkylamino, di-alkylamino, and -NR⁸R.^S, provided, however, that any substitution of the alkyl carbon attached to the N of -C(O)NHR⁷, -C(S)NHR⁷ or -S(O)2NHR⁷ is fluoro, wherein the lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino alkyl chain(s) are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon attached to O of alkoxy, S of thioalkyl or N of mono- or dialkylamino is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

R.⁴,R⁵,R⁶,R¹²,R¹⁴,R¹⁵,R¹⁶,R⁴²,R⁴³,R⁴⁵,R⁴⁶ and R⁴⁷ are independently selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -NO₂, -CR^toR.^bR.^2S, and -LR²⁶;

L in each case is selected independently from the group consisting of -(alk)_to-S-(rent)_b-, (rent)_to-OR-(rent)_b-, -(rent)_to-NR²⁵-(alk)b-, -(alk)aC(O)-(alk)b-, -(alk)aC(S)-(alk)b-, -(alk)aS(O)-(alk)b -, -(alk)aS(O)2-(alk)b-, -(alk)a-OC(O)-(alk)b-, -(alk)aC(O)O-(alk)b- , -(alk)a-OC(S)-(alk)b-, -(alk)aC(S)O-(alk)b-, (alk)aC(O)NR²⁵-(rent)b-, -(rent)_to-C(S)NR²⁵-(alk)b-, -(alk)aS(O)2NR²⁵-(rent)b-, -(rent)_to-NR²⁵C(O)-(alk)b-, -(alk)aNR²⁵C(S)-(alk)b-, -(alk)_to-NR²⁵S(O)2-(alk)b-, -(alk)a-NR²⁵C(O)O-(alk)b-, -(alk)_to-NR²⁵C(S)O-(alk)b-, -(alk)aOC(O)NR²⁵-(rent)b-, -(rent)_to-OC(S)NR²⁵-(alk)b-, -(alk)a-NR²⁵C(O)NR²⁵-(rent)b-, -(rent)_to-NR²⁵C(S)NR²⁵-(alk)b-, and -(alk)a-NR²⁵S(O)2NR²⁵-(rent)_b-;

a and b are independently 0 or 1;

alk is C^alkylene or C^alkylene substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkyl, lower alkoxy, lower alkylthio, monoalkylamino, di-alkylamino, and -NR⁸R.⁹, wherein lower alkyl or lower alkoxy, lower alkylthio, mono-alkylamino or di-alkylamino alkyl chain(s) are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution of the O-linked alkyl chain carbon of alkoxy, S for thioalkyl or N for mono- or di-alkylamino is fluorine;

R.²⁵ in each occurrence it is independently selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

R.²⁶ in each case it is independently selected from the group consisting of hydrogen, provided, however, that hydrogen does not bond to any of S(O), S(O)2, C(O) or C(S) of L, optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R^2S is optionally substituted lower alkenyl, no alkene carbons thereof attached to N, S, O, S(O), S(O)2, C(O) or C(S) of L, optionally substituted lower alkynyl, provided, however, that when R²⁶ is optionally substituted lower alkynyl, no alkene carbon thereof is attached to N, S, O, S(O), S(O)₂, C(O) or C(S) of L, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

R.¹⁰ and R¹¹ in each occurrence independently selected from the group consisting of hydrogen, fluorine, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluorine, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; or any two of R¹⁰ and R¹¹ on the same or adjacent carbon atoms combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl and any others of R¹⁰ and R¹¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, and wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

R.⁸ and R⁹ combine with the nitrogen to which they are attached to form an optionally substituted 5-7 membered heterocycloalkyl with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, and fluorine-substituted lower alkylthio;

R.¹⁷ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, and -OR¹⁸;

R.³¹ and R³³ are independently selected from the group consisting of optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, and optionally substituted heterocycloalkyl;

R.³⁶ is selected from the group consisting of substituted methyl, C alkyl₂.₆ optionally substituted, optionally substituted lower alkenyl, provided, however, that when R³⁶ is optionally substituted lower alkenyl, none of the alkene carbons attached to the S(O)₂of S(O)₂R.³⁶, optionally substituted lower alkynyl, provided, however, that when R³⁶is optionally substituted lower alkynyl, no alkyne carbon thereof is attached to the S(O)₂of S(O)₂R.³⁶, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and -NR¹⁹R.²⁰;

R.¹⁹,R²⁰,R³⁴,R³⁵,R³⁷, and R³⁸ are independently selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R¹⁹,R²⁰,R³⁴,R³⁵,R³⁷, or R³⁸ is optionally substituted lower alkenyl, no alkene carbon thereof is attached to the N of NR¹⁹R.²⁰,NR³⁴R.³⁵ or NR³⁷R.³⁸, optionally substituted lower alkenyl, provided, however, that when R¹⁹,R²⁰,R³⁴,R³⁵,R³⁷, or R³⁸ is optionally substituted lower alkynyl, no alkyne carbon thereof is attached to the N of NR¹⁹R.²⁰,NR³⁴R.³⁵ or NR³⁷R.³⁸, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl; either

R.³⁴ and R³⁵ together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl; either

R.³⁷ and R³⁸ together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl;

R.³² is selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and -OR¹⁸;

R.⁸² is selected from hydrogen or lower alkyl; and

R.¹⁸ is hydrogen or optionally substituted lower alkyl;

provided, however, that the compound is not 3-{3-[2-(tetrahydropyran-2-¡lox¡)-ethox¡]0θηθίΙ)-^-1'^Λ^^οη-^-'Ι-1 ll-nirrnlnr9 n.hlnirirlina rarartori^arln nnmiia the aatriirtiirg

<img file="ECSP088121A_D0003.tif" />

4-(4-Methyl-piperazin-1 -ylmethyl)-N-[4-(1 Hp¡rrolo[2,3-b]p¡r¡d¡n-3-¡lmethyl)-fen¡l ]-benzamide, characterized in that the structure

<img file="ECSP088121A_D0004.tif" />

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula Illa:

<img file="ECSP088121A_D0005.tif" />

all salts, prodrugs, tautomers and isomers thereof, where A, L₂,Z₂,Z₆,R⁴,R⁵,R⁶,R¹⁵,R¹⁶ and R³¹ are as defined by Formula III.

In some modalities of the compounds of the purple Formula, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluorine, -OH, -NH2, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine, and R¹⁶ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some embodiments of the compounds of Formula Illa, R and R are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluorine, -OH, -NH2, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine, R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy, Z2 is N or CR¹², Z6 is N or CR^1D,R¹² and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R.²², where R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl, or optionally substituted heteroaryl, and where the alkyl chain of R⁵,R²¹ or R²², when lower alkyl, or the alkyl chain of the lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, OH, -NH₂, lower alkoxy, fluorine substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula IIIb:

<img file="ECSP088121A_D0006.tif" />

Formula IHb all salts, prodrugs, tautomers and isomers thereof, where:

A is -O-, -CR⁴⁰R.⁴¹-, -C(O)- or -NR⁴⁸-;

z₁₂ is N or CR⁵²;

z₁₆ is N or CR⁵⁶;

R.⁴⁰ and R⁴¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; either

R.⁴⁰ and R⁴¹ are combined to form 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

l_3 is selected from the group consisting of NR⁴⁸-, -S-, -O-, -NR⁴⁸CH(R)⁴⁹)-, -SCH9-(R⁴⁹)-, OCH(R⁴⁹)-, -C(O)NR⁴⁸-, -S(O)2NR⁴⁸-, -CH(R⁴⁹)NR⁴⁸-, -CH(R⁴⁹)O-, -CH(R⁴⁹)S-, -NR⁴⁸C(O)-, and -NR⁴⁸S(O)2-;

r53 and p55_{I know}|_ecc¡_onan regardless of the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with fluorine, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino or cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- lower alkoxy is fluorine;

R.⁵² and R⁵⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy;

R.⁴⁹ is selected from the group consisting of hydrogen, lower alkyl, and fluorine-substituted lower alkyl;

Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl;

R.³⁹ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, aryl, heteroaryl, and NR⁵⁰R.⁵¹, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and wherein aryl and heteroaryl are optionally substituted with one or more R substituents²³ independent;

R.⁵⁰ is hydrogen or lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino;

R.⁵¹ is aryl or heteroaryl, where aryl and heteroaryl are optionally substituted with one or more R substituents²³ independent;

R.²³ in each case it is independently selected from the group consisting of -OH, -NH2, -CN, NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR⁵⁷, -MR⁵⁷, -NR⁴⁸R.⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)2R⁵⁷, -S(O)2R⁵⁷, C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, -S(O)2NR⁴⁸R.⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluoro, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R²³, or as lower alkyl substituents, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C (O)NH2, -OR⁵⁸, MR⁵⁸, -NR⁴⁸R.⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, S(O)2NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁵⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁷, -MR⁵⁷, -NR⁴⁸R.⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, or S(O)2NR⁴⁸R.⁵⁷ is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl where cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵⁷ or as lower alkyl substituents are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH_2i -OR⁵⁸, -MR⁵⁸, -NR⁴⁸R.⁶⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.^5S, -S(O)₂NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁵⁸ in each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁸, -MR⁵⁸ -NR⁴⁸R.⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, either

-SW)₂NR⁴⁸R.⁵⁸ it is fluorine;

R.⁴⁸ in each case it is independently hydrogen or lower alkyl; and t is 0,1,2 or 3.

In some embodiments of the compounds of Formula IIIb, At is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-. In some embodiments, A! is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-„ more preferably -CH₂-, and R⁵³ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy. In some modalities, L3 is NR^CHjR⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-. In some embodiments, Ai is CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH₂-, and L₃ is -NR⁴⁸CH(R)⁴⁹)-, SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula IIIp:

<img file="ECSP088121A_D0007.tif" />

all salts, prodrugs, tautomers and isomers thereof, wherein:

TO! is -O-, -CR⁴⁰R.⁴¹-,-C(O)-o-NR⁴⁸-;

z₂₂ is Ν or CR⁶²;

z₂₆ is N or CR⁶⁶;

r is 0,1 or 2;

R.⁴⁰ and R⁴¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; either

R.⁴⁰ and R⁴¹ are combined to form 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

R.⁶²,R⁶³,R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- lower alkoxy is fluorine;

Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl;

R.³⁹ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, aryl, heteroaryl, and NR⁵⁰R.⁵¹, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and wherein aryl and heteroaryl are optionally substituted with one or more R substituents²³ independent;

R.⁵⁰ is hydrogen or lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino;

R.⁶¹ is aryl or heteroaryl, where aryl and heteroaryl are optionally substituted with one or more R substituents²³ independent;

R.²³ in each case it is independently selected from the group consisting of -OH, -NH2, -CN, NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR⁵⁷, -MR⁶¹, -NR⁴⁸R.⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)2R⁵⁷, -S(O)2R⁵⁷, C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, -S(O)2NR⁴⁸R.⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluoro, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R²³, or as lower alkyl substituents, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C (O)NH2, -OR⁵⁸, MR⁵⁸, -NR⁴⁸R.⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, S(O)2NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁵⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁷, -MR⁵⁷, -NR⁴⁸R.⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, or -S(O)2NR⁴⁸R.⁵⁷ is fluoro, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, where cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵⁷ or as lower alkyl substituents are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -MR⁵⁸, -NR⁴⁸R.⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.^ffi, -S(O)₂NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁵⁸ in each occurrence it is independently selected from the group consisting of lower alkyl, heterocycloalkyl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁸, -MR⁵⁸, -NR⁴⁸R.^5S. -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, either

-SW)₂NR⁴⁸R.⁵⁸ it is fluorine;

R.⁴⁸ in each case it is independently hydrogen or lower alkyl; and t is 0,1,2, or 3.

In some embodiments of the compounds of Formula IIIp, Ai is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-. In some embodiments, Ai is -CR⁴⁰R.⁴¹- or -C(O)-, preferably CH2- or -C(O)-, and R⁶²,R⁶⁴,R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula III:

<img file="ECSP088121A_D0008.tif" />

all salts, prodrugs, tautomers and isomers thereof, where A, s, Z₂,Z₅,R⁴,R⁵,R⁶,R¹⁵,R¹⁷, and R³² are as defined by Formula III.

In some modalities of the compounds of the Formula lile, R⁴ and R^yes are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluorine, -OH, -NH2, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine, and R¹⁶ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some modalities of the compounds of the Formula lile, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, R¹⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluorine, -OH, -NH2, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine, R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine substituted lower alkyl, lower alkoxy, and fluorine substituted lower alkoxy, Z2 is N or CR¹², Z6 is N or CR¹⁸,R¹² and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R.²², where R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl, or optionally substituted heteroaryl, and where the alkyl chain of R⁵,R²¹ or R²², when lower alkyl, or the alkyl chain of the lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, furthermore wherein R³² lower alkyl or -OR is optionally substituted¹⁸, where R¹⁸ is as defined by Formula III.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula IIIn:

<img file="ECSP088121A_D0009.tif" />

all salts, prodrugs, tautomers and isomers thereof, where A, s, Z₂,Z₃,R⁴,R^yes,

R.⁶,R¹⁵, and R³² are as defined by Formula III.

In some embodiments of the compounds of Formula Illn, R⁴ and R^B. are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -CH₂-, and R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some modalities of the compounds of the Formula lile, R⁴ and R^B. are hydrogen, A is -0-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, R¹⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine substituted lower alkyl, lower alkoxy, and fluorine substituted lower alkoxy, Z2 is N or CR¹², Z6 is N or CR¹⁶,R¹² and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl -NR²¹R.²², where R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl, or optionally substituted heteroaryl, and where the alkyl chain of R⁵,R²¹or R²², when lower alkyl, or the alkyl chain of the lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, furthermore wherein R³² lower alkyl or -OR is optionally substituted¹⁸, where R¹⁸is as defined by Formula III.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula Ilio:

<img file="ECSP088121A_D0010.tif" />

Formula Πο all salts, prodrugs, tautomers and isomers thereof, where A, L₂,Z₂,Z₄,Z₅,Z₅,R⁴,R^and,R⁶, and R³³ are as defined by Formula III.

In some embodiments of the compounds of Formula Ilio, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR¹², Z4 is N or CR¹⁴, Z5 is N or CR¹⁵, Z6 is N or CR¹⁶, and R¹²,R¹⁴,R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine.

In some embodiments of the compounds of Formula Ilio, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR¹², Z4 is N or CR¹⁴, Z5 is N or CR¹⁵, Z6 is N or CR¹⁶,R¹²,R¹⁴,R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2 , lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided that, however, any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R.²², where R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl, or optionally substituted heteroaryl, and where the alkyl chain of R⁵,R²¹ or R²², when lower alkyl, or the alkyl chain of the lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluorine, mono-alkylamino, di-alkylamino and cycloalkylamino.

In some modalities of the compounds of Formula III, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR¹², Z4 is N or CR¹⁴, Z5 is N or CR¹⁵, Z6 is N or CR¹⁶,R¹²,R¹⁴,R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R.²², where R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl, or optionally substituted heteroaryl, and where the alkyl chain of R⁵,R²¹ or R²², when lower alkyl, or the alkyl chain of the lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.

In some embodiments, compounds of Formula IIIq have the structure according to the following subgeneric structure of Formula IIIq:

<img file="ECSP088121A_D0011.tif" />

all salts, prodrugs, tautomers and isomers thereof, wherein:

A, is -O-, -CR⁴⁰R.⁴¹-, -C(O)- or NR⁴⁸;

z₁₂ is N or CR⁵²;

z₁₄ is N or CR⁵⁴;

z₁₅ is N or CR⁵⁵;

z₁₆ is N or CR⁵⁶;

R.⁴⁰ and R⁴¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; either

R.⁴⁰ and R⁴¹ are combined to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, dialkylamino, and cycloalkylamino;

L₃ is selected from the group consisting of -NR⁴⁸-, -S-, -O-, -NR⁴⁸CH(R)⁴⁹)-, -SCH(R⁴⁹)-, -OCH(R⁴⁹)-, -C(O)NR⁴⁸-, -S(O)2NR⁴⁸-, -CH(R⁴⁹)NR⁴⁸-, -CH(R⁴⁹)O-, -CH(R⁴⁹)S-, -NR⁴⁸C(O)-, and -NR⁴⁸S(O)2-;

R.⁵⁴ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with fluorine, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino or cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- lower alkoxy is fluorine;

R.⁵² and R⁵⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy;

R.⁴⁹ is selected from the group consisting of hydrogen, lower alkyl, and fluorine-substituted lower alkyl;

Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl;

R.³⁹ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, aryl, heteroaryl, and NR⁵⁰R.⁵¹, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and wherein aryl and heteroaryl are optionally substituted with one or more R substituents²³ independent;

R.⁵⁰ is hydrogen or lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino;

R.⁶¹ is aryl or heteroaryl, where aryl and heteroaryl are optionally substituted with one or more R substituents²³ independent;

R.²³ in each case it is independently selected from the group consisting of -OH, -NH2, -CN, NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR⁵⁷, -MR⁵⁷, -NR⁴⁸R.⁶⁷,NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)2R⁵⁷, -S(O)2R⁵⁷, -C(O)RS7, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, -S(O)2NR⁴⁸R.⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluoro, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R²³, or as lower alkyl substituents, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C (O)NH2, -OR⁵⁸, MR⁵⁸, -NR⁴⁸R.⁵⁸,NR⁴⁸C(O)R⁵⁸,NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, S(O)2NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁵⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁷, -MR⁵⁷, -NR⁴⁸R.⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, or -S(O)2NR⁴⁸R.⁵⁷ is fluoro, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, where cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵⁷ or as lower alkyl substituents are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH_2i -OR⁵⁸, -MR⁵⁸, -NR⁴⁸R.⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.^C8, -S(O)₂NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁵⁸ in each occurrence it is independently selected from the group consisting of lower alkyl, heterocycloalkyl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁸, -MR⁵⁸, -NR^R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, either

-SW)₂NR⁴⁸R.⁵⁸ it is fluorine;

R.⁴³ in each case it is independently hydrogen or lower alkyl; and you have 0,1,2, or 3.

In some embodiments of the compounds of Formula IIIq, Ai is -CR⁴⁶R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-. In some embodiments, Ai is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH₂-, and R⁵⁴ and R⁵⁵ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy. In some modalities, L3 is NR⁴³CH(R)⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably -OCH(R⁴⁹)-. In some embodiments, Ai is CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH₂-, and L₃ is -NR⁴⁸CH(R)⁴⁹)-, SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably

-OCH(R)⁴⁹)-.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula III:

<img file="ECSP088121A_D0012.tif" />

all salts, prodrugs, tautomers and isomers thereof, where A, Z₂,Z₄,Z₅,Z_yes,R⁴,R⁵,R⁶,R¹⁰,R¹¹ and R³³ are as defined by Formula III, and r is 0, 1 or 2.

In some embodiments of the compounds of Formula IIId, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR¹², Z4 is N or CR¹⁴, Z5 is N or CR¹⁵, ZB is N or CR¹⁶, and R¹²,R¹⁴,R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine.

In some embodiments of the compounds of Formula IIId, R⁴ and R⁶ are hydrogen, A is -0-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR¹², Z4 is N or CR¹⁴, Z5 is N or CR¹⁵, Z6 is N or CR¹⁶,R¹²,R¹⁴,R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2 , lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided that, however, any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine, R¹⁰ and R¹¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and fluoro-substituted lower alkyl, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R.²², where R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and where the alkyl chain of R⁵,R²¹or R²², when lower alkyl, or the alkyl chain of the lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluorine, mono-alkylamino, di-alkylamino and cycloalkylamino.

In some embodiments of the compounds of Formula Ilid, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR¹², Z4 is N or CR¹⁴, Z5 is N or CR¹⁵, Z6 is N or CR¹⁶,R¹²,R¹⁴,R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy, R¹⁰ and R¹¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and fluoro-substituted lower alkyl, and R⁵ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R.²², where R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl, or optionally substituted heteroaryl, and where the alkyl chain of R⁵,R²¹ or R²², when lower alkyl, or the alkyl chain of the lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula III:

.Cy—(R²³)t

Formula lile all salts, prodrugs, tautomers and isomers thereof, where:

At is -O-, -CR⁴⁰R.⁴¹-, -C(O)- or NR⁴⁸-;

z₂₂ is N or CR⁶²;

z₂₄ is N or CR⁶⁴;

z₂₆ is N or CR⁶⁵;

z₂₆ is N or CR⁶⁶;

r is 0,1 or 2;

R.⁴⁰ and R⁴¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; either

R.⁴⁰ and R⁴¹ are combined to form 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

R.⁶²,R⁶⁴,R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- lower alkoxy is fluorine;

Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl;

R.³⁹ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, aryl, heteroaryl, and NR^S0R.⁵¹, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and wherein aryl and heteroaryl are optionally substituted with one or more R substituents²³ independent;

R.⁵⁰ is hydrogen or lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino;

R.⁵¹ is aryl or heteroaryl, where aryl and heteroaryl are optionally substituted with one or more R substituents²³ independent;

R.²³ in each case it is independently selected from the group consisting of -OH, -NH2, -CN, NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR⁵⁷, -MR¹¹, -NR⁴⁸R.⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)2R⁵⁷, -S(O)2R⁵⁷, C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, -S(O)2NR⁴⁸R.⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluoro, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R²³, or as lower alkyl substituents, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, MR⁵⁸, -NR⁴⁸R.⁵⁸,

-NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, -S(O)₂NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁵⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁷, -MR⁵⁷, -NR⁴⁸RS7, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, or -S(O)2NR⁴⁸R.⁵⁷ is fluoro, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, where cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵⁷ or as lower alkyl substituents are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -MR⁵⁸, -NR⁴⁸R.⁵⁸, -NR⁴⁸C(O)R⁵⁸,NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, -S(O)₂NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁵⁸ in each occurrence it is independently selected from the group consisting of lower alkyl, heterocycloalkyl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁸, -MR⁵⁸, -NR^R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, either

-SW)₂NR⁴⁸R.⁵⁸ it is fluorine;

R.⁴⁸ in each case it is independently hydrogen or lower alkyl; and tesO, 1,2, or 3.

In some embodiments of the compounds of Formula lile, At is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-. In some embodiments, At is -CR⁴⁰R.⁴¹_ or -C(O)-, preferably CH2- or -C(O)-, and R⁶²,R⁶⁴,R⁶⁵ and R⁶⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula III:

<img file="ECSP088121A_D0013.tif" />

Formula ülf all salts, prodrugs, tautomers and isomers thereof, where A, Z₂,Z₄,Z₅,Z₆,X,R⁴,R⁵,R⁶,R³⁴,R³⁵ and R⁸² are as defined for Formula lll.

In some embodiments of the compounds of Formula III, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR¹², Z4 is N or CR¹⁴, Z5 is N or CR¹⁵, Z6 is N or CR¹⁶, and R¹²,R¹⁴,R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine.

In some embodiments of the compounds of Formula III, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR¹², Z4 is N or CR¹⁴, Z5 is N or CR¹⁵, Z6 is N or CR¹⁶,R¹²,R¹⁴,R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine, and one of R³⁴ and R³⁵ is selected from the group consisting of optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl, and the other from R³⁴ and R³⁵ is hydrogen or lower alkyl, or R³⁴ and R³⁵ together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl.

In some embodiments, compounds of Formula III have the structure according to the following sub-generic structure of Formula III:

<img file="ECSP088121A_D0014.tif" />

all salts, prodrugs, tautomers and isomers thereof, wherein:

TO! is -O-, -CR⁴⁰R.⁴¹-, -C(O)- or NR⁴⁸-;

z₃₂ is N or CR⁷²;

z₃₄ is N or CR⁷⁴;

z₃₆ is N or CR⁷⁵;

z₃₆ is N or CR⁷⁶;

X is O or S;

R.⁴⁸ in each case it is independently hydrogen or lower alkyl;

R.⁴⁰ and R⁴¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; either

R.⁴⁰ and R⁴¹ are combined to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, dialkylamino, and cycloalkylamino;

R.⁷²,R⁷⁴,R⁷⁵ and R⁷⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl and lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- lower alkoxy is fluorine;

R.⁶⁷ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -C(S)NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -OR⁶⁸, -MR⁶⁸, -NR⁶⁹R.⁶⁸, -C(O)R^S8, -C(S)R⁶⁸, -C(O)OR^&amp;3, -C(O)NR⁶⁹R.⁸⁸, -C(S)NR⁶⁹R.⁶⁸,

-SW)₂NR⁶⁹R.⁶⁸,NR^S9C(O)R⁶⁸, -NR⁶⁹C(S)R⁶⁸, -NR⁶⁹S(O)2R⁶⁸, -NR⁶⁹C(O)NH2,

-NR⁶⁹C(O)NR^S9R.⁶⁸, -NR⁶⁹C(S)NH2, -NR⁶⁹C(S)NR⁶⁹R.⁶⁸,NR⁶⁹S(O)2NH₂, -NR⁶⁹SW)₂NR⁶⁹R.^S8,

-S(O)R³⁸, And so)₂R.⁶⁸;

one of R⁶⁰ and R⁶¹ is lower alkyl, fluorine substituted lower alkyl, or -(CH₂)₀.₂R.⁷⁰, and the other of R⁶⁰ and R⁶¹ is hydrogen or lower alkyl;

or R⁸⁰ and R⁸¹ together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl;

R.⁶⁸ is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R⁶⁸ is optionally substituted lower alkenyl, no alkene carbon thereof is attached to N, S, O, S(O), S(O)₂, C(O) or C(S) of -OR⁶⁸, -MR⁶⁸, -NR⁶⁹R.⁶⁸, -C(O)R⁶⁸, -C(S)R³⁸, -C(O)OR³⁸,

-C(O)NR⁶⁹R.⁶⁸, -C(S)NR⁶⁹R.⁶⁸, -S(O)2NR⁶⁹R.⁶⁸, -NR⁶⁹C(O)R⁶⁸, -NR⁶⁹C(S)R⁶⁸, -NR⁶⁹S(O)2R⁶⁸,

-NR⁶⁹C(O)NH2, -NR⁶⁹C(O)NR^H.HR.⁶⁸, -NR⁶⁹C(S)NH2, -NR⁶⁹C(S)NR⁶⁹R.⁶⁸, -NR⁶⁹SW)₂NH₂,

-NR⁶⁹S(O)2NR⁶⁹R.⁶⁸, -S(O)R⁶⁸, or -S(O)2R⁶⁸, optionally substituted lower alkynyl, provided, however, that when R⁶⁸ is optionally substituted lower alkynyl, no alkyne carbon thereof is attached to the N, S, O, S(O), S(O)2, C(O) or C(S) of -OR⁵⁸, -MR⁶⁸, -NR⁶⁹R.⁶⁸, -C(O)R⁶⁸, -C(S)R⁶⁸, -C(O)OR⁶⁸, -C(O)NR⁵⁹R.⁶⁸, -C(S)NR⁶⁹R.⁶⁸, -S(O)2NR⁵⁹R.⁶⁸,NR⁶⁹C(O)R⁶⁸,NR⁶⁹C(S)R⁶⁸, -NR⁶⁹S(O)2R⁶⁸, -NR⁶⁹C(O)NH2j -NR⁶⁹C(O)NR⁵⁹R.⁶⁸, -NR⁶⁹C(S)NH₂,

-NR⁶⁹C(S)NR⁶⁹R.⁶⁸, -NR⁵⁹S(O)2NH2, -NR⁵⁹S(O)2NR⁶⁹R.⁶⁸, -S(O)R⁶⁸, bear)₂R.⁶⁸, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

R.⁶⁹ is hydrogen or optionally substituted lower alkyl;

R.⁷⁰ is selected from the group consisting of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl; and

R.⁸² is hydrogen or lower alkyl.

In some embodiments of the compounds of Formula IIIg, Ai is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-.

In some embodiments of the compounds of Formula IIIg, Ai is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-, and R⁶⁷ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -S(O) 2NH₂, C(O)NH₂, -OR⁶⁸, -MR⁶⁸, -NR⁶⁹R.⁶⁸, -C(O)R⁶⁸, -C(S)R⁶⁸, -C(O)NR⁶⁹R.⁶⁸, -S(O)2NR⁶⁹R.⁶⁸,NR⁶⁹C(O)R⁶⁸,NR⁶⁹S(O)2R⁶⁸, -S(O)R⁶⁸, And so)₂R.⁶⁸.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula Illh:

<img file="ECSP088121A_D0015.tif" />

all salts, prodrugs, tautomers and isomers thereof, where A, X, R⁴,R⁵,R⁶,R³⁷,R³⁸,R⁴²,R⁴³,R⁴⁵,R⁴⁶, and R⁴⁷ are as defined by Formula III.

In some embodiments of the compounds of Formula Illh, R⁴ and R⁶ are hydrogen, A is -0-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, and R⁴²,R⁴³,R⁴⁵,R⁴⁶ and R⁴⁷ are independently selected from the group consisting of hydrogen, halogen, -OH, -CN, -NO2, -NH₂, lower alkyl, fluoro-substituted lower alkyl, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkyl, mono-alkylamino, di-alkylamino, and cycloalkylamino, further wherein at least one of, at least least two of, at least three of, at least four of, or preferably all of R⁴²,R⁴³,R⁴⁶,R^4B and R⁴⁷ they are hydrogen.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula III:

<img file="ECSP088121A_D0016.tif" />

all salts, prodrugs, tautomers and isomers thereof, wherein:

TO₁ is -O-, -CR⁴⁰R.⁴¹_, -C(O)- or -NR⁴⁸-;

X is O or S;

R.⁴⁸ in each case it is independently hydrogen or lower alkyl;

R.⁴⁰ and R⁴¹ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; either

R.⁴⁰ and R⁴¹ are combined to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, dialkylamino, and cycloalkylamino;

R.⁶⁷ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -NH2, -CN , -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2i -C(S)NH2j -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2 , -OR⁶⁸, MR⁶⁸, -NR⁶⁹R.⁶⁸, -CjOjR⁶⁸, -C(S)R⁶⁸, -C(O)OR⁶⁸, -C(O)NR⁶⁹R.⁶⁸, -CjSjNR^R⁶⁸, -S(O)2NR⁶⁹R.⁶⁸, -NR⁶⁹C(O)R⁶⁸, -NR⁶⁹C(S)R⁶⁸, -NR^B9S(O)2R⁶⁸, -NR^B9C(O)NH2, -NR^B9C(O)NR⁶⁹R.⁶⁸, -NR^B9C(S)NH2, -NR⁶⁹C(S)NR⁶⁹R.⁶⁸, -NR69S(O)2NH₂,NR^B9S(O)2NR^B9R.⁶⁸, -S(O)R⁶⁸, and -S(O)2R⁶⁸;

one of R⁶⁰ and R⁶¹ is lower alkyl, fluorine substituted lower alkyl, or -(CH₂)o.2R⁷⁰ and the other of

R.⁶⁰ and R⁶¹ is hydrogen or lower alkyl;

or R³⁰ and R⁶¹ together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl;

R.⁶⁸ is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R⁶⁸ is optionally substituted lower alkenyl, no alkene carbon thereof is attached to N, S, O, S(O), S(O)₂, C(O) or C(S) of -OR⁶⁸, -MR⁸⁸, -NR³⁹R.⁶⁸, -C(O)R⁶⁸, -C(S)R⁶⁸, -C(O)OR⁶⁸,

-C(O)NR⁶⁹R.⁸⁸, -C(S)NR⁶⁹R.⁶⁸, -S(O)2NR⁶⁹R.^B8, -NR⁶⁹C(O)R⁶⁸, -NR⁶⁹C(S)R⁶⁸, -NR⁶⁹S(O)2R^B8,

-NR⁶⁹C(O)NH2, -NR⁶⁹C(O)NR⁸⁹R.⁶⁸, -NR⁶⁹C(S)NH2, -NR⁶⁹C(S)NR⁶⁹R.⁶⁸, -NR⁶⁹SW)₂NH₂,

-NR⁶⁹S(O)2NR⁶⁹R.⁶⁸, -S(O)R^o8, or -S(O)2R^d8, optionally substituted lower alkynyl, provided, however, that when R⁶⁸ is optionally substituted lower alkynyl, no alkyne carbon thereof is attached to the N, S, O, S(O), S(O)2, C(O) or C(S) of -OR⁸⁸, -MR⁸⁸, -NR⁶⁹R.⁸⁸, -C(O)R⁶⁸, -C(S)R⁶⁸, -C(O)OR⁶⁸, -C(O)NR⁸⁹R.⁶⁸, -C(S)NR⁶⁹R.⁶⁸, -S(O)2NR⁶⁹R.⁸⁸,

-NR⁶⁹C(O)R⁶⁸, -NR⁶⁹C(S)R⁶⁸, -NR⁶⁹S(O)2R⁶⁸, -NR³⁹C(O)NH2, NR⁶⁹C(O)NR⁶⁹R.⁶⁸, -NR⁶⁹C(S)NH2, -NR⁶⁹C(S)NR⁶⁹R.⁶⁸, -NR³⁹S(O)2NH₂, -NR³⁹S(O)2NR³⁹R.³⁸, -YesOjR³⁸, or -S(O)2R³⁸, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

R.⁶⁹ is hydrogen or optionally substituted lower alkyl; and

R.⁷⁰ is selected from the group consisting of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl.

In some embodiments of the compounds of Formula lili, At is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-.

In some embodiments of the compounds of Formula lili, Ai is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, and R⁶⁷ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -S(O)₂NH₂, C(O)NH₂, -OR⁶S, -SR⁶⁸, -NR⁶⁹R.⁶⁸, -C(O)R⁶⁸, -C(S)R⁶⁸, -C(O)NR⁶⁹R.⁶⁸, -S(O)₂NR⁶⁹R.⁶⁸,

-NR⁶⁹C(O)R⁶⁸, -NR⁶⁹S(O)2R⁶⁸, -S(O)R⁶⁸, and -S(O)2R⁶⁸

In some embodiments of the compounds of Formula lili, Ai is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -C(O)-, R⁶⁷ is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR²¹R.²², where R²¹ is hydrogen or lower alkyl, and R²² is hydrogen, lower alkyl, optionally substituted aryl, or optionally substituted heteroaryl, and where the alkyl chain of R⁶⁷,R²¹ or R²², when lower alkyl, or the alkyl chain of the lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluoro, mono-alkylamino, di-alkylamino and cycloalkylamino, and one of R⁶⁰ and R⁶¹ is lower alkyl or fluorine-substituted lower alkyl, and the other from R⁶⁰ and R⁶¹ is hydrogen or lower alkyl. In some embodiments, Ai is C(O)-, R⁶⁷ optionally substituted aryl or optionally substituted heteroaryl, and one of R⁶⁰ and R⁶¹ is lower alkyl or fluorine-substituted lower alkyl, and the other from R⁶⁰ and R⁶¹ is hydrogen or lower alkyl.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula lllj:

<img file="ECSP088121A_D0017.tif" />

all salts, prodrugs, tautomers and isomers thereof, where A, R⁴,R⁵,R⁶,R¹², ru,_rw_R.16, and_R.36 _{they are like} define p_gold |_to Formula III.

In some embodiments of the compounds of Formula lllj, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH₂- or -C(O)-, and R¹²,R¹⁴,R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine, preferably where R¹⁴ and R¹⁵ are hydrogen, more preferably where R¹² is fluorine, R^1S is hydrogen, fluorine, or chlorine, and R¹⁴ and R¹⁵ they are hydrogen.

In some embodiments of the compounds of Formula lllj, R⁴ and R⁶ are hydrogen, A is -O-, CR^toR.^b-, -NR¹-, or -C(O)-, preferably -CH2- or -C(O)-, R¹²,R¹⁴,R¹⁵ and R¹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, and lower alkoxy, wherein the alkyl chain of the lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2 , lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided that, however, any substitution on the alkyl carbon attached to the -O- of lower alkoxy is fluorine, preferably where R¹⁴ and R¹⁵ are hydrogen, more preferably where R¹² is fluorine, R¹⁶ is hydrogen, fluorine, or chlorine, and R¹⁴ and R¹⁵ are hydrogen, and R³⁶ is selected from the group consisting of C alkyl₂.₆ optionally substituted, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and -NR¹⁹R.²⁰, where R¹⁹ and R²⁰ are as defined by Formula III, furthermore where one of R¹⁹ and R²⁰ is hydrogen or optionally substituted lower alkyl, and the other from R¹⁹ and R²⁰ is selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl.

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula IIIlk:

RT

lllk formula

<img file="ECSP088121A_D0018.tif" />

<img file="ECSP088121A_D0019.tif" />

all salts, prodrugs, tautomers and isomers thereof, wherein:

TO! is -O-, -CR⁴⁰R.⁴¹-, -C(O)- or -NR⁴⁸-;

R.⁸¹ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -NH2, -CN , NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, C(S)NH2, -NHC(0)NH2, -NHC(S)NH2, -NHS(O)2NH2 , -OR⁶⁸, -MR⁶⁸, -NR⁶⁹R.⁶⁸, -C(O)R⁶⁸, -C(S)R⁶⁸, C(O)OR⁶⁸, -C(O)NR⁶⁹R.⁶⁸, -C(S)NR⁶⁹R.⁶⁸, -S(O)2NR⁶⁹R.⁶⁸, -NR⁶⁹C(O)R⁶⁸, -NR^B9C(S)R⁶⁸, -NR⁶⁹S(O)2R⁶⁸,NR⁶⁹C(O)NH2, -NR⁸⁹C(O)NR⁶⁹R.⁶⁸, -NR⁶⁹C(S)NH2, -NR⁶⁹C(S)NR⁶⁹R.⁶⁸, -NR⁶⁹S(O)2NH_2j NR⁶⁹S(O)2NR⁶⁹R.⁶⁸, -S(O)R⁶⁸, and -S(O)2R⁶⁸;

R.⁷¹ and R⁷⁸ are independently selected from the group consisting of hydrogen, halogen, C^ alkyl, and Ο alkyl_ν3 fluorine substituted;

R.⁷⁷ is selected from the group consisting of substituted methyl, C alkyl₂.₅ optionally substituted aryl, optionally substituted heteroaryl, and -NR⁷⁹R.⁸⁰, wherein methyl is substituted with one or more substituents selected from the group consisting of optionally substituted aryl and optionally substituted heteroaryl;

R.⁶⁸ is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R⁶⁸ is optionally substituted lower alkenyl, no alkene carbon thereof is attached to N, S, O, S(O), S(O)₂, C(O) or C(S) of -OR⁶⁸, -MR⁶⁸, -NR⁵⁹R.⁶⁸, -C(O)R⁶⁸, -C(S)R⁶⁸, -C(O)OR⁶⁸,

-C(O)NR⁶⁹R.⁶⁸, -C(S)NR⁶⁹R.⁶⁸, -S(O)2NR⁶⁹R.⁸⁸, -NR⁶⁹C(O)R⁶⁸, -NR⁶⁹C(S)R⁶⁸, -NR⁶⁹S(O)2R⁸⁸,

-NR⁶⁹C(O)NH2, -NR⁶⁹C(O)NR⁶⁹R.⁶⁸, -NR⁶⁹C(S)NH2, NR⁶⁹C(S)NR⁶⁹R.⁶⁸, -NR⁶⁹SW)₂NH₂,

-NR⁶⁹S(O)2NR⁶⁹R.⁶⁸, -S(O)R°⁸, or -S(O)2R^o8, optionally substituted lower alkynyl, provided, however, that when R⁶⁸ is optionally substituted lower alkynyl, no alkyne carbon thereof is attached to the N, S, O, S(O), S(O)2, C(O) or C(S) of -OR⁶⁸ -MR⁶⁸, -NR⁶⁹R.⁶⁸, -C(O)R⁶⁸, -C(S)R⁶⁸, -C(O)OR⁶⁸, -C(O)NR^S9R.⁶⁸, -C(S)NR⁶⁹R.⁶⁸, -S(O)2NR⁶⁹R.⁶⁸,

-NR⁶⁹C(O)R⁶⁸, -NR⁶⁹C(S)R⁶⁸, -NR⁶⁹S(O)2R⁶⁸, -NR⁶⁹C(O)NH2, -NR^S9C(O)NR⁶⁹R.⁶⁸, -NR⁶⁹C(S)NH2, -NR⁶⁹C(S)NR⁶⁹R.⁶⁸, -NR⁶⁹S(O)2NH₂,NR⁶⁹S(O)2NR⁶⁹R.⁶⁸, -S(O)R⁶⁸, or -S(O)2R⁶⁸, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

R.⁶⁹ is hydrogen or optionally substituted lower alkyl; and

R.⁷⁹ and R⁸⁰ are independently hydrogen or optionally substituted lower alkyl, or R⁷⁹ and R⁶⁰ combine with the nitrogen to which they are attached to form optionally substituted 5-7 membered heterocycloalkyl.

In some embodiments of the compounds of Formula lllk, A! is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH₂- or -C(O)-, more preferably -C(O)-.

In some embodiments of the compounds of Formula IIIlk, At is -CR⁴⁰R.⁴¹- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -C(O)-, and R⁸¹ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -S(O) 2NH₂, -C(O)NH₂, -OR⁶⁸, -MR⁶⁸, -NR⁶⁹R.⁶⁸, -C(O)R⁶⁸, -C(S)R⁶⁸, -C(O)NR⁶⁹R.⁶⁸, -S(O)2NR⁶⁹R.⁶⁸, -NR⁶⁹C(O)R⁶⁸, -NR⁵⁹S(O)2R⁶⁸, -S(O)R⁶⁸, And so)₂R.⁶⁸

In some embodiments, the compounds of Formula III have the structure according to the following sub-generic structure of Formula III:

<img file="ECSP088121A_D0020.tif" />

all salts, prodrugs, tautomers and isomers thereof, wherein:

R.⁸¹ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH_2i -C(S)NH_2j -NHC(O)NH₂, -NHC(S)NH_2j -NHS(O)₂NH₂, -or⁶⁸, MR⁶⁸, -NR⁶⁹R.⁶⁸, -C(0)R^6S. -C(S)R⁶⁸, -C(O)OR⁶⁸, -C(O)NR⁶⁹R.⁶⁸, -C(S)NR⁶⁹R.⁶⁸, -S(O)2NR⁶⁹R.⁶⁸, -NR⁶⁹C(O)R⁶⁸, -NR⁶⁹C(S)R⁶⁸, -NR⁶⁹S/(O)2R⁶⁸, -NR⁶⁹C(O)NH2, -NR⁶⁹C(O)NR⁶⁹R.⁶⁸, -NR⁶⁹C(S)NH2, -NR⁶⁹C(S)NR⁶⁹R.⁶⁸, -NR⁶⁹S(O)2NH2, NR⁶⁹S(O)2NR⁶⁹R.³⁸, -S(O)R⁶⁸, And so)₂R.⁶⁸;

R.⁸3 is selected from the group consisting of hydrogen, fluorine, and chlorine;

R.¹¹² is selected from the group consisting of C alkyl₂.₆ optionally substituted aryl, optionally substituted heteroaryl, and -NR⁷⁹R.⁸⁰;

R.⁶⁸ is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R⁶⁸ is optionally substituted lower alkenyl, no alkene carbon thereof is attached to N, S, O, S(O), S(O)₂, C(O) or C(S) of -OR⁶⁸, -MR⁶⁸, -NR⁶⁹R.⁶⁸, -C(O)R⁶⁸, -C(S)R⁶⁸, -C(O)OR⁶⁸,

-C(O)NR⁶⁹R.⁶⁸, -C(S)NR⁶⁹R.⁶⁸, -C(O)2NR⁶⁹R.⁶⁸, -NR⁶⁹C(O)R⁶⁸, -NR⁶⁹C(S)R⁶⁸, -NR⁶⁹S(O)2R⁶⁸,

-NR⁶⁹C(O)NH2, -NR⁶⁹C(O)NR⁶⁹R.⁶⁸, -NR^B9C(S)NH2, -NR⁶⁹C(S)NR⁶⁹R.⁶⁸, -NR⁶⁹SW)₂NH₂,

-NR⁶⁹S(O)2NR⁶⁹R.⁶⁸, -S(O)R³⁸, or -S(O)2R³⁸, optionally substituted lower alkynyl, provided, however, that when R³⁸ is optionally substituted lower alkynyl, no alkyne carbon thereof is attached to the N, S, O, S(O), S(O)2, C(O) or C(S) of -OR³⁸ -MR³⁸ NR⁶⁹R.³⁸, -C(O)R³⁸, -C(S)R⁶⁸, C(O)OR⁶⁸, -C(O)NR³⁹R.³⁸, -C(S)NR³⁹R.³⁸, -S(O)2NR³⁹R.³⁸,

-NR⁶⁹C(O)R⁶⁸, -NR⁶⁹C(S)R⁶⁸, -NR³⁹S(O)2R⁶⁸, -NR³⁹C(O)NH2, -NR³⁹C(O)NR⁶⁹R.⁶⁸, -NR⁶⁹C(S)NH2, NR⁶⁹C(S)NR 69R⁶⁸, -NR⁶⁹S(O)2NH₂, -NR⁶⁹S(O)2NR⁶⁹R.⁶⁸, -S(O)R⁶⁸, or -S(O)2R⁶⁸, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;

R.⁶⁹ is selected from the group consisting of hydrogen and optionally substituted lower alkyl; and R⁷⁹ and R⁸⁰ are independently hydrogen or optionally substituted lower alkyl, or R⁷⁹ and R⁸⁰ combine with the nitrogen to which they are attached to form optionally substituted 5-7 membered heterocycloalkyl.

In some modalities of the compounds of Formula IIIm, R⁸¹ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -S(O)₂NH₂, -C(O)NH₂, -OR⁶⁸, -MR⁶⁶8,

-NR⁶⁹R.⁶⁸, -C(O)R⁶B, -C(S)R⁶⁸, -C(O)NR⁶⁹R.⁶⁸, -S(O)2NR⁶⁹R.⁶⁸, -NR⁶⁹C(O)R⁶⁸, -NR⁶⁹S(O)2R⁶⁸,

-S(O)R³⁸, And so)₂R.⁶⁸.

In one aspect, the present invention includes compounds that are useful as intermediates in the preparation of compounds of Formula III, the compounds having a structure selected from the group consisting of Formula IV, Formula V, Formula VI, Formula VII, Formula VIII, and Formula IX as follows:

<img file="ECSP088121A_D0021.tif" />

formula IV

Formula V

Ze=Z5 «Ύ\ Λ

AND

L~R³³

formula VI

<img file="ECSP088121A_D0022.tif" />

$

<img file="ECSP088121A_D0023.tif" />

_R.15

<img file="ECSP088121A_D0024.tif" />

Formula VII

formula VIII

Formula IX where:

z₂, Z4, Z5, Ζβ, L₂, X, s, n15 n17 n31 n32 n33 n37 n38 n42 n43 n45 n46 η , η , η ,Γι ,Γι , π , Γι₍ η , π , π , π

R.⁴⁷ are as defined for Formula III;

R.¹⁰⁸ is selected from the group consisting of -C(O)R⁸⁴, -CH₂I, -CH₂CI, -CH₂Br,-CH₂OH, and CH₂BEAR)₂R.¹⁰⁹;

R.¹⁰⁹ is selected from the group consisting of lower alkyl and aryl;

R.⁸⁴ is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;

R.⁸⁵ is selected from the group consisting of hydrogen, a protecting group of nitrogen, S(O)₂R.⁸⁷, -C(O)NR⁸⁸R.⁸⁹, and -C(S)NR⁸⁸R.⁸⁹;

R.⁸⁶ is selected from the group consisting of hydrogen, lower alkyl, and a nitrogen protecting group;

R.⁸⁷ is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R⁸⁷ is optionally substituted lower alkenyl, no alkene carbon thereof is attached to S(O)2, optionally substituted lower alkynyl, provided, however, that when R⁸⁷ is optionally substituted lower alkynyl, no alkyne carbon thereof attached to S(O)2, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and -NR⁹⁰R.⁹¹; and

R.⁸⁸,R⁸⁹,R⁹⁰ and R⁹¹ are independently selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl; either

R.⁸⁸ and R⁸⁹ together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl.

In some embodiments of the compounds of Formulas IV, V, VI, VII, or VIII, R¹⁰⁸ is -C(O)R⁸⁴, preferably where R⁸⁴ it's hydrogen. In some embodiments of the compounds of Formulas IV, V, VI, VII, or VIII, Z2 is N or CR¹², Z4 is N or CR¹⁴, Z5 is N or CR¹⁵, and Z6 is N or CR¹⁶ and R¹²,R¹⁴,R¹⁶,R¹⁶,R¹⁷,R⁴²,R⁴³,R⁴⁵,R⁴⁶ and R⁴⁷ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some embodiments, compounds of Formula IV have the structure according to the following sub-generic structure of Formula IVa:

<img file="ECSP088121A_D0025.tif" />

Formula IVa where:

R.⁸⁴ is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;

R.⁹²,R⁹³,R⁹⁵, and R⁹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy;

L₄ is selected from the group consisting of -NR⁴⁸-, -S-, -O-, -NR⁴⁸CH(R)⁴⁹)-, -SCH(R⁴⁹)-, -OCH(R⁴⁹)-, -C(O)NR⁴⁸-, -S(O)2NR⁴⁸-, -CH(R⁴⁹)NR⁴⁸-, -CH(R⁴⁹)O-, -CH(R⁴⁹)S-, -NR⁴⁸C(O)-, and NR⁴⁸S(O)2-;

Cy is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl;

R.⁹⁷ in each case it is independently selected from the group consisting of -OH, -NH2, -CN, NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR⁵⁷, -MR⁵⁷, -NR⁴⁸R.⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)2R⁵⁷, -S(O)2R⁵⁷, C(O)R⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, -S(O)2NR⁴⁸R.⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluoro, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁹⁷, or as lower alkyl substituents, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, MR⁵⁸, -NR⁴⁸R.⁵⁸,

-NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, -S(O)₂NR⁴⁶R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁴⁹ is selected from the group consisting of hydrogen, lower alkyl, and fluorine-substituted lower alkyl;

R.⁵⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁷, -MR⁵⁷,NR⁴⁸R.⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, or -S(O)2NR⁴⁸R.⁵⁷ is fluoro, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, where cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵⁷ or as lower alkyl substituents are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH_2j -OR⁵⁸, -MR⁵⁸, -NR⁴⁸R.⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, -S(O)₂NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino; and

R.⁵⁸ in each occurrence it is independently selected from the group consisting of lower alkyl, heterocycloalkyl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, any substitution of the alkyl carbon attached to O, S, or N of -OR⁵³. -MR⁵⁸, -NR⁴⁸R.⁵³. -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, either

-SW)₂NR⁴⁸R.⁵⁸ it is fluorine;

R.⁴⁸ in each case it is independently hydrogen or lower alkyl; yu is 0,1,2, or 3.

In some embodiments of the compounds of Formula IVa, at least two of R⁹²,R⁹³,R⁹⁵and R^9S they are hydrogen. In some modalities, at least two of R⁹²,R⁹³,R⁹⁵ and R⁹⁶ are hydrogen, L4 is -NR⁴⁸CH(R)⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably L4 is -OCH₂-, Cy is aryl or heteroaryl, and each R⁹⁷ is independently selected from the group consisting of halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some embodiments, the compounds of Formula IV have the structure according to the following structure «Jiih-HAnarira Hp Formula l\/h-

<img file="ECSP088121A_D0026.tif" />

TJXmvui 1 or where R⁸⁴,R⁹²,R⁹³,R⁹⁵,R⁹⁶,R⁹⁷, Cy and u are as defined by Formula IVa, and r is 0, 1 or

2.

In some embodiments of the compounds of Formula IVb, at least two of R⁹²,R⁹³,R⁹⁵and R⁹⁶ they are hydrogen. In some modalities, at least two of R⁹²,R⁹³,R⁹⁵ and R⁹⁶ are hydrogen, Cy is aryl or heteroaryl, and each R⁹⁷ is independently selected from the group consisting of halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some embodiments, the compounds of Formula V have the structure according to the following sub-generic structure of Formula Va:

<img file="ECSP088121A_D0027.tif" />

Formula Goes where:

R.⁸⁴ is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;

R.⁹²,R⁹³,R⁹⁵, and R⁹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy;

R.⁹⁸ is selected from the group consisting of hydrogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy; and s is 0, 1, or 2;

In some embodiments, the compounds of Formula VI have the structure according to the following sub-generic structure of Formula Via:

<img file="ECSP088121A_D0028.tif" />

Formula Via where:

R.⁸⁴ is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;

R.⁹²,R⁹⁴,R⁹⁵, and R⁹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy;

L₄ is selected from the group consisting of NR⁴⁸-, -S-, -0-, -NR⁴⁸CH(R)⁴⁹)-, -SCH(R⁴⁹)-, -OCH(R⁴⁹)-, -C(O)NR⁴⁸-, -S(O)2NR⁴⁸-, -CH(R⁴⁹)NR⁴⁸-, -CH(R⁴⁹)O-, -CH(R⁴⁹)S-, -NR⁴⁸C(O)-, and -NR⁴⁸S(O)2

Cy is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl;

R.⁹⁷ in each case it is independently selected from the group consisting of -OH, -NH2, -CN, NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR⁵⁷, -MR⁵⁷, -NR⁴⁸R.⁵⁷, -NR⁴⁸C(O)R⁵⁷, -NR⁴⁸S(O)2R⁵⁷, -S(O)2R⁵⁷, C(O)R⁵⁷, -C(O)OR⁵⁷ -C(O)NR⁴⁸R.⁵⁷, -S(O)2NR⁴⁸R.⁵⁷, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluoro, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁹⁷, or as lower alkyl substituents, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C (O)NH2, -OR⁵⁸, MR⁵⁸,NR⁴⁸R.⁵⁸,NR⁴⁸C(O)R⁵⁸,NR⁴⁸S(O)2R⁵⁸, -S(0)2R^r8; -C(O)R⁵⁸, -C(O)OR⁵S, -C(O)NR⁴⁸R.⁵⁸, S(O)₂NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁴⁹ is selected from the group consisting of hydrogen, lower alkyl, and fluorine-substituted lower alkyl;

R.⁵⁷ is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁷, -MR⁵⁷,NR⁴⁸R.⁵⁷, -C(O)OR⁵⁷, -C(O)NR⁴⁸R.⁵⁷, either

-SW)₂NR⁴⁸R.⁵⁷ is fluoro, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, where cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R⁵⁷ or as lower alkyl substituents are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH₂, -CN, NO₂, -C(O)OH, -S(O)₂NH₂, -C(O)NH₂, -OR⁵⁸, -MR⁵⁸, -NR⁴⁸R.⁵⁸, -NR⁴⁸C(O)R⁵⁸, -NR⁴⁸S(O)2R⁵⁸, -S(O)2R⁵⁸, -C(O)R⁵⁸, -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, -S(O)₂NR⁴⁸R.⁵⁸, halogen, lower alkyl, fluoro-substituted lower alkyl, and cycloalkylamino;

R.⁵⁸ in each occurrence it is independently selected from the group consisting of lower alkyl, heterocycloalkyl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, any substitution of the alkyl carbon attached to O, S, or N of -OR⁵⁸, -MR⁵⁸, -NR^4SR.^k -C(O)OR⁵⁸, -C(O)NR⁴⁸R.⁵⁸, either

-SW)₂NR⁴⁸R.⁵⁸ it is fluorine;

R.⁴⁸ in each case it is independently hydrogen or lower alkyl; and u is 0,1,2 or 3.

In some modalities of the compounds of Formula Via, at least two of R⁹²,R⁹⁴,R⁹⁵and R⁹³ they are hydrogen. In some modalities, at least two of R⁹²,R⁹⁴,R⁹⁵ and R⁹⁶ are hydrogen, L4 is NR⁴⁸CH(R)⁴⁹)-, -SCH(R⁴⁹)-, or -OCH(R⁴⁹)-, preferably L4 is -OCH₂-, Cy is aryl or heteroaryl, and each R⁹⁷ is independently selected from the group consisting of halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some embodiments, the compounds of Formula VI have the structure according to the following sub-generic structure of Formula Vlb:

Vlb formula

<img file="ECSP088121A_D0029.tif" />

where R⁸⁴,R⁹²,R⁹⁴,R⁹⁵,R⁹⁶,R⁹⁷, C and u are as defined by the Way Formula and r is 0, 1 or

2.

In some embodiments of the compounds of Formula Vlb, at least two of R⁹²,R⁹⁴,R⁹⁵and R⁹⁶ they are hydrogen. In some modalities, at least two of R⁹²,R⁹⁴,R⁹⁵ and R⁹⁶ are hydrogen, Cy is aryl or heteroaryl, and each R⁹⁷ is independently selected from the group consisting of halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some embodiments, the compounds of Formula VII have the structure according to the following sub-generic structure of Formula VII:

<img file="ECSP088121A_D0030.tif" />

where:

R.⁸⁴ is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;

R.⁹²,R⁹⁴,R⁹⁵, and R⁹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy;

R.⁹⁹ is selected from the group consisting of optionally substituted lower alkyl, optionally substituted aryl, optionally substituted heteroaryl, and NR⁷⁹R.⁸⁰; and

R.⁷⁹ and R⁸⁰ are independently hydrogen or optionally substituted lower alkyl, or R⁷⁹ and R⁸⁰ combine with the nitrogen to which they are attached to form optionally substituted 5-7 membered heterocycloalkyl.

In some modalities of the compounds of Formula Vlla, one of R⁹² and R⁹⁶ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy, and the other from R⁹² and R⁹⁶ is selected from the group consisting of halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy; in additional modalities, one of R⁹² and R⁹⁶ is hydrogen, fluorine or chlorine, and the other of R⁹² and R⁹⁶ is fluorine or chlorine; in additional modalities, R⁹² is fluorine and R^9B is hydrogen, fluorine, or chlorine; in additional modalities, R⁹² and R⁹⁶ they are fluorine

In some modalities of the compounds of Formula Vlla, R⁹⁴ and R^9S they are hydrogen; in additional modalities, one of R⁹² and R⁹⁶ is selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy and the other from R⁹² and R⁹⁶ is selected from the group consisting of halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy; in additional modalities, one of R⁹² and R⁹⁶ one is selected from hydrogen, fluorine or chlorine and the other from R⁹² and R⁹⁶ is selected from fluorine or chlorine; in additional modalities, R⁹² is fluorine and R⁹⁶ is selected from hydrogen, fluorine, or chlorine; in additional modalities, R⁹² and R⁹⁶ they are fluorine

In some embodiments, compounds of Formula VII have the structure according to the following sub-generic structure of Formula VIIb:

<img file="ECSP088121A_D0031.tif" />

VHb formula where:

X is O or S;

R.⁸⁴ is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;

R.⁹²,R⁹⁴,R⁹⁵, and R⁹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy;

R.⁸² is hydrogen or lower alkyl;

one of R¹⁰⁰ and R¹⁰¹ is lower alkyl, fluorine substituted lower alkyl, or -(CH₂)_ ₂R.⁷°, and the other of R¹⁰⁰ and R¹⁰¹ is hydrogen or lower alkyl; either

R.¹⁰⁰ and R¹⁰¹ together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl; and

R.⁷⁰ is selected from the group consisting of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl.

In some modalities of the compounds of Formula Vllb, at least two of R⁹²,R⁹⁴,R⁹S and R⁹⁶ they are hydrogen. In some modalities, at least two of R⁹²,R⁹⁴,R⁹⁵ and R⁹⁶ are hydrogen, and R⁷⁰ is aryl or heteroaryl, wherein aryl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some embodiments, the compounds of Formula VIII have the structure according to the following sub-generic structure of Formula Villa:

<img file="ECSP088121A_D0032.tif" />

Formula Life where:

X is O or S;

R.⁸⁴ is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;

R.¹⁰²,R¹⁰³,R¹⁰⁵,R¹⁰⁶, and R¹⁰⁷ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy;

one of R¹⁰⁰ and R¹⁰¹ is lower alkyl, fluorine substituted lower alkyl, or -(CH2)₀.₂R.⁷⁰ and the other of R.¹⁰⁰ and R¹⁰¹ is hydrogen or lower alkyl;

or R¹⁰⁰ and R¹⁰¹ together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl; and

R.⁷⁰ is selected from the group consisting of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl.

In some modalities of the compounds of Formula Villa, at least two, also at least three, also at least four, or all of R¹⁰²,R¹⁰³,R¹⁰⁵,R¹⁰⁶, and R¹⁰⁷ they are hydrogen. In some modalities, at least two, also at least three, also at least four, or all of R¹⁰²,R¹⁰³,R¹⁰⁵,R¹⁰⁶, and R¹⁰⁷ are hydrogen, and R⁷⁰ is aryl or heteroaryl, wherein aryl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy.

In some embodiments, compounds of Formula IX have the structure according to the following sub-generic structure of Formula IXa:

Formula Ka where:

R.⁸⁴ is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;

R.⁹²,R⁹⁵, and R⁹⁶ are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy;

R.⁹⁸ is selected from the group consisting of hydrogen, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, and fluorine-substituted lower alkoxy; and s is 0, 1, or 2.

In some embodiments of any of the above embodiments of the compounds of Formula IVa, IVb, Va, Via, Vlb, Vlla, Vllb, Villa, or IXa, R⁸⁴ it's hydrogen.

In some embodiments of the above compounds, compounds are excluded where N (except where N is a heteroaryl ring atom), O, or S is attached to a carbon that is also attached to N (except where N is a carbon atom). heteroaryl ring), O, or S; or where N (except where N is a heteroaryl ring atom), O, C(S), C(O), or S(O)n (n is 0-2) is attached to an alkene carbon of a alkenyl group or is attached to an alkyne carbon of an alkynyl group; therefore, in some embodiments compounds that include linkages such as the following are excluded from the present invention: -NR-CH₂-NR-, -O-CH₂-NR-, -S-CH₂-NR-, -NR-CH₂-O-, -O-CH₂-O-, -S-CH₂-O-, -NRCH₂-S-, -O-CH₂-S-, -S-CH₂-S-, -NR-CH=CH-, -CH=CH-NR-, -NR-ChC-, -ChC-NR-, -O-CH=CH-, -CH=CH0-, -O-CHC -, -ChC-O-, -S(0)o.₂-CH=CH-, -CH=CH-S(0)o.₂-, -S(0) or_₂-ChC-, -CeC-S(O)₀-₂-, -C(O)-CH=CH-, -CH=CH-C(O)-, -ChC-C(O)-, or -C(O)-ChC-, -C(S)-CH =CH-, -CH=CH-C(S)-, -ChC-C(S)-, or -C(S)-ChC-.

With reference to the compounds herein, the specification of a compound or group of compounds includes pharmaceutically acceptable salts of such or such a compound, prodrugs, and all stereoisomers, unless clearly indicated otherwise. With reference to compounds of Formula III, such reference is understood to include compounds of Formulas llla-lllq, and all sub-modalities thereof.

In one aspect, the invention provides methods of treating a protein kinase-mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of Formula III. The terms "treat," "therapy," and similar terms refer to the administration of material, eg, compound of Formula III, in an amount effective to prevent, alleviate, or ameliorate one or more symptoms of a disease or condition, ie, indication, and/or to prolong the survival of the subject being treated. The term "protein kinase-mediated disease or condition" refers to a disease or condition in which the biological function of a protein kinase affects the development and/or course of the disease or condition, and/or in which the modulation of protein kinase alters the development, course, and/or symptoms of the disease or condition. A protein kinase-mediated disease or condition includes a disease or condition for which modulation provides therapeutic benefit, for example where treatment with protein kinase inhibitors, including the compounds described herein, provides therapeutic benefit to the subject who suffers from or is at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of a compound of Formula III in combination with one or more other therapies for the disease or condition.

In one aspect, the invention provides methods of treating a Raf protein kinase-mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of Formula III. The terms "Raf protein kinase-mediated disease or condition," "Raf-mediated disease or condition," and the like refer to a disease or condition in which the biological function of a Raf kinase, including any mutations thereof, affects the development and/or course of the disease or condition, and/or in which modulation of Raf protein kinase alters the development, course, and/or symptoms of the disease or condition. Raf protein kinase includes, but is not limited to, B-Raf, BRaf mutations, c-Raf-1, and c-Raf-1 mutations. In some embodiments, the Raf protein kinase is B-Raf V600E mutation. In additional embodiments, the disease or condition is a cancer that is sensitive to treatment by an inhibitor of the V600E B-Raf mutant. A disease or condition mediated by Raf protein kinase includes a disease or condition for which inhibition of Raf provides therapeutic benefit, for example where treatment with Raf inhibitors, including the compounds described herein, provides therapeutic benefit for the subject suffering from or at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of a compound of Formula III in combination with one or more other therapies for the disease or condition.

In one aspect, the invention provides methods of treating an Fms protein kinase-mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of Formula III. The terms "Fms protein kinase-mediated disease or condition," "Fms-mediated disease or condition," and the like refer to a disease or condition in which the biological function of an Fms protein kinase, including any mutation thereof, affects the development and/or course of the disease or condition, and/or in which Fms modulation alters the development, course, and/or symptoms of the disease or condition. An Fms-mediated disease or condition includes a disease or condition for which inhibition of Fms provides therapeutic benefit, for example where treatment with Fms inhibitors, including the compounds described herein, provides therapeutic benefit to the subject who suffers from or is at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of a compound of Formula III in combination with one or more other therapies for the disease or condition.

In one aspect, the invention provides methods of treating a Kit protein kinase-mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of Formula III. The terms "Kit-mediated disease or condition," "Kit protein kinase-mediated disease or condition," and the like refer to a disease or condition in which the biological function of a Kit protein kinase, including any mutation thereof, affects the development and/or course of the disease or condition, and/or in which the modulation of Kit alters the development, course, and/or symptoms of the disease or condition. A Kit-mediated disease or condition includes a disease or condition for which inhibition of Kit provides therapeutic benefit, for example where treatment with Kit inhibitors, including the compounds described herein, provides therapeutic benefit to the subject who suffers from or is at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of a compound of Formula III in combination with one or more other therapies for the disease or condition.

In one aspect, the invention provides methods of treating a Jnk protein kinase-mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of Formula III. The terms "Jnk-mediated disease or condition," "Jnk protein kinase-mediated disease or condition," and the like refer to a disease or condition in which the biological function of a Jnk kinase, eg, Jnk1, Jnk2, Jnk3, or any mutation thereof, affects the development and/or course of the disease or condition, and/or in which modulation of the Jnk kinase alters the development, course, and/or symptoms of the disease or condition. A Jnk-mediated disease or condition includes a disease or condition for which inhibition of Jnk provides therapeutic benefit, for example where treatment with Jnk inhibitors, including the compounds described herein, provides therapeutic benefit to the subject who suffers from or is at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of a compound of Formula III in combination with one or more other therapies for the disease or condition. Jnk protein kinase includes, but is not limited to, Jnk1, Jnk2, or Jnk3.

In some embodiments, a compound of the invention has an IC₅or less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted assay for activity of kinase. In some embodiments, a compound of Formula III will have an IC₅or less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM with respect to at least one kinase selected from the group consisting of B-Raf, c-Raf-1, Fms, Jnk1, Jnk2, Jnk3, and Kit, and any mutations thereof. In some embodiments, a compound of Formula III will have an IC₅₀ less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM with respect to at least one kinase selected from the group consisting of B-Raf, B-Raf V600E mutant, c-Raf-1, Fms, Jnk1, Jnk2, Jnk3, and Kit, preferably BRaf, B-Raf V600E mutant or c-Raf-1.

In some embodiments, a compound of Formula III is an inhibitor of a Raf kinase and has an IC₅₀ less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 131.1, less than 5 nM, or less than 1 nM as determined in a generally accepted assay for activity from Raf kinase. In some embodiments, a compound of Formula III will have an IC₅₀ less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM relative to B-Raf, c-Raf-1, or B -Raf mutant V600E. In some embodiments, a compound of Formula III will selectively inhibit one Raf kinase relative to one or more other Raf kinases. In some embodiments, the compound of Formula III will selectively inhibit a Raf kinase mutation relative to wild type kinase, eg B-Raf V600E relative to B-Raf wild type.

In some embodiments, a compound of Formula III is an inhibitor of an Fms kinase and has an IC₅₀ less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted assay for Fms activity kinase. In some embodiments, a compound of Formula III will selectively inhibit Fms kinase relative to Kit kinase.

In some embodiments, a compound of Formula III is an inhibitor of a Kit kinase and has an IC₅c of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted assay for activity of Kinase kit.

In some embodiments, a compound of Formula III is an inhibitor of a Jnk kinase and has an IC₅₀ less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted assay for Jnk activity kinase. In some embodiments, a compound of Formula III is an inhibitor of a Jnk1 kinase and has an IC₅₀ less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted assay for Jnk1 activity kinase. In some embodiments, a compound of Formula III is an inhibitor of a Jnk2 kinase and has an IC₅₀ less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted assay for Jnk2 activity kinase. In some embodiments, a compound of Formula III is an inhibitor of a Jnk3 kinase and has an IC₅₀ less than 500 nM, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted assay for Jnk3 activity kinase. In some embodiments, a compound of Formula III will selectively inhibit one Jnk kinase relative to one or more other Jnk kinases, such as selectively inhibiting Jnk 1 relative to Jnk 2 and/or Jnk3, selectively inhibiting Jnk2 relative to Jnk3 and/or or Jnk1, or selectively inhibit Jnk3 relative to Jnk1 and/or Jnk 2.

In addition to any of the modalities mentioned above, a compound of the invention will inhibit the effects of a kinase mutation, including, but not limited to, a mutation that is associated with a disease state, such as cancer. For example, the B-Raf V600E mutant occurs in a high percentage of some cancers, such as melanoma, and compounds of the invention will inhibit the kinase activity of this mutant.

In addition to any of the embodiments in the foregoing, a compound of the invention may selectively inhibit a kinase relative to one or more other kinases, where preferably the inhibition is selective relative to any of the other kinases, be it a kinase discussed in present, or other kinases. In some embodiments, the compound can selectively inhibit the effects of a kinase mutation relative to wild type kinase, eg B-Raf V600E relative to B-Raf wild type. In some embodiments, the compound can selectively inhibit Fms relative to Kit. The selective inhibition of one kinase relative to another is such that IC₅₀ for a kinase it can be at least about 2-fold, also 5-fold, also 10-fold, also 20-fold, also 50-fold, or at least about 100-fold less than the IC₆₀ for any of the other kinases as determined in a generally accepted assay for kinase activity.

In another aspect, the invention provides methods of treating a protein kinase-mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a composition including a compound of Formula III.

In one aspect, the invention provides methods of treating a disease or condition mediated by a protein kinase selected from the group consisting of B-Raf, c-Raf-1, Fms, Jnk1, Jnk2, Jnk3, and Kit, and any mutations of the same, by administering to the subject an effective amount of a composition that includes a compound of Formula III.

In one aspect, the invention provides methods of treating a disease or condition mediated by B-Raf, c-Raf-1 or B-Raf V600E by administering to the subject an effective amount of a composition including a compound of Formula III. In one aspect, the invention provides methods of treating a disease or condition mediated by B-Raf, c-Raf-1 or B-Raf V600E by administering to the subject an effective amount of a composition that includes a compound of Formula III in combination with one or more other therapies suitable to treat the disease or condition. In one aspect, the invention provides methods of treating a B-Raf mutant V600E-mediated cancer by administering to the subject an effective amount of a composition including a compound of Formula III in combination with one or more suitable anti-cancer therapies, such as one or more chemotherapy drugs.

In another aspect, the invention provides a method of treating or prophylaxis of a disease or condition in a mammal, by administering to the mammal a therapeutically effective amount of a compound of Formula III, a prodrug of such compound, or a pharmaceutically acceptable salt of such a compound or prodrug. The compound can be individual or it can be part of a composition. In another aspect, the invention provides a method of treating or prophylaxis of a disease or condition in a mammal, by administering to the mammal a therapeutically effective amount of a compound of Formula III, a prodrug of such compound, or a pharmaceutically acceptable salt of such compound or prodrug in combination with one or more other therapies suitable for the disease or condition.

In another aspect, the invention provides compositions that include a therapeutically effective amount of a compound of Formula III and at least one pharmaceutically acceptable carrier, excipient, and/or diluent. The composition may include a plurality of different pharmacologically active compounds, which may include a plurality of the compounds of Formula III.

In a related aspect, the invention provides kits including a composition as described herein. In some embodiments, the composition is packaged, eg, in a container, bottle, jar, which may further be packaged, eg, within a box, wrapper, or bag; the composition is approved by the US Food and Drug Administration or similar regulatory agency for administration to a mammal, eg, a human; The composition is approved for administration to a mammal, eg, a human, for a protein kinase-mediated disease or condition; The kit of the invention includes written instructions for use and/or other indication that the composition is suitable or approved for administration to a mammal, eg, a human, for a protein kinase-mediated disease or condition; and the composition is packaged in unit dose or single dose form, for example, single dose pills, capsules, or the like.

In aspects involving treatment or prophylaxis of a disease or condition with the compounds of Formula III, the disease or condition is, for example without limitation, selected from the group consisting of neurological diseases such as ischemic stroke, cerebrovascular ischemia, infarct dementia multiple, head injury, spinal cord injury, Alzheimer's disease (AD), PaR disease^whatinson, amyotrophic lateral sclerosis, dementia, senile chorea, and Huntington's disease; neoplastic diseases and associated complications, including chemotherapy-induced hypoxia, gastrointestinal stromal tumors (GISTs), prostate tumors, mast cell tumors (including canine mast cell tumors), acute myeloid leukemia, acute lymphocytic leukemia, chronic myeloid leukemia, multiple myeloma, melanoma, mastocytosis, gliomas , glioblastoma, astrocytoma, neuroblastoma, sarcomas (for example sarcomas of neuroectodermal origin), carcinomas (for example lung, breast, pancreatic, renal, female genital tract, carcinoma in situ), lymphoma (for example histiocytic lymphoma), neurofibromatosis (including Schwann cell neoplasm), myelodysplastic syndrome, leukemia, tumor angiogenesis, and cancers of the thyroid, liver, bone, skin, brain , pancreas, lung (eg small cell lung cancer), breast, colon, prostate, testis and ovary; pain of neuropathic or inflammatory origin, including acute pain, chronic pain, and migraine; cardiovascular diseases including heart failure, cardiac hypertrophy, thrombosis (eg thrombotic microangiopathy syndromes), atherosclerosis, reperfusion injury and ischemia (eg cerebrovascular ischemia, hepatic ischemia); inflammation including, but not limited to, polycystic kidney disease (PKD), age-related macular degeneration, rheumatoid arthritis, allergic rhinitis, inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, systemic lupus erythematosus, Sjogren's syndrome, Wegener's granulomatosis, psoriasis, scleroderma, chronic thyroiditis, Grave's disease, myasthenia gravis, multiple sclerosis, osteoarthritis, endometriosis, scarring, vascular restenosis, fibrotic disorders, hypereosinophilia, CNS inflammation, pancreatitis, nephritis, atopic dermatitis, and hepatitis; immunodeficiency diseases, organ transplant rejection, graft versus host disease; renal or prosthetic diseases including diabetic nephropathy, nephrosclerosis, glomerulonephritis, interstitial nephritis, lupus nephritis, prostatic hyperplasia, chronic renal failure, tubular necrosis, renal complications associated with diabetes, and hypertrophy; metabolic diseases including type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity, hepatic steatosis, insulin resistance, hyperglycemia, lipolysis, and obesity; infection, including but not limited to Helicobacter pylori and Influenza viruses, fever, sepsis; lung diseases including chronic obstructive pulmonary disease (COPD), acute respiratory distress syndrome (ARDS), asthma, allergy, bronchitis, emphysema, and pulmonary fibrosis; developmental genetic diseases such as Noonan syndrome, Costello syndrome, (faciocutaneous-skeletal syndrome), leopard syndrome, cardiofaciocutaneous syndrome (CFC) and neural crest syndrome, abnormalities causing cardiovascular, skeletal, intestinal, skin, hair and endocrine; and disorders of bone structure or mineralization, including osteoporosis, increased risk of fracture, hypercalcemia, and bone metastasis.

In a related aspect, the compounds of Formula III may be used in the preparation of a medicament for the treatment of a B-Raf-mediated disease or condition selected from the group consisting of neurological diseases such as ischemic stroke, heart attack dementia, multiple, head injury, spinal cord injury, Alzheimer's disease (AD), PaR disease^whatinson; neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, carcinoma (for example lung, breast, pancreatic, renal), lymphoma (for example histiocytic lymphoma) and cancer of the thyroid, lung (for example small cell lung cancer ), liver, breast, ovary and colon, neurofibromatosis, myelodysplastic syndrome, leukemia, tumor angiogenesis; pain of neuropathic or inflammatory origin, including acute pain, chronic pain, and migraine; cardiovascular diseases including heart failure, cardiac hypertrophy, thrombosis (eg thrombotic microangiopathy syndromes), atherosclerosis, reperfusion injury; inflammation including, but not limited to, psoriasis, polycystic kidney disease (PKD), arthritis and autoimmune diseases and conditions, osteoarthritis, endometriosis, scarring, vascular restenosis, fibrotic disorders, rheumatoid arthritis, inflammatory bowel disease (IBD); immunodeficiency diseases, organ transplant rejection, graft versus host disease; kidney or prostate diseases including diabetic nephropathy, nephrosclerosis, glomerulonephritis, prostatic hyperplasia; metabolic disorders, obesity; infection, including but not limited to Helicobacter pylori and Influenza viruses, fever, sepsis; lung diseases including chronic obstructive pulmonary disease (COPD) and acute respiratory distress syndrome (ARDS); developmental genetic diseases such as Noonan syndrome, Costello syndrome, (faciocutaneous-skeletal syndrome), leopard syndrome, cardio-faciocutaneous (CFC) syndrome, and neural crest syndrome, abnormalities causing cardiovascular, skeletal, intestinal, skin, hair diseases and endocrine.

In a related aspect, the compounds of Formula III may be used in the preparation of a medicament for the treatment of a c-Raf-1-mediated disease or condition selected from the group consisting of colorectal, ovarian, lung, and renal, acute myeloid leukemia, myelodysplastic syndromes, tumor angiogenesis, and neuroendocrine tumors such as medullary thyroid cancer, carcinoid, small cell lung cancer, and pheochromocytoma.

In a related aspect, the compounds of Formula III may be used in the preparation of a medicament for the treatment of an Fms-mediated disease or condition selected from the group consisting of immune disorders, including rheumatoid arthritis, systemic lupus erythematosus (SLE) , Wegener's granulomatosis, and transplant rejection, inflammatory diseases including Chronic Obstructive Pulmonary Disease (COPD), emphysema, and atherosclerosis, metabolic disorders, including insulin resistance, hyperglycemia, and lipolysis, disorders of bone structure or mineralization, including osteoporosis, increased risk of fracture, hypercalcemia, and bone metastases, diseases of the kidney, including nephritis (for example glomerulonephritis, interstitial nephritis, lupus nephritis), tubular necrosis, renal complications associated with diabetes, and hypertrophy and cancers, including multiple myeloma, acute myeloid leukemia, chronic myeloid leukemia (CML), breast cancer, and ovarian cancer.

In a related aspect, the compounds of Formula III may be used in the preparation of a medicament for the treatment of a Jnk-mediated disease or condition selected from the group consisting of metabolic diseases including type 1 diabetes, type 2 diabetes, metabolic syndrome , obesity, and hepatic steatosis; cardiovascular diseases such as atherosclerosis, ischemia (eg cerebrovascular ischemia, hepatic ischemia), reperfusion injury, cardiac hypertrophy; kidney diseases such as chronic renal failure; neoplastic diseases and associated complications, including chemotherapy-induced hypoxia, prostate tumors, myeloid leukemia, and cancers of the liver, bone, skin, brain, pancreas, lung, breast, colon, prostate, and ovary; rejection of transplants; pain of neuropathic or inflammatory origin including acute and chronic pain; inflammatory and autoimmune diseases including age-related macular degeneration, rheumatoid arthritis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, systemic lupus erythematosus, Sjogren's syndrome, psoriasis, scleroderma, chronic thyroiditis, Graves' disease, myasthenia gravis, and sclerosis multiple, and inflammation in other organs including CNS inflammation, pancreatitis, nephritis, atopic dermatitis, and hepatitis; inflammatory airway diseases such as asthma, allergy, bronchitis, pulmonary fibrosis, chronic obstructive pulmonary disease; neurological diseases such as stroke, cerebrovascular ischemia, neurodegenerative diseases such as PaR disease^whatinson, Alzheimer's disease, amyotrophic lateral sclerosis, dementia, senile chorea, head and spinal cord trauma, and Huntington's disease.

In a related aspect, the compounds of Formula III may be used in the preparation of a medicament for the treatment of a Jnk1-mediated disease or condition selected from the group consisting of type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity and hepatic steatosis.

In a related aspect, the compounds of Formula III may be used in the preparation of a medicament for the treatment of a Jnk2-mediated disease or condition, such as atherosclerosis.

In a related aspect, the compounds of Formula III may be used in the preparation of a medicament for the treatment of a Jnk3-mediated disease or condition selected from the group consisting of inflammatory diseases including autoimmune diseases such as rheumatoid arthritis, inflammatory syndrome intestine, Crohn's disease, systemic lupus erythematosus, Sjogren's syndrome, psoriasis and multiple sclerosis, inflammatory airway diseases such as asthma, allergy, pulmonary fibrosis, and chronic obstructive pulmonary disease, and inflammation in other organs, such as CNS inflammation, pancreatitis, nephritis, and hepatitis; neurological diseases such as stroke, cerebrovascular ischemia, and neurodegenerative diseases such as PaR disease^whatinson's disease, Alzheimer's disease, and

Huntington's; and neoplastic diseases such as prostate tumors and myeloid leukemia.

In a related aspect, the compounds of Formula III may be used in the preparation of a medicament for the treatment of a Kit-mediated disease or condition selected from the group consisting of malignancies, including mast cell tumors, small cell lung cancer, testicular cancer. , gastrointestinal stromal tumors (GIST), glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female genital tract, sarcomas of neuroectodermal origin, colorectal carcinoma, carcinoma in situ, Schwann cell neoplasm associated with neurofibromatosis, acute myelocytic leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia, canine mastocytosis, melanoma, and mast cell tumors, and inflammatory diseases, including asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, syndrome of inflammation of the intestine, rejection of transplants, and hypereosinophilia.

Additional aspects and embodiments will be apparent from the following Detailed Description and from the claims.

DETAILED DESCRIPTION OF THE INVENTION

As used herein the following definitions apply unless otherwise clearly stated:

"Halogen" refers to all halogens, ie, chlorine (Cl), fluorine (F), bromine (Br), or iodine (I).

"Hydroxy" or "hydroxy" refers to the -OH group.

"Thiol" refers to the -SH group.

“Lower alkyl” alone or in combination means an R^toAlkane-derived dical containing 1 to 6 carbon atoms (unless specifically defined) including straight chain alkyl or branched alkyl. The straight or branched chain alkyl group is attached at any available point to produce a stable compound. In many embodiments, a lower alkyl is a straight or branched alkyl group containing 1-6, 1-4, or 1-2 carbon atoms, such as methyl, ethyl, propyl, isopropyl, butyl, t-butyl, and the like. A "substituted lower alkyl" indicates lower alkyl that is independently substituted, unless otherwise indicated, with one or more, preferably 1,2,3,4 or 5, also 1, 2, or 3 substituents, attached. on any available atom to produce a stable compound, where the substituents are selected from the group consisting of -F, -OH, -NH₂, -NO₂, -CN, C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH_2i -SW)₂NH₂, -NHC(O)NH₂, NHC(S)NH₂, -NHS(O)₂NH₂, C(NH)NH₂, -0°, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)O°, - C(S)O°, -S(O)R°, -S(O)₂R°, C(O)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR°R°, -S(O)₂NHR°, -S(O)₂NR°R°, -C(NH)NHR°, C(NH)NRPR°, -NHC(O)R°, -NHC(S)R°, -NRO(O)R°, -NR°C(S )R°, -NHS(O)₂R°, -NR°S(O)₂R°, NHC(O)NHR°, -NHC(S)NHR°, -NR°C(O)NH₂, -NRO(S)NH₂, -NRO(O)NHR°, -NR°C(S)NHR°, NHC(O)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR°R°, -NR°C(S)NR⁰R°, NHS(O)2NTIR°, -NR°S(O)2NH2, NR°S(O)2NHR°, -NHS(O)2NR°R°, -NR^eitherS(O)2NR°R°, -NHR°, -NR°R°, -R®, -R', and -R⁹. Additionally, possible substitutions include subsets of these substitutions, as indicated herein, eg, in the description of the compounds of Formula III, attached at any available atom to produce a stable compound. For example "fluoro-substituted lower alkyl" means a lower alkyl group substituted with one or more fluorine atoms, such as perfluoroalkyl, where preferably the lower alkyl is substituted with 1, 2, 3, 4 or 5 fluorine atoms, also 1 , 2, or 3 fluorine atoms. While substitutions are meant to attach on any available atom to produce a stable compound, when the optionally substituted alkyl is a one-moiety R group such as -OR (for example alkoxy), -SR (for example thioalkyl), - NHR (for example alkylamino), C(O)NHR, and the like, the substitution of the R group of the alkyl is such that substitution of the alkyl carbon attached to any O, S, or N of the moiety (except where N is a heteroaryl ring atom) excludes substituents which may result in any O, S, or N of the substituent (except where N is a heteroaryl ring atom) attaching to the attached alkyl carbon to any O, S, or N portion. “Rent from C₂.₆” indicates lower alkyl containing 2-6 carbon atoms. A “C alkyl₂₆"substituted" indicates optionally substituted lower alkyl containing 2-6 carbon atoms. A "substituted methyl" indicates methyl that is independently substituted, unless otherwise indicated, with 1, 2, or 3 substituents, wherein the substituents are selected as for optionally substituted lower alkyl.

“C1,3-Alkylene” refers to a divalent Alkane-derived Radical containing 1-3 carbon atoms, straight-chain or branched, of which two hydrogen atoms are taken from the same carbon atom or from different carbon atoms . The alkylene of Ci-₃ includes methylene -CH₂-, ethylene CH₂CH₂-, propylene -CH₂CH₂CH₂-, and isopropylene -CH(CH3)CH₂- or -CH₂CH(CH3)-. Ci alkylene₃substituted with one or more substituents indicates alkylene Ci.₃ which is independently substituted, with one or more, preferably 1, 2, 3, 4, or 5, also 1, 2, or 3 substituents as indicated, attached on any available atom to produce a stable compound.

"Lower alkenyl" alone or in combination means a straight or branched hydrocarbon containing 2-6 carbon atoms (unless specifically defined) and at least one, preferably 1-3, more preferably 1-2, most preferably one, carbon-to-carbon double bond. Carbon-to-carbon double bonds can be contained within a straight or branched chain portion. Examples of lower alkenyl groups include ethenyl, propenyl, isopropenyl, butenyl, and the like. A "substituted lower alkenyl" means lower alkenyl that is independently substituted, unless otherwise indicated, with one or more, preferably 1,2,3,4 or 5, also 1, 2, or 3 substituents, attached in any atom available to produce a stable compound, where the substituents are selected from the group consisting of -F, -OH, -NH₃, -NO₂, -CN, C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, C(NH)NH₂, -0°, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)O°, - C(S)O°, -S(O)R°, -S(O)₂R°, C(O)NHR°, -C(S)NHR°, -C(O)NR°R°,

-C(S)NR°R°, -S(O)₂NHR°, -S(O)₂NR°R°, -C(NH)NHR°, -C(NH)NR¹R°, -NHC(O)R°, -NHC(S)R°, -NRO(O)R°, -NR°C(S)R°, -NHS(O)₂R°, NR°S(O)₂R°, -NHC(O)NHR°, NHC(S)N1 ¡IR°,

-NRO(O)NH₂, -NR°C(S)NH₂, -NRO(O)NHR°, -NR°C(S)NHR°, -NHC(O)NR^EITHERR°, -NHC(S)NR°R°, -NRO(O)NR°R°, -NR°C(S)NR°R°, -NHS(O)₂NHR°, -NR°S(O)₂NH₂, -NR°S(O)₂NHR°, -NHS(O)₂NR°R°, -NR°S(O)₂NR^eitherR.^either, -NHR°, -NR°R°, -R^d, -R^F, and -R⁹. In addition, possible substitutions include subsets of these substitutions, as indicated herein, for example, in the description of the compounds of Formula III, attached at any available atom to produce a stable compound. For example "fluoro-substituted lower alkenyl" means a lower alkenyl group substituted with one or more fluorine atoms, where preferably the lower alkenyl is substituted with 1, 2, 3, 4 or 5 fluorine atoms, also 1, 2, or 3 fluorine atoms. While substitutions are understood to attach on any available atom to produce a stable compound, substitution on alkenyl groups is such that -F, -C(O)-, -C(S)-, -C(NH) -, -S(O)-, -S(O)₂-, -O-, -S-, or N (except where N is a heteroaryl ring atom), do not bond to an alkene carbon thereof. In addition, where alkenyl is a substituent of another moiety or an R group of a moiety such as -O, NHR, -C(O)R, and the like, the substitution of the moiety is such that any -C(O)-, -C(S)-, -S(O)-, -S(O)₂-, O-, -S-, or N thereof (except where N is a heteroaryl ring atom) do not bond to an alkene carbon of the alkenyl substituent or R group. In addition, where alkenyl is a substituent of another moiety or an R group of a moiety such as -O, -NHR, -C(O)NHR, and the like, the substitution of the R group of alkenyl is such that substitution of the carbon of the alkenyl alkenyl attached to any O, S, or N of the moiety (except where N is a heteroaryl ring atom) excludes substituents that may result in any O, S, or N of the substituent (except where N is a heteroaryl ring atom) attaching to the alkenyl carbon attached to any O, S, or N of the moiety. An "alkenyl carbon" refers to any carbon within an alkenyl group, whether saturated or part of the carbon-to-carbon double bond. An "alkene carbon" refers to a carbon within an alkenyl group that is part of a carbon-to-carbon double bond.

"Lower alkynyl" alone or in combination means a linear or branched hydrocarbon containing 2-6 carbon atoms (unless specifically defined) containing at least one, preferably one, carbon-to-carbon triple bond. Examples of alkynyl groups include ethynyl, propynyl, butynyl, and the like. A "substituted lower alkynyl" means lower alkynyl that is independently substituted, unless otherwise indicated, with one or more, preferably 1,2,3,4 or 5, also 1, 2, or 3 substituents, attached at any atom available to produce a stable compound, where the substituents are selected from the group consisting of -F, -OH, -NH₂, -NO₂, -CN, C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH_2j -SW)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, NHS(OR)₂NH₂, C(NH)NH₂, -0°, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)O°, - C(S)O°, -S(O)R°, -S(0)₂R°, C(O)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR°R°, -S(O)₂NHR°, -S(O)₂NR°R°, -C(NH)NHR°, C(NH)NRPR°, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R°, -NR°C (S)R°, NHS(O)₂R°, NR°S(O)₂R°, NHC(O)NHR°, -NHC(S)NHR°, -NR°C(O)NH₂, -NR°C(S)NH₂, -NRO(O)NHR°, -NR°C(S)NHR°, NHC(O)NR°R°, NHC(S)NR°R°, -NR°C(O)NR°R°, - NR°C(S)NR°R⁰, -NHS(O)2NHR°, -NR°S(O)2NH2, NR°S(O)2NHR°, -NHS(0)2NR°R^either, -NR°S(0)2NR°R^either, -NHR⁰, -R^d, -R^F, and -R⁹. In addition, possible substitutions include subsets of these substitutions, as indicated herein, for example, in the description of the compounds of Formula III, attached at any available atom to produce a stable compound. For example "fluoro substituted lower alkynyl" means a lower alkynyl group substituted with one or more fluorine atoms, where preferably the lower alkynyl is substituted with 1, 2, 3, 4 or 5 fluorine atoms, also 1, 2, or 3 fluorine atoms. While substitutions are understood to attach on any available atom to produce a stable compound, substitution of alkynyl groups is such that -F, -C(O)-, -C(S)-, -C(NH)- , -S(O)-, -S(O)₂-, -O-, -S-, or N (except where N is a heteroaryl ring atom) do not bond to an alkyne carbon thereof. In addition, where alkynyl is a substituent of another moiety or an R group of a moiety such as -O, -NHR, C(O)R, and the like, the substitution of the moiety is such that any -C(O)-, -C(S)-, -S(O)-, -S(O)₂-, -0-, -S-, or N thereof (except where N is a heteroaryl ring atom) are not bonded to an alkyne carbon of the alkynyl substituent or R group. In addition, where the alkynyl is a substituent of another moiety or an R group of a moiety such as -O, -NHR, -C(O)NRR, and the like, the substitution of the alkynyl R group is such that substitution of the carbon of the alkynyl attached to any O, S, or N of the moiety (except where N is a heteroaryl ring atom) excludes substituents that may result in any O, S, or N of the substituent (except where N is a heteroaryl ring atom) attaching to the alkynyl carbon attached to any O, S, or N of the moiety. An "alkynyl carbon" refers to any carbon within an alkynyl group, whether saturated or part of the carbon-to-carbon triple bond. An "alkyne carbon" refers to a carbon within an alkynyl group that is part of a carbon-to-carbon triple bond.

"Cycloalkyl" refers to saturated or unsaturated, non-aromatic monocyclic, bicyclic or tricyclic carbon ring systems of 3-10, also 3-8, more preferably 3-6, ring members per ring, such as cyclopropyl, cyclopentyl, cyclohexyl, adamantyl, and the like. A "substituted cycloalkyl" is a cycloalkyl that is independently substituted, unless otherwise indicated, with one or more, preferably 1,2, 3, 4, or 5, also 1,2, or 3 substituents, attached anywhere. atom available to produce a stable compound, where the substituents are selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -0^either, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)O°, C(S)O °, -S(O)R°, -S(O)2R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°R° -C(S)NR° R° -S(O)2NHR°, S(O)2NR°R°, -C(NH)NHR°, -C(NH)NRPR°, -NHC(O)R°, -NHC(S)R° , -NR°C(O)R°. -NR°C(S)R°, NHS(O)2R°, -NR^eitherS(O)2R°, -NHC(O)NHR°, -NHC(S)NHR NR°C(O)NH_2j -NR°C(S)NH₂, -NR°C(O)NRR°, NR°C(S)NHR°, -NHC(O)NR°R°, -NHC(S)NR°R°, -NR°C(0)NR^eitherR° -NRO(S)NR°R°, -NHS(O)2NHR°, NR°S(O)2NH2, NR°S(0)2NHR^either, NHS(O)2HR^eitherR°, NR°S(O)₂NR°R° -NHR°, -NR°R°, -R^d, -R^and, -R', and -R⁸.

"Heterocycloalkyl" refers to a non-aromatic saturated or unsaturated cycloalkyl group having 5 to 10 atoms in which 1 to 3 ring carbon atoms are replaced by O, S, or N heteroatoms, and optionally fused with 5-6 ring membered benzo or heteroaryl. "Heterocycloalkyl" is also intended to include oxidized S or N, such as sulfinyl, sulfonyl, and N-oxide of a tertiary ring nitrogen. Heterocycloalkyl is also intended to include compounds in which a ring carbon may be oxo-substituted, ie the ring carbon is a carbonyl group, such as lactones and lactams. The point of attachment of the heterocycloalkyl ring is at a carbon or nitrogen atom so that a stable ring is retained. Examples of heterocycloalkyl groups include, but are not limited to, morpholino, tetrahydrofuranyl, dihydropyridinyl, piperidinyl, pyrrolidinyl, pyrrolidonyl, piperazinyl, dihydrobenzofuryl, and dihydroindolyl. A "substituted heterocycloalkyl" is a heterocycloalkyl that is independently substituted, unless otherwise indicated, with one or more, preferably 1,2, 3, 4, or 5, also 1, 2, or 3 substituents, attached anywhere. atom available to produce a stable compound, where the substituents are selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -0^either, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)O°, C(S)O °, -S(O)R°, -S(O)2R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR °R°, -S(O)2NHR°, S(O)2NR°R°, -C(NH)NHR°, -C(NH)NRR°, -NHC(O)R°, -NHC(S) R°, -NR°C(O)R°, -NRO(S)R°, NHS(O)2R^either, -NR°S(O)2R^either, -NHC(O)NHR°, -NHC(S)NHR°, -NRO(O)NH2, -NR°C(S)NH2, -NR°C(O)NHR^either, -NRO(S)NHR°, -NHC(O)NR°R°, -NHC(S)NR°R⁰, -NR°C(0)NR°R^either, NRO(S)NR°R°, -NHS(O)2NHR°, NR°S(O)₂NH₂,NR^eitherS(O)2NHR°, NHS(O)2HR^eitherR°,NR°S(O)2NR^eitherR°, -NHR°, -NR°R°, -R^d, -R^and, -R f , and -R⁹.

"Aryl" alone or in combination refers to a monocyclic or bicyclic ring system containing aromatic hydrocarbons such as phenyl or naphthyl, which may optionally be fused to a cycloalkyl of preferably 5-7, more preferably 5-6, ring members. . A "substituted aryl" is an aryl that is independently substituted, unless otherwise indicated, with one or more, preferably 1, 2, 3, 4, or 5, also 1, 2, or 3 substituents, attached anywhere. atom available to produce a stable compound, where the substituents are selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, NHC(S)NH₂, NHS(OR)₂NH₂, -C(NH)NH₂, -0°, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)O°, C (S)O°, -S(O)R°,

-SW)₂R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR°R°, -S(O)₂NHR°, -S(0)₂NR^eitherR°,

-C(NH)NHR°, -C(NH)NRPR°, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R°, -NR°C(S)R °, NHS(O)₂R°, -NR°S(O)₂R°, -NHC(O)NHR°, -NHC(S)NHR°, -NR°C(O)NH₂, -NR°C(S)NH₂, -NR°C(O)NHR°, -NR°C(S)NHR°, -NHC(O)NR°R°, NIC(S)NR°R°, -NR°C(O)NR°R⁰, -NR°C(S)NR°R°, -NHS(O)₂NHR°, NR°S(O)₂NH₂, -NR°S(O)₂NHR°, NHS(O)₂NR°R°, -NR°S(O)₂NR°R°, -NHR°, -NR°R°, -R^d, -R^F, and -R⁹.

"Heteroaryl" alone or in combination refers to a monocyclic aromatic ring structure containing 5 or 6 ring atoms, or a bicyclic aromatic group having 8 to 10 atoms, containing one or more, preferably 1-4, more preferably 1 -3, even more preferably 1-2, heteroatoms independently selected from the group consisting of O, S, and N. Heteroaryl is also intended to include S or oxidized N, such as sulfinyl, sulfonyl, and N-oxide of a tertiary ring nitrogen. A carbon or nitrogen atom is the point of attachment of the heteroaryl ring structure such that a stable compound is produced. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyridazinyl, pyrazinyl, quinooxalyl, indolizinyl, benzojthienyl, quinazolinyl, purinyl, indolyl, quinolinyl, pyrimidinyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, thienyl, isoxazolyl, oxathiadiazolyl, isothiazolyl, tetrazolyl, imidazolyl, triazolyl, furanyl, benzofuryl, and indolyl. "Nitrogen-containing heteroaryl" refers to heteroaryl in which any heteroatoms are N. A "substituted heteroaryl" is a heteroaryl that is independently substituted, unless otherwise indicated, with one or more, preferably 1, 2, 3, 4, or 5, also 1, 2, or 3 substituents, attached anywhere. atom available to produce a stable compound, where the substituents are selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, NHC(O)NH₂,

-NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -O°, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)O°, - C(S)O°, -S(O)R°, -S(O)₂R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°11°, -C(S)NR°R°, -S(O)₂NHR°, -S(O)₂NR°R^either, -C(NH)NHR°, -C(NH)NRWR°, -NHC(O)R°, -NHC(S)R°, -NRO(O)R°, -NR°C(S)R° , NHS(OR)₂R°, -NR°S(O)₂R°, -NHC(O)NHR°, -NHC(S)NHR°, -NR°C(O)NH₂,

-NRO(S)NH₂, -NR°C(O)NHR°, -NR°C(S)NHR°, -NHC(O)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR^eitherR°, NR°C(S)NR°R°, -NHS(O)2NHR°, -NR°S(O)2NH2, -NR°S(O)2NHR°, -NHS(O)2NR°R^either, -NR°S(O)2NR°R° -NHR°, -NR°R°, -R^d, -R^and, -R', and -R⁹.

The variables R°, R^p R.^c,R^d,R^and,R^F and R⁹ as used in the description of optional substituents for alkyl, alkenyl, alkenyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are defined as follows:

each R°, R^p, and R° are independently selected from the group consisting of R^d,R^and,R^F, and R⁹, or R^p and R^and combine with the nitrogen to which they are attached to form a 5-7 membered heterocycloalkyl or 5-7 membered nitrogen-containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5-7 membered nitrogen-containing heteroaryl is optionally substituted with one or more, preferably 1,2, 3, 4 or 5, also 1,2, or 3 substituents selected from the group consisting of halogen, NO₂, -CN, -OH, -NH₂, -0°, -SR°,

-NHR°, -NR°R°, -R^x,yR^AND;

each R^d is independently lower alkyl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluorine, -OH, -NH2, - NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S) )NH2, -NHS(O)2NH2, -C(NH)NH2, -OR^what, -MR^what, -OC(O)R^what, OC(S)R^what, -C(O)R^what, -C(S)R^what, -C(O)OR^what, -C(S)OR^what, -S(O)R^what, -S(O)2R^what, -C(O)NHR^what, -C(S)NHR^what, -C(O)NR^whatR.^what, -C(S)NR^whatR.^what, -S(O)2NHR^what, -S(O)2NR^whatR.^what, -C(NH)NHR^what, -C(NH)NR^mR.^m,

-NHC(O)R^what, NHC(S)R^what,NR^whatC(O)R^what, -NR^whatC(O)R^what, -NHS(O)2R^what,NR^whatS(O)2R^what, -NHC(O)NHR^what,

-NHC(S)NHR^what, -NR^whatC(O)NH2, -NR^whatC(S)NH2, -NR^whatC(O)NHR^what, -NR^whatC(S)NHR^what, -NHC(O)NR^whatR.^what, -NHC(S)NR^whatR.^what,NR^whatC(O)NR^whatR.^what, -NR^whatC(S)NR^whatR.^what, -NHS(O)2NHR^what, -NR^whatS(O)2NH₂, -NR^whatS(O)2NHR^what, NHS(O)2NR^whatR.^what, -NR^whatSW)₂NR^whatR.^what, -NHR^what, -NR^whatR.^what, -R^¡, and -R^j;

each R^and is independently lower alkenyl, wherein lower alkenyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluorine, -OH, -NH2, NO2 , -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S) )NH2, -NHS(O)2NH2, -C(NH)NH2, -OR^what, -MR^what, -OC(O)R^what, -OC(S)R^what, -C(O)R^what, -C(S)R^what, -C(O)OR^what, -C(S)OR^what, -S(O)R^what, -S(O)2R^what, -C(O)NHR^what, C(S)NHR^what, -C(O)NR^whatR.^what, -C(S)NR^whatR.^what, -S(O)2NHR^what, -S(O)2NR^whatR.^what, -C(NH)NHR^what, -C(NH)NR^mR.^r,

NHC(O)R^what, NHC(S)R^what, -NR^whatC(O)R^what, -NR^whatC(S)R^what, -NHS(O)2R^what, -NR^whatS(O)2R^what, -NHC(O)NHR^what, -NHC(S)NHR^what, -NR^whatC(O)NH₂,NR^whatC(S)NH2, -NR^whatC(O)NHR^what, -NR^whatC(S)NHR^what, -NHC(O)NR^whatR.^what, -NHC(S)NR^whatR.^what,NR^whatC(O)NR^whatR.^what, -NR^whatC(S)NR^whatR.^what, -NHS(O)2NHR^what, -NR^whatS(O)2NH₂, -NR^whatS(O)2NHR^what, NHS(O)2NR^whatR.^what, -NR^whatSW)₂NR^whatR.^what, NHR^what, -NR^whatR.^what, -R^h, and R^j;

each R^F is independently lower alkynyl, wherein lower alkynyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH2, - NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC( S)NH2, -NHS(O)2NH2, -C(NH)NH2, -OR^what, -MR^what, -OC(O)R^what, -OC(S)R^what, -C(O)R^what, -C(S)R^what, -C(O)OR^what, -C(S)OR^what, -S(O)R^what, -S(O)2R^what, -C(O)NHR^what, C(S)NHR^what, -C(O)NR^whatR.^what, -C(S)NR^whatR.^what, -S(O)2NHR^what, -S(O)2NR^whatR.^what, -C(NH)NHR^what, -C(NH)NR^mR.^r, -NHC(O)R^what, -NHC(S)R^what, -NR^whatC(O)R^what, -NR^whatC(S)R^what, -NHS(O)2R^what,NR^whatS(O)2R^what, -NHC(O)NHR^what, -NHC(S)NHR^what, -NR^whatC(O)NH2, -NR^whatC(S)NH2, -NR^whatC(O)NHR^what,NR^whatC(S)NHR^what, -NHC(O)NR^whatR.^what, -NHC(S)NR^whatR.^what, -NR^whatC(O)NR^whatR.^what, -NR^whatC(S)NR^whatR.^what, -NHS(O)2NHR^what, -NR^whatS(O)2NH₂, -NR^whatS(O)2NHR^what, NHS(O)2NR^whatR.^what, -NR^whatSW)₂NR^whatR.^what, -NHR^what, -NR^whatR.^what, -R^h, and -R';

each R⁹ is independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4, or 5, also 1, 2 or 3 substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2 , -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -OR^what, -MR^what, -OC(O)R^what, -OC(S)R^what, -C(O)R^what, -C(S)R^what, -C(O)OR^what, -C(S)OR^what, -S(O)R^what, -S(O)2R^what, -C(O)NHR^what, -C(S)NHR^what, -C(O)NR^whatR.^what, -C(S)NR^whatR.^what, -S(O)2NHR^what, -S(O)2NR^whatR.^what, -C(NH)NHR^what, -C(NH)NR^mR.^r, -NHC(O)R^what, -NHC(S)R^what, -NR^whatC(O)R^what,NR^whatC(S)R^what, -NHS(O)2R^what, -NR^whatS(O)2R^what, -NHC(O)NHR^what, -NHC(S)NHR^what, -NR^whatC(O)NH2, -NR^whatC(S)NH2, -NR^whatC(O)NHR^what, -NR^whatC(S)NHR^what, NHC(O)NR^whatR.^what, -NHC(S)NR^whatR.^what, -NR^whatC(O)NR^whatR.^what, -NR^whatC(S)NR^whatR.^what, NHS(OR)₂NHR^what, -NR^whatS(O)2NH2, -NR^whatS(O)2NHR^what, -NHS(O)₂NR^whatR.^what, -NR^whatSW)₂NR^whatR.^what, NHR^what, -NR^whatR.^what, -R^h, -R^¡, and -R^j;

where R^what,R^m, and R¹¹ in each case they are independently selected from the group consisting of R^h,R¹, and R' or R^m and R^no combine with the nitrogen to which they are attached to form a 5-7 membered heterocycloalkyl or a 5-7 membered nitrogen-containing heteroaryl, wherein the

5-7 membered or 5-7 membered nitrogen-containing heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, - NO₂, -CN, -OH, -NH₂, OR^OR, -MR^OR, -NHR^L, -NR^ORR.^OR, and R^x yR^and;

where each R^h is independently lower alkyl optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of fluoro, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, - NHS(O)2NH2, -C(NH)NH2, -OR^r, -MR^r, -OC(O)R^r, -OC(S)R^r, -C(O)R^r, -C(S)R^r, -C(O)OR^r, -C(S)OR^r, -S(O)R^r, -S(O)2R^r, -C(O)NHR^r, -C(S)NHR^r, -C(O)NR^rR.^r, -C(S)NR^rR.^r, -S(O)2NHR^r, -S(O)2NR^rR.^r, -C(NH)NHR^r, -C(NH)NR^SR', -NHC(O)R^r, NHC(S)R^r,NR^rC(O)R^r, -NR^rC(S)R^r, -NHS(O)2R^r,NR^rS(O)2R^r, -NHC(O)NHR^r, -NHC(S)NHR^r, -NR^rC(O)NH2, -NR^rC(S)NH2, -NR^rC(O)NHR^r,NR^rC(S)NHR^r, -NHC(O)NR^rR.^r, NHC(S)NR^rR.^r, -NR^rC(O)NR^rR.^r, -NR^rC(S)NR^rR.^r, -NHS(O)2NHR^r, -NR^rS(O)2NH₂, -NR^rS(O)2NHR^r, -NHS(O)2NR^rR.^r, -NR^rSW)₂NR^rR.^r, -NHR^r, -NR^rR.^r, -R^¡,y-Ri;

wherein each R' is independently selected from the group consisting of lower alkenyl and lower alkynyl, wherein lower alkenyl or lower alkynyl are optionally substituted with one or more, preferably 1,2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluorine, -OH, -NH₂, -NO₂, -CN, -C(O)OH, -C(S)OH,

-C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, -NHS(O)₂NH₂, -C(NH)NH₂, -EITHER^r, -MR^r, -OC(O)R^r, -OC(S)R^r', -C(O)R^r, -C(S)R^r, -C(O)OR¹, -C(S)O^r, -S(O)R^r, -S(O)₂R.^r, -C(O)NHR^r, -C(S)NHR^r, -C(O)NR^rR.^r, -C(S)NR^rR.^r, -S(O)2NHR^r, -S(O)2NR^rR.^r, -C(NH)NHR^r, -C(NH)NR^SR\

-NHC(O)R^r, -NHC(S)R^r, -NR^rC(O)R^r, -NR^rC(S)R^r, -NHS(O)2R^r, -NR^rS(O)2R^r, -NHC(O)NHR^r,

-NHC(S)NHR^r, -NR^rC(O)NH2, -NR^rC(S)NH2, -NR^rC(O)NHR^r,NR^rC(S)NHR^r, -NHC(O)NR^rR.^r, -NHC(S)NR^rR.^r, -NR^rC(O)NR^rR.^r, -NR^rC(S)NR^rR.^r, -NHS(O)2NHR^r, -NR^rS(O)2NH₂, -NR^rS(O)2NHR^r, -NHS(O)2NR^rR.^r,-NR^rSW)₂NR^rR.^r, NHR^r, -NR^rR.^r, and -R^j;

where each R¹ is independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4, or 5, also 1, 2 or 3 substituents selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN,

-C(O)OH, -C(S)OH, -C(O)NH₂, -C(S)NH₂, -S(O)₂NH₂, -NHC(O)NH₂, -NHC(S)NH₂, NHS(OR)₂NH₂, -C(NH)NH₂, -OR^r, -MR^r, -OC(O)R^r, -OC(S)R^r, -C(O)R^r, -C(S)R^r, -C(O)OR^r, -C(S)OR^r, -S(O)R^r, -S(O)2R^r, -C(O)NHR^r, -C(S)NHR^r, -C(O)NR^rR.^r, -C(S)NR^rR.^r, -S(O)2NHR', -S(O)₂NR^rR.^r, -C(NH)NHR^r, C(NH)NR^SR', -NHC(O)R^r, -NHC(S)R^r, -NR^rC(O)R^r, -NR^rC(S)R^r, -NHS(O)2R^r, -NR^rS(O)2R^r, -NHC(O)NHR^r, -NHC(S)NHR^r, -NR^rC(O)NH2, -NR^rC(S)NH2, -NR^rC(O)NHR^r, -NR^rC(S)NHR^r, -NHC(O)NR^rR.^r, -NHC(S)NR^rR.^r, -NR^rC(O)NR^rR.^r, -NR^rC(S)NR^rR.^r, -NHS(O)2NHR^r, -NR^rS(O)2NH₂, -NR^rS(O)2NHR^r, -NHS(O)2NR^rR.^r, -NR^rSW)₂NR^rR.^r, -NHR^r, -NR^rR.^r, cycloalkylamino, and -R^x where each R^r,R^yes, and R¹ in each occurrence they are independently selected from the group consisting of lower alkyl, C3.6 alkenyl, C3.s alkenyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3 , 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R^and, fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, di-alkylamino, and cycloalkylamino, provided that, however, any lower alkyl carbon substitution attached to any O, S, or N, of -OR^r, -MR^r, -C(O)OR^r, -C(S)OR^r, -C(O)NHR^r, -C(S)NHR^r, -C(O)NR^rR.^r, -C(S)NR^rR.^r, -S(O)2NHR^r, -S(O)2NR^rR.^r, -C(NH)NHR^r, -NR^rC(O)R^r, -NR^rC(S)R^r, -NR^rSW)₂R.^r, -NHC(O)NHR^r, -NHC(S)NHR^r, -NR^rC(O)NH2, -NR^rC(S)NH2, -NR^rC(O)NHR^r, -NR^rC(S)NHR^r, -NHC(O)NR^rR.^r, -NHC(S)NR^rR.^r, -NR^rC(O)NR^rR.^r, -NR^rC(S)NR^rR.^r, -NHS(O)₂NHR^r,NR^rSW)₂NH₂, -NR^rS(O)2NHR^r, -NHS(O)2NR^rR.^r, -NR^rSW)₂NR^rR.^r, -NHR^r, or -NR^rR.^r is selected from the group consisting of fluorine and -R^and, and wherein C3.6 alkenyl or C3.6 alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1,2, or 3 substituents selected from the group consisting of -R^and, fluoro, lower alkyl, fluoro-substituted lower alkyl, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any C3 substitution.₆ alkenyl or C₃.₆ alkynyl carbon attached to either O, S, or N, of -O^r, -MR^r, -C(O)OR^r, -C(S)OR^r, -C(O)NHR^r, -C(S)NHR^r, -C(O)NR^rR.^r, -C(S)NR^rR.^r, -S(O)2NHR^r, -S(O)2NR^rR.^r, -C(NH)NHR^r, -NR^rC(O)R^r, -NR^rC(S)R^r, -NR^rS(O)2R^r', NHC(O)NHR^r, -NHC(S)NHR^r, -NR^rC(O)NH2, -NR^rC(S)NH_yes, -NR^rC(O)NHR^r,

-NR^rC(S)NHR^r, -NHC(O)NR^rR.^r, -NHC(S)NR^rR.^r, -NR^rC(O)NR^rR.^r, -NR^rC(S)NR^rR.^r, -NHS(O)₂NHR^r,

-NR^rSW)₂NH₂, -NR^rS(O)2NHR^r, -NHS(O)2NR^rR.^r, -NR^rSW)₂NR^rR.^r, -NHR^r, or -NR^rR.^r is selected from the group consisting of fluoro, lower alkyl, fluoro substituted lower alkyl, and -R^and and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4, or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, - NH₂, -NO₂, -CN, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, dialkylamino, and cycloalkylamino, or R^yes and R' combine with the nitrogen to which they are attached form a 5-7 membered heterocycloalkyl or 5-7 membered nitrogen-containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5-7 membered nitrogen-containing heteroaryl members are optionally substituted with one or more, preferably 1, 2, 3, 4, or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -NO₂, -CN, -OH, -NH₂, OR^OR, -MR^OR, -NHR^OR, -NR^ORR.^OR, and R^and;

where each R^or is independently selected from the group consisting of lower alkyl, C3.6 alkenyl, C3.6 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R^and, fluoro, -OH, -NH2, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of lower alkyl carbon attached to the O of -OR^L, S of -SR^L, or N of -NHR^OR is fluorine or -R^and, and wherein C3.6 alkenyl or C3.s alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R^and, fluoro, -OH, -NH2, lower alkyl, fluoro-substituted lower alkyl, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, with the proviso that, however, any substitution of C₃.₆ alkenyl or C₃.₆ alkynyl carbon attached to the O of -OR^OR, S of -SR^OR, or N of -NHR^OR is fluoro, lower alkyl, fluoro substituted lower alkyl, or -R^and and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4, or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, - NH₂, -NO_2j -CN, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, dialkylamino, and cycloalkylamino;

wherein each R* is selected from the group consisting of lower alkyl, lower alkenyl, and lower alkynyl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2,3,4, or 5, also 1,2, or 3 substituents selected from the group consisting of -R^and, fluorine, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, and wherein lower alkenyl or lower alkynyl are optionally substituted with one or more, preferably 1, 2 , 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R^and, fluorine, -OH, NH₂, lower alkyl, fluorine-substituted lower alkyl, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;

where each R^and is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4, or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, -NH₂, -NO₂, -CN, lower alkyl, fluoro-substituted lower alkyl, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, fluoro-substituted lower alkylthio, monoalkylamino, di-alkylamino, and cycloalkylamino.

In some embodiments, all occurrences of optionally substituted lower alkyl, C alkyl₂.₆ optionally substituted, optionally substituted lower alkenyl, or optionally substituted lower alkynyl are optionally substituted with one or more, also groups 1, 2 or 3 or substituents selected from the group consisting of fluorine, NO₂, -CN, -OR^1a, -MR^1a, -NR^1aR.^1a, -OC(O)R^1a, -OC(S)R^1a, -C(O)R^1a, -C(S)R^1a, -C(O)OR^1a, -C(S)OR^1a, -C(O)NR^1aR.^1a, C(S)NR^1aR.^1a, -S(O)2NR^1aR.^1a, -C(NH)NR^1aR.^1a, -NR^1aC(O)R^1a, -NR^1aC(S)R^1a, -NR^1aS(O)2R^1a, -NR^1aC(O)NR^1aR.^1a, -NR^1aC(S)NR^1aR.^1a, -NR^1aS(O)2NR^1aR.^1a, -S(O)R^1a, -S(O)2R^1a, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also groups 1, 2 or 3 or substituents selected from the group consisting of halogen, -NO₂, -CN, -OR^1a, -MR^1a, -NR^1aR.^1a, -OC(O)R^1a, -OC(S)R^1a, -C(O)R^1a, -C(S)R^1a, -C(O)OR^1a, -C(S)OR^1a, -C(O)NR^1aR.^1a, -C(S)NR^1aR.^1a, -S(O)₂NR^1aR.^1a,

-C(NH)NR^1aR.^1a, -NR^1aC(O)R^1a, -NR^1aC(S)R^1a, -NR^1aS(O)2R^1a,NR^1aC(O)NR^1aR.^1a, -NR^1aC(S)NR^1aR.^1a, -NR^1aS(O)2NR^1aR.^1a, -S(O)R^1a, -S(O)2R^1a, -R^{1 B}, and lower alkyl optionally substituted with one or more, also groups 1,2, or 3 or substituents selected from the group consisting of fluorine, -OH, -NH2, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio with fluorine, mono-alkylamino, di-alkylamino, and -R^{1 B}, and all occurrences of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted 5-7 membered heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl are optionally substituted with one or more , also groups 1, 2, or 3 or substituents selected from the group consisting of halogen, -NO₂ -CN, -OR^1a, -MR^1a,

-NR^1aR.^1a, -OC(O)R^1a, -OC(S)R^1a, -C(O)R^1a, -C(S)R^1a, -C(O)OR^1a, -C(S)OR^1a, -C(O)NR^1aR.^1a, -C(S)NR^1aR.^1a, -S(O)2NR^1aR.^1a, -C(NH)NR^1aR.^1a, -NR^1aC(O)R^1a, -NR^1aC(S)R^1a, -NR^1aS(O)2R^1a, -NR^1aC(O)NR^1aR.^1a, -NR^1aC(S)NR^1aR.^1a, -NR^1aS(O)2NR^1aR.^1a, -S(O)R^1a, -S(O)2R^1a, -R^{1 B}, and lower alkyl optionally substituted with one or more, also groups 1, 2, or 3 or substituents selected from the group consisting of fluoro, -OH, NH2, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluoro, mono-alkylamino, di-alkylamino, and -R^{1 B}, where R^1a is selected from the group consisting of hydrogen, provided, however, that hydrogen does not bond to any of the C(S), C(O), S(O), or S(O)2 of -OC( O)R^1a, -OC(S)R^1a,

-C(O)R^1a, -C(S)R^1a, -NR^1aC(O)R^1a, -NR^1aC(S)R^1a, -NR^1aS(O)2R^1a, -S(O)R^1a, or -S(O)2R^1a, -R^1a, and lower alkyl optionally substituted with one or more, also groups 1, 2, or 3 or substituents selected from the group consisting of fluorine, -OH, -NH2, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio with fluorine, mono-alkylamino, di-alkylamino, and -R^{1 B}, provided, however, that any substitution of the alkyl carbon attached to O, S, or N of -OR^1a, -MR^1a,NR^1aR.^1a, -C(O)OR^1a, -C(S)OR^1a, -C(O)NR^1aR.^1a, -C(S)NR^1aR.^1a, -S(O)2NR^1aR.^1a, -C(NH)NR^1aR.^1a, -NR^1aC(O)R^1a, -NR^1aC(S)R^1a, -NR^1aS(O)2R^1a, -NR^1aC(O)NR^1aR.^1a, -NR^1aC(S)NR^1aR.^1a, or -NR^1aS(O)2NR^1aR.^1a, is fluorine or -R^{1 B}, and where -R^{1 B} is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl aryl and heteroaryl are optionally substituted with one or more, also groups 1, 2, or 3 or substituents selected from the group consisting of halogen, - CN, -OH, -NH₂, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, fluorine-substituted lower alkylthio, mono-alkylamino, dialkylamino, and cycloalkylamino.

In some embodiments, all occurrences of optionally substituted lower alkyl, C alkyl₂.₆ optionally substituted, optionally substituted lower alkenyl, or optionally substituted lower alkynyl are optionally substituted with one or more, also groups 1, 2, or 3 or substituents selected from the group consisting of fluoro, -CN, -OR^1a, -MR^1a, -NR^1aR.^1a, -C(O)R^1a, -C(S)R^1a, -C(O)OR^1a, -C(O)NR^1aR.^1a, -C(S)NR^1aR.^1a, -S(O)₂NR^1aR.^1a,

-NR^1aC(O)R^1a,NR^1aC(S)R^1a,NR^1aS(O)2R^1a, -S(O)R^1a, -S(O)2R^1a, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl aryl and heteroaryl are optionally substituted with one or more, also groups 1, 2, or 3 or substituents selected from the group consisting of halogen, CN, -OR^1a, -MR^1a,NR^1aR.^1a, -C(O)R^1a, -C(S)R^1a, -C(O)OR^1a,

-C(O)NR^1aR.^1a, -C(S)NR^1aR.^1a, -S(O)2NR^1aR.^1a, -NR^1aC(O)R^1a,NR^1aC(S)R^1a, -NR^1aS(O)2R^1a, -S(O)R^1a, -S(O)2R^1a, -R^{1 B}, and lower alkyl optionally substituted with one or more, also groups 1, 2, or 3 or substituents selected from the group consisting of fluorine, -OH, -NH2, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio with fluorine, mono-alkylamino, dialkylamino, and -R^{1 B}, and all occurrences of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted 5-7 membered heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, or optionally substituted 5- or 7-membered nitrogen-containing heteroaryl are optionally substituted with one or more , also groups 1,2, or 3 or substituents selected from the group consisting of halogen, -CN, -OR^1a, -MR^1a, -NR^1aR.^1a, C(O)R^1a, -C(S)R^1a, -C(O)OR^1a, -C(O)NR^1aR.^1a,

-C(S)NR^1aR.^1a, -S(O)2NR^1aR.^1a, -NR^1aC(O)R^1a, -NR^1aC(S)R^1a, -NR^1aS(O)2R^1a, -S(O)R^1a, -S(O)2R^1a, -R^{1 B}, and lower alkyl optionally substituted with one or more, also groups 1, 2, or 3 or substituents selected from the group consisting of fluorine, -OH, -NH2, lower alkoxy, fluorine-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio with fluorine, mono-alkylamino, di-alkylamino, and where R^1a is selected from the group consisting of hydrogen, provided, however, that hydrogen does not bond to any of C(S), C(O), S(O), or S(O)₂ from -C(O)R^1a,

-C(S)R^1a, -NR^1aC(O)R^1a, -NR^1aC(S)R^1a, -NR^1aS(O)2R^1a, -S(O)R^1a, or -S(O)2R^1a, -R^{1 B}, and lower alkyl optionally substituted with one or more, also groups 1, 2, or 3 or substituents selected from the group consisting of fluoro, -OH, NH2, lower alkoxy, fluoro-substituted lower alkoxy, lower alkylthio, substituted lower alkylthio fluoro, mono-alkylamino, di-alkylamino, and -R^{1 B}, provided, however, that any substitution of the alkyl carbon attached to O, S, or N of -OR^1a,-MR^1a, -NR^1aR.^1a, -C(O)OR^1a, -C(O)NR^1aR.^1a, -C(S)NR^1aR.^1a, -S(O)2NR^1aR.^1a, -NR^1aC(O)R^1a, -NR^1aC(S)R^1a, or -NR^1aS(O)2R^1a, is fluorine or -R^{1 B}, and where -R^{1 B} is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also groups 1, 2, or 3 or substituents selected from the group consisting of halogen, -CN, -OH, -NH2, lower alkoxy, fluorine substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, mono-alkylamino, dialkylamino, and cycloalkylamino.

"Lower alkoxy" denotes the -OR group^z, where R^z is lower alkyl, "substituted lower alkoxy" denotes lower alkoxy in which R^z is lower alkyl substituted with one or more substituents as indicated herein, for example, in the description of compounds of Formula III, including descriptions of cycloheteroalkyl, aryl, and heteroaryl substituted cycloalkyl, attached at any available atom to produce a compound stable. Preferably, the lower alkoxy substitution is with 1, 2, 3, 4, or 5 substituents, also 1, 2, or 3 substituents. For example "fluoro-substituted lower alkoxy" denotes lower alkoxy in which the lower alkyl is substituted with one or more fluorine atoms, where preferably the lower alkoxy is substituted with 1,2, 3, 4 or 5 fluorine atoms, also 1 , 2, or 3 fluorine atoms. While substitutions on the alkoxy are understood to attach to any available atom to produce a stable compound, alkoxy substitution is such that O, S, or N (except where N is a ring atom), attach to the alkyl carbon. attached to alkoxy O. In addition, where alkoxy is described as a substituent of another moiety, the alkoxy oxygen is not attached to a carbon atom that is attached to an O, S, or N of the other moiety (except where N is a ring atom). of heteroaryl), or to an alkene or alkyne carbon of the other moiety.

“Lower alkyl” denotes the -SR group^oh, where R^oh is lower alkyl, "substituted lower alkylthio" denotes lower alkylthio which R^oh is lower alkyl substituted with one or more substituents as indicated herein, for example, in the description of compounds of Formula III, including descriptions of cycloheteroalkyl, aryl, and heteroaryl substituted cycloalkyl, attached at any available atom to produce a compound stable. Preferably, the substitution of lower alkylthio is with 1, 2, 3, 4, or 5 substituents, also 1, 2, or 3 substituents. For example "fluoro-substituted lower alkylthio" denotes lower alkylthio in which the lower alkyl is substituted with one or more fluorine atoms, where preferably the lower alkylthio is substituted with 1, 2, 3, 4 or 5 fluorine atoms, also 1 , 2, or 3 fluorine atoms. While alkylthio substitutions are understood to bind on any available atom to produce a stable compound, alkylthio substitution is such that O, S, or N (except where N is a heteroaryl ring atom), do not bind. to the alkyl carbon attached to the alkyl S. In addition, where alkylthio is described as a substituent of another moiety, the alkylthio sulfur is not attached to a carbon atom that is attached to an O, S, or N of the moiety (except where N is a heteroaryl ring atom), or on an alkene or alkene carbon of the other portion.

"Amino" or "amine" denotes the group -NH₂. "Mono-alkylamino" denotes the group -NHR^baby where R^baby is lower alkyl. "Di-alkylamino" denotes the group NR^babyR.^DC, where R^baby and R^DC they are independently lower alkyl. "Cycloalkylamino" denotes the group -NR^ddR.^ee, where R^dd and R^ee combine with nitrogen to form a 5-7 membered heterocycloalkyl where the heterocycloalkyl may contain an additional intra-ring heteroatom, such as O, N, or S, and may also be further substituted with lower alkyl. Examples of 5-7 membered heterocycloalkyl include, but are not limited to, piperidine, piperazine, 4-methylpiperazine, morpholine, and thiomorpholine. While it is understood that when mono-alkylamino, dialkylamino, or cycloalkylamino are substituted on other moieties that attach to any available atom to produce a stable compound, the nitrogen of mono-alkylamino, di-alkylamino, or cycloalkylamino as substituents does not attach. to a carbon atom that is attached to an O, S, or N portion of the other portion.

A "nitrogen protecting group" is a chemical group covalently attached to a nitrogen atom of a compound that is used to protect nitrogen from the reaction in the course of a synthetic step. The nitrogen protecting group can be added to a compound and removed at a subsequent step by methods known to those of skill in the art. Nitrogen protecting groups include, without limitation, carbamate, amide, N-sulfonyl derivatives, groups of the Formula -C(O)O, where R is, for example, methyl, ethyl, t-butyl, benzyl, phenylethyl, CH₂=CHCH₂-, and the like, groups of the formula -C(O)R¹, where R¹ is, for example, methyl, phenyl, trifluoromethyl, and the like, groups of the formula -SO2R¹¹, where R¹¹ is, for example, tolyl, phenyl, trifluoromethyl, 2,2,5,7,8-pentamethylchroman-6-yl, 2,3,6-trimethyl-4-methoxyphenyl, and the like, and silanyl containing groups such as 2 -trimethylsilylethoxymethyl, t-butyldimethylsilyl, triisopropylsilyl, and the like. Other suitable nitrogen protecting groups can be found in texts such as TW Greene &amp; PGM Wuts, Protective Groups in Organic Synthesis, John Wiley &amp; Sons, 1991.

As used herein, the term "composition" refers to a formulation suitable for administration to an animal subject intended for therapeutic purposes that contains at least one pharmaceutically active compound and at least one pharmaceutically acceptable carrier or excipient.

The term "pharmaceutically acceptable" indicates that the indicated material does not have properties that should prompt a medical or veterinary professional to avoid administration of the material to a subject, taking into consideration the disease or condition to be treated and the respective route of administration. For example, such material is commonly required to be essentially sterile, eg, for injections.

In the present context, the term "therapeutically effective" or "effective amount" indicates that the materials or amount of material is effective in preventing, alleviating, or ameliorating one or more symptoms of a disease or condition, and/or in prolonging the survival of the patient. subject in question.

As used herein, the term "modulate" or "modulates" refers to an effect that alters a biological activity, especially a biological activity associated with a particular biomolecule such as a protein kinase. For example, an agonist or antagonist of a particular biomolecule modulates the activity of the biomolecule, eg, an enzyme, by either increasing (eg, agonist, activator), or decreasing (eg, antagonist, inhibitor) the activity of the biomolecule. , such as an enzyme. Such activity is typically indicated in terms of an inhibitory concentration (IC₅₀) or a concentration (EC₅₀) of the compound by an inhibitor or activator, respectively, with respect to, for example, an enzyme.

In the context of the use, testing, or selection of compounds that are or can be modulated, the term "contact" means that the compound(s) may be due to being in sufficient proximity to a particular molecule, complex, cell, tissue, organism, or other specific material that binds interactions and/or chemical reaction between the compound and other specific material can occur.

The present invention relates to the compounds of Formula III and all subgeneric Formulas thereof, including the compounds of Formula IIIa-m and all subgeneric Formulas thereof, including all salts, prodrugs, tautomers and isomers, which are modulators of protein kinases, for example without limitation, the compounds are modulators of at least one of the kinases selected from the group consisting of B-Raf, c-Raf-1, Fms, Jnk1, Jnk2,

Jnk3, Kit, and any mutations of these kinases, and the use of such compounds in the treatment of diseases or conditions.

II. Target kinases and indications of the invention

Protein kinases play a key role in the propagation of biochemical signals in various biological pathways. More than 500 kinases have been described, and specific kinases have been implicated in a wide range of diseases or conditions including, for example without limitation, cancer, cardiovascular disease, inflammatory disease, neurological disease, and other diseases and conditions. As such, kinases represent important checkpoints for small molecule therapeutic intervention. Target specific protein kinases are contemplated by the present invention as follows:

B-Raf: Target B-Raf kinase (ie, muño vraf sarcoma viral oncogene B1 homologue) is an 84.4 kDa serine/threonine kinase encoded by chromosome 7q34 (symbol: BRAF). The mature protein comprises the RBD (ie, Ras-binding domain), C1 (ie, protein kinase C conserved region 1) and STK (ie, serine/threonine kinase) domains. Target B-Raf kinase includes any mutations of B-Raf, such as the Va1<600> to Glu<600> (V600E) mutant.

Indications for modulation of B-Raf activity, including B-Raf V600E activity, for the treatment of disease states including, but not limited to, neurological diseases such as ischemic stroke, multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson's disease; neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, carcinoma (for example lung, breast, pancreatic, renal), lymphoma (for example histiocytic lymphoma) and thyroid, lung cancer (for example cancer small cell lung), liver, breast, ovarian and colon, neurofibromatosis, myelodysplastic syndrome, leukemia, tumor angiogenesis; pain of neuropathic or inflammatory origin, including acute pain, chronic pain, and migraine; cardiovascular diseases including heart failure, cardiac hypertrophy, thrombosis (eg thrombotic microangiopathy syndromes), atherosclerosis, reperfusion injury; inflammation including, but not limited to, psoriasis, polycystic kidney disease (PKD), arthritis and autoimmune diseases and conditions, osteoarthritis, endometriosis, scarring, vascular restenosis, fibrotic disorders, rheumatoid arthritis, inflammatory bowel disease (IBD); immunodeficiency diseases, organ transplant rejection, graft-versus-host disease; kidney or prosthetic diseases including diabetic nephropathy, nephrosclerosis, glomerulonephritis, prostatic hyperplasia; metabolic disorders, obesity; infection, including but not limited to Helicobacter pylori and influenza viruses, fever, sepsis; lung diseases including chronic obstructive pulmonary disease (COPD) and acute respiratory distress syndrome (ARDS); developmental genetic diseases such as Noonan syndrome, Costello syndrome, (faciocutaneous-skeletal syndrome), leopard syndrome, cardio-faciocutaneous (CFC) syndrome, and neural crest syndrome, abnormalities causing cardiovascular, skeletal, intestinal, skin, hair diseases and endocrine.

c-Raf-1: Target Kinase c-Raf-1 (ie, vRaf murine sarcoma viral oncogene homologue 1) is a 73.0 kDa STK encoded by chromosome 3p25 (symbol: RAF1). c-Raf-1 can be targeted to mitochondria by BCL2 (ie, the B cell leukemia 2 oncogene) which is a regulator of apoptotic cell death. Active c-Raf-1 enhances resistance to BCL2-mediated apoptosis, and cRaf-1 phosphorylates BAD (i.e., BCL-binding protein).₂). c-Raf-1 is implicated in carcinomas, including colorectal, ovarian, lung, and renal cell carcinoma. C-Raf-1 is also implicated as an important mediator of tumor anglogenesis (Hood et al., 2002, Science 296, 2404). C-Raf-1 inhibitors may also be useful for the treatment of acute myeloid leukemia and myelodysplastic syndromes (Crump, Curr Pharm Des 2002, 8(25):2243-8). Raf-1 activators may be useful as a treatment for neuroendocrine tumors, such as medullary thyroid cancer, carcinoid, small cell lung cancer, and pheochromocytoma (Kunnimalaiyaan et al., Anticancer Drugs 2006,17(2):139-42).

Fms: The target Fms kinase (ie, feline McDonough sarcoma) is a gene family member originally isolated from the Susan McDonough strain of feline sarcoma virus. Fms is a 108.0 kDa transmembrane tyrosine kinase encoded by chromosome 5q33.2-q33.3 (symbol: CSF1R). The structure of the transmembrane Fms receptor comprises two Ig-like domains, an IgC2-like domain, two additional Ig-like domains, a TM domain, and the TK domain.

The presence of c-fms has been associated with several different types of diseases. Fms has been associated with immune disorders, including rheumatoid arthritis, systemic lupus erythematosus (SLE), Wegener's granulomatosis, and transplant rejection, inflammatory diseases including Chronic Obstructive Pulmonary Disease (COPD), emphysema, and atherosclerosis, metabolic disorders, including resistance to insulin, hyperglycemia, and lipolysis, disorders of bone structure or mineralization, including osteoporosis, increased risk of fracture, hypercalcemia, and bone metastases, kidney diseases, including nephritis (for example glomerulonephritis, interstitial nephritis, lupus nephritis), tubular necrosis, renal complications associated with diabetes, and hypertrophy and cancers, including multiple myeloma, acute myeloid leukemia, chronic myeloid leukemia (CML ), breast cancer, and ovarian cancer.

Jnk1: Jnk1 target (ie, c-Jun kinase 1) is a 48.3 kDa serine/threonine kinase encoded by chromosome 10q11.22 (symbol: MAPK8), also known as mitogen-activated protein kinase 8. Jnk1 is a mitogen-activated protein kinase (ie, MAPK) which forms a family of signal-threonine protein kinases that participate in a major signaling system by which cells convert extracellular stimulation into extracellular responses. Jnk1 is implicated in type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity, and hepatic steatosis.

Jnk2: The target Jnk2 kinase (ie, c-Jun kinase 2) is a 48.1 kDa serine/threonine kinase encoded by chromosome 5q35 (symbol: MAPK9). Jnk2 is implicated in atherosclerosis.

Jnk3: The target Jnk3 kinase (ie, c-Jun kinase 3) is a 52.6 kDa serine/threonine kinase encoded by chromosome 4q21-q22 (symbol: MAPK10). Jnk3 inhibitors are potential therapeutic agents for the treatment of inflammatory diseases including autoimmune diseases such as rheumatoid arthritis, inflammatory bowel syndrome, Crohn's disease, systemic lupus erythematosus, Sjogren's syndrome, psoriasis and multiple sclerosis, inflammatory diseases of the respiratory tract. such as asthma, allergy, pulmonary fibrosis, and chronic obstructive pulmonary disease, and inflammation in other organs, such as CNS inflammation, pancreatitis, nephritis, and hepatitis; neurological diseases such as stroke, cerebrovascular ischemia, and neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, and Huntington's disease; and neoplastic diseases such as prostate tumors and myeloid leukemia.

Kit: The target Kit kinase (ie, feline Hardy-Zuckerman sarcoma viral oncogene 4) is a 109.9 kDa transmembrane tyrosine kinase encoded by chromosome 4q12 (symbol: KIT). Receptor protein tyrosine kinases (RPTKs) regulate key signal transduction cascades that control cell growth and proliferation. The Stem Cell Factor (SCF) Receptor Kit is a type III transmembrane RPTK that includes five extracellular immunoglobulin (IG) domains, a single transmembrane domain, and a split cytoplasmic kinase domain separated by a kinase insert segment. Kit plays an important role in the development of melanocytes, mast cells, germ cells and hematopoietic cells.

Aberrant expression and/or activation of Kit has been implicated in a variety of disease states. Kit has been associated with mast cell tumors, small cell lung cancer, testicular cancer, gastrointestinal stromal tumors (GISTs), glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female genital tract, sarcomas of neuroectodermal origin, colorectal carcinoma, carcinoma in situ, cell neoplasia. Schwann syndrome associated with neurofibromatosis, acute myelocytic leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis, melanoma, and canine mast cell tumors, and inflammatory diseases, including asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, inflammatory bowel syndrome, transplant rejection, and hypereosinophilia.

III. Kinase Activity Assays

A number of different assays for kinase activity can be used to test for active modulators and/or determine the specificity of a modulator for a particular kinase or group of kinases. In addition to the tests mentioned in the Examples below, one of ordinary skill in the art will be aware of other tests that can be used and will be able to modify a test for a particular application. For example, numerous articles concerning kinases describe assays that can be used. When testing for kinase activity, preferred compounds of the present invention (i.e., compounds of formula III) will have an IC₅₀ or CE₅₀ less than 10 μΜ, also less than 1 μΜ, also less than 100 nM, also less than 10 nM or less than 1 nM.

IV. Organic Synthetic Techniques

A wide variety of organic synthetic techniques exist in the art for preparing compounds of Formula III. Many of these organic scientific methods are described in detail in standard reference sources used by those skilled in the art. An example of such a reference is March 1994, Advanced Organic Chemistry; Reactions, Mechanisms and Structure, New York, McGraw Hill.

V. Alternative Forms or Derivatives of the Compounds

The compounds contemplated herein are described with reference to generic formulas and specific compounds. Furthermore, the compounds of the invention may exist in a number of different forms or derivatives, all within the scope of the present invention. These include, for example, tautomers, stereoisomers, racemic mixtures, regioisomers, salts, prodrugs (eg, carboxylic acid esters), solvated forms, different crystal forms or polymorphs, and active metabolites.

(a) Tautomers, Stereoisomers, Regioisomers and Solvated Forms.

It should be understood that some compounds may exhibit tautomerism. In such cases, the formulas provided herein expressly represent only one of the possible tautomeric forms. Therefore it is to be understood that the formulas provided herein are intended to represent any tautomeric form of the depicted compounds and are not limited merely to the specific tautomeric form represented by the formula drawings.

Also, some of the compounds according to the present invention may exist as stereoisomers, ie they have the same atomic connectivity of covalently bonded atoms that still differ in the spatial orientation of the atoms. For example, the compounds may be optical stereoisomers, which contain one or more chiral centers, and therefore may exist in two or more stereoisomeric forms (eg, enantiomeric or diastereomers). Thus, such compounds may occur as a single stereoisomer (ie, essentially free of other stereoisomers), racemates, and/or mixtures of enantiomers and/or diastereomers. As another example, stereoisomers include geometric isomers, such as c/s or trans orientation of substituents on adjacent double bond carbons. All single stereoisomers, racemates, and mixtures thereof are intended to be within the scope of the present invention. Unless otherwise specified, all stereoisomeric forms are included within the formulas provided herein.

In some embodiments, a chiral compound of the present invention is in a form containing at least 80% of a single isomer (60% enantiomeric excess ("ee") or diastereomeric excess ("de")), or by at least 85% (70% ee or de), 90% (80% ee or de), 95% (90% ee or de), 97.5% (95% ee or de), or 99% ( 98% ee or de). As generally understood by those skilled in the art, an optically pure compound having a chiral center is one that consists essentially of one of two possible enantiomers (i.e., is enantiomerically pure), and an optically pure compound having more than one chiral center is one that is diastereomerically pure and enantiomerically pure. In some embodiments, the compound is in optically pure form.

For compounds in which the synthesis involves the addition of a single group on a double bond, particularly a carbon-carbon double bond, the addition can occur on either of the two double-bonded atoms. For such compounds, the present invention includes both regioisomers.

Additionally, the formulas are intended to cover solvated as well as unsolved forms of the identified structures. For example, the indicated structures include hydrated and non-hydrated forms. Other examples of solvates include the structures in combination with a suitable solvent such as isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, or ethanolamine.

(b) Prodrugs and Metabolites

In addition to the present formulas and compounds described herein, the invention also includes prodrugs (generally pharmaceutically acceptable prodrugs), active metabolic derivatives (active metabolites), and their pharmaceutically acceptable salts.

Prodrugs are compounds or pharmaceutically acceptable salts thereof which, when metabolized under physiological conditions or when converted by solvolysis, yield the desired active compound. Prodrugs include, without limitation, esters, amides, carbamates, carbonates, ureides, solvates, or hydrates of the active compound. Typically, the prodrug is inactive, or less active than the active compound, but may provide one or more advantageous handling, administration, and/or metabolic properties. For example, some prodrugs are esters of the active compound; in the course of metabolism, the ester group is cleaved to supply the active drug. Also, some prodrugs are enzymatically activated to deliver the active compound, or a compound which, with subsequent chemical reaction, yields the active compound.

In this context, a common example of a prodrug is an alkyl ester of a carboxylic acid. With regard to compounds of Formula III, additional examples include, without limitation, an amide or carbamate derivative at the 1-position nitrogen of the azaindole nucleus.

As described in The Practice of Medicinal Chemistry, Ch. 31-32 (Ed. Wermuth, Academic Press, San Diego, CA, 2001), prodrugs can be conceptually divided into two non-exclusive categories, bioprecursor prodrugs and carrier prodrugs. Generally, bioprecursor prodrugs are compounds that are inactive or have low activity compared to the corresponding active drug compound, contain one or more protecting groups, and are converted to an active form by metabolism or solvolysis. Both the active drug form and any metabolic products released should have acceptably low toxicity. Typically, the formation of the active drug compound involves a metabolic process or reaction that is one of the following types:

Oxidative reactions: Oxidative reactions are exemplified without limitation to reactions such as oxidation of alcohol, carbonyl and acid functionalities, hydroxylation of aliphatic carbons, hydroxylation of alicyclic carbon atoms, oxidation of aromatic carbon atoms, oxidation of carbon-to-carbon double bonds, oxidation of functional groups containing nitrogen, oxidation of silica, phosphorus, arsenic and sulfur, oxidative N-dealkylation, O and S oxidative dealkylated, oxidative deamination as well as other oxidative reactions.

Reductive Reactions: Reductive reactions are exemplified without limitation to reactions such as reduction of carbonyl functionalities, reduction of alcohol functionalities and carbon-carbon double bonds, reduction of nitrogen-containing functional groups, and other reduction reactions.

Reaction without change in oxidation state: Reactions without change in oxidation state are exemplified without limitation to reactions such as hydrolysis of esters and ethers, hydrolytic cleavage of carbon-nitrogen single bonds, hydrolytic cleavage of non-aromatic heterocycles, hydration and dehydration at multiple bonds, new atomic bondings that They result from dehydration reactions, hydrolytic dehalogenation, hydrogen halide molecule removal, and other such reactions.

Carrier prodrugs are drug compounds that contain a transport moiety, eg, that enhances uptake and/or localized delivery to a site(s) of action. Desirably for such a carrier prodrug, the linkage between the drug moiety and the transport moiety is a covalent bond, the prodrug is inactive or less active than the drug compound, the prodrug and any transport moiety released are acceptably non-toxic . For prodrugs where the transport moiety is intended to enhance uptake, typically the release of the transport moiety should be rapid. In other cases, it is desirable to use a moiety that provides low release, for example, certain polymers or other moieties, such as cyclodextrins (see, for example, Cheng et al., US Patent Publication No. 20040077595, Application No. 10/ 656,838, incorporated herein by reference). Such prodrug carriers are often advantageous for orally administering drugs. Carrier prodrugs can, for example, be used to improve one or more of the following properties: increased lipophilicity, increased duration of pharmacological effects, increased site specificity, decreased toxicity and adverse reactions, and/or improvement in drug formulation. (eg stability, solubility in water, suppression of an undesirable organoleptic or physiochemical property). For example, lipophilicity can be increased by esterification of hydroxyl groups with lipophilic carboxylic acids, or of carboxylic acid groups with alcohols, eg, aliphatic alcohols. Wermuth, supra.

Prodrugs may proceed from prodrug to active form in a single step or may have one or more intermediate forms which may themselves have activity or may be inactivated.

Metabolites, eg, active metabolites overlap with prodrugs as described above, eg, bioprecursor prodrugs. Thus, such metabolites are pharmacologically active compounds or compounds that are further metabolized to pharmacologically active compounds that are derivatives resulting from metabolic processes in the body of a subject. Of these, the active metabolites are such pharmacologically active derivative compounds. For prodrugs, the prodrug compound is generally inactive or less active than the metabolic product. For active metabolites, the parent compound can be an active compound or it can be an inactive prodrug.

Active prodrugs and metabolites can be identified using routine techniques known in the art. See, for example, Bertolini et al, 1997, J Med Chem 40:2011-2016; Shan et al., J Pharm Sci 86:756-757; Bagshawe, 1995, Drug Dev fies 34:220-230; Wermuth, supra.

(c) Pharmaceutically acceptable salts

The compounds may be formulated as, or in the form of pharmaceutically acceptable salts. The pharmaceutically acceptable salts are non-toxic in the amounts and concentrations in which they are administered. Preparation in such salts can facilitate pharmacological use by altering the physical characteristics of a compound without preventing it from exerting its physiological effect. Useful alterations in physical properties include lowering the melting point to facilitate transmucosal administration and increasing solubility to facilitate administration at higher drug concentrations.

Pharmaceutically acceptable salts include acid addition salts such as those containing sulfate, chloride, hydrochloride, fumarate, maleate, phosphate, sulfamate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, cyclohexylsulfamate, and quinate. Pharmaceutically acceptable salts can be obtained from acids such as hydrochloric acid, maleic acid, sulfuric acid, phosphoric acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, ptoluenesulfonic, cyclohexylsulfamidic acid, fumaric acid, and chemical acid.

Pharmaceutically acceptable salts also include basic addition salts such as those containing benzathine, chloroprocaine, choline, diethanolamine, ethanolamine, t-butylamine, ethylenediamine, meglumine, procaine, aluminum, calcium, lithium, magnesium, potassium, sodium, ammonium, alkylamine. and zinc, when acidic functional groups, such as carboxylic acid or phenol are present. For example, see Femington's Pharmaceutical Sciences, 19^th ed., Mack Publishing Co., Easton, PA, Vol. 2, p. 1457, 1995. Such salts can be prepared using the appropriate corresponding bases.

Pharmaceutically acceptable salts can be prepared by standard techniques. For example, the free base form of a compound can be dissolved in a suitable solvent, such as an aqueous or aqueous-alcohol solution containing the appropriate acid, and then isolated by evaporating the solution. In another example, a salt can be prepared by reacting the free base and acid in an organic solvent.

Thus, for example, if the particular compound is a base, the desired pharmaceutically acceptable salt may be prepared by any suitable method available in the art, for example, treatment of the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, or with an organic acid such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, purivic acid, oxalic acid, glycolic acid, salicylic acid, a pyranosidylic acid, such as glucuronic acid or galacturonic acid, an alpha-hydroxy acid, such as citric acid or tartaric acid, an amino acid, such as aspartic acid or glutamic acid, a aromatic acid, such as benzoic acid or cinnamic acid, a sultanic acid, such as p-toluenesulfonic or ethanesulfonic acid, or the like.

Similarly, if the particular compound is an acid, the desired pharmaceutically acceptable salt may be prepared by any suitable method, for example, treatment of the free acid with an inorganic or organic base, such as an amine (primary, secondary or tertiary). a metal hydroxide in alkali or metal hydroxide in alkaline earth, or the like. Illustrative examples of suitable salts include organic salts derived from amino acids, such as L-glycine, L-lysine, and L-arginine, ammonia, primary, secondary, and tertiary amines, and cyclic amines, such as hydroxyethylpyrrolidine, piperidine, morpholine, and piperazine, and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum and lithium. Additional examples of pharmaceutically acceptable salts of the compounds of Formula I include, without limitation, the mono-sodium and bis-potassium salts thereof.

The pharmaceutically acceptable salt of the different compounds can be presented as a complex. Examples of complexes include 8-chlorotheophylline complex (analogous to, for example, dimenhydrinate:diphenhydramine 8-chlorotheophylline complex 1:1); Dramamine) and various cyclodextrin inclusion complexes.

Unless otherwise specified, the specification of a compound herein includes pharmaceutically acceptable salts of such compound.

(d) Polymorphic forms

In the case of agents that are solids, it should be understood by those skilled in the art that the compounds and salts may exist in different crystalline or polymorphic forms, all of which are intended to be within the scope of the present invention and specified formulas.

SAW. Administration

The methods and compounds will typically be used in therapy for human subjects, however, they may also be used to treat similar or identical indications in other animal subjects. In this context, the terms "subject", "animal subject", and the like refer to human and non-human vertebrates, eg, mammals, such as non-human primates, sporting and commercial animals, eg, equine, bovine, swine, rodents, and pets, eg, canines and felines.

Suitable dosage forms, in part, depend on the use of the route of administration, eg, oral, transdermal, transmucosal, by inhalation or by injection (parenteral). Such dosage forms should allow the compound to reach the target cells. Other factors are well known in the art, and include considerations such as toxicity and dosage forms that slow the compound or composition to exert its effects. Techniques and formulations can generally be found in The Science and Practice of Pharmacy, 21^st edition, Lippincott, Williams and Wilkins, Philadelphia, PA, 2005 (hereby incorporated by reference herein).

The compounds of the present invention, ie Formula III, may be formulated as pharmaceutically acceptable salts.

Carriers or excipients can be used to produce compositions. Carriers or excipients may be chosen to facilitate administration of the compound. Examples of carriers include calcium carbonate, calcium phosphate, various sugars such as lactose, glucose, or sucrose or starch types, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols, and physiologically compatible solvents. Examples of physiologically compatible solvents include sterile solutions of water for injection (WFI), saline, and dextrose.

The compounds can be administered by different routes including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, transmucosal, rectally, transdermal, or by inhalation. Oral administration is preferred. For oral administration, for example, the compounds can be formulated in conventional oral dosage forms such as capsules, tablets, and liquid preparations such as syrups, elixirs, and concentrated drops.

For inhalants, the compounds of the invention may be formulated as a dry powder or a suitable solution, suspension or aerosol. Powders and solutions can be formulated with suitable additives known in the art. For example, the powders may include a suitable powder base such as lactose or starch, and the solutions may comprise propylene glycol, sterile water, ethanol, sodium chloride, and other additives, such as acid, alkali, and buffer salts. Such solutions or suspensions may be administered by inhalation by spray, pump, atomizer, or nebulizer, and the like. The compounds of the invention may also be used in combination with other inhaled therapies, for example, corticosteroids such as fluticasone propionate, beclomethasone dipropionate, triamcinolone acetonide, budesonide and mometasone furoate; beta agonists such as albuterol, salmeterol and formoterol; anticholinergic agents such as ipratropium or tiotropium bromide; vasodilators such as treprostinal and iloprost; enzymes such as DNase; therapeutic proteins; immunoglobulin antibodies; and oligonucleotide, such as single or double stranded DNA or RNA, siRNA; antibiotics such as tobramycin; muscarinic receptor antagonists; leukotrion antagonists; cytokine antagonists; protease inhibitors; cromolyn sodium; nedocril sodium; and sodium cromoglycate.

Pharmaceutical preparations for oral use can be obtained, for example, by combining the active compounds with solid excipients, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or cores. dragees Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, monitol, or sorbitol; Cellulose preparations, eg maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropyl methyl cellulose, carboxymethyl cellulose (CMC), sodium and/or polyvinylpyrrolidone (PVP; povidone ). If desired, disintegrating agents may be added, such as cross-linked polyvinylpyrrolidone, agar, or alginic acid, or a salt thereof such as sodium alginate.

The dragee cores are provided with suitable coatings. For that purpose, concentrated sugar solutions may be used, which may optionally contain, for example, gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol (PEG), and/or titanium dioxide, lacquer solutions, and organic solvents. or suitable solvent mixtures. Dyes or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical preparations that can be used in oral form include push-fit capsules made of gelatin ("gelcaps"), as well as soft-sealed capsules made of gelatin, and a plasticizer, such as glycerol or sorbitol. Push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols (PEGs). In addition, stabilizers can be added.

Alternatively, injection (parenteral administration) may be used, eg, intramuscular, intravenous, intraperitoneal, and/or subcutaneous. For injection, the compounds of the invention are formulated in sterile liquid solutions, preferably in physiologically compatible buffers or solutions, such as saline, Hank's solution or Ringer's solution. Furthermore, the compounds can be formulated in solid form and redissolved or suspended immediately prior to use. Freeze-dried forms can also be produced.

Administration can also be by transmucosal, topical, or transdermal means. For transmucosal, topical, or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally produced in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents can be made to facilitate permeation. Transmucosal administration, for example, can be via nasal sprays and suppositories (rectum or vaginal). The topical compositions of this invention are preferably formulated as oils, creams, lotions, ointments, and the like by choosing appropriate carriers known in the art. Suitable carriers include vegetable or mineral oils, stringy petrolatum (soft, white paraffin), drier, branched-chain fats, animal fats, and high molecular weight (greater than C) alcohol.₁₂). Preferred carriers are those in which the active ingredient is soluble. Emulsifiers, stabilizers, humectants and antioxidants may also be included as well as color or fragrance imparting agents, if desired. Creams for topical application are preferably formulated from a mixture of mineral oil, self-emulsifying beeswax and water into which the active ingredient, dissolved in a small amount of solvent (eg an oil), is mixed. Additionally, administration by transdermal means may comprise a transdermal patch or dressing such as a bandage impregnated with an active ingredient and optionally one or more carriers or diluents known in the art. To be administered in the form of a transdermal delivery system, the administration of the dosage will, of course, be continuous rather than intermittent through the specification regimen.

The amounts of the various compounds to be administered can be determined by standard procedures that take into account factors such as IC₅₀ of the compound, the biological half-life of the compound, the age, height and weight of the subject, and the disorder associated with the subject. The importance of these and other factors is well known to those of ordinary skill in the art. In general, a dose will be between about 0.01 and 50 mg/kg, preferably 0.1 and 20 mg/kg of the subject being treated. Multiple doses can be used.

EXAMPLES

Examples related to the present invention are described below. In most cases, alternative techniques can be used. The examples are intended to be illustrative and are not to limit or restrict the scope of the invention. In some examples, the indicated mass spectrometry result for a compound may have more than one value due to the isotope distribution of an atom in the molecule, such as a compound having a bromine or chlorine substituent.

Example 1: Synthesis of [3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]amide of propane-1-sultanic acid P-0773 and Related Compounds.

Compound P-0773 was synthesized in five steps from 2,4-difluoro-phenylamine 42 as shown in Scheme 13.

Scheme 13

<img file="ECSP088121A_D0033.tif" />

Step 1 - Preparation of 3-amino-2,6-difluoro-benzoic acid benzyl ester (43):

To 2,4-difluoro-phenylamine (42, 5.11 mL, 50.7 mmol) in tetrahydrofuran (250 mL), quenched with dry ice/acetone under a nitrogen atmosphere, was slowly added n-butyllithium (1.60 M in hexane, 34.0 mL , 54.4 mmol). After 30 min, 1,2-Bis-(chloro-dimethylsilanyl)-ethane (11.5 g, 53.4 mmol) was slowly added to the reaction and dissolved in tetrahydrofuran (40.0 mL). After 1 hour -butyllithium (1.60 M in hexane, 31.9 mL, 51.0 mmol) was slowly added to the reaction. The reaction was stirred at -78 °C for 30 minutes and then allowed to warm to room temperature over 40 minutes. The reaction was slowly cooled to -78 °C, followed by the addition of n-butyllithium (1.60 M in hexane, 35.1 mL, 56.2 mmol). After 70 min, benzyl chloroformate (7.97 mL, 55.8 mmol) was added to the reaction. The reaction mixture was stirred at -78 Ό overnight followed by the addition of 2 N HCl (120 mL). The reaction was allowed to warm to room temperature over 2 hours. The organic layer was separated. The aqueous layer was made alkaline with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated by column chromatography on silica gel (20% ethyl acetate/hexane) to give a colorless oil (43.10.6 g, 79.7%). MS(ESI) [M+H⁺]⁺ = 264.1.

Step 2 - Preparation of 2,6-difluoro-3-(propan-1-sulfonylamino)-benzoic acid benzyl ester (44):

To 3-amino-2,6-difluoro-benzoic acid benzyl ester (43, 6.00 g, 22.8 mmol) in methylene chloride (150 mL) was added pyridine (2.76 mL, 34.2 mmol) and propan-1 chloride. -sulfonyl (3.80 mL, 33.8 mmol). The reaction was stirred at room temperature overnight. The reaction was then poured into water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated with silica gel column chromatography to give a colorless oil (44, 7.0 g, 83.1%). MS(ESI) [M+H⁺]⁺= 370.1.

Step 3 - Preparation of 2,6-dfluoro-3-(propan-1-sulfonylam¡no)-benzoic acid (45):

To 2,6-difluoro-3-(propan-1-sulfonylamino)-benzoic acid benzyl ester (44, 2.0 g, mmol) in methanol (30 mL) was added 20% palladium hydroxide on carbon (100 mg ). The reaction was stirred under hydrogen at 1 atm for 15 minutes. The reaction was filtered and concentrated to give a white solid which was used in the next step.

Step 4 - Preparation of 2,6-dfluoro-3-(propan-1-sulfonylamino)-benzoyl chloride (46):

To 2,6-difluoro-3-(propan-1-sulfonylamino)-benzoic acid (45.1.50 g, 5.4 mmol) was added toluene (7.0 mL) and thionyl chloride (15.0 mL, 0.21 mmol). The reaction was heated at reflux for 3 hours. The reaction was concentrated to give crude compound which was used in the next step.

Stage 5- Preparation of [3-(5-bromo-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-difluoro-phenyl]-amide of propane-acid 1 -sulfonic acid (P-0773):

To aluminum trichloride (8.89 g, 66.7 mmol) was added methylene chloride (150 mL) under a nitrogen atmosphere below 5 °C. Into this, 5-bromo-7-azaindole (67, 1.64 g, 8.34 mmol) in methylene chloride (20 mL) was added. The reaction was stirred for 60.0 min and sodium chloride was added.

2,6-Difluoro-3-(propan-1-sulfonylaminoj-benzoyl (46, 3.50 g, 11.8 mmol) in methylene chloride (20 mL) The reaction was stirred for 6 hours and warmed to room temperature overnight The reaction mixture was poured into water and extracted with ethyl acetate The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (methylene chloride/methanol 5%) to give a white solid (P-0773, 1.2 g, 31.4%). MS(ESI) [M+H⁺]⁺ = 460.0, 462.0.

N-[3-(5-Bromo-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-benzenesulfonamide

P-0798y N-[3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-3-fluoro-benzenesulfonamide

<img file="ECSP088121A_D0034.tif" />

<img file="ECSP088121A_D0035.tif" />

were prepared following the protocol of Scheme 13, which replaces propan-1sulfonyl chloride with benzenesulfonyl chloride and 3-fluoro-benzenesulfonyl chloride, respectively, in Step 2. P-0798 MS(ESI) [M - H⁺] = 489.9, 491.9.

Propane-1-sulfonic acid [3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-4-chloro-2-fIuoro-phenyl]-amide P-0805

<img file="ECSP088121A_D0036.tif" />

was prepared following the protocol of Scheme 13, substituting 4-chloro-2-fluoro-phenylamine for 2,4-difluoro-phenylamine in Step 1. MS(ES1) [MH⁺]' = 471.9, 473.9.

Propan-1-sulfonic acid [2,4-difluoro-3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-amide P0007

<img file="ECSP088121A_D0037.tif" />

azaindole in Step 5. MS(ES1) [M + H⁺]⁺ = 380.1.

was prepared following the protocol of Scheme 13, which replaces 5-bromo-7-azaindole with 7[2,4-dif fluoro-3-(5-methox¡-1 Hp¡ rrolo[2,3-b]p¡r ¡d¡ n-3-carbon yl)-phenyl]-am ¡dida of propan-1 sulfonic acid P-0806

<img file="ECSP088121A_D0038.tif" />

was prepared following the protocol of Scheme 13, substituting 5-bromo-7-azaindole for 5-methoxy-7-azaindole 104 (prepared as described in Example 16) in Step 5. MS(ES1) [M-H⁺]' = 410.1.

Example 2: Synthesis of [3-(5-bromo-1H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-2-fluoro-fen¡l]-am¡da of propane-1-sulfonic acid P-0955 and Related Compounds.

Compound P-0955 was synthesized in six steps from 4-chloro-2-fluoro-phenylamine 47 as shown in Scheme 14.

Scheme 14

<img file="ECSP088121A_D0039.tif" />

Step /—Preparation of 3-Amino-6-chloro-2-fluoro-benzo\co benzyl ester of acid (48):

To 4-chloro-2-fluoro-phenylamine (47, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), cooled with dry ice/acetone under a nitrogen atmosphere, was slowly added n-butyllithium (2.500 M in hexane, 24.4 mL). After 20 min, 1,2-Bis-(chloro-dimethylsilanyl)-ethane (12.9 g, 60.0 mmol) was slowly added to the reaction and dissolved in tetrahydrofuran (40.0 mL). After 1 hour, n-butyllithium (2.50 M in hexane, 25.0 mL) was slowly added to the reaction. The reaction was stirred at -78 °C for 20 minutes and was allowed to warm to room temperature over 60 minutes. The reaction was cooled slowly to -78 Ό, followed by the addition of n-butyllithium (2.50 M in hexane, 26.0 mL). After 80 min, benzyl chloroformate (10.0 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 Ό overnight followed by the addition of water (80 mL) and concentrated hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature over 2 hours. The organic layer was separated and the aqueous layer made alkaline over potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated by column chromatography on silica gel (20% ethyl acetate/hexane) to give a colorless oil (48.12.5 g, 78.3%). MS(ESI) [M+H⁺]⁺= 280.0.

Step 2 - Preparation of 6-chloro-2-fluoro-3-(propan-1-sulfonylamino)benzoic acid benzyl ester (49):

To 3-amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48, 1.20 g, 4.3 mmol) in methylene chloride (28 mL) was added pyridine (0.52 mL, 6.4 mmol) and propan-1 chloride. -sulfonyl (0.685 g, 4.8 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated with silica gel column chromatography to give a colorless oil (49, 960 mg, 58.0%). MS(ESI) [MhT]' = 384.1.

Step 3 - Preparation of 6-chloro-2-fluoro-3-(propan-1-sulfonylamino)-benzoic acid (115):

To 6-chloro-2-fluoro-3-(propan-1-sulfonylaminoj-benzoic acid benzyl ester (49, 6.00 g, 15.6 mmol) in tetrahydrofuran (100 mL) was added 1.0 M potassium hydroxide (100 mL). reaction was refluxed overnight.The reaction was poured into water, acidified to pH 2 with 1N hydrochloric acid, and extracted with ethyl acetate.The organic portion was dried over anhydrous sodium sulfate, filtered, and dried. concentrated to give a white solid 115 (3.95 g, 85.8%).

Step 4 - Preparation of 2-fluoro-3-(propan-1-sulfonylamino)-benzoic acid (50):

To 6-chloro-2-fluoro-3-(propan-1-sulfonylaminoj-benzoic acid (115, 0.69 g, 2.3 mmol) in methanol (10 mL) was added 20% palladium hydroxide on carbon (200 mg). The reaction was stirred under hydrogen at 50 psi for 2 hours.The reaction was filtered and concentrated to give a white solid which was used in the next step.MS(ESI) [MH⁺] =260.1.

Step 5 - Preparation of 2-fluoro-3-(propan-1-sulfonylam¡no)-benzoyl chloride (51):

To 2-fluoro-3-(propan-1-sulfonylamino)-benzoic acid (50.1.17 g, 4.5 mmol) was added thionyl chloride (10.0 mL). The reaction was heated at reflux for 3 hours. The reaction was concentrated to give crude compound 51 which was used in the next step.

Step 6- Preparation of [3-(5-bromo-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2-fluoro-phenyl]-amide of propane-1-sulfonic acid (P-0955) :

Aluminum trichloride (2.52 g, 18.9 mmol) and methylene chloride (60.0 mL) were combined under a nitrogen atmosphere. Into the reaction mixture, 5-bromo-7-azaindole (67, 630.0 mg, 3.2 mmol) in methylene chloride (20.0 mL) was added. The reaction was stirred at room temperature for 70 minutes, then 2-fluoro-3-(propan-1-sulfonylamino)-benzoyl chloride (51, 0.749 g, 2.68 mmol) in methylene chloride (20 mL). The reaction was stirred at room temperature for 2 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give compound P-0955 (65 mg, 5.5%). MS(ESI) [M+H⁺]⁺ = 440.2, 442.2.

Using the protocol of Scheme 14, substituting 5-bromo-azaindole with any 5-chloro-7azaindole (80, prepared as described in Example 9), 5-fluoro-7-azaindole (81, prepared as described in Example 9), Example 9) or 7-azaindole in Step 6, propane-1-sulfonic acid [3-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2-fluoro-phenylj-amide P-1013 (MS(ESI) [M - H⁺]' = 394.1), propane-1-sulfonic acid [2-fluoro-3-(5-fluoro1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-amide P-1028 (MS (ESI) [M - H⁺]' = 378.1), and propane-1-sulfonic acid [2-fluoro-3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-amide P-1056 (MS( ESI) [M + H⁺]⁺ = 362.2) were prepared, respectively;

<img file="ECSP088121A_D0040.tif" />

P-1013

P-1028

<img file="ECSP088121A_D0041.tif" />

P-1056

Example 3: [2,4-dif fluoro-3-(5-pyridin-3-yl-1 Hpyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-amide of propane-1-sulfonic acid P-0088 and related compounds.

Compound P-0088 was synthesized in one step from [3-(5-bromo-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)2,4-difluoro-phenylj-amide of propan-1 acid -sulfonic P-0773 by Suzuki coupling ((Muyaura and Suzuki, Chem. Rev. 1995, 95:2457) as shown in Scheme 15.

<img file="ECSP088121A_D0042.tif" />

<img file="ECSP088121A_D0043.tif" />

<img file="ECSP088121A_D0044.tif" />

Step 1 - Preparation of propane-1-sulfonic acid [2,4-difluoro-3-(5-pyridin-3 ¡l-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)phenyl)-amide ( P-0088):

A [3-(5-bromo-1 Hp¡rrolo[2,3-b]p¡rid¡n-3-carbon¡l)-2,4-difluoro-phenyl]-amide of propane-1sulfonic acid (P-0773, prepared as described in Example 1, 65.0 mg, 0.14 mmol) in acetonitrile (4.0 mL) was added pyridine-3-boronic acid (609, 25.0 mg, 0.20 mmol), tetrakis(triphenylphosphine) palladium(0) (11 mg, 1.0% mmol) and aqueous potassium carbonate (1.0 M, 2.0 mL). The reaction was heated at 160 °C for 10 minutes in a CEM Discover microwave instrument. The reaction was poured into water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated by column chromatography on silica gel (methylene chloride/methanol 5%) to give a white solid (P-0088, 30 mg, 46.9%). MS(ESI) [M+H⁺]⁺ = 457.2.

Additional compounds were prepared following the protocol of Scheme 15, optionally replacing [3-(5-bromo-1H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbonyl)-2,4- Propane-1-sulfonic acid d¡fluoro-phenyl]-amide P-0773 with an appropriate 5-bromo azaindole and/or pyridine-3-boronic acid 609 with an appropriate botanical acid or botanical acid ester. The 5-bromo azaindole used was synthesized as described in either Example 1, 2, 5, or 54. The following compounds were made following this procedure:

N-[2,4-Difluoro-3-(5-pyr¡d¡n-3-¡l-1 Hp¡rrolo[2,3-b]p¡r¡d¡n-3-carbon¡l) -phenyl]-benzenesulfonamide (P0685),

Propane-1 sulfonic acid [4-chloro-2-fluoro-3-(5-pyridin-3-yl-1H-pyrrolo[2,3b]pyridin-3-carbonyl)-phenyl]-amide ( P-0753),

Propan-1-sulfonic acid [2,4-difluoro-3-(5-phenyl-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-amide (P-0636),

Propane-1-sulfonic acid [4-chloro-2-fluoro-3-(5-phenyl-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-amide (P-0776) { Propane-1 sulfonic acid 3-[5-(4-chlorophenyl)-1H-pyrrolo[2,3b]pyridine-3-carbonyl]-2,4-difluoro-phenyl}-amide (P-0956), { Propane-1-sulfonic acid 3-[5-(4-dimethylamino-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-2,4-difluoro-phenyl}-amide (P -0889), acid {2,4-difluoro-3-[5-(4-methoxy-phenyl)-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}-amide propan1-sulfonic acid (P-0877), Acid {2,4-difluoro-3-[5-(4-trifluoromethyl-phenyl)-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}-amide propane-1-sulfonic acid (P-0912), {2,4-difluoro-3-[5-(3-methoxy-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl] Propan1-sulfonic acid -phenyl}-amide (P-0874), {3-[5-(3-dimethylamino-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-2, Propane-1-sulfonic acid 4-difluoro-phenyl}-amide (P-0876),

Propan-1-sulfonic acid [2-fluoro-3-(5-phenyl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-amide (P0897), {3- Propane-1-sulfonic acid [5-(4-chloro-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-2-fluorophenyl}-amide (P-1009),

5-phenyl-1 H-pyrrolo[2,3-b]pyridine,

Acid [2-fluoro-3-(5-pyridin-3-yl-1 Hpyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-amide propane-1sulfonic acid (P-1251), {2,4-difluoro-3-[5-(3-fluorophenyl)-1 Hpyrrolo[2,3-b]pyridine-3-carbonylj-phenyl}-amide from propan-1 sulfonic acid (P-1259), {2,4-difluoro-3-[5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]- propan-1 sulfonic acid feniI}-amide (P-1260),

Propane-1-sulfonic acid [2-fluoro-3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-amide (P-1261),

Propan acid [2,4-difluoro-3-(5-pyrid¡n-4-¡l-1 H-pyrrolo[2,3-b]pyrid¡n-3-carbonyl)-phenyl]-amide -1 Sulfonic (P4262), 3-{3-[2,6-Difluoro-3-(propan-1-sulfonylamino)-benzoyl]-1H-pyrrolo[2,3-b]pyridin-5-yl} acid Benzoic (P-1266), {2,4-difluoro-3-[5-(3-morphol¡n-4-yl-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl] Propane-1-sulfonic acid -phenyl}-amide (P-1873), {2.4-d¡fluoro-3-[5-(3-morphol¡n-4-ylmethyl-phenyl)-1H-pyrrolo[2,3-b]p¡ridin-3-carbon¡ Propan-1-sulfonic acid l]-phenyl}-amide (P-1878), {2,4-difluoro-3-[5-(6-methoxy-pyridin-3-yl)-1H- Propane-1-sulfonic acid pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}-amide (P-1879), {2,4-difluoro-3-[5-(6-morpholin-4 Propane-1-sulfonic acid -yl-pyridin-3-yl)-1Hpyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}-amide (P-1881), (2,4-difluoro-3-{5-[6-(4-methyl-piperazin-1-yl)-pyridin-3-yl]-1H-pyrrolo[2,3-b]pyridin-3-carbonyl Propane-1-sulfonic acid }-phenyl)amide (P-1882), {3-[5-(4-cyano-3,5-dimethyl-phenyl)-1Hpyrrolo[2,3-b]p ¡r¡d¡n-3-carbonyl]-2₌Propane-1-sulfonic acid 4-difluoro-phenyl}-amide (P4980),

N-{2,4-Difluoro-3-[5-(1-methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}- 4-trifluoromethyl-benzenesulfonamide (P-1996),

N-{2,4-Difluoro-3-[5-(1-methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-b]pyridin-3-carbonyl]-phenyl }-3-fluorobenzenesulfonamide (P-1997), {2,4-difluoro-3-[5-(1-methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3-b]pyridine Propane-1-sulfonic acid -3-carbonyl]-phenyl}-amide (P-1864), {3-{5-(4-chlorophenyl)-1H-pyrrolo[2,3-b]pyridin-3- propane-1 sulfonic acid carbon¡l]-4-fluoropheniI}-amide (P-1432),

4-{3-[2,6-Difluoro-3-(propan-1-sulfonylamino)-benzoyl]-1H-pyrrolo[2,3-b]pyridin-5-yl}-benzamide (P1546),

4-{3-[2,6-Difluoro-3-(propan-1-sulfonylamino)-benzoyl]-1H-pyrrolo[2,3-b]pyridin-5-yl}-N,Ndimethylbenzamide (P-1547), (2,4-difluoro-3-{5-[4-(morpholine-4-carbonyl)-phenyl]-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)- phenyl)-amide of propan-1 -sulfonic acid (P-1548),

3-{3-[2,6-Difluoro-3-(propan-1-sulfon¡lam¡no)-benzo¡l]-1 H-pyrrolo[2,3-bjpyr¡din-5-yl)-benzamide (P4549), {2,4-difluoro-3-[5-(4-methyl-1H-imidazol-2-yl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl )-amide of propane-1-sulfonic acid (P-2006), and

N-{2,4-Difluoro-3-[5-(6-methoxy-pyridin-3-yl)-1 H-pyrrolo[2,3-bjpyridin-3-carbonyl]-phenyl)-3-fluorobenzenesulfonamide (P -2012).

The following table indicates the 5-bromo azaindole (column 2) and boronic acid (column 3) used to give the compound (column 4). Column 1 gives the compound number and column 5 the observed mass.

<td></td><td>5-Brazindole</td><td>boronic acid</td><td>Compound</td><td>MS(ESI) Observed</td>

<td>P-0685</td><td>AND Ν No</td><td>B(OH)₂ 0</td><td>AND (Al °vQ 0^F HN-m Vi} 0</td><td> 491.1</td>

<td>P-0753</td><td>to &lt; BryvD N·??⁰FH 0</td><td>B(OH)₂either</td><td>λΛΓ Γ ΤΛ^F H 0 TO</td><td> 473.1</td>

<td>P-0636</td><td>go_{Rr Λ} j V\_rs=o EITHER</td><td>B(OH)_zEITHER</td><td>npG 1 Á_Λ Tr^Ms=o ArV</td><td> 456.1</td>

<td>P-0776</td><td>vG Rr λ. Λ ΓΧ.'β-Ο W^F h° Yo</td><td>B(OH)₂either</td><td>nvG I heard_Λ ry\.,s=o Γ or^F H 0 SG</td><td> 472.1</td>

<td></td><td></td><td>B(OH)₂</td><td>^ciy% VÚ</td><td></td>

<td></td><td>5-brazaindole</td><td>boronic acid</td><td>Compound</td><td>MS(ESI) [M+H⁴]⁴Observed</td>

<td>Ρ-0877</td><td>ντϋ</td><td>Β(ΟΗ)2 φ °χ</td><td>^{1 F}V\L I saw %Ό &gt; 1J_Λ j rVi-s^o Πϊν H</td><td> 486.3</td>

<td>Ρ-0912</td><td>^bfwcf^Ν-'^ι=° IΓ 7^F Η 0^Ν ñ</td><td>Β(ΟΗ)₂Φ cf₃</td><td>^F&gt; V VO Yn^F "either</td><td> 524.1</td>

<td>Ρ-0874</td><td>vn</td><td>Β(ΟΗ]&gt;2 what, 1</td><td>-either y_7 ιφφ-Υ¹\7Π left^or II OR</td><td>484.3 [MH⁴]</td>

<td>Ρ-0876</td><td>^Ν’’^Γ° ΤηFΗ 0</td><td>Β(ΟΗ)₂Φ /Νχ</td><td>η ΦΥ . jl j_Λ ΓWs=o &gt;^ΛΧθ5^F H 0¹ v_to</td><td> 499.3</td>

<td>Ρ-0897</td><td>ΥΙΓV^F Η 0</td><td>Β(ΟΗ)₂ό</td><td>r» °vQ I^F H 0 Vn</td><td> 438.3</td>

<td>P-1MQ</td><td>°vQ rn. J γ'μ'^-Ο</td><td>Β(ΟΗ)₂Α</td><td></td><td> 472.2</td>

<td></td><td>5-brazaindole</td><td>boronic acid</td><td>Compound</td><td>MS(ESI) [M+H*T Observed</td>

<td>Ρ-1260</td><td></td><td>B(OH)₂0 F</td><td>ύι XX hey_Λ rr^Ms=o</td><td> 474.2</td>

<td>Ρ-1261</td><td>vq</td><td>B(OH)₂"X"</td><td>nXO'' Jl J ~ Γ r\iso^C|X&lt;An3^F H 0</td><td> 490.2</td>

<td>Ρ-1262</td><td>^brYrV^H 6</td><td>B(OH)₂ύ</td><td>°2q vn</td><td> 457.2</td>

<td>Ρ-1266</td><td>γζΛ^brV%rÁ f^Ν'θ~° \ |[YFH 0 vn</td><td>B(OH)₂χλγΟΒη 0</td><td>HCky.0F, / (Lw°Yn^F_h either</td><td> 500.1</td>

<td>Ρ-1873</td><td>nS^br'r^rÁ f^No.'S~° Y ΪΛ FH 0</td><td>VY either._B..o a»-&gt; %EITHER</td><td>COXX 0%%%^F ° ^No. h</td><td> 541.2</td>

<td>Ρ-1878</td><td>_{Rr Λ} T Γχ.-θ-ο ΎiP&gt; F h 0^No. h</td><td>c?^VNo. Q^Qb~O 7-0W</td><td>I Ν^&gt;R/ A v O j yn fho vn</td><td> 555.3</td>

<td></td><td>either.</td><td>AND EITHER._B..° 1</td><td>Ύί V?do</td><td> /187 7</td>

<img file="ECSP088121A_D0045.tif" />

<td></td><td colspan="4">5-brazaindole</td><td>boronic acid</td><td colspan="4">Compound</td><td>MS(ESI) [m+hT Observed</td>

<td></td><td></td><td></td><td>AND TO</td><td>ϋ</td><td>B(OH)₂</td><td>NC^</td><td></td><td></td><td>tied up</td><td></td>

<td>Ρ-1980</td><td>br&gt;</td><td>Ίι</td><td>EITHER^F</td><td>\i'S=O NμH 0</td><td>Αλ</td><td></td><td>h</td><td>no</td><td>to toSrto^eitherΛ^F H 0</td><td> 509.2</td>

<td></td><td></td><td>V</td><td>'NH</td><td></td><td>CN</td><td></td><td></td><td>V</td><td>^heno h</td><td></td>

<td>Ρ-1996</td><td>Βκ</td><td>c</td><td>F 4.p</td><td>,C^F3 P -rv</td><td>1, no. AND</td><td>\ Ά</td><td></td><td>F 0</td><td rowspan="2">. AND X 0</td><td> 562.2</td>

<td></td><td></td><td>. Εν</td><td></td><td>O'O</td><td>AND</td><td></td><td>'n</td><td>w h</td><td></td>

<td></td><td></td><td></td><td>R.</td><td>F</td><td></td><td rowspan="2">\ TO</td><td></td><td></td><td>R,_F</td><td></td>

<td rowspan="2">Ρ-1997</td><td rowspan="2">Bl</td><td></td><td>Q,A&gt;</td><td></td><td> 0</td><td></td><td> 0.</td><td> 0</td><td rowspan="2"> 512.2</td>

<td>'il</td><td colspan="2">\FHN-Ss</td><td>B—0</td><td></td><td> ·*</td><td>ill</td><td></td>

<td></td><td></td><td>ito</td><td>'n h</td><td>either^D.</td><td>x</td><td></td><td>tea</td><td>h</td><td>TO</td><td></td>

<td></td><td></td><td></td><td>AND.</td><td></td><td>ί N</td><td rowspan="2">\ Ν'!</td><td></td><td></td><td>R.</td><td></td>

<td></td><td></td><td></td><td>TO</td><td rowspan="2">hi^x?r°</td><td></td><td></td><td>Q</td><td></td><td></td>

<td rowspan="2">Ρ-1864</td><td rowspan="2">br&gt;</td><td></td><td></td><td>x</td><td>NJ</td><td></td><td></td><td>tea</td><td> 460.2</td>

<td></td><td>ta f</td><td rowspan="2">HO</td><td>B-0</td><td></td><td></td><td>ill \</td><td>FHN^_tea</td><td></td>

<td></td><td></td><td></td><td>W h</td><td></td><td></td><td colspan="2">you^xNo.^No. h</td><td>or °</td><td></td>

<td></td><td></td><td></td><td>R.</td><td></td><td>B(OH)₂</td><td></td><td></td><td></td><td>TO THE</td><td></td>

<td></td><td></td><td></td><td>and V</td><td>) S</td><td>TO</td><td colspan="2">^clno</td><td></td><td>°Y) 7</td><td></td>

<td>Ρ-1432</td><td>Br.</td><td></td><td></td><td>H 0</td><td>Q</td><td colspan="2"></td><td>TO</td><td>A Ν'?Γ° H 0</td><td> 472.2</td>

<td></td><td></td><td></td><td>-½ h</td><td></td><td>I Cl</td><td></td><td></td><td>'N'</td><td>-N h</td><td></td>

<td></td><td></td><td></td><td>F,</td><td> &lt; /</td><td>B(OH)_to</td><td>NH_z</td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>) S</td><td>TO</td><td>oAr</td><td> %</td><td></td><td>see 7</td><td></td>

<td>Ρ-1546</td><td>Br-</td><td></td><td>no^F</td><td>H 0</td><td></td><td>[YO</td><td></td><td>already</td><td>/ rA.-SO •γ-Α r-NVO^F H 0</td><td> 497.2</td>

<td></td><td></td><td>phone</td><td>^λν h</td><td></td><td>o^nh₂</td><td></td><td></td><td>tea</td><td>h</td><td></td>

<td></td><td></td><td></td><td>R.</td><td> /</td><td>B(OH)₂</td><td>teto</td><td></td><td></td><td>F. /</td><td></td>

<td>Ρ-1547</td><td>br.</td><td></td><td>h D.^F</td><td>) 7 \|-S=ON « H 0</td><td></td><td>TO(</td><td>TO.</td><td></td><td>yu T y-\,,S=O .Μ ' N n | ?^F H 0</td><td> 527.3</td>

<td></td><td></td><td>Ή</td><td>h</td><td></td><td>or bi</td><td></td><td></td><td>AND</td><td>TO h</td><td></td>

<td></td><td></td><td></td><td></td><td> &lt; /</td><td>B(OH)₂</td><td> 0</td><td></td><td></td><td> \ - /</td><td></td>

<td>Ρ-1548</td><td>Br.</td><td></td><td>/ALREADY^F</td><td>} 7 no.</td><td>and</td><td>I heard you</td><td>x</td><td colspan="2">te ΥΌ) Αύμ nT</td><td> 569.3</td>

<td></td><td></td><td> %</td><td>h</td><td></td><td>(Ate theo</td><td></td><td></td><td></td><td>TO</td><td></td>

<td></td><td colspan="4">r~</td><td></td><td>H,N. .</td><td>no</td><td></td><td>F. /</td><td></td>

<td></td><td>5-brazaindole</td><td>boronic acid</td><td>Compound</td><td>σ rags 5 “ o.·—ía EITHER</td>

<td>P-2006</td><td>AND AND_No.-?r° I^F H0nn</td><td>AND Ύ Ύ</td><td>F. _7'nh i L Ύ^FHN~bo⁰</td><td> 560.2</td>

<td>Q-2012</td><td>FAITH θΥΥ FHN-Y yn y</td><td>Φ</td><td>andw YyTY TO</td><td> 632.1</td>

Example 4: Synthesis of N-[2,4-difluoro-3-(5-pyridin-3-¡l-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)phenylj-ethanesulfonamide P-0728.

Compound P-0728 was synthesized in eight steps from 2,4-difluorophenylamine 42 as shown in Scheme 16.

Scheme 16

<img file="ECSP088121A_D0046.tif" />

Stage 1 - Preparation of dibenz¡l-(2.4-difluorophenyl)-amine (52):

To 2,4-difluoro-phenylamine (42.10.0 g, 77.4 mmol) in N,Ndimethylformamide (130 mL) were added potassium carbonate (32.1 g, 0.23 mol) and benzyl bromide (21.2 mL, 0.18 mol). . The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluted with 10% ethyl acetate in hexane. The appropriate fractions were combined and concentrated to provide the compound (52.12.0 g, 50%). MS(ES1) [M+H⁺]⁺ = 310.2.

Step 2 - Preparation of 3-dibenzylamino-2_;6-difluoro-benzaldehyde (53):

A dibenzyl-(2,4-difluoro-phenyl)-amine (52, 4.30 g, 13.9 mmol) in tetrahydrofuran (60 mL), under a nitrogen atmosphere, was cooled in an acetone/dry ice bath to -78 °C, nbutyllithium (2.50 M in hexane, 6.1 mL, 15.3 mmol) was added slowly. The reaction was stirred for 1 hour, N,Ndimethylformamide (1.2 mL, 15.3 mmol) was added, and the reaction was allowed to warm to room temperature over 1 hour. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% ethyl acetate in hexane to give the compound (53, 4.0 g, 85%). MS(ESI) [M+H⁺]⁺ = 337.2.

Step 3 - Preparation of (3-dibenzylamino-2-6-difluoro-phenyl)-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (54):

To 3-dibenzylam¡no-2,6-difluoro-benzaldehyde (53, 0.76 g, 2.3 mmol) in methanol (50 mL) was added 5-pyridin-3-¡l-1 H-pyrrolo[2,3 -b]pyridine (89, 0.40 g, 2.1 mmol, prepared as described in Example 17) and potassium hydroxide (0.50 g, 8.9 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give the compound (54, 0.60 g, 50%). MS(ESI) [M+H⁺f = 533.2.

Step 4—Preparation of (3-d¡benz¡lam¡no-2,6-d¡fluorofen¡l)-(5-p¡r¡d¡n-3-yl-1H-p¡rrolo[2, 3-b]pyridan

3-l)-methanone (55):

A (3-dibenzylamno-2,6-difluorophenyl)-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (54, 0.90g, 1.7 mmol) in methylene chloride (20 mL) under a nitrogen atmosphere was added Dess-Martin periodane (0.97 g, 2.3 mmol). The reaction was stirred at room temperature for 15 minutes. The reaction was poured into a sodium bicarbonate and sodium thiosulfate solution and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give the compound (55, 0.70 g, 78%). MS(ESI) [M+H⁺]⁺ = 531.2.

Step 5 - Preparation of (3-dibenzylamino-2,6-difluoro-phenyl)-(5-pyridin-3-yl-1-triisopropylsilanyl-1Hpyrrolo[2,3-b]pyridin-3-yl)-methanone (56 ):

A (3-dibenzylamino-2,6-difluoro-phenyl)-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-methanone (55, 0.84 g, 1.6 mmol) in tetrahydrofuran (150 mL) was added sodium hydride (210.0 mg, 60% in mineral oil, 5.3 mmol) under a nitrogen atmosphere. The reaction was stirred for 5 minutes. Triisopropylsilyl chloride (0.80 mL, 3.8 mmol) was added and the reaction stirred at room temperature for 3 hours. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% ethyl acetate in hexane to give the compound (56, 420 mg, 39%). MS(ES1) [M+H⁺]⁺ = 687.4.

Step 6- Preparation of (3-am¡no-2,6-d¡fluorophenyl)-(5-p¡ridin-3-¡l-1-triisopropylsilan¡l-1Hpyrrolo[2,3-b]pyridine -3-yl)-methanone (57):

A (3-dibenzylamino-2,6-difluoro-phenyl)-(5-pyridin-3-1-1-triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridin-3- il)methanone (56, 55.0 mg, 0.080 mmol) in methanol (15 mL) was added 20% palladium hydroxide on carbon (20 mg). The reaction was stirred under an atmosphere of hydrogen overnight. The reaction was filtered to remove the catalyst, then concentrated to give crude compound which was used in the next step.

Step 7-Preparation of N-[2,4-difluoro-3-(5-pyrid¡n-3-yl-1 -tr¡¡soprop¡ls¡lan¡l-1H-pyrrolo[2,3-b] prídan·

3-carbonyl)phenyl]-ethanesulfonamide (58):

A (3-am¡no-2,6-difluoro-phenyl)-(5-pyridin-3-yl-1 -triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridin-3-yl)methanone (57 , 35.0 mg, 0.069 mmol) in methylene chloride (6 mL) was added methanesulfonyl chloride (0.30 mL, 3.9 mmol) and triethylamine (0.40 mL, 2.9 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated to give the crude compound which was used in the next step.

Step 8-Preparation of N-[2,4-difluoro-3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]ethanesulfonamide ( P-0728):

A N-[2,4-difluoro-3-(5-pyridin-3-yl-1-triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]ethanesulfonamide (58, 35.0 mg, 0.060 mmol) in tetrahydrofuran (10 mL) was added tetra-n-butylammonium fluoride (19 mg, 0.072 mmol). The reaction was stirred at room temperature f or 5 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to provide the compound (P0728, 5.6 mg, 22%). MS(ESI) [M+H⁺]⁺ = 443.1.

Example 5; Preparation of propane-2-sulfonic acid [2,4-difluoro-3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)phenylj-amide P-0850 .

Compound P-0850 was synthesized in four steps from 2,4-difluorophenylamine 42 as shown in Scheme 17.

Scheme 17

<img file="ECSP088121A_D0047.tif" />

Stage 1 -Preparation of propane-2-sulfonic acid (2,4-difluoro-phenyl)-acid amide (59):

To 2,4-difluoro-phenylamine (42, 4.0 mL, 40.0 mmol) in methylene chloride (50 mL) were added pyridine (3.37 mL, 42.3 mmol), propan-2-sulfonyl chloride (6.00 g, 42.3 mmol) and dimethylaminopyridine (0.20 g, 1.64 mmol) under a nitrogen atmosphere. The reaction was stirred at 45 °C overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel 3% methanol in methylene chloride to give a white solid (59.8.0 g, 85%). MS(ESI) [MH⁺]⁺ = 234.0.

Step 2 - Preparation of propane-2-sulfonic acid (2,4-difluoro-3-formyl-phenyl)-amide (60):

Propan-2-sulfonic acid (2,4-difluoro-phenyl)-amlda (59, 2.35 g, 9.95 mmol) in tetrahydrofuran (70 mL) under a nitrogen atmosphere cooled with a dry-ice/acetone bath, was added. added 1.60 M of n-butyllithium (1.60 M in hexane, 6.53 mL, 10.45 mmol). The reaction was stirred for 40 min, followed by another portion of n-butyllithium (1.60 M in hexane, 6.84 mL, 10.94 mmol). The reaction was stirred for 1 hour and Ν,Ν-dimethylformamide (0.92 mL, 11.9 mmol) was added. The reaction was allowed to warm to room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography (dichloromethane/methanol 5%) to give the compound (60.1.4 g, 53.4%). MS(ESI) [MH⁺] =263.4.

Step 3—Preparation of {2,4-d¡fluoro-3-[hydroxy¡-(5-pyridin-3-¡l-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]phenyl )-amide of propane-2-sulfonic acid (61 ):

To propane-2-sulfonic acid (2,4-difluoro-3-formyl-phenyl)-amide (60, 220.0 mg, 0.83 mmol) in methanol (15 mL) was added 5-pyridin-3-yl-1 H -pyrrolo[2,3-b]pyridine (89, 150.0 mg, 0.77 mmol, prepared as described in Example 17) and potassium hydroxide (537.0 mg, 9.6 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in dichloromethane to give the compound (61, 160 mg, 45.3%). At this stage, the minor compound {2,4-difluoro-3-[methox¡-(5-pyr¡d¡n-3-¡l-1 Hp¡rrolo[2,3-b]p¡r¡d Propane-2-sulfonic acid ¡n-3-yl)-methyl]-phenyl}-amide was also formed and isolated. MS(ESI) [M + H⁺]⁺= 460.1.

Step 4—Preparation of propane-2-acid [2,4-difluoro-3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)phenyl]amide Su¡phonic (P-0850):

A {2,4-difluoro-3-[hydroxy-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenyl)-amide of propane-2-sulfonic acid (61,40.0 mg, 0.087 mmol) in tetrahydrofuran (10 mL) was added DessMartin periodane (48.0 mg, 0.11 mmol). The reaction was stirred at room temperature for 5 minutes. The reaction was poured into sodium thiosulfate and potassium carbonate solution and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give the compound (P-0850, 13.4 mg, 33.5%). MS(ESI) [M + H⁺]⁺= 458.1.

N-(2,4-Difluoro-3-formyl-phenyl)-3-trifluoromethyl-benzenesulfonamide 579, N-(2,4-difluoro-3-formylphenyl)-4-trifluoromethyl-benzenesulfonamide 580, and benzyl ester of N-(2,4-difluoro-3-formyl-phenyl)-4fluoro-benzenesulfonamide 581, and (2,4-difluoro-3-formylphenyl)-carbamic acid

<img file="ECSP088121A_D0048.tif" />

<img file="ECSP088121A_D0049.tif" />

were prepared following Steps 1 and 2 of Scheme 17, which replaces propane-2-sulfonyl chloride with 3-trifluoromethyl-benzenesulfonyl chloride, 4-trifluoromethyl-benzenesulfonyl chloride, 4-fluoro-benzenesulfonyl chloride, and benzyl chloroformate, respectively, in Stage 1.

Propan-1 Sulfonic Acid [4-chloro-3-(5-chloro-1 H-pyrrolo[2,3 b]pyridine-3-carbonyl)-2-fluoro-phenyl]-amide P-1004

<img file="ECSP088121A_D0050.tif" />

was prepared using the protocol of Scheme 17, substituting 4-chloro-2-fluoro-phenylamine for 2,4-difluoro-phenylamine and propan-2-sulfonyl chloride for propan-1-sulfonyl chloride in Step 1, and

5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridine 89 with 5-chloro-7-azaindole 80 (see Example 9) in Step 3. MS(ES1) [M + H⁺]⁺ = 430.1.

Propan-1-sulfonic acid [4-chloro-2-fluoro-3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-amide P

0904

<img file="ECSP088121A_D0051.tif" />

was prepared using the protocol of Scheme 17, substituting 4-chloro-2-fluoro-phenylamine for 2,4-difluoro-phenylamine and propan-2-sulfonyl chloride for propan-1-sulfonyl chloride in Step 1, and

5-pyridin-3-yl-1H-pyrrolo[2,3 bjpyridine 89 with 7-azaindole 94 in Step 3. MS(ESI) [M + H⁺]⁺ 396.2.

Thiophen-2-sulfonic acid [3-(5-chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-amide

P-1267

Cl

<img file="ECSP088121A_D0052.tif" />

was prepared using the protocol of Steps 3 and 4 of Scheme 17, which replaces 5-pyridin-3-yl1H-pyrrolo[2,3-b]pyridine 89 with 5-chloro-7-azaindole 80 (see Example 9) and propane-2-sulfonic acid (2,4-difluoro-3-formyl-phenyl)amide 60 with thiophene-2-sulfonic acid (2,4-difluoro-3-formyl-phenyl)-amide 512 (see Example 21) in Step 3. MS(ESI) [M + H']' = 451.9.

Thiophen-3-sulfonic acid [3-(5-chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-amide

P-1268

<img file="ECSP088121A_D0053.tif" />

was prepared using the protocol of Steps 3 and 4 of Scheme 17, which replaces 5-pyridin-3-11H-pyrrolo[2,3-b]pyridine 89 with 5-chloro-7-azaindole 80 (see Example 9 ) and propane-2-sulfonic acid (2,4-difluoro-3-formyl-phenyl)amide 60 with thiophene-3-sulfonic acid (2,4-difluoro-3-formyl-phenyl)-amide 513 (see Example 21) in Step 3. MS(ESI) [M + H⁺]⁺ = 454.1.

Additional compounds were prepared following the protocol of Scheme 17, optionally replacing propan-2-sulfonyl chloride with an appropriate acid chloride in Step 1 and/or 5-pyridin-3-yl-1H-pyrrolo[2,3 -b]pyridine with an appropriate azaindole in Step 3. The azaindoles were purchased or synthesized as described in Examples 6, 13, 14, 16 and 17. Some compounds were then isolated in Step 3, such as any hydroxy or derivative methoxy. The following compounds were made following these procedures:

Dimethylamine-1-sultanic acid {3-[5-(4-chloro-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-2,4-difluoro-phenyl}-amide ( P-1257),

N-[3-(5-Bromo-1H-p¡rrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-2,4-d¡fluoro-fen¡l]- benzenesulfonamide (P-0798),

Propane-1-sulfonic acid [3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-amide (P-0773),

Dimethylamine-1-sulfonic acid [3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difIuoro-phenylj-amide (P-0898),

N-[3-(5-Chloro-1 Hp¡rrolo[2,3-b]p¡r¡din-3-carbon¡l)-2,4-d¡fluoro-phenyl]-benzenesulfonamide (P-0885),

N-[2,4-Difluoro-3-(5-fluoro-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-phenyl]-benzenesulfonam¡de (P -0902), {2,4-difluoro-3-[hydrox¡-(5-¡sopropen¡l-1 Hpyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenyl} -propan-1-sulfonic acid amide (P-1239),

Propan-1 sulfonic acid [2,4-difluoro-3-(5-isopropen¡I-1 Hp¡rrolo[2,3-b]pyrid¡n-3-carbon¡l)-phenyl]-amide (P -0991), {2,4-difluoro-3-[hydroxy-(5-methyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenyl}-am 1-propane sulfonic acid (P-1240) ida, {2,4-difluoro-3-[methoxy-(5-methyl-1 Hp¡rrolo[2,3-b]p¡r¡d¡n- Propane-1 sulfonic acid 3-yl)-methyl]-phenyl}-amide (P-1241), {2,4-difluoro-3-[hydroxy-(5-isopropyl- propan1-sulfonic acid 1 H-pyrrolo[2,3-b]pyridin-3-yl)-methyl)phenyl}-amide (P-1242),

Propane-1 sulfonic acid [2,4-difluoro-3-(5-isopropyl-1 H-pyrrolo[2,3-b]pyrid¡n-3-carbon¡l)-phenyl}-amide (P-0907 ), propane1-sulfonic acid {2,4-difluoro-3-[hydroxy-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenyl}-amide ( P-1243), {2,4-difluoro-3-[methoxy-(5-methoxy¡-1 H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenyl} -propan1-sulfonic acid amide (P-1244), (2,4-difluoro-3-{hydroxy-[5-(4-methyl-piperazin-1-yl)-1H-pyrrolo[2,3-b]pyridin-3-yl]-methyl}- propane-1-sulfonic acid phenyl)-amide (P-1245),

Propane-1-sulfonic acid [3-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-difIuoro-phenyl]-amide (P-0933 ), {2,4-dif I uoro-3-(5-f I oro-1H-pyrrolo[2,3-b]pyr¡d¡ n-3-carbonyl)-phen ¡l]-am¡ propane-1 sulfonic acid da (P-0907),

Piperidine-1-sulfonic acid [3-(5-chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-dif fluoro-phenyl]-amide (P-1020) ,

N-[3-(5-Chloro-1 Hpyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-difluoro-phenyl]-4-methoxybenzenesulfonamide (P0983),

N-[3-(4-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-benzenesulfonamide (P-0954),

Dimethylamine-1-sulfonic acid [3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-amide (P-0950),

Dimethylamine1-sulfonic acid [3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-difluoro-phenyl]-amide ( P-0837),

Dimethylamine-1-sulfonic acid [3-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-amide (P-1258),

Butane-1-sulfonic acid [3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenylj-amide (P-1263),

Butan-1 acid [2,4-difluoro-3-(5-methox¡-1 H-pyrrolo[2,3-b]pyridine-3-carbon¡l)-phenyl]-amide sulfonic (P-1264),

Butane-1-sulfonic acid [3-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenylj-amide (P-1265),

Propan-1-sulfonic acid [3-(5-ethoxy¡-1 H-pyrrolo[2,3-b]pyridine-3-carboniI)-2,4-difluoro-phenyl]-amide (P-1252 ), propane1-sulfonic acid {2,4-difluoro-3-[5-(2-methoxy-ethoxy¡)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}-amide (P-1253) propane-1-sulfonic acid (P-1254),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-4-ethyl-benzenesulfonamide (P1700),

N-[3-(5-Ethyl-1 Hp¡rrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-2,4-d¡fluoro-phenyl]-4-tr ¡fluoromethyl-benzenesulfonamide (P-1783),

Thiophen-3-sulfonic acid [3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenylj-amide (P-1798),

Benzo[b]thiophene-2-sulfonic acid [3-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-amide (P-1799) ,

5-pyridin-2-yl-acid [3-(5-chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-difluoro-phenyl]-amide thiofen2-sulfonic acid (P-1800),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-4-cyano-benzenesulfonamide (P1822),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-3-fluoro-4-methylbenzenesulfonamide (P-1823 ),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-4-isopropyl-benzenesulfonamide (P-1839),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-4-fluoro-benzenesulfonamide (P1840),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-2,4-difluoro-phenyl]-3,5 -difluoro-benzenesulfonamide (P-1841),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-d¡fluoro-phenyl]-4-methyl-benzenesulfonamide (P1842),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-difluoro-phenyl]-4-oxazol-5-ylbenzenesulfonamide (P-1843),

N-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-4-fluoro-benzenesulfonamide (P-1865),

N-{2,4-Difluoro-3-[5-(2-methoxy-ethoxy)-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}-3-fluorobenzenesulfonamide (P-1871 ),

N-{2,4-Difluoro-3-[5-(2-methoxy-ethoxy)-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}-4-fluorobenzenesulfonamide (P-1872 ), (2,4-difluoro-3-{5-[4-(2-methoxy-ethoxy)-phenyl]-1 Hpyrrolo[2,3-b]pyridin-3-carbonyl propan-1-sulfonic acid }-phenyl)-amide (P-1998),

N-{2,4-Difluoro-3-[5-(2-methoxy-ethoxy¡)-1 Hp¡rrolo[2,3-b]p¡r¡d¡n-3-carbon¡l]-phen ¡l}-4-trifluoromethylbenzenesulfonamide (P-2005), and

N-(2,4-Difluoro-3-{5-[4-(2-methoxy-ethoxy)phenyl]-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl}-phenyl)-4-trifluoromethyl- benzenesulfonamide (P-2013).

The following table indicates the acid chloride (column 2) and azaindole (column 3) used to give the objective compounds (column 4). Column 1 gives the compound number and column 5 the observed mass. Compounds isolated after Step 3 of Scheme 17 are as indicated in column 1.

<td></td><td>sulfonyl chloride</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [Μ+Ηψ observed</td>

<td>P-1257</td><td>_zSW₂IC ~^N \</td><td>h</td><td>F. Cv^ 0. r A or , HN-SN XD^F either⁴^No. No.</td><td> 415.1</td>

<td>P-0798</td><td>SW₂IC either</td><td>^B.vn^no «</td><td>I Q ΎχΡ*^ν&gt;ο NN or Π</td><td> 489.9 491.1</td>

<td>P-0773</td><td>/^SOüCi</td><td>h</td><td>P0^FHNb</td><td>455.9 457.9 [M-lT]</td>

<td>P-0898</td><td>sopci No. \</td><td>θ'ΎΎΥ^No. h</td><td>i or v^fHNf°</td><td> 497.0 499.1</td>

<td>P-0885</td><td>Partner</td><td>already h</td><td>_cl 5^9 TX5^FHN'^o NN or laughed</td><td>446.1 448.1 [MH*·]'</td>

<td>P0902</td><td>SW₂IC or</td><td>fyyy h</td><td>yp p^FYVÁ f hn-sL· NN 0</td><td>430.1 [M-H7</td>

<td>P-1239 Step3</td><td></td><td>vn</td><td>Yo^HOrP 'i'n^FHN'§'EITHER NN 0 Π</td><td>422.2 [M-lT]'</td>

<td></td><td></td><td></td><td>i,Ph(</td><td></td>

<td></td><td>sulfonyl chloride</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+HT Observed</td>

<td>Ρ-1240 Step 3</td><td></td><td>Y53 Π</td><td>^H0vO YLF^HNio NN or</td><td>396.4 [m-hT]</td>

<td>Ρ-1241 Step 3</td><td>.SW₂C! /^⁷</td><td></td><td>Wvhn-s^ ü Z/ to O no 0</td><td>410.3 [MH¹]·</td>

<td>Ρ-1242 Step 3</td><td>SW₂IC</td><td>atp</td><td>Yo ΛύΡ^ο N bj 0</td><td>424.3 [M-lT]</td>

<td>Ρ-0997</td><td>/^SUACI</td><td>Λτρ</td><td>NN or Π</td><td> 422.3</td>

<td>Ρ-1243 Step 3</td><td> ___/SW₂IC</td><td>1 Ύτ»^No. h</td><td>^FH&gt;</td><td>412.3 [MH*]'</td>

<td>Ρ-1244 Step 3</td><td>SW₂IC Z-⁷</td><td>1 w</td><td>°TIP”^No.^o NN 0</td><td>426.4 [MH*]</td>

<td>Ρ-1245 Step 3</td><td>/^SO;·⁰¹</td><td>^&lt;'^No.W</td><td>W^FH^o NN 0</td><td>480.3 [M-lT]</td>

<td>Ρ0933</td><td> ____/SW₂IC</td><td>^Clw \Ζ Ι^No. h</td><td>no.</td><td> 414.2</td>

<td></td><td>sulfonyl chloride</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+H*]* Observed</td>

<td>Ρ-1020</td><td>SOOCI 1^¿ 0</td><td>^π h</td><td>οΛ) Q VUN^JW^FHNi'o No. fl °</td><td> 455.2</td>

<td>Ρ-0983</td><td>SW₂IC Φ</td><td>^No. h</td><td>F Ν No Π</td><td>476.1 [MH*]</td>

<td>Ρ-0954</td><td>SW₂IC either</td><td> 6</td><td>a VO Q to^{F ΗΝ}'?*ο N(| 0</td><td> 448.2</td>

<td>Ρ-0950</td><td>,SW₂ci \</td><td>C9</td><td>'milestone^FHNI Ν No</td><td> 381.2</td>

<td>Ρ-0837</td><td>,SW₂IC Ή \</td><td>n^n h</td><td>ojPy UQ^FHN'iF'o M°</td><td> 458.1</td>

<td>Ρ-1258</td><td>,SW₂CI '''N \</td><td>SY-n^No. h</td><td>F._r, HJ Tn^FHNI^No. ñ⁰</td><td> 415.1</td>

<td>Ρ-1263</td><td>SOZCI r</td><td>^ΒΓΥΎΥ AND</td><td>ΎχΡ^ν^ο no 0</td><td> 472.1 474.1</td>

<td>Ρ-1264</td><td>,SW₂IC Γ</td><td>ton^No. h</td><td>°xyp®*íi'o Ν N 0</td><td> 424.2</td>

<td>Ρ-1265</td><td>SW₂IC r</td><td>^Clvn</td><td>^c1YyV?hn-X^</td><td>426.0 [MH*]'</td>

<td></td><td>sulfonyl chloride</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [Μ+Ηψ Observed</td>

<td>Ρ-1252</td><td></td><td>[“OT¹h</td><td>XYxCfhn-s^ I"U? io¹ NN 0 Π</td><td> 424.2</td>

<td>Ρ-1253</td><td></td><td>c Because h</td><td>r°\ / C°rUS w^FHN'IX Ν' N 0</td><td> 454.2</td>

<td>Ρ-1254</td><td> /^/^S°2CI</td><td>r C x^^m h</td><td>X ( ÜjXo NN or</td><td> 495.3</td>

<td>Ρ-1700</td><td>SO,CI</td><td>^αϊΧ^No. h</td><td>“H⁰</td><td> 476.2</td>

<td>Ρ-1783</td><td>S0,CI Φ cf₃</td><td>^No.tl</td><td>_F CF₃</td><td> 510</td>

<td>Ρ-1798</td><td>SW₂IC ά</td><td>ΎΧ^h η</td><td>iOp^ΒΓ W^FHN1X^No.X or</td><td>495.9 497.6 [M-tf]</td>

<td>Ρ-1799</td><td>SW₂IC \^yeseither</td><td>°'ϊΎΛ Saint</td><td>W^F "'•either NN or</td><td> 502.0 (-)</td>

<td>Ρ-1800</td><td>S0₂IC \^yesor</td><td>Clx_rx^_5¡r-\</td><td>oXX oAt Cl zx JXX ux^FHNxo No pj 0</td><td> 531.1</td>

<td>Ρ-1822</td><td>SW₂IC Φ CN</td><td>°'Tn^no o</td><td>PCN Vfj 0</td><td> 473.1</td>

<td></td><td>sulfonyl chloride</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+H⁴]⁴Observed</td>

<td>Ρ-1823</td><td>Partner..</td><td>^c'm ΝN</td><td>oJq&gt; (V^αγχΡΥ₀Ν No Π</td><td> 480,1</td>

<td>Ρ-1839</td><td></td><td>Τχτ ν--»</td><td>θ'τγγΥο NN 0 Π</td><td> 488</td>

<td>Ρ-1840</td><td>SO,CI AND F</td><td>YY''ZN</td><td>^αΤϊΡΥ Ν N 0</td><td> 464</td>

<td>Ρ-1841</td><td>SW₂IC TO</td><td>^c,m</td><td>And wp~^FαχΜ&gt; F HN-^o Ν N 0 Π</td><td> 482</td>

<td>Ρ-1842</td><td>SOYCI</td><td>TP</td><td>Ν No</td><td>460.0 [MH⁴]</td>

<td>Ρ-1843</td><td>S0₂IC ά</td><td></td><td>Νβ 0</td><td>513.0 [MH⁴]’</td>

<td>Ρ-1865</td><td>SW₂IC Φ F</td><td>oh</td><td>^no í¡ °</td><td> 432.1</td>

<td>Ρ-1871</td><td>SW₂Inc,</td><td>no</td><td>0F^FHY°</td><td> 506.2</td>

<td>Ρ-1872</td><td>SW₂IC you F</td><td>EITHER⁰ rn ΝN</td><td>rr WY; Ν N 0</td><td> 506.2</td>

<td></td><td>sulfonyl chloride</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+HT Observed</td>

<td></td><td>SW₂IC Φ cf₃</td><td></td><td>f.9^F3 w or^brW^FHN'HNN 0</td><td></td>

<td>P-1998</td><td>SW₂IC</td><td>XV¹</td><td>F. Γ°ΥΊι VO⁰%f'hn-^oi W o^No. h</td><td> 530.3</td>

<td>P-2005</td><td>sojci Φ cf₃</td><td>EITHER °W to</td><td>autumn Φ you^fHN~bo N fj 0</td><td> 556.0</td>

<td>Q-2013</td><td>SW₂ci Φ CF_S</td><td>^{1 No.} ñ</td><td>o'o °r&gt; I 0 V-yU ¿hn-.Sa IX)^F or or^No. ñ</td><td> 539.2 —</td>

Example 6: Synthesis of [2,4-difluoro-3-(5-phenylamino-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)phenylj-amide of propane-1-sulfonic acid P-0848 and Related compounds.

Propan-1-sulfonic acid [2,4-difluoro-3-(5-phenylamino-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)phenyl]-amide P-0848 was synthesized in five steps of 5-bromo-7-azaindole 67 as shown in Scheme

18.

<img file="ECSP088121A_D0054.tif" />

Step 1 - Preparation of 5-bromo-1 -triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridine (68):

To 5-bromo-7-azaindole (67, 1.5 g, 7.6 mmol) in Ν,Ν-dimethylformamide (20 mL) were added sodium hydride (60% in mineral oil, 0.27 g, 11.0 mmol) and triisopropylsilyl chloride ( 2.6 mL, 12.0 mmol), under a nitrogen atmosphere. The reaction was stirred for 2 hours at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% ethyl acetate in hexane to give the compound (68, 1.6 g, 59%). MS(ESI)[M+H⁺]⁺ = 352.3.

Step 2 - Preparation of 5-phenyl-(1-triisopropylsilan¡l-1H-p¡rrolo[2,3-b]p¡ríd¡n-5-yl)-am¡na (69): A 5-bromo -1-triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridine (68, 0.10 g, 0.3 mmol) in toluene (5 mL) were added aniline (0.04 mL, 0.42 mmol), tert-butoxide sodium (0.15 g, 1.56 mmol), tris(dibenzyldeneacetone)d¡palladium(0) (9.2 mg, 0.01 mmol) and (S)-(-)-2,2'-bis(diphenylphosphino)- 1,1'-binaphthil (6.3 mg, 0.01 mmol). The reaction was heated at 160 Ό for 10 minutes in a CEM Discover microwave instrument. The reaction was concentrated and purified by column chromatography on silica gel eluting with 3% ethyl acetate in hexane to give the compound (69.40 mg, 40%). MS(ESI)[M+H⁺]⁺ = 366.6.

Step 3 - Preparation of phenyl-(-1H-pyrrolo[2,3-b]pyridin-5-yl)-amine (70):

To 5-phenyl-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-5-yl)-amine (69, 0.14 g, mmol) in tetrahydrofuran (3.0 mL) was added tetra-n fluoride -butylammonium (0.197 g, 0.76 mmol). The reaction was stirred for 1 hour at room temperature. The reaction was concentrated and purified by column chromatography on silica gel eluting with 3% ethyl acetate in hexane to give the compound (70.60 mg, 76%). MS(ES 1)[M+H⁺]⁺ = 210.3.

Step 4 - Preparation of (2,4-d¡fluoro-3-[hydroxy-(5-phenylamino-1H-pyrrolo[2,3-b]pyr¡d¡n-3-yl)-meth Propan-1-sultanic acid ¡l]phenyl}-amide (71):

To phenyl-(-1H-pyrrolo[2,3-b]pyridin-5-yl)-amine (70, 17.0 mg, 0.09 mmol) in methanol (5.0 mL) was added potassium hydroxide (92.0 mg, 1.6 mmol ) and propane-1-sulfonic acid (2,4-difluoro-3-formyl-phenyl)-amide (73, 19.0 mg, 0.072 mmol, prepared as described in Example 7) under a nitrogen atmosphere. The reaction was stirred for 12 hours at room temperature. The reaction was concentrated and purified by column chromatography on silica gel eluting with 1% methanol in dichloromethane to give the compound (71.17 mg, 50%). MS(ES 1)[M+H⁺]⁺ = 473.5.

Step 5 - Preparation of [2,4-d¡fluoro-3-(S fen¡lam¡no-1H-pyrrolo[2,3-b]pyrid¡n-3-carbonyl)-phenyl]· amide of propan acid -1-sufonic (P-0848):

Propane-1-sulfonic acid {2,4-difluoro-3-[hydroxy-(5-phenylamino-1 H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenyl}-amide (71, 7.5 mg, 0.016 mmol) in tetrahydrofuran (3 mL) was added DessMartin periodane (6.70 mg, 0.0158 mmol) under a nitrogen atmosphere. The reaction was stirred for 20 minutes. The reaction was concentrated and purified by column chromatography on silica gel eluting with 1% methanol in dichloromethane to give the compound (P-0848, 6.2 mg, 84%). MS(ES1)[M+H⁺]⁺ = 471.2.

Propane-1-sulfonic acid P-[2,4-difluoro-3-(5-morpholin-4-yl-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-amide 0853, {2,4-difIuoro-3-[5-(4-methyl-piperidin-1-yl)-1H-pyrrolo[2,3-b]pyridin-3-carbonyl]-phenyl}-am propan-1-sulfonic acid P-0860 ida, and {2,4-difluoro-3-[5-(4-methyl-piperazin-1-yl)-1H-pyrrolo[2,3-b]pyridine Propan-1-sulfonic acid -3carbonylj-phenyl)-amide P-1246,

<img file="ECSP088121A_D0055.tif" />

were prepared using the protocol of Scheme 18, substituting aniline for morpholine, 4-methylpiperidine, and 4-methyl-piperazine, respectively, in Step 2. P-0853 MS(ESI) [M + H⁺]⁺ = 465.2. P0860 MS(ESI) [M+H⁺]⁺= 477.3. P-1246 MS(ESI) [M - H⁺]⁺ = 478.4.

4-[5-(3-Chloro-4-methoxy-phenylamino)-1H-pyrrolo[2,3-b]pyridin-3-carbonyl]-indole-1-carboxylic acid P-butylamide 1859 was prepared using the protocol of Scheme 18, substituting aniline for 3-chloro-4-methoxyphenylamine in Step 2 and propane-1-sulfonic acid (2,4-difluoro-3-formyl-phenyl)-amide. 73 with 4-Formyl-indole-1-carboxylic acid butylamide 519 (see Example 22) in Step 4. MS(ES1) [M +H⁺]⁺= 516.2.

Example 7: Synthesis of (2,4-difluoro-3-formyl-phenyl)-amide of propane-1-sulfonic acid 73.

Compound 73 was synthesized in two steps from 2,4-difluoro-phenylamine 42 as shown in Fig.

Scheme 19.

Scheme 19

<img file="ECSP088121A_D0056.tif" />

Step 1-Preparation of propane-1-sulfonic acid (2,4-difluoro-phenyl)-amide (72):

To 2,4-difluoro-phenylamine (42, 3.0 mL, 29.8 mmol) in tetrahydrofuran (50 mL) were added triethylamine (9.13 mL, 65.5 mmol) and propan-1-sulfonyl chloride (2.90 mL, 25.8 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into 1M HCI and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to give the compound (72, 2.0 g, 28%) which was used in the next step.

Step 2 - Preparation of propane-1-sulfonic acid (2,4-difluoro-3-formyl-phenyl)-amide (73):

Propan-1-sulfonic acid (2,4-difluoro-phenyl)-amide (72.1.5 g, 6.38 mmol) in tetrahydrofuran (10 mL) was cooled under a nitrogen atmosphere in an acetone/dry ice bath. at -78°C lithium diisopropylamide (0.80 M in tetrahydrofuran, 24 mL, freshly prepared from n-butyllithium and diisopropylamine) was added. After 30 minutes, N,Ndimethyl-formamide (542 pL, 7.018 mmol) was added dropwise to the reaction. The reaction was stirred for 30 minutes at -78 Ό and then allowed to warm to room temperature over 40 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% ethyl acetate in hexane to give a light yellow solid (73, 300 mg, 18%). MS(ESI)[MH⁺] = 262.3.

Example 8: Synthesis of [3-(5-bromo-1H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-phenyl]-amide of propane- 1-sultan P-1116.

Compound P-1116 was synthesized in four steps of 3-amino-benzoic acid ethyl ester 74 as shown in Scheme 20.

<img file="ECSP088121A_D0057.tif" />

Step /-Preparation of S-jpropan-l-sulfonylaminoj-benzbic acid ethyl ester (75):

To 3-amino-benzoic acid ethyl ester (74, 5.0 g, 0.030 mol) in methylene chloride (30.0 mL) were added pyridine (3.67 mL, 0.045 mol) and propan-1-sulfonyl chloride (3.75 mL, 33.0 mmol ). The reaction was stirred at room temperature for 2 hours. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and concentrated. The desired compound was isolated by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give a white solid (75.6.0 g, 74.1%).

Step 2 - Preparation of 3-(propan-1-sultanylamino)-benzoic acid (76):

To 3-(Propan-1-sulfonylamino)-benzoic acid ethyl ester (75, 1.60 g, 5.90 mmol) in water was added lithium hydroxide (1.0 g, 4.2 mmol) and tetrahydrofuran (20 mL). The reaction was stirred at room temperature overnight. The reaction mixture was acidified with 1N HCl, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and washed with ethyl acetate to give the compound (76.1.2 g, 84.5%) as a white solid. MS(ES1 )[MH⁺]⁺ = 242.1.

Step 3 - Preparation of 3-(propan-1-sulfonylamino)-benzoyl chloride (77):

A solution of 3-(propan-1-sulfonylamino)-benzoic acid (76.1.20 g, 4.93 mmol) in thionyl chloride was heated under reflux for 3.0 hours. Evaporation of the solvent gave compound 77 as a white solid which was used for the next step.

Step 4 - Preparation of [3-(5-bromo-1H-pyrrolo[2,3-b]-pyridin-3-carbon¡l)-phenyl]-amide of propan-1-sultanic acid (P-1116 ):

To aluminum trichloride (4.8 g, 36.0 mmol) in methylene chloride (70.0 mL), under a nitrogen atmosphere, was added 5-bromo-1H pyrrolo[2,3-b]pyridine (67, 797 mg, 4.04 mmol) was dissolved in methylene chloride (5.0 mL). The reaction was stirred at room temperature for 30 minutes, followed by the addition of 3-(propan-1-sulfonylamino)-benzoyl chloride (77, 1.10 g,

4.20 mmol) was dissolved in methylene chloride (4.0 mL). The reaction was stirred at room temperature for 2 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give a white solid (P1116, 300.0 mg). MS(ESI)[MH⁺]⁺ = 420.1,422.1.

Example 9: Synthesis of 5-chloro-1H pyrrolo[2,3-bjpyridine 80.

Compound 80 was synthesized in two steps from 5-bromo-1-triisopropylsilyl-7-azaindole 68 as shown in Scheme 21.

Scheme 21

Stage 1

Cl

No.

<img file="ECSP088121A_D0058.tif" />

<img file="ECSP088121A_D0059.tif" />

Stage 1 - Preparation of 5-chloro-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (79):

A 5-bromo-1-triisopropylsilyl-7-azandole (68, 1.60 g, 4.53 mmol, prepared as described in Example 6) in tetrahydrofuran (50.0 mL), under a nitrogen atmosphere at - 78 °C, tert-butyllithium (1.70 M in hexane, 6.12 mL) was added. The reaction was stirred for 1 hour, followed by the addition of hexachloroethane (1.29 g, 5.43 mmol). The reaction was stirred for 3 hours, poured into water, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give crude compound (79.1.60 g). MS(ESI)[M+H⁺]⁺ = 309.3.

Step 2 - Preparation 5-chloro-1H-pyrrolo[2,3-b]pyridine (80) /

To 5-chloro-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (79, 1.40 g, 4.53 mmol) in tetrahydrofuran (15 mL) was added tetra-n-butylammonium fluoride (1.42 g, 5.43 mmol). The reaction mixture was stirred at room temperature for 10 minutes. The reaction mixture was concentrated and isolated by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give the compound (80, 0.40 g. 58% over 2 steps). MS(ESI)[MH⁺]⁺ = 153.1.

5-Fluoro-1H-pyrrolo[2,3-b]pyridine 81

<img file="ECSP088121A_D0060.tif" />

was prepared using the protocol of Scheme 21, substituting N-fluoro-N(phenylsulfonyl)benzenesulfonamide for hexachloroethane in Step 1. MS(ES1) [M + H⁺]⁺=137.1.

Example 10: Synthesis of 2,4-difluoro-3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenol P-0078 and related compounds.

Compound P-0078 was synthesized in two steps from 5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine 89 as shown in Scheme 24.

Scheme 24

<img file="ECSP088121A_D0061.tif" />

P-0009 R=H

P-0042 R = Me

<img file="ECSP088121A_D0062.tif" />

Stage 1— Preparation of 2.4-difluoro-3-[hydroxy-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3¡l)methylphenol (P-0009):

To 2,4-difluoro-3-formyl-phenylester carbamic acid tert-butyl ester (39, 0.405 g, 15.7 mmol) in methanol (36 mL), under a nitrogen atmosphere, was added 5-pyridin-3-yl- 1H-pyrrolo[2,3-b)pyridine (89, 288.0 mg, 14.8 mmol, prepared as described in Example 17) and potassium hydroxide (145.0 mg, 25.9 mmol). The reaction was stirred at room temperature overnight. The reaction was then poured into water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and concentrated. The mixture was purified by column chromatography on silica gel eluting with 4% methanol in methylene chloride to give two separate compounds, a colorless oil (P-0009, 0.23 g, 44.1%, MS(ESI) [M+H⁺]⁺= 354.1), and a colorless oil (P-0042, 0.050 g, 9.2%, MS(ES1) [M₊HT= 367.1).

Step 2 - Preparation of 2,4-difluoro-3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)phenol (P0078):

A 2,4-difluoro-3-[hydroxy¡-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenol (P-0009 , 34.0 mg, 0.096 mmol) in acetonitrile (15 mL), trifluoroacetic acid (1.0 mL, 13.0 mmol) and triethylsilane (2.0 mL, 12.0 mmol) were added. The reaction was stirred at room temperature for 48 hours. The reaction mixture was poured into sodium bicarbonate solution, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give the compound (P-0078, 6.0 mg, 19%). MS(ES1 )[M + H⁺]⁺ = 338.1.

Additional compounds were prepared following the protocol of Scheme 24, replacing either or both of 2,4-difluoro-3-formyl-phenylester carbamic acid er--butyl ester 39 with an appropriate aldehyde and/or 5-pyridin-3-yl -1 H-pyrrolo[2,3-b]pyridine 89 with an appropriate azaindole in Step 1.

The azaindoles were purchased or synthesized as described in Examples 6 and 17. The aldehydes were prepared as described in Example 5 (via Step 2). Some compounds were isolated after Step 1, such as any hydroxy or methoxy derivatives. The following compounds were made following these procedures:

Propane-2-sulfonic acid {3-[(5-bromo-1 Hp¡rrolo[2,3-b]pyridin-3-¡l)-methox¡-methyl]-2,4-difluoro-phenylj-amide (P-0356),

Propane-2-sulfonic acid [3-(5-bromo-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,4-difluoro-phenylj-amide (P-0867 ), {2,4-difluoro-3-[methoxy-(5-p¡r¡d¡n-3-yl-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3- Propane-2-sulfonic acid ¡l)-methyl]-phenyl}-amide (P-0947), {3-[(5-bromo-1H-pyrrolo[2,3-b]pyridin- Propane-1 sulfonic acid 3-yl)-hydroxy-methyl]-2,4-difluoro-phenylj-amide (P-0188),

Propan-1-sulfonic acid [3-(5-bromo-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,4-d¡fluoro-phenylj-amide (P-0910), {2_:4-difluoro-3-[hydroxy-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenyl}- Dimethylamino-1 -sulfonic acid amide (P-0944),

Propane-1-sulfonic acid [2,4-difluoro-3-(5-phenylamino-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenyl]-amide (P-0818),

Propan-1-sulfonic acid [2,4-difluoro-3{5-phen¡I-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenyl]-amide (P0911),

Propane-1 Sulfonic Acid [2,4-difluoro-3-(5-morpholin-4-yl-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenyl]-amide (P-0964), {2,4-dif I uoro-3-[5-(4-methyl-piperidin-1-yl)-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl Propane-1-sulfonic acid ]-phenylj-am ¡dide (P-0984) and {2,4-difluoro-3-[hydroxy¡-(5-pyridin-3-yl-1H-pyrrolo) acid methyl ester [2,3-b]pyridin-3-yl)-methyl]-phenyl}carbamic (P-0065).

The following table indicates the aldehyde (column 2) and azaindole (column 3) used to give the subject compound (column 4). Column 1 gives the compound number and column 5 the observed mass. Compounds isolated after Step 1 of Scheme 24 are as indicated in column 1.

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+HT Observed</td>

<td>Stage 1 P-0356</td><td>0F TO. HN./ 7</td><td>vn</td><td>&gt; VM °/^brI hn-sH Sx/'N⁰^No. h</td><td> 474.1 476.1</td>

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [MIH'f Observed</td>

<td>P-0867</td><td>0F to. HN./ AND</td><td></td><td>F. I⁰Ύη f^ιν4ά SAn⁰^No. h</td><td> 460.2</td>

<td>Stage 1 P-0947</td><td>0F to. Yo*/,, AND</td><td>vn</td><td>Y¡i °vQ o Saint⁰^No. h</td><td> 459.2</td>

<td>Stage 1 P-0188</td><td>0 F to HN./ \</td><td>to^tl</td><td>^HOrO°^brI Saint⁰¹ h</td><td> 460 462</td>

<td>P-0910</td><td>⁰ f to HN./ \</td><td>^1χιτ 'N^No. h</td><td>F. rv⁰^ΒΎΊη</td><td> 444.1 446.1</td>

<td>Stage 1 P-0944</td><td>0F X; to</td><td></td><td>F. no^hw°/sAn°^No. h</td><td> 460.2</td>

<td>P-0818</td><td>0F to HN./ \</td><td>Q cough^No. h</td><td>QAO 9^HNtoY\¿hn-sa LL &gt; or \—</td><td> 457.1</td>

<td>P-0911</td><td>⁰ F ito HÑ./ \</td><td>YÍn</td><td>F. /Ί1 rA )⁰W⁰</td><td> 442.2</td>

<td>P-0964</td><td>⁰ F to</td><td>οΎ</td><td>F. Om rM ° Υ-χΥ c hn-s—\</td><td>449.3 γμ-ηΊ'</td>

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+II]⁺Observed</td>

<td>Ρ-0984</td><td>0F %</td><td>^No. h</td><td>F. &lt;0θ w°</td><td> 463.3</td>

<td>Stage 1 Ρ-0065</td><td>0F % CCf</td><td>UC_noh</td><td>Whoops. do nA 1 II 7^F h⁰A</td><td></td>

<td>Stage 1 Isolated</td><td>0F%Cu</td><td>^ci'and^zGoes vn</td><td>^ηοΛ) P^C.I f H°'^No. you</td><td></td>

<td>Stage 1 Isolated</td><td>c cu</td><td>^zYn 'OR</td><td>F&lt;^hW or -°n5 u^No. h</td><td></td>

<td>Stage 1 Isolated</td><td>0F στ</td><td>QC^No. h</td><td>^H&lt;iO or 05 CU u</td><td></td>

<td>Stage 1 Isolated</td><td>0F kJku</td><td>V h</td><td>VF Λ^hwθ I/Ux, II . Vx/UU ΝΌ yn^F h¹ h</td><td></td>

Example 11: Synthesis of N-[2,4-difluoro-3-(1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenylj-3-methoxybenzenesulfonamide P-0971.

Compound P-0971 was synthesized in four steps from 2,4-difluoro-phenylamine 42 as shown in Scheme 26.

Scheme 26

<img file="ECSP088121A_D0063.tif" />

<img file="ECSP088121A_D0064.tif" />

Step 1 - Preparation of N-(2,4-difluoro-phenyl)-3-methoxy-benzenesulfonamide (91);

To 2,4-difluoro-phenylamine (42, 0.44 mL, 4.4 mmol) in methylene chloride (10.0 mL), under a nitrogen atmosphere, were added pyridine (1.00 mL, 12.4 mmol) and 3-methox chloride. ¡benzenesulfonyl (1.00 g, 4.84 mmol). After 12 hours, the reaction was poured into cold 1M HCI and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give a light yellow solid (91, 0.90 g, 69%). MS(ESl)[M+H⁺]⁺ = 300.

Step 2 - Preparation of N-{2,4-d¡fluoro-3-[hydroxy-(1-triisopropylsilan¡!-1H-pyrrolo[2,3-b]p¡r¡d¡n-3- yl)·methyljphenyl)-3-methoxy-benzenesulfonamide (92);

A N-(2,4-difluoro-phenyl)-3-methoxy-benzenesulfonamide (91.0.148 g, 0.494 mmol) in tetrahydrofuran (10.0 mL) chilled in acetone/dry ice bath -78°C, under an atmosphere of nitrogen, lithium diisopropylamide (0.85 M in tetrahydrofuran, 1.45 mL, 1.23 mmol) was added dropwise. After 30 min, 1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-3-carbaldehyde (96, 0.15 g, 0.500 mmol, prepared as described in Example 12) was added dropwise into the reaction tetrahydrofuran (2.0 mL). The reaction was then stirred for 1 hour at -78°C and allowed to reach room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 40% ethyl acetate in hexane to give a light yellow solid (92, 0.080 g, 26.8%).

MS(ESI)[M+H⁺]⁺ = 602.

Step 3 - Preparation of N-{2,4-difluoro-3-[hydroxy-(1H-pyrrolo[2,3-b]pyridin-3yl)methyl]phenyl)-3-methoxybenzenesulfonamide (93)/

A N-{2,4-difluoro-3-[hydroxy¡-(1-triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridin-3-¡l)-methyl]-phenyl}-3-methoxybenzenesulfonamide ( 92, 0.075 g, 0.12 mmol) in tetrahydrofuran (3.0 mL), tetra-nbutylammonium fluoride (0.039 g, 0.15 mmol) was added. The reaction was stirred at room temperature for 20 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 3% methanol in dichloromethane to give a light yellow solid (93, 0.030 g, 55%). MS(ES1)[M+H⁺]⁺ = 446.

Step 4 - Preparation of N-[2.4-difluoro-3-(1H-pyrrolo[2,3-b]pyr¡d¡n-3-carbon¡l)phenyl]-3-methoxy¡benzenesulfonamide (P-0971) :

A N-{2,4-difluoro-3-[hydroxy-(1 H-pyrrolo[2,3-b]pyridin-3-yl)methyl]-phenyl}-3-methox¡-benzenesulfonam¡ da (93, 0.02 g, 0.05 mmol) in tetrahydrofuran (3.0 mL) was added Dess-Martin periodane (0.02 g, 0.015 mmol) under a nitrogen atmosphere. The reaction was stirred for 10 minutes at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 3% methanol in dichloromethane to give a light yellow solid (P-0971, 0.010 g, 50%). MS(ESl)[M+H⁺]⁺= 444.

Additional compounds were prepared following the protocol in Scheme 26, replacing 3-methoxy-benzenesulfonyl chloride with the appropriate sulfonyl chloride in Step 1. The following compounds were made following these procedures:

N-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-2,5-dimethoxy-benzenesulfonamide (P1131),

N-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-4-methoxy-benzenesulfonamide (P-0958),

Piperidine-1-sultanic acid [2,4-difluoro-3-(1 H-pyrrolo[2,3-b]pyrid¡n-3-carbon¡l)-phenyl]-amide ( P0952),

N-[2,4-Difluoro-3-(1 Hp¡rrolo[2,3-b]p¡r¡din-3-carbon¡l)-fen¡l]-4-tr¡fluoromethyl-benzenesulfonam go (P0931),

4-Butoxy-N-[2,4-difluoro-3-(1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-benzenesulfonamide (P-1006),

4-Chloro-N-[2,4-difluoro-3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-benzenesulfonamide (P-0937),

N-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3,4-dimethoxy-benzenesulfonamide, (P1090), and

3,4-Dichloro N-[2,4-difluoro-3-(1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-benzenesulfonamide (P4015).

The following table indicates the sulfonyl chloride (column 2) used to give the objective compound (column 3). Column 1 gives the compound number and column 4 gives the observed mass.

<td></td><td>sulfonyl chloride</td><td>Compound</td><td>MS(ESI) [M+H*]* Observed</td>

<td>P-1131</td><td>| SW₂IC °Ά</td><td>F, °^zjH.o</td><td> 474.2</td>

* piperidine-1-sulfonyl chloride prepared from sulfonyl chloride and piperidine in acetonitrile, refluxed for 8 hours, concentrated, and used without further purification.

Example 12: Synthesis of 1-triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridine-3-carbaldehyde 96.

Compound 96 was synthesized in two steps from 7-azaindole 94 as described in Scheme 27.

Scheme 27

<img file="ECSP088121A_D0065.tif" />

Step 1 - Preparation of 1H-pyrrolo[23-b]pyridine-3-carbaldehyde (95):

To 1H-Pyrrolo[2,3-b]pyridine (94, 16.0 g, 135 mmol) in water (110 mL), hexamethylenetetramine (26.0 g, 185 mmol), and acetic acid (55.0 mL, 967 mmol) were added. . The reaction was refluxed for 12 hours. Water (329 mL) was added and the reaction cooled to room temperature. The reaction was filtered and washed with water to give the compound (95.15.0 g, 76%). MS(ES1)[M+H⁺]⁺ = 147.

Stage 2 - Preparation of 1-tri¡soprop¡ls¡lanyl-1H-pyrrolo[2,3-b]pyrid¡n-3-carbaldehyde (96):

To 1H-Pyrrolo[2,3-b]pyridine-3-carbaldehyde (95, 4.05 g, 27.71 mmol) in tetrahydrofuran (30.0 mL) was added sodium hydride (60% in mineral oil, 1.5 g, 38 mmol) and triisopropylsilyl chloride (8.0 mL, 38 mmol) under a nitrogen atmosphere. The reaction was stirred for 2 hours at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% ethyl acetate in hexane to give the compound (96, 3.0 g, 36%). MS(ESl)[M+H⁺]⁺ = 303.

Example 13; Synthesis of 5-isopropyl-1H-pyrrolo[2,3-b]pyridine 99.

Compound 98 was synthesized in three steps from 5-bromo-1-triisopropylsilanyl-1H-pyrrolo[2,3bjpyridine 68 described in Scheme 28.

Scheme 28

<img file="ECSP088121A_D0066.tif" />

Step 1—Preparation of 2-(1-triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridin-5-yl)propan-2-ol (97): A 5-bromo-1-triisopropylsilanyl-1 H pyrrolo[2,3 -b]pyridine (68, 2.0 g, 5.66 mmol, prepared as described in Example 6) in tetrahydrofuran (20.0 mL), quenched in acetone/dry-ice bath -78 °C, under a nitrogen atmosphere, was tert--Butylthio (1.7 M in tetrahydrofuran, 7.3 mL, 12 mmol) was added dropwise. After 20 min, acetone (0.830 mL, 11 mmol) was added dropwise to the reaction. The reaction was stirred for 30 minutes at -78°C and then allowed to come to room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% ethyl acetate in hexane to give the compound (97.1.30 g, 69%). MS(ESI)[M+H⁺]⁺ = 333.

Step 2—Preparation of 5-isopropenyl-1H-pyrrolo[2,3-b]pyridine (98):

To 2-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-5-µl)propan-2-ol (97, 0.500 g, 1.5 mmol) in acetonitrile (10.0 mL) was added triethylsilane ( 1.00 mL, 6.3 mmol) and trifluoroacetic acid (0.50 mL, 6.5 mmol) under a nitrogen atmosphere. The reaction was refluxed for 3 hours, then cooled to room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 50% ethyl acetate in hexane to give the compound (98, 0.200 g, 84%). MS(ESI)[M+1¡Y=159.

Stage 3- Preparation of 5-isopropyl-1H-pyrrolo[2,3-b]pyridine (99):

To 5-¡sopropenyl-1H-pyrrolo[2,3-b]pyridine (98, 0.080 g, 0.501 mmol) in tetrahydrofuran (5.0 mL) was added 20% palladium hydroxide on carbon (5.0 mg). The reaction was stirred under hydrogen at 40 psi for 30 minutes. The reaction mixture was filtered and concentrated to give the compound (99, 0.078 g, 96%). MS(ESl)[M+H⁺]⁺ =161.

Example 14: Synthesis of 5-Methyl-1H pyrrolo[2,3-bjpyridine 101.

Compound 101 was synthesized in two steps from 5-bromo-1-triisopropylsilanyl-1H-pyrrolo[2,3bjpyridine 68 described in Scheme 29.

Scheme 29

br·

Stage 1

TIPS

N TIPS

100

Step 1 - Preparation of 5-Methyl-1-tri¡soprop¡ls¡lanyl-1H-pyrrolo[2,3-b]pyridine (100):

To PdCI₂(dppf) (0.04 g, 0.05 mmol) in toluene (10.0 mL) under a nitrogen atmosphere was added 5-bromo-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (68, 0.3 g, 0.8 mmol, prepared as described in Example 6, 1.0 mL in toluene) and methylmagnesium bromide (1.0 M in tetrahydrofuran, 3.0 mL, 3.0 mmol). The reaction was stirred at 90 °C for 2 hours and then allowed to reach room temperature. The reaction was poured into citric acid (0.1 M in water) and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 50% ethyl acetate in hexane to give the compound (100, 0.16 g, 60.0%). MS(ESI)[M+H⁺]⁺= 289.4.

Step 2 - Preparation of 5-Methyl-1H-pyrrolo[2,3-b]pyridine (101):

To 5-Methyl-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (100, 0.160 g, 0.55 mmol) in tetrahydrofuran (3.0 mL) was added tetra-n-butylammonium fluoride (0.145 g, 0.55 mmol ). The reaction was stirred for 1 hour at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 3% methanol in dichloromethane to give a light yellow solid (101.0.07 g, 95%). MS(ESI)[M+H⁺]⁺=133.2.

5-Methyl-1H-pyrrolo[2,3-b]pyridine was prepared following the protocol of Scheme 29, substituting ethylmagnesium bromide for methylmagnesium bromide in Step 1.

Example 15: Synthesis of 1-[2,4-difluoro-3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)phenyl]-3-propyl-urea P-0774 and related compounds.

Compound P-0774 was synthesized in two steps of {2,4-difluoro-3-[hydrox¡-(5-pyridin-3-yl-1H-pyrrolo[2,3b]pyridin-3) acid methyl ester -yl)-methyl]phenyl)-carbamic P-0065 described in Scheme 30.

<img file="ECSP088121A_D0067.tif" />

Step /-Preparation of 1-(2,4-difluoro-3-[hydroxy-(5-pyridin-3-yl-1H-pyrrolo[2,3b]pyridin-3yl)methyl]phenyl)-3-propyl-urea (103):

A acid methyl ester {2_:4-difluoro-3-[hydroxy-(5-pyridin-3-yl-1H-pyrrolo[2,3b]pyridin-3-yl.)-methyl]-phenyl}carbamic acid (P-0065, 30.0 mg, 0.07 mmol, prepared as described in Example 10) 1-propanamine (2.0 mL, 20 mmol) was added and the reaction was heated at 120 °C for 20 min in a CEM uncovered microwave instrument. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give the compound (103, 20.0 mg, 60%). MS(ES1 )[M+H⁺]⁺ = 438.51.

Step 2-Preparation of 1 -[2,4-difluoro-3-(5-pyridin-3-¡l-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]- 3propyl-urea (P-0774):

A 1 -{2,4-difluoro-3-[hydroxy¡-(5-pyridin-3-yl-1 H-pyrrolo[2,3b]pyridin-3-yl)-methyl]-phenyl}-3 -Propyl-urea (103, 20.0 mg, 0.04 mmol) in tetrahydrofuran (3 mL) was added Dess-Martin periodane (23.0 mg, 0.055 mmol) under a nitrogen atmosphere. The reaction was stirred for 10 minutes. The reaction was concentrated and purified by column chromatography on silica gel eluting with 1% methanol in dichloromethane to give the compound (P-0774, 6.0 mg, 30%). MS(ESl)[M+H⁺]⁺ = 436.5.

Additional compounds were prepared following the protocol in Scheme 30, replacing

1-propanamine with an appropriate amine and optionally replacing {2,4-difluoro-3-[hydroxy¡-(5-pyridin-3-yl-1H-pyrrolo[2,3b]pyridin-3-yl) acid methyl ester )-methyl]-phenyl}-carbamic

P-0065 with an appropriate carbamic acid methyl ester (see Example 10) in Step 1. The following compounds were made following these procedures:

-sec-Butyl-3-[2,4-difluoro-3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P- 1289),

-Cyclopentyl-3-[2,4-difluoro-3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]- urea (P-1317),

-Butyl-3-[2,4-difluoro-3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P- 1318),

-Butyl-3-[2,4-difluoro-3-(5-methoxy-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)phenyl]-urea (P-1567),

-[3-(5-Chloro-1 Hpyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-difluoro-phenyl]-3-(2-morpholin-4-¡l-ethyl) -urea (P1580),

-Butyl-3-[3-(5-chloro-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-2,4-d¡fluoro-phenyl ]-urea (P-1586),

Morpholine-4-carboxylic acid [3-(5-chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-difluoro-phenyl]-amide (P-1606),

-Butyl-3-[3-(5-chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-diffluoro-phenyl]-1-methyl-urea (P- 1612),

- Buty l-3-[2,4-dif I or oro-3-(5-methoxy-1 H-pyrrolo[2,3-b]pyridin-3-carbon yl)f en i I]-1 - methyl urea (P-1884),

Morpholine-4-carboxylic acid [2,4-diffluoro-3-(5-methoxy-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-amide (P-1894),

-Butyl-3-[2,4-difluoro-3-(1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-1-ethyl-urea (P-1983),

- Buti I-3-[2,4-dif luo ro-3-(5-methox¡-1H-p¡ rro lo[2,3-b]pyrid in-3-carbon i I)-phenyl] -1 -ethyl-urea (P-1994), and

[2,4-difluoro-3-(5-methox¡-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-fen¡l]-am¡da of the 3-diethylaminopyrrolidine-1-carboxylic acid (P-2015).

The following table indicates the amine (column 2) and carbamic acid methyl ester (column 3) used to give the objective compounds (column 4). Column 1 gives the compound number and column 5 the observed mass.

<td></td><td>Amine</td><td>carbamic acid methyl ester</td><td>Compound</td><td>I heard -σι &lt;M¡</td>

<td>Ρ-1289</td><td>η₂ν'^·</td><td>(O, hqV) or NN h</td><td>NN /0/</td><td> 450,4</td>

<td>Ρ-1317</td><td>νη₂ό</td><td>R.^Ηον~Ώ' or W^FHh</td><td>R. rO, VíO 0 li iVt ii^noA/o, ν^λνη^heither</td><td> 462.4</td>

<td>Ρ-1318</td><td>η₂ν</td><td>^hooh^noAvTf¡f°^{z N} h</td><td>nCuXP_hV lX?^F ΗHN^No.h</td><td> 450.5</td>

<td>Ρ-1567</td><td>Η_ΖΝ</td><td>R.^H(vD θ n^n^Π h</td><td>you NN h</td><td> 403.2</td>

<td></td><td>Amine</td><td>carbamic acid methyl ester</td><td>Compound</td><td>MS(ESI) [M+H*]¹· Observed</td>

<td>P-15S0</td><td>νη₂ 1 0</td><td>F, W&gt;JA or ΝN h</td><td>TO í ,1 ¿&gt;^F Η HN fj</td><td> 464.3</td>

<td>Ρ-1586</td><td>Η₂Ν</td><td>R. noja 0^c,rxY«^vΝN h</td><td>°jA oi ciyCryvj í &lt;D^F H H ν N</td><td> 407.3</td>

<td>Ρ-1606</td><td>ΗΰV</td><td>F.^h°HA^{0 c,}tYL^vΝN</td><td>I KNOW^αϊΜM? J vn^h year</td><td> 421.1</td>

<td>Ρ-1612</td><td>/ ΗΝ</td><td>F. Μθ^No. you</td><td>hey^αγγντγ vn</td><td> 421.3</td>

<td>Ρ-1884</td><td>/ ΗΝ</td><td>F^hgarlic YrVr</td><td>⁰ 1 ΧτγΗγ ΝN^No. h</td><td> 417.4</td>

<td>Ρ-1894</td><td>Η Η ν</td><td>xyj m W h</td><td>F, °rM 2 µm fh VA^h year</td><td> 417.4</td>

<td>Ρ-1983</td><td>!—ΝΗ</td><td>F. or JAA Ν N</td><td>Yí A m^F ηY^No. h</td><td> 401.4</td>

<td>Ρ-1994</td><td>rW. \</td><td>F. no ha o h</td><td>'GA 0 I come to</td><td> 431.4</td>

<td>Ρ-2015</td><td>Α</td><td>yh^zOnjη</td><td>^oτχΓ?^Ν AND ΤΝ ΜΉ</td><td> 472.4</td>

The intermediate from Step 1 of Scheme 30 can alternatively be reacted under reduced conditions to provide analogous compounds to which the carbonyl attached from the 3-position of azaindole to the phenyl ring is methylene. The product of Step 1 is a mixture of the 3-position hydroxyl and methoxy methyl linkage, which can be carried out via Step reduction as the mixture or can be isolated as either hydroxyl or methoxy for use in this reaction. This reduction is exemplified as follows using the product from Step 1 in the preparation of P-1567 to prepare 1-Butyl-3-[2,4-difluoro-3-(5-methoxy-1H-pyrrolo[2,3b ]pyridin-3-ylmethyl)-phenyl]-urea P-1571.

<img file="ECSP088121A_D0068.tif" />

Step 1 - Preparation of 1-Butyl-3-[2,4-difluoro-3-(5-methoxy-1H-pyrrolo[2,3-b]pyridin3-ylmethyl)-phenyl]-urea (P-1571):

A mixture of 1-Butyl-3-2,4-difluoro-3-[hydroxy-(5-methoxy¡-1H-pyrrolo[2,3-b]pyridin-3¡l)-methyl]-phenyl-urea (41 mg, 0.000081 mol, isolated from Scheme 30 Step 1), triethylsilane mL,

0.01 mol), and trifluoroacetic acid (1 mL, 0.01 mol) in 20 mL of acetonitrile was refluxed for 3 hours. The mixture was concentrated and the residue redissolved in ethyl acetate and sodium bicarbonate solution. The organic layer was collected and dried over MgSO₄. A creamy white solid was then obtained by chromatography (P1571.18 mg, 57%). MS(ESI) [MH⁺]⁺ = 389.2.

Additional compounds were prepared following the protocol of Step 1 of Scheme 30 followed by the previous reduction step as Step 2, where the product of Scheme 30 of Step 1 can be isolated as either the hydroxyl or methoxy derivative, or used as the mix, replacing 1-propanamine with an appropriate amine and {2,4-difluoro-3-[hydroxy-(5-pyridin-3-yl-1Hpyrrolo[2,3b]pyridin-3-yl)-methyl]- acid methyl ester phenyl}-carbamic P-0065 with an appropriate carbamic acid methyl ester (see Example 10) in Step 1. The following compounds were made following these procedures:

-Cyclopentyl-3-[2,4-difluoro-3-(5-methoxy¡-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenyl]-urea (P-1572),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,4-difluoro-phenyl]-3-cyclopentyl-urea ( P-1575),

-Butyl-3-[3-(5-chloro-1H-pyrrolo[2,3 b]pyridin-3-i Im ethyl)-2,4-diffluoro-phenyl]-urea (P1587),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyr¡d¡n-3-¡lmet¡l)-2,4-d¡fluoro-fen¡l]-3-( 2-morpholin-4-ylethyl)-urea (P-1594),

Morpholine-4-carboxylic acid [3-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,4-difluoro-phenyl]-amide (P-1595 ),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,4-difluoro-phenyl]-3-(2,2,2-trifluoroethyl )-urea (P-1601),

-Cyclopentyl-3-{2,4-difluoro-3-[5-(3-methanesulfonyl-phenyl)-1 H-pyrrolo[2,3-b]pyridin-3ylmethyl]-phenyl)-urea ( P-1615),

-Butyl-3-[3-(5-chloro-1H-pyrrolo[2,3-b]pyrid i η-3-yl methyl)-2,4-dif fluoro-phenyl]-1 -methyl- urea (P-1625),

1-[3-(5-Chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,4-difluoro-phenyl]-3-cyclopropylmethylurea (P-1652),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3- ylmethyl)-2,4-difluoro-phenyl]-3-(4-fluorophenyl)urea (P-1657) ,

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,4-difluoro-phenyl]-3-(4-fluoro-benzyl)urea (P-1654 ), and

3-Diethylamino-pyrrolidin-1-acid [2,4-difluoro-3-(5-methoxy-1 Hpyrrolo[2,3-b]pyridin-3-ylmethyl)-phenyl]-amide carboxylic (P-2014).

The following table indicates the amine (column 2) and carbamic acid methyl ester (column 3) used to give the objective compound (column 4). For carbamic acid methyl ester, R can be H or CH₃, where the compound is either a mixture of the two, or any of the isolated compounds where R is H or R is CH₃. Column 1 gives the compound number and column 5 the observed mass.

<td></td><td>Amine</td><td>carbamic acid methyl ester</td><td>Compound</td><td>MS(ESI) [M+H⁴]⁴Observed</td>

<td>P-1572</td><td>NH, or</td><td>R.^R3Jj 0 ^yMf ¡f</td><td>F_xYQ⁰ήΥ^F AND^No. " either</td><td> 401.2</td>

<td>P-1575</td><td>nh₂either</td><td>R.^R.Q.y~O 0^ciYv4f W^FHh</td><td>F, JQ⁰Y'Y^No. ΰ or</td><td> 405.2</td>

<td>P-1587</td><td>h₂no Yo</td><td>F^R0I⁰W^hh</td><td>D,P)^F ΗH^whatNN¹ h</td><td> 393.3</td>

<td></td><td>Amine</td><td>carbamic acid methyl ester</td><td>Compound</td><td>MS(ESI) [m-hT Observed</td>

<td>Ρ-1594</td><td>νη₂ό 0</td><td>F.^R0yO 0 αγνίνθ' W^FHh</td><td>and R^αΊΥγ Ü H NN h</td><td> 450.3</td>

<td>Ρ-1595</td><td>Η 0</td><td>^αϊϊν fi⁰NN h</td><td>F. &lt;0⁰θίγγξ Yn V V^h I</td><td> 407.2</td>

<td>Ρ-1601</td><td>η₂ν^ cf₃</td><td>F.^R0\-O 0^c'TyvV°^No. you</td><td>F, rM 9^ICW\ FNN^CF₃T,D&gt;^F ΗH³NN^No. h</td><td> 419.2</td>

<td>Ρ-1615</td><td>νη₂ό</td><td>VF GOES^No. B.</td><td>F. οίΥγΥτΛ¹ 'Ύ or</td><td> 525.2</td>

<td>Ρ-1625</td><td>/ ΗΝ</td><td>^rah)⁰°ίπΔ h</td><td>^c w? TO KN h</td><td> 407.3</td>

<td>Ρ-1652</td><td>η₂ν. Δ</td><td>AND.^R0uu or CMUjW liv hn^tono h</td><td>R. rO⁰^gl WI F Il JL?^F h h v NN 'h</td><td> 391.2</td>

<td>Ρ-1657</td><td>νη₂and F</td><td>F.^R0I or Δντ vn h</td><td>αΔΡλΡ I Xj^F ΗH NN¹ h</td><td> 461.2</td>

<td>Ρ-1654</td><td>νη₂Φ F</td><td>F.^R0yO 0 Ckzv ΖτχΛγυ' °ύΜ&gt; fb⁰Ύ'Ν h</td><td>F ΔΠ¹ θ v Cl-οΥγ_No.\w^FHH^No. h</td><td> 445.2</td>

<td>Ρ-2014</td><td>σ ñ</td><td>F. Yo^R.W⁰°rrwN^v^no no</td><td>i γΆ or °nv V</td><td> 458.4</td>

Example 16: Synthesis of 5-Methoxy-1H-pyrrolo[2,3-b]pyridine 104 and related compounds.

Compound 104 was synthesized in a 5-bromo-1 H-pyrrolo[2,3-b]pyridine step as described in Scheme 31.

Scheme 31

<img file="ECSP088121A_D0069.tif" />

104

Step 1 - Preparation of 5-Methoxy-1H-pyrrolo[2,3-b]pyridine (104):

To 5-bromo-7-azaindole (67, 500.0 mg, 2.53 mmol) in N,Ndimethylformamide (8 mL) were added copper(1)iodine (966 mg, 5.08 mmol) and sodium methoxide in methanol ( 3M, 5mL). The reaction was stirred overnight at 120 °C under an atmosphere of Argon. The reaction was poured into water, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give a white solid (104, 140 mg, 28%). MS(ESl)[M+H⁺]⁺ = 149.1. In an alternative method, 2.3 g (11.7 mmol) 5-bromo-7-azaindole (67, 2.3 g, 11.7 mmol) was dissolved in 75 mL Ν,Ν-dimethylformamide and 50 mL methanol (50 mL), adding methoxide. sodium (32 g, 0.6 mol) and copper-(l)bromine (3.2 g, 22.4 mmol) at room temperature. The reaction was stirred for three hours at 100 °C under an atmosphere of Argon. The mixture was diluted with ethyl acetate and poured into a solution of ammonium chloride: ammonium hydroxide (4:1). The organic layer was extracted with ammonium chloride:ammonium hydroxide (4:1), washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated by column chromatography on silica gel eluting with 30% to 70% ethyl acetate in hexanes to give a yellow solid (104, 0.27 g, 15.6%). MS(ESI) [M + H⁺]% 149.2.

5-Ethox¡-1 H-pyrrolo[2,3-b]pyridine 506

<img file="ECSP088121A_D0070.tif" />

was prepared using the protocol of Scheme 31, which replaces methanol with ethanol and sodium methoxide with sodium ethoxide.

5-(2-Methoxy-ethoxy)-1Hp¡rrolo[2,3-b]pyrid¡na 507

<img file="ECSP088121A_D0071.tif" />

was prepared using the protocol of Scheme 31, which replaces methanol with 2-Methoxy-ethanol and sodium methoxide with 2-Methoxy-sodium ethoxide (prepared from 2-Methoxyethanol and sodium hydride). MS(ES1) [M + H⁺]⁺ = 193.3.

Dietyl-[2-(1H-pyrrolo[2,3-b]pyridin-5-yloxy)-ethyl]-amine 508 was prepared using the protocol of Scheme 31, substituting methanol for 2-diethylamino- ethanol and sodium methoxide with sodium 2-diethylamino-ethoxide (prepared from

2,2-diethylamino-ethanol and sodium hydride). MS(ESI) [M + H⁺]⁺ = 234.5.

Example 17: Synthesis of 5-Pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine 89.

5-P¡r¡d¡n-3-¡l-1H-pyrrolo[2,3-b]pyrid¡na 89 was synthesized in one step from 5-bromo-1H-pyrrolo[2,3-b]pyr Idina 67 as described in Scheme 32.

<img file="ECSP088121A_D0072.tif" />

Step 1 - Preparation of 5-P¡ridin-3-¡l-1H-pyrrolo[2,3-b]pyridine (89).

To 5-bromo-7-azaindole (67, 1.00 g, 5.08 mmol) in water (13.0 mL) and acetonitrile (36 mL) were added pyridine-3-boronic acid (609, 1.0 g, 8.1 mmol), potassium carbonate (1-79g,

0.0130 mol) and Tetrakis(triphenylphosphine)palladio(0) (50.0 mg, 0.043 mmol) under a nitrogen atmosphere. The reaction mixture was heated at 170 °C overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography on silica gel eluting with 25% ethyl acetate in hexane to give a light yellow solid (89.820 mg, 82%). MS(ESI)[M+H⁺]⁺ = 196.1.

Additional compounds were prepared following the protocol in Scheme 32, in which pyridine-3-boronic acid is replaced with an appropriate botanical acid or 5-bromo-7-azaindole is replaced with 5-(4,4,5,5-Tetramethyl- [1,3,2]dioxaborolan-2-yl)-1 H pyrrolo[2,3-b]pyridine and reacting with a suitable aryl or heteroaryl halide (i.e., coupled with the boronic acid ester on the azaindole, and the halide in the group to couple to position 5 of the azaindole). The following compounds were prepared by these procedures:

5-(4-Chloro-phenyl)-1 H pyrrolo[2,3-b]pyridine (514),

5-(4-Fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridine (605),

5-phenyl-1H-pyrrolo[2,3-b]pyridine,

5-(6-Methoxy-pyridin-3-¡l)-1 Hp¡rrolo[2,3-b]pyridine,

5-(2-Methoxy-pyrimidin-5-yl)-1H-pyrrolo[2,3-b]pyridine,

5-Pyridin-4-yl-1H-pyrrolo[2,3-b]pyridine,

4-(1H-Pyrrolo[2,3-b]pyridin-5-yl)-benzenesulfonamide,

3-(1H-Pyrrolo[2,3-b]pyridin-5-yl)-benzenesulfonamide,

5- Pyrimidin-5-yl-1H-pyrrolo[2,3-b]pyridine, 5-(3-Methanesulfonyl-phenyl)-1H-pyrrolo[2,3-b]pyridine (P-0173), and

3-(1H-Pyrrolo[2,3-b]pyridin-5-yl)-benzamide (P-1622).

The table below lists either 5-bromo-7-azaindole or 5(4,4,5,5-Tetramethyl-[1,3,2]dioxaborolan-2-yl)-1H-pyrrolo[2,3] starting material -b]pyridine (column 1) and the appropriate reagent to be coupled to the 5-position of the azaindole (column 2) to give the resulting compound (column 3), with the observed mass determined in column 4.

<td>Start Azaindole</td><td>Reagent attached to position 5</td><td>Compound</td><td>MS(ESI) Observed</td>

<td>^ΒΎΡ^No. «</td><td>B(OH)₂Q Cl</td><td>h</td><td> 229.1</td>

<td>^ΒγΎ3</td><td>B(OH&gt;2q F</td><td>h</td><td> 213.1</td>

<td>^ΒΥΓ&gt;</td><td>B(OH)_zEITHER</td><td>xqq</td><td> 195.2</td>

<td>^No. h</td><td>B(OH)₂ 0 0—</td><td></td><td> 226.2</td>

<td>^B.YT&gt; No.</td><td>either^No.~í_</td><td>μ^no or</td><td> 227.2</td>

<td>Start Azaindole</td><td>Reagent attached to position 5</td><td>Compound</td><td>MSQESI) [M+H*]* Observed</td>

<td> °^B.m</td><td>AND 0*'b</td><td>0.0 Ύ Ύ</td><td> 274.1</td>

<td>and °^B.w</td><td>βΧΧ,ΝΗζ oh</td><td>ΗζΝθΡγ^ do VN Η</td><td> 274.1</td>

<td>and °Yp^no ñ</td><td>V-Br_No.=y</td><td>TO^No.'</td><td> 197.2</td>

<td>^brW Λ</td><td> /0</td><td>or Vv^No. h</td><td> 273.1</td>

<td>^brYY Υ|^ΛΝ^No. Η</td><td>QbB(OH)₂h₂n-&lt; 0</td><td>Η₂ΝγΟΥρ, 0N*™^No. h</td><td> 238.2</td>

Example 18: Synthesis of 3-(4-(4-chlorobenzyloxy)-3-methoxybenzyl)-1H-pyrrolo[2,3bjpyridine P-1247.

[Compound P-1247 was synthesized in three steps from 4-hydroxy¡-3-methoxybenzaldehyde 105 as shown in Scheme 33.

Scheme 33 or

<img file="ECSP088121A_D0073.tif" />

<img file="ECSP088121A_D0074.tif" />

Stage 1 - Preparation of 4-(4-chlorobenzyloxy¡)-3-methoxybenzaldehyde (106).

To 4-hydroxy-3-methoxybenzaldehyde (105,600.0 mg, 3.94 mmol) and 4-chlorobenzyl bromide (557, 1.20 g, 5.84 mmol) in acetonitrile (6 mL) was added potassium carbonate (0.390 g 2.82 mmol). The reaction was heated in the microwave at 300 watts, 120° for 10 minutes. The reaction was extracted with ethyl acetate and water. The organic layer was washed with brine, dried over magnesium sulfate, filtered, and the volatiles removed by evaporation. The desired compound was purified by recrystallization from hexanes to provide 106 (1.01 g, 93%). MS(ESI) [MH⁺]⁺ = 275.1.

Step 2 - Preparation of 3-((4-(4-chlorobenzyloxy)-3-methoxyphenyl)(methoxy)methyl)-1Hpyrrolo[2,3-b]pyridine (107).

To 1H-Pyrrolo[2,3-b]pyridine (94, 0.235 g, 1.99 mmol) and 4-(4-chlorobenzyloxy)-3-methoxybenzaldehyde (106, 0.500 g, 1.81 mmol) was added 5 mL of methanol followed by the addition of solid potassium hydroxide (0.203 g, 3.61 mmol). The reaction was left at room temperature for 18 days. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was separated and the volatiles removed to give a solid which was slurried in hot ethyl acetate. The suspension was allowed to cool and the solid was collected by vacuum filtration to give 107 (548 mg, 74%). MS(ESI) [M+H⁺]⁺= 409.4.

Step 3 - Preparation of 3-(4-(4-chlorobenzyloxy¡)-3-methoxybenzyl)-1H-pyrrolo[2,3bjpyridine (P-1247).

A 3-((4-(4-chlorobenzyloxy)-3-methoxyphenyl)(methoxy¡)methyl)-1H-pyrrolo[2,3-b]pyrid¡ne (107, 0.548 g, 1.34 mmol ) in acetonitrile (20 mL) was added trifluoroacetic acid (1.7 mL, 2.21 mmol) and triethylsilane (3.47 mL, 2.17 mmol). The reaction was stirred at 60 °C for 15 hours. The volatiles were removed and the desired compound was purified by silica gel chromatography, eluting with a 0% to 60% gradient of ethyl acetate in hexanes to give a white solid (P-1247, 505 mg, 99%). MS(ESI) [M+H⁺]⁺ = 379.4.

Additional compounds were prepared using the protocol of Scheme 33, Steps 2 and 3, replacing 4-(4-chlorobenzyloxy)-3-methoxy¡benzaldehyde 106 with a suitable aldehyde (prepared as described in Example 34), and optionally replacing 1 H-Pyrrolo[2,3-b]pyridine 94 with an appropriate substituted 7-azaindole (see Example 9 or Example 16) in Step 2. The following compounds were made following these procedures:

3-[3-Methoxy-4-(4-trifluoromethyl-benzyloxy)-benzyl]-1 H-pyrrolo[2,3-b]pyridine (P-1721),

3-[3-Trifluoromethyl-4-(4-trifluoromethyl-benzyloxy)-benzyl]-1H-pyrrolo[2,3-b]pyridine (P1797),

3-{3-Methoxy-4-[4-(4-methyl-piperazin-1-ylmethyl)-benzyloxy]-benzyl}-1H-pyrrolo[2,3bjpyridine (P-1821),

3-[4-(4-Chloro-benzyloxy)-2-fluoro-5-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-1844),

3-(4-(3-Fluoro-4-trifluoromethyl-benzyloxy¡)-3-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-1849),

3-[4-(4-Chloro-3-trifluoromethyl-benzyloxy)-3-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P1851),

2-[2-Methoxy¡-4-(1H-pyrrolo[2,3-b]pyr¡din-3-¡lmethyl)phenoxymethyl]-1H-benzoimidazole (P-

1870),

3-[4-(4-Chloro-2-fluoro-benzyloxy)-2-fluoro-5-methoxy-benzyl]-5-methoxy¡-1H-pyrrolo[2,3bjpyridine (P-1885),

3-(4-(3,4-Dichloro-benzyloxy)-3-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-1886),

3-[4-(4-Chloro-benzyloxy)-3-fluoro-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-1896),

2-[2-Fluoro-4-(1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenoxymethyl]-1H-benzoimidazole (P-

1899),

3-(4-Benzyloxy-2,5-difluoro-benzyl)-1H-pyrrolo[2,3-b]pyridine (P-1901),

5-Chloro-3-[4-(4-chloro-benzyloxy¡)-2-fluoro-5-methoxy¡-benz¡l]-1H-pyrrolo[2,3-b]pyridine (P-1970),

5-Chloro-3-[4-(4-chloro-2-fluoro-benz¡lox¡)-2-fluoro-5-methoxy¡-benzyl]-1H-pyrrolo[2,3b]pyridine (P-1972 ),

3-[4-(4-Chloro-2-fluoro-benzyloxy)-2-fluoro-5-methoxy-benz¡l]-1H-pyrrolo[2,3-b]pyr¡d¡na (Ρ- 1973),

2-[4-(5-Chloro-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-ylmethyl)-5-fluoro-2-methoxy¡-phenox¡methyl]- 1 Hbenzoimidazole (P-1976),

2-[5-Fluoro-2-methoxy-4-(5-methoxy-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-ylmethyl)-phenoxymethyl]-1 Hbenzoimidazole (P-1977),

2-[5-Fluoro-2-methoxy¡-4-(1 Hp¡rrolo[2,3-b]p¡r¡din-3-ylmethyl)-phenoxymethyl]-1 H-benzoimidazole (P-1978),

3-{4-[2-(2-Bromo-ethoxy)-ethoxy]-2-fluoro-5-methoxy-benzyl}-5-chloro-1H-pyrrolo[2,3bjpyridine (P-1984),

5-Chloro-3-[2,5-difluoro-4-(2-methoxy-ethoxy¡)-benz¡l]-1H-pyrrolo[2,3-b]pyridine (P-1986), 5-Chloro -3-[2-fluoro-5-methoxy-4-(2-methoxy-ethoxy)-benzyl]-1H-pyrrolo[2,3-b]pyridine (P1990), {3-[4-(5- Chloro-1 H-pyrrolo[2,3-b]pyrid¡n-3-ylmethyl)-5-fluoro-2-methoxy-phenox¡]-propyl}diethyl-amine (P-2004) ,

5-Chloro-3-{2-fluoro-5-methoxy-4-[2-(2-methoxy¡-ethoxy¡)-ethoxy¡]-benz¡l}-1H-pyrrolo[2,3bjpyridine (P- 2002),

3-(4-Benzyloxy-2,6-difluoro-benzyl)-1H-pyrrolo[2,3-b]pyridine (P-2022),

3-{2-FlLioro-5-methoxy-4-[2-(2-methoxy-ethoxy)-ethoxy¡]-benzyl}-5-methoxy-1H-pyrrolo[2,3bjpyridine (P-2025), and

3-{2-Fluoro-5-methoxy-4-[2-(2-methoxy-ethoxy)-ethoxy]-benzyl}-1 H-pyrrolo[2,3-b]pyridine (P2026).

The following table indicates the aldehyde (column 2) and azaindole (column 3) used to give the objective compound (column 4). Column 1 indicates the compound number and column 5 the observed mass.

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [m+hT Observed</td>

<td>Ρ-1721</td><td>cf₃^Η UJ or.</td><td>CO^No. he</td><td>and f|</td><td> 413.2</td>

<td>Ρ-1797</td><td>cf₃V. or^hylt ΥΌ cf₃</td><td>Co^No. »</td><td>V-_to</td><td> 451.3</td>

<td>Ρ-1821</td><td>t—\-N_hKp° 0-</td><td>Co</td><td>H 0 N-⁷ /</td><td> 457.4</td>

<td>Ρ-1844</td><td>Cl n or TLJ</td><td>CO Of|</td><td>F, rH-0 froY)- yy /</td><td> 397.2</td>

<td>Ρ-1849</td><td>cf₃⁰ líV^ΗΎχΥ</td><td>Co^No. B.</td><td>oCy⁰'^⁰'¹' '[ψN/p¹ h^F</td><td> 432.4</td>

<td>Ρ-1851</td><td>Cl^{0 F3C}EITHER</td><td>00 N'1</td><td></td><td></td>

<td>Ρ-1870</td><td>9 HNy</td><td>co^No. No.</td><td>&gt;r N ! h</td><td> 385.4</td>

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESrj [M+rfT Observed</td>

<td>Ρ-1885</td><td>IG 0F Α^ΗΥ1 Ύ&gt; η-0 Οχ</td><td>TO</td><td>R. Ww- V'N / /</td><td> 445.3</td>

<td>Ρ-1886</td><td> ° ^ΗΥιτ Οχ</td><td>Ú3 TO</td><td>γτΓΥο⁰¹^No. B' «</td><td> 413,3</td>

<td>Ρ-1896</td><td>x</td><td> 0% ^No. you</td><td>what</td><td> 367.3</td>

<td>Ρ-1899</td><td>Ρ HN.7J F</td><td>QC h</td><td>V-¡j^F 8</td><td> 373.4</td>

<td>Ρ-1901</td><td>ρ ο γψ F</td><td>ΓΡ</td><td>ιΎ^F¹ h</td><td> 351.4</td>

<td>Ρ-1970</td><td>Cl Ρ f λ^Η Til Τ SV Οχ</td><td>^αΌ3 'TO</td><td>F /-A-0^αγγ07 A'</td><td> 431.2</td>

<td>Ρ-1972</td><td>Cl 0 f λ^hvl j^FΤΌ Οχ</td><td>^C.'O3^No. h</td><td>k^c,yv^⁼^°^vhEITHER'^ci/c' h^r</td><td> 449.2</td>

<td>Ρ-1973</td><td>Cl £1 ή^h lI J f Οχ</td><td>PC^F'tl</td><td>F fYS ;₀^mR.^clw Ν / v</td><td> 415.3</td>

<td>Ρ-1976</td><td>Q_F HN^N °X~\JHA either-</td><td>^c,o3¹ h</td><td>ΤεΥήΟ Srjj'H</td><td> 437.3</td>

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+H? Observed</td>

<td>Ρ-1977</td><td>ρ ην^ν χχγ ο—</td><td>^¿O3O</td><td>AND /-Q-°_v τγγ UQ /° nAy n N / H</td><td> 433.4</td>

<td>Ρ-1978</td><td>Ρ θΛΥΧ Η 'Υ ο—</td><td> 03 ^No.h</td><td>AND</td><td> 403.4</td>

<td>Ρ-1984</td><td>0 hVy⁰'-Ί</td><td>“Ό3^no 0</td><td>ΝN^m h</td><td> 457.4 459.4</td>

<td>Ρ-1986</td><td>^F o /</td><td>^σΌ3Y</td><td>F. zAo Yn&gt; 3&gt;_ Ύν</td><td> 353.4</td>

<td>Ρ-1990</td><td>AND /°_ζo</td><td>^ICTY h</td><td>F^clAND 1 7 θn—^No. B'</td><td> 3653</td>

<td>Ρ-2004</td><td>fo P</td><td>°Yp vn</td><td>^Fh X wW vQ p h</td><td> 420.4</td>

<td>Ρ 2002</td><td>either^Fk^Χ°Δ_hHQ-o^° 0-</td><td>^c,O3 Y</td><td>_C1YVA-°W°^no to^z</td><td> 409.3</td>

<td>Ρ-2022</td><td>⁰ Yo F^TOTO)'''^xj0</td><td> 03</td><td>I θ5^Fvn</td><td> 438.1</td>

<td>Ρ-2025</td><td>or AND VQ-o^° o-</td><td>^¿o3^No. h</td><td>AC IX 2 7° Ki N^zh</td><td> 405.2</td>

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+HT Observed</td>

<td>P-2026</td><td>or AND either-</td><td>CO</td><td>tete /</td><td> 373.2</td>

Example 19: Synthesis of [3-(5-bromo-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2fluoro-phenyl]-amide of propane-1-sulfonic acid P-0955 and related compounds.

As an alternative method to Example 2, compound P-0955 was synthesized in nine steps from 4-chloro-2-fluoro-phenylamine 47 as shown in Scheme 37.

Scheme 37

Stage 1 BnO

<img file="ECSP088121A_D0075.tif" />

Step 1 - Preparation of 3-Amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48).

To 4-chloro-2-fluoro-phenylamine (47, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), quenched with a dry ice/acetone bath under a nitrogen atmosphere, n-butyllithium (2.50 M in hexane, 24.4 mL) was added slowly. After 20 min, 1,2Bis-(chloro-dimethyl-silanyl)-ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was slowly added to the reaction. After 1 hour, n-butyllithium (2.50 M in hexane, 25.0 mL) was slowly added to the reaction. The reaction was stirred at -78 °C for 20 minutes and then allowed to warm to room temperature over 60 minutes. The reaction was cooled slowly to -78 °C, followed by the addition of n-butyllithium (2.50 M in hexane, 26.0 mL). After 80 min, benzyl chloroformate (10.0 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 °C overnight followed by the addition of water (80 mL) and concentrated hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature over 2 hours. The organic layer was separated. The aqueous layer was made alkaline with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated by column chromatography on silica gel (20% ethyl acetate/hexane) to give a colorless oil (48, 12.5 g, 78.3%). MS(ESI) [M+H⁺]⁺= 280.0.

Step 2 - Preparation of 6-chloro-2-fluoro-3-(propan-1-sulfonylamino)-benzoic acid benzyl ester (49):

To 3-amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48.1.20 g, 4.3 mmol) in methylene chloride (28 mL) was added pyridine (0.52 mL, 6.4 mmol) and propanesulfonyl chloride (0.685 g, 4.8 mmol). The reaction was stirred at room temperature overnight, then poured into water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated with silica gel column chromatography to give a colorless oil (49, 960 mg, 58.0%). MS(ESI) [MH⁺]' = 384.1.

Step 3 - Preparation of 6-chloro-2-fluoro-3-(propan-1-sulfonylamino)benzoic acid (115);

To 6-chloro-2-fluoro-3-(propan-1-sulfonylamino)-benzoic acid benzyl ester (49, 6.00 g, 15.6 mmol) in tetrahydrofuran (100 mL) was added 1.0 M potassium hydroxide (100 mL). The reaction was refluxed overnight. The reaction was poured into water, acidified to pH 2 with 1N hydrochloric acid, and extracted with ethyl acetate. The organic portion was dried over anhydrous sodium sulfate, filtered, and concentrated to give a white solid 115 (3.95 g, 85.8%).

Step 4 - Preparation of 2-fluoro-3-(propan-1-sulfonylamino)-benzoKO acid (50);

To 6-chloro-2-fluoro-3-(propan-1-sulfonylamino)-benzoic acid (115, 0.69 g, 2.3 mmol) in methanol (10 mL) was added 20% palladium hydroxide on carbon (200 mg). The reaction was stirred under hydrogen at 50 psi for 2 hours. The reaction was filtered and concentrated to give a white solid which was used in the next step. MS(ESI) [MH⁺] =260.1.

Step 5 - Preparation of 2-fluoro-3-(propan-1-sulfonylamino)~benzoic acid methyl ester (501):

To 2-fluoro-3-(propan-1-sulfonylaminoj-benzoic acid (50, 5.05 g, 0.0193 mol) in methylene chloride (100 mL) was added N,N-dimethylformamide (0.075 mL, 0.97 mmol). under a nitrogen atmosphere.The reaction was quenched with ice/water, followed by the slow addition of oxalyl chloride (2.00 M in methylene chloride, 10.8 mL, 21.6 mmol).The reaction mixture was stirred at room temperature for 3.0 hours. The reaction was quenched slowly with ice/water, followed by the addition of methanol (36.0 mL, 0.89 mol). The reaction was stirred at room temperature overnight. The reaction was concentrated and purified with silica gel column chromatography eluting with 30% ethyl acetate in hexane to give a crude white solid 4.0g.

Step 6- Preparation of (2-fluoro-3-hydroxymethyl-phenyl)-amide of propane-1sulfonic acid (502):

To 2-fluoro-3-(propan-1-sulfonylamino)-benzoic acid methyl ester (501, 3.80 g, 13.8 mmol) in tetrahydrofuran (133 mL) was added lithium tetrahydroaluminate (1.00 M in tetrahydrofuran, 20.0 mL, 20.0 mmol) under a nitrogen atmosphere at room temperature. The reaction was stirred at room temperature for 8 hours, followed by the addition of 10 g of NaSO₄-10H₂0. After 12 hours, the reaction was filtered, concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give a white solid (502.3.0 g, 87.9%).

Step 7- Preparation of propane-7-sulfonic acid (2-fluoro-3-formyl-phenyl)-amide (503):

To propane-1-sulfonic acid (2-fluoro-3-hydroxymethyl-phenyl)-amide (502, 0.20 g, 0.81 mmol) in tetrahydrofuran (5.0 mL) was added Dess-Martin periodinane (0.377 g, 0.89 mmol). . The reaction was stirred at room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give a white solid (503,100 mg, 50.0%). MS(ES1) [MH⁺]⁺ = 244.1.

Step 8- Preparation of {3-[(5-bromo-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxy-methyl]-2fluoro-phenyl}-amide of propane-1-sulfonic acid ( 504):

To 5-bromo-7-azaindole 67 (312 mg, 1.58 mmol) in methanol (28 mL) was added propane-1-sulfonic acid (2-fluoro-3-formyl-phenyl)-amide (503, 370 mg, 1.5 mmol) and potassium hydroxide (422.8 mg, 7.5 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the desired compound as a white solid (504, 300 mg, 45.0%).

Step 9 - Preparation of [3-(5-bromo-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4difluoro-phenylj-amide of propane-1-sultanic acid (P-0955):

A {3-[(5-bromo-1 H-pyrrolo[2,3-b]pyrid¡n-3-yl)-hydroxy-methyl]-2-fIuoro-phen¡I}-amide of propane acid -1-sulfonic acid (504, 0.650 g, 1.47 mmol) in tetrahydrofuran (25.0 mL) was cooled with ice/water and Dess-Martin periodinane (0.748 g, 1.76 mmol) was added. The reaction was stirred at room temperature for 15 minutes. The reaction was poured into water containing sodium thiosulfate and potassium carbonate and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane and washed with ethyl acetate to give a white solid. (P-0955, 0.35g, 54.1%). MS(EST) [M+H⁺]⁺ = 460.0, 462.0.

Butane-1-sulfonic acid [3-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2-fluoro-phenyl]-amide P-1250 was prepared following the protocol of Scheme 37 , which replaces propane-2-sulfonyl chloride with butane-1-sulfonyl chloride in Step 1 and 5-bromo-1H-pyrrolo[2,3bjpyridine 67 with 5-chloro-1H-pyrrolo[2,3-b ]pyridine 80 (see Example 9) in step 8.

MS(ESI) [MH⁺] = 408.1.

Propan-1-sulfonic acid [2-fluoro-3-(5-methoxy¡-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-amide P-1256

<img file="ECSP088121A_D0076.tif" />

was prepared following the protocol of Scheme 37, which replaces 5-bromo-1H pyrrolo[2,3-b]pyridine 67 with 5-methoxy¡-1 H-pyrrolo[2,3-b]pyridine 104 (see Example 16) in step 8. MS(ESI) [M — H⁺]= 390.1.

N-[3-(5-chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2-fluoro-phenyl]benzenesulfonamide

P-1255

<img file="ECSP088121A_D0077.tif" />

was prepared following the protocol of Scheme 37, which replaces propane-2-sulfonyl chloride with benzenesulfonyl chloride in Step 1 and 5-bromo-1H-pyrrolo[2,3b]pyridine 67 with 5-chloro -1H-pyrrolo[2,3-b]pyridine 80 (see Example 9) in step 8.

MS(ESI) [Μ - H¹] = 428.0.

Example 20: Synthesis of 3-3-[2,6-difluoro-3-(propan-1-sulfonylamino)benzoyl]-1H-pyrrolo[2,3-b]pyridin-5-yl-propionic acid P-1270.

Compound P-1270 was synthesized in three steps from propan-1-acid [3-(5-bromo-1 H-pyrrolo[2,3b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-amide -sulfonic P-0773 as shown in Scheme 38.

Scheme 38

<img file="ECSP088121A_D0078.tif" />

<img file="ECSP088121A_D0079.tif" />

Step 1 - Preparation of (E)-3-3-[2,6-difluoro-3-(propan-1sulfonylamino)-benzoyl)-1Hpyrrolo[2,3-b]pyridin-5-yl-acrylic acid methyl ester (505 ):

Propan-1-sulfonic acid A [3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-amide (P-0773, 125.0 mg, 0.27 mmol, prepared as described in Example 4) in Ν,Ν-dimethylformamide (4.0 mL) were added palladium acetate (15 mg, 0.068 mmol), triphenylphosphine (36 mg, 0.14 mmol), methyl acrylate ( 0.098 mL, 1.1 mmol) and triethylamine (0.114 mL, 0.82 mmol) under a nitrogen atmosphere. The reaction was stirred at 140 C overnight, then poured into water, acidified with water, and extracted with ethyl acetate. To the methylene chloride filtrate (5.0 mL) was added 1,8-diazabicyclo[5.4.0]undec-7-ene (0.50 mL, 3.3 mmol). The reaction was stirred at room temperature for 3 hours. The reaction was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give a light yellow oil which was used directly in the next step.

Step 2 - Preparation of 3-3-[2,6-dlfluoro-3-(propan-1-sulfonylamino)benzoyl]-1H-pyrrolo[2,3-b]pyridin-5-yl-acrylic acid (P- 1269):

A (E)-3-3-[2,6-difluoro-3-(propan-1-sulfonylamino)-benzoyl]-1Hpyrrolo[2,3-b]pyridin-5-yl-acrylic acid methyl ester (100.0 mg, 0.22 mmol) in tetrahydrofuran (5.0 mL) and water (1.50 mL) was added lithium hydroxide (21 mg, 0.86 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water, acidified with 1N HCl to pH around 1, then extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give a white solid (P-1269.30mg). MS(ESI) [MH⁺] = 448.0.

Step 3 - 3-3-[2,6-difluoro-3-(propan-1-sulfonylamino)-benzo¡l]-1H-pyrrolo[2,3b]p¡r¡d¡n-5-¡l acid -prop¡on (P-1270):

3-3-[2,6-Difluoro-3-(propan-1-sulfonylamino)-benzoyl]-1H-pyrrolo[2,3b]pyridin-5-yl-acrylic acid (P-1269, 20.0 mg, 0.045 mmol) in methanol (5.0 mL) was added 20% Pd(OH)2/C (10 mg) under an atmosphere of hydrogen. The reaction was stirred at room temperature for 2 hours. The reaction mixture was filtered, concentrated and purified by column chromatography on silica gel eluting with 10% methanol in methylene chloride to give a white solid (P-1270, 8.8 mg). MS(ESI) [MH⁺] = 450.1.

Example 21: Synthesis of (2,4-difluoro-3-formyl-phenyl)-amide of thiophene-2-sulfonic acid 508.

Compound 512 was synthesized in four steps from 2,4-difluoro-phenylamine 42 as shown in Scheme 39.

Scheme 39

F

F

<img file="ECSP088121A_D0080.tif" />

OF

<img file="ECSP088121A_D0081.tif" />

509

<img file="ECSP088121A_D0082.tif" />

<img file="ECSP088121A_D0083.tif" />

Stage 1 - Preparation of 3-am¡no-4,2-d¡fluoro-benzo\co acid ethyl ester (509):

To 4,2-difluoro-phenylamine (42, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), quenched with dry ice/acetone under a nitrogen atmosphere, n-butyllithium (2.50 M in hexane, 24.4 mL) was added slowly. After 20 min, 1,2-Bis-(chloro-dimethylsilanyl)-ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was slowly added to the reaction. After 1 hour, n-butyllithium (2.50 M in hexane, 25.0 mL) was slowly added to the reaction. The reaction was stirred at -78 °C for 20 minutes and then allowed to warm to room temperature over 60 minutes. The reaction was cooled slowly to -78 °C, followed by the addition of n-butyllithium (2.50 M in hexane, 26.0 mL). After 80 minutes, ethyl chloroformate (6.69 mL,

70.0mmol). The reaction mixture was stirred at -78 °C overnight followed by the addition of water (80 mL) and concentrated hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature over 2 hours. The organic layer was separated. The aqueous layer was made alkaline over potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated by column chromatography on silica gel (20% ethyl acetate/hexane) to give a Colorless oil (509.4.6 g, 39%). MS(ESI) [M + H⁺]⁺= 218.1.

Step 2 - Preparation of 2,6-difluoro-3-(thiophen-2-sulfonylamino)benzoic acid ethyl ester (510):

To 3-amino-2,4-difluoro-benzoic acid ethyl ester (509, 1.20 g, 5.93 mmol) in methylene chloride (28 mL) was added pyridine (0.52 mL, 6.4 mmol) and thiophene-2-chloride. sulfonyl (0.97 g,

5.38mmol). The reaction was stirred at room temperature overnight, then poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated with silica gel column chromatography (20% ethyl acetate/hexane) to give a colorless oil (510.1.2 g, 65.0%). MS(ESI) [M + H⁺]⁺= 348.2.

Step 3 - Preparation of thiophene2-sulfonic acid (2,4-difluoro-3-hydroxymethyl-phenyl)-amide (511):

To 2,6-difluoro-3-(thiophene-2-sulfonylamino)-benzoic acid ethyl ester (510.1.6 g, 3.5 mmol) in tetrahydrofuran (25.0 mL) was added lithium tetrahydroaluminate (1.00 M in tetrahydrofuran,

8.08 mL, 8.08 mmol) under a nitrogen atmosphere at room temperature. The reaction was stirred at room temperature for 8 hours, followed by the addition of 10 g of NaSO₄-10H₂O. After 12 hours, the reaction was filtered, concentrated, and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give a white solid (511,300.0 mg, 21.0%).

Step 4 - Preparation of acid (2,4-difluoro-3-formyl-phenyl)-amide (512):

To thiophene-2-sulfonic acid (2,4-difluoro-3-hydroxymethyl-phenyl)-amide (511, 0.46 g, 1.52 mmol) in tetrahydrofuran (5.0 mL) was added Dess-Martin periodinan (0.71 g, 1.67 mmol). The reaction was stirred at room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give a white solid (512,100 mg, 21%). MS(ESI) [M + H⁺]⁺= 304.2.

Thiophen-3-sulfonic acid (2,4-difluoro-3-formyl-phenyl)-amide 513

<img file="ECSP088121A_D0084.tif" />

was prepared following the protocol of Scheme 39, substituting thiophene-2-sulfonyl chloride with thiophene-3-sulfonyl chloride in Step 2. MS(ESI) [M + H⁺]⁺= 304.2.

N-(2,4-Difluoro-3-formyl-phenyl)-methanesulfonamide 577 was prepared following the protocol of Scheme 39, which replaces thiophene-2-sulfonyl chloride with methanesulfonyl chloride in Step 2.

N-(2,4-Difluoro-3-formyl-phenyl)-3-fluoro-benzenesulfonamide 578

<img file="ECSP088121A_D0085.tif" />

was prepared following the protocol of Scheme 39, which replaces dethiophene-2-sulfonyl chloride with 3-fluoro-benzenesulfonyl chloride in Step 2.

Example 22: Synthesis of 4-(5-Pyridin-3-yl-1 H-pyrrolo[2,3b]pyridin-3-carbonyl)-indole-1-carboxylic acid P-1486 butylamide and related compounds

Compound P-1486 was synthesized in three steps from 1 H-indole-4-carbaldehyde 518 as shown in Scheme 41.

Scheme 41

<img file="ECSP088121A_D0086.tif" />

Step 1—Preparation of 4-Formyl-mdo\-1-carboxylic acid butylamide (519):

To 1H-Indole-4-carbaldehyde (518, 1.57 g, 10.8 mmol) in acetonitrile (20 mL) was added 1-isocyanatobutane (1.81 mL, 16.2 mmol), followed by 4-dimethylaminopyridine (130 mg, 1.1 mmol). The reaction was refluxed for 48 hours. The reaction solution was quenched with 1 M HCI(aq) and extracted with ethyl acetate. The organic layer was washed with sodium bicarbonate, brine, dried over anhydrous magnesium sulfate, filtered, and concentrated to give a light yellow solid (519, 2.62 g, 45%). MS(ESI) [M+H⁺]⁺= 245.2.

Step 2 - Preparation of 4-[Hydroxy-(5-pyridin-3-¡l-1Hpyrrolo[2,3-b]pyridin-3yl)-methyl]-Mo\-1-carboxylic acid butylamide (520):

To 5-Pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine (89.51 mg, 0.26 mmol, prepared as in Example 17) in methanol (2 mL), acid 4-butylamide was added Formyl-indole-1 carboxylic acid (519, mg, 0.34 mmol) and potassium hydroxide (44 mg, 0.78 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with water, brine, dried over anhydrous magnesium sulfate, filtered, and concentrated. The desired compound was isolated with silica gel column chromatography to give an off-white solid (520.7 mg, 6%). MS(ESI) [M+HT = 440.3.

Step 3 - Preparation of 4-(5-Pyridin-3-yl-1H-pyrrolo[2,3b]pyridin-3-carbonyl)-mdo\-1-carboxylic acid butylamide (P-1486 ):

A 4-[Hydroxy-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]indole-1-carboxylic acid butylamide (520.7 mg , 0.016 mmol) in tetrahydrofuran (1 mL) was added Dess-Martin periodinane (7.4 mg, 0.017 mmol). The reaction was stirred at room temperature for 30 minutes, then poured into water and extracted with ethyl acetate. The organic layer was washed with saturated sodium bicarbonate, brine, dried over anhydrous magnesium sulfate, filtered, and concentrated. The desired compound was purified by Prep HPLC using a gradient of buffer A (5% acetonitrile, 95% water, 0.1% formic acid) and buffer B (95% acetonitrile, 5% water, 0.1% formic acid). formic). P-1486 was isolated as a white fluffy solid (2.8 mg, 40%). MS(ESI) [M+HT = 438.3.

Additional compounds were prepared following the protocol of Scheme 41, optionally substituting 1-isocyanatobutane with an appropriate isocyanate in Step 1 and optionally substituting 5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine. 89 with a suitable 7-azaindole in Step 2. The azaindole was purchased or synthesized as described in Examples 16 and 17. The following compounds were made following these procedures:

4-(5-Phenyl-1 Hpyrrolo[2,3-b]pyridin-3-carbonyl)-indole-1 carboxylic acid butylamide (P-1576), 4- [5-(4-Chloro-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbon¡l]-indole-1carboxylic acid (P-1602), 4-(5-Phenyl) butylamide -1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-indole-1-carboxylic acid (P-1611), 4-[5-(4-Chloro-phenyl)-1H-pyrrolo[2-butylamide ,3-b]pyridine-3-carbonyl]-indole-1 carboxylic acid (P-1618), 4-(5-Bromo-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-indole-1-carboxylic acid butylamide (P-1687), 4-[5-(4-Sulfamoyl- phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]indole-1-carboxylic acid (P-1854), 4-[5-(3-Sulfamoyl-phenyl)-1H-butylamide pyrrolo[2,3-b]pyridin-3-carbonyl]indole-1-carboxylic acid (P-1858), 4-[5-(2-Methoxy-pyrimidin-5-yl)-1H-pyrrolo[ 2,3-b]pyridine-3carbonyl]-indole-1-carboxylic acid (P-1860), 4-(5-P¡r¡mid¡n-5-yl-4H-pyrrolo[2,3-b]pyr¡d¡n-3-carbon¡l)-¡indole-1-carboxylic acid butylamide (P-1862), 4-(5-Methoxy-1Hpyrrolo[2,3-b]pyridin-3-carbonyl)-indole-1-carboxylic acid butylamide (P-1875), and (pyridin-3-ylmethyl) 4-[5-(6-Methoxy-pyridin-3-yl)-1H-pyrrolo[2,3-b]pyridine3-carbonyl]-indole-1-carboxylic acid -amide (P-1887).

The following table indicates the isoclanate used in Step 1 (column 2), and the 7azaindole used in Step 2 (column 3) to give the objective compound (column 4).

<td></td><td>isocyanate</td><td>— Azaindole</td><td>Compound</td><td>MS(ESI) [M+H⁺]⁺Observed</td>

<td>P-1576</td><td></td><td></td><td>fu °rP o )</td><td> 437.3</td>

Column 1 gives the compound number and column 5 the observed mass.

<td></td><td>isocyanate</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+H⁺]⁺Observed</td>

<td>ΡΊ858</td><td>qN=C=O</td><td>I heard^No. h</td><td></td><td> 516.2</td>

<td>P-1860</td><td></td><td>h</td><td>AA I or uh the K?^hnyou^No. B.J.</td><td> 469.3</td>

<td>P-1862</td><td>^-N=C=O</td><td>TO ν' N</td><td>To VQ or NvWi. Ln-&lt; 1hn~a^No. S.J.</td><td> 439.3</td>

<td>P-1875</td><td>^-N=C--0</td><td>either \</td><td>Afvtu^ 8 HN“\^No. H.J.</td><td> 391.4</td>

<td>P-1887</td><td>N=C=O ζ N-⁷</td><td>N[f</td><td>andQ_eitherto AA IJ-J hn-⁷^No. ñ</td><td> 503.4</td>

The product of Step 2 of Scheme 41 can alternatively be related to form the compounds that correspond to the methylene linker at position 3 of azaindole. For example, 4-(5-pyridin-3-yl-1 H pyrrolo[2,3b]pyridin-3-ylmethyl)-indol-1-carboxylic acid butylamide P-1656 was prepared from acid butylamide 4-[Hydroxy(5-pyrid¡n-3-yl-1 H-pyrrolo[2,3-b]pyr¡d¡n-3-¡l)-methyl]-indole-1-carboxylic acid 520 as shown in Scheme 41 a.

Scheme 41a

520

Step 1 - Preparation of 4-(5-pyridin-3-yl-1H-pyrrolo[2,3b]pyridin-3-lmethyl)-Mo\-1-carboxylic acid butylamide ( P-1656):

4-[Hydroxy-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-indole-1-carboxylic acid butylamide mixture (520, 18 mg , 0.041 mmol), trifluoroacetic acid (0.5 mL), triethylsilane (1 mL), and acetonitrile (8 mL) were refluxed for 4 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with saturated sodium bicarbonate, brine, dried over anhydrous magnesium sulfate, filtered, and concentrated. The desired compound was purified by Prep HPLC using a gradient of buffer A (5% acetonitrile, 95% water, 0.1% formic acid) and buffer B (95% acetonitrile, 5% water, 0.1% formic acid). ). P-1656 was isolated as a cream-white solid (4.8 mg, 28%). MS(ESI) [M+H⁺]⁺ = 424.2.

The corresponding hydroxy-methyl derivative from Scheme 41 of Step 2 was reacted following the protocol of Scheme 41a to prepare 4[5-(2-methoxy-pyrimidin-5-yl)-1H-pyrrolo[2, 3-b]pyridin-3-ylmethyl]-indol-1-carboxylic acid P-1861, 4-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl acid butylamide )-indole-1-carboxylic acid P1876, and 4-(5-Pyridin-4-yl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-indole-1-carboxylic acid butylamide P-1877, with the structures shown below.

<img file="ECSP088121A_D0087.tif" />

Example 23: Synthesis of (3-Benzyloxy-2,6-difluoro-phenyl)-(5-pyridin-3-yl-1H15 pyrrolo[2,3-b]pyridin-3-yl)-methanone P- 1467 and related compounds

Compound P-1467 was synthesized in four steps from 2,4-difluorophenol 35 as shown in Scheme 43.

Scheme 43

<img file="ECSP088121A_D0088.tif" />

Stage 1— Preparation of 1-Benzyloxy-2,4-difluoro-benzene (525).

To 2,4-difluoro-phenol (35, 7.60 g, 0.0584 mol) in Ν,Ν-dimethylformamide (50.0 mL) were added benzyl bromide (8.0 mL, 0.067 mol) and potassium carbonate (9.00 g, 0.0651 mol). under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the compound as a white solid (525.3.20 g, 25%).

Step 2 - Preparation of 3-Benzyloxy-2,6-difluoro-benzaldehyde (526);

To 1-Benzyloxy-2,4-difluoro-benzene (525, 3.00 g, 13.6 mmol) in Tetrahydrofuran (48 mL) under a nitrogen atmosphere and quenched with dry ice/acetone was added nButyllithium (1.60 M in hexane, 8.94 mL). After 20 min, Ν,Ν-dimethylformamide (1.46 mL, 0.0189 mol) was added to the reaction. After another 20 minutes, the flask was shaken at room temperature for 30 minutes. The reaction mixture was poured into water, acidified to pH-1, and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated, and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give the compound as a yellow solid (526, 2.5 g, 74%).

Step 3 - Preparation of (3-Benzyloxy-2,6-difluoro-phenyl)-(5-pyridin-3-yl-1Hpyrrolo[2,3-b]pyridin-3-yl)-methanol (527):

To 5-P¡ridin-3-yl-1 H-pyrrolo[2,3-b]pyridine (89, 750.0 mg, 0.003842 mol, prepared as in Example 17) in methanol (20.0 mL) was added 3-Benzyloxy -2,6-difluorobenzaldehyde (526, 1.12 g, 4.5 mmol) and potassium hydroxide (1.50 g, 0.0267 mol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight then poured into water, acidified with 1N HCI to pH around 2 and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the compound (527,700 mg, 35%).

Step 4 - Preparation of (3-Benzyloxy-2,6-difluoro-phenyl)-(5-pyridin-3-yl-1Hpyrrolo[2,3-b]pyridin-3-yl)-methanone (P-1467):

A (3-Benzyloxy-2,6-difluoro-phenyl)-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (527, 300.0 mg, 0.68 mmol) in tetrahydrofuran (10.0 mL) was added Dess-Martin periodinane (344 mg, 0.81 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction mixture was concentrated on silica and purified by column chromatography on silica gel eluting with 10% methanol in dichloromethane to give the compound (P1467, 240 mg, 80%). MS(ESI) [M+H⁺]⁺ = 442.2.

(5-E5romo-1H-pyrrolo[2,3-b]pyridin-3-¡l)-[2,6-difluoro-3-(2-methoxy-ethoxy)-phenyl]methanone

P-1453

<img file="ECSP088121A_D0089.tif" />

was prepared following the protocol of Scheme 43, which replaces benzyl bromide with 1-Bromo-2-methoxy-ethane in Step 1 and 5-Pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine with 5-Bromo-1 H-pyrrolo[2,3-b]pyridine (67) in Step 3. MS (ES1) [M + H⁺]⁺ = 410.1, 412.1.

[2,6-Difluoro-3-(2-methoxy-ethoxy)-phenyl]-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-yl) methanone

P-1584

<img file="ECSP088121A_D0090.tif" />

was prepared following the protocol of Scheme 43, which replaces benzyl bromide with 1-Bromo-2-methoxy-ethane in Step 1 and 5-Pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine with 5-methoxy¡-1H-pyrrolo[2,3-b]pyridine (104, prepared as in Example 22) in Step 3. MS (ESI) [M + H⁺]⁺ = 363.2.

(3-Benzyloxy-2,6-difluoro-phenyl)-(5-methoxy-1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone P-

<img file="ECSP088121A_D0091.tif" />

1597 was prepared following the protocol of Scheme 43, which replaces 5-Pyridin-3-yl-1Hpyrrolo[2,3-b]pyridine with 5-methoxy¡-1H-pyrrolo[2,3-b]pyridine (104, prepared as in Example 16) in Step 3. MS(ESI) [M + H⁺]⁺= 395.2.

(3-Benzyloxy-2,6-difluoro-phenyl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone P-1802 was prepared following the protocol of Scheme 43, substituting 5-pyridin-3 for -yl-1 Hpyrrolo[2,3-b]pyridine with 7-azaindole. To a solution of (3-benzyloxy 2,6-difluoro-phenyl)-(1 Hpyrrolo[2,3-b]pyridin-3-yl)-methanone (P-1802, 0.5 g, 1.37 mol) in methanol ( 70 mL) and tetrahydrofuran (30 mL), palladium on carbon (120 mg, 10% wt, 0.58 mol) was added. The mixture was stirred under hydrogenation (60 psi) for six hours. After removal of the solvent, the residue was dried under vacuum, which provided (2,6-Difluoro-3-hydroxy-phenyl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone 651

OH as a white solid (363 mg, 96%). MS (ESI) [M+H⁺]⁺ = 275.36.

Additional compounds were prepared following steps 3 and 4 of Scheme 43, replacing 3-benzyloxy-2,6-difluoro-benzaldehyde 526 with an appropriate aldehyde and/op¡ridin-3-yl-1H-pyrrolo[2 ,3-b]pyridine 89 with an appropriate azaindole in Step 3. The azaindols used were synthesized as described in Examples 9 or 16.

The aldehydes used were synthesized as described in Example 5 or 21. The following compounds were made following these procedures:

N-[3-(5-Chloro-1 Hpyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-4-trifluoromethylbenzenesulfonamide (P -1541),

N-[2,4-Difluoro-3-(5-methoxy-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-4-trifluoromethylbenzenesulfonamide (P-1542),

N-[2,4-Difluoro-3-(5-methoxy¡-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-fluorobenzenesulfonamide (P-1581),

N-[2,4-Difluoro-3-(5-methoxy¡-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-4-fluorobenzenesulfonamide (P-1582),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-2,4-d¡fluoro-phenyl]-3-fluorobenzenesulfonamide (P-1583),

N-[2,4-Difluoro-3-(5-methoxy¡-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-trifluoromethylbenzenesulfonamide (P-1598),

N-[3-(5-Chloro-1 Hpyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-3-trifluoromethylbenzenesulfonamide (P-1599 ), (5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-¡l)-{2-fluoro-5-methoxy-4-[2-(2-methoxy-ethoxy )ethoxyjphenylj-methanone (P-2003), (4-Benzyloxy-2,6-difluoro-phenyl)-(1H-pyrrolo[2,3-b]pyridin-3-l)-methanone (P-2020 ), and

[4-(4-Chloro-benzyloxy)-3-methoxy-phenyl]-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P1698).

The following table indicates the aldehyde (column 2) and azaindole (column 3) used to give the objective compound (column 4). Column 1 gives the compound number and column 5 the observed mass.

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+HT Observed</td>

<td>P-1541</td><td>cf₃h_F^r N'^OH 0</td><td>ύζ vn</td><td>F Yr&gt; F Í|-Z no^h 0 h</td><td> 516.2</td>

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+H⁺]⁺Observed</td>

<td>Ρ-1542</td><td>Ονργ^ΗF Π'ϊ°</td><td>^Η Η</td><td>F i and Q 9 ry^CF4 I F Hv^whatNo.^TONo.^h 0 ^m h</td><td> 512.2</td>

<td>F-1581 Ί</td><td>r(Υ 0 ΟΛ 1 ηΓν^'° F Η 0</td><td>'°Ό3^Ν S</td><td>iYp w m3 ttf ΝN h</td><td> 462.2</td>

<td>p-1582</td><td>F^QOj Ο^ηΎ</td><td>Ύ53 vn</td><td>F °Ό«Ό ιςψΗο</td><td> 462,2</td>

<td>Ρ-1583</td><td>F Η 0</td><td>^Clw^Ν Η</td><td>ύΥΥΑ vn^h either^rh</td><td> 466.1</td>

<td>Ρ-1598</td><td>_F_rr^CF· y w</td><td>'θ'ύο Η</td><td>OrPAQ 7 .QF ñ Ó CF, Ν N</td><td> 510.1</td>

<td>Ρ-1599</td><td>frr^CF' ο &gt;\ V s=o Η Ο Ν'^ Ο F Η 0</td><td>^αΌ3^Ν Η</td><td>VO r&gt; I f 6 cf₃ν N^No. h</td><td> 514.0</td>

<td>Ρ-2003</td><td>F^XqX&gt; Yq__either^o</td><td>^ICYD Sr'NΗ</td><td>»AV °vdW w ? h</td><td> 423.3</td>

<td>Ρ-2020</td><td>⁰ F «vS ΑΛ-ηφ</td><td>ζ»¹ Η</td><td>Me too 03^F</td><td> 363.1</td>

<td>Ρ-1698</td><td> 7°</td><td> 03 ^Νm</td><td>(TTco either '</td><td> 393.2</td>

Example 24: Synthesis of 3-(3-Benzyloxy-2,6-difluoro-benzyl)-5-pyridin-3-yl-1Hpyrrolo[2,3-b]pyridine P-1455:

Compound P-1455 was synthesized in four steps from 2,4-difluorophenol 35 as shown in Scheme 43a.

Scheme 43a

<img file="ECSP088121A_D0092.tif" />

Stages 1-3 are identical to Stages 1-3 of Scheme 43.

Step 4-Preparation of 3-(3-Benzyloxy-2,6-difluoro-benzyl)-5-pyridin-3-yl-1Hpyrrolo[2,3-b]pyridine (P-1455):

A (3-Benzyloxy-2,6-difluoro-phenyl)-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyr¡d¡n-3-¡l)-methanol (527 , 580.0 mg, 1.3 mmol) in acetonitrile (29.0 mL) trifluoroacetic acid (1.9 mL,

0.025 mol) and triethylsilane (3.9 mL, 0.024 mol). The reaction was stirred at 80 °C for 1 hour. The reaction was poured into water, made basic with 1M potassium carbonate to pH=4, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 50% ethyl acetate in hexane to give a yellow solid (P-1455, 530mg). MS(ESI) [M+H⁺]⁺ = 428.3.

5-Bromo-3-[2,6-difluoro-3-(2-methoxy-ethoxy)benzyl]-1H pyrrolo[2,3-b]pyridine P-1454

<img file="ECSP088121A_D0093.tif" />

was prepared following the protocol of Scheme 43a by substituting benzyl bromide with 1-Bromo-2-methoxy-ethane in Step 1 and 5-Pyridin-3-1-1H-pyrrolo[2,3-b ]pyridine with 5-Bromo-1 H-pyrrolo[2,3-b]pyridine (67) in Step 3. MS (ESI) [M + H⁺]⁺ = 410.1, 412.1.

Additional compounds were prepared by following steps 3 and 4 of Scheme 43a, replacing 3-benzyloxy¡-2,6-d¡fluoro-benzaldehyde 526 with an appropriate aldehyde and/or pyridin-3-yl-1H-pyrrolo[2 ,3-b]pyridine 89 with an appropriate azaindole (see Example 9 or Example 16) in Step 3. The following compounds were made following these procedures:

N-[2,4-Difluoro-3-(5-methoxy¡-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenyl]-3-trifluoromethylbenzenesulfonamide (P-1590), and

N-[2,4-Difluoro-3-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenyl]-3-trifluoromethylbenzenesulfonamide (P-1600) .

The following table indicates the aldehyde (column 2) and azaindole (column 3) used to give the objective compound (column 4). Column 1 indicates the compound number and column 5 the observed mass.

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [m+hY Observed</td>

<td>P-1590</td><td>either^F θ'⁰'³hYY FH 0</td><td>1 ΥΖΣ 1 H either \</td><td>or /Ά 's'Q cf, NN h</td><td></td>

<td>P-1600</td><td>_F pr^CF3 wfTKy FH 0</td><td>^Clw A</td><td>F ζ OFH 0 CF₃NNH</td><td></td>

Example 25: Synthesis of 3-[2,6-difluoro-3-(propan-1sulfonylamino)-benzoyl]-1H-pyrrolo[2,3-b]pyridine-5-carboxylic acid ethylamide P-1630

Compound P-1630 was synthesized in six steps from 5-bromo-1-triisopropylsilyl-7azaindole 68 as shown in Scheme 45.

Scheme 45

<img file="ECSP088121A_D0094.tif" />

Step /-Preparation of 1-Triisopropylsilanyl-1H-pyrrolo[2,3b]pyridine-5-carboxylic acid methyl ester (531):

5-Bromo-1-trüsopropylsilyl-7-azaindole (68, 1.50 g, 4.2 mmol, prepared as described in Example 6) in tetrahydrofuran (20.0 mL) under a nitrogen atmosphere, was quenched with dry ice/acetone, n-Butyllithium (10.0 M in hexane, 0.467 mL) was added slowly. After 60 min, ethyl chloroformate (0.394 mL, 5.1 mmol) was added to the reaction. After another hour the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the crude compound as a light yellow solid which was used directly in the next step.

Step 2 - Preparation of 1H-Pyrrolo[2,3-b]pyridine-5-carboxylic acid methyl ester (532):

1-Triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine-5-carboxylic acid methyl ester (531,

0.950 g, 2.9 mmol) in tetrahydrofuran (20.0 mL) was added tetrabutylammonium fluoride, trihydrate (1.20 g, 3.8 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction was concentrated and purified with silica gel column chromatography eluting with 4% methanol in methylene chloride to give the compound as a white solid (532,300 mg, 60%). MS(ES1) [M+H⁺]⁺= 177.2.

Stage 3 - Preparation of 3-[2,6-difluoro-3-(propan-1sulfonylamino)phenylj-hydroxy-methyl-1H-pyrrolo[2,3-b]pyridine-5-carboxylic acid methyl ester ( P-1545):

To 1H-Pyrrolo[2,3-b]pyridine-5-carboxylic acid methyl ester (532, 155.0 mg, 0.88 mmol) in methanol (15.0 mL) was added (2,4-difluoro-3-formyl-phenyl) -propan-1-sulfonic acid amide (73, 260.0 mg, 0.99 mmol, prepared as described in Example 7) and potassium hydroxide (859 mg, 15.3 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight.

The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the compound as a white solid (P-1545, 110 mg, 28%). MS(ESI) [M+H⁺]⁺= 440.2.

Step 4 - Preparation of 3-[2,6-difluoro-3-(propan-1sulfon¡lamino)-benzo¡l]-1H-pyrrolo[2,3-b]p¡r¡d¡ acid methyl ester n-5-carboxylic (P-1552):

3-[2,6-Difluoro-3-(propan-1-sulfonylamino)-phenyl]-hydroxy-methyl1H-pyrrolo[2,3-b]pyridine-5-carboxylic acid methyl ester (P4545 ,100.0 mg, 0.23 mmol) in tetrahydrofuran (10 mL) was added Dess-Martin periodinane (107 mg, 2.5 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction mixture was concentrated with silica gel and then purified with silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound as a white solid (P-1552, 80 mg, 80% ). MS(ESI) [M+H⁺]⁺= 438.2.

Step 5 - Preparation of 3-[2,6-difluoro-3-(propan-1-sulfonylamino)-benzo¡l]1Hp¡rrolo[2,3-b]pyridine-5-carboxylic acid (P4559):

3-[2,6-Difluoro-3-(Propan-1-sulfonylamino)-benzoyl]-1Hpyrrolo[2,3-b]pyridine-5-carboxylic acid methyl ester (P-1552, 80.0 mg, 0.18 mmol ) in tetrahydrofuran (10.0 mL) were added water (3.0 mL) and lithium hydroxide (82 mg, 3.4 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water, acidified with 1N HCl to pH around 1, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered, concentrated, and washed with ethyl acetate to give an off-white solid (P-1559, 60 mg, 77%) MS(ESI) [M+H⁺f = 424.2.

Step 6: Preparation of 3-[2,6-difluoro-3-(propan-1-sulfonylamino)-benzoyl]-1H-pyrrolo[2,3-b]pyridine-5-carboxylic acid ethylamide (P-1630):

To 3-[2,6-difluoro-3-(propan-1-sulfonylamino)-benzoyl]-1H-pyrrolo[2,3-b]pyridine-5-carboxylic acid (P-1559, 38.0 mg, 0.090 mmol) in tetrahydrofuran (2.3 mL) was added to a solution of ethylamine (2.0 M in tetrahydrofuran, 0.20 mL), bromotris-pyrrolidine-phosphonium hexafluorophosphate (80.0 mg, 0.17 mmol), and triethylamine (0.30 mL, 2.2 mmol) under a nitrogen atmosphere. The reaction mixture was stirred overnight at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 40% ethyl acetate in hexane to give the compound as a white solid (P-1630, 13.2 mg, 33%). MS(ESI) [MH⁺]' = 449.0.

Example 26: Synthesis of 1-butyl-3-[3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenyl]-urea P-4445.

Compound P-1445 was synthesized in six steps from 5-pyridin-3-yl-1H-pyrrolo[2,3bjpyridine 89 as shown in Scheme 49.

Scheme 49

<img file="ECSP088121A_D0095.tif" />

Stage 1- Preparation of (3-nitro phenyl)-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-yl)meiano/(P-1399 ):

To 3-nitrobenzaldehyde (534, 1.08 g, 7.17 mmol) in methanol (34 mL) was added 5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine (89.1.08 g, 5.52 mmol, prepared as described in Example 17) and potassium hydroxide (1.55 g, 27.6 mmol). The reaction was stirred at room temperature for four hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and concentrated. The mixture was purified by column chromatography on silica gel eluting with 4% methanol in dichloromethane to give two different compounds, to a white solid (P-1399, R=H, 1.20 g, 63%) MS(ESI) [M +H⁺]⁺ = 347.2, and a light yellow solid (535, R-Me, 0.434 g, 22%).

Step 2 - Preparation of (3-nitrophenyl)-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3yl)methanone (536).

A (3-nitro-phenyl)-(5-pyridin-3-¡l-1 H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (P-4399, R =H,

500 mg, 1.44 mmol) in dimethylformamide (26 mL) was added Dess-Martin periodane (674 mg, 1.59 mmol). The reaction was stirred for one hour and the reaction was poured into water. All solids were filtered and purified by column chromatography on silica gel eluting with 3% methanol in dichloromethane to give the compound (536, 295 mg, 59%). MS(ESI)[M+H⁺]⁺ = 345.2.

Step 3 — Preparation of (3-nitrophenyl)-[5-pyridin-3-yl-1-(toluene-4-sulfonyl)-1Hpyrrolo[2,3-b]pyridin-3-yl)-methanone ( 537):

A (3-nitro-phenyl)-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-yl)-methanone (536, 291 mg, 0.85 mmol) In tetrahydrofuran (7 mL) was added 1.5 M lithium diisopropylamide in cyclohexane (676 μΙ, 1.59 mmol) at -78°C under a nitrogen atmosphere. After 30 minutes, p-toluenesulfonyl chloride (209 mg, 1.10 mmol) in tetrahydrofuran was added and the reaction stirred for three hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and concentrated. All solids were filtered and purified by column chromatography on silica gel eluting with 60% ethyl acetate in hexane to give the compound (537.182 mg, 43%). MS(ESI)[M+H⁺]⁺ = 499.2.

Step 4 - Preparation of (3 Aminophenyl)-[5-pyridin-3-yl-1-(toluene-4-sulfonyl)-1Hpyrrolo[2,3-b]pyridin-3 yl]-methanone (538):

A (3-n¡tro-phenyl)-[5-pyridi η-3-yl-1 -(toluene-4-sulfonyl)-1H-pyrrolo[2,3-b]pyrid i η- 3-yl) methanone (537, 180 mg, 0.361 mmol) in methanol (4 mL) was added 10% palladium on carbon (20 mg) and a few drops of concentrated aqueous hydrochloric acid. The resulting mixture was stirred under an atmosphere of hydrogen overnight and the catalyst was filtered off through a pad of celite. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 90% ethyl acetate in hexane to give the compound (538.58 mg, 34%). MS(ESI)[M+H⁺]⁺ = 469.3.

Step 5 - Preparation of 1-Butyl-3-3-[5-pyridin-3-yl-1-(toluene-4-sulfonyl)-1Hpyrrolo[2,3-b]pyridin-3-carbonyl]-phenyl-urea (539):

A (3-Amino-phenyl)-[5-p¡rid in-3-¡l-1 -(toluene-4-su If onyl)-1 H-pyrrolo[2,3-b]pyridi η- 3-yl]methanone (538, 53 mg, 0.11 mmol) in tetrahydrofuran (1.6 mL) was added 1-isocyanatobutane (12 mg, 0.12 mmol). The reaction was heated at 90 °C overnight and concentrated and purified by column chromatography on silica gel eluting with 2% methanol in dichloromethane to give the compound (539.39 mg, 61%). MS(ESI)[M+H⁺]⁺= 568.4.

Step 6 - Preparation of 1-Butii-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyr¡d¡n-3carbonyl)phenyl]-urea (P -1445):

A 1 - But i I-3-3-[5-pi ridi η-3-il-1 -(toluen-4-su If oni I) -1H-pyrrolo[2,3-b] p¡ rid i n-3-carbon ¡I]phenyl-urea (539, 33 mg, 0.058 mmol) in tetrahydrofuran (2 mL) was added 1.0 M tetra-n-butylammonium fluoride in tetrahydrofuran (192 μΙ) under a nitrogen atmosphere and the reaction was stirred for three hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and concentrated. All solids were filtered and purified by column chromatography on silica gel eluting with 4% methanol in dichloromethane to give the compound (P-1445, 8 mg, 30%). MS(ESI)[M+H⁺]⁺ = 414.3.

Example 27: Synthesis of 1-butyl-3-[3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenyl]-urea P-1447

Compound P-1447 was synthesized in five steps from 3-[(3-nitro-phenyl)-methoxymethyl]-5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine 535 as shown in Scheme 50.

Scheme 50

<img file="ECSP088121A_D0096.tif" />

Step 1 - Preparation of 3-(3-nitro-benzyl)-5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine (P-1402):

A 3-[(3-n¡tro-phenyl)-methoxy-methyl]-5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridine (535, 431 mg , 1.20 mmol, per Example 26, Scheme 49 Step 1) in acetonitrile (130 mL), trifluoroacetic acid (18 mL, 230 mmol) and triethylsilane (36 mL, 230 mmol) were added. The reaction was refluxed for three hours. The reaction mixture was poured into sodium bicarbonate solution and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 80% ethyl acetate in hexane to give the compound (P-1402.323 mg, 82%). MS(ESI)[M+H⁺]⁺ = 331.2.

Step 2 - Preparation of 3-(3-nitro-benzyl)-5-pyridin-3-yl-1-(toluen-4-suifonyl)-1Hpyrrolo[2,3-b]pyridine (552):

A 3-(3-nitro-benzyl)-5-pyridin-3-yl-1 H-plrrolo[2,3-b]pyridine (P-1402, 141 mg, 0.43 mmol) in Ν,Ν-dimethylformamide (3 mL) sodium hydride (60% dispersion in mineral oil, 21 mg, 0.512 mmol) was added under a nitrogen atmosphere. After thirty minutes, p-toluenesulfonyl chloride (114 mg, 0.60 mmol) in Ν,Ν-dimethyl-formamide was added and the reaction stirred for three hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and concentrated. All solids were filtered and purified by column chromatography on silica gel eluting with 40% ethyl acetate in hexane to give the compound (552.120 mg, 58%). MS(ESI)[M+H⁺]⁺ = 485.25.

Step 3 - Preparation of 3-[5-Pyridin-3-µl-1-(toluene-4-sulfonyl)-1H-pyrrolo[2,3b]pyridin-3-µlmethyl]-phenylamine (553):

A 3-(3-nitro-benzyl)-5-pyridin-3-yl-1 -(toluene-4-sulfonyl)-1 H-pyrrolo[2,3-b]pyridine (552, 230 mg, 0.14 mmol) in methanol (5 mL) was added 10% palladium on carbon (10 mg) and a few drops of concentrated aqueous hydrochloric acid. The resulting mixture was stirred under an atmosphere of hydrogen overnight, and the catalyst was filtered off through a pad of celite. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 90% ethyl acetate in hexane to give the compound (553.88 mg, 41%). MS(ESI)[M+H⁺]⁺= 455.3.

Step 4 - Preparation of 1-butyl-3-3[5-pyridin-3-yl-1-(toluene-4-sulfonyl)-1Hpyrrolo[2,3-b]pyridin-3¡ImethylIJ-phenyl-urea (554 ):

A 3-[5-pyrid¡n-3-¡l-1 -(toluene-4-sulfonyl)-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl]-phenylamine (553, 14 mg, 0.031 mmol) in tetrahydrofuran (0.5 mL) was added 1-¡ocyanatobutane (3.4 mg, 0.03 mmol). The reaction was heated at 90 °C overnight and concentrated and purified by column chromatography on silica gel eluting with 2% methanol in dichloromethane to give the compound (554, 7.2 mg, 42%). MS(ESI)[M+H⁺]⁺= 554.4.

Step 5 - Preparation of 1-Butyl-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2, 3-b]pyridin-3-ylmethyl)-phenyl]-urea (P-1447):

A 1 -buty l-3-3-[5-pyridin-3- yl-1 -(toluen-4-sulfonyl)-1H-pyrrolo[2,3-bJpyridin-3-ylmethyl]phenyl- Urea (554.11 mg, 0.02 mmol) in tetrahydrofuran (0.7 mL) was added 1.0 M tetra-n-butylammonium fluoride in tetrahydrofuran (66 μΙ) under a nitrogen atmosphere and the reaction stirred for three hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and concentrated. All solids were filtered and purified by column chromatography on silica gel eluting with 4% methanol in dichloromethane to give the compound (P-1447, 2.5 mg, 31%). MS(ESI)[M+H⁺]⁺ = 400.3.

-Cyclopentyl-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenyl]-urea P-1446

<img file="ECSP088121A_D0097.tif" />

was prepared following the protocol in Scheme 50, substituting isocyanatocyclopentane for 1-isocyanatobutane in Step 4. MS(ESI) [M + H⁺]⁺= 412.4.

Example 28: Synthesis of 3-[3-chloro-4-(4-chloro-benzyloxy)-benzyl]-1H-pyrrolo[2,3bjpyridine P-1449.

The compound P-1449 was synthesized in three steps from 3-chloro-4-hydroxy-benzaldehyde

556 as shown in Scheme 51.

Scheme 51

<img file="ECSP088121A_D0098.tif" />

Step 1 - Preparation of 3-chloro-4-(4-chloro-benzyloxy)-benzaldehyde (558):

To acetonitrile (15.0 mL) were added 3-chloro-4-hydroxy-benzaldehyde (556, 0.6 g, 4 mmol), 4-chlorobenzyl bromide (557, 1.2 g, 6 mmol), and potassium carbonate (0.9 g, 7mmol). The reaction was heated at 150Ό for 10 minutes in an uncovered microwave CEM instrument. The reaction was poured into water, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate: hexanes) (558, 0.85 g, 76%).

Step 2 - Preparation of 3-[3-chloro-4-(4-chloro-benzyloxy)phenyl]-methoxy-methyl-1Hpyrrolo[2,3-b]pyridine (559):

H-Pyrrolo[2,3-b]pyridine (94, 0.3 g, 2.8 mmol) was mixed with 3-chloro-4-(4-chlorobenzyloxy)-benzaldehyde (558, 0.8 g, 3 mmol), potassium hydroxide ( 0.9 g, 17 mmol) and methanol (90.0 mL). The reaction was heated at 50°C under a nitrogen atmosphere for six days. After neutralization with 6N hydrochloric acid the reaction was poured into water, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate: hexanes) to give a yellow solid (559, 0.6 g, 41%). MS(ESI) [M + H⁺]⁺= 413.2, 415.2 [MH⁺]' =411.1,413.1.

Step 3 Preparation of 3-[3-chloro-4-(4-chloro-benzyloxy¡)-benzyl]-1H-pyrrolo[2,3bjpyridine (P-1449):

3-[3-Chloro-4-(4-chloro-benzyloxy¡)-phenyl]-methoxy-methyl-1 H-pyrrolo[2,3-b]pyrid¡ne (559, 0.2 g, 0.6 mmol) trifluoroacetic acid (0.226 mL, 3 mmol), triethylsilane (0.4 mL, 3 mmol), and acetonitrile (5 mL) were mixed. The reaction was warmed to 50 °C and stirred for two days. The reaction was concentrated. The residue was diluted with ethyl acetate and neutralized with 2M aqueous sodium hydroxide. The reaction was poured into water, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate:hexanes) to give a yellow solid (P-1449, 0.0744 g, 33%). MS(ESI) [M + H⁺]⁺= 383.2, 385.2.

Additional compounds were prepared following the protocol of Scheme 51, replacing 3-chloro-4-hydroxy-benzaldehyde 556 with an appropriate aldehyde and optionally replacing 4-chlorobenzyl bromide 557 with an appropriate benzyl halide in Step 1, and optionally replacing 1 H-pyrrolo[2,3-b]pyridine 94 with an appropriate azaindole in Step 2. The following compounds were made following these procedures:

3-[4-(4-chloro-benzyloxy)-2-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-1450),

3-[4-(4-Chloro-benzyloxy)-benzyl]-1 H-pyrrolo[2,3-b]pyridine (P-1462), 3-[4-(4-Chloro-benzyloxy)-3-fluoro -5-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-1466), 3-[4-(4-Chloro-benzyloxy)-3-ethoxy-benzyl]-1H-pyrrolo [2,3-b]pyridine (P-1470), 3-[2-Chloro-4-(4-chloro-benzyloxy)-benz¡l]-1H-pyrrolo[2,3-b]pyridine (P -1471), 3-[4-(4-Chloro-benzyloxy)-3-trifluoromethoxy¡-benz¡l]-1 H-pyrrolo[2,3-b]pyridine (P-1487), 3-[ 4-(4-Chloro-benzyloxy)-3-methoxy-benzyl]-5-methoxy-1H-pyrrolo[2,3-b]pyridine (P1531),

5-Chloro-3-[4-(4-chloro-benzyloxy)-3-methoxy¡-benz¡l]-1 H-pyrrolo[2,3-b]pyr¡d¡na (P-1532),

3-[4-(4-Chloro-2-fluoro-benzyloxy)-3-methoxy-benzyl]-1 H-pyrrolo[2,3-b]pyridine (P-1544),

3-[4-(2,4-Dichloro-benzyloxy¡)-3-methoxy¡-benz¡l]-1Hp¡rrolo[2,3-b]pyridine (P-1568),

3-[3-Methoxy-4-(4-methoxy-benzyloxy)-benzyl]-1 H-pyrrolo[2,3-b]pyridine (P-1569), 3-[3-Methoxy-4 -(2,4,6-trifluoro-benzyloxy)-benzyl]-1 H-pyrrolo[2,3-b]pyridine (P-1578), 3-(4-(2,6-Dichloro-benzyloxy)-3 -methoxy-benzyl]-1 H-pyrrolo[2,3-b]pyridine (P-1579), and

3-[3-Chloro-4-(4-chloro-benzyloxy)-5-nnetoxy¡-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-1616).

The following table lists the aldehyde (column 2), benzyl halide (column 3), and azaindole (column 4) used to give the objective compound (column 5). Column 1 indicates the compound number and column 6 the observed mass.

<td></td><td>Aldehyde</td><td>benzyl halide</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+TTJ Observed</td>

<td>Ρ-1450</td><td>Η_νΟ ΟΗ</td><td>br x</td><td>No^No. 9</td><td>/ cn</td><td> 379.2 381.2</td>

<td>Ρ-1462</td><td>Η^Ο ΟΗ</td><td></td><td>m</td><td>O~í^^^IN h</td><td> 349.1 351.2</td>

<td>Ρ-1466</td><td>ΗγΟ οΧ 1 ΟΗ</td><td>^B.x</td><td>w h</td><td>Χο-^αw?</td><td> 397.2 399.2</td>

<td>Ρ-1470</td><td>ΗγΟ LoX ΟΗ</td><td>br</td><td>m “B</td><td>QrX x</td><td> 393.2 395.2</td>

<td>Ρ-1471</td><td>Η_ν° x¹ΟΗ</td><td>br x</td><td>ΩΛh_to</td><td>^|&lt;~N^IN h</td><td> 383.1 385.1</td>

<td>Ρ-1487</td><td>ΗγΟ x "IF,</td><td>br ^Cl</td><td>co</td><td>XF/F.jFf¹QQ cf₃</td><td> 433.2 435.2</td>

<td>Ρ-1531</td><td>ΗγΟ Υ^Ο OH 1</td><td>br ^Cl</td><td></td><td>0 tiN Cj^h cF</td><td> 409.2</td>

<td>Ρ-1532</td><td>ΗγΟ Υ^ο OH 1</td><td>br x</td><td>^clyr*</td><td>0 &gt;PN OR^h cF</td><td> 413.1</td>

<td>Ρ-1544</td><td>ΗγΟ VO OH 1</td><td>br x</td><td>No</td><td>Xo 'τ'⁷w/^F¹ h</td><td> 397.2</td>

<td></td><td>Aldehyde</td><td>benzyl halide</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+H⁴]⁴Observed</td>

<td>P-1568</td><td> 0</td><td>ck</td><td></td><td>W^{1 Cl}^No. h</td><td> 413.1 415.1 416.2</td>

<td>P-1569</td><td>'Yo. OH 1</td><td>Cl x</td><td>what</td><td></td><td> 375.2</td>

<td>P-157S</td><td>-either 1</td><td>Br F x</td><td></td><td>ζχ &gt;</td><td>399.2 397.1 ([MH⁴]')</td>

<td>P-1579</td><td>ooh 1</td><td>Br Cl</td><td>TO</td><td>^cl\-\ 'either ¢. xx /^C|no no h</td><td>413.2 415.2 416.2 ([MI-TD</td>

<td>P-1616</td><td>H&amp;O Cl'Vto OH 1</td><td>br x</td><td> 03</td><td>Cl o3 /°X</td><td> 413.1</td>

Example 29: Synthesis of 3-(4-benzyloxy-3-methoxy-benzyl)-1H-pyrrolo[2,3bjpyridine P-1613.

Compound P-1613 was synthesized in two steps from 4-benzyloxy-3-methoxy¡benzaldehyde 564 as shown in Scheme 53.

<img file="ECSP088121A_D0099.tif" />

P-1613

Step 1 - Preparation of 3-[(4-benzyloxy-3-methoxy-phenyl)-methoxy-methyl]-1Hpyrrolo[2,3-b]pyridine (565):

Methanol (125 mL) and potassium hydroxide (4.4 g, 79 mmol) were mixed with 1Hpyrrolo[2,3-b]pyridine (94, 3.1 g, 26.6 mmol) and 4-benzyloxy-3-methoxy¡-benzaldehyde (564 , 12.9 g, 53.2 mmol). The reaction was stirred at room temperature for 2 days. The resulting white solid was filtered and washed with water. Unpurified material was transferred without further purification.

Step 2 - Preparation of 3-(4-benzyloxy-3-methoxy-benzyl)-1H-pyrrolo[2 3-b]pyridine (P-1613):

3-[(4-Benzyloxy-3-methoxy-phenyl)-methoxy-i-Thiethyl]-1H-pyrrolo[2,3-b]pyridine (565, 0.9g, 2.4 mmol) and acetonitrile (50 mL) were mixed with trifluoroacetic acid (0.360 mL, 4.7 mmol) and triethylsilane (0.746 mL, 4.7 mmol). The reaction was warmed to 80°C and stirred overnight. The reaction was concentrated. The mixture was extracted with ethyl acetate and saturated sodium bicarbonate. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated. The desired compound was isolated by silica gel column chromatography to give the compound (P-1613, 0.454 g 54.8%). MS(ESI) [M + H⁺]⁺= 345.3.

Example 30: Synthesis of 1 -[3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)phenyl]-3-butyl-urea P-1596.

Compound P-1596 was synthesized in a 5-bromo-1H-pyrrolo[2,3bjpyridine 67 step as shown in Scheme 55.

Scheme 55

Br-

<img file="ECSP088121A_D0100.tif" />

585

Stage 1 Br

P-1596

Step 1-Preparation of 1-[3-(5-bromo-1Hpyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-butyl-urea (P-1596):

To aluminum trichloride (3.67 g, 0.0275 mol) in dichloromethane (100 mL, 2 mol) under a nitrogen atmosphere was added 5-bromo-7-azaindole (67, 1.08 g, 0.00548 mol) at room temperature. After one hour, 3-isocyanato-benzoyl chloride (584, 5.00 g, 0.0275 mol) was added under a nitrogen atmosphere at room temperature. The resulting mixture was stirred overnight at room temperature. 1-Butanamine (585, 54 mL, 0.54 mol) was carefully added. All solvents were removed. The residue was purified by silica gel column chromatography to give the compound (P-1596.172 mg, 8%). MS(ESI) [MH⁺]-= 413.1,415.0.

Additional compounds were prepared following the protocol of Scheme 55, replacing 1-butanamine 585 with an appropriate amine and optionally replacing 5-bromo-7-azaindole 67 with 5-pyridin-3-yl-1H-pyrrolo[2,3- b]pyridine 89 (prepared as described in Example 17). The following compounds were made following these procedures:

-Benzyl-3-[3-(5-bromo-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-urea (P-1553),

-Benzyl-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-urea (P-1554),

-(2-Methoxy-ethyl)-3-[3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P1566), and

-Phenyl-3-[3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-urea (P-1591).

The following table indicates the amine (column 2) and azaindole (column 3) used to give the objective compound (column 4). The compound number is given in column 1 and the observed mass in column 5.

<td></td><td>Amine</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [m+hT Observed</td>

<td>P-1553</td><td>zNH₂ό</td><td>^B.'AND P Λί</td><td>and</td><td> 447.0 449.1</td>

<td>P-1554</td><td>nh₂either</td><td></td><td>TO</td><td> 448.3</td>

<td>P-1566</td><td>h₂N&gt; You</td><td></td><td>H SQ θ hny</td><td> 416.3</td>

<td>P-1591</td><td>nh₂either</td><td></td><td>Υ^λν^h^No. h</td><td> 434.3</td>

Example 31: Synthesis of 1-Butyl-3-3-[5-(1-methyl-1H-pyrazol-4-yl)-1H-pyrrol[2,3b]pyridine-3-carbonyl]-phenyl-urea P- 1880

Compound P-1880 was synthesized in one step from 1-[3-(5-bromo-1H-pyrrolo[2,3b]pyridine-3-carbonyl)-phenyl]-3-butyl-urea P-1596 as shown in Scheme 56.

Scheme 56

<img file="ECSP088121A_D0101.tif" />

<img file="ECSP088121A_D0102.tif" />

Step 1-Preparation of 1-Butyl-3-3-[5-(1-methyl-1H-pyrazol-4-yl)-1H-pyrrolo[2,3b]pyridine-3-carbonyl]-phenyl-urea ( Q-1880):

In a microwave oven tube, 1 -[3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-3-butyl-urea (P-1596, 0.077 g, 0.00018 mol, prepared as described in Example 47), 1-Methyl-4-(4,4,5,5-tetramethyl-[1,3,2]dioxaborolan-2-yl)-1H-pyrazole (0.0964 g, 0.000464 mol), and Tetrak¡s(tr¡fen¡lfosf¡na)palladium(0) (0.011 g, 0.0000093 mol) were mixed in 1.00 M potassium carbonate in water (1.2 mL), acetonitrile (2.0 mL , 0.037 mol), and tetrahydrofuran (1.0 mL, 0.012 mol). The resulting mixture was heated at 100°C in the microwave for 20 minutes, then at 120Ό for 10 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography to give the compound (P-1880, 52 mg, 67%). MS(ESJ)[M+H⁺]⁺= 417.4.

Example 32: Synthesis of 1 -Butyl-3-[2-chloro-3-(5-pyr¡d¡n-3-¡l-1 H-pyrrolo[2,3-b]pyridine

3-carbonyl)-phenyl]-urea P-1828

Compound P-1828 was synthesized in two steps from 3-amino-2-chlorobenzoic acid

586 as shown in Scheme 57.

Scheme 57

<img file="ECSP088121A_D0103.tif" />

Stage 1 -Preparation of -(3 Butyl-ureido)-2-chloro-benzoic acid (587):

To Ν,Ν-diisopropylamine (1.72 mL, 0.0122 mol) in tetrahydrofuran (12 mL, 0.14 mol), was added 1.6 M of n-butyllithium in hexane (7.6 mL) at -78°C under a nitrogen atmosphere. After 30 minutes, 3-amino-2-chlorobenzoic acid (586, 1.00 g, 0.00583 mol) was added. After another 30 minutes, 1-isocyanatobutane (2.60 mL, 0.0233 mol) was added at -78°C under a nitrogen atmosphere and allowed to stir for two hours. The reaction mixture was warmed to room temperature and stirred at room temperature for 30 minutes. The reaction was quenched with 1M HCI soln. (aq) and extracted with ethyl acetate twice. The combined organic layers were washed with brine, dried over anhydrous magnesium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 40:2:1 dichloromethane:methanol:acetic acid to give the compound as an off-white solid (587.147 mg, 9%).

Step 2 - Preparation of 1-Butyl-3-[2-chloro-3-(5-pyridin-3-yl-1H-pyrrolo[2.3-b]pyridine3-carbonyl)phenyl]-urea (P-1828):

To 3-(3-Butyl-ureido)-2-chloro-benzoic acid (587.103 mg, 0.000380 mol) was added dichloromethane (10 mL, 0.2 mol) followed by thionyl chloride (110 pL, 0.0015 mol) and 1 drop of dimethylformamide to give a suspension. The reaction was stirred at room temperature for 2 hours. Solid material was still present in the reaction mixture, so tetrahydrofuran (0.5 mL, 0.006 mol) was added and stirring continued at room temperature. The reaction turned to a clear solution after 2 hours, then stirred for another hour. All volatiles were removed in vacuo and the residue was stripped with toluene, twice. The solid was then dried under high vacuum for 60 minutes and dissolved in dichloromethane (5 mL). This was added to 5-(pyridin-3-yl)1H-pyrrolo[2,3-b]pyridine (89, 0.074 g, 0.00038 mol, prepared as described in Example 17) which has been treated with trichloride aluminum (0.25 g, 0.0019 mol) in dichloromethane (10 mL) for 1 hour. The reaction was stirred at room temperature overnight, then quenched with methanol (5 mL). The resulting solution was extracted with ethyl acetate and water with saturated sodium bicarbonate added to adjust the ρΗ ~ 8. The organic layer was washed with sodium bicarbonate and brine and dried over magnesium sulfate and filtered. The organic layer was concentrated and purified by column chromatography on silica gel eluting with 2% methanol in dichloromethane followed by 5% methanol in dichloromethane to give the compound as a white solid (P-1828, 45 mg, 26% ). MS(ESI) [M+H⁺]⁺= 448.3.

Additional compounds were prepared following the protocol of Scheme 57, replacing 3-amino-2-chlorobenzoic acid 586 with an appropriate carboxylic acid and optionally replacing 1-¡ocyanatobutane with an appropriate isocyanate in Step 1 and optionally replacing 5-(pyrid¡ n-3-yl)-1 H-pyrrolo[2,3-b]pyridine 89 with an appropriate substituted 7-azaindole (see Example 17) in Step 2. The following compounds were made following these procedures:

-But¡l-3-[2-methyl-3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-carbon ¡l)-phenyl]-urea (P1742),

3-Buty I-1 -methyl-1 -[2-methyl I-3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl )-phenyl]urea (P-1855),

[3-(5-Bromo-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-4-fluoro-phenyl]-urea (P-1570),

[4-Fluoro-3-(5-phenyl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-urea (P-1589),

3-{3-[5-(3-Butyl-ureido)-2-fluoro-benzoyl]-1 H-pyrrolo[2,3-b]pyridin-5-yl}-benzamide (P1621),

-Butyl-3-{4-fluoro-3-[5-(3-methane su If onyl-phenylj)-1 H-pyrrolo[2,3-b]pyridine-3carbonylj-phenylj-urea (P-1627) , and

-[3-(5-Bromo-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-4-fiuoro-phenyl]-3-butyl-urea (P1637).

The following table indicates the carboxylic acid (column 2), the isocyanate (column

3), and azaindole (column 4) used to give the objective compound (column 5). Column 1 indicates the compound number and column 6 the observed mass.

<td></td><td>Acid</td><td>isocyanate</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+H¹]* Observed</td>

<td>P-1742</td><td>TO nh₂</td><td> /</td><td>h</td><td>ao h^nh</td><td> 428.3</td>

<td>P-1855</td><td>TO HN,„</td><td></td><td></td><td>A Vm p</td><td> 442.3</td>

<td>P-1570</td><td>0F^H0and nh₂</td><td>HN=C=O</td><td>^brrr&gt;^no «</td><td>Br^A ​​n-4 ΤΟ H NH₂ΝN</td><td> 377.1 379.1</td>

<td>P-1589</td><td>0 F no^j nh₂</td><td>HN=C=O</td><td>θχγ ™H</td><td>to ΎΌ⁰AfQ h^h₂ΝN¹ h</td><td> 375.2</td>

<td>P-1621</td><td>0F «TJ nh₂</td><td> / 0</td><td>o*.nh₂h</td><td>O^NH₂A Vm⁰MsyX-T nA LOH NH^No. h U</td><td> 474.3</td>

<td>P-1627</td><td>^H0AND nh₂</td><td>Yo 0</td><td>0 °x 1 u</td><td>0 O=s-FfeA A °A;J( 0 AND^h or</td><td> 509.2</td>

<td>P-1637</td><td>0F nh₂</td><td>/ ,n</td><td>^brw h</td><td>TO" IT^h nh^No. Sx/</td><td> 433.1 435.1</td>

Example 33; Synthesis of 1-Butyl-3-[4-fluoro-3-(5-pyridin-3-yl-1H-pyrrolo[2,3b]pyridine-3-carbonyl)-phenyl]-urea (P-1534):

Compound P-1534 was synthesized in two steps from 5-(3-butylureido)2-fluorobenzoic acid 588 (prepared from 3-fluoro-5-aminobenzoic acid and 1-isocyanatobutane following the protocol described in Step 1 of Scheme 57 , Example 32) and 5-bromo-7-azaindole 67 as shown in Scheme 58.

Scheme 58

<img file="ECSP088121A_D0104.tif" />

<img file="ECSP088121A_D0105.tif" />

Step 1 - Preparation of 1-[3-(5-bromo-1H-pyrrolo[2,3-b]-pyridine-3-carbonyl)-4-fluoro-phenyl]-3-butyl-urea (P-1637):

To aluminum trichloride (0.524 g, 0.00393 mol) and dichloromethane (20 mL, 0.3 mol) under a nitrogen atmosphere was added 5-bromo-7-azaindole (67, 0.155 g, 0.000787 mol) in dichloromethane. To 5-(3-butylureido)-2-fluorobenzoic acid (588, 0.200 g, 0.000787 mol) was added 4 mL of dichloromethane (4 mL) followed by thionyl chloride (69 pL, 0.00094 mol) and a drop of Ν, Ν-dimethylformamide. After 1 hour the reaction remained a slurry so additional thionyl chloride was added along with tetrahydrofuran. The reaction remained a suspension, so it was placed in a 50 O oil bath. After another hour, the reaction was still a suspension, and was thus allowed to react at 50 °C overnight. The reaction became a clear solution. All volatiles were removed under vacuum, then the residue was dissolved in dichloromethane and added to the suspension of 5-bromo-7-azaindole and aluminum trichloride. The reaction was allowed to stir at room temperature for 4.5 hours, followed by the addition of water and extraction with ethyl acetate. The organic layer was dried over magnesium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with a gradient of methanol (0 to 10%) in dichloromethane to give the compound (P-1637, 14 mg, 4%).

Step 2 - Preparation of 1-But¡l-3-[4-fluoro-3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]p¡r¡d¡n3-carbonyl )-phenyl]-urea (P-1534):

A 1 -[3-(5-bromo-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-4-fluoro-phenyl]-3-butyl-urea (P1637, 14.0 mg, 0.0000323 mol) , 3-pyridylboronic acid (5.96 mg, 0.0000485 mol), and Tetrakis(triphenylphosphine)palladium(0) (0.820 mg, 7.09E-7 mol) were mixed in 1.00 M potassium carbonate in water (1.00 mL ) and acetonitrile (2.00 mL, 0.0383 mol). The resulting mixture was heated at 120 °C in the microwave oven for 40 minutes. The reaction was extracted with ethyl acetate and water twice, and the combined organic layers washed with 1M sodium bicarbonate followed by brine, and the organic layer dried over magnesium sulfate and filtered. The organic layer was concentrated and purified by reverse phase HPLC (acetonitrile and water with 0.1% formic acid) to give the compound as a white solid (P-1637, 8.5 mg, 61%). MS(ESI) [M+H*]* = 432.3.

-Butyl-3-{4-fluoro-3-[5-(3-trifluoromethoxy-phenyl)-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl]phenyl}-urea P-1660 was prepared by following the protocol of Scheme 58, by replacing 3-Pyridylboronic Acid with 3-Trifluoromethoxy-Phenylboronic Acid in Step 2. MS(ESI) [M+H⁺]⁺ = 515.2.

Example 34: Synthesis of aldehyde reagents to couple to 7-azaindoles

Aldehyde compounds to be coupled to position 3 of a 7-azaindole are shown in the following Schemes. 3-Methoxy-4-[4-(4-methyl-piperazin-1-ylmethylj-benzyloxy]benzaldehyde 591 was prepared in One Step as shown in Scheme 59.

Scheme 59

<img file="ECSP088121A_D0106.tif" />

' 105 5o9

<img file="ECSP088121A_D0107.tif" />

<img file="ECSP088121A_D0108.tif" />

Stage 1- Synthesis of 3-Methoxy-4-[4-(4-methyl-piperazin-1-ylmethyl)-benzyloxy]benzaldehyde (591).

To 4-Hydroxy-3-methoxybenzaldehyde (105, 2.1 g, 0.014 mol) in Ν,Ν-dimethylformamide (40.0 mL) was added 1,4-bis(bromomethyl)-benzene (589, 4.00 g, 0.0152 mol) and potassium carbonate (5.0 g, 0.036 mol) under a nitrogen atmosphere. After 12 hours 1-methyl-piperazine (590, 3.8 mL, 0.034 mol) was added to the reaction. After 2 hours the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% methanol in dichloromethane to give the compound (589.1.2 g, 25.0%). MS(ESI) [M+H⁺]⁺ = 355.3.

2-Fluoro-4-hydroxy-5-methoxy¡-benzaldehyde 593 was synthesized in one step from

2-fluoro-4,5-dimethoxy-benzaldehyde 592 as shown in Scheme 60.

Scheme 60

<img file="ECSP088121A_D0109.tif" />

/0 592 593

Step 1 - Synthesis of 2-fluoro-4-hydroxy-5-methoxy-benzaldehyde (593):

To 2-fluoro-4,5-dimethoxy-benzaldehyde (592, 1.00 g, 5.43 mol) in dichloromethane (50.0 mL) was added aluminum trichloride (4.34 g, 32.6 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and washed with ethyl acetate and hexane to give a white solid (593, 0.70g, 76.0%).

2,5-Difluoro-4-hydroxy¡-benzaldehyde 597 was synthesized in three steps from 2,5-difluorophenol 594 as shown in Scheme 61.

Scheme 61

<img file="ECSP088121A_D0110.tif" />

<img file="ECSP088121A_D0111.tif" />

Step 1 - Synthesis of 4-bromo-2,5-difluorophenol (595);

To 2,5-difluorophenol (594, 5.50 g, 0.0423 mol) in chloroform (110.0 mL), bromine (2.18 mL, 0.0423 mol) was added slowly. After 3 hours, the reaction was poured into sodium thiosulfate solution and extracted with ethyl acetate. The organic layer was dried over sodium sulfate, concentrated, and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give a colorless oil (595, 6.20 g, 70.2%).

Stage 2 - (4-Bromo-2,5-difluoro-phenoxy)-tert-butyl-dimethylsilane (596):

To 4-bromo-2,5-difluoro-phenol (595, 3.50 g, 0.0167 mol) in N,N-dimethylformamide (50.0 mL) were added tert-butyldimethylsilyl chloride (3.83 g, 0.0254 mol) and 1H-imidazole (6.00 g, 0.0529 mol). The reaction was stirred at room temperature overnight, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound (596.3.0 g, 55.4%).

Stage 3 -2,5-Dfluoro-4-hydroxy-benzaldehyde (597):

A (4-bromo-2,5-difluoro-phenoxy)-tert-butyl-dimethyl-silane (596, 3.00 g, 9.28 mmol) in tetrahydrofuran (37.5 mL), under nitrogen at -78 °C, n -butyllithium (3.90 mL, 2.50 M in hexane) was added slowly. After 30 min, Ν,Ν-dimethylformamide (0.825 mL, 0.0106 mol) was added to the reaction. One hour later, the reaction was allowed to come to room temperature. The reaction was poured into water and 1N HCl, then extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the compound as an off-white solid (597.0.86 g, 59.0%).

4-(4-Chloro-benzyloxy)-3-fluoro-benzaldehyde 599 was synthesized in one step from 3-fluoro-4-hydroxy-benzaldehyde 598 as shown in Scheme 62.

Scheme 62

<img file="ECSP088121A_D0112.tif" />

Step 1 - Synthesis of 4-(4-chloro-benzyloxy)-3-fluoro-benzaldehyde /599;.

To 3-fluoro-4-hydroxy-benzaldehyde (598, 0.800 g, 5.71 mmol) in N,N-dimethylformamide (50.0 mL) was added sodium hydride (260.0 mg, 60% in mineral oil, 6.50 mmol). After 15 minutes, 4-chlorobenzyl bromide (557, 1.29 g, 6.28 mmol) was added to the reaction mixture. The reaction was stirred at 80 °C for 5 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give the compound (599.1.3 g, 86.0%).

Additional aldehydes were prepared using the protocol of Scheme 62, by replacing 4-chlorobenzyl bromide 557 with a suitable alkylating agent, and/or 3fluoro-4-hydroxy-benzaldehyde 598 with a suitable aldehyde. The following table indicates the alkylating agent (column 1) and the starting aldehyde (column 2) used to give the aldehyde (column 3) synthesized following this protocol.

<td>leasing agent</td><td>Aldehyde</td><td>Compound</td>

<td>/=\</td><td>OR— 0 /=( Μ λ-ΟΗ h</td><td>hH mQ-CI z°</td>

<td>br</td><td>EITHER- C) /=\ HJ-oh h</td><td>H 'Á &lt;f~\-CF_{3 /0}</td>

<td> /=\</td><td>cf₃ohms</td><td></td>

<td>leasing agent</td><td>Aldehyde</td><td>Compound</td>

<td>mu</td><td>0 hma</td><td>0-X</td>

<td>TO either-</td><td>0 hma_FA^oh</td><td>0 h^;vy⁰^ pAAq.'x/O·'-</td>

<td>either-⁷</td><td> 0 ^H-JLand V^ckA^OH</td><td>0 |/yA°\ P Br</td>

<td></td><td>0 .A^.f</td><td>0 .A^.f</td>

Example 35: Synthesis of [4-(4-chloro-benzyloxy)-3-fluoro-phenyl]-(1H-pyrrolo[2,3b]pyridin-3-yl)-methanone P-1897 and related compounds

Compound P-1897 was synthesized in two steps from 4-(4-chloro-benzyloxy¡)-3fluoro-benzaldehyde 599 as shown in Scheme 63.

Scheme 63

Cl

Step 1 - Synthesis of [4-(4-chloro-benzyloxy)-3-fluoro-phenyl)-(1H-p¡rrolo[2,3-b]p¡r¡d¡n-3¡I) -methanol (P-1895):

To 1 H-Pyrrolo[2,3-b]pyridine (94, 100.0 mg, 0.85 mmol) in methanol (50.0 mL) was added 4-(4-chloro-benzyloxy)-3-fluoro-benzaldehyde (599, 250.0 mg , 0.94 mmol, prepared as described in Example 34) and potassium hydroxide (1.00g, 17.82 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give the compound (P-1895, 55 mg, 17.0%). MS(ESI) [M+H⁺]⁺ = 383.3.

Step 2 - Synthesis of [4-(4-chloro-benzyloxy)-3-fluoro-phenyl]-(1H-pyrolo[2,3-b]pyridin-3yl)-methanone (P-1897):

A[4-(4-chloro-benzyloxy)-3-fluoro-phenyl]-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (P-1895, 17.7 mg, 0.046 mmol) In tetrahydrofuran (10.0 mL) was added periodinane from DessMartin (23.5 mg, 0.056 mmol). The reaction was stirred at room temperature for 15 minutes. The reaction was concentrated, then purified with silica gel column chromatography eluting with 50% ethyl acetate in hexane to give a white solid (P1897, 6.4 mg, 36.3%). MS(ESI) [M+Ηψ = 381.3.

Additional compounds were prepared using the protocol of Scheme 63, by replacing 4-4-(4-chloro-benzyloxy)-3-fluoro-benzaldehyde 599 with a suitable aldehyde (prepared as described in Example 34), and optionally replacing 1HPyrrolo[2,3-b]pyridine 94 with an appropriate substituted 7-azaindole (see Example 9 or Example 16) in Step 1. The following compounds were made following this procedure:

[4-(4-Chloro-benzyloxy)-2-fluoro-5-methoxy-phenyl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone (P-1845),

[4-(4-Chloro-3-trifluoromethyl-bencloxy)-3-methox¡-phenyl]-(1 H-pyrrolo[2,3-b]pyr¡d¡n-3-¡ l)methanone (P-1850/

[4-(4-Chloro-benzyloxy)-3-fluoro-phenyl]-(1H-pyrrolo[2,3-b]pyrid¡n-3-¡l)-methanone (P1897/

[4-(1 H-Benzoimidazol-2-ylmethoxy)-3-fluoro-phenyl]-(1 H-pyrrolo[2,3-b]pyridin-3-yl)methanone (P-1900), ( 4-Benzyloxy-2,5-difluoro-phenyl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-1903),

[4(1 H-Benzoimidazol-2-ylmethoxy)-2-fluoro-5-methoxy-phenyl]-(5-methoxy¡-1H-pyrrolo[2,35 b]pyridin-3-yl)-methanone ( P-1979),

[4-(1 H-Benzoim¡dazol-2-¡lmethox¡)-2-fluoro-5-methox¡-phenyl]-(1 H-pyrrolo[2,3-b]p¡rid¡n- 3yl)-methanone (P-1982),

[4-(1 /-/-Benzoimidazol-2-ylmethoxy)-2,5-difluoro-phenyl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone (P-1987), {4-[2-(2-Bromo-ethoxy)-ethoxy]-2-fluoro-5-methoxy-phenyl}-(5-chloro-1H-pyrrolo[2,3-b]pyridin3-¡l )-methanone (P-1988), (5-Chloro-1H-pyrrolo[2,3-b]pyr¡d¡n-3-¡l)-[2,5-d¡fluoro-4-( 2-methox¡-ethox¡)-phenyl]-methanone (P-1989), and (5-Chloro-1 H-pyrrolo[2_J3-b]pyridin-3-¡l)-[2-fluoro-5-methoxy-4-(2-methoxy¡-ethoxy¡)-phenyl]methanone (P-1991).

The following table indicates the aldehyde (column 2) and azaindole (column 3) used to give the objective compound (column 4). Column 1 indicates the compound number and column 5 the observed mass.

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [Μ+Η*]⁺Observed</td>

<td>Ρ-1845</td><td>Cl ti or^h uj vu</td><td>TO</td><td>ojk^No. you'</td><td>409.6 [M-rf·]·</td>

<td>Ρ-1850</td><td>Cl 0^F3Cyk^hY1Y γΌ</td><td>03 vn</td><td>bf N/'r'p h^CF3</td><td></td>

<td>Ρ-1897</td><td>Cl^hYl9 I F</td><td> 03 ^No. or</td><td>NN'H</td><td> 381.3</td>

<td>Ρ-1900</td><td>Q HN^N F</td><td> 03</td><td>0. ALA opAO^No. fl H</td><td> 387.4</td>

<td>Ρ-1903</td><td>IaO^h ugh me F</td><td>03 n' you</td><td>vKo Π3%Α Άν h</td><td>363.3 [Μ-Ο]</td>

<td>Ρ-1979</td><td> 0 _F^Hfv UW HM either-</td><td>TO^no or</td><td>ΙΊ Ν / Η Π</td><td> 447.4</td>

<td>Ρ-1982</td><td>Q_F hn_vno Η Ύ 0—</td><td> 03 ^No. «</td><td>Η^θ Π</td><td> 417.3</td>

<td>Ρ-1987</td><td>Q_F HN_andNo. F</td><td> 03 ^No. he</td><td>νΑ-νη TO^F II</td><td> 405.3</td>

<td>Ρ-1988</td><td>⁰ Yo^r^ηΎύ°^χ &gt;</td><td>^αΓ3 TO¹ h</td><td>Ο-Υ m^ζ 7-0 Br XQO A^ΙΊ Η</td><td> 471.2 473.2</td>

<td></td><td>Aldehyde</td><td>Azaindole</td><td>Compound</td><td>MS(ESI) [M+H*]⁴Observed</td>

<td>P-1989</td><td>^F z°</td><td>°'W h</td><td>AND^C.T'XM ΝN h</td><td>365.2 [MH*]'</td>

<td>P-1991</td><td></td><td>h</td><td>R. either. ΉM 7-0.^ICYM. S I &lt;DP or- Nβ^z</td><td>377.2 [MH*]'</td>

Example 36: Synthesis of 3-(4-Benzyloxy-2,5-difluoro-benzyl)-1 H-pyrrolo[2,3b]pyridine P-1901

Compound P-1901 was synthesized in four steps from 4-bromo-2,5 difluoro-phenol 595 as shown in Scheme 64.

Scheme 64

<img file="ECSP088121A_D0113.tif" />

Step 1 - Synthesis of 1-Benzyloxy-4-bromo-2,5-difluoro-benzene (600):

To 4-bromo-2,5-difluoro-phenol (595, 0.90 g, 0.0043 mol, prepared as described in Example 34, Scheme 61) in N,N-dimethylformamide (30.0 mL) were added sodium hydride (0.21 g, 60% in mineral oil, 0.0052 mol) and benzyl bromide (0.563 mL, 0.00474 mol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% ethyl acetate in hexane to give a white solid (600, 0.84 g, 65.0%).

Step 2 - (4-Benz¡lox¡-2,5-d¡fluoro-phenyl)-(1-triisoprop¡ls¡lanyl-1H-pyrrolo[2,3-b]p¡r¡d¡n3-yl )-methanol (601):

To 1-Benzyloxy-4-bromo-2,5-difluoro-benzene (600, 0.84 g, 2.80 mmol) in tetrahydrofuran (15.0 mL) and ether (15.0 mL), under a nitrogen atmosphere at -78 Ό, nButyllithium (1.20 mL, 2.50 M in hexane) was added slowly. After 20 minutes, 1-Triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridin-3-carbaldehyde (96, 0.82 g, 0.0027 mol, prepared as described in Example 18) was added to the reaction. . After 20 minutes, the reaction was allowed to warm to room temperature over 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified with silica gel column chromatography eluting with 20% ethyl acetate in hexane to a white solid (601.1.0g, 70.0%). MS(ESI) [M+H⁺]⁺= 523.4.

Step 3 - Synthesis of (4-Benzyloxy-2,5-difluorophenyl)-(1H-pyrrolo[2,3-b]pyridin-3-l)methanol (P-1902):

To (4-Benzyloxy-2,5-difluoro-phenyl)-(1-triisopropylsilan i I-1 H-pyrrolo[2,3-bjpyridi η-3-yl)methanol (601, 1.00 g, 1.91 mmol) in tetrahydrofuran (15.0 mL) was added tetrabutylammonium fluoride, trihydrate (0.63 g, 2.04 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction was rot-evaporated and purified with silica gel column chromatography eluting with 50% ethyl acetate in hexane to give the compound as a white solid (P-1902, 0.59 g, 84.0%). MS(ESI) [M+H*]* = 367.4.

Step 4- Synthesis of 3-(4-Benzyloxy-2_he5-difluoro-benzyl)-1H-pyrrolo[2,3-b]pyridine (P1901):

A (4-Benzyloxy-2,5-difluoro-phenyl)-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (P-1902, 500.0 mg, 1.37 mmol) in acetonitrile ( 25.0 mL) triethylsilane (2.00 mL, 0.0125 mol) and trifluoroacetic acid (1.00 mL, 0.0130 mol) were added. The reaction was heated at reflux for 2 hours. The reaction was concentrated and purified with silica gel column chromatography eluting with 50% ethyl acetate in hexane to give a white solid (P-1901, 60.0 mg, 94.1%). MS(ESI) [M+Ηψ = 351.4.

3-[3-Trifluoromethyl-4-(4-trifluoromethyl-benzyloxy)-benzyl]-1H-pyrrolo[2,3-b]pyridine P-

<img file="ECSP088121A_D0114.tif" />

was prepared using the protocol of Scheme 64, by substituting 4-bromo-2,5-difluoro-phenol 595 with 4-bromo-2-trifluoromethyl-phenol (prepared as described in Example 34, Scheme 61, Step 1, by replace 2,5-difluoro-phenol 594 with 2-trifluoromethylphenol) and benzyl bromide with 1-bromomethyl-4-trifluoromethyl-benzene in Step 1. MS(ESI) [M+H^J]*= 451.

Example 37: Synthesis of 3-[4-(4-chloro-benzyloxy)-2,5-difluoro-benzyl]-1Hpyrrolo[2,3-b]pyridine P-1974

Compound P-1974 was synthesized in four steps from 3-(4-benzyloxy¡-2,5difluoro-benzyl)-1H-pyrrolo[2,3-b]pyridine P-1901 as shown in Scheme 65.

Scheme 65

<img file="ECSP088121A_D0115.tif" />

Step 1- Synthesis of 3-(4-Benzylox¡-2,5-difluoro-benzyl)-1-triisopropylsilanyl-1Hpyrrolo[2,3-b]pyridine (602):

A 3-(4-Benzyloxy-2,5-difluoro-benzyl)-1 H-pyrrolo[2,3-b]pyridine (P-1901, 560.0 mg, 1.60 mmol, prepared as described in Example 18, Scheme 33) in tetrahydrofuran (28.0 mL) was added sodium hydride (100.0 mg, 60% in mineral oil, 2.50 mmol). After 10 minutes, triisopropylsilyl chloride (0.500 mL, 2.36 mmol) was added to the reaction. After 4 hours the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give the compound (602.0.70 g, 86.1%).

Step 2 - Synthesis of 2,5-difluoro-4-(l-triisopropylsilanyl-1H-pyrrolo[2,3-b]-pyridin-3-ylmethyl)-phenol (603):

A 3-(4-Benzyloxy-2,5-difluoro-benzyl)-1-triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridine (602, 0.70 g, 0.0014 mol) in methanol (30.0 mL) 50% palladium hydroxide on carbon (0.1 g) was added under an atmosphere of hydrogen. The reaction was stirred at room temperature overnight. The reaction was filtered and concentrated to give a colorless oil (603, 0.47 g, 82.0%).

Step 3 -3-[4-(4-Chloro-benz¡lox¡)-2,5-difluoro-benzyl]-1-triisopropylsilan¡l-1Hpyrrolo[2,3-b]pyridine (604):

A 2,5-dif I uoro-4-(l-triisoprop¡ Isi lanyl-1 Hp¡ rrolo[2,3-b]p¡ ridi η-3-ylmeti l)-phenol (603, 120.0 mg, 0.29 mmol) in N,Ndimethylformamide (15.0 mL) was added sodium hydride (18.0 mg, 60% in mineral oil, 0.45 mol) under a nitrogen atmosphere. After 10 minutes, 4-chlorobenzyl bromide (65.1 mg, 0.32 mol) was added to the reaction. The reaction was stirred at 40 Ό overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to give crude compound (604, 0.15 g) which was used directly in the next step.

Step 4- Synthesis of 3-[4-(4-chloro-benzyloxy)-2,5-difluoro-benz¡l]-1H-pyrrc)lo[2,3bjpírídína (P-1974):

A 3-[4-(4-chloro-benzyloxy)-2,5-difluoro-benzyl]-1-triisopropylsilanyl-1 H-pyrrolo[2,3bjpyridine (604, 0.150 g, 0.28 mmol) in tetrahydrofuran (10.0 mL) tetra-n-butylammonium fluoride (80.0 mg, 0.31 mmol) was added. After 10 minutes, the reaction was concentrated and purified by column chromatography on silica gel eluting with 50% ethyl acetate in hexane to give the compound as a white solid (P-1974, 30.8 mg, 28.9%). MS(ESI) [M+H}]⁺= 385.3.

2-[2,5-Dlfluoro-4-(1Hpyrrolo[2,3-b]pyridin-3-lmethyl)-phenoxymethyl]-1H-benzoimidazole P1975 was prepared using the protocol of Scheme 65, substituting 4-chlorobenzyl bromide with 2-chloromethyl-1H-benzoimidazole in step 3. MS(ESI) [M+H⁺]⁺= 391.3.

Example 38: Synthesis of 1-(4-Butoxy-phenyl)-3-{3-[5-(4-fluoro-phenyl)-1Hpyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl)- urea P-1754

<img file="ECSP088121A_D0116.tif" />

Compound P-1754 was synthesized in three steps from 5-(4-fluoro-phenyl)-1Hpyrrolo[2,3-b]pyridine 605 as shown in Scheme 66.

Scheme 66

<img file="ECSP088121A_D0117.tif" />

<img file="ECSP088121A_D0118.tif" />

Step 1 - Preparation of (3-chloro-phenyl)-[5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyr¡d¡n-3¡l]-methanone (606):

To 5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridine (605, 530 mg, 2.5 mmol, prepared as described in Example 23) dissolved in 20 mL of dioxane was added 3-nitrobenzaldehyde (534, 758 mg, 5 mmol) and potassium hydroxide (4 mL of 2.5M aqueous). The vessel was shaken on an orbital shaker for 16 hours and the dioxane removed under reduced pressure. The residue was partitioned between ethyl acetate and water. The aqueous layer was neutralized with the addition of 1M HCI. The organic layer was washed with brine, dried over magnesium sulphate and concentrated under reduced pressure to give yellow-orange oil (1.5g). The crude material was dissolved in dichloromethane (150 mL) and cooled to 0°C. With vigorous stirring, pyridinium chlorochromate (3.0 g, 14 mmol) was slowly added, keeping the solution temperature at 0^either C. After the addition was complete the solution was allowed to stir at room temperature for 1 hour. The resulting dark brown/black solution was diluted with chloroform and passed through a plug of silica. Elution with methanol gave 1.5 g of crude 606 which was carried on to the next step without further purification.

Step 2 - Preparation of (3-Amino-phenyl)-[5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridin3-ylJ-methanone (607):

Crude (3-Chloro-phenyl)-[5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridin-3-l]-methanone (606.1.5 g) was dissolved in a minimal amount of methanol (~5 mL) and Pd/C (5%, ~10 mg) was added. The reaction mixture was shaken on a Parr shaker under 4,921 kgf/cm² (70 psi) of H₂ overnight. The reaction mixture was filtered through Celite® and concentrated under reduced pressure to give 1.4 g of crude 607 which was carried on without further purification.

Step 3 - Preparation of 1-(4-Butoxy-phenyl)-3-(3-[5-(4-fluoro-phenyl)-1H-pyrrolo[2,3b]p¡r¡d¡n-3- carbon¡l]-phenyl}-urea (P-1754):

To a solution of -(3-Amino-phenyl)-[5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]methanone (607, 7.5 mg) Clean 1-butoxy-4-isocyanatobenzene (608, 1.6 mg) was added to anhydrous pyridine (200 pL) and the reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure and the residue was dissolved in DMSO (200 pL) and purified using reverse phase HPLC with an acetonitrile/water gradient. MS(ESI) [M+H⁺]⁺= 523.5.

Additional compounds were prepared following the protocol of Scheme 66, optionally substituting 5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridine 605 with a suitable azaindole in Step 1 and/or optionally substituting 1-butoxy-4-isocyanato-benzene 608 with a suitable isocyanate in Step 3. The azaindoles were purchased or prepared as described in Examples 9 or 17. The following compounds were prepared by this procedure:

-(2-Methoxy¡-ethyl)-3-[3-(5-pyrid¡n-3-yl-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P1566 ),

-Phenyl-3-[3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-urea (P-1591),

-Phenyl-3-(3-(1H-pyrrolo[2,3-b]pyrid im-3-carbonyl)-phenyl]-urea (P-1703),

-(4-Fluoro-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1704),

-(4-Methoxy-phenyl I)-3-(3-( 1H-pyrrolo[2,3-b]pyrid i n-3-carbon i I)-phenyl]-urea (P-1705),

-(3,4-Difluoro-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1706),

-(3-Methoxy-phenyl)-3-[3-(1 Hpyrrolo[2,3-b]pyrid i n -3-carbon i I)-phenyl]-urea (P-1707),

-(3,4-Dimethoxyphenyl)-3-[3-(1H-pyrrolo[2,3-b]pyrid¡n-3-carbonyl)-phenyl]-urea (P-1708),

-(4-Chloro-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1709),

-(3-Chloro-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1710),

-(4-Chloro-3-trifluoromethyl-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1711),

-(2-Chloro-5-trifluoromethyl-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1712),

1-(2-Chloro-4-trifluoromethyl-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1713),

-(2-Fluoro-3-trifluoromethyl-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1714),

-(4-Bu1oxy-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1715) ,

-(3-Fluoro-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1716),

-[3-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-(4-trif fluoromethyl-f en yl)-urea (P1717),

1-(3-(1 H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-p-tolyl-urea (P-1718),

-[3-( 1H-Pyrrolo[2,3-b]pyrid¡n-3-carbon¡l)-phenyl]-3-m-tol¡I-urea (P-1719),

-[3-( 1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-o-tolyl-urea (P-1720),

-(4-Methoxy-phenyl)-3-[3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbonyl)-phenyl) )-urea (P-1723),

-(3,4-Difluoro-phenyl)-3-[3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea ( P-1724),

-(3,4-Dimethoxy-phenyl)-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]urea (P-1725 ),

-(3-Chloro-phenyl)-3-[3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-urea ( P1726),

1-(2-Chloro-3-trifluoromethyl-phenyl)-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea ( P-1727),

-(2-Fluoro-3-trifluoromethyl-phenyl)-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea (P- 1728),

1-(4-Butox¡-fen¡l)-3-[3-(5-p¡r¡d¡n-3-¡l-1H-p¡rrolo[2,3-b]p¡r¡ din-3-carbon¡l)-phenyl]-urea (P-1729),

-(3-Fluoro-phenyl)-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-urea (Ρ- 1730),

-[3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-(4-trifluoroinnetyl-phenyl)urea (P-1731),

1(2Chloro5trifluoromethylphenyl)3[3(5pyridin3yl1Hpyrrolo[2,3b]pyridin3carbonyl)-phenyl]-urea (P-1732),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-phenyl-urea (P-1733),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-(4-methoxy¡ -phenyl)-urea (P-

1734),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-(3,4-dfluoro-phenyl)-urea (P-

1735),

-(3-Chloro-phenyl)-3-[3-(5-chloro-1H-pyrrolo[2,3-b]pyrid im-3-carbon ¡I)-phenyl]-urea(P-

1736),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-phenyl]-3-(4-chloro-3-trifluoromethylphenyl)- urea (P-1737),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-(2-chloro-5-trifluoromethylphenyl)-urea (P- 1738),

1-[3-(5-Chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-(2-chloro-4-trifluoromethylphenyl)- urea (P-1739),

1-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyrid¡n-3-carbonyl)-phenyl)-3-(2-fluoro-3-trifluoromethylphenyl)-urea (P-1740),

-(4-Butoxy-phenyl)-3-[3-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]urea (P1741),

-[3-(1H-Pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-(3-trif fluoromethyl-f en yl)-urea (P1746),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-(3-trifluoromethyl-phenyl)-urea (P- 1747),

-(4-Fluoro-phenyl)-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1748) ,

-(3-Methoxy-phenyl)-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl ]-urea (P-1749),

-(4-Chlorophenyl)-3-[3-(5-pyrid¡η-3-yl-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P1750),

-(4-Chloro-3-trifluoromethyl-phenyl)-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea (P- 1751),

-(2-Chloro-5-trifluoromethyl-phenyl)-3-{3-[5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridine-3carbonyl]-phenyl}- urea (P-1752),

-(2-Chloro-4-trifluoromethyl-phenyl)-3-{3-[5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}-urea ( P-1753),

-(4Butoxy-phenyl)-3-{3-[5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl }urea (P-1754),

-[3-(5-Pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-(3-trifluoromethyl-phenyl)urea (P-1755 ),

-[3-(5-P¡ridin-3-yl-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-fen¡l]-3-p- tolyl-urea (P-1756),

-[3-(5-Pyridi η-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-carbon ¡I)-phenylj-3-m-tolyl-urea (P-1757),

-{3-[5-(4-Fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}-3-m-tolylurea (P1758),

-[3-(5-Pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-o-tol¡l-urea (P-1759),

-Pyridin-4-yl-3-[3-(1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-urea (P-1760),

-(2-Methoxy-ethyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea(P-1761),

-(3-Methox¡-5-trifluoromethyl-phenyl)-3-[3-(1 Hp¡rrolo[2,3-b]pyrid¡n-3-carbon¡l)-phenyl] -urea (P-1762),

-(6-Methoxy-pyridin-3-yl) -3-[3-(1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-urea (P1763),

-lsoxazol-3-yl-3-[3{ 1 H-pyrrolo[2,3-b]pyridin-3-carbon¡I)-phenyl]-urea (P-1764), (3-Met¡I-isoxazole -5-¡l)-3-[3-(1H-pyrrolo[2,3-b]pyr¡di n-3-carbonyl)-phenyl]-urea (P1765),

-(3-Chloro-4-trifluoromethyl-phenyl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P-1766),

-(3,4-Dimethyl-isoxazol-5-yl)-3-[3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-urea (P1767),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-pyrid i η-4-yl-urea (P-1770),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3pyridin-3-yl-urea (P-1771 ),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-(2-methoxy¡-ethyl)-urea (P1772),

1-[3-(5-Chloro-1H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-fen¡l]-3-(3-methox¡- 5-trifluoromethylphenyl)-urea (P-1773),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-(6-methoxy-pyridin-3-yl)- urea (P-1774),

-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-3-isoxazol-3-yl-urea (P-1775),

1-[3-(5-Chloro-1H-p¡rrolo[2,3-b]p¡rid¡n-3-carbon¡l)-fen¡l]-3-(3,4-d¡met ¡l-¡soxazole-5-¡l)urea (P-1776),

-P¡ridin-4-yl-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyrid¡n-3-carbonyl)-phenyl]- urea (P1777),

-(3-Methoxy-5-trifluoromethyl-phenyl)-3-[3-(5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea ( P-1778),

-(6-Methoxy-pyridin-3-yl)-3-[3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl )-phenyl]urea (P-1779),

-(4-Dimethylamino-phenyl)-3-[3-(1 H-pyrrolo[2,3-b]pyrid im-3-carbon ¡I)-phenyl]-urea (P1780),

-Pyridin-3-yl-3-[3-(1 Hpyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-urea (P-1781),

-[3-(5-Chloro-1 Hp¡rrolo[2,3-b]pindin-3-carbon¡l)-fen¡l]-3-(4-d¡met¡lam¡no-fen¡l )-urea (P-1782),

-(4-Fluoro-phenyl)-3-{3-[5-(4-fluoro-phenyl)-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}urea (P-1816 ),

-(3,4-Difluoro-phenyl)-3-{3-[5-(4-fluoro-phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}urea (P-1817),

-(3,4-Dimethoxyphenyl)-3-{3-[5-(4-fluoro-phenyl)-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl]-phenyl}urea (P-1818), and

-(3-Fluoro-phenyl)-3-{3-[5-(4-fluoro-phenyl)-1Hpyrrolo[2,3-b]pyridin-3-carbonyl]-phenyl }urea(P-1819).

The following table indicates the azaindole (column 2) and isocyanate (column 3) used to give the objective compound (column 4). Column 1 gives the compound number and the observed mass is given in column 5.

<td></td><td>Azaindole</td><td>isocyanate</td><td>Compound</td><td>MS(ESI) [m+hT Observed</td>

<td>P-1566</td><td>Λ</td><td> 0, ^C.'n-^</td><td>or and Q? NC ID^h</td><td> 416.3</td>

<td>P-1591</td><td>No.</td><td>TO b</td><td>&lt;51 °zQ or . YX) H nAJ NN^h</td><td> 434.3</td>

<td>P-1703</td><td> 03</td><td>V 0</td><td>N'N η^No. h</td><td> 357.1</td>

<td>P-1704</td><td>03 » n</td><td>Q.</td><td>íYYo-'</td><td> 375.1</td>

<td>P-1705</td><td> 03</td><td> %</td><td>cry tA-O⁰'</td><td> 387.1</td>

<td>P-1706</td><td>03 h</td><td>%'n F</td><td>°rQ or 4</td><td> 393.1</td>

<td>P-1707</td><td> 03</td><td>AND X / 0-°</td><td>03 3-O</td><td> 387.1</td>

<td></td><td></td><td>TO</td><td>O/Z O'</td><td></td>

<td></td><td>Azaindole</td><td>isocyanate</td><td>Compound</td><td>MS(ESI) [Μ+Η/Γ Observed</td>

<td>Ρ-1712</td><td>Οό Η</td><td>&lt;Λ&gt;·</td><td>°rQ ρ J*³XH^hIC</td><td> 459.1</td>

<td>Ρ-1713</td><td> 03 ^ΝΗ</td><td>% cf₃</td><td>(η h ü M ΗV</td><td> 459.1</td>

<td>Ρ-1714</td><td> 03 ^Ν ϋ</td><td>x x cf₃</td><td>fxT^h'^h'Q Ν Ν^Η EC, ΗF3</td><td>Yo 443.1</td>

<td>Ρ-1715</td><td> 03 ^Ν ϋ</td><td>“Μ</td><td>-Tp ί ΤΟ η νΛ7^whatZr; η Η</td><td> 429.1</td>

<td>Ρ-1716</td><td>03 -π</td><td>CL V</td><td>^ΚΓ Ν π F Η</td><td> 375.1</td>

<td>Ρ-1717</td><td> 03 ^Ν Η</td><td>χ hcf₃</td><td>°rO Ρ C3 SX-O⁰</td><td> 425.1</td>

<td>Ρ-1718</td><td> 03</td><td>% 'ν</td><td>ίχΑΧ-Ο^Ν Ι(</td><td> 371.1</td>

<td></td><td></td><td> 0».</td><td>O.jTO_η /</td><td></td>

<td></td><td>Azaindole</td><td>isocyanate</td><td>Compound</td><td>MS(ESI) [M+H*]⁺Observed</td>

<td>Ρ-1725</td><td>νν Η</td><td> %&gt; 0-</td><td>0. Λ0 „ or- 100 )-⁵ 0k° ™H</td><td> 494.3</td>

<td>Ρ-1726</td><td>_Ν^|Λν ' Η</td><td> 0 0^-°</td><td>(A °yO &lt;? p nJyyX n-\./n 11' H^No. h</td><td> 468.3</td>

<td>Ρ-1727</td><td>Η</td><td>% x CF_S</td><td>f0 00+0 Tin η TV 'X^h_C.]</td><td> 535.9</td>

<td>Ρ-1728</td><td>όι¹ Η</td><td>You Τ x cf₃</td><td>/0 xdh you x^h XCF₃</td><td> 520.3</td>

<td>Ρ-1729</td><td>Η</td><td></td><td>χχχχ '0'NH^No. h</td><td> 505.9</td>

<td>Ρ-1730</td><td>Η</td><td> 0₄0, V</td><td>00%Ο PJ T T0 h N'W^whatNN^hh</td><td> 451.9</td>

<td></td><td>Α</td><td></td><td>UT n</td><td></td>

<td></td><td>Azalndol</td><td>isocyanate</td><td>Compound</td><td>MS(ESI) [m+hY Observed</td>

<td>Ρ-1736</td><td>^ατη</td><td>% Qt-c</td><td>Q^ClCI'''_r^zSsv^,''^i N”' A''# ΠnAJ^No. 9 ^h</td><td> 425,1</td>

<td>Ρ-1737</td><td>^αΌ3</td><td>either* Q^CFCl</td><td>yQ ox^CF= CK^J n-Í rvci TX} h nAj^no lí «</td><td> 493,1</td>

<td>Ρ-1738</td><td>^tom</td><td> %._No.</td><td>VQ or TT hV m %r</td><td> 493.1</td>

<td>Ρ-1739</td><td>^Clw ” Ν</td><td>0.¾ cf₃</td><td>^C1YS5 ¡ΛΥΥ·</td><td> 493.1</td>

<td>Ρ-1740</td><td>^tow Mr-N Η</td><td>% x cf₃</td><td>yQp I T&gt; h nAU SAINT^h CF₃</td><td> 477.1</td>

<td></td><td></td><td> 1</td><td>W 0</td><td></td>

<td></td><td>Azaindole</td><td>isocyanate</td><td>Compound</td><td>MS(ESI) [M+HY Observed</td>

<td>Ρ-1751</td><td>BV h</td><td>^now-_CF'sci</td><td>0, „CF,¹ h</td><td> 535.9</td>

<td>P-1752</td><td>^No. h</td><td>Xc,V^CF·</td><td>^FnVQ or Y iq</td><td> 553.2</td>

<td>P-1753</td><td>'h</td><td>x cf₃</td><td>FZ^, 0, „ XXYotY /o OO hV^No. f|^hci</td><td> 553.2</td>

<td>P-1754</td><td>you</td><td>Υϋ</td><td>F^s, 0_&lt;n ~^V''\ ry-o ιΠΟ η tj-O Ν</td><td> 523.5</td>

<td>P-1755</td><td></td><td>X...</td><td>0, „CF, NOyyP^Nl /Y Y 1% u NA J</td><td> 502.3</td>

<td></td><td>Azaindole</td><td>isocyanate</td><td>Compound</td><td>MS(ESI) [M+H⁴]⁴Observed</td>

<td>Ρ-1762</td><td> (33 ^Ν Ν</td><td>χγ cf₃</td><td>Χ^λν^η cf₃</td><td> 455.1</td>

<td>Ρ-1763</td><td>03 Νj)j</td><td>°Ύ^νϊΧ XX/</td><td>Ζ&gt;0 C0 η ν-μ Ν^Η</td><td> 388.3</td>

<td>Ρ-1764</td><td> 03</td><td> 3</td><td>°γθ ρ η ν-Δο Χ^Λν^{η ν}</td><td> 348.3</td>

<td>Ρ-1765</td><td> 03</td><td>Ν.</td><td>NÁ.jTÍÍ</td><td> 867.',</td>

<td></td><td>Azaindole</td><td>isocyanate</td><td>Compound</td><td>MS(ESI) [μ+ηΤ Observed</td>

<td>Ρ-1775</td><td>^α'Μ Η</td><td>Ν φ</td><td>°rQ ρ ci^M ΜιΛ j=\ ΥΎΛ η ¡ρ_Νo η ν</td><td> 382.3</td>

<td>Ρ-1775</td><td>Saint^Η Η</td><td>Ή</td><td>Ρ \_7 ΜγΧΑ^Ν JI</td><td> 410.3</td>

<td>Ρ-1777</td><td></td><td>\ x</td><td>η ΜΑ ο ΐίτΛ Η NÁ.JT</td><td> 435.1</td>

<td></td><td>Azaindole</td><td>isocyanate</td><td>Compound</td><td>MS(ESI) [Μ+Ηψ Observed</td>

<td>Ρ-1819</td><td>Η</td><td>°s' V</td><td>^FNo. rQ p 4^No.oh h</td><td> 468.1</td>

Example 39: Synthesis of N-[3-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4difluoro-phenyl]-3,5-difluorobenzenesulfonamide P-1841

Compound P-1841 was synthesized in six steps from 2,4-difluoroaniline 42 as shown in Scheme 67.

Scheme 67

<img file="ECSP088121A_D0119.tif" />

Step 1 - Preparation of (2,4-difluoro-phenyl)-carbamic acid benzyl ester [613):

To 2,4-difluoroaniline (42, 7.0 mL, 0.070 mol) in 100 mL of dichloromethane was added pyridine (11 mL, 0.14 mol) and benzyl chloroformate (11.9 mL, 0.0834 mol). The reaction mixture was stirred at room temperature for 1.5 hours. The reaction mixture was concentrated under reduced pressure and the residue was partitioned between ethyl acetate and KHSO soln.₄. The organic layer was dried (MgS0₄), was concentrated and crystallized from hexanes to give compound 613 (15.6 g, 85%).

Step 2 - Preparation of (2,4-difluoro-3-formyl-phenyl)carbamic acid benzyl ester (614):

To a round bottom flask was added (2,4-difluoro-phenyl)carbamic acid benzyl ester (613.3.83 g, 14.5 mmol) in tetrahydrofuran (148 mL, 1.82 mol). The solution was cooled to -78 Ό and n-butyllithium (1.60 M in hexane, 19.1 mL, 30.0 mmol) was added over 30 min followed by the addition of Ν,Ν-dimethylformamide (1.12 mL, 14.5 mol). The reaction mixture was allowed to warm to room temperature and stirred overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated, and crystallized from ether to give compound 614 (3.0 g, 71%).

Step 3 - Preparation of {2,4-difluoro-3-[hydroxy-(1Hpyrrolo[2,3-b]pyridin-3-yl)-methylj-phenyl}-carbamic acid benzyl ester (615):

To a round bottom flask was added 5-chloro-1 H-pyrrolo[2,3-b]pyridine (80, 0.524 g, 3.43 mmol, prepared as described in Example 9) in methanol (5.00 mL, 0.123 mol). Potassium hydroxide (0.800 g, 14.2 mmol) and (2,4-difluoro3-formyl-phenyl)-carbamic acid benzyl ester (614, 1.02 g, 3.5 mmol) were added and the reaction mixture was stirred overnight. The reaction mixture was poured into 1N HCI and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated, and crystallized from ethyl acetate to give compound 615 (710 mg, 46%). MS(ESI) [M+H⁺]⁺= 444.

Stage 4 - Preparation of [2,4-difluoro-3-(1H-pyrrolo[2,3b]pyr¡d¡n-3-carbon¡l)-phenyl]-carbamic acid benzyl ester (616).

{2,4-Difluoro-3[hydroxy-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methyl]-phenyl}-carbamic acid benzyl ester was added to a round bottom flask. (615, 1.01 g, 2.28 mmol) in tetrahydrofuran (5.00 mL, 0.0616 mol), Dess-Martin periodinane (1.20 g, 2.89 mmol) was added portionwise. The reaction mixture was stirred at room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated, and purified by silica gel chromatography to give compound 616 (914 mg, 91%). MS(ESI) [M+H⁺]⁺= 442.

Step 5 - Preparation of (3-Amino-2,6-difluoro-phenyl)-(5-chloro-1H-pyrrolo[2,3b]pyridin-3-yl)-methanone (P-1801):

[2,4-Difluoro-3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]carbamic acid benzyl ester (616, 800 mg, 1.81 mmol) was added to 10 M NaOH ( 15.00 mL) and refluxed overnight. The reaction mixture was diluted with 30 mL of water and extracted with ethyl acetate to give compound P-1801 (450 mg, 81%).

Step 6 - Preparation of N-[3-(5-doro-1H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-2,4dfluoro-phenyl]-3,5 -difluorobenzenesulfonamide (P-1841)

In a microwave oven reaction vessel were combined (3-Amino-

2,6-difluoro-phenyl)-(5-chloro-1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-1801, 50 mg, 0.16 mmol, prepared as described in Section Example ???), 3,5difluorobenzenesulfonyl chloride (610, 103 mg, 0.49 mmol), pyridine (0.5 mL, 6.1820 mol), and tetrahydrofuran (3.0 mL,). The reaction was heated in the CEM microwave oven at 300 watts, 130°C for 10 minutes. The reaction mixture was partitioned between ethyl acetate and brine. The organic layer was collected, dried over Na₂SW₄, filtered and concentrated. Compound (P-1841) was isolated using column chromatography (silica, hexane:ethyl acetate 70:30) to obtain 36 mg (46%) of the compound. MS = 482.0.

Additional compounds were prepared following the protocol of Scheme 67 Step 6, optionally substituting (3-Amino-2,6-difluoro-phenyl)-(5-chloro-1H-pyrrolo[2,3b]pyridin-3-yl) -methanone P-1801 with (3-Amino-2,6-difluoro-phenyl)-(1 H-pyrrolo[2,3-b]pyridin-3yl)-methanone P-2021 (prepared by Scheme 67 Steps 1- 5, by substituting 5-chloro-1Hpyrrolo[2,3-b]pyridine 80 with 1H-pyrrolo[2,3-b]pyridine 94 in Step 3) and/or 3,5-difluorobenzenesulfonyl chloride 610 with a appropriate sulfonyl. The following compounds were prepared by this procedure:

N-[3-(5-chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-4-isopropylbenzenesulfonamide (P-1839),

N-[2,4-Difluoro-3-(1 Hpyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-benzenesulfonamide (P-0913),

N-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-nitrobenzenesulfonamide (P-1937),

N-{4-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenylsulfamoyl]-phenyl}acetamide (P-1938),

N-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]pyrid¡n-3-carbonyl)-phenyl]-4-methoxybenzenesulfonamide (P-0958), 5-acid methyl ester -[2,4-Difluoro-3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)phenylsulfamoyl]-furan-2-carboxylic acid (P-1941), 5-[2, 4-Difluoro-3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)phenylsulfamo¡l]-2-methyl-furan-3-carboxylic¡co (P-1942),

Acid 5-Oxazol5-[2,4-difluoro-3-(1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-amide yl-thiophen-2-sulfonic acid (P-1943),

5-Isoxazol-5-yl-thiophene-2-sulfonic acid [2,4-difluoro-3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-amide (P-1948) ,

N-[2,4-D¡fluoro-3-(1H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-fen¡l]-2,4-d¡ methoxybenzenesulfonamide (P-1951),

Acid [2,4-dif fluoro-3-(1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-amide

Dimethyl-thiophene-3-sulfonic acid (P-1952),

Acid [2,4-dif fluoro-3-(1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-amide

Dimethyl-furan-3-sulfonic acid (P-1953),

N-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]pyr¡din-3-carbon¡l)-phenyl]-2-methylbenzenesulfonamide (P-1954),

Acid [2,4-dif fluoro-3-(1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-amide

Dihydro-benzo[1,4]dioxin-6-sulfonic acid (P-1955),

Acid [2,4-dif fluoro-3-(1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-amide

Dimethyl-thiazol-5-sulfonic acid (P-1956),

N-[2,4-Difluoro-3-(1 Hpyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-4-trifluoromethylbenzenesulfonamide (P-0931),

N-[2,4-Difluoro-3-(1H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-phenyl]-5-fluoro-2-methylbenzenesulfonamide (P -1961),

N-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]-3-methylbenzenesulfonamide (P-1962),

N-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]p¡rid¡n-3-carbon¡l)-phenyl]-4-oxazole-5-¡lbenzesulfonamide ( P-1963),

N-[2,4-Difluoro-3-(1 H-pyrrolo[2,3-b]pyr¡d¡n-3-carbon¡l)-phenyl]-2,5-dimethoxy¡benzenesulfonamide (P-1131 ),

2- Cyano-N-[2,4-difluoro-3-(1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-phenyl]-benzenesulfonamide (P-1965 ),

3- Cyano-N-[2,4-difluoro-3-(1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-phenyl]

2,52,5-

2.3-

2.4benzenesulfonamide (P-1966),

N-[2,4-D¡fluoro-3-(1H-p¡rrolo[2,3-b]p¡r¡d¡n-3-carbonyl)-phenyl]-4-¡sopropyl - benzenesulfonamide (P-1968),

[2,4-dif fluoro-3-(1 H-pyrrolo[2,3-b]pyrid¡n-3-carbon¡l)-phen i IJ-am ¡ida of the acid

Benzothiazole-6-sulfonic acid (P-1969),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-3-methoxybenzenesulfonamide (P -2011),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]benzenesulfonamide (P-0885),

Acid [3-(5-chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-amide

Thiophene-2-sulfonic acid (P-1267),

N-[3-(5-Chloro-1 Hp¡rrolo[2,3-b]p¡r¡d¡n-3-carbonyl)-2,4-d¡fluoro-phenyl]-4-met Ilbenzesulfonamide (P-1842),

N-{4-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenylsulfamoyl]-phenyl}acetamide (P-1905),

N-[3-(5-Chloro-1 Hpyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-4-methoxybenzenesulfonamide (P-0983 ),

N-[3-(5-Chloro-1 Hpyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-3-trifluoromethylbenzenesulfonamide (P-1599), 5-[3-(5-Chloro-1 Hpyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-difluorophenylsulfamoyl]-furan-2- acid methyl ester carboxylic acid (P-1907), 5-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-difluorophenylsulfamoyl] acid methyl ester -2-methyl-furan-3-carboxylic (P-1908),

Acid [3-(5-chloro-1 Hp¡rrolo[2,3-b]pyrid¡n-3-carbon¡l)-2,4-d¡ffluoro-phenyl]-amide

1,2-Dimethyl-1 H-imidazol-4-sulfonic acid (P-1911),

N-[3-(5-Chloro-1 Hpyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-2-fluorobenzenesulfonamide (P -1912),

N-[3-(5-Chloro-1 Hpyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-4-difluoromethoxy-benzenesulfonamide ( P-1916),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridin-3-carbonyl)-2,4-dfluoro-phenyl]-2,4-d ¡Methoxybenzenesulfonamide (P-1918),

Acid [3-(5-chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-dif fluoro-phenyl]-amide

2.5- Dimethyl-thiophene-3-sulfonic acid (P-1919),

Acid [3-(5-chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-dif fluoro-phenyl]-amide

2.5- Dimethyl-furan-3-sulfonic acid (P-1920),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-2-methylbenzenesulfonamide (P-1921),

Acid [3-(5-chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-dif fluoro-phenyl]-amide

2.3- Dihydro-benzo[1,4]dioxin-6-sulfonic acid (P-1922),

Acid [3-(5-chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-amide

2.4- Dimethyl-thiazole-5-sulfonic acid (P-1923),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-2,4-difluorobenzenesulfonamide (P-1926),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-5-fluoro-2-methylbenzenesulfonamide (P-1927),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-3-methylbenzenesulfonamide (P-1928),

N-[3-(5-Chloro-1 Hpyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluoro-phenyl]-2,5-dimethoxybenzenesulfonamide (P -1929),

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-2,4-d¡fluoro-fen¡l]-2 -cyanobenzenesulfonamide (P-1931), and

N-[3-(5-Chloro-1 H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-2,4-d¡fluoro-phenyl]-3 -cyanobenzenesulfonamide (P-1932).

The following table indicates azaindole (column 2) and sulfonyl chloride (column 2).

3) used to give the objective compound (column 4). The compound number is given in column 1, with the observed mass given in column 5.

<td></td><td>Azaindole</td><td>sulfonyl chloride</td><td>Compound</td><td>MS(YES) [M+H⁴]⁴Observed</td>

<td>Ρ-1839</td><td>^ICYY\F^ΝΗ2 ^;ν^λν</td><td>j^₂ci</td><td>pp a^toW«t⁰</td><td> 489.9</td>

<td>Ρ-0913</td><td>F.^</td><td>SW₂IC EITHER</td><td>yQ Pm^F »t° ΝN</td><td> 413.9</td>

<td>Ρ-1937</td><td>Ε. ίγΓΤ^ΝΗ2 ^ν^λν</td><td>SW₂C1 %</td><td>VO f}NO₂Co^F you^either</td><td> 459.1</td>

<td>Ρ-1938</td><td>F&lt; prÁF^νη2</td><td>SW₂IC 0 or &lt;a^h</td><td>h F ,7^ 0^toautumn^r»t°</td><td> 471.1</td>

<td>Ρ-0958</td><td>/ΤΑ^NH₂</td><td>SW₂IC Φz°</td><td>7)0°' autumn^F «you</td><td> 444.3</td>

<td>Ρ-1941</td><td>F. °YM fM» F^NH2 V^xNo.</td><td>SO,CI to 7°</td><td>pp cA m ot⁰ΝN</td><td> 462.3</td>

<td>Ρ-1942</td><td>F, PfÁF^NH2 V^N</td><td>SW₂IC 0 —0</td><td>77.0 Λ&amp;m^F h'¿ ° ΝN</td><td> 475.9</td>

<td>Ρ-1943</td><td>f&gt; caf^NH2</td><td>sq₂ci to N_v°</td><td>Y-pAjw Crye ΝN</td><td> 487.1</td>

<td>Ρ-1948</td><td>F. prpF^nh2</td><td>SW₂IC^yes / 4.0 No.</td><td>_p ^^ON Optot°^SΝN</td><td> 487.1</td>

<td></td><td>Azaindole</td><td>sulfonyl chloride</td><td>Compound</td><td>MSCESI) [M+H*]* Observed</td>

<td>Ρ-1951</td><td>F. ρΛρ^ΝΗ* ΊΓ'Ν</td><td>| SW₂IC x °x</td><td>M.\M [ΓΥΑ&gt;^FHN'^'o TCN⁰</td><td> 473.9</td>

<td>Ρ-1952</td><td>F. BF^ΝΗζ</td><td>SW₂IC</td><td>caV”V ΝN</td><td> 447.9</td>

<td>Ρ-1953</td><td>jyyf^ΝΗ2</td><td>SW₂ci x</td><td>ΝN</td><td> 432.3</td>

<td>Ρ-1954</td><td>PfA F^ΝΗ2</td><td>SW₂IC G.</td><td>JpΌmf^no^-o⁰</td><td> 427,9</td>

<td>Ρ-1955</td><td>goes fY^F^nhs</td><td>SW_?IC TO</td><td>vQ v~° ΓΥυ f^hn'TO₀w°</td><td> 472.3</td>

<td>Ρ-1956</td><td>F. ν^λν</td><td>SW₂IC sY-y=N</td><td>aVa χΥ rxyat'°^yesΝN</td><td> 448.7</td>

<td>Ρ-0931</td><td>F. fVAF^NH2 ^ν^λν</td><td>SONCI Φ cf₃</td><td>^F rV³m kn⁰</td><td> 481.9</td>

<td>Ρ-1961</td><td>F. iTYYf^nhs</td><td>SW₂ci TO</td><td>yPA-_Frn^F «-Ό</td><td> 445.9</td>

<td>Ρ-1962</td><td>goes fY^F^NH*</td><td>SW_zCI or.</td><td>m A^no^'o W 0</td><td> 427.9</td>

<td></td><td colspan="2">Azaindole</td><td>sulfonyl chloride</td><td colspan="2">Compound</td><td>MS(ESI) [M+H⁴]⁴Observed</td>

<td></td><td></td><td>F_yes</td><td>SW₂IC</td><td></td><td>_rNO.</td><td></td>

<td>Ρ-1963</td><td></td><td></td><td>EITHER</td><td></td><td>%b 0</td><td> 481.1</td>

<td></td><td>[YO</td><td rowspan="2">''VA ρ NH₂ν^λν</td><td>ro</td><td></td><td>ΛΑχ</td><td></td>

<td></td><td></td><td>AND</td><td></td><td>No.⁰</td><td></td>

<td></td><td></td><td>F,</td><td>i SO_zIC</td><td></td><td> 1 .</td><td></td>

<td rowspan="2">Ρ-1131</td><td></td><td>°YM</td><td>AND</td><td colspan="2">W “I-</td><td rowspan="2"> 473.9</td>

<td></td><td>'VA, F</td><td>Ά)</td><td>pr</td><td>ΛF</td>

<td></td><td></td><td>ν^Λν</td><td> 1</td><td>No.</td><td>no 0</td><td></td>

<td></td><td></td><td>κ</td><td rowspan="2">SW₂IC Jk,CN</td><td></td><td>R.</td><td></td>

<td rowspan="2">Ρ-1965</td><td></td><td>I</td><td></td><td>°YQ</td><td rowspan="2"> 439.1</td>

<td> (</td><td>Υγ, F^NFIz</td><td rowspan="2">or</td><td colspan="2">ΙΡΤΛ F^h h'o^CN</td>

<td></td><td></td><td>ν^λν</td><td></td><td> 0</td><td></td>

<td rowspan="2">Ρ-1966</td><td></td><td>F. °YM</td><td>SW₂IC TO</td><td></td><td>F&lt; pl C-^-CN</td><td> 439.1</td>

<td> [[</td><td>FΎ</td><td></td><td>C.</td><td>Y &gt; F^HN'I</td><td></td>

<td></td><td></td><td>Ρn</td><td></td><td>IL J.N</td><td>'Ν θ</td><td></td>

<td></td><td></td><td></td><td>SW₂IC</td><td></td><td>AND</td><td></td>

<td rowspan="2">Ρ-1968</td><td></td><td></td><td>TO</td><td></td><td>I 0</td><td> 456.3</td>

<td></td><td>YX,F^NH2 _ν^λν</td><td></td><td>0 No.</td><td>3 no.</td><td></td>

<td></td><td></td><td>F,</td><td>SW₂IC</td><td></td><td>^F\-</td><td></td>

<td rowspan="2">Ρ-1969</td><td></td><td>vQ</td><td>ά</td><td></td><td>°Ax _0-s</td><td> 471.1</td>

<td></td><td>_F^r nh₂</td><td>YY</td><td colspan="2">mf™-,x₀</td><td></td>

<td></td><td></td><td>ίΔν</td><td>N=/</td><td>no</td><td></td><td></td>

<td></td><td></td><td>AND.</td><td>SW₂IC</td><td></td><td>A.9</td><td></td>

<td>Ρ-2011</td><td rowspan="2">IC</td><td>w</td><td>to</td><td rowspan="2">ck</td><td>°YM 0</td><td> 477.9</td>

<td></td><td>Y'C f nh₂</td><td></td><td>cy^fhp'o</td><td></td>

<td></td><td></td><td></td><td> 1</td><td></td><td>'ipN 0</td><td></td>

<td>Ρ-0885</td><td>IC</td><td>F&lt; w YYS f^NHto</td><td>SW₂IC or</td><td>ck</td><td>Λ 0 PC ν'^ΛΝ 0</td><td> 447.9</td>

<td>Ρ-1267</td><td>IC</td><td>F.yQ YYÁ f NH₂</td><td>SW₂IC either</td><td>ck</td><td>Λ£ YYÁ p Ν'θ*ο UD^h either ΝN</td><td> 453.9</td>

<td></td><td colspan="3">Azaindole</td><td>sulfonyl chloride</td><td colspan="2">Compound</td><td>MS(ESI) [M+HT Observed</td>

<td>P-1842</td><td rowspan="2">cy</td><td>AND.</td><td rowspan="2">nh₂</td><td>SW₂IC EITHER</td><td rowspan="2">EC</td><td>E, / yQ W</td><td rowspan="2"> 462.3</td>

<td></td><td></td><td>V</td><td></td>

<td></td><td></td><td></td><td></td><td>Yo</td><td></td><td>w⁰</td><td></td>

<td></td><td></td><td>AND</td><td></td><td>SW₂C!</td><td></td><td> 0=/</td><td></td>

<td></td><td></td><td>0.J</td><td rowspan="3">) nh₂</td><td>[TO]</td><td></td><td>E,^NH</td><td></td>

<td>P-1905</td><td>ck</td><td>w Αγ p</td><td>Q</td><td rowspan="2">Cl-</td><td>YQ 0</td><td> 505.1</td>

<td></td><td></td><td>1 JL ?^r</td><td>HN r</td><td>tM Γ^ηνΚ W 0</td><td></td>

<td></td><td></td><td>AND</td><td></td><td>SOJCI I</td><td></td><td>FP</td><td></td>

<td>P-0983</td><td>ck</td><td>CL J r\05^FV^xNo.</td><td>nh₂</td><td>Φ °x</td><td>EC</td><td>γγ) 0 rn Α-,γ SCN⁰</td><td> 477.9</td>

<td></td><td></td><td>AND 0.Γ</td><td></td><td>SW₂IC 1</td><td></td><td rowspan="2">F^C.h γθ or</td><td></td>

<td>P-1599</td><td rowspan="2">Cl_yes</td><td>/V</td><td rowspan="2">nh₂</td><td>TO</td><td rowspan="2">EC</td><td> 515.9</td>

<td></td><td> 05 ^F</td><td></td><td>ΐΥΤΛ F^hn*ÍPo</td><td></td>

<td></td><td></td><td>ff N</td><td></td><td>cf₃</td><td></td><td></td><td></td>

<td></td><td></td><td>AND</td><td></td><td>SW₂IC</td><td></td><td>^xeither</td><td></td>

<td>P-1907</td><td rowspan="2">ck</td><td>CL X /V</td><td></td><td></td><td></td><td> ¢9°</td><td> 496.3</td>

<td></td><td>Pn&gt;^F</td><td>nh₂</td><td>Or&lt;</td><td>ck</td><td rowspan="2">yy st 'NN</td><td></td>

<td></td><td></td><td></td><td></td><td> 7°</td><td></td><td></td>

<td></td><td></td><td>F.</td><td></td><td>S0₂IC</td><td></td><td>χ°_ν0</td><td></td>

<td></td><td></td><td></td><td></td><td> 1</td><td></td><td>F. λ</td><td></td>

<td>P-1908</td><td>ck</td><td>CL J 05^F'EITHER</td><td>nh₂</td><td> -0</td><td>ck</td><td>y0 ¿TY p at°</td><td> 509.9</td>

<td rowspan="2">P-1911</td><td rowspan="2">ck</td><td>F. rv</td><td rowspan="2">nh₂</td><td>SW₂IC TO</td><td></td><td>zYY0 0</td><td> 466.3</td>

<td>íYS^F</td><td>Λ\</td><td>ck</td><td>CD^F hT^{0 what}No.^TONo.</td><td></td>

<td></td><td></td><td>F.</td><td></td><td rowspan="2">SW₂IC 6'</td><td></td><td>AND</td><td></td>

<td>P-1912</td><td>ck</td><td>CL J /V CO^F</td><td>nh₂</td><td>EC</td><td>W^FOr Cri Wo SA or</td><td> 465.9</td>

<td></td><td>Azaindole</td><td>sulfonyl chloride</td><td>Compound</td><td>MS(ESI) [M+rf]⁺Observed</td>

<td>Ρ-1916</td><td>F.^ICYY&lt;FΆ</td><td>sojci Φ. °ΎF</td><td>%-Q v^αγγ4</td><td> 513.9</td>

<td>Ρ-1918</td><td>F.^ciyyTf^νη2</td><td>—or |</td><td>^F&gt;=\ \ λ-/⁰'' Mp Ά W fn-so VA θ</td><td></td>

<td>Ρ-1919</td><td>⁰¹ Ύαρ^ΝΗζ</td><td>SW₂IC TO</td><td>Cl v/\VV^m ' S'n V»^F H Ó ° Ν N</td><td> 481.9</td>

<td>Ρ-1920</td><td>ε.^Cl νη₂ν^ΛΝ</td><td>SW₂IC x</td><td>W^F</td><td> 465.9</td>

<td>Ρ-1921</td><td>ε.^Cl WC F^ΝΗ2</td><td>SO,CI r</td><td>vb ό W fA^'o W^N 0</td><td> 461.9</td>

<td>Ρ-1922</td><td>Goes^ciyy4f^NH2 ¹ν^λν</td><td>SO,CI TO</td><td>or Va rO VQ and V°^c'tM&gt;^F«&gt;0 V-II 0</td><td> 505.9</td>

<td>Ρ-1923</td><td>Goes NH_to</td><td>SW₂IC sA-X^No.</td><td>^clw^F no. ΝN</td><td> 483.1</td>

<td>Ρ-1926</td><td>F. F NH₂</td><td>SW₂IC % F</td><td>^αγγξ fHn-sv 0</td><td> 483.9</td>

<td>Ρ-1927</td><td>„. AtV...</td><td>SW₂IC ar</td><td>vqs ΠΙ. J.F.</td><td> 479.9</td>

<td></td><td>Azaindole</td><td>sulfonyl chloride</td><td>Compound</td><td>MS(ESI) [m+hT Observed</td>

<td>P-1928</td><td>^clYVy^NH2XX</td><td>SW₂IC ά</td><td>^0ΙτΜf^hn'xwo</td><td> 461.9</td>

<td>P-1929</td><td>^ciyyTxnh₂xx</td><td>1 OS₂IC rt. 1</td><td>iO θΌ-ο^c,TrV^HNKXX or</td><td> 507.9</td>

<td>P-1931</td><td>^ICYYIF^NH2</td><td>SW₂IC</td><td>yb Q^c'vM&gt; f^hn-x^cnXX 0</td><td> 473.1</td>

<td>P-1932</td><td>F.^Cl yyCf^nhs XX</td><td>SW₂IC</td><td>VQ A c_lrJ^_No.-sXX»</td><td> 473.1</td>

Example 40: Synthesis of 4-(5-pyridin-3-yl-1H-pyrrolo[2,3) acid dibutylamide

b]pyrid¡n-3-carbon¡l)¡indole-1 -carboxylic P-1636

Compound P-1636 was synthesized in two steps from 1H-indole-4-carboxylic acid 611 as shown in Scheme 68.

Scheme 68

<img file="ECSP088121A_D0120.tif" />

Step 1 - Preparation of 1-dibutylcarbamoyl-1H-indole-4-carboxylic acid (612):

To 1H-Indole-4-carboxylic acid (611, 251 mg, 1.56 mmol) in tetrahydrofuran (3 mL), was added 2.5M n-butyllithium in hexane (1.28 mL, 3.19 mmol) at -78 O. After 30 minutes dibutylcarbamyl chloride (657 mg, 3.43 mmol) was added and stirred for two hours. The reaction solution was quenched with 1M HCl (aq) and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous magnesium sulfate, filtered, and concentrated. The desired compound was isolated by column chromatography on silica gel using 10% ethyl acetate in hexane to give a white solid (612.88 mg, 18%). MS(ESI) [MH⁺] =315.1.

Step 2 - Preparation of 4-(5-pyridin-3-yl-1H-pyrrolo[2,3b]pyridine-3-carbonyl)-indole-1-carboxylic acid dibutylamide (P-1636):

To 1-dibutylcarbamoyl-1H-indole-4-carboxylic acid (612, 78 mg, 0.25 mmol) in dichloromethane (2 mL), thionyl chloride (25 pL, 0.34 mmol) was added and stirred for one hour, followed by rotary evaporation to remove solvents to provide the dry acid chloride, which was dissolved in dichloromethane for later use. Meanwhile, 5-pyridin-3-yl-1 H-pyrrolo[2,3-b]pyridine (89.55 mg, 0.28 mmol, prepared as described in Example 17) in dichloromethane (8 mL), aluminum trichloride (215 mg, 1.6 mmol) was mixed and stirred for one hour, followed by addition of dry acid chloride in dichloromethane (3 mL). The reaction was stirred at room temperature overnight, then quenched with methanol and all volatiles removed. The desired compound was isolated by column chromatography on silica gel using 10% methanol in dichloromethane to give a solid (P-1636.11 mg, 9%). MS(ESI) [Μ+Ηψ = 494.3.

Additional compounds were prepared following the protocol of Scheme 68, substituting dibutylcarbamyl chloride with a suitable reagent in Step 1 and optionally substituting 5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyr¡d ¡na 89 with 5-(6-Methoxy¡pyridin-3-¡l)-1H-pyrrolo[2,3-b]pyridine (see Example 17) in Step 2. The following compounds were prepared following this procedure :

[1 -(Butan-1 -sulfoni I) -1H - i ndo I-4-yl]-(5-pyridin-3-¡I-1H-p¡ r rolo[2,3-b] pyridin-3 -i I) methanone (P-1661),

4-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-indole-1-carboxylic acid pentylamide (P-1702),

4-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-carbonyl)-indole-1-carboxylic acid dipropylamide (P-1722), and

4-[5-(6-Methoxy-pyridin-3-yl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]indole-1-carboxylic acid butylamide (P-1827).

The following table indicates the reagent used instead of dibutylcarbamyl chloride (column 2) and the azaindole (column 3) used to give the objective compound (column 3). The compound number is given in column 1, and the observed mass is given in

<img file="ECSP088121A_D0121.tif" />

<td></td><td>Stage 1 reagent</td><td>Azaindole</td><td>Compound</td><td>MS(ESJ) [M+hY Observed</td>

<td>P-1702</td><td>N=C=O</td><td>θγ</td><td></td><td> 452.3</td>

<td>P-1722</td><td>ClyO to</td><td></td><td>V'N</td><td> 466.3</td>

<td>P-1827</td><td>N=C=O</td><td>AND^Νϊ&gt;γΥα Η</td><td>AND YOU^No. iPrC</td><td> 468.3</td>

Example 41: Synthesis of 3-(3-Benzyloxy-2-chloro-6-fluoro-benzyl)-1 H-pyrrolo[2,3o]pyridine P-1852, (3-Benzyloxy-2-chloro-6-fluoro- phenyl)-(1H-pyrrolo[2,3-b]pyridiη-3-yl)methanone P-1853 and related compounds

Compounds P-1852 and P-1853 were synthesized in four steps from 2-chloro-4-fluorophenol 617 and 1H-pyrrolo[2,3-£>]pyridine 94 as shown in Scheme 67.

Scheme 69

<img file="ECSP088121A_D0122.tif" />

<img file="ECSP088121A_D0123.tif" />

P-1852 +

<img file="ECSP088121A_D0124.tif" />

Step 1 - Preparation of 1-Benzyloxy-2-chloro-4-fluoro-benzene (618):

To a solution of 2-chloro-4-fluorophenol (617.7 g, 0.05 mol) in tetrahydrofuran (100 mL) was added sodium hydride (1.8 g, 95% dry powder, 0.071 mol) at room temperature over 15 min. under a nitrogen atmosphere. The reaction mixture was stirred at room temperature for 30 minutes. Benzyl bromide (10 g, 0.060 mol) was slowly added to the reaction mixture, then stirred at room temperature overnight. The reaction mixture was poured into ice water, extracted with ethyl acetate, washed with hydrochloric acid (10%), water, brine, and dried over magnesium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexane to give the compound as a white solid (618, 7.6 g, 60%).

Step 2 - Preparation of 3-Benzyloxy-2-chloro-6-fluoro-benzaldehyde (619):

To a solution of 1 -benzyloxy-2-chloro-4-fluoro-benzene (618, 5.8 g, 0.024 mol) in tetrahydrofuran (100 mL) was added 2.50 M of n-butyllithium (2.7 mL, 2.50 M in hexane, 0.029 mol) slowly at -78 °C for 15 minutes under nitrogen. The reaction mixture was stirred at -78 °C for 30 minutes. To the reaction mixture was then added N,Ndimethylformamide (4.2 mL, 0.054 mol). The reaction was allowed to warm to room temperature and was continued at room temperature overnight. The reaction mixture was poured into ice water, extracted with ethyl acetate, washed with hydrochloric acid (10%), water, brine, and dried over magnesium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexane to give the compound as a white solid (619, 2.1 g, 32%). MS(ESI) [M+H⁺]⁺ = 265.08.

Step 3 - Preparation of 3-[(3-Benz¡lox¡-2-chloro-6-fluoro-phenyl)-methoxy-methyl]-1Hpyrrolo[2,3-b]pyridine (P-1867) and (3- Benzyloxy-2-chloro-6-fluoro-phenyl)-(1H-pyrrolo[2,3-b]pyridin3-yl)-methanol (P-1868):

A mixture of 1 H-pyrrolo[2,3-b]pyridine (94, 0.5 g, 4 mmol), 3-benzyloxy-2-chloro-6-fluoro-benzaldehyde (619, 1.3 g, 4.9 mmol), and potassium hydroxide (0.99 g, 18 mmol) in methanol (30 mL) was stirred at room temperature overnight. The reaction mixture was concentrated and the residue was dissolved in ethyl acetate and water. The organic layer was collected and washed with brine. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexane to give compound P-1867 as a white solid (1.3 g, 70%, MS(ESI) [M +H⁺]⁺ = 397.16), and compound P-1868 as an off-white solid (0.2 g, 10, MS(ESI) [M+HT = 383.14).

Step 4a - Preparation of 3-(3-Benzyloxy-2-chloro-6-fluoro-benzyl)-1H-pyrrolo[2,3bjpyridine (P-1852):

A mixture of 3-[(3-Benzyloxy-2-chloro-6-fluoro-phenyl)-methoxy-methyl]-1H-pyrrolo[2,3£>]pyridine (P-1867, 0.1 g, 0.2 mmol) , trifluoroacetic acid (0.6 mL, 8 mmol), and triethylsilane (0.3 mL, 2 mmol) in acetonitrile (10 mL) was refluxed for 2 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with methanol in dichloromethane to give the compound as an off-white solid (P-1852, 62 mg, 70%). MS(ESI) [M+H⁺]⁺ = 367.16.

Step 4b - Preparation of (3-Benziioxy-2-chloro-6-fluoro-phenyl)-(1H-pyrroio[2,3-b]pyridin-3-yl)-methanone (P-1853):

To a solution of (3-Benzyloxy-2-chloro-6-fluoro-phenyl)-(1 H-pyrrolo[2,3-b]pyridin-3-yl)methanol (P-1868, 65 mg, 0.17 mmol) Dess-Martin periodinane (79 mg, 0.19 mmol) was added to tetrahydrofuran (10 mL) at 0 °C. The reaction mixture was stirred at room temperature for 2 hours. The reaction was quenched with saturated sodium thiosulfate solution, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with methanol in dichloromethane to give the compound as a light yellow solid (P-1853, 32 mg, 50%). MS(ESI) [M+H⁺]⁺ = 381.13.

Additional compounds were prepared following the protocol of Scheme 69, optionally replacing 2-chloro-4-fluorophenol 617 with 2,6-difluorophenol or 2,6-dichlorophenol, optionally replacing benzyl bromide with an appropriate substituted benzyl bromide, and optionally replacing 1 H-pyrrolo[2,3-d]pyridine 94 with an appropriate substituted 1H-pyrrolo[2,3-b]pyridine. The azaindoles were purchased or prepared as described in Examples 9 or 16. The following compounds were made following this procedure:

3-[2,6-Dichloro-3-(4-chloro-benzyloxy)-benzyl]-1 H-pyrrolo[2,3-b]pyridine (P-1768),

[2,6-Dichloro-3-(4-chloro-benz¡loxy)-phenyl]-(1H-pyrrolo[2,3-¿)]pyridiπ-3-yl)methanone (P1769), (3-Benzyloxy -2,6-difluoro-phenyl)-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-1802),

3-(3-Benzylox¡-2,6-difluoro-benz¡l)-1 Hp¡rrolo[2,3-b]pyrid¡na (P-1803),

3-(3-Benzyloxy-2,6-difluoro-benzyl)-5-methoxy¡-1 H-pyrrolo[2,3-¡>]pyridine (P-1804), 3-(3-Benzyloxy-2,6 -difluoro-benzyl)-5-chloro-1H-pyrrolo[2,3-b]pyridine (P-1824), (3-Benzyloxy-2,6-difluoro-phenyl)-(5-chloro-1H- pyrrolo[2,3-b]pyridin-3-yl)-methanone (P1825),

3-[(3-Benzyloxy-2-chloro-6-fluoro-phenyl)-methoxy¡-methyl]-1 H-pyrrolo[2,3-b]pyridine (P1867), (3-Benzyloxy-2- chloro-6-fluoro-phenyl)-(1 Hpyrrolo[2,3-b]pyridin-3-l)-methanol (P-1868),

[2-Chloro-3-(3-chloro-benzyloxy)-6-fluoro-phenyl]-(1H-pyrrolo[2,3-£>]pyridin-3-yl)-methanone (P-1869),

[2-Chloro-3-(4-chloro-benz¡lox¡)-6-fluoro-fen¡l]-(1H-p¡rrolo[2,3-b]p¡r¡d¡n-3- ¡l)-methanone (P-1874),

3-[2,6-Difluoro-3-(pyridin-4-ylmethoxy)-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-1993), and

3-[3-(4-Chloro-2-fluoro-benzyloxy)-2,6-difluoro-benzyl]-1Hpyrrolo[2,3-b]pyridine (P1992).

The phenol, benzyl bromide and azaindole used in Steps 1, 2, and 3, respectively, are indicated in columns 2, 3, and 4 of the following table, respectively, to give the objective compound (column 5). The compound number is given in column 1, and the observed mass is given in column 6.

<td></td><td>Phenol</td><td>benzyl bromide</td><td>Azaindole</td><td>Compound</td><td>MS (ESI) [m+hT Observed</td>

<td>Ρ-1768</td><td>Cl Λ&gt; ooh</td><td>CO</td><td>CO</td><td>ci ci [CyAc/ o-⁷</td><td> 417.14</td>

<td>Ρ-1769</td><td>Cl eXP ooh</td><td>Ί EITHER 1 Cl</td><td>co</td><td>Cl Cl CVCcr o-⁷</td><td> 431.09</td>

<td>Ρ-1802</td><td>X' ooh</td><td>(Yo</td><td></td><td>F VyJO crr/¹ h</td><td> 365.23</td>

<td>Ρ-1803</td><td>Ϋ ooh</td><td></td><td>AND</td><td>F. rO O CVA^FMr-N^No. h</td><td> 351.23</td>

<td>Ρ-1804</td><td>ooh</td><td>'either</td><td>ΎΡ</td><td>0— =O xr</td><td> 381.26</td>

<td>Ρ-1824</td><td>F •X ooh</td><td>either</td><td>^c,W</td><td>F Cl CW X^ICsjCto&gt;</td><td> 385.22</td>

<td>Ρ-1825</td><td>ooh</td><td>B._either</td><td>-t</td><td>F. h</td><td> 399.21</td>

<td></td><td>Phenol</td><td>benzyl bromide</td><td>Azaindole</td><td>Compound</td><td>MS (ESI) [M+H¹]¹' Observed</td>

<td>P-1869</td><td>ooh</td><td>AND</td><td>03 saw</td><td>yb b lOTAcr o-/</td><td> 415.24</td>

<td>P-1874</td><td>and ooh</td><td>Cl</td><td>Co^No. h</td><td>W 0^No. h</td><td> 415.23</td>

<td>P-1993</td><td>,4 ooh</td><td> 6</td><td>QC</td><td></td><td> 352.39</td>

<td>P-1992</td><td>„¿¿ ooh</td><td>Cl</td><td> 0?</td><td></td><td> 403.32</td>

Example 42: Synthesis of (3-Benzyloxy-2-methyl-phenyl)-(lH-pyrrolo[2,3-b]pyridin-3l)-methanone P-1848 and 3-(3-Benzyloxy-2 -methyl-benzyl)-1H-pyrrolo[2,3-¿>]pyridine P-1857

Compounds P-1848 and P-1857 were synthesized in five steps from compounds 620 and 1H-pyrrolo[2,3-¿>]pyridine 94 as shown in Scheme 70.

Scheme 70

<img file="ECSP088121A_D0125.tif" />

P-1B57

Step 1 - Preparation of 3-Benzyloxy-2-methyl-benzoic acid (621).

To a solution of 3-hydroxy-2-methyl-benzoic acid (620, 5.0 g, 0.033 mol) in tetrahydrofuran (100 mL) and Ν,Ν-dimethylformamide (50 mL), sodium hydride (4.4 g as 60% of dispersion in mineral oil, 0.11 mol) was added slowly over 30 minutes and the reaction was stirred at 0 °C under a nitrogen atmosphere. The reaction mixture was allowed to warm to room temperature, then stirred at room temperature for 1 hour. Benzyl bromide (9.0 mL, 0.076 mol) was slowly added into the reaction mixture, and the reaction mixture was stirred at room temperature overnight. The reaction mixture was poured into water, extracted with ethyl acetate, washed with ammonium chloride-ammonium hydroxide solution (4:1), brine, and dried over magnesium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexane to give the compound as a white solid (621, 5.8 g, 73%).

Step 2 - Preparation of (3-Benzyloxy-2-methyl-phenyl)-methanol (622):

To a solution of 3-benzyloxy-2-methyl-benzoic acid (621, 3.0 g, 0.012 mol) in tetrahydrofuran (100 mL), lithium aluminum hydride (25 mL, 1M solution in tetrahydrofuran, 0.025 mol) was added by dripping at 0 °C for 5 min. The reaction mixture was then stirred at room temperature overnight under a nitrogen atmosphere. After sodium sulfate decahydrate (20.0 g, 0.062 mol) was added, the reaction mixture was stirred at room temperature for 10 minutes. A white solid was collected by filtration. The solid compound was further washed with a mixture of hexane and dichloromethane (9:1) and dried under high vacuum (622, 2.8 g, 91%).

Step 3 - Preparation of 3-Benzyloxy-2-methyl-benzaldehyde (623):

To a solution of (3-benzyloxy-2-methyl-phenyl)-methanol (622, 627 mg, 2.75 mmol) in tetrahydrofuran (60 mL) was added Dess-Martin periodinan (2.9 g, 6.87 mmol) at 0 °C The resulting mixture was stirred at 0 Ό for 50 minutes. The reaction mixture was quenched with saturated sodium thiosulfate solution, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexane to give the compound as a white solid (623, 0.55 g, 84%).

Step 4 - Preparation of (3-Benzyloxy-2-methyl-phenyl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)methanol (624) and 3-[(3-Benzyloxy-2 -methyl-phenyl)-methoxy-methyl]-1H-pyrrolo[2,3-b]pyridine (625):

A mixture of 1 H-pyrrolo[2,3-b]pyridine (94, 0.33 g, 2.8 mmol), 3-benzyloxy-2-methylbenzaldehyde (623, 0.55 g, 2.4 mmol), and potassium hydroxide (0.39 g, 6.1 mmol) in methanol (40 mL) was stirred at room temperature for 17 hours. The reaction mixture was poured into water and then extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexane to give compound 624 as an off-white solid (330 mg, 39%, MS(ESI) [M+H⁺]⁺ = 3-(5.29, and compound 625 as a white solid (24 mg, 3%, MS(ESI) [M+H⁺]⁺ = 359.30).

Step 5a - Preparation of (3-Benzyloxy-2-methyl-phenyl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone (P-1848):

To a solution of (3-E5encyloxy-2-methyl-phenyl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (624, 0.12g, 0.35mmol) in tetrahydrofuran (15mL ) periodinane from DessMartin (0.37 g, 0.89 mmol) was added at 0 °C. The reaction mixture was stirred at 0 °C for 50 minutes, then quenched with saturated sodium thiosulfate solution, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of the solvent, the residue was washed with ethyl ether and hexanes (1:1) to give the compound as a yellow solid (P1848.108 mg, 90%). MS(ESI) [M+H⁺]⁺ = 343.22.

Step 5b - Preparation of 3-(3-Benzyloxy-2-methyl-benzyl)-1H-pyrrolo[2,3-b]pyridine (P-1857):

A mixture of 3-[(3-benzyloxy-2-methyl-phenyl)-methoxy-methyl]-1H-pyrrolo[2,3-b]pyridine (625, 24 mg, 0.067 mmol) , trifluoroacetic acid (1 mL, 13 mmol), and triethylsilane (2 mL, 12.5 mmol) in acetonitrile (10 mL) was refluxed for 4 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of the solvent, the residue was washed with a mixture of ethyl ether and hexanes (1:1) to give the compound as a yellow solid (P-1857, 17 mg, 75%). MS(ESI) [M+H⁺]⁺= 329.24.

Example 43: Synthesis of [3-(4-chloro-benzyloxy)-2-ethoxy-phenyl]-(1H-pyrrolo[2,3b]pyridin-3-yl)-methanone P- 1892 and 3-[3-(4-chloro-benzyloxy)-2-ethoxy-benzyl]-1Hpyrrolo[2,3-b]pyridine P-1893

Compounds P-1892 and P-1893 were synthesized in five steps from compounds 626,557 and 1H-pyrrolo[2,3-í)]pyridine 94 as shown in Scheme 71.

Scheme 71

<img file="ECSP088121A_D0126.tif" />

ci

<img file="ECSP088121A_D0127.tif" />

<img file="ECSP088121A_D0128.tif" />

Step 1 Preparation of 2,3-Bis-(4-chloro-benzyloxy)-benzaldehyde (627):

To a solution of 2,3-dihydroxybenzaldehyde (626, 2.0 g, 14.5 mmol) in tetrahydrofuran (100 mL) was added sodium hydride (0.52 g, 13.0 mmol) at 0 °C under a nitrogen atmosphere. The reaction mixture was allowed to warm to room temperature and was stirred at room temperature for 30 minutes. To the reaction mixture was then added 4-chlorobenzyl bromide (557, 2.7 g, 13.0 mmol). The reaction mixture was stirred at room temperature under a nitrogen atmosphere overnight. Ν, N-dimethylformamide (50 mL) was added into the reaction mixture and stirred at room temperature for 24 hours. The reaction mixture was poured into ice water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over magnesium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexane to give the compound as an off-white solid (627, 2.3 gm, 46%).

Step 2 - Preparation of 3-(4-chloro-benzyloxy¡)-2-hydroxy¡-benzaldehyde (628):

To magnesium (0.098 g, lathe shavings, 4.0 mmol) in a mixture of anhydrous ether (20 mL) and benzene (20 mL) at 0 °C, bromine (0.10 mL, 2.0 mmol) was added dropwise. When the reaction had started, stirring was started and the addition of bromine continued until complete. The ice bath was removed and the reaction mixture was heated until the solution was nearly colorless. After cooling, the reaction mixture was slowly added to a solution of 2,3-bis-(4-chloro-benzyloxy¡)-benzaldehyde (627, 0.78 g, 2.0 mmol) in benzene (60 mL) at room temperature while which was shaken vigorously. On completion of the addition, the reaction mixture was stirred at room temperature overnight, then refluxed for 36 hours. After the reaction mixture was cooled to room temperature, a solid was collected by filtration and washed with benzene, then boiled in hydrochloric acid (100 mL, 1.0 M) for 30 minutes. After cooling, the solution was extracted with dichloromethane. The organic layer was washed with brine and dried over magnesium sulfate. An off-white solid was obtained after removal of the solvent (628, 0.32 mg, 60%). MS(ESI) [MH-]=261.25.

Step 3 - Preparation of 3-(4-chloro-benzyloxy¡)-2-ethoxy-benzaldehyde (629).

To a mixture of 3-(4-chloro-benzyloxy)-2-hydroxy-benzaldehyde (110 mg, 0.42 mmol), potassium carbonate (150 mg, 1.1 mmol) in acetonitrile (8 mL) was added iodoethane (0.2 mL, 2.5 mmol) at room temperature. The mixture was stirred at 98 °C for 18 hours. The reaction mixture was poured into saturated ammonium chloride solution and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over magnesium sulfate. After removal of the solvent, a light yellow solid was obtained (629.116 mg, 95%).

Step 4 - Preparation of [3-(4-chloro-benz¡lox¡)-2-ethoxyfen¡l]-(1H-pyrrolo[2,3-b]pyrid¡n3-yl)-methanol (630) and 3-{[3-(4-chloro-benzyloxy¡)-2-ethoxy-phenyl]-methoxy-methyl}-1H-pyrrolo[2,3bjpyridine (631):

A mixture of 1 H-Pyrrolo[2,3-b]pyridine (94, 26 mg, 0.22 mmol), 3-(4-chlorobenzyloxy)-2-ethoxy-benzaldehyde (629, 54 mg, 0.19 mmol), and hydroxide Potassium (30 mg, 0.4.6 mmol) in methanol (5 mL) was stirred at room temperature for 4 days. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexane to give compound 630 as an off-white solid (20 mg, 26%, MS(ESI) [M+H⁺]⁺ = 409.32) and compound 631 as an off-white solid (44 mg, 56%, MS(ESI) [Μ+Ηψ = 423.33.

Step 5a - Preparation of [3-(4-chloro-benzyloxy)-2-ethoxy-phenyl]-(1H-pyrrolo[2,3b]pyr¡d¡n-3-yl)-methanone (P-1892):

To a solution of [3-(4-chloro-benzyloxy)-2-ethoxy¡-phenyl]-(1H-pyrrolo[2,3-¿>]pyr¡d¡n-3-¡l)methanol (630, 20 mg, 0.05 mmol) in tetrahydrofuran (8 mL) was added Dess-Martin periodinan (52 mg, 0.12 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 50 minutes. The reaction was quenched with saturated sodium thiosulfate solution, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of the solvent, the residue was washed with a mixture of ethyl ether and hexanes (1:1) to give the compound as a yellow solid (P-1892.15 mg, 75%). MS(ESI) [M+H⁺]⁺ = 407.38.

Step 5b - Preparation of 3-[3-(4-chloro-benzyloxy)-2-ethoxy-benzyl]-1H-pyrrolo[2,3bjpyridine (P-1893):

A mixture of 3-{[3-(4-chloro-benzyloxy)-2-ethoxyphenyl]-methoxy-methyl}-1 H-pyrrolo[2,3¿>]pyridine (631, 44 mg, 0.1 mmol), acid trifluoroacetic acid (1 mL, 13 mmol), and triethylsilane (2 mL, 12.5 mmol) in acetonitrile (10 mL) was refluxed for 4 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of the solvent, the residue was washed with a mixture of ethyl ether and hexanes (1:1) to give the compound as a yellow solid (P-1893, 40 mg, 98%). MS(ESI) [M+H⁺]⁺ 393.39.

[3-(4-Chloro-benzyloxy)-2-methoxy-phenyl]-(1 H-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P1891), [3-(4-chloro- benzyloxy)-2-(2,2,2-trifluoroethoxy)phenyl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone (P-2076), and [3-(4 -chloro-2-fluoro-benzylox¡)-2-ethox¡-phenyl]-(5-methox¡-1H-pyrrolo[2,3b]pi r idi n -3- yl)-m et an ona (P-2016)

<img file="ECSP088121A_D0129.tif" />

were prepared following the protocol of Scheme 71, substituting iodoethane for iodomethane in step 3 to provide P-1891 or substituting iodoethane for 2-iodo-1,1,1-trifluoroethane in step 3 to provide P-2076, or substituting 4-chlorobenzyl 557 with 4-chloro-2-fluoro-benzyl bromide in step 1 and 7-azaindole with 5-methoxy-7-azaindole in step 4 to give P-2016. MS(ESI) [Μ+Ηψ 393.4 (P-1891), 461.08 (P-2076), and 455.2 (P-2016).

Example 44. Synthesis of {3-[5-(4-chloro-phenyl)-1 H-pyrrolo[2,3-b]pyridine-3carbonyl]-2,4-difluoro-phenyl}-amide of propane acid -1-sulphonic P-0956

Compound P-0956 was synthesized in three steps from 5-(4-chlorophenyl)-1Hpyrrolo[2,3-b]pyridine 514 and propanic acid (2,4-difluoro-3-formyl-phenyl)-amide. -1-sulfonic acid 73 as shown in Scheme 72.

Scheme 72

632R = H 633 R = CHCl

Stage 1-Preparation of (3-{[5-(4-chloro-phenyl)-1H-pyrrolo[2,3-b]pyridin-3-l]-hydroxymethyl}-2 Propane-1-sulfonic acid,4-difluoro-phenyl)-amide (632) and (3-{[5-(4-chloro-phenyl)1H-pyrrolo[2,3-b]pyridin-3-yl Propane-1-sulfonic acid ]-methoxy-methyl}-2,4-difluoro-phenyl)-amide (633).

To a suspension of 5-(4-chloro-phenyl)-1H-pyrrolo[2,3-b]pindine (514, 64.9 g, 158 mM, prepared as described in Example 17) and (2,4- Propane-1-sulfonic acid difluoro-3-form¡l-phenyl)-amide (73, 90.4 g, 191 mM, prepared as described in Example 7) in methanol in a water bath was added potassium hydroxide ( 128.8g, 1.28M). The reaction was stirred 72 hours at room temperature and then adjusted to pH 7 with 4N hydrochloric acid. The resulting mixture was evaporated in vacuo to remove the methanol and extracted 3x with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give a crude oil. The crude oil was triturated with 3:1 MTBE/heptane to give a solid 1:3 mixture of 632 and 633 which was used directly for the next step.

Stage 2-Preparation of (3-{[5-(4-chloro-phenyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]-hydroxmethyl}- Propane-1-sulfonic acid 2,4-difluoro-phenyl)-amide (632):

To a solution of 632 and 633 (approximately 315 mM) in acetic acid was added 48% hydrobromic acid (final 8%). The resulting mixture was stirred overnight at room temperature and then evaporated in vacuo. The crude residue was taken up with equal volumes of ethyl acetate and water, and adjusted to pH 7 with solid potassium carbonate. The layers were divided and the aqueous layer was extracted 2x with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give 632 as a viscous oil which was used directly for the next step.

Step 3-Preparation of propane-1-sulfonic acid {3-[S-(4-chloro-phenyl)-1Hpyrrolo[2,3-b]pyridine-3-carbonyl]-2_:Acid 4-difluoro-phenyl}-amide (P-0956):

To a solution of 632 (approximately 386 mM) in 1,4-dioxane was added 2,3-dichloro-5,6-dicanobenzoquinone (83.8 g, 502 mM) followed by water (final 4.8%). The resulting mixture was stirred 2 hours at room temperature and then quenched with one volume of saturated sodium bicarbonate. The mixture was evaporated in vacuo to remove the 1,4-dioxane and extracted 3x with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give a crude solid which was purified on a silica gel column with 94:5:1 dichloromethane/methanol/ammonium hydroxide as eluant to give P- 0956 (about 50% yield over 3 steps) as a white solid.

Example 45: Synthesis of 3-Iodo-l-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine 635

3-Iodo-1 -triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridine 635 was synthesized in one step from 3-Iodo-1 H-pyrrolo[2,3-b]pyridine 634 as shown in Scheme 73.

Scheme 73

<img file="ECSP088121A_D0130.tif" />

Step 1 - Preparation of 3-Iodo-1-triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridine (635):

3-Iodo-1 H-pyrrolo[2,3-b]pyridine 634 (2.00 g, 8.20 mmol) was dissolved in N,N-dimethylformamide (50 mL). Sodium hydride (60% dispersion in mineral oil, 390 mg, 9.8 mmol) was added. After 20 minutes, triisopropylsilyl chloride (1.74 mL, 8.20 mmol) was added dropwise. After 1.5 hours the reaction was poured into water and extracted with ethyl acetate, washed with saturated sodium bicarbonate and brine. The organic portions were dried over anhydrous sodium sulfate and concentrated. Purification by chromatography on silica gel, 0-25% ethyl acetate/hexane gradient gave compound 635 as a white solid (3.224 g, 98.2%).¹H-NMR was consistent with the desired compound.

Example 46: Synthesis of 1-(tert-Butyl-dimethyl-silanyl)-3-iodo-1H-pyrrolo[2,3b]pyridine 636

-(tert-Butyl-dimethyl-silanyl)-3-iodo-1H-pyrrolo[2,3-b]pyridine 636 was synthesized in one step from 3-Iodo-1H-pyrrolo[2,3-b ]p¡ridina 634 as shown in Scheme 74.

Scheme 74

<img file="ECSP088121A_D0131.tif" />

Step 1 - Preparation of 1-(tert-Butyl-dimethyl-silanyl)-3-iodo-1H-pyrrolo[2,3-b]pyridine (636):

3-Iodo-1 H-pyrrolo[2,3-b]pyridine 634 (1.11 g, 4.6 minol) was dissolved in tetrahydrofuran (120 mL). Sodium hydride (60% dispersion in mineral oil, 0.13 g, 5.5 mmol) was added, followed by tert-butyldimethylsilyl chloride (0.85 g, 5.5 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic portion was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified with silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound as a white solid (636.100 mg, 15%).

Example 47: Synthesis of [5-(4-chloro-benzyloxy)-4-methoxy-pyridin-2-yl]-(1Hpyrrolo[2,3-b]pyridin-3-yl)-methanone P-2024

[5-(4-Chloro-benzyloxy)-4-methoxy-pyridin-2-yl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone

P-2024 was synthesized in six steps from Kojic acid, 3, and 3-iodo-1-triisopropylsilanyl1H-pyrrolo[2,3-b]pyridine, 2, as shown in Scheme 75.

Scheme 75

<img file="ECSP088121A_D0132.tif" />

Step 1- Preparation of 5-(4-chloro-benzyloxy)-2-hydroxymethyl-pyran-4-one (638):

Kojic acid (637, 5.00 g, 35.2 mmol) and 4-chlorobenzyl bromide (557, 7.95 g,

38.7 mmol) were suspended in methanol (40 mL) in a sealed 80 mL tube. Sodium hydroxide in water (12 M, 2.93 mL) was added. The reaction was heated at 80 °C overnight. The resulting suspension was concentrated. Water was added and the mixture was filtered and washed with water to provide a brown solid. Minimal methanol washing on the filter removed the brown color. A white solid (638, 7.58 g, 80%) was isolated. Ή-NMR was consistent with the desired compound.

Stage 2 - Preparation of 5-(4-chloro-benzyloxy)-2-hydroxymethyl-1H-pyridin-4-one (639);

5-(4-Chloro-benzyloxy)-2-hydroxymethyl-pyran-4-one (638, 8.00 g, 3.00 mmol) was suspended in ammonium hydroxide (200 mL) in a sealed 80 mL tube. The reaction was heated at 90 °C overnight. On cooling, the reaction was brought down to pH 10 with 6N HCl to give a beige solid which was collected by filtration (639.7.8 g, 98%).

Step 3 - Preparation of [5-(4-chloro-benzyloxy)-4-methoxypyridin-2-yl]-methanol (640);

5-(4-Chloro-benzyloxy)-2-hydroxymethyl-1H-pyridin-4-one (639, 1.06 g, 3.99 mmol) was dissolved in methanol (8.5 mL) and Ν,Ν-dimethylformamide (46 mL). Trimethylsilyldiazomethane in hexane (2.00 M, 3.99 mL) was added. The reaction was stirred at room temperature overnight, then additional trimethylsilyldiazomethane in hexane (2.00 M, 3.99 mL) was added. The reaction was stirred at room temperature for 2 days. The mixture was adsorbed on silica and purified by silica gel chromatography, methanol:dichloromethane to give the compound (640.798 mg, 72%). MS(ESI) [M+H⁺]⁺= 280.4, 282.4.

Step 4 - Preparation of 5-(4-chloro-benzyloxy)-4-methoxy-pyridine-2-carbaldehyde (641):

[5-(4-Chloro-benzyloxy¡)-4-methoxy¡-pyridin-2-¡l]-methanol (640, 480 mg, 1.7 mmol) was dissolved in dimethyl sulfoxide (26 mL) and Dess-Martin periodinane (909 mg, 2.1 mmol) was added. The reaction was allowed to stir at room temperature for 2 hours. The reaction was concentrated under high vacuum and then poured into NaHCO solution.₃ and na₂S₂EITHER₃. The mixture was extracted with ethyl acetate. The organic portions were dried with anhydrous sodium sulfate and filtered. The filtrate was adsorbed on silica and purified by silica gel chromatography, ethyl acetate:hexanes, to provide the desired compound as a white powder (641.343 mg, 72%).

Step 5 - Preparation of [5-(4-chloro-benzyloxy¡)-4-methoxy¡-pyridin-2-yl]-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl )-methanol (642):

3-Iodo-1 -triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridine (635, 180 mg, 0.450 mmol) was dissolved in tetrahydrofuran (2.5 mL) and the reaction cooled to -20 °C under a nitrogen atmosphere. Isopropylmagnesium chloride in tetrahydrofuran (2.00 M, 0.243 mL) was added. The reaction was stirred for 1 hour, during which the temperature rose to 0 °C. The reaction was cooled to -20 °C and 5-(4-chloro-benzyloxy)-4-methoxy-pyridine-2-carbaldehyde (641, 80.0 mg, 0.288 mmol) in tetrahydrofuran (0.75 mL) was added. The reaction was allowed to warm to room temperature and stirred overnight. The reaction was quenched with methanol and adsorbed on silica, then purified by chromatography on silica gel, methanekdichloromethane, to provide the desired product, (642.94 mg, 59%).¹HNMR was consistent with the desired compound. MS(ESI) [M+H⁺]⁺ 552.4, 554.4, 555.4.

Stage 6- Preparation of [5-(4-chloro-benzyloxy¡)-4-methoxy¡-pyrid¡n-2-yl]-(1H-pyrrolo[2,3b]-pyrid¡n-3-yl)- Methanone (P-2024):

[5-(4-Chloro-benz¡lox¡)-4-methoxy-pyrid¡n-2-¡l]-(1-triisopropylsilanyl-1 H-pyrrolo[2,3b]pyridin-3- yl)-methanol (642, 60.0 mg, 0.11 mmol) was dissolved in tetrahydrofuran (2.00 mL). Dess-Martin periodinane (55.3 mg, 0.13 mmol) was added to the reaction and stirred at room temperature overnight. The mixture was extracted with ethyl acetate and saturated sodium bicarbonate. The organic portions were dried with anhydrous sodium sulfate, filtered, and the filtrate adsorbed on silica and purified by chromatography on silica gel, methane-dichloromethane, to provide the desired compound (P-2024, 10.7 mg, 25%).¹H-NMR was consistent with the desired compound. MS(ESI) [M+H⁺]⁺ = 394.1,396.1.

Example 48: Synthesis of 3-4-[1-(4-chloro-phenyl)-ethoxy]-3-methoxy-benzyl-1Hpyrrolo[2,3-b]pyridine P-2000

3-4-[1 -(4-Chloro-fenll)-ethox¡]-3-methox¡-benc¡ I-1 H-pyrrolo[2,3-b]p¡r¡dine P-2000 was synthesized in three steps from vanillin 105, 4-chlorophenylmethylcarbinol 643, and 1-(tertbut¡ld¡methyl-silan¡l)-3-iodo-1H-pyrrolo[2,3-b]pyridine 636, as shown in Scheme 76.

Scheme 76ci

Cl

Stage

645

Step 1 - Preparation of 4-[1-(4-chloro-phenyl)-ethoxy]-3-methoxy¡-benzaldehyde (644):

4-Chlorophenylmethylcarbinol (643, 0.668 mL, 6.57 mmol) was dissolved in tetrahydrofuran (60.0 mL) at 0 °C under a nitrogen atmosphere. 4-Hydrox¡-3-methoxybenzaldehyde (105, 1.00 g, 6.57 mmol) and triphenylphosphine (2.07 g, 7.89 mmol) were added to the reaction, followed by diisopropyl azodicarboxylate (1.55 mL, 7.89 mmol) over 10 min. The reaction was stirred for 2 hours. The mixture was adsorbed on silica and purified by silica gel chromatography, ethyl acetate:hexanes, to provide the desired compound, (644, 1.14 g, 60%).¹H-NMR was consistent with the desired compound.

Step 2 - Preparation of [1-(tert-But¡l-dimethyl-s¡lanyl)-1H-pyrrolo[2,3-b]p¡rid¡n-3-yl]-4[ 1 -(4- chloro-phenyl)-ethoxy]-3-methoxy-phenyl-methanol (645):

-(tert-Butyl-dimethyl-silanyl)-3-iodo-1 H-pyrrolo[2,3-b]pyridine (636, 647.0 mg, 1.81 mmol) was dissolved in tetrahydrofuran (10.0 mL) at -20 °C under a nitrogen atmosphere. Isopropylmagnesium chloride in tetrahydrofuran (2.0 M, 0.98 mL) was added to the reaction. The reaction was stirred for 1 hour, during which the temperature rose to 0 °C. The reaction was cooled to -20 °C and 4-[1-(4-chloro-phenyl)-ethoxy]-3-methoxy-benzaldehyde (644, 420 mg, 1.4 mmol) in tetrahydrofuran (3.00 mL) was added. The reaction was stirred for 2 hours during which the temperature rose to 10 °C. The reaction was quenched with methanol and adsorbed on silica, then purified by silica gel chromatography, ethyl acetate:hexanes, to provide the desired compound, (645.463 mg, 61%).¹H-NMR was consistent with the desired compound.

Step 2-Preparation of 3-4-[1-(4-chlorophenyl)-ethoxy]-3-methoxy-benzyl-1H-pyrrolo[2,3bjpyridine (P-2000).

[1 -(tert-But¡l-dimethyl-silan¡l)-1 H-pyrrolo[2,3-b]p¡r¡din-3-¡l]-4-[1 -(4-chloro- phenyl)-ethoxy¡]-3-methoxy-phenyl-methanol (645, 0.200 g, 0.382 mmol) was dissolved in acetonitrile (5.00 mL).

Trifluoroacetic acid (0.138 mL) was added and the reaction stirred for five minutes. Triethylsilane (0.285 mL) was added and the reaction was heated at 80 °C for 2 hours. The reaction was concentrated, then redissolved in ethyl acetate and adsorbed on silica and purified by silica gel chromatography, ethyl acetate:hexanes, to provide the desired compound (P-2000, 57 mg, 38%).¹H-NMR was consistent with the desired compound. MS(ESI): [M+H⁺]⁺= 393.3, 395.3.

Example 49: Synthesis of 5-[4-(2-methoxyethoxy)-phenyl]-1H-pyrrolo[2,3-b]pyridine 648

5-[4-(2-Methoxyethoxy)-phenyl]-1H-pyrrolo[2,3-b]pyridine 648 was synthesized in two steps from 4-bromophenol 646 as shown in Scheme 77.

Scheme 77

<img file="ECSP088121A_D0133.tif" />

Stage 1

br

646

<img file="ECSP088121A_D0134.tif" />

Step 1 - Preparation of 1-Bromo-4-(2-methoxy-ethoxy)-benzene (647):

To a solution of 4-bromophenol (646, 5.0 g, 28.9 mmol) in dimethylformamide (15 mL) were added potassium carbonate (4.40 g, 31.8 mmol) and 1-bromo-2-methoxyethane (5.00 g, 36.0 mmol) under a nitrogen atmosphere. The reaction mixture was stirred at room temperature overnight and concentrated under reduced pressure. The residue was taken up in ethyl acetate (50 mL) and filtered. The filtrate was washed with saturated sodium bicarbonate solution, dried over magnesium sulfate, and filtered. Column chromatography on silica gel (0-10% ethyl acetate in hexanes) gave the desired compound as a colorless oil (647.3.2 g, 48%).

Step 2 - Preparation of 5-[4-(2-Methoxy-ethox¡)-phenyl]-1H-pyrrolo[2,3-b]p¡r¡dine (648J:

To a solution of 5-(4,4,5,5,-tetramethyl-[1,3,2]dioxaborolan-2-yl)-1H-pyrrolol[2,3bjpyridine (1.1 g, 4.3 mmol) in tetrahydrofuran ( 40 mL) was added 1-bromo-4-(2-methoxyethoxy)-benzene (647, 1.50 g, 6.49 mmol) and tetrakis(triphenylphosphine)palladium(0) (0.25 g, 0.21 mmol). The reaction mixture was stirred with potassium carbonate solution (10 mL, 1.0 M) and refluxed overnight. The biphasic reaction mixture was diluted with ethyl acetate (50 mL) and saturated sodium carbonate solution (20 mL). The organic layer was separated, washed with brine, dried over magnesium sulfate, and purified by silica gel column chromatography (50-100% ethyl acetate in hexanes) to give the desired compound as a colorless solid ( 648, 782mg, 67%). MS(ESI) [M+H⁺]⁺= 267.4.

Example 50: Synthesis of 3-[2-fluoro-5-methoxy-4-(pyridin-4-ylmethoxy)-benzyl]-1Hpyrrolo[2,3-b]pyridine P-2040 and related compounds.

Compound P-2040 was synthesized in one step from 5-fluoro-2-methoxy¡-4-(1-triisopropylsilanyl-1Hpyrrolo[2,3-b]pyridin-3-ylmethyl)-phenol 649 and pyridin- 4-yl-methanol 650 as shown in Scheme 78.

Diagram 78 ,N

P-2040

649

Step 1 Preparation of 3-[2-fluoro-5-methoxy-4-(pyridin-4-ylmethoxy)-benzyl]-1Hpyrrolo[2,3-bJpyridine (P-2040):

5-Fluoro-2-methoxy¡-4-(1-triiisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenol (649, 10 mg, 0.024 mmol, prepared as described in Section Example 57) was combined with pyridin-4-yl-methanol (650, 3.2mg, 0.029 mmol) in a 4 ml_ container and dissolved in dry tetrahydrofuran (200μΙ). Triphenylphosphine (7.7 mg) was added and the solution shaken until homogeneous. The mixture was cooled to below 0 Ό in a liquid nitrogen bath and diisopropyl azodicarboxylate solution (50μΙ of 20mg/50pl in THF) was added. The reaction mixture was allowed to warm to room temperature. After 2 hours, the solvent was removed under a reduced atmosphere. Crude material was dissolved in dimethyl sulfoxide (300μΙ) and potassium fluoride (10mg, 0.18mmol) added. The mixture was warmed slightly and allowed to react overnight at room temperature. The vessel was centrifuged and the DMSO solution was purified by reverse phase HPLC using a YMC-Pack ODS-A C-18 column (50mm x 10mm ID), and eluting with water with 0.1% TFA and a 15% gradient. -80% acetonitrile with 0.1% TFA for 8 minutes and a flow rate of 6 mL/minute to give the compound (P-2040, 4.4 mg, 50%). MS(ESI) [M+H⁺]⁺= 364.3.

Additional compounds were prepared following the protocol of Scheme 78, by replacing pyridin-4-yl-methanol 650 with an appropriate alcohol. The following compounds were made following this procedure:

3-[2-Fluoro-5-methoxy-4-(2-morpholin-4-¡l-ethoxy¡)-benz¡l]-1H-pyrrolo[2,3-b]pyridine (P2037),

3-[2-Fluoro-5-methoxy-4-(pyridin-3-ylmethoxy)-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-2038),

3-[2-Fluoro-5-methoxy-4-(6-methyl-pyridin-2-ylmethoxy)-benzyl]-1H-pyrrolo[2,3-b]pyrid ¡na (P-2039),

3-[2-FI uoro-5-methoxy-4-(pyridin-2-ylmethoxy)-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-2041),

3-[2-Fluoro-4-(2-fluoro-4-trifluoromethyl-benzyloxy¡)-5-methoxy¡-benzyl]-1H-pyrrolo[2,3b]pyridine (P-2042),

3-[4-(4-Chloro-2-fluoro-benzyloxy)-2-fluoro-5-methoxy¡-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-1973),

3-[4-(2,4-Dimethylt¡azol-5-¡lmethoxy¡)-2-fluoro-5-methoxy-benz¡l]-1 H-pyrrolo[2,3-b]pyrid¡na (P-2043),

3-(4-(2,5-Dimethyl-2H-p¡razol-3-¡lmethoxy¡)-2-fluoro-5-methoxy-benz¡l]-1 H-pyrrolo[2,3bjpyridine (P -2044),

3-[2-Fluoro-5-methox¡-4-(3-morpholin-4-yl-propoxy¡)-benc¡l]-1 H-pyrrolo[2,3-b]pyr¡d¡na (P2045 ),

-{2-[5-Fluoro-2-methoxy¡-4-(1 Hp¡rrolo[2,3-b]p¡rid¡n-3-ylmethyl)-phenoxy]-eth¡l}-p ¡rrolidin-2one (P-2046),

3-[2-Fluoro-4-(2-fluoro-benzyloxy)-5-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P2047),

3-[2-Fluoro-5-methoxy-4-(3-methylpyridin-4-lmethoxy)-benzyl]-1H-pyrrolo[2,3-b]pyrid ¡na (P-2048),

3-[2-Fluoro-5-methoxy-4-(6-trifluoromethyl-pyridin-3-lmethoxy)-benzyl]-1H-pyrrolo[2,3blpyridine (P-2049),

3-(4-(2,4-Dichloro-benzyloxy)-2-fluoro-5-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P2050),

3-[2-Fluoro-4-(4-imidazol-1 -yl-benzyloxy¡)-5-methoxy¡-benz¡l]-1 H-pyrrolo[2,3-b]pyr¡dine (P-2051 ),

3-(4-(2,4-Difluoro-benzyloxy)-2-fluoro-5-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P2052),

3-{2-Fluoro-4-[1 -(2-fluoro-phenyl)-ethoxy]-5-methoxy-benzyl}-1 H-pyrrolo[2,3-b]pyridine (P·

2053),

3-[4-(3-Cyclopentyl-propoxy)-2-fluoro-5-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P2054),

3-(4-(1,5-Dimethyl-1 H-pyrazol-3-ylmethoxy)-2-fluoro-5-methoxy-benzyl]-1 H-pyrrolo[2,35 bjpyridine (P-2055), and

3-[4-(2-Cyclopentyl-ethoxy)-2-fluoro-5-methoxy-benzyl]-1H-pyrrolo[2,3-b]pyridine (P-2056)

The following table indicates the alcohol (column 2) used in Scheme 78 to provide the compounds (column 4). Column 1 gives the compound number and column 4 the observed mass.

<td></td><td>Alcohol</td><td>Compound</td><td>MS(ESI) [m+hT Observed</td>

<td>P-2037</td><td></td><td></td><td> 386.3</td>

<td>P-2038</td><td>«N HO / δ</td><td>Cci? h</td><td> 364.3</td>

<td></td><td>Alcohol</td><td>Compound</td><td>MS(ESD) Observed</td>

<td>Ρ-2039</td><td></td><td>^Ν Η</td><td> 378.3</td>

<td>Ρ-2041</td><td>ΗΟ J Υ</td><td>ΟχΓ?^Ν Η</td><td> 364,3</td>

<td>Ρ-2042</td><td>F, F ηο, F</td><td>^Ν Η</td><td> 448.7</td>

<td>Ρ-1973</td><td></td><td>Ρ_χ F, Τγθν-νΥ⁰¹0γ</td><td> 415.1</td>

<td>Ρ-2043</td><td>^η°Τ</td><td>/Χ'-Χ X</td><td> 397.9</td>

<td>Ρ-2044</td><td>\ Ηη ,^Ν'Ν^Η0^ΑΧ</td><td> % '</td><td> 381,1</td>

<td>Ρ-2045</td><td>^HCand η</td><td>σΡ</td><td> 400.3</td>

<td></td><td>Alcohol</td><td>Compound</td><td>MS(ESI) [m+hT Observed</td>

<td>Ρ-2046</td><td>0 Ρ</td><td>myv</td><td> 384.3</td>

<td>Ρ-2047</td><td>F. .^hmD</td><td>V-y_ CQ '</td><td> 381.1</td>

<td>Ρ-2048</td><td>^Η0Φ</td><td>^No. h</td><td> 378.3</td>

<td>Ρ-2049</td><td>ΗΟ / Us '-Ah/^F</td><td>_F^no x Co°^m what</td><td> 432.3</td>

<td>Ρ-2050</td><td>α_χΗΟ /V^to</td><td>QC</td><td> 431.1</td>

<td>Ρ-2051</td><td>ΗΟ</td><td>(χΟ sl'n^Γ h</td><td> 429.1</td>

<td>Ρ-2052</td><td>ΗΟ. /VF -00</td><td>V-\ JXy vQ</td><td> 399.1</td>

<td></td><td>Alcohol</td><td>Compound</td><td>MS(ESI) [M+HT Observed</td>

<td>P-2053</td><td></td><td>op</td><td> 395.1</td>

<td>P-2054</td><td></td><td>R. And that's it^No. h</td><td> 383.1</td>

<td>P-2055</td><td>^ho_x /AND</td><td>^zEITHER \ in 3 __________________1</td><td> 381.1</td>

<td>P-2056 Yo</td><td>HO AND</td><td>F_x_ ^No. h</td><td> 369.1</td>

Example 51: Synthesis of [2,6-difluoro-3-(pyridin-3-ylmethoxy)-phenyl]-(1Hpyrrolo[2,3-b]pyridin-3-yl)-methanone P-2058 and related compounds.

Compound P-2058 was synthesized in 1 step from (2,6-Difluoro-3-hydroxy¡phenyl)-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone 651 and Pyridin -3-yl-methanol 652 as shown in Scheme 79.

Scheme 79

651

P-2058

Stage 1 - Preparation of [2,6-Difluoro-3-(pyridin-3-ylmethoxy)phenyl]-(1H-pyrrolo[2,3b]pyridin-3-yl)-methanone (P-2058) :

In a 4 mL container, (2,6-Difluoro-3-hydroxy-phenyl)-(1 H-pyrrolo[2,3-b]pyridin-3-yl)methanone (651, 10 mg, 0.037 mmol, prepared as described in Example 23) was combined with pyridin-3-yl-methanol (652, 4.9 mg 0.044 mmol). The solids were dissolved in dry tetrahydrofuran (200μΙ) and triphenylphosphine (11.5mg, 0.044mmol) added. Once the solution was homogenized, the mixture was cooled below 0 °C in a liquid nitrogen bath and diisopropyl azodicarboxylate solution (50μΙ of 20ιτ^/50μΙ THF) was added. The reaction mixture was allowed to warm to room temperature and the reaction was continued for 2 hours. The solvents were removed under a reduced atmosphere. The resulting residue was diluted with 200μΙ DMSO and the mixture was purified by reverse phase HPLC using a YMC-Pack ODS-A C-18 column (50mm x 10mm ID), and eluting with 0.1% TFA water and a gradient. of 15%-80% acetonitrile with 0.1% TFA for 8 min and a flow rate of 6 mL/min to provide P-2058 (5.9 mg, 44%). MS(ESI) [M+HT = 365.9.

Additional compounds were prepared following the protocol of Scheme 79, by replacing pyridin-3-yl-methanol 652 with an appropriate alcohol. The following compounds were made following this procedure:

[2,6-Dif I uoro-3-( 1 -methyl-1 H-imidazol-2-ylm ethoxy)-phenyl]-(1 H-pyrrolo[2,3-b]pyridin-3-i I) methanone (P-2033),

[2,6-D¡fluoro-3-(6-morpholin-4-yl-pyridin-3-¡lmethoxy¡)-phenyl]-(1H-pyrrolo[2,3-b]pyr¡d¡ n-3-¡l)methanone (P-2034), {2,6-Difluoro-3-[4-(5-methyl-[1,2,4]oxadiazol-3-yl)-benzyloxy]-phenyl} -(1H-pyrrolo[2,3b]pyridin-3-yl)-methanone (P-2035),

[3-(6-Diethylamino-pyridin-3-ylmethoxy)-2,6-difluoro-phenyl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone (P- 2036),

[3-(2-Chloro-4-fluoro-benzyloxy)-2,6-difluoro-phenyl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone (P-2057) ,

[2,6-Difluoro-3-{6-methyl-pyridin-2-ylmethoxy)-phenyl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone (P-2059) ,

[2,6-Difluoro-3-(pyridin-4-ylmethoxy)-phenyl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P2060),

[3-(4-Chloro-2-fluoro-benzyloxy)-2,6-difluoro-phenyl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)methanone (P-2061) ,

[3-(2,4-Dimethyl-thiazol-5-¡lmethoxy¡)-2,6-difluoro-phenyl]-(1H-pyrrolo[2,3-b]pyr¡d¡n-3-yl) methanone (P-2062),

[3-(2,5-Dimethyl-2H-pyrazol-3-ylmethoxy)-2,6-d¡fluoro-phenyl]-(1H-pyrrolo[2,3-b]pyridin-3-yl) methanone (P-2063), and

[2,6-Diuoro-3-(3-morpholin-4-yl-propoxy)-phenyl]-(1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone (P-2064 ).

The following table indicates the alcohol (column 2) used to give the compound (column 3). Column 1 gives the compound number and column 4 the observed mass.

<td></td><td>Alcohol</td><td>Compound</td><td>MS(ESI) [M+ITf Observed</td>

<td>P-2033</td><td>ΗΟ'-χ / AND^No.\</td><td></td><td> 369.1</td>

<td>P-2034</td><td>^nAn-\</td><td>---------|tL—----------------- YY I</td><td> 451.1</td>

<td>P-2035</td><td>H0-A___ TO- AND</td><td>γ.</td><td> 447.1</td>

<td>P-2036</td><td>H0^\ and Γ</td><td>OR</td><td> 437.1</td>

<td></td><td>Alcohol</td><td>Compound</td><td>MS(ESI) [Μ+ΗΤ Observed</td>

<td>Ρ-2060</td><td>^Η0'Χ-χ</td><td></td><td> 365.9</td>

<td>Ρ-2061</td><td>IC</td><td>IC</td><td> 417.1</td>

<td>Ρ-2062</td><td>V</td><td>s^n</td><td> 399.9</td>

<td>Ρ-2063</td><td>°y</td><td>F&lt; °Χτ^Ν' 5Λν γ</td><td> 383.1</td>

<td></td><td>'μ-*ν</td><td>yu</td><td></td>

Example 52: Synthesis of [3-(4-Chloro-2-fluoro-benzyloxy)-2-(2-fluoro-ethoxy)-phenyl](1H-pyrrolo[2,3-b]pyridin-3-yl) -methanone P-2086 and 3-[3-(4-Chloro-2-fluoro-benzyloxy)-2(2-fluoro-ethoxy)-benzyl]-1H-pyrrolo[2,3-b]pyridine P-2085

Compounds P-2086 and P-2085 were synthesized in three steps from compounds 659 and 1H-pyrrolo[2,3-ojpyridine 94 as shown in Scheme 81.

<img file="ECSP088121A_D0135.tif" />

<img file="ECSP088121A_D0136.tif" />

662

P-2085

Step 1 - Preparation of 3-(4-Chloro-2-fluoro-benzylox¡)-2-(2-fluoro-ethox¡)benzaldehyde &lt;660/

To a solution of 3-(4-Chloro-2-fluoro-benzyloxy¡)-2-hydroxy-benzaldehyde (659, 140 mg, 0.5 mmol, prepared by the protocol of Example 43, Steps 1 and 2 of Scheme 71, using 4-chloro-2-fluoro-benzyl bromide instead of 4-chloro-benzyl bromide in Step 1) in tetrahydrofuran (8 mL) was added dropwise a mixture of 2-fluoro-ethanol (64 mg, 1.0 mmol ), triphenylphosphine (180 mg, 0.7 mmol), and diisopropyl azodicarboxylate (120 mg, 0.6 mol) in tetrahydrofuran (5 mL) at 0 °C. The reaction mixture was stirred at 0 Ό for 10 minutes and then at 40 °C for 3 days. The reaction mixture was dissolved in water and ethyl acetate. The organic layers were collected, washed with brine, and dried over magnesium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexanes to give the compound as a white solid (660.88 mg, 54%). MS(ESI) [M+H⁺]⁺⁼327.12.

Step 2 - Preparation of [3-(4-Chloro-2-fluoro-benzyloxy)-2-(2-fluoro-ethoxy)-phenyl]-(1Hpyrrolo[2,3-b]pyridin-3-yl) -methanol (661) and 3-{[3-(4-Chloro-2-fluoro-benzyloxy)-2-(2-fluoro-ethoxy)phenylj-methoxy-methyl}-1H-pyrrolo[2,3-b ]pyridine (662):

A solution of 3-(4-chloro-2-fluoro-benzyloxy)-2-(2-fluoro-ethoxy)-benzaldehyde (660, mg, 0.27 mmol), 1H-pyrrolo[2,3-b]pyridine ( 94, 38 mg, 0.32 mmol), and potassium hydroxide (45 mg, 0.81 mol) in methanol (5 mL) was stirred at room temperature for 24 hours. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexane to give compound 661 as a white solid (67 mg, 56%), MS(ESI) [M+ h⁺]⁺ = 445.13 and compound 662 as a white solid (36 mg, 29%), MS(ESI) [M+H⁺]⁺ = 459.15.

Step 3a - Preparation of [3-(4-Chloro-2-fluoro-benzyloxy¡)-2-(2-fluoro-ethoxy¡)-phenyl](1H-pyrroio[2,3-b]pyridin- 3-i¡)methanone (P-2086):

To a solution of [3-(4-chloro-2-fluoro-benzyloxy)-2-(2-fluoro-ethoxy¡)-phenyl]-(1 Hpyrrolo[2,3-b]pyr¡din-3 -yl)-methanol (661, 60 mg, 0.1 mmol) in tetrahydrofuran (10 mL) was added Dess-Martin periodinan (69 mg, 0.16 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 3 hours. The reaction was quenched with saturated sodium thiosulfate solution, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexanes to give the compound as a white solid (P-2086.15 mg, 20%). MS(ESI) [M+H⁺]⁺ = 441.06.

Step 3b - Preparation of 3-[3-(4-Chloro-2-fluoro-benzyloxy¡)-2-(2-fluoro-ethoxy¡)benzyl]-1H-pyrrolo[2,3-b]pyridine (P- 2085/·

A mixture of 3-{[3-(4-chloro-2-fluoro-benzyloxy)-2-(2-fluoro-ethoxy)-phenyl]-methoxymethyl}-1 H-pyrrolo[2,3- ¿>]pyridine (662, 36 mg, 0.078 mmol), triethylsilane (0.5 mL, 3 mmol), and trifluoroacetic acid (0.2 mL, 2 mmol) in acetonitrile (20 mL) was stirred at 80 °C for 2 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexanes to give the compound as a yellow solid (P-2085, 24 mg, 71%). MS(ESI) [M+H⁺]⁺ = 429.15.

3-(4-Chloro-benzyloxy)-2-(2,2-d¡fluoro-ethox¡)-phenyl]-(1H-pyrrolo[2,3-£>]pyridin-3-yl)methanone (P-2075)

<img file="ECSP088121A_D0137.tif" />

(P-2075) was prepared following the protocol of Scheme 81, substituting 2-fluoro-ethanol with 2,2-difluoro-ethanol and substituting 3-(4-Chloro-2-fluoro-benzyloxy¡)-2-hydroxy -benzaldehyde with 3-(4-chloro-benzyloxy)-2-hydroxy-benzaldehyde (628 from Example 43) in Step 1 to provide P-2075. MS(ESI) [Μ+Ηψ = 443.1.

Example 53; Synthesis of [3-(2-Chloro-4-methanesulfonyl-benzyloxy)-2-ethoxy-phenyl](1H-pyrrolo[2,3-b]pyridin-3-yl)-methanone P-2094

Compound P-2094 was synthesized in four steps from compounds 635 and 663 as shown in Scheme 82.

Scheme 82

<img file="ECSP088121A_D0138.tif" />

<img file="ECSP088121A_D0139.tif" />

Step 1 - Preparation of (3-Benzyloxy-2-ethoxy¡-phenyl)-(1-triisopropylsilanyl-1Hpyrrolo[2,3-b]pyridin-3-yl)-methanol (664);

To a solution of 3-iodo-1 -triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridine (635.1.306 g, 3.26 mmol) in tetrahydrofuran (42 mL) at -20 °C under nitrogen Isopropylmagnesium chloride (1.70 mL, 2.0 M solution in tetrahydrofuran, 3.40 mmol) was added. The reaction mixture was stirred at -20 °C for 1.5 hours. It was allowed to warm to 5 Ό and then kept at 5 °C for 1 hour. The reaction mixture was then cooled to -20 °C. To this solution was slowly added a solution of 2-ethoxy-3-benzyloxybenzaldehyde (663, 0.698 g, 2.72 mmol, prepared by the protocol of Example 43, Steps 1-3 of Scheme 71, using benzyl bromide in place of sodium bromide). 4-chloro-benzyl in Step 1) in tetrahydrofuran (42 mL). The reaction mixture was stirred at -20 °C for 2.5 hours, and was allowed to warm to 5 °C over 2.5 hours. The reaction mixture was poured into ice water, extracted with ethyl acetate, washed with saturated ammonium chloride, brine, and dried over magnesium sulfate. After removal of the solvent, the residue was purified by column chromatography on silica gel eluting with ethyl acetate in hexane to give the compound as a light yellow oil (664,200 mg, 13.9%).

Stage 2 - Preparation of (2-ethoxy-3-hydrox¡-phenyl)-(1-triisopropylsilanyl-1 H-pyrrolo[2,3b]pyridin-3-¡l)-methanone &lt;665/

To a solution of (3-benzyloxy-2-ethoxy-phenyl)-(1-triisopropylsilanyl-1H-pyrrolo[2,3b]pyridin-3-yl)-methanol (664.195 mg, 0.37 mmol) in methanol mixture (20 mL) and tetrahydrofuran (50 mL) was added palladium on carbon (50 mg, 10% by weight, 0.2 mmol). The mixture was stirred under hydrogenation for seventeen hours. After removal of the solvent, the residue was washed with a mixture of ethyl ether and hexanes to give the compound as a white solid (665.63 mg, 95%). MS(ESI) [M⁺h⁺]⁺ = 439.37.

Step 3 - Preparation of [3-(2-Chloro-4-methanesulfonyl-benzyloxy)-2-ethoxy-phenyl]-(1tr¡¡sopropylsilan¡l-1H-pyrrolo[2,3-b]pyridin-3-yl )-methanone (666):

To a solution of (2-ethoxy-3-hydroxy¡-phenyl)-(1 -triisopropylsilanyl-1H-pyrrolo[2,3£>]pyridin-3-yl)-methanone (665, 40 mg, 0.064 mmol) in tetrahydrofuran (15 mL) was added sodium hydride (3.32 mg, 0.083 mmol) at room temperature under a nitrogen atmosphere. The mixture was stirred at room temperature for 40 minutes, then 1-bromomethyl-2-chloro-4-methanesulfonyl-benzene (21.72 mg, 0.077 mmol) was added to the reaction mixture. It was stirred at room temperature overnight. The mixture was then poured into water and extracted with ethyl acetate. The organic layer was collected and washed with brine, dried over magnesium sulfate. After removal of the solvent, a crude compound was obtained as a light yellow oil (666.84 mg).

Step 4 - Preparation of [3-(2-Chloro-4-methanesulfonyl-benz¡loxy)-2-ethoxy-phenyl]-(1Hpyrrolo¡2,3-b]pyridin-3-yl)-methanone (P -2094):

To a solution of (2-ethoxy-3-hydroxy-phenyl)-(1-triisopropylsilanyl-1H-pyrrolo[2,3b]pyridin-3-l)-methanone (666.84 mg, 0.054 mmol) in methanol (10 mL) potassium hydroxide (6 N in solution) was added until the pH of the solution changed above 10. Potassium fluoride (30 mg, 0.5 mmol) was then added to the reaction mixture and the mixture was stirred at room temperature for 6 hours. The reaction mixture was then poured into saturated sodium carbonate and extracted with ethyl acetate. The organic layer was collected and washed with brine, dried over magnesium sulfate. After removal of the solvent, the residue was purified by preparative HPLC to provide as a white solid (P-2094, 5 mg, 19%). MS(ESI) [M+H⁺]⁺ = 485.17.

Example 54: Synthesis of propane-1-sulfonic acid [3-(5-bromo-1 H-pyrrolo[2,3-b]pyrid¡n-3-carbon¡l)-4fluoro-phenylj-amide P -1403

Compound P-1403 was synthesized in seven steps from 3-fluoro-5-nitrobenzoic acid 667 as shown in Scheme 83.

Scheme 83

<img file="ECSP088121A_D0140.tif" />

Step 1- Preparation of 3-fluoro-5-aminobenzoic acid (668):

In a Parr pressure reactor was added 3-fluoro-5-nitrobenzoic acid (667, 5.0 g, 0.027 mol), methanol (50.0 mL), 20% Pd(OH)₂ on carbon (300mg). The reaction was shaken under an atmosphere of hydrogen at 50 psi overnight. The reaction was filtered through celite and concentrated to dryness to provide a white solid (668, 4.0 g, 95.0%).

Step 2 - Preparation of 2-Fluoro-5-(propan-1-sulfonylamino)-benzoic acid (669):

To 3-fluoro-5-aminobenzoic acid (668.3.00 g, 0.0180 mol) in methylene chloride (204 mL) were added pyridine (41 mL, 0.50 mol) and propan-1-sulfonyl chloride (2.23 mL, 0.0198 mol) under a nitrogen atmosphere. The reaction was stirred at room temperature for 5 days. The reaction was poured into water, pH adjusted to 1 with 1N HCI, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give a white solid (669, 2.0 g, 42%). MS (ESI) [MH⁺] = 260.1.

Step 3-Preparation of 2-Fluoro-5-(propan-1-sulfonylamino)benzoic acid methyl ester (670):

To 2-Fluoro-5-(propan-1-sulfonylamino)-benzoic acid (669, 2.0 g, 0.0076 mol) in methanol (20.0 mL) was added sulfuric acid (0.90 mL, 0.017 mol). The reaction was stirred at room temperature overnight. The reaction was concentrated and purified by column chromatography on silica gel eluted with 20% ethyl acetate in hexane to give a white solid (670.1.27 g, 62%). MS (ES» [MH⁺]' = 274.1.

Step 4 - Preparation of (4-fluoro-3-hydroxymethyl-phenyl)-amide propane-1sulfonic acid (671:)

To 2-Fluoro-5-(propan-1-sulfonylamino )-benzoic acid methyl ester (670, 1.20 g, 0.00436 mol) in tetrahydrofuran (100.0 mL) was added lithium tetrahydroaluminate (1.00 M in tetrahydrofuran, 10.0 mL) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. To the reaction was added Na₂S0₄.10H₂0 (5 g), and then stirred at room temperature for 1 hour. The reaction was filtered, concentrated and purified by column chromatography on silica gel eluted with 50% ethyl acetate in hexane to give the compound (671.0.90 g, 83%). MS (ESI) [MH⁺] = 246.1.

Step 5 - Preparation of (4-fluoro-3-formyl-phenyl)-anide propane-1-sulfonic acid (672):

To (4-fluoro-3-hydroxymethyl-phenyl)-amide propane-1-sulfonic acid (671, 0.483 g, 0.00195 mol) in ice-cold tetrahydrofuran (10.0 mL), periodinan from Dess-Martin ( 1.00 g, 0.00236 mol). The reaction was stirred at room temperature for 10 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give a white solid (672, 360 mg, 75%). MS(ESI)[MH⁺]= 244.1.

Stage 6-Preparation of 3-[(5-bromo-1H-pyrrolo[2,3-b]pyridin-3-yl)-hydroxymethyl]-4-fluoro-phenyl-amide propane-1-sulfonic acid (673 ):

To 5-bromo-7-azaindole (67, 170.0 mg, 0.86 mmol) in methanol (7.0 mL) was added (4-fluoro-3-formyl-phenyl)-anide propane-1-sulfonic acid (672, 220.0 mg, 0.90 mmol) and potassium hydroxide (0.50 g, 0.0089 mol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water, acidified with 1N HCl to pH=5, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% methanol in methylene chloride to give the compound (673, 55.0 mg, 14.0%). MS (ESI) [M+H⁺]⁺ = 442.1,444.1.

Step 7 - Preparation of [3-(5-bromo-1H-pyrrolo[2,3-b]p¡r¡d¡n-3-carbon¡l)-4fluoro-phenylj-amide propane-1-sulfonic acid ( P-1403):

A 3-[(5-brom o-1 Hp¡rrolo[2,3-b]p¡r¡d¡n-3-yl)-h¡drox¡-methyl]-4-fluoro-phen acid Propane-1-sulfonic acid (673, 55.0 mg, 0.12 mmol) in tetrahydrofuran (8.0 mL) was added Dess-Martin periodinan (70.0 mg, 0.17 mmol). The reaction was stirred at room temperature for 5 minutes. The reaction was concentrated with silica gel and purified with silica gel column chromatography eluting with 25% ethyl acetate in hexane to give an off-white solid (P-1403, 26.2 mg, 47%). MS (ESI) [M+H⁺]⁺ = 437.9, 439.9.

Example 55: Synthesis of 2-[2,4-Difluoro-3-(S-pyridin-3-yl-1H-pyrrolo[2,3b]pyridin-3-ylmethyl)-phenoxy]-ethanol P-1395 and related compounds

Compound P-1395 was synthesized in four steps from 4-Chloro-2-fluorophenol 521 as shown in Scheme 42.

Scheme 42

<img file="ECSP088121A_D0141.tif" />

P-1393

Step 1 - Preparation of 4-Chloro-2-fluoro-1-(2,2,2-trifluoro-ethoxy)-benzene (522):

To 4-Chloro-2-fluoro-phenol (521, 5.0 g, 0.034 mol) in methanol (50.0 mL) was added potassium fluoride (2.2 g, 0.038 mol). The solvent was removed. The resulting salt was added to N,Ndimethylformnaldehyde (25 mL), followed by the addition of 1,1,1-trifluoro-2-iodo-ethane (8.60 g, 40.9 mmol). The reaction was stirred at 50 °C overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give a colorless oil (522, 2.0 g, 26%).

Step 2 - Preparation of 6-Chloro-2fluoro-3-(2,2,2-truoro-ethoxy)-benzaldehyde (523):

4-Chloro-2-fluoro-1-(2,2,2-trifluoro-ethoxy)-benzene (522, 0.80 g, 3.5 mmol) in THF (20 mL) was cooled in a dry ice/acetone bath. and under a nitrogen atmosphere, n-butyllithium (1.60 M in Hexane, 2.30 mL) was slowly added. After one hour, N,Ndimethylformamide (0.298 mL, 3.85 mmol) was added to the reaction. After 30 minutes, the reaction was allowed to come to room temperature and stirred for 10 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the compound (523, 450 mg, 50%).

Step 3 - Preparation of (5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-yl)-[6-chloro-2fluoro-3(2,2,2-trifluoro-ethoxy)phenylj-methanol (524):

To 5-bromo-7-azaindole (67, 291 mg, 1.48 mmol) in methanol (22 mL) were added

6-Chloro-2-fluoro-3-(2,2,2-trifluoro-ethoxy)-benzaldehyde (523, 400.0 mg, 1.6 mmol) and potassium hydroxide (1.49 g, 26.6 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature for 48 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 25% ethyl acetate in hexane to give the compound (524, 300 mg, 42%). MS (ESI) [Μ+Ηψ = 453.1,455.1.

Step 4 - Preparation of (5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-¡l)-[6-chloro-2fluoro-3(2,2,2-trifluoro-ethoxy) phenyl]-methanol (P-1393):

A (5-Bromo-1 H-pyrrolo[2,3-b]p¡r¡din-3-¡l)-[6-chloro-2-fluoro-3-(2,2,2-tfluoro-ethox ¡)phenylj-methanol (524,140.0 mg, 0.31 mmol) in trahydrofuran (6.0 mL) was added Dess-Martin periodinan (157 mg, 0.37 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the compound (P-1393.100 mg, 72%). MS (ES» [M-H+j- = 448.9, 450.9.

Step 5 - Preparation of [6-Chloro-2-fluoro-3-(2,2,2-trifluoro-ethox¡)-phenyl]-(5-pyridin-3¡I-1 H-pyrrolo[2, 3-b]pyridin-3-yl)-methanone (P-1395):

A (5 Bromo-1 H-pyrrolo[2,3-b]pyridin-3-yl)-[6-chloro-2-fluoro-3-(2,2,2-trifluoro-ethoxy)phenylj-methanol (P-1393, 53.0 mg, 0.12 mmol) in acetonitrile (4.0 mL) was added Tetrakis(triphenylphosphine)palladium(0) (5.0 mg, 0.0043 mmol), 3-pyridylboronic acid (15.1 mg, 0.12 mmol) and 1 M potassium carbonate solution (1.5 mL). The reaction was heated in a microwave oven (300 watts) at 160°C for 7 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 60% ethyl acetate in hexane to give the compound (P1395, 3.8 mg, 53%) as a light yellow solid. MS (ESI) [M+H⁺]⁺= 450.2.

[2,6-Difluoro-3-(2-methoxy-ethoxy)-phenyl]-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3-yl)methanone P -1456

<img file="ECSP088121A_D0142.tif" />

was prepared following the protocol of Scheme 42, by substituting 4-Chloro-2-fluorophenol 521 with 2,4-difluoro-phenol and 1,1,1 -Trifluoro-2-iodo-ethane with 1-Bromo-2-methoxy¡ ethane in Step 1. MS (ESI) [M+H⁺]⁺ = 410.2.

N-(3-{3-[2,6-D¡fluoro-3-(2-methoxy-ethoxy)-benzo¡l]-1 H-irrolo[2,3-b]pyridin-5 -¡l}-phenyl)-

<td>methanesulfonamide P-1472</td><td></td>

<td>andx)</td><td>F. w i^{F o}'^ν°' AND</td>

was prepared following the protocol of Scheme 42, by substituting 4-Chloro-2-fluorophenol 521 with 2,4-difluoro-phenol and 1,1,1-Trifluoro-2-iodo-ethane with 1-Bromo-2-methoxy¡ ethane in Step 1, and replacing pyridine-3-botanical acid with [(3methylsulfon¡l)am¡nophenyl]-boronic acid in step 4. MS (ESI) [M + H⁺]⁺= 502.2.

Example 56: Synthesis of 2-[2_Yo4-Difluoro-3-(5-pyridin-3-yl-1H-pyrrolo[2,3 b]pyridin-3-ylmethyl)-phenoxy]-ethanol P-1394

Compound P-1394 was synthesized in four steps from 2,6-Difluoro-3-hydroxy-benzaldehyde 540 as shown in Scheme 48.

Scheme 48

<img file="ECSP088121A_D0143.tif" />

Step 1 - Preparation of 2,6-Difluoro-3-[2-(tetrahydro-pyran-2-yloxy)-ethoxyjbenzaldehyde (541):

To 2,6-difluoro-3-hydroxy-benzaldehyde (540, 0.150 g, 0.95 mmol) in N,N-dimethylformamide (8.0 mL) was added 2-(2-bromo-ethoxy)-tetrahydro-pyran (0.218 g, 1.04 mmol) and potassium carbonate (0.52 g, 3.8 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature for 72 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the compound as a colorless oil (541.180 mg, 66%).

Step 2-Preparation of (5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-yl)-2,6-difluoro-3-[2(tetrahydro-pyran-2-yloxy)- ethoxy]-phenyl-methanol (542):

To 5-bromo-7-azaindole (67, 118 mg, 0.000597 mol) in methanol (9.0 mL) was added 2,6-difluoro-3-[2-(tetrahydro-pyran-2-yloxy)-ethoxy]- benzaldehyde (541, 180.0 mg, 0.63 mmol) and potassium hydroxide (601.9 mg, 10.7 mmol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give crude compound which was used directly in the next step.

Step 3 - Preparation of 2-[3-(5-Bromo-1H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,4-difluoro-phenoxy]-ethanol (P-1392):

A (5-Bromo-1 H-pyrrolo[2,3-b]pyridin-3-yl)-2,6-difluoro-3-[2-(tetrahydro-pyran-2-yloxy)ethoxyj-phenyl-methanol ( 542, 0.22 g, 0.46 mmol) in acetonitrile (6.0 mL) trifluoroacetic acid (0.14 mL, 1.8mmol) and triethylsilane (0.29 mL, 1.8 mmol) were added. The reaction was stirred at room temperature overnight. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 35% ethyl acetate in hexane to give the compound as a white solid (P-1392, 62 mg, 35%). MS (M+H⁺)⁺= 383.1,385.1.

Step 4 - Preparation of 2-[2,4 Difluoro-3-(5-pyridin-3-yl-1H-pyrrolo[2,3-b]pyridin-3ylmethyl)-phenoxy]-ethanol (P- 1394):

A 2-[3-(5-Bromo-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-2,4-dif fluoro-phenoxyj-ethanol (P1392, 35.0 mg, 0.091 mmol) in acetonitrile (4.0 mL) were added 3-pyridylboronic acid (14.6 mg, 0.12 mmol), tetrakis(tr¡fen¡lfosf¡na)pallad¡o(0) (3.0 mg, 0.0026 mmol), and 1M carbonate solution of potassium (1.5 mL). The reaction was heated in a microwave oven (300 watts) at 160°C for 7 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was collected and dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting 4% methanol in methylene chloride to give the compound as a white solid (P-1394, 11.0 mg, 32%). MS (ESI) [M+H⁺]⁺ = 382.2.

Example 57: Synthesis of 5-fluoro-2-methoxy-4-(1-triisopropylsilanyl-1Hpyrrolo[2,3-b]pyridin-3-ylmethyl)-phenol 649.

5-Fluoro-2-methoxy¡-4-(1 -triisopropylsilan¡I-1 H-pyrrolo[2,3-b]pyridin-3-ylmethyl)-phenol 649 was synthesized in five steps from 2-fluoro- 4-hydroxy-5-methoxy benzaldehyde 653 and benzyl bromide as shown in Scheme 80.

Scheme 80

<img file="ECSP088121A_D0144.tif" />

<img file="ECSP088121A_D0145.tif" />

Step 1 - Preparation of 4-Benzyloxy-2-fluoro-5-methoxy-benzaldehyde (654):

2-Fluoro-4-hydroxy-5-methoxy-benzaldehyde (653, 1.62 g, 9.52 mmol) was dissolved in

Ν,Ν-dimethylformamide (50 mL) and sodium hydride (60% dispersion in mineral oil, 530 mg, 13 mmol) were added. After 20 minutes, benzyl bromide (1.5 mL, 12 mmol) was added to the reaction mixture. The reaction was stirred at room temperature under a nitrogen atmosphere for 5.5 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 0-50% ethyl acetate in hexane to provide the compound as a white solid, consistent with the desired structure for¹H-NMR (654, ​​2.0 g, 81%).

Step 2 - Preparation of (4-Benzyloxy-2-fluoro-5-methoxy-phenyl)-(1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-methanol (655):

3-Iodo-1-triisopropylsilanyl-1 H-pyrrolo[2,3-b]pyridine (635, 620 mg, 1.5 mmol, prepared as described in Example 45) was dissolved in tetrahydrofuran (15 mL) at 20°C under a nitrogen atmosphere. Isopropylmagnesium chloride (2.0 M in tetrahydrofuran, 840 pL) was added to the reaction. The reaction was stirred for 1.5 hours, during which the temperature rose to 5 °C. The reaction was cooled to -20C. 4-Benzyloxy2-fluoro-5-methoxy-benzaldehyde (654, ​​250 mg, 0.9606 mmol) in tetrahydrofuran (5.0 mL) was added to the reaction. The reaction was stirred for 2.5 hours during which time the temperature rose to 5 °C. The reaction was poured into water. The mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 2-25% ethyl acetate in hexane to provide the compound as a white solid (655, 501 mg, 63%). MS (ES1) [M+H⁺]⁺= 535.4.

Step 3 - Preparation of 3-(4-Benzyloxy-2-fluoro-5-methoxy-benzyl)-1H-pyrrolo[2,3bjpyridine (656):

(4-Benzyloxy-2-fluoro-5-methoxy¡-phenyl)-(1-Triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridin-3yl)-methanol (655, 1.49 g, 2.79 mmol) was dissolved in acetonitrile (50 mL) and trifluoroacetic acid (1.1 mL) was added. The reaction was stirred for 5 minutes. Triethylsilane (2.2 mL) was added to the reaction. The reaction was heated at 80°C for 6 hours. The reaction was concentrated and the crude material was dissolved in ethyl acetate and washed with 1N HCI, saturated sodium bicarbonate, and brine. The organic portion was dried over anhydrous sodium sulfate and concentrated. The obtained solid was used in the next reaction without further purification (656, 833 mg, 83%). MS (ESI) [M+H⁺]'^he'= 363.4.

Step 4 - Preparation of 3-(4-Benzyloxy-2-fluoro-5-methoxy-benzyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (657);

3-(4-Benzyloxy-2-fluoro-5-methoxy-benzyl)-1H-pyrrolo[2,3-b]pyridine (656, 0.877 g, 2.42 mmol) was dissolved in Ν,Ν-dimethylformamide (30 mL ). Sodium hydride (60% dispersion in mineral oil, 140 mg, 3.6 mmol) was added at room temperature. After 20 min, triisopropylsilyl chloride (513 pL, 2.42 mmol) was added dropwise. The reaction was stirred for four hours. The reaction was poured into water and extracted with ethyl acetate. The organic portion was washed with saturated sodium bicarbonate and brine. The organic portion was dried over anhydrous sodium sulfate and filtered. The filtrate was adsorbed on silica gel and purified by chromatography on silica gel using 20-80% ethyl acetate/hexane. The resulting material was purified one time with a 5-30% ethyl acetate/hexane gradient to provide the desired compound (657.831 mg, 66%). MS (ESI) [M+H⁺]⁺ = 519.4.

Step 5 - Preparation of 5-Fluoro-2-methoxy-4-(1-Triisopropylsilanyl-1H-pyrrolo[2,3bJpyridin-3-ylmethyl)-phenol (649);

3-(4-Benzyloxy-2-fluoro-5-methoxy-benzyl)-1-triisopropylsilanyl-1H-pyrrolo[2,3-b]pyridine (657, 0.831 g, 1.60 mmol) was dissolved in methanol (40 mL ) and tetrahydrofuran (40 mL). 10% Palladium on carbon (3.41 g) was added. The reaction was shaken at 50 psi for 1 hour. The reaction was filtered through Celite and washed with methanol. The organic portion was passed through celite several times until a clear solution was obtained. The organic portion 5 was concentrated under reduced pressure to provide the desired compound as an off-white solid (649.587 mg, 86%). MS (ES1) [M+H⁺]⁺ = 429.5.

Example 58: Additional compounds

Additional compounds of the invention were synthesized following the methods of the above examples, or similar methods known to those of skill in the art, and are shown in Table 1 below.

<img file="ECSP088121A_D0146.tif" />

<img file="ECSP088121A_D0147.tif" />

ρχθ1433

<img file="ECSP088121A_D0148.tif" />

<img file="ECSP088121A_D0149.tif" />

<img file="ECSP088121A_D0150.tif" />

<img file="ECSP088121A_D0151.tif" />

<img file="ECSP088121A_D0152.tif" />

<img file="ECSP088121A_D0153.tif" />

<img file="ECSP088121A_D0154.tif" />

<img file="ECSP088121A_D0155.tif" />

<img file="ECSP088121A_D0156.tif" />

<img file="ECSP088121A_D0157.tif" />

<img file="ECSP088121A_D0158.tif" />

<img file="ECSP088121A_D0159.tif" />

<img file="ECSP088121A_D0160.tif" />

<img file="ECSP088121A_D0161.tif" />

<img file="ECSP088121A_D0162.tif" />

<img file="ECSP088121A_D0163.tif" />

<img file="ECSP088121A_D0164.tif" />

Example 59: Analysis of Kinase Activity

Alpha Screen analysis was used to select for kinases. The assay is dependent on the phosphorylation of a peptide substrate. In this assay, an antibody that recognizes the phosphorylated substrate binds to an acceptor bead. The peptide substrate binds biotin, which binds to the streptavidin-containing donor bead. Thus, the phosphorylated substrate is bound by antibody and streptavidin, arranging the donor and acceptor beads in close proximity when the kinase is not inhibited. The donor produces singlet oxygen which results in emission from the acceptor when they are in close proximity. Conversely, when kinase is inhibited, the donor and acceptor beads do not associate and emission from the acceptor is reduced. Fluorescence signal against compound concentration was used to determine IC values.₅₀.

Genetic engineering

For B-Raf V600E and Kit, kinase preparation was required. Plasmids encoding a selection of kinase enzymes were designed using common polymerase chain reaction (POR) methods. Relevant DNA sequences and encoded protein sequences used in the analysis are shown together (see below). Complementary DNA from various human tissues was purchased from Invitrogen, and these were used as substrates in PCR reactions. Specific customary synthetic oligonucleotide primers (Invitrogen see below) were designed to initiate the PCR product, and also to provide the appropriate restriction enzyme cleavage sites for ligation with the plasmids. Additional pairs of oligonucleotides (see below) were used to introduce mutations into the coding sequence to alter the sequence for enzyme activation in BRAF. In the case of KIT, the complete sequence coding for the enzyme was made through a genetic synthesis procedure, using usual synthetic oligonucleotides covering the complete coding sequence (Invitrogen).

Plasmids used for ligation with the kinase-encoding inserts were derived from either pET (Novagen) for expression using E. coli or pFastBac (Invitrogen) for expression using baculovirus infection of insect cell cultures. In each of these cases, the kinase was designed to include a histidine tag for purification using metal affinity chromatography.

Plasmids encoding kinase as bicistronic mRNA were designed to co-express a second protein that modifies the kinase protein during its expression in the host cell. For Kit, protein tyrosine phosphatase 1B (PTP) was co-expressed for dephosphorylation of phosphotyrosines. For BRAF, the CDC37 chaperones were co-expressed for more efficient protein folding of BRAF.

The plasmid encoding the phosphorylation substrate protein MEK1, a substrate for BRAF, was expressed as a GST N-terminal fusion and a C-terminal biotinylation fusion using pGEX vectors (Amersham) modified to include sequences encoding a C-terminal biotinylation tag. .

Protein Expression in E. col! and Purification

For protein expression, the KIT-containing plasmid was transformed into E. coli strain BL21 (DE3) Codonplus RILP (Invitrogen) and transformants selected for growth on LB agar plates containing appropriate antibiotics. Single colonies were grown overnight at 37°C in 200 mL TB medium (Terrific Broth), 16x1 L fresh TB medium in 2.8 I flasks were inoculated with 10 mL culture overnight and grown with constant agitation. at 37°C. Once the cultures reached an absorbance of 1.0 at 600 nm, IPTG was added and the cultures were allowed to grow for an additional 12-18 hours at temperatures ranging from 12-30Ό. Cells were harvested by centrifugation and the pellets were frozen at -80 Ό until ready for lysis.

For Protein Purification; Frozen E. coli cell pellets were resuspended in lysis buffer and used using standard mechanical methods. Soluble proteins were purified through poly-Histidine tags using IMAC immobilized metal affinity purification. The kinases have been purified using a 3-step purification process using; IMAC, size exclusion chromatography and ion exchange chromatography. The poly-Histidine tag was removed as necessary using Thrombin (Calbiochem). For B-Raf, the purification protocol required 5 mM MgCI₂ throughout the purification in order to stabilize the soluble protein during purification and concentration.

Baculovirus Expression Vector System, Virus Production:

Transfection of a monolayer of Spodoptera frugiperda (Sf9) cells was performed using a bacmid containing BRAF transfection reagent and cellfectin (Invitrogen) in serum-free, antibiotic-free Grace's complete medium (Invitrogen). After a five hour incubation, the transfection medium was removed, and the monolayer was fed with Grace's medium containing 10% FBS and antibiotics. After an incubation of 72 to 96 hours, the virus-containing cell supernatant was harvested. The concentration of the virus broth was then determined using a baculovirus (BD) concentration kit. Virus stock was then expanded using low Multiplicity of Infection (MOI 0.1) cultures and harvested 48 hours post infection. The concentration of the expanded virus broth was determined for use in recombinant protein production.

Protein Production;

The protein expression level was optimized by varying the MOI (1-10) and the harvest period (48-72 hours). Sf9 cells were adapted to SF-900 II serum-free medium and cultured in suspension in spinner bottles. The cell suspension was then used to inoculate a Wave bioreactor for a 25 liter production scale. Cells were harvested 48-72 hours post infection and stored at -80 Ό until ready for lysis. Proteins were purified similar to those expressed in E. coli.

Kinase Assay

AlphaScreen analyzes were done using compounds dissolved in DMSO at a concentration of 20 mM. Compounds were subsequently diluted to the desired final concentration in each sample well, using a 1:3 serial dilution for a total of 8 concentration points. Plates were prepared so that each kinase reaction is 20 µΙ in a buffer of 1x kinase, 5% DMSO and 10 µΜ ATP. Kit and Fms were tested alternately with 100 μΜ ATP. After incubation of the kinase reaction for 1 hour at room temperature, 5 μΙ of the donor beads in stop buffer were added, the sample was mixed and incubated for 20 minutes at room temperature before adding 5 μΙ of the beads. acceptors in stop buffer. Samples were incubated for 60 minutes at room temperature and the signal per well was read on an AlphaQuest reader. The phosphorylation substrate results in antibody binding and association of donor and acceptor beads such that the signal correlates with kinase activity. The signal against the concentration of the compound was used to determine the IC₅₀. Conditions used for 20 μΙ reaction for each kinase are described as follows.

For Raí kinases, B-Raf and c-Raf were purchased from Upstate Biotechnology and B-Raf V600E was prepared using plasmid P4254 expressed in Sf9 cells as described above. Overall, final analysis conditions were 0.1 ng kinase, 100 nM biotin-MEK1 substrate (prepared as described above) in 1x kinase buffer (50 mM HEPES, pH 7.0, 50 mM NaCI, 2 mM of MgCI₂, 1 mM MnCI₂, 1 mM DTT, 0.01% Tween-20), followed by streptavidin-coated donor bead (10 pg/ml, Perkin Elmer Life Science) and coated Protein A, bound to MEK antibody acceptor bead¹/2 anti phosphorus (10 pg/ml CellSignal) in stop buffer (50 mM EDTA in 1x kinase buffer).

Fms was acquired from Upstate Biotechnology. Final analysis conditions were 0.5 ng kinase, 30 nM biotin-(E4Y)₁₀ (Upstate Biotechnology) in 1x kinase buffer (8 mM MOPS pH 7.4, 2 mM MgCI₂, 8 mM MnCI₂, 2 mM DTT, 0.01% Tween-20), followed by a streptavidin-coated donor bead (20 pg/ml,

Perkin Elmer Life Science) and PY20 antibody-coated acceptor bead (20 pg/ml, Perkin Elmer Life Science) in stop buffer (8 mM MOPS, pH 7.4, 100 mM EDTA, 0.3% BSA). For analysis at 100 μΜ ATP, the 1x buffer was 8 mM MOPS pH 7.0, 2 mM MgCI₂, 8 mM MnCI₂, 2 mM DTT, 50 mM NaCI, 0.01% BSA and 0.01% Tween-20 and the stopping buffer was 8 mM MPOS, pH 7.0, 100 mM EDTA, 0.01% BSA.

Kit was purchased or prepared from Cell Signaling Technology using the P1332 plasmid expressed in E. coli as described above. Final analysis conditions were 0.1 ng kinase, 100 nM biotin-(E4Y)₃ (Open Source Biotech, Inc.) in 1x kinase buffer (50 mM HEPES pH 7.2, 5 mM MgCI₂, 5 mM MnCI₂, 0.2% BSA, 0.01% NP-40), followed by streptavidin-coated donor bead (1 pg/ml, Perkin Elmer Life Science) and PY20 antibody-coated acceptor bead (1 pg/ml Perkin Elmer Life Science) in stop buffer (50 mM EDTA in 1x kinase buffer). for analysis at 100 μΜ ATP, 1 ng kinase was used and 1x buffer was 8 mM MOPS pH 7.0, 1 mM MgCI₂, 2 mM MnCI₂0.1 mM DTT, 0.001% BSA and 0.01% Tween-20, with 30 nM biotin-(E4Y) substrate₁₀ (Upstate Biotechnology). Beads were in 10 pg/ml stopping buffer of 8 mM MOPS, pH 7.0, 100 mM EDTa, 0.3% BSA.

Selected compounds that have IC₅₀, less than 10 μΜ are shown in tables 2a (B-Raf), 2b (B-Raf V600E), 2c (c-Raf-1), 2d (Fms), 2e (Jnk1), 2F (Jnk2), 2g (Jnk3) and 2h (Kit) as follows.

Table 2a. Compounds with activity towards B-Raf kinase with IC₅₀&lt;10 μΜ.

<td>B-Raf</td><td>P-0007, P-0088, P-0166, P-0178, P-0188, P-0310, P-0356, P-0636, P-0685, P-0728, P-0753, P-0773, P- 0774, P-0776, P-0798, P-0805, P-0806, P-0818, P-0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P-0867, P-0874, P-0876, P-0877, P-0885, P-0889, P-0896, P-0897, P-0898, P-0902, P-0904, P-0907, P- 0910, P-0911, P-0912, P-0913, P-0928, P-0931, P-0933, P-0937, P-0944, P-0946, P-0947, P-0952, P-0954, P-0955, P-0956, P-0958, P-0959, P-0983, P-0984, P-0991, P-0997, P-1003, P-1004, P-1006, P-1009, P-1013, P-1020, P-1028, P-1056, Pl 116, P-1243, P-1244, P-1246, P-1247, Pl 249, P-1250, P-1251, P-1252, P-1253, P-1254, P-1255, P-1256, P-1257, P-1258, Pl 259, P-1260, P-1261, P-1262, P-1263, P-1264, P-1265 , P-1266, P-1267, P-1268, Pl 269, Pl 270, P-1288, P-1289, P-1317, P-1318, P-1397, P-1431, P-1432, P-1433 , P-1445, P-1446, P-1447, P-1455, P-1467, P-1486, P-1532, Pl 534, P-1539, P-1541, Pl 542, P-1544, P-1546 , P-1547, Pl 548, P-1549, P-1552, Pl 553, P-l554, P-1559, P-1566, Pl 567, P-1568, P-1569, Pl 570, Pl 576, P-1580, P-1581, P-1582, P-1583, Pl 586, P-1589, P-1590, P-1591, Pl 596, Pl 597 , Pl 598, Pl 599, P-1600, P-1602, P-1608, P-1609, Pl 610, P-1612, Pl 613, Pl 616, P-1621, P-1627, P-1630, P- 1631, P-1636, P-1637, P-1638, P-1639, P-1656, P-1660, P-1663, P-1664, P-1665, P-1670, P-1671, P-1687, P-1700, P-1701, P-1702, Pl 703, P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P-1710, P-1711, P-1712 , P-1713, P-1714, P-1715, P-1716, P-1717, P-1718, P-1719, Pl 720, P-1721, Pl 722, Pl 723, Pl 724, P-1725, P-1726, P-1727, Pl 728, P-1729, P-1730, Pl 731, Pl 732, P-1733, P-1734, P-1735, Pl 736, Pl 737, P-1738, P-1739, Pl 740, P-1741, P-1742, Pl 746, P-1747, P-1748, P-1749, Pl 750, P-1751 , P-l752, P-1753, P-1755, P-l756, Pl 757, P-1758, P-1759, P-1760, P-1762, P-1763, P-1764, P-1765, P- 1766, Pl 767, P-1768, P-l769, P-1770, P-1771, P-1772, P-1773, P-1774, P-1775, P-1776, P-1777, P-1778, P -1779, P-1780, P-1781, P-1782, P-1783, P-1784, P-1798, P-1799, P-1800, P-1802, P-I804, Pl 816, Pl 817, P-1818, P-1819, Pl 822, P-1823, Pl 825, P-1827, P-1828, P-1839, P- 1840, P-1841, Pl 842, P-1864, Pl 865, P-1871, Pl 872, Pl 873, Pl 878, Pl 879, Pl 881, Pl 882, P-1907, P-1912, P-1916, P-1980, P-1996, P-1997, Pl 998, P-2005, P-2006, P-2007, P-2012, P-2013</td>

<td colspan="2">Table 2b. Compounds with activity towards kinase B-Raf V600E V600E with HF₅₀&lt; 10 μΜ.</td>

<td>B-Raf V600E</td><td>P-0007, P-0088, P-0166, P-0178, P-0188, P-0356, P-0493, P-0636, P-0685, P-0728, P-0753, P-0773, P- 0774, P-0776, P-0798, P-0803, P-0805, P-0806, P-0818, P-0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P-0867, P-0874, P-0876, P-0877, P-0885, P-0889, P-0896, P-0897, P-0898, P-0902, P-0904, P- 0907, P-0910, P-0911, P-0912, P-0913, P-0928, P-0931, P-0933, P-0937, P-0944, P-0946, P-0947, P-0950, P-0952, P-0954, P-0955, P-0956, P-0957, P-0958, P-0959, P-0964, P-0971, P-0983, P-0984, P-0991, P-0997, P-1003, P-1004, P-1006, P-1009, P-1013, P-1015, P-1020, P-1028, P-1056, P-1071, P-1090, Pl 116 , P-1131, P-1243, P-1244, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1254, P-1255, P -1256, P-1257, P-1258, P-1259, P-1260, P-1261, P-1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1269 , P-1270, P-1288, P-1289, P-1316, P-1317, P-1318, P-1345, Pl 396, P-1397, P-1398, P-1403, P-1431, P- 1432, P-1433, Pl 444, P-1445, P-1446, P-1447, Pl 449, P-1450, P-1455, P-1462, P-1466, P-1467, Pl 470, P-1471, P-1486, P-1495, Pl 531, P-1532, P-1534, P-1539, P-1540, P-1541, P-1542, P-1544, P-1545, P-1546, P-1547, P-1548, P-1549, P-1552, P-1553, Pl 554, P-1559, P-1566, Pl 567, P-1568, P-1569, P-1570, P-1572.P-1575, P-1576, P-1581, P-1582, P-1583, P-1586, P-1589, P-1590, P-1591, P-1S94, Pl 596, P-1597 , P-I598, P-1599, P-1600, Pl 601, P-1602, Pl 606, Pl 607, P-1608, P-1609, P-1610, P-1611, P-1612, P-1613, P-1621, P-1627, P-1630, P-1631, P-1636, P-1637, P-1638, P-1639, P-1656, P-1660, P-1663, P-1664, P-1665, P-1666, P-1670, P-1671, P-1687, Pl 698, P-1700, P-1701, P-1702, P-1703 , P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P-1710, P-1711, P-1712, P-1713, P-1714, P-1715, P -1716, Pl 717, P-1718, P-1719, P-1720, P-1721, Pl 722, P-1723, P-1724, P-1725,</td>

<td></td><td>P-1726, P-1727, P-1728, P-1729, P-1730, P-1731, P-1732, P-1733, P-1734, P-1735, P-1736, P-1737, P- 1738, P-1739, P-1740, P-1741, P-1742, P-1746, P-1747, P-1748, P-1749, P-1750, P-1751, P-1752, P-1753, P-1755, P-1756, P-1757, P-1758, P-1759, P-1760, P-1762, P-1763, P-1764, P-1765, P-1766, P-1767, P- 1768, P-1769, P-1770, P-1771, P-1772, P-1773, P-1774, P-1775, P-1776, Pl 777, P-1778, P-1779, P-1780, P -1781, P-1782, P-1783, P-1784, P-1797, P-1798, P-1799, P-1800, P-1802, P-1804, P-1816, P-1817, P-1818, P-1819, P-1822, P-1823, P-1828, P-1839, P-1840, P-1841, P-1842, P-1843, P-1864, Pl 865, P-1871 , P-1872, Pl 873, P-1878, P-1879, P-1881, Pl 882, P-1907, P-1912, Pl 916, P-1980, P-1996, Pl 997, Pl 998, P- 2005, P-2006, P-2007, P-2012, P-2013</td>

<td colspan="2">Table 2c. Compounds with activity towards c-Raf-1 kinase with ΙΟ_ια&lt;10μΜ</td>

<td>c-Raf-1:</td><td>P-0007, P-0088, P-0166, P-0178, P-0188, P-0356, P-0636, P-0685, P-0728, P-0753, P-0773, P-0774, P- 0776, P-0798, P-0805, P-0806, P-0818, P-0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P-0867, P-0874, P-0876, P-0877, P-0885, P-0889, P-0896, P-0897, P-0898, P-0902, P-0904, P-0907, P-0910, P- 0911, P-0912, P-0913, P-0928, P-0931, P-0933, P-0937, P-0944, P-0947, P-0950, P-0952, P-0954, P-0955, P-0956, P-0957, P-0958, P-0959, P-0964, P-0971, P-0983, P-0991, P-0997, P-1003, P-1004, P-1006, P-1009, P-1013, P-1015, P-1020, Pl 028, Pl 056, P-1071, P-1243, P-1244, P-1246, P-1247, P-l249, P-1250, Pl 251, Pl 253, P-1254, P-1255, P-1256, P-1257, P-1258, P-1260, P-1261, P-1262, P-1265, P-1288, P-1289, P-1316, P-1317, Pl 318, P-1396, P-l397, P-1398, P-1403, P-1431, Pl 432, P-1433, P-1455, P-1541, Pl 542, Pl 546, P-1547, P-1581, P-1583, P-1630, P-1671, P-1712, P-1713, P-1714, P-1733, P-1737, P-1738, P-1739, P-1740, P-1783, P-1839, P-1864, P-1871, Pl 873, P-1878,P-1879,P-1881,P-1882</td>

<td colspan="2">Table 2d. Compounds with activity towards Fms conlC kinase_m£10 μΜ</td>

<td>fms:</td><td>P-0007, P-0088, P-0166, P-0636, P-0685, P-0753, P-0773, P-0774, P-0798, P-0805, P-0806, P-0818, P- 0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0867, P-0874, P-0876, P-0885, P-0898, P-0911, P-0913, P-0931, P-0933, P-0952, P-0954, P-0955, P-0956, P-0958, P-1009, P-1013, P-1246, P-1247, P-1249, P- 1250, P-1251, P-1252, P-1253, P-1255, P-1259, P-1260, P-1262, P-1263, P-1264, P-1265, Pl 266, P-1267, P -1269, P-1289, P-1316, P-1317, P-1318, P-1340, P-1397, Pl 400, P-1403, P-1431, P-1432, P-1433, P-1445, P-1447, P-1449, P-1450, P-1455, P-1462, P-1466, P-1467, Pl 470, P-1471, P-1486, P-1495, P-1496 , P-1532, P-1534, P-1541, P-1542, P-1544, P-1545, Pl 546, P-1547, P-1548, Pl 549, P-1552, P-1553, P-l554 , Pl 559, P-1566, Pl 567, P-156S, P-1569, P-1570, P-1571, P-1572, P-1575, P-1576, P-1580, P-1581, P-1583 , Pl 586, Pl 587, P-1589, Pl 591, P-1594, P-1595, Pl 596, P-1597, P-1598, P-1599, Pl 602, P-l606, P-1608, Pl 609 , P-1610, P-1611, P-1612, Pl 613, P-1615, P-1616, Pl 618, P-1621, P-1625, P-1627, P-1630, P-1631, P-1636, Pl 637, P-1638, P-1639, P-1652, P-1653, P-1654, P-1656, Pl 657, P-1660, Pl 663, Pl 664, P-1665, P-1670, P-1671, P-1687, P-1700, P-1701, P-l702, P-1703, Pl 704, Pl 705, P- 1706, P-1707, P-1708, P-1709, P-1710, P-1711, P-1712, P-1713, P-1714, P-1715, P-1716, P-1717, P-1718, P-1719, Pl 720, Pl 721, P-l722, P-1723, P-1724, P-1725, P-1726, P-1727, P-1728, P-1729, P-1730, P-1731, P-1732, P-1733, P-1734, P-1735, P-1736, P-1737, P-1738, P-1739, P-1740, P-1741, Pl 742, P-1746, P-1747, P-1748, P-1749, P-1750, P-1751, P-1753, P-1754, P-1755, P-1756, P-1757 , P-1758, P-1759, P-1760, P-1761, P-1762, P-1763, P-1764, P-1765, P-1766, P-1767, P-1768, P-1769, P -1771, P-1772, P-1773, P-1774, P-1775, P-1776, P-1778, P-1779, P-1780, P-1781, P-1782, P-1783, P-1784 , P-1796, P-1798, P-1799, Pl 800, P-1802, P-1803, P-1804, P-1816, P-1817, P-1818, P-1819, P-1821, P- 1822, Pl 827, P-1828, P-1839, P-1840, P-1864, P-1871, P-1872, Pl 873, Pl 878, P-1879, P-1881, Pl 882, P-1907, P-1912, P-1916,</td>

<td colspan="2">' ) P-1980, P-1996, P-1997, P-1998, P-2005, P-2006, P-2007, P-2012, P-2013</td>

<td>Table 2e. coy</td><td>nposites with activity towards Jnk1 kinase with IC_m&lt; 10 μΜ</td>

<td>Jnkl:</td><td>P-0088, P-0636, P-0685, P-0728, P-0753, P-0774, P-0848, P-0850, P-0851, P-0853, P-0860, P-0876, P- 0897, P-0956, P-0958, P-0991, P-0997, P-1009, P-1251, P-1253, P-1256, P-1260, P-1262, P-1266, P-1288, P-1289, P-1317, P-1318, P-1400, P-1432, P-1433, P-1445, P-1446, P-1447, P-1486, P-1534, P-1546, P- 1547, P-1548, P-1549, P-1553, P-1554, P-1566, P-1567, P-1570, P-1576, P-1589, P-1591, P-1596, P-1602, P-1610, P-1611, P-1618, P-1621, P-1627, P-1631, P-1636, P-1637, P-1638, P-1639, P-1656, P-1660, P-1687, P-1702, P-1706, P-1707, P-1708, P-1720, P-1722, P-1723, P-1724, P-1725, P-1727, Pl 730, P-1731 , P-1742, P-1748, P-1749, P-1750, P-1751, P-1755, P-1756, P-1757, P-1759, P-1760, P-1764, P-1765, P -1767, P-1770, P-1775, P-1776, P-1777, P-1778, M 779, P-1827, P-1828, P-1839, P-1842, Pl 864, P-1873, P -1878, P-1879, Pl 896, P-1897, Pl 898, P-2007</td>

Table 2f. Compounds with activity towards Jnk2 kinase with IC_S0 &lt; 10 μΜ

<td>Jnk2:</td><td>P-0088, P-0685, P-1253, P-1318, P-1445, P-1447, P-1486, P-1547, P-1548, P-1554, P-1566, P-1567, P- 1570, P-1575, P-1576, P-1589, P-1591, P-1602, P-1611, P-1621, P-1627, P-1656, P-1671, P-1687, P-1700, P-1702, P-1711, P-1720, P-1722, P-1723, P-1724, P-1727, P-I728, P-1729, P-1730, P-1731, Pl 732, P-1737 , P-1742, P-1748, P-1749, P-1750, P-1751, Pl 753, P-1755, P-1756, P-1757, P-1759, P-1760, P-1764, P- 1765, P-1767, P-1770, P-1776, P-1777, P-1778, P-1779, P-1827, P-1828, Pl 864, P-2007</td>

Table 2g. Compounds with activity towards Jnk3 kinase with ic_S9&lt; ίο μΜ

<td>Jn¿3:</td><td>P-0088, P-0132, P-0166, P-0636, P-0753, P-0774, P-0851, P-0991, P-1253, P-1289, P-1317, P-1318, P- 1400, P-1445, P-1447, P-1486, P-1534, P-1546, P-1547, P-1548, P-1554, P-1566, P-1567, P-1570, P-1576, P-1589, P-1591, P-1610, P-1611, P-1618, P-1621, P-1636, P-1687, P-1702, P-1703, P-1704, P-1706, P- 1707, Pl 713, P-1716, P-1720, P-1722, P-1724, P-1742, Pl 748, P-1749, P-1750, Pl 753, P-1755, P-1757, P-1759 , P-1764, P-1765, P-1767, P-1770, P-1775, P-1776, P-1777, P-1827, P-1828, P-1864, P-2007</td>

Table 2h. Compounds with activity towards kinase Kit with IC_JO&lt; 10 μΜ

<td>kit;</td><td>P-0007, P-0088, P-0132, P-0166, P-0636, P-0685, P-0753, P-0773, P-0774, P-0776, P-0798, P-0806, P- 0818, P-0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P-0867, P-0874, P-0876, P-0877, P-0885, POS 89, P-0898, P-0907, P-0910, P-0911, P-0913, P-0931, P-0933, P-0937, P-0952, PO954, P-0955, P-0956, P -0958, P-0954, P-0983, P-1009, P-1013, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1254 , P-1255, P-1256, P-1257, P-1259, P-1260, P-1261, P-1262, P-1263, P-1264, P-1266, P-1267, P-1268, Pl 269, P-1275, P-1289, P-1316, P-1317, P-1318, P-1396, P-1397, P-1400, P-1403, P-1431, P-1432 , P-1433, P-1445, P-1446, P-1447, P-1449, P-l450, Pl 455, P-1462, P-1466, P-1467, P-1470, P-1471, P- 1486, P-1495, Pl 531, P-1532, P-1534, P-1541, P-1542, P-1544, Pl 545, P-1546, P-1547, P-1548, P-1549, P- 1552, P-1553, P-1554, Pl 559, P-1566, P-1567, Pl 568, P-1569, P-1575, P-1576, P-1580, P-1581, P-1582, P- 1583, P-1590, P-1591, P-1598, P-1599, P-1630, P-1671, P-170D, P-1703, P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P-1711, P-1712, P-1713, P-1714, P-1718, P-1719, P-1720, Pl 733 , P-1737, Pl 739, P-l740, P-1767, P-1776, Pl 783, P-1798, Pl 822, P-1839, Pl 840, P-1864, Pl 865, P-1871, P- l872, P-1873, P-1878, P-1879, Pl 881, P-1882, P-1980, P-1996, P-1997, Pl 998</td>

Plasmid sequence and PCR primer information:

B-Raf V600E

PCR primers

<td>BRAF</td><td>BRAF437D-S</td><td>ACGGGACCATATGGATGATTGGGAGATTCCTGA (SEQ ID NO:___)</td><td> 4783</td>

<td></td><td>BRAF722K-A</td><td>CACTGGTCGACTATTTTGGCAATGAGCGGGCCA (SEQ ID NO:___)</td><td>47B4</td>

<td></td><td>BRAFV599E-S</td><td>GGTCTAGCTACAGAAAAATCTCGATGGAG (SEQ ID NO:___)</td><td> 893</td>

<td></td><td>BRAFV599E-A</td><td>CTCCATCGAGATTTTCTGTAGCTAGACC (SEQ ID NO:___)</td><td> 894</td>

P4254. pFastBacBD-CDC37 BRAF D437-K722-X, V600E .

YFQGHMDDWBIPDGQITVG Q agaattggatctggatcatttggaacagtctacaagggaaagtggcatggtgatgtggca RIGSGSFGTVYKGKWHGDVA gtgaaaatgttgaatgtgacagcacctacacctcagcagttacaagccttcaaaaatgaa

VKMLNVTAPTPQQLQAFKNE gtaggagtactcaggaaaacacacgacatgtgaatatcctactcttcatgggctattccaca

VGVLRKTRHVNILLFMGYST aagccacaactggctattgttacccagtggtgtgagggctccagcttgtatcaccatctc

KPQLAIVTQWCEGSSLYHHL catatcattgagaccaaatttgagatgatcaaacttatagatattgcacgacagactgca

HIIETKFEMIKLIDIARQTA cagggcatggattacttacacgccaagtcaatcatcccagagacctcaagagtaataat

QGMDYLHAKSIIHRDLKSNN atatttcttcatgaagacctcacagtaaaaataggtgattttggtctagctacagaaaaa

IFLHEDLTVKIGDFGLATEK tctcgatggagtgggtcccatcagtttgaacagttgtctggatccattttgtggatggca

SRWSGSHQFEQLSGSILWMA ccagaagtcatcagaatgcaagataaaaatccatacagctttcagtcagatgtatatgca

PEVIRMQD KNPYS FQSDVYA tttggaattgttctgtatgaattgatgactggacagttaccttattcaaacatcaacaac

FGIVLYELMTGQLPYSNINN agggaccagataatttttatggtgggacgaggatacctgtctccagatctcagtaaggta

RDQIIFMVGRGYLSPDLSKV cggagtaactgtcoaaaagccatgaagagattaatggcagagtgcctcaaaaagaaaaga

RSNCPKAMKRLMAECLKKKR gatgagagaccactctttccccaaattctcgcctctattgagctgctggcacgctcattg

DERPLFPQILASIELLARSL ccaaaatagtcgactagagcctgcagtatcgaggcatgcggtaccaagctt (seq id NO:__)

PK - (SEQ ID NO: )

PCR Primers Kit

<td>kit</td><td>8K1A</td><td>ATGTACGAAGTTCAGTGGAAAGTTGTTGAAGAAATCAACGG (SEQ ID NO i___)</td><td> 1775</td>

<td></td><td>BK1B</td><td>GGTCGATGTAAACGTAGTTGTTACCGTTGATTTCTTCAACAACTTT (SEQ ID NO:___)</td><td> 1777</td>

<td></td><td>8K2A</td><td>AACAACTACGTTTACATCGACCCGACCCAGCTGCCGTACGAC (SEQ ID NC:___)</td><td> 1779</td>

<td></td><td>8K2B</td><td>GTTACGCGGGAACTCCCATTTGTGGTCGTACGGCAGCTGGGTC (SEQ ID NO:___)</td><td> 1781</td>

<td></td><td>8K3A</td><td>aaatgggagttcccgcgtaaccgtctgtctttcggtaaaaccc (SEQ ID NO:___)</td><td> 1782</td>

<td></td><td>8K3B</td><td>ACCGAACGCACCCGCACCCAGGGTTTTACCGAAAAGACAGAC (SEQ ID NO:___)</td><td> 1783</td>

<td></td><td>8K4A</td><td>GGTGCGGGTGCGTTCGGTAAAGTTGTTGAAGCGACCGCGTACG (SEQ ID NO:___1</td><td> 1784</td>

<td></td><td>8K4B</td><td>GCCGCGTCAGATTTGATCAGACCGTACGCGGTCGCTTCAAC (SEQ ID NO:___)</td><td> 1785</td>

<td></td><td>8K5A</td><td>CTGATCAAAICTGACGCGGCGATGACCGTTGCGGTTAAAATGC (SEQ ID NO:___)</td><td> 1786</td>

<td></td><td>8K5B</td><td>GTCAGGTGCGCAGACGGTTTCAGCATTTTAACCGCAACGGTCA (SEQ ID NO:__)</td><td> 1787</td>

<td></td><td>8K6A</td><td>AAACCGTCTGCGC!ACCTGACCGAACGTGAAGCGCTGATGTCTG (SEQ ID NO:___)</td><td> 1788</td>

<td></td><td>8K6B</td><td>CCAGGTAAGACAGAACTTTCAGTTCAGACATCAGCGCTTCACGT (SEQ ID NO:___)</td><td> 1789</td>

<td></td><td>8K7A</td><td>CTGAAAGTTCTGTCTTACCTGGGTAACCACATGAACATCGTTAA (SEQ ID NO:___)</td><td> 1791</td>

<td></td><td>8K7B</td><td>GGTGCACGQACCCAGCAGGTTAACGATGTTCATGTGGTTAC (SEQ ID NO:___)</td><td> 1792</td>

<td></td><td>8K8A</td><td>CTGCTGGGTGCGTGCACCATCGGTGGTCCGACCCTGGTTATOA (SEQ ID NO:___)</td><td> 1793</td>

<td></td><td>8K8B</td><td>GICACCGTAGCAGCAGTATTCGGIGAIAACCAGGGTCGGACCA (SEQ ID NO:___)</td><td> 1794</td>

<td></td><td>8K9A</td><td>GAATACTGCTGCTACGGTGACCTGCTGAACTTCCTGCGTCGTA (SEQ ID NO:___)</td><td> 1795</td>

<td></td><td>8K9B</td><td>AGAGCAGATGAAAGAGTCACGTTTACGACGCAGGAAGTTCAGC (SEQ ID NO:___)</td><td> 1798</td>

<td></td><td>8K10A</td><td>CGTGACTCTTTTCATCTGCTCTAAACAGGAAGACCACGCGGAAG (SEQ ID NO:,___)</td><td> 1797</td>

<td></td><td>3K1DB</td><td>CAGCAGGTTTTTGTACAGCGCCGCTTCCGCGTGGTCTTCCTGT (SEQ ID NO: ___)</td><td> 1798</td>

<td></td><td>ΒΚ11Α</td><td>GCGCTGTACAAAAACCTGCTGCACTCTAAAGAATCTTCTTGCTC (SEQ ID NO:___)</td><td> 1799</td>

<td></td><td>8K11B</td><td>ccatgtattcgttggtagagtcagagcaagaagattctttagagt (SEQ ID NO!___)</td><td>1B11</td>

<td></td><td>8Κ11Ά</td><td>GACTCTACCAACGAATACAIGGACATGAAACCGGGTGTTTCTTA (SEQ ID NO:___)</td><td> 1812</td>

<td></td><td>8K11B</td><td>TCCGCTTTGGTGGGAACAACGTAAGAAACACCCGGTTTCATGT (SEQ ID NO:___)</td><td> 1813</td>

<td></td><td>8K12A</td><td>GTTG'nCCGACCAARGCGGACAAACGTCG'nCTGTTCGTATCG (SEQ ID NO:___)</td><td> 1814</td>

<td></td><td>8K12B</td><td>TAACGTCACGrTCGATGTAAGAACCGATACGAACAGAACfiACGTTG (SEQ ID NO:___)</td><td> 1815</td>

<td></td><td>8K13A</td><td>tcttaCatcgaacgtgacgttaccccggcgatcatggaagacg (SEQ ID NO:___)</td><td> 1816</td>

<td></td><td>8K13B</td><td>CCAGGTCCAGCGCCAGTTCGTCGTCTTCCATGATCGCCGG (SEQ ID NO:___)</td><td> 1817</td>

<td></td><td>8K14A</td><td>GAACTGGCGCTGGACCTGGAAGACCIGCTGTCTTTCTCTTACC (SEQ ID NO:___)</td><td> 1818</td>

<td></td><td>8K14B</td><td>GAACGCCATACC'TTTCGCAACCTGGTAAGAGAAAGACAGCAGGT (SEQ ID NO:___)</td><td> 1819</td>

<td></td><td>8K15A</td><td>GTTGCGAAAGGTATGGCGTTCCTGGCGTCTAAAAACTGCATCCA (SEQ ID NO:___)</td><td> 1821</td>

<td></td><td>8K15B</td><td>CGCGCCGCCAGGTCACGGTGGMGCAGTTTTTAGACGCC (SEQ ID NO:__)</td><td> 1822</td>

<td></td><td>8K16A</td><td>CGTGACCTGGCGGCGCGTAACATCCTGCTGACCCACGGTCG (SEQ ID NO:___)</td><td> 1823</td>

<td></td><td>3K16B</td><td>ACCGAAGTCGCAGATTTTGGTGATACGACCGTGGGTCAGCAGG (SEQ ID NO:____)</td><td> 1824</td>

<td></td><td>3K17A</td><td>ACCAAAATCTGCGACTTCGGTCTGGCGCGTGACATCAAAAAACG (SEQ ID NO:___)</td><td> 1825</td>

<td></td><td>3K17B</td><td>GTTACCTTTAACAACGTAGTTAGAGTCGTTTTTGATGTCACGCGCC (SEQ ID NO:___)</td><td> 1828</td>

<td></td><td>8K18A</td><td>TCTIACIACGTTGTTAAAGGTAACGCGCGTCTGCCGGTTAAATG (SEQ ID NO:___)</td><td> 1827</td>

<td></td><td>8K18B</td><td>GAAGATAGATTCCGGCGCCATCCAITTAACCGGCAGACGCGC (SEQ ID NO:___)</td><td> 1829</td>

<td></td><td>3K19A</td><td>ATGGCGCCGGAATCTATCTTCAACTGCGTTTACACCTTCGAATC (SEQ ID NO;___)</td><td> 1831</td>

<td></td><td>ΘΚ19Β</td><td>GATACCGTAAGACCAAACGTCAGATTCGAAGGTGTAAACGCAG (SEQ ID NO: ]</td><td> 1832</td>

<td></td><td>8K2OA</td><td>σΑΟβτττοοταττΑοοοτΑτοττοοτοτσαοΑΑΟτοττατστο [SEQ ID NO:___)</td><td> 1833</td>

<td></td><td>8K20B</td><td>CCTGTGGGAACTGTTCTCTCTGGGTTCTTCTCCCGTACCCGG</td><td> 1834</td>

<td></td><td></td><td>(SEQ ID NO:___)</td><td></td>

<td></td><td>8Κ21Α</td><td>GGTTCTTCTCCGTACCCGGGTATGCCGGTTGACTCTñAATTCTAT [SEQ ID NO;___)</td><td> 1835</td>

<td></td><td>ΒΚ21Β</td><td>CGGAAACCTTCTTTGATCATTTTGTAGAATTTAGAGTCAACCGGC (SEQ ID NO:___)</td><td> 1836</td>

<td></td><td>ΒΚ22Α</td><td>AAAATGATCAAAGAAGGTTTCaGTATGCTCTCTCCGGAACACG (SEQ ID NO:___)</td><td> 1837</td>

<td></td><td>ΒΚ22Β</td><td>ATGTCGTACATTTCC0CC0QCGCGTGTTCCGGAGACAGCATA (SEQ ID NO:___)</td><td>1B3B</td>

<td></td><td>8Κ23Α</td><td>CCGGCGGAAATGTACGACATCATGAAAACCTGCTGGGACGCG (SEQ ID NO:___)</td><td> 1839</td>

<td></td><td>8Κ23Β</td><td>AAGGTCGGACGTTTCAGCGGGTCCGCGTCCCAGCAGGTTTTC (SEQ ID NO:___1</td><td>1S41</td>

<td></td><td>ΒΚ24Α</td><td>CCGCTCAAACGTCCGACCTTTCAAACAGATCGTTCAGCTGATCG (SEQ ID NO:___)</td><td> 1842</td>

<td></td><td>ΘΚ24Β</td><td>TTGGTAGATTCAGAGATCTGTTTTTCGATCAGCTGAACGATCTGTT (SEQ ID NO:___)</td><td> 1843</td>

<td></td><td>8Κ25Α</td><td>AAACAGATCTCTGAATCTACCAACCACATCTACTCTAACCTGGC (SEQ ID NC:___)</td><td> 1844</td>

<td></td><td>8Κ25Β</td><td>tgacggttcggagagcagttcgccaggttagaggtagatgtgg (SEQ ID NO:___)</td><td> 1845</td>

<td></td><td>8Κ26Α</td><td>AACTGCTCTCCGAACCGTCAGAAACCGGTTGTTGACCACTCTG (SEQ ID NO:___}</td><td> 1846</td>

<td></td><td>8Κ2 6Β</td><td>GTAGAACCAACAGAGTTGATACGAACAGAGTGGTCSACAACCGGT (SEQ ID NO:___)</td><td> 1847</td>

<td></td><td>8Κ27Α</td><td>CGTATCAACTCTGTTGGTTCTACCGCGTCTTCTTCTCAGCCG (SEQ ID NO:___)</td><td> 1848</td>

<td></td><td>ΒΚ27Β</td><td>AACGTCGTCGTGAACCAGCAGCGGCTGAGAAGAAGACGCGCG (SEQ ID NO:___)</td><td> 1849</td>

<td></td><td>8K-F</td><td>GTTGTTTCATATGTACGAAGTTCAGTGGAAAG (SEQ ID NO:___)</td><td> 1851</td>

<td></td><td>8K-R</td><td>gttgtttgtcgactasacgtcgtcgtgaaccagcag (SEQ ID NO:___)</td><td> 1852</td>

<td></td><td>KIT CODE-K948X</td><td>GTTCTTGTCGACTATTTCTGACGGTTCGGAGAGC (SEQ ID NO:___)</td><td> 3411</td>

Ρ1332.Ν6 ΒΙΡΤΡ ΚΓΓ Μ552-Κ948-Χ COD taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatgtacgaa

MGHHHHHHMYE gttcagtggaaagttgttgaagaaatcaacggtaacaactacgtttacatcgacccgacc VQWKVVEEXNGWNYVYXDPT cagctgccgtacgaccacaaatgggagttcccgcgtaaccgtctgtctttcggtaaaacc QLPYDHKWEFPRNRLSFGKT ctgggtgcgggtgcgttcggtaaagttgttgaagcgaccgcgtacggtctgatcaaatct LGAGAFGKVVEATAYGLIKS gacgcggcgatgaccgttgcggttaaaatgctgaaaccgtctgcgcacctgaccgaacgt DAAMTVAVKMLKPSAHLTBR gaagcgctgatgtctgaactgaaagttctgtcttacctgggtaaccacatgaacatcgtt EALMSEI₎KVI_YOSYLGNH MNIV aacctgctgggtgcgtgcaccatcggtggtccgaccctggttatcaccgaatactgctgc NLLGACTIGGPTLVITEYCC tacggtgacctgctgaacttcctgcgtcgtaaacgtgactctttcatctgctctaaacag YGDLLNFLRRKRDSFICSKQ gaagaccacgcggaagcggcgctgtacaaaaacctgctgcactctaaagaatcttcttgc EDHAEAALYKNLLHSKESSC tctgactctaccaacgaatacatggacatgaaaccgggtgtttcttacgttgttccgacc SDSTNEYMDMKPGVSYVVPT aaagcggacaaacgtcgttctgttcgtatcggttcttacatcgaacgtgacgttaccccg KADKRRSVRIGSYIERDVTP gcgatcatggaagacgacgaactggcgctggacctggaagacctgctgtctttctcttac ΑΙΜΕϋϋΕΏΑΙιϋΏΕΌΏΙιΞΡδΥ caggttgcgaaaggtatggcgttcctggcgtctaaaaactgcatccaccgtgacctggcg QVAKGMAFLASKNCIHRDLA gcgcgtaacatcctgctgacccacggtcgtatcaccaaaatctgcgacttcggtctggcg ΑΕΝΙίΕΤΗΟΗΙΤΚΧΟϋΡΟΕΑ cgtgacatcaaaaacgactctaactacgttgttaaaggtaacgcgcgtctgccggttaaa RDIKNDSNYVVKGNARLPVK tggatggcgccggaatctatcttcaactgcgtttacaccttcgaatctgacgtttggtct WMAPESIFNCVYTFESDVWS tacggtatcttcctgtgggaactgttctctctgggttcttctccgtacccgggtatgccg YGIFLWEIiFSLiGSSPYPGMP gttgactctaaattctacaaaatgatcaaagaaggtttccgtatgctgtctccggaacac VDSKFYKMIKEGFRMLSPEH gcgccggcggaaatgtacgacatcatgaaaacctgctgggacgcggacccgctgaaacgt APAEMYDIMKTCWDADPLKR ccgaccttcaaacagatcgttcagctgatcgaaaaacagatctctgaatctaccaaccac PTFKQIVQLIEKQISESTNH atctactctaacctggcgaactgctctccgaaccgtaagaaatagtcgactgaaaaagga IYSNLANCSPNRQK·- (SEQ ID NO: ) agagt (seq id no: )

MEK1 Substrate

PCR primers

<td>MEK1</td><td>MEK1-S</td><td>CGGGTCCCATATGCCCAAGAAGAAGCCGAC (SEQ ID NO:___)</td><td> 755</td>

<td></td><td>MEK-HIS</td><td>GTTCGTTGTCGACGACGCCAGCAGCATGGGTTG (SEQ ID NO:___)</td><td> 2127</td>

<td></td><td>K97A-1 (K104A)</td><td>CTAATTGATCTGGAGATCGCGCCCGCAATCCGG (SEQ ID NO:___)</td><td> 2023</td>

<td></td><td>K97A-2 (K104A)</td><td>CCGGATTGCGGGCGCGATCTCCAGATGAATTAG (SEQ ID NO:___)</td><td> 2024</td>

P1277.pGEX-BIO MEK1 K97A atgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttctt

MSPILGYWKIKGLVQPTRLL· ttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaa ΕΕΥΕΕΕΚΥΕΕΗΕΥΕΒΕΕΘΟΚ tggcgaaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatattgat WRNKKFELGLEFPNLPYYID ggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaac

GDVKLTQSMAIIRYIADKHN atgttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttg

MLGGCPKERAEISMLEGAVL gatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagtt

DIRYGVSRIAYSKDFETLKV gattttcttagcaagctacctgaaatgatgaaaatgttcgaagatcgtttatgtcataaa

DFLSKLPEMLKMFEDRLCHK acatatttaaatggtgatcatgtaacccatcctgaattcatgttgtatgacgctcttgat

TYLNGDHVTHPDFMLYEALD gttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaa

VVLYMDPMCLDAFPKLVCFK aaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagca

KRIEAIPQIDKYLKSSKYIA tggcctttgcagggctggcaagccacgtttggtggtggcgaccatactccaaaatcggat

WPLQGWQATFGGGDHPPKSD ctggttccgcgtggatctcatatgcccaagaagaagccgacgaccatccagctgaaaccg

LVPRGSHMPKKKPTPIQLNP gcccccgacggctctgcagttaacgggaccagctgcggagaccaacttggaggccttg

APDGSAVNGTSSAETNLEAL cagaagaagctggaggagctagagcttgatgagcagcagcgaaagcgccttgaggcattt

QKKLEELELDEQQRKRLEAF cttacccagaagcagaaggtgggagaactgaaggatgacgactttgagaagatcagtgag

LTQKQKVGELKDDDFEKISE ctgggggctggcaatggcggtgtggtgttcaaggtctcccacaagccttctggcctggtc

LGAGNGGVVFKVSHKPSGLV atggccagagcgctaattcatctggagatcaaacccgcaatccggaaccagatcataagg

MARALIHLEIKPAIRNQIIR gagctgcaggttctgcatgagtgcaactctccgtacatcgtgggcttctatggtgcgttc

ELQVLHECNSPYIVGFYGAF tacagcgatggcgagatcagtatctgcatggagcacatggatggaggttctctggatcaa

YSDGEISICMEHMDGGSLDQ gtcctgaagaaagctggaagaattcctgaacaaattttaggaaaagttagcattgctgta

VLKKAGRTPEQILGKVSIAV ataaaaggcctgacatatctgagggagaagcacaagatcatgcacagagatgtcaagccc

IKGLTYLREKHKIMHRDVKP tccaacatcctagtcaaatcccgtggggagatcaagctctgtgactttggggtcagcggg snilvnsrgeiklcdfgvsg cagctcatcgactccatggccaactccttcgtgggcacaaggtcctacatgtcgccagaa

QLIDSMANSFVGTRSYMSPE agactccagggactcattactctgtgcagtcagacatctggagcatgggactgtctctg

RLQGTHYSVQSDIWSMGLSL gtagagatggcggttgggaggtatcccatccctcctccagatgccaaggagctggagctg

VEMAVGRYPIPPPDAK.ELEL atgtttgggtgccaggtggaaggagatgcggctgagaccccacccaggccaaggaccccc

MPGCQVEGDAAETPPRPRTP gggaggccccttagctcatacggaatggacagccgacctcccatggGaatttttgagttg GRPLSSYGMDSRPPMAIFE ttggattacatagtcaacgagcctcctcaaaaactgcccagtggagtgttcagtctggaa

LDYIVNEPPPKLPSGVFSLE tttcaagattttgtgaataaatgcttaataaaaaacccccgcagagagagcagatttgaag

FQDFVNKCLiIKNPAERADLiK caactcatggttcatgcttttatcaagagatctgatgctgaggaagtggattttgcaggt

QLMVHAFIKRSDAEEVDFAG tggctctgctccaccatcggccttaaccagcccagcacaccaacccatgctgctggcgtc

WLCSTIGLNQPSTPTHAAGV gtcgaactgaacgacatcttcgaagctcagaaaatcgaatggcaccgttagaattc

VDLNDIFEAQKIEWHR(nucleic acid SEQ ID NO:___) (polypeptide SEQ ID NO:___)

Additional examples of certain methods contemplated by the present invention can be found in the following applications: US Provisional Application No. 60/580,898, filed June 17, 2004; North American Provisional Application

No. 60/682,076, filed May 17, 2005; North American Provisional Application

No. 60/682,058, filed May 17, 2005; North American Provisional Application

No. 60/682,063, filed May 17, 2005; North American Provisional Application

No. 60/682,051, filed May 17, 2005; North American Provisional Application

No. 60/682,042, filed May 17, 2005; North American Provisional Application

No. 60/692,750, filed June 22, 2005; and US Provisional Application No. 60/692,960, filed June 22, 2005; each of which is hereby incorporated by reference herein in its entirety including all specifications, figures and tables for all purposes.

All patents and other references cited in the specification are indicative of the level of expertise of those skilled in the art to which the Invention pertains, and are Incorporated by reference in their entireties, Including any tables and figures, to the same extent as if each reference would have been incorporated by reference in its entirety individually.

One skilled in the art will readily appreciate that the present invention is well adapted to obtain the ends and advantages mentioned, as well as those inherent herein. The methods, varlances, and compositions described herein as presently representative of the preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes to the present and uses will occur by those skilled in the art, which are encompassed within the spirit of the invention, as defined by the scope of the claims.

It will be readily apparent to one skilled in the art that variation of substitutions and modifications can be made to the invention described herein without departing from the scope and spirit of the invention. For example, variations can be made for crystallization or co-crystallization conditions for Ret proteins and Ret surrogates and/or various kinase domain sequences can be used. Thus, such additional embodiments are within the scope of the present invention and the following claims.

The invention illustratively described herein can be properly practiced in the absence of any element or elements, limitation or limitations which are not specifically described herein. Thus, for example, in each instance herein, any of the terms "comprising", "consisting essentially of" and "consisting of" may be replaced with any of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and the use of such terms and expression is not intended to exclude any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the claimed invention. Thus, it is to be understood that while the present invention has been specifically described by preferred embodiments and optional features, modification and variation of the concepts described herein may be rearranged by those skilled in the art, and that such modifications and variations are considered to fall within the scope of this invention as defined by the appended claims.

Furthermore, in the case where features or aspects of the invention are described in terms of Markush groups or other set of alternatives, those skilled in the art will recognize that the invention is accordingly also described in terms of any individual member or subgroup of members. from the Markush group or another group.

Also, unless otherwise stated, in the case where multiple numerical values ​​are provided for modalities, additional modalities are described by taking 2 different values ​​as the end points of an interval. Such ranges are also within the scope of the described invention.

Thus, additional embodiments are within the scope of the invention within the following claims.