Pyrrolo [2, 3-b]pyridine derivatives as protein kinase inhibitors

[0001] The present invention relates to compounds that modulate kinases and their uses. Specific embodiments take into account indications for diseases that are susceptible to treatment by modulation of kinase activity by the compounds of the present invention.

BACKGROUND OF THE INVENTION [0002] The information contained herein is only intended to facilitate the understanding of the reader. None of the information provided or references cited is considered to be the state of the art of the present invention.

[0003] Receptor kinase proteins regulate the key signal of transduction cascades that control or are involved in the control of a large number of physiological functions including cell growth and proliferation, cell differentiation, cell development, cell division, cell adhesion, stress response, short-axis conduction range by contact, regulation of transcription, abnormal mitogenesis, angiogenesis, abnormal cell-cell endothelial or cell-matrix interactions during vascular development, inflammation, limfohematopoetic activity of stem cells, protective immunity against specific bacteria, allergic asthma, abnormal tissue-specific response to activation JNK signal transduction pathways, cellular transformation, memory, apoptosis,competence-dependent modification of the neuromuscular synapse, immune mediation of the disease, and calcium metabolism.

[0004] Specific disease states associated with improper regulation of protein kinases include, without limitation, acrocephalosifactia type I, acute myeloid leukemia, AIDS-induced lymphoma, Alzheimer's disease, amyotrophic lateral sclerosis, arthritis, asthma, atherosclerosis, atopic dermatitis, autoimmune diseases, bacterial infections, bladder cancer, breast cancer, central nervous system cancer, colon cancer, endometrial cancer, fallopian tube cancer, gastrointestinal cancer, ovarian cancer, heart failure, chronic myelogenous leukemia, colon cancer, colorectal cancer, chronic obstructive disease lung (COPD), Crouzon syndrome, diabetes, diabetic nephropathy, emphysema, endometriosis, epithelial carcinoma, fibrosis, gastrointestinal stromal tumor (GIST),glomerulonephritis, Graves' disease, head injuries, hepatocellular carcinoma, Hirschsprung's disease, human glioblastomas, immunodeficiency diseases, inflammatory disorders, ischemic stroke, Jackson-Weiss syndrome, leiomyosarcomas, leukemia, lupus nephritis, malignant melanoma, malignant melanoma

viral infections, diabetic retinopathy, alopecia, erectile dysfunction, macular degeneration, chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), neurofibromatosis and tuberous sclerosis. Accordingly, there is a need in the art for additional compounds and methods for their use in the modulation of receptor protein kinases.

[0005] This application relates to the following published patent applications: WO 2004024895, US 20040142864, WO 2004078923, US 20050170431, WO 2005028624, US 20050164300, and WO 2005062795. WO 2004/016610 describes pyrrolo- [2,3b] -pyridine compounds as inhibitors of Itk protein kinase, which differs from the compounds claimed herein in that they have an aromatic heterocyclic ring at the 2-position and have other substituents at the 3-position of the pyrrolopyridine ring.

In particular, the invention relates to compounds of formula IIm as described below. Thus, the invention provides compounds for therapeutic methods involving the modulation of protein kinases as well as novel compounds that can be used for therapeutic methods involving modulation of protein kinases. [0007] Compounds of the formula IIIm having a structure are described herein

<img file="PL1893612T3_D0001.tif" />

and its salts, where:

R⁸¹ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -NH2, -CN , NO2, -C (O) OH, -S (O) 2NH2, -C (O) NH2, -C (S) NH2, -NHC (O) NH2, NHC⁽S⁾NH2^- NHS (O)₂NH₂, -OR⁶⁸, -SR⁶⁸, ^ \ R ^^and'' R^and''.-CD2) R^and'⁸.-C (R ^^and'⁸. C⁽ABOUT⁾OR⁶8 -C (O) NR⁶⁹R⁶⁸, -C (S) NR⁶⁹R⁶⁸. ^- S⁽ABOUT⁾2NR⁶⁹R^{68, -}NO⁶⁹C⁽ABOUT⁾R^68,NO⁶⁹C⁽S) R⁶8 ^-NO⁶⁹S⁽ABOUT⁾2R^{68, -} R 6 'C (O) IHl2 ^. - \ Ri⁹⁹C (O)) \ k^9R&lt;⁸⁸.

^-NO⁶⁹C⁽S⁾NH2^-NO⁶⁹C⁽S⁾NO⁶⁹R^{68, -} ^ ΪH⁹⁹S (O) ^ 2ΪH^{2, -} NO⁸8 (0²²^⁹¾⁸ S⁽ABOUT⁾R⁶8 and ^-S⁽ABOUT^{) 2}R^68; r8³ is selected from the group consisting of hydrogen, fluoro and chloro:

Rⁿ² is selected from the group consisting of an optionally substituted C2-6 alkyl, an optionally substituted aryl, an optionally substituted heteroaryl, and ^-NO⁷⁹R⁸⁰;

R⁶⁸ is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, however, providing that when R68 is an optionally substituted lower alkenyl, none of its alkene carbons ⁿand^{e is}t ^{with in}and^ązany from N, S^. ABOUT^. S (O,) ^. SCO^{2 ,,} WHAT ^- l ^ b C (S ^- with -OR⁸ -SR⁸ NO⁶⁹R⁶8 ^-C⁽ABOUT⁾R⁶8 -C (S) R⁸. ^-C⁽ABOUT⁾OR⁶8 ^-C⁽O) NR⁶⁹R⁶⁸' ^- ϋ ^ ίΐΛ⁸, S⁽ABOUT^{) 2}NO⁶⁹R^{68, -}NO⁶⁹C (O) R^{68, -}NO⁶⁹C (S) R⁶8 ^-NO⁶⁹S (O)²R⁶8 ^- NO⁶⁹C (O) NH², NR⁶⁹C⁽ABOUT⁾NO⁶⁹R⁶8 ^-NO⁶⁹C⁽S⁾NO^{2, -}NO⁶⁹C (S⁾NO⁶⁹R^{8 -}NO⁶⁹S⁽ABOUT^{) 2}NH²^-NO⁶⁹S⁽ABOUT^{) 2}NO⁶⁹R⁶8 ^-S⁽ABOUT⁾R⁶8 or ^-S⁽ABOUT^{) 2}R⁶8 ^{Alternatively, on}lⁿand^{e after}d^slaunched in style^himlower alkynyl, however, ensuring that when R68 is an optionally substituted lower alkynyl, no carbon from its alkyne is bonded to N, S, O, S (O), S (O) 2, C (O) or C (S) ) from -OR68, - SR68, -NR6⁹R68, -C (O) R68, -C (S) R68, -C (O) OR68, ^- C (O) NR⁶⁹R⁶⁸, -C (S) NR⁶⁹R⁶8 -S (O.²²NO⁶⁹R⁸, -NR⁶⁹C (O) R⁶⁸, NR⁶⁹C⁽S⁾R⁶8 - \ I <6 '⁹S (0) 2I <6⁸ - ^ I <⁽" '^.9 '(O)) II2. - \ II^RDo) \ r^LR8, NO⁶⁹C⁽S⁾NH²> - ^ "C ^ fR⁹¹.⁸, -) R⁹⁹S (O²²) ^ H² - 4 NR⁶⁹S (O) 2 NR⁶⁹R⁶⁸, -S (O) R⁶⁸, or -S (O) 2R⁶⁸a substituted cycloalkyl, an optionally substituted heterocyclyl, an optionally substituted aryl, and an optionally substituted heteroaryl;

R69 jibe with ginpv derived from hydrogen and optionally underlaid lower alkyl; and r79 j j8⁸t _Sand _ne. g. hydroxy or iodic acid and lower alkere or R⁷⁹ and r8 ° combine with the nitrogen to which they are attached to form an optionally substituted 5-7 membered heterocycloalkyl.

[0008] In some embodiments of compounds of formula IIIm, R8¹ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aiyl o^pcjona^ln^ande ^pabout^ds^tand^andhe^yhe^teroar^yl, -CN -^S(^ABOUT)²NH2_; -Ο ^ ΝΗ ^ -O^R68-^SR68, NR⁶⁹R⁶8 ^-C⁽ABOUT⁾R^{68, -}C⁽S) R⁶8 ^-C⁽ABOUT⁾NO⁶⁹R⁶8 ^-S⁽ABOUT⁾2NR⁶⁹R^{68, -}NO⁶⁹C⁽ABOUT⁾R^{68, -}

NO⁶⁹S⁽ABOUT⁾2R^68, -S (O) R⁶⁸, and ^-S⁽ABOUT)₂R⁶⁸.

[0009] The compounds of formula IIIm, and all sub-embodiments set forth herein, can be used to treat a subject suffering from or at risk for any of the diseases mediated by protein kinase mediated by diseases or conditions.

In some embodiments of the above compounds, the compounds are excluded where N (only not where N is a heteroaryl ring atom), O, or S is bonded to carbon which is also bonded to N (only not where N is heteroaryl ring), O, or S; or where N (only not where N is an ether of an ether), O, C (S), C (O), or S (O) n (n is 0-2) is bonded to an alkene carbon or an alkenyl group or bound to an alkynyl carbon from an alkynyl group; accordingly, in some embodiments, compounds that contain bonds such as the following are excluded from the present invention: -NR-CH2-NR-, -OCH2-NR-, -S-CH2-NR-, -NR-CH2O-, -O-CH2-O-, -S-CH2-O-, -NR-CH2-S-, -O-CH2-S-, -S-CH2-S-, -NR-CH = CH-, -CH = CHNR-, -NR-C = C-, -C = C-NR-, -O-CH = CH-, -CH = CH-O-, -OC = C-, -C = CO-, -S (O) O-CH 2 = CH-,

[0012] In one aspect, the invention provides for the use of a compound of formula IIIm for the manufacture of a medicament for treating diseases or conditions mediated by protein kinase

- animal subjects, wherein the use comprises administering to the subject a working amount of a compound of formula IIIm and all of its sub-embodiments. The terms "treat," "therapy," and similar terms refer to the administration of a material, e.g. a compound of formula IIIm, in an effective amount to prevent, reduce or prevent one or more of the symptoms of a disease or condition, i.e. an indication, and or or to extend the survival of the treated subject. The term "protein kinase-mediated disease or condition" refers to a disease or condition in which the biological function of the protein kinase affects the development and / or course of the disease or condition, and / or wherein protein kinase modulation alters the development, course, and / or symptoms of the disease. or state. The protein kinase-mediated disease or condition includes a disease or condition for which modulation provides a therapeutic benefit, e.g. where treatment with protein kinase inhibitors, including compounds described herein, provides a therapeutic benefit to a subject suffering from or at risk of this disease or condition. In one aspect, the use comprises administering to the subject an effective amount of a compound of formula IIIm in combination with one or more other therapies of the disease or condition.

[0013] In one aspect, the invention provides for the use of a compound of formula IIIm in the manufacture of a medicament for treating diseases or conditions mediated by protein kinase on animal subjects, wherein the use comprises administering to the subject an effective amount of a compound of formula IIIm. The term "Raf protein kinase-mediated disease or condition," "Raf-mediated disease or condition," and the like refer to a disease or condition in which the biological function of Raf kinase, including any mutations thereof, affects the development and / or course of the disease or disease; a condition, and / or wherein the modulation of Raf protein kinase changes the development, course, and / or symptoms of the disease or condition. Raf protein kinase including, but not limited to, B-Raf, B-Raf mutation, c-Raf-1 and ofc-Raf-1 mutation. In some embodiments, the Raf protein kinase is a V600E B-Raf mutation. In further embodiments, the disease or condition is a cancer that is susceptible to treatment with inhibitors of the B-Raf mutant V600E. The Raf protein-mediated disease or disease state comprises a disease or condition for which Raf inhibition provides a therapeutic benefit, e.g. wherein treatment with Raf inhibitors, including compounds described herein, provides a therapeutic benefit to a subject suffering from or at risk of this disease or condition. In one aspect, the use comprises administering to the subject an effective amount of a compound of formula IIIm in combination with one or more other therapies of the disease or condition. wherein treatment with Raf inhibitors, including compounds described herein, provides a therapeutic benefit to a subject suffering from or at risk of this disease or condition. In one aspect, the use comprises administering to the subject an effective amount of a compound of formula IIIm in combination with one or more other therapies of the disease or condition. wherein treatment with Raf inhibitors, including compounds described herein, provides a therapeutic benefit to a subject suffering from or at risk of this disease or condition. In one aspect, the use comprises administering to the subject an effective amount of a compound of formula IIIm in combination with one or more other therapies of the disease or condition.

[0014] In one aspect, the methods used comprise administering to the subject an effective amount of a compound of formula IIIm in combination with one or more other disease therapies. Raf protein kinase includes, but is not limited to, B-Raf, B-Raf mutations, cRaf-1 and ofc-Raf-1 mutations. In some embodiments, the Raf protein kinase is a V600E B-Raf mutation. In further embodiments, the disease or condition is a cancer that is susceptible to treatment with inhibitors of the B-Raf mutant V600E.

[0015] In some embodiments, the compound of Formula IIIm is a Raf kinase inhibitor and has an IC 50 less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM like

- 6 were determined in generally accepted trials of Raf kinase activity. In some embodiments, a compound of formula IIIm will have an IC 50 less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM including B -Raf, c-Raf 1, or V600E mutant B-Raf. In some embodiments, the compound of Formula IIIm will selectively inhibit one of the Raf kinases or one or more other Raf kinases. In some embodiments, the compound of formula IIIm will selectively inhibit the Raf kinase mutation or wild-type kinase, e.g. B-Raf V600E or wild-type B-Raf.

[0016] Furthermore, for each of the above-mentioned embodiments, a compound of the invention will also inhibit the action of a kinase mutation, including, but not limited to, a mutation that is associated with a disease state such as cancer. For example, the B-Raf V600B mutant is present in a high percentage of some cancers, such as melanoma, and the compounds of the invention will inhibit the kinase activity of this mutant.

[0017] Furthermore, for each of the above-mentioned embodiments, a compound of the invention may selectively inhibit one kinase or one or more other kinases, wherein inhibition is selective with respect to any other kinase, both kinases discussed herein and other kinases. In some embodiments, the compound can selectively inhibit the kinase kinase kinase kinase kinase, e.g. B-Raf V600E or wild-type B-Raf.

In some embodiments, the compound can selectively inhibit Fms depending on the Kit. The selective inhibition of one kinase relative to another is such that the IC 50 for one kinase can be at least about 2-fold, also 5-fold, also 10-fold, also 20-fold, also 50-fold, or at least 100-fold smaller than the IC50 for one of the other kinases as defined in the generally accepted assays of kinase activity.

[0018] In one aspect, the invention provides compositions that include a therapeutically effective amount of at least one compound of formula IIIm and at least one pharmaceutically acceptable carrier, excipient and / or diluent. The composition may contain a plurality of various pharmaceutically active compounds that may comprise a plurality of compounds of formula IIIm or may comprise at least one compound of formula IIIm together with at least one compound that is therapeutically effective in the same disease indication. In one aspect, at least one compound of formula IIIm and at least one compound that is therapeutically effective in the same disease indication has a synergistic effect on the disease indication. In one aspect,

[0019] In one aspect, the invention provides for the use of a composition comprising a compound of formula IIIm in the manufacture of a medicament for treating diseases or conditions mediated by B-Raf kinase, c-Raf-1, or B-Raf V600E by administering to the subject an effective amount.

- 7 compositions. In one aspect, the invention provides for the use of a composition comprising a compound of formula IIIm in the manufacture of a medicament for treating diseases or conditions mediated by B-Raf, c-Raf-1, or B-Raf V600E by administering to the subject an effective amount of the composition in combination with one or more other suitable therapies for the treatment of this disease. In one aspect, the invention provides for the use of a composition comprising a compound of Formula IIIm in the manufacture of a medicament for treating cancer mutant B-Raf V600E by administering to the subject an effective amount of the composition in combination with one or more other suitable anti-cancer therapies, such as one or more chemotherapeutic drugs .

[0020] In one aspect, the invention provides for the use of a composition comprising a compound of formula IIIm in the manufacture of a medicament for the treatment of cancer by administering to the subject an effective amount of the composition in combination with one or more other therapies or medical procedures effective in the treatment of cancer. Other medical therapies or procedures include appropriate anti-cancer therapies (e.g., drug therapy, vaccine therapy, gene therapy, photodynamic therapy) or a medical procedure (e.g., surgery, radiation therapy, heating of hyperthermia, bone marrow or stem cell transplantation). In one aspect, one or more anti-cancer therapies or medical procedures are selected for treatment from a chemotherapeutic agent (e.g., a chemotherapeutic drug), radiotherapy (e.g. x radiation, γ-irradiation,

[0021] In a preferred embodiment, the invention provides for the use of a composition comprising a compound of formula IIIm in the manufacture of a medicament for the treatment of cancer by administering to the subject an effective amount of the composition in combination with one or more suitable chemotherapeutic substances. In one aspect, one or more suitable chemotherapeutic substances are selected from alkylating agents, including, but not limited to adozelazine, altretamine, bovillezole, busulfan, carboplatin, carboquone, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, estramustine, fotemustine, hepsulfame, ifosfamide, improsulfan, irofulven, lomustine, mechlorethamine, melphalan, oxaliplatin, piposulfan, semustine, streptozocin, temozolomide, thiotepa and treosulfan; antibiotics, including, but not limited to bleomycin, dactinomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, menogaril, mitomycin, mitoxantrone, neocarzinostatin, pentostatin, and filamycin; antimetabolite, including but not limited to azacitidine, capecitabine, cladribine, clofarabine, cytarabine, decitabine, floxuridine, fludarabine, 5-fluorouracil, piporafur,

- gemcitabine, hydroxyurea, mercaptopurine, methotrexate, nelarabine, pemetrexed, raltitrexed, thioguanine and trimetrexate; immunotherapy, including, but not limited to alemtuzumab, bevacizumab, cetuximab, galiksymab, gemtuzumab, panitumumab, pertuzumab, rituximab, tositumomab, trastuzumab, and 90 Y tiuxetan ibritumomab; a hormone or hormone antagonist, including, but not limited to, anastrozole, androgen, buserelin, diethylstilbestrol, exemestane, flutamide, fulvestrant, -goserelin, -idoxifene, letrozole, leuprolide, magestrol, raloxifene, tamoxifen and toremifene; a taxane, including, but not limited to, DJ-927, docetaxel, TPI 287, paclitaxel and paclitaxel DHA; including, but not limited to, alitretinoin, bexarotene, fenretinide, isotretinoin, and tretinoin; alkaloid, including, but not limited to etoposide, homoharringtonin, teniposide, vinblastine, vincristine, vindesine and vinorelbine; an anti-angiogenic substance, including but not limited to AE-941 (GW786034, Neovastat), ABT-510, 2-methoxy estradiol, lenalidomide and thalidomide; a topoisomerase inhibitor, including, but not limited to, amsacrine, edotecarin, exatecan, irinotecan (also an active metabolite of SN-38 (7-ethyl-10-hydroxy-camptothecin)), rubitecan, topotecan and 9-aminocamptothecin; a kinase inhibitor including, but not limited to, erlotinib, gefitinib, flavopiridol, imatinib mesilate, lapatinib, sorafenib, sunitinib malate, AEE-788, AG-013736, AMG 706, AMN107, BMS-354825, BMS-599626, UCN-01 (7-hydroxystaurosporine), and vaalanib; a target transduction signal inhibitor including, but not limited to, bortezomib, geldanamycin and rapamycin; biological response modifier including but not limited to, imiquimod, interferon-α, and interleukin-2; other chemotherapeutics, including, but not limited to, 3-AP (thiosemicarbazone 3-amino-2-carboxaldehyde), aminoglutethimide, asparaginase, briostatin-1, cilengitide, E7389, ixabepilon, procarbazine, sulindac, temsirolimus, tipifarnib. Preferably, the method of treating cancer comprises administering to the subject an effective amount of a composition of formula I (more preferably of formula III, and even more preferably of formulas IIIj, IIIk or IIIm) in combination with a chemotherapeutic substance selected from 5-fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel , SN-38, temozolomide, vinblastine, bevacizumab, cetuximab or erlotinib. 3-AP (thiosemicarbazone 3-amino-2-carbaldehyde), aminoglutethimide, asparaginase, briostatin-1, cilengitide, E7389, ixabepilone, procarbazine, sulindac, temsirolimus, tipifarnib. Preferably, the method of treating cancer comprises administering to the subject an effective amount of a composition of formula I (more preferably of formula III, and even more preferably of formulas IIIj, IIIk or IIIm) in combination with a chemotherapeutic substance selected from 5-fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel , SN-38, temozolomide, vinblastine, bevacizumab, cetuximab or erlotinib. 3-AP (thiosemicarbazone 3-amino-2-carbaldehyde), aminoglutethimide, asparaginase, briostatin-1, cilengitide, E7389, ixabepilone, procarbazine, sulindac, temsirolimus, tipifarnib. Preferably, the method of treating cancer comprises administering to the subject an effective amount of a composition of formula I (more preferably of formula III, and even more preferably of formulas IIIj, IIIk or IIIm) in combination with a chemotherapeutic substance selected from 5-fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel , SN-38, temozolomide, vinblastine, bevacizumab, cetuximab or erlotinib.

[0022] In another aspect, the invention provides compositions that comprise a therapeutically effective amount of a compound of formula IIIm and at least one pharmaceutically acceptable carrier, excipient and / or diluent. The composition may contain a plurality of different pharmacologically active compounds that may comprise a plurality of compounds of formula IIIm.

[0023] In a related aspect, the invention provides kits that include a composition as described herein. In some embodiments, the composition is packaged, e.g. into a vial, a bottle, a flask that may be further packaged, e.g. in a box, envelope, or bag; the composition is approved by the US Food and Drug Administration or a similar agency regulating administration to a mammal, e.g. a human; the composition is approved for administration to a mammal, e.g. a human, in a disease or condition mediated by a protein kinase; the kit of the invention contains written instructions for use and / or other indication,

That the composition is suitable or approved for administration to a mammal, e.g. a human, in a disease or condition mediated by a protein kinase; and the composition is packaged in dosage units or as single doses, e.g. single dose pills, capsules or the like.

[0024] In one aspect, the compounds of formula IIIm may be used in the preparation of a medicament for the treatment of B-Raf-mediated diseases or conditions selected from the group consisting of neurological diseases such as ischemic stroke, multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson's disease; neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, carcinoma (eg lung, pancreas, kidney cancer), lymphoma (e.g. histiocytic lymphoma) and thyroid cancer, lungs (e.g. small cell lung cancer), liver, breast , ovary and colon, neurofibromatosis, myelodysplastic syndrome, leukemia, tumor angiogenesis; pain of neuropathic or inflammatory origin, including acute pain, chronic pain and migraine; cardiovascular diseases including myocardial infarction, cardiac hypertrophy, thrombosis (e.g. thrombotic microangiopathy syndromes), atherosclerosis, reperfusion injury; inflammation including but not limited to psoriasis, polycystic kidney disease (PKD), arthritis and autoimmune diseases and conditions, osteoarthritis, scarring endometriosis, vascular restenosis, fibrosis, rheumatoid arthritis, inflammatory bowel disease (IBD) ; immunodeficiency diseases, graft rejection, graft versus host disease, kidney or prostate disease, including diabetic nephropathy, nephrosklerosis, glomerulonephritis, prostate hyperplasia, metabolic disorders, obesity; infections, including, but not limited to Helicobacter pylori and influenza virus, fever, sepsis; lung diseases including chronic obstructive pulmonary disease (COPD) and acute respiratory distress syndrome (ARDS); genetic development diseases such as Noonana syndrome, Costello syndrome (face and skin-skeletal syndrome), Leopard syndrome, cardio-facial-cutaneous syndrome (CFC), abnormalities of the neural crest syndrome causing cardiovascular, skeletal, intestinal, skin, hair and endocrine diseases.

[0025] In a related aspect, the compounds of formula IIIm can be used for the preparation of medicaments for the treatment of c-Raf-1 mediated diseases or conditions selected from the group consisting of colorectal, ovarian, lung and renal cell carcinoma, acute myeloid leukemia, myelodysplastic syndromes , tumor angiogenesis, and neuroendocrine tumors, such as medullary thyroid cancer, carcinoid cancer, small cell lung cancer and pheochromocytoma.

[0026] Additional aspects and embodiments will be apparent from the following Detailed Description and from the claims.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [0027] The following definitions apply in the present description, unless otherwise indicated:

[0028] "Halogen" refers to all halogens, i.e., chlorine (Cl), fluorine (F), bromine (Br), or iodine (I).

[0029] "Hydroxyl" or "hydroxy" refers to -OH groups.

[0030] "Hor o^dnose^and s^dabout ^gru^p -SR [0031] "Lower alkyl" alone or in combination means an alkane derived radical having from 1 to 6 carbon atoms (unless otherwise defined) which has a straight chain alkyl or branched alkyl. The straight chain or branched alkyl group is attached In many embodiments, the lower alkyl is a straight or branched alkyl group containing 1-6, 1-4, or 1-2 carbon atoms, such as methyl, ethyl, propyl, isopropyl, and the like. , substituted, lower alkyl, is lower alkyl which is independently substituted, unless otherwise indicated, with one or more, preferably 1, 2, 3, 4, or 5, also 1, 2, or 3 substituents attached to any available atom to form a stable compound,wherein the substituents are selected from the group consisting of -F, -OH, -NH2, -NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, -S (O) 2NH2, NHC11H^{2 -}NHC⁽S) NH²; ^-NHS⁽ABOUT^{) 2}NH² -C (NH) NH 2, -OR^about, -SR^about. ^-OC⁽O) R o '-OC (S) R o, -O (oC, -C (S) R^about, -c2 oro -c-oro-s (O) r^about, ^ (o ^ ro -c (O) nhr^about. ^-C⁽s) nhro C 6 -C 6 -C 10 NR 10 ^-S⁽O^{) 2}NHR0 (OHNR4-C (NH) NHR^about, -C (NH) NRPR^c. NHC (O) R^about, -NHC ^ K, NR^aboutC (O) R^about, NRT &amp; lt; 1 &amp; gt; ^-NR ° S⁽ABOUT^{) 2}R °^-

NHC (O) NHR °^-NHC (S) NHR <9> -NR <3> NH², -NR <3> NH², -NR ^^ NHRo ^-

NR &amp; lt; 1 &amp; gt; NH4 NH4 &amp; lt; &amp; apos; &amp; gt; ^-NHC⁽S⁾NO⁰R °^. -NR^aboutWHAT⁾NO^aboutR^about, -NR ^^ NRoRo NHS (O^{) 2}NHR^about. ^-NR ° S⁽ABOUT^{) 2}NH² -NR^aboutS (O^{) 2}NHR^about, -NHS ^ NRoR, ^-NR ° S⁽ABOUT^{) 2}NO^ABOUTR °^.NHRo-NR^aboutRo, -R^e, -Rf, and -Rg. Further, possible substitutions include subsets of these substitutions, such as those indicated herein, for example in the description of compounds of formula III, attached to any available atom to form a stable compound. For example, "fluoro substituted lower alkoxy" means a lower alkyl group substituted with one or more fluorine atoms, such as perfluoroalkyl, wherein preferably lower alkyl is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also with 1, 2 or 3 atoms Although substitutions are assumed to be attached to each atom available to form a stable compound when the optionally substituted alkyl is a group R such as -OR (e.g., alkoxy), -SR (e.g. thioalkyl), -NHR (e.g. alkylamino), -C (O) NHR and the like, the substitution of the alkyl group R is such that that substitution of an alkyl carbon bound to any of the O, S, or N residues (but not where N is a heteroaryl ring atom) excludes substituents which would result in an O, S, or N substituent (only not where N is a ring atom) heteroaryl) would be bound to an alkyl carbon bound to O, S, or N residues. "C 2-6 alkyl" means a lower alkyl group having 2-6 carbon atoms. "Substituted C 2-6 alkyl" means an optionally substituted lower alkyl group having 2-6 carbon atoms. "Substituted methyl" means a methyl that is independently substituted, unless otherwise indicated, with 1, 2, or 3 substituents, wherein the substituents are selected as an optionally substituted lower alkyl. which would result in that the O, S, or N substituent (only not where N is a heteroaryl ring atom) would be bound to the alkyl carbon associated with O, S, or N residues. "C 2-6 alkyl" means a lower alkyl group having 2-6 carbon atoms. "Substituted C 2-6 alkyl" means an optionally substituted lower alkyl group having 2-6 carbon atoms. "Substituted methyl" means a methyl that is independently substituted, unless otherwise indicated, with 1, 2, or 3 substituents, wherein the substituents are selected as an optionally substituted lower alkyl. which would result in that the O, S, or N substituent (only not where N is a heteroaryl ring atom) would be bound to the alkyl carbon associated with O, S, or N residues. "C 2-6 alkyl" means a lower alkyl group having 2-6 carbon atoms. "Substituted C 2-6 alkyl" means an optionally substituted lower alkyl group having 2-6 carbon atoms. "Substituted methyl" means a methyl that is independently substituted, unless otherwise indicated, with 1, 2, or 3 substituents, wherein the substituents are selected as an optionally substituted lower alkyl. is optionally substituted lower alkyl having 2-6 carbon atoms. "Substituted methyl" means a methyl that is independently substituted, unless otherwise indicated, with 1, 2, or 3 substituents, wherein the substituents are selected as an optionally substituted lower alkyl. is optionally substituted lower alkyl having 2-6 carbon atoms. "Substituted methyl" means a methyl that is independently substituted, unless otherwise indicated, with 1, 2, or 3 substituents, wherein the substituents are selected as an optionally substituted lower alkyl.

[0032] "Lower alkenyl" alone or in combination means a straight or branched hydrocarbon having 2-6 carbon atoms (unless specifically defined) and at least one, preferably 1-3, more preferably 1-2, most preferably one, double Carbon and carbon bonding The carbon / carbon double bonds may be contained either within a straight chain or branched portion. Examples of lower alkenyl groups include ethenyl, propenyl, isopropenyl, butenyl and the like. "Substituted lower alkenyl" means lower alkenyl which is independently substituted, unless otherwise indicated, one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents attached to any available atom to form a stable compound, wherein the substituents are selected from the group consisting of -F, -OH, -NH2, -NO2, -CN, -C (O) OH,-C (S) OH, -C (O) NH2, -C (S) NH2, s (O)²NH^{2 -}NHC (O) NH ^ ^-NHC (S) NH ^ ^-NHS (O)²nh ^ ^-C (NH) nH² oro ^-Sr ° OC (O) R °, ^-OC⁽s) ro -c (O) r °, ^-C⁽s) ro -c (O) or °, -c (S) or °, -s (O) r °, ^ (O)⁰. C⁽ABOUT⁾NHR0 -C (S) NHR⁰, -C (O) NR ° R⁰, -C (S) NR ° R °, ^-S⁽ABOUT^{) 2}NHR0 -S ^ NROC, C (NH) NHR⁰, -C (NH) NRpR^c, -NHC (O) R⁰, -NHC (S) R⁰, -NR ° C (O) R °, -NR ° C (S) R °, ^-NHS (O.R.⁰, -NR^aboutS (O)²R ° ^-NHC⁽ABOUT⁾NHR^ABOUT, -NHC (S) NHR⁰, -NR ° C (O) NH², -NR⁰C (S) NH². NO^aboutC (O) NHR °, -NR^aboutC (S) NHR °, -NHC (O) NR^aboutR °, -NHC (S) NR^aboutR °, -NR ° C (O) NR^aboutR °, NR ° C (S) NR ° R °, -NHS (O) 2 NH,, -N ° C (O) 2 NH 2, NR ° S (O) 2 NHRO, -NHS (O) 2 NR^aboutR ° ^No.°^s(^about) 2^NRO-^nhrO -NRTi⁰-^rd-^rf, and -^rg. Daley modi substitutions about^bejmuj^andsubsets of these substitutions, such as those indicated herein, e.g. in the description of compounds of formula III, attached to any available atom to form a stable compound. For example, "fluoro substituted lower alkenyl" means a lower alkenyl group substituted with one or more fluorine atoms, wherein preferably lower alkenyl is substituted with 1, 2, 3, 4 or 5 fluorine atoms, including 1, 2, or 3 fluoro atoms. the substitutions are attached to any available atom to form a stable compound, substitutions of alkenyl groups are such that -F, -C (O) -, C (S) -, -C (NH) -, -S (O ) -, -S (O) -2-, -O-, -S-, or N (only not where N is a heteroaryl ring atom), are not bound to their alkene carbon. Further, where alkenyl is a substituent of another a residue or group R of a residue such as -OR, -NHR, -C (O) R and the like, substitution of the residue is such that any of their -C (O) -, -C (S) -, -S (O) -, -S (O) 2, -0-, - S-, or N (but not where N is a heteroaryl ring atom) is not bonded to the alkene carbon of an alkenyl substituent or group R. Further, where alkenyl is a substituent of another R group or residue such as -OR, -NHR, C (O) NHR and the like, the substitution of the alkenyl group R is such that the substitution of alkenyl carbon bound to any of O, S, or N residues (only not where N is a heteroaryl ring atom) excludes substituents that would result in any O , S, or N substituent (only not where N is a heteroaryl ring atom) would be bound to an alkenyl carbon bound to S, or N residues. "Alkenyl carbon" refers to any carbon within an alkenyl group, either saturated or part of the carbon double bond with carbon. "Alkylene carbon" refers to any carbon within an alkenyl group that is part of a carbon double bond with carbon. [0033] "Lower alkynyl" alone or in combination means a straight or branched hydrocarbon

- 12 containing 2-6 carbon atoms (unless specifically defined) comprising at least one, preferably one, triple carbon-carbon bond. Examples of alkynyl groups include ethynyl, propynyl, butynyl and the like. "Substituted lower alkynyl" means lower alkynyl which is independently substituted, unless otherwise indicated, with one or more, preferably 1, 2, 3, 4 or 5, also with 1, 2, or 3 substituents attached to any available atom, to form a stable compound wherein the substituents are selected from the group consisting of -F, -OH, -NH2, -NO2, -CN, -C (O) OH, C (S) OH, -C (O) NH2, - C (S) NH2, -S (O) 2NH2, -NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, C (NH) NH². ^-OR &amp; lt; ^-SRo -OC ^ R ^ -OC (S) R °, ^-C⁽ABOUT⁾R^{about, -}C⁽S⁾R^about, -C (O) OR °, -C (S) OR °, S (O) R^about, (O) N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N, N- S ^^ NR &amp; lt; 9 &amp; gt; (NfflNHRo -C (NH) NRpR^c, -NHCOK, -NHC ^ K, -NR ^ OK, NR ^ S ^. ^-NHS⁽ABOUT^{) 2}ro ^-NR ° S⁽ABOUT^{) 2}R °^. -NHC &amp; lt; 1 &amp; gt; NHRo-NHC &amp; apos; NHRo-NR^aboutC (O) NH². NR ° C (S) NH², -NR &amp; lt; 1 &amp; gt; NHRo-NRC &amp; lt; 1 &amp; gt; NHRo -NHC &amp; lt; 1 &amp; gt; NR &amp; lt; EMI ID = 8.2 &amp; gt; ^-NHS⁽ABOUT^{) 2}NHRo ^-NO^aboutS⁽ABOUT^{) 2}NH^{2, -}NR ° S⁽ABOUT^{) 2}NHR °^.NHSCOhNR ^ ^-NR ° S⁽ABOUT^{) 2}NO^ABOUTR °^. ΑΊΙΚΌ -NRoro -R^{1, -}R^e and ^-R^g. Further,^canbadⁱⁿsubstitutions include subsets of these substitutions, such as those indicated herein, e.g. in the description of compounds of formula III, attached to any available atom to form a stable compound, e.g. "substituted lower alkynyl fluorine" means a lower alkynyl group substituted with one or more fluorine atoms, wherein preferably the lower alkynyl is substituted with 1,2,3, 4 or 5 fluorine atoms, also 1, 2, 3 fluoro .. Although it is understood that the substitutions are attached to any available atom to form a stable compound, substitutions of alkynyl groups are those that -F, C (O) -, -C (S) -, -C (NH) -, -S (O) -, -S (O) 2-, -O-, -S-, or N (only not where N is a heteroaryl ring atom), they are not related to their alkyne carbon.where alkynyl is a substituent of another R group or residue such as -OR, -NHR, -C (O) R and the like, the substitution of the residue is such that any of their -C (O) -, -C (S) -, - S (O) -, -S (O) 2, -O-, -S-, or N (only not where N is a heteroaryl ring atom) is not bonded to the alkyne alkynyl or R group carbon. alkynyl is a substituent of another R group or residue such as -OR, -NHR, -C (O) NHR and the like, the substitution of the R alkenyl group is such that substitution of alkynyl carbon bound to any O, S, or N residue (only no where N is a heteroaryl ring atom) excludes substituents which would result in any O, S, or N substituent (only not where N is a heteroaryl ring atom) being bound to the alkynyl carbon bound to S, or N residues."Alkynyl carbon" refers to any carbon within the alkynyl group, either saturated or part of the carbon-carbon triple bond. "Alkine carbon" refers to any carbon within the alkynyl group that is part of the triple carbon carbon bond.

[0034] "Cycloalkyl" refers to a saturated or unsaturated, non-aromatic monocyclic, bicyclic or tricyclic carbon ring system of 3-10, also 3-8, more preferably 3-6 ring members per ring, such as cyclopropyl, cyclopentyl, cyclohexyl , adamantyl and the like. "Substituted cycloalkyl" is a cycloalkyl,

Which is independently substituted, unless otherwise indicated, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents attached to any available atom to form a stable compound wherein the substituents they are selected from the group consisting of halogen, -OH, -NH2, -NT2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, - S (O) 2NH2, -NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, C (NH) NH2, -OR °, -SR °, -OC (O) R °, - OC (S) R °, -C (O) R °, -C (S) R °, -C (O) OR °, -C (S) OR °, S (O) R °, -S (O )₂R °, -C (O) NHR °, -C (S) NHR °, -C (O) NR R, -C (S) NR ° R °, -S (O)₂NHR °, S⁽ABOUT^{) 2}NR ° R °^. (NH) NH¹ -C (NH) NRPR^c. ^-NHC (O) R ^. -NHC (S) R °, -NR ° C (O) R °, NR ° C (S) R °, NHS (O) 2 R °, NR ° S (O) 2 R °, -NHC (O) NHR °, -NHC (S) NHR, -NR C (O) NH 2, NR ° C (S) NH 2, -NR ° C (O) NHR °, -NR ° C (S) NHR °, -NHC (O) NR R, NHC (S) NR R, NR C (O) NR R, - NR C (S) NR R, NHS (O) 2 NRH, -NR ° S (O) 2 NH 2, -NR S (O) 2 NH, NHS (O)²NR ° R \ ^-NR S (O) 2NR R ^-NHR \ ^-NR ° R \ -R^d. ^-R \ -R^f, and ^-R^g.

dihydropyridinyl, piperidinyl, pyrrolidinyl, pyrrolidonyl, piperazinyl, dihydrobenzofuryl and dihydroindolyl. "Substituted heterocycloalkyl" is heterocycloalkyl which is independently substituted, unless otherwise indicated, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents attached to any available atom to form a stable compound wherein the substituents are selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, -C (O) OH, -C (S) OH, C (O) NH2, -C (S) ) NH2, -S (O) 2NH2, -NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, -C (NH) NH preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents attached to any available atom to form a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH2, -NO2 , -CN, -C (O) OH, -C (S) OH, C (O) NH2, -C (S) NH2, -S (O) 2NH2, -NHC (O) NH2, -NHC (S) NH2. -NHS (O) 2 NH 2, -C (NH) NH preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents attached to any available atom to form a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH2, -NO2 , -CN, -C (O) OH, -C (S) OH, C (O) NH2, -C (S) NH2, -S (O) 2NH2, -NHC (O) NH2, -NHC (S) NH2. -NHS (O) 2 NH 2, -C (NH) NH₂, -OR °, -SR °, -OC (O) R °, -OC (S) R °, -C (O) R °, -C (S) R °, -C (O) OR °, - C (S) OR °, -S (O) R 8, S (O) 2 R 8, -C (O) NHR °, -C (S) NHR °, -C (O) NR R, -C (S ) NR ° R °, -S (O) 2 NRH, -S (O) 2 NR ° R, C (NH) NHR °, (NfflNRPRc) ^-NHC⁽ABOUT⁾R °^. -NHC (S) R °, -NR ° C (O) R °, NR ° C (S) R °, NHS (O) 2 R °, NR ° S (O) 2 R °, -NHC (O) NHR, -NHC (S) NHR, NR ° C (O) NH 2, -NR ° C (S) NH NR C (O ) NHR, -NR ° C (S) NHR °, -NHC (O) NR R, -NHC (S) NR R, -NR C (O) NR R, NR C (S) NR R, -NHS (O )₂NHR, -NR ° S (O) 2 NH 2, -NR ° S (O) 2 NRH, -NHS (O) 2 NR ° R °, NR ° S (O)²NR ° R °^. NI IR ^. -NR ° R °, ^-Rd -R^e, -R^f, and ^-R^g.

[0036] "Aryl" alone or in combination refers to a monocyclic or bicyclic ring system containing aromatic hydrocarbons, such as phenyl or naphthyl, which may optionally be linked to a cycloalkyl, containing preferably 5-7, more preferably 5-6 ring members. " Arylene "means divalent aryl. "Substituted aryl" means aryl which is independently substituted, unless otherwise indicated, one

- 14 or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents attached to any available atom to form a stable compound, wherein the substituents are selected from the group consisting of -OH, -NH2 , -NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, C (S) NH2, -s (O) 2NH2, -hhc (O) nh2, -hhc (S) nh2, -nhs (O) 2NH2, -c (nh) nh2, -or °, SR °, -OC (O) R °, -OC (S) R °, -C (O) R °, -C (S) R °, -C (O) OR °, -C (S) OR °, -S (O) R 8, -S (O) 2 R °, C (O) NHR °, -C ( S) NHR °, -C (O) NR 10 R 8, -C (S) NR 10 R 8, -S (O) 2 NRH, -S (O) 2 NR R °, C (NH) NHRP 2 ( NHiNRPRc ^-NHC (O) R ^. -NHC (S) R °, NR ° C (O) R °, NR ° C (S) R °, NHS (O) 2R °, -NR ° S (O) 2 R °, -NHC (O) NHR °, -NHC (S) NHR °, -R ° CC (O) NH 2, -NR ° C (S) NH 2 , -NR ° C (O) NHR °, -NR ° C (S) NHR °, NHC (O) NTRR °, -NHC (S) NR R, -NR C (O) NR R, NR C (S) NR R, -NHS (O)₂NHR, -NR ° S (O) 2 NH 2, -NR ° S (O) 2 NRH, -NHS (O) 2 NR ° R °, NR ° S (O)²NR ° R \ -NHRP ^-NR ° RP -R^d. ^-rh ^-R^f and ^-R^g. "P^aboutd^st^andand^{hey macaws}l^en"j^est with a divalent substituted aryl.

[0037] "Heteroaryl" alone or in combination refers to a monocyclic aromatic ring structure containing 5 or 6 ring atoms or a bicyclic aromatic group having 8 to 10 atoms, containing one or more, preferably

1-4, more preferably 1-3, even more preferably 1-2, heteroatoms independently selected from the group consisting of O, S, and N. Heteroaryl is also to have an oxidized S or N, such as a sulfinyl, a sulfonyl, and a tertiary N -oxide. ring nitrogen. The carbon or nitrogen atom is the point of attachment of the heteroaryl ring structure such that a stable compound is formed. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyridazinyl, pyrazinyl, quinoxalyl, indolizinyl, benzo [b] thienyl, quinazolinyl, purinyl, indolyl, quinolinyl, pyrimidinyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, thienyl, isoxazolyl, oxatiadiazolyl , isothiazolyl, tetrazolyl, imidazolyl, triazolyl, furanyl, benzofuryl and indolyl. "Nitrogen-containing heteroaryl" refers to a heteroaryl, wherein any of the heteroatoms is N.⁰, -CO3 NRpR⁰. ^-NHC⁽ABOUT⁾R °^.NHC (S) R °, NR ° C (O) R °, -NR ° C (S) R °, -NHS (O) 2 R °, -NR ° S (O) 2 R °, -NHC (O) NHR °, NHC (S) NHR, -NR C (O) NH₂, -NR ° C (S) NH 2, -NR ° C (O) NHR °, -NR ° C (S) NHR °, NHC (O) MR R, -NHC (S) NR R, -NR C (O ) NR R, -NR ° C (S) NR ° R °, -NHS (O) 2 NRH, NR ° S (O) 2 NH 2^-NR c S (O) 2 NHR °^-NHS (O) 2 NR ° R °^. NR c S (O) 2 NR ° R °^-NHR ^-NR ° R \ ^-rp R^c, -Rf, and -Rg. "Substituted heteroarylene" means a divalent substituted heteroaryl.

^[0038^] WITH^mand^enne R ° Rp Rh R^d, Rp R^f and R^g I^k used in^piOne hundred optional substituents for alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are defined as follows:

- 15 Each R °, R^pand R^cis selected independently from the group consisting of R^d'R^e, R^f and R^g or RP and Rc connected to the nitrogen to which they are attached to form

A 5-7 membered heterocycloalkyl or 5 or 7 membered heteroaryl containing nitrogen, wherein the 5-7 membered heterocycloalkyl or the 5 or 7 membered nitrogen heteroaryl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1 , 2, or 3 substituents selected from the group consisting of a halogen,

-WELL₂. ^-CN ^-OH ^-ΝΗ^{2 -}ORU ^-SR \ ^- NHRu ^-NO^atrk ^-Rk and -R^s;

each Rd is independently lower alkyl, wherein the lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also with 1, 2 or 3 substituents selected from the group consisting of fluorine, -OH, -NH₂, -NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, -S (O) 2NH2, -NHC (O) NH2, - NHC (S) NH 2, N 2 O 4 NH^{2 -}C (NH) NH2. -OR k,^-SRK ^-OC⁽O) Rk ^-OC⁽S) R ^-C (O) I &lt;k ^-C⁽S) R ^-C⁽ABOUT⁾OR k ^-C⁽S⁾OR k ^-S⁽ABOUT⁾Rk -S ^ Rk ^-C⁽ABOUT⁾NHRk ^-C (S) NI^R\ ^-C⁽ABOUT⁾NO^kRk -C (S) NRkRk, ^-S (O) 2 NH^R\ ^-S (()) 2 NR^kR\^- C (NH⁾NHRk ^-CWNR^mrk ^-NHC (O)^R\ NHC (S)^R\ ^-NRkC⁽O) Rk ^-NO^kC (S)^R\ ^-NHS (O) 2^R\ -NR^kS (O) 2Rk, NHC⁽O) NHR^{k -}NHC⁽S) NHRk ^-NO^kC⁽ABOUT⁾NH^{2, -}NO^kC⁽S⁾NH² -NR^kC (O) NHR^k, -NR^kC (S) NHR^k, NHC⁽ABOUT⁾NO^kRk NHC⁽S⁾NO^kR^kNR &amp; lt; 1 &amp; gt; NR &amp; lt; k &amp; gt; k^kC⁽S⁾NO^krk ^-NHS⁽ABOUT^{) 2}NHRk ^-NO^kS (O)²NH^{2, -}NO^kS (O)²NHRk ^-N IS (()) 2 NR^kR\ ^-NO^kS (())₂NO^kR\ ^-NH^R\NO^kRk -Ri and R^j; each R e is an independent lower alkenyl, wherein the lower alkenyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also with 1, 2 or 3 substituents selected from the group consisting of fluorine, -OH, -NH₂, -NO₂, -CN, -C (O) OH, -C (S) OH, -C (O) NH₂, -C (S) NH₂, -S (O)₂NH₂, -NHC (O) NH₂, -NHC (S) NH₂. ^-NHS⁽ABOUT⁾2NH2^-C⁽NH⁾NH2^-OR k ^-SRk -OC (O) R^k, -OC (S) R^k, -C (O) R^k. ^-C⁽S) R^k. ^- C⁽ABOUT⁾OR k ^-C⁽S⁾OR^{k -}S⁽O) R^k. ^-S⁽ABOUT⁾2Rk ^-C (O) NH^R\ ^-C⁽S⁾NHRk ^-C⁽ABOUT⁾NO^kR^k.

- C (S) NRkRk, -S (O)₂NHRk -S (O)₂NR k R k, -C (NH) NH^R\ -C (NH) NR^mK '. NHC (O) R k -NHC (S) R k, -NIR^kc(O) R \ -NR^kC (S) I &lt;k -NHS (O) 2 Rk, -NR^kS (()) 2^R\ _ NHC (O) NHRk -NHiaSNHRk-NR^kC (O) NH2, NR^kC (S) NH 2, NR^kC (O) NHR, -NR^kC (S) NHRk, -NHC (O) NR^kRk-NHC (S) NR^kRkNR^kC (O) NR^kRk-NR^kC (S) NR^kRkNHS (O)₂NHRk, - NrkS (O)₂NH₂, -NRkS (O)₂NHRk NHS (O)₂NRkRk, -NRkS (O) 2 NR^kRk -MHR^k- NRkRk -R^h, and -R 1;

Each R is an independent lower alkynyl, wherein the lower alkynyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also with 1, 2 or 3 substituents selected from the group consisting of fluorine, -OH, NH2, NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2-C (S) NH₂, -S (O) 2 NH 2, -NHC (O) NH 2, NHC (S) NH₂. ^-NHS⁽ABOUT^{) 2}NH² -C (NH) NH 2, ^-OR k ^-SRK ^-OC⁽O) Rk ^-OC⁽S) R WHAT)^R\ ^-C⁽S) Rk -C (O) ORk -C (S) OR.k -S (O) Rk ^^ °)) Rkk -C (O) THRkk C⁽S) NHRk ^-C⁽O) NR^kRk -C (S) NR^kR^kj -S (O) 2NHI^R\ -S (O)₂NO^kR^k -C (NH) NHRL^k.

- 16 -C (NH) NR^mRⁿ, -NHC (O) R^k, -NHC (S) R^k, NR^kC (O) R^k, -NR^k(S) R^k, NHS (O) 2R^k, -NRkS (O) 2Rk, -NHC (O) NHRk, -NHC (S) NHRk, -NR^kC (O) NH2, NRc⁽S) NH 2, ^-NO^kC⁽O) NHR^k. ^-NO^kC (S) NI IR^k. ^-NHC⁽O) NR^kR^k.^-

NHC⁽S⁾NO^kR^k.^-NO^kC⁽ABOUT⁾NO^kR^k.^-NO^kC⁽S⁾^^kR^k.^- NHS⁽ABOUT)²NHR^k.^-

NRkS (O) 2NH2, -NRkS (O) 2NHRk, -NHS (O) 2 NR^kRk, - NR^kS (O) 2 NR^kR^kand -NHR^{k -}N^kR^k. ^rh and -^rj; every R^g is independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl, where the cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, -C (O) OH, -C (S) OH, -C (O) NH2, -C (S) NH2, -S ( O) 2NH 2, NHC 2 NH 4 O 2 N 3 NH 3 -NHS (O) 2 NH 2, -C (NH) NH 2, -OR^k, -SR^k. ^-OC⁽ABOUT⁾Rl -OC (S) R^k, -C (O) R^k, -C (S) R^k, (O.R.¹, -C1, -OR2, Rk1 (O2 R) ^-C (O) NI IR^{1, -}C (S) NI IR^{1, -}C (O) NR^kR^k <RTI ID = 0.0> (NR & lt; / RTI & gt; R, & lt; / RTI & gt;¹, (NR & lt; 1 & gt; H, & lt; & quot; & gt; NHJNHR¹, ^ (NffjNRmen -NHC ^ R¹, NHC (S) R^k. ^-NO^kC ⁽O) R^k -No ^^ r¹, ms ^ r, -NR^kS (O⁾2R^k, -NHC & lt; 1 & gt; NHR¹,? NHC & lt; 1 & gt; NHR¹. ^-N^kkC⁽ABOUT⁾NH^{2, -}NO^kC⁽S⁾NH²NR.C ^ NHR¹, -NR^kC (S⁾NHR^k. ^-NHC⁽ABOUT⁾NO^kR^k NHC ^ NR.R. ^-NO^kC⁽O) NR^kRk-NR^kC (S) NR^kRk-NHS (O) 2 NRH, -NRkS (O) 2NH2, NR^kS (()) 2NI IR, NHS (O.⁾2NR^kR^k, -NRkS (O)₂NO^kRk, NHRk, -NR^kRk, -Rh, -r and -R; where R, Rm and Rn are in each case selected independently of the group consisting of^{Rh Rl} and R j or R m and R n in combination with the nitrogen to which they are attached to form a 5-7 ccellorcycloalkyl or 5 or 7 membered nitrogen heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered nitrogen-containing heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group ^sKL^andgive^ACEJ ^sand^from IHurinwcm - \ O₂. -CN, -OH-NH₂, OR ". -SR". NHR^at, - \ R "R".

-R \ and -^-C; wherein each Rh is independently lower alkyl optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of fluorine, -OH, -NH2, -NO2, - CN, -C (O) OH, -C (S) OH, C (O) NH2, -C (S) NH2, -S (O) 2NH2, -NHC (O) NH2, -NHC (S) NH2, -NHS (O) 2NH2, CiNHM ^-Orr ^-SRC ^-OC⁽ABOUT⁾R^c ^ C ^ R^-. ^-C⁽ABOUT⁾RC ^ (S ^ r ^-C⁽ABOUT⁾OR^rC 1 OR- -SOK-8 (O (R, -C (O) NHR ') -C (S) NIR -' / -C (O) NR^rR^r'-C (S) NR^rR^r. ^-S⁽ABOUT^{) 2}NHR^r ^ (O &amp; lt; 1 &amp; gt; NR &amp; lt; 3 &amp; gt;) (NHJNHRi. &amp; Lt; + &amp; gt ;, (N &amp; lt; 2 &amp; gt; ^-N IC (S) Rr NRUjO ^ r -NR ^ S ^, ^-NHS (O)₂R " ^-NO^rS⁽ABOUT^{) 2}R^{r, -}N IC (O) NI IRk ^-

NHC (S) NHRr NR^rC (O) 1Hd2, -2RR^rCS) NH2, -2RR^rC (ONHRr5, 'RCiCSMMIR'.

^-NHC (O) NR^rR^{r, -} NHC (S) NR^rR^r -NR ^ OJNRrRT-NR ^ SJNRCRr ^-

NHS (O)²NHRR ^-NO^cS (O)²NH^{2, -}NO^rS (O)²NHR^r NHS (O2₂NICR / nr ^ o ^ nrcr^-. ^-NHRr -nrcrc -r¹. ^{and -}F^j;

- 17 where every R¹ is independently selected from the group consisting of lower alkenyl and lower alkynyl, wherein lower alkenyl or lower alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluorine , -OH, -NH, -NO2, -CN, -C (O) OH, C (S) OH, -C (O) NH2, -C (S) NH2, -S (O) 2NH2, -NHC ( O) NH2, -NHC (S) NH2, NHS⁽ABOUT^{) 2}NH^{2, -}C (NH) NH², -OR^r, -SR^r, -OC⁽O) R^r, -OC⁽S) R^r, -C⁽O) R^r, -C1 R ', C 1 H 2 O 4 (R 3, R 2, R 2, R 2, R 2, NH 4, NH 4, N, R 2, R 6, R 3, R 2) (O &amp; apos; NHR &amp; apos ;, ^ (O ^ NRTR &amp; apos ;, ^-C (NH) NHR^r. ^-C⁽NH⁾NO^sR^t

OTąO ^ NHC ^ Rr ^-NO^rC (O) R^r. ^-NO^rC (S) R^r. ^-NHS (O^{) 2}R^r. ^-NO^rS⁽ABOUT^{) 2}R^{r, -}NHC (O) NHRR ^-NHC (S) NHRR ^-NO^rC (O) NH² NR ^^ NH ^ ^-NO^rC (O) NHRR NO^rC (S) NHRR ^-NHC (O) NR^rrr ^-NHC (S) NR^r<RTI ID = 0.0> Rt-NRf. </ RTI> NRTRt NRt ^ NRTRT NHi! SO) 2 NR^r, --RUSO ^ -HU, -2RS (O)₂2HI (NHS (O) 2 NR^rRr - l · Rr^rS (O22l · Rr^rR^r -NH Kg -2® * ^ ora j where every R^J is independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of

NHC (0) NR^rR^r nhs NHR ^^¹;

Halogen, -OH, -NH 2, -NO 2, -CN, -C (O) OH, -C (S) OH, -C (O) NH 2, -C (S) NH 2, S ^ NH^{2 -}NHC (0) NH2^-NHC (S) NH 2^- NHS (O) 2NH2^-C (NH) NH². ^-OR^r. ^-SR^r, ^ C ^ R ', ^-OC (S) R^r, K ^ Rr ^-C (S) R^r, ^ (O ^ R ', ^-C (S) OR^r. ^ (O ^ r ^-S⁽ABOUT⁾2R^{r -} C1-O-C ^ -C ^ -HR ^ -C ^ TRCR¹- -C ^ TRCR¹- -SCO ^ -HRC- -SCO ^ -aRC, ^-C (NH) NHRR ^-C (NH) NR^rrr ^-NHC (O) R^{r, -}NHC (S) R^{r, -}NO^rC (O) R^{r, -}

NR ^^ Rr -NHStO ^ R ', ^-NO^rS⁽0⁾2R^{r, -}NHC (O) NHR^r. ^-NHC (S) NHR^r, NR 1 -C 2 N 2 ^- -RI^rCS) NH [2 ^- -2R'C (O) 2 H (NRCC-S-Ha^-, NHCO 3, JRRr-2R'C (O) 2R'Rg-2R'C (S) 2R'R6 - RESCO ^ -HU ^^ 8 (0^{2, - -} thrC^- NH-S ^ bar^- NO^rS (0) 2 NR^rR^{r, -}NHRr NR^rRr. Cycloalcloamino, and

-Rg where every R^r, R^rand R^l in each case is independently selected from the group consisting of lower alkyl, C3.6 alkenyl, C3.6 alkynyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein the lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R^s, fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, di-alkylamino, and cycloalkylamino, however, assuring that none of the lower carbon substituents a^lkilu not in^{Still af}es^ut with ^withand^dn^sm O, - ^lat^{b N} from -0^rr-^SSR, -C (^ABOUT)^Orr -^C(S) 0^rr, Cl 2 NHR ', K 2 NHR 2, NRTR', ^-S (O^{) 2}NHR^r, ^ (O ^ NRTR ', ^-

C (NH) NHR^r, ^ C ^ R ', ^-NR'C (S) I (^ - (O ^ R ', ^ C ^ NHR', ^-

NHC (S) NHRR ^-2R'C (O) 2H₂. ^-2R'C (S) 2I (2R'C (O) 2IH ( ^-2R'C (S) 2HI ( ^-NHC (O) NR^rrr ^- NHC (S) NR^rR f -NRt ^ NRTRr -NRt ^ NRTRr ^-

NHS NHR ^^¹; ^-NO^rS (O) 2NH2^. NR / Ha ^ SCO¹; -2118 (0) 221 ((- 18 NR^rS (O) 2 NR^rR^r, -NHR^r, or -NR^rR^r is selected from the group consisting of fluorine and -R^s, and wherein C 3-6 alkenyl or C 3-6 alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, di-alkylamino, and cycloalkylamino, however, assuming that none of the C3.6 alkenyl or C3 carbon substitutions. 6 alkynyl does not bind ^sand^from with^andd^NYM ABOUT^. S^. or N ^{with -}ORO -SR^r, -C ^ OR ', ^-C⁽S) OR^r - C (O) NHRT^r, -C-NHRO ^-C⁽ABOUT⁾NO^rR^r'-C ^ NRORO-SO2 NHRd ^-S⁽ABOUT^{) 2}NO^rR^r C⁽NH⁾NHRO ^-NO^rC⁽ABOUT⁾R^r' ^-NO^rC⁽S⁾R^r' ^-NO^rS⁽ABOUT^{) 2}R^r NHC ^ NHRO ^-

NHC (S) MHRO ^-NO^rC (O) NH²'-NR <3> NH^{2 -}NO^rC (O) NHR^r' ^-NO^rC (S) NHR^r' NHC ^ NRTRO -NHC ^ NRORO -NROD ^ NRORO -NROD ^ NRORO ^-NHS (Q)²NHRO ^-NO^rS (O)²NH²' ^-NO^rS (O)²NHR^r'-NHS ^ NRORO ^-NO^rS (O)²NHR^rR^r' ^-NHRO or NR'Rr is selected from the group consisting of fluoro, lower alkyl, fluorine substituted lower alkyl, and -Ry, and where cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OR, -NH2, -NO2, -CN, lower alkyl, fluorine substituted lower alkyl, lower alkocycle, fluorine substituted lower alkoxy, lower alkylthio Halogen is lower than alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, or R^s and Rt in combination with the nitrogen to which they are attached form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen-containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered containing 1, 1, 1, 6, 6 and 3 are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -NO2, -CN, OH Alk OR '^{1, -}SR'u ^-NHRu ^-NO^atru ^-R^X' ^{and -}R^s;

wherein each R 1 is independently selected from the group consisting of lower alkyl, C 3-6 alkenyl, C 3-6 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein the lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -Ry 'fluorine, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, monoalkylamino, di-alkylamino , and cycloalkylamino, however, assuring that no substitution of a lower alkyl carbon is bound to Oof -OR ", S of -SR", or N of -NHRu is fluoro or -Ry, and where C3-6 alkenyl or C3-6 alkynyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -Ry,fluorine, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, diallylamino, and cycloalkylamino, however, assuming that no substitution of C 3-6 alkenyl or C 3-6 alkynyl carbon is not related to O with -OR^AT, S with -SR^AT, or N of -NHRu is fluorine, lower alkyl, substituted fluorine, lower alkyl, or -R^s, and where the cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, -NH2 - NO₂, -CN, lower alcal, fluoro substituted lower alkyl, lower alkoxy, lower alkoxy substituted substituent, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, di-alkylamino, and cycloalkylamino;

where every R^x is selected from the group consisting of lower alkyl, lower alkenyl and lower alkynyl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of from -Ry, fluorine, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, di-alkylamino, and cycloalkylamino, and where lower alkenyl or lower alkynyl are optionally substituted one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -R, fluoro, -OH, -NH2, lower alkyl, fluorine substituted lower alkyl, lower alkoxy; , fluoro substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio,mono-alkylamino, dialkylamino, and cycloalkylamino;

wherein each Ry is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein the cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, lower alkyl, fluorine substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, mono- alkylamino, di-alkylamino, and cycloalkylamino.

[0039] In some embodiments, in all cases the optionally substituted lower alkyl, the optionally substituted C2-6 alkyl, the optionally substituted lower alkenyl, or the optionally substituted lower alkynyl are optionally substituted with one or more, also 1, 2, or 3 groups or substituents^ybwounds^sm^and with ^gru^p s^KLand^doh^andc^sc^h s^ut from fluorine^. -NO, -CN, -O^rU-^sr .la

-OC (S) R, -C (O) R^ul, -C (S) R^XS (O) 2 NR^laR¹a, -C (NH) NR^laR¹

-C (O) OR, -C (S) OR 1a, -C (O) NR 1^andR ^-NO^1aR^1a

OC⁽O) RC (S) NR1^andR la

NO^1aC⁽ABOUT⁾NO^1aR¹.

-NR ^ C ^ NR ^¹.

-NR1aC (O) Rla

-NO. 1^andC (S) R 1a,

-NR1aS (O)₂1a,

-NR ^ S ^ R ^ NR¹. ^-S⁽O) R la

-S (O)²R 1a cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also with 1, 2 or 3 groups, or

- substituents selected from the group consisting of halogen, -NO2, -CN, -OR^la, -SR^la.

NO^1aR^1a. ^-OC (O) R¹8 ^-OC (S) R2¹8 ^-C (O) R¹8 ^-C (S) R¹8 ^-C (O) OR¹8 ^-C (S) OR¹8 ^-

C (O) NR^1aR¹8 ^-C⁽S⁾NO^1aR¹8 -S (O)₂NO^1aR^1a, -C (NH) -NR^1aR^1a, -NR^1aC (O) R^1a. ^-

NO^1aC (S) R^1a, -NR &amp; lt; N &amp; gt; R¹. ^-NO^1aC⁽ABOUT⁾NO^1aBR¹8-NR2C16NR3¹. ^-^NR^1AS(^ABOUT) 2^NR^1aR18 -^s(^about)^r18 -^S(^ABOUT) 2^1a -R^lb. ^and mższe^go. alkyl^pcjonalme ^pabout^ds^tand^andthey^gwith one or more, also with 1, 2 or 3 groups or substituents selected from the group consisting of fluorine, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, monoalkylamino, dialkylamino, and - R¹and in all cases of an optionally substituted heterocycloalkyl, an optionally substituted 5-7 membered heterocycloalkyl, an optionally substituted aryl, an optionally substituted arylene, an optionally substituted heteroaryl, an optionally substituted heteroarylene or an optionally substituted 5 or 7 membered nitrogen heteroaryl are optionally substituted with one or more, also 1, 2, or 3 groups or substituents selected from ^gru^p skla^doh^andc^sc^h s^ut with ^fluorowca^. -NO ^ -CN, -^OR18 -^SRa, -N^RlaRl8- ^oc(^about)^r18 OC⁽S⁾R¹8 ^-C⁽ABOUT⁾R¹and -C (S) R^1a. ^-C⁽ABOUT⁾OR¹8 ^-C⁽S⁾OR¹8 ^-C⁽ABOUT⁾NO^1aR¹8 ^-C⁽S⁾NO^1aR¹8 S⁽ABOUT^{) 2}NO^1aR¹8 ^-C⁽NH⁾NO^1aR¹8 ^-NO^1aC⁽ABOUT⁾R¹8 ^-NO^1aC⁽S) R^la -NR^1aS (O)₂R^1a. ^-

NO^1aC⁽ABOUT⁾NO^1aR¹8 ^-NO^1aC⁽S⁾NO^1aR¹8 ^-NO^1aS⁽ABOUT^{) 2}NO^1aR¹8 ^-S⁽ABOUT⁾R¹8 -S (O)²R^1a, -R^lb. ^and lower alkyl optionally substituted with one or more, also with 1, 2 or 3 groups or substituents selected from the group consisting of fluorine, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, mono-alkylamino , di-alkylamino, and -R¹^ where R^at is selected from the group consisting of hydrogen, but with the assurance that hydrogen is not ^{with in}and^{related to} with^andd^from C (S), C (O), S (O), or S⁽ABOUT)^{2nd o}f ^-OC⁽ABOUT⁾R¹8 ^-OC⁽S⁾R¹8 ^-C⁽ABOUT⁾R¹8 C⁽S⁾R¹8 ^-NTR^1aC⁽ABOUT⁾R¹8 ^-NO^1aC⁽S⁾R¹8 ^-NO^1aS⁽ABOUT^{) 2}R¹8 ^-S⁽ABOUT⁾R¹8 or -S (O)₂R^1a, -R^lb. ^and lower alkyl optionally substituted with one or more, also with 1, 2 or 3 groups or substituents selected from the group consisting of fluorine, -OH, NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -R¹however, while ensuring that no substitution of an alkyl carbon is associated with O, S, or N of -OR^AT, -SR^AT, -NR <R>, ^-C⁽O) OR^{1a -}C⁽S⁾OR¹8 ^-C⁽ABOUT⁾NO^laR¹8 ^-C⁽S⁾NO^1aR¹8 -S (O) 2 NR^1aR^1a. ^-C⁽NH⁾NO^1aR¹8 NO^1aC⁽ABOUT⁾R¹8-NR^1aC (S) R^1a. ^-NO^1aS⁽ABOUT^{) 2}R¹8 ^-NO^1aC⁽ABOUT⁾NO^1aR¹8 ^-NO^1aC⁽S⁾NO^1aR¹8 or N^Rlas(^ABOUT)²N^RlaRla, thi^t fluorine ^lat^b -^Rib, and ^gday -^Rib is: you^bwounds^s with ^gru^py s^KLand^doh^andfrom cycloalkyl, heterocycloalkyl, aryl and heteroaryl, where the cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also with 1,2 or 3 groups or substituents selected from the group consisting of halogen, -CN, -OH, - NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluorine-substituted alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino.

[0040] In some embodiments, in all cases the optionally substituted lower alkyl, the optionally substituted C2-6 alkyl, the optionally substituted lower alkenyl, or the optionally substituted lower alkynyl are

Optionally substituted with one or more, also with 1, 2 or 3 groups or substituents selected from ^gru^py s^kla^dwhich s^ut from fluoro^. -CN, -OR¹^ -SR¹^ -NR.¹'¹!!¹'¹ -C (O) R^1a C (S) R¹P ^-C⁽ABOUT⁾OR¹P ^-C⁽ABOUT⁾NO^1aR¹and ^-C⁽S⁾NO^1aR¹P-SCO ^ NR ^ R¹* ^-NO^1aC⁽ABOUT⁾R¹P NO^1aC⁽S⁾R¹P ^-NO^1aS⁽ABOUT^{) 2}R¹and ^-S⁽ABOUT⁾R¹P ^-S⁽ABOUT^{) 2}R¹Cycloalkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also with 1, 2 or 3 groups or substituents selected from the group ^sKL^andgive^ących ^sand^{of -}CN ^-OR¹P ^-SR¹P ^-NO^1aR¹P ^-C⁽ABOUT⁾R¹P ^-C⁽S⁾R¹P ^-C⁽ABOUT⁾OR¹P ^-C⁽ABOUT⁾NO^1aR¹P -C (S) NR^1aR^1a -S (O)²NO^1aR^1a. ^-NO^1aC⁽ABOUT⁾R¹P ^-NO^1aC⁽S⁾R¹P ^-NO^1aS⁽ABOUT^{) 2}R^1a,-S (O) R 1a, -S (O) 2 R 1a, -R^lb, and lower alkyl optionally substituted with one or more, also with 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, mono -alkylamino, di-alkylamino, and -R¹and in all cases of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted 5-7 membered heterocycloalkyl, optionally substituted aryl, optionally substituted arylene, optionally substituted heteroaryl, optionally substituted heteroarylene, or optionally substituted 5 or 7 membered nitrogen containing heteroaryl are optionally substituted one or more, also 1, 2, or 3 groups or substituents in^ybwounds^sm^and with ^gru^py skia^doh^ands p^ut from halogen - cain -0R.^1a-^sr1P-NR ^ R¹'¹ -^c(^about)^r1PC⁽S⁾R¹P ^-C⁽ABOUT⁾OR¹P ^-C⁽ABOUT⁾NO^1aR¹P ^-C⁽S⁾NO^1aR¹P ^-S⁽ABOUT^{) 2}NO^1aR¹P ^-NO^1aC⁽ABOUT⁾R¹P NO^1aC⁽S⁾R¹P ^-NO^1aS⁽ABOUT^{) 2}R¹P ^-S⁽ABOUT⁾R¹P -S (O) 2R^1a, -R^lb, and ⁿthat^Regu alkyl ^opc^jonalm^esubstituted with one or more, also with 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluorine substituted lower alkylthio, monoalkylamino, di-alkylamino, and -R¹^ where R^at is selected from the group consisting of hydrogen, but with the proviso that the hydrogen is not connected to any of C (S), C (O), S⁽0⁾ or S⁽0)^{2nd o}f ^-C⁽ABOUT⁾R¹P ^-C⁽S) R^{1 -}NO^1aC⁽ABOUT⁾R¹P ^-NO^1aC⁽S⁾R¹P ^-NO^1aS⁽ABOUT^{) 2}R¹P S (O) R1a, or -S (O) 2R1a, -R^Lb, and lower alkyl optionally substituted with one or more, also with 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, OH, NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono- alkylamino, di-alkylamino, and -R¹however, while ensuring that none of the alkyl carbon substitutions is associated with O, S, or N ^{with -}OR¹P ^-SR \ ^-NO^1aR¹P ^-C⁽ABOUT⁾OR¹P ^-C⁽ABOUT⁾NO^1aR¹P ^-C⁽S⁾NO^1aR¹P -S ^ NR ^ R¹* NO^1aC⁽ABOUT⁾R¹P ^-NO^1aC⁽S⁾R¹P or ^-NO^1aS⁽ABOUT^{) 2}R¹P ^thit fl^uorem or -R^lb. ^{and g}d^withand^{e -}R^{lb is}t selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl, where the cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also with 1, 2 or 3 groups or substituents selected from the group consisting of halogen, -CN, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, dialkylamino, and cycloalkylamino.

[0041] "Lower alkoxy" means a group -OR^WITHwhere R^with it is lower alkyl. "Substituted

"Lower alkoxy" means lower alkoxy, in which R^with is lower alkyl substituted with one or more substituents as indicated herein, e.g. in the description of compounds of formula III, containing descriptions of substituted cycloalkyl, cycloheteroalkyl, aryl and heteroaryl, attached to any available atom to form a stable compound. Preferably, the lower alkoxy substitution is 1, 2, 3, 4, or 5 substituents, also 1, 2, or 3 substituents. For example, "substituted fluoro lower alkoxy" means lower alkoxy wherein lower alkyl is substituted with one or more fluorine atoms, wherein preferably lower alkoxy is substituted with 1, 2, 3, 4 or 5 fluorine atoms, including 1, 2, or 3 fluorine atoms Although it is understood that alkoxy substitutions are attached to any available atom to form a stable compound, the alkoxy substitution is such that O, S,

[0042] "Lower alkylthio" means a -SR group^aawhere R^aa it is lower alkyl. "Substituted lower alkylthio" means a lower alkylthio in which Raa is lower alkyl substituted with one or more substituents as indicated herein, for example in the description of compounds of formula 11I containing descriptions of substituted cycloalkyl, cycloheteroalkyl, aryl and heteroaryl, attached to any available atom, to form a stable compound Preferably, the substitution of lower alkylthio occurs with 1, 2, 3, 4, or 5 substituents, also with 1, 2, or 3 substituents. For example, "fluoro substituted lower alkylthio" means lower alkylthio wherein lower alkyl is substituted with one or more fluorine atoms, wherein preferably lower alkylthio is substituted with 1, 2, 3, 4 or 5 fluorine atoms, also with 1, 2 or 3 fluoro atoms. Although it is understandable that alkylthio substitutions are attached to any available atom to form a stable compound, the alkylthio substitution is such that O, S, or N (only not where N is a heteroaryl ring atom) are not attached to the alkyl carbon attached to the S alkylthio. Further, where the alkylthio is described as a substituent of another residue, the alkylthio sulfur is not bonded to a carbon atom that is linked to O, S, or N other residue (only not where N is a heteroaryl ring atom), or to an alkene carbon or the alkyne of another residue.

[0043] "Amino" or "amine" means a -NH2 group. "Mono-alkylamino" means an NHR group^bb where ^rbb means lower a^lkil. "H-aHdoammo" means^gru^Pe -NR R⁰⁰where K^bb and R^cc means independently lower alkyl. "Cycloalkylamino" means a -NR group^ddR^eewhere R^dd and R^ee in combination with nitrogen to form a 5-7 membered heterocycloalkyl, wherein the heterocycloalkyl may contain additional heteroatom within the ring, such as O, N, or S, and may also be further substituted with lower alkyl. Examples of 5-7 membered heterocycloalkyl include, but are not limited to, piperidine, piperazine, 4-methylpiperazine, morpholine and thiomorpholine. Although it is understood that when monoalkylamino, dialkylamino, or cycloalkylamino are substituents of other residues that are attached to any available atom to form a stable compound, nitrogen

Mono-alkylamino, di-alkylamino, or cycloalkylamino substituents are not bound to a carbon atom that is bonded to O, S, or N other.

and silanyl containing groups such as 2-trimethylsilylethoxymethyl, t-butyldimethylsilyl, triisopropylsilyl, and the like. Other suitable nitrogen protecting groups can be found in documents such as TW Greene &amp; PGM Wuts, Protective Groups in Organic Synthesis, John Wiley &amp; Sons, 1991.

[0045] As used herein, the term "composition" refers to a formula suitable for administration to an intended animal subject for therapeutic purposes that comprises at least one pharmaceutically active compound and at least one pharmaceutically acceptable carrier or excipient.

[0046] The term "pharmaceutically acceptable" indicates that the material indicated does not have the properties that would cause a reasonably prudent physician to avoid giving the material to the patient, taking into account the disease or conditions being treated and the appropriate route of administration. the material was essentially sterile, e.g. for injection.

In the present context, the term "therapeutically effective" or "effective amount" indicates that the material or amount of material is effective to prevent, reduce, or ameliorate one or more of the symptoms of the disease or medical condition, and / or extend the survival of the subject entity.

In the present context, the terms "synergistically effective" or "synergistic effect" indicate that two or more compounds that are therapeutically effective when used in combination provide improved therapeutic effect greater than the combined effect that would be expected based on the operation of a particular compound used alone.

[0049] As used herein, the terms "ligand" and "modulator" are used equivalently to indicate that a compound that alters (i.e., increases or decreases) the activity of a target biomolecule, e.g. an enzyme such as a kinase. In general, the ligand or modulator will be a small molecule, where "the small molecule refers to a compound with a molecular weight of 1500 daltons or less, or preferably 1000 daltons or less, 8 daltons or less, or 600 daltons or less. Thus, "improved ligand" means one that

- 24 which has better pharmacological and / or pharmacokinetic properties than the reference compound, where "better" can be defined by a person with skills in the relevant field for a particular biological system or therapeutic application.

[0050] The term "binds" in combination with the interaction between a target and a potential binding compound indicates that the candidate binding compound combines with the target to a statistically significant extent compared to binding generally to proteins (e.g., non-specific binding). "Binding compound" refers to a compound that has a statistically significant affinity for the target molecule Preferably the binding compound interacts with a specific target with a dissociation constant (KD) of 1 mM or less, 1 mM or less, 100 nm or less, 10 nm or less, or 1nM or less.

In the context of binding compounds to a target, the terms "greater affinity" and "selective" indicate that the compound binds more closely than the reference compound, or rather than the compound itself at the reference conditions, i.e. with the lower dissociation constant. In some embodiments, the higher affinity is at least 2, 3, 4, 5, 8, 10, 50, 100, 200, 400, 500, 1000, or 10,000-fold higher affinity.

[0052] As used herein in connection with the compounds of the invention, the term "synthesizing" and like terms mean chemical synthesis from one or more precursor materials. Further, by "testing" is meant the formation of experimental conditions and the collection of data with respect to a particular result under conditions experimental. For example, enzymes can be tested based on their ability to act on a detectable substrate. The compound or ligand can be tested based on its ability to bind to a particular target molecule or molecules.

[0053] As used herein, the term "modulating" or "modulating" refers to effecting a change in biological activity, in particular a biological activity associated with a particular biomolecule, such as a protein kinase. For example, an agonist or antagonist of a particular biomolecule modulates the activity of this biomolecule, e.g. the enzyme, or by raising (e.g., agonist, activator), or reducing (e.g., antagonist, inhibitor) the activity of a biomolecule, such as an enzyme. Such activity is typically indicated under conditions of inhibitory concentration (IC 50) or the excitatory concentration (EC 50) of the compound for the inhibitor or activator, respectively, including, for example, the enzyme.

[0054] In the context of using, testing or screening compounds that are or may be modulators, the term "contacting" means that the compound (i) is subjected to a sufficiently close proximity to a particular molecule, complex, cell, tissue, organism or other a particular material so that potentially binding interactions and / or chemical reactions between the compound and other specific material can occur.

[0055] As used herein in connection with an amino acid or nucleic acid sequence, the term "isolate" indicates that this sequence is separated from at

- the least part of the amino acid and / or nucleic acid sequence with which it would normally be associated.

[0056] In combination with an amino acid or nucleic sequence, the term "purified" indicates that the subject molecule contains a significantly higher proportion of the biomolecule in the composition than the proportion observed in the previous composition, e.g. in cell culture. The greater proportion can be 2-fold, 5-fold fold, 10 times, or more than 10 times, taking into account the proportion found in the previous composition.

I. General The present invention relates to compounds of formula IIIm and all subsets of formulas that are protein kinase modulators, e.g. without limitation, compounds being modulators of at least one of the kinases selected from the group consisting of Abl, Akt1, Akt2, Akt3, ALK, Alk5, B-Raf, Brk, Btk, Cdk2, CDK4, CDK5, CDK6, CHK1, c-RafI, Csk, EGFR, EphA1, EphA2, EphB2, EphB4, Erk2, Fak, FGFR1, FGFR2, FGFR3, FGFR4, Flt1, Flt3, Flt4, Fms, Frk, Fyn, Gsk3a, Gsk33, HCK, Her2 / Erbb2, Her4 / Erbb4, IGF1R, IKK beta, Irak4, Itk, Jak1, Jak2, Jack3, fnk1, Jnk2, Jnk3, Kdr, Kit , LCK, MAP2K1, MAP2K2, MAP4K4, MAPKAPK2, Met, Mnk1, MLK1, p38, PDGFRA, PDGFRB, PDPK1, Pim1, Pim2, Pim3, PKC alpha, PKC beta, PKCeta, Plk1, Pyk2, Ret, ROCK1, ROCK2, Ron, Src, Stk6, Syk, TEC, Tie2, TrkA, Yes, and Zap70, and the use of such compounds in the treatment of diseases and conditions.

II. Target Kinases and Indications of the Invention [0058] Protein kinases play a role in the propagation of biochemical signals in various biological pathways. Over 500 kinases have been described, and specific kinases have been involved in a wide range of diseases and conditions (i.e., indications), including without limitation, in cancer, cardiovascular disease, inflammatory disease, neurological disease and other diseases. As such, kinases represent important control points for therapeutic interventions on small molecules. A description of the specific protein kinases contemplated by the present invention follows:

[0059] B-Raf: Target B-Raf kinase (i.e. B1 homologue of a murine oncogene viral sarcoma v-raf) is 84.4 kDa serine / threonine kinase encoded on chromosome 7q34 (symbol: BRAF). The mature protein contains the RBD domains (i.e., the Ras binding domain), Cl (i.e., conserved protein kinase C region) and STK (i.e., serine / threonine kinase).

[0060] Target B-Raf kinase is involved in the transduction of mitogenic signals from the cell membrane into the nucleus and may play a role in postsynaptic responses of hippocampal neurons. As such, RAP family genes encode kinases that are regulated by Ras and mediate cellular responses to growth signals. Indeed, B-Raf kinase is a key compound of the RAS-> Raf-> MEK-> ERK / MAP kinase signaling pathway, which plays a fundamental role in the regulation of cell growth, division and proliferation, and when constitutively activated induces the genesis of tumors. Among several isoforms

Raf kinase, type B, or B-Raf, is the strongest activator of further MAP kinase signaling.

[0061] The BRAF gene is often mutated in various human tumors, especially in malignant melanoma and colon cancer. The most frequently reported mutation was the change in the sense of thymine (T) to adenine (A) in nucleotide 1796 (T1796A, the amino acid change in the B-Raf protein is Val <600> on Glu <600>) observed in 80% of malignant melanoma tumors. Functional analysis reveals that transversion is the only detected mutation that causes constitutive activation of B-Raf kinase activity, independent of RAS activation, by converting B-Raf into a dominant transforming protein.

[0062] Niihori et al. Reported that in 43 people with cardio-facial skin syndrome (CFC), they identified two heterozygous KRAS mutations in three subjects and eight BRAF mutations in 16 subjects, indicating that dysregulation of the RAS-RAF pathway -ERK is the common molecular basis for these three related disorders (Niihori et al., Nat Genet. 2006, 38 (3): 294-6).

[0063] B-Raf inhibitors may be useful in the treatment of neurological diseases such as ischemic stroke, multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson's disease; neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, carcinoma (eg lung, pancreas, kidney cancer), lymphoma (e.g. histiocytic lymphoma) and thyroid cancer, lungs (e.g. small cell lung cancer), liver, breast , ovary and colon, neurofibromatosis, myelodysplastic syndrome, leukemia, tumor angiogenesis; pain of neuropathic or inflammatory origin, including acute pain, chronic pain and migraine; cardiovascular diseases including myocardial infarction, cardiac hypertrophy, thrombosis (e.g. thrombotic microangiopathy syndromes), atherosclerosis, reperfusion injury; inflammation including, but not limited to, psoriasis, polycystic kidney disease (PKD), arthritis and autoimmune diseases and conditions, osteoarthritis, scarring endometriosis, vascular restenosis, fibrosis, rheumatoid arthritis, inflammatory bowel disease (IBD); immunodeficiency diseases, graft rejection, graft-versus-host disease, kidney or prostate disease, including diabetic nephropathy, nephrosklerosis, glomerulonephritis, prostatic hypertrophy, metabolic disorders, obesity; infections, including, but not limited to Helicobacter pylori and influenza virus, fever, sepsis; lung diseases including chronic obstructive pulmonary disease (COPD) and acute respiratory distress syndrome (ARDS); genetic development diseases, such as Noonana syndrome, Costello syndrome (facial-cutaneous and skeletal syndrome), Leopard's syndrome,

[0064] c-Raf-1: the target c-Raf-1 kinase (e.g., the murine oncogene viral sarcoma v-raf 1) is 73.0 kDa STK encoded on chromosome 3p25 (symbol: RAF1). cRaf-1 can be targeted to the mitochondria via BCL2 (e.g., cell leukemia oncogene

- 27 B 2) which is the regulator of apoptotic cell death. Active c-Raf-1 improves BCL2 mediated resistance to apoptosis, and c-Raf-1 phosphorylates BAD (ie, BCL2 binding protein). c-Raf-1 is involved in cancer, including colon, ovarian, lung and renal cell carcinoma. C-Raf-1 is also involved as an important mediator of tumor angiogenesis (Hood, JD et al., 2002, Science 296, 2404). C-Raf-1 inhibitors may be useful in the treatment of acute myeloid leukemia and myelodysplastic syndromes (Crump, Curr Pharm Des 2002, 8 (25): 2243-8). Raf-1 activators may be useful in the treatment of neuroendocrine tumors such as medullary thyroid carcinoma, carcinoid cancer, small cell carcinoma and pheochromocytoma (Kunnimalaiya et al., Anticancer Drugs 2001, 17 (2): 139-42). C-Raf 1 inhibitors may be useful in the treatment of colorectal cancer, ovarian cancer,

III. Binding Assays [0065] The processes of the present invention may include assays that are capable of detecting the binding of compounds to the target molecule. Such binding is at a statistically significant level, preferably with a confidence level of at least 90%, more preferably at least 95.97, 98, 99% or greater confidence that the assay signals are binding to the target molecule, e.g. differentiating from the background. Preferably, controls are used to distinguish target binding from non-specific binding. The large variety of binding assays is known from various target types and can be used for this invention.

[0066] Binding of compounds can also be characterized by their action on the activity of the target molecule. The compounds of the present invention may be tested for a particular kinase to assess the inhibitory concentration (IC 50) or the excitatory concentration (EC 50) of the compound with respect to this kinase. The IC 50 (or EC 50) is defined as the concentration of a compound at which 50% of the activity of the measured activity of the target kinase is lost (or obtained) relative to activity when no compound is present. Activity can be measured using methods known to those with ordinary skill in the art, e.g., by measuring any detectable product or signal produced by the emergence of an enzymatic reaction or other activity of the protein being measured. The compounds will have an IC 50 or EC 50 of less than 10 μΜ,

By &amp; quot; background signal &amp; quot; in reference to a binding assay is meant a signal that is recorded under standard conditions for a particular assay in the absence of a test compound, molecular scaffold, or ligand that binds to the target molecule. they realize that there are accepted methods and that they are widely available to determine the background signal.

[0068] By "standard deviation" is meant the square root of the variance.

- 28 The variance is a measure of how the distribution is distributed. It is calculated as the mean deviation square for each number from its mean. For example, for numbers 1, 2 and 3, the average is 2, and the variance is:

and² = (1-2)² + (2-2) * + (3--2) * = 0.667.

IV. Kinase assays [0069] A variety of different kinase activity assays can be used to test active modulators and / or determine the modulator specificity for a particular kinase or group of kinases. In addition to the test mentioned in the Examples below, a person with ordinary skill in the art will be familiar with other tests that may be used and may modify the test for a particular application. For example, many kinase documents describe tests that can be used.

[0070] Additional alternative tests may use the determination of binding. For example, this type of test can be formatted either in the fluorescence resonance energy transfer (FRET) format, or using the AlphaScreen format (homogeneous test for amplified luminescence proximity) by varying donor and acceptor reagents that are attached to streptavidin or to a specific anti-phosphorylated antibody protein.

V. Organic Synthetic Techniques [0071] The versatility of computer-assisted modulator design and identification lies in the diversity of structures imaged by computer programs. Computer programs can search databases that contain a very large number of molecules and can modify modulators already coupled with the enzyme with very diverse chemical function groups. The consequence of this chemical diversity is that the potential modulator of the kinase function can take a chemical form that is unpredictable. In the field, there is extensive testing of organic synthesis techniques to address the challenges of constructing these potential modulators. Many of these organic synthesis processes are described in detail in standard reference sources used by people with skill in the art. An example of such reference is March, 1994, Advanced Organic Chemistry: Reactions, Mechanisms and Structure, New York, and McGraw Hill. Thus, techniques useful for synthesizing a potential kinase function modulator identified by computer-assisted methods are readily available to those skilled in the art of chemical organic synthesis.

[0072] With regard to the synthesis examples described herein, the solvents include polar and non-polar solvents known to those skilled in the art, including polar proton and polar protic solvents. Polar solvents including, without

- limiting, protic solvents such as methanol, ethanol, isopropyl alcohol, t-butanol, n-butanol, acetic acid, formic acid or water or non-protic solvents such as tetrahydrofuran (THF), acetonitrile, dioxane, methylene chloride, dimethylsulfoxide (DMSO) , acetone, N, N-dimethylformamide (DMF), N, N-dimethylacetamide (DMA), ethyl acetate, 1,2-dimethoxyethane, 1,2-dichloroethane, chloroform, 1,2-dichloroethane or pyridine. The polar solvents contain a mixture of water with any of the above or a mixture of any two or more of the foregoing. Non-polar solvents including, without limitation, toluene, benzene, chlorobenzene, xylenes and hexanes.

[0073] Regarding the synthesis examples described here, reducing agents include, without limitation, reducing substances such as catalytic reducing substances using hydrogen transition metal catalysts such as palladium, platinum, rhodium, etc. (e.g., Pt / acetic acid / H2) ; a mixture of trifluoroacetic acid and triethylsilane, borane-tetrahydrofuran complex, diborane, borane-dimethylsulphide complex, and a combination of sodium borohydride and boron trifluoride; metals such as reduced iron, zinc powder, magnesium etc .; metal-hydrogen complex compounds such as organic metal borohydrides (e.g. potassium borohydride, sodium borohydride, lithium borohydride, zinc borohydride, sodium triacetoxyborohydride, etc.), lithium aluminum hydride, etc .; metal hydrides such as sodium hydride, etc .; organic tin compounds (triphenyl tin hydride, etc.);

[0074] Regarding the synthesis examples described herein, oxidizing materials, including, without limitation, oxidizing agents such as Dess-Martin reagent, TEMPO (N-oxide)

2,2,6,6-tetramethylpiperidine), DDQ (2,3-dichloro-5,6-dicyano-1,4-benzoquinone), PDC (pyridinium dichromate), PCC (pyridine chlorochromate), pyridine, SO3, chromium trioxide , p-nitronadbenzoic acid, magnesium monoperoxyphthalate, sodium periodate, potassium periodate, hydrogen peroxide, urea peroxide, alkali metal bromides, cumene hydroperoxide, tert-butyl peroxide, peracids such as performic acid, peracetic acid, pertrifluoroacetic acid, perbenzoic acid, m-acid -chloroperbenzoic acid, oxcarbenzene benzoic acid and the like; sodium metaperiodate, dichromic acid; dichromates such as sodium dichromate, potassium dichromate; permanganic acid; permanganates such as potassium permanganate, sodium permanganate; and lead salts, such as lead tetraacetate.

VI. A compound of the compounds A compound or derivative form [0075] The compounds contemplated herein are described with references to both generic and specific compounds. In addition, the compounds of the invention may exist as many different forms or derivatives. These include, for example, tautomers, stereoisomers, racemic mixtures, regioisomers, salts, prodrugs (e.g., carboxylic acid esters), solvated forms, various crystalline or polymorphic forms, and active metabolites

- 30 (a) Tautomers, Stereoisomers, Regioisomers, and Solvated Kranes [0076] It is understood that some compounds may exhibit tautomerism. In such cases, the formulas provided here clearly show only one of the possible tautomeric forms. It is understood, therefore, that the formulas provided herein are intended to represent any tautomeric form of the illustrated compound and are not intended to be limited only to the specific tautomeric form depicted by the drawing of the pattern.

[0077] Similarly, some of the compounds of the present invention may exist as stereoisomers, i.e. have the same atomic bonds of covalently linked atoms as before, differing in the spatial orientation of the atoms. for example, the compounds may be optical stereoisomers that contain one or more chiral centers and therefore may exist in two or more stereoisomeric forms (e.g., enantiomers or diastereoisomers). Thus, such compounds may be present as single stereoisomers (i.e., substantially free of other stereoisomers), racemates, and / or mixtures of enantiomers and / or diastereoisomers. As another example, stereoisomers include geometric isomers, such as the orientation of cis- or trans-substituents at the carbon adjacent to the double bond. All such single stereoisomers, racemates and mixtures thereof are intended to be included within the scope of the present invention. Unless otherwise indicated, all such steroisomeric forms are included in the formula provided herein.

[0078] In some embodiments, the chiral compound of the present invention is in a form that comprises at least 80% of the isomer alone (60% enantiomeric excess ("ee") or diastereoisomeric excess ("de")), or at least 85% ( 70% ee or de), 90% (80% ee or de), 95% (90% ee or de), 97.5% (95% ee or de), or 99% (98% ee or de). As generally understood by those skilled in the art, an optically pure compound having a chiral center is one that consists essentially of one of two possible enantiomers (i.e. a pure enantiomer), and an optically pure compound having more than one chiral center is one, that it is both a pure diastereoisomer and an enantiomer. In some embodiments, the compound is present in an optically pure form.

[0079] For compounds whose synthesis involves the addition of a single double bond group, in particular to a carbon-carbon double bond, the addition can take place at both atoms of the double bond. For such compounds, the present invention includes both such regioisomers.

[0080] In addition, the formulas are intended to represent both solvated and non-solvated forms with identified structures. For example, the indicated structures include both hydrated and non-hydrated forms. Other examples of solvates include structures in combination with a suitable solvent such as isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid or ethanolamine.

(b) Prolics and Metabolites

[0081] In addition to the present formulas and compounds described herein, prodrugs (generally pharmaceutically acceptable prodrugs), active metabolic derivatives (active metabolites), and pharmaceutically acceptable salts thereof are described.

[0082] Prodrugs are compounds or pharmaceutically acceptable salts thereof that when metabolized under physiological conditions or when they are converted by solvolysis, the desired active compound is obtained. Prodrugs, including, without limitation, esters, amides, carbamates, carbonates, ureids, solvates, or hydrates of the active compound. Typically, the prodrug is inactive or less active than the active compound, but may provide more favorable handling, administration and / or metabolic properties. For example, some prodrugs are esters of the active compound; during the metabolic breakdown, the ester group is cleaved off to obtain the active drug. Also, some prodrugs are enzymatically activated to obtain the active compound, or a compound from which the active compound will be obtained by further chemical reactions.

[0083] In this context, a common example of a prodrug is a carboxylic acid alkyl ester. Relative to the compounds of Formula IIIm, further examples include, without limitation, an amide or carbamate derivative at the 1 st position of the nitrogen of the azaindole core.

[0084] As described in The Practice of Medicinal Chemistry Ch. 31-32 (Ed. Wermuth, Academic Press, San Diego, CA, 2001), prodrugs can be conceptually divided into two non-exclusive categories, bioprecursor prodrugs and carrier prodrugs. Generally, bioprecursor prodrugs are compounds that are inactive or have low activity compared to corresponding active drug compounds that contain one or more protecting groups and are converted to the active form through metabolism or solvolysis. Both the active drug form and the released metabolic products should have an acceptably low toxicity. Typically, the formation of the active drug compound includes a metabolic process or reaction that is one of the following types:

Oxidation reactions: Oxidation reactions are, without limitation, reactions such as the oxidation of alcohol, carbonyl, and acidic functional groups, hydroxylation of aliphatic carbons, hydroxylation of alicyclic carbon atoms, oxidation of aromatic carbon atoms, oxidation of carbon-carbon double bonds, oxidation of groups nitrogen-containing, silicon, phosphorus, arsenic and sulfur oxidation, N-dealkylation, oxidative O- and S-dealkylation, oxidative deamination and other oxidative reactions.

[0086] Reduction reactions: Reduction reactions are, without limitation, reactions such as the reduction of carbonyl functional groups, reduction of alcohol functional groups and carbon-carbon double bonds, reduction of nitrogen-containing functional groups, and other reduction reactions.

[0087] Reactions without change in the oxidation state: Unrestricted reactions in the oxidation state are, without limitation, reactions such as ester and ether hydrolysis, hydrolytic cleavage of single bonds of carbon-nitrogen, hydrolytic cleavage of non-aromatic heterocycles, hydration and dehydration of multiple bonds, new

- atomic bonds resulting from the dehydration reaction, hydrolytic dehalogenation, removal of the hydrogen halide molecule and other such reactions.

[0088] The carrier prodrugs are drug compounds that contain a transporting residue that, e.g., improves uptake and / or localized delivery to sites (a) of action. Preferably for such a carrier prodrug the binding between the drug moiety and the transporting residue is a covalent bond, the prodrug is inactive or less active than the drug compound, the prodrug and each released transporting residue are acceptably non-toxic. For prodrugs, where the transporting residue is to increase uptake, typically release of the transporting residue should be rapid. In other cases, it is desirable to use a residue that provides slow release, e.g. of certain polymers or their residues, such as cyclodextrins. (See, e.g., Cheng et al., US Patent Publication No. 20040077595, App. No. 10 / 656,838). Such carrier prodrugs are often beneficial in the case of oral administration of medicaments. For example, the carrier pro-drugs may be used to improve one or more of the following: increased lipophilicity, increased duration of pharmacological action, increased site specificity, reduced toxicity and adverse effects, and / or improved drug formulation (e.g. stability, water solubility, undesired suppression organoleptic or physicochemical properties). For example, lipophilicity can be enhanced by esterification of hydroxyl groups with lipophilic carboxylic acids, or carboxylic acid groups with alcohols, e.g. aliphatic alcohols. Wermuth, supra. increased duration of the pharmacological effect, increased site specificity, reduced toxicity and adverse effects and / or improvement in the drug formulation (e.g. stability, water solubility, suppression of undesirable organoleptic or physicochemical properties). For example, lipophilicity can be enhanced by esterification of hydroxyl groups with lipophilic carboxylic acids, or carboxylic acid groups with alcohols, e.g. aliphatic alcohols. Wermuth, supra. increased duration of the pharmacological effect, increased site specificity, reduced toxicity and adverse effects and / or improvement in the drug formulation (e.g. stability, water solubility, suppression of undesirable organoleptic or physicochemical properties). For example, lipophilicity can be enhanced by esterification of hydroxyl groups with lipophilic carboxylic acids, or carboxylic acid groups with alcohols, e.g. aliphatic alcohols. Wermuth, supra. For example, lipophilicity can be enhanced by esterification of hydroxyl groups with lipophilic carboxylic acids, or carboxylic acid groups with alcohols, e.g. aliphatic alcohols. Wermuth, supra. For example, lipophilicity can be enhanced by esterification of hydroxyl groups with lipophilic carboxylic acids, or carboxylic acid groups with alcohols, e.g. aliphatic alcohols. Wermuth, supra.

[0089] Prodrugs may proceed from the prodrug form to the active form in a single step or may have one or more intermediate forms that may themselves have activity or may be inactive.

[0090] Metabolites, e.g. active metabolites, overlap with prodrugs as described above, e.g. bioprecursor prodrugs. Thus, such metabolites are a pharmacologically active compound or compounds that are further metabolised to pharmacologically active compounds that are derivatives derived from metabolic processes in the body of the subject. Of these, active metabolites are such pharmacologically active derivative compounds. For prodrugs, the prodrug compound is generally inactive or less active than the metabolic product. For active metabolites, the parent compound may be either an active compound or it may be an inactive prodrug.

[0091] Prodrugs and active metabolites can be identified using routine techniques known in the art. See, e.g., Bertolini et al, 1997, J Med Chem 40: 2011-2016; Shan et al., J Pharm Sci 86: 756-757; Bagshawe, 1995, Drug Dev Res. 34: 220-230; Wermuth, supra.

(c) Pharmaceutically acceptable polyols Compounds can be formulated as such or in the form of pharmaceutically acceptable salts. Contemplated forms of pharmaceutically acceptable salts include, but are not limited to, mono, bis, tris, tetra, and so on, pharmaceutically acceptable salts are

- non-toxic in the amounts and concentrations in which they are administered. The preparation of such salts can facilitate pharmacological use by altering the physical properties of the compound without preventing its physiological effect. Useful changes in physical properties include lowering the melting point to facilitate transmucosal administration and increase solubility to facilitate administration of higher drug concentrations.

[0093] Pharmaceutically acceptable salts include acid addition salts, such as those comprising sulfate, chloride, hydrochloride, fumarate, maleate, phosphate, sulfamate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, cyclohexylsulfamate and quinate. . Pharmaceutically acceptable salts may be obtained from acids such as hydrochloric acid, maleic acid, sulfuric acid, phosphoric acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, acid cyclohexylsulfamic acid, fumaric acid, quinic acid.

[0094] Pharmaceutically acceptable salts also include base addition salts, such as those containing benzathine, chloroprocaine, choline, diethanolamine, ethanolamine, t-butylamine, ethylenediamine, meglumine, procaine, aluminum, calcium, lithium, magnesium, potassium, sodium, ammonia, alkylamine. and zinc when acidic functional groups such as carboxylic acid or phenol are present. For example, see Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Co., Easton, PA, Vol. 2, pp. 1457, 1995. Such salts may be prepared using appropriate appropriate bases.

[0095] Pharmaceutically acceptable salts may be prepared by standard techniques. For example, the free base form of the compound may be dissolved in a suitable solvent, such as an aqueous or aqueous-alcoholic solution containing the appropriate acid, and then isolated by evaporation of the solution. In another example, the salt may be prepared by reacting the free base and acid in an organic solvent.

Thus, for example, if a particular compound is a base, the desired pharmaceutically acceptable salt can be prepared by any suitable method available in the art, e.g., interaction of the free base with an inorganic acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid , phosphoric acid and the like, or with an organic acid such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, pyranosylic acid such as glucuronic acid or acid a galacturonic alpha-hydroxy acid such as citric acid or tartaric acid, amino acids such as aspartic acid and glutamic acid, aromatic acids such as benzoic acid or cinnamic acid, sulfonic acid,such as p-toluenesulfonic acid or ethanesulfonic acid or the like.

[0097] Similarly, if a particular compound is an acid, the desired pharmaceutically acceptable salt can be prepared by any suitable method, such as

For example, reacting the free acid with an inorganic or organic base such as an amine (primary, secondary or tertiary), an alkali metal hydroxide or an alkaline earth metal hydroxide or the like. Illustrative examples of suitable salts including organic salts derived from amino acids such as L-glycine, L-lysine and L-arginine, ammonia, primary, secondary or tertiary amines and cyclic amines such as hydroxyethylpyrrolidine, piperidine, morpholine or piperazine and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum and lithium. Further examples of pharmaceutically acceptable salts of the compounds of formulas I-III include, without limitation, their mono-sodium and bispotassium salts.

[0098] Pharmaceutically acceptable salts of various compounds may be present as complexes. Examples of complexes include the 8-chloroteophylline complex (analogous to, e.g., dimenhydrinate complex: 8-chloroteophylline diphenhydramine (1: 1), dramamine) and various complexes including the cyclodextrin.

[0099]

Unless otherwise specified, the specification of the present compound includes pharmaceutically acceptable salts of such a compound.

(d) Uonny poliinoriic / .ne [0100] For substances that are solid bodies, it is understood by those skilled in the art that the compound and salts may exist in various crystalline and polymorphic forms, all of which are intended to be within the scope of this invention and specific designs.

VII. Administration [0101] The methods and compounds will typically be used in the therapy of human subjects. However, they can also be used to treat similar or identical indications of other animal subjects. In this context, the terms "subject," "animal subject," and the like refer to human and nonhuman vertebrates, e.g., mammals, such as inhuman primates, sport and breeding animals, e.g. horses, cattle, pigs, sheep, rodents and pets, e.g. dogs and cats.

[0102] Suitable dosage forms, depending in part on the use or route of administration, for example, orally, transdermally, mucosally, by inhalation or by injection (parenterally). Such dosage forms should allow the compound to reach target cells. Other factors are well known in the art and include considerations such as toxicity and dosage forms that delay the effect of the compound or composition. Techniques and formulas can usually be found in The Science and Practice of Pharmacy, 21th Edition, Lippincott, Williams and Wilkins, Philadelphia, PA, 2005 (hereby incorporated by reference).

[0103] The compounds of the present invention, i.e. formula IIIm, may be formulated as

Pharmaceutically acceptable salts.

[0104] Carriers and excipients may be used to prepare the composition. Carriers and excipients may be selected to facilitate administration of the compound. Examples of carriers include calcium carbonate, calcium phosphate, various sugars, such as lactose, glucose, sucrose, or types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols, and physiologically compatible solvents. Examples of physiologically compatible solvents include sterile water solutions for injection (WFI), saline solutions and dextrose.

[0105] The compounds may be administered via a variety of routes of administration, including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, transmucosal, rectal, percutaneous or pulmonary administration. Oral administration is preferred. For oral administration, for example, the compounds may be formulated in conventional oral dosage forms such as capsules, tablets, liquid preparations such as syrups, elixirs and concentrated drops.

[0106] For inhalation, the compounds of the invention may be formulated as a dry powder or a suitable solution, suspension or aerosol. Powders and solutions can be formulated with suitable additives known in the art. For example, the powders may contain a suitable powder base, such as lactose or starch, and the solutions may consist of propylene glycol, sterile water, ethanol, sodium chloride, and other additives such as salts of acids, bases or buffers. Such solutions or suspensions may be administered by inhalation by a spray, a pump, an atomiser, or a nebulizer and the like. The compounds of the invention may also be used in combination with other inhalation therapies, e.g. corticosteroids such as fluticasone propionate, beclomethasone dipropionate, acetonide triamcinolone, budesonide and mometasone furoate, beta agonists such as albuterol, salmeterol and formoterol; anticholinergic agents, such as tiotropium bromide or ipratroprium, vasodilators, such as treprostinal and iloprost, with enzymes such as DNAase, therapeutic proteins, immunoglobulin antibodies; oligonucleotides, such as single or double-stranded DNA or RNA, siRNA, antibiotics, such as tobramycin; muscarinic receptor antagonists; leukotriene antagonists, cytokine antagonists, protease inhibitors, disodium cromoglycate; nedocril sodium; and sodium cromoglycate. such as single or double stranded DNA or RNA, siRNA, antibiotics, such as tobramycin; muscarinic receptor antagonists; leukotriene antagonists, cytokine antagonists, protease inhibitors, disodium cromoglycate; nedocril sodium; and sodium cromoglycate. such as single or double stranded DNA or RNA, siRNA, antibiotics, such as tobramycin; muscarinic receptor antagonists; leukotriene antagonists, cytokine antagonists, protease inhibitors, disodium cromoglycate; nedocril sodium; and sodium cromoglycate.

[0107] Pharmaceutical preparations for oral use can be achieved, for example, by combining the active compounds with solid excipients, optionally grinding the resulting mixture and processing the mixture into granules, after addition of suitable auxiliaries, if desired to obtain tablet cores or dragees. Suitable excipients are, in particular, fillers, such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations, e.g., corn starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose (CMC), and / or polyvinylpyrrolidone (PVP: povidone). If desired, substances can be added

Disintegrating agents, such as cross-linked polyvinyl pyrrolidone, agar or alginic acid or salts thereof such as sodium alginate.

[0108] Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally comprise, for example, gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol (PEG) and / or titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Colorants or pigments may be added to the tablet or dragee coatings to identify or to determine different combinations of doses of active compounds.

[0109] Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin ("gelatin capsules") as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. Push-fit capsules may contain the active ingredients in an additional mixture with a filler such as lactose, a binder such as starches and / or lubricants such as talc or magnesium stearate, and optionally stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols (PEGs). In addition, stabilizing substances may be added.

[0110] Alternatively, injection (parenteral administration) may be used e.g. intramuscular, intravenous, intraperitoneal, and / or subcutaneous. For injection, the compounds of the invention are formulated in sterile liquid solutions, preferably in physiologically compatible buffers or solutions, such as physiological saline, Hank's solution or Ringer's solution. In addition, the compounds can be formulated in solid form and dissolved or suspended immediately before use. Freeze-dried forms can also be produced.

[0111] Administration can also be by transmucosal, superficial or transdermal agents. For transmucosal, surface or intradermal administration, penetrating substances suitable for penetration of the barrier are used in the formula. Such penetrants are generally known in the art and include, for example, for transmucosal administration of bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate penetration. Transmucosal administration can be, for example, by nasal spray or suppositories (rectal or vaginal). The surface compositions of the invention are preferably formulated as oils, creams, lotions, ointments and the like by selection of a suitable carrier known in the art. Suitable carriers include vegetable or mineral oils, white petrolatum (white soft paraffin), fats or oils and branched chains, animal fats and high molecular weight alcohols (above C12). Preferred carriers are those in which the active ingredient is soluble. Emulsifiers, stabilizers, humectants and antioxidants may also be included, as well as color or fragrance substances, if desired. Surface-based creams are preferably

- 37 formulated from a mixture of mineral oil, self-emulsifying beeswax and water to which a mixture of the active ingredient is added, dissolved in a small amount of solvent (e.g., petroleum). Additionally, the intradermal administration may include an intradermal patch or dressing, such as an active impregnated bandage and optionally one or more carriers or diluents known in the art. For administration in the form of a transdermal delivery system, the dosage will, of course, be continuous rather than interrupted throughout the dosing schedule.

[0112] Amounts of various compounds for administration may be determined by standard procedures taking into account factors such as the IC50 of the compound, the biological half-life of the compound, the age, dimensions and weight of the subject, and the disease associated with the subject. The importance of these and other factors is well known to those with ordinary skill in the art. Generally, the dose will be between about 0.01 and 50 mg / kg, preferably 0.1 and 20 mg / kg of the subject being treated. Multiple doses can be used.

[0113] The compounds of the invention may be used in combination with other therapies to treat the same disease. Such combinations of use include administering the compounds and one or more other therapeutic agents at different times or co-administering the compound and one or more other treatments. In some embodiments, the dosage may be modified for one or more of the compounds of the invention or other therapeutic agents used in the combination, e.g. reducing the amount of dosages relative to the compound or therapy used alone by methods well known to those of ordinary skill in the art.

[0114] It is understood that the use in combination includes use with other therapies, drugs, medical procedures, etc., where the other therapy or procedure can be administered by other means (e.g., in a short time such as within hours (e.g., 1), 2, 3,

4-24 hours), or over a longer period (e.g., 1-2 days, 2-4 days, 4-7 days, 1-4 weeks)) than the compound of the present invention, or at the same time as the compound of the invention. Use in combination also includes use with a therapy or medical procedure that is administered once or sporadically, such as surgery, administered with the compound of the invention within a short time or a long time before or after other therapy or procedure. In some embodiments, the present invention provides a supply of a compound of the invention and one or more therapeutic drugs provided by various routes of administration or the same route of administration. Use in combination for any route of administration comprises providing a compound of the invention and one or more other therapeutic drugs provided by the same route of administration in any formulas, including formulas, where two compounds are chemically combined in such a way that they maintain their therapeutic effect when administered. In one aspect, the other drug therapy may be co-administered with one or more compounds of the invention. Use in combination by joint administration of common formulas or formulas with chemically linked compounds or the administration of two or

- 38 more compounds in separate formulas within a short time apart (eg within an hour, 2 hours, 3 hours, up to 24 hours), administration with the same or different routes. Common administration of separate formulations includes co-administration by delivery through the device, e.g. the same inhalation device, the same syringe or administration from a separate device within a short time from one another. Common formulas of the compounds of the invention and one or more additional drug therapies provided by the same route include the joint preparation of materials, such that they can be administered with one device containing separate compounds combined into a formula or compounds that are modified so that they are chemically combined. while maintaining your biological activity. Such chemically bonded compounds may have a bond,

EXAMPLES [0115] Examples related to the present invention are described below. In most cases, alternative techniques may be used. The examples are intended to illustrate but not to limit or narrow the scope of the invention. In some examples, the mass spectrometry results indicated for a compound may assume more than one value due to the isotope arrangement of the atom in the molecule, such as a compound having a bromo or chloro substituent.

Example 1: Synthesis of [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide

P-0773 propane-1-sulfonic acid and related compounds.

[0116] Compound P-0773 was synthesized in five steps from 2,4-difluoro-phenylamine 42 as shown in Scheme 13.

<img file="PL1893612T3_D0002.tif" />

Step 1-preparation of 3-amino-2,6-difluoro-benzoic acid benzyl ester (43):

[0117] To 2,4-difluoro-phenylamine (42, 5.11 mL, 50.7 mmol) in tetrahydrofuran (250 mL), cooled with a dry ice / acetone bath under nitrogen, n-butyllithium was slowly added (1.60 M in hexane, 34.0 mL, 54.4 mmol). After 30 minutes, 1,2-bis- (chlorodimethylsilanyl) -ethane (11.5 g, 53.4 mmol) dissolved in tetrahydrofuran (40.0 mL) was added slowly to the reaction. After 1 hour n-butyllithium (1.60 M in hexane, 31.9 mL, 51.0 mmol) was slowly added to the reaction. The reaction was stirred at -78 ° C for 30 minutes and then allowed to warm to room temperature over 40 minutes. The reaction was cooled to -78 ° C, followed by slow addition of n-butyllithium (1.60 M in hexane, 35.1 mL, 56.2 mmol). After 70 minutes, benzyl chloroformate (7.97 mL, 55.8 mmol) was added to the reaction. The reaction mixture was stirred at -78 ° C overnight, followed by the addition of 2 N HCl (120 mL). The reaction was allowed to warm to room temperature for 2 hours. The organic layer was separated. The aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and rinsed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (20% ethyl hexane) to give b The organic layers were combined and rinsed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (20% ethyl hexane) to give b The organic layers were combined and rinsed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (20% ethyl hexane) to give b^ezb^andrw^ny dej ⁽43, 10.6 g, 79.7%). MS (ESI) [M + H +]⁺ = 264.1.

Step 2 - Preparation of the benzyl ester of 2.6-dichloroboro-3- (propane-sulfonylamino) -benzoic acid (44):

[0118] To the benzyl ester of 3-amino-2,6-difluoro-benzoic acid (43, 6.00 g, 22.8 mmol) in methylene chloride (150 mL) was added pyridine (2.76 mL, 34.2 mmol) and propan-1-propionyl chloride. sulfonyl (3.80 mL, 33.8 mmol). The reaction was stirred at room temperature overnight. The reaction was then poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel to give a colorless oil (44, 7.0 g, 83.1%). MS⁽ESI) [M + 1 +] + = 370.1.

Step 3 - Preparation of 2,6-difluoro-3- (propane-1-sulfonylamino) -benzoic acid (45);

[0119] To 2,6-difluoro-3- (propane-1-sulfonylamino) benzoic acid benzyl ester (44, 2.0 g, mmol) in methanol (30 mL) was added 20% palladium hydroxide on charcoal (100 mg). The reaction was stirred in the presence of hydrogen at 1 atm for 15 minutes. The reaction was filtered and concentrated to give a white solid 45 that was used in the next step.

Step 4- Preparation of 2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl chloride (46):

[0120] 2,3-Difluoro-3- (propane-1-sulfonylamino) -benzoic acid (45.1.50 g, 5.4 mmol) was added toluene (7.0 mL) and thionyl chloride (15.0 mL, 0.21 mmol). The reaction was heated to reflux for 3 hours. The reaction was concentrated to give the crude compound that was used in the next step.

Step 5- Preparation of propane-1-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenyl] -amide (P-0773):

[0121] To aluminum trichloride (8.89 g, 66.7 mmol) was added methylene chloride (150 mL) under a nitrogen atmosphere below 5 ° C. To this was added 5-bromo-7-azaindol (67, 1.64 g, 8.34 mmol) in methylene chloride (20 mL). The reaction was stirred for 60.0 minutes and 2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl chloride (46, 3.50 g, 11.8 mmol) in methylene chloride (20 mL) was added. The reaction was stirred for 6 hours and warmed to room temperature overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (methylene chloride / methanol 5%) to give a white solid⁽P^-0773, 1.2 g, 31.4%). MS⁽ESI) [M + H⁺]⁺ = 460.0, 462.0.

[⁰¹²²] N- [³- (⁵-^bromo-^1H-^piro^labout[^2.3-^b]^piry^dyWell-³-^kar^bhe^ylabout)-^{2,4, di}f^lFluoro-fen^ylo] benzenesulfonamide P-0798 and N- [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-fluoro-benzenesulfonamide

<img file="PL1893612T3_D0003.tif" />

were prepared according to the protocol of Scheme 13, substituting propane-1sulfonyl chloride with benzenesulfonyl chloride and 3-fluorobenzene chloride, respectively.^lfhe^ylat^. in ^Ethis^pie ². ^p-⁰⁷98 ^MS(^ESI) [^M - ^H+]^- = ⁴⁸⁹.^{9, 491}.⁹.

Propane-1-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -4-chloro-2-fluoro-phenyl] -amide P-0805

<img file="PL1893612T3_D0004.tif" />

was prepared according to the protocol of Scheme 13, substituting 2,4-difluoro-phenylamine ⁴-chloro-2-fluoro-phenylamine in Eta^pie EM^S(E^SI) [M - H⁺]⁺ = ⁴7E^{9, 473}.9.

[2,4-Propyl-1-sulfonic acid [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide P-0007

<img file="PL1893612T3_D0005.tif" />

was prepared according to the protocol of Scheme 13, substituting 5-bromo-7-azaindol 7azarn^dokm in ^Ethis^pie 5. ^MS (^ESI) [^M + ^H+] + = ³8O.E [Propane-1-sulfonic acid [2,4-difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide P-0806

<img file="PL1893612T3_D0006.tif" />

prepared according to Scheme 13, substituting 5-bromo-7-azaindol with 5-methoxy-7-azaindole 104 (prepared as described in Example 16) in Step 5. MS⁽ESI) [M-H +^]'= 410.1.

Example 2: Synthesis of [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluorophenyl] -amide propan-1-sulfonic acid P-0955 and related compounds.

[0126] Compound P-0955 was synthesized in six steps from 4-chloro-2-fluorophenylamine 47 as shown in Scheme 14.

- 42 Scheme 14

<img file="PL1893612T3_D0007.tif" />

Step 1-preparation of 3-amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48):

[0127] To 4-chloro-2-fluoro-phenylamine (47, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), cooled with a dry ice / acetone bath under a nitrogen atmosphere, was added^lno n-butykhtu (².⁵⁰⁰ M in ^he^ksan^ande^{, 24}.⁴ m^L). After²⁰ mmutac^h Uzo-bis-chloro-dimethyl-silanyl) -ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was added slowly to the reaction. After 1 hour n-butyllithium (2.50 M in hexane, 25.0 mL) was slowly added to the reaction. The reaction was stirred at -78 ° C for 20 minutes and allowed to warm to room temperature over 60 minutes. The reaction was cooled to -78 ° C, followed by slow addition of n-butyllithium (2.50 M in hexane, 26.0 mL). After 80 minutes, benzyl chloroformate (10.0 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 ° C overnight, followed by addition of water (80 mL) and concentration with hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature for 2 hours. The organic layer has been separated, and the aqueous layer is made basic with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and rinsed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give a colorless oil (48, 12.5 g, 78.3%).

Step 2 - Attenuation of 6-chloro-2-fluoro-3- (propane-1sulfonylamino) -benzoic acid benzyl ester (49 '):

[0128] To 3-amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48, 1.20 g,

4.3 mmol) in methylene chloride (28 mL) was added pyridine (0.52 mL, 6.4 mmol) and propane-1-sulfonyl chloride (0.685 g, 4.8 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel to give a colorless oil (49, 960 mg, 58.0%). MS (ESI) [M^-H⁺] '= 384.1.

- Step 3-Preparation of 6-chloro-2-fluoro-3- (propane-1-sulfonylamino) benzoic acid (115):

[0129] To 6-Chloro-2-fluoro-3- (propane-1-sulfonylamino) benzoic acid benzyl ester (49, 6.00 g, 15.6 mmol) in tetrahydrofuran (100 mL) was added 1.0 M aqueous potassium hydroxide (100 mL). . The reaction was heated to reflux overnight. The reaction was poured into water, acidified to pH2 with 1 N hydrochloric acid and extracted with ethyl acetate. The organic portion was dried over anhydrous sodium sulfate, filtered and concentrated to give a white solid 115 (3.95 g, 85.8%).

Step 4 - Preparation of 2-fluoro-3-propane-1-sulfonylamino) -benzoic acid (50):

[0130] To 6-Chloro-2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (115, 0.69 g, 2.3 mmol) in methanol (10 mL) was added 20% palladium hydroxide on carbon (200 mg) . The reaction was stirred in the presence of hydrogen at 50 psi for 2 hours. The reaction was filtered and concentrated to give a white solid 50 that was used in the next^et^apand^e. MS (ESI) [M^-H⁺] '= 260.1.

Step 5- Preparation of 2-fluoro-3- (propane-1-sulfonylamino) -benzoyl chloride (51):

[0131] To 2-Fluoro-3- (propane-1-sulfonylamino) -benzoic acid (50, 1.17 g, 4.5 mmol), thionyl chloride (10.0 mL) was added. The reaction was heated to reflux for 3 hours. The reaction was concentrated to afford crude compound 51, which was used in the next step.

Step 6- Preparation of propane-1-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluorophenyl] -amide (P-0955):

[⁰¹³²] TrójcMorek: ^gbnu ((².⁵² g. ^18.9 mmo^l) ^and cMore: met^ylenu (⁶⁰.⁰ m^L) were combined under a nitrogen atmosphere. 5-Bromo-7-azaindol (67, 630.0 mg, 3.2 mmol) in methylene dichloride (20.0 mL) was added to the reaction mixture. The reaction was stirred for 70 minutes, then 2-fluoro-3- (propane-1-sulfonylamino) -benzoyl chloride (51.0.749 g, 2.68 mmol) in methylene chloride (20 mL) was added. The reaction was stirred at room temperature for 2 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give compound P-0955 (65 mg, 5.5%). MS⁽ESI) [M + H +] + = 440.2, 442.2.

[0133] Using the protocol of Scheme 14 substituting 5-bromo-azaindole or 5-chloro-7azaindole (80, prepared as described in Example 9), 5-fluoro-7-azaindol (81, prepared as described in Example 9) or 7- azaindol in Step 6, [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluoro-phenyl] -amide, propano-1su^lfplugs^gabout^p-¹⁰¹³ (^MS(^ESI) [^M-H +] '= ^394.1) [²fluoro³- (⁵-^fluoro-¹-^piro^labout[^2.3b] pyridine-3-carbonyl) -phenyl] -amide of propane-1-sulfonic acid P-1028 (MS (ESI) [M-H +] - = 378.1), and [2-fluoro-3- (1H-pyrrolo [ 2,3-b] pyridine-3-carbonyl) -phenyl] -amide ^pro^pWell-¹-su^lfplugs^gabout ^p-¹⁰⁵⁶ (^MS(^ESI) [^M + ^{H +}] + = ³⁶².²) left

- 44 prepared accordingly;

<img file="PL1893612T3_D0008.tif" />

Example 3: [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] -amide P-0088 propane-1-sulfonic acid P-0955 and related compounds.

[0134] Compound P-0088 was synthesized in one step from propane-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide. P-0773 through the Suzuki coupling ((Muyaura and Suzuki, Chem1995, 95: 2457) as shown in Scheme 15.

<img file="PL1893612T3_D0009.tif" />

<img file="PL1893612T3_D0010.tif" />

Step 1-Preparation of [2,4 -fluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide of propane-1-sulfonic acid (P- 0088):

[0135] To propane-1-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-0773, prepared as described in Example 1, 65.0 mg, 0.14 mmol) in acetonitrile (4.0 mL) was added pyridine-3-boronic acid (609, 25.0 mg, 0.20 mmol), tetrakis (triphenylphosphine) palladium (0) (11 mg, 1.0%). mmol) and aqueous potassium carbonate (1.0 M, 2.0 mL). The reaction was heated to 160 ° C for 10 minutes in a CEM Discover microwave. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (methylene chloride / methanol 5%) to give the white colored body^andL^{e (}P^-0088^. 30 mg. 46.9%). MS⁽ESI) ^[M + H^{+] +} = 457.2.

[0136] Additional compounds were prepared according to the Scheme-15 protocol, optionally replacing [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenyl] -amide. propane-1-sulfonic acid P-0773 with a suitable 5-bromoazaindole and / or pyridine-3-boric acid 609 with the corresponding boric acid or boric acid ester. The 5-bromo azaindol used was synthesized as described in any of

Examples 1, 2 or 5. The following compounds were prepared by following this procedure:

N- [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -benzenesulfonamide (P-0685), [4-chloro 2-fluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] propane-1-sulfonic acid (P-0753), [2 , 4-difluoro-3- (5-phenyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide, propane-1-sulfonic acid (P-0636), [4-chloro-2-d] 3- (5-phenyl-1H-pyrrolo [2-b] pyridine-3-carbonyl) -phenyl] -amide propan-1-sulfonic acid (P-0776) {3- [5- (4-chloro) phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenyl] -amide propane-1-sulfonic acid (P-0956), {3- [5- (4-dimethylamino) -Phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluoro-phenyl} -amide propane-1-sulfonic acid (P-0989), {2,4-difluoro-3 Propane-1-sulfonic acid [5- (4-methoxy-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-cabonyl] phenyl} -amide (P-0877), {2,4-Difluoro-3- [5- (4-trifluoromethyl-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide propane-1-sulfonic acid (P-0912), {2 , 4-difluoro-3- [5- (3-methoxy-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl} -amide, propane-1-sulfonic acid (P-0874), {3- [5- (3-Dimethylamino-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluoro-phenyl} -amide propane-1-sulfonic acid (P-0876) , Propane-1-sulfonic acid [2-fluoro-3- (5-phenyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-0897), {3- [ 5- (4-chloro-phenyl) -1H-pyrrolo [2,3, b] pyridine-3-carbonyl] -2-fluorophenyl} propane-1-sulfonic acid (P-1009),Propan-1-sulfonic acid 3-b] pyridine-3-carbonyl] phenyl} -amide (P-0874), {3- [5- (3-dimethylamino-phenyl) -1H-pyrrolo [2,3-b] Pyridine-3-carbonyl] -2,4-difluoro-phenyl} -amide propane-1-sulfonic acid (P-0876), [2-Fluoro-3- (5-phenyl-1H-pyrrolo [2,3-b] pyridine Propane-1-sulfonic acid carbonyl) -phenyl] -amide (P-0897), {3- [5- (4-chloro-phenyl) -1H-pyrrolo [2,3, b] pyridine-3-one propan-1-sulfonic acid carbonyl] -2-fluorophenyl} amide (P-1009),Propan-1-sulfonic acid 3-b] pyridine-3-carbonyl] phenyl} -amide (P-0874), {3- [5- (3-dimethylamino-phenyl) -1H-pyrrolo [2,3-b] Pyridine-3-carbonyl] -2,4-difluoro-phenyl} -amide propane-1-sulfonic acid (P-0876), [2-Fluoro-3- (5-phenyl-1H-pyrrolo [2,3-b] pyridine Propane-1-sulfonic acid carbonyl) -phenyl] -amide (P-0897), {3- [5- (4-chloro-phenyl) -1H-pyrrolo [2,3, b] pyridine-3-one propan-1-sulfonic acid carbonyl] -2-fluorophenyl} amide (P-1009),

5-phenyl-1H-pyrrolo [2,3-b] pyridine, [2-fluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl ] propan-1-sulfonic acid amide (P-1251), {2,4-difluoro-3- [5- (3-fluoro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] propane-1-sulfonic acid phenyl} -amide (P-1259), {2,4-difluoro-3- [5- (4-fluoro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl propan-1-sulfonic acid phenyl} -amide (P-1260),

- propane-1-sulfonic acid {3- [5- (3-chloro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenyl} -amide (P-1261) ), Propane-1-sulfonic acid [2,4-difluoro-3- (5-pyridin-4-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P- 1262),

3- {3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl} -benzoic acid (P-1266), {2, 4-difluoro-3- [5- (3-morpholin-4-yl-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide propane-1-sulfonic acid (P-1873) {2,4-difluoro-3- [5- (3-morpholin-4-ylmethylly-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide propane-1-sulfonic acid (P-1878), {2,4-difluoro-3- [5- (6-methoxy-pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide propane-1-sulfonic acid (P-1879), {2,4-difluoro-3- [5- (6-morpholin-4-yl-pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridine -3-carbonyl] -phenyl} -amide of propane-1-sulfonic acid (P-1881), (2,4-difluoro-3- {5- [6- (4-methyl-piperazin-1-yl) -pyridin-3 -yl] -1H-pyrrolo [2,3-b] pyridine-3-carbonyl} -phenyl) -amide propane-1-sulfonic acid (P-1882), {3- [5- (4-cyano-3,5- dimethyl-phenyl) -1H-pyrrolo [2,Propane-1-sulfonic acid 3-b] pyridine-3-carbonyl] -2,4-difluorophenyl} -amide (P-1980),

N- {2,4-difluoro-3- [5- (1-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -4-trifluoromethyl-benzenesulfonamide (P- 1996)

N- {2,4-difluoro-3- [5- (1-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -3-fluoro- Benzenesulfonamide (P-1997), {2,4-difluoro-3- [5- (1-methyl-1H-pyrazol-4-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide (P-1864),

4- {3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl} -benzamide (P-1546),

4- {3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl} -N, N + dimethyl-benzamide (P-) 1547), (2,4-difluoro-3- {5- [4- (morpholine-4-carbonyl) -phenyl] -1H-pyrrolo [2,3-b] pyridine-3-carbonyl} -phenyl) -amido propane -1-sulfonic acid (P-1548),

3- {3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl} -benzamide (P-1549), {2, 4-Difluoro-3- [5- (4-methyl-1H-imidazol-2-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl} -amide propane-1-sulfonic acid (P -2006), and N- {2,4-difluoro-3- [5- (6-methoxy-pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -phenyl } -3-fluoro-benzenesulfonamide (P-2012).

[0137] The following table indicates 5-bromo azaindol (column 2) and boric acid (column 3) used to obtain the compound (column 4). Column 1 contains the compound number and column 5 of the observed mass.

<td></td><td>5-brazaindol</td><td>Acid boric</td><td>Relationship</td><td>Watchers MS (ESI)⁽M + H^+]</td>

<td>P-0685</td><td></td><td>Β (ΟΗ) 2 ά</td><td>F (Ps o^NTóO Źhn- ^ Ό Ν Η ο</td><td>491.1</td>

<td>P-0753</td><td></td><td>Β (0Η) ζ about</td><td>0 «&gt; ^ Ζ φφ YM Το ^MrrV ηΤ 'Ν' * Ν "Η</td><td>473.1</td>

<td>P-0636</td><td>d- 0^F H * 0^N 8</td><td>Β (0Η) 2 0</td><td>&amp; Ojf ^HO</td><td>456.1</td>

<td>P-0776</td><td>"Η</td><td>Β (ΟΗ) 2 ό</td><td></td><td>472.1</td>

<td>P-0956</td><td>TP ^{FH ο}Ν Η</td><td>Β (0Η) 2 φ CI</td><td>"Wedding X V £ F Η 0 ν - (&gt;</td><td>490.1</td>

- 48 P-0889

P-0877

P-0912

P-0874

P-0876

P-0897

5-brazaindol

<img file="PL1893612T3_D0011.tif" />

<img file="PL1893612T3_D0012.tif" />

<img file="PL1893612T3_D0013.tif" />

<img file="PL1893612T3_D0014.tif" />

<img file="PL1893612T3_D0015.tif" />

<img file="PL1893612T3_D0016.tif" />

Boric acid

<img file="PL1893612T3_D0017.tif" />

<img file="PL1893612T3_D0018.tif" />

<img file="PL1893612T3_D0019.tif" />

<img file="PL1893612T3_D0020.tif" />

<img file="PL1893612T3_D0021.tif" />

<img file="PL1893612T3_D0022.tif" />

Relationship

<img file="PL1893612T3_D0023.tif" />

<img file="PL1893612T3_D0024.tif" />

<img file="PL1893612T3_D0025.tif" />

<img file="PL1893612T3_D0026.tif" />

<img file="PL1893612T3_D0027.tif" />

<img file="PL1893612T3_D0028.tif" />

Watchers

MS (ESI) ⁽M + H^+]

499.2

486.3

524.1

484.3 [M^-H⁺] '

499.3

438.3

- 49 P-1009

P-0857

P-1251

P-1259

P-1260

5-brazaindol

<img file="PL1893612T3_D0029.tif" />

<img file="PL1893612T3_D0030.tif" />

<img file="PL1893612T3_D0031.tif" />

<img file="PL1893612T3_D0032.tif" />

<img file="PL1893612T3_D0033.tif" />

<img file="PL1893612T3_D0034.tif" />

Boric acid

<img file="PL1893612T3_D0035.tif" />

<img file="PL1893612T3_D0036.tif" />

<img file="PL1893612T3_D0037.tif" />

<img file="PL1893612T3_D0038.tif" />

<img file="PL1893612T3_D0039.tif" />

Relationship

<img file="PL1893612T3_D0040.tif" />

<img file="PL1893612T3_D0041.tif" />

<img file="PL1893612T3_D0042.tif" />

<img file="PL1893612T3_D0043.tif" />

<img file="PL1893612T3_D0044.tif" />

<img file="PL1893612T3_D0045.tif" />

Watchers

MS (ESI) ⁽M + H^+]

472.2

455.1 [MH +^]439.3

474.2

<img file="PL1893612T3_D0046.tif" />

474.2

- 50 P-1261

P-1262

P-1266

P-1873

P-1878

P-1879

5-brazaindol

<img file="PL1893612T3_D0047.tif" />

<img file="PL1893612T3_D0048.tif" />

<img file="PL1893612T3_D0049.tif" />

<img file="PL1893612T3_D0050.tif" />

<img file="PL1893612T3_D0051.tif" />

<img file="PL1893612T3_D0052.tif" />

Boric acid

<img file="PL1893612T3_D0053.tif" />

<img file="PL1893612T3_D0054.tif" />

<img file="PL1893612T3_D0055.tif" />

<img file="PL1893612T3_D0056.tif" />

<img file="PL1893612T3_D0057.tif" />

Relationship

<img file="PL1893612T3_D0058.tif" />

<img file="PL1893612T3_D0059.tif" />

<img file="PL1893612T3_D0060.tif" />

<img file="PL1893612T3_D0061.tif" />

<img file="PL1893612T3_D0062.tif" />

<img file="PL1893612T3_D0063.tif" />

Watchers

MS (ESI) ⁽M + H^+]

490.2

457.2

500.1

541.2

555.3

<img file="PL1893612T3_D0064.tif" />

487.3

- 51 P-1881

P-1882

P-1980

P-1996

P-1997

P-1864

5-brazaindol

<img file="PL1893612T3_D0065.tif" />

<img file="PL1893612T3_D0066.tif" />

<img file="PL1893612T3_D0067.tif" />

<img file="PL1893612T3_D0068.tif" />

<img file="PL1893612T3_D0069.tif" />

<img file="PL1893612T3_D0070.tif" />

Boric acid

<img file="PL1893612T3_D0071.tif" />

<img file="PL1893612T3_D0072.tif" />

<img file="PL1893612T3_D0073.tif" />

<img file="PL1893612T3_D0074.tif" />

<img file="PL1893612T3_D0075.tif" />

Relationship

<img file="PL1893612T3_D0076.tif" />

<img file="PL1893612T3_D0077.tif" />

<img file="PL1893612T3_D0078.tif" />

<img file="PL1893612T3_D0079.tif" />

<img file="PL1893612T3_D0080.tif" />

<img file="PL1893612T3_D0081.tif" />

Watchers

MS (ESI) ⁽M + H^+]

542.3

555.3

509.2

562.2

512.2

<img file="PL1893612T3_D0082.tif" />

460.2

- 52 P-1546

P-1547

P-1548

P-1549

P-2006

P 2012

5-brazaindol

<img file="PL1893612T3_D0083.tif" />

<img file="PL1893612T3_D0084.tif" />

<img file="PL1893612T3_D0085.tif" />

<img file="PL1893612T3_D0086.tif" />

<img file="PL1893612T3_D0087.tif" />

<img file="PL1893612T3_D0088.tif" />

Boric acid

<img file="PL1893612T3_D0089.tif" />

<img file="PL1893612T3_D0090.tif" />

<img file="PL1893612T3_D0091.tif" />

<img file="PL1893612T3_D0092.tif" />

<img file="PL1893612T3_D0093.tif" />

<img file="PL1893612T3_D0094.tif" />

Relationship

<img file="PL1893612T3_D0095.tif" />

<img file="PL1893612T3_D0096.tif" />

<img file="PL1893612T3_D0097.tif" />

<img file="PL1893612T3_D0098.tif" />

<img file="PL1893612T3_D0099.tif" />

<img file="PL1893612T3_D0100.tif" />

Watchers

MS (ESI) ⁽M + H^+]

497.2

527.3

569.3

499.3

560.2

632.1

Example 4: Synthesis of N- [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -ethanesulfonamide P-0728.

[0138] Compound P-0728 was synthesized in five steps from 2,4-difluorophenylamine 42 as shown in Scheme 16.

<img file="PL1893612T3_D0101.tif" />

Step 1-Preparation of dibenzyl- (2,4-difluorophenyl) -amine (52):

To 2,4-difluoro-phenylamine (42.0.0 g, 77.4 mmol) in N, N-dimethylformamide (130 mL) was added potassium carbonate (32.1 g, 0.23 mol) and benzyl bromide (21.2 mL, 0.18 mol). . The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% ethyl acetate in hexane. Appropriate fractions were combined and concentrated to give compound (52, 12.0^g 50%). MS (KSI) [M + H⁺]⁺= 310.2.

Step 2-Preparation of 3-dibenzylamino-2,6-difluoro-benzaldehyde (53):

To dibenzyl- (2,4-difluoro-phenyl) -amine (52, 4.30 g, 13.9 mmol) in tetrahydrofuran (60 mL), under nitrogen, cooled at -78 ° C, acetone / dry ice bath, added slowly n-butyllithium (2.50 M in hexane, 6.1 mL, 15.3 mmol). The reaction was stirred for 1 hour, N, N-dimethylformamide (1.2 mL, 15.3 mmol) was added and allowed to warm to room temperature over 1 hour. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% acetate

- ethyl acetate in hexane, which gave the compound (53, 4.0 g, 85%). MS (ESI) [M + H⁺]⁺ = 337.2.

Step 3-Preparation of (3-dibenzylamino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanol (54):

To 3-dibenzylamino-2,6-difluoro-benzaldehyde (53.0.76 g, 2.3 mmol) in methanol (50 mL) was added 5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine (89, 0.40 g, 2.1 mmol, prepared as described in Example 17) and potassium hydroxide (0.50 g, 8.9 mmol) under nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluted⁵% cHortóem of methylene, co ^dso-called^blethat^k (^54.0.^{60 g}. ⁵⁰%). ^MS(^ESI) [^M+^H+]⁺= ⁵³³2.

Step 4-Preparation of (3-dibenzylamino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone (55):

[0142] To (3-Cis-benzyl-2,6> -carboxyl-uoryl o) - (5-pyrrolidine n-3-yl o-1II-pyrole o | 2,3b] pyridin-3 -ethyl) -methanol (54, 0.90g, 1.7 mmol) in methylene chloride (20 mL) in DMS-10-N-butoxide (0.97 g, 2.3 mmol). The reaction was stirred at room temperature for 15 minutes. The reaction was poured into a solution of sodium bicarbonate and sodium thiosulfate and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give the compound (55, 0.70 g, 78%). MS⁽ESI) ^[M + H^{] +}= 531.2.

Step 5-Preparation of (3-dibenzylamino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone (56) :

[0143] To (3-dibenzylamino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone (55, 0.84 g, 1.6 mmol) in tetrahydrofuran (150 mL) was added sodium hydride (210.0 mg, 60% in mineral oil, 5.3 mmol) under nitrogen. The reaction was stirred for 5 minutes. Triisopropylsilyl chloride (0.80 mL, 3.8 mmol) was added and the reaction was stirred at room temperature for 3 hours. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluted¹⁰% ethyl acetate w ^he^ksan^ande^. What ^dso-called^blethat^k (^{56, 420} ny ³⁹%). ^MS(^ESI) [M +^{H +}] + = 687.4.

Step 6- Preparation of (3-Amino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone (57) :

[0144] To (3-dibenzylamino-2,6-difluorophenyl) - (5-pyridin-3-yl-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-3-yl) methanone (56) , 55.0 mg, 0.080 mmol) in methanol (15 mL) was added 20% palladium hydroxide on charcoal (20 mg). The reaction was stirred under a hydrogen atmosphere overnight. The reaction was filtered to remove the catalyst and then concentrated to give the crude compound that was used in the next step.

Step 7-Preparation of N- [2,4-difluoro-3- (5-pyridin-3-yl-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -ethanesulfonamide (58) :

[0145] To (3-Amino-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone (57) , 35.0 mg, 0.069 mmol) in methyl chloride (6 mL) was added methanesulfonyl chloride (0.30 mL, 3.9 mmol) and triethylamine (0.40 mL, 2.9 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried with anhydrous sodium sulfate and concentrated to give the crude compound which was used in the next step.

Step 8-Preparation of N- [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -ethanesulfonamide (P-0728):

[0146] To N- [2,4-difluoro-3- (5-pyridin-3-yl-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -ethanesulfonamide (58, 35.0 mg, 0.060 mmol) in tetrahydrofuran (10 mL) was added tetra-n-butylammonium fluoride (19 mg, 0.072 mmol). The reaction was stirred at room temperature for 5 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanocon in methylene chloride, which^dand^Labout^blethat^k (^p-^{0728, 5}.⁶ m^{g 22}%). MS (ESI) [M +^{H +}]⁺= 443.1.

Example 5-Preparation of [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide propan-1-sulfonic acid P-0850 .

[0147] Compound P-0850 was synthesized in four steps from 2,4-difluorophenylamine 42 as shown in Scheme 17.

<img file="PL1893612T3_D0102.tif" />

Step 1- Preparation of propane-2-sulfonic acid (2,4-difluoro-phenyl) -amide (59):

[0148] To 2,4-difluoro-phenylamine (42, 4.0 mL, 40.0 mmol) in methylene chloride (50 mL) pyrimidines (3.37 mL, 42.3 mmol), propane-2-sulfonyl chloride (6.00 g, 42.3 mmol) were added. and dimethylaminopyridine (0.20 g, 1.64 mmol) under nitrogen. The reaction was stirred at 45 ° C overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 3% methanol in methylene chloride to give a white solid (59.0 8.0 g, 85%). MS (ESI) [M^-H⁺] '= 234.0.

Step 2- Preparation of propane-2-sulfonic acid (2,4-difluoro-formyl) -amide (60):

To 1. propan-2-sulfonic acid (2,4-difluoro-phenyl) -amide of propane-2-sulfonic acid (59, 2.35 g, 9.95 mmol) in tetrahydrofuran (70 mL), under a nitrogen atmosphere, ice-cold dry bath, added 1.60M n-butyllithium (1.60 M in hexane, 6.53 mL, 10.45 mmol). The reaction was stirred for 40 minutes after which another part of n-butyllithium (1.60 M in hexane, 6.84 mL, 10.94 mmol) was added. The reaction was stirred for I hour and N, N-dimethylformamide (0.92 mL, 11.9 mmol) was added. The reaction was allowed to warm to room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel (dichloromethane / methanol 5%) to give the compound (60, 1.4 g, 53.4%). MS⁽ESI) [M^-+ H] '= 263.4.

Step 3-Preparation of {2,4-difluoro-3- [hydroxy- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl] -amide of propanoic acid 2-sulfonic acid (61):

To propane-2-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide (60, 220.0 mg, 0.83 mmol) in methanol (15 mL) was added 5-pyridin-3-yl-1H -pyrrolo [2,3-b] pyridine (89,

- 57 150.0 mg, 0.77 mmol, prepared as described in Example 17) and potassium hydroxide (537.0 mg, 9.6 mmol) under nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in dichloromethane to give the compound (61, 160 mg, 45.3%). In this step, it reduces the compound {2,4-difluoro-3- [methoxy- (5-pyridin-3-yl] H-pyrrolo [2,3-b] pyridin-3-yl) methyl] -phenyl] -amide propane-2-sulfonic acid has also been formed and isolated. MS (ESI) [M + H +] + = 460.1.

Step 4-Preparation of [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-carbonyl) -phenyl] -amide of propane-2-sulfonic acid (P- 0850):

{2,4-Difluoro-3- [hydroxy- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -amide of propanoic acid 2-sulfonic acid (61, 40.0 mg, 0.087 mmol) in tetrahydrofuran (10 mL) was added Dess-Martin periodinane (48.0 mg, 0.11 mmol). The reaction was stirred at room temperature for 5 minutes. The reaction was poured into a solution of sodium thiosulfate and potassium carbonate and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give the compound (P-0850, 13.4 mg, 33.5%). MS⁽ESI^{) [}M + H^{] +}= 458.1.

N- (2,4-difluoro-3-formyl-phenyl) -3-trifluoromethyl-benzenesulfonamide 579, N (2,4-difluoro-3-formyl-phenyl) -4-trifluoromethyl-benzenesulfonamide 580, and N - (2,4-difluoro-3-formyl-phenyl) -4-fluoro-benzenesulfonamide 581 and (2,4-difluoro-3-formyl-phenyl) -carbamic acid benzyl ester

<img file="PL1893612T3_D0103.tif" />

prepared according to the protocol of Steps 1 and 2 of Scheme 17, substituting propane-1-sulfonyl chloride with 3-trifluoromethyl-benzenesulfonyl chloride, 4-trifluoromethyl-benzenesulfonyl chloride, 4-fluoro-benzenesulfonyl chloride and benzyl chloroformate in Step 1, respectively.

[4-Chloro-3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluoro-phenyl] -amide propane-1-sulfonic acid P-0806

<img file="PL1893612T3_D0104.tif" />

was prepared according to Scheme 17, substituting 2,4-difluoro-phenylamine

4-Chloro-2-fluoro-phenylamine and propane-2-sulfonyl chloride with propanesulfonyl chloride in Step 1, and 5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine 89 5-chloro-7-aam^dOKM ⁸0 (^pthe nose of Prz^skla^d 9) in ^Ethis^pie ³. M^S(^ESI) [M + ^H+] + =⁴³0.E [propane-1-sulfonic acid [4-chloro-2-fluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide P-0904

<img file="PL1893612T3_D0105.tif" />

was prepared according to Scheme 17, substituting 2,4-difluoro-phenylamine

4-chloro-2-fluoro-phenylamine and propane-2-sulfonyl chloride with propanesulfonyl chloride in Step 1, and 5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine 89- azaindole 94 in et^apand^e 3. MS⁽ESI) ^[M + H^{+] +}= 396.2.

[0155] Thiophene-2-sulfonic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide P-1267

<img file="PL1893612T3_D0106.tif" />

prepared according to the protocol of Steps 3 and 4 of Scheme 17, substituting 5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine 89 5-chloro-7-azaindole 80 (see Example 9) and (2,4-difluoro-3 -formyl-phenyl) -amide of propane-2-sulfonic acid 60 (2,4-difluoro-3-formyl-phenyl) -amide of thiophene-2-sulfonic acid 512 (see Example 21) in Step 3. MS⁽ESI) ^[M + H '^]'= 451.9.

[0156] Thiophene-3-sulfonic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide P-1268

<img file="PL1893612T3_D0107.tif" />

was prepared using the Steps 3 and 4 protocol of Scheme 17, substituting 5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine 89 5-chloro-7-azaindole 80 (see Example 9) and (2,4-difluoro-3 -formyl-phenyl) -amide of propane-2-sulfonic acid 60 (2,4-difluoro-3-formyl-phenyl) -amide of thiophene-3-sulfonic acid 513 (see Example 21) in Step 3. MS⁽ESI) ^[M + H +^{] +}= 454.1.

[0157] Additional compounds were prepared according to Scheme 17, optionally replacing propane-2 = sulfonyl chloride with the appropriate acid chloride in Step 1 and / or 5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine with the appropriate azaindol in Stage

3. Azindindols have been removed from zxkpionelub or from Akytisylated Akzoisanow, Examples 1, 3, 1 4, 1 6 and 17. Some compounds were isolated after Step 3, or as hydroxy or methoxy derivatives. The following compounds were made following this procedure:

{3- [5- (4-Chloro-phenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluorophenyl} -amide dimethylamino-1-sulfonic acid (P-1257) .

N- [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -benzenesulfonamide (P-0798), [3- (5-bromo) 1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide propane-1-sulfonic acid (P-0773), [3- (5-bromo-1H-pyrrole Dimethylamino-1-sulfonic acid [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-0898),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] benzenesulfonamide (P-0885),

N- [2,4-difluoro-3- (5-fluoro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-0902), {2,4-difluoro-3 - [Propyl-1-sulfonic acid [hydroxy- (5-isopropenyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] phenyl} -amide (P-1239), [2,4-difluoro -3- (5-isopropenyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide Propane-1-sulfonic acid (P-0991), {2,4-difluoro-3- [ Hydroxy ((5-methyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] propyl-1-sulfonic acid (P-1240), propane-6-phenyl} -amide, {2,4-difluoro 3- [methoxy- (5-methyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] phenyl} -amide propane-1-sulfonic acid (P-1241), {2.4 -Phenyl-3- [hydroxy- (5-isopropyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] phenyl} -amide propane-1-sulfonic acid (P-1242), [2 , Propan-1-sulfonic acid 4-difluoro-3- (5-isopropyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-0997), {2,4-Difluoro-3- [hydroxy- (5-methoxy-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] phenyl} -amide propane-1-sulfonic acid (P-1243), { 2,4-Difluoro-3- [methoxy- (5-methoxy-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] phenyl} -amide propane-1-sulfonic acid (P-1244) , {2,4-difluoro-3- [hydroxy- [5- (4-methyl-piperazin-1-yl) -1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl} -phenyl} -amide propane-1-sulfonic acid (P-1245), propanoic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide 1-Sulfonic acid (P-0933), propane-1-sulfonic acid [2,4-difluoro-3- (5-fluoro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide (P-0907), piperidine-1-sulfonic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P- 1020),{2,4-Difluoro-3- [methoxy- (5-methoxy-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] phenyl} -amide propane-1-sulfonic acid (P-1244 ), {2,4-difluoro-3- [hydroxy- [5- (4-methyl-piperazin-1-yl) -1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl} -phenyl} - propane-1-sulfonic acid propionate (P-1245), propanoic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide 1-sulfonic (P-0933), propane-1- [2,4-difluoro-3- (5-fluoro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide Sulfonic acid (P-0907), piperidine-1- sulfonic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P -1020){2,4-Difluoro-3- [methoxy- (5-methoxy-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] phenyl} -amide propane-1-sulfonic acid (P-1244 ), {2,4-difluoro-3- [hydroxy- [5- (4-methyl-piperazin-1-yl) -1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl} -phenyl} - propane-1-sulfonic acid propionate (P-1245), propanoic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide 1-sulfonic (P-0933), propane-1- [2,4-difluoro-3- (5-fluoro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide Sulfonic acid (P-0907), piperidine-1- sulfonic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P -1020)Propane-1-sulfonic acid 3-b] pyridin-3-yl) methyl} -phenyl} -amide (P-1245), [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-one] propan-1-sulfonic acid carbonyl) -2,4-difluoro-phenyl] -amide (P-0933), [2,4-difluoro-3- (5-fluoro-1H-pyrrolo [2,3-b] pyridine -3-carbonyl) -phenyl] -amide of propane-1-sulfonic acid (P-0907), [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4 piperidine-1-sulfonic acid-difluoro-phenyl] -amide (P-1020),Propane-1-sulfonic acid 3-b] pyridin-3-yl) methyl} -phenyl} -amide (P-1245), [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-one] propan-1-sulfonic acid carbonyl) -2,4-difluoro-phenyl] -amide (P-0933), [2,4-difluoro-3- (5-fluoro-1H-pyrrolo [2,3-b] pyridine -3-carbonyl) -phenyl] -amide of propane-1-sulfonic acid (P-0907), [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4 piperidine-1-sulfonic acid-difluoro-phenyl] -amide (P-1020),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-methoxy-benzenesulfonamide (P-0983),

N- [3- (4-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] benzenesulfonamide (P-0954),

N- [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] acetami (P-1002), [3- ( 1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide dimethylamino-1-sulfonic acid (P-0950), [3- (5-pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide, dimethylamino-1-sulfonic acid (P-0837), [3- (5-chloro-1H-pyrrole Dimethylamino-1-sulfonic acid [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1258), [3- (5-bromo-1H-pyrrolo [2, 3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide of butane-1-sulfonic acid (P-1263), [2,4-difluoro-3- (5-methoxy-1H-pyrrole [2,3-b] pyridine-3-carbonyl) -phenyl] -amide, butane-1-sulfonic acid (P-1264),

- Butyl-1-sulfonic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1265), 3- (5-Ethoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide propane-1-sulfonic acid (P-1252), {2.4 -Phenyl-3- [5- (2-methoxy-ethoxy) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide propane-1-sulfonic acid (P-1253), {3 - [5- (2-Diethylamino-ethoxy) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl} -amide propan-1-sulfonic acid (P-1254),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-ethyl-benzenesulfonamide (P-1700),

N- [3- (5-ethyl-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-trifluoromethyl-benzenesulfonamide (P-1783), [3- (5-bromo) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide, thiophene-3-sulfonic acid (P-1798), [3- (5-chloro-1H-) pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide of benzo [b] thiophene-2-sulfonic acid P-1799, [3- (5-chloro-1H-pyrrole [2,3-b] Pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide 5-pyridin-2-yl-thiophene-2-sulfonic acid (P-1800),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-cyanobenzenesulfonamide (P-1822),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-fluoro-4-methyl-benzenesulfonamide (P-1823),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-isopropyl-benzenesulfonamide (P-1839),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -fluoro-benzenesulfonamide (P-1840),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3,5-difluorobenzenesulfonamide (P-1841),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-methyl-benzenesulfonamide (P-1842),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-oxazol-5-yl-benzenesulfonamide (P-1843),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-fluorobenzenesulfonamide (P-1865),

N- {2,4-difluoro-3- [5- (2-methoxy-ethoxy) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -62-phenyl} -3-fluoro-benzenesulfonamide (P -1871), N- {2,4-difluoro-3- [5- (2-methoxyethoxy) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl} -4-fluoro-benzenesulfonamide ( P-1872), {2,4-difluoro-3- {5- [4- (2-methoxy-ethoxy) -phenyl] -1H-pyrrolo [2,3-b] pyridine-3-carbonyl} -phenyl] -amide propane-1-sulfonic acid (P-1998),

N- {2,4-difluoro-3- [5- (2-methoxy-ethoxy) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl} -4-trifluoromethyl-benzenesulfonamide (P-2005 ), and N- (2,4-difluoro-3- {5- [4 (2-methoxy-ethoxy) -phenyl] -1H-pyrrolo [2,3-b] pyridine-3-carbonyl} -phenyl) - 4-trifluoromethyl-benzenesulfonamide (P-2013).

[0158] The following table indicates the acid chloride (column 2) and azaindol (column 3) used to obtain the target compound (column 4). Column 1 contains the compound number and column 5 of the observed mass. The compounds isolated after Step 3 of Scheme 17 are marked in column 1.

- 63 observed

<img file="PL1893612T3_D0108.tif" />

N

<img file="PL1893612T3_D0109.tif" />

ABOUT

AT

cd

AND

PL o

ΙΟ

I pl cn

ΙΟ pl o

oi

en

LA o

and

EN

<td>Observed MS (ESI) ^[M + H +] +</td><td>+ - s θ</td><td>&lt;NN d ta 5? δ</td><td>&lt;N ABOUT &lt;N T</td><td>+ in &lt;6 's δ</td><td>it's ffi 2 th</td>

<td>Relationship</td><td>£ 0 1 WITH AND I ^ '</td><td>$ ^x ABOUT Λ</td><td>0 ν / 'φο WITH Λ / Χ ί 4 ^ * 0, u 'Λ Γ \ &lt;</td><td>with / Ύ¹TCT ΟΧ²¹1H f /</td><td>0 gk u Ί θ / γ żx Ψ</td>

<td>azaindole</td><td>ast H</td><td>I Λ</td><td>/ * ZX LJ about</td><td>fzx P</td><td>&lt;a K V /</td>

<td>Sulfonyl chloride</td><td>* 0</td><td>ABOUT p Ύ</td><td>S¹Ύ</td><td>3 · What λ</td><td>33 WHAT AND</td>

<td></td><td>&lt;N ABOUT ABOUT ABOUT ώ</td><td>&lt;N CL ώ W</td><td>about about about ώ</td><td>3 &lt;N CL o3 CL W</td><td>&lt;N CL o3 CL W</td>

- 65 observed

<td colspan="2">Watchers MS (ESI) [M⁺H +⁺</td><td>Ι-Ϊ</td><td>422.3</td><td>+ CC hg &lt;N</td><td>+ sc WELL You S Ι-Ϊ</td><td>^ck ffi ° &lt;&lt; 00 g Tl- &amp;</td>

<td></td><td></td><td>0 kR 2</td><td>0</td><td></td><td>you^R0</td><td>WITH</td>

<td></td><td></td><td>As / I 0 * And Λ</td><td>2 ck</td><td>ζ ck</td><td>_{Λ &lt;}JJ-u.</td><td>• v # z ^ X £ k u: γ</td>

<td></td><td></td><td>ykzi¹6</td><td>L 1 θ-χγ ζχ pz</td><td>uf | dft¹ ABOUT</td><td>uy _ / SS ^ zi 0 Yi 'G²</td><td>round¹· X / with</td>

<td></td><td rowspan="2">•about &amp; N</td><td>Λ</td><td></td><td>-c</td><td>-about^with</td><td>about</td>

<td></td><td></td><td></td><td></td><td></td><td>/</td>

<td></td><td></td><td>&lt;21</td><td></td><td></td><td>Pzi</td><td>C ZX</td>

<td></td><td></td><td>P</td><td>&amp;</td><td>FJZ</td><td>k</td><td>Ep</td>

<td></td><td></td><td></td><td>- &lt;</td><td>with</td><td>1</td><td>/ ~ F</td>

<td></td><td>about .s 'c3 N</td><td></td><td>\</td><td>-0</td><td>-0</td><td>/</td>

<td colspan="2">Sulfonyl chloride</td><td>* s</td><td>about about* k</td><td>about k</td><td>ABOUT c * What λ</td><td>5 · ABOUT k</td>

<td></td><td></td><td>Γ " ΓΓ C '-I C</td><td>ο HE Ok ο</td><td>&lt;a, &lt;s i-l o3</td><td>3 ~ You C '-I S</td><td>&lt;-a &lt;a, 1-H 03</td>

<td></td><td></td><td>ώ ω</td><td>ώ</td><td>¹pl ω</td><td>ώ ω</td><td>¹ 'CJ pl ω</td>

<td>Observed MS (ESI) [M + H +] +</td><td>414.2</td><td>+ - κ Ο JL £ S</td><td>455.2</td><td>+ - K WHAT JL</td><td>448.2</td>

<td>Relationship</td><td>0 $ and V = z l δ</td><td>0 Ο Ή &amp; β! 0</td><td>(V υ = 0 AND δ</td><td>° "fb? V / TEO okay u 1 &lt;/ P&gt; g and / n ϋ</td><td>AND^f$ uy₀VZI⁰ IN δΌ in</td>

<td>azaindole</td><td>/ Ζχ Η Η δ</td><td>Η λ⁷</td><td>X /²¹H δ</td><td>ZZI H h⁷δ</td><td>Ο'ζι_s a5 A = /</td>

<td>Sulfonyl chloride</td><td>5 Ύ</td><td>05 c? Ύ</td><td>ϋ W / \^IN'ABOUT</td><td>** · Ι-0-Ο⁷</td><td>° -θ</td>

<td></td><td>ηι ηι Ο Ο CL</td><td>r ~ about about about cl</td><td>about &lt;N ABOUT 1 CL</td><td>m 00 about about^ώ</td><td>ur ABOUT ABOUT CL</td>

<td>Observed MS (ESI) ^[Μ + Η^+]+</td><td>393.2</td><td>381.2</td><td>458.1</td><td>415.1</td><td>472.1 474.1</td>

<td></td><td>Y ° 2</td><td>AT / T °</td><td>\ 0 / ^foO 2</td><td rowspan="3">A2 / V. lk tr v</td><td>and 0 '&lt;Z "Ao with</td>

<td></td><td>cc</td><td>with rt¹</td><td></td><td>ATI JGA</td>

<td></td><td></td><td>IA</td><td>it 1</td><td>u 1</td>

<td></td><td></td><td>uf</td><td>° f^Z1</td><td>L \</td><td>0Ύ?¹</td>

<td></td><td>Q</td><td></td><td></td><td>0 \ _JQ</td><td>AND</td>

<td>Relationship</td><td>ABOUT ^ from</td><td>in</td><td></td><td>d</td><td>AT C</td>

<td></td><td>/ "Make</td><td></td><td>/ 'Zi</td><td>^^ zx</td><td>Azi</td>

<td></td><td>H</td><td>Λ4</td><td>&lt;Q^with/AND</td><td>AND</td><td>&lt;A</td>

<td rowspan="2">azaindole</td><td></td><td></td><td>λβ!_Ζ'</td><td>/</td><td>ii</td>

<td>^Vwith</td><td></td><td></td><td>□</td><td>aa</td>

<td rowspan="2">Sulfonyl chloride</td><td>ABOUT K</td><td>About&gt; oz&gt; • \, _, -</td><td>ABOUT CM ABOUT</td><td>¢ 3 CM ABOUT</td><td>σ CM ABOUT WHAT 7</td>

<td></td><td>/</td><td>and</td><td>WITH</td><td></td>

<td></td><td>P-1002</td><td>P-0950</td><td>P-0837</td><td>P-1258</td><td>P-1263</td>

<td>Observed MS (ESI) [M⁺H⁺]⁺</td><td>424.2</td><td>426.0</td><td>1 + X 1 s</td><td>424.2</td><td>454.2</td><td>495.3</td>

<td></td><td>k / ^ o about/:</td><td colspan="2">1 ζ Α / Ι ck</td><td>-/''and</td><td>C in^--0 ζ VI λ / U_at 1</td><td>ky ζ lk L ί</td>

<td></td><td>1 1; 'kC^with</td><td>ik</td><td>fi</td><td>f 0</td><td></td><td>(THIS at 0</td>

<td></td><td></td><td></td><td>y = z</td><td>0</td><td>ο r-</td><td>&lt;2 0</td>

<td>Relationship</td><td>-c</td><td></td><td>^ϋ</td><td></td><td>V / °</td><td>at</td>

<td></td><td>Æ?¹</td><td colspan="2"></td><td></td><td>^ ζχ</td><td>/ * ZX</td>

<td></td><td>Q</td><td></td><td>2-</td><td>t *^with</td><td>/ 0</td><td>0 0</td>

<td>azaindole</td><td>-0</td><td>ABOUT</td><td></td><td></td><td></td><td>Id</td>

<td>Chloride sulfonyl</td><td>and</td><td colspan="2">§ What</td><td></td><td>CT m X</td><td>WHAT &lt;</td>

<td></td><td>P-1264</td><td colspan="2">P-1265</td><td>P-1252</td><td>P-1253</td><td>P-1254</td>

- 69 ODserwowan

<td colspan="3">&lt;-h HH About tzf + ? 7 ""</td><td rowspan="2">476.2</td><td rowspan="2">510</td><td rowspan="2">495.9</td><td rowspan="2">K At 2 &amp;</td><td rowspan="2">502.0 (-)</td><td colspan="2" rowspan="2">531.1</td>

<td colspan="2">ABOUT (ZI ABOUT D o</td><td>+ 2</td>

<td></td><td></td><td></td><td>/ ~ fl ° V "" = Q 2 As / X</td><td>ks / ^ o with % of ZX Lau</td><td colspan="2">C_aboutwith L / A * ll</td><td>oy and</td><td>C²&lt;2</td><td>ABOUT // 2 'x</td>

<td></td><td></td><td></td><td>ΙΛι</td><td></td><td>at; \</td><td></td><td rowspan="2"></td><td rowspan="2">IB u: y σ</td><td></td>

<td></td><td></td><td></td><td>ι / Λ cTf?¹</td><td>Ll 1 CRF ^¹</td><td>about</td><td>C^with</td><td>*at. γΖΙ</td>

<td></td><td></td><td></td><td>q</td><td>ABOUT</td><td></td><td>ά</td><td>q</td><td></td><td>C^with</td>

<td></td><td>L4 ABOUT</td><td></td><td>(Γ</td><td></td><td></td><td></td><td>about</td><td colspan="2">ABOUT</td>

<td></td><td>&amp;</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td>WITH</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td>N</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td>^ ZI</td><td></td><td colspan="2">&lt;Ζ "ζζ</td><td>H7T</td><td></td><td>^ ZI</td>

<td></td><td></td><td></td><td>H</td><td>B</td><td>ff</td><td></td><td>M</td><td>Γ</td><td>V with</td>

<td></td><td></td><td></td><td>\ = 7</td><td>V /</td><td colspan="2"></td><td>\ = /</td><td colspan="2">\ ^ - 7</td>

<td></td><td>2 Ό . £</td><td></td><td>δ</td><td></td><td>ώ</td><td></td><td>about</td><td>about</td><td></td>

<td></td><td>'3 hd</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td>L&gt; &lt;</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td>£ 3 L4 ABOUT at-</td><td></td><td>AND⁷</td><td>L (y</td><td>V " 9 8-</td><td>ϋ</td><td>0 "* C0</td><td>$ Λ "AJ</td><td>B</td>

<td></td><td>ABOUT 2</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td>about</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td></td><td></td><td></td><td>about</td><td>* Γ Ί</td><td></td><td>OO</td><td>about</td><td>about</td><td>)</td>

<td></td><td></td><td></td><td>&lt;-&gt;</td><td>WSJ</td><td></td><td>AT'</td><td>AT"</td><td>oc</td><td>)</td>

<td></td><td></td><td></td><td>1 Pl</td><td>EN</td><td></td><td>1 EN</td><td>EN</td><td>en</td><td>1</td>

- 70 observed

<td colspan="2">Watchers MS (ESI) [M⁺H⁺]⁺</td><td>473.1</td><td>480.1</td><td>00 00 tr</td><td>464</td><td colspan="2">C 00 tr</td>

<td></td><td></td><td>θΌΧ 2</td><td>~ 9</td><td>tv</td><td>4½</td><td>AT. and</td><td>L ·? P «° pO</td>

<td></td><td></td><td rowspan="2">u 1</td><td rowspan="2"></td><td>1 WITH</td><td>and</td><td></td><td>έ</td>

<td></td><td></td><td>N I</td><td>pr¹</td><td></td><td>zx</td>

<td></td><td></td><td></td><td></td><td></td><td>l / Ut</td><td colspan="2">Kau.</td>

<td></td><td></td><td></td><td rowspan="2">about</td><td>lft</td><td>UTM^oAfF</td><td>u. ί G</td><td>^&gt; 1</td>

<td></td><td></td><td>0</td><td>pz</td><td>H</td><td></td><td>&lt;/ z</td>

<td></td><td></td><td></td><td></td><td>YSS /</td><td>H</td><td></td><td></td>

<td></td><td>Relationship</td><td></td><td></td><td>ϋ</td><td>/ -in* Q</td><td></td><td>ABOUT</td>

<td></td><td></td><td>ΑΤζΣΕ</td><td></td><td></td><td>^ ZX</td><td colspan="2"></td>

<td></td><td></td><td>/ ^^WITH</td><td>CS</td><td>\ ²</td><td>\ S</td><td></td><td>j</td>

<td></td><td>azaindole</td><td>about</td><td>about</td><td>about</td><td>about</td><td>about</td><td></td>

<td colspan="2" rowspan="2">Sulfonyl chloride</td><td>ΰ "Ό"^ξ</td><td>1-4-</td><td>and / y /</td><td>S-AV-l</td><td>% ol ABOUT in-</td><td>ll / "Λ</td>

<td></td><td></td><td>\ = s / \</td><td>IN</td><td></td><td>IX</td>

<td></td><td></td><td>04</td><td>m Γχΐ</td><td>oh</td><td>ABOUT</td><td></td><td></td>

<td></td><td></td><td>CN 00</td><td>CN 00</td><td>ro 00</td><td>\ r 00</td><td></td><td>tr 00</td>

<td></td><td></td><td>AND EN</td><td>AND EN</td><td>AND EN</td><td>AND EN</td><td></td><td>AND EN</td>

<td>Observed MS (ESI) ^[M⁺+ H] +</td><td>And that About HP ko 2 Ή -</td><td>AND ΓΌ '</td><td>432.1</td><td>506.2</td><td>506.2</td>

<td></td><td>yy k / 'W'O Stewards / X</td><td>fO WV VSW = o</td><td>fj? VO? A 1</td><td>Loam av</td><td>Ύ1Λ WMO</td>

<td></td><td>LA</td><td>A / I la</td><td>WITH of / I</td><td rowspan="2">1 with Λ / Ι L ^{U 11}</td><td>2 ZVI</td>

<td></td><td>Perkin&gt; x</td><td>UFX</td><td>ck</td><td>0 · u.</td>

<td></td><td>G²</td><td rowspan="2">f2 about</td><td>ii and</td><td>_Ο-Υ ^? Ζχ</td><td>yttrium 1 χ</td>

<td rowspan="2">Relationship</td><td>ϋ</td><td>O ^ f21</td><td>\ o ° ^ 0</td><td>oYf k Q</td>

<td></td><td></td><td></td><td></td><td>ad</td>

<td></td><td>f ^ zz</td><td></td><td>f ^ 2X</td><td>r ^ zi</td><td>zz ^</td>

<td></td><td>fi</td><td>/"and</td><td rowspan="2"></td><td>fi</td><td>M</td>

<td></td><td>= ^ /</td><td>\ = ^</td><td>y = /</td><td></td>

<td>azaindole</td><td>about</td><td>about</td><td></td><td>Æ</td><td>c about-</td>

<td rowspan="3">Sulfonyl chloride</td><td>ly</td><td rowspan="2">0</td><td>Lqu</td><td>and J ARE</td><td>0 s / s.</td>

<td rowspan="2"></td><td rowspan="2">\ = /</td><td rowspan="2">IN</td><td rowspan="2">\ = /</td>

<td></td>

<td></td><td rowspan="2">&lt;N 00 1 ph</td><td rowspan="2">WHAT Ή 00 1 ph</td><td rowspan="2">MD kO OO 1 ph</td><td>1? oo</td><td rowspan="2">&lt;N 1? OO 1 ph</td>

<td></td><td>1 ph</td>

<td>Observed MS (ESI) [M + H ++</td><td></td><td>530.3</td><td>556.0</td><td>539.2</td>

<td></td><td>IN</td><td>ABOUT</td><td></td><td>lT</td>

<td></td><td>cf about</td><td>Λ Λ -X</td><td rowspan="2">ΌΑ WITH</td><td>&amp;</td>

<td></td><td rowspan="2">IX</td><td></td><td>with</td>

<td></td><td></td><td>Λχ / Ι</td><td></td>

<td></td><td></td><td></td><td>IAU.</td><td></td>

<td></td><td>j</td><td></td><td>uf ξ</td><td>σΓ /²¹</td>

<td></td><td>at.</td><td></td><td></td><td>/ x</td>

<td></td><td>C</td><td>O_J =&gt; -</td><td>&lt;J</td><td>_t - /</td>

<td>Relationship</td><td></td><td></td><td>q- ^ W with</td><td>f N- o</td>

<td></td><td></td><td></td><td>^ "ZLZ</td><td>C?^x</td>

<td></td><td></td><td>tz</td><td>C^with</td><td>vz</td>

<td>azaindole</td><td>d5</td><td>o_p-</td><td>c '</td><td>V?^ABOUTYP ~</td>

<td></td><td>δ</td><td>about</td><td>f /</td><td></td>

<td rowspan="2">Sulfonyl chloride</td><td></td><td>about* What )</td><td>and / u</td><td>ay-</td>

<td>\ Y ** /</td><td>\</td><td></td><td></td>

<td></td><td></td><td>00 HE HE ώ</td><td>P-2005</td><td>P-2013</td>

Example 6: Synthesis of [2,4-difluoro-3- (5-phenylamino-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide propane-1-sulfonic acid P-0848 and related compounds.

[2,471] [2,4-difluoro-3- (5-phenylamino-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide Propane-1-sulfonic acid P-0848 was synthesized in five steps from 5bromo-7-azaindol 67 as shown in Scheme 18.

<img file="PL1893612T3_D0110.tif" />

Step 1 - Preparation of 5-bromo-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (68):

[0160] To 5-bromo-7-azaindole (67, 1.5 g, 7.6 mmol) in N, N-dimethylformamide (20 mL) were added sodium hydroxide (60% in mineral oil, 0.27 g, 11.0 mmol) and trriisopropylsilyl chloride (2.6 mL, 12.0 mmol) under nitrogen. The reaction was stirred for 2 hours at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% ethyl acetate in^he^ksan^ande^. What ^daio zw^blethat^k (^{68, 1.6} g. ⁵9%). M^S(E^SI) [M +^{H +}]⁺ = ³⁵².³.

Step 2 - Preparation of 5-phenyl- (1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-5-yl) amine (69):

[0161] Aniline (0.04 mL, 0.42 mmol) was added to 5-bromo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (68, 0.10 g, 0.3 mmol) in toluene (5 mL), tert Sodiumbutoxide (0.15 g, 1.56 mmol), tris (dibenzylideneacetone) dipalladium (0) (9.2 mg, 0.01 mmol) and (S) - (-) - 2,2'bis (diphenylphosphino) -1,1'-binaphthyl (6.3 mg, 0.01 mmol). The reaction was heated to 160 ° C for 10 minutes in a CEM Discover microwave. The reaction was concentrated and purified by column chromatography on silica gel eluting with 3% ethyl acetate^ylu ^he^ksan^ande^. What ^daio zw^blethat^k (^{69, 40} m^{g 40}%). ^MS(^ESI) [^M+^H+]⁺= ³⁶⁶.⁶.

- Step 3 Preparation of phenyl- (1H-pyrrolo [2,3-b] pyridin-5-yl) -amine (70):

[0162] 5-phenyl- (1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -amine (69, 0.14 g, mmol) in tetrahydrofuran (3.0 mL) was added with tetra-n-fluoride. butylammonium (0.197 g, 0.76 mmol). The reaction was stirred for 1 hour at room temperature. The reaction was concentrated and purified by column chromatography on silica gel eluting with 3% ethyl acetate in hexane to give the compound (70, 60 mg, 76%). MS⁽ESI^{) [}M + H^]+ = 210.3.

Step 4-Preparation of propane-1-sulfonic acid {2,4-difluoro-3- [hydroxy- (5-phenylamino-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -amide. 71)

To Phenyl - (- 1H-pyrrolo [2,3-b] pyridin-5-yl) -amine (70, 17.0 mg, 0.09 mmol) in methanol (5.0 mL) potassium hydroxide was added (92.0 mg, 1.6 mmol) and propane-1-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide (73.19.0 mg, 0.072 mmol, prepared as described in Example 7) under nitrogen. The reaction was stirred for 12 hours at room temperature. The reaction was concentrated and purified by column chromatography on silica gel eluting with 1% methanok w^dic^hlOromë^tan^ande^. What ^dso-called^blethat^k (^{71, 17} m^{g 50}%). ^MS(^ESI) [^M+^H+]⁺=

473.5.

Step 5 -Prepare [2,4-difluoro-3- (5-phenylamino-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide propan-1-sulfonic acid (P-0848):

[0164] To propano-1-sulfonic acid {2,4-difluoro-3- [hydroxy- (5-phenylamino-1H-pyrrolo [2,3-b] pyridin-3-yl) methyl] -phenyl} -amide (71, 7.5 mg, 0.016 mmol) in tetrahydrofuran (3 mL) was added Dess-Martin periodinane (6.70 mg, 0.0158 mmol) under nitrogen. The reaction was stirred for 20 minutes. The reaction was concentrated and purified by column chromatography on silica gel eluting with 1% methanol in dichloromethane to give the compound (P-0848, 6.2 mg, 84%). MS⁽ESI^{) [}M + H^{] +}= 471.2.

[⁰¹⁶5] [^2.4-^{difluoromethyl}uoro-³- (⁵-plague^fabout^ln⁴-^ylabout-^1H-^piro^labout[^2.3-^b]^piry^dyWell-³-^kar^bhe^ylabout)-^fen^ylo propan-1-sulfonic acid amide P-0853, {2,4-difluoro-3- [5- (4-methyl-piperidin-1-yl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl ] -phenyl-propan-1-sulfonic acid-P-0860, and {2,4-difluoro-3- [5- (4-methyl-piperazin-1-yl) -1H-pyrrolo [2,3-b] ] pyridine-3-carbonyl] -phenyl} -amide of propane-1-sulfonic acid P-1246,

<img file="PL1893612T3_D0111.tif" />

and accordingly

<img file="PL1893612T3_D0112.tif" />

were prepared using the Scheme 18 protocol, substituting aniline with morpholine, 4-methylpiperidine and 4-methylpiperazine respectively in Step 2. P-0853 MS (ESI) [M + H^+]+ = 465.2. P^-0860 MS⁽ESI) ^[M + H⁺]⁺ = 477.3. P^-1246 MS (ESI) ^[M ^- H⁺] '= 478.4.

Example 7: Synthesis of propane-1sulfonic acid (2,4-difluoro-formyl-phenyl) -amide 73.

[0166] Compound 73 was synthesized in two steps from 2,4-difluorophenylamine 42 as shown in Scheme 19.

<img file="PL1893612T3_D0113.tif" />

Step 1- Preparation of propane-1-sulfonic acid (2,4-difluoro-phenyl) -amide (72):

[0167] To 2,4-difluoro-phenylamine (42, 3.0 mL, 29.8 mmol) in tetrahydrofuran (50 mL) was added triethylamine (9.13 mL, 65.5 mmol) and propane-1-sulfonyl chloride (2.90 mL, 25.8 mmol) in nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into 1M HCl and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. Filtrate

- 76 was concentrated to give the compound (72.0.0 g, 28%) which was used in the next step.

Step 2- Preparation of propane-sulphonic acid (2,4-dluoro-3-formyl-phenyl) -amide (73):

To propane-1-sulfonic acid (2,4-difluoro-phenyl) -amide (72, 1.5 g, 6.38 mmol) in tetrahydrofuran (10 mL) under a nitrogen atmosphere, cooled at -78 ° C. acetone / dry bath ice, lithium diisopropylamide (0.80 M in tetrahydrofuran 24 mL, freshly prepared from n-butyllithium and diisopropylamine) was added. After 30 minutes acetone N, N-dimethylformamide (542 mL, 7.018 mmol) was added dropwise to the reaction. The reaction was stirred for 30 minutes at -78 ° C and then allowed to warm to room temperature over 40 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 5% ethyl acetate in hexane, which gave light yellow solids (73, 300 and 18%). MS (ESI) [M^-H⁺] '= 262.3.

Example 8: Synthesis of 5-chloro-1H-pyrrolo [2,3-b] pyridine 80.

[0169] Compound 80 was synthesized in two steps from 5-bromo-1-triisopropylsilyl-7-azaindol 68 as shown in Scheme 21.

<img file="PL1893612T3_D0114.tif" />

Step 1 - Preparation of 5-chloro-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (79):

[0170] To 5-bromo-1-triisopropylsilyl-7-azaindole (68, 1.60 4.53 mmol, prepared as described in Example 6) in tetrahydrofuran (50.0 mL), tert-butyllithium was added under nitrogen at -78 ° C ( 1.70 M in hexane, 6.12 mL). The reaction was stirred for 1 hour, after which hexachloroethane (1.29 g, 5.43 mmol) was added. The reaction was stirred for 3 hours, poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the crude compound (79, 1.60 g).

MS⁽ESI^{) [}M + H^]+ = 309.3.

Step 2 - Preparation of 5-chloro-1H-pyrrolo [2,3-b] pyridine (80):

[0171] To 5-chloro- (1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (79, 1.40 g, 4.53 mmol) in tetrahydrofuran (15.0 mL) was added tetra-n-butylammonium fluoride (1.42 g,

- 5.43 mmol). The reaction mixture was stirred at room temperature for 10 minutes. The reaction mixture was concentrated and isolated by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give compound (80, 0.40).^g. ⁵8% ^pthrough two stages). ^MS (ESI) [^M-H⁺] '= ¹⁵³. E 5-Fluoro-1H-pyrrolo [2,3-b] pyridine 81 was prepared using the Scheme 21 protocol, substituting lieksacilloiOetan \ fnu o O - \ ((t'enYlosLllt'onvlo) ^benzenosu^lfshe M^idem in ^Ethis^pie 1. ^MS(^ESI) [^M + ^{H +}] + = ¹³⁷.E

<img file="PL1893612T3_D0115.tif" />

Example 9: Synthesis of N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] 3-methoxy-benzenesulfonamide P-0971.

[0173] Compound P-0971 was synthesized in four steps from 2,4-difluorophenylamine 42 as shown in Scheme 26.

<img file="PL1893612T3_D0116.tif" />

Step 1 - Preparation of N- (2,4-difluoro-phenyl) -3-methoxy-benzenesulfonamide (91):

[0174] To 2,4-difluoro-phenylamine (42, 0.44 mL, 4.4 mmol) in methylene chloride (10.0 mL), under a nitrogen atmosphere, pyridine (1.00 mL, 12.4 mmol) and 3-methoxybenzenesulfonyl chloride (1.00 g) were added. 4.84 mmol). After 12 hours, the reaction was poured into cold 1M HCl and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% acetate

Ethyl acetate in hexane gave a light yellow solid (91.90 g, 69%). MS (ESI) [M + H⁺]⁺ = 300.

Step 2-Preparation of N- {2,4-difluoro-3- [hydroxy- (1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -3-methoxy-benzenesulfonamide ( 92)

[0¹⁷5] To N- (2^.4-^diFluoro-Phe^ylabout)-³-me^tabout^ks^s-benzenesulfonamide^lfonam^idu (^91.0.14^{8 g 0}.4⁹4 mmol) in tetrahydrofuran (10.0 mL), cooled at -78 ° C acetone bath / dry ice, under nitrogen atmosphere, lithium diisopropylamide (0.85 M in tetrahydrofuran, 1.45 mL, 1.23 mmol) was added dropwise. After 30 minutes, 1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine-3-carbaldehyde (96, 0.15 g, 0.500 mmol, prepared as described in Example 12) was added dropwise in tetrahydrofuran (2.0 mL) for reaction. The reaction was then stirred for 1 hour at -78 ° C and allowed to reach room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 40% ethyl acetate in hexane to give a light yellow solid (92, 0.080).^g 26.8%). MS⁽ESI^{) [}M + H^]+ = 602.

Step 3-Preparation of X-I 2,4-Difho) ro-3-hydroxy-1-parolol 2,3-Halogenin-3-yl () -methyl] -phenyl} -3-methoxy-benzenesulfonamide (93):

[0176] To N- {2,4-difluoro-3- [hydroxy- (1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-3-yl) methyl] phenyl} -3-methoxybenzenesulfonamide (92, 0.075 g, 0.12 mmol) in tetrahydrofuran (3.0 mL) was added tetra-n-butylammonium fluoride (0.039 g, 0.15 mmol). The reaction was stirred at room temperature for 20 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 3% methanol in dichloromethane to give a light yellow solid (93, 0.030 g, 55%). MS⁽ESI^{) [}M + H^]+ = 446.

Step 4 - Preparation of N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] 3-methoxybenzenesulfonamide (P-0971):

To {2,4-difluoro-3- [hydroxy- (1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -3-methoxy-benzenesulfonamide (93, 0.02 g, 0.05 mmol) in tetrahydrofuran (3 mL), Dess-Martin periodinane (0.02 g, 0.015 mmol) was added under a nitrogen atmosphere. The reaction was stirred for 10 minutes at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 3% methanol in^dic^hlOromë^tan^ande^. what is kkkk ^{yellow core}a stak body (P-^0971, Deg. °^{10 g 50}%). ^MS(^ESI) [^M+^{H +}] + = 444.

[0178] Additional compounds were prepared according to Scheme 26, substituting 3-methoxy-benzenesulfonyl chloride with the corresponding sulfonyl chloride in

- 79 Step 1. The following compounds were prepared by following this procedure:

N- {2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl] phenyl] -2,5-dimethoxy-benzenesulfonamide (P-1131),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-methoxybenzenesulfonamide (P-0958), [2,4-difluoro-3- (1H) -pyrrol [2,3-b] pyridine-3-carbonyl) -phenyl] -amide piperidine-1-sulfonic acid (P-0952),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-trifluoromethyl-benzenesulfonamide (P-0931),

4-butoxy-N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-1006),

4-chloro-N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-0937),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] -3,4-dimethoxy-benzenesulfonamide, (P-1090), and

3,4-dichloro-N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-1015).

The following table indicates the sulfonyl chloride (column 2) used to obtain the target compound (column 3). Column 1 contains the compound number and column 4 of the observed mass.

<td></td><td>Sulfonyl chloride</td><td>Relationship</td><td>Watchers MS (ESI) ^[M + H^+]+</td>

<td>P-1131</td><td>| SO₂CI ύ 1</td><td>fO ^F^ 0-Q</td><td>474.2</td>

<td>P-0958</td><td>/ θ C εο ^ ο</td><td>ζ (Ρ F ΗΝ-Ι-θ-Ο⁰</td><td>444.2</td>

<td>P-0952</td><td>* (\ n-so₂ci λ_ /</td><td>Cp f Υθ V ~_H^about</td><td>421.2</td>

<td>P-0931</td><td>f₃c-f ^ -sOjC</td><td>F &lt; ° A ^ o He^F hn-s-OCF, NN o "H</td><td>482.2</td>

<td></td><td>Sulfonyl chloride</td><td>Relationship</td><td>Observed MS (ESI) [M + H⁺]⁺</td>

<td>P-1006</td><td>FC ^ ^s°^2C</td><td>Λ «.Λ Saf ⁰</td><td>486.2</td>

<td>P-0937</td><td>CHQ ^ -S0₂CI</td><td>&lt;yQ 0 frS FHN-S-fCHa y-- ^about</td><td>446.1^[M^-H +^{] -}</td>

<td>P-1090</td><td>0 - SOgCI</td><td>yQ o " What ^{f HN}-him ° 3-</td><td>474.2</td>

<td>P-1015</td><td>and-so_withthese cl</td><td>cl In o / = &lt;f HN-śKjha H Cl</td><td>480.0 482.1 [M-H +] -</td>

<td colspan="4">* Piperidine-1-sulfonyl chloride prepared from sulfuryl chloride and piperidine in acetonitrile, refluxed for 8 hours, concentrated and used without further purification.</td>

Example 10: Synthesis of 1-t-iisopropyl-cninyl-1-l-pyrrolo 2,3-b | no-3-carbaldehyde pyrids 96.

[0179] Compound 96 was synthesized in two steps from 7-azaindole 94 as described in Scheme 27.

<img file="PL1893612T3_D0117.tif" />

Step 1 - Preparation of 1H-pyrrolo [2,3-b] pyridine-3-carbaldehyde (95):

[0180] To 1H-pyrrolo [2,3-b] pyridine (94, 16.0 g, 135 mmol) in water (110 mL), hexamethylenetetramine (26.0 g, 185 mmol) and acetic acid (55.0 mL, 967 mmol) were added. . The reaction was boiled for 12 hours. Water (329 mL) was added and the reaction was cooled to room temperature. The reaction was filtered and rinsed with water to obtain^{with in}and^AZEk (95, 15.0 g, 76%). MS (ESI) [M + H⁺]⁺ = 147.

Step 2- Preparation of 1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine-3-carbaldehyde (⁹⁶)^: [0181] To 1H-pyrrolo [2,3-b] pyridine-3-carbaldehyde (95, 4.05 g, 27.71 mmol) in tetrahydrofuran (30.0 mL) was added sodium hydride (60% in mineral oil, 1.5 g, 38 mmol ) and trriisopropylsilyl chloride (8.0 mL, 38 mmol) under nitrogen. The reaction was stirred for 2 hours at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was rinsed with brine,

- dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% acetate e^backin ebony, what ^dand^Labout^blethat^k (96, 3Ό ^g, 36%). MS (ESI) [M + H⁺]⁺ = ^thirty3.

Example 11: Synthesis of 5-isopropyl-1H-pyrrolo [2,3-b] pyridine 99.

[0182] Compound 98 was synthesized in three steps from 5-bromo-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine 68 described in Scheme 28.

<img file="PL1893612T3_D0118.tif" />

Step 1-Preparation of 2- (1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -propan-2-ol (97):

[0183] To 5-bromo-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (68, 2.0 g, 5.66 mmol, prepared as described in Example 6) in tetrahydrofuran (20.0 mL), cooled at 78 ° C acetone bath / dry ice under nitrogen atmosphere, tert-butyllithium (1.7 M in tetrahydrofuran, 7.3 mL, 12 mmol) was added dropwise. After 20 minutes, acetone (0.830 mL, 11 mmol) was added dropwise to the reaction. The reaction was stirred for 30 minutes at -78 ° C and then allowed to reach room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 10% acetate e^backu ^he^ksan^ande^. What ^daio zw^blethat^k (^97, E³° g, ⁶⁹%). ^MS(^ESI) [^M+^{H +}] + = ³³³.

Step 2- Preparation of 5-isopropenyl-1H-pyrrolo [2,3-b] pyridine (98):

[0184] To 2- (1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridin-5-yl) -propan-2-ol (97, 0.500 g, 1.5 mmol) in acetonitrile (10.0 mL) were added triethylsilane (1.00 mL, 6.3 mmol) and trifluoroacetic acid (0.50 mL, 6.5 mmol) under nitrogen. The reaction was refluxed for 3 hours and then cooled to room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluted⁵⁰% ethyl acetate w ^he^ksan^ande^. What ^dso-called^blethat^k (^98.0.²⁰⁰ g. ⁸4%). ^MS(^ESI) [^M+^H+] + = 159

Step 3 - Preparation of 5-isopropyl-1H-pyrrolo [2,3-b] pyridine (99):

[0185] To 5-isopropyl-1H-pyrrolo [2,3-b] pyridine (98, 0.080 g, 0.501 mmol) in tetrahydrofuran (5.0 mL) was added 20% palladium hydroxide on charcoal (5.0 mg). The reaction was stirred in the presence of hydrogen at 40 psi for 30 minutes. The reaction mixture was^psculpture^fand^ltRowan ^and zat^ęwife, a^{by d}to collect: (^99, ABOUT^{78 g 9}6%). ^MS (ESI) [^M+^{H +}]⁺ = 161.

Example 12: Synthesis of 5-methyl-1H-pyrrolo [2,3-b] pyridine 101.

[0186] Compound 101 was synthesized in two steps from 5-bromo-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine 68 described in Scheme 29.

<img file="PL1893612T3_D0119.tif" />

Step 1 - Preparation of 5-methyl-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (100):

[0187] To PdCl2 (dppf) (0.04 g, 0.05 mmol) in toluene (10.0 mL) under nitrogen, 5-bromo-1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (68, 0.3 g) was added. , 0.8 mmol, prepared as described in Example 6, 1.0 mL in toluene) and methylmagnesium bromide (1.0 M in tetrahydrofuran, 3.0 mL, 3.0 mmol). The reaction was stirred at 90 ° C for 2 hours and then allowed to reach room temperature. The reaction was poured into citric acid (0.1 M in water) and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 50% ethyl acetate in hexane, which gave^{with in}and^AZEk ⁽100, 0.16 ^g 60.0%). MS⁽ESI^{) [}M + H^+]+ = 289.4.

Step 2 - Preparation of 5-methyl-1H-pyrrolo [2,3-b] pyridine (101):

[0188] To 5-methyl- (1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (100 0.160 g, 0.55 mmol) in tetrahydrofuran (3.0 mL) was added tetra-n-butylammonium fluoride (0.145 g, 0.55). The reaction was poured into water and extracted with ethyl acetate The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered The filtrate was concentrated and purified by column chromatography on silica gel eluting with 3% solution. methanol in dichloromethane, which gave a slightly yellow solid (101, 0.07 g, 95%).

- 84 MS (ESI) [M + H +] + = 133.2.

[0189] 5-Methyl-1H-pyrrolo [2,3-b] pyridine

<img file="PL1893612T3_D0120.tif" />

was prepared using the Scheme 29 protocol, substituting methylmagnesium bromide with ethyl magnesium bromide in Step 1.

Example 13: Synthesis of 5-methoxy-1H-pyrrolo [2,3-b] pyridine 104 and related compounds.

[0190] Compound 104 was synthesized in one step from 5-bromo-1H-pyrrolo [2,3-b] pyridine 67 as described in Scheme 31.

<img file="PL1893612T3_D0121.tif" />

Step 1 - Preparation of 5-methoxy-1H-pyrrolo [2,3-b] pyridine (104):

[0191] To 5-bromo-7-azaindole (67, 500.0 mg, 2.53 mmol) in N, N-dimethylformamide (8 mL), copper (I) iodide (966 mg, 5.08 mmol) and sodium methoxide in methanol were added ( 3 M, 5 mL). The reaction was stirred overnight at 120 ° C under an argon atmosphere. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate^backu ^he^ksan^ande^. What ^dit gave steadily (ΙΌ^{4, 140} m^{g 28}%). ^MS(^ESI) [^M+^H+] + = ¹⁴⁹.E ^INAlternatively, 2.3 g (11.7 mmol) of 5-bromo-7-azaindole (67, 2.3 g, 11.7 mmol) was dissolved in 75 mL of N, N-dimethylformamide and 50 mL of methanol (50 mL) by the addition of sodium methoxide (32 g, 0.6 mol) and copper- (I) bromide (3.2 g, 22.4 mmol) at room temperature. The reaction was stirred for three hours at 100 ° C

- argon atmosphere. The mixture was diluted with ethyl acetate and poured into a solution of ammonium chloride: ammonium hydroxide (4: 1). The organic layer was extracted with ammonium chloride: ammonium hydroxide (4: 1), washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel eluting with 30% to 70% e acetate^backu ^he^kthemselves ^doh^andc ^withthings: e gave steadily (ΙΌ^{4, 0}.2^{7 g}. ¹⁵.6%). ^MS (ESI) [^M+ H⁺]⁺= M9.2. [0192]⁵-e^tabout^ks^s-^1H-^piro^labout[^2.3-^b]^pir^{-galactosides}on ⁵⁰⁶ was prepared using the protocol of Scheme 31, substituting methanol with ethanol and sodium methoxide with sodium ethoxide.

[0193] 5- (2-methoxy-ethoxy) -1H-pyrrolo [2,3-b] pyridine 507

<img file="PL1893612T3_D0122.tif" />

was prepared using the protocol of Scheme 31, substituting methanol with 2-methoxyethanol and sodium methoxide with 2-methoxy-sodium ethoxide (prepared from 2-methoxyethanol) ^and wo^dorodenk: u so^dat). ^MS(^ESI) [^M + ^H+] + =¹⁹³.³.

[0194] Diethyl- [2 (1H-pyrrolo [2,3-b] pyridin-5-yloxy) -ethyl] -amine 508 was prepared using the Scheme 31 protocol, substituting methanol with 2-diethylaminoethanol and sodium 2-diethylamine-methoxide methanol. sodium (prepared from 2.2^de^youloamino-ethanol ^and wo^doroden^ku so^dat). ^MS(^ESI) [^M + ^{H +}] + =: 2³⁴.⁵.

Example 14: Synthesis of 5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine 89.

[0195] 5-Pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine 89 was synthesized in one step from 5-bromo-1H-pyrrolo [2,3-b] pyridine 67 as described in Scheme 32 .

Scheme 32

<img file="PL1893612T3_D0123.tif" />

<img file="PL1893612T3_D0124.tif" />

Step 1 - Preparation of 5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine (89):

[0196] To 5-bromo-7-azaindole (67, 1.00 g, 5.08 mmol) in water (13.0 mL) and acetonitrile (36 mL) were added pyridine-3-boronic acid (609, 1.0 g, 8.1 mmol), potassium carbonate (1.79 g, 0.0130 mol) and tetrakis (triphenylphosphine) palladium (0) (50.0 mg, 0.043 mmol) under nitrogen. The reaction was heated to 170 ° C overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate and concentrated. The precipitate was purified by column chromatography on silica gel eluted with 25% ethyl acetate in hexane, which gave slightly^withThe yolk gave constant (^{89, 820} m^{g 82}%). ^MS(^ESI) [^M+^H+]⁺= ¹⁹⁶.E Additional compounds have been prepared according to Scheme 32, or by substituting pyridine-3-boronic acid with the appropriate boronic acid or by substituting 5- (4,4,5,5-tetramethyl- [5-bromo-7-azaindol] 1,3,2] dioxaborolan-2-yl) -1H-pyrrolo [2,3-b] pyridine and reacting with the corresponding heteroaryl aryl or halide (i.e., coupling the boric acid ester with azaindol, and the halide to the group to be coupled to the 5-position azaindole).

The following compounds were prepared according to this procedure:

5- (4-chloro-phenyl) -1H-pyrrolo [2,3-b] pyridine (514),

5- (4-Fluoro-phenyl) -1H-pyrrolo [2,3-b] pyridine (605),

5-phenyl-1H-pyrrolo [2,3-b] pyridine,

- 5- (6-Methoxy-pyridin-3-yl) -1H-pyrrolo [2,3-b] pyridine,

5- (2-methoxy-pyrimidin-5-yl) -1H-pyrrolo [2,3-b] pyridine,

5-pyridin-4-yl-1H-pyrrolo [2,3-b] pyridine,

4- (1H-pyrrolo [2,3-b] pyridin-5-yl) benzenesulfonamide,

3- (1H-pyrrolo [2,3-b] pyridin-5-yl) -benzenesulfonamide,

5- pyrimidin-5-yl-1H-pyrrolo [2,3-b] pyridine,

5- (3-methanesulfonyl-phenyl) -1H-pyrrolo [2,3-b] pyridine (P-0173), and 3- (1H-pyrrolo [2,3-b] pyridin-5-yl) benzamide ( P-1622).

[0198] The following table indicates either the starting material 5-bromo-7-azaindol or 5 (4,4,5,5-tetramethyl- [1,3,2] dioxaborolan-2-yl) -1H-pyrrole [2,3 -b] pyridine (column 1) and the appropriate reagent to be coupled to the azaindol position 5 (column 2) to obtain the starting compound (column 3), together with the observed mass given in column 4.

<td>Starting azaindol</td><td>Reagent coupled to position 5</td><td>Relationship</td><td>Watchers MS (ESI) [M + H^+]+</td>

<td>Ύο N ¹⁵¹^; H</td><td>B (OH&gt; 2 cl</td><td></td><td>229.1</td>

<td>^ΒΎΧ&gt; Ν^ΛΝ</td><td>B (OH&gt; 2 0 F</td><td></td><td>213.1</td>

<td>^ΒΎΐ&gt;^NH</td><td>B (OH) 2 about</td><td></td><td>195.2</td>

<td>Starting azaindol</td><td>Reagent coupled to position 5</td><td>Relationship</td><td>Watchers MS (ESI) [M + H^+]+</td>

<td>^N κ</td><td>B (OH) 2 0 · 0-</td><td>k ^ * 'N' H</td><td>226.2</td>

<td>" _and</td><td>B (OH) 2</td><td>^ 21 C^withwith ) ?-with about \</td><td>227.2</td>

<td>° υύλ</td><td></td><td>¹ H</td><td>196.2</td>

<td>°^Bin N, N rl</td><td>Λ</td><td>Ά H</td><td>274.1</td>

<td>) - &lt;?^bXX3^N M</td><td>bi-TA nh₂AND</td><td></td><td>274.1</td>

<td>Starting azaindol</td><td>Reagent coupled to position 5</td><td>Relationship</td><td>Watchers MS (ESI) [M + H⁺]⁺</td>

<td>· dl? °^BW&gt;</td><td>On ^ V ~ Br = ^ /</td><td>Λⁿ ay^Ν B</td><td>197.2</td>

<td>^bYjO^N 9</td><td>(TW OA ( Λό</td><td>Ν H</td><td>273.1</td>

<td>^Brn^N H</td><td>(GB (OH)₂H₂N &lt;</td><td>about "H</td><td>238.2</td>

Example 15: Synthesis of [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluorophenyl] -amide of the prrpanr-1-sulfrnrwegr acid P) 0955 related compounds.

[0199] As an alternative method to this in Example 2, the compound P-0955 was synthesized in nine steps from 4-chloro-2-fluoro-phenylamine 47 as shown in Scheme 37.

<img file="PL1893612T3_D0125.tif" />

Step 1-Preparation of 3-amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48):

[0200] To 4-chloro-2-fluoro-phenylamine (47, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), cooled in a dry ice / acetone bath under nitrogen, was slowly added n-butyllithium (2.50 M in hexane, 24.4 mL). After 20 minutes, 1,2-bis- (chloro-dimethylsilanyl) -ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was added slowly to the reaction. After 1 hour n-butyllithium (2.50 M in hexane, 25.0 mL) was slowly added to the reaction. The reaction was stirred at -78 ° C for 20 minutes and allowed to warm to room temperature over 60 minutes. The reaction was cooled to -78 ° C, followed by slow addition of n-butyllithium (2.50 M in hexane, 26.0 mL). After 80 minutes, benzyl chloroformate (10.0 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 ° C overnight. followed by the addition of water (80 mL) and concentration with hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature for 2 hours. The organic layer was separated. The aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and rinsed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give b dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give b dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give b^ezb^arwny dej (48, 12.5 g, 78.3%). MS (ESI) [M + H +] + = 280.0.

- Step 2 - Preparation of 6-Chloro-2-fluoro-3- (propane-1sulfonylamino) -benzoic acid benzyl ester (49):

[0201] To 3-amino-6-chloro-2-fluoro-benzoic acid benzyl ester (48, 1.20 g,

4.3 mmol) in methylene chloride (28 mL) was added pyridine (0.52 mL, 6.4 mmol) and propanesulfonyl chloride (0.685 g, 4.8 mmol). The reaction was stirred overnight at room temperature, then poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel to give a colorless oil (49, 960 mg, 58.0%). MS (ESI) [M^-H⁺] '= 384.1.

Step 3 - Preparation of 6-chloro-2-fluoro-3- (propane-1-sulfonylamino) benzoic acid (115):

[0202] To 6-Chloro-2-fluoro-3- (propane-1-sulfonylamino) benzoic acid benzyl ester (49, 6.00 g, 15.6 mmol) in tetrahydrofuran (100 mL) was added 1.0M aqueous potassium hydroxide (100 mL). . The reaction was heated to reflux overnight. The reaction was poured into water, acidified to pH 2 with 1 N hydrochloric acid and extracted with ethyl acetate. The organic portion was dried over anhydrous sodium sulfate, filtered and concentrated to give a white solid 115 (3.95 g, 85.8%).

Step 4 - Preparation of 2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (50):

[0203] To 6-chloro-2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (115, 0.69 g, 2.3 mmol) in methanol (10 mL) was added 20% palladium hydroxide on carbon (200 mg) . The reaction was stirred in the presence of hydrogen at 50 psi for 2 hours. The reaction was filtered and concentrated to give a white solid 50 that was used in the next step. MS (ESI) [M^-H⁺] '= 260.1.

Step 5 - Preparation of 2-fluoro-2-fluoro-3- (propane-1sulfonylamino) -benzoic acid methyl ester (501):

[0204] To 2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid (50, 5.05 g, 0.0193 mol) in methylene chloride (100 mL) was added N, N-dimethylformamide (0.075 mL, 0.97 mmol) in nitrogen atmosphere. The reaction was cooled with ice / water and then occurred

- free addition of oxalyl chloride (2.00M in methylene chloride, 10.8 mL, 21.6 mmol). The reaction mixture was stirred at room temperature for 3.0 hours. The reaction was cooled with ice / water, followed by the free addition of methanol (36.0 mL, 0.89 mol). The reaction was stirred at room temperature overnight. The reaction was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give a white solid 4.0g.

Step 6- Preparation of propanesulfonic acid 2-fluoro-3-hydroxymethylphenyl-amide (502):

[0205] To 2-fluoro-3- (propane-1-sulfonylamino) -benzoic acid methyl ester (501, 3.80 g, 13.8 mmol) in tetrahydrofuran (133 mL) was added lithium tetrahydroglinate (1.00 M in tetrahydrofuran, 20.0 mL, 20.0 mmol) under nitrogen at room temperature. The reaction was stirred at room temperature for 8 hours, after which 10 g of NaSO4-10H2O was added. After 12 hours the reaction was filtered, concentrated and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give a white solid (502, 3.0 g, 87.9%).

Step 7- Preparation of propane-1-sulfonic acid (2-fluoro-3-formyl-phenyl) -amide (503):

[0206] To propano-1-sulfonic acid (2-fluoro-3-hydroxymethyl-phenyl) -amide (502, 0.20 g, 0.81 mmol) in tetrahydrofuran (5.0 mL) was added Dess-Martin periodinane (0.377 g, 0.89 mmol). . The reaction was stirred at room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate^backu ^he^ksan^ande^. What ^dalo Małe gave steadily (^503,100 mg ⁵⁰.0%). ^MS(^ESI) [^M-^{H +}]⁺= ²⁴⁴.E

Step 8-Preparation of propane-1-sulfonic acid {3 - [(5-bromo-1H-pyrrolo [2,3-b] pyridin-3-yl) -hydroxy-methyl] -2-fluorophenyl} -amide (504):

[0207] To 5-bromo-7-azaindol 67 (312 mg, 1.58 mmol) in methanol (28 mL) were added propane-1-sulfonic acid (2-fluoro-3-formyl-phenyl) -amide (503, 370). mg, 1.5 mmol) and potassium hydroxide (422.8 mg, 7.5 mmol) under nitrogen. The reaction was stirred overnight at room temperature, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and

- 93 filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the desired compound as a white solid (504, 300 mg, 45.0%).

Step 9- Preparation of [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenyl] -amide, propane-1-sulfonic acid (P-0955):

[0208] To propano-1-sulfonic acid {3 - [(5-bromo-1H-pyrrolo [2,3-b] pyridin-3-yl) -hydroxy-methyl] -2-fluorophenyl} -amide (504, 0.650 g, 1.47 mmol) in tetrahydrofuran (25.0 mL) ice-cooled / water was added Dess-Martin periodinane (0.748 g, 1.76 mmol). The reaction was stirred at room temperature for 15 minutes. The reaction was poured into water containing sodium thiosulfate and potassium carbonate and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluted with 20% ethyl acetate in hexane and rinsed with ethyl acetate each time.^dand^Lo Hale gave constantly. (^p-^{0955, 0}.³⁵ g, 5⁴.1%). ^MS (ESI) [^M+^{H +}]⁺ = ⁴⁶⁰.^{0, 462}ABOUT.

[0209] Butano-1-sulfonic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluorophenyl] -amide P-1250

<img file="PL1893612T3_D0126.tif" />

prepared according to Scheme 37, substituting propane-2-sulfonyl chloride with butane-1-sulfonyl chloride in Step 1 and 5-bromo-1H-pyrrolo [2,3-b] pyridine 67 ⁵-c^hloro-^1H-^piro^labout[^2.3-^b]^pir^{-galactosides}n^ą80 (see Prov^YKLand^{d 9}) in ^etand^pie ⁸. ^MS(^ESI) [^M - ^{H +}] '= 408.1.

[2-Fluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide propan-1-sulfonic acid P-1256

<img file="PL1893612T3_D0127.tif" />

prepared according to Scheme 37, substituting 5-bromo-1H-pyrrolo [2,3-b] pyridine 67-methoxy-1H-pyrrolo [2,3-b] pyridine 104 (see Example 16) in Step 8. MS (ESI) ) [M^-H^+]'= 390.1.

[0211] N- [3- (5-Chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2-fluoro-phenyl] benzenesulfonamide P-1255

<img file="PL1893612T3_D0128.tif" />

was prepared according to Scheme 37, substituting propane-2-sulfonyl chloride with benzenesulfonyl chloride in Step 1 and 5-bromo-1H-pyrrolo [2,3-b] pyridine 67 c^hloro-^1H-^piro^labout[^2.3-^b]^pir^{-galactosides}n^ą80 (Look ^Pgovernment^scanine^{d 9}) in ^etand^pie ⁸. ^MS(^ESI) [^M - H +] '= 428.0.

Example 16: Synthesis of 3-3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl-propionic acid P-1270.

[0212] Compound P-1270 was synthesized in three stages from propane-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide. P-0773 as shown in Scheme 38.

<img file="PL1893612T3_D0129.tif" />

<img file="PL1893612T3_D0130.tif" />

Stage 3

<img file="PL1893612T3_D0131.tif" />

Step 1: Preparation of (E) -3-3- [2,6-difluoro-3- (propane-1sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl-acrylic acid methyl ester (505)

[0213] To propane-1-sulfonic acid [3- (5-bromo-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-0773, 125.0 mg, 0.27 mmol, prepared as described in Example 4) in N, N-dimethylformamide (4.0 mL), palladium acetate (15 mg, 0.068 mmol), triphenylphosphine (36 mg, 0.14 mmol), methyl acrylate (0.098 mL) were added. 1.1 mmol) and triethylamine (0.114 mL, 0.82 mmol) under nitrogen. The reaction was stirred at 140 ° C overnight, then poured into water, acidified and extracted with ethyl acetate. To the filtrate in methylene chloride (5.0 mL) was added 1,8-diazabicyclo [5.4.0] undec-7-ene (0.50 mL, 3.3 mmol). The reaction was stirred at room temperature for 3 hours. The reaction was concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane, which gave a light yellow oil,

Step 2 Preparation of 3-3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl-acrylic acid (P-1269):

[0214] To (3) -3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -lH-pyrrolo [2,3-b] pyridin-5-yl-methyl ester, acrylic (100.0 mg, 0.22 mmol) in tetrahydrofuran (5.0 mL) and water (1.50 mL) was added lithium hydroxide (21 mg, 0.86

- 96 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water, acidified with 1N HCl to pH around 1, and then extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give a white solid (P-1269, 30 mg). MS⁽ESI) [M^-H +] '= 448.0.

Step 3 - 3- 3- [2,6-Difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl-propionic acid (P-1270):

[0215] To 3-3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridin-5-yl-acrylic acid (P-1269, 20.0 mg, 0.045 mmol) in methanol (5.0 mL) was added 20% Pd (OH) 2 / C (10 mg) under a hydrogen atmosphere. The reaction was stirred at room temperature for 2 hours. The reaction mixture was filtered, concentrated and purified by column chromatography on silica gel eluting with 10% methanokem in cork: in the^da small one gave permanent (^p-^{1270, 8}.⁸ m^g). ^MS(^ESI) [M-^{H +}] '= 450.1.

Example 17: Synthesis of thiophene-2sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide 508.

[0216] Compound 512 was synthesized in four steps from 2,4-difluorophenylamine 42 as shown in Scheme 39.

<img file="PL1893612T3_D0132.tif" />

Step 1-Preparation of 3-amino-4,2-difluoro-benzoic acid ethyl ester / (509):

[0217] To 4,2-difluoro-phenylamine (42, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), cooled with a dry ice / acetone bath under nitrogen was slowly added n-butyllithium (2.50 M in hexane, 24.4 mL). After 20 minutes, 1,2-bis- (chloro-dimethyl-silanyl) -ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was added slowly to the reaction. After 1 hour n-butyllithium (2.50 M in hexane, 25.0 mL) was slowly added to the reaction. The reaction was stirred at -78 ° C for 20 minutes and allowed to warm to room temperature over 60 minutes. The reaction was cooled to -78 ° C, followed by slow addition of n-butyllithium (2.50 M in hexane, 26.0 mL). After 80 minutes, ethyl chloroformate (6.69 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 ° C overnight. followed by the addition of water (80 mL) and concentration with hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature for 2 hours. The organic layer was separated. The aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and rinsed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give b dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give b dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give b^ezb^andrw^ny dej (509 4.6 g, 39%). MS (ESI) [M + H⁺]⁺ = 218.1.

Step 2 - Preparation of 2,6-difluoro-3- (thiophene-2-sulfonylamino) benzoic acid ethyl ester (510):

[0218] To 3-amino-2,4-difluoro-benzoic acid ethyl ester (509, 1.20 g, 5.93 mmol) in methylene chloride (28 mL) was added pyridine (0.52 mL, 6.4 mmol) and thiophene-2-thiophene chloride. sulfonyl (0.97 g, 5.38 mmol). The reaction was stirred overnight at room temperature, then poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by column chromatography on silica gel (ethyl acetate / hexane 20%) to give a colorless oil (510,

1.2 g, 65.0%). MS (ESI) [M + H⁺]⁺= 348.2.

Step 3- Preparation of thiophene-2sulfonic acid (2,4-difluoro-3-hydroxymethyl-phenyl) -amide (511):

To ethyl ester of 2,6-difluoro-3- (thiophene-2-sulfonylamino) -benzoic acid (510,1.6 g, 3.5 mmol) in tetrahydrofuran (25.0 mL) was added lithium tetrahydroglate (1.00 M in tetrahydrofuran, 8.08 mL, 8.08 mmol) under nitrogen at room temperature. The reaction was stirred at room temperature for 8 hours, followed by the addition of 10 g NaSO4-10H₂A. After 12 hours, the reaction was filtered, concentrated, and purified by column chromatography on silica gel eluting with 5% methanol in methylene chloride to give a white solid (511, 300.0 mg, 21.0%).

- Step 4- Preparation of thiophene-2-sulfonic acid (2,4-difluoro-formyl-phenyl) -amide (512):

[0220] To dithiophene-2-sulfonic acid (2,4-difluoro-3-hydroxymethyl-phenyl) -amide (511, 0.46 g, 1.52 mmol) in tetrahydrofuran (5.0 mL) was added Dess-Martin periodinane (0.71g, 1.67). mmol). The reaction was stirred at room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate^backu ^he^ksan^ande^. What ^da small one gave steadily (^512.100 my ²¹%). ^MS (ESI) [^M+ H⁺]⁺ = ³⁰⁴.². [0221] (2,4-Difluoro-3-formyl-phenyl) -amide, thiophene-3-sulfonic acid 513

<img file="PL1893612T3_D0133.tif" />

was prepared according to Scheme 39, substituting thiophene-2su chloride^lfhe^ylu chloride chloride! thio^fene³-su^lfhe^ylu ^Ethis^pie ². ^MS(^ESI) [^M+ ^H+] + = ³⁰⁴.². [0222] N- (2,4-Difluoro-3-formyl-phenyl) -3-fluoro-benzenesulfonamide 578

<img file="PL1893612T3_D0134.tif" />

prepared according to Scheme 39, substituting thiophene-2-sulfonyl chloride with 3-fluorobenzenesulfonyl chloride in Step 2.

Example 18: Synthesis of (3-benzyloxy-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone P-1467 and related compounds

[0223] Compound P-1467 was synthesized in four steps from 2,4-difluorophenol 35 as shown in Scheme 43.

<img file="PL1893612T3_D0135.tif" />

Stage 1 - Preparation of 1-benzyloxy-2,4-difluoro-benzene (525):

[0224] To 2,4-difluoro-phenol (35, 7.60 g, 0.0584 mol) in N, N-dimethylformamide (50.0 mL) was added benzyl bromide (8.0 mL, 0.067 mol) and potassium carbonate (9.00 g, 0.0651 mol). under a nitrogen atmosphere. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the compound as a white solid (525, 3.20 g, 25%).

Step 2 - Preparation of 3-benzyloxy-2,6-difluoro-benzaldehyde (526):

[0225] To 1-benzyloxy-2,4-difluoro- benzene (525, 3.00 g, 13.6 mmol) in tetrahydrofuran (48 mL) under nitrogen and dry ice / acetone, n-butyllithium (1.60 M in hexane, 8.94 mL) was added. ). After 20 minutes, N, N-dimethylformamide (1.46 mL, 0.0189 mol) was added to the reaction. After another 20 minutes, the flask was stirred at room temperature for 30 minutes. The reaction mixture was poured into water, acidified to pH = 1 and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and purified by column chromatography on silica gel eluting with 30% ethyl acetate in hexane to give the compound as a yellow solid (526, 2.5g, 74%).

- Step 3 - Preparation of (3-benzyloxy-2,6-difluoro- phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanol (527):

[0226] To 5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridines (89, 750.0 mg, 0.003842 mol, prepared as in Example 17) in methanol (20.0 mL) were added 3-benzyloxy2, 6-difluoro-benzaldehyde (526, 1.12 g, 4.5 mmol) and potassium hydroxide (1.50 g, 0.0267 mol) under a nitrogen atmosphere. The reaction was stirred at room temperature overnight, then poured into water, acidified with 1 N HCl to pH around 2 and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the compound (527, 700 mg, 35%).

Step 4 - Preparation of (3-benzyloxy-2,6-difluoro- phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone (P-1467):

[0227] To (3-benzyloxy-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanol (527, 300.0 mg, 0.68 mmol) in tetrahydrofuran (10.0 mL) was added Dess-Martin periodinane (344 mg, 0.81 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction mixture was concentrated with the gel and purified by column chromatography on silica gel eluting with 10% methanol in^dic^hlOromë^tan^ande^. What ^dso-called^blethat^k (^p-^{1467, 240} m^{g 80}%). ^MS (ESI) [^M+^{H +}]⁺ = ⁴⁴².².

[0228] Additional compounds have been prepared according to Steps 3 and 4 of Scheme 43, replacing 3-benzyloxy-2,6-difluorobenzaldehyde 526 with the appropriate aldehyde and / or pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine 89 suitable azaindol in Step 3. The azaindoles used were synthesized as described in Examples 9 or 16. The aldehydes used were synthesized as described in Example 5 or 21. The following compounds were prepared according to this procedure:

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-trifluoromethyl-benzenesulfonamide (P-1541),

N- [2,4-difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-trifluoromethyl-benzenesulfonamide (P-1542),

N- [2,4-difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] -fluoro-benzenesulfonamide (P-1581),

N- [2,4-difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-fluoro-benzenesulfonamide (P-1582),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-fluoro-benzenesulfonamide (P-1583),

N- [2,4-difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -3-trifluoromethyl-benzenesulfonamide (P-1598), and

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-trifluoromethyl-benzenesulfonamide (P-1599).

[0229] The following table indicates aldehyde (column 2) and azaindol (column 3) used to obtain the target compound (column 4). Column 1 contains the compound number and column 5 of the observed mass.

<td></td><td>aldehyde</td><td>azaindole</td><td>Relationship</td><td>observation ane MS (ESI) [M + H^+]+</td>

<td>P-1541</td><td>cf₃° Pjref ' H _F</td><td>^c.WCO SI IV ™ H</td><td>c. Jjla^Fin H</td><td>516.2</td>

<td>P-1542</td><td>9 ^ 3ⁱⁿN? «F N-§ = O H 0</td><td>Άν</td><td>and ri⁰' "' N o 1H</td><td>512.2</td>

<td>P-1581</td><td>0. ' zy_Ns F Η 0</td><td>^N N</td><td>F^N H</td><td>462.2</td>

- 102 -

<td></td><td>aldehyde</td><td>azaindole</td><td>Relationship</td><td>OOserwow ane MS (ESI) [M + H⁺]⁺</td>

<td>P-1582</td><td>F⁰H</td><td>on</td><td>KNA H</td><td>462.2</td>

<td>P-1583</td><td>μΑ; H f N "V ° FHO</td><td>aa</td><td>^clYA ₀Ν β ^HO</td><td>466.1</td>

<td>P-1598</td><td>τ HF hĄ °</td><td>hi</td><td>AA ^h / ^cf</td><td>510.1</td>

<td>P-1599</td><td>_n In i&gt;^CFs T-0^h IN</td><td>^NN</td><td>_cl IN in^{FHn CF}H</td><td>514.0</td>

Example 19. Synthesis of 3- (3-benzyloxy-2,6-difluoro-benzyl) -5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine P-1455:

[0230] Compound P-1455 was synthesized in four steps from 2,4-difluorophenol as shown in Scheme 43a.

- 103 Diagram 43a

<img file="PL1893612T3_D0136.tif" />

[0231] Steps 1-3 are identical to Steps 1-3 of Scheme 43.

Step 4 - Preparation of 3- (3-benzyloxy-2,6-difluoro-benzyl) -5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine (P-1455):

[0232] To (3-benzyloxy-2,6-difluoro-phenyl) - (5-pyridin-3-yl-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanol (527, 580.0 mg, 1.3) mmol) in acetonitrile (29.0 mL) was added trifluoroacetic acid (1.9 mL, 0.025 mol) and triethylsilane (3.9 mL, 0.024 mol). The reaction was stirred at 80 ° C for 1 hour. The reaction was poured into water, basified with 1M potassium carbonate to pH = 4 and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 50% ethyl acetate in hexane to give a yellow solid (P-1455, 530 mg). MS (ESI) [M + H^{+] +} = 428.3.

[0233] Additional compounds were prepared according to Steps 3 and 4 of Scheme 43a, substituting 3-benzyloxy-2,6-difluoro-benzaldehyde 526 with the appropriate aldehyde and / or pyridin-3-yl-1H-pyrrolo [2,3-b] pyridine 89 with the corresponding azaindol (see Example 9 or Example 16) in Step 3. The following compounds were prepared according to this procedure:

N- [2,4-difluoro-3- (5-methoxy-1H-pyrrolo [2,3-b] pyridin-3-ylmethyl) -phenyl] -3-trifluoromethyl-benzenesulfonamide (P-1590), and

N- [2,4-difluoro-3- (5-chloro-1H-pyrrolo [2,3-b] pyridin-3-ylmethyl] -phenyl] -3-trifluoromethyl-benzenesulfonamide (P-1600).

The following table indicates the aldehyde (column 2) and azaindol (column 3) used to obtain the target compound (column 4). Column 1 contains the compound number and column 5 of the observed mass.

<td></td><td>aldehyde</td><td>azaindole</td><td>Product</td><td>observation ane MS (ESI)^[M + H^]+</td>

<td>P-1590</td><td> ABOUT'^CF' F Η 0</td><td>n³h</td><td>F A / pr 'sQ Aj e KI A-_f^{FK b CF}</td><td></td>

<td>P-1600</td><td>0 -y ³FH 0</td><td></td><td>^αχτ £? ^ h'V cF_S^N H</td><td></td>

Example 20: Synthesis of 3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid ethylamide P-1630

[0234] Compound P-1630 was synthesized in six steps from 5-bromo-1-triisopropylsilyl-7-azaindol 68 as shown in Scheme 45.

<img file="PL1893612T3_D0137.tif" />

Step 1- Preparation of 1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (531):

[0235] To 5-bromo-1-triisopropylsilyl-7-azaindole (68.1.50 g, 4.2 mmol, prepared as described in Example 6) in tetrahydrofuran (20.0 mL) under nitrogen atmosphere, cooled with dry ice / acetone, slowly added solution n-butyllithium (10.0 M in hexane, 0.467 mL). After 60 minutes, benzyl chloroformate (0.394 mL, 5.1 mmol) was added to the reaction. After another hour the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried with anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the crude compound as a slightly yellow solid which was used in the next step.

Step 2 - Preparation of 1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (532):

[0236] To 1-trisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (531, 0.950 g, 2.9 mmol) in tetrahydrofuran (20.0 mL) was added tetrabutylammonium fluoride, triphenyl (1.20 g, 3.8 mmol). The reaction was stirred in

- room temperature for 10 minutes. The reaction was concentrated and purified by column chromatography on silica gel eluting with 4% methanol in methylene chloride, which gave^blethat^k as the wading made it permanent (^{532, 300} m^{g 60}%). MS (ESI) [M + H⁺]⁺ = Π7.2.

Step 3 - Preparation of 3- [2,6-difluoro-3- (propane-1sulfonylamino) -phenyl] -hydroxymethyl-1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (P1545):

[0237] To 1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (532, 155.0 mg, 0.88 mmol) in methanol (15.0 mL) was added (2,4-difluoro-3-formyl-phenyl) ) propan-1-sulfonic acid amide (73, 260.0 mg, 0.99 mmol, prepared as described in Example 7) and potassium hydroxide (859 mg, 15.3 mmol) under nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried with anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 20% ethyl acetate in hexane to give the compound as white^cia.ł^about permanent (P^-1545^. 110 nu 28%). MS (ESI) [M + H + | + = 440.2.

Step 4 - Preparation of 3- [2,6-difluoro-3- (propane-1sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (P-15S2):

[0238] To 3- [2,6-difluoro-3- (propane-1-sulfonylamino) -phenyl] hydroxy-methyl-1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (P- 1545, 100.0 mg, 0.23 mmol) in tetrahydrofuran (1.0 mL) was added Dess-Martin periodinane (107 mg, 2.5 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction mixture was concentrated with silica gel and then purified by column chromatography on silica gel eluting with 30% ethyl acetate in^he^ksan^ande^. What ^dalo zw^blethat^k I^ko Small gave permanent (^p-^{1552, 80} m^{g 80}%). ^MS(^ESI) [M +^{H +}] + =

438.2.

Step 5 - Preparation of 3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid (P-1559):

[0239] To 3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid methyl ester (P-1552, 80.0 mg) 0.18 mmol) in tetrahydrofuran (10.0 mL) was added water (3.0 mL) and lithium hydroxide (82 mg, 3.4 mmol). The reaction was stirred at room temperature overnight. The reaction was poured

107 to water, acidified with 1N HCl to pH around 1, and then extracted with ethyl acetate.

The organic layer was dried with anhydrous sodium sulfate, filtered, concentrated and washed with ethyl acetate to give an off-white solid (P-1559, 60 mg, 77%) MS (ESI) [M + H⁺]⁺ = 424.2.

Step 6: Preparation of 3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid ethylamide (P-1630):

[0240] To 3- [2,6-difluoro-3- (propane-1-sulfonylamino) -benzoyl] -1H-pyrrolo [2,3-b] pyridine-5-carboxylic acid (P-1559, 38.0 mg, 0.090 mmol) ) in tetrahydrofuran (2.3 mL) was added a solution of ethylamine (2.0 M in tetrahydrofuran, 0.20 mL), bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (80.0 mg, 0.17 mmol) and triethylamine (0.30 mL, 2.2 mmol) nitrogen atmosphere. The reaction mixture was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried with anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel eluting with 40% ethyl acetate in hexane to give the compound as a white solid (P-1630, 13.2 mg, 33%). MS (ESI) [M^-H^+]'= 449.0.

Example 21: Synthesis of N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenyl] -3,5-difluorobenzenesulfonamide P-1841 [0241] Compound P- 1841 was synthesized in six stages from 2,4-difluoroaniline 42 as shown in Scheme 67.

Diagram 67

<img file="PL1893612T3_D0138.tif" />

Stage 2

<img file="PL1893612T3_D0139.tif" />

at ^etaP 4 Cbz ~

<img file="PL1893612T3_D0140.tif" />

- 108 Step 1 - Preparation of (2,4-difluoro-phenyl) -carbamic acid benzyl ester (613):

[0242] To 2,4-difluoroaniline (42, 7.0 mL, 0.070 mol) in 100 mL dichloromethane was added pyridine (11 mL, 0.14 mol) and benzyl chloroformate (11.9 mL, 0.0834 mol). The reaction mixture was stirred at ambient temperature for 1.5 hours. The reaction mixture was concentrated under reduced pressure and the precipitate was partitioned between ethyl acetate and KHSO4 solution. The organic layer was dried (MgSO4), concentrated and recrystallized from hexanes to give compound 613 (15.6 g, 85%).

Step 2 - Preparation of (2,4-difluoro-3-formyl-phenyl) -carbamate benzyl ester (614):

[0243] Add (2,4-difluoro-phenyl) -carbamate benzyl ester (613, 3.83 g, 14.5 mmol) in tetrahydrofuran (148 mL, 1.82 mol) to the round bottom flask. The solution was cooled to - 78 ° C and n-butyllithium (1.60 M in hexane, 19.1 mL, 30.0 mmol) was added, and after 30 minutes N, N-dimethylformamide (1.12 mL, 14.5 mol) was added. The reaction mixture was allowed to warm to ambient temperature and was stirred overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and crystallized from ether, which gave compound 614 (3.0 g, 71%).

Step 3 Preparation of {2,4-difluoro-3- [hydroxy- (1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -carbamic acid benzyl ester (615):

[0244] 5-chloro-1H-pyrrolo [2,3-b] pyridine (80, 0.524 g, 3.43 mmol, prepared as described in Example 9) in methanol (5.00 mL, 0.123 mol) was added to a round bottom flask. Potassium hydroxide (0.800 g, 14.2 mmol) and (2,4-difluoro-3-formyl-phenyl) -carbamic acid benzyl ester (614.1.02 g, 3.5 mmol) were added and the reaction mixture was stirred overnight. The reaction mixture was poured into 1 N HCl and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and recrystallized from ethyl acetate to give compound 615.⁽710 ya 46%). MS⁽ESI^{) [}M + H^]+ = 444.

Step 2 - Preparation of [2,4-Difluoro-3 - ((1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -carbamic acid benzyl ester (616):

[0245] {2,4-Difluoro-3- [hydroxy (1H-pyrrolo [2,3-b] pyridin-3-yl) -methyl] -phenyl} -carbamic acid benzyl ester was added to a round bottom flask ( 615, 1.01 g, 2.28 mmol) in tetrahydrofuran (5.00 mL, 0.0616 mol). The Dess-Martin periodinane was added in portions (1.20 g, 2.89 mmol). The reaction mixture was stirred at ambient temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and purified by column chromatography over silica gel, yielding compound 616 (914 n 91%). MS (ESI) [M + H +] + = 442.

Step 5 - Preparation of (3-amino-2,6-difluoro-phenyl) - (5-chloro-1H-pyrrolo [2,3-b] pyridin-3-yl) -methanone (P-1801):

[2,4-Difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] carbamate benzyl ester (616, 800 mg, 1.81 mmol) was added to 10 M NaOH (15.00 mL) and warmed to boiling overnight. The reaction mixture was diluted with 30 mL of water and extracted with ethyl acetate to give compound P-1801 (450 mg, 81%).

Step 6 - Preparation of N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3,5-difluorobenzenesulfonamide (P-1841) [0247 ] (3-Amino-2,6-difluorophenyl) - (5-chloro-1H-pyrrolo [2,3-b] pyridin-3-yl) methanone (P-1801, 50 mg) was combined in a microwave reaction vessel. 0.16 mmol), 3,5-difluorobenzenesulfonyl chloride (610, 103 mg, 0.49 mmol), pyridine (0.5 mL, 6.1820 mol) and tetrahydrofuran (3.0 mL). The reaction was heated in a CEM microwave at 300 watts, 130 ° C for 10 minutes. The reaction mixture was partitioned between ethyl acetate and brine. The organic layer was collected, dried over Na 2 SO 4), filtered and concentrated. Compound (P-1841) was isolated using column chromatography (silica, hexane: ethyl acetate 70:30) to obtain 36 mg (46%) of the compound. MS = 482.0.

[0248] Additional compounds were prepared according to the Scheme 67 protocol of Step 6, optionally substituting (3-amino-2,6-difluoro-phenyl) - (5-chloro-1H-pyrrolo [2,3-b] pyridin-3-yl) - methanone P-1801 from (3-amino-2,6-difluoro-phenyl) - (1H-pyrrolo [2,3-b] pyridin-3-yl) methanone P-2021 (prepared according to Scheme 67 steps 1-5, substituting 5-chloro-1H-pyrrolo [2,3-b] pyridine 80H-pyrrolo [2,3-b] pyridine 94 in Step 3) and / or 3,5-difluorobenzenesulfonyl chloride 610 with a suitable sulfonyl chloride. The following compounds were prepared according to this procedure:

- 110 N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl ] -4-isopropylbenzenesulfonamide (P1839),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-0913),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] -3-nitrobenzenesulfonamide (P-1937),

N- {4- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenylsulfamoyl] phenyl} -acetamide (P-1938),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-methoxybenzenesulfonamide (P-0958), 5- [2.4] methyl ester -difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenylsulfamoyl] -furan-2-carboxylic acid (P-1941), 5- [2,4-difluoro-3-methyl acid methyl ester (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenylsulfamoyl] -2-methylfuran-3-carboxylic acid (P-1942), [2,4-difluoro-3- (1H-pyrrolo [2] , 3-b-pyridine-3-carbonyl) -phenyl] -amide, 5-oxazol-5-ylthiophene-2-sulfonic acid (P-1943), [2,4-difluoro-3- (1H-pyrrolo [2, 3-b-pyridine-3-carbonyl) -phenyl] -amide 5-deoxazol-5-yl-thiophene-2-sulfonic acid (P-1948),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] -2,4-dimethoxybenzenesulfonamide (P-1951), [2,4-difluoro- 3- (1H-pyrrolo [2,3-b] pyridin-3-carbonyl) -phenyl] -amide of 2,5-dimethyl-thiophene-3-sulfonic acid (P-1952), [2,4-difluoro-3- ( 1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide, 2,5-dimethylfuran-3-sulfonic acid (P-1953),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -2-methoxybenzenesulfonamide (P-1954), [2,4-difluoro-2 (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide, 2,3-dihydro-benzo [1,4] dioxino-6-sulfonic acid (P-1955), [2,4-difluoro-3 - (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -amide, 2,4-dimethyl-thiazole-5-sulfonic acid (P-1956),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-trifluoromethyl-benzenesulfonamide (P-0931),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -5-fluoro-2-methyl-benzenesulfonamide (P-1961),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) phenyl] -3-methyl-benzenesulfonamide (P-1962),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-oxazol-5-ylbenzenesulfonamide (P-1963),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -2,5-dimethoxybenzenesulfonamide (P-1131),

2-Cyano-N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-1965),

3- Cyano-N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] benzenesulfonamide (P-1966),

N- [2,4-difluoro-3- (1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -phenyl] -4-isopropylbenzenesulfonamide (P-1968), [2,4-difluoro-2 Benzothiazole-6-sulfonic acid (1H-pyrrolo [2,3-b] pyrrole-3-carbonyl) -phenyl] -amide (P-1969),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-methoxy-benzenesulfonamide (P-2011),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] benzenesulfonamide (P-0885), [3- (5-chloro) 1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide, thiophene-2-sulfonic acid (P-1267),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-methyl-benzenesulfonamide (P-1842),

N- {4- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenylsulfanoyl] -phenyl} -acetamide (P-1905),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-methoxy-benzenesulfonamide (P-0983),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-trifluoromethyl-benzenesulfonamide (P-1599).

5- [3- (5-Chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenylsulfamoyl] -furan-2-carboxylic acid methyl ester (P-1907), methyl ester 5- [3- (5-Chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenylsulfamoyl] -2-methylfuran-3-carboxylic acid (P-1908), [3] - 1,2-Dimethyl-1H-imidazole-4-sulfonic acid (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-) 1911),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -2-fluorobenzenesulfonamide (P-1912),

- 112 N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -4-difluoromethoxy-benzenesulfonamide (P-1916),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -2,4-dimethoxy-benzenesulfonamide (P-1918), [3- 2,5-Dimethyl-thiophene-3-sulfonic acid (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1919), 3-Dimethyl-furan-3-sulfonic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P-1920 )

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluorophenyl] -2-methyl-benzenesulfonamide (P-1921), [3- (5-chloro) -1-H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide, 2,3-dihydro-benzo [1,4] dioxine-6-sulphonic acid (P-1922 ), 2,4-dimethyl-thiazole-5-sulfonic acid [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -amide (P -1923)

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -2,4-difluoro-benzenesulfonamide (P-1926),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -5-fluoro-2-methyl-benzenesulfonamide (P-1927),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-methyl-benzenesulfonamide (P-1928),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -2,5-dimethoxy-benzenesulfonamide (P-1929),

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -2-nitro-benzenesulfonamide (P-1931), and

N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3-carbonyl) -2,4-difluoro-phenyl] -3-cyanobenzenesulfonamide (P-1932).

[0249] The table below shows the types of azaindol (column 2) and sulfonyl chloride (column 3) used to obtain the corresponding compound (column 4). The number of the compound is given in column 1, and the observed mass - in column 5.

<td></td><td>azaindole</td><td>Chloride sulfonyl</td><td>Relationship</td><td>MS (ESI) [M + H^+]+ observation</td>

<td></td><td></td><td></td><td></td><td>wowan</td>

- 113 -

<td></td><td>azaindole</td><td>Chloride sulfonyl</td><td>Relationship</td><td>MS (ESI)^[M + H^]+ observed</td>

<td>P-1839</td><td></td><td>S ^ CI</td><td>yO "YyS πφ ABN</td><td>489.9</td>

<td>P-0913</td><td>fHĄF ΝΗ2 txn</td><td>SO₂CI about</td><td>a '&lt;ap IS ^ t⁰</td><td>413.9</td>

<td>P^-1937</td><td>Fk f \ Vνη^kN^ANDN</td><td>so2d CY</td><td>y-ίθ Bżoo₂TO F ° NN</td><td>459^.1</td>

<td>P^-1938</td><td>r_ ^ hCf ΝΗ₂</td><td>SO2Cl Q ΟγΝΗ</td><td>H F ^ NV YBP êf Atf</td><td>471^.1</td>

<td>P^-0958</td><td>f ^ ^ rAF^NH2Uan</td><td>SO2Ci Φ THIS</td><td>^with3 \ 7¹IZ⁰ AT, 0 /</td><td>444^.3</td>

<td>P^-1941</td><td>C ^ k / f ^NH2</td><td>SO₂CJ and</td><td>y0 TO ° THIS ^F bf °</td><td>462^.3</td>

<td>P^-1942</td><td>1nAn</td><td>so_withand AND. -0</td><td>^χΟγΟ ° A&gt; X ęf mi · »</td><td>475^.9</td>

- 114 -

<td></td><td>azaindole</td><td>Chloride sulfonyl</td><td>Relationship</td><td>MS (ESI) [M + H⁺]⁺observed</td>

<td>P-1943</td><td>&amp;</td><td>SO2CI N-O</td><td>⁵ xj ^F HO nn</td><td>487.1</td>

<td>P-1948</td><td>___. "Ist; N</td><td>SO2CI⁴ Λ S</td><td>HE dp / 'Hf</td><td>487.1</td>

<td>P-1951</td><td>iTyTf ^NH2</td><td>| so₂these k</td><td>_ ^fy= \ \ ζ ^ Ζ⁰" ' kv^aboutkk IN? F^HN"| * About ARE^N 0</td><td>473.9</td>

<td>P-1952</td><td>F nh₂</td><td>SO2CI k</td><td>myaf ° NN</td><td>447.9</td>

<td>P-1953</td><td>r_ / ΡαΠνΗ₂</td><td>SO2Cł Ti /</td><td>N '§ ~ o and XNN^{FH δ}NN</td><td>432.3</td>

<td>P-1954</td><td>Fy = \ F ^ ^^^ ^NH2 ^vxn</td><td>SO2CI '0</td><td>"ABOUT | iM&gt; fW ^ o⁰</td><td>427.9</td>

<td>P-1955</td><td>R * s JPR $ Fnh2</td><td>SO2CI k ck</td><td>° F ° VQ ° ί ^ Γ $ ^{F HN}_^S&gt;⁰^ Ν^Γ"^{ν 0}</td><td>472.3</td>

- 115 -

<td></td><td>azaindole</td><td>Chloride sulfonyl</td><td>Relationship</td><td>MS (ESI) [M + H^+]+ observed</td>

<td>P-1956</td><td>f ,. (ΧΑ f ^nh2</td><td>SO₂CI_SV ) = N /</td><td>F in ° f 'P' PtO h £ ' 'N ~ n ^at</td><td>448.7</td>

<td>P-0931</td><td></td><td>SO₂CI Φ CF3</td><td>_F CF₃K __f ³yP wo O®^{F HN}0 * ° ^about</td><td>481.9</td>

<td>P-1961</td><td>R (TyTf ^NHsAND</td><td>SO2C1 ACL</td><td>Ύ "Ρ ™" Ό-f fp υΧο Slan ⁰</td><td>445.9</td>

<td>P-1962</td><td>iTrS f ^NH2</td><td>SO2CI α</td><td>R \ _ PyNTp ^ o * / W ⁰</td><td>427.9</td>

<td>P-1963</td><td>yp OX^NH2</td><td>SOjCI $ in</td><td>__ Pr ^ c /^vN^XN ⁰</td><td>481.1</td>

<td>P-1131</td><td>5¾ ΟΧ^ΝΗζ</td><td>1 SO2CI ί</td><td>AND pA F "^N-S "⁰N ™ ⁰</td><td>473.9</td>

<td>P-1965</td><td>F yp '.y^ΝΗ2</td><td>SO₂CI Or "</td><td>yp Q 5AN ⁰</td><td>439.1</td>

<td>P-1966</td><td>R _ pAΊ * ^νη2</td><td>SO2C</td><td>E, yp c ^ cn ΠΑ ^Γηνο ό * %% ABOUT</td><td>439.1</td>

- 116 -

<td></td><td>azaindole</td><td>Chloride sdfonyM</td><td>Relationship</td><td>MS (ESI)^[M + H^]+ observed</td>

<td>P-1968</td><td>nh₂'ΊΖ-ν</td><td>s ^ of</td><td></td><td>456.3</td>

<td>P-1969</td><td>IN PrS FNHz</td><td>SOsCJ AND N = /</td><td>R_ In 0Α liM F ^HN7O ^^INN, N ^ABOUT</td><td>471.1</td>

<td>P-2011</td><td>YG</td><td>SO2CI ώ, 1</td><td>b CY ^ S ρ "^ν- £ "ο Ά'Ν θ</td><td>477^.9</td>

<td>P-0885</td><td>^C'T ^^^NH2</td><td>SO2CI ό</td><td>R yQ O ^clyy4^{F hn} s? W 0</td><td>447^.9</td>

<td>P-1267</td><td>F.^theseW'Tf ^ NH₂in</td><td>SO2CI ό</td><td>An $^cl TO At⁰7 / N</td><td>453^.9</td>

<td>P-1842</td><td>^οιγγ {f '^NHZ^V~ N hT</td><td>SO2CI φ</td><td>W. A AQ W AA FH "O?» O Pl · N ^ABOUT</td><td>462^.3</td>

<td>P-1905</td><td>R _ nh</td><td>SO2CI φ HM r</td><td>⁰= f F NH y0 0^Ε'Υύ4 £ * O. V^XN ⁰</td><td>505.1</td>

<td>P-0983</td><td>F^ckff F NH sr</td><td>SO2CI φ</td><td>\_s&lt;= &lt;^ABOUTAO V^c^^ V &lt;YHW-S * ^ tt Γ v ^F JO ^krt"N ^ABOUT</td><td>477^.9</td>

- 117 -

<td></td><td>azaindole</td><td>Chloride sdfonyM</td><td>Relationship</td><td>MS (ESI)^[M + H^]+ observed</td>

<td>P-1599</td><td>R^α^ Τϊν^NH*</td><td>so_withthese AND</td><td>f CF₃vQ 0 Γ ^HN* O ^kN^XN ⁰</td><td>515.9</td>

<td>P-1907</td><td>^NH2 'Ν' 'N</td><td>SCbCl fi</td><td>F »" ^ * A From ^f »0 NN</td><td>496.3</td>

<td>P-1908</td><td>^c'^ YyV^nh* Ύ</td><td>SCoCI 4 = 0 -0</td><td>-oo ^HH / C at^andTY RNf ° N ^N</td><td>509^.9</td>

<td>P-1911</td><td>^these WSF ^NH2^Vf / ~ N</td><td>SC2CI Λ M</td><td>"^ SA^and-nS τ f ​​| - ~ °^kN^ANDN ⁰</td><td>466^.3</td>

<td>P^-1912</td><td>f ^NH2</td><td>sc₂these about"</td><td>0</td><td>465^.9</td>

<td>P-1916</td><td></td><td>SO2CI Φ,^ΟΎ F</td><td>F F vO 0 ^F^and'Tr ^ iRhh-So '' N ''^{n 0}</td><td>513.9</td>

<td>P-1918</td><td>^theseYyVP^NHZ* Άν</td><td>S so₂these r</td><td>_c, νρτΓ Ρ "^ν"®ό^vn^xn ⁰</td><td></td>

<td>P-1919</td><td>F.^C!VV4f ΝΗ^{2 1}ν^λν</td><td>SO2CI</td><td>^cl a4friP^kN, N</td><td>481^.9</td>

- 118 -

<td></td><td>azaindole</td><td>Chloride sulfonyl</td><td>Relationship</td><td>MS (ESI) [M + H⁺]⁺observed</td>

<td>P-1920</td><td>F_ NH *</td><td>SO₂C! k</td><td>You M 'S ~ FRS ^F H &lt;s</td><td>465.9</td>

<td>P-1921</td><td>F</td><td>SOjCI above</td><td>C_F T3^c'TnC f ^hn-?-about (ύ'Ν °</td><td>461.9</td>

<td>P-1922</td><td>F ° ko^kir ~ N</td><td>SO2CI J</td><td>"JS V - N u V yy CyM (ⁿabout₀^VNk o</td><td>505.9</td>

<td>P-1923</td><td>^αγν \ f ^NH2^atN, N</td><td>Y ". A-in ABOUT \ Q</td><td>R γΟ ^ -Γ^Qxxn ^{F HH} f⁰</td><td>483.1</td>

<td>P-1926</td><td>^clvM&gt; ^{f NH}* "ITN</td><td>so;&gt; you ABOUT" F</td><td>ⁱⁿr0 * 0^F" 'FRF^N-Fat ^vnk ⁰</td><td>483.9</td>

<td>P-1927</td><td>F &lt;^CIYV \ F ^nh2 "Ν^ΛΝ</td><td>SO2C! AND</td><td>K^andrvT f ^h^ ns ^f^SN-^l^ N ⁰</td><td>479.9</td>

<td>P-1928</td><td>_and ° kp XQ '- ^{! N}-</td><td>SO2C] CK</td><td>yO 0^αγγζ ^ N - * ( (n 0</td><td>461.9</td>

<td>P-1929</td><td>° ^FVX^c1VY \ f nh₂</td><td>1 SO2CI 1</td><td>° O-OγΜ. NN υ</td><td>507.9</td>

- 119 -

<td></td><td>azaindole</td><td>Chloride sulfonyl</td><td>Relationship</td><td>MS (ESI)^[M + H^+]+ observed</td>

<td>P-1931</td><td>r, X^C'WŚ F^nH2</td><td>SO₂C1 N;^N</td><td>Tri f ^hn-§-about^cn</td><td>473.1</td>

<td>P-1932</td><td>^CYYSf NH2</td><td>SO₂CI</td><td>^FV \^vn^xn ^about</td><td>473.1</td>

Example 22. Synthesis of propane-1-sulfonic acid {3- [5- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluorophenyl} -amide, P-0956 [0250 ] Compound P-0956 was obtained in three stages from 5- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridine 514 and propane-1-sulfonic acid (2,4-difluoro-3-formyl-phenyl) -amide, as shown in Diagram 72.

Diagram 72

<img file="PL1893612T3_D0141.tif" />

Step 1-Preparation of propane-1- ([5- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-3-yl] hydroxymethyl} -2,4-difluoro-phenyl) -amide Sulfonic (632) and (3 - {[5- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-3-yl] methoxymethyl} -2,4-difluorophenyl) -amide of propane-1sulfonic acid ( 633):

[0251] To a 5- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridine suspension (514, 64.9 g, 158 mM, prepared as described in Example 17) and (2,4-difluoro-3- propan-1-sulfonic acid propyl-1-formamide (73, 90.4 g, 191 mM, prepared as described in Example 7) in methanol in a water bath, potassium hydroxide (128.8 g, 1.28 M) was added. The reactants were stirred for 72 h at room temperature, then the pH was adjusted to 7 with 4N hydrochloric acid. The resulting mixture was evaporated in vacuo to remove methanol and extracted 3x with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give a crude oil. Crude

120 oil was triturated with a 3: 1 mixture of MTBE / heptane to give a solid 1: 3 mixture

632 and 633, which was used directly for the next stage.

Step 2-Preparation of propane-1- ({5- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridin-3-yl] hydroxymethyl} -2,4-difluoro-phenyl) -amide sulfonic acid (632):

[0252] To a solution of 632 and 633 (ca. 315 mM) in acetic acid was added 48% hydrobromic acid (final concentration 8%). The resulting mixture was stirred overnight at room temperature and then evaporated in vacuo. The crude residue was dissolved in an equimolar mixture of ethyl acetate and water, and the pH was adjusted to 7 with solid potassium carbonate. The layers were separated and the aqueous layer was extracted 2x with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give 632 as a viscous oil which was used directly for the next step.

Step 3-Preparation of propane-1-sulfonic acid {3- [5- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl] -2,4-difluorophenyl} -amide of propane-1-sulfonic acid (P- 0956):

[0253] To a solution of 632 (ca. 386 mM) in 1,4-dioxane was added 2,3-dichloro-5,6-dicyanobenzoquinone (83.8 g, 502 mM) followed by water (final concentration 4.8%). The resulting mixture was stirred for 2 hours at room temperature and then quenched with one volume of saturated potassium hydrogen carbonate solution. The mixture was evaporated in vacuo to remove 1,4-dioxane and extracted 3x with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give a crude solid product that was purified on a silica gel column using a 94: 5: 1 mixture of dichloromethane / methanol / ammonium hydroxide as eluent to yield P-0956 (about 50% yield for 3 steps) in the form of a white solid.

Example 23: Synthesis of 3-iodo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine 635 [0254] 3-Iodo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine 635 was prepared in one step with 3-iodo-1H-pyrrolo [2,3-b] pyridine 634, as shown in scheme 73.

Diagram 73

<img file="PL1893612T3_D0142.tif" />

Step 1-Preparation of 3-iodo-1-triisopropylsilanyl-1H-pyrrolo [2,3-b] pyridine (635):

[0255] 3-Iodo-1H-pyrrolo [2,3-b] pyridine 634 (2.00 g, 8.20 mmol) was dissolved in N, N-dimethylformamide (50 mL). Sodium hydride (60% suspension in mineral oil, 390 mg, 9.8 mmol) was added. After 20 minutes, triisopropylsilyl chloride (1.74 mL, 8.20 mmol) was added dropwise. After 1.5 h the mixture was poured into water and extracted with ethyl acetate, washed with saturated sodium bicarbonate solution and brine. The organic layers were dried over

Anhydrous sodium sulfate and concentrated. Purification by silica gel chromatography using a 0-25% gradient of ethyl acetate / hexane mixture gave compound 635 as a white solid (3.224 g, 98.2%). Results^LH-NMR corresponded to the desired compound.

Example 24: Synthesis of 1- (tert-butyldimethylsilanyl) -3-iodo-1H-pyrrolo [2,3-b] pyridine 636 [0256] 1- (tert-butyldimethylsilanyl) -3-iodo-1H-pyrrole [2,3 -b] pyridine 636 was obtained in one step from 3-iodo-1H-pyrrolo [2,3-b] pyridine 634, as shown in scheme 74.

Scheme 74

<img file="PL1893612T3_D0143.tif" />

636

Step 1-Preparation of 1- (tert-butyldimethylsilanyl) -3-iodo-1H-pyrrolo [2,3-b] pyridine (636):

[0257] 3-Iodo-1H-pyrrolo [2,3-b] pyridine 634 (1.11g, 4.6 mmol) was dissolved in tetrahydrofuran (120 mL). Sodium hydride (60% suspension in mineral oil, 0.13 g, 5.5 mmol) was added followed by tert-butyldimethylsilyl chloride (0.85 g, 5.5 mmol). The reactants were stirred at room temperature overnight. The mixture was poured into water and extracted with ethyl acetate. The organic portion was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to provide the compound as a white solid (636, 100 mg, 15%).

Example 25: Synthesis of 5- [4- (2-methoxyethoxy) -phenyl] -1H-pyrrolo [2,3-b] pyridine 648 [5-25] 5- [4- (2-methoxyethoxy) phenyl] -1H-pyrroloate [2,3-b] pyridine 648 was prepared in two steps from 4-bromophenol 646, as shown in scheme 77.

<img file="PL1893612T3_D0144.tif" />

Step 1-Preparation of 1-Bromo-4- (2-methoxyethoxy) benzene (647):

[0259] To a solution of 4-bromophenol (646, 5.0 g, 28.9 mmol) in dimethylformamide (15 mL) was added potassium carbonate (4.40 g, 31.8 mmol) and 1-bromo-2-methoxyethane ( 5.00 g, 36.0 mmol) under nitrogen. The reaction mixture was stirred at ambient temperature overnight and concentrated under reduced pressure. The residue was suspended in ethyl acetate (50 mL) and filtered. The filtrate was washed with a saturated solution of sodium hydrogen carbonate, dried over magnesium sulfate and filtered. Silica gel column chromatography (0-10% solution

- 122 ethyl acetate in hexanes) gave the desired compound as a colorless oil (647, 3.2 g,

48%).

Step 2-Preparation of 5- [4- (2-methoxyethoxy) -phenyl] -1H-pyrrolo [2,3-b] pyridine (648):

[02⁶θ] To a solution of 5- (^4.4.5^.5^.-these^trame^backabout-[^1,3,2]^diabout^kare^boro^lan-²-^ylabout)-¹H^piro^labout[^2.3b] pyridine (1.1 g, 4.3 mmol) in tetrahydrofuran (40 mL) was added 1-bromo-4- (2-methoxyethoxy) -benzene (647, 1.50 g, 6.49 mmol) and tetrakis (triphenylphosphine) palladium (0) (0.25 g, 0.21 mmol).

[0261] The reaction mixture was stirred with a solution of potassium carbonate (10 mL, 1.0 M) and heated under reflux overnight. The two-phase reaction mixture was diluted with ethyl acetate (50 mL) and saturated sodium carbonate solution (20 mL). The organic layer was separated, washed with brine, dried over magnesium sulfate and purified by silica gel column chromatography (50-100% ethyl acetate in hexanes) to give the desired compound as a colorless solid (648, 782 mg, 67%). MS (ESI)^[M + H^{+] +}= 267^.4.

Example 25: Additional Compounds [0262] Additional compounds of the invention were synthesized by the methods described in the above Examples or the like, or methods known to those skilled in the art, and are shown in Table 1 below.

<img file="PL1893612T3_D0145.tif" />

Example 26: Kinase activity assays [0263] The effect of potential modulators of kinase activity can be measured by a variety of methods known in the art. For example, direct, indirect FRET or AlphaScreen radiometric tests may be used to determine the level of phosphorylation of the reagent in the presence of test compounds to determine the blocking effect of a given compound on the kinase. Invitrogen (Carlsbad, CA) uses a FRET based assay for Btk, EGFR, EphB2, Flt3, Irak4, Kdr, M AP2K1, M APKAPK2, PDGFRB, PKC theta, Stk6 and Yes. For these

123 assays of compounds of the invention were screened by Invitrogen using the Z'-Lyte ™ kinase assay.

[0264] In brief, the Invitrogen kinase assay involves the use of a specific peptide substrate optimized for each of the kinases containing at each end the fluorophores that form the FRET pair. Peptide susceptibility to proteolytic degradation depends on the phosphorylation of the peptide. The non-phosphorylated peptide is degraded by the protease, while the kinase-phosphorylated peptide is not degraded. The degradation of the peptide disrupts FRET between the donor fluorophore (coumarin) and acceptor (fluorescein), which leads to an increase in the ratio of donor emission to acceptor emission. The ratio of coumarin to fluorescein emission is used to evaluate the progress of the reaction. The degree of phosphorylation is determined on the basis of the emission ratio, which is low when the kinase is active (the phosphorylated peptide is not decomposed, FRET pair combined) or higher in the case of blocked kinase (the non-phosphorylated peptide is unfolded, the FRET pair separated). Therefore, the assay involves a kinase reaction in the presence of various concentrations of a given compound, a specific reaction with a specific protease, and a detection of the coumarin fluorescein and fluorescein emission ratio. The emission ratio as a function of compound concentration was used to determine the IC 50 values. The reaction conditions for individual kinases were determined in order to obtain optimal reaction times, incubation temperatures and kinase and ATP concentrations. Samples prepared were composed of 1x kinase buffer (50 mM HEPES pH 7.5, 50 mM MgCl 2, 5 mM EGTA, 0.05% BRIJ-35) and the appropriate concentration of compound in DMSO, so that the final DMSO concentration was 1%. Blinds include a control sample with 0% phosphorylation, no ATP, control sample with 100% phosphorylation, consisting of a synthetically phosphorylated peptide, and a 0% inhibition control sample containing active kinases without compound. The assay plates are usually prepared to a final volume of 10 μΐ per sample, by adding 2.5 μl of the compound at a concentration four times the desired concentration (4x) in 4% DMSO (dilution series of the compound gives a concentration curve), 5 μl of the appropriate kinase mixed with the peptide substrate Z'-LYTE ™ (2x in 2x kinase buffer, final peptide at 2 μΜ) and 2.5 ml ATP 4x solution. All kinases except MAP2K1 had 10 μM ATP in the kinase reaction, whereas MAP2K1 had 100 μM. The samples were mixed and the kinase reaction was incubated for 1 h at room temperature, after which 5 μl of the test solution was added and mixed. After incubation for another 1 h at room temperature, 5 μl of stopping reagent was added to each sample and mixed. Fluorescent signals were measured to determine the emission ratio.

[0265] The AlphaScreen assay was used to screen additional kinases. This test is similar to the phosphorylation of the peptide substrate. In this assay, an antibody recognizing the phosphorylated substrate is bound to the acceptor bed. The peptide substrate is combined with biotin, which binds to a donor bed containing streptavidin. Thus, the phosphorylated reagent is bound by the antibody and streptavidin, approaching the small donor and acceptor deposit distance when the kinase is not blocked. Donor gives off singlet oxygen, which leads to emissions from the acceptor when they are at a short distance from each other. On the other hand, when the kinase is blocked, the donor and acceptor beds are unrelated and

- 124 emission from the acceptor is reduced. The dependence of the fluorescence signal on the concentration of the compound was used to determine the IC 50 values.

Genetic engineering [0266] For some kinase screening studies, it was necessary to obtain a kinase. Plasmids encoding a number of kinase enzymes were obtained by the usual polymerase chain reaction (PCR). For each of them, the corresponding DNA sequences and coding protein sequences used in the assays are set out below. Complementary DNA cloned from various human tissues was purchased from Invitrogen and used as substrates in PCR reactions. Custom designed synthetic oligonucleotide primers were designed (Invitrogen, see below), which task was to initiate the PCR product, as well as provide appropriate restriction enzyme cleavage sites for ligation with plasmids.

[0267] In the case of KIT, the entire enzyme coding sequence was obtained through a gene synthesis procedure using custom-made synthetic oligonucleotides, encompassing the entire coding sequence (Invitrogen).

[0268] Plasmids used for ligation with kinase-coding inserts were either pET (Novagen) for expression using E. coli or pFastBac (Invitrogen) for expression using baculovirus infected insect cell cultures. In each of these cases, the kinase was modified to contain a histidine tag for purification by metal affinity chromatography.

[0269] In some cases, kinase-generating plasmids were created as bicistronic mRNA for the co-expression target of a second protein that modifies the kinase protein during its expression in the host cell. In the case of Abl, FGFR1, Flt1, Kdr, Kit, Met, Ret, and Src, coexpression of tyrosine phosphatase 1B (PTP) was observed to dephosphoryl phosphotyrosines. In the case of ERK2, the activated form of MEK1 (MEK1DD) was co-expressed to phosphorylate and activate ERK2. In the case of p38a, the activated form of MEK6 (MKK6) was co-expressed to phosphorylate and activate p38a. In the case of BRAF, the CDC37 chaperone protein was co-expressed to more efficiently fold the BRAF protein chains.

[0270] Plasmids encoding proteins that are phosphorylated substrates were expressed as N-terminal GST fusions and C-terminal biotinylation fusions, using pGEX vectors (Amersham) modified to contain sequences coding for the C-terminal biotinylation tag. These reagents include MEK1, a substrate for BRAF, and BAD, a substrate for Pim1.

Expression of proteins in E. coli and purification.

[0271] For the expression of proteins, plasmids containing the appropriate genes were

- transformed into E. coli BL21 (DE3) RIL or pLyS strains (Invitrogen) and transformants selected for cultivation on agar plates with LB medium containing the appropriate antibiotics. Individual colonies were grown overnight at 37 ° C into 200ml TB medium (Terrific broth). 16x1 L of fresh TB medium in 2.8L flasks was inoculated with 10ml of culture from overnight cultures and grown under constant shaking at 37 ° C. After cultures of absorbance at 1.0 at 600 nm, IPTG was added and cultures were allowed to grow for a further 12-18 h at temperatures in the range of 1230 ° C. The cells were harvested by centrifugation and the granules were frozen at 80 ° C until lysis.

[0272] For the purification of proteins; granules of frozen E. coli cells were suspended in lysis buffer and lysed using standard mechanical methods. Soluble proteins were purified via polyhistidine tags using immobilized metal affinity chromatography (IMAC). All kinases described herein were purified in a three-stage purification process using: IMAC, molecular exclusion chromatography (SEC) and ion exchange chromatography. In most cases, the polyhistidine tag was removed with thrombin (Calbiochem).

[0273] In some cases, the purification protocol required modification to stabilize the soluble protein during purification and concentration. In the case of BRaf, 5mM MgCf was necessary during the entire purification. In the case of Ret the combination of 1mM ATP and 5M MgCh was necessary during lysis of the cells and during the whole purification. In the case of Zap70, an excess of 5M AMP-PCP was required relative to the protein as well as 5mM MgCl2.

The baculovirus expression vector system

Virus production:

[0274] Transfection of the Spodoptera frugiperda cell monolayer (Sf9) was performed using the bacmid containing the appropriate gene and the transfectant Cellfectin Reagent (Invitrogen) in complete Grace's medium (Invitrogen) that did not contain antibiotics and plasma. After a five-hour incubation, the transfection medium was removed and the monolayer was fed with Grace's medium containing 10% FBS and antibiotics. After the incubation lasting from 72 to 96 h, the supernatant containing the virus was collected. The titer of viral material was then determined using a baculovirus (BD) kit. Viral material was later propagated using cultures with low multiplicity of infection (MOI 0.1) and harvested 48 h after inoculation. The titer of the viral material was then determined for the recombinant production of proteins.

[0275] The protein expression level was optimized by differentiating MOI (1-10) and harvest time (48-72 h). Sf9 cells were adapted to SF-900 II medium containing no plasma and grown in suspension in spinner flasks. The cell suspension was

- 126 then used to inoculate the Wave bioreactor on a 25L scale. The cells were harvested 48-72 h after inoculation and stored at 80 ° C until lysis.

Proteins were purified in a similar manner to proteins expressed in E. coli.

Kinase assay [0276] AlphaScreen assays were conducted using compounds dissolved in DMSO at a concentration up to 20 mM. The compounds were dissolved according to the desired final concentrations in each well of the sample, using a 1: 3 serial dilution for a total of 8 concentration measurement points. The plates were prepared in such a way that each kinase reaction mixture contained 20 μl in 1x kinase buffer, 5% DMSO and 10 μΜ ATP. The kinase and test conditions (as defined below) used for individual kinases are shown in Table 3. After incubation of the kinase reaction mixture for 1 h at room temperature, 5 μl donor bed in buffer was added (50mM EDTA in 1x kinase buffer), the sample was mixed and incubated 20 minutes at room temperature, then 5 μL of the acceptor bed was added in the holding buffer. Samples were incubated for 60 minutes at room temperature and the signal of each sample was read on the AlphaQuest reader. The phosphorylated reagent leads to antibody binding and association of donor and acceptor media in such a way that the signal correlates with kinase activity. The dependence of the signal on the concentration of the compound was used to determine the IC50.

[0277] Test conditions A:

HEPES 50mM Kinase, pH 7.2, 5mM MgCl2, 5mM MnCh, 0.2% BSA, 0.01% NP-40

Substrate 100 nM biotin - (E4Y) 3 (Open Source Biotech, Inc.)

Donor bed The bed is coated with streptoavidin 1 pg / ml (Perkin kimer Lite Science).

Acceptor bed Compound coated with PY20 1 pg / ml (Perkin Elmer Life Science) [0278] Test B conditions:

Kinase buffer

substratum

Donor bed Acceptor bed with mM HEPES pH 7.0, 50 mM NaCl, 2 mM MgCl 2, 1 mM MnCl 2, 1 mM DTT, 0.01% Tween-20.

100 nM biotin-MEK1 (prepared as described above).

A bed covered with streptoavidin 10 pg / ml (Perkin Elmer Life Science).

Coated with protein A 10 pg / ml, bound to the anti-phospho antibody MEK1 / 2 (CellSignal) [0279] Test conditions C:

Kinetic buffer Substrat

The donor mM HEPES resin pH 7.0, 4 mM MgCl 2, 1 mM DTT, 0.01% Tween-20. 100 nM biotin-MBP (Upstate Biotechnology, Waltham, MA).

A bed covered with streptoavidin 10 pg / ml (Perkin Elmer Life Science).

- 127 Acceptor bed Coated with A 10pg / ml protein bound to the anti-phospho antibody

MBP (CellSignal) [0280] Test D conditions:

Kinase buffer 8 mM MOPS pH 7.4, 2 mM MgCl 2, 8 mM MnCl 2, 2 mM DTT, 0.01% Tween-20.

Substrate 30 nM biotin- (E4Y) 10 (Upstate Biotechnology).

Donor bed A bed covered with streptoavidin 20 pg / m 1 (PerkńnElmer Life Science).

Acceptor bed Antibody coated with PY20 20 pg / ml (Perkin Elmer Life Science) [0281] ^INarun^ki P test:

20 mM HEPES Kinase buffer pH 7.0, 10 mM MgCl 2, 1 mM DTT, 0.01% Tween-20.

Substrate 30 nM biotin-ATF2 (Upstate Biotechnology).

Donor plate Zteze pokytte with streptoavidin 10 pg / ml (PerkńnElmer Science Science).

Acceptor bed Covered with protein A 10 pg / ml, bound to anti-phospho ATF2 antibody (CellSignal) [0282] ^INarun^ki test E

Kinase buffer 8 mM HEPES pH 7.0, 4 mM MgCl 2, 1 mM DTT, 0.01% Tween-20.

Substrate 100 nM biotin-BAD (prepared as described above).

Donor's deposit Zteże ρο1 \ ΐ 'stietp) tmwid \ą 10 pg / ml 1 (PerkńnElmer Dolls Sciencek

Acceptor bed Coated with protein A 10 pg / ml, bound to anti-phospho BAD antibody (Ser112) (CellSignal) [0283] Test conditions G:

25 MM MOPS kinase buffer, pH 7.1, 0.1 mM MgCl 2, 5 mM MnCl 2, 0.2% BSA, 1 mM DTT, 0.01% Tween-20.

Substrate 100nM biotin- (E4Y) 3 (Open Source Biotech, Inc.)

Donor bed LOAD ^ e pokytte stfeptoaγvidyny 1 pg / m 1 ιΑγΡιιΗΙιμτ Ι.ίΟτ Sci enee).

Acceptor bed PY20 1 pg / ml coated (Perkin Elmer Life Science)

Table 3 Kinase reaction conditions (volume of 20 μl mixture) for kinase screening assays.

<td>kinase</td><td>Manufacturer*</td><td>Plasmid number</td><td>The host of expression</td><td>Test conditions</td>

<td>abl</td><td></td><td>P1121</td><td>E. coli</td><td>A (1 ng kinase)</td>

<td>B-Raf</td><td>Upstate</td><td></td><td></td><td>B (0.1 ng kinase)</td>

<td>B-Raf V600E</td><td></td><td>P4254</td><td>Sf9</td><td>B (0.1 ng kinase)</td>

- 128 -

<td>kinase</td><td>Manufacturer*</td><td>Plasmid number</td><td>The host of expression</td><td>Test conditions</td>

<td>c-Raf-1</td><td>Upstate</td><td></td><td></td><td>B (0.1 ng kinase)</td>

<td>Erk2</td><td></td><td>P4227</td><td>E. coli</td><td>C (4 ng kinase)</td>

<td>Fak</td><td></td><td>P1358</td><td>Sf9</td><td>A (0.1 ng kinase)</td>

<td>FGFR1</td><td></td><td>P1351</td><td>E. coli</td><td>A (0.1 ng kinase)</td>

<td>Flt1</td><td></td><td>P1826</td><td>E. coli</td><td>A (0.1 ng kinase)</td>

<td>Flt4</td><td>ProQinase</td><td></td><td></td><td>A (0.1 ng kinase)</td>

<td>fms</td><td>Upstate</td><td></td><td></td><td>D (0.5 ng kinase)</td>

<td>JNK1</td><td>Upstate</td><td></td><td></td><td>E (0.1 ng kinase)</td>

<td>JNK2</td><td>Roche</td><td></td><td></td><td>E (0.05 ng kinase)</td>

<td>JNK3</td><td>Upstate</td><td></td><td></td><td>E (0.1 ng kinase)</td>

<td>Putty</td><td></td><td>P1332</td><td>E. coli</td><td>A (0.1 ng kinase)</td>

<td>Underworld</td><td></td><td>P1818</td><td>E. coli</td><td>A (0.1 ng kinase)</td>

<td>p38</td><td></td><td>P4292</td><td>E. coli</td><td>E (6 ng kinase)</td>

<td>Pim1</td><td></td><td>P1215</td><td>E. coli</td><td>F (0.01 ng kinase)</td>

<td>Pyk2</td><td>Upstate</td><td></td><td></td><td>D (1 ng kinase)</td>

<td>Ret</td><td></td><td>P1378</td><td>E. coli</td><td>A (0.01 ng kinase)</td>

<td>src</td><td></td><td>P1144</td><td>E. coli</td><td>A (0.01 ng kinase)</td>

<td>Zap70</td><td></td><td>P1868</td><td>Sf9</td><td>G (0.1 ng kinase)</td>

<td colspan="3">* Upstate = Upstate Biotechnology</td><td></td><td></td>

<td colspan="2">Roche = Roche Expression</td><td colspan="2">Group proteins (Indianapolis, IN)</td><td></td>

<td colspan="4">ProQinase = ProQinase GmbH (Freiburg, Germany)</td><td></td>

[0284] Kinase Kit was alternatively purchased from Cell Signaling Technology. Kit and Fms tests were also conducted using 100 μΜ ATP, when in the case of Fms, 1x buffer was 8 mM MOPS pH 7.0, 2 mM MgCl 2, 8 mM MnCl 2, 2 mM DTT, 50 mM NaCl, 0.01% BSA and 0.01% Tween-20 and stopping buffer was 8 mM MOPS, pH 7.0, 100 mM EDTA, 0.01% BSA, while for Kit 1 ng kinase was used, buffer 1x was 8 mM MOPS pH 7.0 , 1 mM MgCl 2, 2 mM MnCl 2, 1 mM DTT, 0.001% BSA and 0.01% Tween-20, with reagent 30 nM biotin - (E4Y) 10 (Upstate Biotechnology), and the beds had 10 μg / ml in stop buffer 8 mM MOPS, pH 7.0, 100 mM EDTA, 0.3% BSA.

[0285] The compounds screened with at least one of the methods or methods described above

- 129 similar methods, having an IC50 below 10 μΜ, are shown in Tables 2a (Ab1), 2b (B-Raf), 2c (B-Raf V600E), 2d (Btk), 2e (c-Raf-1), 2f (EGFR), 2g (EphB2), 2h (Erk2), 2i (Fak), 2j (FGFR1), 2k (Flt1), 2l (Flt3), 2m (Flt4), 2n (Fms), 2o (Irak4), 2p (Jnk1), 2q (Jnk2), 2r (Jnk3), 2s (Kdr), 2t (Kit), 2u (MAP2K1), 2v (MAPKAPK2), 2w (Met), 2x (p38), 2y (PDGFRB), 2z (Pim1), 2aa (PKC theta), 2bb (Pyk2), 2cc (Ret), 2dd (Src), 2ee (Stk6), and 2ff (Yes), 2gg (Zap70), 2hh (Akt3), 2ii (ALK) , 2jj (Cdk2), 2kk (Csk), 2ll (EphA2), 2mm (EphB4), 2nn (Frk), 2oo (Gskp), 2pp (Hck), 2qq (MAP4K4), 2rr (IGF1R), 2ss (IKK beta ), 2tt (Itk), 2uu (Jak3), 2vv (MLK1), 2ww (TrkA), 2xx (PDGFRA), 2yy (Plk1), 2zz (Brk), 2ab (ROCKI), 2ac (Syk), 2ad (TEC) ) and 2ae (Tie2).

Table 2a. Abl kinase-active compounds with an IC 50 &lt;10 μM.

<td>abl</td><td>P-0001, P-0002, P-0003, P-0005, P-0007, P-0010, P-0011, P0012, P-0019, P-0025,</td>

<td></td><td>P-0028, P-0032, P-0033, P-0040, P-0041, P-0045, P-0047, P0048, P-0050, P-0054, P-0056, P-0058, P-0068, P-0072, P-0074, P-0090, P-0093, P0134, P-0140, P-0142, P-0167, P-0169, P-0196, P-0218, P-0224, P-0244, P-0316, P0320, P-0448, P-0453, P-0501, P-0521, P-0529, P-0550, P-0559, P-0562, P-0579, P0594, P-0599, P-0604, P-0611, P-0623, P-0624, P-0645, P-0656, P-0671, P-0675, P0691, P-0693, P-0708, P-0738, P-0751, P-0762, P-0781, P-0794, P-0800, P-0806, P0885, P-1011, P-1012, P-1115, P-1127, P-1318, P-1336, P-1394, P-1426</td>

Table 2b. B-Raf kinase active compounds with ICs &amp; lt; 10 μM.

<td>B-Raf</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P0008, P-0009, P-0010, P-0016, P-0019, P-0021, P-0024, P-0025, P-0026, P-0027, P0032, P-0034, P-0035, P-0036, P-0037, P-0038, P-0041, P-0042, P-0045, P-0050, P0052, P-0054, P-0055, P-0056, P-0059, P-0060, P-0065, P-0066, P-0067, P-0068, P0078, P-0079, P-0082, P-0088, P-0090, P-0093, P-0095, P-0102, P-0112, P-0114, P-</td>

- 130 -

<td></td><td>0122, P-0126, P-0140, P-0143, P-0162, P-0165, P-0166, P-0171, P-0178, P-0180, P0184, P-0188, P-0192, P-0196, P-0200, P-0210, P-0228, P-0257, P-0262, P-0265, P0269, P-0271, P-0284, P-0293, P-0297, P-0302, P-0307, ​​P-0310, P-0351, P-0356, P0369, P-0382, P-0396, P-0414, P-0448, P-0486, P-0521, P-0550, P-0556, P-0559, P0579, P-0594, P-0599, P-0604, P-0613, P-0636, P-0683, P-0685, P-0693, P-0697, P0700, P-0716, P-0721, P-0728, P-0734, P-0744, P-0745, P-0746, P-0753, P-0763, P0773, P-0774, P-0776, P-0778, P-0779, P-0794, P-0798, P-0805, P-0806, P-0807, P0818, P-0837, P-0841, P-0842, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P0861, P-0863, P-0866, P-0867, P-0868, P-0874, P-0876, P-0877, P-0883, P-0885, P0889, P-0894, P-0896, P-0897, P-0898, P-0902, P-0904, P-0907, P-0909, P-0910, P0911, P-0912, P-0913, P-0919, P-0924, P-0928, P-0931, P-0932, P-0933, P-0937, P0939, P-0941, P-0944, P-0946, P-0947, P-0952, P-0954, P-0955, P-0956, P-0958, P0959, P-0973, P-0975, P-0978, P-0980, P-0983, P-0984, P-0987, P-0991, P-0997, P0998, P-1003, P-1004, P-1006, P-1009, P-1013, P-1014, P-1020, P-1027, P-1028, P1056, P-1076, P-1080, P-1110, P-1116, P-1243, P-1244, P-1246, P-1247, P-1249, P1250, P-1251, P-1252, P-1253, P-1254, P-1255, P-1256, P-1257, P-1258, P-1259, P1260, P-1261, P-1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1268, P-1269, P-</td>

- 131 -

<td></td><td>1270, P-1279, P-1280, P-1281, P-1282, P-1288, P-1289, P-1317, P-1318, P-1336, P1338, P-1341, P-1343, P-1346, P-1347, P-1348, P-1349, P-1365, P-1383, P-1384, P1385, P-1386, P-1387, P-1388, P-1389, P-1390, P-1391, P-1395, P-1397, P-1419, P1420, P-1429, P-1430, P-1431, P-1432, P-1433, P-1445, P-1446, P-1447, P-1451, P1452, P-1453, P-1454, P-1455, P-1456, P-1457, P-1458, P-1459, P-1467, P-1469, P1472, P-1473, P-1475, P-1477, P-1479, P-1480, P-1481, P-1485, P-1486, P-1526, P1527, P-1528, P-1529, P-1532, P-1534, P-1539, P-1541, P-1542, P-1544, P-1546, P1547, P-1548, P-1549, P-1552, P-1553, P-1554, P-1555, P-1556, P-1559, P-1566, P1567, P-1568, P-1569, P-1570, P-1576, P-1577, P-1580, P-1581, P-1582, P-1583, P1584, P-1585, P-1586, P-1589, P-1590, P-1591, P-1592, P-1593, P-1596, P-1597, P1598, P-1599, P-1600, P-1602, P-1605, P-1608, P-1609, P-1610, P-1612, P-1613, P1616, P-1621, P-1627, P-1630, P-1631, P-1636, P-1637, P-1638, P-1639, P-1656, P1660, P-1663, P-1664, P-1665, P-1670, P-1671, P-1687, P-1700, P-1701, P-1702, P1703, P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P-1710, P-1711, P-1712, P1713, P-1714, P-1715, P-1716, P-1717, P-1718, P-1719, P-1720, P-1721, P-1722, P1723, P-1724, P-1725, P-1726, P-1727, P-1728, P-1729, P-1730, P-1731, P-1732, P1733, P-1734, P-1735, P-1736, P-1737, P-1738, P-1739, P-1740, P-1741, P-1742, P-</td>

- 132 -

<td></td><td>1746, P-1747, P-1748, P-1749, P-1750, P-1751, P-1752, P-1753, P-1755, P-1756, P1757, P-1758, P-1759, P-1760, P-1762, P-1763, P-1764, P-1765, P-1766, P-1767, P1768, P-1769, P-1770, P-1771, P-1772, P-1773, P-1774, P-1775, P-1776, P-1777, P1778, P-1779, P-1780, P-1781, P-1782, P-1783, P-1784, P-1798, P-1799, P-1800, P1802, P-1804, P-1816, P-1817, P-1818, P-1819, P-1822, P-1823, P-1825, P-1827, P1828, P-1839, P-1840, P-1841, P-1842, P-1864, P-1865, P-1871, P-1872, P-1873, P1878, P-1879, P-1881, P-1882, P-1907, P-1912, P-1916, P-1980, P-1996, P-1997, P1998, P-2005, P-2006, P-2007, P-2012, and P-2013</td>

Table 2c. B-Raf V600E kinase active compounds with IC50 &lt;10 μΜ.

<td>B-Raf V600E</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P0008, P-0009, P-0010, P-0011, P-0012, P-0013, P-0014, P-0015, P-0016, P-0017, P0019, P-0021, P-0022, P-0024, P-0025, P-0026, P-0027, P-0028, P-0032, P-0033, P0034, P-0035, P-0036, P-0037, P-0038, P-0039, P-0040, P-0041, P-0042, P-0043, P0044, P-0045, P-0046, P-0047, P-0048, P-0049, P-0050, P-0051, P-0052, P-0053, P0054, P-0055, P-0056, P-0059, P-0060, P-0062, P-0063, P-0066, P-0067, P-0068, P0070, P-0071, P-0072, P-0073, P-0074, P-0075, P-0078, P-0079, P-0082, P-0085, P0088, P-0089, P-0090, P-0092, P-0093, P-0095, P-0097, P-0099, P-0100, P-0102, P0107, P-0108, P-0109,</td>

- 133 -

<td></td><td>P-0110, P-0112, P-0114, P-0118, P-0119, P-0121, P-0122, P0124, P-0126, P-0129, P-0134, P-0135, P-0137, P-0139, P-0140, P-0141, P-0146, P0147, P-0148, P-0152, P-0153, P-0156, P-0160, P-0162, P0165, P-0166, P-0170, P0171, P-0174, P-0175, P-0178, P-0180, P-0181, P-0184, P-0185, P-0186, P-0187, P0188, P-0191, P-0192, P-0196, P-0199, P-0200, P-0205, P-0208, P-0210, P-0211, P0215, P-0228, P-0231, P-0237, P-0242, P-0243, P-0244, P-0246, P-0248, P-0252, P0255, P-0257, P-0261, P-0262, P-0265, P-0269, P-0271, P-0274, P-0284, P-0287, P0293, P-0295, P-0297, P-0302, P-0307, ​​P-0308, P-0311, P-0318, P-0320, P-0325, P0333, P-0344, P-0347, P-0351, P-0352, P-0355, P-0356, P-0358, P-0369, P-0373, P0381, P0382, P-0386, P-0388, P-0396, P-0409, P-0414, P-0418, P-0420, P-0421, P0434, P-0441, P-0447, P-0448, P-0453, P-0472, P-0483, P-0486, P-0493, P-0515, P0521, P-0535, P-0550, P-0552, P-0559, P-0573, P-0579, P-0592, P-0594, P-0599, P0600, P-0603, P-0604, P-0613, P-0623, P-0624, P-0636, P-0638, P-0645, P-0646, P0647, P-0651, P-0656, P-0668, P-0671, P-0679, P-0683, P-0685, P-0691, P-0693, P0696, P-0698, P-0700, P-0710, P-0713, P-0716, P-0721, P-0728, P-0730, P-0734, P0744, P-0745, P-0746, P-0751, P-0753, P-0762, P-0763, P-0771, P-0773, P-0774, P0776, P-0777, P-0778, P-0779, P-0794, P-0798, P-0803, P-0805, P-0806, P-0807, P0810, P-0811, P-0816,</td>

- 134 -

<td></td><td>P-0818, P-0819, P-0833, P-0837, P-0841, P-0842, P-0848, P0850, P-0851, P-0853, P-0857, P-0860, P-0861, P-0863, P-0866, P-0867, P-0868, P0874, P-0876, P-0877, P-0885, P-0886, P-0889, P-0893, P-0894, P-0896, P-0897, P0898, P-0902, P-0904, P-0905, P-0907, P-0910, P-0911, P-0912, P-0913, P-0919, P0927, P-0928, P-0931, P-0933, P-0937, P-0939, P-0944, P-0946, P-0947, P-0950, P0951, P-0952, P-0954, P-0955, P-0956, P-0957, P-0958, P-0959, P-0962, P-0964, P0971, P-0976, P-0980, P-0981, P-0983, P-0984, P-0991, P-0997, P-0998, P-1000, P1002, P-1003, P-1004, P-1006, P-1007, P-1008, P-1009, P-1010, P-1013, P-1014, P1015, P-1016, P-1018, P-1020, P-1021, P-1022, P-1024, P-1025, P-1026, P-1028, P1029, P-1030, P-1031, P-1035, P-1043, P-1049, P-1056, P-1061, P-1063, P-1064, P1065, P-1067, P-1069, P-1070, P-1071, P-1074, P-1082, P-1085, P-1090, P-1091, P1112, P-1113, P-1116, P-1117, P-1120, P-1123, P-1128, P-1131, P-1138, P-1139, P1140, P-1160, P-1177, P-1179, P-1180, P-1181, P-1183, P-1187, P-1194, P-1195, P1199, P-1243, P-1244, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P1254, P-1255, P-1256, P-1257, P-1258, P-1259, P-1260, P-1261, P-1262, P-1263, P1264, P-1265, P-1266, P-1267, P-1269, P-1270, P-1279, P-1280, P-1281, P-1282, P1283, P-1288, P-1289, P-1316, P-1317, P-1318, P-1323, P-1329, P-1336, P-1341, P1343, P-1345, P-1346, P-1347, P-1348, P-1349, P-1365, P-1366, P-1368, P-1369, P-</td>

- 135 -

<td></td><td>1370, P-1381, P-1383, P-1384, P-1385, P-1386, P-1387, P-1388, P-1389, P-1390, P1391, P-1392, P-1394, P-1395, P-1396, P-1397, P-1398, P-1399, P-1402, P-1403, P1409, P-1411, P-1413, P-1414, P-1415, P-1416, P-1417, P-1418, P-1419, P-1420, P1423, P-1425, P-1426, P-1429, P-1430, P-1431, P-1432, P-1433, P-1444, P-1445, P1446, P-1447, P-1448, P-1449, P-1450, P-1451, P-1452, P-1453, P-1454, P-1455, P1456, P-1457, P-1458, P-1459, P-1462, P-1465, P-1466, P-1467, P-1469, P-1470, P1471, P-1472, P-1473, P-1474, P-1475, P-1477, P-1478, P-1479, P-1480, P-1481, P1485, P-1486, P-1495, P-1505, P-1506, P-1516, P-1526, P-1527, P-1528, P-1529, P1530, P-1531, P-1532, P-1534, P-1539, P-1540, P-1541, P-1542, P-1544, P-1545, P1546, P-1547, P-1548, P-1549, P-1550, P-1552, P-1553, P-15554, P-1556, P-1558, P-1559, P-1561, P-1564, P-1566, P-1567, P-1568, P-1569, P-1570, P-1572, P-1575, P1576, P-1577, P-1578, P-1579, P-1581, P-1582, P-1583, P-1584, P-1585, P-1586, P1589, P-1590, P-1591, P-1592, P-1594, P-1596, P-1597, P-1598, P-1599, P-1600, P1601, P1602, P-1605, P-1606, P-1607, P-1608, P-1609, P-1610, P-1611, P-1612, P1613, P-1614, P-1621, P-1627, P-1630, P-1631, P-1636, P-1637, P-1638, P-1639, P1656, P-1660, P-1663, P-1664, P-1665, P-1666, P-1670, P-1671, P-1687, P-1698, P1700, P-1701, P-1702, P-1703, P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P1710, P-1711, P-1712,</td>

- 136 -

<td></td><td></td><td></td><td>P-1713, P-1714, P-1715, P-1716, P-1717, P-1718, P-1719, P1720, P-1721, P-1722, P-1723, P-1724, P-1725, P-1726, P-1727, P-1728, P-1729, P1730, P-1731, P-1732, P-1733, P-1734, P-1735, P-1736, P-1737, P-1738, P-1739, P1740, P-1741, P-1742, P-1746, P-1747, P-1748, P-1749, P-1750, P-1751, P-1752, P1753, P-1755, P-1756, P-1757, P-1758, P-1759, P-1760, P-1762, P-1763, P-1764, P1765, P-1766, P-1767, P-1768, P-1769, P-1770, P-1771, P-1772, P-1773, P-1774, P1775, P-1776, P-1777, P-1778, P-1779, P-1780, P-1781, P-1782, P-1783, P-1784, P1797, P-1798, P-1799, P-1800, P-1802, P-1804, P-1816, P-1817, P-1818, P-1819, P1822, P-1823, P-1828, P-1839, P-1840, P-1841, P-1842, P-1843, P-1864, P-1865, P1871, P-1872, P-1873, P-1878, P-1879, P-1881, P-1882, P-1907, P-1912, P-1916, P1980, P-1996, P-1997, P-1998, P-2005, P-2006, P-2007, P-2012, and P-2013</td>

<td></td><td colspan="3">Table 2d. Btk kinase-active compounds with IC 50 &lt;10 μΜ.</td>

<td>Btk:</td><td></td><td colspan="2">P-0005, P-0006, P-0007, P-0009, P-0010, P-0011, P-0012, P-0013, P-0014, P-0015, P-0016, P-0017, P-0019, P-0020, P-0021, P-0022, P-0024, P-0025, P-0026, P-0027, P-0028, P-0029, P-0031, P-0033, P-0040, P-0041, P-0042, P-0043, P-0044, P-0045, P-0046, P-0047, P-0048, P-0049, P-0050, P-0051, P-0452, P-0053, P-0054, P-0055, P-0059, P-0060, P-0061, P-0062, P-0063, P-0067, P-0068, P-0070, P-0072, P-0073, P-0074, P-0075, P-0079, P-0081, P-0082, P-0083, P-0085, P-0088, P-0089, P-0090, P-0093, P-0094, P-0097, P-0102, P-0107, P-0108, P-0109, P-0112,</td>

- 137 -

<td></td><td></td><td>P-0113, P-0125, P-0134, P-0135, P-0138, P-0139, P-0145, P-0148, P-0152, P-0156, P-0166, P-0171, P-0217, P-0228, P-0257, P-0280, P-0297, P-0302, P-0304, P-0314, P-0321, P-0325, P-0351, P-0418, P-0429, P-0763, P-0806, P-0807, P-0885, P-0897, P-0991, P-0997, P-1020, P-1262, P-1266, P-1267, P-1269, P-1317, P-1336, P-1343, P-1346, P-1388, P-1390, P-1420, P-1426, P-1459, P-1473, P-1475, P-1479, P-1480, P-1481, P-1389, P-1485, P-1486</td>

<td></td><td colspan="2">Table 2e. Compounds active against c-Raf kinase with IC 50S 10 μΜ</td>

<td>c-Raf-1:</td><td></td><td>P-0001, P-0002, P-0004, P-0005, P-0006, P-0007, P-0008, P0009, P-0010, P-0015, P-0016, P-0021, P-0024, P-0025, P-0026, P-0027, P-0032, P0034, P-0035, P-0036, P-0037, P-0038, P-0042, P-0045, P-0052, P-0055, P-0066, P0078, P-0079, P-0082, P-0088, P-0090, P-0102, P-0112, P-0114, P-0121, P-0122, P-0137, P-0156, P-0162, P-0165, P-0166, P-0170, P-0178, P-0180, P-0184, P-0188, P0210, P-0228, P-0257, P-0262, P-0265, P-0269, P-0297, P-0302, P-0307, ​​P-0356, P0369, P-0382, P-0396, P-0418, P-0486, P-0521, P-0535, P-0542, P-0559, P-0604, P0613, P-0636, P-0656, P-0685, P-0700, P-0716, P-0721, P-0728, P-0734, P-0744, P0745, P-0746, P-0753, P-0763, P-0773, P-0774, P-0776, P-0778, P-0779, P-0794, P0798, P-0805, P-0806, P-0807, P-0811, P-0818, P-0837, P-0841, P-0842, P-0848, P0850, P-0851, P-0853, P-0857, P-0860, P-0861, P-0863, P-0866, P-0867, P-0868, P0874, P-0876, P-0877, P-0883, P-0885, P-0889, P-0890, P-0894, P-0896, P-0897, P-</td>

- 138 -

<td></td><td>0898, P-0902, P-0904, P-0907, P-0909, P-0910, P-0911, P-0912, P-0913, P-0919, P0924, P-0928, P-0931, P-0933, P-0937, P-0939, P-0941, P-0944, P-0946, P-0947, P0950, P-0952, P-0954, P-0955, P-0956, P-0957, P-0958, P-0959, P-0964, P-0971, P0973, P-0974, P-0975, P-0978, P-0983, P-0987, P-0991, P-0997, P-0998, P-1002, P1003, P-1004, P-1006, P-1009, P-1013, P-1014, P-1015, P-1017, P-1020, P-1027, P1028, P-1047, P-1056, P-1061, P-1063, P-1064, P-1065, P-1070, P-1071, P-1076, P1077, P-1078, P-1079, P-1118, P-1122, P-1145, P-1243, P-1244, P-1246, P-1247, P-1249, P-1250, P-1251, P-1253, P-1254, P-1255, P-1256, P-1257, P-1258, P-1260, P1261, P-1262, P-1265, P-1279, P-1283, P-1288, P-1289, P-1316, P-1317, P-1318, P1336, P-1338, P-1365, P-1386, P-1387, P-1388, P-1389, P-1390, P-1391, P-1395, P1396, P-1397, P-1398, P-1403, P-1413, P-1419, P-1431, P-1432, P-1433, P-1448, P1451, P-1452, P-1453, P-1454, P-1455, P-1456, P-1458, P-1541, P-1542, P-1546, P1547, P-1581, P-1583, P-1630, P-1671, P-1712, P-1713, P-1714, P-1733, P-1737, P1738, P-1739, P-1740, P-1783, P-1839, P-1864, P1871, P-1873, P-1878, P-1879, P-1881, P-1882</td>

Table 2f. EGFR kinase active compounds with IC 50 &lt;10 μΜ

<td>EGFR:</td><td>P-0001, P-0002, P-0003, P-0004, P-0025, P-0095, P0153, P-0877</td>

Table 2g. EphB2 kinase active compounds with IC₅q &lt;10 μM

<td>EphB2:</td><td>P-0001, P-0003, P-0005, P-0006, P-0007, P-0009, P-001 0, P-</td>

- 139 -

<td></td><td>0011, P-0012, P-0013, P-0014, P-0015, P-0016, P-0017, P-0019, P-0020, P-0021, P0022, P-0025, P-0027, P-0028, P-0029, P-0032, P-0033, P-0034, P-0035, P-0036, P0038, P-0040, P-0041, P-0042, P-0043, P-0044, P-0045, P-0048, P-0050, P-0052, P0053, P-0055, P-0056, P-0059, P-0062, P-0067, P-0068, P-0070, P-0072, P-0074, P0075, P-0078, P-0083, P-0088, P-0090, P-0093, P-0102, P-0107, P-0109, P-0114, P0124, P-0125, P-0126, P-0139, P-0145, P-0186</td>

Table 2h. Erk2 kinase active compounds with IC50 &lt;10 μΜ

<td>Erk2:</td><td>P-0031, P-0041, P-0058, P-0154, P-0550, P0611, P-1336</td>

Table 2i. Compounds active against Fak kinase with ICs &amp; lt; 10 μM

<td>Fak:</td><td>P-0001, P-0002, P-0003, P-0004, P-0006, P-0007, P-0008, P-0009, P-0016, P-0018, P-0024, P-0025, P-0026, P-0027, P-0032, P-0034, P-0035, P0036, P-0037, P-0045, P-0054, P-0055, P-0067, P-0078, P-0088, P-0102, P-0112, P-0114, P-0166, P-0196, P-0209, P-0210, P-0211, P-0224, P-0257, P-0269, P-0276, P-0293, P-0298, P-0302, P-0310, P-0333, P-0391, P-0396, P-0437, P-0486, P-0494, P0501, P-0611, P-0668, P-0675, P-0685, P-0691, P-0700, P-0721, P-0774, P-0795, P0797, P-0806, P-0811, P-0818, P-0837, P-0850, P-0851, P-0867, P-0885, P-0889, P0910, P-0911, P-0933, P-0951, P-0955, P-0956, P-0986, P-0992, P-1002, P-1009, P1013, P-1020, P-1054, P-1083, P-1114, P-1146, P-1190, P-1247, P-1249, P-1250, P-1253, P-1255, P-1256,</td>

- 140 -

<td></td><td></td><td>P-1263, P-1264, P-1266, P-1267, P-1269, P-1279, P-1280, P1281, P-1282, P-1288, P-1289, P-1316, P-1318, P-1321, P-1323, P-1329, P-1336, P1341, P-1346, P-1347, P-1348, P-1349, P-1359, P-1365, P-1383, P-1384, P-1385, P1387, P-1388, P-1389, P-1390, P-1391, P-1392, P-1394, P-1396, P-1397, P-1400, P1401, P-1402, P-1403, P-1411, P-1431, P-1432, P-1433, P-1445, P-1446, P-1447, P-1449, P-1450, P-1451, P-1452, P-1453, P-1455, P-1456, P-1457, P-1458, P-1459, P1473, P-1474, P-1475, P-1477, P-1478, P-1479, P-1480, P-1481, P-1482, P-1485, P1486, P-1492, P-1495, P-1500, P-1502, P-1685</td>

<td></td><td colspan="2">Table 2j. Compounds active against FGFR kinase with IC50 &lt;10 μΜ</td>

<td>FGFR:</td><td></td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P0008, P-0009, P-0010, P-0011, P-0012, P-0013, P-0015, P-0016, P-0017, P-0019, P0020, P-0021, P-0024, P-0025, P-0026, P-0027, P-0028, P-0029, P-0032, P-0033, P0034, P-0035, P-0036, P-0037, P-0038, P-0039, P-0040, P-0041, P-0042, P-0043, P0045, P-0050, P-0052, P-0054, P-0055, P-0056, P-0058, P-0059, P-0066, P-0067, P0068, P-0072, P-0073, P-0078, P-0079, P0082, P-0088, P-0089, P-0090, P-0093, P-0096, P-0097, P-0099, P-0101, P-0102, P-0103, P-0112, P-0114, P-0119, P-0121, P0129, P-0132, P-0134, P-0137, P-0140, P-0142, P-0149, P-0150, P-0152, P-0156, P0158, P-0165, P-0166, P-0167, P-0168, P-0170, P-0171, P-0175, P-0178, P-0180, P0184, P-0189, P-0192,</td>

- 141 -

<td></td><td>P-0196, P-0198, P-0204, P-0205, P-0206, P-0210, P-0211, P-0215, P-0217, P-0218, P-0219, P-0220, P-0227, P-0228, P-0232, P-0233, P-0239, P-0242, P-0244, P-0246, P-0248, P-0257, P-0262, P-0265, P-0267, P-0269, P-0271, P-0274, P-0284, P-0287, P-0289, P-0293, P-0294, P-0297, P-0298, P-0302, P-0304, P-0308, P-0309, P-0316, P-0320, P-0321, P-0325, P-0326, P-0329, P-0335, P-0339, P-0341, P-0344, P-0346, P-0351, P-0363, P-0368, P-0369, P-0371, P-0373, P-0374, P-0379, P-0383, P-0385, P-0391, P-0392, P-0396, P-0400, P-0404, P-0409, P-0411, P-0418, P-0420, P-0421, P-0424, P-0426, P-0442, P-0447, P-0448, P-0452, P-0453, P-0459, P-0473, P-0474, P-0479, P-0483, P-0486, P-0489, P-0493, P-0495, P-0501, P-0507, P-0510, P-0515, P-0520, P-0521, P-0535, P-0550, P-0556, P-0559, P-056I, P-0562, P-0563, P-0575, P-0579, P-0594, P-0599, P-0611, P-0613, P-0615, P-0623, P-0624, P-0632, P-0636, P-0640, P-0645, P-0647, P-0656, P-0658, P-0668, P-0671, P-0679, P-0683, P-0685, P-0691, P-0693, P-0697, P-0698, P-0699, P-0700, P-0708, P-0710, P-0721, P-0728, P-0730, P-0734, P-0737, P-0744, P-0745, P-0746, P-0749, P-0751, P-0753, P-0763, P-0771, P-0773, P-0774, P-0776, P-0798, P-0805, P-0806, P-0807, P-0811, P-0818, P-0819, P-0826, P-0828, P-0835, P-0837, P-0841, P-0848, P-0850, P-0851, P-0853, P-0854, P-0857, P-0860, P-0865, P-0867, P-0868, P-0874, P-0876, P-0877, P-0885, P-0889, P-0894, P-0896, P-0897, P-0898, P-0902, P-0904, P-0907,</td>

- 142 -

<td></td><td>P-0910, P-0911, P-0912, P-0913, P-0919, P-0927, P-0933, P-0935, P-0937, P-0944, P-0947, P-0950, P-0951, P-0952, P-0954, P-0955, P-0956, P-0958, P-0964, P-0974, P-0976, P-0977, P-0979, P-0983, P-0991, P-0997, P-1002, P-1004, P-1008, P-1009, P-1015, P-1017, P-1018, P-1020, P-1021, P-1027, P-1066, P-1074, P-1078, P-1110, P-1111, P-1116, P-1120, P-1123, P-1125, P-1142, P-1181, P-1182, P-1188, P-1194, P-1246, P-1249, P-1250, P-1251, P-1252, P-1253, P-1254, P-1255, P-1256, P-1257, P-1258, P1259, P-1260, P-1261, P-1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1269, P-1270, P-1272, P-1273, P-1274, P-1279, P-1280, P-1281, P-1282, P-1283, P-1287, P-1288, P-1289, P-1316, P-1317, P-1318, P-1321, P-1322, P-1323, P1325, P-1326, P-1327, P-1328, P-1329, P-1330, P-1331, P-1332, P-1333, P-1334, P1335, P-1336, P-1337, P-1338, P-1339, P-1340, P-1341, P-1342, P-1343, P-1344, P1345, P-1346, P-1347, P-1348, P-1349, P-1365, P-1366, P-1367, P-1369, P-1377, P1380, P-1381, P-1382, P-1383, P-1384, P-1385, P-1386, P-1387, P-1388, P-1389, P1390, P-1391, P-1392, P-1393, P-1394, P-1395, P-1396, P-1397, P-1398, P-1399, P1402, P-1403, P-1404, P-1406, P-1407, P-1409, P-1411, P-1415, P-1416, P-1418, P-1419, P-1420, P-1423, P-1424, P-1426, P-142 8, P-1429, P-1430, P-1431, P-1433, P1445, P-1446, P-1447, P-1448, P-1451, P-1452, P-1453, P-1454, P-1455, P-1456, P1458, P-1459, P-1460,</td>

- 143 -

<td></td><td></td><td></td><td>P-1461, P-1463, P-1464, P-1465, P-1467, P-1468, P-1469, P1472, P-1473, P-1474, P-1475, P-1476, P-1477, P-1478, P-1479, P-1480, P-1481, P1482, P-1485, P-1486, P-1512, P-1516, P-1522, P-1524, P-1525, P-1526, P-1527, P1528, P-1529, P-1530, P-1534, P-1538, P-1539, P-1542, P-1545, P-1546, P-1547, P1548, P-1549, P-1550, P-1554, P-1555, P-1556, P-1561, P-1564, P-1577, P-1581, P1582, P-1583, P-1584, P-1585, P-1589, P-1591, P-1592, P-1593, P-1595, P-1597, P1603, P-1605, P-1608, P-1609, P-1610, P-1614, P-1621, P-1622, P-1624, P-1625, P-1685</td>

<td></td><td colspan="3">Table 2k. Flt1 kinase active compounds with IC 50 &lt;10 μΜ</td>

<td>Flt1:</td><td></td><td colspan="2">P-0001, P-0002, P-0003, P-0004, P-0005, P-0008, P-0009, P-0011, P-0012, P-0013, P-0016, P-0017, P-0018, P-0019, P-0020, P-0021, P-0024, P-0026, P-0027, P-0032, P-0033, P-0034, P-0036, P-0037, P-0038, P-0039, P-0041, P-0054, P-0055, P-0056, P-0067, P-0068, P-0072, P-0078, P-0082, P-0088, P-0090, P-0091, P-0101, P-0103, P-0112, P-0114, P-0127, P-0134, P-0150, P-0154, P-0166, P-0177, P-0180, P-0184, P-0194, P-0196, P-0206, P-0211, P-0214, P-0224, P-0244, P-0269, P-0274, P-0278, P-0287, P-0298, P-0302, P-0315, P-0320, P-0325, P-0326, P-0337, P-0371, P-0373, P-0383, P-0404, P-0409, P-0421, P-0448, P-0455, P-0461, P-0470, P-0477, P-0483, P-0486, P-0491, P-0514, P-0515, P-0521, P-0550, P-0559, P-0579, P-0603, P-0624, P-0629, P-0632, P-0636, P-0640, P-0656, P-0668, P-0679, P-0683, P-0685, P-0691, P-0700, P-0708, P-0721, P-0733, P-0737, P-0749, P-0751, P-0757,</td>

- 144 -

<td></td><td>P-0768, P-0771, P-0773, P-0774, P-0777, P-0805, P-0866, P-0868, P-0951, P-0958, P-0962, P-1002, P-1008, P-1010, P-1018, P-1021, P-1027, P-1082, P-1110, P-1112, P-1147, P-1160, P-1181, P-1194, P-1246, P-1247, P-1250, P-1251, P-1255, P-1256, P-1259, P-1260, P-1261, P-1262, P-1266, P-1269, P-1279, P-1289, P-1317, P-1318, P-1365, P-1366, P-1370, P-1372, P-1373, P-1383, P-1393, P-1395, P-1403, P-1404, P-1406, P-1411, P-1415, P-1416, P-1417, P-1418, P-1420, P-1422, P-1423, P-1424, P-1425, P-1426, P-1427, P-1428, P-1429, P-1430, P-1431, P-1432, P-1433, P-1445, P-1446, P-1447, P-1457, P-1460, P-1461, P-1462, P-1463, P-1464, P-1465, P-1467, P-1468, P-1469, P-1472, P-1475, P-1486, P-1491, P-1492, P-1495, P-1497, P-1499, P-1502, P-1505, P-1523, P-1526, P-1527, P-1528, P-1529, P-1530, P-1531, P-1532, P-1533, P-1534, P-1541, P-1542, P-1544, P-1546, P-1547, P-1548, P-1549, P-1552, P-1553, P-1554, P-1556, P-1557, P-1559, P-1564, P-1566, P-1567, P-1569, P-1570, P-1571, P-1572, P-1575, P-1576, P-1577, P-1580, P-1581, P-1582, P-1583, P-1584, P-1585, P-1586, P-1587, P-1589, P-1590, P-1591, P-1592, P-1593, P-1594, P-1595, P-1596, P-1597, P-1598, P-1599, P-1600; P-1601, P-1602, P-1603, P-1605, P-1606, P-1608, P-1609, P-1610, P-1612, P-1613, P-1614, P-1615, P-1618, P-1619, P-1621, P-1622, P-1624, P-1625, P-1686</td>

Table 2l. Flt3 kinase active compounds with IC50 &lt;10 μΜ

- 145 -

<td>Flt3:</td><td>P-0088, P-0262, P-0409, P-0636, P-0806, P-1244, P-1280, P1318, P-1336, P-1394, P-1426</td>

<td colspan="2">Table 2m. Flt4 kinase active compounds with IC50I 10 μΜ</td>

<td>Flt4:</td><td>P-0001, P-0003, P-0005, P-0011, P-0012, P-0019, P-0024, P-0029, P-0032, P-0039, P-0040, P-0041, P-0090, P-0093, P-0097, P-0117, P-0142, P-0167, P0190, P-0196, P-0204, P-0205, P-0206, P-0211, P-0215, P-0218, P-0224, P-0265, P-0316, P-0325,</td>

<td colspan="2">(continued)</td>

<td></td><td>P-0335, P-0352, P-0418, P-0448, P-0452, P-0453, P-0495, P-0521, P-0544, P-0550, P-0559, P-0579, P-0594, P-0599, P-0617, P-0624, P-0632, P-0645, P-0656, P-0668, P-0679, P-0691, P-0703, P-0708, P-0737, P-0738, P-0751, P-0762, P-0771, P-0813</td>

<td colspan="2">Table 2n. Compounds active against Fms kinase with IC 50 &amp; lt; 10 μM</td>

<td>fms:</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P0008, P-0009, P-0010, P-0012, P-0016, P-0019, P-0020, P-0021, P-0025, P-0026, P0027, P-0032, P-0033, P-0034, P-0035, P-0036, P-0037, P-0038, P-0042, P-0045, P0048, P-0054, P-0067, P-0068, P-0072, P-0078, P-0079, P-0082, P-0088, P-0090, P0093, P-0101, P-0102, P-0103, P-0112, P-0114, P-0121, P-0129, P-0134, P-0145, P0152, P-0166, P-0170, P-0175, P-0180, P-0184, P-0189, P-0196, P-0210, P-0211, P0228, P-0233, P-0237, P-0239, P-0244, P-0257, P-0262, P-0269, P-0274, P-0284, P0287, P-0291, P-0293, P-0297, P-0298, P-0302, P-0317, P-0325, P-0327, P-0333, P0351, P-0369, P-0373, P-0383, P-0391, P-0396, P-0409, P-0418, P-0420, P-0421, P-</td>

- 146 -

<td></td><td>0461, P-0483, P-0486, P-0491, P-0501, P-0515, P-0535, P-0559, P-0563, P-0613, P0636, P-0656, P-0685, P-0721, P-0733, P-0753, P-0763, P-0771, P-0773, P-0774, P0778, P-0798, P-0805, P-0806, P-0807, P-0811, P-0818, P-0835, P-0837, P-0848, P0850, P-0851, P-0853, P-0854, P-0857, P-0867, P-0874, P-0876, P-0883, P-0885, P0898, P-0911, P-0913, P-0919, P-0927, P-0931, P-0933, P-0952, P-0954, P-0955, P0956, P-0958, P-1002, P-1008, P-1009, P-1013, P-1110, P-1112, P-1124, P-1194, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1255, P-1259, P-1260, P1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1269, P-1279, P-1280, P-1281, P1282, P-1289, P-1316, P-1317, P-1318, P-1321, P-1323, P-1324, P-1325, P-1326, P1327, P-1328, P-1329, P-1330, P-1331, P-1332, P-1333, P-1334, P-1335, P-1336, P1337, P-1338, P-1339, P-1340, P-1341, P-1342, P-1343, P-1344, P-1346, P-1365, P1366, P-1368, P-1369, P-1370, P-1372, P-1376, P-1380, P-1381, P-1384, P-1385, P1386, P-1387, P-1388, P-1389, P-1390, P-1391, P-1392, P-1393, P-1394, P-1395, P1397, P-1399, P-1400, P-1402, P-1403, P-1404, P-1405, P-1406, P-1409, P-1410, P-1411, P-1415, P-1416, P-1419, P-1420, P-1421, P-1423, P-1425, P-1426, P-1427, P-1428, P-1429, P-1430, P-1431, P-1432, P-1433, P-1445, P-1447, P-1448, P-1449, P-1450, P-1451, P-1452, P-1453, P-1454, P-1455, P-1456, P-1457, P-1458, P-1459, P-1460, P-1461, P-1462,</td>

- 147 -

<td></td><td>P-1463, P-1464, P-1465, P-1466, P-1467, P-1468, P-1469, P-1470, P-1471, P-1472, P-1473, P-1474, P-1475, P-1476, P-1477, P-1478, P-1479, P-1480, P-1481, P-1482, P-1483, P-1485, P-1486, P-1488, P-1489, P-1490, P-1491, P-1492, P-1493, P-1494, P-1495, P-1496, P-1497, P-1498, P-1499, P-1500, P-1501, P-1502, P-1503, P-1504, P-1505, P-1506, P-1511, P-1522, P-1525, P-1526, P-1527, P-1528, P-1529, P-1530, P-1532, P-1534, P-1541, P-1542, P-1544, P-1545, P-1546, P-1547, P-1548, P-1549, P-1552, P-1553, P-1554, P-1555, P-1556, P-1558, P-1559, P-1564, P-1566, P-1567, P-1568, P-1569, P-1570, P-1571, P-1572, P-1575, P-1576, P-1580, P-1581, P-1583, P-1586, P-1587, P-1589, P-1591, P-1594, P-1595, P-1596, P-1597, P-1598, P-1599, P-1602, P-1606, P-1608, P-1609, P-1610, P-1611, P-1612, P-1613, P-1615, P-1616, P-1618, P-1621, P-1625, P-1627, P-1630, P-1631, P-1636, P-1637, P-1638, P-1639, P-1652, P-1653, P-1654, P-1656, P-1657, P-1660, P-1663, P-1664, P-1665, P-1670, P-1671, P-1685, P-1687, P-1700, P-1701, P-1702, P-1703, P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P-1710, P-1711, P-1712, P-1713, P-1714, P-1715, P-1716, P-1717, P-1718, P-1719, P-1720, P-1721, P-1722, P-1723, P-1724, P-1725, P-1726, P-1727, P-1728, P-1729, P-1730, P-1731, P-1732, P-1733, P-1734, P-1735, P-1736, P-1737, P-1738, P-1739, P-1740, P-1741, P-1742, P-1746, P-1747, P-1748, P-1749, P-1750, P-1751, P-1753, P-1754, P-1755, P-1756, P-1757, P-1758,</td>

- 148 -

<td></td><td>P-1759, P-1760, P-1761, P-1762, P-1763, P-1764, P-1765, P-1766, P-1767, P-1768, P-1769, P-1771, P-1772, P-1773, P-1774, P-1775, P-1776, P-1778, P-1779, P-1780, P-1781, P-1782, P-1783, P-1784, P-1796, P-1798, P-1799, P-1800, P-1802, P-1803, P-1804, P-1816, P-1817, P-1818, P-1819, P-1821, P-1822, P-1827, P-1828, P-1839, P-1840, P-1864, P-1871, P-1872, P-1873, P-1878, P-1879, P-1881, P-1882, P1907, P-1912, P-1916, P-1980, P-1996, P-1997, P-1998, P-2005, P-2006, P-2007, P2012, P-2013</td>

<td colspan="2">Table 2o. Compounds active against Iraq4 kinase with IC50 &lt;10 μΜ</td>

<td colspan="2">Iraq4: P-0002, P-0020, P-0076, P-0087, P-0091, P-0130</td>

<td colspan="2">Table 2p Compounds active against Jnk1 kinase with ICs0 &lt;10 μM</td>

<td>JNK1:</td><td>P-0001, P-0002, P-0003, P-0004, P-0006, P-0008, P-0009, P0010, P-0015, P-0016, P-0021, P-0025, P-0026, P-0027, P-0032, P-0033, P-0034, P0035, P-0036, P-0037, P-0038, P-0040, P-0042, P-0045, P-0052, P-0054, P-0056, P0066, P-0078, P-0079, P-0082, P-0088, P-0090, P-0102, P-0112, P-0114, P-0121, P0134, P-0140, P-0156, P-0184, P-0196, P-0204, P-0228, P-0244, P-0257, P-0269, P0285, P-0297, P-0302, P-0308, P-0431, P-0448, P-0486, P-0521, P-0559, P-0579, P0599, P-0624, P-0636, P-0668, P-0685, P-0691, P-0700, P-0721, P-0728, P-0734, P0745, P-0753, P-0763, P-0774, P-0807, P-0848, P-0850, P-0851, P-0853, P-0860, P0876, P-0897, P-0956, P-0958, P-0991, P-0997, P-1002, P-1008, P-1009, P-1021, P-</td>

- 149 -

<td></td><td></td><td>1251, P-1253, P-1256, P-1260, P-1262, P-1266, P-1279, P-1280, P-1281, P-1288, P1289, P-1317, P-1318, P-1336, P-1338, P-1343, P-1346, P-1347, P-1348, P-1349, P1356, P-1359, P-1365, P-1366, P-1370, P-1384, P-1385, P-1390, P-1394, P-1400, P1402, P-1432, P-1433, P-1445, P-1446, P-1447, P-1456, P-1458, P-1459, P-1465, P1468, P-1473, P-1475, P-1486, P-1523, P-1534, P-1546, P-1547, P-1548, P-1549, P1553, P-1554, P-1556, P-1566, P-1567, P-1570, P-1576, P-1577, P-1585, P-1589, P1591, P-1592, P-1596, P-1602, P-1610, P-1611, P-1618, P-1621, P-1627, P-1631, P1636, P-1637, P-1638, P-1639, P-1656, P-1660, P-1687, P-1702, P-1706, P-1707, P1708, P-1720, P-1722, P-1723, P-1724, P-1725, P-1727, P-1730, P-1731, P-1742, P1748, P-1749, P-1750, P-1751, P-1755, P-1756, P-1757, P-1759, P-1760, P-1764, P1765, P-1767, P-1770, P-1775, P-1776, P-1777, P-1778, P-1779, P-1827, P-1828, P1839, P-1842, P-1864, P-1873, P-1878, P-1879, P-1896, P-1897, P-1898, P-2007</td>

<td></td><td colspan="2">Table 2q. Jnk2 kinase active compounds with IC50 &lt;10 μΜ</td>

<td>JNK2:</td><td></td><td>P-0001, P-0005, P-0006, P-0009, P-0013, P-0015, P-0016, P0025, P-0027, P-0033, P-0034, P-0035, P-0040, P-0042, P-0052, P-0054, P-0056, P0066, P-0069, P-0079, P-0082, P-0088, P-0090, P-0121, P-0140, P-0142, P-0156, P0184, P-0196, P-0204, P-0228, P-0238, P-0269, P-0285, P-0297, P-0308, P-0448, P0486, P-0521, P-0579, P-0594, P-0599, P-0623, P-0685, P-0700, P-0721, P-0734, P-</td>

- 150 -

<td></td><td></td><td>0744, P-0746, P-0774, P-1253, P-1318, P-1445, P-1447, P-1486, P-1547, P-1548, P1554, P-1566, P-1567, P-1570, P-1575, P-1576, P-1589, P-1591, P-1602, P-1611, P1621, P-1627, P-1656, P-1671, P-1687, P-1700, P-1702, P-1711, P-1720, P-1722, P1723, P-1724, P-1727, P-1728, P-1729, P-1730, P-1731, P-1732, P-1737, P-1742, P1748, P-1749, P-1750, P-1751, P-1753, P-1755, P-1756, P-1757, P-1759, P-1760, P1764, P-1765, P-1767, P-1770, P-1776, P-1777, P-1778, P-1779, P-1827, P-1828, P1864, and P-2007</td>

<td></td><td colspan="2">Table 2r. Jnk3 kinase-active compounds with IC50 &lt;10 μΜ</td>

<td>JNK3:</td><td></td><td>P-0001, P-0002, P-0003, P-0004, P-0006, P-0008, P-0009, P0010, P-0015, P-0016, P-0024, P-0025, P-0026, P-0027, P-0031, P-0032, P-0033, P0034, P-0035, P-0036, P-0037, P-0038, P-0040, P-0041, P-0045, P-0047, P-0052, P0054, P-0056, P-0058, P-0059, P-0066, P-0078, P-0079, P-0080, P-0088, P-0089, P0090, P-0093, P-0102, P-0112, P-0114, P-0115, P-0117, P-0122, P-0132, P-0133, P-0134, P-0165, P-0166, P-0167, P-0176, P-0179, P-0184, P-0189, P-0190, P-0196, P0204, P-0211, P-0213, P-0218, P-0228, P-0238, P-0244, P-0257, P-0263, P-0269, P0279, P-0285, P-0300, P-0308, P-0313, P-0320, P-0371, P-0378, P-0448, P-0483, P0521, P-0550, P-0559, P-0562, P-0579, P-0594, P-0599, P-0604, P-0624, P-0625, P0632, P-0636, P-0640, P-0645, P-0656, P-0659, P-0668, P-0671, P-0675, P-0682, P0683, P-0691, P-0697, P-0698, P-0703, P-0710, P-0716, P-0734, P-0738, P-0753, P-</td>

- 151 -

<td></td><td></td><td>0755, P-0757, P-0763, P-0774, P-0778, P-0807, P-0822, P-0851, P-0951, P-0962, P0991, P-1002, P-1005, P-1008, P-1010, P-1011, P-1016, P-1018, P-1021, P-1022, P1032, P-1082, P-1087, P-1088, P-1253, P-1279, P-1280, P-1289, P-1317, P-1318, P1346, P-1347, P-1348, P-1349, P-1355, P-1356, P-1359, P-1372, P-1375, P-1384, P-1385, P-1394, P-1400, P-1445, P-1447, P-1458, P-1465, P-1468, P-1473, P-1475, P-1477, P-1485, P-1486, P-1489, P-1490, P-1505, P-1529, P-1534, P-1546, P-1547, P-1548, P-1554, P-1561, P-1566, P-1567, P-1570, P-1576, P-1577, P-1585, P-1589, P-1591, P-1592, P-1610, P-1611, P-1618, P-1621, P-1636, P-1687, P-1702, P-1703, P-1704, P-1706, P-1707, P-1713, P-1716, P-1720, P-1722, P-1724, P-1742, P-1748, P-1749, P-1750, P-1753, P-1756, P-1757, P-1759, P-1764, P-1765, P-1767, P-1770, P-1775, P-1776, P-1777, P-1827, P-1828, P-1864, P-2007</td>

<td></td><td colspan="2">Table 2s. Kdr kinase active compounds with IC 50 &lt;10 μΜ</td>

<td>kdr:</td><td></td><td>P-0001, P-0003, P-0005, P-0006, P-0007, P-0009, P-0011, P0012, P-0013, P-0014, P-0015, P-0016, P-0017, P-0018, P-0019, P-0020, P-0021, P0022, P-0023, P-0024, P-0025, P-0027, P-0028, P-0029, P-0030, P-0031, P-0032, P0033, P-0039, P-0040, P-0041, P-0042, P-0043, P-0044, P-0045, P-0046, P-0048, P0049, P-0050, P-0051, P-0052, P-0053, P-0054, P-0055, P-0056, P-0057, P-0059, P0060, P-0061, P-0063, P-0064, P-0065, P-0067, P-0068, P-0069, P-0070, P-0071, P-</td>

- 152 -

<td></td><td>0073, P-0074, P-0075, P-0076, P-0077, P-0078, P-0080, P-0081, P-0082, P-0084, P0085, P-0086, P-0087, P-0088, P-0089, P-0090, P-0091, P-0092, P-0093, P-0096, P0097, P-0098, P-0100, P-0101, P-0102, P-0103, P-0105, P-0106, P-0107, P-0108, P0110, P-0111, P-0112, P-0113, P-0114, P-0115, P-0117, P-0120, P-0122, P-0125, P-0126, P-0127, P-0128, P-0129, P-0130, P-0131, P-0133, P-0134, P-0135, P-0136, P0137, P-0139, P-0140, P-0141, P-0142, P-0143, P-0144, P-0145, P-0147, P-0149, P0152, P-0157, P-0158, P-0161, P-0162, P-0163, P-0164, P-0165, P-0167, P-0168, P0169, P-0170, P-0172, P-0173, P-0174, P-0175, P-0176, P-0177, P-0179, P-0180, P0182, P-0184, P-0189, P-0190, P-0192, P-0194, P-0195, P-0196, P-0197, P-0198, P0199, P-0202, P-0203, P-0204, P-0206, P-0212, P-0213, P-0216, P-0218, P-0224, P0225, P-0226, P-0230, P-0234, P-0242, P-0243, P-0260, P-0261, P-0262, P-0267, P0268, P-0269, P-0270, P-0274, P-0279, P-0287, P-0288, P-0289, P-0293, P-0295, P0296, P-0299, P-0308, P-0316, P-0319, P-0320, P-0321, P-0322, P-0326, P-0337, P0339, P-0369, P-0376, P-0379, P-0391, P-0409, P-0418, P-0427, P-0448, P-0455, P0458, P-0473, P-0482, P-0495, P-0521, P-0550, P-0559, P-0562, P-0579, P-0611, P0623, P-0624, P-0632, P-0640, P-0645, P-0668, P-0679, P-0683, P-0691, P-0703, P0708, P-0730, P-0737, P-0738, P-0751, P-0762, P-0771, P-0777, P-0796, P-0806, P0813, P-0933, P-0951,</td>

- 153 -

<td colspan="2"></td><td>P-0956, P-0962, P-0981, P-1023, P-1244, P-1280, P-1318, P1394, P-1426</td>

<td colspan="3">Table 2t. Kit kinase active compounds with an IC50 of &lt;10 μΜ</td>

<td>Putty:</td><td colspan="2">P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0007, P-0008, P-0009, P-0011, P-0012, P-0013, P-0016, P-0017, P-0018, P-0019, P-0020, P-0021, P-0024, P-0026, P-0027, P-0028, P-0029, P-0030, P-0031, P-0032, P-0033, P-0034, P-0035, P-0036, P-0037, P-0038, P-0039, P-0040, P-0041, P-0042, P-0050, P-0054, P-0056, P-0059, P-0064, P-0067, P-0069, P-0072, P-0078, P-0079, P-0080, P-0082, P-0086, P-0088, P-0090, P-0093, P-0097, P-0101, P-0102, P-0103, P-0112, P-0114, P-0115, P-0117, P-0120, P-0121, P-0122, P-0123, P-0127, P-0129, P-0132, P-0133, P-0134, P-0136, P-0140, P-0142, P-0152, P-0154, P-0157, P-0166, P-0167, P-0168, P-0171, P-0175, P-0176, P-0179, P-0180, P-0184, P-0189, P-0190, P-0195, P-0196, P-0204, P-0205, P-0206, P-0210, P-0211, P-0213, P-0216, P-0217, P-0218, P-0224, P-0233, P-0235, P-0237, P-0244, P-0248, P-0253, P-0257, P-0262, P-0263, P-0265, P-0269, P-0274, P-0279, P-0284, P-0287, P-0289, P-0293, P-0298, P-0300, P-0302, P-0304, P-0315, P-0316, P-0321, P-0323, P-0325, P-0326, P-0333, P-0341, P-0346, P-0352, P-0367, P-0369, P-0371, P-0373, P-0378, P-0384, P-0385, P-0391, P-0392, P-0396, P-0402, P-0404, P-0409, P-0411, P-0418, P-0420, P-0421, P-0427, P-0447, P-0448, P-0450, P-0453, P-0459, P-0461, P-0473, P-0483, P-0491, P-0495, P-0499, P-0501, P-0511,</td>

- 154 -

<td></td><td>P-0519, P-0521, P-0535, P-0550, P-0554, P-0556, P-0559, P-0561, P-0562, P-0563, P-0579, P-0594, P-0599, P-0604, P-0611, P-0613, P-0617, P-0623, P-0624, P-0625, P-0626, P-0632, P-0636, P-0640, P-0644, P-0645, P-0647, P-0656, P-0658, P-0659, P-0668, P-0671, P-0679, P-0682, P-0683, P-0685, P-0690, P-0691, P-0693, P-0697, P-0699, P-0700, P-0703, P-0708, P-0721, P-0733, P-0736, P-0737, P-0738, P-0749, P-0751, P-0753, P-0755, P-0757, P-0762, P-0763, P-0771, P-0773, P-0774, P-0776, P-0778, P-0794, P-0796, P-0798, P-0800, P-0806, P-0810, P-0813, P-0815, P-0818, P-0825, P-0835, P-0837, P-0848, P-0850, P-0851, P-0853, P-0854, P-0857, P-0860, P-0861, P-0865, P-0866, P-0867, P-0874, P-0876, P-0877, P-0885, P-0889, P-0898, P-0905, P-0907, P-0910, P-0911, P-0913, P-0919, P-0924, P-0927, P-0931, P-0933, P-0935, P-0937, P-0951, P-0952, P-0954, P-0955, P-0956, P-0958, P-0962, P-0964, P-0978, P-0983, P-1002, P-1008, P-1009, P-1010, P-1013, P-1016, P-1018, P-1021, P-1033, P-1082, P-1084, P-1096, P-1110, P-1112, P-1160, P-1181, P-1194, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1254, P-1255, P-1256, P-1257, P-1259, P-1260, P-1261, P-1262, P-1263, P-1264, P-1266, P-1267, P-1268, P-1269, P-1275, P-1279, P-1280, P-1281, P-1289, P-1316, P-1317, P-1318, P-1320, P-1321, P-1323, P-1329, P-1336, P-1338, P-1341, P-1343, P-1346, P-1347, P-1348, P-1349, P-1365, P-1366, P-1367, P-1368, P-1369, P-1370, P-1372, P-1376,</td>

- 155 -

<td></td><td>P-1380, P-1382, P-1383, P-1384, P-1385, P-1386, P-1387, P-1388, P-1389, P-1390, P-1391, P-1392, P-1393, P-1394, P-1395, P-1396, P-1397, P-1399, P-1400, P-1402, P-1403, P-1404, P-1406, P-1407, P-1408, P-1409, P-1410, P-1411, P-1413, P-1414, P-1415, P-1416, P-1417, P-1419, P-1420, P-1422, P-1423, P-1424, P-1425, P-1426, P-1427, P-1428, P-1429, P-1430, P-1431, P-1432, P-1433, P-1445, P-1446, P-1447, P-1449, P-1450, P-1451, P-1452, P-1453, P-1454, P-1455, P-1456, P-1457, P-1458, P1460, P-1461, P-1462, P-1463, P-1464, P-1465, P-1466, P-1467, P-1468, P-1469, P-1470, P-1471, P-1472, P-1474, P-1475, P-1476, P-1478, P-1479, P-1480, P-1481, P-1482, P-1483, P-1484, P-1486, P-1488, P-1489, P-1490, P-1493, P-1495, P-1497, P-1498, P-1499, P-1500, P-1501, P-1502, P-1503, P-1505, P-1506, P-1514, P-1521, P-1522, P-1525, P-1526, P-1527, P-1528, P-1529, P-1530, P-1531, P-1532, P-1534, P-1538, P-1541, P-1542, P-1543, P-1544, P-1545, P-1546, P-1547, P-1548, P-1549, P-1550, P-1551, P-1552, P-1553, P-1554, P-1557, P-1559, P-1562, P-1564, P-1565, P-1566, P-1567, P-1568, P-1569, P-1574, P-1575, P-1576, P-1578, P-1580, P-1581, P-1582, P-1583, P-1590, P-1591, P-1593, P-1598, P-1599, P-1605, P-1630, P-1671, P-1685, P-1700, P-1703, P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P-1711, P-1712, P-1713, P-1714, P-1718, P-1719, P-1720, P-1733, P-1737, P-1739, P-1740, P-1767, P-1776,</td>

- 156 -

<td></td><td>P-1783, P-1798, P-1822, P-1839, P-1840, P-1864, P-1865, P-1871, P-1872, P-1873, P-1878, P-1879, P-1881, P-1882, P-1980, P-1996, P-1997, P-1998</td>

Table 2u. MAP2K1 kinase active compounds with IC50 &lt;10 μΜ

<td>MAP2K1:</td><td>P-0001, P-0002, P-0003, P-0005, P-0006, P-0008, P-0010, P0011, P-0012, P-0014, P-0015, P-0017, P-0018, P-0022, P-0023, P-0029, P-0031, P0041, P-0046, P-0051, P-0057, P-0058, P-0061, P-0076, P-0079, P-0081, P-0087, P0098, P-0099, P-0105, P-0108, P-0111, P-0120, P-0149, P-0152, P-0158, P-0167, P0170, P-0177, P-0194, P-0198, P-0331, P-0337, P-0568, P-0806</td>

Table 2v. MAPKAPK2 kinase active compounds with ICs0 &lt;10 μM

<td>MAPKAPK 2:</td><td>P-0007, P-0041, P-0057, P-0058, P-0077, P-0086, P-0104, P0106, P-0151, P-0226</td>

Table 2in. Met kinase-active compounds with an IC 50 &lt;10 μM

<td>Underworld:</td><td>P-0001, P-0002, P-0004, P-0006, P-0008, P-0009, P-0015, P0016, P-0020, P-0026, P-0027, P-0028, P-0034, P-0035, P-0037, P-0038, P-0041, P0052, P-0054, P-0058, P-0066, P-0076, P-0078, P-0082, P-0101, P-0114, P-0117, P0140, P-0146, P-0149, P-0156, P-0165, P-0184, P-0228, P-0262, P-0269, P-0320, P0325, P-0369, P-0419, P-0542, P-0550, P-0675, P-0685, P-0700, P-0716, P-0721, P0746, P-0761, P-0763, P-0773, P-0778, P-0781, P-0811, P-0822, P-0842, P-0951, P0962, P-1008, P-1012, P-1023, P-1037, P-1068, P-1092, P-1114, P-1132, P-1280, P1394, P-1465, P-1527</td>

Table 2x. P38 kinase active compounds with IC 50 &lt;10 μM

<td>p38:</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0008, P0010, P-0016, P-0019,</td>

- 157 -

<td></td><td>P-0025, P-0026, P-0027, P-0028, P-0032, P-0034, P-0035, P0036, P-0037, P-0038, P-0041, P-0045, P-0050, P-0056, P-0058, P-0059, P-0066, P0068, P-0079, P-0082, P-0088, P-0090, P-0093, P-0112, P-0114, P-0122, P-0134, P0155, P-0156, P-0158, P-0163, P-0167, P-0170, P-0184, P-0190, P-0196, P-0204, P0205, P-0210, P-0228, P-0244, P-0257, P-0262, P-0267, P-0297, P-0302, P-0308, P0369, P-0442, P-0448, P-0511, P-0519, P-0521, P-0550, P-0559, P-0579, P-0594, P0599, P-0604, P-0611, P-0624, P-0636, P-0645, P-0668, P-0671, P-0679, P-0685, P0691, P-0699, P-0700, P-0703, P-0708, P-0716, P-0721, P-0728, P-0734, P-0738, P0744, P-0745, P-0746, P-0751, P-0753, P-0757, P-0763, P-0773, P-0774, P-0776, P0798, P-0806, P-0807, P-0841, P-0842, P-0868, P-0884, P-0887, P-0933, P-1042, P-1046</td>

Table 2y. PDGFRB kinase active compounds with IC₅q &lt;10 μΜ

<td colspan="2">PDGFRB:</td><td colspan="2">P-0088, P-0262</td>

<td colspan="4">Table 2z. Compounds active against Pim1 kinase with ICsq &lt;10 μΜ</td>

<td></td><td>Pim1:</td><td>P-0024. P-0090</td><td></td>

Table 2aa. PKC theta active compounds with IC₅q &lt;10 μΜ

<td>PKC theta:</td><td>P-0001, P-0002, P-0003, P-0004, P-0006, P-0008, P-0011, P0012, P-0013, P-0014, P-0017, P-0019, P-0020, P-0021, P-0022, P-0024, P-0025, P0026, P-0030, P-0031, P-0039, P-0044, P-0046, P-0049, P-0051, P-0055, P-0057, P0060, P-0063, P-0069, P-0070, P-0109, P-0112, P-0238, P-0270</td>

Table 2bb. Pyk2 kinase active compounds with IC®, 10 μΜ

<td>Pyk2:</td><td>P-0001, P-0010, P-0015, P-0018, P-0021, P-0024, P-0032, P-</td>

- 158 -

<td></td><td></td><td></td><td>0041, P-0052, P-0056, P-0058, P-0069, P-0078, P-0086, P-0088, P-0095, P-0112, P0116, P-0122, P-0137, P-0142, P-0166, P-0178, P-0188, P-0257, P-0262, P-0269, P0287, P-0318, P-0320, P-0356, P-0369, P-0396, P-0486, P-0501, P-0521, P-0529, P0550, P-0559, P-0562, P-0611, P-0636, P-0685, P-0697, P-0700, P-0728, P-0753, P0806, P-0818, P-0837, P-0848, P-0850, P-0851, P-0857, P-0861, P-0866, P-0867, P0874, P-0883, P-0897, P-0898, P-0910, P-0911, P-0912, P-0919, P-0924, P-0928, P0944, P-0946, P-0947, P-0957, P-0964, P-0978, P-0991, P-0997, P-1002, P-1010, P1418, P-1069, P-1280, P-1281, P-1282, P-1288, P-1316, P-1349, P-1365, P-1367, P1368, P-1370, P-1372, P-1373, P-1375, P-1376, P-1377, P-1379, P-1380, P-1381</td>

<td></td><td colspan="3">Table 2cc. Ret-kinase active compounds with IC50 &lt;10 μΜ</td>

<td>Ret:</td><td></td><td colspan="2">P-0001, P-0001, P-0002, P-0003, P-0003, P-0004, P-0005, P-0005, P-0006, P-0008, P-0009, P-0010, P-0011, P-0012, P-0013, P-0014, P-0015, P-0016, P-0017, P-0019, P-0020, P-0022, P-0024, P-0025, P-0026, P-0027, P-0028, P-0028, P-0029, P-0032, P-0032, P-0033, P-0034, P-0035, P-0036, P-0037, P-0038, P-0039, P-0040, P-0040, P-0041, P-0041, P-0042, P-0043, P-0044, P-0045, P-0046, P-0047, P-0048, P-0049, P-0050, P-0051, P-0052, P-0053, P-0054, P-0055, P-0056, P-0058, P-0059, P-0060, P-0061, P-0062, P-0063, P-0064, P-0065, P-0066, P-0069, P-0070, P-0071, P-0072, P-0073, P-0075, P-0078, P-0079, P-0082, P-0083, P-0085, P-0088,</td>

- 159 -

<td></td><td>P-0089, P-0090, P-0094, P-0095, P-0096, P-0097, P-0099, P-0100, P-0101, P-0102, P-0103, P-0107, P-0108, P-0109, P-0110, P-0113, P-0114, P-0115, P-0116, P-0117, P-0119, P-0121, P-0122, P-0123, P-0124, P-0134, P-0135, P-0137, P-0138, P-0139, P-0140, P-0141, P-0142, P-0148, P-0152, P-0156, P-0158, P-0159, P-0165, P-0167, P-0171, P-0175, P-0179, P-0181, P-0184, P-0186, P-0190, P-0196, P-0196, P-0204, P-0205, P-0206, P-0210, P-0211, P-0215, P-0218, P-0224, P-0228, P-0231, P-0232, P-0236, P-0244, P-0244, P-0245, P-0246, P-0248, P-0250, P-0257, P-0262, P-0265, P-0269, P-0280, P-0286, P-0289, P-0293, P-0297, P-0302, P-0304, P-0307, ​​P-0308, P-0314, P-0316, P-0316, P-0320, P-0320, P-0321, P-0325, P-0329, P-0339, P-0341, P-0344, P-0347, P-0351, P-0352, P-0363, P-0367, P-0369, P-0371, P-0378, P-0385, P-0392, P-0396, P-0412, P-0418, P-0434, P-0448, P-0448, P-0452, P-0453, P-0453, P-0469, P-0472, P-0486, P-0495, P-0501, P-0501, P-0517, P-0520, P-0521, P-0521, P-0533, P-0536, P-0542, P-0550, P-0550, P-0559, P-0559, P-0561, P-0579, P-0594, P-0596, P-0599, P-0599, P-0604, P-0608, P-0611, P-0623, P-0623, P-0624, P-0624, P-0632, P-0636, P-0638, P-0640, P-0644, P-0645, P-0645, P-0647, P-0656, P-0659, P-0668, P-0668, P-0671, P-0675, P-0678, P-0679, P-0682, P-0683, P-0691, P-0693, P-0697, P-0698, P-0699, P-0700, P-0703, P-0708, P-0710, P-0716, P-0721, P-0726, P-0728, P-0730,</td>

- 160 -

<td></td><td>P-0734. P-07.35. P-0736, P-0737, P-0738, P-0744, P-0745. P ^ C0 ^ - ^ (^ 6 P-0749, P-0751, P-0753. P-0757, P-0761, t-ETEs. P-0771, P-0778, P-0794. P-0796, P-0807.P-0810, P-0811,] P1 (^^ 1), P-0822, P-0825, 1--082 (6 P-0835, P-0841, P-0863, P-0865. P-0881, P-0939. P-0976, P-0977, P-0985. P-0998. P-1000, P ^ l ^^^, P-1007, P-1011, P-1019, P-1024, P-1025, P-1026, P-1029, P-1031, P-1033, P1 1, 2, 2, P-1066, P-1072, P-1073, ^^ 1 ^ '^^, P-1081, P-1085, P-1089, P-1097, P-1111, P-1113, P-1115, P-1117, P-1119, P-1121, P-1125, P-1126, P-1129, P-1130, P-1133. P-1134. P-1135, P-1137. P-1178, P-1181, P-1185, P-1188, &lt;1&gt; 1 P-1191, I-1192. P-1193. P-1196 P-1198, P-1240, P-1201</td>

<td colspan="2">Table 2dd. Src kinase active compounds with IC 50 &lt;10 μΜ</td>

<td>src:</td><td>--0001, --0002, --0003, --0004, --000., --0006, --0007, -0008, --000, - - 0010, --0016, --0017, --0021, --002., --0026, --0027, --0028, -0032, --0034, --003., --0036, --0037, --0038, --0040, --0041, --004., --00 .., -0067, --0068, --0072, --0078, --007 ,, --0082, --0088, --00,0, --0102, --0112, -0114, --0134, --01.2, --0166, --0171, --01.6, --020 ,, --0210, --0237, --0244, -026 ,, --0302, --0316, --0320, --0373, --03.6, --0448, --04.3, --0483, --0.01, -0.1., --0.21, --0..0, --0 .. ,, --0.62, --0. ,,, --0623, --0624, --064., --0647, -0668, --068., --0700, --0721, --07.3, --0763, --0771, --0774, --080., --0806, -0807, --0818, --0837, --0848, --08.0, --08.1, --08.3, --08.7, --0866, --0874, -</td>

- 161 -

<td></td><td></td><td>0876, P-0877, P-0885, P-0889, P-0898, P-0907, P-0910, P-0933, P-0950, P-0952, P0955, P-0956, P-0958, P-0997, P-1009, P-1010, P-1013, P-1020, P-1021, P-1181, P1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1254, P-1255, P-1256, P-1257, P1258, P-1261, P-1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1269, P-1280, P1281, P-1288, P-1289, P-1316, P-1317, P-1318, P-1336, P-1338, P-1343, P-1345, P1346, P-1347, P-1348, P-1349, P-1366, P-1383, P-1384, P-1385, P-1387, P-1388, P1390, P-1391, P-1394, P-1396, P-1397, P-1398, P-1399, P-1403, P-1416, P-1417, P1431, P-1432, P-1433, P-1445, P-1446, P-1447, P-1448, P-1451, P-1457, P-1459, P1469, P-1472, P-1473, P-1475, P-1476, P-1477, P-1478, P-1479, P-1480, P-1481, P1484, P-1485, P-1486, P-1495, P-1496, P-1506, P-1527, P-1530</td>

<td></td><td colspan="2">Table 2ee. Stk6 kinase active compounds with IC50 &lt;10 μΜ</td>

<td>Stk6:</td><td></td><td>P-0001, P-0002, P-0003, P-0007, P-0008, P-0009, P-0010, P0011, P-0013, P-0014, P-0015, P-0018, P-0020, P-0022, P-0023, P-0029, P-0030, P0031, P-0032, P-0033, P-0035, P-0040, P-0041, P-0042, P-0043, P-0044, P-0045, P0046, P-0049, P-0051, P-0052, P-0054, P-0056, P-0057, P-0058, P-0060, P-0061, P0063, P-0064, P-0065, P-0069, P-0070, P-0071, P-0076, P-0077, P-0080, P-0081, P0082, P-0086, P-0087, P-0088, P-0091, P-0092, P-0093, P-0094, P-0098, P-0099, P0100, P-0101, P-0104, P-0105, P-0106, P-0110, P-0111, P-0115, P-0117, P-0118, P-</td>

- 162 -

<td></td><td></td><td>0119, P-0120, P-0123, P-0127, P-0128, P-0129, P-0131, P-0132, P-0133, P-0136, P0140, P-0143, P-0146, P-0147, P-0148, P-0153, P-0154, P-0155, P-0157, P-0160, P0162, P-0163, P-0164, P-0169, P-0172, P-0173, P-0174, P-0176, P-0177, P-0179, P0181, P-0185, P-0187, P-0188, P-0189, P-0191, P-0193, P-0199, P-0201, P-0202, P0203, P-0206, P-0207, P-0208, P-0212, P-0213, P-0214, P-0221, P-0225, P-0235, P0237, P-0249, P-0250, P-0251, P-0253, P-0260, P-0261, P-0269, P-0272, P-0276, P0279, P-0281, P-0283, P-0287, P-0290, P-0295, P-0300, P-0313, P-0317, P-0319, P0322, P-0345, P-0348, P-0355, P-0370, P-0372, P-0406, P-0407, P-0417, P-0419, P0426, P-0436, P-0441, P-0445, P-0469, P-0471, P-0489, P-0546, P-0806, P-0885, P0933, P-0955, P-1013, P-1280, P-1336, P-1394, P-1426</td>

<td></td><td colspan="2">Table 2ff. Yes kinase active compounds with IC50I of 10 μΜ</td>

<td>Yes:</td><td></td><td>P-0005, P-0007, P-0010, P-0011, P-0012, P-0013, P-0014, P0015, P-0016, P-0017, P-0019, P-0020, P-0021, P-0022, P-0024, P-0027, P-0028, P0029, P-0031, P-0033, P-0036, P-0040, P-0042, P-0043, P-0044, P-0045, P-0046, P0047, P-0048, P-0049, P-0050, P-0051, P-0052, P-0053, P-0055, P-0056, P-0059, P0060, P-0061, P-0062, P-0063, P-0065, P-0067, P-0068, P-0070, P-0072, P-0074, P0075, P-0081, P-0082, P-0083, P-0088, P-0090, P-0093, P-0095, P-0097, P-0101, P0102, P-0107, P-0109, P-0112, P-0122, P-0124, P-0125, P-0126, P-0129, P-0134, P-</td>

- 163 -

<td>( AND ( AND (</td><td>) 138, P-0139, P-0145,^J-0152, P-0153, P-0161, P-0162, P-0166, P-0171, P-0175, P) 188, P-0202, P-0209,^J-0210, P-0230, P-0237, P-0271, P-0283, P-0310, P-0327, P) 483, P-0636</td>

<td colspan="2">Table 2gg. Zap70 kinase active compounds with ICso &lt;10 μΜ</td>

<td>Zap70:</td><td>P-0001, P-0004, P-0015, P-0030, P-0032, P-0033, P-0034, P0035, P-0037, P-0038, P-0040, P-0041, P-0047, P-0058, P-0123, P-0193, P-0195, P0205, P-0218, P-0228, P-0249, P-0275, P-0296, P-0310, P-0320, P-0342, P-0348, P0359, P-0360, P-0378, P-0379, P-0387, P-0394, P-0434, P-0442, P-0456, P-0476, P0484, P-0495, P-0500, P-0507, P-0523, P-0550, P-0586, P-0602, P-0607, P-0611, P0624, P-0642, P-0649, P-0675, P-0676, P-0694, P-0698, P-0703, P-0716, P-0724, P0727, P-0755, P-0795, P-0808, P-0836, P-0842, P-0856, P-0859, P-0865, P-0875, P0878, P-0880, P-0888, P-0929, P-0930, P-0953, P-0982, P-0996, P-1000, P-1005, P1019, P-1051, P-1073, P-1081, P-1089, P-1119, P-1184, P-1197</td>

<td colspan="2">Table 2hh. Akt3 kinase active compounds with IC50 &lt;10 μM</td>

<td>Akt3:</td><td>P-0001, P-0002, P-0003, P-0004, P-0005, P-0006, P-0008, P0019, P-0021, P-0024, P-0025, P-0026, P-0027, P-0034, P-0035, P-0036, P-0037, P0038, P-0041, P-0048, P-0055, P-0057, P-0058, P-0060, P-0067, P-0099, P-0112, P0114, P-0122, P-0127, P-0154, P-0196, P-0270, P-0278, P-0307, ​​P-0329, P-0404, P0436, P-0573, P-0861, P-0866, P-0883, P-0890, P-0924, P-0936, P-0940, P-0951, P0952, P-0958, P-0962,</td>

- 164 -

<td></td><td>P-0978, P-0990, P-0995, P-1010, P-1016, P-1018, P-1021, P1022, P-1027, P-1034, P-1039, P-1040, P-1043, P-1047, P-1060, P-1062, P-1082, P1095, P-1139, P-1145, P-1147, P-1150, P-1155, P-1158, P-1172, P-1224, P-1288, P-1459</td>

Table 2ii. ALK kinase active compounds with IC50 &lt;10 μΜ

<td>ALK:</td><td>P-0806, P-1280, P-1244, P-1336, P-1394, P-1426</td>

Table 2jj. Cdk2 kinase active compounds with IC₅q &lt;10 μM

<td>Cdk2:</td><td>P-0805, P-1280, P-1244, P1394</td>

Table 2kk. Compounds active against Csk kinase from IC₅q &lt;10 μΜ

<td>csk:</td><td>P-0007, P-0805, P-0806, P-0885, P-0933, P-0955, P-0956, P1013, P-1020, P-1336, P-1394, P-1426</td>

Table 2ll. EphA2 kinase active compounds with ICso &lt;10 μΜ

<td>EphA2:</td><td>P-1336, P-1394</td>

Table 2mm. Compounds active against EphB4withICso kinase &lt;10 μΜ

<td>EphB4:</td><td>P-0806, P-1336</td>

Table 2nn. Frk kinase active compounds with IC50 &lt;10 μΜ

<td>Frk:</td><td>P-0007, P-0805, P-0885, P-0933, P-0955, P-0956, P-1013, P1020, P-1244, P-1318, P-1336, P-1394</td>

<td colspan="2">Table 2oo. Gsk3p kinase active compounds with ICsq &lt;10 μΜ</td>

<td>Gsk33:</td><td>P-0007, P-0015, P-0017, P-0053, P-0057, P-0079, P-0081, P0085, P-0086, P-0094, P-0104, P-0106, P-0109, P-0123, P-0135, P-0148, P-0154, P0159, P-0169, P-0180, P-0207, P-0226, P-0236, P-0252, P-0273, P-0462, P-0700, P0728, P-0763, P-0850, P-0902, P-0913, P-0969, P-1002, P-1142, P-1181, P-1252, P1317, P-1336, P-1372, P-1426</td>

Table 2pp. Hck-active compounds with IC 50 &lt;10 μΜ

- 165 -

<td>HCK:</td><td>P-0007, P-0806, P-0885, P-0933, P-1318, P-1336, P1394, P-1426</td>

Table 2qq. MAP4K4 kinase active compounds with IC50 &lt;10 μΜ

<td>MAP4K4:</td><td></td><td>P-0007, P-0057, P-0069, P-0079, P-0082, P-0088, P-0130, P0131, P-0152, P-0174, P-0176, P-0198, P-0202, P-0214, P-0220, P-0256, P-0269, P0287, P-0300, P-0317, P-0357, P-0367, P-0369, P-0391, P-0402, P-0442, P-0449, P0477, P-0488, P-0495, P-0518, P-0527, P-0537, P-0573, P-0601, P-0685, P-0695, P0700, P-0728, P-0734, P-0753, P-0800, P-0806, P-0811, P-0850, P-0851, P-0853, P0862, P-0885, P-0896, P-0902, P-0904, P-0909, P-0913, P-0931, P-0933, P-0937, P0954, P-0958, P-0971, P-0986, P-1017, P-1042, P-1056, P-1252, P-1253, P-1279, P1280, P-1289, P-1317, P-1318, P-1336, P-1372, P-1383, P-1394, P-1406, P-1411, P1414, P-1415, P-1417, P-1418, P-1426, P-1429, P-1685</td>

<td></td><td colspan="2">Table 2r IGF1R kinase active compounds with IC 50 &lt;10 μM</td>

<td>IGF1R:</td><td></td><td>P-0002, P-0003, P-0004, P-0009, P-0031, P-0079, P-0080, P0084, P-0115, P-0136, P-0154, P-0157, P-0212, P-0213, P-0700, P-0716, P-0746, P0850, P-1336, P-1337, P-1390, P-1394</td>

<td></td><td colspan="2">Table 2ss. IKK beta kinase active compounds with IC 50 &lt;10 μM</td>

<td>IKK beta:</td><td></td><td>P-0007, P-0013, P-0014, P-0029, P-0057, P-0073, P-0084, P0085, P-0086, P-0087, P-0096, P-0098, P-0106, P-0111, P-0115, P-0120, P-0127, P0128, P-0133, P-0135, P-0163, P-0164, P-0172, P-0177, P-0179, P-0216, P-0270, P0272, P-0315, P-0376, P-0404, P-0410, P-0436, P-0629, P-0682, P-0690, P-0790, P-</td>

- 166 -

<td colspan="2"></td><td>0896, P-0920, P-0962, P-1223</td>

<td colspan="3">Table 2tt. Itk kinase-active compounds with IC 50 &lt;10 μM</td>

<td>ITK:</td><td colspan="2">P-0002, P-0003, P-0004, P-0006, P-0008, P-0009, P-0013, P-0016, P-0019, P-0020, P-0024, P-0025, P-0027, P-0031, P-0034, P-0035, P-0036, P-0038, P-0067, P-0173, P-0196, P-0521, P-0579, P-0716, P-0778, P-0883, P-0951, P-1016, P-1067, P-1337, P-1385</td>

<td colspan="3">Table 2uu. Jak3 kinase-active compounds with an IC 50 &lt;10 μM</td>

<td colspan="2">JAK3:</td><td>P-0003, P-0004, P-0009, P-0013, P-0014, P-0019, P-0020, P0022, P-0024, P-0034, P-0039, P-0044, P-0046, P-0049, P-0051, P-0060, P-0061, P0063, P-0070, P-0084, P-0101, P-0106, P-0108, P-0109, P-0119, P-0122, P-0124, P0138, P-0141, P-0146, P-0171, P-0178, P-0187, P-0215, P-0318, P-0521, P-0730, P0863, P-01367, P-01385</td>

Table 2vv. Compounds active against MLK1 kinase with IC50 &lt;10μ

<td>MLK1:</td><td>P-1336, P-1426</td>

Table 2ww. TrkA kinase active compounds with IC₅0 &lt;10 μM

<td>TrkA:</td><td>P-0409, P-0806, P-1244, P1426</td>

Table 2xx. PDGFRA kinase active compounds with IC 50 &lt;10 μM

<td>PDGFRA:</td><td>P-0007, P-0409, P-0806, P-0885, P-0933, P-1280, P-I336, P1394, P-1426</td>

<td colspan="2">Table 2yy. PlK1 kinase active compounds with IC50 &lt;10 μM</td>

<td colspan="2">Plk1: P-0018, P-0022, P-0031, P-0044, P-0046, P-0067, P-0075, P0083, P-0085, P-0099, P-01113, P-0123, P-0128, P-0135, P-0146, P-0148, P-0154, P0178, P-0286, P-0332, P-0345, P-0366, P-0480, P-0490, P-0581, P-0863, P-0954, P-1138</td>

- 167 Table 2zz. Brk kinase active compounds with IC50 &lt;10 μΜ

<td>brk:</td><td colspan="2">P-0007, P-0805, P-0806, P-0885, P-0933, P-0955, P-0956, P1013, P-1020, P 1244, P-1318, P-1336, P-1394</td>

<td colspan="2">Table 2ab. ROCK1 kinase active compounds with ICs &amp; lt; 10 μM</td><td rowspan="3"></td>

<td colspan="2">ROCK1: P-0057</td>

<td colspan="2">Table 2ac. Syk kinase active compounds with IC 50 &lt;10 μΜ</td>

<td>Hiss:</td><td colspan="2">P-0002, P-0010, P-0033, P-0054, P-0056, P-0057, P-0089, P0196, P-0448, P-0521, P-0599, P-1336</td>

<td colspan="2">Table 2ad. TEC kinase active compounds with IC 50 &lt;10 μΜ</td><td></td>

<td>TEC:</td><td>P-0033, P-0044, P-0088, P-0156, P-0166, P-0228, P-0257, P0297, P-0429, P-0017, P-0897, P-0954, P-0983, P-0991, P-0997, P-1020, P1317</td><td></td>

<td colspan="2">Table 2ae. Tie2 kinase active compounds with IC 50 &lt;10 μΜ</td>

<td>Tie2:</td><td>P-0806, P-1280, P-1336, P-1394, P-1426</td>

Information on plasmid sequence and PCR primer:

abl

PCR primers [0286]

<td>abl</td><td>Abel-227</td><td>CACCACGGTGTGTCCCCCAACTACGA (SEQ ID NO: _)</td><td>1424</td>

<td></td><td>CABL-A</td><td>GTCACGTCGACTCAGACGCCTTGTTTCCCCAGCT (SEQ ID NO: _)</td><td>736</td>

- 168 Ρ1121. pET-SPEC BI-PTP Abl G227-V515-X taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccaccacggtgtgtcc

MGHHHHHHGVS cccaactacgacaagtgggagatggaacgcacggacatcaccatgaagcacaagctgggc

PNYDKWEMERTDITMKHKLG gggggccagtacggggaggtgtacgagggcgtgtggaagaaatacagcctgacggtggcc

GGQYGEVYEGVWKKYSLTVA gtgaagaccttgaaggaggacaccatggaggtggaagagtttgaaagaagctgcagtc

VKTLKEDTMSVEEFLKEAAV atgaaagagatcaaacaccctaacctggtgcagctccttggggtctgcacccgggagccc

MKEIKHPNLVQLLGVCTREP ccgttctatatcatcactgagttcatgacctacgggaacctcctggactacctgagggag

PFYIITEFMTYGNLL DYLRE tgcaaccggcaggaggtgaacgccgtggtgctgctgtacatggccactcagatctcgtca

CKRQEV NAVVLLYMATQI SS gccatggagtacctggagaagaaaaacttcatccacagagatcttgctgcccgaaactgc

AMEYLEKKNFIHRDLAARNC ctggtaggggagaaccacttggtgaaggtagctgattttggcctgagcaggttgatgaca

LVGENHLVKVADFGLSRLMT ggggacacctacacagcccatgctggagccaagttccccatcaaatggactgcacccgag

GDTYTAHAGAKFPIKWTAPE agcctggcctacaacaagttctccatcaagtccgacgtctgggcatttggagtattgctt

SLAYNKFSIKSDVWAFGVLL tgggaaattgctacctatggcatgtccccttacccgggaattgacctgtcccaggtgtat

WEIATYGMS PYPGIDLSQVY gagctgctagagaaggactaccgcatggagcgcccagaaggctgcccagagaaggtctat

ELLEKDYRMERPEGCPEKVY gaactcatgcgagcatgttggcagtggaatccctctgaccggccctcctttgctgaaatc

ELMRACWQWNPSDRPSFAEI caccaagcctttgaaacaatgttccaggaatccagtatctcagacgaagtggaaaaggag

HQAFETMFQESSISDEVEKE ctggggaaacaaggcgtctgagtcgac (seq id bo i)

LGKQGV - (SED ID NO:)

B-Raf V600E

PCR primers [0287]

<td>BRAF</td><td>BRAF437D-S</td><td>ACGGGACCATATGGATGATTGGGAGATTCCTGA (SEQ II NO: _)</td><td>4783</td>

<td></td><td>BRAF722K-A</td><td>CACTG GTCGACTATT TTGGCAATGAGCGGG CCA (SEQ II KO: _)</td><td>4784</td>

<td></td><td>BRAFV599B-S</td><td>3GTCTAGCTACAGAAAAATCTCGATGGAG (SEQ II NO: _)</td><td>893</td>

(continued)

<td></td><td></td><td>CTCCATCGAGATTTTTCTGTAGCTAGACC</td><td></td>

<td></td><td>BRAFV599E-A</td><td>(SEQ II NO: _)</td><td>894</td>

- 169 Ρ 4254. pFastBacBD-CDC37 BRAF D437-K722-X, V600E tattccggattattcataccgtcccaccatcgggcgcggatctcggtccgaaacc atgtcgtactaccatcaccatcaccatcacgattacgatatcccaacgaccgaaaacctg

MSYYHHHHHHDYDIPTrENL tattttcagggccatatggatgattgggagattcctgatgggcagattacagtgggacaa YFQGHMDDWEI PDG QITVGQ agaattggatctggatcatttggaacagtctacaagggaaagtggcatggtgatgtggca

RIGSGSFGTVYKGXWHGDVA gtgaaaatgttgaatgtgacagcacctacacctcagcagttacaagccttcaaaaatgaa VKMLNVTAPT PQQLQAFXNE gtaggagtactcaggaaaacacgacatgtgaatatcctactcttcatgggctattccaca

VGVLRXTRHVNILLFMGYST aagccacaactggctattgttacccagtggtgtgagggctccagcttgtatcaccatctc KPQLAIVTQWCEGSS LYHHL catatcattgagaccaaatttgagatgatcaaacttatagatattgcacgacagactgca

HIIETKFEMIKLIDIARQTA cagggcatggattacttacacgccaagtcaatcatccacagagacctcaagagtaataat QGMDYLHAKS IIHRDLKSNM atatttcttcatgaagacctcacagtaaaaaggtgattttggtctagctacagaaaaa

IFLHEDLTVKIGDFGLATEK tctcgatggagtgggtcccatcagtttgaacagttgtctggatccattttgtggatggca

SRWSGSHQFEQLSGSILWMA ccagaagtcatcagaatgcaagataaaaatccatacagctttcagtcagatgtatatgca

PEVIRMQDKNPYSFQSDVYA tttggaattgttctgtatgaattgatgactggacagttaccttattcaaacatcaacaac

FGIVLYELMTGQLPYSNINN agggaccagataatttttatggtgggacgaggatacctgtctccagatctcagtaaggta

RDQIIFMVGRGYLSPDLSKV cggagtaactgtccaaaagccatgaagagattaatggcagagtgcctcaaaaagaaaaga

RSNCPKAMKRLMAECLKKKR gatgagagaccactctttccccaaattctcgcctctattgagctgctggcccgctcattg

DERPLFPQILASIELLARSL ccaaaatagtcgactagagcctgcagtctcgaggcatgcggtaccaagctt (seq id NO: _)

PK - (SEQ ID NO:)

Erk2

PCR primers [0288]

<td>ERK2</td><td>ERG2-S</td><td>ggcagcccatatggcggcogcggcggcggc [SEQ ID NO: _)</td><td>748</td>

<td colspan="4">(continued)</td>

<td></td><td>ERK2</td><td>TGTCCGTCGACATTTAAGATCTGTATCCTGG (SEQ ID NO: _)</td><td>749</td>

- 170 P4227.pET15S ERK2 / MEK1DD taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggcagcagccatcatcatcatcatcacagc

MGSSHHHHHHS agcggcctggtgccgcgcggcagccatatggcggcggcggcgggcgcgggcccggagatg

SGLVPRGSHMAAAAGAGPEM gtccgcgggcaggtgttcgacgtggggccgcgctacaccaacctctcgtacatcggcgag VRGQVFDVGPRYTNLSYIGE ggcgcctacggcatggtgtgctctgcttatgataatgtcaacaaagttcgagtagctatc GAYGMVCSAYDNVKKVRVAI aagaaaatcagcccctttgagcaccagacctactgccagagaaccctgagggagataaaa KKISPFEHQTYCQRTLREIK atcttactgcgcttcagacatgagaacatcattggaatcaatgacattattcgagcacca ILLRFRHENIIGINDI IRAP accatcgagcaaatgaaagatgtatatatagtacaggacctcatggaaacagatctttac TIEQMKDVYIVQDLMETDLY aagctcttgaagacacaacacctcagcaatgaccatatctgctattttctctaccagatc KLLKTQHLSNDHICYFLYQI ctcagagggttaaaatatatccattcagctaacgttctgcaccgtgacctcaagccttcc LRGLKYIHSANVLHRDLKPS aacctgctgctcaacaccacctgtgatctcaagatctgtgactttggcctggcccgfcgtt NLLLNTTCDLKICDFGLARV gcagatccagaccatgatcacacagggttcctgacagaatatgtggccacacgttggtac ADPDHDHTGFLTEYVATRWY agggctccagaaattatgttgaattccaagggctacaccaagtccattgatatttggtct RAPEIMLNSKGYTKSIDIWSgtaggctgcattctggcagaaatgctttctaacaggcccatctttccagggaagcattat VGCILAEMLSNRPIFPGKHY cttgaccagctgaaccacattttgggtattcttggatccccatcacaagaagacctgaat LDQL Ν Η I LGILGSPSQEDLN tgtataataaatttaaaagctaggaactatttgctttctcttccacacaaaaataaggtg CIINLKARNYLLSLPHKNKV ccatggaacaggctgttcccaaatgctgactccaaagctctggacttattggacaaaatg PWNRLFPNADSKALDLLDKM ttgacatfccaacccacacaagaggafctgaagtagaacaggctctggcccacccatatctg LTFNPHKRIEVEQALAHPYL gagcagtattacgacccgagtgacgagcccatcgccgaagcaccattcaagttcgacatg ECYYDPSDEPIAEAPFKFDM gaattggatgacttgcctaaggaaaagctcaaagaactaatttttgaagagactgctaga ELDDLPKEKLKELIFEETAR ttccagccaggatacagatcttaaatgtcgac (SEQ ID NO:)))))

FQPGYRS (SEQ ID NO:>

Fak

PCR primers [0289]

<td>FAK</td><td>FAK411</td><td>GCTGGATCCACCAGGGATTATGAGATTCAAAG (SEQ ID NO: _)</td><td>2156</td>

<td></td><td>FAK686</td><td>GTTCTTGTCGACTACTGAGCCTTCrCTTCCTCCA (SEQ ID NO: _}</td><td>2157</td>

- 171 Ρ1358.pFasCBacHtb FAK S411-Q686-X tatfcccggattattcataccgfccccaccatcgggcgcggatctcggtccgaaacc atgtcgfcactaccatcaccatcaccatcacgattacgatatcccaacgaccgaaaacctg

MSYYHHHHHHDYDIPTTENL tattttcagggcgccatgggatccaccagggattatgagattcaaagagaaagaafcagaa

YFQGAMGSTRDYEIQRERIE cttggacgatgtattggagaaggccaatttggagatgtacatcaaggcatttatatgagt

LGRCIGEGQFGDVHQGIYMS ccagagaatccagctttggcggttgcaattaaaacatgtaaaaactgtacttcggacagc

PENPALAVAIKTCKNCTSDS gtgagagagaaatttcttcaagaagccttaacaatgcgtcagtttgaccatcctcatatt

VREKFLQEALTMRQFDHPHI gtgaagctgatfcggagtcatcacagagaatcctgtctggataatcatggagctgtgcaca

VKLIGVITENPVWIIMELCT cttggagagctgaggtcatttttgcaagtaaggaaatacagtttggatctagcatctttg LGELRS FLQVRKYSLDLASL atcctgtatgcctatcagcttagtacagctcttgcatatctagagagcaaaagatttgta

ILYAYQLSTALAYLESKRFV cacagggacattgctgctcggaatgttctggtgtcctcaaatgattgtgtaaaattagga

HRDIAARNVLVSSNDCVKLG gactttggattatcccgatatatggaagatagtacttactacaaagcttccaaaggaaaa

DFGLSRYMEDSTYYKASKGK ttgcctattaaatggatggctccagagtcaatcaattttcgacgttttacctcagctagt

LPIKWMAPESINFRRFTSAS gacgtatggatgtttggtgtgtgtatgtgggagatactgatgcatggtgtgaagcctttt

DVWMFGVCMWEILMHGVKPF caaggagtgaagaacaatgatgtaatcggtcgaattgaaaatggggaaagattaccaatg

QGVKNNDVIGRIEKGERLPM cctccaaattgtcctcctaccctctacagccttatgacgaaatgctgggcctatgacccc

PPNCPPTLYSLMTKCWAYDP agcaggcggcccaggtttactgaacttaaagctcagct.cagcacaatcctggaggaagagga

SRRPRFTELKAQLSTILEEE aaggctcagtagfccggggctcactagtcgcggccgctttcgaatctagagcctgcagt KAQ - STS SLVAAAFESRACS ctcgaggcatgcggtaccaagcfctgtcgagaagtactagaggafccataatc (seb id NO: _)

LEACGTKLVEKY- (SEQ ID NO: _)

FGFR1

PCR primers [0290]

<td>FGFR1</td><td>FGFR1-S</td><td>GACTCCTCATATGGCAGGGGTCTCTGAGTATGA (SEQ ID NO: _)</td><td>1237</td>

<td></td><td>FGFRSAL</td><td>CAGGTCGTCGACrACTCCTGGTTGGAGGTCAAGG (SEQ ID NO: _)</td><td>1611</td>

<td></td><td>C488A-1</td><td>ctgggagaoggcgcgtttgggcaggtgg (SEQ ID NO: _)</td><td>2038</td>

<td></td><td>C488A-2</td><td>ccacctgcccaaacgcgccctctcccag {SEQ ID NO: _)</td><td>2039</td>

- 172 -

<td></td><td>C584S-1</td><td>CAGGGCTGGAATACAGCTACAACCCCAGC (SEQ ID HO! _)</td><td>2041</td>

<td></td><td>C584S-2</td><td>GCTGGGGTTGTAGCTGTATTCCAGCCCTG &lt;SEQ ID NO: _)</td><td>2042</td>

Ρ1351.ρΒΤ Ν6 ΒΙ-ΡΤΡ FGFR Α458-Ε765-Χ C488A, C584S taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatggcaggg

MGHHHHHHMAG gtctcfcgagtatgagcttcccgaagaccctcgctgggagctgcctcgggacagactggtc

VSEYELPED PR W. ELPRDRLV ttaggcaaacccctgggagagggcgcgtttgggcaggtggtgttggcagaggctatcggg

LGKPLGEGAFGQVVLAEAIG ctggacaaggacaaacccaaccgtgtgaccaaagtggctgtgaagatgttgaagtcggac

LDKDKPUR 'VTKVAVKMLKSD gcaacagagaaagacttgtcagacctgatctcagaaatggagatgatgaagatgatcggg

ATEK · DLSDLISEMEMMKMIG aagcataagaatatcatcaacctgctgggggcctgcacgcaggatggtcccttgtatgtc

KHKNIINLLGACTQDGPLYV atcgtggagtatgcctccaagggcaacctgcgggagtacctgcaggcccggaggccccca

IVEYASKGHLREYLQARRPP gggctggaatacagctacaaccccagccacaacccagaggagcagctctcctccaaggac

GLEYSYNPSHNPEEQLSSKD ctggtgtcctgcgcctaccaggtggcccgaggcatggagtatctggcctccaagaagtgc

LVSCAYQVARGMEYLASKKC atacaccgagacctggcagccaggaatgtcctggtgacagaggacaatgtgatgaagata

IHRDLAARNVLVTEDNVMKI gcagacttŁggcctcgcacgggacattcaccacatcgactactataaaaagacaaccaac

ADFGLARDIHHIDYYKKTTN ggccgactgcctgtgaagtggatggcacccgaggcattatttgaccggatctacaccac

GRLPVKWMAPEALFDRIYTH cagagtgatgtgtggtctttcggggtgctcctgtgggagatcttctactctgggcggctcc

QSDV WSFGVLLWEIFTLGGS ccataccccggtgtgcctgtggaggaacttttcaagctgctgaaggagggtcaccgcatg

PYPGVPVEELFKLLKEGHRM gacaagcccagtaactgcaccaacgagctgtacafcgatgatgcgggactgctggcatgca

DKPSKCTNELYMMMRDCWHA gtgccctcacagagacccaccttcaagcagctggtggaagacctggccgcatcgtggcc

VPSQRPTFKQLVEDLiDRIVA ttgacctccaaccaggagtagtcgacgaaggagatatatcc (seq id no:,

LTSNQE - (seq id ho &lt;Ϊ

Flt1

PCR primers [0291]

<td>FLT1</td><td>FLT1-S</td><td>ATCAATTCATATGGACC CACfATGAAGTTCC (SEQ ID NO: _)</td><td>737</td>

- 173 -

<td colspan="4">ATGTAGTCGACCTAATCCTGTTGTACATTTGCTT</td>

<td></td><td>FLT1-A</td><td>(SEQ ID NO: _}</td><td>738</td>

P1826.pETNG BI-PTP FLT1 M799-D1165-X MT taatacgactcactataggggaafctgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatggaccca

MGHHHHHHMDP gatgaagttcctttggatgagcagtgtgagcggctcccttatgatgccagcaagtgggag

DEVPLDEQCERLPYDA £ CEC tttgcccgggagagacttaaactgggcaaatcacttggaagaggggcttttggaaaagtg PARERLKLGKSLGRGAFGKV gttcaagcatcagcatttggcattaagaaatcacctacgtgccggactgtggctgtgaaa VQASAFGIKKSPTCRTVAVK atgctgaaagagggggccacggccagcgagtacaaagctctgatgactgagctaaaaatc MLKEGATASEYKALMTELKI ttgacccacattggccaccatctgaacgtggttaacctgctgggagcctgcaccaagcaa LTHIGHHLNVVNLLGACTKQ ggagggcctctgatggtgattgttgaatactgcaaatatggaaatctctccaactacctc GGPLMVIVEYCKYGNLSNYL aagagcaaacgtgacttattttttctcaacaaggatgcagcactacacatggagcctaag KSKRDLFFLWKDAALHMEPK aaagaaaaaafcggagccaggcctggaacaaggcaagaaaccaagactagatagcgtcacc KEKMEPGLEQGKKPRLDSVT agcagcgaaagctttgcgagctccggctttcaggaagataaaagtctgagtgatgttgag SSESFASSGFQEDKSLSDVE gaagaggaggattctgacggtttctacaaggagcccatcactatggaagatctgatttct EEEDSDGFYKEPITMEDLT S tacagrttttcaagtggccagaggcatggagttcctgtcttccagaaagtgcattcatcgg YSFQVARGMEFLSSRXCIHRgacctggcagcgagaaacattcttttatctgagaacaacgtggtgaagatttgtgattfct DLAARNILLSEWWVVKI CDF ggccttgcccgggatatttataagaaccccgattatgtgagaaaaggagatactcgactt GLARDIYKNPDYVRKGDTRL cctctgaaatggatggctcccgaatctatctttgacaaaatctacagcaccaagagcgac PLKWMAPESIFDKIYSTKSD gtgtggtcttacggagtattgctgtgggaaatcttctccttaggtgggtctccataccca VWSYGVLLWEIFSLGGS PVP ggagtacaaatggatgaggacttttgcagtcgcctgagggaaggcatgaggatgagagct GVQMDEDFC £ RLREGMRMRA cctgagtactctactcctgaaatetatcagatcatgctggactgctggcacagagaccca peystpeiyqimldcwhrdp aaagaaaggccaagatttgcagaacttgtggaaaaactaggtgatttgcttcaagcaaat XERPRFAELVEXLGDLLQAN gtacaacaggattaggtcgaccaccaccaccaccaccactgagatccggctggccctactPLKWMAPESIFDKIYSTKSD gtgtggtcttacggagtattgctgtgggaaatcttctccttaggtgggtctccataccca VWSYGVLLWEIFSLGGS PVP ggagtacaaatggatgaggacttttgcagtcgcctgagggaaggcatgaggatgagagct GVQMDEDFC £ RLREGMRMRA cctgagtactctactcctgaaatetatcagatcatgctggactgctggcacagagaccca peystpeiyqimldcwhrdp aaagaaaggccaagatttgcagaacttgtggaaaaactaggtgatttgcttcaagcaaat XERPRFAELVEXLGDLLQAN gtacaacaggattaggtcgaccaccaccaccaccaccactgagatccggctggccctactPLKWMAPESIFDKIYSTKSD gtgtggtcttacggagtattgctgtgggaaatcttctccttaggtgggtctccataccca VWSYGVLLWEIFSLGGS PVP ggagtacaaatggatgaggacttttgcagtcgcctgagggaaggcatgaggatgagagct GVQMDEDFC £ RLREGMRMRA cctgagtactctactcctgaaatetatcagatcatgctggactgctggcacagagaccca peystpeiyqimldcwhrdp aaagaaaggccaagatttgcagaacttgtggaaaaactaggtgatttgcttcaagcaaat XERPRFAELVEXLGDLLQAN gtacaacaggattaggtcgaccaccaccaccaccaccactgagatccggctggccctact

VQQD - (SEQ ID NO: _) ggccgaaaggaattcgaggccagcagggccaccgctgagcaataactagcataacccctt ggggcctctaaacgggtcttgaggggttttttg (SEQ id mo: _)

Putty

PCR primers [0292]

- 174 -

<td>PUTTY</td><td>8K1A</td><td>ATGTACGAAGTTCAGTGGAAAGTTGTTGAAGAAATCAACGG (SEQ ID NO: _)</td><td>1776</td>

<td></td><td>8K1B</td><td>GGTCGATGTAAACGTAGTTGTTACCGTTGATTTCTTCAACAACTTT (SEQ ID NO: _)</td><td>1777</td>

<td></td><td>8K2A</td><td>aacaactacgtttalcatcgacccgacccagctgccgtacgac (SEQ ID NO: _)</td><td>1779</td>

<td></td><td>BK2B</td><td>gttacgcgggaactcccatttgtggtcgtacggcagctgggtc (SEQ ID NO: _)</td><td>1781</td>

<td></td><td>8K3A</td><td>aaatgggagttcccgcgtaaccgtctgtctttcggtaaaaccc (SEO ID NO: _)</td><td>1782</td>

<td></td><td>8K3B</td><td>ACCGAACG CACCCG CACCCAGtGGTTTTACCGAAAGACAGAC (SEQ ID NO: _)</td><td>1783</td>

<td></td><td>8K4A</td><td>GGTGCGGGTGCGTTCGGTAAAGTTGTTGAAGCGACCGCGTACG (SEQ ID NO: _)</td><td>1784</td>

<td></td><td>8K4B</td><td>gccgcgtcagatttgatcagaccgtacgcggtcgcttcaac (SEQ ID NO: _)</td><td>1785</td>

<td></td><td>8K5A</td><td>CTGATCAAATCTGACGCGGCGATGACCGTTGCGGTTAAAATGC (SEO ID NO: _)</td><td>1786</td>

<td></td><td>8K5B</td><td>gtcaggtgcgcagacggtttcagcattttaaccgcaacggtca (SEO ID NO: _)</td><td>1787</td>

<td></td><td>8K6A</td><td>aaaccgtctgcgcacctgaccgaacgtgaagcgctgatgtctg (SEQ ID NO: _)</td><td>1788</td>

<td></td><td>8K6B</td><td>CCAGGTAAGACAGAACTTTCAGTTCAGACATCAGCGCTTCACGT (SBQ ID NO: _)</td><td>1789</td>

<td></td><td>8K7A</td><td>CTGAAAGTTCTGTCTTACCTGGGTAACCACATGAACATCGTTAA (SEQ ID NO: _)</td><td>1791</td>

<td></td><td>8K7B</td><td>GGTGCACGCACCCAGCAGGTTAACGATGTTCATGTGGTTAC (SEQ ID NO: _)</td><td>1792</td>

<td></td><td>8K8A</td><td>ctgctgggtgcgtgcaccatcggtggtccgaccctggatatca (SEO ID NO: _)</td><td>1793</td>

<td></td><td>8K8B</td><td>GTCACCGTAGCAGCAGTATTCGGTGATAACCAGGGTCGGACCA (SEQ ID NO: _)</td><td>1794</td>

<td></td><td>8K9A</td><td>gaatactgctgctacggtgacctgctgaacttcctgcgtcgta (SEQ ID NO: _)</td><td>1795</td>

<td></td><td>8K9B</td><td>agagcagatgaaagagtcacgtttacgacgcaggaagttcagc (SEQ ID NO: _)</td><td>1796</td>

<td></td><td>8K10A</td><td>CGTGACTCTTTCATCTGCTCTAAACAGGAAGACCACGCGGAAG (SEQ ID NO: _)</td><td>1797</td>

- 175 -

<td></td><td>8K10B</td><td>cagcaggttgtgtacagcgccgcttccgcgtggtcttcctgt (SEQ ID NO: _)</td><td>1798</td>

<td></td><td>8K11A</td><td>GCGCTGTACAAAAACCTGCTGCAjCTCTAAAGAATCTTCTTGCTC (SEQ ID NO: _)</td><td>1799</td>

<td></td><td>8K11B</td><td>CCATGTATTCGTTGGTAGAGTCAGAGCAAGAAGATTCTTTAGAST (SEQ ID NO: _)</td><td>1811</td>

<td></td><td>8K11A</td><td>GACTCTACCAACGAATACATGGACATGAAACCGGGTGTTTCTTA (SEQ ID NO: _)</td><td>1812</td>

<td></td><td>8K11B</td><td>TCCGCTTTGGTCGGAACAACGTAAGAAACACCCGGTTTCATGT (SEQ ID NO:).</td><td>1813</td>

<td></td><td>8R12A</td><td>GTTGTTCCGACCAAAGCGGACAAACGTCGTTCTGTTCGTATCG (SEQ ID NO: _)</td><td>1814</td>

<td></td><td>8K12B</td><td>TAACGTCACGTTCCIATGTAAGAACCGATACGAACAGAACGtACGTTT (SEQ ID NO: _)</td><td>1815</td>

<td></td><td>8K13A</td><td>rCTTACATCGAACGTGACGTTACCCCGGCGATCATGGftAGACG (SEQ ID NO: _)</td><td>1816</td>

<td></td><td>8K13B</td><td>CCAGGTCCGCISSCCLGTTICsTCGTCTTCCATGATCGCCGG (SEQ ID NO: _)</td><td>1817</td>

<td></td><td>8K14A</td><td>gaactggcgctggacctggaagacctgctgtctttctcttacc (SEQ ID NO: _)</td><td>1818</td>

<td></td><td>8K14B</td><td>GAACGCCATACCTTTCGCAACCTGGTAAGAGAAAGACAGCftGGT " (SEQ ID NO: _)</td><td>1819</td>

<td></td><td>8K15A</td><td>GTTGCGAAAGGTATGGCGTTCCTGGCGTCTAAAAACTGCATCCA (3EQ ID NO: _)</td><td>1821</td>

<td></td><td>8K15B</td><td>CGCGCCGCCAGGTCACGGTGGATGCAGTTTTTAGACGCC (SEC ID NO: _)</td><td>1822</td>

<td></td><td>8K16A</td><td>CGTGACCTGGCGGCGCGTAACATCCTGCTGACCCACGGTCG (SEQ ID NO: _)</td><td>1823</td>

<td></td><td>8K16B</td><td>kCCGAAlGTCtGCWGiiTTTTGGTGATACGACCGTGGGrCASCAGG (SEQ ID NO: _)</td><td>1824</td>

<td></td><td>SK17</td><td>ACCAAAATCTGCGACTTCGGTCTGGCGCGTGACATCAAAAACG (SEQ ID NO: __)</td><td>1825</td>

<td></td><td>8K17B</td><td>GTTACCTTTAACAACGTAGTTAGAGTCGTTTTTGATGTCACGCGCC (SEC ID NO: _)</td><td>1826</td>

<td></td><td>8K18A</td><td>TCTAACTACGTTGTTAAAGGTAACGCGCGTCTGCCGGTTAAATG (SEQ ID NO: _)</td><td>1827</td>

<td></td><td>8K18B</td><td>GAAGATAGATTCCGGCGCCATCCATTTAACCGGCAGIAOGCGC (SEQ ID NO: _)</td><td>1829</td>

- 176 -

<td></td><td>8K19A</td><td>ATGGCGCC TCTATCTTCCA ^ ^ G ^ CCT CC ^ ^ ^ l ^ int lC ^ lC ^ TrCGAATC (SEQ ID MO; _)</td><td>1831</td>

<td></td><td>8K19B</td><td>aTTACCGTjTTGACICTTTCGCCTSATCCCAACGTCrTATCCCTC (SSQ ID MO; _)</td><td>1832</td>

<td></td><td>8K20A</td><td>GACCTTCGGTCCTACGGTACCCTTTTCC (C3CTAT'rCTTTTTTC (SEQ ID MO; _J</td><td>1833</td>

<td></td><td>8K20B</td><td>CCTGTCGGAA &lt;TCGT^.rTTCCC'T3CCCTC^.CCTTTTCTTCCCCC (SEQ ID HO; _)</td><td>1834</td>

<td></td><td>8K21A</td><td>CCCTTTTTCCCCCATCCCGCTATGCCCCTTGTTTCTTTATTCTAT (SEQ ID NO; _)</td><td>1835</td>

<td></td><td>8K21B</td><td>CCCTAACC^.CTC'JCrTGAT &lt;TTTrτTGTA (CVTTCCACTCTTTACCGCT (SEQ ID NO; _)</td><td>1836</td>

<td></td><td>8K22A</td><td>| {SEQ ID NO; _)</td><td>1837</td>

<td></td><td>8K22B</td><td>ACCCCCCTTTCCTCCCTTCCTCCCTCTTCTCCTCTCTCTATA (SBQ ID NO; _)</td><td>1838</td>

<td></td><td>8K23A</td><td>CC ^ (C ^^ T ^ 'T ^' ^ j ^^ &lt;C ^^. ^ R (C ^^ (^ C ^ CC LT^.CCCT ^ CTCCCC (SEQ ID NO; _)</td><td>1839</td>

<td></td><td>8K23B</td><td>TTCGTTCGACG'rCCCTCCCCGCCTCCCTTCTACTACCCCTTT (SEQ ID NO: __)</td><td>1841</td>

<td></td><td>8K24A</td><td>CCCC'rGTTACGTCTCACCCTTTAACTGATCCCTCTCCC^.CATCC (SEQ ID NO; _)</td><td>1842</td>

<td></td><td>8K24B</td><td>ttggtagattcagagatctgtttttcgatcagctgaacgatctgtt [3BQ ID NO; _)</td><td>1843</td>

<td></td><td>8K25A</td><td>AATCACATCTCCCAACCCATCTTTTTCATCCACI'CTAATCCCGT (SEQ ID NO; _)</td><td>1844</td>

<td></td><td>SK25B</td><td>tgacggttcggagagcagttcgccaggttagagtagatgtgg (SBQ ID NO; _)</td><td>1845</td>

<td></td><td>8K26A</td><td>AATTCCCCCTCCAATCCTTTGAAACCGCTCCr^.TCACCTCTCTC (SEQ ID NO; _J</td><td>1846</td>

<td></td><td>SK26B</td><td>CTACTΆCCAATT.CTC^.rTCT^ΓrTCCTATTCACTCCTCTTTTACCCGC (SEQ ID NO; _)</td><td>1847</td>

<td></td><td>8K27A</td><td>TCTATCTACTCTCCCCGTCTTATCCTCCCTTCTTCTCACTCC (SEQ ID NO; _)</td><td>1848</td>

<td></td><td>8K27B</td><td>TACCTTCTCCTCATCCTCCACCGCCTCTCATCATCTTCCC [SEQ ID NO; _)</td><td>1849</td>

<td></td><td>8K-F</td><td>CτTCCCCCATA^.rCTACCAACTTTTCTCΘATAβ (SEQ ID NO; _)</td><td>1851</td>

- 177 -

<td></td><td>8K-R</td><td>GTTGTTTGTCGACTAAA1CGTCG3TCGOAACCAGCCAC (SEQ ID WO: _)</td><td>1852</td>

<td></td><td>KIT CODK948X</td><td>GTTCTTGTCGACTATTTCTGACGGTTCGGAGAGC (SEQ ID NO: _)</td><td>3411</td>

Ρ1332.Ν6 BI PTP KIT Μ552-Κ948-Χ COD taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatgtacgaa

MGHHHHHHMYE gttcagtggaaagttgttggaag ^ a ^ s ^ t ^ c ^ c ^ c ^ C ^ ^ ^ t ^; ^ e ^ c ^^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ i ^ i ^^L^ iacatcgacccgacc

VQWKVVEEINGNNYVYIDPT cagctgccgtacgaccacaaatgggagttcccgcgtaaccgtctgtctttcggtaaaacc

QLPYDHKWEFPRNRLSFGKT ctgggtgcgggtgcgttcggtaaagttgttgaagcgaccgcgtacggtctgatcaaatct

LGAGAFGKVVEATAYGLIKS gacgcggcgatgaccgttgcggttaaaatgctgaaaccgtctgcgcacctgaccgaacgt

DAAMTVAVKMLKPSAHLTER gaagcgctgatgtctgaactgaaagttctgtcttacctgggtaaccacatgaacatcgtt

EALMSELKVLSYLGNHMNIV aacctgctgggtgcgtgcaccatcggtggtccgaccctggttatcaccgaatactgctgc

NLLGACTIGGPTLVITEYCC tacggtgacctgctgaacttcctgcgtcgtaaacgfcgactctttcatctgctctaaacag

YGDLLNFLRRKRDSFICSKQ gaagaccacgcggaagcggcgctgtacaaaaacctgctgcactctaaagaatcttcttgc

EDHAEAALYKNLLHSKES SC tctgactctaccaacgaatacatggacatgaaaccgggtgtttcttacgfctgttccgacc

SDSTNEYMDMKPGVSYVVPT aaagcggacaaacgtcgttctgttcgtatcggttcttacatcgaacgtgacgttaccccg

KADKRRSVRIGSYIERDVTP gcgatcatggaagacgacgaactggcgctggacctggaagacctgctgtctttctcttac

AIMEDDELALDLEDLLS FSY caggttgcgaaaggtatggcgttcctggcgtctaaaaactgcatccaccgtgacctggcg

QVAKGMAFLASKNCIHRDLA gcgcgtaacatcctgctgacccacggtcgtatcaccaaaatctgcgacttcggtctggcg

ARNILLTHGRITKICDFGLA cgtgacatcaaaaacgactctaactacgttgttaaaggtaacgcgcgtctgccggttaaa

RDIKNDSNYVVKGNARLPVK tggatggcgccggaatctatcttcaactgcgtttacaccttcgaatctgacgtttggtct

WMAPESIFNCVYTFESDVWS tacggtatcttcctgtgggaactgttctctctgggttcttctccgtacccgggtatgccg

YGIFLWELFSLGSSPYPGMP gtfcgactctaaattctacaaaatgatcaaagaaggtttccgtatgctgtctccggaacac

VDSKFYKMIKEGFRMLSPEH gcgccggcggaaatgtacgacatcatgaaaacctgctgggacgcggacccgctgaaacgt

APAEMYDIMKTCWDADPLKR ccgaccttcaaacagatcgttcagctgatcgaaaaaeagatctctgaatctaccaaccac

PTFKQIVQLIEKQISESTNH atctactctaacctggcgaactgctctccgaaccgtcagaaatagtcgactgaaaaagga

IYSNLANCSPN RQK- ISEQ ID NO:) agagt (seq id ioo:)

- 178 Met

PCR primers [0293]

<td>UNDERWORLD</td><td>G1056</td><td>CATCCTACATATGGGGGACTCTOATATATCCAGTC (SEQ ID NO: _)</td><td>1223</td>

<td></td><td>G-1364</td><td>CTAGCAGGTCSACTACCCAATGAAAGTAGAGAAGATCGC (SEQ ID NO: _}</td><td>1318</td>

P1818.pETN6 BI-PTP MET G1056-G1364-X WT taatacgactcactataggggaattgtgagcggataacaattcccctctagaaafcaattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatgggggac

MGHHHHHHMGD tctgatatatccagtccattactgcaaaatactgtccacattgacctcagtgctctaaat

SDISSPLLQNTVHIDLSALN ccagagctggtccaggcagtgcagcatgtagtgattgggcccagtagcctgattgtgcat PELVQAVQHVVIGPSSLIVH ttcaatgaagtcataggaagagggcattfctggttgtgtatatcatgggactttgttggac FNEVIGRGHFGCVYHGTLLD aatgatggcaagaaaattcactgtgctgtgaaatccttgaacagaatcactgacatagga NDGKKIHCAVKSLNRITDIG gaagtttcccaatttctgaccgagggaatcatcatgaaagattttagtcatcccaatgtc EVSQFLTEGI IMKDFSHPNV ctctcgctcctgggaatctgcctgcgaagtgaagggtctccgctggtggtcctaccatac LSLLGICLRSEGSPLVVLPY atgaaacatggagatcttcgaaatttcattcgaaatgagactcataatccaactgtaaaa MKHGDLRNFIRNETHNPTVK gatcttattggctttggtcttcaagtagccaaaggcatgaaatatcttgcaagcaaaaag DLIGFGLQVAKGMKYLASKK tttgtccacagagacttggctgcaagaaactgtatgctggatgaaaaattcacagtcaag FVHRDLAARNCMLDEKFTVK gttgctgattttggtcttgccagagacatgtatgataaagaatactatagtgtacacaac VADFGLARDMYDKEYYSVHN aaaacaggtgcaaagctgccagtgaagtggatggctttggaaagtctgcaaactcaaaag KTGAKLPVKWMALESLQTQKfcttaccaccaagtcagatgtgtggtcctttggcgtgctcctctgggagctgatgacaaga FTTKSDVWSFGVLLWELMTR ggagccccaccttatcctgatgtaaacacctttgatataactgtttacttgttgcaaggg GAPPYPDVNTFDITVYLLQG agaagactcctacaacccgaatactgcccagaccccttafcatgaagtaatgctaaaatgc RRLLQPEYCPDPLYEVMLKC tggcaccctaaagccgaaatgcgcccatcettttctgaactggtgtcccggatatcagcg WHPKAEMRPSFSELVSEI atcttctctactttcattgggtagtcgac SA (SBO id no;)

IFSTFIG- (SEQ ID NO:) p38

PCR primers

- 179 [0294]

<td>p38</td><td>P38-S</td><td>CCGGATCCATATGTCTCAGGAGAGGCCCAC (SEQ ID NO: _)</td><td>253</td>

<td></td><td>P38-A</td><td>GAAACCCTCGAGTCAGGACTCCATCTCTTCTTG (SEQ ID NO: _]</td><td>254</td>

Ρ4292.pET15S P38A Μ1-5360-Χ MKK6DD taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatatatcatcatgggcagcagccatcatcatcatcatcacagc

MGSSHHHHHHS agcggcctggtgccgcgcggcagccatatgtctcaggagaggcccacgttctaccggcag

SGLVPRGSHMSQERPTFYRQ gagctgaacaagacaatctgggaggtgcccgagcgttaccagaacctgtctccagtgggc ELNKT IWEVPERYQNLSPVG tctggcgcctatggctctgtgtgtgctgcttttgacacaaaaacggggttacgtgtggca SGAYGSVCAAFDTKTGLRVA gtgaagaagctctccagaccatttcagtccatcattcatgcgaaaagaacctacagagaa VKKLSRPFQSIIHAKRTYRE ctgcggttacttaaacacatgaaacatgaaaatgtgattggtctgEtggacgtttttaca LRLLKHMKHENVIGLLDVFT cctgcaaggtctctggaggaattcaatgatgtgtatctggtgacccatctcatgggggca PARSLEEFNDVYLVTHLMGA gatctgaacaacattgtgaaatgtcagaagcttacagatgaccatgttcagttccttatc DLNNIVKCQKLTDDHVQFLI Łaccaaattctccgaggtctaaagtatatacattcagctgacataattcacagggaccta YQILRGLKYIHSADIIHRDL aaacctagtaatctagctgtgaatgaagactgtgagctgaagattctggattttggactg KPSNLAVNEDCELKILDFGL gctcggcacacagatgatgaaatgacaggcta 'cgtggccactaggtggtacagggctcct ARHTDDEMTGYVATRWYRAP gagafccatgctgaactggatgcattacaaccagacagttgatatttggtcagtgggatgc EIMLNWMHYNQTVDIWSVGC ataatggccgagctgttgactggaagaacattgtttcctggtacagaccatattgatcag IMAELLTGRTLFPGTDHIDQ ttgaagcteattttaagactcgttggaaccccaggggctgagcttttgaagaaaatctcc LKLILRLVGTPGAELLKKIS tcagagtctgcaagaaactatattcagtctttgactcagatgccgaagatgaactfctgcg SESARNYIQSLTQMPKMNFA aatgtatttattggtgccaatcccctggctgtcgacttgcfcggagaagatgcttgtattg NVFIGANPLAVDLLEKMLVL gactcagataagagaattacagcggcccaagcccttgcacatgcctactttgctcagtac DSDKRITAAQALAHAYFAQY cacgatcctgatgatgaaccagtggccgatccttatgatcagtcctttgaaagcagggac HDPDDEPVADPYDQSFESRD ctccttatagatgagtggaaaagcctgacctatgatgaagtcatcagctttgtgccacca LLIDEWKSLTYDEVISFVPP ccccttgaccaagaagagatggagtcctgactcgac (SEQ ID Ho. pLDCEEMES} - (SEQ ID NO: _)_)_)_)_)_)_)

Piml

- 180 PCR primers [0295]

<td>PIM1</td><td>PIM-1S</td><td>GCTGGCGCATATGAAGGAGAAGGAGCCCCTGGAG (SEQ ID NO: _i</td><td>233</td>

<td></td><td>PIM-1A</td><td>GAAAGGGTCGACTITGCTGGGCCCCGGCGACAG (SBQ ID NO: _i</td><td>234</td>

P121S-pET29SRI PIM1 E29-K313 HIS WT agatcgatctcgatcccgcgaaattaatacgaGtcactataggggaatfcgtgagcggataa caattcccctctagaaataattttgtttaactttaagaaggagatatatatatgaaggag

Μ KE aaggagcccctggagtcgcagtaccaggtgggcccgctactgggcagcggcggcttcggc

KEPLESQYQVGPLLGSGGFG tcggtcfcactcaggcatccgcgtctccgacaacttgccggtggccatcaaacacgtggag

SVYSGIRVSDNLPVAIXHVE aaggaccggatttccgactggggagagctgcctaatggcactcgagtgcccatggaagtg

KDRISDWGELPNGTRVPMEV gtcctgctgaagaaggtgagctcgggtttctccggcgtcattaggctcctggactggttc

VLLKKVSSGFSGVIRLLDWF gagaggcccgacagtttcgtcctgatcctggagaggcccgagccggtgcaagatctcttc

ERPDSFVLILERPEPVQDLF gacttcatcacggaaaggggagccctgcaagaggagctggcccgcagcttcttctggcag

DFITERGALQEELARSFFWQ gtgctggaggccgtgcggcactgccacaactgcggggtgctccaccgcgacatcaaggac

VLEAVRHCHNCGVLHRDIKD gaaaacatccttatcgacctcaatcgcggcgagcteaagctcatcgacttcgggtcgggg

ENILIDLNRGELKLIDFGSG gcgctgctcaaggacaccgtctacacggacttcgatgggacccgagtgtatagccctcca

ALLKDTVYTDFDGTRVYSPP gagtggatccgctaccatcgctaccatggcaggtcggcggcagtctggtccctggggatc

EWIRYHRYHGRSAAVWSLGI ctgctgtatgatatggtgfcgtggagatattcctttcgagcatgacgaagagatcatcagg

LLYDMVCGDIPFEHDEEIIR ggccaggttttcttcaggcagagggtctcttcagaatgtcagcatctcattagatggtgc

GQVFFRQRVSSECQHLIRWC ttggccctgagaccatcagataggccaaccttcgaagaaatccagaaccatccatggatg

LALRPSDRPTFEEIQNHPWM caagatgttctcctgccccaggaaactgctgagatccacctccacagcctgtcgccgggg

QDVLLPQETAEIHLHSLSPG cccagcaaagfccgaccaccaccaccaccaccactgagatccggctgctaacaaagcccga PSKVDHHHKHH- (seq id NO:) aaggaattcgagttggctgctgccaccgctgagcaataactagcataaccccfctggggcc tctaaacgggtcttgaggggttttttg (seq id no:)

Ret

PCR primers [0296]

- 181 -

<td>RET</td><td>RETH661</td><td>GTTCTTCATATGCACAAGTTTGCCCACAAG-CCA (SEQ ID NO: _)</td><td>2184</td>

<td></td><td>RE-1012-HIS</td><td>gttcttgtcgaccctcttaaccatcatcttctccaggtct (SBQ ID NO: _)</td><td>2431</td>

P1378.pET-SF BI-PTP RET H661-R1012 HIS taatacgactcactataggggatgcgtgagcggataacaattcccctcta gaaataatttt gtttaactttaagaaggagatatacatatgcacaagtttgcccacaagccacccatctcc

MHKFAHKPPIS tcagctgagatgaccttccggaggcccgcccaggccttcccggtcagctactcctcttcc

SAEMTFRRPAQAFPVSYSSS ggtgcccgccggccctcgctggactccatggagaaccaggtctccgtggatgccttcaag

GARRPSLDSMENQVSVDAFK atcctggaggatccaaagtgggaattccctcggaagaacttggttcttggaaaaactcta

ILEDPKWEFPRKNLVLGKTL ggagaaggcgaatttggaaaagtggrtcaaggcaacggccttccatctgaaaggcagagca

GEGEFGKVVKATAFHLKGRA gggtacaccacggtggccgtgaagatgctgaaagagaacgcctccccgagtgagcttcga

GYTTVAVKMLKENAS PS ELR gacctgctgtcagagttcaacgtcctgaagcaggtcaaccacccacatgtcatcaaattg

DLLSEFNVLKQVNHPHVIKL tatggggcctgcagccaggatggcccgctcctcctcatcgtggagtacgccaaatacggc

YGACSQDGPLLLIVEYAKYG tccctgcggggcttcctccgcgagagccgcaaagtggggcctggctacctgggcagtgga

SLRGFLRESRKVGPGYLGSG ggcagccgcaactccagctccctggaccacccggatgagcgggccctcaccatgggcgac

GSRHSSSLDHPDERALTMGD ctcatctcatttgcctggcagatctcacaggggatgcagtatctggccgagatgaagctc

LISFAWQISQGMQYLAEMK gttcatcgggacttggcagccagaaacatcctggtagctgagggggggagaggaagagga

VHRDLAARNILVAEGRKMKI tcggatttcggcttgtcccgagatgtttatgaagaggattcctacgtgaagaggagccag

SDFGLSRDVYEEDSYVKRSQ ggtcggattccagttaaatggatggcaattgaatccctttttgatcatatctacaccacg

GRIPVKWMAIESLFDHIYTT caaagtgatgtatggtcttttggtgtcctgctgtgggagafccgtgaccctagggggaaac

QSDVWSFGVLLWEIVTLGGN ccctatcctgggattcctcctgagcggctcttcaaccttctgagaacgaccggccaccggatg

PYPGIPPERLFNLLKTGHRM gagaggccagacaactgcagcgaggagatgtaccgcctgatgctgcaatgctggaagcag

ERPDNCSEEM YRLMLQCWKQ - gagccggacaaaaggccggt gt 11 gcggacat cagcaaagacc tggagaaga t gatggt t

EPDKRPVFADISKDLEKMMV aagagggtcgaccaccaccaccaccaccactgagatccggctggccctactggccgaaag

KRVDHHHHHH- (SBQ ID NO: _>

gaattcgaggccagcagggccaccgctgagcaataactagcataaccccttggggcctct aaacgggtcttgaggggttttttg (seq id no:)

src

PCR primers [0297]

- 182 -

<td>SRC-86</td><td>GCTGGCCCATATGGTGACCACCTTTGTGGCCCT (SEQ ID NO: _)</td><td>1452</td>

<td>SRC-452 (L536)</td><td>GCTACTAGTCGACCTAGAGGTTCTCCCCSGGCT (SBQ ID NO: _)</td><td>1453</td>

Ρ1144. ρΕΤ-Ν6 ΒΙ-ΡΤΡ SRC V86-L536-X taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatggtgacc

MGHHHHHHMVT acctttgtggccctctatgactatgagtctaggacggagacagacctgtccttcaagaaa

TFVALYDYESRTETDLSFKK ggcgagcggctccagattgtcaacaacacagagggagactggtggctggcccactcgctc GERLQIVNHTEGDWWLAHSL agcacaggacagacaggctacatccccagcaactacgtggcgccctccgactccatccag STGQTGYIPSNYVAPSDSIQ gctgaggagtggtattttggcaagatcaccagacgggagtcagagcggttactgctcaat AEEWYFGKI TRRESERLLLK gcagagaacccgagagggaccttccfccgtgcgagaaagtgagaccacgaaaggtgcctac AEKPRGTFLVRESETTKGAY tgcctctcagtgtctgactfccgacaacgccaagggcctcaacgtgaagcactacaagatc CLSVSDFDNAKGLNVKHYKI cgcaagctggacagcggcggcfctctacatcacctcccgcucccagttcaacagcctgcag RKLDSGGFYITSRTQFNSLQ cagcfcggtggcctactactccaaacacgccgatggcctgtgccaccgcctcaccaccgtg QLV AYYSKHADGLCHRLTTV tgccccacgtccaagccgcagactcagggcctggccaaggatgcctgggagatccctcgg CPTSKPQTQGLAKDAWEIPR gagtcgctgcggctggagcg:caagctgggccagggctgctttggcgaggtgtggatgggg ESLRLEVKLGQGCFGEVWKG acctggaacggtaccaccagggtggccatcaaaaccctgaagcctggcacgatgtctcca TWNGTTRVAIKTLKPGTMSP gaggccttcctgcaggaggcccaggtcatgaagaagctgaggcatgagaagctggtgcag EAFLQEAQVMKKLRHEKLVQ ttgtatgctgtggtttcagaggagcccatttacatcgtcacggagtacatgagcaagggg LYAVVSEEPIYIVTEYMSKG agtttgctggactttctcaagggggagacaggcaagtacctgcggctgcctcagctggrtg SLLDFLKGETGKYLRLPQLV gacatggctgctcagatcgcctcaggcatggcgtacgtggagcggatgaactacgtccac DMAAQIASGMAYVERMNYVH cgggaccttcgtgcagccaacatcctggtgggagagaacctggtgtgcaaagtggccgac RDLRAANI LVGENLVCKVAD tttgggctggctcggctcattgaagacaatgagtacacggcgcggcaaggtgccaaattc FGLARLI EDNEYTARQGAKF cccatcaagtggacggctccagaagctgccctctatggccgcttcaccatcaagtcggac PIKWTAPEAALYGRFTI KSD gtgtggtccttcgggatcctgctgactgagctcaccacaaagggacgggtgccctaccct VWSFGILLTELTTKGRVPYPgggatggtgaaccgcgaggtgctggaccaggtggagcggggctaccggatgccctgcccg GMVNREVLDQVERGYRKPCP ccggagtgtcccgagtccctgcacgacctcatgtgccagtgctggcggaaggagcctgag PECPESLHDLMCQCWRKEPE

- 183 gagcggcccaccttcgagtacctgcaggccttcctggaggactacttcacgtccaccgag ERPTFEYLQAFLEDYFTS ΓΕ ccccagtaccagcccggggagaacctctggccgacgaaggagatatce (seq id no: _)

PQYQPGENL- (SEQ ID NO: _)

Zap70

PCR primers [0298]

<td>ZAP70</td><td>ZAP70-D327-N-BamHI</td><td>AGAGGGATCCGCCACCATGGACAAGAAGCTCTTCCTGAA (SEO ID NO: _)</td><td>5172</td>

<td></td><td>ZAP70-HIS-G606</td><td>ACGAATTCTAGTGGTGGTGGTGGTGGTGGTGCCCTTCCACCT TGCTG (SEQ ID NO: _)</td><td>5171</td>

P1868.pFastBacl ZAP70 D327-G60S HIS, WT agatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgtttt cgtaacagttttgtaataaaaaaaacctataaatattccggattattcataccgtcccacc atcgggcgcggatccgccaccatggacaagaagctcttcctgaagcgcgataacctcctc

MDKKLFLKRDNLL atagctgacattgaacttggctgcggcaactttggctcagtgcgccagggcgtgtaccgc

IADIELGCGNFGSVRQGVYR atgcgcaagaagcagatcgacgtggccatcaaggtgctgaagcagggcacggagaaggca

MRKKQIDVAIKVLKQGTEKA gacacggaagagatgatgcgcgaggcgcagatcatgcaccagctggacaacccctacatc

DTEEMMREAQIMHQLDNPYI gtgcggctcattggcgtctgccaggccgaggccctcatgctggtcatggagatggctggg

VRLIGVCQAEALMLVMEMAG ggcgggccgctgcacaagttcctggtcggcaagagggaggagatccctgtgagcaatgtg

GGPLHKFLVGKREEIPVSNV gccgagctgctgcaccaggtgtccatggggatgaagtacctggagagaagaactttgtg

AELLHQVfiMGMKYLEEKNFV caccgtgacctggcggcccgcaacgtcctgctggttaaccggcactacgccaagatcagc

HRDLAARNVLLVNRHYAKIS gactttggcctctccaaagcactgggtgccgacgacagctactacactgcccgctcagca

DFGLSKALGADDSYYTARSA gggaagtggccgctcaagtggtacgcacccgaatgcafccaacttccgcaagttctccagc

GKWPLKWYAPECINFRKFSS cgcagcgatgtctggagctatggggtcaccatgtgggaggccttgtcctacggccagaag

RSDVWSYGVTMWEALSYGQK ccctacaagaagatgaaagggccggaggtcatggccttcatcgagcagggcaagcggatg

PYKKMKGPEVMAFIEQGKRM gaatgcccaccagagtgtccacccgaactgtacgcactcatgagtgactgctggatctac

ECPPECPPELYALMSDCWIY aagtgggaggatcgccccgacttcctgaccgtggagcagcgcatgcgagcctgttactac

KWEDRPDFLTVEQRMRACYY agcctggccagcaaggtggaagggcaccaccaccaccaccaccactagaattc (seq id no: _

SLASKVEGHHHHHHH- £ SEQ ID NO: _)

Substrate BAD

- 184 PCR primers [0299]

<td>BAD</td><td>BAD-N</td><td>GTTGTGACATATGTTCCAGATCCCAGAGCTTG (SEQ ID NO: _)</td><td>1613</td>

<td></td><td>BAD-S</td><td>3TTGTGAGTCOACTCACTGGGAGGGGGCGGA (SEQ ID NO: _}</td><td>1614</td>

P963.pET-BH BAD Ml-Q168-X tacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgt ttaactttaagaaggagatataccatggctggttgcctgaacgacatcttcgaagctcag

MAGCLNDIFEAQ aaaatcgaatggcaccatcaccatcaccatatgttccagatcccagagtttgagccgagt

KIEWHHHHHHMFQIPEFEPS gagcaggaagactccagctctgcagagaggggcctgggccccagccccgcaggggacggg

BQEDSSSAERGLGPSPAGDG ccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac

PSGSGKHHRQAPGLLWDASH cagcaggagcagccaaccagcagcagccatcatggaggcgctggggctgtggagatccgg

QQEQPTSSSHHGGAGAVEIR agfccgccacagctcctaccccgcggggacggaggacgacgaagggafcgggggaggagccc

SRHSSYPAGTEDDEGMGEEP agcccctttcggggccgctcgcgctcggcgcccccaacctctgggcagcacagogctat

SPFRGRSRSAPPNLWAAQRY ggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcct

GRELRRMSDEFVDSFKKGLP cgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtc

RPKSAGTATQMRQSSSWTRV ttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgagtc

FQSWWDRNLGRGSSAPSQ gaccaccaccaccaccaccactgagatccggctggccctactggccgaaaggaattcgag gccagcagggccaccgctgagcaataactagcataaccccttggggcctctaaacgggtc ttgaggggttttttg (seq id no: _>

(polypeptide SEQ ID NO: _)

MEK 1 substrate

PCR primers [0300]

<td>MSK1</td><td>MEK1-S</td><td>CGGGTCCCATATGCCCAAGAAGAACCCGAC (SEQ ID NO: _)</td><td>755</td>

<td></td><td>MEK-HIS</td><td>GTTCGTTGTCGACGACGCCAGCAGCATGGGTTG (SEQ ID NO: _)</td><td>2127</td>

<td></td><td>K97A-1 (KI 04 A)</td><td>CTAATTCATCTGGAGATCGCGCCCGCAATCCGG (SEQ ID NO: _)</td><td>2023</td>

<td></td><td>K97A2 (K104)</td><td>CCGGATTGCGGGCGCGATCTCCAGATGAATTAG (SEQ ID NO: _)</td><td>2024</td>

- 185 Ρ1277.pGEX-BIO SUFFERINGS K97A atgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttctt MSPILGYWKIKGLVQFTRLL ttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgafcgaaggtgataaa LEYLEEKYEEHLYERDEGDK tggcgaaacaaaaagtttgaattgggtfctggagtttcccaatcttccttattatattgat WRNKKFELGLEFPNLPYYID ggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaac GDVKLTQSMAI IRYIADKHN atgttgggtggttgtccaaaagagcgtgcagagafcttcaatgcfctgaaggagcggttttg MLGGCPKERAEISMLEGAVL gatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagtt DIRYGVSRIAYSKDFETLKV gattttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcataaa DFLSKLPEMLKMFEDRLCHK acatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgat TYLNGDHVTHPDFMLYDALD gttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaa VVLYMDPMCLDAFPKLVCFK aaacgtatfcgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagca KRIEAIPQIDKYLKSSKYIAtggcctttgcagggctggcaagccacgtttggtggtggcgaccatcctccaaaatcggat WPLQGWQATFGGGDHPPKSD ctggttccgcgtggatctcatatgcccaagaagaagccgacgcccatccagctgaacccg LVPRGSHMPKKKPTPIQLNP gcccccgacggctctgcag-ttaacgggaccagctctgcggagaccaacttggaggccttg APDGSAVNGTSSAETNLEAL cagaagaagctggag-gagctagagcttgatgagcagcagcgaaagcgccttgaggccttt QKKLEELELDEQQRKRLEAF cttacccagaagcagaaggtgggagaactgaaggatgacgactttgagaagatcagtgag LTQKQKVGELKDDDFEKISE ctgggggc.tggcaatggcggtgtggtgttcaaggtctcccacaagccttctggcctggta LG AGN _GGVVFKVSHKP SGLV atggccagagcgctaattcatctggagatcaaacccgcaatccggaaccagatcafcaagg MARALIHLEIKPAIRMQIIR gagctgcaggttctgcatgagtgcaactctccgtacatcgtgggcttctatggtgcgttc ELQVLHECNSPYIVGFYGAF tacagcgatggcgagatcagtatctgcatggagcacatggatggaggttctctggatcaa YSDGEIS ICMEHMDGGSLDQ gtcctgaagaaagctggaagaatfccctgaacaaattfctaggaaaagttagcattgctgta vlkkagrifeqilgkvsiavtggcaatggcggtgtggtgttcaaggtctcccacaagccttctggcctggta LG AGN _GGVVFKVSHKP SGLV atggccagagcgctaattcatctggagatcaaacccgcaatccggaaccagatcafcaagg MARALIHLEIKPAIRMQIIR gagctgcaggttctgcatgagtgcaactctccgtacatcgtgggcttctatggtgcgttc ELQVLHECNSPYIVGFYGAF tacagcgatggcgagatcagtatctgcatggagcacatggatggaggttctctggatcaa YSDGEIS ICMEHMDGGSLDQ gtcctgaagaaagctggaagaatfccctgaacaaattfctaggaaaagttagcattgctgta vlkkagrifeqilgkvsiav

- 186 ataaaaggcctgacatatctgagggagaagcacaagatcatgcacagagatgtcaagccc I KGLTYLREKHKIMHRDVKP tccaacatcctagtcaactcccgtggggagatcaagctctgtgactttggggtcagcggg

SNILVNSRGEIKLCDFGVSG cagctcatcgactccatggccaactccttcgtgggcacaaggtcctacatgtcgccagaa

QLIESMANSFVGTRSYMSPE agactccagggactcattactctgtgcagtcagacatctggagcatgggactgtctctg

RLQGTHYSVQSDIWSMGIiSL gtagagatggcggttgggaggtatcccatccctcctccagatgccaaggagctggagctg

VEMAVGRYPIPPPDAKELEL atgtttgggtgccaggtggaaggagatgcggctgagaccccacccaggccaaggaccccc

MFGCQVEGDAAETPPRPRTP gggaggccccttagctcatacggaatggacagccgacctcccatggcaatttttgagttg grplssygmdsrppmaifel ttggattacatagtcaacgagcctcctccaaaactgcccagtggagtgttcagtctggaa

LDYIVNEPPPKLPSGVFSLE tttcaagattttgtgaataaatgcttaataaaaaaccccgcagagagagcagatttgaag FQDFVt! CLI E '' caactcatggttcatgcttttatcaagagatctgatgctgaggaagtggattttgcaggt

QL.MVHAFIKRSDAEEVDFAG tggctctgctccaccatcggccttaaccagcccagcacaccaacocatgctgctggcgtc

WLCSTIGLNQPSTPTHAAGV gtcgacctgaacgacatcttcgaagctcagaaaatcgaatggcaccgttagaattc VDLHDIFEAQKIEWHR- (SBQ ID NO: _) (nucleic acid SEQ ID NO: _)

Example 27: Efficacy of compounds in combination with standard quality chemotherapeutic agents in four human tumor cell lines.

[0301] Compounds of the invention, such as compounds of formula III, in combination with a standard chemotherapeutic agent such as 5-fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel, SN-38, temozolomide or vinblastine, can be evaluated for efficacy in killing human cancer cells. Such human tumor cell lines as A-375 (malignant melanoma), SK-MEL-2 (malignant melanoma, skin metastasis), COLO 205 (colorectal cancer, ascites) or SW-620 (colorectal cancer, nodal metastases) absorbent) can be treated with the compound of formula III alone or in combination with one of the aforementioned chemotherapeutic agents.

[0302] Tumor cells are grown as a monolayer at 37 ° C in a humidified atmosphere (5% CO2, 95% air). The cells are grown on an appropriate medium, for example RPMI1640 (Ref BE12-702F, Cambrex, Verviers, Belgium), containing 2 mM L-glutamine and enriched with 10% fetal bovine serum (FBS, Ref DE14-801E, Cambrex). For the purposes of the experiment, tumor cells are excreted from the culture flask for 5 minutes by treatment with trypsin-verene (Ref 02-007E, Cambrex), dissolved in Hanks solution without calcium or magnesium (Ref BE10-543F, Cambrex). The tryptic processing agent is neutralized by the addition of nutrient medium. The cells are counted in a hemometer and their food is evaluated by means of the Trypan blue exclusion 0.25%. Cell lines are checked for mycoplasma contamination using the Mycotect test kit (Ref 15672- 187 017, Invitrogen, Cergy-Pontoise, France) according to the manufacturer's instructions. The mycoplasma test is performed from culture supernatants and its results are compared with a negative and positive control result.

[0303] Tumor cells (10,000 per sample) are placed in 96-well flat-bottomed microtiter plates (Ref 055260, Nunc, Dutscher, Brumath, France) and incubated at 37 ° C for 24 h and then treated with 100 μΐ of medium lacking drugs enriched with 10% FBS. To determine the IC50 of individual compounds to be used for particular cell lines, tumor cells are incubated in 200 μΐ of a final volume of RPMI1640 supplemented with 10% FBS and containing either a compound of formula III or one compound of the group: fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel, SN-38, temozolomide or vinblastine. The compounds are tested in the appropriate concentration range, such as from 10 to 10⁷ M for a compound of formula III, 5-fluorouracil, dacarbazine or gefitinib, from 10 ⁷ up to 10 ⁷ M for carboplatin, oxaliplatin or temozolomide, from 10 ¹¹ up to 10-6 m for paclitaxel or SN-38 and from 10⁴⁵ up to 10 ¹⁷ M for vinblastine. Compounds of formula III are dissolved in DMSO and diluted with medium to the appropriate concentration. 5-fluorouracil (50 mg / ml, Dakota Pharm, LePlessis Robinson, France), carboplatin (10 mg / ml, Aguettant, Lyon, France) and paclitaxel (6 mg / ml, BristolMyers Squibb SpA, Rueil Malmaison, France) are diluted medium for the right concentration. Dacarbazine (Sigma, Saint Quentin Fallavier, France) and vinblastine (Lilly France

SA, Saint Cloud, France) are dissolved in NaCl 0.9% and diluted with medium to the appropriate concentration. Gefitinib is dissolved in the mixed solution of RPMI 1640 and DMSO, and diluted with medium to the appropriate concentration (maximum final DMSO concentration 0.1% by volume). SN-38 (LKT Laboratories, Inc., St. Paul, Minnesota) is dissolved in DMSO and diluted with medium to the appropriate concentration (maximum final DMSO concentration 0.1% by volume). Temozolomide (LKT Laboratories, Inc., St. Paul, Minnesota) is dissolved in water for injection and diluted with medium to the appropriate concentration. The cells are incubated for 96 h in the presence of test substances at 37 ° C in a 5% CO2 atmosphere. At the end of treatment, the cytotoxic activity is assessed using the MTT assay.

[0304] For the MTT assay, at the end of the cell treatment, 20 μl of a 5 mg / ml solution of 0.22 μιη of the filtered tetrazolium reagent (MTT, Ref M2128, Sigma) in phosphate buffered saline (PBS, Ref. BE17517Q, Cambrex). Culture plates are incubated for 2 h at 37 ° C. The resulting supernatant is removed and the formazan crystals are dissolved in 200 μl DMSO for each well on the plate. The absorbance (OD) is measured at 570 nm of the sample from each position using the VICTOR multifunction microplate reader³™ 1420 (Wallac, PerkinElmer, C ourtaboeuf, F roma).

[0305] The IC 50 for each compound on each cell line is determined from the OD measurements of each sample. Inhibition of cell proliferation depending on the dose

- 188 is expressed by the formula:

IC = (OD of treated cells / OD of drug-free wells) x 100.

The relationship between the mean of multiple measurements for each concentration and drug concentration is plotted. Dose-response curves are plotted using XLFit 3 (IDBS, United Kingdom). The IC50 values ​​determined (drug concentration required to achieve 50% inhibition of cell proliferation) are calculated using XLFit 3 from half-log curve curves. The IC50 value determined for each compound in each cell line is used to determine the concentration of compound of formula III and a standard chemotherapeutic that will be used in combination.

[0306] Cells are treated with a combination of five concentrations of a compound of formula III and five concentrations of one of the compounds: 5-fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel, SN-38, temozolomide or vinblastine, based on IC 50 results. Compounds and cells are treated by the IC50 assay described above and tested with the MTT assay.

[0307] The results are tested to determine whether a given synergistic or antagonistic combination. Drug interactions are calculated by analyzing the effects of multi-drug therapy and by the principle of the equation of the average therapeutic dose in accordance with the methodology described by Chou and Talalay (Adv. Enzyme Regulation 1984, 22: 27-55).

[0308] The combination index (CI) will be calculated from the Chou et al equation. (Adv. Enzyme Regul. 1984.22: 27-55; Encyclopedia of human biology, Academic Press, 1991, 2: 371-9; Synergism and Antagonism in Chemotherapy, Academic Press, 1991, 61-102), which takes into account both (D_m or IC50) as well as the shape of the dose-response curve (m-value). The general formula for CI of two compounds is:

_CJ (£>),) (£% (Ρ), (Ρ)₂ (DJ, (^). (^)₂ where:

(D_x) 1 and (D._x2 in denominators mean the doses (or concentrations) of compound 1 and compound 2 separately, giving x% inhibition, while (D) x and (D) 2 in the counters are the doses of both compounds (1 and 2) in the combination, which also give x % inhibition (are isoefficient). CI <1, = 1, and> 1 indicate synergy, additive effect and antagonism, respectively.

[0309] (Dx) 1 and (Dx) 2 can be calculated from the mean drug dose calculation of Chou et al. (J. Natl. Cancer Inst. 1994, 86: 1517-24):

- 189 where:

Dm is the average therapeutic dose obtained from the antigen of the intersection of the mean dose graph with the x axis, x = log (D) yersusy = log {fa / (1-fa)}, or D_m = io-^{(intersection of y) / m}; m is the slope of the average dose curve, and fa is the fraction of cells that are affected by the treatment.

Each CI value will be calculated using the CalcuSyn program (Biosoft, ZK) from the average fraction of cells experiencing treatment effect at each drug concentration ratio.

[0310] Additional examples. Unless specifically indicated otherwise, the numbering of formulas and numbering of the R groups used in the examples below are not related to the numerals used in the other sections of this application. The reagents and solvents used in these examples can be easily replaced with suitable replacements known in the art, and the isolation of the products is easily carried out by methods known in the art, such as, but not limited to, extraction, crystallization and chromatographic methods. The following formulas are defined for the following examples:

<img file="PL1893612T3_D0146.tif" />

where:

R⁴ and R⁵ they mean the same as in [0 (388);

r12, r13 and r16 are the same as in prime !; OCA]];

R²⁸ means sSO₂R²⁵, C (O) R^2S, -C - O) TR2²⁵, -C (= O) OR²⁵ , -C (= S) R²⁵ , (= S) NR25, C (S) -R25 or -S-2NR2⁵wherein R25 and R26 are hydrogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl or optionally substituted heteroaryl, or

R²⁵ and R²⁶ together with nitrogen form an optionally substituted 5-7 -terocycloalkyl or optionally substituted 5 or 7-nitrogen heteroaryl heteroaryl.

R2⁹ means the water of a woman, opjjalalniepodsawiony mżzzy alkl]; and r3o is a substitute for the alkyl substituent 1 or the substituted benzyl, where optionally substituted benzyl refers to optionally

A substituted aralkyl aryl with an unsubstituted CI11 phenyl fragment.

Example 28. Synthesis of a compound of formula II wherein Rⁿ and Ri⁶ means independently fluoro or chloro [0311]

<img file="PL1893612T3_D0147.tif" />

R13

III _R16

<img file="PL1893612T3_D0148.tif" />

^gdwith^ande ^r12and Ri6 means ^gdwith^ande ^r12and Ri6 means

F or CI

F or CI

Step 1- Synthesis of compound of formula II [0312] A compound of formula II wherein Rⁿ and R &amp; quot; is fluoro or chloro, can be obtained by reacting a compound of formula III with an organolithium reagent (e.g., n-butyl lithium, lithodiisopropylamine) in an inert solvent (e.g., THF) followed by the addition of a formylation reagent (e.g., DMF). The reaction is allowed to run normally at 78 ° C for 1-2 h, and the desired product is isolated by standard procedures (such as extraction, silica gel chromatography).

28 29

Example 29. Synthesis of a compound of formula III wherein R is NR R [0313]

<img file="PL1893612T3_D0149.tif" />

28 29

Step -1- Synthesis of a compound of formula III wherein R is NR R [0314] A compound of formula III wherein R is NR R can be obtained by reacting a compound of formula IV with a base (e.g., pyridine, sodium hydride) in an inert solvent (e.g., DMF, CH2O2) followed by a suitable reagent (R2⁵SO2Cl, e.g. propane-1-sulfonyl chloride; R2⁵C (= O) Cl, e.g. acetyl chloride; R2⁵NCO, e.g. isocyanate, pro^dustat; ^r25°^c(=^about)^C1, n^p. cMoromrówczanem^benz^ylat; ^{r26r25nsO2C1,} n^p. cMorkiem

- 191 -

<img file="PL1893612T3_D0150.tif" />

dimethylsulfamoyl). The reaction is allowed to run usually at room temperature for 8-12 h, and the desired product is isolated by standard procedures (such as silica gel chromatography and extraction).

Example 30. Synthesis of a compound of the Formula VIII [0315]

R²⁵ hn

-,^p

IX

Step 1- Synthesis of the Compound of Formula VIII [0316] The compound of Formula VIII is synthesized by reacting a compound of the Formula IX with a base (e.g., pyridine) in an inert solvent (e.g., CH2O2, and then sulfuryl chloride). The reaction is usually allowed to run under reflux for 8-12 h, and the desired product is isolated by standard procedures (such as evaporation).

Example 31. Synthesis of compounds of formula X

<img file="PL1893612T3_D0151.tif" />

Step 1- Preparation of Compounds of Formula XIIa and XIIb [0318] A suitable solvent (e.g., methanol) is added to compound of formula XVIII and compound of formula II followed by a suitable base (e.g., potassium hydroxide, sodium methoxide). The mixture is usually allowed to stir at room temperature overnight. Isolation by conventional means (such as extraction, washing and filtration) gives a mixture of compounds of formula XIIa and XIIb, which can be separated by silica gel chromatography if desired.

Step 2 Preparation of Compounds of Formula X [0319] A reducing agent (e.g., trifluoroacetic acid and triethylsilane) is added to a compound of formula XIIa or XIIb in a suitable solvent (e.g., acetonitrile). The mixture is usually allowed to stir at room temperature overnight. Isolation by conventional methods (such as silica gel column extraction and column chromatography) yields compounds of formula X.

Example 32. Synthesis of compounds of formula I

192 [0320]

<img file="PL1893612T3_D0152.tif" />

Step 1- Preparation of compounds of formula I:

[0321] An oxidant (e.g., Dess-Martin periodinane, TEMPO, DDQ) is added to the compound of formula XIIa in a suitable solvent (e.g. THF). The mixture is usually allowed to stir at room temperature for 20 minutes. Isolation by conventional methods (such as silica gel column extraction and column chromatography) gives compounds of formula L

Example 33. Synthesis of compounds of formula XIII, where Rⁿ and R1⁶ independently chlorine or fluorine [0322]

<img file="PL1893612T3_D0153.tif" />

F or Cl F or Cl

Step -1- Synthesis of the compound of formula XIII, where R¹² and R¹⁶ means chlorine or fluorine [0323] A compound of formula XIII, wherein R¹² and R "are chlorine or fluorine, synthesized by reacting a compound of formula XIV with an organolithium reagent (e.g., n-butyllithium) and a temporary protecting group (e.g., 1,2-bis- (chlorodimethylsilanyl) ethane) and DMF in an inert solvent (e.g. e.g. THF) under an inert atmosphere (e.g., argon) at 78 ° C for 2-4 h, and then removed with a temporary protecting group with an acid (e.g. 1N HCl). The product is isolated by extraction and silica gel column chromatography.

28

Example 34. Synthesis of compounds of formula XV wherein R is NBR [0324]

- 193 -

<img file="PL1893612T3_D0154.tif" />

Step 1- Synthesis of a Compound of Formula XVI [0325] A compound of Formula XVI can be obtained by reacting a compound of Formula XIII with a base (e.g., pyridine, sodium hydride) in an inert solvent (e.g., DMF, CH2Cl2), and then with a suitable reagent ( R²⁵SO2Cl, e.g. propane-1-sulfonyl chloride; R^25c(= O)^c1, n^p. chlortóem ace^backat^{; r25nc}°, n^p. isocyanate^pro^dustat^{; r25}°^c(= °)^c1, n^p. benzyl chloroformate; r2⁶r2⁵NS ° 2Cl, e.g. dimethylsulfamoyl chloride). The reaction is allowed to run usually at room temperature for 8-12 h, and the desired product is isolated by standard procedures (such as silica gel chromatography and extraction).

Step 2- Synthesis of a compound of formula XVII [0326] A compound of formula XVII can be obtained by hydrolyzing a compound of formula XVI in an aqueous base (e.g., sodium hydroxide) solution. The reaction is allowed to run normally under reflux for 8-12 h, and the desired product is isolated by standard procedures (such as extraction).

Step 3- Synthesis of a compound of formula XV wherein R¹³ means NHR²⁸ [0327] A compound of Formula XV wherein R¹³ means NHR2⁸, can be obtained by reacting a compound of Formula XVII with thionyl chloride. The reaction is allowed to run normally under reflux for 3 h, and the desired product is isolated by standard procedures (such as evaporation).

Example 35. Synthesis of compounds of formula XV [0328]

194 -

<img file="PL1893612T3_D0155.tif" />

Step 1- Synthesis of compound of formula XV [0329] A compound of formula XV may be prepared by reacting a compound of formula XIX with thionyl chloride. The reaction is allowed to run normally under reflux for 3 h, and the desired product is isolated by standard procedures (such as evaporation).

Example 36. Synthesis of compounds of formula I [0330]

<img file="PL1893612T3_D0156.tif" />

Step -1- Synthesis of a compound of formula I [0331] A compound of formula I is synthesized by reacting a compound of formula XVIII with a compound of formula XV (Example 83, e.g. benzoyl chloride) in the presence of a Lewis acid (e.g., aluminum chloride) inert solvent (e.g., dichloromethane) under an inert atmosphere (e.g., argon) at room temperature or with reflux for 1-18 h. The product is isolated by extraction and silica gel column chromatography. Example 37. Synthesis of compounds of formula I, wherein R⁵ is aryl or heteroaryl [0332]

<img file="PL1893612T3_D0157.tif" />

R⁵ means Br is aryl or heteroaryl

Step 1: Synthesis of a compound of formula I, wherein R⁵ is aryl or heteroaryl [0333] A compound of Formula I where R5 is aryl or heteroaryl is obtained by reaction

- 195 of a compound of formula I, wherein R⁵ means bromine, under Suzuki reaction conditions, with boronic acid (e.g., phenylboronic acid) in the presence of a base (e.g., potassium carbonate) and a catalyst (e.g., Pd (Ph3P) 4) in a water / THF solvent system. After 4-12 h of heating to 80 ° C or heating in a microwave at 120 ° C for 15 minutes, the product is isolated by standard working methods (such as silica gel column chromatography).

Example 38. Synthesis of compounds of formula I

<img file="PL1893612T3_D0158.tif" />

<img file="PL1893612T3_D0159.tif" />

[0335] The compound of Formula XX can be synthesized by reacting a compound of Formula XVIII with hexamethyltetraamine and acetic acid in water under reflux for two hours. The desired product precipitates upon cooling and can be isolated by filtration.

Step -2- Synthesis of Compound of Formula XXI [0336] A compound of Formula XXI, wherein P is a protecting group, is synthesized by reacting compound XX with a suitable reagent to introduce a protecting group (PX, e.g., triisopropylsilyl chloride) and a base (e.g. sodium hydride) in a solvent (e.g., THF) usually at room temperature for 8-12 h. The product is isolated by conventional methods (such as extraction).

Step -3- Synthesis of Compound of Formula XXII [0337] A compound of Formula XXII is synthesized by reacting a compound of Formula XXI in a solvent (e.g., THF) with an organolithium reagent (e.g., phenyl lithium) in a solvent (e.g., THF) under an inert atmosphere, cooled to 78 ° C. A suitable organolithium reagent can also be obtained by reacting compounds of formula III, wherein R¹² and R¹⁶are independently fluorine or chlorine, with an organolithium reagent (e.g. butyl lithium) in a solvent (e.g. THF) under an inert atmosphere, cooled to 78 ° C. Usually allows

- Warm the mixture to room temperature and stir for 30 minutes. The product is isolated by conventional methods (such as extraction).

Step -4- Synthesis of the intermediate of the compound of formula I [0338] An intermediate of the compound of formula I is synthesized by reacting a compound of formula XXII with a suitable reagent to remove the protective group, P, (e.g., tetra-n-butylammonium fluoride) in a suitable solvent (e.g. THF). The final product is isolated by standard procedures (such as extraction).

Step -5- Synthesis of compound of formula I [0339] A compound of formula I is synthesized by reacting an intermediate from step 4 with an oxidant (e.g., Dess-Martin periodinane, TEMPO) in an aprotic solvent (e.g., THF) usually at room temperature for 20 minutes. minutes. The product is isolated by conventional methods (such as extraction and silica gel chromatography).

Example 39. Synthesis of compounds of formula I, wherein R⁴ and R⁵ means hydrogen.

[0340]

<img file="PL1893612T3_D0160.tif" />

and R5 is Br and R⁵ H

Step 1- Preparation of compounds of formula I wherein R and R are hydrogen [0341] A compound of formula I where R4 and R⁵ is hydrogen, is synthesized by hydrogenation of a compound of formula I where R 4 is hydrogen and R 5 is bromine in the presence of a suitable solvent (e.g., methanol) and a catalyst (e.g., 10% Pd / C) in an atmosphere of hydrogen gas. The mixture is usually allowed to stir at room temperature for 812 h. Separation by conventional means (such as extraction, washing and filtration) gives compounds of formula I, where R4 and R5 are hydrogen.

Synthesis of a compound of formula Ia:

[0342] The compounds of formula Ia are compounds of formula XVIII, in which r4 is hydrogen and R5 is the only substituent on the backbone of the molecule. Exemplary schemes for the synthesis of groups of compounds of formula Ia are provided in examples 91 to 99 for different r5.

- 197 -

<img file="PL1893612T3_D0161.tif" />

Formula Ia

Example 40. Synthesis of compounds of formula Ia, where R⁵ means aryl or heteroaryl [0343]

<img file="PL1893612T3_D0162.tif" />

where R5 is aryl or heteroaryl [0344] A compound of formula la, wherein R5 is⁵ means aryl or heteroaryl, is synthesized from compound 1 under Suzuki conditions using aryl or heteroarylboronic acids (e.g., phenylboronic acid) in the presence of a base (e.g., potassium carbonate) and a catalyst (e.g., Pd (PPh3) 4) in a water system / THF with thermal heating (e.g., 80 ° C for 12 h) or microwave (e.g., 120 ° C for 15 minutes). The product is isolated by conventional methods (e.g., column chromatography on silica gel).

Example 41. Synthesis of compounds of formula Ia, wherein R5 is alkyl or cycloalkyl [0345]

<img file="PL1893612T3_D0163.tif" />

XXIII Formula Ia wherein R5 is alkyl or cycloalkyl

Step -1- Synthesis of a compound of formula XXIII [0346] A compound of formula XXIII, wherein P is a protecting group, is synthesized by reacting compound 1 with a base (e.g., sodium hydride) in a neutral solvent (e.g., THF), followed by a suitable reagent (PX, e.g. triisopropylsilyl chloride) to introduce a protecting group. The reaction is usually allowed to run at room temperature for 8-12 h, and the desired product is isolated by standard procedures (such as extraction) (Greene, TW; Wuts, P.GM. Protective Groups in Organic Synthesis I, 3rd ed .; John Wiley &amp; Sons: New York, 1981).

Step -2- Synthesis of intermediate of compound of formula la, wherein r5 is alkyl and cycloalkyl [0347] Intermediate of a compound of formula la, where R5 is alkyl or cycloalkyl, is synthesized in

- 198 -

<img file="PL1893612T3_D0164.tif" />

<img file="PL1893612T3_D0165.tif" />

reaction of a compound of formula XXIII with an alkyl or cycloalkyl Grignard reagent (e.g., ethyl magnesium bromide) in the presence of a catalyst (e.g., [1, r-bis (diphenylphosphino) phenocene] dichloropalladium (II) in an inert solvent (e.g., toluene) at low temperature ( e.g. 78 ° C) or under reflux for 2-8 hours. The product is isolated by standard procedures (such as silica gel column extraction and chromatography) as described in the literature (T. Hayashi, M. Konishi, Y Kobori, M. Kumada, T. Higuchi, K. Hirotsu, J. Am Chem. Soc. 1984, 106, 158-163).

Step -3- Synthesis of a compound of formula la, wherein R is alkyl and cycloalkyl [0348] A compound of formula Ia, wherein R is⁵ is alkyl or cycloalkyl, is synthesized by reacting an intermediate of the compound of Formula la from step 2 with a suitable reagent to remove a protecting group (e.g., tetrabutylammonium fluoride) in a suitable solvent (e.g., tetrahydrofuran). The product is isolated by standard procedures (such as silica gel column extraction and silica gel column chromatography).

22 23

Example 42. Synthesis of compounds of formula Ia, wherein R is NR R [0349] ^elaP¹ - _kl »

Stage 3 _?^etaP ² 22_R23_RN

XXIV Model Ia where R⁵ means NR²²R²³

Step -1- Synthesis of an intermediate of a compound of formula XXIV [0350] An intermediate of a compound of formula XXIV is synthesized by reacting a compound of formula XXIII with an amine of formula NHR2²r2³ (e.g., aniline) in a solvent (e.g., toluene), in the presence of a base (e.g., sodium tert-butoxide) and a catalyst consisting of metal (e.g., tris (dibenzylideneacetone) dipalladium (0)) and a ligand (e.g., tri-tert) -butylphosphine) with heating, usually up to 95 ° C, for 8-12 h as described (Thomas, et al., J. Am. Chem. Soc., 2001, 123, 9404) by substituting a compound of formula XXIII with N-substituted-3,6dibromokarbazol. The desired compound is purified by silica gel column chromatography. This intermediate is used directly in step 3 to obtain a compound of formula Ia, gUe^r5 means ^NR22R23, and ^{r22 and r23} Me mean. C (X)^r21, C (X) X^rI 4 &lt;¹⁸ S (O) 2 R 21, or S (O) 2 NR⁷Ri or alternatively can be additionally substituted as described in step 2.

Step -2- Synthesis of Compound of Formula XXIV [0351] Intermediate from step 1 can be further modified when R22 or R23 is hydrogen. In this case the intermediate from step 1 can be reacted with a base (e.g., sodium hydride) in a solvent (e.g. , Ν-dimethylformamide) followed by reaction with the reagent

Alkylating agent (e.g., benzyl bromide) or acylating reagent (e.g., benzoyl chloride, phenyl isothiocyanate, phenyl sulfonylchloride) at room temperature or with heating to 80 ° C for 1-12 h. The desired product can be purified by conventional methods (e.g., column chromatography on silica gel). Alternatively, when R²² or R²³ is a suitable protecting group (e.g., benzyl), can be removed by a suitable treatment (e.g., hydrogenation) to obtain a compound where R22 and / or R23 are hydrogen which is suitable for further modification with an alkylating reagent or an acylating reagent according to with the description in this application.

Step -3- Synthesis of a compound of formula Ia, wherein R is RRR [0352] A compound of formula Ia, wherein R⁵ is 21 [mu] -2 is synthesized by reacting a compound of formula XXIV with a suitable reagent to remove the protecting group (e.g., tetran-butylammonium fluoride) in a suitable solvent (e.g., methanol) The final product can be isolated by standard procedures (such as extraction).

Example 43. Synthesis of compounds of formula Ia, where R⁵ means C (O) NR2⁵r2⁶[0353]

<img file="PL1893612T3_D0166.tif" />

XXVIII. Model Ia ^gdwith^ande ^r5 means ^CONr25r26

Step -1- Synthesis of a compound of formula XXIII [0354] A compound of formula XIII, wherein P is a protecting group, is synthesized by reacting compound 1 with a base (e.g., sodium hydride) in a solvent (e.g., THF) followed by a suitable reagent. (PX, e.g. triisopropylsilyl chloride) to introduce a protecting group. The reaction is allowed to run normally at room temperature for 8-12 h, and the desired product is isolated by standard procedures (such as silica gel column extraction and column chromatography) (Greene, TW; Wuts, PGM Protective Groups in Organic Synthesis 1, 3rd ed .; John Wiley &amp; Sons: New York, 1981).

Step -2- Synthesis of Compound of Formula XXVI [0355] A compound of Formula XXVI can be prepared by reacting a compound of Formula XXIII with sodium cyanide in a polar aprotic solvent (e.g., DMF) under an inert atmosphere (e.g., argon) in the presence of a catalyst (e.g. or cuprous iodide

- 200 tris (dibenzylideneacetone) dipalladium (0)) according to the procedure described by Buchwald et. al., J.

Am. Chem. Soc., 2003, 125, 2890-289I, before substituting 5-bromo-7-azaindole for 5bromoindole.

Step -3- Synthesis of a compound of formula XXVII [0356] A compound of formula XXVII can be obtained by heating a compound of formula XXVI with an aqueous base (e.g., KOH) in the presence of an alcohol (e.g., ethanol) at a higher temperature (e.g., 90 ° C) ) for the required time, usually 24 hours, as described in Org. Son. Collective Volume 2, 292 (1943). Alternatively, compounds of formula XXVII can be obtained directly from a compound of formula XXIII by reacting a compound of formula XXIII with a strong base (e.g., n-butyllithium) and benzyl chloroformate in an inert solvent (e.g. THF), and further debenzylation by hydrogenating the benzyl ester obtained with hydrogen in the presence of a catalyst (e.g., 20% Pd (OH) 2 / C) at room temperature. The product can be isolated by filtration and evaporation.

Step -4 - Synthesis of a compound of formula XXVIII [0357] A compound of formula XXVIII can be obtained by reacting a compound of formula XXVII with an amine (e.g., benzylamine) in a polar aprotic solvent (e.g., DMF) under an inert atmosphere in the presence of an activator (e.g. PyBroP (bromotri (pyrrolidino) phosphonium hexafluorophosphate) according to the procedure described by Coste et al., J. Org. Chem., 1994, 59, 2437.

Step -5-Synthesis of a Compound of Formula Ia [0358] A compound of Formula la, wherein R⁵ means C (O) NR²⁵R²⁶, the cleavage of the protecting group (e.g., TIPS) of the compound of Formula XXVIII with the appropriate reagents (e.g., TBAF) and isolation of the product (e.g., by silica gel column chromatography and extraction) can be obtained.

Example 44. Synthesis of compounds of formula Ia, where R⁵ means CH2NHR2⁵r26

<img file="PL1893612T3_D0167.tif" />

XXX

Formula Ia where R⁵ means CHiNR2⁵r26

Step -1- Synthesis of a compound of formula XXIII [0360] A compound of formula XXIII, wherein P is a protective group, is synthesized by reacting compound 1 with a base (e.g., sodium hydride) in a solvent (e.g., THF), followed by a suitable reagent (PX, e.g. triisopropylsilyl chloride) to introduce a protecting group. The reaction is usually allowed to run at room temperature for 8-12 h, and the desired product is isolated by standard procedures (such as silica gel column extraction and column chromatography) (Greene, TW; Wuts, P.GM. Protective Groups in Organic Synthesis I, 3rd ed .; John Wiley &amp; Sons: New York, 1981).

Step -2- Synthesis of Compound of Formula XXVI [0361] A compound of Formula XXVI can be prepared by reacting a compound of formula with sodium cyanide in a polar aprotic solvent (e.g., DMF) under an inert atmosphere in the presence of a catalyst (e.g., tris (dibenzylideneacetone) dipalladium) (0) or cuprous iodide) according to the procedure described by Buchwald et. al., J Am. Chem. Soc., 2003, 125, 28902891, before substituting 5-bromo-7-azaindole for 5-bromoindole.

Step -3 - Synthesis of a Compound of Formula XXIX [0362] A compound of Formula XXIX can be synthesized from the compound of Formula XXVI under hydrogenation conditions using a catalyst (e.g., PtO2) under an H 2 atmosphere as described by Secrista III et. al., J Org. Chem., 1972, 40, 37, 335-336.

Step -4 - Synthesis of a compound of formula XXX [0363] A compound of formula XXX can be synthesized from a compound of formula XXIX with an electrophilic reagent (e.g., benzyl bromide, benzenesulfonyl chloride, benzoyl chloride, phenyl isothiocyanate, phenyl isothiocyanate) in a polar aprotic solvent (e.g. DIMLY) under an inert atmosphere in the presence of a base (e.g., K2CO3, Et3N). The product can be isolated by standard methods (such as aqueous workup and silica gel column chromatography).

Step -5 - Synthesis of a compound of formula Ia [0364] A compound of formula la, wherein R⁵ means CH2NHR²⁵R²⁶, it is possible to synthesize from a compound of the formula XXX with an electrophilic reagent (e.g., benzyl bromide, benzenesulfonyl chloride, benzoyl chloride, phenyl isocyanate, phenyl isothiocyanate) in a polar aprotic solvent (e.g. DMF) under an inert atmosphere in the presence of a base (e.g., K2CO3, Et3N) followed by deprotection of the protective group under appropriate conditions (e.g., tetra-n-butylammonium fluoride) and purification by conventional methods (such as silica gel chromatography).

25

Example 45. Synthesis of compounds of formula Ia, wherein R is OR [0365]

- 202 -

<img file="PL1893612T3_D0168.tif" />

Formula Ia where R⁵ means OR²⁵

Step -1 - Synthesis of a compound of formula Ia, wherein R is OR²⁵ [0366] A compound of Formula la, wherein R⁵ means OR2⁵, is synthesized in the reaction of compound 1 with the reagent of formula r2⁵OH (e.g., methanol) in the presence of a base (e.g., sodium methoxide) and copper (I) bromide in a solvent (e.g., N, N-dimethylformamide) usually with reflux for 2-8 hours as described by Mazeasa, et. al. in Heterocycles, 1999, 50: 1065. The desired intermediate is purified by conventional methods (e.g., silica gel column chromatography).

Example 46 Synthesis of compounds of formula Ia, wherein R is SR [0367]

<img file="PL1893612T3_D0169.tif" />

where R⁵ means SR2⁵ [0368] A compound of Formula la, wherein R5 is SR25, can be obtained by reacting Compound 1 with a strong base (e.g., potassium hydride or t-butyllithium) and dialkyl disulfides (e.g., dimethyldisulfane) or thiophenols (e.g., 4-methoxythiophen) in a polar aprotic solvent (e.g., N, N-dimethylformamide) in an inert atmosphere according to the procedure described by Yang et. al., Heterocycles, 1992, 34, 1169, before substituting 5-bromo-7azaindole for 5-bromoindole.

25 25

Example 47. Synthesis of compounds of formula Ia, wherein R is S (O) R or S (O) 2R

<img file="PL1893612T3_D0170.tif" />

<img file="PL1893612T3_D0171.tif" />

where R⁵ means SR²⁵

Formula Ia where R⁵ means S⁽O) R²⁵

Formula Ia where R⁵ means S⁽ABOUT^{) 2}R²⁵ Compounds of formula la, wherein R 5 is S (O) R 25, or S (O) 2 R 25, can be obtained by reacting a compound of formula la, wherein R 5 is SR 25, with 1 or 2 equivalents of oxidant

- 203 (e.g., Oxone), respectively, in a polar solvent (e.g., DMF), using standard procedures.

[0371] Additional embodiments are found in the following claims.

- 204 -