Pyrrolo[2,3-b] pyridine derivatives as protein kinase inhibitors
70 claims: 13 independent, 57 dependent
- 1Claims 1. A compound having the structure of Formula Illm:Formula Him or a pharmaceutically acceptable salt thereof, wherein: R81 is selected from the group consisting of hydrogen, halogen, optionally substituted C!-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, C(O)NH2, -C(S)NH2j -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -OR68, SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2, -NR69C(O)NR69R68, -NR69C(S)NH2, -NR69C(S)NR69R68, -NR69S(O)2NH2, NR69S(O)2NR69R68, -S(O)R68, and -S(O)2R68;R83 is selected from the group consisting of hydrogen, fluoro and chloro;R112 is selected from the group consisting of optionally substituted C26־alkyl, optionally substituted aryl, optionally substituted heteroaryl, and nr79r80;R68 is selected from the group consisting of optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, provided, however, that when R is optionally substituted C2-C6 alkenyl, no alkene carbon thereof is bound to N, S, O, S(0), S(0)2, C(0) or C(S) of-OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2, -NR69C(O)NR69R68, -NR69C(S)NH2, -NR69C(S)NR69R68, -NR69S(O)2NH2, -NR69S(O)2NR69R68, S(O)R68, or -S(O)2R68, optionally substituted C2-C6 alkynyl, provided, however, that when R68 is optionally substituted C2-C6 alkynyl, no alkyne carbon thereof is bound to N, S, O, S(0), S(0)2, C(0) or C(S) of-OR68, -SR68, -NR69R , C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2j -NR69C(O)NR69R68, -NR69C(S)NH2, -NR69C(S)NR69R68, -NR69S(O)2NH2, NR69S(O)2NR69R68, -S(O)R68, or -S(O)2R68, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;R69 is selected from the group consisting of hydrogen and optionally substituted C!-C6 alkyl;and R79 and R80 are independently hydrogen or optionally substituted C!-C6 alkyl, or R79 and R80 combine with the nitrogen to which they are attached to form optionally substituted 5-7 membered heterocycloalkyl;wherein: optionally substituted C1-C6 alkyl as R68, R69, R79, R80, or R81, or C26־alkyl as R112, are C!-C6 alkyl or C2-6 alkyl, respectively, optionally substituted with one or more substituents selected from the group consisting of-F, -OH, -NH2, -NO2, -CN, -C(0)0H, -C(S)OH, -C(0)NH2, -C(S)NH2, -S(O)2NH2, -NHC(0)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -OR0, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)OR°, -C(S)OR°, .S(O)R°, -S(O)2R°, -C(0)NHR°, -C(S)NHR°, -C(0)NR°R°, -C(S)NR°R°, -S(O)2NHRo, -S(O)2NRoR°, -C(NH)NHR°, -C(NH)NRpRc, -NHC(0)R°, -NHC(S)R°, -NR°C(0)R°, -NR°C(S)R°, -NHS(0)2R°, -NR°S(O)2R°, -NHC(0)NHR°, -NHC(S)NHR°, -NR°C(0)NH2, -NRoC(S)NH2, -NR°C(0)NHR°, -NR°C(S)NHR°, -NHC(0)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR°R0, -NR°C(S)NR°R°, -NHS(0)2NHR°, -NRoS(O)2NH2, -NRoS(O)2NHR°, -NHS(0)2NR°R°, -NRoS(O)2NR°R°, -NHR°, -NR°R°, -Re, -Rf, and -Rg;optionally substituted C2-C6 alkenyl as R68 or R81 is C2-C6 alkenyl optionally substituted with one or more substituents selected from the group consisting of -F, -OH, -NH2, -N02, -CN, -C(0)0H, -C(S)OH, -C(0)NH2, -C(S)NH2, -S(O)2NH2, -NHC(0)NH2, -NHC(S)NH2, -NHS(0)2NH2, -C(NH)NH2, -OR0, -SR°, -0C(0)R°, -OC(S)R°, -C(0)R°, -C(S)R°, -C(O)OR°, -C(S)OR°, -S(O)R°, -S(O)2R°, -C(0)NHR°, -C(S)NHR°, -C(0)NR°R°, -C(S)NR°R°, -S(0)2NHR°, -S(0)2NR°R°, -C(NH)NHR°, -C(NH)NRpRc, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R°, -NR°C(S)R°, -NHS(O)2R°, -NR°S(0)2R°, -NHC(O)NHR°, -NHC(S)NHR°, -NRoC(O)NH2, -NR°C(S)NH2, -NR°C(O)NHR°, -NR°C(S)NHR°, -NHC(O)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR°R°, -NR°C(S)NR°R°, -NHS(O)2NHR°, -NR°S(O)2NH2, -NR°S(O)2NHR°, -NHS(O)2NRoR°, -NR°S(O)2NRoR°, -NHR°, -NR°R°, -Rd, -Rf, and -Rg;optionally substituted C2-C6 alkynyl as R68 or R81 is C2-C6 alkynyl optionally substituted with one or more substituents selected from the group consisting of -F, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -OR0, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)OR°, -C(S)OR°, -S(O)R°, -S(O)2R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR°R°, -S(O)2NHR°, -S(O)2NRoR°, -C(NH)NHR°, -C(NH)NRpRc, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R°, -NR°C(S)R°, -NHS(O)2R°, -NR°S(O)2R°, -NHC(O)NHR°, -NHC(S)NHR°, -NRoC(O)NH2, -NRoC(S)NH2, -NR°C(O)NHR°, -NR°C(S)NHR°, -NHC(O)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR°R°, -NR°C(S)NR°R°, -NHS(O)2NHR°, -NR°S(O)2NH2, -NR°S(O)2NHR°, -NHS(O)2NRoR°, -NRoS(O)2NR°R°, -NHR°, -NR°R°, -Rd, -Re,and-Rs;optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl or optionally substituted heteroaryl, as R68, R81, R112, or optionally substituted 5-7 membered heterocycloalkyl as R79 and R80 combined with the nitrogen to which they are attached are cycloalkyl, heterocycloalkyl, aryl, heteroaryl or 5-7 membered heterocycloalkyl, respectively, each of which is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -OR0, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)OR°, -C(S)OR°, -S(O)R°, -S(O)2R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR°R°, -S(O)2NHR°, -S(O)2NR°R°, -C(NH)NHR°, -C(NH)NRpRc, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R°, -NR°C(S)R°, -NHS(O)2R°, -NRoS(O)2R°, -NHC(O)NHR°, -NHC(S)NHR°, -NRoC(O)NH2, -NR°C(S)NH2, -NR°C(O)NHR°, -NR°C(S)NHR°, -NHC(O)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR°R°, -NR°C(S)NR°R0, -NHS(O)2NHR°, -NR°S(O)2NH2, -NRoS(O)2NHR°, -NHS(O)2NRoR°, -NR°S(O)2NRoR°, -NHR°, -NR°R°, -Rd, -Re, -Rf, and -Re;each R°, Rp, and Rc are independently selected from the group consisting of Rd, Re, Rf, and Rg, or Rp and Rc combine with the nitrogen to which they are attached to form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered nitrogen containing heteroaryl, respectively, are optionally substituted with one or more substituents selected from the group consisting of halogen, -NO2, -CN, -OH, -NH2, -ORU, -SRU, -NHRU, -NRURU, -Rx, and -Ry;each Rd is independently C!-C6 alkyl, wherein C!-C6 alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, -Nez, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -ORk, -SRk, -OC(O)Rk, -OC(S)Rk, -C(O)Rk, -C(S)Rk, -C(O)ORk, -C(S)ORk, -S(O)Rk, -S(O)2Rk, -C(O)NHRk, -C(S)NHRk, -C(O)NRkRk, -C(S)NRkRk, -S(O)2NHRk, -S(O)2NRkRk, -C(NH)NHRk, -C(NH)NRmRn, -NHC(O)Rk, -NHC(S)Rk, -NRkC(O)Rk, -NRkC(S)Rk, -NHS(O)2Rk, -NRkS(O)2Rk, -NHC(O)NHRk, -NHC(S)NHRk, -NRkC(O)NH2, -NRkC(S)NH2, -NRkC(O)NHRk, -NRkC(S)NHRk, -NHC(O)NRkRk, -NHC(S)NRkRk, -NRkC(O)NRkRk, -NRkC(S)NRkRk, -NHS(O)2NHRk, -NRkS(O)2NH2, -NRkS(O)2NHRk, -NHS(O)2NRkRk, -NRkS(O)2NRkRk, -NHRk, -NRkRk, -R1, and -RJ;each Re is independently C2-C6 alkenyl, wherein C2-C6 alkenyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(0)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -ORk, -SRk, -OC(O)Rk, -OC(S)Rk, -C(O)Rk, -C(S)Rk, -C(O)ORk, -C(S)ORk, -S(O)Rk, -S(O)2Rk, -C(O)NHRk, -C(S)NHRk, -C(O)NRkRk, -C(S)NRkRk, -S(O)2NHRk, -S(O)2NRkRk, -C(NH)NHRk, -C(NH)NRmRn, -NHC(O)Rk, -NHC(S)Rk, -NRkC(O)Rk, -NRkC(S)Rk, -NHS(O)2Rk, -NRkS(O)2Rk, -NHC(O)NHRk, -NHC(S)NHRk, -NRkC(O)NH2, -NRkC(S)NH2, -NRkC(O)NHRk, -NRkC(S)NHRk, -NHC(O)NRkRk, -NHC(S)NRkRk, -NRkC(O)NRkRk, -NRkC(S)NRkRk, -NHS(O)2NHRk, -NRkS(O)2NH2, -NRkS(O)2NHRk, -NHS(O)2NRkRk, -NRkS(O)2NRkRk, -NHRk, -NRkRk, -Rh, and -RJ;each Rf is independently C2-C6 alkynyl, wherein C2-C6 alkynyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -ORk, -SRk, -OC(O)Rk, -OC(S)Rk, -C(O)Rk, -C(S)Rk, -C(O)ORk, -C(S)ORk, -S(O)Rk, -S(O)2Rk, -C(O)NHRk, -C(S)NHRk, -C(O)NRkRk, -C(S)NRkRk, -S(O)2NHRk, -S(O)2NRkRk, -C(NH)NHRk, -C(NH)NRmRn, -NHC(O)Rk, -NHC(S)Rk, -NRkC(O)Rk, -NRkC(S)Rk, -NHS(O)2Rk, -NRkS(O)2Rk, -NHC(O)NHRk, -NHC(S)NHRk, -NRkC(O)NH2, -NRkC(S)NH2, -NRkC(O)NHRk, -NRkC(S)NHRk, -NHC(O)NRkRk, -NHC(S)NRkRk, -NRkC(O)NRkRk, -NRkC(S)NRkRk, -NHS(O)2NHRk, -NRkS(O)2NH2, -NRkS(O)2NHRk, -NHS(O)2NRkRk, -NRkS(O)2NRkRk, -NHRk, -NRkRk, -Rh, and -RJ;each R8 is independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, respectively, are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -ORk, -SRk, -OC(O)Rk, -OC(S)Rk, -C(O)Rk, -C(S)Rk, -C(O)ORk, -C(S)ORk, -S(O)Rk, -S(O)2Rk, -C(O)NHRk, -C(S)NHRk, -C(O)NRkRk, -C(S)NRkRk, -S(O)2NHRk, -S(O)2NRkRk, -C(NH)NHRk, -C(NH)NRmRn, -NHC(O)Rk, -NHC(S)Rk, -NRkC(O)Rk, -NRkC(S)Rk, -NHS(O)2Rk, -NRkS(O)2Rk, -NHC(O)NHRk, -NHC(S)NHRk, -NRkC(O)NH2, -NRkC(S)NH2, -NRkC(O)NHRk, -NRkC(S)NHRk, -NHC(O)NRkRk, -NHC(S)NRkRk, -NRkC(O)NRkRk, -NRkC(S)NRkRk, -NHS(O)2NHRk, -NRkS(O)2NH2, -NRkS(O)2NHRk, -NHS(O)2NRkRk, -NRkS(O)2NRkRk, -NHRk, -NRkRk, -Rh, -R', and -RJ;Rk, Rm, and Rn at each occurrence are independently selected from the group consisting of Rh, R', and Rj, or Rm and Rn combine with the nitrogen to which they are attached form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered nitrogen containing heteroaryl, respectively, are optionally substituted with one or more substituents selected from the group consisting of halogen, -NO2, -CN, -OH, -NH2, ORU, -SRU, -NHRU, -NRURU, -Rx, and -Ry;each Rh is independently C!-C6 alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -ORr, -SRr, -OC(O)Rr, -OC(S)Rr, -C(O)Rr, -C(S)Rr, -C(O)ORr, -C(S)ORr, -S(O)Rr, -S(O)2Rr, -C(O)NHRr, -C(S)NHRr, -C(O)NRrRr, -C(S)NRrRr, -S(O)2NHRr, -S(O)2NRrRr, -C(NH)NHRr, -C(NH)NRsRl, -NHC(O)Rr, -NHC(S)Rr, -NRrC(O)Rr, -NRrC(S)Rr, -NHS(O)2Rr, -NRrS(O)2Rr, -NHC(O)NHRr, -NHC(S)NHRr, -NRrC(O)NH2, -NRrC(S)NH2, -NRrC(O)NHRr, -NRrC(S)NHRr, -NHC(O)NRrRr, -NHC(S)NRrRr, -NRrC(O)NRrRr, -NRrC(S)NRrRr, -NHS(O)2NHRr, -NRrS(O)2NH2, -NRrS(O)2NHRr, -NHS(O)2NRrRr, -NRrS(O)2NRrRr, -NHRr, -NRrRr, -R\ and -Rj;each R‘ is independently selected from the group consisting of C2-C6 alkenyl and C2-C6 alkynyl, wherein C2-C6 alkenyl or C2-C6 alkynyl, respectively, are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -ORr, -SRr, -OC(O)Rr, -OC(S)Rr, -C(O)Rr, -C(S)Rr, -C(O)ORr, -C(S)ORr, -S(O)Rr, -S(O)2Rr, -C(O)NHRr, -C(S)NHRr, -C(O)NRrRr, . -C(S)NRrRr, -S(O)2NHRr, -S(O)2NRrRr, -C(NH)NHRr, -C(NH)NRsRl, -NHC(O)Rr, -NHC(S)Rr, -NRrC(O)Rr, -NRrC(S)Rr, -NHS(O)2Rr, -NRrS(O)2Rr, -NHC(O)NHRr, -NHC(S)NHRr, -NRrC(O)NH2, -NRrC(S)NH2, -NRrC(O)NHRr, -NRrC(S)NHRr, -NHC(O)NRrRr, -NHC(S)NRrRr, -NRrC(O)NRrRr, -NRrC(S)NRrRr, -NHS(O)2NHRr, -NRrS(O)2NH2, -NRrS(O)2NHRr, -NHS(O)2NRrRr, -NRrS(O)2NRrRr, -NHRr, -NRrRr, and -Rj;each Rj is independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, respectively, are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -ORr, -SRr, -OC(O)Rr, -OC(S)Rr, -C(O)Rr, -C(S)Rr, -C(O)ORr, -C(S)ORr, -S(O)Rr, -S(O)2Rr, -C(O)NHRr, -C(S)NHRr, -C(O)NRrRr, -C(S)NRrRr, -S(O)2NHRr, -S(O)2NRrRr, -C(NH)NHRr, -C(NH)NRsRt, -NHC(O)Rr, -NHC(S)Rr, -NRrC(O)Rr, -NRrC(S)Rr, -NHS(O)2Rr, -NRrS(O)2Rr, -NHC(O)NHRr, -NHC(S)NHRr, -NRrC(O)NH2, -NRrC(S)NH2, -NRrC(O)NHRr, -NRrC(S)NHRr, -NHC(O)NRrRr, -NHC(S)NRrRr, -NRrC(O)NRrRr, -NRrC(S)NRrRr, -NHS(O)2NHRr, -NRrS(O)2NH2, -NRrS(O)2NHRr, -NHS(O)2NRrRr, -NRrS(O)2NRrRr, -NHRr, -NRrRr, cycloalkylamino, and -Rx;Rr, Rs, and R‘ at each occurrence are independently selected from the group consisting of C1-C6 alkyl, C3-6 alkenyl, C3-6 alkynyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl;wherein C!-C6 alkyl is optionally substituted with one or more substituents selected from the group consisting of -Ry, fluoro, -OH, -NH2, C1-C6 alkoxy, fluoro substituted C1-C6 alkoxy, C1-C6 alkylthio, fluoro substituted C!-C6 alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the C1-C6 alkyl carbon bound to any O, S, or N, of-0Rr, -SRr, -C(O)ORr, -C(S)ORr, -C(O)NHRr, -C(S)NHRr, -C(O)NRrRr, -C(S)NRrRr, -S(O)2NHRr, -S(O)2NRrRr, -C(NH)NHRr, -NRrC(O)Rr, -NRrC(S)Rr, -NRrS(O)2Rr, -NHC(0)NHRr, -NHC(S)NHRr, -NRrC(O)NH2, -NRrC(S)NH2, -NRrC(O)NHRr, -NRrC(S)NHRr, -NHC(0)NRrRr, -NHC(S)NRrRr, -NRrC(0)NRrRr, -NRrC(S)NRrRr, -NHS(O)2NHRr, -NRrS(O)2NH2, -NRrS(O)2NHRr, -NHS(O)2NRrRr, -NRrS(O)2NRrRr, -NHRr, or -NRrRr is selected from the group consisting of fluoro and -Ry;and wherein C3-6 alkenyl or C3-6 alkynyl, respectively, are optionally substituted with one or more substituents selected from the group consisting of-Ry, fluoro, C!-C6 alkyl, fluoro substituted C!-C6 alkyl, C!-C6 alkoxy, fluoro substituted C!-C6 alkoxy, C1־C6 alkylthio, fluoro substituted Cr C6 alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the C3-6 alkenyl or C3-6 alkynyl carbon bound to any 0, S, orN, of-ORr, -SRr, -C(O)ORr, -C(S)ORr, -C(0)NHRr, -C(S)NHRr, -C(0)NRrRr, -C(S)NRrRr, -S(O)2NHRr, -S(O)2NRrRr, -C(NH)NHRr, -NRrC(O)Rr, -NRrC(S)Rr, -NRrS(O)2Rr, -NHC(0)NHRr, -NHC(S)NHRr, -NRrC(0)NH2, -NRrC(S)NH2, -NRrC(0)NHRr, -NRrC(S)NHRr, -NHC(0)NRrRr, -NHC(S)NRrRr, -NRrC(0)NRrRr, -NRrC(S)NRrRr, -NHS(O)2NHRr, -NRrS(O)2NH2, -NRrS(O)2NHRr, -NHS(O)2NRrRr, -NRrS(O)2NRrRr, -NHRr, or -NRrRr is selected from the group consisting of fluoro, C1-C6 alkyl, fluoro substituted C!-C6 alkyl, and -Ry;and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, respectively, are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, C!-C6 alkyl, fluoro substituted C!-C6 alkyl, C!C6 alkoxy, fluoro substituted C!-C6 alkoxy, C!-C6 alkylthio, fluoro substituted C1-C6 alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, or Rs and R‘ combine with the nitrogen to which they are attached form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered nitrogen containing heteroaryl, respectively, are optionally substituted with one or more substituents selected from the group consisting of halogen, -NO2, -CN, -OH, -NH2, ORU, -SRU, -NHRU, -NRURU, -Rx, and -Ry;each Ru is independently selected from the group consisting of C!-C6 alkyl, C3 alkenyl, C3.6 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein C1-C6 alkyl is optionally substituted with one or more substituents selected from the group consisting of-Ry, fluoro, -OH, -NH2, C1-C6 alkoxy, fluoro substituted C1־C6 alkoxy, C!-C6 alkylthio, fluoro substituted C!-C6 alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the C1־C6 alkyl carbon bound to the O of -ORU, S of-SRU, or N of-NHRU is fluoro or -Ry;and wherein C36־alkenyl or C3 alkynyl, respectively, are optionally substituted with one or more substituents selected from the group consisting of-Ry, fluoro, -OH, -NH2, C1־C6 alkyl, fluoro substituted C!-C6 alkyl, C!-C6 alkoxy, fluoro substituted C!-C6 alkoxy, C!-C6 alkylthio, fluoro substituted C1-C6 alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the C3 alkenyl or C36־alkynyl carbon bound to the O of -ORU, S of-SRU, or N of-NHRU is fluoro, C!-C6 alkyl, fluoro substituted C!-C6 alkyl, or -Ry;and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, respectively, are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, C!-C6 alkyl, fluoro substituted C1-C6 alkyl, C!-C6 alkoxy, fluoro substituted C!-C6 alkoxy, C!-C6 alkylthio, fluoro substituted C!-C6 alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;each Rx is selected from the group consisting of C1-C6 alkyl, C2-C6 alkenyl and C2-C6 alkynyl, wherein C1־C6 alkyl is optionally substituted with one or more substituents selected from the group consisting of-Ry, fluoro, -OH, -NH2, C!-C6 alkoxy, fluoro substituted C!-C6 alkoxy, C1-C6 alkylthio, fluoro substituted C1-C6 alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;and wherein C2-C6 alkenyl or C2-C6 alkynyl, respectively, are optionally substituted with one or more substituents selected from the group consisting of-Ry, fluoro, -OH, -NH2, C1־C6 alkyl, fluoro substituted C!-C6 alkyl, C!-C6 alkoxy, fluoro substituted C!-C6 alkoxy, C!-C6 alkylthio, fluoro substituted C1־C6 alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;each Ry is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, respectively, are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, C1-C6 alkyl, fluoro substituted C!-C6 alkyl, C1־C6 alkoxy, fluoro substituted CrC6 alkoxy, C!-C6 alkylthio, fluoro substituted C1-C6 alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;at each occurrence, alkenyl, by itself or as part of another substituent, is a straight or branched chain hydrocarbon having at least one carbon-to-carbon double bond;at each occurrence, alkynyl, by itself or as part of another substituent, is a straight or branched chain hydrocarbon having at least one carbon-to-carbon triple bond;at each occurrence, cycloalkyl, by itself or as part of another substituent, is a saturated or unsaturated, non-aromatic monocyclic, bicyclic or tricyclic carbon ring system of 3-10 ring members per ring;and at each occurrence, heterocycloalkyl, by itself or as part of another substituent, is a saturated or unsaturated non-aromatic group having from 5 to 10 atoms in which from 1 to 3 carbon atoms in the ring are replaced by heteroatoms of O, S or N, and are optionally fused with benzo or heteroaryl of 5-6 ring members.
- 59Use of a compound according to any one of Claims 1-55 or a composition according to Claim 56 in the preparation of a medicament for the treatment of a disease or condition for which modulation of Raf protein kinase activity provides a therapeutic benefit, wherein said Raf protein kinase is selected from the group consisting of B-Raf, any mutation of B-Raf, c-Raf-1, and any mutation of c-Raf-1.
- 60The use according to Claim 59, wherein said disease or condition is selected from the group consisting of melanoma, glioma, thyroid cancer, liver cancer, lung cancer, colon cancer, cancer, acute pain, chronic pain, and polycystic kidney disease.
Independent claims16
2,173 paragraphs in 73 sections, as filed
BACKGROUND OF THE INVENTION
[0003] The information provided herein is intended solely to assist the understanding of the reader. None of the information provided nor references cited is admitted to be prior art to the present invention. Each of the references cited herein is incorporated in its entirety.
[0004] Receptor protein kinases regulate key signal transduction cascades that control or are involved in the control of a plethora of physiological functions including cellular growth and proliferation, cell differentiation, cellular development, cell division, cell adhesion, stress response, short-range contact-mediated axonal guidance, transcription regulation, aberrant mitogenesis, angiogenesis, abnormal endothelial cell-cell or cell-matrix interactions during vascular development, inflammation, lymphohematopoietic stem cell activity, protective immunity against specific bacteria, allergic asthma, aberrant tissue-specific responses to the activation of the JNK signal transduction pathway, cell transformation, memory, apoptosis, competitive activity-dependent synapse modification at the neuromuscular synapse, immunological mediation of disease, and calcium regulation. As such, a variety of specific disease states are associated with aberrant regulation of protein kinases.
Barton et al. (XP002402100) relates to studies on the phenylation and oxidation of phenols. US2234705 relates to cellulose organic derivative composition containing esters of monoalkoxy benzoic acids. Langham et al. (XP002402101) relates to metalation of halogen-metal interconversion reactions of some halogenaed phenyl ethers. Heacock et al (XP002402102) relates to orientation and relative reaction rate factors in aromatic substitution by the benzensulfonimido radical. DE2413258 relates to alkoxycarbonyl-phenylureas their preparation and their use as herbicides. Pierce et al. (XP002402104) relates to beta-monoalkylaminoethyl esters of alkoxybenzoic acids.
There is a need in the art for additional compounds and methods of use thereof for the modulation of receptor protein kinases in treatment of various diseases.
01802727\42-01
SUMMARY OF THE INVENTION
[0006] The present invention concerns compounds active on protein kinases in general, including, but not limited to, B-Raf, c-Raf-1, Fms, Jnkl, Jnk2, Jnk3, and/or Kit, including any mutations of these kinases, and the use thereof in treating disease and conditions associated with regulation of the activity of the kinases. In particular, the invention concerns compounds of Formula HI as described below. Thus, the invention provides novel uses of compounds for therapeutic methods involving modulation of protein kinases, as well as novel compounds that can be used for therapeutic methods involving modulation of protein kinases.
[0007] The compounds of Formula HI have the following structure:
<img file="IL188248A_D0001.tif" />
all salts, prodrugs, tautomers, and isomers thereof, wherein:
Q has a structure selected from the group consisting of
R15
<img file="IL188248A_D0002.tif" />
045 046
<img file="IL188248A_D0003.tif" />
in which ? indicates the attachment point of Q to A of Formula HI;
Z2 is N or CR12; Z4 is N or CR14; Z5 is N or CR15; Z6 is N or CR16;
L2 is selected from the group consisting 01-(6511¾11)^}^25.^1¾11)., -(CR10R1 ׳)p-O-(CRl0R1 >)q-, -(CR10R1 ׳)P-S-(CR,OR11),-, -(CR,0R’ 1)p-CCOHCrt11),-״ ־(CRI°R1I)p-C(S)-(CR10Rll)q-J-(CR10Rll)p-S(O)-(CR10Rll)q-)-(CRI0R11)p-S(O)2-(CR10R11),-, -^1¾1 1)p-C(O)NR25-(CR10R1 1),-, -(CRV 1)p-C(S)NR2s-(CR10R1 1),-, -^10κ'Τρ-βίο)^“.^1^11),-, ^1¾,1)^2¾(0)-^1¾11^ -(CR10R11)p-NR25C(S)-(CR10R11),-,and-(CR10R11)p-NR25S(O)2-(CR10R11),-;
p and q are independently 0,1, or 2 provided, however, that at least one of p and q is 0; s is 1 or 2;
X is O or S;
A is selected from the group consisting of -O-, -S-, -CRaRb-, -NR1-, -C(O)-, -C(S)-, -S(O)-, and -S(O)2-;
Ra and Rb at each occurrence are independently selected from the group consisting of hydrogen, fluoro, -OH, -NH2, lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino, and -NR8R9, wherein the alkyl chain(s) of lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro; or
Ra and Rb combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
R1 is selected from the group consisting of hydrogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -C(O)R7, -C(S)R7, -S(O)2R7, -C(O)NHR7, -C(S)NHR7, and -S(O)2NHR7, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino, and -NR8R9, wherein the alkyl chain(s) of lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of tlnoalkyl or N of mono- or di-alkylamino is fluoro, further provided that when R1 is lower alkyl, any substitution on the lower alkyl carbon bound to the N of-NR&#1523;- is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
R7 is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino, and -NR8R9, provided, however, that any substitution ofthe alkyl carbon bound to the N of -C(O)NHR7, -C(S)NHR7 or -S(O)2NHR7 is fluoro, wherein the alkyl chain(s) of lower alkoxy, lower alkylthio, mono-alkylamino, or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro, and wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
R4, R5, R6, R12, R14, R15, R16, R42, R43, R4i, R46 and R47 are independently selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -NO2, -CR“RbR26, and -LR26;
L at each occurrence is independently selected from the group consisting of-(alk)a-S-(alk)b-, -(alk)a-O-(alk)b-, -(alk)a-NR25-(alk)b-, -(alk)a-C(O)-(alk)b-, -(alk).-C(S)-(alk)b-, -(alk)B-S(O)-(alk)b-, -(alk)a-S(O)2-(alk)b-, -(alk)B-OC(O)-(alk)b-, -(alk)a-C(O)O-(alk)b-, -(alk)a-OC(S)-(alk)b-, -(alk)a-C(S)O-(alk)b-, -(alk)B-C(O)NR23-(alk)b-, -(alk)0-C(S)NR25-(alk)b-, -(alk)B-S(O)2NR25-(alk)b-, -(alk)B-NR25C(O)-(alk)b-, -(alk)n-NR25C(S)-(aIk)b-, -(alk)a-NR2sS(O)2-(alk)b-, -(alk)a-NR25C(O)O-(alk)b-, -(alk)B-NR25C(S)O-(alk)b-,-(alk)a-OC(O)NR25-(alk)b-, -(alk)a-OC(S)NR25-(alk)b-, -(alk)a-NR25C(O)NR25-(alk)b-, -(alk)B-NR25C(S)NR25-(alk)b-, and -(alk)a-NR25S(O)2NR25-(alk)b-;
a and b are independently 0 or 1;
alk is C1-3 alkylene or C!.3 alkylene substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkyl, lower alkoxy, lower alkylthio, mono-alkylamino, di-alkylamino, and -NR8R9, wherein lower alkyl or the alkyl chain(s) of lower alkoxy, lower alkylthio, mono-alkylamino or di-alkylamino are optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution of the alkyl chain carbon bound to O of alkoxy, S of thioalkyl or N of mono- or di-alkylamino is fluoro;
R25 at each occurrence is independently selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cyclo'alkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
R26 at each occurrence is independently selected from the group consisting of hydrogen, provided, however, that hydrogen is not bound to any of S(O), S(O)2, C(O) or C(S) of L, optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R26 is optionally substituted lower alkenyl, no alkene carbon thereof is bound to N, S, O, S(O), S(O)2, C(O) or C(S) of L, optionally substituted lower alkynyl, provided, however, that when R26 is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to N, S, O, S(O), S(O)2, C(O) or C(S) of L, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
R10 and R11 at each occurrence are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, dialkylamino, and cycloalkylamino; or any two of R10 and Rn on the same or adjacent carbon atoms combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, and any others of R’° and R11 are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, and wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl are optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
R8 and R9 combine with the nitrogen to which they are attached to form a 5-7 membered heterocycloalkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2> lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, and fluoro substituted lower alkylthio;
R17 is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl and-OR18;
R31 and R33 are independently selected from the group consisting of optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, and optionally substituted heterocycloalkyl;
R36 is selected from the group consisting of substituted methyl, optionally substituted C2.6 alkyl, optionally substituted lower alkenyl, provided, however, that when R36 is optionally substituted lower alkenyl, no alkene carbon thereof is bound to the S(O)2 of S(O)2R3s, optionally substituted lower alkynyl, provided, however, that when R36 is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to the S(O)2 of S(O)2R3s, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and -NR19R20;
R19, R20, R34, R35, R37, and R38 are independently selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R19, R20, R34, R35, R37, or R38 is optionally substituted lower alkenyl, no alkene carbon thereof is bound to the N of NR19Rz0, NR34R35 or NR37R38, optionally substituted lower alkynyl, provided, however, that when R19, R20, R34, R35, R37, or R38 is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to the N of NR19Rz0, NR34R35 or NR37R38, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl and optionally substituted heteroaryl,. or
R34 and R35 together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5 or 7 membered nitrogen containing heteroaryl; or
R37 and R38 together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5 or 7 membered nitrogen containing heteroaryl;
R32 is selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and -OR18;
R82 is selected from hydrogen or lower alkyl; and
R18 is hydrogen or optionally substituted lower alkyl;
provided, however, that the compound is not 3-{3-[2-(tetrahydropyran yloxy)-ethoxy]-benzyl}5-thiophen yl-lH-pyrrolo[2,3-b]pyridine, which has the structure ________________.J
<img file="IL188248A_D0004.tif" />
4-(4-Methyl-piperazin-l-ylmethyl)-N-[4-(lH-pynolo[2,3-b]pyridin yImethyl)-phenyl]benzamide, which has the structure
<img file="IL188248A_D0005.tif" />
[0008] In some embodiments, compounds of Formula ΠΙ have the structure according to the following sub-generic structure Formula IHa.
<img file="IL188248A_D0006.tif" />
Formula IHa all salts, prodrugs, tautomers and. isomers thereof, wherein A, L2, Z2, Z6, R4, R5, R6, R15, R17 and R31 are as defined for Formula ΠΙ.
[0009] In some embodiments of compounds of Formula Hla, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-, R17 is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R15 is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0010] In some embodiments of compounds of Formula IHa, R4 and R6 are hydrogen, A is , -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, R17 is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the aikyl chain of lower alkyl or lower
&#906; alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the of lower alkoxy is fluoro, R15 is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, Z2 is N or CR12, Z6 is N or CR16, R12 and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R5 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR2IR22, wherein R21 is hydrogen or lower alkyl, and R22 is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R5, R21 or R22, when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.
[0011] In some embodiments, compounds of Formula HI have the structure according to the following sub-generic structure Formula IHb:
<img file="IL188248A_D0007.tif" />
Formula Hib all salts, prodrugs, tautomers, and isomers thereof, wherein:
A! Is -O-, -CR40R41-, -C(O)- or -NR48-;
Z12 is N or CR52;
Z,6 is N or CR56;
R40 and R41 are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkyltbio, mono-alkylamino, di-alkylamino, and cycloalkylamino; or
R40 and R41 combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
L3 is selected from the group consisting of -NR.48-, -S-, , -NR48CH(R49)-, -SCH(R49)-, -OCH(R49)-, -C(O)NR48-, -S(O)2NR48-, -CH(R49)NR48-, -CH(R49)O-> -CH(R49)S-> -NR48C(O)-, and -NR48S(O)2-;
R53 and R55 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino or cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro;
R52 and R56 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy;
R49 is selected from the group consisting of hydrogen, lower alkyl, and fluoro substituted lower alkyl;
Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl;
R39 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, aryl, heteroaryl, and NRs0R51, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and wherein aryl and heteroaryl are optionally substituted with one or more independent substituents R23;
R50 is hydrogen or lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino;
R51 is aryl or heteroaryl, wherein aryl and heteroaryl are optionally substituted with one or more independent substituents R23;
R23 at each occurrence is independently selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2j -OR57, -SR57, -NR48R57, -NR48C(O)R57, -NR48S(O)2R57, -S(O)2R57, -C(O)R57, -C(O)OR57, -C(O)NR4sR57, -S(O)2NR48R57, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R23, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR58, -SR58, -NR48R58, -NR.48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R57 is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon bound to 0, S, orN of -OR57, -SR57, -NR48R57, -C(O)OR57, -C(O)NR48R57, or -S(O)2NR.48R57 is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R57 or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)0H, -S(O)2NH2, -C(O)NH2, -OR58, -SR58, -NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR4sR58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R58 at each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl carbon bound to 0, S, or N of-OR58, -SR58, -NR48R58, -C(O)OR58, -C(O)NR48R58, or -S(O)2NR.48R58 is fluoro;
R48 at each occurrence is independently hydrogen or lower alkyl; and t is 0, 1, 2, or 3. >
[0012] In some embodiments of compounds of Formula IHb, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-. In some embodiments, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-, and R53 and R55 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. In some embodiments, L3 is -NR48CH(R49)-, -SCH(R49)-, or -OCH(R49)-, preferably -OCH(R49)&#1470;. In some embodiments, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-, and L3 is -NR48CH(R49)-, -SCH(R49)-, or -OCH(R49)-, preferably -OCH(R49)-.
[0013] In some embodiments, compounds of Formula ΙΠ have the structure according to the following sub-generic structure Formula Hip:
PC17US2006/024361
<img file="IL188248A_D0008.tif" />
<img file="IL188248A_D0009.tif" />
Cy—(R23)t all salts, prodrugs, tautomers, and isomers thereof, wherein:
A) is , -CR40R41-, -C(O)- or -NR48-;
Z22 is N or CR62;
Z2e is N or CR66;
r is 0, 1, or 2;
R40 and R41 are independently selected from the group consisting bf hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; or R40 and R41 combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2> lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
R62, R63, R65 and R66 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro;
Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl;
R39 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, aryl, heteroaryl, and NR50R51, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and wherein aryl and heteroaryl are optionally substituted with one or more independent substituents R23;
R50 is hydrogen or lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino;
R51 is aryl or heteroaryl, wherein aryl and heteroaryl are optionally substituted with one or more independent substituents R23;
R23 at each occurrence is independently selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR57, -SR57, -NR48R57, -NR48C(O)R57, -NR48S(O)2R57, -S(O)2R57, -C(O)R57, -C(C)OR57, -C(O)NR48R57, -S(O)2NR48R57, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R23, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of-OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR58, -SR58, -NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R57 is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon bound to 0, S, or N of-OR57, -SR57, -NR48R57, -C(O)OR57, -C(O)NR48R57, or -S(O)2NR48R57 is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaiyl as R57 or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR58, -SR58, -NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R58 at each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -OR58, -SR58, -NR48R58, -C(O)OR58, -C(O)NR48R58, or -S(O)2NR48R58 is fluoro;
R48 at each occurrence is independently hydrogen or lower alkyl; and t is 0, 1, 2, or 3.
[0014] In some embodiments of compounds of Formula Hip, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-. In some embodiments, A! is -CR40R41- or -C(O)-&#1470; preferably -CH2- or -C(O)-, and R62, R64, R65 and R66 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0015] In some embodiments, compounds of Formula ΙΠ have the structure according to the following sub-generic structure Formula Hie:
<img file="IL188248A_D0010.tif" />
Formula IIIc ail salts, prodrugs, tautomers and isomers thereof, wherein A, s, Z2, Z6, R4, R5, R6, R15, R17, and R32 are as defined for Formula HI.
[0016] In some embodiments of compounds of Formula Hie, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-, R17 is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R15 is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0017] In some embodiments of compounds of Formula IHc, R4 and R6 are hydrogen, A is -O-, -CR“Rb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, R17 is selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, R15 is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, Z2 is N or CR12, Zs is N or CR16, R12 and R1e are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R5 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and -NR21R22, wherein R21 is hydrogen or lower alkyl, and R22 is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R&#1470;, R21 or R22, when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, further wherein R32 is optionally substituted lower alkyl or -OR18, where R18 is as defined for Formula HL
[0018] In some embodiments, compounds of Formula ΠΙ have the structure according to the following sub-generic structure Formula ΙΠη:
<img file="IL188248A_D0011.tif" />
Formula ΠΙη all salts, prodrugs, tautomers and isomers thereof, wherein A, s, Z2, Z6, R4, R5, R6, R15, and R32 are as defined for Formula ΠΙ,
[0019] In some embodiments of compounds of Formula ΙΠη, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-, and R15 is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy,
[0020] In some embodiments of compounds of Formula IHc, R4 and R6 are hydrogen, A is -O-, -CRRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, R15 is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, Z2 is N or CR12, Z6 is N or CR16, R12 and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R5 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and -NR21R22, wherein R21 is hydrogen or lower alkyl, and R22 is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R5, R21 or R22, when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, further wherein R32 is optionally substituted lower alkyl or -OR18, where R18 is as defined for Formula HI.
[0021] In some embodiments, compounds of Formula HI have the structure according to the following sub-generic structure Formula ΙΠο:
<img file="IL188248A_D0012.tif" />
Formula ΙΠ0 all salts, prodrugs, tautomers and isomers thereof, wherein A, L2,2¾ Z4, Z5, Z6, R4, R5, R6, and R33 are as defined for Formula HI.
[0022] In some embodiments of compounds of Formula ΠΙ0, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR'-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR12, Z4 is N or CR14, Z5 is N or CR15, Z6 is N or CR16, and R12, R14, R15 and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro.
[0023] In some embodiments of compounds of Formula ΠΙ0, R4 and R6 are hydrogen, A is -O-, -CR3Rb-, -NR1-, or -C(O)&#1470;, preferably -CH2- or -C(O)-, Z2 is N or CR12, Z4 is N or CR14, Z5 is N or CR15, Z6 is N or CR16, R12, R14, R15 and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and R5 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR21R22, wherein R21 is hydrogen or lower alkyl, and R22 is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of Rs, R21 or R22, when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.
[0024] In some embodiments of compounds of Formula ΙΠ0, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, ¾, is N or CR12, Z4 is N or CR14, Z5 is N or CR15, Z6 is N or CR16, R12, R14, R15 and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and R5 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR21R22, wherein R21 is hydrogen or lower alkyl, and R22 is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R5, R21 or R22, when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.
[0025] In some embodiments, compounds of Formula ΠΙ have the structure according to the following sub-generic structure Formula IHq:
£14
L3—Cy—(R23)t l3
Formula IHq all salts, prodrugs, tautomers, and isomers thereof, wherein:
A! is -O-, -CR40R41-, -C(O)- or -NR48-;
Z12 is N or CR52;
ZM is N or CR54;
Z!5 is N or CR55;
Z16 is N or CR56;
R40 and R41 are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; or
R40 and R41 combine to foim a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
L3 is selected from the group consisting of -NR48-, -S-, , -NR48CH(R49)-, -SCH(R49)-, -OCH(R49)-, -C(O)NR48-, -S(O)2NR48-, -CH(R49)NR48-, -CH(R49)O-, -CH(R49)S-, -NR48C(O)-, and -NR48S(O)2-;
R54 and R55 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino or cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro;
R52 and R56 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy;
R49 is selected from the group consisting of hydrogen, lower alkyl, and fluoro substituted lower alkyl;
Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl;
R39 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, aryl, heteroaryl, and NR50R51, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and wherein aryl and heteroaryl are optionally substituted with one or more independent substituents R23;
R50 is hydrogen or lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino;
R51 is aryl or heteroaryl, wherein aryl and heteroaryl are optionally substituted with one or more independent substituents R23;
R23 at each occurrence is independently selected from the group consisting of -OH, -NH2>. -CN, -NO2j -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR57, -SR57, -NR48R57, -NR48C(O)R57, -NR48S(O)2R57, -S(O)2R57, -C(O)R57, -C(O)OR57, -C(O)NR48R57, -S(O)2NR48R57, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of
PCTZUS2006/024361 fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R23, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of-OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR58, -SR58, -NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R57 is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon bound to 0, S, or N of -OR57, -SR57, -NR48R57, -C(O)OR57, -C(O)NR48R57, or -S(O)2NR48R57 is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R57 or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2i -C(O)OH, -S(O)2NH2, -C(O)NH2j -OR58, -SR58, -NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R58 at each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of-OR58, -SR58, -NR48R58, -C(O)OR58, -C(O)NR48R58, or -S(O)2NR48R58 is fluoro;
R48 at each occurrence is independently hydrogen or lower alkyl; and t is 0, 1,2, or 3.
[0026] In some embodiments of compounds of Formula IHq, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-. In some embodiments, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-, and R54 and R55 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy. In some embodiments, L3 is -NR48CH(R49)-, -SCH(R49)-, or -OCH(R49)-, preferably -OCH(R49)-. In some embodiments, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -CH2-, and L3 is -NR48CH(R49)-, -SCH(R49)-, or -OCH(R49)-, preferably -OCH(R49)-.
[0027] In some embodiments, compounds of Formula ΙΠ have the structure according to the following sub-generic structure Formula Did:
<img file="IL188248A_D0013.tif" />
Formula Hid all salts, prodrugs, tautomers and isomers thereof, wherein A, Z2, Z4> Z5, Z6, R4, R5, R6, R10, R11 and R33 are as defined for Formula III, and r is 0, 1, or 2.
[0028] In some embodiments of compounds of Formula Hid, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR12, Z4 is N or CR14, Z5 is N or CR15, Z6 is N or CR16, and R12, R14, R15 and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro.
[0029] In some embodiments of compounds of Formula Hid, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR12, Z4 is N or CR14, Z5 is N or CR15, Z6 is N or CR16, R12, R14, R15 and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, R10 and R11 are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and fluoro substituted lower alkyl, and R5 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR21R22, wherein R21 is hydrogen or lower alkyl, and R22 is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R5, R21 or R22, when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.
[0030] In some embodiments of compounds of Formula Hid, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-> preferably -CH2- or -C(O)-, Zj is N or CR12, Z4 is N or CR14, Z5 is N or CR15, Z5 is N or CR16, R12, R14, R15 and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, R10 and R11 are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, and fluoro substituted lower alkyl, and R5 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR2IR22, wherein R21 is hydrogen or lower alkyl, and R22 is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R5, R21 or R22, when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino.
[0031] In some embodiments, compounds of Formula HI have the structure according to the following sub-generic structure Formula Hie:
<img file="IL188248A_D0014.tif" />
<img file="IL188248A_D0015.tif" />
Cy—(R23)t all salts, prodrugs, tautomers, and isomers thereof, wherein:
A, is , -CR4oR41-, -C(O)- or -NR48-;
Z22 is N or CR62;
Z24 is N or CR64;
Z25 is N or CR65;
Z26 is N or CR66;
r is 0,1, or 2;
R40 and R4’ are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; or
R40 and R41 combine to form a 37&#1470; membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the
PC17US2006/024361 group consisting of halogen, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
R62, R64, R65 and R66 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro;
Cy is selected from the group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl;
R39 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, aryl, heteroaryl, andNR50R51, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, &#908;Η, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and wherein aryl and heteroaryl are optionally substituted with one or more independent substituents R23;
R50 is hydrogen or lower alkyl optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino;
R51 is aryl or heteroaryl, wherein aryl and heteroaryl are optionally substituted with one or more independent substituents R23;
R23 at each occurrence is independently selected from the group consisting of-OH, -NH2, -CN, -NO2, -C(0)OH, -S(O)2NH2, -C(O)NH2, -OR57, -SR57, -NR48R57, -NR48C(O)R57, -NR48S(O)2R57, -S(O)2R57, -C(O)R57, -C(O)OR57, -C(O)NR48R57, -S(O)2NR48R57, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R23, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR58, -SR58, -NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R57 is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy,
PCI7US2006/024361 lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of-OR57, -SR57, -NR48R57, -C(O)OR57, -C(O)NR48R57, or -S(O)2NR48R57 is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R57 or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2j -C(O)NH2, -OR58, -SR58, -NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R58 at each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl carbon bound to 0, S, or N of -OR58, -SR58, -NR48R58, -C(O)OR58, -C(O)NR48R58, or -S(O)2NR48R58 is fluoro;
R48 at each occurrence is independently hydrogen or lower alkyl; and t is 0, 1,2, or 3.
[0032] In some embodiments of compounds of Formula IHe, A1 is -CR40R41- or -C(O)-, preferably -CH2- or -0(0)-. In some embodiments, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, and R62, R64, R65 and R66 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0033] In some embodiments, compounds of Formula HI have the structure according to the following sub-generic structure Formula Ulf:
&#1509; aA ? x
II JL / R82 1
R6 N [&#1507; R35
Formula IHf all salts, prodrugs, tautomers and isomers thereof, wherein A, Z2, Z4, Z5, Z6, X, R4, R5, R6, R34, R35 and R82 are as defined for Formula HI.
[0034] In some embodiments of compounds of Formula Ulf, R4 and R6 are hydrogen, A is -O-, -CR&#1470;Rb&#1470;, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or OR12, Z4 is N or OR14, Z5 is N or OR15, Z6 is N or OR16, and R12, R14, R15 and R16 are independently selected from the group consisting
PCI7US2006/024361 of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the of lower alkoxy is fluoro.
[0035] In some embodiments of compounds of Formula Ulf, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, Z2 is N or CR12, Z4 is N or CR14, Z5 is N or CR15, Z6 is N or CR16, R12, R14, R15 and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, and one of R34 and R35 is selected from the group consisting of optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl and optionally substituted heteroaryl, and the other of R34 and R3&#1470; is hydrogen or lower alkyl, or R34 and R35 together with tire nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5 or 7 membered nitrogen containing heteroaryl.
[0036] In some embodiments, compounds of Formula HI have the structure according to the following sub-generic structure Formula Dig:
<img file="IL188248A_D0016.tif" />
all salts, prodrugs, tautomers, and isomers thereof, wherein:
A! is , -CR&#1524;°R41-, -C(O)- or -NR48-;
Z32 is N or CR72;
Z34 isNorCR74;
Z35 is N or CR75;
Z36 isNorCR76;
X is 0 or S;
R48 at each occurrence is independently hydrogen or lower alkyl;
R40 and R41 are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; or
R40 and R41 combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
R72, R74, R75 and R76 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl and lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -Q- of lower alkoxy is fluoro;
R67 is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -NH2) -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2־ -C(S)NH2, -NHC(O)NH2> -NHC(S)NH2, -NHS(O)2NH2j -OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR®R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(0)2R6s, -NR69C(O)NH2j -NR69C(O)NR69R68, -NR69C(S)NH2> -NR69C(S)NR69R68, -NR69S(O)2NH2, -NR69S(O)2NR69R68, -S(O)R68, and -S(O)2R68;
one of R60 and R61 is lower alkyl, fluoro substituted lower alkyl, or -(CH2)0-2R70, and the other of R60 and R61 is hydrogen or lower alkyl;
or R60 and R61 together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5 or 7 membered nitrogen containing heteroaryl;
R68 is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R68 is optionally substituted lower alkenyl, no alkene carbon thereof is bound to N, S, 0, S(O), S(O)2, C(O) or C(S) of-OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2> -NR69C(O)NR69R68, -NR69C(S)NH2> -NR69C(S)NR69R68, -NR69S(O)2NH2, -NR69S(O)2NR69R68, -S(O)R68, or -S(O)2R68, optionally substituted lower alkynyl, provided, however, that when R68 is optionally substituted lower alkynyl, no alkyne carbon thereof is bound toN, S, O, S(O), S(O)2, C(O) 0rC(S) of-OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68,
-C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R6s, -NR69C(O)NH2, -NR69C(O)NR69R68, -NR69C(S)NH2, -NR69C(S)NR69R68, -NR69S(O)2NH2, -NR69S(O)2NR69R68, -S(O)R68, or -S(O)2R68, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
R69 is hydrogen or optionally substituted lower alkyl;
R70 is selected from the group consisting of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl; and
R82 is hydrogen or lower alkyl.
[0037] In some embodiments of compounds of Formula IHg, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-.
[0038] In some embodiments of compounds of Formula Hlg, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, and R67 is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -S(O)2NH2, -C(O)NH2, -OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69S(O)2R68, -S(O)R68, and -S(O)2R68.
[0039] In some embodiments, compounds of Formula HI have the structure according to the following sub-generic structure Formula IHh:
R46
<img file="IL188248A_D0017.tif" />
Formula IHh all salts, prodrugs, tautomers and isomers thereof, wherein A, X, R4, R5, R6, R37, R38, R42, R43, R45, R46, and R47 are as defined for Formula HI.
[0040] In some embodiments of compounds of Formula mh, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, and R42, R43, R45, R46 and R47 are independently selected from the group consisting of hydrogen, halogen, -OH, -CN, -NO2, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkyl, mono-alkylamino, di-alkylamino, and cycloalkylamino, further wherein at least one of, at least two of, at least three of, at least four of, or preferably all of R42, R43, R45, R46 and R47 are hydrogen.
[0041] In some embodiments, compounds of Formula HI have the structure according to the following sub-generic structure Formula Uli:
<img file="IL188248A_D0018.tif" />
Formula Uli all salts, prodrugs, tautomers, and isomers thereof, wherein:
A! is -O-, -CR40R41-, -C(O)- or -NR48-;
X is O or S;
R48 at each occurrence is independently hydrogen or lower alkyl;
R40 and R41 are independently selected from the group consisting of hydrogen, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino; or R40 and R41 combine to form a 3-7 membered monocyclic cycloalkyl or 5-7 membered monocyclic heterocycloalkyl, wherein the monocyclic cycloalkyl or monocyclic heterocycloalkyl is optionally substituted with one or more substituents selected from the group consisting of halogen, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
R67 is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted'heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -C(S)NH2, -NHC(O)NH2i -NHC(S)NH2, -NHS(O)2NH2, -OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(0)2R6s, -NR69C(O)NH2, -NR69C(O)NR69R68, -NR69C(S)NH2, -NR69C(S)NR69R68, -NR69S(O)2NH2, -NR69S(O)2NR69R68, -S(O)R68, and -S(O)2R68;
one of R60 and R61 is lower alkyl, fluoro substituted lower alkyl, or -(CH2)0.2R70 and the other of R60 and R61 is hydrogen or lower alkyl;
or R60 and R61 together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5 or 7 membered nitrogen containing heteroaryl;
R68 is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R68 is optionally substituted lower alkenyl, no alkene carbon thereof is bound to N, S, 0, S(O), S(O)2, C(O) or C(S) of -OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2i -NR69C(O)NR69R68, -NR69C(S)NH2j -NR69C(S)NR69R68, -NR69S(O)2NH2, -NR69S(O)2NR69R68, -S(O)R68, or -S(O)2R68, optionally substituted lower alkynyl, provided, however, that when R68 is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to N, S, O, S(O), S(O)2, C(O) or C(S) of-OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2> -NR69C(O)NR69R68, -NR69C(S)NH2, -NR69C(S)NR69R68, -NR69S(O)2NH2, -NR69S(O)2NR69R68, -S(O)R68, or -S(O)2R68, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
R69 is hydrogen or optionally substituted lower alkyl; and
R70 is selected from the group consisting of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl,
[0042] In some embodiments of compounds of Formula Uli, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-.
[0043] In some embodiments of compounds of Formula IUi, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, and R67 is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -S(O)2NH2, -C(O)NH2> -OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69S(O)2R68, -S(O)R68, and -S(O)2R68.
[0044] In some embodiments of compounds of Formula Uli, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -C(O)-, R67 is selected from the group consisting of hydrogen, halogen, lower alkyl, lower alkoxy, optionally substituted aryl, optionally substituted heteroaryl, and NR21R22, wherein R21 is hydrogen or lower alkyl, and R22 is hydrogen, lower alkyl, optionally substituted aryl or optionally substituted heteroaryl, and wherein the alkyl chain of R67, R21 or R22, when lower alkyl, or the alkyl chain of lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, and one of R60 and R61 is lower alkyl or fluoro substituted lower alkyl, and the other of R60 and R61 is hydrogen or lower alkyl. In some embodiments, A! is -C(O)-, R67 is optionally substituted aryl or optionally substituted heteroaryl, and one of R60 and R61 is lower alkyl or fluoro substituted lower alkyl, and the other of R60 and R61 is hydrogen or lower alkyl.
[0045] In some embodiments, compounds of Formula ΠΙ have the structure according to the following sub-generic structure Formula IHj:
<img file="IL188248A_D0019.tif" />
Formula IHj all salts, prodrugs, tautomers and isomers thereof, wherein A, R4, R5, Rs, R12, R14, R15, R16, and R36 are as defined for Formula ΠΙ.
[0046] In some embodiments of compounds of Formula Ulj, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, and R12, R14, R1s and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, preferably wherein R14 and R15 are hydrogen, more preferably wherein R12 is fluoro, R16 is hydrogen, fluoro or chloro, and R14 and R15 are hydrogen.
[0047] In some embodiments of compounds of Formula Ulj, R4 and R6 are hydrogen, A is -O-, -CRaRb-, -NR1-, or -C(O)-, preferably -CH2- or -C(O)-, R12, R14, R15 and R16 are independently selected from the group consisting of hydrogen, halogen, lower alkyl and lower alkoxy, wherein the alkyl chain of lower alkyl or lower alkoxy is optionally substituted with one or more substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino and cycloalkylamino, provided, however, that any substitution on the alkyl carbon bound to the -O- of lower alkoxy is fluoro, preferably wherein R14 and R13 are hydrogen, more preferably wherein R12 is fluoro, R16 is hydrogen, fluoro or chloro, and R14 and R15 are hydrogen, and R36 is selected from the group consisting of optionally substituted C2.6 alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and -NR!9R20, where R19 and R20 are as defined for Formula ΙΠ, further wherein one of R19 and R20 is hydrogen or optionally substituted lower alkyl, and the other of R19 and R20 is selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl and optionally substituted heteroaryl.
[0048] In some embodiments, compounds of Formula HI have the structure according to the following sub-generic structure Formula mk:
Formula mk all salts, prodrugs, tautomers and isomers thereof, wherein:
A! is -O-, -CR40R41-, -C(O)- or -NR48-;
R81 is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -NH2, -CN, -NO2, -C(0)OH, -S(O)2NH2, -C(O)NH2, -C(S)NH2, -NHC(O)NH2, -NHC(S)NH2> -NHS(O)2NH2, -OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2, -NR69C(O)NR69R68, -NR69C(S)NH2> -NR69C(S)NR69R68, -NR69S(O)2NH2, -NR69S(O)2NR69R68, -S(O)R68, and -S(O)2R68;
R7’ and R78 are independently selected from the group consisting of hydrogen, halogen, C!.3 alkyl, and fluoro substituted C!.3 alkyl;
R77 is selected from the group consisting of substituted methyl, optionally substituted C2.6 alkyl, optionally substituted aryl, optionally substituted heteroaryl, and -NR79R80, wherein methyl is substituted with one or more substituents selected from the group consisting of optionally substituted aryl and optionally substituted heteroaryl;
R68 is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R68 is optionally substituted lower alkenyl, no alkene carbon thereof is bound to N, S, O, S(O), S(O)2, C(O) or C(S) of-OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2,
-NR69C(O)NR69R68, -NR69C(S)NH2, -NR69C(S)NR69R68, -NR69S(O)2NH2j
-NR S(O)2NR69R68, -S(O)R68, or -S(O)2R68, optionally substituted lower alkynyl, provided, however, that when R68 is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to N, S, 0, S(O), S(O)2, C(O) or C(S) of-OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68 -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R6s, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2, -NR69C(O)NR69R68, -NR69C(S)NH2, -NR69C(S)NR69R68, -NR69S(O)2NH2, -NR69S(O)2NR69R68, -S(O)R68, or -S(O)2R68, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
R69 is hydrogen or optionally substituted lower alkyl; and&#1523;
R79 and R80 are independently hydrogen or optionally substituted lower alkyl, or R79 and R80 combine with the nitrogen to which they are attached to form optionally substituted 5-7 membered heterocycloalkyl.
[0049] In some embodiments of compounds of Formula IUk, A! is -CR40R41- or -C(O)-, preferably -CH2- or -C(O)-, more preferably -C(O)-.
[0050] In some embodiments of compounds of Formula IUk, A! is -CR4°R41- or -C(O)-, preferably -CHj- or -C(O)-, more preferably -C(O)-, and R81 is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -S(O)2NH2, -C(O)NH2, -OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69S(O)2R68, -S(O)R68, and -S(O)2R68.
[0051] In some embodiments, compounds of Formula HI have the structure according to the following sub-generic structure Formula Him.
<img file="IL188248A_D0020.tif" />
Formula ΤΠτη all salts, prodrugs, tautomers and isomers thereof, wherein:
R is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2> -C(S)NH2, -NHC(O)NH2j -NHC(S)NH2, -NHS(O)2NH2j -OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, NR C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2j -NR69C(O)NR69R68, -NR69C(S)NH2j -NR69C(S)NR69R68, -NR69S(O)2NH2, -NR69S(O)2NR69R68, -S(O)R68, and -S(O)2R68;’
R83 is selected from the group consisting of hydrogen, fluoro and chloro;
R is selected from the group consisting of optionally substituted C2.6 alkyl, optionally substituted aryl, optionally substituted heteroaryl, and -NR79R80;
R6 is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R68 is optionally substituted lower alkenyl, no alkene carbon thereof is bound to N, S, O, S(O), S(O)2, C(O) or C(S) of -OR68, -SR68, -!®69Η58, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2j -NR69C(O)NR69R68, -NR69C(S)NH2, -NR6s&#1523;C(S)NR69R68, -NR69S(O)2NH2, -NR S(O)2NR R , -S(O)R 8, or -S(O)2R68, optionally substituted lower alkynyl, provided, however, that when R68 is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to N, S, O, S(O), S(O)2, C(O) or C(S) of-OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)OR68, -C(O)NR69R68, -C(S)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69C(S)R68, -NR69S(O)2R68, -NR69C(O)NH2, -NR69C(O)NR69R68, -NR69C(S)NH2, -NRs9C(S)NR69R68, -NR S(O)2NH2, -NR69S(O)2NR69R68, -S(O)R68, or -S(O)2R68, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
R69 is selected from the group consisting of hydrogen and optionally substituted lower alkyl; and R79 and R80 are independently hydrogen or optionally substituted lower alkyl, or R79 and R80 combine with the nitrogen to which they are attached to form optionally substituted 5-7 membered heterocycloalkyl,
[0052] In some embodiments of compounds of Formula Him, R8’ is selected from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, -CN, -S(O)2NH2, -C(O)NH2, -OR68, -SR68, -NR69R68, -C(O)R68, -C(S)R68, -C(O)NR69R68, -S(O)2NR69R68, -NR69C(O)R68, -NR69S(O)2R68, -S(O)R68, and -S(O)2R68,
[0053] In one aspect, the present invention includes compounds that are useful as intermediates in the preparation of compounds of Formula HI, the compounds having a structure selected from the group consisting of Formula IV, Formula V, Formula VI, Formula VH, Formula VIH, and Formula IX as follows:
<img file="IL188248A_D0021.tif" />
wherein:
Z2, Z4) Z5, Z6, L2> X, s, R5׳, R17, R31, R32, R33, R37, R38, R42, R43, R45, R46, and R47 are as defined for Formula HI;
R108 is selected from the group consisting of -C(O)R84, -CH2I, -CH2C1, -CH2Br, -CH2OH, and -CH2OS(O)2R109;
R109 is selected from the group consisting of lower alkyl and aryl;
R84 is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;
R85 is selected from the group consisting of hydrogen, a nitrogen protecting group, -S(O)2R87, -C(O)NR88R89, and -C(S)NR88R89;
R86 is selected from the group consisting of hydrogen, lower alkyl, and a nitrogen protecting group;
R87 is selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, provided, however, that when R87 is optionally substituted lower alkenyl, no alkene carbon thereof is bound to S(O)2, optionally substituted lower alkynyl, provided, however, that when R87 is optionally substituted lower alkynyl, no alkyne carbon thereof is bound to S(O)2, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, and -NR90R91; and
R88, R89, R90 and R91 are independently selected from the group consisting of hydrogen, optionally substituted lower alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl and optionally substituted heteroaryl; or
R88 and R89 together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5 or 7 membered nitrogen containing heteroaryl.
[0054] In some embodiments of compounds of Formulae IV, V, VI, VII, or VUI, R108 is -C(O)R8‘1, preferably wherein R84 is hydrogen. In some embodiments of compounds of Formulae IV, V, VI, VII, or Vin, Z2 is N or CR2&#1523;, Z4 is N or CR14, Zs is N or CR15, and Z6 is N or CR16 and R12, R14, R15, R16, R17, R42, R43, R45, R46 and R47 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0055] In some embodiments, compounds of Formula IV have the structure according to the following sub-generic structure Formula IVa:
<img file="IL188248A_D0022.tif" />
Formula IVa wherein:
R84 is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;
R92, R93, R95, and R96 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy;
L4 is selected from the group consisting of-NR48-, -S-, , -NR48CH(R49)-, -SCH(R49)-, -OCH(R49)-, -C(O)NR48-, -S(O)2NR48-, -CH(R49)NR48-, -CH(R49)O-, -CH(R49)S-, -NR48C(O)-, and -NR48S(O)2-;
Cy is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl;
R97 at each occurrence is independently selected from the group consisting of -OH, -NH2) -CN,
-NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2j -OR57, -SR57, -NR48R57, -NR48C(O)R57, -NR48S(O)2R57, -S(O)2R57, -C(O)R57, -C(O)OR57, -C(O)NR48R57, -S(O)2NR48R57, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aiyl, and heteroaryl as R97, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2> -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR58, -SR58,
-NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R49 is selected from the group consisting of hydrogen, lower alkyl, and fluoro substituted lower alkyl;
R57 is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of-OR57, -SR57, -NR48R57, -C(O)OR57, -C(O)NR48R57, or -S(O)2NR48R57 is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R57 or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)0H, -S(O)2NH2j -C(O)NH2, -OR58, -SR58, -NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino; and
R58 at each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of-OR58, -SR58, -NR48R58, -C(O)OR58, -C(O)NR48R58, or -S(O)2NR48R58 is fluoro;
R48 at each occurrence is independently hydrogen or lower alkyl; and u is 0,1, 2, or 3.
[0056] In some embodiments of compounds of Formula IVa, at least two of R92, R93, R95 and R96 are hydrogen. In some embodiments, at least two of R92, R93, R95 and R96 are hydrogen, L4 is -NR48CH(R49)-, -SCH(R49)-, or -OCH(R49)-, preferably L4 is -OCH2-, Cy is aryl or heteroaryl, and each R97 is independently selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0057] In some embodiments, compounds of Formula IV have the structure according to the following sub-generic structure Formula IVb:
<img file="IL188248A_D0023.tif" />
Formula IVb wherein R84, R92, R93, R95, R96, R97, Cy and u are as defined for Formula IVa, and r is 0, 1 or 2.
[0058] In some embodiments of compounds of Formula IVb, at least two of R92, R93, R95 and R96 are hydrogen. In some embodiments, at least two of R92, R93, R95 and R96 are hydrogen, Cy is aryl or heteroaryl, and each R97 is independently selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0059] In some embodiments, compounds of Formula V have the structure according to the following sub-generic structure Formula Va:
<img file="IL188248A_D0024.tif" />
Formula Va wherein:
. R84 is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;
R92, R93, R95, and R96 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy;
R98 is selected from the group consisting of hydrogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy; and s is 0, 1, or 2;
[0060] In some embodiments, compounds of Formula VI have the structure according to the following sub-generic structure Formula Via:
<img file="IL188248A_D0025.tif" />
Formula Via wherein:
R84 is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;
R92, R94, R95, and R96 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy;
L4 is selected from the group consisting of -NR48-, -S-, , -NR48CH(R49)-, -SCH(R49)-, -OCH(R49)-, -C(O)NR48-, -S(O)2NR48-, -CH(R49)NR48-, -CH(R49)O-, -CH(R49)S-, -NR48C(O)-, and -NR48S(O)2-;
Cy is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl;
R97 at each occurrence is independently selected from the group consisting of -OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR57, -SR57, -NR48R57, -NR48C(O)R57, -NR48S(O)2R57, -S(O)2R57, -C(O)R57, -C(O)OR57, -C(O)NR48R57, -S(O)2NR48R57, halogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R97, or as substituents of lower alkyl, are optionally substituted with one or more substituents selected from the group consisting of-OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2, -OR58, -SR58, -NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R5s, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R49 is selected from the group consisting of hydrogen, lower alkyl, and fluoro substituted lower alkyl;
R57 is selected from the group consisting of lower alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, provided, however, that any substitution of the alkyl carbon bound to 0, S, or N of -OR57, -SR57, -NR48R57, -C(O)OR57, -C(O)NR48R57, or -S(O)2NR48R57 is fluoro, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl as R57 or as substituents of lower alkyl are optionally substituted with one or more substituents selected from the group consisting of-OH, -NH2, -CN, -NO2, -C(O)OH, -S(O)2NH2, -C(O)NH2> -OR58, -SR58, -NR48R58, -NR48C(O)R58, -NR48S(O)2R58, -S(O)2R58, -C(O)R58, -C(O)OR58, -C(O)NR48R58, -S(O)2NR48R58, halogen, lower alkyl, fluoro substituted lower alkyl, and cycloalkylamino;
R58 at each occurrence is independently selected from the group consisting of lower alkyl, heterocycloalkyl and heteroaryl, wherein lower alkyl is optionally substituted with one or more substituents selected from the group consisting of fluoro, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, monoalkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the alkyl carbon bound to 0, S, or N of-OR58, -SR58, -NR48R58, -C(O)0R58, -C(O)NR48R58, or -S(O)2NR48R58 is fluoro;
R48 at each occurrence is independently hydrogen or lower alkyl; and u is 0, 1, 2 or 3.
[0061] In some embodiments of compounds of Formula Via, at least two of R92, R94, R95 and R96 are hydrogen. In some embodiments, at least two of R92, R94, R95 and R96 are hydrogen, L4 is -NR48CH(R49)-, -SCH(R49)&#1470;, or -OCH(R49)-, preferably L4 is -OCH2-, Cy is aryl or heteroaryl, and each R97 is independently selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0062] In some embodiments, compounds of Formula VI have the structure according to the following sub-generic structure Formula Vlb;
R96 r94
A&#1470;r94 toy-(R97)u r92 0K
R92 O
Formula Vlb wherein R84, R92, R94, R95, R96, R97, Cy and u are as defined for Formula Via and r is 0, 1 or 2.
[0063] In some embodiments of compounds of Formula Vlb, at least two of R92, R94, R95 and R96 are hydrogen. In some embodiments, at least two of R92, R94, R95 and R96 are hydrogen, Cy is aryl or heteroaryl, and each R97 is independently selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0064] In some embodiments, compounds of Formula VH have the structure according to the following sub-generic structure Formula Vila:
R96 r95
Formula Vila wherein:
R84 is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;
R92, R94, R95, and R96 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy;
R99 is selected from the group consisting of optionally substituted lower alkyl, optionally substituted aryl, optionally substituted heteroaryl, and -NR79R80; and
R79 and R80 are independently hydrogen or optionally substituted lower alkyl, or R79 and R80 combine with the nitrogen to which they are attached to form optionally substituted 5-7 membered heterocycloalkyl.
[0065] In some embodiments of compounds of Formula VHa, one of R92 and R96 is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy, and the other of R92 and R96 is selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy; in further embodiments, one of R92 and R96 is hydrogen, fluoro or chloro, and the other of R92 and R96 is fluoro or chloro; in further embodiments, R92 is fluoro and R96 is hydrogen, fluoro, or chloro; in further embodiments, R92 and R96 are both fluoro.
[0066] In some embodiments of compounds of Formula VHa, R94 and R95 are hydrogen; in further embodiments, one of R92 and R96 is selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy and the other of R92 and R96 is selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy; in further embodiments, one of R92 and R96 is selected from hydrogen, fluoro or chloro and the other of R92 and R90 is selected from fluoro or chloro; in further embodiments, R92 is fluoro and R96 is selected from hydrogen, fluoro, or chloro; in further embodiments, R92 and R96 are both fluoro.
[0067] In some embodiments, compounds of Formula VH have the structure according to the following sub-generic structure Formula Vllb:
<img file="IL188248A_D0026.tif" />
r82 N—r100 RW1
Formula VHb wherein:
X is O or S;
R84 is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;
R92, R94, R95, and R96 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy;
R82 is hydrogen or lower alkyl;
one of R100 and R101 is lower alkyl, fluoro substituted lower alkyl, or -(CH2)0.2R70, and the other of R100 and R101 is hydrogen or lower alkyl; or
R100 and R101 together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5 or 7 membered nitrogen containing heteroaryl; and
R70 is selected from the group consisting of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl.
[0068] hi some embodiments of compounds of Formula VITb, at least two of R92, R94, R95 and R96 are hydrogen. In some embodiments, at least two of R92, R94, R95 and R96 are hydrogen, and R70 is aryl or heteroaryl, wherein aryl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0069] In some embodiments, compounds of Formula VIII have the structure according to the following sub-generic structure Formula Villa:
r103 λ-R107 ( R
Ν'-&#1524;—N.
Formula VUIa wherein:
X is O or S;
R84 is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;
R102, R103, R105, R1m&#1470; and R107 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy;
one of R100 and R101 is lower alkyl, fluoro substituted lower alkyl, or -(CH2)0-2R7° and the other of R100 and R101 is hydrogen or lower alkyl;
or R100 and R101 together with the nitrogen to which they are attached form optionally substituted 5-7 membered heterocycloalkyl or optionally substituted 5 or 7 membered nitrogen containing heteroaryl; and
R70 is selected from the group consisting of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl.
[0070] In some embodiments of compounds of Formula VUIa, at least two, also at least three, also at least four, or all of R102, R103, R105, R106, and R107 are hydrogen. In some embodiments, at least two,
PCI7US2006/024361 also at least three, also at least four, or all of R102, R103, R105, R106, and R107 are hydrogen, and R70 is aryl or heteroaryl, wherein aryl and heteroaryl are optionally substituted with one or more substituents selected from the group consisting of halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy.
[0071] In some embodiments, compounds of Formula IX have the structure according to the following sub-generic structure Formula IXa:
<img file="IL188248A_D0027.tif" />
Formula IXa wherein:
R84 is selected from the group consisting of hydrogen, lower alkoxy, -OH, and -Cl;
R92, R95, and R96 are independently selected from the group consisting of hydrogen, halogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy;
R98 is selected from the group consisting of hydrogen, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, and fluoro substituted lower alkoxy; and s is 0,1, or 2.
[0072] In some embodiments of any of the above embodiments of compounds of Formula IVa, IVb, Va, Via, VIb, VHa, Vllb, Villa, or IXa, R84 is hydrogen.
[0073] In some embodiments of the above compounds, compounds are excluded where N (except where N is a heteroaryl ring atom), O, or S is bound to a carbon that is also bound to N (except where N is a heteroaryl ring atom), O, or S; or where N (except where N is a heteroaryl ring atom), O, C(S), C(O), or S(O)n (n is 0-2) is bound to an alkene carbon of an alkenyl group or bound to an alkyne carbon of an alkynyl group; accordingly, in some embodiments compounds which include linkages such as the following are excluded from the present invention: -NR-CH2-NR-, -O-CH2-NR-> -S-CH2-NR-, -NR-CH2 , -O-CH2-O-, -S-CH2-O-, -NR-CH2-S-, -O-CH2-S-, -S-CH2-S-, -NR-CH=CH-, -CH=CH-NR-, -NR-C־€-, -C=C-NR-> -O-CH=CH-, -CH=CH-O-, CC-, -CC , -S(O)0.2־CH=CH-, -CH=CH-S(0)o , -S(O)0.2-C־C-, -CsC-S(O)0.2-, -C(O)-CH=CH-, -CH=CH-C(O)-, -CC-C(O)-, or-C(O)-C sC-, -C(S)-CH־=CH-, -CH=CH-C(S)-, -CC-C(S)-, or -C(S)-CC-.
[0074] In reference to compounds herein, specification of a compound or group of compounds includes pharmaceutically acceptable salts of such compound(s), prodrug(s), and all stereoisomers, unless clearly indicated to the contrary. In reference to compounds of Formula IH, it is understood that such reference includes compounds of Formulae Hla-IHq, and all sub-embodiments thereof.
[0075] In one aspect, the invention provides methods for treating a protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of Formula HI. The terms “treat,” “therapy,” and like terms refer to the administration of material, e.g., compound of Formula EH, in an amount effective to prevent, alleviate, or ameliorate one or more symptoms of a disease or condition, i.e., indication, and/or to prolong the survival of the subject being treated. The term “protein kinase mediated disease or condition” refers to a disease or condition in which the biological function of a protein kinase affects the development and/or course of the disease or condition, and/or in which modulation of the protein kinase alters the development, course, and/or symptoms of the disease or condition. A protein kinase mediated disease or condition includes a disease or condition for which modulation provides a therapeutic benefit, e.g. wherein treatment with protein kinase inhibitors, including compounds described herein, provides a therapeutic benefit to the subject suffering from or at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of a compound of Formula HI in combination with one or more other therapies for the disease or condition.
[0076] In one aspect, the invention provides methods for treating a Raf protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of Formula HI. The terms “Raf protein kinase mediated disease or condition,” ”Raf mediated disease or condition,” and the like refer to a disease or condition in which the biological function of a Raf kinase, including any mutations thereof, affects the development and/or course of the disease or condition, and/or in which modulation of the Raf protein kinase alters the development, course, and/or symptoms of the disease or condition. The Raf protein kinase includes, but is not limited to, B-Raf, mutations of B-Raf, c-Raf-1 and mutations of c-Raf-1. In some embodiments, the Raf protein kinase is B-Raf mutation V600E. In further embodiments, the disease or condition is a cancer that is amenable to treatment by an inhibitor of the V600E mutant B-Raf. A Raf protein kinase mediated disease or condition includes a disease or condition for which Raf inhibition provides a therapeutic benefit, e.g. wherein treatment with Raf inhibitors, including compounds described herein, provides a therapeutic benefit to the subject suffering from or at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of a compound of Formula HI in combination with one or more other therapies for the disease or condition.
[0077] In one aspect, the invention provides methods for treating a Fms protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of Formula ΠΙ. The terms “Fms protein kinase mediated disease or condition,” “Fms mediated disease or condition,” and the like refer to a disease or condition in which the biological function of a Fms protein kinase, including any mutations thereof, affects the development and/or course of the disease or condition, and/or in which modulation of Fms alters the development, course, and/or symptoms of the disease or condition. A Fms mediated disease or condition includes a disease or condition for which Fms inhibition provides a therapeutic benefit, e.g. wherein treatment with Fms inhibitors, including compounds described herein, provides a therapeutic benefit to the subject suffering from or at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of a compound of Formula III in combination with one or more other therapies for the disease or condition.
[0078] In one aspect, the invention provides methods for treating a Kit protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of Formula ΙΠ. The terms “Kit mediated disease or condition,” “Kit protein kinase mediated disease or condition,” and the like refer to a disease or condition in which the biological function of a Kit protein kinase, including any mutation thereof, affects the development and/or course of the disease or condition, and/or in which modulation of Kit alters the development, course, and/or symptoms of the disease or condition. A Kit mediated disease or condition includes a disease or condition for which Kit inhibition provides a therapeutic benefit, e.g. wherein treatment with Kit inhibitors, including compounds described herein, provides a therapeutic benefit to the subject suffering from or at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of a compound of Formula IH in combination with one or more other therapies for the disease or condition.
[0079] In one aspect, the invention provides methods for treating a Jnk protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a compound of Formula HI. The terms “Jnk mediated disease or condition,” “Jnk protein Irinasp. mediated disease or condition,” and the like refer to a disease or condition in which the biological function of a Jnk kinase, e.g. Jnkl, Jnk2, Jnk3, or any mutation thereof, affects the development and/or course of the disease or condition, and/or in which modulation of the Jnk kinase alters the development, course, and/or symptoms of the disease or condition. A Jnk mediated disease or condition includes a disease or condition for which Jnk inhibition provides a therapeutic benefit, e.g. wherein treatment with Jnk inhibitors, including compounds described herein, provides a therapeutic benefit to the subject suffering from or at risk of the disease or condition. In one aspect, the method involves administering to the subject an effective amount of a compound of Formula IH in combination with one or more other therapies for the disease or condition. The Jnk protein kinase includes, but is not limited to, Jnkl, Jnk2, or Jnk3.
[0080] In some embodiments, a compound of the invention has an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted kinase activity assay. In some embodiments, a compound of Formula HI will have an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM with respect to at least one kinase selected from the group consisting of B-Raf, c-Raf-1, Fms,Jnkl, Jnk2, Jnk3, and Kit, and any mutations thereof. In some embodiments, a compound of Formula HI will have an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM with respect to at least one kinase selected from the group consisting of B-Raf, B-Raf V600E mutant, c-Raf-1, Fms, Jnkl, Jnk2, Jnk3, and Kit, preferably B-Raf, B-Raf V600E mutant or c-Raf-1.
[0081] In some embodiments, a compound of Formula HI is an inhibitor of a Raf kinase and has an ICjq of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted Raf kinase activity assay. In some embodiments, a compound of Formula HI will have an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM with respect to B-Raf, c-Raf-1, or B-Raf V600E mutant. In some embodiments, a compound of Formula ΙΠ will selectively inhibit one Raf kinase relative to one or more other Raf kinases. In some embodiments, the compound of Formula HI will selectively inhibit a mutation of the Raf kinase relative to the wild type kinase, for example B-Raf V600E relative to wild type B-Raf.
[0082] In some embodiments, a compound of Formula HI is an inhibitor of a Fms kinase and has an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted Fms kinase activity assay. In some embodiments, a compound of Formula HI will selectively inhibit Fms kinase relative to Kit kinase.
[0083] In some embodiments, a compound of Formula HI is an inhibitor of a Kit kinase and has an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted Kit kinase activity assay.
[0084] In some embodiments, a compound of Formula HI is an inhibitor of a Jnk kinase and has an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted Jnk kinase activity assay. In some embodiments, a compound of Formula HI is an inhibitor of a Jnkl kinase and has an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted Jnkl kinase activity assay. In some embodiments, a compound of Formula ΠΙ is an inhibitor of a Jnk2 kinase and has an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted Jnk2 kinase activity assay. In some embodiments, a compound of Formula ΠΙ is an inhibitor of a Jnk3 kinase and has an IC50 of less than 500 nm, less than 100 nM, less than 50 nM, less than 20 nM, less than 10 nM, less than 5 nM, or less than 1 nM as determined in a generally accepted Jnk3 kinase activity assay. In some embodiments, a compound of Formula HI will selectively inhibit one Ink kinase relative to one or more other Ink kinases, such as selectively inhibiting Jnk 1 relative to Jnk 2 and/or Jnk3, selectively inhibiting Jnk2 relative to Jnk3 and/or Juki, or selectively inhibiting Jnk3 relative to Juki and/or Jnk 2.
[0085] Further to any of the above mentioned embodiments, a compound of the invention will inhibit the effects of a mutation of the kinase, including, but not limited to, a mutation that is related to a disease state, such as a cancer. For example, B-Raf V600E mutant is present in a high percentage of some cancers, such as melanoma, and compounds of the invention will inhibit the kinase activity of this mutant.
[0086] Further to any of the above embodiments, a compound of the invention may selectively inhibit one kinase relative to one or more other kinases, where preferably inhibition is selective with respect to any of the other kinases, whether a kinase discussed herein, or other kinases. In some embodiments, the compound may selectively inhibit the effects of a mutation of the kinase relative to the wild type kinase, for example B-Raf V600E relative to wild type B-Raf. In some embodiments, the compound may selectively inhibit Fms relative to Kit. Selective inhibition of one kinase relative to another is such that the IC50 for the one kinase may be at least about 2&#1470;fold, also 5-fold, also 10-fold, also 20-fold, also 50-fold, or at least about 100-fold less than the ICSO for any of the other kinases as determined in a generally accepted kinase activity assay.
[0087] In another aspect, the invention provides methods for treating a protein kinase mediated disease or condition in an animal subject, wherein the method involves administering to the subject an effective amount of a composition including a compound of Formula HI.
[0088] In one aspect, the invention provides methods for treating a disease or condition mediated by a protein kinase selected from the group consisting of B-Raf, c-Raf-1, Fms, Juki, Jnk2, Jnk3, and Kit, and any mutations thereof, by administering to the subject an effective amount of a composition including a compound of Formula HI.
[0089] In one aspect, the invention provides methods for treating a disease or condition mediated by B-Raf, c-Raf-1, or B-Raf V600E by administering to the subject an effective amount of a composition including a compound of Formula HI. In one aspect, the invention provides methods for treating a disease or condition mediated by B-Raf, c-Raf-1, or B-Raf V600E by administering to the subject an effective amount of a composition including a compound of Formula KI in combination with one or more other suitable therapies for treating the disease or condition. In one aspect, the invention provides methods for treating a cancer mediated by B-Raf V600E mutant by administering to the subject an effective amount of a composition including a compound of Formula HI in combination with one or more suitable anticancer therapies, such as one or more chemotherapeutic drugs.
[0090] In another aspect, the invention provides a method of treating or prophylaxis of a disease or condition in a mammal, by administering to the mammal a therapeutically effective amount of a compound of Formula HI, a prodrug of such compound, or a pharmaceutically acceptable salt of such compound or prodrug. The compound can be alone or can be part of a composition. In another aspect, the invention provides a method of treating or prophylaxis of a disease or condition in a mammal, by administering to the mammal a therapeutically effective amount of a compound of Formula HI, a prodrug of such compound, or a pharmaceutically acceptable salt of such compound or prodrug in combination with one or more other suitable therapies for the disease or condition.
[0091] In another aspect, the invention provides compositions that include a therapeutically effective amount of a compound of Formula IU and at least one pharmaceutically acceptable carrier, excipient, and/or diluent. The composition can include a plurality of different pharmacologically ’ active compounds, which can include a plurality of compounds of Formula ΙΠ.
[0092] In a related aspect, the invention provides kits that include a composition as described herein. In some embodiments, the composition is packaged, e.g., in a vial, bottle, flask, which may be further packaged, e.g., &#1470;within a box, envelope, or bag; the composition is approved by the U.S. Food and Drug Administration or similar regulatory agency for administration to a mammal, e.g., a human; the composition is approved for administration to a mammal, e.g., a human, for a protein kinase mediated disease or condition; the invention kit includes written instructions for use and/or other indication that the composition is suitable or approved for administration to a mammal, e.g., a human, for a protein kinase-mediated disease or condition; and the composition is packaged in unit dose or single dose form, e.g., single dose pills, capsules, or the like.
[0093] In aspects involving treatment or prophylaxis of a disease or condition with the compounds of Formula ΠΙ, the disease or condition is, for example without limitation, selected from the group consisting of neurologic diseases such as ischemic stroke, cerebrovascular ischemia, multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson’s disease, amyotrophic lateral sclerosis, dementia, senile chorea, and Huntington’s disease; neoplastic diseases and associated complications, including chemotherapy-induced hypoxia, gastrointestinal stromal tumors (GISTs), prostate tumors, mast cell tumors (including canine mast cell tumors), acute myeloid leukemia, acute lymphocytic leukemia, chronic myeloid leukemia, multiple myeloma, melanoma, mastocytosis, gliomas, glioblastoma, astrocytoma, neuroblastoma, sarcomas (e.g. sarcomas of neuroectodermal origin), carcinomas (e.g. lung, breast, pancreatic, renal, female genital tract, carcinoma in situ), lymphoma (e.g. histiocytic lymphoma), neurofibromatosis (including Schwann cell neoplasia), myelodysplastic syndrome, leukemia, tumor angiogenesis, and cancers of the thyroid, liver, bone, skin, brain, pancreas, lung (e.g. small cell lung cancer), breast, colon, prostate, testes and ovary; pain of neuropathic or inflammatory origin, including acute pain, chronic pain, and migraine; cardiovascular diseases including heart failure, cardiac hypertrophy, thrombosis (e.g. thrombotic microangiopathy syndromes), atherosclerosis, reperfusion injury and ischemia (e.g. cerebrovascular ischemia, liver ischemia); inflammation including, but not limited to, polycystic kidney disease (PKD), age-related macular degeneration, rheumatoid arthritis, allergic rhinitis, inflammatory bowel disease (IBD), ulcerative colitis, Crohn’s disease, systemic lupus erythematosis, Sjogren’s Syndrome, Wegener’s granulomatosis, psoriasis, scleroderma, chronic thyroiditis, Grave’s disease, myasthenia gravis, multiple sclerosis, osteoarthritis, endometriosis, scarring, vascular restenosis, fibrotic disorders, hypereosinophilia, CNS inflammation, pancreatitis, nephritis, atopic dermatitis, and hepatitis; immunodeficiency diseases, organ transplant rejection, graft versus host disease; renal or prostatic diseases including diabetic nephropathy, nephrosclerosis, glomerulonephritis, interstitial nephritis, Lupus nephritis, prostate hyperplasia, chronic renal failure, tubular necrosis, diabetesassociated renal complications, and hypertrophy; metabolic diseases including type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity, hepatic steatosis, insulin resistance, hyperglycemia, lipolysis and obesity; infection, including, but not limited to Helicobacter pylori and Influenza virus, fever, sepsis; pulmonary diseases including chronic obstructive pulmonary disease (COPD), acute respiratory distress syndrome (ARDS), asthma, allergy, bronchitis, emphysema, and pulmonary fibrosis; genetic developmental diseases such as Noonan’s syndrome, Costello syndrome, (faciocutaneoskeletal syndrome), leopard syndrome, cardio-faciocutaneous syndrome (CFC) and neural crest syndrome abnormalities causing cardiovascular, skeletal, intestinal, skin, hair and endocrine diseases; and disorders of bone structure or mineralization, including osteoporosis, increased risk of fracture, hypercalcemia, and bone metastases.
[0094] In a related aspect, compounds of Formula ΙΠ, can be used in the preparation of a medir.3me.nt for the treatment of a B-Raf-mediated disease or condition, selected from the group consisting of neurologic diseases such as ischemic stroke, multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson’s disease; neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, carcinoma (e.g. lung, breast, pancreatic, renal), lymphoma (e.g. histiocytic lymphoma) and cancer of the thyroid, lung (e.g. small cell lung cancer), liver, breast, ovary and colon, neurofibromatosis, myelodysplastic syndrome, leukemia, tumor angiogenesis; pain of neuropathic or inflammatory origin, including acute pain, chronic pain, and migraine;
cardiovascular diseases including heart failure, cardiac hypertrophy, thrombosis (e.g. thrombotic microangiopathy syndromes), atherosclerosis, reperfusion injury; inflammation including, but not limited to, psoriasis, polycystic kidney disease (PKD), arthritis and autoimmune diseases and conditions, osteoarthritis, endometriosis, scarring, vascular restenosis, fibrotic disorders, rheumatoid arthritis, inflammatory bowel disease (IBD); immunodeficiency diseases, organ transplant rejection, graft versus host disease; renal or prostatic diseases including diabetic nephropathy, nephrosclerosis, glomerulonephritis, prostate hyperplasia; metabolic disorders, obesity; infection, including, but not limited to Helicobacter pylori and Influenza virus, fever, sepsis; pulmonary diseases including chronic obstructive pulmonary disease (COPD) and acute respiratory distress syndrome (ARDS); genetic developmental diseases such as Noonan’s syndrome, Costello syndrome, (faciocutaneoskeletal syndrome), leopard syndrome, cardio-faciocutaneous syndrome (CFC), and neural crest syndrome abnormalities causing cardiovascular, skeletal, intestinal, skin, hair and endocrine diseases.
[0095] In a related aspect, compounds of Formula HI, can be used in the preparation of a medicament for the treatment of a c-Raf mediated disease or condition selected from the group consisting of colorectal, ovarian, lung and renal cell carcinoma, acute myeloid leukemia, myelodysplastic syndromes, tumor angiogenesis, and neuroendocrine tumors such as medullary thyroid cancer, carcinoid, small cell lung cancer and pheochromocytoma.
[0096] In a related aspect, compounds of Formula HI, can be used in the preparation of a medicament for the treatment of a Fms-mediated disease or condition selected from the group consisting of immune disorders, including rheumatoid arthritis, systemic lupus erythematosis (SLE), Wegener's granulomatosis, and transplant rejection, inflammatory diseases including Chronic Obstructive Pulmonary Disease (COPD), emphysema, and atherosclerosis, metabolic disorders, including insulin resistance, hyperglycemia, and lipolysis, disorders of bone structure or mineralization, including osteoporosis, increased risk of fracture, hypercalcemia, and bone metastases, kidney diseases, including nephritis (e.g. glomerulonephritis, interstitial nephritis, Lupus nephritis), tubular necrosis, diabetes-associated renal complications, and hypertrophy and cancers, including multiple myeloma, acute myeloid leukemia, chronic myeloid leukemia (CML), breast cancer, and ovarian cancer.
[0097] In a related aspect, compounds of Formula HI, can be used in the preparation of a medicament for the treatment of a Jnk-mediated disease or condition selected from the group consisting of Metabolic diseases including type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity, and hepatic steatosis; cardiovascular diseases such as atherosclerosis, ischemia (e.g. cerebrovascular ischemia, liver ischemia), reperfusion injury, cardiac hypertrophy; renal diseases such as chronic renal failure; neoplastic diseases and associated complications, including chemotherapyinduced hypoxia, prostate tumors, myeloid leukemia and cancers of the liver, bone, skin, brain, pancreas, lung breast, colon, prostate and ovary; transplant rejection; pain of neuropathic or inflammatory origin including acute and chronic pain; inflammatory and autoimmune diseases including age-related macular degeneration, rheumatoid arthritis, inflammatory bowel disease, ulcerative colitis, Crohn’s disease, systemic lupus erythematosis, Sjogren’s Syndrome, psoriasis, scleroderma, chronic thyroiditis, Grave’s disease, myasthenia gravis, and multiple sclerosis, and inflammation in other organs including CNS inflammation, pancreatitis, nephritis, atopic dermatitis, and hepatitis; airway inflammatory diseases such as asthma, allergy, bronchitis, pulmonary fibrosis, chronic obstructive pulmonary disease; neurologic diseases such as stroke, cerebrovascular ischemia, neurodegenerative diseases such as Parkinson’s disease, Alzheimer’s disease, amyotrophic lateral sclerosis, dementia, senile chorea, head and spinal cord trauma, and Huntington’s disease.
[0098] In a related aspect, compounds of Formula m, can be used in the preparation of a medicament for the treatment of a Ink 1-mediated disease or condition selected from the group consisting of type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity and hepatic steatosis.
[0099] In a related aspect, compounds of Formula DI, can be used in the preparation of a medicament for the treatment of a Jnk2-mediated disease or condition, such as atherosclerosis.
[0100] In a related aspect, compounds of Formula ID, can be used in the preparation of a medicament for the treatment of a Jnk3-mediated disease or condition selected from the group consisting of inflammatory diseases including autoimmune diseases such as rheumatoid arthritis, inflammatory bowel syndrome, Crohn’s disease, systemic lupus erythematosis, Sjogren’s Syndrome, psoriasis and multiple sclerosis, airway inflammatory diseases such as asthma, allergy, pulmonary fibrosis, and chronic obstructive pulmonary disease, and inflammation in other organs, such as CNS inflammation, pancreatitis, nephritis, and hepatitis; neurologic diseases such as stroke, cerebrovascular ischemia, and neurodegenerative diseases such as Parkinson’s disease, Alzheimer’s disease, and Huntington’s disease; and neoplastic diseases such as prostate tumors and myeloid leukemia.
[0101] In a related aspect, compounds of Formula HI, can be used in the preparation of a medicament for the treatment of a Kit-mediated disease or condition selected from the group consisting of malignancies, including mast cell tumors, small cell lung cancer, testicular cancer, gastrointestinal stromal tumors (GISTs), glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female genital tract, sarcomas of neuroectodermal origin, colorectal carcinoma, carcinoma in situ, Schwann cell neoplasia associated with neurofibromatosis, acute myelocytic leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis, melanoma, and canine mast cell tumors, and inflammatory diseases, including asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, inflammatory bowel syndrome, transplant rejection, and hypereosinophilia.
[0102] Additional aspects and embodiments will be apparent from the following Detailed Description and from the claims.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
As used herein the following definitions apply unless clearly indicated otherwise:
[0103] “Halogen” refer to all halogens, that is, chloro (Cl), fluoro (F), bromo (Br), or iodo (I).
[0104] “Hydroxyl” or hydroxy refer to the group -OH.
[0105] “Thiol” refers to the group -SH.
[0106] “Lower alkyl” alone or in combination means an alkane-derived radical containing from 1 to 6 carbon atoms (unless specifically defined) that includes a straight chain alkyl or branched alkyl. The straight chain or branched alkyl group is attached at any available point to produce a stable compound, In many embodiments, a lower alkyl is a straight or branched alkyl group containing from 1 -6, 1 -4, or 1 -2, carbon atoms, such as methyl, ethyl, propyl, isopropyl, butyl, t-butyl, and the like, A substituted lower alkyl denotes lower alkyl that is independently substituted, unless indicated otherwise, with one or more, preferably 1,2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of-F, -OH, -NH2> -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2j -NHS(O)2NH2j -C(NH)NH2, -OR0, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)OR°, -C(S)OR°, -S(O)R°, -S(O)2R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR°R°, -S(O)2NHR°, -S(O)2NR°R°, -C(NH)NHR°, -C(NH)NRpRc, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R°, -NR°C(S)R°, -NHS(O)2R°, -NR°S(O)2R°, -NHC(O)NHR°, -NHC(S)NHR°, -NR°C(O)NH2, -NR°C(S)NH2, -NR°C(O)NHR°, -NR°C(S)NHR0, -NHC(O)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR°R0, -NR°C(S)NR°R°, -NHS(O)2NHR°, -NR°S(O)2NH2, -NR°S(O)2NHR°, -NHS(O)2NR°R°, -NRoS(O)2NR°R°, -NHR°, -NR°R°, -Re, -Rf, and -Re, Furthermore, possible substitutions include subsets of these substitutions, such as are indicated herein, for example, in the description of compounds of Formula m, attached at any available atom to produce a stable compound. For example fluoro substituted lower alkyl” denotes a lower alkyl group substituted with one or more fluoro atoms, such as perfluoroalkyl, where preferably the lower alkyl is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is understood that substitutions are attached at any available atom to produce a stable compound, when optionally substituted alkyl is an R group of a moiety such as -OR (e.g. alkoxy), -SR (e.g. thioalkyl), -NHR (e.g. alkylamino), -C(O)NHR, and the like, substitution of the alkyl R group is such that substitution of the alkyl carbon bound to any O, S, or N of the moiety (except where N is a heteroaryl ring atom) excludes substituents that would result in any O, S, or N of the substituent (except where N is a heteroaryl ring atom) being bound to the alkyl carbon bound to any O, S, or N of the moiety. “C2.6 alkyl” denotes lower alkyl containing 2-6 carbon atoms. A “substituted C2.6 alkyl” denotes optionally substituted lower alkyl containing 2-6 carbon atoms. A “substituted methyl” denotes methyl that is independently substituted, unless indicated otherwise, with 1,2, or 3 substituents, wherein the substituents are selected as per optionally substituted lower alkyl.
[0107] C1-3 alkylene refers to a divalent alkane-derived radical containing 1-3 carbon atoms, straight chain or branched, from which two hydrogen atoms are taken from the same carbon atom or from different carbon atoms. C!.3 alkylene includes methylene -CH2-, ethylene -CH2CH2-, propylene -CH2CH2CH2-, and isopropylene -CH(CH3)CH2- or -CH2CH(CH3)-. C!.3 alkylene substituted with one or more substituents indicates C!.3 alkylene that is independently substituted, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents as indicated, attached at any available atom to produce a stable compound.
[0108] “Lower alkenyl” alone or in combination means a straight or branched hydrocarbon containing 2-6 carbon atoms (unless specifically defined) and at least one, preferably 1-3, more preferably 1-2, most preferably one, carbon to carbon double bond. Carbon to carbon double bonds may be either contained within a straight chain or branched portion. Examples of lower alkenyl groups include ethenyl, propenyl, isopropenyl, butenyl, and the like. A substituted lower alkenyl denotes lower alkenyl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of -F, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2j -S(O)2NH2> -NHC(O)NH2, -NHC(S)NH2i -NHS(O)2NH2j -C(NH)NH2j -OR0, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)OR°, -C(S)OR°, -S(O)R°, -S(O)2R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°R0, -C(S)NR°R°, -S(O)2NHR°, -S(O)2NR°R°> -C(NH)NHR°, -C(NH)NRPR°, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R0, -NR°C(S)R°, -NHS(O)2R°, -NR°S(O)2R°, -NHC(O)NHR°, -NHC(S)NHR°, -NR°C(O)NH2> -NR°C(S)NH2, -NR°C(0)NHR°> -NRDC(S)NHR°, -NHC(O)NR°R°, -NHC(S)NR°R°, -NRoC(O)NR°R°, -NR0C(S)NR0R°, -NHS(O)2NHR°, -NR°S(O)2NH2, -NRoS(O)2NHR°, -NHS(O)2NRoR°, -NRoS(O)2NR°Ro, -NHR°, -NR°R°, -Rd, -Rf, and -RB. Further, possible substitutions include subsets of these substitutions, such as are indicated herein, for example, in the description of compounds of Formula HI, attached at any available atom to produce a stable compound. For example “fluoro substituted lower alkenyl” denotes a lower alkenyl group substituted with one or more fluoro atoms, where preferably the lower alkenyl is substituted with 1,2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is understood that substitutions are attached at any available atom to produce a stable compound, substitution of alkenyl groups are such that -F, -C(O)-, -C(S)-, -C(NH)-, -S(O)-, (0)2-, , -S-, or N (except where N is a heteroaryl ring atom), are not bound to an alkene carbon thereof. Further, where alkenyl is a substituent of another moiety or an R group of a moiety such as -OR, -NHR, -C(O)R, and the like, substitution of the moiety is such that any -C(O)-, -C(S)-, -S(O)-, -S(O)20- ,־-, -S-, or N thereof (except where N is a heteroaryl ring atom) are not bound to an alkene carbon of the alkenyl substituent or R group. Further, where alkenyl is a substituent of another moiety or an R group of a moiety such as -OR, -NHR, -C(0)NHR, and the like, substitution ofthe alkenyl R group is such that substitution of the alkenyl carbon bound to any 0, S, or N ofthe moiety (except where N is a heteroaryl ring atom) excludes substituents that would result in any O, S, or N ofthe substituent (except where N is a heteroaryl ring atom) being bound to the alkenyl carbon bound to any 0, S, or N of the moiety. An “alkenyl carbon” refers to any carbon within an alkenyl group, whether saturated or part of the carbon to carbon double bond. An “alkene carbon” refers to a carbon within an alkenyl group that is part of a carbon to carbon double bond.
[0109] “Lower alkynyl” alone or in combination means a straight or branched hydrocarbon containing 2-6 carbon atoms (unless specifically defined) containing at least one, preferably one, carbon to carbon triple bond. Examples of alkynyl groups include ethyhyl, propynyl, butynyl, and the like. A substituted lower alkynyl denotes lower alkynyl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of-F, -OH, -NH2, -NO2, -CN, -C(0)0H, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2j -NHS(O)2NH2, -C(NH)NH2, -OR0, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(0)0R°, -C(S)OR°, -S(O)R°, -S(O)2R°, -C(0)NHR°, -C(S)NHR°, -C(0)NR°R°, -C(S)NR°R°, -S(O)2NHR°, -S(O)2NR°R°, -C(NH)NHR°, -C(NH)NRPR°, -NHC(0)R°, -NHC(S)R°, -NR°C(0)Ra, -NR°C(S)R°, -NHS(O)2R°, -NR°S(0)2R°, -NHC(0)NHR°, -NHC(S)NHR°, -NR°C(0)NH2, -NR°C(S)NH2, -NR°C(0)NHR°, -NR°C(S)NHR°, -NHC(0)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR°R°, -NR°C(S)NR0R°, -NHS(0)2NHR°, -NR°S(O)2NH2, -NR°S(0)2NHR°, -NHS(0)2NR°R°, -NR°S(O)2NRoR°, -NHR0, -NR°R°, -Rd, -Re, and -RB. Further, possible substitutions include subsets of these substitutions, such as are indicated herein, for example, in the description of compounds of Formula ΙΠ, attached at any available atom to produce a stable compound. For example “fluoro substituted lower alkynyl” denotes a lower alkynyl group substituted with one or more fluoro atoms, where preferably the lower alkynyl is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is understood that substitutions are attached at any available atom to produce a stable compound, substitution of alkynyl groups are such that -F, -C(O)-, -C(S)-, -C(NH)-, -S(O)-, -S(O)2-, , -S-, or N (except where N is a heteroaryl ring atom) are not bound to an alkyne carbon thereof. Further, where alkynyl is a substituent of another moiety or an R group of a moiety such as -OR, -NHR, -C(0)R, and the like, substitution of the moiety is such that any -C(O)-, -C(S)-,-S(O)-, -S(O)20- ,&#1470;-, -S-, or N thereof (except where N is a heteroaryl ring atom) are not bound to an alkyne carbon of the alkynyl substituent or R group. Further, where alkynyl is a substituent of another moiety or an R group of a moiety such as -OR, -NHR, -C(O)NHR, and the like, substitution of the alkynyl R group is such that substitution of the alkynyl carbon bound to any 0, S, or N of the moiety (except where N is a heteroaryl ring atom) excludes substituents that would result in any O, S, or N of the substituent (except where N is a heteroaryl ring atom) being bound to the alkynyl carbon bound to any 0, S, or N of the moiety. An “alkynyl carbon” refers to any carbon within an alkynyl group, whether saturated or part of the carbon to carbon triple bond. An “alkyne carbon” refers to a carbon within an alkynyl group that is part of a carbon to carbon triple bond.
[0110] Cycloalkyl refers to saturated or unsaturated, non-aromatic monocyclic, bicyclic or tricyclic carbon ring systems of 3-10, also 3-8, more preferably 3-6, ring members per ring, such as cyclopropyl, cyclopentyl, cyclohexyl, adamantyl, and the like. A substituted cycloalkyl is a cycloalkyl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH21 -NO2, -CN, -C(0)0H, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2> -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2! -OR0, -SR°, -OC(O)R°, -OC(S)R°, -C(0)R°, -C(S)R°, -C(O)OR°, -C(S)OR°, -S(O)R°, -S(O)2R°, -C(0)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR°R°, -S(O)2NHRo, -S(O)2NRoR°, -C(NH)NHR°, -C(NH)NRpRc, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R°, -NR°C(S)R°, -NHS(O)2R°, -NR°S(O)2Rd, -NHC(0)NHR°, -NHC(S)NHR°, -NR°C(O)NH2> -NR°C(S)NH2, -NR°C(0)NHR°, -NRDC(S)NHR°, -NHC(0)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR0R0, -NR°C(S)NR°R0, -NHS(O)2NHR°, -NRoS(O)2NH2, -NR°S(O)2NHR°, -NHS(O)2NR°R°, -NR°S(O)2NR°R°, -NHR°, -NR°R°, -Rd, -R°, -Rf, and -RE.
[0111] “Heterocycloalkyl” refers to a saturated or unsaturated non-aromatic cycloalkyl group having from 5 to 10 atoms in which from 1 to 3 carbon atoms in the ring are replaced by heteroatoms of O, S or N, and are optionally fused with benzo or heteroaryl of 5-6 ring members. Heterocycloalkyl is also intended to include oxidized S or N, such as sulfinyl, sulfonyl and N-oxide of a tertiary ring nitrogen. Heterocycloalkyl is also intended to include compounds in which a ring carbon may be oxo substituted, i.e. the ring carbon is a carbonyl group, such as lactones and lactams, The point of attachment of the heterocycloalkyl ring is at a carbon or nitrogen atom such that a stable ring is retained. Examples of heterocycloalkyl groups include, but are not limited to, morpholino, tetrahydrofuranyl, dihydropyridinyl, piperidinyl, pyrrolidinyl, pyrrolidonyl, piperazinyl, dihydrobenzofuryl, and dihydroindolyl. A substituted heterocycloalkyl is a heterocycloalkyl that is independently substituted, unless indicated otherwise, with one or more, preferably 1,2,3,4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, -C(O)OH,
-C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2j -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -or0, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)OR°, -C(S)OR°, -S(O)R°, -S(O)2R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR°R°, -S(O)2NHR°, -S(O)2NRoR°, -C(NH)NHR°, -C(NH)NRPR°, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R°, -NR°C(S)R°, -NHS(O)2R°, -NR°S(O)2R0, -NHC(O)NHR°, -NHC(S)NHR°, -NR°C(O)NH2, -NRoC(S)NH2, -NR°C(O)NHR°, -NR°C(S)NHR°, -NHC(O)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR°R0, -NR°C(S)NR°R°, -NHS(O)2NHR°, -NR°S(O)2NH2j -NRoS(O)2NHR°, -NHS(O)2NR°Ro, -NRoS(O)2NR°R°, -nhr°, -NR°R°, -Rd, -R°, -Rr, and -Rs.
[0112] “Aryl” alone or in combination refers to a monocyclic or bicyclic ring system containing aromatic hydrocarbons such as phenyl or naphthyl, which may be optionally fused with a cycloalkyl of preferably 5-7, more preferably 5-6, ring members. A substituted aryl” is an aryl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the substituents are selected from the group consisting of halogen, -OH, -NH2, -NO2, -ON, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2j -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2j -C(NH)NH2, -OR0, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)OR°, -C(S)OR°, -S(O)R°, -S(O)2R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR°R°, -S(O)2NHR°, -S(O)2NRoR°, -C(NH)NHR°, -C(NH)NRpRc, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R°, -NR°C(S)R°, -NHS(O)2R°, -NR°S(O)2R°, -NHC(O)NHR°, -NHC(S)NHR°, -NR°C(O)NH2, -NR°C(S)NH2, -NR°C(O)NHR°, -NR°C(S)NHR°, -NHC(O)NR°R°, -NHC(S)NR°R°, -NR°C(O)NR°R0, -NR°C(S)NR°R°, -NHS(O)2NHR°, -NR°S(O)2NH2j -NR°S(O)2NHR°, -NHS(O)2NR°R°, -NR0S(O)2NRoR°, -nhr°, -NR°R°, -Rd, -Re, -Rf, and -Rg.
[0113] “Heteroaryl” alone or in combination refers to a monocyclic aromatic ring structure containing 5 or 6 ring atoms, or a bicyclic aromatic group having 8 to 10 atoms, containing one or more, preferably 1-4, more preferably 1-3, even more preferably 1-2, heteroatoms independently selected from the group consisting of O, S, and N. Heteroaryl is also intended to include oxidized S or N, such as sulfinyl, sulfonyl and N-oxide of a tertiary ring nitrogen. A carbon or nitrogen atom is the point of attachment of the heteroaryl ring structure such that a stable compound is produced. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyridazinyl, pyrazinyl, quinaoxalyl, indolizinyl, benzo[b]thienyl, quinazolinyl, purinyl, indolyl, quinolinyl, pyrimidinyl, pyrrolyl, pyrazolyl, oxazolyl, thiazolyl, thienyl, isoxazolyl, oxathiadiazolyl, isothiazolyl, tetrazolyl, imidazolyl, triazolyl, furanyl, benzofuryl, and indolyl. “Nitrogen containing heteroaryl” refers to heteroaryl wherein any heteroatoms are N. A substituted heteroaryl” is a heteroaryl that is independently substituted, unless indicated otherwise, with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents, attached at any available atom to produce a stable compound, wherein the
PCT7US2006/024361 substituents are selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, -C(O)0H, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2j -NHC(S)NH2j -NHS(O)2NH2j -C(NH)NH2> -OR0, -SR°, -OC(O)R°, -OC(S)R°, -C(O)R°, -C(S)R°, -C(O)OR°, -C(S)OR°, -S(O)R°, -S(O)2R°, -C(O)NHR°, -C(S)NHR°, -C(O)NR°R°, -C(S)NR°R°, -S(O)2NHR°, -S(O)2NR°Ro, -C(NH)NHR°, -C(NH)NRpRc, -NHC(O)R°, -NHC(S)R°, -NR°C(O)R0, -NR°C(S)R°, -NHS(O)2Ro, -NR°S(O)2Ro, -NHC(O)NHR°, -NHC(S)NHR°, -NRoC(O)NH2, -NRoC(S)NH2, -NR°C(O)NHR°, -NR°C(S)NHR°, -NHC(O)NR°R0, -NHC(S)NR°R0, -NR°C(O)NR°R°, -NR°C(S)NR0R°, -NHS(O)2NHR°, -NRoS(O)2NH2> -NR°S(O)2NHR°, -NHS(O)2NRoR°, -NR°S(O)2NR°Ro, -NHR°, -NR°R°, -Rd, -R8, -Rf, and -RB.
[0114] The variables R°, Rp, R°, Rd, R8, Rf and Rs as used in the description of optional substituents for alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are defined as follows:
each R°, Rp, and Rc are independently selected from the group consisting of Rd, R8, Rf, and Re, or Rp and R° combine with the nitrogen to which they are attached to form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered nitrogen containing heteroaryl are optionally substituted with one or more, preferably 1,2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -NO2, -CN, -OH, -NH2, -OR&#1524;, -SR&#1524;, -NHRU, -NRURU, -Rx, and -Ry;
each Rd is independently lower alkyl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2j -C(NH)NH2j -ORk, -SRk, -OC(O)Rk, -OC(S)Rk, -C(O)Rk, -C(S)Rk, -C(O)ORk, -C(S)ORk, -S(O)Rk, -S(O)2Rk, -C(O)NHRk, -C(S)NHRk, -C(O)NRkRk, -C(S)NRkRk, -S(O)2NHRk, -SiO^NR^, -C(NH)NHRk, -C(NH)NRmRn, -NHC(O)Rk, -NHC(S)Rk, -NRkC(O)Rk, -NRkC(S)Rk, -NHS(O)2Rk, -NRkS(O)2Rk, -NHC(O)NHRk, -NHC(S)NHRk, -NRkC(O)NH2, -NRkC(S)NH2, -NRkC(O)NHRk, -NRkC(S)NHRk, -NHC(O)NRkRk, -NHC(S)NRkRk, -NRkC(O)NRkRk, -NRkC(S)NRkRk, -NHS(O)2NHRk, -NRkS(O)2NH2, -NRkS(O)2NHRk, -NHS(O)2NRkRk, -NRkS(O)2NRkRk, -NHRk, -NRkRk, -R, and -Rj;
each R8 is independently lower alkenyl, wherein lower alkenyl is optionally substituted with one or more, preferably 1, 2, 3,4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH2, -NO2i -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2> -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2, -ORk, -SRk, -OC(O)Rk, -OC(S)Rk, -C(O)Rk, -C(S)Rk, -C(0)ORk, -C(S)ORk, -S(O)Rk, -S(O)2Rk, -C(O)NHRk, -C(S)NHRk, -C(O)NRkRk, -C(S)NRkRk, -S(O)2NHRk, -S(O)2NRkRk, -C(NH)NHRk, -C(NH)NRmRn, -NHC(O)Rk, -NHC(S)Rk, -NRkC(O)Rk, -NRkC(S)Rk, -NHS(O)2Rk, -NRkS(O)2Rk, -NHC(O)NHRk, -NHC(S)NHRk, -NRkC(O)NH2,
PCI7US2006/024361
-NRkC(S)NH2, -NRkC(O)NHRk, -NRkC(S)NHRk, -NHC(O)NRkRk, -NHC(S)NRkRk, -NRkC(O)NRkRk, -NRkC(S)NRkRk, -NHS(O)2NHRk, -NRkS(O)2NH2, -NRkS(O)2NHRk, -NHS(O)2NRkRk, -NRkS(O)2NRkRk, -NHRk, -NRkRk, -Rh, and -Rj;
each Rfis independently lower alkynyl, wherein lower alkynyl is optionally substituted with one or more, preferably 1,2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH2, -N02, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2j -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2jRk, -SRk, -OC(O)Rk, -OC(S)Rk, -C(O)Rk, -C(S)Rk, -C(O)ORk, -C(S)ORk, -S(O)Rk, -S(O)2Rk, -C(O)NHRk, -C(S)NHRk, -C(O)NRkRk, -C(S)NRkRk, -S(O)2NHRk, -S(O)2NRkRk, -C(NH)NHRk, -C(NH)NRmR, -NHC(0)Rk, -NHC(S)Rk, -NRkC(0)Rk, -NRkC(S)Rk, -NHS(O)2Rk, -NRkS(O)2Rk, -NHC(0)NHRk, -NHC(S)NHRk, -NRkC(0)NH2, -NRkC(S)NH2, -NRkC(O)NHRk, -NRkC(S)NHRk, -NHC(O)NRkRk, -NHC(S)NRkRk, -NRkC(0)NRkRk, -NRkC(S)NRkRk, -NHS(O)2NHRk, -NRkS(O)2NH2, -NRkS(O)2NHRk, -NHS(O)2NRkRk, -NRkS(O)2NRkRk, -NHRk, -NRkRk, -Rh, and -Rj;
each Rg is independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaxyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of halogen, -OH, -NH2, -N02, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2> -S(O)2NH2, -NHC(0)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2>Rk, -SRk, -OC(O)Rk, -OC(S)Rk, -C(0)Rk, -C(S)Rk, -C(O)ORk, -C(S)ORk, -S(O)Rk, -S(O)2Rk, -C(0)NHRk, -C(S)NHRk, -C(0)NRkRk, -C(S)NRkRk, -S(O)2NHRk, -S(O)2NRkRk, -C(NH)NHRk, -C(NH)NRraR, -NHC(0)Rk, -NHC(S)Rk, -NRkC(0)Rk, -NRkC(S)Rk, -NHS(O)2Rk, -NRkS(O)2Rk, -NHC(0)NHRk, -NHC(S)NHRk, -NRkC(0)NH2, -NRkC(S)NH2, -NRkC(0)NHRk, -NRkC(S)NHRk, -NHC(0)NRkRk, -NHC(S)NRkRk, -NRkC(0)NRkRk, -NRkC(S)NRkRk, -NHS(0)2NHRk, -NRkS(O)2NH2, -NRkS(O)2NHRk, -NHS(0)2NRkRk, -NRkS(0)2NRkRk, -NHRk, -NRkRk, -Rh, -R', and -Rj;
wherein Rk, Rm, and Rn at each occurrence are independently selected from the group consisting of Rh, R‘, and RJ, or R® and R combine with the nitrogen to which they are attached form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered nitrogen containing heteroaryl are optionally substituted with one or more, preferably 1,2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -N02, -CN, -OH, -NH2, OR“, -SRU, -NHRU, -NRURU, -Rx, and -Ry;
wherein each R1' is independently lower alkyl optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1,2, or 3 substituents selected from the group consisting of fluoro, -OH, -NH2, -N02, -CN, -C(O)OH, -C(S)OH, -C(0)NH2> -C(S)NH2, -S(O)2NH2, -NHC(0)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2jRr, -SRr, -0C(0)Rr, -0C(S)Rr, -C(0)Rr, -C(S)Rr, -C(O)ORr,
-C(S)OR', -S(O)R', -S(O)2R', -C(O)NHR', -C(S)NHRr, -Ο(Ο)ΝΗΤν, -C(S)NR&#1523;Rr, -S(O)2NHRr, -S(O)2NR&#1523;Rr, -C(NH)NHRr, -C(NH)NRsRl, -NHC(O)Rr, -NHC(S)R', -NRrC(O)Rr, -NR'C(S)Rr, -NHS(O)2R', -NR'S(O)2R', -NHC(O)NHRr, -NHC(S)NHR', -NRrC(O)NH2, -NR'C(S)NH2, -NR'C(O)NHRr, -NR'C(S)NHRr, -NHC(O)NR'R', -NHC(S)NRrR', -NR'C(O)NRrR'! -NR'C(S)NR&#1523;R', -NHS(O)2NHR', -NRrS(O)2NH2, -NR'S(O)2NHR', -NHS(O)2NR'R', -NR'S(O)2NRrR', -NHR', -NRTU, -R', and -RJ;
wherein each R'is independently selected from the group consisting of lower alkenyl and lower alkynyl, wherein lower alkenyl or lower alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2 or 3 substituents selected from the group consisting of fluoro, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH2, -C(S)NH2, -S(O)2NH2, -NHC(O)NH2, -NHC(S)NH2j -NHS(O)2NH2, -C(NH)NH2, -OR', -SR', -0C(O)R', -OC(S)R', -C(O)Rr, -C(S)Rr, -C(O)OR', -C(S)OR', -S(O)R', -S(O)2Rr, -C(O)NHRr, -C(S)NHR', -C(O)NR&#1523;Rr, -C(S)NRrR', -S(O)2NHRr, -SiOhNR’R', -C(NH)NHR', -C(NH)NRSR‘, -NHC(O)R', -NHC(S)Rr, -NR'C(O)R', -NR'C(S)Rr, -NHS(O)2R', -NR'S(O)2R', -NHC(O)NHR', -NHC(S)NHR', -NR'C(O)NH2, -NR'C(S)NH2, -NR'C(O)NHRr, -NR'C(S)NHR'&#1470; -NHC(O)NR'R', -NHC(S)NR&#1523;R', -NR'C(O)NR'Rr, -NRrC(S)NR'Rr, -NHS(O)2NHRr, -NR'S(O)2NH2, -NR'S(O)2NHR', -NHS(O)2NR'R', -NR'S(O)2NR'Rr, -NHRr, -NR&#1523;Rr, and -Rj;
wherein each RJ is independently selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1,2,3,4 or 5, also 1, 2 or 3 substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, -C(O)OH, -C(S)OH, -C(O)NH21 -C(S)NH2, -S(O)2NH2j -NHC(O)NH2, -NHC(S)NH2, -NHS(O)2NH2, -C(NH)NH2i -OR', -SR', -OC(O)R', -OC(S)Rr, -C(O)Rr, -C(S)Rr, -C(O)ORr, -C(S)ORr, -S(O)Rr, -S(O)2Rr, -C(O)NHRr, -C(S)NHR', -CCOjNR'R', -C(S)NR'R', -S(O)2NHR', -S(O)2NR'R', -C(NH)NHRr, -C(NH)NRSR‘, -NHC(O)Rr, -NHC(S)R', -NR'C(O)R', -NR'C(S)R', -NHS(O)2R', -NR'S(O)2R', -NHC(O)NHR', -NHC(S)NHR', -NR'C(O)NH2, -NR'C(S)NH2> -NR'C(O)NHRr, -NR'C(S)NHR', -NHC(O)NR'R', -NHC(S)NR'R'1 -NR'C(O)NR'Rr, -NR'CiSJNR'R', -NHS(O)2NHR', -NR'S(O)2NH2, -NR'S(O)2NHR', -NHS(O)2NRrR', -NR'S(O)2NR׳R', -NHR', -NR'R', cycloalkylamino, and -Rx;
wherein each R', Rs, and Rl at each occurrence are independently selected from the group consisting of lower alkyl, C3.6 alkenyl, C3.6 alkynyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of-Ry, fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the lower alkyl carbon bound to any 0, S, or N, of -OR', -SRr, -C(O)OR', -C(S)ORr, -C(O)NHRr, -C(S)NHRr, -0(0)ΝΚ&#905;Γ, -C(S)NR'Rr, -S(O)2NHRr, -SiOjjNR'R', -C(NH)NHRr, -NRrC(O)Rr, -NR'C(S)Rr, -NRrS(O)2Rr, -NHC(O)NHRr, -NHC(S)NHRr, -NRrC(O)NH2, -NR'C(S)NH2, -NRrC(0)NHRr, -NR'C(S)NHRr, -NHC(O)NRrRr, -NHC(S)NRrRr, -NRrC(O)NRrR', -NR'C(S)NR&#1523;Rr, -NHS(O)2NHRr, -NRrS(O)2NH2, -NR'S(O)2NHR', -NHS(0)2NR'Rr, -NR'SCOjjNR'R', -NHRr, or -NR'Rr is selected from the group consisting of fluoro and -Ry, and wherein C3.6 alkenyl or C3.6 alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -Ry, fluoro, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the C3.6 alkenyl or C3.6 alkynyl carbon bound to any O, S, or N, of -OR', -SRr, -C(O)ORr, -C(S)ORr, -C(O)NHRr, -C(S)NHRr, -C(O)NR'Rr, -C^NRTV, -S(O)2NHRr, -S(O)2NR'Rr, -C(NH)NHRr, -NR'C(O)Rr, -NRrC(S)Rr, -NRrS(O)2R', -NHC(O)NHRr, -NHC(S)NHR', -NR'C(0)NH2, -NR'C(S)NH2, -NRrC(0)NHRr, -NR'C(S)NHRr, -NHC(O)NR&#1523;Rr, -NHCfSJNR'R', -NR'C(O)NR'Rr, -NR'C(S)NR&#1523;Rr, -NHS(O)2NHRr, -NRrS(O)2NH2, -NR'S(O)2NHRr, -NHS(O)2NR&#1523;Rr, -NRrS(O)2NR&#1523;Rr, -NHRr, or -NR'R' is selected from the group consisting of fluoro, lower alkyl, fluoro substituted lower alkyl, and -Ry, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, or Rs and R‘ combine with the nitrogen to which they are attached form a 5-7 membered heterocycloalkyl or a 5 or 7 membered nitrogen containing heteroaryl, wherein the 5-7 membered heterocycloalkyl or 5 or 7 membered nitrogen containing heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -NO2, -CN, -OH, -NH2, ORU, -SRU, -NHRU, -NR“R“, -Rx, and -Ry;
wherein each Ru is independently selected from the group consisting of lower alkyl, C3.6 alkenyl, C3.6 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -Ry, fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the lower alkyl carbon bound to the O of -ORU, S of -SR“, or N of -NHR“ is fluoro or -Ry, and wherein C3.s alkenyl or C3.6 alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1,2, or 3 substituents selected from the group consisting of -Ry, fluoro, -OH, -NIL, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, provided, however, that any substitution of the C3.6 alkenyl or C3.6 alkynyl carbon bound to the 0 of -OR, S of -SR“, or N of -NHR is fluoro, lower alkyl, fluoro substituted lower alkyl, or -Ry, and wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
wherein each Rx is selected from the group consisting of lower alkyl, lower alkenyl and lower alkynyl, wherein lower alkyl is optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -Ry, fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino, and wherein lower alkenyl or lower alkynyl are optionally substituted with one or more, preferably 1, 2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of -Ry, fluoro, -OH, -NH2, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino;
wherein each Ry is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more, preferably 1,2, 3, 4 or 5, also 1, 2, or 3 substituents selected from the group consisting of halogen, -OH, -NH2, -NO2, -CN, lower alkyl, fluoro substituted lower alkyl, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino.
[0115] In some embodiments, all occurrences of optionally substituted lower alkyl, optionally substituted C2.6 alkyl, optionally substituted lower alkenyl, or optionally substituted lower alkynyl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -NO2, -CN, -ORla, -SRla, -NRlaRla, -OC(O)Rla, -OC(S)Rla, -C(O)Rla, -C(S)RIa, -C(O)ORla, -C(S)ORla, -C(O)NRIaRla, -C(S)NRlaRla, -S(O)2NRlaRla, -C(NH)NRlaRla, -NRlaC(O)Rla, -NRlaC(S)RIa, -NRlaS(O)2Rla, -NRlaC(O)NRlaRIa, -NRlaC(S)NRlaRla, -NRlaS(O)2NRlaRla, -S(O)RIa, -S(O)2Rla, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1,2 or 3 groups or substituents selected from the group consisting of halogen, -NO2, -CN, -ORIa, -SRla, -NRlaRIa, -OC(O)RIa,
-OC(S)Rla, -C(O)RIa, -C(S)Rla, -C(O)ORla, -C(S)ORla, -C(O)NR10R1“> -C(S)NR18Rla, -S(O)2NRlaRla, -C(NH)NRlaRla, -NRlaC(O)Rla, -NRlaC(S)Rla, -NRlaS(O)2Rla, -NRlaC(O)NRlaRla, -NRlaC(S)NRlaRla, -NRlaS(O)2NRIaRla, -S(O)RIa, -S(O)2Rla, -Rlb, and lower alkyl optionally substituted with one or more, also 1,2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -Rlb, and all occurrences of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted 5-7 membered heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, or optionally substituted 5 or 7 membered nitrogen containing heteroaryl are optionally substituted with one or more, also 1, 2, or 3 groups or substituents selected from the group consisting of halogen, -NO2, -CN, -OR8׳, -SRla, -NRlaR18, -OC(O)R10, -OC(S)Rla, -C(O)Rla, -C(S)Rla, -C(O)ORla, -C(S)OR18, -C(O)NRlaRla, -C(S)NR18R18, -S(O)2NRlaRIa, -C(NH)NRlaR18, -NRIaC(O)Rla, -NR18C(S)R18, -NR18S(O)2Rla, -NR18C(O)NR18R18, -NRlaC(S)NRlaR18, -NR18S(O)2NRlaRla, -S(O)Rla, -S(O)2R18, -Rlb, and lower alkyl optionally substituted with one or more, also 1,2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -Rlb, wherein Rla is selected from the group consisting of hydrogen, provided, however, that hydrogen is not bound to any of C(S), C(O), S(O), or S(O)2 of-OC(O)R18, -OC(S)Rla, -C(O)Rla, -C(S)R18, -NRlaC(O)Rla, -NRlaC(S)Rla, -NR18S(O)2Rla, -S(O)RIa, or-S(O)2Rla, -Rlb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -Rlb, provided, however, that any substitution of the alkyl carbon bound to 0, S, or N of-OR18, -SRla, -NRlaRla, -C(O)ORIa, -C(S)ORla, -C(O)NRlaRla, -C(S)NRlaR18, -S(O)2NRlaRla, -C(NH)NR18Rla, -NRlaC(O)Rla, -NRlaC(S)R18, -NRlaS(O)2Rla, -NRlaC(O)NRlaRla, -NRlaC(S)NRlaR10, or -NRlaS(O)2NRlaR18, is fluoro or -Rlb, and wherein -Rlb is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of halogen, -CN, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino.
[0116] In some embodiments, all occurrences of optionally substituted lower alkyl, optionally substituted C2.8 alkyl, optionally substituted lower alkenyl, or optionally substituted lower alkynyl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -CN, -ORla, -SRla, -NRlaRla, -C(O)Rla, -C(S)Rla, -C(O)ORla, -C(O)NRlaRla, -C(S)NRlaRla, -S(O)2NR18Rla, -NRlaC(O)Rla, -NR18C(S)Rla, -NRIaS(O)2Rla, -S(O)RIa, -S(O)2Rla, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1,2 or 3 groups or substituents selected from the group consisting of halogen, -CN, -ORla, -SR1“, -NRlaRla, -C(O)Rla, -C(S)Rla, -C(O)ORla, -C(O)NR18Rla, -C(S)NRlaRla, -S(O)2NRIaRla, -NRlaC(O)Rla, -NRlaC(S)RIa, -NR18S(O)2R18, -S(O)Rla, -S(O)2Rla, -Rlb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower 'alkylthio, mono-alkylamino, di-alkylamino, and -Rlb, and all occurrences of optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted 5-7 membered heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl, or optionally substituted 5 or 7 membered nitrogen containing heteroaryl are optionally substituted with one or more, also 1,2, or 3 groups or substituents selected from the group consisting of halogen, -CN, -ORla, -SR18, -NRlaRla, -C(O)Rla, -C(S)Rla, -C(O)ORla, -C(O)NRlaRla, -C(S)NRlaR10, -S(O)2NRlaRla, -NRlaC(O)Rla, -NR^C(S)Rla, -NRlaS(O)2R,a, -S(O)Rla, -S(O)2Rla, -Rlb, and lower alkyl optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -Rlb, wherein RIa is selected from the group consisting of hydrogen, provided, however, that hydrogen is not bound to any of C(S), C(O), S(O), or S(O)2 of -C(O)RIa, -C(S)Rla, -NRlaC(O)R18, -NRlaC(S)R18, -NRlaS(O)2Rla, -S(O)Rla, or -S(O)2Rla, -Rlb, and lower alkyl optionally substituted with one or more, also 1,2 or 3 groups or substituents selected from the group consisting of fluoro, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and -Rlb, provided, however, that any substitution of the alkyl carbon bound to O, S, or N of -OR18, -SR18, -NR18R18, -C(O)ORla, -C(O)NRlaRla, -C(S)NRlaRla, -S(O)2NRlaRla, -NRlaC(O)R18, -NRlaC(S)Rla, or -NRlaS(O)2Rla, is fluoro or -Rlb, and wherein -Rlb is selected from the group consisting of cycloalkyl, heterocycloalkyl, aryl and heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more, also 1, 2 or 3 groups or substituents selected from the group consisting of halogen, -CN, -OH, -NH2, lower alkoxy, fluoro substituted lower alkoxy, lower alkylthio, fluoro substituted lower alkylthio, mono-alkylamino, di-alkylamino, and cycloalkylamino.
[0117] “Lower alkoxy” denotes the group-ORZ, where Rz is lower alkyl. Substituted lower alkoxy” denotes lower alkoxy in which Rz is lower alkyl substituted with one or more substituents as indicated herein, for example, in the description of compounds of Formula ΠΙ, including descriptions of substituted cycloalkyl, cycloheteroalkyl, aryl and heteroaryl, attached at any available atom to produce a stable compound. Preferably, substitution of lower alkoxy is with 1, 2, 3, 4, or 5 substituents, also 1, 2, or 3 substituents. For example “fluoro substituted lower alkoxy” denotes lower alkoxy in which the lower alkyl is substituted with one or more fluoro atoms, where preferably the lower alkoxy is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is
PCI7US2006/024361 understood that substitutions on alkoxy are attached at any available atom to produce a stable compound, substitution of alkoxy is such that 0, S, or N (except where N is a heteroaryl ring atom), are not bound to the alkyl carbon bound to the alkoxy 0, Further, where alkoxy is described as a substituent of another moiety, the alkoxy oxygen is not bound to a carbon atom that is bound to an O, S, or N of the other moiety (except where N is a heteroaryl ring atom), or to an alkene or alkyne carbon of the other moiety.
{0118] “Lower alkylthio” denotes the group -SRaa, where Raa is lower alkyl, Substituted lower alkylthio” denotes lower alkylthio in which Raa is lower alkyl substituted with one or more substituents as indicated herein, for example, in the description of compounds of Formula HI, including descriptions of substituted cycloalkyl, cycloheteroalkyl, aryl and heteroaryl, attached at any available atom to produce a stable compound. Preferably, substitution of lower alkylthio is with 1, 2, 3, 4, or 5 substituents, also 1, 2, or 3 substituents. For example “fluoro substituted lower alkylthio” denotes lower alkylthio in which the lower alkyl is substituted with one or more fluoro atoms, where preferably the lower alkylthio is substituted with 1, 2, 3, 4 or 5 fluoro atoms, also 1, 2, or 3 fluoro atoms. While it is understood that substitutions on alkylthio are attached at any available atom to produce a stable compound, substitution of alkylthio is such that O, S, or N (except where N is a heteroaryl ring atom), are not bound to the alkyl carbon bound to the alkylthio S. Further, where alkylthio is described as a substituent of another moiety, the alkylthio sulfur is not bound to a carbon atom that is bound to an 0, S, or N of the other moiety (except where N is a heteroaryl ring atom), or to an‘alkene or alkyne carbon of the other moiety.
[0119] “Amino” or “amine” denotes the group -NH2. “Mono-alkylamino” denotes the group -NHRbb where Rbb is lower alkyl. “Di-alkylamino” denotes the group -NRbbR00, where Rbb and Rcc are independently lower alkyl. “Cycloalkylamino” denotes the group -NRddRes, where Rdd and Ree combine with the nitrogen to form a 5-7 membered heterocycloalkyl, where the heterocycloalkyl may contain an additional heteroatom within the ring, such as Ο, N, or S, and may also be further substituted with lower alkyl. Examples of 5-7 membered heterocycloalkyl include, but are not limited to, piperidine, piperazine, 4-methylpiperazine, morpholine, and thiomorpholine. While it is understood that when mono-alkylamino, di-alkylamino, or cycloalkylamino are substituents on other moieties that are attached at any available atom to produce a stable compound, the nitrogen of mono-alkylamino, di-alkylamino, or cycloalkylamino as substituents is not bound to a carbon atom that is bound to an O, S, or N of tire other moiety.
[0120] A “nitrogen protecting group” is a chemical group covalently bound to a nitrogen atom of a compound that is used to protect the nitrogen from reaction during a synthetic step. The nitrogen protecting group may be added to a compound and removed in a subsequent step by methods known to those of skill in the art. Nitrogen protecting groups include, without limitation, carbamates, amides, N-sulfonyl derivatives, groups of formula -C(O)OR, wherein R is, for example, methyl, ethyl, t-butyl, benzyl, phenylethyl, CH2=CHCH2-, and the like, groups of the formula -C(O)R’, wherein R' is, for example, methyl, phenyl, trifluoromethyl, and the like, groups of the formula -SO2R, wherein R is, for example, tolyl, phenyl, trifluoromethyl, 2,2,5,7,8-pentamethylchroman yl, 2,3,6-trimethyl4-methoxyphenyl, and the like, and silanyl containing groups, such as 2-trimethylsilylethoxymethyl, t-butyldimethylsilyl, triisopropylsilyl, and the like. Other suitable nitrogen protecting groups may be found in texts such as T. W. Greene & P. G. M, Wuts, Protective Groups in Organic Synthesis, John Wiley & Sons, 1991.
[0121] As used herein, the term “composition” refers to a formulation suitable for administration to an intended animal subject for therapeutic purposes that contains at least one pharmaceutically active compound and at least one pharmaceutically acceptable carrier or excipient.
[0122] The term “pharmaceutically acceptable” indicates that the indicated material does not have properties that would cause a reasonably prudent medical or veterinary practitioner to avoid administration of the material to a subject, taking into consideration the disease or conditions to be treated and the respective route of administration. For example, it is commonly required that Such a material be essentially sterile, e.g., for injectibles.
[0123] In the present context, the term “therapeutically effective” or effective amount indicates that the materials or amount of material is effective to prevent, alleviate, or ameliorate one or more symptoms of a disease or condition, and/or to prolong the survival of the subject being treated.
[0124] As used herein, the term “modulating” or “modulate” refers to an effect of altering a biological activity, especially a biological activity associated with a particular biomolecule such as a protein kinase. For example, an agonist or antagonist of a particular biomolecule modulates the activity of that biomolecule, e.g., an enzyme, by either increasing (e.g. agonist, activator), or decreasing (e.g. antagonist, inhibitor) the activity of the biomolecule, such as an enzyme; Such activity is typically indicated in terms of an inhibitory concentration (IC50) or excitation concentration (EC50) of the compound for an inhibitor or activator, respectively, with respect to, for example, an enzyme.
[0125] In the context of the use, testing, or screening of compounds that are or may be modulators, the term “contacting” means that the compound(s) are caused to be in sufficient proximity to a particular molecule, complex, cell, tissue, organism, or other specified material that potential binding interactions and/or chemical reaction between the compound and other specified material can occur.
[0126] The present invention concerns compounds of Formula ΠΙ and all sub-generic formulae thereof including compounds of Formula Hla-m and all sub-generic formulae thereof, including all salts, prodrugs, tautomers, and isomers, that are modulators of protein kinases, for example without limitation, the compounds are modulators of at least one of the kinases selected from the group consisting of B-Raf, c-Raf-1, Fms, Jnkl, Jnk2, Jnk3, Kit, and any mutations of these kinases, and the use of such compounds in the treatment of diseases or conditions.
Π. Kinase targets and indications of the invention
[0127] Protein kinases play key roles in propagating biochemical signals in diverse biological pathways. More than 500 kinases have been described, and specific kinases have been implicated in a wide range of diseases or conditions including, for example without limitation, cancer, cardiovascular disease, inflammatory disease, neurological disease, and other diseases and conditions. As such, kinases represent important control points for small molecule therapeutic intervention. Specific target protein kinases contemplated by the present invention follow:
[0128] B-Raf: Target kinase B-Raf (i.e., v-raf murine sarcoma viral oncogene homolog B1) is a 84.4 kDa serine/threonine kinase encoded by chromosome 7q34 (symbol: BRAF). The mature protein comprises RBD (i.e., Ras binding domain), Cl (i.e., protein kinase C conserved region 1) and STK (i.e., serine/threonine kinase) domains. Target kinase B-Raf includes any mutations of B-Raf, such as Val<600> to Glu<600> (V600E) mutant.
[0129] Indications for modulation of B-Raf activity, including B-Raf V600E activity, for the treatment of pathologic states include, but are not limited to, neurologic diseases such as ischemic stroke, multi-infarct dementia, head injury, spinal cord injury, Alzheimer's disease (AD), Parkinson’s disease; neoplastic diseases including, but not limited to, melanoma, glioma, sarcoma, carcinoma (e.g, lung, breast, pancreatic, renal), lymphoma (e.g. histiocytic lymphoma) and cancer of the thyroid, lung (e.g. small cell lung cancer), liver, breast, ovary and colon, neurofibromatosis, myelodysplastic syndrome, leukemia, tumor angiogenesis; pain of neuropathic or inflammatory origin, including acute pain, chronic pain, and migraine; cardiovascular diseases including heart failure, cardiac hypertrophy, thrombosis (e.g. thrombotic microangiopathy syndromes), atherosclerosis, reperfusion injury;
inflammation including, but not limited to, psoriasis, polycystic kidney disease (PKD), arthritis and autoimmune diseases and conditions, osteoarthritis, endometriosis, scarring, vascular restenosis, fibrotic disorders, rheumatoid arthritis, inflammatory bowel disease (IBD); immunodeficiency diseases, organ transplant rejection, graft versus host disease; renal or prostatic diseases including diabetic nephropathy, nephrosclerosis, glomerulonephritis, prostate hyperplasia; metabolic disorders, obesity; infection, including, but not limited to Helicobacter pylori and Influenza virus, fever, sepsis; pulmonary diseases including chronic obstructive pulmonary disease (COPD) and acute respiratory distress syndrome (ARDS); genetic developmental diseases such as Noonan’s syndrome, Costello syndrome, (faciocutaneoskeletal syndrome), leopard syndrome, cardio-faciocutaneous syndrome (CFC), and neural crest syndrome abnormalities causing cardiovascular, skeletal, intestinal, skin, hair and endocrine diseases.
[0130] c-Raf-1: Target kinase c-Raf-1 (i.e., v-raf murine sarcoma viral oncogene homolog 1) is a 73.0 kDa STK encoded by chromosome 3p25 (symbol: RAFI). c-Raf-1 can be targeted to the mitochondria by BCL2 (i.e., oncogene Β-cell leukemia 2) which is a regulator of apoptotic cell death. Active c-Raf-1 improves BCL2-mediated resistance to apoptosis, and c-Raf-1 phosphorylates BAD (i.e., BCL2-binding protein). c-Raf-1 is implicated in carcinomas, including colorectal, ovarian, lung and renal cell carcinoma. C-Raf-1 is also implicated as an important mediator of tumor angiogenesis (Hood et al., 2002, Science 296, 2404). C-Raf-1 inhibitors may also be useful for the treatment of acute myeloid leukemia and myelodysplastic syndromes (Crump, CurrPharmDes 2002, 8(25):22438). Raf-1 activators may be useful as treatment for neuroendocrine tumors, such as medullary thyroid cancer, carcinoid, small cell lung cancer and pheochromocytoma (Kunnimalaiyaan et al., Anticancer Drugs 2006, 17(2):139-42).
[0131] Fms: Target kinase Fins (i.e., feline McDonough sarcoma) is a member of the family of genes originally isolated from the Susan McDonough strain of feline sarcoma viruses. Fms is a transmembrane tyrosine kinase of 108.0 kDa coded by chromosome 5q33.2-q33.3 (symbol: CSF1R). The structure of the transmembrane receptor Fms comprises two Ig-like domains, a IgC2-like domain, two additional Ig-like domains, a TM domain, and the TK domain.
[0132] The presence of c-fins has been associated with a number of different types of diseases. Fms has been associated with immune disorders, including rheumatoid arthritis, systemic lupus erythematosis (SLE), Wegener's granulomatosis, and transplant rejection, inflammatory diseases including Chronic Obstructive Pulmonary Disease (COPD), emphysema, and atherosclerosis, metabolic disorders, including insulin resistance, hyperglycemia, and lipolysis, disorders of bone structure or mineralization, including osteoporosis, increased risk of fracture, hypercalcemia, and bone metastases, kidney diseases, including nephritis (e.g. glomerulonephritis, interstitial nephritis, Lupus nephritis), tubular necrosis, diabetes-associated renal complications, and hypertrophy and cancers, including multiple myeloma, acute myeloid leukemia, chronic myeloid leukemia (CML), breast cancer, and ovarian cancer.
[0133] Jnkl; Target Jnkl (i.e., c-Jun kinase 1) is a 48.3 kDa serine/threonine kinase encoded by chromosome lOql 1.22 (symbol: MAPK8), also known as mitogen-activated protein kinase 8. Jnkl is a mitogen-activated protein kinase (i.e., MAPK) which form a family of serine-threonine protein kinases that participate in a major signaling system by which cells transduce extracellular stimuli into intracellular responses. Jnkl is implicated in type 1 diabetes, type 2 diabetes, metabolic syndrome, obesity and hepatic steatosis.
[0134] Jnk2: Target kinase Jnk2 (i.e., c-Jun kinase 2) is 48.1 kDa serine/threonine kinase encoded by chromosome 5q35 (symbol: MAPK9). Jnk2 is implicated in atherosclerosis.
[0135] Jnk3: Target kinase Jnk3 (i.e., c-Jun kinase 3) is 52.6 kDa serine/threonine kinase encoded by chromosome 4q21-q22 (symbol: MAPK10). Jnk3 inhibitors are potential therapeutics for the treatment of Inflammatory diseases including autoimmune diseases such as rheumatoid arthritis, inflammatory bowel syndrome, Crohn’s disease, systemic lupus erythematosis, Sjogren’s Syndrome, psoriasis and multiple sclerosis, airway inflammatory diseases such as asthma, allergy, pulmonary fibrosis, and chronic obstructive pulmonary disease, and inflammation in other organs, such as CNS inflammation, pancreatitis, nephritis, and hepatitis; neurologic diseases such as stroke, cerebrovascular ischemia, and neurodegenerative diseases such as Parkinson’s disease, Alzheimer’s disease, and Huntington’s disease; and neoplastic diseases such as prostate tumors and myeloid leukemia.
[0136] Kit: Target kinase Kit (i.e., feline Hardy-Zuckerman 4 sarcoma viral oncogene) is a 109.9 kDa transmembrane tyrosine kinase encoded by chromosome 4ql2 (symbol: KIT). Receptor protein tyrosine kinases (RPTKs) regulate key signal transduction cascades that control cellular growth and proliferation. The Stem Cell Factor (SCF) receptor Kit is a type HI transmembrane RPTK that includes five extracellular immunoglobulin (IG) domains, a single transmembrane domain, and a split cytoplasmic kinase domain separated by a kinase insert segment. Kit plays an important role in the development of melanocytes, mast, germ, and hematopoietic cells.
[0137] Aberrant expression and/or activation of Kit has been implicated in a variety of pathologic states. Kit has been associated with mast cell tumors, small cell lung cancer, testicular cancer, gastrointestinal stromal tumors (GISTs), glioblastoma, astrocytoma, neuroblastoma, carcinomas of the female genital tract, sarcomas of neuroectodermal origin, colorectal carcinoma, carcinoma in situ, Schwann cell neoplasia associated with neurofibromatosis, acute myelocytic leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia, mastocytosis, melanoma, and canine mast cell tumors, and inflammatory diseases, including asthma, rheumatoid arthritis, allergic rhinitis, multiple sclerosis, inflammatory bowel syndrome, transplant rejection, and hypereosinophilia.
HI. Kinase Activity Assays
[0138] A number of different assays for kinase activity can be utilized for assaying for active modulators and/or determining specificity of a modulator for a particular kinase or group of kinases. In addition to the assays mentioned in the Examples below, one of ordinary skill in the art will know of other assays that can be utilized and can modify an assay for a particular application. For example, numerous papers concerning kinases describe assays that can be used. When assayed for kinase activity, preferred compounds of the present invention (i.e., compounds of Formula HI) will have an IC5o or EC50 of less than 10 μΜ, also less than 1 μΜ, also less than 100 nM, also less than 10 nM or less than 1 nM.
TV. Organic Synthetic Techniques
[0139] A wide array of organic synthetic techniques exist in the art to prepare compounds of Formula HI, Many of these organic synthetic methods are described in detail in standard reference sources utilized by those skilled in the art. One example of such a reference is March, 1994, Advanced Organic Chemistry; Reactions, Mechanisms and Structure, New York, McGraw Hill.
V. Alternative Compound Forms or Derivatives
[0140] Compounds contemplated herein are described with reference to both generic formulae and specific compounds. In addition, invention compounds may exist in a number of different forms or derivatives, all within the scope of the present invention, These include, for example, tautomers, stereoisomers, racemic mixtures, regioisomers, salts, prodrugs (e.g., carboxylic acid esters), solvated forms, different crystal forms or polymorphs, and active metabolites.
(a) Tautomers, Stereoisomers, Regioisomers, and Solvated Forms
[0141] It is understood that some compounds may exhibit tautomerism. In such cases, the formulae provided herein expressly depict only one of the possible tautomeric forms. It is therefore to be understood that the formulae provided herein are intended to represent any tautomeric form of the depicted compounds and are not to be limited merely to the specific tautomeric form depicted by the drawings of the formulae.
[0142] Likewise, some of the compounds according to the present invention may exist as stereoisomers, i.e. having the same atomic connectivity of covalently bonded atoms yet differing in the spatial orientation of the atoms. For example, compounds may be optical stereoisomers, which contain one or more chiral centers, and therefore, may exist in two or more stereoisomeric forms (e.g. enantiomers or diastereomers). Thus, such compounds may be present as single stereoisomers (i.e., essentially free of other stereoisomers), racemates, and/or mixtures of enantiomers and/or diastereomers. As another example, stereoisomers include geometric isomers, such as cis- or transorientation of substituents on adjacent carbons of a double bond. All such single stereoisomers, racemates and mixtures thereof are intended to be within the scope of the present invention. Unless specified to the contrary, all such steroisomeric forms are included within the formulae provided herein,
[0143] In some embodiments, a chiral compound of the present invention is in a form that contains at least 80% of a single isomer (60% enantiomeric excess (“e.e.”) or diastereomeric excess (“d.e.”)), or at least 85% (70% e.e. or d.e.), 90% (80% e.e. or d.e,), 95% (90% e.e. or d.e.), 97.5% (95% e.e. or d.e.), or 99% (98% e.e. or d.e.). As generally understood by those skilled in the art, an optically pure compound having one chiral center is one that consists essentially of one of the two possible enantiomers (i.e., is enantiomerically pure), and an optically pure compound having more than one chiral center is one that is both diastereomerically pure and enantiomerically pure. In some embodiments, the compound is present in optically pure form.
[0144] For compounds in which synthesis involves addition of a single group at a double bond, particularly a carbon-carbon double bond, the addition may occur at either of the double bond-linked atoms. For such compounds, the present invention includes both such regioisomers.
[0145] Additionally, the formulae are intended to cover solvated as well as unsolvated forms of the identified structures. For example, the indicated structures include both hydrated and non-hydrated forms. Other examples of solvates include the structures in combination with a suitable solvent such as isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, or ethanolamine, (b) Prodrugs and Metabolites
[0146] In addition to the present formulae and compounds described herein, the invention also includes prodrugs (generally pharmaceutically acceptable prodrugs), active metabolic derivatives (active metabolites), and tlieir pharmaceutically acceptable salts.
[0147] Prodrugs are compounds or pharmaceutically acceptable salts thereof which, when metabolized under physiological conditions or when converted by solvolysis, yield the desired active compound. Prodrugs include, without limitation, esters, amides, carbamates, carbonates, ureides, solvates, or hydrates of the active compound. Typically, the prodrug is inactive, or less active than the active compound, but may provide one or more advantageous handling, administration, and/or metabolic properties. For example, some prodrugs are esters of the active compound; during metabolysis, the ester group is cleaved to yield the active drug. Also, some prodrugs are activated enzymatically to yield the active compound, or a compound which, upon further chemical reaction, yields the active compound.
[0148] In this context, a common example or a prodrug is an alkyl ester of a carboxylic acid. Relative to compounds of Formula ΠΙ, further examples include, without limitation, an amide or carbamate derivative at the 1 -position nitrogen of the azaindole core.
[0149] As described in The Practice of Medicinal Chemistry, Ch. 31-32 (Ed. Wermuth, Academic Press, San Diego, CA, 2001), prodrugs can be conceptually divided into two non-exclusive categories, bioprecursor prodrugs and carrier prodrugs. Generally, bioprecursor prodrugs are compounds that are inactive or have low activity compared to the corresponding active drug compound, that contain one or more protective groups and are converted to an active form by metabolism or solvolysis. Both the active drug form and any released metabolic products should have acceptably low toxicity. Typically, the formation of active drug compound involves a metabolic process or reaction that is one of the follow types:
[0150] Oxidative reactions: Oxidative reactions are exemplified without limitation to reactions such as oxidation of alcohol, carbonyl, and acid functionalities, hydroxylation of aliphatic carbons, hydroxylation of alicyclic carbon atoms, oxidation of aromatic carbon atoms, oxidation of carboncarbon double bonds, oxidation of nitrogen-containing functional groups, oxidation of silicon, phosphorus, arsenic, and sulfur, oxidative N-dealkylation, oxidative O- and S-dealkylation, oxidative deamination, as well as other oxidative reactions.
[0151] Reductive reactions: Reductive reactions are exemplified without limitation to reactions such as reduction of carbonyl functionalities, reduction of alcohol functionalities and carbon-carbon double bonds, reduction of nitrogen-containing function groups, and other reduction reactions.
[0152] Reactions without change in the oxidation state: Reactions without change in the state of oxidation are exemplified without limitation to reactions such as hydrolysis of esters and ethers, hydrolytic cleavage of carbon-nitrogen single bonds, hydrolytic cleavage of non-aromatic heterocycles, hydration and dehydration at multiple bonds, new atomic linkages resulting from dehydration reactions, hydrolytic dehalogenation, removal of hydrogen halide molecule, and other such reactions.
[0153] Carrier prodrugs are drug compounds that contain a transport moiety, e.g., that improves uptake and/or localized delivery to a site(s) of action. Desirably for such a carrier prodrug, the linkage between the drug moiety and the transport moiety is a covalent bond, the prodrug is inactive or less active than the drug compound, the prodrug and any release transport moiety are acceptably non-toxic. For prodrugs where the transport moiety is intended to enhance uptake, typically the release of the transport moiety should be rapid. In other cases, it is desirable to utilize a moiety that provides slow release, e.g., certain polymers or other moieties, such as cyclodextrins. (See, e.g,, Cheng et al., U.S, Patent Publ. No. 20040077595, App. No. 10/656,838, incorporated herein by reference). Such carrier prodrugs are often advantageous for orally administered drugs. Carrier prodrugs can, for example, be used to improve one or more of the following properties: increased lipophilicity, increased duration of pharmacological effects, increased site-specificity, decreased toxicity and adverse reactions, and/or improvement in drug formulation (e.g., stability, water solubility, suppression of an undesirable organoleptic or physiochemical property). For example, lipophilicity can be increased by esterification of hydroxyl groups with lipophilic carboxylic acids, or of carboxylic acid groups with alcohols, e.g., aliphatic alcohols. Wermuth, supra.
[0154] Prodrugs may proceed from prodrug form to active form in a single step or may have one or more intermediate forms which may themselves have activity or may be inactive.
[0155] Metabolites, e.g., active metabolites overlap with prodrugs as described above, e.g., bioprecursor prodrugs. Thus, such metabolites are pharmacologically active compounds or compounds that further metabolize to pharmacologically active compounds that are derivatives resulting from metabolic process in the body of a subject. Of these, active metabolites are such pharmacologically active derivative compounds. For prodrugs, the prodrug compound is generally inactive or of lower activity than the metabolic product. For active metabolites, the parent compound may be either an active compound or may be an inactive prodrug.
[0156] Prodrugs and active metabolites may be identified using routine techniques know in the art. See, e.g., Bertolini et al, 1997, J Med Chem 40:2011-2016; Shan et al., JPharm Sci 86:756-757; Bagshawe, 1995, Drug Dev Res 34:220-230; Wermuth, supra.
(c) Pharmaceutically acceptable salts
[0157] Compounds can be formulated as or be in the form of pharmaceutically acceptable salts. Pharmaceutically acceptable salts are non-toxic in the amounts and concentrations at which they are administered. The preparation of such salts can facilitate the pharmacological use by altering the physical characteristics of a compound without preventing it from exerting its physiological effect. Useful alterations in physical properties include lowering the melting point to facilitate transmucosal administration and increasing the solubility to facilitate administering higher concentrations of the drug.
[0158] Pharmaceutically acceptable salts include acid addition salts such as those containing sulfate, chloride, hydrochloride, fumarate, maleate, phosphate, sulfamate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, cyclohexylsulfamate and
PCI7US2006/024361 quinate. Pharmaceutically acceptable salts can be obtained from acids such as hydrochloric acid, maleic acid, sulfuric acid, phosphoric acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cyclohexylsulfamic acid, fumaric acid, and quinic acid.
[0159] Pharmaceutically acceptable salts also include basic addition salts such as those containing benzathine, chloroprocaine, choline, diethanolamine, ethanolamine, t-butylamine, ethylenediamine, meglumine, procaine, aluminum, calcium, lithium, magnesium, potassium, sodium, ammonium, alkylamine, and zinc, when acidic functional groups, such as carboxylic acid or phenol are present. For example, see Remington's Pharmaceutical Sciences, 19U1 ed., Mack Publishing Co., Easton, PA, Vol. 2, p. 1457, 1995. Such salts can be prepared using the appropriate corresponding bases.
[0160] Pharmaceutically acceptable salts can be prepared by standard techniques. For example, the free-base form of a compound can be dissolved in a suitable solvent, such as an aqueous or aqueousalcohol solution containing the appropriate acid and then isolated by evaporating the solution. In another example, a salt can be prepared by reacting the free base and acid in an organic solvent.
[0161] Thus, for example, if the particular compound is a base, the desired pharmaceutically acceptable salt may be prepared by any suitable method available in the art, for example, treatment of the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, or with an organic acid, such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, a pyranosidyl acid, such as glucuronic acid or galacturonic acid, an alpha-hydroxy acid, such as citric acid or tartaric acid, an amino acid, such as aspartic acid or glutamic acid, an aromatic acid, such as benzoic acid or cinnamic acid, a sulfonic acid, such as p-toluenesulfonic acid or ethanesulfonic acid, or the like.
[0162] Similarly, if the particular compound is an acid, the desired pharmaceutically acceptable salt may be prepared by any suitable method, for example, treatment of the free acid with an inorganic or organic base, such as an amine (primary, secondary or tertiary), an alkali metal hydroxide or alkaline earth metal hydroxide, or the like. Illustrative examples of suitable salts include organic salts derived from amino acids, such as L-glycine, L-lysine and L-arginine, ammonia, primary, secondary, and tertiary amines, and cyclic amines, such as hydroxyethylpyrrolidine, piperidine, morpholine and piperazine, and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum and lithium. Further examples of pharmaceutically acceptable salts of compounds of Formula I include, without limitation, the mono-sodium and bis-potassium salts thereof.
[0163] The pharmaceutically acceptable salt of the different compounds may be present as a complex. Examples of complexes include 8-chlorotheophylline complex (analogous to, e.g., dimenhydrinate: diphenhydramine 8-chlorotheophylline (1:1) complex; Dramamine) and various cyclodextrin inclusion complexes.
[0164] Unless specified to the contrary, specification of a compound herein includes pharmaceutically acceptable salts of such compound.
(d) Polymorphic forms
[0165] In the case of agents that are solids, it is understood by those skilled in the art that the compounds and salts may exist in different crystal or polymorphic forms, all of which are intended to be within the scope of the present invention and specified formulae.
VI. Administration
[0166] The methods and compounds will typically be used in therapy for human subjects. However, they may also be used to treat similar or identical indications in other animal subjects. In this context, the terms “subject,” “animal subject,” and the like refer to human and non-human vertebrates, e.g. mammals, such as non-human primates, sports and commercial animals, e.g., equines, bovines, porcines, ovines, rodents, and pets, e.g., canines and felines.
[0167] Suitable dosage forms, in part, depend upon the use or the route of administration, for example, oral, transdermal, transmucosal, inhalant or by injection (parenteral). Such dosage forms should allow the compound to reach target cells. Other factors are well known in the art, and include considerations such as toxicity and dosage forms that retard the compound or composition from exerting its effects. Techniques and formulations generally may be found in The Science and Practice of Pharmacy, 21st edition, Lippincott, Williams and Wilkins, Philadelphia, PA, 2005 (hereby incorporated by reference herein).
[0168] Compounds of the present invention, i.e. Formula HI, can be formulated as pharmaceutically acceptable salts.
[0169] Carriers or excipients can be used to produce compositions, The carriers or excipients can be chosen to facilitate administration of the compound. Examples of carriers include calcium carbonate, calcium phosphate, various sugars such as lactose, glucose, or sucrose, or types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols and physiologically compatible solvents. Examples of physiologically compatible solvents include sterile solutions of water for injection (WFI), saline solution, and dextrose.
PCI7US2006/024361
[0170] The compounds can be administered by different routes including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, transmucosal, rectal, transdermal, or inhalant. Oral administration is preferred. For oral administration, for example, the compounds can be formulated into conventional oral dosage forms such as capsules, tablets, and liquid preparations such as syrups, elixirs, and concentrated drops.
[0171] For inhalants, compounds of the invention may be formulated as dry powder or a suitable solution, suspension, or aerosol. Powders and solutions may be formulated with suitable additives known in the art. For example, powders may include a suitable powder base such as lactose or starch, and solutions may comprise propylene glycol, sterile water, ethanol, sodium chloride and other additives, such as acid, alkali and buffer salts. Such solutions or suspensions may be administered by inhaling via spray, pump, atomizer, or nebulizer, and the like. The compounds of the invention may also be used in combination with other inhaled therapies, for example corticosteroids such as fluticasone proprionate, beclomethasone dipropionate, triamcinolone acetonide, budesonide, and mometasone furoate; beta agonists such as albuterol, salmeterol, and formoterol; anticholinergic agents such as ipratroprium bromide or tiotropium; vasodilators such as treprostinal and iloprost; enzymes such as DNAase; therapeutic proteins; immunoglobulin antibodies; an oligonucleotide, such as single or double stranded DNA or RNA, siRNA; antibiotics such as tobramycin; muscarinic receptor antagonists; leukotriene antagonists; cytokine antagonists; protease inhibitors; cromolyn sodium; nedocril sodium; and sodium cromoglycate.
[0172] Pharmaceutical preparations for oral use can be obtained, for example, by combining the active compounds with solid excipients, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose (CMC), and/or polyvinylpyrrolidone (PVP: povidone). If desired, disintegrating agents may be added, such as the cross—linked polyvinylpyrrolidone, agar, or alginic acid, or a salt thereof such as sodium alginate.
[0173] ' Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain, for example, gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol (PEG), and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dye-stuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
[0174] Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin (“gelcaps”), as well as soft, sealed capsules made of gelatin, and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols (PEGs). In addition, stabilizers may be added.
[0175] Alternatively, injection (parenteral administration) may be used, e.g., intramuscular, intravenous, intraperitoneal, and/or subcutaneous. For injection, the compounds of the invention are formulated in sterile liquid solutions, preferably in physiologically compatible buffers or solutions, such as saline solution, Hank's solution, or Ringer's solution. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms can also be produced.
[0176] Administration can also be by transmucosal, topical, or transdermal means. For transmucosal, topical or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration, for example, may be through nasal sprays or suppositories (rectal or vaginal). The topical compositions of this invention are formulated preferably as oils, creams, lotions, ointments and the like by choice of appropriate carriers known in the art. Suitable carriers include vegetable or mineral oils, white petrolatum (white soft paraffin), branched chain fats or oils, animal fats and high molecular weight alcohol (greater than C!2). The preferred carriers are those in which the active ingredient is soluble. Emulsifiers, stabilizers, humectants and antioxidants may also be included as well as agents imparting color or fragrance, if desired. Creams for topical application are preferably formulated from a mixture of mineral oil, self-emulsifying beeswax and water in which mixture the active ingredient, dissolved in a small amount solvent (e.g., an oil), is admixed. Additionally, administration by transdermal means may comprise a transdermal patch or dressing such as a bandage impregnated with an active ingredient and optionally one or more carriers or diluents known in the art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
[0177] The amounts of various compounds to be administered can be determined by standard procedures taking into account factors such as the compound IC5o, the biological half-life of the compound, the age, size, and weight of the subject, and the disorder associated with the subject. The importance of these and other factors are well known to those of ordinary skill in the art. Generally, a dose will be between about 0,01 and 50 mg/kg, preferably 0.1 and 20 mg/kg of the subject being treated. Multiple doses may be used.
EXAMPLES
[0178] Examples related to the present invention are described below. In most cases, alternative techniques can be used. The examples are intended to be illustrative and are not limiting or restrictive to the scope of the invention. In some examples, the mass spectrometry result indicated for a compound may have more than one value due to the isotope distribution of an atom in the molecule, such as a compound having a bromo or chloro substituent.
Example 1: Synthesis of propane-l-sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine-3carbonyI)-2,4-difluoro-phenyl]-amide P-0773 and related compounds.
[0179] Compound P-0773 was synthesized in five steps from 2,4-difluoro-phenylamine 42 as shown in Scheme 13.
Scheme 13
<img file="IL188248A_D0028.tif" />
Step 1 - Preparation of 3-amino-2,6-difluoro-benzoic acid benzyl ester (43):
[0180] To 2,4-difluoro-phenylamine (42, 5.11 mL, 50.7 mmol) in tetrahydrofuran (250 mL), cooled with dry ice/acetone bath under an atmosphere of nitrogen, was added n-butyllithium (1.60 M in hexane, 34.0 mL, 54.4 mmol) slowly. After 30 minutes, l,2-Bis-(chloro-dimethyl-silanyl)-ethane (11.5 g, 53.4 mmol) dissolved in tetrahydrofuran (40.0 mL) was added to the reaction slowly. After 1 hour, n-butyllithium (1.60 M in hexane, 31.9 mL, 51.0 mmol) was added slowly to the reaction. The reaction was stirred at -78 °C for 30 minutes and then allowed to warm to room temperature over 40 minutes. The reaction was cooled to -78 °C, followed by addition of n-butyllithium (1.60 M in hexane, 35.1 mL, 56.2 mmol) slowly. After 70 minutes, benzyl chloroformate (7.97 mL, 55.8 mmol) was added to the reaction. The reaction mixture was stirred at -78 °C overnight followed by addition of 2 N HC1 (120 mL). The reaction was allowed to warm to room temperature for 2 hours. The organic layer was separated. The aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtrated and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate/hexane 20%) to give a colorless oil (43, 10.6 g, 79.7%). MS(ESI) [M+lT]+ = 264.1.
Step 2 - Preparation of2,6-difluoro (propane-l-sulfonylamino)-benzoic acid benzyl ester (44); [0181] To 3-amino-2,6-difluoro-benzoic acid benzyl ester (43, 6.00 g, 22.8 mmol) in methylene chloride (150 mL) was added pyridine (2.76 mL, 34.2 mmol) and propane sulfonyl chloride (3.80 mL, 33.8 mmol). The reaction was stirred at room temperature overnight. Then the reaction was poured into water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtrated and concentrated. The desired compound was isolated with silica gel column chromatography to give a colorless oil (44, 7.0 g, 83.1%). MS(ESI) [Μ+Ηψ = 370.1.
Step 3 - Preparation of2,6-difluoro (propane-l-sulfonylamino)-benzoic acid (45);
[0182] To 2,6-difluoro (propane-l-sulfonylamino)-benzoic acid benzyl ester (44,2.0 g, mmol) in methanol (30 mL) was added 20% palladium hydroxide on carbon (100 mg). The reaction was stirred under hydrogen at 1 atm for 15 niinutes. The reaction was filtrated and concentrated to give white solid 45 that was used in the next step.
Step 4 - Preparation of2,6-difluoro (propane-l-sulfonylamino)-benzoyl chloride (46):
[0183] To 2,6-difluoro (propane-l-sulfonylamino)-benzoic acid (45,1.50 g, 5.4 mmol) was added toluene (7.0 mL) and thionyl chloride (15.0 mL, 0.21 mmol). The reaction was heated to reflux for 3 hours. The reaction was concentrated to give crude compound that was used in the next step.
Step 5- Preparation of propane sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)2,4-difluoro-phenyl]-amide (P-0773):
[0184] To aluminum trichloride (8.89 g, 66.7 mmol) was added methylene chloride (150 mL) under an atmosphere of nitrogen below 5 °C. Into this, 5-bromo azaindole (67, 1.64 g, 8.34 mmol) in methylene chloride (20 mL) was added. The reaction was stirred for 60.0 minutes and 2,6-difluoro-3(propane-l-sulfonylamino)-benzoyl chloride (46, 3.50 g, 11.8 mmol) in methylene chloride (20 mL) was added. The reaction was stirred for 6 hours and warmed to room temperature overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtrated and concentrated. The desired compound was isolated by silica gel column chromatography (methylene chloride/methanol 5%) to give a white solid (P-0773, 1.2 g, 31.4%). MS(ESI) [M+1T]+ = 460.0, 462.0.
[0185] N-[3-(5-Bromo-lH-pynolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]benzenesulfonamide P-0798 and N-[3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluorophenyl] -3 -fluoro-benzenesulfonamide
<img file="IL188248A_D0029.tif" />
were prepared following the protocol of Scheme 13, substituting propane sulfonyl chloride with benzenesulfonyl chloride and 3-fluoro-benzenesulfonyl chloride, respectively, in Step 2. P-0798 MS(ESI) [M - H4]' = 489.9, 491.9.
[0186] Propane sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridme carbonyl) chloro-2fluoro-phenylj-amide P-0805
<img file="IL188248A_D0030.tif" />
was prepared following the protocol of Scheme 13, substituting 2,4-difluoro-phenylamine with 4chloro fluoro-phenylamine in Step 1. MS(ESI) [M - H4]’ = 471.9, 473.9.
[0187] Propane sulfonic acid [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]amide P-0007
<img file="IL188248A_D0031.tif" />
was prepared following the protocol of Scheme 13, substituting 5-bromo azaindole with 7azaindole in Step 5. MS(ESI) [M + H*]+ = 380.1.
[0188] Propane sulfonic acid [2,4-difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide P-0806
<img file="IL188248A_D0032.tif" />
was prepared following the protocol of Scheme 13, substituting 5-bromo azaindole with 5methoxy azaindole 104 (prepared as described in Example 16) in Step 5. MS(ESI) [M - H*]’ = 410.1.
Example 2: Synthesis of Propane-l-sulfonic acid [3-(5-bromo-lH-pyn&#1470;olo[2,3-b]pyridine-3carbonyl) fluoro-phenyl]-amide P-0955 and related compounds.
[0189] Compound P-0955 was synthesized iii six steps from 4-chloro fluoro-phenylamine 47 as shown in Scheme 14.
Scheme 14
<img file="IL188248A_D0033.tif" />
Step 1 - Preparation of 3-Amino chloro fluoro-benzoic acid benzyl ester (48):
[0190] To 4-chloro fluoro-phenylamine (47, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), cooled with dry ice/acetone bath under an atmosphere of nitrogen, was added n-butyllithium (2.500 M in hexane, 24.4 mL) slowly. After 20 minutes, l,2-Bis-(chloro-dimethyl-silanyl)-ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was added to the reaction slowly. After 1 hour, nbutyllithium (2.50 M in hexane, 25.0 mL) was added slowly to the reaction. The reaction was stirred at -78 °C for 20 minutes and allowed to warm to room temperature over 60 minutes. The reaction was cooled to -78 °C, followed by addition of n-butyllithium (2.50 M in hexane, 26.0 mL) slowly. After 80 minutes, benzyl chloroformate (10.0 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 °C overnight followed by addition of water (80 mL) and concentrated hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature for hours. The organic layer was separated and the aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtrated and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate/hexane 20%) to give a colorless oil (48, 12.5 g, 78.3%). MS(ESI) [Μ+Ηψ= 280.0.
Step 2 ~ Preparation of 6-chloro fluoro (propane-I-sulfonylamino)-benzoic acid benzyl ester (49):
[0191J To 3-amino chloro fluoro-benzoic acid benzyl ester (48,1.20 g, 4.3 mmol) in methylene chloride (28 mL) was added pyridine (0.52 mL, 6.4 mmol) and propane sulfonyl chloride (0.685 g, 4.8 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtrated and concentrated. The desired compound was isolated with silica gel column chromatography to give a colorless oil (49, 960 mg, 58.0%). MS(ESI) [M-H9]’ - 384.1.
Step 3 - Preparation of 6-chloro fluoro (propane-l-sulfonylamino)-benzoic acid (115): [0192] To 6-chloro fluoro (propane-l-sulfonylamino)-benzoic acid benzyl ester (49, 6.00 g, 15.6 mmol) in tetrahydrofuran (100 mL) was added 1.0 M aqueous potassium hydroxide (100 mL). The reaction was heated to reflux overnight. The reaction was poured into water, acidified to pH 2 with 1 N hydrochloric acid and extracted with ethyl acetate. The organic portion was dried over anhydrous sodium sulfate, filtrated and concentrated to give a white solid 115 (3.95 g, 85.8%).
Step 4 ~ Preparation of2-fluoro (propane-l-sulfonylamino)-benzoic acid (50):
[0193] To 6-chloro fluoro (propane-l-sulfonylamino)-benzoic acid (115, 0.69 g, 2.3 mmol) in methanol (10 mL) was added 20% palladium hydroxide on carbon (200 mg). The reaction was stirred under hydrogen at 50 psi for 2 hours. The reaction was filtrated and concentrated to give white solid 50 that was used in the next step. MS(ESI) [14-177=260.1.
Step 5 - Preparation of2-fluoro (propane-l-sulfonylamino)-benzoyl chloride (51):
[0194] To 2-fluoro (propane-l-sulfonylamino)-benzoic acid (50,1.17 g, 4.5 mmol) was added thionyl chloride (10.0 mL). The reaction was heated to reflux for 3 hours. The reaction was concentrated to give crude compound 51 that was used in the next step.
Step 6- Preparation of Propane sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine~3-carbonyl)2-fluoro-phenyl]-amide (P-0955):
[0195] Aluminum trichloride (2.52 g, 18.9 mmol) and methylene chloride (60.0 mL) were combined under an atmosphere of nitrogen. Into the reaction mixture, was added 5-bromo azaindole (67, 630.0 mg, 3.2 mmol) in methylene dichloride (20.0 mL). The reaction was stirred at room temperature for 70 minutes, then 2-fluoro (propane-l-sulfonylamino)-benzoyl chloride (51, 0.749 g, 2.68 mmol) in methylene chloride (20 mL) was added. The reaction was stirred at room temperature for 2 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give compound P-0955 (65 mg, 5.5%). MS(ESI) [M+H4]4 = 440.2, 442.2.
[0196] Using the protocol of Scheme 14, substituting 5-bromo-azaindole with either 5-chloro-7azaindole (80, prepared as described in Example 9), 5-fluoro azaindole (81, prepared as described in Example 9) or 7-azaindole in Step 6, propane-l-sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine3-carbonyl) fluoro-phenyl]-amideP-1013 (MS(ESI) [M - H4]' = 394.1), propane-l-sulfonic acid [2fluoro (5-fluoro-lH-pyrrolo[2,3&#1470;b]pyridine carbonyl)-phenyl]-amide P-1028 (MS(ESI) [Μ -H*]&#1470; = 378.1), and propane-l-sulfonic acid [2-fluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]amide P-1056 (MS(ESI) [M + H4]4 = 362.2) were prepared, respectively;
<img file="IL188248A_D0034.tif" />
P-1013
<img file="IL188248A_D0035.tif" />
Example 3: Propane-l-sulfonic acid [2,4-difluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine3-carbonyl)-phenyI]-amide P-0088 and related compounds.
[0197] Compound P-0088 was synthesized in one step from propane-l-sulfonic acid [3-(5-bromolH-pyrrolo[2,3-b]pyridjne carbonyl)-2,4-difluoro-phenyl]-amide P-0773 by Suzuki coupling ((Muyaura and Suzuki, Chem. Rev. 1995,95:2457) as shown in Scheme 15.
Scheme 15
<img file="IL188248A_D0036.tif" />
Step 1 - Preparation of propane-l-sulfonic acid [2,4-difluoro (5-pyridin yl-lH-pyrrolo[2,3i>/pyridine carbonyl)-phenyl]-amide (P-0088):
[0198] To propane-l-sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4difluoro-phenyl]-amide (P-0773, prepared as described in Example 1, 65.0 mg, 0.14 mmol) in acetonitrile (4.0 mL) was added pyridine boronic acid (609, 25.0 mg, 0.20 mmol), tetrakis (triphenylphosphine)palladium(O) (11 mg, 1.0% mmol) and aqueous potassium carbonate (1.0 M, 2.0 mL). The reaction was heated to 160 °C for 10 minutes in a CEM Discover microwave instrument. The reaction was poured into water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtrated and concentrated. The desired compound was isolated by silica gel column chromatography (methylene chloride/methanol 5%) to give a white solid (P-0088, 30 mg, 46.9%). MS(ESI) [M+1T]+ = 457.2.
[0199] Additional compounds were prepared following the protocol of Scheme 15, optionally replacing propane sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluorophenyl]-amide P-0773 with an appropriate 5-bromo azaindole and/or pyridine boronic acid 609 with an appropriate boronic acid or boronic acid ester. The 5-bromo azaindole used was synthesized as described in either Example 1, 2, 5, or 54. The following compounds were made following this procedure:
N-[2,4-Difluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]benzenesulfonamide (P-0685),
Propane-1 -sulfonic acid [4-chloro fluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-amide (P-0753),
Propane-1 -sulfonic acid [2,4-difluoro (5-phenyl-lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-0636),
Propane-1 -sulfonic acid [4-chloro fluoro (5-phenyl-lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-0776)
Propane sulfonic acid {3-[5-(4-chloro-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-2,4difluoro-phenyl} -amide (P-0956),
Propane-1 -sulfonic acid {3-[5-(4-dimethylamino-phenyl)-lH-pyrrolo[2,3-b]pyridme carbonyl]-
2.4- difluoro-phenyl}-amide (P-0889),
Propane-1 -sulfonic acid {2,4-diflu0r0 [5-(4-meth0xy-phenyl)-lH-pyrT010[2,3-b]pyridine-3carbonyl]-phenyl}-amide (P-0877),
Propane-l-sulfonic acid {2,4-difluoro [5-(4-trifluoromethyl-phenyl)-lH-pyrrolo[2,3-b]pyridine3-carbonyl]-phenyl}-amide (P-0912),
Propane-l-sulfonic acid {2,4-difluoro [5-(3-methoxy-phenyl)-lH-pyrrolo[2,3-b]pyridine-3carbonyl]-phenyl}-amide (P-0874),
Propane-l-sulfonic acid {3-[5-(3-dimethylamino-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-
2.4- difluoro-phenyl} -amide (P-0876),
Propane-l-sulfonic acid [2-fluoro (5-phenyl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]amide (P-0897),
Propane-l-sulfonic acid {3-[5-(4-chloro-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl] fluorophenyl}-amide (P-1009),
5-phenyl-lH-pyrrolo[2,3-b]pyridine,
Propane-1 -sulfonic acid [2-fluoro (5-pyridin yl-1 H-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-1251),
Propane-1 -sulfonic acid {2,4-difluoro [5-(3-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridine-3carbonyl]-phenyl }-amide (P-1259),
Propane-1 -sulfonic acid {2,4-difluoro [5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridine-3carbonyl]-phenyl}-amide (P-1260),
Propane-1 -sulfonic acid [2-fluoro (5-pyridin yl-lH-pyrrolo [2,3-b]pyridine carbonyl)phenyl]-amide (P-1261),
Propane-1 -sulfonic acid [2,4-difluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-1262),
3-{3-[2,6-Difluoro (propane-l-sulfonylamino)-benzoyl]-lH-pyrrolo[2,3-b]pyridin yl}benzoic acid (P-1266),
Propane-1 -sulfonic acid {2,4-difluoro [5-(3-morpholin yl-phenyl)-lH-pyrrolo[2,3-b]pyridine3-carbonyl]-phenyl} -amide (P-1873),
Propane sulfonic acid {2,4-difluoro [5-(3-morpholin ylmethyl-phenyl)-lH-pyrrolo[2,3b]pyridine carbonyl]-phenyl} -amide (P-1878),
Propane sulfonic acid {2,4-difluoro [5-(6-methoxy-pyridin yl)-lH-pyrrolo[2,3-b]pyridine-
3- carbonyl]-phenyl} -amide (P-1879),
Propane sulfonic acid {2,4-difluoro [5-(6-morpholin yl-pyridin yl)-lH-pyrrolo[2,3b]pyridine carbonyl]-phenyl}-amide (P-1881),
Propane-1 -sulfonic acid (2,4-difluoro {5-[6-(4-methyl-piperazin-1 -yl)-pyridin yl]-1Hpyrrolo[2,3-b]pyridine carbonyl}-phenyl)-amide (P-1882),
Propane sulfonic acid {3-[5-(4-cyano-3,5-dimethyl-phenyl)-lH-pyrrolo[2,3-b]pyridine-3carbonyl]-2,4-difluoro-phenyl}-amide (P-1980),
N-{2,4-Difluoro [5-(l-n1ethyl-lH-pyrazol yl)-lH-pyrrolo[2,3-b]pyridine carbonyl]phenyl } trifluoromethyl-benzenesulfonamide (P-1996),
N-{2,4-Difluoro [5-(l-methyl-lH-pyrazol yl)-lH-pyrrolo[2,3-b]pyridine carbonyl]phenyl }-3 -fluoro-benzenesulfonamide (P-1997),
Propane-1 -sulfonic acid {2,4-difIuoro-3 -[5-( 1 -methyl-1 H-pyrazol yl)-1 H-pyrrolo[2,3b]pyridine carbonyl]-phenyl}-amide (P-1864),
Propane-1 -sulfonic acid {3-[5-(4-chloro-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl] fluorophenyl}-amide (P-1432),
4- {3-[2,6-Difluoro (propane-l-sulfonylamino)-benzoyl]-lH-pyrrolo[2,3-b]pyridin yl}- benzamide (P-1546),
4-{3-[2,6-Difluoro (propane-l-sulfonylamino)-benzoyl]-lH-pyrrolo[2,3-b]pyridm yl}-N,Ndimethyl-benzamide (P-1547),
Propane sulfonic acid (2,4-difluoro {5-[4-(morpholine carbonyl)-phenyl]-lH-pyrrolo[2,3b]pyridine carbonyl}-phenyl)-amide (P-1548), 3-{3-[2,6-Difluoro (propane-l-sulfonyla1nino)-benzoyl]-lH-pyrrolo[2,3-b]pyridin yl}benzamide (P-1549),
Propane-1 -sulfonic acid {2,4-difluoro [5-(4-methyl-lH-imidazol yl)-lH-pyrrolo[2,3b]pyridine carbonyl]-phenyl)-amide (P-2006), and
N-{2,4-Difluoro [5-(6-methoxy-pyridin yl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-phenyl)3 -fluoro-benzenesulfonamide (P-2012).
The following table indicates the 5-bromo azaindole (column 2) and boronic acid (column 3) used to afford the compound (column 4). Column 1 provides the compound number and column 5 the observed mass.
<td></td><td> 5-Br azaindole</td><td> Boronic acid</td><td> Compound</td><td> MS(ES1) [M+HY observed</td>
<td> P-0685</td><td> F. CtA _ 0 ״ To nn 0 ח</td><td> B(OH)2 Q</td><td> n 0 )־־\ץ ך <sup>Nsi</sup>rXr4 fhn-s-O L Km' 11 \==z N 0</td><td> 491.1</td>
<td> P-0753.</td><td><sup>Cl</sup>>\ 4 VQ ל f |T F Η 0 'N N</td><td> B(OH)<sub>2 </sub>ό</td><td> Τ T ל <sup>F</sup> H 0 Sj^-n <sup>N</sup> H</td><td> 473.1</td>
<td> P-0636</td><td><sup>1 </sup>xz^/ □ךיי XZ ο-ω-Μ- O</td><td> ^OH)2</td><td> η (1 7 ב r־M׳s=o <sup>F</sup> HO</td><td> 456.1</td>
<td> P-0776</td><td> r it 7 <sup>F</sup> h 0</td><td> B(OH)2 ό</td><td> o O' ° J</td><td> 472.1</td>
<td> P-0956</td><td> s? zQ /L<sup>0</sup> Im xz ־^י״־ס o</td><td> B(OH)2 Φ Cl</td><td><sup>C</sup>׳Y^1 °7¾ 1 1[ 7 <sup>F</sup> H 0 STn</td><td> 490.1</td>
<td> P-0889</td><td> כס zH x2Jm<sup>o</sup><sup>11</sup>־ xz co <sup>u</sup> 11 o</td><td> B(OH)2 Φ /<sup>N</sup>X.</td><td><sup>zN</sup>n vU ל UVvX z^N'r<sup>0 </sup>Γ 11 7 <sup>F</sup> ho <sup>N</sup> n</td><td> 499.2</td>
<td></td><td> 5-Br azaindole</td><td> Boronic acid</td><td> Compound</td><td> MS(ESI) [M+HT observed</td>
<td> P-0877</td><td> O CL Ο נם</td><td> B(OH)<sub>2</sub> Φ</td><td> °YX °7¾ J J j r־\<sub>r</sub>s=o ר זו ז <sup>F</sup> h 0 SAn n <sub>H</sub></td><td> 486.3</td>
<td> P-0912</td><td> 'S'~° רזו ץ <sup>F</sup> ho Vn</td><td> B(OH)2 9 cf<sub>3</sub></td><td> f<sub>3</sub>c״^ S Xw>U<sup>0 </sup>ר ז ץ <sup>F</sup> ho Vn</td><td> 524.1</td>
<td> P-0874</td><td> CD zS xz o</td><td> B(OH)2 1</td><td> o zx IX \ C<sup>2</sup> €/</td><td> 484.3 [M-H<sup>4</sup>]־</td>
<td> P-0876</td><td> o CL p<sup>2 </sup>ω</td><td> B(OH)2 ό /<sup>N</sup>-X</td><td> x jCUvP^<sup>n</sup>'^<sup>=0 </sup>^^רקל^ז <sup>F</sup> ho I SAn</td><td> 499.3</td>
<td> P-0897</td><td> כס zC xz o</td><td> (J^oh)<sub>2</sub></td><td> o סן<sup>1</sup> xz o</td><td> 438.3</td>
<td> P-1009</td><td> °uC s- <sup>Br</sup>wT /n׳?~° r רז <sup>F</sup> ho SZn</td><td> B(OH)2 0 Cl</td><td><sup>01</sup>ΎΊ VO י L IL J r\1-־s=0 >Vt4 f π & ״ H</td><td> 472.2</td>
<td> P-0857</td><td> R. X <sup>Br</sup>vLTr <sup>N</sup>''~° r רז <sup>F</sup> ho SZn</td><td> B(OH)2 0</td><td> υυΠ^Ν<sup>0</sup>'?־<sup></sup>r 1Γר <sup>F</sup> ho SAn</td><td> 455.1 [M-H<sup>4</sup>]</td>
<td></td><td><sup>Βγ</sup>ΎΊΛ SAn <sup>N</sup> H</td><td> 1J3JOH)2</td><td> Γ1 Sr N <sup>N</sup> H</td><td></td>
<td> P-1251</td><td> °rP Βγ-^\Α^/Ν'״~° 1 ר זו <sup>F</sup> ho Vn</td><td> B(OH)<sub>2</sub> 6</td><td> ים <sup>2</sup>Q xz o</td><td> 439.3</td>
<td> P-1259</td><td> γζϋ Br<sub>></sub>^L7/'N'<sup>0</sup>~״<sup></sup>γ it ר <sup>F</sup> ho V-N</td><td> B(OH)2</td><td> —--1 w >s xz ° II O</td><td> 474.2</td>
<td></td><td> 5-Br azaindole</td><td> Boronic acid</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>/ observed</td>
<td> P-1260</td><td> נס 1zA° xz o</td><td> B(OH)<sub>2</sub> 9 F</td><td> sp. °2q M J V S=o \ || ? <sup>F H</sup> 0 VN</td><td> 474.2</td>
<td> P-1261</td><td> נס zH χί>γ<sup>ο</sup> xz <sup>0</sup>A<sup>7</sup>' o</td><td> B(OH)<sub>2 </sub>A</td><td> n JI J _ Γ /-/-5.=0 <sup>0|χ4χ</sup>^[ΑΓ7 <sup>F</sup> ho SAn</td><td> 490.2</td>
<td> P-1262</td><td> o zx CL p<sup>z </sup>CD</td><td> B(OH)2 9</td><td> o zx CXu. <sub>o</sub>A£zx G<sup>h </sup>/A ?־־</td><td> 457.2</td>
<td> P-1266</td><td> z*S V Ί.Ζ o</td><td> B(OH)2 Ο^,ΟΒη 0</td><td><sup>1 </sup>o VTA o z<sup>7</sup>) XZ o</td><td> 500.1</td>
<td> P-1873</td><td> Mi /<sup>7</sup>Ν'® <sup>0 </sup>ץ YA<sup>F</sup> ho SAn</td><td> Ϊ^Ν־׳> Ao</td><td> η AA 1A Jn״-s־o <sup>f</sup> η 0 °A SAn ח</td><td> 541.2</td>
<td> P-1878</td><td> y0 7 Βη^-γ/ / Ν'® <sup>0 </sup>1 11 7 <sup>F</sup> HO SAn</td><td> 0</td><td> AA 5=<sup>7</sup> Z-«. ζζΛ ^-o xz>^^ xz o׳״-־^ o</td><td> 555.3</td>
<td> P-1879</td><td> בס zfS xzLLy 0ךיי xz Ο</td><td> b-O-a?A z=/ O־\</td><td> o— xz, O-׳״^ o</td><td> 487.3</td>
<td> P-1881</td><td> כס χζ^ΧΥ 0ךיי xz ο</td><td> p-x Li B-0 ־/0</td><td> o -y־~w׳־° zx C<sup>z</sup><sup>2</sup>0 1-:z. G-/</td><td> 542.3</td>
<td> P-1882</td><td> כס zfS xLa-a 0ךיי xz o</td><td> ך־\ A-ν' Q B-0 1 T:</td><td> ''nA <sup>f</sup>\־־\ ( <NvA oA ) > ΧνΓΑ1<sup>0־ </sup>ץ TA <sup>F</sup> ho</td><td> 555.3</td>
<td></td><td> 5-Br azaindole</td><td> Boronic acid</td><td> Compound</td><td> MS(ESI) [Μ+1ΓΓ observed</td>
<td> P-1980</td><td> כס xzJ-^P XZ Ο</td><td> B(OH)2 CN</td><td> z o z^ חד \ סך<sup>1</sup> xz ^י״־־ס ο</td><td> 509.2</td>
<td> P-1996</td><td> R _/<sup>CF3</sup> °rM P <sup>Br</sup>W<sup>F HN</sup>0* ׳׳־ <sup>0</sup></td><td> 1 ,N. °C</td><td> σ> LL. °ר!ו ο IL JL.<sup>ζ</sup>' z Caw ° c? ׳׳<sup>Z</sup>P</td><td> 562.2</td>
<td> P-1997</td><td> a> °^<xz )==/.71 z x/n־־°~<Zkz ן! // γ o</td><td> 1 ,N B-0 c</td><td> \ <sup>F</sup>V^ <sup>F</sup>Y-a A 0 O0 <sup>F HN</sup>0^־ nn 0 ח</td><td> 512.2</td>
<td> P-1864</td><td> o CO Ul\ ° C<sup>z </sup>m</td><td> 1 <sub>Z</sub>N. B-0 °C</td><td> \ <sup>F</sup>y^ / N-j, °V-O n3 '/τΛ / W <sup>F HN</sup>־>o nN o ח</td><td> 460.2</td>
<td> ' P-1432</td><td> □ם xiXf° זי\ fj xz O</td><td> B(OH)<sub>2</sub> Cl</td><td> o y_) zf2j G Σ.Ζ. o</td><td> 472.2</td>
<td> P-1546</td><td> כס zQ x^M זי\ ץץי xz -^י״־ס Ο</td><td> B(OH)2 ό O<sup><־k</sup>'NH<sub>2</sub></td><td> nh<sub>2</sub> / AxJ?m־o 1 II 7 <sup>F</sup> HO Vn</td><td> 497.2</td>
<td> P-1547</td><td> γζΛ ץ II ל <sup>F</sup> η 0 Vn</td><td> B(OH)2 o0׳si<sup>x</sup></td><td> o zx <sup>1</sup>¾4<sup>1</sup> p<sup>2</sup> \ /</td><td> 527.3</td>
<td> P-1548</td><td> ρ' <sup>Ν</sup>'®~° Γ |Γ> <sup>F</sup> HO Vn</td><td> B(OH)2 i ״ a</td><td> <<sup>N</sup> 1ΓΊ °vQ s-o O^> PΝ' υ~° ר זו ץ <sup>F</sup> ho</td><td> 569.3</td>
<td> P-1549</td><td><sup>F</sup> ho רזו ץ</td><td> B(OH)2 (\׳NH<sub>2 </sub>0</td><td> ο ZX 0-u. LU \ ״ <sub>o<</sub>^zx G<sup>2 </sup>o W7 Z CM T</td><td> 499.3</td>
<td></td><td> 5-Br azaindole</td><td> Boronic acid</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]* observed</td>
<td> P-2006</td><td> 1 1 ° 0־7/^ <sup>1</sup><sup>1</sup> ZI jCX m</td><td> N=\</td><td> Fv f ΗΝ-εζ W <5° ח</td><td> 560.2</td>
<td> P-2012</td><td> F. V r 0 <sup>Br</sup>T7f7 <sup>F hn</sup>7Z 1Π 0' ° ח</td><td> B(OH)<sub>2</sub> Φ /0</td><td> jOl '° z 1/־־־=־/ (X uf ץ ° lj<sup>21 </sup>-o</td><td> 632.1</td>
Example 4: Synthesis of N-[2,4-difluoro (5-pyridin yl-lH-pyrro]o[2,3-b]pyridine-3carbonyl)-phenyl]-ethanesulfonamide P-0728.
[0200] Compound P-0728 was synthesized in eight steps from 2,4-difluorophenylamine 42 as shown in Scheme 16.
Scheme 16
<img file="IL188248A_D0037.tif" />
Step 1 - Preparation of dibenzyl-(2,4-difluoro-phenyl)-amine (52);
[0201] To 2,4-difluoro-phenylamine (42,10.0 g, 77.4 mmol) in Ν,Ν-dimethylformamide (130 mL) were added potassium carbonate (32.1 g, 0.23 mol) and benzyl bromide (21.2 mL, 0.18 mol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtrated. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% ethyl acetate in hexane. The appropriate fractions were combined and concentrated to provide the compound (52,12.0 g, 50%), MS(ESI) [M+H4]4 = 310.2.
Step 2 — Preparation of3-dibenzylamino-2,6-difluoro-benzaldehyde (53):
[0202] To dibenzyl-(2,4-difluoro-phenyl)-amine (52, 4.30 g, 13.9 mmol) in tetrahydrofuran (60 mL), under an atmosphere of nitrogen, cooled in a 78&#1470; °C acetone/dry ice bath, was added nbutyllithium (2.50 M in hexane, 6.1 mL, 15.3 mmol) slowly. The reaction was stirred for 1 hour, N,N-dimethylfonnamide (1.2 mL, 15.3 mmol) was added and the reaction was allowed to warm to room temperature for 1 hour. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% ethyl acetate in hexane to provide the compound (53,4.0 g, 85%). MS(ESI) [M+H4]4 = 337.2.
Step 3 - Preparation of (3-dibenzylamino-2,6-difluoro-phenyl)-(5-pyridin yl-IH-pyrrolo[2,3b]pyridin yl)-methanol (54):
[0203] To 3-dibenzylamino-2,6-difluoro-benzaldehyde (53,0.76 g, 2.3 mmol) in methanol (50 mL) were added 5-pyridin yl-lH-pyrrolo[2,3-b]pyridine (89, 0.40 g, 2.1 mmol, prepared as described in Example 17) and potassium hydroxide (0.50 g, 8.9 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% methanol in methylene chloride to provide the compound (54, 0.60 g, 50%). MS(ESI) [M+H4]4 = 533.2.
Step 4 - Preparation of (3-dibenzylamino-2,6-difluoro-phenyl)-(5-pyridin yl-lH-pyrrolo[2,3bJpyridin yl)-methanone (55):
[0204] To (3-dibenzylamino-2,6-difluoro&#1470;phenyl)-(5-pyridin3&#1470;-yl-lH-pyrrolo[2,3-b]pyridin yl)methanol (54, 0.90g, 1.7 mmol) in methylene chloride (20 mL) under an atmosphere of nitrogen was added Dess-Martin periodane (0.97 g, 2.3 mmol). The reaction was stirred at room temperature for 15 minutes. The reaction was poured into a solution of sodium bicarbonate and sodium thiosulfate and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% methanol in methylene chloride to provide the compound (55, 0.70 g, 78%).
MS(ESI) [M+H4]4531.2 &#1470;&#1470;.
Step 5 - Preparation of(3-dibenzylamino-2,6-difluoro-phenyl)-(5-pyridin yl-l-triisopropylsilanyllH-pyrrolo[2,3-b]pyridin yl)-methanone (56):
[0205] To (3-dibenzylamino-2,6-difluoro-phenyl)-(5-pyridn1 yl-lH-pyrrolo[2,3-b]pyridin yl) methanone (55, 0.84 g, 1.6 mmol) in tetrahydrofuran (150 mL) was added sodium hydride (210.0 mg, 60% in mineral oil, 5.3 mmol) under an atmosphere of nitrogen. The reaction was stirred for 5 minutes. Triisopropylsilyl chloride (0.80 mL, 3.8 mmol) was added and the reaction was stirred at room temperature for 3 hours. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% ethyl acetate in hexane to provide the compound (56,420 mg, 39%). MS(ESI) [M+1T]+ = 687.4.
Step 6—Preparation of (3-amino-2,6-diflu0ro-phenyl)-(5-pyridin yl-l-triisopropylsilanyl-lHpyrrolo[2,3-b]pyridin yl)-methanone (57):
[0206] To (3-dibenzylamino-2,6-difluoro-phenyl)-(5-pyridin yl-l-triisopropylsilanyl-lHpyrroIo[2,3-b]pyridin yl)-methanone (56, 55.0 mg, 0,080 mmol) in methanol (15 mL) was added 20% palladium hydroxide on carbon (20 mg). The reaction was stirred under an atmosphere of hydrogen overnight. The reaction was filtered to remove the catalyst, and then concentrated to give the crude compound that was used in the next step.
Step 7 - Preparation ofN-[2,4-difluoro (5-pyridin yl-l-triisopropylsilanyl-lH-pyrrolo[2,3b]pyridine carbonyl)-phenyl]-ethanesulfonamide (58):
[0207] To (3-amino-2,6-difIuoro-phenyl)-(5-pyridin-3&#1470;yl-l-triisopropylsilanyl-lH-pyrrolo[2,3b]pyridin yl)-methanone (57, 35.0 mg, 0.069 mmol) in methylene chloride (6 mL) was added methanesulfonyl chloride (0.30 mL, 3.9 mmol) and triethylamine (0.40 mL, 2.9 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated to give the crude compound that was used in the next step.
Step 8 - Preparation ofN-[2,4-difluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-ethanesulfonamide (P-0728):
[0208] To N-[2,4-difluoro (5-pyridin yl-l -triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]&#1470;ethanesulfonamide (58, 35.0 mg, 0.060 mmol) in tetrahydrofuran (10 mL) was added tetra-n-butylammonium fluoride (19 mg, 0.072 mmol). The reaction was stirred at room temperature for 5 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% methanol in methylene chloride to provide the compound (P-0728, 5.6 mg, 22%). MS(ESI) [M+H+]+ = 443.1.
Example 5: Preparation of propane sulfonic acid [2,4-difluoro (5-pyridin yl-lHpyrrolo[2,3-b]pyridme carbonyl)-phenyl]-amide P-0850.
[0209] Compound P-0850 was synthesized in four steps from 2,4-difluorophenylamine 42 as shown in Scheme 17.
Scheme 17
<img file="IL188248A_D0038.tif" />
<img file="IL188248A_D0039.tif" />
Step 1 - Preparation of propane sulfonic acid (2,4-difluoro-phenyl)-amide (59):
[0210] To 2,4-difluoro-phenylamine (42,4.0 mL, 40.0 mmol) in methylene chloride (50 mL) were added pyridine (3.37 mL, 42.3 mmol), propane sulfonyl chloride (6.00 g, 42.3 mmol) and dimethylaminopyridine (0.20 g, 1.64 mmol) under an atmosphere of nitrogen. The reaction was stirred at 45 °C overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography 3% methanol in methylene chloride to give a white solid (59, 8.0 g, 85%). MS(ESI) [M-H*]’ = 234.0.
Step 2 - Preparation of propane sulfonic acid (2,4-difluoro formyl-phenyl)-amide (60): [0211] To propane sulfonic acid (2,4-difluoro-phenyl)-amide (59, 2.35 g, 9.95 mmol) in tetrahydrofuran (70 mL) under an atmosphere of nitrogen cooled with a dry ice/acetone bath was added 1.60 M of n-butyllithium (1.60 M in hexane, 6.53 mL, 10.45 mmol). The reaction was stirred for 40 minutes, and then another portion of n-butyllithium (1.60 M in hexane, 6.84 ml,, 10.94 mmol) The reaction was stirred for 1 hour and Ν,Ν-dimethylformamide (0.92 mL, 11.9 mmol) was added. The reaction was allowed to warm to room temperature overnight. The reaction was poured into water extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtrated. The filtrate was concentrated and purified by silica gel column chromatography (dichloromethane/methanol 5%) to give the compound (60, 1.4 g, 53.4%). MS(ESI) [M-IT] =263.4.
Step 3 - Preparation ofpropane sulfonic acid {2,4-difluoro [hydroxy-(5-pyridin yl-lHpyrrolo[2,3-b]pyridin yl)-methyl]-phenyl}-amide (61):
[0212] To propane sulfonic acid (2,4-difluoro formyl-phenyl)-amide (60, 220.0 mg, 0.83 mmol) in methanol (15 mL) was added 5-pyridin yl-lH-pyrrolo[2,3-b]pyridine (89, 150.0 mg, 0.77 mmol, prepared as described in Example 17) and potassium hydroxide (537.0 mg, 9.6 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate and filtrated. The filtrate was concentrated and purified by silica gel c-obimn chromatography eluting with 5% methanol in dichloromethane to give the compound (61,160 mg, 45.3%). In this step, minor compound Propane sulfonic acid {2,4-difluoro [methoxy-(5-pyridin3-yl-lH-pyrrolo[2,3-b]pyridin yl)-methyl]-phenyl}-amide was also formed and isolated. MS(ESI) [M + 1Τ]+= 460.1.
Step 4 - Preparation of propane sulfonic acid [2,4-difluoro (5-pyridin yl-lH-pyrrolo[2,3b]pyridine carbonyl)-phenyl]-amide (P-0850):
[0213] To propane sulfonic acid {2)4-difluoro [hydroxy-(5-pyridin yl-lH-pyrrolo[2,3b]pyridin yl)-methyl]-phenyl)-amide (61,40.0 mg, 0.087 mmol) in tetrahydrofuran (10 mL) was added Dess-Martin periodane (48.0 mg, 0.11 mmol). The reaction was stirred at room temperature for 5 minutes. The reaction was poured into sodium thiosulfate and potassium carbonate solution and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtrated. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% methanol in methylene chloride to give the compound (P-0850,13.4 mg, 33.5%).
MS(ESI) [M + HT = 458.1.
[0214] N-(2,4-Difluoro formyl-phenyl) trifluoromethyl-benzenesulfonamide 579, N-(2,4difluoro formyl-phenyl) trifluoromethyl-benzenesulfonamide 580, and N-(2,4-difluoro formylphenyl) fluoro-benzenesulfonamide 581, and (2,4-difluoro formyl-phenyl)-carbamic acid benzyl ester
<img file="IL188248A_D0040.tif" />
<img file="IL188248A_D0041.tif" />
O F
<img file="IL188248A_D0042.tif" />
HN-S^
581 o
F
<img file="IL188248A_D0043.tif" />
were prepared following Steps 1 and 2 of Scheme 17, substituting propane sulfonyl chloride with 3trifluoromethyl-benzenesulfonyl chloride, 4-trifluoromethyl-benzenesulfonyl chloride, 4-fluorobenzenesulfonyl chloride, and benzyl chloroformate, respectively, in Step 1.
PCI7US2006/024361
[0215J Propane sulfonic acid [4-chloro (5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2fluoro-phenyl]-amide P-1004
<img file="IL188248A_D0044.tif" />
was prepared using the protocol of Scheme 17, substituting 2,4-difluoro-phenylamine with 4-chloro2-fluoro-phenylamine and propane sulfonyl chloride with propane sulfonyl chloride in Step 1, and 5-pyridin yl-lH-pyrrolo[2,3-b] pyridine 89 with 5-chloro azaindole 80 (see Example 9) in Step 3. MS(ESI) [M + HT]+ = 430.1.
[0216] Propane-1 -sulfonic acid [4-chloro fluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide P-0904
<img file="IL188248A_D0045.tif" />
was prepared using the protocol of Scheme 17, substituting 2,4-difluoro-phenylamine with 4-chloro2-fluoro-phenylamine and propane sulfonyl chloride with propane sulfonyl chloride in Step 1, and 5-pyridin yl-lH-pyrrolo[2,3-b]pyridme 89 with 7-azaindole 94 in Step 3. MS(ESI) [M + H*]* = 396.2.
[0217] Thiophene sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluorophenyl]-amide P-1267
<img file="IL188248A_D0046.tif" />
was prepared using the protocol of Steps 3 and 4 of Scheme 17, substituting 5-pyridin yl-lHpyrrolo[2,3-b]pyndine 89 with 5-chloro azaindole 80 (see Example 9) and propane sulfonic acid (2,4-difluoro formyl-phenyl)-amide 60 with thiophene sulfonic acid (2,4-difluoro formylphenyl)-amide 512 (see Example 21) in Step 3. MS(ESI) [M + ET]451.9 = &#1470;.
[0218] Thiophene sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluorophenyl]-amide P-1268
PCT7US2006/024361
<img file="IL188248A_D0047.tif" />
was prepared using the protocol of Steps 3 and 4 of Scheme 17, substituting 5-pyridin yl-lHpyrrolo[2,3-b]pyridine 89 with 5-chloro azaindole 80 (see Example 9) and propane sulfonic acid (2,4-difluoro formyl-phenyl)-amide 60 with thiophene sulfonic acid (2,4-difluoro formylphenyl)-amide 513 (see Example 21) in Step 3. MS(ESI) [M + HV = 454.1.
[0219] Additional compounds were prepared following the protocol of Scheme 1 &#1512; , optionally replacing propane sulfonyl chloride with an appropriate acid chloride in Step 1 and/or 5-pyridin-3yl-lH-pyrrolo[2,3-b]pyridine with an appropriate azaindole in Step 3. Azaindoles were purchased or synthesized as described in Examples 6, 13,14, 16 and 17. Some compounds were isolated after Step 3, as either hydroxy or methoxy derivatives. The following compounds were made following this procedure:
Dimethylamine-1 -sulfonic acid {3-[5-(4-chloro-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]2,4-difluoro-phenyl}-amide (P-1257), N-[3-(5-Bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]-benzenesulfonamide (P-0798),
Propane-1 -sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluorophenyl]-amide (P-0773),
Dimethylamine-1 -sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4&#1470;difluorophenyl]-amide (P-0898), N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]-benzenesulfonamide (P-0885), N-[2,4-Difluoro (5-fluoro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-benzenesulfonamide (P-0902),
Propane sulfonic acid {2,4-difluoro [hydroxy-(5-isopropenyl-lH-pyrrolo[2,3-b]pyridin yl)methyl]-phenyl }-amide (P-1239),
Propane sulfonic acid [2,4-difluoro (5-isopropenyl-lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-0991),
Propane sulfonic acid {2,4-difluoro [hydroxy-(5-methyl-lH-pyTrolo[2,3-b]pyridin yl)methyl]-phenyl}-amide (P-1240),
Propane-1 -sulfonic acid {2,4-difluoro [methoxy-(5-methyl-lH-pyrrolo[2,3-b]pyridin yl)methyl]-phenyl}-amide (P-1241),
Propane sulfonic acid {2,4-difluoro [hydroxy-(5-isopropyl-lH-pyrrolo[2,3-b]pyridin yl)methyl]-phenyl}-amide (P-1242),
PCI7US2006/024361
Propane-l-sulfonic acid [2,4-difluoro (5-isopropyl-lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-0997),
Propane-1 -sulfonic acid {2,4-difluoro [hydroxy-(5-methoxy-1 H-pyrrolo[2,3-b]pyridin-3 -yl)methyl]-phenyl }-amide (P-1243),
Propane-l-sulfonic acid {2,4-difluoro [methoxy-(5-methoxy-lH-pyrrolo[2,3-b]pyridin yl)methyl]-phenyl}-amide (P-1244),
Propane-1 -sulfonic acid (2,4-difluoro {hydroxy-[5-(4-methyl-piperazin-1 -yl)-l H-pyrrolo[2,3b]pyridin yl]-methyl}-phenyl)-amide (P-1245),
Propane-1 -sulfonic acid [3-(5-chloro-1 H-pyrrolo [2,3 -b]pyridine-3 -carbonyl)-2,4-difluorophenyl]-amide (P-0933),
Propane-l-sulfonic acid [2,4-difluoro (5-fluoro-lH-pyn&#1470;olo[2,3-b]pyridine carbonyl)-phenyl]amide (P-0907),
Piperidine sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluorophenyl]-amide (P-1020),
N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] methoxybenzenesulfonamide (P-0983),
N-[3-(4-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]-benzenesulfonamide (P-0954),
Dimethylamine sulfonic acid [3-(lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]amide (P-0950),
Dimethylamine sulfonic acid [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4difluoro-phenyl]-amide (P-0837),
Dimethylamine sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluorophenyl]-amide (P-1258),
Butane-1 -sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]amide (P-1263),
Butane sulfonic acid [2,4-difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-1264),
Butane-1 -sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]amide (P-1265),
Propane-l-sulfonic acid [3-(5-ethoxy-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluorophenyl]-amide (P-1252),
Propane-l-sulfonic acid {2,4-difluoro [5-(2-methoxy-ethoxy)-lH-pyn&#1470;olo[2,3-b]pyridine-3carbonyl]-phenyl}-amide (P-1253),
Propane-l-sulfonic acid {3-[5-(2-diethylamino-ethoxy)-lH-pyrrolo[2,3-b]pyridine carbonyl]2,4-difluoro-phenyl}-amide (P-1254),
N-[3-(5-Chloro-lH-py1rolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] ethyl93 benzenesulfonamide (P-1700),
N-[3-(5-Ethyl-lH-pyrrolo[2,3-b]pyridme carbonyl)-2,4-difluoro-phenyl] trifluoromethylbenzenesulfonamide (P-1783),
Thiophene sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluorophenyl]-amide (P-1798),
Benzo[b]thiophene sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4difluoro-phenyl]&#1470;amide (P-1799),
5-Pyridin yl-thiophene suIfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine3&#1470;-carbonyl)-2,4difluoro-phenyl]-amide (P-1800),
N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] cyanobenzenesulfonamide (P-1822),
N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] fluoro methylbenzenesulfonamide (P-1823),
N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] isopropylbenzenesulfonamide (P-1839),
N-[35)&#1470;-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] fluorobenzenesulfonamide (P-1840),
N-[35)&#1470;-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]-3,5-difluorobenzenesulfonamide (P-1841),
N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] methylbenzenesulfonamide (P-1842),
N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] oxazol ylbenzenesulfonamide (P-1843),
N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] fluoro-benzenesulfonamide (P-1865),
N-{2,4-Difluoro [5-(2-methoxy-ethoxy)-lH-pyrrolo[2,3-b]pyridine carbonyl]-phenyl}-3fluoro-benzenesulfonamide (P-1871),
N-{2,4-Difluoro [5-(2-methoxy-ethoxy)-lH-pyrrolo[2,3-b]pyridine carbonyl]-phenyl}-4fluoro-benzenesulfonamide (P-1872),
Propane-l-sulfonic acid (2,4-difluoro-32)-4]-5}&#1470;-methoxy-ethoxy)-phenyl]-lH-pyrrolo[2,3b]pyridine-3 -carbonyl) -phenyl)-amide (P-1998),
N-{2,4-Difluoro [5-(2-methoxy-ethoxy)-lH-pyrrolo[2,3-b]pyridine carbonyl]-pl1enyl}-4trifluoromethyl-benzenesulfonamide (P-2005), and
N-(2,4-Difluoro {5-[4-(2-methoxy-ethoxy)-phenyl]-lH-pyrrolo[2,3-b]pyridine carbonyl}phenyl) trifluoromethyl-benzenesulfonamide (P-2013).
The following table indicates the acid chloride (column 2) and the azaindole (column 3) used to afford the target compounds (column 4). Column 1 provides the compound number and column 5 the observed mass. Compounds isolated after Step 3 of Scheme 17 are so noted in column 1.
<td></td><td> Sulfonyl chloride</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [m+hT observed</td>
<td> P-1257</td><td><sub>z</sub>so<sub>2</sub>ct N \</td><td> o 20</td><td><sup>F</sup>\—X <sup>01</sup>חד Vm θ / . .....</td><td> 415.1</td>
<td> P-0798</td><td> (JO<sub>2</sub>CI</td><td> כס</td><td><sup>0</sup>)¾ Q YX?<sup>F HN</sup>0^־ <sup>k</sup>N־^N O רו</td><td> 489.9 491.1 [M-H<sup>4</sup>]־</td>
<td> P-0773</td><td></td><td> □ס</td><td> XY ΎΧ5<sup>F HN</sup>0^־ ח</td><td> 455.9 457.9 [M-H<sup>4</sup>]־</td>
<td> P-0898</td><td><sub>Z</sub>SO<sub>2</sub>CI ~N \</td><td> tn</td><td> 3ס י— <sup>2</sup>Q חד \ ζ Ο=ω_ _/ Ί Ο \</td><td> 497.0 499.1</td>
<td> P-0885</td><td></td><td> ο <sup>2</sup>Q ί</td><td><sup>0</sup>/¾ Q <sup>01</sup>רץ□ <sup>f ην</sup>0^־ <sup>Ν</sup> Μ Ο</td><td> 446.1 448.1 [M-H<sup>4</sup>]'</td>
<td> P-0902</td><td> SO<sub>2</sub>CI A</td><td> ל X ץ</td><td> \ V<sup>/ζ </sup>1 Ζ /=־s/x kAu. nr ך o^C<sup>zx</sup> C<sup>z </sup>LL</td><td> 430.1 [M-H<sup>4</sup>]־</td>
<td> P-1239 Step 3</td><td> ^SC^CI</td><td> Χο <sup>ΙΝ</sup> Η</td><td> 1 ΎΡ Xm <sup>f hn</sup>k nN 0 ΓΊ</td><td> 422.2 [M-H<sup>4</sup>]־</td>
<td> P-0991 —</td><td> /^,502°)</td><td> ׳''ΚΠ <sup><</sup>־ν'<sup>λ</sup>~ν <sup>1</sup> Η</td><td> ״UO F <sup>HN</sup>־^O nN 0 ΓΊ</td><td> 420.2</td>
<td></td><td> Sulfonyl chloride</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+1T]<sup>+ </sup>observed</td>
<td> P-1240 Step 3</td><td> /^^<sup>S</sup>°2<sup>C|</sup></td><td> *חרץ ־^Ιψ N H</td><td> xS^4° ri</td><td> 396.4 [M-H<sup>4</sup>]־</td>
<td> P-1241 Step 3</td><td> ^^SO<sub>2</sub>CI</td><td> H</td><td> nN 0 ח</td><td> 410.3 [M-Pf]־</td>
<td> P-1242 Step 3</td><td></td><td> N ' H</td><td> N׳^N 0 H</td><td> 424.3 [M-H*]־</td>
<td> P-0997</td><td></td><td> 0Π3 ^ixr N H</td><td> -¼¾ nN 0 ח</td><td> 422.3</td>
<td> P-1243 Step 3</td><td> y-^/<sup>80201</sup></td><td> 3רץ <sup>k</sup><sub>N</sub>^N H</td><td> C>W ־t ׳ ח</td><td> 412.3 [M-H<sup>4</sup>]'</td>
<td> P-1244 Step 3</td><td> ^-^/<sup>8</sup>°<sup>201</sup></td><td> סלץ <sup>1</sup>'hT'N H</td><td></td><td> 426.4 [M-H*]־</td>
<td> P-1245 Step 3</td><td> ^/-^/<sup>8</sup>°<sup>2</sup>°<sup>1</sup></td><td> N H</td><td><sup>Xn</sup>0<sub>Ny</sub>^U 1¾ <sup>f hn</sup>t°</td><td> 480.3 [M-H7</td>
<td> P-0933</td><td> ___/SO2CI</td><td> o</td><td><sup>c</sup>1׳^tP4<sub>0</sub>״ nN 0 rl</td><td> 414.2</td>
<td> P-0907</td><td> //-^<sup>8</sup>°<sup>201</sup></td><td> In <sup>H</sup> M</td><td><sup>F</sup>n'S4<sub>0 </sub>nn 0 ח</td><td> 396.1 [M-PT]־ 1</td>
<td></td><td> Sulfonyl chloride</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [m+hT observed</td>
<td> P-1020</td><td> SO<sub>2</sub>CI 0</td><td> o S'</td><td> R. Οχ < J <sup>Clx</sup>m <sup>f h</sup>O<sub>0 </sub>nN 0</td><td> 455.2</td>
<td> P-0983</td><td> SO<sub>2</sub>CI Φ O\</td><td> o χ Α-</td><td> ״־0 AA N N O ח</td><td> 476.1 [M-H<sup>4</sup>]־</td>
<td> P-0954</td><td> SO<sub>2</sub>CI ό</td><td> Cl (CO ׳</td><td> aO W<sup>F h</sup>t> H</td><td> 448.2</td>
<td> P-0950</td><td><sub>Z</sub>SO<sub>2</sub>CI ־־~N \</td><td> CQ</td><td> F. CO F <sup>HN</sup>־X0 nN 0 ח</td><td> 381.2</td>
<td> P-0837</td><td> ״SO<sub>2</sub>CI N \</td><td> סלן <sup>N</sup> H</td><td> א- ס ο xW חד \ -nAV /־=/! z Ο=ώ^/ ο \</td><td> 458.1</td>
<td> P-1258</td><td><sub>Z</sub>SO<sub>2</sub>CI N \</td><td> o</td><td> Ο ο \ 7י יי AV mA־/ o=L / יי o \</td><td> 415.1</td>
<td> P-1263</td><td> ^^y<sup>S02CI</sup></td><td> נס £N</td><td><sup>ΒΓ</sup>γχΓ^<sup>Ν</sup>0-^־ SrN 0 ח</td><td> 472.1 474.1</td>
<td> P-1264</td><td> __<sub>/</sub>SO<sub>2</sub>CI</td><td> N <sup>1</sup> H</td><td> °ΊπΟ^<sup>Ν</sup>־λ> Vn 0 ח</td><td> 424.2</td>
<td> P-1265</td><td> ^_^SO<sub>2</sub>CI</td><td> o</td><td> nN 0 __n______________</td><td> 426.0 [M-H<sup>4</sup>]'</td>
<td></td><td> Sulfonyl chloride</td><td colspan="2"> Azaindole</td><td> Compound</td><td> MS(ESI) [Μ+Ηψ observed</td>
<td> P-1252</td><td> /__^SO<sub>2</sub>CI</td><td> r°n <sup>1</sup> N</td><td> p? H</td><td> Γ°τ9ςΓ^<sup>Ν</sup>0^־ <sup>1</sup> N N 0 ri</td><td> 424.2</td>
<td> P-1253</td><td> /^,30201</td><td> e</td><td> 'N H</td><td> V^N 0 . ___________________ רז_________________</td><td> 454.2</td>
<td> P-1254</td><td> /^,3°<sup>2</sup>°<sup>1</sup></td><td> <; ύ ב N</td><td> N H</td><td><sup>0</sup>Of^<sup>N</sup>T°</td><td> 495.3</td>
<td> P-1700</td><td></td><td> P o</td><td> H</td><td> -ρΡέ o</td><td> 476.2</td>
<td> P-1783</td><td> SO<sub>2</sub>CI 9 cf<sub>3</sub></td><td> p</td><td> N H</td><td> ps-?־ n^n 0 ח</td><td> 510</td>
<td> P-1798</td><td> SO<sub>2</sub>CI ά</td><td> p בם</td><td><sup>1</sup>N H</td><td> ?Λ ° <Z)=O 1 z EXu. C<sup>z </sup>m —</td><td> 495.9 497.6 [M-Hl</td>
<td> P-1799</td><td> SO<sub>2</sub>CI ή</td><td></td><td> H</td><td><sup>c1</sup>rx> <sup>f hn</sup>0^״־ N^N O ח</td><td> 502.0 (-)</td>
<td> P-1800</td><td> SO<sub>2</sub>CI \ <sup>s</sup> o</td><td> Clx/^. ך <sub>x</sub> bT</td><td> H</td><td> ־pp.^ ח</td><td> 531.1</td>
<td> P-1822</td><td> SO<sub>2</sub>CI Φ CN</td><td> 1 <sub>x</sub> N־־</td><td> H</td><td><sub>F</sub> CN <sup>α</sup>ηί^<sup>ΗΝ</sup>־έ <sup>k</sup>N^N O ח</td><td> 473.1</td>
<td></td><td> Sulfonyl chloride</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [Μ+ΗΑ observed</td>
<td> P-1823</td><td> SO<sub>2</sub>CI L</td><td> o</td><td> ״A-L A'A 0</td><td> 480.1</td>
<td> P-1839</td><td> SO2CI $</td><td> Ύ J3</td><td> ΑΆ 0 ח</td><td> 488</td>
<td> P-1840</td><td> SO<sub>2</sub>CI Φ F</td><td> LA</td><td> F <sup>c</sup>׳y^^״£ N N 0 Π _____________ _</td><td> 464</td>
<td> P-1841</td><td> SO<sub>2</sub>CI A</td><td> o ύ</td><td> ״AAr <sup>k</sup>rAN 0 ח</td><td> 482</td>
<td> P-1842</td><td> SO<sub>2</sub>CI Ψ</td><td> LA</td><td> A ο ___________ ח</td><td> 460.0 [Μ-Α]־</td>
<td> P-1843</td><td> SO<sub>2</sub>CI :</td><td> o</td><td> A <sup>α</sup>η4^׳ζ ΑΆ 0 ח</td><td> 513.0 [Μ-Η<sup>4</sup>]־</td>
<td> P-1865</td><td> SO<sub>2</sub>CI 7 F</td><td> CQ</td><td> F ׳^A ״־־ ׳ to Η</td><td> 432.1</td>
<td> P-1871</td><td> SO<sub>2</sub>Cl 01</td><td> c</td><td> Αα <sup>1</sup>Άν ο π</td><td> 506.2</td>
<td> P-1872</td><td> SO<sub>2</sub>CI ό J_____F_______</td><td> cA></td><td> αΛ ______________ח</td><td> 506.2</td>
PCI7US2006/024361
<td></td><td> Sulfonyl chloride</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]* observed</td>
<td></td><td> SO<sub>2</sub>CI Ψ cf<sub>3</sub></td><td> 1 פס</td><td> בס ס ιζζΑΡ 1Λ/ Z ά'Χλο ω</td><td></td>
<td> P-1998</td><td></td><td> Η</td><td> F. \ <sub>f</sub>׳hn-s־o <sup>1</sup> SXn -vX H</td><td> 530.3</td>
<td> P-2005</td><td> SO<sub>2</sub>CI Φ cf<sub>3</sub></td><td> כ 5</td><td> F. X T ״ר\> f hn—3¾^ I A > 11 0 N N O</td><td> 556.0</td>
<td> P-2013</td><td> SO<sub>2</sub>CI Φ cf<sub>3</sub></td><td> Η</td><td> /-Π 0 חד \ -nyv I A־־/ z °'TA ח- ()</td><td> 539.2</td>
Example 6: Synthesis of propane-l-sulfonic acid [2,4-difluoro (5-phenylamino-lHpyrrolo[2,3-b]pyridine carbonyl)-phenyl]-amide P-0848 and related compounds.
[0220] Propane-l-sulfonic acid [2,4-difluoro (5-phenylamino-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-amide P-0848 was synthesized in five steps from 5-bromo azaindole 67 as shown in Scheme 18.
Scheme 18
<img file="IL188248A_D0048.tif" />
<img file="IL188248A_D0049.tif" />
PCI7US2006/024361
Step 1 - Preparation of 5-bromo-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (68): [0221] To 5-bromo azaindole (67,1.5 g, 7.6 mmol) in N,N-dimethylformamide (20 mL) were added sodium hydride (60% in mineral oil, 0.27 g, 11.0 mmol) and trriisopropylsilyl chloride ( 2.6 mL, 12.0 mmol), under an atmosphere of nitrogen. The reaction was stirred for 2 hours at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10 % ethyl acetate in hexane to give the compound (68, 1.6 g, 59%). MS(ESI)[M+H+]+ = 352.3.
Step 2 - Preparation of 5-phenyl-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine yl)-amine (69): [0222] To 5-bromo&#1470;l -triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (68, 0.10 g, 0.3 mmol) in toluene (5 mL) were added aniline (0.04 mL, 0.42 mmol), sodium Zertibutoxide (0.15 g, 1.56 mmol), tris(diben2yllideneacetone)dipalladium(0) (9.2 mg, 0.01 mmol) and (S) -(-)-2,2’bis(diphenylphosphino)-l,l ’-binaphthyl (6.3 mg, 0.01 mmol). The reaction was heated to 160 °C for 10 minutes in a CEM Discover microwave instrument. The reaction was concentrated and purified by silica gel column chromatography eluting with 3 % ethyl acetate in hexane to give the compound (69, 40 mg, 40%). MS(ESI)[M+H+]+ = 366.6.
Step 3 - Preparation of phenyl-(-lH-pyrrolo[2,3-b]pyridine yl)-amine (70): [0223] To 5-phenyl-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine yl)-amine (69, 0.14 g, mmol) in tetrahydrofuran (3.0 mL) was added tetra-n-butylammonium fluoride (0.197 g, 0.76 mmol). The reaction was stirred for 1 hour at room temperature. The reaction was concentrated and purified by silica gel column chromatography eluting with 3 % ethyl acetate in hexane to give the compound (70,60 mg, 76 %). MS(ESI)[M+lT]+ = 210.3.
Step 4 - Preparation of propane sulfonic acid {2,4-difluoro [hydroxy-(5-phenylamino-lHpyrrolo[2,3-b]pyridin yl)-methyl]-phenyl}-amide (71):
[0224] To phenyl-(-lH-pyrrolo[2,3-b]pyridine yl)-amine (70, 17.0 mg, 0.09 mmol) in methanol (5.0 mL) were added potassium hydroxide (92.0 mg, 1.6 mmol) and propane sulfonic acid (2,4difluoro formyl-phenyl)-amide (73,. 19.0 mg, 0.072 mmol, prepared as described in Example 7) under an atmosphere of nitrogen. The reaction was stirred for 12 hours at room temperature, The reaction was concentrated and purified by silica gel column chromatography eluting with 1 % methanol in dichloromethane to give the compound (71, 17 mg, 50%). MS^SIjfM+HA = 473.5.
Step 5 - Preparation of propane sulfonic acid [2,4-difluoro (5-phenylamino-lH-pyrrolo[2,3b]pyridine carbonyl)-phenyl]-amide (P-0848):
[0225] To propane sulfonic acid {2,4-difluoro [hydroxy-(5-phenylamino-lH-pyrrolo[2,3b]pyridin yl)-methyl]-phenyl)-amide (71, 7.5 mg, 0.016 mmol) in tetrahydrofuran (3 mL) was added Dess-Martin periodane (6,70 mg, 0.0158 mmol) under an atmosphere of nitrogen. The reaction was stirred for 20 minutes. The reaction was concentrated and purified by silica gel column chromatography eluting with 1 % methanol in dichloromethane to give the compound (P-0848, 6.2 mg, 84%). MS(ESI)[M+H+]+ = 471.2.
[0226J Propane sulfonic acid [2,4-difluoro (5-morpholin yl-lH-pyrrolo[2,3-b]pyridine-3 carbonyl)-phenyl]-amide P-0853, propane sulfonic acid {2,4-difluoro [5-(4-methyl-piperidin-lyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-phenyl)-amide P-0860, and propane sulfonic acid {2,4difluoro [5-(4-methyl-piperazin-l-yl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-phenyl}-amide
P-1246,
<img file="IL188248A_D0050.tif" />
were prepared using the protocol of Scheme 18, substituting aniline with morpholine, 4-methylpiperidine, and 4-methyl-piperazine, respectively, in Step 2. P-08S3 MS(ESI) [M + H4]4 = 465.2. P-0860 MS(ESI) [M + H*]+ = 477.3. P-1246 MS(ESI) [M - H4]478.4 = &#1470;.
[0227] 4-[5-(3-Chloro methoxy-phenylamino)-lH-pyrrolo[2,3-b]pyridine carbonyl]-indole-l carboxylic acid butylamide P-1859
<img file="IL188248A_D0051.tif" />
was prepared using the protocol of Scheme 18, substituting aniline with 3-chloro methoxyphenylamine in Step 2 and propane sulfonic acid (2,4-difluoro formyl-phenyl)-amide 73 with 4Formyl-indole-l-carboxylic acid butylamide 519 (see Example 22) in Step 4. MS(ESI) [M + H4]4 = 516.2.
Example 7: Synthesis of propane-l-sulfonic acid (2,4-difluoro formyl-phenyl)-amide 73.
[0228] Compound 73 was synthesized in two steps from 2,4-difluorophenylamine 42 as shown in Scheme 19.
Scheme 19
<img file="IL188248A_D0052.tif" />
Step 1
<img file="IL188248A_D0053.tif" />
Step 1 - Preparation of Propane sulfonic acid (2,4-difluoro-phenyl)-atnide (72): [0229] To 2,4-difluoro-phenylamine (42, 3.0 mL, 29.8 mmol) in tetrahydrofuran (50 mL) were added triethylamine (9.13 mL, 65.5 mmol) and propane sulfonyl chloride (2.90 mL, 25.8 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into 1 M HC1 and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the compound (72, 2.0 g, 28%) that was used in the next step.
Step 2 - Preparation of propane-l-sulfonic acid (2,4-difluoro formyl-phenyl)-amide (73): [0230] To propane-1 -sulfonic acid (2,4-difluoro-phenyl)-amide (72,1.5 g, 6.38 mmol) in tetrahydrofuran (10 mL) under an atmosphere of nitrogen, cooled in a -78 °C acetone/dry ice bath was added lithium diisopropylamide (0.80 M in tetrahydrofuran, 24 mL, freshly prepared from nbutyllithium and diisopropylamine). After 30 minutes, N,N-dimethyl-formamide (542 pL, 7.018 mmol) was added dropwise to the reaction. The reaction was stirred for 30 minutes at -78 °C and then allowed to warm to room temperature for 40 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5 % ethyl acetate in hexane to give a light yellow solid (73,300 mg, 18 %). MS(ESI)[MH4]262.3 &#1470;&#1470;.
Example 8: Synthesis of propane-l-sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-amide P-1116.
[0231] Compound P-1116 was synthesized in four steps from 3 -amino-benzoic acid ethyl ester 74 as shown in Scheme 20.
Scheme 20
<img file="IL188248A_D0054.tif" />
Step 1 - Preparation of 3-(propane-l-sulfonylamino)-benzoic acid ethyl ester (75):
[0232] To 3-amino-benzoic acid ethyl ester (74, 5.0 g, 0.030 mol) in methylene chloride (30.0 mL) were added pyridine (3.67 mL, 0.045 mol) and propane sulfonyl chloride (3.75 mL, 33.0 mmol) The reaction was stirred at room temperature for 2 hours. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and concentrated. The desired compound was isolated by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a white solid (75, 6.0 g, 74.1%).
Step 2 - Preparation of 3-(propane-l-sulfonylamino)-benzoic acid (76);
[0233] To 3-(propane-l-sulfonylamino)-benzoic acid ethyl ester (75, 1.60 g, 5.90 mmol) in water was added lithium hydroxide (1.0 g, 4.2 mmol) and tetrahydrofuran (20 mL). The reaction was stirred at room temperature overnight. The reaction mixture was acidified with 1 N HC1, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and washed with ethyl acetate to give the compound (76, 1.2 g, 84.5%) as white solid. MSiESIjfM-H4]1 = 242,1.
Step 3 - Preparation of 3-(propane-l-sulfonylamino)-benzoyl chloride (IT):
[0234] A solution of 3-(propane-l -sulfonylamino)-benzoic acid (76,1.20 g, 4.93 mmol) in thionyl chloride was heated to reflux for 3.0 hours. Evaporation of the solvent gave compound 77 as white solid that was used for the next step.
Step 4 - Preparation of propane-l-sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-1116):
[0235] To aluminum trichloride (4.8 g, 36.0 mmol) in methylene chloride (70.0 mL), under an atmosphere of nitrogen, was added 5-bromo-lH-pyrrolo[2,3-b]pyridine (67, 797 mg, 4.04 mmol) dissolved in methylene chloride (5.0 mL). The reaction was stirred at room temperature for 30 minutes, followed by addition of 3-(propane-l-sulfonylamino)-benzoyl chloride (77,1.10 g, 4.20 mmol) dissolved in methylene dichloride (4.0 mL). The reaction was stirred at room temperature for 2 hours. The reaction was poured into water and extracted with ethyl acetate. Tire organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give a white solid (P-1116, 300.0 mg). MS(ESI)[M-H+]’ 422.1 ,420.1 &#1470;&#1470;.
Example 9: Synthesis of 5-chIoro-lH-pyrrolo[2,3-b]pyridine 80.
[0236] Compound 80 was synthesized in two steps from 5-bromo-l-triisopropylsilyl azaindole 68 as shown in Scheme 21.
Scheme 21
<img file="IL188248A_D0055.tif" />
<img file="IL188248A_D0056.tif" />
Step J - Preparation 5-chloro-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (79):
[0237] To 5&#1470;bromo&#1470;l -triisopropylsilyl azaindole (68, 1.60 g, 4.53 mmol, prepared as described in Example 6) in tetrahydrofuran (50.0 mL), under an atmosphere of nitrogen at -78 °C, was added tertbutyllithium (1.70 M in hexane, 6.12 mL). The reaction was stirred for 1 hour, followed by addition of hexachloroethane (1.29 g, 5.43 mmol). The reaction was stirred for 3 hours, poured into water, and extracted with ethyl acetate. ,The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the crude compound (79,1.60 g). MS(ESI)[M+H+]+ = 309.3.
Step 2 - Preparation 5-chloro-lH-pyrrolo[2,3-b]pyridine (80):
[0238] To 5-chloro-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (79, 1.40 g, 4.53 mmol) in tetrahydrofuran (15 mL) was added Ze/ra-n-butylammonium fluoride (1.42 g, 5.43 mmol). The reaction mixture was stiffed at room temperature for 10 minutes. The reaction mixture was concentrated and isolated by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound (80, 0.40 g. 58% over 2 steps). MS(ESI)[M-H+] = 153.1.
[0239] 5-Fluoro&#1470;lH-pyffolo[2,3-b]pyridine 81
<img file="IL188248A_D0057.tif" />
was prepared using the protocol of Scheme 21, substituting hexachloroethane with N-fhioro-N(phenylsulfonyl) benzenesulfonamide in Step 1. MS(ESI) [M + ΗΓ4]’1’ = 137.1.
Example 10: Synthesis of 2,4-difluoro (S-pyridin yl-lH-pyrroIo[2,3-b]pyridin yImethyl)phenol P-0078 and related compounds.
[0240] Compound P-0078 was synthesized in two steps from 5-pyridin yl-lH-pyrrolo[2,3b]pyridine 89 as shown in Scheme 24.
Scheme 24
<img file="IL188248A_D0058.tif" />
Step I - Preparation of2,4-difluoro [hydroxy-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin yl)methyl]-phenol (P-0009):
[0241] To carbonic acid teri-butyl ester 2,4-difluoro formyl-phenyl ester (39, 0.405 g, 15.7 mmol) in methanol (36 mL), under an atmosphere of nitrogen, was added 5-pyridin yl-lH-pyrrolo[2,3b]pyridine (89, 288.0 mg, 14.8 mmol, prepared as described in Example 17) and potassium hydroxide (145.0 mg, 25.9 mmol). The reaction was stirred at room temperature overnight. Then, the reaction was poured into water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and concentrated. The mixture was purified by silica gel column chromatography eluting with 4% methanol in methylene chloride to provide two separate compounds, a colorless oil (P-0009, 0.23 g, 44.1%, MS(ESI) [N4&#1470;PH+]+ = 354.1), and a colorless oil (P-0042, 0.050 g, 9.2%, MS(ESI) [M+H/T = 367.1).
Step 2 ~ Preparation of2,4-difluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenol (P-0078):
[0242] To 2,4-difluoro [hydroxy-(5-pyridin yl-lH-pynolo[2,3-b]pyridin yl)-methyl]-phenol (P-0009, 34.0 mg, 0.096 mmol) in acetonitrile (15 mL), were added trifluoroacetic acid (1.0 mL, 13.0 mmol) and triethylsilane (2.0 mL, 12.0 mmol). The reaction was stirred at room temperature for 48 hours. The reaction mixture was poured sodium bicarbonate solution, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30%> ethyl acetate in hexane to give the compound (P-0078, 6.0 mg, 19%). MS(ESI)[M + H*]+ = 338.1.
[0243] Additional compounds were prepared following the protocol of Scheme 24, replacing either or both of carbonic acid teri-butyl ester 2,4-difluoro formyl-phenyl ester 39 with an appropriate aldehyde and/or 5-pyridin yl-lH-pyrrolo[2,3-b]pyridine 89 with an appropriate azaindole in Step 1.
PCI7US2006/024361
Azaindoles were purchased or synthesized as described in Examples 6 and 17. Aldehydes were prepared as described in Example 5 (through Step 2). Some compounds were isolated after Step 1, as either hydroxy or methoxy derivatives. The following compounds were made following this procedure:
Propane-2&#1470;sulfonic acid {3-[(5-bromo-lH-pynolo[2,3-b]pyridin yl)-methoxy-methyl]-2,4difluoro-phenyl}-amide (P-0356),
Propane sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro-phenyl]amide (P-0867),
Propane sulfonic acid {2,4-difluoro [methoxy-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin-3yl)-methyl]-phenyl} -amide (P-0947),
Propane sulfonic acid {3-[(5-bromo-lH-pyrrolo[2,3-b]pyridin yl)-hydroxy-methyl]-2,4difluoro-phenyl} -amide (P-0188),
Propane sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro-phenyl]amide (P-0910),
Dimethylamino-1 -sulfonic acid {2,4-difluoro [hydroxy-(5-pyridin yl-lH-pyrrolo[2,3b]pyridin yl)-methyl]-phenyl} -amide (P-0944),
Propane-1 -sulfonic acid [2,4-difluoro (5-phenylamino-lH-pyrroIo[2,3-b]pyridin ylmethyI)phenyl]-amide (P-0818),
Propane sulfonic acid [2,4-difluoro (5-phenyl-lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenyl]amide (P-0911),
Propane sulfonic acid [2,4-difluoro (5-morpholin yl-lH-pyrr010[2,3-b]pyridin ylmethyl)phenyl]-amide (P-0964),
Propane sulfonic acid {2,4-difluoro [5-(4-methyl-piperidm-l-yl)-lH&#1470;pyrrolo[2,3-b]pyridin-3ylmethyl]-phenyl}-amide (P-0984) and {2,4-Difluoro [hydroxy-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin yl)-methyl]-phenyl}carbamic acid methyl ester (P-0065).
The following table indicates the aldehyde (column 2) and azaindole (column 3) used to afford the target compound (column 4). Column 1 provides the compound number and column 5 the observed mass. Compounds isolated after Step 1 of Scheme 24 are so noted in column 1.
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-0356 Step 1</td><td> O F וי 1] <sup>HN</sup>'/ / θΎ</td><td> כס</td><td> d חד \ ץ>יי 1 0=00=0</td><td> 474.1 476.1</td>
PCI7US2006/024361
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [Μ+1ΤΓ observed</td>
<td> P-0867</td><td> 0 F 1>1 סל ΠΝ ׳P</td><td> m</td><td> נ□ —» /rt Z 7 xz X. \ חד ־n^V Z 1 Ο=ω=Ο</td><td> 460.2</td>
<td> P-0947 Step 1</td><td> O=/ ת־ ’-בגג- _</td><td> S N</td><td> Ο=ω=Ο 1 z lx ץ Q</td><td> 459.2</td>
<td> P-01S8 Step 1</td><td> ח־ ζ=Ο c</td><td> I'M</td><td> 3ס y=< <sup>1 </sup>ΧΖ^Ι-γ<sup>0</sup>׳ חד \ ύΎ χλ־=ζ z 1 Ο=ω=Ο</td><td> 460 462</td>
<td> P-0910</td><td> o F 1!1 HN./P J d^</td><td> Β<sup>Γ</sup>γΜ־Λ</td><td> Ο=ω=Ο 1 ζ Ζ=Ϊ<Χ ך צ!! p<sup>z </sup>ώ ____</td><td> 444.1 446.1</td>
<td> P-0944 Step 1</td><td> z=O ח־ ? >־ ° ׳z- \</td><td></td><td> 0 ζ^ :ב >={ χζ\^—ζ° χλ=^Ζ ζ 1 ο=ω=ο ^ζ^</td><td> 460.2</td>
<td> P-0818</td><td> HN./ J 0'^</td><td> ff rv \—/ X</td><td> ΟΟηκ_</td><td> 457.1</td>
<td> P-0911</td><td> 0:=/ וד גג-- '—<sup>ץ</sup></td><td> n <sup>N</sup> H</td><td> ο zfjC χζ^Λ^ חד \ !דיי χζ^ϊΖ ζ 1 θ=ω=θ</td><td> 442.2</td>
<td> P-0964</td><td> ס f ι!1 HN.P J d</td><td> θ־τη</td><td> θ=ω=θ 1 ζ /=־»־χ ΓΚ ir ץ v<sup>z </sup>r-Z</td><td> 449.3 [M-ΕΠ'</td>
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-0984</td><td></td><td> ^<sup>N</sup>rr> N N</td><td> d 20 IZ.A ־nJv 1W z 1 o=y=o</td><td> 463.3</td>
<td> P-0065 Step 1</td><td> A o</td><td> (\ <sup>2 </sup>A //</td><td> o i 5 <sup>2</sup>H - \ /־n 0ךיי IZ o^°</td><td></td>
<td> Isolated Step 1</td><td> O F 1!1 ar</td><td> CIsZX^. I ' H</td><td> Fv_ <sup>h</sup>vQ 0 <sup>CI</sup>W< p N< Ύ <sup>F</sup> h <sup>0</sup> H</td><td></td>
<td> Isolated Step 1</td><td> O F u. ,1 ΟΎ</td><td> סרץ</td><td><sup>HO</sup>y־Q ° F H<sup>X</sup>O' <sup>Un</sup> H</td><td></td>
<td> Isolated Step 1</td><td> O F 1!1 co<sup>0</sup></td><td> CQ</td><td><sup>HO</sup>rM <sup>0 </sup>q5 Fh 0<sup>1</sup>'hr N H</td><td></td>
<td> Isolated Step 1</td><td> EA<sup>: </sup>o</td><td> °x H</td><td> 0¥ H0 A fA1 <sup>HC</sup>W 7 ס L 1 /y־^ A /׳ p fact 1 Xx? <sup>f h </sup>nN H</td><td></td>
Example 11: Synthesis of N-[2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl) phenyl]-3methoxy-benzenesulfonamide P-0971.
[0244] Compound P-0971 was synthesized in four steps from 2,4-difluorophenylamine 42 as shown in Scheme 26.
PCI7US2006/024361
Scheme 26
<img file="IL188248A_D0059.tif" />
<img file="IL188248A_D0060.tif" />
Step 1 - Preparation ofN-(2,4-difluoro-phenyl) methoxy-benzenesulfonamide (91):
[0245] To 2,4-difluoro-phenylamine(42, 0.44 mL, 4.4 mmol) in methylene chloride (10.0 ml.), under an atmosphere of nitrogen, were added pyridine (1.00 mL, 12.4 mmol) and 3-methoxybenzenesulfonyl chloride (1.00 g, 4,84 mmol). After 12 hours, the reaction was poured into cold 1 M HC1 and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20 % ethyl acetate in hexane to give light yellow solid (91, 0.90 g, 69%). Μ8(ΕδΙ)[Μ+Ηψ = 300.
Step 2 - Preparation ofN-{2,4-difluoro [hydroxy-(l-triisopropylsilanyl-lH-pyrrolo[2i3-b]pyridin3-yl)-methyl]-phenyl} methoxy-benzenesulfonamide (92):
[0246] To N-(2,4-difluoro-phenyl) methoxy-benzenesulfonamide (91, 0.148 g, 0.494 mmol) in tetrahydrofuran (10.0 mL) cooled in a -78 °C acetone/dry ice bath, under an atmosphere of nitrogen, was added lithium diisopropylamide (0.85 M in tetrahydrofuran, 1.45 mL, 1.23 mmol) dropwise. After 30 minutes, l-trii8opropylsilanyl-lH&#1470;pyrrolo[2,3-b]pyridine carbaldehyde (96, 0.15 g, 0.500 mmol, prepared as described in Example 12) was added in tetrahydrofuran (2.0 ml&#1470;,) into the reaction dropwise. Then the reaction was stirred for 1 hour at -78 °C and allowed to reach room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography, eluting with 40 % ethyl acetate in hexane to give light yellow solid (92, 0.080 g, 26.8%). MS(ESI)[M+H*602 = +[&#1470;.
Step 3 - Preparation ofN-{2,4-difluoro [hydroxy-(lH-pyrrolo[2,3-b]pyridin yl)methyl]-phenyl}3-methoxy-benzenesulfonamide (93):
[0247] To N-{2,4-difluoro [hydroxy-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin yl)- , methyl]-phenyl} methoxy-benzenesulfonamide (92, 0.075 g, 0.12 mmol) in tetrahydrofuran (3.0
PCI7US2006/024361 mL), was added tetra-n-butylammonium fluoride (0.039 g, 0.15 mmol). The reaction was stirred at room temperature for 20 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 3 % methanol in dichloromethane to give light yellow solid (93, 0.030 g, 55%). MSiESIjfM+H'‘']4' = 446.
Step 4 - Preparation ofN-[2,4-difluoro (lH-pyrrolo[2,3-bJpyridine carbonyl)phenyl] meihoxybenzenesulfonamide (P-0971):
[0248] To N-{2,4-difluoro [hydroxy-(lH-pyrrolo[2,3-b]pyridin yl)methyl]-phenyl} methoxybenzenesulfonamide (93, 0.02 g, 0.05 mmol) in tetrahydrofaran (3.0 mL) was added Dess-Martin periodane ( 0.02 g, 0.015 mmol) under an atmosphere of nitrogen. The reaction was stirred for 10 minutes at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 3 % methanol in dichloromethane to give light yellow solid (P-0971,0.010 g, 50%), MS(ESI)[M+H+]+ = 444.
[0249] Additional compounds were prepared following the protocol of Scheme 26, replacing 3methoxy-benzene sulfonyl chloride with the appropriate sulfonyl chloride in Step 1. The following compounds were made following this procedure:
N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-2,5-dimethoxybenzenesulfonamide (P-1131), N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] methoxybenzenesulfonamide (P-0958),
Piperidine sulfonic acid [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-amide (P-0952), N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] trifluoromethylbenzenesulfonamide (P-0931), 4-Butoxy-N-[2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-benzenesulfonamide (P-1006), 4-Chloro-N-[2,4-difluoro (lH-pyrroIo[2,3-b]pyridine carbonyl)-phenyl]-benzenesulfonamide (P-0937), N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-3,4-dimethoxybenzenesulfonamide, (P-1090), and 3,4-Dichloro-N-[2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]benzenesulfonamide (P-1015).
The following table indicates the sulfonyl chloride (column 2) used to afford the target compound (column 3). Column 1 provides the compound number and column 4 gives the observed mass.
Ill
<td></td><td> Sulfonyl chloride</td><td> Compound</td><td> MS(ESI) [m+hT observed</td>
<td> P-1131</td><td> ן SO<sub>2</sub>CI O^A 1</td><td> R_ 0 ° ata <sup>f hn</sup>JHQ</td><td> 474.2</td>
<td> P-0958</td><td> /0-^^-SO<sub>2</sub>CI</td><td> CL AA J/Vx 0 /= Γ|Ρ> F HN-S-L Λ-0 SAn 0 H</td><td> 444.2</td>
<td> P-0952</td><td> * 222<sup>n</sup>־<sup>s</sup>°2ci</td><td> Q, T/A <sup>0</sup> /~\ fAfA f hn-s-n ) SAn ° H</td><td> 421.2</td>
<td> P-0931</td><td> F3C——SO<sub>2</sub>CI</td><td> A) ח7 \ I/W z θ=ώ=θ Φ o ח־ ω</td><td> 482.2</td>
<td> P-1006</td><td> O-<222>—so<sub>2</sub>o s</td><td> R_ V CL ?A Λ )Μ <sup>0</sup> /=\ / f hn-s-4 /-0 N 0 <sup>N</sup> H</td><td> 486.2</td>
<td> P-0937</td><td> Cl—S0<sub>2</sub>CI</td><td><sup>F</sup>\-k CL JrX <sup>0</sup> /=\ AlfA F HN-S-Cj- Cl SAn 0 <sup>N</sup> H</td><td> 446.1 [M-H<sup>4</sup>]־</td>
<td> P-1090</td><td> 0——SO<sub>2</sub>CI —0</td><td><sup>F</sup>\—< Ar\ <sup>0</sup> /= ΑΛ, F HN-S-C/-0 SAn <sup>0</sup> א <sup>N</sup> H 0-</td><td> 474.2</td>
<td> P-1015</td><td> Cl--<f~^~<sup>S</sup>°2<sup>CI</sup> cr</td><td><sup>F</sup>V-x cl AA Ar<sup>0</sup> \־ /=\ fArA f hn-s־A A<sup>ci </sup>SAn 0 <sup>1</sup> H Cl</td><td> 480.0 482.1 [M-H<sup>4</sup>]־</td>
* Piperidine sulfonyl chloride prepared from sulfuryl chloride and piperidine in acetonitrile, refluxed for 8 hours, concentrated, and used without ]further purification.
Example 12: Synthesis of l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine3&#1470;-carbaldehyde 96.
[0250] Compound 96 was synthesized in two steps from 7-azaindole 94 as described in Scheme 27.
Scheme 27
<img file="IL188248A_D0061.tif" />
<img file="IL188248A_D0062.tif" />
Step 1 — Preparation of lH-pyrrolo[2,3-b]pyridine carbaldehyde (95):
[0251] To 1H-Pyrrolo[2,3&#1470;b]pyridine (94, 16.0 g, 135 mmol) in water (110 mL), were added hexamethylenetetramine (26.0 g, 185 mmol), and acetic acid (55.0 mL, 967 mmol). The reaction was refluxed for 12 hours. Water (329 mL) was added and the reaction was cooled to room temperature. The reaction was filtrated and washed with water to give the compound (95, 15.0 g, 76%). MS(ESI)[M+H+]+ = 147.
Step 2 - Preparation of l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine carbaldehyde (96): [0252] To lH-Pyrrolo[2,3-b]pyridine carbaldehyde (95, 4.05 g, 27.71 mmol) in tetrahydrofuran (30.0 mL) were added sodium hydride (60% in mineral oil, 1.5 g, 38 mmol) and trriisopropylsilyl chloride (8.0 mL, 38 mmol) under an atmosphere of nitrogen. The reaction was stirred for 2 hours at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10 % ethyl acetate in hexane to give the compound (96, 3.0 g, 36%). MS(ESI)[M+H+]+ = 303.
Example 13: Synthesis of 5-isopropyl-lH-pyrrolo[2,3-b]pyridine 99.
[0253] Compound 98 was synthesized in three steps from 5-bromo-l-triisopropylsilanyl-lHpyrrolo[2,3-b]pyridine 68 described in Scheme 28.
Scheme 28
<img file="IL188248A_D0063.tif" />
Step 1 - Preparation of2-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin yl)-propan ol (97): [0254] To 5-bromo-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (68, 2.0 g, 5.66 mmol, prepared as described in Example 6) in tetrahydrofuran (20.0 mL), cooled in a -78 °C acetone/dry ice bath, under an atmosphere of nitrogen, was added tert-butyllithium (1.7 M in tetrahydrofuran, 7.3 mL, 12 mmol) dropwise. After 20 minutes, acetone (0.830 mL, 11 mmol) was added dropwise to the reaction. The reaction was stirred for 30 minutes at -78 °C and then allowed to reach room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10 % ethyl acetate in hexane to give the compound (97, 1.30 g, 69%). MS(ESI)[M+1T]+ = 333.
Step 2-Preparation of 5-isopropenyl-lH-pyrrolo[2,3-b]pyridine (98):
[0255] To 2-(l-triisopropylsilanyl-lH-py1T010[2>3־b]pyridin5־-yl)־propan ol (97, 0.500 g, 1.5. mmol) in acetonitrile (10.0 mL) were added triethylsilane (1.00 mL, 6.3 mmol) and trifluoroacetic acid (0.50 mL, 6.5 mmol) under an atmosphere of nitrogen. The reaction was refluxed for 3 hours, then cooled down to room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 50 % ethyl acetate in hexane to give the compound (98, 0.200 g, 84%). Μ8(ΕδΙ)[Μ+Ε7]+ = 159.
Step 3- Preparation of 5-isopropyl-lH-pyrrolo[2,3-b]pyridine (99):
[0256] To 5-isopropenyl-lH-pyrrolo[2,3-b]pyridine (98, 0.080 g, 0,501 mmol) in tetrahydrofuran (5.0 mL) was added 20 % palladium hydroxide on carbon (5.0 mg). The reaction was stirred under hydrogen at 40 psi for 30 minutes. The reaction mixture was filtered and concentrated to give the compound (99, 0.078 g, 96%). MS(ESI)[M+lT]+= 161.
Example 14: Synthesis of 5-Methyl-lH-pyrrolo[2,3-b]pyridine 101.
[0257] Compound 101 was synthesized in two steps from 5-bromo-l-triisopropyIsilanyl-lHpyrrolo[2,3-b]pyridine 68 described in Scheme 29.
<img file="IL188248A_D0064.tif" />
Step 1 - Preparation of 5-Methyl-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (100):
[0258] To PdC12(dppf) (0.04 g, 0.05 mmol) in toluene (10.0 mL) under an atmosphere of nitrogen were added 5-bromo-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (68, 0.3 g, 0.8 mmol, prepared as described in Example 6, 1.0 mL in toluene) and methylmagnesium bromide (1.0 M in tetrahydrofuran, 3.0 mL, 3.0 mmol). The reaction was stirred 90 °C for 2 hours and then allowed to reach to room temperature. The reaction was poured into citric acid (0.1 M in water) and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 50 % ethyl acetate in hexane to give the compound (100, 0.16 g, 60.0 %). MSiESfifM+H4]* = 289.4.
Step 2 - Preparation of 5-Methyl-lH-pyrrolo[2,3-b]pyridine (101):
[0259] To 5-Methyl-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (100,0.160 g, 0.55 mmol) in tetrahydrofuran (3.0 mL) was added tetra-n-butylammonium fluoride (0.145 g, 0.55 mmol). The reaction was stirred for 1 hour at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 3% methanol in dichloromethane to provide light yellow solid (101, 0.07 g, 95%). MS(ESI)[M+H+]+= 133.2.
[0260] 5 -M ethyl -1 H-pyrrolo[2,3 -b]pyridine
<img file="IL188248A_D0065.tif" />
was prepared following the protocol of Scheme 29, substituting methylmagnesium bromide with ethylmagnesium bromide in Step 1.
Example 15: Synthesis of 1-(2,4-difluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl] propyl-urea P-0774 and related compounds,
[0261] Compound P-0774 was synthesized in two steps from {2,4-difluoro [hydroxy-(5-pyridin3-yl-lH-pyrrolo[2,3b]pyridm yl)-methyl]-phenyl}-carbamic acid methyl ester P-0065 described in Scheme 30.
Scheme 30
<img file="IL188248A_D0066.tif" />
Step 1 - Preparation of l-{2,4-difluoro [hydroxy-(5-pyridin yl-lH-pyrrolo[2,3b]pyridin yl)methyl]-phenyl} propyl-urea (103):
[0262] To {2,4-difluoro [hydroxy-(5-pyridin yl-lH-pyrrolo[2,3b]pyridin yl)-methyl]phenyl}-carbamic acid methyl ester (P-0065, 30.0 mg, 0.07 mmol, prepared as described in Example 10) was added 1-propanamine (2.0 mL, 20 mmol) and the reaction was heated to 120 °C for 20 minutes in a CEM Discover microwave instrument. ,The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% methanol in methylene chloride to give the compound (103, 20.0 mg, 60%). MS(ESI)[M+H+]+ = 438.51.
Step 2 - Preparation of l-[2,4-difluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbor1yl)phenyl] propyl-urea (P-0774):
[0263] To l-{2,4-difluoro [hydroxy-(5-pyridin yl-lH-pyrrolo[2,3b]pyridin yl)-methyl]phenyl} propyl-urea (103, 20.0 mg, 0.04 mmol) in tetrahydrofuran (3 mL) was added Dess-Martin periodane (23.0 mg, 0.055 mmol) under an atmosphere of nitrogen. The reaction was stirred for 10 minutes. The reaction was concentrated and purified by silica gel column chromatography eluting with 1 % methanol in dichloromethane to give the compound (P-0774, 6.0 mg, 30 %). MS(ESI)[M+H+]+= 436.5.
[0264] Additional compounds were prepared following the protocol of Scheme 30, replacing 1propanamine with an appropriate amine and optionally replacing (2,4-difluoro [hydroxy-(5-pyridin. 3-yl-lH-pyrrolo[2,3b]pyridin yl)-methyl]-phenyl}-carbamic acid methyl ester P-0065 with an appropriate carbamic acid methyl ester (see Example 10) in Step 1, The following compounds were made following this procedure:
l-sec-Butyl [2,4-difluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]urea (P-1289), l-Cyclopentyl [2,4-difluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]urea (P-1317), l-Butyl [2,4-difluoro (5-pyridin yl-lH-py1rolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1318), l-Butyl [2,4-difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1567), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] (2-mo1pholin ylethyl)-urea (P-1580), l-Butyl [3-(5-chloro-lH-pyrrolo[2,3&#1470;b]pyridine carbonyl)-2,4-difluoro-phenyl]-urea (P-1586),
Morpholine carboxylic acid [3-(5-chloro-lH&#1470;pyrrolo[2,3-b]pyridine carbonyl)-2,4&#1470;difluorophenyl]-amide (P-1606), l-Butyl [3-(5&#1470;chloro-lH-pyn&#1470;olo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]-l-methylurea (P-1612), l-Butyl [2,4-difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-l-methylurea (P-1884),
Morpholine carboxylic acid [2,4-difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-amide (P-1894), l-Butyl [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-l-ethyl-urea (P-1983), l&#1470;Butyl [2,4-difluoro (5-methoxy-lH-py1Tolo[2,3-b]pyridme carboPyl)-phenyl]-l-ethylurea (P-1994), and 3-Diethylamino-pyrrolidine-l-carboxylic acid [2,4-difluoro (5-methoxy-lH-pyrrolo[2,3b]pyridine carbonyI)-phenyl]-amide (P-2015).
The following table indicates the amine (column 2) and the carbamic acid methyl ester (column 3) used to afford the target compounds (column 4). Column 1 provides the compound number and column 5 the observed mass.
<td></td><td> Amine</td><td> Carbamic acid methyl ester</td><td> Compound</td><td> MS(ESI) [M+HX observed</td>
<td> P-1289</td><td> H<sub>2</sub>N׳^</td><td> z=\ V? xz י ו7 IZ >=o o \</td><td> F. Ά ° H</td><td> 450.4</td>
<td> P-1317</td><td> nh<sub>2 </sub>ό</td><td> \ o o=< ZI <sup>x</sup> p \=Z</td><td> — :ר ־z--\ I 04 VJ ZI Ou. \=Z</td><td> 462.4</td>
<td> P-1318</td><td> h<sub>2</sub>n</td><td><sup>F</sup>\—. frx <sup>H</sup>W 0 Upp/ W<sup>F H </sup> H</td><td> a AX ך χ.<sup>χ</sup>><sup>F</sup> η h nN H</td><td> 450.5</td>
<td> P-1567</td><td> h<sub>2</sub>n</td><td><sup>HC</sup>PA ° W<sup>F H</sup><sup>N</sup> H</td><td> VQ־S XiXX P N N K A? <sup>F</sup> Η H n<sup>n</sup> H</td><td> 403.2</td>
<img file="IL188248A_D0067.tif" />
Amine
NH2
Carbamic acid methyl ester
Compound
MSCESI) [M+A]+ observed &#1523; O 'na0&#1470; n^n
Λν
I Η ! A
464.3
P-1580
H2N
P-1586
P-1612
P-1884
P-1994 °
&#1524; II
N'&#1497;
Η
<img file="IL188248A_D0068.tif" />
407.3
HO
H
N N
I O
421.1
HO
P-1606
H
AN
421.3
HN
AN
417.4
HO
HN
AN
417.4
HO
P-1894 nN
401.4
H
P-1983
472.4
P-2015
N
H
N O
H / Q
H
O an
Q
N
H
O NAO&#1470; H
N H
H
431.4
H nN
<img file="IL188248A_D0069.tif" />
HO
NO H .0 // 0 nanA
O NKN
[0265] The intermediate product of Step 1 of Scheme 30 can alternatively be reacted under reducing conditions to provide analogous compounds in which the carbonyl linker of the 3&#1470;position of azaindole to the phenyl ring is methylene. The product of Step 1 is a mixture of the hydroxyl and methoxy methyl linker of the 3-position, which may be carried through the reduction Step as the mixture or may be isolated as either the hydroxyl or methoxy for use in this reaction. This reduction is exemplified as follows using the product of Step 1 in the preparation of P-1567 to prepare 1-Butyl3-[2,4-difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenyl]-urea P-1571.
<img file="IL188248A_D0070.tif" />
Step 1 - Preparation of l-Butyl [2,4-difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridin ylmethyl)phenyl]-urea (P-1571):
[0266] A mixture of l-Butyl 2,4-difluoro [hydroxy-(5-methoxy-lH-pyrrolo[2J3-b]pyridin-3yl)-methyl]-phenyl-urea (41 mg, 0.000081 mol, isolated from Step 1 of Scheme 30), triethylsilane (2 ml. 0.01 mol), and trifluoroacetic acid (1 mL, 0.01 mol) in 20 ml of acetonitrile was refluxed for 3 hrs. The mixture was concentrated and the residue was redissolved in ethyl acetate and sodium bicarbonate solution. The organic layer was collected and dried over MgSO4. An off-white solid compound was obtained after chromatography (P-1571,18 mg, 57%). MS(ESI) [M-H4] = 389.2.
[0267] Additional compounds were prepared following the protocol of Step 1 of Scheme 30 followed by the reduction step above as Step 2, where the product of Scheme 30 Step 1 may be isolated as either the hydroxyl or methoxy derivative, or used as the mixture, replacing 1-propanamine with an appropriate amine and {2,4-difluoro [hydroxy-(5-pyridin yl-lH-py1rolo[2,3b]pyridin-3yl)-methyl]-phenyl}-carbamic acid methyl ester P-0065 with an appropriate carbamic acid methyl ester (see Example 10) in Step 1. The following compounds were made following this procedure: l-Cyclopentyl [2,4-difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridm ylmethyl)-phenyl]-urea (P-1572), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro-phenyl] cyclopentyl-urea (P-1575), l-Butyl [3-(5-chloro-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro-phenyl]-urea (P-1587), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridm ylmethyl)-2,4-difluoro-phenyl] (2-morpholin ylethyl)-urea (P-1594), Morpholine carboxylic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro119 phenyl]-amide (P-1595), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro-phenyl] (2,2,2-trifluoroethyl)-urea (P-1601), ( l-Cyclopentyl {2,4-difluoro [5-(3-methanesulfonyl-phenyl)-lH-pyrrolo[2,3-b]pyridin-3ylmethyl]-phenyl}-urea (P-1615), l-Butyl [3-(5-chloro-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro-phenyl]-l-methyl-urea (P-1625), l-[3-(5-Chloro-lH-pynOlo[2,3-b]pyridin ylmethyl)-2,4-difluoro-pl1enyl] cyclopropylmethylurea (P-1652), l5)&#1470;3]&#1470;-Chloro-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro-phenyl] (4-fluoro-phenyl)urea (P-1657), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro-phenyl] (4-fluoro-ben2yl)urea (P-1654), and
3-Diethylamino-pyrrolidine carboxylic acid [2,4-difluoro (5-methoxy-lH-pyrrolo[2,3b]pyridin ylmethyl)-phenyl]-amide (P-2014).
The following table indicates the amine (column 2) and the carbamic acid methyl ester (column 3) used to afford tire target compound (column 4). For the carbamic acid methyl ester, R can be H or CH3, where the compound was either a mixture of the two, or either of the isolated compounds wherein R is H or R is CH3. Column 1 provides the compound number and column 5 the observed mass.
<td></td><td> Amine</td><td> Carbamic acid methyl ester</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1572</td><td> nh<sub>2 </sub>ό</td><td> Fv <sup>RO</sup>Uu> 0 zWTw W <sup>H</sup><sup>IN</sup> H</td><td> \) <sup>2</sup>Q xz^> L 2ח 0ןיי XZ r־־\ >=° L /-2: X</td><td> 401.2</td>
<td> P-1575</td><td> nh<sub>2 </sub>ό</td><td> \ O o=< zx jCXu. ur ץ <sup>1</sup> * o</td><td> R. <sup>0</sup><sup>N</sup> Η ό</td><td> 405.2</td>
<td> P-1587</td><td> h<sub>2</sub>n</td><td><sup>F</sup>V־X <sup>R0</sup>y-O O <sup>N</sup>'<sup>U</sup>'°<sup>X</sup> W<sup>F H</sup> H</td><td> ר<sup>,</sup> y Ai 2 J <sup>Cl</sup> Wa f n <sup>F</sup> η h ך n<sup>n </sup>. H</td><td> 393.3</td>
<td></td><td> Amine</td><td> Carbamic acid methyl ester</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1594</td><td> nh<sub>2</sub> ό 0</td><td> J<sup>3</sup> ' 1 xzJX° -0 <sup>12</sup>Vo</td><td> °Q ci.^a¥<sub>n</sub>a<sub>n</sub>A ך <sup>F</sup> η η nN η</td><td> 450.3</td>
<td> P-1595</td><td> H ό</td><td> o ¥ * וד \ 0'<sup>ת</sup>־ IZ Vo o \</td><td> F< ΑΠ' ° <sup>1</sup>־N^N H</td><td> 407.2</td>
<td> P-1601</td><td> h<sub>2</sub>n^ cf<sub>3</sub></td><td> \ o O=( zx &U. IE \ q^ZI X M \—<sup>z </sup>o</td><td> CO LL ω < zx O=< zx AA<sup>11</sup>־ ιέ ך ^^^zx ס</td><td> 419.2</td>
<td> P-1615</td><td> nh<sub>2 </sub>ό</td><td> A A <sup>R</sup>w 0 75 1 ן-k a s /N O T JL v <sup>F</sup> h <sup>IN</sup> H</td><td> x o=< zx u&u. <sup>v</sup>^<sup>־s</sup>zx Az <sup>1</sup> A<sup>7</sup>״ Ο-ω— II o</td><td> 525.2</td>
<td> P-1625</td><td> Hl./</td><td> O ו7\ IZ Vo o \</td><td> ci-^a¥<sub>n</sub>a<sub>n</sub>J LI ? <sup>F</sup> h ן <sup>k</sup>N^־N <sup>1</sup> H</td><td> 407.3</td>
<td> P-1652</td><td> H<sub>2</sub>N A</td><td> o \ 7Π 0ץיי Vo o \</td><td> F. /־־־־Q <sup>0</sup> I <D <sup>F H H V </sup>n B</td><td> 391.2</td>
<td> P-1657</td><td> nh<sub>2</sub> Q F</td><td><sup>x</sup>o oV ZX CL IE \ x )Λ \—<sup>z</sup> o</td><td> rsX £ XJ 11 T<sup>x</sup>> <sup>F</sup> H H nN H</td><td> 461.2</td>
<td> P-1654</td><td> NH<sub>2</sub> Φ F</td><td> \ o ov zx jCAll le ץ x V^s \ <sup>2 </sup>o</td><td> F οό ךt?<sup>F</sup> η h nN H</td><td> 445.2</td>
<td> P-2014</td><td> ρ<sup>Η </sup>A</td><td><sup>F</sup>V-\ J, <sup>Rt</sup>wv nN H</td><td> o- <sup>2</sup>A-! L A<sup>1</sup> z °^ק> ו r</td><td> 458.4</td>
Example 16: Synthesis of 5-Methoxy-lH-pyrroIo[2,3-b]pyridine 104 and related compounds.
[0268] Compound 104 was synthesized in one step from 5-bromo-lH-pyrrolo[2,3-b]pyridine 67 as described in Scheme 31.
Scheme 31
<img file="IL188248A_D0071.tif" />
<img file="IL188248A_D0072.tif" />
Step I - Preparation of 5-Methoxy-lH~pyrrolo[2,3-b]pyridine (104);
[0269] To 5-bromo azaindole (67, 500.0 mg, 2.53 mmol) in Ν,Ν-dimethylformamide (8 mL) were added copper(I) iodide (966 mg, 5.08 mmol) and sodium methoxide in methanol (3 M, 5 mL). The reaction was stirred overnight at 120 °C under an atmosphere of Argon. The reaction was poured into water, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered. The filtrate was concentrated and purified with silica gel column chromatograph eluting with 20% ethyl acetate in hexane to give white solid (104,140 mg, 28%). MS(ESl)[M+H+]+ = 149.1. In an alternative method, 2.3 g (11.7 mmol) 5-bromo azaindole (67, 2.3 g, 11.7 mmol) was dissolved in 75 mL N,N-dimethylformamide and 50 mL methanol (50 mL), adding sodium methoxide (32 g, 0.6 mol) and copper-(I) bromide (3.2 g, 22,4 mmol) at room temperature. The reaction was stirred for three hours at 100 °C under an atmosphere of argon. The mixture was diluted with ethyl acetate and poured into a solution of ammonium chlorideiammonium hydroxide (4:1). The organic layer was extracted with ammonium chloride: ammonium hydroxide (4:1), washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography eluting with 30% to 70% ethyl acetate in hexanes to give a yellow solid (104, 0.27 g, 15.6%). MS(ESI) [M +1^]+= 149.2.
[0270] 5-Ethoxy-lH&#1470;pyrrolo[2,3-b]pyridine 506
<img file="IL188248A_D0073.tif" />
was prepared using the protocol of Scheme 31, substituting methanol with ethanol and sodium methoxide with sodium ethoxide.
[0271] 5-(2-Methoxy-ethoxy)-lH-pyrrolo[2,3-b]pyridine 507
N N was prepared using the protocol of Scheme 31, substituting methanol with 2-Methoxy-ethanol and
PCT7US2006/024361 sodium methoxide with sodium 2-Methoxy-ethoxide (prepared from 2-Methoxy-ethanol and sodium hydride). MS(ESI) [M + 1T]+ = 193.3.
[0272] Diethyl-[2-(lH-pyrrolo[2,3-b]pyridin yloxy)-ethyl]-amine 508
<img file="IL188248A_D0074.tif" />
was prepared using the protocol of Scheme 31, substituting methanol with 2-diethylamino-ethanol and sodium methoxide with sodium 2-diethylamino-ethoxide (prepared from 2 2-diethylaminoethanol and sodium hydride). MS(ESI) [M + Η*.]+ = 234.5.
Example 17: Synthesis of 5-Pyridin yl-lH-pyrrolo[2,3-b]pyridine 89.
[0273] 5&#1470;Pyridin yl-lH-pyrrolo[2,3&#1470;b]pyridine 89 was synthesized in one step from 5-bromo-lHpyrrolo[2,3-b]pyridine 67 as described in Scheme 32.
Scheme 32
<img file="IL188248A_D0075.tif" />
Step 1 - Preparation of5-Pyridin yl-lH-pyrrolo[2,3-bJpyridine (89):
[0274] To 5-bromo-7&#1470;azaindole (67,1.00 g, 5.08 mmol) in water (13.0 mL) and acetonitrile (36 mL) were added pyridine boronic acid (609,1,0 g, 8.1 mmol), potassium carbonate (1.79 g, 0.0130 mol) and Tetrakis(triphenylphosphine)palladium(0) (50.0 mg, 0.043 mmol) under an atmosphere of nitrogen. The reaction mixture was heated to 170 °C overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified with silica gel column chromatography eluting with 25% ethyl acetate in hexane to provide a light yellow solid (89, 820 mg, 82%). MS(ESI)[M+HT = 196.1.
[0275] Additional compounds were prepared following the protocol of Scheme 32, either by substituting pyridme boronic acid with an appropriate boronic acid or by substituting the 5-bromo7-azaindole with 5-(4,4,5,5-Tetramethyl-[l,3,2]dioxaborolan yl)-lH-pyrrolo[2,3-b]pyridine and reacting with a suitable aryl or heteroaryl halide (i.e. coupling with the boronic acid ester on the azaindole, and the halide on the group to be coupled to the 5-position of the azaindole). The following compounds were prepared by this procedure:
5-(4-Chloro-phenyl)-lH-pyrrolo[2,3-b]pyridine (514), 5-(4-Fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridine (605), 5-Phenyl-lH-pyrrolo[2,3-b]pyridine,
-(6-Methoxy-pyridin-3 -yl)-1 H-pyrrolo[2,3 -b]pyridine, 5-(2-Methoxy-pyrimidin yl)-lH-pynOlo[2,3-b]pyridine, 5-Pyridin yl-lH-pyrrolo[2,3-b]pyridine,
4- (lH-Pyrrolo[2,3-b]pyridin yl)-benzenesulfonamide, 3-(lH-Pyrrolo[2,3-b]pyridin yl)-benzenesulfonamide,
5- Pyrimidin-5 -yl-1 H-pyrrolo[2,3 -b]pyridine, 5-(3-Methanesulfonyl-phenyl)-lH-py1rolo[2,3-b]pyridine (P-0173), and 3-(lH-Pyrrolo[2,3-b]pyridin yl)-benzamide (P-1622).
The following table indicates either 5-bromo azaindole or 5-(4,4,5,5-Tetramethyl-[l,3,2] dioxaborolan yl)-lH-pyrrolo[2,3-b]pyridine starting material (column 1) and the appropriate reagent to be coupled to the 5 position of the azaindole (column 2) to afford the resulting compound (column 3), with the observed mass given in column 4.
<td> Starting azaindole</td><td> Reagent coupled to 5 position</td><td> Compound</td><td> MS(ESI) [M+1T]<sup>+ </sup>observed</td>
<td><sup>N</sup> B</td><td> B(OH)<sub>2</sub> Q Cl</td><td><sup>Cl</sup>3 ' H</td><td> 229.1</td>
<td><sup>Br</sup>w N N</td><td> B(OH)<sub>2</sub> Q F</td><td><sup>F</sup>tl H</td><td> 213.1</td>
<td><sup>B</sup>T0 <sup>N</sup> H</td><td> B(OH)2 ό</td><td> o</td><td> 195.2</td>
<td><sup>N</sup> H</td><td> B(OH)2 0 0—</td><td> Λ3 <sup>1</sup>־hr n <sup>1</sup> H</td><td> 226.2</td>
<td><sup>b</sup>YjO <sup>N</sup> H</td><td> B(OH)2 ό <sup>N</sup>־V</td><td> o 2=<sup>7</sup></td><td> 227.2</td>
<td> w H</td><td></td><td> tv H</td><td> 196.2</td>
PCI7US2006/024361
<td> Starting azaindole</td><td> Reagent coupled to 5 position</td><td> Compound</td><td> MS(ESI) [M+HT observed</td>
<td><sup>0</sup><sup>1</sup> Η</td><td> Br^. Qa nh<sub>2</sub> O׳'b</td><td> 0<sub>x</sub>,0 h<sub>2</sub>n Ll <sup>1</sup>ν<sup>λ</sup>ν Η</td><td> 274.1</td>
<td> cl.? <sup>Ν</sup> Η</td><td> Br'd .NH2 o<sup>z</sup> '0</td><td> ff Qx> /o CM T</td><td> 274.1</td>
<td> °<sup>B</sup>w <sup>Ν</sup> Η</td><td> Ν-λ Br N=/</td><td><sup>1</sup> H</td><td> 197.2</td>
<td><sup>Br</sup>m <sup>Ν</sup> Η</td><td> O־B(0H)<sub>2</sub> /<sup>s</sup>0</td><td> 0, n _ <sup>0</sup> V<sup>X</sup>N <sup>N</sup> H</td><td> 273.1</td>
<td><sup>Β</sup>Το <sup>Ν</sup> Η</td><td> θ-Β(ΟΗ)<sub>2 </sub>h<sub>2</sub>n-< O</td><td> i Q<sup>1 </sup>o W 7=0 z CM X</td><td> 238.2</td>
Example 18: Synthesis of 3-(4-(4-chlorobenzyloxy) methoxybenzyl)-lH-pyrrolo[2,3b]pyridine P-1247.
[0276] Compound P-1247 was synthesized in three steps from 4-hydroxy methoxybenzaldehyde 105 as shown in Scheme 33.
Scheme 33
<img file="IL188248A_D0076.tif" />
<img file="IL188248A_D0077.tif" />
Step 1 - Preparation of 4-(4-chlorobenzyloxy) methoxybenzaldehyde (106):
[0277] To 4-hydroxy methoxybenzaldehyde (105, 600.0 mg, 3.94 mmol) and 4-chlorobenzyl bromide (557,1.20 g, 5.84 mmol) in acetonitrile (6 mL) was added potassium carbonate (0.390 g, 2.82 mmol). The reaction was microwaved on 300 watts, 120 °C for 10 minutes. The reaction was extracted with ethyl acetate and water. The organic layer was washed with brine, dried over magnesium sulfate, filtered and the volatiles removed by evaporation. The desired compound was purified by recrystallization from hexanes to provide 106 (1.01 g, 93%). MS(ESI) [M-H4]’ = 275.1.
Step 2 — Preparation of 3-((4-(4-chlorobenzyloxy) methoxyphenyl)(methoxy)methyl)-lHpyrrolo[2,3-b]pyridine (107):
[0278] To 1H-Pyrrolo[2,3&#1470;b]pyridine (94, 0.235 g, 1.99 mmol) and 4-(4-chlorobenzyloxy)-3methoxybenzaldehyde (106, 0.500 g, 1.81 mmol) was added 5 mL of methanol followed by the addition of solid potassium hydroxide (0.203 g, 3.61 mmol). The reaction was allowed to stir at ambient temperature for 18 days. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was separated and volatiles removed to give a solid which was suspended in hot ethyl acetate. The suspension was allowed to cool and the solid collected by vacuum filtration to provide 107 (548 mg, 74%). MS(ESI) [Μ+Ηψ = 409.4.
Step 3 - Preparation of 3-(4-(4-chlorobenzyloxy) methoxybenzyl)-lH-pyrrolo[2,3-b] pyridine (P1247):
[0279] To 3-((4-(4&#1470;chlorobenzyloxy) methoxyphenyl)(methoxy)methyl)-lH&#1470;pyrrolo[2,3b]pyridine (107,0.548 g, 1.34 mmol) in acetonitrile (20 mL) was added trifluoroacetic acid (1.7 mL, 2.21 mmol) and triethylsilane (3.47 mL, 2.17 mmol). The reaction was stirred at 60 °C for 15 hours. The volatiles were removed and the desired compound was purified by silica gel chromatography, eluting with a gradient from 0% to 60% ethyl acetate in hexanes to provide a white solid (P-1247, 505 mg, 99%). MS(ESI) [Μ+Ηψ = 379.4.
[0280] Additional compounds were prepared using the protocol of Scheme 33, Steps 2 and 3, replacing 4-(4-chlorobenzyloxy) methoxybenzaldehyde 106 with a suitable aldehyde (prepared as described in Example 34), and optionally replacing 1H-Pyrrolo[2,3&#1470;b]pyridine 94 with an appropriate substituted 7-azaindole (see Example 9 or Example 16) in Step 2. The following compounds were made following this procedure;
3-[3-Methoxy (4-trifluoromethyl-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1721), 3-[3-Trifluoromethyl (4-trifluoromethyl-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1797),
3- {3-Methoxy [4-(4-methyl-piperazin-l -ylmethyl)-benzyloxy]-benzyl] -1Hpyrrolo[2,3-b]pyridine (P-1821), 3.[4-(4.Chloro-benzyloxy) fluoro methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1844),
3-[4-(3-Fluoro trifluoromethyl-benzyloxy) methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1849), 3-[4-(4-Chloro trifluoromethyl-benzyloxy) methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1851),
2- [2-Methoxy ( 1 H-pyrrolo [2,3-b]pyridin-3 -ylmethyl)-phenoxymethyl] -1 H-benzoimidazole (P-1870),
3- [4-(4-Chloro fluoro-benzyloxy) fluoro methoxy-benzyl] methoxy-lHpyrrolo[2,3-b]pyridine (P-1885),
3-(4-(3,4-Dichloro-benzyloxy) methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1886), 3-[4-(4-Chloro-benzyloxy) fluoro-benzyl]-lH-pyrrolo(2,3-b]pyridine (P-1896),
2- [2-Fluoro (lH-pyrrolo[2,3-b]pyridin yImethyl)-phenoxymethyl]-lH-benzoimidazole (P-1899),
3- (4-Benzyloxy-2,5-difluoro-benzyl)-lH-pyrrolo[2,3-b]pyridine (P-1901),
5-Chloro [4-(4-chloro-benzyloxy) fluoro methoxy-benzyl]-lH-py1rolo[2,3-b]pyridine (P-1970), 5-Chloro [4-(4-chloro fluoro-benzyloxy) fluoro methoxy-benzyl]-lHpyrrolo(2,3-b]pyridine (P-1972),
3-(4-(4-Chloro fluoro-benzyloxy) fluoro methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1973),
2-(4-(5 -Chloro-1 H-pyrrolo [2,3 -b]pyridin-3 -ylmethyl)-5 -fluoro methoxy-phenoxymethyl]-1Hbenzoimidazole (P-1976), 2-[5-Fluoro methoxy (5-methoxy-lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenoxymethyl]1 H-benzoimidazole (P-1977),
2- [5-Fluoro methoxy (lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenoxymethyl]-lHbenzoimidazole (P-1978),
3- {4-[2-(2-Bromo-ethoxy)-ethoxy] fluoro methoxy-benzyl} chloro-lH-pyrrolo[2,3b]pyridine (P-1984),
5-Chloro [2,5-difluoro (2-methoxy-ethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1986), 5-Chloro [2-fluoro methoxy (2-methoxy-ethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1990), {3-[45)&#1470;-Chloro-lH-pyrrolo[2,3-b]pyridin ylmethyl) fluoro methoxy-phenoxy]-propyl}“ diethyl-amine (P-2004),
5-Chloro {2-fluoro methoxy [2-(2-methoxy-ethoxy)-ethoxy]-benzyl}-lH-pyrrolo[2,3b]pyridine (P-2002),
-(4-Benzyloxy-2,6-difluoro-benzyl)-l H-pyrrolo[2,3-b]pyridine (P-2022),
3-{2-Fluoro methoxy (2-(2-methoxy-ethoxy)-ethoxy]-benzyl} methoxy-lH-pyrrolo[2,3b]pyridine (P-2025), and
3-{2-Fluoro methoxy [2-(2-methoxy-ethoxy)-ethoxy]-benzyl}-lH-pyrrolo[2,3-b]pyridine (P-2026).
The following table indicates the aldehyde (column 2) and the azaindole (column 3) used to afford the target compound (column 4). Column 1 indicates the compound number and column 5 the observed mass.
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1721</td><td> O /=\ CO</td><td> 4^4 H</td><td><sup>N</sup> H</td><td> 413.2</td>
<td> P-1797</td><td> CF3 γν cf<sub>3</sub></td><td> s</td><td> 1Γ 7 Ci ‘י״ T *-L Jx/O cy <sup>1</sup>V^zx w</td><td> 451.3</td>
<td> P-1821</td><td> ~<sup>n</sup>C2׳<sup>n</sup>a_^ o O' /=\ > w /-° H M 0-</td><td> s</td><td> O zz ,d o O</td><td> 457.4</td>
<td> P-1844</td><td> I /=° ח־־־ץ/־ס / /=<sup>7</sup> o /=\</td><td><sup>N</sup> H</td><td> E n_ ף־ס־־/ ( 0 v=/ H</td><td> 397.2</td>
<td> P-1849</td><td> 74° o /=\ ח־ <sup>1</sup> 1</td><td> s</td><td> 1 o JO ° ו^׳יי o ־Π ω</td><td> 432.4</td>
<td> P-1851</td><td> Cl o <sup>F</sup>3<sup>C</sup>vS <sup>H</sup>V! j Vo</td><td> 4^4 <sup>N</sup> H</td><td> /ף־0־ za x־־^/ \=< y<sub>C</sub>| n f| <sup>z</sup> cf<sub>3</sub></td><td></td>
<td> P-1870</td><td> Od o 1 V CT X</td><td> 3</td><td> QV/° dXi ח</td><td> 385.4</td>
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+1T]<sup>+ </sup>observed</td>
<td> P-1885</td><td> Cl <sup>1</sup>¾0 o<sub>x</sub></td><td> 1 3לץ° <sup>N</sup> H</td><td> E 1 ¾½0 Ζ-Λ <sup>o</sup>lpW<sup>a</sup> Α'Ά / <sub>p</sub><sup>7 </sup>1M h F</td><td> 445.3</td>
<td> P-1886</td><td> Cl ¾/ o<sub>x</sub></td><td> H</td><td> /9־0־־ rv Πυρ 00<sup>ci </sup>n^n / <sup>v</sup><sub>cl</sub></td><td> 413.3</td>
<td> P-1896</td><td> Cl ¾9 F</td><td><sup>N</sup> H</td><td> /־־Ολ ¾5¾ K><sup>CI</sup> N f|</td><td> 367.3</td>
<td> P-1899</td><td> Q H ^=( F</td><td> IM <sub>H</sub></td><td> CX? f</td><td> 373.4</td>
<td> P-1901</td><td> ¾.9 F</td><td> H</td><td> F. i 1י <sup>f 1N</sup> H</td><td> 351.4 n</td>
<td> P-1970</td><td> Cl ¾.9</td><td> ץ J0 <sup>N</sup> H</td><td> F. /-CM cis^A א=< w yci I JD /° <sup>N</sup> H</td><td> 431.2</td>
<td> P-1972</td><td> Cl ¾/ 0-Y</td><td> La</td><td> E /—<V0 r-x <sup>Cl</sup>v/LA=A <sup>,</sup>ΑΎα I X> P <sup>7</sup>|\ץ N / c in H <sup>F</sup></td><td> 449.2</td>
<td> P-1973</td><td> Cl ¾/</td><td></td><td> E r־O־/\°־v Oap 00־<sup>cl</sup></td><td> 415.3</td>
<td> P-1976</td><td> Q <sub>F</sub> HN^N vh-o<sup>; </sup>H 9=< 0—</td><td><sup>1</sup> H</td><td> V. <sup>01</sup>nnKO / H ח</td><td> 437.3</td>
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [μ+ηΠ<sup>+ </sup>observed</td>
<td> P-1977</td><td> Q P HN<sub>V</sub>N H 0—</td><td> oύ</td><td> F AyA SA / H 1־1</td><td> 433.4</td>
<td> P-1978</td><td> HO A M. I J</td><td><sup>1</sup> Η</td><td> E Ox ;° ai-Az nA / h Π</td><td> 403.4</td>
<td> P-1984</td><td> «“ o o ׳—ס</td><td> ά</td><td> E /־AH Br TX> /° 0-/ <sup>N</sup> f!</td><td> 457.4 459.4</td>
<td> P-1986</td><td> ύν a y־Q H Ά <sup>F</sup> Λ</td><td><sup>cl</sup>w Ό ח</td><td> E TX? <sup>F</sup> X<sup>N</sup> H</td><td> 353.4</td>
<td> P-1990</td><td> 3: O xL,H o Ά</td><td> Ύ X> <sup>IN</sup> H</td><td> F. \=( I Xj p 0N N /</td><td> 365.3</td>
<td> P-2004</td><td><sub>F</sub> O 0 X <sup>N</sup>, /°</td><td> H</td><td> ״ P xzAx IJ ^ך׳ס .X</td><td> 420.4</td>
<td> P-2002</td><td> 0 y <sup>0</sup>'י Vy<sub>o</sub>^<sup>0</sup>־<sup></sup>H M; 0-</td><td> o</td><td> o <sup>2</sup>0 <sup>rz</sup>xA> XT o׳Y I A</td><td> 409.3</td>
<td> P-2022</td><td> p o --0 OSll X</td><td><sup>N</sup> H</td><td> Co<sup>F</sup><sup>N</sup> H</td><td> 438.1</td>
<td> P-2025</td><td> PH-oPo H o-</td><td> ? —o</td><td> —<כ R_^ —א ־/ 'χΛ<sup>0</sup>־־. /° Ογ׳νΦ <sup>7</sup>-^ >־=א<sup></sup>1p S^N / <sup>ΙΊ</sup> Η</td><td> 405.2</td>
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+1T]<sup>+ </sup>observed</td>
<td> P-2026</td><td> _ E Vzyo<sup>0</sup>^*־<sup></sup>H ^=( O-</td><td> s</td><td> /-0-0 p /</td><td> 373.2</td>
Example 19: Synthesis of Propane-l-sulfonic acid [3-(5-bromo-lH-pyrroIo[2,3-blpyridine-3carbonyl) fluoro&#1470;phenyI]-amide P-0955 and related compounds.
[0281] As an alternative method to that of Example 2, compound P-0955 was synthesized in nine steps from 4-chloro fluoro-phenylamine 47 as shown in Scheme 37.
Scheme 37
<img file="IL188248A_D0078.tif" />
<img file="IL188248A_D0079.tif" />
Step 1 - Preparation of 3-Amino chloro fluoro-benzoic acid benzyl ester (48): [0282] To 4-chloro fluoro-phenylamine (47, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), cooled with dry ice/acetone bath under an atmosphere of nitrogen, n-butyllithium (2.50 M in hexane, 24.4 mL) was added slowly. After 20 minutes, l,2-Bis-(chloro-dimethyl-silanyl)-ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was added slowly to the reaction. After 1 hour, nbutyllithium (2.50 M in hexane, 25.0 mL) was added slowly to the reaction. The reaction was stirred at -78 °C for 20 minutes and then allowed to warm to room temperature over 60 minutes. The reaction was cooled to -78 °C, followed by addition of n-butyllithium (2.50 M in hexane, 26.0 mL) slowly. After 80 minutes, benzyl chloroformate (10.0 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 °C overnight followed by addition of water (80 mL) and concentrated hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature for 2 hours. The organic layer was separated. The aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate/hexane 20%) to give a colorless oil (48,12.5 g, 78.3%). MS(ESI)[M+H+]+ = 280.0.
Step 2 - Preparation of 6-chloro fluoro (propane-l-sulfonylamino)-benzoic acid benzyl ester (49):
[0283] To 3-amino chloro fluoro-benzoic acid benzyl ester (48,1.20 g, 4.3 mmol) in methylene chloride (28 mL) was added pyridine (0.52 mL, 6.4 mmol) and propanesulfonyl chloride (0.685 g, 4.8 mmol). The reaction was stirred at room temperature overnight, then poured into water, and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated with silica gel column chromatography to give a colorless oil (49, 960 mg, 58.0%). MS(ESI) [M-A]'= 384.1.
Step 3 - Preparation of 6-chloro fluoro (propane-l-sulfonylamino)-benzoic acid (115): [0284] To 6-chloro fluoro (propane&#1470;l-sulfonylamino)-benzoic acid benzyl ester (49, 6.00 g, 15.6 mmol) in tetrahydrofuran (100 mL) was added 1.0 M aqueous potassium hydroxide (100 mL). The reaction was heated to reflux overnight. The reaction was poured into water, acidified to pH 2 with 1 N hydrochloric acid and extracted with ethyl acetate. The organic portion was dried over anhydrous sodium sulfate, filtered and concentrated to give a white solid 115 (3.95 g, 85.8%).
Step 4 - Preparation of2-fluoro (propane-l-sulfonylamino)-benzoic acid (50):
[0285] To 6-chloro fluoro (propane-l-sulfonylamino)-benzoic acid (115,0.69 g, 2.3 mmol) in methanol (10 mL) was added 20% palladium hydroxide on carbon (200 mg). The reaction was stirred under hydrogen at 50 psi for 2 hours. The reaction was filtered and concentrated to give white solid 50 that was used in the next step. MS(ESI) [14-11^=260.1.
Step 5 - Preparation of2-fluoro (propane-l-sulfonylamino)-benzoic acid methyl ester (501): [0286] To a 2-fluoro (propane-l-sulfonylamino)-benzoic acid (50, 5.05 g, 0.0193 mol) in methylene chloride (100 mL) was added Ν,Ν-dimethylformamide (0.075 mL, 0.97 mmol) under an atmosphere of nitrogen. The reaction was cooled with ice/water, followed by slow addition of Oxalyl chloride (2.00 M of in methylene chloride, 10.8 mL, 21.6 mmol). The reaction mixture was stirred at room temperature for 3.0 hours. The reaction was cooled with ice/water, followed by addition of methanol (36.0 mL, 0.89 mol) slowly. The reaction was stirred at room temperature overnight. The reaction was concentrate and purified with silica gel column chromatography eluting with 30% ethyl acetate in hexane to give a crude white solid 4.0g.
Step 6 — Preparation of Propane sulfonic acid (2-fluoro hydroxymethyl-phenyl)-amide (502): [0287] To 2-fluoro (propane-l-sulfonylamino)-benzoic acid methyl ester (501, 3.80 g, 13.8 mmol) in tetrahydrofuran (133 mL) was added lithium tetrahydroaluminate (1.00 M in tetrahydrofuran, 20.0 mL, 20.0 mmol) under an atmosphere of nitrogen at room temperature. The reaction was stirred at room temperature for 8 hours, followed by addition of 10 g of NaSO4’10H2O. After 12 hours, the reaction was filtered, concentrated and purified with silica gel column chromatography eluting with 5% methanol in methylene chloride to give a white solid (502, 3.0 g, 87.9%).
Step ?-Preparation of propane sulfonic acid (2-fluoro formyl-phenyl)-amide (503): [0288] To propane sulfonic acid (2-fluoro hydroxymethyl-phenyl)-amide (502,0.20 g, 0.81 mmol) in tetrahydrofuran (5.0 mL) was added Dess-Martin periodinane (0.377 g, 0.89 mmol). The reaction was stirred at room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a white solid (503,100 mg, 50.0%). MS(ESI) [M&#1470;H+]+ = 244.1.
Step 8 - Preparation of Propane sulfonic acid {3-[(5-bromo-lH-pyrrolo[2,3-b]pyridin yl)hydroxy-methyl] fluoro-phenyl}-amide (504):
[0289] To 5-bromo azaindole 67 (312 mg, 1.58 mmol) in methanol (28 mL) were added propane-
1- sulfonic acid (2-fluoro formyl-phenyl)-amide (503, 370 mg, 1.5 mmol) and potassium hydroxide (422.8 mg, 7.5 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the desired compound as white solid (504, 300 mg, 45.0%).
Step 9 - Preparation of propane-l-sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)2,4-dif uoro-phenyl]-amide (P-0955):
[0290] To Propane-l-sulfonic acid {3-[(5-bromo-lH-pyrrolo[2,3-b]pyridin yl)-hydroxy-methyl]-
2- fluoro-phenyl}-amide (504, 0.650 g, 1.47 mmol) in tetrahydrofuran (25.0 mL) cooled with ice/water was added Dess-Martin periodinane (0.748 g, 1.76 mmol). The reaction was stirred at room temperature for 15 minutes. The reaction was poured into water containing sodium thiosulfate and potassium carbonate and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane and washed with ethyl acetate to give white solid. (P-0955, 0.35 g, 54.1%). MS(ESI) [M+H4]4 = 460.0, 462.0.
[0291] Butane sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl) fluorophenyl]-amide P-1250
A 11
HN-S was prepared following the protocol of Scheme 37, substituting propane sulfonyl chloride with butane sulfonyl chloride in Step 1 and 5-bromo-lH-pyrrolo[2,3-b]pyridine 67 with 5-chloro-lHpyrrolo[2,3-b]pyridine 80 (see Example 9) in step 8.
MS(ESI) [M-H*]408.1 = &#1470;.
[0292] Propane sulfonic acid [2-fluoro (5-methoxy-lH-pyn&#1470;olo[2,3-b]pyridine carbonyl)phenyl]-amide P-1256
A II
HN-S 11 O was prepared following the protocol of Scheme 37, substituting 5-bromo-lH-pyrrolo[2,3-b]pyridine 67 with 5-methoxy-lH-pyrrolo[2,3-b]pyridine 104 (see Example 16) in step 8.
MS(ESI) [M-H4)'390.1 &#1470;.
[0293] N-[3-(5-chloro-lH&#1470;pyrrolo[2,3-b]pyridine carbonyl) fluoro-phenyl] benzenesulfonamide
P-1255 was prepared foUowing the protocol of Scheme 37, substituting propane sulfonyl chloride with benzenesulfonyl chloride in Step 1 and 5-bromo-lH-pyrrolo[2,3-b]pyridine 67 with 5-chloro-lHpyrrolo[2,3-b]pyridine 80 (see Example 9) in step 8. MS(ESI) [M - H4]' = 428.0.
Example 20: Synthesis of 3 (2,6-difluoro (propane-l-sulfonylamino)-benzoyl]-lHpyrrolo[2,3 -b]pyridin yl-propionic acid P-1270.
[0294] Compound P-1270 was synthesized in three steps from propane sulfonic acid [3-(5bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]-amide P-0773 as shown in Scheme 38.
<img file="IL188248A_D0080.tif" />
<img file="IL188248A_D0081.tif" />
Step 1 -Preparation of (E) 3-[2,6-difluoro (propane-l -sulfonylamino)-benzoyl]-lH-pyrrolo [2,3-b]pyridin yl-acrylic acid m ethyl ester (505):
[0295] To propane sulfonic acid [3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4difluoro-phenyl]-amide (P-0773, 125.0 mg, 0.27 mmol, prepared as described in Example 4) in N,Ndimethylformamide (4.0 mL) were added palladium acetate (15 mg, 0.068 mmol), triphenylphosphine (36 mg, 0.14 mmol), methyl acrylate (0.098 mL, 1.1 mmol) and triethylamine (0.114 mL, 0.82 mmol) under an atmosphere of nitrogen. The reaction was stirred at 140 °C overnight, then poured into water, acidified with water and extracted with ethyl acetate. To the filtrate in methylene chloride (5.0 mL) was added l,8-diazabicyclo[5.4,0]undec ene (0.50 mL, 3.3 mmol). The reaction was stirred at room temperature for 3 hours. The reaction was concentrated and purified with silica gel column chromatography eluting with 30% ethyl acetate in hexane to give a light yellow oil that was used directly in the next step.
Step 2 - Preparation of3 [2,6-difluoro tpropane-l-sulfonylamino)-benzoyl]-lH-pyrrolo[2,3 b]pyridin yl-acrylic acid (P-1269):
[0296] To (E) 3-[2,6-diiluoro (propane-l -sulfonylamino)-benzoyl]-lH-pynolo [2,3-b]pyridin5-yl-acrylic acid methyl ester (100.0 mg, 0.22 mmol) in tetrahydrofuran (5.0 mL) and water (1.50 mT) was added lithium hydroxide (21 mg, 0.86 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water, acidified with IN HC1 to pH around 1, and then extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a white solid (P-1269, 30 mg), MS(ESI) [M-Ef]' = 448.0.
Step 3 - 3 [2,6-difluoro (propane-l-sulfonylamino)-benzoyl]-lH-pyrrolo[2,3 -b]pyridin ylpropionic acid (P-1270):
[0297] To 3-32,6]&#1470;-difluoro (propane-l-sulfonylamino)-benz0yI]-lH-pynOlo[2,3 -b]pyridin5&#1470;-ylacrylic acid (P-1269, 20.0 mg, 0.045 mmol) in methanol (5.0 mL) was added 20% Pd(OH)2/C (10 mg) under an atmosphere of hydrogen. The reaction was stirred at room temperature for 2 hours. The reaction mixture was filtered, concentrated and purified with silica gel column chromatography eluting with 10% methanol in methylene chloride to give a white solid (P-1270, 8.8 mg). MS(ESI) [M-H4]450.1 &#1470;&#1470;.
Example 21: Synthesis of thiophene sulfonic acid (2,4-difluoro formyl-phenyl)-amide 508.
[0298] Compound 512 was synthesized in four steps from 2,4-difluorophenylamine 42 as shown in Scheme 39.
Scheme 39
<img file="IL188248A_D0082.tif" />
Step 1 - Preparation of 3-amino-4,2-difluoro-benzoic acid ethyl ester (509):
[0299] To 4,2-difluoro-phenylamine (42, 6.30 mL, 57.0 mmol) in tetrahydrofuran (300 mL), cooled with dry ice/acetone bath under an atmosphere of nitrogen, n-butyllithium (2.50 M in hexane, 24.4 mL) was added slowly. After 20 minutes, l,2-Bis-(chloro-dimethyl-silanyl)-ethane (12.9 g, 60.0 mmol) dissolved in tetrahydrofuran (40.0 mL) was slowly added to the reaction. After 1 hour, nbutyllithium (2.50 M in hexane, 25.0 mL) was slowly added to the reaction. The reaction was stirred at -78 °C for 20 minutes and then allowed to warm to room temperature over 60 minutes. The reaction was cooled to -78 °C, followed by addition of n-butyllithium (2.50 M in hexane, 26.0 mL) slowly. After 80 minutes, ethyl chloroformate (6.69 mL, 70.0 mmol) was added to the reaction. The reaction mixture was stirred at -78 °C overnight followed by addition of water (80 mL) and concentrated hydrochloric acid (25 mL). The reaction was allowed to warm to room temperature for 2 hours. The organic layer was separated. The aqueous layer was basified with potassium carbonate and extracted with ethyl acetate. The organic layers were combined and washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate/hexane 20%) to give a colorless oil (509, 4.6 g, 39%). MS(ESI)[M + lT]+ = 218.1.
Step 2 - Preparation of 2,6-difluoro (thiophene sulfonylamino)-benzoic acid ethyl ester (510): [0300] To 3-amino-2,4&#1470;difluoro-benzoic acid ethyl ester (509, 1.20 g, 5.93 mmol) in methylene chloride (28 mL) was added pyridine (0,52 mL, 6.4 mmol) and thiophene sulfonyl chloride (0.97 g, 5.38 mmol). The reaction was stirred at room temperature overnight, then poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated with silica gel column chromatography (ethyl acetate/hexane 20%) to give a colorless oil (510, 1.2 g, 65.0%). MS(ESI) [M + &#943;Γ]+= 348.2.
Step 3 - Preparation of thiophene sulfonic acid (2,4-difluoro hydroxymethyl-phenyl)-amide (Sil):
[0301] To 2,6-difluoro (thiophene sulfonylamino)-benzoic acid ethyl ester (510, 1.6 g, 3.5 mmol) in tetrahydrofuran (25.0 mL) was added lithium tetrahydroaluminate (1.00 M in tetrahydrofuran, 8.08 mL, 8.08 mmol) under an atmosphere of nitrogen at room temperature. The reaction was stirred at room temperature for 8 hours, followed by addition of 10 g of NaSO/10H2O. After 12 hours, the reaction was filtered, concentrated and purified with silica gel column chromatography eluting with 5% methanol in methylene chloride to give a white solid (511, 300.0 mg, 21.0%).
Step 4 - Preparation of thiophene sulfonic acid (2,4-difluoro formyl-phenyl)-amide (512): [0302] To thiophene sulfonic acid (2,4-difluoro hydroxymethyl-phenyl)-amide (511, 0.46 g, 1.52 mmol) in tetrahydrofuran (5.0 mL) was added Dess-Martin periodinane (0.71g, 1.67 mmol). The reaction was stirred at room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a white solid (512, 100 mg, 21%); MS(ESI) [M + H*]+ = 304.2.
[0303] Thiophene sulfonic acid (2,4-difluoro formyl-phenyl)-amide 513
<img file="IL188248A_D0083.tif" />
was prepared following the protocol of Scheme 39, substituting thiophene sulfonyl chloride with thiophene sulfonyl chloride in Step 2. MS(ESI) [M + Ηψ = 304.2.
[0304] N-(2,4-Difluoro formyl-phenyl)-methanesulfonamide 577
F
A
HN&#1470;< 0 was prepared following the protocol of Scheme 39, substituting thiophene sulfonyl chloride with methanesulfonyl chloride in Step 2.
[0305] N-(2,4-Difluoro formyl-phenyl) fluoro-benzenesulfonamide 578
<img file="IL188248A_D0084.tif" />
was prepared fohowing the protocol of Scheme 39, substituting thiophene sulfonyl chloride with 3fluoro-benzenesulfonyl chloride in Step 2,
Example 22: Synthesis 0f4-(5-Pyridin yl-lH&#1470;pyrr0I0[2,3-b]pyridine carb0nyl)-ind01e-lcarboxylic acid butylamide P-1486 and related compounds
[0306] Compound P-1486 was synthesized in three steps from lH-indole carbaldehyde 518 as shown in Scheme 41.
Scheme 41
<img file="IL188248A_D0085.tif" />
<img file="IL188248A_D0086.tif" />
Step 1 - Preparation of 4-Formyl-indole-l-carboxylic acid butylamide (519):
[0307] To lH-Indole carbaldehyde (518, 1.57 g, 10.8 mmol) in acetonitrile (20 mL) was added 1isocyanatobutane (1.81 mL, 16.2 mmol), followed by 4-dimethylaminopyridine (130 mg, 1.1 mmol). The reaction was refluxed for 48 hours. The reaction solution was quenched with 1 M HCI (aq.) and extracted with ethyl acetate. The organic layer was washed with sodium bicarbonate and brine, dried over anhydrous magnesium sulfate, filtrated and concentrated to give a light yellow solid (519, 2.62 g, 45%). MS(ESI) [Μ+1Γ]+= 245.2.
Step 2 - Preparation of 4-[Hydroxy-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin yl)-methyl]-indole-1carboxylic acid butylamide (520):
[0308] To 5-Pyridin yl-lH-pyrrolo[2,3-b]pyridine (89, 51 mg, 0.26 mmol, prepared as in Example 17) in methanol (2 mL), was added 4-Formyl-indole-l -carboxylic acid butylamide (519, 84 mg, 0.34 mmol) and potassium hydroxide (44 mg, 0.78 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with water and brine, dried over anhydrous magnesium sulfate, filtrated and concentrated. The desired compound was isolated with silica gel column chromatography to give an off-white solid (520, 7 mg, 6 %). MS(ESI) [M+1T]+ = 440.3.
Step 3 - Preparation of 4-(5-Pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-indole-l-carboxylic acid butylamide (P-1486):
[0309] To 4-[Hydroxy-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin yl)-methyl]-indole-l-carboxylic acid butylamide (520, 7 mg, 0.016 mmol) in tetrahydrofuran (1 mL) was added Dess-Martin periodinane (7.4 mg, 0.017 mmol). The reaction was stirred at room temperature for 30 minutes, then poured into water and extracted with ethyl acetate. The organic layer was washed with saturated sodium bicarbonate and brine, dried over anhydrous magnesium sulfate, filtrated and concentrated.
The desired compound was purified by Prep HPLC using a gradient of buffer A (5% acetonitrile, 95% water, 0.1% formic acid) and buffer B (95% acetonitrile, 5% water, 0.1% formic acid). P-1486 was isolated as a fluffy white solid (2.8 mg, 40%). MS(ESI) [M+1T]+ = 438.3.
[0310] Additional compounds were prepared following the protocol of Scheme 41, optionally substituting 1-isocyanatobutane with an appropriate isocyanate in Step 1 and optionally substituting 5pyridin yl-lH-pyrrolo[2,3-b]pyridine 89 with a suitable 7-azaindole in Step 2. The azaindole was purchased or synthesized as described in Examples 16 and 17. The following compounds were made following this procedure:
4-(5-Phenyl-lH-pyrrolo[2,3-b]pyridine carbonyl)-indole-l-carboxylic acid butylamide (P-1576),
4-[5-(4-Chloro-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-indole-l-carboxylic acid butylamide (P-1602),
4-(5-Phenyl-lH-pyrrolo[2,3-b]pyridine carbonyl)-indole-l-carboxylic acid benzylamide (P-1611),
4-[5-(4-Chloro-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-indole-l -carboxylic acid benzylamide (P-1618),
4-(5-Bromo-1 H-pyrrolo[2,3-b]pyridine-3 -carbonyl)-indole-1 -carboxylic acid butylamide ‘ (P-1687), 4-[5-(4-Sulfamoyl-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-indole-l-carboxylic acid butylamide (P-1854), 4-[5-(3-Sulfamoyl-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-indole-l-carboxylic acid butylamide (P-1858), 42)-5]&#1470;-Methoxy-pyrimidin yl)-lH-py1rolo[2,3-b]pyridine carbonyl]-indole-l-carboxylic acid butylamide (P-1860), 4-(5-Pyrimidin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-indole-l-carboxyiicacid butylamide (P-1862), 4-(5-Methoxy-lH-pyrrolo[2,3-b]pyridine carbonyl)-indole-l-carboxylicacid butylamide (P-1875), and 4-[5-(6-Methoxy-pyridin yl)-lH-pyn&#1470;olo[2,3-b]pyridine carbonyl]-indole-l-carboxylic acid (pyridin ylmethyl)-amide (P-1887).
The following table indicates the isocyanate used in Step 1 (column 2), and the 7-azaindole used in Step 2 (column 3) to afford the target compound (column 4). Column 1 provides the compound number and column 5 the observed mass.
<td></td><td> Isocyanate</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+eC]<sup>+ </sup>observed</td>
<td> P-1576</td><td> ζ־Ν=Ο=Ο</td><td><sup>N</sup> H</td><td> Γ H /M o WC Ok <sup>N</sup> מ J</td><td> 437.3</td>
<td> P-1602</td><td> ζ־Ν=0=0</td><td> L 1 <sup>N</sup> Pi</td><td> 0410 0 1? hn-v n כ</td><td> 471.2</td>
<td> P-1611</td><td> N=C=O b</td><td><sup>N</sup> H</td><td> Vn <sup>hnV</sup>^ ' H</td><td> 471.3</td>
<td> P-1618</td><td> N=C=O b</td><td><sup>cl</sup>n <sup>N</sup> H</td><td><sup>c</sup>y! yp 0 0 n n <sup>14</sup> H</td><td> 505.2</td>
<td> P-1687</td><td></td><td><sup>1</sup> H</td><td><sub>B</sub> yp ° <sup>Βγ</sup>ΆΑ Uh hn<sub>3</sub></td><td> 439.2 441.2</td>
<td> P-1854</td><td> ^2־N=C=O</td><td> NH<sub>2 </sub>O־S^ <sup>ς</sup>'Ν־<sup>Λ</sup>'Ν H</td><td> nh<sub>2</sub> h<sub>Nj</sub></td><td> 514.2 (M-Η<sup>4</sup>]־</td>
<td></td><td> Isocyanate</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+HT observed</td>
<td> P-1858</td><td> ζ-Ν=0=0</td><td> ך/ nN H</td><td> ύΡ CP & ¾ b X</td><td> 516.2</td>
<td> P-1860</td><td> <qN=c-־o</td><td><sup>N</sup> H</td><td> O ץ x CP C<sup>z </sup>z Λ : ף</td><td> 469.3</td>
<td> P-1862</td><td> ζ־Ν=Ο=Ο</td><td><sup>N</sup> H</td><td> < XJ HN-λ n H J</td><td> 439.3</td>
<td> P-1875</td><td> ζ-Ν־Ό=Ο</td><td> H</td><td> °VQ n VQ <sup>hn</sup>j</td><td> 391.4</td>
<td> P-1887</td><td> N=C=O h</td><td> \ p</td><td> CL-O N-a IL Λ י HN-V N</td><td> 503.4</td>
[0311] The product of Step 2 of Scheme 41 can alternatively be reacted to form the corresponding compounds with methylene linker at the 3 position of the azaindole. For example, 4-(5-pyridin yllH-pyrrolo[2,3-b]pyridin ylmethyl)-indole-l-carboxylic acid butylamide P-1656 was prepared from 4-[Hydroxy-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin yl)-methyl]-indole-l-carboxylic acid butylamide 520 as shown in Scheme 41a.
Scheme 41a
<img file="IL188248A_D0087.tif" />
Step 1 Preparation of4-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin ylmethyl)-indole-l-carboxylic acid butylamide (P-1656):
[0312] A mixture of 4-[hydroxy-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin yl)-methyl]-indoIe-lcarboxylic acid butylamide (520, 18 mg, 0.041 mmol), trifluoroacetic acid (0.5 mL), triethylsilane (1 mL), and acetonitrile (8 mL) was refluxed for 4 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with saturated sodium bicarbonate and brine, dried over anhydrous magnesium sulfate, filtrated and concentrated. The desired compound was purified by Prep HPLC using a gradient of buffer A (5% acetonitrile, 95% water, 0.1% formic acid) and buffer B (95% acetonitrile, 5% water, 0.1% formic acid). P-1656 was isolated as an offwhite solid (4.8 mg, 28%). MS(ESI) [M+1T]+ = 424.2.
[0313] The corresponding hydroxy-methyl derivative of Scheme 41 Step 2 was reacted following the protocol of Scheme 41a to prepare 4-[5-(2-methoxy-pyrimidin yl)-lH-pyrrolo[2,3-b]pyridin-3ylmethyl]-indole-l-carboxylic acid butylamide P-1861, 4-(5-methoxy-lH-pyrrolo[2,3-b]pyridin-3ylmethyl)-indole-l-carboxylic acid butylamide P-1876, and 4-(5-Pyridin yl-lH-pyrrolo[2,3b]pyridin ylmethyl)-indole-l-carboxylic acid butylamide P-1877, with structures shown below.
<img file="IL188248A_D0088.tif" />
<img file="IL188248A_D0089.tif" />
<img file="IL188248A_D0090.tif" />
Example 23: Synthesis of (3-Benzyloxy-2,6-difluoro-phenyl)-(5-pyridin yl-lH-pyrrolo[2,3b]pyridin yl)-methanone P-1467 and related compounds
[0314] Compound P-1467 was synthesized in four steps from 2,4-difluorophenol 35 as shown in Scheme 43.
Scheme 43
<img file="IL188248A_D0091.tif" />
Step 1 — Preparation of l-Benzyloxy-2,4-difluoro-benzene (525):
[0315] To 2,4-difhioro-phenol (35,7.60 g, 0.0584 mol) in Ν,Ν-dimethylformamide (50.0 mL) were added benzyl bromide (8.0 mL, 0.067 mol) and potassium carbonate (9.00 g, 0.0651 mol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound as white solid (525, 3.20 g, 25%).
Step 2 — Preparation of3-Benzyloxy-2,6-difluoro-benzaldehyde (526):
[0316] To l-Benzyloxy-2,4-difluoro-benzene (525, 3.00 g, 13.6 mmol) in Tetrahydro furan (48 mL) under an atmosphere of nitrogen and cooled with dry ice/acetone was added n-Butyllithium (1.60 M in hexane, 8.94 mL). After 20 minutes, Ν,Ν-dimethylformamide (1.46 mL, 0.0189 mol) was added to the reaction. After another 20 minutes, the flask was stirred at room temperature for 30 minutes. The reaction mixture was poured into water, acidified to pH = 1, and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and purified with silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound as a yellow solid (526, 2.5g, 74%).
Step 3 - Preparation of (3-Benzyloxy-2,6-difluoro-phenyl)-( 5-pyridin yl-lH-pyrrolo[2,3-b]pyridin3-yl)-methanol (527):
[0317] To 5-Pyridin yl-lH&#1470;pyrrolo[2,3-b]pyridine (89, 750.0 mg, 0.003842 mol, prepared as in Example 17) in methanol (20.0 mL) were added 3-Benzyloxy-2,6-difluoro-benzaldehyde (526, 1.12 g, 4.5 mmol) and potassium hydroxide (1.50 g, 0.0267 mol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight and then poured into water, acidified with IN HC1 to pH around 2 and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound (527, 700 mg, 35%).
Step 4 - Preparation of (3-Benzyloxy-2,6-difluoro-phenyl)-( 5-pyridin yl-lH-pyrrolo[2,3-b]pyridin3-yl)-methanone (P-1467):
[0318] To (3-Benzyloxy-2,6-difluoro-phenyl)-( 5-pyridin yl-lH-pyrrolo[2,3-b]pyridin yl)methanol (527, 300.0 mg, 0.68 mmol) in tetrahydrofuran (10.0 mL) was added Dess-Martin periodinane (344 mg, 0.81 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction mixture was concentrated with silica and purified with silica gel column chromatography eluting with 10% methanol in dichloromethane to give the compound (P-1467, 240 mg, 80%). MS(ESI) [Μ+Ηψ = 442.2.
[0319] (5-Bromo-lH-pyrrolo[2,3-b]pyridin yl)-[2,6-difluoro (2-methoxy-ethoxy)-phenyl]methanone P-1453
<img file="IL188248A_D0092.tif" />
was prepared following the protocol of Scheme 43, substituting benzyl bromide with l-Bromo-2methoxy-ethane in Step 1 and 5-Pyridin yl-lH-pyrrolo[2,3-b]pyridine with 5-Bromo-lHpyrrolo[2,3-b]pyridine (67) in Step 3. MS (ESI) [M + 1T]+ = 410.1,412.1.
[0320J [2,6-Difluoro (2-methoxy-ethoxy)-phenyl]-(5-methoxy-lH-pyrrolo[2,3-b]pyridin yl)methanone P-1584
<img file="IL188248A_D0093.tif" />
was prepared following the protocol of Scheme 43, substituting benzyl bromide with l-Bromo-2methoxy-ethane in Step 1 and 5-Pyridin yl-lH-pyrrolo[2,3-b]pyridine with 5-methoxy-lHpyrrolo[2,3-b]pyridine (104, prepared as in Example 22) in Step 3. MS (ESI) [M + Ηψ = 363,2.
[0321] (3 -Benzyloxy-2,6-difluoro-phenyl)-(5 -methoxy-1 H-pyrrolo[2,3 -b]pyridin-3 -yl)-methanone
P-1597
<img file="IL188248A_D0094.tif" />
was prepared following the protocol of Scheme 43, substituting 5-Pyridin yl-lH-pyrrolo[2,3b]pyridine with 5-methoxy-lH-pyrrolo[2,3-b]pyridine (104, prepared as in Example 16) in Step 3. MS(ESI) [M +7]+ = 395.2.
[0322] (3-Benzyloxy-2,6-difluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin yl)-methanone P-1802
<img file="IL188248A_D0095.tif" />
was prepared following the protocol of Scheme 43, substituting 5-pyridin yl-lH-pyrrolo[2,3b]pyridine with 7-azaindole. To a solution of (3-benzyloxy-2,6-difluoro-phenyl)-(lH-pyrrolo[2,3b]pyridin yl)-methanone (P-1802, 0.5 g, 1.37 mol) in methanol (70 mL) and tetrahydrofiiran (30 mL) was added palladium on carbon (120 mg, 10% wt., 0.58 mol). The mixture was stirred under hydrogenation (60 psi) for six hours. After removal of solvent, the residue was dried under vacuum, which provided (2,6-Difluoro hydroxy-phenyl)-(lH-pyrrolo[2,3-b]pyridine yl)-methanone 651 as a white solid (363 mg, 96%). MS (ESI) [M+H+]+ = 275.36.
<img file="IL188248A_D0096.tif" />
[0323] Additional compounds were prepared following steps 3 and 4 of Scheme 43, replacing 3benzyloxy-2,6-difluoro-benzaldehyde 526 with an appropriate aldehyde and/or pyridin yl-lHpyrrolo[2,3-b]pyridine 89 with an appropriate azaindole in Step 3. The azaindoles used were synthesized as described in Examples 9 or 16. The aldehydes used were synthesized as described in Example 5 or 21. The following compounds were made following this procedure:
N-[3-(5-Chloro-lH-py1rolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyI] trifluoromethylbenzenesulfonamide (P-1541),
N-[2,4-Difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] trifluoromethylbenzenesulfonamide (P-1542),
N-[2,4-Difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridine carbony])-phenyl] fluorobenzenesulfonamide (P-1581),
N2,4]&#1470;-Difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] fluorobenzenesulfonamide (P-1582),
N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] fluorobenzenesulfonamide (P-1583),
N-[2,4-Difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] trifluoromethylbenzenesulfonamide (P-1598),
N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] trifluoromethylbenzenesulfonamide (P-1599), (5-Chloro-IH-pyrrolo[2,3-b]pyridin yl)-{2-fluoro methoxy [2-(2-methoxy-ethoxy)ethoxy]-phenyl} -methanone (P-2003), (4-Benzyloxy-2,6-difluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin yl)-methanone (P-2020), and [4-(4-Chloro-benzyloxy) methoxy-phenyl]-(lH-py1rolo[2,3-b]pyridin yl)-methanone (P-1698).
The following table indicates the aldehyde (column 2) and the azaindole (column 3) used to afford the target compound (column 4). Column 1 provides the compound number and column 5 the observed mass.
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+HtT observed</td>
<td> P-1541</td><td> w H F N'T0 Η O</td><td> o A</td><td> o zH nAXT ח־ 1 ^^0 iz ~ 0=4=° A o רד G></td><td> 516.2</td>
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1542</td><td> CF, H f N־־?rO H 0</td><td> o \</td><td> F 1 °vO <sup>0</sup> /־־\-CF Ox״ / H U r<sup>CF3</sup> Yp <sup>f k</sup>N N <sup>H</sup> O H</td><td> 512.2</td>
<td> P-1581</td><td> VO'S H /N׳S<sup>0־</sup> F H 0</td><td> o \</td><td> F ן %O _n °Znc <sup>n</sup> Ap W<sup>F H 0 </sup>H</td><td> 462.2</td>
<td> P-1582</td><td> F w 9 H ,A N-S=O F h 0 <sup>ח</sup></td><td> 3רץ° nn h</td><td> 1 o— 2f־< L יי <sup>11</sup>־-Q IZ o־A° רד</td><td> 462.2</td>
<td> P-1583</td><td> ηΑν^<sup>=ο </sup>F H 0</td><td> V^N H</td><td> 1 <sup>1</sup> Ω 1 <sub></sub> I יי! xz ' <sub>ο</sub>=ω=Ο Ο ח־</td><td> 466.1</td>
<td> P-1598</td><td> w F H 0</td><td> 9 o \</td><td> 1 Ο- c5 L יי IZ o־-Y° ό o רד G7</td><td> 510.1</td>
<td> P-1599</td><td> .A> A η\ΓνΑ<sup>ο</sup> F H 0</td><td> 'nN Η</td><td> F q /^\ αγγΓΤΝ-ί'Μ W<sup>F H0 CF</sup>’ H</td><td> 514.0</td>
<td> P-2003</td><td><sup>0</sup>U־y0׳A0 Η M 0—</td><td> ^|\Γ N Η</td><td> 1 /<sup>Q</sup> XZ\/yP i J ° T 1 σ</td><td> 423.3</td>
<td> P-2020</td><td> A o=<L X</td><td> Η</td><td> Οχ / V°x 05 f SAn H</td><td> 363.1</td>
<td> P-1698</td><td> o A cr־x</td><td> Η</td><td> Q r-x H>q /=\ q5> z° vv<sup>ci</sup> N N /</td><td> 393.2</td>
Example 24: Synthesis of 3-(3-Benzyloxy-2,6-difluoro-benzyI) pyridin yI-lH-pyrroIo[2,3b]pyridine P-1455:
[0324] Compound P-1455 was synthesized in four steps from 2,4-difluorophenol 35 as shown in Scheme 43a.
Scheme 43a
<img file="IL188248A_D0097.tif" />
[0325] Steps 1 -3 are identical to Steps 1 -3 of Scheme 43.
Step 4 - Preparation of 3-(3-Benzyloxy-2,6-difluoro-benzyl) pyridin yl-lH-pyrrolo[2,3b]pyridine (P-1455):
[0326] To (3-Benzyloxy-2,6-difluoro-phenyl)-( 5-pyridin yl-lH-pyrrolo[2,3-b]pyridm yl)methanol (527, 580.0 mg, 1.3 mmol) in acetonitrile (29.0 mL) were added trifluoroacetic acid (1.9 mL, 0.025 mol) and triethylsilane (3.9 mL, 0.024 mol). The reaction was stirred at 80 °C for 1 hour. The reaction was poured into water, basified with 1 M potassium carbonate to pH = 4, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 50% ethyl acetate in hexane to give as a yellow solid (P-1455, 530 mg). MS(ESI) [M+H4]4 = 428.3.
[0327] 5-Bromo [2,6-difluoro (2-methoxy-ethoxy)-benzyl]-lH-pyrrolo[2,3-b] pyridineP-1454
<img file="IL188248A_D0098.tif" />
was prepared following the protocol of Scheme 43a by substituting benzyl bromide with l-Bromo-2methoxy-ethane in Step 1 and 5-Pyridin yl-lH-pyrrolo[2,3-b]pyridine with 5-Bromo-lHpyrrolo[2,3-b]pyridine (67) in Step 3. MS (ESI) [Μ + Η*.]+ = 410.1, 412.1.
PCI7US2006/024361
[0328] Additional compounds were prepared following steps 3 and 4 of Scheme 43a, replacing 3benzyloxy-2,6-difluoro-benzaldehyde 526 with an appropriate aldehyde and/or pyridin yl-lHpyrrolo[2,3-b]pyridine 89 with an appropriate azaindole (see Example 9 or Example 16) in Step 3. The following compounds were made following this procedure:
N-[2,4-Difluoro (5-methoxy-lH-pyrrolo[2,3-b]pyridin3&#1470;-ylmethyl)-phenyl] trifluoromethylbenzenesulfonamide (P-1590), and
N2,4]&#1470;-Difluoro (5-chloro-lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenyl] trifluoromethylbenzenesulfonamide (P-1600).
The following table indicates the aldehyde (column 2) and the azaindole (column 3) used to afford the target compound (column 4). Column 1 indicates the compound number and column 5 the observed mass.
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [m+hT observed</td>
<td> P-1590</td><td> I O L יי ° a וד ω</td><td> ο \</td><td> F <sup>1</sup> /-Ό ° /ר <sup>0</sup>ΥΑγΛρ N׳^<sub>rP</sub> W <sup>F H 0 CF</sup>* H</td><td></td>
<td> P-1600</td><td> F Η 0</td><td> H</td><td> 5 zez O--VO o o יי»</td><td></td>
Example 25: Synthesis of 3-[2,6-difluoro (propane-l-sulfonylamino)-benzoy]]-lH-pyrrolo[2,3b]pyridine carboxylic acid ethylamide P-1630
[0329] Compound P-1630 was synthesized in six steps from 5-bromo-l -triisopropylsilyl-7azaindole 68 as shown in Scheme 45.
Scheme 45
<img file="IL188248A_D0099.tif" />
Step 1 Preparation ofl-Triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine carboxylic acid methyl ester (531):
[0330] To 5-bromo-l -triisopropylsilyl azaindole (68, 1.50 g, 4.2 mmol, prepared as described in Example 6) in tetrahydrofuran (20.0 mL) under an atmosphere of nitrogen, cooled with dry ice/acetone, was slowly added n-Butyllithium (10.0 M in hexane, 0.467 mL). After 60 minutes, methyl chloroformate (0.394 mL, 5.1 mmol) was added to the reaction. After another hour, the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give the crude compound as a light yellow solid that was used directly in the next step.
Step 2 - Preparation of 1 H-Pyrrolo[2,3-b]pyridine carboxylic acid methyl ester (532):
[0331] To l-Triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine carboxylic acid methyl ester (531, 0.950 g, 2.9 mmol) in tetrahydrofuran (20.0 mL) was added tetrabutyl-ammonium fluoride, trihydrate (1.20 g, 3.8 mmol). The reaction was stirred at room temperature for 10 minutes, The reaction was. concentrated and purified with silica gel column chromatography eluting with 4% methanol in methylene chloride to give the compound as a white solid (532,300 mg, 60%). MS(ESI) [M+1T]+ = 177.2.
Step 3 Preparation 0f3-[2,6-difluoro (propane-l-sulfonylamino)-phenyl]-hydroxy-methyl-lHpyrrolo[2,3-b]pyridine carboxylic acid methyl ester (P-1545):
[0332] To lH-Pyrrolo[2,3-b]pyridine carboxylic acid methyl ester (532, 155.0 mg, 0.88 mmol) in methanol (15.0 mL) were added propane sulfonic acid (2,4-difluoro formyl-phenyl)-amide (73,
260,0 mg, 0.99 mmol, prepared as described in Example 7) and potassium hydroxide (859 mg, 15.3 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight.
The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound as white solid (P1545, 110 mg, 28%). MS(ESI) [Μ+Ηψ = 440.2.
Step 4 - Preparation of 3-[2,6-difluoro (propane-l-sulfonylamino)-benzoyl]-lH-pyrrolo[2,3b]pyridine carboxylic acid methyl ester (P-1552):
[0333] To 3-[2,6-difluoro (propane-l -sulfonylamino)-phenyl]-hydroxy-methyl-l H-pyrrolo [2,3b]pyridine carboxylic acid methyl ester (P-1545,100.0 mg, 0.23 mmol) in tetrahydrofuran (10 mL) was added Dess-Martin periodinane (107 mg, 2.5 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction mixture was concentrated with silica gel and then purified with silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound as white solid (P-1552, 80 mg, 80%). MS(ESI) [M+lT]+ = 438.2.
Step 5 - Preparation of 3-(2,6-difluoro (propane-l-sulfonylamino)-benzoyl]-lH-pyrrolo[2,3b]pyridine carboxylic acid (P-1559):
[0334] To 3-[2,6-diiIuoro (propane-l-sulfonylamino)-benzoyl]-lH-pyrrolo[2,3-b]pyridine-5carboxylic acid methyl ester (P-1552, 80.0 mg, 0.18 mmol) in tetrahydrofuran (10.0 mL) were added water (3.0 mL) and lithium hydroxide (82 mg, 3.4 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water, acidified with 1 N HC1 to pH around 1, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, filtered, concentrated, and washed with ethyl acetate to give an off-white solid (P-1559, 60 mg, 77%) MS(ESI) [Μ+Ηψ = 424.2;
Step 6: Preparation of3-[2,6-difluoro (propane-l-sulfonylamino)-benzoyl]-lH-pyrrolo[2,3b]pyridine carboxylic acid ethylamide (P-1630):
[0335] To 3-[2,6-difluoro (propane-l-sulfonylamino)-benzoyl]-lH-pyrrolo[2,3-b]pyridine-5carboxylic acid (P-1559, 38.0 mg, 0.090 mmol) in tetrahydrofuran (2.3 mL) was added a solution of ethylamine (2.0 M in tetrahydrofuran, 0.20 mL), bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (80.0 mg, 0.17 mmol) and triethylamine (0.30 mL, 2.2 mmol) under an atmosphere of nitrogen. The reaction mixture was stirred overnight at room temperature. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 40% ethyl acetate in hexane to give the compound as a white solid (P1630, 13.2 mg, 33%). MS(ESI) [M-H4]449.0 &#1470;&#1470;.
Example 26: Synthesis of l-butyl [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin ylmethyl)phenyl]-urea P-1445,
[0336] Compound P-1445 was synthesized in six steps from 5-pyridin yl-lH-py1rolo[2,3 b]pyridine 89 as shown in Scheme 49.
<img file="IL188248A_D0100.tif" />
Step !-Preparation of (3-nitro-phenyl)-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin yl)-methanol (P1399):
[0337] To 3-nitrobenzaldehyde (534, 1.08 g, 7.17 mmol) in methanol (34 mL) was added 5pyridin yl-lH-pyrrolo[2,3-b]pyridine (89, 1.08 g, 5.52 mmol, prepared as described in Example 17) and potassium hydroxide (1.55 g, 27.6 mmol). The reaction was stirred at room temperature for four hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and concentrated. The mixture was purified by silica gel column chromatography eluting with 4% methanol in dichloromethane to provide two different compounds, a white solid (P-1399, R = Η, 1.20 g, 63%) MS(ESI) [M+H4]4 = 347.2, and a light yellow solid (535, R = Me, 0.434 g, 22%).
Step 2 - Preparation of (3-nitro-phenyl)-(5-pyridin yl-!H-pyrrolo[2,3-b]pyridm yl)-methanone (536):
[0338] To (3-nitro-phenyl)-(5-pyridin yl-lH-pyn-olQ[2,3-b]pyridin yl)-methanol (P-1399, R=H, 500 mg, 1.44 mmol) in dimethylformamide (26 mL) was added Dess-Martin periodane (674 mg, 1.59 mmol). The reaction was stirred for one hour and the reaction was poured into water. All solids were filtered and purified by silica gel column chromatography eluting with 3 % methanol in dichloromethane to give the compound (536, 295 mg, 59 %). MS(ESI)[M+H+]+ = 345.2.
Step 3 - Preparation of (3-nitro-phenyl)-[5-pyridin yl-l-(toluene sulfonyl)-lH-pyrrolo[2,3b]pyridin yl)-methanone (537):
[0339] To (3-nitro-phenyl)-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridm yl)-methanone (536,291 mg, 0.85 mmol) in tetrahydrofuran (7 mL) was added 1.5 M of lithium diisopropylamide in cyclohexane (676 μ&#912;, 1.59 mmol) at -78 °C under an atmosphere of nitrogen. After 30 minutes, ptoluenesulfonyl chloride (209 mg, 1.10 mmol) was added in tetrahydrofuran and the reaction was stirred for three hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and concentrated. All solids were filtered and purified by silica gel column chromatography eluting with 60 % ethyl acetate in hexane to give the compound (537, 182 mg, 43 %). MSIES^EM+H4]4 = 499.2.
Step 4 - Preparation of (3-Amino-phenyl)-[5-pyridin yl-l-(toluene sulfonyl)-lH-pyrrolo[2,3b]pyridin yl]-methanone (538):
[0340] To (3-nitro-phenyl)-[5-pyridin-3&#1470;yl-l -(toluene sulfonyl)-lH-pyrrolo[2,3-b]pyridin yl)methanone (537, 180 mg, 0.361 mmol) in methanol (4 mL) was added 10% palladium on carbon (20 mg) and few drops of concentrated aqueous hydrochloric acid. The resulting mixture was stirred under an atmosphere of hydrogen overnight and the catalyst was filtered out through a bed ofcelite. The filtrate was concentrated and purified by silica gel column chromatography eluting with 90 % ethyl acetate in hexane to give the compound (538, 58 mg, 34 %). Μ5(Ε8Ι)[Μ+1Γ]4 = 469.3.
Step 5 - Preparation of l-Butyl 3-[5-pyridm yl-l-(toluene sulfonyl)-lH-pyrrolo[2,3b]pyridine carbonyl]-phenyl-urea (539):
[0341] To (3-Amino-phenyl)-[5-pyridin yl-l-(toluene-4&#1470;sulfonyl)-lH-pyrrolo[2,3-b]pyridin-3yl]-methanone (538, 53 mg, 0.11 mmol) in tetrahydrofuran (1.6 mL) was added 1-isocyanatobutane (12 mg, 0.12 mmol). The reaction was heated at 90 °C overnight and it was concentrated and purified by silica gel column chromatography eluting with 2 % methanol in dichloromethane to give the compound (539, 39 mg, 61%). MSiESBfM+H4]4 = 568.4.
Step 6 — Preparation of l-Butyl [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]urea (P-1445):
[0342] To 1 -ButyI 3-[5-pyridin-3&#1470;yl-l -(toluene sulfonyl)-lH-pyrrolo[2,3-b]pyridine-3carbonyl]-phenyl-urea (539, 33 mg, 0.058 mmol) in tetrahydrofuran (2 mL) was added 1.0 M tetra-nbutylammonium fluoride in tetrahydrofuran (192 μ&#912;) under an atmosphere of nitrogen and the reaction was stirred for three hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and concentrated. All solids were filtered and purified by silica gel column chromatography eluting with 4 % methanol in dichloromethane to give the compound (P-1445, 8 mg, 30 %). MS(ESI)[M+H+]+= 414.3.
Example 27: Synthesis of l-butyI [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin ylmethyl)phenyl]-urea P-1447
[0343] Compound P-1447 was synthesized in five steps from 3-[(3-nitro-phenyl)-methoxy-methyl]5-pyridin yl-lH-pyrrolo[2,3-b]pyridine 535 as shown in Scheme 50.
Scheme 50
<img file="IL188248A_D0101.tif" />
Step 1 - Preparation of3-(3-nitro-benzyl) pyridin yl-lH-pyrrolo[2,3-b]pyridine (P-1402): [0344] To 3-[(3-nitro-phenyl)-methoxy-methyl] pyridin yl-lH-pyrrolo[2,3&#1470;b]pyridine (535, 431 mg, 1.20 mmol, per Example 26, Scheme 49 Step 1) in acetonitrile (130 mL), were added trifluoroacetic acid (18 mL, 230 mmol) and triethylsilane (36 mL, 230 mmol). The reaction was refluxed for three hours. The reaction mixture was poured into sodium bicarbonate solution and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 80% ethyl acetate in hexane to give the compound (P-1402, 323 mg, 82%). MS(ESI)[M+H+]+ = 331.2.
Step 2 - Preparation of3-(3-nitro-benzyl) pyridin yl-l-(toluene sulfonyl)-lH-pyrrolo[2,3b]pyridine (552):
[0345] To 3-(3-nitro-benzyl) pyridin yl-lH-pyrrolo[2,3-b]pyridine (P-1402,141 mg, 0.43 mmol) in Ν,Ν-dimethylformamide (3 mL) was added sodium hydride (60% dispersion in mineral oil, 21 mg, 0.512 mmol) under an atmosphere of nitrogen. After thirty minutes, p-toluenesulfonyl chloride (114 mg, 0.60 mmol) in Ν,Ν-dimethyl-formamide was added and the reaction was stirred for three hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and concentrated. All solids were filtered and purified by silica gel column chromatography eluting with 40 % ethyl acetate in hexane to give the compound (552, 120 mg, 58 %), MS(ESI)[M+HT = 485.25.
Step 3 - Preparation of 3-[5-Pyridm yl-l-(toluene sulfonyl)-lH-pyrrolo[2,3-b]pyridin-3ylmethyl]-phenylamine (553):
[0346] To 3-(3-nitro-benzyl) pyridin yl-l -(toluene sulfonyl)-lH-pyrrolo[2,3-b]pyridine (552, 230 mg, 0.14 mmol) in methanol (5 mL) was added 10% palladium on carbon (10 mg) and few drops of concentrated aqueous hydrochloric acid. The resulting mixture was stirred under an atmosphere of hydrogen overnight, and the catalyst was filtered out through a bed ofcelite. The filtrate was concentrated and purified by silica gel column chromatography eluting with 90 % ethyl acetate in hexane to give the compound (553, 88 mg, 41 %), MSCESIjfM+H4]4 = 455.3.
Step 4 - Preparation of l-butyl 3-[5-pyridin yl-l-(toluene sulfonyl)-lH-pyrrolo[2,3-b]pyridin3-ylmethyl]-phenyl-urea (554):
[0347] To 3-[5-pyridin yl-l-(toluene sulfonyl)-lH-pyrrolo[2,3-b]pyridin ylmethyl]&#1470; phenylamine (553,14 mg, 0.031 mmol) in tetrahydrofuran (0.5 mL) was added 1-isocyanatobutane (3.4 mg, 0.03 mmol). The reaction was heated at 90 °C overnight and was concentrated and purified by silica gel column chromatography eluting with 2 % methanol in dichloromethane to give the compound (554, 7.2 mg, 42 %). MS(ESI)[M+H+]+ = 554.4.
Step 5 — Preparation of l-Butyl [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenyl]urea &-VWT):
[0348] To l-butyl 3-[5-pyridin yl-l-(toluene sulfonyl)-lH-pyrrolo[2,3-b]pyridin-3ylmethyl]-phenyl-urea (554,11 mg, 0.02 mmol) in tetrahydrofuran (0.7 mL) was added 1.0 M tetra-nbutylammonium fluoride in tetrahydrofuran (66 pl) under an atmosphere of nitrogen and the reaction was stirred for three hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate and concentrated. All solids were filtered and purified by silica gel column chromatography eluting with 4 % methanol in dichloromethane to give the compound (P-1447, 2.5 mg, 31 %). MS(ESI)[M+H+]+ = 400.3.
[0349] 1 -Cyclopentyl-3 -[3 -(5-pyridin-3 -yl-1 H-pyrrolo [2,3 -b]pyridin-3 -ylmethyl)-phenyl] -urea P1446
<img file="IL188248A_D0102.tif" />
was prepared following the protocol of Scheme 50, substituting 1-isocyanatobutane with isocyanatocyclopentane in Step 4. MS(ESI) [M + H4]4 = 412.4.
Example 28: Synthesis of 3-[3-chloro (4-chloro-benzyloxy)-benzyl]-lB[-pyrrolo[2,3-b]pyridine P-1449.
[0350] Compound P-1449 was synthesized in three steps from 3-chloro hydroxy-benzaldehyde 556 as shown in Scheme 51.
Scheme 51
<img file="IL188248A_D0103.tif" />
Step 1 — Preparation of 3-chloro (4-chloro-benzyloxy)-benzaldehyde (558):
[0351] To acetonitrile (15.0 mL) were added 3-chloro hydroxy-benzaldehyde (556, 0.6 g, 4 mmol), 4-chlorobenzyl bromide (557,1.2 g, 6 mmol), and potassium carbonate (0.9 g, 7 mmol) The reaction was heated to 150 °C for 10 minutes in a CEM Discover microwave instrument. The reaction was poured into water, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate: hexanes) (558, 0.85 g, 76%).
Step 2 - Preparation of 3-[3-chloro (4-chloro-benzyloxy)-phenyl]-methoxy-methyl-lH-pyrrolo[2,3bjpyridine (559):
[0352] 1H-Pyrrolo[2,3&#1470;b]pyridine (94, 0.3 g, 2.8 mmol) was mixed with 3-chloro (4-chlorobenzyloxy)-benzaldehyde (558, 0.8 g, 3 mmol), potassium hydroxide (0.9 g, 17 mmol) and methanol (90.0 mL). The reaction was heated to 50 °C under an atmosphere of nitrogen for six days. After neutralization with 6N hydrochloric acid the reaction was poured into water, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate: hexanes) to give a yellow solid (559, 0.6 g, 41 %). MS(ESI) [M +1^]+= 413.2, 415.2 [M411.1, 413.1.
Step 3 - Preparation of3-[3-chloro (4-chloro-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P1449):
[0353] 3-[3-Chloro (4-chloro-benzyloxy)-phenyl]-methoxy-methyI-lH-pyrrolo[2,3-b]pyridine (559, 0.2 g, 0.6 mmol) was mixed with trifluoroacetic acid (0.226 mL, 3 mmol), triethylsilane (0.4 mL, 3 mmol) and acetonitrile (5 mL). The reaction was heated at 50 °C and stirred for two days. The reaction was concentrated. The residue was diluted with ethyl acetate and neutralized with 2M aqueous sodium hydroxide. The reaction was poured into water, extracted with ethyl acetate, and washed with brine. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography (ethyl acetate: hexanes) to give a yellow solid (P-1449, 0.0744 g, 33%). MS(ESI) [M + H4]4385.2 ,383.2 &#1470;.
[0354] Additional compounds were prepared following the protocol of Scheme 51, replacing 3chloro hydroxy-benzaldehyde 556 with an appropriate aldehyde and optionally replacing 4chlorobenzyl bromide 557 with an appropriate benzyl halide in Step 1, and optionally replacing 1Hpyrrolo[2,3-b]pyridine 94 with an appropriate azaindole in Step 2. The following compounds were made following this procedure:
3-[4-(4-chloro-benzyloxy) methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1450),
3-[4-(4-Chloro-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1462), 3-[4-(4-Chloro-benzyloxy) fluoro methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1466), 3-[4-(4-Chloro-benzyloxy) ethoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1470), 3-[2-Chloro (4-chloro-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridme (P-1471), 3-[4-(4-Chloro-benzyloxy)-3־trifluoromethoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1487), 3-[4-(4-Chloro-benzyloxy) methoxy-benzyl] methoxy-lH-pyrrolo[2,3-b]pyridine (P-1531), 5-Chloro [4-(4-chloro-benzyloxy) methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1532), 3-[4-(4-Chloro fluoro-benzyloxy) methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1544), 3-[4-(2,4-Dichloro-benzyloxy) methoxy-benzyl]-lH-pyrrolo[2>3-b]pyridine (P-1568), 3-[3-Methoxy (4-methoxy-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1569), 3-[3-Methoxy (2,4,6-trifluoro-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1578), 3-(4-(2,6-Dichloro-benzyloxy) methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1579), and 3-(3Chloro (4-chloro-benzyloxy) methoxy-benzyl]־lH-pynolo[2,3-b]pyridme (P-1616).
The following table indicates the aldehyde (column 2), the benzyl halide (column 3), and the azaindole (column 4) used to afford the target compound (column 5). Column 1 indicates the compound number and column 6 the observed mass.
<td></td><td> Aldehyde</td><td> Benzyl halide</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+hX observed__</td>
<td> P-1450</td><td> H<sub>V</sub>O ג OH</td><td> Br Sexi</td><td> H</td><td> 0' 03 M N <sup>Ν</sup> Η</td><td> 379.2 381.2</td>
<td> P-1462</td><td> Hy0 Y OH</td><td> Br Έ1</td><td><sup>IN</sup> H</td><td><sup>Ν</sup> Η</td><td> 349.1 351.2</td>
<td> P-1466</td><td> H0-״ oq^F 1 OH</td><td> Br ''O'ci</td><td> 03 <sup>Π</sup> H</td><td> F r0^°^O־<sup>cl </sup>03 /° Ν</td><td> 397.2 399.2</td>
<td> P-1470</td><td> w OH</td><td> Br kl ^Cl</td><td><sup>1</sup> H</td><td> ΧΥ'ΟΟ'<sup>01</sup>־<sup></sup>03 _7°</td><td> 393.2 395.2</td>
<td> P-1471</td><td> H^O ׳$ OH</td><td> Br</td><td> 03 <sup>1</sup> H</td><td> ο ζΟ <sup>ϋ</sup> Vy'zx Qz</td><td> 383.1 385.1</td>
<td> P-1487</td><td> HyO Xo <sup>0H</sup>k</td><td> Br 3</td><td> 03 ' H</td><td> ΧΖΜΙΖ<sup>1</sup> Οζ <sup>/0 c</sup>F3 ΙΝ <sub>״</sub></td><td> 433.2 435.2</td>
<td> P-1531</td><td> HyO y3 OH 1</td><td> Br El</td><td> H</td><td> Ο־' 303 <sup>Μ</sup> CI</td><td> 409.2</td>
<td> P-1532</td><td> Hy° T^o OH 1</td><td> Br ^o<sub>ct</sub></td><td> 33ר</td><td> ־0 <sup>Η</sup> CI</td><td> 413.1</td>
<td> P-1544</td><td> HyO ס! OH 1</td><td> Br ΎΧ <sub>F</sub>-^CI</td><td> 03 74 n Η</td><td> ס-׳־גג. /“X-Ci rXx ^־VJ w <sup>/0 F</sup> ' H</td><td> 397.2</td>
<td></td><td> Aldehyde</td><td> Benzyl halide</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1568</td><td> HyO VO OH 1</td><td> Cl Cl-^^CI</td><td> H</td><td> XT Mj ( Xj / Cl N N ׳ H</td><td> 413.1 415.1 416.2</td>
<td> P-1569</td><td> HyO OH 1</td><td> Cl</td><td> 00 H</td><td> A Q o—</td><td> 375.2</td>
<td> P-1578</td><td> HyO TO OH 1</td><td> Br F A,</td><td> 03 H</td><td> R iAa 0 / h / f H</td><td> 399.2 397.1 ([M-HX)</td>
<td> P-1579</td><td> z <sup>1</sup>30 —o</td><td> Br Cl Cl</td><td> 03 H</td><td> CL vrX iiVA 0 / (L Xj / ci nN ' H</td><td> 413.2 415.2 416.2 ([M-H<sup>4</sup>]־)</td>
<td> P-1616</td><td> t-y° XL cr T 0 OH 1</td><td> Br</td><td> 03 nn h</td><td> Cl rM <sup>07</sup>׳C3<sup>CI</sup> 03 ° N N</td><td> 413.1</td>
Example 29: Synthesis of 3-(4-benzyloxy methoxy-benzyl)-lH-pyrrolo[2,3-b]pyridine P-1613. [0355] Compound P-1613 was synthesized in two steps from 4-benzyloxy methoxybenzaldehyde 564 as shown in Scheme 53.
Scheme 53
<img file="IL188248A_D0104.tif" />
Step I - Preparation of3-[(4-benzyloxy methoxy-phenyl)-methoxy-methyl]-lH-pyrrolo[2,3b]pyridine (565):
[0356] Methanol (125 mL) and potassium hydroxide (4.4 g, 79 mmol) were mixed with 1Hpyrrolo[2,3-b]pyridine (94, 3.1g, 26.6 mmol) and 4-benzyloxy methoxy-benzaldehyde (564, 12,9 g, 53.2 mmol). The reaction was stirred at room temperature for 2 days. The resulting white solid was filtered and washed with water. Crude material was carried forward without further purification.
Step 2 - Preparation of3-(4-benzyloxy methoxy-benzyl)-lH-pyrrolo[2,3-b]pyridine (P-1613): [0357] 3-[(4-Benzyloxy methoxy-phenyl)-methoxy-methyl]-lH-pyrrolo[2,3-b]pyridine (565, 0.9g, 2.4 mmol) and acetonitrile (50 mL) were mixed with trifluoroacetic acid (0.360 mL, 4.7 mmol) and triethylsilane (0.746 mL, 4.7 mmol). The reaction was heated at 80 °C and stirred overnight. The reaction was concentrated. The mixture was extracted with ethyl acetate and saturated sodium bicarbonate. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The desired compound was isolated by silica gel column chromatography to give the compound (P1613, 0.454 g 54.8%). MS(ESI) [M + lT]+= 345.3.
Example 30: Synthesis of l-[3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyI)-phenyI]-3butyl-urea P-1596.
[0358] Compound P-1596 was synthesized in one step from 5-bromo-lH-pyrrolo[2,3-b]pyridine 67 as shown in Scheme 55.
Scheme 55
<img file="IL188248A_D0105.tif" />
<img file="IL188248A_D0106.tif" />
Step 1 — Preparation of l-[3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] butyl-u.rea (P-1596):
[0359] To aluminum trichloride (3.67 g, 0.0275 mol) in dichloromethane (100 mL, 2 mol) under an atmosphere of nitrogen was added 5-bromo azaindole (67, 1.08 g, 0.00548 mol) at room temperature. After one hour, 3-isocyanato-benzoyl chloride (584, 5.00 g, 0.0275 mol) was added under an atmosphere of nitrogen at room temperature. The resulting mixture was stirred over night at room temperature. 1-Butanamine (585, 54 mL, 0.54 mol) was added carefully. All solvents were removed. The residue was purified by silica gel column chromatography to give the compound (P1596, 172 mg, 8%). MS(ESI) [M-H+]- = 413.1, 415.0.
[0360] Additional compounds were prepared following the protocol of Scheme 55, replacing 1 butanamine 585 with an appropriate amine and optionally replacing 5-bromo azaindole 67 with 5pyridin yl-lH-pyrrolo[2,3&#1470;b]pyridine 89 (prepared as described in Example 17). The following compounds were made following this procedure:
l-Benzyl [35)&#1470;-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1553), l-Benzyl [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1554), l-(2-Methoxy-ethyl) [3-(5-pyridin-3&#1470;yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1566), and l-Phenyl [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1591). The following table indicates the amine (column 2) and the azaindole (column 3) used to afford the target compound (column 4). The compound number is provided in column 1 and the observed mass in column 5.
<td></td><td> Amine</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+HA observed</td>
<td> P-1553</td><td></td><td> β m</td><td> yA pQ A</td><td> 447.0 449.1</td>
<td> P-1554</td><td> nh<sub>2 </sub>ό</td><td> 7</td><td> NA/νί 1mA J Ip H d <sup>k</sup>N N H H</td><td> 448,3</td>
<td> P-1566</td><td> h<sub>2</sub>n׳A O-X</td><td> Yp</td><td> \ \ ZT Q</td><td> 416.3</td>
<td> P-1591</td><td> (ZH KJ</td><td> Λν</td><td> 0. /P ΎΥρ η nAY Tp H</td><td> 434.3</td>
Example 31: Synthesis of l-ButyI 3-[5-(l-methyUH-pyrazol yI)-lH-pyrrolo[2j3-b]pyridine3-carbonyl]-phenyI-urea P-1880
[0361] Compound P-1880 was synthesized in one step from l-[3-(5-bromo-lH-pyrrolo[2,3b]pyridine carbonyl)-phenyl] butyl-urea P-1596 as shown in Scheme 56.
Scheme 56
<img file="IL188248A_D0107.tif" />
Step !-Preparation of!-Butyl 3-[5-(l-methyl-lH-pyrazol yl)-lH-pyrrolo[2,3-b]pyridine-3carbonyl]-phenyl-urea (P-1880):
(0362] In a microwave tube, 1 -[3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] butylurea (P-1596, 0.077 g, 0.00018 mol, prepared as described in Example 47), l-Methyl (4,4,5,5tetramethyl-[l,3,2]dioxaborolan yl)-lH-pyrazole (0.0964 g, 0.000464 mol), and Tetrak1s(triphenylphosphine)palladium(0) (0.011 g, 0.0000093 mol) were mixed in 1.00 M of potassium carbonate in water (1.2 mL), acetonitrile (2.0 mL, 0.037 mol), and tetrahydrofuran (1.0 mL, 0.012 mol). The resulting mixture was heated at 100 °C in the microwave for 20 minutes, then at 120 °C for 10 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic, layer was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography to give the compound (P-1880, 52 mg, 67%). MS(ESI)[M+HT = 417.4.
Example 32: Synthesis of l-Butyl [2&#1470;chlo1O (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea P-1828
[0363] Compound P-1828 was synthesized in two steps from 3-amino chlorobenzoic acid 586 as shown in Scheme 57.
Scheme 57
<img file="IL188248A_D0108.tif" />
Step 1 - Preparation of-(3-Butyl-ureido) chloro-benzoic acid (587):
[0364] To Ν,Ν-diisopropylamine (1.72 mL, 0.0122 mol) in tetrahydrofuran (12 mL, 0.14 mol), was added 1.6 M n-butyllithium in hexane (7.6 mL) at -78 °C under an atmosphere of nitrogen. After 30 minutes, 3-amino chlorobenzoic acid (586, 1.00 g, 0.00583 mol) was added. After another 30 minutes, l-isocyanatobutane (2.60 mL, 0.0233 mol) was added at -78 °C under an atmosphere of nitrogen and allowed to stir for two hours. The reaction mixture was warmed up to room temperature and stirred at room temperature for 30 minutes. The reaction was quenched with IM HCI (aqueous) solution and extracted with ethyl acetate twice. The combined organic layers were washed with brine, dried over anhydrous magnesium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with dichloromethane:methanol:acetic acid 40:2:1 to give the compound as an off-white solid (587,147 mg, 9%).
Step 2 - Preparation ofl-Butyl [2-chloro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea (P-1828):
[0365] To 3-(3-Butyl-ureido) chloro-benzoic acid (587, 103 mg, 0.000380 mol) was added dichloromethane (10 mL, 0.2 mol) followed by thionyl chloride (110 pL, 0.0015 mol) and 1 drop of dimethylformamide to give a suspension. The reaction was stirred at room temperature for 2 hours. Solid material was still present in the reaction mixture, so tetrahydrofuran (0.5 mL, 0.006 mol) was added and continued stirring at room temperature. The reaction became a clear solution after 2 hours, then stirred for another hour. All volatiles were removed under vacuum and the residue stripped from toluene, twice. The solid was then dried under high vacuum for 60 minutes and dissolved in dichloromethane (5 mL). This was added to 5-(pyridin yl)-lH&#1470;pyrrolo[2,3-b]pyridine (89, 0.074 g, 0.00038 mol, prepared as described in Example 17) which had been treated with aluminum trichloride (0.25 g, 0.0019 mol) in dichloromethane (10 mL) for 1 hour. The reaction was stirred at room temperature overnight, then quenched with methanol (5 mL). The resulting solution was extracted with ethyl acetate and water with added saturated sodium bicarbonate to adjust pH ~ 8. The organic layer was washed with sodium bicarbonate and brine and dried over magnesium sulfate and filtered. The organic layer was concentrated and purified by silica gel column chromatography eluting with 2% methanol in dichloromethane followed by 5% methanol in dichloromethane to give the compound as a white solid (P-1828, 45 mg, 26%). MS (ESI) [M+lT]+= 448.3.
[0366] Additional compounds were prepared following the protocol of Scheme 57, replacing 3amino chlorobenzoic acid 586 with an appropriate carboxylic acid and optionally replacing 1isocyanatobutane with an appropriate isocyanate in Step 1 and optionally replacing 5-(pyridin yl)lH-pyrrolo[2,3-b]pyridme 89 with an appropriate substituted 7-azaindole (see Example 17) in Step 2. The following compounds were made following this procedure:
l-Butyl [2-methyl (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea(P1742),
3-Butyl-l-methyl-l-[2-methyl (5-pyridin yl-lH- pyrrolo[2,3-b]pyridine carbonyl)-phenyl]urea (P-1855),
[3-(5 -Bromo-1 H-pyrrolo [2,3 -b]pyridine carbonyl) fluoro-phenyl]-urea (P-1570), [4-Fluoro5)-3&#1470;-phenyl-lH-pyrrolo[2, 3-b]pyridine carbonyl)-phenyl]-urea (P-1589), 3-{3-[5-(3-Butyl-ureido) fluoro-benzoyl]-lH-pyrT010[2,3-b]pyridin yl}-benzamide (P-1621),
-Butyl {4-fluoro [5-(3-methane sulfonyl-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]phenyl}-urea (P-1627), and l-[3-(5-Bromo-lH-pyrrolo[2,3-b]pyridine carbonyl) fluoro-phenyl}-3 -butyl-urea (P-1637), The following table indicates the carboxylic acid (column 2), the isocyanate (column 3), and the azaindole (column 4) used to afford the target compound (column 5), Column 1 indicates the compound number and column 6 the observed mass.
<td></td><td> Acid</td><td> Isocyanate</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1742</td><td> 0 HcZq nh<sub>2</sub></td><td><sub>Z</sub>C׳ 0</td><td> H</td><td> A °aO ° tfo η NH N N</td><td> 428.3</td>
<td> P-1855</td><td> 0 hL</td><td> ׳C, ׳0</td><td> H</td><td> A <sup>0</sup>CO <sup>0</sup> (AS ' / NH N N ' C/</td><td> 442.3</td>
<td> P-1570</td><td> 0 F <sup>Ηο</sup>Ρφ nh<sub>2</sub></td><td> HN=C=O</td><td> Yv> H</td><td> E — 9 Vo η NH<sub>2</sub> nN H</td><td> 377.1 379.1</td>
<td> P-1589</td><td> 0 F A nh<sub>2</sub></td><td> HN=C=O</td><td> pN H</td><td> *Π□ η*<sup>νη</sup>־ N N</td><td> 375.2</td>
<td> P-1621</td><td> 0 F »A nh<sub>2</sub></td><td> 0</td><td> ο^νη<sub>2</sub><sup>1</sup>־N'n Η</td><td> CM >־/5</td><td> 474.3</td>
<td> P-1627</td><td> 0 F <sup>HO</sup>P nh<sub>2</sub></td><td> J <sub>Z</sub>C׳ 0</td><td> 0 0<sup>:</sup>s— H</td><td> 0 ״s- Ffc־O oV AO nA , Vn <sup>h</sup> ,<sup>nh</sup></td><td> 509.2</td>
<td> P-1637</td><td> 0 F <sup>ΗΟ</sup>ψ nh<sub>2</sub></td><td> ? N, ׳<sub>Z</sub>C 0</td><td> CP H</td><td> Ο W <sup>H</sup><sub>(</sub><sup>NH</sup>, H</td><td> 433.1 435.1 _</td>
Example 33: Synthesis of l-Butyl [4-fluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea (P-1534):
[0367] Compound P-1534 was synthesized in two steps from 5-(3-butylureido) fluorobenzoic acid 588 (prepared from 3-fluoro aminobenzoic acid and 1-isocyanatobutane following the protocol described in Step 1 of Scheme 57, Example 32) and 5-.bromo azaindole 67 as shown in Scheme 58.
Scheme 58
<img file="IL188248A_D0109.tif" />
Step 2
<img file="IL188248A_D0110.tif" />
Step 1 - Preparation of l-[3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl) fluoro-phenyl]-3 butyl-urea (P-1637):
[0368] To aluminum trichloride (0.524 g, 0.00393 mol) and dichloromethane (20 mL, 0.3 mol) under an atmosphere of nitrogen was added 5-bromo azaindole (67, 0.155 g, 0.000787 mol) in dichloromethane, To 5-(3-butylureido) fluorobenzoic acid (588, 0.200 g, 0.000787 mol) was added 4 mL of dichloromethane (4 mL) followed by thionyl chloride (69 pL, 0.00094 mol) and a drop of Ν,Ν-dimethylfonnamide. After 1 hour, the reaction remained a suspension so additional thionyl chloride was added along with tetrahydrofuran. The reaction remained a suspension, so was placed in a 50 °C oil bath. After another hour, the reaction was still a suspension, and so was left to react at 50 °C overnight. The reaction had become a clear solution. All volatiles were removed under vacuum, then the residue dissolved in dichloromethane and added to the 5-bromo azaindole and aluminum trichloride suspension. The reaction was allowed to stir at room temperature for 4.5 hours, followed by the addition of water and extraction with ethyl acetate. The organic layer was dried over magnesium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with a gradient of methanol (0 to 10%) in dichloromethane to give the compound (P-1637, 14 mg, 4%).
Step 2 - Preparation of l-Butyl [4-fluoro (5-pyridin yl-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea (P-1534):
[0369] To l-[3-(5-bromo-lH-pyrrolo[2,3-b]pyridine carbonyl) fluoro-phenyl]-3 -butyl-urea (P1637, 14.0 mg, 0.0000323 mol), 3-pyridylboronic acid (5.96 mg, 0.0000485 mol), and
Tetrakis(triphenylphosphine)palladium(0) (0,820 mg, 7.09E-7 mol) were mixed in 1.00 M potassium carbonate in water (1.00 mL) and acetonitrile (2.00 mL, 0.0383 mol). The resulting mixture was heated at 120 °C in the microwave for 40 minutes. The reaction was extracted with ethyl acetate and water twice, and the combined organic layers were washed with IM sodium bicarbonate followed by brine and the organic layer was dried over magnesium sulfate and filtered. The organic layer was concentrated and purified by reverse phase HPLC (acetonitrile and water with 0.1% fonnic acid) to give the compound as a white solid (P-1637, 8.5 mg, 61%). MS(ESI) [M+rf]+ = 432.3.
[0370] l-Butyl {4-fluoro [5-(3-trifluoromethoxy-phenyl)-lH-pyrrolo[2,3-b]pyridine-3carbonyl]-phenyl }-urea P-1660
<img file="IL188248A_D0111.tif" />
was prepared following the protocol of Scheme 58, replacing 3-Pyridylboronic acid with 3trifluoromethoxy-phenylboronic acid in Step 2. MS(ESI) [M+H^]+ = 515.2.
Example 34: Synthesis of aldehyde reagents for coupling to 7-azaindoles
[0371] Aldehyde compounds for coupling to the 3-position of a 7-azaindole are shown in the following Schemes. 3-Methoxy [4-(4-methyl-piperazin-l-ylmethyl)-benzyloxy]-benzaldehyde 591 was prepared in one Step as shown in Scheme 59.
Scheme 59
<img file="IL188248A_D0112.tif" />
Step 1- Synthesis of3-Methoxy [4-(4-methyl-piperazin-l-ylmethyl)-benzyloxy]-benzaldehyde (591): [0372] To 4-Hydroxy methoxybenzaldehyde (105, 2.1 g, 0.014 mol) in N,N-dimethylformamide (40.0 mL) were added 1,4-bis(bromomethyl)-benzene (589, 4.00 g, 0.0152 mol) and potassium carbonate (5.0 g, 0.036 mol) under an atmosphere of nitrogen. After 12 hours 1-methyl-piperazine (590, 3.8 mL, 0.034 mol) was added to the reaction. After 2 hours, the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with
20% methanol in dichloromethane to give the compound (589,1.2 g, 25.0%). MSQBSI) [M+H4]4 = 355.3.
[0373] 2-Fluoro hydroxy methoxy-benzaldehyde 593 was synthesized in one step from 2-fluoro-4,5-dimethoxy-benzaldehyde 592 as shown in Scheme 60.
Scheme 60
H F
<img file="IL188248A_D0113.tif" />
Step 1
<img file="IL188248A_D0114.tif" />
Step 1 -Synthesis of2-fluoro hydroxy methoxy-benzaldehyde (593):
[0374] To 2-fluoro-4,5-dimethoxy-benzaldehyde (592,1.00 g, 5.43 mol) in dichloromethane (50.0 mL) was added aluminum trichloride (4.34 g, 32.6 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and washed with ethyl acetate and hexane to give a white solid (593, 0.70g, 76.0%).
[0375] 2,5-Difluoro hydroxy-benzaldehyde 597 was synthesized in three steps from 2,5difluorophenol 594 as shown in Scheme 61.
Scheme 61
<img file="IL188248A_D0115.tif" />
Step 1 - Synthesis of 4-bromo-2,5-difluoro-phenol (595):
[0376] To 2,5-difluorophenol (594, 5.50 g, 0.0423 mol) in chloroform (110.0 mL), bromine (2.18 mL, 0.0423 mol) was added slowly. After 3 hours, the reaction was poured into a solution of sodium thiosulfate and extracted with ethyl acetate. The organic layer was dried over sodium sulfate, concentrated and purified with silica gel column chromatography eluting with 20% ethyl acetate in hexane to give a colorless oil (595, 6.20 g, 70.2%).
Step 2 - (4-Bromo-2,5-difluoro-phenoxy)-tert-butyl-dimethyl-silane (596):
[0377] To 4-bromo2,5&#1470;-difluoro-phenol (595, 3.50 g, 0.0167 mol) inΝ,Ν-dimethylformamide (50.0 mL) were added tert-butyldimethylsilyl chloride (3.83 g, 0.0254 mol) and ΙΗ-imidazole (6.00 g,
0.0529 mol). The reaction was stirred at room temperature overnight, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound (596, 3.0 g, 55.4%).
Step 3 - 2,5-Difluoro hydroxy-benzaldehyde (597):
[0378] To (4-bromo-2,5-difluoro-phenoxy)-tert-butyl-dimethyl-siIane (596, 3.00 g, 9.28 mmol) in tetrahydrofuran (37.5 mL), under an atmosphere of nitrogen at -78 °C, n-butyllithium (3.90 mL, 2.50 M in hexane) was added slowly. After 30 minutes, Ν,Ν-dimethylformamide (0.825 mL, 0.0106 mol) was added to the reaction. One hour later, the reaction was allowed to come to room temperature. The reaction was poured into water and 1 N HCI, then extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound as an off-white solid (597, 0.86 g, 59.0%).
[0379] 4-(4-Chloro-benzyloxy) fluoro-benzaldehyde 599 was synthesized in one step from 3fluoro hydroxy-benzaldehyde 598 as shown in Scheme 62.
Scheme 62
<img file="IL188248A_D0116.tif" />
Step 1 - Synthesis of 4-(4-chloro-benzyloxy) fluoro-benzaldehyde (599):
[0380] To 3-fluoro hydroxy-benzaldehyde (598, 0.800 g, 5.71 mmol) in N,N-dimethylfonnamide (50.0 mL) was added sodium hydride (260.0 mg, 60% in mineral oil, 6.50 mmol). After 15 minutes, 4-chlorobenzyl bromide (557, 1.29 g, 6.28 mmol) was added to the reaction mixture. The reaction was stirred at 80 °C for 5 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound (599, 1.3 g, 86.0%).
[0381] Additional aldehydes were prepared using the protocol of Scheme 62, replacing either 4chlorobenzyl bromide 557 with a suitable alkylating agent, and/or 3-fluoro hydroxy-benzaldehyde 598 with a suitable aldehyde. The following table indicates the alkylating agent (column 1) and the starting aldehyde (column 2) used to afford the aldehyde (column 3) synthesized following this protocol.
<td> Alkylating agent</td><td> Aldehyde</td><td> Compound</td>
<td> Br. z=\ A_/־<sup>C|</sup></td><td> p— 0 /=7 77 7־OH H</td><td> 77/ y-q /=\ η M 7 71</td>
<td> Br /=^</td><td> O— 0 /=7 77 /OH</td><td> 6 0 ח־ נס</td>
<td> Br. /=\ <sup>Ci=3</sup></td><td> PF3 0 /=7 77 /־־OH</td><td> 7 ο φ ο ־π</td>
<td> Br. z=\ MX<sup>01</sup></td><td> 0 <sup>hJ</sup>5o0</td><td> 1 J 7^־0 ο</td>
<td> F Br. /=7</td><td> 0— 0 /=7 77 /OH</td><td> en Ο 7 ? 1 7</td>
<td> cf<sub>3</sub> Br /=7 7¼<sup>1</sup></td><td> 0— 0. /=/ 77 /oh</td><td> 77 \ף /<sup>CF3</sup> Τ7<sup>Ζ</sup> 70־ /=/ η Μ Μ /01 0—</td>
<td> H <sup>cl</sup>v_(<sup>N</sup>7fA νΆ7</td><td> 0— 0 /=/ 77 /oh</td><td> 77 70־ Ν-Γ7 η Μ 7 1 J ο— Ν־^Χί^</td>
<td> Br 7</td><td> 0 F^x^OH</td><td> Ε ft 77 70 7=\ <sup>Η</sup> χ /ci 0—</td>
<td> Cl Br. /=/ HlX<sup>ci</sup></td><td> 0— 0 /=7 77 /oh</td><td> /<sup>Cl </sup>77 7ρ /־=< <sup>Η</sup> Μ Μ 7C1 0—</td>
<td> H νι-ΑΑ</td><td> F 0 /=( 77 /oh</td><td> Ρκ ΜΜ Η 77 70 Ν-ΤΑ η Μ. Μ J1 \ F Ν7^־</td>
<td> Br^ /=^</td><td> 0 <sup>H</sup>02i<sup>F </sup>F'^^'OH</td><td> R Oy<sub>0</sub> /=\</td>
<td> Br. /=\</td><td> 0 f^^oh</td><td> 77<sup>ζ</sup> 7־/ 0־=\ <sup>Η</sup> ^=7 Μ 701 0—</td>
<img file="IL188248A_D0117.tif" />
Example 35: Synthesis of [4-(4-chloro-benzyloxy) fluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3yl)-methanone P-1897 and related compounds
[0382] Compound P-1897 was synthesized in two steps from 4-(4-chloro-benzyloxy) fluorobenzaldehyde 599 as shown in Scheme 63.
<img file="IL188248A_D0118.tif" />
Step 1
<img file="IL188248A_D0119.tif" />
Cl
Step 1 — Synthesis of [4-(4-chloro-benzyloxy) fluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanol (P-1895):
[0383] To lH-Py1T010[2,3-b]pyridine (94, 100.0 mg, 0.85 mmol) in methanol (50.0 mL) were added 4-(4-chloro-benzyloxy) fluoro-benzaldehyde (599, 250.0 mg, 0.94 mmol, prepared as described in Example 34) and potassium hydroxide (1.00g, 17.82 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound (P-1895, 55 mg, 17.0%). MS(ESI) [M+H4]4 = 383.3.
Step 2 - Synthesis of [4-(4-chloro-benzyloxy) fluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone (P-1897):
[0384] To [4-(4-chloro-benzyloxy) fluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)-methanol (P1895, 17.7 mg, 0.046 mmol) in tetrahydrofuran (10.0 mL) was added Dess-Martin periodinane (23.5 mg, 0.056 mmol). The reaction was stirred at room temperature for 15 minutes. The reaction was concentrated, then purified with silica gel column chromatography eluting with 50% ethyl acetate in hexane to give a white solid (P-1897, 6.4 mg, 36.3%). MS(ESI) [M+H4]4 = 381.3.
[0385] Additional compounds were prepared using the protocol of Scheme 63, replacing 4 (4chloro-benzyloxy) fluoro&#1470;benzaldehyde 599 with a suitable aldehyde (prepared as described in Example 34), and optionally replacing 1H-Pyrrolo[2,3&#1470;b]pyridine 94 with an appropriate substituted 7-azaindole (see Example 9 or Example 16) in Step 1. The following compounds were made following this procedure:
[4-(4-Chloro-benzyloxy) fluoro methoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)-methanone (P-1845), [4-(4-Chloro trifluoromethyl-benzyloxy) methoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone (P-1850),
[4-(4-Chloro-benzyloxy) fluoro-phenyl]-(1 H-pyrrolo[2,3-b]pyridin yl)-methanone (P-1897), [4-(lH-Benzoimidazol ylmethoxy) fluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone (P-1900), (4-Benzyloxy-2,5-difluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin yl)-methanone (P-1903), [4-( 1 H-Benzoimidazol ylmethoxy) fluoro methoxy-phenyl]-(5-methoxy-1 H-pyrrolo[2,3b]pyridin yl)-methanone (P-1979), [4-(lH-Benzoimidazol ylmethoxy) fluoro methoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3yl)-methanone (P-1982),
[4-( 1 H-Benzoimidazol ylmethoxy)-2,5-difluoro-phenyl]-( 1 H-pyrrolo [2,3-b]pyridin-3 -yl)methanone (P-1987), {4-[2-(2-Bromo-ethoxy)-ethoxy] fluoro methoxy-phenyl}-(5-chloro-lH-pyrrolo[2,3b]pyridin yl)-methanone (P-1988), (5-Chloro-lH-pyrrolo[2,3-b]pyridin yl)-[2,5-difluoro (2-methoxy-ethoxy)-phenyl]methanone (P-1989), and (5-Chloro-lH-pyrrolo[2,3-b]pyridin yl)-[2-fluoro methoxy (2-methoxy-ethoxy)-phenyl]methanone (P-1991).
The following table indicates the aldehyde (column 2) and the azaindole (column 3) used to afford the target compound (column 4). Column 1 indicates the compound number and column 5 the observed mass.
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+HY observed</td>
<td> P-1845</td><td> Cl V</td><td> H</td><td> rvCVVk! 03 Ο ^=/ <sup>9</sup>'N'^'N / Η</td><td> 409.6 [M-lT]־</td>
<td> P-1850</td><td> Cl</td><td> 44־i? H</td><td> 0 _ K=y°\ zta Cda^־<sup>ci</sup><sup>N</sup> H ' CF,</td><td></td>
<td> P-1897</td><td> Cl ¼9 F</td><td> 444 <sup>IN</sup> H</td><td> l/Xci 03 f \=/<sup>Cl </sup>nn H</td><td> 381.3</td>
<td> P-1900</td><td> Q HN^N H F</td><td> 44? <sup>N</sup> H</td><td> Oj~f Oi0׳־ <sup>k</sup>N^N β ח</td><td> 387.4</td>
<td> P-1903</td><td> ¾9 F</td><td> <כל) <sup>n</sup> n</td><td> °Jv (3ך <sub>F</sub> ^-/ ^n^n H</td><td> 363.3 [M-H<sup>4</sup>]־</td>
<td> P-1979</td><td> Q <sub>F</sub> HN<sub>y</sub>N ע<sub>0</sub>_ץ־ס H ^=( 0—</td><td> <ךך ץ H</td><td> WYw / H Π</td><td> 447.4</td>
<td> P-1982</td><td> Q <sub>F</sub> HN^N O־y<sub>0</sub>> H V o—</td><td> 03 H</td><td> n N / h ח</td><td> 417.3</td>
<td> P-1987</td><td> Q <sub>F</sub> hn<sub>v</sub>n °bh-o<sup>J </sup>H ^=( F</td><td> 03 H</td><td> 03 f 0ΧΪ n N h ח</td><td> 405.3</td>
<td> P-1988</td><td><sub>F</sub>X־V-°</td><td> Clx^־^. Ύ j3 <sup>1</sup> H</td><td> ״Jv c<sub>lv%</sub>>Q־ H <sup>B</sup>\ I j3 >° o-/ ^N^N <sup>/</sup><sup>N</sup> H</td><td> 471.2 473.2</td>
<td></td><td> Aldehyde</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1989</td><td> o 1 J i ? A. LL. ΙΐίΥΧ cAx</td><td> SAn H</td><td> 1 cr uurVA oVA<sub>ZT </sub>o o</td><td> 365.2 [M-H<sup>4</sup>]־</td>
<td> P-1991</td><td> ־A w Vo H \=< /° 3</td><td> N H</td><td> E k־\ V0 1X* /° 0- ™ H</td><td> 377.2 [M-H<sup>4</sup>]־</td>
Example 36: Synthesis of 3-(4-BenzyIoxy-2,5-difluoro-benzyl)-lH-pyrrolo[2,3-b]pyridine P-1901
[0386] Compound P-1901 was synthesized in four steps from 4-bromo-2,5-difluoro-phenoI 595 as shown in Scheme 64.
Scheme 64
<img file="IL188248A_D0120.tif" />
Step 1 - Synthesis of l-Benzyloxy bromo-2,5-difluoro-benzene (600):
[0387] To 4-bromo2,5&#1470;-difluoro-phenol (595, 0.90 g, 0.0043 mol, prepared as described in Example 34, Scheme 61) in Ν,Ν-dimethylformamide (30.0 mL) were added sodium hydride (0.21 g, 60% in mineral oil, 0.0052 mol) and benzyl bromide (0.563 mL, 0.00474 mol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% ethyl acetate in hexane to give a white solid (600, 0.84 g, 65.0%).
Step 2 - (4-Benzyloxy-2l5-difluoro-phenyl)-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin yl)methanol (601):
[0388] To l-Benzyloxy bromo-2,5-difluoro-benzene (600, 0.84 g, 2.80 mmol) in tetrahydrofuran (15.0 mL) and ether (15.0 mL), under an atmosphere of nitrogen at-78 °C, n-butyllithium (1.20 mL, 2.50 M in hexane) was added slowly. After 20 minutes, l-Triisopropylsilanyl-lH-pyrrolo[2,3b]pyridine carbaldehyde (96, 0.82 g, 0.0027 mol, prepared as described in Example 18) was added to the reaction. After 20 minutes, the reaction was allowed to warm to room temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified with silica gel column chromatography eluting with 20% ethyl acetate in hexane to a white solid (601, 1.0g, 70.0%). MS(ESI) [M+H4]4523.4 &#1470;.
Step 3 - Synthesis of (4-Benzyloxy-2,5-difluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin yl)-methanol (P1902):
[0389] To (4-Benzyloxy-2,5-difluoro-phenyl)-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin-3yl)-methanol (601,1.00 g, 1.91 mmol) in tetrahydrofuran (15.0 mL) was added tetrabutylammonium fluoride, trihydrate (0.63 g, 2.04 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction was roto-evaporated and purified with silica gel column chromatography eluting with 50% ethyl acetate in hexane to give the compound as a white solid (P-1902, 0,59 g, 84.0%). MS(ESI) [M+H4367.4 = 4[&#1470;.
Step 4-Synthesis of 3-(4-Benzyloxy-2,5-difluoro-benzyl)-lH-pyrrolo[2,3-b]pyridine (P-1901): [0390] To (4-Benzyloxy-2,5-difluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin-3&#1470;yl)-methanol (P-1902, 500.0 mg, 1.37 mmol) in acetonitrile (25.0 mL) were added triethylsilane (2.00 mL, 0.0125 mol) and trifluoroacetic acid (1.00 mL, 0.0130 mol). The reaction was heated to reflux for 2 hours. The reaction was concentrated and purified with silica gel column chromatography eluting with 50% ethyl acetate in hexane to give a white solid (P-1901, 60.0 mg, 94,1%). MS(ESI) [M+H4]4 = 351.4.
[0391] 3-[3-Trifluoromethyl (4-trifluoromethyl-benzyloxy)-benzyl]-lH-pyrrolo[2,3&#1470;b]pyridine
P-1797
<img file="IL188248A_D0121.tif" />
was prepared using the protocol of Scheme 64, substituting 4-bromo-2,5-difluoro-phenol 595 with 4bromo trifIuoroinethyl-phenol (prepared as described in Example 34, Scheme 61, Step 1, substituting 2,5-difluoro-phenol 594 with 2-trifluoromethyl-phenol) and benzyl bromide with 1bromomethyl trifluoromethyl-benzene in Step 1. MS(ESI) [M+H4]4 = 451.
Example 37: Synthesis of 3-[4-(4-chIoro-benzyloxy)-2,5-difh10ro-benzyI]-lH-pyrroIo[2,3b]pyridine P-1974
[0392] Compound P-1974 was synthesized in four steps from 3-(4-benzyloxy-2,5-difluoro-benzyl)lH-pyrrolo[2,3-b]pyridine P-1901 as shown in Scheme 65.
Scheme 65
<img file="IL188248A_D0122.tif" />
Step 1 - Synthesis of 3-(4-Benzyloxy-2,5-difluoro-benzyl)-l-triisopropylsilanyl-lH-pyrrolo[2,3b]pyridine (602):
[0393] To 3-(4-Benzyloxy-2,5-difluoro-benzyl)-lH-pyrrolo[2,3-b]pyridine (P-1901, 560,0 mg, 1.60 mmol, prepared as described in Example 18, Scheme 33) in tetrahydrofuran (28.0 mL) was added sodium hydride (100.0 mg, 60% in mineral oil, 2.50 mmol). After 10 minutes, triisopropylsilyl chloride (0.500 mL, 2.36 mmol) was added to the reaction. After 4 hours, the reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound (602, 0.70 g, 86.1%).
Step 2 - Synthesis of2,5-difuoro (l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin ylmethyl)phenol (603):
[0394] To 3-(4-Benzyloxy2,5&#1470;-difluoro-benzyl)-l -triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (602, 0.70 g, 0.0014 mol) in methanol (30.0 mL) was added 50% palladium hydroxide on carbon (0.1 g) under an atmosphere of hydrogen. The reaction was stirred at room temperature overnight. The reaction was filtered and concentrated to give a colorless oil (603, 0.47 g, 82.0%).
Step 3 - 3-[4-(4-Chloro-benzyloxy)-2,5-difluoro-benzyl]-l-triisopropylsilanyl-lH-pyrrolo[2,3b]pyridine (604):
[0395] To 2,5-difIuoro (l-triisopropylsilanyl-lH&#1470;pyrrolo[2,3-b]pyridin ylmethyl)-phenol (603, 120.0 mg, 0.29 mmol) in Ν,Ν-dimethylformamide (15.0 mL) was added sodium hydride (18.0 mg, 60% in mineral oil, 0.45 mol) under an atmosphere of nitrogen. After 10 minutes, 4-chlorobenzyl bromide (65.1 mg, 0.32 mol) was added to the reaction. The reaction was stirred at 40 °C overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to give the crude compound (604, 0.15 g) that was used directly in the next step.
Step. 4-Synthesisof3-[4-(4-chloro-benzyloxy)-2,5-difluoro-benzyl]-lH-pyrrolo[2,3-b]pyridine (P1974):
[0396] To 3-[4-(4-chloro-benzyloxy)-2,5-difluoro-benzyl]-l-triisopropylsilanyl-lH-py1rolo[2,3bjpyridine (604, 0.150 g, 0.28 mmol) in tetrahydrofuran (10.0 mL.) was added tetra-n-butylammonium fluoride (80.0 mg, 0.31 mmol). After 10 minutes, the reaction was concentrated and purified by silica gel column chromatography eluting with 50% ethyl acetate in hexane to give the compound as a white solid (P-1974, 30.8 mg, 28.9%). MS(ESI) [M+lT]+= 385.3.
[0397] 2-(2,5-Difluoro (lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenoxymethyl]-lHbenzoimidazole P-1975
F was prepared using the protocol of Scheme 65, substituting 4-chlorobenzyl bromide with 2chloromethyl-IH-benzoimidazole in step 3. MS(ESI) [M+Aj+ = 391.3.
Example 38: Synthesis of l-(4-Butoxy-phenyI) {3-[5-(4-fluoro-phenyl)-lH-pyrroIo[2,3b] pyridine carbonyl] -phenyl}-urea P-1754
[0398] Compound P-1754 was synthesized in three steps from 5-(4-fluorophenyl)-lH-pyrrolo[2,3bjpyridine 605 as shown in Scheme 66.
Scheme 66
<img file="IL188248A_D0123.tif" />
Step !-Preparation of (3-chloro-phenyl)-[5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridin yl]methanone (606):
[0399] To 5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridine (605, 530 mg, 2.5 mmol, prepared as described in Example 23) dissolved in 20 mL of dioxane was added 3-nitrobenzaldehyde (534, 758 mg, 5 mmol) and potassium hydroxide (4 mL of 2.5M aqueous). The vial was shaken on an orbital shaker for 16 hrs and the dioxane was removed under reduced pressure. The residue was partitioned between ethyl acetate and water. The aqueous layer was neutralized with the addition of IM HCI. The organic layer was washed with brine, dried over magnesium sulfate and concentrated under reduced pressure to give yellow-orange oil (1.5g). The crude material was dissolved in dichloromethane (150 mL) and chilled to 0° C. With vigorous stirring, pyridinium chlorochromate (3.0 g, 14 mmol) was added slowly, maintaining the solution temperature at 0° C. After complete addition the solution was allowed to stir at ambient temperature for 1 hour. The resulting dark brown/black solution was diluted with chloroform and passed through a plug of silica. Elution with methanol gave 1.5 g of crude 606 that was carried on to the next step without further purification.
Step 2 - Preparation of (3-Amino-phenyl)-[5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridin ylJmethanone (607):
[0400] Crude (3-chloro-phenyl)-[5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridin yl]-methanone (606,1.5 g) was dissolved in a minimal amount of methanol (-5 mL) and Pd/C (5%, -10 mg) was added. The reaction mixture was shaken on a Parr shaker under 70 psi H2 overnight. The reaction mixture was filtered through Celite® and concentrated under reduced pressure to give 1.4 g of crude 607 that was carried on to the next step without further purification.
Step 3 - Preparation of l-(4-Butoxy-phenyl) {3-[5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridtne-3carbonyl]-phenyl}-urea (P-1754):
[0401] To a solution of- (3-Amino-phenyl)-[5-(4-iluoro-phenyl)-lH-pyrrolo[2,3-b]pyridin yl]methanone (607, 7.5 mg) in anhydrous pyridine (200 pL) was added neat l-butoxy isocyanato benzene (608, 1.6 mg) and the reaction mixture was stirred at ambient temperature for 2 hours. The reaction mixture was concentrated under reduced pressure and the residue was dissolved in DMSO (200 pL) and purified using reverse phase HPLC with an acetonitrile/water gradient. MS(ESI) [M+H*3+= 523.5.
[0402] Additional compounds were prepared following the protocol of Scheme 66, optionally substituting 5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridine 605 with a suitable azaindole in Step 1 and/or optionally substituting l-butoxy isocyanato-benzene 608 with a suitable isocyanate in Step 3. Azaindoles were purchased or prepared as described in Examples 9 or 17. The following compounds were prepared by this procedure:
l-(2-Methoxy-ethyl) [3-(5-pyridin yl-lH&#1470;pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1566), l-Phenyl [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1591),
-Phenyl-33]&#1470;-(l H-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1703), l-(4-Fluoro-phenyI) [3-(lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1704), l-(4-Methoxy-phenyl) [3-(lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1705),
-(3,4-Difluoro-phenyl)-3 -[3-( 1 H-pyTrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1706),
-(3 -Methoxy-phenyl)-3 -[3 -(1 H-pyrrolo [2,3 -b]pyridine-3 -carbonyl)-phenyl]-urea (P-1707),
1-(3,4-Dimethoxy-phenyl) [3-(lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1708), l-(4-Chloro-phenyl) [3-(lH-pynOlo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1709), l-(3-Chloro-phenyl) [3-(lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1710), l-(4-Chloro trifluoromethyl-phenyl) [3-(lH-pyrrolo[23&#1470;-b]pyridine carbonyl)-phenyl]-urea (P-1711),
-(2-Chloro trifluoromethyl-phenyl)-3 -[3 -(1 H-pyrrolo [2,3 -b]pyridine carbonyl)-phenyl] -urea (P-1712),
-(2-Chl oro tri fluoromethyl -phenyl)-3 -[3 -(1 H-pyrrolo [2,3 -b]pyridine carbonyl)-phenyl]-urea (P-1713), l-(2-Fluoro trifluoromethyl-phenyl) [3-(lH-py1Tolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1714), l-(4-Butoxy-phenyl) [3-(lH-pyrrolo[2,3-b]pyridme carbonyl)-phenyl]-urea (P-1715),
-(3 -Fluoro-phenyl)-3 -[3 -(1 H-pyrrolo [2,3 -b]pyridine carbonyl)-phenyl] -urea (P-1716), l3]&#1470;-(lH-Pyrrolo[2,3-b]pyridine carbonyl)-phenyl] (4-trifiuoromethyl-phenyl)-urea (P-1717), 1 -[3-(lH-PynOlo[2,3-b]pyridine carbonyl)-phenyl] p-tolyl-urea (P-1718),
-[3-(lH-Pyrrolo[2,3-b]pyridine carbonyl)-phenyl] m-tolyl-urea (P-1719),
-[3 -(1 H-Pyrrolo [2,3 -b]pyridine-3 -carbonyl)-phenyl] -3 -o-tolyl-urea (P-1720), l-(4-Methoxy-phenyl) [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)&#1470;phenyl]-urea (P-1723),
1-(3,4-Difluoro-phenyl) [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridme carbonyl)-pl1enyl]-urea (P-1724),
1-(3,4-Dimethoxy-phenyl) [3-(5-pyridin yl-lH-pynolo[2,3-b]pyridine carbonyl)-pl1enyl]urea (P-1725),
E(3-Chloro-phenyl) [3-(5-pyridin yl-lH-pyn&#1470;olo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1726), l-(2-Chloro trifluoromethyl-phenyl) [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridme-3carbonyl)-phenyl]-urea (P-1727), l-(2-Fluoro trifluoromethyl-phenyl) [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea (P-1728), l-(4-Butoxy-phenyl) [3-(5-pyridin yl-IH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1729), l-(3-Fluoro-phenyl) [3-(5-pyridin yl-lH&#1470;pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1730), l-[3-(5-Pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] (4-tri fluoromethylphenyl)-urea (P-1731), l-(2-Chloro trifluoromethyl-phenyl) [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea (P-1732), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] phenyl-urea (P-1733), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] (4-methoxy-phenyl)-urea (P-1734), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] (3,4-difluoro-phenyl)-urea (P-1735), l3)&#1470;-Chloro-phenyl) [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine-3&#1470;carbonyl)-phenyl]-urea (P-1736), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] (4-chloro trifluoromethylphenyl)-urea (P-1737), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] (2-chloro trifluoromethylphenyl)-urea (P-1738),
-[3-(5-Chloro-1 H-pyrrolo[2,3-b]pyridme carbonyl)-phenyl] (2-chloro trifluoromethylphenyl)-urea (P-1739), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] (2-fluoro trifluorometl1ylphenyl)-urea (P-1740), l-(4-Butoxy-phenyl) [3-(5-cl11oro-lH-pyrrolo[2,3-b]pyridme carbonyl)-phenyl]-urea (P-1741), l-[3-(lH-Pyrrolo[2,3-b]pyridine carbonyl)-phenyl] (3-trifluoromethyl-phenyl)-urea (P-1746), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] (3-trifluoromethyl-phenyl)-urea (P-1747), l-(4-Fluoro-phenyl) [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1748), l-(3-Methoxy-phenyl) [3-(5-pyridin yl-lH-pynOlo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1749), l4)&#1470;-Chloro-phenyl) [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1750), l-(4-Chloro trifluoromethyl-phenyl) [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea (P-1751), l-(2-Chloro trifluoromethyl-phenyl) {3-[5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridme-3carbonyl]-phenyl)-urea (P-1752), l-(2-Chloro trifluoromethyl-phenyl) {3-[5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridine-3carbonyl]-phenyl}-urea (P-1753), l-(4-Butoxy-phenyl) {3-[5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-phenyl)urea (P-1754),
-[3 -(5 -Pyridin-3 -yl-1 H-pyrrolo[2,3-b]pyridine-3 -carbonyl)-phenyl] -3 -(3 -trifluoromethylphenyl)-urea (P-1755), l-[3-(5-Pyridin yl-lH-pynolo[2,3-b]pyridme carbonyl)-phenyl] p-tolyl-urea (P-1756), l-[3-(5-Pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] m-tolyl-urea (P-1757), l-{3-[5-(4-Fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-phenyl} m-tolyl-urea (P-1758), l-[3-(5-PyTidin yl-lH-pyrrolo[2,3-b]pyridme carbonyl)-phenyl] o-tolyl-urea (P-1759), 1 -Pyridin yl-3 - [3-(1 H-pyrrolo [2,3 -b]pyridine-3 -carbonyl)-phenyl] -urea (P-1760), l-(2-Methoxy-ethyl) [3-(lH-pyrrolo[2,3-b]pyridme carbonyl)-phenyl]-urea (P-1761), l-(3-Methoxy trifluoromethyl-phenyl) [3-(lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]urea (P-1762), l-(6-Methoxy-pyridm yl) [3-(lH-pyrrolo[2,3-b]pyridme carbouyl)-phenyl]-urea (P-1763), l-Isoxazol yl [3-(lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1764), l-(3&#1470;Methyl-isoxazoi yl) [3-(lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1765), 1 -(3 -Chloro trifluoromethyl-phenyl)-3 -[3 -(1 H-pyrrolo [2,3-b]pyridine-3 -carbonyl)-phenyl] -urea (P-1766),
1-(3,4-Dimethyl-isoxazol yl) [3-(lH-pyrrolo[2,3-b]pyridme carbonyl)-phenyl]-urea (P-1767), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridme carbonyl)-phenyl] pyridin yl-urea (P-1770), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyi] pyridin yl-urea (P-1771), l-[3-(5-Chloro-lH-pynolo[2,3-b]pyridine carbonyl)-phenyl] (2-methoxy-ethyl)-urea (P-1772), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyI] (3-methoxy trifluoromethyIphenyl)-urea (P-1773), l-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyI] (6-methoxy-pyridin yl)-urea (P-1774), l-[3-(5-Chloro&#1470;lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] isoxazol yl-urea (P-1775), l-[35)&#1470;-ChIoro-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] (3,4-dimethyl-isoxazol yl)urea (P-1776), l-Pyridin yl [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1777), l-(3-Methoxy trifluoromethyl-phenyl) [3-(5-pyridin yl-lH-py1Tolo[2,3-b]pyridine-3carbonyl)-phenyl]-urea (P-1778), l-(6-Methoxy-pyridm yl) [3-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]urea (P-1779), l-(4-Dimethylamino-phenyl) [3-(lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-urea (P-1780),
-Pyridin-3 -yl-3 -[3 -(1 H-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] -urea (P-1781),
5)&#1470;3]&#1524;-Chloro-IH-pyrro 10(2,3-b]pyndine carbonyl)-phenyl] (4-dimethylamino-phenyl)-urea (P-1782), l-(4-Fluoro-phenyl) {3-[5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]-phenyl}urea (P-1816), l-(3,4-Difluoro-phenyl) {3-[5-(4-fluoro-phenyl)-lH-pynolo[2,3-b]pyridine carbonyl]phenylj-urea (P-1817),
1-(3,4-Dimethoxy-phenyl) {3-[5-(4-fluoro-phenyl)-lH-pyrrolo[2,3-b]pyridine carbonyl]phenyl}-urea (P-1818), and l-(3-Fluoro-phenyl) {3-[5-(4-fluoro-phenyl)-lH-py1rolo[2,3-b]pyridine carbonyl]-phenyl}urea (P-1819).
The following table indicates the azaindole (column 2) and isocyanate (column 3) used to afford the target compound (column 4). Column 1 provides the compound number and the observed mass is given in column 5.
<td></td><td> Azaindole</td><td> Isocyanate</td><td> Compound</td><td> MS(ESI) [M+A observed</td>
<td> P-1566</td><td> XL π iCO X^N H</td><td> 0, 'C<sub>x</sub> N־־־^ °x</td><td> o ιζχΑ<sup>0</sup> A IZ A IZ <sup>v</sup> /</td><td> 416.3</td>
<td> P-1591</td><td> Ap nn h</td><td> X Cs 0</td><td> n W P νΑΑ n-4 /X) TTY η νΛΤ <sup>k</sup>N^N H</td><td> 434.3</td>
<td> P-1703</td><td> s</td><td> A X O</td><td> T IZ Xq IZ °</td><td> 357.1</td>
<td> P-1704</td><td> s</td><td> %. N Q ^F</td><td> VQ P Π3 ^n־O״<sup>f</sup> H '־־־' H</td><td> 375.1</td>
<td> P-1705</td><td><sup>1</sup> H</td><td> Qs c<sub>s </sub>N Q Pr</td><td> o<sup>z</sup> X o <sup>zx </sup>°Ύ zx 0 C<sup>z</sup></td><td> 387.1</td>
<td> P-1706</td><td> 03 <sup>1</sup> H</td><td> Qs c<sub>s</sub> ^F</td><td> °r־Q e A 05 B 8-v <sup>k</sup>N N <sup>H</sup> H</td><td> 393.1</td>
<td> P-1707</td><td> 03 Vn</td><td> Qs C<sub>s </sub>N ' O'<sup>0</sup></td><td> °Ά ״0 ״ ־?Άί P —1 03 <sup>N</sup>^N-d</td><td> 387.1</td>
<td> P-1708</td><td><sup>IN</sup> H</td><td> Oa % a '0־^</td><td> c> XX 0 ״' ru p ׳ n-4 /0-0 y ך % n־V <sup>1</sup>Άν</td><td> 417.5</td>
<td> P-1709</td><td><sup>N</sup> H</td><td> °x N - Q ^Cl</td><td> °־rQ p r׳oA n4־ /Ard CQ H nAjT n N ח H</td><td> 391.1</td>
<td> P-1710</td><td> 03 H</td><td> X. N.___ Q-CI</td><td> A / X c3 <sup>N</sup> nO</td><td> 391.1</td>
<td> P-1711</td><td> 03 Vn <sup>N</sup> H</td><td> X N,___ ^Cl</td><td> °aQ p f<sup>f</sup>־ 0040 H</td><td> 459.1</td>
<td></td><td> Azaindole</td><td> Isocyanate</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1712</td><td> H</td><td> 0. V c-O־<sup>CFs</sup></td><td> COO X O<sup>F3 </sup>CtS h h+Zj «8 a</td><td> 459.1</td>
<td> P-1713</td><td> H</td><td> Os C<sub>s </sub>N גז־־וס cf<sub>3</sub> .</td><td> °rQ p m aAj-p־ <sup>X</sup>N N .י Γ <sup>N</sup> H Cl</td><td> 459.1</td>
<td> • P-1714</td><td> H</td><td> Os V <sup>f</sup>P CF3</td><td> □:zQ-^O O IZ TZ <sup>u</sup> סו o ח־ ω</td><td> 443.1</td>
<td> P-1715</td><td></td><td></td><td> °r<sup>zx</sup> ZT o <sup>o</sup>Oj<sup>ZI</sup> C<sup>2</sup></td><td> 429.1</td>
<td> P-1716</td><td></td><td> Q.S c<sub>x</sub> N, O^<sup>F</sup></td><td> zz o ° v?<sup>1</sup> C<sup>2</sup></td><td> 375.1</td>
<td> P-1717</td><td> H</td><td> Os Cs n q (3F<sub>3</sub></td><td> °r־Q s> m bA-CV.</td><td> 425.1</td>
<td> P-1718</td><td> <כס H</td><td> \s N, Q</td><td> C0 h H־^” nN h H</td><td> 371.1</td>
<td> P-1719</td><td> ΓΧΛ <sup>N</sup> H</td><td> N O'</td><td> °rQ p X ιΓχ4 .rt-O ^bfN H H</td><td> 371.1</td>
<td> P-1720</td><td> 05 H</td><td> %, n JQ</td><td> °rQ 0 iTX? 94-0 ^n^n η [ H '</td><td> 371.1</td>
<td> P-1723</td><td> ex ^03 nn H</td><td> Os Cs N_ o</td><td> o <sup>2</sup>Q χΧΧ>><sup>ο </sup>IZ נ\ IZ <sup>υ </sup>Φ o~</td><td> 463.9</td>
<td> P-1724</td><td> ex iTr\ <sup>k</sup>N^N H</td><td> O״s Cs n_ Cr<sup>F</sup></td><td> iXj <sup>0</sup>/־־d^ P IL J ל h VJ <sup>k</sup>'N<sup>></sup>'N H H</td><td> 470.3</td>
<td></td><td> Azaindole</td><td> Isocyanate</td><td> Compound</td><td> MS(ESI) [M+1T]<sup>+ </sup>observed</td>
<td> P-1725</td><td> ΤΉ H</td><td> Q. 0. Q-°x</td><td> D <sup>2</sup>Q xz\po 0 xz A xz <sup>υ </sup>Π. V־O A י O-.</td><td> 494.3</td>
<td> P-1726</td><td> JM. ex Τ<sup>λ</sup>ν Η</td><td> Q. X χ O״<sup>CI</sup></td><td> χί־Χ, ΟχΧΡ rx Cl Γ fl Ϋ־־־Τ/ 0 J nX%J ρμ r\ TTT η νΛ7</td><td> 468.3</td>
<td> P-1727</td><td> Λ ex nn H</td><td> 0. C. 'ν CI-־Ot cf<sub>3</sub></td><td> n °aQ p _ Npv( XVCF, π N־vr <sup>3 n</sup> A <sup>H</sup>cY</td><td> 535.9</td>
<td> P-1728</td><td> ,N. ex^x αΠΧ Τ<sup>λ</sup>ν h</td><td> Οχ Οχ ν Fp cf<sub>3</sub></td><td> pl °7־XY P <sup>N</sup> H N^P N N ח Γ <sub>C</sub>p <sup>H</sup> H F ^<sup>r</sup>3</td><td> 520.3</td>
<td> P-1729</td><td> ״Ns ex^ H</td><td> ‘Μ</td><td> O °rQ ,0 Jy °O.״ » Xn</td><td> 505.9</td>
<td> P-1730</td><td> ״N<sub>s</sub> ex <sup>k</sup>N^~N H</td><td> Ο.χ Οχ Ν O'<sup>F</sup></td><td> rTX O<sub>v</sub> JP ״ F N^xXx-Ss״/^ iq-A Λ/) Τη η νΛΧ <sup>k</sup>N^~N H</td><td> 451.9</td>
<td> P-1731</td><td> AL ex XA H</td><td> °« <sup>S</sup>C. 'Ν η <?F<sub>3</sub></td><td> 0 <sup>2</sup>Q 6 1 ΙΣ ר)<sup>55</sup>^ ! xz <sup>u</sup> o CJ</td><td> 502.3</td>
<td> P-1732</td><td> ״N<sub>s</sub> ex pp Τ<sup>λ</sup>ν H</td><td> Ο.χ A ci־־O־<sup>cf</sup>’</td><td> n yQ p A<sup>F3 </sup><( / ^־NjLn n nA/ ן] ץ] ץ ya .y</td><td> 535.9</td>
<td> P-1733</td><td> 3לץ<sup>מ</sup><sup>Ί</sup> Η</td><td> °XS Οχ Ν ם</td><td> vQ 0 cisx^sj tA AT ץ χτ> h n־־w ^־N Ν H H</td><td> 391.1</td>
<td> P-1734</td><td><sup>α</sup>Ό3 ΤΑ <sup>Ν</sup> Η</td><td> O.X Οχ X Ρ</td><td> o <sup>2</sup>Q χζ׳Ρ^θ ί θ xz xz <sup>u</sup> X o^.</td><td> 421.1</td>
<td> P-1735</td><td><sup>α</sup>ΪΑ Τ<sup>λ</sup>ν Η</td><td> Ο.χ C. Ν Q'<sup>F </sup>'”״F</td><td> p °Ύ zx o ° C<sup>2</sup> o</td><td> 427.1</td>
<td></td><td> Azaindole</td><td> Isocyanate</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1736</td><td> o</td><td> Qs c<sub>s</sub> X 0־׳<sup>CI</sup></td><td> o <sup>2</sup>0 χζ/χο 0 xz כ\ xz <sup>u</sup> 9Tq</td><td> 425.1</td>
<td> P-1737</td><td> °׳w Ν H</td><td> 0, c<sub>x </sub>hi Q־<sup>CF3 </sup>^־Cl</td><td> o <sup>2</sup>0 xz/M<sup>0</sup> 0 xz xz <sup>u </sup>TTo יי \ Q “</td><td> 493.1</td>
<td> P-1738</td><td><sup>c,</sup>w H</td><td> 0. c״ X__ C1O־<sup>CF־</sup></td><td> °hQ 0 j<sup>cf</sup>3 <sup>N</sup> « <sup>H</sup>cT</td><td> 493.1</td>
<td> P-1739</td><td><sup>CI</sup>O3 H</td><td> X c-Q cf<sub>3</sub></td><td> °mQ 0 Οχ׳νί ^N<sup>7</sup>־<sup></sup>11} ” B'V <sup>n</sup>3 <sup>H</sup><sub>c</sub>r</td><td> 493.1</td>
<td> P-1740</td><td> n^n H</td><td> O<sub>s </sub>C<sub>s</sub> X Fp cf<sub>3</sub></td><td> « Li. o C^IL n <sup>zx </sup>°A _ zz % ס</td><td> 477.1</td>
<td> P-1741</td><td> סלץ H</td><td> M</td><td> 2 <sup>2</sup>0 ס. ry~k- XZ xz <sup>u </sup>-A</td><td> 463.1</td>
<td> P-1746</td><td> 03 nn H</td><td> Qs X N. (3־<sup>CF3</sup></td><td><sup>2</sup>0 z/M<sup>0 </sup>o X vL '־־s/'O <7י</td><td> 425.1</td>
<td> P-1747</td><td> o ΰ</td><td> A O־<sup>CF3</sup></td><td> M U. 33 °C z O °C? C<sup>2 </sup>o</td><td> 459.1</td>
<td> P-1748</td><td> ^333 χ N H</td><td> °x N o</td><td><sup>1</sup>3 <sup>0</sup>)־Ό ° My zx-f [I 1 V H N־\_J׳ ν<sup>Λ</sup>Ν H H</td><td> 451.9</td>
<td> P-1749</td><td> X M m33 κ n H</td><td> a X N / o״°</td><td> 373x3 <sup>IN</sup> H</td><td> 463.9</td>
<td> P-1750</td><td> As ^!33 H</td><td> 0» Ox N Q ^Cl</td><td> 0 <sup>2</sup>0 0 IZ Χ2Λ0 Φ o</td><td> 467.9 _</td>
<td></td><td> Azaindole</td><td> Isocyanate</td><td> Compound</td><td> MS(ESI) [M+HT observed</td>
<td> P-1751</td><td> r! (An An H</td><td> Qs to Q־<sup>C</sup>F3 ^c!</td><td> to W P to<sup>F</sup> ICQ h nAa n N h H</td><td> 535.9</td>
<td> P-1752</td><td> τ 1 AT* nn h</td><td> A N cA<sup>CF</sup></td><td><sup>ρ</sup>ί3ααχΟ a a <sup>3 </sup>aTX) H pjV n N ח r H Cl</td><td> 553.2</td>
<td> P-1753</td><td></td><td> Os A A cf<sub>3</sub></td><td> CT u_ o A o <sup>2T </sup>°Ύ o C<sup>z</sup></td><td> 553.2</td>
<td> P-1754</td><td> T1 αΠα Η</td><td> ל%</td><td> CA p > n4־ j Ao IX) h tjAto n N h <sup>ע</sup> H</td><td> 523.5</td>
<td> P-1755</td><td> CA nn H</td><td> 0. A N ry<sup>cF3</sup></td><td> LL.<sup>3 </sup>c>toto AA n <sup>21 </sup>°Ύ zz o C<sup>2 </sup>Q</td><td> 502.3</td>
<td> P-1756</td><td> CA 1ΠΑ N N H</td><td> °A N Q</td><td> An °Av^ ° to-x nJA^A /A T A h hA-A <sup>k</sup>N״A H</td><td> 447.9</td>
<td> P-1757</td><td> A CA^x An H</td><td> °A . Qr־</td><td> o ° vA C<sup>2 </sup>Q</td><td> 447.9</td>
<td> P-1758</td><td> UL.^ aQv <sup>k</sup>N^~N H</td><td> O* to N O' </td><td> AAA 7 x Am «ΛΑ N N ח <sup>IN</sup> H</td><td> 465.1</td>
<td> P-1759</td><td> A CA AX nn H</td><td> q<sub>x</sub> A X _jQ</td><td> /?A _A <sup>2</sup>rt -rAk ,O 0 zz A3 zz <sup>0</sup></td><td> 447.9</td>
<td> P-1760</td><td> H</td><td><sub>Z</sub>z A o'</td><td> AHX° /״ OA ν.־\. / ,N 0 JA H n־V <sup>k</sup>rAN h H</td><td> 358.3</td>
<td> P-1761</td><td> ' H</td><td> o, to N—ץ O .</td><td> O a} TZ IZ^° /</td><td> 339.1</td>
<td></td><td> Azaindole</td><td> Isocyanate</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1762</td><td> 03 TA H</td><td> 0* c<sub>x </sub>n 1 O'<sup>0</sup> CF3</td><td> -? Λ A <sup>s</sup> A<sub>cf</sub> in H \>r<sub>3</sub></td><td> 455.1</td>
<td> P-1763</td><td> (Ά <sup>N</sup> ii</td><td><sup>0</sup>A Π N0^׳</td><td> °r־Q p ~ ׳ A «W m N ח H</td><td> 388.3</td>
<td> P-1764</td><td> CQ</td><td> 0. C. N</td><td> °rQ 0 CXj ” 93.° nN π H</td><td> 348.3</td>
<td> P-1765</td><td> 03 <sup>1</sup> H</td><td> 0<sub>K</sub> A N A</td><td> °rQ p 03 0 η <sup>υ</sup><sup>1</sup> H</td><td> 362.3</td>
<td> P-1766</td><td> 03 H</td><td> Ck C\ <sup>s</sup>n_ At<sup>01</sup> (2F<sub>3</sub></td><td> < co LL. o _ A ο<sub>Ύ</sub><sup>ΖΙ </sup>a Qz</td><td> 459.1</td>
<td> P-1767</td><td> 03 H</td><td> %. N / Q-</td><td> °rQ p vz ־־*’־׳'׳r-'A Ν'* j/« CO Η Ν-<<sub>0</sub>.Ν n N ח H</td><td> 376.3</td>
<td> P-1770</td><td><sup>c</sup>׳w H</td><td> O<sub>x</sub> C<sub>s </sub>κ o</td><td> VQ P <sup>clx</sup>A4 n4׳ An 0 JA H N־\J׳ <sup>k</sup>N^~N H H</td><td> 392.3</td>
<td> P-1771</td><td> St N <sup>Ί</sup> H</td><td> Ck A n o</td><td><sup>0</sup>TO P r־X ^<sub>n</sub>j׳ /A I Η nA-n N <sup>H</sup></td><td> 392.3</td>
<td> P-1772</td><td> 3לץ'<sup>ש</sup> H</td><td> °A °\</td><td> °v /A ΓΜ P ΎIA <sup>H</sup> HA <sup>N</sup> Η 0<sub>x</sub></td><td> 373.1</td>
<td> P-1773</td><td><sup>C</sup>'AO ΑΆ H</td><td> °A < O' cf<sub>3</sub></td><td> VO 0 3' ci^־A <sub>n</sub>4־ /A T1A η n׳M <sup>k</sup>N־^N H <sub>CF3</sub></td><td> 489.1</td>
<td> P-1774</td><td> סרץ'° A^<sup>N</sup> Η</td><td> A. <sup>ν</sup>ύΑ AX</td><td> M3 P 1 ITO “ ^N n N ח H</td><td> 421.9</td>
<td></td><td> Azaindole</td><td> Isocyanate</td><td> Compound</td><td> MS(ESI) [Μ+Ηψ observed</td>
<td> P-1775</td><td><sup>c</sup>׳w H</td><td> O<sub>s</sub> '0* χ ׳V</td><td> vQ p “TXV^nO) Η N</td><td> 382.3</td>
<td> P-1776</td><td><sup>Cl</sup>w <sup>k</sup>r\rN H</td><td> 3 X o'</td><td> °VO P V/ <sup>ci</sup>v׳aX nA Jr* W “ H 0 <sup>N </sup>n N n <sup>H</sup> H</td><td> 410.3</td>
<td> P-1777</td><td> LX N H</td><td> ,O ,o' a'</td><td> n vQ o J 17 Η ΝΆ_ί H H</td><td> 435.1</td>
<td> P-1778</td><td> As LX X^N H</td><td> Qs c<sub>s </sub>n ! O'<sup>0</sup> CFj</td><td> °x VA) ־־0 ״ r Ί >Ά_λ P A nUv^X nA /V Tj3 h n׳V4 <sup>H</sup> cf<sub>3</sub></td><td> 531.9</td>
<td> P-1779</td><td> As LL. N H</td><td> Ϊ1 N O</td><td> o o izjXyO O IZ IZ <sup>u </sup>X O'.</td><td> 465.1</td>
<td> P-1780</td><td> ' H</td><td> i־ z o' o'</td><td> °vO P ־־״x ׳ Avk nA / Xn i מ η β <sup>Λ</sup>></td><td> 400.3</td>
<td> P-1781</td><td> 03 <sup>H</sup> H</td><td> Qs C<sub>s</sub> X a</td><td> °rQ p ' CO H N-Cn N N י׳ H</td><td> 358.3</td>
<td> P-1782</td><td> 3לץ<sup>מ</sup> H</td><td> Uy</td><td> X IZ IZ <sup>u </sup><> X<sup>2</sup>-</td><td> 434.3</td>
<td> P-1816</td><td> H</td><td> °L N Q</td><td> <-> <sup>zx</sup> °Ύ zx o ° vX<sup>1</sup>! C<sup>z</sup></td><td> 468.1</td>
<td> P-1817</td><td> F^s, V</td><td> Qx C<sub>x</sub> X . Q׳־F</td><td> LL n °Ύ zx o k ^x ° l.?<sup>1</sup>' Qz</td><td> 486.1</td>
<td> P-1818</td><td> F.^ nn h</td><td> Ox C. Νχ^χ Qr°<sup>x </sup>^O</td><td> o C<sup>z </sup>yj*</td><td> 510.2</td>
<td></td><td> Azaindole</td><td> Isocyanate</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1819</td><td> ''bi N H</td><td> Ck C. N Q-f</td><td> xd HffO n N ח H</td><td> 468.1</td>
Example 39: Synthesis of N-[3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluorophenyl]-3,5-difluorobenzenesulfonamide P-1841
[0403] Compound P-1841 was synthesized in six steps from 2,4-difluoroaniline 42 as shown in Scheme 67.
Scheme 67
<img file="IL188248A_D0124.tif" />
613 Cbz ou
<img file="IL188248A_D0125.tif" />
Step 1 - Preparation of (2,4-difluoro-phenyl)-carbamic acid benzyl ester (613):
[0404] To 2,4-difluoroaniline (42, 7.0 mL, 0.070 mol) in 100 mL of dichloromethane was added pyridine (11 mL, 0.14 mol) and benzyl chloroformate (11.9 mL, 0.0834 mol). The reaction mixture was stirred at ambient temperature for 1.5 hours. The reaction mixture was concentrated under reduced pressure and the residue was partitioned between ethyl acetate and KHSO4 solution. The organic layer was dried (MgSO4), concentrated and crystallized from hexanes to give compound 613 (15.6 g, 85%).
Step 2 - Preparation of (2,4-difluoro formyl-phenyl)-carbamic acid benzyl ester (614): [0405] Into a round bottom flask was added (2,4-difluoro-phenyl)&#1470;carbamic acid benzyl ester (613, 3.83 g, 14.5 mmol) in tetrahydrofuran (148 mL, 1.82 mol). The solution was chilled to - 78 °C and n-butyllithium (1.60 M in hexane, 19.1 mL, 30.0 mmol) was added over 30 minutes followed by the addition of, Ν,Ν-dimethylformamide (1.12 mL, 14.5 mol). The reaction mixture was allowed to warm to ambient temperature and was stirred overnight. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and crystallized from ether to give compound 614 (3.0 g, 71%).
Step 3 - Preparation of {2,4-difluoro [hydroxy-(lH-pyrrolo[2,3-b]pyridin yl)-methyl]-phenyl}carbamic acid benzyl ester (615):
[0406] Into a round bottom flask was added 5-chloro-lH-pyrrolo[2,3-b]pyridine (80, 0.524 g, 3.43 mmol, prepared as described in Example 9) in methanol (5.00 mL, 0.123 mol). Potassium hydroxide (0.800 g, 14.2 mmol) and (2,4-difluoro formyl-phenyl)-carbamic acid benzyl ester (614,1.02 g, 3.5 mmol) were added and the reaction mixture was stirred overnight. The reaction mixture was poured into IN HC1 and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and crystallized from ethyl acetate to give compound 615 (710 mg, 46%). MS(ESI)[M+H+]+ = 444:
Step 4 - Preparation of [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-carbamic acid benzyl ester (616):
[0407] Into a round bottom flask was added {2,4-difluoro [hydroxy-(lH-pyrrolo[2,3-b]pyridin-3yl)-methyl]-phenyl}-carbamic acid benzyl ester (615,1.01 g, 2.28 mmol) in tetrahydrofuran (5.00 mL, 0.0616 mol). Dess-Martin periodinane (1.20 g, 2.89 mmol) was added in portions. The reaction mixture was stirred at ambient temperature for 10 minutes, then poured into water and extracted with ethyl acetate. The organic layer was washed with brine, dried over sodium sulfate, concentrated and purified by silica gel chromatography to give compound 616 (914 mg, 91%). MSQES^CM+H4]4 = 442.
Step 5 - Preparation of (3-Amino-2,6-difluoro-phenyl)-(5-chloro-lH-pyrrolo[2t3-b]pyridin yl) methanone (P-1801):
[0408] [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-carbamic acid benzyl ester (616, 800 mg, 1.81 mmol) was added to 10 M NaOH (15.00 mL) and warmed to reflux overnight.
The reaction mixture was diluted with 30 mL of water and was extracted with ethyl acetate to give compound P-1801 (450 mg, 81% ).
Step 6 -Preparation of N-[3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]3,5-difluorobenzenesulfonamide (P-1841)
[0409] Into a microwave reaction vessel were combined (3-Amino-2,6-difluoro-phenyl)-(5-chloro1 H-pyrrolo[2,3-b]pyridin yl) -methanone (P-1801, 50 mg, 0.16 mmol, prepared as described in Example ???), 3,5-difluorobenzenesulfonyl chloride (610,103 mg, 0.49 mmol), pyridine (0.5 mL, 6.1820 mol) and tetrahydrofuran (3.0 mL,). The reaction was warmed in the CEM microwave at 300 watts, 130 °C for 10 minutes. The reaction mixture was partitioned between ethyl acetate and brine. The organic layer was collected, dried over Na2SO4, filtered and concentrated. The compound (P1841) was isolated using column chromatography (silica, hexane:ethyl acetate 70:30) to obtain 36 mg (46%) compound. MS = 482.0.
[0410] Additional compounds were prepared following the protocol of Scheme 67 Step 6, optionally substituting (3-Amino2,6&#1470;-difluoro-phenyl)-(5-chloro-lH&#1470;pyrrolo[2,3&#1470;b]pyridin yl) methanone P-1801 with (3-Armno-2,6-difluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridn1 yl) -methanone P-2021 (prepared per Scheme 67 Steps 1-5, substituting 5-chloro-lH-pyrrolo[2,3-b]pyridine 80 with lH-pyrrolo[2,3-b]pyridine 94 in Step 3) and/or 3,5-difluorobenzenesulfonyl chloride 610 with an appropriate sulfonyl chloride. The following compounds were prepared by this procedure:
N-[3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] isopropylbenzenesulfonamide (P-1839),
N-[2,4-Difluoro-3 -(1 H-pyrrolo [2,3-b]pyridine carbonyl)-phenyl] -benzenesulfonamide (P-0913), N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] nitro-benzenesulfonamide (P-1937), N-{4-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenylsulfamoyl]-phenyl)acetamide (P-1938), N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] methoxybenzenesulfonamide (P-0958), 5-[2,4-Difluoro (lH-pynolo[2,3-b]pyridine carbonyl)-phenylsulfamoyl]-iuran carboxylic acid methyl ester (P-1941), 5-[2,4-DifIuoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenylsulfamoyl] methyl-furan-3carboxylic acid methyl ester (P-1942), 5-Oxazol yl-thiophene sulfonic acid [2,4-difluoro (lH-pyrT010[2,3-b]pyridine carbonyl)phenyl]-amide (P-1943), 5-Isoxazol5&#1470;-yl-thiophene sulfonic acid [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-amide (P-1948), N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-2,4-di1nethoxybenzenesulfonamide (P-1951),
2.5- Dimethyl-thiophene sulfonic acid [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-1952),
2.5- Dimethyl-furan sulfonic acid [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-1953), N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] methyl-benzenesulfonamide (P-1954),
2.3- Dihydro-benzo[l,4]dioxine sulfonic acid [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine-3carbonyl)-phenyl]-amide (P-1955),
2.4- Dimethyl-thiazole sulfonic acid [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)phenyl]-amide (P-1956),
N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] trifluoromethylbenzenesulfonamide (P-0931), N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] fluoro methylbenzenesulfonamide (P-1961),
N- [2,4-Difluoro-3 -(1 H-pyrrolo [2,3-b]pyridine-3 -carbonyl)-phenyl] -3 -methyl-benzenesulfonamide (P-1962),
N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl] oxazol ylbenzenesulfonamide (P-1963),
N-[2,4-Difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-2,5-dimethoxybenzenesulfonamide (P-1131),
2- Cyano-N-[2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]-benzenesulfonamide (P-1965),
3- Cyano-N-[2,4-difluoro (lH-pyrrolo(2,3-b]pyridine carbonyl)-phenyl]-benzenesulfonamide (P-1966),
N-(2,4-Difluoro (lH-pyrrolo(2,3-b]pyridine carbonyl)-phenyl] isopropylbenzenesulfonamide (P-1968),
Benzothiazole sulfonic acid [2,4-difluoro (lH-pyrrolo[2,3-b]pyridine carbonyl)-phenyl]amide (P-1969),
N-(3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] methoxybenzenesulfonamide (P-2011),
N-(3-(5-Chloro&#1470;lH-pyrrolo(2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]-benzenesulfonamide (P-0885),
Thiophene sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridn1e carbonyl)-2,4-difluorophenyl]-amide (P-1267),
N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] methylbenzenesulfonamide (P-1842),
N-{4-(3-(5-Chloro-1 H-pyrrolo [2,3-b]pyridine carbonyl)-2,4-difluoro-phenylsulfamoyl] phenyl }-acetamide (P-1905), N-(3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difh10ro-phenyl] methoxybenzenesulfonamide (P-0983),
N-[3-(5-Ch.loro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] trifluoromethylbenzenesulfonamide (P-1599),
5-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenylsulfamoyl]-fi1ran-2carboxylic acid methyl ester (P-1907),
5-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenylsulfamoyl] methylfuran carboxylic acid methyl ester (P-1908),
1.2- Dimethyl-lH-imidazole sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-
2.4- difluoro-phenyl]-amide (P-1911), N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difIuoro-phenyl] fluorobenzenesulfonamide (P-1912), N-[3-(5-Chloro&#1470;lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] difluoromethoxybenzenesulfonamide (P-1916), N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]-2,4-dimethoxybenzenesulfonamide (P-1918),
2.5- Dimethyl-tl1iophene sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4difluoro-phenyl]-amide (P-1919),
2.5- Dimethyl-furan sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4difluoro-phenyl]-amide (P-1920), N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] methylbenzenesulfonamide (P-1921),
2.3- Dihydro-benzo[l,4]dioxine sulfonicacid[3-(5-chloro-lH-pyrrolo[2,3-b]pyridine-3carbonyl)-2,4-difluoro-pbenyl]-an1ide (P-1922),
2.4- Dimethyl-thiazole sulfonic acid [3-(5-chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4difluoro-phenyl]-amide (P-1923), N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]-2,4-difluorobenzenesulfonamide (P-1926), N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] fluoro methylbenzenesulfonamide (P-1927), N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] methylbenzenesulfonamide (P-1928), N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl]-2,5-dimethoxybenzenesulfonamide (P-1929), N-[3-(5-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] cyanobenzenesulfonamide (P-1931), and N-[35)&#1470;-Chloro-lH-pyrrolo[2,3-b]pyridine carbonyl)-2,4-difluoro-phenyl] cyanobenzenesulfonamide (P-1932).
The following table indicates the azaindole (column 2) and the sulfonyl chloride (column 3) used to afford the target compound (column 4). The compound number is provided in column 1, with the observed mass given in column 5.
<td></td><td> Azaindole</td><td> Sulfonyl chloride</td><td> Compound</td><td> MS(ESI) [Μ+ΗΠ<sup>+ </sup>observed</td>
<td> P-1839</td><td> R. <sup>cl</sup>Yn <sup>F NH2 </sup>3*3</td><td> S^<sub>2</sub>CI</td><td> o 5> 3°׳<sub>ζ</sub> חד \ mz Ο=ω^ _ °</td><td> 489.9</td>
<td> P-0913</td><td> Fl yQ pp f<sup>NH2 </sup>3*^n</td><td> ^O<sub>2</sub>CI</td><td> ״°־Q ס=מ> zx u: ץ C<sup>z</sup></td><td> 413.9</td>
<td> P-1937</td><td> °XM PP p<sup>NH</sup>* 3*A</td><td> SO<sub>2</sub>CI ^^no<sub>2</sub></td><td> v) z3p° חד \ 0ךיי xz o=A ° o z o נא</td><td> 459.1</td>
<td> P-1938</td><td> Fv yO pp <sup>F NH2 </sup>3*Α</td><td> SO<sub>2</sub>CI <sub>o</sub>p</td><td> , H ° 7 Y״ ״־־״ ׳ 1yi</td><td> 471.1</td>
<td> P-0958</td><td> VQ pp f <sup>NH</sup>־ 3*A</td><td> SO<sub>2</sub>CI 0 <sub>z</sub>0</td><td> / o Qz ω=Ο zx 0-m ϊχ ץ C<sup>z </sup>_</td><td> 444.3</td>
<td> P-1941</td><td> O חד \ 0ךיי z X w</td><td> SO<sub>2</sub>CI °7 <sup>o==</sup>\ /°</td><td><sup>x</sup>0 F\ z^zA yO Vo m <sup>f</sup> h<sup>0־</sup>0׳<sup></sup>nN</td><td> 462.3</td>
<td> P-1942</td><td> z3p° חד \ 0ךיי ζ X Μ</td><td> SO<sub>2</sub>CI °/ / pO —0</td><td><sup>F</sup>\-x /3״ w M m <sup>f</sup> «t° nN</td><td> 475.9</td>
<td> P-1943</td><td> F<^ yq fY5 <sup>F NH2 </sup>3*^n</td><td> SO2CI N^O</td><td> P A <sup>F</sup>\-x aA/<sup>n</sup> γθ A m ג K׳f° nn</td><td> 487.1</td>
<td> P-1948</td><td> F\_ °rM m f <sup>n</sup>h<sub>2 </sub>3<sup>a</sup>n</td><td> SO<sub>2</sub>CI <sup>s</sup> / 4. z0 N</td><td> O-N <sup>f</sup>a=\ yQ M m <sup>f</sup> at<sup>0</sup> ׳ ^N N</td><td> 487.1</td>
<td></td><td> Azaindole</td><td> Sulfonyl chloride</td><td> Compound</td><td> MS(ESI) [M+H<sup>+</sup>]<sup>+ </sup>observed</td>
<td> P-1951</td><td> CM X 2 CO</td><td> ן SO<sub>2</sub>CI Ο<sub>χ</sub></td><td> rM <sup>0</sup>0־ iPri fWo</td><td> 473.9</td>
<td> P-1952</td><td> O Y חד z X M</td><td> SO<sub>2</sub>CI 3</td><td></td><td> 447.9</td>
<td> P-1953</td><td> R_ w n־S <sup>f NH2</sup></td><td> SO<sub>2</sub>CI ~O4־</td><td> Λ3 A 0P ״.־״</td><td> 432.3</td>
<td> P-1954</td><td> F. w fYS f <sup>mh</sup>־ w n</td><td> SO<sub>2</sub>CI</td><td><sup>F</sup>\-־\ Vm Ό pA ίο</td><td> 427.9</td>
<td> P-1955</td><td> CM X Z (X ui ץ C<sup>z</sup></td><td> SO<sub>2</sub>CI</td><td> 03 f <sup>HN</sup>y<sub>0 </sub><sup>k</sup>pN <sup>0</sup></td><td> 472.3</td>
<td> P-1956</td><td> F< °rU pA f <sup>NH2</sup></td><td> SO<sub>2</sub>CI S׳Y— A</td><td> o ! °?<sup>=o </sup>ZX ׳ CO 0pS<sup>z</sup> י<sup>1 </sup>O<sup>2 </sup>___________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________!</td><td> 448.7</td>
<td> P-0931</td><td><sup>2</sup>Q zO° חד \ 0ךיי ζ X CM</td><td> SO<sub>2</sub>CI Φ cf<sub>3</sub></td><td><sup>z</sup>O וד \ ^יי <sup>z/</sup> 1 Π ° <sup>1</sup>Λ רד ω</td><td> 481.9</td>
<td> P-1961</td><td> CM X z CL uf ץ £Jz</td><td> SO<sub>2</sub>CI tX \^^F</td><td><sup>F</sup>V-x °pP 33-f (pA pN-S^o ^־nA <sup>0</sup></td><td> 445.9</td>
<td> P-1962</td><td> R_ W pA f <sup>NH2 </sup>A</td><td></td><td> Οχ 7P P\ rU LA pA <sub>F</sub>An־s.<sub>o </sub>vA ט</td><td> 427.9</td>
<td></td><td> Azaindole</td><td> Sulfonyl chloride</td><td> Compound</td><td> MS(ESI) [Μ+Ηψ observed־</td>
<td> P-1963</td><td> R. W F NH2 T^N</td><td> P o</td><td> -hJY xMz z °x><sup>Z</sup></td><td> 481.1</td>
<td> P-1131</td><td> CM X z CL ll y C<sup>z</sup></td><td> 1 SO<sub>2</sub>CI °!rS 1</td><td><sup>F</sup>V-K 1 ^JTn <sup>0</sup>-/T TS-־^ ΧΛ־ο<sup>ζ </sup>rrS f<sup>hn</sup>10 ν<sup>Λ</sup>Ν 0</td><td> 473.9</td>
<td> P-1965</td><td><sup>2</sup>Q Y חד Yj z X</td><td> SO<sub>2</sub>CI As_.CN</td><td> R PrA η<sup>Ν</sup>־^ο<sup>0Ν</sup> ν<sup>Λ</sup>Ν 0</td><td> 439.1</td>
<td> P-1966</td><td> F<^ W fYA F <sup>NH2</sup></td><td> SO<sub>2</sub>CI A ^CN</td><td> *V-X °Ar^ CXcn nA fWo</td><td> 439.1</td>
<td> P-1968</td><td> CM X z CL u; ץ 0A? Cly</td><td> ^/)<sub>2</sub>CI</td><td><sup>F</sup>\—x Cd X a־f° nN</td><td> 456.3</td>
<td> P-1969</td><td> R. vQ ΠΛ <sup>F NH2</sup></td><td> SO<sub>2</sub>CI d N=־/</td><td><sup>F</sup>>\ vQ 04 Cn f 0<sup>;</sup>־ <sup>k</sup><sub>N</sub>׳^N 0</td><td> 471.1</td>
<td> P-2011</td><td> CM X z CL. ll ץ o o</td><td> SO<sub>2</sub>CI 01 1</td><td> o o Om׳° \ 7ח xV^z z O^a> / °O^°</td><td> 477.9</td>
<td> P-0885</td><td> R. °r0 f<sup>NH2</sup></td><td> S0<sub>2</sub>CI ό</td><td> o A וד ^ύΎ xV^z z מ>הז0 ° o</td><td> 447.9</td>
<td> P-1267</td><td> CM X z \F \ o o</td><td> SO<sub>2</sub>CI ά</td><td> Λ? O \<>k >! cn=O zx fX u: ך ° X? 0<sup>2</sup> ס</td><td> 453.9</td>
<td></td><td> Azaindole</td><td> Sulfonyl chloride</td><td> Compound</td><td> MS(ESI) [M+HT observed</td>
<td> P-1842</td><td> - X z CO u! ך ° k? o o</td><td> SO<sub>2</sub>CI Φ</td><td><sup>01</sup>ίΟ^<sup>ν</sup>^ <sup>ς</sup>|\Γ~Ν θ</td><td> 462.3</td>
<td> P-1905</td><td> CM X Z CO ui \ crYV o</td><td> SO,CI Φ HN ״ /°</td><td> 0=^ <sub>F</sub> NH °^ד0רץ<sup>01</sup></td><td> 505.1</td>
<td> P-0983</td><td> CM X z 0-- <sup>1</sup> LL. \ C<sup>2 </sup>o</td><td> SO<sub>2</sub>CI Φ °x</td><td> \ <sup>c</sup>׳O^<sup>n</sup>׳S° <sup>k</sup>fxrN 0</td><td> 477.9</td>
<td> P-1599</td><td> o <sup>2</sup>Q z^O חד \ סו z X hJ</td><td> SO<sub>2</sub>CI</td><td> \-עד/ כה Q-Qz° 0־£05 z /^x u: ץ o o</td><td> 515.9</td>
<td> P-1907</td><td> CM X z CO hi ץ C<sup>z </sup>o</td><td> SO<sub>2</sub>CI <sup>0</sup>/ 0=( /°</td><td><sup>x</sup>0 <sup>01</sup>Ytp B 0*° ^N N</td><td> 496.3</td>
<td> P-1908</td><td> £ <sup>:</sup> z co ך :u C<sup>z</sup> o</td><td> SO<sub>2</sub>CI <sup>0</sup>/ / y0־ —Ό</td><td> %>?o z׳< \<>k <sup>r</sup>. O '-^ס־נע zx £O hi ך ° u? o ω</td><td> 509.9</td>
<td> P-1911</td><td> R, Vw י־רד f <sup>NH־ k</sup>r/-N</td><td> SO<sub>2</sub>C) nO</td><td> Q o סו <sup>Ο=</sup>׳<sup>ω</sup>'ν-־-\ d v z— ץ<sup>2</sup></td><td> 466.3</td>
<td> P-1912</td><td> E. V-Q <sup>CI</sup>YM F <sup>nh</sup>2 <sup>k</sup>N^N</td><td> SO<sub>2</sub>CI r־־O-F o</td><td> ס^׳כע 12 z aA- ץ 111 ° V? C<sup>2 </sup>o</td><td> 465.9</td>
<td></td><td> Azaindole</td><td> Sulfonyl chloride</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1916</td><td> CM I z ur ך O o</td><td> SO<sub>2</sub>CI Q. <sup>0</sup>A F</td><td><sub>F</sub> pp<sup>F</sup><sup>0</sup>Up 0 <sup>ci</sup>tM. / *s SA O</td><td> 513.9</td>
<td> P-1918</td><td> CM X z 0-LE ll: ץ oA? C<sup>2 </sup>ω</td><td> 1 SO<sub>2</sub>CI y °\</td><td> n <sup>F</sup>S\ ' ΥΜθ'Ο <sup>α</sup>ΊΤ0 X<sup>N</sup>S0 SA 0</td><td></td>
<td> P-1919</td><td> CM cc ך 01 C<sup>z </sup>o</td><td> SO<sub>2</sub>CI</td><td> SA</td><td> 481.9</td>
<td> P-1920</td><td> CM X z CL LL γ όΟ o o</td><td> SO<sub>2</sub>CI Ά</td><td> SA</td><td> 465.9</td>
<td> P-1921</td><td> CM X z CL ll ך oV? C<sup>z </sup>o</td><td> SO<sub>2</sub>CI ζρΓ</td><td><sup>F</sup>\—K yQ X) <sup>CI</sup>YYS Fi־״h> y^N 0</td><td> 461.9</td>
<td> P-1922</td><td> R. w <sup>CI</sup>TY$ F <sup>NH</sup>־ SA</td><td> SO<sub>2</sub>CI A</td><td><sup>ci</sup>yL^<sup>n</sup>^° SA 0</td><td> 505.9</td>
<td> P-1923</td><td> R, vQ <sup>ci</sup>yys <sup>f NH2 </sup>SA</td><td> SO<sub>2</sub>CI 8\ 2=n</td><td> V9׳ f cn-O ' ZX o X? ZjZ o</td><td> 483.1</td>
<td> P-1926</td><td> Fl yQ <sup>,</sup>γζ f <sup>NH־</sup> SA</td><td> SO<sub>2</sub>CI F</td><td> °X o<sup>f</sup><sup>C</sup>׳YYS F™0־?־ <sup>1</sup>n^n 0</td><td> 483.9</td>
<td> P-1927</td><td> R. vQ <sup>ci</sup>yy4 f <sup>nh</sup>־ SA</td><td> SO<sub>2</sub>CI F׳־^׳^</td><td> o <sup>Z</sup>O -r. XA τΎ z 05;<מ j °0׳ ח־</td><td> 479.9</td>
<td></td><td> Azaindole</td><td> Sulfonyl chloride</td><td> Compound</td><td> MS(ESI) [M+irr observed</td>
<td> P-1928</td><td> F. <sup>C</sup> W4 F NH<sub>2</sub></td><td> SO<sub>2</sub>CI</td><td> o o ץ7יי Ay! z p׳°</td><td> 461.9</td>
<td> P-1929</td><td> F. ΎΎλ f <sup>NHi</sup></td><td> ן SO<sub>2</sub>CI 00¾. Xa 0 1</td><td> 1 0. Jr n Cl λ yM <sup>k</sup>|\T N <sup>0</sup></td><td> 507.9</td>
<td> P-1931</td><td> F. °X> <sup>CI</sup>YY\ F <sup>NH</sup>2 <sup>1</sup>־ιΆν</td><td> SO<sub>2</sub>CI Cx-CN Qj</td><td> F. ״ w Q γΜ> F^-S-oCM</td><td> 473.1</td>
<td> P-1932</td><td> CM X z xx le ך ° V? o o</td><td> SO<sub>2</sub>CI A</td><td> z o 0.° ״*O z /γι XX ur y ° V? o</td><td> 473.1</td>
Example 40: Synthesis of 4-(5-pyridin yl&#1470;lH-pyrrolo[2,3-b]pyridine carbonyl)-indole-lcarboxylic acid dibutylamide P-1636
[0411] Compound P-1636 was synthesized in two steps from lH-indole carboxylic acid 611 as shown in Scheme 68.
Scheme 68
<img file="IL188248A_D0126.tif" />
Step !-Preparation of l-dibutylcarbamoyl-lH-indole carboxylic acid (612):
[0412J To lH-Indole carboxylic acid (611, 251 mg, 1.56 mmol) in tetrahydrofuran (3 mL), was added 2.5M n-butyllithium in hexane (1.28 mL, 3.19 mmol) at -78 °C. After 30 minutes, dibutyl carbamyl chloride (657 mg, 3.43 mmol) was added and stirred for two hours. The reaction solution was quenched with IM HC1 (aq.) and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous magnesium sulfate, filtrated and concentrated. The desired compound was isolated with silica gel column chromatography using 10% ethyl acetate in hexane to give a white solid (612, 88 mg, 18%). MS(ESI) [M-H4]315.1 &#1470;&#1470;.
Step 2 — Preparation of 4-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-indole-l-carboxylic acid dibutylamide (P-1636):
[0413} To l-dibutylcarbamoyl-lH-indole carboxylic acid (612, 78 mg, 0.25 mmol) in dichloromethane (2 mL), thionyl chloride (25 pL, 0.34 mmol) was added and stirred for one hour, followed by rotary evaporation to remove solvents to provide the dried acid chloride, which was dissolved in dichloromethane for later use. Meanwhile, 5-pyridin yl-lH-pyrrolo[2,3-b]pyridine (89, 55 mg, 0.28 mmol, prepared as described in Example 17) in dichloromethane (8 mL), was mixed with aluminum trichloride (215 mg, 1.6 mmol) and stirred for one hour, followed by addition of the dried acid chloride in di chloromethane (3 mL). The reaction was stirred at room temperature overnight, then quenched with methanol and all volatiles were removed. The desired compound was isolated with silica gel column chromatography using 10% methanol in dichloromethane to give a solid (P1636, 11 mg, 9%). MS(ESI) [M+H4]4 = 494.3.
[0414] Additional compounds were prepared following the protocol of Scheme 68, substituting dibutyl carbamyl chloride with a suitable reagent in Step 1 and optionally substituting 5-pyridin yllH-pyrrolo[2,3-b]pyridine 89 with 5-(6-Methoxy-pyridin yl)-lH-pyrrolo[2,3-b]pyridine (see Example 17) in Step 2. The following compounds were prepared following this procedure:
[l-(Butane-l-sulfonyl)-lH-indol yl]-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin yl)-methanone (P-1661),
4-(5-Pyridin yl-lH-pynOlo[2,3-b]pyridine carbonyl)-indole-l-carboxylic acid pentylamide (P-1702),
4-(5-Pyridin yl-lH-pyrrolo[2,3-b]pyridine carbonyl)-indole-l-carboxylic acid dipropylamide (P-1722), and
4-[5 -(6-Methoxy-pyridin-3 -yl)-1 H-pyrrolo[2,3 -b]pyridine-3 -carbonyl]-indole-1 -carboxylic acid butylamide (P-1827).
The following table indicates the reagent used in place of dibutyl carbamyl chloride (column 2) and the azaindole (column 3) used to afford the target compound (column 3). The compound number is provided in column 1, and the observed mass is given in column 5.
<td></td><td> Step 1 reagent</td><td> Azaindole</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1661</td><td> ^SO<sub>2</sub>CI</td><td> ϊη <sub>N</sub> N</td><td> O o ft) 1 Ο=ω=ο</td><td> 459.2</td>
<td></td><td> Step 1 reagent</td><td colspan="2"> Azaindole</td><td colspan="3"> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-1702</td><td> ^N=C=O</td><td> rQ.</td><td> .s</td><td> il</td><td> O</td><td> C<sup>N</sup>^׳° N</td><td> 452.3</td>
<td> P-1722</td><td> Cl-yO a</td><td> Cl</td><td> Ό3</td><td> ίι ך</td><td> t <חלץ</td><td> ־^hH<sup>0</sup>־ \ N-Z</td><td> 466.3</td>
<td> P-1827</td><td> ^N=C=O</td><td></td><td> m3 NrN H</td><td> 1 Os/־ II</td><td> Ύη N</td><td></td><td> 468.3</td>
Example 41: Synthesis of 3-(3-Benzyloxy chloro fluoro-benzyI)-lH-pyrrolo[2,3-6]pyridine P-1852, (3-Benzyloxy chloro fluoro-phenyl)-(lH-pyrrolo[2,3-0]pyridin yI)-methanone P1853 and related compounds
[0415] Compounds P-1852 and P-1853 were synthesized in four steps from 2-chloro-4fluorophenol 617 and lH-pyrrolo[2,3-6]pyridine 94 as shown in Scheme 67.
Scheme 69
<img file="IL188248A_D0127.tif" />
<img file="IL188248A_D0128.tif" />
P-1852
<img file="IL188248A_D0129.tif" />
Step 1 — Preparation of l-Benzyloxy chloro fluoro-benzene (618):
[0416] To a solution of 2-chloro fluorophenol (617, 7 g, 0.05 mol) in tetrahydroforan (100 mL) was added sodium hydride (1.8 g, 95% dry powder, 0.071 mol) at room temperature over 15 minutes under an atmosphere of nitrogen. The reaction mixture was stirred at room temperature for 30 minutes. Benzyl bromide (10 g, 0.060 mol) was added slowly to the reaction mixture, then stirred at room temperature overnight. The reaction mixture was poured into ice water, extracted with ethyl acetate, washed with hydrochloric acid (10%), water, brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide compound as a white solid (618, 7.6 g, 60%).
Step 2 - Preparation of3-Benzyloxy chloro fluoro-benzaldehyde (619):
[0417] To a solution of l-benzyloxy chloro fluoro-benzene (618, 5.8 g, 0.024 mol) in tetrahydrofuran (100 mL) was added 2.50 M of n-butyllithium (2.7 mL, 2.50 M in hexane, 0.029 mol) slowly at -78 °C over 15 minutes under nitrogen. The reaction mixture was stirred at -78 °C for 30 minutes. To the reaction mixture was then added Ν,Ν-dimethylformamide (4.2 mL, 0.054 mol). The reaction was allowed to warm to room temperature and was continued at room temperature overnight. The reaction mixture was poured into ice water, extracted with ethyl acetate, washed with hydrochloric acid (10%), water, brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as a white solid (619, 2.1 g, 32%). MS(ESI) [M+H4]4 = 265.08.
Step 3 - Preparation of3-[(3-Benzyloxy chloro fluoro-phenyl)-methoxy-1nethyl]-lH-pyrrolo[2,3b]pyridine (P-1867) and (3-Benzyloxy chloro fluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin yl) methanol (P-1868):
[0418] A mixture of lH-pyrrolo[2,3-6]pyridine (94, 0.5 g, 4 mmol), 3-benzyloxy chloro-6fluoro-benzaldehyde (619, 1.3 g, 4.9 mmol) , and potassium hydroxide (0.99 g, 18 mmol) in methanol (30 mL) was stirred at room temperature overnight. The reaction mixture was concentrated and the residue was dissolved in ethyl acetate and water. The organic layer was collected and washed with brine. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide compound P-1867 as a white solid (1.3 g, 70%, MS(ESI) [M+H4]4 = 397.16), and compound P-1868 as an off-white solid (0.2 g, 10, MS(ESI) [M+H4]4 = 383.14).
Step 4a - Preparation of3-(3-Benzyloxy chloro fluoro-benzyl)-lH-pyrrolo[2,3-b]pyridine (P1852):
[0419] A mixture of 3-[(3-Benzyloxy chloro fluoro-phenyl)-methoxy-methyl]-lH-pyrrolo[2 ,3/’]pyridine (P-1867, 0.1 g, 0.2 mmol), trifluoroacetic acid (0.6 mL, 8 mmol), and triethylsilane (0.3 mL, 2 mmol) in acetonitrile (10 mL) was refluxed for 2 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate, The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with methanol in dichloromethane to provide compound as an offwhite solid (P-1852, 62 mg, 70%). MS(ESJ) [M+H+]+ = 367.16.
Step 4b — Preparation of (3-Benzyloxy chloro fluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin yl) methanone (P-1853):
[0420] To a solution of (3-Benzyloxy chloro fluoro-pbenyl)-(lH-pyrrolo[2,3-b]pyridin yl)methanol (P-1868, 65 mg, 0.17 mmol) in tetrahydrofuran (10 mL) was added Dess-Martin periodinane (79 mg, 0.19 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 2 hours. The reaction was quenched with a saturated solution of sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with methanol in dichloromethane to provide the compound as a light yellow solid (P-1853, 32 mg, 50%). MS(ESI)[M+lT]+ = 381.13.
[0421] Additional compounds were prepared following the protocol of Scheme 69, optionally replacing 2-chloro fluorophenol 617 with 2, 6-difluorophenol or 2, 6-dichlorophenol, optionally replacing benzyl bromide with an appropriate substituted benzyl bromide, and optionally replacing lH-pyrrolo[2,3-b]pyridine 94 with an appropriate substituted lH-pyrrolo[2,3-b]pyridine. Azaindoles were purchased or prepared as described in Examples 9 or 16. The following compounds were made following this procedure:
3-[2,6-Dichloro (4-chloro-benzyloxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1768), [2,6-Dichloro (4-chloro-benzyloxy)-phenyl]-(lH-pyrrolo[2,3-h]pyridin yl) methanone (P-1769), (3-Benzyloxy-2,6-difluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin yl)-methanone (P-1802), 3-(3-Benzyloxy-2,6-difluoro-benzyl)-lH-pyrrolo[2,3- /?]pyridine (P-1803), 3-(3-Benzyloxy-2,6-difluoro-benzyl) methoxy-lH-pyrrolo[2,3- /?]pyridine (P-1804), 3-(3-Benzyloxy-2,6-difluoro-benzyl) chloro-lH-pyrrolo[2,3- /?]pyridine (P-1824), (3-Benzyloxy-2,6-difluoro-phenyl)-(5-chloro-lH-pyrrolo[2,3- i&#1523;]pyridin yl)-methanone (P-1825), 3-[(3-Benzyloxy chloro fluoro-phenyl)-methoxy-methyl]-lH-pynOlo[2,3- /?]pyridine (P-1867), (3-Benzyloxy chloro fluoro-phenyl)-(lH-pyrrolo[2,3-b]pyridin yl)-methanol (P-1868), [2-Chloro (3-chloro-benzyloxy) fluoro-phenyl]-(lH-pyrrolo[2,3- Z?]pyridin y !)-methanone (P-1869),
[2-Chloro (4-chloro&#1470;benzyloxy) fluoro-phenyl]-(lH-pyrrolo[2,3- b]pyridin yl)-methanone (P-1874),
3-[2,6-Difluoro (pyridin ylmethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1993), and 3-[3-(4-Chloro fluoro-benzyloxy)-2,6-difluoro-benzyl]-lH-pynolo[2,3-b]pyridine (P-1992).
The phenol, benzyl bromide and azaindole used in Steps 1, 2, and 3, respectively, are indicated in columns 2, 3, and 4 of the following table, respectively, to afford the target compound (column 5). The compound number is provided in column 1, and the observed mass is given in column 6.
<td></td><td> Phenol</td><td> Benzyl bromide</td><td> Azaindole</td><td> Compound</td><td> MS (ESI) [m+hT observed</td>
<td> P-1768</td><td> Cl OH</td><td> Cl</td><td><sup>N</sup> H</td><td> ci ci O 0 [3ךן cr 0-<sup>7</sup><sup>N</sup> H</td><td> 417.14</td>
<td> P-1769</td><td> Cl ^׳׳01 OH</td><td> 9 Cl</td><td><sup>N</sup> H</td><td> Cl Cl _V0 0 [f]3 cr 0-,</td><td> 431.09</td>
<td> P-1802</td><td> F N OH</td><td> s</td><td><sup>N</sup> H</td><td> F p 033 <sup>fx</sup>°~ H</td><td> 365.23</td>
<td> P-1803</td><td> F JO F^y^ OH</td><td> כל</td><td><sup>N</sup> H</td><td> p 033<sup>F</sup> °-<sup>7 </sup>H</td><td> 351.23</td>
<td> P-1804</td><td> F N OH</td><td> S</td><td> 1 03 N N</td><td> F ץ f o-<sup>7</sup> SO</td><td> 381.26</td>
<td> P-1824</td><td> F OH</td><td> ό</td><td></td><td> F. ci^OM P y ץ \> f 0-<sup>7</sup><sup>N</sup> H</td><td> 385.22</td>
<td> P-1825</td><td> F JO F^y^ OH</td><td> :6</td><td> 03</td><td> F. Ύ 13 <sup>F 0-/</sup> H</td><td> 399.21</td>
<td></td><td> Phenol</td><td> Benzyl bromide</td><td> Azaindole</td><td> Compound</td><td> MS (ESI) [m+hT observed</td>
<td> P-1869</td><td> F s OH</td><td><sup>Br</sup>> ci׳V0</td><td> 03 ™ H</td><td> VO 0 <sup>c|/</sup></td><td> 415.24</td>
<td> P-1874</td><td> F c OH</td><td> Φ Cl</td><td> 3</td><td> V a<sup>ci </sup>33m 0 CYY Cl 0-9 <sup>1</sup> H</td><td> 415.23</td>
<td> P-1993</td><td> F f5־^ OH</td><td></td><td> ίΦο -'A</td><td> |y ־־״N 333 V N</td><td> 352.39</td>
<td> P-1992</td><td> F OH</td><td> Cl</td><td> OQ</td><td> Cl Vs ή 1ΓΎ? <sup>F 0</sup><sup>1</sup>An</td><td> 403.32</td>
Example 42: Synthesis of (3-Benzyloxy methyl-phenyl)-(lH-pyrrolo[2,3-6]pyridi11 yI)methanone P-1848 and 3-(3-Benzyloxy methyl-benzyI)-lH-pyrroIo[2,3-0]pyridine P-1857
[0422] Compounds P-1848 and P-1857 were synthesized in five steps from compounds 620 and lH&#1470;pyrrolo[2,36&#1470;]pyridine 94 as shown in Scheme 70.
Scheme 70
<img file="IL188248A_D0130.tif" />
Step 1 - Preparation of 3-Benzyloxy methyl-benzoic acid (621):
[0423] To a solution of 3-hydroxy methyl-benzoic acid (620, 5.0 g, 0.033 mol) in tetrahydrofuran (100 mL) and N,N-dimethylformamide (50 mL), sodium hydride (4.4 g,as 60% dispersion in mineral oil, 0.11 mol) was added slowly over 30 minutes and the reaction was stirred at 0 °C under an atmosphere of nitrogen. The reaction mixture was allowed to warm to room temperature, then stirred at room temperature for 1 hour. Benzyl bromide (9.0 mL, 0.076 mol) was added slowly into the reaction mixture, and the reaction mixture was stirred at room temperature overnight. The reaction mixture was poured into water, extracted with ethyl acetate, washed with a solution of ammonium chloride and ammonium hydroxide (4:1), brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as a white solid (621, 5.8 g, 73%).
Step 2 - Preparation of (3-Benzyloxy methyl-phenyl)-methanol (622):
[0424] To a solution of 3-benzyloxy methyl-benzoic acid (621, 3.0 g, 0.012 mol) in tetrahydrofuran (100 mL), lithium aluminum hydride (25 mL, IM solution in tetrahydrofuran, 0.025 mol) was added dropwise at 0 °C for 5 minutes. The reaction mixture was then stirred at room temperature overnight under an atmosphere of nitrogen. After sodium sulfate decahydrate (20.0 g, 0.062 mol) was added, the reaction mixture was stirred at room temperature for 10 minutes. A white solid was collected by filtration. The solid compound was further washed with a mixture of hexane and dichloromethane (9:1) and dried under high-vacuum (622, 2.8 g, 91%).
Step 3 - Preparation of3-Benzyloxy methyl-benzaldehyde (623):
(0425] To a solution of (3-benzyloxy methyl-phenyl)-methanol (622, 627 mg, 2.75 mmol) in tetrahydrofuran (60 mL) was added Dess-Martin periodinane (2.9 g, 6.87 mmol) at 0 °C. The resulting mixture was stirred at 0 °C for 50 minutes. The reaction mixture was quenched with a solution of saturated sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as a white solid (623, 0.55 g, 84%).
Step 4 - Preparation of (3-Benzyloxy methyl-phenyl)-(IH-pyrrolo[2,3-b]pyridin yl)-methanol (624) and 3-[(3-Benzyloxy methyl-phenyl)-methoxy-methyl]-lH-pyrrolo[2,3-b]pyridine (625): [0426] A mixture of lH-pyrrolo[2,3-0]pyridine (94, 0.33 g, 2.8 mmol), 3-benzyloxy methylbenzaldehyde (623, 0.55 g, 2.4 mmol), and potassium hydroxide (0.39 g, 6.1 mmol) in methanol (40 mL) was stirred at room temperature for 17 hours. The reaction mixture was poured into water and then extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide compound 624 as an off-white solid (330 mg, 39%, MS(ESI) [M+H4]'1' = 345.29, and compound 625 as a white solid (24 mg, 3%, MS(ESI) [M+H4]4 = 359.30).
Step 5a - Preparation of (3-Benzyloxy methyl-phenyl)-(lH-pyrrolo[2,3-b]pyridin yl)-methanone (P-1848):
[0427] To a solution of (3-Benzyloxy methyl-phenyl)-(lH-pyrrolo[2,3-h]pyridin yl)-methanol (624, 0.12g, 0.35 mmol) in tetrahydrofuran (15 mL) was added Dess-Martin periodinane (0.37 g, 0.89 mmol) at 0 °C . The reaction mixture was stirred at 0 °C for 50 minutes, then quenched with a saturated solution of sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue was washed with a mixture of ethyl ether and hexanes (1:1) to provide the compound as a yellow solid (P1848, 108 mg, 90%). MS(ESI) [M+H4]4 = 343.22.
Step 5b - Preparation of3-(3-Benzyloxy methyl-benzyl)-lH-pyrrolo[2,3-b]pyridine (P-1857): [0428] A mixture of 3-[(3-benzyloxy methyl-phenyl)-methoxy-methyl]-lH-pyrrolo[2,3b]pyridine (625, 24 mg, 0.067 mmol), trifluoroacetic acid (1 mL, 13 mmol), and triethylsilane (2 mL, 12,5 mmol) in acetonitrile (10 mL) was refluxed for 4 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of solvent, the residue was washed with a mixture of ethyl ether and hexanes (1:1) to provide the compound as a yellow solid (P-1857,17 mg, 75%). MSfESI) [M+H4]4 = 329.24.
Example 43: Synthesis of |3-(4-chloro-benzyloxy) ethoxy-phenyl]-(lH-pyrrolo[2,3-Z>]pyridin3-yl)-methanone P-1892 and 3-[3-(4-chIoro־benzyloxy) ethoxy-benzyl]-lH-pyrrolo[2,3ό] pyridine P-1893
[0429] Compounds P-1892 and P-1893 were synthesized in five steps from compounds 626, 557 and lH-pyrrolo[2,3-/7]pyridine 94 as shown in Scheme 71.
Scheme 71
<img file="IL188248A_D0131.tif" />
<img file="IL188248A_D0132.tif" />
Step 1 - Preparation of2,3-Bis-(4-chloro-benzyloxy)-benzaldehyde (627):
[0430] To a solution of 2,3-dihydroxybenzaldehyde (626, 2.0 g, 14.5 mmol) in tetrahydrofuran (100 mL) was added sodium hydride (0.52 g, 13.0 mmol) at 0 °C under an atmosphere of nitrogen. The reaction mixture was allowed to warm to room temperature and was stirred at room temperature for 30 minutes. To the reaction mixture was then added 4-chlorobenzyl bromide (557, 2.7 g, 13.0 mmol). The reaction mixture was stirred at room temperature under an atmosphere of nitrogen overnight. N, N-dimethylformamide (50 mL) was added into the reaction mixture and it was stirred at room temperature for 24 hours. The reaction mixture was poured into ice water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as an off-white solid (627, 2.3 gm, 46%).
Step 2 - Preparation of3-(4-chloro-benzyloxy) hydroxy-benzaldehyde (628):
[0431] To magnesium (0.098 g, turnings, 4.0 mmol) in a mixture of anhydrous ether (20 mL) and benzene (20 mL) at 0 °C, bromine (0.10 mL, 2.0 mmol) was added dropwise. When the reaction had started, stirring was commenced and the addition of bromine continued until complete. The ice bath was removed and the reaction mixture was heated until the solution was almost colorless. After cooling down, the reaction mixture was slowly added to a solution of 2, 3-bis-(4-chloro-benzyloxy)benzaldehyde (627, 0.78 g, 2.0 mmol) in benzene (60 mL) at room temperature while stirring vigorously. Upon completion of the addition, the reaction mixture was stirred at room temperature overnight, then refluxed for 36 hours. After the reaction mixture was cooled down to room temperature, a solid was collected by filtration and washed with benzene, then boiled in hydrochloric acid (100 mL, 1.0 M) for 30 minutes. After cool down, the solution was extracted with dichloromethane. The organic layer was washed with brine and dried over magnesium sulfate. An off-white solid was obtained after removal of the solvent (628, 0.32 mg, 60%). MS(ESI) [M-H-] =261.25.
Step 3 — Preparation of3-(4-chloro-benzyloxy) ethoxy-benzaldehyde (629):
[0432] To a mixture of 3-(4-chloro-benzyloxy) hydroxy-benzaldehyde (110 mg, 0.42 mmol), potassium carbonate (150 mg, 1.1 mmol) in acetonitrile (8 mL) was added iodoethane (0.2 mL, 2.5 mmol) at room temperature. The mixture was stirred at 98 °C for 18 hours. The reaction mixture was poured into a solution of saturated ammonium chloride and was extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over magnesium sulfate. After removal of solvent, a light yellow solid was obtained (629, 116 mg, 95%).
Step 4 - Preparation of [3-(4-chloro-benzyloxy) ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanol (630) and 3-{[3-(4-chloro-benzyloxy) ethoxy-phenyl]-methoxy-rnethyl}-lH-pyrrolo[2,3b]pyridine (631):
[0433] A mixture of 1H-Pyrrolo[2,3-Z?]pyridine (94, 26 mg, 0.22 mmol), 3-(4-chloro-benzyloxy)-2ethoxy-benzaldehyde (629, 54 mg, 0.19 mmol), and potassium hydroxide (30 mg, 0.4.6 mmol) in methanol (5 mL) was stirred at room temperature for 4 days. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide compound 630 as an off-white solid (20 mg, 26%, MS(ESI) [M+H4]4 = 409.32) and compound 631 as an off-white solid (44 mg, 56%, MS(ESI) [M+H4]4 == 423.33.
Step 5a - Preparation of [3-(4-chloro-benzyloxy) ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone (P-1892):
[0434] To a solution of [3-(4-chloro-benzyloxy) ethoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanol (630, 20 mg, 0.05 mmol) in tetrahydrofuran (8 mL) was added Dess-Martin periodinane (52 mg, 0.12 mmol) at 0 °C. The reaction mixture was stirred at 0 °C for 50 minutes. The reaction was quenched with a saturated solution of sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue was washed with a mixture of ethyl ether and hexanes (1:1) to provide the compound as a yellow solid (P-1892,15 mg, 75%), MS(ESI) [M+H4]4 = 407.38.
Step 5b — Preparation of 3-[3-(4-chloro-benzyloxy) ethoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P1893):
[0435] A mixture of 3-{[3-(4~chloro-benzyloxy) ethoxy-phenyl]-methoxy-methyl}-lHpyrrolo[2,3-0]pyridine (631, 44 mg, 0.1 mmol), trifluoroacetic acid (1 mL, 13 mmol), and triethylsilane (2 mL, 12.5 mmol) in acetonitrile (10 mL) was refluxed for 4 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of solvent, the residue was washed with a mixture of ethyl ether and hexanes (1:1) to provide the compound as a yellow solid (P-1893, 40 mg, 98%). MS(ESI) [M+H4]4 = 393.39.
[0436] [3-(4-Chloro-benzyloxy) methoxy-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)-methanone (P-1891), [3-(4-chloro-benzyloxy) (2,2,2-trifluoroethoxy)-phenyl]-(lH-pynolo[2,3-b]pyridin yl)methanone (P-2076), and [3-(4-chloro fluoro-benzyloxy) ethoxy-phenyl]-(5-methoxy-lHpyrrolo[2,3-b]pyridin-3&#1470;yl)-methanone (P-2016)
Cl
<img file="IL188248A_D0133.tif" />
(P-2076) and
<img file="IL188248A_D0134.tif" />
were prepared following the protocol of Scheme 71, substituting iodoethane with iodomethane in step 3 to provide P-1891, or substituting iodoethane with 2-iodo-l, 1,1-trifluoroethane in step 3 to provide P-2076, or substituting 4-chlorobenzyl bromide 557 with 4-chloro fluoro-benzyl bromide in step 1 and 7-azaindole 94 with 5-methoxy azaindole in step 4 to provide P-2016. MS(ESI) [M+H4]4 = 393.4 (P-1891), 461.08 (P-2076), and 455.2 (P-2016).
Example 44. Synthesis of Propane-l-sulfonic acid {3-[5-(4-chloro-phenyI)-lH-pyrrolo[2,3b]pyridine carbonyl]-2,4-difluoro-phenyl}-amide P-0956
[0437] Compound P-0956 was synthesized in three steps from 5-(4-chlorophenyl)-lH-pyrrolo[2,3 b]pyridine 514 and propane-l-sulfonic acid (2,4-difluoro formyl-phenyl)-amide 73 as shown in Scheme 72.
Scheme 72
<img file="IL188248A_D0135.tif" />
Step 1
<img file="IL188248A_D0136.tif" />
<img file="IL188248A_D0137.tif" />
Step !-Preparation of Propane-l-sulfonic acid (3-{[5-(4-chloro-phenyl)-lH-pyrrolo[2.3-b]pyridin-3yl]-hydroxy-methyl}-2,4-difluoro-phenyl)-amide (632) and Propane-l-sulfonic acid (3-{[5-(4-chlorophenyl)-lH-pyrrolo[2,3-b]pyridin yl]-methoxy-methyl}-2,4-difluoro-phenyl)-amide (632):
[0438] To a suspension of 5-(4-chloro-phenyl)-lH-pyrrolo[2,3-b]pyridine (514, 64.9 g, 158 mM, prepared as described in Example 17) and propane-l-sulfonic acid (2,4-difluoro formyl-phenyl)amide (73, 90.4 g, 191 mM, prepared as described in Example 7) in methanol in a water bath was added potassium hydroxide (128.8 g, 1.28 M). The reaction was stirred 72 hours at room temperature and then adjusted to pH 7 with 4N hydrochloric acid. The resulting mixture was evaporated in vacuo to remove methanol and.extracted 3x with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give a crude oil. The crude oil was triturated with 3:1 MTBE/heptane to give a 1:3 solid mixture of 632 and 633 that was used directly for the next step.
Step 2-Preparation of Propane-l-sulfonic acid (3-{[5-(4-chloro-phenyl)-lH-pyrrolo[2,3-b]pyridin-3yl]-hydroxy-methyl}-2,4-difluoro-phenyl)-amide (632):
[0439] To a solution of 632 and 633 (ca. 315 mM) in acetic acid was added 48% hydrobromic acid (final 8%). The resulting mixture was stirred overnight at room temperature and then evaporated in vacuo. The crude residue was taken up with equal volumes of ethyl acetate and water, and adjusted to pH 7 with solid potassium carbonate. The layers were split and the aqueous layer was extracted 2x with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give 632 as a viscous oil that was used directly for the next step.
Step 3-Preparation of Propane-l-sulfonic acid {3-[5-(4-chloro-phenyl)-lH-pyrrolo[2,3-b]pyridine-3carbonyl]-2,4-difluoro-phenyl}-amide (P-0956):
[0440] To a solution of 632 (ca. 386 mM) in 1,4-dioxane was added 2,3-dichloro-5,6dicyanobenzoquinone (83.8 g, 502 mM) followed by water (final 4.8%). The resulting mixture was stirred 2 hours at room temperature and then quenched with one volume of saturated sodium bicarbonate. The mixture was evaporated in vacuo to remove 1,4-dioxane and extracted 3x with ethyl acetate. The combined organic layers were dried over sodium sulfate and evaporated in vacuo to give a crude solid that was purified on a silica-gel column with 94:5:1 dichloromethane/methanol/ammonium hydroxide as eluent to give P-0956 (approximately 50% yield for 3 steps) as a white solid.
Example 45: Synthesis of 3-Iodo-l-trnsopropylsilanyl-lH-pyrroIo[2,3-b]pyridine 635
[0441] 3-Iodo-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine 635 was synthesized in one step from 3-Iodo-lH-pyrrolo[2,3-b]pyridine 634 as shown in Scheme 73.
Scheme 73
Step 1 - Preparation of3-Iodo-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (635):
[0442] 3-Iodo-lH-pyrrolo[2,3-b]pyridine 634 (2.00 g, 8.20 mmol) was dissolved in N,Ndimethylformamide (50 mL). Sodium hydride (60% dispersion in mineral oil, 390 mg, 9.8 mmol) was added. After 20 minutes, triisopropylsilyl chloride (1,74 mL, 8.20 mmol) was added dropwise. After 1.5 hours, the reaction was poured into water and extracted with ethyl acetate, washed with saturated sodium bicarbonate and brine. The organic portions were dried over anhydrous sodium sulfate and concentrated. Purification by silica gel chromatography, 0-25% gradient ethyl acetate/ hexane gave compound 635 as a white solid (3.224 g, 98.2%). 1H-NMR was consistent with the desired compound,
Example 46: Synthesis of l“(tert-Butyl-dimetbyl-silanyl) iodo-lH-pyrroIo[2,3-b]pyridine 636
[0443] 1 &#1470;(tert-Butyl-dimethyl-silanyl) iodo-lH-pyrrolo[2,3-b]pyridine 636 was synthesized in one step from 3-Iodo-lH-pyrrolo[2,3-b]pyridine 634 as shown in Scheme 74.
Scheme 74
PCT7TJS2006/024361
Step 1 - Preparation of l-(tert-Butyl-dimethyl-silanyl) iodo-lH-pyrrolo[2,3-b]pyridine (636): [0444] 3-Iodo-lH-pyrrolo[2,3-b]pyridine 634 (1.11 g, 4,6 mmol) was dissolved in tetrahydrofuran (120 mL). Sodium hydride (60% dispersion in mineral oil, 0.13 g, 5.5 mmol) was added, followed by tert-butyldimethylsilyl chloride (0.85 g, 5.5 mmol). The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic portion was washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified with silica gel column chromatography eluting with 30% ethyl acetate in hexane to give the compound as a white solid (636, 100 mg, 15%).
Example 47: Synthesis of [5-(4-chloro-benzyloxy) methoxy-pyridin yI]-(lH-pyrroIo[2,3b]pyridin yl)-methanone P-2024
[0445] [5-(4-Chloro-benzyloxy) methoxy-pyridin yl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone P-2024 was synthesized in six steps from Kojic acid, 3, and 3-iodo-l-triisopropylsilanyllH-pyrT010[2,3-b]pyridine, 2, as shown in Scheme 75.
Scheme 75
<img file="IL188248A_D0138.tif" />
<img file="IL188248A_D0139.tif" />
<img file="IL188248A_D0140.tif" />
Step 1 - Preparation of5-(4-chloro-benzyloxy)~2-hydroxymethyl-pyran one (638):
[0446] Kojic acid (637, 5.00 g, 35.2 mmol) and 4-chlorobenzyl bromide (557, 7.95 g, 38.7 mmol) were suspended in methanol (40 mL) in an 80 mL sealed tube. Sodium hydroxide in water (12 M, 2.93 mL) was added. The reaction was heated at 80 °C overnight. The resulting suspension was concentrated. Water was added and the mixture was filtered and washed with water to provide a brown solid. Washing with minimal methanol on the filter removed the brown color. A white solid (638, 7.58 g, 80%) was isolated. ,H-NMR was consistent with the desired compound.
Step 2 - Preparation of 5-(4-chloro-benzyloxy) hydroxymethyl-lH-pyridin one (639): [0447] 5-(4-Chloro-benzyloxy) hydroxymethyl-pyran one (638, 8.00 g, 3.00 mmol) was suspended in ammonium hydroxide (200 mL) in an 80 mL sealed tube. The reaction was heated at 90 °C overnight. Upon cooling, the reaction was lowered to pH 10 with 6N HC1 to provide a beige solid that was collected by filtration (639, 7.8 g, 98%).
Step 3 — Preparation of [5-(4-chloro-benzyloxy) methoxy-pyridin yl]-methanol (640):
[0448] 5-(4-Chloro-benzyloxy) hydroxymethyl-lH-pyridin one (639, 1.06 g, 3.99 mmol) was dissolved in methanol (8.5 mL) andN,N-dimethylformamide (46 mL). Trimethylsilyldiazomethane in hexane (2.00 M, 3.99 mL) was added. The reaction was stirred at room temperature overnight, then additional trimethylsilyldiazometbane in hexane (2.00 M, 3.99 mL) was added. The reaction was stirred at room temperature for 2 days. The mixture was adsorbed onto silica and purified by silica gel chromatography, methanohdichloromethane to provide the compound (640, 798 mg, 72 %). MS(ESI) [M+H+]+= 280.4, 282.4.
Step 4 - Preparation of 5-(4-chloro-benzyloxy) methoxy-pyridine carbaldehyde (641): [0449] [5-(4-Chloro-benzyloxy) methoxy-pyridin yl]-methanol (640, 480 mg, 1.7 mmol) was dissolved in dimethyl sulfoxide (26 mL) and Dess-Martin periodinane (909 mg, 2.1 mmol) was added. The reaction was allowed to stir at room temperature for 2 hours. The reaction was concentrated under high vacuum and then poured into a solution of NaHCO3 and Na2S2O3. The mixture was extracted with ethyl acetate. The organic portions were dried with anhydrous sodium sulfate and filtered. The filtrate was adsorbed onto silica and purified by silica gel chromatography, ethyl acetate:hexanes, to provide the desired compound as a white powder (641, 343 mg, 72 %).
Step 5 - Preparation of [5-(4-chloro-benzyloxy) methoxy-pyridin yl]-(l-triisopropylsilanyl-lHpyrrolo[2,3-b]pyridin yl)-methanol (642):
[0450] 3-Iodo-l-triisopropyIsilanyl-lH-pyrrolo[2,3-b]pyridine (635, 180 mg, 0.450 mmol) was dissolved in tetrahydrofuran (2.5 mL) and the reaction was cooled to -20 °C under an atmosphere of nitrogen. Isopropylmagnesium chloride in tetrahydrofuran (2.00 M, 0.243 ml.) was added. The reaction was stirred for 1 hour, during which the temperature rose to 0 °C. The reaction was cooled to -20 °C and 5-(4-chloro-benzyloxy) methoxy-pyridine carbaldehyde (641, 80.0 mg, 0.288 mmol) in tetrahydrofuran (0.75 mL) was added. The reaction was allowed to warm to room temperature and stirred overnight. The reaction was quenched with methanol and adsorbed onto silica, then purified by silica gel chromatography, methanol: dichloromethane, to provide the desired product, (642, 94 mg, 59%). ’H-NMR was consistent with the desired compound. MS(ESI) [Ni4&#1470;H*]+= 552.4, 554.4,
555.4.
Step 6-Preparation of [5-(4-chloro-benzyloxy) methoxy-pyridin yl]-(lH-pyrrolo[2,3-b]pyridin3-yl)-methanone (P-2024):
[0451] [5-(4-ChIoro-benzyloxy) methoxy-pyridin yl]-(l-triisopropylsilanyl-lH-pyrrolo[2,3b]pyridin yl)-methanol (642, 60.0 mg, 0.11 mmol) was dissolved in tetrahydrofuran (2.00 mL). Dess-Martin periodinane (55.3 mg, 0.13 mmol) was added to the reaction and it was stirred at room temperature overnight. The mixture was extracted with ethyl acetate and saturated sodium bicarbonate. The organic portions were dried with anhydrous sodium sulfate, filtered and the filtrate was adsorbed onto silica and purified by silica gel chromatography, methanohdichloromethane, to provide the desired compound (P-2024, 10.7 mg, 25%). &#1523;H-NMR was consistent with the desired compound. MS(ESI) [M+H4]4 = 394.1, 396.1.
Example 48: Synthesis of 3 [l-(4-chloro&#1470;phenyl)-ethoxy] methoxy-benzyl-lH-pyrrolo[2,3b] pyridine P-2000
[0452] 3 [l -(4-Chloro-phenyl)-ethoxy] methoxy-benzyl-lH-pyrrolo[2,3-b]pyridme P-2000 was synthesized in three steps from vanillin 105, 4-chlorophenylmethylcarbinol 643, and l-(tertbutyl-dimethyl&#1470;silanyl)3&#1470;-iodo-lH-pyrrolo[2,3-b]pyridine 636, as shown in Scheme 76.
Scheme 76
<img file="IL188248A_D0141.tif" />
Step !-Preparation of 4-[l-(4-chloro-phenyl)-ethoxy]-3'-methoxy-benzaldehyde (644): [0453] 4-Chlorophenylmethylcarbinol (643, 0.668 mL, 6.57 mmol) was dissolved in tetrahydrofuran (60.0 mL) at 0 °C under an atmosphere of nitrogen. 4-Hydroxy-3methoxybenzaldehyde (105, 1.00 g, 6.57 mmol) and triphenylphosphine (2.07 g, 7.89 mmol) were added to the reaction, followed by diisopropyl azodicarboxylate (1.55 mL, 7.89 mmol) over 10 minutes. The reaction was stirred for 2 hours. The mixture was adsorbed onto silica and purified by silica gel chromatography, ethyl acetateihexanes, to provide the desired compound, (644,1.14 g, 60 %). 1H-NMR was consistent with the desired compound,
Step 2 - Preparation of [l-(tert-Butyl-dimethyl-silanyl)-lH-pyrrolo[2,3-b]pyridin yl] [l-(4chloro-phenyl)-ethoxy] methoxy-phenyl-methanol (645):
[0454] l-(tert-Butyl-dimethyl-silanyl) iodo&#1470;lH-pyrrolo[2,3-b]pyridine (636, 647.0 mg, 1.81 mmol) was dissolved in tetrahydrofuran (10.0 mL) at -20 °C under an atmosphere of nitrogen.
Isopropylmagnesium chloride in tetrahydrofuran (2.0 M, 0.98 mL) was added to the reaction. The reaction was stirred for 1 hour, during which the temperature rose to 0 °C. The reaction was cooled to -20 °C and 4-[l-(4-chloro-phenyl)-ethoxy] methoxy-benzaldehyde (644, 420 mg, 1.4 mmol) in tetrahydrofuran (3.00 mL) was added. The reaction was stirred for 2 hours during which time the temperature rose to 10 °C. The reaction was quenched with methanol and adsorbed onto silica, then purified by silica gel chromatography, ethyl acetate:hexanes, to provide the desired compound, (645, 463 mg, 61%). ’Η-NMR was consistent with the desired compound.
Step 2 - Preparation of 3 [l-(4-chloro-phenyl)-ethoxy] methoxy-benzyl-lH-pyrrolo[2,3bjpyridine (P-2000):
[0455] [l-(tert-Butyl-dimethyl-silanyl)-lH -pyrrolo[2,3-b]pyridin yl] [l-(4-chloro-phenyl)ethoxy] methoxy-phenyl-methanol (645, 0.200 g, 0.382 mmol) was dissolved in acetonitrile (5.00, mL). Trifluoroacetic acid (0.138 mL) was added and the reaction was stirred for five minutes.
Triethylsilane (0.285 mL) was added and the reaction was heated at 80 °C for 2 hours. The reaction was concentrated, then redissolved in ethyl acetate and adsorbed onto silica and purified by silica gel chromatography, ethyl acetate:hexanes, to provide the desired compound (P-2000, 57 mg, 38 %). 1HNMR was consistent with the desired compound. MS(ESI): [M+H4/ 393.3, 395.3.
Example 49: Synthesis of 5-[4-(2&#1470;methoxyethoxy)&#1470;phenyl]-lH&#1470;pyrrolo[2,3-b]pyridine 648
[0456] 5-[42)&#1470;-Methoxyethoxy)-phenyl]-lH-pyrrolo[2,3-b]pyridine 648 was synthesized in two steps from 4-bromophenol 646 as shown in Scheme 77.
Scheme 77
<img file="IL188248A_D0142.tif" />
Step 1 - Preparation l-Bromo (2-methoxy-ethoxy)-benzene (647):
[0457] To a solution of 4-bromophenol (646,5.0 g, 28.9 mmol) in dimethylformamide (15 mL) were added potassium carbonate (4.40 g, 31.8 mmol) and l-bromo methoxyethane (5.00 g, 36.0 mmol) under an atmosphere of nitrogen. The reaction mixture was stirred at ambient temperature overnight and concentrated under reduced pressure. The residue was slurried in ethyl acetate (50 mL) and filtered. The filtrate was washed with saturated sodium bicarbonate solution, dried over magnesium sulfate and filtered. Silica gel column chromatography (0-10% ethyl acetate in hexanes) gave the desired compound as a colorless oil (647, 3.2 g, 48%).
Step 2 - Preparation of 5-[4-(2-Methoxy-ethoxy)-phenyl]-lH-pyrrolo[2,3-b]pyridine (648): [0458] To a solution of 5-(4,4,5,5,-tetramethyl-[l,3,2]dioxaborolan yl)-lH-pyrrolol[2,3b]pyridine (1.1 g, 4.3 mmol) in tetrahydrofuran (40 mL) was added 1-bromo (2-methoxy-ethoxy)benzene (647, 1.50 g, 6.49 mmol) and tetrakis(triphenylphosphine)palladium (0) (0.25 g, 0.21 mmol). The reaction mixture was stirred with potassium carbonate solution (10 mL, 1.0 M) and wanned to reflux overnight. The biphasic reaction mixture was diluted with ethyl acetate (50 mL) and saturated sodium carbonate solution (20 mL). The organic layer was separated, washed with brine, dried over magnesium sulfate and purified by silica gel column chromatography (50-100% ethyl acetate in hexanes) to give the desired compound as a colorless solid (648, 782 mg, 67%). MS (ESI) [M+H+]+ = 267.4.
Example 50: Synthesis of 3-[2-fluoro methoxy (pyridin ylmethoxy)-benzyI]-lHpyrrolo[2,3-b]pyridine P-2040 and related compounds.
[0459] Compound P-2040 was synthesized in one step from 5-fluoro methoxy (l triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenol 649 and pyridin yl-methanol 650 as shown in Scheme 78.
<img file="IL188248A_D0143.tif" />
<img file="IL188248A_D0144.tif" />
Step 1 - Preparation of 3-[2fluoro methoxy (pyridin ylmethoxy)-benzyl]-lH-pyrrolo[2,3b]pyridine (P-2040):
[0460] 5-Fluoro methoxy (l-triiisopropylsilanyl-lH-pyrT010[2,3-b]pyridine-3&#1470;ylmethyl)phenol (649, 10 mg, 0.024 mmol, prepared as described in Example 57) was combined with pyridin4-yl-methanol (650, 3.2mg, 0,029 mmol) in a 4 mL vial and dissolved in dry tetrahydrofuran (200μ1). Triphenylphosphine (7.7 mg) was added and the solution was shaken until homogenous. The mixture was cooled to below 0 °C in a liquid nitrogen bath and diisopropyl azodicarboxylate solution (50μ1 of 20mg/50pl in THF) was added. The reaction mixture was allowed to warm to room temperature.
After 2 hours, the solvent was removed under reduced atmosphere. The crude material was dissolved in dimethyl sulfoxide (300μ1) and potassium fluoride (10 mg, 0.18mmol) was added. The mixture was heated gently and allowed to react overnight at room temperature, The vial was centrifuged and the DMSO solution was purified by reverse phase HPLC using a YMC-Pack ODS-A C-18 column (50mm x 10mm ID), and eluting with water with 0.1% TFA and a gradient of 15%-80% acetonitrile with 0.1% TFA over 8 minutes and a flow rate of 6 mL/minute to provide the compound (P-2040, 4.4 mg, 50%). MS (ESI) [M+H4]4364.3 &#1470;.
[0461] Additional compounds were prepared following the protocol of Scheme 78, replacing pyridin yl-methanol 650 with an appropriate alcohol. The following compounds were made following this procedure:
3-[2-Fluoro methoxy (2-morpholin yl-ethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2037), 3-[2-Fluoro methoxy (pyridin ylmethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2038), 3-[2-Fluoro methoxy (6-methyl-pyridin ylmethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2039), 3-[2-Fluoro methoxy (pyridin ylmethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2041), 32]&#1470;-Fluoro (2-fluoro trifluoromethyl-benzyloxy) methoxy-benzyl]-lH-pyrrolo[2,3b]pyridine (P-2042), 3-[4-(4-Chloro fluoro-benzyloxy) fluoro methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-1973),
3-(4-(2,4-Dimethyl-thiazol ylmethoxy) fluoro methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2043),
3-(4-(2,5-Dimethyl-2H-pyrazol ylmethoxy) fIuoro methoxy-benzyl]-lH-pyrrolo[2,3b]pyridine (P-2044), 3-[2-Fluoro methoxy (3-morpholin yl-propoxy)-benzyl]-lH-pynOlo[2,3-b]pyridine (P-2045),
1- {2-[5-Fluoro methoxy (lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenoxy]-ethyl}-pyrrolidin-
2- one (P-2046),
3- [2-Fluoro (2-fluoro-benzyloxy) methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2047), 3-[2-Fluoro methoxy (3-methyl-pyridin ylmethoxy)-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2048),
3-[2-Fluoro methoxy (6-trifluoromethyl-pyridin ylmethoxy)-benzyl]-lH-pyrrolo(2,3b]pyridine (P-2049),
3-(4-(2,4-Dichloro-benzyloxy) fluoro methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2050), 3-[2-Fluoro (4-imidazol-l-yl-benzyloxy) methoxy-benzyl]-lH-pynOlo[2,3-b]pyridine (P-2051),
3-(4-(2,4-Difluoro-benzyloxy) fluoro methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2052), 3-{2-Fluoro [l-(2-fluoro-phenyl)-ethoxy] methoxy-benzyl}-lH-pyrrolo[2,3-b]pyridine (P-2053), 3-[4-(3-Cyclopentyl-propoxy) fluoro methoxy-benzyl]-lH-pynolo(2,3-b]pyridine (P-2054), 3-(4-(1,5-Dimethyl-lH-pyrazol ylmethoxy) fluoro methoxy-benzyl]&#1470;lH-pyrrolo(2,3b]pyridine (P-2055), and
3-(4-(2-Cyclopentyl-ethoxy) fluoro methoxy-benzyl]-lH-pyrrolo[2,3-b]pyridine (P-2056) The following table indicates the alcohol (column 2) used in Scheme 78 to provide the compounds (column 4). Column 1 provides the compound number and column 4 the observed mass.
<td></td><td colspan="2"> Alcohol</td><td colspan="3"> Compound</td><td> MS(ESI) [M+H<sup>+</sup>]<sup>+ </sup>observed</td>
<td> P-2037</td><td> HO׳''</td><td> o ____________________________________________ 1</td><td> C N</td><td> A n> ° N . H</td><td></td><td> 386.3</td>
<td> P-2038</td><td> HO</td><td> r=<sup>N</sup>\</td><td> o N</td><td> R A p a</td><td> -sN</td><td> 364.3</td>
<td></td><td> Alcohol</td><td> Compound</td><td> MS(ESI) [M+Hf observed</td>
<td> P-2039</td><td> ho j<sup>N</sup>3</td><td> XX <sup>N</sup> H</td><td> 378.3</td>
<td> P-2041</td><td> HO. H</td><td> R XX 03 /°</td><td> 364.3</td>
<td> P-2042</td><td> \_ F</td><td> r \ F qA</td><td> 448.7 —</td>
<td> P-1973</td><td> F. HO 7X<sup>CI</sup></td><td> F F XX</td><td> 415.1</td>
<td> P-2043</td><td></td><td> R \ /^-A s (lx ׳ X^N</td><td> 397.9</td>
<td> P-2044</td><td> *AX</td><td> א \ ° 03</td><td> 381.1</td>
<td> P-2045</td><td> HO ^־o</td><td><sup>2</sup>O -C)\ 0</td><td> 400.3</td>
<td></td><td> Alcohol</td><td> Compound</td><td> MS(ESI) [M+hTT observed__</td>
<td> P-2046</td><td> HO.___ p $</td><td> AX ^n-{ rn ? O <sup>N</sup> H</td><td> 384.3</td>
<td> P-2047</td><td> F<sub>x </sub>HO. ־־־־^ ׳Vj/</td><td> aJX <sup><N</sup> H</td><td> 381.1</td>
<td> P-2048</td><td> HO y'N ^־־־V</td><td> αΤΧ <sup><N</sup> h</td><td> 378.3</td>
<td> P-2049</td><td> i</td><td><sup>2</sup>Q xz^AΌ\ Ο V z ת־ U</td><td> 432.3</td>
<td> P-2050</td><td> Cl HO. / T—<sup>Cl </sup>MJ׳</td><td> F. Cl n <sup>N</sup> H</td><td> 431.1</td>
<td> P-2051</td><td></td><td></td><td> 429.1</td>
<td> P-2052</td><td> ho. tm —V</td><td></td><td> 399.1</td>
<td></td><td> Alcohol</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-2053</td><td> F<sub>x</sub> HO, / ל) y־־V</td><td> Ο χχ^Ο- Of ־'-(οχ ο 0</td><td> 395.1</td>
<td> P-2054</td><td></td><td> 03 <sup>/0</sup></td><td> 383.1</td>
<td> P-2055</td><td> ל</td><td> R__ / 03 <sup>/0</sup><sup>Ν</sup> Η</td><td> 381.1</td>
<td> P-2056</td><td></td><td><sup>2</sup>Q J</td><td> 369.1</td>
Example 51: Synthesis of [2,6-difluoro (pyridin yhnethoxy)-phenyI]-(lH-pyrrolo[2,3b]pyridin-3&#1470;yl)-methanone P-2058 and related compounds.
[0462] Compound P-2058 was synthesized in 1 step from (2>6-Difluoro hydroxy-phenyl)-(lHpyrrolo[2,3-b]pyridin yl)-methanone 651 and Pyridin yl-methanol 652 as shown in Scheme 79.
Scheme 79
<img file="IL188248A_D0145.tif" />
<img file="IL188248A_D0146.tif" />
Step 1 - Preparation of [2,6-Difluoro (pyridin ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3yl)-methanone (P-2058):
[0463] In a 4mL vial, (2,6-Difluoro hydroxy-phenyl)-(lH-pyrrolo[2,3-b]pyridine yl)methanone (651, 10 mg, 0.037 mmol, prepared as described in Example 23) was combined with pyridin yl-methanol (652, 4.9 mg 0.044 mmol). The solids were dissolved in dry tetrahydrofuran (200μ1) and triphenylphosphine (11.5 mg, 0.044 mmol) was added. Once the solution was homogenous, the mixture was cooled to below 0 °C in liquid nitrogen bath and diisopropyl azodicarboxylate solution (50μ1 of 20mg/50pl THF) was added. The reaction mixture was allowed to warm to room temperature and the reaction was continued for 2 hours. ,The solvents were removed under reduced atmosphere. The resultant residue was diluted with 200μ1 DMSO and the mixture purified by reverse phase HPLC using a YMC-Pack ODS-A C-l 8 column (50mm x 10mm ID), and eluting with water with 0.1% TFA and a gradient of 15%-80% acetonitrile with 0.1% TFA over 8 minutes and a flow rate of 6 mL/minute to provide P-2058 (5.9 mg, 44 %). MS (ESI) [M+H*]+= 365.9.
[0464] Additional compounds were prepared following the protocol of Scheme 79, replacing pyridin yl-methanol 652 with an appropriate alcohol. The following compounds were made following this procedure:
[2,6-Difluoro (l-methyl-lH-imidazol ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone (P-2033), [2,6-Difluoro (6-morpholin yl-pyridin ylmethoxy)-phenyI]-(lH-pyrrolo[2,3-b]pyridin-3yl)-methanone (P-2034), {2,6-Difluoro [4-(5-methyl-[l,2,4]oxadiazol yl)-benzyloxy]-phenyl}-(lH-pyrrolo[2,3b]pyridin y!)-methanone (P-2035), [3-(6-Diethylamino-pyridin ylmethoxy)-2,6-difluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone (P-2036), [3-(2-Chloro fluoro-benzyloxy)-2,6-difluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone (P-2057), [2,6-Difluoro (6-methyl-pyridin ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone (P-2059), [2,6-Difluoro (pyridin ylmethoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)-methanone (P-2060), [3-(4-Chloro fluoro-benzyloxy)-2,6-difluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone (P-2061),
[3-(2,4-Dimethyl-thiazol ylmethoxy)-2,6-difluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)methanone (P-2062),
[3-(2,5-Dimethyl-2H-pyrazol ylmethoxy)-2,6-difluoro-phenyl]-(lH-pyrrolo[2,3-b]pyridin-3yl)-methanone (P-2063), and
[2,6-Difluoro (3-morpholin yl-propoxy)-phenyl]-(lH-pyrrolo[2,3-b]pyridin yl)-methanone (P-2064).
The following table indicates the alcohol (column 2) used to afford the compound (column 3).
Column 1 provides the compound number and column 4 the observed mass.
<td></td><td> Alcohol</td><td> Compound</td><td> MS(ESI) [M+1T]<sup>+ </sup>observed</td>
<td> P-2033</td><td> '<־״ nA</td><td> R 03 <sup>f 0</sup> A ח</td><td> 369.1</td>
<td> P-2034</td><td> ho־־־x_. O Q</td><td> 03 <sup>F</sup> °A <sup>N</sup> H vZ _________________\-0</td><td> 451.1</td>
<td> P-2035</td><td> HO־־־\__ Q</td><td> ?3 o Cm o</td><td> 447.1</td>
<td> P-2036</td><td> HO־־X_ o <sup>N</sup></td><td> MT z o Cm w</td><td> 437.1</td>
<td> P-2057</td><td> Cl HO־׳־\ / Q F</td><td> F. T/C Cl 03 <sup>f</sup> °5ך <sup>N</sup> H \־־־\ _________________________________E____</td><td> 417.1</td>
<td> P-2059</td><td> ho'Vn Γ y־׳</td><td> O O</td><td> 380.3</td>
<td></td><td> Alcohol</td><td> Compound</td><td> MS(ESI) [M+H<sup>4</sup>]<sup>4 </sup>observed</td>
<td> P-2060</td><td> HO-N^ o \־־N</td><td> o 03 //</td><td> 365.9</td>
<td> P-2061</td><td> ΗΟ7\־־־ Ό <sup>S</sup>c1</td><td> E. vU / F 03 <sup>f</sup><sup>N</sup> H Cl</td><td> 417.1</td>
<td> P-2062</td><td> /\־־־HO</td><td> R yO ן ח</td><td> 399.9</td>
<td> P-2063</td><td><sup>Η</sup>°Ύ/</td><td> F<sub>x</sub> 03 <sup>F</sup> °V GN ו ח</td><td> 383.1</td>
<td> P-2064</td><td></td><td> F, yQ CO <sup>F 0</sup>V-x <sup>N</sup> « U</td><td> 402.3</td>
Example 52: Synthesis of [3-(4-Chloro fluoro-benzyloxy) (2-fluoro-ethoxy)-phenyl]-(lHpyrro lo[2,3-b]pyridin3&#1470;-yl)-methanone P-2086 and 3-[3-(4-Chloro fluoro-benzyloxy)- 2-(2fluoro-ethoxy)-benzyl]-lH-pyrr 010[2,3-b]pyridine P-2085
[0465] Compounds P-2086 and P-2085 were synthesized in three steps from compounds 659 and lH-pyrrolo[2,3-d]pyridine 94 as shown in Scheme 81.
Scheme 81
<img file="IL188248A_D0147.tif" />
<img file="IL188248A_D0148.tif" />
<img file="IL188248A_D0149.tif" />
Step 1 - Preparation of3-(4-Chloro fluoro-benzyloxy) (2fluoro-ethoxy)-benzaldehyde (660): [0466] To a solution of 3-(4-Chloro fluoro-benzyloxy) hydroxy-benzaldehyde (659,140 mg, 0.5 mmol, prepared by protocol of Example 43, Steps 1 and 2 of Scheme 71, using 4-chloro fluorobenzyl bromide in place of 4-chloro-benzyl bromide in Step 1) in tetrahydrofuran (8 mL) was added dropwise a mixture of 2-fluoro-ethanol (64 mg, 1.0 mmol), triphenylphosphine (180 mg, 0.7 mmol), and diisopropyl azodicarboxylate (120 mg, 0.6 mol) in tetrahydrofuran (5 ml) at 0 °C. The reaction mixture was stirred at 0 °C for 10 minutes and then at 40 °C for 3 days. The reaction mixture was dissolved in water and ethyl acetate. The organic layers were collected, washed with brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexanes to provide the compound as a white solid (660, 88 mg, 54%). MS (ESI) [M+H4]4 =327.12.
Step 2 - Preparation of [3-(4-Chloro fluoro-benzyloxy) (2-fluoro-ethoxy)-phenyl]-(lH-pyrro lo[2,3-b]pyridin yl)-methanol (661) and 3-{[3-(4-Chloro fluoro-benzyloxy) (2-fluoro-ethoxy)phenyl]-methox y-methyl}-IH-pyrrolo[2,3-b]pyridine (662):
[0467] A solution of 3-(4&#1470;chloro-2&#1470;fluoro-benzyloxy) ( 2-fluoro-ethoxy)-benzaldehyde (660, 88 mg, 0.27 mmol), lH-pyrrolo[2,3-i]pyridine (94, 38 mg, 0.32 mmol), and potassium hydroxide (45 mg, 0.81 mol) in methanol (5 mL) was stirred at room temperature for 24 hours. The reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was collected, washed with brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide compound 661 as a white solid (67 mg, 56%), MS(ES1) [M+H4]4 = 445.13 and compound 662 as a white solid (36 mg, 29%), MS(ESI) [M+H4]4 = 459.15.
Step 3a - Preparation of [3-(4-Chloro fluoro-benzyloxy) (2-fluoro-ethoxy)-phenyl]-(lH-pyrro lo[2,3-b]pyridin yl)-methanone (P-2086):
[0468] To a solution of [3-(4-chloro f[uoro-benzyloxy) (2-fluoro-ethoxy)-phenyl]-(lHpyrrolo[2,3-0]pyridin yl)-methanol (661, 60 mg, 0.1 mmol) in tetrahydrofuran (10 mL) was added Dess-Martin periodinane (69 mg, 0.16 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 3 hours. The reaction was quenched with a saturated solution of sodium thiosulfate, extracted with ethyl acetate, washed with sodium bicarbonate, brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexanes to provide the compound as a white solid (P-2086,15 mg, 20%). MS(ESI) [M+H4]4 = 441.06.
Step 3b - Preparation of 3-[3-(4-Chloro fluoro-benzyloxy)- 2-(2-fluoro-ethoxy)-benzyl]-lH-pyrr olo[2,3-b]pyridine (P-2085):
[0469] A mixture of 3- {[3-(4-chloro fluoro-benzyloxy) (2-fluoro-ethoxy)-phenyl]-methoxymethyl)-lH-pyrrolo[2,3-6]pyridine (662, 36 mg, 0.078 mmol), triethylsilane (0.5 mL, 3 mmol), and trifluoroacetic acid (0.2 mL, 2 mmol) in acetonitrile (20 mL) was stirred at 80 °C for 2 hours. The mixture was concentrated and the residue was dissolved in ethyl acetate. The solution was washed with saturated sodium bicarbonate, brine, and dried over sodium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexanes to provide the compound as a yellow solid (P-2085, 24 mg, 71%). MS(ESI) [M+H4]4 = 429.15.
[0470] 3-(4-Chloro-benzyloxy) (2,2-difluoro-ethoxy)-phenyl]-(lH-pyrrolo[2,3-Z?]pyridin yl)methanone (P-2075) nN / hf-A
F (P-2075) was prepared following the protocol of Scheme 81, substituting 2-fluoro-ethanol with 2,2-difluoroethanol and substituting 3-(4-Chloro fluoro-benzyloxy) hydroxy-benzaldehyde with 3-(4-chlorobenzyloxy)-2&#1470;hydroxy-benzaldehyde (628 of Example 43) in Step 1 to provide P-2075. MS(ESI) [Μ+ΑΓ = 443.1.
Example 53; Synthesis of [3-(2-Chloro methanesulfonyl-benzyloxy) ethoxy-phenyl]-(lHpyrrolo[2,3-b]pyridin yl)-methanone P-2094
[0471] Compound P-2094 was synthesized in four steps from compounds 635 and 663 as shown in Scheme 82.
Scheme 82
<img file="IL188248A_D0150.tif" />
Step Γ- Preparation of (3-Benzyloxy ethoxy-phenyl)-(l-triisopropylsilanyl-lH-pyrrolo[2,3b]pyridin yl)-methanol(664):
[0472] To a solution of 3-iodo-l-triisopropylsilanyl-lH-pyrrolo[2,3-0]pyridine (635,1.306 g, 3.26 mmol) in tetrahydrofuran (42 mL) at -20 °C under nitrogen was added isopropylmagnesium chloride (1.70 mL, 2.0 M solution in tetrahydrofuran, 3,40 mmol). The reaction mixture was stirred at -20 °C for 1.5 hours. It was allowed to warm to 5 °C and then kept at 5 °C for 1 hour. The reaction mixture was then cooled down to -20 °C. To this solution was slowly added a solution of 2-ethoxy-3benzyloxybenzaldehyde (663, 0.698 g, 2,72 mmol, prepared by protocol of Example 43, Steps 1-3 of Scheme 71, using benzyl bromide in place of 4-chloro-benzyl bromide in Step 1) in tetrahydrofuran (42 mL). The reaction mixture was stirred at -20 °C for 2.5 hrs, and was allowed to warm to 5 °C for 2,5 hours. The reaction mixture was poured into iced water, extracted with ethyl acetate, washed with saturated ammonium chloride and brine, and dried over magnesium sulfate. After removal of solvent, the residue was purified by silica gel column chromatography eluting with ethyl acetate in hexane to provide the compound as light-yellow oil (664, 200 mg, 13.9%).
Step 2 - Preparation of (2-ethoxy hydroxy-phenyl)-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin3-yl)-methanone (665):
[0473] To a solution of (3-benzyloxy ethoxy-phenyl)-(l-triisopropylsilanyl-lH-pyrrolo[2,30]pyridin yl)-methanol (664,195 mg, 0.37 mmol) in a mixture of methanol (20 mL) and tetrahydrofuran (50 mL) was added palladium on carbon (50 mg, 10% wt., 0.2 mmol). The mixture was stirred under hydrogenation for seventeen hours. After removal of solvent, the residue was washed with a mixture of ethyl ether and hexanes to provide the compound as a white solid (665, 63 mg, 95%). MS(ESI) [Μ+Ηψ = 439.37.
Step 3 - Preparation of [3-(2-Chloro methanesulfonyl-benzyloxy) ethoxy-phenyl]-(ltriisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin-3~yl)-methanone (666):
[0474] To a solution of (2-ethoxy3&#1470;-hydroxy-phenyI)-(l-triisopropylsilanyl-lH-pyrrolo[2,3b]pyridin yl)-methanone (665,40 mg, 0.064 mmol) in tetrahydrofuran (15 mL) was added sodium hydride (3.32 mg, 0.083 mmol) at room temperature under an atmosphere of nitrogen. The mixture was stirred at room temperature for 40 minutes, thenl-bromomethyl chloro methanesulfonylbenzene (21.72 mg, 0.077 mmol) was added to the reaction mixture. It was stirred at room temperature overnight. The mixture was then poured into water and was extracted with ethyl acetate. The organic layer was collected and washed with brine, dried over magnesium sulfate. After removal of the solvent, a crude compound as light yellow oil was obtained (666, 84 mg).
Step 4 - Preparation of [3-(2-Chloro methanesulfonyl-benzyloxy) ethoxy-phenyl]-(lHpyrrolo[2,3-b]pyridin yl)-methanone (P-2094):
[0475] To a solution of (2-ethoxy hydroxy&#1470;phenyl)-(l-triisopropylsilanyl-lH-pyrrolo[2,3b]pyridin yl)-methanone (666, 84 mg, 0.054 mmol) in methanol (10 mL) was added potassium hydroxide (6 N solution) until pH of the solution turned to over 10. Potassiun fluoride (30 mg, 0.5 mmol) was then added to the reaction mixture and the mixture was stirred at room temperature for 6 hours. The reaction mixture was then poured into saturated sodium carbonate and was extracted with ethyl acetate. The organic layer was collected and washed with brine, dried over magnesium sulfate. After removal of the solvent, the residue was purified by preparative HPLC to provide as a white solid (P-2094, 5 mg, 19%). MS(ESI) [NWrf]+ == 485.17.
Example 54: Synthesis of Propane-l-sulfonic acid [3-(5-bromo -lH-pyrrolo[2,3-b]pyridine-3carbonyl) fluoro-phenyl]-amide P-1403
[0476] Compound P-1403 was synthesized in seven steps from 3-fluoro nitrobenzoic acid 667 as shown in Scheme 83.
Scheme 83
<img file="IL188248A_D0151.tif" />
<img file="IL188248A_D0152.tif" />
Step 1 - Preparation of 3-fluoro aminobenzoic acid (668):
[0477] Into a Parr pressure reactor were added 3-fluoro nitrobenzoic acid (667, 5.0 g, 0.027 mol), methanol (50.0 mL), 20% Pd(OH)2 on carbon (300 mg). The reaction was shaken under an atmosphere of hydrogen at 50 psi overnight. The reaction was filtered through celite and was concentrated to dryness to provide a white solid (668, 4.0 g, 95.0%).
Step 2 - Preparation of2-Fluoro (propane-l-sulfonylamino)-benzoic acid (669):
[0478] To 3-fluoro aminobenzoic acid (668, 3.00 g, 0.0180 mol) in methylene chloride (204 mL) were added pyridine (41 mL, 0.50 mol) and propane sulfonyl chloride (2.23 mL, 0.0198 mol) under an atmosphere of nitrogen. The reaction was stirred at room temperature for 5 days. The reaction was poured into water, adjusted pH to 1 with IN HC1, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 5% methanol in methylene chloride to give a white solid (669, 2.0 g, 42%). MS (ESI) [M-H4]260.1 = &#1470;.
Step 3 - Preparation of2-Fluoro (propane-l-sulfonylamino )-benzoic acid methyl ester (670): [0479] To 2-Fluoro (propane-l&#1470;sulfonylamino)-benzoic acid (669, 2.0 g, 0.0076 mol) in methanol (20.0 mL) was added sulfuric acid (0.90 mL, 0.017 mol). The reaction was stirred at room temperature overnight. The reaction was concentrated and purified with silica gel column chromatograph eluting with 20% ethyl acetate in hexane to give a white solid (670,1.27 g, 62%). MS (ESI) [M-H4]274.1 &#1470;&#1470;.
Step 4 - Preparation of Propane sulfonic acid (4-fluoro-3 -hydroxymethyl-phenyl)-amide (671): [0480] To 2-Fluoro (propane-l-sulfonylamino )-benzoic acid methyl ester (670, 1.20 g, 0.00436 mol) in tetrahydroforan (100.0 mL) was added lithium tetrahydroaluminate (1.00 M in tetrahydrofuran, 10.0 mL) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. To the reaction was added Na2SO4.10H2O (5 g), and then stirred at room temperature for 1 hour. The reaction was filtered, concentrated and purified with silica gel column chromatography eluting with 50% ethyl acetate in hexane to give the compound (671, 0.90 g, 83%).
MS (ESI) = 246.1.
Step 5 - Preparation of Propane-l-sulfonic acid (4-fluoro-3 fbrmyl-phenyl)-amide (672): [0481] To propane-1 -sulfonic acid (4-fluoro-3 -hydroxymethyl-phenyl)-amide (671, 0.483 g, 0.00195 mol) in tetrahydrofuran (10.0 mL), cooled with ice/water, was added Dess-Martin periodinane (1.00 g, 0.00236 mol). The reaction was stirred at room temperature for 10 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 30% ethyl acetate in hexane to give a white solid (672,360 mg, 75%). MS (ESBIM-H4]244.1 &#1470;&#1470;.
Step 6 — Preparation ofPropane-l-sulfonic acid 3-[(5-brom o-lH-pyrrolo[2,3-b]pyridin yl)~ hydroxy-methyl] fluoro-phenyl-amide (673):
[0482] To 5-bromo azaindole (67, 170.0 mg, 0.86 mmol) in methanol (7.0 mL) were added propane-l-sulfonic acid (4-fluoro-3 -formyl-phenyl)-amide (672, 220.0 mg, 0.90 mmol) and potassium hydroxide (0.50 g, 0.0089 mol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water, acidified with IN HC1 to pH = 5, and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 10% methanol in methylene chloride to give the compound (673, 55.0 mg, 14.0%). MS (ESI) [M+lT]+ = 442.1, 444.1.
Step 7 - Preparation of Propane-l-sulfonic acid [3-(5-bromo -lH-pyrrolo[2,3-b]pyridine-3carbonyl)-4 fluoro-phenyl]-amide (P-1403):
[0483] To propane-1 -sulfonic acid 3-[(5-brom 0-1 H-pyrrolo[2,3-b]pyridin yl)-hydroxy-methyl]-4fluoro-phenyl-amide (673, 55.0 mg, 0.12 mmol) in tetrahydrofuran (8.0 mL) was added Dess-Martin periodinane (70.0 mg, 0.17 mmol). The reaction was stirred at room temperature for 5 minutes. The reaction was concentrated with silica gel and purified with silica gel column chromatography eluting with 25% ethyl acetate in hexane to give an off-white solid (P-1403, 26.2 mg, 47%). MS (ESI) [M+H4]4 = 437.9, 439.9.
Example 55: Synthesis of 2-[2,4-Difluoro (5-pyridin yl-l H-pyrr0I0[2,3-b]pyridin-3ylmethyl) -phenoxy]-ethanol P-1395 and related compounds
[0484] Compound P-1395 was synthesized in four steps from 4-Chloro fluoro-phenol 521 as shown in Scheme 42.
•230
Scheme 42
<img file="IL188248A_D0153.tif" />
<img file="IL188248A_D0154.tif" />
Step 1 - Preparation of 4-Chloro fluoro-l-(2,2,2-trifluoro-ethoxy)-benzene (522):
[0485] To 4-Chloro fluoro-phenol (521, 5.0 g, 0.034 mol) in methanol (50.0 mL) was added potassium fluoride (2.2 g, 0.038 mol). The solvent was removed. The resulting salt was added to N,N-dimethylformaldehyde (25 mL), followed by adding l,l,l-trifluoro iodo-ethane (8.60 g, 40.9 mmol). The reaction was stirred at 50 °C overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give colorless oil (522, 2.0 g, 26%).
Step 2 — Preparation of 6-Chloro fluoro (2,2,2-trifluoro-ethoxy)-benzaldehyde (523):
[0486] To 4-Chloro fluoro-l-(2,2,2-trifluoro-ethoxy)-benzene (522, 0.80 g, 3.5 mmol) in THF (20 mL), cooled in dry ice/acetone bath and under an atmosphere of nitrogen, was slowly added nbutyllithium (1.60 M in Hexane, 2.30 mL). After an hour, Ν,Ν-dimethylformamide (0.298 mL, 3.85 mmol) was added to the reaction. After 30 minutes, the reaction was allowed to reach room temperature and was stirred for 10 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound (523, 450 mg, 50% ).
Step 3 — Preparation of (5-Bromo-lH-pyrrolo[2,3-b]pyridin yl)-[6-chloro fluoro (2,2,2trifluoro-ethoxy)-phenyl]-methanol (524):
[0487] To 5-bromo azaindole (67, 291 mg, 1.48 mmol) in methanol (22 mL) were added 6-Chloro2-fluoro (2,2,2-trifluoro-ethoxy)-benzaldehyde (523, 400.0 mg, 1.6 mmol) and potassium hydroxide (1.49 g, 26.6 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature for 48 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 25% ethyl acetate in hexane to give the compound (524, 300 mg, 42%). MS (ESI) [M+H4]4 = 453.1, 455.1.
Step 4 - Preparation of (5-Bromo-lH-pyrrolo[2,3-b]pyridin-3 -yl)-[6-chloro fluoro (2,2,2-tr ifluoro-ethoxy)-phenyl]-methanol (P-1393):
[0488] To (5-Bromo-lH-pyrrolo[2,3-b]pyridin yl)-[6-chloro fluoro (2,2,2-trifluoro-ethoxy)phenyl]-methanol (524, 140.0 mg, 0.31 mmol) in trahydrofuran (6.0 mL) was added Dess-Martin periodinane (157 mg, 0.37 mmol). The reaction was stirred at room temperature for 10 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound (P-1393, 100 mg, 72%). MS (ESI) [M-H+]- = 448.9, 450.9.
Step 5 — Preparation of [6-Chloro fluoro (2,2,2-trifluoro-ethoxy)-phenyl]-(5-pyridin yl- 1Hpyrrolo[2,3-b]pyridin yl)-methanone (P-1395):
[0489] To (5-Bromo-lH-pyrrolo[2,3-b]pyridin yl)-[6-chloro fluoro (2,2,2-trifluoro-ethoxy)phenyl]-methanol (P-1393, 53.0 mg, 0.12 mmol) in acetonitrile (4.0 mL) was added Tetrakis(triphenylphosphine)palladium(0) (5.0 mg, 0.0043 mmol), 3-pyridylboronic acid (15.1 mg, 0.12 mmol) and 1 M potassium carbonate solution (1.5 mL). The reaction was microwaved (300 watts) at 160 °C for 7 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 60% ethyl acetate in hexane to give the compound (P-1395, 3.8 mg, 53%) as light yellow solid. MS (ESI) [M+H4]4 = 450.2.
[0490] [2,6-Difluoro (2-methoxy-ethoxy)-phenyl]-(5-pyridin yl-lH-pyrrolo[2,3-b]pyridin-3yl)-methanone P-1456
<img file="IL188248A_D0155.tif" />
was prepared following the protocol of Scheme 42, substituting 4-Chloro fluoro-phenol 521 with 2,4-difluoro-phenol and l,l,l-Trifluoro iodo-ethane with l-Bromo methoxy-ethane in Step 1. MS (ESI) [M + H4]4 = 410.2.
[0491] N-(3-{3-[2,6-Difluoro (2-methoxy-ethoxy)-benzoyl]-lH-yrrolo[2,3-b]pyridin yl}phenyl)-methanesulfonamide P-1472
<img file="IL188248A_D0156.tif" />
was prepared following the protocol of Scheme 42, substituting 4-Chloro fluoro-phenol 521 with 2,4-difluoro-phenol and l,l,l-Trifluoro iodo-ethane with l-Bromo methoxy-ethane in Step 1, and substituting pyridine boronic acid with [(3-methylsulfonyl)aminophenyl]-boronic acid in step 4. MS (ESI) [M + H4]4 = 502.2.
Example 56: Synthesis of 2-[2,4-DifIuoro (5-pyridin yI-lH-pyrrolo[2,3&#1470;b]pyridin-3ylmethyl) -phenoxy]-ethanol P-1394
[0492] Compound P-1394 was synthesized in four steps from 2,6-Difluoro hydroxy-benzaldehyde 540 as shown in Scheme 48.
Scheme 48
<img file="IL188248A_D0157.tif" />
Step !-Preparation of2,6-Difluoro [2-(tetrahydro-pyran yloxy)-ethoxy]-benzaldehyde (541): [0493] To 2,6-difluoro hydroxy-benzaldehyde (540, 0.150 g, 0.95 mmol) in N,Ndimethylformamide (8.0 mL) were added 2-(2-bromo-ethoxy)-tetrahydro-pyran (0.218 g, 1.04 mmol) and potassium carbonate (0.52 g, 3.8 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature for 72 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 20% ethyl acetate in hexane to give the compound as colorless oil (541, 180 mg, 66%).
Step 2 - Preparation of (5-Bromo-lH-pyrrolo[2,3-b]pyridm-3 -yl)-2,6-difluoro [2-(tetrahydro pyran yloxy)-ethoxy]-phenyl-methanol (542):
[0494] To 5-bromo azaindole (67, 118 mg, 0,000597 mol) in methanol (9.0 ml.) were added 2,6 difluoro [2-(tetrahydro-pyran yloxy)-ethoxy]-benzaldehyde (541,180.0 mg, 0.63 mmol) and potassium hydroxide (601.9 mg, 10.7 mmol) under an atmosphere of nitrogen. The reaction was stirred at room temperature overnight. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to give crude compound that was used directly in the next step.
Step 3 - Preparation of2-[3~(5-Bromo-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro-phenoxy]ethanol (P-1392):
[0495] To (5-Bromo-lH-pyrrolo[2,3-b]pyridin-3 -yl)-2,6-difluoro [2-(tetrahydro -pyran yloxy)ethoxy]-phenyl-methanol (542, 0.22 g, 0.46 mmol) in acetonitrile (6.0 mL) were added trifluoroacetic acid (0.14 mL, l,8mmol) and triethylsilane (0.29 mL, 1.8 mmol). The reaction was stirred at room temperature overnight. The filtrate was concentrated and purified by silica gel column chromatography eluting with 35% ethyl acetate in hexane to give the compound as a white solid (P-1392, 62 mg, 35%). MS (M+1T)+ = 383.1, 385.1.
Step 4 - Preparation of2-[2,4-Difluoro (5-pyridin yl-l H-pyrrolo[2,3-b]pyridin ylmethyl) phenoxy]-ethanol (P-1394):
[0496] To 2-[3-(5-Bromo-lH-pyrrolo[2,3-b]pyridin ylmethyl)-2,4-difluoro-phenoxy]-ethanol (P-1392, 35.0 mg, 0.091 mmol) in acetonitrile (4.0 mL) were added 3-pyridylboronic acid (14.6 mg, 0.12 mmol), tetrakis(triphenylphosphine)palladium(0) (3.0 mg, 0.0026 mmol) and 1 M potassium carbonate solution (1.5 mL). The reaction was microwaved (300 watts) at 160°C for 7 minutes. The reaction was poured into water and extracted with ethyl acetate. The organic layer was collected and dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting 4% methanol in methylene chloride to give the compound as white solid (P-1394, 11.0 mg, 32%). MS (ESI) [Μ+1Τ]+ = 382.2.
Example 57: Synthesis of 5-fluoro methoxy (l-triisopropyIsilanyl-lH-pyrrolo[2,3-b]pyridin3-ylmethyl)-phenol 649.
[0497] 5-Fluoro methoxy (l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin ylmethyl)-phenol 649 was synthesized in five steps from 2-fluoro hydroxy methoxy-benzaldehyde 653 and benzyl bromide as shown in Scheme 80.
Scheme 80
<img file="IL188248A_D0158.tif" />
<img file="IL188248A_D0159.tif" />
Step 1 - Preparation of 4-Benzyloxy fluoro methoxy-benzaldehyde (654):
[0498] 2-Fluoro hydroxy methoxy-benzaldehyde (653,1.62 g, 9.52 mmol) was dissolved in N,N-dimethylformamide (50 mL) and sodium hydride (60% dispersion in mineral oil, 530 mg, 13 mmol) was added. After 20 minutes, benzyl bromide (1.5 mL, 12 mmol) was added to the reaction mixture. The reaction was stirred at room temperature under an atmosphere of nitrogen for 5.5 hours. The reaction was poured into water and extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 0-50 % ethyl acetate in hexane to provide compound as a white solid, consistent with the desired structure by 1H-NMR (654, 2.0 g, 81 %).
Step 2 - Preparation of (4-Benzyloxy fluoro methoxy-phenyl)-(l-triisopropylsilanyl-lHpyrrolo[2,3-b]pyridin yl)-methanol (655):
[0499] 3-Iodo-l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridine (635, 620 mg, 1.5 mmol, prepared as described in Example 45) was dissolved in tetrahydrofuran (15 mL) at -20 °C under an atmosphere of nitrogen. Isopropylmagnesium chloride (2.0 M in tetrahydrofuran, 840 pL) was added to the reaction. The reaction was stirred for 1.5 hours, during which the temperature rose to 5 °C. The reaction was cooled to -20 °C. 4-Benzyloxy fluoro methoxy-benzaldehyde (654, 250 mg, 0.9606 mmol) in tetrahydrofuran (5.0 mL) was added to the reaction. The reaction was stirred for 2.5 hours during which time the temperature rose to 5 °C. The reaction was poured into water. The mixture was extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography eluting with 2-25 % ethyl acetate in hexane to provide compound as a white solid (655, 501 mg, 63 %). MS (ESI) [M+HT = 535.4,
Step 3 - Preparation of 3~(4-Benzyloxy fluoro methoxy-benzyl)-lH-pyrrolo[2,3-b]pyridine (656): [0500] (4-Benzyloxy fluoro methoxy-phenyl)-(l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin3-yl)-methanol (655, 1.49 g, 2.79 mmol) was dissolved in acetonitrile (50 mL) and trifluoroacetic Acid (1.1 mL) was added. The reaction was stirred for 5 minutes. Triethylsilane (2.2 mL) was added to the reaction. The reaction was heated at 80 °C for 6 hours. The reaction was concentrated and the crude material was dissolved into ethyl acetate and washed with 1 N HCI, saturated sodium bicarbonate, and brine. The organic portion was dried over anhydrous sodium sulfate and concentrated. The solid obtained was used in the next reaction without further purification (656, 833 mg, 83%). MS (ESI) [M+H4]4363.4 &#1470;.
Step 4 - Preparation of 3-(4-Benzyloxy fluoro methoxy-benzyl)-l-triisopropylsilanyl-lHpyrr010[2,3-b]pyridine (657):
[0501] 3-(4-Benzyloxy fluoro methoxy-benzyl)-lH-pyrrolo[2,3-b]pyridine (656, 0.877 g, 2.42 mmol) was dissolved in N,N-dimethylformamide (30 mL). Sodium hydride (60% dispersion in mineral oil, 140 mg, 3.6 mmol) was added at room temperature, After 20 minutes, triisopropylsilyl chloride (513 pL, 2.42 mmol) was added dropwise. The reaction was stirred for four hours. The reaction was poured into water and extracted with ethyl acetate. The organic portion was washed with saturated sodium bicarbonate and brine. The organic portion was dried over anhydrous sodium sulfate and filtered. The filtrate was adsorbed onto silica gel and purified by silica gel chromatography using 20-80% ethyl acetate/ hexane. The resulting material was purified a second time with 5-30% gradient ethyl acetate/ hexane to provide the desired compound (657, 831 mg, 66%). MS (ESI) [M+H4]4519.4 &#1470;&#1470;.
Step 5 - Preparation of 5-Fluoro methoxy (l-triisopropylsilanyl-lH-pyrrolo[2,3-b]pyridin-3ylmethyl)-phenol (649):
[0502] 3-(4-Benzyloxy fluoro methoxy-benzyl)-l-triisopropylsilanyl-lH-pyrrolo[2,3b]pyridine (657, 0.831 g, 1.60 mmol) was dissolved in methanol (40 mL) and tetrahydrofuran (40 mL). 10% Palladium on carbon (3.41 g) was added. The reaction was shaken at 50 psi for 1 hour. The reaction was filtered through Celite and washed with methanol. The organic portion was passed through celite several times until a clear solution was obtained. The organic portion was concentrated under reduced pressure to provide the desired compound as an off-white solid (649, 587 mg, 86%). MS (ESI) [M+H4]4 = 429.5.
Example 58: Additional compounds
[0503] Additional compounds of the invention were synthesized following the methods of the Examples above, or similar methods known to those of skill in the art, and are shown in the following Table 1.
Table 1. Additional compounds of the invention.
<img file="IL188248A_D0160.tif" />
<img file="IL188248A_D0161.tif" />
<img file="IL188248A_D0162.tif" />
<img file="IL188248A_D0163.tif" />
<img file="IL188248A_D0164.tif" />
<img file="IL188248A_D0165.tif" />
<img file="IL188248A_D0166.tif" />
P0957
P- .
0959
P1003
<img file="IL188248A_D0167.tif" />
<img file="IL188248A_D0168.tif" />
Cl
<img file="IL188248A_D0169.tif" />
<img file="IL188248A_D0170.tif" />
<img file="IL188248A_D0171.tif" />
<img file="IL188248A_D0172.tif" />
<img file="IL188248A_D0173.tif" />
<img file="IL188248A_D0174.tif" />
<img file="IL188248A_D0175.tif" />
<img file="IL188248A_D0176.tif" />
<img file="IL188248A_D0177.tif" />
<img file="IL188248A_D0178.tif" />
<img file="IL188248A_D0179.tif" />
<img file="IL188248A_D0180.tif" />
<img file="IL188248A_D0181.tif" />
<img file="IL188248A_D0182.tif" />
<img file="IL188248A_D0183.tif" />
<img file="IL188248A_D0184.tif" />
<img file="IL188248A_D0185.tif" />
<img file="IL188248A_D0186.tif" />
<img file="IL188248A_D0187.tif" />
<img file="IL188248A_D0188.tif" />
<img file="IL188248A_D0189.tif" />
<img file="IL188248A_D0190.tif" />
Example 59: Kinase Activity Assays
[0504] AlphaScreen assay was used to screen kinases. The assay is dependent on the phosphorylation of a peptide substrate. In this assay, an antibody that recognizes phosphorylated substrate is bound to an acceptor bead, The peptide substrate is attached to biotin, which binds to a donor bead that contains streptavidin. Thus phosphorylated substrate is bound by antibody and streptavidin, bringing the donor and acceptor beads into close proximity when kinase is not inhibited. The donor produces singlet oxygen which results in emission from the acceptor when they are in close proximity. Conversely, when kinase is inhibited, the donor and acceptor beads are not associated and the emission from the acceptor is reduced. The fluorescence signal vs. compound concentration was used to determine the IC50 values.
Genetic Engineering
[0505] For B-Raf V600E and Kit, preparation of the kinase was required. Plasmids encoding a selection of kinase enzymes were engineered using common polymerase chain reaction (PCR) methods. The relevant DNA sequences and encoded protein sequences used in the assay are shown for each (see below). Complementary DNA cloned from various human tissues were purchased from Invitrogen, and these were used as substrates in the PCR reactions, Specific custom synthetic oligonucleotide primers (Invitrogen see below) were designed to initiate the PCR product, and also to provide the appropriate restriction enzyme cleavage sites for ligation with the plasmids. Additional pairs of oligonucleotides (see below) were used to introduce mutations into the coding sequence to alter the sequence for enzyme activation in BRAF. In the case of KIT, the entire sequence encoding the enzyme was made through a gene synthesis procedure, using custom synthetic oligonucleotides covering the entire coding sequence (Invitrogen).
[0506} The plasmids used for ligation with the kinase-encoding inserts were derivatives of either pET (Novagen) for expression using E. coli, or pFastBac (Invitrogen) for expression using baculovirus infection of insect cell cultures. In each of these cases the kinase was engineered to include a Histidine tag for purification using metal affinity chromatography,
[0507] Hie kinase-encoding plasmids were engineered as bicistronic mRNA to co-express a second protein that modifies the kinase protein during its expression in the host cell. For Kit, protein tyrosine phosphatase IB (FTP), was co-expressed for dephosphorylation of the phosphotyrosines. For BRAF, the chaperone CDC37, was co-expressed for more efficient protein folding of the BRAF.
[0508] Plasmid encoding phosphorylation substrate protein MEK1, a substrate for BRAF, was expressed as N-terminal GST fusion and C-terminal biotinylation fusion, using pGEX vectors (Amersham) modified to include sequences encoding a C-terminal biotinylation tag.
Protein Expression in E. coli and Purification.
[0509] For protein expression, plasmid containing KIT was transformed into E .coli strain BL21 (DE3) Codonplus RILP (Invitrogen) and transformants selected for growth on LB agar plates containing appropriate antibiotics. Single colonies were grown overnight at 37°C in 200 ml TB (Terrific broth) media. 16xlL of fresh TB media in 2.8L flasks were inoculated with 10 mL of overnight culture and grown with constant shaking at 37°C. Once cultures reached an absorbance of 1.0 at 600 nm, IPTG was added and cultures were allowed to grow for a further 12 to 18 hrs at temperatures ranging from 12-30°C. Cells were harvested by centrifugation and pellets frozen at 80°C until ready for lysis.
[0510] For protein Purification; frozen E .coli cell pellets were resuspended in lysis buffer and lysed using standard mechanical methods. Soluble proteins were purified via poly-Histidine tags using immobilized metal affinity purification IMAC. The kinases have been purified using a 3 step purification process utilizing; IMAC, size exclusion chromatography and ion exchange chromatography. The poly-Histidine tag was removed as needed using Thrombin (Calbiochem). For B-Raf, the purification protocol required 5mM MgCl2 throughout purification in order to stabilize soluble protein during purification and concentration.
Baculovirus Expression Vector System, Virus production:
[0511] The transfection of a monolayer of Spodoptera frugiperda (Sf9) cells was performed utilizing a bacmid containing the BRAF and Cellfectin (Invitrogen) transfection reagent in antibioticfree, serum-free Grace’s complete media (Invitrogen), After a five hour incubation, the transfection media was removed, and the monolayer was fed with Grace’s media containing 10% FBS and antibiotics. After a 72 to 96 hr incubation, the cell supernatant containing the virus was harvested. The titer of the virus stock was then determined using a baculovirus titer kit (BD). The virus stock was then expanded using low Multiplicity of Infection (MOI of 0.1) cultures and harvested 48 hrs post-infection. The titer of the expanded virus stock was then determined for use in recombinant protein production.
Protein Production:
[0512] The protein expression level was optimized by varying the MOI (1-10) and time of harvest (48-72 hrs). Sf9 cells were adapted to SF-900 H serum-fiee media and grown in suspension in spinner flasks. The cell suspension was then used to inoculate a Wave bioreactor for 25L production scale. Cells were harvested 48-72 hrs post-infection and stored at -80°C until ready for lysis. Proteins were purified similarly to those expressed in E. coli.
Kinase assay
[0513] AlphaScreen assays were done using compounds dissolved in DMSO to a concentration of 20 mM. The compounds were diluted accordingly to the desired final concentrations in each sample well, using 1:3 serial dilution for a total of 8 concentration points. Plates were prepared such that each kinase reaction is 20 μ&#912; in lx kinase buffer, 5% DMSO and 10 μΜ ATP. Kit and Fms were alternatively assayed with 100 μΜ ATP. After incubation of the kinase reaction for 1 hour at room temperature, 5 μ&#912; of donor beads in stop buffer was added, the sample was mixed and incubated for 20 minutes at room temperature before adding 5 μ&#912; of acceptor beads in stop buffer. The samples were incubated for 60 minutes at room temperature and the signal per well was read on AlphaQuest reader. Phosphorylated substrate results in binding of the antibody and association of the donor and acceptor beads such that signal correlates with kinase activity. The signal vs. compound concentration was used to determine the IC50. The conditions used for 20 μ&#912; reaction for each kinase are described as follows.
[0514] For Raf kinases, B-Raf and c-Raf-1 were purchased from Upstate Biotechnology and B-Raf V600E was prepared using plasmid P4254 expressed in Sf9 cells as described above. For each, the final assay conditions were 0.1 ng kinase, 100 nM biotin-MEKl substrate (prepared as described above) in lx kinase buffer (50 mM HEPES pH 7.0, 50 mM NaCl, 2 mM MgCl2, 1 mM MnCl2, 1 mM DTT, 0.01% Tween-20), followed by Streptavidin coated donor bead (10 pg/ml, Perkin Elmer Life Science) and Protein A coated, bound to anti phosphor MEK1/2 antibody acceptor bead (10 pg/ml, CellSignal) in stop buffer (50 mM EDTA in lx kinase buffer).
[0515] For Ink kinases, Jnkl and Jnk3 were purchased from Upstate Biotechnology and Jnk2 from Roche Protein Expression Group (Indianapolis, IN). The final assay conditions were 0.1 ng kinase (Jnkl and Jnk3) or 0.05 ng kinase (Jnk2), 30 nM biotin-ATF2 (Upstate Biotechnology) in lx kinase buffer (20 mM HEPES pH 7.0, 10 mM MgCl2, 1 mM DTT, 0.01%.Tween-20), followed by Streptavidin coated donor bead (10 pg/ml, Perkin Elmer Life Science) and Protein A coated, bound to anti phosphor ATF2 antibody acceptor bead (10 pg/ml, CellSignal) in stop buffer (50 mM EDTA in lx kinase buffer).
[0516] Fms was purchased from Upstate Biotechnology. The final assay conditions were 0.5 ng kinase., 30 nM biotin-(E4Y)!0 (Upstate Biotechnology) in lx kinase buffer (8 mM MOPS pH 7.4, 2 mM MgCl2, 8 mM MnCl2,2 mM DTT, 0.01% Tween-20), followed by Streptavidin coated donor bead (20 pg/ml, Perkin Elmer Life Science) and PY20 antibody coated acceptor bead (20 pg/ml, Perkin Elmer Life Science) in stop buffer (8 mM MOPS, pH 7.4, 100 mM EDTA, 0.3% BSA). For assays at 100 μΜ ATP, the lx buffer was 8 mM MOPS pH 7.0, 2 mM MgCl2, 8 mM MnCl2,2 mM DTT, 50 mM NaCl, 0.01% BSA and 0.01% Tween-20 and stop buffer was 8 mM MOPS, pH 7.0, 100 mMEDTA, 0.01% BSA.
[0517] Kit was either purchased from Cell Signaling Technology or prepared using plasmid P1332 expressed in E. coli as described above. The final assay conditions were 0.1 ng kinase, 100 nM biotin-(E4Y)3 (Open Source Biotech, Inc.) in lx kinase buffer (50mM HEPES pH7.2, 5mM MgCl2, 5mM MnCl2, 0.2% BSA, 0.01% NP-40), followed by Streptavidin coated donor bead (1 pg/ml, Perkin Elmer Life Science) and PY20 antibody coated acceptor bead (1 pg/ml, Perkin Elmer Life Science) in stop buffer (50 mM EDTA in lx kinase buffer). For assays at 100 μΜ ATP, 1 ng kinase was used and the lx buffer was 8 mM MOPS pH 7.0,1 mM MgCl2, 2 mM MnCl2,1 mM DTT, 0.001% BSA and 0.01 % Tween-20, with substrate of 30 nM biotin-(E4Y)1D (Upstate Biotechnology). Beads were at 10 μg/ml in stop buffer of 8 mM MOPS, pH 7.0, 100 mM EDTA, 0.3% BSA.
[0518] Compounds screened having IC50 of less than 10 μΜ are shown in tables 2a (B-Raf), 2b (BRaf V600E), 2c (c-Raf-1), 2d (Fms), 2e (Jnkl), 2f (Jnk2), 2g (Jnk3), and 2h (Kit) as follows.
Table 2a. Compounds with activity toward kinase B-Raf with IC50 < 10 μΜ.
PCI7US2006/024361
<td> B-Raf</td><td> P-0007, P-0088, P-0166, P-0178, P-0188, P-0310, P-0356, P-0636, P-0685, P-0728, P-0753, P-0773, P-0774, P-0776, P-0798, P-0805, P-0806, P-0818, P-0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P-0867, P-0874, P-0876, P-0877, P-0885, P-0889, P-0896, P-0897, P-0898, P-0902, P-0904, P-0907, P-0910, P-0911, P-0912, P-0913, P-0928, P-0931, P-0933, P-0937, P-0944, P-0946, P-0947, P-0952, P-0954, P-0955, P-0956, P-0958, P-0959, P-0983, P-0984, P-0991, P-0997, P-1003, P-1004, P-1006, P-1009, P-1013, P-1020, P-1028, P-1056, P-1116, P-1243, P-1244, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1254, P-1255, P-1256, P-1257, P-1258, P-1259, P-1260, P-1261, P-1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1268, P-1269, P-1270, P-1288, P-1289, P-1317, P-1318, P-1397, P-1431, P-1432, P-1433, P-1445, P-1446, P-1447, P-1455, P-1467, P-1486, P-1532, P-1534, P-1539, P-1541, P-1542, P-1544, P-1546, P-1547, P-1548, P-1549, P-1552, P-1553, P-1554, P-1559, P-1566, P-1567, P-1568, P-1569, P-1570, P-1576, P-1580, P-1581, P-1582, P-1583, P-1586, P-1589, P-1590, P-1591, P-1596, P-1597, P-1598, P-1599, P-1600, P-1602, P-1608, P-1609, P-1610, P-1612, P-1613, P-1616, P-1621, P-1627, P-1630, P-1631, P-1636, P-1637, P-1638, P-1639, P-1656, P-1660, P-1663, P-1664, P-1665, P-1670, P-1671, P-1687, P-1700, P-1701, P-1702, P-1703, P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P-1710, P-1711, P-1712, P-1713, P-1714, P-1715, P-1716, P-1717, P-1718, P-1719, P-1720, P-1721, P-1722, P-1723, P-1724, P-1725, P-1726, P-1727, P-1728, P-1729, P-1730, P-1731, P-1732, P-1733, P-1734, P-1735, P-1736, P-1737, P-1738, P-1739, P-1740, P-1741, P-1742, P-1746, P-1747, P-1748, P-1749, P-1750, P-1751, P-1752, P-1753, P-1755, P-1756, P-1757, P-1758, P-1759, P-1760, P-1762, P-1763, P-1764, P-1765, P-1766, P-1767, P-1768, P-1769, P-1770, P-1771, P-1772, P-1773, P-1774, P-1775, P-1776, P-1777, P-1778, P-1779, P-1780, P-1781, P-1782, P-1783, P-1784, P-1798, P-1799, P-1800, P-1802, P-1804, P-1816, P-1817, P-1818, P-1819, P-1822, P-1823, P-1825, P-1827, P-1828, P-1839, P-1840, P-1841, P-1842, P-1864, P-1865, P-1871, P-1872, P-1873, P-1878, P-1879, P-1881, P-1882, P-1907, P-1912, P-1916, P-1980, P-1996, P-1997, P-1998, P-2005, P-2006, P-2007, P-2012, P-2013</td>
Table 2b. Compounds with activity toward kinase B-Raf V600E with IC50< 10 μΜ.
<td> B-Raf V600E</td><td> P-0007, P-0088, P-0166, P-0178, P-0188, P-0356, P-0493, P-0636, P-0685, P-0728, P-0753, P-0773, P-0774, P-0776, P-0798, P-0803, P-0805, P-0806, P-0818, P-0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P-0867, P-0874, P-0876, P-0877, P-0885, P-0889, P-0896, P-0897, P-0898, P-0902, P-0904, P-0907, P-0910, P-0911, P-0912, P-0913, P-0928, P-0931, P-0933, P-0937, P-0944, P-0946, P-0947, P-0950, P-0952, P-0954, P-0955, P-0956, P-0957, P-0958, P-0959, P-0964, P-0971, P-0983, P-0984, P-0991, P-0997, P-1003, P-1004, P-1006, P-1009, P-1013, P-1015, P-1020, P-1028, P-1056, P-1071, P-1090, P-1116, P-1131, P-1243, P-1244, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1254, P-1255, P-1256, P-1257, P-1258, P-1259, P-1260, P-1261, P-1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1269, P-1270, P-1288, P-1289, P-1316, P-1317, P-1318, P-1345, P-1396, P-1397, P-1398, P-1403, P-1431, P-1432, P-1433, P-1444, P-1445, P-1446, P-1447, P-1449, P-1450, P-1455, P-1462, P-1466, P-1467, P-1470, P-1471, P-1486, P-1495, P-1531, P-1532, P-1534, P-1539, P-1540, P-1541, P-1542, P-1544, P-1545, P-1546, P-1547, P-1548, P-1549, P-1552, P-1553, P-1554, P-1559, P-1566, P-1567, P-1568, P-1569, P-1570, P-1572, P-1575, P-1576, P-1581, P-1582, P-1583, P-1586, P-1589, P-1590, P-1591, P-1594, P-1596, P-1597, P-1598, P-1599, P-1600, P-1601, P-1602, P-1606, P-1607, P-1608, P-1609, P-1610, P-1611, P-1612, P-1613, P-1621, P-1627, P-1630, P-1631, P-1636, P-1637, P-1638, P-1639, P-1656, P-1660, P-1663, P-1664, P-1665, P-1666, P-1670, P-1671, P-1687, P-1698, P-1700, P-1701, P-1702, P-1703, P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P-1710, P-1711, P-1712, P-1713, P-1714, P-1715, P-1716, P-1717, P-1718, P-1719, P-1720, P-1721, P-1722, P-1723, P-1724, P-1725,</td>
<td></td><td> P-1726, P-1727, P-1728, P-1729, P-1730, P-1731, P-1732, P-1733, P-1734, P-1735, P-1736, P-1737, P-1738, P-1739, P-1740, P-1741, P-1742, P-1746, P-1747, P-1748, P-1749, P-1750, P-1751, P-1752, P-1753, P-1755, P-1756, P-1757, P-1758, P-1759, P-1760, P-1762, P-1763, P-1764, P-1765, P-1766, P-1767, P-1768, P-1769, P-1770, P-1771, P-1772, P-1773, P-1774, P-1775, P-1776, P-1777, P-1778, P-1779, P-1780, P-1781, P-1782, P-1783, P-1784, P-1797, P-1798, P-1799, P-1800, P-1802, P-1804, P-1816, P-1817, P-1818, P-1819, P-1822, P-1823, P-1828, P-1839, P-1840, P-1841, P-1842, P-1843, P-1864, P-1865, P-1871, P-1872, P-1873, P-1878, P-1879, P-1881, P-1882, P-1907, P-1912, P-1916, P-1980, P-1996, P-1997, P-1998, P-2005, P-2006, P-2007, P-2012, P-2013</td>
Table 2c. Compounds with activity toward kinase c-Raf-1 with ICSO< 10 μΜ
<td> c-Raf-1:</td><td> P-0007, P-0088, P-0166, P-0178, P-0188, P-0356, P-0636, P-0685, P-0728, P-0753, P-0773, P-0774, P-0776, P-0798, P-0805, P-0806, P-0818, P-0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P-0867, P-0874, P-0876, P-0877, P-0885, P-0889, P-0896, P-0897, P-0898, P-0902, P-0904, P-0907, P-0910, P-0911, P-0912, P-0913, P-0928, P-0931, P-0933, P-0937, P-0944, P-0947, P-0950, P-0952, P-0954, P-0955, P-0956, P-0957, P-0958, P-0959, P-0964, P-0971, P-0983, P-0991, P-0997, P-1003, P-1004, P-1006, P-1009, P-1013, P-1015, P-1020, P-1028, P-1056, P-1071, P-1243, P-1244, P-1246, P-1247, P-1249, P-1250, P-1251, P-1253, P-1254, P-1255, P-1256, P-1257, P-1258, P-1260, P-1261, P-1262, P-1265, P-1288, P-1289, P-1316, P-1317, P-1318, P-1396, P-1397, P-1398, P-1403, P-1431, P-1432, P-1433, P-1455, P-1541, P-1542, P-1546, P-1547, P-1581, P-1583, P-1630, P-1671, P-1712, P-1713, P-1714, P-1733, P-1737, P-1738, P-1739, P-1740, P-1783, P-1839, P-1864, P-1871, P-1873, P-1878, P-1879, P-1881, P-1882</td>
Table 2d. Compounds with activity toward kinase Fms with IC50 < 10 μΜ
<td> Fms:</td><td> P-0007, P-0088, P-0166, P-0636, P-0685, P-0753, P-0773, P-0774, P-0798, P-0805, P-0806, P-0818, P-0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0867, P-0874, P-0876, P-0885, P-0898, P-0911, P-0913, P-0931, P-0933, P-0952, P-0954, P-0955, P-0956, P-0958, P-1009, P-1013, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1255, P-1259, P-1260, P-1262, P-1263, P-1264, P-1265, P-1266, P-1267, P-1269, P-1289, P-1316, P-1317, P-1318, P-1340, P-1397, P-1400, P-1403, P-1431, P-1432, P-1433, P-1445, P-1447, P-1449, P-1450, P-1455, P-1462, P-1466, P-1467, P-1470, P-1471, P-1486, P-1495, P-1496, P-1532, P-1534, P-1541, P-1542, P-1544, P-1545, P-1546, P-1547, P-1548, P-1549, P-1552, P-1553, P-1554, P-1559, P-1566, P-1567, P-1568, P-1569, P-1570, P-1571, P-1572, P-1575, P-1576, P-1580, P-1581, P-1583, P-1586, P-1587, P-1'589, P-1591, P-1594, P-1595, P-1596, P-1597, P-1598, P-1599, P-1602, P-1606, P-1608, P-1609, P-1610, P-1611, P-1612, P-1613, P-1615, P-1616, P-1618, P-1621, P-1625, P-1627, P-1630, P-1631, P-1636, P-1637, P-1638, P-1639, P-1652, P-1653, P-1654, P-1656, P-1657, P-1660, P-1663, P-1664, P-1665, P-1670, P-1671, P-1687, P-1700, P-1701, P-1702, P-1703, P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P-1710, P-1711, P-1712, P-1713, P-1714, P-1715, P-1716, P-1717, P-1718, P-1719, P-1720, P-1721, P-1722, P-1723, P-1724, P-1725, P-1726, P-1727, P-1728, P-1729, P-1730, P-1731, P-1732, P-1733, P-1734, P-1735, P-1736, P-1737, P-1738, P-1739, P-1740, P-1741, P-1742, P-1746, P-1747, P-1748, P-1749, P-1750, P-1751, P-1753, P-1754, P-1755, P-1756, P-1757, P-1758, P-1759, P-1760, P-1761, P-1762, P-1763, P-1764, P-1765, P-1766, P-1767, P-1768, P-1769, P-1771, P-1772, P-1773, P-1774, P-1775, P-1776, P-1778, P-1779, P-1780, P-1781, P-1782, P-1783, P-1784, P-1796, P-1798, P4799, P-1800, P-1802, P-1803, P-1804, P-1816, P-1817, P-1818, P-1819, P-1821, P-1822, P-1827, P-1828, P-1839, P-1840, P-1864, P-1871, P-1872, P-1873, P-1878, P-1879, P-1881, P-1882, P-1907, P-1912, P-1916,</td>
I P-1980, P-1996, P-1997, P-1998, P-2005, P-2006, P-2007, P-2012, P-2013
Table 2e. Compounds with activity toward kinase Jnkl with ICSO < 10 μΜ
<td> Jnkl:</td><td> P-0088, P-0636, P-0685, P-0728, P-0753, P-0774, P-0848, P-0850, P-0851, P-0853, P-0860, P-0876, P-0897, P-0956, P-0958, P-0991, P-0997, P-1009, P-1251, P-1253, P-1256, P-1260, P-1262, P-1266, P-1288, P-1289, P-1317, P-1318, P-1400, P-1432, P-1433, P-1445, P-1446, P-1447, P-1486, P-1534, P-1546, P-1547, P-1548, P-1549, P-1553, P-1554, P-1566, P-1567, P-1570, P-1576, P-1589, P-1591, P-1596, P-1602, P-1610, P-1611, P-1618, P-1621, P-1627, P-1631, P-1636, P-1637, P-1638, P-1639, P-1656, P-1660, P-1687, P-1702, P-1706, P-1707, P-1708, P-1720, P-1722, P-1723, P-1724, P-1725, P-1727, P-1730, P-1731, P-1742, P-1748, P-1749, P-1750, P-1751, P-1755, P-1756, P-1757, P-1759, P-1760, P-1764, P-1765, P-1767, P-1770, P-1775, P-1776, P-1777, P-1778, P-1779, P-1827, P-1828, P-1839, P-1842, P-1864, P-1873, P-1878, P-1879, P-1896, P-1897, P-1898, P-2007</td>
Table 2f. Compounds with activity toward kinase Jnk2 with IC50< 10 μΜ
<td> Jnk2:</td><td> P-0088, P-0685, P-1253, P-1318, P-1445, P-1447, P-1486, P-1547, P-1548, P-1554, P-1566, P-1567, P-1570, P-1575, P-1576, P-1589, P-1591, P-1602, P-1611, P-1621, P-1627, P-1656, P-1671, P-1687, P-1700, P-1702, P-1711, P-1720, P-1722, P-1723, P-1724, P-1727, P-1728, P-1729, P-1730, P-1731, P-1732, P-1737, P-1742, P-1748, P-1749, P-1750, P-1751, P-1753, P-1755, P-1756, P-1757, P-1759, P-1760, P-1764, P-1765, P-1767, P-1770, P-1776, P-1777, P-1778, P-1779, P-1827, P-1828, P-1864, P-2007</td>
Table 2g. Compounds with activity toward kinase Jnk3 with IC50 < 10 μΜ
<td> Jnk3:</td><td> P-0088, P-0132, P-0166, P-0636, P-0753, P-0774, P-0851, P-0991, P-1253, P-1289, P-1317, P-1318, P-1400, P-1445, P-1447, P-1486, P-1534, P-1546, P-1547, P-1548, P-1554, P-1566, P-1567, P-1570, P-1576, P-1589, P-1591, P-1610, P-1611, P-1618, P-1621, P-1636, P-1687, P-1702, P-1703, P-1704, P-1706, P-1707, P-1713, P-1716, P-1720, P-1722, P-1724, P-1742, P-1748, P-1749, P-1750, P-1753, P-1756, P-1757, P-1759, P-1764, P-1765, P-1767, P-1770, P-1775, P-1776, P-1777, P-1827, P-1828, P-1864, P-2007</td>
Table 2h. Compounds with activity toward kinase Kit with IC5q <10 μΜ
<td> Kit:</td><td> P-0007, P-0088, P-0132, P-0166, P-0636, P-0685, P-0753, P-0773, P-0774, P-0776, P-0798, P-0806, P-0818, P-0837, P-0848, P-0850, P-0851, P-0853, P-0857, P-0860, P-0867, P-0874, P-0876, P-0877, P-0885, P-0889, P-0898, P-0907, P-0910, P-0911, P-0913, P-0931, P-0933, P-0937, P-0952, P-0954, P-0955, P-0956, P-0958, P-0964, P-0983, P-1009, P-1013, P-1246, P-1247, P-1249, P-1250, P-1251, P-1252, P-1253, P-1254, P-1255, P-1256, P-1257, P-1259, P-1260, P-1261, P-1262, P-1263, P-1264, P-1266, P-1267, P-1268, P-1269, P-1275, P-1289, P-1316, P-1317, P-1318, P-1396, P-1397, P-1400, P-1403, P-1431, P-1432, P-1433, P-1445, P-1446, P-1447, P-1449, P-1450, P-1455, P-1462, P-1466, P-1467, P-1470, P-1471, P-1486, P-1495, P-1531, P-1532, P-1534, P-1541, P-1542, P-1544, P-1545, P-1546, P-1547, P-1548, P-1549, P-1552, P-1553, P-1554, P-1559, P-1566, P-1567, P-1568, P-1569, P-1575, P-1576, P-1580, P-1581, P-1582, P-1583, P-1590, P-1591, P-1598, P-1599, P-1630, P-1671, P-1700, P-1703, P-1704, P-1705, P-1706, P-1707, P-1708, P-1709, P-1711, P-1712, P-1713, P-1714, P-1718, P-1719, P-1720, P-1733, P-1737, P-1739, P-1740, P-1767, P-1776, P-1783, P-1798, P-1822, P-1839, P-1840, P-1864, P-1865, P-1871, P-1872, P-1873, P-1878, P-1879, P-1881, P-1882, P-1980, P-1996, P-1997, P-1998</td>
Plasmid sequence and PCR primer information:
[0519] B-Raf V600E
PCR primers
<td> BRAF</td><td> BRAF437D-S</td><td> ACGGGACCATATGGATGATTSGGAGATTCCTGA (SEQ ID NO:___)</td><td> 4783</td>
<td></td><td> BRAF722K-A</td><td> CACTGGTCGACTATTTTGGCAATGAGCGGGCCA (SEQ ID NO:___)</td><td> 4784</td>
<td></td><td> BRAFV599E-S</td><td> GGTCTAGCTACAGAAAAATCTCGATGGAG (SEQ ID NO:___)</td><td> 893</td>
<td></td><td> BRAFV599E-A</td><td> CTCCATCGAGATTTTTCTGTAGCTAGACC (SEQ ID NO:___)</td><td> 894</td>
P4254. pFastBacBD-CDC37 BRAF D437-K722-X, V600E tattccggattattcataccgtcccaccatcgggcgcggatctcggtccgaaacc atgtcgtactaccatcaccatcaccatcacgattacgatatcccaacgaccgaaaacctg
MSYYH HHHHHDYDIPTTE NL tattttcagggccatatggatgattgggagattcctgatgggcagattacagtgggacaa
YFQGHMDDWE I P.DGQIT VGQ agaattggatctggatcatttggaacagtctacaagggaaagtggcatggtgatgtggca
RIGSGSFGTVYKGKWHGDVA gtgaaaatgttgaatgtgacagcacctacacctcagcagttacaagccttcaaaaatgaa
VKMLNVTAPTP QQLQAFKNE gtaggagtactcaggaaaacacgacatgtgaatatcctactcttcatgggctattccaca
VGVLRKTRHVNILLFMGYST aagccacaactggctattgttacccagtggtgtgagggctccagcttgtatcaccatctc
KPQLAIVTQWCE GSSLYHHL catatcattgagaccaaatttgagatgatcaaacttatagatattgcacgacagactgca
HIIETKFEMIKLIDIARQTA cagggcatggattacttacacgccaagtcaatcatccacagagacctcaagagtaataat
QGMDYLHAKSIIHRDLKSNN atatttcttcatgaagacctcacagtaaaaataggtgattttggtctagctacagaaaaa
I F L Η E D L T V.K I G D F G L A T E K tctcgatggagtgggtcccatcagtttgaacagttgtctggatccattttgtggatggca
SRWSGSHQFEQLSGSILWMA ccagaagtcatcagaatgcaagataaaaatccatacagctttcagtcagatgtatatgca
PEVIRMQD'KNPYS FQSDVYA tttggaattgttctgtatgaattgatgactggacagttaccttattcaaacatcaacaac
FGIV LYELM TGQLPYSNINN agggaccagataatttttatggtgggacgaggatacctgtctccagatctcagtaaggta
RDQ IIFMVGRGYLSPDLSKV c99'a9'taact9'tccaaaagccatgaagagattaatggcagagtgcctcaaaaagaaaaga
RSNCPKAMKRLMAECLKKKR gatgagagaccactctttccccaaattctcgcctctattgagctgctggcccgctcattg
DERPLFPQILASIELLARSL ccaaaatagtcgactagagcctgcagtctcgaggcatgcggtaccaagctt (seq id no:__)
P K - (SEQ ID NO:___)
[0520] Kit
PCR primers
<td> KIT</td><td> 8K1A</td><td> ATGTACGAAGTTCAGTGGAAAGTTGTTGAAGAAATCAACGG (SEQ ID NO:___)</td><td> 1776</td>
<td></td><td> 8K1B</td><td> GGTCGATGTAAACGTAGTTGTTACCGTTGATTTCTTCAACAACTTT (SEQ ID NO:___)</td><td> 1777</td>
<td></td><td> 8K2A</td><td> AACAACTACGTTTACATCGACCCGACCCAGCTGCCGTACGAC (SEQ ID NO:___)</td><td> 1779</td>
<td></td><td> 8K2B</td><td> GTTACGCGGGAACTCCCATTTGTGGTCGTACGGCAGCTGGGTC (SEQ ID NO:___)</td><td> 1781</td>
<td></td><td> 8K3A</td><td> AAATGGGAGTTCCCGCGTAACCGTCTGTCTTTCGGTAAAACCC (SEQ ID NO:___)</td><td> 1782</td>
<td></td><td> BK3B</td><td> ACCGAACGCACCCGCACCCAGGGTTTTACCGAAAGACAGAC (SEQ ID NO:___)</td><td> 1783</td>
<td></td><td> BK4A</td><td> GGTGCGGGTGCGTTCGGTAAAGTTGTTGAAGCGACCGCGTACG (SEQ ID NO:___)</td><td> 1784</td>
<td></td><td> BK4B</td><td> GCCGCGTCAGATTTGATCAGACCGTACGCGGTCGCTTCAAC (SEQ ID NO:___)</td><td> 1785</td>
<td></td><td> 8K5A</td><td> CTGATCAAATCTGACGCGGCGATGACCGTTGCGGTTAAAATGC (SEQ ID NO:___)</td><td> 1786</td>
<td></td><td> 8K5B</td><td> GTCAGGTGCGCAGACGGTTTCAGCATTTTAACCGCAACGGTCA (SEQ ID NO:___)</td><td> 1787</td>
<td></td><td> 8K6A</td><td> AAACCGTCTGCGOACCTGACCGAACGTGAAGCGCTGATGTCTG (SEQ ID NO:___)</td><td> 1788</td>
<td></td><td> 8K6B</td><td> CCAGGTAAGACAGAACTTTCAGTTCAGACATOAGCGCTTCACGT (SEQ ID NO:___)</td><td> 1789</td>
<td></td><td> 8K7A</td><td> CTGAAAGTTCTGTCTTACCTGGGTAACCACATGAACATCGTTAA (SEQ ID NO:___)</td><td> 1791</td>
<td></td><td> 8K7B</td><td> GGTGCACGCACCCAGCAGGTTAACGATGTTCATGTGGTTAC (SEQ ID NO:___)</td><td> 1792</td>
<td></td><td> 8K8A</td><td> CTGCTGGGTGCGTGCACCATCGGTGGTCCGACCCTGGTTATCA (SEQ ID NO:___)</td><td> 1793</td>
<td></td><td> 8K8B</td><td> GTCACCGTAGCAGCAGTATTCGGTGATAACCAGGGTCGGACCA (SEQ ID NO:___)</td><td> 1794</td>
<td></td><td> BK9A</td><td> GAATACTGCTGCTACGGTGACCTGCTGAACTTCCTGCGTCGTA (SEQ ID NO:___)</td><td> 1795</td>
<td></td><td> 8K9B</td><td> AGAGCAGATGAAAGAGTCACGTTTACGACGCAGGAAGTTCAGC (SEQ ID NO:___)</td><td> 1796</td>
<td></td><td> BK10A</td><td> CGTGACTCTTTCATCTGCTCTAAACAGGAAGACCACGCGGAAG (SEQ ID NO:___)</td><td> 1797</td>
<td></td><td> 8K10B</td><td> CAGCAGGTTTTTGTACAGCGCCGCTTCCGCGTGGTCTTCCTGT (SEQ ID NO:___)</td><td> 1798</td>
<td></td><td> 8 KI ΙΑ</td><td> GCGCTGTACAAAAACCTGCTGCACTCTAAAGAATCTTCTTGCTC (SEQ ID NO:___)</td><td> 1799</td>
<td></td><td> 8K11B</td><td> CCATGTATTCGTTGGTAGAGTCAGAGCAAGAAGATTCTTTAGAGT (SEQ ID NO:___)</td><td> 1811</td>
<td></td><td> 8 KI ΙΑ</td><td> GACTCTACCAACGAATACATGGACATGAAACCGGGTGTTTCTTA (SEQ ID NO:___)</td><td> 1812</td>
<td></td><td> 8K11B</td><td> TCCGCTTTGGTCGGAACAACGTAAGAAACACCCGGTTTCATGT (SEQ ID NO:___)</td><td> 1813</td>
<td></td><td> ΘΚ12Α</td><td> GTTGTTCCGACCAAAGCGGACAAACGTCGTTCTGTTCGTATCG (SEQ ID NO:___)</td><td> 1814</td>
<td></td><td> 8K12B</td><td> TAACGTCACGTTCGATGTAAGAACCGATACGAACAGAACGACGTTT (SEQ ID NO:___)</td><td> 1B15</td>
<td></td><td> 8K13A</td><td> TCTTACATCGAACGTGACGTTACCCCGGCGATCATGGAAGACG (SEQ ID NO:___)</td><td> 1816</td>
<td></td><td> 8K13B</td><td> CCAGGTCCAGCGCCAGTTCGTCGTCTTCCATGATCGCCGG (SEQ ID NO:___)</td><td> 1817</td>
<td></td><td> 8 KI 4 A</td><td> GAACTGGCGCTGGACCTGGAAGACCTGCTGTCTTTCTCTTACC (SEQ ID NO:___)</td><td> 1818</td>
<td></td><td> 8K14B</td><td> GAACGCCATACCTTTCGCAACCTGGTAAGAGAAAGAOAGCAGGT (SEQ ID NO:___)</td><td> 1819</td>
<td></td><td> 8K15A</td><td> GTTGCGAAAGGTATGGCGTTCCTGGCGTCTAAAAACTGCATCCA (SEQ ID NO:___)</td><td> 1821</td>
<td></td><td> 8K15B</td><td> CGCGCCGCCAGGTCACGGTGGATGCAGTTTTTAGACGCC (SEQ ID NO:___)</td><td> 1822</td>
<td></td><td> 8K16A</td><td> CGTGACCTGGCGGCGCGTAACATCCTGCTGACCCACGGTCG (SEQ ID NO:___)</td><td> 1B23</td>
<td></td><td> 8K16B</td><td> ACCGAAGTCGCAGATTTTGGTGATACGACCGTGGGTCAGCAGG (SEQ ID NO:___)</td><td> 1824</td>
<td></td><td> 8K17A</td><td> ACCAAAATCTGCGACTTCGGTCTGGCGCGTGACATCAAAAACG (SEQ ID NO:___)</td><td> 1825</td>
<td></td><td> 8K17B</td><td> GTTACCTTTAACAACGTAGTTAGAGTCGTTTTTGATGTCACGCGCC (SEQ ID NO:___)</td><td> 1826</td>
<td></td><td> 8K1BA</td><td> TCTAACTACGTTGTTAAAGGTAACGCGCGTCTGCCGGTTAAATG (SEQ ID NO:___)</td><td> 1827</td>
<td></td><td> 8K1BB</td><td> GAAGATAGATTCCGGCGCCATCCATTTAACCGGCAGACGCGC (SEQ ID NO:___)</td><td> 1829</td>
<td></td><td> 8K19A</td><td> ATGGCGCCGGAATCTATCTTCAACTGCGTTTAOACCTTCGAATC (SEQ ID NO:___)</td><td> 1831</td>
<td></td><td> 8K19B</td><td> GATACCGTAAGACCAAACGTCAGATTCGAAGGTGTAAACGCAG (SEQ ID NO:___)</td><td> 1832</td>
<td></td><td> 8Κ20Ά</td><td> GACGTTTGGTCTTACGGTATCTTCCTGTGGGAACTGTTCTCTC (SEQ ID NO:___)</td><td> 1833</td>
<td></td><td> 8K20B</td><td> OCTGTGGGAACTGTTCTCTCTGGGTTCTTCTCCGTACCCGG</td><td> 1834</td>
<td></td><td></td><td> (SEQ ID NO:___)</td><td></td>
<td></td><td> 8K21A</td><td> GGTTCTTCTCCGTACCCGGGTATGCCGGTTGACTCTAAATTCTAT (SEQ ID NO:___)</td><td> 1835</td>
<td></td><td> 8K21B</td><td> CGGAAACCTTCTTTGATCATTTTGTAGAATTTAGAGTCAACCGGC (SEQ ID NO:___)</td><td> 1836</td>
<td></td><td> 8K22A</td><td> AAAATGATCAAAGAAGGTTTCCGTATGCTGTCTCCGGAACACG (SEQ ID NO:___)</td><td> 1837</td>
<td></td><td> 8K22B</td><td> ATGTCGTACATTTCCGCCGGCGCGTGTTCCGGAGACAGCATA (SEQ ID NO:___)</td><td> 1838</td>
<td></td><td> 8K23A</td><td> CCGGCGGAAATGTACGACATCATGAAAACCTGCTGGGACGCG (SEQ ID NO:___)</td><td> 1839</td>
<td></td><td> 8K23B</td><td> AAGGTCGGACGTTTCAGCGGGTCCGCGTCCCAGCAGGTTTTC (SEQ ID NO:___)</td><td> 1841</td>
<td></td><td> 8K24A</td><td> CCGCTGAAACGTCCGACCTTCAAACAGATCGTTCAGCTGATCG (SEQ ID NO:___)</td><td> 1842</td>
<td></td><td> 8K24B</td><td> TTGGTAGATTCAGAGATCTGTTTTTCGATCAGCTGAACGATCTGTT (SEQ ID NO:___)</td><td> 1843</td>
<td></td><td> 8K25A</td><td> AAACAGATCTCTGAATCTACCAACCACATCTACTCTAACCTGGC (SEQ ID NO:___)</td><td> 1844</td>
<td></td><td> 8K25B</td><td> TGACGGTTCGGAGAGCAGTTCGCCAGGTTAGAGTAGATGTGG (SEQ ID NO:___)</td><td> 1845</td>
<td></td><td> 8K26A</td><td> AACTGCTCTCCGAACCGTCAGAAACCGGTTGTTGACCACTCTG (SEQ ID NO:___)</td><td> 1846</td>
<td></td><td> 8K26B</td><td> GTAGAACCAACAGAGTTGATACGAACAGAGTGGTCAACAACCGGT (SEQ ID NO:___)</td><td> 1847</td>
<td></td><td> 8K27A</td><td> CGTATCAACTCTGTTGGTTCTACCGCGTCTTCTTCTCAGCCG (SEQ ID NO:___)</td><td> 1848</td>
<td></td><td> 8K27B</td><td> AACGTCGTCGTGAACCAGCAGCGGCTGAGAAGAAGACGCG (SEQ ID NO:___)</td><td> 1849</td>
<td></td><td> 8K-F</td><td> GTTGTTTCATATGTACGAAGTTCAGTGGAAAG (SEQ ID NO:___)</td><td> 1851</td>
<td></td><td> 8K-R</td><td> GTTGTTTGTCGACTAAACGTCGTCGTGAACCAGCAG (SEQ ID NO:___)</td><td> 1852</td>
<td></td><td> KIT COD-K948X</td><td> GTTCTTGTCGACTATTTCTGACGGTTCGGAGAGC (SEQ ID NO:___)</td><td> 3411</td>
P1332.N6 BI PTP KIT M552-K948-X COD taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattt tgtttaactttaagaaggagatataccatgggtcaccaccatcaccatcatatgtacgaa M GHHHHHHMYE gttcagtggaaagttgttgaagaaatcaacggtaacaactacgtttacatcgacccgacc VQWKVVEEINGNNYVYIDPT cagctgccgtacgaccacaaatgggagttcccgcgtaaccgtctgtctttcggtaaaaca QLPYDHKWEFPRNR LSFGKT ctgggtgcgggtgcgttcggtaaagttgttgaagcgaccgcgtacggtctgatcaaatct LGAGAFGKVVEATAYGLIKS gacgcggcgatgaccgttgcggttaaaatgctgaaaccgtctgcgcacctgaccgaacgt DAAMTVAVKML KPSAHLTER gaagcgctgatgtctgaactgaaagttctgtcttacctgggtaaccacatgaacatcgtt E ALMS ELKVLSYLGNHMNIV aacctgctgggtgcgtgcaccatcggtggtccgaccctggttatcaccgaatactgctgc NLLGACTIGGPTLVITEYCC tacggtgacctgctgaacttcctgcgtcgtaaacgtgactctttcatctgctctaaacag YGDLLNFLRRKRDSFICS KQ gaagaccacgcggaagcggcgctgtacaaaaacctgctgcactctaaagaatcttcttgc EDHAEAALYKNLLHSKESSC tctgactctaccaacgaatacatggacatgaaaccgggtgtttcttacgttgttccgacc SDSTNEYMDMKPGVSYVVPT aaagcggacaaacgtcgttctgttcgtatcggttcttacatcgaacgtgacgttaccccg KADKRRSVRIGSYIERDVTP gcgatcatggaagacgacgaactggcgctggacctggaagacctgctgtctttctcttac AIM'EDDELALDLEDLLSFSY caggttgcgaaaggtatggcgttcctggcgtctaaaaactgcatccaccgtgacctggcg QVAKGMAFLASKNCIHRDLA gcgcgtaacatcctgctgacccacggtcgtatcaccaaaatctgcgacttcggtctggcg ARNILLTHGRI TKI CDFGLA cgtgacatcaaaaacgactctaactacgttgttaaaggtaacgcgcgtctgccggttaaa RDIKNDS NYVVKGNARLPVK tggatggcgccggaatctatcttcaactgcgtttacaccttcgaatctgacgtttggtct
WMAPESIFNCV.YTFESDVWS tacggtatcttcctgtgggaactgttctctctgggttcttctccgtacccgggtatgccg YGIFLWELFSLGS SPYPGMP gttgactctaaattctacaaaatgatcaaagaaggtttccgtatgctgtctccggaacac VDSKFYKMIKEGFRMLSPEH gcgccggcggaaatgtacgacatcatgaaaacctgctgggacgcggacccgctgaaacgt APAEMYDIMKTCWDADPLKR ccgaccttcaaacagatcgttcagctgatcgaaaaacagatctctgaatctaccaaccac PTFKQIVQLIEKQISESTNH atctactctaacctggcgaactgctctccgaaccgtcagaaatagtcgactgaaaaagga IYSNLANCSPNRQK - (SEQ ID NO: ) agagt (seq id no: )
[0521] MEK1 substrate
PCR primers
<td> MEK1</td><td> MEKl-S</td><td> CGGGTCCCATATGCCCAAGAAGAAGCCGAC (SEQ ID NO:___)</td><td> 755</td>
<td></td><td> MEK-HIS</td><td> GTTCGTTGTCGACGACGCCAGCAGCATGGGTTG (SEQ ID NO:___)</td><td> 2127</td>
<td></td><td> K97A-1 (K104A)</td><td> CTAATTCATCTGGAGATCGCGCCCGCAATCCGG (SEQ ID NO:___)</td><td> 2023</td>
<td></td><td> K97A-2 (K104A)</td><td> CCGGATTGCGGGCGCGATCTCCAGATGAATTAG (SEQ ID NO:___)</td><td> 2024</td>
P1277.pGEX-BIO MEK1 K97A atgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttctt MSPILGYWKIKGLVQPTRLL ttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaa LEYLEEKYEEHLYERDEGDK tggcgaaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatattgat WRNKKFEL.GL.EFPNL.PYYID ggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaac GDVKLTQSMAIIRYIADKHN atgttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttg MLGGCPKERAEISMLEGAVL gatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagtt DIRYGVSRI-AYSKDFET LKV gattttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcataaa DFLSKL.PEMLKMFEDRLCHK acatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgat TYLNGDHVTHPDFMLYDALD gttgttttatacatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaa VVLYMDPMCLDAFPKLVCFK aaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagca K R I E A I P Q I'D K Y L K S S K Y I A tggcctttgcagggctggcaagccacgtttggtggtggcgaccatcctccaaaatcggat WP LQGWQATFGGGDHPPKSD ctggttccgcgtggatctcatatgcccaagaagaagccgacgcccatccagctgaacccg LVPRGSHMPKKKPTPIQLNP gcccccgacggctctgcagttaacgggaccagctctgcggagaccaacttggaggccttg APDGSAVNGTSSAETNLEAL cagaagaagctggaggagctagagcttgatgagcagcagcgaaagcgccttgaggccttt QKKLE. ELELDEQ.QRKRLEAF cttacccagaagcagaaggtgggagaactgaaggatgacgactttgagaagatcagtgag LT QKQK VGELKDDDFEKISE ctgggggctggcaatggcggtgtggtgttcaaggtctcccacaagccttctggcctggtc LGAGNGGVVFK VSHKPSGLV atggccagagcgctaattcatctggagatcaaacccgcaatccggaaccagatcataagg
MARALIHL EIKPAIRNQII R gagctgcaggttctgcatgagtgcaactctccgtacatcgtgggcttctatggtgcgttc
ELQVLHECNSPYIVGFYGAF tacagcgatggcgagatcagtatctgcatggagcacatggatggaggttctctggatcaa YSDGEISICMEHMDGGSLDQ gtcctgaagaaagatggaagaattcctgaacaaattttaggaaaagttagcattgctgta VLKKAGRIPEQILGKVSIAV ataaaaggcctgacatatctgagggagaagcacaagatcatgcacagagatgtcaagccc IKGLTYLREKHKIMHRDVKP tccaacatcctagtcaactcccgtggggagatcaagctctgtgactttggggtcagcggg SNILVNSRGEIKLCDF.GVSG cagctcatcgactccatggccaactccttcgtgggcacaaggtcctacatgtcgccagaa QLIDSMANSFVGTRSYMSPE agactccaggggactcattactctgtgcagtcagacatctggagcatgggactgtctctg RLQGTHYSVQSDIWSMGLSL gtagagatggcggttgggaggtatcccatccctcctccagatgccaaggagctggagctg VEMAVGRYPIPPPDAKELEL atgtttgggtgccaggtggaaggagatgcggctgagaccccacccaggccaaggaccccc MFGCQVEGDAAETPPRPRTP gggaggccccttagctcatacggaatggacagccgacctcccatggcaatttttgagttg GRPLSSYGMDSRPPMAIFEL ttggattacatagtcaacgagcctcctccaaaactgcccagtggagtgttcagtctggaa LDYIVNEPPPKLPSGVFSLE tttcaagattttgtgaataaatgcttaataaaaaaccccgcagagagagcagatttgaag FQDFVNKCLIKNPAERADLK caactcatggttcatgcttttatcaagagatctgatgctgaggaagtggattttgcaggt QLMVHAFIKRSDA EEVDFAG tggctctgctccaccatcggccttaaccagcccagcacaccaacccatgctgctggcgtc WLCSTIGLNQPSTPTHAAGV gtcgacctgaacgacatcttcgaagctcagaaaatcgaatggcaccgttagaattc VDLNDIFEAQKIEWHR(nucleic acid SEQ ID NO: ) (polypeptide SEQ ID NO: )
[0522] Additional examples of certain methods contemplated by the present invention may be found in the following applications: U.S. Prov. App. No. 60/580,898, filed June 17, 2004; U.S. Prov. App. No. 60/682,076, filed May 17, 2005; U.S. Prov. App. No. 60/682,058, filed May 17, 2005; U.S, Prov, App. No. 60/682,063, filed May 17, 2005; U.S. Prov. App. No. 60/682,051, filed May 17, 2005; U.S. Prov. App. No. 60/682,042, filed May 17, 2005; U.S. Prov. App. No. 60/692,750, filed June 22, 2005; and U.S. Prov. App. No. 60/692,960, filed June 22, 2005; each of which are hereby incorporated by reference herein in their entireties including all specifications, figures, and tables, and for all purposes.
[0523] All patents and other references cited in the specification are indicative of the level of skill of those skilled in the art to which the invention pertains, and are incorporated by reference in their entireties, including any tables and figures, to the same extent as if each reference had been incorporated by reference in its entirety individually.
[0524] One skilled in the art would readily appreciate that the present invention is well adapted to obtain the ends and advantages mentioned, as well as those inherent therein. The methods, variances, and compositions described herein as presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art, which are encompassed within the spirit of the invention, are defined by the scope of the claims.
[0525] It will be readily apparent to one skilled in the art that varying substitutions and modifications maybe made to the invention disclosed herein without departing from the scope and spirit of the invention. For example, variations can be made to crystallization or co-crystallization conditions for Ret and Ret surrogate proteins and/or various kinase domain sequences can be used. Thus, such additional embodiments are within the scope of the present invention and the following claims.
[0526] The invention illustratively described herein suitably may be practiced in the.absence of any element or elements, limitation or limitations which is not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising”, “consisting essentially of’ and “consisting of’ may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.
[0527] In addition, where features or aspects of the invention are described in terms of Markush groups or other grouping of alternatives, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group or other group,
[0528] Also, unless indicated to the contrary, where various numerical values are provided for embodiments, additional embodiments are described by taking any 2 different values as the endpoints of a range. Such ranges are also within the scope of the described invention.
[0529] Thus, additional embodiments are within the scope of the invention and within the following claims.
Contents73
213 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32 Sheet 33 Sheet 34 Sheet 35 Sheet 36 Sheet 37 Sheet 38 Sheet 39 Sheet 40 Sheet 41 Sheet 42 Sheet 43 Sheet 44 Sheet 45 Sheet 46 Sheet 47 Sheet 48 Sheet 49 Sheet 50 Sheet 51 Sheet 52 Sheet 53 Sheet 54 Sheet 55 Sheet 56 Sheet 57 Sheet 58 Sheet 59 Sheet 60 Sheet 61 Sheet 62 Sheet 63 Sheet 64 Sheet 65 Sheet 66 Sheet 67 Sheet 68 Sheet 69 Sheet 70 Sheet 71 Sheet 72 Sheet 73 Sheet 74 Sheet 75 Sheet 76 Sheet 77 Sheet 78 Sheet 79 Sheet 80 Sheet 81 Sheet 82 Sheet 83 Sheet 84 Sheet 85 Sheet 86 Sheet 87 Sheet 88 Sheet 89 Sheet 90 Sheet 91 Sheet 92 Sheet 93 Sheet 94 Sheet 95 Sheet 96 Sheet 97 Sheet 98 Sheet 99 Sheet 100 Sheet 101 Sheet 102 Sheet 103 Sheet 104 Sheet 105 Sheet 106 Sheet 107 Sheet 108 Sheet 109 Sheet 110 Sheet 111 Sheet 112 Sheet 113 Sheet 114 Sheet 115 Sheet 116 Sheet 117 Sheet 118 Sheet 119 Sheet 120 Sheet 121 Sheet 122 Sheet 123 Sheet 124 Sheet 125 Sheet 126 Sheet 127 Sheet 128 Sheet 129 Sheet 130 Sheet 131 Sheet 132 Sheet 133 Sheet 134 Sheet 135 Sheet 136 Sheet 137 Sheet 138 Sheet 139 Sheet 140 Sheet 141 Sheet 142 Sheet 143 Sheet 144 Sheet 145 Sheet 146 Sheet 147 Sheet 148 Sheet 149 Sheet 150 Sheet 151 Sheet 152 Sheet 153 Sheet 154 Sheet 155 Sheet 156 Sheet 157 Sheet 158 Sheet 159 Sheet 160 Sheet 161 Sheet 162 Sheet 163 Sheet 164 Sheet 165 Sheet 166 Sheet 167 Sheet 168 Sheet 169 Sheet 170 Sheet 171 Sheet 172 Sheet 173 Sheet 174 Sheet 175 Sheet 176 Sheet 177 Sheet 178 Sheet 179 Sheet 180 Sheet 181 Sheet 182 Sheet 183 Sheet 184 Sheet 185 Sheet 186 Sheet 187 Sheet 188 Sheet 189 Sheet 190 Sheet 191 Sheet 192 Sheet 193 Sheet 194 Sheet 195 Sheet 196 Sheet 197 Sheet 198 Sheet 199 Sheet 200 Sheet 201 Sheet 202 Sheet 203 Sheet 204 Sheet 205 Sheet 206 Sheet 207 Sheet 208 Sheet 209 Sheet 210 Sheet 211 Sheet 212 Sheet 213
123 members in 36 offices
Priority claims3
| Document | Office | Kind | Date |
|---|---|---|---|
| 69296005 | United States of America | P | |
| 73152805 | United States of America | P | |
| 2006024361 | United States of America | W |
Members123
| Document | Office | Kind | |
|---|---|---|---|
| AU2006261993A1 | Australia | A1 | |
| CA2613015A1 | Canada | A1 | |
| WO2007002325A1 | World Intellectual Property Organization (WIPO) | A1 | |
| WO2007002433A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU2006272951A1 | Australia | A1 | |
| CA2608733A1 | Canada | A1 | |
| WO2007013896A2 | World Intellectual Property Organization (WIPO) | A2 | |
| US2007032519A1 | United States of America | A1 | |
| PE20070100A1 | Peru | A1 | |
| WO2007013896A3 | World Intellectual Property Organization (WIPO) | A3 | |
| AR054624A1 | Argentina | A1 | |
| TW200804370A | Taiwan Province of China | A | |
| ECSP077985A | Ecuador | A | |
| MX2007014377A | Mexico | A | |
| EP1885723A2 | European Patent Office (EPO) | A2 | |
| NO20075992L | Norway | L | |
| ECSP088121A | Ecuador | A | |
| MX2007016463A | Mexico | A | |
| EP1893612A1 | European Patent Office (EPO) | A1 | |
| NO20076659L | Norway | L | |
| CR9591A | Costa Rica | A | |
| CR9677A | Costa Rica | A | |
| KR20080027775A | Republic of Korea | A | |
| KR20080030619A | Republic of Korea | A | |
| IL187344A0 | Israel | A0 | |
| IL188248A0 | Israel | A0 | |
| MA29612B1 | Morocco | B1 | |
| CN101223169A | China | A | |
| CN101243084A | China | A | |
| HK1114610A | Hong Kong, China | A | |
| HK1114610A1 | Hong Kong, China | A1 | |
| ZA200709919B | South Africa | B | |
| BRPI0611863A2 | Brazil | A2 | |
| JP2008545652A | Japan | A | |
| JP2008546797A | Japan | A | |
| RU2007142326A | Russian Federation | A | |
| RU2008100933A | Russian Federation | A | |
| NZ565255A | New Zealand | A | |
| BRPI0610066A2 | Brazil | A2 | |
| US2010249118A1 | United States of America | A1 | |
| US2010256365A1 | United States of America | A1 | |
| US7846941B2 | United States of America | B2 | |
| US7863288B2 | United States of America | B2 | |
| UA93679C2 | Ukraine | C2 | |
| US2011059963A1 | United States of America | A1 | |
| NZ563444A | New Zealand | A | |
| RU2418800C2 | Russian Federation | C2 | |
| US2011166174A1 | United States of America | A1 | |
| UA95244C2 | Ukraine | C2 | |
| EP1893612B1 | European Patent Office (EPO) | B1 | |
| AT518860T | Austria | T | |
| ATE518860T1 | Austria | T1 | |
| CN102206216A | China | A | |
| AR078519A2 | Argentina | A2 | |
| AU2006261993B2 | Australia | B2 | |
| DK1893612T3 | Denmark | T3 | |
| PT1893612E | Portugal | E | |
| EP2395004A2 | European Patent Office (EPO) | A2 | |
| ES2371397T3 | Spain | T3 | |
| US2012022098A1 | United States of America | A1 | |
| PL1893612T3 | Poland | T3 | |
| US2012053177A1 | United States of America | A1 | |
| CN101243084B | China | B | |
| AU2012200933A1 | Australia | A1 | |
| US8143271B2 | United States of America | B2 | |
| SI1893612T1 | Slovenia | T1 | |
| CA2613015C | Canada | C | |
| EP2395004A3 | European Patent Office (EPO) | A3 | |
| IL188248AThis record | Israel | A | |
| RS52010B | Serbia | B | |
| KR101125919B1 | Republic of Korea | B1 | |
| ZA200711152B | South Africa | B | |
| RU2011101140A | Russian Federation | A | |
| CN102603581A | China | A | |
| JP5007304B2 | Japan | B2 | |
| LU92035I2 | Luxembourg | I2 | |
| DE122012000043I1 | Germany | I1 | |
| HK1164866A | Hong Kong, China | A | |
| HK1164866A1 | Hong Kong, China | A1 | |
| ZA201202026B | South Africa | B | |
| MY147410A | Malaysia | A | |
| US8415469B2 | United States of America | B2 | |
| US8470818B2 | United States of America | B2 | |
| CR20130216A | Costa Rica | A | |
| US2013261117A1 | United States of America | A1 | |
| NO333913B1 | Norway | B1 | |
| US2013303534A1 | United States of America | A1 | |
| TW201345906A | Taiwan Province of China | A | |
| NO2014006I2 | Norway | I2 | |
| TWI432193B | Taiwan Province of China | B | |
| NO2014006I1 | Norway | I1 | |
| RU2012150759A | Russian Federation | A | |
| CN102206216B | China | B | |
| TWI473808B | Taiwan Province of China | B | |
| MY153898A | Malaysia | A | |
| TW201514140A | Taiwan Province of China | A | |
| AU2012200933B2 | Australia | B2 | |
| CN102603581B | China | B | |
| CY1111996T1 | Cyprus | T1 | |
| CY2012021I1 | Cyprus | I1 |
4 legal events, as the office reported them to INPADOC
Over the term
Point at a mark for the eventEvents
| Event | Code | |
|---|---|---|
| Patent renewedKB | KB | |
| Patent renewedKB | KB | |
| Patent renewedKB | KB | |
| Patent grantedGrantedFF | FF |
Numbers
- Application
- 18824807
Titles
- English
- PYRROLO[2,3-B] PYRIDINE DERIVATIVES AS PROTEIN KINASE INHIBITORS
Classification
- CPC, 55
- C07D471/04
- A61K31/437
- A61K31/496
- A61K31/5377
- A61P1/00
- A61P1/04
- A61P1/16
- A61P1/18
- A61P11/00
- A61P11/06
- A61P13/08
- A61P13/12
- A61P15/08
- A61P17/00
- A61P17/02
- A61P17/06
- A61P19/02
- A61P19/10
- A61P21/04
- A61P25/00
- A61P25/06
- A61P25/14
- A61P25/16
- A61P25/28
- A61P27/02
- A61P27/16
- A61P29/00
- A61P3/04
- A61P3/14
- A61P31/04
- A61P31/16
- A61P35/00
- A61P35/02
- A61P3/06
- A61P37/00
- A61P37/02
- A61P37/06
- A61P37/08
- A61P43/00
- A61P7/00
- A61P7/02
- A61P9/00
- A61P9/04
- A61P9/10
- A61P3/10
- A61K31/435
- A61K31/416
- C07C37/62
- C07C45/00
- C07C45/673
- C07C45/71
- C07C47/565
- C07C47/575
- C07D209/08
- C07C39/27
