Factor ix polypeptides and methods of use thereof

Description

PRONALASK BASIS

The area of discovery

[0001] The present invention relates generally to the field of therapeutics for hemostatic disorders.

State of the art

[0002] Hemophilia B (also known as Christmas disease) is one of the most common inherited bleeding disorders in the world. It results in reduced blood clotting activity in vivo and in vitro and requires extensive medical monitoring throughout the life of the affected individual. In the absence of intervention, the affected person will suffer from spontaneous bleeding into the joints, which causes severe pain and disabling immobility; bleeding into the muscles leads to the accumulation of blood in these tissues; spontaneous bleeding in the throat and neck can cause suffocation if not treated immediately; renal bleeding is also present; and serious bleeding after surgical procedures, minor accidental injuries, or tooth extractions is common.

[0003] Normal blood clotting in vivo requires, at a minimum, the serine proteases: factors Π (prothrombin), VII, IX, X, and XI (soluble plasma proteins); cofactors including the transmembrane protein tissue factor and the plasma proteins factors V and VIII; fibrinogen, transglutaminase factor XIII, phospholipids (including activated platelets), and calcium. Additional proteins, including kallikrein, high molecular weight kininogen, and factor XII, are required for some in vitro clotting assays and may play a role in vivo in pathological conditions.

[0004] In hemophilia, blood clotting is impaired by a deficiency of certain clotting factors in the plasma. Hemophilia B is caused by a deficiency of factor IX, which may result from either reduced synthesis of the factor IX protein or from a defective molecule with reduced activity. Treatment of hemophilia involves replacement of the missing clotting factor by administering exogenous factor concentrates highly enriched in factor IX. However, the production of such a concentrate from blood is fraught with technical difficulties, as described below.

[0005] Purification of factor IX from plasma (plasma-derived factor IX; pdFIX) yields almost exclusively active factor IX. However, such purification of factor IX from plasma is very difficult because factor IX is present in plasma only at low concentrations (5 pg/ml). Andersson, Thrombosis Research 7: 451 459 (1975). Furthermore, purification from blood requires removal or inactivation of infectious agents such as HIV and HCV. In addition, pdFIX has a short half-life and therefore requires frequent dosing. Recombinant factor IX (rFIX) is also available, but suffers from the same short half-life and need for frequent dosing (e.g., 2-3 times per week for prophylaxis) as pdFIX. rFIX also has a lower incremental utilization (K value) compared to pdFIX, requiring the use of higher doses of rFIX than those of pdFIX. Peters et al. (Blood 2010, Vol. 115(10): 2057-2064) disclose FIX and FcRn binding fusion proteins and their use in mice and dogs. Shapiro et al. (Haemophilia 2010, Vol. 16(Suppl. 4): 30) report on the safety and prolonged activity of a single dose of recombinant FIXFc administered to adult patients with hemophilia B.

[0006] Reduced mortality, prevention of joint damage, and improved quality of life have been important advances made possible by the development of plasma-derived factor IX and recombinant factor IX. Prolonged protection from bleeding would represent another key advance in the treatment of patients with hemophilia B. However, to date, no products have been developed that provide prolonged protection. Therefore, there remains a need for improved factor IX polypeptides that are more tolerable and effective than current therapies.

BRIEF SUMMARY OF THE INVENTION

[0007] The present invention provides a method of prophylactically treating a bleed or bleeding episode in a human subject with hemophilia B, as defined in the appended claims. In particular, the present invention provides a chimeric factor IX polypeptide ("FIX") comprising human FIX with an amino acid sequence identical to amino acids 1 to 415 of the sequence

SEQ ID NO: 2 and human Fc as an FcRn binding partner, for use in a method of prophylactically treating bleeding or bleeding episodes in a human subject with hemophilia B, comprising administering to the human subject intravenously multiple doses of 50 IU/kg to 100 IU/kg of a chimeric FIX polypeptide at a dosing interval of 9 days to 18 days. Further aspects and embodiments are disclosed in the appended claims.

[0008] In some embodiments, the plasma level of the chimeric polypeptide reaches an average trough concentration of at least about 1 IU/dl after at least about 6 days in at least about 70%, at least about 80%, at least about 90%, or at least about 100% of a patient population or reaches an average trough concentration of at least about 1, 2, 3, 4, or 5 IU/dl after at least about 6 days in a subject. In some embodiments, the plasma level of said chimeric polypeptide reaches an average trough concentration of about 1-5 or 1-3 IU/dl. Such a nadir or average nadir may be reached after about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39 or about 40 days.

[0009] In some embodiments, the chimeric polypeptide has significantly reduced phosphorylation and sulfation compared to plasma-derived factor IX. In some embodiments, the chimeric polypeptide is less than 25% phosphorylated and less than 25% sulfated, e.g., less than 25% fully phosphorylated and sulfated. In some embodiments, the chimeric polypeptide is less than about 10% phosphorylated and less than about 9% sulfated. In some embodiments, the chimeric polypeptide has a gamma carboxylation pattern/distribution, gamma carboxylation content, sialylation pattern/distribution, and/or sialylation content similar to (i.e., within 10% of) or the same as the chimeric factor IX Fc polypeptide of Examples 5-6.

[0010] In some embodiments, the chimeric polypeptide has an incremental utilization of greater than 0.7 or greater than 0.75 pg/ml (antigen). In some embodiments, the chimeric polypeptide has a mean incremental utilization (K-value) (activity; observed) of at least about 0.8, at least about 0.9, or at least about 1 Ш/dL per IU/kg.

[0011] In some embodiments, the chimeric polypeptide exhibits one or more pharmacokinetic parameters in said patient population or said subject selected from the group consisting of:

(a) a mean clearance (CL) (activity) in said patient population of about 3.36 ± 0.93 mL/h/kg; a mean clearance (CL) (activity) in said patient population of about 3.0-3.72, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7 or 3.72 mL/h/kg; a mean clearance (CL) (activity) in said patient population that is about 2.5 times lower than the clearance of a polypeptide comprising said factor IX without said FcRn BP; a clearance (CL) (activity) in said subject of about 1.84-4.58 mL/h/kg;

(b) a mean retention time (MRT) (activity) in said patient population of at least about 68.05 ± 11.16 hours; a mean MRT (activity) in said patient population of about 60-78, 60, 62, 64, 66, 68, 70, 72, 74, 76 or 78 hours; a mean MRT (activity) in said patient population that is about 3 times longer than the mean MRT of a polypeptide comprising said factor IX without said FcRn BP; a mean retention time (MRT) (activity) in said subject of about 53.1-85.8 hours; a mean retention time (MRT) (activity) in said subject of at least about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85 or about 90 hours;

(c) medium t₁/₂bcta (activity) in the above patient population of about 52.5 ± 9.2 hours; mean tti/₂beta (activity) in the specified patient population which is about 47-60 hours, about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54, about 55, about 56, about 57, about 58, about 59, about 60 hours; median t^beta (activity) in the specified patient population which is about 3 times longer than median ti/₂a beta polypeptide comprising said factor IX without said FcRn BP;₂b_andthat (activity) in said subject of about 40-67.4, about 40, about 45, about 50, about 55, about 60, about 65, about 70 or about 75 hours;

(d) a mean incremental utilization (K-value) (activity; observed) in the said patient population of about 0.93 ± 0.18 ПЙ/dL per ПЙ/kg; a mean incremental utilization (K-value) (activity; observed) in the said patient population of about 0.85-1.0, about 0.85, about 0.86, about 0.87, about 0.88, about 0.89, about 0.90, about 0.91, about 0.92, about 0.93, about 0.94, about 0.95, about 0.96, about 0.97, about 0.98, about 0.99, about 1.0, about 1.05, about 1.10 or about 1.15 Ш/dL per lU/kg; mean incremental utilization (K-value) (activity;

observed) in said patient population which is about 24% better than the mean incremental utilization of a polypeptide comprising said factor IX without said FcRn BP;

incremental utilization (K-value) (activity; observed) in the subject of about 0.62-1.17 lU/dL per lU/kg;

(e) a mean Vss (activity) in said patient population of about 226 ± 67.76 (corrected to 69.8) mL/kg; a mean Vss (activity) in said patient population of about 200-300, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290 or about 300 mL/kg; a Vss (activity) in said subject of about 145365 mL/kg;

(f) a mean AUC/dose (activity) in said patient population of about 32.44 ± 10.75 IU*h/dL per IU/kg; a mean AUC/dose (activity) in said patient population of about 26-40, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39 or about 40 IU*h/dL per IU/kg; an AUC/dose in said subject of about 21.80-54.30 IU*h/dL per IU/kg.

[0012] In some embodiments, the dose of chimeric polypeptide contains a significantly lower (10-100-fold) level (0.01-0.001%) of activated FIX (FIXa) than currently commercialized factor IX products such as MONONINE™ (pdFIX; CSL Behring) or BENEFIX™ (Wyeth; rFIX) (0.1%). Such a level may be 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 times lower than currently commercialized products, or 0.01, 0.05, 0.0033, 0.0025, 0.002, 0.00167, 0.00142, 0.00125, 0.00111 or 0.001%.

[0013] The dose may be a fixed dose or an individualized dose.

[0014] In some embodiments, the chimeric polypeptide is administered intravenously or subcutaneously.

[0015] A chimeric polypeptide may be in the form of a hybrid comprising a second polypeptide in association with said chimeric polypeptide, said second polypeptide comprising or consisting essentially of an FcRn BP, e.g., Fc. The chimeric polypeptide may be at least 90%, at least 95%, or 100% identical to a factor IX sequence, an Fc sequence, or both a factor IX sequence and an Fc sequence in Tables 2A (SEQ ID NO:2) and/or 2B (SEQ ID NO:4), with or without a signal sequence and a propeptide.

[0016] The chimeric polypeptide or hybrid can be administered as part of a pharmaceutical composition comprising at least one excipient.

BRIEF DESCRIPTION OF DRAWINGS/PICTURES

[0017]

FIG. 1. Schematic representation of one type of chimeric factor IX polypeptide, the factor IX-Fc hybrid.

FIG. 2. Group average FIXFc concentration versus time profiles; comparison of nominal dose.

FIG. 3. Group average FIXFc activity versus time profiles; comparison of nominal dose.

FIG. 4. Decision tree for subtracting the initial value.

FIG. 5. Dose proportional increase in Cmax and AUC for FIX activity.

FIG. 6. Estimation of therapeutic duration of rFIXFc at 50 Ш/kg (A) and 100 Ш/kg (B).

FIG. 7. Dose proportional increase in Cmax and AUC for FIX antigen.

FIG. 8. Pharmacokinetic estimates for rFIXFc antigen at nominal doses of 50 (A) and 100 (B) IU/kg.

FIG. 9. Excellent correlation between rFIXFc activity levels and antigen. Note that due to the recalculation of PK activity, as explained in Example 11, R²=0,946.

FIG. 10. RFIX-FC Structure of the rFIX-Fc domain and post-translational modifications. PRO: propeptide cleaved by the processing enzyme. GLA: contains 12 γ-carboxylated glutamic acid (Gia) residues. ACT PEP: activation peptide cleaved to yield active protease. Other modifications: N- and O-glycosylation, Asp(64) β-hydroxylation, tyrosine sulfation, serine phosphorylation.

FIG. 11. SDS-PAGE gel of purification intermediate and purified FIXFc monomer. Samples from different FIXFc purification steps were analyzed by non-reducing SDS-PAGE. Column 1: SeeBlue Plus molecular weight markers (Invitrogen). Column 2: empty column. Column 3: Protein A loading. Column 4: Protein A eluate. Column 5: Fractogel DEAE eluate. Column 6: Q Seph FF eluate. Column 7: final FIXFc by mass. Column 8: empty column. Column 9: final reduced FIXFc by mass.

FIG. 12. Functional activity of FIXFc in FIX-deficient mice. Functional activity of FIXFc in FIX-deficient mice.

FIX-deficient mice were intravenously dosed with 219 Ш/kg FIXFc (3 or 4 per group, 6 groups, n=23) or 200 Ш/kg rFIX (3 or 4 per group, 5 groups, n=23) at time t=0. Blood samples were collected at various times post-dosing (0.25 hours to 96 hours) and assayed for clotting activity using the FIX activity assay. * rFIX activity was undetectable in all mice at time points later than 48 hours post-dosing.

FIG. 13. Whole blood clotting time of FIXFc versus recombinant factor IX in FIX-deficient mice. FIX-deficient mice (6 per group) were given a dose of 50 IU/kg FIXFc or 50 IU/kg rFIX intravenously. Blood samples were collected before dosing and at various times after dosing. Blood samples were incubated at 37°C and visually inspected for the presence of clots once per minute. The time required for clot formation was recorded and, when clotting activity returned to baseline (i.e., no clot formation occurred), additional samples were not collected (samples collected 15 minutes to 144 hours for FIXFc or 15 minutes to 72 hours for rFIX).

FIG. 14. Pharmacodynamics of FIXFc in FIX-deficient mice. FIX-deficient mice were dosed with 219 IU/kg FIXFc (5 per group, 6 groups, n=30) or 200 IU/kg rFIX (4 or 5 per group, 6 groups, n=28) on days 0, 4, and 8. Plasma samples were collected by cardiac puncture 15 minutes and 96 hours after each dose, and clotting activity was measured using the FIX activity assay. Plasma was also collected by tail bleeding at 8, 24, 48, and 72 hours after each dose. FIXFc levels were measured in all samples using a FIXFc-specific ELISA. (A) Measured versus Calculated activity. Clotting activity for FIXFc was measured using a FIX activity assay at 15 minutes and 96 hours after three doses. The in vitro clotting activity for FIXFc was determined to be 43.8 ± 5.4 IU/mg. Based on this activity (IU/mg) and the measured protein levels, plasma clotting activity levels were calculated for the time points of 15 minutes, 8, 24, 48, 72, and 96 hours after each dose. (B) In FIX-deficient mice treated with up to three doses of rFIX at 200 IU/kg, FIX levels were measured by a FIX-specific ELISA. Using the measured specific activities of FIXFc and rFIX, it was possible to compare the calculated clotting activity for all samples analyzed by ELISA.

FIG. 15. Pharmacokinetics and pharmacodynamics of FIXFc in dogs with FIX deficiency. Two dogs with hemophilia B received an intravenous infusion of FIXFc at 140 IU/kg. Blood samples were collected at 5, 15, and 30 minutes, and at 1, 2, 4, 6, 8, 12, 24, 27, 30, 48, 51, 54, 72, 80, 96, 126, 144, and 168 hours. (A) A sandwich ELISA assay, using a FIX capture antibody and an Fc-HRP detection antibody, was used to measure the concentration of intact FIXFc in plasma samples from hemophilia B dogs. (B) The clotting activity of FIX was measured at all time points against a standard curve generated with FIXFc. (C) Blood collected from animals was immediately analyzed for whole blood clotting time. Blood samples were incubated at 28°C and visually inspected for the presence of a clot once per minute, and the time at which a clot formed was recorded.

FIG. 16. Pharmacokinetics of FIXFc in macaque monkeys. Monkeys were administered a single dose (0.5, 2 and 10 mg/kg, corresponding to approximately 25, 100 or 500 IU/kg) of FIXFc (n=2, 3 and 3, respectively). Blood samples were collected at 0.25, 0.5, 1, 8, 24, 48, 72, 96, 120, 144 and 168 hours post-dose and plasma was prepared for analysis of protein concentration by an ELISA specific for FIXFc.

FIG. 17. rFIXFc and BENEFIX™ show comparable activity and dose response in whole blood of mice with HemB. (A) ROTEM® Parameters. rFIX or BENEFIX™ were added to blood of mice with HemB and clotting parameters were measured using ROTEM®. (B)-(D) Dose response, measuring (B) CT, (C) CFT and (D) Alpha-angle.

FIG. 18. Evaluation of acute efficacy in the severed tail bleeding model in mice with hemophilia.

FIG. 19. (A) Blood loss after tail clipping in individual HemB mice treated with rFIXFc or BENEFIX™. (B) Dose response of rFIXFc and BENEFIX™ on median blood loss after tail clipping in HemB mice.

FIG. 20. Tail vein transection (TVT) bleeding model in mice with HemB: a model of venous bleeding characteristic of patients with severe hemophilia.

FIG. 21. Prolonged activity of rFIXFc versus BENEFIX™ in HemB-treated mice measured by the ROTEM® whole blood assay. (A) CT, (B) CFT, (C) Alpha-angle and (D) Partial correlation between whole blood clotting activity (CT) by ROTEM® versus plasma activity by aPTT.

FIG. 22. Prolonged efficacy of FIXFc versus BENEFIX™ in a tail vein transection (TVT) bleeding model in HemB mice. (A) Survival: Survival rates were comparable in mice that received BENEFIX™ 24 hours before TVT and in mice that received rFIXFc 72 hours before TVT, and (B) Rebleeding: Bleeding rates were comparable in mice that received BENEFIX™ 24 hours before TVT and in mice that received rFIXFc 72 hours before TVT.

FIG. 23. Correlation between incremental utilization of rFIXFc activity versus body weight in 12 subjects who received a single dose of rFIXFc from 12.5 to 100 IU/kg.

FIG. 24. Monte Carlo simulation using the structural PK model of rFIXFc activity to construct an activity-time profile to achieve a trough concentration of 1 Ш/dL above baseline after a once-weekly (A), every 10 days (B), or every two weeks (C) dosing regimen. The median population PK parameters and relevant inter- and intra-subject variability were adopted from the Phase 1/2a clinical study. 1000 subjects per dosing regimen were simulated with 14 to 16 sampling points for each subject, and the mean ± SD of the activity-time profiles of the 1000 subjects were plotted for the different dosing regimens.

FIG. 25. Monte Carlo simulation of rFIXFc doses to achieve a trough concentration of 1 Ш/dL (1%), based on recalculated pharmacokinetic data. (A) Once weekly, (B) every 10 days, and (C) every two weeks.

DETAILED DESCRIPTION OF THE INVENTION

[0018] The present invention provides a chimeric factor IX polypeptide for use as defined in the appended claims. Also disclosed, but not part of the invention, is a method of treating factor IX deficiency, e.g., hemophilia B, with factor IX, utilizing a longer dosing interval and/or improved pharmacokinetic parameters than is possible with currently known factor IX products.

[0019] "Administering", as used herein, means administering a pharmaceutically acceptable factor IX polypeptide of the invention to a subject, via a pharmaceutically acceptable route. Preferred routes of administration are intravenous, e.g., intravenous injection and intravenous infusion, e.g., via a central venous access. Additional routes of administration include subcutaneous, intramuscular, oral, nasal, and pulmonary administration, with subcutaneous administration being preferred. Chimeric factor IX polypeptides and hybrid proteins can be administered as part of a pharmaceutical composition comprising at least one excipient. The advantages of the present invention include: improved compliance with the regimen; reduced breakthrough bleeding; increased joint protection from bleeding; prevention of joint damage; reduced morbidity; reduced mortality; prolonged protection from bleeding; reduced thrombotic events; and improved quality of life.

[0020] "Chimeric polypeptide", as used herein, means a polypeptide that includes within itself at least two polypeptides (or portions thereof, such as subsequences or peptides) from different sources. Chimeric polypeptides may include two, three, four, five, six, seven or more polypeptides or portions thereof from different sources, such as different genes, different cDNAs, or different animal or other species. Chimeric polypeptides may include one or more linkers that join different polypeptides or portions thereof. Thus, polypeptides or portions thereof may be joined directly or indirectly, via a linker, or both, within a single chimeric polypeptide. Chimeric polypeptides may include additional peptides such as signal sequences and sequences such as 6His and FLAG that aid in purification or detection of the protein. In addition, chimeric polypeptides may have amino acid or peptide additions at the N- and/or C-termini. Examples of chimeric polypeptides of the invention are chimeric factor IX-FcRn BP polypeptides, e.g., chimeric factor IX-Fc polypeptides, such as FIXFc in Figure 1, SEQ ID NO:2 (Table 2) and Examples 1-4, with or without their signal sequence and propeptide. Other examples of chimeric polypeptides of the invention include, but are not limited to, chimeric factor IX-XTEN polypeptides. Factor IX can be fused to the N-terminus or C-terminus of the XTEN polypeptide.

[0021] A chimeric polypeptide may comprise a sequence at least 90% or at least 95% or 100% identical to the amino acid sequence of factor IX and FcRn BP, e.g., the Fc amino acid sequence shown in Table 2A without the signal sequence and propeptide sequence (amino acids 1 to 642 of SEQ ID NO:2), or alternatively, with the propeptide sequence, or alternatively with the signal sequence and propeptide sequence.

[0022] "Culture", "cultivate" and "cultivation", as used herein, means the incubation of cells under in vitro conditions that allow the growth or division of cells or the maintenance of cells in a viable state. "Cultivated cells", as used herein, means cells that are propagated in vitro.

[0023] "Factor IX" and "FIX", as used herein, mean a functional polypeptide of factor IX in its normal role in coagulation, unless otherwise indicated. Thus, the term factor IX includes variant polypeptides that are functional. Full-length polypeptide and polynucleotide sequences of factor IX are known, as are many functional variants, e.g., fragments, mutants, and modified versions. Factor DC is preferably produced recombinantly ("recombinant factor IX" or "rFIX"), i.e., it is not naturally occurring or plasma-derived. The factor IX in the chimeric protein of the present invention has an amino acid sequence identical to amino acids 1 to 415 of SEQ ID NO:2.

[0024] A large number of functional variants of factor DC are known. International Publication No. WO 02/040544 A3 discloses mutants exhibiting increased resistance to heparin inhibition at page 4, lines 9-30 and page 15, lines 6-31. International Publication No. WO 03/020764 A2 discloses mutants of factor IX with reduced T cell immunogenicity in Tables 2 and 3 (at pages 14-24), and at page 12, lines 1-27.

International Publication No. WO 2007/149406 A2, discloses functional mutated factor IX molecules exhibiting increased protein stability, increased in vivo and in vitro half-life, and increased protease resistance at page 4, line 1 to page 19, line 11.

WO 2007/149406 A2 also discloses chimeric and other variant molecules of factor IX on page 19, line 12 to page 20, line 9. International Publication No. WO 08/118507 A2, discloses mutants of factor IX exhibiting increased clotting activity on page 5, line 14 to page 6, line 5. International Publication No. WO 09/051717 A2, discloses factor IX mutants having an increased number of N-linked and/or O-linked glycosylation sites, resulting in increased half-life and/or utilization at page 9, line 11 to page 20, line 2. International Publication No. WO 09/137254 A2 also discloses factor IX mutants with an increased number of glycosylation sites at page 2, paragraph [006] to page 5, paragraph [011] and page 16, paragraph [044] to page 24, paragraph [057]. International Publication No. WO 09/130198 A2 discloses functional mutant factor IX molecules having an increased number of glycosylation sites, resulting in an increased half-life, at page 4, line 26 to page 12, line 6. International Publication No. WO 09/140015 A2, discloses functional mutants of factor IX having an increased number of Cys residues, which can be used for conjugation of polymers (e.g. PEG), at page 11, paragraph [0043] to page 13, paragraph [0053],

[0025] In addition, hundreds of non-functional mutations in factor IX have been identified in patients with hemophilia, many of which are disclosed in Table 1, pages 11-14 of International Publication No. WO 09/137254 A2. Such non-functional mutations are not included in the invention, but provide additional guidance as to which mutations are more or less likely to result in a functional factor IX polypeptide.

[0026] Factor IX (or a portion of a factor IX chimeric polypeptide) has the amino acid sequence shown in Table 2A without the signal sequence and propeptide sequence (amino acids 1 to 415 of SEQ ID NO:2).

[0027] Factor IX coagulation activity is expressed in International Units (IU). One IU of factor IX activity corresponds approximately to the amount of factor IX in one milliliter of normal human plasma. Several assays are available for measuring factor IX activity, including the single-phase clotting assay (activated partial thromboplastin time; aPTT), thrombin generation time (TGA), and rotational thromboelastometry (ROTEM®). See, e.g., Example 3.

[0028] "FcRn binding partner"¹¹, or "FcRn BP", as used herein, of the chimeric factor IX polypeptide is human Fc. The FcRn binding partner can be specifically bound to the FcRn receptor, resulting in active transport of the FcRn binding partner by the FcRn receptor. The Fc region of the IgG portion that binds to the FcRn receptor has been described based on X-ray crystallography (Burmeister et al. 1994, Nature 372:379). The major contact area of the Fc with the FcRn receptor is near the junction of the CH2 and CH3 domains. The Fc-FcRn contacts are all within a single Ig heavy chain. The major contact sites include amino acid residues 248, 250-257, 272, 285, 288, 290-291, 308-311, and 314 of the CH2 domain and amino acid residues 385-387, 428, and 433-436 of the CH3 domain. References to amino acid numbering of immunoglobulins or immunoglobulin fragments, or regions, are based on Kabat et al. 1991, “Sequences of Proteins of Immunological Interest¹¹, US Department of Public Health, Bethesda; MD. (The FcRn receptor has been isolated from several mammalian species including humans. The sequences of human FcRn, rat FcRn, and mouse FcRn are known (Story et al. 1994, J. Exp. Med. 180: 2377).) .

[0029] The FcRn BP (or the FcRn BP portion of a chimeric polypeptide) may contain one or more mutations and combinations of mutations.

[0030] The FcRn BP (or FcRn BP portion of a chimeric polypeptide) may contain mutations that confer increased half-life, such as M252Y, S254T, T256E, and combinations thereof, as disclosed in Oganesyan et al., Mol. Immunol. 46:1750 (2009); H433K, N434F, and combinations thereof, as disclosed in Vaccaro et al., Nat. Biotechnol. 23:1283 (2005); the mutants disclosed on pages 1-2, paragraph [0012], and examples 9 and 10

US 2009/0264627 Al; and mutants disclosed on page 2, paragraphs [0014] to [0021] US 20090163699 Al.

[0031] The FcRn BP (or FcRn BP portion of a chimeric polypeptide) may also include the following mutations: The Fc region of IgG may be modified according to well-known procedures, such as site-directed mutagenesis and the like, to provide modified IgG or Fc fragments or portions thereof that will bind to FcRn. Such modifications include modifications distant from the FcRn contact sites, as well as modifications within the contact sites that retain or even enhance binding to FcRn. For example, the following individual amino acid residues in human IgG1 Fc (Fcγ1) can be substituted without significant loss of Fc binding affinity for FcRn: P238A, S239A, K246A, K248A, D249A, M252A, T256A, E258A, T260A, D265A, S267A, H268A, E269A, D270A, E272A, L274A, N276A, Y278A, D280A, V282A, E283A, H285A, N286A, T289A, K290A, R292A, E293A, E294A, Q295A, Y296F, N297A, S298A, Y300F, R301A, V303A, V305A, T307A, L309A, Q311A, D312A, N315A K317A, E318A, K320A, K322A, S324A, K326A, A327Q, P329A, A330Q, A330S, P331A, P331S, ЕЗЗЗА, K334A, T335A, S337A, K338A, K340A, Q342A, R344A, E345A, Q347A, R355A, E356A, M358A, T359A, K360A, N361A, Q362A, Y373A S375A D376A, A378Q, E380A, E382A, S383A, N384A, Q386A, E388A, N389A, N390A, Y391F, K392A, L398A, S400A, D401A, D413A, K414A, R416A, Q418A, Q419A, N421A, V422A, S424A, E430A, N434A, T437A, Q438A, K439A, S440A, S444A and K447A, where for example P238A represents a wild-type proline substituted with alanine at position 238. In addition to alanine, other amino acids may be substituted for the wild-type amino acids at the above positions. Mutations can be introduced individually into Fc, yielding more than a hundred FcRn binding partners that differ from native Fc. In addition, combinations of two, three, or more of these individual mutations can be introduced together, yielding hundreds more FcRn binding partners. Certain of these mutations may confer new functionality to the FcRn binding partner. For example, N297A removes a highly conserved N-glycosylation site. The effect of this mutation is to reduce immunogenicity, thereby improving the circulating half-life of the FcRn binding partner, and to render the FcRn binding partner incapable of binding to FcγRI, FcγRIIA, FcγRIIB, and FcγRIIIA, without compromising affinity for FcRn (Routledge et al. 1995, Transplantation 60:847; Friend et al. 1999, Transplantation 68:1632; Shields et al. 1995, J. Biol. Chern. 276:6591). In addition, at least three human Fc gamma receptors appear to recognize an IgG binding site within the lower hinge region, generally amino acids 234-237. Therefore, another example of novel functionality and potentially reduced immunogenicity could arise from mutations in this region, such as replacing amino acids 233-236 of human IgG1 "ELLG" with the corresponding sequence from IgG2 "PVA" (with a single amino acid deletion). It has been shown that FcγRI, FcγRII, and FcγRIII, which mediate distinct effector functions, will not bind to IgG1 when such mutations are introduced (Ward and Ghetie 1995, Therapeutic Immunology 2:77; and Armour et al. 1999, Eur. J. Immunol. 29:2613). As a further example of the novel functionality resulting from the mutations described above, the affinity for FcRn can be increased above wild-type affinity in some cases. This increased affinity may reflect an increased rate of "inclusion" of the FcRn.¹¹, reduced rate of "exclusion"¹¹ or an increased rate of "inclusion"¹¹ and a reduced rate of "exclusion"¹¹Mutations thought to confer increased affinity for FcRn include T256A, T307A, E380A, and N434A (Shields et al. 2001, J. Biol. Chem. 276:6591).

[0032] "Hybrid"¹¹ polypeptides and proteins, as used herein, mean a combination of a chimeric polypeptide with another polypeptide. The chimeric polypeptide and the other polypeptide in the hybrid may be linked to each other via non-covalent protein-protein interactions, such as charge-charge interactions or hydrophobic interactions. The chimeric polypeptide and the other polypeptide in the hybrid may be linked to each other via covalent bond(s), such as disulfide bonds. A chimeric peptide and another peptide may be linked to each other by more than one type of bond, such as non-covalent and disulfide bonds. Hybrids are described in

WO 2004/101740, WO2005/001025, U.S. Patent No. 7,404,956, U.S. Patent No. 7,348,004, and WO 2006/074199. The second polypeptide is optionally a second copy of the same chimeric polypeptide or may be a non-identical chimeric polypeptide. The second polypeptide is optionally a polypeptide comprising an FcRn BP, e.g., Fc. The chimeric polypeptide is a chimeric factor IX-Fc polypeptide, and the optional second polypeptide consists essentially of Fc. See, e.g., Figure 1, Examples 1-3, and Table 2 (SEQ ID NO:2 and 4). See, e.g., US 7404956.

[0033] The second polypeptide in the hybrid may comprise or consist essentially of a sequence at least 90% or at least 95% or 100% identical to the amino acid sequence shown in Table 2B without the signal sequence (amino acids 1 to 227 of SEQ ID NO:4), or alternatively, with the signal sequence.

[0034] The polypeptide for use of the present invention also includes factor IX fused to one or more XTEN polypeptides. Schellenburger et al., Nat. Biotech. 27:1186-90 (2009). Factor IX can be fused to the N-terminal end of the XTEN polypeptide or to the C-terminal end of the XTEN polypeptide. XTEN polypeptides include, but are not limited to, those disclosed in WO 2009/023270, WO 2010/091122, WO 2007/103515, US 2010/0189682, and US 2009/0092582.

[0035] "Dosing interval¹¹, as used herein, means the period of time that elapses between multiple doses administered to a subject. Chimeric FIX16 Dosing Interval

FcRn BP, e.g. chimeric FIX-Fc, may be at least about one and a half to eight times longer than the dosing interval required for an equivalent amount (in IU/kg) of said factor IX without the FcRn BP, e.g. Fc portion (i.e., polypeptide consisting of said FIX). The dosing interval when administered, e.g. of the chimeric factor IX-Fc polypeptide (or hybrid) of the invention, may be at least about one and a half times longer than the dosing interval required for an equivalent amount of said factor IX without the FcRn BP, e.g., Fc, portion (i.e., a polypeptide consisting of said factor IX). The dosing interval may be at least about one and a half to eight times longer than the dosing interval required for an equivalent amount of said factor IX without, e.g., an Fc portion (or a polypeptide consisting of said factor IX).

[0036] The dosing interval is 9-18 days, e.g. about 9-17, about 9-16, about 9-15, about 9-14, about 913, about 9-12, about 9-11, about 9-10 days, about 10-18, about 11-18, about 12-18, about 13-18, about 1418, about 15-18, about 16-18, about 17-18 days, about 10-11, about 11-12, about 12-13, about 13-14, about 14-15, about 15-16, and about 16-17 days, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, or about 18 days. The dosing interval can be about 10-14 days. The dosing interval may be about every two weeks or twice a month. The dosing interval may be a fixed interval, e.g., 10-13 days for 50-100 IU/kg. The fixed interval and dose are determined such that the combination of interval and dose results in a trough concentration of at least about 1-5 or at least about 1-3, or at least about 1, at least about 2, or at least about 3 Ш/dl of FIX activity in a population of subjects or in an individual subject. The fixed dosing interval may also be 10-14 days for 50-100 IU/kg. The fixed dosing interval can also be 15 days for 50-150IU/kg.

[0037] The dosing interval may, alternatively, be an individualized interval determined for each subject based on pharmacokinetic data or other information about that subject. The individualized dose/dosing interval combination may be the same as for the fixed interval summary in the preceding paragraphs, or it may vary, as illustrated in the examples. The regimen may initially be with a fixed dosing interval, and then may be changed to an individualized dosing interval.

[0038] "On-demand treatment, as used herein, means treatment that is intended to occur over a short period of time and is in response to an existing condition, such as a bleeding episode, or a perceived short-term need, such as a planned surgery." Conditions that may require on-demand treatment include bleeding episode, hemarthrosis, muscle bleeding, oral bleeding, hemorrhage, muscle hemorrhage, oral hemorrhage, trauma, head trauma, gastrointestinal hemorrhage, intracranial hemorrhage, intraabdominal hemorrhage, intrathoracic hemorrhage, bone fracture, central nervous system hemorrhage, retropharyngeal hemorrhage, retroperitoneal hemorrhage, or iliopsoas sheath hemorrhage. Bleeding episodes other than those listed are also included. The subject may require surgical prophylaxis, perioperative management, or treatment for surgery. Such operations include minor surgery, major surgery, tooth extraction, tonsillectomy, other dental/thoracofacial surgery, inguinal herniotomy, synovectomy, total knee replacement, other joint replacement, craniotomy, osteosynthesis, trauma surgery, intracranial surgery, intraabdominal surgery, intrathoracic surgery. Operations other than those listed are also included. Additional conditions that may require treatment on request include those listed in Table 26.

[0039] Additional conditions that may require on-demand treatment include minor hemorrhage, hemarthroses, superficial muscle hemorrhage, soft tissue hemorrhage, moderate hemorrhage, intramuscular hemorrhage or soft tissue hemorrhage with dissection, mucosal hemorrhage, hematuria, major hemorrhage, pharyngeal hemorrhage, retropharyngeal hemorrhage, retroperitoneal hemorrhage, central nervous system hemorrhage, bruises, cuts, abrasions, joint bleeding, nosebleeds, mouth bleeding, bleeding gums, intracranial bleeding, intraperitoneal bleeding, minor spontaneous bleeding, bleeding after major trauma, moderate bruising of the skin, or spontaneous bleeding into joints, muscles, internal organs, or the brain. Additional reasons for on-demand treatment include the need for perioperative care for surgery or dental extractions, major surgery, extensive oral surgery, urological surgery, hernia surgery, orthopedic surgery such as knee, hip, or other major joint replacement.

Abbreviations:

[0040]

AUCjnf

Area under the concentration-time curve from zero to infinity

AUC_a

Area under the concentration-time curve during the distribution phase

AUCp

Area under the concentration-time curve during the elimination phase

Alpha HL

Distribution phase half-life

Beta HL

Elimination half-life; also called t_1/2

C168

Estimated FIXFc activity above baseline at approximately 168 hours post-dose

Cmax

The maximum concentration, which occurs at T_max

CV%

Percentage coefficient of variation

Cl

Clearance

IVR in vivo utilization (%)

K-Value

Incremental usability

MRT

Average retention time

N

Number

NC

Not calculable

No.

Not reported

SD

Standard deviation

SE

Standard error

TBLP1

The model predicted time after dose when FIXFc activity decreased to approximately

Ш/dL above baseline

TBLP3

The model predicted time after dose when FIXFc activity decreased to approximately

Ш/dL above baseline

TBLP5

The model predicted time after dose when FIXFc activity decreased to approximately

Ш/dL above baseline

Vss

Volume of distribution at steady state

We

Volume of distribution of the central compartment

[0041] Pharmacokinetic (PK) parameters include the above terms and the following terms, which have their usual meaning in the art unless otherwise indicated. Some of the terms are explained in more detail in the examples. PK parameters may be based on the level of FIX antigen (often indicated in parentheses as “antigen”) or on the level of FIX activity (often indicated in parentheses as “activity”). In the literature, PK parameters are often based on the level of FIX activity because of the presence of endogenous, inactive FIX in the plasma of some patients, which hinders the ability to measure administered (i.e., exogenous) FIX using antibodies to FIX. However, when FIX is administered as part of a fusion protein containing a heterologous polypeptide such as FcRn BP, administered (i.e., exogenous) FIX antigen can be accurately measured using antibodies to the heterologous polypeptide. In addition, certain PK parameters may be based on model-predicted data (often indicated in parentheses as "model-predicted") or on observed data (often indicated in parentheses as "observed"), and it is desirable that they be based on observed data.

[0042] “Baseline,” as used herein, is the lowest measured plasma factor IX level in a subject prior to dosing. In the first human study described in Example 1, plasma factor IX levels were measured at two time points prior to dosing: at the screening visit and immediately prior to dosing. The pre-dose times were treated as zero (baseline) for calculation purposes, i.e., to generate “baseline-subtracted” data. See, e.g., Figure 4. Alternatively, (a) the baseline for patients with pre-treatment FIX activity <1%, no detectable FIX antigen, and nonsense genotypes is defined as 0%, (b) the baseline for patients with pre-treatment FIX activity <1% and detectable FIX antigen is set at 0.5%, (c) the baseline for patients with pre-treatment FIX activity between 1-2% is Cmin (the lowest activity during the PK study), and (d) the baseline value for patients whose pre-treatment FIX activity was >2% is 2%. Activity above the pre-dose baseline value is considered residual drug from the previous treatment, and is reduced to the baseline value and subtracted from the PK data after dosing with rFIXFc. See Example 11.

[0043] "The area under the plasma concentration-time curve (AUC), as used herein, is based on the rate and extent of elimination of factor IX following administration. The AUC is determined over a specified time period, such as 12, 18, 24, 36, 48, or 72 hours, or to infinity using extrapolation based on the slope of the curve. Unless otherwise specified herein, the AUC is determined to infinity (AUC_INF). AUC can also be calculated by dose. As with many other PK parameters, AUC determination can be performed on a single subject, or on a population of subjects for which an average is calculated. In Example 1, the mean AUC/dose in the patient population was 32.44 IU*h/dL per IU/kg, and the range for individual subjects was 21.80-54.30 IU*h/dL per Ш/kg. (See Table 13 for mean AUC/dose based on activity.) Therefore, the mean AUC/dose in the patient population may be about 26-40, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, or about 40 IU*h/dL per IU/kg. See Table 14 for AUC/dose and other AUC parameters based on antigen.

[0044] "In vivo utilization" (IVR) is represented by the incremental utilization (K value), which is the observed peak activity minus the pre-dose level, divided by the dose. IVR can also be calculated on a percentage basis, as described in the examples. For clarity, the units used herein (K-value or IU/dl per IU/kg versus % %). The mean IVR can be determined in a population of patients, or an individual IVR can be determined in a single subject. The FIXFc used in the first human study described in Example 1 demonstrated a mean IVR of about 0.93 Ш/dl per ПЈ/kg in the patient population; and the IVR in each subject ranged from 0.62 to 1.17 ПЈ/dl per Ш/kg (Table 13). Therefore, the chimeric polypeptide for use of the invention exhibits a mean IVR in the patient population of 0.85-1.15 (e.g. about 0.85, about 0.86, about 0.87, about 0.88, about 0.89, about 0.90, about 0.91, about 0.92, about 0.93, about 0.94, about 0.95, about 0.96, about 0.97, about 0.98, about 0.99, about 1.0, about 1.05, about 1.10, about 1.15) and an IVR in the subject of at least about 0.6, about 0.7,0.8, about 0.9, about 1.0, about 1.1, or about 1.2 Ш/dl per lU/kg.

[0045] "Clearance rate" (CL), as used herein, is a measure of the body's ability to eliminate a drug, and is expressed as the volume of plasma cleared of the drug over time. FIXFc used in the study described in Example 1 showed a mean CL of about 3.36 ml/h/kg (see Table 13), which is about 2.5 times lower than the CL (8.2 ml/h/kg) of a polypeptide consisting of factor IX (BENEFIX™); the range of CL values in individual subjects was 1.84-4.58 ml/h/kg. Therefore, the chimeric polypeptide for use of the invention exhibits a mean CL in the population of 3.0-3.72, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, or 3.72 mL/h/kg. For CL based on antigen, see Table 14.

[0046] "Mean retention time (MRT), as used herein, is a measure of the average half-life of a drug molecule in the body. FIXFc used in the study described in Example 1 showed a mean MRT of about 68.05 hours (see Table 13); the range of MRT values was 53.1-85.8 hours in individual subjects." Therefore, a chimeric polypeptide for use of the invention exhibits a mean MRT in a population of 60-78, about 60, about 62, about 64, about 66, about 68, about 70, about 72, about 74, about 76, or about 78 hours, and a MRT in a subject of at least about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, or about 90 hours. For antigen-based MRT, see Table 14.

[0047] ,,of/₂p", or "ti/2beta" or "Beta HL", as used herein, is the half-life associated with the elimination phase, tv2p=(ln2)/the elimination rate constant associated with the terminal phase. In the study described in Example 1, the FIXFc used showed a mean t_1/2z in the patient population which was about 52.5 hours (see Table 13), and the range ti/₂ β values in individual subjects were 47-60 hours. Therefore, the chimeric polypeptide for use of the invention exhibits an average ίι/₂β greater than about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54, about 55, about 56, about 57, about 58, about 59, or about 60 hours. For Τ_1/2β based on antigen, see Table 14.

[0048] "Trough concentration", as used herein, is the lowest plasma factor IX activity level reached after administration of a dose of a chimeric polypeptide for use of the invention or other factor IX molecule and before administration of the next dose, if any. Trough concentration is used herein interchangeably with "threshold". Pre-dose factor IX levels are subtracted from measured factor IX levels to calculate the trough level. In some embodiments, the nadir concentration is 1-5 or 1-3 PJ/dl after about 6, about 7, about 8, about 9, about 10, about 11, about 12 or about 13 or about 14 days. In some embodiments, the plasma level of the chimeric polypeptide reaches an average trough concentration of at least about 1 IU/dl after at least about 6 days in at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the patient population or reaches a trough concentration of at least about 1, 2, 3, 4, or 5 IU/dl after at least about 6 days in a subject. In some embodiments, the plasma level of said chimeric polypeptide reaches an average trough concentration of about 1-5 or 13 IU/dl. Such a lowest concentration or average lowest concentration may be reached after about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about

28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39 or about 40 days.

[0049] “Volume of distribution at steady state (Vss),” as used herein, is the apparent space (volume) into which a drug is distributed. Vss = amount of drug in the body divided by the plasma concentration at steady state. In Example 1, the mean Vss found in the population was about 226 mL/kg, and the range for subjects was about 145-365 mL/kg. (See Table 13.) Therefore, the mean Vss in the patient population may be 200-300, about 200, about 210, about 220, about

230, about 240, about 250, about 260, about 270, about 280, about 290, or about 300 mL/kg. Vss for individual subjects may be about 145, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, about

300, about 310, about 320, about 330, about 340, about 350, about 360, or about 370 ml/kg. For antigen-based Vss, see Table 14.

[0050] "Polypeptide", "peptide" and "protein"¹¹ are used interchangeably and refer to a polymeric compound composed of covalently linked amino acid residues.

[0051] “Polynucleotide¹¹ and "nucleic acid"¹¹ are used interchangeably and refer to a polymeric compound composed of covalently linked nucleotide residues. Polynucleotides may be DNA, cDNA, RNA, single-stranded or double-stranded, vectors, plasmids, phages, or viruses. Polynucleotides include those in Table 1, which encode the polypeptides in Table 2 (see Table 1). Polynucleotides also include fragments of polynucleotides in Table 1, e.g. those encoding fragments of the polypeptides of Table 2, such as factor IX, Fc, signal sequence, propeptide, 6His and other fragments of the polypeptides of Table 2.

[0052] „Prophylactic treatment¹¹, as used herein, means the administration of a factor IX polypeptide in multiple doses to a subject over a period of time to increase the level of factor IX activity in the subject's plasma. Preferably, the increased level is sufficient to reduce the incidence of spontaneous bleeding or to prevent bleeding in the event of an unforeseen injury. Prophylactic treatment reduces or prevents bleeding episodes, for example, those described under on-demand treatment. Prophylactic treatment can be fixed or individualized, as explained under "dosing interval"¹¹, e.g. to compensate for interpatient variability.

[0053] "Subject", as used herein, means a human. Subjects also include pediatric subjects. Pediatric subjects are from birth to 20 years of age, preferably from birth to 18 years of age, from birth to 16 years of age, from birth to 15 years of age, from birth to 12 years of age, from birth to 11 years of age, from birth to 6 years of age, from birth to 5 years of age, from birth to 2 years of age, and from 2 to 11 years of age.

[0054] The uses described herein may be administered to a subject in need of control or prevention of bleeding or bleeding episodes. Such subjects include those requiring control or prevention of bleeding in minor hemorrhage, hemarthrosis, superficial muscle hemorrhage, soft tissue hemorrhage, moderate hemorrhage, intramuscular hemorrhage or soft tissue hemorrhage with dissection, mucosal hemorrhage, hematuria, major hemorrhage, pharyngeal hemorrhage, retropharyngeal hemorrhage, retroperitoneal hemorrhage, central nervous system hemorrhage, bruises, cuts, abrasions, joint hemorrhages, nosebleeds, bleeding from the mouth, bleeding gums, intracranial bleeding, intraperitoneal bleeding, minor spontaneous hemorrhage, bleeding after major trauma, moderate bruising of the skin, or spontaneous bleeding into joints, muscles, internal organs, or the brain. Such subjects also include those requiring perioperative management, such as management of bleeding associated with surgery or dental extraction.

[0055] "Therapeutic dose", as used herein, means the dose that achieves the therapeutic goal, as described herein. The calculation of the required dose of plasma-derived factor IX (pdFIX) is based on the empirical finding that, on average, 1 µg pdFIX per kg of body weight increases plasma factor IX activity by approximately 1 µg/dL (1%). On this basis, the required dose is determined by the following formula:

Required units = body weight (kg) x desired factor IX increase (PJ/dL or % normal) x (Ш/kg per Ш/dL)

[0056] Since FIXFc, e.g. as described in the examples and in Figure 1, has an incremental utility similar to pdFIX (different from that of BENEFIX™), the required dosage is determined using the above formula, or by slight adaptation thereof. See also Table 26 for specific recommended dosages for various on-demand treatment needs. For pediatric subjects using pdFIX, the dosing guidelines are the same as for adults. However, pediatric patients may have lower incremental utilization, and the dose may therefore need to be adjusted upwards.

[0057] The therapeutic dose is 50-100, 50 and 100 IU/kg.

[0058] Additional combinations of doses and dosing intervals include: a dose of at least about 100 IU/kg and a dosing interval of at least about 9 days, a dose of at least about 100 IU/kg and a dosing interval of at least about 12 days, or a dose of 50-100 IU/kg and a dosing interval of 10-14 days.

[0059] "Variant", as used herein, refers to a polynucleotide or polypeptide that differs from the original polynucleotide or polypeptide, but retains essential properties thereof, e.g., factor IX coagulation activity or Fc (FcRn binding) activity. Generally, variants are overall close to and, in many regions, identical to the original polynucleotide or polypeptide. Variants include polypeptide and polynucleotide fragments, deletions, insertions, and modified versions of the original polypeptides.

[0060] Variant polynucleotides may comprise, or alternatively consist of, a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, the nucleotide coding sequence in SEQ ID NO:1 or 3 (Factor IX portion, Fc portion, individually or together) or its complementary chain, the nucleotide coding sequence of known mutated and recombinant factor IX or Fc as disclosed in the publications and patents cited herein or its complementary strand, the nucleotide sequence encoding the polypeptide of SEQ ID NO:2 or 4 (a portion of factor IX, an Fc portion, individually or together), and/or polynucleotide fragments of any of these nucleic acid molecules (e.g., those fragments described herein). Polynucleotides that hybridize to these nucleic acid molecules under stringent hybridization conditions or under conditions of lower stringency are also included as variants, as are polypeptides encoded by these polynucleotides as long as they are functional.

[0061] Variant polypeptides may comprise, or alternatively consist of, an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to, for example, the polypeptide sequence shown in SEQ ID NO:2 or 4 (factor IX portion, Fc portion, individually or together), and/or polypeptide fragments of any of these polypeptides (e.g., those fragments described herein).

[0062] By a nucleic acid having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence, it is meant that the nucleotide sequence of the nucleic acid is identical to the reference sequence, except that the nucleotide sequence may include up to five point mutations per 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or replaced with another nucleotide, or a number of nucleotides up to 5% of the total number of nucleotides in the reference sequence may be inserted into the reference sequence. The query sequence may be, for example, the entire sequence shown in SEQ ID NO: 1 or 3, an ORF (open reading frame), or any fragment specified as described herein.

[0063] In practice, whether any particular nucleic acid molecule or polypeptide is at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence or polypeptide of the present invention can be conventionally determined using known computer programs. The preferred method for determining the best overall match between a query sequence (reference or original sequence) and a subject sequence, also called a global sequence alignment, can be determined using the computer program FASTDB based on the algorithm of Brutlag et al. (Comp.

App. Biosci.(1990) 6:237-245). In sequence alignment, the query and target sequences are both DNA sequences. RNA sequences can be compared by converting U to T. The result of the above global sequence alignment is in percent identity. The preferred parameters used in FASIDB DNA sequence alignment to calculate percent identity are: Matrix=unique, k-tuple=4, mismatch penalty=1, join penalty=30, randomization group length=0, cutoff score=1, gap penalty=5, gap size penalty=0.05, window size=500 or the length of the nucleotide sequence in question, whichever is shorter.

[0064] If the subject sequence is shorter than the query sequence due to deletions at the 5' or 3' end, rather than internal deletions, manual correction of the results must be performed. This is because the FASTDB program does not take into account 5' and 3' truncations of the subject sequence when calculating percent identity. For subject sequences truncated at the 5' and 3' ends, relative to the query sequence, the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' to the subject sequence and that are not paired/aligned, as a percentage of the total bases of the query sequence. Whether a nucleotide is paired/aligned is determined based on the results of the FASIDB sequence alignment. This percentage is then subtracted from the percent identity calculated by the above-mentioned FASTDB program using the above-mentioned parameters to obtain the final percent identity result. This corrected result is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as shown by the FASTDB alignment, that do not match/align with the query sequence are calculated for the purposes of manually adjusting the percent identity result.

[0065] For example, 90 bases of the subject sequence are aligned to 100 bases of the query sequence to determine percent identity. Deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a match/alignment of the first 10 bases at the 5' end. The 10 mismatched bases represent 10% of the sequence (number of bases at the 5' and 3' ends that are not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity result calculated by the FASTDB program. If the remaining 90 bases were perfectly aligned, the final percent identity would be 90%. In the second example, 90 bases of the subject sequence are compared to 100 bases of the query sequence. This time the deletions are internal deletions, so there are no bases at the 5' and 3' ends of the subject sequence that do not match/align with the query sequence. In this case, the percent identity calculated by the FASTDB program has not been manually corrected. Again, only the bases 5' and 3' of the subject sequence, as shown in the FASTDB alignment, that do not match/align with the query sequence are manually corrected. No other manual corrections are made for the purposes of the present invention.

[0066] By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence, it is meant that the amino acid sequence of the subject polypeptide is identical to the query sequence, except that the amino acid sequence of the subject polypeptide may include up to five amino acid changes for every 100 amino acids of the query amino acid sequence. In other words, to obtain a polypeptide that has an amino acid sequence at least 95% identical to the amino acid sequence of interest, up to 5% of the amino acid residues in the subject sequence may be inserted, deleted (indel) or replaced with another amino acid. These changes to the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed or individually between residues in the reference sequence or in one or more adjacent groups within the reference sequence.

[0067] In practice, whether any particular polypeptide is at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, the amino acid sequences of SEQ ID NO:2 (Factor IX portion, Fc portion, individually or together) or 4, or to a known Factor IX or Fc polypeptide sequence, can be conventionally determined using known computer programs. A preferred method for determining the best overall match between a query sequence (reference or original sequence) and a subject sequence, also called a global sequence alignment, can be determined using the computer program FASTDB based on the algorithm of Brutlag et al., Comp. App. Biosci. 6:237-245(1990). In a sequence alignment, the query and subject sequences are either both nucleotide sequences or both amino acid sequences. The result of the above global sequence alignment is in percent identity. The preferred parameters used in FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, mismatch penalty=1, join penalty=20, randomization group length=0, pBreak score=1, Window size=sequence length, gap penalty=5, gap size penalty=0.05, window size=500 or the length of the amino acid sequence in question, whichever is shorter.

[0068] If the subject sequence is shorter than the query sequence due to deletions at the N- or C-terminal end, rather than internal deletions, manual correction of the results must be performed. This is because the FASTDB program does not take into account N- and C-terminal truncations of the subject sequence when calculating the global percent identity. For subject sequences truncated at the N- and C-termini, relative to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal to the subject sequence that do not match/align with the corresponding subject residue, as a percentage of the total bases of the query sequence. Whether a residue matches/aligns is determined based on the results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity calculated by the above-mentioned FASTDB program using the above-mentioned parameters to obtain the final percent identity result. This final percent identity result is used for the purposes of the present invention. Only the residues N- and C29 terminal of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manual adjustment of the percent identity result. That is, only the positions of the query residues beyond the farthest N- and C-terminal residues of the subject sequence.

[0069] For example, 90 amino acid residues of the subject sequence are aligned to 100 residues of the query sequence to determine percent identity. The deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a match/alignment of the first 10 residues at the N-terminus. 10 The unpaired residues represent 10% of the sequence (number of residues at the N and C-termini that are not paired/total number of residues in the query sequence) so that 10% is subtracted from the percent identity result calculated by the FASTDB program. If the remaining 90 residues were perfectly aligned, the final percent identity would be 90%. In another example, 90 residues of the subject sequence are compared to 100 residues of the query sequence. This time the deletions are internal deletions, so there are no residues at the N- or C-termini of the subject sequence that do not match/align with the query sequence. In this case the percent identity calculated by the FASTDB program is not manually corrected. Again, only the residue positions outside the N- and C-terminal ends of the subject sequence, as shown in the FASTDB alignment, that do not match/align with the query sequence are manually corrected. No other manual corrections are made for the purposes of the present invention.

[0070] Polynucleotide variants may contain changes in coding regions, non-coding regions, or both. Polynucleotide variants containing changes that produce silent substitutions, additions, or deletions but do not alter the properties or activities of the encoded polypeptide are particularly preferred. Nucleotide variants produced by silent substitutions due to the degeneracy of the genetic code are preferred. Furthermore, variants in which 5-10, 1-5, or 12 amino acids are substituted, deleted, or added in any combination are also desirable. Polynucleotide variants can be produced for a variety of reasons, e.g. to optimize codon expression for a particular host (changing codons in human RNA to those preferred by a bacterial host such as E. coli).

[0071] Naturally occurring variants are called "allelic variants," and refer to one of several alternative forms of a gene occupying a given locus on an organism's chromosome (Genes II, Lewin, B., ed., John Wiley &amp; Sons, New York (1985)). These allelic variants may vary at either the polynucleotide and/or polypeptide level. Alternatively, variants that do not occur naturally may be produced by mutagenesis techniques or by direct synthesis.

[0072] Using known methods of protein engineering and recombinant DNA technology, variants can be generated to improve or alter the characteristics of a polypeptide. For example, one or more amino acids can be deleted from the N-terminus or C-terminus of a secreted protein without significant loss of biological function. Authors Ron et al., J. Biol. Chern. 268: 2984-2988 (1993), reported variant KGF proteins that have heparin-binding activity even after deletion of 3, 8, or 27 amino-terminal amino acid residues. Similarly, Interferon gamma showed up to ten-fold increased activity after deletion of 8-10 amino acid residues from the carboxy-terminus of this protein. (Dobeli et al., J. Biotechnology 7:199-216 (1988).)

[0073] Furthermore, a wealth of evidence indicates that variants often retain biological activity similar to that of the native protein. For example, Gayle et al. (J. Biol. Chern. 268:2210522111 (1993)) conducted a comprehensive mutational analysis of the human cytokine IL-Ια. They used random mutagenesis to generate over 3,500 individual IL-Ια mutants that had an average of 2.5 amino acid changes per variant along the entire length of the molecule. Multiple mutations were tested at every possible amino acid position. The researchers found that "[m]ost of the molecule could be altered with little effect on [binding or biological activity]¹¹.

(See Abstract.) In fact, only 23 unique amino acid sequences, out of over 3,500 nucleotide sequences examined, produced a protein that differed significantly in activity from the wild type.

[0074] As noted above, polypeptide variants include modified polypeptides. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavins, covalent attachment of heme moiety of the molecule, covalent attachment of nucleotides or nucleotide derivatives, covalent attachment of lipids or lipid derivatives, covalent attachment of phosphotidylinositols, cross-linking, cyclization, disulfide bond formation, demethylation, covalent cross-link formation, cysteine formation, pyroglutamate formation, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, tRNA-mediated addition of amino acids to proteins such as arginylation, and ubiquitination.

[0075] The term “about” is used herein to mean approximately, roughly, approximately, or in the regions. When the term “about” is used in connection with a numerical range, it modifies that range by extending the limits above and below the stated numerical values. Generally, the term “about” is used herein to modify a numerical value above and below the stated value by a variation of 10 percent, up or down (higher or lower).

[0076] Having described the present invention in detail, it will be more clearly understood with the aid of the following examples, which are included herein for illustrative purposes only and are not intended to limit the invention.

Example 1. First human study (FiH)

[0077] The first human study was an open-label, dose-escalation, phase 1/2 study to determine the safety, tolerability, and pharmacokinetic (PK) parameters of FIXFc (recombinant human coagulation factor IX fusion protein). FIXFc is a recombinant fusion protein comprising human coagulation factor IX linked to the Fc domain of human IgG1. The fusion protein was expressed in human embryonic kidney cells (HEK 293). See Example 3.

[0078] FIXFc is being developed for the control and prevention of hemorrhagic episodes in patients with hemophilia B (congenital factor IX deficiency or Christmas disease), including the control and prevention of bleeding in surgical settings.

[0079] FIXFc is a recombinant fusion protein composed of coagulation factor IX (FIX) and the Fc domain of a human antibody (IgGl isotype). The FIXFc molecule is a heterodimeric molecule with one FIXFc chain (FIXFc-sc) and one Fc chain (Fc-sc) linked together by two disulfide bonds in the Fc hinge region. See Figure 1 and Table 2.

[0080] rFIXFc medicinal product is a clear, colorless solution intended for intravenous (IV) administration. rFIXFc is supplied as 1000 IU per 5 mL volume in a 10 mL single-use vial. The medicinal product is packaged in USP Type I glass vials with bromobutyl stoppers and unlabeled, tear-off aluminum caps. rFIXFc medicinal product contains 200 IU/mL in 10 mM sodium phosphate buffer pH 7.0 supplemented with 145 mM NaCl and 0.1% polysorbate 20. The rFIXFc solution must not be diluted.

[0081] Study Design. A total of 14 previously treated patients with severe hemophilia B were enrolled and treated with FIXFc as an intravenous (IV) infusion over approximately 10 minutes. Six dose levels were evaluated in the study: 1, 5, 12.5, 25, 50, and 100 IU/kg. One patient per dose level was enrolled at dose levels 1, 5, 12.5, and 25 IU/kg, and at least three evaluable patients per dose level were enrolled at 50 and 100 IU/kg.

[0082] After screening (scheduled within 14 days of the FIXFc dose), the treatment period for patients began. The treatment period for each dose level included a single dose of FIXFc (day 1) until the completion of the 72-hour safety observation period (3 days) for dose levels 1 and 5 IU/kg, or until the last PK sample was collected for patients at dose levels 12.5 to 100 IU/kg (approximately 10 days). Patients treated with 1, 5, 12.5, or 25 IU/kg were enrolled and treated sequentially starting at 1 IU/kg. Patients receiving 50 IU/kg were not treated on the same day, and there was at least one day between doses. After treatment of patients with 50 IU/kg, treatment of patients with 100 IU/kg was initiated.

[0083] The post-treatment period was a 30-day safety monitoring period, starting from the day the patient received the FIXFc dose, and overlapped with the treatment period because patients underwent necessary study evaluations, such as PK sampling, during this time.

[0084] Patients assigned to dose levels of 12.5 to 100 IU/kg had blood samples drawn to assess FIX activity and FIXFc concentrations. Blood samples were to be drawn immediately prior to FIXFc administration; 15 minutes after the end of the infusion; and at 1, 3, 6, 9, 24, 48, 72, 96, 120, 168, and 240 hours after the end of the infusion or until baseline FIX levels were reached. If the patient continued to have FIX levels above baseline at the 240 hour time point (study day 11), samples were collected at 288 hours (study day 13) and again at 336 hours (study day 15) if the FIX level was above baseline on study day 13.

[0085] Patient 10 received BENEFIX™ treatment for bleeding prior to the scheduled FIXFc sampling at 216 hours post-dose. Accordingly, FIXFc activity and antigen data for 216 hours and subsequent time points were excluded from the analysis. No additional discrepancies occurred that are believed to have affected the results of the interim analysis of this study.

[0086] For FIX antigen, pharmacokinetic analyses were performed on individual patient data of observed FIXFc concentration versus time after IV infusion of FIXFc. The primary analysis was performed using a model dependent methodology. FIXFc concentration data were computer fitted to a two-compartment open-label model with central compartment elimination using user-defined initial parameter estimates to calculate initial parameter values. WinNonlin estimated microscopic rate constants were generated, and the FIXFc concentration data were weighted by the function 1/(Y'^has * AND'^has). The observed data for two subjects (i.e., patients 5 and 6) were not adequately described by the two-compartment model. Accordingly, a model-independent analysis was performed on these two patients using the WinNonlin noncompartmental analysis IV-Infusion input model (linear trapezoidal rule for AUC calculation). For the noncompartmental analysis, half-life was calculated from the beta phase using data points that describe a terminal log-linear decline in the regression. A minimum of three points was used to describe the elimination phase. This occurred approximately between 4 and 14 days. For PK analysis of antigens, “mg/kg” dose equivalents were used. These values were determined based on a specific activity for FIXFc of 60.2 IU/mg. Actual sampling times, doses, and infusion durations were used for calculations. Nominal sampling times and doses were used to create concentration-time tables and figures. Individual and mean PK parameters and descriptive statistics are presented. Formal statistical analysis was not performed because the dose range and number of subjects in each cohort were too small for meaningful analysis.

[0087] For factor IX activity, the baseline subtraction method was applied to the activity versus time profile according to the baseline subtraction decision tree (Figure 4). Activity values &lt;1% were defined as 1 IU/dL for a decline from baseline.

Pre-dose times were treated as zero for calculation purposes. In addition, baseline-corrected activity data were truncated at time points that represented a return to baseline levels. Pharmacokinetic analyses were performed on baseline-corrected FIX activity versus time data obtained after IV infusion of FIXFc. Model-dependent estimation was used for analysis of dose groups by IV infusion. The baseline-corrected data were computer-fitted to a two-compartment open model with central compartment elimination using parameter limits defined in the WinNonlin program to calculate the baseline parameter values. Microscopic rate constants estimated in the WinNonlin program were generated, and the FIXFc activity data were weighted by the function l/(Y'^has * Y ^). Actual sampling times, doses, and infusion durations were used for calculations. Nominal sampling times and doses were used to create concentration-time tables and plots.

[0088] When not available from actual data, activity at 168 hours post-dose (C168) and time to 1 Ш/dL above baseline (TBLP1) of rFIXFc were obtained using microscopic rate constants generated in the WinNonlin program to simulate FIXFc activity levels versus time data. Individual™ and mean PK parameters and descriptive statistics are presented in this example. Formal statistical analysis was not performed because the dose range and number of subjects in each cohort were too small for meaningful analysis.

[0089] The pharmacokinetic results of FIXFc antigen showed that plasma FIXFc concentrations increased rapidly after a short IV infusion of FIXFc, with mean (±SD) Cmax values of 1670 (n=1), 2730 (n=1), 7510 ± 2480 and 15400 ± 3960 ng/mL for nominal dose levels of 12.5, 25, 50 and 100 IU/kg, respectively, and were achieved within the first half hour in all patients. All patients treated with FIXFc had a dose-dependent increase in systemic plasma exposure to FIXFc (as assessed by Cmax)._max i AUC_INF). Although limited to one patient suitable for evaluation at nominal doses of 12.5 and 25 IU/kg, an increase in both C and_max and AUCinf was reasonably dose proportional over the estimated dose range. (Table 3 shows individual patient data and group average FIXFc antigen concentration versus time; sorted by nominal dose, actual dose, infusion duration, and patient number. Table 4 shows individual patient data and group average FIXFc antigen PK surname data; sorted by nominal dose, actual dose, equivalent dose "mg/kg", and patient number, and see Table 11.)

[0090] Plasma concentrations of FIXFc declined in a biexponential manner following short IV infusion. The distribution (alpha) and elimination (beta) half-lives appeared to be dose-independent over the dose range evaluated, with individual patient alpha and beta half-lives ranging from 9.79 to 21.2 hours and 71.0 to 140 hours, respectively.

The mean (±SD) alpha half-lives for the nominal dose levels of 50 and 100 IU/kg were 13.1 ± 4.77 and 12.1 ± 2.33 hours, respectively. The mean (±SD) beta half-lives for the nominal dose levels of 50 and 100 IU/kg were 110 ± 26.5 and 95.8 ± 11.1 hours, respectively. In addition, primary PK parameter values for Cl, Vss, and MRT were determined, and in general, all appeared to be independent of dose over the dose range evaluated. As noted, this estimate is limited to data from a single patient at the nominal dose levels of 12.5 and 25 IU/kg. (Table 12 and Figures 2, 7, and 8.)

[0091] Furthermore, the mean Cl values were 2.28 ± 0.374 and 2.11 ± 0.464 mL/h/kg for the nominal dose levels of 50 and 100 IU/kg, respectively. The mean Vss values were 259 ± 78.5 and 238 ± 52.2 mL/kg for the nominal dose levels of 50 and 100 IU/kg, respectively. In addition, the mean MRT values were 112 ± 21.5 and 114 ± 17.1 hours for the nominal dose levels of 50 and 100 IU/kg.

[0092] The baseline-corrected pharmacokinetic results of FIXFc activity showed that FIXFc activity increased rapidly after a short IV infusion of FIXFc, with mean (±SD) Cmax values predicted by the model of 11.9 (n= 1), 19.9 (n= 1), 41.6 ± 8.97 and 98.2 ±

8.21 Ш/dL for nominal dose levels of 12.5, 25, 50 and 100 Ш/kg, respectively, and were achieved within the first half hour in all patients. (Table 5 shows individual patient data and group average baseline-corrected FIXFc activity versus time; sorted by nominal dose, actual dose, infusion duration and patient number. Table 6 shows individual patient data and group average FIXFc activity PK surname data; sorted by nominal dose, actual dose, equivalent dose "mg/kg", and patient number.)

[0093] All patients treated with FIXFc had a dose-dependent increase in FIX activity (relative to the pre-dose baseline response). Although limited to one patient eligible for evaluation at the nominal dose levels of 12.5 and 25 IU/kg, an increase in both C and_max and AUCinf were reasonably dose proportional over the estimated dose range. (Tables 6, 9, and 13 and Figures 3 and 5.)

[0094] After the end of the infusion, the decline in FIX activity corrected for baseline showed a biexponential decay; characterized by a rapid distribution phase (alpha) followed by a loglinear elimination phase (beta). During the alpha phase, the rate of decline in FIXFc activity was variable, with individual patient half-lives of alpha ranging from 0.140 to 16.6 hours. The apparent dose-dependent increase in mean alpha half-life values was obscured by data from one patient at the nominal dose levels of 12.5 and 25 IU/kg. In contrast, elimination half-life (beta) values appeared to be independent of dose over the dose range, with individual patient beta half-life values ranging from 42.1 to 67.4 hours over the dose range of 25 to 100 IU/kg. Although easily estimated and reported, the elimination half-life for patient 1 treated with 12.5 Ш/kg rFIXFc was not included in the summary evaluation because FIX levels in this patient were only detectable up to 96 hours, resulting in a shortened terminal phase and contributing to an underestimation of the terminal elimination half-life. The mean (±SD) beta half-lives for the nominal dose levels of 50 and 100 IU/kg were 52.1 ± 10.4 and 52.5 ± 10.1 hours, respectively, and 52.5 ± 9.2 (range 40-67.4) hours for the combined nominal doses of 25, 50, and 100 IU/kg (Tables 6, 8, and 13).

[0095] In addition, we obtain PK parameter values for Cl, V_b In_Ssi and MRT were determined, and in general, all appeared to be dose-independent in the estimated dose range.

[0096] Furthermore, the mean Cl values were 3.77 ± 1.12 and 2.89 ± 0.615 mL/h/kg for the nominal dose levels of 50 and 100 IU/kg, respectively, and 3.36 ± 0.928 mL/h/kg for the combined nominal doses of 25, 50, and 100 IU/kg. (Tables 6, 8, and 13.)

[0097] The mean Vss values were 264 ± 77.6 and 179 ± 31.1 mL/kg for the nominal dose levels of 50 and 100 IU/kg, respectively, and 226 ± 69.8 mL/kg for the combined nominal doses of 25, 50, and 100 IU/kg. (Tables 6, 8, and 13.) In addition, the mean MRT values were 71.7 ± 13.0 and 62.8 ± 8.82 hours for the nominal dose levels of 50 and 100 IU/kg, respectively, and 68.05 ± 11.16 hours for the combined nominal doses of 25, 50, and 100 IU/kg. (Tables 6, 8, and 13.)

[0098] In addition to the primary PK parameters, secondary PK parameters (e.g. Cl68, K-values, IVR, etc.) were determined to assess the duration of the effect of FIXFc. As expected, dose-dependent increases in Cl68, TBLP1, TBLP3, and TBLP5 were observed. In contrast, K-values and IVR values appeared to be dose-independent over the dose range evaluated. Over the full dose range, individual patient K-values predicted by the model and observed ranged from 0.61 to 1.02 and 0.62 to 1.17 Ш/dL per lU/kg, respectively. Mean K-values predicted by the model for nominal dose levels of 50 and 100 lU/kg were 0.76 and 0.90 Ш/dL per lU/kg, respectively, and 0.821 ± 0.1387 (range 0.61-1.02) lU/dL per 1 lU/kg for combined nominal doses of 25, 50, and 100 Ш/kg. The mean IVR values predicted by the model for the nominal dose levels of 50 and 100 Ш/kg were 34.5 and 35.1%, respectively. The mean observed K-values for the nominal dose levels of 50 and 100 Ш/kg were 0.86 and 1.02 lU/dL per lU/kg, respectively, and 0.926 ± 0.1787 (range 0.97-1.17) lU/dL per 1 Ш/kg for the combined nominal doses of 25, 50, and 100 Ш/kg. The mean observed IVR values for the nominal dose levels of 50 and 100 lU/kg were 39.2% and 39.8%, respectively. (Tables 6, 7, 8, and 13.) Tables 7A-7B show individual patient data and group average FIXFc activity second-order PK surname data; sorted by nominal dose, actual dose, and patient number.

[0099] Each 1 IU/kg of infused rFIXFc increased plasma FIX activity by 0.93 ± 0.18 Ш/dl on average, and this incremental efficiency (K-value) showed a weak positive correlation with body weight (R²=0.336, p=0.048) (Figure 23).

[0100] Pharmacokinetic estimates for FIXFc activity were consistent with those for rFIXFc antigen (e.g., compare Tables 13 and 14). Furthermore, there was an excellent correlation between the levels of rFIXFc activity and antigen, indicating preservation of rFIXFc in vivo activity. (Figure 9.) In addition, relative to historical data for BENEFIX™ (Wyeth), rFIXFc demonstrated (Table 8) the following:

Dose linearity of 25-100 IU/kg times greater increase in TV₂beta times greater increase in average retention time 24% improved incremental usability

2.5 times reduced clearance

[0101] FIXFc is a recombinant fusion protein composed of FIX linked to the Fc domain of human IgG1. FIXFc is designed to be a longer-acting version of FIX. Preclinical studies with FIXFc have shown an extended half-life of FIX activity compared to BENEFIX™, a commercially available recombinant factor IX product. The rationale for this study was to evaluate the safety and PK of FIXFc in patients with severe hemophilia B. For this study, 12 evaluable subjects, aged 18 to 76 years, were available for PK evaluation. Each subject received a single dose of FIXFc at a nominal dose of 12.5, 25, 50, or 100 IU/kg body weight infused intravenously over approximately 10 minutes. Plasma samples for PK evaluations of FIXFc activity and antigen concentrations were obtained before infusion and up to 14 days after dosing. PK and FIXFc antigen and activity were independently characterized in this study using model-dependent and model-independent methods.

[0102] FIXFc was well tolerated following single IV doses of 12.5, 25, 50, and 100 IU/kg body weight. There was no evidence of serious drug-related adverse events in this study. No neutralizing or binding antibodies to rFIXFc were detected in any subject.

[0103] Approximate increases in C were observed_max i AUC_INF dose proportional for both FIXFc antigen and activity after administration of doses from 12.5 to 100 Ш/kg, but V and Cl were similar at all doses. These results indicate that FIXFc antigen and activity exhibit linear PK over the dose range evaluated. The relatively small values of the V parameter may indicate that FIXFc enters the interstitial fluid but does not cross the cell membrane into intracellular fluids.

[0104] Peak plasma levels of FIXFc antigen and activity were observed within 0.5 hours after the end of the infusion and remained detectable for several days after dosing. Evidence of decreased clearance and prolonged half-life was observed for both FIXFc antigen and activity.

[0105] The mean clearance and terminal elimination half-life values associated with FIXFc antigen concentrations for the 50 and 100 IU/kg dose levels were 2.28 and 2.11 mL/h/kg and 110 and 95.8 hours, respectively. Similarly, the mean clearance and terminal elimination half-life values associated with FIXFc activity levels in the same dose range were 3.77 and 2.89 mL/h/kg and 52.1 and 52.5 hours, respectively. Comparison of the PK activity results of FIXFc observed in the current study with the reported PK activity of BENEFIX™ (Summary of Product Characteristics of BENEFIX™; Nov 18, 2009) revealed an approximately 3-fold decrease in FIXFc clearance and an approximately 3-fold increase in both FIXFc terminal elimination half-life and mean residence time relative to BENEFIX™.

[0106] With the observed improvements in PK, FIXFc will provide prolonged protection from bleeding, allowing for less frequent injections for individuals with hemophilia B. Based on the results of this study, rFIXFc can be dosed every two weeks or twice a month using doses of 100 IU/kg and at least once a week using lower doses. Such a regimen requires fewer injections. In addition, the use of rFIXFc will have other potential clinical implications such as: central venous access; improved regimen compliance; reduced breakthrough bleeding; and increased joint protection from bleeding.

Example 2. B-LONG Phase 1/2/3 Trial

[0107] This will be an open-label, multicenter evaluation of the safety, pharmacokinetics, and efficacy of recombinant, long-acting coagulation factor IX Fc fusion protein (rFIXFc) in the prevention and treatment of bleeding in previously treated subjects with severe hemophilia B. Treatment with FIX products currently on the market requires dosing 2-3 times per week. A product with an extended half-life that extends the required dosing interval to once a week or longer would be considered by the medical community as a significant improvement for the treatment of patients with severe hemophilia.

[0108] Dose levels vary considerably for rFIX products in clinical prophylaxis studies: reported doses range from 10 to 171 IU/kg (Roth et al., Blood 98:3600 (2001)) or 40 to 100 IU/kg (MASAC Recommendation 177, National Hemophilia Foundation (Oct. 2006)). Furthermore, trough concentrations of FIX activity during prophylactic treatment in subjects without clinical signs of bleeding are predicted to range between 0.2 and 3.8 IU/dL (Carlsson et al., Hemophilia 4:83 (1998)). Considering inter-individual patient variability, individualized dosing regimens based on the patient's clinical status are common practice.

[0109] Results from a phase 1/2a study (Example 1) evaluating the safety and pharmacokinetics of a single dose of a frozen liquid formulation of rFIXFc showed that the drug was well tolerated at doses ranging from 1 to 100 IU/kg, and PK characterization suggested several advantages over currently available treatments, namely a half-life and MRT that were 3-fold longer than those previously reported for BENEFIX™ (61 hours vs. 19 hours). The purpose of this study is to prospectively determine PK parameter estimates of lyophilized rFIXFc in humans, compare these with BENEFIX™ PK parameter estimates in humans, and demonstrate the efficacy of lyophilized rFIXFc in the prevention and treatment of bleeding, as well as the safety of its repeated administration in previously treated subjects with severe hemophilia B.

[0110] The study will include four arms: low-dose prophylaxis regimen (n=25), high-dose prophylaxis regimen (n=25), on-demand regimen (n=20), and major surgery regimen (n=5). The low-dose prophylaxis regimen arm will include a PK subgroup (n=16) dosed with BENEFIX™, followed by a cross-over to rFIXFc.

[0111] The primary objectives of the study are: to assess the safety and tolerability of rFIXFc across all treatment arms; to assess the efficacy of rFIXFc across all treatment arms; and to assess the efficacy of prophylaxis versus on-demand therapy (comparison of annualized number of bleeding episodes between arms 1 and 2 versus the on-demand regimen arm 3).

[0112] The secondary objectives of the study are: to compare PK parameter estimates of rFIXFc and BENEFIX™; to assess the efficacy of rFIXFc in the on-demand and surgical arms; to assess and compare PK parameter estimates of rFIXFc at baseline and week 26 (±1 week) in the PK subgroup; to assess the response of subjects to treatment in all arms; and to assess the consumption of rFIXFc in all arms.

Main inclusion criteria:

[0113]

Males 12 years of age and older and weighing at least 40 kg Diagnosed hemophilia B (baseline factor IX level less than or equal to 2%) History of at least 100 days of exposure to any factor IX product Platelet count >100,000 cells/µL

INR (international normalized ratio) &lt;1.40 as defined by the normal range of the testing laboratory

CD4 count >200 cells/µL

Main exclusion criteria:

[0114]

History of factor IX inhibitors Renal or hepatic dysfunction Diagnosed coagulation defect other than hemophilia B Previous history of anaphylaxis associated with any administration of FIX or IV immunoglobulin Taking systemic immunosuppressive medications (e.g., systemic corticosteroids; however, HAART (highly active antiretroviral therapy) is permitted)

Example 3. FIXFc production in HEK293 cells

[0115] FIXFc was produced in stably transfected HEK293 cells containing an expression cassette for FIXFc (native FIX fused directly to the Fc region) and an expression cassette for Fc itself. The cells were also transfected with an expression cassette for PC5, which is a processing enzyme that allows for complete processing of the FIX propeptide. Transfected cells were grown in serum-free suspension medium containing vitamin K, and secreted three proteins: FIXFc dimer, FIXFc monomer (one FIXFc chain and one Fc chain), and Fc dimer. FIXFc monomer (“FIXFc”) was purified by column chromatography (Protein A, Fractogel DEAE, and Q Sepharose pseudo-affinity elution with low ionic strength CaCl₂), and virally inactivated and filtered for administration to human subjects. See also Peters et al., Blood. 2010 Mar ll;115(10):2057-64 (Epub 2010 Jan 7); and U.S. Patent No. 7,566,565.

[0116] The coagulation activity of FIXFc was measured by quantifying its ability to restore the clotting activity of FIX-deficient plasma using an MLA Electra 1600C (Medical Laboratory Automation/Instrument Labs, Pleasantville, NY). The results were compared to a calibration curve generated using serial dilutions of the World Health Organization FIX standard.

[0117] Serine phosphorylation and tyrosine sulfation of factor IX are thought to be important for in vivo utilization. MONONINE™ (plasma-purified factor IX (pdFIX) manufactured by CSL Berhing) has been reported to have better in vivo utilization than BENEFIX™ (recombinant FIX (rFIX) manufactured by Wyeth) due to the higher phosphorylation/sulfation levels of MONONINE™ (>90%/>90% versus <10%/5%). However, FIXFc produced in HEK293 cells has almost zero phosphorylation/sulfation (<10%/4%, which is very similar to BENEFIX™), and shows a better IVR (1.0 Ш/dl per Ш/kg) than BENEFIX™ (0.7).

[0118] In addition, FIXFc produced as described above had significantly lower (10100-fold) levels (0.01-0.001%) of activated FIX (FIXa), a product-associated impurity, than either MONONINE™ (pdFIX) or BENEFIX™ (rFIX) (0.1%). The resulting FIXFc will have fewer adverse thrombotic events after administration than MONONINE™ or BENEFIX™.

Example 4. Pediatric studies: Extrapolation and interrelationship between development in the adult population and the pediatric population

[0119] Patient characteristics that show relationships with factor IX pharmacokinetics include age-related physiological changes (Bjorkman and Bemtorp, Clin.

Pharmacokinetics 40:815-32 (2001); and Bjorkman, Hemophilia 9(suppl 1):101-10 (2003)) and body size and composition (Shapiro, Hemophilia 11:571-82 (2005)). Therefore, weight-adjusted factor IX clearance (CL) generally decreased with age and/or body weight during growth from childhood to adulthood, with a corresponding increase in terminal half-life (t1/2). For the rFIX product (BENEFIX™), CL and steady-state volume of distribution (Vss) are increased in children and then remain constant throughout adulthood; therefore, these parameters will be carefully monitored in pediatric studies.

[0120] Peak levels of factor IX (FIX:C) procoagulant activity depend on the initial volume of distribution of FIX:C following single and/or repeated doses of FIX. The initial distribution of FIX is rapid. However, the in vivo availability (mean incremental availability) of BBENEFIX™ has been shown to be generally 30% lower than that of monoclonal antibody-purified plasma-derived coagulation factor IX (pdFIX) (Roth et al., Blood 98:3600-3606 (2001)). Furthermore, studies with pdFIX have shown that subjects aged 15 years and younger have significantly lower utilization than those who are older (White et al.,

Thromb. Haemost. 73:779-84 (1995)). Therefore, monitoring of trough and peak levels will also be conducted in pediatric studies.

[0121] Since studies have shown that children may respond differently compared to adults, baseline pharmacokinetic assessments with 50 IU/kg rFIXFc will be conducted in children with shortened pharmacokinetic sampling.

[0122] A Phase 1/2a study (SYN-FIXFc-07-001) evaluating the safety and pharmacokinetic profile of a single intravenous dose of rFIXFc in PTPs aged 18 years and older with severe hemophilia B was recently completed. Preliminary results from this initial human trial demonstrate an approximately 3-fold increase in pharmacokinetic parameters (mean terminal half-life, MRT, and AUC) of rFIXFc compared to what has been reported in the literature for BENEFIX™ (see above). Additionally, rFIXFc was well tolerated with no evidence of injection site reactions or inhibitor development. Together, these safety and pharmacokinetic results support the initiation of a Phase 1/2/3 registrational study (Study 998HB102 (B-LONG), see above) evaluating the safety, pharmacokinetics, and efficacy of rFIXFc in the prevention and treatment of bleeding in 104 PTPs (with at least 100 days of exposure to prior products) aged 12 years and older with severe hemophilia B (&lt;2%). Once sufficient safety data from the registration study are available, a pediatric program will be initiated to further investigate the safety and efficacy of rFIXFc in children. The evidence of a prolonged half-life of rFIX in humans means that less frequent injections will be needed to prevent and treat bleeding in people with hemophilia B.

Phase 2/3 pediatric PTP study in previously treated children (&lt;12 years of age)

[0123] Once data on 10 PTPs (>12 years) with complete pharmacokinetics and 50 days of exposure are available from the previous study (study 998HB 102), a pediatric phase 3 study will be initiated. This pediatric phase 2/3 study, in PTPs who had at least 50 days of exposure to FIX products prior to enrollment, will be conducted globally at approximately 25 clinical sites. Approximately 25 PTPs (to ensure 20 evaluable subjects), aged 2-11 years with severe hemophilia B (<2 Ш/dL [<2%] endogenous FIX), will be screened and selected according to pre-defined criteria. All evaluable subjects will complete the pharmacokinetic portion of the study (PK with FIX product prior to study, followed by PK with rFIXFc) and will receive weekly dosing of rFIXFc for 52 weeks. This study will record the incremental uptake, in vivo half-life, AUC, and clearance of rFIXFc. All subjects will undergo a baseline pharmacokinetic assessment with pre-study FIX and rFIXFc, and the study duration for each subject will be approximately 69 weeks, including screening and follow-up.

[0124] Each subject will receive 50 IU/kg rFIXFc at baseline for pharmacokinetic assessment, followed by repeated weekly dosing with 50-60 IU/kg rFIXFc. For patient compliance, abbreviated pharmacokinetic sampling will be performed for the pre-study product and rFIXFc as follows: pre-dose, at the end of injection, 30 ± 10 minutes, 3 ± 1 hour, 24 ± 3 hours (day 1), 72 ± 3 hours (day 3), 120 ± 3 hours (day 5), and 168 ± 3 hours (day 7) after the end of injection. To examine immunogenicity, all subjects will be treated with rFIXFc weekly for a minimum of 50 exposure days. Safety parameters will be included for immediate assessment of safety and tolerability, such as: (a) vital signs (pulse, blood pressure, respiratory rate, temperature) before rFIXFc injection and 30 minutes after injection; (b) hematological and coagulation parameters; (c) clinical chemistry; (d) frequent determination of FIX inhibitors using the Nijmegen-modified Bethesda assay (immediately before the first exposure, exposure day 4 [week 4], exposure day 12, exposure day 24, exposure day 36, and exposure day 50); and (e) adverse events.

[0125] Efficacy will be assessed by evaluating the number of bleeding episodes, bleeding intervals and number of treatments and FIX consumption per year and per event.

Pediatric Phase 2/3 PUP study in previously untreated children (0-11 years of age)

[0126] Once data from 10 previously treated children (2-11 years) with complete pharmacokinetics and 50 days of exposure are available from the previous study, a Phase 2/3 pediatric PUP study will be initiated. This study will be conducted globally at approximately 60 clinical sites. Up to 30 PUP (to ensure 20 subjects eligible for evaluation), aged 0 years and older with severe hemophilia B (&lt;2 IU/dL [&lt;2%] endogenous FIX), will be screened and selected according to pre-defined criteria.

[0127] Study participation will vary as treatment may begin with rFIXFc as a modified prophylaxis regimen. It is anticipated that patient participation in the study will be approximately four years, including screening and follow-up. During this time, it is anticipated that most patients will have reached 50 days of exposure to rFIXFc. To assess immunogenicity, all subjects will be treated with approximately 50 days of exposure to rFIXFc or up to 4 years. Safety parameters will be included for the immediate assessment of safety and tolerability: (a) frequent determination of FIX inhibitors using the Nijmegen-modified Bethesda assay; and (b) adverse events.

[0128] Efficacy will be assessed by evaluating the number of bleeding episodes, bleeding intervals and number of treatments and FIX consumption per year and per event.

Example 5. Biochemical characterization, activity and PK analysis in non-human animals

[0129] The rFIXFc produced in Example 3 was characterized for its post-translational modification, and the following results were obtained (see Table 15 and Figure 11). The propeptide of rFIXFc was properly processed during production. The gamma-carboxylation pattern of rFIXFc was similar to that of rFIX. Furthermore, the total Gla/molecule (11.2 ± 0.7) of rFIXFc was comparable to rFIX.

Since gamma-carboxylation at certain residues is essential for FIX activity, these are important results. In addition, serine 158 phosphorylation and tyrosine 155 sulfation of rFIXFc were comparable to rFIX. N-linked glycans in FIX were not fully sialylated, similar to rFIX. O-linked glycosylation of rFIXFc in the first EGF domain was the same as that of FIX, although in different relative proportions. Asp 64 of rFIXFc had a higher degree of beta-hydroxylation than rFIX or plasma-derived factor IX (pdFIX). Activated FIX was present at much lower levels in the rFIXFc preparation than in the rFIX or pdFIX preparations, as detailed in Example 3.

[0130] In addition, rFIXFc was administered to various animal species to determine its activity and PK parameters. The results are shown in Table 16 and Figures 12-16.

Example 6. Gamma-carboxylation

[0131] The objectives of this study were to analyze and characterize the γ-carboxylation of glutamic acids (Gia) in a preclinical batch of FIXFc material and commercially available FIX products, to characterize the Gia content of the enriched “peak” fraction and the high salt elution “band” fraction derived from the pseudo-affinity ion exchange chromatography step, and further separation of the enriched "peak" fraction and the "band" fraction of the high salt elution using analytical ion exchange HPLC and further characterization of the separated species.

[0132] To achieve these goals, a number of complementary analytical methods have been developed. These include amino acid analysis (AAA) using base hydrolysis to determine (total) Gia content, peptide mapping (LC/MS) using Lys-C peptides to determine Gia distribution, analytical ion exchange HPLC of intact molecules to separate isoforms, and activated partial thromboplastin time (aPTT) to determine biological activity.

[0133] Two peptides containing Gia (E) are:

• K1K2: YNSGKL⁷£⁸£FVQGNL¹⁵£R¹⁷£'CM²⁽⁾AND²¹£K o [M+H]+6 Gia = 2953.9 o [M+H]+5 Gia = 2909.9 • K3: CSF²⁶AND²⁷EAR³⁰EVF³³ENT³⁶ERTT⁴⁰EFWK o [M+H]+6 Gia = 2959.9 o [M+H]+5 Gia = 2915.9 o [M+H]+4 Gia = 2871.9

[0134] Thirty micrograms of sample (derived from the enriched peak fraction, the high salt band fraction, and each species from analytical ion exchange HPLC) were denatured, reduced, alkylated, and digested with Lys-C (1:20, E:S). The digest was stopped with 2% TFA and injected onto a Jupiter Cl8 (2.0 x 250 mm) Phenomenex column. Separation was performed on an Agilent 1100 system. The column was maintained at 25°C, and the peptides were eluted with a multi-step acetonitrile gradient. Mass spectrometry (Thermo-Fisher LCQ) was performed in the “Triple Play” mode.

[0135] Complementary methods were developed to analyze and characterize the Gia content and distribution of preclinical rFIXFc material. γ-Carboxylation of glutamic acid (Gia) content and distribution in the preclinical batch of rFIXFc (enriched peak fraction) was performed and compared to commercially available products. The analysis showed similar Gia content and distribution compared to commercially available products. The high salt elution "band" fraction was analyzed and compared to the enriched peak fraction. The analysis indicated a reduced level of γ-carboxylation.

[0136] FIXFc (enriched peak fraction) was isolated from the pseudo-affinity chromatography step of the anion exchange and further separated into 3 isoforms by analytical ion exchange HPLC. The AEX column feed and the separated species were highly γ-carboxylated. (The AEX column feed is the band fraction collected during the high salt elution step of the pseudo-affinity chromatography step of the anion exchange.) The AEX column feed and the separated species were biologically active. Gia content and distribution were similar to rFIX. Peptide map indicates distribution of 4/5/6 Glas on K3 peptide. Peptide map indicates high population of 6 Glas on K1K2 peptide and trace level of 5 Glas.

[0137] FIXFc (band top fraction) was isolated from the pseudo-affinity ion exchange chromatography step and further separated into 2 isoforms by analytical ion exchange HPLC. The AEX column loading and separated species were reduced in the level of γ-carboxylation. A reduced Gia content was observed compared to the FIXFc enriched top fraction. A reduced level of biological activity was observed. The peptide map indicates an increased population of 5 Glas in K1K2 relative to the enriched peak fraction and may suggest an impact on biological activity.

[0138] Reference: Dumont JA, et al., Monomeric Fc Fusion Molecules in Therapeutic AbsFrom Bench to Clinic, Ch. 33 p779-795; Gillis S, et al., Protein Science (1997) 6:185; White GC, et al., J. Thrombosis and Haemostasis (1997) 78:261; Hansson K, and Stenflo J, Journal Thrombosis and Haemostasis (2005) 3:2633; and Peters RT, et al., Blood (2010) 115:2057.

Example 7. Evaluation of the procoagulant activity of rFIXFc in HemB-deficient mouse bleeding models

Comparable potency of rFIXFc and BENEFIX™ was demonstrated in the ROTEM in vitro whole blood assay of HemB mice and in the HemB mouse severed tail bleeding model in vivo.

[0139] The ability of rFIXFc to form strong and stable clots was assessed by rotational thromboelastometry (ROTEM®, Pentapharm GmbH, Munich, Germany) with calcium chloride as activator (NATEM). Pooled whole blood collected via the vena cava from HemB mice was divided into seven aliquots, which were supplemented with rFIXFc to final concentrations of 7.4%, 0.74% and 0.074% of normal plasma FIX activity, or with BENEFIX™ to 10%, 1%, 0.1% of normal. As a negative control, a blood sample was supplemented with FIX formulation buffer. A total of 10 pooled blood samples from 5 HemB mice were generated to complete the evaluation. The NATEM reaction was initiated by the addition of CaCl₂. Coagulation parameters were assessed, including clotting time (CT), clot formation time (CFT) and alpha angle. The mean and SD of CT, CFT and alpha angle are summarized in Table 17. Dose response curves for the three parameters are shown in Figure 17. All three parameters were comparable between rFIXFc and BENEFIX™ in the dose range tested (p>0.05 by one-way ANOVA (Kruskal-Wallis) analysis).

[0140] The acute efficacy of rFIXFc was also evaluated in a HemB mouse tail-severe hemorrhage model. (Figure 18) HemB male mice were stratified for equal body weight and age into different treatment groups. Prior to tail-severe injury, mice were anesthetized with a cocktail of 50 mg/kg Ketamine and 0.5 mg/kg Dexmidetomidine and placed on a heating pad to maintain body temperature. The tails of the mice were then immersed in 37°C water for 10 minutes to dilate the lateral vein. After dilation of the vein, rFIXFc, BENEFIX™ or vehicle were injected through the tail vein, and 5 minutes later, the distal 4 mm of the tail was excised using a No. 11 straight-bladed surgical scalpel. The drained blood was collected in 13 ml of warm saline over 30 minutes, and blood loss was quantified gravimetrically. Six rFIXFc treatment groups (720, 360, 240, 120, 80, 40 IU/kg, n=15) and three BENEFIX™ treatment groups (360, 120, 40 IU/kg, n=15) were tested. The individual animal blood loss value and the median blood loss dose-response curve are shown in Figure 19(A), and the median blood loss volume of each treatment group is summarized in Table 18. The dose response in median blood loss volume for both rFIXFc and BENEFIX™ was comparable (p=0.9315 by unpaired t-test with Welch correction).

[0141] To determine whether the threefold increased half-life of rFIXFc relative to BENEFIX™ resulted in the prolonged efficacy of rFIXFc, the present inventors evaluated the efficacy of rFIXFc and BENEFIX™ in both the ex vivo ROTEM® assay and the tail vein transection (TVT) bleeding model in HemB mice. Figure 20.

[0142] For the ROTEM® ex vivo assay, male HemB mice received 50 lU/kg rFIXFc or 100 lU/kg BENEFIX™ by intravenous injection. Whole blood was collected from the vena cava of treated animals 5 minutes, 24, 72, 96, 120, 168, and 216 hours after dosing with rFIXFc (n=8 mice at each time point) or 5 minutes, 24, 48, 72, and 96 hours after dosing with BENEFIX™ (n=4 mice/time point). Blood samples were analyzed immediately by NATEM. The mean and SD for CT, CFT, and alpha angle are shown in Table 19, and the CT, CFT, and alpha angle versus time curves are shown in Figure 21. Compared to BENEFIX™, rFIXFc showed comparable CT, CFT, and alpha angle at 5 minutes, but significantly improved CT, CFT, and alpha angle after 72 hours despite a 2-fold lower dose compared to BENEFIX™.

[0143] To assess the prophylactic efficacy of rFIXFc and BENEFIX™, male HemB mice were stratified for equal representation of body weight and age into 9 different treatment groups. rFIXFc was administered by IV injection at doses of 4 IU/kg, 13 IU/kg, 40 IU/kg and 120 IU/kg 72 hours before tail vein transection, while the same doses of BENEFIX™ were administered 1 hour before injury. Before tail vein transection, mice were anesthetized with a cocktail of 50 mg/kg Ketamine/0.125 mg/kg Dexmidetomidine/0.1 mg/kg Buprenex. To allow mice to maintain normal activity after tail vein transection, a 1 mg/kg solution of Atipamezole was administered to reverse the effect of Dexmidetomidine, which was immediately followed by transection of the lateral tail vein with a No. 11 straight surgical blade at an area where the tail diameter is approximately 3 mm. The blood loss was flushed with warm saline to ensure clear observation of the wound, and the mouse was then individually housed in a clean cage with a white paper pad for the next 24 hours. Rebleeding and physical activity were observed and recorded hourly for up to 12 hours after injury. Moribund mice were euthanized immediately after identification, and a check-up 24 hours after injury was performed to complete the study. The Kaplan-Meier curve for time to euthanasia and the graph of survival rates 24 hours after TVT are shown in Figure 22. The log-rank test determined that all treatment groups with a dose greater than 4 IU/kg were significantly better than the vehicle group (p&lt;0.001). Furthermore, survival was comparable between mice that received the same dose of rFIXFc 72 hours before injury and those that received BENEFIX™ 24 hours before injury (p=0.4886, 0.9268, 0.7279 and 0.5209 for the 4, 13, 40 and 120 IU/kg dose groups, respectively). Survival rates at 24 hours after TVT are shown, and the ED50 value for each molecule was extrapolated from the curve; the ED50 for the two treatments were similar: 17.8 μg/kg for rFIXFc and 15.4 μg/kg for rFIX. Thus, rFIXFc provided a 3-fold longer duration of protection in HemB-challenged mice compared to a comparable dose of BENEFIX™, as measured by survival and rebleeding after tail vein transection injury. Therefore, rFIXFc provided a 3-fold longer duration of protection in HemB-challenged mice compared to a comparable dose of BENEFIX™, as measured by survival and rebleeding after tail vein transection injury.

[0144] In conclusion, the data show that while 15.4 IU/kg of BENEFIX™ resulted in 50% survival of HemB mice after tail vein transection 24 hours after dosing, 17.8 IU/kg of rFIXFc achieved 50% survival in animals injured 72 hours after dosing.

Therefore, rFIXFc demonstrates a 3-fold longer prophylactic efficacy in correlation with the prolongation of its half-life compared to BENEFIX™. The results from the bleeding model were further supported by ROTEM® ex vivo analysis of whole blood from HemB mice treated with either 100 lU/kg BENEFIX™ or 50 lU/kg rFIXFc. At 5 minutes post-dosing, comparable improvements in clot formation were observed in both treatment groups. However, major ROTEM® parameters such as clotting time, clot formation time and alpha-angle were significantly improved in mice treated with rFIXFc 72 to 216 hours after dosing despite a 2-fold lower dose of rFIXFc compared to BENEFIX™.

[0145] In summary, the acute potency of rFIXFc is comparable to that of BENEFIX™, as demonstrated in both the ROTEM® in vitro whole blood assay and the HemB mouse tail-vein bleed model. The prolonged prophylactic efficacy of rFIXFc was demonstrated in the ROTEM® ex vivo whole blood assay from HemB-treated mice and was found to be approximately 3-fold longer compared to BENEFIX™ in the HemB mouse tail-vein bleed model. The prolonged efficacy of rFIXFc correlates well with a 3-fold longer T_1/2 rFIXFc versus BENEFIX™ previously demonstrated in a pharmacokinetic study in mice with HemB. Therefore, rFIXFc is fully active for on-demand treatment, while achieving significantly prolonged prophylactic protection with the potential to reduce dosing frequency, which is being investigated in a phase 3 study.

Example 8. Pharmacokinetic and pharmacodynamic analysis of rFIXFc and BENEFIX' after a single subcutaneous dose in FIX-deficient mice

[0146] The pharmacokinetic (PK) and pharmacodynamic (PD) profiles of recombinant factor IXFc (rFIXFc) and BENEFIX™ (rFIX) were determined following a single intravenous or subcutaneous injection of 200 or 400 IU/kg in FIX-deficient mice. Whole blood was collected via the vena cava (n=4 mice/time point/treatment). Plasma concentrations of rFIXFc and BENEFIX™ were determined using an ELISA assay specific for human FIX. The activities of rFIXFc and BENEFIX™ were determined using the activated partial thromboplastin time (aPTT) assay. PK analyses were performed using a model-dependent methodology using WinNonLin. The results are shown in Tables 22 and 23.

[0147] For FIXFc, bioavailability in FIX-deficient mice was 38% for the 200 IU/kg dose and 38-46% for the combined dose (antigen ELISA assay) and 29% for the 200 IU/kg dose and 29-39% for the combined dose (aPTT activity assay) compared to rFIX, 23% and 19%, respectively. rFIXFc had 1.5-1.7-fold (200 IU/kg dose) and 1.5-2.5-fold (combined doses) improved bioavailability compared to BENEFIX™.

[0148] For rFIXFc, the terminal half-life (antigen ELISA assay) was 62 hours for the 200 IU/kg dose and 51-62 hours for the combined doses, and the terminal half-life (aPTT activity assay) was 42 hours for the 200 IU/kg dose and 40-42 hours for the combined doses, while for BENEFIX™ the terminal half-life was 24 hours (antigen ELISA assay) for the 200 IU/kg dose and 17 hours (aPTT activity assay) for the 200 IU/kg dose. This indicates a 2.5-2.6-fold (200 IU/kg dose and combined dose) improvement in half-life with rFIXFc.

[0149] Additionally, as Tables 22 and 23 show, rFIXFc had a 4.5-5.6-fold increase in AUC/dose and a 1.9-3.7-fold increase in Cmax/dose relative to BENEFIX™.

[0150] Recombinant factor IX Fc fusion (rFIXFc) protein is a long-acting form of recombinant FIX (rFIX) that will provide less frequent dosing of rFIX for the treatment of hemophilia B. From mice to non-human primates and in patients with hemophilia B, rFIXFc has an approximately 3-fold longer half-life than rFIX (BENEFIX™). For prophylactic treatment, intravenous delivery of rFIX remains a burdensome method of administration, especially in children and in patients with difficult-to-reach veins. Subcutaneous administration of rFIX represents a more attractive route of delivery that is less invasive and requires less frequent dosing. As such, subcutaneous delivery of rFIXFc will cause less pain and discomfort than intravenous delivery and will result in improved compliance due to easier administration and administration in less time than the intravenous route. Prophylaxis regimens will also improve quality of life, and clinical outcomes will include reduced bleeding frequency.

[0151] The concentration of rFIXFc in mouse plasma was measured by an ELISA specific for human FIX, which measured the FIX portion of the molecule, and the nominal mg/kg dose was used in the analysis.

A summary of PK parameters for rFIXFc and BENEFIX™ is presented in Table 20 (antigen ELISA assay) and Table 21 (aPTT activity assay) for n=4/group. Both assays, antigen assay and activity assay, showed that Cmax and AUC were significantly improved for rFIXFc compared to BENEFIX™. Using the antigen ELISA assay, the bioavailability (F%) was 38% for rFIXFc versus 23% for BENEFIX™. Similarly, using the aPTT activity assay, the bioavailability was 29% for rFIXFc versus 19% for BENEFIX™. Thus, rFIXFc showed an increase in bioavailability! compared to BENEFIX™ by 1.5 to 1.6 times. Elimination half-life measurements showed that rFIXFc significantly increased the half-life, whether measured by antigen assay (rFIXFc 62 hours vs. BENEFIX™ 24 hours) or activity assay (rFIXFc 42 hours vs. BENEFIX™ 17 hours). These data indicate that rFIXFc had an extended half-life compared to BENEFIX™ by 2.6 to 2.5 times.

[0152] rFIXFc administered subcutaneously to FIX-deficient mice exhibited a PK and PD profile with increased Cmax and AUC for rFIXFc compared to BENEFIX™. Overall, the bioavailability for rFIXFc ranged from 29% (activity) to 38% (antigen) with a half-life of 42 hours (activity) to 62 hours (antigen) compared to BENEFIX™, which had a bioavailability of 19-23% and a half-life of 17-24%, respectively. Thus, the half-life for rFIXFc delivered subcutaneously to FIX-deficient mice showed an increase of approximately 2.2 (antigen) to 3.3 (activity) fold compared to currently commercialized rFIX products administered intravenously. Overall, these data support the idea that rFIXFc delivered subcutaneously will be of clinical benefit for the prophylactic treatment of patients with hemophilia B.

Example 9. Pharmacokinetic analysis of rFIXFc after a single subcutaneous dose in macaque monkeys

[0153] The pharmacokinetic (PK) profile of recombinant factor IX-Fc (rFIXFc) was studied following a single subcutaneous dose of 50 IU/kg, 100 IU/kg, or 200 IU/kg in cynomolgus monkeys. Plasma rFIXFc concentrations were measured using a FIX-specific ELISA assay. Primary analysis was performed using a model-dependent methodology using WinNonLin. See Tables 22-25.

[0154] Pharmacokinetic analysis of plasma concentration versus time data (measured by FIX-specific ELISA) showed that bioavailability and terminal half-life were similar between doses. Bioavailability for rFIXFc was 40% (50 IU/kg), 34% (100 IU/kg), 36% (200 IU/kg), and 36-45% (combined doses). Terminal half-life for rFIXFc was 61 hours (50 IU/kg), 45 hours (100 IU/kg), 49 hours (200 IU/kg), and 44-58 hours (combined doses).

[0155] The concentration of rFIXFc in monkey plasma was measured using a FIX-specific ELISA assay that measured the FIX portion of the molecule, and the nominal mg/kg dose was used in the assay. Peak and recovery analysis demonstrated the accuracy of this FIX-specific ELISA assay for detecting rFIXFc over the range of plasma concentrations assessed. A summary of the PK parameters for rFIXFc is shown in Table 22 (50 IU/kg), Table 23 (100 IU/kg), and Table 24 (200 IU/kg) for n=3/group. For rFIXFc SC, the geometric means and CV% of the geometric means for Cmax were 860 + 22 (50 IU/kg), 1630 + 97 (100 IU/kg), and 3,750 + 26 (200 IU/kg), respectively, indicating a dose-dependent increase. Similar increases were observed for AUC.

The geometric means for bioavailability (F%) were 40 + 16 (50 IU/kg), 30 + 75 (100IU/kg), and 36 + 27 (200 IU/kg), indicating that bioavailability was similar between doses. Terminal half-life measurements showed that the half-life was similar between doses and was 58 + 39 hours (50 IU/kg), 45 + 3 hours (100 IU/kg), and 46 + 44 hours (200 IU/kg).

[0156] rFIXFc administered subcutaneously to macaques demonstrated a PK profile with dose-dependent increases in Cmax and AUC. Overall, bioavailability ranged from 30-40% with a half-life of 45-58 hours. Thus, the half-life for rFIXFc delivered subcutaneously to monkeys showed an approximately 2.8-fold increase compared to currently commercialized rFIX products administered intravenously. Overall, these data support the idea that rFIXFc delivered subcutaneously will be of clinical benefit for prophylactic treatment in patients with hemophilia B.

Example 10. Proposed prophylactic dosing regimens

[0157] Compared to the standard recommended dose regimen of 25 to 40 IU/kg of FIX two or three times per week, the PK activity results of the mean rFIXFc from the Phase 1/2a study described above suggest that dosing of rFIXFc about once a week at about 22.5 IU/kg, or about every 10 days at about 45 IU/kg, or about every 2 weeks at about 120 IU/kg is sufficient to maintain a trough concentration of 1% above baseline (Figure 24). These model-simulated estimates are supported by available data from the Phase 1/2a trial, which fit well within the 95% confidence interval of the simulated activity versus time curve. These regimens will often be used at the start of therapy. Given the heterogeneity of reported clinical breakthrough bleeding events relative to trough plasma FIX activity, maintenance doses will need to be adjusted on an individual basis.

[0158] After recalculation of the PK results from the Phase 1/2 study (see Example 11), the new proposed dosing regimen, e.g. for prophylaxis, is 20 IU/kg once weekly, 40 IU/kg every 10 days, or 100 IU/kg every two weeks (twice monthly). See also Table 27 and Figure 25.

Example 11. Recalculation of pharmacokinetic data from the first human study (FiH) (example 1)

[0159] Subjects with various hemophilia B genotypes, such as stop codon/nonsense and missense mutations, were enrolled in the FiH study discussed in Example 1. Several subjects had significantly reduced levels of endogenous FIX antigen that correlated with significantly reduced FIX activity, while several subjects with missense genotypes had more antigen than measured activity, indicating a non-functional circulating protein. Pretreatment FIX activity in 2 subjects exceeded 2 Ш/dL, likely due to incomplete washout from their last infusion of FIX concentrate based on historical testing and disease phenotype. Based on this information, the PK data from Example 1 were recalculated without subtracting baseline, as detailed below.

See table 27.

[0160] In contrast to the PK calculations (based on activity) in Example 1, if the rFIXFc PK activity is modeled without subtracting the initial value, as recently reported for the PK analysis of glycoPEGylated rFIX (Negrier et al., Blood DOI 10.1182/blood 2011 02 335596 (2011)), the resulting estimates of elimination half-life and MRT are much longer than those in Example 1, and are 82.2 ± 21.6 and 96.8 ± 22.0 hours (mean ± SD), respectively. However, knowing that not all patients with severe hemophilia B have 0% endogenous FIX activity, and taking into account the patient's genotype and endogenous FIX antigen level, the present inventors adopted a baseline subtraction analysis method in their PK modeling. Specifically, (a) the baseline value for two patients was defined as 0% because their pretreatment FIX activity was <1%, they had no detectable FIX antigen, and they had nonsense genotypes, (b) the baseline value for three patients was set at 0.5% because their pretreatment FIX activity was <1% and they had detectable FIX antigen, (c) for patients whose pretreatment FIX activity was between 1-2%, Cmin (the lowest activity during the PK study) was defined as the baseline value, and (d) for patients whose pretreatment FIX activity was >2%, 2% (which was the upper cutoff for inclusion in the study) was the baseline value. Activity above the predose baseline was considered residual drug from prior treatment, and was reduced to baseline and subtracted from the PK data after rFIXFc dosing.

[0161] The resulting mean terminal half-life (56.7 ± 10.9 hours, range 42.4-74.5 hours) and MRT (71.8 ± 10 hours, range 53.2-85.9 hours) of rFIXFc are approximately 3-fold longer than those reported for rFIX. The reported terminal half-life of rFIX is 19.3 ± 4.97 hours (range 11.136.4 hours) and MRT 26.0 ± 6.07 hours (range 15.8-46.1 hours). Roth et al., Blood 98:3600-3606 (2001); i Summary of Product Characteristics for BENEFIX™, Electronic Medicines Compendium (2010) (http://www.medicines.org.Uk/emc/medicine/20376/SPC/BENEFDC7#PHARMACODYNA MIC PROPS). Dakle, rasponi za rFIXFc se ne preklapaju sa rasponima za rFIX. Similarly, the mean CL of rFIXFc activity (3.18 ± 0.78 mL/hkg, range 2.05-4.18 mL/h/kg) is approximately 2.6-fold lower than that reported for rFIX (8.40 ± 2.01 mL/h/kg, range 4.6613.64 mL/h/kg), while the Vss of both proteins is comparable at 4-5 times the plasma volume.

[0162] Although the same trend of improvement was observed in rFIXFc antigen PK, and Τ_1/2a i TT_1/2β rFIXFc antigens were significantly longer than those derived from FIX activity measurements. T_1/2and the estimated rFIXFc antigen clearly deviates from that normally associated with FIX (2-3 hours). Furthermore, probably incomplete washout of pre-study replacement therapy before rFIXFc infusion sometimes resulted in a higher initial value, which in turn could lead to an underestimation of rFIXFc Τ_1/2β, as measured by FIX activity. A number of subjects had aPTT activity up to 3 Ш/dL, well above the limit of quantification (1 Ш/dL) for the aPTT assay, at later time points up to 336 hours (14 days) after dosing. However, these time points were excluded from the terminal half-life estimate because the values were at or only slightly above pre-treatment baseline values and were considered to have returned to baseline. In contrast, low but detectable terminal levels of rFIXFc can be unmasked by a specific and highly sensitive rFIXFc antigen ELISA assay, which detects as low as 0.1 IU/dL compared to the lower limit of aPTT of 1.0 IU/dL.

[0163] The remaining PK parameters (activity) changed by a small amount compared to the elimination half-life and MRT. See Table 27(B). A linear dose-proportional increase in FIX activity was observed, based on C_max occurring immediately after infusion and AUC_INF(Table 4). FIX activity showed a biexponential decline after rFIXFc infusion, and was characterized by a rapid distribution phase (alpha) followed by a log-linear elimination phase (beta). The mean distribution half-life (T_1/2a) was highly variable for individual subjects (mean 3.4 and 10.3 hours for the two higher dose groups) (Table 27(B)). The mean elimination half-life (Τ_1/2β) was independent of dose in the therapeutic dose range tested, i.e., 53.5 hours, 57.5 ± 8.2 hours, and 56.5 ± 14.1 hours at 25 IU/kg, 50 IU/kg, and 100 IU/kg, respectively. The time to 1% (1 IU/dL) above baseline, an estimate of rFIXFc activity, showed a dose-proportional increase. It was 7.3, 10.1 ± 1.5, and 12.3 ± 2.5 days for doses of 25, 50, and 100 IU/kg, respectively. At 168 hours (1 week) post-dose, plasma FIX activity was maintained at 1.1 Ш/dL, 2.5 ± 0.9 lU/dL, and 4.6 ± 1.7 Ш/dL above baseline for the 25, 50, and 100 Ш/kg dose groups, respectively. Also independent of dose were MRT, CL, and Vss over the 25 to 100 lU/kg dose range. Furthermore, each 1 Ш/kg of rFIXFc administered increased plasma FIX activity by an average of 0.93 ± 0.18 Ш/dL (Table 27(B)), and this incremental efficiency (K) showed a weak positive correlation with body weight (R²=0,336, p=0,048)

[0164] Long-term empirical clinical experience suggests that maintaining plasma factor activity as low as 1 to 2 IU/dL will be adequate to prevent spontaneous bleeding events in patients with severe hemophilia A and B (Nilsson et al., J. Intern. Med. 232:25-32 (1992)), and increased bleeding events are associated with the length of time below 1% of normal FVIII activity. Collins et al., Thromb Haemost 7:413-420 (2009). Therefore, PK analyses provide a means to optimize prophylactic treatment by modeling individualized doses to achieve sustained trough levels above 1% (1 Ш/dL) of baseline, reducing peak/trough variation, and improving treatment cost-effectiveness. Carlsson et al., Haemophilia 4:83-88 (1998); Kisker et al., Haemophilia 9:279-284 (2003).

[0165] To construct the concentration-time profiles after different dosing regimens, Monte Carlo simulations were performed using a population PK model of rFIXFc activity. Mean estimates of model parameters (CL, volume of distribution, intercompartmental clearance, and second compartment volume) in the tested population, inter-individual variance, and residual variability were adopted for this phase l/2a study. Wang et al., J. Clin. Pharmacol. 49:1012-1024 (2009). One thousand subjects per dosing regimen were simulated with 14 to 16 sampling points for each subject. There were 14 sampling points for weekly dosing, 15 for every 10 days dosing, and 16 for every other week dosing. Body weight (BW) was generated according to the published method, Wang et al. (2009), i.e., based on the power equation Z=BW-0.5. The median BW of the 1000 subjects was assumed to be 75 kg. Based on the simulated concentration-time profiles, the mean ± standard deviation (SD) of the drug concentration-time profiles in 1000 subjects was plotted graphically for different dosing regimens. Figure 25.

[0166] Compared to the standard recommended dose regimen of 25 to 40 IU/kg of FIX twice weekly, the results of PK activity modeling of the mean rFIXFc from this study indicate that dosing rFIXFc once weekly at 20 IU/kg, or every 10 days at 40 IU/kg, or every 2 weeks at 100 IU/kg is sufficient to maintain a trough concentration of 1% above baseline. Figure 25. These model-simulated estimates are supported by the available data from this phase l/2a study, which fit well within the 95% confidence interval of the simulated activity versus time curve. However, given the heterogeneity of reported clinical breakthrough bleeding events relative to trough plasma FIX activity levels (Bjorkman, Haemophilia 9:101-110 (2003); Ahnstrom et al., Haemophilia 10:689-697 (2004)), the maintenance dose would likely require individual adjustment.

Tables

[0167]

Table 1: Polynucleotide sequence: FIX-Fc

A. DNA sequence of FIX-Fc chain (SEQ ID NO: 1, which encodes SEQ ID NO:2 pSYN-FIX-030 nucleotide sequence (nt 1 to 7583):

FIX exon 1 (signal peptide, 1st amino acid propeptide): nt 690-777

FIX mini intron: nt 778-1076

FIX propeptide sequence: nt 1077-1126

Mature FIX sequence: nt 1127-2371

Fc: nt 2372-3052

A. DNA sequence of the FIX-Fc chain (SEQ ID NO: 1, koja kodira SEQ ID NO:2 gcgcgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatata tggagttccgcgttacataacttacggtaaatggcccgGctggctgaccgcccaacgacccccgcccattgacgt caataatgacgtatgttccGatagtaacgcGaatagggactttccattgacgtcaatgggtggagtatttaGggt aaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccct.attgacgtcaatgacggtaaat ggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtca tcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttc caagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgta acaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggc taactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagcttcgcgac gtacggccgcGaGcatgcagcgGgtgaacatgatcatggcagaatcaccaggcGtcatGaccatctgccttttag gatatc.tac.tc.agtgctgaatgtacaggtt-tgtt-t ccttttttaaaatacattgagtatgcttgccttttagata tagaaatatctgatgctgtcttcttcactaaattttgattacatgatttgacagcaatattgaagagtctaacag ccagcacgcaggttggtaagtactgtgggaacatcacagattttggctccatgccctaaagagaaattggctttc agattatttggattaaaaacaaagactttcttaagagatgtaaaattttcatgatgttttcttttttgctaaaac taaagaattatt cttttacattt cagtttttcttgatcatgaaaacgccaacaaaattctgaatcggccaaagag gtataattcaggtaaattggaagagtttgttcaagggaatctagagagagaatgtatggaagaaaagtgtagttt tgaagaagcacgagaagtttttgaaaacactgaaagaacaactgaat.tttggaagcagtatgttgatggagat.ca gtgtgagtccaatccatgtttaaatggcggcagttgcaaggatgacattaattcGtatgaatgttggtgtccctt tggatttgaaggaaagaactgtgaattagatgtaacatgtaacattaagaatggcagatgcgagcagttttgtaa aaatagtgctgataaGaaggtggtttgGtGGtgtactgagggatatcgacttgGagaaaaccagaagtcGtgtga accagcagtgcGatttccatgtggaagagtttctgtttGacaaacttctaagctcacccgtgctgagactgtttt tcctgatgtggactatgtaaattctactgaagctgaaaccattttggataacatcactcaaagcacccaatcatt taatgacttcactcgggttgttggtggagaagatgccaaaccaggtcaattcccttggcaggttgttttgaatgg taaagttgatgcattctgtggaggctctatcgttaatgaaaaatggattgtaactgctgcccactgtgttgaaac tggtgttaaaattaGagttgtcgcaggtgaacataatattgaggagacagaacatacagagcaaaagcgaaatgt gattcgaattattcctcaccacaactacaatgcagctattaataagtacaaccatgacattgcccttcgaact ggacgaacccttagtgctaaacagctacgttacacctatttgcattgctgaaggaatacacgaacatcttcct caaatttggatctggctatgtaagtggctggggaagagtcttccacaaagggagatcagctttagttcttcgta ccttagagttccacttgttgaccgagccacatgtcttcgatctacaaagttcaccatctataaacatgttctg tgctggcttccatgaaggaggtaga.gattcatgtca.agga.gata.gtggggga.ccccatgttaGtgaagtgga.agg gaccagtttcttaaGtggaattattagctggggtgaagagtgtgcaatgaaaggGaaatatggaatatataGcaa ggtgtcccggtatgtcaactggattaaggaaaaaacaaagctcactgacaaaactcacacatgcccaccgtgccc agctccggaactcctgggcggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccg gacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtgga cggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgt cctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagc ccccatcgagaaaacGatctccaaagcaaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccg ggatgagctgacGaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtgga gtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgttggactccgacggctccttctt cctctacagcaagctGacGgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatga ggctctgcacadccactacacgcagaagagcctctccctgtctccgggtaaatgdgaattcagacatgataagat acattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgcta ttgctttatttgtaaccattataagctgcaataaacaagttggggtgggcgaagaactccagcatgagatccccg cgctggaggatcatGcagGcggGgtcGcggaaaacgattccgaagcccaacctttcatagaaggcggcggtggaa tcgaaatctcgtagcacgtgtcagtcctgctcctcggccacgaagtgcacgcagttgccggccgggtcgcgcagg

A. DNA sequence of the FIX-Fc chain (SEQ ID NO: 1, koja kodira SEQ ID NO:2 gcgaactcccgcccccacggctgctcgccgatctcggtcatggccggcccggaggcgtcccggaagttcgtggac acgacctccgaccactcggcgtacagctcgtccaggccgcgcacccacacccaggccagggtgttgtccggcacc acctggtcctggaccgcgctgatgaacagggtcacgtcgtcccggaccacaccggcgaagtcgtcctccacgaag tcccgggagaacccgagccggtcggtccagaactcgaccgctccggcgacgtcgcgcgcggtgagcaccggaacg gcactggtcaacttggccatggtttagttcctcaccttgtcgtattatactatgccgatatactatgccgatgaL taattgtcaacacgtgctgatcagatccgaaaatggatatacaagctcccgggagctttttgcaaaagcctaggc ctccaaaaaagcctcctcactacttctggaatagctcagaggcagaggcggcctcggcctctgcataaataaaaa aaattagtcagccatggggcggagaatgggcggaactgggcggagttaggggcgggatgggcggagttaggggcg ggactatggttgctgactaattgagatgcatgctttgcatacttctgcctgctggggagcctggggactttccac acctggttgctgactaattgagatgGatgctttgcatacttctgcctgctggggagcctggggactttccacacc ctcgtcgagctagcttcgtgaggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaag ttggggggaggggtcggcaattgaaGcggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtg tactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttcttttt cgcaacgggtttgcGgccagaacacaggtaagtgcGgtgtgtggttGccgcgggcctggcctctttacgggttaL ggcccttgcgtgccttgaattacttccacGtggctccagtacgtgattcttgatcccgagctggagccaggggcg ggccttgcgctttaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgc gaatctggtggcaccttcgcgcctgtctogGtgctttcgataagtctGtagccatttaaaatttttgatgacctg ctgcgaGgGtttttttctggcaagatagtcttgtaaatgcgggccaggatctgcacactggtatttcggtttttg gggccgGgggcggcgacggggcccgtgcgtcccagcgcacatgttGggcgaggcggqgcctgcgagcgcggccac cgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccc cgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctc cagggggctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaggggcct ttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctgga gcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtgg agactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttggt tcattctcaagcQtcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgaacacgtggtcgcggcc gcgccgccaccatggagacagacacactcctgctatgggtactgctgctctgggttccaggttccactggtgaca aaactcacacatgcccaccgtgcccagcacctgaactcctgggaggaccgtcagtcttcctcttccccccaaaac ccaaggacaccctcatgatctcccggaccactgaggtcaccitgcgtggtggtggacgtgagccacgaagacectg aggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtaca acagcaGgtaccgtgtggtcagcgtGctcaccgtGctgcaccaggactggctgaatggGaaggagtacaagtgca aggt.&lt;it.Gc:aat:aa ag&lt;gc:c:&lt;:&lt;:c:a t.(iga gaa aat :c:a t. t:t.Gc:aa a gc&lt;:a a aggg(:ag&lt;:&lt;:c:&lt;:gaga a c:&lt;:a c: aggtgtacaccctgcccccatcccgcgatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggct tctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccg tgttggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacg tcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggta aatgactcgagagatctggccggctgggcccgtttcgaaggtaagcctatccctaaccctctcctcggtctcgat tctacgcgtaceggteatcatcaccatcaccattgagtttaaacccgctgatcagcctcgactgtgccttctage tgccagccatctgttgtttgcccctccccgtgcGttccttgaccctggaaggtgccactcccactgtccttttc tataaaatgaggaaattgcatGcattgtctgagtaggtgtcattGtattctgggggggggggggggggcaggac agcaagggggaggattgggaagacatagcaggcatgctggggatgcggtgggcttatggcttctgaggcggaa agaaccagtggcggtaatacggttatccacagaatcagggataacgcaggaaagaacatgtgagcaaaaggcca gc.aaaaggncaggaicc.gtaaaaaggccgr.gttgctggngttttttcc.ataggc.tcc.gr.r'.ccnctgangagr.atca caaaaatcgacgctcaagtcagaggtggcgaaacccgacgactataaagataccaggcgtttcccc ctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgt ggGgctttGtcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgca cgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtettgagtccaacccggtaagacacga cttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttctt gaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttacctt cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagca gcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgaagctcagtggaa cgaaaactcacgttaagggattttggtcatgacattaacctataaaaataggcgtatcacgaggccctttcgtce cgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagc ggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgc ggcatcagagcagattgtactgagagtgcaccatatatgcggtgtgaaataccgcacagatgcgtaaggagaaaa taccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggGgatcggtgcgggcctcttcgcta ttacgcca

B. Fc DNA sequence (with mouse Igk signal peptide underlined) (SEQ ID NO:3, encoding SEQ ID NO:4) This is the Fc cassette from pSYN-FIX-030. In addition, there is a separate Fc expression cassette that was transfected into the cell line in plasmid pSYN-Fc-015 that

A. The DNA sequence of the FIX-Fc chain (SEQ ID NO: 1, which encodes SEQ ID NO:2) encodes the same amino acid sequence, but contains several non-coding changes. The second copy of the Fc-coding sequence allows for a better monomer-dimer ratio.

atggagacagacacactcctgctatgggtactgctgctctgggttccaggttccactggtgacaaaactcacacat gcccaccgtgcccagcacctgaactcctgggaggaccgtcagtcttcctcttccccccaaaacccaaggacacc ctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttc aactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacg taccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctcc aacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgl acaccctgcccccatcccgcgatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatc ccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgtl ggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtctl ctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaa

Table 2: Polypeptide sequences

<td>FIX-Fc monomer hybrid: created by co-expression of FIX-Fc and Fc chains.</td><td></td>

<td>A. FIX-Fc lanac (SEQ ID NO:2):</td><td></td>

<td>(28 amino acid signal sequence underlined, 18 amino acid propeptide double underlined, Fc portion in italics.) The C-terminal lysine is not present in either subunit; this processing is often observed in recombinant proteins produced in mammalian cell culture, as well as in proteins derived from plasma.</td><td></td>

<td>FIXFC-SC SUBUNIT:</td><td></td>

<td>FIX signal peptide: -46 MQRVNMIMAE SPGLITICLL GYLLSAEC</td><td></td>

<td>FIX propeptid: -18 TVFLDHENAN KILNRPKR</td><td></td>

<td></td><td></td>

<td>FIX-Fc monomer hybrid: created by co-expression of FIX-Fc and Fc chains.</td><td></td>

<td>1 YNSGKLEEFV QGNLERECME EKCSFEEARE VFENTERTTE FWKQYVDGDQ 51 CESNPCLNGG SCKDDINSYE CWCPFGFEGK NCELDVTCNI KNGRCEQFCK 101 NSADNKWCS CTEGYRLAEN QKSCEPAVPF PCGRVSVSQT SKLTRAETVF 151 PDVDYVNSTE AETILDNITQ STQSFNDFTR WGGEDAKPG QFPWQWLNG 201 KVDAFCGGSI VNEKWIVTAA HCVETGVKIT WAGEHNIEE TEHTEQKRNV 251 IRIIPHHNYN AAINKYNHDI ALLELDEPLV LNSYVTPICI ADKEYTNIFL 301 KFGSGYVSGW GRVFHKGRSA LVLQYLRVPL VDRATCLRST KFTIYNNMFC 351 AGFHEGGRDS CQGDSGGPHV TEVEGTSFLT GIISWGEECA MKGKYGIYTK 401 VSRYVNWIKE KTKLTDKTHT CPPCPAPELL GGPSVFLFPP KPKDTLMISR 451 TPEVTCVWD VSHEDPEVKF NWYVDGVEVH NAKTKPREEQ YNSTYRWSV 501 LTVLHQDWLN GKEYKCKVSN KALPAPIEKT ISKAKGQPRE PQVYTLPPSR 551 DELTKNQVSL TCLVKGFYPS DIAVEWESNG QPENNYKTTP PVLDSDGSFF 601 LYSKLTVDKS R^QQGNVFGC SVMHEALHNH YTQKSLSLSP GK</td><td></td>

<td></td><td>B. Fc lanac (SEQ ID NO:4)</td>

<td colspan="2">20 heterologous mice Ikk signal™ light chain peptide amino acids (underlined):</td>

<td colspan="2"></td>

<td>-20 METDTLLLWV LLLWVPGSTG</td><td rowspan="2"></td>

<td></td>

<td colspan="2">Mature Fc sequence (corresponds to human IgG1 amino acids 221 to 447, EU numbering)</td>

<td colspan="2">1 DKTHTCPPCP APELLGGPSV FLFPPKPKDT LMISRTPEVT CVWDVSHED 51 PEVKFNWYVD GVEVHNAKTK PREEQYNSTY RWSVLTVLH QDWLNGKEYK 101 CKVSNKALPA PIEKTISKAK GQPREPQVYT LPPSRDELTK NQVSLTCLVK 151 GFYPSDIAVE WESNGQPENN YKTTPPVLDS DGSFFLYSKL TVDKSRWQQG 201 NVFSCSVMHE ALHNHYTQKS LSLSPGK</td>

Table 3. Individual patient data on FIXFc antigen concentration versus time;

Sorted by nominal dose, actual dose, infusion duration, and patient number

<td>Actual time (h)</td><td>Concentration (ng/mL)</td><td>Actual time (h)</td><td>Concentration (ng/mL)</td><td>Actual time (h)</td><td>Concentration (ng/mL)</td><td>Actual time (h)</td><td>Concentration (ng/mL)</td>

<td colspan="2">Patient 1</td><td colspan="2">Patient 2</td><td colspan="2">Patient 3</td><td colspan="2">Patient 4</td>

<td> -0.50</td><td> 0.0</td><td> -1.23</td><td> 0.0</td><td> -0.18</td><td> 0.0</td><td> -0.18</td><td> 0.0</td>

<td> 0.17</td><td> 2325.3</td><td> 0.17</td><td> 3352.1</td><td> 0.28</td><td> 5915.3</td><td> 0.17</td><td> 8166.5</td>

<td> 0.42</td><td> 1632.4</td><td> 0.40</td><td> 3017.3</td><td> 0.42</td><td> 6574.3</td><td> 0.42</td><td> 7362.3</td>

<td> 1.17</td><td> 1497.7</td><td> 1.15</td><td> 2280.7</td><td> 1.17</td><td> 5764.7</td><td> 1.17</td><td> 6723.4</td>

<td> 3.18</td><td> 1466.4</td><td> 3.15</td><td> 2077.5</td><td> 3.17</td><td> 4204.8</td><td> 3.17</td><td> 5291.4</td>

<td> 6.13</td><td> 1268.2</td><td> 6.15</td><td> 2054.7</td><td> 6.17</td><td> 3956.2</td><td> 6.18</td><td> 4673.1</td>

<td> 9.12</td><td> 1100.7</td><td> 9.15</td><td> 1700.4</td><td> 9.17</td><td> 3567.7</td><td> 9.17</td><td> 3954.6</td>

<td> 24.12</td><td> 805.0</td><td> 24.23</td><td> 1417.3</td><td> 24.17</td><td> 2805.6</td><td> 24.17</td><td> 3327.6</td>

<td> 48.03</td><td> 544.5</td><td> 48.40</td><td> 766.0</td><td> 48.98</td><td> 1727.7</td><td> 48.20</td><td> 2148.7</td>

<td> 72.23</td><td> 377.7</td><td> 70.73</td><td> 719.0</td><td> 72.40</td><td> 1165.8</td><td> 72.17</td><td> 1632.2</td>

<td> 96.75</td><td> 215.3</td><td> 92.57</td><td> 480.2</td><td> 96.98</td><td> 917.1</td><td> 96.17</td><td> 1234.4</td>

<td> 120.13</td><td> 192.6</td><td> 119.98</td><td> 326.3</td><td> 121.23</td><td> 673.9</td><td> 120.13</td><td> 894.0</td>

<td> 141.95</td><td> 128.6</td><td> 141.10</td><td> 241.1</td><td> 168.65</td><td> 568.2</td><td> 144.18</td><td> 645.2</td>

<td> 169.45</td><td> 112.4</td><td> 167.98</td><td> 194.6</td><td> 240.15</td><td> 265.4</td><td> 168.22</td><td> 564.1</td>

<td> 192.37</td><td> 93.6</td><td> 192.85</td><td> 160.1</td><td> 290.97</td><td> 286.4</td><td> 192.20</td><td> 509.2</td>

<td> 216.28</td><td> 76.1</td><td> 216.98</td><td> 149.0</td><td> 337.98</td><td> 238.5</td><td> 216.23</td><td> 474.5</td>

<td> 237.30</td><td> 76.4</td><td> 238.65</td><td> 125.7</td><td></td><td></td><td> 240.23</td><td> 446.1</td>

Table 3. Individual patient data on FIXFc antigen concentration versus time;

Sorted by nominal dose, actual dose, infusion duration and patient number (continued)

<td>Actual time (h)</td><td>Concentration (ng/mL)</td><td>Actual time (h)</td><td>Concentration (ng/mL)</td><td>Actual time (h)</td><td>Concentration (ng/mL)</td><td>Actual time (h)</td><td>Concentration (ng/mL)</td>

<td colspan="2">Patient 5</td><td colspan="2">Patient 6</td><td colspan="2">Patient 7</td><td colspan="2">Patient 8</td>

<td> -0.18</td><td> 0.0</td><td> -0.07</td><td> 0.0</td><td> -1.27</td><td> 0.0</td><td> -1.37</td><td> 0.0</td>

<td> 0.17</td><td> 7520.2</td><td> 0.17</td><td> 11671.7</td><td> 0.22</td><td> 7055.9</td><td> 0.25</td><td> 27413.4</td>

<td> 0.43</td><td> 7233.9</td><td> 0.42</td><td> 8654.5</td><td> 0.42</td><td> 6215.7</td><td> 0.47</td><td> 23640.8</td>

<td> 1.20</td><td> 6752.1</td><td> 1.17</td><td> 8880.4</td><td> 1.17</td><td> 5498.6</td><td> 1.35</td><td> 18505.6</td>

<td> 3.15</td><td> 5873.1</td><td> 3.17</td><td> 8509.3</td><td> 3.17</td><td> 4477.7</td><td> 3.22</td><td> 15708.1</td>

<td> 6.23</td><td> 5919.2</td><td> 6.17</td><td> 7618.7</td><td> 6.17</td><td> 4084.8</td><td> 6.17</td><td> 14915.6</td>

<td> 9.20</td><td> 5332.9</td><td> 9.17</td><td> 6584.2</td><td> 9.17</td><td> 3888.9</td><td> 9.17</td><td> 16486.4</td>

<td> 24.17</td><td> 4215.9</td><td> 48.17</td><td> 3217.7</td><td> 24.17</td><td> 2849.4</td><td> 24.72</td><td> 9937.8</td>

<td> 48.15</td><td> 2986.6</td><td> 72.17</td><td> 1651.6</td><td> 48.82</td><td> 1630.6</td><td> 48.90</td><td> 6383.5</td>

<td> 72.15</td><td> 1933.3</td><td> 96.17</td><td> 1580.1</td><td> 72.57</td><td> 1295.7</td><td> 72.38</td><td> 4190.6</td>

<td> 96.03</td><td> 1249.0</td><td> 120.17</td><td> 722.7</td><td> 96.57</td><td> 1150.7</td><td> 96.40</td><td> 3774.7</td>

<td> 120.13</td><td> 401.4</td><td> 240.17</td><td> 329.5</td><td> 121.15</td><td> 954.9</td><td> 120.30</td><td> 2514.9</td>

<td> 144.03</td><td> 482.3</td><td> 288.17</td><td> 292.7</td><td> 144.10</td><td> 780.6</td><td> 168.77</td><td> 1626.0</td>

<td> 168.17</td><td> 478.0</td><td> 336.17</td><td> 252.7</td><td> 168.82</td><td> 447.6</td><td> 240.27</td><td> 924.7</td>

<td> 192.12</td><td> 433.7</td><td></td><td></td><td> 192.77</td><td> 446.5</td><td> 288.83</td><td> 682.4</td>

<td> 216.15</td><td> 368.9</td><td></td><td></td><td> 240.57</td><td> 427.8</td><td> 337.03</td><td> 586.4</td>

<td> 240.07</td><td> 264.0</td><td></td><td></td><td></td><td></td><td></td><td></td>

Table 3. Individual patient data on FIXFc antigen concentration versus time;

Sorted by nominal dose, actual dose, infusion duration and patient number (continued)

<td>Actual time (h)</td><td>Concentration (ng/mL)</td><td>Actual time (h)</td><td>Concentration (ng/mL)</td><td>Actual time (h)</td><td>Concentration (ng/mL)</td><td>Actual time (h)</td><td>Concentration (ng/mL)</td>

<td colspan="2">Patient 9</td><td colspan="2">Patient 10</td><td colspan="2">Patient 11</td><td colspan="2">Patient 12</td>

<td> -0.82</td><td> 0.0</td><td> -0.48</td><td> 0.0</td><td> -0.15</td><td> 0.0</td><td> -1.12</td><td> 0.0</td>

<td> 0.28</td><td> 15027.1</td><td> 0.25</td><td> 16760.0</td><td> 0.23</td><td> 19641.7</td><td> 0.17</td><td> 15194.5</td>

<td> 0.63</td><td> 13374.1</td><td> 0.50</td><td> 11529.0</td><td> 0.47</td><td> 17267.2</td><td> 0.42</td><td> 12255.7</td>

<td> 1.17</td><td> 12395.6</td><td> 1.22</td><td> 10566.3</td><td> 1.22</td><td> 15902.2</td><td> 1.17</td><td> 11171.3</td>

<td> 3.20</td><td> 10808.4</td><td> 3.22</td><td> 9889.0</td><td> 3.22</td><td> 13708.9</td><td> 3.17</td><td> 9835.4</td>

<td> 6.22</td><td> 9640.2</td><td> 6.22</td><td> 8290.2</td><td> 6.25</td><td> 12469.4</td><td> 6.17</td><td> 8513.2</td>

<td> 9.15</td><td> 10505.5</td><td> 9.22</td><td> 7114.7</td><td> 9.22</td><td> 12029.8</td><td> 9.17</td><td> 8413.0</td>

<td> 23.15</td><td> 6487.3</td><td> 24.22</td><td> 5877.0</td><td> 24.22</td><td> 8083.3</td><td> 24.17</td><td> 5538.2</td>

<td> 46.62</td><td> 5324.8</td><td> 48.22</td><td> 3980.4</td><td> 47.72</td><td> 4431.0</td><td> 48.20</td><td> 3885.5</td>

<td> 70.10</td><td> 2895.5</td><td> 72.22</td><td> 2455.6</td><td> 71.88</td><td> 2162.6</td><td> 72.13</td><td> 2959.9</td>

<td> 94.15</td><td> 3208.3</td><td> 96.12</td><td> 2052.6</td><td> 191.72</td><td> 1468.7</td><td> 95.17</td><td> 2215.4</td>

<td> 118.13</td><td> 2610.6</td><td> 120.22</td><td> 1302.5</td><td> 263.72</td><td> 428.6</td><td> 119.17</td><td> 1799.7</td>

<td> 166.10</td><td> 2007.2</td><td> 144.22</td><td> 1349.3</td><td></td><td></td><td> 167.38</td><td> 1339.7</td>

<td> 238.15</td><td> 1086.2</td><td> 168.22</td><td> 1221.0</td><td></td><td></td><td> 239.50</td><td> 892.4</td>

<td> 286.15</td><td> 942.8</td><td> 192.18</td><td> 910.2</td><td></td><td></td><td> 287.25</td><td> 646.9</td>

<td> 335.57</td><td> 621.3</td><td> 216.22</td><td> 136.2</td><td></td><td></td><td></td><td></td>

Table 4. Individual and group average FIXFc Antigen PK summary data

<td>Nominal per dose (IU/kg)</td><td>Dose (IU/kg)</td><td>Equivalent per dose (mg/kg)</td><td>Patience nt</td><td>Cmax (ng/m L)</td><td>AUCinf (h*ng/mL)</td><td>CI* (mL/h/kg)</td><td>Vss* (mU/kg)</td><td>MRT *(h)</td><td>Alfa HL * (h)</td><td>Bet a HL * (h)</td>

<td rowspan="2"> 12.5</td><td> 13.714</td><td> 0.228</td><td> 1</td><td> 1670</td><td> 91300</td><td> 2.50</td><td> 245</td><td> 98.2</td><td> 21.2</td><td> 107</td>

<td></td><td>N</td><td></td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td>

<td rowspan="2"> 25</td><td> 27.250</td><td> 0.453</td><td> 2</td><td> 2730</td><td> 144000</td><td> 3.14</td><td> 273</td><td> 87.1</td><td> 11.3</td><td> 71. 0</td>

<td></td><td>N</td><td></td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td>

<td rowspan="11"> 50</td><td> 54.5</td><td> 0.905</td><td> 3</td><td> 5470</td><td> 356000</td><td> 2.54</td><td> 366</td><td> 144</td><td> 18.6</td><td> 138</td>

<td> 54.5</td><td> 0.905</td><td> 4</td><td> 6910</td><td> 389000</td><td> 2.32</td><td> 244</td><td> 105</td><td> 10.6</td><td> 85. 3</td>

<td> 54.5</td><td> 0.905</td><td> 5</td><td> 7520</td><td> 416000</td><td> 2.17</td><td> 184</td><td> 84.5</td><td>NC</td><td> 94. 3</td>

<td> 54.513</td><td> 0.906</td><td> 6</td><td> 11700</td><td> 531000</td><td> 1.71</td><td> 790</td><td> 112</td><td>NC</td><td> 140</td>

<td> 55.878</td><td> 0.928</td><td> 7</td><td> 5950</td><td> 348000</td><td> 2.67</td><td> 310</td><td> 116</td><td> 10.1</td><td> 93. 9</td>

<td colspan="3">N</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 3</td><td> 5</td>

<td colspan="3">Mean value</td><td> 7510</td><td> 408000</td><td> 2.28</td><td> 259</td><td> 112</td><td> 13.1</td><td> 110</td>

<td colspan="3">SD</td><td> 2480</td><td> 73900</td><td> 0.374</td><td> 78.5</td><td> 21.5</td><td> 4.77</td><td> 26. 5</td>

<td colspan="3">SE</td><td> 1110</td><td> 33100</td><td> 0.167</td><td> 35.1</td><td> 9.60</td><td> 2.75</td><td> 11. 8</td>

<td colspan="3">Geometric mean</td><td> 7230</td><td> 403000</td><td> 2.26</td><td> 250</td><td> 111</td><td> 12.6</td><td> 108</td>

<td colspan="3">Geometric mean CV%</td><td> 30.3</td><td> 17.1</td><td> 17.6</td><td> 30.8</td><td> 19.4</td><td> 34.9</td><td> 23. 8</td>

<td> 100</td><td> 109</td><td> 1.81</td><td> 10</td><td> 12500</td><td> 667000</td><td> 2.72</td><td> 263</td><td> 96.8</td><td> 9.79</td><td> 78.</td>

<td>Nominal dose (lU/kg)</td><td>Dose (IU/kg)</td><td>Equivalent per dose (mg/kg)</td><td>Patience nt</td><td>r '-'max (ng/m L)</td><td>AUCinf (h*ng/m L)</td><td>CI* (mL/h/kg)</td><td>Vss* (mL/k g)</td><td>MRT *(h)</td><td>Alfa HL * (h)</td><td>Bet a HL * (h)</td>

<td rowspan="11"></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0</td>

<td> 109</td><td> 1.81</td><td> 8</td><td> 21600</td><td> 1200000</td><td> 1.51</td><td> 156</td><td> 103</td><td> 15.7</td><td> 94. 3</td>

<td> 109</td><td> 1.81</td><td> 9</td><td> 13400</td><td> 998000</td><td> 1.81</td><td> 248</td><td> 137</td><td> 11.5</td><td> 107</td>

<td> 109.17 6</td><td> 1.81</td><td> 11</td><td> 17200</td><td> 844000</td><td> 2.15</td><td> 226</td><td> 105</td><td> 13.0</td><td> 97. 1</td>

<td> 109.44 1</td><td> 1.82</td><td> 12</td><td> 12500</td><td> 778000</td><td> 2.34</td><td> 295</td><td> 126</td><td> 10.6</td><td> 102</td>

<td colspan="3">N</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td>

<td colspan="3">Mean value</td><td> 15400</td><td> 897000</td><td> 2.11</td><td> 238</td><td> 114</td><td> 12.1</td><td> 95. 8</td>

<td colspan="3">SD</td><td> 3960</td><td> 206000^a</td><td> 0.464^b</td><td> 52.2^C</td><td> 17.1</td><td> 2.33</td><td> 11. 1</td>

<td colspan="3">SE</td><td> 1770</td><td> 92000</td><td> 0.208</td><td> 23.3</td><td> 7.64</td><td> 1.04</td><td> 4.9 6</td>

<td colspan="3">Geometric mean</td><td> 15100</td><td> 878000</td><td> 2.06</td><td> 232</td><td> 113</td><td> 11.9</td><td> 95. 2</td>

<td colspan="3">Geometric mean CV%</td><td> 24.5</td><td> 22.9</td><td> 22.9</td><td> 24.7</td><td> 14.8</td><td> 118. 7</td><td> 12. 2</td>

* CL, Vss, MRT, Tl/2 and Τ1/2β for the combined 12.5-100 IU/kg doses are 2.30±0.46 (1,512.72); 250±58.2 (156-366); 110±18.5 (84.5-144); 12.0±4.0 (10.1-18.6, not including two patients whose PK parameters were determined by noncompartmental analysis); and 101±20.9 (78140), respectively. Due to correction for rounding or other errors, (a) should be 207,000, and (b) should be 0.468, (c) should be 52.1.

Table 5. Individual and group average FIXFc activity and baseline-corrected FIXFc activity versus time; Sorted by nominal dose, actual dose, infusion duration, and patient number

<td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (Ш/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td>

<td colspan="3">Patient 1</td><td colspan="3">Patient 2</td><td colspan="3">Patient 3</td>

<td> -309.80</td><td> 2</td><td>NC</td><td> -310.60</td><td> 3</td><td>NC</td><td> -524.08</td><td> &lt; 1.0</td><td>NC</td>

<td> -0.50</td><td> 3</td><td> 0.0</td><td> -1.23</td><td> 2</td><td> 0.0</td><td> -0.18</td><td> 2</td><td> 0.0</td>

<td> 0.17</td><td> 16</td><td> 13.0</td><td> 0.17</td><td> 23</td><td> 21.0</td><td> 0.28</td><td> 44</td><td> 42.0</td>

<td> 0.42</td><td> 11</td><td> 8.1</td><td> 0.40</td><td> 19</td><td> 17.0</td><td> 0.42</td><td> 31</td><td> 29.0</td>

<td> 1.17</td><td> 10</td><td> 7.1</td><td> 1.15</td><td> 15</td><td> 13.0</td><td> 1.17</td><td> 27</td><td> 25.1</td>

<td> 3.18</td><td> 12</td><td> 9.4</td><td> 3.15</td><td> 13</td><td> 11.0</td><td> 3.17</td><td> 22</td><td> 20.2</td>

<td> 6.13</td><td> 9</td><td> 6.6</td><td> 6.15</td><td> 11</td><td> 9.0</td><td> 6.17</td><td> 18</td><td> 16.4</td>

<td> 9.12</td><td> 10</td><td> 7.9</td><td> 9.15</td><td> 13</td><td> 11.0</td><td> 9.17</td><td> 17</td><td> 15.6</td>

<td> 24.12</td><td> 7</td><td> 5.0</td><td> 24.23</td><td> 8</td><td> 6.0</td><td> 24.17</td><td> 12</td><td> 11.0</td>

<td> 48.03</td><td> 6</td><td> 4.0</td><td> 48.40</td><td> 6</td><td> 4.0</td><td> 48.98</td><td> 7</td><td> 6.0</td>

<td> 72.23</td><td> 4</td><td> 2.0</td><td> 70.73</td><td> 6</td><td> 4.0</td><td> 72.40</td><td> 6</td><td> 5.0</td>

<td> 96.75</td><td> 3</td><td> 1.0</td><td> 92.57</td><td> 4</td><td> 2.0</td><td> 96.98</td><td> 6</td><td> 5.0</td>

<td> 120.13</td><td> 3</td><td> 1.0</td><td> 119.98</td><td> 4</td><td> 2.0</td><td> 121.23</td><td> 5</td><td> 4.0</td>

<td> 141.95</td><td> 3</td><td> 1.0</td><td> 141.10</td><td> 4</td><td> 2.0</td><td> 168.65</td><td> 3</td><td> 2.0</td>

<td> 169.45</td><td> 2</td><td> 0.0</td><td> 167.98</td><td> 3</td><td> 1.0</td><td> 240.15</td><td> 1</td><td> 0.0</td>

<td> 192.37</td><td> 3</td><td> 1.0</td><td> 192.85</td><td> 2</td><td> 0.0</td><td> 290.97</td><td> 1</td><td> 0.0</td>

<td> 216.28</td><td> 3</td><td> 1.0</td><td> 216.98</td><td> 3</td><td> 1.0</td><td> 337.98</td><td> 1</td><td> 0.0</td>

<td> 237.30</td><td> 3</td><td> 1.0</td><td> 238.65</td><td> 3</td><td> 1.0</td><td> 675.22</td><td> 2</td><td> 1.0</td>

<td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (Ш/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td>

<td colspan="3">Patient 1</td><td colspan="3">Patient 2</td><td colspan="3">Patient 3</td>

<td> 746.22</td><td> 3</td><td> 1.0</td><td> 891.90</td><td> 2</td><td> 0.0</td><td></td><td></td><td></td>

<td colspan="9">Note: Bold data represent return to baseline and were excluded from analysis.</td>

Table 5. Individual and group average FIXFc activity and baseline-corrected FIXFc activity versus time; Sorted by nominal dose, actual dose, infusion duration, and patient number (continued)

<td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (Ш/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td>

<td colspan="2">Patient 4</td><td></td><td colspan="2">Patient 5</td><td></td><td colspan="2">Patient 6</td><td></td>

<td> -285.52</td><td> 1</td><td>NC</td><td> -104.18</td><td> &lt; 1.0</td><td>NC</td><td> -503.20</td><td> 3</td><td>NC</td>

<td> -0.18</td><td> &lt; 1.0</td><td> 0.0</td><td> -0.18</td><td> &lt; 1.0</td><td> 0.0</td><td> -0.07</td><td> 3</td><td> 0.0</td>

<td> 0.17</td><td> 59</td><td> 58.0</td><td> 0.17</td><td> 35</td><td> 34.0</td><td> 0.17</td><td> 3</td><td> 0.0</td>

<td> 0.42</td><td> 45</td><td> 44.0</td><td> 0.43</td><td> 30</td><td> 29.0</td><td> 0.42</td><td> 64</td><td> 61.0</td>

<td> 1.17</td><td> 40</td><td> 39.0</td><td> 1.20</td><td> 25</td><td> 24.0</td><td> 1.17</td><td> 57</td><td> 54.1</td>

<td> 3.17</td><td> 30</td><td> 29.0</td><td> 3.15</td><td> 21</td><td> 20.0</td><td> 3.17</td><td> 54</td><td> 51.3</td>

<td> 6.18</td><td> 26</td><td> 25.0</td><td> 6.23</td><td> 19</td><td> 18.0</td><td> 6.17</td><td> 42</td><td> 39.6</td>

<td> 9.17</td><td> 22</td><td> 21.0</td><td> 9.20</td><td>No.</td><td>No.</td><td> 9.17</td><td> 43</td><td> 40.9</td>

<td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (Ш/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td>

<td colspan="3">Patient 4</td><td colspan="3">Patient 5</td><td colspan="3">Patient 6</td>

<td> 24.17</td><td> 14</td><td> 13.0</td><td> 24.17</td><td> 13</td><td> 12.0</td><td> 24.17</td><td> 26</td><td> 24.0</td>

<td> 48.20</td><td> 9</td><td> 8.0</td><td> 48.15</td><td> 9</td><td> 8.0</td><td> 48.17</td><td> 17</td><td> 15.0</td>

<td> 72.17</td><td> 8</td><td> 7.0</td><td> 72.15</td><td> 7</td><td> 6.0</td><td> 72.17</td><td> 13</td><td> 11.0</td>

<td> 96.17</td><td> 5</td><td> 4.0</td><td> 96.03</td><td> 5</td><td> 4.0</td><td> 96.17</td><td> 10</td><td> 8.0</td>

<td> 120.13</td><td> 4</td><td> 3.0</td><td> 120.13</td><td> 4</td><td> 3.0</td><td> 120.17</td><td> 9</td><td> 7.0</td>

<td> 144.18</td><td> 4</td><td> 3.0</td><td> 144.03</td><td> 3</td><td> 2.0</td><td> 168.17</td><td> 6</td><td> 4.0</td>

<td> 168.22</td><td> 3</td><td> 2.0</td><td> 168.17</td><td> 2</td><td> 1.0</td><td> 240.17</td><td> 4</td><td> 2.0</td>

<td> 192.20</td><td> 3</td><td> 2.0</td><td> 192.12</td><td> 2</td><td> 1.0</td><td> 288.17</td><td> 3</td><td> 1.0</td>

<td> 216.23</td><td> 2</td><td> 1.0</td><td> 216.15</td><td> 2</td><td> 1.0</td><td> 336.17</td><td> 4</td><td> 2.0</td>

<td> 240.23</td><td> 2</td><td> 1.0</td><td> 240.07</td><td> 2</td><td> 1.0</td><td> 504.17</td><td> 3</td><td> 1.0</td>

<td> 720.73</td><td> &lt;1.0</td><td> 0.0</td><td> 547.07</td><td> &lt; 1.0</td><td> 0.0</td><td></td><td></td><td></td>

<td colspan="9">Note: Bold data represent return to baseline and were excluded from analysis.</td>

Table 5. Individual™ and Group Mean FIXFc Activity and Baseline-Corrected FIXFc Activity vs. Time; Sorted by Nominal Dose, Actual Dose, Infusion Duration, and Patient Number (continued)

<td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (Ш/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td>

<td colspan="3">Patient 7</td><td colspan="3">Patient 8</td><td colspan="3">Patient 9</td>

<td> -438.43</td><td> &lt; 1.0</td><td>NC</td><td> -120.42</td><td> &lt; 1.0</td><td>NC</td><td> -193.05</td><td> 8</td><td>NC</td>

<td> -1.27</td><td> 4</td><td> 0.0</td><td> -1.37</td><td> &lt; 1.0</td><td> 0.0</td><td> -0.82</td><td> 3</td><td> 0.0</td>

<td> 0.22</td><td> 46</td><td> 42.0</td><td> 0.25</td><td> 129</td><td> 128.0</td><td> 0.28</td><td> 100</td><td> 97.0</td>

<td> 0.42</td><td> 38</td><td> 34.1</td><td> 0.47</td><td> 117</td><td> 116.0</td><td> 0.63</td><td> 93</td><td> 90.1</td>

<td> 1.17</td><td> 30</td><td> 26.2</td><td> 1.35</td><td> 102</td><td> 101.0</td><td> 1.17</td><td> 94</td><td> 91.1</td>

<td> 3.17</td><td> 28</td><td> 24.5</td><td> 3.22</td><td> 98</td><td> 97.0</td><td> 3.20</td><td> 80</td><td> 77.3</td>

<td> 6.17</td><td> 24</td><td> 20.8</td><td> 6.17</td><td> 80</td><td> 79.0</td><td> 6.22</td><td> 69</td><td> 66.6</td>

<td> 9.17</td><td> 22</td><td> 19.2</td><td> 9.17</td><td> 72</td><td> 71.0</td><td> 9.15</td><td> 64</td><td> 61.9</td>

<td> 24.17</td><td> 14</td><td> 12.4</td><td> 24.72</td><td> 53</td><td> 52.0</td><td> 23.15</td><td> 47</td><td> 45.0</td>

<td> 48.82</td><td> 10</td><td> 9.0</td><td> 48.90</td><td> 30</td><td> 29.0</td><td> 46.62</td><td> 25</td><td> 23.0</td>

<td> 72.57</td><td> 6</td><td> 5.0</td><td> 72.38</td><td> 19</td><td> 18.0</td><td> 70.10</td><td> 17</td><td> 15.0</td>

<td> 96.57</td><td> 5</td><td> 4.0</td><td> 96.40</td><td> 14</td><td> 13.0</td><td> 94.15</td><td> 13</td><td> 11.0</td>

<td> 121.15</td><td> 4</td><td> 3.0</td><td> 120.30</td><td> 9</td><td> 8.0</td><td> 118.13</td><td> 9</td><td> 7.0</td>

<td> 144.10</td><td> 3</td><td> 2.0</td><td> 168.77</td><td> 6</td><td> 5.0</td><td> 166.10</td><td> 5</td><td> 3.0</td>

<td> 168.82</td><td> 2</td><td> 1.0</td><td> 240.27</td><td> 3</td><td> 2.0</td><td> 238.15</td><td> 3</td><td> 1.0</td>

<td> 192.77</td><td> 2</td><td> 1.0</td><td> 288.83</td><td> 2</td><td> 1.0</td><td> 286.15</td><td> 2</td><td> 0.0</td>

<td> 240.57</td><td> 2</td><td> 1.0</td><td> 337.03</td><td> 2</td><td> 1.0</td><td> 335.57</td><td> 2</td><td> 0.0</td>

<td> 744.57</td><td> 3</td><td> 2.0</td><td> 840.28</td><td> &lt; 1.0</td><td> 0.0</td><td> 741.77</td><td> 3</td><td> 1.0</td>

<td colspan="9">Note: Bold data represent return to baseline and were excluded from analysis.</td>

Table 5. Individual and group average FIXFc activity and baseline-corrected FIXFc activity versus time; Sorted by nominal dose, actual dose, infusion duration, and patient number (continued)

<td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (Ш/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td>

<td colspan="3">Patient 10</td><td colspan="3">Patient 11</td><td colspan="3">Patient 12</td>

<td> -334.63</td><td> 1</td><td>NC</td><td> -912.28</td><td> 2</td><td>NC</td><td> -342.58</td><td> 2</td><td>NC</td>

<td> -0.48</td><td> 2</td><td> 0.0</td><td> -0.15</td><td> 2</td><td> 0.0</td><td> -1.12</td><td> 2</td><td> 0.0</td>

<td> 0.25</td><td> 120</td><td> 118.0</td><td> 0.23</td><td> 110</td><td> 108.0</td><td> 0.17</td><td> 108</td><td> 106.0</td>

<td> 0.50</td><td> 104</td><td> 102.0</td><td> 0.47</td><td> 106</td><td> 104.0</td><td> 0.42</td><td> 90</td><td> 88.0</td>

<td> 1.22</td><td> 84</td><td> 82.1</td><td> 1.22</td><td> 96</td><td> 94.0</td><td> 1.17</td><td> 70</td><td> 68.0</td>

<td> 3.22</td><td> 75</td><td> 73.2</td><td> 3.22</td><td> 92</td><td> 90.0</td><td> 3.17</td><td> 69</td><td> 67.0</td>

<td> 6.22</td><td> 60</td><td> 58.4</td><td> 6.25</td><td> 81</td><td> 79.0</td><td> 6.17</td><td> 55</td><td> 53.0</td>

<td> 9.22</td><td> 56</td><td> 54.6</td><td> 9.22</td><td> 70</td><td> 68.0</td><td> 9.17</td><td> 55</td><td> 53.0</td>

<td> 24.22</td><td> 36</td><td> 35.0</td><td> 24.22</td><td> 53</td><td> 51.0</td><td> 24.17</td><td> 37</td><td> 35.0</td>

<td> 48.22</td><td> 21</td><td> 20.0</td><td> 47.72</td><td> 33</td><td> 31.0</td><td> 48.20</td><td> 25</td><td> 23.0</td>

<td> 72.22</td><td> 14</td><td> 13.0</td><td> 71.88</td><td> 25</td><td> 23.0</td><td> 72.13</td><td> 14</td><td> 12.0</td>

<td> 96.12</td><td> 11</td><td> 10.0</td><td> 167.72</td><td> 8</td><td> 6.0</td><td> 95.17</td><td> 10</td><td> 8.0</td>

<td> 120.22</td><td> 7</td><td> 6.0</td><td> 191.72</td><td> 8</td><td> 6.0</td><td> 119.17</td><td> 7</td><td> 5.0</td>

<td> 144.22</td><td> 6</td><td> 5.0</td><td> 263.72</td><td> 4</td><td> 2.0</td><td> 167.38</td><td> 6</td><td> 4.0</td>

<td> 168.22</td><td> 6</td><td> 5.0</td><td> 359.72</td><td> 3</td><td> 1.0</td><td> 239.50</td><td> 3</td><td> 1.0</td>

<td> 192.18</td><td> 4</td><td> 3.0</td><td> 383.97</td><td> 3</td><td> 1.0</td><td> 287.25</td><td> 2</td><td> 0.0</td>

<td> 216.22</td><td> 85</td><td> 84.0</td><td> 890.97</td><td> 14</td><td> 12.0</td><td> 526.42</td><td> 4</td><td> 2.0</td>

<td> 744.95</td><td> 2</td><td> 1.0</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (Ш/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td><td>Actual time (h)</td><td>Result (lU/dL)</td><td>Result corrected for baseline value (lU/dL)</td>

<td colspan="3">Patient 10</td><td colspan="3">Patient 11</td><td colspan="3">Patient 12</td>

<td colspan="9">Note: Bold data represent return to baseline and were excluded from analysis.</td>

Table 6. Individual and group average FIXFc activity pharmacokinetic summaries data;

Sorted by nominal dose, actual dose and patient number

<td>Nominal alna dose (lU/kg)</td><td>Dose (IU/kg)</td><td>Pacij ent</td><td>c ⁱⁿ'inax (THE/ dL)</td><td>AUCuy F (h*IU/ dL)</td><td>AU c_a(%)</td><td>AU Q (%)</td><td>AUC/d weight (IU*h/ dL per lU/kg)</td><td>Cl (mL/h/ kg)</td><td>We (mL/kg)</td><td>Vss (mL/ kg)</td><td>M RT (h)</td><td>Alf a HL (h)</td><td>Bet a HL (h)</td>

<td rowspan="2"> 12.5</td><td> 13.71 4</td><td> 1</td><td> 11.9</td><td> 418</td><td> 0.23 1</td><td> 99.8</td><td> 30.5</td><td> 3.28</td><td> 102</td><td> 157</td><td> 48. 0</td><td> 0.1 40</td><td> 33. 3</td>

<td colspan="2">N</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td>

<td rowspan="2"> 25</td><td> 27.25</td><td> 2</td><td> 19.9</td><td> 753</td><td> 2.50</td><td> 97.8</td><td> 27.6</td><td> 3.62</td><td> 134</td><td> 275</td><td> 76. 0</td><td> 1.2 0</td><td> 54. 0</td>

<td colspan="2">N</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td>

<td rowspan="4"> 50</td><td> 54.5</td><td> 3</td><td> 34.5</td><td> 1280</td><td> 5.7</td><td> 94.5</td><td> 23.5</td><td> 4.26</td><td> 155</td><td> 365</td><td> 85. 8</td><td> 2.3 2</td><td> 62. 9</td>

<td> 54.5</td><td> 4</td><td> 48.5</td><td> 1450</td><td> 12.4</td><td> 87.7</td><td> 26.6</td><td> 3.76</td><td> 111</td><td> 282</td><td> 75. 1</td><td> 3.6 4</td><td> 58. 9</td>

<td> 54.5</td><td> 5</td><td> 33.0</td><td> 1190</td><td> 1.5</td><td> 98.3</td><td> 21.8</td><td> 4.58</td><td> 160</td><td> 274</td><td> 59. 9</td><td> 0.8 40</td><td> 42. 1</td>

<td> 54.51</td><td> 6</td><td> 53.5</td><td> 2960</td><td> 1.0</td><td> 99.1</td><td> 54.3</td><td> 1.84</td><td> 100</td><td> 149</td><td> 81.</td><td> 1.0</td><td> 56.</td>

<td>Nomin alna doza (IU/kg)</td><td>Dose (IU/kg)</td><td>Pacij ent</td><td>c ’-max (IU/ dL)</td><td>AUCjn F (h*IU/ dL)</td><td>AU c_a(%)</td><td>AU Q (%)</td><td>AUC/d weight (IU*h/ dL per IU/kg)</td><td>Cl (mL/h/ kg)</td><td>We (mL/kg)</td><td>Vss (mL/ kg)</td><td>M RT (h)</td><td>Alf a HL (h)</td><td>Bet a HL (h)</td>

<td rowspan="8"></td><td> 3</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 1</td><td> 7</td><td> 7</td>

<td> 55.87 8</td><td> 7</td><td> 38.6</td><td> 1270</td><td> 2.2</td><td> 97.9</td><td> 22.7</td><td> 4.41</td><td> 141</td><td> 248</td><td> 56. 4</td><td> 1.0 7</td><td> 40. 0</td>

<td colspan="2">N</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td>

<td colspan="2">Mean value</td><td> 41.6</td><td> 1630</td><td> 4.56</td><td> 95.5</td><td> 29.8</td><td> 3.77</td><td> 133</td><td> 264</td><td> 71. 7</td><td> 1.7 9</td><td> 52. 1</td>

<td colspan="2">SD</td><td> 8.97^a</td><td> 750</td><td> 4.75</td><td> 4.70</td><td> 13.8</td><td> 1.12</td><td> 26.7</td><td> 77.6</td><td> 13. 0</td><td> 1.1 9</td><td> 10. 4</td>

<td colspan="2">SE</td><td> 4.01</td><td> 335</td><td> 2.13</td><td> 2.10</td><td> 6.18</td><td> 0.501</td><td> 11.9</td><td> 34.7</td><td> 5.7 9</td><td> 0.5 31</td><td> 4.6 5</td>

<td colspan="2">Geometric mean</td><td> 40.9</td><td> 1530</td><td> 2.98</td><td> 95.4</td><td> 27.9</td><td> 3.59</td><td> 131</td><td> 254</td><td> 70. 7</td><td> 1.5 2</td><td> 51. 3</td>

<td colspan="2">Geometric mean CV%</td><td> 21.4</td><td> 39.1</td><td> 136. 5</td><td> 5.0</td><td> 39.4</td><td> 39.4</td><td> 21.1</td><td> 33.8</td><td> 18. 8</td><td> 68. 6</td><td> 21. 0</td>

<td rowspan="5"> 100</td><td> 109</td><td> 10</td><td> 98.9</td><td> 3330</td><td> 18.5</td><td> 81.3</td><td> 30.6</td><td> 3.28</td><td> 109</td><td> 216</td><td> 65. 9</td><td> 6.5 3</td><td> 54. 6</td>

<td> 109</td><td> 8</td><td> 111</td><td> 4580</td><td> 28.9</td><td> 71.1</td><td> 42.0</td><td> 2.38</td><td> 98.0</td><td> 145</td><td> 61. 1</td><td> 13. 2</td><td> 54. 2</td>

<td> 109</td><td> 9</td><td> 92.1</td><td> 3540</td><td> 17.0</td><td> 82.9</td><td> 32.5</td><td> 3.08</td><td> 118</td><td> 163</td><td> 53. 1</td><td> 9.4 3</td><td> 42. ₄d</td>

<td> 109.1 76</td><td> 11</td><td> 99.1</td><td> 5150</td><td> 28.6</td><td> 71.3</td><td> 47.2</td><td> 2.12</td><td> 110</td><td> 162</td><td> 76. 2</td><td> 16. 6</td><td> 67. 4</td>

<td> 109.4</td><td> 12</td><td> 89.9</td><td> 3060</td><td> 9.2</td><td> 90.8</td><td> 28.0</td><td> 3.58</td><td> 121</td><td> 207</td><td> 57.</td><td> 4.1</td><td> 43.</td>

<td>Nominal alna dose (lU/kg)</td><td>Dose (IU/kg)</td><td>Pacij ent</td><td>c ’-max (NJ/ dL)</td><td>AUCjn F (h*IU/ dL)</td><td>AU c_a(%)</td><td>AU Q (%)</td><td>AUC/d weight (IU*h/ dL per lU/kg)</td><td>Cl (mL/h/ kg)</td><td>We (mL/kg)</td><td>Vss (mL/ kg)</td><td>M RT (h)</td><td>Alf a HL (h)</td><td>Bet a HL (h)</td>

<td rowspan="7"></td><td> 41</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 9</td><td> 9</td><td> 8</td>

<td colspan="2">N</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td>

<td colspan="2">Mean value</td><td> 98.2</td><td> 3930</td><td> 20.4</td><td> 79.5</td><td> 36.1</td><td> 2.89</td><td> 111</td><td> 179</td><td> 62. 8</td><td> 9.9 9</td><td> 52. 5</td>

<td colspan="2">SD</td><td> 8.21^b</td><td> 893°</td><td> 8.37</td><td> 8.37</td><td> 8.17</td><td> 0.615</td><td> 8.98</td><td> 31.1</td><td> 8.8 2</td><td> 4.9 9</td><td> 10. 1</td>

<td colspan="2">SE</td><td> 3.67</td><td> 399</td><td> 3.74</td><td> 3.74</td><td> 3.65</td><td> 0.275</td><td> 4.02</td><td> 13.9</td><td> 3.9 5</td><td> 2.2 3</td><td> 4.5 1</td>

<td colspan="2">Geometric mean</td><td> 97.9</td><td> 3860</td><td> 18.9</td><td> 79.1</td><td> 35.4</td><td> 2.83</td><td> 111</td><td> 177</td><td> 62. 4</td><td> 8.9 2</td><td> 51. 7</td>

<td colspan="2">Geometric mean CV%</td><td> 8.2</td><td> 22.4</td><td> 49.7</td><td> 10.5</td><td> 22.4</td><td> 22.5</td><td> 8.2</td><td> 17.4</td><td> 13. 8</td><td> 59. 4</td><td> 19. 0</td>

Due to rounding or other errors, (a) should be 8.98, (b) should be 8.23, (c) should be 892, and (d) should be 42.2.

Table 7A-7B. Individual™ and group average FIXFc activity secondary pharmacokinetic summary data; Sorted by nominal dose, actual dose, and patient number

<td>Appointment Dose (lU/kg)</td><td>A matter of doses (Il/kg)</td><td>Patient</td><td>C168 a (IU/d L)</td><td>TBLP l^b(And)</td><td>TBL P3^C(And)</td><td>TBLP 5^d(And)</td><td>K value^and(Gκ/dL OR lU/kg)</td><td>K value^f(lU/dL or lU/kg)</td><td>In Vivo Usability^g (%)</td><td>In Vivo Usability^h (%)</td>

<td> 12.5</td><td> 13.71</td><td> 1</td><td> 0.264</td><td> 4.34</td><td> 2.13</td><td> 1.11</td><td> 0.87</td><td> 0.95</td><td> 30.8</td><td> 33.6</td>

<td>Appointment Dose (lU/kg)</td><td>A matter of doses (Il/kg)</td><td>Patience nt</td><td>C168 a (IU/d L)</td><td>TBLP l^b(And)</td><td>TBL P3^C(And)</td><td>TBLP 5^d(And)</td><td>K value^and(GH/dL per lU/kg)</td><td>K value^f(lU/dL or lU/kg)</td><td>In Vivo Usability^g (%)</td><td>In Vivo Usability^h (%)</td>

<td rowspan="2"></td><td> 4</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td colspan="2">N</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td>

<td rowspan="2"> 25</td><td> 27.25</td><td> 2</td><td> 1.09</td><td> 7.28</td><td> 3.72</td><td> 2.06</td><td> 0.73</td><td> 0.77</td><td> 31.8</td><td> 33.5</td>

<td colspan="2">N</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td><td> 1</td>

<td rowspan="11"> 50</td><td> 54.5</td><td> 3</td><td> 2.09</td><td> 9.79</td><td> 5.64</td><td> 3.70</td><td> 0.63</td><td> 0.77</td><td> 33.0</td><td> 40.2</td>

<td> 54.5</td><td> 4</td><td> 2.08</td><td> 9.58</td><td> 5.69</td><td> 3.89</td><td> 0.89</td><td> 1.06</td><td> 37.8</td><td> 45.2</td>

<td> 54.5</td><td> 5</td><td> 1.22</td><td> 7.50</td><td> 4.72</td><td> 3.42</td><td> 0.61</td><td> 0.62</td><td> 33.6</td><td> 34.6</td>

<td> 54.51 3</td><td> 6</td><td> 4.61</td><td> 12.2</td><td> 8.47</td><td> 6.72</td><td> 0.98</td><td> 1.12</td><td> 38.2</td><td> 43.6</td>

<td> 55.87 8</td><td> 7</td><td> 1.17</td><td> 7.37</td><td> 4.74</td><td> 3.51</td><td> 0.69</td><td> 0.75</td><td> 29.9</td><td> 32.6</td>

<td colspan="2">N</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td>

<td colspan="2">Mean value</td><td> 2.23</td><td> 9.29</td><td> 5.85</td><td> 4.25</td><td> 0.76</td><td> 0.86</td><td> 34.5</td><td> 39.2</td>

<td colspan="2">SD</td><td> 1.40</td><td> 1.98</td><td> 1.54</td><td> 1.39</td><td> 0.17</td><td> 0.22</td><td> 3.5</td><td> 5.5</td>

<td colspan="2">SE</td><td> 0.627</td><td> 0.886</td><td> 0.687</td><td> 0.623</td><td> 0.074</td><td> 0.0963</td><td> 1.6</td><td> 2.5</td>

<td colspan="2">Geometric mean</td><td> 1.96</td><td> 9.12</td><td> 5.71</td><td> 4.10</td><td> 0.75</td><td> 0.84</td><td> 34.4</td><td> 38.9</td>

<td colspan="2">Geometric mean CV%</td><td> 60.0</td><td> 21.2</td><td> 24.1</td><td> 28.6</td><td> 21.5</td><td> 25.4</td><td> 10.2</td><td> 14.4</td>

^a Cl68 = Estimated FIX activity above baseline at approximately 168 hours post-dose. The value in italics was estimated from simulations performed using a one-compartment model and the patient's microscopic rate constants.

<td>Appointment Dose (lU/kg)</td><td>A matter of doses (Il/kg)</td><td>Patience nt</td><td>C168 a (IU/d L)</td><td>TBLP l^b(And)</td><td>TBL P3^C(And)</td><td>TBLP 5^d(And)</td><td>K value^and(GH/dL per lU/kg)</td><td>K value^f(lU/dL or lU/kg)</td><td>In Vivo Usability^g (%)</td><td>In Vivo Usability^h (%)</td>

<td colspan="11">^b TBLP1 = Model-predicted time after dose when FIX activity decreased to approximately 1 Ш/dL above baseline. Values in italics were estimated from simulations performed using a one-compartment model and patient microscopic rate constants.^c TBLP3 = Model predicted time postdose when FIX activity decreased to approximately 3 Ш/dL above baseline.^d TBLP5 = Model predicted time postdose when FIX activity decreased to approximately 5 Ш/dL above baseline.^and The K-value is calculated using C_max model-predicted values generated from the results with the initial value subtracted divided by the dose.^f The K-value was calculated using the observed maximum sample result after the dose; K-value = (observed C_max value minus the initial value)/dose).^g In-vivo utilization = 100 x (model predicted C_max value from data minus baseline/dose) x plasma volume (dL)/dose in IU; where plasma volume in mL= (23.7 x Ht in cm) + (9.0 x Wt in kg) - 1709.^h In-vivo utilization = 100 x (observed C_max value minus the initial value) x plasma volume (dL)/dose in IU; where plasma volume in mL = (23.7 * Ht in cm) + (9.0 x Wtukg)- 1709.</td>

Tabela 7B

<td>Appointment Dose (lU/kg)</td><td>A matter of doses (Il/kg)</td><td>Patience nt</td><td>C168 a (IU/d L)</td><td>TBLP l^b(And)</td><td>TBL P3^C(And)</td><td>TBLP 5^d(And)</td><td>K value^and(lU/dL Ρθ lU/kg)</td><td>K value^f(Ш/dL or lU/kg)</td><td>In Vivo Usability^g (%)</td><td>In Vivo Usability^h (%)</td>

<td>Appointment Ina doza (IU/kg)</td><td>Dose (Il/kg)</td><td>Patience nt</td><td>C168 a (IU/d L)</td><td>TBLP l^b(And)</td><td>TBL P3^C(And)</td><td>TBLP 5^d(And)</td><td>K value^and(lU/dL Ρθ IU/kg)</td><td>K value^f(IU/dL or IU/kg)</td><td>In Vivo Usability^g (%)</td><td>In Vivo Usability^h (%)</td>

<td rowspan="11"> 100</td><td> 109</td><td> 10</td><td> 4.08</td><td> 11.6</td><td> 8.01</td><td> 6.34</td><td> 0.91</td><td> 1.08</td><td> 43.4</td><td> 51.8</td>

<td> 109</td><td> 8</td><td> 4.88</td><td> 12.1</td><td> 8.57</td><td> 6.92</td><td> 1.02</td><td> 1.17</td><td> 28.7</td><td> 33.1</td>

<td> 109</td><td> 9</td><td> 3.09</td><td> 9.87</td><td> 7.07</td><td> 5.78</td><td> 0.84</td><td> 0.89</td><td> 39.7</td><td> 41.8</td>

<td> 109.1 76</td><td> 11</td><td> 6.77</td><td> 14.7</td><td> 10.3</td><td> 8.21</td><td> 0.91</td><td> 0.99</td><td> 27.8</td><td> 30.3</td>

<td> 109.4 41</td><td> 12</td><td> 3.09</td><td> 9.96</td><td> 7.07</td><td> 5.72</td><td> 0.82</td><td> 0.97</td><td> 35.8</td><td> 42.2</td>

<td colspan="2">N</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td>

<td colspan="2">Mean value</td><td> 4.38</td><td> 11.6</td><td> 8.20</td><td> 6.59</td><td> 0.90</td><td> 1.02</td><td> 35.1</td><td> 39.8</td>

<td colspan="2">SD</td><td> 1.53</td><td> 1.97</td><td> 1.34</td><td> 1.03</td><td> 0.0784</td><td> 0.11</td><td> 6.8</td><td> 8.5</td>

<td colspan="2">SE</td><td> 0.685</td><td> 0.881</td><td> 0.597</td><td> 0.459</td><td> 0.0351</td><td> 0.0482</td><td> 3.0</td><td> 3.8</td>

<td colspan="2">Geometric mean</td><td> 4.19</td><td> 11.5</td><td> 8.12</td><td> 6.53</td><td> 0.90</td><td> 1.02</td><td> 34.5</td><td> 39.1</td>

<td colspan="2">Geometric mean CV%</td><td> 34.1</td><td> 16.5</td><td> 15.7</td><td> 15.0</td><td> 8.6</td><td> 10.5</td><td> 19.8</td><td> 21.6</td>

Table 8. Phase 1/2a Study: Comparison of PK Parameters for rFIXFc and BENEFIX™

<td>Parameters</td><td>*rFIXFc [Mean±SD (min. - max.] [N=ll]</td><td>tBENEFIX™ [Mean±SD (min. - max.)] [N=ll]</td>

<td>t_In2 (hours)</td><td> 52.5 ±9.2 (40 - 67.4)</td><td> 19.3 ±4.97(11.1 -36.4)</td>

<td>MRI (hours)</td><td> 68.05 ±11.16 (53.1 - 85.8)</td><td> 26.0 ±6.07 (15.81 -46.09)</td>

<td>Parameters</td><td>*rFIXFc [Mean±SD (min. - max.] [N=ll]</td><td>1BENEFIX™ [Mean±SD (min. - max.)] [N=ll]</td>

<td>CL (mL/sat/kg)</td><td> 3.36+0.93 (1.84 -4.58)</td><td> 8.4 ±2.01 (4.66 - 13.64)</td>

<td>Incremental utilization (IU/dL per IU/kg)</td><td> 0.93 ±0.18(0.62-1.17)^a</td><td> 0.75 ±0.23 (0.34 - 1.38)</td>

<td>Cmax (PJ/dL per IU/kg)</td><td>24 hours after injection</td><td></td>

<td>AUC</td><td>48 hours after injection</td><td></td>

<td colspan="3">* Estimates from 2-compartment analysis of FIX activity at nominal doses of 25, 50 and 100 IU/kg (n=11) t Summary of Product Characteristics of BENEFIX™ (Nov 18, 2009); Medijana i raspon (n=56) a. Range corrected for rounding or other errors as 0.63-1.18.</td>

[0168] Compared to historical data for BENEFIX™, rFIX-Fc demonstrated:

• 3x increase in half-life and mean retention time • 24% improved incremental utilization vs. • 2.5x decreased clearance

Table 9. Phase 1/2a study: Dose-proportional increase in Cmax and AUC of rFIXFc (activity)

<td>Dosage (IU/kg)</td><td>Br. patients</td><td>Cmax (IU/dL) [Mean±SD (min. - max.)]</td><td>AUC (h*IU/dL) [Mean±SD (min. - max.)]</td>

<td> 25</td><td> 1</td><td> 19.9</td><td> 753</td>

<td> 50</td><td> 5</td><td> 41.6 ±8.97 (33.0- 53.5)</td><td> 1630 ±750 (1190 -2960)</td>

<td> 100</td><td> 5</td><td> 98.2 ±8.21 (89.9- 111.0)</td><td> 3930 ±893 (3060 - 5150)</td>

<td colspan="4">See also Figure 5.</td>

Table 10A-10B. Estimated therapeutic duration of rFIXFc at 50 and 100 IU/kg doses.

<td>Parameter</td><td>Geo Median</td>

<td>Parameter</td><td>Geo Median</td>

<td>FDCC ranked 7</td><td>2.0 Ш/dL (above baseline)</td>

<td>Time to 1 Ш/dL above baseline</td><td>9.1 and</td>

<td>Time to 3 Ш/dL above baseline</td><td>5.7 and</td>

<td colspan="2"></td>

<td>Parameter</td><td>Geo Median</td>

<td>FDCC ranked 7</td><td>4.2 Ш/dL (above baseline)</td>

<td>Time to 1 Ш/dL above baseline</td><td>11.5 and</td>

<td>Time to 3 Ш/dL above baseline</td><td>8.1 and</td>

See also Figure 6A-6B.

Table 11. Dose proportional increase in Cmax and AUC for rFIXFc antigen.

<td>Doza (lU/kg)</td><td>Br. patients</td><td>Cmax (ng/mL) [Mean ±SD]</td><td>AUC (h*ng/mL) [Mean ±SD]</td>

<td> 25</td><td> 1</td><td> 2.730</td><td> 144.000</td>

<td> 50</td><td> 5</td><td> 7,510 ±2,480</td><td> 408,000 ± 73,900</td>

<td> 100</td><td> 5</td><td> 15,400 ±3,960</td><td> 897,000 ± 206,000</td>

<td colspan="4">See also figure 7.</td>

Table 12. Pharmacokinetic estimates for rFIXFc antigen

<td>Parameters</td><td>50 Ш/kg [Mean ±SD] (N=5)</td><td>100 Ш/kg [Mean ±SD] (N=5)</td>

<td>CL (mL/sat/kg)</td><td> 2.28 ±0.37</td><td> 2.11 ±0.46</td>

<td>Vss (mL/kg)</td><td> 259 ±78.5</td><td> 238 ± 52.2</td>

<td>MRI (hours)</td><td> 112 ± 21.5</td><td> 114 ± 17.1</td>

<td>you/2 (hours)</td><td> 110 ± 26.5</td><td> 95.8± 11.1</td>

<td>Parameters</td><td>50 Ш/kg [Mean ±SD] (N=5)</td><td>100 Ш/kg [Mean ±SD] (N=5)</td>

<td colspan="3">See also Figure 8A-8B.</td>

Table 13. Mean PK values based on activity

<td></td><td>Cmax (lU/dL)</td><td>ALSO NF (h*IU /dL)</td><td>AUCa (%)</td><td>AUCb (%)</td><td>AUC/ dose (IU*h /dL PO lU/kg )</td><td>Cl (mL/k g)</td><td>WE (mL/h /kg)</td><td>VSS (mL/k g)</td><td>MRT (h)</td><td>tl/2a (h)</td><td>tl/2₽ (h)</td>

<td>n</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td>

<td>Average value</td><td> 65.364</td><td> 2596.6 36</td><td> 11.591</td><td> 88.427</td><td> 32.436</td><td> 3.555</td><td> 123.36 4</td><td> 226.00 0</td><td> 68.045</td><td> 5.463</td><td> 52.45 5</td>

<td>Std dev</td><td> 32.970 8</td><td> 1497.1 234</td><td> 10.449 0</td><td> 10.521 0</td><td> 10.750 6</td><td> 0.9257</td><td> 21.280 4</td><td> 69.758 2</td><td> 11.163 7</td><td></td><td> 9.167 4</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 5.4197</td><td></td>

<td>%CV</td><td> 50.442 0</td><td> 57.656 3</td><td> 90.147 9</td><td> 11.898 0</td><td> 33.143 5</td><td> 27.589 0</td><td> 17.250 1</td><td> 30.866 4</td><td> 16.406 3</td><td></td><td> 17.47 68</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 99.212 8</td><td></td>

<td>Median</td><td> 53.500</td><td> 2960.0 00</td><td> 9.200</td><td> 90.800</td><td> 28.000</td><td> 3.580</td><td> 118.00 0</td><td> 216.00 0</td><td> 65.900</td><td> 3.640</td><td> 54.20 0</td>

<td>Minimum one</td><td> 19.90</td><td> 753.00</td><td> 1.00</td><td> 71.10</td><td> 21.80</td><td> 1.84</td><td> 98.00</td><td> 145.00</td><td> 53.10</td><td> 0.84</td><td> 40.00</td>

<td>Thank you mum</td><td> 111.00</td><td> 5150.0 0</td><td> 28.90</td><td> 99.10</td><td> 54.30</td><td> 4.58</td><td> 160.00</td><td> 365.00</td><td> 85.80</td><td> 16.60</td><td> 67.40</td>

<td></td><td>Cmax (lU/dL)</td><td>ALSO NF (h*IU /dL)</td><td>AUCa (%)</td><td>AUCb (%)</td><td>AUC/ dose (IU*h /dL Ph lU/kg )</td><td>Cl (mL/k g)</td><td>VI (mL/h/kg)</td><td>VSS (mL/k g)</td><td>MRT (h)</td><td>tl/2a (h)</td><td>tl/2₽ (h)</td>

<td>Geo. middle</td><td> 56.951</td><td> 2181.2 94</td><td> 6.781</td><td> 87.826</td><td> 31.020</td><td> 3.226</td><td> 121.76 7</td><td> 216.53 3</td><td> 67.218</td><td> 3.326</td><td> 51.71 5</td>

<td></td><td></td><td></td><td></td><td>C168 [1] (lU/d L)</td><td>TBLP 1[2] (and)</td><td>TBLP 3[3] (and)</td><td>TBLP 5 [4] (and)</td><td>Increment Ina utilizati on [5] (lU/d L per lU/kg )</td><td>Increment Ina utilizati on [6] (lU/d L per lU/kg )</td><td>In Vivo efficiency P] (%)</td><td>In Vivo Efficiency [8] (%)</td>

<td></td><td></td><td></td><td>n</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td><td> 11</td>

<td></td><td></td><td></td><td>Average value</td><td> 3.106</td><td> 10.177</td><td> 6.727</td><td> 5.115</td><td> 0.821</td><td> 0.926</td><td> 34.518</td><td> 38.99 1</td>

<td></td><td></td><td></td><td>Std dev</td><td> 1.8231</td><td> 2.3315</td><td> 2.0089</td><td> 1.8975</td><td> 0.1387</td><td> 0.1787</td><td> 4.9250</td><td> 6.663 6</td>

<td></td><td></td><td></td><td>%CV</td><td> 58.689 7</td><td> 22.908 8</td><td> 29.862 3</td><td> 37.094 4</td><td> 16.892 1</td><td> 19.294 0</td><td> 14.267 8</td><td> 17.09 00</td>

<td></td><td></td><td></td><td>Median</td><td> 3.090</td><td> 9.870</td><td> 7.070</td><td> 5.720</td><td> 0.840</td><td> 0.970</td><td> 33.600</td><td> 40.20 0</td>

<td></td><td>Cmax (lU/dL)</td><td>ALSO NF (h*IU /dL)</td><td>AUCa (%)</td><td>AUCb (%)</td><td>AUC/ dose (IU*h /dL per lU/kg</td><td>Cl (mL/k g)</td><td>VI (mL/h/kg)</td><td>VSS (mL/k g)</td><td>MRT (h)</td><td>tl/2a (h)</td><td>tl/2₽ (h)</td>

<td></td><td></td><td></td><td>Small alder</td><td> 1.09</td><td> 7.28</td><td> 3.72</td><td> 2.06</td><td> 0.61</td><td> 0.62</td><td> 27.80</td><td> 30.30</td>

<td></td><td></td><td></td><td>Maxi Malno</td><td> 6.77</td><td> 14.70</td><td> 10.30</td><td> 8.21</td><td> 1.02</td><td> 1.17</td><td> 43.40</td><td> 51.80</td>

<td></td><td></td><td></td><td>Geo. middle</td><td> 2.621</td><td> 9.938</td><td> 6.447</td><td> 4.761</td><td> 0.810</td><td> 0.910</td><td> 34.202</td><td> 38.48 6</td>

<td colspan="12">Footnotes: Note: PK parameter values were determined by the 2-compartment method. Geo. mean = geometric mean [1] C168 = FIX activity above baseline at 168 hours post-dose. [2] TBLP1 = Estimated time after dose when FIX activity decreased to 1 Ш/dL above baseline.</td>

<td colspan="12">[3] TBLP3 = Estimated time after dose when FIX activity decreased to 3 Ш/dL above baseline.</td>

<td colspan="12">[4] TBLP3 = Estimated time after dose when FIX activity decreased to 5 Ш/dL above baseline.</td>

<td colspan="11">[5] Incremental efficacy was calculated using the model-predicted Cmax value generated from the results minus the baseline value divided by the dose.</td><td></td>

[6] Incremental utilization was calculated using the observed maximum sample result after the dose;

Incremental utilization = (observed Cmax value minus initial value)/dose.

[7]

In vivo utilization = 100 x (model predicted Cmax value from data minus baseline/dose) x plasma volume (dL)/dose in IU where plasma volume in ml = (23.7 x Ht in cm) + (9.0 x Wtu kg) - 1709.

[8]

In vivo utilization = 100 x (observed Cmax value minus baseline value) x plasma volume (dL)/dose in IU;

where plasma volume in ml = (23.7 x Ht in cm) + (9.0 x Wtu kg) - 1709.

Table 14. Mean PK values based on antigen level.

<td rowspan="2">Nominal dose (lU/kg)</td><td rowspan="2">Dose (IU/kg)</td><td rowspan="2">Equivalent dose (mg/kg)</td><td rowspan="2">Patience nt</td><td rowspan="2">c ⁱⁿmax (ng/m L)</td><td rowspan="2">AUCjnf (h*ng/m L)</td><td rowspan="2">Cl (ml./h/k g)</td><td rowspan="2">Vss (mL/k g)</td><td rowspan="2">MR T(h)</td><td>Alph a HL</td><td>Beta HL</td>

<td>(h)</td><td>(h)</td>

<td> 12.5</td><td> 13.714</td><td> 0.228</td><td> 1</td><td> 1670</td><td> 91300</td><td> 2.5</td><td> 245</td><td> 98.2</td><td> 21.2</td><td> 107</td>

<td> 25</td><td> 27.25</td><td> 0.453</td><td> 2</td><td> 2730</td><td> 144000</td><td> 3.14</td><td> 273</td><td> 87.1</td><td> 11.3</td><td> 71</td>

<td rowspan="5"> 50</td><td> 54.5</td><td> 0.905</td><td> 3</td><td> 5470</td><td> 356000</td><td> 2.54</td><td> 366</td><td> 144</td><td> 18.6</td><td> 138</td>

<td> 54.5</td><td> 0.905</td><td> 4</td><td> 6910</td><td> 389000</td><td> 2.32</td><td> 244</td><td> 105</td><td> 10.6</td><td> 85.3</td>

<td> 54.5</td><td> 0.905</td><td> 5</td><td> 7520</td><td> 416000</td><td> 2.17</td><td> 184</td><td> 84.5</td><td>NC</td><td> 94.3</td>

<td> 54.513</td><td> 0.906</td><td> 6</td><td> 11700</td><td> 531000</td><td> 1.71</td><td> 190</td><td> 112</td><td>NC</td><td> 140</td>

<td> 55.878</td><td> 0.928</td><td> 7</td><td> 5950</td><td> 348000</td><td> 2.67</td><td> 310</td><td> 116</td><td> 10.1</td><td> 93.9</td>

<td rowspan="2"> 100</td><td> 109</td><td> 1.81</td><td> 10</td><td> 12500</td><td> 667000</td><td> 2.72</td><td> 263</td><td> 96.8</td><td> 9.79</td><td> 78</td>

<td> 109</td><td> 1.81</td><td> 8</td><td> 21600</td><td> 1200000</td><td> 1.51</td><td> 156</td><td> 103</td><td> 15.7</td><td> 94.3</td>

<td rowspan="2">Nominal per dose (IU/kg)</td><td rowspan="2">Dose (IU/kg)</td><td rowspan="2">Equivalent dose (mg/kg)</td><td rowspan="2">Patience nt</td><td rowspan="2">r '-'max (ng/m L)</td><td rowspan="2">AiS_from(h*ng/m L)</td><td rowspan="2">Cl (mL/h/k g)</td><td rowspan="2">Vss (mL/kg)</td><td rowspan="2">MR T(h)</td><td>Alph a HL</td><td>Beta HL</td>

<td>(h)</td><td>(h)</td>

<td rowspan="3"></td><td> 109</td><td> 1.81</td><td> 9</td><td> 13400</td><td> 998000</td><td> 1.81</td><td> 248</td><td> 137</td><td> 11.5</td><td> 107</td>

<td> 109.17 6</td><td> 1.81</td><td> 11</td><td> 17200</td><td> 844000</td><td> 2.15</td><td> 226</td><td> 105</td><td> 13</td><td> 97.1</td>

<td> 109.44 1</td><td> 1.82</td><td> 12</td><td> 12500</td><td> 778000</td><td> 2.34</td><td> 295</td><td> 126</td><td> 10.6</td><td> 102</td>

<td></td><td colspan="3">N</td><td> 12</td><td> 12</td><td> 12</td><td> 12</td><td> 12</td><td> 12</td><td> 12</td>

<td></td><td colspan="3">Mean value</td><td> 9929.0</td><td> 563525. 0</td><td> 2.3</td><td> 250.0</td><td> 109. 6^b</td><td> 13.2^C</td><td> 100. ₇and</td>

<td></td><td colspan="3">SD</td><td> 5940.0</td><td> 339925. 0</td><td> 0.5^a</td><td> 58.2</td><td> 18.5</td><td> 4.0^d</td><td> 20.9</td>

<td></td><td colspan="3">SE</td><td> 1715.0</td><td> 98128.0</td><td> 0.1</td><td> 16.8</td><td> 5.3</td><td> 1.3</td><td> 6.0</td>

<td></td><td colspan="3">Geometric mean</td><td> 8014.0</td><td> 452356. 0</td><td> 2.3</td><td> 243.7</td><td> 108. 2</td><td> 12.8</td><td> 98.8</td>

Due to rounding or other errors, (a) should be 0.46, (b) should be 110, (c) should be 12.0, (d) should be 3.95, and (e) should be 101.

Table 15: Biochemical characterization of factor IX

<td colspan="2"></td><td>FIXFc</td><td>rFIX</td><td>pdFIX</td>

<td colspan="2">Gamma-carboxylation</td><td></td><td></td><td></td>

<td rowspan="3">aa 1-23 (K1K2 peptide)</td><td>6% Family</td><td> 97.8</td><td> 96.9</td><td> 99.6</td>

<td>5% Family</td><td> 2.2</td><td> 3.1</td><td> 0.4</td>

<td>4% Family</td><td> 0</td><td> 0</td><td> 0</td>

<td>aa 24-43 (K3 peptide)</td><td>6% Family</td><td> 61.3</td><td> 63.7</td><td> 98.9</td>

<td></td><td>FIXFc</td><td>rFIX</td><td>pdFIX</td>

<td>Gamma-carboxylation</td><td></td><td></td><td></td>

<td>5% Family</td><td> 26.3</td><td> 30.9</td><td> 1.1</td>

<td>4% Family</td><td> 12.5</td><td> 5.4</td><td> 0</td>

<td>Total GLA/mol, peptide map</td><td> 11.5</td><td> 11.6</td><td> 12.0</td>

<td>GLA size/mol, AAA</td><td> 11.3 ±0.3</td><td> 11.5 + 0.3</td><td> (12)</td>

<td>Propeptide content</td><td>not detected</td><td>not detected</td><td>not detected</td>

<td>β-hydroxylation of Asp 64</td><td> 70%</td><td> 49%</td><td> 37%</td>

<td>Sulfation Tyr 155</td><td> 4%</td><td> 5%</td><td> (&gt;90%)</td>

<td>Phosphorylation of Ser 158</td><td> &lt;10%</td><td> &lt;10%</td><td> (&gt;90%)</td>

<td>Ala 148/Thr 148</td><td> 0/100%</td><td> 100/0%</td><td> 30/70%</td>

<td>Activated FIX</td><td> &lt;0.0125%</td><td> 0.109+/-0.00185%</td><td> 0.21 +/- 0.010%</td>

<td>FXIa activation</td><td> | 94.8 +/- 2.4%</td><td> | 96.6 +/- 1.8%</td><td>Not finished.</td>

Table 16: Summary of terminal half-lives of FIXFc and BENEFIX™ after a single intravenous dose.

<td>Types</td><td>BENEFIX™</td><td>FIXFc</td>

<td>Normal mice</td><td>12.3 hours</td><td>47.2 ± 4.8 sat</td>

<td>FlX-deficient mice</td><td>13.2 hours</td><td>46.2 ±10.1 sat</td>

<td>FcRN KO mice</td><td>16.5 ±3.0 sat</td><td>16.9 ±2.1 sat</td>

<td>FcRN Tg32b mice</td><td>14.2 ± 2.9 sat</td><td>53.0 ± 6.6. sat</td>

<td>Rats</td><td>5.8 hours</td><td>34.8 ± 5.3 sat</td>

<td>Dogs with FlX deficiency</td><td>14-18 sat *</td><td>47.5 hours</td>

<td>Monkey</td><td>12.7 saf</td><td>47.3± 9.1 sat</td>

<td colspan="3">* Brinkhous et al, Blood, 1996; 88: 2603-2610 1 McCarthy et al, 2002, Thromb Haemost, 2002; 87: 824-830</td>

Table 17. Summary of in vitro ROTEM® parameters for rFIXFc and BENEFIX™ added to mouse whole blood with HemB

<td></td><td>% of normal activity</td><td>CT (sec) (Mean ± SD)</td><td>CFT (sec) (Mean ± SD)</td><td>Alpha angle (°) (Mean ± SD)</td>

<td rowspan="3">rFIXFc (n=10 pooled samples)</td><td> 0.074</td><td> 2263 ± 209</td><td> 1152 ± 170</td><td> 24 ± 5</td>

<td> 0.74</td><td> 1371± 82</td><td> 459 ± 45</td><td> 34 ± 5</td>

<td> 7.4</td><td> 790.8 ± 30</td><td> 226 ± 20</td><td> 52 ±2</td>

<td rowspan="3">BENEFIX™ (n=10 pooled samples)</td><td> 0.1</td><td> 2019± 178</td><td> 732 ± 123</td><td> 30 ±3</td>

<td> 1</td><td> 1090 ± 38</td><td> 324 ± 33</td><td> 43 ±3</td>

<td> 10</td><td> 551.1 ±38</td><td> 127 ± 10</td><td> 67 ±2</td>

Table 18. Median blood loss after tail clipping in HemB mice treated with rFIXFc or BENEFIX™

<td rowspan="2">Doza (lU/kg)</td><td colspan="3">Median blood loss (mL)</td>

<td>rFIXFc (n=15/dose)</td><td>BENEFIX™ (n=15/dose)</td><td>Vehicle (n=18)</td>

<td> 720</td><td> 0.101</td><td></td><td></td>

<td> 360</td><td> 0.651</td><td> 0.218</td><td></td>

<td> 240</td><td> 0.298</td><td></td><td></td>

<td> 120</td><td> 0.4567</td><td> 0.564</td><td></td>

<td> 80</td><td> 0.8474</td><td></td><td></td>

<td> 40</td><td> 1.0097</td><td> 0.918</td><td></td>

<td> 0</td><td></td><td></td><td> 1.1586</td>

Table 19. Ex vivo ROTEM® parameter in HemB mice treated with rFIXFc and BENEFIX™

<td></td><td>Times (h)</td><td>CT (sec) (Mean ± SD)</td><td>CFT (sec) (Mean ± SD)</td><td>Alpha angle (degree) (Mean ± SD)</td>

<td rowspan="5">100 IU/kg BENEFIX™ (n=4 mice/time point)</td><td> 0.083</td><td> 599 ± 23</td><td> 174 ± 16</td><td> 58 ±2</td>

<td> 24</td><td> 682 ± 49</td><td> 184 ± 34</td><td> 57 ± 5</td>

<td> 48</td><td> 897± 114</td><td> 310 ± 89</td><td> 45 ± 7</td>

<td> 72</td><td> 1141± 155</td><td> 508 ± 123</td><td> 32 ± 7</td>

<td> 96</td><td> 1613± 181</td><td> 605 ± 92</td><td> 27 ±3</td>

<td rowspan="7">50 IU/kg rFIXFc (n=8 mice/time point)</td><td> 0.083</td><td> 700 ± 18</td><td> 213 ± 9</td><td> 53 ± 1</td>

<td> 24</td><td> 836 ± 31</td><td> 261 ± 15</td><td> 47 ±2</td>

<td> 72</td><td> 845 ± 38</td><td> 285 ± 17</td><td> 45 ±2</td>

<td> 96</td><td> 957 ± 30</td><td> 296 ± 26</td><td> 43 ±2</td>

<td> 120</td><td> 1014 ± 83</td><td> 342 ± 50</td><td> 42 ± 4</td>

<td> 168</td><td> 1139± 65</td><td> 408 ± 41</td><td> 36 ±3</td>

<td> 216</td><td> 1366 ± 96</td><td> 453 ± 48</td><td> 34 ±3</td>

Table 20A. PK parameters of rFIXFc and BENEFIX™ (200 IU/kg) following a single subcutaneous injection in FIX-deficient mice (antigen ELISA)

<td rowspan="2">The only one</td><td>Dose</td><td>V/F</td><td>Love g</td><td>AUC™ F</td><td>Absorption HL</td><td>Elimination of HL</td><td>CL/F</td><td>Tm ax</td><td>Cma X</td><td>AUCjn_F /danger</td><td>Cmax/d oza</td><td>F</td>

<td>of/kg</td><td>mL/ kg</td><td>Hr</td><td>Hr*ng/ mL</td><td>Hr</td><td>Hr</td><td>mL/Hr /kg</td><td>Hr</td><td>of/ mL</td><td>Hr.kg/ mL</td><td>g/mL</td><td> %</td>

<td>Good IX</td><td> 72727 3</td><td> 392 0</td><td> 2.8 6</td><td> 6397</td><td> 1.96</td><td> 23.9</td><td> 114</td><td> 10. 6</td><td> 148</td><td> 0.0088 0</td><td> 0.204</td><td> 23. 3</td>

<td>rFIXF c</td><td> 32786 89</td><td> 207 1</td><td> 0.8 96</td><td> 141370</td><td> 7.67</td><td> 61.9</td><td> 23.2</td><td> 27. 3</td><td> 117 8</td><td> 0.0431</td><td> 0.359</td><td> 38. 1</td>

Table 20B. PK parameters of rFIXFc and BENEFIX™ (200 IU/kg) after subcutaneous injection of a single dose in FIX-deficient mice (aPTT activity assay)

<td>Compound</td><td>Doz a</td><td>V/F</td><td>Love g</td><td>AUCin F</td><td>Absorption HL</td><td>Elimination of HL</td><td>CL/F</td><td>Tm ax</td><td>Cma X</td><td>AUCin _F/danger</td><td>Cmax/d oza</td><td>F</td>

<td>outside</td><td>IL7 kg</td><td>dL/ kg</td><td>Hr</td><td>Hr*IU/ dL</td><td>Hr</td><td>Hr</td><td>dL/Hr/ kg</td><td>Hr</td><td>W/d L</td><td>Hr*kg/ dL</td><td>g/dL</td><td> %</td>

<td>BeneFI X</td><td> 207</td><td> 54.8</td><td> 0.63 1</td><td> 93.9</td><td> 7.01</td><td> 17.2</td><td> 2.20</td><td> 16.0</td><td> 2.04</td><td> 0.454</td><td> 9.86</td><td> 18. 9</td>

<td>rFIXFc</td><td> 172</td><td> 25.1</td><td> 2.32</td><td> 418</td><td> 6.84</td><td> 42.4</td><td> 0.411</td><td> 23.8</td><td> 4.82</td><td> 2.43</td><td> 28.0</td><td> 29. 1</td>

Table 21. PK and PD analysis of rFIXFc and BENEFIX™ after a single subcutaneous dose in FIX-deficient mice.

<td></td><td>Test</td><td>AUC/doza (Hr*kg/m L)</td><td>Elim. Half-life (Hr)</td><td>CL/F (mL/Hr/kg)/ %</td><td>Tma X (Hr)</td><td>Cmax/doz a (kg/mL)</td><td>F (%)</td>

<td>rFIXFc 200 lU/kg</td><td>Antigen</td><td> 0.041</td><td> 61.9</td><td> 23.2</td><td> 27.3</td><td> 0.00035</td><td> 38. 1</td>

<td>BENEFIX™ 200 lU/kg</td><td>Antigen</td><td> 0.0073</td><td> 23.9</td><td> 114</td><td> 10.6</td><td> 0.00017</td><td> 23. 3</td>

<td>Relationship (rFIXFc/BENEFIX IMj</td><td>Antigen</td><td> 5.62</td><td> 2.59</td><td> 0.20</td><td> 2.58</td><td> 2.05</td><td> 1.6 3</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>rFIXFc 400 lU/kg</td><td>Antigen</td><td> 0.042</td><td> 50.9</td><td> 23.7</td><td> 18.3</td><td> 0.00045</td><td> 45. 6</td>

<td>BENEFIX™ 400 lU/kg</td><td>Antigen</td><td> 0.0089</td><td> 20.2</td><td> 113</td><td> 8.13</td><td> 0.00024</td><td> 20. 2</td>

<td>Relationship</td><td>Antigen</td><td> 4.72</td><td> 2.52</td><td> 0.21</td><td> 2.25</td><td> 1.91</td><td> 2.2</td>

<td></td><td>Test</td><td>AUC/doza (Hr*kg/m L)</td><td>Elim. Half-life (Hr)</td><td>CL/F (mL/Hr/kg)/ %</td><td>Tma X (Hr)</td><td>Cmax/doz a (kg/mL)</td><td>F (%)</td>

<td>(rFIXFc/BENEFIX IMj</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 6</td>

<td></td><td></td><td>AUC/doza (Hr*kg/m L)</td><td>Elim. Half-life (Hr)</td><td>CL/F (mL/Hr/kg)/ %</td><td>Tma X (Hr)</td><td>Cmax/doz a (kg/mL)</td><td>F (%)</td>

<td>rFIXFc 200 IU/kg</td><td>Activity t</td><td> 0.021</td><td> 42.4</td><td> 41.1</td><td> 23.8</td><td> 0.00024</td><td> 29. 1</td>

<td>BENEFIX™ 200 IU/kg</td><td>Activity t</td><td> 0.0047</td><td> 17.2</td><td> 220</td><td> 16.0</td><td> 0.00010</td><td> 18. 9</td>

<td>Relationship (rFIXFc/BENEFIX IMj</td><td>Active</td><td> 4.47</td><td> 2.46</td><td> 0.19</td><td> 1.49</td><td> 2.40</td><td> 1.5 4</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>rFIXFc 400 IU/kg</td><td>Activity t</td><td> 0.028</td><td> 40.3</td><td> 35.6</td><td> 15.9</td><td> 0.00037</td><td> 39. 2</td>

<td>BENEFIX™ 400 IU/kg</td><td>Activity t</td><td> 0.0052</td><td> 15.6</td><td> 193</td><td> 18.1</td><td> 0.00010</td><td> 15. 5</td>

<td>Relationship (rFIXFc/BENEFIX IMj</td><td>Active</td><td> 5.38</td><td> 2.58</td><td> 0.18</td><td> 0.88</td><td> 3.70</td><td> 2.5 3</td>

Table 22. PK parameters of rFIXFc (50 µg/kg) after single dose subcutaneous injection in macaque monkeys.

<td>Group A</td><td>ID animals</td><td>V/F (mL/k g)</td><td>AUC (Hr*ng/mL)</td><td>Absorption HL (Hr)</td><td>HL Terminal (Hr)</td><td>CL/F (mL/Hr/ kg)</td><td>Tma X (Hr)</td><td>Cmax (ng/m L)</td><td>AUC/D (Hr* kg/ mL)</td><td>F( %)</td>

<td> 50</td><td>5C4</td><td> 545</td><td> 109000</td><td> 8.42</td><td> 50.2</td><td> 7.53</td><td> 26.1</td><td> 1050</td><td> 0.133</td><td> 43.</td>

<td>Group A</td><td>ID animals</td><td>V/F (mL/k g)</td><td>AUC (Hr*ng/mL)</td><td>Absorption HL (Hr)</td><td>HL Terminal (Hr)</td><td>CL/F (mL/Hr/ kg)</td><td>Tma X (Hr)</td><td>Cmax (ng/m L)</td><td>AUC/D (Hr* kg/ mL)</td><td>F( %)</td>

<td>lU/kg</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 7</td>

<td>rFIX Fc</td><td>C37716</td><td> 975</td><td> 108000</td><td> 6.4</td><td> 89</td><td> 7.6</td><td> 26.2</td><td> 685</td><td> 0.132</td><td> 43. 3</td>

<td></td><td>C41440</td><td> 622</td><td> 82500</td><td> 8.54</td><td> 43.4</td><td> 9.93</td><td> 24.9</td><td> 885</td><td> 0.101</td><td> 33. 1</td>

<td></td><td>N</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td>

<td></td><td>Mean value</td><td> 714</td><td> 99800</td><td> 7.79</td><td> 60.9</td><td> 8.35</td><td> 25.7</td><td> 873</td><td> 0.122</td><td> 40. 1</td>

<td></td><td>SD</td><td> 229</td><td> 14900</td><td> 1.2</td><td> 24.6</td><td> 1.37</td><td> 0.68 5</td><td> 182</td><td> 0.0183</td><td> 6.0 3</td>

<td></td><td>SE</td><td> 132</td><td> 8630</td><td> 0.695</td><td> 14.2</td><td> 0.79</td><td> 0.39 6</td><td> 105</td><td> 0.0106</td><td> 3.4 8</td>

<td></td><td>Geometric mean</td><td> 691</td><td> 99000</td><td> 7.72</td><td> 57.9</td><td> 8.28</td><td> 25.7</td><td> 860</td><td> 0.121</td><td> 39. 7</td>

<td></td><td>Geometric mean CV%</td><td> 31.2</td><td> 15.8</td><td> 16.4</td><td> 39.4</td><td> 15.8</td><td> 2.68</td><td> 21.7</td><td> 15.9</td><td> 15. 9</td>

Table 23. PK parameters of rFIXFc (100 IU/kg) after single dose subcutaneous injection in macaque monkeys.

<td>Group A</td><td>ID animals</td><td>V/F (mL/k g)</td><td>AUC (Hr*ng/mL)</td><td>Absorption HL (Hr)</td><td>HL Terminal (Hr)</td><td>CL/F (mL/Hr/ kg)</td><td>Tma X (Hr)</td><td>Cmax (ng/m L)</td><td>AUC/D (Hr* kg/ mL)</td><td>F( %)</td>

<td>100 lU/kg</td><td> 29109</td><td> 1630</td><td> 69800</td><td> 11.4</td><td> 48.1</td><td> 23.5</td><td> 31</td><td> 644</td><td> 0.0426</td><td> 14. 0</td>

<td>Group A</td><td>ID animals</td><td>V/F (mL/k g)</td><td>AUC (Hr*ng/mL)</td><td>Absorption HL (Hr)</td><td>HL Terminal (Hr)</td><td>CL/F (mL/Hr/ kg)</td><td>Tma X (Hr)</td><td>Cmax (ng/m L)</td><td>AUC/D (Hr* kg/ mL)</td><td>F( %)</td>

<td rowspan="8">rFIX Fc</td><td> 605097</td><td> 561</td><td> 207000</td><td> 5.12</td><td> 49.2</td><td> 7.9</td><td> 18.6</td><td> 2250</td><td> 0.126</td><td> 41. 5</td>

<td>C35785</td><td> 387</td><td> 238000</td><td> 6.37</td><td> 39</td><td> 6.89</td><td> 19.9</td><td> 2970</td><td> 0.145</td><td> 47. 8</td>

<td>N</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td>

<td>Mean value</td><td> 858</td><td> 172000</td><td> 7.62</td><td> 45.4</td><td> 12.8</td><td> 23.2</td><td> 1950</td><td> 0.105</td><td> 34. 4</td>

<td>SD</td><td> 671</td><td> 89600</td><td> 3.31</td><td> 5.58</td><td> 9.3</td><td> 6.79</td><td> 1190</td><td> 0.0546</td><td> 18. 0</td>

<td>SE</td><td> 388</td><td> 51700</td><td> 1.91</td><td> 3.22</td><td> 5.37</td><td> 3.92</td><td> 687</td><td> 0.0315</td><td> 10. 4</td>

<td>Geometric mean</td><td> 707</td><td> 151000</td><td> 7.18</td><td> 45.2</td><td> 10.9</td><td> 22.6</td><td> 1630</td><td> 0.0921</td><td> 30. 3</td>

<td>Geometric mean CV%</td><td> 86.2</td><td> 75.5</td><td> 43.1</td><td> 12.8</td><td> 75.5</td><td> 28.2</td><td> 96.9</td><td> 75.5</td><td> 75. 5</td>

Table 24. PK parameters of rFIXFc (200 IU/kg) after single dose subcutaneous injection in macaque monkeys.

<td>Group A</td><td>ID animals</td><td>V/F (mL/k g)</td><td>AUC (Hr*ng/mL)</td><td>Absorption HL (Hr)</td><td>HL Terminal (Hr)</td><td>CL/F (mL/Hr/ kg)</td><td>Tma X (Hr)</td><td>Cmax (ng/m L)</td><td>AUC/D (Hr* kg/ mL)</td><td>F( %)</td>

<td rowspan="2">200 lU/kg rFIX</td><td> 50883</td><td> 855</td><td> 408000</td><td> 3.36</td><td> 73.7</td><td> 8.03</td><td> 15.7</td><td> 3310</td><td> 0.124</td><td> 40. 9</td>

<td>C31129</td><td> 461</td><td> 415000</td><td> 6.42</td><td> 40.4</td><td> 7.91</td><td> 20.2</td><td> 5030</td><td> 0.127</td><td> 41.</td>

<td>Group A</td><td>ID animals</td><td>V/F (mL/k g)</td><td>AUC (Hr*ng/mL)</td><td>Absorption HL (Hr)</td><td>HL Terminal (Hr)</td><td>CL/F (mL/Hr/ kg)</td><td>Tma X (Hr)</td><td>Cmax (ng/m L)</td><td>AUC/D (Hr* kg/ mL)</td><td>F( %)</td>

<td>Fc</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 6</td>

<td></td><td>C41410</td><td> 147</td><td> 262000</td><td> 11.5</td><td> 32.6</td><td> 3.12</td><td> 26.7</td><td> 3160</td><td> 0.0799</td><td> 26. 3</td>

<td></td><td>N</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td>

<td></td><td>Mean value</td><td> 487</td><td> 362000</td><td> 7.08</td><td> 48.9</td><td> 6.36</td><td> 20.9</td><td> 3830</td><td> 0.110</td><td> 36. 3</td>

<td></td><td>SD</td><td> 354</td><td> 86100</td><td> 4.08</td><td> 21.8</td><td> 2.8</td><td> 5.51</td><td> 1040</td><td> 0.0263</td><td> 8.6 7</td>

<td></td><td>SE</td><td> 205</td><td> 49700</td><td> 2.36</td><td> 12.6</td><td> 1.62</td><td> 3.18</td><td> 598</td><td> 0.0152</td><td> 5.0 0</td>

<td></td><td>Geometric mean</td><td> 387</td><td> 354000</td><td> 6.27</td><td> 46</td><td> 5.83</td><td> 20.4</td><td> 3750</td><td> 0.108</td><td> 35. 5</td>

<td></td><td>Geometric mean CV%</td><td> 110</td><td> 26.4</td><td> 67.6</td><td> 44.2</td><td> 58.3</td><td> 27</td><td> 25.9</td><td> 26.5</td><td> 26. 5</td>

Table 25. PK analysis of rFIXFc after single-dose subcutaneous injection in macaque monkeys

<td>rFIXFc (IU/kg)</td><td></td><td>AUC (Hr*ng/mL)</td><td>Half-life aps (Hr)</td><td>Elim. Half-life (Hr)</td><td>CL/F (mL/Hr /kg)/%</td><td>Tmax (Hr)</td><td>Cmax (ng/mL)</td><td>F(%)</td>

<td rowspan="2"> 50</td><td>Geo. Mean value</td><td> 99.000</td><td> 7.72</td><td> 57.9</td><td> 8.28</td><td> 25.7</td><td> 860</td><td> 39.7</td>

<td>CV% Geo. sr</td><td> 15.8</td><td> 16.4</td><td> 39.4</td><td> 15.8</td><td> 2.68</td><td> 21.7</td><td> 15.9</td>

<td>rFIXFc (IU/kg)</td><td></td><td>AUC (Hr*ng/mL)</td><td>Half-life aps (Hr)</td><td>Elim. Half-life (Hr)</td><td>CL/F (mL/Hr /kg)/%</td><td>Tmax (Hr)</td><td>Cmax (ng/mL)</td><td>F(%)</td>

<td rowspan="2"> 100</td><td>Geo. Mean value</td><td> 221.959</td><td> 5.71</td><td> 43.8</td><td> 7.38</td><td> 19.2</td><td> 2.585</td><td> 44.5</td>

<td>CV% Geo. sr</td><td> 9.89</td><td> 15.5</td><td> 16.5</td><td> 9.70</td><td> 4.78</td><td> 19.8</td><td> 10.0</td>

<td rowspan="2"> 200</td><td>Geo. Mean value</td><td> 354.000</td><td> 6.27</td><td> 46</td><td> 5.83</td><td> 20.4</td><td> 3.750</td><td> 35.5</td>

<td>CV% Geo. sr</td><td> 26.4</td><td> 67.6</td><td> 44.2</td><td> 58.3</td><td> 27</td><td> 25.9</td><td> 26.5</td>

Bioavailability ranged from 35.5 to 44.5% for rFIXFc

The elimination half-life ranged from 43.8 to 57.9 hours for rFIXFc.

Table 26. Dosing guidelines for rFIXFc therapy in hemophilia B

<td>Type of hemorrhage</td><td>Required level of factor IX (%)</td><td colspan="2">Dose frequency (hours)</td>

<td>Hands</td><td></td><td colspan="2"></td>

<td>Epistaxis</td><td></td><td colspan="2"></td>

<td>Hemarthrosis, uncomplicated</td><td> 20-30</td><td colspan="2"> 48</td>

<td>Superficial muscle</td><td> 20-30</td><td colspan="2"> 48</td>

<td>Superficial soft tissue</td><td> 20-30</td><td colspan="2"> 48</td>

<td colspan="2">Moderate</td><td></td><td></td>

<td colspan="2">Epistaxis</td><td></td><td></td>

<td colspan="2">Intramuscular with dissection</td><td> 25-50</td><td> 48</td>

<td colspan="2">Soft tissue with dissection</td><td> 25-50</td><td> 48</td>

<td colspan="2">Mucous membranes</td><td> 25-50</td><td> 48</td>

<td>Type of hemorrhage</td><td>Required factor IX level (%)</td><td colspan="2">Dose frequency (hours)</td>

<td>Hands</td><td></td><td colspan="2"></td>

<td colspan="2">Tooth practice</td><td> 25-50</td><td> 48</td>

<td colspan="2">Hematuria</td><td> 25-50</td><td> 48</td>

<td colspan="2">Hemarthroses, with limited movement</td><td> 40-80</td><td> 48</td>

<td>Big</td><td></td><td></td>

<td>Epistaxis</td><td> 50-100</td><td> 24-48</td>

<td>Farinks</td><td> 50-100</td><td> 24-48</td>

<td>Retrofarinks</td><td> 50-100</td><td> 24-48</td>

<td>I returned the tone.</td><td> 50-100</td><td> 24-48</td>

<td>Operation</td><td> 50-100</td><td> 24-48</td>

<td>CNS</td><td> 50-100</td><td> 24-48</td>

<td colspan="3">The patient should consult with their doctor, but should only take 1 follow-up dose no less than 24-48 hours after the initial dose.</td>

Tables 27A and 27B. Comparison of data using the calculations in (A) Example 1 and (B) Example 11.

<td>A</td><td colspan="12"></td>

<td rowspan="2"></td><td rowspan="2">Dose (Ш/ kg)</td><td colspan="11">Parameter (mean±SD)</td>

<td>n</td><td>Cmax (IU/dL )</td><td>AUCi NF (hlU/dL)</td><td>CL (mL/h /kg)</td><td>Vss (mL/ kg)</td><td>MRT (h)</td><td>Tl/2a (h)</td><td>Tl/2 3(h)</td><td>Incremen tal efficiency (IU/dL PO IU/kg) *</td><td>C168h (IU/dL)t</td><td>Time to 1% above initial value</td>

<td></td><td></td><td></td><td colspan="2"></td><td colspan="2"></td><td colspan="2"></td><td></td><td colspan="2"></td><td colspan="2"></td><td></td><td></td><td colspan="2"></td><td>(and)i</td>

<td rowspan="4"></td><td> 25</td><td> 1</td><td colspan="2"> 19.9</td><td colspan="2"> 753</td><td colspan="2"> 3.62</td><td> 275</td><td colspan="2"> 76.0</td><td colspan="2"> 1.20</td><td> 54.0</td><td> 0.77</td><td colspan="2"> 1.09</td><td> 7.28</td>

<td> 50</td><td> 5</td><td colspan="2"> 41.6± 8.97 /8.98</td><td colspan="2"> 1630 ±750</td><td colspan="2"> 3.77± 1.12</td><td> 264± 77.6</td><td colspan="2"> 71.7± 13.0</td><td colspan="2"> 1.79± 1.19</td><td> 52.1 ±10. 4</td><td> 0.86±0. 22</td><td colspan="2"> 2.23±1.40</td><td> 9.29± 1.98</td>

<td> 100</td><td> 5</td><td colspan="2"> 98.2± 8.21 /8.23</td><td colspan="2"> 3930 ±893</td><td colspan="2"> 2.89± 0.615</td><td> 179± 31.1</td><td colspan="2"> 62.8± 8.82</td><td colspan="2"> 9.99± 4.99</td><td> 52.5 ±10. 1</td><td> 1.02±0. 11</td><td colspan="2"> 4.38±1.53</td><td> 11.6± 1.97</td>

<td> 25- 100</td><td> 1 1</td><td colspan="2">NA§</td><td colspan="2">NA§</td><td colspan="2">ND</td><td>ND</td><td colspan="2">ND</td><td colspan="2">ND</td><td>ND</td><td>ND</td><td colspan="2">NA§</td><td>NA§</td>

<td colspan="19">V</td>

<td rowspan="2">Dose (IU/kg)</td><td colspan="18">Parameter (mean±SD) (range)</td>

<td>n</td><td colspan="2">c '-'max (IU/d L)</td><td colspan="2">AUCi NF (hlU/dL)</td><td colspan="2">CL (mL/h /kg)</td><td colspan="3">Vss (mL/kg)</td><td colspan="2">MRT (h)</td><td colspan="2">Tl/2a_D( h)</td><td>T1/2b (h)</td><td>Increm ental efficiency (lU/dL PO IU/kg) *</td><td>C168 h (IU/ dL)t</td><td>Time to 1% above initial value (days)*</td>

<td> 25</td><td> 1</td><td colspan="2"> 20.4</td><td colspan="2"> 766</td><td colspan="2"> 3.56</td><td colspan="3"> 271</td><td colspan="2"> 76.2</td><td colspan="2"> 0.61</td><td> 53.5</td><td> 0.77</td><td> 1.11</td><td> 7.3</td>

<td> 50</td><td> 5</td><td colspan="2"> 47.5± 12.8 (33.061.1)</td><td colspan="2"> 1700 ±550 (1300 2660)</td><td colspan="2"> 3.44± 0.84 (2.05- 4.18)</td><td colspan="3"> 262±55.4 (163-296)</td><td colspan="2"> 76.8± 6.7 (67.985.9)</td><td colspan="2"> 3.4±3.4 (0.138.72)</td><td> 57.5±8. 2 (47.967.2)</td><td> 0.87±0. 21 (0.631.12)</td><td> 2.46 ± 0.89 (1.6 3-</td><td> 10.1 ± 1.5 (8.412.3 )</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 3.92 )</td><td></td>

<td> 100</td><td> 5</td><td> 98.5± 7.9 (90.8110)</td><td> 4020 ±986 (3090 5130)</td><td> 2.84± 0.66 (2.13- 3.55)</td><td> 183±27.9 (162-221)</td><td> 65.9± 10.3 (53.276.5)</td><td> 10.3±5. 6 (3.97- 16.6)</td><td> 56.5±1 4.1 (42.474.5)</td><td> 1.02±0. 11 (0.891.18)</td><td> 4.65 ± 1.73 (3.0 86.85 )</td><td> 12.3 ±2.5 (9.915.0 )</td>

<td> 25- 100</td><td> 11</td><td>THAT^§</td><td>NA§</td><td> 3.18 ± 0.78 (2.05- 4.18)</td><td> 227 ± 58.6 (162-296)</td><td> 71.8± 10.0 (53.2- 85.9)</td><td>NA§</td><td> 56.7 ± 10.9 (42.4- 74.5)</td><td> 0.93 ± 0.18 (0.631.18)</td><td>NA§</td><td>THAT^§</td>

<td colspan="12">Results are presented as mean ±SD with range indicated in parentheses C_max indicates maximum concentration; AUC_INF, area under the curve (from time zero extrapolated to infinite time); CL, clearance; Vss, volume of distribution at steady state; MRT, mean retention time; Tl/2n, distribution half-life; Tl/2n, elimination half-life; NA, not applicable * Incremental utilization was calculated using the observed C_max value reduced by the initial value before treatment and divided by the dose t Plasma FIX activity above baseline at 168 hours (7 days) post-dose t Model predicted time after dose when FIX activity decreased to 1 ПЈ/dL above the subject's baseline value^§ The data are not applicable because the parameters are not dose independent, and therefore mean and SD values were not calculated across different dose groups.</td>