Factor ix polypeptides and methods of use thereof
Abstract
The present invention provides methods of administration of Factor IX, methods of administration of chimeric and hybrid polypeptides comprising Factor IX, chimeric and hybrid polypeptides comprising Factor IX, polynucleotides encoding such chimeric and hybrid polypeptides, cells comprising such polynucleotides, and methods for producing such chimeric and hybrid polypeptides using such cells.

Term
6.3 yearsleft in the term
Expires 8 January 2033.
- Priority
- Filed
- Granted
- Today
- Expires
19 claims: 14 independent, 5 dependent
- 1Uso de un polipéptido quimérico del Factor IX (FIX) que comprende FIX humano y un compañero de unión de FcRn (FcRn BP) para la elaboración de un medicamento para reducir la frecuencia de sangrado espontáneo en un sujeto humano con hemofilia B en necesidad del mismo, en donde el polipéptido quimérico FIX es administrado de forma intravenosa al sujeto en múltiples dosis de 25 lU/kg a 50 lU/kg en un intervalo de dosificación de 7 días entre dos dosis, en donde el FcRn BP es Fe humano o albúmina humana.
- 2El uso de conformidad con la reivindicación 1, en donde el polipéptido quimérico FIX exhibe una o más características seleccionadas del grupo que consiste en:a. una recuperación gradual (Valor K) (actividad;observada) de 0.62-1.17 lU/dl per lU/kg;b. un aclaramiento (CL) (actividad) de 1.84-4.58 mL/hora/kg;c. un tiempo medio de residencia (MRT) (actividad) de 53.1-85.8 horas;d. un ti/2beta (actividad) de 40-67.4 horas;e. un Vss (actividad) de 145-365 mL/kg;IMPI 172 INSTITUTO MEXICANO DE LA PROPIEDAD INDUSTRIAL f. un AUC/dosis de 21.80-54.30 IU*h/dl por lU/kg;y g. cualquier combinación de los mismos.
- 3El uso de conformidad con la reivindicación 1 ó 2, en donde cada una de las múltiples dosis es 25 lU/kg a 40 lU/kg.
- 4El uso de conformidad con cualquiera de las reivindicaciones 1 a 3, en donde cada una de las múltiples dosis es 25 lU/kg, 30 lU/kg, 35 lU/kg, 40 lU/kg, 45 lU/kg, o 50 lU/kg.
- 5El uso de conformidad con cualquiera de las reivindicaciones 1 a 3, en donde cada una de las múltiples dosis es 25 lU/kg.
- 6El uso de conformidad con cualquiera de las reivindicaciones 1 a 3, en donde cada una de las múltiples dosis es 30 lU/kg.
- 7El uso de conformidad con cualquiera de las reivindicaciones 1 a 3, en donde cada una de las múltiples dosis es 35 lU/kg.
- 8El uso de conformidad con cualquiera de las reivindicaciones 1 a 3, en donde cada una de las múltiples dosis es 40 lU/kg.
- 9El uso de conformidad con cualquiera de las reivindicaciones 1 a 3, en donde cada una de las múltiples dosis es 45 lU/kg. IMPI 173 INSTITUTO MEXICANO DE LA PROPIEDAD INDUSTRIAL
- 10El uso de conformidad con cualquiera de las reivindicaciones 1 a 3, en donde cada una de las múltiples dosis es 50 lU/kg.
- 11El uso de conformidad con cualquiera de las reivindicaciones 1 a 10, en donde el sujeto necesita control de sangrado en hemorragia menor, hemartrosis, hemorragia de músculo superficial, hemorragia de tejido blando, hemorragia moderada, hemorragia intramuscular o de tejido blando con disección, hemorragia de la membrana mucosa, hematuria, hemorragia masiva, hemorragia de la faringe, hemorragia de la retrofaringe, hemorragia retroperitoneal, hemorragia del sistema nervioso central, hematomas, cortes, raspaduras, hemorragia de las articulaciones, sangrado por la nariz, sangrado por la boca, sangrado por las encías, sangrado intracraneal, sangrado intraperitoneal, hemorragia espontánea menor, sangrado luego de una lesión importante, hematomas moderados en la piel, o hemorragia espontánea en las articulaciones, músculos, órganos internos o el cerebro.
- 12El uso de conformidad con cualquiera de las reivindicaciones 1 a 11, en donde el sujeto necesita tratamiento para hemartrosis, sangrado muscular, sangrado oral, hemorragia, hemorragia en músculos, hemorragia oral, traumatismo, trauma capitis, sangrado gastrointestinal, hemorragia intracraneal, hemorragia intraabdominal, hemorragia intratorácica, fractura ósea, sangrado en el IMPI 174 INSTITUTO MEXICANO DE LA PROPIEDAD INDUSTRIAL sistema nervioso central, sangrado en el espacio retrofaríngeo, sangrado el espacio retroperitoneal, o sangrado en la envoltura del músculo iliopsoas.
- 13El uso de conformidad con cualquiera de las reivindicaciones 1 a 12, en donde el FIX es idéntico a aminoácidos 1 a 415 de SEQ ID NO:2.
- 14El uso de conformidad con cualquiera de las reivindicaciones 1 a 13, en donde el FcRn BP comprende Fe.
- 15El uso de conformidad con cualquiera de las reivindicaciones 1 a 13, en donde el FcRn BP comprende albúmina. 16 El uso de conformidad con la reivindicación 14, en donde el Fe es idéntico a aminoácidos 1 a 227 de SEQ ID NO:4.
- 1617. El uso de conformidad con cualquiera de las reivindicaciones 1 a 16, en donde el polipéptido quimérico FIX además comprende un enlazador que une el FIX y el FcRn BP.
- 1718. El uso de conformidad con la reivindicación 17, en donde el enlazador une FIX al extremo terminal N de la albúmina humana.
- 1819. El uso de conformidad con la reivindicación 1, en donde el nivel de plasma del polipéptido quimérico FIX en el sujeto alcanza una concentración mínima de al menos 1 lU/dl después de al menos 6 días después de la IMPI 175 INSTITUTO MEXICANO DE LA PROPIEDAD INDUSTRIAL administración, en donde actividad en plasma de FIX se mide por un ensayo de coagulación de una etapa que determina un tiempo activado de tromboplastina parcial.
- 1920. El uso de conformidad con cualquiera de las 5 reivindicaciones 1 a 19, en donde el sujeto exhibe la actividad en plasma de FIX por encima de 1 lU/dl durante el intervalo de dosificación como se midió por un ensayo de coagulación de una etapa que determina un tiempo activado de tromboplastina parcial.
Independent claims19
1,637 paragraphs in 251 sections, as filed
MEXICAN INSTITUTE or INDUSTRIAL PROPERTY
PATENT TITLE No. 375112
Owner(s): BIOGEN HEMOPHILIA INC.
Address: 250 Binney Street, Cambridge, Massachusetts, 02142, USA
Name: FACTOR IX POLYPEPTIDES AND METHODS FOR USING THEM.
Classification: CIP: A61K38/36; A61K38/38; A61K38/48; A61K39/395
CPC: A61K38/36; A61K38/38; A61K38/4846; A61K39/39533
Inventor(s): GLENN PIERCE; SAMANTHA TRUEX; ROBERT T. PETERS; HAIYAN-JIANG
REQUEST
Number: International Filing Date:
MX/a/2017/008224 July 11, 2011
Divisional Patent Number: 356527
PRIORITY*
<td>Country:</td><td>Date:</td><td>Number:</td>
<td>US</td><td>July 9, 2010</td><td> 61/363,064</td>
<td>US</td><td>December 17, 2010</td><td> 61/424,555</td>
Validity: Twenty years
Expiration Date: July 11, 2031
Issue Date: September 21, 2020
The reference patent is granted based on articles 1<sup>either</sup>, 2<sup>either</sup> fraction V, 6<sup>either</sup> section III, and 59 of the Industrial Property Law.
In accordance with article 23 of the Industrial Property Law, this patent is valid for twenty years, non-renewable, counted from the date of filing of the international application and will be subject to the payment of the fee to keep the rights in force. .
Whoever signs this title does so based on the provisions of articles 6<sup>either</sup> fraction III, 7<sup>either</sup> BIS 2 and 59 of the Industrial Property Law; items 1<sup>either</sup>, 3<sup>either</sup> fraction V item a), sub item i), 4<sup>either</sup> and 12th sections I and III of the Regulations of the Mexican Institute of Industrial Property; items 1<sup>either</sup>, 3<sup>either</sup>, 4<sup>either</sup>, 5<sup>either</sup> section V item a), sub item ii), 16 items I and III and 30 of the Organic Statute of the Mexican Institute of Industrial Property; 1<sup>either</sup>, 3<sup>either</sup> and 5<sup>either</sup> subparagraph a) and penultimate paragraph, of the Agreement that delegates powers to the Deputy Directors General, Coordinator, Divisional Directors, Heads of Regional Offices, Divisional Deputy Directors, Departmental Coordinators and other subordinates of the Mexican Institute of Industrial Property.
This official letter is signed with an advanced electronic signature (FIEL), based on articles 7 BIS 2 of the Industrial Property Law; 3 of its Regulations, and 1 section III, 2 section V, 26 BIS and 26 TER of the Agreement establishing the guidelines for the use of the Electronic Payment and Services Portal (PASE) of the Mexican Institute of Industrial Property, in the procedures indicated.
<img file="MX375112B_D0001.tif" />
DIVISIONAL DEPUTY DIRECTOR OF SUBSTANTIVE EXAMINATION OF PATENT AREAS BIOTECHNOLOGY, PHARMACEUTICAL AND CHEMICAL
EMELIA HERNANDEZ PRIEGO
Original string:
EMELIA HERNANDEZ PRIEGO|00001000000405397295|Administration Service
Tax|56||MX/2020/72468|MX/a/2017/008224|Normal patent title with PCT divisional|1223|GAGV|Page(s) 2|8P9G04Z9cREpUKuNgSErmKeQMvg=
Digital stamp:
EMcc3pwuu/SZeZj+M+W9aDU5Pud64EHfmK2gkeb8jlAAFoetdqW/2ikGVCmKbwuAtZhlavhjUCvraPMNRvV6BRjA4M lwwuxYxvQo6w/XIPF10AtUVKICSv/mJeC9GiqPmhf+0BFPOIKDjKa0AVzQG2BwcYxfka2KXZRXCipdkSK7gLXP8s/T BipQyCquto/3Kmbt9ZbmF9Vllr1NKNDZard/fQQUM1vEZFupFvXQ84nFwfRaRln/0YT/Lknb4rf+8rvf61NnmbekPE w4GgKHM/PMsAqXuDgBIHeteNOYAkW6/7HIFkrzhMBOzUzokl8qm9blwleqnmSELeuF11STKA== * Información adicional en la siguiente página.
MX/2020/72468 www.gob.mx/impi
Arenal No. 550, Pueblo Santa María Tepepan, Mexico City, CP 16020. CDMX
Creativity for Wellbeing
<img file="MX375112B_D0002.tif" />
ECONOMY
<img file="MX375112B_D0003.tif" />
IMPI
2020, Year of Leona Vicario, Meritorious Mother of the Country
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Continuation Priorities
Country: Date: Number:
<td>US</td><td>January 7, 2011</td><td> 61/430,819</td>
<td>US</td><td>February 1, 2011</td><td> 61/438,572</td>
<td>US</td><td>February 11, 2011</td><td> 61/442,079</td>
<td>US</td><td>April 1, 2011</td><td> 61/470,951</td>
www.gob.mx/impi
Arenal No. 550, Pueblo Santa María Tepepan, Mexico City, CP 16020. CDMX
Creativity for Wellbeing
<img file="MX375112B_D0004.tif" />
IMPI
- 1 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
FACTOR IX POLYPEPTIDES AND METHODS OF USING THEM
field of invention
In general terms, the present invention relates to the field of treatment of hemostatic disorders.
Background of the Invention
Hemophilia B (also known as Christmas disease) is one of the most commonly inherited bleeding disorders in the world. This has as a consequence the decrease of the coagulant activity in vivo and in vitro and requires extensive medical follow-up throughout the life of the affected individual. In cases in which no intervention was made, the affected individual would suffer spontaneous hemorrhages in the joints, which produce acute pain and debilitating immobility, also hemorrhages in the muscles prevail, which would result in the accumulation of blood in those tissues; spontaneous bleeding in the throat and neck that could lead to suffocation if not treated immediately; renal hemorrhage and acute hemorrhage 20 after surgery, minor accidental injuries or dental extractions.
At a minimum, normal blood coagulation in vivo requires the serine proteases factors II (prothrombin), VII, IX, X, and XI (soluble plasma proteins); cofactors that include the transmembrane protein tissue factor and REF: 27S29D
<img file="MX375112B_D0005.tif" />
IMPI
-2MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY plasma proteins Factors V and VIII; fibrinogen, Factor XIII transglutaminase, phospholipid (including activated platelets), and calcium. Additional proteins including kallikrein, high molecular weight kininogens, and factor XII are required for some coagulation assays and may play a role in vivo in pathological conditions.
In hemophilia, blood coagulation is disturbed by a lack of certain plasma coagulation factors. Hemophilia B is caused by a deficiency of Factor IX which can be due to either decreased synthesis of Factor IX protein or a defective molecule with reduced activity. Hemophilia is treated by replacing the missing coagulation factor with endogenous factor concentrates highly enriched in Factor IX. However, the generation of such a blood concentrate presents technical difficulties, as described below.
Purification of Factor IX from plasma (plasma-derived Factor IX, pdFIX) produces almost exclusively active Factor IX. However, such purification of factor IX from plasma is very difficult since Factor IX is only present in low concentration in plasma (5 pg/mL. Andersson, Thrombosis Research 7: 451-459 (1975). Additionally, purification from the blood requires the removal or
<img file="MX375112B_D0006.tif" />
IMPI
-3MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY inactivation of infectious agents such as HIV and HCV. Furthermore, pdFIX has a short half-life and therefore requires frequent dosing. Recombinant factor IX (rFIX) is also available, but suffers from the same short half-life and the need for frequent dosing (eg, 2-3 times per week for prophylaxis) as pdFIX. Also, rFIX exhibits a lower gradual recovery (K value) compared to pdFIX, and requires the use of higher doses of rFIX than those for pdFIX.
Reduction in mortality, prevention of joint damage and improvement in quality of life have been some of the important achievements due to the development of recombinant and plasma-derived Factor IX. Prolonged bleeding protection would represent another key advance in the treatment of patients with haemophilia B. However, no products have been developed to date that allow for prolonged protection. Therefore, there remains a need for improved methods of treating hemophilia caused by Factor IX deficiency that are more tolerable and more effective than current therapies.
Brief Description of the Invention
The present invention provides methods of administering Factor IX that employ chimeric polypeptides comprising Factor IX and hybrids of such chimeric polypeptides, chimeric polypeptides comprising
<img file="MX375112B_D0007.tif" />
IMPI
-4INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL comprise Factor IX and hybrids of such chimeric polypeptides, polynucleotides encoding such chimeric and hybrid polypeptides, cells comprising such polynucleotides, and methods for producing such chimeric and hybrid polypeptides using such cells. In some embodiments the Factor IX chimeric polypeptide is a Factor IX FcRn chimeric binding partner (BP) polypeptide such as a Factor IX Fe chimeric polypeptide. In other embodiments, the Factor IX chimeric polypeptide is a Factor IX-XTEN polypeptide.
The present invention provides a method of administering Factor IX to a subject in need thereof comprising administering to the subject a dose of at least about 10, at least about 20, or at least about 25 IU/kg of a polypeptide. Factor IX FcRn chimeric BP, eg, a Factor IX-Fc chimeric polypeptide or a Factor IX-XTEN chimeric polypeptide, at least about once weekly or greater dosage intervals.
In some embodiments, the plasma level of a chimeric polypeptide reaches an average trough concentration of at least about 1 IU/dl after at least about 6 days by at least about 70%, at least about 80%, at minus about 90%, or about
<img file="MX375112B_D0008.tif" />
IMPI
-5MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
100% of a patient population reaches a trough concentration of at least about 1, 2, 3, 4, or 5 IU/dl after at least about 6 days in one subject. In some embodiments, the plasma level of the chimeric polypeptide reaches an average trough concentration of about 1-5 or 1-3 IU/dl. The minimum concentration or average minimum concentration can be reached after about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15 , about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about of 28, around 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39 or about 40 days.
In some embodiments the chimeric polypeptide exhibits greatly reduced phosphorylation and sulfation compared to plasma-derived Factor IX. In some embodiments, the chimeric polypeptide is less than 25% phosphorylated and less than 25% sulfated, eg, less than 25% fully phosphorylated and sulfated. In some embodiments, the chimeric polypeptide is
<img file="MX375112B_D0009.tif" />
IMPI
-6 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY less than about 10% phosphorylated and less than about 9% sulfated. In some embodiments, the chimeric polypeptide has a gamma carboxylation pattern/distribution, gamma carboxylation content, sialylation pattern/distribution, and/or sialylation content similar to {i.e., within 10% of) or the same as those of the chimeric Factor IX Fe polypeptide in Examples 5-6.
In some embodiments, the chimeric polypeptide has a gradual recovery greater than 0.7 or greater than 0.75 pg/ml or (antigen). In some embodiments, the chimeric polypeptide has an average (activity; observed) graded recovery (K value) of at least about 0.8, at least about 0.9, or at least about 1 IU/dL per IU/kg.
In some embodiments, the chimeric polypeptide exhibits one or more pharmacokinetic parameters in the patient population or in the subject, selected from the group consisting of:
(a) an average clearance (CL) (activity) in the patient population of about 3.36 +
0.93 mL/hour/kg, an average clearance (CL) (activity) in the patient population of about 3.0-3.72, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, or 3.72 mL/hour/kg , an average clearance (CL) (activity) in the patient population that is 2.5 times lower than the clearance of a
<img file="MX375112B_D0010.tif" />
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY polypeptide comprising Factor IX without the FcRn BP, a clearance (CL) (activity) in the subject of about 1.84-4.58 mL/hour/kg;
(b) an average mean residence time (MRT) in the patient population of at least around 68.05 + 11.16 hours, an average MRT (activity) in the patient population of around 60-78, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78 hours, an average TMR (activity) in the patient population that is about fold greater than the average TMR of a polypeptide comprising Factor IX without the FcRn BP, a mean residence time (MRT) (activity) in the subject of about 53.1-85.8 hours, a mean residence time (MRT) (activity) in the subject of at least about 45, about 50, about 55 , about 60, about 65, about 70, about 75, about 80, about 85 or about 90 hours;
(c) an average ti/2beta (activity) in the patient population of about 52.5 ± 9.2 hours; a you/<sub>2be</sub>average ta (activity) in the patient population that is about 47-60 hours, about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54 , about 55, about 56, about 57, about 58, about 59, about 60 hours; a you/<sub>2</sub>average beta (activity)
<img file="MX375112B_D0011.tif" />
IMPI
-8 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY in the patient population that is approximately 3 times greater than the ti/<sub>2beta</sub> average of a polypeptide comprising Factor IX without the FcRn BP, a ti/<sub>2be</sub>rt (activity) in the subject of about 40-67.4, about 40, about 45, about 50, about 55, about 60, about 65, about 70 or about 75 hours;
(d) a gradual recovery (K value) (activity, observed) in the patient population of about 0.93 ± 0.18 IU/dL per IU/kg; a gradual recovery (K value) (activity , observed) in the patient population of
<td>around</td><td>of</td><td> 0.85-1.</td><td>0, around 0.85,</td><td>around</td><td>of 0.86,</td>
<td>around</td><td>of</td><td> 0.87,</td><td>around 0.88,</td><td>around</td><td>of 0.89,</td>
<td>around</td><td>of</td><td> 0.90,</td><td>around 0.91,</td><td>around</td><td>of 0.92,</td>
<td>around</td><td>of</td><td> 0.93,</td><td>around 0.94,</td><td>around</td><td>of 0.95,</td>
<td>around</td><td>of</td><td> 0.96,</td><td>around 0.97,</td><td>around</td><td>of 0.98,</td>
<td>around</td><td>of</td><td> 0.99,</td><td>around 1.0,</td><td>around</td><td>of 1.05,</td>
<td>around</td><td>of</td><td>1.10 or</td><td colspan="3">about 1.15 IU/dL per IU/kg; a</td>
<td colspan="2">Recovery</td><td>gradual</td><td colspan="3">(K value) (activity, observed) in the</td>
about 24% better than the patient population that is average gradual recovery of a polypeptide comprising Factor IX without the FcRn BP; a gradual recovery (K value) (activity; observed) in the subject of about 0.621.17 IU/dL per IU/kg;
(e) an average Vss (activity) in the patient population of about 226 + 67.76 (corrected to
69.8) mL/kg; an average Vss (activity) in the patient population of about 200-300, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, or about 300 mL/kg; a Vss (activity) in the subject of about 145-365 mL/kg;
(f) an average AUC/dose (activity) in the patient population of about 32.44 + 10.75 IU*h/dL per IU/kg; an average AUC/dose (activity) in the patient population of about 26-40, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, or about 40 IU*h/dL per IU/kg; an average AUC/dose (activity) in the subject of about 21.80-54.30 IU*h/dL per IU/kg.
In some embodiments, the chimeric polypeptide dose contains a significantly (10-100 fold) lower level (0.01-0.001%) of activated FIX (FlXa) than Factor IX products such as MONONINE™ (pdFIX; CSL Behring)) or BENEFIX™ (Wyeth; rFIX) (0.1%) currently commercially available. Such level may be 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 times lower than in currently marketed products, or 0.01, 0.05, 0.0033, 0.0025, 0.002,
<img file="MX375112B_D0012.tif" />
IMPI
- 10 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
0.00167, 0.00142, 0.00125, 0.00111 OR 0.001%.
In some embodiments the dosage range is 6-18, 6-10, 9-18, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, 5 at least 14, at least 15, at least 16, at least 17 or at least 18 days, weekly, twice a month or once a month. The dosage range may be a prophylactic dosage range, a fixed prophylactic dosage range, or an individual prophylactic dosage range.
The methods of the invention are practiced in a subject in need of control or prevention of bleeding or bleeding episodes, in need of intermittent treatment, in need of prophylactic treatment, or in need of on-demand treatment.
The therapeutic doses used in the methods of the invention are about 25-180, about 20-180, about 20-50, about 20-100, about 10-180, about 10-50, about 10 -30 or about 50-100 20 IU/kg. The dose can be a fixed or individual dose.
In some embodiments, the chimeric polypeptide is administered intravenously or subcutaneously.
The subject in the methods of the invention may be a human subject or may be a non-human mammal. Non-human mammals include mice, dogs, primates,
<img file="MX375112B_D0013.tif" />
IMPI
-11 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY monkeys, cats, horses, cows, pigs, and other domestic animals and small animals.
The chimeric polypeptide may be in the form of a hybrid comprising a second polypeptide associated with the chimeric polypeptide, where the second polypeptide comprises or consists essentially of an FcRn BP, eg an Fe. The chimeric polypeptide can be at least 90%, at least 95%, or 100% identical to the Factor IX sequence, the Fe sequence, or both the Factor IX and Fe sequences in Tables 2A (SEQ ID NO: 2) and/or 2B (SEQ ID NO: 4), with or without the signal sequence(s) and propeptide.
The chimeric or hybrid polypeptide can be administered as part of a pharmaceutical composition comprising at least one excipient.
In addition, the invention provides the above-described chimeric and hybrid polypeptides themselves, polynucleotides encoding them, cultured human embryonic cells comprising polynucleotides, and methods of producing such chimeric and hybrid polypeptides, and polypeptides produced by such methods.
Brief Description of the Figures
FIG. 1. Schematic of one type of chimeric Factor IX polypeptide, a hybrid of Factor IX-Fc.
FIG. 2. Group average FIXFc concentration according to
<img file="MX375112B_D0014.tif" />
IMPI
- 12MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY of time profiles; comparison of nominal doses.
FIG. 3. Group average FIXFc activity as a function of time profiles; comparison of nominal doses.
FIG. 4. Reference value subtraction decision tree,
FIG. 5. Dose proportional increase in Cmax and AUC for FIX activity.
FIGS. 6A-6B. Estimated therapeutic duration of rFIXFc at 50 (fig. 6A) and 100 (fig. 6B) IU/kg.
FIG. 7. Dose proportional increase in Cmax and AUC for FIX antigen.
FIGS. 8A-8B. Pharmacokinetic estimates for rFIXFc antigen at nominal doses of 50 (fig. 8A) and 100 (fig. 8B) IU/kg.
FIG. 9. Excellent correlation between rFIXFc activity and antigen levels. It should be noted that due to reheating of the PK activity, as mentioned in Example 11, R<sup>2</sup> = 0.946.
FIG, 10. Post-translational and domain structure modifications of rFIX-Fc. PRO: Propeptide cleaved by processing enzyme. GLA: contains 12 γ-carboxylated glutamic acid (Gla) residues, ACT ΡΞΡ: activation peptide cleaved to provide active protease. Other modifications: N- and O-glycosylation, Asp(64) β-hydroxylation, Tyr sulfation, Ser phosphorylation.
<img file="MX375112B_D0015.tif" />
IMPI
-13 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
FIG. 11. SDS-PAGE gel of purified FIXFc monomers and purification intermediates. Samples from different steps in FIXFc purification were analyzed by non-reducing SDSPAGE. Lane 1: SeeElue Plus molecular weight markers (Invitrogen). Lane 2: Empty lane. Lane 3: Protein A loading. Lane 4: Protein A eluate. Lane 5: DEAE fractogel eluate. Lane 6: Eluate Q Seph FF. Lane 7: bulk final FIXFc. Lane 8: Empty lane. Lane 9: Bulk final reduced FIXFc.
FIG. 12. Functional activity of FIXFc in FIX-deficient mice. At time = 0, intravenous doses of 219 IU/kg FIXFc (3 or 4 per group, 6 groups, n = 23) or 200 IU/kg rFIX (3 or 4 per group, 5 groups, n = 23) were administered to mice. with FIX deficiency. Blood samples were collected at various time points after dosing (0.25 hours to 96 hours) and analyzed for clotting activity by FIX activity assay. *rFIX activity is not detectable in all mice later than 48 hours after dosing.
FIG. 13. FIXFc whole blood clotting time as a function of recombinant FIX in FIX-deficient mice. Intravenous doses of 50 IU/kg FIXFc or 50 IU/kg rFIX were administered to FIX-deficient mice (6 per group). Blood samples were collected before dosing and at various times after
<img file="MX375112B_D0016.tif" />
IMPI
-14MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY her. Blood samples were incubated at 37°C and visually checked once per minute for the presence of a blood clot. The time required for clot formation was recorded and, once the clotting activity returned to baseline (i.e., no clot formation), no additional samples were obtained (samples were collected 15 minutes to 144 hours). for FIXFc or 15 minutes to 72 hours for rFIX).
FIGS. 14A-14B. Pharmacodynamics of FIXFc in FIX-deficient mice. Doses of 219 IU/kg FIXFc (5 or 6 per group, 6 groups, n = 30) or 200 IU/kg rFIX (4 or 5 per group, 6 groups, n » 28) were administered on days 0, 4 and 8 to FIX-deficient mice. Plasma samples were collected by cardiac puncture 15 minutes and 96 hours after each dose and clotting activity was measured by FIX activity assay. Plasma was also collected by tail bleed at 8, 24, 48, and 72 hours after each dose. FIXFc levels were measured in all samples using FIXFc-specific ELISA. (fig. 14A) Activity measured against activity calculated. FIXFc coagulant activity was measured by FIX activity assays 15 minutes and 96 hours after three doses. The in vitro coagulant activity for FIXFc was determined to be 43.8 ± 5.4 IU/mg. This activity (Ul/mg) and the measured protein levels were taken as a basis to determine a level of
<img file="MX375112B_D0017.tif" />
IMPI
-15 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY Plasma clotting activity calculated for 15 minute, 8, 24, 48, 72 and 96 hour time points after each dose, (Fig. 14B) In FIX-deficient mice treated with up to three doses of 200 IU/kg rFIX, FIX levels were measured with FIX-specific ELISA. From the specific activities of FIXFc and rFIX measured, it was possible to compare the coagulant activity calculated for all the samples analyzed by ELISA.
FIGS. 15A-15C. Pharmacokinetics and pharmacodynamics of FIXFc in dogs with FIX deficiency. Two dogs with hemophilia B were given 140 IU/kg of FIXFc intravenously. Blood samples were taken at 5, 15, and 30 minutes and at 1, 2, 4, 6, 8, 12, 24, 27, 30, 48, 51, 54, 72, 80, 96, 126, 144 and 168 hours after the dose (fig. 15A) A sandwich ELISA assay with a FIX capture antibody and an Fc-HRP detection antibody was used to measure the concentration of intact FIXFc in plasma samples from the dog with hemophilia B. (Fig. 15B) FIX coagulant activity for all time points relative to a standard curve generated with FIXFc. (Fig. 15C) Blood taken from animals was immediately analyzed to determine the coagulation time of whole blood. Blood samples were incubated at 28°C and visually inspected once per minute for the presence of clots and the time to clot formation recorded.
<img file="MX375112B_D0018.tif" />
IMPI
-16 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
FIG. 16. Pharmacokinetics of FIXFc in Cynomolgus monkeys.
A single dose (0.5, 2, and 10 mg/kg, corresponding approximately to 25, 100, or 500 IU/kg) of FIXFc (n = 2, 3, and 3, respectively) was administered to the monkeys. Blood samples were collected at 0.25, 0.5, 1, 8, 24, 48, 72, 96, 120, 144, and 168 hours post-dose and plasma was prepared for protein concentration analysis by FIXFc-specific ELISA.
FIGS. 17A-17D. rFIXFc and BENEFIX™ exhibit comparable activity and dose response in the whole blood of HemB mice. (Fig. 17A) ROTEM® Parameters rFIX or BENEFIX™ were placed in the blood of HemB mice and coagulation parameters were measured by ROTEM®. (fig. 17B)-(fig. 17D) Dose response by measurement of (fig. 17B) CT, (fig. 17C) CFT and (fig. 17D) Alpha angle.
FIG. 18. Evaluation of acute efficiency in hemophiliac mice tail cut bleeding model.
FIGS. 19A-19B. (Fig. 19A) Blood loss caused by cutting the tail of an individual HemB mouse treated with rFIXFc or BENEFIX™. (Fig. 19B) Dose response of rFIXFc and BENEFIX™ in mean blood loss after tail docking of HemB mice.
FIG. 20. Tail Vein Cross-Sectional Bleeding (TVT) Model of HemB Mice: A Characteristic Venous Bleeding Model for
<img file="MX375112B_D0019.tif" />
IMPI
-17 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY patients with severe hemophilia.
FIGS. 21A-21D. Prolonged Activity of rFIXFc Relative to BENEFIX™ in ROTEM® Whole Blood Treated HemB Mice. (Fig. 21A) CT, (Fig. 21B) CFT, (Fig. 21C) Alpha angle and (Fig. 21D) partial correlation between whole blood (CT) coagulant Φ activity by ROTEM versus plasma activity by aPTT.
FIG. 22. Prolonged efficacy of FIXFc relative to BENEFIX™ in HemB mouse tail vein transection (TVT) model. (A) Survival: Survival rates were comparable in mice that received BENEFIX™ 24 hours prior to TVT and in mice that received rFIXFc 72 hours prior to TVT, and (B) Rebleeding: Bleeding rates were comparable in mice that received BENEFIX™ 24 hours before TVT and in mice receiving rFIXFc 72 hours before TVT.
FIG. 23. Correlation between the gradual recovery of rFIXFc activity as a function of body weight in 12 subjects who received a single dose of 12.5 to 100 IU/kg of rFIXFc.
FIGS. 24A-24C. The Monte Carlo simulation method that uses the structural PK model of rFIXFc activity to build the activity-time profiles and reach the minimum of 1 IU/dL over the reference after
<img file="MX375112B_D0020.tif" />
IMPI
-18MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY dosing regimens weekly (Fig. 24A), every 10 days (fig. 24B) or every two weeks (fig. 24C) . Population mean PK parameters and relevant between-subject and within-subject variations from the Phase 1/2a clinical study were adopted. 1000 subjects per dosing regimen were simulated with 14 to 16 sampling points for each subject, and the mean ± SD of the activity-time profiles of the 1000 subjects were plotted for different dosing regimens.
FIGS. 25A - 250. The Monte Carlo simulation method for doses of rFIXFc reaching the trough concentration of 1 IU/dL (1%) based on recalculated pharmacokinetic data, (fig. 25A) once a week, (fig. 25B) every 10 days and (fig. 25C) every two weeks.
Detailed description of the invention
The present invention provides a method of treating Factor IX deficiency, eg, hemophilia B, with Factor IX, using a smaller dosage range and/or improved pharmacokinetic parameters than is possible with Factor IX products. currently known. Also, the present invention provides chimeric Factor IX polypeptides, chimeric Factor IX polynucleotides, and methods of their production.
As used herein, administration means providing a Factor IX polypeptide.
-19IMPI to
MEXICAN INSTITUTE<sup>F</sup> OF THE PROPERTY
Pharmaceutically acceptable INDUSTRIAL M of the invention to a subject by a pharmaceutically acceptable route. Preferred routes of administration are intravenous, eg intravenous injection, and intravenous infusion, eg via central venous access. Additional routes of administration include subcutaneous, intramuscular, oral, nasal, and pulmonary administration, preferably subcutaneous. The Factor IX chimeric polypeptides and hybrid proteins can be administered as part of a pharmaceutical composition comprising at least one excipient. Some advantages of the present invention include: improved adherence to regimen, reduced breakthrough bleeding, increased protection of joints from bleeding, prevention of joint damage, reduced morbidity, reduced mortality, prolonged protection against bleeding, decreased of thrombotic events and improvement in quality of life.
As used herein, "chimeric polypeptide" means a polypeptide that includes at least two polypeptides (or portions thereof, such as subsequences or peptides) from different sources. Chimeric polypeptides can include two, three, four, five, six, seven, or more polypeptides or parts thereof from different origins, such as different genes, different cDNAs, or different animal or other species.
polypeptides
<img file="MX375112B_D0021.tif" />
IMPI
-20MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY may include one or more bonds that join different polypeptides or parts thereof. Thus, the polypeptides or parts thereof may be linked directly or may be found linked indirectly, by linkages, or arrivals, into a single chimeric polypeptide. Chimeric polypeptides can include additional peptides such as signal sequences and sequences such as 6His and FLAG that assist in protein purification or detection. In addition, chimeric polypeptides may have amino acid or peptide additions at the N-terminus and/or the C-terminus. Examples of chimeric polypeptides of the invention are Factor IX-FcRn BP chimeric polypeptides, for example, Factor IX-Fe chimeric polypeptides such as FIXFc in Figure 1, SEQ ID NO: 2 {Table 2) and Examples 1 -4, with or without its signal sequence and propeptide. Other examples of chimeric polypeptides of the invention include, but are not limited to, Factor IX-XTEN chimeric polypeptides. Factor IX can be fused to either the N-terminus or the C-terminus of ΧΤΞΝ.
The chimeric polypeptide may comprise a sequence that is at least 90% or at least 95% or at least 100% identical to Factor IX and FcRn BP, for example, the amino acid sequence of Fe presented in Table 2A si signal sequence and protein sequence. propeptide (amino acids 1 to 642 of SEQ ID NO: 2); or alternatively with propeptide sequence;
<img file="MX375112B_D0022.tif" />
IMPI
-21 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY or, alternatively, with a signal sequence and a propeptide sequence.
As used herein, 'cultivation'<sup>1</sup> and culturing mean incubating cells under in vitro conditions that allow cell reproduction or division, or maintaining cells in a living state. Cultured cells, as used herein, means cells that are propagated in vitro.
As used herein, Factor IX and FIX mean Factor IX polypeptide functional in its usual role in coagulation, unless otherwise specified. Thus, the term "Factor IX" includes variant polypeptides that are functional and polynucleotides encoding the functional variant polypeptides. Preferred Factor IX polypeptides include human, bovine, porcine, canine, feline and murine Factor IX polypeptides. The full-length polynucleotide and polypeptide sequences of Factor IX are known, as well as various functional variants, eg, fragments, mutations, and modified versions. Factor IX polypeptides include full-length Factor IX, full-length Factor IX minus N-terminal Met, full-length Factor IX minus signal sequence, mature Factor IX (minus signal sequence and propeptide), and Factor IX. Mature IX with an additional Met at the N-terminus. Preferably, Factor IX is produced by means of
<img file="MX375112B_D0023.tif" />
IMPI
-22MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY.
A large number of functional variants of Factor IX are known. International Publication Number WO 02/040544 A3, which is incorporated herein in its entirety by this reference, describes mutations exhibiting increased resistance to heparin inhibition on page 4, lines 9-30 and page 15, lines 6- 31. International Publication Number WO 03/020764 A2, which is incorporated herein in its entirety by this reference, describes Factor IX mutations with reduced T cell immunogenicity in Tables 2 and 3 (on pages 14-24) and in page 12, lines 1-27. International Publication Number WO 2007/149406 A2, which is incorporated herein in its entirety by this reference, describes Factor IX molecules with functional mutations that exhibit increased protein stability, increased in vivo and in vitro half-life, and increased resistance to proteases. on page 4, line 1, to page 19, line 11. WO 2007/149406 A2 also describe variant or chimeric molecules of Factor IX on page 19, line 12 to page 20, line 9. International Publication Number WO 08/118507 A2, which is incorporated herein in its entirety by this reference, describes Factor IX mutations exhibiting increased coagulant activity on page 5, line 14 and page 6, line 5. The International Publication WO number
<img file="MX375112B_D0024.tif" />
IMPI
-23MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
09/051717 A2, which is incorporated herein in its entirety by this reference, describes Factor IX mutations that exhibit an increased number of N- and/or O-linked glycosylation sites, resulting in increased half-life and/or recovery. on page 9, line 11 to page 20, line 2. International Publication Number WO 09/137254 A2, which is incorporated herein in its entirety by this reference, also describes Factor IX mutations with increased amounts of glycosylation sites on page 2, paragraph [006] to page 5, paragraph [011] and page 16, paragraph [044] to page 24, paragraph [057]. International Publication Number WO 09/130198 A2, which is incorporated herein in its entirety by this reference, describes Factor IX molecules with functional mutations that exhibit an increased number of glycosylation sites, resulting in increased half-life, in page 4, line 26 to page 12, line 6. International Publication Number WO 09/140015 A2, which is hereby incorporated in its entirety by this reference, describes functional mutations of Factor IX that have an increased number of Cys residues, which can be used in conjugating polymers (e.g. , PEG), on page 11, paragraph [0043] to page 13, paragraph [0053].
In addition, hundreds of non-functional mutations in Factor IX have been identified in hemophilia patients, many
<img file="MX375112B_D0025.tif" />
IMPI
-24MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY of those presented in Table 1 on pages 11-14 of international publication number WO 09/137254 A2, which is incorporated herein in its entirety by this reference. Such non-functional mutations are not included in the invention, but provide further guidance as to which mutations are more or less likely to result in a functional Factor IX polypeptide.
Factor IX (or Factor IX portion of a chimeric polypeptide) may be at least 90% or at least 95% or 100% identical to a Factor IX amino acid sequence presented in Table 2A without a signal sequence and propeptide sequence (amino acids 1 to 415 of SEQ ID Ν': 2) or, alternatively, with a propeptide sequence or with a signal sequence and propeptide (full-length Factor IX).
The coagulant activity of Factor IX is expressed in international units (IU). One IU of Factor IX activity corresponds approximately to the amount of Factor IX in one milliliter of normal human plasma. Several assays are available to measure Factor IX activity, including the one-stage coagulation assay (activated partial thromboplastin time; aPTT), thrombin generation time (TGA), and rotational thromboelastometry (ROTEM®). See, for example, Example 3.
As used herein, binding partner of
<img file="MX375112B_D0026.tif" />
IMPI
-25 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
FcRn or FcRn BP means functional neonatal Fe receptor (FcRn) binding partners, unless otherwise specified. An FcRn binding partner is any molecule that can specifically bind the FcRn receptor with consequent active transport of the FcRn binding partner by the FcRn receptor. Therefore, the term FcRn BP includes any functional variant of IgG Fe. For example, the region of the Fe portion of IgG that binds to the FcRn receptor was described based on X-ray crystallography (Burmeister et al. 1994, Nature 372:379, incorporated herein in its entirety by this reference). The main contact area of Fe with FcRn is near the junction of the CH2 and CH3 domains. The Fe-FcRn contacts are all within a single Ig heavy chain. FcRn BP includes total IgG, IgG De fragment, and other IgG fragments that include the entire FcRn binding region. Major contact sites include amino acid residues 248, 250-257, 272, 285, 288, 290-291, 308-311, and 314 of the CH2 domain and amino acid residues 385-387, 428, and 433-436 of the C domain. CH3. References to amino acid numbering of immunoglobulins or immunoglobulin fragments or regions are based on Kabat et al, 1991, Sequences of Proteins of Immunology.1 Interest, US Department of Public Health, Bethesda; MD, which is hereby incorporated in its
<img file="MX375112B_D0027.tif" />
IMPI
-26MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY by means of this reference. (The FcRn receptor has been isolated from various mammalian species including humans. The sequences of human FcRn, rat FcRn and mouse FcRn are known (Story et al. 1994, J. Exp. Med. 180: 2377) , which are incorporated herein in their entirety by this reference.) An FcRn BP may comprise the CH2 and CH3 domains of an immunoglobulin with or without the hinge region of the immunoglobulin. Exemplary FcRn BP variants are provided in WO 2004/101740 and WO 2006/074199, which are incorporated herein in their entirety by this reference.
FcRn BP also includes albumin and fragments of it that bind to FcRn. Preferably the albumin is human albumin. Factor IX can be bound to the N-terminus of albumin or to the C-terminus of albumin, provided that the Factor IX component of the albumin-Factor IX fusion protein can be processed by an enzymatically active proprotein convertase to provide a polypeptide that contains a processed Factor IX. Examples of albumin, eg, fragments thereof, that can be used in the present invention are known, for example, in US Patent No. 7,592,010, US Patent No. 6,686,179 and Schulte, Thrombosis Res. 124 Suppl. 2:S6-S8 (2009), all of which are incorporated herein in their entirety by this reference.
<img file="MX375112B_D0028.tif" />
IMPI
-27 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
FcRn BP (or the FcRn BP portion of a chimeric polypeptide) may contain one or more mutations and combinations of mutations.
FcRn BP (or the FcRn BP portion of a chimeric polypeptide) may contain mutations that confer increased half-life such as M252Y, S254T, T256E, and combinations thereof, as described in Oganesyan et al., Mol. Immunol. 46:1750 (2009), which is incorporated herein in its entirety by this reference; H433K, N434F, and combinations thereof, as described in Vaccaro et al., Nat, Biotechnol. 23:1283 (2005), which is incorporated herein in its entirety by this reference; the mutations presented on pages 1-2, paragraph [0012] and in Examples 9 and 10 of US 2009/0264627 Al, which is incorporated herein in its entirety by this reference, and the mutations described on page 2, paragraphs [0014] to [0021] of US 20090163699 Al, which is incorporated herein in its entirety by this reference.
In addition, FcRn BP (or the FcRn BP portion of a chimeric polypeptide) may contain the following mutations: The Fc region of IgG may be modified according to recognized processes such as site-directed mutagenesis and the like to provide modified IgG or portions or Fe fragments of it that can bind with FcRn. Such
<img file="MX375112B_D0029.tif" />
IMPI
-28INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL modifications include modifications away from the FcRn contact sites, as well as modifications within the contact sites that preserve or even enhance FcRn binding. For example, the following single amino acid residues in human igGl Fe(Fcyl) can be substituted without
<td></td><td>loss</td><td>significant</td><td>of affinity of</td><td>bonding of faith by</td><td>FcRn:</td>
<td></td><td>P238A,</td><td>S239A, K246A,</td><td>K248A, D249A,</td><td>M252A, T256A,</td><td>E258A,</td>
<td></td><td>T260A,</td><td>D265A, S267A,</td><td>H268A, E269A,</td><td>D270A, E272A,</td><td>L274A,</td>
<td></td><td>N276A,</td><td>Y278A, D280A,</td><td>V282A, E283A,</td><td>H285A, N28SA,</td><td>T289A,</td>
<td> 10</td><td>K290A,</td><td>R292A, E293A,</td><td>E294A, Q295A,</td><td>Y296F, N297A,</td><td>S298A,</td>
<td></td><td>Y300F,</td><td>R301A, V303A,</td><td>V305A, T307A,</td><td>L309A, Q311A,</td><td>D312A,</td>
<td></td><td>N315A,</td><td>K317A, Ξ318Α,</td><td>K320A, K322A,</td><td>S324A, K326A,</td><td>A327Q,</td>
<td></td><td>P329A,</td><td>A330Q, A330S,</td><td>P331A, P331S,</td><td>E333A, K334A,</td><td>T335A,</td>
<td></td><td>S337A,</td><td>K338A, K340A,</td><td>Q342A, R344A,</td><td>E345A, Q347A,</td><td>R355A,</td>
<td> 15</td><td colspan="4">E356A, M358A, T359A, K360A, N361A, Q362A, Y373A, S375A</td><td>D376A,</td>
<td></td><td>A378Q,</td><td>E380A, E382A,</td><td>S383A, N384A,</td><td>Q386A, E388A,</td><td>N389A,</td>
<td></td><td>N390A,</td><td>Y391F, K392A,</td><td>L398A, S40OA,</td><td>D401A, D413A,</td><td>K414A,</td>
<td></td><td>R416A,</td><td>Q418A, Q419A,</td><td>N421A, V422A,</td><td>S424A, E430A,</td><td>N434A,</td>
<td></td><td>T437A,</td><td>Q438A, K439A,</td><td>S440A, S444A</td><td colspan="2">and K447A, where, for</td>
<td> 20</td><td>example,</td><td colspan="2">P238A represents proline from</td><td colspan="2">substituted wild type</td>
with alanine at position number 238. In addition to alanine, other amino acids may be substituted with wild-type amino acids at the positions specified above. It is possible to introduce mutations in Fe individually and as a result have more than a hundred FcRn binding partners.
<img file="MX375112B_D0030.tif" />
IMPI
-29 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY other than Faith of natural origin. Additionally, it is possible to introduce combinations of two, three, or more of these individual mutations together, and obtain hundreds more FcRn binding partners. Some of these mutations may confer new functionality to the FcRn binding partner. For example, one embodiment incorporates N297A and removes a highly conserved N-glycosylation site. This mutation has the effect of reducing immunogenicity, thus improving the circulating half-life of the FcRn binding partner, and rendering the FcRn binding partner unable to bind FcyRI, FcyRIIA, FcyRIIB, and FcyRIIIA without compromising affinity for FcRn. FcRn (Routledge et al. 1995, Transplantation 60:847, which is incorporated herein in its entirety by this reference; Friend et al. 1999, Transplantation 68:1632, which is incorporated herein in its entirety by this reference; Shields et al. 1995, J. Biol. Chem. 276:6591, which is incorporated herein in its entirety by this reference). Likewise, it appears that at least three human Fe gamma receptors recognize a binding site on IgG in the lower hinge area, generally at amino acids 234-237. Thus, another example of new functionality and potentially decreased immunogenicity may arise from mutations in this region, for example by replacing amino acids 233-236 of human IgGl ELLG with the corresponding sequence of IgG2.
<img file="MX375112B_D0031.tif" />
IMPI
-30MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
PVA (with, removal of an amino acid). It has been shown that FcyRI, FcyRII, and FcyRIII, which mediate various effector functions, will not bind igGl when mutations have been introduced (Ward and Ghetie 1995 Therapeutic Immunology 2:77, incorporated herein in its entirety by this reference and Armor et al. 1999, Eur. J. Immunol. 29:2613, which is incorporated herein in its entirety by this reference). Affinity for FcRn may be increased beyond wild-type in some circumstances, as a further example of new functionality arising from the mutations described above. This increased affinity may reflect an increase in the forward rate, a decrease in the reverse rate, or an increase in the forward rate and a decrease in the reverse rate. Mutations thought to impart increased affinity for FcRn include T256A, T307A, E380A, and N434A (Shields et al. 2001, J. Biol. Chem. 276:6591, which is incorporated herein in its entirety by this reference).
The FcRn BP (or FcRn BP portion of a chimeric polypeptide) may be at least 90% or at least 95% or 100% identical to the amino acid sequence of Fe presented in Table 2A or 2B without a signal sequence (amino acids 1 to 227 of SEQ ID NO: 2) or, alternatively, with a signal sequence.
As used herein, polypeptides and proteins
<img file="MX375112B_D0032.tif" />
IMPI
-31 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY hybrids” means a combination of a chimeric polypeptide with a second polypeptide. The chimeric polypeptide and the second polypeptide in a hybrid may associate with each other via non-covalent protein-protein interactions, such as charge-charge or hydrophobic interactions. The chimeric polypeptide and the second polypeptide in a hybrid may associate with each other via covalent bonds, such as disulfide bonds. The chimeric peptide and the second peptide may associate with each other via more than one type of bond, such as non-covalent and disulfide bonds. Hybrids are described in WO 2004/101740, WO2005/001025, US Patent No. 7,404,956, US Patent No. 7,348,004, and WO 2006/074199, each of which is incorporated herein in its entirety by this reference. The second polypeptide may be a second copy of the same chimeric polypeptide or may be a non-identical chimeric polypeptide. In preferred embodiments, the second polypeptide is a polypeptide comprising an FcRn BP, eg, Fe. In preferred embodiments, the chimeric polypeptide is a Factor IX-FcRn BP, eg, Factor IX-Fc chimeric polypeptide, and the second polypeptide consists essentially of Fe. See, for example, Figure 1, Examples 1-3, and Table 2 (SEQ ID NO.<sup>s</sup>; 2 and 4). See, for example, US 7404956 , which is incorporated herein in its entirety by this reference.
<img file="MX375112B_D0033.tif" />
IMPI
-32 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
The second polypeptide in a hybrid may comprise or consist essentially of a sequence that is at least 90% or at least 95% or 100% identical to the amino acid sequence presented in Table 2B without a signal sequence (amino acids 1 to 227 of SEQ ID NO: 4) or, alternatively, with a signal sequence.
The polypeptide of the present invention also includes Factor IX fused to one or more XTEN polypeptides. Schellenburger et al., Nat. Biotech. 27:1186-90 (2009), which is incorporated herein in its entirety by this<sub>re</sub>F<sub>and</sub>rence. Factor IX can be fused to the N-terminus of the XTEN polypeptide or to the C-terminus of the XTEN polypeptide. XTEN polypeptides include, but are not limited to, those described in WO 2009/023270, WO 2010/091122, WO 2007/103515, US 2010/0189682, and US 2009/0092582, each of which is incorporated herein by reference. entirety by this reference.
As used herein, "dosage interval" means the amount of time that elapses between the administration of multiple doses to a subject. The dosage range in methods of the invention employing a chimeric FIX-FcRn BP, for example a chimeric FIX-Fc, may be at least about one and one-half times to eight times as long as the required dosage interval. for an equivalent amount {in Ul/kg) of the Factor
<img file="MX375112B_D0034.tif" />
-33 IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
IX without the FcRn BP, eg, Fe part (ie, a polypeptide consisting of FIX). The dosage range when administering, for example, a chimeric Factor IX-Fc polypeptide (or a hybrid) of the invention may be at least about one and one-half times as long as the dosage range required for an amount equivalent Factor IX without the FcRn BP, eg, Fe part (ie, a polypeptide consisting of Factor IX). The dosage range may be at least about one and one-half times to eight times as long as the dosage range required for an equivalent amount of Factor IX without, for example, the Fe part (or a polypeptide consisting of the Factor IX).
In some embodiments the dosage range is 6-18, 6-10, 9-18, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 days. The dosage interval may be at least once a week and may be 6-10 days, for example, about 7-10, about 7-9, about 7-8, about 8-10, about 9- 10, about 6-7, about 8-9, about 6, about 7, about 8, about 9 or about 10 days.
The dosage interval may be 9-18 days, for example, about 9-17, about 9-16, about
<img file="MX375112B_D0035.tif" />
IMPI
-34MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
9-15, about 9-14, about 9-13, about 9-12, about 9-11, about 9-10, about 10-18, about 11-18, about 12-18, about 13-18, about 14-18, about 15-18, about 16-18, about 17-18, about 10-11, about 11-12, about 12-13, about 13-14, about 14-15, about 15-16, about 16-17 days, about 9, about 10, about 11, about 12, about 13, around 14, around 15, around 16, around 17 or around 18 days. The dosage interval can be 10-14 days. The dosage interval can be around two weeks or twice a month. The dosage interval may be greater than 18 days, for example, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, around 28, around 29, around 30, around 31, around 32, around 33, around 34, around 35, around 36, around 37, around 38, around 39 or around 40 days. The dosage interval may be a fixed interval, for example, 7 days for 25-50 IU/kg, 10-13 days for 50-100 IU/kg, or 14 days for 100-150 IU/kg. The fixed interval and dose are determined such that the combination of interval and dose will result in a minimum of at least about 1-5 or at
<img file="MX375112B_D0036.tif" />
IMPI
-35INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL less than about 1-3 or at least about, at least about 3 or at least about 3 Ul/dl of FIX activity in a population of subjects or in an individual subject. Fixed dosing interval can also be 7 days for 20-50 IU/kg, 10-14 days for 50-100 IU/kg, 14-16 days for 100-150 IU/kg, 7 days for 10-50 IU /kg, 10-13 days for 15-100 IU/kg or 14-15 days for 50-150 IU/kg. The fixed dosage interval can also be 7 days for 10-30 IU/kg, 10 days for 15-50 IU/kg, 11 days for 20-70 IU/kg, 12 days for 25-85 IU/kg, 13 days for 30-100 IU/kg, 14 days for 40-125 IU/kg and 15 days for 50-150 IU/kg.
In preferred embodiments the dosage range is 20 IU/kg once a week, 40 IU/kg every 10 days or 100 IU/kg every two weeks (twice a month).
The dosage range may alternatively be an individual range that is determined for each subject based on pharmacokinetic data or other information about the subject. The individual dose/dosage interval combination may be the same as that for fixed interval regimens in the preceding paragraphs or may differ, as illustrated in the Examples. Initially, the regimen may include a fixed dosing interval and may later change to an individual dosing interval.
As used herein, on-demand treatment means treatment that is intended to take place over a short period of time and that is developed in response to an existing condition, such as a bleeding episode, or a short-term need such as a planned surgery. Some conditions that may require treatment on demand include a bleeding episode, hemarthrosis, muscle bleeding, oral bleeding, hemorrhage, muscle bleeding, oral bleeding, trauma, trauma capitis, gastrointestinal bleeding, intracranial hemorrhage, intra-abdominal hemorrhage, intrathoracic hemorrhage, bone fracture, bleeding in the central nervous system, bleeding in the retropharyngeal space, bleeding into the retroperitoneal cavity or bleeding into the iliopsoas muscle sheath. Bleeding episodes other than these are included. The subject may be in need of surgical prophylaxis, perioperative management, or treatment for surgery. Such surgeries include minor surgery, major surgery, tooth extraction, tonsillectomy, other dental or thoracic/facial surgery, inguinal hernia surgery, synovectomy, total knee replacement, other joint replacement, craniotomy, osteosynthesis, emergency surgery, intracranial surgery, intra-abdominal surgery, intrathoracic surgery. Surgeries that were not listed are also included. Other conditions that may require treatment on demand include those listed in Table 26.
<img file="MX375112B_D0037.tif" />
-37IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Some additional conditions that may require on-demand treatment include minor hemorrhages, hemarthrosis, superficial muscle hemorrhage, soft tissue hemorrhage, moderate hemorrhage, intramuscular or soft tissue hemorrhage with dissection, mucous membrane hemorrhage, hematuria, massive hemorrhage, pharynx, retropharyngeal hemorrhage, retroperitoneal hemorrhage, central nervous system hemorrhage, bruises, cuts, scrapes, joint bleeding, nose bleed, mouth bleed, gum bleeding, intracranial bleeding, intraperitoneal bleeding, minor spontaneous bleeding, bleeding after major injury, moderate skin bruising, or spontaneous joint bleeding, muscles, internal organs, or the brain. Additional reasons for on-demand treatment include the need for perioperative management for dental surgery or extraction, major surgery, major oral surgery, urologic surgery, hernia surgery, orthopedic surgery such as knee, hip, or other major joint replacement.
Abbreviations:
AUCinf Area under the concentration-time curve from zero to infinity
AUCa Area under the concentration-time curve in the distribution phase
<img file="MX375112B_D0038.tif" />
IMPI
-38 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
AUCp Area under the concentration-time curve in the elimination phase
<td colspan="2" rowspan="2">Alpha HL Beta HL</td><td colspan="3">Distribution phase half-life</td>
<td>Elimination phase half-life;</td><td colspan="2">I also know</td>
<td colspan="4">he refers to her as you/2 C168 FIXFc activity estimated on reference approximately 168 hours post dose C<sub>max</sub> Maximum concentration at T<sub>max</sub>CV% Percent coefficient of variation Cl Clearance IVR In vivo recovery (%) K value Gradual recovery TMR mean residence time N Number NC Not calculable NR Not reported SD Standard deviation SE Standard Error</td><td>the</td>
<td colspan="2">TBLP1</td><td colspan="2">Time after dose anticipated by</td><td>the</td>
<td>model in</td><td>the</td><td>that FIXFc activity has</td><td>listless</td><td>a</td>
approximately 1 IU/dL above reference
TBLP3 Model-predicted time post-dose in which FIXFc activity has decayed to approximately 3 IU/dL over baseline
TBLP5
Time after the dose anticipated by the
<img file="MX375112B_D0039.tif" />
IMPI
-39INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL model in which the activity of FIXFc has decayed to approximately 5 υΐ/dL over the reference
v<sub>gs</sub> Volume of distribution at steady state
VI Central compartment volume of distribution
Pharmacokinetic (PK) parameters include the above and following terms, which have their usual meaning in the art, unless otherwise indicated. Some of the terms are explained in greater detail in the Examples. PK parameters can be based on the level of FIX antigen (often indicated as antigen in parentheses herein) or the level of FIX activity (often indicated as activity in parentheses herein). In the literature, PK parameters are often based on the level of FIX activity due to the presence of endogenous and inactive FIX in the plasma of some patients, which interferes with the ability to measure administered (i.e., exogenous) FIX using antibody against FIX. However, when FIX is administered as part of a fusion protein containing a heterologous polypeptide such as an FcRn BP, it is possible to accurately measure the administered (ie, exogenous) FIX antigen using an antibody to the heterologous polypeptide. In addition, certain PK parameters
<img file="MX375112B_D0040.tif" />
IMPI
-40 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY may be based on data predicted by models (often indicated as predicted models in parentheses herein) or on observed data {often indicated as observed in parentheses herein), and are preferably based on on observed data.
As used herein, "reference" is the lowest level of Factor IX measured in plasma in a subject prior to administration of a dose. In the first human study described in Example 1, plasma Factor IX levels were measured at two time points prior to dosing: at an assessment view and immediately prior to dosing. Pre-dose time points were treated as zero (reference) for the purposes of calculations, ie, to generate data with subtraction of reference values. See, for example, Figure 4. Alternatively, (a) set the reference for patients whose pretreatment FIX activity is <1%, have no detectable FIX antigen, and have nonsense genotypes as 0%, (b) set the reference for patients with FIX activity before treatment <1% and presenting detectable FIX antigen in 0.5%, (c) the reference for patients whose FIX activity before treatment is between 1-2% is Cmin (the lowest activity throughout the PK study) and (d) the reference for patients whose FIX activity before treatment is ^ 2 is
<img file="MX375112B_D0041.tif" />
IMPI
-41 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
two%. Activity over baseline before dosing is considered residual drug from previous treatment and was carried over to baseline and subtracted from PK data after rFIXFc dosing. See Example 11.
Area under the plasma concentration-time curve (AUC), which, as used herein, is based on the rate and extent of elimination of Factor IX following its administration. AUC is determined at a specific time period such as 12, 18, 24, 36, 48, or 72 hours, or to infinity by extrapolation based on the slope of the curve. Unless otherwise specified herein, AUC is determined for infinity (AUCinf). AUC can also be calculated on a dose basis. As in the case of many of the other PK parameters, the AUC determination can be carried out on a single subject or on a population of subjects, for which the average is calculated. In Example 1 the mean AUC/dose in the patient population was 32.44 IU*h/dL per IU/kg and the range for individual subjects was 21.80-54.30 IU*h/dL per IU/kg. (See Table 13 average AUC/dose based on activity.) Therefore, average AUC/dose in a patient population may be about 26-40, about 26, about 27, about 28, about about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36,
<img file="MX375112B_D0042.tif" />
IMPI
-42MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY around 37, around 38, around 39 or around 40 IU*h/dL per IU/kg. See Table 14 AUC/dose and other antigen-based AUC parameters.
In vivo recovery (IVR) is represented by the gradual recovery (K value), which is the observed peak activity minus the pre-dose level and then divided by the dose. The IVR can also be calculated on a percentage basis, as described in the Examples. For purposes of clarity, units (K value or Ul/dl per Ul/kg based on %) are used herein. The IVR can be determined on a population of patients, or the individual IVR can be determined on a single subject. The FIXFc used in the first human study described in Example 1 showed an average IVR of about 0.93 IU/dl per IU/kg in the patient population and an IVR in each subject ranging between 0.62 and 1.17 IU/dl. per IU/kg (Table 13). Therefore, the chimeric polypeptide of the invention shows an average IVR in a patient population of 0.85-1.15 (eg, about 0.85, about 0.86, about 0.87, about 0.88, about 0.89, about 0.90). , about
0.91, around 0.92, around 0.93, around
0.94, around 0.95, around 0.96, around
0.97, about 0.98, about 0.99, about 1.0, about 1.05, about 1.10, about 1.15) and
<img file="MX375112B_D0043.tif" />
IMPI
-43MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY an IVR in a subject of at least around 0.6, around 0.7, 0.8, around 0.9, around 1.0, around 1.1 or around 1.2 Ul/dl per Ul/kg.
Clearance (CL), as used herein, is a measure of the body's ability to eliminate a drug and is expressed as the volume of plasma that becomes free of drug per time. The FIXFc used in the study described in Example 1 showed an average CL of about 3.36 ml/hour/kg (see Table 13), which is about 2.5 times lower than the CL (8.2 ml/hour/kg) of a polypeptide consisting of Factor IX (BENEFIX™); the range of CL values in individual subjects was 1.84-4.58 ml/h/kg. Thus, a chimeric polypeptide of the invention exhibits a population average CL of 3.0-3.72, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, or 3.72 mL/hour/kg. For a CL based on an antigen, see Table 14.
Mean residence time (MRT), as used herein, is a measure of the half-life of drug molecules in the body. The FIXFc used in the study described in Example 1 showed an average TMR of about 68.05 hours (see Table 13); the range of TMR values was 53.1-85.8 hours in individual patients. Thus, a chimeric polypeptide of the invention exhibits an average TMR in a population of 60-78, around
<img file="MX375112B_D0044.tif" />
IMPI
-44 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY of 60, around 62, around 64, around 66, around 68, around 70, around 72, around 74, around 76 or around 78 hours and an MRT in a subject of at least about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, or about 90 hours. For an antigen-based TMR see Table 14.
or 11/2 theta or Beta HL, as used herein, is a half-life associated with the elimination phase, ^/<sub>2</sub>β= íIn2)/elimination rate constant associated with the terminal phase. In the study described in Example 1, the FIXFc used showed an average ti/<sub>2</sub>« in a patient population that was around 52.5 hours (see Table 13) and the range of f ti /<sub>2</sub> p in individual subjects was 47-60 hours. Therefore, a chimeric polypeptide of the invention exhibits an average ti/<sub>2</sub>p greater than about
<td>47 around</td><td>of</td><td>48, around 49, around 50,</td>
<td>about</td><td> 51,</td><td>around 52, around 53,</td>
<td>about</td><td> 54,</td><td>around 55, around 56,</td>
<td>about</td><td> 57,</td><td>around 58, around 59 or</td>
<td>about</td><td> 60</td><td>hours. For you/<sub>2</sub>p based on an antigen</td>
see Table 14.
Minimum concentration as used herein is the level of activity of Factor IX in the
<img file="MX375112B_D0045.tif" />
IMPI
-45MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY lowest plasma level achieved after administering a dose of a chimeric polypeptide of the invention or another Factor IX molecule and before the administration of the next dose, if any. Minimum concentration is used herein interchangeably with threshold. Reference Factor IX levels are subtracted from measured Factor IX levels to calculate the trough level. In some modalities, the minimum concentration is 1-5 or 1-3 IU/dl after about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13 or about 14 days. In some embodiments, the plasma level of a chimeric polypeptide reaches an average trough concentration of at least about 1 IU/dl after at least about 6 days in at least about 70%, at least about 80%, at least about 90% or about 100% of a patient population or reaches a trough concentration of at least about 1, 2, 3, 4, or 5 IU/dl after at least about 6 days in a subject. In some embodiments, the plasma level of the chimeric polypeptide reaches an average trough concentration of about 1-5 or 1-3 IU/dl. The minimum concentration or average minimum concentration can be reached after about 6, about 7, about 8,
<img file="MX375112B_D0046.tif" />
IMPI
-46 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td>around</td><td>of</td><td> 9,</td><td>around</td><td>of</td><td> 10,</td><td>around</td><td>of</td><td> 11,</td>
<td>around</td><td>of</td><td> 12,</td><td>around</td><td>of</td><td> 13,</td><td>around</td><td>of</td><td> 14 ,</td>
<td>around</td><td>of</td><td> 15,</td><td>around</td><td>of</td><td> 16,</td><td>around</td><td>of</td><td> 17,</td>
<td>around</td><td>of</td><td> 18,</td><td>around</td><td>of</td><td> 19,</td><td>around</td><td>of</td><td> 20,</td>
<td>around</td><td>of</td><td> 21,</td><td>around</td><td>of</td><td> 22,</td><td>around</td><td>of</td><td> 23,</td>
<td>around</td><td>of</td><td> 24,</td><td>around</td><td>of</td><td> 25,</td><td>around</td><td>of</td><td> 26,</td>
<td>around</td><td>of</td><td> 27,</td><td>around</td><td>of</td><td> 28,</td><td>around</td><td>of</td><td> 29,</td>
<td>around</td><td>of</td><td> 30,</td><td>around</td><td>of</td><td> 31,</td><td>around</td><td>of</td><td> 32,</td>
<td>around</td><td>of</td><td> 33,</td><td>around</td><td>of</td><td> 34,</td><td>around</td><td>of</td><td> 35,</td>
<td>around</td><td>of</td><td> 36,</td><td>around</td><td>of</td><td> 37,</td><td>around</td><td>of</td><td> 38,</td>
<td>around</td><td>from 3 to 9</td><td>either</td><td>about</td><td> 40</td><td>days.</td><td></td><td></td><td></td>
Volume of distribution at steady state (Vss) as used herein is the apparent space (volume) in which a drug is distributed. Vss = the amount of drug in the body divided by the steady-state plasma concentration. In Example 1, the average Vss found in the population was around 226 mL/kg and the range for subjects was around 145-365 mL/kg. (See Table 13). Therefore, the average Vss in a patient population can be 200-300, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270 , about 280, about 290 or about 300 mL/kg. The Vss for individual subjects ω
<img file="MX375112B_D0047.tif" />
IMPI σι
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td>it can be around 145, around 150, around</td>
<td>160, around 170, around 180, around 190,</td>
<td>around 200, around 210, around 220,</td>
<td>around 230, around 240, around 250,</td>
<td>around 260, around 270, around 280,</td>
<td>around 290, around 300, around 310,</td>
<td>around 320, around 330, around 340,</td>
<td>around 3S0, around 360 or around 370</td>
<td>ml/kg For a Vss based on an antigen see Table</td>
<td> 14.</td>
<td>Polypeptide, peptide, and protein are used</td>
<td>interchangeably and refer to a compound</td>
<td>polymer that comprises amino acid residues linked together</td>
<td>covalent form.</td>
Polynucleotide and nucleic acid are used interchangeably and refer to a polymeric compound comprising covalently linked nucleotide residues. Polynucleotides can be DNA, cDNA, RNA, single-stranded or double-stranded, vectors, plasmids, phages, or viruses. Polynucleotides include those in Table 1 that encode the polypeptides of Table 2 (see Table 1). Polynucleotides also include fragments of the polynucleotides in Table 1, for example, those encoding fragments of the polypeptides in Table 2, such as Factor IX, Fe,
<img file="MX375112B_D0048.tif" />
IMPI
-48INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL signal sequence, propeptide, 6His and other fragments of the polypeptides in Table 2.
Prophylactic treatment, as used herein, means administering a Factor IX polypeptide in multiple doses to a subject over time to increase the level of Factor IX activity in a subject's plasma. Preferably, the increased level is sufficient to decrease the incidence of spontaneous bleeding or to prevent bleeding in the event of an unforeseen injury. Prophylactic treatment decreases or prevents bleeding episodes, for example, those described in treatment on demand. Prophylactic treatment may be fixed or may be individual, as discussed under dosage interval, for example, to compensate for interpatient variability.
Subject as used herein means a human or non-human mammal. Non-human mammals include mice, dogs, primates, monkeys, cats, horses, cows, pigs, and other domestic and small animals. Subjects also include pediatric humans. Pediatric human subjects are birth to 20 years, preferably birth to 18 years, birth to 16 years, birth to 15 years, birth to 12 years, birth to 11 years, birth to 6 years, birth to 5 years, from birth to 2 years and from 2 to 11 years of age.
The methods of the invention can be practiced on a subject in need of controlling or preventing bleeding or bleeding episodes. Subjects include those who need to control □ prevent bleeding in minor hemorrhage, hemarthrosis, superficial muscle hemorrhage, soft tissue hemorrhage, moderate hemorrhage, intramuscular or soft tissue hemorrhage with dissection, mucous membrane hemorrhage, hematuria, massive hemorrhage, pharyngeal hemorrhage, retropharyngeal hemorrhage, retroperitoneal hemorrhage, central nervous system hemorrhage, bruises, cuts, scrapes, joint bleeding, nose bleed, mouth bleed, gum bleeding, intracranial bleeding, intraperitoneal bleeding, minor spontaneous bleeding, bleeding after major injury, moderate skin bruising, or spontaneous joint bleeding, muscles , internal organs, or the brain. Subjects also include those in need of perioperative treatment, such as treatment of bleeding associated with dental surgery or extraction.
Therapeutic dose as used herein means a dose that achieves a therapeutic purpose,
<img file="MX375112B_D0049.tif" />
IMPI
-50 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY as described herein. Calculation of the required dose of plasma-derived Factor IX (pdFIX) is based on the empirical finding that approximately 1 IU of pdFIX per kg of body weight increases plasma Factor IX activity by approximately 1 IU/dL ( 1%). Based on that, the required dosage is determined using the following formula:
Required units = body weight (kg) x desired increase in Factor IX (IU/dL or % of normal) x 1 (IU/kg per IU/dL)
Since FIXFc, for example, as described in the Examples and in Figure 1, has a gradual recovery similar to pdFIX (different from that of BENEFIX™), the required dose is determined by using the aforementioned formula or adjusting it slightly. See also Table 26 for specific recommended dosages for various on-demand treatment needs. For pediatric subjects using pdFIX, the dosage guideline is the same as for adults. However, pediatric patients may have a slower gradual recovery and the dosage should therefore be increased.
Therapeutic doses that can be used in the methods of the invention are 10-180, 20-180 or 25-180 IU/kg, more specifically, the preferred doses for a 6-10 day dosing interval are as follows: about from 25-110, about 30-110, about 40-110, about 50-110, about 60-110, about 70-110, about 80-110, about 90-110, and about 100- 110; about 30-100, about 30-90, about 30-80, about 30-70, about 30-60, about 30-50, about 30-40 IU/kg; about 40-110, about 50-100, about 6090, and about 70-80 IU/kg; about 40-50, about 50-60, about 60-70, about 70-80, about 80-90, about 90-100, and about 100-110 IU/kg; about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 105 and about 110 IU/kg. A dosage interval of βίο days includes a weekly dosage interval. Additional therapeutic doses for a 6-10 day dosing interval, eg, weekly, include 20-50, 20-100 and 20-180 IU/kg, more specifically, the preferred doses for a 6-10 day dosing interval. days, for example, weekly, are as follows: about 20-110, about 20-100, about 20-90, about 20-80, about 2070, about 20-60, about 20-50, about 20-40, about 20- 30, around 20-40 and around 20 IU/kg. See also Examples 10 and 11. Doses may be less than 20 IU/kg if effective for a given patient, for example, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about of 17, about 18 or about 19 IU/kg.
Preferred therapeutic doses for a 9-18 day dosing interval, eg twice monthly, are as follows: about 50-180, about 60-180, about 70-180, about 80-180, about 90-180, about 100-180, about 110-180, about 120-180, about 130-180, about 140-180, about 150-180, about 160-180, about 170-180 IU/kg and about 90-170, about 90-160, about 90-150, about from 90140, about 90-130, about 90-120, about 90-110, about 90-100 IU/kg; about 100-170, about 110-160, about 120-150, and about 130-140 IU/kg; about 90-100, about 100-110, about 110-120, about 120-130, about 130-140, about 140-150, about 150-160 and about 160-170 IU/kg ; around 60,
<img file="MX375112B_D0050.tif" />
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td>around</td><td>of</td><td> 70,</td><td>around</td><td>of</td><td> 80,</td><td>around</td><td>of</td><td> 90,</td>
<td>around</td><td>of</td><td> 95,</td><td>around</td><td>of</td><td> 100,</td><td>around</td><td>of</td><td> 105,</td>
<td>around</td><td>of</td><td> 110,</td><td>around</td><td>of</td><td> 115,</td><td>around</td><td>of</td><td> 120,</td>
<td>around</td><td>of</td><td> 125,</td><td>around</td><td>of</td><td> 130,</td><td>around</td><td>of</td><td> 135,</td>
<td>around</td><td>of</td><td> 140,</td><td>around</td><td>of</td><td> 145,</td><td>around</td><td>of</td><td> 150,</td>
<td>around</td><td>of</td><td> 155,</td><td>around</td><td>of</td><td> 160,</td><td>around</td><td>of</td><td> 165,</td>
<td>around</td><td>of</td><td> 170,</td><td>around</td><td>of</td><td> 175</td><td>and around</td><td>of</td><td> 180</td>
Ul/kg See also Examples 10 and 11.
Preferred therapeutic doses are 10-50, 15-100, 20-100, 20-50, 50-100, 10, 20, 40, 50 and 100 IU/kg.
Therapeutic doses can be around 2050, around 20-100, around 20-180, around 25-110, around 30-110, around 40-110, around 50-110, around 60- 110, about 70-110, about 80-110, about 90-110, about 100110, about 30-100, about 30-90, about 30-80, about 30-70, about 30-60, about 30-50, about 30-40 IU/kg; about 40-110, about 50-100, about 60-90, about 70-80 IU/kg; about 40-50, about 50-60, about 60-70, about 70-80, about 80-90, about 90-100, about 100-110 IU/kg; about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about
<img file="MX375112B_D0051.tif" />
IMPI
-54MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY of 75, around 80, around 85, around 90, around 95, around 100, around 105 and around 110 Ul/kg. Doses are preferred over dosage ranges of about 6-10, about 7-10, about 7-9, about 7-8, about 8-10, about 9-10, about 6- 7, around 8-9, around 6, around 7, around 8, around 9 and around 10 days, and once a week.
The therapeutic dose can be about 90-180, about 100-180, about 110-180, about 120-180, about 130-180, about 140-180, about 150-180, about 160-180 and around 170-180 IU/kg. The therapeutic dose can be around 90-170, around 90-160, around 90-150, around 90-140, around 90-130, around 90-120, around 90-110 and around 90 -100 IU/kg. The dose can be around 100-170, around 110-160, around 120-150 and around 130-140 IU/kg. The therapeutic dose can be around 90-100, around 100-110, around 110-120, around 120-130, around 130-140, around 140-150, around 150-160 and around 160-170 Ul/kg The dose can be about 90, about 95, about 100, about 105, about 110, about 115, about 120, about 125, about 130, about 135, about 140,
<img file="MX375112B_D0052.tif" />
IMPI
-55MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td>around</td><td>of</td><td> 145,</td><td>around</td><td>of</td><td>150, around</td><td>from 155,</td>
<td>around</td><td>of</td><td> 160,</td><td>around</td><td>of</td><td>165 around</td><td>from 170,</td>
<td>around</td><td>of</td><td> 175,</td><td>around</td><td>of</td><td>180 IU/kg. The</td><td>dose it</td>
preferred for dosage ranges of about 9-18, about 9-17, about 9-16, about 9-15, about 9-14, about 9-13, about 9-12, about 9 -11, about 9-10, about 10-18, about 11-18, about 12-18, about 13-18, about 14-18, about 15-18, about 16-18 , around 17-18, around 10-11, around 11-12, around 12-13, around 13-14, around 14-15, about 15-16 and about 16-17 days, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17 and about 18 days, once a month or twice a month (every two weeks).
Preferred therapeutic doses and dosage ranges are as follows: 20 IU/kg once a week, 40 IU/kg every 10 days, and 100 IU/kg every other week (twice a month). Additional combinations of doses and dose ranges include: a dose of at least about 50 IU/kg and a dosing interval of at least about 7 days, a dose of at least about 100 IU/kg and a dosing interval of at least about 9 days, a dose of at least about 10 0 IU/kg and a
<img file="MX375112B_D0053.tif" />
IMPI
-56INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL dosage interval of at least about 12 days, a dose of at least about 150 IU/kg and a dosage interval of at least about 14 days, 20-50 or 20100 IU/kg and the dosing interval is once a week, a dose of 20-50 IU/kg and a dosing interval of 7 days, a dose of 50-100 IU/kg and a dosage interval of 10-14 days or a dose of 100-150 IU/kg and a dosage interval of 14-16 days. Preferred dosage range and dose combinations also include 10-50 IU/kg for 7 days, 15-100 IU/kg for 10-13 days, 50-150 IU/kg for 14-15 days, 10-30 IU/ kg for 7 days, 15-50 IU/kg for 10 days, 20-70 IU/kg for 11 days, 2585 IU/kg for 12 days, 30 to 100 IU/kg for 13 days, 40 to 125 IU/kg for 14 days and 50-150 Ul/kg for 15 days.
Variant, as used herein, refers to a polynucleotide or polypeptide that differs from, but retains essential properties of, the parent polynucleotide or polypeptide, for example, Factor IX coagulant activity or Fe (FcRn-binding) activity. . Usually, the variants are generally quite similar to, and, in many regions, identical to the original polynucleotide or polypeptide. Variants include polypeptide and polynucleotide fragments, deletions, insertions, and modified versions of the original polypeptides.
Variant polynucleotides may comprise, or
<img file="MX375112B_D0054.tif" />
IMPI
-57 INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL alternatively consist of, a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, the coding sequence of nucleotide in SEQ ID No: 10 3 (the Factor IX portion, the Fe portion, individually or together) or the complementary chain of these, the nucleotide coding sequence of mutant and recombinant Factor IX or Fe such as those described in the publications and patents cited herein or the complementary chain thereof, a nucleotide sequence encoding the polypeptide of SEQ ID NO:2 or 4 (the Factor IX portion, the Fe portion, individually or together), and/or polynucleotide fragments of any of these nucleic acid molecules (eg, those fragments described herein). Polynucleotides that hybridize to these nucleic acid molecules under stringent or lower stringency hybridization conditions are included as variants, as are the polypeptides encoded by these polynucleotides so long as they are functional.
Variant polypeptides may comprise, or alternatively consist of, an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to, for example, the polypeptide sequence shown. in SEQ ID NO: 2 or 4 (the Factor IX portion, the Fe portion, individually or together) and/or polypeptide fragments of
<img file="MX375112B_D0055.tif" />
IMPI
-58MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY any of these polypeptides {for example, those fragments described herein).
By a nucleic acid having a nucleotide sequence at least, for example, 95% identical to a reference nucleotide sequence is meant that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a nucleic acid with a nucleotide sequence that is at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be removed or replaced by another nucleotide or an amount of nucleotides up to 5% of the total nucleotides of the reference sequence can be inserted into the reference sequence. The query sequence may be, for example, the entire sequence shown in SEQ ID NO: 1 or 3, the open reading frame ORF, or any specified fragment as described herein.
As a practical matter, if any particular nucleic acid molecule or polypeptide is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide or polypeptide sequence of the present invention, It can
<img file="MX375112B_D0056.tif" />
IMPI
-59MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY determined in a conventional manner using known computer programs. A preferred method for determining the best overall match between a query sequence {reference or original sequence) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. to the. (Comp. App. Biosci. (1990) 6:237-245), which is incorporated herein in its entirety by this reference. In a sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting the U's to T's. The result of the global sequence alignment is in percent identity. The preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identity are: Array = Unitary, k-tuple = 4, Mismatch Penalty = 1, Joining Penalty = 30, Randomization Group Length = 0, Cut Result = 1, Gap Penalty = 5, Gap Size Penalty = 0.05, Window Size = 500 or the length of the subject nucleotide sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence due to 5' or 3' deletions and not due to internal deletions, a manual correction must be made to the results. This is because the program
<img file="MX375112B_D0057.tif" />
IMPI
-60MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
FASTDB does not estimate the 5' and 3' truncations of the subject sequence when calculating percent identity. For subject sequences truncated at the 5' or 3' ends, relative to the query sequence, percent identity is corrected by calculating the number of bases in the query sequence that are 5' or 3 of the subject sequence, that are not matched/aligned, as a percentage of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by the results of the FASTDB sequence alignment. This percentage is then subtracted from the identity percentage, calculated by the aforementioned FASTDB program using the specified parameters to arrive at a final identity percentage result. This corrected result is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as shown in the FASTDB alignment, that are not matched/aligned with the query sequence are calculated in order to manually adjust the percentage result of identity.
For example, a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity. The deletions occur at the 5' end of the subject sequence and therefore the FASTDB alignment does not show a match/alignment of the first 10 bases at the 5' end. The 10 bases do not
<img file="MX375112B_D0058.tif" />
IMPI
-61 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY represent 10% of the sequence (number of bases at the 5' and 3' ends unpaired/total number of bases in the problem sequence) then 10% is subtracted from the result of the percentage of identity computed by the FASTDB program. If the remaining 90 bases matched perfectly, the final percent identity would be 90%. In another example, a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions such that there are no bases 5' or 3' of the subject sequence that are not matched/aligned with the query sequence. In this case the identity percentage calculated by FASTDB is not manually corrected. Again, only bases 5' and 3' of the subject sequence that are not matched/aligned with the query sequence are manually corrected. For the purposes of the present invention, no other manual corrections will be made.
With a polypeptide having an amino acid sequence at least, for example, 95% identical to a test amino acid sequence of the present invention, the amino acid sequence of the subject polypeptide is intended to be identical to the test sequence except that the sequence of the subject polypeptide may include up to five amino acid alterations per 100 amino acids of the amino acid sequence of the query sequence.
<img file="MX375112B_D0059.tif" />
IMPI
-62MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY amino acids. In other words, to obtain a polypeptide that has an amino acid sequence that is at least 95% identical to a test amino acid sequence, up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels), or substituted. with another amino acid. These alterations to the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between the terminal positions, interspersed, either individually between residues in the reference sequence or in one. or more contiguous groups within the reference sequence.
As a practical matter, if any particular polypeptide is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to, for example, the amino acid sequences of SEQ ID NO: 2 (the Factor IX portion, the Fe portion, individually or together) or 4, or a sequence of known Fe or Factor IX polypeptides, can be determined in a conventional manner using known computer programs. A preferred method for determining the best overall match between a query sequence (reference or original sequence) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. To the.<sub>F</sub> Comp. app.
<img file="MX375112B_D0060.tif" />
IMPI
-63 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Biosci. 6:237-245(1990), which is incorporated herein in its entirety by this reference. In a sequence alignment the query and subject sequences are both nucleotide sequences or both amino acid sequences. The result of the global sequence alignment is in percent identity. The preferred parameters used in a FASTDB amino acid alignment are: Matrix = PAM 0, k-tupia = 2, Discordant Penalty = 1, Joining Penalty = 20, Randomization Group Length = 0, Deadline Result = 1, Size window = sequence length, Gap Penalty = 5, Gap Size Penalty 0.05, Window Size = 500 or the length of the subject amino acid sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence due to N-terminal deletions or not due to internal C-deletions, a manual correction must be made to the results. This is because the FASTDB. it does not estimate truncations at the N- or C-terminus of the subject sequence when calculating percent identity. For subject sequences truncated at the N- or C-terminus, relative to the query sequence, percent identity is corrected by calculating the number of residues in the query sequence that are N- or C-terminus of the subject sequence, that are not
<img file="MX375112B_D0061.tif" />
IMPI
-64INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL matched/aligned with a corresponding subject residue, as a percentage of the total bases of the query sequence. Whether a residue is matched/aligned is determined by the results of the FASTDB sequence alignment. This percentage is then subtracted from the identity percentage, calculated by the aforementioned FASTDB program using the specified parameters to arrive at a final identity percentage result. The final percentage identity result is what is used for the purposes of the present invention. Only the N- and C-terminal residues of the subject sequence, which are not matched/aligned with the query sequence, are considered in order to manually adjust the percent identity result. That is, only the test residue positions outside of the residues furthest from the N- and C- ends of the subject sequence.
For example, a 90 amino acid subject sequence is aligned to a 100 residue query sequence to determine percent identity. The deletion occurs at the N-terminus of the subject sequence and therefore the FASTDB alignment does not show a match/alignment of the first 10 residues at the N-terminus. The 10 mismatched residues represent 10% of the sequence (number of mismatched N- and C-terminal residues/total number of residues in the query sequence), so subtract
<img file="MX375112B_D0062.tif" />
-65IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
10% of the result to the percentage of identity calculated by the FASTDB program. If the remaining 90 residues matched perfectly, the final percent identity would be 90%. In another example, a 90 residue subject sequence is compared to a 100 residue query sequence. This time the deletions are internal deletions so that there are no residues at the N- or C-terminus of the subject sequence that are not matched/aligned with the query. In this case the identity percentage calculated by FASTDB is not manually corrected. Again, only residue positions outside the N- and C-terminus of the subject sequence, as demonstrated by the FASTDB alignment, that are not matched/aligned with the query sequence are manually corrected. For the purposes of the present invention, no other manual corrections will be made.
Polynucleotide variants may contain alterations in the coding or non-coding regions, or both. Polynucleotide variants containing alterations that produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide, are especially preferred. Nucleotide variants produced by silent substitutions are preferred due to the degeneracy of the genetic code. In addition, it is also
<img file="MX375112B_D0063.tif" />
IMPI
-66MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY prefer variants in which 5-10, 1-5 or 1-2 amino acids are substituted, deleted or added in any combination. Polynucleotide variants can be produced for a variety of reasons, for example, to optimize codon expression for a particular host (change human mRNA codons to those preferred by a bacterial host such as E. coli).
Naturally occurring variants are called allelic variants and refer to one of several alternative forms of a gene that occupies a given locus on an organism's chromosome (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985)). These allelic variants may vary at either the polynucleotide and/or polypeptide level and are included in the present invention. Alternatively, non-naturally occurring variants can be produced by mutagenesis techniques or by direct synthesis.
Variants can be generated to improve or alter the characteristics of the polypeptides, using known methods of protein modification and recombinant DNA technology. For example, one or more amino acids can be removed from the N-terminus or the C-terminus of the secreted protein without causing substantial loss of biological function. The authors of Ron et al., J. Biol. Chem. 268: 2984-2988 (1993), which is incorporated herein in its entirety by this reference, filed
<img file="MX375112B_D0064.tif" />
IMPI
-67MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY variant KGF proteins that had heparin-binding activity even after removal of 3, 8, or 27 amino-terminal amino acid residues. Similarly, Interferon gamma showed up to a tenfold activity after removing 8-10 amino acid residues from the carboxy termini of this protein. (Dobeli et al., J. Biotechnology 7:199-216 (1988), incorporated herein in its entirety by this reference.)
Furthermore, there is abundant evidence showing that the variants usually retain biological activity similar to that of the naturally occurring protein. For example, Gayle et al. (J. Biol. Chem. 268:2210522111 (1993), incorporated herein in its entirety by this reference) performed extensive mutational analyzes on the human cytokine IL-la. They used random mutagenesis to generate more than 3,500 individual IL-la mutants that averaged 2.5 amino acid changes per variant over the total length of the molecule. Multiple mutations at every possible amino acid position were examined. The researchers found that most of the molecule could be altered with little effect on [binding or biological activity]. (See the Abstract.) In fact, just 23 unique amino acid sequences out of more than 3,500 nucleotide sequences examined produced a protein that was considerably different
-68IMPI to
MEXICAN INSTITUTE<sup>F</sup> OF THE PROPERTY
INDUSTRIAL M for activity relative to wild type.
As stated above, polypeptide variants include modified polypeptides. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, crosslinking , cyclization, disulfide bond formation, demethylation, covalent cross-link formation, cysteine formation, pyroglutamate formation, formylation, gamma-carboxylation, glycosylation, formation of GPI anchor molecules, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer RNA-mediated addition of amino acids to proteins, such as arginylation and ubiquitination.
The term around is used herein to mean approximately, near, or in the vicinity of. When the term around is used in conjunction with a numeric range, it modifies that range by extending the limits above and below the stated numeric values. In general, the term around is used herein to modify a numerical value by
<img file="MX375112B_D0065.tif" />
IMPI
-69MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY above and below the indicated value with a variation of 10%, up and down (higher or lower).
Having described the present invention in detail, it will be more clearly understood by reference to the following examples, which are incorporated herein for illustrative purposes only and are not to be construed as limiting the invention. All patents and publications mentioned herein are hereby expressly incorporated by reference. Example 1. First trial in humans (FiH)
The first human study was an open-label, dose-escalation, Phase 1/2 study to determine the safety, tolerability, and pharmacokinetic (PK) parameters of FIXFc (factor IX fusion protein). recombinant human coagulation). FIXFc is a recombinant fusion protein comprising human coagulation factor IX linked to the Fc domain of human IgGl. The fusion protein is expressed in human embryonic kidney cells (HEK 293). See Example 3.
FIXFc is in development to control and prevent bleeding episodes in patients with hemophilia B (congenital factor IX deficiency or Christmas disease), including the control and prevention of bleeding in surgical settings.
FIXFc is a recombinant fusion protein that
<img file="MX375112B_D0066.tif" />
IMPI
-70MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY comprises coagulation Factor IX (FIX) and an Fe domain of a human antibody (IgGl isotype). The FIXFc molecule is heterodimeric with a single FIXFc chain (FIXFc-se) and a single Fe chain (Fe-se) linked through two disulfide bonds at the hinge region of Fe. See Figure 1 and Table two.
rFIXFc drug product is a clear, colorless solution intended for intravenous (IV) administration. rFIXFc is administered at 1,000 IU per 5 mL volume in a 10 mL single-use vial. The drug product is packaged in USP type I glass vials with a bromobutyl stopper and simple easy-to-remove aluminum seal caps. The rFIXFc drug product contains 200 IU/mL in 10 mM sodium phosphate buffer pH 7.0 with an addition of 145 mM NaCl and 0.1¾ polysorbate 20. The rFIXFc solution must not be diluted.
Study design. A total of 14 previously treated patients with severe hemophilia B were enrolled and treated with FIXFc as an intravenous (IV) infusion over approximately 10 minutes. Six dose levels, 1, 5, 12.5, 25, 50, and 100 IU/kg, were evaluated in the study. One patient per dose level was enrolled at the 1, 5, 12.5, and 25 IU/kg dose levels, and at least three evaluable patients per dose level were enrolled at 50 and 100 IU/kg.
<img file="MX375112B_D0067.tif" />
IMPI
-71 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
After the check-up (scheduled within 14 days of the FIXFc dose), the treatment period for the patients began. The treatment period for each dose level included a single dose of FIXFc (Day 1) until the end of the 72-hour safety observation period (3 days) for dose levels 1 and 5 IU/kg or until take the last PK sample for patients at dose levels 12.5 to 100 IU/kg (approximately 10 days). Patients treated with 1, 5, 12.5, or 25 IU/kg were enrolled and treated sequentially starting at 1 IU/kg. Patients receiving 50 IU/kg were not treated on the same day and at least one day of separate dosing. After treatment of the 50 IU/kg patients, treatment of the 100 IU/kg patients began.
The post-treatment period was a 30-day safety observation period beginning on the day the patient received the FIXFc dose and overlapping with the treatment period as patients were undergoing required study evaluations. , such as PK sampling, during this time.
Patients assigned to dose levels of 12.5 to 100 IU/kg had blood samples taken to assess FIX activity and FIXFc concentration. Blood samples were to be taken just prior to FIXFc administration; 15 minutes after the end of the infusion;
<img file="MX375112B_D0068.tif" />
IMPI
-72MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY and at 1, 3, 6, 9, 24, 48, 72, 96, 120, 168 and 240 hours after the end of the infusion or until the reference FIX levels were reached. If a patient continued to have FIX levels above baseline at the 240 hour time point (Study Day 11), samples were taken at 288 hours (Study Day 13) and again at 336 hours (Study Day 15). of study) if the FIX level was above the reference on Day 13 of the study.
Patient 10 was treated with BENEFIX™ and then had a blood sample taken prior to FIXFc sampling scheduled at 216 hours post dosing. As a consequence, FIXFc activity and antigen data for 216 hours and subsequent time points were excluded from the analysis. No other deviations occurred that were considered to affect the results of the interim analysis of this study.
For the Factor IX antigen, pharmacokinetic analyzes were performed on the concentration of FIXFc observed in the individual patient as a function of time data following an IV infusion of FIXFc. A primary analysis was carried out using model-dependent methodology. FIXFc concentration information was entered into the computer in an open two-compartment model with clearance from the central compartment using defined initial parameter estimates.
<img file="MX375112B_D0069.tif" />
IMPI
-73MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY by the user for the calculation of initial parameter values. Microscopic index constants estimated by WinNonlin were generated and the FIXFc concentration information was evaluated with the function of 1/ (y<sup>1</sup>^ * and<sup>hat</sup>), the information observed in two subjects (for example, Patients 5 and 6) was inadequately described by the two-compartment model. As a consequence, a model-independent analysis was performed on these two patients using WinNonlin non-compartmental analysis of the IV Infusion admission model (linear trapezoidal rule for AUC calculation). For noncompartmental analysis, half-life was calculated from the beta phase using data points that describe the terminal log-linear decline in the regression. A minimum of three points was used to describe the elimination phase. This occurred approximately between days 4 and 14. For antigen PK analyses, mg/kg dose equivalents were used. These values were determined based on a specific activity for FIXFc of 60.2 IU/mg. Actual sampling times, doses, and infusion durations were used for calculations. Nominal sampling hours and doses were used for the creation of concentration time tables and figures. Individual and average PK parameters are presented as well as descriptive statistics. A formal statistical analysis was not performed because the
<img file="MX375112B_D0070.tif" />
IMPI
The dose range and the number of subjects in each cohort were too small for meaningful analyses.
For Factor IX activity, a baseline subtraction method was applied to activity versus time profile according to the baseline subtraction decision tree (FIG. 4). Activity values of <1% were defined at 1 IU/dL per decrease from baseline. Pre-dose times were taken as zero for calculation purposes. In addition, baseline corrected activity information was truncated at time points that represented a return to baseline levels. Pharmacokinetic analyzes were performed on baseline subtracted FIX activity as a function of time data obtained after IV infusion administration of FIXFc. A model-dependent assessment was used for the analysis of IV infusion dose groups. Data with subtraction of reference values were entered into the computer in a two-compartment open model with elimination from the central compartment using estimates of limit parameters defined by WinNonlin for the calculation of initial parameter values. Microscopic rate constants estimated by WinNonlin were generated and FIXFc activity information was weighted with the function of 1/ (γ'^ . γ-^} .
<img file="MX375112B_D0071.tif" />
IMPI
-75MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY sampling, doses and true infusion durations for calculations. Nominal sampling hours and doses were used to create concentration time tables and figures,
Where available from current data, activity at 168 hours post-dose (C168) and time at 1 IU/dL over baseline (TBLP1) of rFIXFc were obtained using WinNonlin-generated microscopic rate constants to stimulate the activity level of FIXFc as a function of time information. Individual and average PK parameters as well as descriptive statistics are presented in this Example. No formal statistical analysis was performed because the dose range and number of subjects in each cohort were too small for meaningful analysis.
Results for FIXFc antigen pharmacokinetics showed that plasma FIXFc concentrations increased markedly after short IV infusion of FIXFc, with C values<sub>max</sub> mean (±SD) of 1670 (n=l), 2730 (n=l), 7510 ± 2480 and 15400 + 3960 ng/mL for nominal dose levels of 12.5, 25, 50 and 100 IU/kg, respectively, and was achieved within the first half hour in all patients. All FIXFc-treated patients had dose-related increases in systemic FIXFc plasma exposure (as assessed by C<sub>raah</sub>xy AUCi<sub>NF</sub>) · Though
<img file="MX375112B_D0072.tif" />
IMPI
-76INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL was limited to a single evaluable patient at the nominal dose 12.5 and 25 IU/kg, the observed increase in both Cmax and AUC<sub>INF</sub>was reasonably dose proportional over the dose range tested. (Table 3 shows group and individual patient mean FIXFc antigen concentration as a function of time data; categorized by nominal dose, actual dose, infusion duration, and patient number. Table 4 shows the group and individual patient FIXFc antigen average summary PK data; sorted by nominal dose, actual dose, mg/kg equivalent dose and patient number, displays group and individual patient FIXFc antigen average summary PK information; classified by nominal dose, actual dose, mg/kg equivalent dose, and patient number [sic] and see Table 11.)
Plasma FIXFc concentrations decreased in a biexponential manner after the short IV infusion. Both distribution (alpha) and elimination (beta) half-lives appeared to be dose-independent over the dose range evaluated with individual patient alpha and beta half-life values ranging from 9.79 to 21.2 hours and 71.0 to 140 hours, respectively. . The mean (±SD) alpha half-life values for the nominal dosage levels of 50 and 100 IU/kg were 13.1 + 4.77 and 12.1 + 2.33 hours, respectively. The average beta half-life values
<img file="MX375112B_D0073.tif" />
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
-ΊΊ(+SD) for nominal dosage levels of 50 and 100 IU/kg were 110 + 26.5 and 95.8 + 11.1 hours, respectively. In addition, primary PK parameter values for Cl, V<sub>yes</sub>s and TMR and, in general, all appeared to be independent of dose in the dose range evaluated. As noted, this evaluation is limited by data from a single patient at the nominal dosage levels of 12.5 and 25 IU/kg. (Table 12 and Figures 2, 7 and 8.)
Furthermore, the mean Cl values were 2.28 + 0.374 and 2.11 + 0.464 mL/h/kg for nominal dosage levels of 50 and 100 IU/kg, respectively. The values of V<sub>H.H</sub>mean were 259 ± 78.5 and 238 ± 52.2 mL/h/kg for nominal dosage levels of 50 and 100 IU/kg, respectively. Additionally, the mean TMR values were 112 + 21.5 and 114 ± 17.1 hours for the nominal dosage levels of 50 and 100 IU/kg.
FIXFc activity-corrected baseline pharmacokinetic results showed that FIXFc activity increased markedly after short IV infusion of FIXFc, with C values<sub>raax</sub> model predicted mean (±SD) of 11.9 (n=l), 19.9 (n=l), 41.6 + 8.97, and 98.2 ± 8.21 IU/dL for nominal dosage levels of 12.5, 25, 50, and 100 IU/dL kg, respectively, and was reached in the first half hour in all patients. (Table 5
<img file="MX375112B_D0074.tif" />
IMPI
-78INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL shows group and individual patient average baseline corrected FIXFc activity as a function of time data; classified by nominal dose, actual dose, duration of infusion and patient number and. Table 6 shows the PK data summary of group average and individual patient FIXFc activity; classified by nominal dose, current dose, mg/kg equivalent dose and patient number.)
All FIXFc-treated patients had dose-related increases in FIX activity (relative to pre-dose baseline response). Although limited to a single evaluable patient at both the 12.5 and 25 ul/kg nominal dose levels, the observed increase in both Cmax and AUCikf was reasonably dose proportional over the dose range evaluated. (Tables 6, 9 and 13 and Figures 3 and 5.)
At the end of the infusion, the decline in baseline-corrected FIX activity showed a biexponential decay, characterized by a rapid distribution (alpha) phase followed by a loglinear elimination (beta) phase. During the alpha phase, the rate of decline in FIXFc activity was fluctuating with half-life values in individual alpha patients ranging from 0.140 to 16.6 hours. The apparent dose-dependent increase in mean alpha half-life values was confounded by a single patient at the nominal dose levels of 12.5 and 25 IU/kg. For him
<img file="MX375112B_D0075.tif" />
IMPI
-79INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL In contrast, elimination half-life (beta) values appeared to be independent of dose over the dose range with beta half-life values in individual patients ranging between 42.1 and 67.4 hours over the 25- to 67-hour dose range. 100IU/kg. Although estimated and reported, the elimination half-life for patient 1 treated with 12.5 IU/kg FIXFc is not included in the summary evaluation since this patient's FIX levels were detected for only up to 96 hours which resulted in a truncated terminal phase and contributed to an underestimation of the terminal elimination half-life. The mean (±SD) beta half-life values for nominal dose levels of 50 and 100 IU/kg were 52.1 ± 10.4 and 52.5 ± 10.1 hours, respectively, and 52.5 ± 9.2 (range 40-67.4) hours for combined nominal doses of 25, 50 and 100 IU/kg. (Tables 6, 8 and 13.)
In addition, primary PK parameter values for Cl, Vi, V<sub>H.H</sub> and TMR and, in general, all appeared to be independent of dose in the dose range evaluated.
In addition, the mean Cl values were 3.77 ± 1.12 and 2.89 ± 0.615 mL/h/kg for the 50 and 100 IU/kg nominal dose levels, respectively, and 3.36 ± 0.928 mL/h/kg for the 25 combined nominal doses. , 50 and 100 IU/kg. (Tables 6, 8 and 13.)
<img file="MX375112B_D0076.tif" />
IMPI
-80MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
V values<sub>yes</sub>Mean s were 264 + 77.6 and 179 ± 31.1 mL/kg for the nominal dose levels of 50 and 100 IU/kg, respectively, and 226 ± 69.8 mL/kg for the combined nominal doses of 25, 50, and 100 IU/kg. . (Tables 6, 8, and 13.) In addition, the mean TMR values were 71.7 +13.0 and 62.8 + 8.82 hours for the nominal dose levels of 50 and 100 IU/kg, respectively, and 68.05 + 11.16 hours for the combined nominal doses of 25, 50 and 100 Ul/kg. (Tables 6, 8 and 13.)
In addition to primary PK parameters, secondary PK parameters (eg, C168, K values, IVR, etc.) were determined to assess the duration of effect of FIXFc. As anticipated, dose-dependent increases in C168, TBLP1, TBLP3, and TBLP5 values were observed. In contrast, K and IVR values appeared to be independent of dose over the dose range tested. Over the total dose range, the individual patient model predicted and observed K values ranged from 0.61 to 1.02 and 0.62 to 1.17 IU/dL per IU/kg, respectively. The model predicted mean K values for the nominal dose levels of 50 and 100 IU/kg were 0.76 and 0.90 IU/dL per IU/kg, respectively, and 0.821 ±. 0.1387 (range 0.61-1.02) hours for combined nominal doses of 25, 50 and 100 IU/kg. The predicted IVR values for the average model for nominal dose levels of 50 and 100
<img file="MX375112B_D0077.tif" />
IMPI
-81 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Ul/kg were 34.5 and 35.1%, respectively. The mean observed K values for the nominal dose levels of 50 and 100 IU/kg were 0.86 and 1.02 IU/dL per IU/kg, respectively, and 0.926 + 0.1787 (range 0.97-1.17) IU/dL per 1 IU/kg. for combined nominal doses of 25, 50 and 100 IU/kg. The mean observed IVR values for the nominal dose levels of 50 and 100 IU/kg were 39.2 and 39.8%, respectively. (Tables 6, 7, 8, and 13.) Tables 7A-7B show the summary information for individual patient and group average FIXFc PK secondary activity, sorted by nominal dose, actual dose, and patient number.
Each 1 IU/kg of infused rFIXFc increased plasma FIX activity by 0.93 ± 0.18 IU/dl on average, and this gradual recovery (K value) showed a weak positive correlation with body weight (R<sup>2</sup>=0.336, p=0.048) (Figure 23).
Pharmacokinetic estimates for FIXFc activity were consistent with those for the rFIXFc antigen (eg, compare Tables 13 and 14). Furthermore, there was an excellent correlation between rFIXFc activity and antigen levels, indicating preservation of rFIXFc activity in vivo. (Figure 9.) Additionally, related to the historical information for BENEFIX™ (Wyeth), rFIXFc demonstrated (Table 8) the following:
<img file="MX375112B_D0078.tif" />
IMPI
-82 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Dose linearity from 25-100 IU/kg 3-fold increase in ti/<sub>2</sub>beta 3-fold increase in mean residence time
24% enhanced gradual recovery 2.5-fold reduction in clearance
FIXFc is a recombinant fusion protein comprising FIX linked to the Fc domain of human IgGl. FIXFc has been designed to be a long-acting version of FIX. Preclinical studies with FIXFc have shown a prolongation of the half-life of FIX activity compared to BENEFIX™, the commercially available recombinant FIX product. The rationale for this study was to evaluate the safety and PK of FIXFc in patients with severe hemophilia B. For this study, 12 evaluable subjects aged between 18 and 76 years were available for PK evaluation. Each subject received a single administration of FIXFc at a nominal dose of 12.5, 25, 50, or 100 IU/kg body weight infused intravenously over approximately 10 minutes. Plasma samples for PK assessments of FIXFc activity and antigen concentrations were obtained before infusion, as well as up to 14 days after dosing. The PK of both antigen and FIXFc activity was independently characterized in this study using model-dependent and model-independent methods.
<img file="MX375112B_D0079.tif" />
IMPI
-83MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
FIXFc was well tolerated following single IV doses of 12.5, 25, 50, and 100 IU/kg body weight. There were no serious adverse events related to the drug in the present study. No neutralizing or binding antibodies to rFIXFc were detected in any subject.
Approximate dose-proportional increases in Cmax and AUC were observed.<sub>INF</sub> in antigen and FIXFc activity following doses of 12.5 to 100 IU/kg, but V and C1 were similar across all doses. These results indicate that FIXFc antigen and activity showed linear PK over the dose range tested. Relatively small V parameter values may indicate that FIXFc enters the interstitial fluid but does not cross the cell membrane into intracellular fluids.
Peak plasma levels of antigen and FIXFc activity were observed up to 0.5 hours before the end of the infusion and remained detectable for several days after dosing. Evidence of reduced clearance and prolonged half-life in antigen and FIXFc activity were observed.
The mean clearance and terminal elimination half-life values associated with FIXFc antigen concentrations for the 50 and 100 IU/kg dose levels were 2.28 and 2.11 mL/h/kg and 110 and 95.8 hours,
<img file="MX375112B_D0080.tif" />
IMPI
-84MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY respectively. Similarly, the mean clearance and terminal elimination half-life values associated with FIXFc activity levels in the same dose range were 3.77 and 2.89 mL/h/kg and 52.1 and 52.5 hours, respectively. Comparison of the FIXFc PK activity results observed in the current study with those that reported PK for BENEFIX™ activity (Summary of Product Characteristics of BENEFIX™; Nov 18, 2009) revealed an approximate 3-fold reduction in the FIXFc clearance and an approximate 3-fold increase in FIXFc terminal elimination half-life and mean residence time compared to BENEFIX™.
With the improvements seen in PK, FIXFc will provide prolonged protection against bleeding, allowing individuals with Hemophilia B to have injections less frequently. Based on the results of this trial, rFIXFc can be administered every two weeks or twice a month using doses of 100 IU/kg and at least once a week using lower doses. The method requires fewer injections. In addition, the use of rFIXFc will have other potential clinical impacts such as: central venous access, improved method compliance, reduction of frequent bleeding, and increased protection of joints from bleeding.
Example 2. Phase 1/2/3 trial of B-LONG
<img file="MX375112B_D0081.tif" />
IMPI
-85 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
This is an open-label, multicenter evaluation of the safety, pharmacokinetics, and efficacy of recombinant long-acting coagulant fusion Factor IX Fe (rFIXFc) in the prevention and treatment of bleeding in previously treated subjects with severe hemophilia B. Treatment with FIX products currently available on the market requires dosing 2-3 times per week. A product with a long half-life that extends the required dosing interval to once a week or more might be viewed by the medical community as a significant improvement in the treatment of patients with severe hemophilia.
Dosage levels vary widely for rFIX products in clinical prophylaxis studies: reported doses range from 10 to 171 IU/kg (Roth et al, Blood 98:3600 (2001)) or 40 to 100 IU/kg ( MASAC Recommendation 177, National Hemophilia Foundation (October 2006). Also, trough FIX activity levels during prophylactic treatment in subjects without clinical signs of bleeding are expected to range from 0.2 to 3.8 IU/dL (Carlsson et al., Hemophilia 4:83 (1998)). Individual dosage regimens based on a patient's clinical status are common practice given the variability between individual patients.
The results of the phase 1/2a study (Example 1) that
<img file="MX375112B_D0082.tif" />
IMPI
-86 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY evaluates the safety and pharmacokinetics of a single dose of a frozen liquid formulation of rFIXFc have shown that the drug is well tolerated at doses ranging between 1 and 100 IU/kg, and the pharmacokinetic characterization advantages over currently available treatments, namely half-life and TMR 3 times greater than previously reported for BENEFIX™ (61 hours vs. 19 hours). The purpose of this study is the eventual determination of estimated PK parameters of lyophilized rFIXFc in humans to compare them with estimates of PK parameters of BENEFIX™ in humans and to demonstrate the efficacy of lyophilized rFIXFc in the prevention and treatment of bleeding and the safety of its dosage. repeated for previously treated subjects with severe hemophilia B.
The study will involve four arms: a low-dose prophylactic regimen (n=25), a high-dose prophylactic regimen (n=25), an on-demand regimen (n=20), and a major surgery regimen (n=5). . The low dose regimen group will include a PK subgroup (n=16) dosed with BENEFIX™ followed by switching to rFIXFc.
The main study objectives are: to assess the safety and tolerability of rFIXFc in all treatment groups, to assess the efficacy of rFIXFc in all treatment groups, and to assess the prophylactic efficacy in on-demand therapy (comparison of the annual amount of
<img file="MX375112B_D0083.tif" />
-87IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY bleeding episodes between Groups 1 and 2 and against Group 3 on demand).
The secondary objectives of the study are: to compare the estimated PK parameters of rFIXFc and BENEFIX™, to evaluate the efficacy of rFIXFc in the on-demand and surgical groups, to evaluate and compare the estimated PK parameters of rFIXFc at baseline and at Week 26 (+ 1 week) in the PK subgroup, assess the response of subjects to treatment in all groups, and assess rFIXFc consumption in all groups.
Main inclusion criteria:
Male gender, 12 years and older and weighing at least 40 kg
Diagnosis of hemophilia B (Factor IX reference level less than or equal to 2%)
History of at least 100 days of exposure to any Factor IX product
Platelet count 5:100,000 cells/pL
INR (International Normalized Ratio) 1.4 0 as defined by the normal range of the laboratory performing the test
CD4 count 5200 cells/pL
Main exclusion criteria
History of Factor IX inhibitors
Kidney or liver dysfunction
Diagnosis of another coagulation defect other than
<img file="MX375112B_D0084.tif" />
IMPI
-88 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY Hemophilia B
Previous history of anaphylaxis associated with the administration of any FIX or IV immunoglobulin.
Intake of immunosuppressive drugs (for example, systemic corticosteroids, however, intake of HAART (highly active antiretroviral therapy) is allowed).
Example 3. Production of FIXFc in HEK293 cells
FIXFc was produced in stably transfected HEK293 cells containing a FIXFc expression cassette (naturally occurring FIX directly fused to the Fe region) and an Fe expression cassette alone. In addition, the cells were transfected with an expression cassette for PC5, which is a processing enzyme that allows the complete processing of the FIX propeptide. Transfected cells were cultured in serum-free suspension medium containing vitamin K, and secreted all three proteins. FIXFc dimer, FIXFc monomer (one FIXFc chain and one Fe chain) and Fe dimer. FIXFc monomer (FIXFc) was purified by column chromatography (pseudo-affinity elution with Protein A, Fractogel DEAE and Q Sepharose with CaCl<sub>2</sub> low ionic strength), was virally inactivated and filtered for administration to human subjects. See also Peters et al., Blood Mar 11, 2010; 115(10):2057-64 (Epub 2010 Jan 7) and patent
<img file="MX375112B_D0085.tif" />
IMPI
-89 MEXICAN INSTITUTE OF US INDUSTRIAL PROPERTY N° 7,566,565; which are incorporated herein in their entirety by this reference.
FIXFc coagulant activity was measured by quantifying its ability to return coagulant activity to FIXFc-deficient plasma using MLA Electra 1600C (Medical Laboratory Automation/Instrument Labs, Pleasantville, NY). Results were compared to the calibration curve generated using serial dilutions of a World Health Organization FIX standard.
Serine phosphorylation and tyrosine sulfation of Factor IX are considered to be important for recovery in vivo. MONONINE™ (plasma-purified Factor IX (pdFIX) marketed by CSL Berhing) has been reported to exhibit better in vivo recovery than BENEFIX™ (recombinant FIX (rFIX) marketed by Wyeth) due to the higher level of phosphorylation/sulfation of MONONINE ™ (>90%/>90% vs. <10%/5%). However, FIXFc produced in HEK293 cells exhibits virtually no phosphorylation/sulfation (<10%/4%, very similar to BENEFIX™) and exhibits better IVR (1.0 IU/dl per IU/kg) than BENEFIX™ (0.7).
Additionally, FIXFc produced as described above had a significantly (10-100-fold) lower level (0.01-0.001%) of activated FIX (FlXa), a product-bound impurity, than MONONINE™ (pdFIX) or BENEFIX. ™ (rFIX) (0.1%). The resulting FIXFc will have
<img file="MX375112B_D0086.tif" />
IMPI
-90 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY fewer unwanted thrombotic events after administration of MONONINE™ or BENEFIX™.
Example 4. Pediatric studies: Extrapolation and interrelation between development in adult and pediatric populations.
Patient characteristics that demonstrate a relationship to FIX pharmacokinetics include age-dependent physiological changes (Bjorkman and Berntorp, Clin, Pharmacokinetics 40:815-32 (2001) and Bjorkman, Hemophilia 9(suppl. 1):101- 10 (2003)) and body size and composition (Shapiro, Hemophilia 11:571-82 (2005)). Therefore, it has been determined that generally the weight-adjusted clearance (CL) of FIX decreases with age and/or body weight during growth from childhood to adulthood, with a corresponding increase in terminal half-life {ti/2). For the rFIX product (BENEFIX™), CL and volume of distribution at steady state (Vss) increase in children and then remain constant throughout adulthood, so these parameters are closely monitored in pediatric studies.
The maximum levels of FIX procoagulant activity (FIX:C) depend on the initial volume of distribution of FIX:C after a single dose and/or repeated doses of FIX. The initial distribution of FIX is fast. However, it has been shown that the in vivo recovery (average gradual recovery) for BENEFIX™ was typically 30% less than that for
<img file="MX375112B_D0087.tif" />
IMPI
-91 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY a monoclonal antibody-purified plasma-derived coagulation factor (pdFIX) (Roth et al., Blood 98:3600-3606 (2001)). Furthermore, studies with pdFIX have shown that subjects 15 years of age or younger have significantly less recovery than those who are older (White et al., Thromb. Haemost. 73:779-84 (1995)). Therefore, trough and peak levels will also be monitored in pediatric studies.
Since studies have shown that children may respond differently from adults, pharmacokinetic evaluations will be performed at baseline with 50 IU/kg rFIXFc in children with abbreviated pharmacokinetic sampling.
The phase I/2a study (SYN-FIXFc-07-001) that evaluated the safety and pharmacokinetic profile of a single intravenous administration of rFIXFc in PTPs aged 18 years and older with severe hemophilia B was recently completed. Preliminary results from this initial screening in humans demonstrate an approximately 3-fold increase in pharmacokinetic parameters (mean terminal half-life, TMR, and AUC) of rFIXFc compared to what has been reported in the literature for BENEFIX™ (see above). ). Additionally, rFIXFc was well tolerated and there were no signs of injection site reactions or development of inhibitors. Taken together, these safety and pharmacokinetic results support the initiation of a
<img file="MX375112B_D0088.tif" />
IMPI
-92INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL informative phase 1/2/3 study (Study 998HB102 (B-LONG), see above) to evaluate the safety, pharmacokinetics and efficacy of rFIXFc in the prevention and treatment of bleeding in 104 PTP (with at least 100 treatment ED for prior products) 12 years or older with severe hemophilia B (<2%) . Once data from the registry study are available, a pediatric program will be initiated to further investigate the safety and efficacy of rFIXFc in children. If prolonged rFIXFc half-life were to be demonstrated in humans, it would mean that less frequent injections would be necessary to individuals with hemophilia B for the prevention and treatment of bleeding.
Phase 2/3 PTP Pediatric Study in Treatment-Experienced Children (<12 Years)
Once data from 10 PTPs (^12 years) for 26 EDs from the registry study (Study 998HB 102) are available, a phase 3 pediatric study will be initiated. This phase 2/3 pediatric study in PTPs in patients who submitted at least 50 EDs for FIX products prior to their participation, will be held globally at approximately 25 clinical sites. Approximately 25 PTPs (to ensure 20 evaluable subjects) ages 2-11 with severe hemophilia B (<2 IU/dL [<2%] endogenous FIX) will be tested and selected according to the criteria defined above. All evaluable subjects
<img file="MX375112B_D0089.tif" />
IMPI
-93INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL will complete the pharmacokinetic part of the study (PK with FIX product prior to the study and then PK with rFIXFc) and will receive weekly doses of rFIXFc for 52 weeks. This study will record the gradual recovery, in vivo half-life, AUC, and clearance of rFIXFc. All subjects will undergo pharmacokinetic evaluation at baseline with pre-study FIX and rFIXFc, and the study duration for each subject will be approximately 69 weeks, including analysis and follow-up.
Each subject will receive 50 IU/kg rFIXFc at baseline for pharmacokinetic evaluation followed by a repeat weekly dose of 50-60 IU/kg rFIXFc. For patient adherence, abbreviated pharmacokinetic sampling will be used for a pre-study product and for rFIXFc as follows: pre-dose, end of injection, 30 + 10 minutes, 3 ± 1 hours, 24 ± 3 (Day 1), 72 ± 3 {Day 3), 120 + 3 {Day 5) and 168 + 3 hours (Day 7) after the end of the injection. Regarding immunogenicity, all subjects will be treated with rFIXFc weekly for a minimum of 50 ED. Safety parameters will be included for determination of immediate safety and tolerability such as: (a) vital signs (pulse, blood pressure, respiratory rate, temperature) before rFIXFc injection and 30 minutes after injection; (b) haematological parameters and
-94 coagulation; (c) clinical biochemistry; (d) frequent FIX inhibitor determinations with the Nijmegen modified Bethesda assay (immediately before first exposure, ED4 [week 4], ED12, ED24, ED36 and ED50 and (e) 5 adverse events.
Efficacy will be evaluated by assessing the number of bleeding episodes, bleeding intervals and number of treatments and consumption of FIX per annualized year and per event.
Phase 2/3 PUP Pediatric Study in Treatment-Naïve Children (0-11 Years)
Once data from 10 treatment-experienced children (2-11 years) with complete pharmacokinetics and 50 EDs are available in study 15 above, a pediatric PUP study will be initiated. in English] phase 2/3. This study will be conducted globally at approximately 60 clinical sites. Approximately 30 PUPs (to ensure 20 evaluable subjects) 20 0 years and older with severe hemophilia B (<2 IU/dL [<2%] endogenous FIX) will be tested and selected according to the criteria defined above.
Participation in the study will vary as initial treatment may begin with rFlXFc as a modified prophylactic regimen. It is expected that the participation
<img file="MX375112B_D0090.tif" />
IMPI
-95MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY each patient in the study for approximately four years, including analysis and follow-up. During this time, patients are expected to reach 50 ED for rFIXFc. Regarding immunogenicity, all subjects will be treated with approximately 50 ED of rFIXFc or up to four years. Safety parameters for the determination of immediate safety and tolerability will be included: (a) frequent FIX inhibitor determinations with the modified Bethesda assay with Nijmegen and (b) adverse events.
Efficacy will be evaluated by assessing the number of bleeding episodes, bleeding intervals and number of treatments and consumption of FIX per annualized year and per event.
Example 5. Biochemical characterization, activity and PK analysis in non-human animals
The rFIXFc produced in Example 3 was characterized for its post-translational modification and the following results were obtained (see Table 15 and Figure 11). The rFIXFc propeptide was processed appropriately during production. The gamma carboxylation pattern of rFIXFc was similar to that of rFIX. Additionally, Gla/total molecule {11.2 ± 0.7) of rFIXFc was comparable to rFIX. Since gamma carboxylation at certain residues is essential for FIX activity, these are important results. Furthermore, phosphorylation of Ser 158 and sulfation of Tyr 155 of
<img file="MX375112B_D0091.tif" />
IMPI
-96MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY rFIXFc were comparable to rFIX. The N-linked glycans in FIX are not completely sialylated, as in rFIX. The O-linked glycosylation of rFIXFc in the first EGF domain was the same as FIX, but in different relative proportions. Asp 64 of rFIXFc exhibited a higher degree of beta-hydroxylation than rFIX or plasma-derived FIX (pdFIX). Activated FIX was present at a much lower level in the rFIXFc preparation than in the rFIX or pdFIX preparations, as discussed in detail in Example 3.
Additionally, rFIXFc was administered to various animal species to determine its activity and PK parameters. The results are presented in Table 16 and Figures 12-16.
Example 6. Gamma Carboxylation
Analyze and characterize the γ-carboxylation of glutamic acids (Gla) in a preclinical amount of FIXFc material and commercially available FIX products were the objectives of this study, to characterize Gla content in an enriched peak fraction and a ribbon fraction. of high salt elution originating from a pseudo-affinity chromatography ion exchange step, and to further separate an enriched peak and a high salt elution band fraction by ion exchange HPLC and further characterize the separated species.
<img file="MX375112B_D0092.tif" />
IMPI
-97 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
To achieve these goals, a number of complementary analytical methods were developed. These include amino acid analysis (ΑΆΑ) with basic hydrolysis to determine (total) Gla content, peptide mapping (LC/MS) using Lys-C peptides to determine Gla distribution, analytical ion exchange HPLC of intact molecules to determine separate isoforms and activated partial thromboplastin time (aPTT) to determine biological activity.
The two peptides that contain Gla (E) are:
-K1K2 : YNSGKL<sup>7</sup>AND<sup>s</sup>EFVQGNL<sup>15</sup>ER<sup>17</sup>NDE<sup>20</sup>AND<sup>21</sup>EK • [M+H]+6 Gla = 2953.9 • [M+H]+5 Gla = 2909.9
-K3 ; CSF<sup>26</sup>AND<sup>27</sup>EAR<sup>30</sup>£FV<sup>33</sup>ENT<sup>3S</sup>ERTT<sup>40</sup>EFWK • [M+H]+6 Gla = 2959.9 • [M+H]+5 Gla = 2915.9 • [M+H]+4 Gla = 2871.9
Thirty micrograms of sample (originating from enriched peak fraction, high salt ribbon fraction and each species from analytical ion exchange HPLC) were denatured, reduced, alkylated and digested with Lys-C (1:20 E:S). The digest was quenched with 2% TFA and injected onto a Phenomenex Jupiter C18 column (2.0 x 250 mm). The separation was carried out on an Agilent 1100 system. The column was kept at 25°C.
<img file="MX375112B_D0093.tif" />
IMPI
-98MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY and peptides were eluted with a multi-step acetonitrile gradient. Mass spectrometry (Thermo-Fisher LCQ) was carried out in Triple Play mode.
Complementary methods were developed to analyze and characterize Gla content and preclinical distribution of rFIXFc material. The content and distribution of the γ-carboxylation of glutamic acids (Gla) in a preclinical amount of rFIXFc (enriched peak fraction) was carried out and compared to commercially available products. Analysis showed that Gla content and distribution are similar to those of commercially available products. A high salt eluting ribbon fraction was analyzed and compared to the enriched peak fraction. Analysis indicated a reduced level of y-carboxylation.
FIXFc (enriched peak fraction) was isolated from the ion exchange step of pseudo-affinity chromatography and further separated into 3 isoforms by analytical ion exchange HPLC. Species loaded and separated by AEX column were highly γ-carboxylated. (AEX column loading is the ribbon fraction collected during a high salt elution step of the pseudo-affinity chromatography ion exchange step. Species
<img file="MX375112B_D0094.tif" />
IMPI
-99MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY loaded and separated by AEX column were biologically active. Gla content and distribution were similar to rFIX. The peptide map indicates the distribution of 4/5/6 Gla in peptide K3. The peptide map indicates an elevated population of 6 Gla in peptide K1K2 and a trace level of 5 Gla.
FIXFc (ribbon fraction) was isolated from the pseudo-affinity chromatography ion exchange step and further separated into 2 isoforms by analytical ion exchange HPLC. Species loaded and separated by AEX column were reduced in γ-carboxylation level. The relative content of Gla was reduced relative to the peak fraction enriched for FIXFc. A decreased level of biological activity was observed. The peptide map indicates an increased population of 5 Gla in K1K2 relative to the enriched peak fraction and may suggest an impact on biological activity.
References (each incorporated herein in its entirety by this reference): Dumont JA, et al., Monomeric Fe Fusion Molecules in Therapeutic Abs-From Bench to Clinic, Ch. 33 p. 779-795; Gillis S, et al., Protein Science (1997) 6:185; White GC, et al., J. Thrombosis and Haemostasis (1997) 78:261; Hansson K and Stenflo J, Journal Thrombosis and Haemostasis (2005) 3:2633 and Peters RT, et al., Blood (2010) 115:2057.
<img file="MX375112B_D0095.tif" />
IMPI
-100 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Example 7. Effect of the procoagulant activity of rFIXFc in bleeding models of HemB mice
Comparable potency of rFIXFc and BENEFIX* was demonstrated in HemB ROTEM mouse whole blood in vitro and in a HemB mouse tail cut bleeding model in vivo”
The ability of rFIXFc to form stable and firm clots was evaluated by rotary thromboelastometry (ROTEM®, Pentapharm GmbH, Munich, Germany) with calcium chloride as activator (NATEM). Whole blood pools collected from the vein each of HemB mice were divided into seven aliquots to which rFIXFc was added to a final concentration of 7.4%, 0.74%, and 0.074% normal FIX activity or BENEFIX™ up to 10%, 1 %, 0.1% of normal. FIX formulation buffer was added to the blood sample, as a negative control. A total of 10 blood pools from 5 HemB mice were generated to complete the evaluation. The NATEM reaction was started with the addition of CaCls· Coagulation parameters including clotting time (CT), clot formation time (CFT) and Alpha angle were evaluated. The means and SD of CT, CFT and Alpha angle are summarized in Table 17. Dose responses for the three parameters are plotted in Figure 17. All three parameters are comparable between rFIXFc and BENEFIX™ over the dosage range tested ((p>0.05 by one-way ANOVA (Kruskal-Wallis)).
<img file="MX375112B_D0096.tif" />
IMPI
-101 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
The acute efficacy of rFIXFc in HemB mouse tail cut bleeding models was also evaluated. (Figure 18). Male HemB mice were stratified to achieve a presentation of equal body weight and age in different treatment groups. Before tail cuts were made, mice were anesthetized with a cocktail of 50mg/kg ketamine and 0.5mg/kg dexmedetomidine and placed on a heating pad to maintain body temperature. The tails of the mice were then immersed in water at 3-7°C for 10 minutes to dilate the lateral vein. When the veins were dilated, rFIXFc, BENEFIX™ or vehicle was injected into the tail vein and 5 minutes later the distal 4 mm of the tail was cut with a #11 straight edge scalpel. The blood that came out of the wound was collected over 13 ml of warm saline solution for 30 minutes and the blood loss was quantified gravimetrically. Six rFIXFc treatment groups (720, 360, 240, 120, 80, 40 IU/kg, n=15) and three BENEFIX™ treatment groups (360, 120, 40 IU/kg, n=15) were analyzed. ). Curves of blood loss and dose response values for mean blood loss are shown in Figure 19A and Table 18 summarizes the mean volumes of blood loss for each treatment group. Dose response in mean volumes of blood loss for rFIXFc and BENEFIX™ are comparable (p = 0.9315 based on
<img file="MX375112B_D0097.tif" />
IMPI
-102INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL correction by unpaired Welch's t-test),
The present inventors evaluated the efficacy of rFIXFc and BENEFIX™ in both an ex vivo ROTEM* assay and a model of tail transverse bleeding (TVT) in HemB mice to determine if the extended half-life 3-fold increase in rFIXFc relative to BENEFIX™ resulted in the prolonged efficacy of rFIXFc. Figure 20.
in ROTEM<sup>1</sup> ex vivo, HemB mice received 50 IU/kg rFIXFc or 100 IU/kg BENEFIX™ by intravenous injection. Whole blood was collected from the vena cava of treated animals 5 minutes, 24, 72, 96, 120, 168, and 216 hours after the rFIXFc dose (n=8 mice at each time point) or 5 minutes, 24, 48 , 72 and 96 hours after BENEFIX™ dosing (n=4 mice/time point). Blood samples were immediately analyzed by NATEM. The means and SD of CT, CFT and alpha angle are presented in Table 19, and the curves of CT, CFT and alpha angle as a function of time are shown in Figure 21, Compared to BENEFIX™, rFIXFc demonstrated CT, CFT and alpha angle comparable at 5 minutes, but CT, CFT and alpha angle significantly increased after 72 hours, despite a 2-fold lower dose relative to BENEFIX™.
Male HemB mice were stratified to achieve equal representation of body weight and age in 9
103 different treatment groups to assess the efficacy of rFIXFc and BENEFIX<sup>1</sup>. rFIXFc was administered by intravenous injection at doses of 4 IU/kg, 13 IU/kg, 40 IU/kg, and 120 IU/kg 72 hours before tail vein transection, while the same doses of BENEFIX were administered. ™ 24 hours prior to injury. Before tail vein transections were made, mice were anesthetized with a cocktail of 50 mg/kg ketamine/0.125 mg/kg dexmedetomidine/0.1 mg/kg buprenex. For mice to maintain normal activity after tail vein transection, 1 mg/kg atipamezole solution is administered to reverse the effect of dexmedetomidine, which was administered immediately after tail vein transection. tail with a number 11 straight edge scalpel in an area where the diameter of the tail is approximately 3 mm. The blood that spurted out was washed away with warm saline to ensure good vision of the wound, and then the mouse was placed alone in a clean cage with white bedding paper for the next 24 hours. Rebleeding and physical activity were observed and recorded every hour up to 12 hours post-injury. Dying mice were euthanized immediately after they were identified and a control was performed 24 hours after injury to complete the study. The Kaplan-Meier curve of time
104 Figure 22 shows euthanasia and the table of survival rates 24 hours after TVT. It was determined by log-rank test that all treatment groups with doses greater than 4 IU/kg were significantly better than the group with doses greater than 4 IU/kg. vehicle {p< 0.001). Furthermore, survival is comparable between mice receiving the same dose of rFIXFc 72 hours prior to injury and those receiving BENEFIX™ 24 hours prior to injury (p= 0.4886, 0.9268, 0.7279, and 0.5209 for 4, 13 dose groups). , 40 and 120 IU/kg, respectively). Survival rates 24 hours after TVT were plotted and the ED50 value for each molecule was extrapolated from the curve. The ED50 value for both treatments was similar, 17.8 Ul/kg for rFIXFc and 15.4 Ul/kg for rFIX. Thus, rFIXFc provided a 3-fold longer duration of protection in HemB mice relative to a comparable dose of BENEFIX™ as measured by survival and post-injury rebleeding by cross section of the vein. tail. Thus, rFIXFc provided a 3-fold longer duration of protection in HemB mice relative to a comparable dose of BENEFIX™ as measured by survival and post-injury rebleeding by cross section of the vein. tail.
In conclusion, as evidenced by the data, while 15.4 IU/kg of BENEFIX™ resulted in
<img file="MX375112B_D0098.tif" />
IMPI
-105MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY 24 hours post-dose survival of 50% of HemB mice that underwent tail vein transection, 17.8 IU/kg rFIXFc achieved 50% survival 72 hours after dosing in animals that sustained injuries. Therefore, rFIXFc demonstrated a 3-fold greater prophylactic efficacy correlated to its half-life extension relative to BENEFIX™. The results of the bleeding models were further corroborated by ex vivo ROTEM analysis of mouse whole blood.
HemB treated with either 100 IU/kg BENEFIX™ or 50 IU/kg rFIXFc. Comparable improvement in clot formation was observed in both treatment groups 5 minutes post-dose. However, the most important ROTEM parameters such as clotting time, clot formation time, and alpha angle were significantly improved in rFIXFc-treated mice between 72 and 216 hours post-dose despite dose 2 fold lower rFIXFc relative to BENEFIX™.
In summary, the acute potency of rFIXFc is comparable to that of BENEFIX™ as shown in ROTEM* whole blood in vitro and in the tail-cut bleeding model in HemB mice. The prolonged Φ 4 prophylactic efficacy of rFIXFc was demonstrated in ex vivo ROTEM whole blood from treated HemB mice and was determined to be approximately
3 times longer compared to BENEFIX™ in the model of
<img file="MX375112B_D0099.tif" />
IMPI
-106 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY Cross-sectional bleeding in the tail vein of HemB mice. The prolonged efficacy of rFIXFc correlates with the Ti/<sub>3</sub> 3-fold increase in rFIXFc relative to BENEFIX™ previously demonstrated in pharmacokinetic study in HemB mice. Therefore, rFIXFc is fully active for on-demand treatment while achieving significantly prolonged prophylactic protection with the potential to reduce dose frequency, which is under investigation in the phase 3 study.
Example 8. Pharmacokinetic and pharmacodynamic analysis of rFIXFc and BENEFIX™ after a single subcutaneous dose in FIX-deficient mice
The pharmacokinetic (PK) and pharmacodynamic (PD) profiles of recombinant Factor IX-Fc (rFIXFc) and BENEFIX™ (rFIX) were determined following a single intravenous or subcutaneous injection of 200 or 400 IU/kg in FIX-deficient mice. Whole blood was collected via the vena cava (n=4 mice/time point/treatment). Plasma concentrations of rFIXFc and BENEFIX™ were determined by an ELISA assay specific for human FIX. The activities of rFIXFc and BENEFIX™ were determined using an activated partial thromboplastin time (aPTT) assay. PK analyzes were carried out using a model-dependent methodology with
<img file="MX375112B_D0100.tif" />
IMPI
-107 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
WinNonLin. The results are shown in Tables 22 and 23.
Bioavailability in FIX-deficient mice was 38% for the 200 IU/kg dose and 38-46% for the combined dose (ELISA for antigens) and 29% for the 200 IU/kg dose and 29-39 % for combined dose (aPTT activity assay) for FIXFc compared to rFIX, 23% and 19%, respectively. rFIXFc exhibited 1.5-1.7-fold (200 IU/kg dose) and 1.5-2.5-fold (combined dose) improved bioavailability compared to BENEFIX™.
The terminal half-life (antigen ELISA) was 62 hours for the 200 IU/kg dose and 51-62 hours for the combined doses, and the terminal half-life (aPTT activity assay) was 42 hours for the 200 IU/kg dose. IU/kg and 4042 hours for the combined doses for rFIXFc, while for BENEFIX™ the terminal half-life was 24 hours (antigen ELISA) for the 200 IU/kg dose and 17 hours (aPTT activity assay). ) for the 200 IU/kg dose. This indicates a 2.5-2.6-fold improvement (200 IU/kg dose and combined dose) in half-life with rFIXFc.
Furthermore, as shown in Tables 22 and 23, rFIXFc exhibited a 4.5-5.6-fold increase in AUC/dose and a 1.9-3.7-fold increase in Cmax/dose as a function of BENEFIX™.
Recombinant factor IX Fe fusion protein
<img file="MX375112B_D0101.tif" />
IMPI
-108 INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL (rFIXFc) is a long-acting form of recombinant FIX (rFIX) that will provide less frequent doses of rFIX for the treatment of hemophilia B. From mice to non-human primates and patients with hemophilia B, rFIXFc has an approximately 3-fold longer half-life than rFIX (BENEFIX™). Intravenous administration of rFIX remains a laborious delivery method for prophylactic treatment, especially for children and patients with poorly accessible veins. Subcutaneous administration of rFIX appears to be a more attractive route of administration that is less invasive and has a lower dosage frequency. As such, subcutaneous administration of rFIXFc will cause less pain and discomfort than intravenous administration and will result in better compliance since it is easier to administer and takes less time to administer than intravenous administration. Prophylactic regimens will also improve quality of life and clinical outcomes will include a lower incidence of bleeding.
The concentration of rFIXFc in mouse plasma was measured using an ELISA specific for human FIX which measured the FIX part of the molecule and the nominal mg/kg dose was used in the analysis. A summary of the PK parameters for rFIXFc and BENEFIX™ is presented in Table 20 (ELISA for antigens) and Table 21 (aPTT activity assay) for n=4/group. So much
<img file="MX375112B_D0102.tif" />
IMPI
-109INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL both antigen analysis and activity analysis showed that Cmax and AUC were significantly improved for rFIXFc against BENEFIX™. Bioavailability (F%) was 38% for rFIXFc versus 23% for BENEFIX™ using antigen ELISA. Similarly, bioavailability was 29% for rFIXFc versus 19% for BENEFIX™ using the aPTT activity assay. Therefore, rFIXFc demonstrated a 1.5- to 1.6-fold increase in bioavailability over BENEFIX™. Elimination half-life measurements demonstrated that rFIXFc markedly increased half-life whether measured by antigen assays (62 hours rFIXFc vs. 24 hours BENEFIX™) or activity (42 hours rFIXFc vs. 17 hours BENEFIX™). These data show that rFIXFc exhibited a 2.6- to 2.5-fold extended half-life relative to BENEFIX™.
Subcutaneously administered rFIXFc to FIX-deficient mice demonstrated PK and Pd profiles with increases in Cmax and AUC for rFIXFc compared to BENEFIX™. Overall, the bioavailability for rFIXFc ranged from 29% (activity) to 38% (antigen) with a half-life of 42 hours (activity) to 62 hours (antigen) compared to BENEFIX™, which had a bioavailability of 19- 23% and a half-life of 17-24%, respectively. Thus, the half-life for rFIXFc administered subcutaneously to FIX-deficient mice demonstrated an increase of 2.2
<img file="MX375112B_D0103.tif" />
IMPI
-110 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY (antigen) to 3.3 (activity) times over currently commercially available rFIX products that are administered intravenously. Overall, these data support the notion that subcutaneously administered rFIXFc will be clinically beneficial for the prophylactic treatment of patients with hemophilia B.
Example 9. Pharmacokinetic analysis of rFIXFc after a single subcutaneous dose in Cynomolgus monkeys
The pharmacokinetic (PK) profile of recombinant Factor IX-Fc (rFIXFc) was studied after a single subcutaneous dose of 50 IU/kg, 100 IU/kg, or 200 IU/kg in cynomolgus monkeys. Plasma rFIXFc concentration was measured using FIX-specific ELISA. A primary analysis was carried out using model-dependent methodology with WinNonLin. See Tables 22-25.
Pharmacokinetic analyzes of plasma concentration versus time data (measured by FIX-specific ELISA) demonstrated similar bioavailability and terminal half-life between doses. Bioavailabilities for rFIXFc were 40% (50 IU/kg), 34% (100 IU/kg), 36% (200 IU/kg), and 36-45% (combined doses). Terminal half-lives for rFIXFc were 61 hours (50 IU/kg), 45 hours (100 IU/kg), 49 hours (200 IU/kg), and 44-58 hours (combined doses).
The concentration of rFIXFc in monkey plasma was measured.
111 using a FIX-specific ELISA that measured the FIX part of the molecule and the nominal mg/kg dose was used in the analysis. Growth and recovery analysis demonstrated the accuracy of this FIX-specific ELISA in detecting rFIXFc outside the range of plasma concentrations tested. A summary of the PK parameters for rFIXFc is presented in Table 22 (50 IU/kg), Table 23 (100 IU/kg) and Table 24 (200 IU/kg) for n=3/group. For rFIXFc SC the geometric means and CV% of the geometric mean of Cmax were 860 + 22 (50 IU/kg), 1630 + 97 (100 IU/kg), and 3750 + 26 (200 IU/kg), respectively, indicating a dose-dependent increase. Similar increases were observed for AUC. Geometric means of bioavailability (F%) were 40 + 16 (50 IU/kg), 30 + 75 (100 IU/kg), and 36 + 27 (200 IU/kg), demonstrating similar bioavailability between doses. Terminal half-life measurements showed that the half-life was similar between doses at 58 + 39 hours (50 IU/kg), 45 + 13 hours (100 IU/kg), and 46 + 44 hours (200 IU/kg).
Subcutaneously administered rFIXFc to cynomolgus monkeys demonstrated a PK profile with dose-dependent increases in Cmax and AUC. Bioavailability generally ranged from 30-40% with a half-life of 4558 hours. Thus, the half-life for rFIXFc administered subcutaneously to monkeys demonstrated a 2.8-fold increase.
<img file="MX375112B_D0104.tif" />
IMPI
-112INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL on currently commercially available rFIX products that are administered intravenously. Overall, these data support the notion that subcutaneously administered rFIXFc will be clinically beneficial for the prophylactic treatment of patients with hemophilia B.
Example 10. Intended Prophylactic Dosing Regimens
Compared to the standard recommended dosing regimen of 25 to 40 IU/kg FIX two to three times per week, the rFIXFc PK activity results from the phase I/2a study described above suggest that approximately once-per-week dosing rFIXFc week around 22.5 IU/kg, or about every 10 days around 45 IU/kg, or approximately every 2 weeks of about 120 IU/kg is sufficient to maintain a minimum of 1% over the reference (Figure 24). These simulation model estimates are validated by the available phase 1/2a trial data, which fall entirely within the 95% confidence interval of the simulated activity-time course curve. Often these regimens will work early in therapy. Considering the heterogeneity of clinical flares of bleeding events related to trough levels of FIX activity in plasma, maintenance doses should be adjusted on an individual basis.
<img file="MX375112B_D0105.tif" />
IMPI
-113 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
After the PK results from the phase 1/2 study are recalculated (see Example 11), the new intended dosage regimen, for example for prophylaxis, is 20 IU/kg once weekly, 40 IU/kg every week. 10 days or 100 IU/kg every two weeks (twice a month). See also Table 27 and Figure 25.
Example 11. Recalculation of Pharmacokinetic Data from the First Human Study (FiH Study) (Example 1)
Subjects with a variety of hemophilia B genotypes, such as stop/nonsense and missense codon mutations, were included in the FiH study discussed in Example 1. Several of the subjects had markedly reduced endogenous FIX antigen levels that correlated with markedly reduced FIX activity, while few subjects with missense genotypes had more antigen than the activity measured, indicating a circulating protein. dysfunctional, Pretreatment FIX activity exceeded 2 IU/dL in 2 subjects, probably due to incomplete washout from his last FIX concentrate infusion based on test history and disease phenotype. With this information as a basis, the PK data of Example 1 was recalculated without subtraction from the reference values, as described in detail below. See the
<img file="MX375112B_D0106.tif" />
IMPI
- 114MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Table 27.
In contrast to the (activity-based) PK calculations in Example 1, if the PK activity of rFIXFc is modeled without subtraction from reference values, as recently reported for PK analysis of a glycoPEGylated rFIX (Negrier et al., Blood DOI 10.1182/blood 2011 02 33 5596 (2011), which is incorporated herein in its entirety by this reference), the resulting estimates of elimination half-life and TMR are much higher than those estimated in Example 1, of 82.2 + 21.6 and 96.8 ± 22.0 hours (mean + SD), respectively. However, since they knew that not all patients with severe hemophilia B have 0% endogenous FIX activity, and taking into account the patient's genotype and endogenous FIX antigen level, the present inventors adopted an assay method for subtract from reference values in your PK modeling. Specifically, (a) reference was defined in two patients as 0% given that their pretreatment FIX activity was <1%, they had no detectable FIX antigen, and they did not have missense genotypes; (b) the reference for three patients was set at 0.5% given that their pre-treatment FIX activity was <1% and they had detectable FIX antigen; (c) Cmin (lowest activity throughout the PK study) was defined as reference for patients whose pre-treatment FIX activity was between 1-2% and (d)
<img file="MX375112B_D0107.tif" />
IMPI
-115 INSTITUTO MEXICANO DE LA PROPERDAD INDUSTRIAL for patients whose FIX activity prior to treatment was 52%, 2% (which was the upper limit to participate in the trial) was the reference. Activity above baseline before dosing is considered residual drug from previous treatment, and was carried to baseline and subtracted from PK data after rFIXFc dosing.
The resulting mean terminal half-life (56.7 ± 10.9 hours, range 42.4 - 74.5 hours) and TMR (71.8 ± 10 hours, range 53.2 - 85.9 hours) of rFIXFc is approximately 3-fold greater than that reported for rFIX. The reported terminal half-life of rFIX is 19.3+4.97 hours (range 11.1 - 36.4 hours) and TMR 26.0 ± 6.07 hours (range 15.8 - 46.1 hours). Roth et al. , Blood 98:3600-3606 (2001); and the Summary of Product Characteristics for BENEFIX™, Electronic Medicines Compendium (2010) (http://www.medicines.org.uk/emc/medicine/20376/SPC/BENEFIX™/ #PHARMACODYNAMIC_PROPS), which are incorporated into the herein in its entirety by this reference. Therefore, the ranges for rFIXFc do not overlap with the ranges for rFIX. Similarly, the mean CL of rFIXFc activity (3.18 ± 0.78 mL/hr/kg, range 2.05 - 4.18 mL/hr/kg) is approximately 2.6 times lower than that reported for rFIX (8.40 + 2.01 mL/hr/kg). kg, interval 4.66 - 13.64 mL/hr/kg), while the Vss of both proteins are comparable to 4-5
<img file="MX375112B_D0108.tif" />
-116 IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY times the volume of plasma.
Although the same trend of improvement was observed in the PK of the rFIXFc antigen, both T<sub>1/2</sub>ouch Τ<sub>1/2</sub>rFIXFc antigen β were significantly higher than those derived from FIX activity measurements. clearly the Ti/aa estimated for the rFIXFc antigen deviate from those normally associated with FIX {2-3 hours). In addition, probable incomplete washout of pre-study replacement therapy prior to rFIXFc infusion sometimes resulted in a value greater than reference, which, in turn, could lead to an underestimation of Τ<sub>1/2</sub>rFIXFc β as measured by FIX activity. A number of subjects had aPTT activity as high as 3 IU/dL, well above the limit of quantification (1 IU/dL) for the aPTT assay, at time points later than 336 hours (14 days) after the dose. However, these time points were excluded from the terminal half-life estimate because the values were at or slightly above pre-treatment baselines and thus were considered to have returned to baseline. In contrast, low but detectable terminal levels of rFIXFc can be detected by high-sensitivity rFIXFc antigen ELISA, which detects amounts as low as 0.1 IU/dL compared to aPTT lower limit of 1.0 IU/dL.
<img file="MX375112B_D0109.tif" />
-117IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
The remaining PK parameters (activity) changed by a small amount related to elimination half-life and TMR. See Table 27(B). A linear, dose-proportional increase in FIX activity was observed based on Cmax occurring immediately after infusion and AUCi<sub>NF</sub> (Table 4). FIX activity exhibited biexponential decline following rFIXFc infusion and was characterized by a rapid distribution phase (alpha) followed by a log-linear elimination phase (beta). The average distribution half-life (Ti/<sub>2</sub>a) was highly variable for individual subjects (mean 3.4 and 10.3 hours for the two highest dose groups) (Table 27(B)). The mean elimination half-life (Τχ/<sub>2</sub>β) was not dose dependent for the dose range tested, ie, 53.5 hours, 57.5 ± 8.2 hours, and 56.5+ 14.1 hours at 25 IU/kg, 50 IU/kg, and 100 IU/kg, respectively. The 1% (1 IU/kg) time point over control, an assessment of rFIXFc activity, exhibited a dose-proportional increase. This was 7.3, 10.1 ± 1.5 and 12.3 ± 2.5 days for doses of 25, 50 and 100 Ul/kg, respectively. Plasma FIX activity 168 hours (1 week) post-dose was maintained at 1.1 IU/dL, 2.5 + 0.9 IU/dL, and 4.6 + 1.7 IU/dL over baseline for the 25, 50 dose groups. and 100 IU/kg, respectively. TMR, CL and Vss were also not dose dependent for the dose range of 25 to 100 IU/kg.
<img file="MX375112B_D0110.tif" />
IMPI
-118 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Furthermore, each 1 IU/kg of rFIXFc infused increased plasma FIX activity by 0.93 ± 0.18 IU/dl on average (Table 27(B)) and this gradual recovery (K) showed a weak positive correlation with body weight. body (R<sup>a</sup>=0.336, p=0.048).
Empirical experience has suggested that a sustained plasma factor activity as low as 1 to 2 IU/dL will be adequate to prevent spontaneous bleeding events in many patients with severe hemophilia A and B (Nilsson et al., J. Tntem. Med 232:25-32 (1992), which is incorporated herein in its entirety by this reference.), and increased bleeding episodes are associated with the amount of time below 1% normal FVIII activity. Collins et al., Thromb Haemost: 7:413-420 (2009), which is incorporated herein in its entirety by this reference. Therefore, PK assays provide a means to optimize prophylactic treatment with individualized dose modeling to achieve sustained trough levels above 1% (1 IU/dL) of baseline, reduced peak/trough variation, and improve cost/effectiveness. of the treatment. Carlsson et al., Haemophilia 4:83-88 (1998); Kisker et al., Haemophilia 9:278-284 (2003), which are incorporated herein in their entirety by this reference.
To construct the concentration/time profiles after the different dosing regimens, it was carried out
119 carried out the Monte Carlo simulation method with the population PK model of rFIXFc. The mean estimates of the model parameters (CL, volume of distribution, intercompartmental clearance, and second compartment volume) in the analyzed population, the between-individual variance, and the residual variability were adopted for this phase 1/2a study. Wang et al., J. Clin. Pharmacol. 49:1012-1024 (2009), which is incorporated herein in its entirety by this reference. One thousand subjects per dosing regimen were challenged with 14 to 16 sampling points for each subject. There were 14 sampling points for weekly dosing, 15 for every 10-day dosing, and 16 for every other week dosing. Body weight (BW) was generated according to the published method, Wang et al. (2009). That is, the power equation of Z=BW0.5 is taken as a basis. The average BW in 1000 subjects was assumed to be 75 kg. Simulated concentration/time profiles were taken as the basis and the mean + standard deviation (SD) of the concentration/time profiles of the 1000 subjects for different dosing regimens were plotted. Figure 25.
Compared to the standard recommended dosing regimen of 25 to 40 IU/kg FIX twice weekly, the average rFIXFc PK activity results from this study
<img file="MX375112B_D0111.tif" />
IMPI
-120 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY show that a once-weekly dosage of rFIXFc of 20 IU/kg, or 40 IU/kg approximately every 10 days, or 100 IU/kg approximately every 2 weeks is sufficient to maintain a minimum of 1% on the reference. Figure 25. These simulation model estimates are validated by the available phase 1/2a trial data, which fall entirely within the 95% confidence interval of the simulated activity-time course curve. However, when considering the heterogeneity of clinical outbreaks of bleeding events related to the trough level of FIX activity in plasma (Bjorkman, Haemophilia 9:101-110 (2003); Ahnstrom et al., Haemophilia 10:689- 697 (2004), incorporated herein in their entirety by this reference), the maintenance dose would likely require individual adjustment.
Boards
Table 1: Polynucleotide sequences: FIX-Fe
A. DNA sequence of FIX-Fc chain (SEQ ID NO: 1, encoding SEQ ID NO: 2)
Nucleotide sequence (nt[nucleotide] 1 to 7583) pSYN-FIX-030: FIX exon 1 (signal peptide, first amino acid propeptide): nt 690-777
FIX mini intron: nt 778-1076
FIX propeptide sequence: nt 1077-1126
Mature FIX sequence: nt 1127-2371
121
Faith: nt 2372-3052 gcgcgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagt tcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctga ccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaa tagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagt acatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggccc gcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacg tattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggata gcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttt tggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaa tgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagaga acccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagcttcg cgacgtacggccgccaccatgcagcgcgtgaacatgatcatggcagaatcaccaggcctca tcaccatctgccttttaggatatctactcagtgctgaatgtacaggtttgtttcctttttt aaaatacattgagtatgcttgccttttagatatagaaatatctgatgctgtcttcttcact aaattttgattacatgatttgacagcaatattgaagagtctaacagccagcacgcaggttg gtaagtactgtgggaacatcacagattttggctccatgccctaaagagaaattggctttca gattatttggattaaaaacaaagactttcttaagagatgtaaaattttcatgatgttttct tttttgctaaaactaaagaattattcttttacatttcagtttttcttgatcatgaaaacgc caacaaaattctgaatcggccaaagaggtataattcaggtaaattggaagagtttgttcaa gggaatctagagagagaatgtatggaagaaaagtgtagttttgaagaagcacgagaagttt ttgaaaacactgaaagaacaactgaattttggaagcagtatgttgatggagatcagtgtga gtccaatccatgtttaaatggcggcagttgcaaggatgacattaattcctatgaatgttgg tgtccctttggatttgaaggaaagaactgtgaattagatgtaacatgtaacattaagaatg gcagatgcgagcagttttgtaaaaatagtgctgataacaaggtggtttgctcctgtactga
122 gggatatcgacttgcagaaaaccagaagtcctgtgaaccagcagtgccatttccatgtgga agagtttctgtttcacaaacttctaagctcacccgtgctgagactgtttttcctgatgtgg actatgtaaattctactgaagctgaaaccattttggataacatcactcaaagcacccaatc atttaatgacttcactcgggttgttggtggagaagatgccaaaccaggtcaattcccttgg caggttgttttgaatggtaaagttgatgcattctgtggaggctctatcgttaatgaaaaat ggattgtaactgctgcccactgtgttgaaactggtgttaaaattacagttgtcgcaggtga acataatattgaggagacagaacatacagagcaaaagcgaaatgtgattcgaattattcct caccacaactacaatgcagctattaataagtacaaccatgacattgcccttctggaactgg acgaacccttagtgctaaacagctacgttacacctatttgcattgctgacaaggaatacac gaacatcttcctcaaatttggatctggctatgtaagtggctggggaagagtcttccacaaa gggagatcagctttagttcttcagtaccttagagttccacttgttgaccgagccacatgtc ttcgatctacaaagttcaccatctataacaacatgttctgtgctggcttccatgaaggagg tagagattcatgtcaaggagatagtgggggaccccatgttactgaagtggaagggaccagt ttcttaactggaattattagctggggtgaagagtgtgcaatgaaaggcaaatatggaatat ataccaaggtgtcccggtatgtcaactggattaaggaaaaaacaaagctcactgacaaaac tcacacatgcccaccgtgcccagctccggaactcctgggcggaccgtcagtcttcctcttc cccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacatgcgtggtgg tggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggt gcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagc gtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctcca acaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgaga accacaggtgtacaccctgcccccatcccgggatgagctgaccaagaaccaggtcagcctg acctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggc agccggagaacaactacaagaccacgcctcccgtgttggactccgacggctccttcttcct ctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctcc
<img file="MX375112B_D0112.tif" />
IMPI
-123INSTITUTO MEXICANO DE LA PROPIEDAD INDUSTRIAL gtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggta aatgagaattcagacatgataagatacattgatgagtttggacaaaccacaactagaatgc agtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattat aagctgcaataaacaagttggggtgggcgaagaactccagcatgagatccccgcgctggag gatcatccagccggcgtcccggaaaacgattccgaagcccaacctttcatagaaggcggcg gtggaatcgaaatctcgtagcacgtgtcagtcctgctcctcggccacgaagtgcacgcagt tgccggccgggtcgcgcagggcgaactcccgcccccacggctgctcgccgatctcggtcat ggccggcccggaggcgtcccggaagttcgtggacacgacctccgaccactcggcgtacagc tcgtccaggccgcgcacccacacccaggccagggtgttgtccggcaccacctggtcctgga ccgcgctgatgaacagggtcacgtcgtcccggaccacaccggcgaagtcgtcctccacgaa gtcccgggagaacccgagccggtcggtccagaactcgaccgctccggcgacgtcgcgcgcg gtgagcaccggaacggcactggtcaacttggccatggtttagttcctcaccttgtcgtatt atactatgccgatatactatgccgatgattaattgtcaacacgtgctgatcagatccgaaa atggatatacaagctcccgggagctttttgcaaaagcctaggcctccaaaaaagcctcctc actacttctggaatagctcagaggcagaggcggcctcggcctctgcataaataaaaaaaat tagtcagccatggggcggagaatgggcggaactgggcggagttaggggcgggatgggcgga gttaggggcgggactatggttgctgactaattgagatgcatgctttgcatacttctgcctg ctggggagcctggggactttccacacctggttgctgactaattgagatgcatgctttgcat acttctgcctgctggggagcctggggactttccacaccctcgtcgagctagcttcgtgagg ctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttgggggga ggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatg tcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagt cgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgt ggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttcca cctggctccagtacgtgattcttgatcccgagctggagccaggggcgggccttgcgcttta
<img file="MX375112B_D0113.tif" />
IMPI
-124INSTITUTO MEXICANO DE LA PROPIEDAD INDUSTRIAL ggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgc gaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaa tttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccag gatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtccc agcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggta gtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccc tgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccg gccctgctccagggggctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtc acccacacaaaggaaaggggcctttccgtcctcagccgtcgcttcatgtgactccacggag taccgggcgccgtccaggcacctcgattagttctggagcttttggagtacgtcgtctttag gttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagt taggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatct tggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgt gaacacgtggtcgcggccgcgccgccaccatggagacagacacactcctgctatgggtact gctgctctgggttccaggttccactggtgacaaaactcacacatgcccaccgtgcccagca cctgaactcctgggaggaccgtcagtcttcctcttccccccaaaacccaaggacaccctca tgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctga ggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgg gaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggact ggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcga gaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgccccca tcccgcgatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatc ccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccac gcctcccgtgttggactccgacggctccttcttcctctacagcaagctcaccgtggacaag agcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaacc
<img file="MX375112B_D0114.tif" />
IMPI
-125 INSTITUTO MEXICANO DE LA PROPIEDAD INDUSTRIAL actacacgcagaagagcctctccctgtctccgggtaaatgactcgagagatctggccggct gggcccgtttcgaaggtaagcctatccctaaccctctcctcggtctcgattctacgcgtac cggtcatcatcaccatcaccattgagtttaaacccgctgatcagcctcgactgtgccttct agttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgcca ctcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtca ttctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagc aggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagtggcggta atacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagc aaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccc tgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataa agataccaggcgtttccccctagaagctccctcgtgcgctctcctgttccgaccctgccgc ttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacg ctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccc cccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaa gacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgt aggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagta tttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgat ccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcg cagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtgg aacgaaaactcacgttaagggattttggtcatgacattaacctataaaaataggcgtatca cgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagct cccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggc gcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattg tactgagagtgcaccatatatgcggtgtgaaataccgcacagatgcgtaaggagaaaatac cgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcggg
<img file="MX375112B_D0115.tif" />
IMPI
-126 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY cctcttcgctattacgcca
B. Fe (mouse IgK signal peptide) DNA sequence (SEQ ID NO: 3 encoding SEQ ID: 4) This is the Fe cassette of pSYN-FIX-030. Additionally there is a separate Fe expression cassette that was transfected into the cell line on plasmid pSYN-Fc-015 that encodes the same amino acid sequence, but contains some non-coding changes. The second copy of the Fe coding sequence makes a better monomer:dimer ratio possible.
Atggagacagaeacactcctgctatgggtactgctgctctgggttccaggttccactggtg acaaaactcacacatgcccaccgtgcccagcacctgaactcctgggaggaccgtcagtctt cctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacatgc gtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcg tggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgt ggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaag gtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagc cccgagaaccacaggtgtacaccctgcccccatcccgcgatgagctgaccaagaaccaggt cagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagc aatgggcagccggagaacaactacaagaccacgcctcccgtgttggactccgacggctcct tcttcctctacagcaagetcaccgtggacaagagcaggtggcagcaggggaacgtcttctc atgctccgtgatgcatgaggctctcagaccagactaccct
<img file="MX375112B_D0116.tif" />
IMPI
- 127 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Table 2: Polypeptide Sequences
FIX-Fe monomer hybrid; created by coexpressing chains of FIX-Fc and Fe.
A. FIX-Fc chain (SEQ ID NO: 2):
(23 amino acid signal sequence underlined, 18 amino acid propeptide double underlined, Fe portion in italics.) The C-terminal lysine is not present in any subunit. This processing is generally observed in recombinant proteins produced in mammalian cell culture, as well as with plasma-derived proteins. SUBUNIT OF FIXFC-SC;
! FIX signal peptide; -46 MQRVNMIMAE SPGLITICLL GYLLSAEC Propeptide of FIX: -18 TVFLDHENAN KILNRPKR
YNSGKLEEFV QGNLERECME EKCSFEEARE VFENTERTTE FWKQYVDGDQ 51 CESNPCLNGG SCKDDINSYE CWCPFGFEGK NCELDVTCNI KNGRCEQFCK 101 NSADNKWCS CTEGYRLAEN QKSCEPAVPF PCGRVSVSQT SKLTRAETVF 151 PDVDYVNSTE AETILDNITQ STQSFNDFTR WGGEDAKPG QFPWQWLNG 201 KVDAFCGGSI VNEKWIVTAA HCVETGVKIT WAGEHNIEE TEHTEQKRNV 251 IRIIPHHNYN AAINKYNHDI ALLELDEPLV LNSYVTPICI ADKEYTNIFL 301 KFGSGYVSGW GRVFHKGRSA LVLQYLRVPL VDRATCLRST KFTIYNNMFC 351 AGFHEGGRDS CQGDSGGPHV TEVEGTSFLT GIISWGEECA MKGKYGIYTK 401 VSRYVNWIKE KTKLTDKTHT CPPCPAPELL GGPSVFLFPP KPKDTLMISR 451 TPEVTCWVD VSHEDPEVKF NWYVDGVEVH NAKTKPREEQ YNSTYRWSV 501 LTVLHQDWLN GKEYKCKVSN RALPAPIEKT ISKAKGQPRE PQVYTLPPSR
MEXICAN INSTITUTE
128
551 DELTKNQVSL TCLVKGFYPS DTAVEWESNG QPENNYKTTP PVLDSDGSFF 601 LYSKLTVDKS RWQQGNVFSC SVMHEALHNH YTQKSLSLSP GK
B. Fe Chain (SEQ ID NO: 4)
Heterologous signal peptide of 20 amino acids of mouse IgK light chain (underlined) í
-20 METDTLLLWV LLLWVPGSTG
Mature Fe sequence (corresponding to human IgGl amino acids 221 to 447, EU numbering) 1 DKTHTCPPCP APELLGGPSV FLFPPKPKDT LMISRTPEVT CVWDVSHED 51 PEVKFNWYVD GVEVHNAKTK PREEQYNSTY RWSVLTVLH QDWLNGKEYK
101 CKVSNKALPA PIEKTISKAK GQPREPQVYT LPPSRDELTK NQVSLTCLVK
151 GFYPSDIAVE WESNGQPENN YKTTPPVLDS DGSFFLYSKL TVDKSRWQQG
201 NVFSCSVMHE ALHNHYTQKS LSLSPGK
<img file="MX375112B_D0117.tif" />
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
129
<td rowspan="8">Table 3. Individual patient FIXFc antigen concentration as a function of time data, sorted by nominal dose, actual dose, duration of infusion, and patient number.</td><td>Concentration (ng/mL)</td><td rowspan="2">Patient 4 |</td><td>or or</td><td>ώ ld H 00</td><td> 7362.3 |</td><td> 6723.4 1</td><td> 5291.4 |</td><td>1 TIME9P</td><td> ¡ 3954.6 |</td><td> 3327.6 |</td><td>co IN</td><td>it is it's re LO</td><td> 1234.4 1</td><td>EITHER 00</td><td>I 3'9^9</td><td>I 1*^99</td><td> 1 3*609</td><td> 1</td><td>I Ι'θ^ΐ'</td>
<td>Actual time (hrs)</td><td>co rd or 1</td><td> 0.17</td><td> 0.42</td><td>>H</td><td></td><td>H IT</td><td> 9.17</td><td>H CS</td><td> 48-20</td><td> 72-17</td><td> ¿1'96</td><td>H EITHER H</td><td> | 144.18</td><td> 168.22</td><td> | 192.20</td><td> | 216.23</td><td> | 240.23</td>
<td>Concentration (ng/mL)</td><td rowspan="2">Patient 3 |</td><td>EITHER either</td><td> 5915.3 |</td><td>IT LD</td><td>L'^L^</td><td> 4204.8</td><td> 3956.2 |</td><td> 3567.7 |</td><td>IT lo or 00 CS</td><td>1727.7j</td><td> 1165.8</td><td> 917.1</td><td>Ch in IT</td><td> 568.2</td><td>m LD is</td><td>SF LD 00 is</td><td></td><td></td>
<td>Actual time (hrs)</td><td>00 or 1</td><td> 0.28</td><td> 0.42</td><td>r-1</td><td> 3.17</td><td> 6.17</td><td> 9.17</td><td> 24.17</td><td> 86'8^</td><td> 72.40</td><td> 96-98</td><td> 121.23</td><td>in LD 00 LO</td><td> | 240.15</td><td>£ ORσ > OJ</td><td> | 337,98</td><td></td>
<td>Conc in t rae ion (ng/mL)</td><td rowspan="2">Patient 2________1</td><td>oh 1</td><td>| τ'δ^εε</td><td>tHOCO</td><td>σ 00 CS CS</td><td>I 9'¿¿03</td><td>2054/7_____I</td><td>year</td><td> 1417.3____1</td><td> 766.0</td><td>either H</td><td>CS or 00</td><td> 326.3</td><td> 241.1</td><td>LD two</td><td>or LD</td><td> 149.0</td><td>it is</td>
<td>Actual time (hrs)</td><td> -1.23</td><td> 0.17</td><td>EITHER either</td><td> 1.15</td><td>in Π</td><td>LD H <0</td><td> 9.15</td><td>river <N n</td><td>either oo mr</td><td> 70.73</td><td> 92.57</td><td>co H</td><td>I 141.10</td><td> 167.98</td><td>m 00 it is</td><td>I 216.98</td><td> | 238.65</td>
<td>Concentration rae ion (ng/mL )</td><td rowspan="2">1 Patient 1 1</td><td>ooo</td><td> 1 £*93£3</td><td> 1632-4 |</td><td> 1497.7</td><td>f99^T</td><td>1268.2 I</td><td>ooo</td><td>either in or 00</td><td> 544-5</td><td>you</td><td> 215.3</td><td>IT it is</td><td> 128.6</td><td> 112.4</td><td> 93.6</td><td>V9?</td><td> ^‘9¿</td>
<td>Actual time(h)</td><td>or you or 1</td><td>ΔΙ '0 |</td><td> 1 0.42</td><td>T'l |</td><td> 1 3.18</td><td>I 6.13</td><td> 31 ‘6 1</td><td></td><td>I 48.03</td><td>ce is CS</td><td> 1 96.75</td><td>ετ'οζτ |</td><td>I141.95</td><td> 1 169.45</td><td>I 192.37</td><td> 1 216.28</td><td>oh yeah month</td>
<img file="MX375112B_D0118.tif" />
130
IMPI to
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY M
<td rowspan="8">Table 3. Individual patient FIXFc antigen concentration versus time data, sorted by nominal dose, actual dose, duration of infusion, and patient number (continued).</td><td>Concentration (ng/mL)</td><td rowspan="2">Patient 8 |</td><td>either either</td><td> 1</td><td> 23640.8 |</td><td> 18505.6 1</td><td> 15708.1 |</td><td>ld go in</td><td> 16486,4 |</td><td> 9937,8 |</td><td> 6383,5 |</td><td>k0 or in</td><td> 3774.7 1</td><td>I 6'^153</td><td> 1626.0 |</td><td>1Δ</td><td>it's 00 LD</td><td>I fr'98S</td><td></td>
<td>Actual time (hrs)</td><td>in</td><td>the cs EITHER</td><td>EITHER</td><td>LA n</td><td>it is</td><td>H <0</td><td>in</td><td>it is it is</td><td>0 in 00 yes<sup>1</sup></td><td>com it is</td><td>0 Φ in</td><td>0 mr 0 is</td><td>CO</td><td>LZ'^Z 1</td><td>m co 00 00 is</td><td>in OR hmm</td><td></td>
<td>Concentration (ng/mL)</td><td rowspan="2">Patient 7 |</td><td>EITHER either</td><td>in LO the 0</td><td>THE fS L0</td><td> 5498.6 |</td><td>Γ LL ^</td><td> 00 00 0</td><td>in 00 00 00m</td><td>in 00 OI</td><td>Φ O rn <D rr</td><td>LA in 03</td><td>0 LA</td><td>in LA in</td><td>OR? or 00</td><td>ID 'Φ</td><td>THE</td><td>00 it is Φ</td><td></td>
<td>Actual time (hrs)</td><td>K</td><td>03 03 EITHER</td><td>I HEARD EITHER</td><td>dr</td><td>in</td><td> <0</td><td>H in</td><td> 03</td><td>oj co 00</td><td>THE it is</td><td>In kD in</td><td>in rt it is</td><td>0 'φ H</td><td>is co co LD fH</td><td>is in</td><td></td><td></td>
<td>Concentration (ng/mL)</td><td rowspan="2">Patient 6 |</td><td> 0 0</td><td>11671.7J</td><td>8654.5____I</td><td>Or 00 or 00</td><td>m at 0in 00</td><td>I¿'819¿</td><td> 6584.2</td><td>| L'LTZZ</td><td>'EITHER * the H</td><td>0 00in</td><td>it is</td><td>THE in ΟΪ in</td><td>> is in is</td><td>OI ui is</td><td></td><td></td><td></td>
<td>Actual time (hrs)</td><td> 0 0 1</td><td> 0</td><td>it is 0</td><td>Rh H</td><td></td><td> <0</td><td>in</td><td> 00</td><td>CS</td><td>10σ></td><td> 120.17</td><td>0 it is</td><td>I 288.17</td><td>I 336.17</td><td></td><td></td><td></td>
<td>Concentration (ng/mL)</td><td rowspan="2">I Patient 5 ___1</td><td> 0 0</td><td>it is 0 is the</td><td>7233.9 I</td><td>1 T'39¿9</td><td> 5873-1</td><td>I HEARD 2 in LA</td><td> 1</td><td>in THE 03</td><td> , 2986.6</td><td>fa ro CO in</td><td>0 in 01 RH</td><td>0 'Φ</td><td>in 01 with</td><td> 0 00</td><td>in m</td><td>in 00 MO</td><td> 0 03</td>
<td>Actual time(h)</td><td>ω or 1</td><td>either</td><td> 0</td><td>0 is</td><td>THE in</td><td>in 03 <0</td><td>or 03 σ\</td><td>it is</td><td>THE 00 'Φ</td><td>THE it is</td><td>m 0 ω in</td><td>H 0 is</td><td>at 0 Rh</td><td> 00</td><td>it is is in</td><td> 91*913 1</td><td>EITHER Or is it</td>
<img file="MX375112B_D0119.tif" />
131
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Table 3. Individual patient FIXFc antigen concentration in
<td></td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> '0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>*rd</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>OR</td><td></td><td></td><td>íA</td><td>F</td><td>m</td><td></td><td><N</td><td> 0</td><td>it is</td><td>THE</td><td>σ></td><td></td><td> ></td><td>F*</td><td></td><td>Οϊ</td><td></td>
<td></td><td>you M</td><td></td><td> 0</td><td></td><td>THE</td><td>dr</td><td>THE</td><td>in</td><td></td><td> 00</td><td>THE</td><td>in</td><td>THE</td><td>σί</td><td>σ\</td><td>re</td><td>IT</td><td></td>
<td>R'0-H</td><td>ii</td><td>CS</td><td> 0</td><td>O rd LA</td><td>ia FS CS</td><td>rd rd</td><td>no 00 in</td><td>LA 00</td><td>H co</td><td><n LA LA</td><td>00 00m</td><td>THE in is</td><td>rd CS CS</td><td> 2</td><td>rn in</td><td>λXσ>ω</td><td>THE</td><td></td>
<td>υ</td><td>either \</td><td> □</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>neither</td><td>H.H<sup>1</sup></td><td>P</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> 8 3</td><td>you V</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>A</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> *</td><td>1 (h)</td><td>you til</td><td> 12</td><td>dr</td><td>CS</td><td> 17</td><td> 17</td><td> 17</td><td> 17</td><td> ¿1'</td><td>0 is</td><td> .13</td><td> ></td><td>dr</td><td> 8£'</td><td> .50</td><td>the cs</td><td></td>
<td>you you</td><td>3 you</td><td></td><td>dr 1</td><td>EITHER</td><td>EITHER</td><td>dr</td><td>η</td><td></td><td>σι</td><td><*CS</td><td> 00</td><td></td><td> 95.</td><td>in dr</td><td> 167</td><td> 239</td><td> 287</td><td></td>
<td></td><td>'Η Φ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>-H H_</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>-d</td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>W</td><td> '0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>0 Ό</td><td>“H0</td><td></td><td></td><td>F</td><td>CS</td><td>CS</td><td>in</td><td></td><td> 00</td><td>CO</td><td> 0</td><td>THE</td><td> 0</td><td>THE</td><td></td><td></td><td></td><td></td>
<td></td><td>you PM<sub>Λ</sub></td><td></td><td>EITHER</td><td> 5</td><td>yes</td><td> 02</td><td>YOU</td><td> 69</td><td>i29</td><td>m</td><td>river</td><td>CS k£></td><td>00 i LO</td><td> 00</td><td></td><td></td><td></td><td></td>
<td>you</td><td>§ or</td><td>Φ</td><td>EITHER</td><td>96T</td><td> 172</td><td> 159</td><td> 137</td><td> 124</td><td> 120</td><td> 801</td><td> 44:</td><td>it is</td><td> 141</td><td>CS</td><td></td><td></td><td></td><td></td>
<td></td><td>you in</td><td>P</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>ε Λ</td><td>With</td><td>you 0)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 2</td><td></td><td>H</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Η</td><td></td><td>EITHER</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> « ,0</td><td></td><td>you til</td><td>THE</td><td>No</td><td></td><td>the</td><td>CS</td><td>THE</td><td>it is</td><td>CS CS</td><td>it is</td><td>00 1 ΛΊ</td><td> 72</td><td> 72</td><td></td><td></td><td></td><td></td>
<td>•Η ._j gd 8s</td><td>[) odura</td><td></td><td>or 1</td><td>CS EITHER</td><td> 0.4</td><td>CS</td><td> 3.2</td><td>CS <0</td><td> 9.2</td><td>CS</td><td></td><td> 71.1</td><td>dr two</td><td> 263.</td><td></td><td></td><td></td><td></td>
<td></td><td>Ti ψ Η M</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>0 i</td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td><sup>a</sup> you</td><td> '0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>gone (co</td><td>“H 0 ti d</td><td></td><td>EITHER</td><td>EITHER EITHER</td><td>0 <Y\</td><td>C0 <0</td><td>0 Ολ</td><td>CS EITHER</td><td>E> *4*</td><td> 0</td><td> 0</td><td>M3 THE</td><td>THE CS</td><td>THE CS</td><td>in in</td><td>EITHER Η</td><td>it is 0</td><td>it is IT</td>
<td></td><td>P</td><td>Q</td><td></td><td>L£></td><td>CS</td><td> <0</td><td>co</td><td>σ></td><td></td><td>l^-R.</td><td> 00</td><td>THE</td><td>THE</td><td>EITHER</td><td></td><td>CS</td><td></td><td></td>
<td>or φ •H jj</td><td>§ 1 and</td><td>you</td><td>AC</td><td>LO r-1</td><td>lf) dr</td><td>THE OR</td><td>com</td><td>is co</td><td>dr</td><td>00in</td><td>σ) m</td><td>CS</td><td>Or is it</td><td>m rd</td><td>m</td><td>CS</td><td>σί</td><td>fJ</td>
<td>•HS</td><td>g 51</td><td>P</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>«ΗΠ</td><td> 8 3</td><td>you 0)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>wow</td><td></td><td>♦ rH</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>t* <d</td><td></td><td>or</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td><sup>0</sup> &</td><td></td><td>Pa</td><td> 00</td><td>THE</td><td>EITHER</td><td>CS</td><td>it is</td><td>it is</td><td>CS</td><td>is rj</td><td>it's king</td><td>it is</td><td>it is</td><td> 22</td><td> 22</td><td> 22</td><td> 18</td><td> 22</td>
<td></td><td>λ</td><td></td><td></td><td>CS</td><td>THE</td><td>it is</td><td>CS</td><td>it is</td><td>it is</td><td>X</td><td>vN</td><td></td><td></td><td>Yo</td><td> *</td><td> •</td><td></td><td></td>
<td>YO " 8 8</td><td>OR B*rd yes you -Η ti</td><td></td><td>or you</td><td>EITHER</td><td>EITHER</td><td>dr</td><td>m</td><td> <0</td><td>σι</td><td> 24.</td><td>00 <φ</td><td> 72.</td><td> 96</td><td> 120</td><td> 144</td><td> 168</td><td>CS σ\rd</td><td>LO rd CS</td>
<td>-H m</td><td>HM</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>it um<</td><td> ,8</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Wΰ</td><td>'Ή</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> 2</td><td></td><td></td><td>dr</td><td>dr</td><td>IT</td><td></td><td>either)</td><td>THE</td><td>rn</td><td>OO</td><td>THE</td><td>m</td><td> <0</td><td>it is</td><td>it is</td><td>CO</td><td>m</td>
<td>ion data, and</td><td>w M P S 1 g</td><td>you 9</td><td>EITHER EITHER</td><td> 15027</td><td> 13374</td><td> 12395</td><td> 10808</td><td> 9640.</td><td> 10505</td><td> 6487.</td><td> 5324.</td><td>LA 0) CO CS</td><td>00 0 is m</td><td> 2610.</td><td> 2007.</td><td> 1086.</td><td>NC in</td><td> 621.</td>
<td>C.Q.</td><td>0 you</td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Λή d</td><td>or</td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>WP *U m</td><td></td><td>*hu</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>you you -H '0 h you</td><td>0 (h)</td><td>you CU</td><td> .82</td><td> .28</td><td>IT</td><td></td><td> .20</td><td>AI is</td><td>THE</td><td>THE</td><td>is kD</td><td>0ΤΊ</td><td>5XM</td><td> 8.13</td><td> 01’9</td><td> 2 00</td><td>the rd L0</td><td>THE THE</td>
<td>υh §φ</td><td>Es</td><td></td><td>0t</td><td> 0</td><td>EITHER</td><td>dr</td><td></td><td> 10</td><td>σι</td><td>month</td><td>THE</td><td>or</td><td>v<sup>1 </sup>σϊ</td><td>dr</td><td>THE H</td><td> 23</td><td> 28</td><td> 33</td>
<td><HΌ</td><td>Η M</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>ΜΊ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td><sup>10</sup></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<img file="MX375112B_D0120.tif" />
IMPI
132
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Table 4. Summary of FIXFc antigen pharmacokinetic information for individual patient and group average.
<td>Beta HL* (h)</td><td> 107</td><td>fH</td><td>either</td><td>Η</td><td> 138</td><td> 85.3</td><td>either</td><td> 140</td><td>σ\ in ΰη</td><td>LD</td><td> 110</td><td>vn 04</td><td>8'Π</td><td> 108</td><td> | 23.8</td><td>EITHER co</td>
<td>Alpha HL* (h)</td><td> 21.2</td><td>i—1</td><td> 1..... </td><td>r4</td><td><0 yes</td><td>OR) EITHER</td><td></td><td>NC</td><td>either</td><td>in</td><td>r4 CO</td><td>> 'Ψ</td><td> 2.75</td><td>oh</td><td> 34.9</td><td> 9*79</td>
<td>TMR* (h)</td><td> 04 00</td><td>Rh</td><td>H co</td><td>H</td><td>H</td><td> 105</td><td> 00</td><td> 112</td><td> 116</td><td>IT</td><td>OI H H</td><td>LD H01</td><td>either <0</td><td>τττ</td><td>CB</td><td> 8*96</td>
<td>v<sub>H.H</sub>* (mL/kg)</td><td> 245</td><td>r4</td><td> 273</td><td>Rh</td><td> 366</td><td> 244</td><td>Ϊ8Τ</td><td> 061</td><td> 310</td><td>y'all</td><td> 259</td><td> 78.5</td><td>LO)rn</td><td> 250</td><td> 30.8</td><td> 263</td>
<td>Cl* (inL/h/kg)</td><td> 2.50</td><td>tH</td><td> 3.14</td><td>RS</td><td>y'all 04</td><td> | 2,32</td><td> 2.17</td><td></td><td> 2.67</td><td>m</td><td>ω OJ 04</td><td> 0*374</td><td>yes or</td><td>^í> 04 I heard</td><td><0 ϊ—1</td><td> 2.72</td>
<td>yes 1 * a</td><td> 91300</td><td>H</td><td> 144000</td><td>Rh</td><td> 356000</td><td> 389000</td><td> 416000</td><td> 531000</td><td> 348000</td><td>IT</td><td> 408000 <sup>;</sup></td><td> 73900</td><td> 33100</td><td> 403000</td><td>iH</td><td> 667000</td>
<td>(ng/mL)</td><td> 1670 1 .</td><td>H</td><td> 2730</td><td>Rh</td><td> 5470</td><td> 6910</td><td> 7520</td><td> 11700</td><td> 5950</td><td>a</td><td> 7510</td><td> 2480</td><td>οτττ</td><td> 7230</td><td> 30.3</td><td>OR OR LA 04</td>
<td>Patient</td><td>f—1</td><td rowspan="3">a</td><td>I HEARD</td><td rowspan="3">a</td><td></td><td></td><td>y'all</td><td>It</td><td>either-</td><td rowspan="3">a</td><td rowspan="3">Average</td><td rowspan="3">SD</td><td rowspan="3">ace</td><td rowspan="3">geometric mean</td><td rowspan="3">Geometric mean CV%</td><td> 01</td>
<td>Equivalent dose (mg/kg) ¡</td><td> 0.228</td><td>r*> Lfi either</td><td>ω or <Ti either</td><td> 0*905</td><td> 0.905</td><td> 0.906</td><td> 0.928</td><td> 00</td>
<td>Actual dose (Ul/kg)</td><td>iH</td><td> ! 27.250 1</td><td>THE in</td><td> 54.5</td><td>IT</td><td></td><td> 55.878</td><td> 109</td>
<td>Nominal dose (Ul/kg)</td><td colspan="2"> 12.5</td><td colspan="2"> 25</td><td colspan="11"> 50</td><td> 100</td>
133
<td> 94.3</td><td> 107</td><td>Va6</td><td> 102</td><td>m</td><td>00 in in</td><td>dr *</td><td> 96^</td><td> 95.2</td><td> 12.2</td>
<td> 15.7</td><td>m Η r4</td><td>either rn</td><td>LD rd</td><td>m</td><td>d</td><td>mrq d</td><td>either</td><td>in H</td><td>co HH</td>
<td> 103</td><td>Ρrd</td><td>mo</td><td>LOD No.</td><td>LD</td><td>H</td><td>H</td><td>LD</td><td>in H</td><td> 00</td>
<td> 156</td><td>00 v<sup>1 </sup>n</td><td>LD n ri</td><td>LD n</td><td>y'all</td><td>ωm d</td><td>od Cl tn</td><td>m river Cl</td><td>Cl d</td><td>Cl</td>
<td> 1.51</td><td>ω</td><td>IT laugh</td><td>m n</td><td>IT</td><td>dr d</td><td>Λ LD EITHER</td><td>00 o'clock either</td><td>LD or Cl</td><td>in dCl</td>
<td> 1200000</td><td> 000866 |</td><td> 844000</td><td>ooo 00</td><td>Lfi</td><td> 897000</td><td><n OO or LD O d</td><td>ooo CJ σι</td><td> 878000 <sup>;</sup></td><td>in dd</td>
<td> 21600</td><td>ooo n</td><td>oh</td><td>oo I d</td><td>y'all</td><td>or or a</td><td>OR LO in m</td><td>either r4</td><td>oo rd in rd</td><td>y'all η</td>
<td>ω</td><td>σι</td><td>H</td><td>d</td><td rowspan="3">a</td><td rowspan="3">Average</td><td rowspan="3">Ω ω</td><td rowspan="3"></td><td rowspan="3">geometric mean</td><td rowspan="3">Geometric mean CV%</td>
<td>Hω</td><td>00 r4</td><td>CO</td><td>n 00 *</td>
<td> 109</td><td>in or</td><td> 109.176</td><td>M* cr or t-4</td>
m co H +1 O rH lo lo m
I LD tn H d
m
4-1 om ri
IMPI to
MEXICAN INSTITUTE<sup>F</sup> OF THE PROPERTY
INDUSTRIAL bO tn ω >
d ri i r4 a ϊ-4
LD
0 4-1 0 min
<td> 0</td><td>ÍH 0 Λ</td><td>u '•m*<sup>1</sup></td>
<td>ω Ή (A __|</td><td>01 CD</td><td> 00</td>
<td>H</td><td>a</td><td>LD</td>
<td>'(you you (you</td><td>0 or OR</td><td>EITHER</td>
<td> 0</td><td rowspan="2">Q> 0</td><td>Φ</td>
<td>a</td><td>in</td>
<td> »</td><td> 0</td><td>fd</td>
<td> 0</td><td></td><td>\r4</td>
<td>You</td><td>dr</td><td>M</td>
<td>(you</td><td></td><td>ID</td>
<td>you h g</td><td>0τ! Ή</td><td>JQ (D TZI</td>
<td>(D</td><td>X</td><td></td>
<td></td><td>Φ</td><td></td>
<td>EITHER</td><td>Q</td><td>eleventh</td>
<td>Ό</td><td></td><td></td>
<td> 0</td><td>Φ -OR</td><td>r<sup>5</sup>^</td>
<td></td><td></td><td></td>
<td> 0)</td><td>Φ</td><td>EITHER</td>
<td></td><td> £</td><td>EITHER</td>
<td>Ψ4</td><td>your</td><td>EITHER</td>
<td></td><td> ></td><td></td>
<td></td><td>H</td><td>l></td>
<td>PU</td><td></td><td>either</td>
<td></td><td>EITHER</td><td>d</td>
<td>ω</td><td>Φ</td><td></td>
<td> 0</td><td>a</td><td>Ϊ4</td>
<td>ÍH</td><td> 01</td><td>Φ</td>
<td>-OR</td><td>Φ</td><td> 0)</td>
<td> 0)</td><td>Sh</td><td></td>
<td></td><td></td><td>(you</td>
<td>fq</td><td></td><td>Ή</td>
<td>d</td><td></td><td>ÍH</td>
<td>CL</td><td>either</td><td>Φ</td>
<td></td><td></td><td>eleventh</td>
<td>01Q</td><td>b</td><td>Φ τ!</td>
<td>I>1</td><td>co</td><td></td>
<td> 3</td><td></td><td>__M^h_</td>
<td>υ</td><td></td><td>(you</td>
<td>m</td><td>σ></td><td></td>
<td><D</td><td></td><td></td>
<td>íj</td><td>EITHER</td><td>m</td>
<td>d</td><td>either</td><td>Φ</td>
<td>cu</td><td> 44</td><td></td>
<td>H</td><td></td><td> 0</td>
<td>OR</td><td>EITHER</td><td>ÍH</td>
<td>ru</td><td>r4</td><td>IM</td>
<td>Λ</td><td></td><td>Φ</td>
<td> 01</td><td></td><td>ω</td>
<td> 0</td><td></td><td> 0</td>
<td></td><td></td><td></td>
<td></td><td></td><td>OR</td>
<td>(ΰ</td><td>(you</td><td> 0</td>
<td>-rl</td><td>4J you (D</td><td></td>
<td></td><td>ε</td><td></td>
<td></td><td>r4</td><td> 0</td>
<td> □</td><td>-OR</td><td> 0</td>
<td>you</td><td></td><td>Ό</td>
<td></td><td>you</td><td>c</td>
<td></td><td>Λ</td><td> 0</td>
<td></td><td>g</td><td>TJ</td>
<td></td><td> 0</td><td>Φ</td>
<td> 01</td><td>υ</td><td></td>
Π
LO <UU] (you
Lf4
oh
eleventh
Φ
TJ
<img file="MX375112B_D0121.tif" />
IMPI
134
IT YOU
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY tí 0) ω Ή ω O Ό
<td>Corrected result p%r reference (IU/dL)</td><td rowspan="3">Patient 3</td><td>NC</td><td> 0.0</td><td>EITHER 04 M<sup>1</sup></td><td> 29.0</td><td>m</td><td>01 or 04</td><td>IT</td><td>IT IT</td><td>| ii.o</td><td> 6.0</td><td> 5.0</td><td> 5.0</td><td> 4.0</td><td> 2.0</td><td> 0.0</td>
<td>Result (IU/dL)</td><td>either v</td><td> 01</td><td> 44</td><td><sup>31</sup></td><td> 27</td><td> 22</td><td> 18</td><td> 17</td><td>I heard</td><td></td><td></td><td>IT</td><td>IT</td><td>Γ0</td><td>i—1</td>
<td>Actual time (hrs)</td><td>00 or n in Yo</td><td>00H or 1</td><td>00 I heard either</td><td>CM EITHER</td><td> 1.17</td><td>H</td><td>T'9</td><td>σ></td><td> 24.17</td><td> 86'8^</td><td> | 72.40</td><td> | 96.98</td><td>P121-23</td><td> | 168.65</td><td> | 240.15</td>
<td>Result corrected by reference (IU/dL)</td><td rowspan="3">Patient 2____________I</td><td>1 ON</td><td>EITHER EITHER</td><td>θ ' _______</td><td>I 0 ' ΔΤ</td><td>either H</td><td>O'TT</td><td>I 0'6</td><td> | 11.0</td><td>EITHER IT</td><td> 4.0</td><td> 4.0</td><td> 2.0</td><td> 2.0</td><td>EITHER IN</td><td>either</td>
<td>Result (IU/dL)</td><td></td><td>I heard</td><td> 23</td><td>H</td><td> 15</td><td> 13</td><td></td><td>H</td><td> 00</td><td>L0</td><td><o</td><td></td><td></td><td></td><td></td>
<td>Actual time (hrs)</td><td>or what either m 1</td><td>m 04 1</td><td>T'0</td><td>EITHER EITHER</td><td> 1.15</td><td>LH river</td><td> 6.15 !</td><td>I 9-15</td><td>EE^S |</td><td>EITHER 00</td><td>I 70.73</td><td>I 92.57</td><td>I 119.98</td><td> | 141.10</td><td> | 167.98</td>
<td>Result corrected by reference (lU/dL)</td><td rowspan="3">Patient 1 Ί</td><td>NC |</td><td>either either</td><td> 13.0</td><td> 8.1</td><td> |</td><td> ^'6</td><td>ko go</td><td> 7.9</td><td> 5.0</td><td>EITHER SF</td><td> 2.0</td><td>either H</td><td> 1.0</td><td>either H</td><td> 0.0</td>
<td>Result (IU/dL)</td><td>0J</td><td>0Ί</td><td> 16</td><td> 11</td><td><sup>10</sup></td><td> 12</td><td>οϊ</td><td> 10</td><td>Γ-</td><td></td><td></td><td></td><td>0Ί</td><td></td><td> 04</td>
<td>Actual time (hrs)</td><td>or 00 (Parrot Yo</td><td> -0.50</td><td>0.17j</td><td> 0.42</td><td> 1.17</td><td> 3.18</td><td>IT</td><td>01H EITHER)</td><td>H I HEARD</td><td> 48.03</td><td> 72.23</td><td> 96.75</td><td> 120.13</td><td> 141.95</td><td> 169.45</td>
either
<img file="MX375112B_D0122.tif" />
IMPI
135
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td>Result corrected by reference (IU/dL)</td><td rowspan="3">| Patient 3</td><td>either either</td><td>or or</td><td>EITHER H</td><td></td>
<td>Result (IU/dL)</td><td>Rh</td><td>rl</td><td>it is</td><td></td>
<td>Actual time (hrs)</td><td> 290*97</td><td> | 337,98</td><td> | 675.22</td><td></td>
<td>Result corrected by reference (IU/dL)</td><td rowspan="3">Patient 2</td><td> 0.0</td><td> 1.0</td><td> 1.0</td><td>or or</td>
<td>Cip/in) ορη^τηβθΉ</td><td>it is</td><td>in</td><td></td><td>n</td>
<td>Actual time (hrs)</td><td> 192.85</td><td>I 216.98</td><td> | 238.65</td><td> | 891.90</td>
<td>Result corrected by reference (lü/dL)</td><td rowspan="3">Patient 1</td><td>1 O'T...</td><td> 1.0</td><td> 1.0</td><td> 1.0</td>
<td>Result (ÜI/dL)</td><td>in</td><td>EITHER</td><td></td><td>ΓΟ</td>
<td>Actual time (hrs)</td><td> 192.37</td><td> 216.28</td><td> 237.30</td><td> 746.22</td>
tí υ tí ω μ or
Φ íq ti
O ω 0) tn cu íq tí tí tí tí jj tí 0) ω (ü íq Λ ω iq
CQ you heard <D ω Q
-H υ x ω tí o lq CJ tí yq
<img file="MX375112B_D0123.tif" />
IMPI
136 your
H ί> •rl ro
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
0)
YOU £
y'all
EITHER
4J u
&
or you
<td>Result corrected by reference (TU/dL)</td><td rowspan="3">Patient 6</td><td>NC</td><td> 0.0</td><td> 0 0</td><td> 0'19</td><td> 54.1</td><td>m m</td><td> 39.6</td><td> 40.9</td><td>either sji Cl</td><td>either m</td><td>0 'TT</td>
<td>Result (IU/dL)</td><td></td><td>m</td><td>n</td><td> 64</td><td> 57</td><td>m</td><td> 42</td><td><sup>43</sup> 1</td><td> 26</td><td></td><td></td>
<td>Actual time (hrs)</td><td>or NC OO ω l</td><td>either or 1</td><td>either</td><td>Cl EITHER</td><td></td><td> 3.17</td><td> 6.17</td><td> 1 9.17</td><td>I LX^Z</td><td> | 48.17</td><td> | 72.17</td>
<td>Reference Corrected Result (TU/dL)</td><td rowspan="3">Patient 5</td><td>NC</td><td>either either</td><td> 34.0</td><td> 29.0</td><td>0 ' ΪΖ</td><td>either either C.J.</td><td>EITHER 00</td><td>NR</td><td> 12.0</td><td>either 00</td><td> 6.0</td>
<td>Result (lÜ/dL)</td><td>either v</td><td>either v</td><td> 35</td><td> 30</td><td> 25</td><td> | 21</td><td> 19</td><td>Pi 2í</td><td> 13</td><td>y'all</td><td></td>
<td>Actual time (hrs)</td><td> -104.18</td><td>00 or 1</td><td> 0.17</td><td>m EITHER</td><td>or Cl t—1</td><td> 3.15</td><td> 6.23</td><td>SO'6</td><td>LX^Z |</td><td>IT CO Sat</td><td>IT Cl</td>
<td>Result corrected by reference (ZU/dL)</td><td rowspan="3">Patient 4</td><td>NC</td><td> 0 0</td><td> 58.0</td><td> 44.0</td><td>0'6C</td><td> 29.0</td><td> 25.0</td><td>EITHER Cl</td><td>either in</td><td>either 00</td><td> 7.0</td>
<td>Result (IU/dL)</td><td>r-1</td><td>either v</td><td>in m</td><td> 45</td><td> 40</td><td> 30</td><td> 26</td><td> 22</td><td> 14</td><td>y'all</td><td>co</td>
<td>Actual time (hrs)</td><td>CJ in LO co Cl i</td><td>00 either 1</td><td> 0,17</td><td>cj mr either</td><td>Do you?</td><td> 3.17</td><td> 6.18</td><td> 9.17</td><td> 24.17</td><td> 48.20</td><td>H EITHER</td>
either
<img file="MX375112B_D0124.tif" />
IMPI
137
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td> 0 0</td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>You Ό</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>ti Ή</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>-u tn</td><td>µ 8 u</td><td></td><td>EITHER</td><td>EITHER</td><td>EITHER</td><td>EITHER</td><td>EITHER</td><td>EITHER</td><td>either</td><td></td>
<td>1—I 0</td><td>or S</td><td></td><td>v</td><td></td><td> *</td><td>Yo-</td><td> 4</td><td> »</td><td></td><td></td>
<td>P.M</td><td>ex*d</td><td></td><td>co</td><td></td><td></td><td></td><td>H</td><td>I heard</td><td>dr</td><td></td>
<td>01 M</td><td><2 u</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Φ0</td><td>Λ1</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>fti u</td><td></td><td>flj</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>UJ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Ό</td><td></td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>you</td><td>J</td><td>cu</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>JJ</td><td>Ό</td><td>•du</td><td>either</td><td>σχ</td><td> <0</td><td>M*</td><td>m</td><td>Yes*</td><td>Γ0</td><td></td>
<td>P</td><td>P</td><td>you</td><td>i—I</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>H</td><td> &</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td>'W</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>a</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>0 former</td><td></td><td></td><td></td><td> 17</td><td> ></td><td>dr</td><td> 17 ¡</td><td> 17</td><td> 17</td><td></td>
<td>EΦ</td><td>eh eh)</td><td></td><td> n</td><td>either</td><td>CO</td><td>EITHER</td><td>co</td><td></td><td></td><td></td>
<td>-rd</td><td>µ</td><td></td><td>/TX</td><td>OJ</td><td> ^0</td><td></td><td>co</td><td>m</td><td>either</td><td></td>
<td>H</td><td></td><td></td><td>saw</td><td>dr</td><td>tH</td><td>IN</td><td>I HEARD</td><td>CO</td><td>in</td><td></td>
<td> 0)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>0 you is</td><td>gingiva ZdL)</td><td></td><td>either</td><td>EITHER</td><td>EITHER</td><td>EITHER</td><td>either</td><td>either</td><td>either</td><td>either</td>
<td>3 tons 2φ Π1<sup>M</sup></td><td>f ex (IU.</td><td></td><td></td><td>m</td><td>Cl</td><td>td</td><td>dr</td><td>dr</td><td>H</td><td>either</td>
<td>$H<sup>K</sup> 0</td><td>Φμ</td><td>IT</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>or</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>rt)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td></td><td>4J</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Ό</td><td></td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>you</td><td></td><td> 0)</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>either</td>
<td>JJ</td><td></td><td>Ή</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> ♦</td>
<td></td><td></td><td>EITHER</td><td></td><td></td><td>m</td><td>Μ</td><td>I HEARD</td><td>ΟΪ</td><td>I HEARD</td><td></td>
<td>a</td><td> &</td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>m</td><td>H</td><td>fu</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>v</td>
<td>Φ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> (½</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td></td><td></td><td></td><td>m</td><td>m</td><td></td><td> 03</td><td>m</td><td>EITHER</td><td> [·></td>
<td>fu</td><td>you</td><td></td><td>ΓΌ OR</td><td>dr</td><td>either</td><td>Yo<sup>-</sup>1</td><td></td><td></td><td>either</td><td>either</td>
<td> 0}</td><td></td><td></td><td>ΙΛ</td><td>EITHER</td><td>Mr</td><td> 00</td><td> 03</td><td>My</td><td>either</td><td>l></td>
<td>You</td><td>h~</td><td></td><td>WΟΊ</td><td>OI rH</td><td> 14</td><td> 16</td><td>6T I</td><td> 1 21</td><td></td><td></td>
<td> 0 0</td><td>you</td><td></td><td></td><td>EITHER</td><td>either</td><td>EITHER</td><td>EITHER</td><td>either</td><td>EITHER</td><td>either</td>
<td>X! or <Ü Ή</td><td></td><td></td><td>EITHER</td><td>σι</td><td></td><td>0Ί</td><td>OJ</td><td>T“d</td><td>dr</td><td>either</td>
<td>P tn</td><td>M 8 Ό</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>rl 0) ph</td><td>or E > & mp</td><td></td><td>'Φ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>to μ</td><td>w you Ή”</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>ooo</td><td>Φ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Pi u</td><td>h</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>do</td><td></td><td>it</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>you</td><td>d</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>either</td>
<td>P</td><td>You</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> *</td>
<td></td><td></td><td></td><td>y'all</td><td>Yes*</td><td></td><td>m</td><td>m</td><td>I HEARD</td><td>I HEARD</td><td>|—l</td>
<td>P</td><td>either</td><td>U you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>you you</td><td>H</td><td>CU</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>v</td>
<td>P!</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td></td><td></td><td></td><td>m</td><td>co</td><td></td><td>either</td><td>m</td><td>I HEARD</td><td></td>
<td>& rd E ti φ Φ -HH</td><td>(h)</td><td></td><td>dr ID</td><td>or NC</td><td>M<sup>1</sup></td><td>E89</td><td>03 03 in</td><td>OJ</td><td>03 or mr</td><td> 20.7</td>
<td>H</td><td></td><td></td><td>0Ί</td><td>Yo<sup>-</sup>1</td><td>dr</td><td>dr</td><td>dr</td><td>I heard</td><td>I heard</td><td>EITHER"</td>
<td>you rd U tí Φ íd Φ Φμ</td>
you you
<td colspan="2"> 0</td>
<td>ω Φ íd tn Φ μ</td><td></td>
<td>you you</td><td></td>
<td>tí ti 4J tí Φ ω Φ μ ÍX Φ μ</td><td></td>
<td>ti -M Ή μ tn ω tí you Φ ω 0 jj ti TJ ca 0 you 0 to</td><td>ω Ή ωrd >you you you Ü1 0rd ΦTJ 0] 0 Ό HP rd υ X Φ tí 0 μ φ tí Ud</td>
to go
<img file="MX375112B_D0125.tif" />
IMPI
138
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td rowspan="9">Table 5. FIXFc activity and baseline-corrected FIXFc activity based on group average and individual patient time data, classified by nominal dose, actual dose, infusion duration, and patient number (continued).</td><td>Result corrected by reference (lU/dL)</td><td rowspan="3">Patient 9</td><td></td><td>EITHER EITHER</td><td>o s</td><td> 90-1</td><td>σΐ</td><td>m</td><td>ω LO LO</td><td>Ch IT</td><td>EITHER in</td><td> 23.0</td><td>0 H</td>
<td>'Ü — *q 2 P Μ H m ti</td><td> 00</td><td>in</td><td> 0 0</td><td>rn in</td><td>vF co</td><td> 0 00</td><td>IT</td><td>M<sup>1 </sup>LD</td><td>M<sup>1</sup></td><td>IT OJ</td><td>dr</td>
<td>0 t£ -H H</td><td>LQ or in σ\ 1</td><td>oo oo or 1</td><td>00 I HEARD 0</td><td>m LO 0</td><td>dr</td><td>0 01 n</td><td>or kD</td><td>H Ch</td><td>a month</td><td>OJ LO ID</td><td>EITHER EITHER</td>
<td>M * 'Η 5 § M a σι θ' m s ~ or</td><td rowspan="3">00 ω you -H U Rj CU</td><td></td><td>either either</td><td>0 00 H</td><td>0 H</td><td>EITHER EITHER</td><td>0 σ\</td><td>0 σι</td><td>EITHER</td><td>0 OJ m</td><td>EITHER σι I HEARD</td><td>EITHER CO</td>
<td>8 - A υ Ό 2 θ' tt H φ — Pi</td><td>or ♦ v</td><td>or ♦ v</td><td>Ch oh</td><td>H</td><td>OI OR</td><td>00 σι</td><td>or 00</td><td>Hear-</td><td>min</td><td>0 mr</td><td>in</td>
<td>0 trust •Η M</td><td>oh or heard 1</td><td>s 1</td><td>m LE 0</td><td>yes EITHER</td><td>Ul m</td><td>is ΟΪ m</td><td>IT</td><td>in</td><td>I HEARD OJ</td><td>0Ch 00</td><td>CO NC</td>
<td>«joyj rd H tj 8 ” « B 0<sup>H</sup>or</td><td rowspan="3">(D ti Φ □ you 1¾</td><td>s</td><td>EITHER either</td><td>0 EITHER)</td><td>M<sup>1 </sup>m</td><td>oh I EYE IT</td><td>m 01</td><td> 00 0 01</td><td>OJ Chrd</td><td>M<sup>1</sup>I HEARD</td><td>0 Ch</td><td>0in</td>
<td>'Ü~ 4J 2 you ΏH Φ RÍ</td><td>either dr v</td><td></td><td>kD</td><td>00 pm</td><td>0m</td><td>00 is</td><td>Me I HEARD</td><td>OJ OI</td><td>M*rd</td><td>0H</td><td>year</td>
<td>| S2 ΉM<sup>v</sup></td><td>m 00m 1</td><td>OJ</td><td>OI OI 0</td><td>OJ 0</td><td>na</td><td>in</td><td>Rh</td><td>σι</td><td>M<sup>1 </sup>01</td><td>OI 00 00 <<</td><td>IT OJ</td>
or Ά a t-ι
<img file="MX375112B_D0126.tif" />
IMPI
139
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td>M</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>3 mo -P Ό to Wφ</td><td>(ΊΡ/ΠΙ</td><td></td><td>either r4 r~t</td><td>either</td><td>0Έ</td><td>EITHER rt</td><td>or or</td><td>or or</td><td> 1.0</td>
<td>0) M PiH</td><td>ΦJq</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td></td><td>σι</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td></td><td>To the</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> -8</td><td></td><td>QJ 4J fi</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>aff</td><td> §</td><td>0 -r4</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>υ</td><td></td><td>σ></td><td>m</td><td>m</td><td>it is</td><td>it is</td><td>in</td>
<td> 2</td><td> 13</td><td>d</td><td>dr</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>v</td><td>H</td><td> £+</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Φ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Pi</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Q</td><td></td><td></td><td></td><td>m</td><td>either</td><td></td><td></td><td></td><td></td>
<td>you 1</td><td>dCH</td><td></td><td>H.1E</td><td>r*i 00</td><td> 66.1</td><td>00m</td><td>H 00</td><td> 35.5</td><td> 41.7</td>
<td>H</td><td></td><td></td><td>VΈ</td><td>Rh</td><td>F1</td><td>NC</td><td> 04</td><td></td><td> 0-</td>
<td>M</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>& d 5 u Ύ</td><td>gingiva ZdL)</td><td></td><td>EITHER</td><td>EITHER</td><td>EITHER</td><td>either</td><td>EITHER</td><td>or 4</td><td>either</td>
<td>yes bi</td><td>J&</td><td></td><td>in</td><td> 00</td><td>ω</td><td>(N</td><td>i—f</td><td></td><td>either</td>
<td>ωΦ</td><td>w lj *|| “</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>q M ti M 0</td><td>wk</td><td> 00</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>OR</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> <8</td><td> <·—·.</td><td>inte</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>P</td><td>dL</td><td>(U *iH</td><td></td><td></td><td></td><td></td><td></td><td></td><td>either</td>
<td></td><td></td><td>OR</td><td></td><td>σ\</td><td></td><td>n</td><td>it is</td><td> 04</td><td>r4</td>
<td></td><td>either</td><td>d</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>ω</td><td>H</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>v</td>
<td>Φ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 0</td><td></td><td></td><td></td><td>either</td><td></td><td></td><td>m</td><td>in</td><td> 00</td>
<td> !</td><td>eai [h)</td><td></td><td>ui π</td><td> 0.3</td><td> 8.7</td><td>NC EITHER</td><td> 00 00</td><td>or r-</td><td> 0*2</td>
<td>-Η 1</td><td> 4</td><td></td><td>vSJ /Tb</td><td>rj</td><td>US</td><td></td><td> 00</td><td>m</td><td></td>
<td></td><td></td><td></td><td>U1</td><td>dr</td><td>H</td><td>it is</td><td>it is</td><td>m</td><td>ω</td>
<td>M</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>0 8< Q jj</td><td>d 1 §</td><td></td><td>either</td><td>EITHER</td><td>EITHER</td><td>either</td><td>either</td><td>either</td><td>either</td>
<td>Η «H</td><td> 4.</td><td></td><td></td><td></td><td> 1</td><td>v</td><td></td><td> *</td><td> ►</td>
<td>P & ω φ</td><td>Φ O ui “</td><td></td><td></td><td>m</td><td></td><td>H</td><td>dr</td><td>w</td><td>it is</td>
<td>ΦH</td><td>ΤΊ RJ gave</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> * 8</td><td>M</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>OR</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>Φ</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td>jj</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>EITHER</td><td></td><td> £</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> *9</td><td></td><td>(D</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>m jj</td><td> *8</td><td>*hu</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>p-</td><td></td><td>d</td><td>in</td><td></td><td></td><td>it is</td><td></td><td>it is</td><td>m</td>
<td>either</td><td>D</td><td>you</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>ta</td><td>H</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td><u</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>Pi</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>time</td><td>d 5 <D fi h</td><td></td><td>y'all LO IX</td><td> 21.15</td><td> 44.10</td><td>it's 00 00 AD</td><td> 92,77</td><td>three or</td><td>In</td>
<td>H</td><td></td><td></td><td>ui</td><td>you<sup>-</sup>1</td><td>H</td><td>fH</td><td>dr</td><td>it is</td><td>r-</td>
<img file="MX375112B_D0127.tif" />
IMPI
140 I heard
Λ
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY φ ti (U £ o μ a
Ή >
H YOU HE
Ή (tí tí Ή EO tí ω -iJ ω o Ό
<td>Result corrected by reference (lU/dL)</td><td rowspan="3">Patient 12</td><td>NO</td><td>EITHER either</td><td>EITHER LO OR</td><td> 88.0</td><td> 68.0</td><td>EITHER ID</td><td> 53.0</td><td> 53.0</td><td> 35.0</td>
<td>Result (IU/dL)</td><td>oa</td><td>I HEARD</td><td> 108</td><td> 90</td><td> 70</td><td>in</td><td> 55</td><td> 55</td><td> 37</td>
<td>Actual time (hrs)</td><td> -342.58</td><td> -1.12</td><td> 0.17 |</td><td>I heard either</td><td>t—1</td><td> 3.17</td><td> ¿1'9</td><td>T'6</td><td></td>
<td>Result corrected by reference (lü/dL)</td><td rowspan="3">Patient 11</td><td>NC</td><td> 0’0</td><td>either 00 o H</td><td>either or t-4</td><td> 94.0</td><td>EITHER ooo</td><td> 79.0</td><td>EITHER ω LO</td><td> 51.0</td>
<td>Result (lu/dL)</td><td></td><td>I HEARD</td><td> 110</td><td> 106</td><td><sup>96</sup></td><td>03 in</td><td> 81</td><td> 70</td><td>m</td>
<td>0 you £ ΉH H</td><td>co 04 03 Ch J</td><td>in either 1</td><td> 0.23</td><td>yes or</td><td> 1.22</td><td> 3.22</td><td>LO OR) LD</td><td> 9.22</td><td> | 24.22</td>
<td>Result corrected by reference (lU/dL)</td><td rowspan="3">Patient 10</td><td>NC</td><td> 1 0’0</td><td> 118.0</td><td> 102.0</td><td> 82.1</td><td> 73.2</td><td>00in</td><td>IT IT</td><td> 35.0</td>
<td>Result (lu/dL)</td><td>t—1</td><td>OJ</td><td> 120 1</td><td> 104</td><td>co</td><td> 75</td><td> 60</td><td> 56</td><td> 36</td>
<td>Actual time (hrs)</td><td> -334.63</td><td>ω or 1</td><td>IT I HEARD either</td><td>bear</td><td>OJ 04</td><td>03 I heard co</td><td> 6.22</td><td> 9.22</td><td>03 OI 04</td>
141
IMPI to
MEXICAN INSTITUTE<sup>F</sup> OF THE PROPERTY
INDUSTRIAL BO
<td>Result corrected by reference (lU/dL)</td><td rowspan="3">Patient 12</td><td> 23.0</td><td> 12.0</td><td>EITHER 00</td><td>EITHER in</td><td>either</td><td> 1.0</td><td> 0.0</td><td>either <N</td><td></td>
<td>Result (IU/dL)</td><td> 25</td><td><sup>14</sup> 1</td><td><sup>10</sup></td><td></td><td><D</td><td>m</td><td></td><td></td><td></td>
<td>Actual time (hrs)</td><td> 48.20</td><td> 72.13</td><td>LD 0^</td><td>0ΊH</td><td>00ΓΩ yes</td><td> 239.50</td><td> 287.25</td><td> 526.42</td><td></td>
<td>Result corrected by reference (lU/dL)</td><td rowspan="3">Patient 11</td><td> 31.0</td><td>either</td><td> 0’9</td><td>EITHER</td><td> 2.0</td><td>0'T</td><td>EITHER</td><td> 12.0</td><td></td>
<td>Result (IU/dL)</td><td>Γ0</td><td> 25</td><td> 00</td><td>CO</td><td></td><td>in</td><td>EITHER)</td><td> 14</td><td></td>
<td>Real time (h)</td><td> , 47.72</td><td> 71.88</td><td> 167.72</td><td> 191.72</td><td> 263.72</td><td> 359.72</td><td> ¿6'888</td><td> 890.97</td><td></td>
<td>Result corrected by reference (IU/dL)</td><td rowspan="3">Patient 10</td><td>either or CM</td><td> 13.0</td><td> 10.0</td><td> 0'9</td><td> 5.0</td><td>YOU</td><td>EITHER n</td><td>or 4 00</td><td> 1.0</td>
<td>Result (IU/dL)</td><td> 21</td><td> 14</td><td> 11</td><td></td><td>ω</td><td>EITHER</td><td></td><td><sup>85</sup></td><td></td>
<td>IS 3 ΉM H</td><td> 48.22</td><td> 72.22</td><td>H go (You</td><td> 120.22</td><td> 144,22</td><td> 168.22</td><td> 192.18</td><td> 216.22</td><td>in ch</td>
Or ti Ή (1)
Φ ti ti o ω ai ti ti jj ti cu □ 0) (D μ w H ω |—i 'ti
<img file="MX375112B_D0128.tif" />
IMPI
142
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td colspan="2"></td><td>hs</td><td> 33.3</td><td></td><td>either THE</td><td>H</td><td><n it's kd</td><td> 6'85</td><td> 42.1</td><td>ω LA</td><td>EITHER EITHER</td><td>THE</td><td>H rs LA</td><td>or rd</td><td> 4.65</td><td>in THE</td><td> 21.0 [</td>
<td></td><td></td><td>«1 n_ l —</td><td>either</td><td></td><td>OR Λ1</td><td></td><td>It is fa</td><td>ίη</td><td>O : m</td><td></td><td>π</td><td></td><td>σκ</td><td>in dr</td><td>rn LA</td><td>rs THE</td><td>K.D.</td>
<td>Ή CÜ 0</td><td></td><td>yy £</td><td>either</td><td>dr</td><td>NA*</td><td>H</td><td>IJ is</td><td>m</td><td><sup>1</sup>either</td><td></td><td></td><td>THE</td><td></td><td>dr</td><td>EITHER</td><td>dr</td><td> 68,</td>
<td>Ό</td><td></td><td></td><td>either</td><td></td><td>EITHER</td><td></td><td> 00</td><td>H</td><td>Φ</td><td>A</td><td></td><td></td><td> ></td><td>EITHER</td><td>σ></td><td> ></td><td> 00</td>
<td></td><td></td><td>TM1 (h)</td><td> 48.</td><td>dr _</td><td> 76.</td><td>dr</td><td> 85.</td><td>THE</td><td> 59.</td><td> 81.</td><td> 56.</td><td>THE</td><td>Yo-[</td><td> 13.</td><td>a</td><td>0L</td><td>00 t—i</td>
<td>c</td><td></td><td> §</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>K.D.</td><td></td><td></td><td>co</td>
<td>Ή ε</td><td></td><td rowspan="2">Vgg ímL;</td><td></td><td></td><td>THE</td><td></td><td>the in</td><td>it is</td><td></td><td>σ> *+<</td><td>00 'í+l</td><td></td><td></td><td></td><td></td><td>THE</td><td>rri</td>
<td>0κ</td><td></td><td></td><td>(—t</td><td>it is</td><td>dr</td><td>v U rn</td><td>it is</td><td>it is</td><td>dr</td><td>You see</td><td>the</td><td>it is</td><td></td><td>m</td><td>it is</td><td>m</td>
<td>Η Ή</td><td></td><td></td><td></td><td></td><td></td><td></td><td>iΛ</td><td></td><td></td><td>J-*-b</td><td></td><td></td><td></td><td></td><td>in</td><td>r^4</td><td>dr</td>
<td>Μ 0 Τί</td><td></td><td> ><sup>rt</sup> Yo</td><td>os or rd</td><td>dr</td><td>H</td><td>dr</td><td>LA LA</td><td>r*i r-1</td><td>H</td><td>VJ or H</td><td></td><td>THE</td><td> I m</td><td>kd is</td><td>dr</td><td>ΓΊm</td><td> 21.</td>
<td>h 0 CU</td><td></td><td>£ j</td><td></td><td></td><td>rM</td><td></td><td>ΙΛ</td><td>in</td><td>íTl·</td><td>χΉ</td><td></td><td></td><td></td><td>it is</td><td></td><td></td><td></td>
<td>0 Ό</td><td></td><td>C1 (mLy</td><td>fS in</td><td>dr</td><td>* X <Ώ in</td><td>f—1</td><td>it is</td><td>in</td><td>w lA</td><td> 00</td><td></td><td>THE</td><td>m</td><td>dr</td><td> 0-5(</td><td> 3.5!</td><td>in m</td>
<td>you υ Η 4d Ή Ή</td><td>0) 4-1 α α></td><td>ϊ/Dose i*h/dL 'kg)</td><td>IT</td><td></td><td>kd</td><td></td><td>the</td><td>K.D.</td><td> 00</td><td>m</td><td></td><td></td><td> 00</td><td> 00</td><td>co</td><td>in</td><td></td>
<td>you</td><td>Ήυ</td><td>OMO or < — ah</td><td> 30.</td><td></td><td> 27.</td><td>dr</td><td> 23.</td><td>KD OS</td><td>it is</td><td>THE</td><td>it is</td><td>(A</td><td>in is</td><td>in dr</td><td>K.D.</td><td> 2</td><td> 39.</td>
<td>υ</td><td>Γΰ CU 0></td><td> -</td><td>co Λ</td><td></td><td>co</td><td></td><td>THE r4+</td><td></td><td>00 ίΊΠ</td><td>fT\</td><td>in Yo</td><td></td><td>a ιn</td><td> .70</td><td> 01’</td><td>LD</td><td>either</td>
<td rowspan="2">o y'all</td><td>τί</td><td>iq tfP</td><td>U1Ch</td><td>dr</td><td>in</td><td>dr</td><td>σι</td><td> 2</td><td>wσι</td><td>u i in</td><td> 2</td><td>THE</td><td> μF in</td><td></td><td>it is</td><td>in</td><td>the</td>
<td>Mere</td><td>(%) °ΟΠΥ</td><td>H m OS either</td><td>dr</td><td>or you I HEARD</td><td>I laughed</td><td>YOU</td><td>is dr</td><td> 1.5</td><td>0Ί</td><td>it is it is</td><td>in</td><td> 4.56</td><td> 4.75</td><td>ET' δ</td><td>00 in it is</td><td>AI <D rn rd</td>
<td><υ τί</td><td>ηύι</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>0 τιφ Ε</td><td>you '0 Ή</td><td>yes 1 EITHER * §s</td><td> 418</td><td></td><td> 753</td><td>dr</td><td> 1280</td><td> 1450</td><td> 0611</td><td>or KD σι is</td><td> 1270</td><td>y'all</td><td> 1630</td><td> 750</td><td> 335</td><td> 1530</td><td> 39.1</td>
<td>0 = CU >1</td><td>ω 3 Ψ4 β Ή</td><td>(TP/ni) ™o</td><td> 11.9</td><td>H</td><td>6*6T</td><td></td><td>y'all in</td><td> 48.5</td><td> 33.0</td><td>a m LA</td><td>K.D. 00 in</td><td>THE</td><td>kd rd</td><td>in co</td><td> 4.01 |</td><td>in EITHER</td><td>it is</td>
<td>you you η Η > Ή</td><td>5η of the</td><td>Patient</td><td></td><td></td><td>it is</td><td></td><td>m</td><td></td><td>the</td><td>K.D.</td><td></td><td></td><td> 0</td><td></td><td></td><td>or icon</td><td> 0</td>
<td>Ό you Η</td><td>'VJ Ή υ ti Μ</td><td rowspan="2">Actual dose (IU/kg)</td><td>dr</td><td></td><td>THE IN</td><td></td><td>(A</td><td>in</td><td>THE</td><td>£TS'l</td><td>coω tΓϊ</td><td></td><td>id τ) i</td><td>ΓΊ</td><td>M</td><td>I aometr</td><td>I ate</td>
<td>Φ .μ)</td><td>you τί</td><td> 13</td><td>z</td><td>it is</td><td> £</td><td>'Φ a</td><td>'Φ THE</td><td>M<sup>1 </sup>THE</td><td>THE</td><td>or 1 LA</td><td></td><td>M IU</td><td>L—। AC</td><td>lH ω</td><td>cu tn</td><td>Í14</td>
<td>you Φ Ή υ ft</td><td>real<sub>you</sub> <</td><td>Nominal dose (IU/kg)</td><td colspan="2">the it's H</td><td colspan="2"> 25</td><td colspan="11">you</td>
<img file="MX375112B_D0129.tif" />
IMPI
143
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td rowspan="2"></td><td rowspan="2">the</td><td rowspan="2"> 54.2</td><td rowspan="2">'Φ 04</td><td rowspan="2"> 67.4</td><td rowspan="2"> 43.8</td><td rowspan="2">the</td><td colspan="2">LA I rd</td><td rowspan="2">THE Φ</td><td rowspan="2">r4</td><td rowspan="2"> 19.0</td>
<td> 52</td><td> 10</td>
<td></td><td>in</td><td> 04</td><td>m</td><td>k0</td><td>in</td><td></td><td>in</td><td>in</td><td>in</td><td></td><td> <1</td>
<td></td><td>ia</td><td> «</td><td><φ</td><td>faith</td><td></td><td></td><td>in</td><td>in</td><td>C4</td><td>in</td><td> *</td>
<td></td><td></td><td>in</td><td></td><td>IT</td><td>faith</td><td></td><td>faith-</td><td></td><td>-faith</td><td>-faith</td><td>in</td>
<td></td><td>íc</td><td></td><td>in</td><td>dr</td><td></td><td>the</td><td>in</td><td>'Φ</td><td></td><td> 00</td><td>the</td>
<td></td><td>σ\</td><td></td><td>p_|</td><td>I heard</td><td>in</td><td></td><td> 00</td><td>OJ</td><td>THE</td><td></td><td>co</td>
<td></td><td> *</td><td>faith</td><td>faith</td><td></td><td> ♦</td><td></td><td></td><td> 00</td><td>in</td><td></td><td> *</td>
<td></td><td>THE</td><td></td><td>m</td><td> <0</td><td></td><td></td><td> 04</td><td></td><td>faith</td><td>NC</td><td>rn</td>
<td></td><td>GOES</td><td> <0</td><td>in</td><td>θ'</td><td>tA</td><td>a</td><td>ω</td><td> 00</td><td>m</td><td> <0</td><td>r4</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>σ></td><td></td><td></td>
<td></td><td> <0</td><td>in</td><td>m</td><td> 04</td><td></td><td></td><td>in</td><td> «</td><td>faith</td><td></td><td> *</td>
<td></td><td>H</td><td>'Φ</td><td>L0</td><td></td><td>either</td><td></td><td>F·*</td><td>dr</td><td>in</td><td>F*</td><td></td>
<td></td><td> 04</td><td>ξ—|</td><td>dr</td><td>tM</td><td> 04</td><td>the</td><td>r4</td><td>in</td><td>dr</td><td>Rh</td><td>dr</td>
<td></td><td></td><td>EITHER</td><td></td><td></td><td></td><td></td><td></td><td>co</td><td>C4</td><td></td><td></td>
<td></td><td>σ\</td><td> 4</td><td> 00</td><td>EITHER</td><td></td><td></td><td>dr</td><td>in</td><td>EITHER</td><td></td><td>NC</td>
<td></td><td>either</td><td> 00</td><td></td><td>F-(</td><td> 04</td><td></td><td></td><td>faith</td><td> »</td><td>dr</td><td></td>
<td></td><td>H</td><td>in</td><td>dr</td><td>dr</td><td>H</td><td>THE</td><td>i—1</td><td>co</td><td>Mr</td><td>H</td><td>co</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>THE</td><td>THE</td><td></td><td></td>
<td></td><td> 03</td><td> 00</td><td>EC</td><td>I HEARD</td><td> 00</td><td></td><td>in</td><td>dr</td><td> ></td><td>in</td><td>iA</td>
<td></td><td> 04</td><td>m</td><td>EITHER</td><td>Item</td><td>the</td><td></td><td> 00</td><td>GOES</td><td> 04</td><td> 00</td><td></td>
<td></td><td></td><td></td><td></td><td>faith</td><td> 4</td><td></td><td> 1</td><td>faith-</td><td>faith</td><td>faith</td><td>CD</td>
<td></td><td>m</td><td> 04</td><td>m</td><td> 04</td><td>in</td><td>THE</td><td> 04</td><td>either</td><td>either</td><td></td><td></td>
<td></td><td> <0</td><td>either</td><td>the</td><td>I HEARD</td><td>EITHER</td><td></td><td>dr</td><td></td><td>THE</td><td></td><td> <<</td>
<td></td><td></td><td> 4</td><td></td><td> ♦</td><td>faith</td><td></td><td> 1</td><td>dr</td><td> <0</td><td> *</td><td></td>
<td></td><td>either</td><td> 04</td><td> 01</td><td></td><td> 00</td><td></td><td>V0</td><td>faith</td><td>-faith</td><td>THE</td><td>IN</td>
<td></td><td>m</td><td></td><td>m</td><td></td><td>EITHER]</td><td>THE</td><td>in</td><td> 00</td><td>m</td><td>m</td><td> __04</td>
<td></td><td>in</td><td></td><td> 01</td><td>in</td><td> 00</td><td></td><td>THE</td><td></td><td></td><td></td><td>THE</td>
<td></td><td></td><td> 4.</td><td> «</td><td>faith</td><td></td><td></td><td> ♦</td><td>in</td><td></td><td>k</td><td>faith</td>
<td></td><td></td><td></td><td> 01</td><td>Rh</td><td>either</td><td></td><td>in</td><td></td><td></td><td>in</td><td>either</td>
<td></td><td>co</td><td></td><td>ooo</td><td></td><td>in</td><td>THE</td><td>either*</td><td> 00</td><td>in</td><td>either</td><td>Rh</td>
<td></td><td>the</td><td>in</td><td>either</td><td>\P</td><td></td><td></td><td></td><td></td><td>Φ</td><td>in</td><td></td>
<td></td><td></td><td>faith</td><td>F·</td><td>faith</td><td>m</td><td></td><td>Yo</td><td>in</td><td></td><td>faith</td><td></td>
<td></td><td> 00</td><td>ω</td><td> ></td><td> 00</td><td></td><td></td><td>either</td><td> ♦</td><td> *</td><td> 00</td><td>in</td>
<td></td><td></td><td> 04</td><td>|—i</td><td>I HEARD</td><td>in</td><td>in</td><td> 04</td><td>co</td><td>in</td><td> 1—1</td><td></td>
<td></td><td>either</td><td>either</td><td>either</td><td>either</td><td>either</td><td></td><td>either</td><td> 0</td><td></td><td>either</td><td></td>
<td></td><td>in</td><td> 00</td><td>'φ</td><td>in</td><td>AD</td><td></td><td>m</td><td>in</td><td>in</td><td></td><td></td>
<td></td><td>in</td><td>the</td><td>the</td><td></td><td>either</td><td></td><td>in</td><td>σ></td><td>in</td><td> 00</td><td> 04</td>
<td></td><td>in</td><td></td><td>in</td><td>the</td><td>m</td><td>THE</td><td>in</td><td> 03</td><td>in</td><td>m</td><td> 04</td>
<td></td><td>σ\</td><td></td><td>H</td><td></td><td>in</td><td></td><td> 01</td><td></td><td> ></td><td>in</td><td></td>
<td></td><td></td><td>Rh</td><td></td><td>faith</td><td>faith</td><td></td><td> 1</td><td> 04</td><td> <0</td><td>-faith</td><td>(N</td>
<td></td><td> 00</td><td></td><td> 04</td><td>in</td><td>in</td><td></td><td> 00</td><td></td><td>-faith</td><td></td><td> •</td>
<td></td><td>in</td><td>Rh</td><td>in</td><td>in</td><td> 00</td><td>THE</td><td>in</td><td> 00</td><td>in</td><td>in</td><td> 00</td>
<td>J></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>δ</td>
<td>or 8</td><td>either</td><td></td><td></td><td>dr</td><td>οι</td><td></td><td></td><td></td><td></td><td> 8</td><td>0u</td>
<td></td><td>w</td><td> 00</td><td>in</td><td>. dr</td><td> 1—1</td><td></td><td> 0</td><td></td><td></td><td>0 -H</td><td>0Ή</td>
<td></td><td></td><td></td><td></td><td>go</td><td> |—|</td><td></td><td>Ή</td><td></td><td></td><td>«H</td><td>-H</td>
<td></td><td></td><td></td><td></td><td></td><td>sh</td><td></td><td>Ό</td><td></td><td></td><td>Ό-U</td><td>Ό U</td>
<td> '0)</td><td></td><td></td><td></td><td>H</td><td>Φ</td><td></td><td></td><td></td><td></td><td>£t</td><td>g'g</td>
<td>B.</td><td>in</td><td>0Ί</td><td>in</td><td>in</td><td>in</td><td></td><td> 8</td><td></td><td></td><td> 8 5</td><td>or 8</td>
<td></td><td>either</td><td>EITHER</td><td>either</td><td>either</td><td>either</td><td></td><td>or</td><td>Q</td><td>M</td><td><u</td><td> 0)</td>
<td></td><td></td><td>i—I</td><td> (—|</td><td>dr</td><td>You</td><td></td><td> &</td><td>Ul</td><td></td><td>& in</td><td>Λ tn</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>Ο</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>o</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td>dr</td><td></td><td></td><td></td><td></td>
<td>XI co in 00 0) ω oí VH íq Φ XI <D You nor CN nΦ or H<u £ω neither § ΰ 0 3 - Xi 0 ~ ω d0 <N Uncle or 00 * <. <D 0<sup>w</sup><sup>&</sup> d to £ you R η<sup>Λ</sup>or 0 Ήqrt uu<sub>Λ</sub> £ 3 0 <sup>or</sup> m CN nor 00 0 T M ΉQJ XI W Q} Q you Ή ÍH Φ XΦn</td>
<img file="MX375112B_D0130.tif" />
IMPI
144
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td rowspan="11">Table 7A-7B. Summary of secondary pharmacokinetic data of individual patient and group average FIXFc activity, classified by nominal dose, actual dose and patient number.</td><td>Recovery<sup>11 </sup>Live (%></td><td>UJ m in</td><td>i—1</td><td>IT hmm</td><td>dr</td><td>CM EITHER <1</td><td>CM THE</td><td>U3 m</td><td>IT in</td><td><0 I HEARD in</td><td>THE</td><td> 39.2 1</td><td>THE THE</td><td>THE tN</td><td> 38.9</td><td>Rh</td>
<td><sup>1</sup> 9 8.-0 £ „ 3 ΐ * £ φ mq μ μ H</td><td>ooo or in</td><td>t—1</td><td>ooo ω</td><td>H</td><td>EITHER rn rn</td><td>CO m</td><td>LO m (Ό</td><td>IN CO in</td><td>σι on I heard</td><td>THE</td><td>THE rn</td><td>The m</td><td>IT dr</td><td>rn</td><td>(N ooh</td>
<td>dχ 5 5 5 &S d H ></td><td>m either</td><td>i—1</td><td>either</td><td>dr</td><td>either</td><td>LO or</td><td>I heard EITHER</td><td>ii t—1</td><td>a > either</td><td>THE</td><td>LÜ oo either</td><td>Hey C4 EITHER</td><td>m Ά ση or either</td><td>Ιφ 00 EITHER</td><td>THE OJ</td>
<td>“ka 5 0 0 S \ Η H & D mh ></td><td>s either</td><td>dr</td><td>m either</td><td>dr</td><td>ω<0 either</td><td>ch co either</td><td>either</td><td>co ch either</td><td>σ > ω either</td><td>THE</td><td>either</td><td>EITHER</td><td>either either</td><td>THE EITHER</td><td>IT C4</td>
<td>or -η Ή and<sup>s</sup></td><td>dr</td><td>r-1</td><td>ω or NC</td><td>dr</td><td>either on</td><td>σι co m</td><td>(N n</td><td>ΓΊ IT</td><td>a m</td><td>THE</td><td>THE CM</td><td>CPi m dr</td><td>rnCM either</td><td>EITHER vF</td><td>LD 00 CN</td>
<td>Λ .5 J Ή e<sup>s</sup></td><td>in I heard</td><td>dr</td><td>m</td><td>i—1</td><td>m</td><td>(Ti ω THE</td><td>yes</td><td> 00</td><td></td><td>a</td><td>LA 00 THE</td><td>THE</td><td>£ either</td><td>dr THE</td><td>H rFO)</td>
<td>Λ „ Λ 2 m 8</td><td></td><td>i—1</td><td>ωn</td><td></td><td>σι heard</td><td>00 LO σϊ</td><td>either THE</td><td>I heard rsj rd</td><td>rn</td><td>THE</td><td>ch cs> in</td><td>COσ></td><td>LO 00 with either</td><td></td><td>it is) NC</td>
<td>ω 3 ID \ wow</td><td>either</td><td>the</td><td>σ\ or</td><td>dr</td><td>σ > or ai</td><td>00 or (N</td><td>(N (N</td><td>LD</td><td>r-í</td><td>THE</td><td>m LE 04</td><td>EITHER</td><td>£L0 either</td><td>ω σ\</td><td>EITHER EITHER <0</td>
<td>4J you 01 Ήυm 0«</td><td>H</td><td rowspan="2">a</td><td>OJ</td><td rowspan="2">a</td><td>m</td><td>Mr</td><td>in</td><td>IT</td><td></td><td rowspan="2"></td><td rowspan="2"> 3 !</td><td rowspan="2">Qω</td><td rowspan="2">Kω</td><td rowspan="2"><sub>Λ</sub><sup>0 </sup>0 OR -fd -H 0) 4-1 ! 1 to φ or</td><td rowspan="2">qV' δ •H0ΌU Φ 'H § ΰid<sup>ft</sup> B. 8,</td>
<td>a . *H (rt á</td><td>H rn</td><td>lf) n £</td><td>THE THE</td><td>IT THE</td><td>in IT</td><td>m THE a</td><td>00 00 THE THE</td>
<td>5 SS 8 i fe 5 8 s</td><td colspan="2">the NC</td><td colspan="2">the rd</td><td colspan="11">wave</td>
145
IMPI to
MEXICAN INSTITUTE<sup>F</sup> OF THE PROPERTY
INDUSTRIAL BO
C168 = FIX activity estimated on reference values £ o A tí ε tí tí A ra jj ω Φ
Φ Tí tn A υ
£
0) w φ AO ti >
tn or in
-H §
you you
O tn (U 3 <d A
OX!
ooo
LO tí Φ £ tí tí ε
A § A tí o rd φ oe τί tí tí tí ω tn oo (ti nS rd tí tí tn tí τι tí
0) ω tu P ou tí i—fg tn
Φ Tí μ Ή -U £ os a <d (U
4J or
cu ti or ε
A Φ 4A Φ M rd rd (tí
OI rtí Ό rd > tu
ÍX '0 u en o A u •A £ fd td
A
O you you you
Φ you or ε you
Φ you
A □ you CU
Ό u ω or A υ *A ε
Ή Ό α \Α
0) tn Φ 4J tí tí tn tí O u >1
OU you 0)
Ήe
To you Λ § u
0} or (tí tn tu O Ή
0) YOU
OR (U
0)
U tí Φ A Φ tíi tí tí tí tn a
φ Tí o ε u tí φ A Φ Ψ4
ΦA<u
To >
you
Φ tn ti in rd
Φ or -μ ω
Ή > Φ A Eli
C.Q.
Ή
WO Ό you
Φ You or tn
Φ you
CU
II rA ffl rd
Φ JJ you Φ you you e
Ή X or A to id rd
Or Ό Ή
3
-H £ ω
to you you
Φ
You
You
-A >
Ά ti U ti
Φ you
AA ti A (ti ft rd
Ά tí Ώ Φ tí > Ή tí tí in Φ A or tí >
tn ω Φ tí tí tí tn tí O □ o tí tí Φ •d £
A tí CU 8 υ tí tí
Φ you
-§
N
to you 3
pj
OR 4J
-h tn you
Φ
You
or you you you
or p. g you
To the
you you
Φ tí s I Ό rd £ A
X or A you you
AB
-A £ m ti
XH fu
CU
Or you?
-A > Φ A CU tn A tn o Ό (d H tu
Ό or tn (D
O t tu -A a cu fi <D £rd TJ td £A
X or A you you
EITHER
B Ή E 01 tí tn a 4J tí φ τ( φ u φ tí tí o £
-AX 'td E ti >
(D you
Ό
U (do tu tn tn O ao M tu tí A
3 ω in O tí in o Tí tí (d tn <U μ
O You You You N You
Ό
or you
Φ tn
Φ you you Φ
0Ί
U you
Φ
You
a) 15
Ό td Ό -H >
Ά ti U ti
PU useful pq
Φ
You
Ll
or td >
tí tn Φ A tí
4J u tí tí A Φ tí Φ <0 or tí
<img file="MX375112B_D0131.tif" />
IMPI
146 you
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY r4 ti ti S ti o £ 0}
0) 44 0) M ti Ti
Ή JJ Í4 ti CU ti o
ti ti or £ x
or in
Or 75 ti ti ci ω Ή
ClOQ (ti -r4
U ε ua ti ti h ¡5 ti
X ϋ E u ω O tí ti E ti ti
ÍH O ti ti cn ti >
ti Ti u ti ti p ω 44 ti Ci
II or you Í4 or you you >
PO ti ti ω Ή ω o τί xoo H íl
or >
Ή >
you or Í4 you you
Cl ti □ tí m ti ti Tí tí ti ω
or you
4) ti □ ti ti Cu ü ti ti ti ti ti in
CM cu tu 75 tí O Tí ti 75 £ O σ> o rr4 ω 0) B ti ω ti
Cu ω Ή ω OQ tí ti ti Λ tí ti ti tí P i-4 ns
<img file="MX375112B_D0132.tif" />
IMPI
147
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Table 7B
<td>Recovery<sup>11 </sup>Live (%)</td><td> 51.8</td><td> 33.1</td><td> 00</td><td> 30-3 |</td><td> 42.2 |</td><td>in</td><td>co in m</td><td>in 00</td><td>CO m</td><td>T'6£</td><td> 21.6</td>
<td>Recovery<sup>3 </sup>Live (%)</td><td>σι</td><td>CO is</td><td>in σι</td><td>ooo Or is it</td><td>ooo The m</td><td>THE</td><td>AI in</td><td>co LD</td><td>either σι</td><td>THE m</td><td>co H</td>
<td>Value* K (IU/dL per IU/kg)</td><td>co or</td><td>r-1</td><td>in co either</td><td>in either</td><td>yes or</td><td>THE</td><td>it's</td><td>H EITHER</td><td>rs 00 either either</td><td>it's</td><td>THE EITHER</td>
<td>Value® K (IU/dL per IU/kg)</td><td>either</td><td>rs EITHER</td><td>00 either</td><td>h in either</td><td>is co either</td><td>LD</td><td>or in either</td><td>yes<sup>1 </sup>co either either</td><td>LA in or either</td><td>or in either</td><td>LD 00</td>
<td>, TBLP5<sup>d</sup>(Day)</td><td>IT</td><td>YOU <n LD</td><td> □0</td><td>rH is co</td><td>OJ a</td><td>in</td><td>on the LD</td><td>in or</td><td>at tA either</td><td>m tA IT</td><td>EITHER y'all</td>
<td>TBLP3<sup>C</sup>(Day)</td><td>either co</td><td>LD CO</td><td>either</td><td>σ > or</td><td>either</td><td>THE</td><td>Or is it 00</td><td>σι H</td><td>in iA EITHER</td><td>it is 00</td><td>THE H</td>
<td>TBLPl<sup>b</sup>(Day)</td><td>IT</td><td>YOU</td><td>00 cn</td><td>H</td><td>LD in in</td><td>in</td><td>LD</td><td>yes</td><td>00 co EITHER</td><td>THE</td><td>THE LD</td>
<td>C168<sup>a</sup>(IU/dL)</td><td>co or 'φ</td><td>CO CO</td><td><T* or σι</td><td>IT</td><td>in or σι</td><td>THE</td><td>00 in</td><td>σι THE</td><td>THE CO LD EITHER</td><td>in</td><td>in</td>
<td>Patient</td><td>either</td><td>ω</td><td>(You</td><td>H H</td><td>rs</td><td rowspan="2">a</td><td rowspan="2">I Average</td><td rowspan="2">Dω</td><td rowspan="2">MW</td><td rowspan="2">geometric mean</td><td rowspan="2">Geometric mean CV%</td>
<td>Actual Dose (Ul/kg)</td><td>(Uncle</td><td>0Ί or</td><td>cn or</td><td>LD in or</td><td> 109.441</td>
<img file="MX375112B_D0133.tif" />
IMPI
-148 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Table 8, Phase I/2a Study: Comparison of PK Parameters for rFIXFc and BENEFIX™
<td colspan="3"></td>
<td>Parameters</td><td>*rFIXFc [Mean+SD (min.-max.) ] [N=ll]</td><td><sup>F</sup>BENEFIX™ [Average ±SD {min-max)] [N=ll]</td>
<td>you/2 (hours)</td><td> 52.5 ± 9.2 {40 - 67.4)</td><td> 19.3 ± 4.97 (11.1 - 36.4)</td>
<td>TMR (hours)</td><td> 68.05 ± 11.16 (53.1 - 85.8)</td><td> 26,0 ± 6.07 (15.81 - 46.09)</td>
<td>LC(mL/hour/kg)</td><td> 3.36 ± 0.93 (1.84 - 4.58)</td><td> 8.4 ± 2.01 {4.66 - 13.64)</td>
<td>Gradual recovery (IU/dL per IU/kg)</td><td> 0.93 ±0.18 (0.62 - 1.17)<sup>a</sup></td><td> 0.75 ± 0.23 (0.34 - 1.38)</td>
<td>(IU/dL per IU/kg)</td><td>24 hours after injection</td><td></td>
<td>AUC</td><td>48 hours after injection</td><td></td>
* Estimates from 2-compartment assays of FIX activity at the nominal doses 25, 50, and 100 IU/kg (n=ll) tBENEFIX™ Brief Description of Product Characteristics {November 18, 2009); Average and interval (n=56)
a. Corrected range due to rounding or other errors such as 0.63 - 1.18.
Referring to historical data for BENEFIX™, rFIX-Fc demonstrated:
- a 3-fold increase in half-life and time
<img file="MX375112B_D0134.tif" />
IMPI
-149 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY means of residence
- 24% relative improved gradual recovery
- clearance reduced 2.5 times
Table 9. Phase I/2a Study: Dose Proportional Increase in Cmax and AUC of rFIXFc (Activity)
<td colspan="4"></td>
<td>Dose (Ul/kg)</td><td>No. of patients</td><td>Cmax (ul/dL) [ Average+SD (min-max) ]</td><td>AUC (h*Ul/dL) [Mean+SD (min-max)]</td>
<td> 25</td><td> 1</td><td> 19.9</td><td> 753</td>
<td> 50</td><td> 5</td><td> 41.6 + 8.97 (33.0 - 53.5)</td><td> 1630 ± 750 (1190 - 2960)</td>
<td> 100</td><td> 5</td><td> 98.2 ± 8.21 (89.9 - 111.0)</td><td> 3930 ± 893 (3060 - 5150)</td>
See also Figure 5.
Table 10A-10B. Estimated therapeutic duration of rFIXFc at doses of 50 and 100 IU/kg.
<td>Parameter</td><td>Geo Average</td>
<td>FIX:C on Day 7</td><td>2.0 IU/dL (above reference)</td>
<td>Time of 1 IU/dL above reference</td><td>9.1 days</td>
<td>3 IU/dL time over reference</td><td>5.7 days</td>
<img file="MX375112B_D0135.tif" />
IMPI
-150MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td>Parameter</td><td>Geo Average</td>
<td>FIX:C on Day 7</td><td>4.2IU/dL (on reference)</td>
<td>Time of 1 IU/dL above reference</td><td>11.5 days</td>
<td>Time of 3 IU/dL above reference</td><td>8.1 days</td>
See also Figures 6A-6B.
Table 11. Dose proportional increase in Cmax and AUC of rFIXFc antigen.
<td>Dose (ul/kg)</td><td>No. of patients</td><td>Cmax (ng/mL) [Bromedium±SD]</td><td>AUC (h*ng/mL) [Mean±SD]</td>
<td> 25</td><td> 1</td><td> 2,730</td><td> 144,000</td>
<td> 50</td><td> 5</td><td> 7,510 ± 2,480</td><td> 408,000 + 73,900</td>
<td> 100</td><td> 5</td><td> 15,400 ± 3,960</td><td> 897,000 + 206,000</td>
See also Figure 7.
<img file="MX375112B_D0136.tif" />
IMPI
- 151 Table 12. Pharmacokinetic estimates for the antigen
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY rFIXFc.
<td>Parameters</td><td>50 IU/kg [Mean ± SD] (N=5)</td><td>100 IU/kg [Mean ± SD] (N=5)</td>
<td>CL (mL/hour/kg)</td><td> 2.28 ± 0.37</td><td> 2.11 ± 0.46</td>
<td>Vss (mL/kg)</td><td> 259 ± 78.5</td><td> 238 + 52.2</td>
<td>TMR (hours)</td><td> 112 ± 21.5</td><td> 114 ±17.1</td>
<td>ti/j (hours)</td><td> 110 ± 26.5</td><td> 95.8 ± 11.1</td>
See also Figures 8A-8B.
<img file="MX375112B_D0137.tif" />
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Table 13. Average PK Values Based on Activity
<td>tl/2p W</td><td>H H</td><td> 52.455</td><td> 9.1674</td><td></td><td> 17.4768</td><td></td><td> 54.200</td><td>ooo either</td><td>either * IT</td><td> 51,715</td><td>In Vivo Recovery 18] (%)</td><td>you<sup>-</sup>1</td><td>3Í <n 00 0Ί</td><td>L0 LO</td>
<td>B. ” Λ</td><td>Rh</td><td><0 in</td><td></td><td>or tH a</td><td></td><td>00ClKOI σι</td><td>or ω m</td><td>00 or</td><td>O Vü H</td><td>uo OI Γ0 m</td><td>Your Live Recovery E7] C%)</td><td>H</td><td>OO H LO 'Φ m</td><td> 4,9250</td>
<td>a §</td><td>i—I</td><td>in to 00 LO</td><td> 11.1637</td><td></td><td> 16.4063</td><td></td><td>oo σχ a LO</td><td>or H in a</td><td>or 00 one co</td><td>oo H 04 *</td><td>gradual recovery [6] (IU/dL per iu/kg)</td><td>H</td><td>LP 04 σι either</td><td>or 00 either</td>
<td>vss (mL/kg)</td><td>H</td><td> 226.000</td><td>04 00 in σ> <0</td><td></td><td>LO 00 EITHER</td><td></td><td>ooo <0 H I heard</td><td>ooo a r-í</td><td>ooo I m</td><td> 216.533</td><td>H 1=4 HU r § μ</td><td>H</td><td>iH 04 00 either</td><td>00 two either</td>
<td>IV (mL/h/kg)</td><td>H</td><td>LO ox neither OI H</td><td> 21*2804</td><td></td><td> 17.2501</td><td></td><td> 118.000</td><td>or or ¢0Λ</td><td>ooo either</td><td><srH</td><td>TBLP5 [4] (Day)</td><td>H H</td><td>a H THE</td><td>a s oo</td>
<td>(Βχ/ίπι) TD</td><td>dr</td><td>tn a a</td><td>inΠon either</td><td></td><td>or an 00 in R</td><td></td><td>oh my m</td><td> 00</td><td>ooo lil</td><td>LOD 01</td><td>TBLP3 [31 (Day)</td><td>H</td><td>l> Cl ώ</td><td>σχ 00 oo ot</td>
<td>AUC/Dose (UT*h/dL per IU/kg)</td><td>H</td><td>YOU oh rn</td><td>L£> or a either</td><td></td><td> 33.1435</td><td></td><td>ooah 00 04</td><td>or 00 1—t is</td><td>gold*1 rr</td><td>or 04 or P!</td><td>TBLP1 [2] । (Day)</td><td>H</td><td>either</td><td>hmm <N</td>
<td> 6 £ 3 *</td><td></td><td>£ 00 0Q</td><td> 10.5210</td><td></td><td> 11.8980</td><td></td><td>oo co or 0)</td><td>either</td><td>either σί σ\</td><td>I OI 00 £</td><td>os _ \ _ SHKJ ¿D</td><td>Rh</td><td><0 or m</td><td>i heard 04 00</td>
<td>AUCa (%)</td><td>H F</td><td>5Í a</td><td>Or σι either</td><td></td><td>an 3 either</td><td></td><td>oo I heard σί</td><td>ooo</td><td>om 00 CN</td><td>00 IT</td><td></td><td>you</td><td> 1</td><td>Dev. its T-</td>
<td>AUC INF (h*Ul/dL)</td><td>H</td><td>lo lo LO with an O)</td><td> 1497,1234</td><td></td><td><0 inΦ go></td><td></td><td>oh Q or LO σ\ I heard</td><td>ooo m a</td><td>ooo or in a</td><td> 2181.294</td><td></td><td></td><td></td><td></td>
<td>CiP/m}</td><td>i—1</td><td><0m in him</td><td> 32.9708</td><td></td><td></td><td></td><td>oh LA hmm</td><td>or on H</td><td>ooo Rh</td><td>σ\ LO in</td><td></td><td></td><td></td><td></td>
<td></td><td>you</td><td> 1</td><td>Dev. its T.</td><td></td><td> 5</td><td></td><td>.2s</td><td>you</td><td>Yo</td><td>Geo Avg.</td><td></td><td></td><td></td><td></td>
or vn vn
<img file="MX375112B_D0138.tif" />
153
IMPI to
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY BO
<td>€ϊ/2β (Μ</td><td>rj</td><td> 17.0900</td><td> 40.200</td><td> 30.30</td><td>or 00 a</td><td> 38.486</td>
<td>0 ”Λ</td><td> 1</td><td> 2678</td><td>oo OV</td><td>or 00</td><td> .40</td><td>That's it</td>
<td> 2 ~</td><td></td><td>iH</td><td>σι</td><td> 27</td><td> 43</td><td> 34</td>
<td>TMR (W</td><td>H</td><td>EITHER in heard</td><td>0Δ6Ό</td><td> 0.62</td><td></td><td>or in or</td>
<td>SVS (mL/kg) 1 ________ .</td><td>rj</td><td> 16.8921</td><td>EITHER 00 or</td><td>IT EITHER</td><td>it's</td><td>or H00 EITHER</td>
<td> £</td><td></td><td></td><td>either</td><td>w</td><td></td><td></td>
<td></td><td> 11</td><td>in or</td><td>it is</td><td>either</td><td><N</td><td></td>
<td>ΠL</td><td></td><td> 37.</td><td>a</td><td>it is</td><td>co</td><td></td>
<td> . §</td><td></td><td>is <r></td><td> 70</td><td>it is</td><td> 30</td><td> 47</td>
<td>CJ (mL/ Yo</td><td>H</td><td>00 in 03</td><td> 7.0</td><td></td><td> '01</td><td> 6.4</td>
<td>ί d</td><td></td><td>co</td><td></td><td></td><td></td><td></td>
<td>AUC/DOS (ÜI*h/c per Ul/kg)</td><td>H</td><td>co or σι O] OI</td><td> 9.870</td><td> 82'1</td><td>either H</td><td>00m in</td>
<td>AUCb (%></td><td> 11</td><td> 58.6897</td><td> 3.090</td><td>in or</td><td> <0</td><td> 2,621 -</td>
<td>ADCa <%)</td><td>H</td><td>B.</td><td>Medium</td><td>min</td><td>Max.</td><td>Geo Avg.</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 8 ?</td><td>Rh</td><td></td><td></td><td></td><td></td><td></td>
<td>(TP/ xe</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td>δg</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td> £</td><td></td><td></td><td></td><td></td><td> 1</td>
(DΉd
□d
E u Ή Í4 '(D § ω 0 £ O id cu ϊϊ o ω tn
OJ
You
ΌCπί
Or m ω m η -η ή ω ω ω
0 0 τί Τ τ or;
o tn ω íd d
or you Ή ga
HE ω
Ή Ό σι <υ 2 ο Ό ηί ε Ή
Ο£ <υ ιι
ΙΛ Λ
<img file="MX375112B_D0139.tif" />
IMPI υ £ Φ
0} 4-1
Φa or τί
H
Tj í> Φ íq ftí ti o!
Ή
H
-U 3
154
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY in O
Φ d j j ω
ω ο Ρ d μ φ d φ σι ο
ω τί ο ε d γΗ πί γΗ d ω φ Μ φ in ω ο d ω ε
-Η in ο Q ^ι Φ m φ γΩ ΟΙ 'fcRR*'
II ί-ι Ο Λ
Η
TJ Φ¡H&
in d ε ω dd ε tn d α φ ε d ο >
α φ I ο >
ΙΌ
Η ω ο τί π!
d '0 υ d ÍH
ϋ] φ β Φ ω υ Φ 4J ΰ d ω 'Η ω ο Ό πί
0)
Ο tn d μ 4-> ω ο 3 Ε ίΰ >ο
Η
U d μ φ £ υ φ τί α ο ιι d ε in d π! > Μ Φ ω
ρ4φ
τ>
φ τί d σ > ο > Η in ο
Γ'rH
I in ε υ ρ φ
<img file="MX375112B_D0140.tif" />
155
IMPI to
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY M
Table 14. Average PK values based on antigen level.
<td>Beta HL</td><td>(h)</td><td> 107</td><td> 71</td><td> 138</td><td>ΓΌ ID 00</td><td><B</td><td> 140</td><td> 93.9</td><td> 78</td><td> 94.3</td><td> 107</td><td> 97.1</td><td> 102</td><td> 12</td><td>QO</td><td> 20.9</td><td> 6.0</td><td> 8*86</td>
<td>Alpha HL</td><td>(h)</td><td> 21.2</td><td> 11.3</td><td><0 00H</td><td> 10.6</td><td>NC</td><td>NC</td><td> 10.1</td><td>CB</td><td>H</td><td> 11.5</td><td>ετ</td><td> 10.6</td><td> 12</td><td>ro H</td><td> 4.0<sup>d</sup></td><td> ♦</td><td>ω CM</td>
<td colspan="2">RMR (h)</td><td> 98.2</td><td> 87.1</td><td> 144</td><td> ! 105</td><td> 84.5</td><td>mrs</td><td> 116</td><td> 8*96</td><td>। εοτ</td><td> 137</td><td> 105 1</td><td> 126 ’</td><td> 12</td><td> 109,6*</td><td> 18-5</td><td> 5.3</td><td> 108.2</td>
<td colspan="2">v<sub>H.H</sub>(mL/kg)</td><td> 245</td><td> 273</td><td> 366</td><td> 244</td><td> 184 1 . .</td><td></td><td> 310</td><td> 263</td><td> 156</td><td> 248</td><td> 226</td><td> 295</td><td>IM</td><td>either om IM</td><td>CM 00 LA</td><td> 16.8</td><td> 243.7</td>
<td colspan="2">Cl (mL/h/kg)</td><td> 2.5</td><td> 3-14</td><td>m CM</td><td>CM CM</td><td> 2.17</td><td> 1.71</td><td>yes CM</td><td> 2.72</td><td>ι—1 in</td><td>ω</td><td>in rd IM</td><td>:(N</td><td>CM</td><td> 2.3</td><td>(0 a either</td><td>vo</td><td>NC</td>
<td colspan="2">s M § g * i</td><td> 91300</td><td> 144000</td><td> 356000</td><td> 389000</td><td> 416000 <sup>!</sup></td><td> 531000</td><td> 348000</td><td> 667000</td><td> 1200000</td><td> 000866</td><td> 844000 1</td><td> 778000</td><td> 12</td><td> 563525.0</td><td>om CM CB CB in m</td><td> 98128.0</td><td> 452356.0</td>
<td colspan="2">J$</td><td> 1670</td><td> 2730</td><td> 5470</td><td> 6910</td><td> 7520</td><td> 11700</td><td> 5950</td><td> 12500</td><td> 21600</td><td> 13400</td><td> 17200</td><td> 12500</td><td> 12</td><td> 9929.0</td><td>either either <btn</td><td>either in r4 r4</td><td> 8014.0</td>
<td colspan="2">Patient</td><td>iH</td><td>CM</td><td></td><td></td><td></td><td></td><td></td><td> 10</td><td> 00</td><td>CB</td><td>r4</td><td></td><td rowspan="3">H</td><td rowspan="3">Average</td><td rowspan="3">SD</td><td rowspan="3">I KNOW</td><td rowspan="3">geometric mean</td>
<td colspan="2">Equivalent dose (mg/kg)</td><td> 0,228</td><td>min :EITHER</td><td>a or <b either</td><td> 0.905</td><td> 806'0</td><td>lo or</td><td> 0.928</td><td>co r4</td><td>00 H</td><td> 1.81</td><td> 00 *</td><td> 1.82</td>
<td colspan="2">Actual dose (Ul/kg)</td><td> 13.714</td><td> 27.25</td><td>a m</td><td> 54.5</td><td> 54.5</td><td> 54.513</td><td> 55.878</td><td> 109</td><td>60t</td><td> 109</td><td> 109.176</td><td>r4 CB OR</td>
<td colspan="2">Nominal dose (Ul/kg)</td><td> 12.5</td><td> 25</td><td colspan="5"> 50</td><td colspan="5"> 001</td><td></td><td> 1</td><td></td><td></td><td></td>
<img file="MX375112B_D0141.tif" />
156
IMPI to
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY BO
Table 15: Biochemical characterization of Factor IX.
<img file="MX375112B_D0142.tif" />
<img file="MX375112B_D0143.tif" />
IMPI
- 157 Table 16: Brief description of the terminal half-lives of FIXFc and BENEFIX™ after a single intravenous dose.
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td>Species</td><td>BENEFIT™</td><td>FIXFc</td>
<td>normal mice</td><td>12:30 p.m.</td><td>47.2 ± 4.8hrs</td>
<td>Fix-deficient mice</td><td>1:20 p.m.</td><td>46.2 + 10.1 hours</td>
<td>FcRN KO mice</td><td>16.5 ± 3.0 hrs</td><td>16.9 + 2.1 hrs</td>
<td>FcRN Tg32b mice</td><td>14.2 ± 2.9 hrs</td><td>53.0 + 6.6. hr</td>
<td>rats</td><td>5.8hrs</td><td>34.8 ± 5.3 hrs</td>
<td>Dogs with FIX deficiency</td><td>2pm-6pm*</td><td>47.5 hours</td>
<td>Bow</td><td>12:7 p.m.<sup>F</sup></td><td>47.3+ 9.1hrs</td>
*Brinkhous et al, Blood, 1996; 88: 2603-2610.
<sup>F</sup> McCarthy et al, 2002, Thromb Haemost, 2002; 87:
824-830.
<img file="MX375112B_D0144.tif" />
IMPI
-158 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Table 17, Summary of ROTEN® In Vitro Parameters for Aggregated rFIXFc and BENEFIX™ in HemB Mouse Whole Blood Pools
<td></td><td>% normal activity</td><td>CT (sec) (Mean + SD)</td><td>cft (sec) (Mean + SD)</td><td>Alpha Angle (°) (Mean ± SD)</td>
<td rowspan="3">rFIXFc (groups n=10)</td><td> 0.074</td><td> 2263 ± 209</td><td> 1152 ± 170</td><td> 24 ± 5</td>
<td> 0.74</td><td> 1371 ± 82</td><td> 459 ± 45</td><td> 34 ± 5</td>
<td> 7.4</td><td> 790.8 ± 30</td><td> 226 ± 20</td><td> 52 + 2</td>
<td rowspan="3">BENEFIT™ (groups n=10)</td><td> 0.1</td><td> 2019 ± 178</td><td> 732 ± 123</td><td> 30 ± 3</td>
<td> 1</td><td> 1090 ± 38</td><td> 324 ± 33</td><td> 43 ± 3</td>
<td> 10</td><td> 551.1 ± 38</td><td> 127 + 10</td><td> 67+2</td>
Table 18. Average blood loss after tail docking of HemB mice treated with rFIXFc or BENEFIX™<sup>1</sup>
<td rowspan="2">Dose (Ul/kg)</td><td colspan="3">Average blood loss (ml«)</td>
<td>rFIXFc (n=15/dose)</td><td>BENEFIT™ (n=15/dose)</td><td>Vehicle (n=18)</td>
<td> 720</td><td> 0.101</td><td></td><td></td>
<td> 360</td><td> 0.651</td><td> 0.218</td><td></td>
<td> 240</td><td> 0.298</td><td></td><td></td>
<td> 120</td><td> 0.4567</td><td> 0.564</td><td></td>
<td> 80</td><td> 0.8474</td><td></td><td></td>
<td> 40</td><td> 1.0097</td><td> 0.918</td><td></td>
<td> 0</td><td></td><td></td><td> 1.1586</td>
<img file="MX375112B_D0145.tif" />
IMPI
-159Table 19. Ex vivo parameter ROTEM in HemB mice
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY treated with rFIXFc and BENEFIX™
<td></td><td>Time hour)</td><td>CT (sec) (Mean ± SD)</td><td>cft (sec) (Mean ± SD)</td><td>Alpha angle (degree) (Mean ± SD)</td>
<td rowspan="5">100 IU/kg BENEFIX™ (n=4 mice/time point)</td><td> 0.083</td><td> 599 ± 23</td><td> 174 ± 16</td><td> 58 ± 2</td>
<td> 24</td><td> 682 ± 49</td><td> 184 ± 34</td><td> 57 ± 5</td>
<td> 48</td><td> 897 ± 114</td><td> 310 ± 89</td><td> 45 ± 7</td>
<td> 72</td><td> 1141 ± 155</td><td> 508 ± 123</td><td> 32 ± 7</td>
<td> 96</td><td> 1613 ± 181</td><td> 605 ± 92</td><td> 27 ± 3</td>
<td rowspan="7">50 IU/kg rFIXFc (n=8 mice/time point)</td><td> 0.083</td><td> 700 ± 18</td><td> 213 ± 9</td><td> 53 ± 1</td>
<td> 24</td><td> 836 ± 31</td><td> 261 ± 15</td><td> 47 ± 2</td>
<td> 72</td><td> 845 ± 38</td><td> 285 ± 17</td><td> 45 ± 2</td>
<td> 96</td><td> 957 ± 30</td><td> 296 ± 26</td><td> 43 * 2</td>
<td> 120</td><td> 1014 ± 83</td><td> 342 ± 50</td><td> 42 ± 4</td>
<td> 168</td><td> 1139 ± 65</td><td> 408 ± 41</td><td> 36 + 3</td>
<td> 216</td><td> 1366 1 96</td><td> 453 ± 48</td><td> 34 ± 3</td>
Table 20A. PK parameters of rFIXFc and BENEFIX™ {200 IU/kg) after single dose subcutaneous injection in FIX-deficient mice (antigen ELISA).
<td>Compound</td><td>Dose</td><td>WF m Ukg</td><td>Tiag Hr</td><td>AUC. Hr^hgJlTiL</td><td>Absc ncí&n HL kt</td><td>HL Elimination Hr</td><td>CUF mUHrikg</td><td>Tmax 1+</td><td>ngtnL</td><td>AUC/Dchsis HrkgtnL</td><td>Cmax/Dose griTiL</td><td>F</td>
<td>Gene FIX</td><td> 727273</td><td> 3320</td><td> 2.86</td><td> 6307</td><td>1JD6</td><td> 23.3</td><td> 114</td><td> 10.6</td><td> 148</td><td> 0.00880</td><td> 0.204</td><td> 23.3</td>
<td>tFKFq</td><td> 3278680</td><td> 2071</td><td>0J&9B</td><td> 141370</td><td>Tj67</td><td> 61.3</td><td> 232</td><td> 27.3</td><td> 1178</td><td>0D431</td><td> 0.350</td><td> 38.1</td>
<img file="MX375112B_D0146.tif" />
-160 Table 20B, PK Parameters of rFIXFc and BENEFIX™ {200
IU/kg) following subcutaneous injection of a single dose in FIX-deficient mice (aPTT activity assay).
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td>Compound</td><td>Dose</td><td>V/F dUkfl</td><td>TUg Hr</td><td>AUC^ HriU/dL</td><td>HL absorption hr</td><td>Elimination HL hr</td><td>CUF dL/HrAg</td><td>Tmax hf</td><td>Crrak IIWL</td><td>AUC/Dchsis HíktfdL</td><td>Cmax/Dose gtiL</td><td>F %</td>
<td>BeneFIX</td><td> 207</td><td>54th</td><td> 0631</td><td> 83.9</td><td> 7.01</td><td> 17.2</td><td> 220</td><td> 16,0</td><td> 2.04</td><td> 0.454</td><td> 986</td><td> 189</td>
<td>iFIXFc</td><td> 172</td><td> 25,1</td><td> 232</td><td> 418</td><td> 6.84</td><td> 42.4</td><td> 0.411</td><td> 23.8</td><td> 4.82</td><td> 2.43</td><td> 280</td><td> 29.1</td>
<img file="MX375112B_D0147.tif" />
IMPI
161
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td rowspan="8">Table 21. PK and PD analysis of rFIXFc and BENEFIX™ after a single subcutaneous dose in FIX-deficient mice.</td><td>F (%)</td><td> 38.1</td><td>in in <N</td><td>in ID ♦</td><td></td><td>9'S^</td><td> 20.2</td><td> 2.26</td><td>F (%)</td><td>Ch is</td><td>Chω</td>
<td>Cmax/Dose (kg/inL)</td><td> 0.00035</td><td>ooo either</td><td> 2.05</td><td></td><td> 0.00045</td><td> 0.00024</td><td> 1.91</td><td>Cmax/Dose (kg/nL)</td><td> 0.00024</td><td>either ooo either</td>
<td>Tinax (Hr)</td><td> 27.3</td><td>ÍO or</td><td> 2.58</td><td></td><td>m 00rd</td><td>go 00</td><td> 2,25</td><td>Tinax (Hr)</td><td>co in is</td><td>either LD</td>
<td>CL/F (mL/Hr/kg)/%</td><td>it is CS</td><td>rd rd</td><td>or cf either</td><td></td><td> 23.7</td><td>m dr</td><td> 0.21</td><td>LC/F (mL/Hr/kg) /%</td><td> 41.1</td><td>EITHER CS is</td>
<td>elimination half-life (HR)</td><td>Chΰ</td><td>Ch in CJ</td><td><hm it is</td><td></td><td>Ch or in</td><td>it is EITHER CS</td><td>month</td><td>elimination half-life (HR)</td><td>M<sup>1</sup>CS</td><td>(S</td>
<td>AUC/Dose (Hr*kg/mL)</td><td> 0.041</td><td>in ooo either</td><td> 5.62</td><td></td><td>is M<sup>1 </sup>either either</td><td> 6800*0</td><td> 4.72</td><td>AUC/Dose (Hr*kg/mL)</td><td> 0.021</td><td> 0.0047</td>
<td>Trial</td><td>Antigen</td><td>Antigen</td><td>Antigen</td><td></td><td>Antigen</td><td>Antigen</td><td>Antigen</td><td></td><td>Exercise</td><td>Exercise</td>
<td></td><td>rFIXFc 200 IU/kg</td><td>BENEFIX™ 200 IU/kg</td><td>Ratio (rFIXFc/BENEFIX™)</td><td></td><td>rFIXFc 400 IU/kg</td><td>BENEFIX™ 400 IU/kg</td><td>Ratio (rFIXFc/BENEFIX™)</td><td></td><td>rFIXFc 200 IU/kg</td><td>BENEFIX™ 200 IU/kg</td>
<img file="MX375112B_D0148.tif" />
IMPI
162
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td></td><td></td><td></td><td> 04</td><td>m</td><td>in</td>
<td> *—</td><td>in*</td><td></td><td>σί</td><td></td><td>in</td>
<td>faith</td><td></td><td></td><td></td><td>H</td><td></td>
<td>a</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td>either</td><td></td>
<td> 3 1</td><td> 40</td><td></td><td>in oo</td><td> 001</td><td> .70</td>
<td> □</td><td>I HEARD</td><td></td><td>either</td><td>either</td><td></td>
<td></td><td></td><td></td><td>either</td><td>either</td><td></td>
<td></td><td>in</td><td></td><td>σ></td><td></td><td>ooo</td>
<td>3μ</td><td></td><td></td><td></td><td> »</td><td>co</td>
<td>sx</td><td></td><td></td><td>it</td><td> 00</td><td> +</td>
<td>P—</td><td>dr</td><td></td><td>dr</td><td>YO-[</td><td>either</td>
<td>dp</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td>
<td>u# fe M</td><td>I heard</td><td></td><td></td><td></td><td>co</td>
<td></td><td>dr</td><td></td><td>v</td><td>C\</td><td></td>
<td>dϋ</td><td>EITHER</td><td></td><td> 35</td><td>dr</td><td>either</td>
<td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td><td></td><td></td>
<td>gives Hr</td><td></td><td></td><td></td><td></td><td></td>
<td></td><td colspan="2"> 10</td><td>m</td><td></td><td> 00</td>
<td> ></td><td>st*</td><td></td><td> *</td><td>v</td><td>y'all</td>
<td></td><td colspan="2"> •</td><td>either</td><td>m</td><td></td>
<td>§ -d</td><td>NC</td><td></td><td>sf</td><td>dr</td><td><N</td>
<td>ul rd</td><td></td><td></td><td></td><td></td><td></td>
<td>Φ</td><td></td><td></td><td></td><td></td><td></td>
<td>•3 3 δ £</td><td></td><td></td><td> .028</td><td> 0052</td><td>CO</td>
<td>R£ H.H</td><td></td><td></td><td>EITHER</td><td>either</td><td>y'all</td>
<td></td><td></td><td></td><td>Ό</td><td></td><td>•you</td>
<td> 9</td><td> •3</td><td></td><td></td><td></td><td> 4</td>
<td> &</td><td></td><td></td><td></td><td>-rd ></td><td>saw</td>
<td>eQ</td><td colspan="2">»J</td><td>*rl</td><td>Ή</td><td></td>
<td></td><td>eleventh</td><td></td><td>-OR</td><td>-P</td><td>4J</td>
<td>faith</td><td> £</td><td></td><td></td><td>ac</td><td>ac</td>
<td></td><td>g</td><td></td><td> &1</td><td>you and</td><td>F*</td>
<td></td><td> >4</td><td></td><td> 44</td><td>H</td><td>K</td>
<td></td><td>a</td><td></td><td><sup>F</sup>in</td><td>Í3</td><td>£ faith</td>
<td></td><td>8 8n</td><td></td><td>ooo</td><td> 400</td><td>orci 'BEN1</td>
<td></td><td>Prop[XFc;</td><td></td><td>u faith X</td><td>;fix™</td><td>Prop IXFC></td>
<td></td><td>faith M</td><td></td><td>H fe id</td><td>Yo</td><td>(rF:</td>
<td></td><td></td><td></td><td></td><td>C.Q.</td><td></td>
<img file="MX375112B_D0149.tif" />
IMPI
-163 Table 22. PK parameters of rFIXFc (50 IU/kg) after
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY Subcutaneous injection of a single dose in cynomolgus monkeys.
<td>Cluster</td><td>ΑιιπηΠΟ</td><td>\£F (mükg)</td><td>ALiC CHfbgjhiL)</td><td>Assertion HL(I+)</td><td>Timrinal HL (Hr)</td><td>CUF (mUIMig)</td><td>Tmax</td><td>ClTBX</td><td>AUC/D (HrkghiL)</td><td>F.W.</td>
<td rowspan="9">50 IWcg rFDIFc</td><td> 504</td><td> 54$</td><td> 109000</td><td> 8.42</td><td> 501</td><td> 753</td><td> 28.1</td><td> 1050</td><td> 0.133</td><td> 43,7</td>
<td>C37716</td><td> 075</td><td>10&0DD</td><td> 6.4</td><td> 39</td><td>7 JO</td><td> 262</td><td> 085</td><td> 0.132</td><td> 43 3</td>
<td>C41440</td><td> 622</td><td> 32500</td><td> 8.54</td><td> 43.4</td><td> 993</td><td> 249</td><td> 885</td><td> 0,101</td><td> 33.1</td>
<td>N</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td>
<td>Average</td><td> 714</td><td> 93800</td><td> 7.79</td><td> 30.9</td><td> 835</td><td> 25.7</td><td> 873</td><td> 0,122</td><td> 40.1</td>
<td></td><td> 220</td><td> 14000</td><td> 1/2</td><td> 24.6</td><td> 137</td><td>0J685</td><td> 182</td><td> 0.0183</td><td> 6.03</td>
<td>I KNOW</td><td> 132</td><td> 3030</td><td> 0 595</td><td> 14.2</td><td> 0.79</td><td></td><td> 105</td><td>D.D1D6</td><td> 3.48</td>
<td>Average Geom.</td><td></td><td> 99000</td><td> 7.72</td><td> 57,9</td><td> 828</td><td> 25.7</td><td> 860</td><td> 0.121</td><td> 38.7</td>
<td>Average Geom. CVl</td><td> 312</td><td> 153</td><td>16Λ</td><td> 39.4</td><td> 15«</td><td> 268</td><td> 217</td><td> 15.9</td><td> : 15.9</td>
Table 23. PK parameters of rFIXFc (100 IU/kg) after single dose subcutaneous injection in cynomolgus monkeys.
<td>Cluster</td><td>AnimalJD</td><td>V/F (mUkg)</td><td>AUC (HfnglmL)</td><td>Absorption HL(Hr)</td><td>Terminal HL(Hr)</td><td>CUF (mUHrJkrj</td><td>Tmat (Hf)</td><td>Cmax (hglhit)</td><td>AUC/D (Hr'kgftnL)</td><td>F.W.</td>
<td rowspan="9">100 KJ/kg rFIXFc</td><td> 29109</td><td> 1630</td><td> 69800</td><td> 11.4</td><td> 48.1</td><td> 23.5</td><td> 31</td><td> 644</td><td> 0.0426</td><td> 14.0</td>
<td> 605097</td><td> 561</td><td> 207000</td><td> 5.12</td><td> 49.2</td><td> 7.9</td><td> 18.6</td><td> 2250</td><td> 0.126</td><td> 41.5</td>
<td>C35785</td><td> 387</td><td> 238000</td><td> 6.37</td><td> 39</td><td> 6.89</td><td> 19.9</td><td> 2970</td><td> 0.145</td><td> 47.8</td>
<td>N</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td>
<td>Average</td><td> 858</td><td> 172000</td><td> 7.62</td><td> 45.4</td><td> 12.8</td><td> 23.2</td><td> 1950</td><td> 0.105</td><td> 34.4</td>
<td>SD</td><td> 671</td><td> 89600</td><td> 3.31</td><td> 5.58</td><td> 9.3</td><td> 679</td><td> 1190</td><td> 0.0546</td><td> 18.0</td>
<td>I KNOW</td><td> 388</td><td> 51700</td><td> 1.91</td><td> 3.22</td><td> 5.37</td><td> 3.92</td><td> 687</td><td> 0.0315</td><td> 10.4</td>
<td>Average Geom.</td><td> 707</td><td> 151000</td><td> 7.1?</td><td> 45.2</td><td> 10.9</td><td> 22.6</td><td> 1630</td><td> 0.0921</td><td> 30.3</td>
<td>Average Geom,CV%</td><td> 86.2</td><td> 75.5</td><td> 43.1</td><td> 128</td><td> 75.5</td><td> 28.2</td><td> 96.9</td><td> 75.5</td><td> 75.5</td>
<img file="MX375112B_D0150.tif" />
IMPI
-164 Table 24. PK parameters of rFIXFc (200 IU/kg) after single dose subcutaneous injection in cynomolgus monkeys.
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<td>Cluster</td><td>AnimalJD</td><td>WF (mLAg)</td><td>AUC ÍHr*ng/mL)</td><td>Absorption HL(Hr)</td><td>finished at HL (Hr)</td><td>CUF (mUHr/kg)</td><td>Tmax (Hr)</td><td>Cmax (nsArt)</td><td>AÜOD</td><td>F.W.</td>
<td rowspan="9">200 IU/kg rflXFc</td><td> 63893</td><td> 055</td><td> 406000</td><td> 3.36</td><td> 73.7</td><td> 6 03</td><td> 15 7</td><td> 3310</td><td> 0.124</td><td> 40.9</td>
<td>C31120</td><td> 461</td><td> 415000</td><td>e.42</td><td> 40.4</td><td>7.S1</td><td> 202</td><td> 5030</td><td> 0.127</td><td> 41.6</td>
<td>C41410</td><td>M7</td><td> 262000</td><td> 11.5</td><td>32.Θ</td><td> 3.12</td><td> 287</td><td> 3160</td><td>0.O79B</td><td>2B.3</td>
<td>N</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td><td> 3</td>
<td>Average</td><td> 467</td><td> 362000</td><td> 7.00</td><td>4BJ</td><td> 6.36</td><td> 20.3</td><td> 3630</td><td>Ü.11D</td><td> 36.3</td>
<td>SD</td><td> 354</td><td> 06100</td><td> 4.00</td><td> 21.0</td><td> 2.0</td><td> 5.51</td><td> 1040</td><td>0.D2B3</td><td> 0.67</td>
<td>I KNOW</td><td> 205</td><td> 49700</td><td> 2 36</td><td> 12 6</td><td> 1.02</td><td> 3.10</td><td> 598</td><td> 0.0152</td><td> 500</td>
<td>Average Geom.</td><td> 307</td><td> 354000</td><td> 6 27</td><td> 46</td><td> 5.03</td><td> 20 4</td><td> 3750</td><td>0.10Θ</td><td> 35.5</td>
<td>Avg Geom CV%</td><td> 110</td><td> 28.4</td><td> 67.6</td><td> 44.2</td><td> 50-3</td><td> 27</td><td> 25.9</td><td> 26.5</td><td> 265</td>
<img file="MX375112B_D0151.tif" />
165
IMPI to
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY BO
Table 25. PK parameters of rFIXFc after a single subcutaneous dose in cynomolgus monkeys.
<td></td><td>in in</td><td> 15.9</td><td> 44.5</td><td> 10.0</td><td> 35.5</td><td>9'92 Yo</td>
<td>Cmax (ng/inL)</td><td> 860</td><td>it is</td><td> 2,585</td><td> 19.8</td><td>or m</td><td> 25.9</td>
<td>Tmax (Hr)</td><td> 25.7</td><td>KWD 00 it is</td><td>N in</td><td>00 M<sup>1</sup></td><td>or CS</td><td>LZ</td>
<td>LC/F (mL/Hr/kg) /%</td><td> 8.28</td><td> 15.8</td><td> 7.38</td><td> 1 9.70</td><td> 5.83</td><td> 2'85</td>
<td>elimination half-life (HR)</td><td> 57.9</td><td> 39.4 .. .</td><td> 43.8</td><td> 16.5</td><td> 46</td><td> 44.2</td>
<td>Abs_ half-life (Hr)</td><td>ZL' L</td><td>LD</td><td> 5.71</td><td> 15.5</td><td> 6.27</td><td> <0</td>
<td>AuC (Hr*ng/mL)</td><td> 99,000</td><td> 00 2</td><td>in LA in *1 CS CS</td><td> 68*6</td><td> 354,000</td><td>CS</td>
<td></td><td>Geom. Average</td><td>Geom. Average CV%</td><td>Geom. Average</td><td>Geom. Average CV%</td><td>Geom. Average</td><td>Geom. Average CV%</td>
<td>rFIXFc (Ul/kg)</td><td colspan="2">or in _</td><td colspan="2">ooo</td><td>ccc</td><td>ys</td>
I heard íq ti ti íd in ín co ti
Sd you you id you >
to '0
Or ti £ ε
you
0) I heard TJ id >
ε v ω
<img file="MX375112B_D0152.tif" />
IMPI
Table 26. Dosage Guidelines for the Treatment of Hemophilia
B with rFIXFc.
Factor IX Frequency of
Level Required dose %
Type of hemorrhage (hrs)
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
- 166Minor
epistaxis
<td>Hemarthrosis, uncomplicated</td><td> 20-30</td><td> 43</td>
<td>superficial muscle</td><td> 20-30</td><td> 48</td>
<td>Superficial soft tissue</td><td></td><td> 20-30</td>
<td></td><td></td><td> 48</td>
<td>moderate</td><td></td><td></td>
<td>epistaxis</td><td></td><td></td>
<td>Intramuscular with dissection</td><td> 26-50</td><td> 48</td>
<td>soft tissue with dissection</td><td> 25-50</td><td> 48</td>
<td>mucous membranes</td><td> 25-50</td><td> 48</td>
<td>dental extractions</td><td> 25-50</td><td> 48</td>
<td>Hematuria</td><td> 25-50</td><td> 48</td>
<td>Hemarthrosis, with movement</td><td> 40-80</td><td> 48</td>
<td>limited</td><td></td><td></td>
<td>Higher</td><td></td><td></td>
<td>epistaxis</td><td> 50-100</td><td> 24-48</td>
<td>Pharynx</td><td> 50-100</td><td> 24-48</td>
<td>retro f ar i nge</td><td> 50-100</td><td> 24-48</td>
<td>retroperitoneum</td><td> 50-100</td><td> 24-48</td>
<td>Surgery</td><td> 50-100</td><td> 24-48</td>
<td>CNS</td><td> 50-100</td><td> 24-48</td>
The patient should consult with their physician, but should only take a follow-up dose no less than 24-48 hours after the initial dose.
<img file="MX375112B_D0153.tif" />
IMPI
167
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
1Μ
C.Q.
CSJ
or ε
0)
C.J.
<td></td><td>1% time over reference<sub>;</sub> (Day)t</td><td>oo cnj</td><td> 9.29 ±1.98</td><td> 11.6 ±1.97</td><td>svn</td>
<td></td><td>ClSSi (UMdL)T 1</td><td> 1.09</td><td> 2.23 ±1.40</td><td> 4.38 ±1.53</td><td>NAS</td>
<td></td><td>¿ c: g _J — mo</td><td>¡ 0.77 Yo</td><td>$s or Ή</td><td> 1.02 ±0.11</td><td>Q</td>
<td></td><td></td><td> 54.0</td><td> 521 ±10.4</td><td> 52.5 ±10.1</td><td>OZ</td>
<td>(asT°!i*</td><td> © §</td><td>3 V—</td><td> 1.79 ±1.19 . ..</td><td> 9.99 <sup>1</sup> ±4.99</td><td>or z</td>
<td></td><td>g i heard</td><td> 76.0</td><td> 71.7 ±13.0</td><td> 62.8 ±8.82</td><td>Q2</td>
<td> £</td><td>1E</td><td> 275</td><td> 264 ±77.6</td><td> 179 ±31.1</td><td>EITHER</td>
<td></td><td>Iεd</td><td> 362</td><td> 3.77 ±1.12</td><td> 2.89 ±0.615</td><td>EITHER</td>
<td></td><td>B&£ C.J._ <Ό</td><td> 753</td><td> 1630 ±750</td><td></td><td>s</td>
<td></td><td>sZ) J</td><td> 19.9</td><td> 41.6 ±8.97/8.98</td><td> 98.2 ±8.218.23</td><td>SWN</td>
<td></td><td>c</td><td></td><td>LQ</td><td>a</td><td>^í— τ—</td>
<td></td><td>ls»</td><td>a</td><td> 8</td><td> 100</td><td> 25-100</td>
<img file="MX375112B_D0154.tif" />
IMPI
168
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
TABLE 27B
<td></td><td>Time of 1% on the rafe-renda</td><td>& a</td><td>co</td><td> 10.1 ±1.5 (8.4-12.3)</td><td> 12312.5 (9.9-15.0)</td><td>Yo</td>
<td></td><td colspan="2">lilffffl) <®IQ</td><td></td><td> 2.46 ±0.89 (1.633.92)</td><td> 4.65 ±1.73 (3.08-6.85) '</td><td>Yo</td>
<td></td><td>Grackial recovery (UUdLper</td><td>> or</td><td>F= EITHER</td><td> 0.871021 (0.631.12)</td><td>1.02 ±0.11 I (0.89-1.18)<sup>¡</sup></td><td> 0.93 ±0.18 (0.63-1.18) .</td>
<td></td><td colspan="2">(M)te/kL</td><td>LO ϋ</td><td>tea</td><td> 56.5 ±14.1 (424-74.5)</td><td> 56.7110.9 (4244.5)</td>
<td>to +l</td><td colspan="2">£ Yo</td><td>either</td><td>£ $s EITHER</td><td> 10.3±5.6 (3.97-16.6)</td><td>Yo</td>
<td>Net (Average (Proportion)</td><td colspan="2">MRT(h)</td><td> £</td><td> 76.816.7 (67.985.9)</td><td> 65.9±10.3 (53.2-76.5)</td><td> 71.810.0 (53.285.9)</td>
<td> £</td><td colspan="2">Vss(rrükg)</td><td></td><td>okay -</td><td> 183 ±27.9 (162-221)</td><td> 227 158.6 (162-296)</td>
<td></td><td colspan="2">CLfmUWkg)</td><td>8 co</td><td> 3.4410.84(2.05- 4.18)</td><td> 28410.66 (2.133.56)</td><td> 3.1810.78(205- 4.18)</td>
<td></td><td colspan="2">AUCnf(IiIU/ dL)</td><td> £</td><td>17D0tt55D (1300-2660)</td><td> 4020 1 986 (30906130)</td><td>you</td>
<td></td><td colspan="2">a J</td><td> §</td><td> 47.51128(33.0· 61.1)</td><td> 98.517.9 ’ (903-110)</td><td>s</td>
<td></td><td colspan="2">c</td><td>t—</td><td>1O</td><td>IT</td><td>Yo-</td>
<td colspan="3"></td><td> &</td><td> 8</td><td>8v—</td><td> 25-100</td>
<img file="MX375112B_D0155.tif" />
IMPI
-169 MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
The results presented are Mean ± SD with the interval mentioned in parentheses.
Cmax indicates the maximum concentration; AUC<sub>rNF</sub>, the area under the curve (zero time extrapolated to infinite time) ; CL, clearance; Vss, volume of distribution at steady state; TMR, mean residence time; Tl/2a, the distribution half-life; Τ1/2β, the elimination half-life; NA, not applicable.
Gradual recovery is Lilizing C^ax minus baseline antenui a± cratation and divided by dose.
<sup>F</sup> FIX activity in plasma above the reference value 168 hours (7 days) after the dose.
* Model-predicted time post-dose when FIX activity decreased to 1 IU/dL over subject's baseline.
<sup>s</sup> The information does not correspond because the parameters are not dose independent, therefore the mean and SD values were not calculated across the different dose groups.
<img file="MX375112B_D0156.tif" />
170
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
It is stated that in relation to this date, the best method known by the applicant to carry out the aforementioned invention is the one that is clear from the present description of the invention.
<img file="MX375112B_D0157.tif" />
171
S IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
Contents251
161 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32 Sheet 33 Sheet 34 Sheet 35 Sheet 36 Sheet 37 Sheet 38 Sheet 39 Sheet 40 Sheet 41 Sheet 42 Sheet 43 Sheet 44 Sheet 45 Sheet 46 Sheet 47 Sheet 48 Sheet 49 Sheet 50 Sheet 51 Sheet 52 Sheet 53 Sheet 54 Sheet 55 Sheet 56 Sheet 57 Sheet 58 Sheet 59 Sheet 60 Sheet 61 Sheet 62 Sheet 63 Sheet 64 Sheet 65 Sheet 66 Sheet 67 Sheet 68 Sheet 69 Sheet 70 Sheet 71 Sheet 72 Sheet 73 Sheet 74 Sheet 75 Sheet 76 Sheet 77 Sheet 78 Sheet 79 Sheet 80 Sheet 81 Sheet 82 Sheet 83 Sheet 84 Sheet 85 Sheet 86 Sheet 87 Sheet 88 Sheet 89 Sheet 90 Sheet 91 Sheet 92 Sheet 93 Sheet 94 Sheet 95 Sheet 96 Sheet 97 Sheet 98 Sheet 99 Sheet 100 Sheet 101 Sheet 102 Sheet 103 Sheet 104 Sheet 105 Sheet 106 Sheet 107 Sheet 108 Sheet 109 Sheet 110 Sheet 111 Sheet 112 Sheet 113 Sheet 114 Sheet 115 Sheet 116 Sheet 117 Sheet 118 Sheet 119 Sheet 120 Sheet 121 Sheet 122 Sheet 123 Sheet 124 Sheet 125 Sheet 126 Sheet 127 Sheet 128 Sheet 129 Sheet 130 Sheet 131 Sheet 132 Sheet 133 Sheet 134 Sheet 135 Sheet 136 Sheet 137 Sheet 138 Sheet 139 Sheet 140 Sheet 141 Sheet 142 Sheet 143 Sheet 144 Sheet 145 Sheet 146 Sheet 147 Sheet 148 Sheet 149 Sheet 150 Sheet 151 Sheet 152 Sheet 153 Sheet 154 Sheet 155 Sheet 156 Sheet 157 Sheet 158 Sheet 159 Sheet 160 Sheet 161
87 members in 25 offices
Priority claims6
| Document | Office | Kind | Date |
|---|---|---|---|
| 61363064 | United States of America | – | |
| 61424555 | United States of America | – | |
| 61430819 | United States of America | – | |
| 61438572 | United States of America | – | |
| 61442079 | United States of America | – | |
| 61470951 | United States of America | – |
Members87
| Document | Office | Kind | |
|---|---|---|---|
| CA2804274A1 | Canada | A1 | |
| WO2012006624A2 | World Intellectual Property Organization (WIPO) | A2 | |
| WO2012006624A3 | World Intellectual Property Organization (WIPO) | A3 | |
| AU2011274414A1 | Australia | A1 | |
| SG186856A1 | Singapore | A1 | |
| MX2013000281A | Mexico | A | |
| EP2590668A2 | European Patent Office (EPO) | A2 | |
| CN103140237A | China | A | |
| US2013171175A1 | United States of America | A1 | |
| US2013202595A1 | United States of America | A1 | |
| JP2013534426A | Japan | A | |
| EA201291480A1 | Eurasian Patent Organization (EAPO) | A1 | |
| KR20140017480A | Republic of Korea | A | |
| CL2013000058A1 | Chile | A1 | |
| EP2590668A4 | European Patent Office (EPO) | A4 | |
| NZ605348A | New Zealand | A | |
| SG10201505218YA | Singapore | A | |
| US9233145B2 | United States of America | B2 | |
| JP2016034973A | Japan | A | |
| BR112013000650A2 | Brazil | A2 | |
| US2016166657A1 | United States of America | A1 | |
| US2016243206A1 | United States of America | A1 | |
| US2016257943A1 | United States of America | A1 | |
| AU2011274414B2 | Australia | B2 | |
| AU2016228243A1 | Australia | A1 | |
| US2016346365A1 | United States of America | A1 | |
| JP2017036328A | Japan | A | |
| US9623091B2 | United States of America | B2 | |
| US9629903B2 | United States of America | B2 | |
| US9670475B2 | United States of America | B2 | |
| US9675676B2 | United States of America | B2 | |
| AU2016228243B2 | Australia | B2 | |
| UA115120C2 | Ukraine | C2 | |
| BR112013000650A8 | Brazil | A8 | |
| EA028067B1 | Eurasian Patent Organization (EAPO) | B1 | |
| AU2017268650A1 | Australia | A1 | |
| EA201790876A1 | Eurasian Patent Organization (EAPO) | A1 | |
| US9867873B2 | United States of America | B2 | |
| MX356527B | Mexico | B | |
| MY166954A | Malaysia | A | |
| US2018207244A1 | United States of America | A1 | |
| US2018228878A1 | United States of America | A1 | |
| US2018228879A1 | United States of America | A1 | |
| KR20180118808A | Republic of Korea | A | |
| JP2019023242A | Japan | A | |
| US2019192640A1 | United States of America | A1 | |
| US2019192641A1 | United States of America | A1 | |
| KR20190104442A | Republic of Korea | A | |
| AU2017268650B2 | Australia | B2 | |
| EP3552619A1 | European Patent Office (EPO) | A1 | |
| AU2020200118A1 | Australia | A1 | |
| US10548954B2 | United States of America | B2 | |
| US10561714B2 | United States of America | B2 | |
| US10568943B2 | United States of America | B2 | |
| SG10201913700SA | Singapore | A | |
| MX2020009702A | Mexico | A | |
| IL223990A | Israel | A | |
| IL223990B | Israel | B | |
| IL277432D0 | Israel | D0 | |
| US2021008178A1 | United States of America | A1 | |
| US10898554B1 | United States of America | B1 | |
| US2021023185A1 | United States of America | A1 | |
| EA037095B1 | Eurasian Patent Organization (EAPO) | B1 | |
| IL277432A | Israel | A | |
| IL277432B | Israel | B | |
| IL284368A | Israel | A | |
| IL284368D0 | Israel | D0 | |
| EA202092566A1 | Eurasian Patent Organization (EAPO) | A1 | |
| JP2022044828A | Japan | A | |
| AU2020200118B2 | Australia | B2 | |
| KR20220097518A | Republic of Korea | A | |
| AU2022204643A1 | Australia | A1 | |
| MY192639A | Malaysia | A | |
| UA126265C2 | Ukraine | C2 | |
| KR20230156435A | Republic of Korea | A | |
| MX375112BThis record | Mexico | B | |
| EP3552619B1 | European Patent Office (EPO) | B1 | |
| AU2022204643B2 | Australia | B2 | |
| DK3552619T3 | Denmark | T3 | |
| PT3552619T | Portugal | T | |
| FI3552619T3 | Finland | T3 | |
| LT3552619T | Lithuania | T | |
| EP4653528A2 | European Patent Office (EPO) | A2 | |
| RS67366B1 | Serbia | B1 | |
| PL3552619T3 | Poland | T3 | |
| ES3050283T3 | Spain | T3 | |
| SI3552619T1 | Slovenia | T1 |
Numbers
- Publication
- 375112
- Application
- 2017008224
Titles2
- Spanish
- POLIPÉPTIDOS DE FACTOR IX Y MÉTODOS PARA USARLOS.
- English
- FACTOR IX POLYPEPTIDES AND METHODS TO USE THEM.
Classification
- IPC, 2
- A61K38 36
- A61K38 38