RS51174B

Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood glp-1 level

Abstract

A composition comprising a GPR119 agonist and a DPP-IV inhibitor, wherein said DPP-IV inhibitor is not identical to 1- [2- [5-cyanopyridin-2-yl) amino] ethylamino] acetyl-2-cyano- (S) pyrrolidine (NVP-DPP728) .Prijava further comprises 50 claims.

RS51174B, drawing sheet 1 — Sheet 1 of 13

Term

No projected expiry on record.

50 claims: 2 independent, 48 dependent

1
ΡΑΤΕΝΤΝΙ REQUESTS ΡΑΤΕΝΤΝΙ ZAHTEVI 1. A composition comprising a GPR119 agonist and a DPP-IV inhibitor, wherein said DPP-IV inhibitor is not identical to 1 [2- [5-cyanopyridin-2-yl) amino] ethylamino] acetyl-2-cyano- (S) - pyrrolidine (NVP-DPP728). 1. Kompozicija koja sadrži GPR119 agonist i DPP-IV inhibitor, naznačena time, što navedeni DPP-IV inhibitor nije identičan sa 1[2-[5-cijanopiridin-2-il)amino]etilamino]acetil-2-cijano-(S)-pirolidinom (NVP-DPP728).
29
A method of preparing a pharmaceutical composition comprising admixing a GPR119 agonist and a DPP-IV inhibitor, together with at least one pharmaceutically acceptable carrier, wherein said DPP-IV inhibitor is not identical to 1 - [2 [5-cyanopyridine- 2-yl) amino] ethylamino] acetyl-2-cyano- (S) -pyrrolidine (NVP-DPP728). 29. Postupak pripremanja farmaceutske kompozicije, naznacen time, što se navedeni postupak sastoji od smešanja GPR119 agonista i DPP-IV inhibitora, zajedno sa bar jednim farmaceutski prihvatljivim nosačem, pri čemu navedeni DPP-IV inhibitor nije identičan sa 1 -[2[5-cijanopiridin-2-il)amino]etilamino]acetil-2-cijano-(S)-pirolidinom (NVP-DPP728). 295 295 51174Β 51174Β

Independent claims2

2,959 paragraphs in 35 sections, as filed

FIELD OF THE INVENTION

The present invention relates to compositions and methods for treating and preventing diabetes and related conditions. The present invention further relates to compositions and methods for increasing blood GLP-1 levels in a mammal.

BACKGROUND OF THE INVENTION

The following discussion is intended to facilitate understanding of the invention, but is not intended nor is it recognized as a state of the art for the invention.

A. Diabetes

Type 2 diabetes is one of the most common chronic diseases. Type 2 diabetes is characterized by food abstinence and postprandial hyperglycemia and with relatively insufficient insulin. Hyperglycemia can cause long-term microvascular and macrovascular complications, such as nephropathy, neuropathy, retinopathy, and peripheral vascular disease.

51174Β

In addition, type 2 diabetes also causes a disease that often accompanies hyperlipidemia, atherosclerosis, and hypertension. Hyperlipidemia is the primary risk factor for cardiovascular disease due to atherosclerosis. Obesity is a well-known common risk factor for the development of atherosclerosis, stroke, hypertension and type 2 diabetes. Type 2 diabetes causes significant mortality at significant cost to patients, their families, and society. The incidence of type 2 diabetes in the United States is about 7% and costs up to 10% of the money that goes to health care. Furthermore, the incidence of type 2 diabetes worldwide is increasing so that type 2 diabetes is now considered epidemic on a global scale.

B. Glucagon-like peptide-1 (GLP-1)

Glucagon-like peptide-1 (GLP-1) is an incretin hormone derived from the posttranslational modification of proglucagon and excreted through intestinal endocrine cells. GLP-1 mediates its actions through specific G protein-coupled receptor (GPGR), namely GLP-1 R. GLP-1 is best characterized as a hormone that regulates glucose homeostasis. GLP-1 has been shown to stimulate glucose-dependent insulin secretion and increase pancreatic beta cell mass. GLP-1 has also been shown to reduce the rate of gastric emptying and to promote satiety. The efficacy of GLP-1 peptide agonists in glucose control in type 2 diabetes has been demonstrated in several clinical studies [see, e.g., Nauck et al., Drug News Perspect (2003) 16: 413-422], as well as its efficacy in weight loss [Zander et al., Lancet (2002) 359: 824-830].

GLP-1 receptor agonists are additionally useful in protection against myocardial infarction and against cognitive and neurodegenerative disorders. For GLP-1 z

51174 Β has been shown to be cardioprotective in a rat model of myocardial infarction [Bose et al., Diabetes (2005) 54: 146-151], and GLP-IR has been shown in rodent models to be involved in learning and neuroprotection [During et al. , Nat JVled (2003) 9: 1173-1179; and Greig et al., Αηπ NY Acad

Sci (2004) 1035-290-315],

Certain disorders such as type 2 diabetes are characterized by GLP-1 deficiency [see, e.g., Nauck et al., Diabetes (2004) 53 Suppl 3: S190-196].

Current GLP-1 peptide agonists suffer from a lack of oral bioavailability, a negative impact on patient acceptance. Efforts to develop orally bioavailable non-peptidergic, small-molecule GLP-1R agonists have so far been unsuccessful [Mentlein, Expert Opin Investig Drugs (2005) 14: 57-64]. An attractive alternative approach is to develop an orally active composition for increase in endogenous blood GLP-1 levels.

C. GPR119

GPR119 G protein-paired receptor (GPR119; e.g., human GPR119, GenBank® Accession No. AAP72125 and its alleles; e.g., murine GPCR119, GenBank® Accession No. ΑΥ288423 and its alleles) is selectively expressed on pancreatic beta cells, GPR119 activation leads to an increase in levels of intracellular cAMP, consistent with Gs-paired GPR119. GPR119 agonists stimulate glucose-dependent insulin secretion in vitro and lower and raise blood glucose levels in vivo. See, e.g., International Application WO 04/065380, WO 04/076413, and EP 1338651. In the patent literature, GPR119 is referred to as RUP3 (see, e.g., International Application WO 00/31258).

51174 Β

D. Dipeptidyl Peptidase (DPP-IV)

Dipeptidyl peptidase IV (DPP-IV, EC 3.4.14.5) shows catalytic activity against a wide range of peptide substrates including peptide hormones, neuropeptides and chemokines. Incretin glucagon-like peptide 1 (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP) that stimulate glucose-dependent insulin secretion and otherwise promote blood glucose homeostasis are rapidly cleaved by DPP-IV at position 2 alanine leading to non-activation of their biological activity. Both pharmacological and genetic decline in DPP-IV activity is associated with enhanced incretin action, elevated insulin, and lower blood glucose in vivo. Genetic decline in DPP-IV activity has been shown to provide resistance to obesity and to improve insulin sensitivity. For the second-generation DPP-IV inhibitor LAF237 (Ahren et al., J Clin Endocrinol Metab (2004) 89: 2078-2084; and Villhauer et al., J. Med Chem (2003) 46: 27742789), is currently in phase 3 clinical trials for Type 2 diabetes and additional DPPIV inhibitors are in clinical development, including MK-0431, BMS-477118, PSN9301 and SYR-322.

Since incretin hormones are not just substrates for DPP-IV, there is a concern that inhibition of cleavage of other endogenous DPP-IV substrates may provide an increase in unwanted side effects [see, e.g., Shen et al., J Biol Regul Homeost Agents (2004) 18: 47-54]. It will therefore be useful to identify activity that promotes blood glucose homeostasis that is associated with substantially lower concentrations of DPP-IV inhibitors.

Yasuda N, et al evaluates the effects of subchronic treatment with metformin and a DPP-IV inhibitor on a rat model of obesity and exacerbation

51174 Β glucose tolerance. Combination treatment causes a significant increase in GLP-1 levels (J. Pharm. Ehr. Theva. Vol, 310, No. 2, 2004 p. 614-619).

E. G protein-coupled receptors

GPCRs share a common structural motif, having seven sequences of between 22 to 24 hydrophobic amino acids forming seven alpha helices, each of which twists the membrane (each twist is identified by a number, e.g., transmembrane-1 (TM-1). ), transmembrane-2 (TM-2), etc.). The transmembrane helices are connected by amino acid strands between transmembrane-2 and transmembrane-3, transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the outside ,, or on the “extracellular” side, cell membranes (referred to as extracellular regions 1, 2 and 3 (EC-1. EC-2 and EC-3), each separately). The transmembrane helices are also connected by amino acid strands between transmembrane-1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the inner, or intracellular, side of the cell membrane (referred to as to the intracellular ”regions 1, 2 and 3 (ΙΟΙ, IC-2 and IC-3), each separately). The "carboxy" ("C") end of the receptor lies in the intracellular space inside the cell, and the "amino" ("N") end of the receptor lies in the extracellular space outside the cell.

In general, when an agonist binds to a G protein-paired receptor (often referred to as "receptor" activation), there is a change in receptor conformation that facilitates pairing between the intracellular region and the intracellular "G-protein." GPCRs have been reported to be promiscuous ”with respect to G protein, i.e., that GPCR may enter

51174Β interacting with more than one G protein. See, Kenakin, T., 43 Life Sciences 1095 (1988). although other G proteins may exist, G proteins Gq, Gs, Gi, Gz, and Go are currently identified. Ligand-activated GPCR pairing with G-protein initiates the signaling cascade process (referred to as “signal transduction”). Under normal circumstances, signal transduction ultimately results in cellular activation or cellular inhibition.

Gs stimulates the enzyme adenylyl cyclase. Gi (both Gz and Go), on the other hand, inhibit adenylyl cyciasis. Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus activated GPs that pair Gs protein are associated with increased cellular cAMP levels. On the other hand, activated GPCRs that pair Gi (or Gz, Go) protein are associated with a decrease in cellular cAMP levels. See, General, Indirect Mechanisms of Synaptic Transmission ”,” Chpt 8, From Neuron to Brain (3rd Ed.) Nichols,

JG, es, et al., Sinauer Associates, Inc. (1992). Thus, assays that detect cAMP can be used to determine whether a compound is a candidate, e.g., a receptor agonist (i.e., such a compound would increase cAMP levels). Gq and Go are associated with the activation of the enzyme phospholipase C, which in turn hydrolyzes the phospholipid PIP2, releasing two intracellular messengers; diacylglycerol (DAG) and inositol 1,4,5-triphosphate (IP3). Increased accumulation of IP3 is associated with activation of Gq- and Go-linked receptors. See, in general, ‘Indirect Mechanisms of Synaptic Transmission”, ”Chpt 8, From Neuron to Brain (3rd Ed.) Nichols, JG, es, et al eds., Sinauer Associates, Inc. (1992). Assays that detect IP3 accumulation can be used to determine whether a compound is a candidate, e.g., an agonist for a Gq- or Go-linked receptor (i.e., such a compound would increase intracellular free calcium levels). See, e.g., Table A (“N / A:” not applicable).

51174 Β

TABLE Α

<td>G protein</td><td>Effect on cAMP after GPCR activation (i.e., constitutive activation or agonist binding)</td><td>Effect on 1Ρ3 accumulation after GPCR activation (i.e., constitutive activation iii agonist binding)</td><td>Effect on cAMP production after contact with an inverse agonist</td><td>Effect on IP3 accumulation after contact with an inverse agonist</td>

<td>Gs</td><td>Increase</td><td>N / A</td><td>Reduction</td><td>N / A</td>

<td>Give</td><td>Reduction</td><td>N / A</td><td>Increase</td><td>N / A</td>

<td>Gz</td><td>Reduction</td><td>N / A</td><td>Increase</td><td>N / A</td>

<td>Go</td><td>Reduction</td><td>Increase</td><td>Increase</td><td>Reduction</td>

<td>Gq</td><td>N / A</td><td>Increase</td><td>N / A</td><td>Reduction</td>

There are also promiscuous G proteins, which appear to pair several classes of GPCRs for the phospholipase C pathway, such as Gal5 or Gal6 [Offermans & Simon, J Biol Chem (1995), 270: 15175-80], or chimeric G proteins designed to pair a large number of GPCRs for the same path, e.g. phospholipase C [Milligan & Rees, Trends in Pharmaceutical Sciences (1999) 20: 118-24].

Under physiological conditions, GPCRs ονί exist in the cell membrane in equilibrium between different conformations: inactive “state” and “active” state. The inactive receptor is unable to bind to the intracellular signal transduction pathway to initiate a signal transduction leading from a biological response. Changing the conformation of the receptor to the active state allows binding to the transduction pathway (rgeco G-protein) and produces a biological response.

51174 Β

The receptor can be stabilized in the active state by a ligand or compound such as a drug. Recent discoveries, including but not limited to amino acid sequence modifications of the receptor, provide means other than ligands or drugs to promote and stabilize the receptor in the conformation of the active state. These agents effectively stabilize the receptor in the active state by simulating the effect of a receptor-binding ligand. Stabilization by such ligand-independent agents is called constitutive receptor activation. The endogenous receptor showing activity in the absence of ligand is referred to as a constitutively active endogenous receptor.

ESSENCE OF THE INVENTION

The present invention relates to the combination of an amount of GPR119 agonist with an amount of dipeptidyl peptidase IV (DPP-IV) inhibitor such that the combination provides a greater blood glucose lowering effect in a subject than that provided by the amount of GPR119 agonist alone or with the amount of DPP-IV inhibitor and use of such a combination to treat or prevent diabetes and related conditions. The present invention further relates to the combination of an amount of GPR119 agonist with an amount of dipeptidyl peptidase IV (DPP-IV) inhibitor such that the combination provides a greater effect in increasing blood GLP-1 levels in the subject relative to that provided only by the amount of GPR119 agonist or the amount of DPP-IV inhibitors and the use of such a combination for treating or preventing a condition ameliorated by an increase in blood GLP-1 levels or for increasing blood GLP-1 levels in a subject lacking GLP-1.

51174 Β

Described herein are methods of treating or preventing diabetes or a condition associated therewith comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting of a substantially GPR119 agonist and a DPP-IV inhibitor. Presumably, the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to lower the blood glucose level of the subject. The presumed level of glucose in the blood is an elevated level of glucose in the blood.

Also described herein are methods of treating or preventing a condition ameliorated by an increase in blood GLP-1 levels comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting of a substantially GPR119 agonist and a DPP-IV inhibitor. Preferably, the GPR119 agonist and DPP-IV inhibitor are administered in amounts sufficient to increase the blood GLP-1 level in the subject.

Also described herein are methods of increasing GLP-1 levels in the blood comprising administering to a GLP-1 deficient subject a therapeutically effective amount of a composition comprising or consisting of a substantially GPR119 agonist and a DPP-IV inhibitor. Preferably, the GPR119 agonist and DPP-IV inhibitor are administered in amounts sufficient to increase the blood GLP-1 level in the subject.

Presumably diabetes is Type 2 diabetes.

The presumed diabetes-related condition was selected from the group consisting of hyperglycemia, impaired glucose tolerance, insulin resistance, pancreatic beta-cell deficiency, enteroendocrine cell deficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetes mellitus, diabetes mellitus.

51174 Β Arterial disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, stroke, hypertension, and obesity.

Presumably, the condition ameliorated by an increase in GLP-1 levels in the blood was selected from the group comprising diabetes, a condition associated with diabetes, myocardial infarction, learning impairment, memory impairment, and neurodegenerative disorder.

Presumably, the condition enhanced by an increase in GLP-1 in the blood is a neurodegenerative disorder selected from the group consisting of excitotoxic brain damage caused by severe epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-related disease, stroke, motor neuronal disease, impaired learning or memory, traumatic brain injury, spinal cord injury, and peripheral neuropathy.

Supposedly the subject is a man.

In a first aspect the present invention is characterized by a composition comprising or consisting of a GPR119 agonist and a DPP-IV inhibitor wherein said DPP-IV inhibitor is not identical to 1- [2- [5-cyanopyridin-2-yl) amino] ethylamino] acetyl- 2-cyano- (5) -pyrrolidine (NVP / DPP728). In certain embodiments, the present invention relates to a dosage form composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to lower blood glucose levels in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level. In certain embodiments, the present invention relates to a dosage form of a composition wherein the GPR119 agonist and II

51174Β

DPP-IV inhibitor in amounts sufficient to increase blood GLP-1 levels in the subject.

In certain realizations, the subject is man.

In another aspect, the present invention features a composition comprising or consisting of a substantially GPR119 agonist and a DPP-IV inhibitor for use in a method of treating a human or animal body with a therapy wherein said DPP-IV inhibitor is not identical to 1- [2- [5- cyanopyridin-2-ylamino] ethyl-amino] acetyl-2-cyano- (5) -pyrrolidine (NVP / DPP728). In certain embodiments, the present invention relates to a dosage form of a composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to lower blood glucose levels in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level. In certain embodiments, the present invention relates to a dosage form of a composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to increase the level of GLP-1 in the blood of the subject.

The present invention is further characterized by a composition comprising or consisting essentially of a GPR119 agonist and a DPP-IV inhibitor for use in a method of treating or preventing diabetes or a condition associated therewith in a human or animal body by therapy wherein said DPP-IV inhibitor is not identical to 1 - [2- [5-cyanopyridin-2-yl) amino] ethyl-amino] acetyl-2-cyano- (5) pyrrolidine (NVP / DPP728). In certain embodiments, the present invention relates to a dosage form composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to lower blood glucose levels in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.

51174 Β

The present invention further comprises a composition comprising or consisting of substantially GPR119 agonists and DPP-IV inhibitors for use in a method of treating or preventing diabetes or a condition enhanced by an increase in blood GLP-1 levels in a human or animal body by therapy wherein said DPP-IV inhibitor is not identical to 1- [2- [5-cyanopyridin-2-yl] amino] ethyl-amino] acetyl-2-cyano- (5) -pyrrolidine (NVP / DPP728). In certain embodiments, the present invention relates to a single dose composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to increase blood GLP-1 levels in the subject.

The present invention is further characterized by a composition comprising or consisting of substantially GPR119 agonists and DPP-IV inhibitors for use in a method of treating or preventing GLP-1 deficiency in a human or animal body by therapy. In certain embodiments, the present invention relates to a dosage form of a composition wherein the GPR119 agonist and the DPP inhibitor are in amounts sufficient to increase the blood GLP-1 level in the subject.

In certain realizations, the subject is man.

In a third aspect, the present invention features a method of preparing a pharmaceutical composition, wherein said method comprises or consists essentially of a mixture of a GPR119 agonist and a DPP-IV inhibitor, together with at least one pharmaceutically acceptable carrier wherein said DPP-IV inhibitor is not identical to 1- [ 2- (5-cyanopyridin-2-yl) amino] ethyl-amino] acetyl-2-cyano (5) -pyrrolidine (NVP / DPP728). In certain embodiments, the method further comprises preparing a dosage form of the pharmaceutical composition wherein

51174Β

GPR119 agonist I DPP-IV inhibitor in amounts sufficient to lower blood glucose levels in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level. In certain embodiments, the method further comprises the step of preparing a dosage form of a pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to increase the level of GLP-1 in the blood of the subject.

In certain realizations, the subject is man.

In a fourth aspect, the present invention is characterized by a pharmaceutical composition comprising or consisting essentially of a GPR119 agonist and a DPP-IV inhibitor, together with at least one pharmaceutically acceptable carrier wherein said DPP-IV inhibitor is not identical to 1- [2- [5-cyanopyridine -2yl) amino] ethyl-amino] acetyl-2-cyano- (5) -pyrrolidine (NVP / DPP728). In certain embodiments, the present invention relates to a dosage form of a pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to lower blood glucose levels in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level. In certain embodiments, the present invention relates to a dosage form of a pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to increase the level of GLP-1 in the blood of the subject.

In certain realizations, the subject is man.

In a fifth aspect, the present invention is characterized by the use of a composition comprising or consisting of substantially GPR119 agonists and DPP-IV inhibitors for the manufacture of a medicament for treating or preventing diabetes or a condition

51174 Β associated with it wherein said DPP-IV inhibitor is not identical to 1- [2- [5-cyanopyridin-2-yl) amino] ethyl-amino] acetyl-2-cyano- (5) -pyrrolidine (NVP / DPP728). In certain embodiments, the present invention relates to a dosage form of a medicament wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to lower blood glucose levels in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.

The present invention is further characterized by the use of a composition comprising or consisting essentially of a GPR119 agonist and a DPP-IV inhibitor for the manufacture of a medicament for treating or preventing a condition ameliorated by an increase in blood GLP-1 levels wherein said DPP-IV inhibitor is not identical to - (5-cyanopyridin-2-yl) amino] ethyl-amino] acetyl-2-cyano- (5) pyrrolidine (NVP / DPP728). In certain embodiments, the present invention relates to a dosage form of a medicament wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to increase blood GLP-1 levels in the subject.

The present invention is further characterized by the use of a composition comprising or consisting essentially of a GPR119 agonist and a DPP-IV inhibitor for the manufacture of a medicament for the treatment or prevention of GLP-1 deficiency wherein said DPP-IV inhibitor is not identical to 1- [2- [5-cyanopyridine -2yl) amino] ethyl-amino] acetyl-2-cyano- (5) -pyrrolidine (NVP / DPP728). In certain embodiments, the present invention relates to a dosage form of a medicament wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to increase blood GLP-1 levels in the subject.

In certain realizations, the subject is man.

51174 Β

Short description of the pictures

The invention is illustrated in connection with the siikas attached herein and in which:

Figure 1 shows the synergistic effect of GPR119 agonists and DPP-IV inhibitors in lowering elevated blood glucose levels in the oral glucose tolerance test (oGTT) in mice. See Example 1.

Figure 2 shows the synergistic effect of GPR119 agonists and DPP-VI inhibitors in increasing blood GLP-1 levels after glucose challenge in mice. See Example 3.

Figure 3 shows the expression of GPR119 in the gut. See Example 10.

Figure 4 shows the expression of GPR119 in a GLUTag endocrine cell line. See Example 11 ..

Figure 5 shows the increase in intracellular cAMP levels in GLUTag endocrine cells via GPR119 agonists. See Example 12.

Figure 6 shows the stimulation of GLP-1 secretion in GLUTag endocrine cells by GPR119 agonists. See Example 13.

Figure 7 shows the effect of GPR119 agonist AR244061 and DPP-IV inhibitor MK-0431 in lowering blood glucose levels in an oral glucose tolerance test (oGTT) in mice. See Example 14.

Silka 8 shows the effect of GPR119 agonist A244061 and DPP-IV inhibitor LAF237 in lowering blood glucose levels in an oral glucose tolerance test (oGTT) in mice. See Example 14.

Figure 9 shows the effect of the GPR119 agonist AR244061 and the DPP-IV inhibitor FE107542 in lowering blood glucose levels in the oral glucose tolerance test (oGTT) in mice. See Example 14.

51174 Β

DETAILED DESCRIPTION OF THE INVENTION

The invention relates to a combination of certain compounds, or pharmaceutically acceptable salts thereof, for the treatment and prevention of diabetes and related conditions. The present invention further relates to a combination of certain compounds, or pharmaceutically acceptable salts thereof, for the treatment or prevention of a condition ameliorated by an increase in blood GLP-1 levels. The Applicant has found that the amount of GPR119 agonist in combination with the amount of DPPIV inhibitor can provide an unexpected synergistic effect in lowering blood glucose levels in a subject greater than that provided by the amount of GPR119 agonist alone or the amount of DPPIV inhibitor alone. The Applicant further found that the amount of GPR119 agonist combined with the amount of DPP-IV inhibitor may provide an unexpected synergistic effect in increasing blood GLP-1 levels in a subject greater than that provided by the amount of GPR119 agonist alone or the amount of DPP-iV inhibitor alone. The applicant further revealed that GPR119 is a GLP-1 receptor secretagogue.

By using a combination of GPR119 agonists and DPP-IV inhibitors in accordance with the present invention, it is possible to treat or prevent diabetes and conditions associated with a dose of DPP-IV inhibitor significantly lower than that currently considered for use in diabetes therapy and conditions associated with Thereby reducing the likelihood of adverse side effects associated with inhibition of DPP-IV activity. By using a combination of GPR119 agonists and ĐPP-IV inhibitors in accordance with the present invention, it is possible to treat or prevent a condition ameliorated by increased blood GLP-1 levels with a dose of DPP-IV inhibitor significantly lower than the current dose.

51174Β considers for use in the treatment of said condition, thereby reducing the likelihood of adverse side effects associated with inhibition of DPPIV activity. Moreover, by using the combination of GPR119 agonists and DPP-IV inhibitors according to the present invention, it is possible to treat or prevent diabetes and conditions associated with a dose of GPR119 agonist significantly lower than that currently considered for use in the treatment of diabetes and conditions associated with thereby reducing the likelihood of adverse side effects if any are found to be associated with GPR119 receptor activation. The present invention provides a new, unexpected and advantageous approach to lowering blood glucose levels in a subject. The present invention further provides a new, unexpected and advantageous approach to increasing GLP-1 levels in a subject.

The term "ligand", as used herein, will mean a molecule that specifically binds to GPCR. The ligand may be, for example, a polypeptide, a lipid, a small molecule, an antibody. An endogenous ligand is a ligand that is an endogenous, natural ligand for the parent GPCR. The ligand may be a "GPCR antagonist", an agonist, a "partial agonist", or an "inverse agonist", and the like.

The term "agonist", as used herein, will mean an agent (e.g., iigand, candidate compound) that activates GPCR by binding to GPCR so as to elicit an intracellular response mediated by GPCR.

The term "partial agonist", as used herein, will mean an agent (e.g., ligand, candidate compound) that activates GPCR by binding to GPCR so as to elicit an intracellular response mediated by GPCR, but to a lesser extent or extent than when uses a complete agonist.

51174 Β

The term "antagonist" shall mean an agent (e.g., ligand, candidate compound) that binds, and is presumably competitively bound, to a GPCR at approximately the same position as an agonist or partial agonist but that does not activate an intracellular response initiated by the active form of GPCR, and therefore it can inhibit the intracellular response by agonists or partially agonists. The antagonist typically does not reduce the underlying intracellular response in the absence of an agonist or partial agonist.

The term "inverse agonist" shall mean an agent (e.g., a ligand, a candidate compound) that binds to a GPCR and that inhibits a basic intracellular response initiated by an active form of the receptor below normal basal activity observed in the absence of an agonist or partial agonist.

The term "GPR119 agonist", as used herein, refers to a compound that binds to the GPR119 receptor and acts as an agonist.

The term "selective GPR119 agonist", as used herein, refers to a GPR119 agonist that has selectivity for the GPR119 receptor over one or more closely related receptors, such as the corticotrophin-releasing factor1 (CRF-1) receptor.

The term "DPP-N inhibitor", as used herein, refers to a compound that binds to DPP-N and inhibits the activity of DPP-N dipeptidium peptidase.

The term "selective DPP-IV inhibitor", as used herein, refers to a DPP-IV inhibitor that has selectivity for DPP-IV over closely related peptidases, such as one or more post-proline cleavage enzymes (PPCE),

51174 Β dipeptidyl peptidase II (DPP-II), dipeptidyl peptidase 8 (DPP-8), and dipeptidyl peptidase 9 (DPP-9).

The term "blood glucose level" or "blood GLP-1 level" shall mean a blood glucose concentration or a blood GLP-1 concentration, respectively. In certain embodiments, the novel blood GLP-1 is a blood level of biologically active GLP-1, wherein GLP-1 having GLP-1R agonist activity is biologically active. In certain embodiments, the new blood glucose or new GLP-1 in the blood is the plasma glucose level or the plasma GLP-1 level.

The term “raised new blood glucose” shall mean such raised new blood glucose found in a subject demonstrating inappropriate basal and postprandial hyperglycemia or such found in a subject on a glucose tolerance test (oGTT).

The term "subject", as used herein, will refer to a mammal, including but not limited to a mouse, rat, rabbit, pig, dog, cat, non-human primate and human, more preferably a mouse or rat, most preferably a human.

The term "in need of prevention or treatment" as used herein refers to an assessment made by a caregiver (eg, doctor, nurse, nurse in the case of humans; veterinarian in the case of non-human mammals). ) which the subject requires or will benefit from the treatment.

The term "therapeutically effective amount" or "therapeutically effective dose" is intended to mean the amount of drug that will elicit the desired biological or medical

51174Β answer. In certain embodiments, a therapeutically effective amount is an amount of a drug that will generate AUC inhibition of over 30% in a mouse oGTT assay.

The term "therapeutically ineffective amount" or "therapeutically ineffective dose" is intended to mean an amount of drug less than a therapeutically effective amount of drug. In certain embodiments, a therapeutically ineffective amount is an amount of checks that will generate AUC inhibition less than or equal to 30% in a mouse oGTT assay.

The term "amount effective to prevent" refers to the amount of a drug that will prevent or reduce the risk of a biological or medical event that is considered to be prevented. In many instances, the amount that is effective to prevent is the same as the therapeutically effective amount.

The term "composition" shall mean a material consisting of at least one component.

The term "active ingredient" shall mean a component that provides pharmacological activity or other direct action in the diagnosis, treatment, alleviation, treatment, or prevention of disease.

The term "pharmaceutical composition" means a composition comprising at least one active ingredient, wherein the composition is responsible for the research and treatment of mammals.

The term "dosage form" shall mean the physical form in which the drug is produced and consumed, such as a tablet, capsule or injectable agent.

51174 Β

As used herein, the term "diabetes" encompasses both insulin-dependent diabetes mellitus (also known as Type 1 diabetes) and insulin-independent diabetes mellitus (also known as Type 2 diabetes).

The term "diabetes-related condition" is intended to include but not be limited to hyperglycemia, impaired glucose tolerance, insulin resistance, pancreatic beta-cell deficiency, enteroendocrine cell deficiency, glucosuria, metabolic acidosis, cataracts, diabetic diabetes mellitus. neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, stroke, hypertension and obesity, where it is understood that conditions associated with diabetes may be included in the realization individually or in any combination.

The term "conditions enhanced by an increase in blood GLP-1 levels" is intended to include but not be limited to conditions associated with diabetes, myocardial infarction, learning impairment, memory impairment, and neurodegenerative disorders, where conditions are ameliorated by an increase in GLP levels. -1 in the blood can be included in the realization individually or in any combination.

The term "atherosclerosis" as used herein refers to the formation of a vascular disease characterized by the deposition of atheromatous plaques containing cholesterol and liids in the inner layer of the walls of large and medium-sized arteries.

51174 Β

The term metabolic syndrome ”as used herein, and according to Adult Treatment Panel III (ATP III, National Institutes of Health: Third Report of the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III), Executive Summary, Bethesda, Md., National Institutes of Health, National Heart, Lung and Blood Institute, 2001 (NIH pub. 01-3670), occurs when a person meets three or more of the five criteria associated with obesity, hypertriclyceridemia, low HDL cholesterol, high blood pressure, and fasting glucose.

The term "neurodegenerative disorder" is intended to include, but is not limited to, excitotoxic brain damage caused by severe epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-related disease, stroke, motor neurone disease, exacerbation learning or memory, traumatic brain injury, spinal cord injury, and peripheral neuropathy.

The term "obesity" as used herein, is defined as a body mass index (BMI) of 30.0 and above, according to the WH0 weight classification [Kopelman, Nature (2000) 404: 635-643, a finding incorporated herein by butter references in full].

The term S ^ b acyl refers to C- |.5 an alkyl radical directly attached to the carbonyl wherein the definition for alkyl is as described herein; some examples include, but are not limited to, acetyl, propionyl, n-butanoyl, iso-butanoyl, sec-butanoyl, Abutanoyl (i.e., pivaloyl), pentanoyl, and the like.

51174 Β

The term (acyloxy) refers to an acyl radical directly attached to an oxygen atom wherein acyl has the same definition given herein; some examples include but are not limited to acetyloxy, propionyloxy, butanoyloxy, isobutanoyloxy, sec-butanoyloxy, t-butanoyloxy, and the like.

The term ”(06 acylsulfonamide refers to (06 acyl attached directly to the sulfonamide nitrogen, wherein the definitions for acyl and sulfonamide have the same meaning as described herein, and acylsulfonamide may be represented by the following formula:

Some embodiments of the present invention are when acylsulfonamide (05 acylsulfonamide, some embodiments are Sm acylsulfonamide, some embodiments are (0z acylsulfonamide, and some embodiments are (0z2 acylsulfonamide. Examples of acylsulfonamides include, but are not limited to, acetylsulfonamyl [S (= O)2NHC [(O) Me], propionylsulfamoyl [-S (= O) 2NHC (= O) Et], isobutyrylsulfamoyl, butyrylsulfamoyl, 2-methyl-butyrylsulfamoyl, 3-methylbutyrylsulfamoyl, 2,2-dimethylpropionsulfamoyl, .pentanoylsulfamoyl, 2-pentanoylsulfamoyl, 2 , 3-methyl-pentanoylsulfamoyl, 4-methyl-pentanoylsulfamoyl, and the like.

The term “S2-b alkenyl means a radical containing 2 to 6 carbons wherein at least one carbon-carbon double bond is present, some embodiments are 2 to 4 carbons, some embodiments are 2 to 3 carbons, and some embodiments have

51174 Β carbon. Both isomers E and Z are encompassed by the term aikenyl. Moreover, the term alkenyl includes di- and tri-alkenyls. Accordingly, if more than one double bond is present then the bonds may be all E or Z or mixtures of E and Z. Examples of alkenyl include vinyl, allyl, 2-butenyl, 3-butenyl, 2-pentenyl, 3pentenyl, 4-pentenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexanyl, 2,4hexadienyl and the like.

The term C 1-4 alkoxy as used herein means an alkyl radical, as defined herein, attached directly to an oxygen atom. Examples include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, t-butoxy, iso-butoxy, sec-butoxy and the like.

The term C 1-4 alkyl denotes with a chain in the normal chain or branched carbon a radical containing 1 to 8 carbons, some embodiments are 1 to 6 carbons, some embodiments are 1 to 3 carbons, and some embodiments are 1 or 2 carbons. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, iso-butyl, t-butyl, pentyl, iso-pentyl, t-pentyl, neo-pentyl, 1-methylbutyl [i.e., -CH (CH3) CH2CH2CH3], 2-methylbutyl [i.e., -SN2SN (SN3) SNSNz], n-hexyl and the like.

The term CLJT alkylcarboxamido or Sm alkylcarboxamide refers to an alkyl group attached to the nitrogen amide group, wherein alkyl has the same definition as described herein. Ον5 alkylcarboxamido can be represented by the following:

51174 Β

alkyl

C1-4 alkyl

Examples include, but are not limited to, N, N-methylcarboxamide, N-propylcarboxamide, N- / iso-propylcarboxamide, N-n-butylcarboxamide, N-sec-butylcarboxamide, N-sec-butylcarboxamide, N-sec-butylcarboxamide, N-sec-butylcarboxamide, N AM-butylcarboxamide and the like.

The term C 1-4 alkylene refers to a C 1-4 divalent carbon group in the normal sequence. In some embodiments, 0μ3 alkylene refers to -CH2-, CH2CH2-, i —CH2CH2CH2-, etc .. In some embodiments, Ci-3 alkylene refers to -CH-, -CHCH2-, -CHCH2CH2-, and the like, where these examples refer generally to A.

The term C14 alkylsulfinyl refers to Sm an alkyl radical attached to a sulfoxide radical of formula: -S (O) - wherein the alkyl radical has the same definition as described herein. Examples include, but are not limited to, methylsulfinyl, ethylsulfinyl, n-propylsulfinyl, iso-propylsulfinyl, n-butylsulfinyl, secbutylsulfinyl, iso-butylsulfinyl, t-butyl, and the like.

The term “Ci4 alkylsulfonamide refers to groups

51174 Β

Where S1L alkyl has the same definition as given herein.

The term Sm alkylsulfinir means Sm an alkyl radical attached to a sulfide radical of formula: -S (O) - wherein the alkyl radical has the same definition as described herein. Examples include, but are not limited to, methylsulfinyl, ethylsulfinyl, n-propylsulfinyl, iso-propylsulfinyl, n-butylsulfinyl, sec-butylsulfinyl, iso-butylsulfinyl, t-butyl, and the like.

The term C 1-6 alkylthio means Sm an alkyl radical attached to a sulfide of the formula: -S- wherein the alkyl radical has the same definition as described herein. Examples include, but are not limited to, methylsulfanyl (e.g., CH3S-), ethylsulfanyl, n-propylsulfanyl, iso-propylsulfanyl, n-butylsulfanyl, sec-butylsulfanyl, isobutylsulfanyl, t-butyl, and the like.

The term 'alkylthiocarboxamide' means a thioamide of the following formula:

C 1-4 alkyl wherein C 1-4 alkyl has the same definition as given herein.

The term alkylthioureyl refers to groups of the formula: -NC (S) N- wherein one or both nitrogen is independently substituted with the same or different 4 alkyl groups and alkyl has the same definition as given herein. Examples of alkylthioureyl include, but are not limited to, CH3NHC (S) NH,

51174 Β

NH2C (S) NCH3-, (CH3)2N (S) NH-, (CH3)2N (S) NH 2, CH3)2N (S) NCH3-,

CH3CH2NHC (S) NH-, CH3CH2NHC (S) NCH3- and the like.

The term Sm alkylureyl means a group of the formula: -NC (O) N- wherein one or both nitrogen is independently substituted with the same or different Sm an alkyl group wherein alkyl has the same definition as given herein. Examples of alkylureyl include, but are not limited to, CH3NHC (O) NHNH2C (O) NCH3-, (CH3)2N (O) NH-, CH3)2N (O) NH-, ΟΗ3)2N (0) NOH3-,

CH3CH2NHC (O) NH-, CH3CH2NHC (O) NCH3-, and the like.

The term C2-6 alkynyl means a radical containing 2 to 6 carbons and at least one carbon-carbon triple bond, some embodiments are 2 to 4 carbons, some embodiments are 2 to 3 carbons, and some embodiments have 2 carbons. Examples of alkynyl include, but are not limited to, ethynyl, 1-propynyl, 2-propynyl,

1-butynyl, 2-butynyl, 3-butynyl, 1-pentynyl, 2-pentynyl, 3-pentynyl, 4-pentynyl, 1hexynyl, 2-hexynyl, 3-hexynyl, 4-hexynyl, 5-hexynyl and the like. The term "alkynyl" includes di- and tri-ynes.

The term amino refers to the group -NH2.

The term “C1j4 alkylamino ”means an alkyl radical attached to an amino radical wherein the alkyl radical has the same meaning as described herein. Some examples include, but are not limited to, methylamino, ethylamino, n-propylamino, iso-propylamino, n-butylamino, sec-butylamino, iso-butylamino, t-butylamino, and the like. Some realizations are alkylamino.

The term "aryl" means an aromatic ring radical containing 6 to 10 ring carbons. Examples include phenyl and naphthyl.

51174 Β

The term "aralkyl" defines SGS4 alkylene, such as -CH2-, -CH2CH2- and the like, which is further substituted with an aryl group. Examples of aralkyl include benzyl, phenethylene and the like.

The term "arylcarboxamido" means an aryl group attached to a nitrogen amide group, wherein aryl has the same definition as found herein. An example is M-phenylcarboxamide.

The term "arylurea" means a group -NC (O) N- wherein one of the nitrogen is substituted with aryl.

The term "benzyl" means the group - ~ CH2C6H5.

The term ”carbo-C1.6'alkoxy' refers to an alkyl ester of a carboxylic acid, wherein the alkyl group is as defined herein. In some embodiments, the carbo-C 1-4 alkoxy group is attached to a nitrogen atom and together form a carbamate group (e.g., N-COO-C 1-6 alkyl). In some embodiments, the carbo-C 1-6 -alkoxy group is an ester (e.g., -COO-C 1-6 -alkyl). Examples include, but are not limited to, carbomethoxy, carboethoxy, carbopropoxy, carboisopropoxy, carbobutoxy, carbo-sec-butoxy, carbo-iso-butoxy, carbo-t-butoxy, carbo-n-pentoxy, carbo-iso-pentoxy, carbo- t-pentoxy, carbo-neo-pentoxy, carbo-n-hexyloxy, and the like.

The term "carboxamide" refers to the group -CONH2.

The term "carboxy" or "carboxyl" means the group -CO2H; it is also referred to as a carboxylic acid group.

51174 Β

The term "cyano" means the group -CN.

The term "C3-7-cycloalkenyl" means a non-aromatic ring radical containing a ring of 3 to 6 carbons and at least one double bond; some embodiments contain 3 to 5 vignettes; some realizations contain 3 to 4 hybrids. Examples include cyclopropenyl. cyclobutenyl, cyclopentenyl, cyclopentenyl, cyclohexenyl, and the like.

The term C3-7 cycloalkyl denotes a saturated ring radical containing 3 to 6 carbons; some embodiments contain 3 to 5 carbons; some embodiments contain 3 to 4 carbons. Examples include, cyclopropyl, cyclobutyl, cyclopentyl, cyclopenyl, cyclohexyl, cycloheptyl and the like.

The term ”C4.8 diacylamino ”means an amino group attached to two acyl groups as defined herein, wherein the acyl groups may be the same or different, such as:

Examples C4.8 diacylamino groups include, but are not limited to, diacetylamino, dipropionylamino, acetylpropionylamino and the like.

51174 Β

The term C 1-4 dialkylamino means amino substituted with two same or different alkyl radicals wherein the alkyl radical has the same definition as described herein. Some examples include, but are not limited to, dimethylamino, methylethylamino, diethylamino, methylpropylamino, methylisopropylamino, ethylpropylamino, ethylisopropylamino, dipropylamino, propylisopropylamino, and the like. Some realizations are “C2"dialkylamino".

The term C 1-4 -alkylcarboxamido or C 1-4 -alkylcarboxamide denotes two alkyl radicals, which are the same or different, attached to an amide group, wherein alkyl has the same definition as described herein. The following groups can be represented by CM-dialkylcarboxamido:

C1-4 alkyl

C1-4 alkyl where Sm has the same definition as described here. Examples of dialkylcarbonamides include, but are not limited to, N, N-dimethylcarboxamide, N-methyl-N-ethylcarboxamide, N, N-diethylcarboxamide, N-methyl-visopropylcarboxamide, and the like.

The term “C2.s-dialkylsulfonamide refers to one of the following groups shown below:

51174Β

hS1-Z alkyl

C 1-6 alkyl

wherein it has the same definition as described herein, for example but not limited to, methyl, ethyl, n-propyl, isopropyl, and the like.

The term C 1-4 dialkylthiocarboxamido or * 'C2Dialkylthiocarboxamide means two alkyl radicals, which are the same or different, attached to a thioamide group, wherein alkyl has the same definition as described herein. Sm dialkylthiocarboxamido can be represented by the following groups:

C1-4 alkyl alkyl

Examples of dialkylthiocarboxamides include, but are not limited to, N, N-dimethylthiocarboxamide, N-methyl-N-ethylthiocarboxamide, and the like.

The term C 1-6 dialkylsulfonylamino refers to the amino group attached to S4with alkylsulfonyl groups as described herein.

The term "ethinylene" refers to the carbon-carbon triangular bond as presented below:

51174 Β

The term "formyl" refers to the group -CHO.

The term '' S14 haloalkoxy means haloalkyl, as defined herein, which is directly attached to an oxygen atom. Examples include, but are not limited to, difluoromethoxy, trifluoromethoxy, 2,2,2-trifluoroethoxy, pentafluoroethoxy, and the like.

The term Sm haloalkylT 'denotes Sm an alkyl group, as defined herein, wherein the alkyl is substituted - with one halogen to a fully substituted and a fully substituted Sm haloalkyl may be represented by formula CnL2n+ and wherein L is halogen and is 1, 2, 3 or 4; when more than one halogen is present then it may be the same or different and selected from the group consisting of F, Cl, Br and J, preferably F. Examples (0 haloalkyl groups include, but are not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, chlorodifluoromethyl, 2,2,2-trifluoroethyl, pentafluoroethyl and the like.

The term Sm haloalkylcarboxamide means an alkylcarboxamide group, as defined herein, when Twherein the alkyl substituted with one halogen to fully substituted is represented by formula CnL2n+ and wherein L is halogen in ”is 1, 2, 3 or 4. When more than one halogen is present they may be the same or different and selected from the group consisting of F, Cl, Br and J, preferably F.

51174 Β

The term S-m haloalkylsulfinyl means a haloalkyl radical attached to a sulfoxide group of the formula: -S (O) - wherein the haloalkyl radical has the same definition as described herein. Examples include, but are not limited to, trifluoromethylsulfinyl, 2,2,2-trifluoroethylsulfinyl, 2,2-difluoroethylsulfinyl, and the like.

The term C14 haloalkylsulfonyl means a haloalkyl radical attached to a sulfone group of the formula: -S (O)2- wherein the haloalkyl radical has the same definition as described herein. Examples include, but are not limited to, trifluoromethylsulfonyl, 2,2,2-trifluoroethylsulfonyl, 2,2-difluoroethylsulfonyl, and the like.

The term "Sm haloalkylthio" means haloalkyl Tadical directly attached to sulfur wherein haioalkyl has the same meaning as described herein. Examples include, but are not limited to, trifluoromethylthio (i.e., CF3S-),

1,1-difluoroethylthio, 2,2,2-trifluoroethylthio and the like.

The term halogen or halo means a fluoro, chloro, bromo or iodo group.

The term "O" 2 heteroalkylene refers to CV2 alkylene attached to a heteroatom selected from 0, S, S (0), S (0)2, and NH. Some representative examples include, but are not limited to, groups of the following formulas:

o II

no 0 %

and the like.

51174 Β

The term "heteroaryl" refers to an aromatic ring system which may be one ring, two fused rings or three fused rings wherein at least one carbon in the ring is replaced by a heteroatom selected from, but not limited to, a group containing 0, S and N wherein N may be optionally substituted with Η, 0Μ acyl or Cm alkyl. Examples of heteroaryl groups include, but are not limited to, pyridyl, benzofuranyl, pyrazinyl, pyridazinyl, pyrimidinyl, triazinyl, quinoline, benzoxazole, benzothiazole, 1,7-benzimidazole, isoquinoline, quinazoline, quinoxaline, and the like. In some embodiments, the heteroaryl atom may be 0, S, NH, examples include, but are not limited to, pyrrole, indoi, and the like.

The term "heterocyclic" means a non-aromatic carbon ring (i.e., cycloalkyl or cycloalkenyl as defined herein) wherein one, two or three ring carbons are replaced by a heteroatom selected from, but not limited to, a group consisting of 0 , S, N, wherein N may be optionally substituted with H, C 1-4 acyl or alkyl, and the ring carbon atoms may be optionally substituted with oxo or thiooxy thus forming a carbonyl or thiocarbonyl group. A heterocyclic group is a ring of 3-, 4-, 5-, 6- or 7-membered. Examples of the heterocyclic group include, but are not limited to, aziridin-1-yl, aziridin-2-yl, azetidin-1-yl, azetidin-2-yl, azetidin-3-yl, piperidin-1-yl, piperidin-4-yl, morpholin-4-yl, piperzin-1-yl, piperzin-4-yl, pyrrolidin-1-yl, pyrrolidin-3-yl, [1,3] -dioxolan-2-yl and the like.

The term heterocyclic-carbonyl means a heterocyclic group, as defined herein, directly attached to a carbon or carbonyl group (i.e., C = O). In some embodiments, the nitrogen in the ring of the heterocyclic group is attached to the carbonyl group to form an amide. Examples include, but are not limited to,

51174 Β

Ο 'ίΑ'Ν' ^ ι kj>

and the like.

In some embodiments, the carbon in the ring is attached to the carbonyl group to form a ketone group. Examples include, but are not limited to, * T .....

and the like.

The term heterocyclic-oxy refers to a heterocyclic group, as defined herein, that is directly attached to an oxygen atom. Examples include the following:

51174 Β

and the like.

The term "heterocycliccarboxamido" means a heterocyclic group, as defined herein, with ring nitrogen where the ring nitrogen is attached directly to the carbonyl to form an amide. Examples .include, but are not limited to,

* and the like.

The term heterocyclylsulfonyl means a heterocyclic group, as defined herein, with ring nitrogen where the ring nitrogen is directly attached to SO2 a group forming a sulfonamide. Examples include, but are not limited to,

51174 Β

and the like.

The term "hydroxyl" refers to the group -OH.

The term hydroxylamino refers to the group -NHOH.

The term nitro refers to the group -NO2.

The term C4-7 oxo-cycloalkyl refers to C4.7 cycloalkyl, as defined herein, wherein one of the ring carbons is replaced by a carbonyl. Examples C4.7 oxo-cycloalkyl include, but are not limited to,

2-oxo-cyclobutyl, 3-oxo-cyclobutyl, 3-oxo-cyclopentyl, 4-oxo-cyclohexyl, and the like are each presented separately with the following structures:

The term "perfluoroalkyl" means a group of formula -CnF2n + 1; stated differently, perfluoroalkyl is alkyl as defined herein wherein the alkyl is completely substituted by fluorine atoms and is therefore considered a haloalkyl subunit. Examples of 'perfluoroalkyl include, CF.3, CF2CF3,

51174 Β

CF2CF2CF3) CF (CF3)2t CF2CF2CF2CF3, CF2CF (CF3)2, CF (CF3) CF2CF3 and the like.

The term phenoxy refers to group C6H5O-, r

The term phenyl refers to group C6H5-.

The term phosphonooxy '* refers to a group with the following chemical structure:

o II on

The term sulfonamide refers to the group -SO2NH2.

The term sulfonic acid refers to the group -SO3H.

The term "tetrazolyl" refers to the five-membered thieteroaryl of the following formulas:

51174 Β

In some embodiments, the tetrazolyl group is further substituted at either 1 or 5 positions each with a group selected from the group consisting of C1-3 alkyl, C1-6.3 haloalkyl and C43 alkoxy.

The term thiol denotes the group -SH.

The term GLP-1 secretagogue will mean an agent (e.g., a compound) that promotes GLP-1 secretion from cells, e.g., enteroendocrine cells.

The term endogenous will mean a material that a mammal naturally produces.

The term biologically active fragment of a G protein-paired receptor will mean a fragment of a GPCR that has the structural and biochemical functions of naturally occurring GPCR in certain embodiments, a biologically active fragment that is paired with a G protein. In certain embodiments, the biologically active fragment binds to a GPCR ligand.

The term primer is used herein to mean a specific oligonucleotide sequence that is complementary to the target nucleotide sequence and is used to hybridize to the target nucleotide sequence. The primer serves as the starting point for nucleotide polymerization catalyzed by DNA polymerase, RNA polymerase, or reverse transcriptase.

The term expression vector will mean the DNA sequence necessary for the transcription of kionized DNA and the translation of the transcribed mRNA into an appropriate host cell recombinant for the expression vector. The appropriately constructed expression vector should contain the origin of replication for autonomous replication in dornacin cells,

51174Β selectable markers, a limited number of useful enzyme restriction sites, the potential for a large number of copies, and active promoters. The cloned DNA to be transcribed is operatively linked to a constitutively and conditionally active promoter within the expression vector.

The term candidate compound or test compound will mean a compound (for example, a non-limiting, chemical compound) that is subject to search.

The term contact or contacting will mean bringing at least two residues together. The term modulate or modify will be taken to refer to an increase or decrease in the quantity, quality or diester of a particular activity, function or molecule. By way of illustration without limitation, agonists, partial agonists, inverse agonists, and G protein-paired receptor antagonists are receptor modulators.

The term small molecule is to be understood to mean a compound having a molecular weight of less than about 10,000 grams per mole, including a peptide, peptidomimetic, amino acid, amino acid analog, polynucleotide, polynucleotide analog, nucleotide, nucleotide analog, organic compound or inorganic compound ( that is, including a hetero-organic compound or an organometallic compound), and salts, esters and other pharmaceutically acceptable forms thereof. In certain preferred embodiments, small molecules are organic or inorganic compounds having a molecular weight of less than about 5,000 grams per mole. In certain superiors

51174 In embodiments, the small molecules are organic or inorganic compounds having a molecular weight of less than about 1,000 grams per mole. In certain preferred embodiments, small molecules are organic or inorganic compounds having a molecular weight of less than about 800 grams per mole. In certain preferred embodiments, small molecules are organic or inorganic compounds having a molecular weight of less than about 600 grams per mole. In certain preferred embodiments, small molecules are organic or inorganic compounds having a molecular weight of less than about 500 grams per mole.

The term "polynucleotide" will refer to an RNA, DNA, or RNA / DNA hybrid sequence or more than one nucleotide in the form of either a single strand or a double strand. The polynucleotides of the invention can be prepared by any known method, including synthetic, recombinant, ex vivo generation, or a combination thereof, as well as using any purification method known in the art.

The term "polypeptide" will refer to an amino acid polymer regardless of the length of the polymer. Thus, peptides, oligopeptides, and proteins are included within the definition of a polypeptide. The term also does not specify or exclude modifications of the polypeptide after expression. For example, polypeptides that include covalent attachment of glycosyl groups, acetyl groups, posphate groups, lipid groups, and the like are explicitly encompassed by the term polypeptides.

The term "antibody" as used herein includes a monoclonal antibody and a polyclonal antibody.

51174Β

The term "second messenger" shall mean an intracellular response produced as a result of receptor activation. Other messengers may include, for example, inositol 1,4,5-triphosphate (IP3), diacylglycerol (DAG), cyclic AMP (cAMP), cyclic GMP (cGMP), MAP kinase activity, MAPK / ERK kinase kinase activity -1 (MEKK1), and Ca2 +. The response of the second messenger can be measured by determining receptor activation.

The term "receptor functionality" will refer to the normal functioning of the receptor to receive a stimulus and mitigate the action in the cell, including but not limited to regulating gene transcription, regulating influx and ion efflux, catalytic response and / or modulating activity through G-proteins, as which is to provoke a response from another messenger.

The term "stimulate" or "stimulation", in relation to the term "receptor response" or functionality, shall mean a response or receptor functionality that is increased in the presence of a compound as opposed to that in the absence of the compound.

The term "inhibit or inhibit", in relation to the term "receptor response" or functionality, shall mean a response or receptor functionality that is reduced or prevented in the presence of a compound as opposed to that in the absence of the compound.

Where a range of values is given, it is understood that each intervention value is from the tenth part of the lower limit unless the context clearly indicates otherwise, between the upper and lower range limits and any other specified or intervention value in the specified range, encompassed by the present invention.

51174Β

GPR119 Agonists

Presumably, GPR119 is mammalian GPR119. More preferably, GPR119 is a rodent or primate GPR119. Most preferably, GPR119 is human GPR119.

A class of GPR119 agonists useful in the novel therapeutic combinations of the present invention includes compounds that exhibit an acceptable high affinity for the GPCR119 receptor. The GPR119 agonist or pharmaceutically acceptable salt may be any agonist, more preferably a selective GPR119 agonist.

Examples of GPR119 agonists are. described in international application no. PCT / US2004 / 001267 (published as WO 04/065380). Revealed in international application no. PCT / US2004 / 001267 as a GPR119 agonist is a compound of Formula (I):

R «

0) where:

A and B are independently C1-3 alkylene optionally substituted with 1 to 4 methyl groups;

D is O, S, S (O); S (O)2, CR2R3 or NR2;

51174 Β

V is selected from the group consisting of C1-3 alkylene, ethynylene and Ομ2 heteroalkylene wherein each is optionally substituted with 1 to 4 substituents selected from the group consisting of C 1-8 alkyl, alkoxy, carboxy, cyano, C 1-83 haloalkyl and halogen; or

V is absent;

Wje NO4, 0, S, S (0) or S (0)2; or

W is absent;

X is N or CR5; YjeNiliCR6;

Z is selected from the group containing Ομ5 acyl, (6.5 acyloxy, C1-4 alkoxy, C1-6 alkyl, C1-6 alkyl)14 alkylcarboxamide, Sm alkylthiocarboxamide, C14 alkylsulfonamide, Sm alkylsulfinyl, C14 alkylsulfonyl, alkylthio, Sm alkylthioureyl, S14 alkylureyl, amino, C1-62 alkylamino, C24 dialkylamino, carbo-C 1-4 alkoxy, carboxamide, carboxy, cyano, C4.8 diacylamino, C2-e dialkylcarboxamide, Sm dialkylthiocarboxamide, C2. dialkylsulfonamides, Sm dialkylsulfonylamino, formyl, Sm haloalkoxy, Sm haloalkyl, Sm haloalkylcarboxamide, Sm haloalkylsulfines !, Sm haloalkylsulfonyl, haloalkylthio, halogen, aryl, heterocyclic, heteroaryl, hydroxyl, hydroxylamino, nitro and tetrazolyl, wherein C 1-3 alkyl and acyl each optionally substituted with 1, 2, 3 or 4 groups selected from the group consisting of C 1-8.5 acyl, SGfive acyloxy, Sm alkoxy, C14 alkylcarboxamide, C14 alkylsulfonamide, C14 alkylsulfinyl, C14 alkylsulfonyl, alkylthio, C14 alkylureyl, amino, C1.2 alkylamino, C24 dialkylamino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano,

51174 Β formil, Sm haloalkoxy, Sm haloalkylsulfinyl, Sm haloalkylsulfonyl, haloalkylthio, halogen, hydroxyl, hydroxylamino and nitro; iii

Z is a group of Formula (IA):

where:

R7 is H, Sm alkyl or C3-6 cycloalkyl; i

R8 is H, nitro or nitrii;

With1 is aryl or heteroaryl wherein each is optionally substituted with R9-R13;

R 1 is selected from the group consisting of H, acyloxy, C2.6 alkenyl, Sm alkoxy, Ci.8 alkyl, ClJ} alkylcarboxamide, C2_6 alkynyl, alkylsulfonamide, Cu alkylsulfinyl, alkylsulfonyl, Sm alkyl, C14 alkylureyl, amino, Sm alkylamino, C2_6 dialkylamino, carboxamide, cyano, N, cycloalkyl, C2.is dialkylcarboxamide, S2-b dialkylsulfonamide, halogen, C14 haloalkoxy, Sm haloalkylsulfinyl, haloalkylsulfonyl, C14 haloalkylthio and hydroxyl;

R2 is selected from the group consisting of H, Ci.5 acyl, acyloxy, alkoxy, C 1-6 alkyl, Sm alkylcarboxamide, Sm alkylthiocarboxamide, C 1-4 alkylsulfinyl, C 1-4b4 alkylisulfonyl, Sm alkylthio, amino, carbo-C 1-4 alkoxy,

51174 Β carboxamide, carboxic, cyano, C345 cycloalkyl, C2_6 dialkylcarboxamide, Sm haloalkoxy,. Sm haloalkyl, halogen, heteroaryl, hydroxyl and phenyl; and wherein Ci_8 alkyl, heteroaryl and phenyl each optionally substituted with 1 to 5 substituents selected from the group consisting of S4.5 acyl, (05 acyloxy, Sm alkoxy, C 1-6 alkyl, C 1-4 alkylamino, Sm alkylcarboxamide, Sm alkylthiocarboxamide, Sm alkylsulfonamide, Sm alkylsulfinyl, Cin alkylsulfonyl, Sm alkylthio, Sm alkylthioureyl, S-m alkylureyl, amino, carbo- C1.6-alkoxy, carboxamide, carboxy, cyano, Sz_6-s1k1oa1kj |, Cs ^ -cycloalkyl-C1-6-alkylene, C3C 1-6 cycloalkyl-C 1-6 heteroalkylene, C 1-62_8 dialkylamino, S2.b dialkylcarboxamide, Sm dialkylthiocarboxamide, S2.8 dialkylsulfonamide, S-m alkylthioureyl, C14 haloalkoxy, Sm haloalkyl, haloalkylsulfinyl, C14 haloalkylsulfonyl, Sm haloalkyl, Sm haloalkylthio, halogen, heterocyclic, hydroxyl, hydroxylamino and nitro; or

R2 is -Ar2-With3 wherein su-Ar2 and Ar3 independently aryl or heteroaryl each optionally substituted with 1 to 5 substituents selected from the group consisting of Η, (05 acyl, (05 acyloxy, CLJT alkoxy, alkyl, S-alkylcarboxamide, Sm alkylthiocarboxamide, Sm alkylsulfinyl, Sm alkylsulfonyl, Sm alkylthio, amino, carbo-C 1-4 -alkoxy, carboxamide, carboxy, cyano, C36-cycloalkyl, C2_s dialkylcarboxamide, S1H haloalkoxy, C14 haloalkyl, halogen, hydroxyl and nitro; or

R2 is a group of Formula (IB):

51174 ΙΒ (Β) where:

Ru is C1-6 alkyl or C3.6 cycloalkyl; and R15 is F, C1, Br or CN; or R2 group of formula (IC):

(IC) where:

G is C = O, CR16R17, 0, S, S (0), S (0)2; where R16 and R17 independently H or Ον8 alkyl; i

With4 phenyl or heteroaryl is optionally substituted with 1 to 5 substituents selected from the group consisting of C1-5 acyl, acyloxy, alkyl, Sm alkylcarboxamide, alkylthiocarboxarfide, Sm alkylsulfonamide, Sm alkylsulfinyl, Sm alkylsulfonyl, Sm alkylthio, Cin alkylthioureyl, Sm alkylureyl, amino, carbo-C 1-4 -alkoxy, carboxamide, carboxy, cyano, C3_is-cycloalkyl, C2Dialkylcarboxamide, Sm dialkylthiocarboxamide, C2. 6 dialkylsulfonamide, Sm alkylthioureyl, C1-4 haloalkoxy, Cin haloalkyl,

51174Β

Sm haloalkylsulfinii, Sm haloalkylsulfonyl, C14 haloalkyl, haloalkylthio, halogen, heteroaryl, hydroxyl, hydroxylamino and nitro;

R3 is H, Ci.8 alkyl, alkoxy, halogen or hydroxy;

R4 H or Cva is alkyl;

R5 and R6 are independently H, Ci_8 alkyl or halogen;

R9 is selected from the group consisting of acyl, C 1-6 acyloxy, C 1-62.6 alkenyl, alkoxy, C1-6 alkyl, alkylamino, C4.4 alkylcarboxamide, C2.6 alkynyl, Sm alkylsulfonamide, Sm alkylsulfinyl, alkylsulfonyl, Sm alkylthio, S1H alkylureyl, amino, arylsulfonium, carbo-C 1-4 -alkoxy, carboxamide, carboxy, cyano, C3^ cycloalkyl, C2.6 dialkylamino, S2.b dialkylcarboxamide, S2-e dialkyl sulfonamide, halogen, Sm haloalkoxy, Sm haloalkyl, haloalkylsulfinyl, Sm haloalkylsulfonyl, CV4 haloalkylthio, heterocyclic, heterocyclylsulfonyl, heteroaryl, hydroxyl, nitro, C4.7 oxocycloalkyl, phenoxy, phenyl, sulfonamide and sulfonic acid, wherein acyl, Sm alkoxy, C 1-4 alkyl, C 1-4 alkylsulfonamide, alkylsulfonyl, arylsulfonyl, heteroaryl, phenoxy and phenyl each optionally substituted with 1 to 5 substituents selected independently from the group consisting of C 1-5 acyl, acyloxy, C2.6 alkenyl, C14 alkoxy, alkyl, Sm alkylcarboxamide, S2.b alkynyl, Sm alkylsulfonamide, C14 alkylsulfinyl, C1j} alkylsulfonyl, alkylthio, alkylureyl, carbo-C 1-4 alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C2.6 dialkylcarboxamide, halogen, Sm haloalkoxy, CV4 haloalkyl, Sm haloalkylsulfinyl, Sm haloalkylsulfonyl, haloalkylthio, heteroaryl, heterocyclic, hydroxyl, nitro and phenyl; or

Rg is a group of Formula (ID):

51174Β

V ^^ rR18 Ο (Π)) where:

ρ ί ”γ are independently 0, 1, 2 or 3; i

R18 is H, CV5 acyl, C2^ alkenyl, O.ν3 alkyl, C14 alkylcarboxamide, C2.s alkynyl, Sm alkylsulfonamide, carbo-C 1-4 alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C2Dialkylcarboxamide, halogen, heteroaryl or phenyl, and wherein heteroaryl and phenyl are each optionally substituted with 1 to 5 substituents independently selected from the group consisting of Sm alkoxy, amino, S-alkylamino, S2_b alkynyl, C2.s dialkylamino, halogen, Sm haloaicoxy, Sm haloalkyl and hydroxyl; i

R10-R13 are independently selected from the group consisting of C-j_5 acyl, acyloxy, C2_g alkenyl, Sm alkoxy, S4.8 alkyl, Sm alkylcarboxamide, C2. 6 alkynyl, C14 alkylsulfonamide, S-m alkylsulfinyl, Sm alkylsulfonyl, Sm alkylthio, alkylureyl, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C2.6 dialkylcarboxamide, halogen, Sm haloalkoxy, S1l haloalkyl, Sm haloalkylsulfinyl, Sm haloalkylsulfonyl, C 1-4 haloalkylthio, hydroxyl and nitro; iii

51174 Β two adjacent R10-R11 groups together with Αη form a 5, 6 or 7 membered cycloalkyl, cycloalkenyl or heterocyclic group wherein the 5, 6 or 7 membered group is optionally substituted with halogen.

The present invention also encompasses diastereomers as well as optical isomers, e.g., mixtures of enantiomers including racemic mixtures, as well as individual enantiomers and diastereomers, which result from structural asymmetry in certain compounds of the invention. Separation of individual isomers or selective synthesis of individual isomers is achieved by applying various methods that are very well known to those skilled in the art.

Specific examples of GPR119 agonists disclosed in International Application No. PCT / US2004 / 001267 include the following compounds according to Formula (I) (hereinafter referred to as Group A1):

[6- (4-Benzenesulfonyl-piperidin-1-yl) -5-nitro-pyrimidin-4-yl] - (4-methanesulfonylphenyl) -amine;

{4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yl] -piperazin-1-yl} -acetic acid ethyl ester;

(2-Fluoro-phenyl) - {5-nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] pyrimidin-4-yl} -amine;

1- [6- (4-Imidazol-1-yl-phenoxy) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [5-Nitro-6- (4- [1,2,4] triazol-1-yl-phenoxy) -pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

{6- [4- (4-Fluoro-phenoxy) -piperidin-1-yl] -5-nitro-pyrimidin-4-yl} - (4-methanesulfonyl-phenyl) -amine;

51174S {6- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitropyrimidin-4-yl} - (4-methanesulfonyl-phenyl) - amine;

{6- [4- (3-Cyclopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitropyrimidin-4-yl} - (4-methanesulfonyl-phenyl) -amine ;

(4-Methanesulfonylphenyl) - (5-nitro-6- {4- [3- (3-trifluoromethyl-phenyl) - [1.2.4] oxadiazol-5-yl] -piperidin-1-yl} -pyrimidine-4- yl) -amine;

{6- [4- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yl} - (2-fluoro-phenyl) -amine ;

(2-Fluoro-4-methanesulfonyl-phenyl) - {6- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitro-pyrimidin-4- il} -amine; {6- [4- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yl} - (2-fluoro-4-methanesulfonyl- phenyl) -amine;

(4-Methanesulfonyl-phenylH-nitro-6- [4- (3-propyl- [1,2,4] oxadiazol-5-yl) piperidin-1-yl] -pyrimidin-4-yl} -amine;

{N - N-Cyclopropylmethyl-ethyl-N-ioxadiazol-S-10-piperidin-1-yl] -S-nitropyrimidin-4-yl} - (4-methanesulfonyl-phenyl) -amine;

(4-Methanesulfonyl-phenyl) - {5-nitro-6- [4- (pyridin-4-yloxy) -piperidin-1-yl] pyrimidin-4-yl} -amine;

(4-Methanesulfonyl-phenyl) - {5-nitro-6- [4- (pyrimidin-2-yloxy) -piperidin-1-yl] pyrimidin-4-yl] -amine;

1- [6- (4-Carbamoylmethyl-phenoxy) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- {6- [4- (1,3-Dioxo-1,3-dihydro-isoindol-2-yl) -phenoxy] -5-nitropyrimidin-4-yl} -piperidine-4-carboxylic acid ethyl ester;

4 '- [4- (2-Methoxycarbonylacetyl) phenoxy] -3'-nitro-3,415,6-tetrahydro-2H [1,2 '] bipyridinyl-4-carboxylic acid ethyl ester;

{6- [4- (2-Methoxy-phenylsulfanyl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yl} - (4- [1.2.4] trizol-1-yl-phenyl) -amine ;

51174 Β

4 '- (2-Amino-4-ethanesulfonyl-phenoxy) -3'-nitro-3,4,5,6-tetrahydro [2H] [1,2'] bipyridinyl-4-carboxylic acid ethyl ester; 4 '- (4-Imidazol-1-yl-phenoxy) -3'-nitro-3,4,5,6-tetrahydro-2H [1,2'] bipyridinyl-4-carboxylic acid ethyl ester;

(4-Methoxy-2- {5-nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] -pyrimidine-

4-Yloxy} -phenyl-methanone;

4- {4- [6- (4-Cyclopropylmethoxymethyl-piperidin-1-yl) -5-nitro-pyrimidin-4-yloxy] -phenyl] -butan-2-one;

4- {4- [5-Nitro-6- (4-propoxymethyl-piperidin-1-yl) -pyrimidin-4-yloxy] phenyl} -butan-2-one;

4- {4- [6- (4-Butoxymethyl-piperidin-1-yl) -5-nitro-pyrimidin-4-yloxy] -phenyl} butan-2-one;

4- {4- [6- (4-Isobutoxymethyl-piperidin-1-yl) -5'-nitro-pyrimidin-4-yloxy] phenyl} -butan-2-one;

[1- [6- (Benzo [1,3] dioxol-5-ylamino) -5-nitro-pyrimidin-4-yl] -piperidin-4-yl} - (4-fluoro-phenyl) -methanone;

(2,3-Fluoro-phenyl) - {5 ”nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] pyrimidin-4-yl} -amine;

(2,4-Difluoro-phenyl) - {5-nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] pyrimidin-4-yl} -amine;

1- {2-Nitro-3- [4- (3-oxo-butyl) -phenoxy] -phenyl} -piperidine-4-carboxylic acid ethyl ester;

1- [6- (4-Acetyl-phenoxy) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

3'-Nitro-2 '- [4- (3-oxo-butyl) -phenoxy] -3,4,5,6-tetrahydro-2H (1,4') bipyridinyl-4-carboxylic acid ethyl ester;

4- (4- {5-Nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] -pyrimidin-4-yloxy} phenyl) -butan-2-one;

51174Β

4- (4- {5-Nitro-6- [4- (2-trifluoromethyl-phenoxy) -piperidin-1-yl] -pyrimidin-4-yloxy} -phenyl) -butan-2-one;

4- (4- {6- [4- (3-Methyl- [1,2,4] oxadizol-5-yl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yloxy} -phenyl) -butan-2-one;

4- (2,4-Difluoro-phenoxy) -5-nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] pyrimidine;

4- {4- [6- (4-Fluoro-benzoyl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yloxy] phenyl} -butan-2-one;

4- (4-Methanesulfonyl-phenoxy) -5-nitro-6- [4- (pyridin-2-ylsulfanyl) cyclohexyl] -pyrimidine;

4- (4-Methanesulfonyl-phenoxy) -5-nitro-6- [4- (pyridin-4-ylsulfanyl) cyclohexyl-pyrimidine;

4- (4-Methanesulfonyl-phenoxy) -5-nitro-6- (4-phenylsulfanyl-cyclohexyl) pyrimidine;

1- {6 - [(Benzo [1,3] dioxol-5-ylmethyl) -amino] -5-nitro-pyrimidin-4-yl} piperidine-4-carboxylic acid ethyl ester;

1- {b-4- (1,1-Dioxo-1Z6-thiomorpholin-4-ylmethyl) -phenylamino] -5-nitropyrimidin-4-yl} -piperidine-4-carboxylic acid ethyl ester;

1- [6 ”(4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [6- (4-Dimethyl-sulfarnoyl-phenylamino) -5-nitro-pyrimidin-4-yl] piperidine-

4-carboxylic acid ethyl ester;

1- [6- (3-Methoxy-phenylamino) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [6- (2-Methoxy-phenylamino) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [6- (4-Methanesulfonyl-phenoxy) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

51174 Β

1- {6- [4- (2-Methoxycarbonyl-acetyl) -phenoxy] -5-nitro-pyrimidin-4-yl} piperidine-4-carboxylic acid ethyl ester;

1- [6- (2-Amino-4-ethanesulfonyl-phenoxy) -5-nitro-pyrimidin-4-yl] -piperidine-

4-carboxylic acid ethyl ester;

1- [6- (2,5-Dimethoxy-phenylamino) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

(4- {5-Nitro-6- [4 '(pyridin-2-ylsulfanyl) -piperidin-1-yl] -pyrimidin-4-ylamino} phenyl) -methanone;

1- [6- (4-Cyclohexyl-phenylamino) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [5-Nitro-6- (4- [1,2)4] triazol-1-yl-phenylamino) -pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [5-Nitro-6- (trifluoromethanesulfonyl-phenylamino) -pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [5-Nitro-6- (4- [1,2,3] thiadiazol-4-yl-phenylamino) -pyrimidin-4-yl] piperidine-4-carboxylic acid ethyl ester;

[6- (4-Ethoxymethyl-piperidin-1-yl) -5-nitro-pyrimidin-4-yl] - (4-methanesulfonylphenyl) -amine;

[5-Nitro-6- (4-propyl-piperidin-1-yl) -pyrimidin-4-yl] - (4- (1,2,4] triazol-1-ylphenyl) -amine;

(5-Nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] -pyrimidin-4-yl} - (4- [1,2,4] triazol-1-yl-phenyl) ) -amine;

(2-Fluoro-phenyl) - {6- [4- (3-methyl- [1,2l4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yl} -amine;

(4-Methanesulfonyl-phenyl) - {6- [4- (3-methyl- [1>2,4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yl} -amine; {6- [4- (3-Methyl-1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yl} - (4- [1,2,4] triazole- 1 yl-phenyl) -amine;

51174 Β (4-Methanesulfonyl-phenyl) - {5-nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] pyrimidin-4-yl] -amine;

(3-Methoxy-phenyl) - {5-nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] pyrimidin-4-yl} -amine;

1- [6- (Benzo [1,3] dioxol-5-ylamino) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [6- (2-Fluoro-phenylamino) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [6- (3-Fluoro-phenylamino) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- (6- (3,4-Dihydro-2H-benzo [b] [1,4] dioxepin-7-ylamino) -5-nitropyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- {6- [4- (Morpholine-4-sulfonyl) -phenylamino] -5-nitro-pyrimidin-4-yl} piperidine-4-carboxylic acid ethyl ester;

Benzo [1,3] diosco-5-yl- [5-nitro-6- (4-propyl-piperidin-1-yl) -pyrimidin-4-yl] -amine;

(4-Fluoro-phenyl) - {1- [5-nitro-6- (4- (1,2,4] triazol-1-yl-phenylamino) pyrimidin-4-yl] -piperidin-4-yl} - methanone;

[5-Nitro-6- (4-phenylsulfanyl-piperidin-1-yl) -pyrimidin-4-yl] - (4- [1,2,4] triazole-

1-yl-phenyl) -amine;

(4-Fluoro-phenyl) - (1- [6- (2-fluoro-phenylamino) -5-nitro-pyrimidin-4-yl] piperidin-4-yl} -methanone;

(4-Methanesulfonyl-phenyl) - {5-nitro-6- [4- (pyridin-2-yloxy) -piperidin-1-yl] pyrimidin-4-yl} -amine;

(4-Methanesulfonyl-phenyl) - {5-nitro-6- [4- (pyridin-4-ylsulfanyl) -piperidin-1-yl] pyrimidin-4-yl} -amine;

(4-Methanesulfonyl-phenyl) - {6- [4- (4-methoxy-phenylsulfanyl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yl} -amine;

51174 Β (2-Methoxy-phenyl) - (5-nitro-6- {4- [3- (3-trifluoromethyl-phenyl) - [1,2,4] oxadiazol-5-yl] -piperidin-1-yl} -pyrimidin-4-yl) -amine;

{6- [4- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yl} - (4-methanesulfonyl-phenyl) -amine ;

(6- {4- [5- (4-Fluoro-phenyl) - [1,3,4} oxadiazol-2-yl] -piperidin-1-yl} -5-nitropyrimidin-4-yl) - (4-methanesulfonyl- phenyl) -amine;

(4-Methanesulfonyl-phenyl) - [5-nitro-6- (4-pyridin-2-ylmethyl-piperidin-1-yl} pyrimidin-4-yl] -amine;

1- {6- [4- (2,5-Dioxo-imidazolidin-4-yl) -phenoxy] -5-nitro-pyrimidin-4-yl} piperidine-4-carboxylic acid ethyl ester;

1- [5-Nitro-6- (4- [1,2,3] thiadiazol-4-yl-phenoxy) -pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [6- [4- (3-Oxo-butyl) -phenoxy] -5- [(2,2,2-trifluoro-acetylarnino) pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

1- [6- (2-Benzoyl-5-methoxy-phenoxy) -5-nitro-pyrimidin-4-yl] -piperidine-4-carboxylic acid ethyl ester;

3'-Nitro-4 '- [4- (3-oxo-butyl) 4-oxy] -3(4,5,6-tetrahydro-2H [1,2 '] bipyridinyl-4-carboxylic acid ethyl ester;

1- [6- (4-Dimethyl-sulfamoyl-phenylamino) -5-nitro-pyrimidin-4-yl] -piperidine-

4-carboxylic acid ethyl ester;

- (6- (4- (4,5-Dichloro-imidazol-1-yl) -phenylamino] -5-nitro-pyrimidin-4-yl} piperidine-4-carboxylic acid ethyl ester;

Benzo [1,3] dioxol-5-yl- {5-nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] pyrimidin-4-yl} -amine;

(4-Fluoro-phenyl) - {1- [6- (2-fluoro-phenylamino) -5-nitro-pyrimidin-4-yl] piperidin-4-yl} -methanone;

(2,5-Difluoro-phenyl) - (5-nitro-6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] pyrimidin-4-yl} -amine;

51174 Β

1- {5-Nitro-6- [4- (3-oxo-butyl) -phenoxy] -pyrimidin-4-yl} -piperidine-4-carboxylic acid ethyl ester;

4- [4- (3-Isopripyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4-methanesulfonyl-phenoxy) -pyrimidine-5-carbonitrile;

5- [1,3] Dioxolan-2-yl-4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) piperidin-1-yl] -6- (4-methanesulfonyl- phenoxy) -pyrimidine;

4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4-methanesulfonyl-phenoxy) -pyrimidine-5-carbaldehyde;

5- [1,3] Dioxolan-2-yl-4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) piperidin-1-yl] -6- (4- [1 , 2,3] thiadiazol-4-yl-phenoxy) -pyrimidine;

4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4- [1.2.3] thiadiazol-4-yl-phenoxy) - pyrimidine-5-carbaldehyde;

4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4- [1.2.3] thiadizol-4-yl-phenoxy) - pyrimidine-5-carboxylic acid;

[4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4- [1.2.3] thiadizol-4-yl-phenoxy) -pyrimidin-5-yl] -methanoyl;

[4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4- [1.2.3] thiadizol-4-yl-phenoxy) -pyrimidin-5-ylmethyl] -dimethyl-amine;

4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4-methylsulfanyl-phenylamino) -pyrimidine-5-carbonitrile;

4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4-methanesulfinyl-phenylamino) -pyrimidine-5-carbonitrile;

(4-Methanesulfonyl-phenyl) - {5-nitro-6- [4- (4-trifluoromethoxy-phenoxy) piperidin-1-yl] -pyrimidin-4-yl} -amine;

4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4-methanesulfonyl-phenylamino) -pyrimidine-5-carbonitrile;

1- {1- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yl] -piperidin-4-yl} -hexan-1-one;

51174Β

1- {1- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yl] -piperidin-4-yl] -hexan-1-one;

{6- [4- (3-tert-Butyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitropyrimidin-4-yl} - (2-fluoro-4- methanesulfonyl-phenyl) -amine;

[6- [4- (3-tert-Butyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -5-nitropyrimidin-4-yl} - (4-methanesulfonyl-phenyl) -amine;

[6- (4-Benzofuran-2-yl-piperidin-1-yl) -5-nitro-pyrimidin-4-yl] - (4-methanesulfonyl-phenyl) -amine and

5-Nitro-4- (5-phenyl- [1,3,4] oxadiazol-2-ylsulfanyl) -6- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] -pyrimidine.

Examples of GPR119 agonists are described in International Application no. PCT / US2004 / 005555 (published as WO 04/076413), Revealed in International Application no. PCT / US2004 / 005555 as a GPR119 agonist compound of Formula (II):

(P) where:

A and B are independently C 1-4 alkylene optionally substituted with 1 to 4 methyl groups;

UjeNili CR ,;

D is 0, S, S (O), S (O)2, CR2R3 or NR2;

51174Β

V is selected from the group consisting of CV3 alkylene, ethynylene and aheteroalkylene optionally substituted with 1 to 4 substituents selected from the group consisting of S23 alkyl, C14 alkoxy, carboxy, cyano, C 1-4 haloalkyl and halogen; or V is absent;

W is -S (O)2NO4-, NO4-, -0-, -S-, -S (0)2-; iii W is absent;

X is N or CR5;

Z is N or CR6;

Z is selected from the group consisting of H, Ci_5 acyl, S,.5 acyloxy, alkoxy, alkyl, alkylcarboxamide, S-m alkylthiocarboxamide, C1.

alkylsulfonamide, alkylsulfinyl, 014 alkylsulfonyl, Sm alkylthio, Sm alkylthioureyl, Sm alkylureyl, amino, carbo-C6-alkoxy, carboxamide, carboxy, cyano, S4.b diacylamino, Sm dialkylcarboxamide, Sm dialkylthiocarboxamide, C2.6 dialkylsulfonamide, dialkylsulfonylamino, formyl, Sm haloalkoxy, Sm haloalkyl, Sm haloalkylcarboxamide, Sm haloalkylsulfinyl, S-m haloalkylsulfonyl, S1L haloalkylthio, halogen, aryl, heteroaryl, hydroxyl, hydroxylamino, nitro and tetrazoyl; or

Z is a group of Formula (IIA):

(PA)

51174 Β where:

R7 is H, alkyl or C3_6 cycloalkyl; i

Rs H is nitro or cyano;

Ar 1 is aryl or heteroaryl optionally substituted with R9, R10, Rn, R12 and R13; R1, R5 and R6 are independently selected from the group consisting of H, O, .5 acyloxy, S2-b alkenyl, C2^ a Sm alkoxy, C 1-6 alkyl, alkylcarboxamide, C 1-62_6 alkynyl, Sm alkylsulfonamide, Sm alkylsulfinyl, C1-6. 4 alkylsulfonyl, Sm alkylthio, Sm alkylureyl, amino, alkylamino, C2-8 dialkylamino, carboxamide, cyano, Sz_b cycloalkyl, C2Dialkylcarboxamide, C2.6 dialkylsulfonamide, halogen, haloalkoxy, Sm haloalkyl, Sm haloalkylsulfinyl, Sm haloalkylsulfonyl, S1h haloalkylthio, hydroxyl and nitro;

R2 is selected from the group consisting of H, acyl, Cv5 acyloxy, Sm alkoxy, alkyl, Cin alkylcarboxamide, S1L alkylthiocarboxamide, Cv 4 alkylsulfinyl, Sm alkylsulfonyl, Sm alkylthio, amino, carbo-C 1-4 -alkoxy, carboxadmide, carboxy, cyano, C3N-cycloalkyl, S2-b dialkylcarboxamide, haloalkoxy, C14 haloalkyl, halogen, heteroaryl, hydroxy and phenyl; and wherein alkyl, heteroaryl and phenyl are optionally substituted with 1 to 5 substituents selected from the group consisting of CV5 acyl, C 1-6 acyloxy, Sm alkoxy, C 1-6 alkyl, Sm alkylamino, Sm alkylcarboxamide, Sm alkylthiocarboxamide, Sm alkylsulfonamide, Sm alkylsulfinyl, S14 alkylsulfonyl, Sm alkylthio, alkylthioureyl, Sm alkylureyl, amino, carbo-C1-6-alkoxy, carboxamide, carboxy, cyano, C3.s-cycloalkyl, C3N-cycloalkyl-C 1-6 heteroalkylene, S2with dialkylamino, C2.6 dialkylcarboxamide, C, _4 dialkylthiocaboxamide, C26

51174Β dialkylsulfonamide, Sm alkylthioureyl, Sm haloalkoxy, S14 haloalkyl, haloalkylsulfinyl, Cin haloalkylsulfonyl, C14 haloalkyl, haloalkylthio, halogen, heterocyclic, hydroxyl, hydroxylamino and nitro; or

R2 is -Ar2-With3 wherein Ag2 and Ar3 independently aryl or heteroaryl optionally substituted with 1 to 5 substituents selected from the group consisting of H, Cv5 acyl, acyloxy, Cu alkoxy, Om8 alkyl, Sm alkylcarboxamide, ΟΜ alkylthiocarboxamide, Sm alkylsulfinyl, alkylsulfonyl, Sm alkylthio, amino, carbo-C 1-4 -alkoxy, carboxamide, carboxy, cyano, C3_is-cycloalkyl, S2.b dialkylcarboxamide, Sm haloalkoxy, Sm haloalkyl, halogen, hydroxyl and nitro; or

R2 is a group of Formula (IIB):

where:

Ru ϊθ Cvs alkyl or Sz_6 cycloalkyl; and R15 is F, Cl, Br or CN; or R2 group

Formulas (IIC):

51174Β (PS) where:

G is 0 = 0, CR16R17, O, S, S (O), S (O)2; where R16 and R47 independently H or Cv8 alkyl; and Ar4 phenyl or heteroaryl is optionally substituted with 1 to 5 substituents selected from the group consisting of CVs acyl, acyloxy, Sm alkoxy, S,.8 alkyl, Sm alkylcarboxamide, Cv4 alkylthiocarboxamide, S14 alkylsulfonamide, Sc alkylsulfinyl, C4.4 alkylsulfonyl, S-alkylthio, S1H alkylthioureyl, Sm alkylureyl, amino, carboC1.6-alkoxy, carboxamide, carboxy, cyano, C3.is-cycloalkyl, S2.6 dialkylcarboxamide, dialkylthiocarboxamide, S2-b dialkylsulfonamide, S4.4 alkylthioureyl, Sm haloalkoxy, Sm haloalkyl, Sm haioalkylsulfinyl, C14 haloalkylsulfonyl, Sm haioalkyl, Sm haloalkylthio, halogen, heteroaryl, hydroxyl, hydroxylamino and nitro;

R3 is H, C 1-6 alkyl, S1h alkoxy or hydroxyl;

R4 is H or alkyl;

R9 is selected from the group containing S (.5 acyl, C 1-6 acyloxy, C 1-6 acyloxy2.6 alkenyl, alkoxy, Cv8 alkyl, Sm alkylcarboxamide, C2^ alkynyl, Cu alkylsulfonamide, C14 alkylsulfinyl, Sm alkylsulfonyl, Sm alkylthio, CV4 alkylureyl, amino, arylsulfonyl, carbo-C1-66-alkoxy, carboxamide, carboxy, cyano, C3^ cycloalkyl, C243 dialkylcarboxamide, halogen, CV4 haloalkoxy, Sm haloalkyl, Sm haloalkylsulfinyl, Sm haloalkylsulfonyl, C1.4 haloalkylthio, heterocyclic, heterocyclylsulfonyl, heteroaryl, hydroxyl,

51174 Β nitro, C4-7 oxo-cycloalkyl, phenoxy, phenyl, sulfonamide and sulfonic acid, and wherein acyl, alkoxy, S,.8 alkyl, Sm alkylsulfonamide, alkylsulfonyl, arylsulfonyl, heteroaryl, phenoxy and phenyl optionally substituted with 1 to 5 substituents independently selected from the group consisting of 0.55 acyl, acyloxy, Ον5 and alkynyl, Sm alkoxy, C 1-6 alkyl, alkylcarboxamide, S2-b alkynyl, alkylsulfonamide, alkylsulfinyl, C14 alkylsulfonyl, Sm alkylthio, CV4 alkylureyl, carbo-C 1-4 -alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C2.6 dialkylcarboxamide, halogen, haloalkoxy, CV4 haloalkyl, Sm haloalkylsulfinyl, Sm haloalkylsulfonyl, Sm haloalkylthio, heteroaryl, heterocyclic, hydroxyl, nitro and phenyl; or

Rg is a Formula Group (IID):

where:

"P" and "r" are independently 0, 1, 2 or 3; i

R18 is Η, 0ν5 acyl, O245 alkenes, 0μ6 alkyl, Sm alkylcarboxamide, C2.6 alkynyl, C2.6 and alkylsulfonamide, carbo-C 1-4 -alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C2.6 dialkylcarboxamide, halogen, heteroaryl or phenyl, and wherein the heteroaryl or phenyl is optionally substituted with 1 to 5 substituents selected independently from the group

51174 Β containing Sm alkoxy, S3.8 alkyl, amino, C14 alkylamino, S2.b alkynyl, C2-8 dialkylamino, halogen, S-haloalkoxy, Sm haloalkyl and hydroxyl; i

R10-R13 are independently selected from the group consisting of S3.5 acyl, C 1-6 acyloxy, S2-b alkenyl, Sm alkoxy, S3.8 alkyl, Sm alkylcarboxamide, C2. 6 alkynyl, C14 alkylsulfonamide, Sm alkylsulfinyl, CV4 alkylsulfonyl, alkylthio, Sm alkylureyl, amino, carbo-C1.6-alkoxy, carboxamide, carboxy, cyano, C3^ cycloalkyl, C2Dialkylcarboxamide, halogen, S1D haloalkoxy, Sm haloalkyl, Sm haloalkylsulfinif, Sm haloalkylsulfonyl, Sm haloalkylthio, hydroxyl and nitro; or two adjacent R10-R 11 groups form a 5-, 6- or 7-membered cycloalkyl, cycloalkenyl or heterocyclic group with Ar3 wherein the 5-, 6- or 7-membered group is optionally substituted with halogen.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 005555 includes the following compounds according to Formula (II) (hereinafter referred to as Group B1):

6 '- [4- (2-Methoxycarbonyl-acetyl) -phenoxy] -3'-nitro-3,4,5,6-tetrahydro-2H- [1,2'] bipyridinyl-4-carboxylic acid ethyl ester;

51174 Β

1- [4- (4-Acetyl-3'-nitro-3,4,5,6-tetrahydro-2H- [1,2 '] bipyridinyl-6'-yloxy) phenyl-ethanone;

6 '- [4- (4-Hydroxy-benzenesulfonyl) -phenoxy] -3'-nitro-3,4,5,6-tetrahydro-2H- [1,2'] bipyridinyl-4-carboxylic acid ethyl ester;

6 '- (4-imidazol-1-yl-phenoxy) -3'-nitro-3!4,5,6-tetrahydro-2H [1,2 '] bipyridinyl-4-carboxylic acid ethyl ester;

6 '- (Benzoyl-phenoxy) -3'-nitro-3,4,5,6-tetrahydro-2H- [1,2'] bipyridinyl-4-carboxylic acid ethyl ester;

6 '- [4- (2-Methoxy-ethyl) -phenoxy] -3'-nitro-3,4,5,6-tetrahydro-2H [1,2'] bipyridinyl-4-carboxylic acid ethyl ester ;

6 '- (4-Cyclopentyl-phenoxy) -3'-nitro-3,4,5>6-tetrahydro-2H [1,2 '] bipyridinyl-4-carboxylic acid ethyl ester; 6 '- (4,-Cyano-biphenyl-4-yloxy) -3'-nitro-3,4,5,6-tetrahydro-2H [1,2 '] bipyridinyl-4-carboxylic acid ethyl ester; 3'-Nitro-6,- (4-sulfo-phenoxy) -3,4,5)6-tetrahydro-2H- [1,2 '] bipyridinyl-4-carboxylic acid ethyl ester;

3'-Nitro-6 '- (4-pyrrol-1-yl-phenoxy) -3,4,5,6-tetrahydro-2H- [1,2'] bipyridinium-

4-carboxylic acid ethyl ester;

6 '- (4-Carbamoyl-phenoxy) -3'-nitro-3,415,6-tetrahydro-2H [1,2 '] bipyridinyl-4-carboxylic acid ethyl ester;

3'-Nitro-6 '- (4- [1,2,4] triazol-1-yl-phenoxy) -3,4,5,6-tetrahydro-2H [1,2'] bipyridinyl-4-carbon acid ethyl ester; 6,- (2-Aβ-4-ethylamino-N-Tepoxy) -3'-pyrrolo-3,4,5,6-ethyl-N-2H [1,2'-bipyridinyl-4-carboxylic acid ethyl ester;

3'-Nitro-6 '- [4- (4-oxo-cyclohexyl) -phenoxy] -3A5,6-tetrahydro-2H [1,2'] bipyridinyl-4-carboxylic acid ethyl ester; 6 '- (4'-Methoxy-biphenyl-4-yloxy) -3'-nitro-3,4,5,6-tetrahydro-2H [1,2'] bipyridinyl-4-carboxylic acid ethyl ester;

51174 Β

3'-Nitro-644- [1,2,3] thiadiazol-4-yl-phenoxy) -3,406-tetrahydro-2H [1,2 '] bipyridinyl-4-carboxylic acid ethyl ester;

6 '- [4- (1,3-Dioxo-1,3-dihydro-isoindol-2-yl) -phenoxy] -3'-nitro-3,4,5,6-tetrahydro-2H- [1,2'] bipyridinyl-4-carboxylic acid ethyl ester;

6 '- [4- (2,5-Dioxo-imidazolidin-4-yl) -phenoxy] -3'-nitro-3,4,5,6-tetrahydro-2H- [1,2'] bipyridinium-4-carboxylic acid ethyl ester;

3'-Nitro-6 '- [4- (3-oxo-butyl) -phenoxy] -3,4,5,6-tetrahydro-2H [1,2'] bipyridinyl-4-carboxylic acid ethyl ester;

3- [4- (3'-Nitro-4-propyl-3,4,5,6-tetrahydro-2H- [1,2 '] bipyridinyl-6'-yloxy) phenyl] -3-oxo-propionic acid methyl to be;

4- [4- (3'-Nitro-4-propyl-3,4,5,6-tetrahydro-2H- [1,2 '] bipyridinyl-6,-yloxy) phenyl] -butan-2-one;

4- {4- [3'-Nitro-4- (pyridin-2-ylsulfanyl) -3,4,5,6-tetrahydro-2H- [1,2 '] bipyridinyl-6'-yloxy] -phenyl} - butan-2-one; and 3'-Nitro-4- (pyridin-2-ylsulfanyl) -6 '- (4- [1,2,4] triazol-1-yl-phenoxy) -3,4,5,6tetrahydro-2H- [1 , 2 '] bipyridinyl.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 005555 includes the following compounds according to Formula (II) (hereinafter referred to as Group B2):

1- {5- [4- (2-Methoxycarbonyl-acetyl) -phenoxy] -2-nitro-phenyl} -piperidine-4-carboxylic acid ethyl ester;

1- [5-2-Amino-4-ethanesulfonyl-phenoxy) -2-nitro-phenyl] -piperidine-4-carboxylic acid ethyl ester;

1- {2-Nitro-5- [4- (3-oxo-butyl) -phenoxy] -phenyl} -piperidine-4-carboxylic acid ethyl ester;

4- {4- [4-Nitro-3- (4-propyl-piperidin-1-yl) -phenoxy] -phenyl} -butan-2-one;

1- {4- [4-Nitro-3- (4-propyl-piperidin-1-yl) -phenoxy} -phenyl} -ethanone;

51174 Β

3- {4- [4-Nitro-3- (4-propyl-piperidin-1-yl) -phenoxy] -phenyl} -3-oxopropionic acid methyl ester;

5-Ethanesulfonyl-2- [4-nitro-3- (4-propyl-piperidin-1-yl) -phenoxy] -phenylamine; {4- [4-Nitro-3- (4-propyl-piperidin-1-yl) 'phenoxy] -phenyl} -phenyl-methanone;

1- {4-Nitro-3- [4- (3-oxo-butyl) -phenoxy] -phenyl} -piperidine-4-carboxylic acid ethyl ester;

4- {4- [2-Nitro-5- (propyl-piperidin-1-yl) -phenoxy] -phenyl} -butan] -2-one;

1- [3 '(4-Benzoyl-phenoxy) -4-nitro-phenyl] -piperidine-4-carboxylic acid ethyl ester;

{4- [2-Nitro-5- (4-propyl-piperidin-1-yl) -phenoxy] -phenyl} -phenyl-methanone;

1- {5- [4- (2-Carboxy-ethyl) -phenoxy] -2-nitro-phenyl} -piperidine-4-carboxylic acid ethyl ester;

1- {5- [4- (2-Carboxy-2-oxo-ethyl) -phenoxy] -2-nitro-phenyl} -piperidine-4-carboxylic acid ethyl ester;

- [2-Nitro-5- (4-vinyl-phenoxy) -phenyl] -piperidine-4-carboxylic acid ethyl ester;

3- {4- [4-Nitro-3- (4-propyl-piperidin-1-yl) -phenoxy] -phenyl} -propionic acid;

3- {4- [4-Nitro-3- (4-propyl-piperidin-1-yl) -phenoxy] -phenyl} -2-oxopropionic acid;

1- [2'Nitro-5- (4-vinyl-phenoxy) -phenyl] -4-propyl-piperidine;

- {4- [4-Nitro-3- (4-propyl-piperidin-1-yl) -phenoxy] -phenyl} -butan-1-one;

1- {4- [4-Nitro-3- (4-propyl-piperidin-1-yl) -phenoxy] -phenyl} -pentan-1-one;

1- {4- [4-Nitro-3- (4-propyl-piperidin-1-yl) -phenoxy] -phenyl} -heskan-1-one;

4- {4- [3- (4-Methoxymethyl-piperidin-1-yl) -4-nitro-phenoxy] -phenyl} -butanone;

1- {4- [3- (4-Methoxymethyl-piperidin-1-yl) -4-nitro-phenoxy] -phenyl} -ethanone;

51174S {4- [3- (4-Methoxymethyl-piperidin-1-yl) -4-nitro-phenoxy] -phenyl} -phenylmethanone;

2- (3-Methyl- [1,2,4] oxadiazol-5-yl) -1- {4- [4-nitro-3- (4-propyl-piperidin-1-yl) -phenoxy] -phenyl} - ethanone;

4- (4- {3- [4- (3-Methyl- [1,2,4] oxadiazol-5-yl) -4-nitro-phenoxy} -phenyl) butan-2-one;

4- (4- {4-Nitro-3- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] -phenoxy} -phenyl) butan-2-one;

2- {1- [2-Nitro-5- (4- [1,2,4] triazol-1-yl-phenoxy) -phenyl] -piperidin-4-ylsulfanyl-pyridine;

2-Methyl-5- {4- [4-nitro-3- (4-pripyl-piperidin-1-yl) -phenoxy] -phenyl} -pyrazol-3-ol;

2- [4-Nitro-3- (4-propyl-piperidin-1-yl) -phenoxy] -5-trifluoromethyl-pyridine;

5-Bromo-2- [4-nitro-3- (4-pripyl-piperidin-1-yl) -phenoxy] -pyridine;

1- (4- {4-Nitro-3- [4- (pyridin-2-ylsulfanyl) -piperidin-1-yl] -phenoxy} -phenyl) ethanone;

2- {1- [5- (4-Methanesulfonyl-phenoxy) -2-nitro-phenyl] -piperidin-4-ylsulfanyl} pyridine;

1- {5- [4- (5-Methyl- [1,3,4] oxadiazol-2-yl) -phenoxy] -2-nitro-phenyl} -4-propylpiperidine;

1- {5- [3- (3-Methyl- [1,2,4] oxadiazol-5-yl) -phenoxy] -2-nitro-phenyl} -4-propylpiperidine.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 005555 includes the following compound according to Formula (II) (hereinafter referred to as Group B3):

5-Bromo-1- [4-nitro-3- (4-propyl-piperidin-1-yl) -phenyl] -1H-pyridin-2-one.

51174 Β

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 005555 includes the following compounds according to Formula (II) (hereinafter referred to as Group B4):

6'-Benzenesulfonylamino-3'-nitro-3,4,5,6-tetrahydro-2H- [1,2 '] bipyridinyl-4-carboxylic acid ethyl ester;

6 '- (Benzenesulfonyl-methyl-amino) -3'-nitro-3,4,5,6-tetrahydro-2H [1,2'] bipyridinyl-4-carboxylic acid ethyl ester;

6 '- (Benzenesulfonyl-butyl-amino) -3'-nitro-3,4,5,6-tetrahydro-2H [1,2'] bipyridinyl-4-carboxylic acid ethyl ester; 6 '- (5-Ethanesulfonyl-2-hydroxy-phenylamino) -3'-nitro-3,4,5,6-tetrahydro-2H- [1,2'] bipyridinyl-4-carboxylic acid ethyl ester;

6 '- (2-Bromo-4-trifluoromethyl-benzenesulfonylamino) -3'-nitro-3,4,5,6-tetrahydro-2H- [1,2'] bipyridinyl-4-carboxylic acid ethyl ester; {4- [3'-Nitro-4- (pyridin-2-ylsulfanyl) -3,4,5,6-tetrahydro-2H [1,2 '] bipyridinyl-6'-ylamino] -phenyl} -phenyl-methanone and [3'-Nitro-4- (pyridin-2-ylsulfanyl) -3,4,5,6-tetrahydro-2H- [1,2:] bipyridinyl-6'yl] - (4- (1,2,4] triazol-1-yl-phenyl) -amine.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 005555 includes the following compounds according to Formula (II) (hereinafter referred to as Group B5):

1- [5- (4-Benzoyl-phenylamino) -2-nitro-phenyl] -piperidine-4-carboxylic acid ethyl ester and (4- [4-Nitro-3- (4-propyl-piperidin-1-yl) -phenylamino] -phenyl} -phenyl-methanone.

Examples of GPR119 agonists are described in International Application no. PCT / US2004 / 022327 (published as WO 05/007647). It was discovered in

51174 Β international application no. PCT / US2004 / 022327 as a GPR119 agonist compound of Formula (III):

(W) where:

Α and B are each independently C 1-4 alkylene optionally substituted with 1 to 4 substituents selected from the group consisting of Ον3 alkyl, Sm alkoxy, carboxy, cyano, C1-63 haloalkyl and halogen;

D is 0, S, S (0), S (0)2, CR2R3 or NR2;

E is N, C or CR4;

- is a single bond when it is EN or CR4, or a double bond when EC;

νthe is selected from the group consisting of alkylene, ethynylene and Cb2 heteroalkylene optionally substituted with 1 to 4 substituents selected from the group consisting of C 1-3 alkyl, C 1-4 alkoxy, carboxy, cyano, C 1-3 haloalkyl and halogen; or Έ is a connection;

V2 is C3_6 cycloalkylene or C 1-3 alkylene each of which is optionally substituted with 1 to 4 substituents selected from the group consisting of

51174 Β

C 1-8 alkyl, (O4 alkoxy, carboxy, cyano, C 1-4 haloalkyl and halogen; or is V2 connection;

Wje NO5, 0, S, S (0) or S (0)2; or W is absent;

Q is NR6) 0, S, S (0) or S (0)2;

X is N or CR7;

Y is N or CR3;

Z is selected from the group consisting of (05 acyl, (05 acyloxy, C2.6 alkenyl, C 1-4 alkoxy, alkyl, Sm alkylcarboxamide, C2.6 alkynia, S.m alkylthiocarboxamide, Sm alkylsulfonamide, alkylsulfinyl, (04 alkylsulfonyl, C04 alkylthio, Sm alkylthioureyl, Sm alkylureyl, amino, (02 alkylamino, C2Dialkylamino, carbamimidoyl, carbo-C 1-4 alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C4.8 diacylamino, S2.b dialkycarboxamide, (06 dialkylthiocarboxamide, S2_b dialkylsulfonamide, S2_b dialkylsulfonylamino, formyl, Sm haloalkoxy, Sm haloalkyl, Sm haloalkylcarboxamide, Sn haloalkylsulfinyl, Sm haloalkylsulfonium, Sm haloalkylthio, halogen, aryl, heterocyclic, heteroaryl, hydroxyl, hydroxycarbamimidoyl, hydroxylamino, nitro and tetrazolyl, wherein (08 is alkyl, C3.7 cycloalkyl and heterocyclic each optionally substituted with 1, 2, 3 or 4 groups selected from the group consisting of acyl, (05 acyloxy, C1-4 alkoxy, (07 alkyl, Sm alkylcarboxamide, Sm alkylsulfonamide, C0 4 alkylsulfinyl, (0 alkylsulfonyl, Sm alkylthio, (04 alkylureyl, amino, (02 alkylamino, C2_4 dialkylamino, carbo-C 1-4 alkoxy, carboxamide, carboxy, cyano, formyl, haloalkoxy, Sm haloalkylsulfinyl, haloalkylsulfonyl, Sm haloalkylthio, halogen, hydroxyl, hydroxylamino and nitro, and wherein said (07 alkyl optionally substituted with amino;

51174Β or Z is a group of Formula (IIIA):

(SA) where:

Rg is H, (08 alkyl or (07 cycloalkyl; i

R10 is H, nitro or nitrile;

Ar-I is aryl or heteroaryl, each optionally substituted with R 1, R 212, R13, R4 and R15; wherein R-c is selected from the group consisting of (05 acyl, acylsulfonamide, C1-5 acyloxy, C2-6 alkenyl, Sm alkoxy, (08 alkyl, Sm alkylamino, S0b alkylcarboxamide, Sm alkylthiocarboxamide, C2.6 alkynyl, Sm alkylsulfonamide, S14 alkylsulfinium, alkylsulfonyl, S-m alkylthio, alkylthioureyl, Sm alkylureyl, amino, arylsulfonyl, carbamimidoyl, carbo- (06-alkoxy, carboxamide, carboxy, cyano, C0 7 cycloalkyl, C07 cycloalkyloxy, C2Dialkylamino, S06 dialkylcarboxamide, C2Dialkylthiocarboxamide, guanidinyl, halogen, St-4 haloalkoxy, S1L haloalkyl, Sm haloalkylsulfinyl, Sm haloalkylsulfonyl, Sm haloalkylthio, heterocyclic, heterocyclic-oxy, heterocyclylsulfonyl, heterocyclic-carbonyl, heteroaryl, heteroarylcarbonyl, hydroxyl, nitro, C07 oxo-cycloalkyl, phenoxy, phenyl, sulfonamide, sulfonic acid, and thiol, wherein (05 acyl, acylsulfonamide, Sm alkoxy, (08 alkyl, Sm alkylamino, C06

51174 Β alkylsulfonamide, Sm alkylsulfonyl, alkylthio, arylsulfonyl, carbamimidoyl, C2.6 dialkylamino, heterocyclic, heterocyclic-carbonyl, heteroaryl, phenoxy and phenyl optionally substituted with 1 to 5 substituents selected independently from the group consisting of C1-8.5 acyl, C1-5 acyloxy, C2^ alkenyl, C14 alkoxy, C-.7 alkyl, alkylamino, alkylcarboxamide, C2^ alkynyl, Sm alkylsulfonamide, C14 alkylsulfinyl, C% 4 alkylsulfonyl, Sm alkylthio, Sm alkylureyl, carbo-C 1-4 -alkoxy, carboxamide, carboxy, cyano, cycloalkyl, C3.7 cycloalkyloxy, C2.s dialkylamino, S2_b dialkylcarboxamide, halogen, S1h haloalkoxy, S-haloalkyl, Sm haloalkylsulfinyl, C14 haloalkylsulfonyl, Sm haloalkylthio, heteroaryl, heterocyclic, hydroxyl, nitro, phenyl, and phosphonooxy, wherein 0μ7 alkyl and Sm alkylcarboxamide optionally substituted with 1 to 5 substituents selected from the group consisting of Sm alkoxy and hydroxy; or

R 11 is a group of Formula (IIIB):

(ΠΙΒ) where:

"P" and "r" are each independently 0, 1, 2 or 3; and R16 is Η, Ον5 acyl, C2.6 alkenyl, alkyl, Cin alkylcarboxamide, C2.6 alkynyl, alkylsulfonamide, carbo-C 1-6 -alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C26 dialkylcarboxamide, halogen, heteroaryl or phenyl, and wherein the heteroaryl iii phenyl are optionally substituted with 1 to 5

51174Β substituents selected independently from the group consisting of Sm alkoxy, amino, CLJT alkylamino, C2_6 alkynyl, C2_8 dialkylamino, halogen, Sm haloalkoxy, Sm haloalkyl and hydroxyl; i

R12, R13, R14 and R15 are independently selected from the group consisting of C1-5 acyl, C1-6 acyloxy, C2.6 alkenyl, Sm alkoxy, C 1-6 alkyl, C 1-61J ( alkylcarboxamide, C2^ alkynyl, Sm alkylsulfonamide, Sm alkylsulfinyl, C-. 4 alkylsulfonyl, C14 alkylthio, Sm alkylureyl, carbo-C 1-6 -alkoxy, carboxamide, carboxy, cyano, C 3-7 cycloalkyl, C2.6 dialkylcarboxamide, halogen, haloalkoxy, Sm haloalkyl, Sm haloalkylsulfinyl, haloalkylsulfonyl, CV.4 haloalkylthio, hydroxyl and nitro; or two adjacent groups selected from the group consisting of R12, R13, R14 and R15 together with the atoms to which they are attached form a 5-, 6- or 7-membered cycloalkyl, cycloalkenyl or heterocyclic group attached to Αη, wherein the 5-, 6- and 7-membered groups are optionally substituted with halogen;

R1( R7 and R8 are each independently selected from the group consisting of H, acyloxy, C2.6 alkenyl, Sm alkoxy, C 1-6 alkyl, Sm alkylcarboxamide, C2. 6 alkynyl, Sm alkylsulfonamide, Sm alkylsulfinyl, Sm alkylsulfonyl, alkylthio, Sm alkylureyl, amino, C14 alkylamino, C2.8 dialkylamino, carboxamide, cyano, C3.7 cycloalkyl, S2.b dialkylcarboxamide, C26 dialkylsulfonamide, halogen, C14 haloalkoxy, Sm haloalkyl, haloalkylsulfinyl, Sm haloalkylsulfonyl, CM haloalkylthio and hydroxyl;

R2 is selected from the group consisting of C 1-6 alkyl, amino, aryl, carboxamide, carboxy, cyano, S3.b cycloalkyl, S1L haloalkoxy> C1-4

51174 Β ahaloalkyl, halogen, heteroaryl and hydroxyl; and wherein (0 alkyl, aryl and heteroaryl are optionally substituted with 1 to 5 substituents selected from the group consisting of (0 acyl, (0 acyloxy, C0 alkoxy, (0 alkyl, (0 4 alkylamino, (0 alkylcarboxamide, C0 alkylthiocarboxamide, C0 alkylsulfonamide, C0 alkylsulfinyl, C0 alkylsulfonyl, Sm alkylthio, C0 alkylthioureyl, C0 alkylureyl, amino, carbo-C1-6-alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, Sz.b cycloalkyl-03-heteroalkylene, C2.8 dialkylamino, S2.b dialkylcarboxamide, (0 dialkylthiocarboxamide, 0 dialkylsulfonamide, (0 alkylthioureyl, C0 haloalkoxy, 0 haloalkyl, (0 haloalkylsulfinyl, (0 haloalkylsulfonyl, C0 haloalkyl, (0 haloalkylthio, haloxy, hydroxy or heterocycloalkyl).

R2 is -Ar2-With3 where Ar2 and Ar3 each independently aryl or heteroaryl optionally substituted with 1 to 5 substituents selected from the group consisting of H, 0 acyl, (0 acyloxy, C0 alkoxy, C18 alkyl, O, .4 alkylcarboxamide, O0 alkylthiocarboxamide, C0 alkylsulfinyl, O0 alkylsulfonyl, (0 alkylthio, amino, C0 alkylamino, carbo-O-alkoxy, carboxamide, carboxy, cyano, C3.6 cycloalkyl, C2.8 dialkylamino, O dialkylcarboxamide, O haloalkoxy, O haloalkyl, halogen, hydroxyl and nitro; or

R2 is selected from the Formula Group (IIIC):

(SS)

51174 Β where:

Rv is H, C1-8 alkyl, C37 cycloalkyl, aryl, heteroaryl or OR19; and R18 is F, Cl, Br, CN or NR20R21; pd what R19 is H, Οχ8 alkyl or C3.7 cycloalkyl, and R20 and R21 are each independently H, Οχ8 alkyl, C3.7 cycloalkyl, aryl or heteroaryl; or R2 is a group of Formula (IIID):

where:

G is:

i) -C (O) -, -C (O) NR23-, -C (O) O-, -OO (O) NR23-, -NR23C (O) O-, -

OC (O) -, -C (S) -, -C (S) NR23-, -C (S) O-, -OC (S) -, -CR23R24-, -O-, -S-, -S (0) - or —S (0)2- when D CR2R3, or ii) -CR23R24C (O) -, -C (O) -, -CR23R24C (O) NO25-, -C (O) NO23-, O (O) O-, -C (S) -, -C (S) NR23-, -C (S) O-, -CR23R24-, -S (O) 2-, or a bond when D is NR2,

Where R23, R24 and R25 is each independently H or alkyl; and R22 is H, Shv alkyl, S2_6 alkynyl, Sz.7 cycloalkyl, phenyl, heteroaryl, or heterocyclic each optionally substituted with 1 to 5 substituents selected from the group consisting of Οχ5 acyl, CV5 acyloxy, C2.6 alkenyl, C1-4alkoxy, S%7 alkyl, Sm alkylamino, alkylcarboxamide, Sm alkylthiocarboxamide, O) .4 alkylsulfonamide, Sm alkylsulfinyl, C 1-4 alkylsulfonyl, Sm alkylthio, Ox 4 alkylthioureyl, Ci4 alkylureif, amino, carbo-C 1-4 alkoxy, carboxamide,

51174 Β carboxy, cyano, C3.7 cycloalkyl, C2.6 dialkylamino, C2.6 dialkylcarboxamide, C2.6 dialkylthiocarboxamide, C2.6 dialkylsulfonamide, Sm alkylthioureyl, haloalkoxy, Sm haloalkyl, C14 haloalkylsulfinyl, C14 haloalkylsulfonyl, Sm haloalkyl, haloalkylthio, halogen, heteroaryl, heterocyclic, hydroxyl, hydroxyamino, nitro, phenyl, phenoxy, and sulfonic acid, said alkyl, heteroaryl, phenyl and phenoxy each being optionally substituted with 1 to 5 substituents selected from the group consisting of 0μ5 acyl, Cv5 acyloxy, Cu alkoxy, C 1-8 alkyl, C 1-614 alkylamino, Sm alkylcarboxamide, Sm alkylthiocarboxamide, Sm alkylsulfonamide, Sm alkylsulfinyl, Sm alkylsulfonyl, Sm alkylthio, Sm alkylthioureyl, Sm alkylurea, amino, carboC1.6-alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C2_8 dialkylamino, C2.6 dialkylcarboxamide, C2.5 dialkylthiocarboxamide, C2-6 dialkylsulfonamide, Sm alkylthioureyl, C14 haloalkoxy, haloalkyl, haloalkylsulfinyl, Sm haloalkylsulfonyl, Sm haloalkyl, haloalkylthio, halogen, heterocyclic, hydroxyl, hydroxylamino and nitro;

R3 is H, C1-8 alkyl, Sm alkoxy or hydroxyl; i

R4, R5 and R6 are each independently H, alkyl or Sz.7 cycloalkyl, wherein said Ομ8 alkyl optionally substituted with Sm alkoxy, Sz_7 cycloalkyl, or heteroaryl.

51174 Β by applying various procedures that are very well known to experts in this field of science.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 022327 includes the following compounds according to Formula (III) (hereinafter referred to as Group C1):

3- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxymethyl] pyrrolidine-1-carboxylic acid tert-butyl ester;

4- [5-Cyano-6- (6-methylsulfanyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

4- [5-Cyano-6- (6-methanesulfonylpyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

[6- (1-Hexylpiperidin-4-yloxy) -5-nitro-pyrimidin-4-yl] - (4-methanesulfonylphenyl) -amine;

[6- (1-Cyclopripylmethyl-piperidin-4-yloxy) -5-nitro-pyrimidin-4-yl] - (4-methanesulfonyl-phenyl) -amine;

4- [6- (4-Methanesulfonyl-phenylamino-nitro-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] -piperidine-

1-Carboxylic acid 2-isopropyl-5-methyl-cyclohexyl ester;

{4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] -piperidin-1-yl} -pyrid and η-3-yl-methanone; (2-Chloro-pyridin-3-yl) - {4- [6- (4-methanesulfonyl-phenylamino) -5-nitropyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

{4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] -piperidin-1-yl} -pyridin-2-yl-methanone; (4-Methanesulfonyl-phenyl) - [6- (1-methanesulfonyl-piperidin-4-yloxy) -5-nitropyrimidin-4-yl] -amine;

51174 4 (4-Methanesulfonyl-phenyl) - {5-nitro-6- [1- (propane-1-sulfonyl) -piperidin-4-yloxy] -pyrimidin-4-yl} -amine;

[6- [1- (Butane-1-sulfonyl) -piperidin-4-yloxy] -5-nitro-pyrimidin-4-yl} - (4-methanesulfonyl-phenyl) -amine;

(4-Methanesulfonyl-phenyl) - {5-nitro-6- [1- (tofen-2-sulfonyl) -piperidin-4-yloxy] -pyrimidin-4-yl} -amine;

(4-Methanesulfonyl-phenyl) - {6- [1- (1-methyl-1H-imidazole-4-sulfonyl) piperidin-4-yloxy] -5-nitro-pyrimidin-4-yl} -amine;

{6- (1- (2,4-Dimethyl-thiazole-5-sulfonyl) -piperidin-4-yloxy] -5-nitro-pyrimidine-

4-yl} - (4-methanesulfonyl-phenyl) -amine;

4- [5-Cyano-6- (3-fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

4- [5-Cyano-6- (4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (6-Methanesulfonyl-pyridin-3-ylamino) -5-nitro-pyrimidin-4-yloxypiperidine-1-carboxylic acid tert-butyl ester;

4- [5-Acetyl-6- (6-methanesulfonyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

4- [5-Amino-6- (2-fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [5-Cyano-6- (4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [5-Cyano-6- (4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid ethyl ester;

4- [5-Cyano-6- (4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isobutyl ester;

51174Β

4- (4-Methanesulfonyl-phenylamino) -6- [1- (tetrahydrofuran-2-carbonyl) piperidin-4-yloxy] -pyrimidine-5-carbonitrile;

4- [1- (3,3-Dimethyl-2-oxo-butyl) -piperidin-4-yloxy] -6- (4-methanesulfonylphenylamino) -pyrimidine-5-carbonitrile;

4- (4-Methanesulfonyl-phenylamino) -6- [1- (pyridine-3-carbonyl) -piperidin-4-yloxy] -pyrimidine-5-carbonitrile;

4- (1-Formyl-piperidin-4-yloxy) -6- (4-methanesulfonyl-phenylamino) pyrimidine-5-carbonitrile and

4- (4-Methanesulfonyl) -phenylamino) -6- [1 ”(pyridine-2-carbonyl) -piperidin-4-yloxy] -pyrimidine-5-carbonitrile.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 022327 includes the following compounds according to Formula (!!!) (hereinafter referred to as Group 02):

4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] -piperidine-

1-carboxylic acid tert-butyl ester;

(4-Methanesulfonyl-phenylH5-nitro-6- (piperidin-4-yloxy) -pyrimidin-4-yl] amine;

1- {4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] piperidin-1-yl} -3,3-dimethyl-butan-1-one;

(4-Methanesulfonyl-phenyl) - [5-nitro-6- (1-pyridin-2-ylmethyl-piperidin-4-yloxy) pyrimidin-4-yl] -amine;

(4-Methanesulfonyl-phenyl) - [5-nitro-6- (1-pyridin-3-ylmethyl-piperidin-4-yloxy) pyrimidin-4-yl] -amine;

[6- [1- (3,3-Dimethyl-butyl) -piperidin-4-yloxy] -5-nitro-pyrimidin-4-yl} - (4-methanesulfonyl-phenyl) -amine;

(4-Methanesulfonyl-phenyl) - {6- [1- (3-methyl-butyl) -piperidin-4-yloxy] -5-nitropyrimidin-4-yl} -amino;

51174Β (4-Methanesulfonyl-phenyl) - [5-nitro-6- (3,4,5,6-tetrahydro-2H [1,2 '] bipyridinyl-4-yloxy) -pyrimidin-4-yl] -amine;

4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] -piperidine-

1-carboxylic acid ethyl ester;

1H {4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] piperidin-1-yl} -3,3-dimethyl-butan-2-one;

{6- [1- (2-Ethoxy-ethyl) -piperidin-4-yloxy] -5-nitro-pyrimidin-4-yl} - (4-methanesulfonyl-phenyl) -amine;

4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxymethyl] piperidine-1-carboxylic acid tert-butyl ester;

4- {2- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] -ethyl} piperidine-1-carboxylic acid tert-butyl ester;

3- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] -pyrrolidine-

1-carboxylic acid tert-butyl ester i

3- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxymethyl] pyrrolidine-1-carboxylic acid tert-butyl ester.

4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-ylamino] piperidine-1-carboxylic acid tert-butyl ester;

N- (4-Methanesulfonyl-phenyl) -5-nitro-N '-piperidin-4-yl-pyrimidin-416-diamine;

1- {4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-ylaminopiperidin-1-yl} -ethanone and

1- {4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-ylamino] piperidin-1-yl} -2,2-dimethyl-propan-1-one.

51174 Β

4- [6- (4-Cyano-2-fluoro-phenylamino) -5-ethynyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [5-Ethynyl-6- (2-fluoro-4- [1,2,4] triazol-1-yl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {5-Ethynyl-6- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyrimidin-4-ylamino} -3-fluoro-benzonitrile;

(5-Ethynyl-6- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyromidin-4-yl} - (2-fluoro-4-methanesulfonyl) -phenyl) -amine;

4- {6- [2,5-Difluoro-4- (2-methanesulfonyl-ethyl) -phenylamino] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

—*

4- {6- [2-Fluoro-4- (2-sulfamoyl-ethyl) -phenylamino] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [6- (2-Fluoro-ethyl) -2-methyl-pyridin-3-ylamino] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {2- (4-Fluoro-6- (2-isopropoxy-ethyl) -pyridin-3-ylamino] -3-methyl-pyridin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2,5-Difluoro-4- (2- [1,2,4] triazol-1-yl-ethyl) -phenylamino] -5-methylpyrimidin-4-yloxy} -piperidine-1-carbon isopropyl ester acid;

4- {5-Ethynyl-6- [2-fluoro-4- (4-methoxy-pyridin-2-yl) -phenylamino] -pyrimidine-

4-Yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-propionylsulfamoyl-ethyl) -phenylamino] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-methanesulfonyl-ethyl) -phenylamino] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester and

51174Β

4- {6- [2,3-Difluoro-4- (2-methanesulfonyl-ethyl) -phenylamino] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester.

445-Acetyl-6- (6-methanesulfonyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isobutyl ester;

1- [4- (1-Benzyl-azetidin-3-yloxy) -6- (6-methanesulfonyl-pyridin-3-ylamino) pyrimidin-5-yl] -ethanone;

4- [5-Cyano-6- (6-propylamino-pyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [5-Cyano-6- (2-fluoro-4-isopropylarnyno-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [5-Cyano-6- (2-fluoro-4-propylamino-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [5-Cyano-6- (2-fluoro-4-propoxy-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [5-Cyano-6- (6-propyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {5-Cyano-6- [4- (2-dimethylamino-ethylsulfanyl) -2-fluoro-phenylamino] pyrimidin-4-yloxy} -piepridine-1-carboxylic acid isopropyl ester; 4- {5-Cyano-6- [4- (2-dimethylamino-ethanesulfonyl) -2-fluoro-phenylamino] -3-oxy-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester; 4- {5-Cyano-6- [2-fluoro-4- (4-methylpiperazin-1-yl) -phenylamino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {5-Cyano-6- [2-fluoro-4- (3-methyl-butylamino) -phenylamino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

51174 Β

4- [5-Cyano-6- (2-fluoro-4-morpholin-4-yl-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- {5-Cyano-6- [4- (2-dimethylamino-ethylamino) -2-fluoro-phenylamino] pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester; 4- [5-Cyano-6- (4-dimethylamino-2-fluoro-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- {5-Cyano-6- [2-fluoro-4- (2-pyrrolidin-1-yl-ethylamino) -phenylamino] pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -5-methyl-pyridimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {5-Cyano-6- [2-fluoro-4- (2-morpholin-4-yl-ethylamino) -phenylamino] pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester; 4- [6- (2-Fluoro-4-iodo-phenylamino) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [5-Cyano-6- (2-fluoro-4-methanesulfonylphenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-morpholin-4-yl-phenylamino) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2,5-Difluoro-4-propoxy-phenylamino) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-propylamino-phenylamino) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-methoxy-ethylamino) -phenylamino] -5-methyl-pyrimidine-

4-Yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (6- {2-Fluoro-44 (tetrahydro-furan-2-ylmethyl) -amino] -phenylamino} -5-methyl-pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-methanesulfonyl-ethylamino) -phenylamino] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

51174 Β

4- (6- {2-Fluoro-4 - [(2-methanesulfonyl-ethyl) -methyl-amino] -phenylamino} -5-methyl-pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Bromo-2,5-difluoro-phenylamino) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester,

4- [6- (4-Cyano-2-fluoro-phenylamino) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Cyano-2,5-difluoro-phenylamino) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2,5-Difluoro-4-morpholin-4-yl · phenylamino) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (6-Chloro-2-methyl-pyridin-3-ylamino) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [5-Methyl-6- (2-methyl-6-morpholin-4-yl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [5- (4,5-Dihydro-1H-imidazol-2-yl) -6- (2-fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester ;

(2-Fluoro-4 ”methanesulfonyl-phenyl) - {6- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -5-methyl-pyrimidin-4-yl} -amine;

4- [6- (2-Fluoro-4-propoxy-phenylamino) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-methanesulfonyl-ethoxy) -phenylamino] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-methoxy-ethoxy) -phenylamino] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-isopropoxy-ethoxy) -phenylamino] -5-phenyl-pyrimidin-1-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

51174 Β

4- [6- (6-Chloro-4-methyl-pyridin-3-ylamino) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -5- (N-hydroxycarbamimidoyl) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [5-Carbamimidoyl-6- (2-fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (tetrahydro-furan-2-ylmethoxy) -phenylamino] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {5-Methoxy-ethoxy--2-methyl-pyridin-3-ylamino] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [6- (2-Methoxy-ethoxy) -4-methyl-pyridin-3-ylamino] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2,5-Difluoro-4- (2-methoxy-ethoxy) -phenylamino] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-isopropoxy-ethylsulfamoyl) -phenylamino] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester; 4- {6- [2,5-Difluoro [N-hydroxycarbamimidoyl) -phenylamino] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester; 4- [6- (4-Carbamoyl-2,5-difluoro-phenylamino) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- {6 - [(2-Fluoro-4-methanesulfonyl-phenyl) - (2-methoxy-ethyl) -amino] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Carbamimidoyl-2,5-difluoro-phenylamino) 5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [4- (2-Ethoxy-methoxy) -2-fluoro-phenylamino] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

51174 Β

4- {6- [2-Fluoro-4- (2-hydroxy-ethoxy) -phenylamino] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -pentan-1-one;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -3-methyl-butan-1-one;

4- {6- [2-Fluoro-4- (pyridin-2-ylaminoxy) -phenylamino] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [2- (2-Fluoro-4-methanesulfonyl-phenylamino) -3-methyl-pyridin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (6-Chloro-4-fluoro-pyridin-3-ylamino) -5-cyano-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester; i

4- [5-Amino-6- (2-fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester.

Specific examples of GPR119 agonists detected in International Application no. PCT / US2004 / 022327 include the following compound according to Formula (III) (hereinafter referred to as Group C6):

4 - ({[6- (2-Fluoro-4-methanesulfonyl-phenylamino) -5-methyl-pyrimidin-4-yl] isopropyl-amino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester.

4- (2-Fluoro-4-methanesulfonyl-phenoxy) -6- [1- (3-methoxy-propyl) -piperidin-4-yloxy] -5-methyl-pyrimidine;

51174 Β

1- {4- [6- (2-Rhylo-4-tetrafluoro) - (epoxy) -5-tert-pyrrolidin-1-yl] pyrrolidin-1-yl} -3-methoxy-propane -2-ol;

4- {6- [2-Fluoro-4- (5-isopropoxymethyl- [1,2,4] oxadiazol-3-yl) -phenoxy] -5methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl to be;

4- {6- [2-Fluoro-2- (5-methoxy-pyridin-2-yl) -phenoxy] -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [6- (2-Cyclopropoxy-ethylamino) -2-methyl-pyridin-3-yloxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester; 4- {6- [2-Fluoro-4- (pyridine-2-carboxy) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methanesulfonylaminopyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Methoxy-6'-methyl-3,4,5,6-tetrahydro-2H- [1l2 '] bipyridinyl-5'-yloxy) -

5-Methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid and isopropyl ester;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -2- (4-trifluoromethoxy-phenoxy) -propane- 1 -one;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -2- (4-trifluoromethoxy-phenoxy) -ethanone;

N- (4-Chloro-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yloxy] -piperidin-1-yl} -acetamide;

N- (3-Chloro-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yloxy] -piperidin-1-yl} -acetamide;

N- (3,5-Dichlorophenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -acetamide;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -N- (4-trifluoromethyl-phenyl) -acetamide;

51174 Β

2- {4- [6 (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl] -N-phenyl-acetamide;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -N- (4-isopropyl-phenyl) -acetamide;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -N- (4-methoxy-phenyl) -acetamide;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -N- (3-trifluoromethyl-phenyl) -acetamide;

4- {6- [2-Fluoro-4- (3-methoxy-propane-1-sulfonyl) -phenoxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [6- (2-Isopropoxy-ethyl) -2-methyl-pyridin-3-yloxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {5-Methyl-6- [2-methyl-6- (2-pyridin-2-yl-ethoxy) -pyridin-3-yloxy] -pyrimidine-

4-Yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4 '(thiophene-2-carbonyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} piperidine-1-carboxylic acid isopropyl ester;

4- (6- {6 - [(2-Isopropoxy-ethyl) -methyl-amino] -2-methyl-pyridin-3-yloxy} -5methyl-pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester ;

4- {6- [6- (2-Isopropoxy-ethanesulfonyl) -2-methyl-pyridin-3-yloxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [6 ~ (2-Hydroxy-ethanesulfonyl) -2-methyl-pyridin-3-yloxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (6-Amino-2-methyl-pyridin-3-yloxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-6- [1- (3-methyl-butyl) piperidin-4-yloxy] -pyrimidine;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-morpholin-4-yl-ethanone;

51174 Β

1- (3,4-Dichlorophenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

1- (3-Chloro-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yloxy] -piperidin-1'yl} -ethanone;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1-thiophen-3-yl-ethanone;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-phenyl-ethanone;

1- (2,4-Dimethoxy-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-4-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} - ethanone;

4- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-6- [1- (4-methyl-pentyl) piperidin-4-yloxy] -pyrimidine;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -3-isopropoxy-propan-1-one;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -4-isopropoxy-butan-1-one;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxypiperidin-1-yl} -3-hydroxy-propan-1-one;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1- (5-pyridin-2-yl-thiophene- 2-yl) -ethanone;

4- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-6- [1- (5-methyl-hexyl) piperidin-4-yloxy] pyrimidine;

3- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -3-oxo-propane-1-sulfonic acid;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl] -1-thiophen-2-yl-ethanone;

4- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-6- (1-pentyl-piperidin-4-yloxy) -pyrimidine;

51174Β

4- (1-Butyl-piperidin-4-yloxy) -6- (2-fluoro-4-methanesulfonyl-phenoxy) -5 "methyl-pyrimidine;

4- {4 '(6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -cyclohexanecarboxylic acid;

1- (4-Diethylamino-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

2- {4- [6- (2-Fluoro-4-methanesulfonylphenoxy) -5-methyl-pyrimidin-4-yloxypiperidin-1-yl} -1- (2-methyl-4-phenyl-furan-3-yl) -ethanone;

4- (2-Fluoro-4-methanesulfonyl · phenoxy) -6- (1-hexyl-piperidin-4-yloxy) -5-methyl-pyrimidine;

4- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -butyric acid;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -pentan-2-one;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -hexan-2-one;

1- {4- [6- (2-Fluoro-4 "methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -4-meto-pentan-2-one;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl) -5-methyl-hexan-2-one;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -6-methyl-heptan-2-one;

5- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -4-oxo-valeric acid;

5- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -4-oxo-pentanenitrile;

51174 Β

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -2-pyridin-2-yl-ethanone;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1-pyridin-4-yl-ethanone;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-ylmethyl} -acrylic acid;

1- [1,4] Dioxan-2-yl-2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yloxy] -piperidin-1-yl} -ethanone ;

1- (2,3-Dihydro- [1,4] dioxin-2-yl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] 1-piperidin-1-yl} -ethanone;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1-p-tol-yl-ethanone;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-1-yloxy] piperidin-1-yl} -1- (4-methoxy-phenyl) -ethanone;

1- (2-Chloro-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

3- (2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -acetyl) -benzonitrile;

1- (2,4-Dimethylphenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

1- (4-Chloro-3-methyl-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} - ethanone;

1 '(4-Difluoromethoxy-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) ~

5-Methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

1- (2,3-Dihydro-benzo [1,4] dioxin-6-yl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidine-4- yloxy] -piperidin-1-yl} -ethanone;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) '5-methyl-pyrimidin-4-yloxy] -piperidin-1- (5-phenyl-thiophen-2-yl) -ethanone;

51174 Β

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -1-thiophen-2-yl-ethanone;

[4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -acetic acid ethyl ester;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -3-methoxy-propan-2-ol;

4- (2-Fluoro-4-methanesulfonyl-phenoxy) -6- [1- (4-methoxy-cyclohexyl) piperidin-4-yloxy] -5-methyl-pyrimidine;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -hexan-1-one;

4- {6- [2-Fluoro-4- (2-isobutoxy-ethoxy) -phenoxy] -5-methyl-pyrimidin-4-hydroxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [4- (2-Cyclopropoxy-ethoxy) -2-fluoro-phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [4- (2-Ethoxy-ethoxy) -2-fluoro-phenoxy] -5-methylpyrimidin-4-yloxy} piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (3-methoxy-propoxy) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-pyridin-2-yl-ethoxy) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (tetrahydro-pyran-4-yloxy) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [4- (2-tert-Butoxy-ethoxy) -2-fluoro-phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester

4- [6- (2-Fluoro-4-sulfo-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2,5-Difluoro-4-trifluoromethoxy-phenoxy) -5-ethynyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

51174 Β

4- (6- (2,5-Difluoro-4-trifluoromethoxy-phenoxy) -5-prop-1-ynyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [5-Ethynyl-6- (2-fluoro-4-methoxy-phenoxy) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [5-Ethynyl-6- (6-methoxy-4-methyl-pyridin-3-yloxy) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- {5-Ethynyl-6- [6- (2-isopropoxy-ethyl) -2-methyl-pyridin-3-yloxy] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Cyano-2-fluoro-phenoxy) -5-ethynyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [5-Ethynyl-6- (2-fluoro-4- [1,2,4] triazol-1-yl-phenoxy) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

1- {4- (5-Ethynyl-6- (2-fluoro-4- [1,2,4] triazol-1-yl-phenoxy) -pyrimidin-4-yloxy] piperidin-1-yl} -3- pyridin-2-yl-propan-1-one;

4- {5-Ethynyl-6- [1- (3-isopropyl- (1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyrimidin-4-yloxy} -3-fluoro-benzonitrile;

5-Ethynyl-4- (2-fluoro-4-methanesulfonyl-phenoxy) -6- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -pyrimidine ;

4- (1- (3-Ethyl- (1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -5-ethynyl-6- (2-fluoro-4-methanesulfonyl-phenoxy) -pyrimidine;

4- [1- (3-Ethyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidine;

4- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-6- (1- (3-methyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -pyrimidine ;

4- [6- (2-Fluoro-4-methylenesulfonylamino-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

51174 Β

N- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] cyclohexyl-carbamic acid isopropyl ester;

Trans- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -cyclohexyl} -carbamic acid isopropyl ester;

N- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] cyclohexyl} -3-methyl-butyramide;

N- {4- [6- (2-Fluoro-4-methanesulfonyl'phenoxy) -5-methyl-pyrimidin-4-yloxy] cyclohexyl-isobutyramide;

4- {6- [2,5-Difluoro-4- (2-methanesulfonyl-ethyl) -phenoxy] -5-methyl-pyrimidin-4-hydroxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [4-Fluoro-6- (2-methanesulfonyl-ethyl) -pyridin-3-yloxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {5-Cyclopropyl-6- [2,5-difluoro-4- (2-hydroxy-ethyl) -phenoxy] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (5-Cyclopropyl-6- {2,5-difluoro-4- [2- (4-methoxy-piperidin-1-yl) -ethyl] phenoxy} -pyrimidin-4-yloxy) -piperidine-1-carbonic isopropyl ester acid;

4- {6- [2,5-Difluoro-4- (2-morpholin-4-yl-ethyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (6- {2-Fluoro-4- [2- (4-methoxy-piperidin-1-yl) -ethyl] -phenoxy} -5-methylpyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester ;

4- {6- [6- (2-Fluoro-ethyl) -2-methyl-pyridin-3-yloxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (1-hydroxy-cyclopropylmethyl) -phenoxy] -5-methylpyrimidin-44-oxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {2- [2,5-Difluoro-4- (2-methanesulfonyl-ethyl) -phenoxy] -3-methyl-pyridin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

51174 Β (R) -4- (6- {2-Fluoro-4- [2- (3-methoxy-piperidin-1-yl) -ethyl] -phenoxy} -5-methylpyrimidin-4-yloxy) -piperidin-1 -carboxylic acid isopropyl ester;

(S) -4- (6- {2-Fluoro-4- [2- (3-methoxy-piperidin-1-yl) -ethyl] -phenoxy} -5-methylpyrimidin-4-yloxy) -piperidin-1- carboxylic acid isopropyl ester;

(R) -4- (5-Ethynyl-6- {2-fluoro-4- [2- (2-methoxy-piperidin-1-yl) -ethyl] -phenoxy} pyrimidin-4-yloxy) -piperidin-1 -carboxylic acid isopropyl ester.

(S) -4- (2- {2-Fluoro-4- [2- (2-methoxy-piperidin-1-yl) -ethyl] -phenoxy} -3-methylpyridin-4-yloxy) -piperidin-1- carboxylic acid isopropyl ester;

4- {6- [4-Fluoro-6 '(2-morpholin-4-yl-ethyl) -pyridin-3-yloxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {5-Ethynyl-6- (4-fluoro-6- (2-methanesulfonyl-ethyl) -pyridin-3-yloxy] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4-{2-[2!5-Difluoro-4- (2-isopropoxy-ethyl) -phenoxy] -3-methyl-pyridin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-propionylsulfamoyl-ethyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-sulfamoyl-ethyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2,5-Difluoro-4- (2-sulfamoyl-ethyl) -phenoxy] -5-ethynyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2,5-Difluoro-4- (2- [1,2,4] triazol-1-yl-ethyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carbon isopropyl ester acid;

4- {6- [2,3-Difluoro-4- (2-methanesulfonyl-ethyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (2- {2-Fluoro-4- [2 "(6-methoxy-pyridin-2-yl) -ethyl] -phenoxy} -3-methyl-pyridin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester ;

4- (6- {2-Fluoro-4- [2- (3-methoxy-pyridin-2-yl) -ethyl] -phenoxy} -5-methylpyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester ;

51174 Β

4- [6- (3-Fluoro-1-oxy-pyridin-4-yloxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5'-methoxy-6-methyl- [2,2,Bipyridinyl-5-yloxy) -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {5-Ethynyl-6- [2-fluoro-4- (4-methoxy-pyridin-2-yl) -phenoxy] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (3-methoxy-pyridin-2-yl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (2,5-Difluoro-4- [2- (3-methoxy-piperidin-1-yl) ethyl] -phenoxy} -5-methyl · pyrimidin-4-yloxy) -piperidine-1-carbon Isopropyl ester of 4- (6- (2,5-Difluoro-4- [2- (3-methoxy-piperidin-1-yl) -ethyl] -phenoxy} -5-ethynylpyrimidin-4-yloxy) -piperidine -1-carboxylic acid isopropyl ester.

4- [6- (2-Fluoro-4-morpholin-4-yl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

(4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxypiperidin-1-yl} - [6- (2-pyrrolidin-1-yl-ethyl) -pyridin- 3-yl] -methanone;

(6-Amino-pyridin-3-yl) - (4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

4- [5-Ethyl-6- (2-fluoro-4-methanesulfonyl-phenoxy) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [6- (2-Isopropoxy-ethyl-amino) -2-methyl-pyridin-3-yloxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

51174 Β

4- {6- [6- (2-Hydroxy-ethylsulfanyl) -2-methyl-pyridin-3-yloxy] -5-methylpyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [5-Methyl-6- (2-methyl-6-pentyl-pyridin-3-yloxy) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1- (3-fluoro-phenyl) -ethanone;

4- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-medryl-6- [1- (2-pyridin-3-yl-ethyl) piperidin-4-yloxy] -pyrimidine;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1- (4-trifluoromethoxyphenyl) -ethanone;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1-pyridin-2-yl-ethanone;

4- {6- [6- (2-Methoxy-ethanesulfonyl) -2-methyl-pyridin-3-yloxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (2-Fluoro-4-methanesulfonyl-phenoxy) -6- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -5-methylpyrimidine;

4- (6- {2-Fluoro-4 - [(2-hydroxy-ethylcarbamoyl) -methyl] -phenoxy} -5-methylpyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5-Iodo-pyridin-2-yloxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- {2-Fluoro-4- [N- (2-isopropoxyethyl) -carbonimidoyl] -phenoxy} -5methyl-pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester; 4- [6- (4-Carboxy-2-fluoro-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (4-Bromo-2-fluoro-phenoxy) -6- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) piperidin-4-yloxy] -5-methyl-pyrimidine;

4- [6- (5-Methanesulfonyl-pyridin-2-yloxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

51174Β

4- {6- [6- (2-Hydroxy-ethylamino) -2-methyl-pyridin-3-yloxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [5-Cyclopropyl-6- (2-fluoro-4-methanesulfonyl-phenoxy) pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [6- (2-Methanesulfonyl-ethylamino) -2-methyl-pyridin-3-yloxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -4-oxo-butyric acid;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1- (3-trifluoromethyl-phenyl) -ethanone;

4- {6- [6- (2-Methoxy-ethylsulfanyl) -2-methyl-pyridin-3-yloxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

1- (2,5-Dimethoxy-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

2, {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -1-pyridin-2-yl-ethanone;

4- [6- (6-Chloro-2-methyl-pyridin-3-yloxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1- (4-fluoro-phenyl) -ethanone;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1- (4-trifluoromethylphenyl) -ethanone;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -3,3-dimethyl-butan-2-one;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine and 1-pyridin-3-yl-ethanone;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -butan-2-one;

100

51174 Β

4- (6- {2-Fluoro-4 - [(2-isopropoxyethylcarbamoyl) -methyl] -phenoxy} -5-methylpyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -1- (4-methanesulfonyl-phenyl) -ethanone;

1- (4-Chloro-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

4- (2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -acetyl) -benzonitrile;

1- (3,4-Difluoro-phenyl) -2- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

4- {6- [2-Fluoro-4- (2-isopropoxy-ethylcarbamoyl) -phenoxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester; 1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -butan-1-one;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -methyl-pyrimidin-4-yloxy] piperidin-1-yl] -pentan-1-one;

4- [6- (2,4-Difluoro-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -3-methyl-butan-1-one;

1- {4 ”[6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -4-methyl-pentan-1-one;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -5-methyl-hexan-1-one;

4- {6- [2-Fluoro-4- (2-methoxy-ethylcarbamoyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

101

51174 Β

4- [6- (4-Bromo-2-fluoro-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (methoxy-methyl-carbamoyl) -phenoxy] -5-methyl-pyridin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -3-methoxy-propan-1-one;

4- [6- (4-Cyano-2-fluoro-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [5- (5-Aminomethyl-4,5-dihydro-oxazol-2-yl) -6- (2-fluoro-4-methanesulfonyl-phenoxy) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester ;

4- {6- [6- (2-Methoxy-ethylamino) -2-methyl-pyridin-3-yloxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [6- (3-Methanesulfonyl-pyrrolidin-1-yl) -2-methyl-pyridin-3-yloxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester; 4- [6- (6-Benzylamino-2-methyl-pyridin-3-yloxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Carbamoyl-2-fluoro-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-isopropoxy-ethylamino) -phenoxy] -5-methyl-pyrimidin-4-hydroxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (6- {2-Fluoro-4 - [(tetrahydro-furan-2-ylmethyl) -amino] -phenoxy} -5-methylpyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

4- (6- {6 - [(2-Methanesulfonyl-ethyl) -methyl-amino] -2-methyl-pyridin-3-yloxy} -5-methyl-pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester ; 4- [6- (2-Fluoro-4-hydroxycarbamoyl-phenoxy) -5-methyl-pyrininidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

102

51174 Β

4- {6- [2-Fluoro-4- (2-pyrrolidin-1-yl-ethylcarbamoyl) -phenoxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (4-isopropyl-piperazine-1-carbonyl) -phenoxy] -5-methylpyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-morpholin-4-yl-ethyl) -phenoxy] -5-methyl-pyrimidin-4-oxyxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-methanesulfonyl-ethyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-hydroxy-ethyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Carboxymethyl-2-fluoro-phenoxy) -methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Dimethylcarbamoylmethyl-2-fluoro-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-sulfamoyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-propionylsulfamoyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [5-Ethynyl-6- (2-fluoro-4-methanesulfonyl-phenoxy) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2-phosphonooxy-ethyl) -phenoxy] -5-methyl-pyrimidin-4-hydroxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [5-Bromo-6- (2-fluoro-4-methanesulfonyl-phenoxy) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- (6 ~ {2-Fluoro-4- [2- (2-methanesulfonyl-pyrrolidin-1-yl) -2-oxo-ethyl] phenoxy} -5-methyl-pyrimidin-4-yloxy) -piperidin-1 -carboxylic acid isopropyl ester;

103

51174 Β

4- [6- (4-Carbamoylmethyl-2-fluoro-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4 - {[(tetrahydro-furan-2-ylmethyl) -carbamoyl] -methyl} phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl to be;

4- [6- (2-Fluoro-3-sulfamoyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-

1-carboxylic acid isopropyl ester;

C- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} -C- (4-fluoro-phenyl) -methylene-amine ;

3-tert-Butoxy-1- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yloxy] -piperidin-1-yl} -propan-1-one;

2-Ethoxy-1- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

{4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidin-1-yl} - (tetrahydro-furan-2-yl) -methanone;

(S) -1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -3-methyl-2-methylamino-butane -1-one;

4- (6- {2-Fluoro-4- [2- (3-hydroxy-piperidin-1-yl) -2-oxo-ethyl] -phenoxy} -5methyl-pyrimidin-4-yloxy) -piperidin-1- carboxylic acid isopropyl ester; 4- {6- [2-Fluoro-4- (2-morpholin-4-yl-2-oxo-ethyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [6- [2-Fluoro-4- (2-imidazol-1-yl-ethyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2-Fluoro-4- (2- [1,2,3] triazol-1-yl-ethyl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl to be;

(R) -1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -3-methyl-2-methylamino-butane- 1 -one;

104

51174 Β (S) -1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -3-hydroxy-butan-1-one ;

(R) -N- (1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carbonyl} -2-methyl-propyl) - acetamide;

(S) -N- (1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carbonyl} -2-methylpropyl) -2-acetamide;

(R) -N- (2- [4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-oxy] -piperidin-1-yl} -1-methyl-2-oxo -ethyl) -acetamide;

(S) -N- (2- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -1-methyl-2-oxo -ethyl) -acetamide;

4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid (S) -tetrahydro-furan-3-yl ester;

4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid (R) -tetrahydro-furan-3-yl ester;

4- [6- (2-Amino-4-ethanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

(1- {4- [6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] piperidine-1-carbonyl} -2-methyl-propyl) -carbamic acid tert-butyl I am;

4- {6- [2-Fluoro-4- (6-methoxy-pyridin-3-yl) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

3-Amino-1- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -4-methyl-pentan-1-one;

2-Amino-1- {4- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -3-methyl-butan-1-one;

105

51174 Β

4- {6- [2-Fluoro-4- (2-isopropoxy-ethoxy) -phenoxy] -5-methyl-pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester; and 445-Methyl-6- (4-sulfo-phenoxy) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester.

4 - ({Cyclopropyl- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yl] -amino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({Cyclopropyl- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yl] -amino} -methyl) -piperidine-1-carboxylic acid isopropyl ester;

4 - ({[6- (2-Fluoro-4-methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yl] isopropyl-amino] -methyl) -piperidine-1-carboxylic acid isopropyl ester; and 4 - ({Cyclopropylmethyl- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yl] -amino} -methyl) -piperidine-1-carboxylic acid isopropyl ester.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 022327 includes the following compound according to Formula (III) (hereinafter referred to as Group 010):

4- [6- (2-Fluoro-4-methanesulfonyl) -5-methyl-pyrimidin-4-ylsulfanyl] -piperidine-1-carboxylic acid isopropyl ester.

Examples of GPR119 agonists are described in International Application no.

PCT / US2004 / 022417 (published as WO 05/007658). It was discovered in international application no. PCT / US2004 / 022417 as a GPR119 agonist compound of Formula (IV):

106

51174 Β

where:

Α and Β are each independently Ci.3 alkylene optionally substituted with 1 to 4 substituents selected from the group consisting of CV3 alkyl, S1L alkoxy, carboxy, cyano, Cv3 haloalkyl and halogen;

D is 0, S, S (0)2, CR ^ ž'ili NR2, wherein R3 selected from the group containing Η, ΟμΒ alkyl, Sm alkoxy, halogen and hydroxyl;

E is N, C or CR3, pir what is R3 H or alkyl;

- is a single bond when E is N or CR3, or a double bond when E is C;

K is C3.6 cycloalkylene or alkylene each optionally substituted with 1 to 4 substituents selected from the group consisting of

C1-3 alkyl, Sm alkoxy, carboxy, cyano, C4.3 haloalkyl and halogen; or K is a bond;

Q is NR4, 0, S, S (0) or S (0)2, pir what is R4 H or Ci_B alkyl and C1-68 and C4alkyl is optionally substituted with S2- with dialkylamine;

T is N or CR5;

107

51174Β

Μ is Ν or CR6;

J is Ν or CR7;

UjeCiliN;

V is N, CR8 or V is a bond;

W is N or C;

H is O, S, N, CR 9 or NR 2;

Y is 0, S, N, CR10 or NR12;

Z is C or N;

R5, R7. Rs. R9 · R10are independently selected from the group containing

H, O ^ 5 acyloxy, S2_b alkenyl, alkoxy, C1-68 alkyl, Cr4 alkylcarboxamide, C2_6 alkynyl, Sm alkylsulfonamide, Sm alkylsulfinyl, alkylsulfonyl, Sm alkylthio, Sm alkylureyl, amino, Sm alkylamino, C2 8 dialkylamino, carboxamide, cyano, Sz_6 cycloalkyl, C2.6 dialkylcarboxamide, S2-b dialkylsulfonamide, halogen, Sm haloalkoxy, Sm haloalkyl, Sm haloalkylsulfinyl, Sm haloalkylsulfonyl, C1-64 haloalkylthio, hydroxyl, hydroxylamino and nitro; wherein C2.

alkenyl, S-.8 alkyl, C2^ alkynyl, and C3.6 cycloalkyl optionally substituted with

I, 2, 3 or 4 substituents selected from the group consisting of Cv5 acyl, CV5 acyloxy, 014 alkoxy, Cu alkylamino, Sm alkylcarboxamide, Sm alkylthiocarboxamide, Sm alkylsulfonamide, Sm alkylsulfinyl, S-alkylsulfonyl, C1-4 alkylthio, Sm alkylthiourea !, C14 alkylureyl, amino, carboC1-alkoxy, carboxamide, carboxy, cyano, C2.8 dialkylamino, Ο2.6 dialkylcarboxamide, Sm dialkylthiocarboxamide, dialkylsulfonamide, Sm alkylthioureyl, Sm haloalkoxy, Sm haloalkyl, S14 haloalkylsulfinyl, C1-4 haloalkylsulfonyl, haloalkyl, Sm haloalkylthio, halogen, hydroxyl, hydroxylamino and nitro;

108

51174 Β

Rn and R12 are each independently selected from C2.6 alkenyl, C 1-6 alkyl, C 1-6 alkyl2.6 alkynyl or C3.6 cycloalkyl each independently substituted with 1, 2, 3 or 4 substituents selected from the group consisting of acyl, acyloxy, alkoxy, Sm alkylamino, alkylcarboxamide, Ομ4 alkylthiocarboxamide, alkylsulfonamide, C14 alkylsulfinyl, C1-6.4 alkylsulfonyl, Sm alkylthio, C-4 alkylthioureyl, Sm alkylureyl, amino, carboC1-alkoxy, carboxamide, carboxy, cyano, C2.8 dialkylamino, C2.6 dialkylcarboxamide, dialkylthiocarboxamide, C2_6 dialkylsulfonamide, Sm alkylthioureyl, Sm haloalkoxy, Sm haloalkyl, Sm haloalkylsulfinyl, C 1-4 haloalkylsulfonyl, C 1-4 haloalkyl, C 1-414 haloalkylthio, halogen, hydroxyl, hydroxylamino and nitro;

Ag! is aryl or heteroaryl each optionally substituted with R13, R14, R15l R16 and R17; where R13 selected from the group consisting of 67.5 acyl, Ομ5 acylsulfonamide, 07.5 acyloxy, C2.6 alkenyl, alkoxy, 07.3 alkyl, S1h alkylamino, alkylcarboxamide, Cb4 alkylthiocarboxamide, S2.b alkynyl, S1L alkylsulfonamide, C 1-6 alkylsulfinyl, C 1-4 alkylsulfonyl, alkylthio, ClJ ( alkylthioureyl, alkylureyl, amino, arylsulfonyl, carbamimidoyl, carbo-C7-6-alkoxy, carboxamide, carboxy, cyano, C3. 7 cycloalkyl, C2Dialkylamino, C2.6 dialkylcarboxamide, CLJT dialkylthiocarboxamide, guanadinyl, halogen, haloalkoxy, ¢ 7.4 haloalkyl, haloalkylsulfinyl, C74 haloalkylsulfonyl, Sm haloalkylthio, heterocyclic, heterocyclicoxy, heterocyclyxulfonyl, heterocycliccarbonyl, heteroaryl, heteroarylcarbonyl, hydroxyl, nitro, C4.7 oxocycloalkyl, phenoxy, phenyl, sulfonamide, sulfonic acid and thiol, wherein said 07.5 is acyl, (\5 acylsulfonamide, alkoxy, S18 alkyl, Sm alkylamino, C7-6 alkylsulfonamide, C7_6 alkylsulfonyl, C1-64 alkylthio, arylsulfonyl, carbamimidoyl, S2dialkylamino, heterocyclic,

109

51174Β Heterocyclic-carbonyl, heteroaryl, phenoxy and phenyl optionally substituted with 1 to 5 substituents independently selected from the group consisting of acyl, C1-6 acyloxy, S2-b alkenyl, Sm alkoxy, C-.7 alkyl, C 1-6 alkylM alkylamino, Sm alkylcarboxamide, C2.6 alkynyl, alkylsulfonamide, Cb 4 alkylsulfinyl, S1H alkylsulfonyl, Sm alkylthio, C 1-4 alkylureyl, carbo-C 1-4 alkoxy, carboxamide, carboxy, cyano, C3.7 cycloalkyl, C3.7 cycloalkyloxy, C2.6 dialkylamino, S2-e dialkylcarboxamide, halogen, C14 haloalkoxy, Sm haloalkyl, Sm haloalkylsulfinyl, C14 haloalkylsulfonyl, haioalkylthio, heteroaryl, heterocyclic, hydroxyl, nitro, phenyl and phosphonooxy, wherein C1-7 alkyl and Sm alkylcarboxamide each optionally substituted with 1 to 5 substituents selected from the group consisting of C 1-4 alkoxy and hydroxy; or

R13 is a group of formula (IVA):

(VAT) where:

"P" and "r" are each independently 0, 1, 2 or 3; i

Ris is H, C-_5 acyl, S2_b alkenyl, C1-5 alkyl, S1L alkylcarboxamide, C2.6 alkynyl, alkylsulfonamide, carbo-C16-alkoxy, carboxamide, carboxy, cyano, cycloalkyl, C2.6 dialkylcarboxamide, halogen, heteroaryl or phenyl, wherein said heteroaryls and phenyl are optionally substituted with 1 to 5 substituents selected independently from the group

110

51174 Contains containing (04 alkoxy, amino, Sm alkylamino, C26 alkynyl, C2.g dialkylamino, halogen, Sm haloalkoxy, Sm haloalkyl and hydroxyl;

R14, R15, R16 and R17 are each independently selected from the group consisting of C05 acyl, (05 acyloxy, (06 alkenyl, Sm alkoxy, C 1-6 alkyl alkylcarboxamide, (C 1-6 alkynyl, C 1-4 alkylsulfonamide. C 1-4 alkylsulfinyl, (O 4 alkylsulfonyl, Sm alkylthio, Cin alkylureyl, carbo-C 1-4 -alkoxy, carboxamide, carboxy, cyano, (07 cycloalkyl, (06 dialkylcarboxamide, halogen, Sm haloalkoxy, Sm haloalkyl, Sm haloalkylsulfinyl, C14 haloalkylsulfonyl, haloalkylthio, hydroxyl and nitro; or two adjacent R14, R15, R16 and R17 together with the atoms to which they are attached form a 5-, 6- or 7-membered cycloalkyl, cycloalkenyl, or heterocyclic group fused to Aq wherein the 5-, 6- and 7-membered groups are optionally substituted with halogen; i

R2 is selected from the group containing (08 alkyl, C2.6 alkynyl, amino, aryl, carboxamide, carboxy, cyano, C3^ cycloalkyl, Sm haloalkoxy, Sm haloalkyl, halogen, heteroaryl and hydroxyl; and where they are listed (08 alkyl, aryl and heteroaryl each optionally substituted with 1 to 5 substituents selected from the group consisting of (05 acyl, (05 acyloxy, Sm alkoxy, (08 alkyl, Sm alkylamino, Sm alkylcarboxamide, (04 alkylthiocarboxamide, (04 alkylsulfonamide, Sm alkylsulfinyl, C04 alkylsulfonyl, S-alkylthio, Sm alkylthioureyl, (04 alkylureyl, amino, carboC06-alkoxy, carboxamide, carboxy, cyano, C3N-cycloalkyl, (O6cycloalkyl- (03-heteroalkylene, C2.8 dialkylamino, S2.b dialkylcarboxamide, C2.6 dialkylthiocarboxamide, O24= dialkylsulfonamide, C0 alkylthioureyl, C1-4 haloalkoxy, C1-4 haloalkyl, Sm haloalkylsulfinyl,

111

51174 Β (04 haloalkylsulfonyl, Sm haloalkyl, S1H haloalkylthio, halogen, heterocyclic, hydroxyl, hydroxylamino and nitro; or

R2 is -Ar2-With3 wherein Ag2 and Ar3 each independently aryl or heteroaryl each optionally substituted with 1 to 5 substituents selected from the group consisting of H, (05 acyl, C05 acyloxy, Cu alkoxy, alkyl, (0 4 alkylcarboxamide, Sm alkylthiocarboxamide, Sm alkylsulfinyl, Sm alkylsulfonyl, Sm alkylthio, amino, Sm alkylamino, carbo-C 1-4 -alkoxy, carboxamide, carboxy, cyano, C3.is cycloalkyl, C2.8 dialkylamino, C2 6 dialkylcarboxamide, Sm haloalkoxy, Sm haloalkyl, halogen, hydroxyl and nitro; or

R2 is a group of formula (IVC):

J.R19 (IVB) where:

R19 is H, C1-8 alkyl, C07 cycloalkyl, aryl, heteroaryl or OR2bi R2o is F, Cl, Br, CN or NR22R23; where R2and H, S0b alkyl or C3.7 cycloalkyl, and R22 i

R23 are independently H, (08 alkyl, C3.7 cycloalkyl, aryl or heteroaryl;

R2 is a group of formula (IVC):

112

51174Β (IVC) where:

G is:

i) -O (O) -, -C (O) NR25-, NO25C (O) -, -NR25-, -NR25C (O) O-, OC (O) NR25-, -CR25R26NO27C (O) -, -CR25R2S-C (O) NO27-, 0 (0) 0-, -00 (0) -, -C (S) -, -C (S) NR25-, -C (S) O-, -OC (S) -, CR25R26-. -0-, -3-, -S (0) -, -S (0)2- or connection when D CR2R3, or ii) -CR25R26C (O) -, -O (O) -, -CR25R2SC (O) NO27-, -C (O) NO25-, O (O) O-, -C (S) -, -C (S) NR25-, -C (S) O-, -CR25R26-, -S (O) 2-, or a bond when D is NR2;

Where R25, R26 and R27each independently X or Οχ8 alkyl; and R24 is H, Shz alkyl, Οχ7 cycloalkyl, phenyl, heteroaryl, or heterocyclic each optionally substituted with 1 to 5 substituents selected from the group consisting of 0x5 acyl, 0x5 acyloxy, C2.6 alkenyl, S1H alkoxy, Ox7 alkyl, Sm alkylamino, Sm alkylcarboxamide, Sm alkylthiocarboxamide, alkylsulfonamide, Sm alkylsulfinyl, Ox4 alkylsulfonyl, Sm alkylthio, 0χ4 alkylthioureyl, Sm alkylureyl, amino, carbo-Cx6-alkoxy, carboxamide, carboxy, cyano, Sz_7 cycloalkyl, C2.8 dialkylamino, C2.6 dialkylcarboxamide, Ox4 dialkylthiocarboxamide, C2_6 dialkylsulfonamide, 0χ4 alkylthioureyl, haloalkoxy, Οχ4 haloalkyl, Ox4 haloalkylsulfinyl, Sc haloalkylsulfonyl, Οχ4 haloalkyl, haloalkylthio, halogen,

113

51174Β heteroaryl, heterocyclic, hydroxyl, hydroxylamino, nitro, phenyl, phenoxy, and sulfonic acid, wherein S ism alkoxy, C07 alkyl, (04 alkylamino, heteroaryl, phenyl and phenoxy each optionally substituted with 1 to 5 substituents selected from the group consisting of (05 acyl, Cb5 acyloxy, (04 alkoxy, (C 1-6 alkyl, (O4 alkylamino, Sm alkylcarboxamide, (04 alkylthiocarboxamide, Sm alkylsulfonamide, C0 alkylsulfinyl, (04 alkylsulfonyl, Cin alkylthio, Sm alkylthioureyl, C04 alkylureyl, amino, carbo (06-alkoxy, carboxamide, carboxy, cyano, Sz_7 cycloalkyl, S2.z dialkylamino, (06 dialkylcarboxamide, Sm dialkylthiocarboxamide, C2.q dialkylsulfonamide, Sm alkylthioureyl, Sm haloalkoxy, Sm haloalkyl, haloalkylsulfinyl, C04 haloalkylsulfonyl, Sm haloalkyl, (04 haloalkylthio, halogen, heterocyclic, hydroxyl, hydroxylamino, nitro and phenyl;

Provided that Z and U are not both N.

Specific examples of GPR119 agonists disclosed in International Application no. PCTAJS2004 / 022417 including the following compounds according to Formula (IV) (hereinafter referred to as Group D1):

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

114

51174 Β

4- [1 (4-Methanesulfonyl-phenyl) -3-methyl-1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [1 (4-Methanesulfonyl-phenyl) -3,6-dimethyl-1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [1 (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isobutyl ester;

4- [1 (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

1- (4-Methanesulfonyl-phenyl) -4- (piperidin-4-yloxy) -1H-pyrazolo [3,4-d] pyrimidine;

{4- [1- (Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} -pyridin-3-yl-methanone;

(3-Fluoro-phenyl) - {4- [1 '(4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

(1-tert-Butyl-5-methyl-1H-pyrazol-4-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

(5-tert-Butyl-2-methyl-2H-pyrazol-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine -1-yl} -methanone;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] piperidine-1-carboxylic acid tert-butyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] piperidine-1-carboxylic acid isopropyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] piperidine-1-carboxylic acid isobutyl ester;

Furan-2-yl- {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (1-methyl-1H-pyrrol-2-yl) -mecanon;

115

51174 Β

2- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1,4} -1-pyridin-3-yl-ethanone;

2- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-pyridin-2-yl-ethanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxypiperidin-yl} - (5-methyl-pyridin-3-yl) -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (2-methyl-pyridin-3-yl) -methanone ;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (6-methyl-pyridin-3-yl) -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (5-methyl-isoxazol-3-yl) -methanone;

2- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3!4-d] pyrimidin-4-yloxy] piperidin-1-yl} -1-thiophen-2-yl-ethanone;

4- (1-Benzyl-azetidin-3-yloxy) -1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidine;

3- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] piperidine-1-carboxylic acid tert-butyl ester;

- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} -3,3-dimethyl-butan-2-one;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} -pyrazin-2-yl-methanone;

[4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (5-methyl-pyrazin-2-yl) -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} -pyrimidin-5-yl-methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} -pyridazin-4-yl-methanone;

116

51174S {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} -thiophen-2-yl-methanone;

(3,4-Dimethyl-isoxazol-5-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [1-pyridin-1-yloxy] -piperidin-1-yl] -methanone;

3-tert-Butoxy-1- {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -propan-1-one ;

(3- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} -3-oxo-propyl) -methyl-carbamine tert-butyl ester acid;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3l4-D] Pyrimidin-4-yloxy] piperidin-1-yl} - (6-trifluoromethyl-pyridin-3-yl) -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamine] cyclohexyl} -carbamic acid tert-butyl ester;

N- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] cyclohexane-1,4-diamine;

[4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (4-methyl- [1,2,3] thiadiazole -5-yl) -methanone;

(3,5-Dimethyl-isoxazol-4-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1- yl} -methanone;

(2,5-Dimethyl-2H-pyrazol-3-yl) - (4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl } -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (3-methyl-isoxazol-5-yl) -methanone ;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-thiocarboxylic acid pyridin-4-ylamide;

N- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] cyclohexyl-nicotinamide;

117

51174 Β

3-tert-Butoxy-N- {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-ylamine] cyclohexyl} -propionate;

[4- [1- (4-Methanesulfonylphenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] cyclohexyl} -carbamic acid tert-butyl ester;

(3,5-Dimethyl-isoxazol-4-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} - methanone;

4- [1- (3,5-Bis-Trifluoromethyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

3- [1- (4-Methanesulfonylphenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] azetidine-1-carboxylic acid isopropyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid butyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid propyl ester;

4- [1- (3-Fluoro-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [1- (2,4-Difluoro-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

{4- [1- (2,4-Fluoro-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] cyclohexyl-carbamic acid tert-butyl ester;

{4- [1- (3-Fluoro-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] cyclohexyl-carbamic acid tert-butyl ester;

N- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] cyclohexane-1,4-diamine;

{3- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] piperidin-1-yl} - (6-methyl-pyridin-3-yl) -methanone ;

{3- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] piperidin-1-yl} - (2-methyl-pyridin-3-yl) -methanone ;

118

51174 3- [3- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] piperidin-1-yl} - (5-methyl-pyridin-3-yl) - methanone;

[3- [1- (4 “Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] piperidin-1-yl} -pyridin-3-yl-methanone;

{3- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] piperidin-1-yl} - (1-methyl-1H-pyrrol-3-yl) -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4'-d] pyrimidin-4-yloxy] cyclohexyl-carbamic acid tert-butyl ester;

N- [1- (2,4-Difluoro-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -cyclohexane-

1,4-diamine;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (4-trifluoromethyl-pyridin-3-yl) -methanone ;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid cyclohexyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid tetrahydro-pyran-4-yl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid cyclopentyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid tetrahydro-furan-3-yl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid tetrahydro-thiopyran-4-yl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid cyclobutyl ester;

(6-tert-Butyl-pyridin-3-yl) - {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} - methanone;

119

51174 N- (4 - {{1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] methyl} -cyclohexyl) -carbamic acid tert-butyl ester;

N- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] cyclohexylmethyl} -nicotinamide;

N- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] cyclohexylmethyl} -6-methyl-nicotinamide;

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({(1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - {[1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] methyl} -piperidine-1-carboxylic acid tert-butyl ester;

3 - {[1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] methyl} -piperidine-1-carboxylic acid tert-butyl ester;

4- ({Ethyl- (144-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] amino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4- {1- [2- (2-Dimethylamino-ethoxy) -4-methanesulfonyl-phenyl] -1-pyrazolo [3,4-d] pyrimidin-4-yloxy} -piperidine-1-carboxylic acid tert-butyl ester;

3- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-amino] -piperidine-1-carboxylic acid tert-butyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid pyridin-3-ylmethyl acid ester tert-butyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid 2-pyridin-3-yl-ethyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid 3-pyridin-3-yl-propyl ester;

120

51174Β

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid 2-dimethylamino-ethyl ester;

4 - {[1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -methylamino} -piperidine-1-carboxylic acid tert-butyl ester;

4- [1- (2,4-Difluoro-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({Ethyl- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -amino} -methyl) -piperidine-1-carboxylic acid isopropyl ester ;

4 - ({Ethyl- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -amino} -methyl) -piperidine-1-carboxylic acid tert- butyl ester; 4- [6-Dimethylamino-1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

1- (4 - {[1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -methylamino} -piperidin-1-yl) -3,3-dimethyl- butan-2-one;

4 - {[1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -methylamino} -piperidine-1-carboxylic acid cyclobutyl ester; and 4 - [({- 1- [4- (2-Methanesulfonyl-ethyl) -phenyl] -1H-pyrazolo [3,4-d] pyrimidin-4-yl} methyl-amino) -methyl] -piperidin-1 -carboxylic acid tert-butyl ester;

Specific examples of GPR119 agonists disclosed in International Application no.

PCT / US2004 / 022417 includes the following compounds according to Formula (IV) (hereinafter referred to as Group D2):

4 - ({{[1- (2,5-Difluoro-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -methylamino} -methyl] -piperidine-1-carboxylic acid tert-butyl ester ;

2- {4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-1-yl} -1- (4-trifluoromethoxy) -phenyl) -ethanone;

2- {4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -1- (3-fluoro-phenyl) ) -ethanone;

121

51174 Β

2- {4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -pyridine and η-1-yl} -1-pyridine -2-yl-ethanone;

(2,5-Dimethyl-furan-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} - methanone;

4 - ({(2-Dimethylamino-ethyl) - [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yl] -amino} -methyl) 'piperidine-1-carboxylic acid tert-butyl ester;

4 - ({(2-Dimethylamino-ethyl) - [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -amino} -methyl) -piperidine- 1-carboxylic acid tert-butyl ester;

4- [1- (2-Dimethylamino-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- (2- {Ethyl- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] amino} -ethyl) -piperazine-1-carboxylic acid tert-butyl to be;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3l4-d] pyrimidin-4-ylsulfanyl] piperidine-1-carboxylic acid tert-butyl ester;

4- {2- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] ethyl} -piperazine-1-carboxylic acid ethyl ester;

4- {2- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] propyl} -piperazine-1-carboxylic acid ethyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidine-4-sulfinyl] piperidine-1-carboxylic acid tert-butyl ester;

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanyl] -piperidine-1-carboxylic acid tert-butyl ester;

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanyl] -piperidine-1-carboxylic acid butyl ester;

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanyl] -piperidine-1-carboxylic acid 2-methoxy-ethyl ester;

122

51174Β

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanyl] -piperidine-1-carboxylic acid 3,3-dimethyl-butyl ester;

4- [1- (2-Fluoro-4-methanesulfonyl · phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanyl] -piperidine-1-carboxylic acid 4-methyl-pentyl ester;

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanyl] -piperidine-1-carboxylic acid cyclopropylmethyl ester;

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanyl] -piperidine-1-carboxylic acid cyclobutylmethyl ester;

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanyl] -piperidine-1-carboxylic acid 2-cyclopropyl-ethyl ester;

(5-Bromo-furan-2-yl) - {4- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanyl] -piperidin-1-yl } -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (5-morpholin-4-ylmethyl-furan-2-yl) -methanone ;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid pentyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid 1-ethyl-propyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H'-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid 2-ethyl-butyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid cyclopentylmethyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid 2-pyrrolidin-1-yl-ethyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid 2-morpholin-4-yl-ethyl ester;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid ethyl ester;

123

51174 Β

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid 2,2-dimethyl-propyl ester;

(5-Butyl-pyridin-2-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

Ethyl- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] - (3,4,5,6-tetrahydro-2H- [1,2 ' bipyridinyl-4-ylmethyl) -amine;

Ethyl- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylHS'-trifluoromethyl-SA.Se-tetrahydro-N- [1H-bipyridinyl-ylmethyl) amine ;

[1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] - (5-trifluoromethyl-3l4,5,6-tetrahydro-2H- [1,2 '] bipyridinyl-4-yl) -amine;

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

5'-Fluoro-4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-oxy] -3,4,5,6-tetrahydro-2H- [1,2 ' ] bipyridinyl;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxyl-5'methyl-3,4,5,6-tetrahydro-2H- [1,2 ' ] bipyridinyl;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -6-trifluoromethyl-3,4,5,6-tetrahydro-2H- [1,2 Jbipyridinyl;

[1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] - [1 (3-isopropyl- [1,2,4] oxadiazol-5- ylmethyl) -pyrrolidin-3-yl] -amine;

[1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] - [1 (3-isopropyl- [1,2,4] oxadiazol-5 -ylmethyl) -pyrrolidin-3-yl-amine;

(4-Ethyl-pyridin-2-yl) - {4- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl } -methanone;

- (2-Fluoro-4-methanesulfonyl-phenyl) -4- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-ylmethyl) -pyrrolidin-3-yloxy] -1H-pyrazolo [3,4-d] pyrimidine;

124

51174 Β

1- (2-Fluoro-4-methanesulfonyl-phenyl) -4- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-ylmethyl) -piperidin-4-yloxy] -1H-pyrazolo [3,4-d] pyrimidine;

(5'-Fluoro-3,4,5,6-tetrahydro-2H- [1,2 '] bipyridinyl-4-yl) - [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -amine;

(5-Bromo-pyridin-3-yl) - {4- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl } -methanone;

3- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -pyrrolidine-1-carboxylic acid tert-butyl ester;

3- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-ylamino] pyrrolidine-1-carboxylic acid tert-butyl ester;

3- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-amino] -pyrrolidine-1-carboxylic acid isopropyl ester;

(6-Chloro-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} - methanone;

(5-Chloro-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (1-methyl-3-trifluoromethyl-1H-pyrazole) -4-yl) -methanone;

(2-Chloro-pyridin-4-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} - methanone;

(4-Hydroxy-3-methoxy-phenyl) - {4- [1- (4-methanesulfonyl-phenyl) -1-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone ;

(4-Chloro-3-nitro-phenyl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl] -S-methyl-butan-one;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (6-pyrazol-1-yl-pyridin-3-yl) -methanone;

125

51174Β (2-Hydroxy-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone ;

(5,6-Dichloro-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} - methanone;

(5-Bromo-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3l4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

5- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carbonyl} -nicotinic acid;

(1H-Imidazol-4-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3l4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

3- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -pyrrolidine-1-carboxylic acid tert-butyl ester;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (6; -pyrrolidin-1-yl-pyridin-3 -yl) -methanone;

(6-Isobutylamino-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

(6-Ethylamino-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

(6-Cyclobutylamino-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone ;

(6-Isopropylamino-pyridin-3-ylH441- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

[6- (1-Ethylpropylamino) -pyridin-3-yl] - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl } -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-propyl-butylamino) -pyridin-3-yl] -methanone;

5-Benzyloxy-2- {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-

d] pyrimidin-4-yloxy] -piperidine-1-carbonyl} -pyran-4-one;

126

51174 Β

Benzo [c] Isoxazol-3-yl- {4- [1- (4-methanesulfonyl-phenyl) ”1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

(4-Chloro-pyridin-2-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

(4-Iodo-pyridin-2-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

1- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -butan-2-one;

2- (5-Bromo-pyridin-3-yl) -1- {4- [1- (4-methanesulfonyl-phenyl) -1-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1- or} -ethanone;

(6-Fluoro-pyridin-2-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

(5-Fluoro-pyridin-2-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3I4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

(6-Chloro-pyridin-2-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} 'methanone ;

(2-Chloro-5-fluoro-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl } -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - [5- (2-methyl-pyrrolidin-1,4-ylmethyl) - pyridin-3-yl] -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (6-methyl-pyridin-2-yl) -methanone ;

5- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carbonyl} -nicotinonitrile;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (4-methoxy-pyridin-2-yl) -methanone ;

(2-Fluoro-pyridin-4-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3)4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

127

51174 N- (2-Fluoro-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} - methanone;

(6-Fluoro-pyridin-3-yl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (4-methoxy-thiophen-3-yl) -methanone ;

2- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carbonyl} -pyran-4-one;

(5-Ethoxy-phenyl) - {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy-piperidin-1-yl} -methanone;

{4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} - (5-pyridin-2-yl-thiophen-2- yl) -methanone;

(5-Amino-pyridin-2-yl) - {4- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl } -methanone;

{4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} 1- [5- (3-methyl-butylamino) 1-pyridin-2-yl] -methanone;

{4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-oxy] -piperidin-1-yl} - (4-trifluoromethoxy-phenyl) -methanone;

(5-Butyl-pyridin-2-yl) - {4- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl } -methanone;

(5-Ethylamino-pyridin-2-yl) - {4- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl } -methanone;

{4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} - (5-isopropoxymethyl-pyridin-2-yl) ) -methanone;

(4-Difluoromethoxy-phenyl) - {4- [1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

{4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} - (5-isopropoxy-pyridin-2-yl) ) -methanone;

128

51174 Β

5- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carbonyl} -pyridine-2-carboxylic acid methyl ester; {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} -acetic acid ethyl ester;

{4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} - (3-trifluoromethoxy-phenyl) -methanone;

1- (2-Fluoro-4-methanesulfonyl-phenyl) -4- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -1H-pyrazolo [3,4-d] pyrimidine;

- (4-Chloro-phenyl) -2- {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

2- {4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidin-1-yl} -1- (3-trifluoromethyl-phenyl) -ethanone;

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -5'-isopropoxy-3,4,5,6-tetrahydro-2H- [ 1,2 '] bipyridinyl;

1- (4-Methanesulfonyl-phenyl) -4- [1- (4-trifluoromethoxy-phenyl) -piperidin-4-yloxy] -1H-pyrazolo [3,4-d] pyrimidine;

1- (2-Fluoro-4-methanesulfonyl-phenyl) -4- [1- (4-trifluoromethoxy-phenyl) piperidin-4-yloxy] -1H-pyrazolo [3,4-d] pyrimidine;

1- (4-Chloro-3-methyl-phenyl) -2- {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl } -ethanone;

1- (3,4-Dichloro-phenyl) -2- {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} - ethanone;

5'-Bromo-4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-oxyxy-SAS.e-tetrahydro-1H-1,2 '] bipyridinyl;

1- (2-Fluoro-4-methanesulfonyl-phenyl) -4- [1- (4-trifluoromethoxy-phenyl) piperidin-4-yloxy] -1H-pyrazolo [3,4-d] pyrimidine;

4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -5-trifluoromethyl-3,4,5,6-tetrahydro-2H- [1,2 1] bipyridinyl;

129

51174 Β

1- (2,4-Methoxy-phenyl) -2- {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

- (4-Difluoromethoxy-phenyl) -2- {4- [1- (4-methanesulfonyl-phenyl) -1-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

- (4-Diethylamino-phenyl) -2- {4- [1- (4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4d] pyrimidin-4-yloxy] -piperidin-1-yl} -ethanone;

(2- {4- [1- (2-Fluoro-N-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidine-

4-Yloxy] -piperidin-1-yl} -5-methyl-pyrimidin-4-yl) -dimethyl-amine;

1- (2-Fluoro-4-methanesulfonyl-phenyl) -4- [1- (5-methyl-4-pyrrolidin-1-ylpyrimidin-2-yl) -piperidin-4-yloxy] -1H-pyrazolo (3, 4-d] pyrimidine;

4- [1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-sulfynyl] -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (2-Methyl-4-propylamino-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (4-Isopropylamino-2-methyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (2-Methyl-4-morpholin-4-yl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {1- [4- (2-Methoxy-ethylamino) -2-methyl-phenyl] -1H-pyrazolo [3,4d] pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (1- {4 - [(2-Methanesulfonyl-ethyl) -methyl-amino] -2-methyl-phenyl} -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (4-Bromo-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1 carboxylic acid isopropyl ester;

4- [1- (4-Propylamino-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

130

51174Β

4- [1- (4-Isopropylamino-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- (1- {4- [4- (2-Methanesulfonyl-ethyl) -piperazin-1-yl] -2-methyl-phenyl} -1-pyrazolo [3,4-d] pyrimidin-4-yloxy) -piperidine -1-carboxylic acid isopropyl ester;

4- (1- {2-Methyl-4 - [(tetrahydro-furan-2-ylmethyl) -amino] -phenyl} -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (4-Cyclopropylamino-2-methyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidinecarboxylic acid isopropyl ester;

4- {1 ”[4- (2-Dimethylamino-ethylamino) -2-methyl-phenyl] -1H-pyrazolo [3,4d] pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (4-Morpholin-4-yl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid propyl ester;

4 - ({[1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -isopropyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl to be;

4- [1- (2-Fluoro-4-morpholin-4-yl-phenyl) -1H-pyrazolo [3l4-d] Pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (2-Fluoro-4-isopropylamino-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-hydroxy-piperidine-1-carboxylic acid isopropyl ester;

4- (1- {4-i (2-Methanesulfonyl-ethyl) -methyl-amino] -phenyl} -1H-pyrazolo [3,4d] pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

4- {1- [4- (2-Methoxy-ethylamino) -phenyl] -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (1- {4 - [(Tetrahydro-furan-2-ylmethyl) -amino] -phenyl} -1H-pyrazolo [3,4d] pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

131

51174 Β

4- (1- {4- [4- (2-Methanesulfonyl-ethyl) -piperazin-1-yl] -phenyl} -1H-pyrazolo [3,4d] pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (4-Aminophenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1 carboxylic acid isopropyl ester;

4 - ({(1- (2-Fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yl] -isopropyl-amino} -methyl) -piperidine-1-carboxylic acid isopropyl ester ;

4- [1- (5-Ethyl-pyrimidin-2-yl) -piperidin-4-ylsulfanyl-1- (2-fluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidine;

4- [1- (2-Fluoro ”4-sulfamoyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [1- (2-Fluoro-4-propionylsulfamoyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (4-Cyano-2-fluoro-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

1- (2,5-Difluoro-4-methoxy-phenyl) -4- [4- (3-isopropyl- [1,2,4] oxadinol-5-yl) -cyclohexyloxy] -1H-pyrazolo [3,4-d ] pyrimidine;

4- [1- (2,5-Difluoro-4-methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4, [1- (4-Fluoro-6-methoxy-pyridin-3-yl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (6-Methoxy-2-methyl-pyridin-3-yl)] - 1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (2,5-Difluoro-4-sulfamoyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (2-Fluoro-4-hydroxy-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] · piperidine-1-carboxylic acid isopropyl ester;

132

51174 Β

3-Fluoro-4- {4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyrazolo [3,4-d] pyrimidin-1-yl } -N-propionyl-benzenesulfonamide;

3-Fluoro-4- {4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyrazolo [3,4-d] pyrimidin-1-yl } -benzonitrile;

S-Fluoro-N-N-isopropyl-N-oxadiazole-S-N-piperidinyl-yloxypyrazolo [3,4-d] pyrimidin-1-yl} -benzenesulfonamide;

- (2,5-Difluoro-4-methanesulfonyl-phenyl) -4- [1- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -piperidin-4-yloxy] -1H-pyrazolo [3, 4-d] pyrimidine;

1- (4-Fluoro-6-methoxy-pyridin-3-yl) -4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -1H-pyrazolo [3,4-d] pyrimidine;

4- [1- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -1- (6-methoxy-2-methyl-pyridin-3-yl) -1H-pyrazolo [3,4-d] pyrimidine;

2,5-Difluoro-4- {4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yloxy] -pyrazolo [3,4-d] pyrimidin-1-yl} -benzenesulfonamide;

1- (2-Fluoro-4-methanesulfanyl-phenyl) -4- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -1H-pyrazolo [3,4-d] pyrimidine;

3-Fluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] pyrazolo [3,4-d] pyrimidin-1-yl} -N- propionylbenzenesulfonamide;

3-Fluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] pyrazolo [3,4-d] pyrimidin-1-yl} -benzonitrile;

3-Fluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -pyrazolo [3,4-d] pyrimidin-1-yl} -benzenesulfonamide ;

1- (2,5-Difluoro-4-methanesulfonyl-phenyl) -4- [4- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -cyclohexyloxy] -1H-pyrazolo [3,4-d ] pyrimidine;

1- (4-Fluoro-6-methoxy-pyridin-3-yl) -4- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -1H-pyrazolo [3,4-d] pyrimidine;

4- [4- (3 “isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -1- (6-methoxy-

2-methyl-pyridin-3-yl) -1H-pyrazolo [3,4-d] pyrimidine;

133

51174 Β

2,5-Difluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -pyrazolo [3,4-d] pyrimidin-1-yl} -benzenesulfonamide;

4- [1- (2-Fluoro-4-methoxy-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [1- (4-Difluoromethoxy-2-fluoro-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (2-Fluoro-4-trifluoromethoxy-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [1- (2,5-Difluoro-4-methoxy-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

3-Fluoro-4- {4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyrazolo [3,4-d] -pyrimidin-1-yl} -phenol;

1- (2-Fluoro-4-methoxy-phenyl) -4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) piperidin-4-yloxy] -1H-pyrazolo [3, 4-d] pyrimidine;

- (4-Difluoromethoxy-2-fluoro-phenyl) -4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -1H-pyrazolo [3, 4-d] pyrimidine;

1- (2-Fluoro-4-trifluoromethoxy-phenyl) -4- [1- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -piperidin-4-yloxy] -1H-pyrazolo [3,4 -d] pyrimidine;

- (2,5-Difluoro-4-methoxy-phenyl) -4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -1H-pyrazolo [3 , 4-d] pyrimidine;

3-Fluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -pyrazolo [3,4-d] pyrimidin-1-yl} -phenol ;

1- (2-Fluoro-4-methoxy-phenyl) -4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl] cyclohexyloxy] -1H-pyrazolo [3,4-d] pyrimidine;

- (4-Difluoromethoxy-2-fluoro-phenyl) -4- [1- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -cyclohexyloxy] -1H-pyrazolo [3,4-d] pyrimidine ; i

- (2-Fluoro-4-trifluoromethoxy-phenyl) -4- [1- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -cyclohexyloxy] -1H-pyrazolo [3,4-d] pyrimidine.

B4

51174Β

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 022417 includes the following compounds according to Formula (IV) (hereinafter referred to as Group D3):

4- [9- (- 6-Methanesulfonyl-pyridin-3-yl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid isobutyl ester;

{4- [9- (6-Methanesulfonyl-pyridin-3-yl) -9H-purin-6-yloxy] -piperidin-1-yl} pyridin-3-yl-methanone;

4- [9- (4-Methanesulfonyl-phenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [9- (6-Methanesulfonylpyridin-3-yl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid tert-butyl ester; i

4- [9- (2-Fluoro-4-methanesulfonyl-phenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid tert-butyl ester.

Specific examples of GPR119 agonists detected in international application no. PCT / US2004 / 022417 includes the following compounds according to Formula (IV) (hereinafter referred to as Group D4):

4- [9- (2-Fluoro-4-propionsulfamoyl-phenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [9- (4-Cyano-2-fluoro-phenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [9- (2-Fluoro-4-sulfamoyl-phenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic isopropyl ester;

9- (2-Fluoro-4-methanesulfonyl-phenyl) -6- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -9H-purine;

3-Fluoro-4- {6- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] purin-9-yl} -N-propionyl-benzenesulfonamide;

135

51174 Β

3-Fluoro-4- {6- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] purin-9-yl} -benzonitrile;

3-Fluoro-4- {6- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] purin-9-yl} -benzenesulfonamide;

4- (9- (2,5-Difluoro-4-methanesulfonyl-phenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [9- (4-Fluoro-6-methoxy-pyridin-3-yl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [9- (6-Methoxy-2-methyl-pyridin-3-yl) -9H-pyran-6-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (9- (2,5-Difluoro-4-sulfamoyl-phenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

9- (2,5-Difluoro-4-methanesulfonyl-phenyl) -6- (1- (3-isopropyl- (1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -9H-purine ;

9- (4-Fluoro-6-methoxy-pyridin-3-yl) -6- [1- (3-isopropyl- (1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -9H-purine;

6- [1- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -9- (6-methoxy-2-methyl-pyridin-3-yl) -9H-purine ;

2,5-Difluoro-4- {6- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -purin-9-yl] -benzenesulfonamide;

9- (2-Fluoro-4-methanesulfonyl-phenyl) -6- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -9H-purine;

3-Fluoro-4- {6- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] purin-9-yl} -N-propionyl-benzenesulfonamide;

3-Fluoro-4- {6- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] purin-9-yl} -benzonitrile;

3-Fluoro-4- {6- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -pyrin-9-yl} -benzenesulfonamide;

I36

51174 Β

9- (2,5-Difluoro-4-methanesulfonyl-phenyl) -6- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -9H-purine;

9- (4-Fluoro-6-methoxy-pyridin-3-yl) -6- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -9H-purine;

6- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -9- (6-methoxy-

2-methyl-pyridin-3-yl) -9H-purine; i

2,5-Difluoro-4- {6- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) cyclohexyloxy] -purin-9-yl} -benzenesulfonamide.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 022417 includes the following compound according to Formula (iV) (hereinafter referred to as Group D5):

4- [3- (4-Methanesulfonyl-phenyl) -3H- [1,2,3] triazolo [4,5-d] pyrimidin-7-yloxy] piperidine-1-carboxylic acid tert-butyl ester.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 022417 includes the following compounds according to Formula (IV) (hereinafter referred to as Group D6):

3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -3H- [1,2,3] triazolo [4,5-d] pyrimidine;

3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] - [1,2,3] triazolo [4,5 -d] pyrimidin-3-yl} -N-propionyl-benzenesulfonamide;

3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] [N, N-triazolo-N-pyrimidin- S-yl-benzonitrile;

3-Fluoro-4- {7- [1- (3-isoPr° Pi4'l> 2,4] oxadiazol-5-yl) -piperidin-4-yloxy] [N, N-triazolol-C1-pyrimidin-S-yl] benzenesulfonamide;

3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -3H- [1,2,3] triazlo [4,5-d] pyrimidine;

137

51174Β

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] - [1.2.3] triazolo [4,5-d] pyrimidine-3 -yl} -N-propionyl-benzenesulfonamide;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] - [1.2.3] triazolo [4,5-d] pyrimidine-3 -yl} -benzonitrile;

3-Fluoro-4- [7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] [N-triazolo-S-d-pyrimidin-S-yl-benzenesulfonamide;

3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -7- [4- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -cyclohexyloxy] -3H- [1,2,3] triazolo [4,5-d] pyrimidine;

3- (4-Fluoro-6-methoxy-pyridin-3-yl) -7- [4- (3-isopropyl- [1,2,4] oxadiazole ”

S-10-cyclohexyloxy-SH-tert-triazolo-1-d-pyrimidine;

7- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -3- (6-methoxy-

2-methyl-pyridin-3-yl) -3H- [1,2,3] triazolo [4,5-d] pyrimidine;

2,5-Difluoro-4- {7- [4- (3-isopropyl- [1(2,4] oxadiazol-5-yl) -cyclohexyloxy] - [1,2,3] triazolo [4,5-d] pyrimidin-3-yl} benzenesulfonamide;

4- [3- (2-Fluoro-4-methanesulfonyl-phenyl) -3H- [1,2,3] triazolo [4,5d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2-Fluoro-4-propionsulfamoyl-phenyl) -3H- [1,2,3] triazolo [4,5d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (4-Cyano-2-fluoro-phenyl) -3H- [1,2,3] triazolo [4,5-d] pyrimidin-7-oxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2-Fluoro-4-sulfamoyl-phenyl) -3H- [1,2l3] triazolo [4,5-d] pyrimidin-7-oxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -3H- [1,2,3] triazolo [4l5d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4 - [- 3- (4-Fluoro-6-methoxy-pyridin-3-yl) -3H- [1,2,3] triazolo [4,5d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

138

51174Β

4- [3- (6-Methoxy-2-methyl-pyridin-3-yl) -3H- [1,2,3] triazolo [4,5-d] pyrimidine-

7-Yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3-(2)5-Difluoro-4-sulfamoyl-phenyl) -3H- [1,2,3] triazolo [4,5-d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

3- (2,5-Difluoro * 4-methanesulfonyl-phenyl) - [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -3H- [1, 2,3] triazolo [4(5djpyrimidine;

3- (4-Fluoro-6-methoxy-pyridin-3-yl) -7- [1- (3-isopropyl- [1,2,4] oxadiazole ~

5-yl) -piperidin-4-yloxy] -3H- [1,2,3] triazolo [4,5-d] pyrimidine;

7- [1- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -3- (6-methoxy-2-methyl-pyridin-3-yl) -3H- [ 1.2I3] triazolo [4,5-d] pyrimidine; i

2,5-Difluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] - [1,2,3] triazolo [4,5 -d] pyrimidin-3-yl} -benzenesulfonamide.

Specific examples of GPR119 agonists disclosed in International Application no.

PCT / US2004 / 022417 includes the following compound according to Formula (IV) (hereinafter referred to as Group D7):

4- [3- (4-Methanesulfonyl-phenyl) -isoxazolo [4,5-d] pyrimidin-7-yloxy] piperidine-1-carboxylic acid tert-butyl ester.

Specific examples of GPR119 agonists disclosed in International Application no.

PCT / US2004 / 022417 includes the following compounds according to Formula (IV) (hereinafter referred to as Group D8):

4 - ({Ethyl- [3- (4-methanesulfonyl-phenyl-isoxazolo [4,5-d] pyrimidin-7-ylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4- [3- (4-Methanesulfonyl-phenyl) -isoxazolo [4,5-d] pyrimidin-7-ylsulfanyl] piperidine-1-carboxylic acid tert-butyl ester; i

139

51174 Β

4- [3- (4-Methanesulfonyl-phenyl) -isoxazolo [4,5-d] pyrimidin-7-yloxy] piperidine-1-carboxylic acid isopropyl ester.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 022417 includes the following compound according to Formula (IV) (hereinafter referred to as Group D9):

4- [8- (2-Fluoro-4-methanesulfonyl-phenyl) - [1,7] naphthyridin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / US2004 / 022417 includes the following compounds according to Formula (IV) (hereinafter referred to as Group D10):

4- [8- (2-Fluoro-4-methanesulfonyl-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (4-Methylsulfanyl-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (4-Methanesulfonyl-phenyl) -quinoline-4-Hoxyl-piperidine-1-carboxylic acid isopropyl ester;

4- [8- (4-Isopropoxy-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (4-Bromo-2-fluoro-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (2-Fluoro-4-propionylsulfamoyl-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (4-Cyano-2-fluoro-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (2-Fluoro-4-sulfamoyl-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

140

51174 Β

4- [8- (2,5-Difluoro-4-methanesulfonyl-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (4-Fluoro-6-methoxy-pyridin-3-yl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (6-Methoxy-2-methyl-pyridin-3-yl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (2,5-Difluoro-4-sulfamoyl-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

2,5-Difluoro-4- {4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -quinolin-8-yl} -benzenesulfonamide;

4- [1- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -8- (6-methoxy-2-methyl-pyridin-3-yl) -quinoline;

8- (4-Fluoro-6-methoxy-pyridin-3-yl) -4- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -quinoline;

8- (2,5-Difluoro-4-methanesulfonyl-phenyl) -4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -quinoline;

3-Fluoro-4- {4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] quinolin-8-yl} -benzenesulfonamide;

3-Fluoro-4- {4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] quinolin-8-yl} -benzonitrile;

3-Fluoro-4- {4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -quinolin-8-yl} -N-propionyl-benzenesulfonamide;

8- (2-Fluoro-4-methanesulfonyl-phenyl) -4- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -quinoline;

2,5-Difluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -quinolin-8-yl} -benzenesulfonamide;

4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -8- (6-methoxy-

2-Methyl-pyridin-3-yl) -quinoline;

141

51174 Β

8- (4-Fluoro-6-methoxy-pyridin-3-yl) -4- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -quinoline;

8- (2,5-Difluoro-4-methanesulfonyl-phenyl) -4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -quinoline;

3-Fluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] quinolin-8-yl} -benzenesulfonamide;

3-Fluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] quinolin-8-yl} -benzonitrile;

3-Fluoro-4- (4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] quinolin-8-yl} -N-propionyl-benzenesulfonamide;

8- (2-Fluoro-4-methanesulfonyl-phenyl) -4- [4- (3-isopropyl- [1,2,4] oxadiazole

5-yl) -cyclohexyloxy] -quinoline.

4- [8- (2-Fluoro-4-methanesulfonyl-phenyl) -pyrido [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [8- (2-Fluoro-4-propionylsulfamoyl-phenyl) -pyrido [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (4-Cyano-2-fluoro-phenyl) -pyrido [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (2-Fluoro-4-sulfamoyl-phenyl) -pyrido [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- (8- (2,5-Difluoro-4-methanesulfonyl-phenyl) -pyrido [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [8- (4-Fluoro-6-methoxy-pyridin-3-yl) -pyrido [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

142

51174 Β

4- (8- (6-Methoxy-2-methyl-pyridin-3-yl) -pyrido [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- (8- (2,5-Fluoro-4-sulfamoyl-phenyl) -pyrido [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

8- (2-Fluoro-4-methanesulfonyl-phenyl) -4- (1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -pyrido [3,4-d] pyrimidine;

3-Fluoro-4- {4- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyrido [3,4-d] pyrimidin-8-yl } -N-propionyl-benzenesulfonamide;

3-Fluoro-4- {4- (1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyrido [3,4-d] pyrimidin-8-yl } -benzenesulfonamide;

8- (2,5-Difluoro-4-methanesulfonyl-phenyl) -4- [1- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -piperidin-4-yloxy] -pyrido [3,4 -d] pyrimidine;

8- (4-Fluoro-6-methoxy-pyridin-3-yl) -4- (1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -pyrido [3,4-d] pyrimidine;

4- [1- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -8- (6-methoxy-2-methyl-pyridin-3-yl) -pyrido [3 , 4-d] pyrimidine;

2,5-Difluoro-4- {4- (1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -pyrido [3,4-d] pyrimidin-8- il} -benzenesulfonamide;

8- (2-Fluoro-4-methanesulfonyl-phenyl) -4- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -pyrido [3,4-d] pyrimidine;

3-Fluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] pyrido [3,4-d] pyrimidin-8-yl} -N- propionylbenzenesulfonamide;

3-Fluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] pyrido [3,4-d] pyrininidin-8-yl} -benzonitrile;

3-Fluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] pyrido [3,4-d] pyrimidin-8-yl} -benzenesulfonamide;

8- (2,5-Difluoro-4-methanesulfonyl-phenyl) -4- [4- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -cyclohexyloxy] -pyrido [3,4-d] pyrimidine ;

143

51174 Β

8- (4-Fluoro-6-methoxy-pyridin-3-yl) -4- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -pyrido [3,4-d] pyrimidine;

4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -8- (6-methoxy-

2-Methyl-pyridin-3-yl) -pyrido [3,4-d] pyrimidine; i

2,5-Difluoro-4- {4- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) cyclohexyloxy] -pyrido [3,4-d] pyrimidin-8-yl} -benzenesulfonamide.

Specific examples of GPR119 agonists disclosed in International Application no.

PCT / US2004 / 022417 includes the following compounds according to Formula (IV) (hereinafter referred to as Group D12):

3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -pyrazolo [1,5-a] pyrimidine;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] pyrazolo [1,5-a] pyrimidin-3-yl} -N- pripionylbenzenesulfonamide;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] pyrazolo [1,5-a] pyrimidin-3-yl} -benzonitrile;

3-Fluoro-4- [7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] pyrazolo [1,5-a] pyrimidin-3-yl} benzenesulfonamide;

3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -pyrazolo [1,5-a ] pyrimidine;

3- (4-Fluoro-6-methoxy-pyridin-3-yl) -7- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -pyrazolo [1,5-a] pyrimidine;

7- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -3- (6-methoxy-

2-Methyl-pyridin-3-yl) -pyrazolo [1,5-a] pyrimidine;

2,5-Difluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) cyclohexyloxy] -pyrazolo [1,5-a] pyrimidin-3-yl} -benzenesulfonamide;

4- [3- (2-Fluoro-4-methanesulfonyl-phenyl) -pyrazolo [1,5-a] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

144

51174 Β

4- [3- (2-Fluoro-4-propionylsulfamoyl-phenyl) -pyrazolo [1,5-a] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (4-Cyano-2-fluoro-phenyl) -pyrazolo [1,5-a] pyrimidin-7-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2-Fluoro-4-sulfamoyl-phenyl) -pyrazolo [1,5-a] pyrimidin-7-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -pyrazolo [1,5-a] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (4-Fluoro-6-methoxy-pyridin-3-yl) -pyrazolo [1,5-a] pyrimidin-7-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [3- (6-Methoxy-2-methyl-pyridin-3-yl) -pyrazolo [1,5-a] pyrimidin-7-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2,5-Difluoro-4-sulfamoyl-phenyl) -pyrazolo [1,5-a] pyrimidin-7-yloxy] piperidine-1-carboxylic acid isopropyl ester;

3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -pyrazolo [1,5-a] pyrimidine;

3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyrazolo [1,5-a] pyrimidin-3-yl } -N-propionyl-benzenesulfonamide;

3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyrazolo [1,5-a] pyrimidin-3-yl } -benzonitrile;

3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] pyrazolo [1,5-a] pyrimidin-3-yl } -benzenesulfonamide;

3- (4-Fluoro-6-methoxy-pyridin-3-yl) -7- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -pyrazolo [1,5-a] pyrimidine;

7- [1- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -3- (6-methoxy-2-methyl-pyridin-3-yl) -pyrazolo [1 , 5-a] pyrimidine;

2,5-Difluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -pyrazolo [1,5-a] pyrimidine- 3-yl} -benzenesulfonamide;

145

51174 Β

4- [3- (2-Fluoro-4-methanesulfonyl-phenyl) -2-methyl-pyrazolo [1,5-a] pyrimidine-

7-Yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2-Fluoro-4-propionylsulfamoyl-phenyl) -2-methyl-pyrazolo [1,5a] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

443- (4-SCapo-2-11 | Yogo-Tep 1 H) -2-tert-1H-pyrrolo [1,5-a] pyrimidin-7-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- (3- (2-Fluoro-4-sulfamoyl-phenyl) -2-methyl-pyrazolo [1,5-a] pyrimidin-7-oxy) -piperidine-1-carboxylic acid isopropyl ester;

4- (3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -2-methyl-pyrazolo [1,5a] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (4-Fluoro-6-methoxy-pyridin-3-yl) -2-methyl-pyrazolo [1,5-a] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (6-Methoxy-2-methyl-pyridin-3-yl) -2-methyl-pyrazolo [1,5-a] pyrimidin-7-oxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (3- (2,5-Difluoro-4-sulfamoyl-phenyl) -2-methyl-pyrazolo [1,5-a] pyrimidin-7-oxy) -piperidine-1-carboxylic acid isopropyl ester;

2,5-Difluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -2-methyl-pyrazolo [1,5-a] pyrimidin-3-yl} -benzenesulfonamide;

7- (1- (3-Isopropyl- (1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -3- (6-methoxy-2-methyl-pyridin-3-yl) -2-methyl -pyrazolo [1,5-a] pyrimidine;

3- (4-Fluoro-6-methoxy-pyridin-3-yl) -7- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -2-methyl-pyrazolo [1,5-a] pyrimidine;

3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -7- [1- (3-isopropyl- (1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -2-methyl -pyrazolo [1,5-pyrimidine;

3-Fluoro-4- {7- [1- (3-isopropyl- (1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -

2-methyl-pyrazolo [1,5-a] pyrimidin-3-yl} -benzenesulfonamide;

146

51174 Β

3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy]

2-methyl-pyrazolo [1,5-a] pyrimidin-3-yl} -benzonitrile;

3-Fluoro-4- [7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -

2-Methyl-pyrazolo [1,5-a] pyrimidin-3-yl} -N-propionyl-benzenesulfonamide;

3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- (1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -2-methyl-pyrazolo [1,5-a] pyrimidine;

3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -2-methyl-pyrazolo [1,5-a] pyrimidine;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -2-methyl-pyrazolo [1,5-a] pyrimidin-3-yl} -N-propionyl-benzenesulfonamide;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -2-methyl-pyrazolo [1,5-a] pyrimidin-3-yl} -benzonitrile;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -2-methyl-pyrazolo [1,5-a] pyrimidin-3- yl} -benzenesulfonamide;

3- (2,5-Difluoro-4-methanesulfonyl-phenyl) - {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -2-methyl-pyrazolo [ 1,5apyrimidine;

3- (4-Fluoro-6-methoxy-pyridin-3-yl) - {7- [4- (3-isopropyl [1,2])4] oxadiazol-5-yl) -cyclohexyoxy] -2-methyl-pyrazolo [1,5-pyrimidine;

{7 [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -3- (6-methoxy-2-methyl-pyridin-3-yl) -2-methyl-pyrazolo [1 , 5-a] pyrimidine; i

2,5-Difluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) cyclohexyloxy] -2-methyl-pyrazolo [1,5-a] pyrimidin-3 -yl} benzenesulfonamide.

147

51174 Β

4- [3- (2-Fluoro-4-methanesulfonyl-phenyl) -1-methyl-1H-pyrazolo [3,4d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2-Fluoro-4-propionylsulfamoyl-phenyl) -1-methyl-1H-pyrazolo [3,4d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (4-Cyano-2-fluoro-phenyl) -1-methyl-1H-pyrazolo [3,4-d] pyrimidin-7-oxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2-Fluoro-4-sulfamoyl-phenyl) -1-methyl-1H-pyrazolo [3,4-d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -1-methyl-1H-pyrazolo [3,4-d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester; 4- [3- ( 4-Fluoro-6-methoxy-pyridin-3-yl) -1-methyl-1H-pyrazolo [3,4d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester; 4- (3- (6 -Methoxy-2-methyl-pyridin-3-yl) -1-methyl-1H-pyrazolo [3,4d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (3- (2,5-Difluoro-4-sulfamoyl-phenyl) -1-methyl-1H-pyrazolo [3,4d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester; 3- ( 2-Fluoro-4-methanesulfonyl-phenyl) -7- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -1-methyl-1H-pyrazolo [4,3-d] pyrimidine;

3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] 1-methyl-4H-pyrazolo [4,3-d pyrimidin-3-yl} -N-propionylbenzenesulfonamide;

3-Fluoro-4- {7- (1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] 1-methyl-1H-pyrazolo [4,3-d 1-pyrimidin-3-yl} -benzonitrile;

3-Fluoro-4- {7- [1- (3-isopropyl- [1;2,4] oxadiazol-5-yl) -piperidin-4-yloxy] 1-methyl-1H-pyrazolo [4,3-d] pyrimidin-3-H} benzenesulfonamide;

148

51174 Β

3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -7- [1- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -piperidin-4-yloxy] -1-methyl-1H -pyrazolo [4,3-d] pyrimidine;

3- (4-Fluoro-6-methoxy-pyridin-3-yl) -7- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -1-methyl-1H-pyrazolo [4,3-d] pyrimidine;

7- [1- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -3- (6-methoxy-2-methyl-pyridin-3-yl) -1-methyl -1H-pyrazolo [4,3-d] pyrimidine;

2,5-Difluoro-4- (7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -1-methyl-4H-pyrazolo [4,3-d] pyrimidin-3-yl) -benzenesulfonamide; 3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -1-methyl-1H-pyrazolo [4,3-d] pyrimidine;

3-Fluoro-4- {7- [4- (3-isopropyl- [1l2,4] oxadiazol-5-yl) -cyclohexyloxy] -1-methyl-4H-pyrazolo [4,3-d] pyrimidin-3-yl} -N-propionyl-benzenesulfonamide;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -1-methyl-4H-pyrazolo [4,3-d] pyrimidin-3- yl} -N-propionyl-benzonitrile;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -1-methyl-4H-pyrazolo [4,3-d] pyrimidin-3 ' yl} -benzenesulfonamide;

3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -7- [4- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -cyclohexyloxy] -1-methyl-4H-pyrazolo [4 , 3djpyrimidine;

3- (4-Fluoro-6-methoxy-pyridin-3-yl) -7- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -1-methyl-4H-pyrazolo [4,3-d] pyrimidine;

7- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -3- (6-methoxy-

2-methyl-pyridin-3-yl) -1-methyl-4H-pyrazolo [4,3-d] pyrimidine; i

2,5-Difluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -1-methyl-4H-pyrazolo [4,3-d] pyrimidine- 3-yl} benzenesulfonamide.

149

51174Β

4- [3- (2-Fluoro-4-methanesulfonyl-phenyl) -2-methyl-2H-pyrazolo [4,3d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester; 4- [3- (2-Fluoro-4-propionylsulfamoyl-phenyl) -2-methyl-2H-pyrazolo [4,3d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester; 4- [3- (4 ”Cyano-2-fluoro-phenyl) -2-methyl-2H-pyrazolo [4,3-d] pyrimidin-7-oxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2-Fluoro-4-sulfamoyl-phenyl) -2-methyl-2H-pyrazolo [4,3-d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -2-methyl-2H-pyrazolo [4,3d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester; 4- [3- (4-Fluoro-6-methoxy-pyridin-3-yl) -2-methyl-2H-pyrazolo [4,3d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [3- (6-Methoxy-2-methyl-pyridin-3-yl) -2-methyl-2H-pyrazolo [4,3d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (3- (2,5-Difluoro-4-sulfamoyl-phenyl) -2-methyl-2H-pyrazolo [4,3d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -2-methyl-2H-pyrazolo [3,4-d] pyrimidine;

3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -

2-methyl-2H-pyrazolo [3,4-d] pyrimidin-3-yl} -N-propionylbenzenesulfonamide;

3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -

2-Methyl-2H-pyrazolo [3,4-d] pyrimidin-3-yl} -N-propionyl-benzonitrile;

3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -

2-methyl-2H-pyrazolo [3,4-d] pyrimidin-3-yl} -benzenesulfonamide;

150

51174 Β

3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -7- [1- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -piperidin-4-yloxy] -2-methyl-2H -pyrazolo [4,3-d] pyrimidine;

3- (4-Fluoro-6-methoxy-pyridin-3-yl) -7- [1- (3-isopyrropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -2-methyl-2H-pyrazolo [4,3-d] pyrimidine;

7- [1- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -3- (6-methoxy-2-methyl-pyridin-3-yl) -2-methyl -2H-pyrazolo [4,3-d] pyrimidine;

2,5-Difluoro-4- {7- [1- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] -2-methyl-2H-pyrazolo [4,3-d] pyrimidin-3-yl} -benzenesulfonamide;

3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -2-methyl-2H-pyrazolo [4,3-d] pyrimidine;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -2methyl-2H-pyrazolo [3,4-d] pyrimidin-3- yl} -N-propionyl-benzenesulfonamide;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -2methyl-2H-pyrazolo [3,4-d] pyrimidin-3- yl} -benzonitrile;

3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -2methyl-2H-pyrazolo [3,4-d] pyrimidin-3- yl} -benzenesulfonamide;

3- (2,5-Difluoro-4-methanesulfonyl-phenyl) -7- [4- (3-isopropyl- [1.2.4] oxadiazol-5-yl) -cyclohexyloxy] -2-methyl-2H-pyrazolo [4 , 3djpyrimidine;

3- (4-Fluoro-6-methoxy-pyridin-3-yl) -7- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -cyclohexyloxy] -2-methyl-2H-pyrazolo [4,3-d] pyrimidine;

7- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -3- (6-methoxy-

2-methyl-pyridin-3-yl) -2-methyl-2H-pyrazolo [4,3-d] pyrimidine; i

2,5-Difluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) cyclohexyloxy] -2-methyl-2H-pyrazolo [3,4-d] pyrimidine-3 -yl} benzenesulfonamide.

151

51174Β

Examples of GPR119 agonists are described in U.S. International Application no. 60 / 577,354. It was discovered in US international application no. 60 / 577,354 as a GPR119 agonist compound of Formula (V):

or an N-oxide thereof;

where:

A] and A2 are independently C 1-8 alkylene optionally substituted with one or more substituents selected independently from the group consisting of alkyl, alkoxy, and carboxy;

D is CR-f or NR2, wherein R 1 is selected from the group consisting of H, Cv6 alkyl, C1-6 alkoxy, halogen and hydroxyl;

E is N, C or CR3, where R3 is H or alkyl;

- is a single bond when E is N or CR3, or a double bond when E is C;

K is absent, C3_s cycloalkylene, or CV3 an alkylene group optionally substituted with one or more substituents independently selected from the group consisting of alkyl, N, alkoxy, carboxy, cyano and halogen;

152

51174 Β

It's NR4) Ο, S, S (O) or S (O) 2, wherein R4 is H, acyl, 0,.6 alkyl, S2-b alkenyl, S2_b alkynyl, C3.7 cycloalkyl, or C3.7-cycloalkyl-C1.3-alkylene, wherein said C1.6 alkyl optionally substituted with one or more substituents selected independently from the group consisting of acyl, C4. 6 acyloxy, C2.6 alkenyl, alkoxy, C1-66 alkyl, alkyclamino, alkylcarboxamide, C2 6 alkynyl, O.ν6 alkylsulfonamide, C1-66 alkylsulfinyl, Cv 6 alkylsulfonyl, alkylthio, alkylcarboxamide, alkylthioureyl, Ci.6 alkylureyl, amino, di-C ^ alkylamino, alkoxycarbonyl, carboxamide, carboxy, whose no C3.6 cycloalkyl, di-C1-6alkylcarboxamide, di-C1.6-alkylsulfonamide) di-Ci.6alkylthiocarboxamido, haloalkoxy, haloalkyl, halogen, C1-6.6 haloalkylsulfinyl, CV6 haloalkylsulfonyl, C16 haloalkylthio, hydroxyl, hydroxylamino and nitro;

Q2 is absent, NR5> or O wherein R is5 H, acyl, alkyl, C2.6 alkenyl, C2.6 alkynyl, C37 cycloalkyl, or C3.7-cycloalkyl-C1.3-alkylene, wherein said alkyl is optionally substituted with one or more substituents selected independently from the group consisting of acyl, C4. 6 acyloxy, alkenyl, C1-66 alkoxy, alkyl, alkylamino, CV6 alkylcarboxamide, C2alkynyl, alkylsulfonamide, alkylsulfinyl, alkylsulfonyl,ν6 alkylthio, Cb6 alkylthiocarboxamide, alkylthioureyl, alkylureyl, amino, di-C 1-6 -alkylamino, alkoxycarbonyl, carboxamide, carboxy, cyano, C3.6 cycloalkyl, di-C 1-6 alkylcarboxamide, di-C 1-6 alkylsulfonamide, di-C 1-6 alkylthiocarboxamido, C 1-8.s haloalkoxy, haloalkyl, halogen, Ομ6 haloalkylsulfinyl, Ον6 haloalkylsulfonyl, haloalkylthio, hydroxy, hydroxylamino and nitro;

153

51174 Β

W is N or CH;

X is N or CR6;

Y is N or CR7;

Z is N or CR8;

V is offline C-i_3 heteroalkylene, or Ον3 alkylene wherein each is optionally substituted with one or more substituents selected independently from the group consisting of C13 alkyl, SAb alkoxy, carboxy, cyano, C1-3 haloalkyl, and halogen;

R6, R7 and R8 are each independently selected from the group consisting of H, θ acyl, acyloxy, C2.6 alkenyl, C1.6 alkoxy, alkyl, C16 alkylamino, alkylcarboxamide, C2^ alkynyl, alkylsulfonamide, alkylsulfinyl, Cv6 alkylsulfonyl, alkylthio, alkylthiocarboxamide, alkylthioureyl, alkylureyl, amino, di-C1-6-alkylamino, C16 alkoxycarbonyl, carboxamide, carboxy, cyano, C3.6 cycloalkyl, di-C1.6alkylcarboxamide, di-C1.6-alkylsulfonamide, di-C 1-6 alkylthiocarboxamido, haloalkoxy, haloalkyl, halogen, haloalkylsulfinyl, haloalkylsulfonyl, SAb haloalkylthio, hydroxyl, hydroxylamino and nitro, wherein C2^ alkenyl, O -, + alkyl, C2. 6 alkynyl and C3_6 cycloalkyl each optionally substituted with one or more substituents independently selected from the group consisting of acyl, S 1.

acyloxy, C2.6 alkenyl, alkoxy, C1-66 alkyl, alkylamino, alkylcarboxamide, C2+ alkynyl, S- |.6 alkylsulfonamide, alkylsulfinyl, C3-6. β alkylsulfonyl, C1.6 alkylthio, C16 alkylthiocarboxamide, alkylthioureyl, C1.6 alkylureyl, amino, di-C1.6-alkylamino, alkoxycarbonyl, carboxamide, carboxy, cyano, C3.6 cycloalkyl, di-C 1-6 alkylcarboxamide, di-C 1.6-alkylsulfonamide, di-C 1-4

I54

51174Β alkylthiocarboxamido, haloalkoxy, haloalkyl, halogen, C4.6 haloalkylsulfinyl, Ci.6 haloalkylsulfonyl, S4.6 haloalkylthio, hydroxyl, hydroxylamino and nitro;

Ar is aryl or heteroaryl optionally substituted with R9-R13;

Rg is selected from the group consisting of acyl, Cv6 acyloxy, C?.6 alkenyl, alkoxy, Om6 alkyl, alkylamino, alkylcarboxamide, S2-b alkynyl, C16 alkylsulfonamide, CV6 alkylsulfinyl, alkylsulfonyl, alkylthio, alkylthiocarboxamide, alkylthioureyl, S1b alkylureyl, amino, aryl, arylcarbonyl, arylsulfonyl, di-C 1-4 -alkylamino, carbamimidoyl, Ομ6 alkoxycarbonyl, carboxamide, carboxy, cyano, Sz_6 cycloalkyl, di-1,6-alkylcarboxamide, di-C 1-6 -alkylsulfonamide, di-C 1-6.5alkylthiocarboxamido, guanadine, haloalkoxy, haloalkyl, halogen, Cr6 haloalkylsulfinyl, Cb6 haloalkylsulfonyl, CV6 haloalkylthio, heterocyclic, heterocyclylsulfonyl, heteroaryl, hydroxy, hydroxylamino, nitro, C3_6 oxo-cycloalkyl, phenoxy, sulfonamide, sulfonic acid and thiol; and wherein each available Rg is optionally substituted with one or more substituents selected independently from the group consisting of acyl, C 1-6 acylsulfonamide, acyloxy, S2_b alkenyl, alkoxy, alkyl, C 1-6 alkylamino, alkylcarboxamide, S2h alkynyl, alkylsulfonamide, C,.6 alkylsulfinyl, alkylsulfonyl, Ct.6 alkylthio, C-.5 alkylthiocarboxamide, alkylthioureyl, Cv6 alkylureyl, amino, aryl, arylcarbonyl, arylsulfonyl, di-C 1-6 -alkylamino, S,.b alkoxycarbonyl, carboxamide, carboxy, cyano, S3cycloalkyl, di-C 1-6 alkylcarboxamide, di-C1.6-alkylsulfonamide, di-C 1-6 alkylthiocarboxamido, haloalkoxy, Ομ6 haloalkyl, halogen, haloalkylsulfinyl, haloalkylsulfonyl, haloalkylthio, heteroaryl,

155

51174Β heteroarylcarbonyl, heteroarylsulfonyl, heterocyclic, hydroxyl, hydroxylamino and nitro;

R10-Ri3 are independently selected from the group consisting of Ομθ acyl, S ^ b acyloxy, S2-b alkenyl, alkoxy, Cr6 alkyl, alkylamino, alkylcarboxamide, C2_6 alkynyl, alkylsulfonamide, C1-5 alkylsulfinyl, S4. 6 alkylsulfonyl, Cv6 alkylthio, C 1-6 alkylthiocarboxamide, alkylthioureyl, C 1-66 alkylureyl, amino, di-C16-alkylamino, alkoxycarbonyl, carboxamide, carboxy, cyano, Sz.6 cycloalkyl, di-C 1-6 alkylcarboxamide, di-C 1-6 -alkylsulfonamide, di-C16alkylthiocarboxamido, haloalkoxy, Ομθ haloalkyl, halogen, Ομθ haloalkylsulfinyl, Ομθ haloalkylsulfonyl, Ομ6 haloalkylthio, hydroxyl, hydroxylamino, nitro and thiol; or two adjacent groups together with the atoms to which they are attached form a 5-, 6- or 7-membered cycloalkyl, cycloalkenyl or heterocyclic group wherein the 5-, 6- and 7-membered groups are optionally substituted with halogen or oxo ; i

R2 is selected from the group consisting of H, acyl, acyloxy, C2.e alkenyl, alkoxy, alkyl, alkylamino, C1-66 alkylcarboxamide, C2.6 alkynyl, alkylsulfonamide, N, N-alkylsulfinyl, C 1-6 alkylsulfonyl, alkylthio, C 1-6 alkylthiocarboxamide, alkylthioureyl, alkylureyl, amino, aryl, arylcarbonyl, aryloxy, di-C16-alkylamino, carbamimidoyl, C1-6 alkoxycarbonyl, C3.7-cycloalkoxycarbonyl, carboxamide, carboxy, cyano, C3.6 cycloalkyl, di-C1.6-alkylcarboxamide, di-C 1-6 alkylsulfonamide, di-C 1-6 -alkylthiocarboxamido, guanadine, 0μ6 haloalkoxy, Ομθ haloalkyl, halogen, S] _6 haloalkylsulfinyl, Cb6 haloalkylsulfonyl, haloalkylthio, heteroaryl, heteroaryl-C1-63-alkylene, heteroarylcarbonyl, heteroaryloxy, heterocycliccarboxamide, hydroxyl,

51174 Β hydroxylamino and nitro; wherein each available R2 optionally substituted with one or more substituents selected independently from the group consisting of C1-6 acyl, Cb6 acyloxy, C2.6 alkenyl, C1.6 alkoxy, alkyl, C1-66 alkylamino, alkylcarboxamide, C2_6 alkynyl, alkylsulfonamide, C1-66 alkylsulfinii, S5_6 alkylsulfonyl, Ομ6 alkylthio, Cv6 alkylthiocarboxamide, alkylthioureyl, N- |.6 alkylureyl, amino, aryl, di-Cv6-alkylamino, alkoxycarbonyl, carboxamide, carboxy, cyano, C3.6 cycloalkyl, di-C 1-6 -alkylcarboxamide, di-C 1-6 -alkylsulfonamide, di-C 1-6 alkylthiocarboxamido, haloalkoxy, haloalkyl, halogen, Ομ6 haloalkylsulfinyl, C1.6 haloalkylsulfonyl, haloalkylthio, heterocyclic, heteroaryl, hydroxyl, hydroxyamino and nitro, and wherein Crs alkyl further optionally substituted with one or more substituents selected independently from the group consisting of acyl, alkoxy, alkylamino, alkylcarboxamide, alkylsulfonamide, S,.6 alkylsulfinyl, Cb6 alkylsulfonyl, C143 alkylthio, alkylureyl, amino, di-C 1-6 -alkylamino, alkoxycarbonyl, carboxamide, carboxy, cyano, Sub cycloalkyl, di-C 1-6 alkylcarboxamide, di-C 1-6 alkylsulfonamide, haloalkoxy, haloalkyl, halogen, haloalkylsulfinyl, haloalkylsulfonyl, C 1-66 haloalkylthio, heterocyclic, hydroxyl, hydroxyamino and nitro.

157

51174 Β

Specific examples of GPR119 agonists disclosed in U.S. International Application no. 60 / 577,354 include the following compounds according to Formula (V) (referred to herein as Group E1):

4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4-methanesulfonyl-phenoxy) -pyrimidine;

{6- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -pyrimidin-4-yl} (4-methanesulfonyl-phenyl) -amine;

4 - {{6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -methylamino} -piperidine-1-carboxylic acid tert-butyl ester;

4 ({[6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester; 4 ({[6- (4-Methanesulfonyl-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 ({[6- (2,5-Difluoro-benzylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - [({6 - [(Benzo [1,3] dioxol-5-ylmethyl) -aminol-pyrimidin-4-yl} -methylamino) -methyl] -piperidine-1-carboxylic acid tert-butyl ester; (2-Fluoro-4-methanesulfonyl-phenyl) - {6- [4- (3'fluoro-phenoxy) -piperidin-1-yl] -yrimidin-4-yl} -amine;

4 - ({Methyl- [6- (2-pyridin-4-yl-ethylamino) -pyrimidin-4-yl] -amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({Methyl- [6- (2-pyridin-3-yl-ethylamino) -pyrimidin-4-yl] -amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - [(Methyl- {6 - [(pyridin-34-methyl) -amino] -pyrimidin-4-yl} -amino) -methyl] piperidine-1-carboxylic acid tert-butyl ester;

4 - [({6 - [(2-Fluoro-4-methanesulfonyl-phenyl) -methyl-amino] -pyrimidin-4-yl} methyl-amino) -methyl] -piperidine-1-carboxylic acid tert-butyl ester;

158

51174 Β

4 - ({[6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid iso-butyl ester;

4 - ({[6- (4-Cyano-2-fluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - [({6- [4- (2-Methanesulfonyl-ethyl) -phenylamino] -pyrimidin-4-yl} -methylamino) -methylpiperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (4-Ethylsulfanyl-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (4-Isopropyl-phenylamino) -pyrimidin-4-yl} -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (4-Ethylsulfamoyl-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester:

4 - ({Methyl- [6- (4-methylsulfamoyl-phenylamino) -pyrimidin-4-yl] -amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (4-Dimethylsulfamoyl-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({Methyl- [6- (4-methylsulfamoylmethyl-phenylamino) -pyrimidin-4-yl] -amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({Methyl- [6- (4-sulfamoyl-phenylamino) -pyrimidin-4-yl] -amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({Methyl- [6- (4- [1,2,4] triazol-1-yl-phenylamino) -pyrimidin-4-yl] -amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({Methyl- [6- (4- [1,2,4] triazol-1-ylmethyl-phenylamino) -pyrimidin-4-yl] amino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - [(Methyl- {6- [4- (2- [1,2,4] triazol-1-yl-ethyl) -phenylamino] -pyrimidin-4-yl} amino) -methyl] -piperidin-1- carboxylic acid tert-butyl ester;

4 - ({[6- (Benzo [1,3] dioxol-5-ylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

159

51174Β

4 - ({[6- (6-Methanesulfonyl-pyridin-3-ylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (3,5-Dimethoxy-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - [(Methyl- {6- [4- (2-oxo-oxazolidin-4-yl-methyl) -phenylamino] -pyrimidin-4-yl} -amino) -methyl] -piperidine-1-carboxylic acid tert- butyl ester; 4 - [({6- [4- (1,1-Dioxo-1X6-thiomorpholin-4-ylmethyl) -phenylamino] -pyrimidin-4-yl} -methyl-amino) -methyl] -piperidine-1-carboxylic acid tert- butyl ester;

4 - ({Methyl- [6- (4-pyrazol-1-yl-phenylamino) -pyrimidin-4-yl] -amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2,2-Difluoro-benzo [1,3] dioxol-5-ylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester ;

4 - ({Methyl- [6- (4-trifluoromethanesulfonyl-phenylamino) -pyrimidin-4-yl] amino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester; 4 - [(Methyl- {6- [4- (morpholine-4-sulfonyl) -phenylamino] -pyrimidin-4-yl} -amino) methyl] -piperidine-1-carboxylic acid tert-butyl ester;

4 - [(Methyl- {6- [2- (pyridine-2-carbonyl) -phenylamino] -pyrimidin-4-yl} -amino) methyl] -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2-Fluoro-5-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

N-Ethyl-3-fluoro-4- [6- (methyl-piperidin-4-ylmethyl-amino) -pyrimidin-4-ylamino] -benzenesulfonamide;

3- Fluoro-N-isopropyl-4- [6- (metal-piperidin-4-ylmethyl-amino) -pyrimidine-

4-ylamino] -benzenesulfonamide;

4 - ({[6- (3,4-Difluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

I60

51174 Β

4 - ({[6- (2,6-Difluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2,5-Difluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2,3-Difluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({Methyl- [6- (2,3,5-trifluoro-phenylamino) -pyrimidin-4-yl] -amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2-Fluoro-phenylamino) -pyrimidin-4-yl] -methyl-anilino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2-Fluoro-4-methyl-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (3-Chloro-2-fluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4-({[6-(2i4-Difluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - [(Methyl- {e- [2- (1-oxy-pyridin-3-yl) -ethylamino] -pyrimidin-4-yl} -amino) methyl] -piperidine-1-carboxylic acid tert-butyl ester;

4 - [(Methyl- {6- [2- (1-oxy-pyridin-3-yl) -ethylamino] -pyrimidin-4-yl} -amino) methyl] -piperidine-1-carboxylic acid isobutyl ester;

4 - ({[6- (2,5-Difluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid isobutyl ester;

4 - ({[6- (4-Cyano-2-fluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid isobutyl ester;

4 - [({6- [2- (2-Fluoro-phenoxy) -ethylamino] -pyrimidin-4-yl} -methyl-amino) methyl] -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2-Fluoro-phenoxy) -pyrimidin-4-yl] -methyl-amino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

161

51174 Β

4 - ({[6- (2,5-Difluoro-phenoxy) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - [({6- [2- (2-Chloro-phenoxy) -ethylamino] -pyrimidin-4-yl} -methyl-amino) methyl] -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2-Chloro-phenoxy) -pyrimidin-4-yl] -methyl-amino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - [({6- [2- (4-Fluoro-phenoxy) -propylamino] -pyrimidin-4-yl} -methyl-amino) methyl] -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (4-Ethylsulfamoyl-2-fluoro-phenylamino) -pyrimidin-4-yl] -niethylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2-Fluoro-4-isopropylsulfamoyl-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (4-Cyano-2,5-difluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (4-Bromo-2,5-difluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (5-Carboxy-2-fluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (6-Methoxy-pyridin-3-ylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2,6-Dimethoxy-pyridin-3-ylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

6- {6 - [(1-tert-Butoxycarbonyl-piperidin-4-ylmethyl) -methyl-amino] pyrimidin-4-ylamino} -nicotinic acid;

4 - ({[6- (6-Acetylamino-pyridin-3-ylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (5-Fluoro-pyridin-2-ylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

162

51174Β

4 - ({[6- (4-Cyano-2-ethyl-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (4-Butyryl-phenylamino) -pyrimidin-4-yl] -methyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (5-Bromo-3-methyl-pyridin-2-ylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({{[6- (3-Bromo-5-methyl-pyridin-2-ylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({Methyl- [6- (5-trifluoromethyl-pyridin-2-ylamino) -pyrimidin-4-yl] -amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (4-Bromo-2-fluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (3-Carboxy-4-fluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (4-Ethoxycarbonyl-2-fluoro-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid isobutyl ester;

4 - ({(6- (4-Carboxy-2-fluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid isobutyl ester;

4 - ({[6- (4-Cyano-2-fluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid isopropyl ester;

4 - ({[6- (4-Cyano-2-fluoro-phenylamino) -pyrimidin-1-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid butyl ester;

4 - ({[6- (4-Cyano-2-fluoro-phenylamino) -pyrimidin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid cyclopropylmethyl ester;

{4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -piperazin-1-yl} -acetic acid ethyl ester;

(2-Fluoro-methanesulfonyl-phenyl) - {6- [4- (3-isopropyl- [1,2,4] oxadiazol-5-ylmethyl) -piperazin-1-yl] -pyrimidin-4-yl} -amine;

163

51174 Β

4 - ({([6- (2,5-Difluoro-4-hydroxy-phenylamino)) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid isobutyl ester;

4 - ({[6- (4-Ethylcarbamoyl-2-fluoro-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid isobutyl ester; 4 - [({6- [2-Fluoro-4- (N-hydroxycarbamimidoyl) -phenylamino] -pyrimidin-4-yl} -methyl-amino) -methyl-piperidine-1-carboxylic acid isobutyl ester;

4 - ({[6- (2 “Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid 3-methyl-butyl ester; 4 - ({[6- (2,5-Difluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid isopropyl ester;

(5-Butyl-pyridin-2-yl) - [4 - ({[6- (2-fluoro-4-methanesulfonyl-phenylamino) pyrimidin-4-yl] -methyl-amino} -methyl) -piperidin-1- yl] -methanone;

N- (2-Fluoro-4-methanesulfonyl-phenyl) -N '- (5'-fluoro-3,4I5,6-Tetrahydro-2H [1,2 '] bipyridin-4-ylmethyl) -N'-methyl-pyrimidine;

4 - ({(6- (4-Carbamimidoyl-2-fluoro-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid isobutyl ester;

4 - ({[6- (2-Fluoro-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid cyclobutyl ester;

4- [6 ”(2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-ylamino] piperidine-1-carboxylic acid tert-butyl ester;

N- (2-Fluoro-4-methanesulfonyl-phenyl) -N '- [1- (3-isopropyl- [1,2,4] oxadiazol-5-ylmethyl) -piperidin-4-ylmethyl] -N'-methyl -pyrimidine; -4,6-diamine;

4 - ({[6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid 1-ethyl-propyl ester;

164

51174Β

4 - ({Ethyl- [6- (2-fluoro-4-methanesulfonyl-phenylamino) -pyrinidin-4-yl] amino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - ({Ethyl- [6- (2-fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] amino] -methyl) -piperidine-1-carboxylic acid isopropyl ester;

4 - ({[6- (4-Cyano-2,5-difluoro-phenylamino) -pyrimidin-4-yl] -ethyl-amino} methyl) -piperidine-1-carboxylic acid isopropyl ester;

4 - ({[6- (4-Amino-2,5-difluoro-phenoxy) -pyrimidin-4-yl] -ethyl-amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

4 - ({[6- (2,5-Difluoro-4-methoxy-phenylamino) -pyrimidin-4-yl] -ethyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl to be;

4 - ({[6- (2,5-Difluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -ethylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4- ({Ethyl- [6- (2,4,5-trifluoro-phenylamino) -pyrimidin-4-yl] -amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester;

(2-Fluoro-4-methanesulfonyl-phenyl) - {6- [4- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-1-yl] -pyrimidin-4-yl} -amine;

4 - [(Ethyl- {6- [4- (N-ethylcarbamimidoyl) -2,5-difluoro-phenylamino] -pyrimidin-4-yl} -amino) -methyl] -piperidine-1-carboxylic acid isopropyl ester;

4 - ({[6- (4-Bromo-2,5-difluoro-phenylamino) -pyrimidin-4-yl] -ethyl-amino} methyl) -piperidine-1-carboxylic acid tert-butyl ester;

4 - [({6- [5- (2-Aminoethylamino) -4-cyano-2-fluoro-phenylamino] -pyrimidin-4-yl} -ethyl-amino) -methyl] -piperidine-1-carboxylic acid isopropyl ester;

[1- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -piperidin-4-yl} -acetic acid metal ester;

3- {4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] piperazin-1-yl} -propionic acid ethyl ester;

(2-Fluoro-4-methanesulfonyl-phenyl) - {6- [4- (4-isobutyl-phenyl) -piperidin-1-yl] pyrimidin-4-yl} -amine;

165

51174Β (2-Fluoro-4-methanesulfonyl-phenyl) - {6- [4- (4-isopropyl-phenyl) -piperidin-1-ylpyrimidin-4-yl} -amine;

({6- [4- (3-Cyclopropylmethyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] pyrimidin-4-yl} -2-fluoro-4-methanesulfonyl-phenyl) - amine;

(2-Fluoro-4-methanesulfonyl-phenyl) - {6- [4- (3-isobutyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -pyrimidin-4-yl} -amine ;

(2-Fluoro-4-methanesulfonyl-phenyl) - {6 ”[4- (4-isopropoxy-phenyl) -piperazin-1-yl] -pyrimidin-4-yl} -amine;

(2-Fluoro-4-methanesulfonyl-phenyl) - {6- [4- (4-isopropoxy-phenyl) -piperidin-1-yl] -pyrimidin-4-yl} -amine; (2-Fluoro-4-methanesulfonyl-phenyl) - {6- [4- (5-isopropoxy-pyridin-2-yl) piperazin-1-yl] -pyrimidin-4-yl} -amine;

{6- [4- (3-Dimethylaminomethyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] pyrimidin-4-yl} - (2-fluoro-4-methanesulfonyl-phenyl) - amine;

(2-Fluoro-4-methanesulfonyl-phenyl) - (6- {4- [2- (3-isopropyl- [1,2,4] oxadiazol-5-yl) ethyl] -piperazin-1-yl} - pyrimidin-4-yl) -amine;

(2-Fluoro-4-methanesulfonyl-phenyl) - {6- [4- (5-isopropoxy-pyridin-2-yloxy) piperidin-1-yl] -pyrimidin-4-yl} -amine;

(2-Fluoro-4-methanesulfonyl-phenyl) - {6- (4- (3-pyridin-3-yl- [1,2,4] oxadiazole-

5-yl) -piperidin-1-yl] -pyrimidin-4-yl} -amine;

2,5-Difluoro-4- {6- [4- (4-isopropoxy-phenyl) -piperazin-1-yl] -pyrimidin-4-ylamino-benzonitrile;

4 - {[6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-ylamino] -methyl} piperidine-1-carboxylic acid tert-butyl ester;

4 - {[6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-ylamino] -methyl} piperidine-1-carboxylic acid isopropyl ester;

4 - ({[6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yl] -isopropylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester;

166

51174 Β

4 - ({(4- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyridin-2-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid isobutyl ester; i

4 - ({[2- (2-Fluoro-4 ”methanesulfonyl-phenylamino) -pyridin-4-yl] -methyl-amino} methyl) -piperidine-1-carboxylic acid isobutyl ester.

Specific examples of GPR119 agonists disclosed in U.S. International Application no. 60 / 577,354 include the following compounds according to Formula (V) (hereinafter referred to as Group E2):

4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

(2-Fluoro-4-methanesulfonyl-phenyl) - {6- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-ylmethyl) -piperidin-4-yloxy] -pyrimidin-4-yl} -amine;

4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidine-1'-carboxylic acid isopropyl ester;

(6-Chloro-pyridin-2-yl) - {4- [6- (2-fluoro-4-methanesulfonyl-phenylamino) pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

(6-Bromo-pyridin-2-yl) - {4- [6- (2-fluoro-4-methanesulfonyl-phenylamino) pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

{4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidin-1-yl} - (6-methyl-pyridin-2-yl) -methanone;

{4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidin-1-yl} - (6-fluoro-pyridin-2-yl) -methanone;

{4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidin-1-yl} -pyridin-2-yl-methanone;

(6-Bromo-pyridin-3-yl) - {4- [6- (2-fluoro-4-methanesulfonyl-phenylamino) pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

{4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidin-1-yl} - (5-methyl-pyridin-3-yl) -methanone;

167

51174 Β (5,6-Dichloro-pyridin-3-yl) - {4- [6- (2-fluoro-4-methanesulfonyl-phenylamino) pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

4- [6- (4-Cyano-2,5-difluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- (6- (2,5-Difluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

4- (6- (2,4,5-Trifluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

4- (6- (3-Fluoro-4-methyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (3-Hydroxy-4-methoxy-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- (6- (3-Fluoro-4-cyano-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- (6- (6-Chloro-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (3-Fluoro-4-methoxy-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- (6- (3,4-Dimethoxy-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- (6- (2,3-Dihydro-benzo [1,4] dioxin-6-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (4-Cyano-2,5-difluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Cyano-5-ethylamino-2-fluoro-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

4- (6- (4-Ethoxy-2,5-difluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

168

51174 Β

4- [6- (4-Ethylsulfanyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (4-Isopropylsulfanyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

(5-Butyl-pyridin-2-yl) - {4- [6- (2-fluoro-4-methanesulfonyl-phenylamino) pyrimidin-4-yloxy] -piperidin-1-yl} -methanone;

4- [6- (5-Chloro-3-methyl-pyridin-2-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (6-Acetylamino-4-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (5-Fluoro-4-methyl-pyridin-2-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (6-Methoxy-5-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (6-Methoxy-2-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (6-Fluoro-5-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (2-Chloro-6-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (4-Methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl to be;

4- [6- (2-Methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (6-Chloro-2-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (6-Fluoro-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

169

51174Β

4- [6- (2-Chloro-4-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (6-Methoxy-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

446- (5-Fluoro-pyridin-2-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (2-Fluoro-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (6-Chloro-5-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (2-Methyl-pyridin-4-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (2-Methoxy-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (2,5-Difluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (4'Chloro-2-fluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (2,5-Difluoro-phenylamino) '- pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6 '(6-Methoxy-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Cyano-3-methoxy-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (3-Fluoro-4-hydroxy-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (6-Methoxy-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

170

51174 Β

4- (6- (2,5-Difluoro-4-isopropoxy-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

(2-Fluoro-4-methanesulfonyl-phenyl) - [6- (5'-isopropoxy-3,4,5,6-tetrahydro-2H- [1,2 '] bipyridinyl-4-yloxy) -pyrimidin-4- yl] -amine;

(2-Fluoro-4-methanesulfonyl · phenyl) - {6- [1- (3-isopropyl- [1,2,4] oxadiazole-

5-yl) -piperidin-4-yloxy] -pyrimidin-4-yl} -amine;

4- [6- (4-Cyano-2-fluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (Pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (Pyridin-4-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (2,5-Difluoro-4-propoxy-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Ethylamino-2-fluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Dimethylamino-2-fluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-propyldino-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-isopropylamino-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Methyl-6-propylamino-pyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Methyl-pyridin-3- (lamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (6-Isopropylamino-2-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

51174 Β

4- (6- (2-Methyl-6-propoxy-pyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Iodo-2-methyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (2-Fluoro-4-iodo-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [Methyl- (2-methyl-4,5,6,7-tetrahydro-2H-indazol-3-yl) -amino] pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (2-Methyl-2H-pyrazol-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Phenyl-2H-pyrazol-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (5-tert-Butyl-1H-pyrazol-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5-p-Tolyl-1H-pyrazol-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (6-Methoxy-5-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Methyl-pyridin-3-ylmino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Acetylamino-3-methyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (3-Chloro-4-fluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (3,5-Dimethoxy-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (6 "Ethyl-pyridin-2-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

172

51174 Β

4- [6- (5-Methyl-pyridin-2-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Methyl-quinolin-6-ylamino) -pyrimidin-4-yloxy] -piperide [n-1-carboxylic acid isopropyl ester;

4- [6- (2-Methylsulfanyl-benzothiazol-6-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6 ”(6-Morpholin-4-yl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Benzenesulfonyl-thiophen-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Piperidin-1-yl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (3-Trifluoromethoxy-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5-Oxo-5I6,7,8-Tetrahydro-naphthalen-2-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (6-Methyl-1H-pyrazolo [3,4-b] pyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5-Cyano-pyridin-2-1 (amino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Bromo-2,5-difluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Trifluoromethyl-pyridin-2-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5-Methyl-1H-pyrazol-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5-Cyclopropyl-1H-pyrazol-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

173

51174 Β

4- (6- (2,6-Dimethyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Methoxy-2-methyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (2,4-Dimethoxy-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [Acetyl- (2-Fluoro-4-methanesulfonyl-phenyl) -amino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5-Carbamoyl-pyridin-2-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (4- (3,4-Difluoro-phenyl) -thiazol-2-ylamino] -pyrimidin-4-yloxy} piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5-Oxo-1-phenyl-4,5-dihydro-1H-pyrazol-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (3-Oxazol-5-yl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5-Trifluoromethyl-pyridin-2-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Chloro-2-trifluoromethoxy-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- {6 - ((5-Pyridin-2-yl-thiophen-2-ylmethyl) -amino] -pyrimidin-4-yloxy} piperidine-1-carboxylic acid isopropyl ester;

4- (6- [5- (4-Chloro-phenyl) -2H-pyrazol-3-ylamino] -pyrimidin-4-yloxy} piperidine-1-carboxylic acid isopropyl ester;

4- (6- (1-Oxo-indan-5-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (5- (1-Methyl-pyrrolidin-2-yl) -pyridin-2-ylamino] -pyrimidin-4-yloxy} piperidine-1-carboxylic acid isopropyl ester;

174

51174 Β

4- [6- (6-Methoxy-2-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (5-Bromo-3-methyl-pyridin-2-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Chloro-6-methyl-pyridin-3-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Ethynyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Bromo-2-trifluoromethoxy-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (3-Iodo-4-methyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (2-Fluoro-5-methyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [5- (4-Methoxy-phenyl) - [1,3,4] thiadiazol-2-ylamino] -pyrimidin-4-yloxy} piperidine-1-carboxylic acid isopropyl ester;

4- [6- (3,5-Dimethyl-isoxazol-4-ylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (2- (2,5-Difluoro-4-propoxy-phenylamino) -pyridin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2,5-Difluoro-4-propylamino-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- (6- (2,5-Difluoro-4-morpholin-4-yl-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Methyl-4-propylamino-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (2,5-Difluoro-4- (4-methyl-piperazin-1-yl) -phenylamino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

175

51174 Β

4- {6- [2,5-Difluoro-4- (2-pyrrolidin-1-yl-ethoxy) -phenylamino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [4 (2-Dimethylamino-ethoxy) -2,5-difluoro-phenylamino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2,5-Difluoro-4- (2-morpholin-4-yl-ethoxy) -phenylamino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2,4-Difluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2,4,5-Trifluoro-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [Acetyl- (4 ”methanesulfonyl-phenyl) -amino] -pyrimidin-4-yloxy} piperidine-1-carboxylic acid isopropyl ester;

(2,5-Difluoro-4-propoxy-phenyl) - {6- [1- (5-isopropyl- [1,2,4] oxadiazol-3-yl) -piperidin-4-yloxy] -pyrimidin-4- il} -amine;

4- {6- [2,5-Difluoro-4- (morpholin-4-ylamino) -phenylamino] -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2,5-Difluoro-4- (2-methoxy-ethylamino) -phenylamino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (6- {2,5-Difluoro-4 - [(tetrahydro-furan-2-ylmethyl) -amino] -phenylamino} pyrimidin-4-yloxy) -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (4-Butylamino-2,5-difluoro-phenylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2,5-Difluoro-4- (3-methyl-butylamino) -phenylamino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -2-methyl-pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester;

176

51174 Β

4- (6- (2,5-Difluoro-4- (2-morpholin-4-yl-ethylamino) -phenylamino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- {6- [2- (2,5-Difluoro-phenoxy) -ethylamino] -pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester,

4- (6- (2,3-Difluoro-phenoxy) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester,

4- [6- (4-Bromo-2-fluoro-phenoxy) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [6- (2-Fluoro-4-morpholin-4-yl-phenoxy) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (2,5-Difluoro-4- (tetrahydro-furan-2-ylmethoxy) -phenylamino] pyrimidin-4-yloxy} -piperidine-1-carboxylic acid isopropyl ester;

4- (6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyridin-2-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [5- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyridin-3-yloxy] -piperidine-1-carboxylic acid tert-butyl ester;

4- [6- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyridin-2-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- [4- (2-Fluoro-4-methanesulfonylphenylamino) -pyridin-2-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (4- (2,5-Difluoro-4-propoxy-phenylamino) -pyridin-2-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (2- (2-Fluoro-4-methanesulfonyl-phenylamino) -pyridin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester;

4- (2- (2,5-Difluoro-4-propoxy-phenylamino) -pyridin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester.

177

51174 Β

Examples of GPR119 agonists are described in International Application no. PCT / GB2004 / 050046 (published as WO 2005/061489). It was discovered in international application no. PCT / GB2004 / 050046 as a GPR119 agonist compound of Formula (VI):

R1-AVBR2 (VI) where:

V is a 5-membered heteroaryl ring containing at most four heteroatoms selected from Ο, N and S, optionally substituted with Sm alkyl;

A is -CH = CH- or (CH2)n;

B is -CH = CH- or (CH2)n, where one of the CH2 the group can be replaced with 0, NR5, S (O) m, C (O) or C (O) NR12;

n is independently 0, 1, 2 or 3;

m is independently 0, 1 or 2;

R1 is 3- or 4-pyridyl, 4- or 5-pyrimidinyl or 2-pyrazinyl, any of which may be optionally substituted with one or more substituents selected from halo, C 1-4 alkyl, C 14 fluoroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3 .7 cycloalkyl, aryl, OR6 CN, NO2, S (O)mR6, WITH (R6) 2> N (R6) 2, NR10COLOR6, NO10SO2R6, SO2N (R6)2, heterocyclyl groups or 5- or 6-membered heteroaryl groups;

R2 is 4- to 7-membered cycloalkyl substituted with R3, C (O) OR3, C (O) R3 or S (O)2R2, or a 4- to 7-membered heterocyclyl containing one

178

51174 Β or two nitrogen atoms which are unsubstituted or substituted by C (O) OR4, C (O) R3, S (O) 2R3, C (O) NHR41 P (O) (OR11)2 or a 5- or 6-membered nitrogen-containing heteroaryl group;

R3 is C3-8 alkyl, C3-6 alkenyl or C3-8 alkynyl, any of which may be optionally substituted with up to 5 fluoro or chloro atoms, and may contain a CH2 group which may be replaced by O, or C3-7 cycloalkyl, aryl, heterocyclyl, heteroaryl, C 1-4 alkylC 3-7 cycloalkyl, C 1-4 alkylaryl, C 1-4 alkylheterocyclyl or alkylheteroaryl, any of which may be substituted with one or more substituents selected from halo, alkyl, C 1-4 fluoroalkyl, OR6, CN, CO2CM alkyl, N (R6)2 and NO2;

R4 is C2-8 alkyl, C2-8 alkenyl or C2-8 alkynyl, any of which may be optionally substituted with up to 5 fluoro or chloro atoms, and may contain a CH2 group which may be replaced by O, or C3-7 cycloalkyl, aryl, heterocyclyl, heteroaryl, C 1-4 alkylC 3-7 cycloalkyl, C 1-4 alkylaryl, C 1-4 alkylheterocyclyl or alkylheteroaryl, any of which may be substituted with one or more substituents selected from halo, C 1-6 alkyl, C 1-4 fluoroalkyl, OR& CN; CO2CM alkyl, N (R6)2 and NO2;

R5 is hydrogen, C (O) R7, S (O) 2R8, C3.7 cycloalkyl, or Sm alkyl optionally substituted with OR6, C3-7 cycloalkyl, aryl, heterocyclyl or heteroaryl, wherein the cyclic group may be substituted by one or more substituents selected from halo, C12 alkyl, C12 fluoroalkyl, OR6CN, N (R6) 2 and NO2;

R6 are independently hydrogen, alkyl, C3.7 cycloalkyl, aryl, heterocyclyl or heteroaryl, wherein the cyclic group may be substituted with one

179

51174 Β or more substituents selected from halo, (O alkyl, C0 fluoroalkyl, OR9, CN, SO2CH3, N (R10) 2 and NO2; or group N (R10)n may form a 4o to 7 membered heterocyclic ring optionally containing a further heteroatom selected from O and NR10;

R7 is hydrogen, C 1-4 alkyl, OR6, N (R12, aryl or heteroaryl;

R8 is (O alkyl, (O fluoroalkyl, aryl or heteroaryl;

R9 is hydrogen, (O 0 alkyl or (O fluoroalkyl;

R10 is hydrogen or C0 alkyl;

R11 jephenyl; and

R12 is hydrogen, (O 0 alkyl or (O cycloalkyl.

Specific examples of GPR119 agonists disclosed in International Application no. PCT / GB2004 / 050046 includes the following compounds according to Formula (VI) (hereinafter referred to as Group F1):

4- (3- (Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid tert-butyl ester;

4- (3- (Pyridin-4-yl- [1,2,4] oxadiazol-5-yl) piperidine-1-carboxylic acid tert-butyl ester;

180

51174Β

3- (3- [Pyridin-4-yl- [1:2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid tert-butyl ester;

4- [5- (4-Pentylcyclohexylmethyl) - [1,2,4] oxadiazol-3-yl] pyridine; Trans-2-Chloro-4- [5- (4-pentylcyclohexane) - [1,2,4] oxadiazol-3-yl] pyridine; fra-7s-4- [5- (4-Pentylcyclohexane) - [1,2,4] oxadiazol-3-ylmethyl] pyridine;

4- (3- [Pyridin-4-ylmethyl- [1,2)4] oxadiazol-5-yl) piperidine-1-carboxylic acid tert-butyl ester;

trans-3- [5- (4-Pentylcyclohexyl) - [1,2,4] oxadiazol-3-ylmethyl] pyridine;

4- [5- (4-Butylcyclohexane) - [1I2,4] oxadiazol-3-yl] pyridine;

4- [5- (4-n-PropylcyclohexylH1,2l4] oxadiazol-3-yl] pyridine; trans-4- [5- (4-Pentylcyclohexane) - [1,2,4] oxadiazol-3-yl] pyridine;

4- [2- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-yl) -ethyl] piperidine-1-carboxylic acid tert-butyl ester;

3- [5- (4-Propylcyclohexyl) - [1,2,4] oxadiazol-3-yl] pyridine;

3- [5- (4-Butylcyclohexane) - [1,2,4] oxadiazol-3-yl] pyridine;

trans-4- [3- (4-Pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine-2-carboxylic acid methylamide;

trans-4- [5- (4-Pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine; trans-2-Chloro-4- [3- (4-pephytylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine;

Irans-3- [3- (4-Pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine; trans-2-Methyl-3- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-54] pyridine; trans-2-Chloro-6-methyl-4- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine;

N-4- [3- (4-Pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine-2-carbonitrile;

trans-2-Chloro-3- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine; Irans-2-Chloro-6-methyl-3- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine;

181

51174 Β trans-2-Methyl-5- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine; Irans-3-Methyl-5- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine; trans-2,6-Dichloro-4- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine;

trans-2-Chloro-6-methoxy-4- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazole-

5-yl] pyridine;

Iran-5- [3- (4-Pentylcyclohexyl) - [1,2l4] oxadiazol-5-yl] 2. [1,2,4] triazole-

1-ylpyridine;

2- [3- (4-Pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine;

4- [3- (4-Pentylcyclohexyl) - [1,2,4] oxadiazol-3-yl] pyridine; trans-5- [3- (4-Pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine-2-carbonitrile;

Fraas-5-Chloro-2-methylsulfanyl-4- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine;

trans-2-Fluoro-5- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine; trans-2-Fluoro-4- [3- (4-pentylcyclohexyl) - [1>2!4] oxadiazol · 5-yl] pyridine; trans-2-imidazol-1-yl-5- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine;

Irans-2-Methyl-43- (4-pephlylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine;

Irans-3-Methyl-4- [3- (4-pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] pyridine; trans-4- {2- [3- (4-Pentylcyclohexyl) - [1,2,4] oxadiazol-5-yl] vinyl} pyridine;

4- (5- (Pyridin-4-yl- [1,2,4] oxadiazol-3-ylmethoxy) piperidine-1-carboxylic acid tert-butyl ester;

4- [5- (2-Cyanopyridin-4-yl) - [1,2,4] oxadiazol-3-ylmethoxy] piperidine-1-carboxylic acid tert-butyl ester;

(E) -4- [5- (2-Pyridin-3-yl-vinyl) - [1,2,4] oxadiazol-3-ylmethoxy] piperidine-1-carboxylic acid tert-butyl ester;

182

51174S (E) -4- [5- (2-Pyridin-3-yl-vinyl) - [1,2,4] oxadiazol-3-yl] piperidine-1-carboxylic acid tert-butyl ester;

(E) -4- [5- (2-Pyridin-3-yl-vinyl) - [1,2,4] oxadiazol-3-ylmethyl] piperidine-1-carboxylic acid tert-butyl ester;

(E) -4- [5- (2-Pyridin-4-yl-vinyl) - [1;2,4] oxadiazol-3-yl] piperidine-1-carboxylic acid tert-butyl ester;

4- [5- (2-Pyridin-4-yl · ethyl) - [1,2,4] oxadiazol-3-yl] piperidine-1-carboxylic acid tert-butyl ester;

4- {5- [2- (2-Cyanopyridin-4-yl) ethyl] - [1,2,4] oxadiazol-3-yl} piperidine-1-carboxylic acid tert-butyl ester;

4- {5- [2- (2-Cyanopyridin-4-yl) ethyl] - [1,2,4] oxadiazol-3-ylmethoxy} piperidine-1-carboxylic acid tert-butyl ester;

4- {5- [2- (2-Cyanopyridin-4-yl) ethyl] 1,2,4] oxadiazol-3-ylmethyl} piperidin-

1-carboxylic acid tert-butyl ester;

4- (5-Piperidin-4-yl- [1,2,4] oxadiazol-3-yl) pyridine;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-yl) piperidine-1-carboxylic acid isobutyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-yl) piperidine-1-carboxylic acid

2-methoxyethyl ester; '

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-yl) piperidine-1-carboxylic acid ethyl ester;

3,3-Dimethyl I-1- [4- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] butan-1-one;

2-Cyclopentyl-1- [4- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] ethanone;

4- {5- [1- (Butane-1-sulfonyl) piperidin-4-yl] - [1,2,4] oxadiazol-3-yl} pyridine;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-yl) piperidine-1-carboxylic acid propylamide;

183

51174 Β

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-yl) piperidine-1-carboxylic acid tert-butylamide;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid cyclopentyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid benzyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid isobutyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid ethyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid cycloheptyl ester;

(3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid methyl ester;

4- (3-Pyridin-4-yl- [1t2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid 2-methoxy-ethyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid isopropyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid 4-methoxy-phenyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid 2,2,2-trichloroethyl ester;

4- (3-Pyridin-4-yl- [1,2l4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid 4-chloro-phenyl ester;

4- (3-Pyridin-4yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid phenyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid 2-ethyl-hexyl ester;

184

51174 Β

4- (3-Pyridin-4-yl- [1,2t4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid (7R, 2S, 5R) -2-isopropyl-5-methylcyclohexyl ester;

4- (3-Pyridin-4-yl- [1,2I4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid (7S, 2R))5S) -2-Isopropyl-5-methylcyclohexyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid 2,2-dimethylpropyl ester;

4- (3-Pyridin-4-yl- [1l2,4] Oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid naphthalen-1-yl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1 ”carboxylic acid 2-methoxy-phenyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid 3-trifluoromethylphenyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid prop-2-ynyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid but-2-ynyl ester;

443-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid pentyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-54-methoxy) piperidine-1-carboxylic acid p-tolyl ester;

443-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1'-carboxylic acid 2-chloro-phenyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid naphthalen-2-yl ester;

4- (3-Pyridin-4-yl- [1,2)4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid butyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid 4-methoxycarbonyl-phenyl ester;

185

51174 Β

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid 4-fluoro-phenyl ester;

3-Methyl-1- [4- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidin-1-yl] butan-1-one;

Phenyl- [4- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidin-1-ylmethanone;

- (4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidin-1-ylbutan1-one,

2.2- Dimethyl-1- [4- (3-pyridin-4-yl- [1t2,4] oxadiazol-5-ylmethoxy) piperidin-

1-yl] propan-1-one;

Cyclopentyl- [4- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidin-1-yl] methanone;

[4- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidin-1-yl] -pytolylmethanone;

3,3-Dimethyl-1- [4- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidin-1-yl] butan-1-one;

4- {5- [1- (Butane-1-sulfonyl) piperidin-4-yloxymethyl] 1,2,4] oxadiazol-3-ylpyridine;

4- {5- [1- (Propane-1-sulfonyl) piperidin-4-yloxymethyl] - [1,2,4] oxadiazole-

3-yl} pyridine;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid tert-butylamide;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid o-tolylamide;

trans-4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-yl) cyclohexanecarboxylic acid propyl ester;

trans4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-yl) cyclohexanecarboxylic acid butyl ester;

186

51174 N- trans-4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-yl) cyclohexanecarboxylic acid isobutyl ester;

Trans-4- [5- (4-Propoxymethylcyclohexyl) - [1,2,4] oxadiazol-3-yl] pyridine; trans-4- [5- (4-Butoxymethylcyclohexyl) - [1,2,4] oxadiazol-3-yl] pyridine; cis-4- [5- (3-Butoxymethylcyclopentyl) - [1,2,4] oxadiazol-3-yl] pyridine; cis-4- [5- (3-Propoxymethylcyclopentyl) - [1,2,4] oxadiazol-3-yl] pyridine; cis-4- [5- (3-Butoxymethylcyclohexyl) - [1,2,4] oxadiazol-3-yl] pyridine;

4- (3-Pyridin-4-yl41,2,4] oxadiazol-5 "ylmethoxy) -3,4,5,6-tetrahydro-2H [1,3 '] bipyridinyl;

2- [4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidin-1-yl] pyrazine;

2- [4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidin-1-yl] pyrimidine;

(4-Pentylcyclohexyl) - (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amine; (4-Pentylcyclohexyl-methyl) - (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amine;

4 - [(3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) -amino] piperidine-1-carboxylic acid tert-butyl ester;

4 - {[(3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) -amino] methyl} piperidine-1-carboxylic acid tert-butyl ester;

4 - {[5- (2-Cyanopyridin-4-yl) - [1,2,4] oxadiazol-3-ylmethyl] amino} piperidine-1-carboxylic acid tert-butyl ester;

Methyl- (4-pentylcyclohexyl) - (3-pyridin-4-yl- [1,2,4] oxadiazoyl-5-ylmethyl) amine;

Methyl- (4-pentylcyclohexylmethyl) - (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amine;

4- [Methyl- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amino] piperidine-1-carboxylic acid tert-butyl ester;

187

51174 Β

4- [Ethyl- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amino] piperidine-1 carboxylic acid tert-butyl ester;

4- [Propyl- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amino] piperidine-1-carboxylic acid tert-butyl ester;

4- [Cyclopropylmethyl- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amino] piperidine-1-carboxylic acid tert-butyl ester;

4- [Butyl- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amino] piperidine-1-carboxylic acid tert-butyl ester;

4 - {[Methyl- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amino] methyl} piperidine-1-carboxylic acid tert-butyl ester;

4 - {[Ethyl- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amino] methyl} piperidine1-carboxylic acid tert-butyl ester;

4 - {[5- (2-Cyanopyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl] ethylamino} piperidine-1-carboxylic acid tert-butyl ester;

4- [Methyl- (3-pyridin-4-yl- [1,2l4] oxadiazol-5-ylmethyl) amino] piperidine-1-carboxylic acid cyclopentyl ester;

4 - {(Methyl- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) aminomethylpiperidine-1-carboxylic acid 2,2,2-trichloroethyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxymethyl) piperidine-1-carboxylic acid tert-butyl ester;

4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperazine-1-carboxylic acid tert-butyl ester;

4 - ((3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethanesulfonyl) piperidine-1-carboxylic acid tert-butyl ester;

4- (5-Pyridin-4-yl- [1,2,4] oxadiazol-2-ylmethoxy) piperidine-1-carboxylic acid tert-butyl ester;

188

51174Β

3-Pyridin-4-yl- [1,2,4] oxadiazole-5-carboxylic acid (4-pentylcyclohexyl) amide;

[4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidin-1-yl] phosphonic acid diphenyl ester;

4- (4-Pyridin-4-yl-thiazol-2-ylmethoxy) piperidine-1-carboxylic acid tert-butyl ester;

4- (2-Pyridin-4-yl-thiazol-2-ylmethyl) piperidine-1-carboxylic acid tert-butyl ester;

trans-4- [5- (4-pentyl-cyclohexyl) - [1,3,4] thiadiazol-2-yl] pyridine;

4- (5-Pyridin-4-yl- [1,3,4] thiadiazol-2-ylmethoxy) piperidine-1-carboxylic acid tert-butyl ester;

4- (5-Pyridin-4-yl-4H- [1,2,4] triazol-3-ylmethoxy) piperidine-1-carboxylic acid tert-butyl ester;

4- [2- (5-Pyridin-4-yl-isoxazol-3-yl) ethyl] piperidine-1-carboxylic acid tert-butyl ester;

4- (5-Pyridin-4-yl-isoxazol-3-ylmethoxy) piperidine-1-carboxylic acid tert-butyl ester;

4- (5-Pyridin-4-yl-isoxazol-3-ylmethyl) piperidine-1-carboxylic acid tert-butyl ester;

4- [2- (1-Methyl-5-pyridin-4-yl-1H-pyrazol-3-yl) -ethyl] piperidine-1-carboxylic acid tert-butyl ester;

4- [2- (Methyl-5-pyridin-4-yl-2H-pyrazol-3-yl) -ethyl] -piperidine-1-carboxylic acid tert-butyl ester;

(E) -4- {S- [2- (2-Cyanopyridin-3-yl) vinyl] - [1,2,4] oxadiazol-3-yl} piperidine-1-carboxylic acid tert-butyl ester;

4- {S- [2- (2H-Tetrazol-5-yl) pyridin-4-yl] - [1,2,4] oxadiazol-3-ylmethoxy} piperidine-1-carboxylic acid tert-butyl ester;

189

51174Β

4- [5- (2-Cyanopridin-4-yl) - [1,2,4] oxadiazol-3-ylmethoxy] piperidinecarboxylic acid isopropyl ester; i

4- [5- (2-Cyanopyridin-4-yl) - [1,2,4] oxadiazol -3-ylmethoxy] piperidine-1-carboxylic acid phenyl ester.

In one aspect of the present invention, the GPR119 agonist is a compound of Formula (I).

In one aspect of the present invention, the GPR119 agonist is a compound of Formula (II).

In one aspect of the present invention, the GPR119 agonist is a compound of Formula (III).

In one aspect of the present invention, the GPR119 agonist is a compound of Formula (IV).

In one aspect of the present invention, the GPR119 agonist is a compound of Formula (V).

In one aspect of the present invention, the GPR119 agonist is a compound of Formula (VI).

In one aspect of the present invention, the GPR119 agonist is a compound of Formula (VI), provided that the compound is not 4- (5-piperidin-4-yl- [1,2,4] oxadiazol-3-yl) pyridine, 4- (3 -pyridin-4-yl- [1,2,4] oxadiazol-5-yl) piperidine-1-carboxylic acid butyl ester, 4- [5- (4-butylcyclohexyl) 190

51174 Β [1,2,4] oxadiazol-3-yl] pyridine, 3- [5- (4-butylcyclohexyl) - (1,2,4] oxadiazol-3-ylpyridine, or 3- [5- (4-propylcyclohexyl) - [1,2,4] oxadiazol-3-yl] pyridine.

In one aspect of the present invention, the GPR119 agonist is selected from group A1, group B1, group B2, group VZ, group B4, group B5, group C1, group C2, group SZ, group 04, group 05, group 06, group 07, group 08 , groups 09, groups C10, groups D1, groups D2, groups D3, groups D4, groups D5, groups D6, groups D7, groups D8, groups D9, groups D10, groups D11, groups D12, groups D13, groups D14, groups E1 , group E2 or group F1.

In one aspect, the GPR119 agonist is selected from the left column of Table B.

Specific examples of GPR119 agonists include 2- (pyridin-4-yl) ethyl thiobenzoate and La-lysophosphatidylcholine oleoyl, as disclosed in EP 1338651.

Examples of GPR119 agonists can be found in international application WO 03/026661. The GPR119 agonists disclosed in WO 03/026661 include but are not limited to the compounds of Table 0.

191

51174 Β

TABLE C

<td>Jed. Br.</td><td>Chemical structure</td><td>Chemical name</td>

<td>1C i</td><td>N ^ 4 rV-Z »-01* - 1J n</td><td>[2- (4-Bromophenyl) -6-methylpyrimidin-4-yl] methyl-amine</td>

<td>2C</td><td>N 1</td><td>[2- (4-Bromophenyl) -6-methylpyrimidin-4-yl] -ptolyl-amine</td>

<td>ZS</td><td>A fr0043II J n</td><td>[2- (4-Bromophenyl) -6-methylpyrimidin-4-yl] - (4-methoxy-phenyl) amine</td>

192

51174 Β

<td> 40</td><td>Ν ι / 01 00 "</td><td>[2- (4-Bromophenyl) -6-methyl · pyrimidin-4-yl] phenyl-amine</td>

<td> 50</td><td> 00.0 00'· «</td><td>[2- (4-Bromophenyl) -6-methylpyrimidin-4-yl] cyclohexyl-amine</td>

<td> 60</td><td>TheinIJ Η</td><td>5- [2- (4-Bromo- phenyl) -6-ethyl- pyrimidin-4-amino] -pentane- 1-ol</td>

<td> 70</td><td>ν \ ι ^ ΝΗ 0. THEBr ^</td><td>3- [2- (4-Bromophenyl) -6-methylpyrimidin-4-amino] propionitrile</td>

193

51174Β

<td>8S</td><td>JU + Hk,</td><td>[2- (4-Bromophenyl) -6-ethylpyrimidin-4-yl] - (4-fluoro-benzyl) amine</td>

<td>9s</td><td>Jl J n</td><td>[2- (4-Bromophenyl) -6-ethylpyrimidin-4-yl] - [2 (4-chloro-phenyl) ethyl] -amine</td>

<td>10S</td><td>N0 „V n υ</td><td>[2- (4-Bromophenyl) -6-ethylpyrimidin-4-yl] pyridin-2-ylmethylamine</td>

<td>11S</td><td>ΛV, LJ ν</td><td>[2- (4-Bromophenyl) -6-methylpyrimidin-4-yl] pyridin-3-ylmethylamine I</td>

194

51174 Β

<td>12S</td><td>Is£/ </td><td>3 - {[2- (4-Bromophenyl) -6-methylpyrimidin-4-ylamino] -methyl} 1H-pyridin-2-one</td>

<td>13S</td><td></td><td>4 - {[2- (4-Bromophenyl) -6-ethylpyrimidin-4-ylamino] -methyl} 1H-pyridin-2-one</td>

<td>14S</td><td>Α ι ^ ΝΗΒ> “</td><td>4- {2- [2- (4-Bromophenyl) -6-methylpyrimidin-4-ylamino] -ethyl} -1Hpyridin-2-one</td>

<td>15S</td><td>X °Ν Ί I4^0</td><td>[2- (3-Chloro-4-fluoro-phenyl) -6-ethyl- Pyrimidin-4-yl] (1,1-dioxohexahydro-116-thiopyran-4-yl) -amine</td>

195

51174 Β

<td>16S</td><td>A ^ γ ^ ΝΛΝ '^ Χ'Ν<° F</td><td>[6-Methyl 1-2- (3,4,5-trifluoro-phenyl) pyrimidin-4-yl] - [2 (1-oxy-pyridin-3-yl) -ethyl] -amine</td>

<td>17S</td><td>1ι 1 Ο5F</td><td>[6-Ethyl-2- (3,4,5- Trifluoro-phenyl) pyrimidin-4-yl] - [2 (1-oxy-pyridin-3-yl) -ethyl] -amine</td>

<td>18S</td><td>1 J! 1 Ο F</td><td>[6-Methyl-2- (2,4,5-trifluoro-phenyl) pyrimidin-4-yl] - [2 (1-oxy-pyridin-3-yl) -ethyl] -amine</td>

<td>19S</td><td>јј ^ С rLnln-Ach0 NC- ^</td><td>4- {4-Methyl-6- [2- (1- oxy-pyridin-3-yl) ethylamino] pyrimidin-2-yl} benzonitrile</td>

196

51174 Β

<td>20C 1</td><td> — N and</td><td>2- [4- (6-Methyl-2-phenyl-pyrimidin-4-ylamino) -phenyl] ethanol</td>

<td>21C</td><td></td><td>[2- (3-Chloro-phenyl) - 6-methyl-pyrimidine 4-yl] -methyl-amine</td>

<td>22C</td><td>Br ..... Me</td><td>2 - {[2- (4-Bromophenyl) -6-methylpyrimidin-4-yl] methyl-amino} ethanol; compound with methane</td>

Examples of GPR119 agonists can be found in International Application JP 2004269468. GPR119 agonists disclosed in JP 2004269468 include but are not limited to the compounds of Table D.

197

51174 Β

TABLE D

<td>Jed, Br.</td><td>Chemical structure</td><td>Chemical name</td>

<td>1D</td><td>λ 'Hr · H “ F</td><td>3- [6-Ethyl-2- (3,4,5-trifluoro-phenyl) pyrimidin-4-amino] -propane-1,2-diol</td>

<td>2D</td><td>'FN ^ 4 F</td><td>(S) -3- [6-Methyl-2- (2,3,5-Trifluorophenyl) -pyrimidin-4-amylamino-propane- 1,2-diol</td>

<td>3D</td><td>FV'V '' <VglJ n Jn</td><td>(S) -3- [2- (4-Bromo-3-fluorophenyl) -6-methyl- pyrimidin-4-amino-propane-1,2-diol</td>

198

51174 Β

<td>4D</td><td>l D / n SH F</td><td>(R) -3- [6-Ethyl-2- (3,4,5-Trifluorophenyl) -pyrimidin-4-ylamino] -propane-1,2-diol</td>

<td>5D</td><td>sk J0 Dč the OHfA ^ h bn</td><td>(R) -3- [2- (3-Chloro- 4-Fluoro-phenyl) -6-ethyl-pyrimidin-4-amino-propane- 1,2-diol</td>

<td>6D</td><td>F hT ^ <F^ OH θTHEF</td><td>(R) -3- [2- (4-) Bromo-2,5-difluoro-phenyl) -5fluoro-6-methyl- pyrimidin-4-amino-propane-1,2-diol</td>

199

51174 Β

(R) -3- [2- (4-Chloro-

2,5-difluoro-phenyl) -

6-Difluoromethylpyrimidin-4-ylamino] -propane-1,2-diol

Examples of GPR119 agonists can be found in International Application JP 2004269469. GPR119 agonists disclosed in JP 2004269469 include but are not limited to the compounds of Table E.

TABLE E

<td>Jed. Br.</td><td>Chemical structure</td><td>Chemical name</td>

<td>1E</td><td>N 1</td><td>5- {2- [2- (4-Bromophenyl) -6-ethylpyrimidin-4-ylamino] -ethyl} -1H-pyridin-2-one</td>

200

51174 Β

<td>2E</td><td>F N0 (^ Υ10F</td><td>5- {2- [6-Methyl-2- (2,4,5-Trifluorophenyl) -pyrimidin-4-ylamino] -ethyl} -1Hpyridin-2-yl</td>

<td>THAT</td><td>FN ^ 4 FHN j ^ 0n^ N- ^ AsAOhF</td><td>5- {2- [2- (4-Chloro- 2,5-difluorophenyl) -6-ethylpyrimidin-4-ylamino] -ethyl} -1Hpyridin-2-one</td>

<td>4E</td><td> 1 ClF Φ ^ ΝΗ / AUFjj- ^ HčAo ji j nΡ '^ γ F</td><td>6-Chloro-4- {2- (6-methyl-2- (2,4,5-trifluoro-phenyl) pyrimidin-4-ylamino] -ethyl} -1-pyridin-2-one</td>

201

51174 Β

<td>5E</td><td>F r ^ NHFOF COURSE h oh F</td><td>4- {1-Hydroxy-2- [6-methyl-2- (2,4,5-trifluoro-phenyl) pyrimidin-4- ylamino] -ethyl} -1H- pyridin-2-one</td>

<td>6E</td><td>FN ^ 4 f ^ NH ofN'«T F</td><td>4- {1-Methyl-2- [6- methyl 2- (2,4,5-trifluoro-phenyl) - pyrimidin-4-ylamino] -ethyl} -1H- pyridin-2-one</td>

In one aspect of the present invention, the GPR119 agonist is a compound consisting of group A1, group B1, group B2, group VZ, group B4, group B5, group S1, group C2, group SZ, group C4, group C5, group C6, group 07, group 08, group 09, group C10, group D1, group D2, group D3, group D4, group D5, group D6, group D7, group D8, group D9, group D10, group D11, group D12, group D13 , groups D14, groups E1, groups E2 or groups F1.

In one aspect of the present invention, any one or more GPR119 agonists may be excluded from any embodiment of the present invention.

202

51174 Β

In one aspect of the present invention, the GPR119 agonist has an EC50 of less than about 10 μΜ, less than about 1 μΜ, less than about 100 nM, less than about 75 nM, less than about 50 nM, less than about 25 nM, less than about 20 pM, less than about 15 nM, less than about 10 nM, less than about 5 nM, less than about 4 nM, less than about 3 nM, less than about 2 pM, or less than about 1 nM. Preferably, the GPR119 agonist has an EC50 of less than about 50 nM, less than about 25 nM, less than about 20 nM, less than about 15 nM, less than about 10 nM, less than about 5 nM, less than about 4 nM, less than about 3 nM, less than about 2 nM, or less than about 1 nM.

In one aspect of the invention, the GPR119 agonist is a selective GPR119 agonist, wherein the selective GPR119 agonist has a selectivity for GPR119 via the corticotrophin-releasing factor-1 (CRF-1) receptor of at least about 100-fold.

In one aspect of the present invention, the GPR119 agonist is orally active.

In one aspect of the present invention, the GPR119 agonist is a human GPR119 agonist.

DPP-IV inhibitors

A class of DPP-IV inhibitors useful in the novel therapeutic combinations of the present invention includes compounds that exhibit an acceptably high affinity for DPP-IV. The DPP-IV inhibitor or a pharmaceutically acceptable salt may be any DPP-IV inhibitor, more preferably a selective dipeptidyl peptidase inhibitor, and most preferably a selective DPP-IV inhibitor.

203

51174Β

Examples of DPP-IV inhibitors are described in Willhauer et al., J Med Chem (2003) 46: 2774-2789, for LAF237; Ahren et al., J Clin Endocrinol Metab (2004) 89: 2078-2084; Villhaueret al., J Med Chern (2002) 45: 2362-2365 for NVP-DPP728; Ahren et al “Diabetes Care (2002) 25: 869-875 for NVPDPP728; Peters et al „Bioorg Med Chem Lett (2004) 14: 1491-1493; Caldwell et al., Bioorg Med Chem Lett (2004) 14: 1265-1268; Edmondson et al., Bioorg Med Chem Lett (2004) 14: 5151-5155; and Abe et al., J Nat Prod (2004) 67: 999-1004.

Specific examples of DPP-IV inhibitors include, but are not limited to, dipeptide derivatives or dipeptide mimetics such as alanine pyrrolidide, isoleucinthiazolidide, and the pseudosubstrate N-valyl prolyl, O-benzoyl hydroxylamine, as described, e.g., in US Pat. No. 6,303,661.

Examples of DPP-IV inhibitors can be found in U.S. Pat. Numbers 6,869,947, 6,867,205, 6,861,440, 6,849,622, 6,812,350, 6,803,357, 6,800,650, 6,727,261,6,716,843, 6,710,040, 6,706,742, 6,645,995, 6,617,340, 6,699,871, 6,537,287, 6 / 432,061, 6,395, 6,395, 6,395, 6,395, 6,395, 6,395, 6,395 Examples of DPP-IV inhibitors can be found in U.S. Pat. applications no. 2005059724, 2005059716, 2005043292, 2005038020, 2005032804, 2005004205, 2004259903, 2004259902, 2004249883, 2004254226, 2004242898, 2,004,229,926.2004180925, 2004176406, 2004138214, 2004116328, 2004875817 2003225102, 2003216450, 2003216382, 2003199528, 2003195188, 2003162820, 2003149071, 2003134802, 2003130281, 2003130199 , 2003125304,

204

51174 Β

2003119750, 2003119738, 2003105077, 2003100563, 2003087950, 2003078247, 2002198205, 2002183367,2002103384, 2002049164, 2002006899.

Primeri DPP-IV inhibitora mogu biti pronađeni u međunarodnim prijavama WO 2005/087235, WO 2005/082348, WO 2005/082849, WO 2005/079795, WO 2005/075426, WO 2005/072530, WO 2005/063750, WO 2005/058849 , WO 2005/049022, WO 2005/047297, WO 2005/044195, WO 2005/042488, WO 2005/040095, WO 2005/037828, WO 2005/037779, WO 2005/034940, W02005/033099, WO 2005/032590, WO 2005/030751, WO 2005/030127, WO 2005/026148, VV02005/025554, WO 2005/023762, WO 2005/020920, WO 05/19168, WO 05/12312, WO 05/12308, WO 05/12249, WO 05/11581, WO 05/09956, WO 05/03135, WO 05/00848, WO 05/00846, WO 04/112701, WO 04/111051, WO 04/111041, WO 04/110436, WO 04/110375, WO 04/108730, WO 04/104216, WO 04/104215, WO 04/103993, WO 04/103276, WO 04/99134, WO 04/96806, WO 04/92128, WO 04/87650, WO 04/87053, WO 04/85661, WO 04/85378, WO 04/76434, WO 04/76433, WO 04/71454, WO 04/69162, WO ¢4/67509, WO 04/64778, WO 04/58266 , WO 04/52362, WO 04/53850, WO 04/50022, WO 04/50658, WO 04/48379, WO 04/46106, WO 04/43940, WO 04/41820, WO 04/41795, WO 04/37169, WO 04/37181, WO 04/33455, WO 04/32836, WO 04/20407, WO 04/18469, WO 04/18468, WO 04/18476, WO 04/14860, WO 04/09544, WO 04/07468, WO 04/07446, WO 04/04661, WO 04/00327, WO 03/106456, WO 03/104229, WO 03/101958, WO 03/101448, WO 03/99279, WO 03/95425, WO 03/84940, WO 03/82817, WO 03/80633. WO 03/74500, WO 03/72556, WO 03/72528, WO 03/68757, WO 03/68748, WO 03/57666, WO 03/57144, WO 03/55881,

205

51174 Β

WO 03/45228, WO 03/40174, WO 03/38123, WO 03/37327, WO 03/35067, WO 03/35057, WO 03/24965, WO 03/24942, WO 03/22871, WO 03/15775, WO 03/04498, WO 03/04496, WO 03/02530, WO 03/02596, WO 03/02595, WO 03/02593, WO 03/02553, WO 03/02531, WO 03/00181, WO 03/00180, WO 03/00250, WO 02/83109, WO 02/83128, WO 02/76450, WO 02/68420, WO 02/62764, WO 02/55088, WO 02/51836, WO 02/38541, WO 02/34900, WO 02/30891, WO 02/30890, WO 02/14271, WO 02/02560, WO 01/97808, WO 01/96295, WO 01/81337, WO 01/81304, WO 01/68603, WO 01/55105, WO 01/52825, WO 01/34594, WO 00/71135, WO 00/69868, WO 00/56297, WO 00/56296, WO 00/34241, WO 00/23421, WO 00/10549, WO 99/67278, WO 99/62914, WO 99/61431, WO 99/56753, WO 99/25719, WO 99/16864, WO 98/50066, WO 98/50046, WO 98/19998, WO 98/18763, WO 97/40832, WO 95/29691, WO 95/15309, WO 93/10127, WO 93/08259, WO 91/16339, EP 1517907, EP 1513808, EP 1492777, EP 1490335, EP 1489088, EP 1480961, EP 1476435, EP 1476429, EP 1469873, EP 1465891, EP 1463727, EP 1461337, EP 1450794, EP 1446116, EP 1442049, EP 1441719, EP 1426366, EP 1412357, EP 1406873, EP 1406872, EP 1406622, EP 1404675, EP 1399420, EP 1399471, EP 1399470, EP 1399469, EP 1399433, EP 139915 , EP 1355886, EP 1354882, EP 1338592, EP 1333025, EP 1304327, EP 1301187, EP 1296974, EP 1280797, EP 1282600, EP 1261586, EP 1258476, EP 1254113, EP 1248604, EP 12458 1228061, EP 1137 EP 1104293, EP 1082341, EP 1050540, EP 1043328, EP 0995440, EP 0980249, EP 0975359, EP 0731789, EP 0641347, EP 0610317, EP 0528858, CA 2466870, CA 2433090, CA 2339537, CA 2289125, CA 2289124, CA 2123128, DD 296075, DE 19834591, DE 19828113, DE

206

51174Β

19823831, DE 19616486, DE 10333935, DE 10327439, DE 10256264, DE 10251297, DE 10238477, DE 10238470, DE 10238243, DE 10143840, FR 2824825, FR 2822826, JP 2005507261, JP 2005505531, JP 2005502624, JP, 20055005026321 JP 2005500308321, JP JP 2005023038, JP 2004536115, JP 2004535445, JP 2004535433, JP 2004534836, JP 2004534815, JP 2004532220, JP 2004530729, JP 2004525929, JP 2004525179, JP 2004522786, JP 2004521129, JP 2004435353512, JP 2007435353512 , JP 2004026820, JP 2004026678, JP 2004002368, JP 2004002367, JP 2003535898, JP 2003535034, JP 2003531204, JP 2003531191, JP 2003531118, JP 2003524591, JP 2003520849, JP 2003327532, JP 2003300977, JP 2003238566, JP 20025315472 2002, JP 2002 , JP 2002356471, JP 2002265439, JP 2001510442, JP 2000511599, JP 2000327689, JP 2000191616, JP 1998182613, JP 1998081666, JP 1997509921, JP 1995501078, JP 1993508624.

In one aspect of the present invention, the DPP-IV inhibitor is valine pyrrolidide [Deacon et al., Diabetes (1996) 47: 764769].

In one aspect of the present invention, the DPP-IV inhibitor is 3- (Lizoloucil) thiazolidine (isoleucine-thiazolidide). Isoleucine-thiazolidide can be found in JP 2001510442, WO 97/40832, US 6,303,661 and DE 19616486.

Isoleucine-thiazolidide has been described as an orally active selective DPP-IV inhibitor [Pederson et al, Diabetes (1998) 47: 1253-1258].

207

51174 Β

NVP-DPP728 has been described as an orally active and selective DPP-IV inhibitor [Villhauer et al, J Med Chem (2002) 45: 2362-2365],

In one aspect of the present invention, the DPP-IV inhibitor is a 3 (R) -Amino-

1- [3- (trifluoromethyl) -5,6,7,8-tetrahydro [1,2,4] triazolo [4,3-a] pyrazin-7-yl] -4 (2,4,5-trifluorophenyl) butan-1-one (MK-0431). MK-0431 can be found in EP 1412357, WO 03/04498, US 6,699,871 and US 2003100563. MK-0431 has been described as an orally active and selective DPP-IV inhibitor [Weber et al., Diabetes (2004) 53 (Supp 1.2) : A151,633-P (Abstract)].

In one aspect of the present invention, the DPP-IV inhibitor is [1 - [(3-hydroxy-1-adamantyl) amino] acetyl] -2-cyano- (S) -pyrrolidine (LAF237) LAF237 can be found in US 6,166,063, WO 00 / 34241, EP 1137635, and JP 2002531547.

LAF237 has been described as an orally active and selective ĐPP-IV inhibitor [Villhauer et al, J Med Chem (2003) 46: 2774-2789].

In one aspect of the present invention, the DPP-IV inhibitor is (1S, 3S, SS) -

2- [2 (S) -Amino-2- (3-hydroxyadamantan-1-yl) acetyl] -2azabicyclo [3.1.0] hexane-3-carbonitrile (BMS-477118).

In one aspect of the present invention, the DPP-IV inhibitor is [1- [2 (S) amino-3-methylbutyryl] pyrrolidin-2 (R) -yl] boronic acid (PT-100).

In one aspect of the present invention, the DPP-IV inhibitor is GSK823093.

In one aspect of the present invention, the DPP-IV inhibitor is PSN-9301.

In one aspect of the present invention, the DPP-IV inhibitor is T-6666.

208

51174 Β

In one aspect of the present invention, the DPP-IV inhibitor is SYR-322.

In one aspect of the present invention, the DPP-IV inhibitor is SYR-619.

In one aspect of the present invention, the DPP-IV inhibitor is CR-14023.

In one aspect of the present invention, the DPP-IV inhibitor is CR-14025.

In one aspect of the present invention, the DPP-IV inhibitor is CR-14240. In one aspect of the present invention, the DPP-IV inhibitor is CR-13651.

In one aspect of the present invention, the DPP-IV inhibitor is NNC-722138.

In one aspect of the present invention, the DPP-IV inhibitor is NN-7201.

In one aspect of the present invention, the DPP-IV inhibitor is RNH-1149.

In one aspect of the present invention, the DPP-IV inhibitor is RNH-1004. In one aspect of the present invention, the DPP-IV inhibitor is SNT189379.

In one aspect of the present invention, the DPP-IV inhibitor is GRC-8087. In one aspect of the present invention, the DPP-IV inhibitor is PT-630.

In one aspect of the present invention, the DPP-IV inhibitor is SK-0403.

In one aspect of the present invention, the DPP-IV inhibitor is GSK825964.

In one aspect of the present invention, the DPP-IV inhibitor is TS-021.

In one aspect of the present invention, the DPP-IV inhibitor is GRC-8200. In one aspect of the present invention, the DPP-IV inhibitor is GRC-8116.

In one aspect of the present invention, the DPP-IV inhibitor is FE107542.

In one aspect of the present invention, the DPP-IV inhibitor is selected from the right choline of Table B.

209

51174 Β

In one aspect of the present invention, the DPP-IV inhibitor is not identical to 1- [2- (5-cyanopyridin-2-yl) amino] ethylamino] acetyl-2-cyano- (S) -pyrrolidine (NVP-DPP728).

In one aspect of the present invention, any one or more DPP-IV inhibitors may be excluded from any embodiment of the present invention.

In one aspect of the present invention, the DPP-IV inhibitor has an IC50 of less than about 10 μΜ, less than about μΜ, less than about 100 nM, less than about 75 nM, less than about 50 pM, less than about 25 nM, less than about 20 nM, less than about 15 pM, less than about 10 nM, less than about 5 pM, less than about 4 nM, less than about 3 nM, less than about 2 nM, less than about 1 nM. Preferably, the DPP-IV inhibitor has an IC50 of less than about 50 nM, less than about 25 nM, less than about 20 nM, less than about 15 nM, less than about 10 pM, less than about 5 nM, less than about 4 nM, less of about 3 nM, less than about 2 nM or less than about 1 nM.

In one aspect of the present invention, the DPP-IV inhibitor is a selective DPP-IV inhibitor, wherein the selective DPP-IV inhibitor has a selectivity for human plasma DPP-IV greater than one or more of PPCE, DPP-II, DPP-8 and DPP- 9 of at least about 10 times, more preferably at least about 100 times and most preferably at least about 1000 times.

In one aspect of the present invention, the DPP-IV inhibitor is a human DPP-IV inhibitor.

A combination of GPR119 agonists and DPP-IV inhibitors

210

51174 Β

By way of illustrative example only and not limitation, an exemplary combination of GPR119 agonists and DPP-IV inhibitors according to the present invention is provided by selecting GPR119 agonists from the left column of Table B and DPP-IV inhibitors from the right column of Table B. It is explicitly contemplated that each individual combination of GPR119 agonists and DPP-IV inhibitors provided by the selection of GPR119 agonists from the left column of Table B and DPP-IV inhibitors from the right column of Table B is a separate embodiment within the scope of the present invention.

TABLE B

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>[6- (4-Benzensulfonil-piperidin-1-yl) - 5-nitro-pyrimidin-4-yl] -methanesulfonyl phenyl) -amine</td><td>Governor-pirolidid</td>

<td>{4- [6- (4-Methanesulfonyl-phenylamino) - 5-nitro-pyrimidin-4-yl] piperazin-1-yl} - acetic acid ethyl ester</td><td>3- (L-isoleucyl) thiazolidine (isoleucinthiazolidide)</td>

<td>(2-Fluoro-4-methanesulfonyl-phenyl) - {6- [4- (3-isopropyl- [1,2,4] oxadiazol-5tl) -piperidin-1-yl] -5-nitro-pyrimidin-4-yl} -amine</td><td>1- [2- (5-cyanopyridin-2-yl) amino] ethylamino] acetyl-2-cyano- (S) pyrrolidine (NVP-DPP728)</td>

<td>6 '- [4- (2-Methoxycarbonyl-acetyl) phenoxy] -3'-nitro-3,4,5,6-tetrahydro-2H- [1,2'] bipyridinyl-4-carboxylic acid ethyl ester</td><td>3(R)-Amino-1-[3-(trifluorometil)5A7,8-tetrahidro[1,2,4]triazolo[4,3ajpirazi η-7-i (]-4-(2,4,5trifluorofenil)butan-1-on (MK-0431)</td>

<td>1- (4- (4-Acetyl-3'-nitro-3l4,5,6-Tetrahydro-2H- [1,2 '] bipyridinyl-6'-yloxy) -phenyl] ethanone</td><td>(1 - [[3-hydroxy-1-adamantyl) amino] acetyl] -2-cyano- (S) -pyrrolidine (LAF237)</td>

211

51174 Β (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>6 '- [4- (4-Hydroxy-benzenesulfonyl) phenoxy] -3'-nitro-3,4,5,6-tetrahydro-2H- [1,2'] bipyridinyl-4-carboxylic acid ethyl ester</td><td>(1S, 3S, 5S) -2- [2 (S) -Amino-2- (3-hydroxyadamantan-1-yl) acetyl] -2azabicyclo [3.1.0] hexane-3-carbonitrile (BMS-477118)</td>

<td>1- [5- (4-Benzoyl-phoenix) -2-nitro-phenyl] piperidine-4-carboxylic acid ethyl ester</td><td>[1- [2 (S) -Amino-3-methylbutyryl] pyrrolidin-2 (R) -yl] boronic acid (PT-100)</td>

<td>1- {5- [4- (2-Methoxycarbonyl-acetyl) phenoxy] -2-nitro-phenyl} -piperidin-4carbonska kiselina ethyl estar</td><td>GSK-823093</td>

<td>-(5-(2-Amino-4-etansulfonil-fenoksi)- 2-Nitro-phenyl] -piperidine-4-carbon acid ethyl ester</td><td>PSN-9301</td>

<td>5-Bromo-1 - [4-nitro-3- (4-propylpiperidin-1 -yl) -phenyl] -1 H-pyridine-2-one</td><td>T-6666</td>

<td>6’-Benzensulfonilamino-3’-nitro- 3,4,5,6-tetrahydro-2H- [1,2 '] bipiFidinil- 4-carboxylic acid ethyl ester</td><td>SYR-322</td>

<td>6 '' (Benzenesulfonyl-methyl-amino) -3'-nitro-3,4,5,6-tetrahydro-2H [1,2 '] bipyridinyl) -4-carboxylic acid ethyl ester</td><td>SYR-619</td>

<td>6 '- (Benzenesulfonyl-butyl-amino) -3'-nitro-3,4,5,6-tetrahydro-2H [1,2'] bipyridinyl) -4-carboxylic acid ethyl ester</td><td>CR-14023</td>

212

51174Β (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>1- [5- (4-Benzoyl-phenylamino) -2-nitrophenyl] -piperidine-4-carboxylic acid ethyl ester</td><td>CR-14025</td>

<td>{4- [4-Nitro-3- (4-propyl-piperidin-1-il) fenilamina] -phenyl} -phenyl-methanone</td><td>CR-14240</td>

<td>3- [6 (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxymethyl] -pyrrolidine-1-carboxylic acid tert-butyl ester</td><td>CR-13651</td>

<td>4- [5-Cyano-6- (6-methylsulfanyl-pyridine 3-Ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid ethyl ester</td><td>NNC-72-2138</td>

<td>4- [5-Cyano-6- (6-methanesulfonylpyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid ethyl ester</td><td>NN-7201</td>

<td>4- [6- (4-Methanesulfonyl-phenylamino) -5-nitro-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester</td><td>RNH-1149</td>

<td>(4-Methanesulfonyl-Phenyl) - [5-nitro-6- (piperidin-4-delight) -pyrimidin-4-yl] amino</td><td>RNA 1004</td>

<td>1- {4- [6- (4-Methanesulfonyl-phenylamino) - 5-Nitro-pyrimidin-4-yloxy] -piperidin-1-yl} -3,3-dimethyl-butan-1-yl</td><td>SNT-189379</td>

213

51174 Β (continued)

<td>GPR119agonist</td><td>DPP-IV inhibitor</td>

<td>4- [6- (4-Methanesulfonyl-phenylamino) 5-nitro-pyrimidin-4-ylamino] -piperidine-1-carboxylic acid tert-butyl ester</td><td>GRC-8087</td>

<td>N- (4-Methanesulfonyl-phenyl) -5-nitro-N'piperidin-4-yl-pyrimidine-4,6-diamine</td><td>PT-630</td>

<td>1- {4- [6- (4-Methanesulfonyl-phenylamino) - 5-Nitro-pyrimidin-4-ylamino] -piperidine- 1-yl} -etanon</td><td>SK-0403</td>

<td>4- [6- (4-Cyano-2-fluoro-phenylamino) - 5-Ethynyl-pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>GSK-825964</td>

<td>4- [5-Ethynyl-6- (2-fluoro-4- [1,2,4] Triazol-1-yl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>8-(3-Aminopiperidin-1 -il-N2,7dibenzil-1-metilguanin trifluoroacetat</td>

<td>4- {5-Ethynyl-6- [1- (3-isopropyl- [1,2,4] Oxadiazol-5-yl) -piperidin-4-yloxy] -pyrimidin-4-ylamino} -3-fluorobenzonitrile</td><td>N- [2- [2- [8- (3-Aminopiperidin-1-yl) -7 (2-butynyl) -3'-methylxanthin-1-yl] acetyl] phenyl] formamide</td>

<td>4- [5-Acetyl-6- (6-methane are Ifon and Ipyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isobutyl ester</td><td>8-[3(R)-Aminopiperidin-1-il]-7-(2butinil)-3-metil-1-(hinazolin-2ilmetil)ksantin</td>

<td>1- [4- (1-Benzyl-azetidin-3-yloxy) -6-methanesulfonyl-pyridin-3-ylamino) -pyrimidin-5-yl] -ethanone</td><td>8- (3-Aminopiperidin-1 -yl) -1 - (Benzo [c] -1,8-naphthyridin-6-ylmethyl) -7- (2-butynyl) -3-methylxanthine</td>

214

51174 Β (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>4- [5-Cyano-6- (6-propylamino-pyridin-3-ylamino) -pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester</td><td>2- [8-3 (R) -Aminopiperidin-1-yl] -7- (2butinil) -3-metilksantin-1-yl] -N- (2-pyridyl) acetamide</td>

<td>4 - ({[6- (2-Fluoro-4-methanesulfonylphenylamino) -5-methyl-pyrimidin-4-yl] isopropyl-amino} -methyl) -piperidine-1-carbon chiselin tert-butyl ester</td><td>2- (3-Aminopiperidin-1 -yl) -3- (2- butynyl) -5- (hydroxalin-6-ylmethyl) -4,5-dihydro-3H-imidazole [4,5-d] -pyridazin4-one</td>

<td>4- (2-Fluoro-4-methanesulfonylphenoxy) -6- [1- (3-methoxy-propyl) -piperidine-4-delight] -5-methyl-pyrimidine</td><td>(1S, 3S, 5S) -2- [2 (S) -Amino-4,4-dimethylpentanoyl] -2azabicyclo [3.1.0] hexane-3 (S> carbonitrile trifluoroacetate</td>

<td>1- {4- [6- (2-Fluoro-4-methanesulfonyl- phenoxy) -5-methyl-pyrimidin-4-delight] piperidin-1-yl} -3-methoxy-propan-2-ol</td><td>N1- (1-Cijanpetil) -N1,3-dimethyl-L valinamid</td>

<td>4- {6- [2-Fluoro-4- (5-isopropoxymethyl- [1,2,4] Oxadiazol-3-yl) -phenoxy] -5-methyl-pyrimidin-4-yloxy-piperidine-1-carboxylic acid isopropyl ester</td><td>(1S, 3S, 5S) -2- [2 (S) -Amino-2- [1- (3,3-dimethylbutyryl) -piperidin-4-yl] -acetyl] -2azabicyclo [3.1.0] hexane-3- carbonitrile</td>

<td>4- [6- (2-Fluoro-4-morpholine-4-ylphenoxy) -5-methyl-pyrimidine-4-yloxy] piperidine-1-carbonska kiselina isopropyl estar</td><td>2- [7- (2-Butynyl) -1- (2-phenylethyl) -8- (1-piperazinyl) xanthine-3-yl] -N- (2-propynyl) acetamide hydrochloride</td>

215

51174 Β (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>{4- [6- (2-Fluoro-4-methanesulfonylphenoxy) -5-methyl-pyrimidine-4-ioxy] piperide n-1 -yl} - [6- (2-pyrrolidin-1 -yl-ethyl) pyridin-3-yl] -methanone</td><td>2- [7- (2-Butynyl) -1- (3-cyanobenzyl) -6oxo-8- (1-piperazinyl) -6,7-dihydro-1H-purin-2-yloxy] -N methylbenzamide trifluoroacetate</td>

<td>(6-Amino-pyridin-3-yl) {4- [6- (2-fluoro- 4-Methanesulfonyl-phenoxy) -5-methyl-pyrimidin-4-yloxy] -piperidin-1-yl} -methanone</td><td>2- [3- (2-Butynyl) -4-oxo-2- (1- piperazinyl) -4,5-dihydro-3Himidazole [4,5-d] pyridazin-5-ylmethylbenzonitrile trifluoroacetate</td>

<td>4 - ({Cyclopropyl- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yl] -amino} -methyl) piperidine-1-carboxylic acid tert-butyl ester</td><td>N- [1 (S) - [2 (S) -Cyanopyrrolidin-1-ylcarbonyl] -4 ~ (pyrazin-2-ylcarboxamido) -butyl] -carbamic acid 1-acetoxyethyl ester</td>

<td>4 - ({Cyclopropyl- [6- (2-fluoro-4-methanesulfonyl-phenoxy) -5-methylpyrimidin-4-yl] -amino} -methyl) piperidine-1-carboxylic acid isopropyl ester</td><td>2(S),4-Diamino-1-(4- triomorpholinyl) butan-1-one</td>

<td>4 - ({[6- (2-Fluoro-4-methanesulfonylphenoxy) -5-methyl-pyrimidin-4-yl] isopropyl-amino} -methyl) -piperidine-1-carbon dioxide isopropyl ester</td><td>1 - [Perhidroindol-2 (S) - ylcarbonyl] azetidine-2 (S) -carbonitrile</td>

<td>4- [6- (2-Fluoro-4-methanesulfonylphenylamino) -5-methyl-pyrimidin-4ylsulfanyl] -piperidine-1-carboxylic acid isopropyl ester</td><td>1-(2-Benzotiazolil)-1- [1 [(2S, 3aS, 7aS) -perhidroindol-2ilkarbonil] pyrolidine-2 (S) -il] methane chloride</td>

216

51174Β (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>4- [1- (4-Methanesulfonyl-phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester</td><td>142 (S) -amino-2-cyclohexylacetyl] -4- methylazetidine-2-carbonitrile hydrochloride</td>

<td>4- [1- (4-Methanesulfonyl-phenyl) -3-methyl-1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid tert-butyl ester</td><td>642- [2- (S) -Cyano-4,5-dihydro-1H-pyrazol-1-yl] -2-oxoethylamino] ethylamino] pyridine-3-carbonitrile</td>

<td>4- [1- (4-Methanesulfonyl-phenyl) -3,6-dimethyl-1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidine-1-carboxylic acid tert-butyl ester</td><td>64242- [2 (S) -cyano-4 (S) - fluoropirolidin-1-yl] -2-oksoetilamino] - 2-metilprop; iamino] -N, N- dimethylpyridine-3-sulfonamide</td>

<td>4-({[1-(2,5-Difluoro-feni!)-1H- Pyrazolo [3,4-d] pyrimidin-4-yl] -methylamino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester</td><td>trans-N-[4-[1 (S)-Amino-2-[3(S)fluoropirolidin-1il]-2oksoetil]cikloheksil]-2,4difluorobenzensulfonamid</td>

<td>2- {4- [1- (2-Fluoro-4-methanesulfonyl- phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy] -piperidin-1- (4- trifluoromethoxy-phenyl) -ethanone</td><td>2 (S) -Amino-1- (1-pyrrolidinyl) -244 [thiazol-2-ylamino) cyclohexyl] ethanone trifluoroacetate</td>

<td>24441- (2-Fluoro-4-methanesulfonyl- phenyl) -1H-pyrazolo [3,4-d] pyrimidin-4-yloxy} -piperidin-1-yl} -143-fluorophenyl) -ethanone L.</td><td>N4 (1R, 3R) -341 (S) -Amino-2-oxo-2 (1-pyrrolidinyl) ethyl] cyclopentyl] -4 (methylsulfonyl) benzenesulfonamide</td>

217

51174 Β (ηastavak) _____

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>4- [9- (6-Methanesulfonyl-pyridin-3-yl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid isobutyl ester</td><td>3(R)-Amino-1-(6-benzil)-3-metil- 5,6,7,8-tetrahidroimidazol [1,2a] pirayin-7-il) -4- (3,4d ifl uorofen il) b utan -1 -on</td>

<td>{4- [9- (6-Metansulfonil-piridin-3-il) -9H-purin-6-delight] -pipendin-1-il} piridin-3-il-methanone</td><td>trans-N- [4- [1 (S) -Amino-2-oxo-2- (1-pyrrolidinyl) ethyl] cikloheksil] -2,4difluorobenzensulfonamid</td>

<td>4- [9- (4-Methanesulfonyl-phenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid tert-butyl ester</td><td>3(R)-Amino-4-(2,5-difluorofenil)-1- [4-hydroxy-2- (trifluoromethyl) -5,6,7,8tetrahidropirido [3,4-d] pyrimidin-7- he] butan-1-one</td>

<td>4- [9- (2-Fluoro-4-propionylsulfamoylphenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>N-[(1R,3R)-3-[1(S)-Amino-2-okso-2(1-pirolidini!)etil]ciklopentil]-2(metilsulfonamido)etansulfonamid</td>

<td>4- [9- (4-Cyano-2-fluoro-phenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid isopropyl ester -</td><td>2-[4-[3(R)-Amino-4-(2- fluorophenyl) butyryl] -3 (R) benzylpiperazin-1-yl] -N- [3 (methylsulfonamido) phenyl] acetamide</td>

<td>4- [9- (2-Fluoro-4-sulfamoyl-phenyl) -9H-purin-6-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>3 (R) -Amino-1- (3-thiazolidinyl) -4- (2,4,5-trifluorofenil) butan-1-on</td>

<td>4- [3- (4-Methanesulfonyl-phenyl) -3 H [1,2,3] triazolo [4,5-d] pyrimidin-7- Iloxy] -piperidine-1-carboxylic acid tert-butyl ester</td><td>4-[3(R)-Amino-4-(2,4,5- triflorofenil) butyryl] -3 (R) -methyl-1,4- diazapan-2-on</td>

218

51174 Β __________ (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- [1- (3-izopropil- [1,2,4] oksadiazol-5il) -piperidin-4-delight] -3H [1 ,2,3]triazolo[4,5-d]pirimidin</td><td>3(S)-Amino-4-(3,3-difluoropirolidin- 1-yl) -N, N-dimethyl-4-okso-2 (S) - [4- ([1,2,4] troazolo [1,5-a] pi ridin-6-yl) phenyl] butyramide</td>

<td>3-Fluoro-4- {7- [1- (3-isopropyl- [1,2,4] Oxadiazol-5-yl) -piperidin-4-yloxy] - [1,2,3] triazolo [4,5-d] pyrimidin3-yl} -N-propionyl-benzenesulfonamide</td><td>3(R)-Amino-1-[2-(trifluorometil)- 5,6,7,8-tetrahidro[1,2,4]triazolo[1,5a]pirazon-7-il]-4-(2,4,5trifluorofenil)butanon hlorhidrat</td>

<td>3-Fluoro-4- {7- [1- (3-isopropyl [1,2,4] oxadiazol-5-yl) -piperidin-4-yloxy] - [1,2,3] triazolo [4,5-d] pyrimidin3- or} -benzonitrile</td><td>2 (S) -Amino-3 (S) - (4-fluorophenyl) -1- (3- thiazolidine yl) butan-1-one</td>

<td>4- [3- (4-Methanesulfonyl-phenyl) isoxazolo [4,5-d] pyrimidin-7-yloxy] piperidine-1-carboxylic acid tert-butyl ester</td><td>7- [3 (R) -Amino-4- (2,5-difluorophenyl) butyryl] -5,6,7,8-tetrahydroimidazo [1,2-a] pyrazine-2-carbon kisene ethyl ester</td>

<td>4 - ({Ethyl- [3- (4-methanesulfonyl-phenyl) -isoxazolo [4,5-d] pyrimidin-7-yl] amino} -methyl) -piperidine-1-carboxylic acid tert-butyl ester</td><td>3(R)-Amino-1 -(8-hloro-1,2,3,4tetrahidropirazion[1,2a]benzimidazol-2-il)-4-2,5difluorofenil)butan-1 -on trifluoracetat</td>

<td>4- [3- (4-Methanesulfonyl-phenyl) isoxazolo [4,5-d] pyrimidin-7-ylsulfanyl] piperidine-1-carboxylic acid tert-butyl ester</td><td>3(R)-Amino-(2,5-difluorofenil)-1-[2- (4-fluorophenyl) -4,5,6,7tetrahydrothiazolo [4,5-c] pyridin-5-yl] butan-1-one</td>

219

51174 Β (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor .. ..</td>

<td>4- [3- (4-Methanesulfonyl-phenyl) - isoxazolo [4,5-d] pyrimidin-7-oxy] piperidine-1-carboxylic acid isopropyl ester</td><td>2-[4-2-[3(R)-Amino-4-(2- fluorophenyl) butyryl] -1,2,3,4tetrahydroisoquinolin-3-ylcarboxamidomethyl] phenyl] acetic acid</td>

<td>4- [8- (2-Fluoro-4-methanesulfonyl-phenyl) - [1,7] Naphthyridin-4-yloxy] -piperidine-1 carboxylic acid isopropyl ester</td><td>3(S)-Amino-2-oksopiperidin-1 ilfosfonski diamid hlorhidrat</td>

<td>4- [8- (2-Fluoro-4-methanesulfonyl-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>2- [2- (5-Nitropyridin-2-ylamino) ethylamino] -1- (1-pyrrolidinyl) ethanone dihydrohydrate</td>

<td>4- [8- (4-Methanesulfanyl-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>2- [8- (3-Aminopiperidin-1-yl) -1,3-dimethylxanthin-7-ylmethyl] benzonitrile hemisuccinate</td>

<td>4- [8- (4-Methanesulfonyl-phenyl) -quinolin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester -</td><td>2 (S) -Amino-2-cikloheksil-1- (3,3,4,4tetrafluoropirolidin-1-il) etanon hlorhidrat</td>

<td>4- [8- (2-Fluoro-4-methanesulfonyl-phenyl) pyrido [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester</td><td>2(S)-Amino-2-cikloheksil-1 -(3fluoropirolidin-1 -il)etanon</td>

<td>4- [8- (2-Fluoro-4-propionylsulfamoylphenyl) -pyrido [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester</td><td>2-Amino-1-ciklopentil-3-metilpentan- 1-on hlorhidrat</td>

220

51174 Β (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>4- [8- (4-Cyano-2-fluoro-phenyl) pyrido [3,4-d] pyrimidin-4-yloxy] piperidine-1-carboxylic acid isopropyl ester</td><td>4-Amino-5-oxo-5- (1-pyrrolidinyl) pentanamide</td>

<td>3- (2-Fluoro-4-methanesulfonyl-phenyl) -7- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -cyclohexyloxy] -pyrazolo [1,5-pyrimidine</td><td>1 ~ [2- [1,1-Dimethyl-2- (6-phenylpyridin-2-ylamino) ethylamino] acetyl] pyrrolidine2 (S) -carbonitrile hydrochloride</td>

<td>3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) cyclohexyloxy] pyrazolo [1,5 a] pyrimidin-3-yl) -N-propionylbenzenesulfonamide</td><td>(7R*,8S*13bS*)-7-Butil-11,12- dimetoksi-, 3,4,4a, 6,7,8,9,9a, 13bdekahidro-1 H-pirido [1,2f] fenantridin-8-amin</td>

<td>3-Fluoro-4- {7- [4- (3-isopropyl- [1,2,4] oxadiazol-5-yl) cyclohexyloxy] pyrazolo [1,5a] pyrimidin-3-yl} -benzonitrile. -</td><td>5- (Aminomethyl-6- (2,4-dichlorophenyl) -2- (3,5-dimetoxifenil) pyrimidin-4-amine</td>

<td>4- [3- (2-Fluoro-4-methanesulfonyl-phenyl) 1-methyl-1H-pyrazolo [4,3-d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>3- (Aminomethyl) -4- (2,4-dichlorophenyl) - 7,9-dimethoxy-5H-indeno [1,2b] pyridin-2-amine</td>

<td>4- [3- (2-Fluoro-4-propionylsulfamoylphenyl) -1-methyl-1H-pyrazolo [4,3-d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>5- (Aminomethyl) -6- (2,4-dichlorophenyl) - N2- (2-methoxyethyl) -N2-methylpyrimidine- 2,4-diamine</td>

221

51174 Β (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>4- [3- (4-Cyano-2-fluoro-phenyl) -1-methyl- 1H-pyrazolo [4,3-d] pyrimidin-7-yloxy] piperidine-1-carboxylic acid isopropyl ester</td><td>4,4-Difluoro-1- [2- [exo-8- (2pyrimidinyl) -8-aza bicyclo [3.2.1] oct-3-amino] acetyl] pyrrolidin-2 (S) carbonitrile</td>

<td>4- [3- (2-Fluoro-4-methanesulfonyl-phenyl) - 2-Methyl-2H-pyrazolo [4,3-d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>exo-3- [2- [8- (2-Pyrimidinyl) -8-azabicyclo [3.2.1] oct-3- ylamino] acetyl] thiazolidin-4 (R) carbonitrile</td>

<td>4- [3- (2-Fluoro-4-propionylsulfamoylphenyl) -2-methyl-2H-pyrazolo [4,3d] pyrimidin-7-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>1 - [2- [3- (2,3-Dihidro-1 H-izoinodl-2-il) - 1,1-dimethyl-3-oxopropylamino] acetyl] pyrrolidin-2 (S) -carbonitrile</td>

<td>4- [3- (4-Cyano-2-fluoro-phenyl) -2-methyl2H-pyrazolo [4,3-d] pyrimidin-7-yloxy] piperidine-1-carboxylic acid isopropyl ester</td><td>8-(3-Aminoperhidroazepin-1-il)-3metil-7-(2-metilbenzil)-2,3,6,7tetrahidro-1 H-purin-2,6-dion</td>

<td>4- [4- (3-Isopropyl- [1,2,4] oxadiazol-5-yl) -piperidin-1-yl] -6- (4-methanesulfonylphenoxy) -pyrimidine</td><td>8-[3(R)-Aminopiperidin-1-il]-7-(5fluoro-2-metilbenzil)-1,3dimetilksantin</td>

<td>(6-[4-(3-lzopropil-[1,2,4]oksadiazol- 5-yl) -piperidin-1-yl] pyrimidine-4-yl} - (4metansulfonil-Fenio-amin</td><td>2- [2- (3-Aminopiperidin-1-yl) -6,7-dimethoxy-4-oxo-3,4-dihydroquinazolin-3-ylmethyl] benzonitrile</td>

<td>4 - {[6- (2-Fluoro-4-methanesulfonylphenylamino) -pyrimidin-4-yl] -methylamino} -piperidine-1-carboxylic acid tert-butyl ester</td><td>1-[2(S)-Amino-3,3-dimetilbutiril]- 4 (S) -fluoropyrrolidine-2 (S) -carbonitrile hydrochloride</td>

222

51174 Β (continued) ___

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>4- (6- (2-Fluoro-4-methanesulfonylphenylamino) -pyrimidin-4-yloxypiperidine-1-carboxylic acid tert-butyl ester</td><td>2- [3- (Aminomethyl) -4-butoxy-2- (2,2-dimethylpropyl) -1-oxo-1,2- dihydroisoquinolin-6-yloxy] -acetamide hydrochloride</td>

<td>(2-Fluoro-4-methanesulfonyl-phenyl) - {6 (1- (3-isopropyl- (1,2,4] oxadiazol-5-ylmethyl) -piperidin-4-yloxy] -pyrimidin-4-yl} -amine; (6-2-Fluoro-4-methanesulfonyl-phenylamino) -pyrimidin-4-yloxy] -piperidine-1-carboxylic acid isopropyl ester</td><td>3- (3-Hloroimidazo [1,2-a] pyridine-2ylmethylsulphonyl) -N, N-dimethyl-1H-1,2,4triazole-1-carboxamide</td>

<td>(6-Hloro-pyridine-2-yl) - {4- [6- (2-fluoro- 4-metansulfonil-fenilamino) pyrimidin-4-delight] -piperidin-1-il} -methanone</td><td>6 Hloro-2-isobutyl-4-3- fenilhinolin ylmethylamine</td>

<td>[2- (4-Bromo-phenyl) -6-methyl-pinmidin- 4-he] -methyl-amine</td><td>trans-1- (2- (4- (1,3-Dioxo-2,3-dihydro-1H-isoindol-2-yl) cyclohexylamino] acetyl] pyrrolidine2 (S) -carbonitrile hydrochloride</td>

<td>[2- (4-Bromo-phenyl) -6-methyl-pyrimidine 4-yl] -p-tolyl-amin</td><td>Trans-4- [2- (4 (R) -Cyanothiazolidin-3-yl] -2-oxoethylamino] -N, N dimethylcyclohexanecarboxamide hydrochloride</td>

223

51174 Β (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>[2- (4-Bromo-phenyl) -6-methyl-pyrimidine 4-yl] - (4-methoxy-phenyl) -amine</td><td>N- (5-Chloropyridin-2-il) -2- [4- [1- (2- (4cijanotiazolidin-3-il) -2oksoetil] hidrozaino] piperidin-1iljacetamid tris (trifluoroacetat)</td>

<td>[2- (4-Bromo-phenyl) -6-methyl-pyrimidine 4-il] -fenil-amin</td><td>6- [2- [2- [2 (S) -Cyanoazetidin-1-yl) -2-oxoethylamino] ethylamino] pyridine-3-carbonitrile dihydrochloride</td>

<td>[2- (4-Bromo-phenyl) -6-methyl-pyrimidine 4-yl] -cyclohexyl-amine</td><td>4(S)-Fluoro-1-[2-[1-(2- hydroxyacetyl) -4-methylpiperidin-4ylamino] acetyl] pyrrolidin-2 (S) carbonitrile fumarate</td>

<td>5- [2- (4-Bromo-phenyl) -6-ethyl-pyrimidine 4-ylamino] -pentan-1-ol</td><td>TS-021</td>

<td>3- [2- (4-Bromo-phenyl) -6-methyl- pyrimidin-4-ylamino] -propionitrile</td><td>ORC-8200</td>

<td>[2- (4-Bromo-phenyl) -6-ethyl-pyrimidin-4- the] - (4-fluoro-benzyl) -amirr-</td><td>GRC-8116</td>

<td>[2- (4-Bromo-phenyl) -6-ethyl-pyrimidin-4- il] - [2- (4-hloro-fenil) -etil] -amin</td><td>FE107542</td>

<td>[2- (4-Bromo-phenyl) -6-ethyl-pyrimidin-4- yl] -pyridin-2-ylmethyl-amine</td><td></td>

<td>[2- (4-Bromo-phenyl) -6-methyl-pyrimidine 4-yl] -pyridin-3-ylmethyl-amine</td><td></td>

<td>3 - {[2- (4-Bromo-phenyl) -6-methylpyrimidin-4-ylamino] -methyl} -1H-pyridin2-one</td><td></td>

224

51174 Β (continued)

<td>GPR119 agonist</td><td>DPP-IV in hibitor</td>

<td>4 - {[2- (4-Bromo-phenyl) -6-ethyl-pyrimidine 4-ylamino] -methyl} -1H-pyridin-2-one</td><td></td>

<td>4- {2- [2- (4-Bromo-phenyl) -6-methylpyrimidin-4-ylamino] -ethyl} -1H-pyridin-2-one</td><td></td>

<td>[2- (3-Hloro-4-fluoro-phenyl) -6-ethylpirimidin-4-il] - (1.1-dioxysohexahidro-116-tiopiran-4-il-amin</td><td></td>

<td>[6-Methyl-2- (3,4,5-trifluorophenyl) pyrimidin-4-yl] - [2- (1-oxy-pyridin-3-ij) ethyl] -amine</td><td></td>

<td>[6-Ethyl-2- (3,4,5-trifluorophenyl) pyrimidin-4-yl] - [2- (1-oxy-pyridin-3-yl) ethyl] -amine</td><td></td>

<td>(6-Methyl-2- (2,4.5-trifluorophenyl) pyrimidin-4-yl] - [2- (1-oxy-pyridin-3-yl) ethyl] -amine</td><td></td>

<td>4- {4-Methyl-6- [2- (1-oxy-pyridin-3-yl) - ethylamino] -pyrimidin-2-yl} -benzonitrile</td><td></td>

<td>2- [4- (6-Methyl-2-phenyl) -pyrimidin-4ilamino) -phenyl] -ethanol</td><td></td>

<td>[2- (3-Hloro-phenyl) -6-methyl-pyrimidin-4-yl] -methylamine</td><td></td>

<td>2 - {[2- (4-Bromo-phenyl) -6-methylpyrimidin-4-yl] -methyl-amino} -ethanol; compound with methane</td><td></td>

225

51174 Β (continued) _____

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>3- [6-Ethyl-2- (3,4,5-trifluoro-phenyl) - pyrimidin-4-ylamino] -propane-1,2-diol</td><td></td>

<td>(S) -3- [6-Methyl-2- (3,4,5-trifluoro-phenyl) - pyrimidin-4-ylamino] -propane-1,2-diol</td><td></td>

<td>(S) -3- [2- (4-Bromo-3-fluoro-phenyl) -6-methyl-pyrimidin-4-ylamino] -propane-1,2-diol</td><td></td>

<td>(R) -3- [6-Ethyl-2- (3,4,5-trifluoro-phenyl) - pyrimidin-4-ylamino] -propane-1,2-diol</td><td></td>

<td>(R) -3- [2- (3-Chloro-4-fluoro-phenyl) -6-ethyl-pyrimidin-4-ylamino] -propane-1,2-diol</td><td></td>

<td>(/?) - 3- [2- (4-Bromo-2,5-difluoro-phenyl) - 5-Fluoro-6-methyl-pyrimidin-4-ylamino] propane-1,2-diol</td><td></td>

<td>(R) -3- [2- (4-Peak-2,5-fluff-fluid) - 6-Difluoromethyl-pyrimidin-4-ylamino] - propan-1,2-diol</td><td></td>

<td>5- {2- [2- (4-Bromo-phenyl) -6-ethylpyrimidin-4-ylamino] -ethyl} -1H-pyridan2-one</td><td></td>

<td>5- {2- [6-Methyl-2- (2,4,5-trifluoro-phenyl) pyrimidin-4-ylamino] -ethyl} -1H-pyridin-2-one</td><td></td>

226

51174 Β {continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>4- {2- [2- (4-Chloro-2,5-difluoro-phenyl) -6-ethyl-pyrimidin-4-ylamino] -ethyl} -1H-pyridin-2-one</td><td></td>

<td>6-hloro-4- {2- [6-methyl-2- (2,4,5- trifluoro-phenyl) -pyrimidine-4-ilamiino] ethyl} -1H-pyridin-2-one</td><td></td>

<td>441-Hydroxy-2- [6-methyl-2- (2,4,5trifluoro-phenyl) -pyrimidine-4-ylamino] ethyl} -1 H-pyridine-2-one</td><td></td>

<td>4- {1-Methyl-2- [6-methyl-2- (2,4,5trifluoro-phenyl) -pyrimidine-4-ylamino] ethyl} -1 H-pyridine-2-one</td><td></td>

<td>4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid tert-butyl ester</td><td></td>

<td>4- [5- (2-cyanopyridine-4-yl) - [1,2,4] oxadiazol-3-ylmethoxy] · piperidine-1-carboxylic acid tert-butyl ester</td><td></td>

<td>4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid cyclopentyl ester</td><td></td>

<td>4- (3-Pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethoxy) piperidine-1-carboxylic acid 2,2,2-trichloroethyl ester</td><td></td>

227

51174 Β (continued)

<td>GPR119 agonist</td><td>DPP-IV inhibitor</td>

<td>4- [Ethyl- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) -amino] piperidine-1-carboxylic acid tert-butyl ester</td><td></td>

<td>4- (Methyl- (3-pyridin-4-yl [1,2,4] oxadiazol-5-ylmethyl) -amino] piperidine-1-carboxylic acid cyclopentyl ester</td><td></td>

<td>4 - {[Methyl- (3-pyridin-4-yl- [1,2,4] oxadiazol-5-ylmethyl) amino] metal} -piperidine-1-carboxylic acid 2,2,2-trichloroethyl ester</td><td></td>

Additionally, the compounds of the composition of the invention, including those illustrated in TABLE B, include all pharmaceutically acceptable salts, solvates, and hydrates thereof. See, e.g., Berge et al (1977), Journal of Pharmaceutical Sciences 6: 1-19; and Polymorphism irrPharmaceutical Solids (1999) Brittain, ed, Marcel Dekker, Inc.

As per the combination therapy described above, the compositions of the invention may be administered in any suitable manner. Suitable routes of administration include oral, nasal, rectal, transmucosal, transdermal, or intestinal administration, parenteral delivery, including intramuscular, subcutaneous, intramedullary injection, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, intrapulmonary or intrapulmonary using procedures known in science. Others

228

51174 Β suitable routes of administration are aerosol and depot formulations. Formulations for delayed drug release, especially depot, have been explicitly considered. In certain preferred embodiments, the compositions of the present invention are administered orally. The compositions of the present invention may be formulated in solid or liquid form, such as tablets, capsules, powders, syrups, elixirs and the like, sterile solutions, suspensions or emulsions, and the like. In certain embodiments, one or both of the GPR119 agonists and DPP-IV inhibitors are administered orally.

Formulations for oral administration may be in the form of aqueous solutions and suspensions, in addition to tablet and capsule formulations. Aqueous solutions and suspensions may be prepared from sterile powders or granules. The compounds may be dissolved in water, polyethylene glycol, propylene glycol, ethanol, corn oil, cottonseed oil, peanut oil, sesame oil, benzyl alcohol, sodium chloride, and / or various buffers. Other adjuvants are well and widely known in science.

It will be appreciated that the GPR119 agonist and the DPP-IV inhibitor may be present as a combination preparation for simultaneous, separate or sequential use in the prevention or treatment of diabetes or a condition associated therewith. Such combination preparations may be, for example, in the form of a twin pack.

It will therefore be further appreciated that the invention contemplates a product comprising or comprising essentially a GPR119 agonist and a DPP-IV inhibitor as a combined composition for simultaneous, separate or sequential use in the prevention and treatment of diabetes and a condition associated therewith.

229

51174Β

The combination of the present invention consisting of or containing essentially a GPR119 agonist and a DPP-IV inhibitor may be prepared by mixing the GPR119 agonist and a DPP-IV inhibitor either together or independently with a pharmaceutically acceptable carrier, excipient, binder, diluent, etc., as is. described herein, and by administering the mixture or mixtures either orally or non-orally as the pharmaceutical composition (s).

It will therefore be appreciated that the GPR119 agonist and the DPP-IV inhibitor or pharmaceutical composition may be administered in separate dosage forms or in unit dosage form.

It will be further appreciated that when the GPR119 agonist and the DPP-IV inhibitor are in separate dosage forms, the GPR119 agonist and the DPP-IV inhibitor may be administered by different routes.

Pharmaceutical compositions of GPR119 agonists and DPP-IV inhibitors, either individually or in combination, may be prepared by methods well known in the art, e.g., by conventional mixing, dissolving, granulating, dragging, rinsing, emulsifying, encapsulating, collecting, methods. lyophilization and spray drying.

The pharmaceutical compositions for use in accordance with the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers consisting of excipients and excipients which facilitate the handling of the active compounds in pharmaceutically usable compositions. Suitable pharmaceutically acceptable carriers are available to those skilled in the art [see, e.g., Remington: The Science and Practice of

230

51174Β

Pharmacy, (Gennaro et al.), 20th Edition, 2000, Lippincott Williams & Wilkins; and Handbook of Pharmaceutical Excipients (Rowe et al., eds), 4th Edition, 2003. Pharmaceutical Press], The appropriate formulation depends on the chosen route of administration. The term "carrier" material or excipient "herein means any substance, which is not in itself a therapeutic agent, which is used as a carrier and / or diluent and / or adjuvant, or a liquid carrier for delivering a therapeutic agent to a subject or added to a pharmaceutical composition to improve its handling or storage properties or to allow or facilitate the formation of a unit dosage composition into separate articles such as a capsule or tablet suitable for oral administration. Inert fillers include, by way of illustration only and not limitation, diluents, disintegrants, binders, wetting agents, polymers, lubricants, glidants, substances added to mask or react against unpleasant taste or odor, flavoring agents, dyes, fragrance, and substances added to improve the appearance of the composition. Acceptable excipients include stearic acid, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulfuric acid, magnesium carbonate, talc, gelatin, gum acacia, sodium alginate, pectin, dextrin, mannitol, cellulose, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol materials, such as cellulose esters of alkanoic acids and cellulose alkyl esters, easily soluble cocoa butter or powder, polymers, such as polyvinylpyrrolidone, polyvinyl alcohol and polyethylene glycols, and other pharmaceutically acceptable materials. The components of the pharmaceutical composition may be encapsulated or tableted for conventional administration.

Pharmaceutically acceptable refers to those properties and / or substances that are acceptable to the patient from a pharmacological / toxicological point of view and

231

51174Β a pharmaceutical chemical that manufactures them from a physical / chemical point of view in terms of composition, stability, patient acceptance and bioavailability.

When a GPR119 agonist and a DPP-IV inhibitor are in separate dosage forms, it is understood that the pharmaceutically acceptable carrier used to formulate the GPR119 agonist need not be identical to the pharmaceutically acceptable carrier used to formulate the DPP-IV inhibitor.

The dragee cores are given in appropriate coatings. For this purpose, concentrated sugar solutions may be used and may generally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol and / or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyes or pigments may be added to tablets or dragee coatings for identification or to characterize different combinations of active doses of the compound.

Pharmaceutical compositions that can be used orally include push-fit capsules made of gelatin. ' as Ϊ soft, sealed capsules composed of gelatin and plasticizers, such as glycerin or sorbitol. Push-fit capsules may contain the active ingredients in admixture with a filler such as lactose, a binder such as starch, and / or a lubricant such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as naphtha oils, liquid paraffin, liquid polyethylene glycols, cremophor, capsule, medium or long chain mono-, di- or triglycerides. Stabilizers may also be added to these formulations.

232

51174Β

Additionally, a GPR119 agonist and a DPP-IV inhibitor can be delivered using a sustained release system. Various delayed release materials have been identified and are well known to those skilled in the art. Delayed-release tablets or capsules are particularly preferred. For example, time-delayed materials such as glycerin monostearate or glycerin distearate may be employed. The dosage form may also be coated by the techniques described in U.S. Pat. Nos. 4,256,108, 4,166,452 and 4,265,874 to form an osmotic therapeutic tablet for controlled release.

It is explicitly contemplated that combination therapy may be given or provided alone or in combination with one or more other pharmaceutically or physiologically acceptable compounds. In one aspect of the present invention, the second pharmaceutically or physiologically acceptable compound is not a GPR119 agonist and is not a DPP-IV inhibitor. In one aspect of the present invention, another pharmaceutically or physiologically acceptable compound is a pharmaceutical agent selected from the group consisting of a sulfonylurea (e.g., glibenclamide, glipizide, gliclazide, glimepiride), meglitinide (e.g., repaglinide, nateglinide), biguanide e.g., metformin), α-glycosidase inhibitors (e.g., acarbose, epalrestat, miglotol, voglibose), thizaolidenedione (e.g., rosglitazone, pioglitazone), insulin analog (insulin lispro, insulin aspart, insulin glargine) ), chromium picolinate / biotin, and a biological agent (e.g., an adiponectin or fragment containing its C-terminal globular domain, or an adiponectin multimer or said fragment thereof; or an adiponectin receptor agonist AdipoRI or AdipoR2, presumably when said agonist is orally active) . In one aspect of the present invention, the pharmaceutical agent is metformin. In one aspect of the present invention, the pharmaceutical agent is an adiponectin agonist

233

51174 Β AdipoRI or AdipoR2 receptors, presumably when the agonist is orally active.

In the combination therapy of the present invention, the GPR119 agonist of the present invention and the DPP-IV inhibitor of the present invention may be administered simultaneously or at separate intervals. When co-administered a GPR119 agonist and a DPP-IV inhibitor may be incorporated into one pharmaceutical composition or into separate compositions, e.g., a GPR119 agonist in one composition and a DPP-IV inhibitor in another composition. Each of these compositions may be formulated with conventional excipients, diluents or carriers, and compressed into tablets or formulated into elixirs or solutions; and as sustained release dosage forms and the like. The GPR119 agonist and the DPP-IV inhibitor can be administered by different routes. For example, a GPR119 agonist may be administered orally via a tablet and a DPP-IV inhibitor may be administered by inhalation.

When administered separately, therapeutically effective amounts of the GPR119 agonist and DPP-IV inhibitor of the present invention are administered according to different schedules. One can be given before the drigogue until the time between the two administrations falls within the therapeutically effective interval. A therapeutically effective interval is a period of time that begins when one or both (a) GPR119 agonist or (b) DPP-IV inhibitor is administered to a mammal and ends with a limited end of benefit in the treatment of combinations (a) and (b).

In one aspect, the present invention is characterized by a pharmaceutical composition comprising or consisting of an essential combination of an amount of GPR119 agonist according to the present invention and an amount of DPP-IV

234

51174 The inhibitor of the present invention, together with at least one pharmaceutically acceptable carrier.

In one aspect, the present invention is characterized by a pharmaceutical composition comprising or consisting of an essential combination of an amount of a GPR119 agonist of the present invention and an amount of a DPP-IV inhibitor of the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of a pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to provide a blood glucose lowering effect in the subject. In certain embodiments, the blood glucose level may be elevated blood glucose levels.

In one aspect, the present invention is characterized by a pharmaceutical composition comprising or consisting of an essential combination of an amount of a GPR119 agonist of the present invention and an amount of a DPP-IV inhibitor of the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of a pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to provide a blood glucose lowering effect in the subject, and wherein the amount of GPR119 agonist itself and the amount of the DPP-IV inhibitor are therapeutically ineffective in lowering blood glucose levels in a subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.

235

51174Β inhibitors according to the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of a pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to provide a blood glucose lowering effect in the subject and wherein the effect is a synergistic effect. In certain embodiments, the blood glucose level is an elevated blood glucose level.

In one aspect, the present invention relates to a pharmaceutical composition comprising or consisting of an essential combination of an amount of a GPR119 agonist of the present invention and an amount of a DPP-IV inhibitor of the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of a pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to provide a blood glucose lowering effect in the subject, wherein the effect is synergistic, and wherein the amount of GPR119 agonist and the amount of DPP-IV inhibitor alone is therapeutically ineffective in lowering blood glucose levels in a subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.

236

51174 Β agonist and DPP-IV inhibitor in amounts sufficient to obtain the effect of increasing blood GLP-1 levels in the subject.

In one aspect, the present invention is characterized by a pharmaceutical composition comprising or consisting of an essential combination of an amount of a GPR119 agonist of the present invention and an amount of a DPP-IV inhibitor of the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of a pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to provide the effect of increasing GLP-1 levels in the blood of the subject, wherein the amount of GPR119 agonist and the amount of DPP-IV inhibitors therapeutically ineffective in increasing blood GLP-1 levels in a subject.

In one aspect, the present invention features a pharmaceutical composition comprising or consisting of an essential combination of an amount of a GPR119 agonist of the present invention and an amount of a DPP-IV inhibitor of the present invention, together with at least one pharmaceutically acceptable carrier. The present invention also relates to a dosage form of a pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to provide an effect of increasing blood GLP-1 levels in the subject, and wherein the effect is a synergistic effect.

In one aspect the present invention relates to a pharmaceutical composition comprising or consisting of an essential combination of an amount of GPR119 agonist according to the present invention and an amount of DPP-IV inhibitor according to the present invention, together with at least one

237

51174Β a pharmaceutically acceptable carrier. The present invention also relates to a dosage form of a pharmaceutical composition wherein the GPR119 agonist and the DPP-IV inhibitor are in amounts sufficient to provide the effect of increasing GLP-1 levels in the blood of the subject, wherein the effect is a synergistic effect, and the amount itself is The GPR119 agonist and the amount of DPP-IV inhibitor alone are therapeutically ineffective in increasing blood GLP1 levels in a subject.

Pharmaceutical compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an amount to achieve their intended purpose. In some embodiments, the pharmaceutical composition of the present invention is useful for treating or preventing diabetes and related conditions. Diabetes and related conditions are according to the present invention. In some embodiments, the pharmaceutical composition of the present invention is useful for treating or preventing a condition ameliorated by an increase in blood GLP-1 levels. Conditions corrected by increasing blood GLP-1 levels are according to the invention.

238

51174 The combination therapies of the present invention the amount of GPR119 agonist of the present invention and the amount of DPP-IV inhibitor of the present invention are provided in amounts that provide a synergistic effect in lowering blood glucose levels in a subject, wherein the amount of GPR119 agonist and the amount of DPP-IV inhibitors therapeutically ineffective in lowering new blood glucose in a subject. In certain embodiments, the blood glucose level is an elevated blood glucose level. Determining the amounts of GPR119 agonists and DPP-IV inhibitors that provide a synergistic effect in lowering blood glucose levels in a subject, where the amount of GPR119 agonists and the amount of DPP-IV inhibitors alone are therapeutically ineffective in lowering blood glucose levels in a subject, is within the scope of knowledge. experts in this field of science, especially in light of the detailed discovery given here.

In certain embodiments of the combination therapy of the present invention, the amount of GPR119 agonist of the present invention and the amount of DPP-IV inhibitor of the present invention are provided in amounts that provide a synergistic effect in increasing blood GLP-1 levels in the subject. The determination of the amounts of GPR119'agonists and DPP-IV inhibitors that provide a synergistic effect in increasing blood GLP-1 levels in a subject is within the knowledge of those skilled in the art, particularly in light of the detailed disclosure provided herein. In one embodiment of the combination therapy of the present invention, the amount of GPR119 agonist of the present invention and the amount of DPP-IV inhibitor of the present invention are provided in amounts that provide a synergistic effect in increasing blood GLP-1 levels in a subject, wherein the amount of GPR119 agonist is DPP-IV inhibitors are therapeutically ineffective in increasing blood GLP-1 levels in a subject. Determination

239

51174 Β the amount of GPR119 agonists and DPP-IV inhibitors that provide a synergistic effect in increasing blood GLP-1 levels in the subject, where the amount of GPR119 agonists and the amount of DPP-IV inhibitors are therapeutically ineffective in increasing blood GLP-1 levels in the subject, is within the knowledge of experts in this field of science, especially in light of the detailed discovery given here.

Data obtained from animal studies, including but not limited to studies using mice, rats, rabbits, pigs and non-human primates, can be used to formulate a dose range for use in humans. In general, one skilled in the art understands how to extrapolate in vivo data obtained in an animal model system to another, such as the human model. In some circumstances, these extrapolations may only be based on the weight of the animal model compared to others, such as the human model; in other circumstances, these extrapolations are not simply weight-based but incorporate various factors. Representative factors include the type, age, weight, sex, diet and medical condition of the patient, severity of the disease, route of administration, pharmacological circumstances under consideration such as activity, efficacy, pharmacokinetic and toxicological profiles of the particular compound used, whether used drug delivery system, or whether it is an acute or chronic disease state to be treated or prophylaxis performed or whether further active compounds are provided in addition to the compounds of the present invention and as part of a drug combination. The dosage regimen for treating the disease state with the compounds and / or compositions of the present invention is selected in accordance with the various factors listed above. Thus, the actual dose regimen used may vary widely and may therefore deviate from the presumed dose regimen and

240

51174 Β The person skilled in the art will recognize that the dose and dosage regimen outside these typical ranges can be tested and, where appropriate, can be used in the methods of the present invention.

An exemplary and putative animal model system is the oral glucose tolerance test (oGTT) in mice (see, Example 1). In this model, only illustratively but not restrictively, the amount of GPR119 agonists alone or the amount of DPP-IV inhibitors that are therapeutically ineffective is the amount of GPR119 agonists alone and the amount of DPP-IV inhibitors that produce Field Acute (AUC) inhibition of glycemic deviation less of or equal to about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, more preferably less than about 25%, less than about 20% , less than about 15%, less than about 10% or less than about 5%. In this model, only illustratively but not restrictively, the amount of GPR119 agonist itself and the amount of DPP-IV inhibitors that are therapeutically ineffective is the amount of GPR119 agonist itself and the amount of DPP-IV inhibitors that produce the Field Curve (AUC) inhibition of glycemic deviation around 0-30%, about 0-25%, about 0-20%, about 0-15%, about 0-10% or about 0-5%, more preferably bko 0-25%, okc 0-20%, about 0 -15%, about 0-10% or about 0-5%. In this model, only illustratively but not limitingly, a therapeutically effective amount of a combination of a GPR119 agonist and a DPP-IV inhibitor of the present invention is an amount of a combination that produces a Field Below Curve (AUC) to inhibit glycemic deviation greater than about 30%, greater than about 35 %, greater than about 40%, greater than about 45%, greater than about 50%, greater than about 55%, greater than about 60%, greater than about 65%, greater than about 70%, greater than about 75%, greater than about 80%, greater than about 85%, greater than about 90% or greater than about 95%, more preferably greater than about 35%, greater than about 40%, greater than about 45%, greater than about 50%, greater than about

241

51174 Β

55%, greater than about 60%, greater than about 65%, greater than about 70%, greater than about 75%, greater than about 80%, greater than about 85%, greater than about 90%, or greater than about 95% .

The dose amount and interval can be adjusted to provide a synergistic effect of lowering blood glucose levels to a subject or to provide a synergistic effect of increasing blood GLP-1 levels in a subject according to the present invention. In certain embodiments, the blood glucose level is an elevated blood glucose level. It will be appreciated that the exact dose of GPR119 agonist or DPP-IV inhibitor of the present invention will vary depending on the combination of GPR119 agonist and DPP-IV inhibitor, its potency, route of administration, age and weight of the patient and the severity of the condition to be treated. The exact formulation, route of administration and dosage may be chosen by the individual physician in view of the patient's condition. By way of illustration only and not limitation, the amount of GPR119 agonist or DPP-IV inhibitor that provides a synergistic effect in lowering blood glucose levels in a patient according to the present invention or provides a synergistic effect in increasing blood GLP-1 levels in a patient according to the present invention is of about 0.001 mg / kg body weight, less than 0.005 mg / kg body weight, less than about 0.01 mg / kg body weight, less than about 0.05 mg / kg body weight, less than about 0.1 mg / kg body weight, less than about 0.5 mg / kg body weight, less than about 1 mg / kg body weight, less than about 5 mg / kg body weight, less than about 10 mg / kg body weight kg body weight, less than about 50 mg / kg body weight, or less than about 100 mg / kg body weight. In certain embodiments, the blood glucose level is an elevated blood glucose level. In some embodiments, the amount of GPR119 agonist or DPP-IV inhibitor that provides a synergistic blood glucose lowering effect in a subject according to

242

51174Β of the present invention or provides a synergistic effect of increasing blood GLP-1 levels in a subject of the present invention is less than about 0.001-100 mg / kg body weight, less than about 0.001-50 mg / kg body weight, less than about 0.001-10 mg / kg body weight, less than about 0.001-5 mg / kg body weight, less than about 0.001-1 mg / kg body weight, less than about 0.001 to 0.5 mg / kg body weight, less than about 0.001-0 , 1 mg / kg body weight, less than about 0.001-0.5 mg / kg body weight, less than about 0.001-0.01 mg / kg body weight, or less than about 0.001-0.005 mg / kg body weight. In certain embodiments, the blood glucose level is an elevated blood glucose level. In some embodiments, the amount of GPR119 agonist or DPP-IV inhibitor that provides a synergistic effect in lowering blood glucose levels in a subject of the present invention or provides a synergistic effect of increasing blood GLP-1 levels in a subject of the present invention is about 0.001-100 mg / kg body weight, about 0.001-50 mg / kg body weight, about 0.001-10 mg / kg body weight, about 0.001-5 rng / kg body weight, about 0.001 to 1 mg / kg body weight, about 0.001-0.5 mg / kg body weight, about 0.001-0.1 mg / kg body weight, about 0.001-0.05 mg / kg body weight, about 0.001-0.01 mg / kg body weight, or about 0.001-0.005 mg / Rg tefes weight. In certain embodiments, the blood glucose level is an elevated blood glucose level.

An additional exemplary and putative animal model system is an increase in blood GLP-1 levels following a glucose challenge in mice (see, Example 3).

The dose and interval can be adjusted individually to provide plasma levels of the GPR119 agonist of the present invention and the DPP-IV inhibitor of the present invention that provide a synergistic effect in

243

51174 Β lowering blood glucose levels in a subject according to the present invention or giving a synergistic effect of increasing blood GLP-1 levels in a subject according to the present invention. In certain embodiments, the blood glucose level is elevated blood glucose levels. Dose intervals can also be determined using values for a selected range of GPR119 agonists or values for a selected range of DPP inhibitors that have a synergistic effect in lowering blood glucose levels in a subject of the present invention or give a synergistic effect of increasing blood GLP-1 levels in a subject. of the subject according to the present invention. In certain embodiments, the blood glucose level is an elevated blood glucose level. The GPR119 agonist and DPP-IV inhibitor should be administered using a regimen that maintains plasma levels within a selected range of GPR119 agonist and DPP-IV inhibitor concentrations, each individually, for 10-90% of the time, presumably between 30-99% of the time, and most preferably between 50-90% of the time. In cases of topical administration or selective administration, the concentration range of a GPR119 agonist or the concentration range of a DPP-IV inhibitor that has a synergistic effect in lowering blood glucose levels in a subject of the present invention or gives a synergistic effect of increasing blood GLP-1 levels in a subject of the present invention it does not have to be related to plasma concentration. In certain embodiments, the blood glucose level is an elevated blood glucose level.

The amount of a given composition will, of course, depend on the subject being treated, the subject's weight, the severity of the pain, the mode of administration, and the assessment of the doctor prescribing it.

244

51174Β

Described herein is a method of treating or preventing diabetes or a condition associated therewith comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or substantially consisting of an amount of GPR119 agonist of the present invention and an amount of DPP-IV inhibitor of the present invention. In a related aspect, the present invention is characterized by said method wherein the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to provide a blood glucose lowering effect in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.

Described herein is a method of treating or preventing diabetes or a condition associated therewith comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of GPR119 agonist of the present invention and an amount of DPP-IV inhibitor of the present invention. . Also described is a method wherein the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to provide a blood glucose lowering effect in a subject, and wherein the amount of GPR119 agonist and the amount of the DPP-IV inhibitor alone are therapeutically ineffective in lowering glucose levels in the subject. subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.

245

51174 Β

Described herein is a method of treating or preventing diabetes or a condition associated therewith comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of GPR119 agonist of the present invention and an amount of DPP-IV inhibitor of the present invention. . Also described is said method wherein the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to provide a blood glucose lowering effect in the subject, and wherein the effect is a synergistic effect. In certain embodiments, the blood glucose level is an elevated blood glucose level.

Described herein is a method of treating or preventing diabetes or a condition associated therewith comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of GPR119 agonist of the present invention and an amount of DPP-IV inhibitor of the present invention. . Also described is a method wherein the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to provide a blood glucose lowering effect in a subject, wherein the effect is a synergistic effect, and wherein the amount of GPR119 agonist itself and the amount of DPP-IV inhibitor are therapeutically ineffective in lowering blood glucose levels in the subject. In certain embodiments, the blood glucose level is an elevated blood glucose level.

The combination therapy of the present invention is useful in treating or preventing diabetes or a condition associated with it in a mammal, including most preferably a human. In some embodiments, the diabetes in question is Type 1 diabetes. In some putative embodiments, diabetes is Type 2 diabetes. Diabetes-related conditions include, but are not limited to, hyperglycemia, impaired glucose tolerance, insulin resistance,

246

51174Β pancreatic beta-cell deficiency, enteroendocrine cell deficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular hyperplasia, atherosclerosis, metabolites obesity. It is understood that conditions associated with diabetes may be included in the realization individually or in any combination.

Described herein is a method of treating or preventing a condition ameliorated by an increase in blood GLP-1 levels comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of GPR119 agonist of the present invention and an amount of DPP-IV inhibitor. according to the present invention. Also described herein is a method wherein the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to provide the effect of increasing blood GLP-1 levels in the subject.

247

51174 Β described said method wherein the GPR119 agonist and the DPP-IV inhibitor are administered in amounts sufficient to effect an increase in GLP-1 levels in the blood of the subject, and wherein the amount of GPR119 agonist and the amount of DPP-IV inhibitor alone are therapeutically ineffective in increasing the levels GLP-1 in the blood of a subject.

Described herein is a method of treating or preventing a condition ameliorated by an increase in blood GLP-1 levels comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of GPR119 agonist of the present invention and an amount of DPP-IV inhibitor. according to the present invention. Also described is said method wherein the GPR119 agonist and the DPP-IV inhibitor are administered in an amount sufficient to provide the effect of increasing GLP-1 levels in the blood of the subject, and wherein the effect is a synergistic effect.

Described herein is a method of treating or preventing a condition ameliorated by an increase in blood GLP-1 levels comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising or consisting essentially of an amount of GPR119 agonist of the present invention and an amount of DPP-IV inhibitor. according to the present invention. Also described herein is a method wherein the GPR119 agonist and the DPP-IV inhibitor are administered in an amount sufficient to provide an effect of increasing GLP-1 levels in the blood of the subject, wherein the effect is a synergistic effect, and wherein the amount of GPR119 agonist and the amount of DPP -IV inhibitors are therapeutically ineffective in increasing blood GLP-1 levels in a subject.

The combination therapy of the present invention is useful in treating or preventing diabetes or a condition ameliorated by increasing GLP-1 levels in

248

51174 Β blood in mammals, including the most desirable human. The condition ameliorated by increased blood GLP-1 levels includes, but is not limited to, diabetes, a condition associated with diabetes, myocardial infarction, learning impairment, memory impairment, and neurodegenerative disorders, with diabetes-related conditions including, but not limited to, hyperglycemia. glucose tolerance, insulin resistance, pancreatic beta-cell deficiency, enteroendocrine cell deficiency, glucosuria, metabolic acidosis, cataracts, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic coronary artery disease, diabetic cerebrovascular disease, diabetic peripheral vascular disease, metabolic syndrome, hyperlipidemia, atherosclerosis, stroke, hypertension, and obesity, and does not include neurodegenerative disorder brain damage caused by severe epileptic seizures, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion-related disease, motor-neuronal disease, traumatic brain injury, spinal cord injury, and peripheral neuropathy. In some embodiments, the diabetes in question is Type 1 diabetes. In some putative embodiments, diabetes is Type 2 diabetes. It is understood that conditions ameliorated by an increase in blood GLP-1 levels may be included in the embodiments individually or in any combination.

Without further elaboration, it is believed that one skilled in the art can, using the foregoing description, apply the present invention to its limit. The foregoing detailed description is given for clarity and understanding only, and an unnecessary limitation should not be construed therefrom, but should be considered as modifications within the scope of the invention which may become apparent to those skilled in the art.

249

51174 Β

EXAMPLES

Without further elaboration, it is believed that one skilled in the art can, using the foregoing description, apply the present invention to its limit. The detailed examples that follow should be considered as illustrative only and not limitations of the previous discovery in any way. Those skilled in the art will readily recognize appropriate variations in procedures.

EXAMPLE 1: SYNERGISTIC EFFECT OF GPR119 AGONISTS AND DPP-IV INHIBITORS IN LOWERING BLOOD GLUCOSE LEVELS IN AN ORAL GLUCOSE TOLERANCE TEST (OGTT) IN MICE

An oral glucose tolerance test (oGTT) in mice is performed as described herein. Overnight fasted mice (n = 6 mice per treatment) were administered via oral gavage with vehicle (PET) GPR119 agonist (AR231453) at 1 μkg (milligram of compound per kilogram body weight), GPP-IV inhibitor (AR2478TO) at 0 , 1 μg, or a combination of GPR119 agonists (1 μg) and DPP-IV inhibitors (0.1 μg). Thirty minutes later, a bolus of glucose (3 grams / kg) is delivered orally. Plasma glucose levels are determined at designated time points over a two-hour period using blood (55 μΙ_) collected from the tail incision and from the glucose meter. The glycemic deviation curve is given graphically based on data obtained from 6 mice and mean values of +/- SEM are given (Figure 1). The field below the glycemic deviation curve (AUC) was calculated for each mouse and the AUC inhibition (%) was reported in Figure 1B.

250

51174Β

In this example, a GPR119 agonist given at 1 μg alone, or a DPP-IV inhibitor given at 0.1 μg alone produces an AUC inhibition of glycemic deviation of less than 15-20% in a mouse model, which is considered therapeutically ineffective for long-term glycemic control in patients with diabetes. On the other hand, the combination of both compounds at their therapeutically ineffective dose (0.1 μg for DPP-IV inhibitor and 1 μg for GPR119 agonist in this Example) produces AUC inhibition over 60%. Typically, a therapeutically effective dose produces an AUC inhibition of about 30% in a mouse model study, such as that observed for the incretin mimetic exendin-4 at -60%.

Both the DPP-IV inhibitor and the GPR119 agonist alone can produce a therapeutic response (at approximately 40% AUC inhibition) in this type of mouse model study, but only with significantly higher doses (Figures 1C and Figure 1D, for each individual).

EXAMPLE 2: COMBINATION OF GPR119 AGONISTS AND DPP-IV INHIBITORS FOR TREATMENT OR PREVENTION OF DIABETES AND CONDITIONS CONCERNED

A GPR119 agonist according to the present invention was selected. A DPP-IV inhibitor according to the present invention is selected.

Titration of GPR119 agonists with respect to the percentage of Field Curve Inhibition (AUC) in the mouse oral glucose tolerance test (oGTT) is determined over the entire dose range from about 0.01 μg (milligrams of compound per kilogram of body weight) to about 100 μg. See Example 1. A dose of a GPR119 agonist that produces glycemic AUC inhibition was selected

251

51174Β deviations of about 15-20%. Typically, a dose of a GPR119 agonist that produces AUC inhibition of 30% or less is therapeutically ineffective in this mouse model.

Titration of DPP-IV inhibitors with respect to the percentage of field inhibition (AUC) in the mouse oral glucose tolerance test (oGTT) is determined by the entire dose range from about 0.01 μg (milligrams of compound per kilogram of body weight) to about 100 μg. See Example 1. A dose of DPP-IV inhibitor that produces an AUC inhibition of glycemic deviation of about 15-20% was selected. Typically, a dose of DPP-IV inhibitor that produces AUC inhibition of 30% or less is therapeutically ineffective in this mouse model.

AUC inhibition of glycemic aberration produced by the combination of a selected dose of GPR119 agonist and a selected dose of DPP-IV inhibitor was determined in a mouse oGTT assay. The therapeutic efficacy of the combination of GPR119 agonists and DPP-IV inhibitors was determined. Typically, the amount of combination that produces AUC inhibition over 30% is therapeutically effective in this mouse model. synergism between GPR119 agonists and DPP-IV inhibitors was established.

The data obtained in this mouse model can be used to formulate a dose range for use in humans. In general, one skilled in the art understands how to extrapolate in vivo data obtained in an animal model of a system to another system, such as a human. The combination of GPR119 agonists and DPP-IV inhibitors according to the present invention is useful in treating or preventing diabetes or conditions associated with it.

252

51174 Β

It is understood that the foregoing is intended to serve only as an illustration and not as a limitation.

EXAMPLE 3: SYNERGISTIC EFFECT OF GPR119 AGONISTS AND DPP-IV INHIBITORS IN INCREASING BLOOD GLP-1 LEVEL AFTER GLUCOSE CHALLENGE IN MICE

C57blk / 6 male mice (8 weeks of age) were fasted for 18 hours, and randomly divided into twelve groups with n = 6 per group. Mice were administered oral vehicle (PET), GPR119 agonist (10 mg / kg), DPP-IV inhibitor (1 mg / kg), or a combination of GPR119 agonist and DPP-IV inhibitor, as indicated. The GPR119 agonist (AR231453) and DPP-IV inhibitor (Ag247810) used herein are identical to those used in the Example

1. Thirty minutes after treatment, glucose bolus was delivered to them orally at 3 g / kg, and plasma was collected at zero minute (no glucose bolus), both at 2 minutes and at 5 minutes after glucose bolus. Plasma GLP-1 levels are determined using GLP-1 ELISA equipment purchased from Linco Research Laboratory [Glucagon-Like Peptide-1 (Active) ELISA Kit, Catalog # EGLP-35K],

Co-administration of GPR119 agonists with a DPP-IV inhibitor has been found to produce a synergistic effect of increasing blood GLP-1 levels. See Figure 2.

EXAMPLE 4: MELANOPHORE EXAMINATION FOR GPR119 AGONIST ACTIVITY

253

51174 Β

Melanophores are maintained in culture as reported by Potenza et al [Pigment Cell Research (1992) 5: 372-378] and transfected with an expression vector encoding a GPR119 agonist (GPR119; e.g., human GPR119, GenBank® Accession No. AAP72125 and their alleles) using electroporation. After electroporation, the transfected cells were placed on a 96-well plate for examination. The cells are then allowed to grow for 48 hours in order to both recover from the electroporation process and reach maximum levels of receptor expression.

On the day of the experiment, the growth medium on the cells was replaced with serum-free buffer containing 10 nM melatonin. Melatonin acts via endogenous Gi-paired GPCR in melanophores to lower intracellular cAMP levels. In response to decreased cAMP levels, melanophores translocate their pigment toward the center of the cell. The net effect is a significant reduction in the reading of the absorbance of the cell monolayer in the well, measured at 600-650 pM.

After 1 hour of incubation in melatonin, the cells become completely pigmented. At this point, the baseline reading of the absorbance is collected. Serial dilutions of the test compound are then added to the plate, and compounds having GPR119 agonist activity produce an increase in intracellular cAMP levels. In response to these increased levels of cAMP, melanophores translocate their pigment back to the cell periphery. After one hour, the stimulated cells are completely pigmented. The cell monolayer in the dispersed state absorbs much more light in the range of 600-650 nM. The measured increase in absorbance compared to the baseline reading allows the degree of receptor stimulation to be quantified and a dose-response curve to be drawn.

254

51174 Β

Materials and procedures related to the melanophore assay were found in U.S. Pat. Nos. 5,462,856 and 6,051,386, the disclosure of which is incorporated herein by reference in its entirety.

Other assays for identifying a compound as a GPR119 agonist will be apparent to one skilled in the art (see, e.g., Example 7, infra).

EXAMPLE 5: FULL LENGTH CLONING OF ENDOGENIC HUMAN GPR119

A polynucleotide encoding endogenous human GPR119 is cloned by PCR using GPR119 specific primers:

5'-GTCCTGCCACTTCGAGACATGG-3 '(SEQ ID NO: 3; sens, ATG as initiation codon)

5'-GAAACTTCTCTGCCCTTACCGTC-3 '(SEQ ID NO: 4; antisense, 3' stop codon) and human genomic DNA as a template. TaqPlus Precision ™ DNA polymerase (Stratgene) was used to amplify the follow-up cycle with steps 2 to 4 repeated 35 times: 94 ° C, 3 minutes; 94 ° C, 1 minute; 58 ° C, 1 minute; 72 ° C, 2 minutes; 72 ° C, 10 minutes. A 1.0 Kb PCR fragment of predicted size was isolated and cloned into the pCRII-TOPO ™ vector (Invitrogen) and completely sequenced using the T7 DNA sequenase kit (Amersham). See, SEQ ID NO: 1 for the nucleic acid sequence and SEQ ID NO: 2 for the deduced amino acid sequence.

255

51174 Β

PRIMER 6:

RECEPTOR EXPRESSION Although various cells are available in the art to express the G protein-coupled receptor, it is most preferred to use mammalian cells or melanophores. The following is illustrative; experts in this field of science have the ability to determine those techniques that are presumably useful for the needs of experts. See, e.g., Example 4, supra, as it relates to melanophores.

a. Transient transfection

On day one, 6x106/ 10 cm a vessel with 293 cells is placed on a plate. On day two, two reaction tubes are prepared (the proportions that follow for each tube are per plate): tube A is prepared by mixing 4 ug of DNA (e.g., pCMV vector; pCMV vector with cDNA receptor, etc.) at 0, 5 mL serum-free DMEM (Gibco BRL); tube B was prepared by mixing 24 μL of lipofectamine (Gibco BRL) in 0.5 mL of serum-free DMEM. Tubes A and B are mixed by inversions (several times), followed by incubation at room temperature for 30-45 minutes. The mixture is referred to as a "transfection mixture". 293 cells on the plate were washed with 1HRV5, followed by the addition of 5 mL of serum-free DMEM. 1 mL of the transfection mixture was added to the cells, followed by incubation for 4 hours at 37 ° C / 5% CO2. The transfection mixture was removed by aspiration, followed by the addition of 10 mL of DMEM / 10% / Fetal bovine serum. The cells were incubated at 37 ° C / 5% CO2. After 48 hours of incubation, the cells were harvested and used for analysis.

256

51174Β

b. Stable cell lines

Approximately 12x106 293 cells are placed on a plate on a 15 cm plate of tissue culture. They are grown in DME High Glucose Medium which contains ten percent fetal bovine serum and one percent sodium pyruvate, Lglutamine, and antibiotics. Twenty-four hours after plating 293 cells (or up to -80% confluence), cells were transfected using 12pg DNA (e.g., pCMV-neor vector with DNA receptor). 12pg DNA is combined with 60μΙ_ lipofectamine and 2mL DME Serum-Free High Glucose Medium. The medium is aspirated from the well and the cells are washed once with serum-free medium. DNA, lipofectamine and a mixture of media were added to the plate along with 10 mL of serum-free medium. After incubation at 37 ° C for four to five hours, the medium is aspirated and 25 mL of serum-containing medium is added. Twenty-four hours after transfection, the medium is aspirated again, and fresh serum-free medium is added. Forty-eight hours after transfection, medium was aspirated and serum-free medium containing ganoticin (G418 drug) was added at a final concentration of approximately 12x106 293 cells placed on a 15 cm plate of tissue culture. They are grown in DME High Glucose Medium containing ten percent fetal bovine serum and one percent sodium pyruvate, L-glutamine, and antibiotics. Twenty-four hours after plating 293 cells (or up to 8080% confluence), cells were transfected using 12pg DNA (e.g., pCMV vector with a DNA receptor). 12pg DNA is combined with 60μ1_ lipofectamine and 2mL DME Serum-free high glucose medium. The medium is aspirated from the well and the cells are washed once with serum-free medium. DNA, lipofectamine and a mixture of media were added to the plate along with 10 mL of serum-free medium. After incubation at 37 ° C for four to five hours, the medium is aspirated and 25 mL of serum-containing medium is added.

257

51174 Β

Twenty-four hours after transfection, the medium is aspirated again, and fresh serum-free medium is added. Forty-eight hours after transfection, the medium is aspirated and serum-free medium containing ganoticin (G418 drug) is added to a final concentration of approximately 500 pg / mL. Transfected cells now undergo selection on positively transfected cells containing the G418 resistant gene. The medium is changed every four to five days as selection takes place. During selection, cells are grown to create stable pools, or divided for stable clonal selection.

EXAMPLE 7: SEARCH FOR SEARCH FOR CANDIDATE COMPOUND AS GPR119 AGONIST

Various approaches are available to search for candidate compounds as GPCR119 agonists. The following are illustrative; experts in this field of science have the ability to identify techniques that are presumably useful for the needs of experts. Experiments to search for a compound as a G protein-paired receptor agonist are well known to those skilled in the art (see, e.g., International Application WO 02/42461).

1. Membrane binding trials: [35S] GTPyS view

When the G protein-paired receptor is in its active state, either as a result of ligand binding or constitutive activation, the receptor is paired for the G protein and stimulates the release of GDP and subsequent binding of the GTP to the G protein. The alpha subunit of the G protein-receptor complex acts as a GTPase and slowly hydrolyzes GTP to GDP, when at that point the receptor is normally inactivated. Activated receptors continue to alter GDP for GTP. GTP analogue that cannot be hydrolyzed, [35S] GTPyS can be

258

51174 Β used to demonstrate enhanced binding [35S] GTPyS for membranes expressing activated receptors. Advantage of using [35S] GTPyS binding to measure activation is this. (a) that it is generically applicable to all G protein-coupled receptors; (b) that it is closest to the surface of the membrane making it less likely to pick up molecules that affect the intracellular cascade.

The experiment utilizes the ability of G protein-coupled receptors to stimulate [35S] GTPγS binding to membranes expressing relevant receptors. The assay is generic and has application in drug detection for all G protein-coupled receptors.

Membrane preparation

In some embodiments, membranes comprising the G protein-paired receptor of the invention and for use in identifying candida compounds such as, e.g., receptor agonists, are presumably prepared as follows:

a. Materials “Membrane scraping buffer” consists of 20 mM HEPES and 10 mM EDTA, pH 7.4; “Membrane wash buffer” consists of 20 mM HEPES and 0.1 mM EDTA, pH 7.4; Binding Buffer ”consists of 20 mM HEPES, 100 mM NaCl, and 10 mM MgCl2, pH 7,4.

b. Procedure

259

51174 Β

All materials will be stored on ice during the procedure. First, the medium will be aspirated from the confluent monolayer of cells, followed by washing with 10 mL of cold PBS, followed by aspiration. Thereafter, 5 mL of membrane scraping buffer will be added to scrape the cells; this will be followed by transfer of the cellular extract to 50 mL of centrifuged tubes (centrifuged at 20,000 rpm for 17 minutes at 4 ° C). Thereafter, the surface layer was aspirated and the pellet was resuspended in 30 mL of membrane wash buffer followed by centrifugation at 20,000 rpm for 17 minutes at 4 ° C. The surface layers will then be aspirated and the pellet resuspended in binding buffer. This will then be homogenized using a Brinkman Polytron gen homogenizer (1520 seconds to run until all material is in suspension). This is referred to herein as the Membrane Protein.

Bradford's protein assay

After homogenization, the membrane protein concentration will be determined using a Bradford protein assay (the protein can be diluted to about 1.5 mg / mL, aliquoted and frozen (-80 ° C) for later use; when frozen, the protocol for use will be be as follows: on the day of the experiment, the frozen membrane protein is thawed at room temperature, followed by vortexing and then homogenized with a Polytron at about 12 x 1000 rpm for about 5-10 seconds; it has been observed that for multiple preparations, the homogenizer should be carefully cleaned between homogenizations of different preparations.

a. Materials

260

51174 Β

Binding buffer (as above); Bradford color reagent; The Bradfor protein standard will be used, following the manufacturer's instructions (Biorad, cat. No. 500-0006).

b. Procedure

A duplicate tube will be prepared, one that includes a membrane, and one as an ‘empty’ control. Each contains 800 μΙ_ binding buffer. Thereafter, 10 μΙ of Bradford protein standard (1 mg / mL) will be added to each tube, and then 10 μl of membrane protein will be added to only one tube (not empty). After that, 200 μL of Bradford reagent dye will be added to each tube, followed by vortexing of each. After five (5) minutes, the tubes will be swirled again and the material in them will be transferred to the cuvettes. The cuvettes will then be read using a CECIL 3041 spectrophotometer, at a wavelength of 595.

Identification view

a. Materials

GDP buffer consists of 37.5 mL of binding buffer and 2 mg of GDP (Sigma, Cat. No. G-7127), followed by a series of dilutions in binding buffer to give 0.2 μΜ GDP (final GDP concentration in each well) is 0.1 μΜ GDP); each well containing the candidate compound has a final volume of 200 μΙ_ and consists of 100 μΙ_ GDP buffer (final concentration, 0.1 μΜ GDP), 50 μΙ_ membrane protein in binding buffer, and 50 μΙ_ [35S] GTPγS (0.6 nM) in binding buffer (2.5 μι. [35S] GTPγS on 10 mL of binding buffer).

261

51174 Β

b. Procedure

Candidate compounds will presumably be screened using a 96-well plate format (can be frozen at -80 ° C). The membrane protein (or membrane with an expression vector that excludes the Target GPCR, as a control) will be homogenized briefly after suspension. The protein concentration will be determined using a Bradford protein assay as given above. The membrane protein (and control) will then be diluted to 0.25 mg / mL in binding buffer (final assay concentration, 12.5 pg / well). Thereafter, 100 μΙ_ GDP buffer is added to each well of the VVallac Scintistrip ™ (VVallac) 5 μL tool-Pins will be used to transfer 5 μι. the candidate compound in each well (i.e., 5 pL in a total volume of 200 μΙ_ is a 1:40 ratio so that the final search concentration of the candidate compound is 10 μΜ). Again, to avoid contamination, after each step of transfer the tool should be rinsed in three tanks containing water (1X), ethanol (1X) and water (2X) - excess liquid should be shaken off the tool after each rinsing and dried with paper and handkerchiefs. Thereafter, 50 μΐ_ membrane protein will be added to each well (control well contains membranes without Targeted GPCR and is also utilized) and pre-incubated for 5-10 minutes at room temperature. After that, 50 μι [35S] GTPγS (0.6 nM) in binding buffer will be added to each well, followed by incubation on a shaker for 60 minutes at room temperature (again, in this example, the plates are covered with foil). The experiment will then be stopped by turning the plates at 4000 rpm for 15 minutes at 22 ° C. The plates will then be aspirated with an 8-channel manifold and sealed with plate covers. The plates will then be read

262

51174Β on VVallac 1450 using the setting “Prot. # 37 ”(according to the manufacturer's instructions).

2. Adenylyl cyclase assay

Flash Plate ™ adeninyl cyclase kit (New England Nuclear; Cat. No. SMP004A) designed for cell-based experiments can be modified for use with crude plasma membranes. Flash Plate wells may contain a scintillation coating that also contains a specific antibody that recognizes cAMP. well-generated cAMP can be quantified by direct competition to bind a radioactive cAMP tracer to a cAMP antibody. The following serves as a concise protocol for measuring changes in cAMP levels in whole cells that express receptors.

In certain embodiments, a modified Flash Plate ™ adenylyl cyclase kit (New England Nuclear; Cat. No. SMP004A) is used to identify candidate compounds such as, e.g., GPR119 agonists according to the following protocol.

Cells transfected with the G protein-paired receptor of the invention were harvested approximately three days after transfection. Membranes are prepared by homogenizing suspended cells in a buffer containing 20 mM HEPES, pH 7.4 and 10 mM MgCl2. Homogenization is performed on ice using Brinkman Polytron ™ for approximately 10 seconds. The resulting homogenate was centrifuged at 49,000 X g for 15 minutes at 4 ° C. The resulting pellet is then resuspended in buffer containing 20 mM HEPES, pH 7.4 and 0.1 mM EDTA, homogenized for 10 seconds,

263

51174 Β followed by centrifugation at 49,000 h g for 15 minutes at 4 ° C. The resulting pellet is then stored at -80 ° C until used. On the day of the direct identification search, the membrane pellet was slowly thawed at room temperature, resuspended in buffer containing 20 mM HEPES, pH 7.4 and 10 mM MgCl2) to obtain a final protein concentration yield of 60 mg / mL (resuspended membranes were then placed on ice until use).

cAMP standards and Detection buffer (containing 2 μθί trackers) [125J] cAMP (100 μl) for 11 mL of Detection Buffer] was prepared and maintained according to the manufacturer's instructions. The assay buffer was prepared fresh for screening and contained 20 mM HEPES, pH 7.4, 10 mM MgCl2, 20 mM phosphocreatine (Sigma), 0.1 units / mL creatine phosphokinase (Sigma), 50 μΜ GTP (Sigma) and 0.2 mM ATP (Sigma); The sample buffer is then stored on ice until used.

Candidate compounds are added, presumably, e.g. a 96-well plate (3 gL / well; 12 μΜ final assay concentration) together with 40 μΙ_ Membrane Protein (30 μ9 ^ 3Ζθηόΐό) and 50 μ1_ Assay Buffer. This mixture was then incubated for 30 minutes at room temperature, with gentle shaking.

After incubation, 100 [mu] L of Detection Buffer was added to each well, followed by incubation for 2-24 hours. The boards are then counted in a VVallac MicroBeta ploče board reader using “Prot. # 31 ”(according to the manufacturer's instructions).

3. CRE-Luc reporter view

264

51174 Β

293 and 293Τ cells were plated in 96-well plates at a density of 2 x 10 'cells per well and transfected using Lipofectamine Reagent (BRL) the next day according to the manufacturer's instructions. The DNA / lipid mixture was prepared for each transfection of 6 wells as follows: 260 ng plasmid DNA in 100 μΙ_ DMEM was gently mixed with 2 μΙ_ lipid in 100 μΙ_ DMEM (260 ng plasmid DNA contained 200 ng 8xCRE-Luc reporter plasmid, 50 ng pCMV containing the G protein-coupled receptor of the invention, or pCMV alone, is 10 ng of GPRS expression plasmid [GPRS in pcDNA3 (Invitrogen)]. The 8XCRE-Luc reporter plasmid was prepared as follows: The SRIF-B'gal vector was obtained by cloning the rat somatostatin promoter (-71 / + 51) at the GblV-HindIII site in the pBgal-Basic Vector (Clomech). Eight (8) copies of the cAMP response elements were obtained by PCR from the adenovirus template AdpCF126CCRE8 [see, Suzuki et al „Hum Gene Ther (1996) 7: 1883-1893] and cloned into the SRIV-B-gal vector at the Kpn-BglV position, resulting in an 8xCRE-B-gal reporter vector. The 8xCRE-Luc reporter plasmid was generated by replacing the beta-glactosidase gene in the 8xCREβ-gal reporter vector with the luciferase gene derived from the pGL3-base vector (Promega) and the HirićlTII-BamHI position. After 30 minutes of incubation at room temperature, the DNA / lipid mixture was diluted with 400 μL DMEM and 100 μL of the diluted mixture was added to each well. 100 μί DMEM with 10% FCS was added to each well after 4 hours of incubation in a cell culture incubator. The next day, the transfected cells were changed to 200 pL / well DMEM without phenol red, followed by washing with PBS. Luciferase activity was measured the next day using the LucLiteTM reporter gene assay kit (Packard) following the manufacturer's instructions and read on a 1450 MicroBeta in scintillation and luminescent counter (VVallac).

265

51174Β

PRIMER 8

RADIOACTIVALLY MARKED COMPOUND

In certain embodiments, a compound known as a G protein-coupled receptor ligand of the invention is radiolabeled. The radiolabeled compound as described herein can be used for screening assays to identify / evaluate compounds. In general, a newly synthesized or identified compound (i.e., a test compound) can be evaluated for its ability to reduce the binding of a radiolabeled known ligand and receptor, by its ability to reduce the formation of a complex between a radiolabeled known ligand and a receptor. Suitable radionucleotides that may be incorporated into the compounds of the present invention include but are not limited to3X (also spelled as T for tritium), 11C, UC, 18F, 82Br, 123J, 124J, 125J, 131J, 75Br, 15THE, 13N, 35S i 77Br. Compounds that incorporate3H, 14C, 125J, 131J, 35With or 82Br will generally be the most useful. For radioactive recording applications11C, 18F, 125J, 123J, 124J, 131J, 75Vg, 76No. or 77Br will generally be the most useful.

It is understood that a radiolabeled compound has at least one radionuclide incorporated. In some embodiments, the radionuclide is selected from the group consisting of3H, 14C, 125J, 35S i 82Br. In some embodiments, the radionuclide is3H ili 14C.

Synthetic processes for incorporating radioactive isotopes including those applicable to those compounds known as G protein ligands

266

51174 Β Paired receptor inventions are well known in the art and involve the incorporation of tritium activity levels into target molecules, are as follows:

A. Catalytic reduction with tritium gas - this process normally gives a yield of high specific activity of the product and requires halogenated or unsaturated precursors.

B. Reduction with Sodium Hydrohydride [3X] - this process is rather inexpensive and requires precursors containing reducible functional groups such as aldehydes, ketones, lactones, esters and the like.

C. Reduction with Lithium Aluminum Hydride [3H] - This procedure offers products with almost theoretical specific activities. It also requires precursors containing reducible functional groups such as aldehydes, ketones, lactones, esters and the like.

D. Tritium Gas Exposure Labeling - This procedure involves exposing precursors containing interchangeable protons to tritium gas in the presence of an appropriate catalyst.

E. N-Methylation using Methyl iodide [3H] - This process is commonly used to prepare O-methyl or N-methyl (3H) products by treatment of appropriate precursors with high specific activity methyl iodide (3H). This process generally allows a high specific activity, such as, for example, about 80-87 Ci / mmol.

Synthetic procedures for incorporating levels 125 J in the target molecules include:

A. Sandmeyer and similar reactions - This process transforms an aryl or heteroaryl amine into a diazonium salt, such as a tetrafluoroborate salt, and

267

51174 Β then to 125J of the labeled compound using Na 125J. A representative procedure is given by Zhu. D.-G. And co-workers in J. Org. Chem. 2002, 67, 943-948.

B. Vegetable garden 12SPhenol iodination - This process allows incorporation 125 J at the ortho position of the phenol as given in Collier, TL and co-workers in J. Labeled Compd Radioharm. 1999, 42, S264-S266.

C. Exchange aryl and heteroaryl bromide with 125 J - this procedure is generally a two-step procedure. The first step is the conversion of aryl and heteroaryl bromides to the corresponding tri-alkyltine intermediates product using for example, a Pd catalyzed reaction [i.e., Pd (Ph3P)4] or through aryl or heteroaryl lithium, in the presence of a trialkyltin halide or alkylditine hexa [e.g., (CH3)3SnSn(CH3)3J. A representative procedure is given in Bas, M.-D. and co-workers in J. Labeled Compd Radiopharm., 2001, 44, S280-S282.

The foregoing techniques are intended to be illustrative only and not restrictive. Other radiolabelling techniques of a compound known as a G protein-coupled receptor ligand of the invention are well known to those skilled in the art.

PRIMER 9

RECEPTOR BINDING TEST

The test compound can be evaluated for its ability to reduce complex formation between a compound known as the G protein-paired receptor ligand of the invention and the receptor. In certain

268

In 51174Β embodiments, the known ligand is radiolabeled. Radiolabeled known ligand can be used in a screening assay to identify / evaluate compounds. In general, a newly synthesized or identified compound (i.e., a test compound) can be evaluated for its ability to reduce the binding of a radiolabeled known ligand and receptor.

Experiment protocol for detecting a complex between a compound known as a ligand G protein-paired receptor of the invention and a receptor

A. Receptor preparation

293 cells were instantly transfected with 10 μg of an expression vector containing a polynucleotide encoding the G protein-paired receptor of the invention using 60 μL lipofectamine (15-cm wells). The currently transfected cells were grown in a 24-hour (75% confluence) medium with a change of medium and removed with 10 mL / well of Hepes-EDTA buffer (20 mM Hepes + 10 mM EDTA, pH 7; 4). The cells were then centrifuged in a Beckman Coulter centrifuge for 20 minutes, at 17,000 rpm (JA-25.50 rotor). The pellet was then resuspended in 20 mM Hepes + 1 mM EDTA, pH 7.4 and homogenized with a 50-mL Dounce homogenizer and centrifuged again. After removing the surface layer, the pellets are stored at 80 ° C until used in the experiment. When used in the experiment, the membranes were thawed on ice for 20 minutes and then 10 mL of incubation buffer (20 mM Hepes, 1 mM MgCl) was added.2, 100 mM NaCl, pH 7.4). The membranes are then vortexed to resuspend the crude membrane pellet and homogenized with a Brinkmannn PT-3100 Polytron

269

51174Β homogenizer for 15 seconds at position 6. Membrane protein concentration was determined using a BRL Br adford protein assay.

B. Binding experiment

For total binding, a total volume of 50 μL of appropriately diluted membranes (diluted in assay buffer containing 50 mM Tris HCl (pH 7.4), 10 mM MgCl2, and 1 mM EDTA; 5-50 [mu] g protein) was added to a 96-well propylene microtiter plate followed by the addition of 100 [mu] L assay buffer and 50 [mu] L radiolabeled ligand. For non-specific binding, 50 [mu] L of assay buffer is added instead of 100 [mu] L and an additional 50 [mu] L of said non-radiolabeled ligand is added before 50 [mu] L of radiolabeled known ligand is added. The plates are then incubated at room temperature for 60-120 minutes. The binding reaction was quenched by filtering the assay plates through a Microplat Devices GF / C Unifilter filtration plate with a Brandell 96-well plate collector followed by washing with cold 50 mM Tris HCl, pH 7.4 containing 0.9% NaCl. Then seal the bottom of the filter plate, add 50 μL of Optihpase Supermir to each well, seal the top of the plates, and count the plates in a Trilux MicroBeta scintillation counter. To determine whether less complex between said radiolabeled known ligand and said receptor formed in the presence of test compound, instead of adding 100 μL of assay buffer, 100 μL of appropriately diluted test compound was added to the appropriate wells followed by the addition of 50 μL of radiolabeled known ligand.

The level of specific binding of a radiolabeled known ligand in the presence of a test compound less than the level of specific binding

270

51174 Β Radiolabeled known ligand in the absence of a test compound is indicative of less complex formation between said radiolabeled known ligand and said receptor in the presence of a test compound than in the absence of a test compound.

PRIMER 10

EXPRESSION OF GPR119 IN THE INTESTINE

Expression of GPR119 mRNA in various tissues was determined using the Rnase Protection Assay (RPA).

Mouse tissue RNA was obtained commercially (Clontech). A 255 bp protected fragment of murine GPR119 was cloned into the pCRII-TOPO cloning vector (Invitrogen). The sequence of the 255 bp protected fragment is as follows (nucleotides containing the murine GPR119 coding region are underlined):

5’OTGGCCTGCCAGTAATGGCCAGAACGGTGCTGTGACTCTGAGCCT ATAGCACAT CTAATCCTGTCCCATGAGAATCTGAGCTCGCCATCCAGCATGCCTTT GTAAGTGGA

AGTGCTGCTACCTCACCATGGAGTCATCCTTCTCATTTGGAGTGATCC TTGCTGTCC

TAACCATCCTCATCATTGCTGTTAATGCACTGGTAGTTGTGGCTATGC TGCTATCAA

TCTACAAGAATGATGGTGTTGGCCTTTGCTT-З '(SEQ ID N0: 5).

271

51174Β

The full length sample size is 356 bp. The plasmid was linearized with BamHI and gel purified using a Sephaglass Bandprep kit (Amersham). After gel purification of the fragment, the riboprobe was made by in vitro transcription using T7 RNA polymerase (Ambion Maxiscript kit). The assay was purified by acrylamide gel electrophoresis and hybridized to 20 μg total RNA at 45 ° C overnight. Hybrids were digested with RNA the next day and run on 5% acrylic gel to detect results (Ambino, RPA III kit). All procedures for in vitro transcription and RPA reactions were performed following the manufacturer's instructions.

The highest level of GPR119 expression was found in pancreatic sections, although GPR119 was also found to be expressed in the colon and to a lesser extent in the small intestine. See Figure 3.

PRIMER11

EXPRESSION OF GPR119 IN GLUTAG ENTEROENDOCRIN STEEL LINE

Northern blot analysis was used to determine the level of GPR119 mRNA expression in GLUTag (F / a subline; see Example 12, infra), HIT-T15 (pancreatic beta hamster cell line; ATCC Vg. CRL-1777), and NCI-H716 ( human endocrine cell line; ATCC No. CRL-251). GLUTag is in the murine enteroendocrine cell line secreting GLP-1 [Brubaker et al., Endocrinology (1998) 139: 4108-4114].

RNA is extracted from cultured cell tissue using RNA Bee (TelTest). Ten (10) pg of total RNA was separated on 0.8% electrophoresis

272

51174 Β Agarose aela, and stains on nylon membranes (Amersham). The RNA stain hybridizes to32P-labeled mouse GPR119 cDNA probe (see, e.g., murine gPR119, GenBank® Accession No. ΑΥ288423), followed by retesting with 32P-labeled cDNA probe for mouse prepoglucagon mRNA as a control. Hybridization signals are visualized by autoradiography.

GLUTag cells (Fia subline; see Example 12, infra) were found to express GPR119 and prepoglucagon. See Figure 4

PRIMER 12

GPR119 AGONIST RAISES INTRACELLULAR CAMP IN GLUTAG CELLS

GLUTag is a murine enteroendocrine cell line secreting GLP-1 [Brubaker et al., Endocrinogy (1998) 139: 4108-4114]. The effect of GPR119 agonists on the level of intracellular cAMP in GLUTag (Fla subline) enteroendocrine cells is determined. Fro subline GLUTag is used as a negative control. Analysis of the northern spot (insertion) using a mouse GPR119 cDNA probe (see, e.g., mouse GPR119, GenBank® Accession no. ΑΥ288423) indicates that the Fla subline GLUTag expresses GPR119, while the Flo subline GLUTag does not express that GPR119 can be detected.

GluTag (GLUTag-Fla and GLUTag-Fro) cells were plated at 8585% confluence in a 15-cm tissue culture plate with regular growth medium. The next day, cells were scraped with cold scraping Buffer (20 mM HEPES, 10 mM EDTA, pH 7.4) and downed at 100 rpm for 17 minutes at 4 ° C. Cell pellets are washed with cold

273

51174 Β

Membrane wash buffer (20 mM HEPES, 0.1 mM EDTA, pH 7.4) and swirled again as described above. Membrane pellets were resuspended in cold binding Buffer (20 mM HEPES, 1 mM MgCl2, 100 mM NaCl, pH 7.4) and homogenize twice using a Polytron ™ homogenizer (Model No. PT3100; Brinkman) at 7000 rpm for 10 seconds. Protein concentration is determined by Bradford's experiment. Cell membranes were diluted to a protein concentration of 0.2 mg / mL in Binding Buffer. (The final concentration of the experiment is 10 ug / pool).

The cyclase assay is performed with the Flash Plate ™ Adenylyl cyclase kit (New England Nuclear; Cat. Vg. SMP004A). Flash pool pools contain a scintillation coating that even contains a specific antibody that recognizes cAMP. The generated cAMP in the wells can be quantified by direct competition for binding of the radioactive cAMP tracker to the cAMP antibody.

Details of the cyclase assay as performed are described here. Standards cAMP and Detection Buffer (containing'l pCi tracker [125J] cAMP (50 μΙ_) to 11 mL Detection Buffer) were prepared and maintained according to the manufacturer's instructions. The GPR119 agonist AR231453 was freshly prepared and serially diluted in 50 μL of freshly prepared 2x Reconstitution buffer (20 mM Phosphocreatine, 20 units / 50 μL creatine phosphokinase, 20 μM GTP, 0.2 mM ATP, 1 mM ΙΒΜΧ). Eight doses of GPR119 agonists, from 10 μM down to 1.27 nM were tested. The experiment is performed on a flash board with 96 pools. The GPCR119 agonist and cAMP standards are added to the appropriate well. The cell membranes are then added to the wells, and the plate is incubated for 60 minutes at room temperature. 100 uL Detection mix which

274

51174 Β contains a tracker 3H-cAMPs are then added to each well. The plates were incubated for two hours, after which the samples were calculated in a Vallac MicroBeta scintillation counter. The cAMP / pool values are then extrapolated from the standard cAMP curve contained within each assay plate.

GPCR119 was found to raise the level of intracellular cAMP in GLUTag-Fla cells expressing GPR119, but also in GLUTag-Fro cells not expressing GPR119. The GPR119 agonist was found to raise cAMP in GLUTag cells with an EC50 of about 4.3 nM. See Figure 5.

PRIMER13

GPR119 AGONSIT STIMULATES GLP-1 SECRETION IN GLUTAG CELLS

GLUTag-Fla cells (see Example 12, supra) were plated on 24-well plates on day one in complete culture medium (DMEM / 10% FBS). On day 2, the culture medium was changed to low glucose medium (DMEM / 3mM Glucose / 10% FBS). On the third day, the cells are washed twice with IXPBS. Washed GLUTag-Fla cells were stimulated with GPR119 agonist (AR231453) at various concentrations or with forskolin (1 μM) as a positive control in serum-free DMEM with 15 mM glucose for one hour at 37 ° C and 5% CO2 in a tissue culture incubator. The surface layers were then collected and clarified by centrifugation at 500 g and 4 ° C for 5 minutes. The released GLP-1 in the surface layer was determined by ELISA using reagents purchased from LINCO Research Laboratory [Glucagon-like peptide-1 (Active) ELISA kit cat. no. # EGLP-3SK].

275

51174 Β

GLUTag cells were found to secrete GLP-1 when stimulated with a GPR119 agonist. See Figure 6.

EXAMPLE 14: EFFECT OF GPR119 AGONIST AR244061 AND DPP-IV INHIBITOR IN GLUCOSE LOWERING IN THE ORAL GLUCOSE TOLERANCE TEST (oGTT) IN MICE

An oral glucose tolerance test (oGTT) in a 7-8 week old mouse C57BL / 6J was performed as described herein. Rgeko at night in starved mice (n = 8 mice per treatment group) was administered via oral carrier gavage, GPR119 agonist (AR244061, other than that used in Example 1), DPP-IV inhibitor (MK-0431, LAF237 or FE107542 ), or a combination of GPR119 agonists and DPP-IV inhibitors. The GPR119 agonist AR244061 is given at 10 mpk or 30 mpk (milligrams of compound per kilogram of body weight). DPP-IV inhibitors MK-0431 and LAF237 are given at 1 mpk, and FE107542 is given at 10 mpk. One hour after compound dosing, an oral bolus of glucose (2 grams / kg) was delivered, and blood samples from beets were collected to measure blood glucose at 0, 30, 60, and 120 minutes. The results obtained for MK-043Tsu are shown in Figure 7; the results obtained for LAF237 are shown in Figure 8; and the results obtained for FE107542 are shown in Figure 9. For each treatment group, the glycemic deviation curve was plotted and presented with the blood glucose concentration given as mean +/- standard error of mean (SEM). The field below the glycemic deviation curve (AUC) is calculated and reported as AUC (% of control vehicle).

From the inspection of Figure 7, Figure 8 and Figure 9 it is apparent that where the concentrations of both GPR119 agonists were used (the GPR119 agonist is different from that of

276

51174 Β used in Example 1) and the DPP-IV inhibitors themselves (with each of the three different DPP-IV inhibitors) measurable glycemic control was provided, the combination of GPR119 agonists and DPP-IV inhibitors provided a dose-dependent level of glycemic control higher than when provided GPR119 agonist or DPP-IV inhibitor alone.

While the foregoing specification teaches us the principles of the present invention, with examples provided for the purpose of illustration, it will be understood that the practice of the invention encompasses all common variations, adaptations, or modifications, as coming from the scope of the following claims.

LISTA SEKVENCI <110> Arena Pharmaceuticals, Inc.

<120 COMBINATION THERAPY FOR THE TREATMENT OF DIABETES AND RELATED CONDITIONS AND FOR THE TREATMENT OF CONDITIONS IMPROVED BY INCREASED GLP-1 BLOOD LEVELS <130> WJW / FP6442545 <140> EP <141> 2006-01-09 < 2006-01-09 <150> PCT / US2006 / 000510 <151> 2006-01-09 <150> US 60 / 643,086 <151> 2005-01-10 <150> US 60 / 683,172 <151> 2005-05- 19

277

51174 Β <150> US 60 / 726,880 <151> 2005-10-14 <160> 5 <170> Patent Version 3.2 <210> 1 <211> 1008 <212> DNK <213> Homo sapiens <400> 1 reggae ctttctcatt tggagtgatc cttgctgtcc tggcctccct caccattgct £ 0 actaacacac tagtggctgt ggctgtgctg ctgttgatcc acaagaatga Cggtgtcagt120 ctctgcttca ccttgaatct ggctgtgget gacaccttga ttggtgtggc catctctggc180 ctactcacag accagctctc cagcccttct cggcccacac agaagacccc gtgcagcctg240 cggatggcat ttgtcacttc ctccgcagct gcctctgtcc tcacggtcat gctgatcacc300 ettgacaggt accttgccat caagcagccc ttccgctact tgaagatcae gagtgggttc360 gtggccgggg cetgeattgc cgggctgtgg ttagtgtctt acctcattgg cttcctccca420 ctcggaaccc ccatgttcca gcagactgcc tacaaagggc agtgcagctt ctttgctgta480 tttcaccctc acttcgtgct gaecctctcc tgcgttggct tcttcccagc catgctcctc540 tttgtcttct tctactgcga catgctcaag attgcctcca tgcacagcca gcagattcga600 aagatggaac acgcaggagc catggctgga ggttatcgat ccccacggac tcccagcgac560 ttcaaagctc tccgtactgt gtccgttctc attgggagct ttgctctatc ctggaccccc720 ttccttacea ctggcattgt gcaggtggcc tgccaggagt gtcacctcta cctagtgctg780 gaacggtacc tgtggctgct cggcgtgggc aactccctgc tcaacccact catctatgcc840 tattggcaga aggaggtgcg actgcagctc taccacatgg ccctaggagt gaagaaggtg900 ctcacctcat tcctcctctt tctctcggcc aggaattgtg geccagagag gcccagggaa960 agttcctgtc acatcgtcac tatctccagc tcagagtttg atggctaa1008 <210>2 <211> 335 <212> PRT

278

51174 Β <213> Homo sapien <400> 2

<td rowspan="2">With 1</td><td rowspan="2">Glu</td><td rowspan="2">To be</td><td rowspan="2">To be</td><td rowspan="2">Faction five</td><td colspan="4" rowspan="2">Ser Phe Gly Val</td><td colspan="6">Ile Leu Ala Val Leu Ala</td><td rowspan="2">To be</td>

<td>Lion</td><td>with</td><td>with</td><td>Ala 20</td><td>Thr</td><td>Asn</td><td>Thr</td><td>Lion</td><td>Val 25</td><td>Ala</td><td>Val</td><td>Ala</td><td>Val</td><td>sick of thirty</td><td>Lion</td><td>Lion</td>

<td>with</td><td>His</td><td>LyS 35</td><td>Asn</td><td>Asp</td><td>Gly</td><td>hrs</td><td>To be 40</td><td>Lion</td><td>Your</td><td>Faction</td><td>Thr</td><td>Lion 45</td><td>ABP</td><td>Lion</td><td>Ala</td>

<td>Gln 65</td><td>Lion</td><td>To be</td><td>To be</td><td>Pro</td><td>To be 70</td><td>Angry</td><td>Pro</td><td>Thr</td><td>Gln</td><td>Light 75</td><td>Thr</td><td>yours</td><td>Cys</td><td>To be</td><td>Lion 80</td>

<td>Angry</td><td>With</td><td>Ala</td><td>Sculptures</td><td>Val 95</td><td>Thr</td><td>To be</td><td>To be</td><td>Ala</td><td>Ala 90</td><td>Ala</td><td>To be</td><td>Val</td><td>Lion</td><td>Thr 95</td><td>hrs</td>

<td>With</td><td>Lion</td><td>with</td><td>Thr one hundred</td><td>Fhe</td><td>Asp</td><td>Angry</td><td>Flag</td><td>Lion 105</td><td>Ala</td><td>with</td><td>Light</td><td>Gln</td><td>Pro 110</td><td>Faction</td><td>Angry</td>

<td>Flag</td><td>Lion</td><td>Light 115</td><td>with</td><td>With</td><td>To be</td><td>Gly</td><td>Faction 120-</td><td>Val</td><td>Ala</td><td>Gly</td><td>Ala</td><td>Cys 125</td><td>with</td><td>Ala</td><td>Gly</td>

<td>Lion</td><td>Trp 130</td><td>Lion</td><td>Val</td><td>To be</td><td>Flag</td><td>Lion 135</td><td>with</td><td>Gly</td><td>Faction</td><td>Lion</td><td>Pro 140</td><td>Lion</td><td>Gly</td><td>with</td><td>Pro</td>

<td>With 145</td><td>Sculptures</td><td>Gln</td><td>Gln</td><td>Thr</td><td>Ala 150</td><td>Flag</td><td>Light</td><td>Gly</td><td>Gln</td><td>Cys 155</td><td>To be</td><td>Faction</td><td>Faction</td><td>Ala</td><td>Val 160</td>

<td>Faction</td><td>His</td><td>Pro</td><td>His</td><td>Faction 165</td><td>Val</td><td>Lion</td><td>Thr</td><td>Lion</td><td>To be 170</td><td>Cys</td><td>Val</td><td>Gly</td><td>Faction</td><td>Faction 175</td><td>Pro</td>

279

51174Β

<td colspan="3">Ala Met Leu</td><td>Lion one hundred</td><td colspan="2">Phe Val</td><td>Faction</td><td>Faction</td><td>flag 185</td><td colspan="3">cys Asp Met</td><td>Lion</td><td>Light 190</td><td>with</td><td>Ala</td>

<td>To be</td><td>With</td><td>His</td><td>To be</td><td>Gln</td><td>Gln</td><td>with</td><td>Angry</td><td>Light</td><td>With</td><td>Glu</td><td>His</td><td>Ala</td><td>Gly</td><td>Ala</td><td>With</td>

<td>Ala</td><td>Gly</td><td>Gly</td><td>Flag</td><td>Angry</td><td>To be</td><td>Pro</td><td>Angry</td><td>Thr</td><td>RGO</td><td>To be</td><td>Asp</td><td>Faction</td><td>Light</td><td>Ala</td><td>Lion</td>

<td>Angry</td><td>Thr</td><td>hrs</td><td>To be</td><td>Val</td><td>Lion</td><td>with</td><td>Gly</td><td>To be</td><td>Faction</td><td>Ala</td><td>Lion</td><td>To be</td><td>Trp</td><td>Thr</td><td>Pro</td>

<td>Faction</td><td>Lion</td><td>with</td><td>Thr</td><td>Gly</td><td>with</td><td>Val</td><td>Gln</td><td>Val</td><td>Ala</td><td>Cys</td><td>Gln</td><td>Glu</td><td>Cys</td><td>His</td><td>Lion</td>

<td>Flag</td><td>Lion</td><td>Val</td><td>Lion</td><td>Glu</td><td>Angry</td><td>Flag</td><td>Lion</td><td>Trp</td><td>Lion</td><td>Lion</td><td>Gly</td><td>Val</td><td>Gly</td><td>Asn</td><td>To be</td>

<td>Lion</td><td>Lion</td><td>Acn</td><td>Pro</td><td>Lion</td><td>with</td><td>Flag</td><td>Ala</td><td>Flag</td><td>Trp</td><td>Gln</td><td>Light</td><td>Glu</td><td>Val</td><td>Angry</td><td>Lion</td>

<td>Gln</td><td>Lion</td><td>Flag</td><td>Hls</td><td>With</td><td>Ala</td><td>Lion</td><td>Gly</td><td>Val</td><td>l.ys</td><td>Light</td><td>Val</td><td>Lion</td><td>Thr</td><td>To be</td><td>Faction</td>

<td>Lion</td><td>Lion</td><td>Faction</td><td>Lion</td><td>To be</td><td>Ala</td><td>Angry</td><td>Asn</td><td>Suz</td><td>Gly</td><td>Pro</td><td>Glu</td><td>Angry</td><td>Pro</td><td>Angry</td><td>Glu</td>

<td>To be</td><td>To be</td><td>Cys</td><td>His</td><td>for</td><td>Val</td><td>Thr</td><td>with</td><td>To be</td><td>To be</td><td>To be</td><td>Glu</td><td>Faction</td><td>ASp</td><td>Gly</td><td></td>

<210>3 <211 >22 <212> DNK <213> Veštačka <220>

<223> Prajmer <400> 3 gtcctgccac ttcgagacat gg 22

280

51174 Β <210>4 <211 >23 <212> DNK <213> Veštačka <220 <223> Prajmer

<td>gaaacttctc tgcccttacc gfc</td><td> 23</td>

<td><210 5 <211> 255 <212> DNK <213> Artificial</td><td></td>

ctggcctgcc agtaatggcc agaacggtgc tgtgactctg agcctatagc acatctaatc ctgtcccatg agaatctgag ctcgccatcc agcatgcctt tgtaagtgga agtgctgcta

120 cctcaccatg gagtcatcct tctcatttgg agtgatcctt gctgtcctaa ccatcctcat

180 cattgctgtt aatgcactgg tagttgtggc tatgctgcta tcaatctaca agaatgatgg

240 tgttggcctt tgctt

255

281

51174 Β

LISTA SEKVENCI <110> Arena Pharmaceuticals, Inc.

<120> COMBINATION THERAPY FOR THE TREATMENT OF DIABETES AND CONDITIONS

POVEZANIH SA NJIME I ZA TRETMAN STANJA POBOLJŠANIH POVEĆANJEM NIVOA GLP-1 U KRVI <130> WJW/FP6442545 <140> EP <141> 2006-01-09 <150> EP 06717678.4 <151 >2006-01-09 <150> PCT/US2006/000510 <151> 2006-01-09 <150> US 60/643,086 <151> 2005-01-10 <150> US 60/683,172 <151> 2005-05-19 <150> US 60/726,880 <151 > 2005-10-14 <160> 5 <170> Patentin version 3.2 <210> 1 <211>1008 <212> DNK <213> Homo sapien <400> 1

282

51174 Β

<td>atggtcat</td><td>ctttctcatt</td><td>tggagtgatc</td><td>cttgctgtcc</td><td>tggcctccct</td><td>catcattgct</td><td> 60</td>

<td>actaacacac</td><td>tagtggctgt</td><td>ggctgtgctg</td><td>ctgttgatcc</td><td>areas</td><td>tggtgtcagt</td><td> 120</td>

<td>ctctgcttca</td><td>ccttgtct</td><td>ggctgtggct</td><td>gacaccttga</td><td>ttggtgtggc</td><td>catctctggc</td><td> 180</td>

<td>ctactcacag</td><td>accagctctc</td><td>cagcccttct</td><td>cggcccacac</td><td>agaagaccct</td><td>gtgcagcctg</td><td> 240</td>

<td>cggatggcat</td><td>ttgtcacttc</td><td>ctccgcagct</td><td>gcctctgtcc</td><td>tcacggtcat</td><td>gctgatcacc</td><td> 300</td>

<td>tttgacaggt</td><td>accttgccat</td><td>caagcagccc</td><td>ttccgctact</td><td>tgaagatcat</td><td>gagtgggttc</td><td> 360</td>

<td>gtggccgggg</td><td>cctgcattgc</td><td>cgggctgtgg</td><td>ttagtgtctt</td><td>acctcattgg</td><td>cttcctccca</td><td> 420</td>

<td>ctcggaatcc</td><td>ccatgttcca</td><td>gcagactgcc</td><td>tacaaagggc</td><td>agtgcagctt</td><td>ctttgctgta</td><td> 480</td>

<td>tttcaccctc</td><td>acttcgtgct</td><td>gaccctctcc</td><td>tgcgttggct</td><td>tcttcccagc</td><td>catgctcctc</td><td> 540</td>

<td>tttgtcttct</td><td>tctactgcga</td><td>catgctcaag</td><td>attgcctcca</td><td>tgcacagcca</td><td>gcagattcga</td><td> 500</td>

<td>area</td><td>atgcaggagc</td><td>catggctgga</td><td>ggttatcgat</td><td>ccccacggac</td><td>tcccagcgac</td><td>ббо</td>

<td>ttcaaagctc</td><td>tccgtactgt</td><td>gtctgttctc</td><td>attgggagct</td><td>ttgctctatc</td><td>ctggaccccc</td><td> 720</td>

<td>ttccttatca</td><td>ctggcattgt</td><td>gcaggtggcc</td><td>tgccaggagt</td><td>gtcacctcta</td><td>cctagtgctg</td><td> 780</td>

<td>gaacggtacc</td><td>tgtggctgct</td><td>cggcgtgggc</td><td>aactccctgc</td><td>tcaacccact</td><td>catctatgcc</td><td> 840</td>

<td>tattggcaga</td><td>aggaggtgcg</td><td>actgcagctc</td><td>taccacatgg</td><td>ccctaggagt</td><td>gaagaaggtg</td><td> 900</td>

<td>ctcacctcat</td><td>tcctcctctt</td><td>tctctcggcc</td><td>aggttgtg</td><td>gcccagagag</td><td>gcccagggaa</td><td> 960</td>

<td>agttcctgtc</td><td>acatcgtcac</td><td>tatctccagc</td><td>tcagagtttg</td><td>atggctaa</td><td></td><td> 1008</td>

<2102 <211 >335 <212> PRT <213> Homo sapien <400 2

283

51174Β

<td>With 1</td><td colspan="2">Glu Ser</td><td colspan="2">Ser Phe five</td><td>To be</td><td>Faction</td><td>Gly</td><td>Val</td>

<td>with</td><td>His</td><td>Light 35</td><td>Asn</td><td>Asp</td><td>Gly</td><td>Val</td><td>To be 40</td><td>Lion</td>

<td>Gln 65</td><td>Lion</td><td>To be</td><td>To be</td><td>Pro</td><td>To be 70</td><td>Angry</td><td>Pro</td><td>Thr</td>

<td>Angry</td><td>With</td><td>Ala</td><td>Faction</td><td>Val 85</td><td>Thr</td><td>To be</td><td>To be</td><td>Ala</td>

<td>With</td><td>Lion</td><td>with</td><td>Thr one hundred</td><td>Faction</td><td>Asp</td><td>Angry</td><td>Flag</td><td>Lion 105</td>

<td>Flag</td><td>Lion</td><td>Light 115</td><td>with</td><td>With</td><td>To be</td><td>Gly</td><td>Faction 120</td><td>Val</td>

<td>With 145</td><td>Faction</td><td>Gln</td><td>Gln</td><td>Thr</td><td>Ala 150</td><td colspan="3">Thug I> ys Gly</td>

<td>Faction</td><td>His</td><td>Pro</td><td>His</td><td>Faction 165</td><td>Val</td><td>Lion</td><td>Thr</td><td>Lion</td>

<td>Val</td><td>Ala</td><td>Val</td><td>Lion thirty</td><td>Lion</td><td>Lion</td>

<td>Faction</td><td>Thr</td><td>Lion 45</td><td>Asn</td><td>Lion</td><td>ALa</td>

<td>Light 75</td><td>Thr</td><td>Lion</td><td>Cys</td><td>To be</td><td>Lion 80</td>

<td>with</td><td>Light</td><td>Gln</td><td>Pro 110</td><td>Faction</td><td>Angry</td>

<td>Cys 155</td><td>To be</td><td>Faction</td><td>Faction</td><td>Ala</td><td>Val 160</td>

<td>Cys</td><td>Val</td><td>Gly</td><td>Faction</td><td>Faction 175</td><td>Pro</td>

284

51174 Β

<td>Ala</td><td>Gly</td><td>Gly</td><td>Flag</td><td>Angry</td><td>To be</td><td>Pro</td><td>Angry</td><td>Thr</td><td>Pro</td><td>To be</td><td>Asp</td><td>Faction</td><td>Light</td><td>Ala</td><td>Lion</td>

<td>Angry</td><td>Thr</td><td>Val</td><td>To be</td><td>Val</td><td>Lion</td><td>with</td><td>Gly</td><td>To be</td><td>Faction</td><td>Ala</td><td>Lion</td><td>To be</td><td>Trp</td><td>Thr</td><td>Pro</td>

<td>Flag</td><td>Lion</td><td>Val</td><td>Lion</td><td>GlU</td><td>Angry</td><td>Flag</td><td>Lion</td><td>Trp</td><td>lion</td><td>Lion</td><td>Gly</td><td>Val</td><td>Gly</td><td>Asn</td><td>To be</td>

<td>Lion</td><td>Lion</td><td>Asn</td><td>Pro</td><td>Lion</td><td>with</td><td>Flag</td><td>Ala</td><td>Flag</td><td>Trp</td><td>Gln</td><td>Light</td><td>Glu</td><td>Val</td><td>Angry</td><td>Lion</td>

<td>Gln</td><td>Lion</td><td>Flag</td><td>His</td><td>With</td><td>Ala</td><td>Lion</td><td>Gly</td><td>Val</td><td>Light</td><td>bys</td><td>Val</td><td>Lion</td><td>Thr</td><td>To be</td><td>Faction</td>

<td>Lion</td><td>Lion</td><td>Faction</td><td>Lion</td><td>To be</td><td>Ala</td><td>Angry</td><td>Asn</td><td>Cys</td><td>Gly</td><td>Pro</td><td>Glu</td><td>Angry</td><td>Pro</td><td>Angry</td><td>Glu</td>

<td>To be</td><td>to be</td><td>Cys</td><td>His</td><td>with</td><td>Val</td><td>Thr</td><td>with</td><td>To be</td><td>To be</td><td>To be</td><td>Glu</td><td>Faction</td><td>Asp</td><td>Gly</td><td></td>

<2103 <211 >22 <212> DNK <213> Veštačka <220 <223> Prajmer

285

51174 Β

<td>gtcctgccac ttcgagacat gg</td><td> 22</td>

<td><210>4 <211 >23 <212> DNK <213> Artificial</td><td></td>

<td><220> <223> Prajmer</td><td></td>

<td><400>4 gaaacttctc tgcccttacc gtc</td><td> 23</td>

<td><210 5 <211 >255 <212> DNK <213> Artificial</td><td></td>

<td>ctggectgcc</td><td>agtaatggcc</td><td>agaacggtgc</td><td>tgtgactctg</td><td>agcctatagc</td><td>acatctaatc</td><td> 60</td>

<td>ctgtcccatg</td><td>agaatctgag</td><td>ctcgccatcc</td><td>agcatgcctt</td><td>tgtaagtgga</td><td>agtgctgcta</td><td> 120</td>

<td>cctcaccatg</td><td>gagtcatcct</td><td>tctcatttgg</td><td>agtgatcctt</td><td>gctgtcctaa</td><td>ccatcctcat</td><td>1Β0</td>

<td>cattgctgtt</td><td>aatgcactgg</td><td>tagttgtggc</td><td>tatgctgcta</td><td>tcaatctaca</td><td>agaatgatgg</td><td> 240</td>

<td>tgttggcctt</td><td>tgctt</td><td></td><td></td><td></td><td></td><td> 255</td>

286

51174 Β

LISTA SEKVENCI <110> Arena Pharmaceuticals, Inc.

Chu, zhi-Liang

Leonard, James

Al-Shamma, Hussien

Jones, Robert M.

<120> COMBINATION THERAPY FOR THE TREATMENT OF DIABETES AND CONDITIONS

NIVOAGLP-1 UKRVI <130> 107.VVO1 <150> EP 06717678.4 <151 >2006-01-09 <150> US 60/643,086 <151 > 2005-01-10 <150> US 60/683,172 <151 >2005-05-19 <150> US 60/726,880 <151> 2005-10-14 <160> 5 <170> Patentin version 3.2 <210> 1 <211> 1008 <212> DNK <213> Homo sapien <400> 1

287

51174Β atggaatcat ctttctcatt tggagtgatc cttgctgtcc tggcctccct catcattgct60 actaacacac tagtggctgt ggctgtgctg ctgttgatcc acaagaatga tggtgtcagt120 crctgcttca ccttgaatct ggctgtggct gacaccttga ttggtgtggc catctctggc180 ctactcacag accagctctc cagcccttct cggcccacac agaagaccct gtgcagcctg240 cggatggcat ttgtcacttc ctccgcagct gcctctgtcc tcacggtcat gctgatcacc300 tttgacaggt accttgccat caagcagccc ttccgctact tgaagatcat gagtgggttc360 gtggccgggg cctgcattgc cgggctgtgg ttagtgtctt acctcattgg cttcctccca420 ctcggaatcc ccatgttcca gcagactgcc tacaaagggc agtgcagctt ctttgctgta480 tttcaccctc acttcgtgct gaccctctcc tgcgttggct tcttcccagc catgctcctc540 tttgtcttct tctactgcga catgctcaag attgcctcca tgcacagcca gcagattcga600 aagatggaac atgcaggagc catggctgga ggttatcgat ccccacggac tcccagcgac660 ttcaaagctc tccgtactgt gtctgttctc attgggagct ttgctctatc ctggaccccc720 ttccttatca ctggcattgt gcaggtggcc tgccaggagt gtcacctcta cctagtgctg780 gaacggtacc tgtggctgct cggcgtgggc aactccctgc tcaacccact catctatgcc840 tattggcaga aggaggtgcg actgcagctc taccacatgg ccctaggagt gaagaaggtg900 ctcacctcat tcctcctctt tctctcggcc aggaattgtg gcccagagag gcccagggaa 960 agttcctgtc acatcgtcac tatctccagc tcagagtttg atggctaa1008 <210> 2 <211> 335 <212> PRT <213> Homo sapiens <400> 2

288

51174 Β

<td>With</td><td>Glu</td><td>To be</td><td>To be</td><td>Faction</td><td>to be</td><td>Faction</td><td rowspan="2">Gly</td><td>hrs</td><td>with</td><td>Lion</td><td>Ala</td><td>hrs</td><td>Lion</td><td>Ala</td><td>to be</td>

<td>with</td><td>His</td><td>Light</td><td>AbP</td><td rowspan="2">A5p</td><td rowspan="2">Gly</td><td>Val</td><td>to be</td><td>Lion</td><td rowspan="2">Cys</td><td>faction</td><td>тћг</td><td>Lion</td><td>Asn</td><td>Lion</td><td>Ala</td>

<td>Gln</td><td>Lion</td><td>To be</td><td>To be</td><td>Рго</td><td>to be</td><td rowspan="2">Angry</td><td>Pro</td><td>Thr</td><td>Gln</td><td>Light</td><td>Thr</td><td>Lion</td><td rowspan="2">cys</td><td>to be</td><td>Lion</td>

<td rowspan="2">Angry</td><td>With</td><td>Ala</td><td>Faction</td><td>hrs</td><td>Thr</td><td>To be</td><td>To be</td><td>Ala</td><td>Ala</td><td>Ala</td><td>To be</td><td>Val</td><td>Lion</td><td>Thr</td><td>hrs</td>

<td>With</td><td>Lion</td><td>with</td><td>Тћг</td><td>Faction</td><td rowspan="2">ASp</td><td rowspan="2">Angry</td><td rowspan="2">Flag</td><td>Lion</td><td>Ala</td><td>11 e</td><td rowspan="2">Light</td><td>Gln</td><td>рго</td><td>Faction</td><td rowspan="2">Angry</td>

<td rowspan="2">Flag</td><td>'_me</td><td>Light</td><td>11 e</td><td>With</td><td>to be</td><td rowspan="2">Gly</td><td>Faction</td><td>hrs</td><td>Ala</td><td rowspan="2">Gly</td><td>Ala</td><td>Cys</td><td>with</td><td>Ala</td><td rowspan="2">Gly</td>

<td>Lion</td><td>Tgr</td><td>Lion</td><td>hrs</td><td>to be</td><td rowspan="2">flag</td><td>Lion</td><td>with</td><td rowspan="2">Gly</td><td>Faction</td><td>Lion</td><td>pro</td><td>Lion</td><td rowspan="2">Gly</td><td>11 e</td><td>Pro</td>

<td>With</td><td>Faction</td><td>Gln</td><td>Gln</td><td>Thr</td><td>Ala</td><td rowspan="2">flag</td><td rowspan="2">Light</td><td rowspan="2">Gly</td><td>Gln</td><td>cys</td><td>to be</td><td>faction</td><td>faction</td><td>Ala</td><td>Val</td>

<td>Faction</td><td>His</td><td>RGO</td><td>His</td><td>Faction</td><td>Val</td><td>Lion</td><td>Thr</td><td>Lion</td><td>To be</td><td rowspan="2">Cys</td><td>hrs</td><td rowspan="2">Gly</td><td>Faction</td><td>Faction</td><td>рго</td>

<td>Ala</td><td>With</td><td>Lion</td><td>Lion</td><td>Faction</td><td>Val</td><td>Faction</td><td>Faction</td><td>Flag</td><td rowspan="2">cys</td><td rowspan="2">Asp</td><td>With</td><td>Lion</td><td>Light</td><td>with</td><td>Ala</td>

<td>To be</td><td>With</td><td>His 195</td><td>to be</td><td>Gln</td><td>Gln</td><td>Xle</td><td>Angry 200</td><td>Light</td><td>With</td><td>Glu</td><td>His</td><td>Ala 205</td><td>Gly</td><td>Ala</td><td>With</td>

289

51174 Β

<td>Ala</td><td>Gly</td><td>Gly</td><td rowspan="2">Flag</td><td rowspan="2">Angry</td><td>5eg</td><td>RGO</td><td rowspan="2">Angry</td><td>Thr</td><td>Pro</td><td>To be</td><td>Asp</td><td>Faction</td><td rowspan="2">Light</td><td>Ala</td><td>lion</td>

<td>Angry</td><td>Thr</td><td>Val</td><td>to be</td><td>Val</td><td>Lion</td><td>11 e</td><td rowspan="2">Gly</td><td>to be</td><td>Faction</td><td>Ala</td><td>Lion</td><td>to be</td><td rowspan="2">Trp</td><td>Thr</td><td>RGO</td>

<td>Faction</td><td>Lion</td><td>for</td><td>Thr</td><td>Gly</td><td>G1e</td><td>Val</td><td>Gln</td><td>hrs</td><td>Ala</td><td rowspan="2">cys</td><td>Gln</td><td>Glu</td><td rowspan="2">Cys</td><td>His</td><td>Lion</td>

<td rowspan="2">Flag</td><td>Lion</td><td>hrs</td><td>Lion</td><td>G1U</td><td>Angry</td><td>Flag</td><td>Lion</td><td>Tgr</td><td>Lion</td><td>Lion</td><td rowspan="2">Gly</td><td>hrs</td><td>Gly</td><td>Asn</td><td>To be</td>

<td>Lion</td><td>Lion</td><td>Asn</td><td>Pro</td><td>Lion</td><td>11 e</td><td rowspan="2">Flag</td><td>Ala</td><td rowspan="2">flag</td><td rowspan="2">Tgr</td><td>Gln</td><td rowspan="2">Light</td><td>Glu</td><td>Val</td><td rowspan="2">Angry</td><td>Lion</td>

<td>Gln</td><td>Lion</td><td rowspan="2">flag</td><td>His</td><td>With</td><td>Ala</td><td>Lion</td><td rowspan="2">Gly</td><td>hrs</td><td rowspan="2">Light</td><td rowspan="2">Ly5</td><td>hrs</td><td>Lion</td><td>Thr</td><td>To be</td><td>Faction</td>

<td>Lion 305</td><td>Lion</td><td>Faction</td><td>Lion</td><td>To be</td><td>Ala 310</td><td>Angry</td><td>A $ P</td><td>Cys</td><td>Gly</td><td>Рго 315</td><td>Glu</td><td>Angry</td><td>RGO</td><td>Angry</td><td>Glu 320</td>

<td>To be</td><td>To be</td><td>Cys</td><td>His</td><td>11 e</td><td>hrs</td><td>Thr</td><td>with</td><td>to be</td><td>to be</td><td>to be</td><td>Glu</td><td>Faction</td><td rowspan="2">Asp</td><td>Gly</td><td></td>

<210> 3 <211> 22 <212> DNK

<td><213> Artificial</td><td> -</td>

<td><220> <223> Prajmer</td><td></td>

<td><400> 3 gtcctgccac ttcgagacat gg</td><td> 22</td>

<td><210>4 <211> 23 <212> DNK <213> Artificial</td><td></td>

290

51174 Β <220>

<223> Prajmer <400>4 gaaacttctc tgcccttacc gtc 23 <210 5 <211> 255 <212* DNK <213> Veštačka <220>

<223> Proba <400> 5 ctggcctgcc ctgtcccatg cctcaccatg cattgctgtt tgttggcctt agtaatggcc agaatctgag gagtcatcct aatgcactgg tgctt agaacggtgc ctcgccatcc tctcatttgg tagttgtggc tgtgactctg agcatgcctt agtgatcctt tatgctgcta agcctatagc tgtaagtgga gctgtcctaa tcaatctaca acatctaatc agtgctgcta ccatcctcat agaatgatgg

120

180

240

255

291

51174 Β

Contents35

118 members in 30 offices

This recordMember, by publication datePriority claim20 more offices are in the list below

Priority claims12

Priority claims
Document	Office	Kind	Date
64308605	United States of America	P	2005-01-10
64308605	United States of America	P	2005-01-10
68317205	United States of America	P	2005-05-19
68317205	United States of America	P	2005-05-19
72688005	United States of America	P	2005-10-14
72688005	United States of America	P	2005-10-14
643086	–	–	–
683172	–	–	–
726880	–	–	–
US20050643086P	–	–	–
US20050683172P	–	–	–
US20050726880P	–	–	–

Members118

Family members, oldest first
Document	Office	Kind
US2006154866A1	United States of America	A1	2006-07-13
AU2006205164A1	Australia	A1	2006-07-20
CA2593427A1	Canada	A1	2006-07-20
CA2654733A1	Canada	A1	2006-07-20
WO2006076231A2	World Intellectual Property Organization (WIPO)	A2	2006-07-20
WO2006076231A8	World Intellectual Property Organization (WIPO)	A8	2006-09-21
TW200637534A	Taiwan Province of China	A	2006-11-01
WO2006076231A3	World Intellectual Property Organization (WIPO)	A3	2007-01-18
AR052082A1	Argentina	A1	2007-02-28
EP1758565A2	European Patent Office (EPO)	A2	2007-03-07
US2007072803A1	United States of America	A1	2007-03-29
US2007072804A1	United States of America	A1	2007-03-29
HK1096537A1	Hong Kong, China	A1	2007-06-01
EP1808168A1	European Patent Office (EPO)	A1	2007-07-18
HK1100353A1	Hong Kong, China	A1	2007-09-21
NO20073816L	Norway	L	2007-09-27
NO20101746L	Norway	L	2007-09-27
KR20070095400A	Republic of Korea	A	2007-09-28
IL184364A0	Israel	A0	2007-10-31
MX2007008376A	Mexico	A	2008-01-11
CN101128192A	China	A	2008-02-20
EA200701469A1	Eurasian Patent Organization (EAPO)	A1	2008-02-28
BRPI0606727A	Brazil	A	2008-03-11
JP2008110964A	Japan	A	2008-05-15
JP4118323B1	Japan	B1	2008-07-16
JP2008526235A	Japan	A	2008-07-24
ZA200705470B	South Africa	B	2008-07-30
JP2008195733A	Japan	A	2008-08-28
JP2008220374A	Japan	A	2008-09-25
JP2008220375A	Japan	A	2008-09-25
JP2008239623A	Japan	A	2008-10-09
EP1997484A2	European Patent Office (EPO)	A2	2008-12-03
CN101332303A	China	A	2008-12-31
EP1997484A3	European Patent Office (EPO)	A3	2009-02-11
JP4221444B2	Japan	B2	2009-02-12
JP4237243B2	Japan	B2	2009-03-11
EP1758565B1	European Patent Office (EPO)	B1	2009-05-13
AT431139T	Austria	T	2009-05-15
ATE431139T1	Austria	T1	2009-05-15
EP1808168B1	European Patent Office (EPO)	B1	2009-06-03
AT432693T	Austria	T	2009-06-15
ATE432693T1	Austria	T1	2009-06-15
DE602006006765D1	Germany	D1	2009-06-25
EA011883B1	Eurasian Patent Organization (EAPO)	B1	2009-06-30
DE602006007093D1	Germany	D1	2009-07-16
CR9220A	Costa Rica	A	2009-07-31
AU2009202898A1	Australia	A1	2009-08-06
AU2009202900A1	Australia	A1	2009-08-06
PT1758565E	Portugal	E	2009-08-19
PT1808168E	Portugal	E	2009-08-25
HRP20090403T1	Croatia	T1	2009-08-31
DK1758565T3	Denmark	T3	2009-09-07
HRP20090446T1	Croatia	T1	2009-09-30
DK1808168T3	Denmark	T3	2009-10-05
ES2327268T3	Spain	T3	2009-10-27
PL1758565T3	Poland	T3	2009-10-30
SI1758565T1	Slovenia	T1	2009-10-31
SI1808168T1	Slovenia	T1	2009-10-31
ES2327872T3	Spain	T3	2009-11-04
EP2116235A1	European Patent Office (EPO)	A1	2009-11-11
PL1808168T3	Poland	T3	2009-11-30
AU2009202900B2	Australia	B2	2010-02-11
AU2009202898B2	Australia	B2	2010-02-18
SG158876A1	Singapore	A1	2010-02-26
AU2009202900B8	Australia	B8	2010-06-03
US2010137293A1	United States of America	A1	2010-06-03
KR20100072085A	Republic of Korea	A	2010-06-29
UA91698C2	Ukraine	C2	2010-08-25
US7803753B2	United States of America	B2	2010-09-28
US7803754B2	United States of America	B2	2010-09-28
NZ556219A	New Zealand	A	2010-09-30
RS51127B	Serbia	B	2010-10-31
RS51174BThis record	Serbia	B	2010-10-31
US2010285494A1	United States of America	A1	2010-11-11
US2010285495A1	United States of America	A1	2010-11-11
US2010286111A1	United States of America	A1	2010-11-11
US2010286153A1	United States of America	A1	2010-11-11
US2010286168A1	United States of America	A1	2010-11-11
US2010286172A1	United States of America	A1	2010-11-11
US2010291589A1	United States of America	A1	2010-11-18
US2010298333A1	United States of America	A1	2010-11-25
KR20100129328A	Republic of Korea	A	2010-12-08
NZ578502A	New Zealand	A	2011-01-28
NZ587368A	New Zealand	A	2011-01-28
KR101016890B1	Republic of Korea	B1	2011-02-22
NZ578504A	New Zealand	A	2011-02-25
EP2322150A2	European Patent Office (EPO)	A2	2011-05-18
EP2322151A2	European Patent Office (EPO)	A2	2011-05-18
EP2322152A1	European Patent Office (EPO)	A1	2011-05-18
EP2322156A1	European Patent Office (EPO)	A1	2011-05-18
EP2322157A1	European Patent Office (EPO)	A1	2011-05-18
US8003597B2	United States of America	B2	2011-08-23
CA2654733C	Canada	C	2011-09-06
AU2006205164B2	Australia	B2	2011-09-08
US8022034B2	United States of America	B2	2011-09-20
JP2011184458A	Japan	A	2011-09-22
NO331089B1	Norway	B1	2011-10-03
US8030270B2	United States of America	B2	2011-10-04
JP4787804B2	Japan	B2	2011-10-05
CN102218141A	China	A	2011-10-19

Showing 100 of 118

Abstract

Term

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

C. GPR119

ESSENCE OF THE INVENTION

DETAILED DESCRIPTION OF THE INVENTION

(PA)

(SS)

B4

I36

I54

I60

TABLE C

TABLE D

TABLE E

TABLE B

EXAMPLES

EXAMPLE 4: MELANOPHORE EXAMINATION FOR GPR119 AGONIST ACTIVITY

EXAMPLE 5: FULL LENGTH CLONING OF ENDOGENIC HUMAN GPR119

PRIMER 6:

EXAMPLE 7: SEARCH FOR SEARCH FOR CANDIDATE COMPOUND AS GPR119 AGONIST

PRIMER 8

RADIOACTIVALLY MARKED COMPOUND

PRIMER 9

RECEPTOR BINDING TEST

PRIMER 10

EXPRESSION OF GPR119 IN THE INTESTINE

AGTGCTGCTACCTCACCATGGAGTCATCCTTCTCATTTGGAGTGATCC TTGCTGTCC

TAACCATCCTCATCATTGCTGTTAATGCACTGGTAGTTGTGGCTATGC TGCTATCAA

PRIMER11

EXPRESSION OF GPR119 IN GLUTAG ENTEROENDOCRIN STEEL LINE

PRIMER 12

GPR119 AGONIST RAISES INTRACELLULAR CAMP IN GLUTAG CELLS

PRIMER13

GPR119 AGONSIT STIMULATES GLP-1 SECRETION IN GLUTAG CELLS

RELATED TO IT AND TREATMENT OF CONDITIONS IMPROVED BY INCREASE

Priority claims12

Members118

Numbers

Titles2

Classification