Delivering functional nucleic acids to mammalian cells via bacterially-derived, intact minicells

[0001] The invention relates to efforts made to effectively deliver functional nucleic acids to mammalian cells. More specifically, the invention relates to the use of bacterial vectors - minicells - to deliver functional nucleic acids to mammalian cells. The invention has a particular application in eliminating drug resistance, particularly in the context of cancer and AIDS therapy, to stimulate apoptosis and to prevent cancer in target cells.

[0002] Recent developments have highlighted various techniques for introducing functional nucleic acids into cells. For example, liposome-based transfection methods can provide exogenously produced nucleic acids. However, this exogenous approach has a disadvantage - it only causes temporary inhibition of the target. In addition, liposomes are unstable in vivo. As an alternative to delivering exogenously produced nucleic acids, vectors can provide plasmids that encode functional nucleic acids that are produced endogenously. However, viral vectors currently useful for this purpose have serious security concerns. Exemplary problems include recombination with wild-type viruses, insertion and oncogenic potential, virus-induced immunosuppression, limited ability of viral vectors to carry large segments of DNA, recovery of attenuated viruses in attenuated viruses, difficulties in the production and distribution of recombinant viruses, low stability and adverse reactions. such as an inflammatory response, caused by existing immunity. An approach that prevents these problems will offer significant benefits by making the delivery of functional nucleic acids safer and more effective.

[0003] An effective method of delivering functional nucleic acids would be particularly beneficial for reversing drug resistance. Mammalian cells use a number of biological processes to achieve drug resistance, which is a major obstacle to successful cancer treatment. Similarly, drug resistance limits the effectiveness of HIV treatment, especially with respect to highly active antiretroviral therapy (HAART), which is based on a combination of nucleoside reverse transcriptase inhibitors (NRTIs) and protease inhibitors (PI) or non-nucleoside reverse transcriptase inhibitors (NNRTIs).

[0004] Clinical tumor resistance to chemotherapy may be congenital or acquired. Congenital resistance occurs when diagnosed against cancers that do not respond to first-line chemotherapy. Acquired resistance occurs against cancers that may favorably respond to initial treatment, but show a resistant phenotype in the event of relapse. Such cancers gain resistance to both previously used drugs and new drugs, including drugs with different structures and mechanisms of action. The term MDR (multi-drug resistance) describes this phenomenon in which the cancer cells acquire cross-resistance to several structurally unrelated drugs after exposure to a single drug.

[0005] The mechanisms of multi-drug resistance are complex and multifactorial, mainly due to high levels of genomic instability and mutations in cancer cells.

Examples of mechanisms are drug inactivation, drug ejection through cell membrane pumps, reduced drug influx, drug target mutations, and failure to initiate apoptosis (Bredel, 2001; Chen et al. 2001; White and McCubrey, 2001;

Sun et al., 2001).

[0006] Drug ejection is particularly common, and may be the result of overexpression of membrane-associated proteins that pump drugs from the intracellular to extracellular environment. Such pumps often belong to the superfamily of transporters with an ATP binding cassette (ABC) (Doige et al., 1993). P-glycoprotein (Pgp) is one such example, and is a major contributor to MDR in a number of cancer cells (Endicott et al., 1989; Litman et al., 2001). Other examples include MDR related protein (MRP; Cole et al., 1992), breast cancer resistance protein (BCRP; Litman et al., 2000), and lung related protein (LRP; larger crypt protein; Scheffer et al., 2000). Other multi-drug transporter proteins have also been identified in cancer cells (Gottesman et al., 2002) and in pathogenic microorganisms (Van Bambeke et al., 2000).

[0007] Resistance to apoptosis (programmed cell death) of tumor cells induced by cytotoxic agents and radiation (Sellers and Fisher, 1999) is another common mechanism. This mechanism is often associated with overexpression of antiapoptotic proteins such as B-cell leukemia protein 2 (Bcl-2), Bcl-XL, Bcl-W, A1 / Bf11, Mcl-1 and mutations in p53 protein. Although a thorough understanding of how Bcl-2 proteins exert their anti-apoptotic effects remains elusive, proteins are overexpressed in many cancers, including colorectal, prostate and breast cancers (Hanada, et al., 1995; Bakhshi et al., 1985; Wang et al., 1996). Increased expression of the transcription factor, nuclear factor kappa B (NF-KB) is also the main mechanism for the acquisition of resistance to chemotherapy by cancer cells (Wang et al., 1999).

[0008] Anti-MDR drugs have been identified, such as drugs that block the action of P-glycoprotein (List et al., 1993; Miller et al., 1991; Wishart et al., 1992). However, many of these drugs were ineffective in clinical trials because they bound to the patients' plasma, did not reach their destination (Ayesh et al., 1996a; Broxterman et al., 1987; Lehnert et al., 1996) and were toxic to normal cells . Attempts have also been made to use functional nucleic acids to counter MDR. Despite this, as noted above, existing vectors for this purpose were unstable or toxic, or created other serious safety issues that hampered their use in humans (Sioud, 2004).

[0009] WO 02/17852 A discloses a pharmaceutical composition comprising an antisense nucleotide directed to bcl-2 and a pharmaceutically acceptable carrier.

[0010] US 2003/203481 A1 discloses minicells of bacterial origin for the delivery of compounds to mammalian cells and suggests the use of minicells for the treatment of cancer, including the delivery of antisense oligonucleotides, ribozymes or small molecule drugs, and further suggests the use of a targeting moiety for specific delivery to cells target.

[0011] WO 03/033519 A discloses minicells of bacterial origin for delivering compounds to mammalian cells.

[0012] Accordingly, there is still a need for tools and methods for providing functional nucleic acids that reduce drug resistance, stimulate apoptosis, and prevent cancer in target cells.

BRIEF DESCRIPTION OF THE INVENTION [0013] To meet these and other needs, the invention provides, in one aspect, a composition comprising (a) an intact minicell of bacterial origin that contains a functional nucleic acid molecule or a plasmid containing a segment that encodes a functional nucleic acid molecule, a minicell containing additionally a bispecific ligand, a bispecific ligand having specificity for both the surface component on the minicell, as well as a surface component on a non-phagocytic mammalian cell; and (b) a pharmaceutically acceptable carrier thereto, wherein the functional nucleic acid molecule is directed to a gene or protein transcript that contribute to resistance to the chemotherapeutic agent.

[0014] In a further aspect, the invention provides an intact minicell of bacterial origin comprising a functional nucleic acid molecule or plasmid containing a segment that encodes a functional nucleic acid molecule, wherein the functional nucleic acid molecule is directed to a gene or protein transcript that stimulates resistance to a chemotherapeutic drug, a minicell additionally containing a bispecific ligand, a bispecific ligand having specificity for both the surface component on the minicell and the surface component on the non-phagocytic mammalian cell; for use as a medicine.

[0015] In a further aspect, the invention provides an intact minicell of bacterial origin comprising a functional nucleic acid molecule or a plasmid containing a segment that encodes a functional nucleic acid molecule, wherein the functional nucleic acid molecule is directed to a gene or protein transcript that stimulates resistance to a chemotherapeutic drug. minicell containing additionally a bispecific ligand, a bispecific ligand having specificity for both the surface component on the minicell and the surface component on the non-phagocytic mammalian cell; for use in the treatment of a disease resistant to a chemotherapeutic agent, wherein the intact minicell is administered simultaneously or sequentially with the chemotherapeutic agent to enable functional nucleic acid to reduce resistance to the chemotherapeutic agent.

[0016] In another aspect, the invention provides a chemotherapeutic agent for use in the treatment of drug-resistant malignant neoplasm, wherein an intact bacterial-derived minicell containing a functional nucleic acid molecule or a plasmid containing a segment that encodes a functional nucleic acid molecule, wherein the functional nucleic acid molecule is targeted to the gene or a protein transcript that stimulates resistance to a chemotherapeutic agent, a minicell containing an additional bispecific ligand, a bispecific ligand having specificity for both the surface component on the minicell and the surface component on a non-phagocytic mammalian cell, is administered simultaneously or sequentially with a chemotherapeutic agent to allow functional nucleic acid to reduce resistance to the chemotherapeutic agent.

[0017] The invention provides a method of delivering a functional nucleic acid, comprising (a) providing an intact minicell that contains a functional nucleic acid molecule or comprises a plasmid containing a segment that encodes a functional nucleic acid molecule, and then (b) bringing the minicell into contact with the target cell mammalian, such that the mammalian cell absorbs the minicell. After uptake of the minicell, the functional nucleic acid molecule is released into the cytoplasm, transported to the nucleus and expressed by the target cell. The above-mentioned plasmid may also contain a regulatory element, such as a promoter, terminator, enhancer or signal sequence, which is operably linked to a segment that encodes a functional nucleic acid molecule. It is particularly preferred that the plasmid contains a promoter that is dependent on RNA polymerase (pol) II or pol III, such as human RNA III polymerase promoters 7SK, H1 and U6. In addition, the plasmid may contain a reporter element, such as a nucleic acid segment encoding a green fluorescent protein. Contact between the minicell and a mammalian cell may occur in vitro or in vivo.

[0018] With respect to the invention, the category of "functional nucleic acids" includes: siRNA molecules, including shRNA molecules; miRNA molecules, antisense molecules and ribozyme molecules. Preferably, the functional nucleic acid molecule is targeted to a gene or protein transcript that stimulates drug resistance, inhibits apoptosis, or contributes to a tumor phenotype. Particularly useful targets that contribute to drug resistance include transporters having an ATP binding cassette, such as P-glycoprotein, MDR-2, MDR-3, BCRP, APT11a and LRP. Particularly useful targets that contribute to apoptosis resistance include Bcl-2 (B-cell leukemia / lymphoma), Bcl-XL, A1 / Bfl 1, adhesion-focal kinase and mutant p53 protein. Other useful targets are oncogenic proteins and mutant tumor suppressor proteins.

[0019] The invention further provides a method of overcoming drug resistance or resistance to apoptosis and treating a malignant tumor in an individual. The method includes (a) providing an intact minicell that contains a functional nucleic acid molecule or plasmid containing a segment that encodes a functional nucleic acid molecule, wherein the functional nucleic acid molecule is directed to a protein transcript that stimulates drug resistance, (b) minicell contact with the target mammalian cell, yes, that the mammalian cell absorbs the minicell and (c) delivering the chemotherapeutic to the target mammalian cell. Preferably, step (c) is carried out after steps (a) and (b) to allow functional nucleic acid to reduce drug resistance prior to drug administration. The drug may be delivered by any conventional means, but preferably it is delivered via an intact minicell.

[0020] As indicated above, the bispecific ligand has specificity for both a surface component on a minicell and a surface component on a mammalian cell, such as a receptor. As a result, the ligand binds the minicell to the mammalian cell, the minicell is absorbed by the mammalian cell, and the minicell content is released into the cytoplasm of the mammalian cell. In other embodiments of the invention, the minicell contacts the target mammalian cell which is competent for phagocytosis or endocytosis. The use of bispecific ligands is optional when the target cell is competent for phagocytosis.

[0021] In the composition of the invention, the functional nucleic acid molecule can be a shRNA or miRNA or other siRNA molecule, an antisense molecule, or a ribozyme molecule. Preferably, the functional nucleic acid molecule is targeted to a gene or protein transcript that stimulates drug resistance, inhibits apoptosis, or contributes to a tumor phenotype. Particularly useful targets that contribute to drug resistance include transporters having an ATP binding cassette, such as P-glycoprotein, MDR-2 and MDR-3. Particularly useful targets that contribute to apoptosis resistance include Bcl-2 (B-cell leukemia / lymphoma), Bcl-XL, A1 / Bfl 1, adhesion-focal kinase, and mutated p53 protein. Other useful targets are oncogenic proteins and mutant tumor suppressor proteins. The plasmid may also contain a regulatory element, such as a promoter, terminator, enhancer or signal sequence, which is operably linked to a segment that encodes a functional nucleic acid molecule. In addition, the plasmid may contain a reporter element. A functional nucleic acid molecule may contain multiple RNA interference sequences, such as miRNA or shRNA, and they may exist in one cistron or be expressed from separate promoters to allow for simultaneous knockdown effect on multiple drug-related target elements. In preferred embodiments, the composition contains less than one contaminating stem cell per 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹ or 10¹² minicells.

[0022] The invention will further provide the use of intact minicells in the preparation of a medicament for use in a method of overcoming drug resistance or stimulating apoptosis by administering the medicament to a cell, tissue or organ. In the drug, minicells contain a functional nucleic acid molecule or a plasmid encoding a functional nucleic acid molecule, wherein the functional nucleic acid molecule is directed to a protein transcript that stimulates drug resistance or inhibits apoptosis. The disease being treated in this context may be, for example, cancer or an acquired disease such as AIDS and tuberculosis.

[0023] The invention provides a significant improvement over conventional methods and formulations for the delivery of functional nucleic acids in the context of cancer and HIV by (i) providing safe and stable excipients for the delivery of functional nucleic acids, (ii) counteracting major drug-resistance mechanisms in diseased cells, (iii) reducing the toxic side effects associated with overcoming drug resistance, and (iv) providing targeted excipients, with the packaged drug, for treating the disease.

BRIEF DESCRIPTION OF THE DRAWINGS [0024]

Figure 1 shows the effect of various treatments on the viability of the Caco-2 human colon cancer cell line. Treatments are shown on the x-axis (minicells are designated "M") and the percentage of cell viability is shown by bars. Each bar represents the average of six independent measurements, and the standard deviation from the average is shown.

Figure 2 shows the regression of human colon cancer (Caco-2) xenografts in nude mice (11 mice per group) after double surgery with (1) targeted recombinant minicells carrying shRNA-encoding plasmids (anti-bcl2 or anti-Mdr1) and (2) ) targeted minicells with packed chemotherapeutic drug - irinotecan. The bispecific antibody used to target colon cancer cells had specificity against the O antigen from S. typhimurium on one arm and human epidermal growth factor receptor (EGFR) on the other arm. Targeted re6 combined minicells were injected intravenously on days 9 and 23, and targeted minicells with packed irinotecan were administered intravenously on days 15, 18, 29 and 32. Other treatments - intravenous controls included: Group 1 - only cancer, Group 2 - free Irinotecan, Group 3 -^EGFRmini-cells Iryno, Group 4 - ^EGFRminikomórkishRNA-MDR-1, Group 5 - ^EGFPminikomórkishRNA-bcl-2 and Group 6 - ^EGFRminikomórkishRNA-MDR-1, followed by free Iryno. Tumor volume is shown on the y-axis. SEM is shown for each measurement.

Figure 3 shows the regression of human colon cancer (Caco-2) xenografts in nude mice (11 mice per group) after double surgery with (1) targeted recombinant minicells carrying shRNA-encoding plasmids (anti-bcl2 or anti-Mdr1) and ( 2) targeted minicells with packed chemotherapeutic agent - 5-FU. The bispecific antibody used to target colon cancer cells had specificity against the O antigen from S. typhimurium on one arm and human epidermal growth factor receptor (EGFR) on the other arm. The targeted recombinant minicells were injected intravenously on days 9 and 23, and the targeted minicells packed with 5-FU were administered intravenously on days 15, 18, 29 and 32. Other treatments - intravenous controls included: G1 - tumor only, G2 (control), free 5-FU (5 x 10⁴ ng / g mouse body weight ~ 1 x 10⁶ ng per mouse), G3 (control), ^EGFRminikomórki5-FU. G4 (control),^EGFRSHRNA-MDR-1, G5 minicells (control), ^EGFRSHRNA-bcl-2, G6 minicells (control), ^EGFRminikomórkishRNA-MDR1 then ^CMV5-FU, G7 minicells (control), ^EGFRminikomórkishRNA-nonsense, then ^EGFR5-FU, G8 minicells (control), ^EGFRminikomórkishRNA-MDR-1, followed by free 5-FU, G9 (expt), ^EGFRminikomórkishRNA-MDR-1, then ^EGFR5-FU and G10 minicells (expt), ^EGFRminikomórkishRNA-bcl-2, then ^EGFRminikomórki5-FU. Tumor volume is shown on the y-axis. SEM is shown for each measurement.

Figure 4 shows human breast cancer (MDA-MB468) xenograft regression in nude mice (11 mice per group) after double treatment with (1) targeted recombinant minicells carrying shRNA (anti-Mdr1) encoding plasmids and (2) targeted minicells with a packed chemotherapeutic drug doxorubicin. The bispecific antibody used to target breast cancer cells carried specificity on one arm against the O antigen from S. typhimurium and on the other shoulder against human EGFR. Targeted recombinant minicells were injected intravenously on day 21, and targeted minicells packed with Dox were administered intravenously on days 27, 34 and 41. Intravenous treatments included: G1 - tumor only, G2 (control),^EGFRminicellsDox, and G3 (expt), ^EGFRminikomórkishRNA-MDR-1, then ^EGFRminikomórkiDox. Tumor volume is shown on the y-axis. SEM is shown for each measurement.

Figure 5 shows the effect of dosing regimens on reversal of drug resistance and therapeutic effect. Human colon cancer (Caco-2) xenografts were established in mice of the mouse breed and the following intravenous procedures were administered: G1 - only tumor, G2 (control), free irinotecan, G3 (expt),^EGFRminikomórkishRNAMDR-1, followed by 96 hours later^EGFRminicells Irino, G4 (expt), ^EGFRminikomórkishRNA-MDR-1, followed by 120 hours later^EGFRIrino and G5 minicells (expt), ^EGFRminikomórkishRNA-MDR-1 followed by 144 hours later^EGFRminikomórkiIryno.

The bispecific antibody used to target breast cancer cells carried specificity against the S. typhimurium O antigen on one arm and human EGFR on the other arm. Tumor volume is shown on the y-axis. SEM is shown for each measurement.

Figure 6 shows the effect of dosing regimens on reversal of drug resistance and therapeutic effect. Human colon cancer (Caco-2) xenografts were established in mice of the mouse breed and the following intravenous procedures were administered: G1 - tumor only, G2 (control), free 5-FU, G3 (expt),^EGFRminikomórkishRNA-MDR-1, followed by 96 hours later^EGFRminicells 5-FU, G4 (expt), ^EGFRminikomórkishRNA-MDR-1, followed by 120 hours later^EGFRminicells 5-FU and G5 (expt), ^EGFRminikomórkishRNA-MDR-1, followed by 144 hours later^EGFRminikomórki5-FU. The bispecific antibody used to target breast cancer cells carried specificity against the S. typhimurium O antigen on one arm and human EGFR on the other arm. Tumor volume is shown on the y-axis. SEM is shown for each measurement.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [0025] The inventors have found that intact minicells of bacterial origin can safely and efficiently introduce into mammalian target cells any functional nucleic acid range, such as siRNA molecule, miRNA molecule, ribozyme or antisense nucleic acid. In the specific context of cancer and HIV infection, the inventors have found that the introduction of functional nucleic acids into target cells, via intact minicells, can reduce drug resistance or resistance to apoptosis in target cells.

[0026] The inventors have also found that minicells can sequentially transfect the same mammalian target cells, particularly in vivo, and that minicells can sequentially deliver a range of different contents to the same mammalian target cells. These statements are the first in the context of any macromolecular excipients for delivery and provide, for the first time, a method for the treatment of complex multifactorial diseases, such as cancer and HIV, for which it is necessary to deliver different therapeutic contents to the same cell before achieving a therapeutic effect. Similarly, the inventors have found that the complex problem of drug resistance associated with numerous mutations in different genes can be treated using minicells that introduce multiple RNAi sequences into the host cell to counter many genetic defects, and that after RNAi is delivered via minicells and provides sufficient time for knockdown effect on target proteins regulating drug resistance, cancer cells previously resistant to specific chemotherapeutics can be successfully treated with minicells packed with the same drugs. This is the first demonstration in vivo of effective cancer treatment that is resistant to all other treatments. The concentrations of chemotherapeutic drugs, delivered through minicells, required for effective treatment of drug-resistant cancer cells proved to be over 1000-fold lower than with free drug treatment. This is a surprising statement because all previous methods of reversing drug resistance using RNAi or drug inhibiting protein inhibitors still required drug concentrations that could cause severe toxicity in the mammalian subject. Thus, the methods of the invention, i.e. minicell-controlled delivery of RNAi, and then minicell-regulated delivery of a chemotherapeutic have the potential to successfully treat cancer without severe toxicity.

[0027] In addition, the inventors have found that the minicell serotype can be adapted to overcome the host's immune response against minicells.

[0028] The following description outlines the invention associated with these statements, without limiting the invention to the specific embodiments, methodologies, protocols or reagents described. Similarly, the terminology used herein describes only specific embodiments and does not limit the scope of the invention.

I. Definitions [0029] Unless defined otherwise, all technical and scientific terms used in the description have the same meaning as commonly understood by those of ordinary skill in the art.

[0030] For convenience, the meanings of the specific terms and phrases used in the description, examples and appended claims are given below. Other terms and phrases are defined throughout the description.

[0031] The terms referring to the singular "a", "an" and "the" [articles in English] include references to the plural, unless the context clearly indicates otherwise.

[0032] "Antisense oligonucleotide" means a nucleic acid molecule complementary to a portion of a particular gene transcript that can hybridize to the transcript and block its translation. The antisense oligonucleotide may contain RNA or

GOUT.

[0033] "Biomolecular sequence" or "sequence" means all or part of a polynucleotide or polypeptide sequence.

[0034] "Cancer", "cancer", "tumor", "malignant tumor" and "cancer", as used interchangeably herein, means cells or tissues that have an abnormal growth phenotype characterized by a significant loss of control over proliferation cellular. The methods and compositions of the present invention are particularly used for precancerous, malignant, pre-metastatic, metastatic and non-metastatic cells.

[0035] "Complementary" means the topological compatibility or matching of the interacting surfaces of two molecules, such as a functional nucleic acid molecule and its target. The molecules can be described as complementary and furthermore the contact surface characteristics are complementary to each other.

[0036] "Reply" or "present" when used, for example, in the context of a polynucleotide or sequence that "corresponds" or "represents" a gene means that the polynucleotide sequence is present in a gene or in a nucleic acid gene product, e.g. mRNA. The polynucleotide may be present entirely within the exon of the genomic sequence of the gene or different parts of the polynucleotide sequence may be present in different exons, e.g. such that an adjacent polynucleotide sequence is present in mRNA, before or after splicing, which is a gene expression product.

[0037] The term "cytokine" is a generic term for proteins released by one population of cells that act on another cell as intercellular mediators.

[0038] "Drug" means any physiologically or pharmacologically active substance that causes a desired local or systemic effect in animals, especially mammals and humans.

[0039] "Expression" generally means the process by which a polynucleotide sequence is successfully transcribed and translated such that detectable levels of the amino acid sequence or protein are expressed. As used herein, in some contexts, expression refers to mRNA production. In other contexts, expression refers to protein production.

[0040] "Functional nucleic acid" refers to a nucleic acid molecule that when introduced into a host cell specifically interferes with protein expression. Typically, functional nucleic acid molecules have the ability to reduce protein expression by directly interacting with the transcript that encodes that protein. Ribozymes, antisense nucleic acids and siRNAs, including shRNAs, short RNAs (typically less than 400 bases long), micro-RNAs (miRNAs) are examples of functional nucleic acids.

[0041] "Gene" refers to a polynucleotide sequence that contains control and coding sequences necessary for the production of a polypeptide or precursor. The polypeptide may be encoded by the full-length coding sequence or any part of the coding sequence. The gene may be an uninterrupted coding sequence, or it may comprise one or more introns connected via appropriate splice sites. In addition, the gene may contain one or more modifications in the coding or non-translated regions that may affect the biological activity or chemical structure of the expression product, expression rate, or expression control method. Such modifications include, but are not limited to, mutations, insertions, deletions and substitutions of one or more nucleotides. In this regard, such modified genes may be referred to as "variants" of the "native" gene.

[0042] "Host cell" means a cell that can or has been used as a recipient of a recombinant vector or other polynucleotide transfer and contains progeny of a primary cell that has been transfected. The progeny of a single cell may not necessarily be completely identical in morphology or in genomic or total DNA to the stem cell due to natural, accidental or deliberate mutation.

[0043] "Hybridization" means any process by which a polynucleotide sequence binds to a complementary sequence by pairing the bases.

[0044] "Subject", "subject", "host" and "patient", as used interchangeably herein, means any mammalian subject for which diagnosis, treatment or therapy is desired. In a preferred embodiment, the subject, subject, host or patient is a human. Other entities may include, but are not limited to, cattle, horses, dogs, cats, guinea pigs, rabbits, rats, primates and mice.

[0045] "Label" means substances that are capable of delivering a detectable signal, directly or by interacting with one or more additional members of the signal generating system. Labels that are directly detected and may find use in the invention include fluorescent labels. Specific fluorophores include fluorescein, rhodamine, BODIPY, cyanine dyes and the like. The invention also contemplates the use of radioactive isotopes such as³⁵S ³²P ³H and similar as tags. Colorimetric markers such as colloidal gold or balls of colored glass or plastic (e.g. polystyrene, polypropylene, latex) may also be used. For example, see U.S. Patents No. 4,366,241, No. 4,277,437, No.

4,275,149, No. 3,996,345, No. 3,939,350, No. 3,850,752 and No. 3,817,837.

[0046] "Oligonucleotide" means a polynucleotide containing, for example, from about 10 nucleotides (nt) to about 1000 nt. Oligonucleotides for use in the invention are preferably from about 10 nt to about 150 nt in length. The oligonucleotide may be a naturally occurring oligonucleotide or synthetic oligonucleotide. Oligonucleotides can be modified.

[0047] Minicell "means non-nuclear forms of bacterial cells made by a disorder of coordination during the cleavage of binary cell division with DNA segregation. Minicells are different from other small vesicles that are produced and released spontaneously in specific situations and are not, unlike minicells, subject to specific genetic rearrangements or expression of episomal genes. In practicing the invention, it is desirable that the minicells have intact cell walls ("intact minicells").

[0048] "Modified oligonucleotide" and "modified polynucleotide" means oligonucleotides or polynucleotides with one or more chemical modifications, at the molecular level, relative to the natural molecular structure of all or any bases, sugar residues and internucleoside phosphate bonds, as well as molecules having added substitution or combinations of modifications at these places. The internucleoside phosphate bonds can be phosphodiester, phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethyl ester, acetamidate, carbamate, thioether, bridged phosphoramidates, bridged methylene phosphonates, phosphorothioate, phosphorothioate, phosphorothioate, phosphonothioate, phosphonothioate, phosphonothioate 5'-3 'or 5'-5' and combinations of such similar bonds. The phosphodiester linkage may be replaced with a replacement linkage such as phosphorothioester, methylamino, methylphosphonate, phosphoramidate and guanidine, and the ribose subunit of polynucleotides may also be substituted (e.g., hexose phosphodiester; peptide nucleic acids). Modifications may be internal (single or repeated) or at the end (ends) of the oligonucleotide molecule and may include addition to the molecule of internucleoside phosphate linkages, such as deoxyribose and phosphate modifications that cleave or crosslink to opposite chains or related enzymes or other proteins. The terms "modified oligonucleotides" and "modified polynucleotides" also include oligonucleotides or polynucleotides containing modified sugar residues (e.g., 3 'substituted ribonucleotide or deoxyribonucleotide monomers), any of which are connected with each other by 5' to 3 'bonds.

[0049] The expression "nucleic acid molecules" and the term "polynucleotides" mean polymeric forms of nucleotides of any length or ribonucleotides or deoxynucleotides. These concepts include, but are not limited to, single, double or triple stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or a polymer containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-naturally occurring or derivatized bases nucleotides. The polynucleotide backbone may contain sugars and phosphate groups (which can typically be found in RNA and DNA) or modified or substituted sugar or phosphate groups. Alternatively, the polynucleotide backbone may comprise a polymer of synthetic subunits such as phosphoramidites and thus may be an oligodeoxynucleoside phosphoramidate or a mixed phosphoramidate phosphodiester oligomer. The polynucleotide may contain modified nucleotides such as methylated nucleotides and nucleotide analogues, uracil, other sugars and linking groups such as fluororibose and thioesters and nucleotide branching. The polynucleotide may be further modified, such as by conjugation with a labeling component. Other types of modification include caps, substitution of one or more naturally occurring nucleotides with an analogue, and introduction of agents for attachment of the polynucleotide to proteins, metal ions, labeling components, other polynucleotides or a solid support.

[0050] "Pharmaceutically acceptable" refers to physiological compatibility. The pharmaceutically acceptable carrier or excipient does not tolerate the biological activity of the administered composition, is chemically inert and is not toxic to the organism to which it is administered.

[0051] The "polypeptide" and "protein" used herein interchangeably means the polymeric form of amino acids of any length, which may include translated, non-translated, chemically modified, biochemically modified and derivatized amino acids. The polypeptide or protein may be naturally occurring, recombinant or synthetic, or any combination thereof. In addition, the polypeptide or protein may contain a fragment of a naturally occurring protein or peptide. The polypeptide or protein may be a single molecule or may be a complex multiparticulate complex. In addition, such polypeptides or proteins may have modified peptide backbones. The terms include fusion proteins, including fusion proteins with a heterologous amino acid sequence, fusions with a heterologous and homologous leader sequence, with or without N-terminal methionine residues, immunologically labeled proteins and the like.

[0052] "Purified" refers to a compound that is removed from its natural environment and is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or 99.99% free from other ingredients with which it is naturally associated.

[0053] "Ribozyme" means an RNA molecule having enzymatic activity that repeatedly cleaves other RNA molecules in a manner specific for nucleotide base sequences.

[0054] "RNA interference" (RNAi) means sequence specific or gene specific suppression of gene expression (protein synthesis) mediated by short interfering RNA (siRNA), short RNA with hairpins, short RNA or microRNA .

[0055] "Sequence identity" refers to a degree of similarity or complementarity. There may be partial or complete identity. Partial sequence complementarity means one that inhibits at least partially the hybridization of an identical sequence to a target polynucleotide; this means that the functional term 'essentially identical' is used. Inhibition of hybridization of a completely complementary sequence to a target sequence can be tested by using a hybridization assay (Southern or Northern hybridization analysis, solution hybridization and the like) under low stringency conditions. A substantially identical sequence or probe will compete and inhibit binding (i.e., hybridization) of a completely identical sequence or probe to the target sequence under low stringency conditions. This does not mean that low stringent conditions mean those in which non-specific binding is allowed; low stringent conditions require that the binding of the two sequences to each other be a specific (i.e., selective) interaction. The lack of non-specific binding can be tested by using a second target sequence that lacks even a partial degree of complementarity (e.g. less than about 30% identity); in the absence of non-specific binding, the probe will not hybridize to a second non-complementary target sequence.

[0056] Another way of considering sequence identity, in the context of two nucleic acid or polypeptide sequences, involves referencing residues in two sequences that are the same when matched for maximum match in a particular region. As used herein, "percentage sequence identity" means the value determined by comparing two optimally matched sequences within a comparison window, wherein part of the polynucleotide sequence in the comparison window may contain additions or deletions (ie, gaps) compared to the reference sequence (which does not contain the addition or deletion) to optimally match two sequences. The percentage is calculated by determining the number of positions that have identical nucleic acid bases in both sequences to obtain the number of matches, dividing the number of matches by the total number of positions in the comparison window, and multiplying this result by 100 to get the percentage of sequence identity.

[0057] "Short interfering RNA" (siRNA) refers to double-stranded RNA molecules, typically from about 10 to about 30 nucleotides in length, that are capable of mediating RNA interference (RNAi). As used herein, the term siRNA includes short RNA with hairpin structure, also known as shRNA.

[0058] The terms "treatment", "treatment", "treat" and the like refer to obtaining the desired pharmacological and / or physiological effect. The effect may be prophylactic in terms of completely or partially preventing the disease or its symptoms and / or may be therapeutic in terms of partial or complete stabilization of the condition or recovery from the disease and / or adverse effects attributable to the disease. "Treatment" includes any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the occurrence of a disease or symptom in an individual that may be predisposed to having the disease or symptom but has not yet been diagnosed as being sick; (b) inhibiting the disease symptom, i.e., arresting progress; or (c) relieving the symptom of the disease, i.e., causing regression of the disease or symptom.

II. Delivery of functional nucleic acids via minicells [0059] As indicated above, the invention provides a method of delivering functional nucleic acid to a target cell, comprising (a) providing an intact minicell that contains a functional nucleic acid molecule or a plasmid containing a segment that encodes a functional nucleic acid molecule and then (b) bringing the minicell into contact with the target mammalian cell, yes, that the mammalian cell absorbs the minicell. After uptake of the minicell, the functional nucleic acid molecule is released into the cytoplasm of the target cell or expressed with the participation of the target cell. Minicells may contact mammalian target cells via bispecific ligands as described in WO 2005/056749. Contact between the minicell and the target mammalian cell may occur in vitro or in vivo.

A. Minicells [0060] The minicells of the invention are non-nuclear forms of E. coli cells or other bacteria made by a disorder of coordination, during cell cleavage, of cell division with DNA segregation. Prokaryotic chromosome replication is associated with normal binary cleavage that involves the formation of a septum in the middle of the cell. For example in E. coli, mutation of min genes, such as minCD, may remove inhibition of septum formation at cell poles during cell division, resulting in the production of a normal daughter cell and a non-nuclear minicell. See de Boer et al., 1992; Raskin & de Boer, 1999; Hu & Lutkenhaus, 1999; Harry, 2001. Minicells are different from other small vesicles that are produced and released spontaneously in specific situations and are not, unlike minicells, subject to specific genetic rearrangements or expression of episomal genes. In the practice of the invention, it is desirable that the minicells have intact cell walls ("intact minicells").

[0061] In addition to the operon mutation, non-nuclear minicells are also produced after many other genetic rearrangements or mutations that interfere with septum formation, for example in divIVB1 in B. subtilis. See. Reeve and Cornett, 1975; Levin et al., 1992. Minicells can also be formed after disruption at the expression levels of protein genes involved in cell division / chromosome segregation. For example, overexpression of minE leads to polar division and production of minicells. Similarly, minicells lacking a chromosome may be the result of chromosome segregation defects, e.g. smc mutation in Bacillus subtilis (Britton et al., 1998), spoOJ deletion in

B. subtilis (Ireton et al., 1994), mukB mutation in E. coli (Hiraga et al., 1989) and parC mutation in E. coli (Stewart and D'Ari, 1992). Gene products can be delivered in trans. If overexpressed from a high-copy plasmid, for example, CafA may increase the rate of cell division and / or inhibit chromosome division after replication (Okada et al., 1994), resulting in the formation of chain-linked and non-nuclear minicells (Wachi et al., 1989) ; Okada et al., 1993). Minicells can be obtained from any bacterial cells of Gram-positive or Gram-negative origin.

[0062] According to the invention, the minicells contain a functional nucleic acid or plasmid that encodes a functional nucleic acid whose delivery is desired. The "functional" nucleic acid molecules of the invention have the ability to reduce protein expression by interacting directly with the transcript that encodes that protein. SiRNA molecules, ribozymes, and antisense nucleic acids are exemplary functional nucleic acids.

B. siRNA molecules [0063] Short interfering RNA (siRNA) molecules are useful for conducting

RNAi, a post-transcriptional gene silencing mechanism. Typically, "siRNA" means double-stranded RNA molecules from about 10 to about 30 nucleotides in length, which have been named for their ability to specifically interfere with protein expression. Preferably siRNA molecules are 12-28 nucleotides in length, more preferably 15-25 nucleotides in length, even more preferably 19-23 nucleotides in length and most preferably 2123 nucleotides in length. Therefore, preferred siRNA molecules are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides in length.

[0064] The length of one strand determines the length of the siRNA molecule. For example, siRNA, which is described as having 21 ribonucleotides (21-mer), may contain two opposing RNA strands that have joined each other over 19 adjacent base pairs. The other two ribonucleotides on each strand will form the "unpaired end". When siRNA contains two strands of different lengths, the longer strand determines the length of the siRNA. For example, a dsRNA containing one strand that is 21 nucleotides long and another strand that is 20 nucleotides long is a 21-mer.

[0065] SiRNAs that contain an unpaired end are desirable. The unpaired end may be at the 5 'or 3' end of the thread. Preferably, it is at the 3 'end of the RNA strand. The unpaired end length can vary, but is preferably from about 1 to about 5 bases and more preferably is about 2 nucleotides in length. Preferably, the siRNA of the invention will have an unpaired 3 'end having about 2 to 4 bases. More preferably, the unpaired 3 'end is 2 ribonucleotides long. Even more preferably, 2 ribonucleotides having an unpaired 3 'end are uridine (U).

[0066] According to the invention, the term siRNA includes short RNA with hairpin structure. shRNAs contain a single RNA strand that forms a stem-loop structure, where the trunk consists of complementary sense and antisense strands that contain double-stranded siRNA, and the loop is a variable-size connector. The structure of the shRNA trunk is usually from about 10 to about 30 nucleotides in length. Preferably, the stem of the siRNA molecule is 12-28 nucleotides in length, more preferably 15-25 nucleotides in length, even more preferably 19-23 nucleotides in length and most preferably 21-23 nucleotides in length. Therefore, preferred shRNA molecules contain stems that are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides in length.

[0067] siRNAs of the invention are intended to interact with a target ribonucleotide sequence, which means that they are sufficiently complementary to the target sequence to hybridize to the target sequence. In one embodiment, the invention provides siRNA molecules comprising a ribonucleotide sequence at least 70%, 75%, 80%, 85% or 90% identical to the target ribonucleotide sequence or complementary to the target ribonucleotide sequence. Preferably, the siRNA molecule is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the target ribonucleotide sequence or complementary to the target ribonucleotide sequence. Most preferably, siRNA will be 100% identical to the target nucleotide sequence or complementary to the ribonucleotide sequence. However, siRNA molecules with insertions, deletions or single point mutations relative to the target may also be effective.

[0068] Tools supporting siRNA design are readily available to the public. For example, the siRNA computer design tool is available on the Internet at<a href="http://www.dharmacon.com">www.dharmacon.com</a>.

C. Ribozymes [0069] Ribozymes are RNA molecules having enzymatic activity that can repeatably cleave other RNA molecules specifically for nucleotide base sequences. Such enzymatic RNA molecules can be targeted to essentially any RNA transcript and perform effective cleavage in vitro.

[0070] Six types of naturally occurring enzymatic RNAs are currently known. Anyone can catalyze the hydrolysis of RNA phosphodiester bonds in the trans system (and can cleave other RNA molecules) under physiological conditions. In general, enzymatic polynucleotides act by first binding to a target RNA. Such binding occurs through the target binding portion of the enzymatic polynucleotide that is held in close proximity to the enzymatic portion of the molecule that acts to result in cleavage of the target RNA. Hence, the enzymatic polynucleotide first recognizes and then binds to the target RNA by complementary base pairing, and when bound to the correct site, acts enzymatically, cleaving the target RNA. Strategically cleaving such a target RNA will destroy its ability to direct the synthesis of the encoded protein. After the enzymatic polynucleotide binds and cleaves the RNA target data, it is released from that RNA to search for the next target and can repeatedly bind and cut new targets.

[0071] The enzymatic nature of ribozyme is preferred. Because a single ribozyme molecule has the ability to cleave multiple target RNA molecules, effective ribozyme concentrations can be quite low.

[0072] Useful ribozymes may contain one of several motifs, including a hammer head (Rossi et al. (1992)), a hair clip (Hampel and Tritz, (1989), Hampel et al. (1990)), an inflammatory virus motif delta liver (Perrotta and Been (1992), intron group I (US Patent No. 4,987,071), RNazyP RNA in combination with the RNA targeting sequence (Guerrier-Takada et al. (1983)), and VS RNA Neurospora (Saville &amp; Collins ( 1990); Saville &amp; Collins (1991); Collins &amp; Olive (1993)). These specific motifs are not limiting, since all that is important in the ribozyme of the invention is that there is a specific substrate binding site that is complementary to one or more regions of the target RNA, and that it has nucleotide sequences within or surrounding it a substrate binding site that confers RNA cleavage activity on the molecule.

[0073] Ryozymes of the invention may contain modified oligonucleotides (e.g., to improve stability, orientation, etc.). Nucleic acid sequences encoding ribozymes may be under the control of a strong constitutive promoter, such as, for example, the RNA II polymerase or RNA III polymerase promoter, so that transfected cells produce sufficient amounts of ribozyme to destroy target endogenous [RNA] information and inhibit translation.

D. Antisense oligonucleotides [0074] The antisense oligonucleotides of the invention specifically hybridize with the nucleic acid encoding the protein and interfere with the transcription or translation of the protein. In one embodiment, the antisense oligonucleotide is directed to DNA and interferes with its replication and / or transcription. In another embodiment, the antisense oligonucleotide specifically hybridizes to RNA, including pre-mRNA and mRNA. Such antisense oligonucleotides can affect, for example, RNA translocation to a protein translation site, protein translation from RNA, RNA splicing to obtain one or more types of mRNA, and catalytic activity that can be associated with or facilitated by RNA. The overall effect of such interference is to modulate, reduce or inhibit the expression of the target protein.

[0075] There are several sites within a gene that can be used in the design of an antisense oligonucleotide. For example, an antisense oligonucleotide may bind a region including a translation initiation codon, also known as a start codon, of an open reading frame. In this regard, the "start codon" and "translation initiation codon" generally refer to portions of such mRNA or gene that comprise at least about 25 to at least about 50 consecutive nucleotides in any direction (i.e. 5 'or 3') from the translation initiation codon.

[0076] Another site for antisense interaction is the open reading frame termination codon. The terms "stop codon region" and "translation termination codon region" generally refer to portions of such mRNA or gene that comprise from at least about 25 to at least about 50 consecutive nucleotides in any direction away from the translation termination codon.

[0077] An open reading frame or coding region may also mean success targets. An open reading frame is generally understood to refer to the region between the translation initiation codon and the translation termination codon. Another target region is the 5 'untranslated region, which is part of the 5' mRNA from the translation initiation codon. It includes nucleotides between the 5 'cap site and the codon for initiating translation of mRNA or corresponding nucleotides in the gene.

[0078] Similarly, the 3 'untranslated region can be used as a target for antisense oligonucleotides. The 3 'untranslated region means that portion of the mRNA 3' to the translation termination codon and thus includes nucleotides between the translation termination codon and the 3 'end of the mRNA or corresponding nucleotides in the gene.

[0079] The antisense oligonucleotide may also be targeted to the 5 'region of the mRNA cap. The 5 'cap contains a N7-methylated guanosine residue, connected to the 5'-nearest mRNA residue by a 5'-5' triphosphate bond. The 5 'region of the cap is believed to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap.

[0080] Although some eukaryotic mRNA transcripts are directly translated, many contain one or more intronic regions that are excised from the transcript prior to its translation. The remaining (and thus translated) regions of the exons are joined together by splicing to form a continuous mRNA sequence. MRNA splicing sites, i.e. intron-exon junctions are potential target regions and are particularly useful in situations where abnormal splicing is associated with the disease, or where overproduction of a particular mRNA splicing product is associated with the disease. In addition, abnormal junctions due to rearrangements or deletions are also potential targets for antisense oligonucleotides.

[0081] Considering these different targets, antisense oligonucleotides that are sufficiently complementary to target polynucleotides should be selected. They must show a sufficient degree of complementarity or precise pairing so that there is a stable and specific binding between the oligonucleotide and the polynucleotide target. Importantly, the sequence of the antisense oligonucleotide need not be 100% complementary to that of its target polynucleotide to specifically hybridize. The antisense oligonucleotide is specifically hybridized when the binding of the antisense oligonucleotide to the target polynucleotide interferes with the normal functioning of the target polynucleotide, causing loss of utility, and when there is a sufficient degree of complementarity to avoid non-specific binding of the antisense oligonucleotide in which the sequence is different from the target binding, i.e. under physiological conditions in in vivo assays or therapeutic treatment, and in in vitro assays in the conditions in which the assays are performed.

[0082] Antisense oligonucleotides may be at least about 8 nt to at least about 50 nt in length. In one embodiment, the antisense oligonucleotides can be about 12 to about 30 nt in length.

[0083] The antisense oligonucleotides used in accordance with the invention can be conveniently and routinely produced by a well-known solid phase synthesis technique. Equipment for such synthesis is sold by several suppliers, including, for example, Applied Biosystems (Foster City, CA). Other methods of such synthesis known in the art may also be used, alternatively or alternatively. It is well known to use similar techniques for the preparation of oligonucleotides such as phosphorothioates and alkylated derivatives.

E. Nucleic Acids Encoding Functional Nucleic Acids [0084] In preferred embodiments of the invention, the minicells contain nucleic acids that encode functional nucleic acids. For example, the plasmid may encode a functional nucleic acid that is expressed inside mammalian target cells. This enables endogenous delivery of functional nucleic acids that has advantages over the transient nature of exogenous delivery.

[0085] Hence, recombinant intact minicells may carry plasmid DNA encoding one or more siRNA sequences targeted for gene silencing or apoptosis resistance. By using minicells that encode many functional nucleic acids, it is possible to treat cells that express many mechanisms of drug resistance. Different siRNA sequences can be expressed individually from different promoters. For example, siRNA targeting Pgp mRNA can be expressed from the U6 promoter, and siRNA targeting mRNABcl-2 can be expressed from the H1 promoter. These multiple expression cassettes are preferably located on a single plasmid, but may also exist on different plasmids. Different siRNA sequences can also be expressed from a single promoter, with the recombinant plasmid carrying an expression cassette consisting of multiple siRNA coding sequences that are linked together by non-coding polynucleotide sequences. A single gene transcription terminator can be placed below the complete expression cassette.

[0086] In one strategy, the plasmid encodes the sense and antisense strands of siRNA as two independent transcripts that, when expressed within the target cell, hybridize to form functional siRNA duplexes. In a second preferred strategy, the plasmid encodes one or more siRNAs, all of which are expressed as a single transcript that forms a short-loop RNA hairpin structure. The hairpin structure can be processed by the Dicer enzyme to form functional siRNAs.

F. Reporter elements [0087] The nucleic acid molecule to be introduced by the approach of the invention may comprise a reporter element. The reporter element confers on the recombinant host an easily detectable phenotype or trait, typically by encoding a polypeptide not otherwise produced by the host, which can be detected, after expression, by histological or in situ analysis, such as by in vivo imaging techniques. For example, a reporter element provided by an intact minicell according to the invention could encode a protein that causes, when absorbed by the host cell, a colorimetric or fluorometric change that is detectable by in situ analysis and which is a quantitative or semi-quantitative function of transcription activation. Illustration of these proteins are esterases, phosphatases, proteases and other enzymes whose activity generates a detectable chromophore or fluorophore.

[0088] Preferable examples are E. coli β-galactosidase, which causes a color change by cleaving the indigo substrate, indolyl-eD-galactoside, and luciferase, which oxidizes long-chain aldehyde (bacterial luciferase) or heterocyclic carboxylic acid (luciferin) with simultaneous release light. Also, useful in this context is a reporter element that encodes a green fluorescent protein (GFP) from the jellyfish, Aequorea victoria, as described in Prasher et al. (1995). The field of GFP-related technology is illustrated by two published PCT applications, WO 095/21191 (discloses the polynucleotide sequence encoding the 238 amino acid GFP apoprotein containing a chromophore formed from amino acids 65 to 67) and WO 095/21191 (discloses the cDNA modification for the GFP A. victoria apopeptide, providing a peptide with altered fluorescent properties), and application of Heim et al. (1994) regarding mutated GFP, characterized by a 4- to 6-fold improvement in excitation amplitude.

[0089] Another type of reporter element is associated with an expression product that makes the recombinant toxin resistant minicell. For example, the neo gene protects the host against toxic levels of the G418 antibiotic, while the gene encoding dihydrofolate reductase confers resistance to methotrexate, and the chloramphenicol acetyltransferase (CAT) gene confers chloramphenicol resistance.

[0090] Other genes for use as reporter elements are those that can transform a host minicell for expression of distinct cell surface antigens, e.g., viral envelope proteins such as HIV gp120 or herpes gD, which are readily detectable in immunoassays.

G. Regulatory elements [0091] The nucleic acid molecule to be introduced by the approach of the invention may also have the desired coding segment operably linked to a regulatory element, such as a promoter, terminator, enhancer and / or signal sequence. A suitable promoter may be tissue-specific or even cancer-specific, as required by the therapeutic context.

[0092] A promoter is "tissue-specific" when it is preferentially activated in a given tissue, and hence is effective in directing expression, in the target tissue, of a functionally linked structural sequence. The category of tissue-specific promoters includes, for example: the hepatocyte-specific promoter for albumin and? 1-antitrypsin, respectively; the elastase I gene control region that is active in pancreatic lobular cells; insulin gene control region, active in pancreatic beta cells; mouse mammary gland tumor virus control region that is active in testicular, breast, lymphatic and mast cells; myelin protein basic gene control region, active in oligodendrocyte cells; and the gonadotropin releasing hormone gene control region that is active in the hypothalamus cells. See. Frain et al. (1990), Ciliberto et al. (1985), Pinkert et al., (1987), Kelsey et al. (1987), Swift et al. (1984), MacDonald (1987), Hanahan, (1985), Leder et al. (1986), Readhead et al. (1987), and Mason et al. (1986).

[0093] There are also promoters that are expressed preferentially in certain cancer cells or in cancer cells per se, and which are useful in the treatment of various cancers in accordance with the invention. The class of promoters that are specific for cancer cells is illustrated by: the tyrosinase promoter, for targeting melanomas; MUC1 / Df3 promoter for targeting breast cancer; myoD hybrid enhancer / SV40 promoter that targets the expression of rhabdomyosarcoma (RMS); carcinoembryonic antigen promoter (CEA), which is specific for CEA expressing cells, such as colon cancer cells, and the type II hexokinase gene promoter, to target non-small cell lung cancers. See. Hart (1996), Morton &amp; Potter (1998), Kurane et al. (1998) and Katabi et al. (1999).

[0094] Promoters that are dependent on RNA polymerase (pol) II or pol II are preferred promoters. Highly preferred promoters are RNA polymerase III, H1 and U6 promoters.

[0095] The signal sequence of the invention may be used to cause expression of the expression product or localization of the expression product in a specific cellular compartment. Hence, the therapeutic polynucleotide molecule that is delivered through intact minicells may contain the signal sequence in the correct reading frame, so that the expression product in question is secreted by the absorbing cell or its progeny, thereby interacting with the surrounding cells in accordance with chosen treatment paradigm. Illustrative signal sequences include the C-terminal hemolysin secretion sequence described in US Patent No. 5,143,830, the BAR1 secretion sequence disclosed in US Patent No. 5,037,743, and the portion of the signal sequence of the zsig32 polypeptide described in US Patent No. 6,025,197.

H. Functional nucleic acid targets [0096] The functional nucleic acids of the invention are directed to a gene or protein transcript that stimulates drug resistance, inhibits apoptosis, or contributes to a tumor phenotype. The successful application of functional nucleic acid strategies in such situations has already been achieved in the prior art, but without the benefit of minicell vectors. See. e.g. Sioud (2004), Caplen (2003), Wu et al. (2003), Nieth et al. (2003), Caplen and Mousses (2003), Duxbury et al. (2004), Yague et al. (2004), Duan et al. (2004), [0097] Proteins that contribute to drug resistance are preferred targets for functional nucleic acids. Proteins can contribute to acquired drug resistance or to internal drug resistance. Acquiring a resistant phenotype occurs when affected cells, such as cancer cells, initially respond to drugs but become refractory after subsequent treatment cycles. Useful targets involved in acquired drug resistance include, transporters having an ATP binding cassette, such as P-glycoprotein (P-gp, P-170, PGY1, MDR1, ABCB1, MDR-related protein, multi-drug resistance protein 1), MDR- 2 and MDR-3, MRP2 (protein associated with multi-drug resistance), BCR-ABL (region of fracture clusters - Abelson protooncogene), STI-571 protein associated with resistance, protein associated with lung resistance, cyclooxygenase 2, kappa nuclear factor XRCC1 (cross-complementation of X-ray damage; group 1), ERCC1 (cross-complement and excision gene), GSTP1 (glutathione S-transferase), β-tubulin mutant and growth factors such as IL-6 are additional targets involved in acquired drug resistance. When previously untreated cells do not respond to one or more drugs, the resistance phenotype is internal. An example of a protein that contributes to internal resistance is LRP (a protein associated with lung resistance).

[0098] Useful targets also include proteins that contribute to apoptosis resistance. They include Bcl-2 (B-cell leukemia / lymphoma), Bcl-XL,

A1 / Bfl 1, adhesion-focal kinase and mutated p53 protein.

[0099] Useful targets also include oncogenic proteins and mutant tumor suppressor proteins. Examples include β-catenin, PKC-α (protein kinase C), C-RAF, K-Ras (V12), Dead box DPNA helicase DP97, DNMT1 (DNA 1 methyltransferase), FLIP (Flice-like inhibitory protein), C -Sfc, 53BPI, Polycomb EZH2 protein (homologue enhancer zeste), ErbB 1, HPV-16 E5 and E7 (early papilloma virus early 5 and early 7), fortilinin and MCI1P (myeloid leukemia protein 1), DIP13a (13a protein reactive with DDC), MBD2 (methyl CpG binding domain), p21, KLF4 (Kruppel 4-like factor), tpt / TCTP (tumor-controlled translation protein), SPK1 and SPK2 (sphingosine kinase), P300, PLK1 (Polo-like kinase 1), Trp53, Ras, ErbB1, VEGF (endothelial growth factor) vascular) and BAG1 (atanogen 1 bound to BCL2).

[0100] With respect to HIV infection, targets include HIV-Tat, HIV-Rev, HIV-Vif, HIV-Nef, HIV-Gag, HIV-Env, LTR, CD4, CXCR4 (chemokine receptor) and CCR5 (chemokine receptor ).

[0101] Due to the heterogeneity of the tumor cells, many different drug resistance or apoptosis resistance pathways can be triggered in target cells. Thus, functional nucleic acids used in the methods of the invention may need to change over time. For example, if biopsy samples reveal new mutations that lead to acquired drug resistance, specific siRNAs can be designed and encoded on the appropriate expression plasmid that transforms the minicell-producing bacterial strain used to produce recombinant minicells, load it into intact minicells that are given to respond to acquired drug resistance.

III. Method of overcoming drug resistance and treating disease [0102] In another aspect, the invention provides a method of overcoming drug resistance and treating a subject from a disease such as cancer or AIDS. The method includes (a) providing an intact minicell that contains a functional nucleic acid molecule or plasmid containing a segment that encodes a functional nucleic acid molecule, wherein the functional nucleic acid molecule is directed to a transcript of a protein that stimulates drug resistance, (b) minicell contact with the target mammalian cell such that the mammalian cell absorbs the minicell and (c) delivering the drug to the target mammalian cell. Preferably, step (c) is carried out after steps (a) and (b) to allow functional nucleic acid to reduce drug resistance prior to drug administration. Drug delivery and functional nucleic acid introduction may occur sequentially, in any order, or simultaneously.

[0103] According to the invention, the drugs can be delivered by any conventional means. For example, drugs may be delivered orally, parenterally (including subcutaneously, intravenously, intramuscularly, intraperitoneally and by infusion), topically, transdermally, or by inhalation. The appropriate mode of delivery and dosage of each drug is easy to determine by medical experts.

A. Drug delivery via minicells [0104] Although drug delivery can occur via conventional means, delivery via minicells is preferred. The inventors in this regard have found that these mammalian cells can again be successfully transfected by targeting intact minicells that are unpacked with various contents. For example, minicells packaged with the siRNA-encoding plasmid can transfect a mammalian cell, after which the drug-packed minicells can deliver the drug to the same mammalian cell. This finding was surprising, and indicates that intracellular processes associated with minicell disintegration, endosomal release of content and escape of content to intracellular targets remain fully functional after the first round of transfection and content delivery.

[0105] The drug may be packaged in a separate minicell relative to that of the functional nucleic acid or plasmid encoding the functional nucleic acid. Alternatively, the drug may be packaged in the same minicell as the functional nucleic acid molecule or plasmid encoding the functional nucleic acid molecule. Some medicines may interact with nucleic acids and prevent the medicine and nucleic acid from being packaged together in the same minicell. For example, doxorubicin is known to interact with DNA.

Preferably, the minicells of the invention contain a sufficient amount of drug to exert a physiological or pharmacological effect of the drug on the target cell. Also preferably, the drugs contained within the minicells are heterologous or foreign to the minicells, which means that the bacterial stem cells of the minicells do not normally produce the drug.

[0107] Both hydrophilic and hydrophobic drugs can be packaged into minicells by creating a drug concentration gradient between the extracellular environment containing the minicells and the minicell cytoplasm. When the extracellular environment has a higher drug concentration than the minicell cytoplasm, the drug naturally shifts down this concentration gradient to the minicell cytoplasm. However, when the concentration gradient is reversed, the drug does not come out of the minicells.

[0108] To load minicells with drugs that are not usually water-soluble, the drugs can be pre-dissolved in a suitable solvent. For example, paclitaxel can be dissolved in a 1: 1 mixture of ethanol and cremophore EL (polyethoxylated castor oil) followed by dilution in PBS to achieve a solution of paclitaxel that is partially dissolved in aqueous media and carries minimal amounts of organic solvent to ensure that the medicine remains in solution. Minicells can be incubated in this final environment for drug loading. Thus, the inventors have found that even hydrophobic drugs can diffuse into the cytoplasm of minicells to achieve high and therapeutically significant drug loading of the cytoplasm. This is unexpected because the minicell membrane is composed of a hydrophobic phospholipid bilayer, which was expected to prevent the diffusion of hydrophobic molecules into the cytoplasm.

[0109] Another method of loading minicells with a drug involves culturing the recombinant bacterial stem cells under conditions such that the parent bacterial cell transcribes and translates the nucleic acid encoding the drug and the drug is released into the cytoplasm of the parent bacterial cell. For example, a gene cluster encoding the cellular biosynthesis pathway of a desired drug may be cloned and transferred to a parent bacterial strain that is capable of producing minicells. Gene transcription and translation of the gene cluster results in drug biosynthesis within the cytoplasm of parent bacterial cells, filling the drug with bacterial cytoplasm. When the parent bacterial cell divides and creates daughter minicells, the minicells also contain the drug in their cytoplasm. Pre-charged minicells can be purified by any suitable minicell purification method, including the methodology described above.

[0110] Similarly, another method of loading minicells with a drug involves culturing a recombinant minicell that contains the expression plasmid encoding the drug under conditions such that the gene encoding the drug is transcribed and translated within the minicell.

B. Drugs [0111] Drugs useful in the invention can be a physiologically or pharmacologically active substance that produces the desired local or systemic effect in animals, especially mammals and humans. Drugs can be inorganic or organic compounds, including but not limited to, peptides, proteins, nucleic acids and small molecules, all of which can be characterized or uncharacterized. They may exist in various forms, such as unchanged molecules, molecular complexes, pharmacologically acceptable salts, such as hydrochloride, hydrobromide, sulfate, laurate, palmitate, phosphate, nitrite, nitrate, borate, acetate, maleate, tartrate, oleate, salicylate and the like . For acidic drugs, metal salts, amines or organic cations can be used, for example quaternary ammonium compounds. Drug derivatives such as bases, esters and amides can also be used. A drug that is insoluble in water can be used in a form that means its water-soluble derivative, or as its basic derivative, which in any case, or through its delivery, is converted by enzymes, hydrolyzed at the body's pH, or by means of other metabolic processes to their original therapeutically active form.

[0112] Useful drugs include chemotherapeutic agents, immunosuppressants, cytokines, cytotoxic agents, nucleolytic compounds, radioactive isotopes, receptors and prodrug activating enzymes that can be naturally occurring or produced by recombinant means.

[0113] Drugs that are affected by classical multi-drug resistance have particular utility in the invention, such as vinca alkaloids (e.g. vinblastine and vincristine), anthracyclines (e.g. doxorubicin and daunorubicin), RNA transcription inhibitors (e.g. actinomycin-D) and drugs stabilizing microtubules (e.g. paclitaxel). (Ambudkar et al.,

1999) [0114] In general, cancer chemotherapy agents are preferably drugs. Useful drugs for the treatment of cancer include nitrogen mustards, nitrosoureas, ethyleneimines, alkanesulfonates, tetrazine, platinum compounds, pyrimidine analogs, purine analogs, antimetabolites, folic acid analogs, anthracyclines, taxanes, vinca alkaloids, hormone topoisomerase inhibitors and. Examples of chemotherapy drugs are actinomycin-D, alkeran, Ara-C, anastrozole, asparaginase, BiCNU, bicalutamide, bleomycin, busulfan, capecitabine, carboplatin, carboplatinum, carmustine, CCNU, chlorambucil, cisplatin, cladribine, cyclophabine, cyclophosphine , cytosine arabinoside, cytoxane, dacarbazine, dactinomycin, daunorubicin, dexrazoxane, docetaxel, doxorubicin, DTIC, epirubicin, ethyleneimine, etoposide, floxuridine, fludarabine, fluorouracil, flutamide, photemustine, gemcitabine, herceptin, hexamethylamine, hydroxycarbamide, idarubicin, ifosfamide, irinotecan, lomustine, mechlorethamine, melphalan, mercaptopurine, methotrexate, mitomycin, mitotane, mitoxantrone, oxaliplatin, paclitaxel, pstristaine, pamiditaine 571, streptozocin, tamoxifen, temozolomide, teniposide, tetrazine, thioguanine, thiotepa, tomudex, topotecan, treosulfan, trimetrexate, vinblastine, vincristine, vindesine, vinorelbine, VP-16 and Xeloda.

[0115] Useful drugs for cancer chemotherapy also include alkylating agents such as thiotepa and cyclophosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carbocarbone, meturedopa and uredopa; ethyleneimines and methylamelamines, including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylol melamine; nitrogen mustard derivatives such as chlorambucil, chlornafazine, cholophosphamide, estramustine, ifosfamide, mechloretamine, mechloretamine oxide hydrochloride, melphalan, Novembiehin, fenesterine, prednimustine, trophosphamide, uracil mustard; nitroureas such as carmustine, chlorozotocin, photemustine, lomustine, nimustine and ranimustine; antibiotics such as aclacinomizins, actinomycin, autramycin, azaserin, bleomycin, cactinomycin, calicheamycin, carabicin, carminomycin, carzinophylline, chromomycin, dactinomycin, daunorubicin, detorubicin, 6-diazine-euborine-norxorine idarubicin, marcellomycin, mitomycin, mycophenolic acid, nogalamycin, olivomycin, peplomycin, potfiromycin, puromycin, quelamycin, rhodorubicin, streptonigrine, streptozocin, tubercidin, ubenimex, zynostatin and zorubicin; anti-metabolites such as methotxate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin and trimetrexate, purine analogues such as fludarabine, 6-mercaptopurine, thiaprine and thioguanine; pyrimidine analogues such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocytabine, floxuridine and 5-FU; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane and testolactone; adrenocortical hormone antagonists such as aminoglutethimide, mitotane and trilostane; folic acid supplements such as folinic acid; aceglatone; aldophosphamide glycoside, aminolevulinic acid; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfornithine; elliptin acetate; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet; pirarubicin; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK®; razoxane; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2 ', 2 "-trichlorotriethylamine; urethane; vindesine, dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (" Ara-C "); cyclophosphamide; thiotepa; taxoids, e.g. paclitaxel (TAXOL®, Bristol-Myers Squibb Oncology, Princeton, NJ) and doxetaxel (TAXOTERE®, Rhone-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogues such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; edatrexate; teniposide; daunomycin; aminopterin; Xeloda; ibandronate; CPT-11; RFS 2000 topoisomerase inhibitor; difluoromethylornithine (DMFO); retinoic acid; Esperamicins; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Also included are anti-hormonal agents that act to regulate or inhibit the hormone's effects on tumors, such as anti-estrogens, including, for example, tamoxifen, raloxifene, 4 (5) -imidazole aromatase inhibitors, 4-hydroxy tamoxifen, trioxyfen, keoxyfen, onapristone and toremifene ( Fareston); and antiandrogens such as flutamide, nilutamide, bicalutamide, leuprolide and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above.

[0116] Useful drugs also include cytokines. Examples of such cytokines are lymphokines, monokines and traditional polypeptide hormones. Among the cytokines are growth hormones such as human growth hormone, N-methionyl human growth hormone and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH) and luteinizing hormone (LH); hepatic growth factor; fibroblast growth factor; prolactin; placental lactogen; tumor necrosis factor-α and

-β; a substance that inhibits the functions of Muller's ducts; mouse gonadotropin-related peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors such as NGF-β; platelet-derived growth factor; transforming growth factors (TGFs) such as TGF-α and TGF-β; insulin-like growth factors -I and -II; erythropoietin (EPO); osteoinductive factors; interferons such as interferon -α, -β and -γ; growth-promoting factors (CSF) such as macrophage-CSF (M-CSF); granulocyte-macrophage-CSF (GM-CSF); and granulocyte-CSF (G-CSF); interleukins (IL) such as IL-1, IL-la, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12, IL-15; tumor necrosis factor such as TNF-α or TNF-β; and other polypeptide factors, including LIF and kit ligand (KL). As used herein, the term cytokine includes proteins from natural sources or from recombinant cell culture and biologically active equivalents of native cytokine sequences.

[0117] Drugs can be prodrugs, subsequently activated by a prodrug activating enzyme that converts a prodrug, such as a peptidyl chemotherapeutic agent, to the form of an active anti-cancer drug. See. e.g. WO 88/07378, WO 81/01145; U.S. Patent No. 4,975,278. In general, the enzyme component includes any enzymes capable of interacting with a prodrug to be converted to a more active, cytotoxic form.

IV. Targeting minicells to specific mammalian cells [0118] According to the invention, the minicell is targeted to the target mammalian cell via a bispecific ligand as described in WO 2005/056749. A bispecific ligand, with specificity for both the minicell and mammalian cell components, causes the minicell to bind to the mammalian cell, such that the minicell is absorbed by the mammalian cell and the mammalian cell produces a functional nucleic acid molecule. This method of targeted delivery can be carried out in vivo or in vitro, or both in vivo and in vitro.

[0119] Contact between the bispecific ligand, minicell and mammalian cell can occur in a number of different ways. For in vivo delivery, it is preferable to administer a minicell that already has a bispecific ligand attached thereto. Hence contact of all: minicell, bispecific ligand and target cell when the bispecific ligand-targeted minicell reach the target cell in vivo. Alternatively, the bispecific ligand and minicell may be administered separately in vivo.

[0120] Contact between bispecific ligands, minicells and mammalian cells may also occur during one or more in vitro incubations. In one embodiment, three elements are incubated with each other all at once. Alternatively, incubations can be carried out in stages. In one example of a stepwise approach, minicells and bispecific ligands are first incubated together to form a bi-specific ligand-targeted minicells that are then incubated with target cells. In another example, bispecific ligands are first incubated with target cells, followed by incubation with minicells. The combination of one or more in vitro incubations and in vivo administration may also result in contact of bispecific ligands, minicells and mammalian target cells.

[0121] The inventors have found that the targeted delivery approach finds general application for mammalian cells, including cells that are normally resistant to specific adhesion and endocytosis of minicells. For example, bispecific antibody ligands with anti-O-polysaccharide specificity on one arm and anti-HER2 receptor specificity or anti-androgen receptor on the other arm effectively bind minicells to relevant receptors on a number of non-phagocytic target cells. These cells include lung, ovarian, brain, breast, prostate and skin cancer cells. In addition, effective binding precedes rapid endocytosis of minicells by each of the non-phagocytic cells.

[0122] Target cells of the invention include any cells into which a functional nucleic acid is to be introduced. Desired target cells are characterized by cell surface receptor expression, which - after ligand binding - facilitates endocytosis. Preferred target cells are non-phagocytic, which means that the cells are not specialized phagocytes such as macrophages, dendritic cells and natural killer (NK) cells. Preferred target cells are also mammalian cells.

[0123] Ligands useful in the targeted delivery methods of the invention include any agent that binds to a surface component on a target cell and to a surface component on a minicell. Preferably, the surface component on the target cell is a receptor, particularly a receptor capable of mediating endocytosis. The ligands may contain a polypeptide and / or a carbohydrate component. Antibodies are preferred ligands. For example, a bispecific antibody that carries dual specificities for a surface component on intact minicells of bacterial origin and for a surface component on target mammalian cells can be effectively used to target minicells to mammalian target cells in vitro and in vivo. Useful ligands also include receptors, enzymes, binding peptides, fusion / chimeric proteins and small molecules.

[0124] Selection of a specific ligand is based on two main criteria: (i) specific binding to one or more domains on the surface of intact minicells, and (ii) specific binding to one or more domains on the surface of target cells. Thus, ligands preferably have a first arm that carries the specificity for the surface structure of an intact minicell of bacterial origin and a second arm that carries the specificity for the surface structure of a mammalian cell. Each of the first and second arms can be multivalent. Preferably, each arm is monospecific, even if it is multivalent.

[0125] For the purpose of binding to minicells of bacterial origin, it is desirable for one arm of the ligand to be specific for the O-polysaccharide component of the lipopolysaccharide found on the parent bacterial cell. Other minicell surface structures that can be used to bind ligand include cell surface exposed polypeptides and carbohydrates on outer membranes, cell surface exposed segments of pilli, fimbri and flagella peptides.

[0126] For binding to target cells, one ligand arm is specific to the surface component of a mammalian cell. Such components include cell surface proteins, peptides and carbohydrates, whether characterized or not characterized. Cell surface receptors, especially those capable of activating receptor-mediated endocytosis, are desirable cell surface components for targeting. Such receptors, if overexpressed on the surface of the target cell, confer additional selectivity for targeting the cells for treatment, thereby reducing the possibility of delivery to non-target cells.

[0127] By way of example, cancer cells, metastatic cells, vascular cells such as endothelial cells and smooth muscle cells, lung cells, kidney cells, blood cells, bone marrow cells, brain cells, liver cells etc. can be targeted. , or precursors to any selected cells, by selecting a ligand that specifically binds the cell surface receptor motif on the desired cells. Examples of cell surface receptors include carcinoembryonic antigen (CEA), which is overexpressed in most cancers of the colon, rectum, breast, lung, pancreas and gastrointestinal tract (Marshall, 2003); heregulin receptors (HER-2, neu or c-erbB-2), which are often overexpressed in breast, ovarian, colon, lung, prostate and cervical cancer (Hung et al., 2000); epidermal growth factor receptor (EGFR), which is highly expressed in many solid tumors, including breast, head and neck, non-small cell lung and prostate cancer (Salomon et al., 1995); asjaloglikoprotein receptor (Stockert, 1995); transferrin receptor (Singh, 1999); a serpine enzyme complex receptor that is expressed on hepatocytes (Ziady et al., 1997); fibroblast growth factor receptor (FGFR) that is overexpressed on pancreatic ductal adenocarcinoma cells (Kleeff et al., 2002); vascular endothelial growth factor receptor (VEGFR), for gene therapy against angiogenesis (Becker et al., 2002; Hoshida et al., 2002); folate receptor that is selectively overexpressed in 90% of non-mucosal ovarian cancers (Gosselin and Lee, 2002); cell surface glycocalyx (Batra et al., 1994); carbohydrate receptors (Thurnher et al., 1994); and a polymeric immunoglobulin receptor that is useful for delivering genes to respiratory epithelial cells and attractive for treating lung diseases such as cystic fibrosis (Kaetzel et al., 1997).

[0128] Preferred ligands include antibodies and / or antibody derivatives. As used herein, the term "antibody" includes an immunoglobulin molecule obtained by generating in vitro or in vivo immunogenic responses. The term "antibody" includes polyclonal, monospecific and monoclonal antibodies as well as antibody derivatives such as single chain antibody fragments (scFv). Antibodies and antibody derivatives useful in the invention can also be obtained by recombinant DNA techniques.

[0129] Wild-type antibodies have four polypeptide chains, two identical heavy chains and two identical light chains. Both types of polypeptide chain have constant regions that are not differentiated or differ slightly between antibodies of the same class, and variable regions. Variable regions are unique to a particular antibody and contain an antigen binding domain that recognizes a specific epitope. The antigen binding domain regions that are most directly involved in antibody binding are "complementarity determining regions" (CDRs).

[0130] The term "antibody" also includes antibody derivatives, such as antibody fragments, that retain the ability to specifically bind to antigens. Such antibody fragments include Fab fragments (a fragment that contains an antigen binding domain and contains a light chain and a portion of a heavy chain connected by a disulfide bond bridge), Fab '(an antibody fragment comprising a single antigen binding domain containing Fab and an additional heavy chain part, through hinge region, F (ab ') 2 (two Fab' molecules connected by disulfide bonds between chains in the heavy chain hinge regions), bispecific Fab (Fab molecule having two antigen binding domains, each of which can be directed to a different epitope) and scFv (variable, antigen-binding determining the single light and heavy chain region of the antibody, linked by an amino acid chain).

[0131] When the antibodies, including antibody fragments, form part or all of the ligands, they are preferably of human origin or are modified to be suitable for human use. The so-called. "Humanized antibodies" are well known in the art. See. e.g. Osbourn et al., 2003. They have been modified by genetic manipulation and / or in vitro treatment to reduce their antigenicity in humans. Methods for humanizing antibodies are described, e.g. in US Patent Nos. 6,639,055, No. 5,585,089 and No. 5,530,101. In the simplest case, humanized antibodies are created by transplanting antigen binding loops, known as complementarity determining regions (CDRs), from mouse mAb to human IgG. See. Jones et al., 1986; Riechmann et al., 1988; Verhoeyen et al., 1988. Generating, however, high-affinity humanized antibodies generally requires the transfer of one or more additional residues from so-called framework regions (FR) of mouse parent mAb. Several variants of humanization technology have also been developed. See. Vaughan et al., 1998.

[0132] Human antibodies can also be used in the invention rather than "humanized antibodies". They have high affinity for their respective antigens and are routinely obtained from very large, single chain variable fragments (scFv) or phage display libraries. See. Griffiths et al., 1994; Vaughan et al., 1996; Sheets et al., 1998; de Haard et al., 1999; and Knappik et al., 2000.

[0133] Useful ligands also include bispecific single chain antibodies that typically denote recombinant polypeptides consisting of a light chain variable part covalently attached by a linker molecule to the corresponding heavy chain variable part. See. U.S. Patents No. 5,455,030, No. 5,260,203 and No. 4,496,778. Bispecific antibodies can also be obtained by other methods. For example, chemical heteroconjugates can be generated by chemically linking intact antibodies or antibody fragments with different specificities. See. Karpovsky et al., 1984. However, such heteroconjugates are difficult to obtain in a reproducible manner and are at least twice as large as normal monoclonal antibodies. Bispecific antibodies can also be generated by disulfide exchange, which is associated with enzymatic cleavage and reassociation of antibody fragments. See. Glennie et al., 1987.

[0134] Because Fab and scFv fragments are monovalent, they often have low affinity for target structures. Thus, preferred ligands derived from these components are engineered into dimeric, trimeric or tetrameric conjugates to increase functional affinity. See.

Tomlinson and Holliger, 2000; Carter, 2001; Hudson and Souriau, 2001; and Todorovska et al.,

2001. Such conjugate structures can be generated by chemical and / or genetic cross-linking.

[0135] Bispecific ligands of the invention are preferably monospecific at each end, i.e. specific for a single component on minicells at one end and specific for a single component on target cells at the other end. Ligands can be multivalent at one or both ends, for example in the form of so-called diabetic, tricyclic and tetrafal. See. Hudson and Souriau, 2003. Diabody means a divalent dimer formed by the non-covalent association of two scFvs that results in two Fv binding sites. Similarly, the trichody is the result of the formation of a three-valent three scFv trimer, resulting in three binding sites, and the tetrabody is the result of the formation of a tetravalent four scFv tetramer, resulting in four binding sites.

[0136] Several humanized, human and mouse monoclonal antibodies and fragments thereof that have specificity for receptors on mammalian cells have been approved for therapeutic use in humans, and this list is growing rapidly. See. Hudson and Souriau, 2003. An example of such an antibody that can be used to form one arm of a bispecific ligand has HER2 specificity: Herceptin^™; Trastuzumab.

[0137] Antibody variable regions can also be conjugated to a wide range of protein domains. Fusion with human immunoglobulin domains such as CH3 IgG1 both increases mass and stimulates dimerization. See. Hu et al., 1996. Fusion to human Ig Fc hinge regions may add effector functions. Also, fusion to heterologous protein domains from multimeric proteins stimulates multimerization. For example, short scFv fusion to short amphipathic helices has been used for the production of miniantibodies. See. Pack and Pluckthun, 1992. Domains from proteins that form heterodimers, such as fos / jun, can be used to produce bispecific molecules (Kostelny et al., 1992) and, alternatively, homodimerization domains can be engineered to form heterodimers using engineering strategies such as " knobs-intoholes ”[creating protrusions matching the holes] (Ridgway et al., 1996). Finally, fusion protein partner selection can be carried out that will provide both multimerization as well as an additional function, e.g. streptavidin. See. Dubel et al., 1995.

V. Delivery to cells competent for phagocytosis or endocytosis [0138] The invention further provides delivery by bringing minicells of bacterial origin into contact with mammalian cells that are competent for phagocytosis or endocytosis. Such mammalian cells that are able to absorb parent bacterial cells by intracellular bacterial pathogens similarly absorb minicells that release their content in the mammalian cell cytoplasm. This delivery approach can be carried out without the use of targeted ligands.

[0139] A number of mechanisms may be involved in the absorption of minicells by a given cell type, and the invention is not dependent in this respect on any particular mechanism. For example, phagocytosis is a well-documented process in which macrophages and other phagocyte cells, such as neutrophils, absorb particles by extending the pseudo-leg above the surface of the particle until the particle is completely absorbed. Although described as "non-specific" phagocytosis, specific receptors have been shown to be involved in the process. See. Wright and Jong (1986); Speert et al., (1988).

[0140] Thus, one form of phagocytosis requires interactions between surface ligands and ligand receptors located in pseudo-membrane membranes (Shaw and Griffin, 1981). This attachment step, regulated by specific receptors, is considered to be dependent on bacterial surface adhesives. For less virulent bacteria, such as nonenterotoxinogenic E. coli, phagocytosis may also occur in the absence of surface ligands for phagocyte receptors. See. for example. Pikaar et al. (1995). Hence, the invention includes, but is not limited to, the use of minicells that have, or do not, surface adhesins, in harmony with the nature of their parent bacterial cells, and are absorbed by phagocytes (i.e., "phagocytic competent" host cells) from which neutrophils and macrophages are the main types in mammals.

[0141] Another absorption process is endocytosis by which intracellular pathogens, for example the species Salmonella, Escherichia, Shigella, Helicobacter, Pseudomonas and Lactobacilli gain access to mammalian epithelial cells, where they are replicated. Two basic mechanisms in this regard are clrin-dependent endocytosis, regulated by the receptor, also known as "endocytosis of the coated [clrin] cavities" (Riezman, 1993) and clrin-independent endocytosis (Sandvig &amp; Deurs, 1994). One or both may be involved when the absorption-competent cell that acts by endocytosis (i.e., the "endocytosis-competent" host cell) absorbs minicells in accordance with the invention. Representative endocytosis-competent cells are breast epithelial cells, gastrointestinal enterocytes, gastric epithelial cells, lung epithelial cells, and urinary tract and bladder epithelial cells.

[0142] When conducting delivery to an absorbent competent mammalian cell without using a targeting ligand, the nature of the application contemplated will affect the choice of the bacterial source of the minicells used. For example, Salmonella, Escherichia and Shigella species carry adhesins, which are recognized by endocytotic mediators on enterocytes in the gastrointestinal tract, and may be suitable to provide a drug that is effective against colon cancer cells. Similarly, minicells derived from Helicobacter pylori, bearing adhesins specific for gastric epithelial cells, may be suitable for delivery of cells targeted for gastric cancer. Inhalation or insufflation may be ideal for administering intact minicells derived from the Pseudomonas species, which carries adhesins recognized by receptors on lung epithelial cells. Minicells derived from Lactobacilli that carry adhesins specific for the epithelial cells of the urinary tract and the bladder can be well suited to deliver the drug to the urethra for urinary tract cancer or bladder cancer.

VI. Formulations [0143] The invention includes within the scope of compositions or formulations as defined above. The functional nucleic acid can be any of the siRNAs, shRNAs, ribozymes or antisense molecules described herein. The functional nucleic acid may also be encoded by another nucleic acid, such as a plasmid, as described herein. The nucleic acid encoding the functional nucleic acid may have any of the regulatory elements or reporter elements as described herein.

[0144] The formulation optionally comprises a drug as described herein. Preferably, the minicell of the formulation comprises a drug. Alternatively, the minicell may contain a nucleic acid molecule, such as a plasmid that encodes the drug.

[0145] Thus, formulations containing a minicell preferably contain less than about 1 contaminating bacterial parent cell per 10⁷ minicells, more preferably contain less than about 1 contaminating parent bacterial cell out of 10⁸minicells, even more preferably contain less than about 1 contaminating parent bacterial cell out of 10⁹ minicells, even more preferably contain less than about 1 contaminating parent bacterial cell out of 10¹⁰ minicells and most preferably contain less than about 1 contaminating parent bacterial cell in 10¹¹ minicells.

[0146] As defined above, the formulations also contain a bispecific ligand for targeting the minicell to the target cell. The minicell and ligand may be any of those described herein. Hence, the minicell contains a nucleic acid encoding a functional nucleic acid and the bispecific ligand is capable of binding to the surface component of the minicell and to the surface component of the target mammalian cell.

[0147] A formulation consisting essentially of minicells and, optionally, drugs may be prepared according to the invention (i.e., a formulation that includes such minicells, drugs and ligands with other components that do not interfere excessively with the nucleic acid or drug delivery properties of the composition) , in a conventional manner using one or more pharmaceutically acceptable carriers or excipients.

[0148] The formulations can be presented in unit dosage form, e.g., in ampoules or vials, or in multi-dose containers, with or without a preservative added. The formulation may be in the form of a solution, suspension or emulsion in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. A suitable solution is isotonic with the recipient's blood and is illustrated by physiological saline solution, Ringer's solution and dextrose solution. Alternatively, the formulations may be in the form of a lyophilized powder, for reconstitution with a suitable excipient, e.g. sterile pyrogen-free water or saline solution. The formulations can also be in the form of a tissue preparation. Such long-acting formulations can be administered by implantation (e.g., subcutaneous or intramuscular) or by intramuscular injection.

A. Routes of administration [0149] The formulations of the invention may be administered by various routes and to different locations in the mammalian body to achieve the desired therapeutic effect, local or systemic. Delivery can be achieved, for example, by oral administration, by administration of the formulation into the body cavity, by inhalation or insufflation, or by parenteral, intramuscular, intravenous, portal vein, intrahepatic, peritoneal, subcutaneous, intraocular or intradermal administration. The mode and place of administration depend on the location of the target cells. For example, cystic cells with fibrosis may be an effective target for inhaled delivery of targeted minicells. Similarly, tumor metastasis can be more effectively treated by intravenous delivery of targeted minicells. Primary ovarian cancer can be treated by intraperitoneal administration of targeted minicells.

B. Purity [0150] The minicells of the invention are substantially free of contaminating bacterial stem cells. Hence, the minicell containing formulations of the invention preferably contain less than about 1 contaminating bacterial parent cell per 10⁷ minicells, more preferably contain less than about 1 contaminating parent bacterial cell out of 10⁸ minicells, even more preferably contain less than about 1 contaminating parent bacterial cell out of 10⁹ minicells, even more preferably contain less than about 1 contaminating parent bacterial cell out of 10¹⁰ minicells and most preferably contain less than about 1 contaminating parent bacterial cell in 10¹¹ minicells.

[0151] Methods for purifying minicells are known in the art and described in WO 03/033519. One such method combines cross-flow filtration (the feed flow is parallel to the membrane surface; Forbes, 1987) and dead-end filtration [with unidirectional flow] (the feed flow is perpendicular to the membrane surface). Optionally, the combination of filtration may be preceded by differential centrifugation, at low centrifugal force, to remove some of the bacterial cells and, as a consequence, enrich the supernatant with minicells.

[0152] Another purification method uses density gradient centrifugation in a biologically compatible medium. After centrifugation, the minicell band collects from the gradient, and, optionally, the minicells are subjected to successive rounds of density gradient centrifugation to increase purity. The method may further comprise the initial step of conducting differential centrifugation on the sample containing minicells. When running at low centrifugal force, differential centrifugation will remove some of the parent bacterial cells, thereby enriching the supernatant with minicells.

[0153] Particularly effective purification methods use bacterial filaments to increase the purity of minicells. Hence, the minicell purification method may comprise the steps of (a) subjecting a minicell containing sample to a condition that induces the bacterial cell to assume a filamentous form, followed by (b) filtering the sample, to obtain a purified minicell preparation.

[0154] Known methods for purifying minicells may also be combined. One highly effective combination of methods is as follows:

Step A: Differential centrifugation of minicell-producing bacterial cell culture. This step, which can be carried out at 2000 g for about 20 minutes, removes most parent bacterial cells while leaving the minicells in the supernatant.

Step B: Density gradient centrifugation using an isotonic and non-toxic medium for making a density gradient. This stage separates minicells from many contaminants, including stem bacterial cells, with minimal loss of minicells. Preferably, this step is repeated as part of the purification method.

Step C: Cross-flow filtration through a 0.45 μm filter to further reduce parental bacterial cell contamination.

Step D: Stress-induced fibrin formation in other bacterial stem cells. This can be done by subjecting the minicell suspension to any of several stressful environmental conditions.

Step E: Antibiotic treatment to kill stem bacterial cells.

Step F: Cross-flow filtration to remove minor impurities such as membrane vesicles, membrane fragments, bacterial residues, nucleic acids, nutrient components etc., and to concentrate minicells. A 0.2 μm filter can be used to separate minicells from fine contaminants, and a 0.1 μm filter can be used to concentrate minicells.

Step G: Dead-end filtration to remove filamentous dead bacterial cells. A 0.45 μm filter can be used at this stage.

Step H: Removal of endotoxins from the minicell preparation. Anti-lipid A coated magnetic beads can be used at this stage.

C. Administration regimens [0155] In general, the formulations disclosed herein can be used in appropriate dosages, as defined in routine tests, to obtain an optimal physiological effect, while minimizing any potential toxicity. The dosage regimen can be selected in accordance with a number of factors, including patient age, weight, gender, and health; severity of the condition for treatment, route of administration, and renal and hepatic function of the patient.

[0156] Optimal precision in achieving minicell and drug concentrations in a range that gives maximum efficacy with minimal adverse effects may require a regimen based on minicell kinetics and drug availability for target sites and target cells. The distribution, balance and removal of minicells or the drug may be considered when determining the optimal concentration for the treatment regimen. The dosage of minicells and drugs can be adjusted, when used in combination, to achieve the desired effect.

[0157] In addition, the administration of the doses of the formulations can be optimized using a pharmacokinetic / pharmacodynamic modeling system. For example, one or more dosage regimens can be selected, and a pharmacokinetic / pharmacodynamic model can be used to determine the pharmacokinetic / pharmacodynamic profile of one or more dosage regimens. One dosage regimen can then be selected for administration for which the desired pharmacokinetic / pharmacodynamic response is achieved based on the particular pharmacokinetic / pharmacodynamic profile. See. e.g. WO 00/67776.

[0158] Specifically, the formulations can be administered at least once a week over several weeks. In one embodiment, the formulations are administered at least once a week for several weeks to several months.

[0159] More specifically, the formulations can be administered at least once a day for about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24, 25, 26, 27, 28,

29, 30 or 31 days. Alternatively, the formulations can be administered about once a day, about once in 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 days or more.

[0160] The formulations may alternatively be administered about once a week, about once every 2,

3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 weeks or more. Alternatively, the formulations can be administered at least once a week for about 2, 3, 4, 5,

6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 weeks or more.

[0161] Alternatively, the formulations may be administered about once a month, about once every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months or more.

[0162] The formulations can be administered in a single daily dose, or the total daily dosage can be administered in divided doses of two, three or four times a day.

[0163] In a method in which minicells are administered prior to drug delivery of the drug may occur at any time, from several minutes to several hours after administration of the minicells. Alternatively, the drug can be administered at any time, from several hours to several days, potentially several weeks up to several months after the minicells.

[0164] More specifically, minicells may be administered at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23 or 24 hours before the drug. In addition, minicells may be administered at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 days before drug administration. Minicells may be administered at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 weeks or more before drug. Minicells may be administered at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months before drug.

[0165] In another embodiment, the minicell is administered after the drug. Minicells may be administered at any time, from a few minutes to several hours after administration. Minicells can alternatively be administered at any time, from several hours to several days, potentially several weeks up to several months after the drug.

[0166] The following examples are illustrative only, and are not limiting, and provide a more complete understanding of the invention. The examples demonstrate that drug-resistant tumor cells can be successfully treated in vivo by (1) administration of targeted recombinant minicells carrying RNAi sequences designed to reduce or eliminate expression of the gene (s) encoding drug resistance and (2) administration of targeted drug-packed minicells carrying drug, to which cancer cells have been sensitized.

Example 1. Plasmids for the expression of anti-MDR1 and anti-bcl-2 shRNA and purification of recombinant minicells.

[0167] Recombinant minicells carrying plasmids encoding shRNA sequences (Mdr1 or bcl-2) were generated as follows. The Mdr1 shRNA sequence used in this study was described by Wu et al., 2003 (5'-TCGA AAGAAACCAACTGTCAGTGTA gagtactg TACACTGACAGTTGGTTTCTT TTTTT-3 ') (SEQ ID NO: 1) and the snRNA bcl-2 sequence used was as described in Wacheck et ., 2003 (5'TCGATGTGGATGACTGAGTACCTGA gagtactg TCAGGTACTCAGTCATCCACATTTTT-3 ') (SEQ ID NO: 2). The respective shRNA sequences were synthesized and individually subcloned into the IMG-800 plasmid (Imgenex Corp., San Diego, CA, USA) so that the sequences could be expressed from the U6 plasmid promoter. The plasmid carries the pUC origin of replication, which allows achieving a large number of plasmid copies in bacterial cells. The recombinant plasmids were sequenced to ensure that the shRNA sequences were correct and in reading frame for expression from the U6 promoter. The recombinant plasmids were transformed into the mutant S. typhimurium minCDE strain and the minicells carrying plasmids were purified as described in US7611885. The recombinant minicells were designated as minicell TurkishRNA-MDR1 and minicell TurkishRNA-bcl2, respectively.

Example 2. Demonstration of receptor-driven recombinant delivery of plasmid shRNA via minicells to drug-resistant cancer cells and inversion of drug-resistance in vitro.

[0168] When siRNAs directed against a variety of drug-coding transcripts have been shown to reverse drug resistance in cancer cells in vitro, targeted delivery of siRNA to cancer cells, particularly in vivo, is a critical obstacle. Recombinant minicells harboring the anti-MDR1 shRNA plasmid (minikomórkishRNA-MDR1) and shRNA control against the nonsense RNA sequence (minikomkishkishRNA-nonsense) were purified and a bispecific antibody that produced specificity against the S. typhimurium antigen and anti-human recombinant EGFR was described and added in patent application WO 2005/056749. Targeted recombinant minicells were designated as^EGFRminikomórkishRNA-MDR-1 and ^EGFRminikomórkiShRNA-nonsense. Minicells packed with chemotherapeutics 5-FU and irinotecan were also obtained, oriented as above and designated as^EGFR5-FU minicells and ^EGFRminikomórkiIryno.

[0169] The Caco-2 human colon cancer cell line (ATCC), which is highly resistant to irinotecan and 5-FU, was selected for this in vitro study primarily to determine if EGFR-targeted recombinant minicells could successfully provide plasmids shRNA to cancer cells and secondly, whether expression of anti-MDR-1 siRNA can reverse drug resistance and make Caco-2 cells sensitive to EGFR-targeted and drug-packed minicells. Caco-2 cells were inoculated at 3 x 10⁶ cells per flask with Minimum Essential Medium, 10% cosmic calf serum and incubated for 3 hours at 37 ° C, 5% CO2.

[0170] Cells were treated ^EGFRminicellish RNA-MDR-1, and (b) ^EGFRminikomórkamishRNA-nonsense. A control flask was included without any treatment. Minicells were added at a concentration of 10¹⁰ per flask, and all flasks were incubated for 72 hours. Cells from each treatment were trypsinized and seeded at 1x10⁴ cells / ml / well in 24 well plates and incubated for 3 hours. at 37 ° C, 5% CO2. The control from untreated cells was then incubated with (6 wells / treatment) (a) free irinotecan (25 μM), (b) free 5-FU (25 μM), (c)^EGFRIrino minicells, and (d) ^EGFRminikomórkami5-FU.

[0171] EGFRminicamish RNA-MDR-1-treated Caco-2 cells were incubated with (6 wells / treatment) (a) ^CMV5-FU minicells (non-specific as the bispecific antibody is a surface protein on cytomegalovirus), (b) free irinotecan, (c) free 5-FU, (d) ^EGFRminicells Iryno, and (e) ^ERFRminikomórkami5-FU. treated^EGFRminicell Rish-nonsense Caco-2 cells were then treated ^EGFRminikomórkami5-FU.

[0172] All cells were incubated for another 72 hours, followed by a colorimetric MTT cell proliferation assay (Cory et al., 1991) using CellTiter 96 AQueous One Solution cell proliferation assay (Promega Corp., Madison, WI, USA), according to the manufacturer's instructions. Colorimetric measurements were read at 490 nm.

[0173] The results showed that (Fig. 1) Caco-2 cells were highly resistant to first-line chemotherapy drugs for colon cancer, i.e. irinotecan and 5-FU. In addition, the cells remained resistant after treatment^EGFRminikomórkamiIryno, ^EGFRminicells 5-FU and ^EGFRminikomórkamishRNA-MDR-1. Cells that received double treatment, i.e.^EGFRminikomórkishRNA-MDR-1 and then ^EGFRminicells or ^EGFR5-FU minicells showed that this treatment was highly effective in reversing drug resistance, and deaths&gt; 50% of the cells were observed after a single combination of treatments. Contrast and double treatment^EGFRminicells SHRNA-nonsense and then ^EGFR5-Fu minicells had no effect on drug resistance, suggesting that expression of anti-MDR-1 shRNA in Caco-2 cells was specifically responsible for reversing drug resistance. Combination of treatment^EGFRminishocellish RNA-MDR-1 followed by free irinotecan or 5FU was also effective in reversing drug resistance, but to a lesser extent resulting in a ~ 30% reduction in cell survival. These data also suggest that delivery of a chemotherapeutic agent through receptor-driven and drug-unpacked minicells may provide a higher concentration of the drug intracellularly compared to free drug provided in an extracellular environment.

[0174] This result showed that (a) shRNA can be effectively delivered to non-phagocytic mammalian cells via receptor-driven recombinant minicells, (b) functional nucleic acid (shRNA) encoding plasmids escapes from intracellular organelles in which minicells are broken down, ( c) the plasmid is transported to the mammalian cell nucleus in which the shRNA is expressed, (d) shRNA is effective in degrading the mRNA encoding the multi-drug resistance protein, MDR-1, (e) the same mammalian cells are sensitive to the next wave of receptor-driven minicells that now carry drug instead of plasmid, (f) double treatment protocol, i.e. delivery of shRNA via receptor-driven minicells, followed by delivery of chemotherapeutic via receptor-driven minicells highly effective in reversing drug resistance in non-phagocytic mammalian cells.

Example 3. Demonstration in vivo tumor regression achieved by the method of the invention i.e. double treatment via receptor-driven shRNA delivering minicells followed by drug delivery via minicells.

[0175] This example demonstrates that receptor-driven minicells can be used to reverse drug resistance in cancer cells in vivo.

[0176] S. typhimurium-derived minCDE minicells were purified and packaged with irinotecan. 7 x 10⁹ the minicells in the BSG solution were centrifuged, the supernatant discarded, and the minicells were resuspended in 940 μl BSG and 60 μl irinotecan solution (1 mg / ml; dissolved in sterile distilled water). The suspension was incubated overnight at 37 ° C with rotation to allow irinotecan to diffuse into the minicell cytoplasm. Excess irinotecan unspecifically bound to the outer surface of the minicells, and was then washed by ultrafiltration of the cells with mixing as follows. Stirring Amicon ultrafiltration chamber, model 8010 (Millipore, Billerica, MA, USA) assembled according to the manufacturer's instructions, with an ultrafiltration membrane disk (polyethersulfone; molecular weight cut-off at 300 kDa; Millipore). The cells were washed three times with sterile distilled water and then three times with BSG successively. The chamber was then filled with 9 ml fresh BSG and 1 ml minicell packed with irinotecan solution was added. The chamber was held at 10 psi, stirred until the volume was reduced to 5 ml, and covered with 5 ml BSG. Ultrafiltration was continued until the volume again fell to 5 ml. The cover / ultrafiltration procedure was performed 6 times to allow thorough washing of the outer surfaces of irinotecan-packed minicells. During the last ultrafiltration, the volume was reduced to 1 ml, and the sample was transferred to a sterile Eppendorf tube, and then centrifuged at 13,200 rpm for 10 minutes, pelleted with irinotecan-packed minicells.

[0177] A bispecific antibody was constructed as described above and in published US Patent Application No. 2004-0265994. Briefly, anti-lipopolysaccharide. typhimurium (Biodesign, Saco, Maine, USA) and anti-human epidermal growth factor receptor (EGFR) mouse monoclonal antibodies (Oncogene Research Products, Cambridge, MA, USA) were combined with purified recombinant A / G protein via the Fc fragments of each monoclonal antibody . The anti-EGFR monoclonal antibody was selected because the xenograft cells were human colon cancer (Caco-2) cells that are known to overexpress EGFR on the cell surface (Nyati et al., 2004).

[0178] Purified recombinant A / G protein (Pierce Biotechnology, Rockford, IL, USA) was diluted to a final concentration of 100 μg / ml in Immunopure binding buffer (Pierce Biotechnology) and 0.5 ml of the solution was incubated overnight at 4 ° C with pre a mixed solution containing 20 μg / ml of each of the anti-5 monoclonal antibodies. typhimurium LPS and anti-human EGFR. Excess antibody unbound to protein A / G was then removed as follows. Dynabeads® G protein solution (Dynabeads® [2.8 μm] coated with recombinant G Protein covalently coupled to the surface of magnetic beads; Dynal Biotech, Oslo, Norway) was gently mixed and transferred 100 μ 100 of solution into an Eppendorf centrifuge tube. The tube was placed in Dynal MPC-S (magnetic particle concentration device, type S) to immobilize the beads, and the supernatant was discarded. The beads were resuspended in 0.5 ml of washing solution containing 0.1M Na-phosphate buffer (pH 5.0). The steps of immobilizing the balls and washing up were repeated three times. The solution containing the protein A / G-bispecific antibody mixture was added to the beads and incubated with gentle agitation at room temperature for 40 min. The tube was placed on an MPC-S rack for ball immobilization and protein A / G-bispecific antibody removed by pipette. This step eliminated the unbound excess of monoclonal antibodies and provided a solution that carried the A / G protein bispecific antibody via their Fc fragments. Recombinant minicells were incubated with protein A / G-bispecific antibody for 1 hour. at room temperature to coat minicells with antibody via its anti-LPS Fab region.

[0179] The mice used in this example were purchased from the Animal Resources Center (Perth, WA, Australia), and all animal experiments were carried out in accordance with the guidelines for the care and use of laboratory animals, after approval by the Animal Ethics Committee. The experiments were carried out in a small animal facility with NSW Agriculture accreditation at EnGeneIC Pty Ltd (Sydney, New South Wales, Australia). Human colon cancer cells (Caco-2, ATCC) were cultured in tissue culture in RPMI 1640 medium supplemented with 5% bovine calf serum (GIBCO-BRL Life Technologies, Invitrogen Corporation, Carlsbad, CA, USA) and glutamine (Invitrogen) in the atmosphere with humidification, with 95% air and 5% CO2 at 37 ° C. 1 x 10⁶ cells in 50 μl serum-free medium were mixed with 50 μl reduced matri gel (BD Biosciences, Franklin Lakes, NJ, USA) and injected subcutaneously between the blades of each mouse using a 23G needle. Tumors were measured twice a week using an electronic digital caliper (Mitutoyo, Japan, accuracy of 0.001) and the mean tumor volume was calculated using the formula, length (mm) x width² (mm) X 0.5 = volume (mm³). Various therapies were initiated after tumors reached volumes between 50 mm³ and 80 mm³, and mice were randomized to eight different groups of 11 per group.

[0180] Different groups received the following treatment: Group 1 (control) received no treatment. Group 2 (control), free irinotecan (1.2 x 10⁴ ng / g mouse body weight ~ 2.4 x 10⁵ ng per mouse), intravenously. This control was included to confirm in vitro results that the tumor cells were drug resistant. Group 3 (control), EGFR targeted, irinotecan-extracted minicells (designated as^EGFRminikomórkiIryno). Group 4 (control),^EGFRminikomórkishRNA-MDR-1. Group 5 (control),^EGFRminikomórkishRNA-bcl-2. Group 6 (control),^EGFRminikomórkishRNA-MDR-1 followed by free irinotecan. Group 7 (experimental),^EGFRmini-cells hRNA-MDR-1, then ^EGFRminikomórkiIryno. Group 8 (expt.),^EGFRminicells SHRNA-bcl-2, then ^EGFRminikomórkiIryno. Quantitative studies with irinotecan by HPLC showed that 5 x 10⁸ minicells packed ~ 80 ng of drug. All minicell treatments included 5 x 10⁸ minicells, and shRNA treatment was administered on days 9 and 23. All drug treatments were administered on days 15, 18, 29 and 32. This provided a six-day interval between shRNA treatment and the drug to ensure that sufficient time had passed for intracellular and nuclear delivery shRNA, gene expression and suppression of drug-regulating protein expression, i.e. MDR-1 or bcl-2.

[0181] The results revealed (Fig. 2) a striking contrast between mean tumor volumes in control groups (G 1 to 6) and experimental groups (G 7 and 8). Tumor volumes in the experimental groups stabilized rapidly and showed significant stabilization in most of the 11 animals in each group. In contrast, mean tumor volumes in all other control groups continued to increase, and by day 36 after the xenograft establishment the experiment was terminated because the control animals were too diseased. Experimental animals, on the other hand, were healthy and showed no toxic side effects from treatment. Statistical analysis of the data using one-way ANOVA showed that the experimental groups (7 and 8) were highly significant compared to control groups 1 to 6 (p = 0.0004). This result is the first demonstration of targeted in vivo delivery of shRNA to address the serious problem of drug resistance in cancer. The result also demonstrated that the invention is generally applicable because two mechanistically different drug resistance methods, i.e. overexpressed membrane-associated pump protein (MDR-1) and cytoplasmic anti-apoptotic protein (bcl-2) may be down-regulated in drug-resistant cancer cells in vivo. Treating the same cells with another wave of receptor-driven, chemically therapeutic-packed minicells could effectively treat such cancers.

Example 4. A second demonstration in vivo of the tumor regression efficacy achieved by the method of the invention, i.e. double treatment via shRNA minicells followed by drug delivery minicells.

[0182] Colorectal cancer cells are also known to be highly resistant to another first-line chemotherapeutic agent, 5-fluorouracil (5-FU), and this example shows that the methods of the invention not only allow reversal of drug resistance in vivo but also enable tumor stabilization / regression to be achieved.

[0183] As described above, minicells were obtained from the mutant S. typhimurium minCDE strain and purified using gradient centrifugation / filamentation / filtration / endotoxin removal procedure. Similarly, recombinant minicells carrying plasmids shRNA, shRNA-MDR-1, shRNA-bcl-2 and shRNA-nonsense were prepared and purified from the relevant recombinant S. typhimurium minCDE strains. The purified empty minicells were unpacked with 5-FU chemotherapeutic agent as described for irinotecan in Example 3. HPLC analysis was used to determine the concentration of 5-FU packed in minicells.

[0184] A bispecific antibody containing dual anti-human EGFR specificity and an S. typhimurium anti-antigen was constructed as described in Example 3. Recombinant minicells (10¹⁰) were incubated with the bispecific antibody for 1 hour at room temperature to coat the minicells with the antibody via its Fab region of the anti-O antigen.

[0185] Caco-2 cell line xenografts were established in Balb / c nude mice and after tumors reached a volume of between 50 mm³ and 80 mm³, mice were randomized into 10 groups (n = 11 mice per group). Intravenous treatment included: (a) G1 - only control - cancer. G2 (control), free 5-FU (5 x 10⁴ ng / g mouse body weight ~ 1 x 10⁶ ng per mouse). This control was included to confirm in vitro results that the tumor cells were drug resistant. G3 (control), EGFR targeted, 5-FU unpacked minicells (designated as^EGFRminikomórki5-FU). G4 (control),^EGFRminikomórkishRNA-MDR-1. G5 (control),^EGFRminikomórkishRNA-bcl-2. G6 (control),^EGFRminikomórkishRNA-MDR-1, then ^CMVminikomórki5-FU. The CMV antibody is surface-targeted on the cytomegalovirus and serves as a non-specifically targeted control. G7 (control),^EGFRminikomórkishRNA-nonsense, then ^EGFRminikomórki5-FU. G8 (control),^EGFRminikomórkishRNA-MDR-1 followed by free 5-FU. G9 (expt),^EGFRminicells SHRNA-MDR-1, then ^EGFRminikomórki5-FU. G10 (expt),^EGFRminicells SHRNA-bcl-2, then ^EGFRminikomórki5-FU. All shRNA treatments were administered on days 9 and 23, and drug treatment was given on days 15, 18, 29 and 32. This provided a six-day interval between shRNA and drug treatment to ensure that sufficient time had elapsed for intracellular and nuclear shRNA delivery, expression gene and suppression of drug-regulating protein expression, i.e. MDR-1 or bcl-2.

[0186] The results revealed (Fig. 3) a striking contrast between mean tumor volumes in control groups (G 1 to 8) and experimental groups (G 9 and 10). Tumor volumes in the experimental groups stabilized rapidly in most of the 11 animals in each group. In contrast, mean tumor volumes in all other control groups continued to increase, and by day 36 after the xenograft establishment the experiment was terminated because the control animals were too burdened with the disease. Experimental animals, on the other hand, were healthy and showed no toxic adverse effects of treatment. Statistical analysis of data using one-way ANOVA showed that the experimental groups (9 and 10) were highly significant compared to control groups 1 to 8 (p = 0.0008).

Example 5. Demonstration of tumor regression in vivo achieved in doxororubicin resistant human breast cancer cells by the method of the invention.

[0187] The inventors have shown that the human breast adenocarcinoma cell line, MDA-MB-468 is highly sensitive to doxororubicin, and that murine xenograft treated xenografts ^EGFRminicells of Dox are stabilized / regressed.

[0188] In this example, MDA-MB-468 cells were cultured in tissue culture and treated with increasing Dox concentrations to obtain a Dox resistant clone. It is well established that such drug treatment in vitro and in vivo increases the expression of multi-drug resistance proteins such as MDR-1 and bcl-2. Several Dox resistant clones were obtained, and one was used to establish xenograft in Balb / c nude mice. Intravenous groups (n = 11 mice per group) included G2 -^EGFRminicellsDox and G3 - ^EGFRminikomórkishRNA-MDR-1, then ^EGFRminikomórkiDox. G1 mice were only tumor control. ShRNA treatment was given on day 21 and drug treatment was given on day 27, 34 and 41.

[0189] The results showed (Fig. 4) that treatment ^EGFRminicellish RNA-MDR-1, then ^EGFRminicellsDox in G3 mice was highly effective in reversing Dox resistance in cancer cells, and that tumors stabilized. Control treatment^EGFRminicellsDox (G2) showed that the tumor cells were highly resistant to Dox and the tumors grew rapidly.

Example 6. Demonstrating in vivo the effect of dosing regimens on reversal of drug resistance and therapeutic effect.

[0190] This example demonstrates the effect of dosing regimens on reversal of drug resistance and therapeutic effect. Ensuring sufficient time for effective delivery of shRNA to tumor cells prior to administration of receptor-driven, drug-packed minicells improves results. A time course experiment was made, however^EGFRminikomórkishRNA-MDR-1 was administered intravenously in nude mice bearing Caco-2 xenograft cells. In separate groups (n = 11 mice per group), mice were dosed^EGFRminicells Irino after 96 hours (G3), 120 hours (G4) or 144 hours (G5) after treatment^EGFRminikomórkamishRNA-MDR1. G1 and G2 were only tumor controls and free irinotecan (~ 2.4 x 10)⁵ ng / dose). Minicells were administered 5 x 10 each⁸ per dose and each dose had ~ 80 ng irinotecan packed in minicells, which is a dose 3,000-fold lower than that given as free drug. The results showed (Figure 5) a clear correlation between the time provided for shRNA expression and subsequent administration^EGFRIryno minicells, 144 hours (G5) were most effective in reversing drug resistance and achieving a significant therapeutic effect.

Example 7. A second demonstration in vivo of the effect of dosing regimens on reversal of drug resistance and therapeutic effect.

[0191] This example demonstrates that the effect of the dosing regimen observed in Example 6 has wide application.

[0192] The experiment described in example 6 was repeated with the same controls and experimental groups, except that G2 received free 5-FU (1x10⁶ ng / dose) and at G3, G4 and G5, the second treatment was carried out with ^EGFRminikomórek5-FU. Minicells were administered 1 x 10 each⁹ per dose and each dose was ~ 80 ng 540

FU, i.e. ~ 12,500 times less than free drug administered in G2 to mice.

[0193] The results showed (Fig. 6) that administration ^EGFR5-FU minicells after 144 hours after administration^EGFRminRells shRNA-MDR-1 (G5) resulted in maximum efficacy in reversing drug resistance and therapeutic efficacy. The potential of the invention is evident in the concentration of drug required for the successful treatment of these highly resistant tumors, as minicells carried 3,000-fold and 12,500-fold less drug compared to treatment with free irinotecan and 5-FU, respectively. Free drugs had no effect on tumor growth as observed in Figures 5 and 6.

Literature [0194]

Ambudkar, et al., Annu. Rev. Pharmacol. Toxicol. 39: 361 (1999).

Antoku, et al., Biochem. Biophys. Res. Commun., 286: 1003 (2001).

Ayesh et al., Anticancer Drugs, 7 (6): 678-86 (1996)

Ayesh et al., Biochim. Biophys. Acta, 1316 (1): 8-18 (1996)

Bakhshi, et al., Cell, 41: 899 (1985).

Bargou, et al., Int. J. Cancer, 60: 854 (1995).

Batra et al., Gene Ther. 1 (4): 255-60 (1994).

Becker et al., Cancer Biol Ther., 1 (5): 548-53 (2002).

Bredel, Brain Res. Rev., 35: 161 (2001).

Britton et al., Genes Dev., 12: 1254 (1998).

Broxterman et al., Cancer Lett., 35 (1): 87-95 (1987).

Brummelkamp, ​​et al., Science 296: 550 (2002).

Caplen, Expert Opin. Biol. Ther., 3 (4): 575-86 (2003).

Caplen and Mousses, Ann. NY Acad. Sci., 1002: 5 56-62 (2003).

Carter, P. Nat Rev Cancer, 1 (2): 118-29 (2001).

Chen, et al., Int. J. Cancer, 93: 107 (2001).

Ciliberto et al., Cell. 41: 531 (1985).

Cole et al., Science 258: 1650-1654 (1992).

Collins &amp; Olive, 32 Biochem. 2795-99 (1993).

Cory et al., Cancer Commun. 3: 207-212 (1991).

Cory, S. Annu. Rev. Immunol., 13: 513-543 (1995).

de Boer et al., J. Bacteriol. 174: 63 (1992).

de Haard, HJ et al. J. Biol. Chem. 274, 18218-18230 (1999).

Doige et al., Ann. Rev. Microbiol., 47: 291-319 (1993).

Dubel et al., J. Immunol. Methods, 178: 201-209 (1995).

Duan et al., Mol. Cancer Therapeutics, 3 (7): 833-38 (2004).

Duxbury et al., J. Am. Coll. Surg., 198: 953-59 (2004).

Elbashir et al., Genes Dev., 15 (2): 188-200 (2001).

Elbashir et al., Nature, 411 (6836): 494-8 (2001).

Endicott et al., Ann. Rev. Biochem., 58: 137-71 (1989).

Fardel et al., Gen Pharmacol., 27 (8): 1283-1291 (1996).

Forbes, Australian J. Biotechnology 1:30 (1987).

Frain et al., Mol. Cell Biol., 10: 991 (1990).

Frankel et al., Leukemia, 14: 576-585 (2000).

Gariboldi et al., Int. J. Oncology, 22: 1057-64 (2003).

Glennie et al., J. Immunol., 139 (7): 2367-75 (1987).

Gosselin et al., Biotechnol. Annu. Rev., 8: 103-31 (2002). Gottesman, et al., Nat. Rev. Cancer 2: 48 (2002).

Griffiths et al., EMBO J. 13: 3245-3260 (1994).

Guerrier-Takada et al., Cell, 35: 849 (1983).

Hampel and Tritz, Biochem., 28: 4929 (1989).

Hampel et al., Nucleic Acids Research: 299 (1990)

Hanada, et al., J. Biol. Chem., 270: 11962 (1995).

Hanahan, Nature, 315: 115 (1985).

Hannon, Nature (Lond.), 418: 244 (2002).

Harry, Mol. Microbiol., 40: 795 (2001).

Hart, Semin. Oncol., 23: 154 (1996).

Heim et al., Proc. Natl. Acad. Sci. USA, 91: 12501 (1994). Hiraga et al., J. Bacteriol., 171: 1496 (1989).

Hoshida et al., Pancreas, 25 (2): 111-21 (2002).

Hu et al., Cancer Res., 56: 3055-3061 (1996).

Hu et al., Mol. Microbiol., 34: 82-90 (1999).

Hunter et al., Mol. Cell. Biol., 16: 877 (1996).

Hudson &amp; Souriau, Expert Opin. Biol. Ther. 1: 845-855 (2001). Hudson &amp; Souriau, Nat. Med., 9 (1): 129-34 (2003).

Hung et al., Adv. Exp. Med. Biol., 465: 171-80 (2000).

Hutvagner &amp; Zamore, Curr. Opin. Genet. Dev., 12: 225 (2002).

Ireton et al., J. Bacteriol. 176: 5320 (1994).

Jones et al., Nature 321: 522-525 (1986).

Juliano &amp; Ling, Biochimica et Biophysica Acta, 455: 152 (1976).

Kaetzel et al., Biochem. Soc. Trance. 25: 475-480 (1997).

Karpovsky et al., J. Exp. Med., 160 (6): 1686-701 (1984).

Katabi et al., Human Gene Therapy 10: 155 (1999).

Kelsey et al., Genes and Devel. 1: 161 (1987).

Kleeff et al., Cancer Gene Ther., 9 (6): 522-32 (2002).

Knappik et al., J. Mol. Biol. 296: 57-86 (2000).

Kostelny et al., J. Immunol. 148 (5): 1547-53 (1992).

Kroemer, Nat. Med., 3: 614 (1997).

Kurane et al., JPN. J. Cancer Res. 89: 1212 (1998).

Leder et al., Cell 45: 485 (1986).

Lehnert, Eur. J. Cancer, A (6): 912-20 (1996).

Levin et al., J. Bacteriol. 174: 6717 (1992).

List, Oncology, 7 (10): 23-8, 32, 35-38 (1993).

List et al., J. Clin. Oncol., 11 (9): 1652-60 (1993).

Litman, et al., J. Cell Sci., 113: 2011 (2000).

Litman et al., Cell Mol. Life Sci., 58 (7): 931-59 (2001).

MacDonald et al., Hepatology 7: 425 (1987).

Mason et al., Science 234: 1372 (1986).

McCubrey, et al., Cell Cycle Checkpoints and Cancer, pp. 17-53. Georgetown, TX: Landes Bioscience, (2001a).

McCubrey, et al., Leukemia, 15: 1203 (2001).

Miller et al., J. Clin. Oncol., 9 (1): 17-24 (1991).

Morton &amp; Potter, J. Pharmacology &amp; Exper. Therapeutics 286: 1066 (1998).

Nieth et al., FEBS Letters, 545: 144-50 (2003).

Nyati et al., Clin Cancer Res. 10; 691-700 (2004).

Okada et al., Sci. Threshold. 77: 253 (1993-94).

Okada et al., J. Bacteriol. 176: 917 (1994).

Osbourn et al., Drug Delivery Tech., 8: 845-851 (2003).

Pack et al., Biochemistry, 31 (6): 1579-84 (1992).

Perrotta and Been, Biochem., 31: 16 (1992)

Pikaar et al., J. Infect. Dis. 172: 481 (1995).

Pinkert et al., Genes and Devel. 1: 268 (1987).

Prasher et al., Trends in Genetics 11: 320 (1995).

Raskin &amp; de Boer, J. Bacteriol. 181: 6419 (1999).

Readhead et al., Cell 48: 703 (1987).

Reeve &amp; Cornett, J. Virol. 15: 1308 (1975).

Ridgway et al., Protein Eng., 9 (7): 617-21 (1996).

Riezman, Trends in Cell Biology, 3: 330 (1993).

Rossi et al., Aids Research and Human Retroviruses, 8: 183 (1992)

Salomon et al., Crit. Rev. Oncol. Hematol., 19: 183-232 (1995).

Salveson et al., Cell, 91: 443 (1997).

Sandvig &amp; Deurs, Trends in Cell Biology, 4: 275 (1994).

Sato, et al., Proc. Natl. Acad. Sci. USA, 91: 9238 (1994).

Sattler, et al., Science (Wash. DC), 275: 983 (1997).

Saville &amp; Collins, Cell, 61: 685-96 (1990).

Saville &amp; Collins, PNAS (USA), 88: 8826-30 (1991).

Scheffer, et al., Curr. Opin. Oncol., 12: 550 (2000).

Sellers &amp; Fisher, J. Clin. Invest., 104: 1655 (1999).

Sharp, Genes Dev., 15: 485 (2001).

Shaw &amp; Griffen, Nature 289: 409 (1981).

Sheets et al., Proc. Natl Acad. Sci. USA, 95: 6157-6162 (1998).

Siould, "Therapeutic siRNAs," Trends in Pharmacological Sciences, 25 (1): 22-28 (2004).

Speert et al., J. Clin. Invest., 82: 872 (1988).

Stewart &amp; D'Ari, J. Bacteriol., 174: 4513 (1992).

Sun, et al., Biochem. Biophys. Res. Commun., 280: 788 (2001).

Swift et al., Cell, 38: 639 (1984).

Thurnher et al., Glycobiology, 4 (4): 429-35 (1994).

Todorovska et al., J. Immunol. Methods, 248: 47-66 (2001).

Tomlinson &amp; Holliger, Methods Enzymol., 326: 461-479 (2000).

U.S. Patent No. 3,817,837

U.S. Patent No. 3,850,752

U.S. Patent No. 3,939,350

U.S. Patent No. 3,996,345

U.S. Patent No. 4,275,149

U.S. Patent No. 4,277,437

U.S. Patent No. 4,366,241

U.S. Patent No. 4,496,778

U.S. Patent No. 4,987,071

U.S. Patent No. 4,975,278

US Patent No. 5,037,743 US Patent No. 5,143,830 US Patent No. 5,260,203 US Patent No. 5,455,030 US Patent No. 5,530,101 US Patent No. 5,585,089 US Patent No. 6,025,197 US Patent No. 6,639,055

US Published Patent Application No. 2004-0265994 Van Bambeke, et al., Biochem. Pharmacol. , 60: 457 (2000).

Vaughan, et al., Nature Biotechnol., 14: 309-314 (1996).

Vaughan et al., Nature Biotechnol., 16: 535-539 (1998).

Wachi et al., J. Bacteriol., 171: 6511 (1989).

Wang, et al., Nat. Med., 5: 412 (1999).

Wang et al., Proc. Natl. Acad. Sci. USA, 93: 7063-7068 (1996).

White &amp; McCubrey, Leukemia, 15: 1011-1021 (2001).

WO 81/01145

WO 88/07378 WO 95/21191 WO 00/67776 WO 05/056749

Wu, et al., Cancer Res., 63: 1515-19 (2003).

Wacheck, et al., Oligonucleotides, 13: 393 (2003).

Wright &amp; Jong, Experimental Medi., 163: 1245 (1986).

Yague et al., Gene Therapy, 11: 1170-74 (2004).

Ziady et al., Am. J. Physiol., 273 (2 Pt 1): G545-52 (1997).

SEQUENCE LIST [0195] &lt;110&gt; ENGENEIC MOLECULAR DELIVERY PTY LTD.

&lt;120&gt; SUPPLY OF FUNCTIONAL NUCLEIC ACIDS

FOR MAMMAL CELLS UNDER INTRADUCED

BACTERIAL ORIGIN MINICELLS &lt;130&gt; 060348-0121 &lt;140&gt; PCT / US05 / 30181 &lt;141&gt; 2005-08-25 &lt;150&gt; 60 / 604.433 &lt;151&gt; 2004-08-26 &lt;160&gt; 2 &lt;170&gt; PatentIn version 3, 3 &lt;210&gt; 1 &lt;211&gt; 59 &lt;212&gt; DNA &lt;213&gt; Artificially generated sequence &lt;220&gt;

&lt;223&gt; Description of the artificial sequence: synthetic oligonucleotide &lt;400&gt; 1 tcgaaagaaa ccaactgtca gtgtagagta ctgta_actg acagttggtt tcttttttt 59 &lt;210&gt; 2 &lt;211&gt; 59 &lt;212&gt; DNA &lt;213&gt; Sequence generated &lt;220&gt;

&lt;223&gt; Description of the artificial sequence: synthetic oligonucleotide &lt;400&gt; 2 tcgatgtgga tgactgagta cctgagagta ctgtcaggta ctcagtcatc cacattttt 59