Fgf21 mutants and uses thereof

ΜΑ 33716Β1

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00031.tif" id="idf0001" />

2012 FGF21 mutations and their use is based on the demand in precedence to the request for interim US Patent No. 61 / 175,736 to 1 Vida in the May 5, 2009, and asked the interim US Patent No. 61 / 285,118 Alnoda Desber 9 in 2009 , and they are combined here in full as a reference. 5 respect to the technical field of the invention Bdzenat DNA Thther poly peptides Tgrh FGF21; and chromatic peptide 1 T. mutation FGF21, a pharmacy and combinations that include peptides Tgrh FGF21, and ways to treat Adhlrapat Oahtih using such nuclear Alohamahish or urinary peptides or combinations Alheidlah. Background Altguenia 10 represents FGF21 Boulibptid sorting out the actual and which belongs to the sub - family of factors y 0 and Aroi fibrous (FGFs), which includes FGF21, FGF19 'and Itoh et al, 2004, FGF23 563-69 .Genetic}. Z FGF21 Ebarh 'z FGF Ir Zmhli as Ozhbatad &amp; lt ;, Alheibawin works Kahrmon in regulating glucose and fat metabolism and energy. FGF21 was isolated cDNA in compensation are set on KDE Zzz insignificant factor. 1 to 15 Zdezh genetically dramatically in the liver, pancreas and is the only member of the family of Ed FGF Lalai is one I sedate genetically mainly in the liver. Show Alphenran mutated and Ray snitch and i Apr 1 expression Eshr'h Z FGF21 metabolic phenotypes at a rate Nhu slow, low levels of Z Geloko-g plasma and Lamai Gelesarad, and the absence of diabetes are Type 2 age - related, and hyper Altzsj 1 Neri father. Dada administration pharmaceutical protein FGF21 gene Almatj for Ne Union Lugg and the return of the land and Alrvesaat 20 to levels that are measured in terms of c to Okoz plasma levels are Mkhidh H'a WSL and cholesterol, and Tgesl Mhacn glucose and insulin sensitivity. In addition Avi reminded 'reduces FGF21 Q body weight and body fat by increasing energy and make physical activity and the rate of Alod. Shower empirical research have called for the Aeta Pots 0 d FGF21 to treat trauma sugar Z Aaa WAP 2 and 1 Halal fat in the blood and gaffes or other metabolic disorders in humans. 25 d be FGF21 Bhariamr listen Alcann short in the neighborhood. In Alphenran, the lessons Alzhda g 1 FGF21 to Shri Ezrh Z 1 Avi 2 hours, and in Karodrdh, the half - life is 2.5 to 3 hours. When developing FGF21 protein for use in therapy for the treatment of trauma one thought g types 2, it will be Mzalmargob increase in half - life. I 'll let FGF21 Nat old proteins

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00032.tif" id="idf0002" />

2 2ΜΑ 33716Β1 migraine Alnarz give less frequent doses to patients are given protein. The description of such proteins in this application. Disclosure of the invention is detected poly peptide isolated comprised of a succession Hmkhr Amini of succession number: 4, and includes 5 Moreover: (a) the replacement of an amino acid and at least one in position 180; and (b) the replacement of an amino acid and at least one is selected from the group of Almkanh :(;) Assadbdal in position 171; and (AA) replace the position 98; and (d) Tokat 0 Zha. In a instantiations urinary peptide Almzul presented Adal Apr 1 includes the Brda 98 and Aladal in Mod 180 where: (a) substitution at position 98 is selected from the group consisting of 10-arginine, cystine, acid glutamic, glutamine, lysine, and threonine; and (b) Aladal in position 180 is chosen 0 n the group consisting of glycine, proline, serine, or glutamic acid; and (c 0) Nolevat than ever. In a structural unit instantiations be in position 98 is arginine and be structural unit in position 180 is a glutamic acid. The Oakhta provide poly Bouapd merger Tmdil Ena &amp; gt; Bonnebptid Hazzol integrated amino acid sequence is homogeneous. In a instantiations Wu ^ n succession acid asset Veer homogenized phrase Fc domain Oohzih of it, and can include 1- exponent of the sequence number: 11. In another embodiment the BMJ urinary peptide scope of Fc 0 n through 0.1 i Looney crimp Last Oahzia includes link Me GGGGSGGGGSGGGGS ( 1 st b RIP: 31) Ne - additional specific Oadia urinary peptide includes the sequence number: 47. Oakhia be detected MP and shipments include two or more poly-fusion peptides. Oevia be detected Z Nczykabh 20 pharmacy - Tech Bonnie peptide isolated factor pharmaceutically acceptable formulation, gel-like mane. On the other hand, it includes giving the patient Sabri Ne h 1 0 Li JH a pharmacy that is available here is the combination Nzver way to treat a metabolic disorder in a instantiations. Instantiations in a metabolic disorder is Ara z 1 Sugar In another embodiment a metabolic disorder is obesity. The Abouktatovir 1 encoded nuclear acids Bonnie peptide isolated in one instantiations includes nuclear A- sticking Halihno. 25: 46. Aekzan be DNA Mtoagdohmaql, Dson 1 st Gdaoucheh Ne cell family. In another embodiment Oevia, Punic includes Bbtalp folding: (a) Z-party Amini Z does not Dzdd Dhouhdatbmavehkamadosd ^ n Pony polypeptide able d ZZ 4 War fought in K 1 independent since Y, or (b) Czyb party Krbokciec for no more than 12 units constructivism acid Amive, Habh be

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00041.tif" id="idf0003" />

-3- ΜΑ 33716Β1 urinary peptide able pardoned text 8 rice 1 km in Cannon Shyi; or (c) Zdvedb Ohive party why not incite Z 8 building blocks of amino acid and pruning party carboxylic for no more than 12 units constructivism acid additional) where the urinary peptide able Presentation Khgd blood glucose in Cannon Idaa. In other embodiments are Oadia Nrabott Alparvi because thes placebo Bo one extent or more z Arvyr't '0 such as PEG. 5 In another embodiment, Athl 1 Buffy d 1 Vzul heavy Adal in 1 subject of 171 Adal in Ads 180 in that it: (a) are chosen replacement in position 180 from the group consisting 0 n glycine, proline, light of f glutamic; (b) short-Lader Aladal in Mod 171 &amp; lt ;, Almdjauah Adnnmn not 'arginine, asparagine, Aspartic acid, Sistine, glutamic acid, glutamine, Czykn, histidine, lysine, serine, threonine, tryptophan, and tyrosine; and (d) combinations of 10 that 0 Ne one a-data Den structural unit in position 171 is a glycine and be one unit Aldz Veh Apr 1 Awwada 180 is glutamic acid. The Oakhia provide poly Bouapd merger includes one of poly peptide Alhiol Akej Ha amino acid sequence is heterogeneous. In a instantiations can Ahin that Den Daye shaking Alohana heterogeneous a scale FC or fragment thereof, and d that Zchl on consecutive amino acid number: 11. Ne another embodiment of the BMJ polycarbonate However, the scope of the 15 Fc are Khurd 0.1 Duck In another embodiment Oakhia includes respond presented GGGGSGGGGSGGGGS (Mtwalahram: 31) ni a 1 Sedat birth includes Alibova d on a sequence number: 47. the AD 1 Lid Z Hbeb and DAT includes Ainin or more 0 n poly peptides Alandemaj- are detected Ed Z replies friendly Il d In peptide isolated factor formulation pissed pharmacist, gel-like weight Ne encouraged. The last; is to provide a method for the treatment of metabolic disorder, and in a way instantiations include 20 to 0 to give trauma Pfera Ne need Sedlah seen that combination is provided here. In a instantiations E. Dunn 1 disorder, but 0 allocating Dora p disease father Looney another embodiment be turmoil metabolic Dora Z Asamzh 0 is not to provide a nucleic acid Chther urinary peptide isolated in a instantiations sustains Alhed Akwoa presented obsolete number: 46. It can be found DNA in less' and Lalai It can be found in a cell's family itself. In the embodiment of additional Oehta Eshethl Hervé x Ely: (a) J 25 amino party to Malaesid 8 and DAT Rrkd S 'B Ryan Arne Lab for ADRA Z E.

Khgd blood glucose in Cannon Tdbouap; or (b) p Dave Krbodi to Malaesiden 12 Ozh I Bmaveh acid, amino, Dr. Dunn Capone 0 able Z Khhi stitching 1 blood in as one independent since Shyi; or (d) Chwib amino party to no more than about 8 and ^ s building of the amino acid and Dguenib Hlerv Rrs have not

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00051.tif" id="idf0004" />

-4- -4-ΜΑ 33716Β1 than Z 12 Lebanese alone to amino acid, where the urinary peptide able to Khgd blood glucose in the breasts Cannon in other embodiments Oadia urinary peptide Tzhaia one or more of Albolierat associated, such as

.PEG In - another 0 includes urinary peptide to replace in the position 98, the replacement of the position in 1715 Wade 1 for Ni-position 180 of the sequence number: 4 where: (a) are chosen replacement in position 171 Z group consisting of alanine, arginine, asparagine, Aspartic , cystine, glutamic acid, glutamine, &amp; lt; the Seine, Hsaitidin, lysine, serine, Threyoven, tryptophan, or tyrosine; (b) are selected Aladjaddal nee position 98 consisting of arginine group, cystine, acid Gelotahek, glutamine, lysine, or threonine; and (c) are my sister's 1 Aladalna Alhoda 180 Z Alahjmuhalhecozh 10 Z glycine, proline, serine or glutamic acid; and combinations of them. In one additional instantiations be one Constructivism to Odth in position 98 is arginine, and be unity Constructivism in position 171 is a glycine and be unity constructivism when lepers 180 Ebarh Z - Glutamic 0 last Oehta provide poly peptide fusion includes urinary peptide 1 to access Almzdahj u 1 Mechanism A- Alad Z Almottagas 0 Ne a instantiations be succession acid Alohana heterogeneous an Fc domain or Qa fragment of it, and could include the sequence of the amino acid 11: 0 in the embodiment of additional dunums 1 Sach urinary peptide scope of Fc through link in another embodiment Oahia includes R-1 Pt &amp; lt; , GGGGSGGGGSGGGGS (sequence number: 31). In a specific instantiations Aithamhl Punic peptide sequence on the number: 47. The Oevia detect many units it includes an Ace or pardoned Ashe Z Donny peptides integration. The Oeviaakoshv Azatrkpah pharmacy include Aralbrr peptide 1 Vzul factor 20 formulation of pharmaceutically acceptable, Shell Gel Mani. Ne other hand, is to provide a method for Amaalbh forced 1b loss in a instantiations include giving human patient Lalai j * d at 11 &amp; lt; of Jeremiah Zlay installation "of Pharmacy

It is provided here. In a instantiations Aladzerab metabolic be Ebarh RIP 1 u a chromatic-August last metabolically have an obesity. This is Oadia provide nuclear acids. 1 to issue a Bonnie peptide 1 Izul In a instantiations includes DNA sequence Ravi: 46. Sha that the acid would like Azhoy 0 Apr 25 or less, and IP Ahecn be in itself Mtoagdoua trot in the pot. Vetjsidakhroazaichl urinary peptide on: (a) Chwib Wahine party for no more than eight building blocks of acid Alode 1V have urinary peptide able presented Khgd blood glucose in Cannon mammal 0 or (b) Chandb party crap {cable to Malabzadan 12 units structural amino acid, where Boukon Albordbdddaadra shower Khhi Gelmuk 0 Iz

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00061.tif" id="idf0005" />

5 blood in Cannon mammal; or (d) Chwib flew amino why not exacerbate 8 building blocks - Alohive and pruning party carboxylic for no more than 12 units structural amino acid, where one of the poly Bddab able to Khgd blood glucose in Cannon mammal. In other embodiments are Aagia Trad urinary Ddbb covalently with one or more polymers, such as PEG.

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00071.tif" id="idf0006" />

Figures showing a- Abntanj experience Activity ELK- to Iossiferraz made to Tgr 1 T. Ttnab 7 &amp; quot; 181, FGF21, and 181-8 (Figure AA) and Tgrati_veb 01-172, FGF21 and 171-1 'and -110 169, and 164-1 (Figure August); each panel shows the results obtained by comparing a human FGF21. Figure 2 Ntanj shows experience Activity ELK- to Iossiferraz have been made to compare FGF21 Shri and Tgrat Chwib 3- 181, FGF21, and 181-4, and 181-5, and 181-7 E and 181-8 E and 180-1e and -1178, and 177-1, 176 1, 175-1, and 174-1, and 173-1, and 172-1, and 181-9, and 149-1. Figure 3 shows the blood glucose levels measured in mice Mahtonh by PBS (solid column), or 15 compared to human FGF21, (Mgtouh) column, or Tgrat Alchwib 8-181 FGF21 (gray column) and -9181 (chart) column. Figure 4 shows the percentage change levels in the blood glucose measured in mice injected with PBS (Downer solid), or compared to WT) FC-FGF21) (Downer Mgtouhh), or proteins BMJ -Fc FGF21 Mchenbh that include building blocks for amino acid 181-5 (solid triangles) or 20 181-7 (triangles Mgtouhh). Figure 5 shows the percentage of sperm to changing levels in blood glucose measured in mice injected with PBS (solid circles), or compared to WT) FC-FGF21) (Mgtouhh circles), or merge -Fc FGF21 lump protein containing the building blocks of the amino acid 175-1 (solid triangles), or merge FC-FGF21 protein containing a lump on the building blocks of amino Hmkhy 171-1 (triangles Mgtouhh). 25 Figures 6 O_ 6 d results chromatography analysis Alsand- mass spectrometry (LC-MS) sample compared -Fc G5) -FGF21) Beshla (Haahno.: 107) (only 6 a) and Eivat Fc- (G5) -FGF21 drawn are Vnran at 6 hours (sample D6; Figure 6 b), and at 24 hours (sample D24; Figure 6 c), and at 48 hours (sample D48; Figure 6 d) after injection.

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00072.tif" id="idf0007" />

-6- -6-ΜΑ 33716Β1 Figures 7 A- 7 d Ntanj LC-MS analysis of a sample compared FGF21- (G3) -Fc (sequence number: 105) derived from human mammal Cannon (Fig. 7a) and samples FGF21 (3) Fc drawn from Vnran at 6 hours (sample Ε6; Figure 7 b) E and at 24 hours (D24 sample; Figure 7 c), and at 48 hours (Ε48 sample; Figure 7 d) after injection. 5 Figures 8 O_ 8 d Ntanj analysis of LC-MS sample compared to the Fc (L15) FGF21 (Mtwalahno.: 49) (Fig. 8a) and samples Fc (L15) FGF21 drawn from Vnran at 6 hours (Figure 8b), and at 24 hours (Fig. 8c) a and 48 hours (Fig. 8d) after injection. Shapes 9 A- 9 d show Ntanj analysis of LC-MS sample Mtarnh FGF21- (L15) -Fc (sequence number: 41) (Fig. 9a) and samples one drawn from mice at 6 hours (Figure 9 b) .10 When 24 hours (Figure 9 c) , and 48 hours (Figure 9 d) after injection. Figures 10 (a) 0 August: show fission specific sites by LC-MS analysis of proteins merging 1 (Figure 10 A, the successive number: 49) 1 (Fig. 10 B, the successive number: 41) Ne injected mice. Figure 11 shows the blood glucose levels measured in Vnran injected by PBS (solid column) 0.15 1 (sequence number: 49) (Mgtouh) column, Ootgrat Fc (L15) -FGF21

Fc (L15) -FGF21 G170E (sequence number: 51) (gray column), or 1 Ρ171Α (Htoalahno.: 53) (dotted column), or Fc (L15) -FGF21 S172L (sequence number: 55) (Mgtouh diagonally shaded column crosswise), or Fc (L15) -FGF21- (G170E / P171A, S172L (sequence number: 59) (shaded Arhisha column horizontally Solid) or 1 20 (sequence number: 61) (Mgtouh column shaded diagonally crosswise.) shown in Fig. 12 percentage change in blood glucose levels measured Ne Vnran injected by PBS (Downer solid), or 1 (sequence number: 49) (Downer Mgtouhh), or Tgrat 1 Fc- (L15) -FGF21 G170E (sequence number: 51) ( six triangles), ^ Fc- (L15) -FGF21P171A (Htoalahno.: 53) (triangles Hgtouhh), or Fc- (L15) -FGF21 25 S172L (MTW Ahno. 1: 55) (Maanatmassath), or 1 G170Ε / Ρ171A / S172L (succession No: 59) (lozenges Mgtouhh), or 1 G151A (sequence number: 61) (solid squares). Figure 13 shows the blood glucose levels measured in mice injected with PBS (solid column)

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00081.tif" id="idf0008" />

ΜΑ 33716Β1 -6- 1 (sequence number: 49) (Ehod Mgtouh), or mutations Fc- (L15) -FGF21 will (Fc- (L15) -FGF21 (P150A, G151A, I152V rade) 'or _ (Fc- ( L15 FGF21 Gl 70Ε (sequence number: 51) (Mgtouh shaded column diagonally), or 1 (G170E, P171A) (sequence number: 63) (gray column shaded diagonally), or 1 5 (G170E, S172L) (sequence number: 67 ) (Aaud Mgtouh shaded diagonally). Figure 14 shows the percentage change in blood glucose levels measured in mice injected with PBS (solid squares), or mutations Fc- (L15) -FGF21 (sequence number: 49) (Hgtouhh boxes), or 1 T. families Fc- (L5) -FGF21 ^ Fc- (L15) -FGF21 1 (sequence number: 65) (solid triangles upside down), or _ (Fc- (L15 10 FGF21 G170E (sequence number: a 5) (Mosatmaobhizt), or 1 (G17.E.P171A) (Mtwalahno.: 63) (Downer solid), or Fc- (L15) -FGF21 1 (sequence number: 67) (Downer Mgtouhh). Figure 15 shows the blood glucose levels measured in Vnran injected by PBS (solid column), Aotgrat Fc- (L15) -FGF21 will Fc- (L15) -FGF21 G170E (RTM succession: 51) (column 15 ^ h) or Fc- (L15) -FGF21 G170A (H'bertm: 69) (Rade repelling) 'Fc- (L15) -J1 FGF21 G17.C (sequence number: 71) (Emod 0 0 silhouetted Gtouh), or Fc- (L15) -FGF21 G170D (RTM succession: 73) (covenants gray and white), or Fc- (L15) -FGF21 G170N (RTM succession: 75) (Amodmazll Massat), or G170S 1 (Htoalahno.: 77) (shaded column Mgtouh). 20 shown in Figure 16, the percentage change levels in the blood glucose measured in mice injected with PBS (Downer solid), or mutations b G170E 1 (Mtwalahno.: 51) (Duanrmgtouhh), or Fc (L15) -FGF21 G170A (^ 1 ^ 8 69 ) (solid triangles), or Fc- (L15) -FGF21 G170C (Htoalahno.h: 71) (Milthat Mgtouhh), or -Fc L15) -FGF21 G170D) (RTM succession: 73) (solid triangles), or 1 25 Ρ170Ν ( RTM succession: 75) (lozenges Mgtouhh), or Fc- (L15) -FGF21 G170S (solid inverted triangles). Figure 17 shows the levels of blood glucose measured in Vnran injected by PBS (solid column), or Alazrac Fc- (L15) -FGF21 will Fc- (L15) -FGF21 G170E (1 st Bertm: 51) (repel -8- ΜΑ 33716Β1 and h) E Fc- (L15) -FGF21 P171Ej1 (^ 1 ^ 8 79) (¥ gray) 4 Fc- (L15) -J1 FGF21 Ρ171Η (sequence number: 81) (Amodmazldesmt), or 5) -FGF21 P171Q; Fc- (L (sequence number: 83) (0 Gtouh shaded column), or Ρ171Τ 1 (sequence number: 85) (Spotted), or Fc- column (L15) -FGF21 Ρ171Υ (sequence number: 87) (shaded gray column) 0.5 shown in Fig. 18 percentage of Tver in blood glucose levels measured in mice injected with PBS (Doazsmth) Ootgrat 1 (Htoalahno.: 51) (Doadhirmgtouhh) E or Fc- (L15) -FGF21 Ρ171Ε (Mtwalahno.: 79) (triangles called), or Ρ171Η 9 (Htoalahno.: 81) (Mthelthatmgtouhh), or - (Fc- (L15 FGF21 P171Q (consecutive number: 83) (lozenges called), or Ρ171Τ 9 10 (Htoalahno.: 85) (Maanatmgtouhh), Fc- (L15) -FGF21 PiïlYjl (Mtwalahno.: 87) (solid squares) shows Alohkl 19 A. 19 Dztazj analysis y (Figure 19 termination sequence number: 49) and samples drawn from mice in a time of 6 hours (Figure August 9) E and 24 hours (Figure 19 g), and 48 hours (Figure 19 d ) after injection. 15 Figures 20 (a) 20 d results of the analysis LC-MS sample Mgarzh £ 0170 1 (bereavement 20a; 0 Twalah RTM: 51) and SAT Fc- (L15) -FGF21 G170E Z to Aran i time of 6 hours (Fig. 20b), and at 24 hours (Fig. 20 h; and at 48 hours (Figure 20 d) after injection. yen Alozqal 21 a- 21 d p 1 cat LC-MS b to Arla Fc- (L15) -FGF21 Ρ171Α 20 (Figure 21 a, Twab RTM: 53) and Eilot Fc- (L15) -FGF21 Ρ171A Q 6 PAHs and Az time of 6 hours (Fig. 21b), and at 24 hours (Figure 21 d), and at 48 hours (Fig. 21 d) after Alann. show Alozqal 22 a- 22 d brother s-LC-MS FH Drlo Fc- (L15) -FGF21 S172L ( Izql 22 Oicalahrtm: 55) and Att 172 of Fc- (L 15) -FGF21 Dh'n S-25 time of 6 hours (Figure 22 b), and at 24 hours (Figure 22 d) 'and 48 hours (Figure 22 d) after the injection. show Alohkl 23 (a) 23 d fission specific sites by LC-MS analysis of proteins integrate -Fc, (Fig. 23a, Alehtoalahno.: 49), Fc- (L15) -FGF21 G170E (Fig. 23

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00101.tif" id="idf0009" />

-9- -9-ΜΑ 33716Β1 burden Awalors 51) Fc- (L15) -FGF21 Ρ171Α (p. 23 D'walord. 53) Fc-j L15) -FGF21 S172L) (23 d bereavement, Almto Mechanism No. 1: 55) Rotant d c 0 0 Apr Vdhir'n fields. Figures 24 (a) 24 c Ntanj experience Activity ELK- to Iossiferraz made to Tgrat FGF21 'will FGF21 L99R (Earth 109)' FGF21 L99ÜJ (Earth 111) '5 and H't FGF21 will FGF21 Al 11Τ (Mtwalahno.: 113) (Study 24 a); and bodies FGF21 b FGF21 (sequence number: 115), FGF21 A129QJ (sequence number: 117), and FGF21 A134K (Htoalahno.: 119) (1 figure 24 b); and capacity FGF21 will FGF21 Α134Υ (Earth 121) 'FGF21 A134Ej (Earth 123)' FGF21 A129Kj (sequence number: 125) (Figure 24 d); show each plate results that have been obtained for a sample compared to 10 FGF21 mankind. Figures 25 (a) 25 d results to experience Activity ELK- to Iossiferraz made to Tgrat -Fc Fc- (L15) -FGF21 P171G ^ (L15) -FGF21 (and the earth 89) 'Fc- (L15) j FGF21 P171S (Mtwalahno.: 91) P171Tj 1 (Htoalahno.: 85) (25 bereavement a); and capacity Fc- (L15) -FGF21 P171Y ^ Fc- (L15) &amp; quot; FGF21 (and the earth 15 87) 'Fc- (L15) -FGF21 P17iwj (sequence number: 93) , and h 171? 0.1 (MTW 1 Ahno.: 95) (Figure 25b); and Zawat Fc- (L15) -FGF21 (Mtwalahno.: 49), -Fc L15) -FGF21 (A45K, G170E)) (MTW 1 Mechanism No. 97), FGF21A45K (and the Earth 0.99) (1 to form 25 d); Fc- (L15) -FGF21 (0 Twalahrd 49) E Fc- (L15) -FGF21 Ρ171Ε (Htoalahno.: 79) E Fc- (L15) -FGF21 (A45K / G170E) j (Htoalahrd 97) (bereavement 25 d); 20 shows each plate results that have been obtained for a sample compared FGF21 drink of figures 26 A- 26 bloc as a function of time d FGF21 mature z processor and Dran FGF21 Mokhtlgh; shown in Figure 26, a 1 change in the bloc Ne percent Ahtarzh WT) FGF21 'given 1 T. solid) and FGF21 A45K (Downer Samth) after incubation of 65 mg / ml protein in the degree 4'm for several 1 and 2,

And 4 days, Bivma figure shows 26 b! Change in Denny 1 Syrlo WT) FGF21) (0 Twalah RIP 25 4) FGF21 P78Cj (Htoalahno.: 127) 'FGF21 P78R (succession RIP 129)' L86T (succession RIP 131) FGF21 L98Cj (sequence number: 133 ), FGF21 L98R (sequence number: 135) 'FGF21 Α111Τ (and only compaction 113)' and 81290 FGF21 (WAP compaction 115) 'and FGF21 A129Q (Chalors 117)' FGF21 A129KJ (Earth 125) 'A134Kj 10- 10-ΜΑ 33716Β1 FGF21 (Mtwalahno.: 119), FGF21 A134Yj (sequence number: 121), FGF21 A134Ej (sequence number: 123) (all the signs on the curve) after incubation of 65 mg / ml protein in grade 4 &amp; quot; C for 1, 6, and 10 days. Figure 27 shows the results of the experiment Activity ELK- to Iossiferraz have been made to compare the human FGF21 5 mutations FGF21 Α45Κ, FGF21 (Mtwalahno.: 99), FGF21 L52Tj (Mtwalahno.: 139) your responsibilities £ 58 I FGF21 (Mtwalahno.: 131). Figure 28 is a chart showing Altver in the levels of agglomeration mutations _ (Fc- (L15 Fc- (L15) -FGF21 (6-181 / G170E), -FGF21 (sequence number: 1.1) (lozenges six), Fc (L15) FGF21 (Α45Κ, G170EG (August u RTM: 97) (Herbatmgtouhh), 10 Fc (L15) FGF21 P171Aj (1 st Bertm: 53) (^) 'Fc (L15) -FGF21 G170Ej (succession RTM: 51) (triangles Mgtouhh) and FGF21 (solid circles) after incubation in the degree of 16:00 for 1, 4, and 8 days, and the shape is 28 to graph Oaadh also shows the results of immunization. be a figure 29 is a curve showing blood girth glucose levels in mice injected with PBS (material carriers) (Downer Samth) or mutations 1 15 (Α45Κ, G170E) (RTM succession: 97) (circles Mgtouhh), - (FGF21) Fc- (L15 A45K, P171G) (RTM succession: 103) (solid triangles), or 0.1 (Htoalahno.: 43) (Milthatmgtouhh). be a form 30 is a chart showing the results of the experiment Activity ELK- to Iossiferraz made pardoned FGF21 human (Downer solid, solid line) Fc - (L15) -FGF21j (Mtwalahrtm: 49) (Doash 20 Mgtouhh , Khthassat) Fc- (L15) -FGF21 (L98R, P171G) j (Mtwalahrtm: 43) (Hat solid, Mnicot line). Figure 31 is a chart showing the clusters of higher molecular weight in the Secretariat, it should be observed for nine days at room temperature (Figure 31, a) At 4 ° Mtoah (Figure 31, b) d FGF21 (succession RTM: 4) (Downer Samth, solid line) and Fc- (L 15) - FGF21 (Htoalahrtm: 49) (d'Oise 25 Mgtouhh, solid line) Fc- (L15) -FGF21 (L98R, P171G) j (Habertm: 43) (Hut Mmuammth, Mnicot) line is the shape 32 is a series effects MALDI mass spectrum shows the observed changes in -Fc (L15) -FGF21 (L98RP171G) (u 1 Bertm: 43) Ezd Nat Mokhtlgh over

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00121.tif" id="idf0010" />

-11- -11-ΜΑ 33716Β1 168 hours. A figure 33 is a Mkhthl Yasin Altver in the Secretariat, in blood glucose levels in mice 0b / ob Lal are compared to PBS bus (circles Mgtouhh), and mutations type is address FGF21 (such Mrbek solid); and Alhlgrat FGF21 They (Fc- (L 15) -FGF21 (L98R, P171G (MTW Mechanism No. 1: 43), (solid inverted triangles); (, L98R, P171G) 9 (sequence number: 143) (open) Maivat, (Fc- (L15) -FGF21 (L98R, P171G, 182G '(Mtwalahno.; 145) (solid circles). be a figure 34 is a chart showing Altver in the Secretariat, Ne Stobat Jokoz blood in Vnran ob / ob both Mtarnh PBS bus (Downer Samth), and mutations FGF21' in - (Fc- ( L15 1 FGF21 (sequence number: 43) (triangles Samth); 1 L98R, P171G, 182G, 183G)) (succession No. 147) (triangles Mgtouhh), Fc- (L15) -J (FGF21 (L98R, P171G, 182G ( succession No. 145) and (Maivat solid) Fc- (L15) -J (FGF21 (L98RP171G, 182Ρ (^ 1 ^ 8 143) (Maanatmuftouhh), Figure 35 is a chart showing Altver per cent in blood glucose levels in mice ob / ob both compared to the PBS bus (Downer Mgtouhh), and mutations FGF21 namely - (Fc- (L15 FGF21 (L98R, P171G) (u 1 Prvi 43) '(RT Q ^) 4 Fc- (L15) -FGF21 L98R, P171G, Y179S)) (sequence number: 149) (triangles Mgtouhh), Fc- (L15) -FGF21 L98R, P171G, Υ179Α)) (Htoalahno.: 153) (Mthelthatsamthmgulwbh), _ (Fc- (L15 (FGF21 (L98R, P171G, A180S (sequence number: 155) (lozenges Mgtouhh) Fc- (L15) j (FGF21 (L98RP171G, A180G RIP: 157) (Duanrs ^). A figure 36 is a chart showing Altver in the Secretariat, in blood glucose levels in Vnran ob / ob both compared to the PBS bus (Downer solid), and mutations Fc- (L15) _ 'FGF21 FGF21 (L98R, P171G) (sequence number: 43) (Mgtouhh); t boxes 1 (L98R, P171G, Y179F) (sequence number: 151) (solid triangles), and Fc- (L15) -FGF21 (L98R, P171G, Α180Ε) (Htoalahno.: 57) (lozenges Mgtouhh). Figure 37 is a graph showing a schematic study designed to examine the escalation Jrt six weeks Mngzh in monkeys Rbhh. In Figure shaded icons show cases of the withdrawal of blood in Alsalo status symbols spotted showed cases of the withdrawal of blood in Mufmah situation. -12- ΜΑ 33716Β1 be forms 38 O_ d is a series diagrams showing how they were randomly Nthsim monkeys Alrisosah the confused OGGT AUCsj, OGTT and body weight; illustrated in Figure 38. A basis glucose line in OGTTl levels, Tnanlr Solid square to Group A, and the Department of solid solid line to group b and Tnanlr Mgtouhh circle the dashed line to Group c before being compounds or c carrier assigned to each group; Figure 38 b basis glucose line levels in 0GTT2, symmetry solid box to the group a, and the Department of solid solid line to the b group and symmetry Danrh Mgtouhh the dashed line to Group c before being vehicles or carrier assigned to each group; shown in Figure 38 c basis glucose line d 1 levels, OGTTs and 2 are set out in terms of the AUC, trout column corresponds to a group, and corresponds to the shaded range column b and corresponds to open the column to the Group c; Figure 10 shows the 38 d baseline body weight, corresponds trout column to a group, and corresponds to the shaded column in b and corresponds to open the column to the group c. Figure 39 is a chart showing the percentage Altver in body weight for the base material 1 Line Few, FGF21 (1 u Bertm: 4) Fc- (L15) -FGF21 (L98R, P171G) J (H'bertm: 43) on the body weight of the monkeys / Rrpsosa; homology shaded columns 1 and 2 of weeks 1 and 2 at the dose of 15 Ankhvdh, and symmetry Mgtouhh 3 and 4 columns to weeks 3 and 4 at the medium dose, and corresponds to the solid columns 5 and 6 weeks 5 and 6 at the high dose, and symmetry mottled columns 7, 8 and 9 weeks 9 -7 during scavenging. A figure 40 is a chart showing Altver in the Secretariat, in insulin Alsanm relative to the base line with Article tanker, FGF21 (succession RTM: 1 20 (succession RTM: 43) Ely insulin levels Alsanm in monkeys Alrisosah; Tnanlr shaded columns 1 and 2 of weeks 1 and 2 at low dose, Mgtouhh 3 and 4 columns correspond to weeks 3 and 4 at the medium dose, and corresponds to the columns of solid 5 and 6 weeks 5 and 6 at the high dose, and symmetry mottled columns 7 and 8 to weeks 7 and 8 during the scavenging. be a figure 41 is a chart showing carrier effects, FGF21 (succession RTM: 4) Fc-J 25 (0FGF21 (L98R, P171G (L15) (Mtoalano.: 43), given when Asilyh dose, folding levels of insulin feeder monkeys Lj] acquired during weeks 5 and 6 of the study ;; symmetry columns Jeremiah solid week 5 and symmetry shaded columns to be a week 6. Figure 42 is a chart showing confused glucose d OGTT5 Almngz with these one exponent As Yeh

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00141.tif" id="idf0011" />

-13- ΜΑ 33716Β1 for treatment by high dose (Fc- (L15) -FGF21 (L98R, P171G (sequence number: 43); homology Danrh solid, solid line to the conveyor, square and corresponds Mgtouh, the dotted line to FGF21 and Ananlr Hthelthassat, solid line to (L98R, P171G) 1 (Htoalahrtm: 43). be a figure 43 is a scheme forms of insulin shows d 0GTT5 Almngz at the end of five weeks for the treatment of high-dose by (Fc- (L15) -FGF21 (L98RP171G (1 st b RTM: 43); homology Mmmth circle, solid line to the carrier, and corresponds to Mgtouh box, line AVI fell FGF21 and Ivazer Milt Massat, Khthassat Zly (Fc- (L15) -FGF21 (L98R, P171G (0 Zulah RTM: 43). Figure 44 is a chart showing the percentage of Tver of glucose base line OGTT 10 AUC3-5 Alahdd nee the end of each dose (low Mtoshalh and high dose) for Karodrbah; Tz 1 Zer promising Mgto fairway of 0 AUC3 calculated from measurements of glucose during OGTT3, and correspond to columns six of 0 Li AUC4 calculated from measurements of glucose during OGTT4, and symmetry shaded columns to AUC5 calculated from measurements of glucose Aie 0GTT5. is one of the form 45 is a graph showing the Nhirat carrier, FGF21 and Fc- (L15) -FGF21 15 (L98R, P171G) (Htoalah number: 43) on the Tver percentage of the baseline levels Tri Gelesarad Azzha Sanmh Z each group of monkeys Alrisosah; homology shaded 1 and 2 columns to weeks 1 and 2 at the low dose, light of ^ Oemayor Mahtouhh 3 and 4 Jeremiah exponent 1 Sell 3 and 4 Az a 4 medium lung, and symmetry Omayhmsamth 5 and 6 AVI 1 Otabie 5 and 6 Ezd 1 high Jrah, Otz 1 Zer Oehdh mottled 7, 8 and 9 Eyre Alosaya 7, 8 and 9 Isaiah 1 E Rh 1 lakh. 20 against 46 cent Z drawing ^ ne shows levels of Tri Gelesarad plasma feeder are all set Z monkeys 1 Rsusah; as is the size during the fifth and sixth weeks of treatment mated, FGF21 or (Fc- (L15) -FGF21 (L98R, P171G (succession RTM: 43) the high dose; homology Oaadh shaded Jeremiah week 5 and Dnadhir Miss 0 columns six Eyre Aloladoa 6. Lenin 1 x 47 Hbarh for bad shows levels of human FGF21 each presented alone Ne monkeys 25 Alhagrdh | to Amaash India initial dose, 5, 12, 19, and 26 days, samples acquired 21 Aouma almost after injection. be one whole 48 E 0 Arhen 0 Khttssuyt (Fc- (L15) -FGF21 (L98R, P171G (Htoalah RTM: 43) monkey 4 for separately measured when the initial dose, and 5, and 12 E and 19 E and 26 days, samples

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00151.tif" id="idf0012" />

-14- -14-ΜΑ 33716Β1 acquired almost 5 days after injection. A figure 49 is a chart showing the average concentrations of FGF21 and-bit - (15 Fc- (L (FGF21 (L98RP171G (0 Twalahno.: 43) Ehghash are Dladh OGTTs been a, Jaai b 0 d Jrhh low, medium and high, Tnanlr shaded columns Jeremiah 0GTT3 w discount , Wei ^ 5 columns Solid to 0GTT4 when Alatosth dose and Tazer Alhgtouhh Jeremiah columns 0GTT5 at high dose. the shape is 50 a succession amino acid protein fusion Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε) (sequence number: 47 ); building blocks IgGl Fc (sequence number: 11) are shown Bouktthagal, explains the link 3 (G4S) (succession RTM: 31) Bouktm 1 yoke and short-Zs 10 mutations described in succession FGF21 (succession RTM: 39) cell line and underneath Khhl be one of the form 51 z; z scheme shows Alasibabh dose of the compounds that have been tested in experiments Erk -lausegaraz; but you have led one test (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε (pro RTM: 47), (L98R, P171G, Α180Ε), ( succession RTM: 45), the type of untreated FGF21, and the integration of Fc with FGF21 type untreated 0.15 a figure 52 is a diagram Ntanj shows experience Rbahl Razin 0 Biacore Z -Fc solutions (G4S) 3-FGF21 (L98RP171G, Α180Ε) (Ouab RTM: 47) and Fc- (L15) -FGF21 (L98R, P171G) (RTM succession: 43) to human (hand Eliean) and Ciano β-Kl.tho (left). A figure 53 is a pair of charts showing the dose response 1 20 (L98R, P171G, Α180Ε) (Hatwalah RTM: 47) in Fr'n db / db b 0 d Rh 'shower and Ke 4 Figure age of 53 A levels of blood glucose in Vnran db / db when Whitney multiple points ton tanker article or -Fc (G4S) 3-FGF21 (L98R, P171G, Α180Ε), Ne while the figure 53 b -3 (Fc- (G4S FGF21 (L98R, P171G, Α180Ε) illustrates the effect on the body after injection Alanfred in mice .db / db

25 Figure 54 is a chart showing graphically the number of repeat dose study to -3 (Fc- (G4S FGF21 (L98R, P171G, Α180Ε) (0 Raprtm: 47) and, Fc- (L15) -FGF21 (L98R Ρ171G) (succession RTM : 43) Vivdhiran .DIO be a figure 55 is a blueprint for attributes GTT mice that have been treated Balhadh tanker, -Fc

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00161.tif" id="idf0013" />

-15- ΜΑ 33716Β1 (G4S) 3-FGF21 (L98R, P171G, Α180Ε) (0 Twalahno.: 47) or Fc- (L15) -FGF21 (L98R, P171G) (sequence number: 43) when the number of times different doses. Figure 56 is a chart showing the Tver body weight from baseline (day small) in mice are processed article carrier, (Fc- (G4S) 3-FGF21 (L98R, P171G, A180E (Twab No. 5: 1 Fc- (L15) -FGF21 (sequence number: 43) Ezd different doses. be a figure 57 is a chart showing the results of a study of cells outside Alcann Alehie gel 1 T. Zibh FGF21 (L98R, P171G) ^^ J (1 st number: 37) anything FGF21. be a figure 58 is a scheme the impact on the level of blood glucose among mice p shows 8 weeks db / db and are given many aqueous gel formulas. is the figure 59 is a chart showing to raise the level of blood glucose nly Oran Bahr 8 weeks db / db and are given many aqueous gel formulations . be a figure 60 is a chart showing Hayer on Stoy Geloko (l blood Zdy Win 1 n r 8 weeks db / B6 and are given doses of many gels Almaty formats; Solid mice Aldoaz overlook are given sample compared to the gel Mani, representing squares Solid Algiran Olney is Ahlaaha 15 doses of (FGF21 (L98R, P171G (Toalahno. 0.0 37) Ne Dlom 1 m a p 10 mg / kg, Ththel 1 Mthellot Alhsamth Alvdhiran 1 t is Aetaaha Jrouat of (FGF21 (L98R, P171G in Dlam Mani at 30 mg / kg, representing triangles Almthelobh mice Ashe was Aadai Fc- (L 15) -FGF21 (L98R, P171G, Α180Ε) (SHA 7 Ravi 57) alone-a figure 61 is a chart showing the percentage Altver Ne flat 0 Z Bocuse 1 km to the Saran Bahr 8 20 weeks db / B6 is Ataahm Me 1 T. of the many are gels German formats; represent Almsth circles Vdhiran are given sample compared to the gel Mani, representing squares solid Alphenran that are given Jrouat are (FGF21 (L98R, P171G (Toalorvi 37) Nihlammanezd 0 Amjmakjm, during one of the triangles, one for solid Algiran Altaeetm a 0 Etaaha Jrouat Z (FGF21 (L98R, Ρ171G in Hllagha Mani at 30 mg / kg, and inverted triangles represent Alnnran that have been given Fc- (L 15) -FGF21 25 (L98R, P171G, Α180Ε) (young Ravi. 57) Safardh. A figure 62 is a chart showing the influence Me anime weight in Vdhiran sounding 8 Wallace 0 db / B6 and are given doses of many gels German formats; represent Anduaz Almassath Vdhiran DTM given sample compared to the gel Mani, representing squares father Alvdhiran Ashe is a 0 Etazha Jraot Z

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00171.tif" id="idf0014" />

-16-

-16- MA 33716Β1 (FGF21 (L98R, P171G (1 st Maly number: 37) in the gel Mani at 0 Amjm / kg, representing Alhthelthat Almsth Alvdhiran 1 Lenny is Aetaaha an extract 1 t of (FGF21 (L98R, P171G in gel 1 m nee St. 30 mg / kg, and Tmtd Alhthelthat Alehtlobh Algdhir 1 n 1 Lenny was Aetauho, Fc- (L15) -FGF21 (L98R (P171G, Α180Ε (1 st Bertm: 57) Bmveldh.

5 is figure 63 is a chart showing the percentage Altver the weight of one's body Nellie Vir 1 N. Bahr 8 weeks db / B6 and are given an extract 1 t of many gels German formats; represent Solid circles mice sample is given compared to gel Mani, representing squares Solid families Olney fulfilled Ahetai disabled Z (FGF21 (L98R, P171G (sequence number: 37) in the gel Mani at 0 Amjm / kg, representing triangles Solid Algiran that are given doses of (FGF21 (L98R, P171G Ne Dlom Hani at 1030 mg / kg, representing triangles inverted Alphenran 1 t been a 0 Etai, Fc- (L 15) -FGF21 (L98R (P171G, Α180Ε (Hawalahno.: 57) for his response. be a figure 64 is a graph showing a schematic Damim study to increase the dose Ne for nine weeks in monkeys / Rrtmah which has a deficiency in glucose Tolerance (IGT). Figure 65 is a chart showing the effects of the carrier, and has been studying the impact of _ (Fc- (L15 15 (FGF21 (L98RP171G (Mtwalaharham: 43) Fc- (G4S) 3-FGF21 (L98R, P171G, j (Α180Ε (sequence number: 47) Elytmaoltaam AM has Alqirdharrtmah IGT- be a figure 66 is a plan that shows study Enairat Article tanker, 1 L98RP171G)) (Alatwalahrtm: 43) Fc- (G4S) 3-FGF21 (L98R, P171G, A180E ) j (sequence number: 47) on Ntaul Algakeh I Alqirdharrbhh .IGT 20 Figure 67 is a chart showing the study of the effects of the tanker, 1 L98RP171G)) (Alehtoalah RTM: 43) Fc- (G4S) 3-FGF21 (L98R, P171G , A180E) j (RTM succession: 47) pardoned a meal PM I Alqirdharrtmah .IGT be Enhkhttiodh Figure 68 is a study Enairat habit tanker, then L98RP171G)) (Dub RTM: 43) ^ Fc- (G4S) 3-FGF21 (L98RP171G , Α180Ε

25 (RTM succession: 47) on the body weight in 1 to Qirdhrrrtmah, IGT

Leo figure 69 years 5 are planned study shows Enairat habit tanker, Fc- (L 15) -FGF21 L98RP171G)) (Almtwalahrtm: 43) Fc- (G4S) 3-FGF21 (L98RP171G, A180E) j (RTM succession: 47) on the index I have a body mass Azqirdhanaa: .IGT

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00181.tif" id="idf0015" />

Not -17- -17-ΜΑ 33716Β1 my 4 Wen Figure 70 Ouarh 'z plan that shows Study Nhirat Article tanker, ^

L98R, P171G)) (Almtwalahno.: 43) Fc- (G4S) 3-FGF21 (L98R, P171G, ΑΙ8ΟΕΧ5 (sequence number: 47) on the skin fold thickness at Alqirdhadhira: .IGT Figure 71 Ebarh Z plan that shows Study Nhirat Article tanker, 1 5 (L98R, P171G) (1 Sbertm: 43) Fc- (G4S) 3-FGF21 (L98R, P171G1A180E) j (sequence number: 47) on the perimeter of my stomach for Qirdhh 9 h IGT. j 4 Wen Figure 72 is a chart showing the study of the effects of the tanker, Fc- (L 15) -FGF21 L98RP171G)) (1 Sabertm: 43) and (£ 8180, Fc- (G4S) 3-FGF21 (L98RP171G (sequence number: 47) on plasma glucose levels for the monkeys Rrr 6 h .IGT 10 have the shape 73 a plan that shows the study of the effects of the tanker, Fc- (L 15) -FGF21 L98RP171G)) (Almtwalahno.: 1 Fc- (G4S) 3-FGF21 (sequence number: 47) on glucose tolerance among Altrdharrbmm: .IGT the shape is 74 words scheme illustrates Tlaar study 1 T. Article tanker 0.1

L98R, P171G)) (Alehtoalahno.: 43) ^ Fc- (G4S) 3-FGF21 (L98RP171G, Α180Ε 15 (sequence number: 47) on three-levels of plasma Gelesrad the one to Qirdhrrrbeh .IGT be a figure 75 is a plan that shows Study Nhirat Article tanker , 1 L98RP171G)) (Alehtoalahno.: 43) Fc- (G4S) 3-FGF21 (L98R, P171G, A180E) j (sequence number: 47) on total cholesterol levels of the plasma in monkeys Mrdh .IGT be a figure 76 is a plan that shows study Nhirat Article tanker, 1 20 (L98R, P171G) (Fc- (G4S) 3-FGF21 (L98R, P171G, A180E) j (43: ^^ 61 (sequence number: 47) on the levels of HDL cholesterol to the plasma Alqirdhrrabeh IGT. be Figure 77 is a series of remnants Mutaias Lactic mass explains the observed changes in the (Fc- (L15) -FGF21 (L98R, P171G (Alabhuh Ellery Alehtoalahno. 4: 43) Fcj (G4S) 3-FGF21 (L98R, P171G, Α180Ε) (right Alagamuah , sequence number: 47) at multiple points 25 during the period of 168 hours.

Figure 78 is a chart showing the relative abundance (%) of the peptide 1 -C party, the Bountiful Alhl Balzsphlhzaaabptid Alhlerv total of Stqhmenkl C 0 0 n (Fc- (L15) -FGF21 (L98R, P171G

1 1 as that is Thalilhboishlh MRM

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00191.tif" id="idf0016" />

-18- -18-ΜΑ 33716Β1 LC / MS / MS after digestion of Asp-Ν. Leko 0 n Figure 79 is a chart showing Ntanj experience ELISA plasma concentration Nat length Fc- (L15) -FGF21 (L98R, P171G) J-l51 (Mtwalahno.: 43) and 1 (L98R, P171G, Α180Ε) (sequence number: 57) in the a period of 240 hours after injection into a vein in 5 Alphenran. A figure 80 is a chart showing Ntanj experience Activity elk -liossiferraz which has a negative comparison sample, FGF21 human (sequence number: 4) and Tgrat treatment Paljlecosal FGF21 FGF21 (Y179N, S181T) ^ J RIP: 161) 'FGF21 Υ179Ν (Habertm: 163 ) FGF21 P124Sj (Mtwalahrtm: 165). 10 detailed description of the invention can be prepared FGF21 protein Marzh human characteristics such as an increase in prostitution migraine and / or reduce the bloc using the methods that are disclosed in this application and methods of sex vital record. And optionally, can be added to extend the half-life by combining an antibody, or part of it, 15 to the end of the party N or C for the party succession FGF21 type is Alaaalj. Z is S Eva additional extension of the mid-life or reduce the bloc FGF21 protein type is Bo processor 1 middle introduction of amino acid substitutions in the protein. It is referred to such proteins Alnazlmh nee this one S Ktgrat, or Tgrat FGF21, constitute embodiments of the present invention.

Be DNA output modes for the return of genetic Union used in this one application, a -20 Apr examples, generally those set forth in Sambrook et al., M.lecular Cloning: A (1989, Laboratory Manual (Cold Spring Harbor Laboratory Press or Current. Protocols in Molecular Biology (Ausubel et al., eds .. Green Publishers Inc (1994 and Wiley and Sons mother Dehaj Clahaa in this one S Kahrdja any Erd 0 1. General definitions 25 indicates expression &amp; quot; molecule isolated DNA "Avi molecule - a nuclear Mtohr s, but (1) s were Ezl 0 are about 50 in the Secretariat, at least are protein, or fat, or Hoad Krarhadrae or other materials are naturally exist with them when they are isolated DNA) 1 Klee Z Khalaa 1 Air 4 or (2) is not linked to all or part of poly nucleotides, which is connected to one molecule of DNA to Dhuoa

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00201.tif" id="idf0017" />

-19- -19-ΜΑ isolated 33716Β1 &amp; quot; In nature, or (3) is effectively connected to the poly nucleotides, which are not connected to in nature, or (4) does not occur in nature as part of a succession Nyukiotid larger. In Mgdilh, the DNA molecule isolated empty to a large extent from any nucleic acid molecules other contaminating or other contaminated materials and that is their existence in their natural habitat, which will interfere with its use in A poly-peptide production or use of therapeutic or Alakhasa or preventive or research. Expression is used &amp; quot; carrier &amp; quot; To refer to any molecule (eg, DNA, or plasmid, or virus) is used to transfer encrypted information to a host cell. Expression indicates &amp; quot; expression vector Legacy &amp; quot; To the conveyor, which is suitable for transforming a host cell and Otway pardoned nucleic acid sequences and directed and / or control the expression of DNA sequences is Alehtjazsh 0 E. entered. It includes an expression, for example, but not limited, to paralyze the operations of transcription, and u 'and Lot RNA controversy, if introns are present. Expression is used Omousel effective &amp; quot; In this application to indicate that linked the Ho'vyt m &amp; lt; injury where is initialized sequences Sidling described so or assembled to carry out his job one Aaftdh 0 so, GS be succession edgewise connected effectively to the succession encryption capable of inducing doubled and / or 5A transcription and / or transfer succession encryption. For Almth, is effectively connected Hwallo net enhanced when it is enhanced able to direct transcription succession 1 Iar Taha. Do not under 1 0 e c H'lah attractant that ^ n contiguous with the coding sequence, as long as it works properly. So, for example, that Ahecn transcriptase sequences Tarnh Hzcolh not be present because Htoalah Hazz and Htoalah Alchgar Wei 0 Be that are also Atb 1 t Hishalah enhanced &amp; quot; connected to the effective &amp; quot; To succession encryption. 20 expression is used &amp; quot; host cell &amp; quot; The burdens to a cell snitch not been converted, or be able Z that betrays converted Bmnwalah - nuclear, such as the DNA is available here, and then to express gene selected for 0 put one Htmam includes expression on the descendants of confused mother, Sue 1 E was F ^ is identical to one of the bereaved or not, or in one of Tkoic Originally genetic mother, so long as to be Adlan Alltar Hugodo. Bashir .ltobeir &amp; quot; poly peptide Isudo AVI Duffy peptide 0 availability s and Lalai (a) have led Ezlh &amp; lt ;, Ho'na 5025 Ne pain one these on one of the least Z routine ', or fat, or Hoad carbohydrates, or other materials are Surat I and Judy with Aandash is when nuclear Alhed Akosh from the source cells, or (2) is not linked to Sboasith optimism Ta 1 placebo or non-covalently) Avi all or part of poly nucleotides which Tosila Aleh &amp; quot; Angeoffa isolated polypeptide &amp; quot; Vi.tabaah, or (3) is in P * Air worm (Bo'sth GMT \ El Sahaa or 0 Gail -20- ΜΑ 33716Β1 covalently) 1 Li-poly Nyukleomhd which are not Zoppe Ibb Ne S, or (4) is not in the bodies of nature . Besorhmgdilh, be Alboulibptid Alaazzolllachteraa Alarkavy Jeremiah end four years 0 distanced &amp; lt; Liat DNA and other contaminating or other contaminated snitch materials Pettm quality one in Dnla August Lalai will interfere with its use in poly-peptide production or use Aldlaja or A- or 1 Loewe or F -5 indicates expression &amp; quot; result natural &amp; quot; When used Vasa iky, materials Ahio Yeh Hthel 0 &amp; lt; Liat - nuclear 'and poly peptides, and Khalaaaamadevh, and the like, AVI rad snitch is Dodi in August do not handled by humans. Similarly, the expression refers &amp; quot; I is a natural &amp; quot; Sthdm is not in this one demand Jeremiah material which does not exist in nature or that have been modified or Tkhitt 0 Bavea a valley far. HCA used with respect to Bnyukluotadat, refers expression Aazatjhtabieioaa a &amp; gt; Vyruled ADAs (A) 'Das 10 (C), and guanine (G), and thymine (T), and uracil (7). When Astkhadda ^ mind the things iky Bohamahish Amiveh, DDS expression &amp; quot; due to natural &amp; quot; To twenty amino Ace acid (A) '(f) (C)' acid Olardak (D), and acid glutamic (E), and phenylalanine (F) 'Odi (G)' Lopez (H) 'and azo Rs I)), and lysine (K) 'and Usain (L), and Hiaonin (M)' and the ground (P) 'and glutamine (Q)' and I will!

(R), and d (S), and Threyos (T), and valine (7), and Reclamation (W) and Aozat ( '(Y 15 Q expression &amp; quot; Bonnie polypeptide FGF21 &amp; quot; to the urinary peptide Ir output μ processor Ne humans 0 No 0 purposes of this disclosure, can be used to express A'bola polypeptide FGF21 &amp; quot; interchangeably to Lash 1 Rh AVI Arne polypeptide FGF21 full length, the presentation, for example, Almtwalitin RIP RTM: 2; and 6 'and Lalai consists are 209 units constructivism acid Wahine, which are Chwerhaboisth MTW 1 has one of Veokluotad Lld 1 by RTM: 1 and 5 ', respectively; any image mature poly peptide, presented, for example, Alehtoalah RTM: 4 and 8' 1 taught -20 Era 8 a unit constructivism acid Wahine snitch is encrypted Rlo 1 st at 1 ^^ to the will of RTM: 3 and 7, respectively, which may esta where remove 28 units constructivism to Hhi S t the end of orf exponent of Port polypeptide FGF21 full former was (ie, Ashe constitute the peptide signal). can not Port ladies FGF21 Nat full length and mature ignite the methionine Nat Trha exponent 'which can not be entered by the treatment or as a result of the process genetic expression Valley 0.25 can be used both terms &amp; quot; Tgrh poly peptide FGF21 &amp; quot; and &amp; quot; Tgrh FGF21 &amp; quot; interchangeably and refer Jeremiah poly peptide FGF21, which has been the amendment Htoalah - exponent FGF21 output. Naturally (Mtna, successive No. 2, 4, 6, or 8). These include Shell AST; t example will exclusively, to replace one or more of the amino acids, acids as replacements Bhavezlk

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00221.tif" id="idf0018" />

A -21- -21-ΜΑ 33716Β1 expose the result and Bzz 1 Ir Protect 1 Z is the result of a natural amino, and trimming. So, Nstal Tgrat poly Bpenid FGF21; hr for example but not limited to, the Tgrat FGF21-oriented site, and poly FGF21 ύ'Α / \ Μ Mchenbh, and Tgrat FGF21 resistance to proteolysis, and Tgrat FGF21 decreases d; and mutations combination FGF21, and proteins are the integration of FGF21, as described in this application. 5 for the purpose set Alchwibat specific replacements Alhhi Alode Surat FGF21 to choose the current 1 GS, p numbering units Avve 5 amino acid Almchenbh or mutagens corresponds to that of the poly-peptide FGF21 unit Constructivism 181 mature. Can ignite Zerat FGF21 'n well 4 days to 1 for the need, Je Emczunin ends with 1 Kd amino acid, which can be entered by genetic or a result of the one mystery of Alor 1 st bacterial treatment. In other embodiments of the present invention, Tgrh poly peptide include FGF21 10 on succession acid Wahine, which are Mtabih dialogue 85% Presentation least Htoalah Alhhi Alode boom FGF21, r where give specific building blocks unwanted Jeremiah Tgrh poly peptide property FGF21 'Er 0 example, _khasans resistance proteolysis or increase the half-life or Khgd 1 blocks and combinations of them, have not been further modified. In other words, with the exception of the building blocks in succession Tgrh FGF21, which have been modified in order to give _khasans resistance to proteolysis or Khgd bloc 15 or other _khasans, it can be modified about 5% of all the Z Akandh units crisp other Alod in succession boom FGF21. For example, in the boom FGF21; j 0 Be to rake adjustment Q173E, up to 15% are all the building blocks of the amino acid is unity structural glutamic acid, which has been replaced with a glutamine at position 173. In other embodiments, too, includes Tgrh FGF21 on consecutive amino acid which matching be at least 90% dialogue, or about 95; or in 2096, or 97, or 98, or 99% Ir succession amino acid mutation No. FGF21, but where they are not further modified building blocks specific donor desirable property to Tgrh Donny DSP Je 'FGF21 For example, _khasansy resistance to proteolysis or Khgd bloc, have not been modified a 0 prescient. Sly 0 Il these mutations Boulibptid FGF21 Nchahduahd eating for Boulibptid FGF21 Z Checked. The present invention includes a molecule of DNA vacancy Tgrh poly peptide FGF21 Chl Je 25 consecutive amino acids, which are matching about 85% to at least the sequence of the amino acid mutation No. FGF21, but where given a specific building blocks unwanted Eyre property boom role Bbdod FGF21, For example, _khasans resistance to proteolysis or increase the half-acre or Khvhzy bloc and combinations of them, have not been further modified.

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00231.tif" id="idf0019" />

1 -22- In other words, with the exception of the building blocks in succession Tgrh FGF21, which have been modified in order to give resistance to proteolysis or Khgd caking properties or other characteristics, can be modified about 015 a. Each of the other building blocks of the amino acid sequence mutation in FGF21. For example, in the boom FGF21 can be modified Q173E, up to 15% of all structural units 5 to Hmash amino is unity Constructivism to Hmkhy glutamic, which has been replaced by a glutamine in the position in 1730 includes the present invention furthermore a molecule comprised of DNA on succession nucleotides, which are identical for about 90% at least 'or ho 1 Lee 95' or 96 'or 97' or 98 'or Wu% of 0 Li 0 Twalah Alnyuklutid encrypted boom FGF21, but which may not be an additional amendment 1 encoded Vukayutdat the building blocks of the amino acid donor _khasans resist degradation 0 protein or a reduction of 1 to 0 conglomerate owns such mutations poly FGF21 polypeptide encoded and at least one activity of poly peptide FGF21 unhandled. Refers expression Otgrh poly peptide FGF21 effectively Hyoya'a any Tgrh poly peptide FGF21 described in this 1 to Hllb and who owns a watch poly peptide FGF21 unhandled, such as the ability to Khgd glucose 'or insulin, or Tri Gelesarad, or blood cholesterol; and reduce body weight; and improve glucose tolerance 0.15 or energy consumption, or insulin sensitivity, broke up of the type or number of amendments which have been a 0 Dechalha Ne boom poly peptide FGF21. It can nevertheless be considered to Tgrat poly peptide FGF21 acquiree be reduced to the level of some of the activity of FGF21 thing for a 0 de urinary dam FGF21 Gore Tgrat poly processor FGF21 polypeptide effective vital. E indicates all of the expressions &amp; quot; effective amount &amp; quot; And &amp; quot; therapeutically effective amount &amp; quot; The amount of Tgrh poly peptide 20 FGF21 used to support the level of Mlhondmn biological activity of one or more of the poly-peptide FGF21 unhandled, such as the ability to lower glucose, or insulin, or Tri Gelesarad 'or blood cholesterol; and reduce body weight; and improve glucose tolerance, or consumption energy, or insulin sensitivity. Refers expression &amp; quot; pharmaceutically acceptable carrier material &amp; quot; Or &amp; quot; material carrier Mtbolh Physiology &amp; quot; As used in this application to one or more of the materials drafting appropriate to implement or strengthen give Tgrh poly peptide E. 25 FGF21 Ne deaf human or non-human patient. Expression includes any of Aibtto Olat E. dispersion, wraps, anti-bacterial agents and anti-fungal agents, factors equal tension E. surface and delay absorption, and all of them and the like that are physiologically compatible. Ohthelh pharmaceutically acceptable carrier materials include one or more of water, saline solution, a for-Um \\ me a Agzm

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00241.tif" id="idf0020" />

-23- -23-ΜΑ 33716Β1 Balgosvat, Aldickstrozz, glycerol, ethanol and the like, as well as combinations of them. In some cases, it could be included Amodil factors equal to surface tension, for example, sugars, polyethylene alcohols such as mannitol, sorbitol, or sodium chloride in pharmacy combination. Oadia can play a pharmaceutically acceptable substances such as wetting amounts or small amounts of aid materials such as 5 moisturizing or emulsifying agents, preservatives Ooualemwad organization, which promotes the storage period or effectiveness of Tgrh urinary peptide FGF21 or constitute a component of carrier material. Omold Alddo expression refers to a molecule or part are molecule which is able to be connected by an antibody, and additional in which it is possible that it is used in Hawwan to produce antibodies that are able to bind to the top of the adhesive to the antigen that. It may be the birth of the top 10 against the adhesive to one or more. Refers expression &amp; quot; Fc normal &amp; quot; To a molecule or sequence comprised of a sequence of a fragment Gore Rabahlat him 0 Born antibody resulting from digestion of the antibody in whole or product by other means, whether Ne r ^ Rh single units or several units, and can include articulated area. Hmadr Algeloubeyolven immunoglobulin Fc original d be original in Mgdilh, but not necessarily, of a human Weah of 0 to 5 Be a be of any Algeloubeyolinata immune, although he is favoring IgGl and 2 Hegel. Wish as ^ Adam IgG4. It is configured native Fc molecules of poly peptides Monomreh which Ahecn to rake intra one I Photo bilateral unit or multi-unit by covalently linked (ie LED 1 E. significant links; the hand) and 0 Girl covalent. Estimates of the number a bilateral links between the sulfide Aldznah between units run Vision 0 1 Modhumrah molecule 1 Shower

Natural Fc 1 Jeremiah 4 depending on the category (for example, IgG; IgEj, IgAj) or fen Hleaot 20 (0 Elysbatall Zq, IgGl; IgG2j; IgG3j; IgG4; IgAlj; IgGA2). One is the dimer is linked by disulfide resulting from digestion of Papaan 0 n IgG (1 Zer;, .Ellison et al 4071-9: 10 .1982, Nucleic Acids Res), J 4 Wen 1 Kir &amp; quot; Fc Hellbiei &amp; quot; K 0 is a -m in this application in a single unit Jeremiah photographs and bilateral unity, and multi-unit. An example is provided Ash'lbh Bonnie polypeptide Fc Ne successive number: AA, which are derived are molecule IgGl Shi 0 Imknnohl original 25 Fc, but not necessarily, the methionine party Amini, and Lalai Khet a 0 Dza in with Hinsah treatment or a result of the genetic expression of the bacterial; like Dzenat Fc 1 m and the p Dzemat &amp; quot; Fc original &amp; quot ;. Expression indicates &amp; quot; Fc &amp; quot different form; To the molecule or succession and Lalai blood is 0 Fc night z r and because

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00251.tif" id="idf0021" />

-24- -24-ΜΑ 33716Β1 still includes the linking site of the future, FcRn (neonatal Fc future). Explaining international applications W097 / 34631 and 96/32478 WO forms Fc Mokhtlgh numbers, and also the future Ha Penny's reaction, and are thus incorporated as a reference. So, can the expression includes &amp; quot; Fc &amp; quot different form; A molecule or sequence that is being amended to comply with the humans of the natural Fc is a human. Moreover, it includes 5 Fc naturally on the areas that can be removed because they provide structural features or dynamically activity and which are not Cteach mechanism for integration of molecules FGF21 mutants of the present invention. So, it includes password &amp; quot; Fc &amp; quot different form; The molecule or sequence which reduces site or unit constructivism natural Fc of one or more, or it may be a modified site or unit constructivism natural Fc and one or more, and that affects or is included in: (1) The composition of disulfide Association, or (2 ) incompatibility with the cell selected hostess, or (3) non 10 homogenization party N when expressed in a cell selected hostess, or (4) the introduction of Jakosel group, or (5) Benny interaction with complement, or (6) linking to the future of the Fc is continued future, or (7) toxicity based on an antibody cells (ADCC). It is explained forms of Fc Mokhtlgh with additional detail in this Wasp later 0 photo can be changed Fc include, but not necessarily, the methionine party Omive, and Lalai can be entered by engineering treatment Oontejh to the process of genetic expression of bacterial; Shell &amp; lt; Liat Fc 15 is still considered molecules &amp; quot; Fc original ''. Includes expression &amp; quot; Fc domain &amp; quot; Fc on natural forms and different Fc and the sequences are the Ka is before. Homa also different forms of molecules Fc Fcj naturally, includes express A'majal Fc &amp; quot; Me &amp; lt; Ne Liat monochrome image of unity Ohumicaddh unity of the body of Soamhiomh Amadadkamil Oohztj Bucca "Plan and '' other governors. In some embodiments of the present invention, it can be field Fc link to a purification FGF21 or 20 FGF21 (including Mchenbh image are FGF21) For example, for ways 0.1 Study covalent Z field Fc and successive FGF21. Can form a protein BMJ such multiple units En through the link fields Fc and both of these five mergers proteins and multiple units are a feature of the present invention can include changing the image Fc, but not necessarily, on Mitdundn Hennev Omive, which can be entered by the geometric processing or as a result of the process of expression Alzh Ala ^ j. 25 2-Tefa't FGF21 - &amp; quot; I am Bonnie polypeptide Tgrh FGF21 him Hwalah Sd Odauash In succession for the amino acid sequence of the urinary peptide FGF21 Alnhj naturally, Z for S successive number: 2, 4, 6 or 8 with one or more of the amino acid. It can be Tahim Tgrat

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00261.tif" id="idf0022" />

-25 -25ΜΑ 33716Β1 FGF21 by one entry or more replacements of the amino acid, either conservative or non-conservative up-or amino acids due to a natural or non-natural result, in a private placement of poly peptide .FGF21 can include expression &amp; quot; replacement of amino governor &amp; quot acid ; Replacement Unit Construction of an amino acid naturally (ie, unit constructions exist in known for succession urinary subject polypeptide FGF21 unhandled) with alone constructivism normal guy (ie, unit constructions that are not its presence in the position known to the succession urinary peptide FGF21 unhandled) so that there is little effect or no polar or shipment of structural integrity of the amino acid in this position. Amino acid substitutions province include building blocks for Hhi Amini, it is a natural ewe, which are typically incorporated by chemical peptide synthesis rather are synthesized in vital systems. These include simulators Bbtidiy, images or other inverted reserved for cracks amino acid. Can be divided into structural units emerging naturally to Livnat on the basis of characteristics common side chain: (!) Lack of harmony Waterproof: Norliusin,; Met, Ala, Val, Leu, Ile; and (2) the harmony of water in neutral:, (3) acidic: ; Asp, Glu; and (4): basal:; His, Lys, Arg; Asn, Gin; and (5) building blocks that affect Me toha the 0 della:; .Gly, Pr; and (6) aromatic :. Trp, tyr, Phe. It can be classified Amtbdalat exchange of a member of one of these groups to another member Z Sass Category province. Bacon and that - the exchange of replacements is a member of one of these Alphenat to a member of Z category brother 0 Z province. This can be a threat amino acid substitutions desirable (whether conservative or non-conservative) by those with skill in the field when such desirable replacements. The ideal Qanmh statement (and because the specific z) to acid substitutions Wahine Ne countries were one. Table 1 replacements Ahamty amoebic replacements illustrations unit Abananah original Val, Leu, Ile Ala 26- 26-ΜΑ 33716Β1

Lys, Gin, Asn Arg Gin Asn Glu Asp Ser, Ala Cys Asn Gin Asp Glu Pro, Ala Gly Asn, Gin, Lys, Arg His Leu, Val, Met, Ala, Phe Ile Ile, Val, Met, Ala, Phe Leu Arg, Gin, Asn Lys Leu, Phe, Ile Met Leu, Val, Ile, Ala, Tyr Phe Ala Pro Thr, Ala, Cys Ser Ser Thr Tyr, Phe Trp Trp, Phe, Thr, Ser Tyr Ile, Met, Leu, Phe, Ala Val 3- Port peptides FGF21 Mchenbh is directed a embodiments present invention to 0 Photos deviated ^ for Hervé Madahj FGF21 polypeptide or FGF21 mutation. This one grew to the level of the current G-sticking one of the effort to set poly peptides FGF21 Mchenbh snitch be able to provide an activity which is similar to 'taste and a Bahish Azlat' N'Dour Z manicured MA. 33716Β1 -Tl - for Poptad ^ FGF mature. As used in this application, Altmber A'bola polypeptide refers FGF21 Mchenb &amp; quot; The Dove master of FGF21 may it have been removed and the building blocks of the amino acid from the end of the amino party (or party N) of the poly-peptide FGF21, might have been removed and the building blocks of the amino acid from the end of the carboxylic party (or party C) of the poly-peptide FGF21, or it may have been removed units Construction of the amino acid from both ends Alamana party and the party of the carboxyl poly peptide FGF21. The preparation of cases uncovered Alchwib reported in this application as described in this application in the examples 3 and 6. Can be evaluated polycarbonate Activity peptides FGF21 Almchenbh party N and urinary peptides FGF21 Almchenbh party C using the experience ELK- to Iossiferraz outside the organism as described in Example No. 4. Can be made and no specific details of the experiments outside Alcann neighborhood which can be used to examine the activity urinary peptides FGF21 Almchenbh in example 4.

Can also be evaluated urinary peptides FGF21 Activity Almchenbh the present invention in an experiment in Alcann neighborhood, Mtdvinran db / db, or ob / ob Hohpin as in the examples 5 and 7 figures. In general, to evaluate the peptides poly Activity FGF21 Mchenbh in the organism, it can be given a urinary peptides FGF21 Almchenbh to animal experiments within the peritoneum. After the incubation period desirable (for example, one hour or more), can be used to withdraw blood samples, can be done to measure blood glucose levels. It can be no specific details of the experiments in the neighborhood Alcann which can be used to examine the urinary peptides FGF21 Activity Almchenbh examples in figures 5 and 7. A- cases Chwib N party in some embodiments of the present invention, include cases Chwib party N 1 ', 2' or 3 'or 4,

Or 5, or 6, or 7, or 8 units Construction of an amino acid from the end of the poly-N party FGF21 mature polypeptide or Tgrh FGF21. As described, for example, in the example No. 5 and Figure 3, poly peptides gaining FGF21 Mchenbh Nat cases Chwib party N to less than 9 building blocks of the amino acid urinary ability of peptides FGF21 Almchenbh Khgd on blood glucose in people. Accordingly, in particular embodiments, the present invention includes pictures Mchenbh of poly peptide FGF21 mature Ootgrat FGF21 Nat cases Hanib party N are 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8 units constructivism acid Amini. (B) cases Chwib party C -28- -28-ΜΑ 33716Β1 in some embodiments of the present invention, Nstml cases Enchenab party C 1, or 2, or 3 ', or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12 units of the structural amino acid from the end of the party of the poly C Bpenid FGF21 mature. As shown, for example, in the example No. 4 and figure in August, poly peptides showed FGF21 Mchenbh Nat cases Chwib parties C to less than 3 for unit constructions 5 to amino acid efficiency of at least 50% of the efficiency of Ed FGF21 unhandled experience ELK- to Iossiferraz outside Alcann the neighborhood, including the acquired urinary peptides FGF21 Almchenbh ability to lower blood glucose in people. Accordingly, in particular embodiments, the present invention includes pictures Mchenbh of poly peptide FGF21 mature or Tgrat FGF21 Nat cases Chwib party C 1, or 2, E or 3 ', or 4, or 5, or 6, or 7, or 8, or 9 , or 10, or 11, or 12 units of the amino acid constructivism.

10 (c) cases Chwib party N and party C in some embodiments of the present invention, it can be for poly peptides FGF21 Almchenbh combination of cases Chwib party N party C. poly peptides contribute FGF21 Mchenbh Nat combination of cases Zhanib party N and party C Almannanlr activity urinary peptides FGF21 Almchenbh Nat Chwib cases of either party or the party N C only. In other words, poly peptides possess FGF21 Mchenbh Nat both 15 cases Chwib party N less than unity constructivism of amino acid and cases Chwib party C is less than 13 units constructivism to Hmkhy amino Nat biological activity comparable or greater Mtna Activity Khgd blood glucose on poly peptides body FGF21 Mchenbh Nat cases Chwib party N less than 9 unit constructions of amino acid or poly peptides FGF21 Mchenbh Nat cases Chwib party C is less than 13 units constructivism to amino acid accordingly, in particular embodiments, includes present invention on the 1 / h l Mtdz 0 by the Bo 0 me 20 polypeptide FGF21 mature or mutations urinary peptide FGF21 Nat both cases Tchenb Alhlerv N Z 1 ', 2, or 3; or 4, or 5, or 6, or 7, or 8 unit constructions of amino acid and cases Chwib party C 1, or 2, or 3', 4, E or 5 'or 6, or 7, or 8, or 9, or 10, or 11, or 12 units of the amino acid constructivism. As Hohekl mutations ^ FGF2 of the present invention, it can optionally be Ntaatml poly 25 peptides FGF21 Mchenbh and Tgrat FGF21 on the unity of constructivism methionine Party amino acid, which can be entered by direct mutagenesis or as a result of the process of the mystery and Rush bacterial. Can be done to prepare the urinary peptides of the invention FGF21 Alhishzbh Lalani as a 0-Hosher and h in the examples 3 and 6 can be used those with ordinary skill in the field, the usual Ha Molecular Dynamics techniques

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00301.tif" id="idf0023" />

-29- ΜΑ 33716Β1

I record this information, the coupler with the present disclosure, for the preparation and use of urinary peptides FGF21 E. Almchenbh the present invention. Can be used record Ntnaat d DNA gene product of the return of the Union, and the synthesis of nucleotides Oolijo, and the fabric of the farm, and the conversion (for example, an electrical electrophoresis, to Abovktin). See, for example, Molecular Cloning: A .Sambrook et al0 Laboratory Manual, the former, which is incorporated in this application as a reference for any purpose. This can be an enzymatic reactions and purification techniques in accordance with the specifications Almsta, as Mngz are common in the area, or as described in this application. What is not provided specific definitions, labels be used with regard to procedures and laboratory techniques for analytical chemistry and synthetic organic chemistry, pharmaceutical chemistry and pharmaceutical described in this application are those well known and commonly used in the field. It can be done using standard techniques for chemical synthesis; and analysis Alkemiana; and preparation, formulation, and delivery pharmacist; and treat patients. It can also be merged urinary peptides FGF21 Almchenbh the present invention to an entity Azar, and Lalai can confer additional _khasans to urinary peptides FGF21 Almchenbh. In one embodiments of the present invention, it can be integrated poly peptide FGF21 lump succession to the Fc. Aeknaneacmtzgivmthelhma integration using a molecular vital ways known and / or guidance supplied in this application. Are explained Hoaid poly peptides merger like this, and also ways to work poly peptides such merger, detail eat nee this Wasp. E. 4. FGF21 mutants resistant to degradation mainland and Tiny as described in Almial No. 8, was discovered to be a mature FGF21 is subject to the decomposition of Ni-organism, which was ultimately determined to be established if they attack the protein. It was discovered that Alttal in Alcann neighborhood d FGF21 Nahvj Bada Omar to listen effectively shorter, and I j 0 Be the zing that the potential therapeutic molecule. Accordingly, it has been directed to conduct a study priest caper 1 T. FGF21 1 u show Mtaomh biodegradable protein. As a result of this examination, the sites Ne Adoni include the Dddd mature FGF21 have been identified for Tkkon particularly vulnerable to decomposition Prussian Ely Rabaalh A. '. A 0 J 1 x units structural amino acid in positions 4-5' and 20-21, and 151-152 '171-172 and 78 of -181. It has been extensive studies, but focused and directed for the appointment of replacements and IP Khahidh cancel &amp; gt; 1 Toliar Alalahz the case of protein while not affecting Z protein activity Avi Drickl Gore Hisholh. If S 0 0 scarcity first 8 -30- -30-ΜΑ 33716Β1 Wa 1 D Olney mutations have been prepared and tested. As described, for example, in the examples 13 and a 4-digit, not all z skills FGF21 perfect shape; given some mutations Mquaomhthll protein folding and Poke h 0 August 1 Zh i FGF21 Ashtml. Gained another Ttgarat Activity FGF21 but Wen gives resistance Ttd loans. Gained many Tgrat, including, for example, FGF21 5 P171G Ri Activity 0 corresponded Hthel FGF21 Fair processor while also showing resistance to Khgd decomposition Albrootina- was a Wallace 1 standards t to set Tgrat FGF21 desirable resistance to degradation protease be Zt 0 framework 1 Strip FGF21 mm 1 such as B-1 Zorh Hthel ; or greater than, activity d FGF21 unhandled. Therefore, the guiding another embodiment of the present invention to Tgrat FGF21 SPS be Mquaoi biodegradable protein 10 and still gaining activity which is similar to necessarily request 'or one size Z' FGF21 z processor 0 to 1 despite the blight less willing Ne us on some AAC 1 lattes, constitute Tgrat FGF21 be resistant to degradation protease but show Activity Minimizer another embodiment of the present invention. In D Azlat J 0 In that z ^ n 1 Barghob to maintain a degree of proteolysis, and therefore, Zat FGF21 and 1 u constitute allow certain Ahdot trail of proteolysis another embodiment of the present invention as well.

15 Kmahohekl mutations FGF21 Alatofferh here, can be prepared mutations resistance of FGF21 1 - protease of the present invention as described in this application. Can be used people with one regular Deneirh in the field, for example, with the usual record this information vital molecular techniques, coupler Ha current detection, to prepare and use Tgrat FGF21 protein resistance to overlook that have been detected here. It can be done using standard techniques d DNA Ntak return R1 Union 20 gene, and the synthesis of nucleotides Oolijo, and the fabric of the farm, and the conversion (for example, an electrical electrophoresis, to Abovktin). See, presented Sddl Madal, Sambrook et al .. Molecular Cloning: A

Laboratory Manual, the former, which is incorporated in this application as a reference for any Grd- can be an enzymatic reactions and purification techniques in accordance with the specifications Almsta, as is commonly Mngz field nee, or as described in this application. What is not provided specific definitions, the labels 25 Alastkhaddmh regarding procedures and laboratory techniques for analytical chemistry and synthetic organic chemistry, pharmaceutical chemistry and pharmaceutical described in this application are those well-known and used Sprrh 1 st in teh field. This can be done using standard techniques for chemical synthesis; chemical analysis; Oa-, and drafting, plug pharmacist; and treat patients.

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00321.tif" id="idf0024" />

-31- ΜΑ 33716Β1 can be also integrate mutations FGF21 resistance to degradation protease of the invention one of Hani A, Li Ke 1 n another, which can confer additional _khasans to boom FGF21 resistant to degradation Albroohiawl · In a embodiments of the present invention, it can be integrated into the boom FGF21 resistant to degradation Eros Jeremiah succession IgG Fc, for example, the successive number: 11. can Aneetmtzgivlthelhma Daha Pt'm E5 vital ways known molecular and / or guidance supplied in this application. It is explained Vo'id In Aldahj such peptides, and also ways to work poly peptides merger such as this, in more detail in this Wasp. 5-Tgrat FGF21 decreases conglomerate as described in Example No. Aatkon one of the characteristics of urinary peptide FGF21 is age p tendency bloc. When Nczykizzat above approximately J 5 mg / ml, the bloc ^ ne rate and be in the dryer Hr'rh Here Algervh.kma shown and described in this application, the agglomeration rate of Bonny Dam FGF21 z r is supported on both the concentration and temperature. It can be shown that the bloc is a challenge when working with FGF21 is Hhalj p these concentrations, Milavi the context of a therapeutic formulation. Tavalzlk, has been conducting a study Mujrl 1: 1 v Iain Secret FGF21 and FGF21 that appear conglomerate discount. It was then tested Tgrat FGF21 resultant Emile Er Wu bloc at concentrations Mokhtlgh. Been extensive studies, but focused and directed to set the private and AVI de 4 or replacements -nger bloc noted Dr. FGF21 is not affecting them processor u Activity Albroos Jeremiah dryer unacceptable. The example in the No. 15 explaining attempt to set a suitable decreases conglomerate Tgrat. Dundh 16 E. schedule some mutations that have been prepared and tested. As Homusharouh, pardoned for AAC ^ Fill the Ne example RTM 2017, no code Alhlgrat FGF21 Hthani shaped afternoon. Had some mutations dew FGF21 L58E I FGF21 and sleep included are additional consideration. Gained Zgarat Ady; such as FGF21 Α134Ε; FGF21 activity but did not give _khasans conglomerate discount. Mystery gained 1 T. numerous, such as FGF21 L98R 'Activity FGF21 also showed conglomerate discount. One 1 Tgrat, FGF21 Α45Κ 'showed an i 0 these Tat FGF21 Zafd them also shows conglomerate Q &amp; gt ;. properties 25 Ed u r 1 to Asar pussy E 1 x 1 T. FGF21 Vvh the bloc to have activity boom FGF21 necessarily Hmathl such as, or greater than, activity d FGF21 unhandled. Therefore, it is directed to another embodiment Aaasraa ESR Hebrat FGF21 Nat _khasans conglomerate reduced while still gaining FGF21 and 1 activity in Lecco n Mhathl Eyre 'or a size of 0, FGF21 unhandled. Although it is less interested in some of t 1 32- 32-ΜΑ 33716Β1 cases, constitute Tgrat FGF21 Nat _khasans conglomerate reduced, but Activity FGF21 Minimizer show another embodiment of the present invention. In some cases it can be desirable to maintain the degree of agglomeration and, therefore, form a Tgrat FGF21 which allows occurrence of a certain degree of agglomeration another embodiment of the present invention as well. 5 0 p as both mutations FGF21 available here, can be prepared mutations FGF21 antihypertensive available here conglomerate as described in this application. Yale 0 Be used to those with ordinary skill in the field, for example, with the usual standard techniques of molecular this vital information 5, Mturnh Ha current detection, to prepare and use Tgrat FGF21 lowering conglomerate of the present invention. It can be used for standard devout DNA gene product of the return of the Union, and the synthesis of Olitjonyukluotad, and Zarah 5 1 fabric, and convert (for example, an electrical electrophoresis, to Abovktin). See, for 0, Almse

Sambrook et al .. Molecular Cloning: A Laboratory Manual 'least' Lalai the DTM and incorporated in this application as a reference for any purpose. Bekn that are made of reactions 0 Zzimih Qalat and purification according to the specifications of Almsia, as Homngz Hanah are in the field, or as explanations in this S. What is not provided specific definitions, labels be used with regard to procedures and techniques for 15 laboratory analytical chemistry and synthetic organic chemistry, pharmaceutical chemistry and pharmacy Ne described this request are those well known and commonly used in the field. It can be done using standard techniques for chemical synthesis; chemical analysis; and preparation, drafting, and 1 Ztosta pharmacist; and treat patients. This can be also be integrated FGF21 mutations lowering the bloc of the invention one Zhafy AVI additional entity ', which can be 20 imparts additional _khasans AVI boom-reducing FGF21 bloc. Ne one embodiments of the present Ac'a, can be integrated into the boom-reducing FGF21 bloc Jeremiah Htoalah IgG Fc 'heavy For example, the sequence number: 11. It can be Tngiv such integration using the methods of its borders &amp; lt; Aiah known or guidance supplied in this application are explaining the benefits of the merger poly peptides representing these four and also ways of doing Ravi peptides merger such as this, in more detail in this application. 25 6. Tgrat FGF21 joint as described in this application, succession FGF21 has kind is Alaa 1 committees Khhasy Edidh and 1 u Yemen to put considerable challenges when using FGF21 as a particle Elaja 0 z r these challenges is the possibility that the protein to the breakdown and the inclination of the bloc when Nrd suffered. B * d z Hive Sz RNAi -53- 33716Β1 Dam 1 T. FGF21 which overcomes all of these challenges, has been conducting directed to identify any of the substitutions of the amino acid study grant _khasans resistance to proteolysis and reduce the bloc can be combined in a way to add or support in succession poly peptide Single while maintaining the levels of activity that are equal to or greater than the activity type FGF21 untreated. This represents a great challenge, where z Almarrv in the field that the introduction of multi-Ttgarat in poly peptide Mthom that could affect some of the pain one Hayan adversely expression, Alnchahd, following the industrialization of Brodan. Surprisingly, and as shown, for example, in the examples numbers 19 and 20, Akhaf been that Avd desired to Tgrat many FGF21 can be actually integrated manner add or Ma'zrh to generate 0 mutation FGF21 B_khasd 1 Z beasts Szzh 0 ^ n Sr't FGF21 and Lalai Sa resistant to degradation protease in front of a reduced rate, which is still gaining activity and who have such a similar, or greater than, activity d FGF21 unhandled as open about this nee S. Amaaber was a choice for the appointment of a joint Tgrat FGF21 be desirable for i Alhlgrh FGF21 similar to, or greater than, activity d FGF21 unhandled. Therefore, the steering - another one of the present invention to Tgrat FGF21 protein resistant to degradation and Nat bloc - properties while still gaining FGF21 activity and who is a representative to, or greater than 0 FGF21 bad wizard. B 1, although it is less a desire Ne some cases, Tzql mutants FGF21, which are resistant to degradation protease and Nat conglomerate discounted properties but activity FGF21 Minimizer show embodiment additional to Ahtr 1 GS insisted-I · Apr -alhalat can be desirable to maintain the degree of decomposition of protein and / or conglomerate ' and carefulness, constitute mutants FGF21 which allows occurrence of a certain degree of decomposition of protein and / or conglomerate additional wrinkle to the current A.chteraa too. As Ha all mutations FGF21 of the present invention, Aekn be prepared FGF21 common mutations of the present invention also Homusharouh in this application. Can people with normal cullet is used in the field, for example, the usual with this vital information 0 s, p 0 Htrzh for current detection, to prepare and use common Tgrat FGF21 of the invention S record vital molecular techniques. Ahecn that is used to record Ntnaat d DNA gene product of the return of the Union, and Tziq Alijo Veokluotad, and Hzrah fabric, and convert (for example, an electrical electrophoresis, to Abovktin). See, folding, for example,

Sambrook et al., M.lecular Cloning: A Laboratory Manual 'Previously, Lalai DTM incorporated in this application as a reference for any purpose. Can be made of reactions 0 Zzimih and ^ v Zi -34- -34-ΜΑ 33716Β1 accordance with the specifications Almsia, as is commonly Mngz field nee, or as described nee this request. What is not provided specific definitions, are designations used Fimaatalq procedures and Altqanyata Kieia laboratory for analytical and synthetic organic chemistry, pharmaceutical chemistry and Akidbh the annotations 0 Ne this application are those well known? And used in the manner Hanah Almjh. It can be done using standard techniques for the synthesis of 5 Alkemiana; chemical analysis; Wa-E and 1 to formulate, and 1 strain and Ddlana; and treat patients. Ahecn be also integrate FGF21 mutations common to the invention Aszewy Avi Last yen 'and Lalai Bek 7 confer additional properties Jeremiah boom joint FGF21. -at Invention in one warm, can be integrated into the boom joint FGF21 AVI Toalah IgG Fc 'Z for aluminum E \ 1 * λΛ \ β RTM: 11. 10 can be Ttefin such integration using the methods of Houda Dzenlh and / or LG Alto 0 the provider in this application. Are explained Phoand poly peptides merger requested this, and Oimda wineskin to work shower peptide 1 v 1 Kmj 0 5 such as this, in more detail in this application. 7. p FGF21 protein as used in this application, aromas &amp; quot refers; Ravi Sep Dehaj FGF21 &amp; quot; Or &amp; quot; Rs merging 15 FGF21 &amp; quot; To integrate the unit constructions of amino acid and birth Owakqr (Tal Ross or 0 z Las) when the party N or party C for any Tgrh poly DSP FGF21 to or h in this 1 S 0 ignite peptides and poly peptides is Mottagatsh, presented for aluminum odds Aksro &amp; amp; t Ge-of-sticking ^ to allow the discovery and / or insulation to Tgrh Boulibptid FGF21; wares accept Ie Zs or part of these, such as the area outside the cell Oumajal inside the cell membrane controversial; Lori Rabahla or &amp; lt; E Hih 1 and the one who 20 connects Jeremiah routine will decrease membrane controversial; and an enzyme or portion thereof which is Ncdhvezaa; poly peptide or polypeptide which promotes formation Aolijoumrat, such as the Board of Lierse Cloud 4 and RNAi Q or allowance and Lalai Azab stability, such as the constant region of globulin immunoprecipitation (Hthela, Lal Fc) Htoalah prolong Htrh Ehr not - Elytolivh 0 Natvenoo more (0 Ztha 0.2 '5' 10 , 15'20'25 'A.k) g Alolad Alodhz't shipment and / or unshipped caused naturally or Gore Mala Tbima (Tal, SF; glycine, Gelotahek 25 or Hmagn Ombartak) is designed to form a merger Af loyalty navel backstopping partner or Gore Aq loyalty Sorhe dolly to the Tgrh FGF21; and antibody will or Gore will or IL of 0 Alaz or Khhagh and RNAi polypeptide have an activity, such as Activity therapeutic, disappeared Z Tgr 1 T. Looney because of FGF21 to Akhdhiraa Lalani-be burning also by the present invention is a Z caper; t FGF21 rather AVI Ayers 0 Pray

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00361.tif" id="idf0025" />

35- 35-711 &amp; lt;? &amp; Lt; 7 1 Larry (HSA). It can be prepared D0-FGF21 proteins Boishlh c d c 0 0 Htjash Htoagliat is a 0 d what one party - 0, - FGF21. As .hrouh in this application, it can be p succession Fair Htjatsh a succession Oobolimr amino acid is me &amp; lt ;, -5 Amini. It ahecn be Dehaj Clay 1 T. heterogeneous either Hbeshrh to boom Bonnie reason FGF21 or Z through the connector or adapter molecule. Walked to write down connector or molecule adapter Ebarh Z alone acid Lacey and one or more units (Aoouhdat), for example, 1, or 2, or 3 'or 4' or 5 'or 6, or 7, or 8; A'o 9 unit constructivism (or units), for example, 0.0 a, or 1 a, or 12 'or 13' or 14 'or 15, or 16, or 17, or 8 Aoo 19 Eoo 20' or 25 'or 30' or 35; or 40 'or 45' or 50 units '10 Maveh (Ooouhdat)' and eat tequila 0 15 N. Avi 35 units constructions (Ooouhdat). Aekn be Eva connector design or molecule adapter Hhler to Adod ^ j DNA or of &amp; amp;'s not ^ fairway Hsal compact Awq, a- cases p Fc Ne incarnations present invention A, are merged Tgrh poly peptide FGF21 I Fc 'Mtta area of ​​the field of 15 and one or eat for the human IgG Fc are. Antibodies include two functionally independent 'Mtver the area known as the &amp; quot; Fab &amp; quot;' And Lalai Arbahl hold against 'and Hjal p-known bass &amp; gt; &amp; quot; Fc &amp; quot;' Lalai and the DTM is included in an effective and Zazv dew complement activation and attack Boishlh Khalaa phagocyte 1 0 5 Iike that Dr. Fc RR Nmsd long, while the Fab short life (31-525: 337 Capon et al, 1989, Nature). When Tusilhmasuia with a therapeutic protein, buzzing the shower ^ for Fc E 0 t r longer or DJ Hthel 20 this Alozanf tying the future of Fc, and Nthbyt Mkte, and possibly one shower shoehorn Hishama (1989, .Capon et al) - recommended Liel kinetics of drug in Cannon neighborhood that y FGF21 human life listening short about one hour in Vnran because of filtering and hydrolyzed in Alcann neighborhood. For you 'financial framework 1 has a range of B1 to the age of FGF21 were merged succession Fc original end of the party I N or C polypeptide Ndona FGF21. Sleep Dh succession Fc In FGF21 unhandled, particularly Fc Alhedmj Avi of 0 to rack N Z FGF21 unhandled 0.25 I immorality is as expected, on any high 'Despite 0 n that' these remarkable led to Ashe study 1 z 1 for the degradation of Abrocana 3 FGF21 Ne Alcann neighborhood and abstinence for Tgrat FGF21 that were resistant to Hull this one decomposition. Is, Z gone off the 0 Thal, Hrhathelhz 5 mutations in the examples 9 digits Wa 1 'show 1.:.1.-1 Ehr Akll are FGF21 Fair processor 0 These proteins and integrate other embodiment of FGF21

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00371.tif" id="idf0026" />

-36- -36-ΜΑ 33716Β1 the present invention. Everywhere Mq current detection, FC-FGF21 expression refers to the integration of Ross last heh integrate successive Fc to terminals N d FGF21. Similarly, everywhere are detected, the monastery Sr- FGF21 Fc to integrate it is integrated into the successive Fc terminals C d FGF21 protein. 5 can be Tantih merger FGF21 protein product, eg 'Bo 1 middle of a black-M 0 Brunnen language. It turns out that Albbbdat compact and proteins to the Fc region Leko 0 n a p 1 Ehr biggest A.ly largely Alcann in the neighborhood of the counter is built. Also, the survey Dehaj Ave 0 Ztqh Fc to Daemrnatkoan Multiple Units for poly-peptide combination. It can be the Fc region Bar.h Z 0 Ztqh Fc arising naturally, or can be altered to improve certain quality, such as therapeutic qualities, or Zs Dduc 'or 10 conglomerate discount. The detailed explanation of useful amendments to the factors therapeutic protein by the merger Ha LaSalle Fc production &amp; quot; '10 counter in the international Alhllb No. 00/024782 WO E and I are a bear bank b 0 He 0 returned amusing 0 b d and armpit Ross r When you configure the merger of the present invention a protein, it can be , but does not require, Asnhaddam connector · The 5 and Ajd, may ^ n the chemical structure of the connector is critical, where his mother works mainly Kamiaad. Lash be configured Mosul acids Ominomomoya by peptide bonds. Bahish Akjsadat in the present invention, are configured Alaousel Z 1 Jeremiah 20 - Ohive and the righteousness of God's Plan 1 Rwabtabptid, b DTM Ahttiar Ohaad Alominomn twentieth acid Wahine resulting sa. Ivd't different 'is selected the one Jeremiah 20 amino acid acids are only 0 Ivo Liben and Ddran, Wallace' and Ross 'and Odaarran' 20 and glutamine, and lysine. In some incarnations, short Ndodn Housel are carnivorous 1 Z Amivo 1 Ta.dr disabled Njasmia, Hil glycine and alanine. In some incarnations, conductors be a Z RNAi Gelesivat (Mtd 4 (Gly) (Alehtoalah RIP: 29) G \ y) sJ) (Almdoandh No. 0.30)) E or RNAi Olaninat 'or combinations 0 n Geless atrium (such as RNAi (Gly - Ala)) 'or combinations are glycine Ori (such as &amp; gt; PL Gly- Ser))). Connectors include one other has since ratio &amp; lt;,: Gly) 5-Ser- (Gly) 3-Ser- (Gly) 4-Ser) 25 (Alehtoalahno.: 28), Gly) 4-Ser- (Gly) 4-Ser- (Gly ) 4-Se7) (Almdoualdh Rum: 31) '(Gly) 3-J 4 (Lys- (Gly (Almtwalahrs: 32) E and 2 (j 0) -ljh-Z 0 ^ 88-3 (of 0) (Almchabrd: 33) 'Gly-Pro-Asn-Gly-Glyj, (33: ^ MiJ) (Gly) 3-Cys- (Gly) 4j (the 0 Qgualahrlm: 35). Bivmaatm 1 spotted connector Z 15 units constructivism to amino acid Ezhabesvh works especially for Brocivat

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00381.tif" id="idf0027" />

-37- -37-ΜΑ 33716Β1 integrate FGF21, expect that the present invention Connectors any Ootrkibh along. When the use of slam MTW Link 1 Mechanism is 0 Tjazsh, such as the area of ​​Fc 'and Donny Sep Tgrh FGF21 or FGF21' Ed about the link between the brackets. Sir Alaouselat Alashrouhh in perfect Hmatlb, and are expected connectors that are too long 5 snitch _ihl Z and other building blocks by the present invention. Are also expected connectors non-peptidic by invention Alhani 0 .Je) For Almial, J 0 Be that lasted a-M Mo 0 links alkyl 0 such as - (0) ΝΗ- (CH2) sC, where 2 = s to 20 can be replaced with these alkyl connectors further by a group is crippling Tjasmia, including, for example but not limited to, alkyl whistling (nest example, C1-C6), or acyl whistling, or halogen (for example, Br, Cl) 'or CN' 10 or 2 ^ n or a connector is ideal peptide is a poly ethylene Jakol connector, where the connector weight Jezzini 0 100 N. Avi 5000 Kbaodashen 0 u example 'z 100, I 500 kDa. 8-Tfouat FGF21 chemically modified can be prepared Photo chemically modified to Tgrat urinary peptide FGF21 described in this 15 demand, including images flexor Z FGF21 Trot nee this one one to ask, Chkhn Mar in the field, Bmalomah annotated detected in this S. DVDR last such families 1 T. chemically modified so that the boom FGF21 FGF21 Alfdl Kemiavea different Z Azh i FGF21 rate, I am in the Aldhua or 1 for the position of molecules Mohlh In normal family FGF21. Ahecn that include Alhlgrat FGF21 modified chemically composed Bo 0 molecules middle Alafou to Ahjmuh Kim 0 Aaiah Houselh normal 20 and one or more. In a instantiations, it can be modified poly Tgrat because of FGF21 of the invention Lazne Bo'sth covalent conductivity of polymer and one or more. For the student, Ake n 0 1 0 Polymer God Khtar Negotiable Dissolve 1 n in the water so that typically a protein that is Rs Ibb Apr 1 water to Bivh 0.0 does not precipitates such as a physiological environment. Almstml be appropriate within the field of polymers Ebarh Z vinegary 0 0 -r for polymers; Mgdilh 25, for the therapeutic use of the preparation of the final product 'of ^ n Alboulihr acceptable Shehadli 1. Polymers form insoluble in water associated to Tgrat Donny alternative FGF21 of the invention Acani also a feature of the invention. Polymers can be perfect all circulated by St. or fork. ϋβύ each Z are Alboulihrat

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00391.tif" id="idf0028" />

-38- -38-ΜΑ 33716Β1 typical Bai molecular weight of from about 2 kilometers Das Avi varicose 100 each Dalton (Eyen express how I &amp; quot; that Alasthoudrat to Bollymrkabl soluble Almoee will Dzn b 0 Z the &amp; lt; Ivat eat was pointed some are little molecular weight mentioned). Hest Arzn Aldzive Lal poly 0 t Besolh della between about 5 kDa and about a 50 kilo Das' and eat in preference to wrap ho 1 Apr 12 h Das 5 and about 40 kDa, and most preferred between the margins 20 each Das Duay 35 each Das. Include polymers Mtasph soluble in water or Khalant Hzha, HR, for example all eat the materials Krrhilratih conductive AVI Ν Omosalh Ir 0, and diabetes 1 t, pl 4 Pat Vosev 1 T., and Donny polyethylene glycol (PEG) (Ava images Z PEG eat s been wi 0 mother to derive one's Brocz 1 T. , the Ivlk 0 Dhu- (Cj-Co), or Alcoxa, or aryl Akl- Ravi benefits Jakol), and Modhu 0 Athoxi -10 polyethylene glycol and dextran (such as dextran - weight 1 Kulkul 'all Mbil example, all 6 of Dalton), and cellulose, and polymers composed mainly of carbohydrates, and Rvi- (N- phenyl p-Weldon) Bo 0 t Aaialin Jakol, and polymers homogeneous polypropylene Jakol, and Rlrrat Hishturkh dioxide RNAi Brobbeliseroksid Aathelen, and Mrkpata polyol handled by Denis a, Klxi (all for the 0 Thal, Gelesarol), and alcohol poly phenyl . Also comprised by the present invention for Adra &amp; lt; Liat 0 15 interconnected dual function that can be used to prepare multiple units Tgrh RNAi FGF21 polypeptide conductive Nchahmaa. Also comprised by the present invention is a Tgrat FGF21 covalently connected to the poly Sialak acid. In some embodiments of the present invention, the Tgrh FGF21 covalently rate, or chemically to include polymer Negotiable one soluble or more, including, for example, and not limitation, the poly-20 polyethylene glycol (PEG), or poly Oxy polyethylene glycol, or poly propylene glycol. See, for example, US patent numbers 4,640,835; and 4,496,689; and 4,301,144; and 4,670,417; and 4,791,192 and 4,179,337. In some embodiments of the present invention, Tgrh includes FGF21 on the polymer and one or more, including, for example, and not limitation, mono Mathoxi- polyethylene Jakol, and dextran, and cellulose, and polymers composed mainly of carbohydrates, poly -25 (Ν- Phenyl Pirollidon ) polyethylene glycol and propylene polymers homogeneous Jakol, and polymers joint poly propylene oxide / ethylene oxide, polyol compounds processed by poly Aathoxi (eg, glycerol), and poly vinyl alcohol, or Khalant of such polymers. In some embodiments of the invention Alhani, it is more covalent modification Tgrh FGF21 sub-units

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00401.tif" id="idf0029" />

-39 ΜΑ 33716Β1 peg. In some Altjsiedk, it is linked polymer soluble in water and one or more (for example, when party N) mutation FGF21. In some incarnations, it is wildly connected polymer Negotiable I soluble in water and one or more side chain to one or more of Tgrh FGF21. In some incarnations, PEG is used to improve the therapeutic ability to Tgrh FGF21. The explanation of some five such roads, for example, in US Patent No. 6,133,426, which is incorporated in this Wasp as a reference for any purpose. In embodiments of the present invention, where the polymer is a PEG 'can be set not be straight or branched. The average molecular weight range Ed PEG will range in Mgdilh of about 2 kDa to about 100 kDa 0.10 and more preferred from about 5 kDa to about 50 kDa, for example, 10, or 20 'or 30, or 40, or 50 kDa. Will be generally connected to Ed peg set to boom FGF21 by acylation or alkylation reductionist through interacting on the incision Ed PEG group (for example, an aldehyde group, or group of amino, or group thiol, or group ester) to reactive the boom FGF21 group (for proverb, aldehyde group, amino or group, or group 15 ester). A can be specifically Tnfein Enter Ed PEG group of poly peptide, including mutations FGF21 current invented using any PEG-known in the field Enter a group interaction. The explanation of such interactions, for example, in the following references: Francis et al, 1992, Focus on Growth 4-10: 3 Factors ·,) and European Patent No. 0 154 316 384 4010; and US Patent No. 4,179,337 20. For example, you can enter Ed PEG groups are Tngiv by acylation or alkylation reaction with the molecule polyethylene glycol photoactive reaction (or polymer soluble in water photoactive similar) as Homusharouh in this application. For reactions Alosalh, it must be a selected polymer aldehyde group interacting single. Aldehyde be interactive, for example, a polyethylene glycol aldehyde Brobbeon, which is soluble in water, Omono C1-C10 Olcoxa or 25 derivatives Oralux them (see, for example, US Patent No. 5,252,714). ; In some embodiments of the present invention, it covers a useful strategy for connecting Ed peg set to poly peptide merge, through the configuration of link associated in solution, incision polypeptide PEGj, each with a special function which are mutually reactive toward the other. Can be easily synthesized peptides preparation phase

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00411.tif" id="idf0030" />

-40 111 1 humiliation solid Takida, the initial A'asat '. A set of peptides and functional appropriate in a specific location. It is purified E. Article Alooah and distinguish them in full before the interaction with the incision of the PEG. Rt Aq h PEG is happening in Lhasa E. in the process of Mani and can follow it are easily done by HPLC p Hlor Exi 0 can Lam easily purified peptides entrance to Ed PEG group by HPLC- me and distinguishable Bo 0 Allath 5 HPLC Ttila refers Hmagn amino nice d mussels laser. Bwimmerat be poly screed another type of polymer soluble in water and the insults d that is used to modify the protein. Therefore, Ckdtgrat FGF21 to choose 1 GS 1 to August Hani Er Bo Donnie screed passes embodiments of the present invention. Dextran Ebarh be vehicles for Rlamrat Ravi 0 Scrip Hecozh of sub-units each separately from glucose connector -r; Tdh Wasit; 1-6 Y-lats less. 10 will be available the same dextran molecular weights of about 1 kilo Daran Jeremiah ho 1 Apr 70 Ikl_ d 1 Zen. Dextran is a suitable polymer soluble in water for use as a vector worker know one or Te in Toulihh with another carrier (eg, Fc). See, for Almthag, Wasp Adoni bridge WO 96/11953. NCR has been the use of conjugated dextran Ha Geloubeyolinat immunological therapeutic or see, for Almth, European Patent 456 3150, and two thousand are with Thee Bahla reference. 15 Eshetl invention Hafi also on the use of dextran Hawwana 1 kDa Jeremiah margins 20 Enlarge Dalton. In general, it can be an amended chemical under any circumstances appropriate user interaction routine with a molecule polymer tonic will include ways to prepare poly peptides chemically modified in general the following steps: (a) polypeptide with a molecule polymer tonic polyurethane reaction (such as an ester reactant or a derivative aldehyde 20 for the polymer molecule) under conditions where it becomes so Tgrh poly peptide FGF21 Jeremiah molecule polymer and one or more connector, and (b) obtaining the reaction products. It will be to determine the ideal reaction conditions on the basis of known and desired results transactions. For example, whenever the ratio of polymer molecules to a larger protein, the greater the percentage of the polymer molecule Mosul larger. In one embodiments of the present invention, it can be modified FGF21 mutations chemically split a single polymer molecule at 25 amino terminals (see, for example, US Patent No. 5,234,784). In another embodiment of the invention, can be chemically paired Tgrat poly peptide FGF21 Jeremiah butene. It is then made available to link Albiotizatgrat urinary peptide FGF21 to avidin, resulting Jeremiah avidin / biotin / poly peptide Tgrat FGF21 tetravalent. This can be also be a Tsasah 0 WEDDING

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00421.tif" id="idf0031" />

V / '-41

-41 IK 33716Β1 Tgrat poly peptide FGF21 to Dai Venzovinol (DNP) Oonraa Nddensufinol (TNP) and Dr. Alehtravqat resulting with anti DNP or anti-TNP-IgG to form Htravqat Dhikamirak Equal 10. General Sgh, include cases which Aekn be mitigated or modified by giving mutations modified FGF21 chemically that have been disclosed to those described nee this circumstances Wasp Secret 1 v 5 RNAi Bpenid FGF21, in any case, can have mutations urinary peptide modified FGF21 chemically disclosed in this request additional activities, or dynamic activities enhanced or reduced, or other Khhts, such as Aar listen fleeting or minus, as Mtarn with Hlgrat FGF21 fled Sdlh 0 9. Arcilla 1 T. Pharmacy Z Tgrat FGF21 and (. VAJi is considered one of the combinations pharmacy! for containing pardoned Tzac FGF21 within del present invention, and the blood of 10 specifically predicted Ne light sequences definitions FGF21 multiple Tgrh show _khasans enhanced. can Pharmacy combinations include the Tgrh FGF21 like this - an effective amount of a therapeutic Z Tgrh RNAi Sep FGF21 in combination with the wording acceptable pharmaceutically or physiologically chosen for the occasion with Otob administration worker. be acceptable formulation in Mgdilh Ir toxic Msenthbl dose factors and 15 concentrations used. Yesh that I pharmaceutical composition in the formulation to modify factors, or maintain, or Hgz, for example, pH, or osmosis, or viscosity, or serenity 'or one color, or Tawi tension, or Waller 1 loyalty or or consistency, or the melt rate or at all or penetration of the composition. Factors include the &amp; lt; Agha occasion, Nash example but not limited to, acids, amino (such as glycine, or glutamine 0.20, or asparagine, or arginine or lysine), and materials antimicrobial, and antioxidants (such as Oschorbak acid, or sulfite sodium, or bisulfite sodium), rad Organization Wareham Adro- (Shell Race or Dnat, or Κ1 Ras-, and vehicles citrate, or acids and other organic), and factors amplify (such as mannitol or glycine), and factor chelation (eg - a 0 ethylene Dai Apt Hleratrik (EDTA)), and the factors complicating (such as caffeine, Opole vinyl Pirollidon, or Hdro- and the- beta -25 cyclo Dkaatren), and fillers, and Scridat glutamate, and other materials -t (Shell - or mannose, or Dquistranat), and proteins (Mil albumin serum, or Gelazpf, or &amp; lt; Pulimat immune), and factors coloring and give the flavor and ease, and factors emulsification, Wu-data Olahh water (Shell sprayed fry 0 Pirollidon), poly peptides low fetal weight, Ooz 1 T. anti Hiozh - (Shell Sdom) E

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00431.tif" id="idf0032" />

-42- -42- I 33716Β1 and preservatives (such as chloride Benz Alkuniom, or benzoic acid, or salicylic Hmkhy, or Tamrcol, or ethyl alcohol Fein, or methyl paraben, propyl paraben or, Ockelor Hecsidin, Oouhamad Sorbic, or above the hydrogen oxide ), and Mnibat (such as glycerin or propylene glycol, or polyethylene glycol), and alcohols sugar (such as mannitol or sorbitol), factors tolerate, and materials surfactants or 5 Awahl moisturizing (such Hoad Brunak or PEG or esters Sorbytan Oomrkpat polysorbate like polysorbate 20 Opole sorbate 80 Outromithaman Aulecisin Oochollstrul Ootaluxabal), and the factors that enhance the stability (such as sucrose or sorbitol), and the factors that promote tension (such as halides metal alkali-of Amodil sodium chloride Oobutaseyoum- seen mannitol, sorbitol), and Oaql connected, and materials diluted, and excipients and / or adjuvants Pharmacy (see, for example, Remington's 10 Pharmaceutical Sciences (18th ed., AR Gennaaro, ed .. Mack Publishing 1990 Company following her and folders, built in this application as a reference for any purpose). Sot is determined pharmaceutical composition ideal technician Maher depending, for aluminum; and Avar intended to give, and the form of delivery, and the dose desired (see, for Allol 'Remington's Pharmaceutical Sciences, supra). J 00 Be that the influence of such formulations on the natural situation 0.15 rate ever in Alcann the neighborhood, and the rate of liquidation in Alcann neighborhood of the boom poly peptide .FGF21 can be the primary carrier or article carrier in the pharmaceutical composition of either the nature of Manet seen non-watermark for example, can be Oomadh be carrier-carrier injection is water, Oomahlol physiological saline, or cerebrospinal fluid, industrial, and can complement other materials Hanah in the composition of giving through non intestine. Aern normal saline pH regulator solution or brine mixture with 20 Olbohen serum is a more ideal vectors. Trkiaat include other ideal drugstore entrepreneur pH Tris pH 7. No. 8.5, or acetate pH regulator No. 4_ pH 5.5, which could include the addition or replacement of sorbitol appropriately. In one embodiments of the present invention can be prepared Tgrh poly peptide combinations FGF21 for storage by mixing the selected composition Nat desired degree of purity with optional formulation of 25 factors (der Remington's Pharmaceutical) in the form of a paste or dried water solution freeze. Moreover, Yale 0 Be that do drafting Tgrh poly peptide product FGF21 on trivial freeze drying using appropriate excipients output dew Skloz 0 can be selected Nzquieat pharmacy Tgrh Bowlby polypeptide FGF21 to connect via an e 0 howled · -43 &amp; quot; ΜΑ 33716Β1 Alternatively, it can be selected formulations for inhalation or for delivery through the gut, through the gloom, for example. The fact that the preparation of such pharmaceutically acceptable compositions within the skill area. Formulation components are present in concentrations that are acceptable to the administration site. For example, the use of the Organization of materials for pH to maintain the structure when the pH physiological or when the number is less pH, typically within the range of pH 0 n about 5 to about 8. When are expected to give through non intestine, can be combinations therapeutic for use in this invention in the form of Manny acceptable solution through the intestine it is free from material causing fever Say pharmaceutically acceptable. Conveyor be suitable in particular for injection through an intestinal Abarhan sterile distilled water formulation boom Dove polypeptide FGF21 on trivial sterile solution isotonic, preserved properly take place. Can include preparation else too drafting the desired molecule with a worker, such as injectable accurate balls, or bio-corrosive particles, Oomrkpat polymer (such as poly lactic acid or acid poly Glicolak), or beads, or fatty particles, which provides for Ahllaq rated or continuous Mttj of which can then be plugged by injection. Bekn that is also used - Hiaruvek, and Ahecn to have this influence to promote the continuous persistence in circulation. Zstml and other appropriate means uncooked desirable to deliver a drug N for planting devices. In a instantiations, a pharmacy can be a combination of the inhaled formulation. For example, it can be formulated Tgrh poly peptide FGF21 in the form of dry powder for inhalation. It could also have been formulating solutions for inhalation Tgrh poly peptide FGF21 with the motivation to connect Aarawlesl. E. additional embodiment, too, can be atomisation solutions. At Moreover Rnoa explanation given in the international application number 94/20069 WO, which explains the pulmonary delivery of proteins modified Kemianao · is also predicted that it could be given certain formats through the gloom. In one -at present invention, it can be formulated Tgrat poly FGF21 polypeptide that is administered in this way with or without those I-bearing materials used routinely in the installation of solid images dew Oaqrahh doses of 0 and capsules. For example, it can be a capsule designed to release part of the formula when Lala Ne gastrointestinal tract when it is to maximize the bioavailability is reduced decomposition is one Bazzi ago. Ahecn also Dadam the use of diluted substances, materials and profitable for taste, and materials for low wax rose fusion; and visited -44- ΜΑ 33716Β1; E. vegetarian, and Imoad sleigh, and factors comment, Tqkik factors, and links. Ahish include other pharmaceutical effective amount of the composition 0 n Tgrat poly peptide FGF21 in Zit with non-toxic excipients which are suitable for the manufacture of tablets. By dissolving discs in sterile water, or adequate Fash else can be done to prepare solutions in the form of unit dose. Excipients suitable include, for 5 example, and not limitation, the diluted Rigid materials, such as calcium carbonate, or carbonate or Beckerbonata sodium, or lactose, Oovosvat calcium, or linking factors, such as starch or gelatin, or Assag acacia; or factors lubrication such as magnesium stearate, or Staarik acid, or talc. Combinations will be Tgrh poly peptide Pharmacy additional FGF21 clear to those with skill in Almjh, including Tgrat formats including poly peptide FGF21 in a continuous or Mtnn connected formats. 0 to create techniques for the formulation of a variety of means continuously connected, or other standardized, such as carrier materials for particle greasy or Oojsamat bio-corrosion, or beads are porous and injection Montrth, are also well-known to those skilled in the field (see, for example, the international application number 93/15722 WO, Qiqh porous polymeric formulations to deliver a pharmacy, and 327-298: 364 .Pharm SAL .Wischke &amp; amp; Schwendeman, 2008, Int 'and &amp; amp; Freiberg 15 18 -1: 282 .Zhu, 2004, Int. j. Pharm, which explains the preparation and use of the ball Deghiksam accurate). As described here, the aqueous gel is Mthana the Nat-acting or sustained Alhqahkm the formula. Additional examples of sustained release of cosmetic containers on the polymer in the form of semi-Mngzh problem products include, for example, chips or minute capsules. It could include the launch of 20 containers on a continuous polyester materials or Gel Mani materials or poly Aktadat (US Patent No. 3,773,919 and European Patent No. 481 058 0) or common polymers of L- glutamic acid and gamma Aithil- L- glutamate (56 -547: 22 Sidman et al., 1983, Biop.lymers) or RNAi (2-hydroxy Aithil- meth acrylate) (: 15 .Langer et al., 1981, j Biomed.. Mater. Res 277 -167 and 105 -98: 12 .Langer, 1982, Chem. Tech) or ethylene vinyl acetate (Langer E. 25 former and others) or acid Port-3 - (-) D- hydroxy Biotirak (European patent No. 1 330 988 e). Can be sustained release formulations also include the presentation Jsamatdhenneh, which can be e prepared by any of several ways known in the field. See, for example, Epstein et 92 -3688: 82 .al., 1985, Proc. Natl. Acad. Sci. , USA; European Araaq thinner 13:00 0

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00461.tif" id="idf0033" />

-45- 33716Β1 676 036 'and 046 088 of 0, and 0. 949 143 should the pharmaceutical composition of the boom poly peptide FGF21 to be used to give the neighborhood Alcann be sterilized in a module. It can be Tngiv this by filtration through sterile filtration membranes. When the composition to be freeze-dried, it can be Ttefin sterilization using this method either before or after the 'freeze-drying and restructuring. Can be done to give the composition of storage through the intestine is dried in the image Baltjaid or in solution. In addition, NAT is placed combinations Aehlae through Z intestine generally in a container Nat Mngz the arrival of a sterile, for example, a bag or a bottle of pink lotion plug hole are by subcutaneous injection needle. Once the pharmaceutical composition is formulated, it can be stored in a sterile Qanat a trivial solution, or suspension, or gel, or emulsion, or a solid material, or the effortless dewatered or lyophilized powder. Can such formulas are stored either in a ready to use, or in the form of an image (for example, freeze-dried) need to restructure before administration. In a specific embodiment, the invention is directed to a current into groups to produce a unit to give a single dose. Aekn contain all 0 n groups on both the first container with a protein dryer and a second container by Sbzh Manet. Have also flared within crowned this invention is a 1-containing groups il'iSU prefilled Chamber of single and multiple rooms (for example, injectors and Haqat soluble liquid). 6 P fulfilled effective amount of a poly peptide Tgrh Pharmacy FGF21 combination to be used therapeutically '.λ \ ",; Yale example, Ely 0 therapeutic context and objectives. Someone Maher will realize in the area that the appropriate treatment of Suu dose levels of 0 P and Dndr so dependent, Ni part, .Je) despicable Alhousel, and reasons that are its use Tglhbonnicad FGF21 'and the way equ' Y (body weight, or surfaces Table 3, or the size of the member) and the case (age and general health) of the patient. Accordingly 'can be assayed for one doctor brightest one dose mussels and enumerates the route of administration for therapeutic effect ideal. Can range from typical doses of 0.1 micrograms 0 n dialogue / kg Arldy 100 Hikroger Amakjm Owakqr, Athado 1 hr factors referred to before. Ne other embodiments, the dose can range from 0 n 0.1 micro g / kg to up to about 100 Hkro g / kg; or 1 Hkro Gramakjm AVI p Ho'r 100 micro g / kg; or 5 micro grams / kg Ir z Hawwana 10 micrograms / kg; or 15 micro g / kg to even Hawwana 20 micro g / kg; or 25 p er your responsibilities Gramakjm about -46- -46-ΜΑ 33716Β1 30 micro g / kg; or 35 micro g / kg to Z Davani 40 grams Hkro / kg; or 45 micro g / kg to up to about 50 0 grams Kro / kg; or 55 de g / kg AVI p Ho'na 60 micro g / kg; or 65 micro g / kg to fold ho 1 70 0 Kro g / kg; or 75 micro g / kg to up to about 100 micro g / kg. In embodiments of A &amp; lt; Z a 0 Lima Ahecn to 5 be the dose of 50 micro g / kg or 100 micrograms / kg or 150 Hkro Gramasa or 200 Maikarouhram / kg or 250 micrograms / kg or 300 Hmkrogram / kg or 350 de Gramakjm or 400 micro g / kg or 450 micrograms / kg or 500 Dugram / kg or 550 Z g / kg or 600 micrograms / kg or 650 micrograms / kg or 7000 Kro Gramakjm or 750 micrograms / kg or 800 micrograms / kg or 850 Dugram / kg or 900 de Gramaquim or 10 950 micro g / kg or 100 micro g / kg or 200 de g / kg or 300 de g / kg or 400 micro g / kg or 500 micro g / kg or 600 é g / d or 700 micro g / kg or 800 microseconds g / kg or 900 de g / kg or 1000 Dugramakjm or 2000 Hkro g / kg or 3000 Hkro g / kg or 40 000 Kro g / kg or 5000 micro g / kg or 6000 micrograms / kg or 7000 micrograms / kg or 8000 du 15 grams / kg or 9000 micro g / kg or 10 mg / kg. Repeat dosing on Albarakbh transactions will depend father 0 Aiah for Hlfrh RNAi Dddab FGF21 in the formula that is given. Typically, a doctor will give one processor Ikirkih shower is one of the Omol to the dose that achieve the desired effect. This can be given formula Me This Jrah Mgrdh or in the form of two or more doses (which may contain or do not contain the same amount of one molecule to Barghob) Ena &amp; gt; 20 over time, or the effortless Chreib continuously by means instilling Kindle. The DTM Badra Rotiveh additional screening appropriate dose by those with ordinary skill in the Council; and the fact that within Zhlaq 1pm taken Boisalthm routine. It can be confirmed through the appropriate doses of a mother-Badanat response appropriate doses. Be a way to give the pharmaceutical composition according to the known pathways, for example, Z Henneiq one mouth; or 25 during the injection by administration intravenous or intraperitoneal, Oodakhl etc. (inside Ed) 'Oodakhl ventricular cerebrospinal, or Ni intramuscularly, or in the eye, or in the artery, or in Alasabh; or Boualth Azi continuous launch (which may also be injection); or by implantation and supported. Alrabhe d crave be issuing ^ termination fixtures by bolus injection or continuously by infusion, or Wasit 0 of Wa, 0.101 of instilling 0

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00481.tif" id="idf0034" />

-47- -47-ΜΑ 33716Β1 an alternative or additional, can be given a composition topically for Hleriq instill membrane, or sponge, or other appropriate material can be done by absorption or b molecule Albarghob 0 DTM use means planting, it could be planting method in any tissue or an appropriate member, and Ahecn that aven deliver the desired molecule for deployment by, or bolus of 0 divorce 0 and profiteers, or a 0 Etae constant 0 are in order to give the drug, Hthela, Tgrh FGF21 was detected Ezhahma, Ezd specified rate Sptobabt can maintain the drug concentration when Stoy returned Elaji 1 for an extended period, to that point 0 e Ahecn Bam, a variety of different ways. Ne one illiterate; Ahecn termination 13:00 Boss 13:00 1 Dhi includes &amp; lt ;, and passes such as gelatin (Mtna, gelatin beef, gelatin, mortal, or Mmadr. Last gelatin) or can be used Bolier result of natural or generated Tkhalieia 0 Ahecn Adam any b are 1 to Berlbr &amp; lt; for example, gelatin) in the gel Mani, such as 5, 10, 15 or 20. / .. Joshua walked to my sister one's focus Avahp Z a variety of factors, such as therapeutic features one of Talo ^ d 1 to 1 kinetics Kwabh therapeutic molecule. Zstml examples of polymers that Bekn included in the gel German polyethylene glycol (&amp; quot; PEG &amp; quot;); chromatic ethylene oxide, polyethylene -CO- poly oxide polypropylene oxide, a block of CO- polyethylene oxide or polymers joint random, Bvel alcohol, poly (Phenyl Pirollidenon), acids (Looney Amin), dextran, heparin, poly Scared, poly ether compounds and the like. Last King of clear and taken into account when generating gel Mani formats in the degree of cross-correlation Apr 1 to gel and a German worker reciprocal interdependence. In a instantiations, Yale 0 Be the reciprocal interdependence achieved Khurd Thael treatment Mitt Acrylic includes meth acrylic anhydride. In some cases, it can be a high degree required Atrad Exchange while in other cases the preferred degree of less than 1 Pet Water Akedna 0 Ne some cases, the cross-correlation of the top cross-thread leads to lasting effect Atod. It can result in a higher degree of cross-correlation I gel mani more toughness and a longer period during which give conceded 0 can be used for any rate are the polymer to cross-correlation factor (Mtna, acrylic anhydride meth) to generate a gel Manny the properties required. For example, it can be a polymer rate I am the King of reciprocal interdependence Mtta 0.8: 1; 16: 1 '24: 1 or 32: 1. &amp; lt ;, for example, when logging Boulihr 1 to gel German is a gelatin, and a cross-correlation term for meth acrylate, it can Astkhadd 13:00 averages 8: 1.16: 1.24: 1 or 32: 1 of acetic meth Acrylic: gelatin. -48- 33716Β1 0 a- therapeutic uses for Tgd s Port polypeptide FGF21 can be Ahaddam mutations Bonnie strain FGF21 to treat, Ootchkas, Aotkhvev, Oomna a number of diseases or disorders, or cases, Ava in it, pardoned Q, Del Alhthal not limited to, metabolic disorders. In a instantiations, be the Aloda 0 rad turmoil treated Ebarh Z diabetes, for example, diabetes type 2. In another embodiment mellitus, Iike 5 turmoil will not Aloadma &amp; gt; Ebarh Z obesity. Other embodiments include cases or disorders such as a- Gahtor tuck one blood; and'ria blood pressure; and hepatostomy such as hepatitis Alggra is Alekhona (NASH); Ord bristly and Ouana, such as atherosclerosis; and aging. In the application, can be processed disorder or condition such as Mod 1 sugar or August and'lth Aet-termination Tgrh poly peptide FGF21 as described in this application AVI Rahish Apr 1 \ a facial 0 Les quantity &amp; lt ;, therapeutically effective dose. This can be an administration as described nee this Wasp 4, such as h; n IV 'or injection intraperitoneal, or injected into a muscle, or by mouth nee pictures tetter or - liquid 0 in most cases, can be given a desirable dose by a doctor processor , 0 as a de Auj in this one demand, and could represent a therapeutically effective dose of poly Tgrh Bptdd FGF21. Q6 roll Leko 7 z Alo's for those with skill in the field that will adopt effective dose therapeutically &amp; lt ;, Tgrh Duffy Sep FGF21; Hess to M'quboelmkhry, the schedule of administration and the unity of 1 to Jrah worker Alhatty, drug DTM Ate Ze A-nuclear or ponies; '.' &amp; quot; t yearning in Ha other therapeutic agents, the immune status and health of the future. Means of expression a therapeutically effective dose &amp; quot; As Ne user this one Wasp; that Khip 1 Buffy dam Tgrh FGF21 that occurs vital response seen Pharmaceutical ^ M. Sage, or Hiwane or Annan DTM Atdh Bo 1 middle researcher, or a therapist, or a practitioner of another, which includes pardoned - or 1 Z Herd or Ala- August that is being processed. 11. antibodies are expected antibodies and fragments of body Dad and I soils 0 for specifically I Looney Sedat for Tgrh FGF21 of the invention led Apr 1, but do not bind specifically Avi poly peptides to Tgrh FGF21 unhandled and be Duffy 0 toured Wallace Alhani. Can be numerous antibodies monoclonal antibody, in so many monoclonal Atdbh specifically; and Atdah antibodies (MAbs); and the product of the return of genetic Union; and Jimrah; and compatible with humans, such as the inlaid area identification tape (CDR); and b; bear Ende; / or Hmash specifically; no; also Tzaa 1; or 1 Tdkal Manlgh; or molecules chemically modified ones. Antibody fragments on those -49-ΜΑ 33716Β1 -49- portions of the antibody that Nsbt determine ί summit adhesive poly peptide Tgrh FGF21 include. Examples of such fragments include fragments F (ab ') j Fab generated by splitting enzymes to antibodies full length. Other fragments bind to those generated by DNA technology include the return of genetic Ntah Union, such as the product of expression plasmids return of genetic Union containing nucleic acid sequences vacated five variable regions of the antibody. The expression &amp; quot; link on some qualitative &amp; quot; When used in the context of an antibody, means that the antibody Ertbtabmstahedvh in the presence of a heterogeneous group of proteins and / or other other biological materials. In a manner Okir challenged, when the antibody is linked to a qualitatively Bmstahedvh, it means Azh under the conditions of a specific immune experience Msptha, the antibody is linked Bmstahedvh not linked by a set amount 10 other proteins present in the sample. Khaddam any format immune experience appropriate to identify an antibody which is related Bmstahedvh qualitatively, Mtna, tests of immune Nat solid phase ELISA. See Hthela, Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York. It is generally produce many antibodies directed to poly Bbdid Tgrh FGF21 antibody (Alyspit JLUI, rabbits or Vnran) by injection under the skin or inside the 15 multiple Albrighton poly Tgrh FGF21 polypeptide and an adjuvant. Can be useful poly peptide Tgrh accompany FGF21 protein to the holder which is immune generator species intended to be vaccinated, such as hemocyanin Aleriq, or serum, or albumin, globulin, or for the advancement of beef, Mibad trypsinize soybeans. Also, the use of the clustering of such chips to enhance the immune response factors. After immunization, the animals are bled and the serum is evaluated for antibody titer anti-Tgrh FGF21. 20 is produced monoclonal antibodies directed Nhoboli peptides Tgrh FGF21 using any method which provides Antah antibody molecules by continuous cell lines in a farm. Examples of suitable methods for the preparation of antibodies mono include monoclonal hybrid tumor d ways, .Kohler et al 97 -495: 256 1975, Nature and the way the hybrid tumor of B cells and human (SAL, 1984, Kohler 3001: 133 .Immunol; Monoclonal Antibody Productio 1. Brodeur et al 25 (1987, .Techniques and Application 51-63 (Marcel Dekker, Inc. without Alhogr invention also by hybridoma cell lines that produce monoclonal antibodies reactive p 0 poly peptides Tgrh FGF21. can be modified monoclonal antibodies of the invention for use as materials treatment. in a

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00511.tif" id="idf0035" />

-50- 611 &amp; lt;? &amp; Lt ;? 1 AAA-coming, the antibody is a monoclonal antibody &amp; quot; Jimra &amp; quot; ^ N heh &amp; lt; E Z heavy chain (Η) and / or light (L) matching 0 p or homogeneous to the succession debate in the i bodies; dispersant types of private Ooantmi to a class or subclass of antibody particular, while the one for the rest of Z Coterie (chains ) with matching or homogeneous to the succession debate in antibodies derived types are another 5 or belongs to Fannah or Fannah subset of antibody else. Almstml also be fragments of such antibodies newcomer 0 as long as they show biomechanical frightened. See, for example, the Terrorist RTM Patent 4,816,567; 55 -6851: 81 .Morrison et al., 1985, Proc. Natl. Acad. Sci. USA In another embodiment, a monoclonal antibody of the invention is a body x ^ d '' compatible with humans &amp; quot ;. Be ways to agree with humans to non-human antibodies known in the field. Azzer, sticking to fill the 10 1 Alohloah patents 5,585,089 and 5,693,762 numbers. As a handicap, you have to Djam Hiad compatible with humans Unit Construction of amino acid and one or more input in it from the source that is non Shri 0 could be reconciled with humans, for example, by using the described methods in the field (.ntr, for example; Jones et al , 1986, Nature 321: 522-25; Riechmann et -1534: 239 Verhoeyen et al., 1988, Science; 27-323: 332 al, 1998, Nature 15 36), by replacing part of the area on Alotl identify complementary areas corresponding rodents for antibody E. mortal. This is also one of the invention include human antibodies that bind urinary peptides boom FGF21 of the present invention. Using transgenic animals and genetically modified (such as Alphenran) that are capable of a 0 Yj Nukhaira technical antibodies mankind in the absence of the production of IgE immune endogenous, it is those are the 20 production Alodjaam anti immunization a generator against a derivative of the boom FGF21 (which Leko 7 has presented example A amino acids Tmasah at least), combined optionally with a carrier material. See, for example, -2551: 90 .Jakobovits et al, 1993, Proc. Natl. Acad. Sci. USA,. , 1993, Bruggermann et al; 58-255: 362 Jakobovits et al., 1993, Nature; 55 33: 7 .Year in Immuno. In one way, the production Nlk Alehiwanata modified Rathiaptattiyl 25 positions AAC 1 Yeh origin Nschwr globulin heavy and light chains in which the immune, and enter positions that Ttfr human proteins and heavy and light chain genes in their own group. They are then hybridized modified animals partially paralyzed animals which Boukon by less z full perfection of Tobeilat for animal contains all the required immune system modifications are 0 light of

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00521.tif" id="idf0036" />

-51- -51-! 33716Β1

Give generator immunotherapy, those genetically modified animals and produces antibodies Bmtoagliat amino acid (other than Kunhafr Yeh, for example) Ntdmn Almnahlq changing that are specific immune antibody generators mentioned. See, for example, the International Bulletin of international patent applications No. WO 96/33735, and No. 94/02602 WO. And Atamocef additional ways in US Patent No. 5 Bulletin 1 Kolahltlebatt patent 1 Kolahno. 91/10741 WO No. WO 90/04036, and in European Patent No. 073 546 0. It can also produce antibodies to human Balthabayr for the DNA of the output of the return of the genetic link in Oopaltmber family cells Hybrid tumor cells are also described here. In an alternative embodiment, it can also produce human antibodies from Tnehr groups -10 cells (see for Shal, Marks; 381: 227 .Mol. Biol RO, 1991, .Hoogenboom et al 581: 222 .Mol. Biol RO, 1991, .et al) and simulate these Aalaaat Alaztkhab Alhmaea &amp; lt ;, Zlal display rich ammunition antibody on the surface of viruses filamentary case antibacterial and 1 wolf Lash -almmelthmh be associated with antigen available. This is usually the production of antibodies Jimrah inlaid Bad CDR and compatible with the one for humans Bhlrq Matj Audh 15 genetic link. And the introduction of nucleic acid encoded antibody AVI Khalaa one family Oa- -13'ha using materials and procedures Almnkurh here. Ravi single instantiations, is a 0 Ij 1 Agam 1 mane in Khalada Tdbeh family, such as CHO cells may be the product of antibodies monoclonal (Bhrdh for u example) Balthabayr for the DNA result of a genetic link back to I-cell or Okir in Alhgeni tumor cells have also been descriptions here . 20 can be used antibodies boom stile d FGF21 of the invention in any b Ab 1 t known, such as competitive Association of tests and experiments involve direct and Hbeshr, and the experiences of Hersia p. 11 \ Ztr meant Sybil \ Httha, Techniques; 0 Monoclonal Antibodies: A Mannal 1 of \ 0 aa (1987 , .147-158 (CRC Press, Inc) 'atopic short C- this Baladawh a 0 les fully) r and determine amounts urinary peptides boom FGF21. And linking Glades Mufadh one of Bernie Women of Y-25 FGF21 intimacy that would be appropriate for the way the experience is one he repents. For diagnostic applications, in certain embodiments can Trevi 1 Agam Lhasa S 'anti d FGF21 part undetectable. Can Jze.lkabl for Ktaf that ϋ'βί any Fairsakon Aadra on Antah detectable signal whether it be directly or indirectly Hbeshr. He called 013 to 0.01 for example

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00531.tif" id="idf0037" />

-52- 33716Β1 part stainless revealed to be a peer-beam, Shell No 3 or 14 h or 32ρ or of 35 or 5 Ha or TC &amp; quot; Or In A '' or 67Ga, or a compound or a chemical brilliant meanings, such as ISO Theo cyanate colored brilliant or rhodamine or Yousefran or an enzyme such as alkaline phosphatase enzyme or enzyme β - Jalaktosedaz or enzyme peroxidase Z AST (63-138: 184 .Bayer et al, 1990, Meth. Enz). And adopt competitive binding experiments on standard No. capability (such as poly peptide Tgrh FGF21 or part of immunoreactive) to compete with the material being analyzed to test sample (such as urinary peptide boom FGF21) to connect with a specified amount of an antibody boom d FGF21. And commensurate urinary Mtdar boom FGF21 polypeptide in the test sample is inversely with the standard amount that becomes associated with antibodies. To facilitate determining the amount by which the standard becomes linked, are usually not melt the antibodies before or after the competition, so it is linked to the standard material and which are analyzed with antibodies can be separated properly from the standard material and which are analyzed, which remain linked. It includes caret experiments typically use two anti two objects, each of them will be able to link with various generator for immunity or the top of the adhesive protein that is detected Wa or quantify part. In an experiment to involve, it is usually linked to the material being analyzed for a sample test by an antibody first be installed on a solid carrier and then Arbt antibody second with the material being analyzed, and thus be configured complex is soluble in three parts. See, for example, US Patent 4,376,110. The second antibody can be the same numbering part undetectable (intercalation experiments directly) Ooimkn measured using antibody-resistant immune globulin are numbered part undetectable (involve indirect experiments). And it is, for example, a caret types of experiences in the experience of adsorption enzyme-linked immunosorbent (ELISA), and in that case be part stainless revealed an enzyme. The objects are also counter the surge of anti d FGF21 useful in imaging the health district. It can give an antibody numbered part undetectable to the animal, and preferably Ni-Ti one's blood, and Wood and determine the antibody No. place in the host that is being tested. The antibody can be numbered in any mow 0 be undetectable in the animal, whether it be nuclear magnetic resonance Oopalohah Bussell or other e-detecting known in the field. It can be used antibodies Tgrh FGF21 of the invention as treatments. These factors are therapeutic in general is a Meddat or antioxidants as they either enhance Ootkhvd consecutive WAC Jt 1 to less than 0 publicly biological Zhth of poly peptide boom FGF21. In a instantiations, objects -53- be ΜΑ 33716Β1 anti-anti invention is a counter or fragments of bodies, including the Association will be able to link precisely 0 p poly peptide Tgrh FGF21. And be able to discourage or remove functional effectiveness of poly PayPal Tgrh FGF21 in Cannon neighborhood or Kharah organism. Some incarnations, the antibody Athbhd of anti functional effectiveness of the poly peptide boom FGF21 about 50% at least, and in Mgdil about 80./Ο at least. In another embodiment, the antibody anti boom for FGF21 is capable of interfering with the interaction between the poly peptide Tgrh FGF21 and the future of FGF and so Athbhd or eliminates the effectiveness of urinary peptide boom FGF21 outside the organism or in the organism. The objects are identified anti Tgrh against FGF21 of anti-moded or liquidation experiences that are well known in this area. 10 The invention concerns Oadapmjmuah ensure antibodies Tgrh FGF21 and other factors useful in the detection of urinary peptide levels of FGF21 mutation in biological samples. And those factors can include a numbered undetectable serum conglomerate samples compared to positive and negative factors discovery. 1 Examples The following examples are illustrative of specific embodiments of the invention and its uses Almokhtlgh. This is a statement for the purposes of explanation only and should not be interpreted as Mqidh to the field of the invention in any way. 15 Example 1 to prepare constructs genetic expression of FGF21 20 was obtained DNA sequence that Chir urinary peptide FGF21 mature exaggerating the interaction of the enzyme polymerase chain (PCR) using the countryside containing Nakyotad sequences corresponding to the parties to a 5 wa 3 for succession mature FGF21. It features a table (2) prefixes that were used in the amplification of successive mature FGF21. Table 2 starters PCR to prepare the infrastructure FGF21 succession No. successive initiator 12a AAA 'A- 5' 3 in the direction of 13 copies 5LTAGTGAGCTCGAATTCTTAGGAAGCGTAGCTGG-3 'was not an anti 0'

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00551.tif" id="idf0038" />

-54- ΜΑ: 33716Β1

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00561.tif" id="idf0039" />

To the direction of copies used prefixes in the preparation of an enzyme positions internal Noukkiez Mtedh included in marginalized mature Dobeir 0 gene for FGF21 (Achl place Ndel Aydia on methionine party-genetic Alltobeir bacterial) cloning vector for the succession to the conveyor suitable expression (such as ρΕΤ30 (b

San Diego, CA; Biosciences) or Thousand Oaks, CA) pAMG33; Amgen)). 5 contains the expression vector pAMG33 on low copy number 100-R out of reproduction, and enhanced lac rate, and Jane C.s.esen resistance. It contains the expression vector ρΕΤ30 on the origin of the derivative &amp; lt ;, pBR322 for transcription, and an enhanced 17 retractable induce, and Jane kanamycin resistance. While he found that the expression of pAMG33 is the highest, it was found that the cloning vector ρΕΤ30 is reliable. Thus, most of the structures Almnkurh current detection was generated Olave ρΕΤ30 and Akhaddbert You de Psahlah. It was after 10 transfer sequences Alnkhtarh to pAMG33 also amplified. FGF21 was amplified sequence in the reaction contain 40.65 Maikarolter dH20 mixture, and 5 Maikarolter lengthy structured interaction 10) PfuUltra II times), and 1.25 Maikarolter mixture 40) mM dNTP Molar -4 * 10 mM Molar), and 0.1 Maikarolter Mrsaf (100 Nanojm / ml), and 1 Maikarolter first one (10 Makromolar), and 1 Maikarolter first two (10 micro Molar), wa Maikarolter enzyme 15 poly 0 Liraz A- 1 Dhuoa La Jolla, CA) PfuUltra II fiision HS DNA; Stratagene). It was conducted reactions amplification heated for two minutes at 95 ° C, followed by ten cycles at 95 ° C for 20 seconds, and 60 ° C for 20 seconds (with the introduction of 1 degree additional percentage each cycle), and 72 ° C for several 15 seconds / Iklhadh of gross required, followed by 20 cycle at 94 ° C for 20 seconds, and 55 ° seminal for 20 seconds, and 72 ° C for 15, 20 seconds, and 55 ° C for 20 seconds, and 72 ° seminal for 15 seconds / kg base of the required output, followed by d 72 ° C for 3 minutes. It was Ahtdham amplification products using enzymes Altaqbid endonuclease EcoRIj, Dpnl, Ndel, strapped in a suitable vector, then converted to Mzovsdh cells Example 2 purification FGF21 proteins from Aguirraa

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00562.tif" id="idf0040" />

25 55 55 1 33716Β1 nee following Alohthelh, was Sobeir genetic numerous FGF21 protein, urinary peptide containing FGF21 from 1 to Dhua untreated urinary peptides and Almchenbh FGF21 and FGF21 Brocivot Alazj Ne J 13:00 Akeber Alzh bacterial. After genetic expression, which is described below, was purified proteins Ji FGF21), for about Lalai described in this example, what did not deny otherwise. 5 and Tnqahalboly Women FGF21 are kind untreated, poly peptides FGF21 Mchenbh, and Tgrat FGF21 of the bodies of the inclusion of bacterial, Tat dissolving the bodies of flammable Holh Ri (DWIBs) in the melt structured solution containing hydrochloride 6 ace DTTj Ne lengthy 0 Zzm d Tris p pH 8.5. I have been Khalthm certain reminded of the rut of 1 cent h to Rose 6 saw him one Crvh; and esta A.d 1 FH mixture solvent to buffer solution hostile doubled, Woody u Jorda and; abomination f '0.1 hydrochloride Sastamen at pH 9.5 and Zalh ^ reminded Z 24 i 0 cent 5 ° C (see Elysepel example; 63-157: 9 .Clarke, 1998, Curr. Opin. Biotechnol, 1997, Rud.lph et ai; 34-1523: 97 .Mannall et al, 2007, Biotechnol. Bioeng Folding proteins, &amp; quot; Protein Function: A Practical Approach (Creighton, ed., &amp; quot; .and Ishibashi et al, 2005, Protein Expr. Purif; 99-57 (New York, IRL Press 15 1-6: 42). after melting and re-multiplexed, was nominated the mixture through a filter 0.45 microns. was then reminded the focus of re-multiplexed 10 times solution virtually using 10 kDa as a weight &amp; lt; Aia Q Hrehl Pall Omega Mgsol machining at a pressure across the endothelial (TMP) rate of 20 lb / ft light of, and the work of ultra-filtration using his 3 sizes columns of 20 mM Molar Tris; number Hedrojive 8 k 20 TMP rate of 20 pounds a square inch. it was then Alhqah sample is subjected to chromatography exchange anionic (AEX) using Radnj Q Sepharose HP. it was run calibrator written saline 0 n small to 250 milli Molar NaCl at 20 Whalley Molar when Tris pH 8.0 at 5 ° C. It was analyzed parts Tip Boath. And assembled. 25 were then subjected to assemble the output filter Ed AEX chromatography to hydrophobic interaction (HIC) have been-or vinyl resin Sevaros IIP. The protein has filtered using a linear scale reduced from 0.7 to 0 and lar small Molar of Amutiom sulfate at pH 8.0 and Alahabth degree heat. RTM analysis summit parts using Laemmli, 1970, Nature 227: 680-85) SDS-PAGE) and Tjd-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00571.tif" id="idf0041" />

-56- 33716Β1 was the focus of the assembly HIC using a 10 kDa molecular weight of 0.2 Pall Omega m2 bar Mgsol machining to 7 mg / ml when TMP $ 20 lbs / square inch. Ultrafiltration was the result of focus using 5 column volumes of structured solution formulation when TMP $ 20 lbs / square inch, was easing Nj demodulator to 5 mg / ml concentration. It was in the end the solution filtration through a membrane Bosidin 0.2 Micro Molar Pall mini-Kleenpac. To Tantih merger FGF21 proteins Tgrh fusion proteins FGF21 of antibodies inclusion bacterial, it has thawed objects inclusion washed twice (DWIBs) in the melt structured solution containing hydrochloride Joinedan DTTj in Tris buffer solution at the number Hallidrugeni 8.5 and mixed afterwards for one hour at room temperature. The added solvent mixture on the buffer solution Anaad doubled that contains urea and arginine and Cspn hydrochloride Sastamen at pH 9.5 and mixed afterwards for 24 hours at 5 ° C (see for eating 2007,4, Mannall et al; 63-157: 9 .Clarke , 1998, Curr. Opin. Biotechnol al., 1997, &amp; quot; Folding proteins, &amp; quot;; Rudolph g; 34-1523: 97 .Biotechnol. Bioeng Protein Function: A Practical Approach (Creighton, ed .. New York, IRF 1 -6: 42 .and Ishibashi et al, 2005, Protein Expr. Purif; 99-57 (. (Press after melting and re-multiplexed, was the work of separating a mixture of endothelial against 5 volumes of 20 mM Tris Molar, No. pH 8.0, using a separate pipeline Endothelial 10 kDa. it was adjusting pH to re-multiplexed separation membrane even 5.0 using acetic ο50 acid /. 'and then purified centrifuged for 30 min at 4 km. it was after that was Alnanagah sample subjected to Asnscherab ion exchange (AEX) using Ratj HP Q. Sevaros was running a linear scale from the small saline to 250 mM NaCl in 20 Molar Molar Haley when Tris pH 8.0 at 5 ° C. It was analyzed by the top portions

Laemmli, 1970, Nature 227: 680-85) SDS- PAGE) (f). It was then subjected to chromatography AEX assemble the filter output hydrophobic interaction (HIC) Bastkhadd 13:00 HP Sevaros vinyl resin. The Tat protein filter using a linear scale decreasing Z 0.6 0 lar to the small Molar ammonium sulfate at pH 8.0 and ambient temperature. It was prolong the summit parts by SDS-PAGE and assembled. ΜΑ 33716Β1 -6 (e) After step Ed HIC, was then Chapter membrane assembly d 60 declined Z Avlol 1 Tzm drafting. It was the focus of the assembly, which was the work of separating endothelial him up to 5 mg / ml Ba-M Pall Jumbosep. It was in the end the solution filtration through a membrane Bosid; P 0.2 Holar u Pall .mini-Kleenpac 5 Hadh and expression Alora 3 Z for Ajila FGF21 ùUjjjjj were prepared structures Alhishgrh proteins FGF21 Alhishzbh hydrogenation in the table (3) By Sjim PCR Lash '&amp; quot; ♦ 1: R. FGF21 are the types of non-processor is also described later (Twin is described for the carrier FGF21 expression of types 1 and SJ in Hthal!) 0 10 table 3 Chwibat FGF21 number Annanah units Ashdlh * Bannanah units of the amino acid to a party. Chwibat a 1180-1 2179-1 3178-1 4 \ 11 \ 5176-1 6 \ 15 \ 7174-1 8173-1 9172-1 10171-1 12169-113168 -114,167 to 1

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00591.tif" id="idf0042" />

-58- * For poly peptides mature FGF21. 15 166-1 16 165-1 17 164-1 21 160-1 25 156-1 29 152-1 32 149-1 68 113-1 Chwibat party - N 1 181-2 2 181-3 3 181-4 4 181 -55,181 to 6 6181-7 6181-8 8181-9 Chwibat party -C and -Ν 11 174-5 17 \ 11-1 20 169-9 40 149-9 26 169-15 46 149-15 82 15-113 33716Β1 1

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00601.tif" id="idf0043" />

33716Β1 f 5 was prepared FGF21 protein structures Almchenbh using primers that contain sequences that are similar to the areas before and after the coupon (or vouchers) that are exposed (resulting in pieces). And provide Altanjunt used in amplification reactions Almnkurh 15 Naklutid almost succession overlap to allow for the rotation of the output of the amplifier, a full carrier that currently contains the desired mutation or Alchwib. Charisma was FGF21 illustrations Almchenb, that there is a vacancy FGF21 protein which Eventher structural unit of the histidine at position-successive FGF21 mature preparation (ie boom Alchwib 2-181), using Altanjunt set forth in the table (4). Table 4 starters PCR to prepare Tgrh FGF21 Chwib illustrative

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00611.tif" id="idf0044" />

Be pipelined Crease (sequence number: 9) part of the poly-peptide FGF21 mature includes Mathonan ends -Ν, and be the second successive is the first direction copies (sequence number: 14), and are the third and fourth sequences (hobbies sequences Figures: 7 or 18) parts of the structures of expression for FGF21, and be the fifth successive first counter to the direction of copies (sequence number: 16):

MetHisProIleProAspSerSerProLeu

5'-GGAGATATACATATG-CCAATTCCAGATTCTTCTCCATTATT

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00612.tif" id="idf0045" />

CAGATTCTTCTCCATTATT -60-

-60- MA 33716Β1

TCTAAGAAGAGGTAATAA

'5-AAAACAAATTGAAATTCTTCCTCTATATGTATAC was prepared FGF21 protein structures Mchenbh using the PCR conditions Almnkurh in Example (1). It was Ahtdham amplification products using the restriction enzyme Nalkaz internal Dpnl and then converted a 0 Li competition 5 cells. It was Alastnsakat resulting sequence to confirm the absence of the enzyme Bollymraz generated errors. It was Ackbyr Azbrocanat FGF21 slimmed converted competitive BL21 (DE3) or BL21 fascinating Invitrogen; Carlsbad, CA) Star) using the encoded structure of the protein FGF21 Mchenb DD 0 was the shift factors throughout the night with limited ventilation among TB complementary using 40 Mkrojm / ml C.s.esen, and has ventilation in the next morning, after a draw Vasirh, was 10 to urge the 0.4 million Molar IPTG. It was harvested Tgrat FGF21 centrifugal 18-20 hour rather. Induction. Example 4 Hits Khar? Alcann District of Brocitat FGF21 has been conducting experiments to determine Almchenbh FGF21 protein , which is holding the effectiveness of FGF21 type 0 is 15 processor in the enzyme ELK - to Iossifraz experience outside Alcann neighborhood. Summarizes the table (5) Allantnj obtained for FGF21 proteins containing Chwiaat at the party - N party -C or when all of the party - N party and -C. ELK tests were conducted - to Iossifraz B1 use Nzlam human kidney cells to 293Τ Output Return genetic link where 293Τ cells express a Zand Z barriers 1 E Mnthah β -Klotho and the sender of an enzyme to Iossifraz. And also it contains these structures on sequences Almchgrh d 20 GAL4-ELK1. The sender of the enzyme to Iossifraz paid by booster has presented five copies tandem for the position of linkage Gal4. Β -Klotho is shared future be Htalobod along with Ed FGF21 to activate the FGF receptors and induce your own Wendell signal d 1 vinegar 1 cell, SPS in turn lead to the phosphorylation of Erk and ELK. The effectiveness of the enzyme is organized to Iossifraz level Ed Erk / Ilhamufgr, it is used in the event of indirect observation and repel the amount of FGF21. 25 experiments were conducted ELK -liossifraz 293Τ cultivation of cells in the presence of concentrations of poly Mokhtlgh Bouapd Tgrh FGF21 or FGF21 type untreated for 6 hours and test outputs of cell lysis after that to see the effectiveness of the enzyme Alliossifraz. Show Alohkl Q (aa-August) Ikh b FD 1 Mechanism ELK -liossifraz conducted on mutations Almchenbh 181 -7) FGF21) and (8-181) (in AA)

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00621.tif" id="idf0046" />

ΜΑ 33716Β1 -61- E. and families ton ^ 172 -1) FGF21) and (1-171) and (1-169) and (1-164) (d August) - the mother in Figure 2 illustrate Alomhny which was obtained in experiments ELK - Hser'z each Z mutations Aelchenbh 181 -3) FGF21) and (4-181) and (5-181) and (8-181) and (1-180) and (-178 a) and (1 -177) and (1-176) and (1-175) and (1-174) and (1-173) and (1-172) and (f -181) and (1-149). Were compared to poly peptides Tgrh FGF21 Ha FGF21 Z Azaa Gore processor standard Tefr't show the effectiveness of 50% persons are effective FGF21 0 n type is Alhaalj that has been pointed out that they do not Ndoye on the effectiveness of FGF21 missing were identified d &amp; quot; + &amp; quot; In a table (5) - Table 5 Brocanaq FGF21 Mchenbh: experience outside one Ts neighborhood Hnibat Alparty- C activity (+/-) Hits the building blocks of the amino acid ./.93.2 180-1 + 178-1 ./.95.0 a ./ .112.0 177-1 + ./.104.8 176-1; 174-1 ./1046 0 ./.96.1 173-1 + 172-1 ./.97.5 a ./.113.0 171-1; ./.84.9 169 -1 - ./.20 167-1 - 20 e /. 166-1 - 165-1 ./.10 Chwibat Alpartyt -Ν activity (+/-) Hits acid building blocks of the amino -62- 1015 a ./.112.5 181-2 t ./.130.3 181-3 A. /.117.0 181-4 181-5 of the ./.119.6, ./.74.2 181-7 - ./.24.9 181-8 - 181-9 ./.12.5 show Alztaij Aq- 4's or a 0 0 n many building blocks of Hed amino (Hthel FGF21 protein Almchenb of the most amusing -C Lalai Dndon z the building blocks of the amino acid (1-167) and shorter proteins) removes the effectiveness Ed FGF21. In addition 33716Β1

MK, it shows the table (5) that the manifestations Alhnt Party -Ν of seven or more Alouhd 1 T. Albmandh amino acid (such as protein FGF21 Almchenb party -N which Atko 7 &amp; lt ;, August 1 T. Albmave amino acid (8-181) and proteins shorter) removes Ed effectiveness of FGF21. F z dixM not surprising, it was found that Almchenbh FGF21 proteins that have a 1 st are Tchenb Alhlerv -Ν units Albz 1 by 8 to 14 and pruning party -C d 12 or 32 units constructivism lacks effectiveness in experiments ELK- to Iossiferraz. Consistent with the data presented in Table (5), Women FGF21 Almchenbh form the polyurethane Ashe Sha her Chwibat party -Ν less than seven building blocks of acid 1 to Omive -at current Alaxtoaa 0 In Maathl, form a urinary peptides FGF21 Almchenbh that without Hadsan Dalarv -C Least Z 13 The structural unit of the amino acid embodiments of the present invention. Shawl 5 Hits Kharah object health proteins Ed 0 Study be d FGF21 number of biological events that include the ability to Khgd blood glucose levels or insulin or triglyceride triple or cholesterol, reducing body weight or improve glucose tolerance or energy consumption or sensitivity to Azcolin 0 was O analysis &amp; gt; Dove Women FGF21 Mchenbh to see the effectiveness of FGF21 in Alcann neighborhood, Badechl Alerh ^ s FGF21 Ashnbh Vnran in ob / ob resistance to Arashwlin, measuring the ability of poly peptide FGF21 Mchenb particular on Khgd glucose

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00641.tif" id="idf0047" />

20 -63- 33716Β1 blood. It was Polycarbonate polypeptide FGF21 Almchenb which is tested in the peritoneum in the Far ob / ob age 8 weeks (lab Jackson), was obtained blood samples when Mokhtlgh time points after a single-injection, such as the small, 6, 24, 72, 120 and 68 of hours after the injection. Was measured glucose levels repent B1 use Z 1 glucose LifeScan, Inc. Milpitas, CA) OneFouch); and Dr. Z Results Ktvier percentage of glucose in the blood for the basic level of glucose in the blood (ie, the period when young). And be in shape (3) provide Ntanj one of the experiments that show the amount of glucose detected in the blood Jernan injected mutations (8-181) and (9-181) flexor g FGF21. This showed the experience that proteins Aondmaj FGF21 Almchenbh that Ztdmn (8-181) unit constructions of amino acid glucose appear in the blood, which reduces the effectiveness of the organism, however, be effective in Tgev less effective d FGF21 type is the processor at 3 and 6 hours after the injection, but the fusion proteins that include FGF21 Almchenbh 9-181) and the structural unit of the amino acid that does not Tzar effectiveness. Thus, the analysis in Alcann neighborhood of poly peptides FGF21 Almchenbh showed that Alhanaf to about 7 amino acids are Alparty- Ν LED FGF21 mature does not erase the biological effectiveness of the molecule (unlike analysis outside of the organism, which assumed that Alhanaf of seven amino acids of the party -N d FGF21 grownup could invalidate effectiveness. it can explain Ntanj difference obtained with urinary peptides FGF21 Almchenbh Balhlerv -Ν EXTENDED (Hil 8-181 FGF21) in experiments p 1 Kazn one neighborhood in Alkazn health interaction of FGF21 with β-Kl.tho and Msenthbl FGF in influencing converting the signal. in particular, active FGF21 complex dual future that includes a common future β -Klotho Oa- FGF (FGFR), which begins the sequence of signal transmission, which contains the enzyme tyrosine kinase. This is my one n party &amp; quot; N d FGF21 involved in connecting and activating FGFR while be party -C d FGF21 0 Talobh interaction Yie et al 2009 FERS Γ / ett. 583: 19-241 β -Klotho). The DTM views Alazz ^ ELK - to Iossifraz in 293 kidney cells, which are the expression Alzand where all Almsenthbl Alhishturk β -Klotho is expressed FGFR at normal levels. The amount of FGFR Mnknd b \ a ratio to that of B β -Klotho and Tkonzb β -Klotho Jeremiah FGFR in 293 Ed Jaihgervciologihouhouma can affect the composition of the future complex linking Aturabhalih group in the end Dr. Ed FGFR. Ed 293 and look in the lab system is too weak for the poly peptides FGF21 Almchenbh Balhlerv -Ν -64-

-64- MA 33716Β1 and can hold off his one intermediate product Z leads to Zil mutations Almchenbh party -Ν tested Mil 8-181 FGF21. Thus, in determining whether Nan S. FGF21 Father b 1 b 1 -N Lhv Qiv A- - FGF21 Q untreated, was considered Hits own mutant FGF21 Ne experience in one of the neighborhood quits Kazn one of them. Accordingly, the invention include urinary peptides 5 FGF21 flexor Ashe have Chwibath Party -N less than 8 building blocks of the amino acid. Example 6 to prepare a Altsd Ezo and must Tdt not? FGF21 due to the possibility of increasing the half-life of the protein-protein merging with 0 Twalah Fc 'as has been - and analysis of the merger proteins which include poly peptides FGF21 Mchenbh. Thader were Brociv 1 T. merger 10 FGF21 Almchenbh androgenization Ne table (6) 0 n sequences FGF21 inflated by SOEing (braiding By Jenny link interference) PCR. Was prepared Roe v ^ merger FGF21 '\ late been integrated Fc portion of IgGl gene for the human immune globulin (sequence number: 11) with either the party or the party -Ν -C protein FGF21. Table 6 link Fc place the building blocks of the amino acid Ttnsat party -C 15 2A 178-1142 A 175-1 15 -COOH 175-1 15 -ΝΗ2 171-1 15 -COOH 171-1 15 -COOH 170-1 Cinsat party - Ν 15 -ΝΗ2 181-5 15 -COOH 181-5 15 -ΝΗ2 181-7 15 -COOH 181-7

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00661.tif" id="idf0048" />

65- ΜΑ 33716Β1 Chwibat -C party and party -Ν 15 -ΝΗ2 175-5 15 -COOH 175-5 15 -ΝΗ2 171-5 15 -COOH 171-5 15 -COOH 170-6 35 -COOH 178-7 15; NH - 1-a? 1 \ 15 -COOH 1-of 1 \ 35 -COOH 174-7 35 -COOH Υ12-Ί 15 -ΝΗ2 171-7 35 -COOH 171-7 15 -COOH 171-7 was prepared specifically protein structures merger FGF21 (which includes those vacated Brocivat merger FGF21 Almchenbh) in a series of three reactions amplify used Amassi glare (P Almnkurh interaction in Mial (1) in the first reaction, has been designing a pair of Altanjunt to produce To'b contain the subject of cloning Ndel (ignites on methionine -Ν genetic expression of the bacterial) and 0 Ztqh Fc and succession link. in the second reaction, was Zdmam pair of Altanjunt to produce a succession contain 1 j pearl 0 the overlapping portion of the link and part of successive encrypted d FGF21, and the subject of cloning EcoRl. It was Ne end in the third interaction design a pair of prefixes for the purpose of connecting the outputs Altvaalan Alools. The DTM Ne table (7) the inclusion of a representative set of starters to form 1-181 FC-FGF21. table 7 consecutive number: successive reaction initiator (1) 19 5'-AGGAGGAATAACATATGGACAAAACTCACACATG-3 'direction

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00671.tif" id="idf0049" />

-66- ΜΑ 33716Β1 copies 20 5'-GGATCCACCACCACCGCTACCAC-3 'counter to the direction of the interaction of copies (2) 2150-30 direction copies 22 5'-TAGTGAGCTCGAATTCTTAGGAAGCGTAGCTGG-3' direction counter to the optimistic copies (3) 19; '- AGGAGGAATAACATATGGACAAAACTCACACATG-3' 22 copies direction counter to the direction of copies and was the result of the final Ahtdham interaction using enzymes Altaqbid Naklyaz internal EcoRIj Ndel strapped in a carrier ρΕΤ30 and then converted into a competitive cells. It was Alastnsakat resulting sequence to confirm the absence of the enzyme Bollymraz generated errors. Example 7 5 Hits in Alhi object to Brocaiat! Idmaj FGF21 Mchenbh been generating fusion proteins include succession FGF21 built with succession Fc and tested to determine effectiveness in Alcann neighborhood. FGF21 was prepared fusion proteins incorporating Almchenbh IgGl Fc molecule Ha -Ν either party or the end of the party -C Mchenb FGF21 protein to form a succession neighboring one. To Tmbez between mergers -Ν party and party -C, the merger FGF21 proteins which were 10 integrating molecule Fc with the end of the raft design -Ν protein FGF21 as FC-FGF21, and the integration of proteins in which the integration of the molecule Fc been with the end of the party design -C protein FGF21 y -67-

-67- MA 33716Β1, FGF2.-F. And d FGF21 be a number of vital events We cover the ability to Khgd blood glucose or insulin levels or cholesterol, reducing body weight or improve glucose tolerance and energy consumption, or insulin sensitivity. To evaluate the effectiveness of FGF21 in the organism, the poly peptides Tgrh enter 5 FGF21 and FGF21 poly peptides Andmaj Vnran in ob / ob resistance to insulin, and measured the ability of FGF21 protein specific to Khgd glucose levels in the blood. It was Polycarbonate polypeptide FGF21 or urinary peptide boom FGF21 or urinary peptide fusion FGF21 that is being tested in the peritoneum in Vnran ob / ob age of 8 weeks (Jackson) coefficient, were obtained Mokhtlgh blood samples when Nqahid of time after a single-injection, for example) small, 6, 24, 120 and 168 hours anymore. Do you were to measure glucose levels in the blood glucose scale LifeScan, Inc. ) OneTouch Milpitas, CA), and the expression of the results as a seminal Tvier of glucose in the blood for Msdoy basis of glucose in the blood (ie the time when the small). And be in shape (4) provide the results of one of the experiments that the percentage found Tvier Ne glucose levels in the observed blood in the Alphenran injected sample comparison PBS and Alolornh FC-FGF2 Z 15 ore type ensures 1-181 unit constructions of amino acid or merger of FC-proteins FGF21 0 Hzbh Cover 5-181 or 7-181 unit constructions of amino acid. This showed that one of the equivalents Brociv 1 v 1 to Atj FC-FGF21 Almchenbh that 5-181 or 7-181 unit constructions of amino acid Qzar include decreases the effectiveness of glucose in the blood Mmathlhlfalah FC-FGF21 of grazing Al Gore Alalj 6 hours DD injection. Thus, the analysis showed Alcann in the neighborhood of Bonnie peptides FGF21 thousands wed six Ohaad 20 amino Z orf -Ν for FGF21 mature for Atatheraly biological effectiveness of the molecule. However 'also additional analysis in the organism that has been Khgd Sedat FGF21 urinary ability, but ^ Las blood glucose and blood glucose levels returned Avi basis Hzd 24 hours after injection (been getting similar Ntanj using FGF21 type is Alsalj). It was found that deficiencies in one of Gaalah Apr 1 0 object to the neighborhood as a result of one n Say pressed for one of the proteins d FGF21, has also been described in Lal (8). 25 were eating (5) Ravi p Tbarbnz 1 Doanh p Afbh percentage of Tver Ne levels 1 to Jtmvi in ​​the blood of 0 to Hozh in Alphenran injected sample comparison PBS and Eivh Aq 1 Rlo FGF21-FC are Aldhua Z processor which includes 1-181 unit constructivism acid Alomenba, and Ross a 0 Ktj FGF21 - Fc Lap 1 includes the one who 1-175 unit or structural protein Fc.-FGF21 Father Lalai - 1-171 alone Pfave -68- ΜΑ 33716Β1 amino acid. The Tzar this experience it would be t ^ FGF21-FcJ 1 beam is Lalai Zlen processor 181-1 Unit structural amino acid effectiveness decreases glucose Hmtdh Woody Avi cut in Staiwiat glucose in the blood by about 30./Ο almost over a period of time Hisharha 24 hours AVI 120 Sala DD injection. And Qzar FC-FGF21 protein Almchenb hurt - 1-171 unit of constructivism Hialomive 5 decreases the effectiveness of glucose in the blood become clear only later Az 72 meekness must ESL. O reminded 'Sha Hits remarkable similar to the effectiveness of FGF21-FC Z type is Avalj. O reminded 'Asilyh be similar Altahozh of the effectiveness of FGF21-FC are the kind untreated. Nor Dkon Ross Alaij- FGF21 Fc Almchenb which includes 1-175 unit constructivism active in one neighborhood in Ih one cut does not do 0 1 Skoz in the motherland. 10 describes the overall experiences Alchwib Almnkurh here that the routines merger FGF21 Almchenbh that have Chwib party -Ν Tzar effectiveness decreases blood glucose similar to dunk Alkhash Brod Alamaj FGF21 0 n type is the processor and also show those special proteins Alandmaj FGF21 Almchenbh that are Vihadmj molecule Fc Ha -Ν the end of the party for Bruce FGF21 Father greater effectiveness of the merger proteins which integrate Fc molecule Q orf -C Wash is 15 FGF21 Almchenb. Example 8 1 Hohzattala FGF21 in 1 Sak was first note decomposition FGF21 using panicking merger FGF21 Fc protein function are also given Zzk described in Example (7). Pharmacokinetics analysis in Alcann neighborhood showed that Ed human FGF21 his age three descriptive 20 short by about an hour in Alphenran as a result of the liquidation of the rapid decomposition in Alcann neighborhood 0 was Balt 0 Affi under 0 E. half-life Dr. FGF21 integrate succession Fc with the end of the party -Ν -or- C for poly peptide 0 will then Han merger region Fc does not fully distinguish the issue of half-life as the merger proteins that Hamad succession was the Fc 0 p end party -Ν F. C for Purbptid FGF21 (and Bakadid Ahajat FC-FGF21 'E. any which are integrated Ed Fc succession with the party - Ν d EGF21 mature, do not show the effectiveness of 0 to expect in the 25 Alcann neighborhood, and found instead that it maintains effective Khgd glucose in the blood while not increased in Z 24 hours Vnran 0ob / ob and as described in Figure (4) E Khgdt Rotivat a 0 Ztj FC -FGF21 of glucose levels in the blood by about 30-40% at 6 hours after Ain; Ne crave returned glucose levels in the blood, I basically levels at 24 hours.

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00701.tif" id="idf0050" />

-69- ΜΑ 33716Β1 thus were discussed the case of protein decomposition d FGF21 0 n type is the processor, and found that the rapid loss of efficiency in the neighborhood Alcann using fusion proteins FC-FGF21 as the result of the decomposition of FGF21 in the organism. The lead case decomposition of protein to the biological effectiveness of the discount Ae Nee Akazn \ neighborhood and thus to listen effectively shorter life affects decomposition adversely Aladam treatment 0 me for that molecule. According to it, resulting in significant degradation of proteins merger FGF21 Fc we discuss the case of decomposition Abrocan d Alcann FGF21 in the neighborhood and determine Tgrat FGF21 that were resistant to this decomposition. To determine the decomposition Places, was an analysis of LC-MS and sequence of addiction pardoned Brodbnat Azdhaj FGF21 and FGF21 Fc human type is the processor obtained when Mokhtlgh time points after injection in Vnran C57B6 Nkur. And helped addiction sequence to confirm whether the end of the party or the party -Ν -C protein is subject to degradation. When it was merged succession Fc with FGF21 pustulation party ^ E Wad that decomposition occurs when the peptide bond between the building blocks of the amino acid 151 and 152 will Alodat Albmandh amino acid 171 and 172 of the part of the human FGF21 molecule merger Azm 1 d Qrham unity structural previously successive mature FGF21 does not include a ^ E to Fc Pro; 1 yen to Aktj). Ua found that degradation at 171-172 occurs first, and was followed by degradation Az 151-152. Woody 1 Say Zd 72-171 for specific step rate and plays a role in the half-life of Dzhe. When it was merged succession Fc 0 p party -C d FGF21, it found that the decomposition occurs when the association between the peptide building blocks 4 and 5 of the amino acid and the structural units 20 and 21 of the amino acid. As a result of these experiments, it was pointedness that succession Ed Fc Tzar protect the part of successive FGF21, which is adjacent to the Fc succession of decomposition. It was also a result of a 0 Ttid to Athll in one object to one neighborhood to brusk and mergers FGF21j FC-FGF21 Z Bio E. untreated monkeys in Sinomolojus. These studies confirmed that the subject of fission LED FGF21 when building blocks 171-172 is the main place to be biodegradable in monkeys and he is maintaining the position of the decomposition Almnkur between Alvoriaat and Alrnnisyat. Example 9 determine Tgr s resistance to degradation Aleriutah d FGF21 have been identified Tgrat FGF21 suitable demo specifically for positions succession FGF21 type Z E processor, which the positions of the effectiveness of proteolysis main replacements were introduced Ddna acid until a certain at this 5 positions. Amoebic acid substitutions were dependent on maintaining successive FGF21 with other types (as described in Example 8) and maintain with biochemical building blocks -70- ΜΑ 33716Β1 another amino acid. And are in a table (8) provide a list of Bastbdalat amino acid that has been or may be entered in the FGF21 protein type is the processor. And Nttabq number of positions specified in the table (8) with the position of the structural unit in the mature FGF21 protein, which consists 0 n 181 units structural amino acid. Table 8 building blocks mutagens d FGF21 mutations unity constructivist original position of the amino acid Gin, Ile, Lys Arg 19 His, Leu, Phe Tyr 20 Ile, Phe, Tyr, Val Leu 21 Ile, Phe, Val Tyr 22 Ala, Arg Pro 150 Ala , Val Gly 151 His, Leu, Phe, Val lie 152 Ala, Asn, Asp, Cys, Gin, Glu, Pro, Ser Gly 170 Ala, Arg, Asn, Asp, Cys, Glu, Gin, Gly, His, Lys, ser, Thr, Trp, Tyr Pro 171 Leu, Thr ser 172 Arg, Glu Gin 173 10, 0 tha 7 Ylvialkd District to analyze the FGF21-FCJ FC-FGF21 was d stability of proteins Anmaj FGF21 Fc in Alcann neighborhood injected Algiran protein merger, pulling the blood of mice when Nqahid different time, and analysis of serum Bagay 1 x Lacy Ai b 1 Aszhab Aand (LC-MS). Specifically, it was in the peritoneum injection Alphenran d 10 mg / kg Z -Fc G5) -FGF21) (RTM succession: 107) (expressed in E. coli and purified Ahresaa has also been described in the then -71- -71- 1 33716Β1 Example 2 ) or FGF21- (G3) -Fc (expressed in mammalian cells and pious according to the standard) standards. It was pulled blood from Alphenran at 6, 24 and 48 hours after injection (Table 9) and collected in tubes EDTA pre-treatment Bmkhalait enzyme inhibitor protease (Roche Diagnostics has been plasma season by 1 to expel Alhrkza samples at 12.000 gx for 10 minutes. It was purified affinity proteins FGF21 are blood using 5 resin Oquz Fc Anti evil. table 9 curses FGF21 blood Almshoy given protein sample 6 hours Fc- (G5) -FGF21 D6 24-hour Fc- (G5) -FGF21 D24 48-hour Fc- (G5) -FGF21 D48 6 hours FGF21- (G3) -Fc Ε6 24-hour FGF21- (G3) -Fc Ε24 48-hour FGF21- (G3) -Fc Ε48 by analyzing samples affinity purified by LC-MS, protein standards were analyzed 0.1 reference. It was either cut using protein standards Tris [2-carboxy-ethyl) 15 phosphine (TCEP) or is reduced. Standards have been discounted and non-discounted analyzed by LC-MS using the ACE Ciano in 0.3 mm X 30 cm column Ha spray outflow from the column in the spectrometer Alki_ to hold traditional LCQ ion. And where the spectra demilitarized gyri discount for the purest samples, it has been Khgd pure intimacy samples analyzed by LC-MS. And are in Alohkl (6a -6 d) a statement Altahozh blocs standard Fc- (G3) -FGF21 diluted samples 15 D6 and 024 and 048 and are in the forms (7 a -7 d) a statement Altahozh blocs standard FGF21 - (G3) -Fc samples E24j Ε6 and 48 h. It was subjected to some of the standard filter and outputs the sample sequence addiction Edman to confirm -Ν of proteins and fragments party has also been identified by LC-Μ, and are in the table (10) providing Ntanj LC-MS analysis of standards and samples. 20 Table 10 Ntane prolong LC-MS and unexpected fragments

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00731.tif" id="idf0051" />

-72- ΜΑ 33716Β1 Hzbh Party -Ν smooth Aqglim Mlhunlh key blocks sample FGF21 Yes 414-1 45.339 Dalton Fc _ (G5) _FGF21 valuable one Yes Seah 414-1 404-1 45.338 44.317 Dalton Dalton D6 Yes 404-1 44.321 Dalton D24 Yes 404 -1? 44.327 42.356 Dalton Dalton D48's wallets 410-1 410-1 46.408 Dalton (address Paljlecosal; 0 e) 44.964 Dalton (untreated FGF21 _ (G3) -Fc valuable one Seah not 410-5 410-5 45.963 Dalton (address Paljlecosal; 0 e) 44.516 Dalton (untreated Bazkostl) Ε6 not 410-5 410-5 410-21 45.963 Dalton (address Paljlecosal GOf) 44.526 Dalton (untreated Bahalkoshal) 44.130 Dalton (address Paljlecosal; 0 e) Ε24 not 410-5? 410-21 Dalton 45.984 44.130 Dalton 44.022 Dalton Ε48 as shown in the table (10), each of certain samples of pure intimacy degree of decomposition showed after 6

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00741.tif" id="idf0052" />

33716Β1 -η &amp; gt; - just hours rotation. After 24 hours of rotation, the main output d Fc - (G5) -FGF21 fragment consisting of structural units 1-404 Alamana acid, which has been described in each of the samples Ej D. However, the main output 4 FGF21- (G5 ) - Fc in samples E is a fragment of the structural units are comprised 5-410 amino acid resulting both Brrtanat merger tested, was part of the FGF21 protein merger susceptible to degradation in a very large part of the Fc protein. Example 11 preparation Walt * Bereshrah for Tgrat FGF21 resistance to overlook protein were prepared structures' to encrypted Tgrat FGF21 listed Ne Mall (11) - PCR for distraught one to express FGF21 type is the processor are also described later (is described formation conveyor 1 to express FGF21 are type is processor in example 1). When the link is embedded in the portion of origin, the link Alzlatkhaddmkan L15 &amp; quot;) GGGGGSGGGSGGGGS &amp; quot; ' Htoalahno.: 28) was Agvihzh 1 near Hutobb FGF21 mutants that are resistant to degradation and Tzar protease Insaf Oaar longer. Table 11 Tgrat FGF21 protein resistance Sell

Link Fc mutation (mutations) R19I L15 -COOH R19I L15 R19K L15 -COOH R19K L15 R19Q L15 -COOH R19Q L15 R19K, Y20H L15 -COOH R19K, Υ20Η L15 R19K, L21I L15 -COOH R19K, L21I L15 R19K, Υ20Η, L21I - 74- 1 33716Β1

L15 -COOH R19K, Υ20Η, L21I L15 Y20F L15 -COOH Y20F L15 Υ20Η 115 -COOH Υ20Η Y20L L15 -COOH Y20L L15 Υ20Η, L2H L15 -COOH Υ20Η, L2H L15 L2H L15 -COOH L2H L15 L21F L15 -COOH L21F L15 L21V L15 -COOH L21V L15 L21Y L15 -COOH L21Y L15 Y22F 115 -COOH Y22F 115 Υ22Ι 115 -COOH Υ22Ι 115 Y22V L15 -COOH Y22V L15 Ρ150Α L15 -ΝΗ2 Ρ150Α L15 -ΝΉ2 P150R L15 Ρ150Α, G151A

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00761.tif" id="idf0053" />

-1¾MK 33716Β1

L15 -. ,,, 2 P150A, G151A L15 Ρ150Α, I152V L15 -ΝΗ2 Ρ150Α, I152V L15 Ρ150Α, G151A, I152V L15 2 A- Ρ150Α, G151A, I152V L15 G151A L15 2 a G151A L15 G151V L15 -ΝΗ2 G151V L15 G151A, I152V 115 -ΝΗ2 G151A, I152V L15 I152F L15 2 A- I152F L15 Ι152Η L15 -ΝΗ2 Ι152Η L15 I152L L15 -ΝΗ2 I152L L15 527 a 1 L15 G170A 115 G170A L15 G170C L15 -ΝΗ2 G170C L15 G170D 115 -ΝΗ2 G170D 115 G170E 115 -ΝΗ2 G170E 115 G170N

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00771.tif" id="idf0054" />

-76- - L15 -ΝΉ2 G170N L15 G170P L15 -ΝΗ2 G170P L15 G170Q L15 -ΝΗ2 G170Q L15 G170S L15 -ΝΗ2 G170S L15 G170E, Ρ171Α L15 -ΝΗ2 G170E, P171A L15 G170E, S172L L15 -ΝΗ2 G170E, S172L L15 G170E, P171A , S172L L15 -ΝΉ2 G170E, P171A, S172L L15 Ρ171Α L15 -ΝΗ2 Ρ171Α L15 -ΝΗ2 P171C L15 -ΝΗ2 P171D L15 -ΝΗ2 Ρ171Ε 115 -ΝΗ2 P171G 115 -ΝΗ2 Ρ171Η 115 -ΝΗ2 Ρ171Κ 115 -ΝΗ2 Ρ171Ν L15 -ΝΉ2 P171Q L15 - ΝΗ2 P171S L15 -ΝΗ2 Ρ171Τ L15 -ΝΗ2 P171W 115 -ΝΗ2 Ρ171Υ

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00781.tif" id="idf0055" />

11Λ &amp; lt;? &amp; Lt ;? 1 -66-

L15 Ρ171Α, S172L L15 -ΝΗ2 Ρ171Α, S172L L15 2 A- S172L L15 S172T L15 -ΝΗ2 S172T L15 Q173E L15 -ΝΗ2 Q173E L15 Q173R L15 -ΝΗ2 Q173R were prepared Tgrh structures FGF21 using Tanjunt includes sequences that are similar to Mnahlq before and after the coupon (or coupons) that is causing the boom. It has also provided the prefixes used in the amplification reactions Almnkurh c 1 Neklertad for succession overlap to allow for the rotation of the output of the amplifier, which is full of the carrier boom now required. It was prepared boom FGF21 illustrations, in which there is a vacancy boom FGF21, which have a structural unit of the glutamic acid at position 170 instead of the original structural integrity of the structure of glycine (ie, mutation G170E), using Altanjunt eyelet in the table (12). Table 12 PCR primers to prepare Tgrh FGF21 illustrative sequence number: sequence initiator 23 5'-ATGGTGGAACCTTCCCAGGGCCGAAGC-3 'transcription direction 24 A- 5 counter to the direction of GGAAGGTTCCACCATGCTCAGAGGGTCCGA-3' copies allow prefixes set out in the table (12) 'to replace the unit for construction of glycine structural unit of acid glutamic as shown later, where Alehtoalah one of the top Ebarh z ^ commencement in the direction of Alzs 6 -78- 33716Β1 (sequence number: 23), and are second sequences and third (consecutive No. 25 and No. 27) parts of FGF21 expression structure, be pipelined the fourth is a first counter to the direction of copies (sequence number: 26).

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00801.tif" id="idf0056" />

Was prepared structures boom FGF21 using the PCR conditions Almnkurh in Example (1). It was Ahtdham amplification products using enzyme Nklyaz restrictive DPnl, and then converted to Tmavsah 0 cells were Alastnsakat resulting sequence to confirm the absence of an enzyme generated by Albolamraz errors. It has just been fusion proteins FGF21 - (L15) -Fe Fc- (L 15) -FGF21 the Z, ho Mosofhia in Example 6. It was FGF21 expression Aztgrat transferred cells (BL21 (DE3 competitive or BL21 Star (Invitrogen; Carlsbad, CA) using the infrastructure encrypted certain Tgrh. It was the growth of the transferred material throughout the night with limited ventilation among TB complementary using 40 Mkrojmamna Carr C.s.esen been ventilated in the next morning, and was urging them after a draw Gahakeh Ne 0.4 Haley Holar IPTG. were harvested urinary peptides boom FGF21 centrifuged for a period of 18-20 λίί ^ d mowing 0 was also mutation analysis of FGF21 to see the expected immune nascent and blood - immune responses against proteins to address the antigen and Alntdam in the position of a link to a class 4 II contract opportunities Htuaq Ha tissue (MHC). and have this overlap is required to help the cell -Τ in browning antibodies that characterize the protein, which is highlighted positions Association Dzenat Category MHC 'II' P; FH Ahin 1 Kzba whether the protein quality sequences that Ahecn sprayed with a series Z Alolod Hazah 0 and has been the synthesis algorithms computer relies on references Osg worker know one Veh nor the category of MHC ' II in determining whether the peptide amino acid sequences Khli a 0 McCabe to break Althal Afoua 0 0 Adam was ΤΕΡΙΤΟΡΕ program to identify her if he could raster mutations in FGF21 Tgrat specifically to increase the quality of Τ cells to antigen for the majority of evil. Depending pardoned gimmick 1 st its core one of Bruce A- each Tgrh FGF21, a can 0 Nalehtoqaloas families to MSAS Zack immune · - 0 La6-shawl 12 Effect of succession link on the decomposition of FGF21 to determine whether the presence of continued amino acid long between successive Ed Fc and successive FGF21 Bather on the decomposition of Ed FGF21 , was injected Alphenran proteins merger FGF21 that Fml 5 region Fc was where all the successive FGF21 by 15 and out of the amino acid his successive GGGGGSGGGSGGGGS (dam &amp; quot; 15 a &amp; quot;) Toallono..'28) E was 0 Ibdmsasn at different time points, were serum analyzed by LC-MS . Specifically was injected Alphenran using Fc- (L15) -FGF21 or L15) -Fc) -FGF21 (been Alhsolelaha 0 Nahresaakulaa) Hzd 23 E. mg / kg, and was drawing blood at 6, 24 and 48 hours, and was purified familiarity of blood drawn using Radnj E. 10 Fc Oquz anti-human. Before pure samples Boisatth LC-MS analysis, the analysis of protein Fc- standards (L15) -FGF21 1 reference. It was either Khgd protein standards using TCEP or not reduced. It was analyzed both the discount and non-discount criteria by LC-MS using the ACE Ciano in 0.3 mm 30 column X cm Ha outflow spray are column in Matthias nice mass fraction is found to hold the ion 15 Alnthleeda LCQ and where the spectra prevent gyri discount samples purest, was Khgd familiarity samples E. purified by Bad LC-MS analysis. E are in Figures 8 (a -8 d) A statement of the significant blocs of samples Please choose a pure record and landscapes - (15 Fc- (L E. FGF21 reduced, drawn when Mokhtlgh points in time. This is in the forms (Wa -9 d) A statement of the significant blocs E. samples Please choose a pure FGF21 - (L15) record -Fc and landscapes drawn Andanagat time Mokhtlgh. were subjected E. 20 some standard filtering products and the sample sequence addiction to confirm the party -Ν of proteins and help in predicting the identification of fragments perceived by LC-MS., and are in a table (13) to provide the results of the analysis of Ed MS -LC standards and samples and indicate fragments expected. Ntanj analysis of LC-MS and shrapnel Alatoukah party sound -Ν Sliver percentage of each noticeable key blocks sample FGF21 Yes 424-1100 AH / AH 46.002 Dalton Fc- (L15) -FGF21 valuable one Seah Yes 424-1 65% 46,000 Dalton Fc- (L15) -FGF21

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00811.tif" id="idf0057" />

80- 33716Β1 414-1 ./.35 44.978 Down 6 hours Uncle 414-1 ./.85 44.978 Dadon Fc- (L15) -FGF21 394-1 ./.15 43.022 Down 24 hours Yes 414-1 ./.60 44.976 Down Fc- (L15) -FGF21 394-1 ./.40 43.019 Down 48 hours Yes 424-1 ./.100 45.999 Daldon FGF21- (L15) -Fc harsh Yes 423-1 ./.100 45.870 Down FGF21- (L15) -Fc 6 hours some thing E 423-1 ./.40 45.869 Down FGF21- (L15) -Fc 423-6 ./.35 45.301 Down 24 hours 423-22 25% 43.460 Down some thing E 423-1 ./.15 45.870 Down FGF21- (L15) -Fc 423-6 ./.20 45.297 Down 48 hours 423-22 ./.65 43.461 Down degradation after just 6 hours L 31 AA Ztaat affinity purified samples degree as e Mddz 0 0 ) s, somewhat, Z Curran 0 d 24 Aaeh 0 n Adan 0 The outputs Alriasahl - Fc- (L15) -FGF21 Adra Z Hzabaa consists of 1-414 unit Bmaiah - Ohive (85% 0 n b) and 1-394 (15 / 0.0 n Alaivh) , The main outputs d FGF21- (L15) -Fc Ebarh z z fragments 1-423 alone the 1 st of les Hmkhr 4 0 but Ive (40./Ο from 1 to Aivh) and 6-423 (35./. z sample) and 22-423 (25./ . Z August) -0 Baanloatazhtardhsrlat FGF21- (L15) -Fcj Fc- (L15) -FGF21 in the Sma 1 (10a) and (10b) Ely, respectively. Example 13 λμΐ's Elk 1 independent since \ 1 * ùfijjjl) jy λ * βΔ \ Fc- (L151-FGF21 ύ \ β7 1-7 for «* per ton for As described here, the fission case of protein depends, for proteins merger FGF21 Fc on the direction of succession Ed Fc, with the party making the Fc fusion protein fixed more Z 1 Lhv FGF21 protein fusion (ie, found that the party is part -Ν proteins merger Fc - (L15) -FGF21 and part -81- - party -C proteins merger FGF21-- (L15) is very persistent -Fc). It was, for example, determine the fission at position 5 and 21 ^ FGF21 - (L15) -Fc and placements 151 and 171 g - (5 Fc- (LI FGF21. As a result of these observations, has been conducting research to determine Tgrat FGF21 resistance to proteolysis 0.5 shows the decomposition of LC-MS d Fc - (L15) -FGF21 for the decomposition of biodegradable protein in the first quarter Alcann happens between the structural units of 171-172 amino acid, followed by degradation of the structural units of 152-151 amino acid. The clump decomposition case of Brodan at position 171, could Mia fission -ΜΓ- position 151, wedge half-life effectiveness of the molecule. However, it can also be mutations Almtaomh of hydrolyzed protein which prevent fission is at position 151 building blocks at position 10 thus lead Eyre molecule lost for the last ten amino acids, which are known Ptdmanhave linking common future P-Klotho; which rings a specific affinity for the future Aturabhalih Group and effectiveness outside the organism in Alcann neighborhood. Thus, it appears' to modify the genetic building blocks of the amino acid that surrounds the site 171 in the mature FGF21 to be Hrjajaddavi improve consistency in Alcann neighborhood and effectiveness in the effectiveness of the molecule. 15 neighborhood mutations Fc (l5) - (Ll5) -FGF21 resistance to decomposition Arutin injected Algiran ob / ob in Albrighton boom FGF21 'and withdraw blood samples are Algiran Mahtonh when small and 0.25, 1, 3, 5 and 7 days after injection and measurement of blood glucose levels later in the samples. And be in shape (11) to provide the results for one of the experiments, showing the levels of glucose in the Almtash blood in Algiran injected with a sample Almtarnh PBS or comparative sample 1 (sequence 20 No: 49) or bulletins Fc (15) _ (L15) -FGF21 will fc (15) FGF21 G170E (Habertm 0.51) or Fc- (L15) -FGF21 Ρ171Α (MTW 1 Maly number: 53) or Fc- (L15) -FGF21 S172L (MTW 1 Mechanism Ravi 55) or (Fc- (L15) - FGF21 (G170E , Ρ171 A, S172L (1 st b Ravi 59) or Fc- (L15) -FGF21 G151A (sequence number: 61). Figure (12) percentage of Tver in E. blood glucose levels are also identified in this experiment. the Tzar this experience mutations -Fc e 25 L15) -FGF21 G170E) 4 Fc- (L15) -FGF21 S172L 'Fc (L15) -FGF21 Ρ171Α, and! (Fc- (L15) -FGF21 (G170E, Ρ171Α, S172L I Arz S Apr 1 km E of bad effective for about five days, which exceeds the effectiveness of Fc - (L15) -FGF21 dilatable is Alanaalj. And improves S 'Fc- (L15) - FGF21 G151A Dzveavkteftrh 1 Jokoz Apr 1 km Ashe Tkhvhish 1 Silaya -82- -82-ΜΑ 33716Β1 Palmgarzh h Ross Alandmaj Fc- (L15) -FGF21 type Z Alzaalj. d Hdhish, Huda Allergmhnon boom Fc- (L15) - FGF21 S172L not z Tirat 1 st Om not Asa 'and Y have the appearance of cheering 0 corresponded such as 1 cured Sep Fc- (L15) - FGF21 Z Aldhua Z Slj, Heq Wad that this boom shows improved effectiveness in the organism compared with the Punic Dashd Fc- (L15) -FGF21 type untreated. This is shown in Figure (13) providing Ntanj another experiment, glucose levels was found in 1 km measured in the injected sample comparison mice PBS or the comparison sample Fc- (L15) -FGF21 or _ (Fc- (L15 FGF21 to Surat (Fc- (L15 ) -FGF21 (Ρ150Α, G151A, I152V (H'b Ravi 65) or G170E 1 (sequence No. 51) or (Fc- (L15) -FGF21 (G170E, Ρ171Α 10 (Htoalah number: 63) or (Fc- (L15 ) -FGF21 (G170E, S172L (Htoalahrvi 67). o (14) percentage of Tvier in blood glucose levels as specified in this experiment. Luca is the case nee mentioned earlier experiment, the Brosalazdhaj FC-FGF21 type is the processor and Dynasty ( Fc- (L15) -FGF21 (Ρ150Α, G151A, I152V not z 8 Phys I Waddle in the antipyretic efficacy of blood due to decomposition potentially at position 171, which can Aashr happen 15 and the return Matoyat blood glucose animals injected these proteins AVI basis after 24 hours Hnalhakn . However, you receive Fc- (L15) -FGF21 (G170E, 'Fc- (L15) -FGF21 G170E (Ρ171Α' or (Fc- (L15) -FGF21 (G170E, S172L nation I in 1 km until about 5 days after injection, which exceeds Brodan merger Fc- (L15) -FGF21 type is Alzajawaltgrh (Fc- (L15) -FGF21 (Ρ150Α, G151A, I152V. 20 is shown in Figure (15) providing Ntanj another experiment, glucose levels was found in the blood measured in Alphenran injected sample comparison PBS or Fc- (L15) -FGF21 mutations 1 G170E (Mtwalahno.: 51) or G170A 1 (Htoalahno.: 69) or _ (Fc- (L15 FGF21 G170C (Hawalahrfm: 71) 1'Fc- (L15) - FGF21 G170Dj (Q 1 Prvi 73) or 0FGF21 G170N (Fc- (L15 (^^ 8: 75) or Fc- (L15) -FGF21 G170S (u 1 25 No: 77). and the figure (16) percentage of Tgber in glucose levels blood also be determined in this experiment. showed both Tgrat FGF21 tested in this experiment the effectiveness decreases glucose stretching effect in the blood for about 5 days after injection. this is shown in Figure (17) providing Ntanj other experiment showing glucose levels Almtash blood

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00841.tif" id="idf0058" />

-83- - In mice injected with the PBS or one of Ed caper data Fc (L15) -FGF21 G170E (Mtwalahrtm: 51), or Fc- (L15) -FGF21 Ρ171Ε (Htoalahno.: 79) -or- (Fc- (L15 FGF21 Ρ171Η (Mnualbh number: 81) ^ Fc- (L15) -FGF21 P171Q (0 Twalahrtm: 83) or Fc- (L15) -FGF21 Ρ171Τ (sequence number: 85) P171Yj1 1 (sequence number: 87). Figure (18) percentage percentage of Tvier in blood glucose levels as defined in this experiment. showed all mutations FGF21 tested in this 5 test the effectiveness of improved decreases glucose in the blood when compared Ha Fc - FGF21 type is the processor. example 14 Alhtal in Lucky object to Tgrat Fc- (L151 -FGF21 resistance to overlook the protein must be 6 Ash 120 hours of injection was reliability analysis in Alcann neighborhood selected Tgrat FGF21 injected Algiran boom FGF21, and the withdrawal of blood from Algiran when Mokhtlgh points in time, the analysis of serum by LC-MS. precisely injected Asran A.mabasrh Fc - (L15) -FGF21 G170E; Fc- (L15) -FGF21 P171Aj or Fc- (L15) -FGF21 S172L (obtained from E. coli Alaicherichiya function are also given in the description Hthal 2), which was commuted all 180 Mnhave Maikarolter Tgaribamn 10 Molar mM HCl prior to injection, blood was withdrawn at 6, 24, 48, 72 and 20 a hour. And has affinity purification of proteins FGF21 0 n slander extruded using resin Ajaros Fc column anti-human. The samples were filtered from the column using 10 mM HCl Molar include all structures on FGF21 Fc region and 15 out of the amino acid at the end of the amino end of the protein FGF21. It was also injected Alphenran sample compared to the kind of FGF21 untreated. Before analyzing samples affinity purified by LC-MS, it has been Tgrat FGF21 of crude kind analysis of non-treatment and non-treatment of FGF21 reference. It was Khgd all standards and samples point in time using TCEP and analyzed afterwards by LC-MS using the ACE Ciano Bahod 0.3 mm X 30 cm with spray outflow from the column in my shoulder Matthias nice barrier for ion traditional LCQ. Ease of familiarity was purified samples using ammonium acetate, diluted using TCEP-and then by LC-MS as previously described. The statement is notable blocks d 1 is the type Andcefroh, 24 and 48 processor

Hours after injection Alohkl (19 a -19 d), respectively. This is a statement blocs notable d - (15 Fc- (L -84- -84- i 33716Β1 FGF21 G170E when the small, 6, 24 and 48 hours after injection into shapes (20 A'-20d) by Adani. This is a statement notable blocks d Ρ171Α 9 when the small and 6, 24 and 48 hours after Ain Apr forms (21 A'-21d) on Tuwani. This is a statement notable blocks for Fc- (L15) -FGF21 S172L when the small, 6, 24 and 48 lighter after injection in Alozql (22 a -22 d), respectively. It was found that each of the samples drawn at 72 and 120 Ktoa Me framework structure of higher molecular weight (&amp; gt; 200 Dadn Bo 1 Plan SDS-PAGE presented additional) for 0 and k to insult the exception of Bear snitch Akr

1 Alehtbaka. And it is in a table (14) to provide the results of the analysis of LC-MS standards and other samples. Table 14 Ntanj LC-MS analysis of the expected fragments addiction Sliver percentage of each Mlhunlh key blocks sample FGF21 - 424-1 ./.100 45.994 Dalton Fc- (L15) -FGF21 WT Qayath not ./.80 424-1 46.001 Dalton Fc- (L15) -FGF21WT 414-1 ./.20 44.987 Dalton 6 hours not ./.100- 414-1 44.979 Dalton Fc- (L15) -FGF21WT 24 an hour - 414-1 ./.100- 44.980 Dalton Fc- ( L15) -FGF21WT 48-hour 424-1 ./.100 46.068 Dalton Fc- (L15) -FGF21 G170E not Qasph 424-1 ./.100 46.078 Dalton Fc- (L15) -FGF21G170E 6 hours not 424-1 ./. 80 46.074 Dalton Fc- (L15) -FGF21G170E 421-1 ./.20 45.761 Dalton 24 hours for 1424-1 /.60- 46.072 Dalton Fc- (L15) -FGF21G170E 421-1 5 / ο40 ~ 45.760 Dalton 48 hours - 85. -85- - - 424-1 ./.100 45.970 Dalturn Fc- (L15) -FGF21 Ρ171Α valuable one for the state not ./.100 424-1 45.980 Dalton Fc- (L15) -FGF21 Ρ171Α 6 hours no 424-1421 -1 ~ 70 e / e -30./. 45.973 45.657 Dalton Dalton Fc- (L15) -FGF21 Ρ171Α 24-hour no 424-1 421-1 ./.50- ./.50- 45.992 45.673 Dalton Dalton Fc- (L15) -FGF21 Ρ171Α 48-hour 424-1 ./ 0.100 46.022 Daldon Fc- (L15) -FGF21 S172L s 6 does not ascend 424-1 ./.100 46.027 Dalton Fc- (L15) -FGF21 S172L 6 hours not ./.100 414-1 44.984 Dalton Fc- (L15) -FGF21 S172L 24-hour no 414-1 ./.100 44.985 Dalton Fc- (L15) -FGF21 S172L 48 hour Kha shown Ne table (14), similar to the decomposition of one of the genre is the processor and the boom S172L 0 n where that after 24 hours, 0 n spin, The main Alnj Brod merger is a fragment of Tankon 1-414 unit constructivism acid Ohive. And 9 by any 0 Ga Noadj decomposition of Tehrat Fc- (L15) -FGF21 - G170E &amp; lt ;, where the samples drawn c after 24 hours of rotation containing 70-80% loans Spam (1-424 - a 0 Ive) and 20-30% Z fragment consisting of units constructivism 1-421 amino acid. Even after 48 hours, holding Assa Tabrat Fc- (L15) -FGF21 P171Aj Fc- (L15) -FGF21 G170E Brod bitterest 1 1 Diane E to increase the amount of shrapnel, which consists 0 n 1-421 unit constructions of amino acid. As has observed Ne previous analyzes rolls FC-FGF21 'were detected decomposition part FGF21 skew 4 Alazach Rowe; that part I. Sllt 1 Pt.oukdtmana forms 23 a -23 d, respectively, display types betrayed Alaaaljh Mahddhvemuada Alazhtar Fc- (L15) -FGF21P171AjFc - (L15) -FGF21G170E 72 wa uh Fc- (L15) -FGF21.

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00871.tif" id="idf0059" />

-86- -86-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00881.tif" id="idf0060" />

Shawl 15 Thdbd Tefz data FGF21 Almkhidh bloc's promise was approved by the bloc are sticking to one type Khhdazs untreated FGF21. In light of this property, Nonid Etbi Tgrat FGF21 Nkhvdh bloc. It has been identified Tgrat FGF21, which reduces the bloc on the basis of 5 Lafter 1 Dan. And is the first assumption is that B-1 to Zsph d FGF21 'because S (or Aldemrh) lasted initiated through interactions is monolithic with water and Tvoelat van der Waals because &amp; lt; Liat FGF21 Ashe' liiV by structural units is harmonious with the water that has been exposed to an environment Munib-dependent water harmonious 0 p water. The second assumption is that these lies Ne Alouhd 1 T. structural evil harmonious Ha returnees displayed can be replaced for the work variables to punctuate Tgrat Ne Tawalbeh A- 1 groaning FGF21 5 1 can reduce the bloc without being subjected FGF21 activity at risk. Have been using the geometric method of protein regulars good to determine the structural units is one of harmonious Ha water in FGF21. So it was not Luck X or SAT NMR y FGF21 Ahecn Dap-rays to determine the structural units is harmonious 0 p water before, there is a crystalline structure ray 1.3) X Obrom) Nat high accuracy are (FGF19 (1PWA obtained from protein data bank 15 PDB which has been used to create 3D Tmong homogeneity d FGF21 using Nmang program MOE Molecular Operating Environment: Chemical Computing Group; Montreal,) Quebec, Canada). FGF19 has been selected as a template, as it is between a protein found in the 'PDB FGF19 is the closest related proteins d FGF21 with regard to the homogeneity of the amino acid sequence. The account access to Munib through the following method using the MOE. And is determined 20 first criterion for the surface SA1 private surface can be reached in the structural units Balonjstrom 2. Although it may seem unit constructivism specific amino acid in the original sequence of the protein several times, each time there is in the unit constructivism can have as a region Mokhtlgh surface area as a result of some differences, among which, the approach of the structural unit to the surface of the protein, and the direction of the side chain of structural integrity, and the spatial position of the building blocks of the amino acid neighbors. And 25 1 Lhz reason, was the work of a second measure of the surface area (SA2), while the unit constructivist be Nat attention has been obtained from the protein structure with structural or Almasth neighboring units. Tgrh been the work of these neighboring building blocks spatially outside the organism to Gelesanat to remove the side chains are then SA2 structural unit of interest, with a measurement of the total surface area of ​​possible special account

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00882.tif" id="idf0061" />

-87- ΜΑ 33716Β1 structural unity in its exact configuration 1. Ahecn and then work Shsn SAl AVI SA2 (SA1 / SA2) Fair just a special measure by the possible surface area for construction of the unit that is already exposed. 10 were numbing many 0 n units Constructivism is harmonious 0 p water and that are exposed significantly to the penitent to Hazeed z analysis, Z scourge s been the work of mutations outside the organism for the building blocks to replace the unity structural befell 1 Rh with some other building blocks for amino acid found naturally. SAB Altvierat market was located in the thermal stability of the protein ewe many replacements using Nmong FGF21 program approved CUPSAT presented interactive Web Cogne UnAersity Protein Stability Analysis Tools)) according to the instructions that are provided at the position CUPSAT. See: 34 .Parthiban et al., 2006, Nucleic Acids Res 7:54 .W239-42; Parthiban et al., 2007, BMC Struct. Biol. The mutation is fixed or an exception is Aqalvh Ha water clearly in the design Tgrat FGF21, which reduces 0 n bloc. And are considered to be fixed replacement sets (or in some rare cases, the instability) which provides the attributes of ionic and / or monolithic with water Tgrat candidate for FGF21 Mitigating the bloc. 15 Table 15 presents a summary of the data from these sheep five possible way to address the genetic protein, which also lists some examples of Tgrat FGF21, which is expected to be low by the bloc of protein and sturdier the better. «15 countries to influence Allsopp Tgrat FGF21 u Persistence 20 persistence (kcal / mol) boom unity Annaiah WT unit number constructivist 1.25 KA 26 1.54 E 2.016 R 0.66 TA 45 -88-ΜΑ 33716Β1

0.71 Q 1.8 K 2.34 E 1.59 R 0.33- TL 52 0.16 GL 58 0.15- S 1 c 0.08 E 1.3 AP 60 1.51 K 0.66 E 1.31 R 0.14 AP 78 2.48 C 0.08 R 0.13 H 0.18 TL 86 4.1 C 2.52 AF 88 3.08 S 2.88 K 1.48 E 0.49 TL 98 0.17 Q 0.19- K 3.08 c 0.84 E &amp; quot; 89- &amp; quot; 89-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00911.tif" id="idf0062" />

-

3.4 R 7.34 e L 99 2 E 1.01 D 1.61 R 0.47 TA 111 0.12- K 3.93 QA 129 1.02 K 3.76 N 3.01 E 16. 60 D 1.68 R 2.9 H 5.37 KA 134 4.32 Y 5.13 E 6.18 R 2.86 H Example 16 Akeder and Sir | to Orathi mutations FGF21 to reduce the bloc and proteins integration structures that constitute Tgrat FGF21 Almnkurh in table 16 was prepared by inflating 5 PCR to Taql expression of FGF21 Z 1 Dhua untreated as described in example 11 (vector expression structure FGF21 untreated been sucking Ne Ashe 1 1 ). The work of integration proteins as Almnkur here, Oiviaval 6. A p 0 Stkhaddamrabotk was GGGGGSGGGSGGGGS (A'habertm: 28 &amp; quot;). Schedule 16

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00912.tif" id="idf0063" />

-90- - Mutants FGF21 Mitigating the bloc

Link Fc mutations Α26Ε Α26Κ A26R Α45Ε Α45Κ L15 -ΝΉ2 Α45Κ L15 -ΝΗ2 A45R L15 -ΝΗ2 A45Q L15 -ΝΗ2 Α45Τ L15 -ΝΗ2 Α45Κ, L98R L52T L58C L58E L58G L58S Ρ60Α Ρ60Ε Ρ60Κ P60R Ρ78Α P78C Ρ78Η P78R L86C

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00921.tif" id="idf0064" />

ΜΑ 33716Β1 au-L86T F88A F88E F88K F88R F88S L98C L15 -ΝΗ2 L98E L15 -ΝΗ2 L98K L15 2 A- L98Q L98R L15 -ΝΗ2 L98R L99C L99D L99E L99R L15 -ΝΗ2 Α111Κ Α111Τ A129D L15 -ΝΗ2 Α129Ε L15 2 A- Α129Η Α129Κ L15 - ΝΗ2 Α129Ν L15 -ΝΗ2 A129R A129Q Α134Ε L15 -ΝΗ2 Α134Η -92- -92-! Α134Κ Α134Υ been tested to work conglomerate many 0 n FGF21 proteins including FGF21 Hnakuagar S 'and Aadidat peptide FGF21 Ashnbh, and Tgrat FGF21 and FGF21 fusion proteins Sdam size exclusion chromatography (SEC). It was incubated samples to be analyzed 4 Az der Shih ^ 4 or 5 at room temperature or at 37 ° C for many of the points of time, were then exposed were told SEC. Was conducted near Ely 1 0 ^ m Beckman HPLC 1 to 6 Dod d SEC. And where Lq b * At FGF21 type is the processor, it has been using covenants TOSOHAAS TSK-Gel G2000 SEC using 2 X PBS containing 2% isopropyl alcohol Khlor wheelchair. And Balnsphlbrootinat FGF21 Fc and Edid 1 T. Albbbd to Tgrh FGF21, was used TOSOHAAS TSK-Gel G3000 10 SEC 2 PBS X using a mobile phase. Shawl 17 Hits Asilyh mutations FGF21 any cell has been conducting experiments to determine mutations Alakllh bloc and maintained actively FGF21 type is treated in the 5 to elk Osvraz in Akhaddbarat esta Alcann outside the neighborhood. The Tngiv tests ELK 15 to Osvraz as described in the parable 4. The forms showed 24 a - 24 c Ntanj test the effectiveness ELK to Osvraz Lahti is performed on Tgrat FGF21 L99RFGF21 (109: fâjMjl0) FGF21 L99ÜJ (sequence number: 111) FGF21 Α11 lTj ( sequence number: 113) (bereavement 24 a) 'and Tgrk b FGF21 (succession RTM: 115) and FGF21A129Q (Mtwalahno.: 117) FGF21 Α134Κ (1 st b RTM: 119) (a ^ 24 b) of the Ouaq FGF21 will 20 FGF21 Α134Υ (succession number: a 12) and h 8134 FGF21 (^^ number: 123) your responsibilities FGF21 Α129Κ (sequence number: 125) (24 bereavement c). Ntanj these tests have shown that some mutations that reduce the size does not adversely affect the watch as FGF21 is 0 o ne Achtbr't ELK to Odraz. Shawl 18 preparation and expression Alou I &amp; amp; Ù the &amp; amp; Rat common Fc- (L15) FGF21 Bust longer and lower levels of the bloc's 25 -93- -; It showed a number of combination Tgrat FGF21, which contain mutations conglomerate down in addition to the increase in half-life through stop proteolysis, which has been Thouderhaoagheranhaha IgGl Fc molecules (sequence number: 11). Basically it has been prepared Tgrat FGF21 as outlined in aluminum 11.5 Example 19 Cd.avtaldst Fç- (L151FGF21 which clarifies ^ waned s half-life longer and lower levels of the bloc have been conducting experiments to determine Tgrat Nalevh FGF21 maintained actively FGF21 Z type goers brightest one Bh in ELK test which Eetmkh 1 shake Alcann neighborhood. this has been the test as is described in the example 4. Figures 25 a '25 d Ndanj a land. Zhahl elk to Ohsraz Ashe short of 0 Saaa jL) Tgr 1 T. Fc- (L15) -FGF21 jFc- (L15 ) -FGF21 P171G ^ Fc- (L15) -FGF21 Fc- (L15) -FGF21P171TP171S (d 25 a) and lattes Fc- (L15) -FGF21 In Fc- (L15) -FGF21 jFc- (L15) -FGF21 P171WjFc- ( L15) -FGF21 Ρ171Υ 15 P171C, (1 to form 25b);, - Fc- (L15) -FGF21 FGF21 A45Kj (1 to form 25 c), Fc- (L15) -FGF21 P171EjFc- (L15) -FGF21 Fc- (L15 ) -FGF21 (Α45Κ, G170EG (Figure 25 d). Ntanj these experiments show that the mutations designed to improve Althbamt, or all of the stability and solubility, which is not to SHTML on Almuammh activity compared d Fc- (L15) -FGF21 are kind untreated . They surprising that Tgrh FGF21 20 Α45Κ have shown the possibility of Tz d Fc- (L15) -FGF21 Azaa z is 0 Asalj explains' to form 26 O.lngar in Nsph'ltktl sample Mgarzh of WT) FGF21) and FGF21 Α45Κ after incubated 65 mg disappointed liters of protein at 4 ° C for 1; 2; 4 momma. Ka that these data have indicated that Tgrh Α45Κ lead to shortages in the bloc Albrocs 4 Olarlo will sort untreated. 25 shows one form of the 26 B-1 change in the proportion of the bloc Balzsph to sample one of Mgarzh WT) FGF21) and FGF21 FGF21 'FGF21 L98R' FGF21 L98C "FGF21 L86T, FGF21 P78R, P78C! FGF21 Α129Κ 'FGF21 A129Q' FGF21 A129D, Α111Τ; 'FGF21 Α134Κ FGF21 A134Ej' FGF21 Α134Υ after incubated 65 mg dictated liters of protein at 4 °

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00951.tif" id="idf0065" />

-94- ΜΑ 33716Β1 Hnoah for 1, 6 and 10 days. The data indicated - - Bada to a lack of protein in the bloc, compared to non-protein type processor. Figure 27 also illustrates Ntanj Activity ELK to Osvraz that are made to the comparison sample FGF21 Alepeshrahotehrat FGF21 L52TFGF21 Α45Κ &amp; lt; ^ FGF21 and FGF21 E. 5 L58E. The results show that these five Tgrh FGF21 Α45Κ retain full effectiveness y FGF21 kind of processor is also showing greater potential for the type of FGF21 is Alamaalh. In spite of that, the - Kghaeh and effectiveness of low showing compared d FGF21 type is the processor. Figures show a 28 -28 b Altver in the levels of agglomeration of such Tgrat 1

10 (Fc- 'Fc- (L15) -FGF21 (Α45Κ, G170E)' Fc- (L15) -FGF21 (6-181, G170E Ρ171Α, (L15) -FGF21 Ρ171Ε 1 Fc- (L15) -FGF21 G170E 'sample comparison FGF21 that follow incubation at 4 ° C for 1; 4; 8 days. show this one to experience that 1 ^ 5 'of more than 8 days z stretches (Fc- (L15) -FGF21 (Α45Κ, G170E ^ Ozartktlaqhinzkalmohishhanitgrat Fc- (L15 ) -FGF21 G170E or _ (Fc- (L15 15 FGF21 Ρ171Ε, a 0 is not that these three mutations Almnkurh show the bloc less from those described in the Acarzh sample Fc- (L15) -FGF21. the table shows 17 per bloc that is obtained for a sample of 1 to Mgarzh FC-FGF21 and Dora (Fc- (L15) -FGF21 (Α45Κ, G170E Ahme p a-at 4 seminal degree or a degree Algervhmadh heat small 0.2; 3; 4.7 days. Jdallal 17 20 J2SL1H Id Elmo 3 grant Fc-FGF2! j Fç -FGF21 Sjila jâ day 7 day 4 day 3 day 2 today small pain: 2.32 2.14 1.89 1.71 1.12 4 ° C Fc- (L15) -FGF21WT 12.59 9.57 7.94 6.09 1.12 room temperature of 32 mg ml 1.24 1.03 0.88 0.45 4 ..66 ° C Fc- (L15) -FGF21 (Α45Κ, G170E)

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00961.tif" id="idf0066" />

(-95- 33716Β1 8.60 6.62 5.22 3.86 0.45 temperature of 33 mg a ml room Example 20 1 to attend for 4 11 »&amp; lt; for Fc-FGF21pH | 3ùljlfaùfc Kha is mentioned Aelah, can enumeration Hab 1 T. melting FGF21 are through Enter Alchwibat specific substitutions of amino acid . and Baladhah seen it, Dan determinants FGF21 Imkl &amp; gt; - Z by integrating FGF21 proteins modified Ha part Fc Sz IgGl to Ajlopulin Almz one human apolipoprotein 0 In addition, through the introduction of combinations own amendments Almnkurh above, and fed FGF21 have the stability and solubility enhancer. DNA sequences encoded for Tgrat synthesis of FGF21 Almnkurh in table 8 (a), which have been prepared using Almnkurh techniques Oelaha was Alrabottaltistkhaddmebarhenrabott 15 a, GGGGGSGGGSGGGGS (MTW 1 Ahno.: 28). table 18 Tgr 1 T. twelve FGF21 link Fc Tgrat bloc Tgrat hydrolyzed protein building blocks of the amino acid L15 -ΝΗ2 Α45Κ G170E 181-1 L15 - ΝΉ2 L98R G170E 181-1 L15 -ΝΉ2 Α45Κ, L98R G170E 181-1 L15 -ΝΗ2 Α45Κ P171G 181-1 L15 -ΝΗ2 Α45Κ P171S 181-1 L15 -ΝΗ2 L98R P171G 181-1 L15 -ΝΗ2 L98R P171S 181-1 L15 - ΝΗ2 Α45Κ, L98R P171G 181-1 L15 -ΝΗ2 G170E 178-1 L15 -ΝΗ2 G170E 181-6 L15 -ΝΗ2 Α45Κ G170E 181-6 -716Β1 L15 -ΝΗ2 L98R G170E 181-6 L15 -ΝΗ2 P171G 181-6 L15 - 2 L98R P171G 181-6 L15 2 G170E 181-7 illustrated in Figure 29, blood glucose levels, which have been measured in the Algiran that have been Annha mutations Tolivhhn 48Fc- (L15) -FGF21 (Fc- (L15) -J Fc- (L15) -FGF21 (A45K, G170E Fc- (L15) -FGF21 (L98R, P171G) j FGF21 (A45K, P171G). 5 in 1 test another, take place Dralhtgrh 'FGF21 They (Fc- (L15) -FGF21 (L98R, P171G Balto 1 Zimattfrh 8FGF21; Fc-FGF21 VI 1 Fih Eir 0 processor 0 in one of the experiments, the strain cell 293Τ for recurrent link was the work of &amp; lt; lung's 0 Zha in the presence of Tlkiz' T - Z FGF21 or 1 Fc - (L15) FGF21 for 6 hours. outputs analysis of cellular been tested afterwards to see activity Osvraz. as shown with Iil 30; 10:00 Fc - (L15) -FGF21 (L98R, P171G) J y I Fc- (L15) -FGF21 '^ indicates that the introduction of the two mutations points livre not the activity of the molecule Alcann Khark neighborhood. in another test, the stability was evaluated (Fc- (L15) -FGF21 (L98R, P171G at 65 mg disappointed liter for 9 days when my grade two different temperatures, namely room temperature at 4 ° C, with 15 Fc- (L15) -FGF21j FGF21 .oukdtm outcomes analysis cell lysis after a period of incubation using SEC-HPLC to determine the bloc in exchange format time in many 0 n temperatures. the Tupper entities described in Figure 31 or 31 for that rate to be the bloc has been reduced dramatically Ni (15 Fc- (L (FGF21 (L98R, P171G at room temperature (triangles Alasmth, and the dotted line Ne form 31 a) and at 4 degree Mtoah (Solid triangles, and the dotted line in Figure 31 b). 20 Shawl 21 Tgz data FGF21 resistance to degradation Aleriutah Ashe include St. Tgrat Mke has also study Dhulevat mutations inside / Rkhalbh / spacious. Specifically, the steadiness VII &amp; lt; r Alcann neighborhood d (Fc- (L15) -FGF21 (L98R, P171G has compared to 0 p firming _ (Fc- (L15 FGF21 in Algiran and instantiations canis has been discovered that the results are similar Ne each Z Aldhuean . at

<img img-format="tif" img-content="drawing" file="MA-33716-B1D00981.tif" id="idf0067" />

-97- ΜΑ 33716Β1 of one study conducted on monkeys Alainomulus- Fc-J- (L15) -FGF21 (L98R, P171G) Fc L15) -FGF21) were injecting them intravenously 23.5 mg kg of equal parts of serum was Tdjaaa plasma at points in time of 840 hours after the dose. The analysis of time points to 168 hours has been esta Anakahid time samples purified using affinity for Fc anti-Awad, was then analyzed by mass spectrometry MALDI scale. The results correspond well between each of the analyzes. Data analysis using MALDI conglomerate, immune, and link when the subject Ρ171 has seen that it is not present in the molecule (Fc- (L15) -FGF21 (L98R, P171G b to Tgoh Ρ171 to P171G. In spite of this, has Mlahkhalh be simple and slow decomposition Alnj for loss of up to three building blocks for a party c for 4 (Fc- (L15) -FGF21 (L98R, P171G (1 to form 32.) has also Mlahvlh cases of fission carried out when the building blocks of a party that the mystery of one T. FGF21 after most prone to splitting between the building blocks of acid position amino 171 and 172 that were stopped and shown in figures 20 and 21. fission three building blocks of terminals 0 Kadihthel stopped fission by party C molecule by carboxy peptidase way the unity of constructivism and unit constructions sequential or attack specific protease when the building blocks of the amino acid 178 and 179 using networking Unknown when the building blocks of the amino acid 179-180 and 180-181. and can result in lost 2-3 amino acids at the party C AVI reduce tidier 1 i β-Kl.tho Looney 1 Zhaah Nthleel efficiency and Alzhat1-Rgey / Rzbh / spacious molecule, see, for example, 2009, .Yie et al 583: 19-24 .FEBSLett. to deal Ha decomposition Alkrboxa peptidase the party C, the effect of adding 'Aguetao structural unit of the amino acid for many Aadidat peptide boom multi-FGF21 studied. There are several structures, including those described in Table 19 E is - and the work of tests by using the techniques described here. Table 19 summarizes the elk to Odraz test results that were outside Alcann neighborhood. The amino acid can be Annasph covers those that create long ranges Leiden 1 and 5 A -; amino for example a length of 1 ', 2, or 3 or 4 or 5 or 10 or 15 - Amive. And Ahecn a-or any number and any type of Kafta amino acids, for example, the unit constructivism Porsche once, and the unity of constructivism Glycine one, Bnaiatin and two units of glycine, five building blocks of Aljlsin, E. In addition to the combination of that. Some examples are 1 to provide Ody Ne example 1 to bare Ne Addol 19. -98- 33716Β1 In addition, to deal 0 p attack protease apparent when termination units - exponent of 178 and 79, and be specific mutations structural units to limit exponent Hzd Alhoada 179 'and 180 and 81 has a driveway. And 1 cat Zia Mdjauah there are structures, including those described in Table 19, which has been working and tested using Almnkurh Z 1 techniques. Dutt der Shh 1 1 died own tender mutations at these positions. Table 19, a 0.0 m 7 summarizes examples F ^ t 1 t been done and coached in the Spar elk to Osvraz which are outside Alcann neighborhood, which is being implemented as Almnkur here. According to the terms used herein, the hFc means succession kjJL} Fc (RTM any Htoalah 11), and suggest a link Ouaili L15 L15 by eBay, GGGGGSGGGSGGGGS RTM 28). Schedule 19

The effectiveness and the values ​​of EC50 for Aadidat polypeptide FGF21, which ignites on EC50 amendments party C Hits (nano Molar) structures% 100.00 0.4 huFGF21% 76.10 2.5 hFc (L15) hFGF21 (L98R, P171G)% 78.30 2.6 hFc (L15) hFGF21 (L98R, P171G, Y179F ) hFc (L15) hFGF21 (L98R, P171G, 1-180)% 77.40 7.8 hFc (L15) hFGF21 (L98R, P17lG, 1-179) ./.79.60 1.9 hFc (L15) hFGF21 (L98R, P171G, Α180Ε)% 87.90 130 hFc (L15) hFGF21 (L98R, P171G, S181K) GSGSGSGSGS.hFGF21 (L15) hFc% 83.10 834 MKEDD.hFGF21 (L15) hFc 0 / .69.90 272 hFc (L15) hFGF21 (L98R, P171G, S181P, Ρ182) % 76.90 3.25 hFc (L15) hFGF21 (L98R, P171G, A180G)% 77.30 3.43 hFc (L15) hFGF21 (L98R, P171G, S181G) -99- -99- - hFc (L15) hFGF21 (L98R, P171G, L182) hFGF21 (L98R, P171G, G182) 0 / .44.40 428 hFc (L15) hFGF21 (L98R, P171G, Υ179Ρ) ./.82.60 61 hFc (L15) hFGF21 (L98R, P171G, Y179G) ./.74.80 hFc (L15) hFGF21 (L98R, P171G, Y179S) ./.79.60 43.2 hFc (L15) hFGF21 (L98R, P171G, Υ179Α) ./.77.60 3.07 hFc (L15) hFGF21 (L98R, P171G, S181T) ./.73.50 2.66 hFc (L15) hFGF21 (L98R, P171G, S181A) ./.72.60 3.46 hFc (L15) hFGF21 (L98R, P171G, S181L) ./.79.50 33.8 hFc (L15) hFGF21 (L98R, P171G, S181P) ./.77-10 617 hFc (L15) hFGF21 (L98R, P171G, Α180Ρ) './.84.70 2.18 hFc (L15) hFGF21 (L98R, P171G, A180S) - hFGF21 (L98R1 P171G, GGGGG182-6) ./.85.90 6.1 hFc (L15) hFGF21 ( L98R, P171G, Ρ182) ./.71.10 6.5 hFc (L15) hFGF21 (L98R, P171G, G182) ./.63.90 167 hFc (L15) hFGF21 (l-178, L98R, P171G) './.84.20 1941 hFc ( L15) hFGF21 (L98R, P171G, GG182- ./.99.70 4307 hFc (L15) hFGF21 (L98R, P171G, GGGGG182-6) Ashe db / db Figure 33 percentage Altver in blood glucose levels in Almlhzh Asran and Aznoa is' PBS that are injecting their help him comparison (C57B6 suffer from diabetes (rear Atnpf 0 n the &amp; lt; Biat covered FGF21, Fc - (L15) -FGF21 (L98R, P171 G) 1 processor .lomla Fc-FGF21 (L98R, a 'C, which has been added unity constructivism Brolin Oocalesen them when one Ldv 0 Akkar a 0 addition unity structural Fc- (L15) -FGF21 (L98R, P171G, 182G) and P171G, 182Ρ) has pointed out, FGF21 1 alfalfa boom or type untreated polypeptide C of 0 Li Alhlerv 182 &amp; quot; We refer to G "1 Lotte constructivism through its position in the resulting protein, and then the (-100- 33716Β1 own d 181 unit worker know 1 Vision incomplete Z C that may have been added unity constructivism of glycine to the party, but 0 Pray Eyre has led FGF21 protein mutation or type is processor. as shown in Figure 33 that the FC-FGF21 Khgd blood glucose levels for 6 hours, while all der 1 lattes Zerat showed Fc- (L15) - three active low continuous glucose in blood for up to at least 120 abuse 0 molecule flared on Adhavhouhdh constructivism of proline at 'FGF21 (L98R, P171G, 182Ρ) special molecule merger, appeared Ozehg 1 der led Avi Lhasa FGF21 structure C and end party 'Fc ^ FGF21 (L98R, P171G) Mstwik' glucose Baidm compared d. (L98RP171G, 182G)

Fc- (L15) -FGF21 (L98R, P171G, and in the next test, 'the activity of one the one who Kandaglasarahh's Temtdr 1 Sthomgarzthma activity Fc -. (L15) -FGF21 (L98R, P171G, 182P) jl82G)' C, which was Dni live trait of the molecule Mufar Almstml two glycine added at the end as shown in Figure 34 Ntanj .Fc. (L15) .FGF21 (L98R, P171G, 182G 183G) an ob / ob test. Figure 34 percentage Altver in blood glucose levels observed in mice R. 1 Fc- (L15) -J, compared to PBS injected sample FGF21 (L98R, P171G, 182G 183G), Fc- (L15) -FGF21 (L98R, P171G, 182G)., Fc- (L15) -FGF21 (L98RP171G, 182Ρ) as shown in Figure 34, showed all studies of molecules raging decrease in glucose levels compared to a sample comparison PBS. This experience has resulted in a 0 t Almakid on previous results (in Figure 33) is that, - that by adding 0 n proline at the party C showed low efficacy improved glucose compared to molecule, which does not have the cover are Albrooline u Khmt Madal (Fc- (L15) -FGF21 (L98R, P171G. u Hervé Z Zlay, the addition of Ats of the building blocks of glycine at the finish party C, the presentation, for example (0FGF21 (L98R, P171G, 182G 183G (Fc- (L15, has appeared that reduces the effectiveness of the molecules in the organism also led to shorten the period of the effect of lower glucose Drkhal humiliation pain:. broad form 35 Altver in the proportion of blood glucose levels observed Ne mice db / db experiencing Z S (background C57B6) that have been injection by using a sample Almtarnh PBS or Aadidat peptide 1 Tgrh Fc- (L15) -FGF21 (L98R, P171G), Fc- (L15) -FGF21 (L98R, JFGF21 ', (P171G, Y179S), Fc- (L15) -FGF21 (L98R, P171G, Υ179Α -101- ΜΑ 33716Β1 '' (L98R, P171G, A180S),, (L98R, P171G, A180G). the All mutations showed the same Nchahz low glucose similar period was similar to the procedure. the figure shows 36 Altver in the proportion of blood glucose levels observed in mice db / db infected disease diabetes (background C57B6) that have been injection by using a comparison sample carrier, - (Fc- (L15 5 - (FGF21 (L98R, P171G), Fc- (L15) -FGF21 (L98R, P171G, Y179F), Fc- (L15 ( FGF21 (L98R, P171G, Α180Ε. And Basrzhha, (Fc- (L15) -FGF21 (L98R, P171G E. (Fc- (L15) .FGF21 (L98R, P171G, Y179F was less effective in Khgd blood glucose. In spite of that, (Fc- (L15) - FGF21 (L98R, P171G, Α180Ε where acid alanine at Ala'mive part of 180 was the work of Tgrh him to glutamic acid, was more effective 0 n -Fc 10 1 additional amount of 20% decrease in blood glucose levels compared to 0 p (Fc- (L15 ) -FGF21 (L98R, P171G. this data suggests that the Tgrh Α180Ε could be the decline in the end, party C in the organism and then -alfalah and efficiency Drkhal trait Rlhh molecule 0.4 CFA 2215 Afyqird rhesus study was the work of Fc-Linker-structure FGF21 using the method described here. these include infrastructure on! succession IgGl Fc (sequence No. 11) merged at the end to party C Htoalahrabott L15

(Almto Ahno. 1 to 28), which was then incorporated at the finish Alhlerv E p 0 0 S end Stewalah FGF21 Milli (successive No. 4), in which put 20 Tefrs P171Gj L98R been. Subsequently, the expression of this structure and purified as described here. S were separated Dimreh protein image, and each monomer which is linked through bilateral links between the sulfide particles between the Fc region of each monomer. And is referred Avi this molecule Apr 1 current Mil 22 -Fc "(L15) -FGF21 (L98R, P171G) and have a succession amino acid sequence 43 and is decrypted I Bo 1 middle Alehtoalahno.: 42. In this example FGF21 z I am the 0 cycle Alalohn FGF21 'Looney 25 successive 4.22 - 1 design study a team Aahle structure (Fc- (L15) -FGF21 (L98R, P171G is Htzamn and esta 1 skin (&amp; quot; SC &amp; quot;) in monkeys rhesus Z Llacur Aletilataave 0 Nalscrid BMI greater than 35 have been treated

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01031.tif" id="idf0068" />

-102- 33716Β1 Mjhuan from 1 to Araud (No. 10 T. Nnd Group) either b. Mature FGF21 (such as successive No. 4) or article carrier of the sample comparison. T 0 t any Alehioaz 1 T. for 42 Aomaqubl give any compound tested were then divided into Mjhuat z 10 and give Edh injection via the intravenous administration of the test compounds or the comparison sample material in a manner Veer lûjLu, Kha shown Ne Alhkhtt contained in Figure 37. In short, it was injected into each animal visits and 1 unit in one day, or a compound including one Dah | 0 FGF21 was given a day, while others were given - (L98R, P171G) Aspuaa. The response has been increased (Fc- (L15) -FGF21 (L98R, P171G FGF21 and all? ^^ 4; Ke 0 A is shown in Figure 37. The has control of body weight and food intake presented Azrash. Ua CRO was unknown in processing. The perform glucose tolerance tests Z Triv &amp; gt; chagrin (OGTTs) before the start of treatment. nor was one Sttam 0GTT1 - animals I three Mkavnh by groups of the same animals the distribution of building .Je 1- Alhohabrdh Nan Alhs (AUC) and body weight. I have been using the results of OGTT (0GTT2 1) for the second to confirm the classification (OGTT (first 0GTT1. the Aoud Olney him one forms OGTT and Alticazttoaqh 0 Nick Alajinr 1 T. (OGTTl) Avi (0GTT2) Altanatmufttmaaha 0 market was RIP T. 1 Zj 1 OGTTs and 2 in figures 38 or 38 b, using measurements AUC described Apr 1 to form 38 c 0 has been introduced weight the original body in Figure 38 d and table 20 was a 0 water 3 OGTTs, and 4, and 5 every two weeks at the end of each treatment low dose Ahumicosth or E 1 Yeh has been blood samples from Alsahh animals assembling a week was used to measure the levels of one of glucose and insulin and triglyceride Gelesrad, plus I test compound levels . has been compiled to that point 1 T. weekly blood scavenging during the period, which amounted to 3 weeks. Market showed OGTTl and 2 primary Aa00 expected form of glucose as shown in normal animals. Ha maximum plasma glucose which was obtained at 30 minutes, and with the AUC to show Mjmo At three. The plasma display chemistry of the core values ​​in the development of fasting in Table 20. The function are also given a 0 Census chemical measurements on blood samples collected before the start of treatment. Table 20 core values ​​of Astoyat Wen body, glucose Albulazemava the fasting state, and insulin, and triglyceride Gelesrad three groups of rhesus monkeys a ΜΑ 33716Β1 -1.3-

Fc- (L15) -FGF21 (L98R, P171G) FGF21 article carrier 101 010 1 Number of 0.4 ± 8.5 0.4 ± 8.7 0.5 ± 8.5 body weight (kg) 3.7 ± 82.2 5.3 ± 94.8 4.8 ± 91.9 plasma glucose (mg of dl) 205.1 ± 1023.4 107.7 ± 976.1 ± 942.6 insulin (Pico grams a liter 121.4 ml) 9.8 ± 71.7 5.2 ± 58.6 4.8 ± 44.4 triglyceride (mg / ml) was selected Mokhtlgh levels of Jeratn where low dose is 0.1 to 0.3 mg a kg, medium dose of 0.3 mg kg wa high dose is 1 to 5 mg a kg d was P171GJFGF21 9- respectively. The dose levels were selected based on the observation of a dose response in mice, with doses Systems dependence on the expected number of times jkij) in human Alcannat. I have been using doses equal in number Molar 0 n FGF21 in 1 Dtt A- and medium, have been lifted high doses Fc (L15) -FGF21 (L98R, P171G) - to 5 mg a kg (ie instead of 3 mg a kg, which have a Molarat Mtkavnh Ha dose FGF21 which amounts to 1 attacked a kg) 2-22 test compounds the effect on body weight nee this test, so that the effect of sheep Vyas Merritt 0 Alakhzbar shower body weight Alehtas Ospuaa, was calculated ratio Altver in body weight of the basic weight in a week λα three groups of monkeys and rot. Market were also measured body weight during Alilath weeks are scavenging period. It was to include the values ​​of body weight exponent 1 ^ Se in a well 20 '-104- -104-ΜΑ 33716Β1 has been Sa body weight through this study, either before or after administration of the test compounds. Market ratio of body weight from baseline 11 changed Ahiomat Aq ^ folding D 1.1 for the time of confusion was the weight of one's body for Ahilan ------ plus dependent on the dose a way to extend the 1.6 as 1 selling Z Guetrp treatment, as shown in Figure 39. As noted earlier , 1 in 5 Ashe RIP ((2009) 9-250: (1 ) 58 Xu et al .. Diabetes), the treatment using FGF21 lead Ahsavea large Epeshkd Jeremiah Azqas weight Ed and Lucan's (Fc- (L15) -FGF21 ( L98R, P171G amount exposure is greater than Tlay Olney Kazt d FGF21 (Fig . 48 and 1 to form 47 Elyaltertab) 0.0 Ataufer possible explanation possible for Mlahnlh (Fc- (L15) -FGF21 (L98R , P171G Ashe touched 0 t Hazeeda Z body weight Almakkaks for FGF21. 10 effect ^ Kpat test insulin levels Hustoaat insulin were measured in blood samples collected after fasting all night or after a meal in the afternoon. was measured plasma insulin levels in a fasting in rhesus monkeys every week in the

Alehiomat the 0 treatment plant Bai are Alhkban S FGF21 or (Fc- (L15) -FGF21 (L98R, P171G 15 Looney when I am Guetrp scavenging which runs to three weeks. It was pulling samples 0 n blood in almost the fasting state after five days are the last kitten was injecting them d (Fc- (L15) -FGF21 (L98R, P171G almost b 0 d 21 hours from the last time it was injecting the d FGF21. not been measuring the levels of plasma insulin in the nutrition situation in monkeys rhesus during the week AAC 1 Q and the sixth of Almajh using either the article tanker or FGF21 during treatment dose high 20. it was - Aanamt of blood in almost feed mode after three days of injection d - (Fc- (L15 (FGF21 (L98R P171G and Nthreyba two hours after they last injected with FGF21. Kmayodh Figure 40. Effect of pain 1 de Avql 5 and L98R, P171G) J FGF21) on insulin levels in a fasting presented study, which has on each nine weeks, whereas Figure 41 nutrition levels of insulin identified from samples taken during week 5 and 6:25 in the same way, when Pay two doses, each Z Fc- (L15) -FGF21 (L98R, P171G) J FGF21 led Jeremiah dismiss insulin plasma levels in nutrition and fasting mode. the Tat note that Alaholin treated animals d 1 levels do not say no to note that the increase in glucose levels pointed to increased sensitivity to insulin.

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01061.tif" id="idf0069" />

-105- 33716Β1 4-22ihr test compounds Z OGTT (glucose and Alalh) has been launched in three 3 OGTTs) OGTTs, 4 and 5) after treatment. The measure forms the level Alalin and glucose 0GTT5 in the treated animals for 6 weeks using Article tanker or FGF21 or (0FGF21 (L98R, P171G (Fc- (L15 landscapes the last two weeks of the system increased 5 high dose. Was conducted 0GTT5 Tqrbaa after 7 days of give another ton d _ (Fc- (L15 FGF21 (RG (L98R, P171G) 4 up after 21 abuse 0 n Aehlaead not FGF21. market has been accessed forms of insulin and glucose 0GTT5 in Figure 42 and Figure 43, respectively. the animals Sljhb (Fc- (L15) -FGF21 (RG (L98R, P171G p showed have removed 8 Phys pp compared with the treated article carrier animals only at the highest dose and when another Zhveh point measured 0.10 Kha shown Ne Figure 42. when the last dose end, showed, Fc- (L15) -FGF21 (RG (L98R P171G) best improvement in the removal of glucose. as FGF21 any improvement in the removal of Ed ^ cuz did not appear. Wad was for Fc- (L15) -FGF21 (RG (L98R, P171G) Drd blot. z reminded one venesection FGF21 (Fig. 48 Figure 47, respectively), while providing clarification Annasp to note that -Fc L15) -FGF21 (RG (L98R, P171G)) D a 0 appeared Lash a Aktheretafa 1 Lis Z a ^ Phys 15 Bdlamn FGF21. It was insulin levels during 0GTT5 significantly low Z statistical Alihiq when the last time point measured in the treated animals d Fc- (L 15) -FGF21 (RG L98R, P171G)) compared to animals treated article tanker. Altver in the percentage of glucose AUC from baseline was calculated for three 3 OGTTs) OGTT; and 4; and 5) that have been working at the end of each of the low- and middle-dose and high in groups of 20 three Almokhtlgh of monkeys rhesus as shown in Figure 44. The procedure 0GTT5 stir 1 five times a day after the last injection d Fc- (L15) -FGF21 (RG (L98R, P171G) and 21 frames after the last injection d FGF21 showed Fc- (L15) -FGF21 (RG (L98R, Pi71Gü1) ^ Z led statistically to Nthleel AUC5. the core values ​​OGTT for each group was Erz 6 Apr form 38 c 0.25 has been measuring plasma glucose levels in a fasting on days when there is a 0 result OGTTs. did not notice there was no statistical differences Nat value in the glucose levels of plasma ne r fasting measured between the three animal groups. 22-5 effect of the test compounds at levels Tri Gelesrad

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01071.tif" id="idf0070" />

-106- 33716Β1 been MAP ratio Altver in the levels of Tri Gelesrad plasma in a fasting in monkeys rhesus CKD week in one of the Ahiomat birth I Palm 1 de Avqla 4 or FGF21 or Fc- (L15) -FGF21 (RG L98R, P171G)) During the period Sweeping $ 3 weeks. The withdrawal of blood samples in a fast Chibakldshayambadakhrushd 1710?, Of 98 A) Fc- (L15) -FGF21 (RG) and Theribabad 21 hours after additional tons d 0FGF21 was measured levels of triglyceride Gelesrad every week after the start of one of the Mtabh km 1 has been Altver percentage of the basic situation in Figure 45, has been fasting basic values ​​displayed in table 20. as shown in Figure 45, the Alehiouattat treated either by 1 (L98R, P171G) or FGF21 they have shown Ntsa dependent on dose levels of triglyceride ^ 9 ^^ Fc- ( L15) -FGF21 (RG (L98R ^ 171GJ) ^; ^^ compared with FGF21. the recommended form Nraa Gelesrad 46 levels in plasma in the sample that were obtained are rhesus monkeys Ne feeding mode, during the fifth and sixth week using the carrier material or -Fc (L98R, P171G) 1 or FGF21. was pulled blood samples in feed mode after approximately 3 Oyambaadalhaknd 1710?, Fc- (L15) -FGF21 (RG (L98R) and the Arabization of one number Soetin are additional tons d FGF21. has been to reduce the levels of Tri Gelesrad blood in the nutrition situation in Alhaaljh animals b Fc- (L15) -FGF21 (RG (L98R, P171Gj FGF21) significantly, compared Tri Gelesrad levels in the treated animals article carrier (Figure 46). 6-22 concentration of the test compounds were evaluated Altarhish the tested compounds that are almost given at a dose levels equivalent to Molarah weir period of one study. Concentration was measured L98R, P171G) 9 before the dose, and a 5-Aime Nthreyba of injection. FGF21 levels were measured pre-dose, at 5 ', 12, 19 and 26 days. Samples were withdrawn pain at about 21 hours after the last injection. It has been one focus of the individual compounds that are tested at each monkey in Figures 47 and 48. As shown in Figure Apr 47; Z majority of animals shown in the treatment group d FGF21 had a lower concentrations Z AAC quantitative. As Bodh Figure 48 that the animals in the group of «\ a (s b 0 - (Fc- (L15 FGF21 (RG (L98R, P171G) as 1 n Nenni Hsdhuaat Imkz &amp; gt; Aki_ 1 Here are the - (Fc- (L15 FGF21 (RG (L98R, P171G ) Oie all along the x 1:00 Paljrhh &amp; lt; drag Etin Aspuaa Bzhs Shah 0 -107- 33716Β1 dose). the average concentration of each phase dose Nthreyba proportionately from 0.3 to 5 increased attacked a then for Fc- (L15) -FGF21 (RG (L98R, P171G). The Qrkanhzok AAC Near &amp; lt ;, Turakmkmaho shown through fixed concentrations after fully weekly dose and the second in NY all 0 Laure dose for each of the two compounds. In the course of non-treatment phase (the period of scavenging) were level 1 v 5 Fc- discovery (L15) -FGF21 (RG (L98R, P171G) at about day 47 (12 Rt d additional Jrhh) and Kazakedmn minimum accumulation (LLOQ) after that. has also exposure to vehicle control test during each OGTT. could not be discovered FGF21 during 3 OGTTs, and 4, after treatment d FGF21 low and medium dose. though u z, it may esta NOTE levels can be measured during 0GTT5, after Jerlo parasite treatment .10 the proportion of the dose levels increased Fc- (L15) -FGF21 (RG (L98R, P171G) p OGTT third Jeremiah fifth Ha increasing dose levels, as Homodh a bereavement 49. confirms Bamazat vehicle levels that the animals may have been exposed to the expected quantity Z each Ri 'will Fc- (L15) -FGF21 (RG (L98R, P17GFGF21)' ^^^ abrasive. and as has been observed significant changes in the amount of FGF21 measured, which b 1 Rh Z Ztej 0 s expected 0 t h Parties 15 in mind that the sample was made Nthreyba after 21 hours after the last dose and the period of half Dr. Omar FGF21 was Tqriya one hour. 7-22 Conclusions

FGF21 led Avi reduce insulin levels and Tri Gelesrad plasma Ne put Almtm, eating Ha put the lack of body weight at higher doses. Led, Fc- (L 15) -FGF21 (RG (L98R 20 P171G) Ir improve OGTT Ha Nts insulin levels at the highest dose, also led one of the Jrt to reduce Nzaa Gelesrad plasma levels in a fasting, eating put addition EFE body weight. Each Z Fc- (L15) -FGF21 (RG (L98R, P17G FGF21) Wadia Jeremiah Tkulailedds metabolic parameters in rhesus monkeys that do not suffer from diabetes. the match level Alachassolr &amp; gt; and Tri Gelesrad between Fc- (L15) -FGF21 (RG (L98R, P171GjFGF21) d Doo 25 compound levels in the same range, and in the case of nutrition. as a result of improved properties related thereto, as 1 n Fc- (L15) -FGF21 (RG (L98R, P171G) Ovddinm FGF21 Naoz Alamaamlatoyhecn given time nee week to observe the effectiveness of the metabolic parameters. shawl 23

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01091.tif" id="idf0071" />

-108- ΜΑ 33716Β1 Azd * age Fc- (G4S) 3-FGF21 (L98R. P171G, Α180Ε ^ Fc were generated Fc fusion includes Tgrh FGF21, which are grouped with IgGl Fc Created by the linker. Included FGF21 Fc fusion on Tgrat Created three-point genetically are processed in succession E. poly peptide d FGF21, friendlier Α180Ε, P171G, L98R (the numbering on the mature image for I FGF21, are available on the successive number: 4 body). the building of this part by escorting. Fc human (Mtwalahno. : 11) Balpartylavi Α180Ε, P171G, L98R 'boom FGF21 (Htoalahno.: 39) through amino acid link includes Almto 1 Mechanism GGGGSGGGGSGGGGS (Mto'lah number: 31). the Hma'ldzee design to trivial &amp; quot;, Fc- (G4S) 3 -FGF21 (L98R, P171G (Α180Ε &amp; quot; is described sequence of the amino acid Nat full length in Figure 50 with a sequence of No. 47; and be encoded by DNA sequence number: 46. tests showed Drkhal for Aalrlhh's (Fc- (G4S) 3- FGF21 (L98R, P171G, Α180Ε it represents an effective simulator for the phosphorylation of Erk in the output of genetic Union Back strain that expresses the genetically engineered β-Klotho. A'zar -Fc G4S) 3-FGF21 (L98R, P171G, Α180Ε)) Oifta Please choose a connecting β- Kl.tho enhanced compared Bazdmaj Fc 0 n FGF21 from 1 to Dhua is Almtj or 1 Zdmaj Fc's FGF21- (G4S) 3-FGF21 (L98R, P171G) (0 Twalahno.: 45). Ezdmaeetmhakn, Fc- (G4S) 3-FGF21 (L98R (710, Α180Ε a? Alnmang in animal Nasabhbalskr, it Khgd blood glucose levels, body weight Khgdt, suitable for injection twice a week. 1-23

Food-0 Alahforeig 0 cells Alehihd (£ 8180, Fc- (G4S) 3-FGF21 (L98R, P171G has Altjarbldr 1 Shmaama Be (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε; ^ k effectively similar to a merger Fc's FGF21 are kind untreated FGF21 or Z types Wallace Giralanaalj Ne experience enzyme ELK - to Iossiferraz Q4 Dlkhaldbo parchment.

ELK experiments enzyme has 0 to Iossiferraz using the output of the Auth Union &amp; lt; Iv'a Lzz 13:00 1 cells for human kidneys 293Τ, in which the overly 293Τ cells in health Adrani Z 0, but a penalty termination β-Kl.tho and mentor enzyme Iossifraz. It is a β-Kl.tho future Hishturk bear d FGF21 to Tencdt Hustablatt FGF and induce intracellular signal transduction, including Vsgrh Erk. Include the prospects for Harshad enzyme Erk - a Iossiferraz on structures include sequences vacated GAL4-ELK1 f to Iossifar 1 g .5xUAS are urged enzyme Guide to Iossiferraz 5xUAS by Hazz includes Z Khhs income tandem Lemke \ n -109- link 4 Lallah are organized effective leader by the level of Erk Mufsafar, and it is used in the Z surveillance. .lmaeshrh And determine the amount of activity FGF21. Has enzyme ELK- to Iossiferraz experiments by Astbaat 293Τ cells in the presence of Mokhtlhh concentrations of FGF21 type is the processor, the merger Fc the Fc-L15-FGF21 (L98R,, FGF21 5 &amp; lt; Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε), P171G, A180E are the types Z Alanaaljh, for a period of 6 hours, we have been testing products relentlessly cells to determine the activity Azzdem to Iossiheraz · been expressed Altolqat obtained in the enzyme to Iossiferraz experiments for each birth &amp; lt ;, FGF21 is the axis y been expressed compound concentrations in the axis X. figure shows 51 dose-response vehicles that have been tested in the enzyme Erk experiences of -10 to Aosieiraz. retained (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε actively Mchabahlorlo merger Fc d FGF21 0 n type is Alaaalj, Modkha Ozatolivh mutations Ha P171G 'L98R' and £ Α180 not livre biological activity y FGF21. Mtarnh d FGF21 of a kind original untreated, showed Buniata merger Fc reduced effectiveness in Tgevh and most effective in the experiment with a basis of cells Ha excessive genetic expression of a common future .β-Kl.th. 15 2-23 Sahkhcj / C / T Landsat (Fc-FGF21 (L98R, P171G, Α180Ε Ed link Mokhtlgh sequences were generated homologous Fc fusion by merging similar IgGl Fc human d, FGF21 (L98R. Through successive link Mokhtlgh, GGGGGSGGGSGGGGS (succession No. 20: 28). Reference was made to link d L15 and reference was made to integrate the resulting molecule d -15 Fc-L FGF21 (L98R, P171G, Α180Ε) (sequence number: 57). In this experiment, esta study Nair sequences Rabhdmokhtlnhar effectiveness of mergers (.FC-FGF21 (L98R, P171G, Α180Ε has ELK enzyme tests - to Iossiferraz 293Τ by culturing cells in the presence of concentrations of FC-L15-FGF21 (L98R ^ Fc- (G4S) 3- FGF21 (L98R, P171G, A180E) ü-ÂiL 25 (P171 G, A180Ε for 6 hours, was being outputs of cell lysis test to determine the enzyme activity of Iossiferraz. 1 Fc- (G4S) 3-FGF21 effectiveness of similar d -Fc L15-FGF21 ( L98R, P171G, Α180Ε), which refers to the MTW 1 Aaterbt Mokhtlgh, Ha, links 3 (G4S) or L15, and did not have a large Lanier vital valet d .FC-FGF21

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01111.tif" id="idf0072" />

-110- ΜΑ 33716Β1 3- 23 intimacy Rabtir 0 Jalgoa 0.0 Lhh's (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε &amp; lt ;, for piotho in linking experiments was a 6-year Rla (Fc- (G4S) 3-FGF21 (L98R, P171G , Α180Ε d β-Klotho Pfera 5 cynoj in a lengthy balance Biacore link experience. Oevia been compared Please choose a Fc- (G4S) 3-FGF21 (FGF21 ^^ (L98R, P171G, Α180Ε Las - Fc However bulletins P171Gj L98R only, and challenged (FC -L15-FGF21 (L98R, P171G (Mtwalahno.: 43), was installed Niotraviden a chip CM5 using paired Secretary. was taken Bertan- FGF21 on flowing again cells for about 15000 RU. the first use of the flow cell sample compared in the background. a 10 was Ahtdham Tgrat FGF21 when relievers (0.03 - 2,000 nano Molar) using 10 Nadhu Molar of β-ΚοΛο human cynoj in PBS plus 0.1 mg / ml Ρ20 ./.0.005, BSA at room temperature for 1 hour. was measured linking solutions mixed by injection? biotin on the surface. defined signal linking% 100 β-Kl.tho in the absence of Tgrat FGF21 in the solution. showed β-link Kloîho low response with increasing concentrations of FGF21 Tgrat to the -β 15 Klotho it has been associated with mutations in FGF21 solution, and who was arrested β-Kl.tho reaction from the surface of the link FGF21 installer biotin. The relative link layout of the mixture versus focus Molara l FGF21 using 5 GraphPad Prizm. It has been the envy of 1 B 0; EC using meow 0 of Zdr Khhlih JÀÉ1 4 Mk 1 n one in the same program. Figure 52 shows the results from the balance of Biacore d Fc- solution correlation experiment (G4S) 3-FGF21 20 (β-KlothoJ Fc-L15-FGF21 (L98R, P171G) j (L98R, P171G, A180E S (S 0) and 1 to Rabah (1 walked). additional (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε for improved correlation to double at least each of the β-Klotho human and baboons compared d -15 Fc-L (FGF21 (L98R, P171G. 4- 23 25 category (15 Fc - (G4S) 3-FGF21 (I ^ 98R, P171G, Α180Ε ^ S 1 cried z 1 n db / db Zmobh pal 0 cr been studying subtraction to determine whether (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε can exert effects metabolic useful, such as Khgd blood glucose and reduce body weight, so the mice db / db

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01121.tif" id="idf0073" />

ΜΑ 33716Β1

Ill infected with sugar. Deliberately study Oadta to the examination period and the dose-response d -3 (Fc- (G4S (FGF21 (L98R, P171G, Α180Ε b * d Adash's 0 Rh and 1 unit. Was in Algtd 1 E Adrdnove Dash- Fc (G4S) 3-FGF21 (L98R, P171G, Α180Ε ) w Jraot 0.1 '0.3' 1 and 3 mg / Kjmldy Algiran infected diabetic db / db. the Oadiatdman material conveyor (10 mM for Molar Tris, 2.2¾ 5 sucrose, 3.3./. sorbitol 'his number Alhipugeni 8.5) for the group that received treatment in the study . was obtained blood samples from each animal (10 = η for each group) at baseline (prior to injection), and after the injection duration of 6.24, 72 120, and 168 hours. the measurement of blood glucose levels using Matthias sugar LifeScan, Inc. Milpitas, CA) OneTouch). the measurement of body weight at baseline (time small) 0.24, 72 120, and 168 h after injection .10 Figure 53 a shows the levels of blood glucose in mice db / db at multiple time points after injection material Almaqla or (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε. led Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε) to lower the dose depends on the blood glucose levels in Alphenran db / db. reached the maximum Khgd for blood glucose about 50./. Alhalh of the line or a comparative group was treated to Article tanker. Access to the maximum effect within 6 hours after injection and continued for 5 for 20 E. hours after injection. Blood glucose levels began to return to baseline in about 168 hours were Anakdrh ED50, a dose required to achieve half of the maximum effect, d -Fc 'G4S) 3-FGF21) about 1 0 g / Kjmvivdhiran db / db. 1 to form 53 b shows the effect of (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε Z 1 venom after injection once in mice db / db. The expression results Ktefir of body weight while the small 20 (prior to injection) showed Algtran that have been Article treated carrier to earn a fixed body weight during a period of 7 days of the study is that the growth rate of body weight was inhibited in mice that have been processed using -Fc 1 G4S) 3-FGF21 ^ way dependent on the dose. whenever they pose Ashe, whenever inhibition pattern longer. in one example, turn off Fc- (G4S) 3-FGF21 L98R, P171G, Α180Ε)) unit gain body weight for 5 days mg / kg at 1 mg / kg, or one 25-day, 0.3 mg / kg. Growth rates were restored later. The ED50 for Anakdrh -3 (Fc- (G4S (FGF21 (L98R, P171G, Α180Ε at reducing body weight of about 1 mg / kg in this experiment. 5-23

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01131.tif" id="idf0074" />

-112- -112-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01141.tif" id="idf0075" />

Fc- (L15) j Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε) 0 Dalzh efficiency Ha number of iterations injection Mokhtlgh DIO 1 at Algiran P171G) can Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε) The study was to determine whether one but with the achievement of (L98R, P171G) to be right less frequently than

Fc- (G4S) 3-FGF21 (L98R, with Aet 1 E DIO 5 efficiency is similar. The study was conducted on Vnran or are given, (Q14D) or once every two weeks (Q7D) Mrnuahdunfa week P171G, Α180Ε) .Q14D 'Q7D' (BIW) RSS Ne exponent FC-L15-FGF21 (L98R, P171G) aged 4 Okhma so meals C57BL / 6 by feeding Nkur Vnran DIO was prepared Vnran energy are rich in fat saturated fatty Ο / .60 acids and high fat included Baal 0 12 ASBO 0 p g AAC 0 Veh . (D12492, Research Diets, Inc., New Brunswick, NJ) 10 on the high-fat meals, a measurement of body weight and blood glucose levels. The carefulness Tqubm Algdhir 1 n DIO randomly assigned to groups that receive material carrier or group that have to achieve an average Matoyat blood glucose at baseline therapy are similar as well as body weight. 7 groups were included in the study group that received Article tanker when Q7D; group that received -3 (Fc- (G4S 15 (FGF21 (L98R, P171G, Α180Ε when Q7D or Q14D; or the group that received -Fc (L98R, P171G) 9 when Q7D, BIW or Q14D. the injection into the peritoneum and the study was conducted for a period of 31 days. the measurement of body weight per week. GTT is bum in the study 28 were terminated study day 31. the study is described in graphic design in Figure 54.

Fc- (G4S) 3-, the Alphenran that have been treated to Article tanker GTT illustrated in Figure 55 attributes u Fc- (L15) -FGF21 (L98R, P171G) or FGF21 (L98R, P171G, Α180Ε) 20 iterations Mokhtlgh doses. Improved statistically glucose tolerance significantly when Algiran that have been Q7D d worsened Rev Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε) E 1 Jhabacthaddam when compared to Article camel, explaining that 1 Q14 Fc- (L15) _ Hassan .DIO the Alphenran Q14D an efficient and convenient to give Α180Ε) but not, Q7D or BIW glucose tolerance when given a dose of FGF21 (L98R, P171G) 25 2 Aden Ash 0 Masphllhakn ^ Fc- (L15) -FGF21 (L98R, P171G) Rev that 'Q14D Fc- ( G4S) 3-FGF21 (L98R, P171G, Bjrah 40 no) have vilified Alvdhiran 0 &amp; lt; Zhhaah 1 when P171G) to those achieved by Q14D or Q7D when Α180Ε)

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01142.tif" id="idf0076" />

-113- 10 15 20 25

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01151.tif" id="idf0077" />

33716Β1

MA BIW or Q7D respectively, Modkha that, Fc- (G4S) 3-FGF21 (L98R, P171G (Α180Ε can be administered in a manner less than twice (P171G 9 Figure 56 shows the changes in body weight of Alhalh line (today's small) have Algiran that was processed article carrier, (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε or - (Fc- (L15 (FGF21 (L98R, P171G when the number of times various doses. The Alphenran that have been treated using Q7D (L98R , P171G, Α180Ε) 1 lost body weight significantly as check to Vnran that received dose (Fc- (L15) -FGF21 (L98R, P171G BIW u. Nthleel body weight were moderately in mice that have been treated at Q14D using -3 ( Fc- (G4S FGF21 (L98R, P171G, Α180Ε) or when using Q7D, L98R) 9 (P171G. not note a significant effect on body weight births Alphenran that have been treated at Q14D using (Fc- (L15) -FGF21 (L98R, P171G. consensus effect on the body 0 p impact on GTT as described above, Modkha that, L98R, P171G) 1 (A180Ε was an efficient when Q14D doses and ask about the number of times injection less than twice (Fc- (L15) -FGF21 (L98R, P171G to achieve the same effect. shawl 24 Sagalhla 6 German Almstth u Tgrat FGF21 provide water gels as a formulation of protein-based therapies that we came back from the required properties. For example, reservation gels German original structure and function for protein gels Alidmn in German. Moreover, it is carried by a gene in accordance with the polymer and the quality of cross-correlation, and can be biodegradable. Farther, we have been successfully using gels German Sabia so as to achieve a sustainable effect of proteins. Accordingly, it has been studied and water gels as a potential way to give Tgrat FGF21 that have been detected here. For all experiments described in this example, water, gels were prepared as follows. It was prepared bovine gelatin solution 25. A 0 Uh (Sigma) in PBS. Added cross correlation factor meth acrylic anhydride by Molarah (MA to gelatin) of 1: 16.24: 1 or 32: 1. Resulting solution was separated sutures versus membrane water to remove any meth acrylamide unnecessary I want hypertext tanker jellies German. Final, has been cooling drying material carrier that gels addictive and have been stored at 4 ° C AVI to reach I types of water gels include Tgrh 0 Ahecn use -114- 33716Β1 this product in the preparation of conductive material from the aqueous gel based gelatin and which can therefore be included on any of Tgrat FGF21 that have been detected here. Thus was prepared gels Nat specific Tgrat FGF21. Mane one of the conductive material of the aqueous gel of gelatin powder meth acrylic 10./0 cryotherapy, it has been prepared solutions. Bury the conductive material of the aqueous gel was then centrifuged for the degradation of the material carrier behalf of jellies German Algilatyna MA dried by cooling. After the addition of the protein that was chosen FGF21 (L98R,), FGF21 (P171G, (RTM succession: 37)) in the current example), to the solution Algilatyna fluidized until a predetermined concentration. Balbtali been added TEMED ore solution. KPS was thereby adding lotion and sleep gently mixing the solution. Were filled syringe 1 ml up to 200 micro liters were allowed its stability for 1.5 to 2 hours at room temperature. Syringes were stored at -20 ° C was dissolved at 4 ° C throughout the night before use. The use of the material from which the tanker aqueous gel presented containing 10 mM Tris Molar of 0.9% sucrose, pH 8.5 with its number is not added Tgrh FGF21 sample Mtarnh. For the experiments in / Ni / RHA, syringes were put on a layer Tejen at 37 degrees for about 10 Maoh Dqang prior to injection in animals. 1-24 activity Kharah living cells (FGF21 (L98R, P171G standpoint z 0 No 0 s Water 10% using a reciprocal correlation rates of multiple The goal of this experiment to test whether (FGF21 (L98R, P171G standpoint Z jellies German is effectively a vital compared to the original image of the (FGF21 (L98R, Ρ171G experience enzyme ELK - to Iossiferraz Khark living cells. Temthouder (not 7 a?, FGF21 (L98R his will in solutions Heath Acrylic gelatin 10./. rates interactively thread of meth Acrylic gelatin 16: 1 '24: 1 and 32 1 Presentation as described. was distracting gels German in the buffer solution outside of living cells to allow for one divorce FGF21 (L98R, P171G). Tmottagmaa middle after 100 or 150 Adshautamtareidahlztjarb outside one of the cells 1 Beard activity (FGF21 (L98R, P171G. analytical tests show (Hthela, - SDS HPLC, PAGE size, the HPLC with Alhlor founded) that (FGF21 (L98R, P171G premise was valid at all time points. -115- 33716Β1 has enzyme ELK experiences - to Iossiferraz using the output of the return system kidney cells and human 293Τ genetic Union, in which overload 293Τ cells in the genetic expression of β-Kl.tho structures and mentor enzyme Iossifraz. Is .β-Kl.th common future d FGF21 is required to activate .FGF receptor that FGF receptors Allenstkhaddmh in this experiment is endogenous FGF receptors 5 are expressed in 293Τ liver cells. Include structures to guide enzyme Iossiferraz on structures Nstal sequences vacated GAL4-ELK1 and mentor to Iossiferraz are urging a reinforced includes five copies tandem to place 5xUAS-Luc) link Gal4). The effectiveness of the enzyme is regulated by the level of Iossifraz 1 Erk / ELK Mufsafar, and Kstkhaddm in indirect observation and determine Kmpeh Activity FGF21. Has an enzyme to Dksaferraz experiments by Astbaat 293T cells in the presence of concentrations Mokhtlgh 0 for z A ^ Rh Aloao (FGF21 (L98R, P171G or (FGF21 (L98RP171G 1 sa gel water for 6 hours, and thus are tested degradation products of cells to determine u 1 i enzyme ELK- to Iossiferraz. Shows Figure 57 results outside of living cells from the experience of the enzyme 11 Tdseveraz. K'an (FGF21 (L98R, P171G Antaleg are gels Han rates interactively thread meth Acrylic gelatin amounting 1:16; 24: 1 and 32: 1 active vital Ha an equivalent activity original image of 15 (FGF21 (L98R, P171G. showed Abianat that gels 1 unscathed h 1 rude Hay 1 Bveh and Ozihh 1 protein embedded FGF21 (L98R) P171G) J premise is considered an effective and consistent even after a period of 10-15 hours in the middle. 2-2420 AAC's / u / seven word d (FGF21 (L98R, P171G a gel S Hzd rates rad commutative Mokhtlgh the Vnran ob / ob aim was 0 n Hzh.ltejrebh determine whether the gel Ani (FGF21 (L98R, P171G Lalai prepared with reciprocal interdependence of meth Acrylic gelatin rates at 24: 1 and 32: 1 may be 0 resulted in the sustained effect of the active usually vital (5 FGF21 (L98R, P171G ^ / Rukh 0 Arhh u 1 Zhaah 25 leads to longer Jib / efficiency Khalah Alha compared to the original image of, FGF21 (L98R P171G). In addition, based on an assessment rates of release Jib Rlkhalabo pill, it determines that reciprocal interdependence top meth acrylic gelatin rates led to the sustained effect of 0 Shell of FGF21 (L98R, P171G) built. Consequently, there is another goal for this experiment, which compared Hlamin

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01171.tif" id="idf0078" />

-116- -116-ΜΑ 33716Β1 Manpin (FGF21 (L98R, P171G was their preparations meth Acrylic gelatin rates of 24: 1 and 32: 1. FGF21 includes a number of vital activities, including, the ability to Khgd blood glucose, Alanmolin, tri triglyceride, Oomstoyat Alchollsatrul; reduce body weight; Ooahassan carrying A glucose, energy use, or insulin sensitivity. the introduction of gels German FGF21 (L98R, P171G) in Alphenran ob / ob resistance has been measured jellies Ani capabilities (FGF21 (L98R, P171G reduce blood glucose and reduce body weight. the procedure to work i /; Il Jib * a 4 a / RHA as shown as follows. were prepared gels German using described here above procedure. has been shaved mice ob / ob 10 (Jackson Laboratory) aged 8 weeks and when the injection site was the anesthesia using ISO Florent and 02 prior to injection directly. was slowly injected gels German (0.2 ml) under the skin was used Vetbond at the site of injection after injection. The Aadia included material carrier (10 mM Molar Tris 0.9% sucrose number, pH 8.5) or included (FGF21 (L98R, P171G in the original trial and kindness in a similar manner in the form of gels Manet. Has re-animals to cages after recovery of 15 Akadir been Alhmbrl on blood samples prior to injection and at multiple time points after injection, Mntha, small, A, 6.24, 42,120,192, and 264 hours after injection. The measure blood glucose levels using a glucose meter LifeScan, Inc. Milpitas, CA) OneTouch). It has control of body weight. - Figures 58 and 59. The results of the experiment. Compared to Article tanker and gels in German Alvestkhaddm Sep 8 Wa) 21 cent 4 Ssrtts blood glucose levels of 20 W at 3 and 6 hours after injection. However, diminished Alztdatd / u / Rzh / spacious image Ala'sbh d (FGF21 (L98R, P171G returned blood glucose levels to the base line after 24 Teh 0 Nain. Led gels German (FGF21 (L98R, P171G to Khgd blood glucose Hbakrta 0.3 Mr worsened 1 T. of after Alann continued activity to a period of 8 days. there was no significant difference p Alhadlat meter 1 Bthtbadleya at 24: 1 or 32: 1. showed Oadta jellies German 25 groups (L98R, P171G) Gnran that have been treated to Article tanker or gels Almave alone . those offspring showed that gels (FGF21 (L98R, P171G Lalai been using meth Acrylic gelatin rates are interrelated type 1 Dlaa.h 24: 1 and 23: 1 was able Tohir

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01181.tif" id="idf0079" />

-117- 33716Β1 launch sustained 0 n (FGF21 (L98R, P171G effective Haoyadachasa parchment and eventually lead Eyre efficiency Otoddrkhaddlaba ue compared to the original image of (FGF21 (L98R, P171G. 3-24 Ahdergnarcykhrkd (FGF21 (L98R, P171G, jFGF21 (L98R, P171G 5 (Α180Ε a watery gel when interactively thread Mokhtlgh rates among Vnran db / B6

Were prepared gel Mani formats using gelatin beef (Sigma) and many of the mutations FGF21 Raafat 4 market 1 (FGF21 (L98R, P171G and, Fc- (G4S) 3-FGF21 (L98R, P171G Α180Ε). The Oadia Mtarnh gel Mani sample preparation. Has been developed 0.2 ml of gel German nee injector 1 ml with a needle .21G Here was prepared aqueous gel samples Intkhaddmh in comparison and gels German containing Tgrh FGF21 as described above. the shaved Vnran hair Jackson Laboratory) db / B6) aged 8 weeks and it when the injection site was using anesthesia Aino Florent, 2 H immediately before injection. Was slowly injected water gels (0.2 ml) under the skin was used Vetbond when Alann place after injection. The Oevia included material carrier (10 mM Molar Tris 0.9% sucrose number, pH 15, 8.5) or included (FGF21 (L98R, original P171G in the experiment and injected in a similar manner to the trivial gels Manet. Has re-animals to their cages after recovery from anesthesia. The get the blood samples prior to injection and at multiple time points after Alhdn, LL, small 0.24, 96,168,240, wa 3 hours after injection. was measured blood glucose levels using a glucose meter OneTouch (LifeScan, Inc. Milpitas, CA). T. 0 T. control less weight 0.20've had demo Altassaam as Homodh as follows: group of animals (η = and for each group) a. jellies German German sample comparison 32: 1 (10./.) 200 HU4: MA Maikarolter b. (FGF21 (L98R , P171G gel AVI 32: 1 (10./.) 0.5 HU4: MA mg / Fehr (200 micro liters ~ 10 mg / kg) 25 d. (FGF21 (L98R, P171G gel I 32: 1 (10./.) 1.5 Η4: MA mg / rat (200 micro liters - 30 mg / kg) d. (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε (for Ayudd Hlamana) 3 mg / kg

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01191.tif" id="idf0080" />

-118- 10 15 20 25 33716Β1 been many Alatefirat measure and explain the results of experiments in the 60-63 forms, illustrated in Figure 60 Altver in blood glucose Ba'ror time of 14 days for the experience, while the figure 61 Bodh percentage Ne Altver of blood glucose over the same period . Figure 62 illustrates Altver in the shape of the body over time 14 day of the experiment, while Figure 63 shows the percentage of Tver in body weight over the same period. Can summarize the results of experiments described graphically in Figures 60-63 as follows: He was (HU4: MA (% 10) 1: 32 FGF21 (L98R, P171G Dar 10 0 ϋω in reducing blood glucose after 24 hours of injection and returned to the blood glucose level the base line between 4-7 Rum. the (HU4: MA (% 10) 1: 32 FGF21 (L98R, P171G Dar 30 0 Ash effective in Nthleel blood glucose are dose of 10 mg / kg, and has noted that the blood glucose level returned to the line Al-Qaeda between 4-7 days. Is (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε Dar 3 mg / Kjcilokoz 1 Kmbh 24 hours are injection to the point were similar with (FGF21 (L98R, P171G at 30 mg / kg Z gels German. comparison sample of jellies German did not include (and that does not include Tgrh FGF21) on any 0 n effects of Ithleel blood glucose. groups showed (FGF21 (L98R, P171G 0 n jellies German ^ 3 (Fc- (G4S (FGF21 (L98R, P171G, Α180Ε ( Aletilatojdfayalalam Akave) Kpozn Aljsmmkhhi compared Balphenran that have been treated sample compared to the aqueous gel. shawl 25 study monkeys Rlr ​​6pm been generating two structures Fc- link -FGF21 using the method described here. included one Alpenidan on succession IgGl Fc (sequence number: 11) are integrated at party C sequence -5ly link) 5-Ser) 9 (sequence number: 11) are integrated at the party sequence Connector (succession RTM: 28) which were incorporated when the party N of succession mature FGF21 (sequence number: 4), Walsh Heihe been introduced Zach P171Gj L98R. Disparage one to raise this Jeremiah 1 Aze in Shal S b &amp; quot; -Fc L15) -FGF21 (L98RP171G)) &amp; quot; (1 Bertm: 43) u. Asaaavih 1 tmp IgGl Fc (sequence number: 11) are integrated at the tip link C sequence - (Gly) Ser- (Gly) 4-Ser

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01201.tif" id="idf0081" />

MA -119- 33716Β1

Gly) 4-Ser) (sequence number: 31) which were incorporated in the N terminal sequence of mature FGF21 (sequence number: 4), in which the three Tgrat Α180Ε, P171G, L98R entry. Are pointing to this! Molecule in 1 Example S b &amp; quot; (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε &amp; quot; (sequence number: 47). The expression of Nanak structures and purification as follows here, and was isolated on Hbnh 5 Dimreh protein image, each monomer of which were interconnected by pioneers disulfide p 1 Bztt Hull Fc region of each monomer. 1-25 Tsim Dart -120- -120-ΜΑ 33716Β1 study was conducted on monkeys and baboons with the presence of palaces Ne attributes glucose tolerance ( IGT). the monkeys aged 8-18 years. Nzaouht weights and their bodies from 5-15 kg BMb of 32-70 kg / m 2. Localisation of 44 has a monkey for a period of six weeks before the start of the compound given. during the acclimation period, the monkeys were trained 4 times week for 4 weeks to get used to the procedures including revenue adherence in the chair, and subcutaneous injection (0.1, PBS million to Trakjm), force-feeding (water 0.0 a million to Trakjm), drawing blood from an OGTT samples and samples OGTT. after 4 weeks 0 n training, OGTT were measured for the mixing of the base and variables metabolize plasma. was selected 40 of the 44 monkey Ahuanaa were divided into three treatment groups to achieve the rule is similar to the weight of the body line levels, responses to OGTT AUC 'and plasma glucose levels and tri Aljherad. The study has blocked the Parties manner. The reference to the group receiving material carrier (Walt 14), (13 = n) Fc- (L15) -FGF21 (L98R, P171G) and, Fc- (G4S) 3-FGF21 (L98R (13 = n) P171G, Α180Ε ) boat a, B, and Dautam Aattaahahrh week are by subcutaneous injection. Was given vehicles manner escalate the dose from a low (0.3 mg / kg) E central (l mg / kg) to high (3 mg / kg) was Fieb all Ilath weeks dose after 9 Osabba vehicles processors, has animal control for 3 more weeks In order to recuperate and heal from the treatments been eating control, body weight, clinical chemistry during the study. Been eating every meal measure. The measurement of body weight Ospuaa 0 assembling Asbuaaabad blood samples five days of each time you inject to measure glucose, tri Algelesarad, cholesterol 1 Klee, -HDL and level 1 T. LDL Cobsrol 0 has OGTTs every three weeks after the start of treatment (at the end of each level dose). AVI is the signal the beginning of a day of treatment with the small and the study is to clarify scheme detailed in Figure 64. n ^ 1 ^ Alod results of Ne This parable is a data Alndjemah at the end of treatment for 9 weeks. 2-25 Tafrmrkpat test on eating animals have been fed twice a day so that each animal received 120 grams of food Nasag during the period of 1 to Zguenm Tq remove leftovers are Altanq of weight after every meal to calculate eat. It was feeding time of 00: 8 Bbaia Avi 30: 8 Sb'kh 1 (± 30 d ^) z Blood 30: 4 1 Miss E I 00: 17:00 Zg 30 minutes). For the production of microprocessors, has been providing interaction (150 g) per animal at 30: 11 I 30: 12 Hsae (± 30 min.) (Every day). Compared to Article tanker, all from one Idqldtnaudtaam -121- 33716Β1 Zdy one of the monkeys (forms 65 '66 and 67). Ibahl (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε eat at every meal, including, meals AM, fruit, PMj by a dose of 0.3 mg / kg. However, declining influence and Hal food returned to nearly baseline or Alakarnh levels after about 30 days of Almajh when the dose is increased to Amjm. was not 1 5 (P171G great effect on eating AM but played down moderately eat at the meal PM when the dose is increased to 1 and 3 mg / kg. However, one (P171G reduced in a similar manner as in eating fruit, Fc- (G4S) 3-FGF21 (L98R, P171G (Α180Ε. showed (L98R, P171G, Α180Ε) 1 overall Tlaar stronger inhibition eat compared d (Fc- (L 15) -FGF21 (L98R, P171 G. afternoon Altoiar to eat 10 to be short of food have been restored eat after about 30 Boom of treatment from 0.3 to 25 the effect of test compounds on body weight on the Supervision of body weight per week during the study. over a period of nine weeks of treatment of treatment, remained the body weight of the animals that have been Amaaljha article tanker Thabia while the body weight in animals that have been Alajhad (Fc- (L15) -FGF21 (L98R, P171G decreased been worsening. Ody- Fc 15 (G4S) 3-FGF21 ( L98R, P171G, Α180Ε) Alykhvd, Okprgeozn Aldjam of- Fc (L15) -FGF21 (L98R, P171G) as shown in Figure 68. Effect of 4-25 vehicles on the body mass index (BMI), skin fold thickness (SFT) and the Ocean ventral (AC) has been monitoring ACj SFT, BMI weekly during the study, both before and after administration of the test vehicle 20 when it was recorded body weight. BMI is defined as the body weight of the individual Mksoia on the box height. SFT refers to the thickness of the double layer of skin and fat underneath dedicated Pferjar exert constant tension over the place. Be ACj, SFT, BMI is a relatively accurate measurements, simple and Maclgh combination of the body and in particular which refers to the fat under the skin. Animals that are treated article showed the tanker AO * SFT, BMI Thabidin Nsbiaokhalal study. Animals that were 25 pulp showed (Fc- (G4S) 3-FGF21 (L98R ^ Fc- (L15) -FGF21 (L98R, P171G (710, Α180Ε Abuyatshd ACj, SFT, BMI over study Nat 9 weeks' RHA that each of the two compounds led a reduction in fat cent. was 1

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01231.tif" id="idf0082" />

-122- Γ7Μ1? &amp; Lt ;? ! (L98R, P171G, Α180Ε) more effective in most cases the cut backs in the SFT, BMI, and 1 1 results are illustrated in Figures 69.70, 71 ', respectively. 5-25 test raises the blood glucose levels of compounds in the fasting state were 5 pooling of blood from the animals was Tsoimha throughout the night. It was done by withdrawing blood from one Spuaa after 5 days of Ain. ^ (Fc- (L15) -FGF21 'Fc- (G4S) 3-FGF21 (L98RP171G, Α180Ε (L98R, PI71 G) of blood glucose levels in a fasting state. Downplayed Fc- (G4S) 3-FGF21 L98R, P171G, Α180Ε )) blood glucose levels at a dose of 0.3 mg / kg achieved the harshest Khgd glucose when the escalation of the dose to 1 mg / kg. However, the - (15 Fc- (L 10 (FGF21 (L98R, P171G Odyvqta.ly lowest Khgd in blood glucose levels at Low bold are tested (3 mg / kg). Accordingly, it was, Fc- ( G4S) 3-FGF21 (L98R, P171G (Α180Ε more efficient and led to Khgd glucose blood more Dothamn 1 L98R, P171G)). not NOTE low blood sugar Fiji 0 n monkeys that have been processed in any Net monkeys Alnin been treated using (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε 15 1 shown in Fig. 72 Matoyat plasma glucose in the fasting state during the study period. Tabar test is fulfilled Aslokgazz for Gade gloom (OGTT) a team OGTTs test before and after Alaagat. esta OGTTs every three weeks to test the compound 1 effect to test all are dose level. Hassan, Fc- (G4S) 3-FGF21 (L98R, P171G 20 (£ 8180 from glucose tolerance at all test doses of 0.3 Leslie 3 mg / kg. the TEKEL glucose levels and the movement of glucose after a large dose of glucose in the test response to therapy d -Fc (G4S) 3-FGF21 (L98R, P171G, Α180Ε). no shower à Ktjbhljerehmlhozhtodh that (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε Anq maximum impact at a dose of 0.3 mg / kg. led (C- (L15) -FGF21 / (L98R, P171G I Avi p 1 Dcz d Rlo Amjm 25 kg was not clear why reducing the vulnerability when the dose was increased to 3 mg / kg. Auhedh E. .lchukl 73 attributes curve OGTT tribal and dimensionality, as well as the area under the curve OGTT E 7-25

CV -23- 33716Β1 Mrenbat the impact of the test on the three-Scaat triglyceride blood was collected from the animals was Tsoimha throughout the night. Blood was withdrawn a week after five days of each ton was tri triglyceride levels significantly lower in animals that have been processed using (Fc- (G4S) 3-FGF21 (L98R, P171G, A180E or Fc- (L15) -FGF21 5 (L98RP171G) . However, the (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε was more 0Fc- (L15) -FGF21 (L98R, P171G) c &amp; gt; ^ y Valley, Fc- (G4S) 3-FGF21 (L98R (P171G , Α180Ε to the maximum Khgd levels tri Gelesarad plasma at 0.3 mg / kg while the (Fc- in (L15) -FGF21 (L98R, P171G only led to Khgd average tripartite Astoyat triglyceride highest dose tested (3 mg / kg). the figure shows 74 tri-levels Gelesrad 10 plasma during the study period.

8-25 Effect of test compounds on the total cholesterol and HDL cholesterol, blood was collected from Heoanata been Tsoimha throughout the night. Blood was withdrawn a week after five days of each injection. Headed total cholesterol levels in plasma and cholesterol - HDL to increase after Afabd (£ 8180, Fc- (G4S) 3-FGF21 (L98RP171G or Fc- (L15) -FGF21 15 (L98R, P171G). Figures 75 and 76 total cholesterol and cholesterol levels - HDL over the study time. 9-25 Conclusion in the study of escalating the dose that has the Nkur Alqirdharrbah IGT, has been treating animals using spikes 21? Ybhlo 0 Ae?, and Daaz 0 RT 1 20 (P171G, Α180Ε and (Fc- (L15) -FGF21 (L98R, P171G Abihsh variables. was reduced body weight and improve body composition. has NOTE Khgd eat for a short period and was restored eat until the base line or comparative levels in Mitcef study. the Oadia reduce blood glucose in the case of fasting and levels of triglyceride by each of the vehicles -3 (Fc- (G4S FGF21 (L98R, P171G, A180E) or (0Fc- (L15) -FGF21 (L98R, P171G p. 25 OGTT was in Tgevh raise cholesterol levels -HDL. d compared to 5) -FGF21 a Fc- (E ( L98R, P171G), 1 discerned that (Fc- (G4S) 3-FGF21 (L98R, P171G, Α180Ε taste -Fc ^ 171G t L15 ^ -FGF21 ^ L98R ^ ^ h ^ Hnh Rat at any dose tested. achieved (Fc- (G4S ) 3-FGF21 (L98R, P171G, Α180Ε Oqsyalchatlgalbahalehtgarat

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01251.tif" id="idf0083" />

-124- 33716Β1 that are measured when Aattanha by 0.3 mg / kg. Accordingly, Aamcn that effective therapeutic dose is &amp; lt ;, (Fc- (G4S) 3-FGF21 (L98RP171G Α180Ε the Alora 1 Low Ashe Z 0.3 mg / kg. Shawl 26 5 study consistency among // Arok Rrr 6 h This study was designed to determine If (L98R, P171G, Α180Ε) 0.1 (successive number: 57) were more resistant Brudiaz of (L98R, P171G) 0.1 (sequence number: 43.) has been observed treatment-party Alkrboxa after injection ____ (L98R, P171G) in Alphenran or monkeys as described in example 21. decomposition led to the loss of the arena 10 d 1 to 3 unit constructivism amino acid of the party led C. C cover the party's efforts or introduce more Mnalotfrat in party C d (Fc- (L15) -FGF21 ( L98R, P171G Avi &amp; lt; Joel Vozq (Fc- (L15) -FGF21 (L98R, P171G, Α180Ε. Tmsaloh Aldralaba) with a p (Fc- (L15) -FGF21 (L98R, P171G, Α180Ε Kankery Fc- (L15) -FGF21 ( L98R, P171G) ^ J ^.

15 Tmtol; flora of LED (Fc- (L15) -FGF21 jFc- (L15) -FGF21 (L98R, P171G, A180E (L98R, P171G). Included telecom infrastructure on succession IgGl Fc (sequence number: 11) are integrated at the tip -C succession Gly link) 5-Ser- (Gly) 3-Ser- (Gly) 4-Ser) (succession RTM: 28) and Alfie were therefore merged party N of mature FGF21 sequence (sequence number: 4), and which is inserted into any Z Alotfrtin 171G, L98R or three Tgrat, A180EJ, P171G, L98R, was the expression of the structures 20 and purified as described here and separated in the form of Dimreh protein image, each monomer of which were interconnected by links to disulfide between molecules between Pc region and monomer.

It was compared fortitude Dakhlrnd 6 Ri d (Fc-J Fc- (L15) -FGF21 (L98R, P171G 1 L15) -FGF21) has Nkur 1 Qirdhrrrbah. The Hakn- (Fc- (L15 (Fc- (L15 ) -FGF21 (L98R, P171G, A180E ^ FGF21 (L98RP171G Vi'tmrd 25 monkeys baboons at 23.5 mg / kg. The blood samples at multiple time points after a single injection assembly within the vein. Matthias been using mass spectrometry MALDI-TOF familiarity with immune surveillance in metabolites at every point and followed by injection. the results are illustrated in Figure 77. -125- -! Trlod (e 171?, Fc- (L 15) -FGF21 ( L98R 'additional, L98R) 1 (P171 G, A180Ε low decomposition significantly party C Ha peaks blocks less subject to explore adjacent to the summit the main sound of the molecule, explaining that the Tgrh Α180Ε slowed decomposition peptidase party C. has Aydia NOTE largest Alchwibat with loss of mass estimated at [376-termination, _! [5] 394 and [401-1e, and only Nanlrt 0 Aknd134-133 0.154 to 153, and 159-158, in succession urinary peptide FGF21. Chwib contributed enzyme internal Andobptidaz in the overall metabolism of both - (Fc- (L15 (Fc- (L15 ) -FGF21 (L98R, P171G, A180E) jFGF21 (L98R, P171G and sleep Z that the boom Α180Ε impact significantly on the decomposition of the internal Andobptidaz rate. to increase the contrast and provide details of the Bzit decomposition, conducted Oadia MRM (multiple reaction monitoring 10) LC-MS to monitor many of the images fragments decomposition party has monkeys C. samples of affinity purification and exposing them to digest Asp-Ν. Thus been monitoring Alaptadat digested Party C by MRM. Been expressed Ntanj many pictures fragments decomposition party C on trivial relative amount of the types of Aleptad full - length (%) shown in Figure 78. We remain a compatibility with the spectra of MALDI, the analysis MRM semi - quantitative terminal fragments C showed an abundance proportional Nkhvdh of peptide fragments that lacks E. 3-1 15 amino acids of the C party and abundance Alzandh proper proportionality of the molecule in monkeys that are a 0 Etaaha (£ 8180, Fc- (L15) -FGF21 (L98RP171G; ^ Fc- (L15) -FGF21 L98R, P171G)). Folding some brief, showed (^ &amp; lt; ^ Fc- ( L15) -FGF21 (L98R, P171G, A180E o rack C and enhanced in terms of Althbatdazias S Ehgharzh d, Fc- (L15) -FGF21 (L98R 20 (P171G the Alqirdhrrr 9 h. E 27 0 1 Dkiat Aldo Veh d (Fc- (L15) -J Fc- ( L15) -FGF21 (L98R, P171G, Α180Ε FGF21 (L98R, P171G) 1 Ki Saran Tmtahedmbim Hzhaldrash p 1 Dat Aldo'vehl, Fc- (L15) -FGF21 (L98RP171G 25 (Α180Ε (Mtwalahno.: 57) Fc- (L15) -FGF21 (L98R, P171G) j ( Mtwabhrhm: 43) dose and 1 unit within one Lord Lad Sr'n 6 / C57BL. a

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01271.tif" id="idf0084" />

-126- 33716Β1 Tama 0 Etae (Fc- (L15) -FGF21 jFc- (L15) -FGF21 (L98R, P171G, Α180Ε (L98R, P171G) at 20 mg / kg by intravenous injection. Blood samples were assembling at 0083 (5 Dqang ), 16,8,4,1, 24.48, 72.96 '168.240 hours after dosing. to determine plasma concentrations of the molecule proper full-length, was developed ELISA using FGF21 a prompt immune reaction to the party and the party N C Track experience experience molecule full-length with proper concentrations neglected products other biodegradable. the Tohfaih plasma concentrations d 1 (Fc- (L15) -FGF21 (L98R, P171G ^ P171G, A180E Iahanvivatra 0240 class, followed by injection into a vein at Algiran as shown in Figure 79. Kazttrkiz 1 v 1 plasma 4 (Fc- (L15) -FGF21 (L98R, P171G, Α180Ε Ardblo largest are those generated by (L98R, P171G) 1 Alnatty at the same dose level of 24 to 168 hours after the injection. the amount of large 0 n '(P171G, Α180Ε measurable after injection duration of 168 hours. As a result, it showed - (Fc- (L15 ^ for Azmaszakn to double compared with d (L98R, P171G) - the half-life Dr. -Fc (46.6 (L15) -FGF21 (L98RP171G, Α180Ε I and fitting for Fc-'s (L15) -FGF21 (9.4 (L98R, P171G hours. The two compounds are less negotiable level of exploration at 240 hours post-dose. Shawl 28

Generating mutations address Paljlecosal linked party ware to improve Amaah or reduce Chwib party C to increase the period of Walker migraine was Tgrat FGF21 design and generation to create the potential places tackle Paljlecosal linked d N and that genetic expression mammal using the lowest tearing succession original amino acid. Mutations facility include (FGF21 (Υ179Ν, S181T (Mto'lahno.: 161) E FGF21 Υ179Ν (1 st Bertm: 163 ^ FGF21 Ρ124δ (1 st Bertm 165). The genetic expression of mutations in passing in 293-6Ε cells were circles put up a test to determine the activity in enzyme Ioualaliossiferraz experience in LUI cjh / Q. has enzyme experiments Ya-to Iossiferraz as described in example 4, except for the use of conventional thinners for media put up, we want to use Mokhtlgh concentrations of proteins purified. -127- revealed circles formatted analysis he did not check processing Paljlecosal Alzandh compared to type is the processor in the genetic expression system, transit, illustrated in Figure 80 results of an experiment enzyme activity ELK- to Iossiferraz. results Alobeinh shows in Figure 80 to Tgrh FGF21 P124S does not adversely affect the activity of FGF21 but Tgrat FGF21 (Υ179Ν, S181T) J FGF21 Υ179Ν in the absence of 5 Paljlecosal treatment led to see is reduced, as is his experience in the experience of the enzyme to Iossiferraz. Although the present invention has been described in several embodiments of the image, but it is understood that there are many changes and modifications that can be made for an experienced in this the field. For this reason, the protection elements designed to cover all these differences with respect and isotopes that fall within the scope of the present invention 10 as shown in the elements of protection. In addition, parts addresses Almnkurh came here for the purpose of regulatory purely not intended to restrict the subject Almnkur. All references Almnkurh here in this application is referred to the contents of the reference here to achieve any of the purposes.

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01291.tif" id="idf0085" />

-128-33716Β1 List of sequences &amp; lt; 110 &amp; gt; Belouski, Edward Biloski SAL Edward Ellison, Murielle M. Alieon Muriel M. Hamburger, Agnes E. Hamburg Agnes E. Hecht, Randy I. Randy Hecht any Li, Yue-Sheng Li Yu-Hath Michaels, MarkL. Al Michaels Marc Sun, Jeonghoon age Geingon Xu, Jing Que Genh and Asthaddamalha &amp; lt; 20 a &amp; gt; FGF21 Tgrat &amp; lt; 130 &amp; gt; A-1429-WO-PCT2 &amp; lt; 160 &amp; gt; 165 &amp; lt; 170 &amp; gt; Palentln version 3.5 &amp; lt; 210 &amp; gt; 1 &amp; lt; 211 &amp; gt; 630 &amp; lt; 212 &amp; gt; DNA Homo sapiens &amp; lt; 213 &amp; gt; 10 15 20 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (630) &amp; lt; 400 &amp; gt; 1 atggactcggacgagaccgggttcgagcactcaggactgtgggtttct 48 Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15 gtg ctg get ggt ctt ctg ctg gga gee tgc cag gca cac ccc ate ​​cct 96 Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin ala His Pro lie Pro 20 25 30 gac tec agt cct etc ctg caa ttc ggg ggc caa gtc egg cag egg tac 144 25 30 35 5 -129-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01311.tif" id="idf0086" />

33716Β1

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 etc tac aca gat gat gee cag cag aca gaa gee cac ctg gag ate agg 192 Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60 gag gat ggg aeg gtg ggg ggc get get gac cag age ccc gaa agt etc 240 Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80 ctg cag ctg aaa gee ttg aag ccg gga gtt att caa ate ttg gga gtc 288 Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin lie Leu Gly Val 85 90 95 aag aca tec agg ttc ctg tgc cag egg cca gat ggg gcc ctg tat gga 336 Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 teg etc. cac ttt gac cct gag gcc tgc age ttc egg gag ctg ett ett 384 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125 gag gac gga tac aat gtt tac cag tcc gaa gcc cac ggc etc ccg ctg 432 Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140 10 15 20 25 cac ctg cca ggg aac aag tcc cca cac egg gac cct gca ccc ega gga 480 His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160 cca get ege ttc ctg cca eta cca ggc ctg ccc CC.C gca ccc ccg gag 528 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175 cca ccc gga ate ctg gcc ccc cag ccc ccc gat gtg ggc tcc teg gac 576 Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 cct ctg age atg gtg gga cct tcc cag ggc ega age ccc age tac get 624 Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205 30 35 40 tcc tga Ser 630 45 &amp; lt; 210 &amp; gt; 2

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01312.tif" id="idf0087" />

5 -130 &amp; quot; ΜΑ 33716Β1

&amp; Lt; 211 &amp; gt; 209 &amp; lt; 212 &amp; gt; PRT Homo sapiens &amp; lt; 213 &amp; gt; &amp; Lt; 400 &amp; gt; 2

Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 1 5 10 15 10

Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro lie Pro 20 25 30 15

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 20

Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60

Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80 25

Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin lie Leu Gly Val 85 90 95 30

Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 35

Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125 40

Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140

His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160 45

Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01321.tif" id="idf0088" />

5 -131-ΜΑ 33716Β1

Pro Pro Gly Ile Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190

Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205 10

Ser &amp; lt; 210 &amp; gt; 3 &amp; lt; 211 &amp; gt; 546 &amp; lt; 212 &amp; gt; DNA Homo sapiens &amp; lt; 213 &amp; gt; 15 20 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (546) &amp; lt; 400 &amp; gt; 3 caccccatccctgactccagtcctctcctgcaattcgggggccaagtc 48 His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val 15 10 15 egg cag egg tac etc tac aca gat gat gee cag cag aca gaa gee cac 96 Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His 20 25 30 ctg gag ate agg gag gat ggg acg gtg ggg ggc get get gac cag age 144 Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser 35 40 45 ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga gtt att caa 192 Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin 50 55 60 ate ttg gga gtc aag aca tec agg ttc ctg tgc cag egg cca gat ggg 240 lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly 65 10 15 1 gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc egg 288 Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01331.tif" id="idf0089" />

-132- 33716Β1 gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc cac 336 GJu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His 100 105 110 ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac egg gac cct 384 Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115 120 125 gca ccc ega gga cca get ege ttc ctg cca eta cca ggc ctg ccc ccc 432 Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro 130 135 140 gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat gtg 480 Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val 145 150 155 160 ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega age 528 Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser 165 170 175 cccagctacgcttcctga 546

Pro Ser Tyr Ala Ser 180

&amp; Lt; 210 &amp; gt; 4 &amp; lt; 211 &amp; gt; 181 &amp; lt; 212 &amp; gt; PRT Homo sapiens &amp; lt; 213 &amp; gt; &amp; Lt; 400 &amp; gt; 4

His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val 15 10 15

Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His 20 25 30

Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser 35 40 45

Pro Glu Ser Leu L.eu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin 50 55 60 5 -133- 33716Β1

Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly 65 70 75 80

Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95 10

Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His 100 105 110

Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115 120 125 15

Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro 130 135 140 20

Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val 145 150 155 160 25

Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser 165 170 175 30

Pro Ser Tyr Ala Ser 180 &amp; lt; 20 5 &amp; lt; 211 &amp; gt; 63,035

&amp; Lt; 212 &amp; gt; DNA Homo sapiens &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 40 &amp; lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (630) &amp; lt; 400 &amp; gt; 5 atggactcggacgagaccgggttcgagcactcaggactgtgggtttct 48 45

Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15 5 -134- 1 33716Β1 gtg ctg get ggt ctt ctg ctg gga gcc tgc cag gca cac ccc ate ​​cct 96 Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro lie Pro 20 25 30 gac tec agt cct etc ctg caa ttc ggg ggc caa gtc egg cag egg tac 144 Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 etc tac aca gat gat gcc cag cag aca gaa gcc cac ctg gag ate agg 192 Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60 gag gat ggg aeg gtg ggg ggc get get gac cag age ccc gaa agt etc 240 Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 16 65 ¾0 ctg cag ctg aaa gcc ttg aag ccg gga gtt att caa ate ttg gga gtc 288 Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin lie Leu Gly Val 85 90 95 aag aca tcc agg ttc ctg tgc cag egg cca gat ggg gcc ctg tat gga 336 Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 teg etc cac ttt gac cct gag gcc tgc age ttc egg gag ctg ctt ctt 384 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125 gag gac gga tac aat gtt tac cag tcc gaa gcc cac ggc etc ccg ctg 432 Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140 cac ctg cca ggg aac aag tc.c cca cac egg gac cct gca ccc ega gga 480 His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160 cca get ege ttc ctg cca eta cca ggc ctg ccc ccc gca etc ccg gag 528 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 165 170 175 cca ccc gga ate ctg gcc ccc cag ccc ccc gat gtg ggc tcc teg gac 576 Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 cct ctg age atg gtg gga cct tcc cag ggc ega age ccc age tac get 624 Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205 10 15 20 25 50 35 40 tcctga 630 1 45 -135- 33716Β1

Ser

&amp; Lt; 210 &amp; gt; 6 &amp; lt; 211 &amp; gt; 209 &amp; lt; 212 &amp; gt; PRT 10 Alansav sapiens &amp; lt; 213 &amp; gt; 6 &amp; lt; 400 &amp; gt;

Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Aal Ser 15 10 15 15

Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro lie Pro 20 25 30

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45

Leu Lyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60

Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80

Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin lie Leu Gly Val 85 90 95 35

Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 40

Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125

Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140 45

His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01371.tif" id="idf0090" />

5 -136- ΜΑ 33716Β1 145 150 155 160

Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 165 170 175

Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 10

Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205 15

Ser &amp; lt; 210 &amp; gt; 7 &amp; lt; 211 &amp; gt; 546 &amp; lt; 212 &amp; gt; DNA Homo sapiens &amp; lt; 213 &amp; gt; 20 25 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (546) 30 &amp; lt; 400 &amp; gt; 7 caccccatccctgactccagtcctctcctgcaattcgggggccaagte 48 His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val 15 10 15 35 egg cag egg tac etc tac aca gat gat gcc cag cag aca gaa gcc cac 96 Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His 20 25 30 40 ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag age 144 Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser 35 40 45 45 ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att caa 192 Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin 50 55 60 ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag egg cca gat ggg 240 lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly ΓΥ 5 -137- 1 33716Β1 65 70 75 80 gcc ctg tat gga teg etc cac ttt gac cct gag gee tgc age ttc egg 288 Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95 gag ctg ett ett gag gac gga tac aat gtt tac cag tee gaa gcc cac 336 Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His 100 105 110 ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac egg gac cet 384 Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115 120 125 gca ccc ega gga cca get ege ttc ctg cca eta cca ggc ctg ccc ccc 432 Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro 130 135 140 gc.a etc ccg gag cca ccc gga ate ctg gcc cc.c cag ccc ccc gat gtg 480 Ala Leu Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val 145 150 155 160 ggc tee teg gac cct ctg age atg gtg gga cct tee cag ggc ega age 528 Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser 165 170 175 10 15 20 25 ccc age tac get tee tga Pro Ser Tyr Ala Ser 180 546 30

&amp; Lt; 210 &amp; gt; 8 &amp; lt; 211 &amp; gt; 181 &amp; lt; 212 &amp; gt; PRT 35 Homo sapiens &amp; lt; 213 &amp; gt; &amp; Lt; 400 &amp; gt; 8 40

His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val 15 10 15

Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His 20 25 30 45

Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01391.tif" id="idf0091" />

5 -138-

5 -138- UK 33716Β1

Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin 50 55 60

Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly 65 70 75 80 10

Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95

Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His 100 105 110 15

Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115 120 125 20

Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro 130 135 140 25

Ala Leu Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val 145 150 155 160 30

Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser 165 170 175

Pro Ser Tyr Ala Ser 180 35 &amp; lt; 210 &amp; gt; 9 &amp; lt; 211 &amp; gt; 10 &amp; lt; 212 &amp; gt; PRT Soualah industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; Part of the poly peptide FGG21 human survey &amp; lt; 223 &amp; gt; 9 &amp; lt; 400 &amp; gt; 4045 (

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01401.tif" id="idf0092" />

5 -139-MA 33716 E. Β1

Met His Pro Ile Pro Asp Ser Ser Pro Leu 1 5 10 &amp; lt; 210 &amp; gt; 10 &amp; lt; 211 &amp; gt; 681 &amp; lt; 212 &amp; gt; DNA Alansav sapiens &amp; lt; 213 &amp; gt; 10 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (681) &amp; lt; 400 &amp; gt; 10 gacaaaactcacacatgtccaccttgtccagctccggaactcctgggg 48 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 15 10 15 gga ccg tea gtc ttc etc ttc ccc cca aa ccc aag gac acc etc atg 96 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age cac 144 lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 35 40 45 gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag gtg 192 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60 cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg tac 240 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr Tyr 65 70 75 80 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat ggc 288 Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly 85 90 95 aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc ate ​​336 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro lie 100 105 110 gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag gtg 3 84 Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val 115 120 125 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01411.tif" id="idf0093" />

5 -140-ΜΑ '33716Β1 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc agc 432 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val Ser 130 135 140 ctg acc tgc ctg gtc aaa ggc ttc tat ccc agc gac atc gcc gtg gag 480 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160 tgg gag agc aat ggg cag ccg gag aac aac tac aag acc acg cct ccc. 528 Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175 gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc gtg 576 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg atg 624 Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val Met 195 200 205 cat gag get ctg cac aac cac tac acg cag aag agc etc tcc ctg tet 672 His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser 210 215 220 ccg ggt aaa 681 Pro Gly Lys 225 10 15 20 25 &amp; lt; 210 &amp; gt; 11 30 &amp; lt; 211 &amp; gt; 227 &amp; lt; 212 &amp; gt; PRT Homo sapiens &amp; lt; 213 &amp; gt; &amp; Lt; 400 &amp; gt; 11 35 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 15 10 15

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 40 lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 35 40 45 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01421.tif" id="idf0094" />

-141- 33716Β1

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr Tyr 65 70 75 80

Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly 85 90 95

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 100 105 110

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val 115 120 125

Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val Ser 130 135 140

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160

Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190

Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val Met 195 200 205

His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser 210 215 220

Pro Gly Lys 225 &amp; lt; 210 &amp; gt; 12 1 33716Β1 -142- &amp; lt; 211 &amp; gt; 40 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; PCRDpW &amp; lt; 400 &amp; gt; 12 aggaggaata acataigcat ccaattccag attcttctcc 40 10 &amp; lt; 210 &amp; gt; 13 &amp; lt; 211 &amp; gt; 33 &amp; lt; 212 &amp; gt; DNA &amp; lt; 2 successive industrial &amp; lt; 3 a &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; PCR initially &amp; lt; 400 &amp; gt; 13 tagtgagctc gaattcttag gaagcgtagc tgg 33 &amp; lt; 210 &amp; gt; 14 &amp; lt; 211 &amp; gt; 41 &amp; lt; 212 &amp; gt; DNA &amp; lt; 213 &amp; gt; Succession industrial &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; PCR principles &amp; lt; 400 &amp; gt; 14 ggagatatac atatgccaat tccagattct tctccattat t 41 15 20 25 30 35 &amp; lt; 210 &amp; gt; 15 &amp; lt; 211 &amp; gt; 34 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 40

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01441.tif" id="idf0095" />

&amp; Lt; 220 &amp; gt;

-143- 5MK 33716Β1 &amp; lt; 223 &amp; gt; PCR principles &amp; lt; 400 &amp; gt; 15 catatgtata tctccttctt aaagttaaac aaaa 34 &amp; lt; 210 &amp; gt; 16 &amp; lt; 211 &amp; gt; 34 &amp; lt; 212 &amp; gt; DNA Industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; PCR commencement 4 &amp; lt; 400 &amp; gt; 16 aaaacaaatt gaaattcttc ctctatatgt atac 34 &amp; lt; 210 &amp; gt; 17 &amp; lt; 211 &amp; gt; 63 &amp; lt; 212 &amp; gt; DNA &amp; lt; 213 &amp; gt; Succession Saih &amp; lt; 220 &amp; gt; &amp; lt; 223 &amp; gt; FGF21 cue from the sensory part of the genetic expression of structure &amp; lt; 400 &amp; gt; 17 ttttgttlaa ctttaagaag gagatataca tatgcatcca attccagatt cttctccatt 60 att 63 &amp; lt; 210 &amp; gt; 18 &amp; lt; 211 &amp; gt; 63 &amp; lt; 212 &amp; gt; DNA Industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; cue from the anti-sense part of the genetic expression of the structure for 223 &amp; gt; FGF21 &amp; gt; 10 15 20 25 30 35 40 &amp; lt; 400 &amp; gt; 18 aaaacaaatt gaaattcttc c.tctatatgt atacgtaggt taaggtctaa gaagaggtaa 60

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01451.tif" id="idf0096" />

ΜΑ 33716Β1 taa

&amp; Lt; 210 &amp; gt; 19 &amp; lt; 211 &amp; gt; 34 &amp; lt; 212 &amp; gt; DNA &amp; lt; 213 &amp; gt; Succession industrial &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; PCR principles &amp; lt; 400 &amp; gt; 19 aggaggaata acatatggac aaaactcaca catg

&amp; Lt; 210 &amp; gt; 20 &amp; lt; 211 &amp; gt; 23 &amp; lt; 212 &amp; gt; DNA &amp; lt; 213 &amp; gt; Succession industrial &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; PCR initially &amp; lt; 400 &amp; gt; 20 ggatccacca ccaccgctac cac

&amp; Lt; 210 &amp; gt; 21 &amp; lt; 211 &amp; gt; 39 &amp; lt; 212 &amp; gt; DNA &amp; lt; 213 &amp; gt; Succession industrial &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; PCR initially &amp; lt; 400 &amp; gt; 21 ggtggtggtg gatcccatcc aattccagat tcttctcca

&amp; Lt; 210 &amp; gt; 22 &amp; lt; 211 &amp; gt; 33 &amp; lt; 212 &amp; gt; DNA -145- 33 27 30 33716Β1 succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; Initially 223 &amp; gt; PCR &amp; gt; &amp; Lt; 400 &amp; gt; 22 tagtgagctc gaattcttag gaagcgtagc tgg &amp; lt; 210 &amp; gt; 23 &amp; lt; 211 &amp; gt; 27 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; Initially 223 &amp; gt; PCR &amp; gt; &amp; Lt; 400 &amp; gt; 23 atggtggaac cttcccaggg ccgaagc &amp; lt; 210 &amp; gt; 24 &amp; lt; 211 &amp; gt; 30 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; Initially 223 &amp; gt; PCR &amp; gt; &amp; Lt; 400 &amp; gt; 24 ggaaggttcc accatgctca gagggtccga &amp; lt; 210 &amp; gt; 25 &amp; lt; 211 &amp; gt; 50 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; Cue from the sensory part of the genetic expression of the structure for 223 &amp; gt; FGF21 &amp; gt; -146- 33716Β1 &amp; lt; 400 &amp; gt; 25 ctcctcggac cctctgagca tgglgggacc llcccagggc cgaagcccca 50

&amp; Lt; 210 &amp; gt; 26 &amp; lt; 211 &amp; gt; 30 &amp; lt; 212 &amp; gt; DNA Industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; Initially 223 &amp; gt; PCR &amp; gt; &amp; Lt; 400 &amp; gt; 26 30 agcctgggag actcgtacca ccttggaagg

&amp; Lt; 210 &amp; gt; 27 &amp; lt; 211 &amp; gt; 50 &amp; lt; 212 &amp; gt; DNA Industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; Cue anti-sense Z part of the genetic expression of the structure 223 &amp; gt; FGF21 &amp; gt; &amp; Lt; 400 &amp; gt; 27 gaggagcctg ggagactcgt accaccctgg aagggtcccg gcttcggggt 50

&amp; Lt; 210 &amp; gt; 28 &amp; lt; 211 &amp; gt; 15 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; G5SG3SG4S (L15) link &amp; lt; 400 &amp; gt; 28

Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser 15 10 15 &amp; lt; 210 &amp; gt; 29 -147- ΜΑ 33716Β1

&amp; Lt; 211 &amp; gt; 4 &amp; lt; 212 &amp; gt; PRT &amp; lt; 213 &amp; gt; Industrial &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; G4 link &amp; lt; 400 &amp; gt; 29 Gly Gly Gly Gly 1 &amp; lt; 210 &amp; gt; 30 &amp; lt; 211 &amp; gt; 5 15

&amp; Lt; 212 &amp; gt; PRT &amp; lt; 213 &amp; gt; Industrial &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; G5 20 Link &amp; lt; 400 &amp; gt; 30 6ly Gly Gly Gly Gly 25 30

&amp; Lt; 210 &amp; gt; 31 &amp; lt; 211 &amp; gt; 15 &amp; lt; 212 &amp; gt; PRT Sanna Aa &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; RAD 3 (223 &amp; gt; (G4S &amp; gt; 35 &amp; lt; 400 &amp; gt; 31

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 15 10 15 40 &amp; lt; 210 &amp; gt; 32 &amp; lt; 211 &amp; gt; 8 0 \ ΜΑ 33716Β1 -48 A-

&amp; Lt; 212 &amp; gt; PRT &amp; lt; 213 &amp; gt; Industrial &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; G3KG4 5 rad &amp; lt; 400 &amp; gt; 32

Gly Gly Gly Lys Gly Gly Gly Gly 0 of 5 1 &amp; lt; 210 &amp; gt; 33 &amp; lt; 211 &amp; gt; 8 &amp; lt; 212 &amp; gt; PRT Industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; G3NGSG2 rad &amp; lt; 400 &amp; gt; 33 Gly Gly Gly Asn Gly Ser Gly Gly 1 5 &amp; lt; 210 &amp; gt; 34 &amp; lt; 211 &amp; gt; 8 &amp; lt; 212 &amp; gt; PRT &amp; lt; 213 &amp; gt; Sanna Aa &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; G3CG4 link &amp; lt; 400 &amp; gt; 34 Gly Gly Gly Cys Gly Gly Gly Gly 15 20 25 30 35

&amp; Lt; 210 &amp; gt; 35 &amp; lt; 211 &amp; gt; 5 &amp; ​​lt; 212 &amp; gt; PRT 40 5 -149- &amp; lt; 213 &amp; gt; Industrial &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; GPNG2 and armpit &amp; lt; 400 &amp; gt; 35 Gly Pro Asn Gly Gly

JO

&amp; Lt; 210 &amp; gt; 36 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA 15 successive industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21RG 20 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 36 atgcatccaattccagattotetccattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag cgt tac etc tac aca gat gat gee cag cag aca gaa gee 96 Val Arg Gin Arg Lyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gac ggg aeg gtg ggg ggt get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg ggt gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg ggt gtc. aag aca tee agg ttc. ctg tgc cag egg cca gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 25 30 35 40 45 ggg gcc ctg tat gga tc.g etc cac ttt gac cct gag gcc tgc age ttc 288

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01511.tif" id="idf0097" />

5 -150 &amp; quot; ΜΑ 33716Β1

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 cgt gag cgt ctt ctt gag gac ggt tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 10 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac cgt gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gea ccc ega gga cca get ege ttc ctg cca c.ta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 15 ccc gea ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc teg gac cct ctg age atg gtg ggt ggt tcc cag ggc e.ga 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin Gly Arg 165 170 175 age ccc age tac get tcc taa 549 Ser Pro Ser Tyr Ala Ser 180 20 25 &amp; lt; 210 &amp; gt; 37 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 30 35 &amp; lt; 400 &amp; gt; 37 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 40

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 45

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01521.tif" id="idf0098" />

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01522.tif" id="idf0099" />

A -151- -151- 1 33716Β1 35 40 45

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Le.u Lys Pro Gly Val lie 50 55 60 5

Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 10

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 15

Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 20

His Gly Leu Pro Leu His Leu Pro Gly Asn L.ys Ser Pro His Arg Asp 115 120 125

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 lG 25

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin Gly Arg 165 170 175

Ser Pro Ser Tyr Ala Ser 180 &amp; lt; 210 &amp; gt; 38 40 &amp; lt; 211 &amp; gt; 546 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 45 &amp; lt; 223 &amp; gt; FGF21RGE

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01531.tif" id="idf0100" />

-152-MA! 33716Β1 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (546) &amp; lt; 400 &amp; gt; 38 cat cca att cca gat tct tct cca tta tta caa ttc ggg ggc caa gtc 48 His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val 15 10 15 egg cag cgt tac etc tac aca gat gat gcc cag cag aca gaa gcc cac 96 Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His 20 25 30 ctg gag ate agg gag gac ggg aeg gtg ggg ggt get get gac cag age 144 Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser 35 40 45 ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg ggt gtt att caa 192 Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin 50 55 60 ate ttg ggt gtc aag aca tcc agg ttc ctg tgc cag egg cca gat ggg 240 lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly 65 70 75 80 gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc cgt 288 Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95 gag cgt ett ett gag gac ggt tac aat gtt tac cag tcc gaa gcc cac 336 Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His 100 105 110 ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac cgt gac cct 384 Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115 120 125 gca ccc ega gga cca get ege ttc ctg cca eta cca ggc ctg ccc C.CC 432 Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro 130 135 140 gca ccc ccg gag cca ccc gga ate ctg gcc CCC cag ccc ccc gat gtg 480 Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val 145 150 155 160 ggc tcc teg gac cct ctg age atg gtg ggt ggt tcc cag ggc ega age 528 Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin Gly Arg Ser 165 170 17 510 152 025 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01541.tif" id="idf0101" />

546 -153-33716Β1 ccc age tac gaa tee taa Pro Scr Tyr Glu Ser 180 &amp; lt; 210 &amp; gt; 39 &amp; lt; 211 &amp; gt; 181 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; lt synthetic structure; 223 &amp; gt; 10 &amp; lt; 400 &amp; gt; 39 His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val 15 10 15 15

Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His 20 25 30 20

Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser 35 40 45 25

Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin 50 55 60 30 lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly 65 70 75 80 35

Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95

Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His 100 105 110 40

Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115 120 125 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01551.tif" id="idf0102" />

-154- 5 ΜΑ 33716Β1

Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro 130 135 140

Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val 145 150 155 160 10

Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin Gly Arg Ser 165 170 175

Pro Ser Tyr Glu Ser 180 15 &amp; lt; 210 &amp; gt; 40 &amp; lt; 211 &amp; gt; 1272 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; WT21-L15-FC 25 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1272) 30 &amp; lt; 400 &amp; gt; 40 atgcatccaattccagattcttctccattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 35 gtc egg cag egg tac etc tac aca gat gat gc.c cag cag aca gaa gee 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 40 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg gga gc aag aca tcc agg ttc ctg tgc cag egg cca gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01561.tif" id="idf0103" />

5 -155-ΜΑ 33716Β1 65 70 75 80 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac cgg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 10 cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc ctg cca 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gea ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 age ccc age tac get tcc ggt gga ggt ggt ggt tet ggt ggt ggt age 576 Ser Pro Ser Tyr Ala ser Gly Gly Gly Gly Gly ser Gly Gly Gly ser 180 185 190 ggt ggt ggt gga tcc gac aaa act cac aca tgc cca ccg tgc cca gca 624 Gly Gly Gly Gly ser Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 195 200 205 cct gaa etc ctg ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc 672 Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 210 215 220 aag gac acc etc atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg 720 Lys Asp Thr Leu Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val 225 230 235 240 gtg gac gtg age cac gaa gac cct gag gtc aag ttc aac tgg tac gtg 768 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 245 250 255 gac ggc gtg gag gtg cat aat gcc aag aca aag ccg cgt gag gag cag 816 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin 260 265 270 15 20 25 30 35 4045

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01571.tif" id="idf0104" />

-156- 33716Β1 tac aac age aeg tac cgt gtg gtc age gtc etc acc gtc ctg cac cag 864 Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin 275 280 285 gac tgg ctg aat ggc aag gag tac aag tgc aag gtc tee aac aaa gee 912 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 290 295 300 etc cca gee ccc ate ​​gag aaa acc ate ​​tee aaa gee aaa ggg cag ccc 960 Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro 305 310 315 320 ega gaa cca cag gtg tac acc ctg ccc cca tee egg gat gag ctg acc 1008 Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 325 330 335 aag aac cag gtc age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age 1056 Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 340 345 350 gac ate ​​gee gtg gag tgg gag age aat ggg cag ccg gag aac aac tac 1104 Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr 355 360 365 aag acc aeg cct ccc gtg ctg gac tee gac ggc tee ttc ttc etc tat 1152 Lys' 1'hr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 370 375 380 age aag etc acc gtg gac aag age agg tgg cag cag ggg aac gtc ttc 1200 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe 385 390 395 400 tea tgc tee gtg atg cat gag get ctg cac aac cac tac aeg cag aag 1248

Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys 405 410 415 age etc tee ctg tet ccg ggt aaa 1272

Ser Leu Ser Leu Ser Pro Gly Lys 420

&amp; Lt; 20 41 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; -157- T I &amp; quot; 4 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 41

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175

-158-MA 33716Β1

Ser Pro Ser Tyr Ala Ser Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser 180 185 190

Gly Gly Gly Gly Ser Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 195 200 205

Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 210 215 220 10

Lys Asp Thr Leu Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val 225 230 235 240 15

Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 245 250 255

Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin 260 265 270 20

Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin 275 280 285 25

Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 290 295 300 30

Leu Pro Ala Pro lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro 305 310 315 320 35

Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 325 330 335

Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 340 345 350 40

Asp lie Ala Val Glu Tj ^ Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr 355 360 365 45

Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01601.tif" id="idf0105" />

A -159- 33716Β1 370 375 38Ü

Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe 385 390 395 400

Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys 405 410 415

Ser Leu Ser Leu Ser Pro Gly Lys 420

&amp; Lt; 210 &amp; gt; 42 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA Industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FCL15RG &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 42 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 gggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn T ^ Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age acg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 -160- 707 580 51 015 20 25 30 35 40 451 h - tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu asn 85 90 95 ggc aag gag tac aag tgc aag gtc tec aac aaa gee etc cca gee ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe ser Cys ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys ser Leu ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 5 -161-ΜΑ 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc. ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag cgt ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga ggt tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 43 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT Sanna Aa &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01631.tif" id="idf0106" />

&amp; Lt; 220 &amp; gt; 5 -162- ΜΑ 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 43

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 10

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 15

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 20

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 25

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 30 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 35

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 40

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 45 -163- 5 -

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys SerVal 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 30

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 45 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01651.tif" id="idf0107" />

-164-MA 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 210 &amp; gt; 44 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; Fc- (G4S) 3-RG &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 44 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01661.tif" id="idf0108" />

-165- -165-ΜΑ 33716Β1 tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thi Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tec cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tec gac ggc tec ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tec ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt ggt ggt ggt tec ggt ggc ggc ggc tet ggt ggt 720 ser Pro Gly Lys Gly Gly Gly Gly ser Gly Gly Gly Gly ser Gly Gly 225 230 235 240 ggt ggc age cat ccg ate ccg gac tet tet ccg ctg ctg cag ttc ggt 768 Gly Gly ser His Pro lie Pro Asp ser ser Pro Leu Leu Gin Phe Gly 245 250 255 ggt cag gtt cgt cag cgt tac ctg tac acc gac gac geg cag cag acc 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 -166 &amp; quot; ΜΑ 33716Β1 gag gcg cac ctg gag atc cgt gaa gac ggt acc gtt ggt ggt gcg gcc 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag tct ccg gaa tct ctg ctg cag ctg aaa gcc. ctg aaa ccg ggt 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt atc cag atc ctg ggc gtt aaa acc tct cgt ttc ctg tgc cag cgt 960 Val Ile Gin Ile Leu Gly Val Lys Thr ser Arg Phe Leu Cys Gin Arg 305 310 315 320 ccg gac ggc gcc ctg tac ggt tct ctg cac ttc gac ccg gag gcg tgc 1008 Pro Asp Gly Ala Leu Tyr Gly ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 tct ttt cgt gaa cgt ctg etc gaa gac ggt tac aac gtt tac cag tct 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gag gcg cac ggt ctg ccg ctg cac ctg ccg ggt aac aaa tct ccg cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgt gac ccg gcg cca cgt ggt cct gcg cgt ttc ctg cca ctg ccg ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccg cct gcg cct cct gaa ccg cct ggt atc ctg get ccg cag ccg 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 cca gac gtt ggt tct tct gac ccg ctg tct atg gtt ggt ggc tct cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 ggt cgt tct ccg tct tac gcc tct taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 45 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01681.tif" id="idf0109" />

&amp; Lt; 220 &amp; gt; 33716Β1 7 H1- Ptih synthetic &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 45

Met Asp Lys Thr Ilis Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -168- -

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His!, Eu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 30 I Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01701.tif" id="idf0110" />

-169-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01711.tif" id="idf0111" />

33716Β1 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 210 &amp; gt; 46 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA Industrial &amp; lt; 213 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; Fc- (G4S) 3-RGE &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 46 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

Di 5 -170- 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01721.tif" id="idf0112" />

11Λ &amp; lt;? &amp; Lt; 2 1 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tec aac aaa gee etc cca gee ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gee aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt ggt ggt ggt tet ggt ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt ggt tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag cgt tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

5 -171-MA 33716Β1 gaa gcc cac ctg gag ate agg gag gac ggg acg gtg ggg ggt get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age cc.c gaa agt etc ctg cag ctg aaa gcc ttg aag ccg ggt 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg ggt gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgt gag cgt ctt ctt gag gac ggt tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgt gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg ggt ggt tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 ggc ega age ccc age tac gaa tcc taa 1275 Gly Arg Ser Pro Ser Tyr Glu Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 47 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT Sanna Aa &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01731.tif" id="idf0113" />

-172- 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 47

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp TyrVal Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -173- -173-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01751.tif" id="idf0114" />

33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 5 174- 1 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Glu Ser 420 15 &amp; lt; 210 &amp; gt; 48 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20 &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-WT21 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 48 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01761.tif" id="idf0115" />

5 175-MA: 33716Β1 taccgtgtggtcagcgtccCaccgtcctgcaccaggactggctgat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtgtacaccctgcccccatcccgtgatgagctgaccaagaaccaggtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc at ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gagtgggagagcaatgggcagccggagaacaactacaagaccacgcct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 354 045

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01771.tif" id="idf0116" />

MA 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac. 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 10 15 20 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 25 30 35 40 &amp; lt; 210 &amp; gt; 49 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; A 45 did not

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01781.tif" id="idf0117" />

&amp; Lt; 220 &amp; gt;

V ΜΑ 33716Β1 -166- synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 49

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp TyrVal Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Leu T ser hr Cys Leu Val Lys Gly Phe Tyr Asp Pro Ser lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -178- ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly -179- 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 50 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-G170E &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 50 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga c.cg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg 1'hr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 5 -180-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01821.tif" id="idf0118" />

33716Β1 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tec aac aaa gee etc cca gee ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 3 84 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn 1'yr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc, tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01822.tif" id="idf0119" />

-181- MK 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gaa cct tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Pro Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 51 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01831.tif" id="idf0120" />

&amp; Lt; 220 &amp; gt; 5 -182- ΜΑ 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 51

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 10

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 15

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 20

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 30

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 35

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 40

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 45

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01841.tif" id="idf0121" />

-183- 1 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 10

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 25

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 30

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 45

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01851.tif" id="idf0122" />

380 -184- MA 33716Β1

MS

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Pro Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15

&amp; Lt; 210 &amp; gt; 52 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-P171A 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 52 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr cs 1¾ IS 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01861.tif" id="idf0123" />

5 -185-! 33716Β1 tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega gaa cca cag 3 84 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tec cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tec gac ggc tec ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tec ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tee cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag c.ag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01871.tif" id="idf0124" />

5 -186-ΜΑ 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc c .tg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc c.cg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga get tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Ala Ser Gin 405 410 415 ggc ega age c.cc age tac get tcc taa 1275 Gly Arg ser Pro ser Tyr Ala ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 53 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 45 -187- -187-ΜΑ 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 53

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro SerVal Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -188- -188- 1 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 30

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01901.tif" id="idf0125" />

-189- 1 33716Β1 37. 375 38.

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Ala Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 210 &amp; gt; 54 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-S172L &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 54 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn TrpTyrVal Asp Gly Val Glu 50 55 60 gtg cat aatgee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01911.tif" id="idf0126" />

5 -190-ΜΑ 33716Β1 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac atc gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cc.a att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc cgg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01921.tif" id="idf0127" />

5 -191-MA 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala Hls Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gttattcaaatcttgggagtcaagacatccaggttcctgtgccagcgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac. 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac. cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga cct ctg cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Leu Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 55 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45 51 &amp; lt; 220 &amp; gt; -192- 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 55

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser 7al Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro GluVal Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -193- 5 ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 30

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 45 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01951.tif" id="idf0128" />

5 -194-MA 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Leu Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15

&amp; Lt; 210 &amp; gt; 56 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; Fc-L! 5-RGE 20 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 56 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01961.tif" id="idf0129" />

5 195-MA 33716Β1 tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gee ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tec cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tec gac ggc tec ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tec ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt ggt ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt ggt tec cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag cgt tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01971.tif" id="idf0130" />

5 -196-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01981.tif" id="idf0131" />

33716Β1 gaa gcc cac ctg gag ate agg gag gac ggg aeg gtg ggg ggt gel get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg ggt 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg ggt gtc aag aca tee agg ttc ctg tgc cag egg 960 Val Ile Gin Ile Leu Gly Val Lys' 1 'hr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgt gag cgt ett ett gag gac ggt tac aat gtt tac cag tee 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgt gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tee teg gac cct ctg age atg gtg ggt ggt tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 ggc ega age ccc age tac gaa tee taa 1275 Gly Arg Ser Pro Ser Tyr Glu Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 57 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D01982.tif" id="idf0132" />

&amp; Lt; 220 &amp; gt; -197- 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 57

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn TrpTyrVal Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr lys Thr Thr Pro 165 170 175 -198- -198-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02001.tif" id="idf0133" />

33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 30

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02002.tif" id="idf0134" />

-199--1 5 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Glu Ser 420 15 &amp; lt; 210 &amp; gt; 58 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-G170E Ρ171Α S172L &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 58 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 gggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gee aag aca aag ccg cgt gag gag cag tac aac age acg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02011.tif" id="idf0135" />

5 -200- MK 33716Β1 tac cgt gtg Ouaj age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtgtacaccctgcccccatcccgtgatgagctgaccaagaaccaggtc 432 Val Tyr Thr Leu Pro Pro ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac. aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tec gac ggc tec ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tec ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tec cat cca att cca gat tet tet cca tta tta c.aa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 -201- 45 10 15 20 25 303 540 45

1 of 6 humiliation I gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tee agg ttc ctg tgc cag egg 960 Val Ile Gin Ile Leu Gly Val Lys Thr ser Arg Phe Leu Cys Gin Arg 305 310 320 315 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tee 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tee teg gac cct ctg age atg gtg gaa get ctg cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Ala Leu Gin 405 410 415 1275 ggc ega age ccc age tac get tee taa Gly Arg Ser Pro Ser Tyr Ala Ser 420 &amp; lt; 210 &amp; gt ; 59 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; -202- 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 59

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -203- ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 10

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 30

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly O {45 -204- 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Ala Leu Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15

&amp; Lt; 210 &amp; gt; 60 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-G151A 20 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 60 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro c.ys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aatgee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02061.tif" id="idf0136" />

-205-ΜΑ 33716Β1 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega gaa cca cag 3 84 Ile Glu Lys Thr Ile ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tec cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tec gac ggc tec ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tec ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tec cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 1 5 20 25 30 35 40

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02071.tif" id="idf0137" />

45 -206-

1,1 £ Antiquities 0 I gaa gcc cac ctg gag ale agg gag gat ggg aeg gtg ggg ggc gel gel 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala

IIS 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tee agg ttc ctg tgc cag egg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly ser Leu His Phe Asp Pro Glu Ala Cys 325 10 330 335 15 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tee 1056 ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gca. ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gca ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Ala lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tee teg gac cct ctg age atg gtg gga cct tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro ser Gin 405 410 415 20 25 30 35 ggc ega age ccc age tac get tee taa Gly Arg ser Pro ser Tyr Ala ser 420 1275 40 &amp; lt; 210 &amp; gt; 61 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02081.tif" id="idf0138" />

&amp; Lt; 220 &amp; gt; -207- -207-ΜΑ '33716Β1 structure of synthetic &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 61

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn TrpTyrVal Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu, Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 5 -208- ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 10

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 30

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02101.tif" id="idf0139" />

-209- 5ΜΑ 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Ala lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 210 &amp; gt; 62 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20 &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-G170E Ρ171Α &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 62 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn TrpTyrVal Asp Gly Val Glu 50 55 60 gtg cat aatgcc aag aca aag ccg cgt gag gag cag tac aac age acg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02111.tif" id="idf0140" />

5 -210- - tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 agc ctg acc tgc ctg gtc aaa ggc ttc tat ccc agc gac atc gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160 gag tgg gag agc aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc. etc tac agc aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag agc etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt agc ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc cgg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02121.tif" id="idf0141" />

-211- 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tee agg ttc ctg tgc cag egg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tee 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tee teg gac cct ctg age atg gtg gaa get tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Ala Ser Gin 405 410 415 ggc ega age ccc age tac get tee taa 1275

Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 63 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; -212- 5 -212- 5 i 33716Β1 created by the structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 63

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 10

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 15

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 20

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 25

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 30 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 35

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 40

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02141.tif" id="idf0142" />

5 -213- ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 30

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02151.tif" id="idf0143" />

-214-ΜΑ 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Ala Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 &amp; lt; 210 &amp; gt; 64 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-P150A G151A I152V &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 64 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gee aag aca aag ccg cgt gag gag cag tac aac age acg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02161.tif" id="idf0144" />

-215-ΜΑ 33716Β1 tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg clg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc egagaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 agc ctg acc tgc ctg gtc aaa ggc ttetat ccc agc gac atc gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160 gag tgg gag agc aat ggg cag ccg gag aac aac tac aag acc acgcct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac agc aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag agc etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt agc ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02171.tif" id="idf0145" />

-216- 5

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02181.tif" id="idf0146" />

33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gig ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tee agg ttc ctg tgc cag egg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gee ctg tat gga teg etc cac ttt gac cct gag gee tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tee 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gee cac ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 10 15 20 egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca gee gca gtt ctg gee ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Ala Ala Val Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tee teg gac cct ctg age atg gtg gga cct tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin 405 410 415 ggc ega age c.cc age tac get tee taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 25 30 35 40 &amp; lt; 210 &amp; gt; 65 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02182.tif" id="idf0147" />

&amp; Lt; 220 &amp; gt; -217- 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 65

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

-218- I 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 5 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 10

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 25

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 30

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 45

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02201.tif" id="idf0148" />

380 -219-61Λ &amp; lt; 2 &amp; gt; 2! E. YIQ 2Π5

Leu Pro Pro Ala Pro Pro Glu Pro Ala Ala Val Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 20

&amp; Lt; 210 &amp; gt; 66 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-G170ES172L 25 30 35 40 45 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 66 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aatgee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02211.tif" id="idf0149" />

5 - 220-ΜΑ 33716Β1 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tec aac aaa gcc etc cca gee ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa ace ate tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 I gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 agcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 160 155 150 145 e j gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576! Pro Val Leu Asp'ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 a ggc caa gtc egg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02221.tif" id="idf0150" />

5 -221-MA 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thi Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Gys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gaa cct ctg cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Pro Leu Gin 405 410 415 10 15 20 25 30 35 ggc ega age ccc age tac get tcc taa Gly Arg Ser Pro Ser Tyr Ala Ser 420 1275 40 &amp; lt; 210 &amp; gt; 67 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02231.tif" id="idf0151" />

&amp; Lt; 220 &amp; gt; -222- 1 33716Β1 Taklegueh structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 67 Met Asp Lys Thr His Thi Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 5 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 10

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 15

His Glu Asp Pro Glu Val Lys Phe Asn TrpTyr Val Asp Gly Val Glu 50 55 60 20

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 25

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 35

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 40

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02241.tif" id="idf0152" />

&amp; Quot; 223- &amp; quot; 223- i 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 30

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02251.tif" id="idf0153" />

-224- 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Pro Leu Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 68 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-G170A &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 68 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn TrpTyrVal Asp Gly Val Glu 50 55 60 gtg cat aatgee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 -225 -μα: 33716Β1 tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val SerVal Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tee aaa gee aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 10 gtg tac acc ctg ccc cca tee cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggette tat ccc age gac ate ​​gee gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 15 20 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc acgcct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tee gac ggc tee ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 25 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tee gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly asn Val Phe Ser Cys Ser Val 195 200 205 30 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tee ctg 672 Met His Glu Ala Leu His asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 35 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 40 ggt gga tee cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gee cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02271.tif" id="idf0154" />

-226- Gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt c.tc ctg cag ctg aaa gcc Ttg aag ccg Gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 10 Gtt att Caa ate Ttg g ga gtc aag aca tec agg ttc ctg Tgc cag egg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 15 cc.a gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu ala Cys 325 330 335 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 20 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gca ccc e.ga gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg get cct tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Ala Pro Ser Gin 405 410 415 25 30 35 1275 ggc ega age ccc age tac get tcc taa Gly Arg Ser Pro Ser Tyr Ala Ser 420 40 &amp; lt; 210 &amp; gt; 69 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02281.tif" id="idf0155" />

&amp; Lt; 220 &amp; gt; -227- -227-ΜΑ 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 69

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Tip Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -228- 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

-229- I 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Ala Pro Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 210 &amp; gt; 70 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 3 a 2 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-G170C &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 70 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02311.tif" id="idf0156" />

5 -230-ΜΑ 33716Β1 tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tec cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu 1'hr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tc.c gac ggc tec ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tec ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tec cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 4045

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02321.tif" id="idf0157" />

5 -231-MA 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala Hls Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Glu Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg tgc cct tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Cys Pro Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 71 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02331.tif" id="idf0158" />

\ &amp; Lt; 220 &amp; gt; - 232 - - 232 -ΜΑ 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 71

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp TyrVal Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr I-, ys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 5 -233 - ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 10

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 30

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02351.tif" id="idf0159" />

-234-ΜΑ 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Cys Pro Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15

&amp; Lt; 210 &amp; gt; 72 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-G170D 20 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 72 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtgcataatgccaagacaaagccgcgtgaggagcagtacaacagcacg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02361.tif" id="idf0160" />

5 -235ΜΑ 33716Β1 tac cgi gig gtc age gtc etc acc gtc ctg cac cag gac igg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggcaaggagtacaagtgcaaggtctccaacaaagccctcccagccccc 336 Gly Lys Glu Tyr Lys Cys Lys Val ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa ace ate tec aaa gee aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtgtacaccctgcccccatcccgtgatgagctgaccaagaaccaggtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg ace tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gee gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gagtgggagagcaatgggcagccggagaacaactacaagaccacgcct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly ser Phe Phe Leu Tyr ser Lys Leu Thr 180 185 190 gtg gac aag age cgttgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys ser Arg Trp Gin Gin Gly Asn Val Phe ser Cys ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 ser Pro Gly Lys Gly Gly Gly Gly Gly ser Gly Gly Gly ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly ser His Pro lie Pro Asp ser ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02371.tif" id="idf0161" />

- 236 - 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly T Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gac cct tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Asp Pro Ser Gin 405 410 415 1275 ggc ega age ccc age tac get tcc taa Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 73 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; -237- -237-ΜΑ 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 73

Met Asp Lys Lhr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 1 to Ah¾ IS I

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 5 - 238 - ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Ihr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 10

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 30

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 45 365 3 hee

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02401.tif" id="idf0162" />

-239- -239-ΜΑ 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Asp Pro Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 74 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-G170N &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 74 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tee cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 6Q 65 5 -240- tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tec cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc acgcct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tec gac ggc tec ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tec ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tec cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly ser His Pro lie Pro Asp ser ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02421.tif" id="idf0163" />

-241- 10 15 20 25 30 35 40 45

61λ &amp; lt;? &amp; Lt; 2 I gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tee agg ttc ctg tgc cag egg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gee ctg tat gga teg etc cac ttt gac cct gag gee tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tee 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gee cac ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tee teg gac cct ctg age atg gtg aac cct tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Asn Pro Ser Gin 405 410 415 1275 ggc ega age ccc age tac get tee taa Gly Arg Ser Pro Ser Tyr Ala ser 420 &amp; lt; 210 &amp; gt; 75 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; -242- 33716Β1 Taklegueh structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 75

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn TrpTyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -243 - ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 10

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 30

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Plie Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly /

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02451.tif" id="idf0164" />

i 45 -244-ΜΑ 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Asn Pro Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 210 &amp; gt; 76 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-G170S

&amp; Lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 76 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 gggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn T ^ Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aatgee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 16 75 I 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02461.tif" id="idf0165" />

5 -245-ΜΑ 33716Β1 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac ag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tee aaa gee aaa ggg cag ccc ega gaa cca cag 3 84 Ile Glu Lys Thr ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tee cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gee gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tee gac ggc tee ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg c.ag cag ggg aac gtc ttc tea tgc tee gtg 624 Val Asp Lys Ser Arg Tip Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tee ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tee cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gee cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02471.tif" id="idf0166" />

A -246- 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr 7al Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gttattcaaatcttgggagtcaagacatccaggttcctgtgccagcgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tee 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tee teg gac cct ctg age atg gtg tee cct tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Ser Pro Ser Gin 405 410 415 ggc ega age ccc age tac get tee taa 1275

Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 77 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; -247- 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 77

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Mai Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 5 -248 - ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 25

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 30

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02501.tif" id="idf0167" />

45 -249-33716Β1

MA 385 375 70 Y

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Ser Pro Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 210 &amp; gt; 78 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-P171E 25 30 35 40 45

&amp; Lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 78 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr Ilis Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aatgee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 3 IS

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02511.tif" id="idf0168" />

5 - 250 - MA 33716Β1 tac cgt gtg gte age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggcaaggagtacaagtgcaaggtctccaacaaagccctcccagccccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggette tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac. aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tc.c gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly ser Phe Phe Leu Tyr ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys ser Arg Trp Gin Gin Gly Asn Val Phe ser Cys ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 g. gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02521.tif" id="idf0169" />

5 -251- 1 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gt att caa ate ttg gga gtc aag aca tec agg ttc ctg tgc cag egg 960 Val lie Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 10 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 15 20 egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc cc.c gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc. 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga gaa tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Glu Ser Gin 405 410 415 25 30 35 1275 ggc ega age ccc age tec get tcc taa Gly Arg Ser Pro Ser Tyr Ala Ser 420 40 45 &amp; lt; 210 &amp; gt; 79 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; ;

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02531.tif" id="idf0170" />

&amp; Lt; 220 &amp; gt; 5 - 252- ΜΑ 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 79

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 10

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 15

His Glu Asp Pro Glu Val Lys Phe Asn TrpTyrVal Asp Gly Val Glu 50 55 60 20

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 5

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 40

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 45

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02541.tif" id="idf0171" />

- 253 - - 253 - 1 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 30

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 51 -254- 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Glu Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 80 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-P171H &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 80 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age acg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 -255- 33716Β1 tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tec cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tec gac ggc tec ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tec ctg 672 Met His Glu Ala Leu His asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tec cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 5 - 256-ΜΑ 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gttattcaaatcttgggagtcaagacatccaggttcctgtgccagcgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga cac tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly His Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 81 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02581.tif" id="idf0172" />

-257-ΜΑ 33716Β1 Taklegueh structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 81 Met Asp Lys Thr His ThrCys Pro Pro Cys Pro Ala Pro Glu Leu Leu 5 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 10

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 15

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 20

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 55 1¾ 15 ¾.

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 25

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 30 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 35

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 40

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02591.tif" id="idf0173" />

1 - 258 - 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly -259-ΜΑ 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly His Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 20

&amp; Lt; 210 &amp; gt; 82 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-P171Q 25 30 35 40 45 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 82 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 gggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 7580

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02611.tif" id="idf0174" />

R. 5 -260-ΜΑ 33716Β1 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg clg aa4 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa ace ate tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 3 84 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 ser Pro Gly Lys Gly Gly Gly Gly Gly ser Gly Gly Gly ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly ser His Pro lie Pro Asp ser ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02621.tif" id="idf0175" />

5 -261-ΜΑ 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age c.cc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga cag tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gin Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 83 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02631.tif" id="idf0176" />

&amp; Lt; 220 &amp; gt; -262- -262-ΜΑ 33716Β1 Taklegueh structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 83

Met Asp Lys Thr His Thi Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 5 1 -263 -

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr260 265 270 20

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala275 280 285 25

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly290 295 300 30

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser340 345 350 40

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His355 360 365 45

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02651.tif" id="idf0177" />

-264-ΜΑ 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gin Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15

&amp; Lt; 210 &amp; gt; 84 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-P171T 20 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 84 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 66 15 ¾6 25 30 35 40 45 a 5 -265 -ΜΑ 33716Β1 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val ser Val Leu Th Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Th Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac atc gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc acgcct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Th Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tee cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Th 260 265 270 10 15 20 25 30 35 40 then

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02671.tif" id="idf0178" />

45 -266- 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tec agg ttc ctg tgc cag egg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc c.tc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga act tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Thr Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275

Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 85 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; -267- 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 85

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -268 - 5

611 &amp; lt;? &amp; Lt; 2 I

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 30

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02701.tif" id="idf0179" />

-269-ΜΑ 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Thr Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 20 86 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-P171Y &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 86 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aatgee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02711.tif" id="idf0180" />

-270- 1 33716Β1 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gat Igg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tec aac aaa gee etc cca gee ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gee aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02721.tif" id="idf0181" />

-271- 10 15 20 25 30 35 40 45 AAA

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02731.tif" id="idf0182" />

ΜΑ 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gttattcaaatcttgggagtcaagacatccaggttcctgtgccagcgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga tac tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Tyr Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 &amp; lt; 210 &amp; gt; 87 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; -272- -272-ΜΑ 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 87

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn TrpTyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 - 273 - - 273 -ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly -274-33716Β1; 'ΜΑ 380 375 370

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Tyr Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 210 &amp; gt; 88 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-P171G 25 30 35 40 45 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 88 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age acg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02761.tif" id="idf0183" />

5

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02771.tif" id="idf0184" />

33716Β1 -ΊΊ5- tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tec aac aaa gee etc cca gee ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa ace ate tec aaa gee aaa ggg cag ccc Ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac ag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys ser Arg Trp Gin Gin Gly Asn Val Phe ser Cys ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc. ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02772.tif" id="idf0185" />

ΜΑ 33716Β1 -'ll gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get gel 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 10 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 15 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 20 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 25 30 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga ggt tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 35 ggc ega age ccc age tac get tcc taa Gly Arg Ser Pro ser Tyr Ala ser 420 1275 40 &amp; lt; 210 &amp; gt; 89 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02781.tif" id="idf0186" />

&amp; Lt; 220 &amp; gt; -211 -

-211 - MK 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 89

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -278- -278-ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 5 -279- 5 -279- 1 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 210 &amp; gt; 90 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 20 &amp; lt; 220 &amp; gt;

&amp; Lt; 223 &amp; gt; FC-L15-P171S 25 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 90 30 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu gggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn TrpTyrVal Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02811.tif" id="idf0187" />

-280- 33716Β1 tac cgt gtg gtc agc gtc. etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 cc.c gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 5 -281-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02831.tif" id="idf0188" />

33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gaccagagccccgaaagtctcctgcagctgaaagccttgaagccggga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tec agg ttc ctg tgc cag egg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga tet tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Ser Ser Gin 405 410 415 ggc ega age c.cc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 91 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 45 0 \ 282- ΜΑ 33716Β1 &amp; quot; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 91

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 10

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 15

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 20

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 25

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 30 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 35

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 40

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 45

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 -283 -ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser ArgTrp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 5 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 10

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 25

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 30

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 45

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

O MA 33716 E. Β1 j -284- 380 375 370 AAA Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly Ile Leu Ala Pro Gin Pro 385 390 395 400 5

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Ser Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 92 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt;

&amp; Lt; 223 &amp; gt; FC-L15-P171W &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 92 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aatgee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02861.tif" id="idf0189" />

5ΜΑ 33716Β1-285 - tac cgt gtg glc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu Hls Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega gaa cca cag 3 84 Ile Glu Lys Thr Ile ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtgtacaccctgcccccatcccgtgatgagctgaccaagaaccaggtc 432 Val Tyr Thr Leu Pro Pro ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 10 15 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 20 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 25 ccc gtg ctg gac tec gac ggc tec ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 30 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 35 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tec ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 40 let ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tec cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 45 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02871.tif" id="idf0190" />

- 286- MA 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get 864 Glu Ala Ilis Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gttattcaaatcttgggagtcaagacatccaggttcctgtgccagcgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga tgg tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Trp Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 93 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02881.tif" id="idf0191" />

&amp; Lt; 220 &amp; gt; 5 ΜΑ 33716Β1! -287- Synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 93

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 10

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 15

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 20

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 25

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 30

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 35

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 40

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 45

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02891.tif" id="idf0192" />

-288- MA 33716 E. Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 30

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly -289- 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Trp Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 94 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-P171C &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 94 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 5 -290-

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02921.tif" id="idf0193" />

33716Β1 tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggcaaggagtacaagtgcaaggtctccaacaaagccctcccagccccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tee aaa gee aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tee cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggette tat ccc age gac ate ​​gee gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tee gac ggc tee ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tee gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tee ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tc.t ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tee cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gee cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 0 152 025 a 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02922.tif" id="idf0194" />

5 -291-33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tee agg ttc ctg tgc cag egg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc egg gag ctg ett ett gag gac gga tac aat gtt tac cag tee 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 2 &amp; gt; 55 1 i egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tc.c teg gac cct ctg age atg gtg gga tgc tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Cys Ser Gin 405 410 415 ggc ega age ccc age tac get tee taa 1275 Gly Arg Ser Pro Ser tyr Ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 95 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02931.tif" id="idf0195" />

5 -292- 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 95

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 10

MA

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 15

His Glu Asp Pro Glu Val Lys Phe Asn Trp TyrVal Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 20

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 25

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 30 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 35

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 40

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 45

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02941.tif" id="idf0196" />

- 293 - -'6Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 10

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 15

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 20

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 25

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 30

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 35

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 40

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 45

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly //

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02951.tif" id="idf0197" />

-294- 33716Β1 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Cys Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420

&amp; Lt; 210 &amp; gt; 96 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-A45KG170E &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 96 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec. cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn ser Thr 65 70 75 80

5 -295 -MA 33716Β1 tac cgt gtg gtc agc gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Th Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega gaa cca cag 384 Ile Glu Lys Th Ile ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tec cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc acgcct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tec gac ggc tec ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tec ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tec cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02971.tif" id="idf0198" />

5 296-ΜΑ 33716Β1 gaa gcc cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get aaa 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Lys 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gaa cct tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Pro Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 10 15 20 25 30 35 40 &amp; lt; 210 &amp; gt; 97 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02981.tif" id="idf0199" />

&amp; Lt; 220 &amp; gt; -297-ΜΑ 33716Β1 structure J &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 97 Met Asp Lys Thr His ThrCys Pro Pro Cys Pro Ala Pro Glu Leu Leu 5 15 10 15 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 10

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 15

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 20

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 25

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 30 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 35

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 40

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D02991.tif" id="idf0200" />

-298- -298-ΜΑ 33716Β1

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Lys 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 5 380 -299- 1 33716Β1 370 375

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Pro Ser Gin 405 410 415 10

Gly Arg Ser Pro Ser Tyr Ala Ser 420 15 &amp; lt; 210 &amp; gt; 98 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 Α45Κ 20 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 98 atgcatccaattccagattcttctccattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gee cag cag aca gaa gee 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get aaa gac cag 144 His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Lys Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caaatcttgggagtcaagacatccaggttcctgtgccagcggccagat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03011.tif" id="idf0201" />

-300-

-300- MA 33716Β1 ggg gtt ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 10 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac cgg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gea ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 age ccc age tac get tcc taa 549 Ser Pro Ser Tyr Ala Ser 180 15 20 25 30

&amp; Lt; 210 &amp; gt; 99 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 35 &amp; lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 9940

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 45

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03021.tif" id="idf0202" />

5 -301-ΜΑ 33716Β1

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Lys Asp Gin 35 40 45

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 50 55 60

Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 10

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 15

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 20

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 25

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 30

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 35

Ser Pro Ser Tyr Ala Ser 180 40

&amp; Lt; 210 &amp; gt; 100 &amp; lt; 211 &amp; gt; 1260 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-FGF21 6-181 G170E 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03031.tif" id="idf0203" />

5 -302-ΜΑ 33716Β1 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1260) &amp; lt; 400 &amp; gt; 100 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asu Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03041.tif" id="idf0204" />

- 303-51015 202 530 354 045 e ΜΑ 33716Β1 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc ace 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tee tet tet cca tta tta caa ttc ggt ggt caa gtc cgg cag 768 Gly Gly Ser Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin 245 250 255 cgg tac etc tac aca gat gat gcc cag cag aca gaa gcc cac ctg gag 816 Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu 260 265 270 ate agg gag gat ggg aeg gtg ggg ggc get get gac cag age ccc gaa 864 Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu 275 280 285 agt etc ctg cag ctg aaa gee ttg aag ccg gga gtt att caa atc ​​ttg 912 Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile Gin Ile Leu 290 295 300 gga gtc aag aca tcc agg ttc ctg tgc cag cgg cca gat ggg gcc ctg 960 Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu 305 310 315 320 tat gga teg etc cac ttt gac cet gag gcc tgc age ttc cgg gag ctg 1008 Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu 325 330 335 ctt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc cac. ggc etc 1056 Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu 340 345 350 ccg ctg cac ctg cca ggg aac aag tcc cca cac cgg gac cct gea ccc 1104 Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro 355 360 365 5 -304- ΜΑ 33716Β1 cga gga cca get ege ttc ctg cca cta cca ggc ctg ccc ccc gea ccc 1152 Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro 370 375 380 ccg gag cca ccc gga ate ctg gee ccc cag ccc ccc gat gtg ggc. tee 1200 Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser 385 390 395 400 10 teg gac cct ctg age atg gtg gaa cct tee cag ggc cga age ccc age 1248 Ser Asp Pro Leu Ser Met Val Glu Pro Ser Gin Gly Arg Ser Pro Ser 405 410 415 tac get tcctaa Tyr Ala Ser 1260 15 &amp; lt; 210 &amp; gt; 101 &amp; lt; 211 &amp; gt; 419 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 20 25 &amp; lt; 400 &amp; gt; 101 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 30

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 35

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 40

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 45 -305 - 5 1 33716Β1

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 10

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 15

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 20

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 25

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 30

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 35

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 40

Gly Gly Ser Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin 245 250 255 45

Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu 260 265 270

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03071.tif" id="idf0205" />

-306- 1 33716Β1

Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu 275 280 285

Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin lie Leu 290 295 300

Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu 305 310 315 320 10

Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu 325 330 335 15

Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu 340 345 350 20

Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro 355 360 365

Arg Gly Pro Ala Arg Phe Leu Pro leu Pro Gly Leu Pro Pro Ala Pro 370 375 380 25

Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser 385 390 395 400 30

Ser Asp Pro Leu Ser Met Val Glu Pro Ser Gin Gly Arg Ser Pro Ser 405 410 415 35

Tyr Ala Ser 40

&amp; Lt; 210 &amp; gt; 102 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-A45KP171G 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03081.tif" id="idf0206" />

-307- 5ΜΑ 33716Β1 &amp; lt; 220 &amp; gt; &amp; Lt; 22 a &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 102 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 gggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met l!, e Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aatgee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gccccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trjj Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03091.tif" id="idf0207" />

5-308 - 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03101.tif" id="idf0208" />

33716Β1; ΜΑ ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age c.gt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met Hls Glu Ala Leu His asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 a Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc cgg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg l'yr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get aaa 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Lys 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 300 295 290 aAA gtt att caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg j 305 310 315 320 E. cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc 1056! Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 350 345 340 AAA gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 5 11Λ &amp; lt;? &amp; lt ;? 1 -309- E. egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tee teg gac cct ctg age atg gtg gga ggt tee cag 1248 Pro Asp Val Gly Ser ser Asp Pro Leu ser Met Val Gly Gly ser Gin 405 410 415 10 ggc ega age ccc age tac get tee taa 1275 Gly Arg ser Pro ser Tyr Ala ser 420 15 &amp; lt; 210 &amp; gt; 103 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 103 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 20 25 30

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 35

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 40

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03111.tif" id="idf0209" />

-310-ΜΑ 33716Β1

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 5 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 10

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 15

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160 20

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 25

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 30

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 35

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 40

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 45

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Lys

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03121.tif" id="idf0210" />

-311- 33716Β1 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 5

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 10

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 15

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 20

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 25

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 30

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 35

Gly Arg Ser Pro Ser Tyr Ala Ser 420 &amp; lt; 210 &amp; gt; 10,440

&amp; Lt; 211 &amp; gt; 1320 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 45 &amp; lt; 223 &amp; gt; FGF21- (G3) -Fc; 28 AA signal sequence removed during processing

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03131.tif" id="idf0211" />

-312- 5

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03141.tif" id="idf0212" />

33716Β1 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1320) &amp; lt; 400 &amp; gt; 104 atggactcggacgagaccgggttcgagcacCaggactgtgggtttC 48 Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15 gtg ctg get gg ctt ctg ctg gga gcc tgc cag gca cac ccc ate ​​cct 96 Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin ala His Pro lie Pro 20 25 30 gac tec agt cct etc ctg caa ttc ggg ggc caa gtc egg cag egg tac 144 Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 etc tac aca gat gat gee cag cag aca gaa gcc cac ctg gag ate agg 192 Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60 gag gat ggg aeg gtg ggg ggc get get gac cag age ccc gaa agt etc 240 Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80 ctg cag ctg aaa gcc ttg aag ccg gga gtt att caa ate ttg gga gtc 288 Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin lie Leu Gly Val 85 90 95 aag aca tec agg ttc ctg tgc cag egg cca gat ggg gcc ctg tat gga 336 Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 teg etc cac ttt gac cct gag gcc tgc age ttc egg gag ctg ett ett 384 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125 gag gac gga tac aat gtt tac cag tcc gaa gcc cac ggc etc ccg ctg 432 Glu Asp Gly Tyr Asn Val Tyr Gin ser Glu Ala His Gly Leu Pro Leu 130 135 140 cac ctg cca ggg aac aag tcc cca cac egg gac cct gca ccc ega gga 480 His Leu Pro Gly Asn Lys ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160 cca get ege ttc ctg cca eta cca ggc ctg cca ccc gca ccc ccg gag 528 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175 10 15 20 25 30 35 40 45

Ox 5 313 ​​&amp; quot; ΜΑ 33716Β1 cca ccc gga ate ctg gcc ccc cag ccc ccc gat gtg ggc tcc teg gac 576 Pro Pro Gly Ile Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 cet ctg age atg gtg gga cet tec cag ggc ega age ccc age tac get 624 Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205 tee ggt gga ggt gac aaa act cac aca tgc cca ccg tgc c.ca gea cet 672 Ser Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro 210 215 220 gaa etc ctg ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag 720 Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 225 230 235 240 gac acc etc atg ate tec egg acc cct gag gtc aca tgc gtg gtg gtg 768 Asp Thr Leu Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val 245 250 255 gac gtg age cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac 816 Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 260 265 270 ggc gtg gag gtg cat aat gcc aag aca aag ccg egg gag gag cag tac 864 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr 275 280 285 aac age aeg tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac 912 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp 290 295 300 tgg ctg aat ggc aag gag tac aag tgc aag gtc tec aac aaa gcc etc 960 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 305 310 315 320 cca gcc ccc ate ​​gag aaa acc ate ​​tec aaa gcc aaa ggg cag ccc ega 1008 Pro Ala Pro lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg 325 330 335 gaa cca cag gtg tac acc ctg ccc cca tec egg gat gag ctg acc aag 1056 Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys 340 345 350 aac cag gtc age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac 1104 Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 355 360 365 ate gcc gtg gag tgg gag age aat ggg cag ccg gag aac aac tac aag 1152 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03151.tif" id="idf0213" />

5 -314- 1 33716Β1

Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys 370 375 380 acc acg cct ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tat age 1200 Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu tyr Ser 385 390 395 400 aag etc ace gtg gac aag age agg tgg cag cag ggg aac gtc ttc tea 1248 Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser 405 410 415 tgc tcc gtg atg cat gag get ctg cac aac cac tac acg cag aag age 1296 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser 420 425 430 ctctccctgtctccgggtaaatga 1320 Leu Ser Leu Ser Pro Gly Lys 435 10 15 20 &amp; lt; 210 &amp; gt; 105 &amp; lt; 211 &amp; gt; 439 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 25 &amp; lt; 400 &amp; gt; 105 Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15 30

Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro lie Pro 20 25 30 35

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 40

Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60 45

Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 5 -315- ΜΑ 33716Β1 65 70 75 80

Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile Gin Ile Leu Gly Val 85 90 95

Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 10

Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125 15

Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu AlaHis Gly Leu Pro Leu 130 135 140 20

His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160 25

Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175

Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 30

Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205 35

Ser Gly Gly Gly Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro 210 215 220 40

Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 225 230 235 240 45

Asp Thr- Leu Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val 245 250 255

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 260 265 270

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03171.tif" id="idf0214" />

5 -316- 1 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr 275 280 285

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp 290 295 300 10

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 305 310 315 320

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg 325 330 335 15

Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys 340 345 350 20

Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 355 360 365 25

Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys 370 375 380 30

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 385 390 395 400 35

Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser 405 410 415 40 E Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser 430 425 420;

Leu Ser Leu Ser Pro Gly Lys 435 45

&amp; Lt; 210 &amp; gt; 106 &amp; lt; 211 &amp; gt; 1245 &amp; lt; 212 &amp; gt; DNA

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03181.tif" id="idf0215" />

-317- 5 1 33716Β1 succession industrial &amp; lt; 3 a 2 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-G5-FGF21 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1245) &amp; lt; 400 &amp; gt; 106 atggacaaactcacacatgtccaccttgtccagctccggaacCctg 48 Met Asp Lys Fhr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec egg ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg egg gag gag cag tac aac age aeg 240 Val His Asn ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc egg gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 10 15 20 25 30 35 40 45 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 O) 5 -318-33716Β1

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag ace acg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tec gac ggc tec ttc ttc etc tac age aag etc ace 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age agg tgg cag cag ggg aac gtc ttc tea tgc tec gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac acg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tctccgggtaaaggtggcggagggggtcatccaattccagattcttct 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly His Pro lie Pro Asp Ser Ser 225 230 235 240 cca tta tta caa ttc ggg ggc caa gtc egg cag egg tac etc tac aca 768 Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr 245 250 255 gat gat gcc cag cag aca gaa gcc cac ctg gag ate agg gag gat ggg 816 Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg Glu Asp Gly 260 265 270 acg gtg ggg ggc get get gac cag age ccc gaa agt etc ctg cag ctg 864 Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu 275 280 285 aaa gcc ttg aag ccg gga gtt att caa ate ttg gga gtc aag aca tcc 912 Lys Ala Leu Lys Pro Gly Val lie Gin lie Leu Gly Val Lys Thr Ser 290 295 300 agg ttc ctg tgc cag egg cca gat ggg gcc ctg tat gga teg etc cac 960 Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly Ser Leu His 305 310 315 320 ttt gac cct gag gcc tgc age ttc egg gag ctg ett ett gag gac gga 1008 Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly 325 330 335 tac aat gtt tac cag tcc gaa gcc cac ggc etc ccg ctg cac ctg cca 1056 Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu His Leu Pro 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03201.tif" id="idf0216" />

5 -319-10 15 20 25 30 35 40 ΜΑ 33716Β1 \ A'1 350 345 340 ggg aac aag tcc cca cac egg gac cet gea ccc ega gga cca get ege 1104 Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg 355. 360 365 ttc ctg cca cta cca ggc ctg ccc ccc gea ccc ccg gag cca ccc gga 1152 Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly 370 375 380 ate ctg gee ccc cag ccc ccc gat gtg ggc tec teg gac cct ctg age 1200 lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp Pro Leu Ser 385 390 395 400 atg gtg gga cct tec cag ggc ega age ccc age tac get tec taa 1245 Met Val Gly Pro ser Gin Gly Arg ser Pro ser Tyr Ala ser 405 410 &amp; lt; 210 &amp; gt; 107 &amp; lt; 211 &amp; gt; 414 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 107 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 45

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03211.tif" id="idf0217" />

- 320.

- 320- IK 33716Β1

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 10

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 15

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 20

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 25

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 30

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 35

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly His Pro lie Pro Asp Ser Ser 225 230 235 240 40

Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr 245 250 255

Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg Glu Asp Gly 260 265 270

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03221.tif" id="idf0218" />

5 -321-ΜΑ 33716Β1

Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu 275 280 285 Lys Ala Leu Lys Pro Gly Val Ile Gin Ile Leu Gly Val Lys Thr Ser 290 295 300 Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly Ser Leu His 305 310 315 320 Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly 325 330 335 Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu His Leu Pro 340 345 350 Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg 355 360 365 Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly 370 375 380 lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp Pro Leu Ser 385 390 395 400 10 15 20 25 30

Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala Ser 405 410 35

&amp; Lt; 210 &amp; gt; 108 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 L99R 40 45

&amp; Lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03231.tif" id="idf0219" />

5 -322-ΜΑ 33716Β1 &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 108 atgcatccaattccagattcttctccattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag cgg tac etc tac aca gat gat gcc cag cag aca gaa gcc 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 50 55 60 caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg cca gat 240 Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 cgg gag ctg cgt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Arg Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac cgg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly Ile Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 age ccc age tac get tcc taa 549 Ser Pro Ser Tyr Ala Ser 10 15 20 25 30 35 40 45

O -323 - 33716Β1 180

&amp; Lt; 210 &amp; gt; 109 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; Ptih Taklegueh &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 109

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95

Glu Arg Leu Arg Leu Glu Asp Gly Tyr Tyr Asn Val Gin Ser Ala Glu 100 105 110

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 5 -324- ΜΑ 33716Β1

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 10

Ser Pro Ser Tyr Ala Ser 180 &amp; lt; 210 &amp; gt; 11,015

&amp; Lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 20

&amp; Lt; 223 &amp; gt; FGF21L99D &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 110 atgcatccaattccagattcttctccattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca gaa gee 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg gga gtc aag aca tec agg ttc ctg tgc cag egg cca gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 25 30 35 40 45 5 - 325 - 1 33716Β1 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gee tgc age ttc 288 Gly Ala Leu Tyr Gly ser Leu His Phe Asp Pro Glu Ala Cys ser Phe 85 90 95 egg gag ctg gac ett gag gac gga tac aat gtt tac cag tee gaa gcc 336 Arg Glu Leu Asp Leu Glu Asp Gly Tyr Asn Val Tyr Gin ser Glu Ala 100 105 110 cac ggc etc cc.g ctg cac ctg cca ggg aac aag tee cca cac egg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 aa cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tee teg gac cct ctg age atggtg gga cct tee cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 15 20 age ccc age tac get tee taa 549 Ser Pro Ser Tyr Ala Ser 180 25 &amp; lt; 210 &amp; gt; 111 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 111 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 30 35 40

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03271.tif" id="idf0220" />

-326-ΜΑ 33716Β1

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45

Ser Pro Ghi Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 5 50 55 60

Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 10

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 15

Arg Glu Leu Asp Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 20

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 25

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 30

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 35

Ser Pro Ser Tyr Ala Ser 180 40 &amp; lt; 210 &amp; gt; 112 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 45

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21A111T

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03281.tif" id="idf0221" />

-327- 5 1 33716Β1 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 112 atg cat cca att cca gat tct tct cca tta tta caa ttc ggg ggc caa 48 Met His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca gaa gcc 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag egg cca gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 10 IS 1 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc gaa acc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Thr 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac egg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gca cc.c ega gga cca get ege ttc ctg cca eta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03291.tif" id="idf0222" />

549 - 328- 5 ΜΑ 33716Β1 age ccc age tac get tc.c taa Ser Pro Ser Tyr Ala Ser 180

&amp; Lt; 210 &amp; gt; 113 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT 10 successive industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 15 &amp; lt; 400 &amp; gt; 113

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 20

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 25

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 30

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 35

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 40

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Thr 100 105 110 45

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03301.tif" id="idf0223" />

- 329-ΜΑ 33716Β1

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 10

Ser Pro Ser Tyr Ala Ser 180 15

&amp; Lt; 210 &amp; gt; 114 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 A129D 20 25 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1)., (549) 30 &amp; lt; 400 &amp; gt; 114 atgcatccaattccagattcttctccattattacaattcgggggccaa 48 Met His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 35 gtc egg cag egg tac etc tac aca gat gat gee cag cag aca gaa gee 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 40 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 45 age ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga gtt art 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg gga gtc aag aca tec agg ttc ctg tgc cag egg cca gat 240

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03311.tif" id="idf0224" />

- 330 - 5 ΜΑ 33716Β1 - 330 - 5 Gin Ile Leu Gly 7al Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gcc ctg tat gga tcg etc cac ttt gac cet gag gcc tgc agc ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg ac aag tcc cca cac cgg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gac ccc ega gga cca get ege ttc ctg cca cta cca ggc ctg ccc 432 Pro Asp Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gea ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc tcg gac cct ctg age atg gtg gga cct tcc cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 age ccc age tac get tcc taa 549 Ser Pro Ser Tyr Ala Ser 180 10 15 20 25 30 35

&amp; Lt; 210 &amp; gt; 115 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; Created by the structure &amp; lt; 223 &amp; gt; 40 &amp; lt; 400 &amp; gt; 115

Met His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 45

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03321.tif" id="idf0225" />

5 -331 ΜΑ 33716Β1 20 25 30

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 50 55 60 10

Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 15

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 20

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 25

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125

Pro Asp Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 30

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 35

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175

Ser Pro Ser Tyr Ala Ser 40 180 &amp; lt; 210 &amp; gt; 116 &amp; lt; 211 &amp; gt; 54,945

&amp; Lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt;

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03331.tif" id="idf0226" />

-332- &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 A129Q &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 116 atg cat cca att cca gat tct tct cca tta tta caa ttc ggg ggc caa 48 Met His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gee cag cag aca gaa gcc 96 Val Arg Gin Arg 'Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag egg cc.a gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac egg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct cag ccc ega gga cca get ege ttc ctg cca eta cca ggc ctg ccc 432 Pro Gin Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03341.tif" id="idf0227" />

- 333 -ΜΑ 33716Β1 gtgggcCctcggaccctctgagcatggtgggaccttcccagggccga 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 age ccc agc tac get tcc taa 549 5 Ser Pro Ser Tyr Ala Ser 180 &amp; lt; 210 &amp; gt; 117 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT 10 successive industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 15 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 117

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 20 15 10 15

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 25

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 30

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 50 55 60 35

Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 40

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03351.tif" id="idf0228" />

-334 33716Β1

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125

Pro Gin Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175

Ser Pro Ser Tyr Ala Ser 180

&amp; Lt; 210 &amp; gt; 118 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 Α134Κ &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 118 atg cat cca att cca gat tct tct cca tta tta caa ttc ggg ggc caa 48 Met His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gee cag cag aca gaa gee 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc. get get gac cag 144 His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys ala Leu Lys Pro Gly Val lie 5 - 335 - 1 33716Β1 50 55 60 caatcttgggagtcaagacatccaggtCctgtgccagcggccagat 240 Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gcc erg tat gga teg etc cac ttt gac cct gag gee tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 egg gag ctg ett ett gag gac gga tac aat gtt tac cag tec gaa gee 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr asn Val Tyr Gin Ser Glu Ala 100 105 110 cae ggc etc ccg ctg cac ctg cca ggg aac aag lee eca cac egg gac 384 His Gly Leu Pro Leu His Leu Pro Gly asn Lys Ser Pro His Arg Asp 115 120 125 cct gca ccc ega gga cca aaa ege ttc ctg cca eta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Lys Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 10 15 20 25 30 age ccc age tac get tcc taa 549 Ser Pro Ser Tyr Ala Ser 180 35 &amp; lt; 210 &amp; gt; 119 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 40 &amp; lt; 400 &amp; gt; 119

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03371.tif" id="idf0229" />

5 -336-ΜΑ 33716Β1

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thi Glu Ala 20 25 30

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 50 55 60

Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 15

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 20

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 25

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 30

Pro Ala Pro Arg Gly Pro Lys Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 35

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 40

Ser Pro Ser Tyr Ala Ser 180 45

&amp; Lt; 210 &amp; gt; 120 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03381.tif" id="idf0230" />

51 015 20 25 30 35 40 451 E -ÏÏ1- 33716Β1 succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 Α134Υ &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 120 atgcatccaattccagattcttcteattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca gaa gcc 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag egg cca gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac egg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gca ccc ega gga cca tat ege ttc ctg cca eta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Tyr Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat 480

MA -338 -10 15 20 25 \ 1 1 m Hla 1

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtgggctcctcggaccctctgagcatggtgggaccttcccagggccga 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 age ccc age tac get tec taa 549 Ser Pro Ser Tyr Ala Ser 180 &amp; lt; 210 &amp; gt; 121 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 121 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 30

His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 35

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 40

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 45

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03401.tif" id="idf0231" />

- 339-ΜΑ 33716Β1 100 105 110 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 5

Pro Ala Pro Arg Gly Pro Tyr Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 10

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 15

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175

Ser Pro Ser Tyr Ala Ser 180 20 &amp; lt; 210 &amp; gt; 122 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 25 &amp; lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 Α134Ε 30 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 122 atgcatccaattccagattcttctccattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gee cag cag aca gaa gee 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03411.tif" id="idf0232" />

-340-ΜΑ 33716Β1 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 50 55 60 caa atc ​​ttg gga glc aag aca tcc agg ttc ctg tgc cag cgg cca gat 240 Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gcc ctg tat gga teg etc cac ttt gac cet gag gee tgc age ttc 288 Gly Ala Leu Tyr Gly ser Leu His Phe Asp Pro Glu Ala Cys ser Phe 85 90 95 10 cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin ser Glu Ala 100 105 110 15 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac cgg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 20 cct gea ccc ega gga cca gaa ege ttc ctg cca cta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Glu Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 25 ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly Ile Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc teg gac cct ctg age atggtg gga cct tcc cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 30! age ccc age tac get tcc taa 549 Ser Pro Ser Tyr Ala Ser 180 35 &amp; lt; 210 &amp; gt; 123 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession Saih &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 40 45 &amp; lt; 400 &amp; gt; 123

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03421.tif" id="idf0233" />

5 1 -341-

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 10

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 15

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 20

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 25

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 30

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 35

Pro Ala Pro Arg Gly Pro Glu Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 40

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 45

Ser Pro Ser Tyr Ala Ser 180

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03431.tif" id="idf0234" />

-342- 5ΜΑ 33716Β1 &amp; lt; 210 &amp; gt; 124 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 Α129Κ &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 124 atgcatccaatteagattcttctccattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gc.c cag cag aca gaa gee 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag egg cca gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys ser Phe 85 90 95 egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac egg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct aaa ccc. ega gga cca get ege ttc ctg cca eta cca ggc ctg ccc 432 Pro Lys Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 10 15 20 25 30 35 40 45 56 5 - 343 - ΜΑ 33716Β1 130 135 140 ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tee teg gac cct ctg age atg gtg gga cct tee cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 10 agccccagctacgcttcctaa 549

Ser Pro Ser Tyr Ala Ser 180 15 &amp; lt; 210 &amp; gt; 125 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 125 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 20 25

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 30

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 35

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 40

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 45

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03451.tif" id="idf0235" />

5 -344- 5 -344- 1 33716Β1

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 10

Pro Lys Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 15

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 20

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175

Ser Pro Ser Tyr Ala Ser 180 25 30 126 &amp; lt; 210 &amp; gt; 549 R. 211 &amp; gt; &amp; Lt; 212 &amp; gt; DNA sequence hourly &amp; lt; 213 &amp; gt;

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 P78C 35 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) 40 &amp; lt; 400 &amp; gt; 126 atg cat cca att cca gat tct tct cca tta tta caa ttc ggg ggc caa 48 Met His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 45 gtc egg cag egg tac etc tac aca gat gat gee cag cag aca gaa gee 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 51 -345 5 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 10 caa ate ttg gga gtc aag aca tee agg ttc ctg tgc cag egg tgc gat 240 Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Cys Asp 65 70 75 80 15 ggg gee ctg tat gga teg etc cac ttt gac cct gag gee tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 egg gag ctg ett ett gag gac gga tac at gtt tac cag tee gaa gee 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 20 cac ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac egg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gca ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tee teg gac cct ctg age atg gtg gga cct tee cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro ser Gin Gly Arg 165 170 175 25 30 35 549 age ccc age tac get tee taa ser Pro ser Tyr Ala ser 180 40 &amp; lt; 210 &amp; gt; 127 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03471.tif" id="idf0236" />

&amp; Lt; 220 &amp; gt; -346-ΜΑ 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 127 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 5 15 10 15 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 10

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 15

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 20

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Cys Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 25

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 30

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 35

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 40

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03481.tif" id="idf0237" />

5 -347-ΜΑ 33716Β1

Ser Pro Ser Tyr Ala Ser 180

&amp; Lt; 210 &amp; gt; 128 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 P78R 10 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 128 atgcateaattcagattcttcteattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca gaa gcc 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag egg cgt gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Arg Asp 65 70 75 80 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac egg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 15 20 25 30 35 40 51 45 - 348 - 5 ΜΑ 33716Β1 115 120 125 cct gca ccc cga gga cca get cgc ttc ctg cca eta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gca ccc ccg gag cca c.cc gga ate ctg gee ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 10 15 gtg ggc tcc teg gac cct ctg age atg gtg gga cct tee cag ggc cga 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 age ccc age tac get tcc taa 549

Ser Pro Ser Tyr Ala Ser 180 &amp; lt; 210 &amp; gt; 129 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 129 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 20 25 30

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 35

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 40

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 45

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Arg Asp 65 70 75 80

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03501.tif" id="idf0238" />

5 - 349- 5 - 349- 1 33716Β1

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 10

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 15

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 20

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 25

Ser Pro Ser Tyr Ala Ser 180 30

&amp; Lt; 210 &amp; gt; 130 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 L86T 35 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 130 atg cat cca att cca gat tct tct cca tta tta caa ttc ggg ggc caa 48 Met His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03511.tif" id="idf0239" />

5 -350-ΜΑ 33716Β1 gtc egg cag cgg tac etc tac aca gat gat gcc cag cag aca gaa gcc 96 Val Arg Gin Aig Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 50 55 60 caaatcttgggagtcaagacatccaggttcctgtgccagcggccagat 240 Gin Ile Leu Gly Val Lys Thr Ser Arg Phe L.eu Cys Gin Arg Pro Asp 65 70 75 80 ggg gcc ctg tat gga teg acc cac ttt gac cet gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Thr His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac cgg gac 384 His Gly Leu Pro Leu His Leu Pro Gly asn Lys Ser Pro His Arg Asp 115 120 125 cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gea ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 age ccc age tac get tcc taa 549 Ser Pro Ser Tyr Ala Ser 180 10 15 20 25 30 35 40 45

&amp; Lt; 210 &amp; gt; 131 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03521.tif" id="idf0240" />

-351- ΜΑ 33716Β1 succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 131

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 10

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 15

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 20

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 25

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Thr His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 30

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 35

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 40

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03531.tif" id="idf0241" />

5 -352- 1 33716Β1

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175

Ser Pro Ser Tyr Ala Ser 180 &amp; lt; 20 132 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 10

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 L86C 15 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 132 atgcatccaattccagattcttctccattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtccggcagcggtacctctacacagatgatgcccagcagacagaagcc 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 ca ate ttg gga gtc aag aca tec agg ttc ctg tgc cag egg cca gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gee ctg tat gga teg tgc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Cys His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly '1'yr Asn Val Tyr Gin Ser Glu Ala 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03541.tif" id="idf0242" />

5 -353 MK 33716Β1 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac egg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cet gea ccc ega gga cca get ege ttc ctg cca cta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gea ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tec teg gac cct ctg age atg gtg gga cct tec cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 10 15 age ccc age tac get tec taa 549 Ser Pro Ser Tyr Ala Ser 180 20 &amp; lt; 210 &amp; gt; 133 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 133 &amp; lt; 400 &amp; gt; 2530

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 35

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 40

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 45

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03551.tif" id="idf0243" />

5 -354- ΜΑ 33716Β1

Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Cys His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 10 15

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 20

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 30

Ser Pro Ser Tyr Ala Ser 180 &amp; lt; 210 &amp; gt; 13,435

&amp; Lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; 40 &amp; lt; 223 &amp; gt; FGF21 L98C &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS 45 &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 134

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03561.tif" id="idf0244" />

5 - 355 -ΜΑ 33716Β1 atg cat cca att cca gat tct tct cca tta tta caa ttc ggg ggc caa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtccggcagcggtacctctacacagatgatgcccagcagacagaagcc 96 Val Arg Gin Arg Tyr Leu tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 50 55 60 caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg cca gat 240 Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 cgg gag tgc ctt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Cys Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac cgg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gea ccc ega gga c.ca get ege ttc ctg cca cta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly Ile Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 age ccc age tac get tcc taa 549 Ser Pro Ser Tyr Ala Ser 180 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03571.tif" id="idf0245" />

5 -356-ΜΑ 33716Β1 &amp; lt; 210 &amp; gt; 135 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 3 a 2 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; lt synthetic structure; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 135 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 10

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 15

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 20

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 25

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 30

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 35

Arg Glu Cys Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 40

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 45

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03581.tif" id="idf0246" />

51 015 202 530 354 045

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03591.tif" id="idf0247" />

-56 Not- 33716Β1

MK 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175

Ser Pro Ser Tyr Ala Ser 180 &amp; lt; 210 &amp; gt; 136 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt;

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 L98R &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 136 atgcatccaattccagattcttctccattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gc egg cag egg tac etc tac aca gat gat gee cag cag aca gaa gee 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg gga gtc aag aca tec agg ttc ctg tgc cag egg cca gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gee ctg tat gga teg etc cac ttt gac cct gag gee tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 5 - 358 -ΜΑ, 33716Β1 cgg gag cgt ctt ctt gag gac gga tac aat gtt tac cag tee gaa gcc 336 Arg Glu Arg leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac cgg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 10 ccc gea ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tec teg gac cct ctg age atg gtg gga cct tec cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 age ccc age tac get tec taa 549 ser Pro ser Tyr Ala ser 180 15 20 25 &amp; lt; 210 &amp; gt; 137 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 137 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 30 35

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 40

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03601.tif" id="idf0248" />

5 -359-ΜΑ 33716Β1

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 50 55 60

Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 10

Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 15

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 20

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 25

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 30

Ser Pro Ser Tyr Ala Ser 180 35

&amp; Lt; 210 &amp; gt; 138 &amp; lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 L52T 40 45

&amp; Lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03611.tif" id="idf0249" />

-360- 5 1 33716Β1 &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 138 atg cat cca att cca gat tct tct cca tta tta caa ttc ggg ggc caa 48 Met His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gee cag cag aca gaa gee 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 10 cac ctg gag ate agg gag gat ggg acg gtg ggg ggc get get gac cag 144 His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age ccc gaa agt acc ctg cag ctg aaa gee ttg aag ccg gga gtt att 192 Ser Pro Glu Ser Thr Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 caa ate ttg gga gtc aag aca tec agg ttc ctg tgc cag egg cca gat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 ggg gee ctg tat gga teg etc cac ttt gac cct gag gee tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac egg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc c.tg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 15 20 25 30 35 40 45 age ccc age tac get tcc taa 549 Ser Pro Ser Tyr Ala Ser

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03621.tif" id="idf0250" />

-361- ΜΑ 33716Β1 180 &amp; lt; 210 &amp; gt; 139 &amp; lt; 211 &amp; gt; 182 5 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 10 &amp; lt; 400 &amp; gt; 139

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 15

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 20

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 25

Ser Pro Glu Ser Thr Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie 50 55 60 30

Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 35

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 40

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 45

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03631.tif" id="idf0251" />

5 -362-

5 -362- MA 33716Β1

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 10

Ser Pro Ser Tyr Ala Ser 180 &amp; lt; 210 &amp; gt; 14,015

&amp; Lt; 211 &amp; gt; 549 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt;

&amp; Lt; 220 &amp; gt; 20 &amp; lt; 223 &amp; gt; FGF21 L58E &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (549) &amp; lt; 400 &amp; gt; 140 atgcatccaattccagattcttctccattattacaattcgggggccaa 48 Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 gtc egg cag egg tac etc tac aca gat gat gcc cag cag aca gaa gcc 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag 144 His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 age cc.c gaa agt etc ctg cag ctg aaa gcc gaa aag ccg gga gtt att 192 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Glu Lys Pro Gly Val lie 50 55 60 caaatcttgggagtcaagacatccaggttcctgtgccagcggccagat 240 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 25 30 35 40 45 51 -363 - ΜΑ 33716Β1 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc 288 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 cgg gag ctg ctt ctt gag gac gga tac aat gtt tac cag tcc gaa gcc 336 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 cac ggc etc ccg ctg cac ctg cca ggg aac ag tcc cca cac cgg gac 384 His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc ctg ccc 432 Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140 ccc gea ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc ccc gat 480 Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 gtg ggc tec 1 ; cg gac cct ctg age atg gtg gga cct tec cag ggc ega 528 Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 10 15 20 age ccc age tac get tec taa Ser Pro Ser Tyr Ala Ser 180 549 25 &amp; lt; 210 &amp; gt; 141 &amp; lt; 211 &amp; gt; 182 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 141 &amp; lt; 400 &amp; gt; 3035

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15 40

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 45 / (.

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03651.tif" id="idf0252" />

-364- ΜΑ 33716Β1

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Glu Lys Pro Gly Val Ile 50 55 60

Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 10

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 15

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110 20

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125 25

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp 145 150 155 160 30

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175 35

Ser Pro Ser Tyr Ala Ser 180 40

&amp; Lt; 210 &amp; gt; 142 &amp; lt; 211 &amp; gt; 1278 &amp; lt; 212 &amp; gt; DNA industrial mitral &amp; lt; 213 &amp; gt; 45 &amp; lt; 220 &amp; gt;

&amp; Lt; 223 &amp; gt; FC-L15-L98RP171G182P

CA 5 -365 -ΜΑ 33716Β1 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1278) &amp; lt; 400 &amp; gt; 142 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp TyrVal Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 1 to Ah¾ IS%? &amp; gt; tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 10 15 20 25 30 35 40 45 0 [5 -366-ΜΑ 33716Β1 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys ser Leu ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc cgg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag cgt ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03681.tif" id="idf0253" />

- 367 - 1 33716Β1 egg gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tee teg gac cct ctg age atg gtg gga ggt tee cag 1248 Pro Asp Val Gly Ser ser Asp Pro Leu ser Met Val Gly Gly ser Gin 405 410 415 10 ggc ega age ccc age tac get tee ccg taa 1278 Gly Arg ser Pro ser Tyr Ala ser Pro 420 425 15 &amp; lt; 210 &amp; gt; 143 &amp; lt; 211 &amp; gt; 425 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 20 25 &amp; lt; 400 &amp; gt; 143

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 30

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 35 40

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn TrpTyrVal Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03691.tif" id="idf0254" />

- 368- - 368-ΜΑ 33716Β1

Tyr Arg Val Val Ser Val Leu Thf Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala -369- 33716Β1 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys GJn Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser Pro 420 425

&amp; Lt; 210 &amp; gt; 144 &amp; lt; 211 &amp; gt; 1278 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt;

&amp; Lt; 223 &amp; gt; FC-L15-L98RP171G182G -370- 5 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1278) &amp; lt; 400 &amp; gt; 144 atggacaaactcacacatgteaccttgtccagctccggaactcctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp TyrVal Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03721.tif" id="idf0255" />

-371-ΜΑ 33716Β1 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc cgg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 gaa gcc cac ctg gag atcagg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg lat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag cgt ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03731.tif" id="idf0256" />

5 -372- 5 -372- I 33716Β1

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc 1200

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 10 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga ggt tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 ggc ega age ccc age tac get tcc ggc taa 1278

Gly Arg Ser Pro Ser Tyr Ala Ser Gly 420 425 15 &amp; lt; 210 &amp; gt; 145 &amp; lt; 211 &amp; gt; 425 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 20 &amp; lt; 400 &amp; gt; 145 25 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 30

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 35

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 40

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 45

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03741.tif" id="idf0257" />

-373 - ΜΑ 33716Β1 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 10

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 15

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160 20

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 25

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 30

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 35

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 40

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 45

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03751.tif" id="idf0258" />

-374- ΜΑ 33716Β1

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 10

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 15

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 20

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 25

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 30

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser Gly 420 425 35

&amp; lt; 210 &amp; gt; 146 &amp; lt; 211 &amp; gt; 1281 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; lt; 220 &amp; gt; &amp; lt; 223 &amp; gt; FC-L15-L98RP171G 182G 183G 40 45 &amp; lt; 220 &amp; gt; 5ΜΑ 33716Β1 &amp; lt; 221 &amp; gt ; CDS &amp; lt; 222 &amp; gt; (1) .. (1281) &amp; lt; 400 &amp; gt; 146 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gc ttc etc ttc ccc cca aaa ccc. aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp TyrVal Asp Gly Val Glu 50 55 60 gtg cat aatgee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tec aac aaa gee etc cca gee ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate tec aaa gee aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tec cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Le u Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc Tgc ctg gtc aaa Ggc ttc tat ccc age gac ate gee gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tec gac ggc 1; cc ttc ttc etc tac age aag etc acc 576 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03771.tif" id="idf0259" />

5! ÏÏF1A -6016-

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg I gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys ser Leu ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggtggatcccatccaattccagattcttctccattattacaattcggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc cgg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Scr Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag cgt ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc c.cg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 10 15 20 25 30 35 40 45 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 0 \

5MA 33716Β1 -666- 370 375 380 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga ggt tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 10 ggc ega age ccc age tac get tec ggt ggc taa 1281

Gly Arg Ser Pro Ser Tyr Ala Ser Gly Gly 420 425 15 &amp; lt; 210 &amp; gt; 147 &amp; lt; 211 &amp; gt; 426 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 20 &amp; lt; 400 &amp; gt; 147 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 25

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 35

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 40

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 45

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03791.tif" id="idf0260" />

-378- MA! 33716Β1

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 10

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 15 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 20

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 25

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 30

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 35

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 40

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 45

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03801.tif" id="idf0261" />

5 -379-

5 -379- MA 33716Β1

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 25

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 30 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser Gly Gly 420 425 35 &amp; lt; 210 &amp; gt; 148 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA 40 successive industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt;

&amp; Lt; 223 A Fc-L15-L98R P171G Y179S

&amp; Lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03811.tif" id="idf0262" />

5 - 380-ΜΑ 33716Β1 &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 148 E. atg gac aaa act cac aca tgt cca CCI tgt cca gel ccg gaa etc ctg 48 Met Asp Lys Th His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 5 1 E. ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 E. Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 30 25 20 e atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 ;; Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr lie ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 10 15 20 25 30 35 40 45 0 \ - 381- 5ΜΑ '&amp; quot; 33716Β1 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tee cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 gaa gee cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cet gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag cgt ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 10 15 20 25 30 35 40 45 0 \ 5 - 382.

5 - 382- MK 33716Β1 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga ggt tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 10 ggc ega age ccc age tec get tec taa 1275

Gly Arg Ser Pro Ser Ser Ala Ser 420 &amp; lt; 210 &amp; gt; 149 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 149 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 15 20 25

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 35

His Glu Asp Pro Glu Val Lys Phe Asn TrpTyrVal Asp Gly Val Glu 50 55 60 40

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 45

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 A ;: 5 - 383 &amp; quot; ΜΑ 33716Β1

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 10

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 15

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 20

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 25

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 30

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 35

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 40

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 45

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03851.tif" id="idf0263" />

5 -384-ΜΑ 33716Β1

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 10

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 15

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 20

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 25

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 30

Gly Arg Ser Pro Ser Ser Ala Ser 420 35 &amp; lt; 210 &amp; gt; 150 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 40

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-L98RP171GY179F &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03861.tif" id="idf0264" />

5 -385 -MA 33716Β1 &amp; lt; 400 &amp; gt; 150 atg gac aaa act cac aca tgt cca cct t. cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp TyrVal Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03871.tif" id="idf0265" />

5ΜΑ 33716Β1 &amp; quot; 386- gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tee cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc cgg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag cgt ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 10 15 20 25 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03881.tif" id="idf0266" />

- 387- 5ΜΑ 33716Β1 ctg ccc ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga ggt tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 ggc ega age ccc age ttc get tcc taa 1275 Gly Arg Ser Pro Ser Phe Ala Ser 420 10 &amp; lt; 210 &amp; gt; 151 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT industrial mitral &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 15 20 &amp; lt; 400 &amp; gt; 151 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 25

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 35 40

His Glu Asp Pro Glu Val Lys Phe Asn TrpTyrVal Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 45 ex 5 -388-33716Β1

I

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 10

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160 15

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 20

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 25

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 30

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 35

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 40

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 45

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly d - 389ΜΑ 33716Β1 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thf Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 5

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 10

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 15

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 20

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 25

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 30

Gly Arg Ser Pro Ser Phe Ala Ser 420 35 &amp; lt; 210 &amp; gt; 152 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; Fc-L15-L98R P171G Υ179Α 40 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03911.tif" id="idf0267" />

5 -390-ΜΑ 33716Β1 &amp; lt; 400 &amp; gt; 152 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa T4 AA ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa cc. c aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tee cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gee aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp T ^ Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tee aac aaa gee etc cca gee ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tee aaa gee aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tee cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gee gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp He Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tee gac ggc tee ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 10 15 20 25 30 35 40 45

5 -391- MK 33716Β1 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thi Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc cgg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag cgt ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ctg gcc ccc cag ccc 1200 10 15 20 25 30 35 40 45 01 -392- ΜΑ '33716Β1

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 ccc gat gtg ggc tee teg gac cct ctg age atg gtg gga ggt tee cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 ggc ega age ccc age get get tec taa 1275 10

Gly Arg Ser Pro Ser Ala Ala Ser 420 &amp; lt; 210 &amp; gt; 153 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 153 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 1 5 20 25

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 35

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 40

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 45

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03941.tif" id="idf0268" />

5 - 393 - ΜΑ 33716Β1 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 10

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160 15

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 20

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 25

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 30

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 35

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 40

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 45

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 5 -394- 1 2 &amp; gt; 2 &amp; gt; 61Λ

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 10

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 15

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 20

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 25

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 30

Gly Arg Ser Pro Ser Ala Ala Ser 420 &amp; lt; 210 &amp; gt; 154 &amp; lt; 211 &amp; gt; 1275 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; 35

&amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-L98RP171GA180S 40 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) &amp; lt; 400 &amp; gt; 15,445

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03961.tif" id="idf0269" />

5 - 395 -ΜΑ 33716Β1 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 gggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atgatctcccgtacccctgaggtcacatgcgtggtggtggacgtgagc 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr He Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gcc gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp He Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 10 15 20 25 30 35 40 45 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 C \ 5 -396-ΜΑ 33716Β1

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 atg caî gag get ctg cac aac cac tac acg cag aag agc etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 ser Pro Gly Lys Gly Gly Gly Gly Gly ser Gly Gly Gly ser Gly Gly 225 230 235 240 ggt gga tec cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc cgg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa atc ​​ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gc.c tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag cgt ctt ctt gag gac gga tac aat gtt tac. cag tcc 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly asn Lys Ser Pro His 1 1 of 5 for 6 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 10 15 20 25 30 35 40 45 θ \ -397- ΜΑ 33716Β1 385 390 395 400 ccc gat gtg ggc tcc tcg gac cct ctg agc atg gtg gga ggt tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 ggc cga agc ccc agc tac tcc tcc taa 1275

Gly Arg Ser Pro Ser Tyr Ser Ser 420 10

&amp; Lt; 210 &amp; gt; 155 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT 15 successive industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; 20 &amp; lt; 400 &amp; gt; 155

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 25

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 35

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 40

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 45

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

<img img-format="tif" img-content="drawing" file="MA-33716-B1D03991.tif" id="idf0270" />

-398- 33716Β1

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 5 - 399- ΜΑ 33716Β1

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 10

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 15

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 20

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 25

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ser Ser 30 420 &amp; lt; 210 &amp; gt; 156 &amp; lt; 211 &amp; gt; 127 535

&amp; Lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FC-L15-L98R P171G A180G 40 &amp; lt; 220 &amp; gt;

&amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1275) 45 &amp; lt; 400 &amp; gt; 156 atggacaaaactcacacatgtccaccttgtccagctccggaactcctg 48

<img img-format="tif" img-content="drawing" file="MA-33716-B1D04011.tif" id="idf0271" />

5 -400-ΜΑ 33716Β1

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac ace etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tec cgt ace cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac c.ct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn TrpTyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gee aag aca aag ccg cgt gag gag cag tac aac age acg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc 336 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 ate gag aaa acc ate ​​tcc aaa gcc aaa ggg cag ccc ega gaa cca cag 384 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 gtg tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc 432 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 age ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate ​​gc.c gtg 480 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160 gag tgg gag age aat ggg cag ccg gag aac aac tac aag acc acg cct 528 Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr 4'hr Pro 165 170 175 ccc gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc 576 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 gtg gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg 624 Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 10 15 20 25 30 35 40 45 0 5 -401-ΜΑ 33716Β1 195 200 205 atg cat gag get ctg cac aac cac tac acg cag ag age etc tcc ctg 672 Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 tet ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 720 Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 ggt gga tee cat cca att cca gat tet tet cca tta tta caa ttc ggg 768 Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255 ggc caa gtc egg cag cgg tac etc tac aca gat gat gcc cag cag aca 816 Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get 864 Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag ccg gga 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag cgg 960 Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat ggg gcc ctg tat gga teg etc cac ttt gac cct gag gcc tgc 1008 Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc cgg gag cgt ctt ctt gag gac gga tac aat gtt tac cag tcc 1056 Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac 1104 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta cca ggc 1152 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc cag ccc 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu ala Pro Gin Pro 385 390 395 400 10 15 20 25 30 35 40 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D04031.tif" id="idf0272" />

5 -402- ΜΑ '33716Β1 ccc gat gtg ggc tcc tcg gac cct ctg agc atg gtg gga ggt tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 ggc cga agc ccc agc tac ggt tcc taa 1275

Gly Arg Ser Pro Ser Tyr Gly Ser 420 10 &amp; lt; 210 &amp; gt; 157 &amp; lt; 211 &amp; gt; 424 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 157 Met Asp Lys Thr His Lhr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15 15 20

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 25

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 30

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 35

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 40

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D04041.tif" id="idf0273" />

-403- ΜΑ 33716Β1

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 10

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160 15

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 20

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205 25

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220 30

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240 35

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270 40

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 45

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

<img img-format="tif" img-content="drawing" file="MA-33716-B1D04051.tif" id="idf0274" />

5 -404- ΜΑ 33716Β1

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 10

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 15

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 20

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 25

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Gly Ser 420 30 &amp; lt; 20 158 &amp; lt; 211 &amp; gt; 1287 &amp; lt; 212 &amp; gt; DNA 35 successive industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; MKEDD-FGF21- (L15) -Fc 40 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (1287) 45 &amp; lt; 400 &amp; gt; 158 atg aaa gaa gat gat cac cca att cca gat tct tct cca tta tta caa 48 Met Lys Glu Asp Asp His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin

<img img-format="tif" img-content="drawing" file="MA-33716-B1D04061.tif" id="idf0275" />

5 -405 -ΜΑ 33716Β1 15 10 15 ttc ggg ggc caa gtc egg cag cgg tac etc tac aca gat gat gcc cag 96 Phe Gly Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin 20 25 30 cag aca gaa gee cac ctg gag atc agg gag gat ggg aeg gtg ggg ggc 144 Gin Thr Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly 35 40 45 get get gac cag age ccc gaa agt etc ctg cag ctg aaa gcc ttg aag 192 Ala Ala Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys 50 55 60 ccg gga gtt att caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc 240 Pro Gly Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys 65 70 75 80 cag cgg cca gat ggg gcc ctg tat gga teg etc cac ttt gac cet gag 288 Gin Arg Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu 85 90 95 gee tgc age ttc cgg gag ctg ctt ctt gag gac gga tac aat gtt tac 336 Ala Cys Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr 100 105 110 cag tee gaa gee cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc 384 Gin Ser Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser 115 120 125 cca cac cgg gac cct gea ccc ega gga cca get ege ttc ctg cca cta 432 Pro His Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu 130 135 140 cca ggc ctg cca ccc gea ccc ccg gag cca ccc gga atc ​​ctg gcc ccc 480 Pro Gly Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro 145 150 155 160 cag ccc ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga cct 528 Gin Pro Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro 165 170 175 tec cag ggc ega age ccc age tac get tcc ggt gga ggt ggt ggt tet 576 Ser Gin Gly Arg Ser Pro Ser Tyr Ala Ser Gly Gly Gly Gly Gly Ser 180 185 190 ggt ggt ggt age ggt ggt ggt gga tcc gac aaa act cac aca tgc cca 624 Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Lys Thr His Thr Cys Pro 195 200 205 10 15 20 25 30 35 40 45

Or 5 -406-ΜΑ 33716Β1 ccg tgc cca gca cct gaa etc ctg ggg gga ccg tea gtc ttc etc ttc 672 Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe 210 215 220 ccc cca aaa ccc aag gac acc etc atg ate tcc cgt acc cct gag gtc 720 Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val 225 230 235 240 aca tgc gtg gtg gtg gac gtg age cac gaa gac cct gag gtc aag ttc 768 Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe 245 250 255 aac tgg tac gtg gac ggc gtg gag gtg cat aat gcc aag aca aag ccg 816 Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro 260 265 270 cgt gag gag cag tac aac age aeg tac cgt gtg gtc age gtc etc acc 864 Arg Glu Glu Gin Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr 275 280 285 gtc ctg cac cag gac tgg ctg aat ggc aag gag tac aag tgc aag gtc 912 Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val 290 295 300 tee aac aaa gee etc cca gee ccc ate ​​gag aaa acc ate ​​tee aaa gcc 960 Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala 305 310 315 320 aaa ggg cag ccc ega gaa cca cag gtg tac acc ctg ccc cca tee cgg 1008 Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg 325 330 335 gat gag ctg acc aag aac cag gtc age ctg acc tgc ctg gtc aaa ggc 1056 Asp Glu Leu Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly 340 345 350 ttc tat ccc age gac atc gcc gtg gag tgg gag age aat ggg cag ccg 1104 Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro 355 360 365 gag aac aac tac aag acc aeg cct ccc gtg ctg gac tcc gac ggc tcc 1152 Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser 370 375 380 ttc ttc etc tat age aag etc acc gtg gac aag age agg tgg cag cag 1200 Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin 385 390 395 400 10 15 20 25 30 35 40 45 -407- 5 ΛΙΙλ? 1 ggg aac gtc ttc tea tgc tee gtg atg cat gag get ctg cac aac cac 1248 Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His 405 410 415 tac aeg cag aag age etc tee ctg tet ccg ggt aaa taa 1287

Tyr Thr Gin Lys Ser Leu Ser Leu Ser Pro Gly Lys 420 425 &amp; lt; 210 &amp; gt; 15,910

&amp; Lt; 211 &amp; gt; 428 &amp; lt; 212 &amp; gt; PRT Mtwabh industrial &amp; lt; 213 &amp; gt; 15 &amp; lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 159

Met Lys Glu Asp Asp His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin 20 15 10 15

Phe Gly Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin 20 25 30 25

Gin Thr Glu Ala His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly 35 40 45 30

Ala Ala Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys 50 55 60 35 40

Pro Gly Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys 65 70 75 80

Gin Arg Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu 85 90 95

Ala Cys Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr 100 105 110 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D04091.tif" id="idf0276" />

ΜΑ 33716Β1 -4.8-

Gin Ser Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser 115 120 125

Pro His Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu 130 135 140

Pro Gly Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro 145 150 155 160 10

Gin Pro Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro 165 170 175 1 5

Ser Gin Gly Arg Ser Pro Ser Tyr Ala Ser Gly Gly Gly Gly Gly Ser 180 185 190 20

Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Lys Thr His Thr Cys Pro 195 200 205

Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe 210 215 220 25

Pro Pro Lys Pro Lys Asp Thr Leu Met lie Ser Arg Thr Pro Glu Val 225 230 235 240 30

Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe 245 250 255 35

Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro 260 265 270 40

Arg Glu Glu Gin Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr 275 280 285

Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val 290 295 300 45

Ser Asn Lys Ala Leu Pro Ala Pro lie Glu Lys Thr lie Ser Lys Ala

<img img-format="tif" img-content="drawing" file="MA-33716-B1D04101.tif" id="idf0277" />

-409- -409-ΜΑ 33716Β1 305 310 315 320

Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg 325 330 335

Asp Glu Leu Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly 340 345 350

Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro 355 360 365

Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser 370 375 380

Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin 385 390 395 400

Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His 405 410 415

Tyr Thr Gin Lys Ser Leu Ser Leu Ser Pro Gly Lys 420 425

&amp; Lt; 20 160 &amp; lt; 211 &amp; gt; 630 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 Υ179Ν SI8IT, 28ΑΑ signal sequence removed during processing &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (630) &amp; lt; 400 &amp; gt; 160 atg gac teg gac gag ace ggg ttc gag cac tea gga ctg tgg gtt tct 48 Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15 5 -410-ΜΑ 33716Β1 gtg ctg get ggt cti ctg ctg gga gcc tgc cag gca cac ccc ate ​​cct 96 Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro Ile Pro 20 25 30 gac tcc agt cet etc ctg caa tie ggg ggc caa gtc egg cag cgg tac 144 Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 etc tac aca gat gat gcc cag cag aca gaa gcc cac ctg gag atc agg 192 Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu Ile Arg 50 55 60 gag gat ggg aeg gtg ggg ggc get get gac cag age ccc gaa agt etc 240 Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80 ctg cag ctg aaa gcc ttg aag ccg gga gtt att caa atc ttg gga gtc 288 Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile Gin Ile Leu Gly Val 85 90 95 aag aca tcc agg ttc ctg tgc cag cgg cca gat ggg gcc ctg tat gga 336 Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 teg etc cac ttt gac cct gag gcc tgc age ttc cgg gag ctg ctt ctt 384 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125 gag gac gga tac aat gtt tac cag tcc gaa gcc cac ggc etc ccg ctg 432 Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140 cac ctg cca ggg aac aag tcc cca cac cgg gac cct gea ccc ega gga 480 His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160 cca get ege ttc ctg cca cta cca ggc ctg cca ccc gea ccc ccg gag 528 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175 cca ccc gga atc ​​ctg gcc ccc cag ccc ccc gat gtg ggc tcc teg gac 576 Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 cct ctg age atg gtg gga cct tcc cag ggc ega age ccc age aac get 624 Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Asn Ala 195 200 205 10 15 20 25 30 35 40 45

M

-411- 5MK 33716Β1 acc tga 630 Thr &amp; lt; 210 &amp; gt; 161 &amp; lt; 211 &amp; gt; 209 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 161 Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15 10 15

Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro lie Pro 20 25 30 20

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 25

Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60 30

Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80 35

Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin lie Leu Gly Val 85 90 95

Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 40

Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125 45

<img img-format="tif" img-content="drawing" file="MA-33716-B1D04131.tif" id="idf0278" />

-412- ΜΑ 33716Β1

Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140

His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160

Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175

Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190

Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Asn Ala 195 200 205

Thr

&amp; Lt; 210 &amp; gt; 162 &amp; lt; 211 &amp; gt; 630 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 Υ179Ν, 28 AA exciting succession were removed during the treatment &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (630) &amp; lt; 400 &amp; gt; 162 atg gac teg gac gag ace ggg ttc gag cac tea gga ctg tgg gtt tet 48 Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu T ^ Val Ser 15 10 15 gtg ctg get ggt ett ctg ctg gga gee tgc cag gca cac ccc ate ​​cct 96 Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro lie Pro 20 25 30 144 gac tcc agt cct etc ctg caa ttc ggg ggc caa gtc egg cag egg tac 5 -413-ΜΑ 33716Β1

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 etc tac aca gat gat gee cag cag aca gaa gee cac ctg gag atc agg 192 Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu ile Arg 50 55 60 gag gat ggg acg gtg ggg ggc get get gac cag agc ccc gaa agt etc 240 Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80 10 ctg cag ctg aaa gcc ttg aag ccg gga gtt att caa atc ​​ttg gga gtc 288 Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile Gin Ile Leu Gly Val 85 90 95 aag aca tcc agg ttc ctg tgc cag cgg cca gat ggg gcc ctg tat gga 336 Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 tcg etc cac ttt gac cet gag gcc tgc agc ttc cgg gag ctg ctt ctt 384 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125 gag gac gga tac aat gtt tac cag tcc gaa gcc cac ggc etc ccg ctg 432 Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140 cac ctg cca ggg aac aag tcc cca cac cgg gac cct gea ccc ega gga 480 His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160 cca get ege ttc ctg cca cta cca ggc ctg cca ccc gea ccc ccg gag 528 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175 cca ccc gga atc ​​ctg gcc ccc cag ccc ccc gat gtg ggc tcc tcg gac 576 Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 15 20 25 30 35 cct ctg age atg gtg gga cct tcc cag ggc ega age ccc age aac get 624 Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Asn Ala 195 200 205 40 tcc tga Ser 630 45 &amp; lt; 210 &amp; gt; 163

<img img-format="tif" img-content="drawing" file="MA-33716-B1D04151.tif" id="idf0279" />

414- ΜΑ 33716Β1

&amp; Lt; 211 &amp; gt; 209 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 5 &amp; ​​lt; 220 &amp; gt; SYNTHETIC structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 163

Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 1 0 15 10 15

Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro lie Pro 20 25 30 15

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 20

Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60 25

Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80 30

Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin lie Leu Gly Val 85 90 95

Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 35

Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125 40

Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140 45

His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160

<img img-format="tif" img-content="drawing" file="MA-33716-B1D04161.tif" id="idf0280" />

5 -415- 5 -415- 1 33716Β1

Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175

Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 10

Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Asn Ala 195 200 205

Ser 15 &amp; lt; 210 &amp; gt; 164 &amp; lt; 211 &amp; gt; 630 &amp; lt; 212 &amp; gt; DNA sequence industrial &amp; lt; 213 &amp; gt; &amp; Lt; 220 &amp; gt; &amp; Lt; 223 &amp; gt; FGF21 P124S, 28 AA signal sequence removed during processing 20 25 &amp; lt; 220 &amp; gt; &amp; Lt; 221 &amp; gt; CDS &amp; lt; 222 &amp; gt; (1) .. (630) &amp; lt; 400 &amp; gt; 164 atg gac teg gac gag acc ggg ttc gag cac tea gga ctg tgg gtt tct 48 Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15 gtg ctg get ggt ett ctg ctg gga gcc tgc cag gca cac ccc ate ​​cct 96 Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro lie Pro 20 25 30 gac tcc agt cct etc ctg caa ttc ggg ggc caa gtc egg cag egg tac 144 Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 etc tac aca gat gat gcc cag cag aca gaa gcc cac c.tg gag ate agg 192 Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60 30 35 40 45 5 -416-ΜΑ 33716Β1 gag gat ggg acg gtg ggg ggc get get gac cag age ccc gaa agt etc 240 Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 16 IS% 6 ctgcagctgaaagccttgaagccgggagttattcaaatcttgggagtc 288 Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile Gin Ile Leu Gly Val 85 90 95 aag aca tcc agg ttc ctg tgc cag egg cca gat ggg gcc ctg tat gga 336 Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110 teg etc cac ttt gac cet gag gcc tgc age ttc cgg gag ctg ctt ctt 384 Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125 gag gac gga tac aat gtt tac cag tcc gaa gcc cac ggc etc ccg ctg 432 Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140 cac ctg cca ggg aac aag tcc tea cac cgg gac cct gea ccc ega gga 480 His Leu Pro Gly Asn Lys Ser Ser His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160 10 15 20 cca get ege ttc ctg cca cta cca ggc ctg cca ccc gea ccc ccg gag 528 Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175 cca ccc gga ate ctg gcc ccc cag ccc ccc gat gtg ggc tcc teg gac 576 Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190 cct ctg age atg gtg gga cct tcc cag ggc ega age ccc age tac get 624 Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205 25 30 35 630 tcc tga Ser 40 &amp; lt; 210 &amp; gt; 165 &amp; lt; 211 &amp; gt; 209 &amp; lt; 212 &amp; gt; PRT succession industrial &amp; lt; 213 &amp; gt; 45 &amp; lt; 220 &amp; gt; -417- -417-ΜΑ 33716Β1 synthetic structure &amp; lt; 223 &amp; gt; &amp; Lt; 400 &amp; gt; 165

Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15

Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro lie Pro 20 25 30

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45

Leu Lyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60

Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80

Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin lie Leu Gly Val 85 90 95

Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110

Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125

Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140

His Leu Pro Gly Asn Lys Ser Ser His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160

Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175 -418- ΜΑ 33716Β1

Pro Pro Gly Ile Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190

Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205

Ser