Fgf21 mutants and uses thereof

215,937/2

<img img-format="tif" img-content="drawing" file="IL215937AD00021.tif" id="idf0001" />

FIELD OF THE INVENTION

The invention relates to nucleic acid molecules encoding FGF21 mutant polypeptides, FGF21 mutant polypeptides, pharmaceutical compositions comprising FGF21 mutant polypeptides, and methods for treating metabolic disorders using such nucleic acids, polypeptides, or pharmaceutical compositions.

BACKGROUND OF THE INVENTION FGF21 is a secreted polypeptide that belongs to a subfamily of fibroblast growth factors (FGFs) that includes FGF19, FGF21, and FGF23 (Itoh et al., 2004, Trend Genet. 20: 563-69). FGF21 is an atypical FGF in that it is heparin independent and functions as a hormone in the regulation of glucose, lipid, and energy metabolism. FGF21 was isolated from a liver cDNA library as a hepatic secreted factor. It is highly expressed in liver and pancreas and is the only member of the FGF family to be primarily expressed in liver. Transgenic mice overexpressing FGF21 exhibit metabolic phenotypes of slow growth rate, low plasma glucose and triglyceride levels, and an absence of age-associated type 2 diabetes, islet hyperplasia, and obesity. Pharmacological administration of recombinant FGF21 protein in rodent and primate models results in normalized levels of plasma glucose, reduced triglyceride and cholesterol levels, and improved glucose tolerance and insulin sensitivity. In addition, FGF21 reduces body weight and body fat by increasing energy expenditure, physical activity, and metabolic rate. Experimental research provides support for the pharmacological administration of FGF21 for the treatment of type 2 diabetes, obesity, dyslipidemia, and other metabolic conditions or disorders in humans.

Human FGF21 has a short half-life in vivo. In mice, the half-life of human FGF21 is 1 to 2 hours, and in cynomolgus monkeys, the half-life is 2.5 to 3 hours. In developing an FGF21 protein for use as a therapeutic in the treatment of type 2 diabetes, an increase in half-life would be desirable. FGF21 proteins having an 1 WO 2010/129503 PCT/US2010/033478 enhanced half-life would allow for less frequent dosing of patients being administered the protein. Such proteins are described herein.

SUMMARY OF THE INVENTION 5 An isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 4 and further comprising: (a) at least one amino acid substitution at position 180; and (b) at least one amino acid substitution selected from the group consisting of: (i) a substitution at position 171; and (ii) a substitution at position 98; and (c) combinations thereof is disclosed. 10 In one embodiment the isolated polypeptide comprises a substitution at position 98 and a substitution at position 180 and wherein: (a) the substitution at position 98 is selected from the group consisting of an arginine, cysteine, glutamic acid, glutamine, lysine, and threonine; and (b) the substitution at position 180 is selected from the group consisting of glycine, proline, serine or glutamic acid; and (c) 15 combinations thereof. In one embodiment the residue at position 98 is arginine and the residue at position 180 is glutamic acid. Also provided is a fusion polypeptide comprising the isolated polypeptide fused to a heterologous amino acid sequence. In one embodiment the heterologous amino acid sequence is an Fc domain or fragment thereof, and can comprise the amino acid sequence of SEQ ID NO:11. In another 20 embodiment the polypeptide is fused to the Fc domain via a linker and in yet another embodiment the linker comprises GGGGSGGGGSGGGGS (SEQ ID NO:31). In one specific embodiment the polypeptide comprises SEQ ID NO:47. Also disclosed is a multimcr comprising two or more of the fusion polypeptides. A pharmaceutical composition comprising the isolated polypeptide and a pharmaceutically acceptable 25 formulation agent, such as a hydrogel, is also disclosed. In another aspect, a method of treating a metabolic disorder is provided and in one embodiment comprises administering to a human patient in need thereof a pharmaceutical composition provided herein. In one embodiment the metabolic disorder is diabetes and in another the metabolic disorder is obesity. Nucleic acids encoding the isolated polypeptide arc 30 also provided and in one embodiment the nucleic acid comprises SEQ ID NO:46. The nucleic acid can be present in a vector, which can itself be present in a host cell. In still another embodiment the polypeptide comprises: (a) an amino-terminal truncation of no more than 8 amino acid residues, wherein the polypeptide is capable of lowering blood glucose in a mammal; (b) a carboxyl-terminal truncation of no 2 WO 2010/129503 PCT/US2010/033478 more than 12 amino acid residues, wherein the polypeptide is capable of lowering blood glucose in a mammal; or (c) an amino-terminal truncation of no more than 8 amino acid residues and a carboxyl-terminal truncation of no more than 12 amino acid residues, wherein the polypeptide is capable of lowering blood glucose in a 5 mammal. In still other embodiments the polypeptide is covalently linked to one or more polymers, such as PEG.

In another embodiment the isolated polypeptide comprises a substitution at position 171 and a substitution at position 180 and wherein: (a) the substitution at position 180 is selected from the group consisting of glycine, proline, serine and 10 glutamic acid; (b) the substitution at position 171 is selected from the group consisting of an alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, lysine, serine, threonine, tryptophan, and tyrosine; and (c) combinations thereof. In one embodiment the residue at position 171 is glycine and the residue at position 180 is glutamic acid. Also provided is a fusion 15 polypeptide comprising the isolated polypeptide fused to a heterologous amino acid sequence. In one embodiment the heterologous amino acid sequence is an Fc domain or fragment thereof, and can comprise the amino acid sequence of SEQ ID NO:11. In another embodiment the polypeptide is fused to the Fc domain via a linker and in yet another embodiment the linker comprises GGGGSGGGGSGGGGS (SEQ ID NO:31). 20 In one specific embodiment the polypeptide comprises SEQ ID NO:47. Also disclosed is a multimer comprising two or more of the fusion polypeptides. A pharmaceutical composition comprising the isolated polypeptide and a pharmaceutically acceptable formulation agent, such as a hydrogel, is also disclosed. In another aspect, a method of treating a metabolic disorder is provided and in one 25 embodiment comprises administering to a human patient in need thereof a pharmaceutical composition provided herein. In one embodiment the metabolic disorder is diabetes and in another the metabolic disorder is obesity. Nucleic acids encoding the isolated polypeptide are also provided and in one embodiment the nucleic acid comprises SEQ ID NO:46. The nucleic acid can be present in a vector, 3 0 which can itself be present in a host cell. In still another embodiment the polypeptide comprises: (a) an amino-terminal truncation of no more than 8 amino acid residues, wherein the polypeptide is capable of lowering blood glucose in a mammal; (b) a carboxyl-terminal truncation of no more than 12 amino acid residues, wherein the polypeptide is capable of lowering blood glucose in a mammal; or (c) an amino- 3 WO 2010/129503 PCT/US2010/033478 terminal truncation of no more than 8 amino acid residues and a carboxyl-terminal truncation of no more than 12 amino acid residues, wherein the polypeptide is capable of lowering blood glucose in a mammal. In still other embodiments the polypeptide is covalently linked to one or more polymers, such as PEG. 5 In yet another embodiment the polypeptide comprises a substitution at position 98, a substitution at position 171 and a substitution at position 180 of SEQ ID NO:4 and wherein: (a) the substitution at position 171 is selected from the group consisting of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, lysine, serine, threonine, tryptophan, or tyrosine; (b) the 10 substitution at position 98 is selected from the group consisting of arginine, cysteine, glutamic acid, glutamine, lysine, or threonine; and (c) the substitution at position 180 is selected from the group consisting of glycine, proline, serine or glutamic acid; and combinations thereof. In a further embodiment the residue at position 98 is arginine, the residue at position 171 is glycine and the residue at position 180 is a glutamic 15 acid. Also provided is a fusion polypeptide comprising the isolated polypeptide fused to a heterologous amino acid sequence. In one embodiment the heterologous amino acid sequence is an Fe domain or fragment thereof, and can comprise the amino acid sequence of SEQ ID NO:11. In another embodiment the polypeptide is fused to the Fe domain via a linker and in yet another embodiment the linker comprises 20 GGGGSGGGGSGGGGS (SEQ ID NO:31). In one specific embodiment the polypeptide comprises SEQ ID NO:47. Also disclosed is a multimcr comprising two or more of the fusion polypeptides. A pharmaceutical composition comprising the isolated polypeptide and a pharmaceutically acceptable formulation agent, such as a hydrogel, is also disclosed. In another aspect, a method of treating a metabolic 25 disorder is provided and in one embodiment comprises administering to a human patient in need thereof a pharmaceutical composition provided herein. In one embodiment the metabolic disorder is diabetes and in another the metabolic disorder is obesity. Nucleic acids encoding the isolated polypeptide arc also provided and in one embodiment the nucleic acid comprises SEQ ID NO:46. The nucleic acid can be 30 present in a vector, which can itself be present in a host cell. In still another embodiment the polypeptide comprises: (a) an amino-terminal truncation of no more than 8 amino acid residues, wherein the polypeptide is capable of lowering blood glucose in a mammal; (b) a carboxyl-terminal truncation of no more than 12 amino acid residues, wherein the polypeptide is capable of lowering blood glucose in a 4 WO 2010/129503 PCT/US2010/033478 mammal; or (c) an amino-terminal truncation of no more than 8 amino acid residues and a carboxy 1-terminal truncation of no more than 12 amino acid residues, wherein the polypeptide is capable of lowering blood glucose in a mammal. In still other embodiments the polypeptide is covalently linked to one or more polymers, such as 5 PEG.

Specific embodiments of the invention will become evident from the following more detailed description of certain embodiments and the claims.

BRIEF DESCRIPTION OF THE DRAWINGS 10 Figures 1A-1B show the results of an ELK-luciferase activity assay performed on the FGF21 truncation mutants 7-181 and 8-181 (Figure 1A) and the FGF21 truncation mutants 1-172, 1-171, 1-169, and 1-164 (Figure IB); each panel shows the results obtained for a human FGF21 control.

Figure 2 shows the results of an ELK-lucifcrasc activity assay performed on a 15 human FGF21 control and the FGF21 truncation mutants 3-181,4-181,5-181,7-181, 8-181, 1-180, 1-178, 1-177, 1-176, 1-175, 1-174, 1-173, 1-172, 9-181, and 1-149.

Figure 3 shows the blood glucose levels measured in mice injected with PBS (solid bar), human FGF21 control (open bar), or the FGF21 truncation mutants 8-181 (gray bar) and 9-181 (stippled bar). 20 Figure 4 shows the percent change in blood glucose levels measured in mice injected with PBS (solid circles), an Fc-FGF21 control (WT) (open circles), or truncated Fc-FGF21 fusion proteins comprising amino acid residues 5-181 (solid triangles) or 7-181 (open triangles).

Figure 5 shows the percent change in blood glucose levels measured in mice 25 injected with PBS (solid circles), an FGF21-Fc control (WT) (open circles), a truncated FGF21-Fc fusion protein comprising residues 1-175 (solid triangles), or a truncated Fc-FGF21 protein comprising amino acid residues 1-171 (open triangles).

Figures 6A-6D show the results of liquid chromatography-mass spcctromctiy (LC-MS) analysis of a human Fc-(G5)-FGF21 (SEQ ID NO: 107) control sample 30 (Figure 6A) and samples of Fc-(G5)-FGF21 drawn from mice at 6 hours (Sample D6; Figure 6B), 24 hours (Sample D24; Figure 6C), and 48 hours (Sample D48; Figure 6D) after injection.

Figures 7A-7D show the results if LC-MS analysis of a mammalian-derived human FGF21-(G3)-Fc (SEQ ID NO: 105) control sample (Figure 7A) and samples of 5 WO 2010/129503 PCT/US2010/033478 FGF21-(G3)-Fc drawn from mice at 6 hours (Sample £6; Figure 7B), 24 hours (Sample E24; Figure 7C), and 48 hours (Sample £48; Figure 7D) after injection.

Figures 8A-8D show the results of LC-MS analysis of an Fc-(L15)-FGF21 (SEQ ID NO:49) control sample (Figure 8A) and samples of Fc-(L15)-FGF21 drawn 5 from mice at 6 hours (Figure 8B), 24 hours (Figure 8C), and 48 hours (Figure 8D) after injection.

Figures 9A-9D show the results of LC-MS analysis of an FGF21-(L15)-Fc (SEQ ID NO:41) control sample (Figure 9A) and samples of FGF21-(L15)-Fc drawn from mice at 6 hours (Figure 9B), 24 hours (Figure 9C), and 48 hours (Figure 9D) 10 after injection.

Figures 10A-10B show the cleavage sites identified by LC-MS analysis of Fc-(L15)-FGF21 (Figure 10A, SEQ ID NO:49) and FGF21-(L15)-Fc (Figure 10B, SEQ ID NO:41) fusion proteins injected into mice.

Figure 11 shows the blood glucose levels measured in mice injected with PBS 15 (solid bar), Fc-(L15)-FGF21 (SEQ ID NO:49) (open bar), or the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21 G170E (SEQ ID NO:51) (gray bar), Fc-(L15)-FGF21 Pl71A (SEQ ID NO:53) (stippled bar), Fc-(L15)-FGF21 S172L (SEQ ID NO:55) (open diagonally crosshatchcd bar), Fc-(L15)-FGF21(G170E, P171A, S172L) (SEQ ID NO:59) (solid horizontally crosshatched bar), or Fc-(L 15)-FGF21 G151A (SEQ ID 20 NO:61) (open diagonally crosshatchcd bar).

Figure 12 shows the percent change in blood glucose levels measured in mice injected with PBS (solid circles), Fc-(L15)-FGF21 (SEQ ID NO:49) (open circles), or the Fc-(L15)-FGF2I mutants Fc-(LI5)-FGF21 G170E (SEQ ID NO:51) (solid triangles), Fc-(LI5)-FGF21 P171A (SEQ ID NO:53) (open triangles), Fc-(L15)- 25 FGF21 S172L (SEQ ID NO:55) (solid diamonds), Fc-(LI5)-FGF21(G170E, P171A, S172L) (SEQ ID NO:59) (open diamonds), or Fc-(L15)-FGF21 G151A (SEQ ID NO:61) (solid squares).

Figure 13 shows the blood glucose levels measured in mice injected with PBS (solid bar), Fc-(L15)-FGF21 (SEQ ID NO:49) (open bar), or the Fc-(L15)-FGF21 30 mutants Fc-(L15)-FGF21(P150A, G151A, 1152V) (gray bar), Fc-(L15)-FGF21 G170E (SEQ ID NO:51) (open diagonally crosshatchcd bar), Fc-(L15)-FGF21(G170E, P171A) (SEQ ID NO:63) (gray diagonally crosshatched bar), or Fc-(L15)-FGF21(G170E, S172L) (SEQ ID NO:67) (open diagonally crosshatched bar).

Figure 14 shows the percent change in blood glucose levels measured in mice 6 WO 2010/129503 PCT/US2010/033478 injected with PBS (solid squares), Fc-(L15)-FGF2l (SEQ ID NO:49) (open squares), or the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21(P150A, G151A, 1152V) (SEQ ID NO:65) (solid inverted triangles), Fc-(L15)-FGF21 G170E (SEQ ID NO:51) (open inverted triangles), Fc-(L15)-FGF21(G170E, P171 A) (SEQ ID NO:63) (solid circles), 5 or Fc-(L15)-FGF21(G170E, S172L) (SEQ ID NO:67) (open circles).

Figure 15 shows the blood glucose levels measured in mice injected with PBS

(solid bar) or the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21 G170E (SEQ ID NO:51) (open bar), Fc-(L15)-FGF21 G170A (SEQ ID NO:69) (gray bar), Fc-(L15)-FGF2l G170C (SEQ ID NO:71) (open crosshatchcd bar), Fc-(LI5)-FGF21 G170D (SEQ ID 10 NO:73) (gray and white bar), Fc-(L15)-FGF21 G170N (SEQ ID NO:75) (solid crosshatchcd bar), or Fc-(L15)-FGF2i G170S (SEQ ID NO:77) (open crosshatchcd bar).

Figure 16 shows the percent change in blood glucose levels measured in mice injected with PBS (solid circles) or the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21 15 G170E (SEQ ID NO:51) (open circles), Fc-(L15)-FGF21 G170A (SEQ ID NO:69) (solid triangles), Fc-(L15)-FGF21 G170C (SEQ ID NO:71) (open triangles), Fc-(L15)-FGF21 G170D (SEQ ID NO:73) (solid diamonds), Fc-(LI5)-FGF21 G170N (SEQ ID NO:75) (open diamonds), or Fc-(L15)-FGF2I G170S (SEQ ID NO:77) (inverted solid triangles).

20 Figure 17 shows the blood glucose levels measured in mice injected with PBS (solid bar) or the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21 G170E (SEQ ID NO:51) (open bar), Fc-(L15)-FGF21 P171E (SEQ ID NO:79) (gray bar), Fc-(L15)-FGF21 P171H (SEQ ID NO:81) (solid crosshatchcd bar), Fc-(L15)-FGF21 P171Q (SEQ LD NO:83) (open crosshatchcd bar), Fc-(L15)-FGF21 P171T (SEQ ID NO:85) (stippled 25 bar), or Fc-(L15)-FGF2l P171Y (SEQ ID NO:87) (gray crosshatchcd bar).

Figure 18 shows the percent change in blood glucose levels measured in mice injected with PBS (solid circles) or the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21 G170E (SEQ ID NO:51) (open circles), Fc-(L15)-FGF21 P171E (SEQ ID NO:79) (solid triangles), Fc-(L15)-FGF21 P171H (SEQ ID NO:81) (open triangles), Fc-

30 (L15)-FGF21 P171Q (SEQ ID NO:83) (solid diamonds), Fc-(L15)-FGF21 P171T (SEQ ID NO:85) (open diamonds), or Fc-(LI5)-FGF21 P171Y (SEQ ID NO:87) (solid squares).

Figures 19A-19D show the results of LC-MS analysis of an Fc-(L15)-FGF21 control sample (Figure 19A, SEQ ID NO:49) and samples drawn from mice at time 6 7 WO 2010/129503 PCT/US2010/033478 hours (Figure 19B), 24 hours (Figure 19C), and 48 hours (Figure 19D) after injection. Figures 20A-20D show the results of LC-MS analysis of an Fc-(L15)-FGF21 G170E control sample (Figure 20A, SEQ 1DNO:51) and samples of Fc-(L15)-FGF21 G170E drawn from mice at 6 hours (Figure 20B), 24 hours (Figure 20C), and 48 5 hours (Figure 20D) after injection.

Figures 21A-21D show the results of LC-MS analysis of an Fc-(L15)~FGF21 P171A control sample (Figure 21A, SEQ ID NO:53) and samples of Fc-(L15)-FGF21 P171A drawn from mice at 6 hours (Figure 2IB), 24 (Figure 21C), and 48 hours (Figure 2ID) after injection. 10 Figures 22A-22D show the results of LC-MS analysis of an Fc-(L15)-FGF21 S172L control sample (Figure 22A, SEQ ID NO:55) and samples of Fc-(L15)-FGF21 S172L drawn from mice at 6 hours (Figure 22B), 24 hours (Figure 22C), and 48 hours (Figure 22D) after injection.

Figures 23A-23D show the cleavage sites identified by LC-MS analysis of Fc- 15 (LI5)-FGF2I (Figure 23A, SEQ ID NO:49), Fc-(L15)-FGF21 G170E (Figure 23B, SEQ ID NO:5l), Fc-(L15)-FGF21 P171A (Figure 23C, SEQ ID NO:53), and Fc-(L15)-FGF21 S172L (Figure 23D, SEQ ID NO:55) fusion proteins injected in mice.

Figures 24A-24C show the results of an ELK-lucifcrasc activity assay performed on the FGF21 mutants FGF21 L99R (SEQ ID NO: 109), FGF21 L99D 20 (SEQ ID NO:111), and FGF21 A111T (SEQ ID NO: 113) (Figure 24A); the FGF21 mutants FGF21 A129D (SEQ ID NO: 115), FGF21 A129Q (SEQ ID NO: 117), and FGF21 A134K (SEQ ID NO: II9) (Figure 24B); and the FGF21 mutants FGF21 A134Y(SEQ ID NO: 121), FGF21 A134E (SEQ ID NO: 123), and FGF21 A129K (SEQ ID NO: 125) (Figure 24C); each panel shows the results obtained for a human 25 FGF21 control.

Figures 25A-25D show the results of an ELK-luciferasc activity assay performed on the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21 P171G (SEQ ID NO:89), Fc-(L15)-FGF21 P171S (SEQ ID NO:91), and Fc-(L15)-FGF21 P171T (SEQ ID NO:85) (Figure 25A); the Fc-(L15)-FGF21 mutants Fc-(L15)-FCF21 P171Y 30 (SEQ ID NO:87), Fc-(L15)-FGF2I P171W (SEQ ID NO:93), and Fc-(L15)-FGF21 P171C (SEQ ID NO:95) (Figure 25B); Fc-(L15)-FGF21 (SEQ ID NO:49), Fc-(L15)-FGF21 (A45K, G170E) (SEQ IDNO:97), and FGF21 A45K (SEQ ID NO:99) (Figure 25C); and Fc-(L15)-FGF21 (SEQ ID NO:49), Fc-(LI5)-FGF21 P171E (SEQ ID NO:79), and Fc-(L15)-FGF21 (A45K, G170E) (SEQ ID NO:97) (Figure 25D); each 8 WO 2010/129503 PCT/US2010/033478 panel shows the results obtained for a human FGF21 control.

Figures 26A-B show the aggregation as a function of time for wild type mature FGF21 and various FGF21 mutants; Figure 26A shows the change in percent aggregation for an FGF21 control (WT, solid diamonds) and FGF21 A45K (solid

5 circles) following incubation of 65 mg/mL protein at 4°C for 1, 2, and 4 days, while Figure 26B shows the change in percent aggregation for an FGF21 control (WT) (SEQ ID NO:4) and FGF21 P78C (SEQ ID NO: 127), FGF21 P78R (SEQ ID NO: 129), FGF21 L86T (SEQ 1DNO:131), FGF21 L86C (SEQ ID NO: 133), FGF21 L98C (SEQ ID NO:135), FGF21 L98R (SEQ ID NO: 137), FGF21 All IT (SEQ ID 10 NO: 113), FGF21 A129D (SEQ ID NO: 115), FGF21 A129Q (SEQ ID NO: 117), FGF21 A129K (SEQ ID NO: 125), FGF21 A134K (SEQ ID NO: 119), FGF21 A134Y (SEQ ID NO:121), and FGF21 A134E (SEQ ID NO:123) (ail labeled on the plot) following incubation of 65 mg/mL protein at 4"C for 1, 6, and 10 days.

Figure 27 shows the results of an ELK-luciferasc activity assay performed on 15 a human FGF21 control and the FGF21 mutants FGF2I A45K (SEQ ID NO:99), FGF21 L52T (SEQ ID NO: 139), and FGF21 L58E (SEQ ID NO:141).

Figure 28A is a plot showing the change in aggregation levels for the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21(6-181, G170E) (SEQ ID NO:101) (solid diamonds), Fc-(L15)-FGF2l (A45K, G170E) (SEQ ID NO:97) (open squares), Fc-

20 (L15)-FGF21 P171E (SEQ ID NO:79) (solid triangles), Fc-(L15)-FGF21 P171A (SEQ ID NO:53) (crosses), Fc-(L15)-FGF2l G170E (SEQ ID NO:51) (open triangles), and an FGF21 control (solid circles) following incubation at 4°C for 1, 4, and 8 days, and Figure 28B is a bar graph also showing the results of the incubation.

Figure 29 shows the blood glucose levels measured in mice injected with PBS 25 (vehicle) (solid circles) or the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21(A45K., G170E) (SEQ ID NO:97) (open circles), Fc-(L15)-FGF21 (A45K, P171G) (SEQ ID NO:103) (solid triangles), or Fc-(L15)~FGF21 (L98R, P171G) (SEQ ID NO:43) (open triangles).

Figure 30 is a plot showing the results of an ELK-luciferasc activity assay 30 performed on human FGF21 (solid circles, solid line), Fc-(L15)- FGF21 (SEQ ID NO:49) (open circles, solid line) and Fc-(L15) FGF21 (L98R, P171G) (SEQ ID NO:43) (solid triangles, dotted line).

Figure 31 is a plot showing the percent high molecular weight aggregates observed after nine days at room temperature (Figure 31 A) and at 4°C (Figure 3IB) 9 WO 2010/129503 PCT/US2010/033478 for FGF21 (SEQ ID NO:4) (solid circles, solid line), Fc-(L15)-FGF21 (SEQ ID NO:49) (open circle, solid line) and Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) (solid triangles, dotted line).

Figure 32 is a series of MALDI mass spectrometry traces showing observed 5 changes in Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) at various points over a 168 hour time period.

Figure 33 is a plot showing the percent change in blood glucose levels in ob/ob mice for each of a PBS vehicle control (open circles), wild-type mature FGF21 (solid squares), and the FGF21 mutants Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID

10 NO:43) (inverted solid triangles); Fc-(L15)-FGF21 (L98R, P171G, 182P) (SEQ ID NO:143) (open diamonds), and Fc-(L15)-FGF21 (L98R, P171G, 182G) (SEQ ID NO: 145) (solid circles).

Figure 34 is a plot showing the percent change in blood glucose levels in ob/ob mice for each of a PBS vehicle control (solid circles), and the FGF21 mutants 15 Fc-(L15)-FGF21 (L98R, P171G)(SEQ ID NO:43) (solid triangles); Fc-(L15)-FGF21 (L98R, P171G, 182G, 183G) (SEQ ID NO:147) (open triangles), Fc-(L15)-FGF21 (L98R, P171G, I82G) (SEQ ID NO:145) (solid diamonds) and Fc-(L15)-FGF21 (L98R, P171G, 182P) (SEQ ID NO:143) (open diamonds).

Figure 35 is a plot showing the percent change in blood glucose levels in 20 ob/ob mice for each of a PBS vehicle control (open circles), and the FGF21 mutants Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) (solid squares); Fc-(L15)-FGF21 (L98R, P171G, Y179S) (SEQ ID NO:149) (open triangles), Fc-(L15)-FGF21 (L98R, P171G, Y179A) (SEQ ID NO:153) (inverted solid triangles), Fc-(L15)-FGF21 (L98R, P171G, A180S) (SEQ ID NO:155) (open diamonds) and Fc-(L15)-FGF21 25 (L98R, P171G, A180G) (SEQ ID NO:157) (solid circles).

Figure 36 is a plot showing the percent change in blood glucose levels in ob/ob mice for each of a PBS vehicle control (solid circles), and the FGF21 mutants Fc-(L15)-FGF21(L98R, P171G) (SEQ ID NO:43) (open squares); Fc-(L15)-FGF21 (L98R, P171G, Y179F) (SEQ ID NO:151) (solid triangles), and Fc-(LI5)-FGF21 3 0 (L98R, P171G, A180E) (SEQ ID NO:57) (open diamonds).

Figure 37 is a diagram graphically depicting the study design for a six-week dose escalation study performed in Rhesus monkeys. In the figure, shaded symbols indicate blood draws in the fasted state and stippled symbols indicated blood draws in the fed state. 10 WO 2010/129503 PCT/US2010/033478

Figures 38A-D is a scries of plots depicting how the rhesus monkeys were randomized on OGTT profiles, OGTT AUCs and body weight; Figure 38A depicts baseline glucose levels in OGTT1, solid square corresponds to group A, solid circle, solid line corresponds to group B and open circle, dashed line corresponds to group C 5 before compounds or vehicle were assigned to each group; Figure 38B depicts baseline glucose levels in OGTT2, solid square corresponds to group A, solid circle, solid line corresponds to group B and open circle, solid line corresponds to group C before compounds or vehicle were assigned to each group; Figure 38C shows baseline glucose levels for OGTTs 1 and 2 shown in terms of AUC, the stippled bar 10 corresponds to group A, the shaded bar corresponds to group B and the open bar corresponds to group C; and Figure 38D shows baseline body weight, the stippled bar corresponds to group A, the shaded bar corresponds to group B and the open bar corresponds to group C.

Figure 39 is a plot showing the percent change in body weight relative to 15 baseline of vehicle, FGF21 (SEQ ID NO:4) and Fc-(L15)-FGF21(L98R, P171G) (SEQ ID NO:43) in Rhesus monkeys; shaded bars 1 and 2 correspond to weeks 1 and 2 at the low dose, open bars 3 and 4 correspond to weeks 3 and 4 at the mid dose, solid bars 5 and 6 correspond to weeks 5 and 6 at the high dose and stippled bars 7, 8 and 9 correspond to weeks 7-9 during the washout period. 20 Figure 40 is a plot showing the percent change in fasted insulin relative to baseline of vehicle, FGF21 (SEQ ID NO:4) and Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) on fasted insulin levels in Rhesus monkeys; shaded bars 1 and 2 correspond to weeks 1 and 2 at the low dose, open bars 3 and 4 correspond to weeks 3 and 4 at the mid dose, solid bars 5 and 6 correspond to weeks 5 and 6 at the high dose 2 5 and stippled bars 7 and 8 correspond to weeks 7 and 8 during the washout period.

Figure 41 is a plot showing the effects of vehicle, FGF21 (SEQ ID NO:4) and Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43), given at the high dose, on fed insulin levels of Rhesus monkeys acquired during weeks 5 and 6 of the study; solid bars correspond to week 5 and shaded bars correspond to week 6. 3 0 Figure 42 is a plot showing the glucose profiles of OGTT5 performed at the end of the two week high-dose treatment with Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43); solid circle, solid line corresponds to vehicle, open square, dotted line corresponds to FGF2I and solid triangle, solid line corresponds to Fc-(L15)-FGF21 (L98R, P171G) (SEQ IDNO:43). 11 WO 2010/129503 PCT/US2010/033478

Figure 43 is a plot showing the insulin profiles of OGTTS performed at the end of the two week high-dose treatment with Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43); solid circle, solid line corresponds to vehicle, open square, dotted line corresponds to FGF21 and solid triangle, solid line corresponds to Fc-(L15)-FGF21 5 (L98R, P171G) (SEQ IDNO:43).

Figure 44 is a plot showing the percent change from baseline of glucose OGTT AUC3-5 determined at the end of each dose period (low, mid and high dose) of the Rhesus monkeys; open bars correspond to AUC3 calculated from glucose measurements during OGTT3, solid bars correspond to AUC4 calculated from 10 glucose measurements during OGTT4 and shaded bars correspond to AUC5 calculated from glucose measurements during OGTT5.

Figure 45 is a graph showing the effects of vehicle, FGF21 and Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) on percent change from baseline of the fasted plasma triglyceride levels from each group of Rhesus monkeys; shaded bars I 15 and 2 correspond to weeks 1 and 2 at the low dose, open bars 3 and 4 correspond to weeks 3 and 4 at the mid dose, solid bars 5 and 6 correspond to weeks 5 and 6 at the high dose and stippled bars 7, 8 and 9 correspond to weeks 7-9 during the washout period..

Figure 46 is a graph showing fed plasma triglyceride levels from each group 20 of the Rhesus monkeys; as measured during the fifth and sixth weeks of treatment with vehicle, FGF21 or Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) at the high dose; shaded bars correspond to week 5 and solid bars correspond to week 6.

Figure 47 is a plot showing human FGF21 levels in individual monkeys measured at pre-dose, and 5, 12, 19, and 26 days, with samples acquired at 25 approximately 21 hours after each injection.

Figure 48 is a plot showing individual monkey Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) levels measured at pre-dose, and 5, 12, 19, and 26 days, with samples acquired approximately 5 days after each injection.

Figure 49 is a plot showing mean concentrations of FGF21 and Fc-(L15)- 30 FGF21 (L98R, P171G) (SEQ ID NO:43) levels measured from the three OGTTs performed following each of the low, mid and high doses; shaded bars correspond to OGTT3 at the low dose, solid bars correspond to OGTT4 at the mid dose and open bars correspond to OGTT5 at the high dose.

Figure 50 is the amino acid sequence of the Fc-(G4S)3-FGF21 (L98R, P171G, 12 WO 2010/129503 PCT/US2010/033478 A180E) fusion protein (SEQ ID NO:47); IgGl Fc residues (SEQ ID NO: 11) are in bold, the (G4S)3 linker (SEQ ID NO:31) is in italics and the point mutations in the FGF21 sequence (SEQ ID NO:39) are in bold and underlined.

Figure 51 is a plot showing the dose-response of the tested compounds in Erk-5 luciferase assays; Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47), Fc-(L15)-FGF21 (L98R, P171G, A180E) (SEQ IDNO:57), wild-type FGF21, and an Fc fusion with wild-type FGF21 were tested.

Figure 52 is a plot showing the results from a Biacore solution equilibrium binding assay of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) and Fc- 10 (L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) to human (right) and cyno β-Klotho (left).

Figure 53 is a pair of plots showing the dose response of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) in db/db mice after a single injection; Figure 53A shows the blood glucose levels in db/db mice at various time points 15 following vehicle or Fc-(G4S)3-FGF21 (L98R, P171G, A180E) injection, while Figure 53B shows the effect of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) on body weight after a single injection into db/db mice.

Figure 54 is a schematic graphically presenting a dose frequency study of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) and Fc-(L15)-FGF21 20 (L98R, P171G) (SEQ 1DNO:43) in DIO mice.

Figure 55 is a plot showing the GTT profiles of mice treated with vehicle, Fc- (G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) or Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) at different dosing frequencies.

Figure 56 is a plot showing change of body weight from baseline (day 0) in 25 mice treated vehicle, Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) or Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) at different dosing frequencies.

Figure 57 is a plot showing the results of an in vitro study of hydrogels comprising the FGF21 (L98R, P171G)) (SEQ ID NO:37) FGF21 mutant.

Figure 58 is a plot showing the effect on blood glucose level of 8 week old 3 0 db/db mice dosed with various hydrogel formulations.

Figure 59 is a plot showing the effect on blood glucose level of 8 week old db/db mice dosed with various hydrogel formulations.

Figure 60 is a plot showing the effect on the blood glucose level of 8 week old 13 WO 2010/129503 PCT/US2010/033478 db/B6 mice dosed with various hydrogel formulations; solid circles represent a mice dosed with a hydrogel control, solid squares represent mice dosed with FGF21 (L98R, P171G) (SEQ ID NO:37) in a hydrogel at 10 mg/kg, solid triangles represent mice dosed with FGF21 (L98R, P171G) in a hydrogel at 30 mg/kg, and inverted triangles 5 represent mice dosed with Fc-(L15)-FGF21 (L98R, P171G, A180E) (SEQ ID NO:57) alone.

Figure 61 is a plot showing the percent change in blood glucose level of 8 week old db/B6 mice dosed with various hydrogel formulations; solid circles represent a mice dosed with a hydrogel control, solid squares represent mice dosed 10 with FGF21 (L98R, P171G) (SEQ ID NO:37) in a hydrogel at 10 mg/kg, solid triangles represent mice dosed with FGF21 (L98R, P171G) in a hydrogel at 30 mg/kg, and inverted triangles represent mice dosed with Fc-(L15)-FGF21 (L98R, P171G, A180E) (SEQ ID NO:57) alone.

Figure 62 is a plot showing the effect on body weight of 8 week old db/B6

15 mice dosed with various hydrogel formulations; solid circles represent a mice dosed with a hydrogel control, solid squares represent mice dosed with FGF21 (L98R, PI71G) (SEQ ID NO:37) in a hydrogel at 10 mg/kg, solid triangles represent mice dosed with FGF21 (L98R, P171G) in a hydrogel at 30 mg/kg, and inverted triangles represent mice dosed with Fc-(L15)-FGF21 (L98R, P171G, A180E) (SEQ ID 20 NO:57) alone.

Figure 63 is a plot showing the percent change in weight of 8 week old db/B6 mice dosed with various hydrogel formulations; solid circles represent a mice dosed with a hydrogel control, solid squares represent mice dosed with FGF2I (L98R, P171G) (SEQ ID NO:37) in a hydrogel at 10 mg/kg, solid triangles represent mice 25 dosed with FGF21 (L98R, P171G) in a hydrogel at 30 mg/kg, and inverted triangles represent mice dosed with Fc-(L15)-FGF21 (L98R, P171G, A180E) (SEQ ID NO:57) alone.

Figure 64 is a diagram graphically depicting the study design for a nine-week dose escalation study performed in cynomolgus monkeys with impaired glucose 3 0 tolerance (IGT).

Figure 65 is a plot depicting the effects of vehicle, Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) on AM meal food intake of the IGT cynomolgus monkeys studied.

Figure 66 is a plot depicting the effects of vehicle, Fc-(L15)-FGF21 (L98R, 14 WO 201(1/129503 PCT/US2010/033478 P171G) (SEQ ID NO:43) and Fc-(C4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO :4 7) on fruit intake of the I GT cynomolgus monkeys studied.

Figure 67 is a plot depicting the effects of vehicle, Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID 5 NO :4 7) on PM meal food intake of the I GT cynomolgus monkeys studied.

Figure 68 is a plot depicting the effects of vehicle, Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) on body weight of the IGT cynomolgus monkeys studied.

Figure 69 is a plot showing the effects of vehicle, Fc-(L15)-FGF21 (L98R,

10 P171G) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) on body mass index of the IGT cynomolgus monkeys studied.

Figure 70 is a plot showing the effects of vehicle, Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) on skin fold thickness of the IGT cynomolgus monkeys studied. 15 Figure 71 is a plot showing the effects of vehicle, Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) on abdominal circumference of the IGT cynomolgus monkeys studied.

Figure 72 is a plot showing the effects of vehicle, Fc-(L15)-FGF21 (L98R, P17IG) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID 2 0 NO:47) on plasma glucose levels of the IGT cynomolgus monkeys studied.

Figure 73 is a plot showing the effects of vehicle, Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) on glucose tolerance of the IGT cynomolgus monkeys studied.

Figure 74 is a plot showing the effects of vehicle, Fc-(L15)-FGF21 (L98R,

25 P171G) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) on plasma triglyceride levels of the IGT cynomolgus monkeys studied.

Figure 75 is a plot showing the effects of vehicle, Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, AI80E) (SEQ ID NO:47) on plasma total cholesterol levels of the IGT cynomolgus monkeys studied. 30 Figure 76 is a plot showing the effects of vehicle, Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (SEQ ID NO:47) on plasma HDL-cholcstcrol levels of the IGT cynomolgus monkeys studied.

Figure 77 is a scries of MALDI mass spectrometry traces showing observed changes in Fc-(L15)-FGF21 (L98R, P17IG) (left panel, SEQ ID NO:43) and Fc- 15 215,937/2 (L15)-FGF21 (L98R, P171G, A180E) (right panel, SEQ ID NO:57) at various points over a 168 hour time period.

Figure 78 is a plot showing the relative abundance (%) of full-length C-terminal peptide over the total C-terminal peptide fragments derived from both Fc-(L15)-FGF21 (L98R, P171G) and Fc-(L15)-FGF21 (L98R, P171G, A180E) as analyzed by MRM LC/MS/MS following Asp-N digestion.

Figure 79 is a plot showing the results of an ELISA assay for the plasma concentration of intact full-length Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) and Fc-(L15)-FGF21 (L98R, P171G, A180E) (SEQ ID NO :5 7) over a period of 240 hours following intravenous injection in mice.

Figure 80 is a plot showing the results of an ELK-luciferase activity assay performed on a negative control, human FGF21 (SEQ ID NO:4) and the FGF21 glycosylation mutants FGF21 (Y179N, S181T) (SEQ ID NO: 161), FGF21 Y179N (SEQ ID NO: 163) and FGF21 P124S (SEQ ID NO: 165).

DETAILED DESCRIPTION OF THE INVENTION A human FGF21 protein having enhanced properties such as an increased half-life and/or decreased aggregation can be prepared using the methods disclosed herein and standard molecular biology methods. Optionally, the half-life can be further extended by fusing an antibody, or portion thereof, to the N-terminal or C-terminal end of the wild-type FGF21 sequence. It is also possible to further extend the half-life or decrease aggregation of the wild-type FGF21 protein by introducing amino acid substitutions into the protein. Such modified proteins are referred to herein as mutants, or FGF21 mutants, and form embodiments of the present invention.

Recombinant nucleic acid methods used herein, including in the Examples, are generally those set forth in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989) or Current Protocols in Molecular Biology (Ausubel et al., eds., Green Publishers Inc. and Wiley and Sons 1994). L_General Definitions

The term “isolated nucleic acid molecule” refers to a nucleic acid molecule provided herein that (1) has been separated from at least about 50 percent of proteins, 16 WO 2010/129503 PCT/US2010/033478 lipids, carbohydrates, or other materials with which it is naturally found when total nucleic acid is isolated from the source cells, (2) is not linked to all or a portion of a polynucleotide to which the “isolated nucleic acid molecule” is linked in nature, (3) is operably linked to a polynucleotide which it is not linked to in nature, or (4) docs not 5 occur in nature as part of a larger polynucleotide sequence. Preferably, an isolated nucleic acid molecule is substantially free from any other contaminating nucleic acid molecules or other contaminants that arc found in its natural environment that would interfere with its use in polypeptide production or its therapeutic, diagnostic, prophylactic or research use. 10 The term “vector” is used to refer to any molecule (e.g., nucleic acid, plasmid, or virus) used to transfer coding information to a host cell.

The term “expression vector” refers to a vector that is suitable for transformation of a host cell and contains nucleic acid sequences that direct and/or control the expression of inserted heterologous nucleic acid sequences. Expression 15 includes, but is not limited to, processes such as transcription, translation, and RNA splicing, if introns arc present.

The term “operably linked” is used herein to refer to an arrangement of flanking sequences wherein the flanking sequences so described are configured or assembled so as to perform their usual function. Thus, a flanking sequence operably 20 linked to a coding sequence may be capable of effecting the replication, transcription and/or translation of the coding sequence. For example, a coding sequence is operably linked to a promoter when the promoter is capable of directing transcription of that coding sequence. A flanking sequence need not be contiguous with the coding sequence, so long as it functions correctly. Thus, for example, intervening 25 untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered “operably linked” to the coding sequence.

The term “host cell” is used to refer to a cell which has been transformed, or is capable of being transformed with a nucleic acid sequence, such as a nucleic acid 30 provided herein, and then of expressing a selected gene of interest. The term includes the progeny of the parent cell, whether or not the progeny is identical in morphology or in genetic make-up to the original parent, so long as the selected gene is present.

The term “isolated polypeptide” refers to a polypeptide provided herein that (1) has been separated from at least about 50 percent of polynucleotides, lipids, 17 WO 2010/129503 PCT/US2010/033478 carbohydrates, or other materials with which it is naturally found when isolated from the source cell, (2) is not linked (by covalent or noncovalcnt interaction) to all or a portion of a polypeptide to which the “isolated polypeptide” is linked in nature, (3) is operably linked (by covalent or noncovalcnt interaction) to a polypeptide with which 5 it is not linked in nature, or (4) does not occur in nature. Preferably, the isolated polypeptide is substantially free from any other contaminating polypeptides or other contaminants that are found in its natural environment that would interfere with its therapeutic, diagnostic, prophylactic or research use.

The term “naturally occurring” when used in connection with biological 10 materials such as nucleic acid molecules, polypeptides, host cells, and the like, refers to materials which arc found in nature and arc not manipulated by man. Similarly, “non-naturally occurring” as used herein refers to a material that is not found in nature or that has been structurally modified or synthesized by man. When used in connection with nucleotides, the term “naturally occurring” refers to the bases adenine 15 (A), cytosine (C), guanine (G), thymine (T), and uracil (U). When used in connection with amino acids, the term “naturally occurring” refers to the 20 amino acids alanine (A), cysteine (C), aspartic acid (D), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isolcucinc (1), lysine (R), leucine (L), methionine (M), asparagine (N), proline (P), glutamine (Q), arginine (R), serine (S), threonine (T), valine (V), 20 tryptophan (W), and tyrosine (Y).

The term “FGF21 polypeptide” refers to a naturally-occurring wild-type polypeptide expressed in humans. For purposes of this disclosure, the term “FGF21 polypeptide” can be used interchangeably to refer to any full-length FGF21 polypeptide, e.g., SEQ ID NOs:2 and 6, which consist of 209 amino acid residues and 25 which arc encoded by the nucleotide sequences of SEQ ID NOs:l and 5, respectively; any mature form of the polypeptide, e.g., SEQ ID NOs:4 and 8, which consist of 181 amino acid residues and which arc encoded by the nucleotide sequences of SEQ ID NOs:3 and 7, respectively, and in which the 28 amino acid residues at the amino-terminal end of the full-length FGF21 polypeptide (/. c., which constitute the signal 3 0 peptide) have been removed. Full-length and mature FGF21 polypeptides can but need not comprise an amino-terminal methionine, which may be introduced by engineering or as a result of a bacterial expression process.

The terms “FGF21 polypeptide mutant” and “FGF21 mutant” can be used interchangeably and refer to an FGF21 polypeptide in which a naturally occurring 18 WO 2010/129503 PCT/US2010/033478 FGF21 amino acid sequence (e.g., SEQ ID N0s:2, 4, 6, or 8) has been modified. Such modifications include, but arc not limited to, one or more amino acid substitutions, including substitutions with non-naturally occurring amino acids and non-natural ly-occu rr in g amino acid analogs, and truncations. Thus, FGF21 5 polypeptide mutants include, but arc not limited to, site-directed FGF21 mutants, truncated FGF21 polypeptides, proteolysis-resistant FGF21 mutants, aggregation-reducing FGF21 mutants, FGF21 combination mutants, and FGF21 fusion proteins, as described herein. For the purpose of identifying the specific truncations and amino acid substitutions of the FGF21 mutants of the present invention, the numbering of the 10 amino acid residues truncated or mutated corresponds to that of the mature 181-rcsiduc FGF21 polypeptide. FGF21 mutants can but need not comprise an aminoterminal methionine, which may be introduced by engineering or as a result of a bacterial expression process. In other embodiments of the present invention, an FGF21 polypeptide mutant comprises an amino acid sequence that is at least about 85 15 percent identical to the mutant FGF2Ts amino acid sequence, but wherein specific residues conferring a desirable property to the FGF21 polypeptide mutant, e.g., proteolysis-resistance, increased half life or aggregation-reducing properties and combinations thereof, have not been further modified. In other words, with the exception of residues in the FGF21 mutant sequence that have been modified in order 20 to confer proteolysis-resistance, aggregation-reducing, or other properties, about 15 percent of all other amino acid residues in the FGF21 mutant sequence can be modified. For example, in the FGF21 mutant Q173E, up to 15 percent of all amino acid residues other than the glutamic acid residue, which was substituted for glutamine at position 173, could be modified. In still other embodiments, an FGF21 25 polypeptide mutant comprises an amino acid sequence that is at least about 90 percent, or about 95, 96, 97, 98, or 99 percent identical to the mutant FGF21’s amino acid sequence, but wherein the specific residues conferring the FGF21 polypeptide mutant's proteolysis-resistance or aggregation-reducing properties have not been further modified. Such FGF21 polypeptide mutants possess at least one activity of the 3 0 wild-type FGF21 polypeptide.

The present invention also encompasses a nucleic acid molecule encoding an FGF21 polypeptide mutant comprising an amino acid sequence that is at least about 85 percent identical to the mutant FGF21 ’s amino acid sequence but wherein specific residues conferring a desirable property to the FGF21 polypeptide mutant, e.g., 19 WO 2010/129503 PCT/US2010/033478 protcolysis-rcsistancc, increased half life or aggregation-reducing properties and combinations thereof have not been further modified.

In other words, with the exception of residues in the FGF21 mutant sequence that have been modified in order to confer proteolysis-resistance, aggregation- 5 reducing, or other properties, about 15 percent of all other amino acid residues in the FGF21 mutant sequence can be modified. For example, in the FGF21 mutant Q173E, up to 15 percent of all amino acid residues other than the glutamic acid residue, which was substituted for glutamine at position 173, could be modified. The present invention further encompasses a nucleic acid molecule comprising a nucleotide 10 sequence that is at least about 90 percent, or about 95, 96, 97, 98, or 99 percent identical to the nucleotide sequence encoding an FGF21 mutanl, but wherein the nucleotides encoding amino acid residues conferring the encoded FGF21 polypeptide mutant's proteolysis-resistance or aggregation-reducing properties have not been further modified. Such nucleic acid molecules encode FGF21 mutant polypeptides 15 possessing at least one activity of the wild-type FGF21 polypeptide.

The term “biologically active FGF21 polypeptide mutant” refers to any FGF21 polypeptide mutant described herein that possesses an activity of the wild-type FGF21 polypeptide, such as the ability to lower blood glucose, insulin, triglyceride, or cholesterol; reduce body weight; and improve glucose tolerance, energy expenditure, 20 or insulin sensitivity, regardless of the type or number of modifications that have been introduced into the FGF21 polypeptide mutant. FGF21 polypeptide mutants possessing a somewhat decreased level of FGF21 activity relative to the wild-type FGF21 polypeptide can nonetheless be considered to be biologically active FGF21 polypeptide mutants. 25 The terms “effective amount” and “therapeutically effective amount” each refer to the amount of an FGF21 polypeptide mutant used to support an observable level of one or more biological activities of the wild-type FGF21 polypeptide, such as the ability to lower blood glucose, insulin, triglyceride, or cholesterol levels; reduce body weight; or improve glucose tolerance, energy expenditure, or insulin sensitivity. 30 The term “pharmaceutically acceptable carrier” or “physiologically acceptable carrier” as used herein refers to one or more formulation agents suitable for accomplishing or enhancing the delivery of an FGF21 polypeptide mutant into the body of a human or non-human subject. The term includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and 20 WO 2010/129503 PCT/US2010/033478 absorption delaying agents, and the like that arc physiologically compatible. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. In some eases, it will be preferable to include isotonic agents, 5 for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in a pharmaceutical composition. Pharmaceutically acceptable substances such as wetting or minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the FGF21 polypeptide mutant can also act as, or form a component of, a carrier. 10 The term “antigen” refers to a molecule or a portion of a molecule that is capable of being bound by an antibody, and additionally that is capable of being used in an animal to produce antibodies that are capable of binding to an epitope of that antigen. An antigen may have one or more epitopes.

The term “native Fc” refers to molecule or sequence comprising the sequence 15 of a non-antigen-binding fragment resulting from digestion of whole antibody or produced by other means, whether in monomeric or multimcric form, and can contain the hinge region. The original immunoglobulin source of the native Fc is preferably, but not necessarily, of human origin and can be any of the immunoglobulins, although IgG 1 and IgG2 are preferred. IgG4 can also be employed. Native Fc molecules are 20 made up of monomeric polypeptides that can be linked into dimeric or multimcric forms by covalent (i.e., disulfide bonds) and non-covalent association. The number of intcrmolecular disulfide bonds between monomeric subunits of native Fc molecules ranges from 1 to 4 depending on class (e.g., IgG, IgA, and IgE) or subclass (e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgGA2). One example of a native Fc is a 25 disulfide-bonded dimer resulting from papain digestion of an IgG (see Ellison et al., 1982, Nucleic Acids Res. 10: 4071-9). The term “native Fc” as used herein is generic to the monomeric, dimeric, and multimcric forms. An example of an Fc polypeptide sequence is presented in SEQ ID NO:II, which is derived from a human IgGl molecule. A native Fc can, but need not, comprise an amino-terminal methionine, 30 which may be introduced by engineering or as a result of a bacterial expression process; such Fc molecules are still considered to be “native Fc” molecules.

The term “Fc variant” refers to a molecule or sequence that is modified from a native Fc but stilt comprises a binding site for the salvage receptor, FeRn (neonatal Fc receptor). International Publication Nos. WO 97/34631 and WO 96/32478 describe 21 215,937/2 exemplary Fc variants, as well as interaction with the salvage receptor. |-1 - Thus, the term “Fc variant” can comprise a molecule or sequence that is humanized from a non-human native Fc. Furthermore, a native Fc comprises regions that can be removed because they provide structural features or biological activity that are not required for the fusion molecules of the FGF21 mutants of the present invention. Thus, the term “Fc variant” comprises a molecule or sequence that lacks one or more native Fc sites or residues, or in which one or more Fc sites or residues has be modified, that affect or are involved in: (1) disulfide bond formation, (2) incompatibility with a selected host cell, (3) N-terminal heterogeneity upon expression in a selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to an Fc receptor other than a salvage receptor, or (7) antibody-dependent cellular cytotoxicity (ADCC). Fc variants are described in further detail hereinafter. An Fc variant can, but need not, comprise an aminoterminal methionine, which may be introduced by engineering or as a result of a bacterial expression process; such Fc molecules are still considered to be “Fc variants.”

The term “Fc domain” encompasses native Fc and Fc variants and sequences as defined above. As with Fc variants and native Fc molecules, the term “Fc domain” includes molecules in monomeric or multimeric form, whether digested from whole antibody or produced by other means. In some embodiments of the present invention, an Fc domain can be fused to FGF21 or a FGF21 mutant (including a truncated form of FGF21 or a FGF21 mutant) via, for example, a covalent bond between the Fc domain and the FGF21 sequence. Such fusion proteins can form multimers via the association of the Fc domains and both these fusion proteins and their multimers are an aspect of the present invention. An Fc domain can, but need not, comprise an amino-terminal methionine, which may be introduced by engineering or as a result of a bacterial expression process. 2, FGF21 Mutants

The term “FGF21 mutant” refers to an FGF21 mutant polypeptide having an amino acid sequence that differs from the amino acid sequence of a naturally occurring FGF21 polypeptide sequence, e.g., SEQ ID NOs:2, 4, 6 or 8,by one or more amino acids. FGF21 mutants can be generated by introducing one or more amino 22 WO 2010/129503 PCT/US2010/033478 10 15 20 25 acid substitutions, either conservative or non-conservative and using naturally or non-naturally occurring amino acids, at particular positions of the FGF21 polypeptide. A “Conservative amino acid substitution” can involve a substitution of a native amino acid residue (i.e., a residue found in a given position of the wild-type FGF21 polypeptide sequence) with a nonnativc residue (i.e., a residue that is not found in a given position of the wild-type FGF21 polypeptide sequence) such that there is little or no effect on the polarity or charge of the amino acid residue at that position. Conservative amino acid substitutions also encompass non-naturally occurring amino acid residues that are typically incorporated by chemical peptide synthesis rather than by synthesis in biological systems. These include pcptidomimctics, and other reversed or inverted forms of amino acid moieties.

Naturally occurring residues can be divided into classes based on common side chain properties: (1) hydrophobic: norleucine, Met, Ala, Val, Leu, lie; (2) neutral hydrophilic: Cys, Scr, Thr; (3) acidic: Asp, Glu; (4) basic: Asn, Gin, His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; and (6) aromatic: Trp, Tyr, Phc.

Conservative substitutions can involve the exchange of a member of one of these classes for another member of the same class. Non-conservative substitutions can involve the exchange of a member of one of these classes for a member from another class.

Desired amino acid substitutions (whether conservative or non-conservative) can be determined by those skilled in the art at the time such substitutions are desired. An exemplary (but not limiting) list of amino acid substitutions is set forth in Table 1.

Table 1

Amino Acid Substitutions

Original Residue Exemplary Substitutions Ala Val, Leu, He Arg Lys, Gin, Asn Asn Gin Asp Glu Cys Ser, Ala 23 WO 2010/129503 PCT/US2010/033478

Original Residue Exemplary Substitutions Gin Asn Glu Asp Gly Pro, Ala His Asn, Gin, Lys, Arg He Leu, Val, Met, Ala, Phe Leu He, Val, Met, Ala, Phe Lys Arg, Gin, Asn Met Leu, Phe, lie Phe Leu, Val, lie, Ala, Tyr Pro Ala Ser Thr, Ala, Cys Thr Ser Trp Tyr, Phe Tyr Trp, Phe, Thr, Ser Val He, Met, Leu, Phe, Ala 3_._Truncated FGF21 Polypeptides

One embodiment of the present invention is directed to truncated forms of a mature FGF21 polypeptide or FGF21 mutant. This embodiment of the present 5 invention arose from an effort to identify truncated FGF21 polypeptides that are capable of providing an activity that is similar, and in some instances superior, to untruncatcd forms of the mature FGF21 polypeptide.

As used herein, the term “truncated FGF21 polypeptide” refers to an FGF21 polypeptide in which amino acid residues have been removed from the amino- 10 terminal (or N-terminal) end of the FGF21 polypeptide, amino acid residues have been removed from the carboxyl-terminal (or C-terminal) end of the FGF21 polypeptide, or amino acid residues have been removed from both the amino-terminal and carboxyl-terminal ends of the FGF21 polypeptide. The various truncations disclosed herein were prepared as described herein Examples 3 and 6. 15 The activity of N-terminally truncated FGF21 polypeptides and C-tcrminally truncated FGF21 polypeptides can be assayed using an in vitro ELK-luciferase assay as described in Example 4. Specific details of the in vitro assays that can be used to examine the activity of truncated FGF21 polypeptides can be found in Example 4.

The activity of the truncated FGF21 polypeptides of the present invention can 20 also be assessed in an in vivo assay, such as db/db mice, or ob/ob mice as shown in Examples 5 and 7. Generally, to assess the in vivo activity of a truncated FGF21 polypeptide, the truncated FGF21 polypeptide can be administered to a test animal 24 WO 2010/129503 PCT/US2010/033478 intraperitoneally. After a desired incubation period (e.g., one hour or more), a blood sample can be drawn, and blood glucose levels can be measured. Specific details of the in vivo assays that can be used to examine the activity of truncated FGF21 polypeptides can be found in Examples 5 and 7. 5 a, N-terminal Truncations

In some embodiments of the present invention, N-terminal truncations comprise 1, 2, 3, 4, 5, 6, 7, or 8 amino acid residues from the N-terminal end of the mature FGF21 polypeptide or FGF21 mutant. As demonstrated in, for example, 10 Example 5 and Figure 3, truncated FGF21 polypeptides having N-terminal truncations of fewer than 9 amino acid residues retain the ability of the mature FGF21 polypeptide to lower blood glucose in an individual. Accordingly, in particular embodiments, the present invention encompasses truncated forms of the mature FGF21 polypeptide or FGF21 polypeptide mutants having N-terminal truncations of 15 1,2, 3,4, 5, 6, 7, or 8 amino acid residues. b. C-tcrminal Truncations

In some embodiments of the present invention, C-tcrminal truncations comprise 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino acid residues from the C-terminal 20 end of the mature FGF21 polypeptide. As demonstrated in, for example, Example 4 and Figure IB, truncated FGF21 polypeptides having C-tcrminal truncations of fewer than 13 amino acid residues exhibited an efficacy of at least 50% of the efficacy of wild-type FGF21 in an in vitro ELK-luciferase assay, indicating that these FGF21 mutants retain the ability of the mature FGF21 polypeptide to lower blood glucose in 25 an individual. Accordingly, in particular embodiments, the present invention encompasses truncated forms of the mature FGF21 polypeptide or FGF21 polypeptide mutants having C-terminal truncations of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino acid residues. 30 c. N-terminal and C-terminal Truncations

In some embodiments of the present invention, truncated FGF21 polypeptides can have a combination of N-terminal and C-terminal truncations. Truncated FGF21 polypeptides having a combination of N-terminal and C-terminal truncations share the activity of corresponding truncated FGF21 polypeptides having either the N-terminal 25 215,937/2 or C-terminal truncations alone. In other words, truncated FGF21 polypeptides having both N-terminal truncations of fewer than 9 amino acid residues and C-terminal truncations of fewer than 13 amino acid residues possess similar or greater biological activity, e.g, blood glucose-lowering activity, as truncated FGF21 polypeptides having N-terminal truncations of fewer than 9 amino acid residues or truncated FGF21 polypeptides having C-terminal truncations of fewer than 13 amino acid residues. Accordingly, in particular embodiments, the present invention encompasses truncated forms of the mature FGF21 polypeptide or FGF21 polypeptide mutants having both N-terminal truncations of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid residues and C-terminal truncations of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino acid residues.

As with all FGF21 mutants of the present invention, truncated FGF21 polypeptides and FGF21 mutants can optionally comprise an amino-terminal methionine residue, which can be introduced by directed mutation or as a result of a bacterial expression process.

The truncated FGF21 polypeptides of the present invention can be prepared as described in Examples 3 and 6. Those of ordinary skill in the art, familiar with standard molecular biology techniques, can employ that knowledge, coupled with the instant disclosure, to make and use the truncated FGF21 polypeptides of the present invention. Standard techniques can be used for recombinant DNA, oligonucleotide synthesis, tissue culture, and transformation (e.g., electroporation, lipofection). See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, supra.- -Enzymatic reactions and purification techniques can be performed according to manufacturer's specifications, as commonly accomplished in the art, or as described herein. Unless specific definitions are provided, the nomenclatures utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical syntheses; chemical analyses; pharmaceutical preparation, formulation, and delivery; and treatment of patients.

The truncated FGF21 polypeptides of the present invention can also be fused to another entity, which can impart additional properties to the truncated FGF21 polypeptide. In one embodiment of the present invention, a truncated FGF21 26 WO 2010/129503 PCT/US2010/033478 polypeptide can be fused to an Fc sequence. Such fusion can be accomplished using known molecular biological methods and/or the guidance provided herein. The benefits of such fusion polypeptides, as well as methods for making such fusion polypeptides, are discussed in more detail herein. 5 4, Proteolysis-resistant FGF21 Mutants

As described in Example 8, mature FGF21 was found to be undergoing in vivo degradation, which was ultimately determined to arise from proteolytic attack. The in vivo degradation of mature FGF21 was found to lead to shorter effective half-life, 10 which can adversely affect the therapeutic potential of a molecule. Accordingly, a directed study was performed to identify FGF21 mutants that exhibit a resistance to proteolysis. As a result of this investigation, the sites in the mature FGF21 polypeptide that were determined to be particularly susceptible to proteolysis include the peptide bond between the amino acid residues at positions 4-5, 20-21, 151-152, 15 171-172 and 178-181. A broad but focused and directed study was performed to identify particular substitutions that eliminate the observed proteolytic effect while not affecting the activity of the protein to an unacceptable degree. Tables 8 and 11 highlight some of the mutants that were prepared and tested. As described in, for example, Examples 13 20 and 14, not all FGF21 mutants exhibited an ideal profile; some mutants conferred proteolysis resistance but at the cost of compromised FGF21 activity. Other mutations retained FGF21 activity but did not confer proteolysis resistance. Several mutants, including, for example, FGF21 P171G, retained a similar level of activity as wild-type FGF21 while also exhibiting resistance to proteolytic degradation. 25 One selection criteria for identifying desirable proteolysis-resistant FGF21 mutants was that the activity of the FGF21 mutant be essentially the same as, or greater than, the activity of wild-type FGF21. Therefore, another embodiment of the present invention is directed to FGF21 mutants that arc resistant to proteolysis and still retain activity that is essentially the same as, or greater than, wild-type FGF21. 3 0 Although less desirable in some eases, FGF21 mutants that arc resistant to proteolysis but exhibit somewhat decreased activity form another embodiment of the present invention. In some eases it can be desirable to maintain a degree of proteolysis, and consequently, FGF21 mutants that allow some degree of proteolysis to occur also form another embodiment of the present invention. 27 215,937/2

As with all FGF21 mutants provided herein, the proteolysis-resistant FGF21 mutants of the present invention can be prepared as described herein. Those of ordinary skill in the art, for example, those familiar with standard molecular biology techniques, can employ that knowledge, coupled with the instant disclosure, to make and use the proteolysis-resistant FGF21 mutants disclosed herein. Standard techniques can be used for recombinant DNA, oligonucleotide synthesis, tissue culture, and transformation (e.g., electroporation, lipofection). See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, supra. |-1 |-1 Enzymatic reactions and purification techniques can be performed according to manufacturer's specifications, as commonly accomplished in the art, or as described herein. Unless specific definitions are provided, the nomenclatures utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical syntheses; chemical analyses; pharmaceutical preparation, formulation, and delivery; and treatment of patients.

The proteolysis-resistant FGF21 mutants of the present invention can be fused to another entity, which can impart additional properties to the proteolysis-resistant FGF21 mutant. In one embodiment of the present invention, a proteolysis-resistant FGF21 mutant can be fused to an IgG Fc sequence, e.g., SEQ ID NO:11. Such fusion can be accomplished using known molecular biological methods and/or the guidance provided herein. The benefits of such fusion polypeptides, as well as methods for making such fusion polypeptides, are known and are discussed in more detail herein. 5. Aggregation-reducing FGF21 Mutants

As described in Example 15, one property of the wild-type FGF21 polypeptide is its propensity to aggregate. At concentrations over about 5 mg/mL, the aggregation rate is high at room temperature. As shown and described herein, the aggregation rate for the wild-type FGF21 polypeptide is both concentration and temperature dependent.

Aggregation can prove to be a challenge when working with wild-type FGF21 at these concentrations, such as in the context of a therapeutic formulation. Accordingly, a directed study was performed to identify FGF21 mutants that exhibit 28 215,937/2 reduced FGF21 aggregation. The resulting FGF21 mutants were then tested for the propensity to aggregate at various concentrations. A broad but focused and directed study was performed to identify particular substitutions that eliminate or reduce the observed aggregation effect of wild-type FGF21 while not affecting the activity of the protein to an unacceptable degree. The approach for identifying suitable aggregation-reducing mutants is described in Example 15. Table 16 highlights some of the mutants that were prepared and tested. As described in, for example, Example 17, not all FGF21 mutants exhibited an ideal profde. Some mutants, such as FGF21 L58E had compromised FGF21 activity and were not studied further. Other mutations, such as FGF21 A134E, retained FGF21 activity but did not confer reduced aggregation properties. Several mutants, such as FGF21 L98R, retained FGF21 activity and also exhibited reduced aggregation. One mutant, FGF21 A45K, surprisingly exhibited increased FGF21 activity while also exhibiting reduced aggregation properties.

One selection criteria for identifying desirable aggregation-reducing FGF21 mutants was that the activity of the FGF21 mutant be essentially similar to, or greater than, the activity of wild-type FGF21. Therefore, another embodiment of the present invention is directed to FGF21 mutants having reduced aggregation properties while still retaining an FGF21 activity that is similar to, or greater than, wild-type FGF21. Although less desirable in some cases, FGF21 mutants having reduced aggregation properties but exhibiting somewhat decreased FGF21 activity form another embodiment of the present invention. In some cases it may be desirable to maintain a degree of aggregation, and consequently, FGF21 mutants that allow some degree of aggregation to occur also form another embodiment of the present invention.

As with all FGF21 mutants provided herein, the aggregation-reducing FGF21 mutants provided herein can be prepared as described herein. Those of ordinary skill in the art, familiar with standard molecular biology techniques, can employ that knowledge, coupled with the instant disclosure, to make and use the aggregation-reducing FGF21 mutants of the present invention. Standard techniques can be used for recombinant DNA, oligonucleotide synthesis, tissue culture, and transformation (e.g., electroporation, lipofection). See, e.g., Sambrook et al., Molecular Cloning: A

Laboratory Manual, supra. |-1

Enzymatic reactions and purification techniques can be performed according to manufacturer's specifications, as commonly accomplished in the art, or as described 29 WO 2010/129503 PCT/US2010/033478 herein. Unless specific definitions are provided, the nomenclatures utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein arc those well known and commonly used in the art. Standard 5 techniques can be used for chemical syntheses; chemical analyses; pharmaceutical preparation, formulation, and delivery; and treatment of patients.

The aggregation-reducing FGF21 mutants of the present invention can be fused to another entity, which can impart additional properties to the aggregation-reducing FGF21 mutant. In one embodiment of the present invention, an aggregation- 10 reducing FGF21 mutant can be fused to an IgG Fc sequence, e.g., SEQ ID NO:11. Such fusion can be accomplished using known molecular biological methods and/or the guidance provided herein. The benefits of such fusion polypeptides, as well as methods for making such fusion polypeptides, are discussed in more detail herein. 15 6, FGF21 Combination Mutants

As described herein, the wild-type FGF21 sequence possesses several properties that can pose significant challenges when FGF21 is used as a therapeutic molecule. Among these challenges are the protein's susceptibility to degradation and its propensity for aggregation at high concentration. After an exhaustive effort to 20 identify FGF21 polypeptides that overcome each of these challenges, a directed study was performed to determine whether the amino acid substitutions conferring proteolysis-resistance and those conferring aggregation-reducing properties could be combined in an additive or synergistic fashion in a single polypeptide sequence while maintaining activity levels that arc equal to or greater than the activity of wild-type 25 FGF21. This represented a significant challenge, as it is known in the art that the introduction of multiple mutations in a given polypeptide can sometimes adversely affect the expression, activity, and subsequent manufacturing of the protein.

Surprisingly, as demonstrated in, for example, Examples 19 and 20, it was found that the desirable properties of several FGF21 mutants could indeed be 3 0 combined in an additive or synergistic fashion to generate an FGF21 mutant having enhanced pharmaceutical properties. FGF21 mutants that arc resistant to proteolysis, have a reduced rate of aggregation, and which still retain activity that is the same as, or greater than, wild-type FGF21, arc disclosed herein. 30 215,937/2

One selection criteria for identifying desirable FGF21 combination mutants was that the activity of the FGF21 mutant be similar to, or greater than, the activity of wild-type FGF21. Therefore, another embodiment of the present invention is directed to FGF21 mutants that are proteolysis-resistant and have reduced aggregation properties while still retaining an FGF21 activity that is similar to, or greater than, wild-type FGF21. Although less desirable in some cases, FGF21 mutants that are proteolysis-resistant and have reduced aggregation properties but exhibit somewhat decreased FGF21 activity form another embodiment of the present invention. In some cases it may be desirable to maintain a degree of proteolysis and/or aggregation, and consequently, FGF21 mutants that allow some degree of proteolysis and/or aggregation also form another embodiment of the present invention.

As with all FGF21 mutants of the present invention, the FGF21 combination mutants of the present invention can be prepared as described herein. Those of ordinary skill in the art, familiar with standard molecular biology techniques, can employ that knowledge, coupled with the instant disclosure, to make and use the FGF21 combination mutants of the present invention. Standard techniques can be used for recombinant DNA, oligonucleotide synthesis, tissue culture, and transformation (e.g., electroporation, lipofection). See, e.g., Sambrook et at.,

Molecular Cloning: A Laboratory Manual, supra.- -Enzymatic reactions and purification techniques can be performed according to manufacturer's specifications, as commonly accomplished in the art, or as described herein. Unless specific definitions are provided, the nomenclatures utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical syntheses; chemical analyses; pharmaceutical preparation, formulation, and delivery; and treatment of patients.

The FGF21 combination mutants of the present invention can be fused to another entity, which can impart additional properties to the FGF21 combination mutant. In one embodiment of the present invention, an FGF21 combination mutant can be fused to an IgG Fc sequence, e.g., SEQ ID NO: 11. Such fusion can be accomplished using known molecular biological methods and/or the guidance provided herein. The benefits of such fusion polypeptides, as well as methods for 31 WO 2010/129503 PCT/US2010/033478 making such fusion polypeptides, arc discussed in more detail herein. 7. FGF21 Fusion Proteins

As used herein, the term “FGF21 fusion polypeptide” or “FGF21 fusion 5 protein” refers to a fusion of one or more amino acid residues (such as a heterologous protein or peptide) at the N-terminus or C-tcrminus of any FGF21 polypeptide mutant described herein.

Heterologous peptides and polypeptides include, but arc not limited to, an epitope to allow for the detection and/or isolation of an FGF21 polypeptide mutant; a 10 transmembrane receptor protein or a portion thereof, such as an extracellular domain or a transmembrane and intracellular domain; a ligand or a portion thereof which binds to a transmembrane receptor protein; an enzyme or portion thereof which is catalytically active; a polypeptide or peptide which promotes oligomerization, such as a leucine zipper domain; a polypeptide or peptide which increases stability, such as an 15 immunoglobulin constant region (e.g., an Fc domain); a half life-extending sequence comprising a combination of two or more (e.g., 2, 5, 10, 15, 20, 25, etc) naturally occurring or non-naturally occurring charged and/or uncharged amino acids (e.g., Serine, Glycine, Glutamic or Aspartic Acid) designed to form a predominantly hydrophilic or predominantly hydrophobic fusion partner for an FGF21 mutant; a 20 functional or non-functional antibody, or a heavy or light chain thereof; and a polypeptide which has an activity, such as a therapeutic activity, different from the FGF21 polypeptide mutants of the present invention. Also encompassed by the present invention arc FGF21 mutants fused to human serum albumin (HSA). FGF21 fusion proteins can be made by fusing heterologous sequences at cither 25 the N-terminus or at the C-tcrminus of an FGF21 polypeptide mutant. As described herein, a heterologous sequence can be an amino acid sequence or a non-amino acid-containing polymer. Heterologous sequences can be fused either directly to the FGF21 polypeptide mutant or via a linker or adapter molecule. A linker or adapter molecule can be one or more amino acid residues (or -mers), e.g., 1, 2, 3, 4, 5, 6, 7, 8, 30 or 9 residues (or -mers), preferably from 10 to 50 amino acid residues (or -mers), e.g, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 residues (or -mers), and more preferably from 15 to 35 amino acid residues (or -mers). A linker or adapter molecule can also be designed with a cleavage site for a DNA restriction endonuclease or for a protease to allow for the separation of the fused moieties. 32 WO 2010/129503 PCT/US2010/033478 a. Fc Fusions

In one embodiment of the present invention, an FGF21 polypeptide mutant is fused to an Fc domain, e.g., one or more domains of an Fc region of a human IgG. 5 Antibodies comprise two functionally independent parts, a variable domain known as “Fab,” that binds an antigen, and a constant domain known as “Fc," that is involved in effector functions such as complement activation and attack by phagocytic cells. An Fc has a long serum half-life, whereas a Fab is short-lived (Capon et al., 1989, Nature 337: 525-31). When joined together with a therapeutic protein, an Fc domain can 10 provide longer half-life or incorporate such functions as Fc receptor binding, protein A binding, complement fixation, and perhaps even placental transfer (Capon et al., 1989).

In vivo pharmacokinetic analysis indicated that human FGF21 has a short half-life of about 1 hour in mice due to rapid clearance and in vivo degradation. Therefore, 15 to extend the half-life of FGF21 a native Fc sequence was fused to the N- or C-terminal end of the FGF21 polypeptide. The fusion of the Fc sequence to wild type FGF21, in particularly Fc fused to the N-tcrminus of wild type FGF21, did not extend the half-life as expected, however this obscrvationled to an investigation of the proteolytic degradation of FGF21 in vivo and the identification of FGF21 mutants that 20 were resistant to such degradation. Such mutants arc described in, for example, Examples 9 and 11, and exhibit longer half-lives than wild-type FGF21. These and other FGF21 fusion proteins form embodiments of the present invention.

Throughout the instant disclosure, Fc-FGF21 refers to a fusion protein in which the Fc sequence is fused to the N-terminus of FGF21. Similarly, throughout 25 the disclosure, FGF21-Fc refers to a fusion protein in which the Fc sequence is fused to the C-terminus of FGF21.

The resulting FGF21 fusion protein can be purified, for example, by the use of a Protein A affinity column. Peptides and proteins fused to an Fc region have been found to exhibit a substantially greater half-life in vivo than the unfused counterpart. 30 Also, a fiision to an Fc region allows for dimerization/multimcrization of the fusion polypeptide. The Fc region can be a naturally occurring Fc region, or can be altered to improve certain qualities, such as therapeutic qualities, circulation time, or reduced aggregation.

Useful modifications of protein therapeutic agents by fusion with the “Fc” 33 215,937/2 domain of an antibody are discussed in detail in International Publication No. WO 00/024782. b._Fusion Protein Linkers

When forming the fusion proteins of the present invention, a linker can, but need not, be employed. When present, the linker’s chemical structure may not be critical, since it serves primarily as a spacer. The linker can be made up of amino acids linked together by peptide bonds. In some embodiments of the present invention, the linker is made up of from 1 to 20 amino acids linked by peptide bonds, wherein the amino acids are selected from the 20 naturally occurring amino acids. In various embodiments, the 1 to 20 amino acids are selected from the amino acids glycine, serine, alanine, proline, asparagine, glutamine, and lysine. In some embodiments, a linker is made up of a majority of amino acids that are sterically unhindered, such as glycine and alanine. In some embodiments, linkers are polyglycines (such as (Gly)4 (SEQ ID NO:29) and (Gly)s (SEQ ID NO:30)), polyalanines, combinations of glycine and alanine (such as poly(Gly-Ala)), or combinations of glycine and serine (such as poly(Gly-Ser)). Other suitable linkers include: (Gly)5-Ser-(Gly)3-Ser-(Gly)4-Ser (SEQ ID NO:28), (Gly)4-Ser-(Gly)4-Ser-(Gly)4-Ser (SEQ ID NO:31), (Gly)3-Lys-(Gly)4 (SEQ ID NO:32), (Gly)3-Asn-Gly-Ser-(Gly)2 (SEQ ID NO:33), (Gly)3-Cys-(Gly)4 (SEQ ID NO:34), and Gly-Pro-Asn-Gly-Gly (SEQ ID NO:35). While a linker of 15 amino acid residues has been found to work particularly well for FGF21 fusion proteins, the present invention contemplates linkers of any length or composition. When a linker was employed to join a heterologous sequence, such as an Fc domain, and an FGF21 polypeptide or FGF21 mutant, the linker is expressed in parentheses.

The linkers described herein are exemplary, and linkers that are much longer and which include other residues are contemplated by the present invention. Nonpeptide linkers are also contemplated by the present invention. For example, alkyl linkers such as -NH-(CH2)s-C(O)-, wherein s = 2 to 20, could be used. These alkyl linkers can further be substituted by any non-sterically hindering group, including, but not limited to, a lower alkyl (e.g., C1-C6), lower acyl, halogen (e.g., Cl, Br), CN, NH2, or phenyl. An exemplary non-peptide linker is a polyethylene glycol linker, wherein the linker has a molecular weight of 100 to 5000 kD, for example, 100 to 500 kD. 34 WO 2010/129503 PCT/US2010/033478 8. Chemically-modified FGF21 Mutants

Chemically modified forms of the FGF21 polypeptide mutants described herein, including the truncated forms of FGF21 described herein, can be prepared by 5 one skilled in the art, given the disclosures described herein. Such chemically modified FGF21 mutants arc altered such that the chemically modified FGF21 mutant is different from the unmodified FGF21 mutant, cither in the type or location of the molecules naturally attached to the FGF21 mutant. Chemically modified FGF21 mutants can include molecules formed by the deletion of one or more naturally- 10 attached chemical groups.

In one embodiment, FGF21 polypeptide mutants of the present invention can be modified by the covalent attachment of one or more polymers. For example, the polymer selected is typically water-soluble so that the protein to which it is attached docs not precipitate in an aqueous environment, such as a physiological environment. 15 Included within the scope of suitable polymers is a mixture of polymers. Preferably, for therapeutic use of the end-product preparation, the polymer will be pharmaceutically acceptable. Non-water soluble polymers conjugated to FGF21 polypeptide mutants of the present invention also form an aspect of the invention.

Exemplary polymers each can be of any molecular weight and can be 20 branched or unbranchcd. The polymers each typically have an average molecular weight of between about 2 kDa to about 100 kDa (the term “about” indicating that in preparations of a water-soluble polymer, some molecules will weigh more and some less than the stated molecular weight). The average molecular weight of each polymer is preferably between about 5 kDa and about 50 kDa, more preferably 25 between about 12 kDa and about 40 kDa, and most preferably between about 20 kDa and about 35 kDa.

Suitable water-soluble polymers or mixtures thereof include, but arc not limited to, N-linked or O-linked carbohydrates, sugars, phosphates, polyethylene glycol (PEG) (including the forms of PEG that have been used to dcrivatizc proteins, 30 including mono-(Ci-Cio), alkoxy-, or aryloxy-polycthylcnc glycol), monomethoxy-polycthylenc glycol, dextran (such as low molecular weight dextran of, for example, about 6 kD), cellulose, or other carbohydrate based polymers, poly-(N-vinyl pyrrolidone) polyethylene glycol, propylene glycol homopolymers, polypropylene oxide/cthylenc oxide co-polymcrs, polyoxycthylatcd polyols (e.g., glycerol), and 35 215,937/2 polyvinyl alcohol. Also encompassed by the present invention are bifunctional crosslinking molecules that can be used to prepare covalently attached FGF21 polypeptide mutant multimers. Also encompassed by the present invention are FGF21 mutants covalently attached to polysialic acid.

In some embodiments of the present invention, an FGF21 mutant is covalently, or chemically, modified to include one or more water-soluble polymers, including, but not limited to, polyethylene glycol (PEG), polyoxyethylene glycol, or polypropylene glycol. See, e.g., U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192; and 4,179,337. In some embodiments of the present invention, an FGF21 mutant comprises one or more polymers, including, but not limited to, monomethoxy-polyethylene glycol, dextran, cellulose, another carbohydrate-based polymer, poly-(N-vinyl pyrrolidone)-polyethylene glycol, propylene glycol homopolymers, a polypropylene oxide/ethylene oxide co-polymer, polyoxyethylated polyols (e.g., glycerol), polyvinyl alcohol, or mixtures of such polymers.

In some embodiments of the present invention, an FGF21 mutant is covalently-modified with PEG subunits. In some embodiments, one or more water-soluble polymers are bonded at one or more specific positions (for example, at the N-terminus) of the FGF21 mutant. In some embodiments, one or more water-soluble polymers are randomly attached to one or more side chains of an FGF21 mutant. In some embodiments, PEG is used to improve the therapeutic capacity of an FGF21 mutant. Certain such methods are discussed, for example, in U.S. Patent No. 6,133,426.

In embodiments of the present invention wherein the polymer is PEG, the PEG group can be of any convenient molecular weight, and can be linear or branched. The average molecular weight of the PEG group will preferably range from about 2 kD to about 100 kDa, and more preferably from about 5 kDa to about 50 kDa, e.g., 10, 20, 30, 40, or 50 kDa. The PEG groups will generally be attached to the FGF21 mutant via acylation or reductive alkylation through a reactive group on the PEG moiety (e.g., an aldehyde, amino, thiol, or ester group) to a reactive group on the FGF21 mutant (e.g., an aldehyde, amino, or ester group).

The PEGylation of a polypeptide, including the FGF21 mutants of the present invention, can be specifically carried out using any of the PEGylation reactions known in the art. Such reactions are described, for example, in the following references: Francis et al., 1992, Focus on Growth Factors 3: 4-10; European Patent 36 WO 2010/129503 PCT/US2010/033478

Nos. 0 154 316 and 0 401 384; and U.S. Patent No. 4,179,337. For example, PEGylation can be carried out via an acylation reaction or an alkylation reaction with a reactive polyethylene glycol molecule (or an analogous reactive water-soluble polymer) as described herein. For the acylation reactions, a selected polymer should 5 have a single reactive ester group. For reductive alkylation, a selected polymer should have a single reactive aldehyde group. A reactive aldehyde is, for example, polyethylene glycol propionaldchydc, which is water stable, or mono Ci-Cio alkoxy oraryloxy derivatives thereof (see, e.g., U.S. Patent No. 5,252,714).

In some embodiments of the present invention, a useful strategy for the 10 attachment of the PEG group to a polypeptide involves combining, through the formation of a conjugate linkage in solution, a peptide and a PEG moiety, each bearing a special functionality that is mutually reactive toward the other. The peptides can be easily prepared with conventional solid phase synthesis. The peptides are “preactivated” with an appropriate functional group at a specific site. The 15 precursors arc purified and fully characterized prior to reacting with the PEG moiety. Ligation of the peptide with PEG usually takes place in aqueous phase and can be easily monitored by reverse phase analytical HPLC. The PEGylatcd peptides can be easily purified by preparative HPLC and characterized by analytical HPLC, amino acid analysis and laser desorption mass spectrometry. 20 Polysaccharide polymers arc another type of water-soluble polymer that can be used for protein modification. Therefore, the FGF21 mutants of die present invention fused to a polysaccharide polymer form embodiments of the present invention. Dextrans arc polysaccharide polymers comprised of individual subunits of glucose predominantly linked by alpha 1-6 linkages. The dextran itself is available in 25 many molecular weight ranges, and is readily available in molecular weights from about 1 kD to about 70 kD. Dextran is a suitable water-soluble polymer for use as a vehicle by itself or in combination with another vehicle (e.g, Fc), See, e.g., International Publication No. WO 96/11953. The use of dextran conjugated to therapeutic or diagnostic immunoglobulins has been reported. See, e.g., European 30 Patent Publication No. 0 315 456, which is hereby incorporated by reference. The present invention also encompasses the use of dextran of about 1 kD to about 20 kD.

In general, chemical modification can be performed under any suitable condition used to react a protein with an activated polymer molecule. Methods for preparing chemically modified polypeptides will generally comprise the steps of: (a) 37 WO 2010/129503 PCT/US2010/033478 reacting the polypeptide with the activated polymer molecule (such as a reactive ester or aldehyde derivative of the polymer molecule) under conditions whereby an FGF21 polypeptide mutant becomes attached to one or more polymer molecules, and (b) obtaining the reaction products. The optimal reaction conditions will be determined 5 based on known parameters and the desired result. An example of this is, the larger the ratio of polymer molecules to protein, the greater the percentage of attached polymer molecule. In one embodiment of the present invention, chemically modified FGF21 mutants can have a single polymer molecule moiety at the amino-terminus (see, e.g., U.S. Patent No. 5,234,784) 10 In another embodiment of the present invention, FGF21 polypeptide mutants can be chemically coupled to biotin. The biotin/FGF21 polypeptide mutants arc then allowed to bind to avidin, resulting in tctravalent avidin/biotin/FGF2I polypeptide mutants. FGF21 polypeptide mutants can also be covalently coupled to dinitrophenol (DNP) or trinitrophenol (TNP) and the resulting conjugates precipitated with anti- 15 DNP or anti-TNP-IgM to form dccamcric conjugates with a valency of 10.

Generally, conditions that can be alleviated or modulated by the administration of the disclosed chemically modified FGF21 mutants include those conditions described herein for FGF21 polypeptide mutants. However, the chemically modified FGF21 mutants disclosed herein can have additional activities, 20 enhanced or reduced biological activity, or other characteristics, such as increased or decreased half-life, as compared to unmodified FGF21 mutants. 9. Pharmaceutical Compositions of FGF21 Mutants and Administration Thereof

Pharmaceutical compositions comprising FGF21 mutants arc within the scope 25 of the present invention, and are specifically contemplated in light of the identification of several mutant FGF21 sequences exhibiting enhanced properties. Such FGF21 mutant pharmaceutical compositions can comprise a therapeutically effective amount of an FGF21 polypeptide mutant in admixture with a pharmaceutically or physiologically acceptable formulation agent selected for 3 0 suitability with the mode of administration.

Acceptable formulation agents preferably are nontoxic to recipients at the dosages and concentrations employed.

The pharmaceutical composition can contain formulation agent(s) for modifying, maintaining, or preserving, for example, the pH, osmolarity, viscosity, 38 215,937/2 clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption, or penetration of the composition. Suitable formulation agents include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine, or lysine), antimicrobials, antioxidants (such as ascorbic acid, sodium sulfite, or sodium hydrogen-sulfite), buffers (such as borate, bicarbonate, Tris-HCl, citrates, phosphates, or other organic acids), bulking agents (such as mannitol or glycine), chelating agents (such as ethylenediamine tetraacetic acid (EDTA)), complexing agents (such as caffeine, polyvinylpyrrolidone, beta-cyclodextrin, or hydroxypropyl-beta-cyclodextrin), fillers, monosaccharides, disaccharides, and other carbohydrates (such as glucose, mannose, or dextrins), proteins (such as serum albumin, gelatin, or immunoglobulins), coloring, flavoring and diluting agents, emulsifying agents, hydrophilic polymers (such as polyvinylpyrrolidone), low molecular weight polypeptides, salt-forming counterions (such as sodium), preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid, or hydrogen peroxide), solvents (such as glycerin, propylene glycol, or polyethylene glycol), sugar alcohols (such as mannitol or sorbitol), suspending agents, surfactants or wetting agents (such as pluronics; PEG; sorbitan esters; polysorbates such as polysorbate 20 or polysorbate 80; triton; tromethamine; lecithin; cholesterol or tyloxapal), stability enhancing agents (such as sucrose or sorbitol), tonicity enhancing agents (such as alkali metal halides -preferably sodium or potassium chloride - or mannitol sorbitol), delivery vehicles, diluents, excipients and/or pharmaceutical adjuvants (see, e.g., Remington's Pharmaceutical Sciences (18th Ed., A.R. Gennaro, ed., Mack Publishing Company 1990), and subsequent editions of the same).

The optimal pharmaceutical composition will be determined by a skilled artisan depending upon, for example, the intended route of administration, delivery format, and desired dosage (see, e.g., Remington's Pharmaceutical Sciences, supra). Such compositions can influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the FGF21 polypeptide mutant.

The primary vehicle or carrier in a pharmaceutical composition can be either aqueous or non-aqueous in nature. For example, a suitable vehicle or carrier for injection can be water, physiological saline solution, or artificial cerebrospinal fluid, possibly supplemented with other materials common in compositions for parenteral 39 WO 2010/129503 PCT/US2010/033478 administration. Neutral buffered saline or saline mixed with scrum albumin arc further exemplary vehicles. Other exemplary pharmaceutical compositions comprise Tris buffer of about pH 7.0-8.5, or acetate buffer of about pH 4.0-5.5, which can further include sorbitol or a suitable substitute. In one embodiment of the present 5 invention, FGF21 polypeptide mutant compositions can be prepared for storage by mixing the selected composition having the desired degree of purity with optional formulation agents (Remington's Pharmaceutical Sciences, supra) in the form of a lyophilized cake or an aqueous solution. Furthermore, the FGF21 polypeptide mutant product can be formulated as a lyophilizate using appropriate excipients such as 10 sucrose.

The FGF21 polypeptide mutant pharmaceutical compositions can be selected for parenteral delivery. Alternatively, the compositions can be selected for inhalation or for delivery through the digestive tract, such as orally. The preparation of such pharmaceutically acceptable compositions is within the skill of the art. 15 The formulation components arc present in concentrations that arc acceptable to the site of administration. For example, buffers arc used to maintain the composition at physiological pH or at a slightly lower pH, typically within a pH range of from about 5 to about 8.

When parenteral administration is contemplated, the therapeutic compositions 20 for use in this invention can be in the form of a pyrogen-free, parenterally acceptable, aqueous solution comprising the desired FGF21 polypeplide mutant in a pharmaceutically acceptable vehicle. A particularly suitable vehicle for parenteral injection is sterile distilled water in which an FGF21 polypeptide mutant is formulated as a sterile, isotonic solution, properly preserved. Yet another preparation can involve 25 the formulation of the desired molecule with an agent, such as injectable microspheres, bio-erodible particles, polymeric compounds (such as polylactic acid or polyglycolic acid), beads, or liposomes, that provides for the controlled or sustained release of the product which can then be delivered via a depot injection. Hyaluronic acid can also be used, and this can have the effect of promoting sustained duration in 30 the circulation. Other suitable means for the introduction of the desired molecule include implantable drug delivery devices.

In one embodiment, a pharmaceutical composition can be formulated for inhalation. For example, an FGF21 polypeptide mutant can be formulated as a dry powder for inhalation. FGF21 polypeptide mutant inhalation solutions can also be 40 WO 2010/129503 PCT/US2010/033478 formulated with a propellant for aerosol delivery. In yet another embodiment, solutions can be nebulized. Pulmonary administration is further described in International Publication No. WO 94/20069, which describes the pulmonary delivery of chemically modified proteins. 5 It is also contemplated that certain formulations can be administered orally. In one embodiment of the present invention, FGF21 polypeptide mutants that arc administered in this fashion can be formulated with or without those carriers customarily used in the compounding of solid dosage forms such as tablets and capsules. For example, a capsule can be designed to release the active portion of the 10 formulation at the point in the gastrointestinal tract when bio availability is maximized and prc-systcmic degradation is minimized. Additional agents can be included to facilitate absorption of the FGF21 polypeptide mutant. Diluents, flavorings, low melting point waxes, vegetable oils, lubricants, suspending agents, tablet disintegrating agents, and binders can also be employed. 15 Another pharmaceutical composition can involve an effective quantity of FGF21 polypeptide mutants in a mixture with non-toxic excipients that are suitable for the manufacture of tablets. By dissolving the tablets in sterile water, or another appropriate vehicle, solutions can be prepared in unit-dose form. Suitable excipients include, but arc not limited to, inert diluents, such as calcium carbonate, sodium 20 carbonate or bicarbonate, lactose, or calcium phosphate; or binding agents, such as starch, gelatin, or acacia; or lubricating agents such as magnesium stearate, stearic acid, or talc.

Additional FGF21 polypeptide mutant pharmaceutical compositions will be evident to those skilled in the art, including formulations involving FGF21 25 polypeptide mutants in sustained- or controllcd-dclivcry formulations. Techniques for formulating a variety of other sustained- or controllcd-dclivery means, such as liposome carriers, bio-crodible microparticles or porous beads and depot injections, arc also known to those skilled in the art (see, e.g., International Publication No. WO 93/15722, which describes the controlled release of porous polymeric microparticles 3 0 for the delivery of pharmaceutical compositions, and Wischkc &amp;amp; Schwendeman, 2008, frit. J. Pharm. 364: 298-327, and Freiberg &amp;amp; Zhu, 2004, hit. J. Pharm. 282: 1-18, which discuss microspherc/microparticle preparation and use). As described herein, a hydrogel is an example of a sustained- or controllcd-dclivcry formulation. 41 WO 2010/129503 PCT/US2010/033478

Additional examples of sustained-release preparations include scmipcrmeablc polymer matrices in the form of shaped articles, e.g. films, or microcapsulcs. Sustained release matrices can include polyesters, hydrogels, polylactidcs (U.S. Patent No. 3,773,919 and European Patent No. 0 058 481), copolymers of L-glutamic acid 5 and gamma cthyl-L-glutamatc (Sidman et al., 1983, Biopolymers 22: 547-56), poly(2-hydroxycthyl-methacrylate) (Langer et al., 1981, J. Biomed. Mater. Res. 15: 167-277 and Langer, 1982, Chem. Tech. 12: 98-105), ethylene vinyl acetate (Langer et al., supra} or poly-D(-)-3-hydroxybutyric acid (European Patent No. 0 133 988). Sustained-release compositions can also include liposomes, which can be prepared by 10 any of several methods known in the art. See, e.g., Epstein et al., 1985, Proc. Natl. Acad. Sci. U.S.A. 82: 3688-92; and European Patent Nos. 0 036 676, 0 088 046, and 0 143 949.

The FGF21 polypeptide mutant pharmaceutical composition to be used for in vivo administration typically should be sterile. This can be accomplished by filtration 15 through sterile filtration membranes. Where the composition is lyophilized, sterilization using this method can be conducted either prior to, or following, lyophilization and reconstitution. The composition for parenteral administration can be stored in lyophilized form or in a solution. In addition, parenteral compositions generally are placed into a container having a sterile access port, for example, an 2 0 intravenous solution bag or vial having a stopper pierccablc by a hypodermic injection needle.

Once the pharmaceutical composition has been formulated, it can be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or as a dehydrated or lyophilized powder. Such formulations can be stored either in a ready-to-usc form or 25 in a form (e.g., lyophilized) requiring reconstitution prior to administration.

In a specific embodiment, the present invention is directed to kits for producing a single-dose administration unit. The kits can each contain both a first container having a dried protein and a second container having an aqueous formulation. Also included within the scope of this invention are kits containing 30 single and multi-chambcrcd pre-filled syringes (e.g., liquid syringes and lyosyringes).

The effective amount of an FGF21 polypeptide mutant pharmaceutical composition to be employed therapeutically will depend, for example, upon the therapeutic context and objectives. One skilled in the art will appreciate that the appropriate dosage levels for treatment will thus vary depending, in part, upon the 42 WO 2010/129503 PCT/US2010/033478 molecule delivered, the indication for which the FGF2I polypeptide mutant is being used, the route of administration, and the size (body weight, body surface, or organ size) and condition (the age and general health) of the patient. Accordingly, the clinician can titer the dosage and modify the route of administration to obtain the 5 optimal therapeutic effect. A typical dosage can range from about 0.1 gg/kg to up to about 100 mg/kg or more, depending on the factors mentioned above. In other embodiments, the dosage can range from 0.1 gg/kg up to about 100 mg/kg; or 1 gg/kg up to about 100 mg/kg; or 5 gg/kg, 10 gg/kg, 15 gg/kg, 20 gg/kg, 25 gg/kg, 30 gg/kg, 35 gg/kg, 40 gg/kg, 45 gg/kg, 50 gg/kg, 55 gg/kg, 60 gg/kg, 65 gg/kg, 70 gg/kg, 75 10 gg/kg, up to about 100 mg/kg. In yet other embodiments, the dosage can be 50 gg/kg, 100 gg/kg, 150 gg/kg, 200 gg/kg, 250 gg/kg, 300 gg/kg, 350 gg/kg, 400 gg/kg, 450 gg/kg, 500 gg/kg, 550 gg/kg, 600 gg/kg, 650 gg/kg, 700 gg/kg, 750 gg/kg, 800 gg/kg, 850 gg/kg, 900 gg/kg, 950 gg/kg, 100 gg/kg, 200 gg/kg, 300 gg/kg, 400 gg/kg, 500 gg/kg, 600 gg/kg, 700 gg/kg, 800 gg/kg, 900 gg/kg, 1000 15 gg/kg, 2000 gg/kg, 3000 gg/kg, 4000 gg/kg, 5000 gg/kg, 6000 gg/kg, 7000 gg/kg, 8000 gg/kg, 9000 gg/kg or 10 mg/kg.

The frequency of dosing will depend upon the pharmacokinetic parameters of the FGF21 polypeptide mutant in the formulation being used. Typically, a clinician will administer the composition until a dosage is reached that achieves the desired 20 effect. The composition can therefore be administered as a single dose, as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via an implantation device or catheter. Further refinement of the appropriate dosage is routinely made by those of ordinary skill in the art and is within the ambit of tasks routinely performed by them. Appropriate 25 dosages can be ascertained through use of appropriate dose-response data.

The route of administration of the pharmaceutical composition is in accord with known methods, e.g., orally; through injection by intravenous, intra periton cal, intracerebral (intraparcnchymal), intracercbroventricular, intramuscular, intraocular, intraarterial, intraportal, or intralcsional routes; by sustained release systems (which 3 0 may also be injected); or by implantation devices. Where desired, the compositions can be administered by bolus injection or continuously by infusion, or by implantation device. 43 WO 2010/129503 PCT/US2010/033478

Alternatively or additionally, the composition can be administered locally via implantation of a membrane, sponge, or other appropriate material onto which the desired molecule has been absorbed or encapsulated. Where an implantation device is used, the device can be implanted into any suitable tissue or organ, and delivery of 5 the desired molecule can be via diffusion, timed-release bolus, or continuous administration.

In order to deliver drug, e.g., an FGF21 mutant disclosed herein, at a predetermined rale such that the drug concentration can be maintained at tt desired therapeutically effective level over an extended period, a variety of different 10 approaches can be employed. In one example, a hydrogel comprising a polymer such as a gelatin (e.g., bovine gelatin, human gelatin, or gelatin from another source) or a naturally-occurring or a synthetically generated polymer can be employed. Any percentage of polymer (e.g., gelatin) can be employed in a hydrogel, such as 5, 10, 15 or 20%. The selection of an appropriate concentration can depend on a variety of 15 factors, such as the therapeutic profile desired and the pharmacokinetic profile of the therapeutic molecule.

Examples of polymers that can be incorporated into a hydrogel include polyethylene glycol (“PEG”), polyethylene oxide, polyethylene oxidc-co-polypropylcne oxide, co-polyethylenc oxide block or random copolymers, polyvinyl 20 alcohol, poly(vinyl pyrrolidinone), poly(amino acids), dextran, heparin, polysaccharides, polycthcrs and the like.

Another factor that can be considered when generating a hydrogel formulation is the degree of crosslinking in the hydrogel and the crosslinking agent. In one embodiment, cross-linking can be achieved via a methacrylation reaction involving 25 methacrylic anhydride. In some situations, a high degree of cross-linking may be desirable while in other situations a lower degree of crosslinking is preferred. In some cases a higher degree of crosslinking provides a longer sustained release. A higher degree of crosslinking may provide a firmer hydrogel and a longer period over which drug is delivered. 30 Any ratio of polymer to crosslinking agent (e.g., methacrylic anhydride) can be employed to generate a hydrogel with desired properties. For example, the ratio of polymer to crosslinkcr can be, e.g., 8:1, 16:1, 24:1, or 32:1. For example, when the hydrogel polymer is gelatin and the crosslinkcr is methacrylate, ratios of 8:1, 16:1, 24:1, or 32:1 methyacrylic anhydride:gclatin can be employed. 44 WO 2010/129503 PCT/US2010/033478 10. Therapeutic Uses of FGF21 Polypeptide Mutants FGF21 polypeptide mutants can be used to treat, diagnose, ameliorate, or prevent a number of diseases, disorders, or conditions, including, but not limited to 5 metabolic disorders. In one embodiment, the metabolic disorder to be treated is diabetes, e.g., type 2 diabetes. In another embodiment, the metabolic disorder is obesity. Other embodiments include metabolic conditions or disorders such as dyslipidimia; hypertension; hepatosteaotosis, such as non-alcoholic steatohepatitis (NASH); cardiovascular disease, such as atherosclerosis; and aging. 10 In application, a disorder or condition such as diabetes or obesity can be treated by administering an FGF21 polypeptide mutant as described herein to a patient in need thereof in the amount of a therapeutically effective dose. The administration can be performed as described herein, such as by IV injection, intrapcritoncal injection, intramuscular injection, or orally in the form of a tablet or liquid formation. 15 In most situations, a desired dosage can be determined by a clinician, as described herein, and can represent a therapeutically effective dose of the FGF21 mutant polypeptide. It will be apparent to those of skill in the art that a therapeutically effective dose of FGF21 mutant polypeptide will depend, inter alia, upon the administration schedule, the unit dose of agent administered, whether the nucleic acid 20 molecule or polypeptide is administered in combination with other therapeutic agents, the immune status and the health of the recipient. The term “therapeutically effective dose,” as used herein, means that amount of FGF21 mutant polypeptide that elicits the biological or medicinal response in a tissue system, animal, or human being sought by a researcher, medical doctor, or other clinician, which includes alleviation of the 25 symptoms of the disease or disorder being treated. 11. Antibodies

Antibodies and antibody fragments that specifically bind to the FGF21 mutant polypeptides of the present invention but do not specifically bind to wild-type FGF21 30 polypeptides are contemplated and are within the scope of the present invention. The antibodies can be polyclonal, including monospecific polyclonal; monoclonal (MAbs); recombinant; chimeric; humanized, such as complementarity-determining region (CDR)-graftcd; human; single chain; and/or bispccific; as well as fragments; variants; or chemically modified molecules thereof. Antibody fragments include 45 WO 2010/129503 PCT/US2010/033478 those portions of the antibody that specifically bind to an epitope on an FGF21 mutant polypeptide. Examples of such fragments include Fab and F(ab’) fragments generated by enzymatic cleavage of full-length antibodies. Other binding fragments include those generated by recombinant DNA techniques, such as the expression of 5 recombinant plasmids containing nucleic acid sequences encoding antibody variable regions.

The term “specifically binding,” when used in the context of an antibody, means that the antibody binds its target in the presence of a heterogeneous population of proteins and/or other biologic material. More particularly, when an antibody 10 specifically binds its target, this means that under predetermined immunoassay conditions, the antibody binds to its target and docs not bind in a significant amount to other proteins present in the sample. Any convenient immunoassay format can be employed to identify an antibody that specifically binds its target, e.g., solid-phase ELISA immunoassays. See, e.g., Harlow and Lane (1988) Antibodies, A Laboratory 15 Manual, Cold Spring Harbor Publications, New York.Polyclonal antibodies directed toward an FGF21 mutant polypeptide generally arc produced in animals (e.g., rabbits or mice) by means of multiple subcutaneous or intraperitoneal injections of the FGF21 mutant polypeptide and an adjuvant. It can be useful to conjugate an FGF21 mutant polypeptide to a carrier protein that is immunogenic in the species to be 20 immunized, such as keyhole limpet hcmocyanin, scrum, albumin, bovine thyroglobulin, or soybean trypsin inhibitor. Also, aggregating agents such as alum arc used to enhance the immune response. After immunization, the animals are bled and the serum is assayed for anti-FGF21 mutant antibody titer.

Monoclonal antibodies directed toward FGF21 mutant polypeptides can be 25 produced using any method that provides for the production of antibody molecules by continuous cell lines in culture. Examples of suitable methods for preparing monoclonal antibodies include the hybridoma methods of Kohler et al., 1975, Nature 256: 495-97 and the human B-cell hybridoma method (Kozbor, 1984, J. Immunol. 133: 3001; Brodeur et al., Monoclonal Antibody Production Techniques and 3 0 Applications 51-63 (Marcel Dekker, Inc., 1987). Also provided by the invention are hybridoma cell lines that produce monoclonal antibodies reactive with FGF21 mutant polypeptides.

Monoclonal antibodies of the invention can be modified for use as therapeutics. In one embodiment, the monoclonal antibody is a “chimeric” antibody 46 WO 2010/129503 PCT/US2010/033478 in which a portion of the heavy (H) and/or light (L) chain is identical with or homologous to a corresponding sequence in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is/arc identical with or homologous to a corresponding sequence in 5 antibodies derived from another species or belonging to another antibody class or subclass. Also included are fragments of such antibodies, so long as they exhibit the desired biological activity. See, e.g., U.S. Patent No. 4,816,567; Morrison et al., 1985, Proc. Natl. Acad. Sci. U.S.A. 81: 6851-55.

In another embodiment, a monoclonal antibody of the invention is a 10 “humanized” antibody. Methods for humanizing non-human antibodies are well known in the art. See, e.g., U.S. Patent Nos. 5,585,089 and 5,693,762. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source that is non-human. Humanization can be performed, for example, using methods described in the art (see, e.g., Jones et al., 1986, Nature 321: 522-25; 15 Ricchmann et al., 1998, Nature 332: 323-27; Vcrhocycn et al., 1988, Science 239: 1534-36), by substituting at least a portion of a rodent complementarity-determining region for the corresponding regions of a human antibody.

Also encompassed by the invention are human antibodies that bind the FGF21 mutant polypeptides of the present invention. Using transgenic animals (e.g., mice) 20 that arc capable of producing a repertoire of human antibodies in the absence of endogenous immunoglobulin production such antibodies arc produced by immunization with an antigen derived from an FGF21 mutant (i.e., having at least 6 contiguous amino acids), optionally conjugated to a carrier. See, e.g., Jakobovits et al., 1993, Proc. Natl. Acad. Sci. U.S.A. 90: 2551-55; Jakobovits et al., 1993, Nature 25 362: 255-58; Bruggermann et al., 1993, Year in Immuno. 7: 33. Γη one method, such transgenic animals arc produced by incapacitating the endogenous loci encoding the heavy and light immunoglobulin chains therein, and inserting loci encoding human heavy and light chain proteins into the genome thereof. Partially modified animals, i.e., animals having less than the full complement of modifications, arc then cross- 30 bred to obtain an animal having all of the desired immune system modifications. When administered an immunogen, these transgenic animals produce antibodies with human (rather than, e.g., murine) amino acid sequences, including variable regions that are immunospccific for these antigens. See, e.g., International Publication Nos. WO 96/33735 and WO 94/02602. Additional methods arc described in U.S. Patent 47 215,937/2

No. 5,545,807, International Publication Nos. WO 91/10741 and WO 90/04036, and in European Patent No. 0 546 073. Human antibodies can also be produced by the expression of recombinant DNA in host cells or by expression in hybridoma cells as described herein.

In an alternative embodiment, human antibodies can also be produced from phage-display libraries (see, e.g., Hoogenboom et al., 1991, J. Mol. Biol. 227: 381; Marks et al., 1991, J. Mol. Biol. 222: 581). These processes mimic immune selection through the display of antibody repertoires on the surface of fdamentous bacteriophage, and subsequent selection of phage by their binding to an antigen of choice.

Chimeric, CDR grafted, and humanized antibodies are typically produced by recombinant methods. Nucleic acids encoding the antibodies are introduced into host cells and expressed using materials and procedures described herein. In one embodiment, the antibodies are produced in mammalian host cells, such as CHO cells. Monoclonal (e.g., human) antibodies can be produced by the expression of recombinant DNA in host cells or by expression in hybridoma cells as described herein.

The anti-FGF21 mutant antibodies of the invention can be employed in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays (see, e.g., Sola, Monoclonal

Antibodies: A Manual of Techniques 147-158 (CRC Press, Inc., 1987)). |-1 |-1 for the detection and quantitation of FGF21 mutant polypeptides. The antibodies will bind FGF21 mutant polypeptides with an affinity that is appropriate for the assay method being employed.

For diagnostic applications, in certain embodiments, anti-FGF21 mutant antibodies can be labeled with a detectable moiety. The detectable moiety can be any one that is capable of producing, either directly or indirectly, a detectable signal. For example, the detectable moiety can be a radioisotope, such as H, C, P, S, I, 99Tc, luIn, or 67Ga; a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin; or an enzyme, such as alkaline phosphatase, β-galactosidase, or horseradish peroxidase (Bayer et al., 1990, Meth. Enz. 184: 138-63).

Competitive binding assays rely on the ability of a labeled standard (e.g., an FGF21 mutant polypeptide, or an immunologically reactive portion thereof) to 48 WO 2010/129503 PCT/US2010/033478 compete with the test sample analyte (e,g„ an FGF21 mutant polypeptide) for binding with a limited amount of anti-FGF21 mutant antibody. The amount of an FGF21 mutant polypeptide in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies. To facilitate determining the amount 5 of standard that becomes bound, the antibodies typically are insolubilized before or after the competition, so that the standard and analyte that arc bound to the antibodies can conveniently be separated from the standard and analyte that remain unbound.

Sandwich assays typically involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected 10 and/or quantitated. In a sandwich assay, the test sample analyte is typically bound by a first antibody that is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex. See, e.g., U.S. Patent No. 4,376,110. The second antibody can itself be labeled with a detectable moiety (direct sandwich assays) or can be measured using an anti- 15 immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assays). For example, one type of sandwich assay is an enzyme-linked immunosorbent assay (ELISA), in which ease the detectable moiety is an enzyme.

The anti-FGF21 mutant antibodies of the present invention are also useful for in vivo imaging. An antibody labeled with a detectable moiety can be administered to 20 an animal, preferably into the bloodstream, and the presence and location of the labeled antibody in the host assayed. The antibody can be labeled with any moiety that is detectable in an animal, whether by nuclear magnetic resonance, radiology, or other detection means known in the art.

The FGF21 mutant antibodies of the invention can be used as therapeutics. 25 These therapeutic agents arc generally agonists or antagonists, in that they either enhance or reduce, respectively, at least one of the biological activities of an FGF21 mutant polypeptide. In one embodiment, antagonist antibodies of the invention are antibodies or binding fragments thereof which arc capable of specifically binding to an FGF21 mutant polypeptide and which arc capable of inhibiting or eliminating the 30 functional activity of an FGF21 mutant polypeptide in vivo or in vitro. In some embodiments, the antagonist antibody will inhibit the functional activity of an FGF21 mutant polypeptide by at least about 50%, and preferably by at least about 80%. In another embodiment, the anti-FGF21 mutant antibody is capable of interfering with the interaction between an FGF21 mutant polypeptide and an FGF receptor thereby 49 WO 2010/129503 PCT/US2010/033478 inhibiting or eliminating FGF21 mutant polypeptide activity in vitro or in vivo. Agonist and antagonist anti-FGF21 mutant antibodies arc identified by screening assays that arc well known in the art.

The invention also relates to a kit comprising FGF21 mutant antibodies and 5 other reagents useful for detecting FGF21 mutant polypeptide levels in biological samples. Such reagents can include a detectable label, blocking serum, positive and negative control samples, and detection reagents.

EXAMPLES 10 The Examples that follow are illustrative of specific embodiments of the invention, and various uses thereof. They arc set forth for explanatory purposes only, and should not be construed as limiting the scope of the invention in any way.

EXAMPLE I 15 Preparation of FGF21 Expression Constructs A nucleic acid sequence encoding the mature FGF21 polypeptide was obtained by polymerase chain reaction (PCR.) amplification using primers having nucleotide sequences corresponding to the 5’ and 3’ ends of the mature FGF21 sequence. Table 2 lists the primers that were used to amplify the mature FGF21 20 sequence.

Table 2 PCR Primers for Preparing FGF21 Construct

Primer Sequence SEQ ID NO: Sense 5'-AGGAGGAATAACATATGCATCCAATTCCAGATTCTTCTCC-3' 12 Antisense 5'-TAGTGAGCTCGAATTCTTAGGAAGCGTAGCTGG-3' 13 25 The primers used to prepare the mature FGF21 expression construct incorporated restriction endonuclease sites (the Ndcl site also comprises an N-tcrminal methionine for bacterial expression) for directional cloning of the sequence into a suitable expression vector (e.g., pET30 (Novagcn/EMD Bioscienccs; San Diego, CA) or pAMG33 (Amgen; Thousand Oaks, CA)). The expression vector 30 pAMG33 contains a low-copy number R-100 origin of replication, a modified lac promoter, and a kanamycin-rcsistancc gene. The expression vector pET30 contains a 50 WO 2010/129503 PCT/US2010/033478 pBR322-dcrived origin of replication, an inducible T7 promoter, and a kanamycin-rcsistance gene. While expression from pAMG33 was found to be higher, pET30 was found to be a more reliable cloning vector. Thus, the majority of the constructs described in the instant disclosure were first generated in pET30 and then screened for 5 efficacy. Selected sequences were then transferred to pAMG33 for further amplification.

The FGF21 sequence was amplified in a reaction mixture containing 40.65 pL dFLO, 5pL PfuUltra II Reaction Buffer (lOx), 1.25 pL dNTP Mix (40 mM - 4 x lOmM), 0.1 pL Template (100 ng/mL), 1 pL Primcrl (10 pM), 1 pL Primcr2 (10 10 pM), and 1 pL PfuUltra II fusion HS DNA Polymerase (Stratagenc; La Jolla, CA). Amplification reactions were performed by heating for 2 minutes at 95°C; followed by ten cycles at 95°C for 20 seconds, 60°C for 20 seconds (with an additional 1°C subtracted per cycle), and 72°C for 15 seconds/kilobase of desired product; followed by 20 cycles at 94°C for 20 seconds, 55°C for 20 seconds, and 72°C for 15 15 seconds/kilobase of desired product; followed by 72°C for 3 minutes. Amplification products were digested with the restriction endonucleases Ndcl, Dpnl, and EcoRI; ligated into a suitable vector; and then transformed into competent cells. EXAMPLE 2 20 Purification of FGF21 Proteins from Bacteria

In the Examples that follow, various FGF21 proteins, including the wild-type FGF21 polypeptide, truncated FGF21 polypeptides, FGF21 mutants, and FGF21 fusion proteins, were expressed in a bacterial expression system. After expression, which is described below, the FGF21 proteins were purified as described in this 25 Example, unless otherwise indicated.

To purify the wild-type FGF21 polypeptide, truncated FGF21 polypeptides, and FGF21 mutants from bacterial inclusion bodies, double-washed inclusion bodies (DWIBs) were solubilized in a solubilization buffer containing guanidine hydrochloride and DTT in Tris buffer at pH 8.5. They were then mixed for one hour

3 0 at room temperature, and the solubilization mixture was added to a refold buffer containing urea, arginine, cysteine, and cystaminc hydrochloride at pH 9.5 and then mixed for 24 hours at 5°C (see, e.g., Clarke, 1998, Curr. Opin. Biotechnol. 9: 157-63; Mannall et al., 2007, Biotechnol. Bioeng. 97: 1523-34; Rudolph et al., 1997, "Folding proteins," Protein Function: A Practical Approach (Creighton, cd., New York, IRL 51 WO 2010/129503 PCT/US2010/033478

Press) 57-99; and Ishibashi et al., 2005, Protein Expr. Purif. 42: 1-6),

Following solubilization and refolding, the mixture was filtered through a 0.45 micron filter. The refold pool was then concentrated approximately 10-fold with a 10 kD molecular weight cut-off Pall Omega cassette at a transmembrane pressure (TMP) 5 of 20 psi, and dialfiltered with 3 column volumes of 20 mM Tris, pH 8.0 at a TMP of 20 psi.

The clarified sample was then subjected to anion exchange (AEX) chromatography using a Q Sepharosc HP resin. A linear salt gradient of 0 to 250 mM NaCl in 20 mM Tris was run at pH 8.0 at 5°C. Peak fractions were analyzed by SDS- 10 PAGE and pooled.

The AEX eluate pool was then subjected to hydrophobic interaction chromatography (HIC) using a Phenyl Sepharosc HP resin. Protein was eluted using a decreasing linear gradient of 0.7 M to 0 M ammonium sulfate at pH 8.0 and ambient temperature. Peak fractions were analyzed by SDS-PAGE (Lacmmli, 1970, Nature 15 227: 680-85) and pooled.

The HIC pool was concentrated with a 10 kD molecular weight cut-off Pall Omega 0.2 m2 cassette to 7 mg/mL at a TMP of 20 psi. The concentrate was dialfiltered with 5 column volumes of formulation buffer at a TMP of 20 psi, and the recovered concentrate was diluted to 5 mg/mL. Finally, the solution was filtered 20 through a Pall mini-Klcenpac 0.2 μΜ Posidync membrane.

To purify FGF21 fusion proteins and FGF21 fusion mutant proteins from bacterial inclusion bodies, double-washed inclusion bodies (DWIBs) were solubilized in a solubilization buffer containing guanidine hydrochloride and DTT in Tris buffer at pH 8.5 and then mixed for one hour at room temperature. Then the solubilization 25 mixture was added to a refold buffer containing urea, arginine, cysteine, and cystamine hydrochloride at pH 9.5 and then mixed for 24 hours at 5°C {see, e.g., Clarke, 1998, Curr. Opin. Biotechnol. 9: 157-63; Mannall et al., 2007, Biotechnol. Bioeng. 97: 1523-34; Rudolph et al., 1997, “Folding proteins,” Protein Function: A Practical Approach (Creighton, ed., New York, IRL Press) 57-99; and Ishibashi etal., 30 2005, Protein Expr. Purif. 42: 1-6).

Following solubilization and refolding, the mixture was dialyzed against 5 volumes of 20 mM Tris, pH 8.0 using 10 kD dialysis tubing. The pH of the dialyzed refold was adjusted to 5.0 with 50% acetic acid, and then clarified by centrifugation for 30 minutes at 4K. 52 WO 2010/129503 PCT/US2010/033478

The clarified sample was then subjected to anion exchange (AEX) chromatography using a Q Scpharosc HP resin. A linear salt gradient of 0 to 250 mM NaCl in 20 mM Tris was run at pH 8.0 at 5°C. Peak fractions were analyzed by SDS-PAGE (Laemmli, 1970, Nature 227: 680-85) and pooled. 5 The AEX eluate pool was then subjected to hydrophobic interaction chromatography (HIC) using a Phenyl Scpharose HP resin. Protein was eluted using a decreasing linear gradient of 0.6 M to 0 M ammonium sulfate at pH 8.0 at ambient temperature. Peak fractions were analyzed by SDS-PAGE and pooled.

Following the HIC step, the pool was then dialyzed 60 volumes of formulation 10 buffer. The dialyzed pool was concentrated to 5 mg/mL using a Pall Jumbosep. Finally, the solution was filtered through a Pall mini-KAccnpac 0.2 μΜ Posidync membrane. EXAMPLE 3 15 Preparation and Expression of Truncated FGF21 Proteins

Constructs encoding the truncated FGF21 proteins listed in Table 3 were prepared by PCR amplification of the wild-type FGF21 expression vector as described below (the construction of the wild-type FGF21 expression vector is described in Example 1). 20

Table 3 FGF21 Truncations

Amino Acid Residues Number of Residues Truncated* C-terminus Truncations 1-180 1 1 -179 2 1-178 3 1 -177 4 1-176 5 1 -175 6 1-174 7 1 -173 8 1-172 9 1 -171 10 1-169 12 1-168 13 53 WO 2010/129503 PCT/US2010/033478

Amino Acid Residues Number of Residues Truncated* 1 - 167 14 1 - 166 15 1 - 165 16 1 - 164 17 1 - 160 21 1 - 156 25 1 - 152 29 1 - 149 32 1 -113 68 N-terminus Truncations 2-181 I 3-181 2 4-181 3 5-181 4 6-181 5 7-181 6 8-181 7 9-181 8 C- and N-terminus Truncations 5-174 11 7-172 17 9-169 20 9-149 40 15-169 26 15-149 46 15-113 82 * relative to mature FGF21 polypeptide

Truncated FGF21 protein constructs were prepared using primers having sequences that arc homologous to regions upstream and downstream of a codon (or 5 codons) to be deleted (resulting in the truncation). The primers used in such amplification reactions also provided approximately 15 nucleotides of overlapping sequence to allow for rccircularization of the amplified product, namely the entire vector now having the desired mutant or truncation.

An exemplary truncated FGF21 construct, encoding an FGF21 protein lacking 10 the histidine residue at position 1 of the mature FGF21 sequence (i.e., the 2-181 truncation mutant), was prepared using the primers shown in Table 4. 54 WO 2010/129503 PCT/US2010/033478

Table 4 PCR Primers for Preparing Exemplary Truncation FGF21 Mutant

Primer Sequence SEQ ID NO: Sense 5’-GGAGATATACATATGCCAATTCCAGATTCTTCTCCATTATT-3 ’ 14 Antisense 5'-CATATGTATATCTCCTTCTTAAAGTTAAACAAAA-3' 15

The primers shown in Table 4 allow for the deletion of the histidine residue as 5 shown below, wherein the upper sequence (SEQ ID NO:9) is a portion of a mature FGF21 polypeptide comprising a N-terminal methionine, the second sequence is the sense primer (SEQ ID NO:14), the third and fourth sequences (SEQ ID NOs:17 and 18) arc portions of an FGF21 expression construct, and the fifth sequence is the antisense primer (SEQ ID NO: 16): 10

MetHisProlleProAspSerSerProLeu 5'-GGAGATATACATATG---

CCAATTCCAGATTCTTCTCCATTATT

TTTTGTTTAACTTTAAGAAGGAGATATACATATGCATCCAATTCCAGATTCTTCTCCATTAT

15 T

AAAACAAATTGAAATTCTTCCTCTATATGTATACGTAGGTTAAGGTCTAAGAAGAGGTAATA

A AAAACAAATTGAAATTCTTCCTCTATATGTATAC-51

20 Truncated FGF21 protein constructs were prepared using essentially the PCR conditions described in Example 1. Amplification products were digested with the restriction endonuclease Dpnl, and then transformed into competent cells. The resulting clones were sequenced to confirm the absence of polymerase-gen crated errors. 25 Truncated FGF21 proteins were expressed by transforming competent BL21 (DE3) or BL21 Star (Invitrogen; Carlsbad, CA) cells with the construct encoding a particular truncated FGF21 protein. Transformants were grown overnight with limited aeration in TB media supplemented with 40 pg/mL kanamycin, were aerated the next morning, and after a short recovery period, were induced in 0.4 mM JPTG. 3 0 FGF21 mutants were harvested by centrifugation 18-20 hours after induction. 55 WO 2010/129503 PCT/US2010/033478 EXAMPLE 4

In vitro Activity of Truncated FGF21 Proteins Experiments were performed to identify truncated FGF21 proteins that retain 5 wild-type FGF21 activity in an ELK-luciferase in vitro assay. Table 5 summarizes the results obtained for FGF21 proteins having truncations at the N-terminus, the C-terminus, or at both the N-terminus and C-terminus. ELK-lucifcrasc assays were performed using a recombinant human 293T kidney cell system, in which the 293T cells overexpress β-Klotho and lucifcrasc reporter constructs. These constructs also 10 contain sequences encoding GAL4-ELK1 and 5xUAS-Luc, a lucifcrasc reporter driven by a promoter containing five tandem copies of the Gal4 binding site, β-Klotho is a co-receptor that is required by FGF21 for activation of its FGF receptors and induction of intracellular signal transduction, which in turn leads to Erk and ELK phosphorylation. Lucifcrasc activity is regulated by the level of phosphorylatcd 15 Erk/ELKl, and is used to indirectly monitor and quantify FGF21 activity. ELK-lucifcrasc assays were performed by culturing the 293T cells in the presence of different concentrations of wild-type FGF21 or FGF21 mutant polypeptide for 6 hours, and then assaying the cell lysates for lucifcrasc activity. Figures 1A-1B show the results of an ELK-lucifcrasc activity assay performed on the 20 FGF21 truncation mutants 7-181 and 8-181 (Figure 1A) and the FGF21 truncation mutants 1-172, 1-171, 1-169, and 1-164 (Figure IB). The luminescence obtained in ELK-luciferase assays for each of the FGF21 truncation mutants 3-181,4-181,5-181, 7-181, 8-181, 1-180, 1-178, 1-177, 1-176, 1-175, 1-174, 1-173, 1-172, 9-181, and 1-149 is shown in Figure 2. 25 FGF21 mutant polypeptides were compared with a wild-type FGF21 standard and mutants showing an efficacy of at least 50% of the efficacy of wild-type FGF2I were considered as having not lost FGF21 activity and were assigned a “+” in Table 5. 30 Table 5

Truncated FGF21 Proteins; in vitro Assay C-terminus Truncations Amino Acid Residues Efficacy Activity (+/-) 1 - 180 93.2% + 56 WO 2010/129503 PCT/US2010/033478 C-terminus Truncations Amino Acid Residues Efficacy Activity (+/-) 1 - 178 95.0% + 1 - 177 112.0% + 1-176 104.8% + 1 - 174 104.6% + 1-173 96.1% + 1 - 172 97.5% + 1 - 171 113.0% + 1 - 169 84.9% + 1 - 167 20% - 1 - 166 20% - 1 - 165 10% - N-terminus Truncations Amino Acid Residues Efficacy Activity (+/-) 2-181 112.5% + 3-181 130.3% + 4-181 117.0% + 5- 181 119.6% + 7- 181 74.2% + 8- 181 24.9% - 9-181 12.5% -

Collectively, the results presented in Table 5 indicate that C-terminal deletions of 14 or more amino acid residues (i.e., a C-terminally truncated FGF21 protein consisting of amino acid residues 1-167 and shorter proteins) eliminate the activity of 5 FGF21. In addition, Table 5 indicates that N-terminal deletions of 7 or more amino acid residues (i.e., an N-tcrminally truncated FGF21 protein consisting of amino acid residues 8-181 and shorter proteins) eliminate the activity of FGF21. Not surprisingly, truncated FGF21 proteins possessing both an N-terminal truncation of 8 to 14 residues and a C-tcrminal truncation of 12 or 32 residues were found to lack 10 activity in ELK-luciferasc assays.

Consistent with the data presented in Tabic 5, truncated FGF21 polypeptides having N-tcrminal truncations of fewer than 7 amino acid residues constitute embodiments of the present invention. Similarly, truncated FGF21 polypeptides having C-tcrminal truncations of fewer than 13 amino acid residues constitute 15 embodiments of the present invention. 57 WO 2010/129503 PCT/US2010/033478 EXAMPLE 5

In vivo Activity of Truncated FGF21 Proteins FGF21 possesses a number of biological activities, including the ability to lower blood glucose, insulin, triglyceride, or cholesterol levels; reduce body weight; 5 or improve glucose tolerance, energy expenditure, or insulin sensitivity. Truncated FGF21 polypeptides were further analyzed for in vivo FGF21 activity, by introducing the truncated FGF21 polypeptides into insulin resistant ob/ob mice, and measuring the ability of a particular truncated FGF21 polypeptide to lower blood glucose. The truncated FGF21 polypeptide to be tested was injected intrapcritoncally into an 8 10 week old ob/ob mouse (Jackson Laboratory), and blood samples were obtained at various time points following a single injection, e.g., 0, 6, 24, 72, 120, and 168 hours after injection. Blood glucose levels were measured with a OncTouch Glucomcter (LifcScan, Inc. Milpitas, CA), and the results expressed as a percent change of blood glucose relative to the baseline level of blood glucose (i.e., at time 0). 15 The results of one experiment arc provided in Figure 3, which shows the amount of blood glucose detected in mice injected with the FGF21 truncation mutants 8-181 and 9-181. This experiment demonstrated that truncated FGF21 fusion proteins comprising amino acid residues 8-181 exhibit blood glucose lowering activity in vivo however the activity is slightly less than the activity of wild-type FGF21 at 3 and 6 20 hours after injection, but that truncated FGF21 fusion proteins comprising amino acid residues 9-181 do not exhibit such activity. Thus, the in vivo analysis of truncated FGF21 polypeptides indicated that the deletion of up to 7 amino acids from the N-terminus of mature FGF21 docs not abolish the molecule's biological activity (in contrast with the in vitro analysis, which suggested that the deletion of 7 amino acids 25 from the N-terminus of mature FGF21 would abolish activity).

The differing results obtained with particular N-terminally truncated FGF21 polypeptides (e.g., FGF21 8-181) in in vitro and in vivo assays can be explained by the interaction of FGF21 with β-Klotho and FGF receptor in effecting signal transduction. In particular, FGF2I activates a dual receptor complex comprising the 30 co-receptor β-Klotho and FGF receptor (FGFR), which initiates a signaling cascade involving tyrosine kinase. The N-tcrminus of FGF21 has been shown to be involved in binding and activation of FGFR while the C-terminus of FGF21 is required for β-Klotho interaction (Yic et al., 2009 FEBS Lett. 583:19-24). The ELK-luciferase in 58 WO 2010/129503 PCT/US2010/033478 vitro assay is performed in 293 kidney cells in which the co-receptor β-Klotho is overexpressed and FGFR is expressed at normal levels. The amount of FGFR is low relative to that of β-Klotho and the ratio of β-Klotho to FGFR in 293 cells is therefore non-physiological, which may affect receptor complex formation and ultimately 5 ligand binding and activation of FGFR. The 293 in vitro system appears to be more vulnerable to N-tcrminally truncated FGF21 polypeptides and therefore may have produced loss of activity results for a few of the N-tcrminally truncated mutants tested, such as FGF21 8-181. Thus, in determining whether a particular N-tcrminally truncated FGF21 mutant retained wild-type FGF21 activity, the activity of that FGF21 10 mutant in the in vivo assay was considered to be dispositive. Accordingly, truncated FGF21 polypeptides having N-tcrminal truncations of fewer than 8 amino acid residues are encompassed by the invention. EXAMPLE 6 15 Preparation and Expression of Truncated FGF21 Fusion Proteins

Because the half-life of a protein can be increased by fusing the protein to an

Fc sequence, fusion proteins comprising truncated FGF21 polypeptides were prepared and analyzed. The truncated FGF21 fusion proteins listed in Table 6 were prepared from amplified FGF21 sequences by SOEing (gene splicing by overlap extension) 2 0 PCR. FGF21 fusion proteins were prepared such that the Fc portion of the human immunoglobulin IgGl gene (SEQ ID NO:11) was fused to either the N-tcrminus or the C-tcrminus of the FGF21 protein.

Table 6 25 Truncated FGF21 Fusion Proteins

Amino Acid Residues Fc Position Linker C-terminus Ί "runcations 1-178 -NH2 15 1-175 -nh2 14 1-175 -COOH 15 1-171 -nh2 15 1-171 -COOH 15 1-170 -COOH 15 N-terminusr 'runcations 5-181 -nh2 15 5-181 -COOH 15 7-181 -nh2 15 59 WO 2010/129503 PCT/US2010/033478

Amino Acid Residues Fc Position Linker 7-181 -COOH 15 C- and N-terminus Truncations 5-175 -nh2 15 5-175 -COOH 15 5-171 -NH2 15 5-171 -COOH 15 6-170 -COOH 15 7-178 -COOH 35 7-175 -nh2 15 7-175 -COOH 15 7-174 -COOH 35 7-172 -COOH 35 7-171 -nh2 15 7-171 -COOH 35 7-171 -COOH 15

In particular, FGF21 fusion protein constructs (including those encoding truncated FGF21 fusion proteins) were prepared in a series of three amplification reactions using essentially the reaction conditions described in Example 1. In the first 5 reaction, a pair of primers was designed to produce a sequence containing an Ndel cloning site (including an N-tcriminal methionine for bacterial expression), Fc region, and linker sequence. In the second reaction, a pair of primers was designed to produce a sequence containing an overlapping portion of the linker, a portion of the FGF2I coding sequence, and an EcoRI cloning site. Finally, in the third reaction, a 10 pair of primers was designed for the purpose of linking the products of the First two reactions. An exemplary set of primers for the construction of Fc-FGF21 1-181 is listed in Table 7.

Table 7 15 PCR Primers for Preparing Exemplary FGF21 Fusion Protein Construct

Primer Sequence SEQ ID NO: Reaction 1 Sense 5 ’ -AGGAGGAATAACATATGGACAAAACTCACACATG-3 ' 19 Antisense 5'-GGATCCACCACCACCGCTACCAC-3’ 20 Reaction 2 Sense 5’-GGTGGTGGTGGATCCCATCCAATTCCAGATTCTTCTCCA-3’ 21 Antisense 5'-TAGTGAGCTCGAATTCTTAGGAAGCGTAGCTGG-3' 22 Reaction 3 Sense 5'-AGGAGGAATAACATATGGACAAAACTCACACATG-3' 19 Antisense 5'-TAGTGAGCTCGAATTCTTAGGAAGCGTAGCTGG-3’ 22 60 WO 2010/129503 PCT/US2010/033478

The product of the final reaction was digested with the restriction endonucleases Ndel and EcoRJ, ligated into the pET30 vector, and then transformed into competent cells. The resulting clones were sequenced to confirm the absence of 5 polymerase-generated errors. EXAMPLE 7 in vivo Activity of Truncated FGF21 Fusion Proteins

Fusion proteins comprising a truncated FGF21 sequence fused to an Fc 10 sequence were generated and assayed for in vivo activity. Truncated FGF21 fusion proteins were prepared by fusing an lgGl Fc molecule to cither the N-terminal or C-terminal end of a truncated FGF21 protein to form a single contiguous sequence. To distinguish between N-terminal and C-tcrminal fusions, FGF21 fusion proteins in which the Fc molecule was fused to the N-terminal end of the FGF21 protein are 15 designated as Fc-FGF21, and fusion proteins in which the Fc molecule was fused to the C-tcrminal end of the FGF21 protein are designated as FGF21-Fc. FGF21 possesses a number of biological activities, including the ability to lower blood glucose, insulin, triglyceride, or cholesterol levels; reduce body weight; or improve glucose tolerance, energy expenditure, or insulin sensitivity. To assess in 20 vivo FGF21 activity, FGF21 polypeptides, FGF21 mutant polypeptides, and FGF21 fusion polypeptides were introduced into insulin resistant ob/ob mice, and the ability of a particular FGF21 protein to lower blood glucose levels was measured. The FGF21 polypeptide, FGF21 mutant polypeptide, or FGF21 fusion polypeptide to be tested was injected intraperitoneally into 8 week old ob/ob mice (Jackson Laboratory), 25 and blood samples were obtained at various time points following a single injection, e.g., 0, 6, 24, 72, 120, and 168 hours after injection. Blood glucose levels were measured with a OncTouch Glucometcr (LifcScan, Inc. Milpitas, CA), and the results expressed as a percent change of blood glucose relative to the baseline level of blood glucose (i.e., at time 0). 30 The results of one experiment are provided in Figure 4, which shows the percent change in blood glucose levels observed in mice injected with a PBS control, a wild-type Fc-FGF21 control comprising amino acid residues 1-181, or truncated Fc-FGF21 fusion proteins comprising amino acid residues 5-181 or 7-181. This experiment demonstrated that truncated Fc-FGF21 fusion proteins comprising amino 61 WO 2010/129503 PCT/US2010/033478 acid residues 5-181 or 7-181 exhibit blood glucose lowering activity that is similar to the activity of wild-type Fc-FGF21 at 6 hours after injection. Thus, the in vivo analysis of truncated FGF21 polypeptides indicated that the deletion of up to 6 amino acids from the N-terminus of mature FGF21 does not affect the molecule’s biological 5 activity. In vivo analysis also indicated, however, that the ability of truncated FGF21 polypeptides to lower blood glucose was reduced and that blood glucose levels returned to baseline at 24 hours after injection (similar results were obtained with wild-type FGF21). The short in vivo activity was found to be a result of the proteolytic degradation of FGF21, as described in Example 8. 10 The results of another experiment arc provided in Figure 5, which shows the percent change in blood glucose levels observed in mice injected with a PBS control, a wild-type FGF21-Fc control comprising amino acid residues 1-181, a truncated FGF21-Fc fusion protein comprising residues 1-175, or a truncated FC-FGF21 protein comprising amino acid residues 1-171. This experiment demonstrates that the wild- 15 type FGF21-Fc comprising amino acid residues 1-181 has a sustained glucose-lowering activity resulting in a reduction of blood glucose levels of approximately 30% over the time period of 24 hours to 120 hours following injection. The truncated Fc-FGF21 protein comprising amino acid residues 1-171 exhibits delayed blood glucose lowering activity evident only at 72 hours after injection. However, the 20 activity observed is the same as the activity of wild-type FGF21-Fc. The truncated FGF21-Fc fusion protein comprising residues 1-175 is not active in vivo in lowering blood glucose.

Collectively, the truncation experiments described herein demonstrate that truncated FGF21 fusion proteins having an N-tcrminal truncation exhibit blood 25 glucose lowering activity that is similar to that of the wild-type FGF21 fusion protein, and further, that truncated FGF21 fusion proteins in which the Fc molecule has been fused to the N-terminal end of the truncated FGF21 protein exhibit more activity than fusion proteins in which the Fc molecule has been fused to the C-terminal end of the truncated FGF21 protein. 30 EXAMPLE 8

Observed in vivo Degradation of FGF21 FGF21 degradation was first observed with FGF21 Fc fusion protein constructs as described in Example 7. Jn vivo pharmacokinetic analysis indicated that 62 WO 2010/129503 PCT/US2010/033478 human FGF21 has a short half-life of about 1 hour in mice due to rapid clearance and in vivo degradation. Therefore, to extend the half-life of FGF21 an Fc sequence was fused to the N- or C-terminal end of the FGF21 polypeptide. However, the fusion of an Fc region did not completely resolve the half-life issue since fusion proteins in 5 which an Fc sequence was fused to the N- or C-terminal end of the FGF21 polypeptide (and in particular Fc-FGF21 fusions, i.e., in which the Fc sequence is fused to the N-terminus of mature FGF21), did not exhibit the expected in vivo efficacy, and instead were found to maintain blood glucose lowering activity for no more than 24 hours in ob/ob mice. As described in Figure 4, Fc-FGF21 fusion 10 proteins reduced blood glucose levels by about 30-40% at 6 hours after injection, while the blood glucose levels returned to baseline levels at 24 hours.

The proteolytic degradation of wild-type FGF21 was subsequently investigated, and the rapid loss of in vivo activity with Fc-FGF21 fusion proteins was found to be the result of in vivo degradation of FGF21. Proteolytic degradation leads 15 to decreased biological activity of the molecule in vivo and thus a shorter effective half-life, and such degradation adversely impacts the therapeutic use of that molecule. Accordingly, the observed degradation of FGF21 Fc fusion proteins led to the investigation of the proteolytic degradation of FGF21 in vivo and to identify FGF21 mutants that were resistant to such degradation. 20 To determine the sites of degradation, LC-MS analysis and Edman sequencing was performed on wild-type human FGF21 and FGF2I Fc fusion proteins obtained at various time points after injection into male C57B6 mice. The Edman sequencing helped confirm whether the N-tcrminal or C-tcrminal end of the protein was undergoing degradation. When an Fc sequence was fused to the N-tcrminus of 25 human FGF21, degradation was found to occur at the peptide bond between amino acid residues 151 and 152 and between amino acid residues 171 and 172 of the human FGF21 portion of the fusion molecule (the residue numbering above is based on the mature FGF21 sequence and does not include the Fc portion of the fusion protein). The degradation at 171-172 was found to occur first, and was followed by 30 degradation at 151-152. Degradation at 171-172 appears to be the rate-limiting step and plays a role in the half-life of the molecule. When an Fc sequence was fused to the C-terminus of FGF21, degradation was found to occur at the peptide bond between amino acid residues 4 and 5 and between amino acid residues 20 and 21. As a result of these experiments, it was determined that the Fc sequence appears to 63 WO 2010/129503 PCT/US2010/033478 protect the portion of the FGF21 sequence that is adjacent to the Fc sequence from degradation. An analysis of the in vivo degradation of wild-type FGF21 and Fc-FGF21 fusion proteins was further conducted in cynomolgus monkeys. These studies confirmed that the cleavage site of FGF21 at amino acid residues 171-172 is the 5 major site of degradation in monkeys and that this site of degradation is conserved between murine and primate. EXAMPLE 9

Identification of FGF21 Proteolysis-Resistant Mutants 10 Suitable FGF21 mutants were identified by experimentally determining the positions of the wild-type FGF21 sequence that arc sites of major proteolytic activity, and specific amino acid substitutions were introduced at these sites. Amino acid substitutions were based on FGF21 sequence conservation with other species (as described in Example 8) and biochemical conservation with other amino acid 15 residues. A list of amino acid substitutions that were or can be introduced into the wild-type FGF21 protein is provided in Table 8, although Table 8 is only exemplary and other substitutions can be made. The numbers of the positions given in Table 8 correspond to the residue position in the mature FGF21 protein, which consists of 181 amino acid residues. 20

Table 8 FGF21 Residues Mutated

Amino Acid Position Native Residue Mutations 19 Arg . ...... Gin, He, Lys 20 Tyr His, Leu, Phe 21 Leu lie, Phe, Tyr, Val 22 Tyr He, Phe, Val 150 Pro Ala, Arg 151 Gly Ala, Val 152 lie His, Leu, Phe, Val 170 Gly Ala, Asn, Asp, Cys, Gin, Glu, Pro, Ser 171 Pro Ala, Arg, Asn, Asp, Cys, Glu, Gin, Gly, His, Lys, Ser, Thr, Trp, Tyr 172 Ser Leu, Thr 173 Gin Arg, Glu 64 WO 2010/129503 PCT/US2010/033478 EXAMPLE 10

In vivo Analysis of Fc-FGF21 and FGF21-Fc Degradation The stability of FGF21 Fc fusion proteins in vivo was determined by injecting mice with a fusion protein, drawing blood from the mice at various time points, and 5 analyzing the serum by liquid chromatography-mass spectrometry (LC-MS). Γη particular, mice were intraperitoneally injected with 10 mg/kg of Fc-(G5)-FGF21 (SEQ ID NO: 107) (expressed in E. coli and purified as described in Example 2) or FGF21 -(G3)-Fc (SEQ ID NO: 105) (expressed in mammalian cells and purified according to standard procedures). Blood was drawn from the mice at 6, 24, and 48 10 hours after injection (Table 9) and collected into EDTA tubes pretreated with protease inhibitor cocktails (Roche Diagnostics). Plasma was separated by ccntriiuging the samples at 12,000xg for 10 minutes. FGF21 proteins were affinity purified from blood using an anti-human-Fc agarose resin. 15 Table 9 FGF21 Samples

Sample Protein Administered Blood Withdrawn D6 Fc-(G5)-FGF21 6 hours D24 Fc-(G5)-FGF21 24 hours D48 Fc-(G5)-FGF21 48 hours E6 FGF21-(G3)-Fc 6 hours E24 FGF21-(G3)-Fc 24 hours E48 FGF2I-(G3)-Fc 48 hours

Prior to analyzing the affinity purified samples by LC-MS, Fc-(G5)-FGF21 and FGF21-(G3)-Fc protein standards were analyzed as a reference. Protein

20 standards were either reduced with tris[2-carboxycthyl] phosphine (TCEP) or not reduced. Reduced and non-reduced standards were analyzed by LC-MS using an ACE cyano 0.3 mm x 30 cm column with the column effluent spraying into an LCQ Classic ion-trap mass spectrometer. Since the dcconvolutcd spectra of the reduced samples were cleaner, the affinity purified samples were reduced prior to LC-MS 25 analysis.

The observed masses for the reduced Fc-(G5)-FGF21 standard and samples D6, D24, and D48 arc shown in Figures 6A-6D. The observed masses for the reduced FGF21-(G3)-Fc standard and samples E6, E24, and E48 arc shown in Figures 7A-7D. Some of the standard and sample eluates were subjected to Edman sequencing in 65 WO 2010/129503 PCT/US2010/033478 order to confirm the N-terminus of the proteins and the fragments as determined by LC-MS. Results of the LC-MS analysis of the standards and samples arc provided in Table 10.

Results of LC-MS Analysis and Predicted Fragments FGF21 Sample Major Observed Masses Fragment Intact N- terminus? Fc-(G5)-FGF21 standard 45,339 Da 1-414 Yes D6 45,338 Da 44,317 Da 1-414 1-404 Yes D24 44,321 Da 1-404 Yes D48 44,327 Da 42,356 Da 1-404 9 Yes FGF21-(G3)-Fc standard 46,408 Da (glycosylated, G0F) 44,964 Da (non-glycosylatcd) 1-410 1-410 Yes E6 45,963 Da (glycosylated, G0F) 44,516 Da (non-glycoylatcd) 5-410 5-410 No E24 45,963 Da (glycosylated, G0F) 44,526 Da (non-glycosylatcd) 44,130 Da (glycosylated, G0F) 5-410 5-410 21-410 No E48 45,984 Da 44,130 Da 44,022 Da 5-410? 21-410 ? No

As indicated in Table 10, all of the affinity purified samples showed some degree of degradation after only 6 hours of circulation. After 24 hours of circulation, 10 the major product of Fc-(G5)-FGF21 was a fragment consisting of amino acid residues 1-404, which was seen in both the D and E samples, in the E samples, however, the major product of FGF21-(G3)-Fc was a fragment consisting of amino acid residues 5-410. For both of the fusion proteins tested, the FGF21 portion of the fusion protein was more susceptible to degradation than the Fc portion of the protein. 66 WO 2010/129503 PCT/US2010/033478 EXAMPLE 11

Preparation and Expression of Proteolysis-Resistant FGF21 Mutants and Fusion

Proteins

Constructs encoding the FGF21 mutants listed in Table 11 were prepared by 5 PCR amplification of the wild-type FGF21 expression vector as described below (the construction of the wild-type FGF21 expression vector is described in Example 1). When a linker was included in the construct, the linker used was GGGGGSGGGSGGGGS (“L15,” SEQ ID NO: 28), The goal of these experiments was to generate FGF21 mutants that arc resistant to proteolysis and exhibit longer 10 half-lives.

Table 11

Proteolysis-Resistant FGF21 Mutants

Mutation(s) Fc Linker R19I R19I -COOH L15 RI9K RI9K -COOH L15 R19Q R19Q -COOH L15 RI9K, Y20H R19K, Y20H -COOH L15 R19K, L21I RI9K, L21I -COOH L15 RI9K, Y20H, L21I RI9K, Y20H, L211 -COOH LI5 Y20F Y20F -COOH L15 Y20H Y20H -COOH L15 Y20L Y20L -COOH L15 Y20H, L21I Y20H, L21I -COOH L15 L21I L21I -COOH L15 L21F L21F -COOH L15 L21V L21V -COOH L15 L21Y L21Y -COOH L15 67 WO 2010/129503 PCT/US2010/033478

Mutation(s) Fc Linker Y22F Y22F -COOH L15 Y221 Y22I -COOH L15 Y22V Y22V -COOH L15 Pl 50 A P150A -NH2 L15 P150R -nh2 LI 5 P150A,G151A P150A,G151A -nh2 L15 P150A, 1152V P150A, 1152V -nh2 L15 P150A, G151A, I152V P150A, G151A, I152V -nh2 L15 G15IA G15IA -nh2 L15 G151V G151V -nh2 L15 G151A, 1152V G151A, 1152V -nh2 L15 1152F 1152F -nh2 LI 5 I152H I152H -nh2 L15 1152L I152L -nh2 LI 5 Il 52V G170A G170A -nh2 L15 G170C G170C -nh2 L15 G170D G170D -nh2 L15 G170E G170E -nh2 L15 G170N G170N -nh2 L15 G170P G170P -nh2 L15 G170Q G170Q -nh2 L15 G170S G170S -nh2 L15 G170E, P171A G170E, P171A -nh2 L15 G170E, S172L 68 WO 2010/129503 PCT/US2010/033478

Mutation(s) Fc Linker G170E, S172L -nh2 L15 G170E, P171A, S172L G170E, P171A, S172L -nh2 LI5 P171A P171A -nh2 LIS P171C -nh2 L15 P171D -nh2 L15 P17IE -nh2 L15 P171G -nh2 L15 P171H -nh2 . L15 P171K -nh2 L15 P171N -nh2 L15 P17IQ -nh2 L15 P171S -nh2 L15 P171T -nh2 L15 P171W -nh2 L15 P171Y -nh2 L15 P171A,S172L P171A, S172L -nh2 L15 S172L -nh2 LIS S172T S172T -nh2 L15 Q173E Q173E -nh2 L15 Q173R Q173R -nh2 L15 FGF21 mutant constructs were prepared using primers having sequences that arc homologous to regions upstream and downstream of a codon (or codons) to be mutated. The primers used in such amplification reactions also provided 5 approximately 15 nucleotides of overlapping sequence to allow for rccircularization of the amplified product, namely the entire vector now having the desired mutant.

An exemplary FGF21 mutant construct, encoding an FGF21 mutant having a glutamic acid residue at position 170 instead of the native glycine residue (/.e., the G170E mutant), was prepared using the primers shown in Table 12.

Table 12 PCR Primers for Preparing Exemplary FGF21 Mutant

Primer Sequence SEQ ID NO: Sense 5’-ATGGTGGAACCTTCCCAGGGCCGAAGC-3’ 23 Antisense 5'-GGAAGGTTCCACCATGCTCAGAGGGTCCGA-3’ 24 69 WO 2010/129503 PCT/US2010/033478

The primers shown in Table 12 allow for the substitution of the glycine residue with a glutamic acid residue as shown below, wherein the upper sequence is the sense primer (SEQ ID NO:23), the second and third sequences (SEQ ID NOs: 25 5 and 27) are portions of an FGF21 expression construct, and the fourth sequence is the antisense primer (SEQ ID NO:26):

5'-ATGGTGGAACCTTCCCAGGGCCGAAGC

CTCCTCGGACCCTCTGAGCATGGTGGGACCTTCCCAGGGCCGAAGCCCCA 10 GAGGAGCCTGGGAGACTCGTACCACCCTGGAAGGGTCCCGGCTTCGGGGT AGCCTGGGAGACTCGTACCACCTTGGAAGG-5’ FGF21 mutant constructs were prepared using essentially the PCR. conditions described in Example 1. Amplification products were digested with the restriction 15 endonuclease Dpnl, and then transformed into competent cells. The resulting clones were sequenced to confirm the absence of polymerase-generated errors. Fc-(L15)-FGF21 and FGF21-(L15)-Fc fusion proteins were generated as described herein, e.g., in Example 6. FGF21 mutants were expressed by transforming competent BL21 (DE3) or 20 BL21 Star (Invitrogcn; Carlsbad, CA) cells with the construct encoding a particular mutant. Transformants were grown overnight with limited aeration in TB media supplemented with 40 gg/mL kanamycin, were aerated the next morning, and after a short recovery period, were induced in 0.4 mM IPTG. FGF21 mutant polypeptides were harvested by centrifugation 18-20 hours after induction. 25 FGF21 mutants were also analyzed for predicted immunogcnicity. Immune responses against proteins are enhanced by antigen processing and presentation in the major histocompatability complex (MHC) class Π binding site. This interaction is required for T cell help in maturation of antibodies that recognize the protein. Since the binding sites of MHC class II molecules have been characterized, it is possible to 30 predict whether proteins have specific sequences that can bind to a series of common human alleles. Computer algorithms have been created based on literature references and MHC class II crystal structures to determine whether linear amino acid peptide sequences have the potential to break immune tolerance. The TEPITOPE computer program was used to determine if point mutations in particular FGF21 mutants would 70 WO 2010/129503 PCT/US2010/033478 increase antigen specific T cells in a majority of humans. Based on an analysis of the linear protein sequence of each FGF21 mutant, none of the mutants was predicted to enhance immunogcnicity. 5 EXAMPLE 12

Impact of Linker Sequence on FGF21 Degradation

To determine whether the presence of a longer amino acid linker between the Fc sequence and the FGF21 sequence affects FGF21 degradation, mice were injected with FGF21 fusion proteins in which the Fc region was separated from the FGF21 10 sequence by a 15 amino acid linker having the sequence GGGGGSGGGSGGGGS (designated “LI5,” SEQ ID NO:28), blood was withdrawn from the mice at various time points, and the serum was analyzed by LC-MS. In particular, mice were injected with Fc-(L15)-FGF21 or FGF21-(L15)-Fc (obtained from E. coli) at 23 mg/kg, blood was drawn at 6, 24, and 48 hours, and drawn blood was affinity purified using an anti- 15 human-Fc agarose resin.

Prior to analyzing the purified samples by LC-MS, Fc-(L15)-FGF21 and FGF21-(L15)-Fc protein standards were analyzed as a reference. Protein standards were either reduced with TCEP or not reduced. Both reduced and non-reduced standards were analyzed by LC-MS using an ACE cyano 0.3 mm x 30 cm column 20 with the column effluent spraying into an LCQ Classic ion-trap mass spectrometer. Since the dcconvoluted spectra of the reduced samples were cleaner, the affinity purified samples were reduced prior to LC-MS analysis.

The observed masses for the reduced Fc-(L15)-FGF21 standard and corresponding affinity purified samples withdrawn at various time points are shown

25 in Figures 8A-8D. The observed masses for the reduced FGF21-(L15)-Fc standard and corresponding affinity purified samples withdrawn at various time points arc shown in Figures 9A-9D. Some of the standard and sample eluates were subjected to Edman sequencing in order to confirm the N-terminus of the proteins and assist in predicting the identity of the fragments observed by LC-MS. Results of the LC-MS 3 0 analysis of the standards and samples and an indication of predicted fragments arc provided in Table 13. 71 WO 2010/129503 PCT/US2010/033478

Table 13

Results of LC-MS Analysis and Predicted Fragments FGF21 Sample Major Observed Masses Percent of Total Fragment Intact N-terminus? Fc-(L15)-FGF21 Standard 46,002 Da 100% 1-424 Yes Fc-(L15)-FGF2I 6 hours 46,000 Da 44,978 Da 65% 35% 1-424 1-414 Yes Fc-(L15)-FGF21 24 hours 44,978 Da 43,022 Da 85% 15% 1-414 1-394 Yes Fc-(L15)-FGF21 48 hours 44,976 Da 43,019 Da 60% 40% 1-414 1-394 Yes FGF21-(L15)-Fc Standard 45,999 Da 100% 1-424 Yes FGF21-(L15)-Fc 6 hours 45,870 Da 100% 1-423 Yes FGF21-(L15)-Fc 24 hours 45,869 Da 45,301 Da 43,460 Da 40% 35% 25% 1-423 6-423 22-423 Some FGF21-(L15)-Fc 48 hours 45,870 Da 45,297 Da 43,461 Da 15% 20% 65% 1-423 6-423 22-423 Some

As indicated in Table 13, all of the affinity purified samples showed some 5 degree of degradation after only 6 hours of circulation. After 24 hours of circulation, the major products of Fc-(L15)-FGF21 were fragments consisting of amino acid residues 1-414 (85% of sample) and 1-394 (15% of sample), and the major products of FGF21(15)Fc were fragments consisting of amino acid residues 1-423 (40% of sample), 6-423 (35% of sample), and 22-423 (25% of sample). Identified cleavage 10 points for the Fc-(L15)-FGF21 and FGF21-(L15)-Fc proteins are shown in Figures Ι0Α and 10B, respectively. EXAMPLE 13

In vivo Activity of Proteolysis-resistant Fc-(L15)-FGF21 Mutants 15 at 1-7 Days after Injection

As described herein, proteolytic cleavage of FGF21 Fc fusion proteins depends upon the orientation of the Fc sequence, with the Fc end of the fusion protein being more stable than the FGF21 end of the fusion protein (i.e., the N-tcrminal portion of Fc-(L15)-FGF21 fusion proteins and the C-terminal portion of FGF21- 20 (L15)-Fc fusion proteins were found to be more stable). For example, cleavage was 72 WO 2(110/129503 PCT/US2010/033478 identified at positions 5 and 21 of FGF21-(L15)Fc and positions 151 and 171 of Fc-(L15)-FGF21.

As a result of these observations, an investigation was performed to identify proteolysis-resistant FGF21 mutants. LC-MS analysis of Fc-(L15)-FGF21 5 demonstrates that in vivo proteolytic degradation first occurs between amino acid residues 171-172, followed by degradation between amino acid residues 151-152. By blocking proteolytic degradation at position 171, the cleavage at position 151 can be prevented, effectively extending the half-life of the molecule. However, proteolysis-resistant mutants in which cleavage is prevented at position 151 can still possess 10 residues at position 171 that arc susceptible to protease attack, thereby resulting in a molecule missing the last 10 amino acids, which arc known to be involved in the binding of the co-receptor β-Klotho, which is a determinant of ligand receptor affinity and in vitro and in vivo potency. Therefore, the mutagenesis of amino acid residues surrounding position 171 in mature FGF21 appear to be more critical for improving 15 the in vivo stability, potency, and efficacy of the molecule.

The in vivo activity of particular proteolysis-resistant Fc-(L15)-FGF21 mutants was assayed by intrapcritoncally injecting ob/ob mice with an FGF21 mutant, drawing blood samples from injected mice at 0, 0.25, 1, 3, 5, and 7 days after injection, and then measuring blood glucose levels in the samples. The results of one

20 experiment are provided in Figure 11, which shows the blood glucose levels measured in mice injected with a PBS control, an Fc-(L15)-FGF21 (SEQ ID NO:49) control, or the Fc-(L15)-FGF2l mutants Fc-(L15)-FGF21 G170E (SEQ ID NO:51), Fc-(L15)-FGF21 P171A (SEQ ID NO:53), Fc-(L15)-FGF21 S172L (SEQ ID NO:55), Fc-(L15)-FGF21 (G170E, P171A, S172L) (SEQ ID NO:59), or Fc-(L15)-FGF21 G151A 25 (SEQ ID NO:61). Figure 12 shows the percent change in blood glucose levels as determined in this experiment. This experiment demonstrates that the Fc-(L15)-FGF21 G170E, Fc-(L15)-FGF21 P171A, Fc-(L15)-FGF21 S172L, and Fc-(L15)-FGF21 (G170E, P171A, S172L) mutants exhibit sustained blood glucose lowering activity for up to 5 days, which is superior to the activity of wild-type Fc-(L15)- 30 FGF21. The Fc-(L15)-FGF21 G151A mutant only partially improved the duration of blood glucose lowering activity as compared with wild-type Fc-(L15)-FGF21 fusion protein. Surprisingly, although the Fc-(L15)-FGF21 S172L mutant is not a proteolysis-resistant mutant, and therefore has similar degradation profile as the wild- 73 WO 2010/129503 PCT/US2010/033478 type Fc-(L15)-FGF21 polypeptide, this mutant was found to exhibit improved in vivo efficacy as compared with the wild-type Fc-(L15)-FGF21 polypeptide.

The results of another experiment arc provided in Figure 13, which shows the blood glucose levels measured in mice injected with a PBS control, an Fc-(L15)- 5 FGF21 control, or the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21 (P150A, G151A, 1152V) (SEQ ID NO:65), Fc-(L15)-FGF21 G170E (SEQ ID NO:51), Fc-(L15)-FGF21 (G170E, P171A) (SEQ ID NO:63), or Fc-(L15)-FGF21 (G170E, S172L) (SEQ ID NO:67). Figure 14 shows the percent change in blood glucose levels as determined in this experiment. As in the experiment described above, the wild-type 10 Fc-FGF21 fusion protein and the Fc-(L15)-FGF21 (P150A, G151A, 1152V) mutant do not exhibit sustained blood glucose lowering activity, possibly because the degradation at 171 site could still occur, and blood glucose levels in animals injected with these proteins returned to baseline at 24 hours after injection. However, the Fc-(L15)-FGF21 G170E, Fc-(L15)-FGF21 (GI70E, P171A), or Fc-(L15)-FGF21 15 (G170E, S172L) exhibit maximal blood glucose lowering activity up to 5 days after injection, which is superior to the wild-type Fc-(L15)-FGF21 fusion protein and the Fc-(L15)-FGF21 (PI50A, G151A, 1152V) mutant.

The results of another experiment arc provided in Figure 15, which shows the blood glucose levels measured in mice injected with a PBS control or the Fc-(L15)- 20 FGF21 mutants Fc-(L15)-FGF21 G170E (SEQ ID NO:51), Fc-(L15)-FGF21 G170A (SEQ ID NO:69), Fc-(L15)~FGF21 G170C (SEQ ID NO:71), Fc-(L15)-FGF21 G170D (SEQ ID NO:73), Fc-(L15)-FGF21 G170N (SEQ ID NO:75), or Fc-(L15)-FGF21 G170S (SEQ ID NO:77). Figure 16 shows the percent change in blood glucose levels as determined in this experiment. All of the FGF21 mutants tested in 25 this experiment exhibited sustained blood glucose lowering activity for up to 5 days after injection.

The results of another experiment are provided in Figure 17, which shows the blood glucose levels measured in mice injected with PBS or the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21 G170E (SEQ TD NO:51), Fc-(L15)-FGF21 P171E (SEQ ID

30 NO:79), Fc-(LI5)-FGF21 P171H (SEQ IDNO:81), Fc-(L15)-FGF2l P171Q(SEQID NO:83), Fc-(L15)-FGF21 P171T (SEQ TD NO:85), or Fc-(L15)-FGF21 P171Y (SEQ ID NO:87). Figure 18 shows the percent change in blood glucose levels as determined in this experiment. All of the FGF21 mutants tested in this experiment exhibited improved blood glucose lowering activity when compared with wild-type 74 WO 2010/129503 PCT/US2010/033478 FC-FGF21. EXAMPLE 14

In vivo Degradation of Proteolysis-resistant Fc-(L15)-FGF21 Mutants 5 at 6 to 120 Hours after Injection

The in vivo stability of selected FGF21 mutants was analyzed by injecting mice with an FGF21 mutant, drawing blood from the mice at various time points, and analyzing the scrum by LC-MS. In particular, mice were injected with cither the Fc-(L15)-FGF21 G170E, Fc-(L15)-FGF21 P171A, or Fc-(L15)-FGF21 S172L mutants 10 (obtained from E. coii as described in Example 2), each of which were diluted in approximately 180 pL of 10 mM HC1 prior to injection, and blood was drawn at 6, 24, 48, 72, and 120 hours. FGF21 proteins were affinity purified from the drawn blood using an anti-human-Fc agarose resin column. Samples were eluted from the column using 10 mM HC1. All of the FGF21 constructs comprise an Fc region and 15 15 amino acid linker at the amino-terminal end of the FGF21 protein. Mice were also injected with a wild-type FGF21 control.

Prior to analyzing the affinity purified samples by LC-MS, unprocessed wild-type FGF21 and unprocessed FGF21 mutants were analyzed as a reference. All standards and time point samples were reduced with TCEP, and then analyzed by LC- 20 MS using an ACE cyano 0.3 mm x 30 cm column with the column effluent spraying into an LCQ Classic ion-trap mass spectrometer. Affinity purified samples were diluted with ammonium acetate, reduced with TCEP, and then analyzed by LC-MS as described above.

The observed masses for wild-type Fc-(L15)-FGF21 at 0, 6, 24, and 48 hours 25 after injection arc shown in Figures 19A-19D, respectively. The observed masses for Fc-(L15)-FGF21 G170E at 0, 6, 24, and 48 hours after injection arc shown in Figures 20A-20D, respectively. The observed masses for Fc-(L15)-FGF21 P171A at 0, 6, 24, and 48 hours after injection arc shown in Figures 21A-21D, respectively. The observed masses for Fc-(L15)-FGF21 S172L at 0, 6, 24, and 48 hours after injection 30 arc shown in Figures 22A-22D, respectively.

All of the samples drawn at 72 and 120 hours were found to contain a high molecular weight (>200 kDa by non-reducing SDS-PAGE) component of fibrinogen that is much more abundant than the remaining Fe-(L15)-FGF21 fusion protein. 75 WO 2010/129503 PCT/US2010/033478

Results of the LC-MS analysis of the other standards and samples arc provided in Table 14.

Table 14 5 Results of LC-MS Analysis and Predicted Fragments FGF21 Sample Major Observed Masses Percent of Total Fragment Edman Fc-(L15)-FGF21 WT Standard 45,994 Da 100% 1-424 — Fc-(L15)-FGF21 WT 6 hours 46,001 Da 44,987 Da 80% 20% I-424 1-414 No Fc-(L15)-FGF2l WT 24 hours 44,979 Da -100% 1-414 No Fc-(L15)-FGF21 WT 48 hours 44,980 Da -100% 1-414 — Fc-(L15)-FGF21 G170E Standard 46,068 Da 100% 1-424 — Fc-(L15)-FGF21 G170E 6 hours 46,078 Da 100% 1-424 No Fc-(L15)-FGF21 G170E 24 hours 46,074 Da 45,761 Da 80% 20% 1-424 1-421 No Fc-(L15)-FGF21 G170E 48 hours 46,072 Da 45,760 Da -60% -40% 1-424 1-421 No Fc-(L15)-FGF21 P171A Standard 45,970 Da 100% 1-424 — Fc-(L15)-FGF21 P171A 6 hours 45,980 Da 100% 1-424 No Fc-(L15)-FGF21 P171A 24 hours 45,973 Da 45,657 Da -70% -30% 1-424 1-421 No Fc-(L15)-FGF21 P171A 48 hours 45,992 Da 45,673 Da -50% -50% 1-424 1-421 No Fc-(L15)-FGF21 S172L Standard 46,022 Da 100% i-424 — Fc-(L15)-FGF21 S172L 6 hours 46,027 Da 100% 1-424 No Fc-(L15)-FGF21 S172L 24 hours 44,984 Da 100% 1-414 No Fc-(L15)-FGF21 S172L 48 hours 44,985 Da 100% 1-414 No

As indicated in Table 14, the degradation of wild-type Fc-(L15)-FGF21 and the S172L mutant look similar, in that after 24 hours of circulation, the major product of the fusion protein was a fragment consisting of amino acid residues 1-414. The

10 degradation products of the Fc-(L15)-FGF21 G170E and Fc-(L15)-FGF21 P171A 76 WO 2010/129503 PCT/US2010/033478 mutants also look similar in that the samples drawn after 24 hours of circulation contain 70-80% intact protein (amino acids 1-424) and 20-30% of a fragment consisting of amino acid residues 1-421. Even after 48 hours, the Fc-(LI5)-FGF21 G170E and Fc~(L15)-FGF21 P171A mutants still retain intact protein while showing 5 an increase in the amount of the fragment consisting of amino acid residues 1-421. As observed in prior analyses of Fc-FGF21 constructs, degradation of the FGF21 portion of the fusion protein was detected and the Fc portion was found to remain stable. The cleavage sites identified for wild-type, Fc-(L15)-FGF21 G170E, Fc-(L15)-FGF2t P171A, and Fc-(L15)-FGF21 S172L are shown in Figures 23A-23D, 10 respectively. EXAMPLE 15

Identification of Aggregation-reducing FGF21 Mutants One property of wild-type FGF21 is its propensity to aggregate. In view of 15 this property, it was desired to generate aggregation-reducing FGF21 mutants. Aggregation-reducing FGF21 mutants were identified on the basis of two hypotheses. The first hypothesis is that, with respect to FGF21, aggregation (or dimerization) is triggered by hydrophobic interactions and van der Waals interactions between FGF21 molecules caused by hydrophobic residues that are exposed to hydrophilic water- 20 based solvent environment. The second hypothesis is that these exposed hydrophobic residues can be substituted to create aggregation-reducing point-mutations in the FGF21 amino acid sequence without compromising FGF21 activity.

A systematic rational protein engineering approach was used to identify exposed hydrophobic residues in FGF21. As there were no known X-ray or NMR 25 structures of FGF21 that could be used to identify exposed hydrophobic residues, a high resolution (1.3 A) X-ray crystal structure of FGF19 (1PWA) obtained from the Protein Databank (PDB) was used to create a 3D homology model of FGF21 using MOE (Molecular Operating Environment; Chemical Computing Group; Montreal, Quebec, Canada) modeling software. FGF19 was chosen as a template, since among 30 the proteins deposited in the PDB, FGF19 is the most closely related protein to FGF21 in terms of the amino acid sequence homology.

Solvent accessibility was calculated by the following method using MOE. A first measure of surface area (SAI) is defined as the area of the residue’s accessible surface in A2. While a particular amino acid residue appears in a protein's primary 77 WO 2010/129503 PCT/US2010/033478 sequence multiple times, each occurrence of the residue can have a different surface area due to differences in, inter alia, the residue’s proximity to the protein surface, the orientation of the residue's side-chain, and the spatial position of adjacent amino acid residues. Therefore, a second measure of surface area (SA2) is made wherein the 5 residue of interest is extracted from the protein structure along with that residue's neighboring, or adjacent, residues. These spatially adjacent residues arc mutated in silico to glycines to remove their side-chains, and then the SA2 for the residue of interest is calculated, giving a measure of the total possible surface area for that residue in its particular conformation. A ratio of SAI to SA2 (SA1/SA2) can then 10 give a measure of the percentage of the possible surface area for that residue that is actually exposed.

Several hydrophobic residues that are highly exposed to the solvent were selected for further analysis, and in silico point mutations were made to these residues to replace the selected residue with the other naturally occurring amino acid residues. 15 The changes in protein thermal stability resulting from different substitutions were calculated using the FGF21 model and the interactive web-based program CUPSAT (Cologne University Protein Stability Analysis Tools) according to instructions provided at the CUPSAT website. See Parthiban et al., 2006, Nucleic Acids Res. 34: W239-42; Parthiban ei al., 2007, BMC Struct. Biol. 7:54. Significantly destabilizing 20 or hydrophobic mutations were excluded in the design of aggregation-reducing point-mutation FGF21 mutants. Stabilizing (or, in rare cases, slightly destabilizing) substitutions that introduce improved hydrophilic and/or ionic characteristics were considered as candidates for aggregation-reducing FGF21 mutants. A summary of the data generated through this rational protein engineering 25 approach is provided in Tabic 15, which also lists exemplary FGF21 mutants expected to have reduced protein aggregation and improved stability.

Table 15

Calculated Effect of FGF21 Mutants on Stability

Residue # WT Residue Mutation Stabilization (Kcal/mol) 26 A K 1.25 E 1.54 R 2.016 45 A T 0.66 78 WO 2010/129503 PCT/US2010/033478

Residue # WT Residue Mutation Stabilization (Kcal/mol) Q 0.71 K 1.8 E 2.34 R 1.59 52 L T -0.33 58 L G 0.16 S -0.15 C 1.0 E 0.08 60 P A 1.3 K 1.51 E 0.66 R 1.31 78 P A 0.14 C 2.48 R 0.08 H 0.13 86 L T 0.18 C 4.1 88 F A 2.52 S 3.08 K 2.88 E 1.48 98 L T 0.49 Q 0.17 K -0.19 c 3.08 E 0.84 R 3.4 99 L C 7.34 E 2.0 D 1.01 R 1.61 111 A T 0.47 K -0.12 129 A Q 3.93 K 1.02 N 3.76 E 3.01 D 3.76 R 1.68 H 2.9 134 A K 5.37 Y 4.32 E 5.13 R 6.18 H 2.86 79 WO 2010/129503 PCT/US2010/033478 EXAMPLE 16

Preparation and Expression of Aggregation-reducing FGF21 Mutants and

Fusion Proteins

Constructs encoding the FGF21 mutants listed in Table 16 were prepared by 5 PCR amplification of the wild-type FGF21 expression vector as described in Example

11 (the construction of the wild-type FGF21 expression vector is described in Example 1). Fusion proteins were generated as described herein, e.g., in Example 6. When a linker was employed it was GGGGGSGGGSGGGGS ("LIS,” SEQ ID NO:28) 10

Table 16

Aggregation-reducing FGF21 Mutants

Mutation(s) Fc Linker A26E A26K A26R A45E A45K A45K -nh2 L15 A45R -nh2 L15 A45Q -nh2 L15 A45T -nh2 L15 A45K, L98R -nh2 L15 L52T L58C L58E L58G L58S P60A P60E P60K P60R P78A P78C P78H P78R L86C L86T F88A F88E F88K F88R F88S 80 WO 2010/129503 PCT/DS2010/033478

Mutation(s) Fc Linker L98C L98E -NH2 L15 L98K -nh2 L15 L98Q -nh2 L15 L98R L98R -nh2 L15 L99C L99D L99E L99R Al UK -nh2 L15 All IT A129D A129E -nh2 L15 A129H -nh2 L15 A129K A129N -nh2 L15 A129R -nh2 L15 A129Q A134E A134H -nh2 L15 A134K A134Y

The aggregation of various FGF21 proteins, including wild-type FGF21, truncated FGF21 polypeptides, FGF21 mutants, and FGF21 fusion proteins was assayed by Size Exclusion Chromatography (SEC). Samples to be analyzed were 5 incubated at 4°C, room temperature, or 37°C for various time points, and then subjected to SEC analysis. Experiments were performed on a Beckman HPLC system equipped with a SEC column. For wild-type FGF21, a TOSOHAAS TSK-Gcl G2000 SEC column was used with 2x PBS containing 2% isopropyl alcohol as the mobile phase. For FGF21 Fc fusion proteins and FGF21 mutant polypeptides, a 10 TOSOHAAS TSK-Gcl G3000 SEC column was used with 2x PBS as the mobile phase. EXAMPLE 17

In vitro Activity of Aggregation-reducing FGF21 Mutants 15 Experiments were performed to identify aggregation-reducing mutants that retain wild-type FGF21 activity in an ELK-lucifcrasc in vitro assay. ELK-lucifcrasc assays were performed as described in Example 4. Figures 24A-24C show the results 81 WO 2010/129503 PCT/US2010/033478 of an ELK-lucifcrasc activity assay performed on the FGF21 mutants FGF21 L99R (SEQ ID NO: 109), FGF2I L99D (SEQ ID NO: 111), and FGF21 Al I IT (SEQ ID NO: 113) (Figure 24A); the FGF21 mutants FGF2I A129D (SEQ ID NO: 115), FGF21 A129Q (SEQ ID NO:117), and FGF21 A134K (SEQ ID NO:119) (Figure 24B); and 5 the FGF21 mutants FGF21 A134Y (SEQ ID NO: 121), FGF21 A134E (SEQ ID NO: 123), and FGF21 A129K (SEQ ID NO: 125) (Figure 24C). The results of these experiments demonstrate that some of the aggregation-reducing mutations did not adversely impact FGF21 activity as assayed in ELK-luciferase assays. 10 EXAMPLE 18

Preparation and Expression of Fc-(L15)-FGF2t Combination Mutants

Showing Longer Half-life and Lower Levels of Aggregation A number of FGF21 combination mutants, containing mutations shown to reduce aggregation as well as to increase half-life by disrupting proteolytic 15 degradation, were prepared and conjugated to IgG I Fc molecules (SEQ ID NO:11).

These FGF21 mutants were prepared essentially as described in Example 11. EXAMPLE 19

In vitro Studies of Fc-(L15)-FGF21 Mutants 20 Showing Longer Half-life and Lower Levels of Aggregation

Experiments were performed to identify FGF21 combination mutants that retain wild-type FGF21 activity in an ELK-lucifcrase in vitro assay. ELK-luciferasc assays were performed as described in Example 4.

Figures 25A-25D show the results of an ELK-lucifcrase activity assay 25 performed on the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21 PI71G, Fc-(L15)-FGF21 P171S, and Fc-(L15)-FGF21 P171T (Figure 25A); the Fc-(LI5)-FGF21 mutants Fc-(L15)-FGF21 P171Y, Fc-(L15)-FOF2t P171W, and Fc-(L15)-FGF21 P171C (Figure 25B); Fc-(L15)-FGF21, Fc-(L15)-FGF21 (A45K, GI70E), and FGF21 A45K (Figure 25C); and Fc-(L15)-FGF21, Fc-(L15)-FGF21 P171E, and Fc-(L15)- 30 FGF21 (A45K, G170E) (Figure 25D). The results of these experiments demonstrate that mutations aimed at improving stability, or both stability and solubility, did not compromise the in vitro activity as compared with wild-type Fc-(L15)-FGF21. Interestingly, the FGF21 A45K mutant showed improved potency relative to wild-type Fc-(L15)-FGF21. 82 WO 2010/129503 PCT/US2010/033478

Figure 26A shows the change in percent aggregation for an FGF21 control (WT) and FGF21 A45K. following incubation of 65 mg/mL protein at 4°C for 1, 2, and 4 days. The data indicated that the A45K mutation leads to a decrease in aggregation of the protein, compared to the wild-type protein. 5 Figure 26B shows the change in percent aggregation for an FGF21 control (WT) and FGF21 P78C, FGF21 P78R, FGF21 L86T, FGF21 L86C, FGF21 L98C, FGF21 L98R, FGF21 All IT, FGF21 A129D, FGF21 A129Q, FGF21 A129K, FGF21 A134K, FGF21 A134Y, and FGF21 A134E following incubation of 65 mg/rnL protein at 4°C for 1,6, and 10 days. The data indicated that the FGF21 L86C, 10 FGF21 L98C, FGF21 L98R,FGF21 All IT, FGF2I A129Q, andFGF21 A129K lead to a decrease in aggregation of the protein, compared to the wild-type protein.

Figure 27 shows the results of an ELK-lucifcrase activity assay performed on a human FGF21 control and the FGF21 mutants FGF21 A45K, FGF21 L52T, and FGF21 L58E. This experiment demonstrates that the FGF21 A45K mutant retains the 15 full efficacy of wild-type FGF21 and exhibits a potency that is even greater than wild-type FGF21. However, the FGF21 L52T, and FGF21 L58E mutants show reduced potency and efficacy as compared with wild-type FGF21.

Figures 28A-28B show the change in aggregation levels for the Fc-(L15)-FGF21 mutants Fc-(L15)-FGF21 (6-181, G170E), Fc-(L15)-FGF21 (A45K, G170E), 20 Fc-(L15)-FGF21 P171E, Fc-(L15)-FGF21 P171A, Fc-(L15)-FGF21 G170E, and an FGF21 control following incubation at 4°C for 1, 4, and 8 days. This experiment demonstrates that over the 8 day period, the Fc-(L15)-FGF21 (A45K, G170E) mutant showed less aggregation than did the Fc-(L15)-FGF21 G170E or Fc-(L15)-FGF21 P171E mutants, but all three mutants showed less aggregation than did the Fc-(L15)- 25 FGF21 control. Table 17 shows the percent aggregation obtained for an Fc-(L15)-FGF21 control and the Fc-(L15)-FGF21 (A45K, G170E) mutant following incubation at 4°C or room temperature for 0,2, 3, 4, or 7 days.

Table 17 30 Percent Aggregation for Fc-FGF21 and Fc-FGF21 Mutant

Sample DayO Day 2 Day 3 Day 4 Day 7 Fc-(L15)-FGF21 WT 4°C 1.12 1.71 1.89 2.14 2.32 32 mg/mL RT 1.12 6.09 7.94 9.57 12.59 83 WO 2010/129503 PCT/US2010/033478

Sample Day 0 Day 2 Day 3 Day 4 Day 7 Fc-(L15)-FGF21 (A45K,G170E) 4°C 0.45 0.77 0.88 1.03 1.24 33 mg/mL RT 0.45 3.86 5.22 6.62 8.60 EXAMPLE 20

Preparation and Expression of Fc-FGF21 Fusion Combination Mutants

As described above, the stability and solubility of FGF21 can be modulated 5 through the introduction of specific truncations and amino acid substitutions. In addition, FGF21 stability can be further enhanced by fusing such modified FGF21 proteins with the Fc portion of the human immunoglobulin IgGl gene. Moreover, by introducing combinations of the above modifications, FGF21 molecules having both enhanced stability and solubility can be generated. Nucleic acid sequences encoding 10 the FGF21 combination mutants listed in Table 18 were prepared using the techniques described above. The linker employed was the L15 linker, GGGGGSGGGSGGGGS (SEQ IDNO:28).

Table 18 15 FGF21 Combination Mutants

Amino Acid Residues Proteolysis Mutation Aggregation Mutation Fc Linker 1-181 G170E A45K -nh2 L15 1-181 G170E L98R -nh2 L15 1-181 G170E A45K, L98R -nh2 L15 1-181 P171G A45K -nh2 L15 1-181 P17IS A45K -nh2 L15 1-181 P171G L98R -nh2 L15 1-181 P171S L98R -nh2 L15 1-181 P171G A45K, L98R -nh2 L15 1-178 G170E -NH2 L15 6-181 G170E -nh2 L15 6-181 G170E A45K -nh2 L15 6-181 G170E L98R -nh2 L15 6-181 P171G -nh2 L15 6-181 P171G L98R -nh2 L15 7-181 G170E -NH, L15

Figure 29 shows the blood glucose levels measured in mice injected with the Fc-(L15)-FGF21 combination mutants Fc-(L15)-FGF21 (A45K, G170E), Fc-(L15)-FGF21 (A45K, P171G), or Fc-(L15)-FGF21 (L98R, P171G). 84 WO 2010/129503 PCT/US2010/033478

In another experiment the FGF21 mutant Fc-(L15)-FGF21 (L98R, P171G) was studied side-by-side with wild-type mature FGF21 and Fc-FGF21. In one experiment, a recombinant 293T cell line was cultured in the presence of different concentrations ofFGF21, Fc-(L15)-FGF21, orFc-(L15) FGF21 (L98R, P171G) for 6 5 hours. Cell lysates were then assayed for lucifcrase activity. As shown in Figure 30, Fc-(L15)-FGF21 (L98R, P171G) had similar activity to Fc-(L15)-FGF21, indicating that the introduction of the two point mutations didn’t alter the molecule’s in vitro activity.

In yet another experiment, the stability of the Fc-(L15)-FGF21 (L98R, P171G) 10 at 65 mg/mL was evaluated for nine days at two different temperatures, namely room temperature and 4°C, side-by-side with FGF21 and Fc-(L15)-FGF21. After the incubation period cell lysates were then analyzed with SEC-HPLC to determine an aggregation versus time profile at various temperatures. The data shown in Figure 31A and 3 IB indicate that the rate of aggregation formation was significantly reduced 15 in the Fc-(L15)-FGF21 (L98R, P171G) at room temperature (solid triangles, dotted line in Figure 31 A) and at 4°C (solid triangles, dotted line in Figure 31B). EXAMPLE 21

Proteolysis-resistant FGF21 Mutants Comprising C-terminal Mutations 20 The in vivo stability of combination mutants was also studied. Specifically, the in vivo stability of Fc-(L15)-FGF21 (L98R, P171G) was compared with the stability of Fc-(L15)-FGF21 in murine and cynomolgus models. The results were found to be similar in both species. In the cynomolgus study, Fc-(L15)-FGF21 (L98R, P171G) and Fc-(L15)-FGF21 were injected IV at 23.5 mg/kg and aliquots of 25 serum and plasma were collected at time points out to 840 hours post dose. Time points out to 168 hours were analyzed. Time point samples were affinity-purified using anti-Fc reagents, then analyzed using MALDI mass spectrometry. The results correlated well between the two analyses.

Analyzing data generated using immu no affinity-MALDI, clipping at the P171 30 site was seen to be eliminated in the Fc-(L15)-FGF21 (L98R, P171G) molecule as a result of the mutation of P171 to P171G. However, a minor and slow degradation resulting in a loss of up to 3 C-terminal residues was observed for Fc-(L15)-FGF21 (L98R, P171G) (Figure 32). The minor cleavages at the three C-tcrminal residues 85 WO 2010/129503 PCT/US2010/033478 were also observed with other FGF21 mutants after the more susceptible cleavage site between amino acid residues 171 and 172 was blocked as shown in Figures 20 and 21. The 3 C-tcrminal residue cleavage may represent the cessation of cleavage from the C-tcrminal end of the molecule by a carboxy peptidase in a sequential, residue-by- 5 residue fashion or a specific protease attack at amino acid residues 178 and 179 with non-specific clipping at amino acid residues 179-180 and 180-181. The loss of 2-3 amino acids at the C-terminus could cause reduced β-Klotho binding and ultimately decreased potency and in vivo activity of the molecule See, e.g., Yic et al., 2009, FEBS Lett. 583:19-24. To address the apparent carboxypeptidase degradation of the 10 C-terminus, the impact of adding an amino acid residue “cap” to various FGF21 mutant polypeptides were studied. A variety of constructs, including those presented in Table 19, were made and assayed using the techniques described herein. Table 19 summarizes the results of the in vitro ELK luciferase assay.

Suitable amino acid caps can be between 1 and 15 amino acids in length, for 15 example 1, 2, 3,4, 5, 10 or 15 amino acids in length. Any number and type of amino acid(s) can be employed as a cap, for example, a single proline residue, and single glycine residue, two glycine residues, five glycine residues, as well as other combinations. Additional examples of caps arc provided in the instant Example and in Table 19. 20 Additionally, to address the apparent protease attack at amino acid residues 178 and 179, mutation of amino acid residues at positions 179, 180 and 181 was studied. Again, a variety of constructs, including those presented in Table 19, were made and assayed using the techniques described herein. The impact of combinations of cap and mutations at these sites was also explored. Table 19 summarizes 25 exemplary constructs that were made and studied in the in vitro ELK-1 ucifcrasc assay, which was performed as described herein. Consistent with the terminology used herein, hFc means a human Fc sequence (i.e., SEQ ID NO:1 i), LI5 refers to the LI5 linker (i.e., GGGGGSGGGSGGGGS, SEQ ID NO:28). 30 Table 19

Efficacy and EC50 Values for FGF21 Polypeptides Comprising C-terminal Modifications

Constructs EC50(nM) Efficacy huFGF21 0.4 100.0% 86 WO 2010/129503 PCT/US2010/033478

Constructs EC50(nM) Efficacy hFc-(L15)-hFGF21(L98R, P171G) 2.5 76.1% hFc-(L15)-hFGF21(L98R, P171G, Y179F) 2.6 78.3% hFc-(L15)-hFGF21(L98R, P171G, 1-180) hFc-(L15)-hFGF21(L98R, P171G, 1-179) 7.8 77.4% hFc-(L15)-hFGF21(L98R, P171G, A180E) 1.9 79.6% hFc-(L15)-hFGF21(L98R, P171G, S181K) 130 87.9% GSGSGSGSGS-hFGF21 -(L15)-hFc MKEDD-hFGF21 -(L15)-hFc 834 83.1% hFc-(LI5)-hFGF21(L98R, P171G, S18IP, Pl82) 272 69.9% hFc-(L15)-hFGF21(L98R, P171G, A180G) 3.25 76.9% hFc-(L15)-hFGF21(L98R, P171G, S181G) 3.43 77.3% hFc-(L15)-hFGF21(L98R, P171G, LI82) hFGF21(L98R, P171G, G182) hFc-(L15)-hFGF21(L98R, P171G, Y179P) 428 44.4% hFc-(L15)-hFGF21(L98R, P171G, Y179G) 61 82.6% hFc-(L15)-hFGF21(L98R, P171G, Y179S) 25.3 74.8% hFc-(L15)-hFGF21(L98R,P171G, Y179A) 43.2 79.6% hFc-(L15)-hFGF21(L98R, P171G, S18 IT) 3.07 77.6% hFc-(L15)-hFGF21(L98R, P171G, SI81A) 2.66 73.5% hFc-(L 15)-hFGF21 (L98R, P171G, S181L) 3.46 72.6% hFc-(L 15)-hFGF21 (L98R, P171G, S181P) 33.8 79.5% hFc-(L 15)-hFGF21 (L98R, P171G, A180P) 617 77,1% hFc-(L 15)-hFGF21 (L98R, P171G, A180S) 2.18 84.7% hFGF21(L98R, P171G, GGGGG182-6) hFc-(L15)-hFGF21(L98R, P171G, P182) 6,1 85.9% hFc-(L15)-hFGF21(L98R, P171G, G182) 6.5 71.1% hFc-(L15)-hFGF21(1-178, L98R,P171G) 167 63.9% hFc-(L15)~hFGF2I(L98R, P171G, GG182-3) 1941 H.2% hFc-(L15)-hFGF21(L98R, P171G, GGGGG182-6) 4307 99.7%

Figure 33 shows the percent change in blood glucose levels observed in diabetic db/db mice (C57B6 background) injected with a PBS control, wild type native FGF21, Fc-(L15)-FGF21 (L98R, P171G) and two capped molecules to which 5 either a proline or glycine residue was added at the C-terminal end, i.e., Fc-(L15)-FGF21 (L98R, P171G, 182P) and Fc-(L15)-FGF21 (L98R, P171G, I82G). When a residue was added to the C-terminus of a wild-type or mutant FGF21 polypeptide, the residue is referred to by its position in the resultant protein. Thus, “182G” indicates that a glycine residue was added to the C-terminus of the mature 181 residue wild- 10 type or mutant protein. Figure 33 shows that native FGF21 lowered blood glucose 87 WO 2010/129503 PCT/US2010/033478 levels for 6 hours while all three Fc-FGF21 mutants studied showed sustained blood glucose-lowering activity for at least 120 hours. Fc-(L15)-FGF21 (L98R, P171G, 182P), a molecule comprising the addition of a proline residue at the C-tcrminus of the FGF21 component of the fusion molecule, appeared most potent and resulted in 5 lowest blood glucose levels compared with Fc-(L15)-FGF21 (L98R, P171G) and Fc-(L15)-FGF21 (L98R,P171G, 182G).

In a subsequent experiment, the in vivo activity of Fc-(L15)-FGF21 (L98R, P171G, 182G) and Fc-(L15)-FGF21 (L98R, P171G, 182P)was studied and compared to the in vivo activity of a capped molecule comprising a two glycine addition at the 10 C-terminus, namely Fc-(L15)-FGF21 (L98R, P171G, 182G, 183G). Figure 34 shows the percent change in blood glucose levels observed in ob/ob mice injected with PBS control, Fc-(LI5)-FGF21 (L98R, P171G), Fc-(L15)-FGF21 (L98R, P171G, 182G, 183G), Fc-(L15)-FGF21 (L98R, P171G, 182G) and Fc-(L15)-FGF21 (L98R, PI71G, 182P). 15 As shown in Figure 34, all of the molecules studied showed sustained glucose- lowering activity compared with the PBS control. This experiment confirmed the previous results (Figure 33) that Fc-(L15)-FGF21 (L98R, P171G, 182P) with a proline addition at the C-terminus showed slightly enhanced glucose-lowering efficacy compared with the molecule without a proline cap, e.g. Fc-(L15)-FGF21 20 (L98R, P171G). However, the addition of two glycine residues at the C-terminus, e.g.

Fc-(L15)-FGF21 (L98R, P171G, 182G 183G), appeared to reduce the molecule’s in vivo potency and shortened the duration of in vivo glucose-lowering effect.

Figure 35 shows the percent change in blood glucose levels observed in diabetic db/db mice (C57B6 background) injected with PBS control or the FGF2I 25 mutant polypeptides Fc-(L15)-FGF21 (L98R, P171G), Fc-(L15)-FGF21 (L98R, P171G, Y179S), Fc-(L15)-FGF21 (L98R, P171G, Y179A), Fc-(L15)-FGF21 (L98R, P171G, A180S), and Fc-(L15)-FGF21 (L98R, Pl71G, A180G). All mutants showed similar glucose-lowering activity with similar duration of action.

Figure 36 shows the percent change in blood glucose levels observed in 30 diabetic db/db mice (C57B6 background) injected with vehicle control, Fc-(L15)-FGF21 (L98R, P171G), Fc-(L15)-FGF21 (L98R, P171G, Y179F), and Fc-(L15)-FGF2I (L98R, P171G, A180E). Compared with Fc-(L15)-FGF21 (L98R, P171G), Fc-(L15)-FGF21 (L98R, P171G, Y179F) was less efficacious in lowering blood glucose. However, Fc-(L15)-FGF21 (L98R, P171G, A180E), in which alanine at 88 WO 2010/129503 PCT/US2010/033478 amino acid position of 180 was mutated to glutamic acid, was more efficacious than Fc-(L15)-FGF21 (L98R, P171G) and caused additional 20% reduction of blood glucose levels compared with Fc-(L15)-FGF21 (L98R, P171G). These data suggest that A180E mutation may have reduced the C-tcrminal degradation in vivo and 5 thereby improved in vivo potency and efficacy of the molecule. EXAMPLE 22 Rhesus Monkey Study

An Fc-Linkcr-FGF21 construct was generated using methodology described

10 herein. The construct comprised an IgG 1 Fc sequence (SEQ ID NO: 11) fused at the C-tcrminus to the L15 (Gly)s-Scr-(Gly)3-Scr-(Gly)4-Scr linker sequence (SEQ ID NO:28) which was then fused at the C-tcrminus to the N terminus of a mature FGF21 sequence (SEQ ID NO:4), into which two mutations, L98R and P171G, had been introduced. This construct was then expressed and purified as described herein. A 15 dimeric form of the protein was isolated, which was linked via intcrmolccular disulfide bonds between the Fc region of each monomer. This molecule is referred to in the instant Example 22 as “Fc-(L15)-FGF21 (L98R, Pl71G)” and has the amino acid sequence of SEQ ID NO:43 and is encoded by SEQ ID NO:42. In this Example, FGF21 refers to the mature form of FGF21, namely SEQ ID NO:4. 20 22.1 Study Design

The Fc-(L15)-FGF21 (L98R, P171G) construct was administered chronically and subcutaneously (“SC”) into non-diabctic male Rhesus monkeys with a BMI > 35. Two other groups of monkeys (n-10 per group) were treated with cither mature 25 FGF21 (i.e., SEQ ID NO:4) or a vehicle control.

Animals were acclimated for 42 days prior to administration of any test compound and were then divided into groups of 10 and administered multiple SC injections of test compounds or control article in a blinded fashion, as depicted graphically in Figure 37. In brief, each animal was injected once a day with 30 compound or vehicle. FGF21 was administered daily, whereas Fc-(L15)-FGF2I (L98R, P171G) was administered weekly. Fc-(L15)-FGF21 (L98R, P171G) and FGF21 doses were escalated every 2 weeks, as shown in Figure 37. Body weight and food intake were monitored throughout the study. The CRO was blinded to the treatment. 89 WO 2010/129503 PCT/US2010/033478

Two oral glucose tolerance tests (OGTTs) were performed prior to the start of the treatment. OGTT1 was used to sort the animals into three equivalent groups having a similar distribution of animals based on area under the curve (AUC) and body weight. The results of the second OGTT (OGTT2) were used to confirm the 5 sorting of the first OGTT (OGTT1). Monkeys with OGTT profiles that were inconsistent from one test (OGTT1) to the next (OGTT2) were excluded. The results of OGTTs 1 and 2 arc shown in Figures 38A and 38B, with AUC measurements shown in Figure 38C. Baseline body weight is shown in Figure 38D and Table 20. OGTTs 3, 4, and 5 were performed every 2 weeks at the end of each dose 10 treatment of low, mid and high doses. Blood samples were collected from fasted animals weekly and were used to measure glucose, insulin, triglyceride levels, as well as the levels of test compound. Blood samples were also collected weekly during the 3-wcek washout period.

Baseline OGTT1 and OGTT2 showed an expected glucose profile as seen in 15 normal animals, with a maximum plasma glucose obtained at 30 minutes, and demonstrated stable AUCs for the 3 different groups.

Fasting baselines values for plasma chemistry arc shown in Table 20. Plasma chemistry measurements were performed on blood samples collected prior to the start of the treatment.

Table 20

Baseline Values for Body Weight, Fasting Plasma Glucose, Insulin, and Triglyceride Levels of the Three Groups of Rhesus Monkeys

Vehicle FGF21 Fc-(L15)-FGF21 (L98R, P171G) N 10 10 10 Body weight (kg) 8.5 ±0.5 8.7 ±0.4 8.5 ±0.4 Plasma glucose 91.9 ±4.8 94.8 ±5.3 82.2 ±3.7 (mg/dL) Insulin (pg/mL) 942.6 ± 121.4 976.1 ±107.7 1023.4 ±205.1 Triglycerides (mg/dL) 44.4 ±4.8 58.6 ±5.2 71.7 ±9.8 90 WO 2010/129503 PCT/US2010/033478

Three different dose levels were selected, the low dose was 0.1 and 0.3 mg/kg, the mid dose was 0.3 and I mg/kg and the high dose was 1 and 5 mg/kg for FGF21 and Fc-(L15)-FGF21(L98R, P171G), respectively. Dose levels were chosen based on the observed dose-response in mice, with a dosing regimen based on the anticipated 5 frequency of injection in humans. Equimolar doses of FGF21 were used for the low and mid doses, and the Fc-(L15)-FGF21(L98R, P171G) high dose was raised to 5 mg/kg (i.e., instead of 3 mg/kg, which would have been equimolar to the 1 mg/kg FGF21 dose). 10 22.2 Effect of Test Compounds on Body Weight

In this experiment, in order to measure effect of the test compounds on body weight measured weekly, the percent body weight change from baseline was calculated weekly in the three different groups of Rhesus monkeys. Body weight was also measured during the three week of wash out period. Baseline body weight values 15 for each group arc included in Table 20.

Body weight was followed throughout the study, both pre- and post administration of test compounds. Body weight percent change from baseline of the vehicle animals increased with time, whereas body weight of animals treated with Fc-(L15)-FGF21 (L98R, Pl71G) and FGF21 decreased in a dose-dependent fashion over 20 the course of the 6 week treatment period, as shown in Figure 39. As observed previously in rodents (Xu et al., Diabetes 58(1):250-9 (2009)), treatment with FGF21 statistically significantly decreased body weight. Fc-(L15)-FGF21 (L98R, P171G) had a greater exposure than did FGF21 (Figure 48 and Figure 47, respectively), offering a possible explanation for the observation that Fc-(L15)-FGF21 (L98R, 25 P171G) showed a more pronounced body weight decrease than FGF21. 22.3. Effect of Test Compounds on Insulin Levels Insulin levels were measured in blood samples that had been collected after an overnight fast or after an afternoon meal. 30 Fasting plasma insulin levels were measured in Rhesus monkeys every week in animals treated with cither vehicle, FGF21 or Fc-(L15)-FGF21 (L98R, P171G) and during the 3-weck washout period. Fasted blood samples were drawn approximately five days after the last Fc-(L15)-FGF21 (L98R, P171G) injection and approximately 21 hours after the last FGF21 injection. 91 WO 2010/129503 PCT/US2010/033478

Fed plasma insulin levels were measured in Rhesus monkeys during the fifth and sixth week of treatment with cither vehicle or FGF21 during the high dose treatment Fed blood samples were drawn approximately three days after Fc-(L15)-FGF21 (L98R, P171G) injection and approximately 2 hours after last FGF21 5 injection. Figure 40 shows the effect of vehicle, FGF21 and Fc-(L15)-FGF21 (L98R, P171G) on fasted insulin levels over the full nine week study, while Figure 41 depicts fed insulin levels determined from samples taken during weeks 5 and 6.

Summarily, at the two highest doses, both FGF21 and Fc-(L15)-FGF21(L98R, P171G) statistically significantly decreased fasted and fed plasma insulin levels. The 10 observation that insulin levels of animals treated with FGF21 and Fc-(L15)-FGF21 (L98R, P171G) were decreased without observing increased glucose levels is indicative of increased insulin sensitivity. 22.4 Effect of Test Compounds on OGTT (Glucose and Insulin) 15 Three OGTTs (OGTTs 3, 4 and 5) were performed after treatment was initiated. OGTT5 glucose and insulin level profiles were measured in animals treated for 6 weeks with vehicle, FGF21 or Fc-FGF21 (L98R, P171G), corresponding to the last two weeks of the high dose escalation regimen. OGTT5 was conducted approximately 7 days after the last Fc-(L15)-FGF21 (L98R, P171G) injection, and 20 approximately 21 hours after the last FGF21 injection. The OGTT5 glucose and insulin profiles arc shown in Figure 42 and Figure 43, respectively. Animals treated with Fc-(L15)-FGF21(L98R, P171G) showed an improved glucose clearance compared to vehicle-treated animals only at the highest dose and at the last time point measured, as shown in Figure 42. At the end of the last dose, Fc-(L15)-FGF21(L98R, 25 Pl71G) showed the strongest improvement in glucose clearance. FGF21 showed no improvement in glucose clearance. Fc-(L15)-FGF2l (L98R, P171G) had a greater exposure than did FGF21 (Figure 48 and Figure 47, respectively), offering a possible explanation for the observation that Fc-(LI5)-FGF21 (L98R, P17IG) showed a more pronounced effect in glucose clearance than FGF21. Insulin levels during OGTT5 30 were statistically significantly lowered at the last time point measured in animals treated with Fc-(L15)-FGF21 (L98R, P171G) compared to animals treated with vehicle.

Glucose AUC percent change from baseline was calculated for the three OGTT (OGTTs 3, 4 and 5) performed at the end of each of the low, mid and high 92 WO 2010/129503 PCT/US2010/033478 doses in the three groups different groups of Rhesus monkeys as shown in Figure 44. OGTT5 was conducted approximately seven days after the last Fc-(L15)-FGF21 (L98R, P171G) injection and 21 hours after last FGF21 injection and showed that Fc-(L15)-FGF21 (L98R, P171G) statistically significantly reduced AUC5. Baseline 5 OGTT values for each group are shown on Figure 38C.

Fasted plasma glucose levels were measured on days when no OGTTs were performed. There were no meaningful statistical differences observed in fasted plasma glucose levels measured among the three groups of animals. 10 22.5 Effect of Test Compounds on Triglyceride Levels

Percent change of fasting plasma triglyceride levels was calculated in Rhesus monkeys every week in animals treated with either vehicle, FGF21 or Fc-(L15)-FGF21 (L98R, P171G) and during the 3-weck washout period. Fasted blood samples were drawn approximately five days after last Fc-(L15)-FGF21 (L98R, P171G) 15 injection and approximately 21 hours after last FGF21 injection. Triglyceride levels were measured every week after the treatment was initiated and percent changes from baseline arc shown in Figure 45, fasting baseline values arc shown in Table 20.

As depicted in Figure 45, animals treated with either Fc-(L15)-FGF21 (L98R, P171G) or FGF21 showed a dose-dependent decrease in triglyceride levels, with Ροζ 0 (LI5)-FGF21 (L98R, P171G) having the greatest lowering effect compared to FGF21.

Figure 46 shows the plasma triglyceride levels in samples acquire from Rhesus monkeys in a fed state, during the fifth and sixth week of treatment with vehicle or Fc-(L15)-FGF21 (L98R, P171G) or FGF21. Fed blood samples were drawn approximately 3 days after Fc-(L15)-FGF21 (L98R, P171G) injection and 25 approximately 2 hours after last FGF21 injection. Fed plasma triglyceride levels of animals treated with FGF21 and Fc-(L15)-FGF21 (L98R, P171G) were statistically significantly reduced, compared to the triglyceride levels of animals treated with vehicle (Figure 46). 30. 22.6 Concentration of Test Compounds

The exposure of the tested compounds administered at approximately equivalent molar dose levels was assessed throughout the study period. The concentration of Fc-(L15)-FGF21 (L98R, P171G) was measured at pre-dose, and approximately 5 days after the last injection. FGF21 levels were measured at pre 93 WO 2010/129503 PCT/US2010/033478 dose, and at 5, 12, 19, and 26 days. Blood samples were drawn at approximately 21 hours after the last injection.

The individual concentration of the tested compounds in each monkeys arc shown in Figures 47 and 48. As shown in Figure 47, the majority of the animals in 5 the FGF21-treated group had concentrations below the quantitation limit. Figure 48 shows that animals in the Fc-(L 15)-FGF21 (L98R, P171G)-trcated group had detectable levels of Fc-(L15)-FGF21 (L98R, P171G) during each dosing phase (two weekly doses at the same dose strength). The average concentration from each dosing phase increased approximately dose-proportionally from 0.3 to 5 mg/kg for Fc-(L15)- 10 FGF21 (L98R, P171G). There is minimal accumulation as demonstrated by the steady concentrations after the first and second weekly dose within each dose escalation phase for both compounds. During the treatment-free phase (washout period) Fc-(L15)-FGF2I (L98R, P171G) levels were detectable up to approximately day 47 (12 days post last dose) and were below lower limit of quantification (LLOQ) 15 afterwards.

Exposure of the test compounds was also monitored during each OGTT. FGF21 was not detectable during OGTTs 3 and 4, following low- and mid-dose FGF21 treatment. However, measurable levels were observed during OGTT5, following high-dose treatment A dose proportional increase in Fc-(L15)-FGF21 20 (L98R, P171G) levels was observed across the third to fifth OGTT with escalating dose levels, as shown in Figure 49.

Compound levels data confirm that the animals were exposed to the expected amount of each compound, namely FGF21 and Fc-(L15)-FGF21 (L98R, P171G), in a dose escalation manner. A large variability was observed in the amount of FGF21 25 measured, which was an expected result considering the sampling was performed approximately 21 hours post the last dose and the half life of FGF21 is approximately 1 hour. 22.7 Conclusions 3 0 FGF21 decreased fasted and fed plasma triglyceride and insulin levels and decreased body weight at the highest doses. Fc-(L15)-FGF21 (L98R, P171G) improved OGTT and decreased insulin levels at the highest dose, and dose dcpcndcntly decreased fasted and fed plasma triglyceride levels as well as body weight. Both FGF21 and Fc-(L15)-FGF21(L98R, P171G) decreased a number of metabolic 94 WO 2010/129503 PCT/US2010/033478 parameters in the non diabetic Rhesus monkeys. Insulin and triglyceride level decreases were identical between FGF21 and Fc-(L15)-FGF21 (L98R, P171G) when circulating compound levels were in a similar range, in the fed condition. Due to its improved properties, Fc-(L15)-FGF21 (L98R, P171G) was superior to FGF21 in most of 5 the parameters measured and could be administered oncc-a-wcek to observe efficacy on metabolic parameters. EXAMPLE 23

Fc-(G4S)3-FGF2I(L98R, P171G, A180E) Fc fusion Molecule An Fc fusion comprising an FGF21 mutant, which was joined to an IgGl Fc 10 component by a linker, was generated. The FGF21 component of the Fc fusion comprised three point mutations engineered in the polypeptide sequence of FGF21, namely L98R, P171G, A180E (numbering based on the mature form of FGF21, provided as SEQ ID NO:4). This molecule was constructed by conjugating a human Fc (SEQ ID NO: 11) to the N-tcrminus of the L98R, P171G, A180E mutant FGF21 15 (SEQ ID NO:39) via a 15 amino acid linker comprising the sequence of GGGGSGGGGSGGGGS (SEQ ID NO:31). This molecule was designated as “Fc-(G4S)3-FGF21(L98R, P171G, A180E)” and its full length amino acid sequence is shown in Figure 50 and in SEQ ID NO:47; it is encoded by the nucleic acid of SEQ ID NO:46. In vitro testing of Fc-(G4S)3-FGF21(L98R, P171G, A180E) showed it is 20 a potent stimulator of Erk phosphorylation in a recombinant cell line overexpressing β-Klotho. Fc-(G4S)3-FGF21 (L98R, P171G, A180E) also showed enhanced β-Klotho binding affinity compared with Fc fusion of wild type FGF21 or Fc fusion of FGF21-(G4S)3-FGF21 (L98R, P171G) (SEQ ID NO:45). When injected into diabetic animal models, Fc-(G4S)3-FGF21(L98R, P171G, A180E) reduced blood glucose 25 levels, decreased body weight, and· was suitable for biweekly injection. 23.1

In vitro Activity of Fc-(G4S)3-FGF21(L98R, P171G, A180E) Experiments were performed to examine whether Fc-(G4S)3-FGF21 (L98R, P171G, A180E) retains similar activity to Fc fusion of wild type FGF21 or wild type 30 native FGF21 in an ELK-luciferase in vitro assay.

ELK-luciferase assays were performed using a recombinant human 293T kidney cell system, in which the 293T cells overexpress β-Klotho and lucifcrasc 95 WO 2010/129503 PCT/US2010/033478 reporter constructs, β-klotho is a co-rcceptor required for FGF21 to activate FGF receptors and induce intracellular signal transduction, including Erk phosphorylation. The Erk- lucifcrase reporter constructs contain sequences encoding GAL4-ELK1 and 5xUAS-Luciferasc reporter. The 5xUAS-Luciferase reporter is driven by a promoter 5 containing five tandem copies of the Gal4 binding site. The reporter activity is regulated by the level of phosphorylatcd Erk, and is used to indirectly monitor and quantify FGF21 activity. ELK-lucifcrasc assays were performed by culturing the 293T cells in the presence of different concentrations of wild-type FGF21, Fc fusion of wild type 10 FGF21, FC-L15-FGF21 (L98R, P171G, A180E) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) for 6 hours, and then assaying the cell lysates for lucifcrase activity. The luminescences obtained in ELK-lucifcrase assays for each of the FGF21 constructs were expressed in y-axis and the compound concentrations were expressed in x-axis. 15 Figure 51 shows the dose-response of the tested compounds in Erk-luciferase assays. Fc-(G4S)3-FGF21 (L98R, P171G, A180E) retained similarly activity compared with Fc fusion of FGF21 wild type, suggesting that a combination of mutations with L98R, P171G and A180E didn’t change the bioactivity of FGF21. Compared with native wild type FGF21, Fc fusion constructs showed slightly reduced 20 potency and the maximal activity in this cell-based kssay with the co-reccptor β-Klotho overexpressed. 23.2

In vitro Activity of Fc-FGF21(L98R, P171G, ΑΪ80Ε) Fusions Comprising 25 Different Linker Sequences A similar Fc fusion analog was generated by fusing the human lgGl Fc to FGF21 (L98R, P171G, A180E) via a different linker sequence, GGGGGSGGGSGGGGS (SEQ ID NO:28). This linker was designated L15 and the resulting fusion molecule was designated Fc-L15-FGF21 (L98R, P171G, A180E) 30 (SEQ ID NO:57). In this experiment, the effect of different linker sequences on the activity of Fc-FGF21 (L98R, P171G, A180E) fusions was studied. ELK-lucifcrasc assays were performed by culturing the 293T cells in the presence of different concentrations of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) 96 WO 2010/129503 PCT/US2010/033478 and Fc-L15-FGF21 (L98R, P171G, A180E) for 6 hours, and then assaying the cell lysates for lucifcrasc activity. Fc-(G4S)3-FGF21 (L98R, P171G, A180E) showed similar activity to Fc-L15-FGF21 (L98R, P171G, A180E), indicating that different linker sequences, e.g., (G4S)3 or L15 linkers, had no significant impact on the 5 bioactivity of Fc-FGF21 fusions. 23.3

In vitro Binding Affinity of Fc-(G4S)3-FGF21(L98R, P171G, A180E) for β-Klolho in Binding Assays 10 The binding of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) to human and cyno β-Klotho was tested in a Biacorc solution equilibrium binding assay. The affinity of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) was also compared with an Fc- fusion FGF21 analog with only L98R and P171G mutations, namely Fc-Ll5-FGF21 (L98R, P171G) (SEQ ID NO:43). 15 Neutravidin was immobilized on a CMS chip using amine coupling. Biotin- FGF21 was captured on the second flow cell to -1500RU. The first flow cell was used as a background control. FGF21 mutants at 5x dilutions (0.03-2000 nM) were incubated with lOnM human or 25nM cyno β-Klotho in PBS plus O.lmg/ml BSA, 0.005% P20 at room temperature for 1 hour. Binding of the free β-Klotho in the 20 mixed solutions was measured by injecting over the biotin-FGF21 surface. 100% β-Klotho binding signal was determined in the absence of FGF21 mutants in the solution. A decreased β-Klotho binding response with increasing concentrations of FGF21 mutants indicated that β-Klotho was binding to FGF21 mutants in solution, which blocked β-Klotho from binding to the immobilized biotin-FGF2l surface. 25 Relative binding of the mixture versus molar concentration of FGF21 was plotted using GraphPad Prizm 5. ECsowas calculated using one site competition nonlinear fit in the same software.

Figure 52 showed the results from a Biacorc solution equilibrium binding assay of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) and Fc-L15-FGF21 (L98R, 30 P171G) to human (right) and cyno β-Klotho (left). Fc-(G4S)3-FGF2I (L98R, P171G, A180E) showed at least 2x improved binding activity to both human and cyno β-Klotho compared to Fc-L15-FGF21 (L98R, P171G). 97 WO 2010/129503 PCT/US2010/033478 23.4

In vivo Efficacy of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) in Diabetic db/db Mice

The question of whether Fc-(G4S)3-FGF21 (L98R, P171G, A180E) could 5 exert metabolic beneficial effects, such as lowering blood glucose and reducing body weight, in diabetic db/db mice was studied. The study was also intended to examine the duration and dose response of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) after a single injection. Fc-(G4S)3-FGF21 (L98R, P171G, A180E) at doses of 0.1, 0.3, 1 and 3 mg/kg was intraperitoncally injected into diabetic db/db mice. A vehicle (lOmM 10 Tris, 2.2% sucrose, 3.3% Sorbitol, pH8.5)-trcatcd group was also included in the study. Blood samples were obtained from each animal (n=10 per group) at baseline (before injection), and 6, 24, 72, 120, and 168 hours after injection. Blood glucose levels were measured with a OncTouch Glucomctcr (LifeScan, lne. Milpitas, CA). Body weight was measured at baseline (time 0), 24, 72, 120, and 168 hours after 15 injection.

Figure 53A shows the blood glucose levels in db/db mice at various time points following vehicle or Fc-(G4S)3-FGF21 (L98R, P171G, A180E) injection. Fc-(G4S)3-FGF21 (L98R, P171G, A180E) resulted in a dose-dependent decrease in blood glucose levels in db/db mice. The maximum glucose reduction was about 50% 20 from baseline or compared with the vehicle-treated group. The maximum effect was reached within 6 hours after injection and sustained for 120 hours post injection. The blood glucose levels started to return to baseline in about 168 hours. The estimated ED50, the dose required to achieve the half maximum effect, for Fc-(G4S)3-FGF21 (L98R, P171G, A180E) was approximately 1 mg/kg in db/db mice. 25 Figure 53B shows the effect of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) on body weight after a single injection into db/db mice. Results arc expressed as change of body weight from time 0 (before injection). Vehicle-treated mice showed progressive and stable body weight gain during the 7 days study period. However, the rate of body weight growth was inhibited in mice treated with Fc-(G4S)3-FGF21 30 (L98R, P171G, A180E) in a dose-dependent manner. The higher the dose, the longer the growth inhibition was. In one example, Fc-(G4S)3-FGF21 (L98R, P171G, AI80E) blunted body weight gain for 5 days at 3 mg/kg, 3 days at 1 mg/kg, or 1 day 98 WO 2010/129503 PCT/US2010/033478 at 0.3 mg/kg. The growth rates were recovered afterwards. The estimated ED50 of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) on body weight reduction was approximately 1 mg/kg in this experiment. 5 23.5

Efficacy Comparison of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) and Fc-(LIS)- FGF21(L98R, P171G) in DIO Mice with Different Injection Frequencies

The study was to determine whether Fc-(G4S)3-FGF21 (L98R, P171G, A180E) could be injected less frequently than Fc-(L15)-FGF21 (L98R, P171G) but 10 achieve similar efficacy. The study was conducted in DIO mice with Fc-(G4S)3-FGF21 (L98R, P171G, A180E) given once a week (Q7D) or once every two weeks (Q14D), or Fc-L15-FGF21 (L98R, P171G) administered at twice a week (BIW), Q7D or Q14D. DIO mice were prepared by feeding 4-wcek old male C57BL/6 mice a high 15 fat-diet that contained 60% of energy from fat enriched with saturated fatty acids (D12492, Research Diets, Inc., New Brunswick, NJ). After 12 weeks of high fat diet feeding, body weight and blood glucose levels were measured. DIO mice were then randomized into vehicle or treatment groups to achieve similar baseline average blood glucose levels and body weight. A total of 7 groups were included in the study: 2 0 vehicle administered at Q7D; Fc-(G4S)3-FGF21 (L98R, P171G, A180E) administered at Q7D or Q14D; or Fc-(L15)-FGF21 (L98R, P171G) administered at BIW, Q7D or Q14D. The injection was intrapcritoncal and the study was carried out for 31 days. Body weight was measured weekly. A GTT was performed at study day 28 and the study was terminated at day 31. The study design is shown graphically in 25 Figure 54.

Figure 55 shows the GTT profiles in mice treated with vehicle, Fc-(G4S)3-FGF21 (L98R, P171G, A180E) or Fc-(L 15)-FGF21 (L98R, P171G) at different dosing frequencies. Glucose tolerance was statistically significantly improved in mice treated with Fc-(G4S)3-FGF21 (L98R, P171G, A180E) at either Q7D or Q14D 3 0 dosing when compared with vehicle, suggesting that Fc-(G4S)3-FGF21(L98R, P171G, A180E) is efficacious and suitable for Q14D administration in DIO mice. Fc-(L15)-FGF21(L98R, PI71G) improved glucose tolerance when administered at BIW or Q7D, but not Q14D, suggesting that Fc-(L15)-FGF21(L98R, P171G) may be less 99 WO 2010/129503 PCT/US2010/033478 suitable for Q14D injection in mice. The efficacy of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) at Q7D or Q14D was comparable to that of Fc-(L15)-FGF21(L98R, P171G) at BIW or Q7D respectively, suggesting that Fc-(G4S)3-FGF21(L98R, P171G, A180E) could be given 2 fold less frequently than Fc-(L15)-FGF21(L98R, 5 P171G).

Figure 56 shows changes of body weight from baseline (day 0) in mice treated vehicle, Fc-(G4S)3-FGF21 (L98R, P171G, A180E) or Fc-(L15)-FGF21 (L98R, P171G) at different dosing frequencies. Mice treated Q7D with Fc-(G4S)3-FGF21 (L98R, P171G, A180E) lost significant body weight as did mice treated BIW with Fc-(L15)-FGF21 (L98R, 10 P17IG). The body weight was moderately reduced in mice treated Q14D with Fc-(G4S)3- FGF21 (L98R, P171G, A180E) or Q7D with Fc-(L15)-FGF21 (L98R, P171G). No significant body weight effect was observed in mice treated Q14D with Fc-(L15)-FGF21 (L98R, P171G). The effect on body weight was consistent with that on GTT as described above, suggesting that Fc-(G4S)4-FGF21 (L98R, P171G, A180E) was efficacious at Q14D dosing 15 and required about 2 fold less frequent injections than Fc-(L15)-FGF21 (L98R, P171G) to achieve the same effect. EXAMPLE 24

Hydrogel Formulations Comprising FGF21 Mutants 20 As a formulation agent for protein-based therapeutics, hydrogels offer a number of desired properties. For example, hydrogels preserve the native structure and function of the protein incorporated in the hydrogel. Moreover, they are well tolerated and depending on the polymer and type of crosslinking, they may be biodegradable. Additionally, hydrogels have previously been used successfully for 25 sustained release of proteins. Accordingly, hydrogels were investigated as a possible delivery method for the FGF21 mutants disclosed herein.

For all experiments described in this example, hydrogels were prepared as follows. A 1.25% bovine gelatin (Sigma) solution in PBS was prepared. The crosslinking agent methacrylic anhydride was added to a molar ratio (MA to gelatin) of 30 16:1, 24:1 or 32:1. The resulting solution was dialyzed against water to remove any un-polymerized methacrylamide to create a hydrogel vehicle. Finally, the hydrogel vehicle was lyophilized and stored at 4°C until ready to make hydrogels comprising an FGF21 mutant. This prep can be used to prepare gelatin-based hydrogel vehicles 100 WO 2010/129503 PCT/US2010/033478 that can subsequently be adapted to comprise any of the FGF21 mutants disclosed herein.

Hydrogels with specific FGF21 mutants were then prepared. Starting with a 10% lyophilized, methacrylic gelatin hydrogel vehicle, solutions were prepared. The 5 hydrogel vehicles were warmed and then centrifuged to dissolve and liquify the lyophilized MA gelatin hydrogel vehicle. The selected FGF21 protein, (FGF21 (L98R, P171G), (SEQ ID NO:37)) in the instant Example), was then added to the liquefied gelatin solution to a pre-determined concentration. A TEMED stock solution was then added. A KPS stock solution was then added and the solution was 10 mixed gently. 1 ml syringes were filled to 200 μΐ and allowed to set for 1.5 to 2 hours at room temperature. The syringes were stored at -20°C and thawed at 4°C overnight prior to use. Hydrogel vehicle comprising lOmM Tris, 9% sucrose, pH8.5 with no FGF21 mutant added was used as a control.

For the in vivo experiments, the syringes were put on heating pad at 37°C for 15 approximately 10 minutes before injection into the animals. 24.1

In vitro Activity of FGF21 (L98R, P171G) Released from 10% Hydrogels with Various Crosslink Ratios 20 A goal of this experiment was to test whether FGF21 (L98R, P171G) released from hydrogel is biologically active compared with the native form of FGF21 (L98R, P171G) in an ELK-luciferase in vitro assay. FGF21 (L98R, P171G) was prepared and incorporated into 10% methacrylic gelatin solutions with methacrylic gelatin crosslink ratios at 16:1, 24:1 and 32:1 as 25 described. The hydrogels were then dispersed into an in vitro buffer solution to allow release of FGF21 (L98R, P171G). The medium were collected after 100 or 150 hours and subject to in vitro assays for FGF21 (L98R, P171G) activity. Analytical assays (e.g., SDS-PAGE, size exclusion HPLC, and reverse phase HPLC) show the FGF21 (L98R, P171G) released was intact at all time points.

30 ELK-luciferase assays were performed using a recombinant human 293T

kidney cell system, in which the 293T cells overexpress β-Klotho and lucifcrasc reporter constructs. β-Klotho is a co-receptor that is required by FGF21 for activation of its FGF receptors. The FGF receptors used in this assay arc endogenous FGF 101 WO 2010/129503 PCT/US2010/033478 receptors expressed in 293T kidney cell. The lucifcrasc reporter constructs contain sequences encoding GAL4-ELK1 and a lucifcrasc reporter driven by a promoter containing five tandem copies of the GaI4 binding site (5xUAS-Luc). Lucifcrasc activity is regulated by the level of phosphorylated Erk/ELKl, and is used to 5 indirectly monitor and quantify FGF21 activity. ELK-luciferase assays were performed by culturing the 293T cells in the presence of different concentrations of the native form of FGF21 (L98R, P171G) or hydrogel-released FGF21 (L98R, P171G) for 6 hours, and then assaying the cell lysates for lucifcrasc activity. Figure 57 shows the in vitro results from the ELK- 10 lucifcrasc assay. FGF21 (L98R, P171G) released from hydrogels with methacrylic gelatin crosslink ratios at 16:1, 24:1 and 32:1 was biologically active with equivalent activity to the native form of FGF21 (L98R, P171G). The data demonstrated that the hydrogel preserved the structure and function of the incorporated protein and the released FGF21 (L98R, P171G) is active and stable even after 10-15 hours in the 15 medium. 24.2

In vivo efficacy of Hydrogel FGF21 (L98R, P171G) at Different Crosslink Ratios in ob/ob Mice 20 The goal of this experiment was to determine whether an FGF21 (L98R, P171G) hydrogel prepared with methacrylic gelatin crosslink ratios at 24:1 and 32:1 provided a sustained release of biologically active FGF21 (L98R, P171G) in vivo and ultimately resulting in longer in vivo efficacy as compared with native form of FGF21 (L98R, P171G). In addition, based on the assessment of in vitro release rates, it was 25 determined that higher cross-linking ratios of methacrylic gelatin gives better sustained release of the incorporated FGF21 (L98R, P171G). Therefore, another goal of this experiment was to compare two FGF2I (L98R, P171G) hydrogels prepared with methacrylic gelatin crosslink ratios at 24:1 and 32:1. FGF21 possesses a number of biological activities, including the ability to 3 0 lower blood glucose, insulin, triglyceride, or cholesterol levels; reduce body weight; or improve glucose tolerance, energy expenditure, or insulin sensitivity. FGF21 (L98R, P171G) hydrogels were introduced into insulin resistant ob/ob mice, and the abilities of FGF21 (L98R, P171G) hydrogel to lower blood glucose and reduce body weight were measured. The procedure for the in vivo work was as follows. 102 WO 2010/129503 PCT/US2010/033478

Hydrogels were prepared using the procedure described above. 8 week old ob/ob mice (Jackson Laboratory) were hair-shaved at the injection site and were anesthetized with isoflurane and O2 just before injection. Hydrogels (0.2 ml) were slowly injected under the skin and Vetbond was applied at the injection site after 5 injection. Vehicle (lOmM Tris, 9% sucrose pH8.5) or native FGF21 (L98R, P171G) were also included in the experiment and injected similarly as hydrogels. Animals were returned to their cage after awaking from anesthesia. Blood samples were obtained before injection and at various time points following injection, e.g., 0, 3, 6, 24, 72, 120, 192 and 264 hours after injection. Blood glucose levels were measured 10 with a OneTouch Glucometcr (LifeScan, Inc. Milpitas, CA). Body weight was also monitored.

Figures 58 and 59 summarize the results of the experiment. Compared with vehicle or control hydrogel, the native form of FGF21 (L98R, P171G) rapidly reduced blood glucose levels at 3 and 6 hr post injection. However, the in vivo activity of the 15 native form of FGF21 (L98R, P171G) waned and the blood glucose levels returned to baseline 24 hours after injection. FGF21 (L98R, P171G) hydrogels resulted in blood glucose reduction as early as 3 hr post injection and the activity was sustained up to 8 days. There was no significant difference between the crosslink ratios at 24:1 or 32:1. FGF21 (L98R, P171G) hydrogel groups also showed slower body weight gain than 20 mice treated with vehicle or hydrogel alone. These results demonstrated that FGF21 (L98R, P171G) hydrogels prepared with methacrylic gelatin crosslink ratios at 24:1 and 32:1 arc capable of providing a sustained release of biologically active FGF21 (L98R, P171G) in vivo and ultimately resulting in longer in vivo efficacy as compared with the native form of FGF21 (L98R, P171G). 25 24.3

In vivo Efficacy of Hydrogel FGF21 (L98R, P171G) and FGF21 (L98R, P171G, A180E) at Different Crosslink Ratios in db/B6 Mice

Hydrogel formulations were prepared using bovine gelatin (Sigma) and 30 several FGF21 mutants and constructs, namely FGF21 (L98R, P171G) and Fc-(G4S)3-FGF21 (L98R, P171G, A180E). A hydrogel control was also prepared. The 0.2 mL of hydrogel was placed in a 1 ml syringe having a 21G needle.

Hydrogel controls and hydrogels comprising an FGF21 mutant were prepared as described above. 8 week old db/B6 mice (Jackson Laboratory) were hair-shaved at 103 WO 2010/129503 PCT/US2010/033478 the injection site and were anesthetized with isofluranc and O2 just before injection. Hydrogels (0.2 ml) were slowly injected under the skin and Vetbond was applied at the injection site after injection. Vehicle (lOmM Tris, 9% sucrose pH8.5) or native FGF21 (L98R, P171G) were also included in the experiment and injected similarly as 5 hydrogels. Animals were returned to their cage after awaking from anesthesia. Blood samples were obtained before injection and at various time points following injection, e.g., 0, 24, 96, 168, 240, 312 hours after injection. Blood glucose levels were measured with a OneTouch Glucometer (LifeScan, Inc. Milpitas, CA). Body weight was also monitored. 10 The experimental design was as follows:

Group of animals (n=9 per group) A. Control hydrogel 32:1 (10%) MA:HU4 200μ1 B. FGF21 (L98R, P171G) hydrogel 32:1 (10%) MA:HU4 0.5 mg/mouse (200μ1, ~ 10 mg/kg) 15 C. FGF21 (L98R, P171G) hydrogel 32:1 (10%) MA:HU4 1.5 mg/mousc (200μ1 ~ 30 mg/kg) D. Fc-(G4S)3-FGF21 (L98R, P171G, A180E) (no hydrogel) 3 mg/kg 20 Various parameters were measured and the results of the experiments arc shown in Figures 60-63. Figure 60 shows the change in blood glucose over the course of the 14 day experiment, while Figure 61 shows the percent change in blood glucose over the same period. Figure 62 shows the change in body weight over the course of the 14 day experiment, while Figure 63 shows the percent change in body weight over 25 the same period.

The results of the experiment shown graphically in Figures 60-63 can be summarized as follows: FGF21 (L98R, P171G) 32:l(10%)MA:HU4 at 10 mg/kg was efficacious in reducing blood glucose at 24 hours post injection and the blood glucose level returned 30 to baseline between 4-7 days. FGF21 (L98R, P171G) 32:l(10%)MA:HU4 at 30 mg/kg was more efficacious in reducing blood glucose than the 10 mg/kg dosage, and the blood glucose level was seen to return to baseline between 7-10 days. 104 WO 2010/129503 PCT/US2010/033478

Fc-(G4S)3-FGF21(L98R, P171G, A180E) at 3 mg/kg itself reduced blood glucose at 24 hours post injection to a degree that was similar to FGF21 (L98R, P171G) at 30mg/kg from hydrogels.

The hydrogel control (which did not comprise an FGF21 mutant) did not have 5 any effect in reducing blood glucose.

The FGF21 (L98R, P171G) hydrogel groups and Fc-(G4S)3-FGF21(L98R, P171G, A180E) (which was not presented in a hydrogel) showed reduced body weight gain compared to mice treated with a hydrogel control. 10 EXAMPLE 25

Cynomolgus Monkey Study

Two Fc-Linkcr-FGF21 constructs were generated using methodology described herein. One construct comprised an IgGl Fc sequence (SEQ ID NO:11) fused at the C-tcrminus to a (Gly)s-Scr-(Gly)3-Ser-(Gly)4-Ser linker sequence (SEQ 15 ID NO:28) which was then fused to the N terminus of a mature FGF21 sequence (SEQ ID NO:4), in which two mutations, L98R and P171G, were introduced. This molecule is referred to in the instant Example as “Fc-(L15)-FGF2l (L98R, P171G)” (SEQ ID NO:43). A second construct comprised an IgGl Fc sequence (SEQ ID NO:11) fused at the C-terminus to a (Gly)4-Scr-(Gly)4-Scr-(Gly)4-Scr linker sequence 20 (SEQ ID NO:3I) which was then fused to the N terminus of a mature FGF21 sequence (SEQ ID NO:4), in which three mutations, L98R, P171G, and A180E, were introduced. This molecule is referred to in the instant Example as “Fc-(G4S)3-FGF21 (L98R, P171G, A180E)” (SEQ ID NO:47). These constructs were then expressed and purified as described herein, and were isolated as a dimeric form of the 25 protein, each monomer of which was linked via intermolecular disulfide bonds between the Fc region of each monomer. 25.1 Study Design

The study was conducted in cynomolgus monkeys with characteristics of 30 impaired glucose tolerance (IGT). The monkeys were 8-18 years old. Their body weights ranged from 5-15 kg and BMI ranged from 32-70 kg/m2. 44 monkeys were acclimated for 6 weeks prior to the initiation of compound administration. During the acclimation period, monkeys were trained 4 times a week for 4 weeks to familiarize the procedures including chair-restrain, subcutaneous injection (PBS, 0.1 ml/kg), 105 WO 2010/129503 PCT/US2010/033478 gavagc (Water, 10 ml/kg), blood drawn for non OGTT and OGTT samples. After 4 weeks of training, baseline OGTT and plasma metabolic parameters were measured. 40 out of 44 monkeys were selected and randomized into three treatment groups to achieve similar baseline levels of body weight, OGTT AUC response, and plasma 5 glucose and triglyceride levels.

The study was conducted in a blind fashion. Vehicle (n=14), Fc-(L15)-FGF21 (L98R, P171G) (n=13) and Fc-(G4S)3-FGF2i (L98R, Pl71G, AI80E) (n=13) were labeled as compound A, B and C and administered once a week via subcutaneous injection. Compounds were given in a dose-escalation fashion from low (0.3 mg/kg), 10 medium (1 mg/kg) to high (3 mg/kg) levels and the dose was escalated every three weeks. After 9 weeks of compound treatments, animals were monitored for additional 3 weeks for compound washout and recovery from treatments. Food intake, body weight, clinical chemistry and OGTT were monitored throughout the study. Food intake was measured every meal. Body weight was measured weekly. Blood samples 15 were collected weekly 5 days post each injection to measure glucose, triglyceride, total cholesterol, HDL- and LDL-cholestcroI levels. OGTTs were conducted every three weeks after the initiation of treatments (at the end of each dose level). The day starting the treatment is designated as 0 and the detailed study plan is shown in Figure 64. 20 The results shown in this example are data collected at the end of 9 weeks treatment. 25.2 Effect of Test Compounds on Food Intake

Animals were fed twice a day, with each animal receiving 120 g of formulated 25 food established during the acclimation period. The remaining food was removed and weighed after each meal to calculate food intake. The feeding time were from 8:00 AM to 8:30 AM (±30 minutes) and then from 4:30PM to 5:00PM (±30 minutes). To produce treats, apple (150 g) was supplied to each animal at 11:30 to 12:30 PM (±30 minutes) every day. 3 0 Compared with vehicle, both Fc-(L15)-FGF21 (L98R, P171G) and Fc- (G4S)3-FGF21 (L98R, P171G, A180E) reduced food intake in monkeys (Figures 65, 66 and 67). Fc-(G4S)3-FGF21 (L98R, P171G, A180E) inhibited food intake on every meal including AM, fruit and PM meals at 0.3 mg/kg dose. However, the effect 106 WO 2010/129503 PCT/US2010/033478 diminished and the food intake returned close to baseline or control levels after about 30 days of treatment when the dose was escalated to 1 mg/kg. Fc-(L15)-FGF21 (L98R, P17IG) didn’t have a significant effect on AM food intake and only modestly reduced food intake on PM meal when the dose was escalated to 1 and 3 mg/kg. 5 However, Fc-(L15)-FGF21 (L98R, P171G) reduced fruit intake similarly as Fc-(G4S)3-FGF21 (L98R, P171G, A180E). Overall, Fc-(G4S)3-FGF21 (L98R, PI71G, A180E) showed a stronger effect on inhibiting food intake than Fc-(L15)-FGF21 (L98R, P171G). The effect on food intake appeared to be short term and food intake was recovered after approximately 30 days of treatment. 10 253. Effect of Test Compounds on Body Weight

Body weight was monitored weekly throughout the study. Over the course of the 9 week treatments, the body weight of animals treated with vehicle remained constant while body weight of animals treated with Fc-(L15)-FGF21 (L98R, P171G) 15 and Fc-(G4S)3-FGF21 (L98R, P171G, A180E) progressively decreased. Fc-(G4S)3-FGF21 (L98R, P171G, A180E) resulted in a more pronounced body weight decrease than Fc-(L15)-FGF21 (L98R, P171G) as shown in Figure 68. 25.4. Effect of Test Compounds on Body Mass Index (BMI), Skin Fold Thickness 20 (SFT) and Abdominal Circumference (AC) BMI, SFT and AC were monitored weekly throughout the study, both pre- and post-administration of test compounds when the body weight was taken. BMI is defined as the individual's body weight divided by the square of his or her height. SFT is the thickness of a double layer of skin and the fat beneath it with a special 25 caliber that exerts a constant tension on the site. BMI, SFT and AC are relatively accurate, simple, and inexpensive measurements of body composition particularly indicative of subcutaneous fat. Animals treated with vehicle showed relatively stable BMI, SFT and AC throughout the study. Animals treated with Fc-(L15)-FGF21 (L98R, P171G) and Fc-(G4S)3-FGF21 (L98R, PI71G, A180E) showed decreased 3 0 levels of BMI, SFT and AC over the course of the 9 week study, suggesting both compounds resulted in reduction of fat mass. Fc-(G4S)3-FGF21 (L98R, P171G, A180E) was more effective and resulted in more pronounced reductions in BMI, SFT and AC than Fc-(L15)-FGF21 (L98R, P171G). Results arc shown in Figures 69, 70 and 71, respectively. 107 WO 2010/129503 PCT/US2010/033478 25.5 Effect of Test Compounds on Fasting Blood Glucose Levels Blood was collected from overnight fasted animals. The blood drawn was conducted weekly at 5 days post each injection. Both Fc-(G4S)3-FGF21 (L98R, 5 P171G, A180E) and Fc-(L15)-FGF21 (L98R, P171G) reduced fasting blood glucose levels. Fc-(G4S)3-FGF21 (L98R, P171G, A180E) reduced fasting blood glucose levels at the dose of 0.3 mg/kg and the maximum glucose reduction was achieved when the dose was escalated to 1 mg/kg. However, Fc-(L15)-FGF21 (L98R, P171G) only resulted in a modest reduction of blood glucose levels at the highest dose tested 10 (3 mg/kg). Therefore, Fc-(G4S)3-FGF21 (L98R, P17IG, A180E) was more efficacious and produced more pronounced blood glucose reduction than Fc-(L15)-FGF21 (L98R, P171G). No hypoglycemia was observed in any of the monkeys treated with Fc-(G4S)3-FGF21 (L98R, P171G, A180E) or Fc-(L15)-FGF21 (L98R, P171G). Figure 72 shows the levels of fasting plasma glucose during the course of 15 study. 25.6 Effect of Test Compounds on Oral Glucose Tolerance Test (OGTT) OGTTs were conducted before and after initiation of treatments. Post-dose OGTTs were performed every three weeks to test compound effect at each dose level. 20 Fc-(G4S)3-FGF2l (L98R, P171G, A180E) improved glucose tolerance at all tested doses from 0.3 to 3 mg/kg. Glucose levels were reduced and the glucose excursion following a bolus of glucose challenge increased in response to Fc-(G4S)3-FGF2I (L98R, P171G, A180E) treatment. There was no dose-response observed suggesting that Fc-(G4S)3-FGF21 (L98R, P171G, A180E) achieved its maximal effect at the 25 dose of 0.3 mg/kg. Fc-(L15)-FGF21 (L98R, P171G) only resulted in an improvement of glucose tolerance at 1 mg/kg dose and it was not clear why the effect diminished when the dose was escalated to 3 mg/kg. Figure 73 shows pre- and post-OGTT curve profiles and the area under the OGTT curve. 30 25.7 Effect of Test Compounds on Trigylceride Levels

Blood was collected from overnight fasted animals. The blood drawn was conducted weekly at 5 days post each injection. Triglyceride levels were significantly reduced in animals treated with Fc-(G4S)3-FGF21 (L98R, P171G, A180E) or Fc-(L15)-FGF21 (L98R, P171G). However, Fc-(G4S)3-FGF21 (L98R, P171G, A180E) 108 WO 2010/129503 PCT/US2010/033478 was more effective than Fc-(L15)-FGF21 (L98R, P171G). Fc-(G4S)3-FGF21 (L98R, P171G, A180E) resulted in a maximal reduction of plasma triglyceride levels at 0.3 mg/kg while Fc-(L15)-FGF21 (L98R, P171G) only resulted in an intermediate reduction of triglyceride levels with the highest tested dose (3 mg/kg). Figure 74 5 shows the levels of fasting plasma triglycerides during the course of study. 25.8 Effect of Test Compounds on Total Cholesterol and HDL-Cholesterol Levels

Blood was collected from overnight fasted animals. The blood drawn was 10 conducted weekly at 5 days post each injection. Plasma total cholesterol and HDL-cholcstcrol levels tended to increase following Fc-(G4S)3-FGF21 (L98R, P171G, A180E) or Fc-(L15)-FGF21 (L98R, P171G) treatment. Figures 75 and 76 show the levels of total cholesterol and HDL-cholcstcrol over the course of study. 15 25.9 Conclusions

In a dosc-cscalation study conducted in male IGT cynomolgus monkeys, animals treated with Fc conjugated FGF21 mutants, namely Fc-(G4S)3-FGF21 (L98R, P171G, ΑΪ80Ε) and Fc-(L15)-FGF21 (L98R, P171G), showed improved metabolic parameters. Body weight was reduced and body composition was 2 0 improved. Short-term reduction of food intake was observed and and the food intake recovered to baseline or control levels mid study. Fasting blood glucose and triglyceride levels were also reduced by both compounds, Fc-(G4S)3-FGF21 (L98R, P171G, A180E) or Fc-(L15)-FGF21(L98R, P171G). OGTT was improved and HDL-cholcsterol levels were slightly elevated. Compared with Fc-(L15)-FGF21 (L98R, 25 P171G), Fc-(G4S)3-FGF21 (L98R, P171G, A180E) appeared to be superior to Fc- (L15)-FGF21 (L98R, P171G) in all parameters measured at any tested dose. Fc-(G4S)3-FGF21 (L98R, P171G, A180E) achieved its maximal effects for most of the parameters measured when administered at 0.3 mg/kg. Therefore the therapeutic effective dose of Fc-(G4S)3-FGF21 (L98R, P171G, A180E) in higher species may be 3 0 lower than 0.3 mg/kg. EXAM PLE 26

Stability Study in Cynomolgus Monkeys This study was designed to determine whether Fc-(L15)-FGF21 (L98R, 109 WO 2010/129503 PCT/US2010/033478 P171G, A180E) (SEQ ID NO:57) was more protease-resistant than Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43). Carboxy terminal processing were observed following Fc-(L15)-FGF21 (L98R, P171G) injection into mice or monkeys as shown in Example 21. The degradation resulted in a successive loss of 1 to 3 amino acid 5 residues from the C-terminus. Efforts by capping the C-terminus or introducing additional mutations into the C-tcrminus of Fc-(L15)-FGF21 (L98R, P171G) yielded a superior molecule Fc-(L15)-FGF21 (L98R, P171G, A180E). This study was designed to assess whether Fc-(L15)-FGF21 (L98R, P171G, A180E) had improved in vivo stability compared with Fc-(L15)-FGF21 (L98R, P171G). 10 Fc-(L15)-FGF21 (L98R, P171G, A180E) and Fc-(L15)-FGF2t (L98R, P171G) constructs were generated. These constructs comprised an IgGl Fc sequence (SEQ ID NO: 11) fused at the C-terminus to a (Gly)5-Ser-(Gly)3-Ser-(Gly)4-Scr linker sequence (SEQ ID NO:28) which was then fused to the N terminus of a mature FGF21 sequence (SEQ ID NO:4), in which either two mutations, L98R, P171G, or 15 three mutations, L98R, P171G, and A180E, were introduced. These constructs were then expressed and purified as described herein, and were isolated as a dimeric form of the protein, each monomer of which was linked via intcrmolecular disulfide bonds between the Fc region of each monomer.

The in vivo stability of Fc-(L15)-FGF21 (L98R, P171G) and Fc-(L15)-FGF21 20 (L98R, P171G, A180E) was compared in male cynomolgus monkeys. Fc-(LI5)- FGF21 (L98R, P171G) and Fc-(L15)-FGF21 (L98R, P171G, A180E) were intravenously injected into cynomolgus monkeys at 23.5 mg/kg. Blood samples were collected at various time points following a single iv injection. Immunoaffinity-MALDI-TOF mass spectrometry was used to monitor metabolites at each time point 25 following injection. Results arc shown in Figure 77.

Compared with Fc-(L15)-FGF21(L98R, P171G), Fc-(L 15)-FGF21 (L98R, P171G, A180E) showed significantly reduced C-terminal degradation with fewer detectable mass peaks adjacent to the parental peak of the intact molecule, suggesting that the A180E mutation slowed down C-tcrminal peptidase degradation. Larger 30 truncations with mass losses estimated at [1-376], [1-394] and [1-401] were also observed and the sites corresponded to 133-134, 153-154 and 158-159 in the FGF21 polypeptide sequence. The internal endopeptidase clipping contributed to the overall metabolism of both Fc-(L15)-FGF21 (L98R, P171G) and Fc-(L15)-FGF21 (L98R, Pl71G, A180E), and the A180E mutation did not appear to significantly impact the 110 WO 2010/129503 PCT/US2010/033478 rate of internal cndopcptidasc degradation.

In order to increase the resolution and provide details of the degradation mixture, MRM (multiplc-rcaction-monitoring) LC-MS mass spectrometry was also performed to monitor various forms of the C-terminal degradation fragments. 5 Monkey samples were affinity-purified and then subjected to Asp-N digestion. The C-terminal digested peptides were then monitored by MRM. Results for various forms of the C-terminal degradation fragments are expressed as relative amount to full length peptide species (%) shown in Figure 78. Consistent with MALDI spectra, the MRM semi-quantitative analysis of the C-terminal fragments also showed reduced 10 relative abundance of the peptide fragments missing 1-3 amino acids from the C-terminus and the increased relative abundance of the intact molecule in monkeys administered with Fc-(L15)-FGF21 (L98R, P171G, A180E) compared with Fc-(L15)-FGF21 (L98R, P171G).

In summary, Fc-(L15)-FGF21 (L98R, P171G, A180E) showed reduced C- 15 terminal degradation and enhanced in vivo stability compared with Fc-(L15)-FGF21 (L98R, P171G) in cynomolgus monkeys. EXAMPLE 27

Pharmacokinetics of Fc-(L15)-FCF21 (L98R, P171G, A180E) and 20 Fc-(L15)-FGF21 (L98R, P171G) in Mice

This study was designed to assess the pharmacokinetics of Fc-(L15)-FGF21 (L98R, P171G, A180E) (SEQ ID NO:57) and Fc-(L15)-FGF21 (L98R, P171G) (SEQ ID NO:43) following a single intravenous dose to male C57BL/6 mice.

Fc-(L15)-FGF21 (L98R, P171G, A180E) and Fc-(L15)-FGF21 (L98R, 25 P171G) were given at 20 mg/kg through intravenous injection. Blood samples were collected at 0.083 (5 minutes), 1, 4, 8, 16, 24, 48, 72, 96, 168, and 240 hours postdosing. In order to determine plasma concentrations of intact full-length molecule, an ELISA assay with the immunoreactivity directed to the N-terminal and C-terminal FGF21 was developed. The assay tracks the full length intact molecule with 30 negligible contaminations from other degradation products. The plasma concentrations of intact Fc-(L15)-FGF21 (L98R, P171G, A180E) and Fc-(L15)-FGF21 (L98R, P171G) over a period of 240 hours following intravenous injection in mice are shown in Figure 79.

The plasma concentrations of Fc-(L15)-FGF21 (L98R, P171G, A180E) were 111 WO 2010/129503 PCT/US2010/033478

significantly higher than those of Fc-(L15)-FGF21 (L98R, P171G) administered at the same dose level from 24 to 168 hours post injection. A significant amount of Fc-(L15)-FGF21 (L98R, P171G, A180E) was measurable at 168 hours post injection in mice. As a result, Fc-(L15)-FGF21 (L98R, P171G, A180E) showed increased AUC 5 coverage and plasma circulating half-life by 2 fold compared with Fc-(L 15)-FGF21 (L98R, P171G) in mice. The half-life of Fc-(LI5)-FGF2I (L98R, P171G, A180E) was 16.6 hours and that of Fc-(L15)-FGF21 (L98R, P171G) was 9.4 hours. Both compounds were below detectable level at 240 hours post dose. 10 EXAMPLE 28

Generation of N-linked Glvcosvlation Mutants to Improve Solubility or Decrease C-terminal Clipnini; to Increase Half-life FGF21 mutants were designed and generated to create potential N-linked glycosylation sites for mammalian expression with minimal disruption to the native 15 amino acid sequence. The mutants constructed include FGF21 (Y179N, S181T) (SEQ ID NO:161), FGF21 Y179N (SEQ ID NO:163) and FGF21 P124S (SEQ ID NO: 165).

Expression of the mutants was performed transiently in 293-6E cells and conditioned media was tested for activity in an ELK-luciferasc in vitro assay. ELK- 20 lucifcrase assays were performed as described in Example 4, with the exception that serial dilutions of conditioned media were used rather than different concentrations of purified proteins.

Analysis of the conditioned media revealed that increased glycosylation compared to wild type was not achieved in the transient expression system. Figure 80 25 shows the results of an ELK-lucifcrase activity assay. The results shown in Figure 80 demonstrate that the FGF21 P124S mutant did not adversely impact FGF21 activity but the FGF21 Y179N and FGF21 (Y179N, S181T) mutants, in the absence of glycosylation, resulted in reduced activity as assayed in the ELK-lucifcrasc assay. 30 While the present invention has been described in terms of various embodiments, it is understood that variations and modifications will occur to those skilled in the art. Therefore, it is intended that the appended claims cover all such equivalent variations that come within the scope of the invention as claimed. In 112 215,937/2 addition, the section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. 113

SEQUENCE LISTING <110> Belouski, Edward J.

Ellison, Murielle M.

Hamburger, Agnes E.

Hecht, Randy I.

Li, Yue-Sheng Michaels, Mark L.

Sun, Jeonghoon Xu, Jing <12 0> FGF21 Mutants and Uses Thereof <13 0> A-1429-WO-PCT2 <160> 165 <170> Patentln version 3.5 <210> 1 <211> 630

<212> DNA <213> Homo sapiens <220> <221> CDS <222> (1)..(630) <400> 1 atg 48 gac teg gac gag acc ggg ttc gag cac tea gga ctg tgg gtt tet Met 1 Asp Ser Asp Glu 5 Thr Gly Phe Glu His 10 Ser Gly Leu Trp Val 15 Ser gtg 96 ctg get ggt ett ctg ctg gga gcc tgc cag gca cac ccc ate cct Val Leu Ala Gly 20 Leu Leu Leu Gly Ala 25 Cys Gin Ala His Pro 30 He Pro gac 144 tcc agt cct etc ctg caa ttc ggg ggc caa gtc egg cag egg tac Asp Ser Ser 35 Pro Leu Leu Gin Phe 40 Gly Gly Gin Val Arg 45 Gin Arg Tyr etc 192 tac aca gat gat gcc cag cag aca gaa gcc cac ctg gag ate agg Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60 gag gat ggg aeg gtg ggg ggc get get gac cag age ccc gaa agt etc 240 Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80 114 ctg 288 cag ctg aaa gee ttg aag ecg gga gtt att caa ate ttg gga gtc Leu Gin Leu Lys Ala 85 Leu Lys Pro Gly val 90 lie Gin He Leu Gly 95 Val aag 336 aca tcc agg ttc ctg tgc cag egg cca gat ggg gee ctg tat gga Lys Thr Ser Arg 100 Phe Leu Cys Gin Arg 105 Pro Asp Gly Ala Leu 110 iyr Gly teg 384 etc cac ttt gac cct gag gee tgc age ttc egg gag ctg ett ett Ser Leu His 115 Phe Asp Pro Glu Ala 120 Cys Ser Phe Arg Glu 125 Leu Leu Leu gag 432 gac gga tac aat gtt tac cag tec gaa gee cac ggc etc ccg ctg Glu Asp 130 Gly Tyr Asn Val Tyr 135 Gin Ser Glu Ala His 140 Gly Leu Pro Leu cac 480 ctg cca ggg aac aag tec cca cac egg gac cct gca ccc ega gga His 145 Leu Pro Gly Asn Lys 150 Ser Pro His Arg Asp 155 Pro Ala Pro Arg Gly 160 cca 528 get ege ttc ctg cca eta cca ggc ctg ccc ccc gca ccc ccg gag Pro Ala Arg Phe Leu 165 Pro Leu Pro Gly Leu 170 Pro Pro Ala Pro Pro 175 Glu cca 576 ccc gga ate ctg gee ccc cag ccc CCC gat gtg ggc tec teg gac Pro Pro Gly lie 180 Leu Ala Pro Gin Pro 185 Pro ASp Val Gly Ser 190 Ser Asp cct 624 ctg age atg gtg gga cct tec cag ggc ega age ccc age tac get Pro Leu Ser 195 Met Val Gly Pro Ser 200 Gin Gly Arg Ser Pro 205 Ser Tyr Ala tec tga 630 Ser <210> 2 <211> 209 <212> PRT <213> Homo <400> 2 115

Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15

Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro lie Pro 20 25 30

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45

Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60

Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80

Leu Gin Leu Lys Ala Leu Lys Pro Gly Val He Gin lie Leu Gly Val 85 90 95

Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110

Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125

Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140

His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160

Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu 165 170 175

Pro Pro Gly He Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190

Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205

Ser 116 <210> 3 <211> 546

<212> DNA <213> Homo sapiens <220> <221> CDS <222> (1)..(546) <400> 3 cac 48 CCC ate cct gac tee agt cct etc ctg caa ttc ggg ggc caa gtc His 1 Pro lie Pro Asp 5 Ser Ser Pro Leu Leu 10 Gin Phe Gly Gly Gin 15 Val egg 96 cag egg tac etc tac aca gat gat gee cag cag aca gaa gee cac Arg Gin Arg Tyr 20 Leu Tyr Thr Asp Asp 25 Ala Gin Gin Thr Glu 30 Ala His ctg 144 gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag age Leu Glu He 35 Arg Glu Asp Gly Thr 40 Val Gly Gly Ala Ala 45 Asp Gin Ser ccc 192 gaa agt etc ctg cag ctg aaa gee ttg aag ecg gga gtt att caa Pro Glu 50 Ser Leu Leu Gin Leu 55 Lys Ala Leu Lys Pro 60 Gly Val lie Gin ate 240 ttg gga gtc aag aca tee agg ttc ctg tgc cag egg cca gat ggg He 65 Leu Gly Val Lys Thr 70 Ser Arg Phe Leu Cys 75 Gin Arg Pro Asp Gly 80 gee 288 ctg tat gga teg etc cac ttt gac cct gag gee tgc age ttc egg Ala Leu Tyr Gly Ser 85 Leu His Phe Asp Pro 90 Glu Ala Cys Ser Phe 95 Arg gag 336 ctg ett ett gag gac gga tac aat gtt tac cag tee gaa gee cac Glu Leu Leu Leu 100 Glu Asp Gly Tyr Asn 105 Val Tyr Gin Ser Glu 110 Ala His ggc 384 etc ecg ctg cac ctg cca ggg aac aag tee cca cac egg gac cct Gly Leu Pro 115 Leu His Leu Pro Gly 120 Asn Lys Ser Pro His 125 Arg Asp Pro 117 gca 432 Ala ccc Pro 130 ega Arg gga Gly cca Pro get Ala ege Arg 135 ttc Phe ctg Leu cca Pro eta Leu cca Pro 140 ggc Gly ctg Leu ccc Pro ccc Pro gca ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc ccc gat gtg 480 Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp val 145 150 155 160 ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega age 528 Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser 165 170 175 ccc age tac get tee tga 546 Pro Ser Tyr Ala Ser 180 <210> 4

<211> 181 <212> PRT < 213 > Homo sapiens <400> 4 His Pro He Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val 1 5 10 15 Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His 20 25 30 Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser 35 40 45 Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin 50 55 60 lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly 65 70 75 80 Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95 Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His 100 105 110 118

Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115 120 125

Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro 130 135 140

Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val 145 150 155 160

Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser 165 170 175

Pro Ser Tyr Ala Ser 180 <210> 5 <211> 630

<212> DNA <213 > Homo sapiens <220> <221> CDS <222> (1)..(630) <400> 5 atg gac teg gac Ser Asp gag acc Glu Thr 5 ggg Gly ttc Phe gag Glu cac His 10 tea Ser gga Gly ctg Leu tgg gtt tet Ser 48 Met 1 Asp Trp Val 15 gtg ctg get ggt ett ctg ctg gga gcc tgc cag gca cac ccc ate cct 96 val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro He Pro 20 25 30 gac tcc agt cct etc ctg caa ttc ggg ggc caa gtc egg cag egg tac 144 Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45 etc tac aca gat gat gcc cag cag aca gaa gcc cac ctg gag ate agg 192 Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60 119 gag 240 gat ggg aeg gtg ggg ggc get get gac cag age ccc gaa agt etc Glu 65 Asp Gly Thr Val Gly 70 Gly Ala Ala Asp Gin 75 Ser Pro Glu Ser Leu 80 ctg 288 cag ctg aaa gee ttg aag ccg gga gtt att caa ate ttg gga gtc Leu Gin Leu Lys Ala 85 Leu Lys Pro Gly Val 90 He Gin He Leu Gly 95 val aag 336 aca tcc agg ttc ctg tgc cag egg cca gat ggg gee ctg tat gga Lys Thr Ser Arg 100 Phe Leu Cys Gin Arg 105 Pro Asp Gly Ala Leu 110 Tyr Gly teg 384 etc cac ttt gac cct gag gcc tgc age ttc egg gag ctg ett ett Ser Leu His 115 Phe Asp Pro Glu Ala 120 Cys Ser Phe Arg Glu 125 Leu Leu Leu gag 432 gac gga tac aat gtt tac cag tcc gaa gee cac ggc etc ccg ctg Glu Asp 130 Gly Tyr Asn Val Tyr 135 Gin Ser Glu Ala His 140 Gly Leu Pro Leu cac 480 ctg cca ggg aac aag tcc cca cac egg gac cct gca ccc ega gga His 145 Leu Pro Gly Asn Lys 150 Ser Pro His Arg Asp 155 Pro Ala Pro Arg Gly 160 cca 528 get ege ttc ctg cca eta cca ggc ctg ccc ccc gca etc ccg gag Pro Ala Arg Phe Leu 165 Pro Leu Pro Gly Leu 170 Pro Pro Ala Leu Pro 175 Glu cca 576 ccc gga ate ctg gee ccc cag ccc CCC gat gtg ggc tcc teg gac Pro Pro Gly lie 180 Leu Ala Pro Gin Pro 185 Pro Asp val Gly Ser 190 Ser Asp cct 624 ctg age atg gtg gga cct tcc cag ggc ega age ccc age tac get Pro Leu Ser 195 Met Val Gly Pro Ser 200 Gin Giy Arg Ser Pro 205 Ser Tyr Ala tcc tga 630

Ser <210> 6 <211> 209

<212> PRT 120 <213 > Homo sapiens <400> 6

Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15

Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro He Pro 20 25 30

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45

Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu lie Arg 50 55 60

Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80

Leu Gin Leu Lys Ala Leu Lys Pro Gly Val He Gin He Leu Gly Val 85 90 95

Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110

Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125

Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140

His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160

Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Leu Pro Glu 165 170 175

Pro Pro Gly He Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Ser Asp 180 185 190

Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205 121

Ser <210> 7 <211> 546

<212> DNA <213> Homo sapiens <220> <221> CDS <222> (1)..(546) <400> 7 cac 48 ccc ate cct gac tec agt cct etc ctg caa ttc ggg ggc caa gtc His 1 Pro lie Pro Asp 5 Ser Ser Pro Leu Leu 10 Gin Phe Gly Gly Gin 15 Val egg 96 cag egg tac etc tac aca gat gat gee cag cag aca gaa gee cac Arg Gin Arg Tyr 20 Leu Tyr Thr Asp Asp 25 Ala Gin Gin Thr Glu 30 Ala His ctg 144 gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag age Leu Glu lie 35 Arg Glu Asp Gly Thr 40 Val Gly Gly Ala Ala 45 Asp Gin Ser ccc 192 gaa agt etc ctg cag ctg aaa gee ttg aag ecg gga gtt att caa Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val lie Gin 50 55 60 ate 240 He 65 ttg Leu gga gtc Gly Val aag aca tee Ser agg Arg ttc Phe ctg Leu tgc Cys 75 cag egg Gin Arg cca Pro gat Asp ggg Gly 80 Lys Thr 70 gee ctg tat gga teg etc cac ttt gac cct gag gee tgc age ttc egg 288 Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95 gag ctg ett ett gag gac gga tac aat gtt tac cag tee gaa gee cac 336 Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His 100 105 110 ggc etc ccg ctg cac ctg cca ggg aac aag tee cca cac egg gac cct 384 122

Gly Leu Pro Leu His Leu Pro Gly Asn Lys 120 Ser Pro His 125 Arg Asp Pro 115 gca ccc ega gga cca get ege ttc ctg cca eta cca ggc ctg ccc ccc 432 Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro 130 135 140 gca etc ecg gag cca ccc gga ate ctg gcc ccc cag ccc ccc gat gtg 480 Ala Leu Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro Pro Asp Val 145 150 155 160 ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag ggc ega age 528 Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser 165 170 175 ccc age tac get tcc tga 546 Pro Ser Tyr Ala Ser 180 <210> i 3 <211> 181 <212> PRT <213> 1 Homo sapiens <400> : 8 His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val 1 5 10 15 Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His 20 25 30 Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser 35 40 45 Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val He Gin 50 55 60 He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly 65 70 75 80 Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95 123

Glu Leu Leu Leu Glu Asp Gly Tyr 100

Asn Val Tyr Gin Ser Glu Ala His 105 110

Gly Leu Pro Leu His Leu Pro Gly 115 120

Asn Lys Ser Pro His Arg Asp Pro 125

Ala Pro Arg Gly Pro Ala Arg Phe 130 135

Leu Pro Leu Pro Gly Leu Pro Pro 140

Ala Leu Pro Glu Pro Pro Gly lie 145 150

Leu Ala Pro Gin Pro Pro Asp Val 155 160

Gly Ser Ser Asp Pro Leu Ser Met 165

Val Gly Pro Ser Gin Gly Arg Ser 170 175

Pro Ser Tyr Ala Ser 180 <210> 9 <211> 10

<212> PRT <213 > Artificial Sequence <220> <223 > portion of a mature human FGF21 polypeptide <400> 9

Met His Pro He Pro Asp Ser Ser Pro Leu 15 10 <210> 10 <211> 681

<212> DNA <213> Homo sapiens <220>

<221> CDS <222> (1) . . (681) <400> 10 gac 4 8 aaa act cac aca tgt cca cct tgt cca get ecg gaa etc ctg ggg Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10 15 124 gga 96 ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc atg Gly Pro Ser Val 20 Phe Leu Phe Pro Pro 25 Lys Pro Lys Asp Thr 30 Leu Met ate 144 tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac 9tg age cac lie Ser Arg 35 Thr Pro Glu Val Thr 40 Cys Val Val Val Asp 45 Val Ser His gaa 192 gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag gtg Glu Asp 50 Pro Glu Val Lys Phe 55 Asn Trp Tyr Val Asp 60 Gly Val Glu Val cat 240 aat gec aag aca aag ccg cgt gag gag cag tac aac age aeg tac His 65 Asn Ala Lys Thr Lys 70 Pro Arg Glu Glu Gin 75 Tyr Asn Ser Thr Tyr 80 cgt 288 gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat ggc Arg Val Val Ser Val 85 Leu Thr Val Leu His 90 Gin Asp Trp Leu Asn 95 Gly aag 336 gag tac aag tgc aag gtc tec aac aaa gee etc cca gee ccc ate Lys Glu Tyr Lys 100 Cys Lys Val Ser Asn 105 Lys Ala Leu Pro Ala 110 Pro lie gag 384 aaa acc ate tec aaa gee aaa ggg cag ccc ega gaa cca cag gtg Glu Lys Thr 115 He Ser Lys Ala Lys 120 Gly Gin Pro Arg Glu 125 Pro Gin Val tac 432 acc ctg ccc cca tec cgt gat gag ctg acc aag aac cag gtc age Tyr Thr 130 Leu Pro Pro Ser Arg 135 Asp Glu Leu Thr Lys 14 0 Asn Gin val Ser ctg 480 acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gee gtg gag Leu 145 Thr Cys Leu Val Lys 150 Gly Phe Tyr Pro Ser 155 Asp He Ala val Glu 160 tgg 528 gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct ccc Trp Glu Ser Asn Gly 165 Gin Pro Glu Asn Asn 170 Tyr Lys Thr Thr Pro 175 Pro gtg 576 ctg gac tec gac ggc tec ttc ttc etc tac age aag etc acc gtg Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 125 180 185 190 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tee gtg atg 624 Asp Lys Ser Arg Trp Gin Gin Giy Asn Val Phe Ser Cys Ser Val Met 195 200 205 cat gag get ctg cac aac cac tac aeg cag aag age etc tee ctg tet 672 His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser 210 215 220 ccg ggt aaa 681 Pro Gly Lys 225 <210> 11 <211> 227 <212> ] PRT <213> Homo sapiens <400> 11 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 1 5 10 15 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 20 25 30 lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 35 40 45 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr Tyr 65 70 75 80 Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly 85 90 95 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro He 100 105 110 Glu Lys Thr He Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val 126 115 12 0 125

Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val Ser 130 135 140

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val Glu 145 150 155 160

Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 165 170 175

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190

Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val Met 195 200 205

His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser 210 215 220

Pro Gly Lys 225 <210> 12 <211> 40

<212 > DNA <213> Artificial Sequence <220> <223> PCR primer <400> 12 aggaggaata acatatgcat ccaattccag attcttctcc 40 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 13 127 tagtgagctc gaattcttag gaagcgtagc tgg 33 <210> <211> <212> <213> 14 41 DNA Artificial Sequence <220> <223> PCR primer <400> 14 ggagatatac atatgccaat tccagattct tctccattat t 41 <210> <211> <212> <213> 15 34 DNA Artificial Sequence <220> <223> PCR primer <400> 15 catatgtata tctccttctt aaagttaaac aaaa 34 <210> <211> <212> <213> 16 34 DNA Artificial <220> <223> PCR primer <400> 16 aaaacaaatt gaaattcttc ctctatatgt atac 34 <210> <211> <212> <213 > 17 63 DNA Artificial Sequence <220> <223> sense strand from a portion of an FGF21 expression construct <400> 17 ttttgtttaa ctttaagaag gagatataca tatgcatcca attccagatt cttctccatt 60 128 att 63 <210> 18 <211> 63

<212> DNA <213> Artificial <220> <223> antisense strand from a portion of an FGF21 expression construct <400> 18 aaaacaaatt gaaattcttc ctctatatgt atacgtaggt taaggtctaa gaagaggtaa 60 taa 63 <210> 19 <211> 34

<212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 19 aggaggaata acatatggac aaaactcaca catg 34 <210> 20 <211> 23

<212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 20 ggatccacca ccaccgctac cac 23 <210> 21 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> PCR primer 129 <400> 21 gAggtggtg gatcccatcc aattccagat tcttctcca 39 <2l0> <211> <212> <213> 22 33 DNA Artificial Sequence <220> <223> PCR primer <400> 22 tagtgagctc gaattcttag gaagcgtagc tgg 33 <210> <211> <212> <213> 23 27 DNA Artificial Sequence <220> <223> PCR primer <400> 23 atggtggaac cttcccaggg ccgaagc 27 <210> <211> <212> <213> 24 30 DNA Artificial Sequence <220> <223> PCR primer <400> 24 ggaaggttcc accatgctca gagggtccga 30 <210> <211> <212> <213 > 25 50 DNA Artificial Sequence <220> <223> sense strand from a portion of an FGF21 expression construct <400> 25 130 ctcctcggac cctctgagca tggtgggacc ttcccagggc cgaagcccca 50 <210> <211> <212> <213> 26 30 DNA Artificial <220> <223> PCR primer <400> 26 agcctgggag actcgtacca ccttggaagg 30 <210> <211> <212> <213> 27 50 DNA artificial <220> <223> antisense strand from a portion of an FGF21 expression construct <400> 27 gaggagcctg ggagactcgt accaccctgg aagggtcccg gcttcggggt 50 <210> <211> <212> <213> 28 15 PRT Artificial Sequence <220> <223> G5SG3SG4S (L15) Linker <400> 28

Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser 15 10 15 <210> <211> <212> <213> 29 4 PRT Artificial <220> <223> G4 Linker <400> 29 131

Gly Gly Gly Gly 1 <210> <211> <212> <213> 30 5 PRT Artificial <220> <223> G5 Linker <400> 30

Gly Gly Gly Gly Gly 1 5 <210> <211> <212> <213> 31 15 PRT Artificial <220> <223> (G4S)3 Linker <400> 31

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 15 10 15 <210> <211> <212> <213> 32 8 PRT Artificial <220> <223> G3KG4 linker <400> 32

Gly Gly Gly Lys Gly Gly Gly Gly 1 5 <210> <211> <212> <213> 33 8 PRT Artificial <220> <223> G3NGSG2 Linker 132 <400> 33

Gly Gly Gly Asn Gly Ser Gly Gly 1 5 <210> 34 <211> 8

<212> PRT <213> Artificial <220> <223> G3CG4 linker <400> 34

Gly Gly Gly Cys Gly Gly Gly Gly 1 5 <210> 35 <211> 5

<212> PRT <213> Artificial <220> <223> GPNG2 Linker <400> 35

Gly Pro Asn Gly Gly 1 5 <210> 36 <211> 549

<212> DNA <213> Artificial Sequence <220>

<223> FGF21 RG <220>

<221> CDS <222> (1)..¢549) <400> 36 atg cat cca att cca gat tct tct 48

Met His Pro lie Pro Asp Ser Ser 1 5 cca tta tta caa ttc ggg ggc caa

Pro Leu Leu Gin Phe Gly Gly Gin 10 15 133 gtc 96 egg cag cgt Val Arg Gin Arg 20 cac 144 ctg gag ate His Leu Glu 35 He age 192 ccc gaa agt Ser Pro 50 Glu Ser caa 240 ate ttg ggt Gin 65 lie Leu Gly ggg 288 gee ctg tat Gly Ala Leu Tyr cgt 336 gag cgt ett Arg Glu Arg Leu 100 cac 384 ggc etc ecg His Gly Leu 115 Pro cct 432 gca ccc ega Pro Ala 130 Pro Arg ccc 480 gca ccc ecg Pro 145 Ala Pro Pro gtg 528 ggc tee teg Val Gly Ser Ser age ccc age tac tac etc tac aca Tyr Leu Tyr Thr agg gag gac ggg Arg Glu Asp Gly 40 etc ctg cag ctg Leu Leu Gin 55 Leu gtc aag aca tee Val Lys 70 Thr Ser gga teg etc cac Gly 85 Ser Leu His ett gag gac ggt Leu Glu Asp Gly ctg cac ctg cca Leu His Leu Pro 120 gga cca get ege Gly Pro Ala 135 Arg gag cca ccc gga Glu Pro 150 Pro Gly gac cct ctg age Asp 165 Pro Leu Ser get tee taa gat gat gee cag Asp 25 Asp Ala Gin aeg gtg ggg ggt Thr Val Gly Gly aaa gee ttg aag Lys Ala Leu Lys 60 agg ttc ctg tgc Arg Phe Leu 75 Cys ttt gac cct gag Phe Asp 90 Pro Glu tac aat gtt tac Tyr 105 Asn val Tyr ggg aac aag tee Gly Asn Lys Ser ttc ctg cca eta Phe Leu Pro Leu 140 ate ctg gee CCC He Leu Ala 155 Pro atg gtg ggt ggt

Met Val Gly Gly 170 cag aca gaa gee Gin Thr 30 Glu Ala get get gac cag Ala 45 Ala Asp Gin ecg ggt gtt att Pro Gly Val lie cag egg cca gat Gin Arg Pro Asp 80 gee tgc age ttc Ala Cys Ser 95 Phe cag tee gaa gee Gin Ser 110 Glu Ala cca cac cgt gac Pro 125 His Arg Asp cca ggc ctg ccc Pro Gly Leu Pro cag ccc ccc gat Gin Pro Pro Asp 160 tee cag ggc ega Ser Gin Gly 175 Arg 549

Ser Pro Ser Tyr Ala Ser 180 134 <210> 37 <211> 182

<212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 37

Met His Pro He Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30

His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val He 50 55 60

Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95

Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin Gly Arg 165 170 175 135

Ser Pro Ser Tyr Ala Ser 180 <210> 38 <211> 546

<212> DNA <213> Artificial Sequence <220>

<223> FGF21 RGE <220> <221> CDS <222> ¢1)..(546) <400> 38 cat 48 cca att cca gat tet tet cca tta tta caa ttc ggg ggc caa gtc His 1 Pro lie Pro Asp 5 Ser Ser Pro Leu Leu 10 Gin Phe Gly Gly Gin 15 Val egg 96 cag cgt tac etc tac aca gat gat gcc cag cag aca gaa gcc cac Arg Gin Arg Tyr 20 Leu Tyr Thr Asp Asp 25 Ala Gin Gin Thr Glu 30 Ala His ctg 144 gag ate agg gag gac ggg aeg gtg ggg ggt get get gac cag age Leu Glu He 35 Arg Glu Asp Gly Thr 40 val Gly Gly Ala Ala 45 Asp Gin Ser ccc 192 gaa agt etc ctg cag ctg aaa gcc ttg aag ccg ggt gtt att caa Pro Glu 50 Ser Leu Leu Gin Leu 55 Lys Ala Leu Lys Pro 60 Gly Val He Gin ate 240 ttg ggt gtc aag aca tcc agg ttc ctg tgc cag egg cca gat ggg lie 65 Leu Gly Val Lys Thr 70 Ser Arg Phe Leu Cys 75 Gin Arg Pro Asp Gly 80 gcc 288 ctg tat gga teg etc cac ttt gac cct gag gcc tgc age ttc cgt Ala Leu Tyr Gly Ser 85 Leu His Phe Asp Pro 90 Glu Ala Cys Ser Phe 95 Arg gag 336 cgt ett ett gag gac ggt tac aat gtt tac cag tcc gaa gcc cac Glu Arg Leu Leu 100 Glu Asp Gly Tyr Asn 105 Val Tyr Gin Ser Glu 110 Ala His 136 ggc 384 Gly etc Leu ccg Pro 115 ctg Leu cac His ctg Leu cca Pro ggg Gly 120 gca ccc ega gga cca get ege ttc 432 Ala Pro Arg Gly Pro Ala Arg Phe 130 135 gca ccc ccg gag cca ccc gga ate 480 Ala Pro Pro Glu Pro Pro Gly He 145 150 ggc tcc teg gac cct ctg age atg 528 Gly Ser Ser Asp Pro Leu Ser Met 165 ccc age tac gaa tcc taa 546 Pro Ser Tyr Glu Ser 180 aac aag tcc cca cac cgt gac cct Asn Lys Ser Pro His 125 Arg Asp Pro ctg cca eta cca ggc ctg ccc ccc Leu Pro Leu Pro 140 Gly Leu Pro Pro ctg gcc ccc cag ccc ccc gat gtg Leu Ala Pro 155 Gin Pro Pro Asp Val 160 gtg ggt ggt tcc cag ggc ega age Val Gly 170 Gly Ser Gin Gly Arg 175 Ser <210> <211> <212> <213> 39 181 PRT Artificial Sequence <220> <223> Synthetic Construct <400> 39 His Pro He Pro Asp Ser Ser Pro 1 5

Leu Leu Gin Phe Gly Gly Gin Val 10 15

Arg Gin Arg Tyr Leu Tyr Thr Asp 20

Leu Glu lie Arg Glu Asp Gly Thr 35 40

Pro Glu Ser Leu Leu Gin Leu Lys 50 55

He Leu Gly Val Lys Thr Ser Arg

Asp Ala Gin Gin Thr Glu Ala His 25 30

Val Gly Gly Ala Ala Asp Gin Ser 45

Ala Leu Lys Pro Gly Val lie Gin 60

Phe Leu Cys Gin Arg Pro Asp Gly 137 65 70 75 80

Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95 Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His 100 105 110 Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115 120 125 Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro 130 135 140 Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro Pro Asp Val 145 150 155 160 Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin Gly Arg Ser 165 170 175 Pro Ser Tyr Glu Ser 180 <210> 40 <211> 1272 <212> DNA <213> Artificial Sequence <220> <223> WT21- -L15· -Fc <220> <221> CDS <222> (1) . . ¢1272) <400> 40 atg cat cca att cca gat tet tet cca tta tta caa ttc ggg ggc caa 48 Met His Pro He Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 1 5 10 15 gtc egg cag egg tac etc tac aca gat gat gec cag cag aca gaa gec 96 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 138 cac 144 ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get gac cag His Leu Glu 35 lie Arg Glu Asp Gly 40 Thr Val Gly Gly Ala 45 Ala Asp Gin age 192 ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga gtt att Ser Pro 50 Glu Ser Leu Leu Gin 55 Leu Lys Ala Leu Lys 60 Pro Gly Val lie caa 240 ate ttg gga gtc aag aca tee agg ttc ctg tgc cag egg cca gat Gin 65 lie Leu Gly Val Lys 70 Thr Ser Arg Phe Leu 75 Cys Gin Arg Pro Asp 80 999 288 gee ctg tat gga teg etc cac ttt gac cct gag gee tgc age ttc Gly Ala Leu Tyr Gly 85 Ser Leu His Phe Asp 90 Pro Glu Ala Cys Ser 95 Phe egg 336 gag ctg ett ett gag gac gga tac aat gtt tac cag tee gaa gee Arg Glu Leu Leu 100 Leu Glu Asp Gly Tyr 105 Asn Val Tyr Gin Ser 110 Glu Ala cac 384 ggc etc ecg ctg cac ctg cca ggg aac aag tee cca cac egg gac His Gly Leu 115 Pro Leu His Leu Pro 120 Gly Asn Lys Ser Pro 125 His Arg Asp cct 432 gca ccc ega gga cca get ege ttc ctg cca eta cca ggc ctg cca Pro Ala 130 Pro Arg Gly Pro Ala 135 Arg Phe Leu Pro Leu 140 Pro Gly Leu Pro ccc 480 gca ccc ccg gag cca CCC gga ate ctg gee ccc cag ccc ccc gat Pro 145 Ala Pro Pro Glu Pro 150 Pro Gly lie Leu Ala 155 Pro Gin Pro Pro Asp 160 gtg 528 ggc tee teg gac cct ctg age atg gtg gga cct tee cag ggc ega Val Gly Ser Ser Asp 165 Pro Leu Ser Met Val 170 Gly Pro Ser Gin Gly 175 Arg age 576 ccc age tac get tee ggt gga ggt ggt ggt tet ggt ggt ggt age Ser Pro Ser Tyr 180 Ala Ser Gly Gly Gly 185 Gly Gly Ser Gly Gly 190 Gly Ser ggt 624 ggt ggt gga tee gac aaa act cac aca tgc cca ccg tgc cca gca Gly Gly Gly Gly Ser Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 139 cct gaa 672

Pro Glu 210 aag gac 720

Lys Asp 225 gtg gac 768

Val Asp gac ggc 816

Asp Gly tac aac 864

Tyr Asn gac tgg 912

Asp Trp 290 etc cca 960

Leu Pro 305 ega gaa 1008 Arg Glu aag aac 1056 Lys Asn gac ate 1104 Asp lie aag acc 1152 195 etc ctg

Leu Leu acc etc

Thr Leu gtg age

Val Ser gtg gag

Val Glu 260 age aeg

Ser Thr 275 ctg aat

Leu Asn gcc ccc

Ala Pro cca cag

Pro Gin cag gtc

Gin Val 340 gee gtg

Ala Val 355 aeg cct ggg gga

Gly Gly atg ate

Met He 230 cac gaa

His Glu 245 gtg cat

Val His tac cgt

Tyr Arg ggc aag

Gly Lys ate gag

He Glu 310 gtg tac

Val Tyr 325 age ctg

Ser Leu gag tgg

Glu Trp ccc gtg 200 ccg tea

Pro Ser 215 tcc cgt

Ser Arg gac cct

Asp Pro aat gcc

Asn Ala gtg gtc

Val Val 280 gag tac

Glu Tyr 295 aaa acc

Lys Thr acc ctg

Thr Leu acc tgc

Thr Cys gag age

Glu Ser 360 ctg gac gtc ttc

Val Phe acc cct

Thr Pro gag gtc

Glu Val 250 aag aca

Lys Thr 265 age gtc

Ser Val aag tgc

Lys Cys ate tcc lie Ser ccc cca

Pro Pro 330 ctg gtc

Leu Val 345 aat ggg

Asn Gly tcc gac etc ttc

Leu Phe 220 gag gtc

Glu Val 235 aag ttc

Lys Phe aag ccg

Lys Pro etc acc

Leu Thr aag gtc

Lys Val 300 aaa gcc

Lys Ala 315 tcc egg

Ser Arg aaa ggc

Lys Gly cag ccg

Gin Pro ggc tcc 205 ccc cca

Pro Pro aca tgc

Thr Cys aac tgg

Asn Trp cgt gag

Arg Glu 270 gtc ctg

Val Leu 285 tee aac

Ser Asn aaa ggg

Lys Gly gat gag

Asp Glu ttc tat

Phe Tyr 350 gag aac

Glu Asn 365 ttc ttc aaa ccc

Lys Pro gtg gtg

Val Val 240 tac gtg

Tyr Val 255 gag cag

Glu Gin cac cag

His Gin aaa gcc

Lys Ala cag ccc

Gin Pro 320 ctg acc

Leu Thr 335 ccc age

Pro Ser aac tac

Asn Tyr etc tat 140

Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 370 375 380 age aag 1200 etc acc gtg gac aag age agg tgg cag cag ggg aac gtc ttc Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe 385 390 395 400 tea tgc 1248 tcc gtg atg cat gag get ctg cac aac cac tac aeg cag aag Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys 405 410 415 age etc 1272 tcc ctg tet ccg ggt aaa Ser Leu Ser Leu Ser Pro Gly Lys 420 <210> 41 <211> 424 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 41 Met His Pro He Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 1 5 10 15 Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30 His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin 35 40 45 Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val He 50 55 60 Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80 Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95 Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 141 100 105 110

His Gly

Pro Ala 130

Pro Ala 145

Val Gly

Leu Pro 115

Pro Arg

Pro Pro

Ser Ser

Leu His

Leu Pro 120

Gly Asn

Lys Ser

Gly Pro

Glu Pro 150

Asp Pro 165

Ser Pro

Ser Tyr 180

Ala Ser

Gly Gly

Gly Gly 195

Ser Asp

Pro Glu 210

Leu Leu

Gly Gly

Lys Asp 225

Thr Leu

Met lie 230

Val Asp

Val Ser

His Glu 245

Asp Gly

Val Glu 260

Val His

Tyr Asn

Ser Thr 275

Tyr Arg

Ala Arg 135

Phe Leu

Pro Leu 140

Pro Gly

He Leu

Ala Pro 155

Leu Ser

Met Val 170

Gly Pro

Gly Gly

Gly Gly 185

Gly Ser

Lys Thr 200

Pro Ser 215

Ser Arg

Asp Pro

Asn Ala

Val Val 280

His Thr

Val Phe

Thr Pro

Glu Val 250

Lys Thr 265

Ser Val

Cys Pro

Leu Phe 220

Glu Val 235

Lys Phe

Lys Pro

Leu Thr

Asp Trp 290

Leu Asn

Gly Lys

Glu Tyr 295

Lys Cys

Lys Val 300

Leu Pro 305

Ala Pro

He Glu 310

Lys Thr

He Ser

Lys Ala 315

Pro His 125

Pro Gly

Gin Pro

Ser Gin

Gly Gly 190

Pro Cys 205

Pro Pro

Thr Cys

Asn Trp

Arg Glu 270

Val Leu 285

Ser Asn

Lys Gly

Arg Asp

Leu Pro

Pro Asp 160

Gly Arg 175

Gly Ser

Pro Ala

Lys Pro

Val Val 240

Tyr Val 255

Glu Gin

His Gin

Lys Ala

Gin Pro 320 142

Arg Glu Pro Gin Val 325 Tyr Thr Leu Pro Pro 330 Ser Arg Asp Glu Leu Thr 335 Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 340 345 350 Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr 355 360 365 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 370 375 380 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe 385 390 395 400 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys 405 410 415 Ser Leu Ser Leu Ser Pro Gly Lys 420 <210> 42 <211> 1275 <212> DNA <213> Artificial <220> <223> Fc LI 5 RG <220> <221> CDS <222> ¢1) . · , (1275) <400> 42 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 143 atg 144 ate tec cgt acc cct gag gtc Met He Ser 35 Arg Thr Pro Glu Val 40 cac 192 gaa gac cct gag gtc aag ttc His Glu 50 Asp Pro Glu Val Lys 55 Phe gtg 240 cat aat gee aag aca aag ccg Val 65 His Asn Ala Lys Thr 70 Lys Pro tac 288 cgt gtg gtc age gtc etc acc Tyr Arg Val Val Ser 85 Val Leu Thr ggc 336 aag gag tac aag tgc aag gtc Gly Lys Glu Tyr 100 Lys Cys Lys Val ate 384 gag aaa acc ate tec aaa gee lie Glu Lys 115 Thr lie Ser Lys Ala 120 gtg 432 tac acc ctg ccc cca tec cgt Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg age 480 ctg acc tgc ctg gtc aaa ggc Ser 145 Leu Thr Cys Leu Val 150 Lys Gly gag 528 tgg gag age aat ggg cag ccg Glu Trp Glu Ser Asn Gly Gin Pro 165 ccc 576 gtg ctg gac tec gac ggc tec Pro Val Leu Asp 180 Ser Asp Gly Ser gtg 624 gac aag age cgt tgg cag cag Val Asp Lys 195 Ser Arg Trp Gin Gin 200 aca tgc gtg gtg gtg gac gtg age Thr Cys Val Val Val 45 Asp Val Ser aac tgg tac gtg gac ggc gtg gag Asn Trp Tyr Val 60 Asp Gly Val Glu cgt gag gag cag tac aac age aeg Arg Glu Glu 75 Gin Tyr Asn Ser Thr 80 gtc ctg cac cag gac tgg ctg aat Val Leu 90 His Gin Asp Trp Leu 95 Asn tec aac aaa gee etc cca gee ccc Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro aaa ggg cag ccc ega gaa cca cag Lys Gly Gin Pro Arg 125 Glu Pro Gin gat gag ctg acc aag aac cag gtc Asp Glu Leu Thr 140 Lys Asn Gin Val ttc tat ccc age gac ate gee gtg Phe Tyr Pro 155 Ser Asp He Ala Val 160 gag aac aac tac aag acc aeg cct Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ttc ttc etc tac age aag etc acc Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr ggg aac gtc ttc tea tgc tec gtg Gly Asn Val Phe Ser 205 Cys Ser Val 144 atg cat 672

Met His 210 tct ccg 720

Ser Pro 225 ggt gga 768

Gly Gly ggc caa 816

Gly Gin gaa gcc 864

Glu Ala gac cag 912

Asp Gin 290 gtt att 960

Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala egg gac 1152 Arg Asp gag get

Glu Ala ggt aaa

Gly Lys tee cat

Ser His gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin He ggg gee

Gly Ala egg gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ctg cac

Leu His ggt gga

Gly Gly 230 cca att

Pro lie 245 cag egg

Gin Arg gag ate

Glu He gaa agt

Glu Ser ttg gga

Leu Gly 310 ctg tat

Leu Tyr 325 cgt ett

Arg Leu etc ccg

Leu Pro ccc ega

Pro Arg aac cac Asn 215 His ggt ggt Gly Gly cca gat Pro Asp tac etc Tyr Leu agg gag Arg Glu 280 etc ctg Leu 295 Leu gtc aag Val Lys gga teg Gly Ser ett gag Leu Glu ctg cac Leu His 360 gga cca Gly Pro tac aeg

Tyr Thr ggt tct

Gly Ser tct tct

Ser Ser 250 tac aca

Tyr Thr 265 gat ggg

Asp Gly cag ctg

Gin Leu aca tee

Thr Ser etc cac

Leu His 330 gac gga

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg cag aag

Gin Lys 220 ggt ggt

Gly Gly 235 cca tta

Pro Leu gat gat

Asp Asp aeg gtg

Thr Val aaa gcc

Lys Ala 300 agg ttc

Arg Phe 315 ttt gac

Phe Asp tac aat

Tyr Asn ggg aac

Gly Asn ttc ctg

Phe Leu age etc

Ser Leu ggt age

Gly Ser tta caa

Leu Gin gcc cag

Ala Gin 270 ggg ggc

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tee

Lys Ser 365 cca eta

Pro Leu tee ctg

Ser Leu ggt ggt

Gly Gly 240 ttc ggg

Phe Gly 255 cag aca

Gin Thr get get

Ala Ala ccg gga

Pro Gly cag egg

Gin Arg 320 gcc tgc

Ala Cys 335 cag tee

Gin Ser cca cac

Pro His cca ggc

Pro Gly 145 370 375 ctg ccc 1200 ccc gca ccc ccg gag cca Leu Pro 385 Pro Ala Pro Pro 390 Glu Pro ccc gat 1248 gtg ggc tcc teg gac cct Pro Asp Val Gly Ser 405 Ser Asp Pro ggc ega 1275 age ccc age tac get tcc Gly Arg Ser Pro 420 Ser Tyr Ala Ser 380 ccc gga ate ctg gec ccc cag ccc Pro Gly He 395 Leu Ala Pro Gin Pro 400 ctg age atg gtg gga ggt tcc cag Leu Ser 410 Met Val Gly Gly Ser 415 Gin taa <210> 43 <211> 424 <212> PRT <213 > Artificial <220> <223> Synthetic Construct <400> 43 Met Asp Lys Thr His Thr Cys 1 5

Pro Cys Pro Ala Pro Glu Leu Leu 10 15

Gly Gly Pro Ser Val Phe Leu Phe 20

Pro Pro Lys Pro Lys Asp Thr Leu 25 30

Met lie Ser Arg Thr Pro Glu Val 35 40

Thr Cys Val Val Val Asp Val Ser 45

His Glu Asp Pro Glu Val Lys Phe 50 55

Asn Trp Tyr Val Asp Gly Val Glu 60

Val His Asn Ala Lys Thr Lys Pro 65 70

Arg Glu Glu Gin Tyr Asn Ser Thr 75 80

Tyr Arg Val Val Ser Val Leu Thr 85

Val Leu His Gin Asp Trp Leu Asn 90 95

Gly Lys Glu Tyr Lys Cys Lys Val 100

Ser Asn Lys Ala Leu Pro Ala Pro 105 110 146 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp He Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val He Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 147

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 44 <211> 1275

<212> DNA <213> Artificial Sequence <220>

<223> Fc-(G4S)3-RG <220> <221> i <222> CDS (1) ., . (1275) <400> 44 atg gac 48 aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga 96 ecg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 148

Met He cac gaa 192

His Glu 50 gtg cat 240

Val His 65 tac cgt 288

Tyr Arg ggc aag 336

Gly Lys ate gag 3 84 lie Glu gtg tac 432

Val Tyr 130 age ctg 480

Ser Leu 145 gag tgg 528

Glu Trp ccc gtg 576

Pro Val gtg gac 624

Val Asp

Ser Arg 35 gac cct Asp Pro aat gee Asn Ala gtg gtc Val Val gag tac Glu Tyr 100 aaa acc Lys 115 Thr acc ctg Thr Leu acc tgc Thr Cys gag age Glu Ser ctg gac Leu Asp 180 aag age Lys 195 Ser

Thr Pro gag gtc

Glu Val aag aca

Lys Thr 70 age gtc

Ser Val 85 aag tgc

Lys Cys ate tee

He Ser ccc cca

Pro Pro ctg gtc

Leu Val 150 aat ggg

Asn Gly 165 tee gac

Ser Asp cgt tgg

Arg Trp

Glu Val 40 aag ttc

Lys Phe 55 aag ccg

Lys Pro etc acc

Leu Thr aag gtc

Lys Val aaa gee

Lys Ala 120 tee,cgt

Ser Arg 135 aaa ggc

Lys Gly cag ccg

Gin Pro ggc tee

Gly Ser cag cag

Gin Gin 200

Thr Cys aac tgg

Asn Trp cgt gag

Arg Glu gtc ctg

Val Leu 90 tee aac

Ser Asn 105 aaa ggg

Lys Gly gat gag

Asp Glu ttc tat

Phe Tyr gag aac

Glu Asn 170 ttc ttc

Phe Phe 185 ggg aac

Gly Asn

Val Val tac gtg

Tyr Val 60 gag cag

Glu Gin 75 cac cag

His Gin aaa gee

Lys Ala cag ccc

Gin Pro ctg acc

Leu Thr 140 ccc age

Pro Ser 155 aac tac

Asn Tyr etc tac

Leu Tyr gtc ttc

Val Phe

Val Asp 45 gac ggt Asp Gly tac aac Tyr Asn gac tgg Asp Trp etc cca Leu Pro 110 ega gaa Arg 125 Glu aag aac Lys Asn gac ate Asp He aag acc Lys Thr age aag Ser Lys 190 tea tgc Ser 205 Cys

Val Ser gtg gag

Val Glu age aeg

Ser Thr 80 ctg aat

Leu Asn 95 gee ccc

Ala Pro cca cag

Pro Gin cag gtc

Gin Val gee gtg

Ala Val 160 aeg cct

Thr Pro 175 etc acc

Leu Thr tee gtg

Ser Val 149 atg cat 672

Met His 210 tct ccg 720

Ser Pro 225 ggt ggc 768

Gly Gly ggt cag 816

Gly Gin gag gcg 864

Glu Ala gac cag 912

Asp Gin 290 gtt ate 960

Val lie 305 ccg gac 1008 Pro Asp tct ttt 1056 Ser Phe gag gcg 1104 Glu Ala cgt gac 1152 Arg Asp 370 gag get

Glu Ala ggt aaa

Gly Lys age cat

Ser His gtt cgt

Val Arg 260 cac ctg

His Leu 275 tct ccg

Ser Pro cag ate

Gin lie ggc gcc

Gly Ala cgt gaa

Arg Glu 340 cac ggt

His Gly 355 ccg gcg

Pro Ala ctg cac

Leu His ggt ggt

Gly Gly 230 ccg ate

Pro He 245 cag cgt

Gin Arg gag ate

Glu He gaa tct

Glu Ser ctg ggc

Leu Gly 310 ctg tac

Leu Tyr 325 cgt ctg

Arg Leu ctg ccg

Leu Pro cca cgt

Pro Arg aac cac Asn 215 His ggt ggt Gly Gly ccg gac Pro Asp tac ctg Tyr Leu cgt gaa Arg Glu 280 ctg ctg Leu 295 Leu gtt aaa val Lys ggt tct Gly Ser etc gaa Leu Glu ctg cac Leu His 360 ggt cct Gly 375 Pro tac aeg

Tyr Thr tcc ggt

Ser Gly tct tct

Ser Ser 250 tac acc

Tyr Thr 265 gac ggt

Asp Gly cag ctg

Gin Leu acc tct

Thr Ser ctg cac

Leu His 330 gac ggt

Asp Gly 345 ctg ccg

Leu Pro gcg cgt

Ala Arg cag aag

Gin Lys 220 ggc

Gly Gly 235 ccg ctg

Pro Leu gac gac

Asp Asp acc gtt

Thr Val aaa gcc

Lys Ala 300 cgt ttc

Arg Phe 315 ttc gac

Phe Asp tac aac

Tyr Asn ggt aac

Gly Asn ttc ctg

Phe Leu 380 age etc

Ser Leu ggc tct

Gly Ser ctg cag

Leu Gin gcg cag

Ala Gin 270 ggt ggt

Gly Gly 285 ctg aaa

Leu Lys ctg tgc

Leu Cys ccg gag

Pro Glu gtt tac

Val Tyr 350 aaa tct

Lys Ser 365 cca ctg

Pro Leu tcc ctg

Ser Leu ggt ggt

Gly Gly 240 ttc ggt

Phe Gly 255 cag acc

Gin Thr gcg gcc

Ala Ala ccg ggt

Pro Gly cag cgt

Gin Arg 320 gcg tgc

Ala Cys 335 cag tct

Gin Ser ccg cac

Pro His ccg ggc

Pro Gly 150 ctg ccg cct gcg cct cct gaa ccg cct ggt ate ctg get ccg cag 1200 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin 385 390 395 cca gac gtt ggt tct tct gac ccg ctg tct atg gtt ggt ggc tct 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser 405 410 415 ggt cgt tct ccg tct tac gcc tct taa 1275 Gly Arg Ser Pro Ser Tyr Ala Ser 420 400 <210> <211> <212> <213> 45 424 PRT Artificial Sequence <220> <223> Synthetic Construct <400> 45 Met Asp Lys Thr His Thr Cy 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 151 lie Glu Lys Thr He 115

Ser Lys Ala Lys Gly Gin 120

Pro Arg Glu Pro Gin 125

Val Tyr Thr Leu Pro 130

Pro Ser Arg Asp Glu Leu 135

Thr Lys Asn Gin Val 140

Ser Leu Thr Cys Leu 145

Val Lys Gly Phe Tyr Pro 150 155

Ser Asp He Ala Val 160

Glu Trp Glu Ser Asn 165

Gly Gin Pro Glu Asn Asn 170

Tyr Lys Thr Thr Pro 175

Pro Val Leu Asp Ser 180

Asp Gly Ser Phe Phe Leu 185

Tyr Ser Lys Leu Thr 190

Val Asp Lys Ser Arg 195

Trp Gin Gin Gly Asn Val 200

Phe Ser Cys Ser Val 205

Met His Glu Ala Leu 210

His Asn His Tyr Thr Gin 215

Lys Ser Leu Ser Leu 220

Ser Pro Gly Lys Gly 225

Gly Gly Gly Ser Gly Gly 230 235

Gly Gly Ser Gly Gly 240

Gly Gly Ser His Pro 245

He Pro Asp Ser Ser Pro 250

Leu Leu Gin Phe Gly 255

Gly Gin Val Arg Gin 260

Arg Tyr Leu Tyr Thr Asp 265

Asp Ala Gin Gin Thr 270

Glu Ala His Leu Glu 275

He Arg Glu Asp Gly Thr 280

Val Gly Gly Ala Ala 285

Asp Gin Ser Pro Glu 290

Ser Leu Leu Gin Leu Lys 295

Ala Leu Lys Pro Gly 300

Val He Gin He Leu 305

Gly Val Lys Thr Ser Arg 310 315

Phe Leu Cys Gin Arg 320

Pro Asp Gly Ala Leu

Tyr Gly Ser Leu His Phe

Asp Pro Glu Ala Cys 152 325 330 335

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin 350 Ser 340 345 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 46 <211> 1275 <212> DNA <213> Artificial <220> <223> Fc-(G4S)3 -RGE <220> <221> CDS <222> (1) . . ,(1275) <400> 46 atg gac 48 aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga 96 ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate 144 tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val val Asp Val Ser 153 35 40 45 cac 192 gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag His Glu 50 Asp Pro Glu Val Lys 55 Phe Asn Trp Tyr Val 60 Asp Gly Val Glu gtg 240 cat aat gec aag aca aag ccg cgt gag gag cag tac aac age aeg val 65 His Asn Ala Lys Thr 70 Lys Pro Arg Glu Glu 75 Gin Tyr Asn Ser Thr 80 tac 288 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat Tyr Arg Val Val Ser 85 Val Leu Thr Val Leu 90 His Gin Asp Trp Leu 95 Asn ggc 336 aag gag tac aag tgc aag gtc tee aac aaa gee etc cca gee ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tee aaa gee aaa ggg cag ccc ega gaa cca cag lie Glu Lys 115 Thr He Ser Lys Ala 120 Lys Gly Gin Pro Arg 125 Glu Pro Gin gtg 432 tac acc ctg ccc cca tee cgt gat gag ctg acc aag aac cag gtc Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 140 Lys Asn Gin Val age 480 ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gee gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp He Ala Val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tee gac ggc tee ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tee gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn Val Phe Ser 205 Cys Ser Val atg cat gag get ctg cac aac cac tac aeg cag aag age etc tee ctg 672

I

Met His 210 tct ccg 720

Ser Pro 225 ggt ggt 768

Gly Gly ggc caa 816

Gly Gin gaa gcc 864

Glu Ala gac cag 912

Asp Gin 290 gtt att 960

Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala cgt gac 1152 Arg Asp 370

Glu Ala ggt aaa

Gly Lys tcc cat

Ser His gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin He ggg gcc

Gly Ala cgt gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala

Leu His ggt ggt

Gly Gly 230 cca att

Pro He 245 cag cgt

Gin Arg gag ate

Glu He gaa agt

Glu Ser ttg ggt

Leu Gly 310 ctg tat

Leu Tyr 325 cgt ett

Arg Leu etc ccg

Leu Pro ccc ega

Pro Arg

Asn 215 His ggt ggt Gly Gly cca gat Pro Asp tac etc Tyr Leu agg gag Arg Glu 280 etc ctg Leu 295 Leu gtc aag Val Lys gga teg Gly Ser ett gag Leu Glu ctg cac Leu His 360 gga cca Gly 375 Pro

Tyr Thr tct ggt

Ser Gly tct tct

Ser Ser 250 tac aca

Tyr Thr 265 gac ggg

Asp Gly cag ctg

Gin Leu aca tcc

Thr Ser etc cac

Leu His 330 gac ggt

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg

Gin Lys 220 ggt ggt

Gly Gly 235 cca tta

Pro Leu gat gat

Asp Asp aeg gtg

Thr Val aaa gcc

Lys Ala 300 agg ttc

Arg Phe 315 ttt gac

Phe Asp tac aat

Tyr Asn ggg aac

Gly Asn ttc ctg

Phe Leu 380

Ser Leu ggt age

Gly Ser tta caa

Leu Gin gcc cag

Ala Gin 270 ggg ggt

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tcc

Lys Ser 365 cca eta

Pro Leu

Ser Leu ggt ggt

Gly Gly 240 ttc ggg

Phe Gly 255 cag aca

Gin Thr get get

Ala Ala ccg ggt

Pro Gly cag egg

Gin Arg 320 gcc tgc

Ala Cys 335 cag tcc

Gin Ser cca cac

Pro His cca ggc

Pro Gly 155 ctg ccc 1200 Leu Pro 385 ccc Pro gca Ala ccc Pro ccg gag Pro Glu 390 cca Pro ccc Pro gga ate ctg gcc Leu Ala ccc Pro cag Gin ccc Pro 400 Gly lie 395 ccc gat 1248 gtg ggc tcc teg gac cct ctg age atg gtg ggt ggt tcc cag Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 ggc cga 1275 age ccc age tac gaa tcc taa Gly Arg Ser Pro Ser Tyr Glu Ser 420 <210> 47 <211> 424 <212> PRT <213> Artificial <220> <223> Synthetic : Construct <400> 47 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 Met He Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 156 lie Glu Lys Thr He Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro He Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val He Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 157

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 Gly Arg Ser Pro Ser Tyr Glu Ser 420 <210> 48 <211> 1275 <212> DNA <213> . Artificial Sequence <220> <223> FC-L15-WT21 <220> <221> CDS <222> ¢1) .. . (1275) <400> 48 atg gac 48 aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga 96 ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate 144 tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 158 cac gaa 192

His Glu 50 gtg cat 240

Val His 65 tac cgt 288

Tyr Arg ggc aag 336

Gly Lys ate gag 3 84 lie Glu gtg tac 432

Val Tyr 130 age ctg 480

Ser Leu 145 gag tgg 528

Glu Trp ccc gtg 576

Pro Val gtg gac 624

Val Asp atg cat 672

Met His gac cct

Asp Pro aat gcc

Asn Ala gtg gtc

Val Val gag tac

Glu Tyr 100 aaa acc

Lys Thr 115 acc ctg

Thr Leu acc tgc

Thr Cys gag age

Glu Ser ctg gac

Leu Asp 180 aag age

Lys Ser 195 gag get

Glu Ala gag gtc

Glu Val aag aca

Lys Thr 70 age gtc

Ser Val 85 aag tgc

Lys Cys ate tcc lie Ser ccc cca

Pro Pro ctg gtc

Leu Val 150 aat ggg

Asn Gly 165 tcc gac

Ser Asp cgt tgg

Arg Trp ctg cac

Leu His aag ttc Lys 55 Phe aag ccg Lys Pro etc acc Leu Thr aag gtc Lys Val aaa gee Lys Ala 120 tcc cgt Ser 135 Arg aaa ggc Lys Gly cag ccg Gin Pro ggc tcc Gly Ser cag cag Gin Gin 200 aac cac Asn His aac tgg

Asn Trp cgt gag

Arg Glu gtc ctg

Val Leu 90 tcc aac

Ser Asn 105 aaa ggg

Lys Gly gat gag

Asp Glu ttc tat

Phe Tyr gag aac

Glu Asn 170 ttc ttc

Phe Phe 185 ggg aac

Gly Asn tac aeg

Tyr Thr 159 tac gtg

Tyr Val 60 gag cag

Glu Gin 75 cac cag

His Gin aaa gcc

Lys Ala cag ccc

Gin Pro ctg acc

Leu Thr 140 ccc age

Pro Ser 155 aac tac

Asn Tyr etc tac

Leu Tyr gtc ttc

Val Phe cag aag

Gin Lys gac ggc

Asp Gly tac aac

Tyr Asn gac tgg

Asp Trp etc cca

Leu Pro 110 ega gaa

Arg Glu 125 aag aac

Lys Asn gac ate

Asp lie aag acc

Lys Thr age aag

Ser Lys 190 tea tgc

Ser Cys 205 age etc

Ser Leu gtg gag

Val Glu age aeg

Ser Thr 80 ctg aat

Leu Asn 95 gcc ccc

Ala Pro cca cag

Pro Gin cag gtc

Gin Val gcc gtg

Ala Val 160 aeg cct

Thr Pro 175 etc acc

Leu Thr tcc gtg

Ser Val tcc ctg

Ser Leu 210 215 220 tct ccg 720

Ser Pro 225 ggt gga 768

Gly Gly ggc caa 816

Gly Gin gaa gcc 864

Glu Ala gac cag 912

Asp Gin 290 gtt att 960

Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala egg gac 1152 Arg Asp 370 ctg ccc 1200 ggt aaa

Gly Lys tcc cat

Ser His gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin He ggg gee

Gly Ala egg gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ccc gca ggt gga

Gly Gly 230 cca att

Pro He 245 cag egg

Gin Arg gag ate

Glu He gaa agt

Glu Ser ttg gga

Leu Gly 310 ctg tat

Leu Tyr 325 ctg ett

Leu Leu etc ccg

Leu Pro ccc ega

Pro Arg ccc ccg ggt ggt

Gly Gly cca gat

Pro Asp tac etc

Tyr Leu agg gag

Arg Glu 280 etc ctg

Leu Leu 295 gtc aag

Val Lys gga teg

Gly Ser ett gag

Leu Glu ctg cac

Leu His 360 gga cca

Gly Pro 375 gag cca ggt tct

Gly Ser tct tct

Ser Ser 250 tac aca

Tyr Thr 265 gat ggg

Asp Gly cag ctg

Gin Leu aca tcc

Thr Ser etc cac

Leu His 330 gac gga

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg ccc gga ggt ggt

Gly Gly 235 cca tta

Pro Leu gat gat

Asp Asp aeg gtg

Thr Val aaa gcc

Lys Ala 300 agg ttc

Arg Phe 315 ttt gac

Phe Asp tac aat

Tyr Asn ggg aac

Gly Asn ttc ctg

Phe Leu 380 ate ctg ggt age

Gly Ser tta caa

Leu Gin gcc cag

Ala Gin 270 ggg ggc

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tcc

Lys Ser 365 cca eta

Pro Leu gcc ccc ggt ggt

Gly Gly 240 ttc ggg

Phe Gly 255 cag aca

Gin Thr get get

Ala Ala ccg gga

Pro Gly cag egg

Gin Arg 320 gcc tgc

Ala Cys 335 cag tcc

Gin Ser cca cac

Pro His cca ggc

Pro Gly cag ccc 160

Leu Pro 385 Pro Ala Pro Pro Glu 390 Pro Pro Gly lie 395 Leu Ala Pro Gin Pro 400 ccc gat 1248 gtg ggc tcc teg gac cct ctg age atg gtg gga cct tcc cag Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin 405 410 415 ggc cga 1275 age ccc age tac get tcc taa Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 49 <211> 424

<212> PRT <213> Artificial Sequence <220> <223> 1 Synthetic : Construct <400> 49 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val ASp Val Ser 35 40 45 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 Tyr Arg val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 161

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val He Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 162

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin 405 410 415 Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 50 <211> 1275 <212> DNA <213> Artificial Sequence <220> <223> FC-L15-G170E <220> <221> CDS <222> (1) ., . ¢1275) <400> 50 atg gac 48 aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg Met Asp Lys Thr His Thr cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga 96 ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 163 cac 192 gaa gac cct His Glu 50 Asp Pro gtg 240 cat aat gcc Val 65 His Asn Ala tac 288 cgt gtg gtc Tyr Arg Val Val ggc 336 aag gag tac Gly Lys Glu Tyr 100 ate 384 gag aaa acc lie Glu Lys 115 Thr gtg 432 tac acc ctg Val Tyr 130 Thr Leu age 480 ctg acc tgc Ser 145 Leu Thr Cys gag 528 tgg gag age Glu Trp Glu Ser ccc gtg ctg gac 576

Pro Val Leu Asp 180 gtg 624 gac aag age Val Asp Lys 195 Ser atg 672 cat gag get Met His 210 Glu Ala gag gtc aag ttc Glu Val Lys 55 Phe aag aca aag ccg Lys Thr 70 Lys Pro age gtc etc acc Ser 85 Val Leu Thr aag tgc aag gtc Lys Cys Lys Val ate tcc aaa gcc lie Ser Lys Ala 120 ccc cca tcc cgt Pro Pro Ser 135 Arg ctg gtc aaa ggc Leu Val 150 Lys Gly aat ggg cag ccg Asn 165 Gly Gin Pro tcc gac ggc tcc

Ser Asp Gly Ser cgt tgg cag cag Arg Trp Gin Gin 200 ctg cac aac cac Leu His Asn 215 His aac tgg tac gtg Asn Trp Tyr val 60 cgt gag gag cag Arg Glu Glu 75 Gin gtc ctg cac cag Val Leu 90 His Gin tcc aac aaa gcc Ser 105 Asn Lys Ala aaa ggg cag ccc Lys Gly Gin Pro gat gag ctg acc Asp Glu Leu Thr 14 0 ttc tat ccc age Phe Tyr Pro 155 Ser gag aac aac tac Glu Asn 170 Asn Tyr ttc ttc etc tac Phe 185 Phe Leu Tyr ggg aac gtc ttc Gly Asn Val Phe tac aeg cag aag Tyr Thr Gin Lys 220 gac ggc gtg gag Asp Gly Val Glu tac aac age aeg Tyr Asn Ser Thr 80 gac tgg ctg aat Asp Trp Leu 95 Asn etc cca gee ccc Leu Pro 110 Ala Pro cga gaa cca cag Arg 125 Glu Pro Gin aag aac cag gtc Lys Asn Gin Val gac ate gcc gtg Asp lie Ala Val 160 aag acc aeg cct Lys Thr Thr 175 Pro age aag etc acc Ser Lys 190 Leu Thr tea tgc tcc gtg Ser 205 Cys Ser val age etc tcc ctg Ser Leu Ser Leu 164 tet ccg 720 Ser Pro 225 ggt gga 768 Gly Gly ggc caa 816 Gly Gin gaa gee 864 Glu Ala gac cag 912 Asp Gin 290 gtt att 960 Val He 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala egg gac 1152 Arg Asp 370 ctg ccc 1200 Leu Pro ggt aaa

Gly Lys tcc cat

Ser His gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin lie ggg gcc

Gly Ala egg gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ccc gca

Pro Ala ggt gga

Gly Gly 230 cca att

Pro lie 245 cag egg

Gin Arg gag ate

Glu lie gaa agt

Glu Ser ttg gga

Leu Gly 310 ctg tat

Leu Tyr 325 ctg ett

Leu Leu etc ccg

Leu Pro ccc ega

Pro Arg ccc ccg

Pro Pro ggt ggt

Gly Gly cca gat

Pro Asp tac etc

Tyr Leu agg gag

Arg Glu 280 etc ctg

Leu Leu 295 gtc aag

Val Lys gga teg

Gly Ser ett gag

Leu Glu ctg cac

Leu His 360 gga cca

Gly Pro 375 gag cca

Glu Pro ggt tet

Gly Ser tet tet

Ser Ser 250 tac aca

Tyr Thr 265 gat ggg

Asp Gly cag ctg

Gin Leu aca tcc

Thr Ser etc cac

Leu His 330 gac gga

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg ccc gga

Pro Gly ggt ggt Gly 235 Gly cca tta Pro Leu gat gat Asp Asp aeg gtg Thr Val aaa gee Lys Ala 300 agg ttc Arg 315 Phe ttt gac Phe Asp tac aat Tyr Asn ggg aac Gly Asn ttc ctg Phe Leu 380 ate ctg He Leu ggt age

Gly Ser tta caa

Leu Gin gcc cag

Ala Gin 270 ggg ggc

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tcc

Lys Ser 365 cca eta

Pro Leu gcc ccc

Ala Pro ggt ggt

Gly Gly 240 ttc ggg

Phe Gly 255 cag aca

Gin Thr get get

Ala Ala ccg gga

Pro Gly cag egg

Gin Arg 320 gee tgc

Ala Cys 335 cag tcc

Gin Ser cca cac

Pro His cca ggc

Pro Gly cag ccc

Gin Pro 165 385 390 ccc gat 1248 gtg ggc tcc teg gac cct Pro Asp Val Gly Ser 405 Ser Asp Pro ggc ega 1275 age ccc age tac get tcc Gly Arg Ser Pro 420 Ser Tyr Ala Ser 395 400 ctg age atg gtg gaa cct tcc cag Leu Ser Met Val Glu Pro Ser Gin 410 415 taa <210> <211> <212> <213> 51 424 PRT Artificial Sequence <220> <223> Synthetic Construct <400> 51 Met Asp Lys Thr His Thr Cys Pro 1 5

Pro Cys Pro Ala Pro Glu Leu Leu 10 15

Gly Gly Pro Ser Val Phe Leu Phe 20

Pro Pro Lys Pro Lys Asp Thr Leu 25 30

Met lie Ser Arg Thr Pro Glu Val 35 40

Thr Cys Val Val Val Asp Val Ser 45

His Glu Asp Pro Glu Val Lys Phe 50 55

Asn Trp Tyr Val Asp Gly Val Glu 60

Val His Asn Ala Lys Thr Lys Pro 65 70

Arg Glu Glu Gin Tyr Asn Ser Thr 75 80

Tyr Arg Val Val Ser Val Leu Thr 85

Val Leu His Gin Asp Trp Leu Asn 90 95

Gly Lys Glu Tyr Lys Cys Lys Val 100

Ser Asn Lys Ala Leu Pro Ala Pro 105 110

He Glu Lys Thr He Ser Lys Ala 115 120

Lys Gly Gin Pro Arg Glu Pro Gin 125 166

<img img-format="tif" img-content="drawing" file="IL215937AD00022.tif" id="idf0002" />

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 167 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Pro Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 52 <211> 1275

<212> DNA <213> Artificial Sequence <220>

<223> FC-L15-P171A <220> <221> i CDS <22; 2> (1) - - . (1275) <400> 52 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met He Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 168

His Glu 50 Asp Pro Glu Val Lys 55 Phe Asn Trp Tyr Val 60 Asp Gly Val Glu gtg 240 cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg Val 65 His Asn Ala Lys Thr 70 Lys Pro Arg Glu Glu 75 Gin Tyr Asn Ser Thr 80 tac 288 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat Tyr Arg Val val Ser 85 val Leu Thr Val Leu 90 His Gin Asp Trp Leu 95 Asn ggc 336 aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gee ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tcc aaa gcc aaa ggg cag ccc cga gaa cca cag lie Glu Lys 115 Thr He Ser Lys Ala 120 Lys Gly Gin Pro Arg 125 Glu Pro Gin gtg 432 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 140 Lys Asn Gin Val age 480 ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gee gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp lie Ala Val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn val Phe Ser 205 Cys Ser val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu 169 tet ccg 720 Ser Pro 225 ggt gga 768 Gly Gly ggc caa 816 Gly Gin gaa gee 864 Glu Ala gac cag 912 Asp Gin 290 gtt att 960 Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gee 1104 Glu Ala egg gac 1152 Arg Asp 370 ctg ccc 1200 Leu Pro 385 ggt aaa

Gly Lys tcc cat

Ser His gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin lie ggg gee

Gly Ala egg gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ccc gca

Pro Ala ggt gga

Gly Gly 230 cca att

Pro He 245 cag egg

Gin Arg gag ate

Glu lie gaa agt

Glu Ser ttg gga

Leu Gly 310 ctg tat

Leu Tyr 325 ctg ett

Leu Leu etc ccg

Leu Pro ccc ega

Pro Arg ccc ccg

Pro Pro 390 ggt ggt

Gly Gly cca gat

Pro Asp tac etc

Tyr Leu agg gag

Arg Glu 280 etc ctg

Leu Leu 295 gtc aag

Val Lys gga teg

Gly Ser ett gag

Leu Glu ctg cac

Leu His 360 gga cca

Gly Pro 375 gag cca

Glu Pro ggt tet

Gly Ser tet tet

Ser Ser 250 tac aca

Tyr Thr 265 gat ggg

Asp Gly cag ctg

Gin Leu aca tec

Thr Ser etc cac

Leu His 330 gac gga

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg ccc gga

Pro Gly ggt ggt Gly 235 Gly cca tta Pro Leu gat gat Asp Asp aeg gtg Thr Val aaa gee Lys Ala 300 agg ttc Arg 315 Phe ttt gac Phe Asp tac aat Tyr Asn ggg aac Gly Asn ttc ctg Phe Leu 380 ate ctg Tie 395 Leu ggt age

Gly Ser tta caa

Leu Gin gee cag

Ala Gin 270 ggg ggc

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tec

Lys Ser 365 cca eta

Pro Leu gee ccc

Ala Pro ggt ggt

Gly Gly 240 ttc ggg

Phe Gly 255 cag aca

Gin Thr get get

Ala Ala ccg gga

Pro Gly cag egg

Gin Arg 320 gee tgc

Ala Cys 335 cag tec

Gin Ser cca cac

Pro His cca ggc

Pro Gly cag ccc

Gin Pro 400 170 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga get tcc cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Ala Ser Gin 405 410 415 ggc ega age ccc age tac get tcc taa 1275

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 53 <211> 424 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 53 Met Asp Lys Thr His Thr Cy£ 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met He Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

He Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125 171

I

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro He Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val He Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 172

Glu Ala His 355 Gly Leu Pro Leu His 360 Leu Pro Gly Asn Lys 365 Ser Pro His Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Ala Ser Gin 405 410 415 Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 54 <211> 1275 <212> DNA <213> . Artificial Sequence <220> <223> FC-L15-S172L <220> <221> ' CDS <222> (1) · . ¢1275) <400> 54 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 173 50 55 60 gtg 240 cat aat gee aag aca aag ccg cgt gag gag cag tac aac age aeg Val 65 His Asn Ala Lys Thr 70 Lys Pro Arg Glu Glu 75 Gin Tyr Asn Ser Thr 80 tac 288 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat Tyr Arg Val Val Ser 85 Val Leu Thr Val Leu 90 His Gin Asp Trp Leu 95 Asn ggc 336 aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gee ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tcc aaa gee aaa ggg cag ccc cga gaa cca cag lie Glu Lys 115 Thr He Ser Lys Ala 120 Lys Gly Gin Pro Arg 125 Glu Pro Gin gtg 432 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 14 0 Lys Asn Gin Val age 480 ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gee gtg Ser 145 Leu Thr Cys Leu val 150 Lys Gly Phe Tyr Pro 155 Ser Asp He Ala Val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn Val Phe Ser 205 Cys Ser Val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu tet 720 ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt 174

Ser Pro 225 ggt gga 768

Gly Gly ggc caa 816

Gly Gin gaa gcc 864

Glu Ala gac cag 912

Asp Gin 290 gtt att 960

Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala egg gac 1152 Arg Asp 370 ctg ccc 1200 Leu Pro 385

Gly Lys tcc cat

Ser His gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin He ggg gee

Gly Ala egg gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ccc gca

Pro Ala

Gly Gly 230 cca att

Pro He 245 cag egg

Gin Arg gag ate

Glu He gaa agt

Glu Ser ttg gga

Leu Gly 310 ctg tat

Leu Tyr 325 ctg ett

Leu Leu etc ccg

Leu Pro ccc ega

Pro Arg ccc ccg

Pro Pro 390

Gly Gly cca gat

Pro Asp tac etc

Tyr Leu agg gag

Arg Glu 280 etc ctg

Leu Leu 295 gtc aag

Val Lys gga teg

Gly Ser ett gag

Leu Glu ctg cac

Leu His 360 gga cca

Gly Pro 375 gag cca

Glu Pro

Gly Ser tet tet

Ser Ser 250 tac aca

Tyr Thr 265 gat ggg

Asp Gly cag ctg

Gin Leu aca tcc

Thr Ser etc cac

Leu His 330 gac gga

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg ccc gga

Pro Gly

Gly 235 Giy cca tta Pro Leu gat gat Asp Asp aeg gtg Thr val aaa gee Lys Ala 300 agg ttc Arg 315 Phe ttt gac Phe Asp tac aat Tyr Asn ggg aac Gly Asn ttc ctg Phe Leu 380 ate ctg He 395 Leu

Gly Ser tta caa

Leu Gin gcc cag

Ala Gin 270 ggg ggc

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tcc

Lys Ser 365 cca eta

Pro Leu gcc ccc

Ala Pro

Gly Gly 240 ttc ggg

Phe Gly 255 cag aca

Gin Thr get get

Ala Ala ccg gga

Pro Gly cag egg

Gin Arg 320 gee tgc

Ala Cys 335 cag tcc

Gin Ser cca cac

Pro His cca ggc

Pro Gly cag ccc

Gin Pro 400 175 ccc gat gtg ggc tcc teg gac cct ctg age atg gtg gga cct ctg cag 1248 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Leu Gin 405 410 415 ggc ega 1275 age ccc age tac get tcc Gly Arg Ser Pro 420 Ser Tyr Ala Ser <210> 55 <211> 424

<212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 55

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val

Ser Val 85

Leu Thr Val

Leu His Gin Asp Trp 90

Leu Asn 95

Gly Lys Glu Tyr 100

Lys

Cys Lys Val

Ser Asn Lys Ala Leu 105

Pro Ala Pro 110

He Glu Lys Thr 115

He Ser Lys Ala Lys 120

Gly Gin

Pro Arg Glu 125

Pro Gin

Val Tyr Thr Leu

Pro

Pro Ser Arg

Asp Glu

Leu Thr Lys

Asn Gin Val 176

<img img-format="tif" img-content="drawing" file="IL215937AD00023.tif" id="idf0003" />

Glu Ala His Gly Leu 355 Pro Leu His 360 Leu Pro Gly Asn Lys 365 Ser Pro His Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Leu Gin 405 410 415 Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 56 <211> 1275 <212> DNA <213> Artificial Sequence <220> <223> FC-L15-RGE <220> <221> 1 CDS <222> ¢1) . . (1275) <400> 56 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 178 gtg 240 cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg Val 65 His Asn Ala Lys Thr 70 Lys Pro Arg Glu Glu 75 Gin Tyr Asn Ser Thr 80 tac 288 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat Tyr Arg Val Val Ser 85 Val Leu Thr Val Leu 90 His Gin Asp Trp Leu 95 Asn ggc 336 aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gee ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tcc aaa gcc aaa ggg cag ccc cga gaa cca cag lie Glu Lys 115 Thr He Ser Lys Ala 120 Lys Gly Gin ' Pro Arg 12 5 Glu Pro Gin gtg 432 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 140 Lys Asn Gin Val age 480 ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gee gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp He Ala Val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn val Phe Ser 205 Cys Ser Val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu tct 720 ccg ggt aaa ggt ggt ggt ggt ggt tct ggt ggt ggt age ggt ggt Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 179 225 230 235 240 ggt ggt 768

Gly Gly ggc caa 816

Gly Gin gaa gcc 864

Glu Ala gac cag 912

Asp Gin 290 gtt att 960

Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala cgt gac 1152 Arg Asp 370 ctg ccc 1200 Leu Pro 385 ccc gat 1248 tcc cat

Ser His gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin He ggg gcc

Gly Ala cgt gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ccc gca

Pro Ala gtg ggc cca att

Pro He 245 cag cgt

Gin Arg gag ate

Glu He gaa agt

Glu Ser ttg ggt

Leu Gly 310 ctg tat

Leu Tyr 325 cgt ett

Arg Leu etc ccg

Leu Pro ccc ega

Pro Arg ccc ccg

Pro Pro 390 tcc teg cca gat

Pro Asp tac etc

Tyr Leu agg gag

Arg Glu 280 etc ctg

Leu Leu 295 gtc aag

Val Lys gga teg

Gly Ser ett gag

Leu Glu ctg cac

Leu His 360 gga cca

Gly Pro 375 gag cca

Glu Pro gac cct tet tet

Ser Ser 250 tac aca

Tyr Thr 265 gac ggg

Asp Gly cag ctg

Gin Leu aca tcc

Thr Ser etc cac

Leu His 330 gac ggt

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg ccc gga

Pro Gly ctg age cca tta

Pro Leu gat gat ASp Asp aeg gtg

Thr Val aaa gcc

Lys Ala 300 agg ttc

Arg Phe 315 ttt gac

Phe Asp tac aat

Tyr Asn ggg aac

Gly Asn ttc ctg

Phe Leu 380 ate ctg

He Leu 395 atg gtg tta caa

Leu Gin gcc cag

Ala Gin 270 ggg ggt

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tcc

Lys Ser 365 cca eta

Pro Leu gcc ccc

Ala Pro ggt ggt ttc ggg

Phe Gly 255 cag aca

Gin Thr get get

Ala Ala ccg ggt

Pro Gly cag egg

Gin Arg 320 gee tgc

Ala Cys 335 cag tcc

Gin Ser cca cac

Pro His cca ggc

Pro Gly cag ccc

Gin Pro 400 tcc cag 180

Pro Asp Val Gly Ser 405 Ser Asp Pro ggc cga 1275 age ccc age tac gaa tcc Gly Arg Ser Pro 420 Ser Tyr Glu Ser

Leu Ser Met Val Gly Gly Ser Gin 410 415 taa <210> <211> <212> <213> 57 424 PRT Artificial Sequence <220> <223> Synthetic Construct <400> 57 Met Asp Lys Thr His Thr Cy 1 5

Pro Cys Pro Ala Pro Glu Leu Leu 10 15

Gly Gly Pro Ser Val Phe Leu Phe 20

Pro Pro Lys Pro Lys Asp Thr Leu 25 30

Met lie Ser Arg Thr Pro Glu Val 35 40

Thr Cys Val Val Val Asp Val Ser 45

His Glu Asp Pro Glu Val Lys Phe 50 55

Asn Trp Tyr Val Asp Gly Val Glu 60

Val His Asn Ala Lys Thr Lys Pro 65 70

Arg Glu Glu Gin Tyr Asn Ser Thr 75 80

Tyr Arg Val Val Ser Val Leu Thr 85

Val Leu His Gin Asp Trp Leu Asn 90 95

Gly Lys Glu Tyr Lys Cys Lys Val 100

Ser Asn Lys Ala Leu Pro Ala Pro 105 110

He Glu Lys Thr He Ser Lys Ala 115 120

Lys Gly Gin Pro Arg Glu Pro Gin 125

Val Tyr Thr Leu Pro Pro Ser Arg 130 135

Asp Glu Leu Thr Lys Asn Gin Val 140 181

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 182 355 360 365

Arg Asp 370 Pro Ala Pro Arg Gly Pro 375 Ala Arg Phe Leu 380 Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415 Gly Arg Ser Pro Ser Tyr Glu Ser 420 <210> 58 <211> 1275 <212> DNA <213> . Artificial Sequence <220> <223> FC-L15-G170E P171A S172L <220> <221> CDS <222> ¢1).,(1275) <400> 58 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys val Val val ASp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 183 gtg 240 cat aat gec aag aca aag ccg cgt gag gag cag tac aac age aeg Val 65 His Asn Ala Lys Thr 70 Lys Pro Arg Glu Glu 75 Gin Tyr Asn Ser Thr 80 tac 288 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat Tyr Arg Val Val Ser 85 Val Leu Thr Val Leu 90 His Gin Asp Trp Leu 95 Asn ggc 336 aag gag tac aag tgc aag gtc tcc aac aaa gee etc cca gee ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tcc aaa gee aaa ggg cag ccc ega gaa cca cag lie Glu Lys 115 Thr He Ser Lys Ala 120 Lys Gly Gin Pro Arg 125 Glu Pro Gin gtg 432 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 14 0 Lys Asn Gin Val age 480 ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gee gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp He Ala Val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn Val Phe Ser 205 Cys Ser val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu tet 720 ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt Ser 225 Pro Gly Lys Gly Gly 230 Gly Gly Gly Ser Gly 235 Gly Gly Ser Gly Gly 240 184 ggt 768 gga tcc cat cca att cca gat tct tct cca tta tta caa ttc ggg Gly Gly Ser His Pro 245 lie Pro Asp Ser Ser 250 Pro Leu Leu Gin Phe 255 Gly ggc 816 caa gtc egg cag egg tac etc tac aca gat gat gee cag cag aca Gly Gin Val Arg 260 Gin Arg Tyr Leu Tyr 265 Thr Asp Asp Ala Gin 270 Gin Thr gaa 864 gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get Glu Ala His 275 Leu Glu lie Arg Glu 280 Asp Gly Thr Val Gly 285 Gly Ala Ala gac 912 cag age ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga Asp Gin 290 Ser Pro Glu Ser Leu 295 Leu Gin Leu Lys Ala 300 Leu Lys Pro Gly gtt 960 att caa ate ttg gga gtc aag aca tec agg ttc ctg tgc cag egg Val 305 lie Gin lie Leu Gly 310 Val Lys Thr Ser Arg 315 Phe Leu Cys Gin Arg 320 cca gat ggg gee ctg tat gga teg etc cac ttt gac cct gag gee tgc 1008

Pro Asp Gly Ala Leu 325 Tyr Gly Ser Leu His 330 Phe Asp Pro Glu Ala 335 Cys age 1056 ttc egg gag ctg Ctt ctt gag gac gga tac aat gtt tac cag tec Ser Phe Arg Glu 340 Leu Leu Leu Glu Asp 345 Gly Tyr Asn Val Tyr 350 Gin Ser gaa 1104 gee cac ggc etc ccg ctg cac ctg cca ggg aac aag tec cca cac Glu Ala His 355 Gly Leu Pro Leu His 360 Leu Pro Gly Asn Lys 365 Ser Pro His egg 1152 gac cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc Arg Asp 370 Pro Ala Pro Arg Gly 375 Pro Ala Arg Phe Leu 380 Pro Leu Pro Gly ctg 1200 ccc ccc gca ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc Leu 385 Pro Pro Ala Pro Pro 390 Glu Pro Pro Gly lie 395 Leu Ala Pro Gin Pro 400 ccc 1248 gat gtg ggc tec teg gac cct ctg age atg gtg gaa get ctg cag Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Ala Leu Gin 185 405 410 415 ggc ega age ccc age tac get tcc taa 1275

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 59 <211> 424

<212 > PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 59

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

He Glu Lys Thr He Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140 186

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro He Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 187

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Ala Leu Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 60 <211> 1275

<212> DNA <213> Artificial Sequence <220>

<223> FC-L15-G151A <220> <221> CDS <222> ΐ1) . . (1275) <400> 60 atg 48 gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg Met 1 Asp Lys Thr His 5 Thr Cys Pro Pro Cys 10 Pro Ala Pro Glu Leu 15 Leu ggg 96 gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc Gly Gly Pro Ser 20 Val Phe Leu Phe Pro 25 Pro Lys Pro Lys Asp 30 Thr Leu atg 144 ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age Met He Ser 35 Arg Thr Pro Glu Val 40 Thr Cys Val Val Val 45 Asp Val Ser cac 192 gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag His Glu 50 Asp Pro Glu Val Lys 55 Phe Asn Trp Tyr Val 60 Asp Gly Val Glu gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 188

Val 65 His Asn Ala Lys Thr 70 Lys Pro Arg Glu Glu 75 Gin Tyr Asn Ser Thr 80 tac 288 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat Tyr Arg Val Val Ser 85 Val Leu Thr Val Leu 90 His Gin Asp Trp Leu 95 Asn ggc 336 aag gag tac aag tgc aag gtc tee aac aaa gee etc cca gee ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tee aaa gee aaa ggg cag ccc ega gaa cca cag lie Glu Lys 115 Thr He Ser Lys Ala 120 Lys Gly Gin Pro Arg 125 Glu Pro Gin gtg 432 tac ace ctg ccc cca tee cgt gat gag ctg acc aag aac cag gtc Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 140 Lys Asn Gin Val age 480 ctg ace tgc ctg gtc aaa ggc ttc tat ccc age gac ate gee gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp lie Ala Val 160 gag 528 tgg gag age aat ggg cag ecg gag aac aac tac aag acc aeg ect Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tee gac ggc tee ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tee gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn Val Phe Ser 205 Cys Ser Val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tee ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu tet 720 ecg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt Ser 225 Pro Gly Lys Gly Gly 230 Gly Gly Gly Ser Gly 235 Gly Gly Ser Gly Gly 240 189 ggt gga 768

Gly Gly ggc caa 816

Gly Gin gaa gcc 864

Glu Ala gac cag 912

Asp Gin 290 gtt att 960

Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala egg gac 1152 Arg Asp 370 ctg ccc 1200 Leu Pro 385 ccc gat 1248 Pro Asp tcc cat

Ser His gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin He ggg gee

Gly Ala egg gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ccc gca

Pro Ala gtg ggc

Val Gly cca att Pro 245 He cag egg Gin Arg gag ate Glu He gaa agt Glu Ser ttg gga Leu Gly 310 ctg tat Leu 325 Tyr ctg ett Leu Leu etc ccg Leu Pro ccc ega Pro Arg ccc ccg Pro Pro 390 tcc teg Ser 405 Ser cca gat

Pro Asp tac etc

Tyr Leu agg gag

Arg Glu 280 etc ctg

Leu Leu 295 gtc aag

Val Lys gga teg

Gly Ser ett gag

Leu Glu ctg cac

Leu His 360 gga cca

Gly Pro 375 gag cca

Glu Pro gac cct

Asp Pro tct tct

Ser Ser 250 tac aca

Tyr Thr 265 gat ggg

Asp Gly cag ctg

Gin Leu aca tcc

Thr Ser etc cac

Leu His 330 gac gga

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg ccc gca

Pro Ala ctg age

Leu Ser 410 cca tta

Pro Leu gat gat

Asp Asp aeg gtg

Thr Val aaa gcc

Lys Ala 300 agg ttc

Arg Phe 315 ttt gac

Phe Asp tac aat

Tyr Asn ggg aac

Gly Asn ttc ctg

Phe Leu 380 ate ctg

He Leu 395 atg gtg

Met Val tta caa

Leu Gin gcc cag

Ala Gin 270 ggg ggc

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tcc

Lys Ser 365 cca eta

Pro Leu gcc ccc

Ala Pro gga cct

Gly Pro ttc ggg

Phe Gly 255 cag aca

Gin Thr get get

Ala Ala ccg gga

Pro Gly cag egg

Gin Arg 320 gee tgc

Ala Cys 335 cag tcc

Gin Ser cca cac

Pro His cca ggc

Pro Gly cag ccc

Gin Pro 400 tcc cag

Ser Gin 415 190 ggc cga age ccc age tac get tcc taa 1275

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 61 <211> 424

<212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 61

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val

Ser Val 85

Leu Thr Val

Leu His

Gin Asp Trp 90

Leu Asn 95 y Lys Glu Tyr Lys Cys Lys Val inn

Ser Asn Lys Ala Leu 105

Pro Ala 110

Pro

He Glu Lys Thr He 115

Ser Lys Ala Lys 120

Gly Gin

Pro Arg Glu 125

Pro Gin

Val Tyr Thr Leu Pro 130

Pro Ser Arg Asp Glu 135

Leu Thr 140

Lys

Asn Gin Val

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp He Ala Val 191 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 192

Arg Asp 370 Pro Ala Pro Arg Gly 375 Pro Ala Arg Phe Leu 380 Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu Pro Pro Ala lie Leu Ala Pro Gin Pro 385 390 395 400 Pro Asp val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin 405 410 415 Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 62 <211> 1275 <212> DNA <213> . Artificial Sequence <220> <223> FC-L15-G170E P171A <220> <221> ' CDS <222> ¢1) . . . (1275) <400> 62 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met He Ser Arg Thr Pro Glu Val Thr Cys Val Val val Asp val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr val Asp Gly val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 193 65 70 75 80 tac 288 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat Tyr Arg Val Val Ser 85 Val Leu Thr Val Leu 90 His Gin Asp Trp Leu 95 Asn ggc 336 aag gag tac aag tgc aag gtc tcc aac aaa gee etc cca gee ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tcc aaa gee aaa ggg cag ccc ega gaa cca cag lie Glu Lys 115 Thr He Ser Lys Ala 120 Lys Gly Gin Pro Arg 125 Glu Pro Gin gtg 432 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 140 Lys Asn Gin Val age 480 ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gee gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp He Ala Val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tee gac ggc tcc ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn Val Phe Ser 205 Cys Ser Val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu tet 720 ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt Ser 225 Pro Gly Lys Gly Gly 230 Gly Gly Gly Ser Gly 235 Gly Gly Ser Gly Gly 240 ggt 768 gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg 194

Gly Gly ggc caa 816

Gly Gin gaa gcc 864

Glu Ala gac cag 912

Asp Gin 290 gtt att 960

Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala egg gac 1152 Arg Asp 370 ctg ccc 1200 Leu Pro 385 ccc gat 1248 Pro Asp

Ser His gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin He ggg gee

Gly Ala egg gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ccc gca

Pro Ala gtg ggc

Val Gly

Pro 245 He cag egg Gin Arg gag ate Glu He gaa agt Glu Ser ttg gga Leu Gly 310 ctg tat Leu 325 Tyr ctg ett Leu Leu etc ccg Leu Pro ccc ega Pro Arg ccc ccg Pro Pro 390 tcc teg Ser 405 Ser

Pro Asp tac etc

Tyr Leu agg gag

Arg Glu 280 etc ctg

Leu Leu 295 gtc aag

Val Lys gga teg

Gly Ser ett gag

Leu Glu ctg cac

Leu His 360 gga cca

Gly Pro 375 gag cca

Glu Pro gac cct

Asp Pro

Ser Ser 250 tac aca

Tyr Thr 265 gat ggg

Asp Gly cag ctg

Gin Leu aca tcc

Thr Ser etc cac

Leu His 330 gac gga

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg ccc gga

Pro Gly ctg age

Leu Ser 410

Pro Leu gat gat

Asp Asp aeg gtg

Thr Val aaa gcc

Lys Ala 300 agg ttc

Arg Phe 315 ttt gac

Phe Asp tac aat

Tyr Asn ggg aac

Gly Asn ttc ctg

Phe Leu 380 ate ctg

He Leu 395 atg gtg

Met Val

Leu Gin gcc cag

Ala Gin 270 ggg ggc

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tcc

Lys Ser 365 cca eta

Pro Leu gcc ccc

Ala Pro gaa get

Glu Ala

Phe Gly 255 cag aca Gin Thr get get Ala Ala ccg gga Pro Gly cag egg Gin Arg 320 gee tgc Ala 335 Cys cag tcc Gin Ser cca cac Pro His cca ggc Pro Gly cag ccc Gin Pro 400 tcc cag Ser 415 Gin 195 ggc cga age ccc age tac get tcc taa 1275

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 63 <211> 424

<212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 63

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val

Val

Ser Val

Leu Thr Val 85

Leu His Gin Asp Trp 90

Leu Asn 95

Gly Lys Glu Tyr Lys 100

Cys Lys Val

Ser Asn Lys Ala Leu 105

Pro Ala Pro 110

He Glu Lys Thr He 115

Ser Lys Ala Lys 120

Gly Gin

Pro Arg Glu 125

Pro Gin

Val Tyr Thr Leu Pro 130

Pro Ser Arg Asp Glu 135

Leu Thr Lys 140

Asn Gin Val

Ser Leu Thr Cys 145

Leu Val 150

Lys Gly

Phe Tyr

Pro Ser Asp 155

He Ala Val 160 196

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val He Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 197

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Ala Ser Gin 405 410 415 Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 64 <211> 1275

<212> DNA <213> Artificial Sequence <220> <223> FC-L15-P150A G151A I152V <220> <221> ' CDS <222> ¢1) . . (1275) <400> 64 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 999 gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met He Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gec aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 198 tac 288 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat Tyr Arg Val Val Ser 85 Val Leu Thr Val Leu 90 His Gin Asp Trp Leu 95 Asn ggc 336 aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gee ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tcc aaa gcc aaa ggg cag ccc ega gaa cca cag lie Glu Lys 115 Thr lie Ser Lys Ala 120 Lys Gly Gin Pro Arg 125 Glu Pro Gin gtg 432 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 14 0 Lys Asn Gin val age 480 ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gee gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp He Ala val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Giy Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn Val Phe Ser 205 Cys Ser Val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu tet 720 ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt Ser 225 Pro Gly Lys Gly Gly 230 Gly Gly Gly Ser Gly 235 Gly Gly Ser Gly Gly 240 ggt 768 gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg Gly Gly Ser His Pro He Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 199 245 250 255 ggc caa 816

Gly Gin gaa gcc 864

Glu Ala gac cag 912

Asp Gin 290 gtt att 960

Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala egg gac 1152 Arg Asp 370 ctg ccc 1200 Leu Pro 385 ccc gat 1248 Pro Asp ggc ega 1275 gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin lie ggg gee

Gly Ala egg gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ccc gca

Pro Ala gtg ggc

Val Gly age ccc cag egg

Gin Arg gag ate

Glu Tie gaa agt

Glu Ser ttg gga

Leu Gly 310 ctg tat

Leu Tyr 325 ctg ctt

Leu Leu etc ccg

Leu Pro ccc ega

Pro Arg ccc ccg

Pro Pro 390 tec teg

Ser Ser 405 age tac tac etc

Tyr Leu agg gag

Arg Glu 280 etc ctg

Leu Leu 295 gtc aag

Val Lys gga teg

Gly Ser ctt gag

Leu Glu ctg cac

Leu His 360 gga cca

Gly Pro 375 gag cca

Glu Pro gac cct

Asp Pro get tec tac aca

Tyr Thr 265 gat ggg

Asp Gly cag ctg

Gin Leu aca tec

Thr Ser etc cac

Leu His 330 gac gga

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg gcc gca

Ala Ala ctg age

Leu Ser 410 taa gat gat

Asp Asp aeg gtg

Thr Val aaa gcc

Lys Ala 300 agg ttc

Arg Phe 315 ttt gac

Phe Asp tac aat

Tyr Asn ggg aac

Gly Asn ttc ctg

Phe Leu 380 gtt ctg

Val Leu 395 atg gtg

Met Val gcc cag

Ala Gin 270 ggg ggc

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tec

Lys Ser 365 cca eta

Pro Leu gcc ccc

Ala Pro gga cct

Gly Pro cag aca

Gin Thr get get Ala Ala ccg gga Pro Gly cag egg Gin Arg 320 gcc tgc Ala 335 Cys cag tec Gin Ser cca cac Pro His cca ggc Pro Gly cag ccc Gin Pro 400 tec cag Ser 415 Gin 200

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> <211> <212> <213> 65 424 PRT Artificial Sequence <220> <223> Synthetic Construct <400> 65 Met Asp Lys Thr His Thr Cys Pro 1 5

Pro Cys Pro Ala Pro Glu Leu Leu 10 15

Gly Gly Pro Ser Val Phe Leu Phe 20

Pro Pro Lys Pro Lys Asp Thr Leu 25 30

Met lie Ser Arg Thr Pro Glu Val 35 40

Thr Cys Val Val Val Asp Val Ser 45

His Glu Asp Pro Glu Val Lys Phe 50 55

Asn Trp Tyr Val Asp Gly Val Glu 60

Val His Asn Ala Lys Thr Lys Pro 65 70

Arg Glu Glu Gin Tyr Asn Ser Thr 75 80

Tyr Arg Val Val Ser Val Leu Thr 85

Val Leu His Gin Asp Trp Leu Asn 90 95

Gly Lys Glu Tyr Lys Cys Lys Val 100

Ser Asn Lys Ala Leu Pro Ala Pro 105 110

He Glu Lys Thr He Ser Lys Ala 115 120

Lys Gly Gin Pro Arg Glu Pro Gin 125

Val Tyr Thr Leu Pro Pro Ser Arg 130 135

Asp Glu Leu Thr Lys Asn Gin Val 140

Ser Leu Thr Cys 145

Leu Val 150

Lys Gly

Phe Tyr

Pro 155

Ser Asp

He Ala Val 160 201

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val He Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 202

Leu 385 Pro Pro Ala Pro Pro 390 Glu Pro Ala Ala Val 395 Leu Ala Pro Gin Pro 400 Pro Asp Val Gly Ser 405 Ser Asp Pro Leu Ser 410 Met Val Gly Pro Ser 415 Gin Gly Arg Ser Pro 420 Ser Tyr Ala Ser <210> 66 <211> 1275 <212> DNA <213> . <220> <223> Artificial Sequence FC-L15-G170E S172L <220> <221> CDS <222> ¢1) ·, . ¢1275) <400> 66 atg gac 48 aaa act cac aca tgt cca cct tgt cca get ecg gaa etc ctg Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15 ggg gga 96 ecg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate 144 tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age Met lie Ser Arg Thr Pro Glu Val Thr Cys val Val Val Asp val Ser 35 40 45 cac gaa 192 gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat 240 aat gcc aag aca aag ecg cgt gag gag cag tac aac age aeg Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 203 tac 288 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat Tyr Arg Val Val Ser 85 Val Leu Thr Val Leu 90 His Gin Asp Trp Leu 95 Asn ggc 336 aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gee ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tcc aaa gcc aaa ggg cag ccc ega gaa cca cag lie Glu Lys 115 Thr He Ser Lys Ala 120 Lys Gly Gin Pro Arg 125 Glu Pro Gin gtg 432 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 140 Lys Asn Gin Val age 480 ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gee gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp He Ala val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn Val Phe Ser 205 Cys Ser Val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu tet 720 ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt Ser 225 Pro Gly Lys Gly Gly 230 Gly Gly Gly Ser Gly 235 Gly Gly Ser Gly Gly 240 ggt 768 gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg Gly Gly Ser His Pro 245 He Pro Asp Ser Ser 250 Pro Leu Leu Gin Phe 255 Gly 204 ggc caa 816

Gly Gin gaa gcc 864

Glu Ala gac cag 912

Asp Gin 290 gtt att 960

Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala egg gac 1152 Arg Asp 370 ctg ccc 1200 Leu Pro 385 ccc gat 1248 Pro Asp ggc ega 1275 Gly Arg gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin He ggg gee

Gly Ala egg gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ccc gca

Pro Ala gtg ggc

Val Gly age ccc

Ser Pro cag egg

Gin Arg gag ate

Glu He gaa agt

Glu Ser ttg gga

Leu Gly 310 ctg tat

Leu Tyr 325 ctg ett

Leu Leu etc ecg

Leu Pro ccc ega

Pro Arg ccc ecg

Pro Pro 390 tec teg

Ser Ser 405 age tac

Ser Tyr tac etc

Tyr Leu agg gag

Arg Glu 280 etc ctg

Leu Leu 295 gtc aag

Val Lys gga teg

Gly Ser ett gag

Leu Glu ctg cac

Leu His 360 gga cca

Gly Pro 375 gag cca

Glu Pro gac cct

Asp Pro get tec

Ala Ser tac aca

Tyr Thr 265 gat ggg

Asp Gly cag ctg

Gin Leu aca tec

Thr Ser etc cac

Leu His 330 gac gga

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg ccc gga

Pro Gly ctg age

Leu Ser 410 taa gat gat

Asp Asp aeg gtg

Thr Val aaa gcc

Lys Ala 300 agg ttc

Arg Phe 315 ttt gac

Phe Asp tac aat

Tyr Asn ggg aac

Gly Asn ttc ctg

Phe Leu 380 ate ctg

He Leu 395 atg gtg

Met Val gcc cag

Ala Gin 270 ggg ggc

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tec

Lys Ser 365 cca eta

Pro Leu gcc ccc

Ala Pro gaa cct

Glu Pro cag aca Gin Thr get get Ala Ala ecg gga Pro Gly cag egg Gin Arg 320 gcc tgc Ala 335 Cys cag tec Gin Ser cca cac Pro His cca ggc Pro Gly cag ccc Gin Pro 400 ctg cag Leu 415 Gin 205 420 <210> 67 <211> 424 <212> PRT <213 > Artificial Sequence <220> <223> Synthetic Construct <400> 67 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 1 5 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 Θ0

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

He Glu Lys Thr He Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp He Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 206 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val He Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 207

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Pro Leu Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 68 <211> 1275

<212> DNA <213> Artificial Sequence <220>

<223> FC-L15-G170A <220> <221> CDS <222> (1) . . (1275) <400> 68 atg 48 gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg Met 1 Asp Lys Thr His 5 Thr Cys Pro Pro Cys 10 Pro Ala Pro Glu Leu 15 Leu ggg 96 gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc Gly Gly Pro Ser 20 Val Phe Leu Phe Pro 25 Pro Lys Pro Lys Asp 30 Thr Leu atg 144 ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age Met He Ser 35 Arg Thr Pro Glu Val 40 Thr Cys Val Val Val 45 Asp Val Ser cac 192 gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag His Glu 50 Asp Pro Glu Val Lys 55 Phe Asn Trp Tyr Val 60 Asp Gly Val Glu gtg 240 cat aat gec aag aca aag ccg cgt gag gag cag tac aac age aeg Val 65 His Asn Ala Lys Thr 70 Lys Pro Arg Glu Glu 75 Gin Tyr Asn Ser Thr 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 208

Tyr Arg Val Val Ser 85 Val Leu Thr Val Leu 90 His Gin Asp Trp Leu 95 Asn ggc 336 aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tcc aaa gcc aaa ggg cag ccc ega gaa cca cag lie Glu Lys 115 Thr He Ser Lys Ala 120 Lys Gly Gin Pro Arg 125 Glu Pro Gin gtg 432 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 14 0 Lys Asn Gin Val age 480 ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gcc gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp He Ala Val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn Val Phe Ser 205 Cys Ser Val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu tet 720 ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt Ser 225 Pro Gly Lys Gly Gly 230 Gly Gly Gly Ser Gly 235 Gly Gly Ser Gly Gly 240 ggt 768 gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg Gly Gly Ser His Pro 245 He Pro Asp Ser Ser 250 Pro Leu Leu Gin Phe 255 Gly 209 ggc caa 816

Gly Gin gaa gcc 864

Glu Ala gac cag 912

Asp Gin 290 gtt att 960

Val lie 305 cca gat 1008 Pro Asp age ttc 1056 Ser Phe gaa gcc 1104 Glu Ala egg gac 1152 Arg Asp 370 ctg ccc 1200 Leu Pro 385 ccc gat 1248 Pro Asp ggc ega 1275 Gly Arg gtc egg

Val Arg 260 cac ctg

His Leu 275 age ccc

Ser Pro caa ate

Gin He ggg gcc

Gly Ala egg gag

Arg Glu 340 cac ggc

His Gly 355 cct gca

Pro Ala ccc gca

Pro Ala gtg ggc

Val Gly age ccc

Ser Pro 420 cag egg

Gin Arg gag ate

Glu He gaa agt

Glu Ser ttg gga

Leu Gly 310 ctg tat

Leu Tyr 325 ctg ett

Leu Leu etc ccg

Leu Pro ccc ega

Pro Arg ccc ccg

Pro Pro 390 tec teg

Ser Ser 405 age tac

Ser Tyr tac etc

Tyr Leu agg gag

Arg Glu 280 etc ctg

Leu Leu 295 gtc aag

Val Lys gga teg

Gly Ser ett gag

Leu Glu ctg cac

Leu His 360 gga cca

Gly Pro 375 gag cca

Glu Pro gac cct

Asp Pro get tec

Ala Ser tac aca

Tyr Thr 265 gat ggg

Asp Gly cag ctg

Gin Leu aca tec

Thr Ser etc cac

Leu His 330 gac gga

Asp Gly 345 ctg cca

Leu Pro get ege

Ala Arg ccc gga

Pro Gly ctg age

Leu Ser 410 taa gat gat

Asp Asp aeg gtg

Thr Val aaa gcc

Lys Ala 300 agg ttc

Arg Phe 315 ttt gac

Phe Asp tac aat

Tyr Asn ggg aac

Gly Asn ttc ctg

Phe Leu 380 ate ctg

He Leu 395 atg gtg

Met Val gcc cag

Ala Gin 270 ggg ggc

Gly Gly 285 ttg aag

Leu Lys ctg tgc

Leu Cys cct gag

Pro Glu gtt tac

Val Tyr 350 aag tec

Lys Ser 365 cca eta

Pro Leu gcc ccc

Ala Pro get cct

Ala Pro cag aca Gin Thr get get Ala Ala ccg gga Pro Gly cag egg Gin Arg 320 gee tgc Ala 335 Cys cag tec Gin Ser cca cac Pro His cca ggc Pro Gly cag ccc Gin Pro 400 tec cag Ser 415 Gin 210 <210> 69 <211> 424

<212> PRT <213> Artificial Sequence <220> <223 > Synthetic Construct <400> 69

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

He Glu Lys Thr He Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp He Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 211

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His· Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val He Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 212

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Ala Pro Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 70 <211> 1275

<212> DNA <213> Artificial Sequence <220>

<223> FC-L15-G170C <220> <221> CDS <222> (1)..¢1275) <400> 70 atg 48 gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc ctg Met 1 Asp Lys Thr His 5 Thr Cys Pro Pro Cys 10 Pro Ala Pro Glu Leu 15 Leu ggg 96 gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc Gly Gly Pro Ser 20 Val Phe Leu Phe Pro 25 Pro Lys Pro Lys Asp 30 Thr Leu atg 144 ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age Met He Ser 35 Arg Thr Pro Glu Val 40 Thr Cys Val Val val 45 Asp val Ser cac 192 gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag His Glu 50 Asp Pro Glu Val Lys 55 Phe Asn Trp Tyr Val 60 Asp Gly val Glu gtg 240 cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg val 65 His Asn Ala Lys Thr 70 Lys Pro Arg Glu Glu 75 Gin Tyr Asn Ser Thr 80 tac 288 cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 213 85 90 95 ggc aag 336

Gly Lys ate gag 384 lie Glu gtg tac 432

Val Tyr 130 age ctg 480

Ser Leu 145 gag tgg 528

Glu Trp ccc gtg 576

Pro Val gtg gac 624

Val Asp atg cat 672

Met His 210 tet ccg 720

Ser Pro 225 ggt gga 768

Gly Gly ggc caa 816 gag tac

Glu Tyr 100 aaa acc

Lys Thr 115 acc ctg

Thr Leu acc tgc

Thr Cys gag age

Glu Ser ctg gac

Leu Asp 180 aag age

Lys Ser 195 gag get

Glu Ala ggt aaa

Gly Lys tcc cat

Ser His gtc egg aag tgc

Lys Cys ate tcc

He Ser ccc cca

Pro Pro ctg gtc

Leu Val 150 aat ggg

Asn Gly 165 tcc gac

Ser Asp cgt tgg

Arg Trp ctg cac

Leu His ggt gga

Gly Gly 230 cca att

Pro He 245 cag egg aag gtc

Lys Val aaa gee

Lys Ala 120 tcc cgt

Ser Arg 135 aaa ggc

Lys Gly cag ccg

Gin Pro ggc tcc

Gly Ser cag cag

Gin Gin 200 aac cac

Asn His 215 ggt ggt

Gly Gly cca gat

Pro Asp tac etc tcc aac

Ser Asn 105 aaa ggg

Lys Gly gat gag

Asp Glu ttc tat

Phe Tyr gag aac

Glu Asn 170 ttc ttc

Phe Phe 185 ggg aac

Gly Asn tac aeg

Tyr Thr ggt tet

Gly Ser tet tet

Ser Ser 250 tac aca aaa gee

Lys Ala cag ccc

Gin Pro ctg acc

Leu Thr 14 0 ccc age

Pro Ser 155 aac tac

Asn Tyr etc tac

Leu Tyr gtc ttc

Val Phe cag aag

Gin Lys 220 ggt ggt

Gly Gly 235 cca tta

Pro Leu gat gat etc cca

Leu Pro 110 cga gaa

Arg Glu 125 aag aac

Lys Asn gac ate

Asp He aag acc

Lys Thr age aag

Ser Lys 190 tea tgc

Ser Cys 205 age etc

Ser Leu ggt age

Gly Ser tta caa

Leu Gin gee cag gee ccc

Ala Pro cca cag

Pro Gin cag gtc

Gin Val gee gtg

Ala Val 160 aeg cct

Thr Pro 175 etc acc

Leu Thr tcc gtg

Ser Val tcc ctg

Ser Leu ggt ggt

Gly Gly 240 ttc ggg

Phe Gly 255 cag aca 214

Gly Gin Val Arg Gin Arg Tyr Leu Tyr 265 Thr Asp Asp Ala Gin 270 Gin 260 gaa gcc cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get 864 Glu Ala His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala 275 280 285 gac cag age ccc gaa agt etc ctg cag Ctg aaa gee ttg aag ccg 912 Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro 290 295 300 gtt att caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag 960 Val lie Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin 305 310 315 cca gat ggg gee ctg tat gga teg etc cac ttt gac cct gag gee 1008

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala 325 330 335 age ttc 1056 egg gag ctg ett ett gag gac gga tac aat gtt tac cag Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin 340 345 350 gaa gcc 1104 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro 355 360 365 egg gac 1152 cct gca ccc cga gga cca get ege ttc ctg cca eta cca Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro 370 375 380 ctg ccc 1200 ccc gca ccc ccg gag cca ccc gga ate ctg gee ccc cag Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin 385 390 395 ccc gat 1248 gtg ggc tcc teg gac cct ctg age atg gtg tgc cct tcc Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met val Cys Pro Ser 405 410 415 ggc cga 1275 age ccc age tac get tcc taa Gly Arg Ser Pro Ser Tyr Ala Ser 420

Thr get

Ala gga

Gly egg

Arg 320 tgc

Cys tcc

Ser cac

His ggc

Gly ccc

Pro 400 cag

Gin 215 <210> 71 <211> 424

<212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 71

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val

Ser Val 85

Leu Thr Val

Leu His Gin Asp Trp 90

Leu Asn 95

Gly Lys Glu Tyr Lys 100

Cys Lys Val

Ser Asn Lys Ala Leu 105

Pro Ala 110

Pro lie Glu Lys Thr He 115

Ser Lys Ala Lys 120

Gly Gin

Pro Arg Glu 125

Pro Gin

Val Tyr Thr Leu Pro Pro 130

Ser Arg Asp Glu Leu 135

Thr 140

Lys

Asn

Gin Val

Ser Leu Thr Cys 145

Leu Val 150

Lys Gly Phe Tyr

Pro Ser Asp 155

He Ala Val 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175 216

<img img-format="tif" img-content="drawing" file="IL215937AD00024.tif" id="idf0004" />

305 310 315 320

Pro Asp Gly Ala

Leu Tyr Gly Ser Leu 325

His 330

Phe Asp

Pro Glu Ala Cys 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly lie Leu Ala Pro Gin Pro 385 390 395 400 217

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Cys Pro Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 72 <211> 1275

<212> DNA <213 > Artificial Sequence <220>

<223> FC-L15-G170D <220> <221> CDS <222> (1)..¢1275) <400> 72 atg 48 Met 1 gac Asp aaa Lys act Thr cac His 5 aca Thr tgt Cys cca Pro cct Pro tgt Cys 10 cca get Pro Ala ccg gaa etc Leu 15 ctg Leu Pro Glu ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc etc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg age 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60 gtg cat aat gcc aag aca aag ccg cgt gag gag cag tac aac age aeg 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg aat 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 218 ggc 336 aag gag tac aag tgc aag gtc tcc aac aaa gee etc cca gee ccc Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tcc aaa gcc aaa ggg cag ccc cga gaa cca cag lie Glu Lys 115 Thr He Ser Lys Ala 120 Lys Gly Gin Pro Arg 12 5 Glu Pro Gin gtg 432 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 140 Lys Asn Gin Val age 480 ctg acc tgc ctg gtc aaa ggc ttc tat ccc age gac ate gcc gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp He Ala val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tee gac ggc tcc ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn Val Phe Ser 205 Cys Ser Val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu tet 720 ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt Ser 225 Pro Gly Lys Gly Gly 230 Gly Gly Gly Ser Gly 235 Gly Gly Ser Gly Gly 240 ggt 768 gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg Gly Gly Ser His Pro 245 He Pro Asp Ser Ser 250 Pro Leu Leu Gin Phe 255 Gly ggc 816 caa gtc egg cag egg tac etc tac aca gat gat gee cag cag aca Gly Gin Val Arg 260 Gin Arg Tyr Leu Tyr 265 Thr Asp Asp Ala Gin 270 Gin Thr 219 gaa gcc 864 cac ctg gag Glu Ala His 275 Leu Glu gac cag 912 age ccc gaa Asp Gin 290 Ser Pro Glu gtt att 960 caa ate ttg Val lie 305 Gin He Leu cca gat 1008 ggg gee ctg Pro Asp Gly Ala Leu 325 age ttc 1056 egg gag ctg Ser Phe Arg Glu 340 Leu gaa gcc 1104 cac ggc etc Glu Ala His 355 Gly Leu egg gac 1152 cct gca ccc Arg Asp 370 Pro Ala Pro ctg ccc 1200 ccc gca ccc Leu Pro 385 Pro Ala Pro ccc gat 1248 gtg ggc tcc Pro Asp Val Gly Ser 405 ggc ega 1275 age ccc age Gly Arg Ser Pro 420 Ser ate agg gag gat ggg Xie Arg Glu 280 Asp Gly agt etc ctg cag Ctg Ser Leu 295 Leu Gin Leu gga gtc aag aca tcc Gly 310 Val Lys Thr Ser tat gga teg etc cac Tyr Gly Ser Leu His 330 ett ett gag gac gga Leu Leu Glu Asp 345 Gly ccg ctg cac ctg cca Pro Leu His 360 Leu Pro ega gga cca get ege Arg Gly 375 Pro Ala Arg ccg gag cca ccc gga Pro 390 Glu Pro Pro Gly teg gac cct ctg age Ser Asp Pro Leu Ser 410 tac get tcc taa Tyr Ala Ser aeg gtg ggg ggc get Thr Val Gly 285 Gly Ala aaa gee ttg aag ccg Lys Ala 300 Leu Lys Pro agg ttc ctg tgc cag Arg 315 Phe Leu Cys Gin ttt gac cct gag gcc Phe Asp Pro Glu Ala 335 tac aat gtt tac cag Tyr Asn Val Tyr 350 Gin ggg aac aag tcc cca Gly Asn Lys 365 Ser Pro ttc ctg cca eta cca Phe Leu 380 Pro Leu Pro ate ctg gee ccc cag He 395 Leu Ala Pro Gin atg gtg gac cct tcc Met Val Asp Pro Ser 415 get

Ala gga

Gly egg

Arg 320 tgc

Cys tcc

Ser cac

His ggc

Gly ccc

Pro 400 cag

Gin <210> 73 <211> 424 220

<212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 73

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110 lie Glu Lys Thr He Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp He Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190 221

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val He Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 222

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Asp Pro Ser 405 410 415

Gin

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 74 <211> 1275

<212> DNA <213> Artificial Sequence <220>

<223> FC-L15-G170N <220> <221> CDS , (1275) <222> (1) .. <400> ' 74 atg gac aaa act cac aca tgt cca cct tgt cca get ccg gaa etc 48 Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 1 5 10 15 ggg gga ccg tea gtc ttc etc ttc ccc cca aaa ccc aag gac acc 96 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 20 25 30 atg ate tcc cgt acc cct gag gtc aca tgc gtg gtg gtg gac gtg 144 Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val val Asp Val 35 40 45 cac gaa gac cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg 192 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 50 55 60 gtg cat aat gec aag aca aag ccg cgt gag gag cag tac aac age 240 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser 65 70 75 tac cgt gtg gtc age gtc etc acc gtc ctg cac cag gac tgg ctg 288 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu 85 90 95 ggc aag gag tac aag tgc aag gtc tcc aac aaa gcc etc cca gcc 336 ctg

Leu etc

Leu age

Ser gag

Glu aeg

Thr 80 aat

Asn ccc 223

Gly Lys Glu Tyr 100 Lys Cys Lys Val Ser 105 Asn Lys Ala Leu Pro 110 Ala Pro ate 384 gag aaa acc ate tcc aaa gcc aaa ggg cag ccc ega gaa cca cag I le Glu Lys 115 Thr lie Ser Lys Ala 120 Lys Gly Gin Pro Arg 125 Glu Pro Gin gtg 432 tac acc ctg ccc cca tcc cgt gat gag ctg acc aag aac cag gtc Val Tyr 130 Thr Leu Pro Pro Ser 135 Arg Asp Glu Leu Thr 14 0 Lys Asn Gin Val age 480 ctg acc tgc ctg gtc aaa gge ttc tat ccc age gac ate gcc gtg Ser 145 Leu Thr Cys Leu Val 150 Lys Gly Phe Tyr Pro 155 Ser Asp He Ala Val 160 gag 528 tgg gag age aat ggg cag ccg gag aac aac tac aag acc aeg cct Glu Trp Glu Ser Asn 165 Gly Gin Pro Glu Asn 170 Asn Tyr Lys Thr Thr 175 Pro ccc 576 gtg ctg gac tcc gac ggc tcc ttc ttc etc tac age aag etc acc Pro Val Leu Asp 180 Ser Asp Gly Ser Phe 185 Phe Leu Tyr Ser Lys 190 Leu Thr gtg 624 gac aag age cgt tgg cag cag ggg aac gtc ttc tea tgc tcc gtg Val Asp Lys 195 Ser Arg Trp Gin Gin 200 Gly Asn Val Phe Ser 205 Cys Ser val atg 672 cat gag get ctg cac aac cac tac aeg cag aag age etc tcc ctg Met His 210 Glu Ala Leu His Asn 215 His Tyr Thr Gin Lys 220 Ser Leu Ser Leu tet 720 ccg ggt aaa ggt gga ggt ggt ggt tet ggt ggt ggt age ggt ggt Ser 225 Pro Gly Lys Gly Gly 230 Gly Gly Gly Ser Gly 235 Gly Gly Ser Gly Gly 240 ggt 768 gga tcc cat cca att cca gat tet tet cca tta tta caa ttc ggg Gly Gly Ser His Pro 245 He Pro Asp Ser Ser 250 Pro Leu Leu Gin Phe 255 Gly ggc 816 caa gtc egg cag egg tac etc tac aca gat gat gee cag cag aca Gly Gin Val Arg 260 Gin Arg Tyr Leu Tyr 265 Thr Asp Asp Ala Gin 270 Gin Thr 224 gaa gcc 864 cac ctg gag ate agg gag gat ggg aeg gtg ggg ggc get get Glu Ala His Leu Glu He Arg Glu Asp Giy Thr Val Gly Gly Ala Ala 275 280 285 gac cag 912 age ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att 960 caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag egg Val lie Gin lie Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat 1008 ggg gee ctg tat gga teg etc cac ttt gac cct gag gee tgc Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc 1056 egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc 1104 cac ggc etc ccg ctg cac Ctg cca ggg aac aag tcc cca cac Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac 1152 cct gca ccc cga gga cca get ege ttc ctg cca eta cca ggc Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc 1200 ccc gca ccc ccg gag cca ccc gga ate ctg gcc ccc cag ccc Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 ccc gat 1248 gtg ggc tcc teg gac cct ctg age atg gtg aac cct tcc cag Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Asn Pro Ser Gin 405 410 415 ggc cga 1275 age ccc age tac get tcc taa Gly Arg Ser Pro Ser Tyr Ala Ser 420

<210> 75 <211> 424 <212> PRT 225 <213> Artificial Sequence <220> <223> Synthetic Construct <400> 75 Met Asp Lys Thr His Thr Cy, 1 5

Pro Pro Cys Pro Ala Pro Glu Leu Leu 10 15

Gly Gly Pro Ser Val Phe Leu 20

Phe Pro Pro Lys Pro Lys Asp Thr Leu 25 30

Met lie Ser Arg Thr Pro Glu 35

Val Thr Cys Val Val Val Asp Val Ser 40 45

His Glu Asp Pro Glu Val Lys 50 55

Phe Asn Trp Tyr Val Asp Gly Val Glu 60

Val His Asn Ala Lys Thr Lys 65 70

Pro Arg Glu Glu Gin Tyr Asn Ser Thr 75 80

Tyr Arg Val Val Ser Val Leu 85

Thr Val Leu His Gin Asp Trp Leu Asn 90 95

Gly Lys Glu Tyr Lys Cys Lys 100

Val Ser Asn Lys Ala Leu Pro Ala Pro 105 110

He Glu Lys Thr He Ser Lys 115

Ala Lys Gly Gin Pro Arg Glu Pro Gin 120 125

Val Tyr Thr Leu Pro Pro Ser 130 135

Arg Asp Glu Leu Thr Lys Asn Gin Val 14 0

Ser Leu Thr Cys Leu Val Lys 145 150

Gly Phe Tyr Pro Ser Asp He Ala Val 155 160

Glu Trp Glu Ser Asn Gly Gin 165

Pro Glu Asn Asn Tyr Lys Thr Thr Pro 170 175

Pro Val Leu Asp Ser Asp Gly 180

Ser Phe Phe Leu Tyr Ser Lys Leu Thr 185 190 226

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro lie Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu He Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val He Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Asn Pro Ser Gin 227 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 76 <211> 1275

<212> DNA <213> Artificial Sequence <220>

<223> FC-L15-G170S <220> <221> CDS <222> (1) . · , (12’ <400> 76 atg gac aaa act 48 Met Asp Lys Thr 5) 1 ggg 96 gga ccg tea Gly Gly Pro Ser 20 atg 144 ate tcc cgt Met lie Ser 35 Arg cac 192 gaa gac cct His Glu 50 Asp Pro gtg 240 cat aat gcc Val 65 His Asn Ala tac 288 cgt gtg gtc Tyr Arg Val Val ggc 336 aag gag tac Gly Lys Glu Tyr cac aca tgt cca His 5 Thr Cys Pro gtc ttc etc ttc Val Phe Leu Phe acc cct gag gtc Thr Pro Glu Val 40 gag gtc aag ttc Glu Val Lys 55 Phe aag aca aag ccg Lys Thr 70 Lys Pro age gtc etc acc Ser 85 Val Leu Thr aag tgc aag gtc Lys Cys Lys Val cct tgt cca get Pro Cys 10 Pro Ala ccc cca aaa ccc Pro 25 Pro Lys Pro aca tgc gtg gtg Thr Cys Val Val aac tgg tac gtg Asn Trp Tyr val 60 cgt gag gag cag Arg Glu Glu 75 Gin gtc ctg cac cag Val Leu 90 His Gin tcc aac aaa gcc Ser Asn Lys Ala tac aac age aeg

Tyr Asn Ser Thr ccg gaa etc ctg Pro Glu Leu 15 Leu aag gac acc etc Lys Asp Thr Leu 30 gtg gac gtg age Val 45 Asp Val Ser gac ggc gtg gag Asp Gly Val Glu 80 gac tgg ctg aat Asp Trp Leu 95 Asn etc cca gcc ccc Leu Pro Ala Pro 228 100 105 110 ate gag 384 lie Glu gtg tac 432

Val Tyr 130 age ctg 480

Ser Leu 145 gag tgg 528

Glu Trp ccc gtg 576

Pro Val gtg gac 624

Val Asp atg cat 672

Met His 210 tet ccg 720

Ser Pro 225 ggt gga 768

Gly Gly ggc caa 816

Gly Gin gaa gcc 864 aaa acc

Lys Thr 115 acc ctg

Thr Leu acc tgc

Thr Cys gag age

Glu Ser ctg gac

Leu Asp 180 aag age

Lys Ser 195 gag get

Glu Ala ggt aaa

Gly Lys tcc cat

Ser His gtc egg

Val Arg 260 cac ctg ate tcc

He Ser ccc cca

Pro Pro ctg gtc

Leu Val 150 aat ggg

Asn Gly 165 tcc gac

Ser Asp cgt tgg

Arg Trp ctg cac

Leu His ggt gga

Gly Gly 230 cca att

Pro lie 245 cag egg

Gin Arg gag ate aaa gcc

Lys Ala 120 tcc cgt

Ser Arg 135 aaa ggc

Lys Gly cag ccg

Gin Pro ggc tcc

Gly Ser cag cag

Gin Gin 200 aac cac

Asn His 215 ggt ggt

Gly Gly cca gat

Pro Asp tac etc

Tyr Leu agg gag aaa ggg

Lys Gly gat gag

Asp Glu ttc tat

Phe Tyr gag aac

Glu Asn 170 ttc ttc

Phe Phe 185 ggg aac

Gly Asn tac aeg

Tyr Thr ggt tet

Gly Ser tet tet

Ser Ser 250 tac aca

Tyr Thr 265 gat ggg cag ccc

Gin Pro ctg acc

Leu Thr 14 0 ccc age

Pro Ser 155 aac tac

Asn Tyr etc tac

Leu Tyr gtc ttc

Val Phe cag aag

Gin Lys 220 ggt ggt

Gly Gly 235 cca tta

Pro Leu gat gat

Asp Asp aeg gtg cga gaa

Arg Glu 125 aag aac

Lys Asn gac ate

Asp He aag acc

Lys Thr age aag

Ser Lys 190 tea tgc

Ser Cys 205 age etc

Ser Leu ggt age

Gly Ser tta caa

Leu Gin gcc

Ala ggg ttc

Phe 255 cag cag

Gin Gin 270 ggc get cca cag

Pro Gin cag gtc

Gin Val gee gtg

Ala Val 160 aeg cct

Thr Pro 175 etc acc

Leu Thr tcc gtg

Ser Val tcc ctg

Ser Leu ggt ggt

Gly Gly 240 ggg

Gly aca

Thr get 229

Glu Ala His Leu Glu lie Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285 gac cag 912 age ccc gaa agt etc ctg cag ctg aaa gee ttg aag ccg gga Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300 gtt att 960 caa ate ttg gga gtc aag aca tcc agg ttc ctg tgc cag egg Val lie Gin He Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320 cca gat 1008 ggg gcc ctg tat gga teg etc cac ttt gac cct gag gee tgc Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335 age ttc 1056 egg gag ctg ett ett gag gac gga tac aat gtt tac cag tcc Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350 gaa gcc 1104 cac ggc etc ccg ctg cac ctg cca ggg aac aag tcc cca cac Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365 egg gac 1152 cct gca ccc ega gga cca get ege ttc ctg cca eta cca ggc Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380 ctg ccc 1200 ccc gca ccc ccg gag cca ccc gga ate ctg gee ccc cag ccc Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly He Leu Ala Pro Gin Pro 385 390 395 400 ccc gat 1248 gtg ggc tcc teg gac cct ctg age atg gtg tcc cct tcc cag Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Ser Pro Ser Gin 405 410 415 ggc ega 1275 age ccc age tac get tcc taa Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 77 <211> 424

<212> PRT <213> Artificial Sequence 230 <220> <223> Synthetic Construct <400> 77

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro 15 10

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 20 25

Met lie Ser Arg Thr Pro Glu Val Thr Cys Val Val Val 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr 65 70 75

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp 85 90

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 100 105

He Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 145 150 155

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys 165 170

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 180 185

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser

Glu Leu Leu 15

Asp Thr Leu 30

Asp Val Ser

Gly Val Glu

Asn Ser Thr 80

Trp Leu Asn 95

Pro Ala Pro 110

Glu Pro Gin

Asn Gin Val

He Ala Val 160

Thr Thr Pro 175

Lys Leu Thr 190

Cys Ser Val 231 195 200 205

Met His Glu Ala Leu His Asn His 210 215

Tyr Thr Gin Lys Ser Leu Ser Leu 220

Ser Pro Gly Lys Gly Gly Gly Gly 225 230

Gly Ser Gly Gly Gly Ser Gly Gly 235 240

Gly Gly Ser His Pro lie Pro Asp 245

Ser Ser Pro Leu Leu Gin Phe Gly 250 255

Gly Gin Val Arg Gin Arg Tyr Leu 260

Tyr Thr Asp Asp Ala Gin Gin Thr 265 270

Glu Ala His Leu Glu He Arg Glu 275 280

Asp Gly Thr Val Gly Gly Ala Ala 285

Asp Gin Ser Pro Glu Ser Leu Leu 290 295

Gin Leu Lys Ala Leu Lys Pro Gly 300

Val He Gin He Leu Gly Val Lys 305 310

Thr Ser Arg Phe Leu Cys Gin Arg 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser 325

Leu His Phe Asp Pro Glu Ala Cys 330 335

Ser Phe Arg Glu Leu Leu Leu Glu 340

Asp Gly Tyr Asn Val Tyr Gin Ser 345 350

Glu Ala His Gly Leu Pro Leu His 355 360

Leu Pro Gly Asn Lys Ser Pro His 365

Arg Asp Pro Ala Pro Arg Gly Pro 370 375

Ala Arg Phe Leu Pro Leu Pro Gly 380

Leu Pro Pro Ala Pro Pro Glu Pro 385 390

Pro Gly He Leu Ala Pro Gin Pro 395 400