Fgf21 mutants and uses thereof

(FGF21 mutants and USPs)

Summary

The present invention relates to the provision of nucleic acid molecules encoding FGF21 mutant polypeptides, FGF21 mutant 5 polypeptides, pharmaceutical formulations containing FGF21 mutant peptides, and methods for treating metabolic disorders

Using such nucleic acids, polypeptides, or pharmaceutical formulations.

9Α2Β9 <? 1 6

? 1201 fulla 906818

(FGF21 mutants broaden their use)

Full description

This application calls for the benefit of the precedence of the US patent application No. 60 / 058,861 filed on June 4, 2008, and the US provisional patent application No. 61 / 058,919 filed on June 4,

5 2008, US Provisional Patent Application 61 / 146,364, filed on March 27, 2009,

US Provisional Patent Application No. 61 / 175,736, filed on May 5, 2009, is to be incorporated into this application as a reference.

Technical field:

The invention relates to nucleic acid molecules encoding FGF21 mutant polypeptides, FGF21 mutant polypeptides 10, pharmaceutical formulations containing FGF21 mutant peptides, and methods for treating disorders

Metabolism using such nucleic acids, polypeptides, or pharmaceutical formulations.

Rigging background:

FGF21 is an embedded polypeptide that belongs to a sub-family of Fibroblast Growth Factors (FGFs) which includes FGF21, FGF19, and Itoh et al., 2004, Trend Genet (FGF23).

15th 20: 563-69). FGF21 is an atypical FGF that is heparin dependent

It acts as a hormone in regulating glucose, lipid, and energy metabolism.

FGF21 was isolated from the hepatic CINA library as hepatic insertion factor. It is tightened in the liver and pancreas and it is the only member of the family of FGF to be expressed mainly in the liver. Appear

9Α2Β9 <? 1 6

Hypermogenic mice consider FGF21 metabolic phenotypes with slow growth rate, plasma glucose and low triglyceride levels, absence of age-related type 2 diabetes, insular hyperplasia and obesity. Additive administration of FGF21 from recombinases in rodent and protozoal models leads to normalized plasma glucose and triglyceride levels and

5 Low cholesterol, improved glucose tolerance and insulin sensitivity. In addition, FGF21 reduces body weight and body fat by increasing energy expenditure, physical activity, and metabolism rate. Empirical research provides support for the proximal administration of FGF21 for treating diabetes type 2.

Obesity, hyperplasia, and other metabolic conditions or disorders in humans.

Human FGF21 has a short half-life in live cache. In mice, the half-life of human FGF21 is 1 to 2 hours, and in baboons, the half-life is about

2.5 to 3 hours. In developing FGF21 for use in a therapeutic form in type 2 hemorrhagic treatment, an increase in half-life would be desirable. Will let

FGF21 proteins have an enhanced half-life of administering a lower frequency dose to patients administering the protein. Such proteins are explained in this application.

15th Disclosure of the invention:

The current disclosure provides an isolated polypeptide comprising the amino acid sequence of the sequence ID: 4, and furthermore includes a substitution for any amino acid: the alanine building block at position 45, the Bosn building block at position 86, or the leucine building block at position 98, or the leucine residue at position 111, or the alanine residue at position 111

20 129, or the glycine residue at position 170, or the proline residue at position 170

33142Β1

171 , Or building block we shall see at position 172, and combinations thereof. In one embodiment the isolated polypeptide comprises the substitution for any amino acid R: the residue of leucine at position 98, the proline residue at position 171, or both the leucine residue at position 98, and the proline residue at position 171. In another embodiment it includes Polypeptide

5 The isolate is on substitution for any amino acid for the leucine residue at position 98 and the proline residue at position 171.

The current disclosure provides an isolated polypeptide comprising the amino acid sequence of the sequence ID: 4, having: (a) the substitution of at least one amino acid which is (1) the glutamine, iso-leucine, or leucine building block at position 19; And (2) the histidine building block,

10 Or leucine, or phenylalanine at position 20; And (3) an aero-leucine, phylalanine, tadrosine or valine building block at position 21; And (4) a two-day iso, phenylalanine, or valine building block at position 22; And (5) an alanine or arginine building unit at position 150; Almond) building block alanine or valine at position 151; And (7) the building block histidine, leucine, phenylalanine or valine at position 152; And (8) the building unit of alanine, or asgin, or acid

15th Aspartic, sisben, glutamic acid, proline or serine at position 170; And (9) a building block of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, leucine, synrin, rionine, tryptophan, or tyrosine in situ 171; (10) leucine or rionin building units at position 172; F (AA) an agitin or glutamic acid building unit at position 173; And (b) a substitution

20 At least one amino acid which is (1) an arginine, or acid, building unit

Glutamic, or to assign to position 26; And (2) the building block of arginine, or glutamic acid; or

١٧.)

ΜΑ 33142Β1

Glutamine; Or lysine, or threonine at position 45; And (3) a threonine building block in the 52 nursing woman;

And (iv) the building block of cysteine, glutamic acid, glycine or serine at position 58;

And (5) the building block of alanine, argitin, glutamic acid, or lysmin at position 60;

And (6) the building block of alanine, allergen, cysteine ​​or histidine at position 78; And (7)

5 A cysteine ​​or threonine building block at position 86; (8) a building block of alanine, argitin, glutamic acid, lispin, or anabirin at position 88; (9) an agitin, cysteine, gluñamic acid, glutamine, leucine or threonine building block at position 98; And (10)

An agitin, aspartic acid, cysteine ​​or gluñamic acid building unit at position 99;

(11) a lysine or threonine building block at position 111; And (12) an allergen building unit, or

10 Asparagine, aspartic acid, gluenamic acid, glutamine, histidine, or lysate at position 129; And (13) an agitin, gluñamic acid, histidine, or leucine building block or two metaphors at position 134; And combinations thereof. In one embodiment the building unit at position 98 is an allergy and the building unit at position 171 is proline.

In another embodiment the polypeptide may comprise an amino acid sequence which is identical

15th At least 85% to the amino acid sequence of the sequence ID: 4, but where no

The replacement of at least one amino acid is furthermore modified from (a) (1) - (11) and (b) (a) - (13).

The present disclosure additionally provides a polypeptide comprising the amino acid sequence of the identity sequence

No. 4, by substituting at least one amino acid which is: (a) a building block

20 Glutamine, leucine, or iso-leucine at position 19; And (b) the histidine building unit, or

2 days, or phenylalanine at position 20; And (c) the building block of iso-leucine, or phenylalanine, or

٢١

ΜΑ 33142Β1

Terumine 'or valine at position 21; (D) The iso-leucine, phenylalanine or valine building block at position 22; (E) An alanine or arginine building unit at position 150; (F) a building block ananthet or valine at position 151; (G) the building block of histidine, leucine, or phenylalanine,

Or Valine in position 152; (H) the building block of alanine, or apherine, or aspartic acid, or

5 Cystine, glutamic acid, proline or synrin at position 170; (I) A building block of alanine, arginine, asparagine, aspartic acid, cysteine, or glutamic acid,

Glutamine, glycine, histidine, leucine, serine, threonine, tryptophan, or tyrosine at position 171; (J) a leucine or threonine building block at position 172; OK)

An arginine or glutamic acid building unit at position 173; And combinations thereof. In one of the embodiments

10 The building block at position 171 is proline, and in another embodiment the polypeptide may comprise an amino acid sequence which is at least 85% identical to the amino acid sequence of the sequence ID: 4, but where the substitution is not further modified

At least one amino acid of (A) - (No).

The present disclosure further provides an isolated polypeptide comprising the 15 amino acid sequence of the sequence ID 4, by substituting at least one amino acid which is

For: (a) the building block of arginine, glutamic acid or lysine at position 26; (B) the building block of arginine, glutamic acid, glutamine, lysine or threonine at position 45;

And (c) a threonine building block at position 52; And (d) the building block of cysteine, or glutamic acid,

Or glycine, or serine in position 58; And (e) the building block of allatine, arginine or acid

20 Glonamic, or Lean at position 60; (F) the building block of alanine, arginine, cysteine, or

Histidine at position 78; (G) an alanine building block at position 88; And (h) a building block

9Α2Β9 <? 1 6

Argitin, glutamic acid, leucine or threonine, at position 98; (I) an agitin building block, aspartic acid, cysteine, or glutamic acid at position 99; Wozy)

A lysine or threonine building unit at position 111; (K) an allergen, or asparagine, building block,

Aspartic acid, gluenamic acid, glutamine, histidine, or lymph in the site.

5 129; (L) an agitin building block, gluonic acid, histidine, or leucine, or

Tyrosmen in position 134; And combinations thereof. In one embodiment the building block at position 98 is allergen, and in another embodiment the polypeptide may comprise an amino acid sequence that is at least 85% identical to the amino acid sequence of the sequence ID: 4,

But where furthermore at least one amino acid substitution is not modified from

10 (The).

In various embodiments, the polypeptides disclosed in this application may furthermore include the substitution of at least one amino acid which is: (a) phenylalanine, proline, aniline, synrin, or glycine at position 179; Or (b) glutamic acid, glihin, proline or serine at position 180; Or (c) lisben, or gelatin, or ryotin,

15th Or alanine, leucine, or proline at position 181 and may furthermore comprise 1 to 10 amino building blocks incorporated into the C-terminal of the polypeptide, and any amino acid can be, for example, one or more residues selected from Group consisting of glycine and proline and combinations thereof.

In various embodiments, the polypeptides disclosed in this application may include (a) segments

20 The amino terminal of no more than 8 amino acid building units, in which the polypeptide is capable

On lowering blood glucose in breast cache; Or (b) a cut of the cr-box ends of not more than

٥١

ΜΑ 33142Β1

12 An amino acid building unit, in which the polypeptide is able to lower blood glucose in a mammary cache; Or (c) amino terminals of more than 8 amino acid residues and carboxyl terminal segments of no more than 12 amino acid residues, wherein the polypeptide is able to lower blood glucose in a mammalian cache.

5 In some embodiments, the polypeptides disclosed in this application may be covalently delivered to one or more polymers, such as PEG. In another embodiment, the polypeptides of the present invention may be combined into a homogeneous scattered amino acid sequence, and optionally via a conductor,

Same as GGGGGSGGGSGGGGS (Series ID: 23). The heterocyclic amino acid sequence can be a stable IgG domain or a slice thereof, such as the amino acid sequence

10 For sequence ID number: 13. Such polypeptides disclosed in this application may also form multiple units.

The present disclosure also provides for pharmaceutical formulations excised on the polypeptides disclosed in this application and a pharmaceutically acceptable formulation agent. Such pharmaceutical formulations may be used in a manner to treat a metabolic disorder, and the method includes administration to a human patient

15th It is needed as a pharmaceutical formulation of the present invention. Metabolic disorders that may be treated include diabetes and obesity.

The provider is also isolated nucleic acid molecules encoding the polypeptides disclosed in this application, and also vectors comprising such nucleic acid molecules and host cells containing such nucleic acid molecules.

20 Images cut out of the sequence ID number: 4 polypeptides are also condensed in embodiments

<img file="MA33142B1_D0001.tif" />

ΜΑ 33142Β1

Different polypeptides can comprise: (a) amino terminal segments of no more than 8 amino acid building units, in which the polypeptide is able to lower blood glucose in a mammalian organism;

Or (b) a carboxylate terminal cut of no more than 12 amino acid building units, wherein the polypeptide is able to lower blood glucose in the breast cache; Or (c) cut off an amino terminal over

5 When the carboxyl terminal is less than 8 amino acid building units, the polypeptide is able to lower blood glucose in a mammary organism.

The current detection furthermore provides additional isolate fusion protein which may comprise: (a) a stable IgG domain; (B) an embedded conductor sequence to the IgG constant assignment; And (c)

Mutant FGF21 incorporated into the conductor sequence and includes the amino acid sequence of the same

10 ID number 4: where the glycine building block of the Leucen building unit has been replaced at position 98 and the glycine building block of the Proline residue has been replaced at position 171. In one embodiment, the conductor sequence may include GGGGGSGGGSGGGGS (sequence with ID: 23) In the stems of the IgG constant, it may include the sequence with ID number:

13. In another embodiment, the conductor sequence may include GGGGGSGGGSGGGGS

15th (Series ID number: 23) The constant assignor of IgG includes the amino acid sequence of the sequence with ID number: 13. In another embodiment also the N terminal of the conductor is combined to the C terminal of the constant field and IgG and the N terminal of the recoil FGGF21 is combined to the C terminal For the conductor.

The disclosed fusion proteins can form multiple units.

In various embodiments of the fusion protein, the FGF21 cache component can include acid replacement

20 At least one amino, which is: (a) phenylalanine, proline, aniline, or serine

Or glycine at position 179; Or (b) glutamic acid, glycine, proline or serine

ΜΑ 33142Β1

At position 180; Or (c) lignin, gliene, threonine, alanine, lermine, or proline at position 181 and may furthermore comprise 1 to 10 amino acid residues fused to the C terminal of the FGF21 plane, which can be the 1 to A 10 building unit is any amino acid, for example, one or more building blocks selected from a group

5 Composed of glycine and proline and combinations thereof.

In other embodiments of a fusion protein, the FGF21 precursor component may include: (a) an amino terminal segment of no more than 8 amino acid residues, in which the polypeptide is capable of lowering blood glucose in a mammalian organism; Or (b) a lotion of the carboxylate terminal of no more than 12 building blocks of an amino acid, wherein the polypeptide is able to lower the blood glucose in an organism

10 breast; Or (c) amino terminals of more than 8 amino acid residues and carboxyl terminal segments of no more than 12 amino acid residues, wherein the polypeptide is able to lower blood glucose in a mammalian organism. In another embodiment, the FGF21 precursor component of a fusion protein may include an amino acid sequence that is at least 85% identical to the amino acid sequence of the sequence ID: 4, but where it is not further modified.

15th The building units are two pockets and two bells 0

The present disclosure also provides pharmaceutical formulations comprising the incorporation protein disclosed in this application and a pharmaceutically acceptable formulation agent. Such pharmaceutical compositions may be used in a method for treating a metabolic disorder, and the method includes administration to a human patient in need of pharmaceutical compositions of the present invention. These include metabolic disorders, which can be:

20 It is treated for diabetes and obesity.

L

ΜΑ 33142Β1

The provider is also isolated nucleic acid molecules encoding the polypeptides disclosed in this application, as well as vectors comprising such nucleic acid molecules and host cells comprising such nucleic acid molecules.

Specific embodiments of the present invention will become apparent from the following very detailed description of the 5 specific embodiments and claims.

Description of shapes and drawings

Figures 1A-AP: Results of an ELK-leuciferase activity experiment were performed on mutations 7-181, FGF21, and 181-8 (Fig. 1A) and cutoff mutations 1-172, FGF21, 171 -1, -1169 and 164 -1 (Fig.); Each panel shows the score obtained to compare a human FGF21.

10 Figure 2: Shows the results of an ELK-leuciegerase activity experiment performed on a comparison of human FGF21 and cut-off gaps 3 - 181, FGF21, 181-4, 181-5, 181-7, 181-8, and 180-1.

178-1, 177-1, 176-1, 175-1, 174-1, 173-1, 172-1, 181-9, and 149-1.

Figure F: shows blood glucose levels measured in mice injected with PBS (solid column), human FGF21 comparison, (open column), or FGF21 cut-off mutations 8-181

15th (Gray column) and 181-9 (striped column).

Figure 4: shows the percentage of coalescence levels in blood glucose measured in mice injected with PBS (solid circuits), or WT comparison (FC-FGF21) (open circuits), or segmental Fc-FGF21 fusion proteins comprising the amino acid-181 building blocks. 5 (solid triangles) or 181-7 (open triangles).

No;

33142Β1

Figure 5: shows the percentage of fractionation of levels in blood glucose measured in mice injected with PBS (solid circuits), or comparison (WT) FC-FGF21 (open circuits), or fusion protein Fc-FGF21 segmented on -175 amino acid metabolites. 1 (solid triangles), or segmented FC-FGF21 fusion protein crossed over the 171-1 amino acid building blocks (triangles

5 Open).

Figures 6a - 6d: show the results of the liquid chromatography-mass spectrum (LC-MS) analysis.

For a human Fc (5) FGF21 comparison sample (Fig. 6a) and Fc (5) FGF21 samples drawn from mice with hours (sample D6; Fig. 6B), 24 hours (sample D24; Fig. 6c), and 48 hours (sample D48; Fig. 6D) After the injection.

10 Figures 7a - 7d: shows the results of the LC-MS analysis of a human FGF21 (3) Fc comparison sample derived from cache of breast! J (Fig. 7a) and FGF21 (3) Fc samples drawn from mice at 6 hours (sample D6; Fig. 7b), 24 Advance (sample D24; Figure 7c), and 48h (sample D48; Figure 7D) after injection.

Figures 8a - 8d: shows the results of LC-MS analysis of a human Fc (15) FGF21 comparison sample (Fig. 15 8a) and Fc (15) FGF21 samples drawn from mice at 6 hours (Fig. 8b) and 24 hours.

(Figure 8C), and 48 stethoscopes (Figure 8D) after injection.

Figures 9a - and d: show the results of LC-MS analysis of a human FGF21 (15) Fc comparison sample (Fig.9a) and FGF21 (15) Fc samples drawn from mice at 6 hours (Fig.9b), 24 stethoscopes (Fig.9c), and 48 stethoscopes ( Figure 9D) after injection.

20 Figures 10A-0Ab: show the cleavage sites mapped by LC-MS analysis of fusion proteins

<img file="MA33142B1_D0002.tif" />

ΜΑ 33142Β1

Fc (15) FGF21) Figure 0A, the sequence with ID number: 24 (FGF21) 15 (Fj) Fig. 10B,

Series ID: 25) injected into mice.

Figure 11: shows blood glucose levels measured in mice injected with PBS (solid column), or Fc (15) FGF21 G170E mutants for Fc (15) FGF21 (open column) or

5 Fc (15) FGF21 (gray column), Fc (15) FGF21 171Α (dotted column), or Fc (15) FGF21

S172L (transverse shaded black with open diagonal), or Fc (15) FGF21 G170E / P171A / S172L (solid horizontal tinted pole), or Fc (15) FGF21 G151A (transverse shaded pole at bottom

Open).

Figure 12: shows the percentage of fractionation levels in blood glucose measured in mice 10 injected with PBS (solid rotor), or Fc (15) FGF21 G170E for Fc (15) FGF21 (rotor)

Open), Fc (15) FGF21 (solid triangles), or Fc (15) FGF21 Ρ171Α (open triangles),

Or Fc (15) FGF21 S172L (solid lozenges), Fc (15) FGF21 G170E / P171A / S172L (open lozenges), or Fc (15) FGF21 G151A (solid boxes).

Figure W: shows blood glucose levels measured in mice injected with PBS (solid 15 column), Fc (15) FGF21 (open column), or Fc (15) FGF21 Fc (15) FGF21 P15OA / G151A / I1527 (gray column) mutations ), Or Fc (15) FGF21 G170E (open shaded black

Diagonally), or Fc (15) FGF21 G170E / P171A (gray column shaded diagonally); Or Fc (15) FGF21 G170E / S172L (diagonally shaded open shaft).

Figure 14: shows the percentage of fractionation of levels in blood glucose measured in mice injected with PBS (solid boxes), Fc (15) mutations, FGF21 (open boxes), or

<img file="MA33142B1_D0003.tif" />

ΜΑ 33142Β1

Fc (15) FGF21 Fc (15) FGF21 P15OA / G151A / I1527 (solid inverted triangles), or

Fc (15) FGF21 G170E (open inverted triangles), Fc (15) FGF21 G170E / P171A (solid circuits), or Fc (15) FGF21 G170E / S172L (open circuits).

Figure 15: shows blood glucose levels measured in mice injected with PBS (solid column 5), or Fc (15) FGF21 G170E mutants for Fc (15) FGF21 (open column) or

Fc (15) FGF21 (gray column), 01708 Fc (15) FGF21 (open shaded post), or Fc (15) FGF21 G170C (gray and white transverse canopy), or Fc (15) FGF21 G170N (solid shaded post), Or Fc (15) FGF21 G170S (open shaded pole).

Figure 16: Shows the percentage of fractionation levels in blood glucose measured in injected mice

10 By PBS (solid circles), or mutations Fc (15) FGF21 G170E, Fc (15) FGF21 (open circuits), Fc (15) FGF21 G170A (solid triangles), or Fc (15) FGF21 G170C (open triangles), Fc (15) FGF21 G170D (solid triangles), Fc (15) FGF2121171Ν (open lozenges), or Fc (15) FGF21 G170S (solid inverted triangles).

Figure 17: shows blood glucose levels measured in mice injected with PBS (solid column 15), or mutations Fc (15) FGF21 G170E, Fc (15) FGF21 (open column), or

Fc (15) FGF21 171Ε (gray column), or Fc (15) FGF21 171Η (solid shaded column),

Or Fc (15) FGF21 P171Q (sunken shaded pole), or Fc (15) FGF21 171Τ (lapped pole); Or Fc (15) FGF21Ρ171Υ (gray shaded column).

Figure 18: shows the percentage of delay in blood glucose levels measured in injected mice

20 By PBS (solid circuits), or mutations Fc (15) FGF21 G170E, Fc (15) FGF21 (circuits

٩

ΜΑ 33142Β1

Open); Or Fc (15) FGF21 171Η (solid triangles), or Fc (15) FGF21 171Η (open triangles); Fc (15) FGF21 P171Q (solid lozenges), Fc (15) FGF21 Ρ171Τ (open lozenges), or Fc (15) FGF21 171Υ (solid boxes).

Figures 19a - WAD: show the results of the LC-MS analysis to compare Fc (15) to FGF21 (Fig.19a).

5 Samples drawn from mice at a time of 6 hours (Fig. 19b) and 24 hours (Fig. 19c),

And 48 hours (Figure 19D) after injection.

Figures 20a - 20d: show the results of the LC-MS analysis of Fc (15) FGF21 G170E (Fig. 20a) and Fc (15) FGF21 G170E samples drawn from mice at a time of 6 hours (Fig. 20b), 24 hours (Fig. 20c), and 48 1 hour (fig. 20 d) after injection.

10 Figures 21a-21d: show the results of LC-MS analysis of Fc (15) FGF21Ρ171Α (Fig. 21a) and Fc (15) FGF21Ρ171ينات samples drawn from mice at 6 hours (Fig. 21b), 24 hours (Fig. 21c), and 48 1 hour (fig. 21 d) after injection.

Figures 22A - 22D: show the results of the LC-MS analysis of Fc (15) FGF21 S172L (Fig. 22a) and Fc (15) FGF21 S172L tested samples from mice at a time of 6 hours (Fig.

15th 22b), 24 hours (Fig. 22c), and 48 hours (Fig. 22d) after injection.

Figures 23a-23d: show the cleavage sites mapped by LC-MS analysis for Fc (15) fusion proteins FGF21 (Fig. 23a, sequence ID: 24) and £ 0170 Fc (15) FGF21 (Fig. 23b, sequence with ID number: 26) and 1718? Fc (15) FGF21 (Fig. 23c, the sequence with ID No. 27) Fc (15) FGF21 S172L (Fig. 23b, the sequence with ID No.:

20 28) Integration proteins injected into mice.

ΜΑ 33142Β1

Figures 24a-24c: show the results of a test of ELK-leucegerase activity performed on mutants FGF21 L99R, FGF21, H99VFGF21, A8111FGF21 (Fig. 24a); And FGF21 A129D, FGF21, and FGF21 8129 A134KJ, FGF21 (Fig.24b); Mutants FGF2121134, FGF21, and FGF21 A134E, and 8129FGF21 (Fig.24c);

5 Each panel shows the score obtained to compare a human FGF21.

Figures 25a - 25d: results are shown for an ELK-leucegerase activity test performed on FC-FGF21 P171TJ, FC-FGF21 P17S, FC-FGF21 P171G, FC-FGF21 (Fig. 25a); Mutants FC-FGF21Ρ171Υ, FC-FGF21, FC-FGF21 P171W, and FC-FGF21 P171C (Fig. 25b); And Fc (15) FGF21 A45K / G170E, Fc (15) FGF21,

10 FGF21 A45Kj (fig. 25c); Fc (15) FGF21 171Ε, Fc (15) FGF21j, and Fc (15) FGF21 A45K / G170E (fig. 25d); Each panel shows the score obtained to compare a human FGF21. Figures 26a - 26b: show agglomeration as a function of time for FGF21 exudative wild type and different FGF21 planes; Figure 26a shows the percent change in agglomeration for comparison of WT (FGF21, solid lozenges) FGF21 45Κ (solid rotor) after incubation of 65 mg ml protein at 4 ° C for a period of time.

15th 1, 2, and 4 days, while Fig. 26b shows the percent change in agglomeration for a comparison of WT (FGF21).

Α11Τ, L98R, L98C, L86R, L86T, P78R, FGF21 P78C, and A129D,

134Κ, A129Kj, A129Qj, and A134EJ, A134Y (all labels z curve) after incubation of 65 mg amal protein at 4 C for 1, 6, and 0 days.

Figure 27: Results are shown for an ELK-leucigerase activity test performed on the FGF21 comparison

20 Human and mutations FGF21 L52T, FGF21Α45Κ, FGF21, S 581p and FGF21.

ΜΑ 33142Β1

Figure 28: The yin curve of the change in clumping levels of mutations Fc (15) FGF21, Fc (15) FGF21 6-181 / G170E (solid repeaters), Fc (15) FGF21 A45K / G17OE0J (open boxes), and ۶1718 Fc (15). FGF21 (crosses), Fc (15) FGF21 G170Ej (open triangles), and FGF21 (solid circles) after incubation at 4 ° C for 1, 4, and 8 days.

28 Restored graphical columns also showing Altta '

Figure 29: A curve showing blood glucose levels measured in mice injected with PBS (vector) (solid circles) or mutations Fc (15) FGF21 A45K / G170E (open circles), Fc (15) FGF21 A45K / P171G (solid triangles) , Or Fc (15) FGF21 L98R / P171G (Triangles

Open).

10 Figure 30: Results of an ELK-Leucigurase activity test performed on human FGF21 (solid circles, solid line) ^ Fc-FGF2 (open circles, solid line) and FC-FGF21 L98R / P171G (solid triangles, dotted line).

Figure 31: A curve showing the high molecular weight in percent clusters observed after nine days at room temperature (Fig. 31a) and at 4m (Fig. 31b) for FGF21 (circles

15th Solid, solid line) ^ Fc- FGF2 (open circles, solid line) and FC-FGF21 L98R / P171G (solid triangles, dotted line).

Fig. 32: A series of MALDI block spectrum traces showing the observed changes in FC-FGF21 L98R / P171G at various points over a tolerant 168 time period.

Figure 33: A curve showing the percent change in blood glucose levels in ob / ob mice

20 For both the PBS vector comparison (open circuits), and the FGF21 wild type mutants (boxes

<img file="MA33142B1_D0004.tif" />

ΜΑ 33142Β1

Solid); Mutants P171G, L98R, FGF21 (solid inverted triangles); P171G, L98R,

182Ρ (open lozenges), 182G, P171G, L98RJ (solid circuits).

Figure 34: A curve showing the percent change in blood glucose levels in ob / ob mice for both the PBS vector comparison (open circuits) and the P171G mutants L98R and FGF21 (squares

5 Solid); WSA, 183G, 182G, P171G (Open Triangles), SL, 182G, P171G

(Solid lozenges).

Figure 35: A curve showing the percent change in blood glucose levels in ob / ob mice for both the PBS vector comparison (open circuits) and the P171G mutants L98R and FGF21 (solid boxes). Y179S, P171G, L98Rj (Open Triangles), A180G, P171G, L98Rj (Circles

10 Solid).

Figure 36: A curve showing the percent change in blood glucose levels in ob / ob mice for both PBS vector comparison (solid circuits) and mutants P171G, L98R, FGF21 (open boxes). Y179F, P171G, L98Rj (solid triangles), Α180Ε, P171G, L98Rj (lozenges

15th Open).

Figure 37: This is a graphical restoration that schematically illustrates the study designed to study the escalation of the dose of six effluents carried out in Rabah monkeys. In the figure, the shaded symbols show cases of blood drawing in the fasting state, and the icons on the spotted show cases of blood drawing in the feeding state.

Figures 38a - d: They are a series of curves that show how the monkeys were random

ΜΑ 33142Β1

-18-

OGTT forms, and OGGT AUCs rosin the body; Figure 38a shows baseline glucose levels in 0GTT1, solid square corresponds to group A, solid circuit and solid line to group B and open circuit symmetry and dashed line to group C before compounds or transport are assigned to each group; Figure 38B shows baseline glucose levels for 0GTT2.

5 Solid radio symmetry to group A, solid circle and solid c to group B and open circuit symmetry and dashed line to group C before vehicles or vector are assigned to each group;

Figure 38c shows baseline glucose levels for -1, ootTs and 2 denoted by AUC.

The speckled column corresponds to group A, the shaded column corresponds to group B, and the shaded column corresponds to group C; Figure 38d shows a baseline weight g, corresponding to the dotted column

10 Noise A, the shaded column flies into group B and the feeding column corresponds to group C. Figure 39: A curve showing the effects of the vector, Fc-FGF! (RG) j FGF21, on the weight of 0 bridles in monkeys. Mirroring columns 1 and 2 correspond to weeks of L and 2 at low dose, and open columns 3 and 4 correspond to weeks 3 and 4 corresponding to weeks 3 and 4 hind ale for medium; Solid bars 5 and 6 correspond to weeks 5 and 6 at the next dose, and the 'spotted columns 7 and 8' correspond to

15th And 9 to 7, 8 and 9 weeks during the scavenging period,

Figure 40: It is a curve that shows the percent change in the first two rats, to the S-line of a vector, FGF21 6, on fasting insulin levels in the monkey Rabah.

Q | Show columns 0 canopy 1 and 2 to weeks 1 and return at low dose, and open symmetry 3 and 4 to weeks 3 and 4 at medium dose, and solid columns 5 and 6 correspond to Ra

20 5 and 6 at high dose, corresponding to bars 7 and 8 to flanks 7 and 8 during a period

Scavenging.

No'

942Β9 &lt;? 1 6

-19-

Figure 41: Passers-by Z curve Sen. Effects of the carrier, FGF21 and ^ Fc-FGF21 ^ RG, given at high dose, on insulin levels of monkeypans acquired during the 5-week study ;; Solid bars correspond to week 5 and shaded bars correspond to week.

Figure 42: It is a curve that shows the forms of glucose D0GTT5 implemented in the two-week warmth

5 For high-dose treatment by Fc-FGF21 (RG); solid circuit symmetry, solid line to conveyor,

Open fun, dotted line corresponds to FGF21 and solid triangle corresponds to solid triangle, solid line to -FC (0FGF21 (RG))

Fig. 43: is a curve showing the first two forms of N0GTT5 implemented in the two-week runtime for high-dose treatment by (Fc-FGF21 (RG); solid circuit symmetry, solid line to vector,

10 An open, dotted line corresponds to FGF21 and a solid triangle, solid line to -Fc (FGF21 (RG.

Figure 44: is a curve showing glucose 3-OGTT AUCI determined at the end of each dose period (low, medium and high dose) for monkeys rabbits. The symmetry of the open columns to AUC3 calculated from the glucose measurements during 0GTT3, and the symmetry of the solid columns to AUC4 calculated from the measurements.

15th Glucose during OGT, and the shaded columns correspond to AUC5 as calculated from glucose measurements during

0GTT5.

Figure 45: A curve showing the effects of the vector, Fc-FGF21 (RG) j FGF21, on the percentage change from baseline of fasted plasma triglyceride levels from each group of monkeys. Corresponding columns 1 and 2 correspond to weeks 1 and 2 at the low dose, and correspond to columns

20 Open 3 and 4 to bars 3 and 4 at medium dose, and solid bars 5 and 6 correspond to

N

9Α2Β9 &lt;? 1 6

The 5 and 6 weeks at the high dose, and spotted bars 7, 8, and 9 correspond to weeks 7, 8 and 9 during the scavenging period.

Figure 46: This is a curve showing the plasma triglyceride levels from each group of monkeys. As measured during the fifth and sixth weeks of treatment with a vector, FGF21 or

5 (Fc-FGF21 (RG) in high dose; shaded columns correspond to Week 5 and solid columns correspond to Week 6.

Fig. 47: A curve showing Fc-FGF21 (monkey RG) levels separately measured at an initial dose, and 5, 12, 19, and 26 days, with samples acquired approximately 21 days after injection.

Figure 48: A curve showing the levels of Fc-FGF21 (monkey RG), each measured separately at

10 An initial dose, 5, 12, 19 and 26 days, with library samples approximately 5 days after injection.

Figure 49: A curve showing average FGF21 concentrations and Fc-FGF21 (RG) levels measured from three OGTTs performed after low, medium and high revision, shaded columns correspond to 0GTT3 at reduced dose, solid bars correspond to OGT at medium dose and open columns correspond to OGT 0GTT5 at high dose.

15th A detailed description of the invention

Transformation of FGF21 protein that enriches with enhanced properties such as increased half-life and / or reduced agglomeration can be accomplished using the methods disclosed in this application and standard biomolecular methods. Optionally, the half-life can be further extended by incorporating an antigens, or part thereof, into either the N-terminus or the C-terminus of the wild-type FGF21 sequence. It is also possible to extend

-21ΜΑ 33142Β1

Additional half-life or reduced clumping of the wild-type FGF21 protein by introducing amino acid substitutions into the protein. Such modified proteins are referred to herein as mutants, or FGF21 mutants, and constitute embodiments of the present invention.

The recombinant nucleic acid methods used herein are included in 5 examples; Cloudy sputum as shown in Sambrook et al ,, Molecular Cloning: A Laboratory

(1989, Manual (Cold Spring Harbor Laboratory Press) or Current Protocols in Molecular (1994 Biology (Ausubel et al., Eds., Green Publishers Inc. and Wiley and Sons) are both incorporated in this application as a reference for any purpose.

1- General definitions

10 The expression expresses a nucleic acid molecule isolated to a nucleic acid molecule of the invention that (1) it has been isolated from at least about 50 percent of protein, fat, carbohydrate, or other substances naturally present with it when total DNA is isolated from Source cells, or (2) it is not attached to all or part of the polynucleotide to which it is connected to the 'isolated DNA molecule' in nature, or (3) it is effectively delivered to the poly

15th A nuclertide that is not attached to it in nature, or (4) does not occur in nature as part of a larger nucleotide sequence. Preferably, the isolated DNA molecule of the present invention is to a large extent devoid of any other contaminating DNA molecules or other contaminating materials which are present in their natural environment that would interfere with its use in polypeptide production or its therapeutic, diagnostic, preventive or research use.

20 The expression vector is used to denote any molecule (for example, nucleic acid, or

٩

9Α2Β9 &lt;? 1 6

A plasmid, or virus) used to transmit encoding information to a host cell.

An expression vector denotes a vector that is suitable for host cell transformation and contains nucleic acid sequences that direct and / or control the expression of the introduced heterozygous DNA sequences. The expression includes, but is not limited to, operations such as,

5 Transfer, and connect DNA to the argument, if introns are present.

The term conductive is used effectively in this order to buy into an arrangement of side sequences in which they are either formatted as the primary sequences thus annotated or combined to perform their usual function. So,

A side-by-side may be actively conducting a coding sequence capable of inducing duplication, transcription and / or transfer of the coding sequence. For example, a sequence is effectively connected

10 Encode to booster when the booster is able to direct the transcription of this encoding sequence. The avoiding sequence does not need to be in contact with the coding sequence, as long as it works correctly. So,

For example, transcriptional transcriptional sequences after transcription can exist between the reinforcer sequence and the coding sequence, and the reinforcer sequence may also be considered to be effectively connected to the coding sequence.

15th The expression uses a host cell to select into a cell that has been transformed, or is able to accommodate the transformation with a nucleic acid sequence and then to express a selected gene of interest. The expression includes the progeny of the parent cell, whether the offspring is identical in appearance or not or in the genetic make-up of the parent cell, as long as the chosen gene is present.

The expression of an isolated polynucleotide refers to a polynucleotide of the present invention which (E) has been made

20 Isolate at least 50 percent of protein, fats, carbohydrates, or carbohydrates

'٩

9Α2Β9 &lt;? 1 6

Other substances that are naturally present with it when total DNA is isolated from source cells, or (2) it is not linked (by a thalamic or non-thalamic reaction) to all or the portion of a polynucleotide that the isolated polypeptide has connected to in nature, or (3) ) Is effectively connected (by a covalent or non-covalent reaction) to a polynucleotide which is not connected

5 Mechanism in nature, or (4) does not occur in nature. Preferably, the isolated polypeptide of the present invention is to a large extent devoid of any other contaminating DNA particles or other contaminating materials which are present in their natural environment that would interfere with its use in polypeptide production or its therapeutic, diagnostic, preventive or research use.

The term refers to a naturally occurring occurrence when used in relation to biological substances such as acid molecules

10 Nuclear, polypeptides, host cells, and the like, into substances that are found in nature and not processed by a human being. Likewise, the term non-naturally occurring as used in this application interrelates to a substance that does not exist in nature or that has been modified or constructively created by a human being. When used in relation to nucleotides, the expression is felt naturally occurring to the bases adenine (Α), metumine (C), guanine (G), thymine (), and uracil.

15th (7) 0 When used in relation to amino acids, the term naturally occurring occurrence refers to the twenty

Aminoalanine (), cysteine ​​(C), aspartic acid (D), glutampic acid (),

Vitilalatin (F), glycine (G), histidine (), iso-leucine (I), and lysine (),

Leucine (L), methionine (), asparagine (), glutamine (Q), arginine (R), and serine (S),

Threonine (), valine (V), tryptophan (W), and tyrosine ().

20 The expression excites FGF21 polypeptide to naturally occurring wild type polypeptide in humans. Purposes

For this disclosure, the expression FGF21 polypeptide can be used interchangeably to indicate

No

ΜΑ 33142Β1

The full-length polypeptide FGF21, for example, the sequence ID: 2, which consists of 209 amino acid building units that are coded by the nucleotide sequence of the sequence ID: 1; The clear polypeptide profile is, for example, the sequence ID: 4, consisting of 181 amino acid building units that are coded by

5 The nucleotide sequence of the sequence ID: 3, in which 28 amino residues have been removed in the amino terminal pacifier of the full-length polypeptide FGF21 (that is, which forms the signaling peptide).

The expression FGF21 polypeptide mutant and FGF21 mutant refer to a variant of the FGF21 polypeptide in which the FGF21 amino acid sequence has been modified wild type. Such modifications include,

10 For example, not to panic, on substitutions of one or more amino acids, including substitutions with non-naturally occurring amino acid isotopes, and segments. Thus, FGF21 polypeptide mutants include, but are not limited to, FGF21 site-directed mutants, segmented FGF21 polypeptides, FGF21 protein degradation mutants, FGF21 caking-reducing mutants, FGF21 synthesis drivers, and FGF21 fusion proteins, as described in

15th this request. To enforce the specification of segmentation specification and amino acid substitutions of FGF21 mutants of the present invention, the numbering of the segmented or mutagen amino acid residues corresponds to that of the FGF21 polypeptide of the mature PM 181.

In other embodiments of the present invention, the FGF21 polypeptide phase comprises an amino acid sequence which is approximately 85% identical to the amino acid sequence of the sequence of identity

20 No.4, but where specific building blocks possess a desirable property to FGF21 polypeptide flap,

For example, anti-proteolytic properties, increase half-life or reduce caking

ΜΑ 33142Β1

And combinations thereof, have not been further modified. In other words, with the exception of the building blocks of the FGF21 mutant sequence that have been modified in order to confer anti-proteolytic properties, reduce agglomeration, or other properties, about 5% of all B units of the other amino acid in the FGF21 mutant sequence can be modified. For example, in mutant FGF21,

5 Q173E, up to 15% of all non-amino acid building blocks can be modified

The glutamic acid building block, which has been substituted for glutamine at position 173. In other embodiments as well, the FGF21 mutant comprises an amino acid sequence which is at least about 90%, or about 96, 96, 97, 98, or 99% match. The 1-amino acid sequence of the sequence ID number: 4, but where specific building blocks are not further modified.

10 A donor of a desired property to the FGF21 polypeptide mutant, for example, antiprolysis resistance, increased half-life or reduced agglomeration and combinations thereof, have not been further modified. Such mutants possess at least one activity of the wild-type FGF21 polypeptide.

The present invention includes a nucleic acid molecule encoding a polypeptide mutant FGF21 comprising an amino acid sequence that is at least approximately 85% identical to the amino acid sequence.

15th Sequence ID: 4, but where specific building blocks confer a desirable property to the FGF21 polypeptide flare, for example, anti-proteolytic properties, increased half-life or reduced agglomeration and combinations thereof, have not been further modified. In other words, with the exception of the building blocks in the FGF21 pilot sequence that have been modified in order to confer anti-proteolytic properties, reduce caking, or other properties, about 15% of the modules can be modified

20 All other amino acid building blocks of the FGF21 mutant sequence. For example, in

Frame Q173E, FGF21, up to 5% of all building blocks of acid can be modified.

٩

ΜΑ 33142Β1

The amigo is the building block of glutamic acid, which has been substituted for glutamine at position 173.

The present invention further includes a nucleic acid molecule encoding a polypeptide mutant FGF21 comprising an amino acid sequence which is at least about 90%, or about 96, 96, 97, 98, or 99% matching to the 1 metric acid 1 amino acid. Mutual 1 D1 T

5 ID # 4, but where specific building blocks possess a desirable property to the FGF21 polypeptide mutant, for example, proteolytic properties, increased half-life or reduced clumping and combinations thereof, were not further modified. Such tripods possess at least one activity of the wild-type FGF21 polypeptide.

The present invention includes a nucleic acid molecule comprising the nucleotide sequence 10 which is approximately 85% matched at least to the nucleotide sequence of the sequence ID number: 4, but

Whereas, the nucleotides coding for the donor amino acid building blocks may not have additional proteolytic properties, increase half-life or reduce clumping and combinations thereof into the FGF21 polypeptide codon. In other words, except for the building blocks in the FGF21 pilot sequence that have been modified to confer antiprolytic properties or reduce agglomeration.

15th Or other properties, about 15% of all other amino acid building blocks can be modified in the FGF21 mutant sequence. For example, in mutant Q173E, FGF21,

Up to 5% of all the amino acid building units other than the glutamic acid building block, which have been substituted for glutamine at position 173. The present invention further includes a nucleic acid molecule comprising the nucleotide sequence which is

20 Matches about 1 to 90% fold 1 to less, or about 1 to 96, 96, 97, 98, or 99% to the amino acid sequence of the sequence ID: 3, but where it may not be further modified

ΜΑ 33142Β1

The nucleotides encoding the donor amino acid building blocks have properties that resist proteolysis, increase half-life or reduce clumping and combinations thereof into mutant polypeptide FGF21 disease. Such mutants possess at least one activator of the wild-type FGF21 polypeptide.

The expression bioactive FGF21 polypeptide mutant indicates which FGF21 polypeptide mutant is annotated.

5 In this application, which possesses wild type FGF21 polypeptide activity, such as the ability to lower glucose, insulin, triglyceride or blood cholesterol; Reduce body weight; It improved glucose tolerance, energy consumption, or insulin sensitivity, regardless of the type or number of modifications that were introduced to the FGF21 polypeptide mutant. However, it can be considered that FGF21 polypeptide flares possessing a slightly reduced level of activity

10 FGF21 is for the FGF21 polypeptide wild type 1 T polypeptide FGF21 is bioactive.

Both the expressions 'effective quantity' and 'therapeutically effective quantity' refer to the amount of FGF21 polypeptide flare used to support an enhanced level of one or more biological activity of wild-type FGF21 polypeptide, such as the ability to lower glucose, insulin, triglycerides, or cholesterol. the blood; Reducing the bridle weight; Improve glucose tolerance, or energy intake, or

15th Insulin sensitivity 0

The term pharmaceutically acceptable carrier or physiologically acceptable carrier as used herein refers to one or more formulation materials suitable for denaturing or enhancing the delivery of the FGF21 polypeptide mutant.

The expression antigen refers to a molecule or part of a molecule that is able to be made

20 Bind to it with an antibody, which additional form may be used in

ΜΑ 33142Β1

Animal to produce antibodies that are able to bind to the adhesive tip of this antigen.

The against generator may have one or more adhesive crests.

A normal Fc expression refers to a molecule or sequence comprising a non-binding fold sequence of an antigen resulting from fully digesting the antibody or produced by another medium. Be a bumper

5 The original immunoglobulin is preferably of human origin and can be any immunoglobulins, although IgG2j IgGl is preferred. Natural Fc molecules are formed from monomeric polypeptides which can be attached to bimeric or multimodal forms by easy covalent bonding (i.e. disulfide bonds) and non-covalent. The number of intermolecular disulfide bonds between the monomeric subunits of normal Fc molecules ranges from 1

10 To 4 depending on the class (for example, IgG, 8C1, and H) or subclasses (for example, IgGl, 02, 03, 81C1, IgGA2) 0 An example of a normal Fc is a dimer bound by a disulfide obtained from the digestion of Papain from 0 (see Ellison et al., 1982, Nucleic 9-4071: 10 Acids Res). The expression Fc is normal as used in this application is generic to single-unit, dual-unit, and multi-unit images. An example of the poly sequence is presented

15th Fc peptide in series ID: 13.

The expression Fc variant denotes a molecule or sequence that is modified from a normal Fc but still includes a binding site for the dependent receptor, FcRn (a neonatal Fc receptor). The international applications numbers W097 / 34631 and 96/32478 WO explain the different Fc variants, as well as an interactions with the dependent receiver, and thus are combined with a reference spat. So, the expression Fc can include a shape

20 Different to a molecule or sequence which is modified to conform to humans from a non-human normal Fc.

Moreover, normal Fc includes regions which can be removed to provide contours

ΜΑ 33142Β1

Structural or biological activity which is not needed for the compaction molecules of FGF21 mutants of the present invention. Thus, the expression Fc variant includes a molecule or sequence that is missing one or more normal Fc site or building blocks, or in which one or more normal Fc site or building blocks may be modified, which affects or is included in: (1) formation Association

5 Disulfide, or (2) incompatibility with a selected host cell, or (3) heterogeneity of the N-terminal upon expression in a selected host cell, or (4) introduction of a glycosyl group, or (5) interaction with a complement, or (6) Binding to a non-receptor-dependent Fc receptor, or (7) antigen-dependent cell toxicity (ADCC). Various Fc forms are explained in further detail in this application below.

The expression Fc domain includes normal Fc, different Fc shapes and sequences as given from

10 Before. As with molecules of different Fc forms and normal Fc, the expression Fc domain includes molecules in mono- or polyunnomic form, either digested from a complete antigen or produced by another medium. In some embodiments of the present invention, the Fc domain may be bound to FGF21 or the FGF21 mutant (including a segmented image of FGF21) for example, by means of a delusional association between the Fc sequence and the sequence FGF21. It can form fusion proteins such as

15th These are multiple modules by means of Fc-coupling binding, and both these fusion proteins and multiple unites are characteristic of the present invention.

2- Tuff_RFGF21 site specific

The expression locator FGF21 tash or FGF21 tash with substitution refers to a mutant polypeptide FGF21 having an amino acid sequence that differs from the amino acid sequence of the polypeptide sequence

20 FGF21 incident naturally, for example, the sequence ID numbers: 2 and 4 and variations

309 Jala 1 each 1

Of which. Site-specific FGF21 mutants can be generalized by introducing amino acid substitutions, either conservative or non-conservative and by using naturally occurring or non-naturally occurring amino acids,

In particular polypeptide sites FGF21.

The term can include a conservative amino acid substitution substitution of a natural 5-amino acid building block (i.e., a building block located at a known locus of the FGF21 wild-type polypeptide sequence) with

An abnormal building block (that is, a building block which is not present in a known locus for the FGF21 polypeptide sequence wild type) such that there is little or no effect on the polarity or charge of the amino acid building block at this location. Conservative amino acid substitutions include naturally occurring scattered amino acid building blocks that are typically incorporated by synthesis of

10 A chemical polypeptide rather than a synthesis in biological systems. These include peptide emulators, and other reserved or inverted images of amino acid slits.

Naturally occurring building blocks can be divided into classes on the basis of common side chain properties:

(1) Non-hydrophobic: Norlewson, Met, Ala, Val, Leu, Ile; And

15th (2) Hydrophobicity in equilibrium: Cys, Ser, Thr; And

(3) Acidic:; Asp, Glu; And

(4): Basal:; Asn, Gin; His, Lys, Arg; And

(5) Building blocks that affect chain routing:; Gly, Pro; And

-311 669229

(6) Aromatic: Trp, Tyr, Phe.

Governorate replacements may include an exchange of a member from one of these classes for another member in the same class. Non-conservative substitutions may include an exchange of a member from one of these classes for a member of another class.

5 Desirable amino acid substitutions (whether conservative or non-conservative) can be determined by those skilled in piloting when such substitutions are desired. An ideal (but unspecified) list of amino acid substitutions is shown in Table 1.

Table number 1

Replacements of gummy amino

<td>Illustrative replacements</td><td>The original building block</td>

<td>Val; Leu; Ile</td><td>Ala</td>

<td>Lys; Gin; Asn</td><td>Arg</td>

<td>Gin; His; Asp, Lys; Arg</td><td>Asn</td>

<td>Glu; Asn</td><td>Asp</td>

<td>Ser; Ala</td><td>Cys</td>

<td>Asn; Glu</td><td>Gin</td>

<td>Asp; Gin</td><td>Glu</td>

<td>Ala</td><td>Gly</td>

<td>Asn; Gin; Lys; Arg</td><td>His</td>

<td>Leu; Val; Met; Ala; Phe; Norleucine</td><td>Ile</td>

<td>Norleucine; Ile; Val; Met; Ala; Phe</td><td>Leu</td>

<td>Arg; Gin; Asn</td><td>Lys</td>

<td>Leu; Phe; Ile</td><td>Met</td>

<td>Trp; Leu; Val; Ile; Ala; Tyr</td><td>Phe</td>

<td>Ala</td><td>Pro</td>

<td>Thr</td><td>Ser</td>

Sleep

ΜΑ 33142Β1

<td>Val; Ser</td><td>Thr</td>

<td>Tyr; Phe</td><td>Trp</td>

<td>Trp; Phe; Thr; Ser</td><td>Tyr</td>

<td>Ile; Leu; Met; Phe; Ala; Norleucine</td><td>Val</td>

3- FGF21 polypeptides segmented

An embodiment of the present invention is directed to cut images of the osmotic polypeptide FGF21. This embodiment of the present invention stemmed from an effort to map a truncated FGF21 polypeptide that is capable of providing activity that is similar to, and in some cases superior to, uncut images.

5 For mature FGF21 polypeptide.

As used in this application, the term FGF21 polypeptide truncated denotes an FGF21 polypeptide in which the amino acid building blocks have been removed from the amino terminal apha (or N terminal)

For FGF21 polypeptide, or amino acid building blocks have been removed from both the amino terminal growths and the carboxylation terminus of FGF21 polypeptide. The exposed cutting states have been prepared

10 In this application as explained in this application in Examples 3 and 3.

The activity of the N-terminal segmented FGF21 polypeptides and the C-terminal segmented FGF21 polypeptides can be evaluated using the ELK-Leucigurase experiment in the laboratory as illustrated in Example 4. Specific details of the experiments can be found in the laboratory which can be used to examine the activity of the polypeptides FGF21 broken down in Example # 4.

15th The activity of the segmented FGF21 polypeptide of the present invention may also be evaluated in an experiment in V.

Nationalistic object, such as ob / ob mice as shown in examples numbers 5 and 7. In general, to evaluate

The activity of FGF21 polypeptides cut in live cache, polypeptides can be administered

7 a

ΜΑ 33142Β1

FGF21 transected into a laboratory animal within a peritoneum. After a desired incubation period (for example, one hour or more), a blood sample may be drawn, and blood glucose levels may be measured. Specific combative details of the organism that can be used to examine the activity of the FGF21 polypeptides truncated in Examples 5 and 7 can be found.

5 A- End cutoff cases N

In exempted embodiments of the present invention, N terminal eruption states include 1, 2, 3, or 4,

Or 5, 6, 7, or 8 amino acid building blocks of the N-terminal terminal of the polyclonal FGF21 exudate. As shown, for example, in Example 5 and Fig. 3, a truncated FGF21 polypeptide with rupture states of less than 9 amigo building units is written.

10 FGF21 polypeptides lowered blood glucose in a person. Accordingly, in special embodiments, the present invention comprises cut-off images of the mature FGF21 polypeptide or FGF21 phase cutoff states of N terminals of 1, 2, 3, 4, 5, 6, 7, or 8 building blocks of an amino acid.

B- Cases of terminal rumble C

15th In some embodiments of the present invention, C terminal rumble states comprise 1, 2, 3, or 4,

Or 5, 6, 7, 8, 9, 10, 11, or 12 building blocks of an amino acid from the C-terminal end of the mature FGF21 polypeptide. As shown, for example, in Example # 5 and Fig. Ab, truncated FGF21 polypeptides with rupture states of less than 13 building blocks of amino acid degradation showed at least 50% efficiency for FGF21 wild type in an experiment.

20 ELK-leucegerase in vitro, including that gain the ability of FGF21 bleached polypeptides.

No 2

341 669229

To lower blood glucose in a person. Accordingly, in special embodiments, the present invention includes segmented images of the exudative FGF21 polypeptide or FGF21 mutants with C-terminal states of L, 2, 3, 4, 5, 6, 7, 8, or 9. , Or 10, 11, or 12 building blocks of 0-amino acid

5 C- End and C ends

In some embodiments of the present invention, the truncated FGF21 polypeptides may have a combination of terminal and C-terminal cut-off states. The segmented FGF21 polypeptides with a combination of-terminal and C-terminal cut-off states may have the corresponding activity of the truncated FGF21 polypeptides with either-terminal or terminal-tear states. C only. In other words, it possesses FGF21 polypeptides

10 A plot with both terminal discs Less than 9 amino acid residues and C terminal eruption states Less than 13 amigo residual units similar or greater blood glucose lowering activity as FGF21 polypeptide truncation Less than 9 amino acid residues Or segmental FGF21 polypeptides with C-terminal polyopeptides less than 13 amino acid residues. Accordingly, in special embodiments, the present invention includes

15th Cut-out images of the exudative FGF21 polypeptide or FGF21 polypeptide mutants with both terminal cutting states Ν of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid residues and cutoff states' for the C-terminal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 13 building blocks of an amino acid.

As with all the FGF21 mutant of the present invention, a segmented FGF21 poly 20 peptides may optionally comprise the methionine building block of the amino terminal, which can be inserted.

ΜΑ 33142Β1

-35-

By direct mutagenesis or as a result of a bacterial expression process.

The segmented FGF21 polypeptides of the present invention may be prepared as illustrated in Examples 3 and 6. Those of ordinary skill in ablating, familiar with standard molecular biotechnology, may use this information, coupled with the current disclosure, to prepare and use polypeptides.

5 FGF21 Fragment of the present invention. Standard techniques can be used to produce DNA recombination, oligonucleotide synthesis, tissue culture, and transformation (for example,

Electrophoresis, lipofectin). See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Preservation, which is incorporated in this application as a reference for any purpose. The enzymatic reactions and purification techniques may be carried out according to the fluorescence specifications, as is

10 It is commonly carried out in aggregate, or as explained in this application. Unless specific definitions are provided, the nomenclature used in relation to the laboratory procedures and techniques for analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry described in this application are those that are well known and commonly used in the short term. Standard chemical synthesis techniques can be used; And chemical analysis; Preparation, Formulation, and Delivery

15th Pharmacist; And treat patients.

The segmented FGF21 polypeptides of the present invention may also be incorporated into another entity,

Which can impart additional properties to the segmented FGF21 polypeptides. In an embodiment of the present invention, a segmented FGF21 polypeptide may be incorporated into the Fc sequence. Such a combination could be carried out using known molecular biomolecular methods and / or the guidance provided in this

20 the demand. The benefits of combining polypeptides like these are explained, and also two ends of making polypeptides

Merges like these, in more detail on this application.

٩

ΜΑ 33142Β1

4- FGF21 mutants resistant F routine

As illustrated in Example # 8, FGF21 was discovered to be an osmotic subject to degradation in the organism, which was finally determined to arise from a proteolytic heme. It was discovered that degradation in vivo and exudative FGF21 leads to a shorter effective half-life, which can be

5 It adversely affects the therapeutic potential of a molecule. Accordingly, a targeted study was performed to map FGF21 mutants that show resistance to proteolysis. As a convenience to this assay, sites in the FGF21 disparate polypeptide that have been identified to be particularly vulnerable to proteolysis include a peptide bond between the amino acid building blocks of the amino acid building blocks 4-5, 20-21, 151-152, and 171-172.

10 An extensive, but focused and targeted study, was performed to identify specific substituents that address the observed protein cytolytic effect while not affecting protein activity to an unacceptable degree. Tables 8 and 1 show some of the mutants that were prepared and tested. As explained, for example, in examples 13 and 4A, not all FGF21 mutants exhibit a perfect shape; Some mutants conferred resistance to proteolysis but at the expense of the activity of FGF21 involved. Acquired

15th Other mutations have FGF21 activity but will not confer resistance to proteolysis. Several specimens have been typed, including, for example, FGF21 P171G with a similar activity level as FGF21 wild type while also showing resistance to reduced proteolysis.

One of the selection criteria for the designation of desirable FGF21 proteins was to be protease

The activity of the FGF21 mutant is essentially identical to, or greater than, the activity of FGF21 wild type 0

20 So; Another embodiment of the present invention is directed at FGF21 which are resistant

H)

ΜΑ 33142Β1

For proteolysis and still gaining activity which is essentially identical to like, or greater than,

FGF21 wild type. Although less desirable in some cases, formation of FGF21 torpedos that are resistant to proteolysis but exhibit denaturing activity is another embodiment of the present invention. In some cases it may be desirable to maintain a degree of proteolysis, thus,

5 The FGF21 mutants which allowed for a certain degree of proteolysis were another embodiment of the present invention as well.

As is 0 p for all the FGF21 torches of the present invention, the FGF21 proteolysis resistant torches of the present invention may be prepared as described herein. Those of ordinary skill can at once use, say, the usual with standard molecular biotechnology

10 This information, coupled with the present disclosure, is for the preparation and use of the proteolytic FGF21 torpedos of the present invention. Standard fuses can be used for DNA recombinant product, oligonucleotide synthesis, tissue culture, and transformation (for example,

Electrophoresis, lipofectin). See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, ibid., Which is incorporated in this application as a reference for any

15th purpose. Enzymatic reactions and purification techniques may be carried out according to the fluorescence specifications, as commonly performed immediately, or as described herein. Unless specific definitions are provided, the nomenclature used in relation to the laboratory procedures and techniques for analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described in this application are those that are well known and commonly used immediately. It can be used

20 Standard techniques for chemical synthesis; And chemical analysis; Preparation, drafting, and delivery

Pharmacist; And treat patients.

ΜΑ 33142Β1

The FGF21 protease-resistant mutant of the present invention can also be combined into another entity, which can impart additional properties to the FGF21 proteolytic mutant. In one embodiment of the present invention, the proteolytic mutant FGF21 may be combined to the IgG Fc sequence, for example, the sequence ID number: 13. It can be performed like this

5 Combination using known biomolecular methods and / or the guidance provided in this application. The benefits of fusion polypeptides like these are explained, and also methods for making fusion polypeptides like these are,

More detailed in this application.

5- FGF21 mutants are caking-reducing

As explained in Example # 15, one of the characteristics of the FGF21 polypeptide wild type 10 is its tendency to clump. At concentrations above about 5 mg, the caking rate is high 1 ° C

Room temperature. As shown and explained herein, the caking rate for FGF21 polypeptide is wild type dependent on both concentration and temperature.

Agglomeration can be demonstrated to be a challenge when working with wild-type FGF21 at these concentrations, for example in the context of a therapeutic formulation. Accordingly, an appointment-oriented study was performed

15th FGF21 mutants which show reduced FGF21 agglomeration. The resulting FGF21 mutant was then tested for a tendency to agglomerate at different concentrations.

A broad but focused study has been conducted to identify specific substitutions that nullify or reduce the observed agglomeration effect of FGF21 wild species while not affecting protein activity to an unacceptable degree. Example # 15 is an explanation of an attempt to identify suitable caking mutants. Shows

20 Table 16 Some mutants that were prepared and tested. As annotated, for example,

ΜΑ 33142Β1

In Example # 17, not all FGF21 mutants were optimally disinfected. Some mutants, such as FGF21 L58E had incorporated FGF21 activity and had not been further studied. Acquired other mutations,

Like FGF21Α134Ε, FGF21 activity but not conferred reduced caking properties. Several mutants, such as FGF21 L98R, acquired FGF21 activity and also showed reduced agglomeration. Nobody showed

5 The mutant, FGF21Α45Κ, has surprisingly increased FGF21 activity while also showing properties

Reduced conglomeration.

One of the selection criteria for mapping of the FGF21 mutant is that the activity of the FGF21 mutant is necessarily similar to, or greater than, the activity of the FGF21 wild type. Therefore, another embodiment of the present invention is directed at FGF21 mutants with reduced caking properties while

10 Acquire FGF21 activity that is identical to, or greater than, FGF21 wild type. Although less desirable in some cases, FGF21 mutants with reduced agglomeration characteristics but FGF21 mutants exhibit another embodiment of the present invention. In some cases it may be desirable to preserve the degree of agglomeration and, consequently, FGF21 mutants which permit some degree of agglomeration to occur form another model of the present invention as well.

15th As with all FGF21 mutants of the present invention, the caking-reducing mutant FGF21 may be prepared for the present invention as described herein. Those of ordinary skill in galvanizing, eg, those familiar with standard molecular biotechnology may use this information, coupled with the present disclosure, to prepare and use the FGF21 agglomeration-reducing mutant of the present invention. Standard techniques can be used and DNA is a product of recombinant DNA.

20 And oligonucleoid synthesis, cage culture, and transduction (eg, electrophoresis, lipofectin). See, for example, Sambrook et al., Molecular Cloning: A Laboratory

942Β9 &lt;? 1 6

Manual, the previous one, which is incorporated in this application as a reference for any purpose. Enzymatic degradations and purification techniques may be performed according to the fluorescence specifications, as commonly performed immediately, or as described herein. Unless specific definitions are provided, the nomenclature used in relation to the laboratory procedures and techniques for analytical chemistry, organic chemistry

5 Synogenetic, medicinal and pharmaceutical chemistry explained in this application are those that are well known and commonly used immediately. Standard chemogenetic techniques can be used; And chemical analysis; Urbanization, formulation and pharmaceutical delivery; And address

The patients-

The FGF21 caking-reducing mutant of the present invention may also be combined into another entity.

10 Which may impart additional properties to the anti-caking mutant FGF21. In one of the models

In the present invention, the caking-reducing mutant FGF21 can be incorporated into the IgG Fc sequence, eg, the sequence ID No .: 13. Such combination can be performed using known biomolecular methods and / or the guidance provided in this application. The benefits of fusion polypeptides like these, and also methods for making polypeptides fusion like these, are explained in more detail in this.

15th the demand.

6- FGF21 mutants are common

As explained in this application, the FGF21 series Irrigation possesses several properties that can pose significant challenges when FGF21 is used as a therapeutic molecule. Among these challenges, Benin is the possibility of protein degradation and its tendency to agglomerate at a high concentration. After effort

20 To painstakingly map the FGF21 polypeptides that overcome each of these challenges, a study was performed

٩

-419Α2Β9 &lt;? 1 6

Intended to determine which amino acid substitutions exhibit proteolytic resistance and agglomeration-reducing properties can be propagated by addition or synergy in the tonic polypeptide sequence while maintaining activity levels that are metastable to or greater than the activity of FGF21 wild type. This represents a major challenge, as it is known that multiple mutations have been introduced

5 In a known polypeptide it can sometimes adversely affect the expression, activity, and subsequent deposition of the protein.

Surprisingly, and as shown, for example, in examples 19 and 20, it was discovered that the desired properties of several FGF21 mutants could in fact be combined in an additive or synergistic manner to generate an FGF21 gash with enhanced pharmacokinetic properties. Have FGF21 mutants which

10 It is resistant to proteolysis, reduced caking rate, and which is still gaining activity that is similar to, or greater than, the activity of FGF21 wild type as disclosed in this application.

One of the selection criteria for mapping desirable common FGF21 flies was for the FGF21 mutant activity to be similar to, or greater than, the FGF21 wild type d-activity. Therefore, another model is directed

15th The present invention refers to FGF21 mutants that are resistant to proteolysis and have reduced agglomeration properties while still writing FGF21 activity which is identical to, or greater than, FGF21 wild type. Although less desirable in some cases, FGF21 mutants which are resistant to proteolysis and have reduced agglomeration properties but exhibit reduced activity of FGF21 are another embodiment of the present invention. In some cases it may be desirable to maintain the degree of lysis

20 Proteinuria and / or agglomeration and, thus, form FGF21 mutants which permit a certain degree of proteolysis and / or agglomeration. Another embodiment of the present invention is also 33142Β1.

As with all FGF21 mutants of the present invention, FGF21 co-mutants of the present invention may be prepared as described herein. Those of ordinary skill in impersonating, for example, the usual with standard molecular biotechnology can use this information,

Coupled with the present disclosure, to coagulate and use common FGF21 mutants of the present invention.

5 Standard techniques can be used for recombinant DNA, oligonucleotide synthesis, tissue culture, and transduction (eg, electrophoresis, lipofectin). Review,

For example, Sambrook et al., Molecular Cloning: A Laboratory Manual, ibid.

Which is included in this application as a reference for any purpose. Enzymatic reactions and purification techniques may be carried out according to the fluorescence specifications, as is commonly performed in hydration, or as is.

10 Raised in this application Unless specific definitions are provided, the nomenclature used in relation to the laboratory procedures and techniques for analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described in this application are those that are well known and used misguided in spoofing. Standard chemical synthesis techniques can be used; And chemical analysis; Pharmaceutical preparation, formulation and delivery; And treat patients.

15th The co-FGF21 mutant of the present invention can also be combined with another entity, which can impart additional properties to the co-FGF21 mutant. In an embodiment of the present invention,

The common FGF21 mutant may be fused to the IgG Fc sequence, for example, the sequence ID number: 13. Such combination may be performed using known biomolecular methods and / or the guidance provided in this application. The benefits of combining polypeptides like these are explained, too

20 Methods for making polypeptide fusion polypeptides such as these are further detailed in this application.

7- DMF FGF21 proteins

ΜΑ 33142Β1

As used herein, the aroma dislocates the FGF21 fusion polypeptide or FGF21 fusion protein into a building block of one or more amino acids (such as a protein or heteropeptide) at the N or C terminus of any FGF21 polypeptide mutant described in this application.

Includes, but is not limited to, heterocyclic peptides and polypeptides on top of 5 adhesive to allow detection and / or isolation of the FGF21 polypeptide model; And a membrane receptor protein

Interstitial or part thereof such as the extracellular domain or the intracellular domain of an interstitial membrane; A ligand or part thereof that binds to an interstitial membrane receptor protein; An enzyme or part thereof which is catalytically active; A polypeptide or polypeptide that promotes the formation of oligomers, such as the leucine cloud domain; A polypeptide or polypeptide that increases stability, such as an immunoglobulin stable region; And gum

10 Functional or nonfunctional antagonist, heavy or light boredom thereof; A polypeptide having an activity, such as a therapeutic activity, is different from the FGF21 polypeptide tear of the present invention. Also incorporated by the present invention are FGF21 torpedos incorporated into human serum albumin (HSA).

The preparation of FGF21 blood proteins can be performed by inserting heterozygous sequences at either the customary 15 N or at the C terminus of the FGF21 polypeptide flare. As explained in this application,

A heterocyclic sequence can be an amino acid sequence or a polymer that does not contain an amino acid. The heterozygous sequences can be incorporated either directly into the FGF21 polypeptide tag or via a conductor or an adapter molecule. A prepared conductor or molecule can be a building block of one or more amino acids (or units), for example, 1, or

20 2; Or 3; Or 4, 5, 6, 7, 8, or 9 building units (or units), for example

Example 1, 10, 11, 12, 13, or 14; Or 15; Or 16; Or 17; Or 18; Or 19;

٢٧

ΜΑ 33142Β1

Or 20, 25, 30, 35, 40, 45, or 50 units of dissolved 0 (or 1T units), and more than 15 to 35 building units (or units). A cloning site connector or adapter molecule may also be designed for a DNA restriction coupling or a protease to allow separation of the embedded slits.

In one embodiment of the present invention, an FGF21 polypeptide mutant is incorporated into one or more domains

For the Fc region of a human IgG. The antibodies comprise two functionally independent parts, a variable domain known as Fab, which binds to an antigen, and a fixed domain coded with Fc, which is included in influent functions such as complementary and homozygous activation by macrophage cells.

D Fc has a long serum half-life, while Fab is short-lived (Capon et al

525-31: 337 1989, Nature). When combined with a glycoprotein, the Fc domain may provide a longer half-life or combine such functions as Fc acceptor binding, complement fixation, and tumor even placental transfer (1989, Capon et al.).

A pharmacokinetic analysis in an organism showed that for a pustular FGF21 the bottom half-life is about

Age for FGF21 The Fc sequence was incorporated into the N or C-terminal primates of the FGF21 polypeptide. Fc zone merging did not extend to FGF21 wild type; In particular, the Fc embedded to the N terminal of the FGF21 wild type, the half-life as expected, however, which resulted in the low proteolytic assay of FGF21 in live cache and mapping of FGF21 mutants by

20 It was resistant to such decomposition. Such mutants are, for example, explained in

ΜΑ 33142Β1

Examples Figures 8 and L1 show longer half-lives than FGF21 wild type 0 These and other FGF21 fusion proteins form an example of the present invention.

Throughout the detection, FC-FGF21 expression refers to a fusion protein in which the Fc sequence is denatured to the N envelopes of FGF21. Likewise, everywhere in the detection, the expression -FGF21 resembles

5 Fc to a fusion protein in which the Fc sequence is fused to the C adverbs for FGF21

The resulting FGF21 fusion protein can be purified, for example, by using a protein affinity column. It has been discovered that peptides and proteins fused to the Fc region exhibit substantially greater half-lives in the organism than the non-integrating antigen portion. Also, incorporation into the Fc region allows for the de-formation / formation of multiple fusion polypeptide units. maybe you can be

10 The Fc region is a naturally occurring Fc region, or it can be altered to improve specific qualities, such as therapeutic qualities, cycle time, or reduced agglomeration.

Useful modifications of protein therapeutics by combining with Fc antibody replication are detailed in WO 00/024782, which is then combined with a whole reference spat. This document discusses a link to a carrier such as polyethylene glycol (PEG), or

15th Dextran, or Fc zone.

B - protein fusion connectors

When constructing the fusion protein of the present invention a conductor may be made, but not required. If present, the chemical structure of the conductor may be inconclusive, as its mother essentially acts as a spacer. The conductor can be formed from amino acids joined together by bonds

20 Polypeptide. In some embodiments of the present invention a conductor from 1 to 20 amino acids is formed

-46ΜΚ 2> 2> 9Α2Β1

Connected by polypeptide bonds, the amino acids are selected from the twenty naturally occurring amino acids. In various embodiments, the 1 to 20 amino acids are selected from the amino glycine, synrin, allatine, proline, asparagine, glutamine and lysine. In some embodiments, a conductor is formed from most amino acids that are non-tropically impaired, such as

5 Glycine and Alanine. In some embodiments, the conductors are polyglycinate (such as 4 (Gly) (sequence ID: 29) two) (series ID: 30), polyalaninate, or combinations of glycine and alanine (such as poly (Gly)). - Ala), or combinations of glycine and serine (as poly (Gly-Ser)). Other suitable connectors include: 50 (Gly) Ser- (Gly) 3-Ser- (Gly) 4-Ser (Serial ID No .: 23), Gly) 4-Ser- (Gly) 4-Ser-j)

10 Gly (4-Ser) (the sequence with identity number: 31), ^ Gly (3-Lys- (Gly)) (the sequence with identity number: 32), Gly (3-Asn-Gly-Ser- (Gly (2j)) Sequence ID: 33, Gly (3-J)

4 (Cys- (Gly) (sequence ID No .: 33), Gly-Pro-Asn-Gly-Glyj (sequence ID: 35), while a 15-building unit conductor of an amino acid that works particularly well for brain proteins has been detected. FGF21, the present invention predicts conductors of any length

15th Or a combination.

The conductors described in this application are exemplary, and conductors which are much longer and incorporate other building blocks are expected by the present invention. Non-peptide conductors are also anticipated by the present invention. For example, an alkyl conductor such as - (NH- (CH) SC) (O-) can be used, where 2 = s to 20. It can be substituted

20 These alkyl conductors are added by a non-obstructed group stereotactically, including, for example

Example but not limited to a small alkyl (for example, C1-C6), a small acyl, or

<img file="MA33142B1_D0005.tif" />

ΜΑ 33142Β1

Halogen (for example, Br, Cl), CN, NH, or FSL. Be non-conductive

An ideal peptide is a polyethylene glycol conductor, in which the conductor has a molecular weight

From 100 to 5000 kilograms for 1 ton, and for example 1 from 100 to 500 kilograms

Dalton.

5 8- Chemically modified FGF21 mutants

Chemically modified images of the FGF21 polypeptide mutants described in this application, including the cut-off images of FGF21 annotated in this application, may be prepared by a person skilled in impersonation, the disclosure information explained in this application. Such chemically modified FGF21 mutant is altered so that the chemically modified FGF21 mutant is different from

10 The FGF21 mutant is unmodified, either in type or in situ to molecules normally conducting to the FGF21 mutant. Chemically modified FGF21 mutants may include molecules formed by deleting one or more naturally occurring chemical groups.

In one embodiment, the FGF21 polypeptide mutants of the present invention may be modified by the covalent conduction of one or more polymers. For example, it is a polymer

15th The selection is typically water soluble so that the protein it is delivered to does not precipitate into the aquatic environment, such as a physiological environment. Included within the range of suitable polymers is a mixture of polymers. Preferably, for the therapeutic use of the final product,

The polymer will be pharmaceutically acceptable. Water insoluble polymers conjugated to FGF21 polypeptide mutants of the present invention also form a feature of the invention.

20 Perfect polymers can be branched or unbranched each. Be both

ΜΑ 33142Β1

Polymers typically have any molecular weight between from about 2 kDa to about 100 kDa (Yin expression is approximately that preparations of a water-soluble polymer,

Some molecules will weigh slightly more and less than the denied molecular weight). The average molecular weight of each polymer is a preferred lameness between about 5 kDa and about

5 50 kDa, most preferred between about 12 kDa and about 40 kDa,

The most preferred is between about 20 kDa and about 35 kDa.

Suitable water-soluble polymers or mixtures thereof, for example PBS, include carbohydrates with N or 0, sugars, phosphates, and polyethylene glycol (PEG) (including images from PEG that have been made

10 They are used to derive proteins, including mono- (Ci-Cio), alkoxy, or aryloxy-polyethylene glycol), mono-methoxy-polyethylene glycol, and dextran (such as low molecular weight dextran, for example, kDa. ), And cellulose,

And polymers consisting of ama carbohydrates, poly- (N-nanylpyrrolidone) polyethylene glycol, homopolymers of propylene glycol, and copolymers poly oxide

15th Propylene / ethylene acamide, and polyol compounds treated with polyethoxy (AliMbel

Example, glycerol), and polyphylated alcohol. Also included by the present invention are dual-function crosslinking molecules that can be used to prepare multiple units of a charge-conducting FGF21 polypeptide mutant. Also included by the present invention are FGF21 mutant lead-bound to polycyclic acid.

20 In some embodiments of the present invention the FGF21 mutant is covalently modified, or chemically, to comprise

Contains one or more soluble polymers, including, but not limited to;

0/

ΜΑ 33142Β1

On polyethylene glycol (PEG), or polyoxyethylene glycol, R-polypropylene glycol. See, for example, US Patent Numbers 4,640,835; And 4,496,689;

And 4,301,144; And 4,670,417; 4, 791 and 92 A 4,179,337, P. In some embodiments of the present invention, the FGF21 mutant includes one or more polymers, including, for example.

5 And not limited to, mono-methoxy-polyethylene glycol, dextran, and cellulose,

Polymers consisting of Asama carbohydrates, poly- (N-phenylpyrrolidone) polyethylene glycol, propidine glycol isomerized polymers, polypropylene oxide / ethylene oxide co-copolymers, polyethoxy-treated polyols (for example, glycerol), polyvinyl alcohol, Or mixtures of such polymers.

10 In some embodiments of the present invention, the FGF21 mutant is importantly modified with PEG subunits. In some embodiments, one or more water soluble polymers (for example, at the N terminal) are attached to the FGF21 mutant. In some embodiments, one or more water-soluble polymers are randomly attached to one or more side chains of the FGF21 mutant. In some embodiments, PEG is used to improve the therapeutic ability

15th For Flyer FGF21. Such methods are explained, for example, in US Patent No. 6,133,426, which is incorporated in this application as a reference for any purpose.

In embodiments of the present invention where the polymer is PEG, the PEG group may be of any appropriate molecular weight, and it may be straight or branched. The average molecular weight of the group or PEG will preferably range from about 2 kDa to about 100 kDa, and more preferably from about 5 kDa to about 50 kDa 1 liter, for example 4 10, 20, 30, 40, or 50. Kilo Dalton. Will

<img file="MA33142B1_D0006.tif" />

ΜΑ 33142Β1

Generally speaking, the delivery of the PEG group to the mutant FGF21 via a methylation or a reductive alkylation through a reaction group on the PEG slit (for example, an aldehyde group,

Or an amigo group, a thiol group, or an ester group) to a reaction group on the mutant FGF21 (for example, an aldehyde group, an amino group, or an ester group).

5 Specifically, the implementation of group or PEG insertion of a polypeptide, including the FGF21 mutant of the present invention, can be performed using any known PEG insertion reaction in verbs. Such agents are explained, for example, in the following references: Francisera 4-10: 3 1992, Focus on Growth Factors; European Patent No. 316 154 0 and 401 0 384; And US Patent No. 4,179,337. For example, cm can perform an entry

10 PEG group by acetylation or alkylation reaction with a reactive polyethylene glycol molecule (or a similar reactive water-soluble polymer) as explained herein. For acylation reactions, the polymer of choice should have a tonic aldehyde group. The reactive aldehyde is, for example, a polyethylene glycol propionine aldehyde, which is soluble in water, or a C1-C10 alkoxy mono or derivatives

15th Areoxylated ones (see, for example, US Pat. No. 5,252,714).

In some embodiments of the present invention, a useful strategy includes the delivery of a PEG group to an integrating polypeptide, during the formation of a conjugate in solution, a peptide moiety and 0 £, each of which carries a special function that is cross-reactive towards the other. The peptides can easily be denatured by conventional solid-phase synthesis. The peptides are primed with a functional group

20 Convenient to specific location. The precursor is completely purified and labeled prior to reaction with the PEG slit. The peptide-binding event with PEG is usually in the aqueous phase and can easily be followed up

ΜΑ 33142Β1

Powered by HPLC reverse phase analysis. The peptides introduced into the PEG group can be easily purified by preparative HPLC and characterized by HPLC analysis, amino acid analysis, and mass spectrometry by laser detection.

Polysaccharide polyols are another type of water-soluble polymer that can be used for protein modification. Therefore, FGF21 mutants form the combined present invention

To polymer polysaccharide embodiments of the present invention. Dextrans are polysaccharides made of separately subunits of glucose predominantly connected by 1-- alpha bonds. The dextran is available in molecular weights from about 1 kDa to about 70 kDa. Dextran is a term

10 For a water-soluble anabolic polymer for use as a carrier by itself or in combination with a carrier

Else (for example, Fc). See, for example, International Application WO 96/11953. Conjugated use of dextran with either therapeutic or diagnostic immunoglobulins has been reported. See, for example, European Patent No. 456 315 0, which is thus combined with a reference stamp. The present invention also includes the use of a dextran of about 1

15th KDa to about 20 kDa.

In general, chemical modification may be carried out under any suitable condition used for the reaction of a protein with an activating polymer molecule. Methods for synthesizing chemically modified polypeptides in general sputum will include the following steps: (a) The reaction of the polypeptide with an activated polymer molecule (such as a reactive ester or an aldehyde derivative of the polymer molecule) under conditions where it becomes

20 Thus mutant FGF21 polypeptide is attached to one or more polymer molecules, and (b) obtained

On reaction products. The ideal reaction conditions will be determined on the basis of coefficients

٩

ΜΑ 33142Β1

Known and desired results. For example, the greater the ratio of polymer molecules to protein, the greater the percentage of the conductive polymer molecule. In one embodiment of the present invention, the chemically modified FGF21 torpedo may have the injection of a single polymer molecule at amino envelopes (see, for example, US Patent No. 5,234,784).

5 In another embodiment of the invention, FGF21 polypeptide mutants can be chemically coupled to butene. FGF21 polypeptide bioavers are then allowed to be bound to avidin, giving rise to avidin apiutin / tetrivalent polypeptide FGF21 mutants. The FGF21 polypeptide mutant FGF21 to di-nitrophenol (DNP) or tri-nitrophenol (TNP) and sedimentation of the resulting conjugates can also be cynically coupled with a DNP leaving or ΤΝΡ-IgG anti-degeneration.

10 Decamzric conjugates of a par of 10.

Generally speaking, cases which may be ameliorated or modified by administration of the present chemically modified FGF21 mutants include those described in this application for FGF21 polypeptide mutants. However, the FGF21 chemically modified polypeptide mutant disclosed in this application could have additional activities, enhanced biological activities or

15th Reduced, or other characteristics, such as plus or minus half-lives, as compared to unmodified FGF21 mutants.

9- Therapeutic combinations of FGF21 torques and their administration

Within the scope of the present invention, therapeutic compositions comprising FGF21 torisors are specifically predicted in light of the definitions of multiple mutant FGF21 sequences exhibiting enhanced properties.

20 FGF21 pharmaceutical formulations such as these may comprise a therapeutically effective amount of

appeared

ΜΑ 33142Β1

FGF21 polypeptide was mutated in a mixture with a pharmacologically or physiologically acceptable formulation agent chosen for suitability with the method of administration.

Are preferred formulation materials that are not toxic to a future at the doses and concentrations used.

5 A pharmaceutical formulation may contain formulations to modify, preserve, or preserve, for example, pH, osmosis, viscosity, clarity, color, isotonicity, odor, sterility, persistence, or The dissolution, release, or penetration of the formula. Suitable formulations include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine, or lysine),

10 Antimicrobial, antioxidant (such as ascorbic acid, sodium sulfite, or sodium bisulfite), and pH-regulating substances (such as borate, or bicarbonate,

Or Res-HCl, citrate compounds, or other organic acids), amplifying agents (such as mannitol or glycine), a chelation agent (such as ethylenediamine tartaric acid (EDTA)), and complexing agents (such as caffeine, polyvinylpyrrolidone, or hydroxybutyrate).

15th Propyl-beta-cyclodextrin), fillers, monosaccharides, other carbohydrates (such as glucose, mannose, or dextrin), proteins (such as serum albumin, gelatin, or immunoglobulins), coloring agents, flavoring and dilution agents, and Emulsification, hydrophilic polymers (such as polyphylpyrrolidone), low molecular weight polypeptides, salt-forming anti-ions (such as sodium), and

20 Preservative (such as per alconium chloride, buzoic acid, salicylic acid, or

Thymersol, phenethyl alcohol, methylparaben, propylparaben, or chlorine

No

ΜΑ 33142Β1

Hexidine, sorbic acid, or hydrogen peroxide), and solvents (such as fibrin,

Or propylene glycol, or polyethylene glycol), and sugar alcohols (such as mannitol or

Sorbitol), suspending agents, and surfactants or wetting agents (such as

Pluronic, PEG, sorbitan esters, or polysorbate compounds such as polysorbate

5 20, polysurate 80, tromethamine, lethyspine, cholesterol, or telocapal),

And Bate promoting agents (such as sucrose or sorbitol), stress enhancing agents (such as alkali metal halides — preferably sodium or potassium chloride — or mannitol sorbitol), conduction agents, diluents, excipients and / or pharmaceutical auxiliaries (see, for example, ,

Remington's Pharmaceutical Sciences (I8, h Ed., AR Gennaaro, ed., Mack 10 1990 Publishing Company and the following variations thereof, are included in this application as a reference for any

purpose).

The ideal pharmaceutical composition will be determined by a skilled technician depending, for example,

The intended passage for administration, form of delivery, and desired dose (see, for example, Remington's Pharmaceutical ScienceSjSupra). Such combinations can influence

15th On the normal state, the release rate in the organism, and the filtering rate in the organism of the polypeptide FGF21.

The primary carrier or carrier in the pharmaceutical formulation may be either aqueous nature or aqueous insulin. For example, a carrier or injection carrier could be water,

Or physiological saline, or synthetic cerebrospinal fluid, possibly supplemented with substances

20 Others are fluid in formulation for non-enteral administration. A normal pH buffer or saline mixed with serum albumin are additional ideal vectors.

ΜΑ 33142Β1

Other ideal pharmaceutical formulations include a tris pH gel with a pH of 7- 8.5, or a pH regulator acetate pH 4- 5.5.

This may furthermore include sorbitol or a suitable substitute. In an embodiment of the present invention, FGF21 mutant polypeptide formulations may be prepared for storage

5 You can easily mix the selected formula of desired purity with optional formulating agents

(Remington's Pharmaceutical ScienceS'Supra) is in the form of a lyophilized paste or water solution. Moreover, the fresh FGF21 polypeptide product can be formulated as lyophilized product using suitable excipients such as macros.

The pharmaceutical compositions of FGF21 polypeptide mutant may be selected for non-enteral delivery. Alternatively, formulations may be selected for inhalation or for ductwork

Alimentary, for example by grief. The preparation of such pharmaceutically acceptable formulations is a skill within the skill to be prepared.

Formulation components are present in concentrations that are acceptable to the site of administration. For example, pH buffers are used to maintain the formula at NO

15th Physiological pH or lower pH, typically within a pH range from about 5 to about 8.

When non-enteral administration is contemplated, therapeutic compositions for use in the present invention may be in the form of a non-enteral acceptable aqueous solution devoid of a fever-inducing substance containing the desired FGF21 polypeptide mutant in an acceptable vector.

20 Pharmaceutically. It is a carrier that is particularly suitable for injection via non-enteric dealers of water

٩

ΜΑ 33142Β1

A sterile distillate in which the mutant FGF21 polypeptide is formulated as a sterile isotonic solution, properly preserved. Another preparation may also include the formulation of the desired molecule with an agent, such as injectable microballs, or bio-corrosive particles,

Polymeric compounds (such as polyactic acid or polyglycolic acid), or beads,

5 Or lipid particles, which are provided for the concurrent or continuous release of the product which can then be delivered by injection. Hyaluronic acid can also be used, and this effect can promote a continuous continuation of blood circulation. Another suitable medium for introducing the desired molecule includes non-implantable AFAR conduction devices.

In one embodiment, a pharmaceutical composition for inhalation may be formulated. For example,

10 The FGF21 polypeptide mutant may be formulated as a dry powder for inhalation. Can

Inhalation solutions of FGF21 polypeptide mutant are also formulated with an aerosol delivery propellant.

In yet another embodiment, solutions may be atomized. In addition, pulmonary administration is described in WO No. 94/20069 WO, which explains the pulmonary conduction of chemically modified proteins.

15th It is also speculated that certain formulas may be given by means of the qab. In an embodiment of the present invention, FGF21 polypeptide mutants administered for this method may be formulated with or without those carriers normally used in the synthesis of solid dosage forms such as tablets and capsules. For example, it could be designed as a transfusion to occupy a portion of the summer at a point in the gastro-intestinal tract when the bioavailability is maximized and the bioavailability is reduced.

20 Pre-systemic degradation. Thinners and flavoring agents can also be used.

Low melting point waxes, vegetable oils and lubricants; Hanging holders;

.٧

-579Α2Β9 &lt;? 1 6

Breakdown agents, and links.

Another pharmaceutical formulation may include an effective amount of FGF21 polypeptide mutant in a mixture with non-toxic excipients and is suitable for tablet application. By dissolving the tablets in sterile water, or another suitable carrier, solutions can be prepared in unit dose form.

5 Suitable excipients include, but are not limited to, inert diluents, such as calcium carbonate, sodium carbonate or bicarbonate, lactose, or calcium phosphate, or binding agents, such as starch, gelatin or acacia gum; Or lubricating agents like magnesium stearate, stearic acid, or talc.

Additional pharmaceutical compositions for the FGF21 polypeptide mutant will be apparent to those with 10 skills in dilatation, including glue including FGF21 polypeptide flyers in continuous conduction glue.

Or codified. Techniques are standardized to formulate a variety of continuous or other rated means of delivery,

Such as materials carrying lipid particles or bio-corrosive gamma particles, or porous beads and fumes injections, Igas are known to those of skill in gall (see, for example,

International Application No. 93/15722 WO explaining the metered release of polymeric fine particles

15th Porosity for connecting pharmaceutical formulations, W. Wischke &amp; Schwendeman, 2008, Int. j. Pharm

327 298: 364, and 1-18: 282. Friberg &amp; Zhu, 2004, Int. j. Pharm, which explains the preparation and use of a microsphere (a fine particle).

Additional examples of continuous release formulations include semi-permeable polymer containers in the form of curd products, for example, chips or microcapsules. Can include

20 Continuous release containers on polyester, water-gel or poly-lactide materials (patent

۵

ΜΑ 33142Β1

American No. 3,773,919 European Patent RNM 481 058 0 (or co-polymers of L-Glutamic acid and Gamma-ESL-L-Glutamate (Sidmanetal., 1983, Biopolymers 56-547: 22) or poly (2-hydroxyethyl-methyl acrylate)). L. Langer, 1981,. Langer et ai 277-167: 15. Biomed. Mater. Res and 105-98: 12. Langer, 1982, Chem. Tech) OR

5 Ethylene-phenyl acetate (Langer et al. Former) or poly-3 - (-) D-hydroxybutyric acid (European Patent No. 988 133 0). The continuous release formulations may also include liposomes, which may be prepared by any of several known methods in preparation. See, for example, Epstein et al., 1985, Proc 92 -3688: 82. Acad. Sci. USA; And European patents numbers 0 036 676, and 0 088

10 046, and 949 143 0

A pharmaceutical formula for FGF21 polypeptide to be used for in vivo administration should typically be sterile. This can be accomplished by atomization through aseptic leaching membranes. While the composition is lyophilized, sterilization can be carried out using this method either before, or after, dehydration and reforming. maybe

15th The composition is stored for non-enteral administration in lyophilized form or in solution. In addition, formulations for intestinal administration are generally placed in a container with a sterile access port, for example, a sachet or vial of a pink solution with a stopper that can be perforated with a hypodermic needle.

Once the pharmaceutical formula has been formulated, it can be stored in sterile vials

20 In the form of a solution, suspension, gel, emulsion, solid, or powder form

The water was horrified or methydrated. Such formulas may be stored either in ready-made form

ΜΑ 33142Β1

For use or in form (eg, freeze-dried) you need to reconstitute before administration.

In a specific embodiment, the present invention is directed to groups to produce a single dose administration unit. Each of the kits can contain both a first container of protein powder pods

5 And a second container with a water dispenser. Also included within the scope of the present invention are sets containing injectors filled with single-chamber and multi-chamber remaining filled (for example, liquid melt injectors and injectors).

MOV The effective amount of a pharmaceutical formulation of mutagen polypeptide FGF21 to be used therapeutically depends, for example, on the context and therapeutic goals. Will realize

10 A person skilled in Anjal suggests that appropriate dose levels for treatment will thus change depending, in part, on the conducting molecule and the indications for which the mutant FGF21 polypeptide is used,

The course of administration, the meat (body weight, surface of the body, or the size of the organ) and the condition (Ash and general health) of the patient. Accordingly, the attending physician may titrate the dose and adjust the course of administration to obtain the ideal therapeutic effect. A typical dose can range from about

15th 0.1 μg / kg to up to 100 μg / kg or more, depending on

The factors referred to before. In other embodiments, the dose can range from 0.1 μg / kg / lmph to up to approximately 100 μg / kgm. Or 1 μg / kg to about 100 μg / kg; Or 5 μg LME to about 10 μg / kg; Or 15 μg / kg to about 20 μg / kg;

20 Or 25 μg / kg to approximately 30 μg / kg; Or 35 μs

G / lm to approximately 40 μg / lm; Or 45 μg LME to

No

-609Α2Β9 &lt;? 1 6

Up to about 50 μg LME; Or 55 μg / kg to about 60

Micrograms / LMOs; Or 65 μg / lm to approximately 70 μg / lm.

Or 75 μg / kg to about 100 μg / kg, and in other embodiments

Also, the dose may be 50 μg / kg, 100 μg / kg, or

5 150 μg / lmph or 200 μg / lmph or 250 μg lmph or

300 G / LME, 350 ميG / LMG, 400G / LMV, 450G / KG, 500G / LMG, 550 550G / KG, 600 600G / LMG, 650G / LMV, or 700 700GM / LMOs or

750 G / kg, 800 g / kg, 850 g / kg, or

10 900 μg / lm or 950 μg / lmph or 100 μg / lmph or

200 G / kg, 300 ميg / kg, or 400 ميg / lm, or

500 Μg / kg, 600 μg / kg, or 700 μg / kg, or

800 G / kgm, 900 g / kg, 1000mcg / kg, 2000 g / kg, 3000mcg / lm, or 4000μg

15th G / kg, 5000 mcg / kg, 6000 mcg / kg, 7000 mcg / kg, 8000 mcg / kg, 9000 mcg / kg, or 10 mg / kg.

The dose frequency will depend on the pharmacokinetic parameters of the FGF21 polypeptide in the array being administered. Typically, the formula will be supervised by a physician

20 Until a dose is reached that achieves the desired effect. This can be covered up

The formula is a single dose or two or more doses (which may or may not contain

ΜΑ 33142Β1

Contain the same amount of desired molecule) over time, or as a continuous impregnation via an infusion or streaking medium. Additional checks for proper dosage are routinely performed by normal skilled people immediately and within the scope of tasks routinely performed by them.

Appropriate dosing can be confirmed using appropriate dose response data.

5 The course of administration of the pharmaceutical composition shall be according to known methods, for example, by cloudiness; Or through injection by intravenous, intraperitoneal, intracerebral (intravenous) intracerebral (intravenous) cerebral ventricle, intramuscular, eye, artery, or injury; Or by continuous release systems (which may also be injection); Or by means of implantation. When desired, the formulations can be administered by bolus or injection

10 Continuous impregnation, or implantation.

Alternatively or additionally, the composition may be administered topically by implanting a membrane, a leach, or other suitable substance on which the desired molecule may be absorbed or inhibited.

When an implantation method is used, the device can be implanted into any suitable tissue or organ, and the desired molecule delivery can be by diffusion, or by a release bolus.

15th Timed, or continuous giving.

10- Therapeutic uses of FGF21 polypeptide mutagen

FGF21 polypeptide mutans may be used to treat, diagnose, mitigate or treat a number of diseases, disorders or conditions, including, but not limited to, metabolic disorders. In one embodiment, the desired metabolic disturbance is

20 Its treatment is macular disease, for example, type 2 diabetes. In another embodiment,

No 2

ΜΑ 33142Β1

A metabolic disorder is obesity. Other examples include metabolic conditions or abnormalities such as hypolemia; High blood pressure; A liver transfusion such as non-alcoholic hepatitis nystitis (NASH); And a cardiovascular disease, such as atheroma sclerosis;

And aging.

5 On request, a disorder or condition such as diabetes or obesity may be treated by administering the FGF21 polypeptide flare as described in this application to a patient who needs it in the amount of a therapeutically effective dose. The administration can be performed as described herein, such as an IV injection, an intraperitoneal injection, an intramuscular injection, or a cloudy injection in the form of a liquid or a compost. In most cases, a desired dose may be given

10 By an attending physician, as explained herein, may represent a therapeutically effective dose of FGF21 polypeptide flare. It will be immediately apparent to the skilled that a therapeutically effective dose of FGF21 polypeptide will depend, among other things, on the administration schedule and dose unit of the antigen antigen, whether the nucleic acid or polypeptide molecule is administered in combination with other therapeutic agents and the immune status And health

15th the future. The term therapeutically effective dose as used herein means that the amount of polypeptide of FGF21 flare that induces a biological or pharmacological response in a human, animal, or animal system is believed by a researcher, attending physician, or other practitioner, which includes dilution Symptoms of the disease or disorder being treated.

11 - Anti-clamps

20 Antibodies and antigen fragments are expected which bind specifically to a mutant polypeptide

0(

ΜΑ 33142Β1

FGF21 of the present invention but not specifically bound to a wild-type FGF21 antipeptide polypeptides within the scope of the present invention. The antibodies can be polyclonal, including monoclonal polymerases; Monoclonal (MAbs); The product of a return to genetic recombination Chimeric; And humanized, such as inlaid with a complementary determining region (CDR);

5 And human; And chain tread; / Or binomial identification; And also fragments; Or various shapes; Or chemically modified molecules thereof. Antigm fragments include those portions of the antibody that specifically bind the adhesive tip to the FGF21 mutant polypeptide. Examples of such fragments include F (ab ') j Fab fragments generated by enzymatic cleavage of full-length antibodies.

Other ligation fragments include those generated by recombinant DNA technology

10 Gene expression, such as recombinant plasmids, contain nucleic acid sequences encoding a variant of antibody expression.

Multiple platelet antibodies directed to a mutant polypeptide FGF21 are generically produced in animals (eg, rabbits or mice) by subcutaneous or intraperitoneal multiple injection of FGF21 mutant polypeptide and an adjuvant. It can be helpful

15th A mutant polypeptide FGF21 is associated with a carrier protein that is a lost generator in the species to be immunized, such as wild hemocyanin, MMR, albumin, or bovine thyroid globulin, soybean trypsin inhibitor. Also, transactional agents like SHB are used to boost the immune response. After vaccination, the animals are bled and the serum is evaluated for a mutant antibody titre FGF21.

20 Monoclonal antibodies directed to a mutant polypeptide FGF21 are produced using

Any method that provides the production of antigm particles by continuous cell lines

No

9Α2Β9 &lt;? 1 6

-64-

Farm. Examples of suitable methods for preparing monoclonal antibodies include the hybridoma methods D 97-495: 256 Kohler et al., 1975, Nature, and the human-cell hybridoma method (3001: 133. Kohler, 1984, J. Immunol; Brodeur et al. Monoclonal Antibody (1987, Productio Techniques and Application 51-63 (Marcel Dekker, Inc.)

5 Also provided by the invention are hybridoma cell strains that produce monoclonal antibodies interacting with a mutant FGF21 polypeptide.

The monoclonal antibodies of the invention can be modified for use as therapeutic agents.

In one embodiment, the monoclonal antibody is a filamentous antibody g in which a heavy (H) and / or light (L) chain portion is identical with or homologous to

10 Corresponding sequence in antibodies derived from a specific species or belonging to a class or subclass of a particular antibody, while the remainder of the chain (s) is identical with or homologous to a corresponding sequence in antibodies derived from other species or belongs to a class or subclass of an antibody Another counter. The inclusion also forms fragments of such antibodies, as long as they ablate the desired biological activity. See, for example, US Patent No.

15th 4,816,567; 55-6851: 81. Morrison et al., 1985, Proc. Natl. Acad. Sci. USA

In another embodiment, the monoclonal antibody of the invention is a humanized antibody. Methods for compatibility with humans for non-human antibodies are known in Anjal. See, for example, U.S. Patent Nos. 5,585,089 and 5,693,762. In general, a humanized antibody has a building block of one or more amino acids

20 Inserted into it from a source that is not human. Human beings can be reconciled, for example

For example, using the methods described in Anjal (see, for example, Jones et al., 1986)

ΜΑ 33142Β1

25 -522: 321 Nature; 27-323: 332, 1998, Riechmann et al. , 1988, Verhoeyen et al. 36-1534: 239 Science), by substituting at least part of a rodent supplemental identification region for regions corresponding to a human leaving body.

The human antibody that binds to mutant 5 FGF21 polypeptides is also included in the present invention. And by using genetically modified animals (such as mice) that are capable

On the production of technical repertoire of human antibodies in the absence of endogenous immunoglobulin production, those antibodies are produced by immunization to the mutagen FGF21 (which, for example, has at least 6 contact amino acids), optionally coupled with a carrier. For example: 90 Jakobovits et al., 1993, Proc. Natl. Acad. Sci. USA

10 2551-55; Jakobovits et al., 1993, Nature 362: 255-58; Bruggermann et al., 1993, Year in

33 7. Immuno: In one race, these transgenic animals are produced by disrupting endogenous sites that permeate heavy and light immune globulin chains, and by inserting the sites that encode human proteins for heavy and light God into the gene set of a region. They are then hybrids of partially modified animals, such as animals whose search is less than complete

15th For modifications to obtain an animal that contains all the required immune system modifications. When given an immunogen, these mutated animals produce antibodies. Amino acid sequences (unlike their mouse colic for example) include the variable regions that are the specifics of immunity to the said antigens. For example, the International Circular for International Patent Applications No. 96/33735 WO and No. 94/02602 WO. Additional methods are described in the US patent

20 No. 5.545.807, International Patent Application Bulletin No. 10741/10741 WO and WO No.

90/04036, and in EP No. 073 546 0. Human antibodies can also be produced

٩

MA

-66-

By expression p-DNA of recombinant DNA in family cells, or by expression in hybridoma cells, as this is described here.

In an alternative embodiment, human antibodies may also be produced from groups showing phage cells (see, for example, Hoogenboom et al., 1991, j. Mol. Biol. 227: 381; Marks et al.

5 581: 222. 1991, Mol. Biol). These processes mimic the immune selection by displaying

Rich ammunition of antigen on the surface of bacteriophage filamentous viruses and subsequent selection of phage cell by association with available antigen. One such technique is described in WO Bulletin No. 99/10494 describing the isolation of functional and highly affective priming antibodies to MPL- and MSK receptors using this method.

10 Normally, CDR-grafted chimeric antibodies that are compatible with humans are produced by recombinant recombination methods. Antibody dilute nucleic acids are introduced into host cells and expressed using the materials and procedures described here. In one embodiment, antibodies are produced in cells of a mammalian family, such as CHO cells. Monoclonal antibodies (for example, blister) can be produced by expressing the recombinant DNA.

15th Gene expression in cells of a family or expression in hybridoma cells as described here.

The mutant anti-FGF21 antibody of the invention can be used in any known test method, such as competitive association tests, direct and indirect intercalation experiments, and immunosuppression experiments (see, for example, Sola, Monoclonal Antibodies: A Manual of Techniques (1987-147-158). (CRC Press. Inc), which is replete with the Avar;

blood

ΜΑ 33142Β1

And quantification of FGF21 mutant polypeptides. The polypeptide antibody binds the mutant FGF21 to languages ​​that are precipitated for the experiment method being used.

For diagnostic uses, in certain embodiments, the mutant anti-D FGF21 antibody may be numbered with a detectable portion. The detectable part can be any part

5 It is able to produce a signal that is capable of being condensed, whether that is ana For example, the detectable part could be a radioisotope, such as Lau, G ',? 32, U 35, or²⁵1 A, TC, 001Ιη, 5Ga, or fluorescent compound or chemical meanings, such as fluorescent colored isothiocyanate, rhodamine, or leosphyrin, or enzyme such as alkaline phosphatase, β-galactosidase, or horse stallion pyroxidase (-138: 184 Bayer et al. , 1990, Meth. Enz

10 63).

Competitive binding experiments rely on the ability of the numbered standard (such as FGF21 mutant polypeptide or part of it to be immunoreactive) to compete with the substance being analyzed for the test sample (such as FGF21 mutant polypeptide) to bind with a specified amount of the mutant antibody to FGF21. The amount of FGF21 mutant polypeptide in the test sample is inversely proportional to the standard amount that becomes bound

15th With antibodies. To facilitate the determination of the standard amount that becomes bound, the antibody is usually not dissolved before or after the antisepsis, so that the standard substance that is being crystallized is bound with the antibodies that can be conveniently separated from the standard substance that is analyzed which remains unrelated.

Intercalation experiments usually involve the use of two opposites, each of which is able to connect

20 With a different immunogen fraction or adhesive top for the protein to be adsorbed or quantified.

<img file="MA33142B1_D0007.tif" />

-689Α2Β9 &lt;? 1 6

In an intercalation experiment, the substance being analyzed is usually attached to the test sample by a first antigen assembly that is fixed to a solid carrier and then a second antigen bonding to the substance being analyzed, thus forming an insoluble complex of three parts. See, for example, US Patent 4,376,110. The second antibody itself can be numbered with a detectable fraction

5 (Direct intercalation experiments) or may be measured with an immunoglobulin-resistant antibody numbered with a detectable fraction (indirect intercalation experiments). For example, one type of intercalation experiment is the ELISA-linked immunosorbent assay (ELISA) experiment, in which case the detectable portion is an enzyme.

Mutagenic antibody to FGF21 is also useful for in vivo imaging.

10 An antibody numbered in a fraction detectable to an animal may be administered, preferably into the bloodstream,

The presence and location of the numbering antibody in the host being tested. The antibody can be numbered in any detectable part of the animal, whether by nuclear magnetic resonance, x-rays, or by another detection method known in the future.

The FGF21 hoop antibody of the invention can be used as treatments. These 15 therapeutic agents are generally antagonists or antagonists, whereby AVA is either enhanced or diluted for Ali

Consecutive one of at least one of the biological activities of FGF21 was inhibited polypeptide. In one embodiment, the antibodies of the antibody of the invention are antibodies or binding fragments that are capable of binding specifically to an FGF21 fly-in polypeptide. It is able to inhibit or eliminate the functional activity of FGF21 polypeptide mutant in a live cache or in vitro.

20 In some embodiments, the antibody inhibits the functional activity of FGF21 polypeptide by at least 50%, preferably by at least 80%. In another embodiment, it is

ΜΑ 33142Β1

The mutant anti-FGF21 antibody is able to interfere with the interaction between the FGF21 mutant polypeptide and the FGF receptor and thereby inhibit or eliminate the activity of the FGF21 mutant polypeptide in the laboratory or in the organism. The antibacterial mutant against FGF21 of the antagonist is identified by filtering experiments that are well known in this degeneration.

5 The invention also relates, together with a set that includes FGF21 mutant antibody and other agents useful in detecting levels of FGF21 mutant polypeptide in biological samples. These factors may include a detectable stinger, agglomerate serum, positive and negative comparison samples, and detection agents.

The pickle:

10 The examples that follow are illustrative of specific examples of the invention and its various uses. They are listed for illustrative purposes only and should in no way be construed as a limitation to the invention.

Mughal (1):

Prepare FGF21-expressing components:

The DNA sequence encoding the functional FGF21 polypeptide was obtained by amplifying the 15 polymerase chain reaction (PCR) using primers containing the corresponding nucleotide sequences.

Peripheral; n for the mature FGF21 sequence. Table (2) includes the initiators that were used to amplify the mature FGF21 sequence.

Table (2):

H

ΜΑ 33142Β1

PCR primers for FGF21 component preparation

<td>Sequential identity number</td><td>Sequence</td><td>The initiator</td>

<td> 5</td><td>5 -AGGAGGAATAACATATGCATCCAATTCCAGATTCTTCTCC-3 '</td><td>In the direction of copying</td>

<td> 6</td><td></td><td>Anti-trend Transcription</td>

The precursors were used to prepare bound endonuclease enzyme loci including the FGF21 expression component of the directional smelting of the sequence to a suitable expression vector (eg Novagen / EMD) 30 Biosciences; San Diego, CA) or Amgen; Thousand Oaks, CA (pAMG33). It contains the expression vector

5 PAMG33 contains a low copy number R.-1OO of clonal origin, modified lac enhancer, and a kanamycin resistance gene. The 30 expression vector has a pBR322-derived parent for transcription,

And 7 inducible promoter, kanamycin resistance gene. While the expression of pAMG33 was found to be higher, 30 was found to be a reliable cloning vector. Thus, most of the components mentioned in the present use were first generated at 30 and were subsequently selected

10 Effectively. The selected sequences were then transferred to PAMG33 for enlargement as well.

The FGF21 sequence was maximized in a reaction mixture containing 40.65 μl HO, 5 μl PfilUltra II reaction buffer 10 times), 1.25 μl dNTP mixture (40 mMol-4 x 10 mmol), and 0.1 μl stack (100 nm). /

Ml), 1 μl primer 1 (10 μmol), and 1 μl primer 2 (10

15th Molar), and 1 l (PfiUtra II fusion HS DNA (Stratagene; La Jolla, CA). The amplification reactions were performed by heating for 2 minutes at 95 ° C;

Followed by 10 turns at 95m for 20 seconds, and 60m for 20 seconds (with 1m subtracting

ΜΑ 33142Β1

Additional for each cycle), and 72m for 15 seconds / kilobase of the required product, followed by 20 cycles at 94 meters for 20 seconds, 55 meters for 20 seconds, 72 meters for 15 seconds, and 55 meters for 20 seconds, And 72m for 15 seconds / kg of driving 5 from the 2h1 for required, followed by 72m for 3 minutes. The amplification products were digested with endonuclease restriction enzymes

5 Dpnl, Ndel, and EcoRJ, were linked into a suitable vector and then converted into competitor cells.

Example (2):

Purification of FGF21 proteins from bacteria:

In the following examples, several FGF21 proteins have been expressed, including the raw-type FGF21 polypeptide, the truncated FGF21 polypeptides, and the FGF21 fusion proteins in the expression system.

10 Bacterial. Following expression, which is described hereafter, the FGF21 proteins were purified as described in this example, unless otherwise indicated.

To purify raw-type FGF21 polypeptides, amputated FGF21 polypeptides, and FGF21 mutants from bacterial containment bodies, washed containment bodies (DWlBs) were dissolved twice in buffer dissolving solution containing guanidine hydrochloride and DTT in Tris buffer and mixed

15th Then for an hour at room temperature, the dissolution mixture was added to the regenerated solution, which contained urea, arginine, and cysteamine at pH 9.5, and then mixed for 24 hours at 5 ° C (see, for example, Clake).

1998, Curr. Opin. Biotechnol. 9: 157-63; Mannall et al., 2007, Biotechnol. Bioeng. 97: 1523-34; Rudolph

et al., 1997, Folding proteins, Protein Function: A Practical Approach (Creighton, ed., New York, IRL 20 1-6: 42 .. (Press) 57-99; and Ishibashi et «7. 2005, Protein Expr. . Purif

M.

ΜΑ 33142Β1

-٦٦-

After thawing and re-duplication, the mixture was atomized through a 0.45 micron filter. The re-duplex solution was then concentrated approximately 10 times using 10 kDa as the molecular weight of Pal, Omega tape separated by cuttings at a TMP of 20 psi, and was ultrafiltrated using 3 column sizes of 20 mmM.

5 Tris, with a pH of 8 at a TMP of 20 psi.

The purified sample was then subjected to anion exchange chromatography (AEX) using Q Sepharose HP and a linear saline scale was run from as small as 250 mM NaCI in 20 mM Tris at pH 8 at 5 M0 and the apex fragments were analyzed with -SDS. PAGE and compile.

10 The agglutination of the AEX filter was then subjected to a hydrophobic reaction chromatography (HIC) using HP phenylsigarose resin. The protein was filtered using a linear gradient reduced from 0.7 molar to as small a molar ammonium sulfate at pH 8 and a buffer temperature. The apex fractions were analyzed using SDS-PAGE-227: 680- (1970, Laemmli 85) and pooled.

15th HIC tolerance was concentrated using 10 kDa of a molecular weight of 0.2 Pall Omega-m² strip separated by pieces to 7 mg / mL at a TMP of 20 psi. The concentration product was ultrafiltrated using 5 column volumes of 10 mM ΚΡΟ4, and 5 ha of sorbitol, with a pH of 8 at a TMP of 20 psi, and the extracted concentration was diluted to 5 mg / mL. Finally, solutions were filtered through a Pall mini-Kleenpac 0.2 20 posidine membrane

ΜΑ 33142Β1

To purify the fusion proteins FGF21 and the fusion mutant proteins FGF21 from bacterial embedding bodies, twice washed embedding bodies (DWIBs) were dissolved in a buffer dissolving solution containing guanidine hydrochloride and DTT in Tris buffer buffer at pH 8.5 and then mixed for 1 hour at room temperature The dissolution mixture was added to the solution

5 Re-regulate agglutinin containing urea, arginine, cysteine, and cysteine ​​hydrochloride at pH 9.5 and then mix it for 24 hours at 5 pm (see, for example,

Clarke, 1998, Curr. Opin. Biotechnol. 9: 157-63; Mannall et al., 2007, Biotechnol. Bioeng. 97: 1523-34;

Rudolph et al., 1997, Folding proteins, Protein Function: A Practical Approach (Creighton, ed., New. (York, IRL Press) 57-99; and Ishibashi et al, 2005, Protein Expr. Purif. 42: 1- 6

10 After dissolution and recombination, membrane separation of the mixture was performed for 5 volumes of 20 mM ™, with pH 8, using 10 kDa membrane separation tubes. The pH was adjusted by membrane separation to 5 with 50% acetic acid, and then purified by centrifugation for 30 minutes at 4 kg.

The purified sample was then subjected to ion exchange chromatography (AEX) using resin

15th HP syngarose Q. A linear saline scale was run from a falcon to 250 mM NaCl in 20 mM Tris at pH 8 at 5 M. The apex fractions were analyzed and aggregated by SSDS Laemmli, 1970, Miwre 227: 680-85 (PAGE).

Then the combination of the AEX filter was subjected to a lacquer and a hydrophobic reaction matograph (HIC) using HP phenylsigarose resin. The protein was then filtered using a linear decreasing gradient.

66942.9

From 0.6 molar to small molar ammonium sulfate at pH 8 and high temperature. The apex fractions were analyzed with SDS-PAGE and collected.

After the HIC step, agglutination membranes were then separated for 60 volumes of 10 mM Tris, 2.2% macrosome, and 3.3% sorbitol, with a pH of 8.5. Was focus

5 The assembly for which membranous separation was performed up to 5 mg / mL using jumbosub. Finally, the solution was filtered through a 0.2 μmolar Pallmini-Kleenpac posidine.

Mughal (3)

Preparation and expression of amputated FGF21 proteins:

The components encoded for the truncated FGF2 proteins listed in Table (3) were prepared by PCR amplification of 10 PCR of the fusion type FGF21 expression vector as described hereinafter.

For the raw-type FGF21 expression vector in Example 1).

Table (3)

Cut-outs FGF21

<td>Amputated Building Units *</td><td>The structural craters of the toothpaste</td>

<td colspan="2">Terminal Sections -C</td>

<td> 1</td><td> 180-1</td>

<td> 2</td><td> 179-1</td>

<td> 3</td><td> 178-1</td>

<td> 4</td><td> 177-1</td>

<td> 5</td><td> 176-1</td>

<td> 6</td><td> 175-1</td>

<td> 7</td><td> 174-1</td>

<td> 8</td><td> 173-1</td>

<td> 9</td><td> 172-1</td>

<td> 10</td><td> 171-1</td>

<td> 12</td><td> 169-1</td>

<td> 13</td><td> 168-1</td>

<td> 14</td><td> 167-1</td>

<td> 15</td><td> 166-1</td>

Sleep

ΜΑ 33142Β1

<td> 16</td><td> 165-1</td>

<td> 17</td><td> 164-1</td>

<td> 21</td><td> 160-1</td>

<td> 25</td><td> 156-1</td>

<td> 29</td><td> 157-1</td>

<td> 32</td><td> 149-1</td>

<td> 68</td><td> 113-1</td>

<td colspan="2">N-terminal bends</td>

<td> 1</td><td> 181-2</td>

<td> 2</td><td> 181-3</td>

<td> 3</td><td> 181-4</td>

<td> 4</td><td> 181-5</td>

<td> -</td><td> 181-6</td>

<td> 6</td><td> 181-7</td>

<td> 7</td><td> 181-8</td>

<td> 8</td><td> 181-9</td>

<td colspan="2">Ν-jC. Terminal Bends</td>

<td> 11</td><td> 174-5</td>

<td> 17</td><td>9-66l</td>

<td> 20</td><td> 169-9</td>

<td> 40</td><td> 149-9</td>

<td> 26</td><td> 169-15</td>

<td> 46</td><td> 149-15</td>

<td> 82</td><td> 113-15</td>

* For FGF21 exudative polypeptides.

The amputated FGF21 protein components were prepared using prefixes containing the sequences that are identical to the regions before and after the codon (or codons) that are detected (resulting in the cut), and the prefixes used in the said amplification reactions provide approximately 15 nucleotides.

5 The interference sequence to allow recirculation of the amplified product, i.e. the complete carrier that currently contains the desired mutant.

The representative truncated FGF21 component, which encodes the FGF21 protein lacking the peptide building block at position -1 of the mature FGF21 sequence (i.e. the segment mutant 2- 181), was prepared using the prefixes shown in Table (4).

10 Table (4)

<img file="MA33142B1_D0008.tif" />

PCR primers for assaying the supernatant FGF21 primitive plots

ΜΑ 33142Β1

<td>Sequential identity number</td><td>Sequence</td><td>Start</td>

<td> 7</td><td>-GGAGATATACATATGCCAATTCCAGATTCTTCTCCATTATT-3 '</td><td>In the direction of copying</td>

<td> 8</td><td>-CATATGTATATCTCCTTCTTAAAGTTAAACAAAA3</td><td>Leaving to the direction of palm</td>

The prefixes shown in Table (4) allow for the detection of the histidine structural unit as shown below, where the upper sequence (sequence identity number: 10) is part of an exudative FGF21 polypeptide containing N-terminal methionine, and the second sequence is the initiator of the direction of transcription (sequence identity Number: 7), and the third and fourth sequences (Sequences Hobbies: 11 and 12) are parts

5 For components expressing FGF21, the material sequence is an anti-transcriptional initiator (streak identity

RTM: 9):

5'-GGAGATATACATATG-- -CCAATTCCAGATTCTTCTCCATTATT

<img file="MA33142B1_D0009.tif" />

The amputated FGF21 protein components were prepared using negative PCR conditions in Example (1). The amplification products were digested with the endogenous nilcase restriction enzyme, Dpnl, and then transformed into competition cells. The resulting bulges were sequenced to confirm that there were no errors generated

15th From the enzyme polymerase.

Amputated FGF21 proteins were expressed by competitive BL21 transformation (DE3) or BL21 Star cells (nitrogen; Carlsbad, CA) using the FGF21-coding component of a specific truncated protein. Factors were done

-119Α2Β9 &lt;? 1 6

Overnight switching using limited ID in complementary TB media using 40 μg /

Ml kanamycin, was filtered to an identity the next morning, and after a short extraction period, it was induced in 0.4 mM IPTG. The FGF21 mutants were harvested by centrifugation 18-20 hr after induction.

5 Shawl (4)

In vitro activity of amputated FGF21 proteins

Experiments to identify truncated FGF21 proteins that block the activity of crude FGF21 in ELK-leucigrase were performed in an in vitro experiment. Table (5) summarizes the results obtained for FGF21 proteins that contain cuts at the N-terminal and the-C-terminus or at

10 Both the N-terminal and the C-terminal. The ELK-leiase assays were performed using a human recombinant 293Τ-cell system in which the 293Τ cells overexpressed the klotho betas and leiomegrase enzyme messenger components. These components also contain the coded sequences GAL4-ELK1 and 5xüAS-Luc, and a promoter-driven leucegrase enzyme transmitter containing five tandem copies of the 0Gal4 binding site. Beta-ktho is a mutated receptor.

15th FGF21 is required to activate its FGF receptor and induce signal transduction within the cell, which in turn leads to the Erk and ELK strand. The activity of the enzyme leucigrase is regulated by the level of the phosphorylated ErkAELK, and it is used in the indirect activity of monitoring and quantifying FGF21.

The ELK-leucigrase experiments were performed by culturing cells-293 ​​in the presence of different concentrations of Burley

20 Raw type FGF21 or FGF21 fresh peptide for 6 hours and post-test cell lysis products

ΜΑ 33142Β1

This is to find out the effectiveness of the enzyme leucigrase. Figures from (1AA) show the results of an ELK-leucegrase efficacy trial conducted on the amputated mutants 181-7 (FGF21) and (8- 181).

(Figure 1A) and the amputated helicopters 172 -1) FGF21), (1- 171), (1- 169) and (1- 164) (in AB format). The fluorescence obtained in Fig. 2 is illustrated

5 ELK-Leucigrase experiments for both truncates 181 -3 (FGF21) and (4- 181)

(5- 181), (8- 181), (1- 180), (1- 178), (1- 177) and (A.

176), (1- 175), (1-174), (1--173), (1- 172), (9-181) and (149-1).

The FGF21 mutant polypeptides were compared with FGF21 of the crude type as a measurement and spins showing 10 at least 50% of the activity of FGF21 of the crude type which then considered as not containing

The efficacy of FGF21 is missing and an NML + was determined in Table (5).

Table (5)

Amputated FGF21 proteins: a laboratory experiment

<td colspan="3">Terminal cuts - C</td>

<td></td><td>Negative</td><td>Lebanese units of the Abi Saffa</td>

<td></td><td> %93.2</td><td> 180-1</td>

<td></td><td> ٠/٠95.0</td><td> 178-1</td>

<td>B</td><td> %112.0</td><td> 177.1</td>

<td> +</td><td> %104.8</td><td> 176-1</td>

<td>a</td><td> %104.6</td><td> 174-1</td>

<td>t</td><td> %96.1</td><td> 173-1</td>

<td>a</td><td> %97.5</td><td> 172-1</td>

<td>a</td><td> %113.0</td><td> 171-1</td>

<td> +</td><td> %84.9</td><td> 169-1</td>

<td> -</td><td> %20</td><td> 167-1</td>

<td> -</td><td>5 / ο20</td><td> 166-1</td>

<td> -</td><td> %10</td><td> 165-1</td>

<td colspan="3">Terminal Sections -N</td>

<td>Aat (♦ / -)</td><td>Amulet</td><td>The building units of the Albanian Safi</td>

<td> +</td><td> %112.5</td><td> 181-2</td>

<td>t</td><td> %130.3</td><td> 181-3</td>

<td> ٠</td><td> %117.0</td><td> 181-4</td>

<td>a</td><td> %119.6</td><td> 181-5</td>

٩

-799Α2Β9 &lt;? 1 6

<td> +</td><td></td><td> 181-7</td>

<td> -</td><td>0 / ο24.9</td><td> 181-8</td>

<td> -</td><td> %12.5</td><td> 181-9</td>

The results presented in Table (5) fully show that the manifestations of c-c and 14 or more of the amino acid building blocks (such as the amputated FGF21 protein of the C-terminal unit consists of the amino acid (1-167) and shorter proteins) effectively The FGF21. In addition, Table (5) shows that the features of the Khin for the N-terminal are of seven or

5 More than the amino acid building blocks (such as the amputated FGF21 protein at N-terminal which is made up of the amino acid building blocks (8-181) and shorter proteins) eliminate the activity of FGF21. Unsurprisingly, it was found that amputated FGF21 proteins having both N-terminal amputations of 8 to 14 building blocks and terminal amputation of D-12 or 32 building blocks were found to be ineffective in the ELK-leucigerase experiments.

10 Consistent with the data presented in Table (5), amputated FGF21 polypeptides having N-terminal cutoffs of less than 7 amino acid residues form embodiments of the present invention. Similarly, amputated FGF21 polypeptides having C-terminal segments of less than 13 amino acid residues form embodiments of the present invention.

Mughal (5):

15th Effectiveness in the laboratory for amputated SAT ^ 21:

FGF21 has a number of biological activities that include the ability to lower levels of blood glucose, oleander, thalglyceride, or cholesterol, and reduce body weight or improve glucose tolerance, energy intake, or insulin sensitivity. Urine was also analyzed

'٩

ΜΑ 33142Β1

Amputated FGF21 peptides To find out the efficacy of FGF21 in the organism, by introducing amputated FGF21 polypeptides into insulin-resistant ob / ob mice, and measuring the ability of a specific amputated FGF21 polypeptide to lower blood glucose. The amputated FGF21 polypeptide being tested was injected into the peritoneum in an 8-week-old ob / ob mouse (Jackson Lab), and blood samples were obtained at

5 Various time points after a single injection, such as small, 6, 24, 72, 120 and 168 hours post-injection. Blood glucose levels were measured using a OneTouch glucose meter (LifeScan, Inc. Milpitas, CA), and the results were expressed as a percentage of blood glucose in the blood relative to the baseline level of glucose in the blood (i.e., at a young age).

And in figure (3), the results of one of the battles that show the amount of glucose in the discovered blood are provided

10 In rats Iggonae with mutants (8-181) and (9-181) truncated for FGF21. This experiment showed that the amputated FGF21 laminate proteins that contain (8-181) an amino acid building block that cleaves glucose in the blood which dilutes the activity in live cache, however, the activity is slightly lower than that of FGF21, the raw type at 3 and 6 hours after Injection, but the truncated FGF21 fusion proteins containing 9-181) metastases

15th Amino fools do not have this effect. Thus, the in vivo analysis of the amputated FGF21 polypeptides showed that the alkhene of about 7 amino acids from the N-terminal L-terminal FGF21 exudate does not erase the biological activity of the molecule (in contrast to the in vitro analysis, which assumed that the alkene of the seven amino acids from the N-terminal of the FGF21 exudate does not erase the biological activity of the molecule. It can deactivate.

The difference results obtained with amputated FGF21 polypeptides can be explained

20 Specifically, with the -N terminal (such as 8-181 FGF21) in laboratory and live cache experiments

By the interaction of FGF21 with the beta-Klotho and the FGF receptor in the signal transduction velocity velocity - and with bac iron;

ΛΑ2Β9? 6 1

FGF21 activates the double receptor complex that includes the common beta-Klotho receptor and FGFR (FGF) that initiates the signaling sequence that includes the enzyme tyrosine kinase. The -N terminal of FGF21 involved in binding and activating FGFR is indicated while terminal-C and FGF21 are identified as a Klotho 1-Yieetal 2009 FEBSLett. 583: 19

5 at. The enzyme ELK-leucigrase is made in 293 kidney cells in which the co-receptor beta-Klotho is overexpressed and FGFR is expressed at normal levels.

The amount of FGFR is lower than that of the Klotho beta and the beta ratio is -

Klotho to FGFR in the 293 non-physiological cells, which could influence the formation of the receptor complex, ultimately binding of the trabecular assembly and activating the FGFR. It looks like O 293 in

10 The laboratory system is very weak for the N-terminal amputated FGF21 polypeptides and thus can have a loss of activity leading to a few tested custom-N-amputees such as 8-181 FGF21. Consequently, it was determined whether the FGF21 mutant specifically with the N-terminal biased to the FGF21 activity of the raw type, and the efficacy of FGF21 in an in vivo experiment was considered lagged. Accordingly, polypeptides are included in the invention

15th FGF21 amputations that have N-terminal cuts of less than 8 B units of the amino acid.

Mughal (6):

Preparation and expression of amputated FGF21 fusion proteins:

However, the possibility of increasing the protein half-life by adhering the protein with the Fc sequence, was prepared

20 Analysis of the fusion proteins containing the amputated FGF21 polypeptide. Proteins were prepared

٩

ΜΑ 33142Β1

The amputated FGF21 fusion listed in Table (6) of FGF21 sequences amplified by SOEing (Interlink Genetic Splicing) PCR. The FGF21 fusion proteins were prepared so that the Fc part of the human immunoglobulin IgGl gene (sequence ID No. 13) was fused with either the -N or the C-terminal of the FGF21 protein.

5 Table (6)

<td>The link</td><td>Position Fc</td><td>The Building Units of the Amino Fool</td>

<td colspan="3">Terminal Sections -C</td>

<td> 15</td><td>-νη₂</td><td> 178-1</td>

<td> 14</td><td>-NH</td><td> 175-1</td>

<td> 15</td><td>-COOH</td><td> 175-1</td>

<td> 15</td><td>-NH</td><td> 171-1</td>

<td> 15</td><td>-COOH</td><td> 171-1</td>

<td> 15</td><td>-COOH</td><td> 170-1</td>

<td colspan="3">Terminal Sections -N</td>

<td> 15</td><td>-NH</td><td> 181-5</td>

<td> 15</td><td>-COOH</td><td> 181-5</td>

<td> 15</td><td>-NH</td><td> 181-7</td>

<td> 15</td><td>-COOH</td><td> 181-7</td>

<td colspan="3">Terminals -C and Terminal -N</td>

<td> 15</td><td>-NH</td><td> 175-5</td>

<td> 15</td><td>-COOH</td><td>6Ί5-5</td>

<td> 15</td><td>-NH</td><td> 171-5</td>

<td> 15</td><td>-COOH</td><td> 171-5</td>

<td> 15</td><td>-COOH</td><td> 170-6</td>

No

ΜΑ 33142Β1

<td> 35</td><td>-COOH</td><td>19 no</td>

<td> 15</td><td>-NH</td><td>\ Ί5-</td>

<td> 15</td><td>-COOH</td><td>6Ί5-</td>

<td> 35</td><td>-COOH</td><td>6Ί4-</td>

<td> 35</td><td>-COOH</td><td>6Τ1-</td>

<td> 15</td><td>-NH</td><td>\ Ί \ -Ί</td>

<td> 35</td><td>-COOH</td><td> 171-7</td>

<td> 15</td><td>-COOH</td><td>6Ί \ -Ί</td>

Specifically, the components of the FGF21 fusion protein (which includes those that stagnate the amputated FGF21 fusion proteins) were prepared in a series of three amplification reactions, which are essentially used in the reaction conditions mentioned in Example (A) 0 and in the first reaction, and then a pair of primers was designed to produce a sequence containing a locus. Cloning of Ndol and related to Fc and Link streak. And in

5 The second interaction, a pair of prefixes is designed to produce a sequence containing the cross-link portion, the encoded sequence portion, FGF21, and an EcoRI clone site. Finally, in the third reaction, a pair of prefixes was designed by imposing the delivery of the products of the first two reactions. In Table (7) a representative set of prefixes for formation 1-181 FC-FGF21 is listed.

Table (7)

<td>Serial identity number:</td><td>Sequence</td><td>The initiator</td>

<td colspan="3">interaction(!)</td>

<td> 14</td><td>S'-AGGAGGAATAACATATGGACAAAACAACATGJ.</td><td>Copy direction</td>

<td> 15</td><td>5'-GGATCCACCACCACCGCTACCAC-3 '</td><td>Anti-trend Transcription</td>

-849 &amp; ΛΑ2? 6 1

<td colspan="3">Interact (2)</td>

<td> 16</td><td> 3'</td><td>Copy direction</td>

<td> 17</td><td>5'-TAGTGAGCTCGAATTCTTAGGAAGCGTAGCTGG-3 '</td><td>Anti-trend Transcription</td>

<td colspan="3">Interaction (3)</td>

<td> 14</td><td>5AGGAGGAATAACATATGGACAAAACTCACACATG-3 '</td><td>Copy direction</td>

<td> 17</td><td></td><td>Anti-trend Transcription</td>

The final reaction product was digested with restriction enzymes poured into an EcoR ^ Ndel internally bound into the 30 transporter and then transferred to competitive cells. The resulting clones were sequenced to confirm that there were no errors generated by the enzyme polymerase.

Example (7):

5 Alkali in the organism of amputated FGF21 fusion larvae:

Fusion proteins containing the FGF21 sequence combined with the Fc sequence were generated and tested for efficacy in live cache. The FGF21 fusion proteins, amputated, were prepared by flashing the IgGl Fc molecule with either the -N-terminus or the -C-terminus of the amputated FGF21 protein to form a single adjacent sequence. To distinguish between the -N-terminal and -C-terminal fuses, the fusion proteins are engineered

10 FGF21 in which the Fc molecule was fused with the N-terminal primordia of FGF21 protein as_FC-FGF21, and fusion proteins were designed in which the Fc molecule was combined with the C-terminal survivor of the FGF21 protein each FGF21-FC.

And FGF21 has a number of vital activities that include the ability to lower glucose in the body

٩

9 &amp; ΛΑ2? 6 1

Blood, insulin or cholesterol levels, reduce body weight or improve glucose tolerance, energy intake or insulin sensitivity. To assess the effectiveness of FGF21 in the organism,

FGF21 tear polypeptides and FGF21 fusion polypeptides were introduced into insulin resistant ob / ob mice, and the ability of a specific protein FGF21 to lower blood glucose levels was measured.

5 FGF21 polypeptide, FGF21, or FGF21 fusion polypeptide tested in the peritoneum were injected into 8-week-old ob / ob mice (Jackson Labs), and blood samples were obtained at different time points after a single injection, for example a small And 6, 24, 120 and 168 hours after injection. Blood glucose levels were measured. LifeScan, Inc. Milpitas, CA (OneTouch), and reporting of results

10 As the percentage change of blood glucose in relation to the baseline level of glucose in the blood (i.e. when time is small).

The results of one of the experiments are provided in Figure (4) showing the percentage change in blood glucose levels observed in mice that dilute with a PBS comparison sample and a crude-type FC-FGF2 comparison sample containing 1-181 building units for an amino acid or fusion proteins FC-FGF21.

15th Ampules contain 5-181 or 7-181 amino acid residues. This experiment showed that the amputated FC-FGF21 fusion proteins containing 5--181 or 7-181 amino acid residues showed similar blood glucose-lowering activity to that of FC-FGF21 of the crude type at 6 hours post-injection. Thus, the analysis in live cache of FGF21 polypeptides showed that beta until two amino acids from the N-terminal and mature FGF21 did not affect the efficacy.

20 Biological molecule. However, the in vivo analysis also showed that the urinary capacity was reduced

Amputated FGF21 peptides reduce blood glucose and that serum glucose levels

CX

ΜΑ 33142Β1

They returned to baseline at 24 h post-injection (similar results were obtained with raw-type FGF21). It was found that the deficiency in activity in the organism was a result of the halolytic degradation of FGF21 proteins, as this was described in an example (8).

In Figure (5) the results of another experiment are provided showing the percentage change in blood glucose levels of 5 observed in mice injected with the PBS control sample and the FGF21-FC comparison sample of the welding type.

That includes 1-181 amino acid building blocks, an amputated FGF21-FC fusion proin containing 1-175 building blocks or an amputated FC-FGF21 protein containing 1-171 amino acid building units. By blurring this experiment, FGF21-FC of the catalytic form that includes 1-181 amino acid building units has an extended glucose depressant activity that leads to

10 To reduce blood glucose levels by approximately 30 d over a period of 24 hours to 120 hours after injection. The amputated FC-FGF21 protein containing 1,171 amino acid building blocks showed delayed blood glucose-lowering activity that was only apparent at 72 hours after injection. However, the observed efficacy is similar to that of raw-type FGF21-FC. However, the observed efficacy is similar to that of the welded-type FGF21-FC. Nor

15th It is an amputated FGF21-FC fusion protein incorporating 1-175 building blocks active in the organism in lowering blood glucose.

Collectively, the cut experiments mentioned here describe that the amputated FGF21 fusion proteins with N-terminal macula exhibit a blood glucose-lowering effect similar to that of the crude FGF21 fusion protein and also those of the FGF21 fusion proteins.

20 An amputation in which the Fc molecule is combined with the N-terminal protector of the amputated FGF21 protein effectively

The largest of the fusion proteins in which the Fc molecule fuses with the C-terminal mantle of the protein

ΜΑ 33142Β1

FGF21 Amputee.

Example (8):

Salina in the clumping of FGF21 in Calan Brother:

Firstly, the degradation of FGF21 was observed using the components of the fusion protein FGF21 Fc as 5 that was described in Example (7) 0 and the pharmacokinetic analysis in live cache showed that the human FGF21 has

A short half-life of about an hour in mice as a result of rapid clearance and lysis in the organism.

The half-life of FGF21 was thus extended by combining the Fc sequence with the -N or -C terminal term of the polypeptide. However, the fusion of the Fc region does not fully characterize the half-life profile since the fusion proteins in which the Fc sequence were fused with the -N or -C terminus of the polypeptide

10 FGF21 (specifically FC-FGF21 fusions, that is, in which the Fc sequence is combined with the N-terminal of the exudative EGF21, does not show the expected activity in the organism, and instead an insistence on the effectiveness of lowering blood glucose in the blood was found in no more than 24 hours. In 0ob / ob mice as described in Fig. 4, FC-FGF21 fusion proteins lowered blood glucose levels by about 30-40% at 6 hours post-injection.

15th Blood glucose back to baseline levels at 24 hours.

Hence, the proteolytic degradation of the soldered type FGF21 was investigated, and it was found that the rapid loss of activity in live cache using FC-FGF21 fusion proteins results from the degradation of FGF21 in live cache. The proteolytic degradation leads to a reduced biological activity of the molecule in the organism, and consequently to a shorter effective lifetime, and this degradation inversely affects

20 Therapeutic use of that molecule. Accordingly, amphoteric degradation resulted in fusion proteins

9 a

ΜΑ 33142Β1

-88-

FGF21 Fc investigated the proteolytic degradation and FGF21 in live cache and identified the FGF21 mutant that was resistant to this degradation.

To identify lysis sites, LC-MS analysis and addiction sequences were performed on human fusion proteins FGF2 ^ FGF21 Fc obtained at different time points after.

5 Injection into male C57B6 mice. The addiction sequence helped confirm whether the n-terminal or C-terminal term of the protein is subject to lysis. When the Fc sequence was combined with the human FGF21 terminal, the degradation was found to take place at the peptide bond between the amino acid building units 151 and 152 and between the 1-t1 subunit of the amino acid 171 and 172 of the human FGF21 fraction 1 of the fusion molecule (the preceding B-unit numbering is based on the mature FGF21 sequence and not

10 Includes the Fc fraction of the fusion protein). Decomposition at 171-172 was found to occur first, and was followed by decay at 151-152. The degradation at 171-172 appeared as a step limiting rate and plays a role in the half-life of the molecule. And when the Fc sequence was combined with the C-terminal of FGF21, it was found that the degradation occurs at the peptide bond between the 4 and 5 amino acid building blocks and between the 20 and 21 amino acid building blocks. As a result of this fight, it was done

15th Determine that the Fc series has a protective back of the FGF21 portion that is adjacent to the Fc sequence of the degradation. In vivo cache degradation analysis of fusion proteins FC-FGF21 FGF2b of the fusion type was also performed in cynomologues monkeys. These studies confirmed that the fission site of FGF21 at B units 171-172 is the main site of degradation in monkeys and that the denial site of degradation between mice and primates is preserved.

20 Example (9):

ΜΑ 33142Β1

We denote mutants resistant to FGF21:

FGF21 mutants were identified suitable for experimental identification of the FGF21 welded-type sequence positions.

Which are sites of major proteolysis activity and specific amino acid substitutions have been introduced at these sites. The amino acid substitutions were based on maintenance of the FGF21 sequence

5 With other species (as described in Example 8) and biochemical combination of other amino acid building blocks. Table (8) provides a list of the amino acid replacements that have been or may be introduced into FGF21 for the crude type. The numbers of cheek sites in Table (8) matched with the building block position in the mature FGF21 protein, which consists of 181 amino acid building blocks.

٠١

Table (8)

Airport Building Units for FGF21

<td>Mutants</td><td>The original prostitution unit</td><td>The amino acid site</td>

<td>Gin, Ile, Lys</td><td>Arg</td><td> 19</td>

<td>His, Leu, Phe</td><td>Tyr</td><td> 20</td>

<td>Ile, Phe, Tyr, Val</td><td>Leu</td><td> 21</td>

<td>Ile, Phe, Val</td><td>Tyr</td><td> 22</td>

<td>Ala, Arg</td><td>Pro</td><td> 150</td>

<td>Ala, Val</td><td>Gly</td><td> 151</td>

<td>His, Leu, Phe, Val</td><td>Ile</td><td> 152</td>

<td>Ala, Asn, Asp, Cys, Gin, Glu, Pro, Ser</td><td>Gly</td><td> 170</td>

<td>Ala, Arg, Asn, Asp, Cys, Glu, Gin, Gly, His, Lys, Ser, Thr, Trp, Tyr</td><td>Pro</td><td> 171</td>

<td>Leu, Thr</td><td>Ser</td><td> 172</td>

<td>Arg, Glu</td><td>Gin</td><td> 173</td>

ΜΑ 33142Β1

Example (10):

Extend in the object as a directory FGF21-F &lt;J FC-FGF21:

The stability of FGF21 Fc fusion proteins in live cache was determined by injection of a fusion protein.

Blood was drawn from mice at different time points, and serum was analyzed by mass spectrometry

5 Liquid Chromatography (LC-MS). Specifically, mice were injected into the peritoneum! - 10 mg / LME of Fc (5) FGF21 (expressed in Escherichia coli and pure as described in Example 2) or FGF21 (3) Fc (expressed in pure mammalian cells according to the criteria. Standard). Blood was drawn from mice at 6, 24 and 48 hours after injection (Table 9) and collected in pretreated EDTA tubes. Roche Diagnostics and the plasma were separated

10 By centrifugation of the macrophytes at 12000 g for 10 minutes. The affinity of FGF21 was purified from blood using anti-human Fc agarose resin.

Table (9)

FGF21

<td>The wiped blood</td><td>High protein</td><td>the sample</td>

<td>6 hours</td><td>FC-FGF21</td><td>D6</td>

<td>24 hours</td><td>FC-FGF21</td><td>D24</td>

<td>48 hours</td><td>FC-FGF21</td><td>D48</td>

<td>6 hours</td><td>FGF21-FC</td><td>Ε6</td>

<td>24 hours</td><td>FGF21-FC</td><td>Ε24</td>

<td>48 hours</td><td>FGF21-FC</td><td>Ε48</td>

Prior to analysis of the LC-MS purified affinity samples, the FGF21 protein parameters - ^ FC-FGF21 were analyzed.

No

ΜΑ 33142Β1

Fc for reference. The protein parameters were either reduced with TCEP or not. Reduced and non-reduced parameters were analyzed by LC-MS using ACE ciato in a 0.3 mm X 30 cm column with the outflow from the column sprayed into a conventional LCQ ionization mass spectrometer. And where the apocalyptic spectra were convolutions

5 For reduced samples, pure affinity samples were reduced prior to FC-MS analysis.

In Figures (6A-6D), the observed masses of Fc (5) FGF21 reduced, samples D6, 24H, and 48E are indicated. Some of the standard filter products and the sample were subjected to fatigue addiction to confirm the -N terminal to proteins and fragments as identified by LC-. Is done in

10 Table (10) Provide the results of LC-MS analysis for standards and samples.

Table (10)

Results of LC-MS analysis and predicted fragments

<td>The L-N fragment is intact</td><td>Workgroup</td><td>Noticeable major blocks</td><td>FGF21 ment</td>

<td>Yeah</td><td> 414-1</td><td>45,339 TBRN</td><td>Fc (5) FGF21 Standard</td>

<td>Yeah</td><td> 414-1 404-1</td><td>45,338 TBN 44,317 Dalburn</td><td>D6</td>

<td>Yeah</td><td> 404-1</td><td>44.321, hail</td><td>D24</td>

<td>Yeah</td><td> 404-1</td><td>44,327 Dalton 42.356 d 1 lton</td><td>D48</td>

CX

-929Α2Β9 &lt;? 1 6

<td>To uncle</td><td> 410-1 410-1</td><td>46.408 Dalton (Gof Treated) 44.964 Dalton (untreated Glycosyl)</td><td>FGF21 (3) Fc Standard</td>

<td>No</td><td> 410-5 410-5</td><td>45.963 Dalton (M * Gof) 44,516 Dalton (untreated Glycosyl)</td><td>Ε6</td>

<td>No</td><td> 410-5 410-5 410-21</td><td>45.963 d1 lton (^ Gof glycosylate) 44,526 Dalton (untreated Glycosyl) 44.130 Dalton (Gof Treated)</td><td>Ε24</td>

<td>No</td><td> 410-5؟ 410-21 ؟</td><td>45.984 d 1 lton 44,130 Dutton 44.022 Dalton</td><td>Ε48</td>

As shown in Table (10), all samples of pure affinity showed a certain degree of degradation after only 6 hours of spinning. After 24 hours of spin, the main output of Fc-FGF21 was a fragment consisting of the 1-404 amino acid building blocks, which were shown in both D and H samples. However, the main output of FGF21-FC in E samples was

5 A fragment consisting of the 5-410 amino acid building blocks produced for each of the fusion proteins selected, the FGF21 fraction of the fusion protein was liable to degrade significantly more than the Fc fraction of the protein.

ΜΑ 33142Β1

Mughal (11):

Preparation and expression of FGF21 mutants resistant to protonolysis:

The components encoded for the FGF21 torpedo listed in Table (11) were prepared by PCR amplification of the raw-type FGF21 expression vector as described below (the expression vector configuration is described

5 Raw-type FGF21 in Example A) The aim of these experiments was to generate FGF21 torpedoes that are resistant to proteolysis and have longer half-lives.

Table (11)

FGF21 torrents are resistant to protein hydrolysis

<td>Descriptor</td><td>Fc</td><td>Torches</td>

<td></td><td></td><td>R19I</td>

<td> 15</td><td>-COOH</td><td>R19I</td>

<td></td><td></td><td>R19K</td>

<td> 15</td><td>-COOH</td><td>R19K</td>

<td></td><td></td><td>R19Q</td>

<td> 15</td><td>-COOH</td><td>R19Q</td>

<td></td><td></td><td>R19K, Υ20Η</td>

<td> 15</td><td>-COOH</td><td>R19K, Υ20Η</td>

<td></td><td></td><td>R19K, L21I</td>

<td> 15</td><td>-COOH</td><td>R19K) L21I</td>

<td></td><td></td><td>R19K, Υ20Η, L21I</td>

<td> 15</td><td>-COOH</td><td>R19K, Υ20Η, L21I</td>

<td></td><td></td><td>Y20F</td>

<td> 15</td><td>-COOH</td><td>Y20F</td>

<td></td><td></td><td>Υ20Η</td>

<td> 15</td><td>-COOH</td><td>Υ20Η</td>

blood

ΜΑ 33142Β1

<td></td><td></td><td>Y20L</td>

<td> 15</td><td>-COOH</td><td>Y20L</td>

<td></td><td></td><td>20Η, L21I</td>

<td> 15</td><td>-COOH</td><td>20Η, L21I</td>

<td></td><td></td><td>L21I</td>

<td> 15</td><td>-COOH</td><td>L21I</td>

<td></td><td></td><td>L21F</td>

<td> 15</td><td>-COOH</td><td>L21F</td>

<td></td><td></td><td>L21V</td>

<td> 15</td><td>-COOH</td><td>L21V</td>

<td></td><td></td><td>L21Y</td>

<td> 15</td><td>-COOH</td><td>L21Y</td>

<td></td><td></td><td>Y22F</td>

<td> 15</td><td>-COOH</td><td>Y22F</td>

<td></td><td></td><td>Υ22Ι</td>

<td> 15</td><td>-COOH</td><td>Υ22Ι</td>

<td></td><td></td><td>Y22V</td>

<td> 15</td><td>-COOH</td><td>Y22V</td>

<td></td><td></td><td>Ρ150Α</td>

<td> 15</td><td>-NH</td><td>Ρ150Α</td>

<td> 15</td><td>-NH</td><td>P150R</td>

<td></td><td></td><td>150Α, G151A</td>

<td> 15</td><td>-NH</td><td>150Α, G151A</td>

<td></td><td></td><td>150Α, I152V</td>

<td> 15</td><td>-NH</td><td>150Α, I152V</td>

<td></td><td></td><td>Ρ150Α, G151A, I152V</td>

<td> 15</td><td>-NH</td><td>Ρ150Α, G151A, I152V</td>

<td></td><td></td><td>G151A</td>

<td> 15</td><td>-NHz</td><td>G151A</td>

Deck

ΜΑ 33142Β1

<td></td><td></td><td>G151V</td>

<td> 15</td><td>-NH</td><td>G151V</td>

<td></td><td></td><td>G151A, I152V</td>

<td> 15</td><td>-NH</td><td>G151A'I152V</td>

<td></td><td></td><td>I152F</td>

<td> 15</td><td>-NH</td><td>I152F</td>

<td></td><td></td><td>Ι152Η</td>

<td> 15</td><td>-NH</td><td>Π52Η</td>

<td></td><td></td><td>I152L</td>

<td> 15</td><td>-NH</td><td>I152L</td>

<td></td><td></td><td>I152V</td>

<td></td><td></td><td>G170A</td>

<td> 15</td><td>-NHz</td><td>G170A</td>

<td></td><td></td><td>G170C</td>

<td> 15</td><td>-NH</td><td>G170C</td>

<td></td><td></td><td>G170D</td>

<td> 15</td><td>-NH</td><td>G170D</td>

<td></td><td></td><td>G170E</td>

<td> 15</td><td>-NH</td><td>G170E</td>

<td></td><td></td><td>G170N</td>

<td> 15</td><td>-NH</td><td>G170N</td>

<td></td><td></td><td>G170P</td>

<td> 15</td><td>-NH</td><td>G170P</td>

<td></td><td></td><td>G170Q</td>

<td> 15</td><td>-ΝΗ2</td><td>G170Q</td>

<td></td><td></td><td>G170S</td>

<td> 15</td><td>-NH</td><td>G170S</td>

<td></td><td></td><td>G170E, Ρ171Α</td>

<td> 15</td><td>-ΝΗ2</td><td>G170E, Ρ171Α</td>

ex

ΜΑ 33142Β1

<td></td><td></td><td>G170E, S172L</td>

<td> 15</td><td>-NH</td><td>G170E, S172L</td>

<td></td><td></td><td>G170E, Ρ171Α, S172L</td>

<td> 15</td><td>-NH</td><td>G170E, Ρ171Α, S172L</td>

<td></td><td></td><td>Ρ171Α</td>

<td> 15</td><td>-NH</td><td>Ρ171Α</td>

<td> 15</td><td>-NH</td><td>P171C</td>

<td> 15</td><td>-NH</td><td>P171D</td>

<td> 15</td><td>-NH</td><td>Ρ171Ε</td>

<td> 15</td><td>-NH</td><td>P171G</td>

<td> 15</td><td>-NH</td><td>Ρ171Η</td>

<td> 15</td><td>-ΝΗ2</td><td>Ρ171Κ</td>

<td> 15</td><td>-NH</td><td>Ρ171Ν</td>

<td> 15</td><td>-ΝΗ2</td><td>P171Q</td>

<td> 15</td><td>-NH</td><td>P171S</td>

<td> 15</td><td>-ΝΗ2</td><td>Ρ171Τ</td>

<td> 15</td><td>-ΝΗ2</td><td>P171W</td>

<td> 15</td><td>-NH</td><td>Ρ171Υ</td>

<td></td><td></td><td>Ρ171Α, S172L</td>

<td> 15</td><td>-ΝΗ2</td><td>Ρ171Α, S172L</td>

<td> 15</td><td>-NH</td><td>S172L</td>

<td></td><td></td><td>S172T</td>

<td> 15</td><td>-ΝΗ2</td><td>S172T</td>

<td></td><td></td><td>Q173E</td>

<td> 15</td><td>-ΝΗ2</td><td>Q173E</td>

<td></td><td></td><td>Q173R</td>

<td> 15</td><td>-NH</td><td>Q173R</td>

The components of the FGF21 mutant were prepared using primers comprising sequences that are identical to the chests

Before and after the codons (or codons) in which the mutant is induced. I have also provided the prefixes

CX

ΜΑ 33142Β1

Used in the denial amplification reactions of 15 nucleotides of the interference sequence to allow recirculation of the amplified product, that is, the complete carrier now has the desired mutant.

The complement FGF21 mutant component, encoding the FGF21 mutant that has a glutamic acid building block at position 170 instead of the original glycine building block (i.e.,

5 Mutant G170E) using the prefixes shown in Table (12).

Table (12)

PCR primers for preparing a representative FGF21 mutant

<td>Sequence ID number:</td><td>The ambulance</td><td>The initiator</td>

<td> 18</td><td>5'-ATGGTGGAACCTTCCCAGGGCCGAAGC-3 '</td><td>Sense</td>

<td> 19</td><td>5'-GGAAGGTTCCACCATGCTCAGAGGGTCCGA-3 '</td><td>Antisense</td>

The prefixes shown in Table (12) allow replacing the structural unit of glycine with a structural unit of glutamic acid as shown later, where the fold sequence is a precursor in

10 Copy direction (sequence ID: 18), and the second and third sequences (sequence ID: 20 and number: 22) are parts of the FGF21 expression component, and the fourth sequence is an antipode to the transcription direction (sequence ID: 21).

<img file="MA33142B1_D0010.tif" />

٠5

٢١

98UK 1-612

The components of the FGF21 mutant were prepared using the PCR conditions mentioned in Example (1). The amplification products were digested with DPnl-restriction enzyme, and then converted into competitive cells. The resulting clones were sequenced to confirm that there were no errors generated by the polymerase enzyme.

5 The FGF21 mutants were expressed by transforming BL21 (DE3 (competitive DE3) or BL21 Star (Invitrogen; Carlsbad, CA) cells using the encoding component of a specific mutant. The mutant material was grown overnight using a limited identity in complementary TB media using 40 μg / mL kanabben, and was then identified. The following morning, they were induced after a short extraction period in 0.4 mM IPTG. FGF21 mutant polypeptides were harvested by centrifugation for 18-20 h.

10 After induction.

The FGF21 mutant was also analyzed to determine the expected immunogenicity and the immune responses against the proteins were optimized. Antigen manipulation and presentation of a Class II binding locus to a major tissue compatible complex (MHC). This interference is required to help the T-cell mature the antibodies that recognize the protein. Whereas, the binding sites of MHC class II molecules are distinguished

15th It can be predicted. Whether proteins have the specific sequences that can bind to a chain of common human deers. Computer algorithms based on references and crystal structural staining of MHC class II were synthesized to determine whether linear amino acid peptide sequences had the potential to break the claim tolerance. Specifically, TEPITOPE was used to determine whether pointers in FGF21 torpedo could increase adenogenic T cells in the majority of

20 Humans. Based on the analysis of the linear protein sequence of each FGF21 phase, this was not expected

Any of the tents can improve immunogenicity.

yen

ΜΑ 33142Β1

Example (12):

Effect of the linker sequence on FGF21 degradation:

To determine if the presence of a long amino acid link between the Fc and FGF21 sequences influences the degradation of FGF21, mice were injected with the fusion proteins FGF21 in which the FGF21 was separated.

5 Region Fc of the sequence FGF21 by 15 amino acid connectors having the sequence GGGGGSGGGSGGGGS (sequence identity number: 23), blood was drawn from mice at different time points, and the serum was analyzed by LC-MS. Specifically, mice were injected with Fc (15) FGF21 or FGF21 (15) Fc (obtained from Escherichia coli) at 23 mg /

Kg, blood was drawn at 6, 24 and 48 hours, and affinity was cleared for the drawn blood

10 Using anti-human Fc Agarose resin.

Prior to analysis of the purified samples by LC-MS, the Fc (15) FGF21 FGF21 (15) Fcj protein parameters were analyzed as culture. Protein standards were either reduced with TCEP or not.

Both reduced and non-reduced titers were analyzed by LC-MS using ACE SIATO in a column of 0.3 mm X 30 mm by spraying the outflow from the column in a mass spectrometer.

15th For conventional ion capture LCQ and where convolutional prevention spectra of reduced samples were purer, the pure affinity samples were reduced prior to LC-MS Bad analysis.

In Figures (8A-8D), the observed masses of standard pure affinity samples are shown and the corresponding Fc (15) FGF21 reduced, drawn at different time points. The observed masses of FGF21 (15) Fc pure affinity samples (15) standard and corresponding drawn at time points are shown in Figures (9A-9D).

20 Different. Standard and sample filter products were exempted for addiction test to confirm terminal-N

ΜΑ 33142Β1

-100-

For proteins and help in predicting the identification of the observed fragments by 0LC-MS. Table (13) provides the results of the LC-MS analysis for the standards and samples, and a statement of the expected fragments.

Table (13)

Results of LC-MS analysis and projected fragments

<td>Terminal -N Sound</td><td>Frivolity</td><td>The percentage of the whole</td><td>Main blocks NB</td><td>AITA FGF21</td>

<td>Yeah</td><td> 424.1</td><td>100 AH / 0</td><td>002.46 d 1 lton</td><td>Fc (15) FGF21 Standard</td>

<td>Yeah</td><td> 424-1 414-1</td><td> ٠/٥65 ٥/٠35</td><td>46,000 Dalton 978,44 Dalton</td><td>Fc (15) FGF21 6 times</td>

<td>Yeah</td><td> 414-1 394-1</td><td> %85 %15</td><td>978,44 Dalton 022.43 D0 lton</td><td>Fc (15) FGF21 24h0</td>

<td>Yeah</td><td> 414-1 394-1</td><td> %60 ٥/٠40</td><td>976,44 Dalton 019,43 Dalton</td><td>Fc (15) FGF21 48 hours</td>

<td>Yeah</td><td> 424-1</td><td> ٥/٥100</td><td>Dion 999.45</td><td>FGF21 (15) Fc Standard</td>

<td>Permeated</td><td> 423-1</td><td> ٥/٠100</td><td>870,45 Dalton</td><td>FGF21 (15) Fc 6 hours</td>

<td>little bit</td><td> 423-1 423-6 423-22</td><td> ٠/٠40 ٥/٥35 %25</td><td>869.45 Dutton 301.45 Dalton 460,43 Dalton</td><td>FGF21 (15) Fc 24 hours</td>

<td>little bit</td><td> 423-1 423-6 423-22</td><td> %15 ٠/٠20 ٥/٠65</td><td>870.45 Dalton 297.45 Dalton 461,43 Dalton</td><td>FGF21 (15) Fc 48 hours</td>

5 As shown in Table (13), samples of pure affinity showed some degree of degradation after 6

ΜΑ 33142Β1

-101-

Only hours of spin. After 24 hours of spinning, the main products were Fc (15) FGF21 were fragments consisting of 1-414 building units of an amino acid (85% of the sample) and 1-394 (15% of the sample), and the main products were FGF21 (15). Fc is fragments of 1-423 amino acid building units (40% of sample), 6-423

5 (35% from; for a sample) and 22-423 (25% from al-'Aza)_JA specific fission cut

For the proteins FGF21 (15) Fcj Fc (15) FGF21 in Figs (10a) and (10b) respectively.

Shawl (13):

Activity in cache mask of Fc (15) FGF21 mutants resistant to protein prolongation on days 1-7 after injection:

10 As described herein, for FGF21 Fc fusion proteins, the cleavage of the protein depends on the sequence orientation or Fc, with the Fc terminus of the fusion protein being more stable than the FGF21 terminus of the fusion protein (i.e., it was found that the N-terminal portion of the fusion proteins FC-FGF21 and The -C terminal fraction of the FGF21-FC fusion proteins is very stable). For example, fission was identified at position 5 and 21 for FGF21-FC and positions 151 and 171 for Fc-FGF21.

15th As a result of these observations, research was conducted to identify FGF21 mutants that are resistant to protein lysis.

The LC-MS degradation of FC-FGF21 shows that the degradation for proteolysis in live cache takes place first between the 171-172 residues of the amino acid, followed by the degradation of the 151-152 amino acid residues. By clumping the hydrolytic proteolytic at position 171, cleavage at position 151 can be inhibited, effectively extending the half-life of the molecule. However

20 So, mutants can also have resistance to protein lysis in which cleavage is inhibited

1 and 2

ΜΑ 33142Β1

-102-

Site 151 building blocks at position 171, are susceptible to protease attack, possibly resulting in a missing molecule of the last ten amit acids, which are known to be included in the binding of the beta-klotho co-receptor, which is a determinant of the receptor languages ​​of the troposphere and activity in the laboratory and in the organism. Thus, the genetic modification of the amino acid building blocks appears

5 That surrounds site 171 in mature FGF21 to be very critical in improving stability in organism and efficacy and in the activity of the molecule.

The efficacy was tested in live cache of Fc (15) FGF21 resistance to protein degradation by injecting ob / ob mice into peritoneum with FGF21, drawing blood samples from mice injected at young, 0.25 and 3, 5 and 7 days after injection and measuring glucose levels in blood 1 after that. in a

10 Samples. The results are provided in Figure (11) for one of the trials, showing the measured blood glucose levels in mice injected with the PBS control sample or the Fc (15) FGF21 or Fc (15) FGF21 mutant for the FGF21 G170E (15) Fc (15) mutants or Fc (15) FGF21 171Α or Fc (15) FGF21 S172L or Fc (15) FGF21 G170E / P171A / S172L or Fc (15) FGF21 G151A). Figure (12) shows the percentage change in glucose levels

15th Blood is also identified in this application. And by the appearance of this tactile that the mutants [moved between the parentheses on the previous page; The serum glucose sustained-release decreased for approximately 5 days, which was greater than that of FC-FGF21 for the raw type. Mutant Fc (15) FGF21 G151A only partially improved the blood glucose interval by moderating activity compared to the crude-type FC-FGF21 fusion protein. Surprisingly, though, mutant Fc (15) -FGF21 S172L does not

20 The mutant is resistant to protein hydrolysis and thus has a similar glycolysis profile as polypeptide Fc (15) -FGF21.

Of the raw type, it has been found that this mutant shows enhanced efficacy in the organism as compared to

ΜΑ 33142Β1

-103-

Raw-type Fc (15) -FGF21 polypeptide.

The results of another experiment are provided in Figure (13), showing the blood glucose levels measured in mice stuttering with the PBS comparison sample or the Fc (15) -FGF21 or Fc (15) FGF21 mutants [Fc (15)] FGF21 P150A / G151A / I152v Fc (15) FGF21 G170E, or

5 Fc (15) FGF21 G170E / P171A or Fc (15) FGF21 G170E / S172L). Shows Figure (14)

The percentage change in blood glucose levels as determined in this experiment. As in the aforementioned experiment, the fusion protein FC-FGF21 of the solute and recombinant type Fc (15) FGF21 P150A / G151A / I152V does not show a prolonged-acting blood glucose that has a potential depressant effect on the hydrolysis pip at position 171 that can continue to occur and recur. Levels

10 The blood glucose in the injected animals brings the proteins back to baseline 24 hours after the injection. However, [Fc (15) FGF21 P150A / G151A / I152V or Fc (15) FGF21 G170E or Fc (15) FGF21 G170E / P171A or Fc (15) FGF21 G170E / S172L]] show maximum blood glucose-lowering efficacy up to about 5 Days after injection, the fusion protein FC-FGF21 was superior to the crude type and Vc (15) FGF21 P150A / G151A / I152V.

15th The results of another experiment are provided in the form (15) showing the blood glucose levels in the mice injected with the PBS or Fc (15) FGF21 mutant Fc (15) FGF21 G170E or Fc (15) FGF21 G170A or Fc (15) FGF21 G170C Or Fc (15) FGF21 G170D, Fc (15) FGF21 G170N, or Fc (15) FGF21 G170S. Wain (16) shows the percentage change in blood glucose levels as determined in this experiment. Both mutants showed

20 FGF21 tested in this trial had an extended-release glucose lowering efficacy of approximately 5%

Days after injection.

ΜΑ 33142Β1

-104-

The results of the other experiment are provided in Figure (17) showing the blood glucose levels measured in the injection mice using PBS or Fc (15) FGF21 for Fc (15) FGF21 G170E or Fc (15) FGF21 Ρ171Ε or Fc (15) FGF21 Ρ171Η Or Fc (15) FGF21 P171Q, Fc (15) FGF21 171Τ, or Fc (15) FGF21 171Υ. Figure (18) shows the percentage change in

5 Blood glucose levels as determined in this test. All FGF21 mutants tested in this trial showed improved blood glucose-lowering efficacy when compared to FC-FGF21 for the raw type.

Example (14):

The degradation cache of Fc (15) FGF21 planes is resistant to protein degradation after 6 to 120

10 1 hour of injection:

The stability was analyzed in the live cache of selected FGF21 torrents by injection of FGF21 torque to mice.

Blood was drawn from mice at different time points, and serum was analyzed by LC-MS. The mice were either injected with Fc (15) FGF21 G170E or Fc (15) FGF21 171Α or Fc (15) FGF21 S172L (obtained from Escherichia coli) as described in

15th Example 2), each of which was diluted in approximately 180 μL of 10 mm HCl before injection, and blood was drawn at 6, 24, 48, 72 and 120 hours. FGF21 affinity was purified from drawn blood using an anti-human Fc agarose resin column. Samples were filtered from the column with 10 mM HCl and all FGF21 components comprised the Fc region and 5a separator for the amino acid at the amino terminus of FGF21. Done too

20 Inject mice with a comparable sample of raw-type FGF21.

٩

ΜΑ 33142Β1

-105-

Prior to analysis of the LC-MS-purified affinity samples, the raw untreated FGF21j mutant FGF21j was analyzed as a reference. All the coefficients and time point samples were reduced with TCEP and subsequently analyzed by LC-MS using Cyanoside ACE with a column of 0.3 mm r 30 X 0 p. The outflow from the column was sprayed into a conventional ion-barrier mass spectrometer.

5 LCQ. The purified affinity samples were diluted with ammonium acetate, diluted with TCEP

And then analyzed by LC-MS as previously described.

Labeling the observed masses of Fc (15) FGF21 for the wild type at small, 6, 24 and 48 h post-injection labeled in Figures (19a-19d), respectively. The masses observed for Fc (15) FGF21 G170E at small, 6, 24 and 48 hours after injection are shown in Figures (20a-).

10 20 d), respectively. The observed masses of Fc (15) FGF21Ρ171Α are shown as small and 6

And 24 and 48 h post-injection in shapes (21A-21D), respectively. The observed masses of Fc (15) FGF21 S172L at small, 6, 24 and 48 hours after injection are shown in Figures 22a-22d respectively.

It was found that both samples drawn at 72 and 120 hr contain a component with a higher 15 molecular weight (> 200 Dalton by SDS-PAGE not subjected) to the ligin generator and be ample.

Much more than the residual Fc (15) FGF21 fusion protein. Table (14) provides the results of the LC-MS analysis for other standards and samples.

Table (14)

Results of LC-MS analysis and projected fragments

<td>addiction</td><td>Sliver</td><td>The percentage of the whole</td><td>Noticeable major blocks</td><td>FGF21 sample</td>

appeared

ΜΑ 33142Β1

-106-

<td></td><td> 424.1</td><td>0100 / e</td><td>994,45 Dton</td><td>Fc (15) FGF21 WT Standard</td>

<td>No</td><td> 424-1 414-1</td><td>080 / e % 20</td><td>001,46 Dalton 987,44D; Leighton</td><td>Fc (15) FGF21 WT Hours</td>

<td>No</td><td> 414-1</td><td> ~٠/٠100</td><td>979,44 without</td><td>Fc (15) FGF21 WT 24 hours</td>

<td></td><td> 414-1</td><td> »100-</td><td>980,44 hon</td><td>Fc (15) FGF21 WT 48 hours</td>

<td></td><td> 424-1</td><td> ٥/٠100</td><td>068.46 d 1 lton</td><td>Fc (15) FGF21 G170E Standard</td>

<td>No</td><td> 424-1</td><td>0 / ο100</td><td>078,46 d 1 lton</td><td>Fc (15) FGF21 G170E 6 hours</td>

<td>No</td><td> 424-1 421-1</td><td> ٠/٠80 ٥/٠20</td><td>074.46 Dalton 761.45 Dalton</td><td>Fc (15) FGF21 G170E 24 hours</td>

<td>No</td><td> 424-1 421-1</td><td> ~%60 ~٥/٠40</td><td>072.46 Dalton 760.45 Dalton</td><td>Fc (15) FGF21 G17OE 48 hours</td>

<td></td><td> 424-1</td><td> 1)1)1/٠</td><td>970,45 hon</td><td>Fc (15) FGF21 171Α Standard</td>

<td>No</td><td> 424-1</td><td> ٥/٥100</td><td>980.45 d 1 liter</td><td>Fc (15) FGF21 171Α 6 hours</td>

<td>No</td><td> 424-1 421-1</td><td> ~٠/٥70 ~٥30</td><td>973.45 Dalton 657.45 Dalton</td><td>Fc (15) FGF21 171Α 24 hours</td>

<td>No</td><td> 424-1 421-1</td><td> ~٥/٥50 ~٥/٥50</td><td>992.45 Dalton 673.45 Dalton</td><td>Fc (15) FGF21 171Α 48 hours</td>

<td></td><td> 424-1</td><td> 1)1)1/٠</td><td>022.46 Dalton</td><td>Fc (15) FGF21 S172L Fabrication</td>

<td>No</td><td> 424-1</td><td> ٥/٠100</td><td>027.46 without</td><td>Fc (15) FGF21 S172L 6 hours</td>

<td>No</td><td> 414-1</td><td> ٥/٥100</td><td>984,44 Dalton</td><td>Fc (15) FGF21 S172L 24 hours</td>

<td>No</td><td> 414-1</td><td> ٠/٥100</td><td>985,44 Dalton</td><td>Fc (15) FGF21 S172L</td>

ΜΑ 33142Β1

-107-

<td></td><td></td><td></td><td></td><td>48 lumens</td>

As shown in Table (14), the degradation of Fc (15) FGF21 of the crude and mutant type S172L is similar in that after 24 hours of rotation, the main product of the fusion protein was a shell of 1-414 building units of an amino acid. The decomposition products of the Fc (15) FGF21 17Α Fc (15) FGF21 G170E mutant are similar in that the samples drawn after 24

5 An hour of spin contains 70-80% intact protein (1-424 amino acids) and 20-30% of a portion of the 1-421 amino acid building block. Even after 48 hours, the Fc (15) FGF21 17Α Fc (15) FGF21 G170E mutant also retains an intact protein while demonstrating an increase in the buffer content of 1-421 amino acid residues.

As noted in previous analyzes of FC-FGF21 components, fragment degradation was revealed

10 FGF21 for the fusion protein and found that the Fc fragment remains stable. On the deposition, the wild species are shown in Figures 23a-23d, identified in the fission sites Fc (15) FGF21 G170E Fc (15) FGF21 S172L Fc (15) FGF21Ρ17Α.

Overstated 15

Identification of FGF21 mutants that reduce clumping

15th The ability to agglomerate is a characteristic of the FGF21 wild type. FGF21 mutants that reduce clumping have been identified on the basis of two assumptions. The first assumption is that for FGF21, agglomeration (or degeneration) is initiated by non-hydrophilic reactions and van der Waals interactions between FGF21 molecules that occur by the hydrophobic modules that have been exposed to the solvent environment dependent on the hydrophobic with water. As for

٩

ΜΑ 33142Β1

-108-

The second assumption is that these presented non-hydrophilic building blocks can be substituted to make mutational variables that can reduce agglomeration without including FGF21 activity.

A good systemic protein engineering method has been used to identify the hydrophobic 5 building blocks of FGF21. Since there were no X-rays or NMR constructs, FGF21 could not

Used to identify the presented water-non-hydrophobic building blocks, a high-resolution 1.3 X-ray crystal structure of FGF19 (1PWA) obtained from the PDB Protein Data Bank that was used to create a 3D homogeneity model of FGF21 using MoleculaOperating Models software. Environment; Chemical Computing) MOE

10 Group; Montreal, Quebec, Canada). FGF19 was chosen as the template, as it is among the proteins

Found in FGF19, PDB is the closest related protein - FGF21 to the amino acid sequence induction.

Solvent accessibility was calculated by the following method using MOE. The first criterion for surface area SA1 is defined as a zone of surface area accessible in

15th Although it may appear to be a specific building block of an amino acid in an original sequence of a protein many times, each time it is found in a building unit may have a superficial deformation due to some differences, among which is the approach of the building block to Protein surface, lateral subunit orientation, and spatial position of the amino acid building blocks of the amino acid. For this reason, a second surface navigation measurement (SA2) was performed.

20 Whereas the structural unit of interest was obtained from the protein structure with

Building units are contiguous or contiguous. Tash was made from these building units spatially

No

ΜΑ 33142Β1

-109-

In the laboratory for glycinate to remove side chains, then SA2 is calculated for the structural unit of interest, with a measurement of the total possible surface area of ​​the structural unit in the specific formation of the spot. Then an algorithm can be made between SA1 to SA1 / SA2 (SA2) to provide a specific measurement of the possible surface alignment ratio of the building unit actually exposed.

5 Many building units that are not hydrophilic and which are exposed to a large extent to the solvent have been selected for further analysis, and the mutants have been made in the laboratory for the building units to be replaced by the chosen building unit with some other building blocks for the naturally occurring amino acid. The changes in protein thermal stability resulting from several substitutions were analyzed using the FGF21 model and the CUPSAT based program.

10 The interactive web (Cologne University Protein Stability Analysis Tools) according to the instructions provided at the CUPSAT site. See Barthiban et al., 2006, Nucleic Acids Res 7:54. 34: W239-42; Parthiban et al., 2007, BMC Struct. Biol. The mutants that are not stable or non-hydrophilic were clearly excluded in the design of mutant variants that reduce agglomeration. It is considered that static substitution sets (or, in rare cases, what

15th Instability) which provides ionic and / or hydrophobic traits that are candidate for FGF21 caking-reducing mutants.

Table 15 presents a summary of the data generated from this rational protein engineering method,

It also lists some examples of FGF21 mutants that are expected to have lower protein agglomerations and better stability.

20 Table 15 θ '

ΜΑ 33142Β1

-110-

Computer effect of FGF21 mutants on stability

<td>Baht (kcal)</td><td>The boom</td><td>Prostitutional unity WT</td><td>Prostitution unit number</td>

<td> 1.25</td><td>K</td><td>A</td><td> 26</td>

<td> 1.54</td><td>E</td><td></td><td></td>

<td> 2.016</td><td>R</td><td></td><td></td>

<td> 0.66</td><td>T</td><td>A</td><td> 45</td>

<td> 0.71</td><td>Q.</td><td></td><td></td>

<td> 1.8</td><td>K</td><td></td><td></td>

<td> 2.34</td><td>E</td><td></td><td></td>

<td> 1.59</td><td>R</td><td></td><td></td>

<td> 0.33-</td><td>T</td><td>L</td><td> 52</td>

<td> 0.16</td><td>G</td><td>L</td><td> 58</td>

<td> 0.15-</td><td>S</td><td></td><td></td>

<td> 1</td><td>C</td><td></td><td></td>

ΜΑ 33142Β1

-111-

<td> 0.08</td><td>E</td><td></td><td></td>

<td> 1.3 1.51 0.66 1.31</td><td>A K E R</td><td>P</td><td> 60</td>

<td> 0.14 2.48 0.08 0.13</td><td>A C R H</td><td>P</td><td> 78</td>

<td> 0.18 4.1</td><td>T C</td><td>L</td><td> 86</td>

<td> 2.52 3.08 2.88 1.48</td><td>A S K E</td><td>F</td><td> 88</td>

<td> 0.49</td><td>T</td><td>L</td><td> 98</td>

No

ΜΑ 33142Β1

-112-

<td> 0.17 0.19- 3.08 0.84 3.4</td><td>Q. K c E R</td><td></td><td></td>

<td> 7.34</td><td>C</td><td>L</td><td> 99</td>

<td> 2</td><td>E</td><td></td><td></td>

<td> 1.01</td><td>D.</td><td></td><td></td>

<td> 1.61</td><td>R</td><td></td><td></td>

<td> 0.47</td><td>T</td><td>A</td><td> 111</td>

<td> 0.12-</td><td>K</td><td></td><td></td>

<td> 3.93</td><td>Q.</td><td>A</td><td> 129</td>

<td> 1.02</td><td>K</td><td></td><td></td>

<td> 3.76</td><td>N</td><td></td><td></td>

<td> 3.01</td><td>E</td><td></td><td></td>

<td> 3.76</td><td>D.</td><td></td><td></td>

ΜΑ 33142Β1

-113-

<td> 1.68 2.9</td><td>R H</td><td></td><td></td>

<td>Birth</td><td>K</td><td>A</td><td> 134</td>

<td> 4.32</td><td>Y</td><td></td><td></td>

<td> 5.13</td><td>E</td><td></td><td></td>

<td> 6.18</td><td>R</td><td></td><td></td>

<td> 2.86</td><td>H</td><td></td><td></td>

Example 16

Capture and expression of FGF21 strains of all cell and fusion proteins

Girls wearing FGF21 torches mentioned in Table 16 were prepared by magnification

5 PCR for the wild-type FGF21 expression vector as stated in Example 11 (the structure of the irrigation FGF21 expression vector was described in Example 1). The fusion proteins were performed as shown here.

That is, in Example 6.

Table 16

FGF21 agglomeration-reducing mutants

<td>Mutants</td><td>Fc</td><td>Link</td>

'L

-1149Α2Β9 &lt;? 1 6

<td>Α26Ε</td><td></td><td></td>

<td>Α26Κ</td><td></td><td></td>

<td>A26R</td><td></td><td></td>

<td>Α45Ε</td><td></td><td></td>

<td>Α45Κ</td><td></td><td></td>

<td>Α45Κ</td><td>-NH</td><td> 15</td>

<td>A45R</td><td>-NH</td><td> 15</td>

<td>A45Q</td><td>-NH</td><td> 15</td>

<td>Α45Τ</td><td>-NH</td><td> 15</td>

<td>45, L98R</td><td>-NH</td><td> 15</td>

<td>L52T</td><td></td><td></td>

<td>L58C</td><td></td><td></td>

<td>L58E</td><td></td><td></td>

<td>L58G</td><td></td><td></td>

<td>L58S</td><td></td><td></td>

<td>Ρ60Α</td><td></td><td></td>

<td>PE</td><td></td><td></td>

<td>Ρ60Κ</td><td></td><td></td>

<td>P60R</td><td></td><td></td>

<td>Ρ78Α</td><td></td><td></td>

<td>P78C</td><td></td><td></td>

<td>Ρ78Η</td><td></td><td></td>

<td>P78R</td><td></td><td></td>

<td>L86C</td><td></td><td></td>

<td>L86T</td><td></td><td></td>

<td>F88A</td><td></td><td></td>

<td>F88E</td><td></td><td></td>

<td>F88K</td><td></td><td></td>

<td>F88R</td><td></td><td></td>

<td>F88S</td><td></td><td></td>

<td>L98C</td><td></td><td></td>

<td>L98E</td><td>-NH</td><td> 15</td>

<td>L98K</td><td>-ΝΗ2</td><td> 15</td>

<td>L98Q</td><td>-ΝΗ2</td><td> 15</td>

<td>L98R</td><td></td><td></td>

<td>L98R</td><td>-NH</td><td> 15</td>

<td>L99C</td><td></td><td></td>

<td>L99D</td><td></td><td></td>

<td>L99E</td><td></td><td></td>

<td>L99R</td><td></td><td></td>

<td>Α111Κ</td><td>-NH</td><td> 15</td>

<td>Α111Τ</td><td></td><td></td>

<td>A129D</td><td></td><td></td>

<td>Α129Ε</td><td>-NH</td><td> 15</td>

<td>Α129Η</td><td>-ΝΗ2</td><td> 15</td>

<td>Α129Κ</td><td></td><td></td>

<td>Α129Ν</td><td>-ΝΗ2</td><td> 15</td>

<td>A129R</td><td>-NH</td><td> 15</td>

<td>A129Q</td><td></td><td></td>

<td>Α134Ε</td><td></td><td></td>

No

MA

33142Β1

-115-

<td>Α134Η</td><td>-NH</td><td> 15</td>

<td>Α134Κ</td><td></td><td></td>

<td>Α134Υ</td><td></td><td></td>

The clumping test was performed of several FGF21 proteins including wild-type FGF21; Amputated FGF21 polypeptides, FGF21 mutants, and FGF21 fusion proteins using meat-excluding chromatography (SEC). The samples to be analyzed were incubated at 4

5 ° C, at room temperature or at 37 ° C for many time points,

She was then subjected to a SEC analysis. Experiments were performed with a Beckman HPLC system with a SEC column. For wild-type FGF21, a TOSOHAAS TSK-Gel G2000 SEC column was used with 2 PBS X containing 2% isopropyl alcohol as the moving chlorine. For FGF21 Fc proteins and FGF21 polypeptides, a

10 TOSOHAAS TSK-Gel G3000 SEC using 2 PBS X as a mobile phase.

Example 17

Anti-caking activity of FGF21 buoys

Aggression was performed to identify clumping-reducing mutants that retain wild-type FGF21 activity in ELK-lucigrase in laboratory tests. ELK-lucigraz tests were performed

15th As shown in Example 4. Figures 24a - 24c show efficacy test results

ELK lucigraz that is performed on mutants FGF21 L99ÜJ FGF21 L99R FGF21.

FGF21 111Τ (Fig.24a), and FGF21 models namely FGF21 A129D and FGF21

ΜΑ 33142Β1

-116-

FGF21 134Κ A129Q (Fig.24b), and FGF21 mutants namely FGF21 134Υ FGF21 129Κ FGF21 A134EJ (Fig.24c). The results of these tests have shown that some size-reducing mutants do not adversely affect FGF21 activity as shown in ELK-lucigraz assays.

5 Overstated 18

Anesthetize and express Fc (15) FGF21 common mutants

To demonstrate a longer half-life and lower levels of caking

A number of the FGF21 mutant syntheses, containing the mutants, showed an additionally coupled clustering

To an increase in the half-life by stopping proteolysis, which was prepared and spelled out with 10 IgGl Fc molecules. The Asama FGF21 torque was then prepared as shown in the example

11.

Example 19

Given studies of Fc (15) FGF21 mutants

That demonstrates longer half-lives and lower levels of caking

15th Experiments were performed to identify mutants of the FGF21 combination that retained wild-type FGF21 activity in the laboratory ELK assay. This test was performed as described in

Example 4.

٩

MA

33142Β1

-117-

Figures 25a - 25d show the results of the ELK-lucigrase activity test performed on the FC-FGF21, FC-FGF21 P171G, 171 FC-FGF21 Ρ17Τ FC-FGF21 mutants (Fig. 25A) and the FC-FGF21 mutant Fc-J FC-FGF21 P17W. FC-FGF21 171Υ FGF21 P171C, (Fig.25b); Fc (15) FGF21 A45K / G17 (E Fc (15) FGF21 and FGF21

5 45 (Fig.25c), Fc (15) FGF2121171Ε ^? Fc (15) FGF21 and Fc (15) FGF21 A45K / G170E (Fig.25d). The results of these experiments show that the mutants are intended to improve stability, or both stability and solubility, and do not include in vitro activity compared to wild-type IFC-FGF21. Surprisingly, the FGF21 45Κ teaser showed a wild-type FC-FGF21-related potential.

10 Fig. 26a shows the change in the caking ratio of a comparable sample of FGF21Α45Κ (WT) FGF21 after incubation of 65 mg mg of protein at 4 ° C for 1, 2, 4 days. Also, these data indicated that the 45Κ flare leads to a decrease in protein agglomeration, compared to that of 45.

Wild type.

Figure 26b shows the change in the caking ratio for the comparison sample FGF21 (WT) and FGF21 15, P78C, P78R, L86T, L86R, L98C, L98R, 111Τ, A129D, A129Q, 129Κ, 134.

134Υ, and 134Ε after incubation of 65 mg ml protein at 4 ° C for 1, 6 and 0 days. The data indicated that 129Κ A129QJ AIT L98R L98Cj L86R

It leads to a decrease in protein clumping, as compared to that of the wild type protein.

No 2

ΜΑ 33142Β1

-118-

Figure 27 also shows the results of ELK-lucigrase activity performed on the human FGF21 comparison sample and FGF21 torches namely FGF21 L58E-J FGF21 L52T FGF21 45Κ.

These results show that FGF21Α45Κ flare retains the full activity of FGF21 for the wild type and shows a greater potential than FGF21 for the wild type. In spite of this, the hoops

5 FGF21 L58Ej FGF21 L52T shows low efficiency and effectiveness in comparison, _ FGF21 type

Nry.

Figures 28a - 28b show the change in the agglomeration levels of Fc (15) FGF21 helicopters such as Fc (15) FGF21 6-181ZG17OE, Fc (15) FGF21 A45K / G170E, Fc (15) FGF21 Ρ171Ε Fc (15) FGF21 171Α, Fc (15) FGF21 G170E, and FGF21 incubated control sample

10 At 4 ° C for 1, 4, and 8 days. This experiment shows that for a period of more than 8 days, the Fc (15) FGF21 A45K / G170E mutants showed less agglomeration than that shown in the Fc (15) FGF21 G170E or Fc (15) FGF21 Ρ171Ε mutants. However, these three aforementioned mutants appear. Lower agglomeration than that shown in the Fc (15) FGF21 comparison sample. Table 17 shows the ratio of agglomeration obtained with respect to the comparison sample FC-FGF21 and the FC-FGF21 mutant.

15th A45K / G170E that follow incubation at 4 ° C or room temperature for a small, 2,

3; 4, 7 days.

Table 17

Turbidity ratio shown on Fç-FGF2 ^ FC-FGF21

No

ΜΑ 33142Β1

119-

<td colspan="2">the sample</td><td>Today Smallness</td><td>Today 2</td><td>Today 3</td><td>Today 4</td><td>Day 7</td>

<td rowspan="2">FC-FGF21 WT 32 Bham z</td><td>4 degree percentage</td><td> 1.12</td><td> 1.71</td><td> 1.89</td><td> 2.14</td><td> 2.32</td>

<td>temperature</td><td> 1.12</td><td> 6.09</td><td> 7.94</td><td> 9.52</td><td> 12.59</td>

<td rowspan="2">FC-FGF21 A45K / G170E 33 BHM T ML</td><td>4 degree percentage</td><td> 0.45</td><td>ϋ.ΊΊ</td><td> 0.88</td><td> 1.03</td><td> 1.24</td>

<td>temperature</td><td> 0.45</td><td> 3.86</td><td> 5.22</td><td> 6.62</td><td> 8.6</td>

Example 20

As mentioned above, the stability and solubility of FGF21 can be modified by introducing some fusion mutants 5 Fç-FGF21.

The segments are specific and the amino acid substitutions, and in addition, the stability of FGF21 can be improved by combining the modified FGF21 proteins with the Fc segment of the IgGl gene for immunoglobulin.

Human. In addition, by introducing the blends of the aforementioned modifications, FGF21 molecules have improved stability and solubility. Encoded DNA sequences

10 Of FGF21 synthesis mutants mentioned in Table 18 were prepared using the techniques

The above-mentioned.

T

ΜΑ 33142Β1

-120-

Table 18

FGF21 synthesis mutants

<td>The building blocks of amino acid</td><td>Protein analysis mutants</td><td>Mutants Agglomeration</td><td>Fc</td><td>Link</td>

<td> 181-1</td><td>G170E</td><td>Α45Κ</td><td>-NH</td><td> 15</td>

<td> 181-1</td><td>G170E</td><td>L98R</td><td>-NH</td><td> 15</td>

<td> 181-1</td><td>G170E</td><td>45, L98R</td><td>-NH</td><td> 15</td>

<td> 181-1</td><td>P171G</td><td>Α45Κ</td><td>-ΝΗ2</td><td> 15</td>

<td> 181-1</td><td>P171S</td><td>Α45Κ</td><td>-ΝΗ2</td><td> 15</td>

<td> 181-1</td><td>P171G</td><td>L98R</td><td>-ΝΗ2</td><td> 15</td>

<td> 181-1</td><td>P171S</td><td>L98R</td><td>-ΝΗ2</td><td> 15</td>

<td> 181-1</td><td>P171G</td><td>45, L98R</td><td>-ΝΗ</td><td> 15</td>

<td> 178-1</td><td>G170E</td><td></td><td>-ΝΗ2</td><td> 15</td>

<td> 181-6</td><td>G170E</td><td></td><td>-ΝΗ,</td><td> 15</td>

<td> 181-6</td><td>G170E</td><td>Α45Κ</td><td>-ΝΗ2</td><td> 15</td>

<td> 181-6</td><td>G170E</td><td>L98R</td><td>-ΝΗ2</td><td> 15</td>

<td> 181-6</td><td>P171G</td><td></td><td>-ΝΗ</td><td> 15</td>

<td> 181-6</td><td>P171G</td><td>L98R</td><td>-ΝΗ</td><td> 15</td>

<td> 181-7</td><td>G170E</td><td></td><td>-ΝΗ2</td><td> 15</td>

Figure 29 shows blood glucose levels measured in mice 5 injected with mutants of a combination of Fc (15) FGF21 namely Fc (15) FGF21 A45K / G170E.

0Fc (15) FGF21 L98R / P17G Fc (15) FGF21 A45K / P17G

No'

ΜΑ 33142Β1

-121-

In another test; The FGF21 mutant namely Fc (15) FGF21 L98R / P171G was studied in parallel with the FGF21 mutant and the completed wild-type FC-FGF21 mutant. In one experiment, the recombinant 29 293 cell strain was cultured in the presence of different concentrations of FGF21, -FC, FGF21, or FC-FGF21L98R / P171G for 6 hours. Cellular analysis products and then tested

5 This is to find out about lucigraz activity. As shown in Figure 30, d FC-FGF21 L98R / P171G had similar activity to d FC-FGF21, indicating that the two entry points

Mutants do not alter the activity of the molecule in the laboratory.

In another test, the stability of FC-FGF21 L98R7P171G was evaluated at 65 mg ml for 9 days at 10 different temperatures, namely room temperature at 4 ° C, with F ^ FGF21.

FGF21. Cell lysis products were analyzed after the incubation period using SEC-HPLC to determine

Agglomeration versus temporal shape at several temperatures. The data shown in Figures 31a and 31b indicate that the caking rate was significantly reduced in FC-FGF21 L98R / P171G at room temperature (solid triangles, dotted line in Fig. 31a)

15th And at 4 ° C (solid triangles, dotted line in Fig. 31b).

Example 21

FGF21 proteolysis-resistant mutants on C-terminal mutants

CX

ΜΑ 33142Β1

-122-

The combinations of mutants have also been studied in vivo. Specifically, the stability of the live cache gm of FC-FGF21 L98R / P171G was compared with that of FC-FGF21 in mice and canine models, and it was found that the results are similar in both species. In the study of Cynomolgus monkeys Fc-FGF2 ^ FC-FGF21 L98R / P171G, they were injected via

5 Intravenous 23.5 mg kg and equal portions of serum and plasma were pooled at time points of 840 hours after dose. Time points were analyzed to 168 hours. Time point samples were purified with languages ​​using anti-Fc, and then analyzed with MALDI mass spectrometry. The results agree well between the two analyzes.

10 Data analysis using MALDI for immunohistochemistry, and binding at the 171 locus was seen folding not present in the FC-FGF21 molecule L98R7P171G as a consequence of the 171 mutant to P171G. Despite this, a slight and slow degradation due to the loss of up to 3 building blocks of the C terminal was observed for FC-FGF21 L98R / P171G (Fig. 32). Cases of fission occurring at either terminal building blocks were also observed

15th With FGF21 mutants after the most vulnerable locus of fission between the amino acid building blocks 171 and 172 that was stopped and shown in Figs 20 and 21. The fission of the 3 eigenvalues ​​of the C terminals may represent the cessation of fission at the C terminal of the molecule by carboxy

Peptidase in a unit building method and then a successive building unit or volume specific protease at the units

١٩

9Α2Β9 &lt;? 1 6

-123-

The structural properties of the amino acid 178 and 179 using an indeterminate crosslinking at the acid building blocks of amino acids 179-180 and 180-181. Loss of 2--3 amethic acids at the C-terminal can reduce the beta-clotho binding and ultimately reduce the efficiency and activity in the organism body of the molecule, See, for example, 19: 24-583. Yie et al. 2009, FEBS Lett.

5 To deal with the degradation of the C-terminal carboxypeptidase, the effect of adding an amino acid building unit cap to several polypeptides of the FGF21 polypeptide studied.

Several constructs, including those shown in Table 19, have been performed and tested using the techniques described here. Table 19 summarizes the results of the ELK-lucigraz test

That was done in the lab.

10 Suitable amino acid caps can be those with a length between 1 and 15 amino acids for example 1 with a length of 1, 2, 3, 4, 5, 10 or 15 amino acids.

Any number and type of amino acid can be used as a coating, for example, one porcelain building block, one glycine building unit, two glycine building blocks, five glycine building blocks, and a combination thereof. Other examples are excused

15th In the current example in Table 19.

In addition, to deal with the apparent protease attack at the amino acid building blocks 178 and 179, and the amino acid build-up mutants at positions 179; And 180 and 181 were studied. And again, there is a set of structures, including

ΜΑ 33142Β1

-124-

It is the ones shown in Table 19, which were worked and tested using the techniques mentioned here. The effect of combinations of alopecia and mutants at these sites was studied. Table 19 also summarizes some examples of girls that have been done and studied on the ELK-lucigraz test that is performed

In the lab, which is executed as mentioned here. According to the terms used here, 5 hFc means a human Fc sequence (i.e., sequence # 13), and L15 denotes a link of 15 building blocks.

(I.e., sequence No. 23). Table 19

Efficacy and EC50 values ​​for FGF21 polypeptide polypeptides arrived at C-terminal modifications

<td>EC50 (nano -No,,</td><td>Bottoms</td><td>The prostitute</td>

<td> ٠/٠100.00</td><td> 0.4</td><td>huFGF21</td>

<td> %76.10</td><td> 2.5</td><td>hFc.L15.hFGF21 (L98R, P171G)</td>

<td> %78.30</td><td> 2.6</td><td rowspan="5">hFc.L15.hFGF21 (L98R, P171G, Y179F) hFc.L15.hFGF21 (L98R, P171G, 1-180) hFc.L15.hFGF21 (L98R, P171G, 1-179) hFc.L15.hFGF21 (L98R, P171G, Α180Ε) hFc.L15.hFGF21 (L98R, P171G, S181K)</td>

<td></td><td></td>

<td> %77.40</td><td> %٦٠</td>

<td> %79.60</td><td> 1.9</td>

<td> %87.90</td><td> 130</td>

<td colspan="2"></td><td>GSGSGSGSGS.hFGF21.L15.hFc</td>

<td> %83.10</td><td> 834</td><td rowspan="3">MKEDD.hFGF21.L15.hFc hFc.L15.hFGF21 (L98R, P171G, S181P, Ρ182) hFc.L15.hFGF21 (L98R, P171G, A180G)</td>

<td> %69.90</td><td> ٦٦٦</td>

<td> %76.90</td><td> 3.25</td>

ΜΑ 33142Β1

-125%77.30

3.43 hFc.L15.hFGF21 (L98R, P171G, S181G) hFc.L15.hFGF21 (L98R, P171G, L182) hFGF21 (L98R, P171G, G182)

<td> %44.40</td><td> 428</td><td>hFc.L15.hFGF21 (L98R, P171G, Υ179Ρ)</td>

<td> %82.60</td><td> 61</td><td>hFc.L15.hFGF21 (L98R, P171G, Y179G)</td>

<td> %74.80</td><td> 25.3</td><td>hFc.L15.hFGF21 (L98R, P171G, Y179S)</td>

<td> %79.60</td><td> 43.2</td><td>hFc.L15.hFGF21 (L98R, P171G, Υ179Α)</td>

<td>% ΊΊ.69</td><td> 3.07</td><td>hFc.L15.hFGF21 (L98R, P171G, S181T)</td>

<td> »/»73.50</td><td> 2.66</td><td>hFc.L15.hFGF21 (L98R, P171G, S181A)</td>

<td> %72.60</td><td> 3.46</td><td>hFc.L15.hFGF21 (L98R, P171G, S181L)</td>

<td> »/»79.50</td><td> 33.8</td><td>hFc.L15.hFGF21 (L98R, P171G, S181P)</td>

<td> »/»77.10</td><td> 617</td><td>hFc.L15.hFGF21 (L98R, P171G, Α180Ρ)</td>

<td> »/»84.70</td><td> 2.18</td><td>hFc.L15.hFGF21 (L98R, P171G, A180S)</td>

hFGF21 (L98R, P171G, GGGGG182-6)

<td> %85.90</td><td> 6.1</td><td>hFc.L15.hFGF21 (L98R, P171G, Ρ182)</td>

<td> »/»71.10</td><td> 6.5</td><td>hFc.L15.hFGF21 (L98R, P171G, G182)</td>

<td> »/»63.90</td><td> 167</td><td>hFc.L15.hFGF21 (L-178, L98R, P171G)</td>

% 84'20 1941 hFc.L15.hFGF21 (L98R, P171G, GG182-3) 99.70 4307% hFc.L15.hFGF21 (L98R, P171G, GGGGG182-6)

Figure 33 shows the percentage change in blood glucose levels observed in the db / db mice suffering from CLE (background C57B6) that were injected into the PBS control sample.

And the original wild type (FGF21, FC-FGF21 (L98R, P171G) and two coated particles that

5 Proline or glycine building block has been added to it at terminal C, i.e., Fc-FGF21 (L98R).

(P171G, 182 and FC-FGF21 „182G 0) In the present example, when adding unit a

942Β9 &lt;? 1 6

-126, FGF21 alopecia a mutant or the wild branch of a C-structural polypeptide was indicated to the terminal 182 indicating G building block through the D-specific locus in the resulting protein. Then, alopecia &lt;- 181 CmBUs would have been added to the parent terminal FGF21 complete from the mutant protein or wild type. Figure 33 also shows that 5 resulted in lowering blood glucose levels for 6 hours, while all three studies showed continuous low blood glucose activity for at least a period of at least FC-FGF21 mutants and the additive subunit molecule, FC-FGF21 (L98R, P171G, 182Ρ). 120 hours of the fusion molecule was shown to be capable of FGF21 of the C component of proline at the Fcj FC-FGF21 (L98R, P171G) terminal and resulted in lower blood glucose levels compared to FGF21 (L98R, P171G, 182 G) 10.

FC-FGF21 (L98R), and in a subsequent test, the activity that was in the live cache body L was studied and compared with the activity that FC-FGF21 (L98R, P171G, 182Pb P171G, 182G) was performed in vivo for the coated molecule comprising two additives. For glycine at the terminal, 34 test results are shown. Fc-FGF21 (L98R, P171G, 182G 183G), which is ob / ob 15, Figure 34 shows the pattern of change in blood glucose levels observed in mice FC-FGF21 (L98R, P171G), FC-FGF21 (L98R, P171G, for comparison). And PBS were injected with a sample. 182G 183G), FC-FGF21 (L98R, P171G, 182G), Fc-FGF21 (L98R, P171G, 182Ρ)

yen

ΜΑ 33142Β1

-127 As shown in Fig. 34, all particulate studies and this experiment resulted in a continuous decrease in the glucose level of PBS compared to the control sample.

FC.FGF21 (L98R, P171G, 182Ρ) confirm the previous results (in Fig. 33) that they showed an improved lower efficacy of glucose compared to C which needed addition of proline at the terminal.

-FC-FGF21 (L98R, P171G) 5 with the molecule without a proline coating, for example, however, adding two glycine residues at the terminal end has been shown to reduce, FC-FGF21 (L98R, (P171G, 182G 183G) for example, C the activity of molecules in the organism also led to a shortening of the duration of the effect of low glucose in the body of the living catenary.

Figure 35 shows the change in the percentage of blood glucose levels observed in PBS mice that were injected directly using a control specimen (C57B6 with bacterium (db / db background FC-FGF21 (L98R, P171G)), FC-FGF21 (L98R, for FGF21 or Mutant polypeptide P171G, Y179S), FC-FGF21 (L98R, P171G, 179Α), FC-FGF21 (L98R, P171G, A180S), and all mutants showed the same reduced activity of Fc-FGF21 (L98R, P171G, A180G) .15 similar glucose using a similar interval for the db / db procedure Figure 36 illustrates the change in the ratio of blood glucose levels observed in Fc- mice, which were injected with a sample of blood glucose (C57B6-infected) bacterial pathogen (FGF21 background (L98R, P171G)) , FC-FGF21 (L98R, P171G, Y179F), FC-FGF21 (L98R, P171G, FC-FGF21 (L98R, P171G), FC-FGF21 (L98R, P171G, Y179F) in comparison with Α180Ε)

ΜΑ 33142Β1

-128-

It was effective in lowering blood glucose. However, FC-FGF21 (L98R (P171G, 180Ε) in which alanine at an amino acid fraction of 180 was mutated to glutamic acid, was more effective than FC-FGF21 (L98R'P171G) and resulted in an additional 20%. Decrease in blood glucose levels compared to Fc-FGF21 (L98R, P171G).

5 These data suggest that the 180Ε mutant could be associated with a decrease in the C terminal in live cache and thus improve the efficacy and efficiency of the organism gm for the molecule.

Example 22

A study on a monkey and weevil

The Fc-Linker-FGF21 architecture was constructed using the method shown here. This architecture 10 comprises the IgGl Fc sequence (sequence # 13) combined at the C terminal into the linker sequence.

Gly) 5-Ser- (Gly) 3-Ser- (Gly) 4-Ser) (sequence # 23) that is then combined at the C terminal with the N terminal end of the completed FGF21 sequence (sequence # 4), in which it is made Put two booms P17G L98R. This structure was then expressed and refined as

Demonstrated here, they were also separated into a protein diphtheria profile, and each monomer thereof was linked via 15 intermolecular disulfide bonds between the Fc region of each monomer. This molecule is referred to in

The current example “Fc-FGF21 (RG) has the homocysteine ​​amino acid sequence 36. In this example FGF21 indicates the completed form of FGF21, which is the sequence 4.

CX

Study deafening

ΜΑ 33142Β1

-129-

Fc-FGF21 (RG) structure was administered concurrently and subcutaneously (SC) in non-congenital male rhesus monkeys with a BMI greater than 35. Two groups of monkeys (n = 10 per group) were treated with either FGF21 mature (Like series # 4) or

With the material conveying the comparison sample.

5 The animals were acclimatized for 42 days before any test compound was administered and were then divided into groups of 10 and administered intravenously several injections of test compounds or control sample material in an informative manner, as shown in the scheme in Figure 37. In summary, all were injected. An animal, once a day, compound or carrier. FGF21 was given daily, while Fc0FGF21 (RG) was given weekly. FGF21J (Fc-FGF21 (RG) was increased every day.

10 Two weeks, as shown in Fig. 37. Body weight and food absorption were monitored across the study. The CRO was unknown in treatment.

Gum glucose tolerance tests (OGTTs) were performed prior to onset of treatment. OGTTl was used to classify the animals into three equivalent groups with the same animal distribution based on the area under the curve (AUC) and the bridle weight. The OGTT results have been used

15th (0GTT2) II to confirm the classification of OGTT (OGTTl I) and monkeys with shapes

An OGTT that was compatible from one (OGTTl) test to the next (0GTT2) was excluded. The results for OGTTs 1 and 2 are shown in Figures 38a and 38b, using

ΜΑ 33142Β1

-130-

AUC measurements shown in Fig.38c. The original body weight has been shown in Fig.38d and Table 20.

3 OGTTs, 4, and 5 were performed every 2 weeks at the end of each low-dose, OR

Medium or high. Blood samples were pooled from fasting animals weekly and 5 times were used to measure glucose, insulin and triglyceride levels, in addition to the levels of the compound.

the test. Blood samples were collected weekly during the 3-week scavenging period.

The primary! OGTT OGTT showed the expected glucose profile as shown in

Ordinary animals. With the maximum plasma glucose obtained at 30 min, and with AUC shown for the three groups.

10 Plasma chemistry for baseline values ​​in fasting mode has been shown in Table 20, as it was performed

Chemical measurements on blood samples collected prior to the start of treatment.

Table 20

Amphibian values ​​for body weight levels, fasting plasma glucose, and insulin,

And the glyceride of the three groups of monkeys and licorice

<td>Fc-FG21 (RG)</td><td></td><td>FGF21</td><td>The carrier material</td>

<td></td><td> 10</td><td> 10</td><td>1 for 10</td>

<td>0 to 0.4</td><td>S.5</td><td> 0.4 ±8.7</td><td>Weight; bridle (kg) 8.5 to 0.5 l</td>

ΜΑ 33142Β1

-131-

<td> 3.7 ±82.2</td><td> 5.3 ±94.8</td><td> 4.8</td><td> ±91.9؛</td><td>Plasma glucose (mg A.</td>

<td></td><td></td><td></td><td></td><td>DL)</td>

<td> 1023.4</td><td> 976.1</td><td>H</td><td> 942.6</td><td>Insulin (Picogram I.</td>

<td> 205.1</td><td> 107.7±</td><td></td><td> 121.4</td><td></td>

<td></td><td></td><td></td><td></td><td>Ml liter)</td>

<td> 9.8 ±71.7</td><td> 5.2 ±58.6</td><td> 4.8</td><td> ±44.4؛</td><td>Triglycerides (mg</td>

<td></td><td></td><td></td><td></td><td>Amal)</td>

Different dosage levels were selected, where the low dose was 0.1 and 0.3 mg kgf, the average dose was 0.3 mg / kg and the high dose was 1 and 5 mg as Fc-FGF21 (I ^ FGF21), respectively. Levels

5 Dosage based on the observed dose response in mice, with dosing regimens dependent on the expected number of injections in human beings. Equal molar doses of FGF21 have been used in low and medium doses, and high doses Fc-FGF21 (RG) have been raised to 5 mg LMOs (i.e. instead of 3 mg LMOs), which has molar equivalent to the dose of FGF21 of 1 mg (LMOs).

10 2.22 The effect of test compounds on bridle weight

8 h 6

9Α2Β9 &lt;? 1 6

-132-

In this test, in order to ensure that the effect of test compounds on the measured body weight can be measured weekly, the percentage change in body weight from baseline weight was calculated weekly in three different groups of rhesus monkeys. Body weight was also measured during the three weeks of the scavenging period. The mundane body weight values ​​are included in Table 20.

5 The bridle weight was tracked throughout this study, both before and after administration of the test compounds. Has

The bridle weight ratio changed from the baseline limit of the carriage animal over a period of time while the brine weight of the treated animal (FGF2 ^ Fc-FGF21 (RG) was overloaded in a dose dependent manner over a 6-week period of treatment, as shown in Fig. 39. As noted. Prior to that in rodents (2009) 9-250: (1) 58 Xu et al., Diabetes), treatment with

10 FGF21 statistically significantly reduces body weight. D) Fc-FGF21 (RG) had a greater exposure than that of D FGF21 (Fig. 48 and Fig. 47 respectively), with expiration of a possible explanation for the observation of Fc-FGF21 (RG) showing more decreased body weight than FGF21.

22 3 - The effect of test compounds on insulin levels 15 Insulin levels were measured in blood samples collected after fasting overnight or after

Afternoon meal.

The plasma insulin levels were measured in the fasting mode in the Rhesus supplement every week

Animals treated with either FGF21 or Fc-FGF21 (RG) and during a period

yen'

ΜΑ 33142Β1

133

Scavenging that lasts to 3 fluid levels. Fasting blood samples were taken approximately five days after the last injection of D (Fc-FGF21 (RG)) and approximately 21 hours after the time of injection of FGF21.

Plasma immolin levels were measured in feeding mode in rhesus monkeys during week 5 and 6 treatment with either the vector or FGF21 abused dose.

Elevated. Blood samples were drawn in the feeding position approximately three days after the injection of b-Fc (FGF21 (RG) and approximately two hours after the last injection. Inulin in fasting mode on the study carried out over all 9 weeks, while Figure 41 shows trophic levels

10 Insulin was determined from samples that were taken during Week 5.

Likewise, at the highest two doses, both Fc-FGF21 (RGb FGF21) reduced the

Plasma insulin levels in feeding and fasting mode. It has been observed that insulin levels in treated animals 0— Fc-FGF21 (RG) j FGF21 were reduced without noting that

An increase in glucose levels indicated increased insulin sensitivity.

15th 4.22 Effect of test compounds on OGTT (glucose and olein)

Three OGTTs (3, 4 and 5) OGTTs were initiated after treatment. Insulin and glucose 0GTT5 levels were measured in animals treated for 6 weeks using the vector or FGF21 or Fc-FGF21 (RG) corresponding to the last two weeks of the overdose regimen.

ΜΑ 33142Β1

-134-

Elevated. 0GTT5 was performed approximately 7 days after the last injection; - Fc-FGF21 (RG,

And approximately 21 hours after the last dose of FGF21 was given. Insulin and glucose 0GTT5 profiles are shown in Figures 42 and 43, respectively. Animals treated with FC-FGF21 (RG) showed improved glucose clearance compared to those treated with vector.

5 Only at the highest dose and at the last measured time point, as shown in Fig. 42. And number to the end of the last dose, Fc-FGF21 (RG) showed the best improvement in glucose clearance. FGF21 also did not show any improvement in glucose clearance. Fc-FGF21 (RG) had a greater exposure than that of FGF21 (Fig. 48 and Fig. 47 respectively), with an appropriate illustration of the observation that Fc-FGF21 (RG) showed a more profound effect on glucose disposal.

10 Instead of FGF21. Insulin levels during 0GTT5 were statistically significantly low at the last time point measured in the treated animals; - Fc-FGF21 (RG)

Compared to animals treated with the vector.

The change in AUC from the baseline was matched to three OGTTs (3, 4,

And 5) that were done at the end of both low, medium and high doses in groups

15th The three different rhesus monkeys as shown in Fig. 44. 0GTT5 was performed approximately five times a day after the last Fc-FGF21 (RG) injection and 21 hours after the last B- FGF21 injection. It was shown that Fc-FGF21 (RG) Statistically it led to AUC5 operability.

The baseline OGTT values ​​specific to each group are shown in Fig.38c.

Z

9Α2Β9 &lt;? &lt;2 1

-135-

Plasma glucose levels were measured in fasting mode on days when OGTTs were not performed. No significant statistical differences were observed in plasma glucose levels in the body

Fasting status measured between the three animal groups.

22 5 - The effect of test compounds on triglyceride levels

5 The percentage change in plasma triglyceride levels in the fasting mode of rhesus monkeys was calculated every week in animals treated with either the vector, FGF21 or Fc-FGF21 (RG) during a scavenging period of 3 weeks. Blood samples were taken in the fasting mode approximately. Every five days after the last injection of Fc-FGF21 (RG) and approximately 21 hours after the last injection of L__

FGF21. Triglyceride levels were measured every week after the start of treatment as shown

10 The change of baseline position in Figure 45, and the baseline fasting values ​​are shown in the table

20.

As shown in Fig. 45, animals treated with either Fc-FGF21 (RG) or FGF21 showed a dose-dependent decrease in triglyceride levels, with Fc-FGF21 (RG) having the least reduced effect compared to FGF21.

15th Figure 46 shows plasma triglyceride levels in the sample obtained from rhesus monkeys in the feeding position, during the fifth and sixth week using the vector or Fc-FGF21 (RG or FGF21). Fc-FGF21 (RG) injection and approximately 2 hours after the last injection! -FGF21 has been reduced.

No

MA

33142Β1

-136-

Feeding status of blood triglyceride levels in animals treated with FGF21-Fc (FGF21 (RG) - 0J) were significantly greater than the triglyceride levels in animals treated with the vector (Fig. 46).

22 6 - Concentration of test compounds

5 Exposure to the tested compounds administered roughly at equivalent molar dose levels was assessed over the course of the study period. Fc-FGF21 (RG) concentration was measured before dose and approximately 5 days after injection. FGF21 levels were measured before dose, at 5, 12, 19 and 26 days. Pain samples were withdrawn approximately 21 hours after the last injection. The concentration was shown. Individuals for the compounds tested in each monkey are in Figures 47 and 48. As shown in

10 Fig. 47, the majority of animals shown in the FGF21 treatment group had concentrations below the quantitative limit. Figure 48 also shows that animals in the Fc-FGF21 (RG) treatment group had detectable levels of Fc-FGF21 (RG) during

Each dose phase (two doses per week with the same strength). The mean concentration of each dose phase was increased approximately proportionally from 0.3 to 5 mg kg for 0Fc-FGF21 (RG).

15th There was minimal accumulation as indicated by the constant concentrations following the first and second weekly dose present in each dose phase for both compounds. During the treatment-free phase (the scavenging period), Fc-FGF21 (RG) levels were detected at approximately day 47 (12 days after the last dose) and were below the minimum accumulation (LLOQ) thereafter.

L g)

-137ΜΑ 2> 2> 942Β9

Exposure to compounds of the abused test per OGTT was also monitored. FGF21 was not detected during 3 OGTTs, and 4, after low- and intermediate-dose FGF21 treatment. However, measurable levels have been observed during 0GTT5, after dose treatment

High. The dose ratio in Fc-FGF21 (RG) levels was increased via the third OGTT to the excitatory 5 with increasing dose levels, as shown in Fig. 49.

The data of the compounds levels confirm that the animals were exposed to the expected amount of each MRI, namely FGF21 and Fc-FGF21 (RG), in an increase in dose method. Significant changes were observed in the amount of FGF21 measured, which is an expected result taking into account The sample was performed approximately 21 hours after the last dose and the half-life of FGF21

10 It was almost an hour.

7-22 1 for khatmeh

FGF21 reduced levels of olein and plasma triglycerides in the fasting and eating mode with reduced body weight at the highest doses. Fc-FGF21 (RG) resulted in improvement of OGTT with decreased levels of inulin at the highest dose.

15th Fasting and eating plasma triglyceride levels in addition to body weight. Both Fc-FGF21 (RGb FGF21) reduced the number of metabolic parameters in the non-diabetic rhesus monkeys. The levels of olein and triglycerides may match between Fc-FGF21 (RGb FGF21) when circulating the ALS levels in the same range.

ΜΑ 33142Β1

-138-

nutrition. As a result of the improved acetaminophen properties, Fc-FGF21 (RG) was better than FGF21 in most of the treatments and could be administered once a week to track the activity on the metabolic parameters.

Although the present invention has been explained in the form of several embodiments, it is understood that there are many changes and modifications that can be made for an experienced in this dissolution. And for this

5 Reason, the claimants aim to cover all these differences with respect to the isotopes and which

It is within the scope of the present invention as set forth in the claims. In addition, the titles of the parts mentioned here came with a purely regulatory imposition and had no aim to restrict the repetitive topic.

And all references denounced here in this application are referred to their contents here for reference.

No

ΜΑ 33142Β1

-139SEQUENCE LISTING <110> Belouski, Edward j.

Ellison, Murielle M. 5

Hamburger, Agnes E.

Hecht, Randy I.

Li, Yue-Sheng Michaels, Mark L,

Sun, Jeonghoon 10

Xu, Jing <120> FGF21 Mutants and Uses Thereof <130> A-1429NPPCT 15 <160> 37 <170> Patentln version 3.3 <210> 1 <211> 630 <212> DNA <213> Homo sapiens <400> 1 atggactcgg acgagaccgg gttcgagcac tcaggactgt gggtttctgt gctggctggt 60 cttctgctgg gagcctgcca ggcacacccc atccctgact ccagtcctct cctgcaattc 120 gggggccaag tccggcagcg gtacctctac acagatgatg cccagcagac agaagcccac 180 ctggagatca gggaggatgg gacggtgggg ggcgctgctg accagagccc cgaaagtctc 240 ctgcagctga aagccttgaa gccgggagtt attcaaatct tgggagtcaa gacatccagg 300 35 tgcagcttcc gggagctgct tcttgaggac ggatacaatg tttaccagtc cgaagcccac 420 ggcctcccgc tgcacctgcc agggaacaag tccccacacc gggaccctgc accccgagga 480 ccagctcgct tcctgccact accaggcctg ccccccgcac ccccggagcc acccggaatc 540 ctggcccccc agccccccga tgtgggctcc tcggaccctc tgagcatggt gggaccttcc 600 45 cagggccga gccccagcta cgcttcctga 630 <210> 2 50 (A

ΜΑ 33142Β1

-140 <211> 209 <212> PRT <213> Homo sapiens <400> 2

Met Asp Ser Asp Glu Thr Gly Phe Glu His Ser Gly Leu Trp Val Ser 15 10 15

Val Leu Ala Gly Leu Leu Leu Gly Ala Cys Gin Ala His Pro Ile Pro 20 25 30

Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin Val Arg Gin Arg Tyr 35 40 45

Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His Leu Glu Ile Arg 50 55 60

Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser Pro Glu Ser Leu 65 70 75 80

Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile Gin Ile Leu Gly Val 85 90 95

Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly Ala Leu Tyr Gly 100 105 110

Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg Glu Leu Leu Leu 115 120 125

Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His Gly Leu Pro Leu 130 135 140

His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro Ala Pro Arg Gly 145 150 155 160

Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro Ala Pro Pro Glu

165 170 175

Pro Pro Gly Ile Leu Ala Pro Gin Pro Pro Asp Val Gly Ser Asp

180 185 190 (X

ΜΑ 33142Β1

-141Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser Pro Ser Tyr Ala 195 200 205

Ser <210> 3 <211> 546 <212> DNA <213> Homo sapiens <400> 3 caccccatcc ctgactccag tcctctcctg caattcgggg gccaagtccg gcagcggtac 60 ctctacacacag atgatgccca agcagctagaa gccatgacgga Ggatgggacg 120 Gtggggggcg Ctgctgacca Gagccccgaa Agtctcctgc Agctgaaagc Cttgaagccg 180 Ggagttattc Aaatcttggg Agtcaagaca Tccaggttcc Tgtgccagcg Gccagatggg 240 gccctgtatg gatcgctcca ctttgaccct gaggcctgca gcttccggga gctgcttctt 300 25 gaggacggat acaatgttta ccagtccgaa gcccacggcc tcccgctgca cctgccaggg 360 aacaagtccc cacaccggga ccctgcaccc cgaggaccag ctcgcttcct gccactacca 420 ggcctgcccc ccgcaccccc ggagccaccc ggaatcctgg ccccccagcc ccccgatgtg 480 ggctcctcgg accctctgag catggtggga ccttcccagg gccgaagccc cagctacgct 540 tcctga 546 35 <210> 4 <211> 181 <212> PRT 40 <213> Homo sapiens <400> 4

His Pro Ile Pro Asp Ser Pro Leu Leu Gin Phe Gly Gly Gin Val 45

Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala His

25 30 ex

ΜΑ 33142Β1

-142Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin Ser

40 45

Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile Gin 50 55 60

Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp Gly 65 70 75 80

Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe Arg 85 90 95

Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala His 100 105 110

Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp Pro 115 120 125

Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro Pro

130 135 140

Ala Pro Pro Glu Pro Pro Gly Ile Leu Ala Pro Gin Pro Pro Asp Val

145 150 155

160

Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg Ser

165 170 175

Pro Ser Tyr Ala Ser 180 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220>

<223> PCR primer <400> 5 aggaggaata acatatgcat ccaattccag attcttctcc 40

Hungry

ΜΑ 33142Β1

-1435 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220>

<223> PCR primer <400> 6 tagtgagctc gaattcttag gaagcgtagc tgg

10 <210> 7 <211> 41 <212> DNA <213> Artificial Sequence <220>

<223> PCR primer <400> 7 ggagatatac atatgccaat tccagattct tctccattat t <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <220>

<223> PCR primer <400> 8 catatgtata tctccttctt aaagttaaac aaaa <210> 9 <211> 34 <212> DNA <213> Artificial <220>

<223> PCR primer <400> 9 aaaacaaatt gaaattcttc ctctatatgt atac <210> 10 <211> 10 <212> PRT <213> Artificial Sequence

50

elbow grease

ΜΑ 33142Β1

-144<220>

<223> portion of a mature human FGF21 polypeptide <400> 10 5

Met His Pro Ile Pro Asp Ser Ser Pro Leu

5 10 <210> 11 <211> 63 <212> DNA <213> Artificial Sequence <220>

<223> sense strand from a portion of an FGF21 expression construct <400> 11 ttttgtttaa ctttaagaag gagatataca tatgcatcca attccagatt cttctccatt 60 20 att 63 <210> 12 25 <211> 63 <212> DNA <213> Artificial <220> 30 <223 > antisense strand from a portion of an FGF21 expression constrtict <400> 12 aaaacaaatt gaaattcttc ctctatatgt atacgtaggt taaggtctaa gaagaggtaa 60 taa 63 <210> 13 <211> 227 40 <212> PRT <213> Homo sapiens <400>

Asp Lys Thr His Thr Cys Pro Cys Pro Ala Pro Glu Leu Leu Gly

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 50

ΜΑ 33142Β1

-145Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 35 40 45

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 50 55 60

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr Tyr 65 70 75 80

Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly 85 90 95

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 100 105 110

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val 115 120 125

Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val Ser 130 135 140

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 145 150 155 160

Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 180 185 190

Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val Met 195 200 205

His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser 210 215 220

Pro Gly Lys 225

ΜΑ 33142Β1

-1465

35

128 <210> 14 <211> 34 <212> DNA <213> Artificial Sequence <220>

<223> PCR primer <400> 14 aggaggaata acatatggac aaaactcaca catg <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220>

<223> PCR primer <400> 15 ggatccacca ccaccgctac cac <210> 16 <211> 39 <212> DNA <213> Artificial Sequence <220>

<223> PCR primer <400> 16 ggtggtggtg gatcccatcc aattccagat tcttctcca <210> 17 <211> 33 <212> DNA <213> Artificial Sequence <220>

<223> PCR primer <400> 17 tagtgagctc gaattcttag gaagcgtagc tgg <210> 18 <211> 27 <212> DNA

MA

33142Β1

-147 <213> Artificial Sequence <220>

<223> PCR primer <400> 18 atggtggaac cttcccaggg ccgaagc 27 <210> 19 10 <211> 30 <212> DNA <213> Artificial Sequence <220> 15 <223> PCR primer <400> 19 ggaaggttcc accatgctca gagggtccga 30 <210 > 20 <211> 50 <212> DNA <213> Artificial Sequence 25 <220>

<223> sense strand ftom a portion of an FGF21 expression construct <400> 20 30 ctcctcggac cctctgagca tggtgggacc ttcccagggc cgaagcccca 50 <210> 21 <211> 30 35 <212> DNA <213> Artificial <220>

<223> PCR primer 40 <400> 21 agcctgggag actcgtacca ccttggaagg 30 <210> 22 <211> 50 <212> DNA <213> artificial <220>

<223> antisense strand fiom a portion of an FGF21 expression construct

٩

ΜΑ 33142Β1

-148 <400> 22 gaggagcctg ggagactcgt accaccctgg aagggtcccg gcttcggggt 50 <210> 23 <211> 15 <212> PRT <213> Artificial Sequence <220>

<223> linker sequence <400> 23

Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser 15 10 15 <210> 24 <211> 424 <212> PRT <213> Artificial <220>

<223> Recombinant fusion protein sequence <400> 24

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95 (A

ΜΑ 33142Β1

-149Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

225 230 235 240 35

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr

260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala

275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu 290 295 300

Lys Ala Leu Lys Pro Gly

<img file="MA33142B1_D0011.tif" />

9Α2Β9 &lt;? 1 6

150Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly Ile Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 25 <211> 424 <212> PRT <213> Artificial <220>

<223> Recombinant fusion protein <400> 25

Met His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly Gly Gin 15 10 15

Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr Glu Ala 20 25 30

His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala Asp Gin

٩'

ΜΑ 33142Β1

-15135

Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly Val Ile 50 55 60

Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg Pro Asp 65 70 75 80

Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys Ser Phe 85 90 95

Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser Glu Ala 100 105 110

His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His Arg Asp 115 120 125

Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly Leu Pro 130 135 140

Pro Ala Pro Pro Glu Pro Pro Gly Ile Leu Ala Pro Gin Pro Pro Asp 145 150 155 160

Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Ser Gin Gly Arg 165 170 175

Ser Pro Ser Tyr Ala Ser Gly Gly Gly Gly Gly Ser Gly Gly Gly Ser 180 185 190

Gly Gly Gly Gly Ser Asp Lys Thr His Thr Cys Pro Cys Pro Ala 195 200 205

Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 210 215 220

Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val

225 230 235 240

Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val

ΜΑ 33142Β1

-152245 250 255

Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin

260 265 270 5

Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin 275 280 285

Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 290 295 300

Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro

305 310 315 320

Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr

325 330 335

Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser

340 345 350

Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr 355 360 365

Lys Thr Thr Pro Pro Val 370 375

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr

380

Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe 385 390 395 400

Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys

405 410 415

Ser Leu Ser Leu Ser Pro Gly Lys

420 <210> 26 <211> 424 <212> PRT 50 <213> Artificial

<img file="MA33142B1_D0012.tif" />

ΜΑ 33142Β1

-153<220>

<223> Recombinant fusion protein <400> 26

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

ΜΑ 33142Β1

-154Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys

325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser

340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His

355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Gly Ile Leu Ala Pro Gin Pro

385 390

395 400

<img file="MA33142B1_D0013.tif" />

ΜΑ 33142Β1

-155

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Glu Pro Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 27 <211> 424 <212> PRT <213> Artificial <220>

<223> Recombinant fusion protein <400> 27

Met Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 15 10 15

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 20 25 30

Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Ser 35 40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val

<img file="MA33142B1_D0014.tif" />

ΜΑ 33142Β1

-156

130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr

180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val

195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly

245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr

260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala

275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly

290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg

305

310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys

325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser

<img file="MA33142B1_D0015.tif" />

ΜΑ 33142Β1

-157340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly Ue Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Ala Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 28 <211> 424 <212> PRT <213> Artificial <220>

<223> Recombinant fusion protein <400> 28

Met Asp Lys Thr His Thr Cys Pro Cys Pro Ala Pro Glu Leu Leu

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu

25 30

Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser

40 45

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu

55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr

70 75

<img file="MA33142B1_D0016.tif" />

ΜΑ 33142Β1

-158Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin

115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val 195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 225 230 235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly 245 250 255

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

ΜΑ 33142Β1

-159Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg

305 310 315

320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys

325 330 335

Ser Phe Arg Glu Leu Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser

340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His

355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly

370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Gly Ile Leu Ala Pro Gin Pro

385 390

395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Pro Leu Gin

405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser <210> 29 <211> 4 <212> PRT 40 <213> Artificial <220>

<223> linker <400> 29

Gly Gly Gly Gly <210> 30

٢١

ΜΑ 33142Β1

-160 <211> 5 <212> PRT <213> Artificial <220> 5 <223> linker <400> 30

Gly Gly Gly Gly Gly 10 <210> 31 <211> 15 15 <212> PRT <213> Artificial <220>

<223> linker 20 <400> 31

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser <210> 32 <211> 8 <212> PRT 30 <213> Artificial <220>

<223> linker <400> 32

Gly Gly Gly Lys Gly Gly Gly Gly

5 <210> 33 <211> 8 <212> PRT <213> Artificial 45 <220>

<223> linker <400> 33 50

Gly Gly Gly Asn Gly Ser Gly Gly

<img file="MA33142B1_D0017.tif" />

ΜΑ 33142Β1

-1611 5 <210> 34 <211> 8 5 <212> PRT <213> Artificial <220>

<223> linker 10 <400> 34

Gly Gly Gly Cys Gly Gly Gly Gly <210> 35 <211> 5 <212> PRT 20 <213> Artificial <220>

<223> linker <400> 35

Gly Pro Asn Gly Gly

5 <210> 36 <211> 424 <212> PRT <213> Artificial 35 <220>

<223> recombinant fusion protein <400> 36 40

Met Asp Lys Thr His Thr Cys Pro Cys Pro Ala Pro Glu Leu Leu

Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu

Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 50

40 45

٢١

1 621 9942 9

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr 65 70 75 80

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn 85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 100 105 110

Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin 115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val 130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro 165 170 175

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val

195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

225 230

235 240

Gly Gly Ser His Pro Ile Pro Asp Ser Ser Pro Leu Leu Gin Phe Gly

245 250 255 a

-16310

9Α2Β9 &lt;? 1 6

Gly Gin Val Arg Gin Arg Tyr Leu Tyr Thr Asp Asp Ala Gin Gin Thr 260 265 270

Glu Ala His Leu Glu Ile Arg Glu Asp Gly Thr Val Gly Gly Ala Ala 275 280 285

Asp Gin Ser Pro Glu Ser Leu Leu Gin Leu Lys Ala Leu Lys Pro Gly 290 295 300

Val Ile Gin Ile Leu Gly Val Lys Thr Ser Arg Phe Leu Cys Gin Arg 305 310 315 320

Pro Asp Gly Ala Leu Tyr Gly Ser Leu His Phe Asp Pro Glu Ala Cys 325 330 335

Ser Phe Arg Glu Arg Leu Leu Glu Asp Gly Tyr Asn Val Tyr Gin Ser 340 345 350

Glu Ala His Gly Leu Pro Leu His Leu Pro Gly Asn Lys Ser Pro His 355 360 365

Arg Asp Pro Ala Pro Arg Gly Pro Ala Arg Phe Leu Pro Leu Pro Gly 370 375 380

Leu Pro Pro Ala Pro Pro Glu Pro Pro Gly Ile Leu Ala Pro Gin Pro 385 390 395 400

Pro Asp Val Gly Ser Ser Asp Pro Leu Ser Met Val Gly Gly Ser Gin 405 410 415

Gly Arg Ser Pro Ser Tyr Ala Ser 420 <210> 37 <211> 1274 <212> DNA <213> Artificial <220>

<223> recombiant fusion protein

-164ΜΑ 33142Β1 <400> 37 atggacaaaa ctcacacatg tccaccttgt ccagctccgg aactcctgggggggaccgtca 60:; ;; acccaaggac accctcatga tctcccgtac ccctgag120:; taccgtgtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac 300 aagtgcaagg tctccaacaa agccctccca gcccccatcg agaaaaccat ctccaaagcc 360 aaagggcagc cccgagaacc acaggtgtac accctgcccc catcccgtga tgagctgacc 420 aagaaccagg tcagcctgac ctgcctggtc aaaggcttct atcccagcga catcgccgtg 480 gagtgggaga gcaatgggca gccggagaac aactacaaga ccacgcctcc cgtgctggac 540 tccgacggct ccttcttcct ctacagcaag ctcaccgtgg acaagagccg ttggcagcag 600 gggaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta cacgcagaag 660 ggtggatccc atccaattcc agattcttct ccattattac aattcggggg ccaagtccgg 780 cagcggtacc tctacacaga tgatgcccag cagacagaag cccacctgga gatcagggag 840 gatgggacgg tggggggcgc tgctgaccag agccccgaaa gtctcctgca gctgaaagcc 900 ttgaagccgg gagttattca aatcttggga gtcaagacat ccaggttcct gtgccagcgg 960 ccagatgggg ccctgtatgg atcgctccac tttgaccctg aggcctgcag cttccgggag 1020 cgtcttcttg aggacggata caatgtttac cagtccgaag cccacggcct cccgctgcac 1080 ctgccaggga acaagtcccc acaccgggac cctgcacccc gaggaccagc tcgcttcctg 1140 ccactaccag gcctgccccc cgcacccccg gagccacccg gaatcctggc cccccagccc 1200 cccgatgtgg gctcctcgga ccctgcgagc atgaggtgggcct 12 gccgccgcggc atgaggtggggc

661Α2Β1

-165