Precise breeding

ES 2 602 133 T3

DESCRIPTION

Accurate reproduction

Field of the invention

The present description relates to methods to improve the nutritional, health and agronomic characteristics of a plant by means of specific modification of well-characterized DNA in the genome of the plant. Unlike a classic plant breeding, the process does not include unknown or potential toxic genes in the plant's genetic makeup. Additionally, the method, unlike conventional genetic engineering strategies, does not incorporate nucleic acids from foreign species, that is, species that are not interfertile with the plant to be modified by genetic engineering, into the genome of the plant. Plants developed through this plant reproduction process show improved agronomic characteristics. Particularly preferred plants include potatoes that exhibit improvements in tuber health and storage characteristics, and grasses that exhibit improvements in tolerance to disease and drought.

Background

The agronomic performance of plants has typically been improved either by classical plant breeding or genetic engineering. Classical reproduction typically results in the transfer of unknown nucleic acids from one plant to another. Genetic engineering techniques introduce foreign nucleic acids into the plant genome, that is, DNA that is not from a plant that is naturally infertile with the plant that is to be genetically engineered. For example, genetic engineering introduces non-plant nucleic acids into a plant genome. Both classical breeding and genetic engineering strategies create plant genomes that contain unwanted and unnecessary genetic material, and the resulting cross or transgenic plants may exhibit unfavorable traits. The shortcomings of both strategies can be detrimental to transgenic plants, as well as to the animals and humans that consume such products.

Conventional reproduction is based on the transfer of unknown DNA

Plant reproduction typically relies on the random recombination of plant chromosomes to create varieties that have new and improved characteristics. In this way, by screening large populations of progeny that result from plant crosses, breeders can identify those plants that display a desired trait, such as increased yield, improved vigor, greater resistance to disease and insects, or greater ability to survive in drought conditions. However, classical breeding methods are laborious and time consuming, and newer varieties typically show only relatively modest improvements.

Additionally, classical plant reproduction typically results in the transfer of hundreds of unknown genes into a plant genome. It is likely that some of these transferred genes encode potentially harmful allergens, such as patatin, lectins, chitinases, proteases, proteins such as thaumatin, lipid transfer proteins, amylases, trypsin inhibitors, and seed storage proteins (Breiteneder et al. , J Allergy Clin Immunol 106: 27-36).

Similarly, gene introgression may be involved in the biosynthesis of toxins including pyrogens, hydrazines, glucosinolates and goitrogens, coumarins, saponins, alkaloids, glycoalkaloids, biogenic amines, enzyme inhibitors, such as lectins (hemagglutinins), trypsin inhibitors, chelating substances such as phytates and oxalates, ribotoxins, antimicrobial peptides, amino acids such as beta-N-oxalylamino-L-alanine, attractiloside, oleandrin, taxol, and isoquinoline (Pokorny, Cas Lek Cesk 136: 267-70, 1997). The risk of inadvertently introducing such toxins into the human and animal food supply is further increased through efforts to straighten out the genetic diversity of related wild crops that have not previously been used for food consumption (Hoisington et al., Proc Natl. Acad Sci USA 96: 5937-43, 1999).

Although classical plant breeding can easily introduce genes involved in unwanted antinutritional compounds into food crops and plants, it cannot be easily removed. For example, it took approximately 15 years to reduce harmful phytate levels in corn and rice by inactivating Lpa genes (Raboy, J Nutr 132: 503S-505S, 2002). The long time frame for achieving positive results is not practical, especially since there is an urgent need for methods that more effectively and efficiently improve the quality of food cultures. For example, a gene that has only recently been found to be associated with the synthesis of antinutritional compounds is the polyphenol oxidase (PPO) gene, which oxidizes certain phenolic compounds to produce mutagenic, carcinogenic, and cytotoxic agents such as phenoxy radicals and quinoid derivatives. (Kagan et al., Biochemistry 33: 9651-60, 1994). The presence of multiple copies of this gene in the genome of plants such as potatoes makes it particularly difficult to reduce PPO activity through reproduction.

ES 2 602 133 T3

Even more time is needed for the elimination of antinutritional compounds if little or nothing is known about their genetic bases. For example, genes have not been linked to the accumulation of high concentrations of acrylamide, a potent and mutagenic neurotoxin, in some potatoes that are heated to 160 ° C or higher (Tareke et al., J Agric Food Chem. 50: 4998 -5006, 2002). It is therefore very difficult to efficiently develop new varieties of potatoes that produce less acrylamide during processing using conventional breeding. Thus, there is a need to grow potatoes and other carbohydrate-rich foods, such as wheat with reduced levels of such harmful compounds, but without the use of unknown or foreign nucleic acids.

Other antinutritional compounds that can accumulate during processing and are difficult to minimize or eliminate through reproduction include the products of the Maillard reaction N-Nitroso-N- (3-keto-1,2-butanediol) -3'-nitrothyramine ( Wang et al., Arch Toxicol 70: 10-5, 1995), and 5-hydroxymethyl-2-furfural (Janzowski et al., Food Chem Toxicol 38: 801-9, 2000). Additional Maillard reaction products that have not been well characterized are also known to show mutagenic properties (Shibamoto, Prog Clin Biol Res 304: 359-76, 1989).

It can be equally difficult to rapidly increase the levels of positive nutritional compounds in food crops due to the inherent imprecision of conventional plant breeding. For example, it would be desirable to increase levels of resistant starch (Topping et al., Physiol Rev 81: 1031-64, 2001) in a variety of crops. Such starch is ultimately responsible for promoting immune responses, suppressing potential pathogens, and reducing the incidence of diseases including colorectal cancer (Bird et al., Curr Issues Intest Microbiol 1: 25-37, 2000). However, the only plants available to increase levels of resistant starch are low-yielding varieties such as the tasteless, sugary-2 maize mutant amylose extender maize mutants. The creation of new sources of high-strength starch, such as potatoes, would allow the broader dietary incorporation of this health-promoting component.

The inability to safely manipulate plant phenotypes usually leads to the use of external chemicals to induce a desired phenotype. Despite numerous breeding programs to delay tuber germination, for example, there are no commercially available varieties of potatoes that can be stored for months without treatment with germination inhibitors. The latter, such as isopropyl-N-chlorophenyl-carbamate (CIPC), is linked to acute toxicity and tumor development, and can be present in processed potato foods in concentrations between 1 mg / kg and 5 mg / kg.

Genetic engineering is based on the transfer of foreign DNA

Genetic engineering can be used to modify, produce, or eliminate certain plant traits. While there has been limited progress in improving the nutritional value and health characteristics of plants, most improvements are directed at plant traits that promote ease of cultivation. Thus, certain plants are resistant to the herbicide glyphosate because they contain the bacterial gene 5-enolpyruvylsychimate-3-phosphate synthase (Padgette et al., Arch Biochem Biophys. 258: 564-73, 1987). Similarly, genetic engineering has produced plant varieties resistant to insects, viruses, fungi (Shah et al., Trends in Biotechnology 13: 362-368, 1995; Gao et al., Nat Biotechnol. 18: 1307-10, 2000; Osusky et al., Nat Biotechnol. 18: 1162-6, 2000 and WO 99/53050), but few with improved nutrition or health benefits.

Genetic engineering has, however, been used to decrease the sugar content in plant tissue in order to reduce the occurrence of the Maillard reaction (US 6,207,880, Lorbeth et al., Nature Biotechnology 16: 473 -477, 1998, EP 0 628 636 and Coetzer et al.) Journal of Agriculture and Food Chemistry 49: 52-657, 2001).

According to standard, well-known techniques, gene expression cassettes, comprising genes and regulatory elements, are inserted within the boundaries of isolated Agrobacterium transfer DNAs (TDNAs) integrated into plant genomes. Thus, Agrobacterium-mediated transfer of T-DNA material typically comprises the following standard procedures: (1) in vitro recombination of genetic elements, at least one of which is of foreign origin, to produce an expression cassette for transformation selection, (2) insertion of this expression cassette, usually together with at least one cassette of different expression containing foreign DNA, in a T-DNA region of a binary vector, usually consisting of several hundred base pairs of Agrobacterium DNA flanked by TDNA border sequences, (3) transfer of localized sequences between T-DNA borders, usually accompanied by some or all of the additional binary vector sequences from Agrobacterium into the plant cell, and (4) selection of stably transformed plant cells. see, for example, US Nos. 4,658,082, 6,051,757, 6,258,999, 5,453,367, 5,767,368, 6,403,865, 5,629,183, 5,464,763, 6,201,169, 5,990,387, 4,693,976, 5,886,244, 5,221,623, 5,736,369, 4,940,838, 6,1403,865, EP 0,629,183, 5,464,763, 6,201,169, 5,990,387, 4,693,976, 5,886,244, 5,221,623, 5,736,369, 4,940,838, 6,1403,812, EP 0,440,838, 6,14053,812, EP 0 016, 5,464,763, 6,14053,812, EP 0,440,838, EP 6,14053,812, EP 0 561,082, 1,009,842A1, 0 853,675A1, 0 486,233B1, 0 554,273A1, 0 270,822A1, 0 174,166A1, and WO 01/25459.

Thus, genetic engineering methods are based on the introduction of foreign nucleic acids into the food supply. Those techniques transfer complex fusions of a few or more than 20 elements

ES 2 602 133 T3 genetic isolates of viruses, bacteria, and plants, which are not native to the transformed plant species. Such foreign elements include regulatory elements such as promoters and terminators, and genes that are involved in the expression of a new trait or function as markers to identify or select for transformation events. Despite testing of foods containing foreign DNA for safety prior to regulatory approval, many consumers are concerned about the long-term effects of consuming foods that express foreign proteins, which are produced by genes obtained from species other than plants. .

A commonly used regulatory element is the cauliflower mosaic virus (CaMV) 35S "super" promoter, which is typically used in plant engineering to induce high levels of expression of transgenes to which it is directly linked. However, the 35S promoter can also enhance the expression of native genes in its vicinity (Weigel et al., Plant Physiol., 122: 1003-13, 2000). Such promoters can thus induce unpredictable alterations in endogenous gene expression, possibly resulting in undesired effects such as increased alkaloid production. Preferred strong promoters are generally those isolated from viruses, such as rice tungro bacilliform virus, maize streak virus, cassava vein virus, mirabilis virus, peanut chlorotic streak caliomovirus, Scrofularia mosaic virus and chorella virus. Other frequently used promoters are cloned from bacterial species and include the nopaline synthase and octapine synthase gene promoters.

To obtain proper gene translation termination, the terminator sequences are fused to the 3 'end of transgenes and include genetic elements from the Agrobacterium nopaline synthase and octopine synthase genes. Other genetic elements can be used to further enhance gene expression or direct the expressed protein to certain cellular compartments. These elements include introns to drive transgene expression and signal peptide sequences to target the foreign gene for certain cellular compartments, usually derived from foreign plant species.

Certain genes involved in the expression of a new trait are more frequently derived from foreign sources. If native genes are used, they are usually reversed to silence the expression of that gene in transgenic plants and co-transformed with foreign DNA such as a selectable marker. The main disadvantage of this antisense technology is that inverted DNA usually contains new, uncharacterized, open reading frames inserted between a promoter and a terminator. Thus, potato plants that were genetically modified with antisense constructs derived from the starch related R1 gene (Kossmann et al., US 6,207,880), L and H type glucan phosphorylase genes (Kawchuk et al., US 5,998,701, 1999), the polyphenol oxidase gene (Steffens, US 6,160,204, 2000), and genes for starch branching enzymes I and II (Schwall et al., Nature Biotechnology 18: 551-554, 2000) all potentially express new peptides consisting of at least 50 amino acids (Table 1). These new peptides can interfere with the development of the plant and / or reduce the nutritional value of the potato, and are therefore undesirable.

Conventional marker genes are incorporated into genetic constructs and are used to select for transformation events. These confer either antibiotic or herbicidal resistance (US 6,174,724), a metabolic advantage (US 5,767,378), or a morphologically subnormal phenotype (US 5,965,791) for the transformed plant. Such markers are typically derived from bacterial sources.

Additionally, because of T-DNA transfer infidelity, approximately 75% of transformation events in plants such as tomato, tobacco, potato contain plasmid backbone sequences in addition to T-DNA (Kononov et al., Plant J.11: 945-57, 1997). The presence of such backbone sequences is undesirable because they are foreign and typically contain origins of replication and antibiotic resistance gene markers.

There are several methods for removing elements such as foreign marker genes, but few are easily applicable to plant genetic engineering. According to one such method, the labeled gene and the desired gene or nucleotide sequences are located in different vectors. Infection of plants with either an Agrobacterium strain carrying both vectors (US document No. 6,265,638) or two Agrobacterium strains where each carries one of the vectors can occasionally result in unlinked integration events, which can be genetically separated through outbreeding. The main disadvantage of this method is that the genetic separation of loci can be very laborious and time consuming, especially if the T-DNA integration events are linked. Additionally, this method is not widely applicable in apomictic plants, which reproduce asexually, such as Kentucky bluegrass, or vegetatively propagated crops such as potatoes, which cannot be rapidly spawned due to inbreeding depression, high levels of heterozygosity, and low fertility levels.

Another method of removing foreign genetic elements is based on inserting the foreign gene, such as the selectable marker gene, into a transposing element. The modified transposing element can then be spliced ​​out of the genome at low frequencies. The traditional crosses with plants must then be made.

ES 2 602 133 T3 not transformed to separate the rearranged element from the host (US 5,482,852). As described by the method above, this alternative method cannot be used for vegetatively propagated or apomictic plant systems.

A third method of removing a marker uses the bacteriophage P1 Cre / lox site-specific collection system (Dale & Ow, Proc. Natl. Acad. Sci. USA, 88: 10558-62, 1991). The insertion of a marker gene together with the Cre recombinase gene and a chimeric gene involved in the induction of Cre (both with their own promoters and terminators) between two lox sites, leads to the cleavage of the region delineated by the lox sites during the regeneration process (Zuo et al., Nat. Biotechnol., 19: 157-61, 2001). This complicated process is inefficient and unreliable, and can cause genome instability.

Recent studies report that some plant genes by themselves can be used as transformation markers. Examples of such plant markers include Pga22 (Zuo et al., Curr Opin Biotechnol. 13: 173-80, 2002), Cki1 (Kakimoto, Science 274: 982-985, 1996) and Esr1 (Banno et al., Plant Cell 13: 2609-18, 2001). All genes, however, trigger cytokinin responses, which confer an undesirable phenotype on the transformed plant. Additionally, such plant markers would still need to be removed after transformation by any of the methods described above.

Alternative methods for transforming plants are also based on the in vitro recombination of foreign genetic elements, and are based on bacterial plasmid sequences for conservation in E. coli, parts of which are cointegrated during the transformation procedure. Examples of such methods for transforming plants with foreign DNA are described in US Nos. 5,591,616, 6,051,757, 4,945,050, 6,143,949, 4,743,548, 5,302,523, and 5,284,253.

Marker-free transgenic plants can also be obtained by omitting any selection procedure before regeneration. A disadvantage of this method is that the majority of events generated through this method will represent non-transformed or chimeric plants because these will usually not be derived from individual transformed plant cells. It is extremely difficult and time consuming to use a free marker procedure for the identification of transgenic plants containing the same DNA insertions in all their cells.

Thus, there is a very important need to improve plants beyond what can be achieved through classical breeding crosses and conventional genetic engineering techniques, and that are not based on the insertion of unknown or foreign nucleic acid into a genome. plant. Accordingly, the present disclosure provides methods and compositions for precisely modifying plant-specific genetic material. In this way, the inventive precise breeding strategy does not include undesirable phenotypes and does not introduce unknown or foreign nucleic acid into a plant genome.

Resume

The present disclosure provides methods of genetically improving the nutritional value and agronomic performance of a plant without the permanent or stable incorporation of either unknown or foreign DNA into the genome of that plant. According to these methods, specific, well-characterized nucleic acids, gene elements, and genes are isolated from a desired plant species or from a plant species that is sexually compatible with the desired, modified plant, and then reinserted into the genome. of the desired plant species. Modification can involve mutation of the isolated nucleic acid sequence, deletion of parts of the isolated nucleic acid, or simply attachment of the nucleic acid to another polynucleotide, such as subcloning of the isolated nucleic acid into a plasmid vector.

Consequently, the transgenic plants produced by the methodology do not possess genomes that comprise any nucleic acid of foreign species. In this way, the method produces a transgenic plant whose genome does not comprise a non-plant species promoter, does not comprise a non-plant species terminator, does not comprise a non-plant 5 'untranslated region, does not comprise an untranslated region 3 'from a non-plant species, does not comprise a marker gene from a non-plant species, does not comprise a regulatory element from a non-plant species, does not comprise a gene from a non-plant species and does not comprise any other polynucleotide that is obtained from a genome of a non-plant species.

Thus, the present location provides a method of producing a stable transgenic plant exhibiting a modified phenotype that is not exhibited by the non-transformed plant, comprising (a) transforming plant cells with a polynucleotide; (b) growing plants with the transformed cells; and (c) selecting a plant stably transformed with the said desired polynucleotide that exhibits a new phenotype that is not exhibited by plants grown from the corresponding non-transformed plant cells. Preferably, the desired polynucleotide consists essentially of (i) nucleic acid sequences that are isolated from and / or native to the genome of plant cells, or other sources of the same species, or are isolated from and / or native to the genome of a plant species that is sexually compatible with the plant from which the plant cells were isolated; and (ii) at least one DNA sequence that is a similar border sequence that has a sequence that

ES 2 602 133 T3 is native to the genome of said plant cells of the same species, or is native to a plant that is sexually compatible with the plant from which the plant cells were isolated, and in which the sequence of Similar frontier is capable of stably integrating the desired polynucleotide into the genome of such plant cells.

A preferred method involves producing a transgenic plant that exhibits a modified phenotype that is not exhibited by the non-transformed plant, which comprises (a) infecting plants with Agrobacterium that carry (i) a PDNA vector, which contains a polynucleotide that is native to the transgenic plant, and (ii) a LifeSupport vector containing an expression cassette containing a selectable marker gene; (b) selecting for transient expression of the selectable marker gene, preferably for 1-10 days, for 3-7 days, or for 4-5 days; (c) transferring explants to regeneration media to allow bud formation; (d) screening shoot populations to determine which one comprises at least one copy of the desired polynucleotide in their genomes and, of those, which shoots do not contain any foreign nucleic acid, such as the selectable marker gene, in their genomes; and (e) allowing shoots containing the desired polynucleotide in their genomes but no DNA marker genes, to grow into whole plants, in which the resulting whole plants exhibit a modified phenotype that is not exhibited by plants grown from untransformed plant cells of the same species.

According to such a method, the desired polynucleotide (i) consists essentially of only elements that are isolated from and / or native to the genome of the plant cell species or sexually compatible species thereof; (ii) comprises at least one border element having a sequence that is isolated from, or native to, the genome of the plant cell species or sexually compatible species thereof, and is capable of stably integrating the desired polynucleotide into the genome of a plant cell exposed to the vector; and (iii) is stably integrated into the genome of the transformed plant; wherein the method does not integrate DNA from non-plant or foreign species into the genome of the transformed plant.

Additionally, any selectable marker gene can be selected as an indicator of successful transformation. For example, a neomycin phosphotransferase marker gene, or an hpt marker gene can be used to confer resistance to aminoglycoside antibiotics, kanamycin and hygromycin respectively. Other marker genes include the marker gene bar, which confers resistance to the herbicide phosphinothricin; the DHFR marker gene, which confers resistance to methotrexate; and the ESPS marker gene, which confers resistance to the pooled herbicide. It is well known in the art how to monitor the expression of such marker genes to determine whether or not it was stably expressed in the genome of a transformed plant cell. Consequently, it is known to the person skilled in the art how to follow the expression of the marker gene to determine that the marker gene is only transiently expressed in the transformed plant cell.

Also provided is a method of making a stably transformed plant comprising the steps of: (1) identifying a target gene; (2) isolating a leader sequence or DNA trailer associated with said target gene; (3) optionally modifying said leader or trailer DNA; (4) operably linking said leader or trailer DNA to native regulatory elements to form an expression cassette; (5) inserting said expression cassette into a PDNA that is localized to a binary vector, wherein the binary vector also carries an operable cytokinin gene such that the inadvertent insertion of additional binary vector sequences, which are of foreign origin, they are detected by expression of the cytokinin gene; (6) introducing the modified binary vector into Agrobacterium; (7) stably integrate the rearranged native DNA into plant cell genomes using LifeSupport mediated transformation; (8) regenerating plant cells containing rearranged native DNA; (9) rule out plants that show a cytokinin overproduction phenotype and that do not regenerate completely; and (10) maintaining additional paralysis of desirable plants that are indistinguishable from non-transformed plants.

Also described, a method of modifying the expression of a trait in a selected plant species is provided. The method may comprise (1) identifying the trait to be modified; (2) construct a recombinant DNA molecule consisting essentially of genetic elements isolated from, or native to, the selected plant species, in which the recombinant DNA molecule, when integrated into the genome of the selected plant species, modifies the expression of the trait in transformed plant species; (3) stably integrate the recombinant DNA molecule into cells of selected plant species using LifeSupport mediated transformation; and (4) identifying transformed plants that exhibit the modified expression of the trait.

Preferably, the polynucleotide that is native to a desired plant is inserted into the genome of the desired plant via infection of explants with two different Agrobacterium strains. A first Agrobacterium strain is capable of transferring native DNA from P-DNA vectors to plant cells; a second strain can transfer a T-DNA carrying an expression cassette for a selectable marker gene for plant cells. Examples of the latter vector include the so-called LifeSupport vectors described herein. By preferably selecting plants that transiently express the marker gene for 1-10 days, for 3-7 days, or for 4-5 days, and subsequently transferring explants to regeneration media, a population of events is obtained, part of which represents plants that contain at least one copy of the polynucleotide, but that lack any copy of the T-DNA or marker gene.

ES 2 602 133 T3

A single Agrobacterium strain can be used that carries both a P-DNA vector, which harbors the desired, native gene of interest or polynucleotide between similar border sequences of P-DNA, and a LifeSupport vector, which contains a marker gene. The marker gene may, or may not, be inserted between P-DNA-like border sequences, T-DNA border sequences, or other T-DNA-like border sequences.

Thus, preferably, the P-DNA vector contains at least two expression cassettes, one of which comprises a native selectable or screened marker gene driven by a native promoter and followed by a native terminator.

By selecting preferably for at least 2 days and more preferably for at least 5 days for native marker gene expression and subsequently transferring explants to regeneration media, a population of events is obtained representing plants that contain at least one copy of the stably introduced DNA. integrated into their genomes. Preferably, the plant-derived marker gene encodes a mutant 5-enolpyruvul-3phosphosichemical acid synthase or tryptophan decarboxylase. More preferably, the selectable marker gene encodes for salt tolerance. More preferably, the salt tolerance gene has the nucleotide sequences shown in SEQ ID 35 and is used to screen for transformation events in potatoes.

Modified expression of the trait can be characterized by increased expression, decreased expression, or undetectable expression.

A plant can be made by the method of (1) identifying the trait to be modified; (2) construct a recombinant DNA molecule that essentially consists of isolated genetic elements from the selected plant species, in which the recombinant DNA molecule, when integrated into the genome of the selected plant species, modifies the expression of the trait in the species processed vegetables; (3) stably integrates the recombinant DNA molecule into cells of selected plant species through LifeSupport mediated transformation; and (4) identification of transformed plants exhibiting modified expression of the trait is provided.

Additionally, a method of modifying the expression of a trait in a selected plant species is provided. This method comprises (1) identifying the trait to be modified; (2) construct a recombinant DNA molecule that consists essentially of (a) genetic elements isolated from the selected plant species, in which the genetic elements, when they were integrated into the genome of the selected plant species, modified the expression of the trait in the transformed plant species; and (b) a selectable marker gene that is isolated from the same plant species; (3) stably integrate the recombinant DNA molecule into cells of selected plant species through LifeSupport-mediated transformation; (4) detect the selectable marker gene; and (5) identifying transformed plants that exhibit modified expression of the trait.

Also provided is a plant that exhibits a modified expression of a trait. The plant may have stably integrated into its genome a recombinant DNA molecule consisting essentially of genetic elements isolated from a plant of the same species, or from a plant that is sexually compatible with those species, in which the DNA molecule Recombinant modifies the expression of the trait.

Also provided is a nucleotide sequence referred to as plant-DNA (P-DNA). Preferably, the P-DNA itself lacks the genes or parts thereof and is delineated by the terminal, similar border sequences of T-DNA that share at least 50%, at least 75%, at least 90% or at least 95% sequence identity with the nucleotide sequence of the T-DNA borders of any virulent Agrobacterium strain, and supporting efficient transfer of the entire Agrobacterium P-DNA to plant cells.

Preferably a similar border sequence promotes and facilitates the integration of a polynucleotide to which it is linked. Additionally, each terminal sequence of the modified P-DNA can be between 5-100 bp in length, 10-80 bp in length, 15-75 bp in length, 15-60 bp in length, 15-50 bp in length, 15- 40 bp in length, 15-30 bp in length, 16-30 bp in length, 20-30 bp in length, 21-30 bp in length, 22-30 bp in length, 23-30 bp in length, 24-30 bp in length, 25-30 bp in length, or 26-30 bp in length. More preferably, the similar border sequence is between 20 and 28 nucleotides in length.

The left and right border sequences of P-DNA of the present invention can be isolated from and / or are native to the genome of a plant to be modified and are not identical in nucleotide sequence to any border sequence of T -DNA derived from Agrobacterium known. In this way, a P-DNA border sequence can have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides that are different from a T-DNA border sequence of an Agrobacterium species, such as Agrobacterium tumefaciens or Agrobacterium rhizogenes. Alternatively, a P-DNA boundary or similar boundary sequence of the present invention is at least 95%, at least 90%, at least 80%, at least 75%, at least 70%, at least 60% or at least less 50% sequence identity to a T-DNA border sequence from an Agrobacterium species, such as Agrobacterium tumefaciens or Agrobacterium rhizogenes. More preferably, a native plant P-DNA border sequence sharing greater than or equal to 99%,

ES 2 602 133 T3

98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82% , 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65 %, 64%, 63%, 62%, 61%, or 60% identity of nucleotide sequences with an Agrobacterium T-DNA border sequence.

A similar border sequence can be isolated from a plant genome and then modified or mutated to change the efficiency by which it is capable of integrating one nucleotide sequence into other nucleotide sequences. Other polynucleotide sequences can be added to or incorporated into a similar border sequence of the present invention. In this way, a P-DNA left border or a P-DNA right border can be modified so that it has multiple 5'-3'- cloning sites, or additional restriction sites. Additionally, a P-DNA boundary sequence can be modified to increase the probability that the accompanying DNA backbone is not integrated into the plant genome.

Even more preferably, P-DNA is isolated from any plant by using degenerate primers in a polymerase chain reaction. P-DNA can be derived from potatoes, can be terminal delineated 25-bp with 80 and 88% identity to conventional T-DNA borders, respectively, and can have the nucleotide sequences shown in SEQ ID NO. 1. Alternatively, the P-DNA can be derived from wheat, can be 25-bp terminal delineated with 72% and 92% identity to conventional T-DNA borders, respectively, and can contain the nucleotide sequences shown in SEQ ID NOT. 3. 4.

Such P-DNA can be modified so that it comprises other polynucleotides positioned between similar border sequences. Preferably, the modified P-DNA consists essentially of, in the 5 'to 3' direction, a first similar border sequence that promotes DNA transfer, a promoter, a desired polynucleotide that is operably linked to the promoter, a terminator, and a second similar border sequence that also promotes DNA transfer. Alternatively, the desired polynucleotide represents one or more copies of a leader, trailer, or gene in sense and / or antisense orientations.

Preferably, the modified P-DNA contains expression cassettes for both a mutant PPO gene and an invertase inhibitor gene.

Thus, the desired polynucleotide can comprise a sense or antisense sequence of a leader sequence. More preferably, the leader sequence is associated with a gene that is endogenous to a cell of the selected plant species. Even more preferably, the leader is associated with a gene that is selected from the group consisting of a PPO gene, an R1 gene, an L or H type alpha glucan phosphorylase gene, a uDp glucose glucosyltransferase gene, a gene HOS1, S-adenosylhomocysteine ​​hydrolase gene, a cinnamate 4-hydroxylase class II gene, a cinnamoyl-coenzyme A reductase gene, a cinnamoyl alcohol dehydrogenase gene, a caffeoyl coenzyme A O-methyltransferase gene, an actin depolymerization factor gene, a Nin88 gene, a Lol p 5 gene, an allergen gene, a P450 hydroxylase gene, an ADP-glucose pyrophosphorylase gene, a proline dehydrogenase gene, a endo-1,4-beta-glucanase, a gene for zeaxanthin epoxidase, and a gene for 1-aminocyclopropane-1-carboxylate synthase.

Preferably, the desired polynucleotide sequence comprises a sense and antisense gene of a trailer sequence. The trailer sequence may be associated with a gene selected from a group consisting of a PPO gene, an R1 gene, an L or H type alpha glucan phosphorylase gene, a UDP glucose glucosyltransferase gene, a HOS1 gene, a gene for S-adenosylhomocysteine ​​hydrolase, a gene for cinnamate 4-hydroxylase class II, a gene for cinnamoyl-coenzyme A reductase, a gene for cinnamoyl alcohol dehydrogenase, a gene for caffeoyl coenzyme A O-methyltransferase, an actin depolymerization factor gene, a Nin88 gene, a Lol p 5 gene, an allergen gene, a P450 hydroxylase gene, an ADP-glucose pyrophosphorylase gene, a proline dehydrogenase gene, a endo-1,4-beta-glucanase, a gene for zeaxanthin epoxidase, and a gene for 1-aminocyclopropane-1-carboxylate synthase.

Preferably, the desired polynucleotide, such as a gene, is isolated from, and / or is native to the plant to be transformed. Alternatively, the desired polynucleotide is modified or mutated. A mutation for the isolated polynucleotide can make the desired nucleotide greater than or equal to 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88 %, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% dissimilar to its non-fined form.

The promoter of an expression cassette located within a P-DNA can be a constitutive promoter. Preferably, the constitutive promoter is the promoter of the potato Ubiquitin-3 gene. Even more preferably, the constitutive promoter is the promoter of the potato Ubiquitin-7 gene.

The promoter of an expression cassette located within a P-DNA can be a regulatable promoter. Preferably, the regulatable promoter is temperature sensitive. Even more preferably, the regulatable promoter is a ci21A promoter or a C17 promoter, each isolated from potato (Schneider et al., Plant Physiol. 113: 335-45, 1997; Kirch et al., Plant Mol Biol 33: 897-909, 1997).

ES 2 602 133 T3

The promoter of an expression cassette located within a P-DNA can be regulated in a temporary way. Preferably, the promoter is an rbcS promoter (Ueda et al., Plant Cell 1: 217-27, 1989).

The promoter of an expression cassette located within a P-DNA can be regulated by any one of abscisic acid, lesions, methyl jasmonate, or gibberellic acid. This promoter can be a promoter selected from either a Rab 16A gene promoter, an α-amylase gene promoter, or a pin2 gene promoter.

The promoter of an expression cassette located within a P-DNA can be a tissue specific promoter. Preferably, this promoter is a GBSS promoter isolated from S. tuberosum.

The present description describes a P-DNA vector that is capable of replicating in both E.coli and Agrobacterium, and contains either a P-DNA or a modified P-DNA. In a preferred embodiment, this vector also contains an expression cassette for a cytokinin gene in its backbone to allow selection against backbone integration events.

The desired nucleotide sequence may further comprise a spacer element. The spacer element can be a Ubi intron sequence or a GBSS spacer sequence.

The desired nucleotide sequence may comprise a mutated native gene encoding a functionally inactive protein, which reduces the total activity of that protein if it is expressed in transgenic plants. This mutated gene can encode a functionally inactive polyphenol oxidase that lacks a copper-binding domain.

The desired nucleotide sequence may comprise a native gene encoding a functionally active protein. Preferably, this gene encodes a protein with homology to the tobacco vacuolar invertase inhibitor.

The terminator of an expression cassette located within a P-DNA can be a Ubi3 terminator sequence or a 3 'untranslated region of a gene from a selected plant species.

Also described herein, a method of modifying a target plant cell is provided. In one embodiment, the method comprises: (1) inserting a modified P-DNA into the genome of at least one cell in the target plant cell using LifeSupport mediated transformation; and (2) observing if there is a phenotypic change in the target plant cell; wherein the promoter in the modified P-DNA transcribes the sense and / or antisense untranslated sequences associated with a native gene to reduce the expression of that native gene, thereby modifying the target plant cell. In another preferred embodiment, the promoter in the modified P-DNA transcribes a gene to overexpress that gene in the target plant cell.

Also described is a method of manufacturing a transgenic plant cell of a selected plant species containing a modified P-DNA. The method comprises co-transferring a plant cell of a selected plant species with a P-DNA vector and a LifeSupport vector comprising a marker gene flanked by a left T-DNA border and a right T-DNA border and a virD2 gene. mutant inserted into the vector backbone, and selecting for a plant cell that transiently expresses the marker gene, and isolating a plant cell that contains the modified P-DNA integrated into its genome but does not contain any nucleotides from the carrier life vector. Preferably, the marker gene confers resistance to kanamycin. More preferably, the yeast ADH terminator follows the kanamycin resistance gene.

The plant cell of the target plant species selected for transformation may be in culture. Alternatively, the plant cell of the target plant species for transformation is within a plant.

This description also discloses a plant of the selected species comprising at least one cell with a genome containing modified P-DNA. The modified P-DNA can consist essentially of, the 5 'to 3' direction, a first term that functions as a T-DNA boundary by P-DNA sequences, a promoter, a desired nucleotide sequence operably linked to either a promoter, a terminator as additional P-DNA sequences delineated by a second terminal. In another embodiment, the desired polynucleotide represents one or more copies of a leader, a trailer, and a gene in the sense and / or antisense orientation.

A plant comprising at least one cell with a genome containing modified P-DNA is also envisaged.

Also disclosed is a method of reducing the expression of a gene in a selected plant species. The method comprises LifeSupport-mediated transformation of a plant cell of a selected plant species with a P-DNA vector, wherein the modified P-DNA of this vector is stably integrated into the genome of a plant cell. Also disclosed is a modified P-DNA comprising a desired polynucleotide that reduces the expression of an endogenous gene of the selected plant species.

ES 2 602 133 T3

Also disclosed is a native gene for the selected plant species that can be mutated and reintroduced into the plant using the methods described herein. Preferably, the mutated gene, for example a mutated PPO gene, is integrated into the genome of the plant cell using a P-DNA vector vector.

The present invention also provides a method of reducing the undesirable expression of the polyphenol oxidase gene in a selected plant species. Preferably, the method comprises integrating into a genome of a selected plant species a modified P-DNA composed solely of nucleotide sequences isolated from the selected plant species or from a plant that is sexually compatible with the selected plant species, consisting essentially of, in the 5 'to 3' direction, a first P-DNA terminal that functions as a T-DNA boundary followed by flanking P-DNA sequences; a promoter; a desired nucleotide that is a sense-oriented trailer nucleotide sequence associated with a specific PPO gene; an antisense oriented sequence of the trailer nucleotide sequence of the specific PPO gene; a termination sequence, and additional P-DNA sequences delineated by a second terminal that functions as a T-DNA boundary, in which the promoter produces a double-stranded RNA molecule that reduces the expression of the specific PPO gene, reducing it mode the bruises of black spots in specific tissues of the plant. Also described is the fact that the sense and antisense oriented nucleotide sequences of the leader nucleotide sequence are derived from the 5'- untranslated region preceding the specific PPO gene. The sense and antisense oriented leader or trailer sequence associated with the PPO gene can be separated by another polynucleotide sequence, indicated herein, such as an intron or a spacer ". Preferably, the leader or trailer sequence is associated with a potato PPO gene. More preferably, the leader or trailer sequence is associated with a potato PPO gene that is expressed in potato tubers. More preferably, the leader or trailer sequence is associated with a potato PPO gene that is expressed throughout the potato tuber except for the epidermis.

The present disclosure also describes a method of reducing acrylamide production, storage sprout induction, phosphate accumulation, and / or cold-induced sweetener in tubers of a selected plant species.

The method may comprise LifeSupport-mediated transformation of a selected plant species with a modified P-DNA composed solely of nucleotide sequences isolated from the selected plant species, or of plants that are sexually compatible with the selected plant species, consisting essentially of , in the 5'- to 3'- direction, a first P-DNA with a similar left border sequence, a promoter, a desired nucleotide sequence, which is a nucleotide sequence from the leader sequence, a termination sequence, a similar border sequence right. Upon expression, an RNA duplex is produced that reduces the expression of the R1 gene, thus reducing cold-induced sweetener in the plant. The desired sense and antisense oriented nucleotide sequences represent the trailer associated with the R1 gene. The antisense or sense-oriented leader or trailer associated with R1 can be separated by another polynucleotide sequence, indicated herein, such as an intron or a spacer.

The method may comprise LifeSupport-mediated transformation of a selected plant species with a modified P-DNA that is similar to one described above but contains a leader or trailer sequence associated with an alpha-glucan phosphorylase gene.

The method may comprise LifeSupport mediated transformation of a selected plant species with a modified P-DNA containing an invertase inhibitor gene.

The modified P-DNA described in the preceding paragraphs can be used to reduce the accumulation of additional undesirable products of the Maillard reaction, which occurs during heating of carbohydrate-rich foods such as potato tubers. These undesirable products include advanced glycation end products (AGEs) that have been associated with different pathologies.

The present description also discloses a method for increasing the levels of resistant starch in the storage organs of plants and food crops.

The method may comprise LifeSupport-mediated transformation of a selected plant species with a modified P-DNA containing an expression cassette for a fusion of the trailer sequences associated with the starch branching enzyme genes I and II.

The present disclosure also discloses isolated nucleotide sequences comprising the potato GBSS gene promoter and the potato proteinase inhibitor gene, which are predominantly expressed in tubers. Isolated promoters have the nucleotide sequence shown in SEQ ID NO .: 6 and SEQ ID NO.:40, respectively.

The present description describes a method of modifying a trait of a selected plant comprising:

ES 2 602 133 T3

to. stably transforming cells of the selected plant with a desired polynucleotide, wherein the desired polynucleotide consists essentially of a nucleic acid sequence that is native to the selected plant, native to the plant of the same species, or is native to a plant that is sexually interfertile with the selected plant,

b. obtaining a stably transformed plant from transformed plant cells in which the transformed plant contains the desired polynucleotide stably integrated into the genome and in which the desired polynucleotide modifies the trait.

Preferably, the method further comprises co-transfection of plant cells with a selectable marker gene that is transiently expressed in the plant cells, and that identifies transformed plant cells, and transformed plants derived from the transformed plant cells, in which the marker gene is not stably integrated and the desired polynucleotide is stably integrated into the genome.

The desired polynucleotide may comprise a P-DNA, GBSS promoter, Ubi7 promoter, Ubi3 promoter, PIP promoter, modified PPO gene, invertase inhibitor gene, salt tolerance gene, R1 associated leader, leader associated phosphorylase, R1 trailer associated , SBE associated trailers, Ubi intron, GBSS spacer, UbiT.

A plant of the present invention may be a monocotyledonous plant, selected from the group consisting of wheat, grass, peat grass, cereals, corn, rice, oats, wheat, barley, sorghum, orchid, iris, lily, onion, banana, sugar cane, sorghum and palm.

A plant of the present invention can also be a dicotyledonous plant, selected from the group consisting of avocado, potato, tobacco, tomato, beet, broccoli, yucca, sweet potato, chili, cotton, poinsetta, legume, alfalfa, soybean, carrot, strawberry. , lettuce, oak, maple, walnut, rose, mint, pumpkin, daisy, and cactus.

Plant cells and plants can be transformed through Agrobacterium mediated transformation. Preferably, Agrobacterium mediated transformation is based on the use of at least one binary vector. The Agrobacterium mediated transformation method can use a first binary vector and a second binary vector. The first binary vector can contain the desired polynucleotide and the second binary vector can contain a selectable marker gene, wherein the selectable marker gene is operably linked to a promoter and a terminator.

According to methods of the present invention, the trait that is modified is selected from the group consisting of health and nutritional improvement characteristics, improved storage, improved yield, improved salt tolerance, increased tolerance to heavy metals, increased tolerance to drought, increased tolerance to disease, increased tolerance to insects, increased tolerance of water stress, increased tolerance to cold and frost, improved color, greater sweetness, greater vigor, better taste, better texture, decreased phosphate content, increased germination, increased micronutrient uptake, improved starch composition, improved longevity of the flower.

The present description also encompasses a plant made by the present meters.

Also provided is a method of modifying a trait in a selected plant comprising:

(a) identification of the trait to be modified;

(b) construction of a first polynucleotide consisting essentially of native genetic elements isolated from the selected plant, a plant of the same species, or a plant that is sexually interfertile with the selected plant, wherein the native genetic elements are capable of modifying the expression of a trait-controlling gene (c) construction of a second polynucleotide comprising a selectable marker gene that is operably linked to a promoter and a terminator;

(d) co-transfection of plant cells of the selected plant with the first and second polynucleotides;

(e) selection for transient expression of the selectable marker gene;

(f) screening for plant cells stably transformed with the first polynucleotide but not containing the second DNA molecule integrated into the genome; and (g) obtaining a stably transformed plant from transformed plant cells exhibiting modified expression of the trait.

ES 2 602 133 T3

Genetic elements can comprise at least one of a promoter, sequence of interest, terminator, enhancer, intron, spacer, or regulatory elements. Plant cells can be transferred with the first polynucleotide before the second polynucleotide or vice versa.

The sequence of interest can be a gene. The gene can be a wild-type polyphenol oxidase gene or a mutated or wild-type R1 gene. The sequence of Interest may be a leader or trailer sequence, wherein the leader or trailer sequence represents an upstream or downstream sequence of a gene that is native to the plant cell. The sequence of Interest may comprise a sense-oriented leader sequence operably linked to an antisense leader sequence. The sequence of Interest may comprise a sense-oriented tow sequence operably linked to an antisense tow sequence. In another embodiment, the promoter is an inducible promoter. In another embodiment, the terminator is a yeast ADH terminator sequence.

Also described is a leader construct comprising in the 5 'to 3' direction, a promoter, a sense-oriented leader sequence, the antisense trailer sequence, and a terminator, in which the expression of a trailer construct produces an RNA molecule. double chain that facilitates the down regulation of expression of the gene to which it is associated. The trailer sequence may be associated with, and located upstream of, the coding region of the PPO gene, the R1, an L-type phosphorylase gene, and an alpha-glucan phosphorylase gene.

Also described is a leader construct comprising a 5 'to 3- direction, a promoter, a sense-oriented trailer sequence, the antisense leader sequence, and a terminator, in which expression of a leader construct produces an RNA molecule. double chain that facilitates the down regulation of expression of the gene to which it is associated. The leader sequence may be associated with, and located upstream of, the coding region of the PPO gene, the R1, an L-type phosphorylase gene, and an alpha-glucan phosphorylase gene.

The method further comprises exposing the plant cell to a second vector comprising a marker element, wherein the marker is transiently expressed in the transformed plant and is not stably integrated into the genome of the transformed plant. In one embodiment, the marker is a herbicide resistance gene, an antibiotic resistance gene, or NPTII.

Preferably, the plant cells are transformed through Agrobacterium-mediated transformation. Agrobacterium mediated transformation can be based on the use of at least one binary vector. The Agrobacterium mediated transformation method can use a first binary vector and a second binary vector. The first binary vector can carry the first polynucleotide and the second binary vector can carry the second polynucleotide.

The present description also describes another method of modifying the expression of a gene in a selected plant comprising:

(a) identification of the functional gene;

(b) construction of a first polynucleotide consisting essentially of native genetic elements isolated from the selected plant, a plant of the same species as the selected plant, or a plant that is sexually interfertile with the selected plant, in which the native genetic elements they are capable of modifying the expression of a gene;

(c) construction of a second polynucleotide comprising a functional selectable marker gene;

(d) co-transfection of plant cells of the selected plant with the first and second polynucleotides;

(e) selection for transient expression of the selectable marker gene;

(f) screening for plant cells stably transformed with the first polynucleotide but not containing the second polynucleotide integrated into the genome; and (g) obtaining a stably transformed plant from transformed plant cells exhibiting modified expression of the gene.

Preferably, the plant cells are transformed through Agrobacterium-mediated transformation. Agrobacterium Mediated Transformation can be based on the use of at least one binary vector. The Agrobacterium mediated transformation method can use a first binary vector and a second binary vector. The first binary vector can carry the first polynucleotide and the second route vector can carry the second polynucleotide.

ES 2 602 133 T3

The First Polynucleotide can comprise at least one P-DNA, GBSS promoter, Ubi7 promoter, Ubi3 promoter, PlP promoter, modified PPO gene, invertase inhibitor gene, salt tolerance gene, R1 associated leader, leader associated phosphorylase, trailer associated R1, associated trailers SBE, Ubi intron, GBSS spacer, UbiT.

The second polynucleotide may comprise at least one of a selectable marker gene, an omega mutated virD2 polynucleotide, a codA polynucleotide, and a codA :: upp fusion polynucleotide.

Also, a plant made by such a method is envisaged.

A transgenic plant can be provided that exhibits a modified expression of a trait compared to the non-transgenic plant from which it was derived, wherein the transgenic plant is stably transformed with a desired polynucleotide consisting essentially of native genetic elements isolated from the plant. , a plant in the same species, or a plant that is sexually interfertile with the plant, and in which the polynucleotide modifies the expression of the trait.

Preferably, the plant is a monocotyledonous plant, selected from the group consisting of wheat, grass, peat grass, cereals, corn, rice, oats, wheat, barley, sorghum, orchid, iris, lily, onion, banana, sugar cane, sorghum and palm.

Alternatively, the plant may be a dicotyledonous plant, selected from the group consisting of avocado, potato, tobacco, tomato, beet, broccoli, yucca, sweet potato, chili, cotton, poinsetta, legume, alfalfa, soybean, carrot, strawberry, lettuce, oak, maple, walnut, rose, mint, pumpkin, daisy, and cactus.

The trait can be selected from the group consisting of improved health and nutritional characteristics, improved storage, improved yield, improved salt tolerance, increased tolerance to heavy metals, increased tolerance to drought, increased tolerance to disease, increased tolerance to insects, increased water stress tolerance, increased tolerance to cold and frost, improved color, greater sweetness, greater vigor, better taste, better texture, decreased phosphate content, increased germination, increased micronutrient uptake, improved starch composition, improved longevity of the flower.

The desired polynucleotide may comprise at least one of a P-DNA, GBSS promoter, Ubi7 promoter, Ubi3 promoter, PlP promoter, modified PPO gene, invertase inhibitor gene, salt tolerance gene, R1-associated leader, leader-associated phosphorylase. , R1 associated trailer, SBE associated trailers, Ubi intron, GBSS spacer, UbiT.

Also included is an isolated, nucleotide-like border sequence ranging in size from 20 to 100 bp that shares between 52% and 96% sequence identity with an Agrobacterium tumafaciens T-DNA border sequence. Preferably, the nucleotide sequence isolated from a monocotyledonous plant is isolated, selected from the group consisting of wheat, grass, peat grass, cereals, corn, rice, oats, wheat, barley, sorghum, orchid, iris, lily, onion, banana, sugar cane, sorghum and palm. Alternatively, the nucleotide sequence can be isolated from a dicot plant selected from the group consisting of potato, tobacco, tomato, beet, broccoli, cassava, sweet potato, chili, cotton, poinsetta, legume, alfalfa, soybean, carrot, strawberry, lettuce. , oak, maple, walnut, rose, mint, pumpkin, daisy, and cactus.

The nucleotide sequence can also be isolated from potato, and has a nucleotide sequence shown in either SEQ ID NO. 94 or 95. The nucleotide sequence may share 52% sequence identity with an Agrobacterium tumafaciens T-DNA border sequence. A vector comprising such nucleotide sequences is also encompassed.

The present disclosure also discloses a method of producing a plant stably transformed with a desired polynucleotide comprising:

(a) isolate a P-DNA that is flanked by similar border sequences from the plant in which the similar border sequences share between 52% and 96% sequence identity with a similar T-DNA border sequence from Agrobacterium tumafaciens ;

(b) inserting the desired polynucleotide between similar border sequences of P-DNA to form a PDNA construct; and (c) transforming a plant cell of the plant with the P-DNA construct; and (d) recovering a plant from the plant cell stably transformed with the P-DNA construct.

The P-DNA construct can be carried in a vector comprising a backbone integration marker gene and transformed plant cells that do not contain the integration marker gene can be selected.

ES 2 602 133 T3 of the spine. Preferably, the Backbone Integration marker gene is a cytoqulin gene. Preferably, plant shoots exhibiting a cytokinin overproduction phenotype are not selected. Alternatively, the backbone integration marker gene is the IPT gene, and plant shoots that exhibit an abnormal phenotype or are unable to develop roots are not selected.

Plant cells can be from a monocotyledonous plant selected from the group consisting of wheat, grass, peat grass, cereals, corn, rice, oats, wheat, barley, sorghum, orchid, iris, lily, onion, banana, sugar cane , sorghum and palm.

Plant cells can be from a dicotyledonous plant selected from the group consisting of potato, tobacco, tomato, beet, broccoli, yucca, sweet potato, chili, cotton, poinsetta, legume, alfalfa, soybean, carrot, strawberry, lettuce, oak, maple , walnut, rose, mint, pumpkin, daisy, and cactus.

Preferably, the plant cells are transformed through Agrobacterium-mediated transformation. Agrobacterium mediated transformation can be based on the use of at least one binary vector. The Agrobacterium mediated transformation method can use a first binary vector and a second binary vector. The first binary vector can carry the first polynucleotide and the second binary vector can carry the second polynucleotide. The second binary vector may comprise at least one negative selectable marker gene and one omega mutated virD2 gene, wherein the negative selectable marker gene is positioned within the right T-DNA border and the left T-DNA border, and wherein the mutated omega virD2 gene is positioned within the backbone of the second binary vector. Preferably, the second binary vector comprises both a negative selectable marker gene positioned within the right T-DNA border and the left T-DNA border, and an omega mutated virD2 gene positioned within the backbone of the second binary vector.

The present disclosure also describes a P-DNA consisting essentially of, in the 5 'to 3' direction, a first T-DNA-like border sequence, a desired polynucleotide sequence operably linked to the promoter, a terminator, and a second sequence of T-DNA like border, where similar border sequences have less than 100% sequence identity with T-DNA border sequences.

Preferably, the T-DNA like border sequences, the promoter, the desired polynucleotide, and the terminator, are all isolated from the same plant, the same plant species, or plants that are sexually interfertile.

The P-DNA can consist essentially of a selectable marker gene.

The T-DNA like border sequences, the promoter, the desired polynucleotide, the terminator, and the selectable marker gene, can all be isolated from the same plant, the same plant species, or plants that are sexually interfertile.

The desired polynucleotide sequence in the P-DNA may be a sequence upstream or downstream of the coding region of a gene, in which the upstream sequence is a leader sequence, and in which the downstream sequence is a trailer sequence. The T-DNA like border sequences, the promoter, the leader sequence, the trailer sequence, the terminator, and the selectable marker gene are all isolated from the same plant, the same plant species, or plants that are sexually interfertile.

Vectors comprising such P-DNA constructs are disclosed herein.

The promoter can be a regulatable promoter. The regulatable promoter can be temperature sensitive. Preferably, the regulatable promoter is a wheat wcs120 promoter. The promoter may be under temporary regulation. The promoter can be a carboxylase promoter. The carboxylase promoter can be a corn carboxylase promoter.

The promoter can be regulated by any one of abscisic acids, wound, methyl jasmonate, or gibberellic acid. The promoter may be a promoter selected from either a Rab 16A gene promoter, an α-amylase gene promoter, or a pin2 gene promoter. The promoter can be a tissue specific promoter.

The leader sequence can be a 5'- untranslated region of a gene that is endogenous to the cell of the selected plant species. The 5 'untranslated region may be upstream of a start codon of a gene that is selected from the group consisting of a PPO gene, an R1 gene, an L or H type alpha glucan phosphorylase gene, a gene for UDP glucose glucosyltransferase, a HOS1 gene, S-adenosylhomocysteine ​​hydrolase gene, a cinnamate 4-hydroxylase class II gene, a cinnamoyl-coenzyme A reductase gene, a cinnamoyl alcohol dehydrogenase gene, a caffeoyl coenzyme A O-methyltransferase gene, an actin depolymerization factor gene, a Nin88 gene, a Lol p 5 gene, an allergen gene, a P450 hydroxylase gene, an ADP-glucose gene pyrophosphorylase, a proline dehydrogenase gene, an endo-1,4-beta-glucanase gene, a zeaxanthin epoxidase gene, and a 1-aminocyclopropane-1-carboxylate synthase gene.

ES 2 602 133 T3

The trailer sequence may be part of the 3 'untranslated region of a gene that is downstream of a stop codon of a gene selected from the group consisting of a PPO gene, an R1 gene, a gene for alpha-glucan phosphorylase. type L or H, a UDP glucose glucosyltransferase gene, a HOS1 gene, a Sadenosylhomocysteine ​​hydrolase gene, a cinnamate 4-hydroxylase class II gene, a cinnamoyl-coenzyme A reductase gene, a cinnamoyl alcohol gene dehydrogenase, a caffeoyl coenzyme A O-methyltransferase gene, an actin depolymerization factor gene, a Nin88 gene, a Lol p 5 gene, an allergen gene, a P450 hydroxylase gene, an ADP-glucose gene pyrophosphorylase, a proline dehydrogenase gene, an endo-1,4-beta-glucanase gene, a zeaxanthin epoxidase gene, and a 1-aminocyclopropane-1-carboxylate synthase gene.

The present vector may further comprise a spacer element that is either a Ubi intron sequence or a GBSS spacer sequence. The vector may comprise a terminator that is a Ubi3 terminator sequence or a 3 'untranslated region of an endogenous plant gene.

The vector may comprise a selectable marker gene operably linked to a constitutive promoter and a Cre gene operably linked to an inducible promoter, wherein the selectable marker gene and the Cre gene are flanked by a first recombinase recognition site and a second site. recombinase recognition. The first recombinase recognition site and the second recombinase recognition site can be lox sites.

The inducible promoter can be a temperature sensitive promoter, a chemically induced promoter, a temporary promoter. The inducible promoter may be a Ha hsp17.7 G4 promoter, a wheat was120 promoter, a Rab 16A gene promoter, an α-amylase gene promoter, a pin2 gene promoter, a carboxylase promoter. It may further comprise a plant derived marker gene. The plant derived marker gene can be an enolpyruvyl-3-phosphoshikimic acid synthase gene.

A method of modifying a plant cell is provided, which comprises integrating a P-DNA sequence into the genome of a plant cell, wherein the P-DNA consists essentially of, in the 5'- to 3'- direction, a first T-DNA like border sequence, a promoter, a desired polynucleotide sequence operably linked to the promoter, a terminator, and a second T-DNA like border sequence, wherein the similar border sequences have less than 100% sequence identity to T-DNA border sequences, and wherein the similar T-DNA border sequences, the promoter, the desired polynucleotide, a terminator, are all isolated from or native to the plant cell genome, wherein the desired polynucleotide comprises sense and antisense sequences of a leader sequence or trailer sequence that are associated with non-coding regions upstream or downstream of a gene in the plant, and wherein expression of the desired polynucleotide produces a double-stranded RNA transcription that directs the gene associated with the desired polynucleotide, thereby modifying the plant cell.

Also disclosed is a method of modifying a plant, comprising:

(i) transfection of at least one cell in the plant with the vector of the present invention;

(ii) selection of a cell that expresses the functional selectable marker;

(iii) isolation of the cell expressing the functional selectable marker;

(iii) induction of the expression of the functional Cre gene in the isolated cell;

(iv) culture of the isolated cell; and (ii) observation of the phenotype of cultured cells; wherein a phenotype that is different from a non-transfected plant cell indicates that the plant cell has been modified.

Preferably, the selection step of this and other methods disclosed herein is performed by identifying which cells are resistant to an antibiotic.

Also disclosed is a method for identifying a target plant cell whose genome contains a P-DNA, comprising cotransfection of a target plant cell with the vector described herein and a second Agrobacterium-derived vector comprising a marker gene flanked by a border. left T-DNA and a right T-DNA border and a mutated omega virD2 gene, in which the P-DNA is integrated into the genome of the plant target cell, and that no part of the second Agrobacterium-derived vector is integrated into the genome of the target plant cell. Preferably, the marker in the second Agrobacterium-derived vector is a neomycin phosphotransferase gene.

Also described is a method for identifying a target plant cell whose genome contains at least a part of an integration cassette, finally comprising selection of cells that survive growth.

ES 2 602 133 T3 in a medium containing kanamycin, in which the genomes of the selected cells contain only the integration cassette. The target plant cell can be within a plant. Also disclosed is a plant comprising at least one cell whose genome comprises such P-DNA.

Also encompassed is a plant comprising at least one cell whose genome is artificially engineered to contain only plant-derived nucleic acids, wherein no plant cell contains foreign nucleic acids integrated into the genome of the cell.

Also encompassed is a polynucleotide sequence of SEQ ID NO. 93, wherein the polynucleotide is between 20 and 80 nucleotides in length. In one embodiment, the polynucleotide is between 21 and 70 nucleotides in length, between 22 and 50 nucleotides in length, between 23 and 40 nucleotides in length, or between 24 and 30 nucleotides in length.

A tuber specific promoter is also encompassed as shown in SEQ ID NO. 40.

Also described is an Agrobacterium-based method of producing transgenic plant cells that does not contain a selectable marker gene stably integrated into a nuclear DNA comprising:

to. constructing a first binary vector composed of a polynucleotide consisting essentially of a desired functional gene operably linked to sequences of T-DNA borders or similar T-DNA borders at the 5 'and 3' ends of the desired functional gene;

b. constructing a second binary vector composed of a functional selectable marker gene linked to T-DNA border sequences or similar T-DNA borders at the 5 'and 3' ends of the functional selectable marker gene;

c. incubate plant cells with:

i. an Agrobacterium strain carrying the first and second binary vectors; or ii. a first Agrobacterium strain carrying the first binary vector and a second Agrobacterium strain carrying the second binary vector;

d. selecting plant cells in which the desired functional gene is integrated into the plant nuclear DNA without integration of the selectable marker gene into the plant nuclear DNA followed by incubation for an appropriate period of time in a medium containing a selection agent appropriate.

Preferably, the selectable marker gene is a herbicide resistance gene or an antibiotic resistance gene. Preferably, the antibiotic resistance gene is the nNPTII gene. Preferably, the antibiotic resistance gene is the structural npt II gene operably linked to the promoter of the Ubiquitin-7 gene and terminator of the yeast alcohol dehydrogenase gene 1 (ADH1). According to this method, the plant cells are first incubated with the first Agrobacterium strain and subsequently incubated with the second Agrobacterium strain or vice versa.

The first binary vector may further comprise a binary integration marker gene that can be used to detect plant cells stably transformed with binary vector backbone sequences. The binary vector integration marker gene can be selected from the group consisting of herbicide resistance gene, antibiotic resistance gene, or NPTII. The second pathway vector may further comprise a gene fusion between the bacterial cytosine deaminase (codA) and uracil phosphoribosyltransferase (upp) genes, which are inserted between the T-DNA or T-DNA-like border sequences, and the cells are exposed. plant to 5-fluorocytosine followed by incubation with the first and second Agrobacterium strains in order to select against those plant cells transformed with the second binary vector.

The secondary binary vector may further comprise a gene that reduces the likelihood of backbone integration. Such a gene may be the mutated omega virD2 gene, wherein the mutated omega virD2 gene reduces the frequency of integration of the selectable marker gene into plant nuclear DNA.

Also disclosed is an isolated nucleotide sequence comprising the GBSS promoter isolated from S. tuberosum. Preferably, this isolated nucleotide sequence has the nucleotide sequence which is SEQ ID. NOT. 6 or 13.

In a first aspect of the invention, a method of reducing the acrylamide accumulation produced by the Maillard reaction during frying is provided, which comprises the transformation into a genome of a crop plant an expression cassette comprising a sequence which, after the expression, (a) silences an endogenous R1 gene, (b) silences an endogenous L-type phosphorylase gene, and / or (c) over-expresses an invertase inhibitor gene.

ES 2 602 133 T3

Preferred embodiments of the invention in one of its different aspects are as described below or as defined in the sub-claims.

Brief description of the drawings

Figure 1. Schematic illustration of some P-DNA vectors used in the present invention. The PDNA region is indicated as a gray box. ipt = expression cassette for the gene; npt = expression cassette for the nptII gene; mPPO = expression cassette for a modified PPO gene; INH = expression cassette for an invertase inhibitor gene; GUS = expression cassette for the GUS gene; LPPO = expression cassette for a sense and antisense copy of the leader associated with a PPO gene; LPH = expression cassette for a sense and antisense copy of the leader associated with a phosphorylase gene; Alf = expression cassette for a potato Alfin homolog. See text for details.

Figure 2. Free gene expression cassettes

Figure 3. Alignment of potato and tobacco invertase inhibitory proteins. St = Solanum tuberosum (potato); Nt = Nicotiana tabacum (tobacco)

Figure 4. Trailer alignment associated with various PPO genes.

Figure 5. Schematic illustrations of some LifeSupport vectors in the present invention. codA is an expression cassette for the codA gene; codA :: upp is an expression cassette for the gene fused to upp; QvirD2 is an expression cassette for the QvirD2 gene.

Detailed description of the preferred embodiments

The precise breeding strategy described here improves the agronomic performance, nutritional value, and health characteristics of plants and crops without introducing unknown nucleic acid, or nucleic acid from a foreign species into a genome of a plant species, and without producing unwanted phenotypes or effects. harmful secondary.

In this way, a transgenic plant is provided, and methods for producing such a plant that do not integrate nucleic acids from non-plant species into the plant genome. Nucleic acids, promoters, regulatory elements, other non-coding gene sequences, markers, polynucleotides, and genes that are integrated into the genome of the selected plant are all preferably isolated from the plant to be transformed, plants of the same species to be transformed, or plants that are sexually interfertile with the plant to be transformed. Such native, modified or co-linked nucleic acids can be mutated with other native nucleic acids in an expression cassette and reintegrated into the genome of the selected plant, according to the methods described herein. Consequently, the genotype and phenotype of the transgenic plant is altered using only that nucleic acid native to the selected plant, or using nucleic acid from a plant that is sexually compatible with the selected plant.

To facilitate the production of such transgenic plants, use is made of the fact that not all TDNA vectors used in Agrobacterium mediated transformation are actually integrated into the plant genome; that is, while a vector can be taken up by the plant cell, an actual integration event may not occur. In accordance with the present invention, such a vector can be used to carry a selectable marker gene in a plant cell. The plant cells can then be screened to determine if the marker has been stably integrated into the plant genome by determining how long the marker gene is expressed. Consequently, plant cells that are only transiently expressed are desired because they represent cells that took, but did not integrate, the selectable marker gene into their genomes.

In this way, by cotransformation of a plant with such a "marker vector" and also with another vector containing the desired native gene or polynucleotide, plant cells that took both vectors can also be selected and, of those, it was determined which cells possess genomes. containing only the desired gene or polynucleotide. The "marker vector" can be modified to further reduce the possibility that the marker will be integrated into the plant genome. The present disclosure provides such marker vectors in the form of "LifeSupport" vectors.

Unless defined otherwise, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein, to laboratory procedures in cell culture, molecular genetics, and nucleic acid chemistry and hybridization described herein, are those well known and commonly employed in the art. Standard techniques are used for recombinant nucleic acid methods, polynucleotide synthesis, microbial culture, cell culture, tissue culture, transformation, transfection, transduction, analytical chemistry, synthetic organic chemistry, chemical synthesis, chemical analysis, and pharmaceutical formulation and delivery. Generally, enzymatic reactions and purification and / or isolation steps are carried out according to

ES 2 602 133 T3 to manufacturers' specifications. The techniques and procedures are generally performed in accordance with conventional methodologies disclosed, for example, in Molecular cloning a laboratory manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989), and Current protocols in molecular biology, John Wiley & Sons, Baltimore, MD (1989).

Amino acid sequence: as used herein, includes an oligopeptide, peptide, polypeptide, or protein and fragments thereof, which are isolated from, native to, or naturally occurring in a plant or are made synthetically but comprise the acid sequence nucleic of the endogenous counterpart.

Artificially manipulated: As used herein, artificially manipulated indicates to move, organize, operate or control by means of the hands or by mechanical means or recombinant means, such as by genetic engineering techniques, a plant or plant cell, in a way that produces a plant or plant cell that has a different biological, biochemical, morphological or physiological phenotype and / or genotype compared to non-manipulated, naturally occurring counterparts.

Asexual Propagation: Producing progeny generated in the whole plant from leaf cuttings, shoot cuttings, root cuttings, tuber eyes, stolons, individual plant cell protoplasts, calluses and the like, which do not involve gamete fusion.

Backbone: nucleic acid sequence of a binary vector that excludes the predicted T-DNA or P-DNA sequence for transfer.

Border sequences and similar border: Border sequences are specific sequences derived from Agrobacterium. Typically, a left border sequence and a right border sequence flanked to a T-DNA and both function as recognition sites for virD2 catalyzed notching reactions. Such activity releases nucleic acid that is positioned between such boundaries. See Table 2 below for examples of border sequences. Released nucleic acid, complexed with virD2 and virE2, is targeted to plant cell nuclei where the nucleic acid is usually integrated into the genome of the plant cell. Usually, two border sequences, one left border and one right border, are used to integrate a nucleotide sequence that is located between them in another nucleotide sequence. It is also possible to use only one border, or more than two borders, to achieve integration of a desired nucleic acid in such a way.

Consequently, a similar border sequence is isolated from the selected plant species to be modified, or from a plant that is sexually compatible with the plant species to be modified, and functions as the Agrobacterium border sequences. . That is, a similar border sequence promotes and facilitates the integration of a polynucleotide to which it is linked. A plant DNA, ie, P-DNA, as described herein preferably contains similar border sequences.

A similar border sequence of a P-DNA is between 5-100 bp in length, 10-80 bp in length, 15-75 bp in length, 15-60 bp in length, 15-50 bp in length, 15-40 bp in length, 15-30 bp in length, 16-30 bp in length, 20-30 bp in length, 21-30 bp in length, 22-30 bp in length, 23-30 bp in length, 24-30 bp in length, 25-30 bp in length, or 26-30 bp in length.

Similar border sequences can be isolated from any plant, such as potatoes or wheat. See SEQ ID NO. 1 and SEQ ID NO. 34, for sequences containing, at each end, the similar border sequences isolated from potato and wheat respectively. In this way, a use P-DNA left or right border sequence is isolated from and / or native to the genome of a plant to be modified. A similar P-DNA border sequence is not identical in nucleotide sequences to any known Agrobacterium-derived T-DNA border sequence. Thus, a similar border sequence of P-DNA can possess 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, 20, or more nucleotides that are different from a T-DNA border sequence of an Agrobacterium species, such as Agrobacterium tumefaciens or Agrobacterium rhizogenes. That is, a border sequence, or similar border of P-DNA has at least 95%, at least 90%, at least 80%, at least 75%, at least 70%, at least 60% or at least 50% of sequence identity to a T-DNA border sequence of an Agrobacterium species, such as Agrobacterium tumefaciens or Agrobacterium rhizogenes, but not 100% sequence identity. As used herein, the descriptive terms PDNA boundary and P-DNA like boundary are interchangeable.

A native P-DNA boundary sequence is greater than or equal to 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%,

91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%,

71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60%, 59%, 58%, 57%, 56%, 55%, 54%, 53%, 52%,

51% or 50% similar in nucleotide sequences to an Agrobacterium T-DNA border sequence. A similar border sequence can, therefore, be isolated from a plant genome and modified or mutated to change the efficiency by which they are able to integrate one nucleotide sequence into another nucleotide sequence. Other polynucleotide sequences can be added or incorporated within a similar border sequence. In this way, a left border of P-DNA or a border

ES 2 602 133 T3 right of P-DNA so that they possess multiple 5'- and 3'- cloning sites, or additional restriction sites. A P-DNA border sequence can be modified to increase the probability that the backbone DNA of the accompanying vector is not integrated into the plant genome.

Table 2 below describes the known T-DNA border sequence sequences identified herein as similar border sequences. None of these sequences identified as having a similar border in Table 2 have previously been identified as having a similar border structure of T-DNA. Similar border sequences were isolated from potatoes by the methods described herein using degenerate primers in potato genomic DNA polymerase chain reactions. The use of any similar P-DNA border sequence to transfer a co-linked polynucleotide into the genome of a plant cell is encompassed.

In fact, any similar border sequence having the nucleic acid sequence structure of SEQ ID NO is encompassed. 93: ANGATNTATN6GT (SEQ ID NO. 93), where N is any nucleotide, such as those represented by A, G, C, or T. This sequence represents the consensus sequence of similar border nucleic acids identified herein.

Table 2. Border sequences and similar border

<td colspan="2">Agrobacterium T-DNA borders</td>

<td>TGACAGGATATATTGGCGGGTAAAC (SEQ ID NO.41)</td><td>Nopaline strains of Agrobacterium (RB)</td>

<td>TGGCAGGATATATTGTGGTGTAAAC (SEQ ID NO.42)</td><td>Nopaline strains of Agrobacterium (LB)</td>

<td>TGGCAGGATATATACCGTTGTAATT (SEQ ID NO.43)</td><td>Agrobacterium Octopine Strains (RB)</td>

<td>CGGCAGGATATATTCAATTGTAATT (SEQ ID NO.44)</td><td>Octopine Strains of Agrobacterium (LB)</td>

<td colspan="2">Agrobacterium T-DNA borders</td>

<td>TGGTAGGATATATACCGTTGTAATT (SEQ ID NO.45)</td><td>LB mutant</td>

<td>TGGCAGGATATATGGTACTGTAATT (SEQ ID NO.46)</td><td>LB mutant</td>

<td>YGRYAGGATATATWSNVBKGTAAWY (SEQ ID NO.47)</td><td>Border pattern</td>

<td colspan="2">Similar boundary sequences</td>

<td>CGGCAGGATATATCCTGATGTAAAT (SEQ ID NO.48)</td><td>R. leguminosarum</td>

<td>TGGCAGGAGTTATTCGAGGGTAAAC (SEQ ID NO.49)</td><td>T. tengcongensis</td>

<td>TGACAGGATATATCGTGATGTCAAC (SEQ ID NO.50)</td><td>Arabidopsis thaliana</td>

<td>GGGAAGTACATATTGGCGGGTAAAC (SEQ ID NO.51)</td><td>A. thaliana CHR1v07142002</td>

<td>TTACAGGATATATTAATATGTATGA (SEQ ID NO.52)</td><td>Oryza sativa AC078894</td>

<td>TAACATGATATATTCCCTTGTAAAT (SEQ ID NO.53)</td><td>Homo sapiens clone HQ0089</td>

<td>TGACAGGATATATGGTAATGTAAAC (SEQ ID NO.54)</td><td>potato (left border sequence) *</td>

<td>TGGCAGGATATATACCGATGTAAAC (SEQ ID NO.55)</td><td>potato (right border sequence) *</td>

<td colspan="2">Y = C or T; R = A or G; K = G or T; M = A or C; W = A or T; S = C or G; V = A, C, or G; B = C, G, or T. Accession numbers for similar border sequences are: Oryza sativa chromosome 10 BAC OSJNBa0096G08 genomic sequences (AC078894.11); Arabidopsis thaliana chromosome 3 (NM_114337.1); Arabidopsis thaliana chromosome c 1 (NM_105664.1); strain MB4T of T. tengcongensis, whole genome section 118 of 244 (AE013091.1); Homo sapiens clone HQ0089 (AF090888.1); Rhizobium clone: ​​rhiz98e12.qlk. * Potato right and left border sequences were obtained and isolated according to the inventive methods described here.</td>

Vehicle DNA: Vehicle DNA is a segment of DNA that is used to carry certain genetic elements and deliver them into a plant cell. In conventional foreign DNA transfer, this carrier DNA is usually Agrobacterium T-DNA, delineated by border sequences. The carrier DNA described here is derived from selected plant species to be modified and contains ends that may be structurally and functionally different from T-DNA boundaries but share with such T-DNAs the ability to support both transfer. of Agrobacterium DNA to the nucleus of plant cells or certain other eukaryotes and the subsequent integration of this DNA into the genome of such eukaryotes.

Consisting essentially of: a composition consisting essentially of certain elements is limited to the inclusion of those elements, as well as those elements that do not materially affect the basic and novel characteristics of the inventive composition. In this way, as long as the composition does not affect the

ES 2 602 133 T3 basic and novel characteristics of the present invention, that is, it does not contain foreign DNA that is not from selected plant species or a plant that is sexually compatible with the selected plant species, then that composition can be considered a component of an inventive composition that is characterized by language consisting essentially of.

Degenerate primer: A degenerate primer is an oligonucleotide that contains sufficient nucleotide variations that they can adjust for base mismatches when hybridized to sequences of similar, but not exact, homology.

Dicotyledonous (dicot): a flowering plant whose embryos have two seed leaves or cotyledons. Examples of dicots include, but are not limited to, tobacco, tomato, potato, sweet potato, tapioca, legumes including alfalfa and soybeans, carrot, strawberry, lettuce, oak, maple, walnut, rose, mint, pumpkin, daisy , and cactus.

Regulatory sequences: refers to those sequences that are standard and known to those in the art, which can be included in expression vectors to increase and / or maximize the transcription of a gene of interest or translation of the resulting RNA in a system of plant. This includes, but is not limited to, promoters, peptide export signal sequences, introns, polyadenylation, and transcription termination sites. Methods of modifying nucleic acid constructs to increase expression levels in plants are also generally known in the art (see, for example, Rogers et al., 260 J. Biol. Chem. 3731-38, 1985; Cornejo et al. , 23 Plant Mol. Biol. 567: 81, 1993). In engineering a plant system to affect the rate of transcription of a protein, several factors known in the art can have an impact, including regulatory sequences such as positively or negatively acting sequences, enhancers and silencers, as well as structure. chromatin. The present invention provides that at least one of these factors can be used in plant engineering to express a protein of interest. The regulatory sequences of the present invention are native genetic elements, that is, they are isolated from the selected plant species that are to be modified.

Foreign: foreign, with respect to a nucleic acid, indicates that that nucleic acid is derived from non-plant organisms, or derived from a plant that is not the same species as the plant that is going to be transformed or is not derived from a plant that it is not interfertile with the plant to be transformed, it does not correspond to the target plant species.

According to the present description, foreign DNA or RNA represents nucleic acids that are naturally occurring in the genetic makeup of fungi, bacteria, viruses, mammals, fish or birds, but are not naturally occurring in the plant to be transformed. Thus, a foreign nucleic acid is one that encodes, for example, a polypeptide that is not naturally produced by the transformed plant. A foreign nucleic acid does not have to encode a protein product. In accordance with the present disclosure, a desired transgenic plant is one that does not contain any foreign nucleic acid integrated into its genome.

Native genetic elements, on the other hand, can be incorporated and integrated into a genome of selected plant species in accordance with the present description. Native genetic elements are isolated from plants that belong to the selected plant species or from plants that are sexually compatible with the selected plant species. For example, native DNA incorporated into cultivated potato (Solanum tuberosum) can be derived from any genotype of S. tuberosum or any wild potato species genotype that is sexually compatible with S. tuberosum (eg S. demissum).

Gene: gene refers to the coding region and does not include nucleotide sequences that are 5 'or 3' to that region. A functional gene is the coding region operably linked to a promoter or terminator.

Genetic rearrangement: refers to the reassociation of genetic elements that can occur spontaneously in vivo as well as in vitro that introduce a new organization of genetic material. For example, the splicing of polynucleotides at different chromosomal loci can occur spontaneously in vivo during both plant development and sexual recombination. Consequently, the recombination of genetic elements by non-natural genetic modification techniques in vitro is similar to the recombination events that also occur through sexual recombination in vivo.

In frame: nucleotide triplets (codons) are translated into a nascent amino acid sequence of the desired recombinant protein in a plant cell. Specifically, the present invention contemplates a first nucleic acid linked in reading frame to a second nucleic acid, wherein the first nucleotide sequence is a gene and a second nucleotide is a promoter or similar regulatory element.

Integrate: refers to the insertion of a nucleic acid sequence from a selected plant species, or from a plant that is of the same species as the selected plant, or from a plant that is sexually compatible with the selected plant species, into the genome of a cell of a selected plant species. Integration refers to the incorporation of only native genetic elements into a plant cell genome. With the

In order to integrate a native genetic element, such as by homologous recombination, the present disclosure may use non-native DNA as a step in such a procedure. In this way, the present disclosure distinguishes between the use of a particular DNA molecule and the "integration of a particular DNA molecule into a plant cell genome."

Introduction: as used herein, refers to the insertion of a nucleic acid sequence into a cell, by methods that include infection, transfection, transformation or transduction.

Isolated: isolated refers to any compound nucleic acid that is physically separated from its normal, native environment. The isolated material can be handled in a suitable solution containing, for example, a solvent, buffer, ion, or other component, and can be in purified or non-purified form.

Leader: transcribed but untranslated sequence that precedes (or 5 'to) a gene.

LifeSupport Vector: A LifeSupport vector is a construct that contains an expressible selectable marker gene, such as a neomycin phosphotransferase marker, that is positioned between T-DNA borders or similar T-DNA borders. The LifeSupport vector can be modified to limit integration of such a marker, as well as other polynucleotides, that are located between border or similar border sequences, in a plant genome. For example, a LifeSupport vector can comprise a virD2, codA :: upp fusion, or any combination of such genetic elements. In this way, a modified virD2 protein will continue to support the transfer of T-DNA to a plant nucleus but will limit the efficiency of subsequent genomic integration of TDNA (Shurvinton et al., Proc Natl Acad Sci USA, 89: 11837-11841, 1992; Mysore et al., Mol Plant Microbe Interact, 11: 668-683, 1998). Alternatively, the codA :: upp gene fusion can be used as a negative selectable marker prior to regeneration. In a preferred construct, the LifeSupport vector comprises the npt marker operably linked to the yeast ADH terminator element.

Monocotyledonous (monocot): a flowering plant whose embryos have a cotyledon or seed leaf. Examples of monocots include, but are not limited to, peat grass, corn, rice, oats, wheat, barley, sorghum, orchid, iris, lily, onion, and palm.

Native: A native genetic element refers to a nucleic acid that exists naturally in, originates from, or belongs to the genome of a plant that is to be transformed. In this way, any nucleic acid molecule, gene, polynucleotide, DNA, RNA, mRNA, or cDNA that is isolated either from the genome of a plant or plant species that is to be transformed or is isolated from a plant or species that is sexually compatible or interfertile with the plant species to be transformed, it is native to, that is, autochthonous to, the plant species. In other words, a native genetic element represents all genetic material that is accessible to plant breeders for plant breeding through classical plant breeding. Any variant of a native nucleic acid is considered native according to the present invention. In this regard, a native nucleic acid can also be isolated from a sexually compatible plant or species thereof and modified or mutated so that the resulting variant is greater than or equal to 99%, 98%, 97%, 96%. , 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79 %, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% similar in nucleotide sequence to unmodified nucleic acid, native isolated from a plant. A native nucleic acid variant can also be less than about 60%, less than about 55%, or less than about 50% similar in nucleotide sequence.

A native nucleic acid isolated from a plant can also encode a variant of the naturally occurring protein product transcribed and translated from that nucleic acid. In this way, a native nucleic acid can encode a protein that is greater than or equal to 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89. %, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% similar in amino acid sequence to unmodified protein , native expressed in the plant from which the nucleic acid was isolated.

Naturally occurring nucleic acid: This phase indicates that the nucleic acid is found within the genome of a selected plant species and can be a DNA molecule or an RNA molecule. The sequence of a restriction site that is normally present in the genome of a plant species can be engineered into an exogenous DNA molecule, such as a vector or oligonucleotide, even though the restriction site was not physically isolated from that genome. Thus, the present invention allows the synthetic creation of a nucleotide sequence, such as a restriction enzyme recognition sequence, as long as the sequence occurs naturally in the genome of the selected plant species or in a plant that is sexually compatible with the selected plant species to be transformed.

Operably linked: combining two or more molecules in such a way that in combination they function properly in a plant cell. For example, a promoter is operably linked to a structural gene when the promoter controls the transcription of the structural gene.

ES 2 602 133 T3

P-DNA: According to the present invention, P-DNA (plant-DNA) is isolated from a plant genome and comprises at each end, or only one end, a similar border sequence of T-DNA. The similar boundary sequence preferably shares at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90% or at least 95%, but less than 100% identity of sequence, with a T-DNA border sequence from an Agrobacterium species, such as Agrobacterium tumefaciens or Agrobacterium rhizogenes. In this way, P-DNAs can be used instead of T-DNAs to transfer one Agrobacterium nucleotide sequence to another polynucleotide sequence. The P-DNA can be modified to facilitate the transition and should preferably not naturally code for proteins or parts of proteins. The PDNA is characterized in that it contains, at each end, at least one border sequence, denoted as either a P-DNA border sequence or similar P-DNA border sequence, which are interchangeable terms. See definition of a similar boundary and boundary sequence above. A P-DNA can also be considered as a similar T-DNA sequence, see definition below.

Plant: includes angiosperms and gymnosperms, such as potato, tomato, tobacco, alfalfa, lettuce, carrot, strawberry, sweet beet, cassava, sweet potato, soybean, corn, peat grass, wheat, rice, barley, sorghum, oats, oak, eucalyptus, walnut, and palm. In this way, a plant can be a monocot or a dicot. The word plant, as used herein, also encompasses plant cells, seed, plant progeny, propagules whether sexually or asexually generated, and descendants of any of these, such as cuttings or seeds. Plant cells include suspension cultures, callus, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, seeds, and microspores. Plants can be in various stages of maturation and can be grown in a liquid or solid culture, or in soil or suitable media in pots, greenhouses or fields. The expression of a leader sequence, trailer or gene introduced into plants can be transient or permanent. A selected plant species can be, but is not limited to, one species of any one of these plants.

Precise reproduction: refers to the improvement of plants by stable introduction of nucleic acids, such as native genes and regulatory elements isolated from the selected plant species, or from another plant in the same species as the selected plant, or from species that are compatible sexually with the selected plant species, in individual plant cells, and subsequent regeneration of these genetically modified plant cells in whole plants. Since no unknown or foreign nucleic acid is permanently incorporated into the plant genome, the technology makes use of the same genetic material that is also accessible through conventional plant breeding.

Plant species: the group of plants belonging to different officially named plant species that show at least some sexual compatibility.

Plant transformation and cell culture: broadly refers to the process by which plant cells are genetically modified and transferred to an appropriate plant culture medium for maintenance, further growth, and / or further development.

Recombinant: As used herein, it broadly describes different technologies by which genes can be sequenced, DNA can be sequenced, and protein products can be produced. As used herein, the term also describes proteins that have been produced after gene transfer into the cells of plant host systems.

Selectable marker: A selectable marker is typically a gene that codes for a protein that confers some type of resistance to an antibiotic, herbicide, or toxic compound, and is used to identify transformation events. Examples of selectable markers include the streptomycin phosphotransferase (spt) gene that encodes streptomycin resistance; the phosphomannose isomerase (pmi) gene that converts mannose-6-phosphate to fructose-6-phosphate; the neomycin phosphotransferase gene (nptII) encoding kanamycin and geneticin resistance, the hygromycin phosphotransferase gene (hpt or aphiv) encoding hygromycin resistance, acetolactate synthase (ALS) genes encoding resistance to sulfonlurea herbicides , genes encoding resistance to herbicides that act to inhibit the action of glutamine synthase, such as phosphinothricin or coarse (for example, the bar gene), or other similar genes known in the art.

Sense deletion: reduction in expression of an endogenous gene by expression of one or more additional copies of all or part of that gene in transgenic plants.

T-DNA-similar: a T-DNA-similar sequence is a nucleic acid that is isolated from a selected plant species, or from a plant that is sexually compatible with the selected plant species, and that shares at least 75%, 80% , 85%, 90%, or 95%, but not 100%, sequence identity to T-DNA from Agrobacterium species. The T-DNA-like sequence may contain one or more border or similar border sequences where each is capable of integrating a nucleotide sequence into another polynucleotide. A P-DNA, as used herein, is an example of a T-DNA-like sequence.

Trailer: the transcribed but not translated sequence following (or 3'a) a gene.

ES 2 602 133 T3

Transcribed DNA: DNA comprising both a gene and the untranslated leader and trailer sequence that is associated with that gene, which is transcribed as a single mRNA by the action of the preceding promoter.

Transcription and Translation Terminators: The expression vectors described herein typically have a transcription termination region at the opposite end of the transcription initiation regulatory region. The transcription termination region can be selected, for mRNA stability to enhance expression and / or for the addition of polyadenylation tails added to the gene transcription product (Alber &amp; Kawasaki, Mol. &amp; Appl. Genetics 4: 19- 34, 1982). Illustrative transcription termination regions include the E9 sequence of the pea RBCS gene (Mogen et al., Mol. Cell Biol., 12: 5406-14, 1992) and the termination signals of different ubiquitin genes.

Plant cell transformation: a process by which DNA is stably integrated into the genome of a plant cell. Stably refers to the permanent, or non-transient retention and / or expression of a polynucleotide in and by a cellular genome. Thus, a stably integrated polynucleotide is one that is fixed within a transformed cellular genome and can be replicated and propagated through successive progeny of the resulting transformed cell or plant. Transformation can occur under natural or artificial conditions using different methods well known in the art. Transformation can be based on a known method for insertion of nucleic acid sequences into the prokaryotic or eukaryotic host cell, including Agrobacterium mediated transformation protocols, viral infection, whiskers, electroporation, heat shock, lipofection, polyethylene glycol treatment, microinjection , and particle bombardment.

Transgene: a gene to be inserted into a host genome, comprising a protein-encoding region. In the context of the present disclosure, elements that comprise the transgene are isolated from the host genome. Transgenic plant: a genetically modified plant that contains at least one transgene.

Use / Use of: the present description envisages the use of nucleic acids from species other than those of the selected plant species that are to be transformed to facilitate the integration of native genetic elements in a selected plant genome, provided that such nucleic acid foreign is not stably integrated into the genome of the same host plant. For example, the plasmid, vector, or cloning construct into which native genetic elements are cloned, positioned, or manipulated, may be derived from a different species than that from which the native genetic elements were derived.

Variant: A variant, as used herein, is understood to indicate a nucleotide or amino acid sequence that deviates from the normal, or given, nucleotide or amino acid sequences of a particular protein or gene. The terms, isoform, isotype, and analog also refer to variant forms of a nucleotide or amino acid sequence. An amino acid sequence that is altered by the addition, deletion or substitution of one or more amino acids, or a change in the nucleotide sequence, can be considered a variant sequence. The variant can have conservative changes, in which a substituted amino acid has similar structural or chemical properties, for example, replacement of leucine with isoleucine. A variant can have non-conservative changes, for example, replacement of a glycine with a tryptophan. Analogous minor variations can also include amino acid deletions or insertions, or both. Guidance can be found in determining which residues can be replaced, inserted, or removed using computer programs well known in the art such as Vector NTI Suite software (InforMax, MD).

P-DNA Vectors

Agrobacterium mediated transformation methods are the preferred means of incorporating recombinant DNA into plant cells. In accordance with the present disclosure, a binary vector was developed to produce genetically modified potato plants containing only native potato nucleic acids. Such a vector differs from conventional, transformation-mediated Agrobacterium vectors in three ways: (1) Instead of an Agrobacterium-derived T-DNA sequence delineated by T-DNA borders, the present vector contains a native plant DNA (P-DNA) fragment that is flanked by similar border sequences, what a torpor transfer of Agrobacterium P-DNA to plant cells even though they are structurally and functionally different from T-DNA boundaries, (2) the backbone of the present vector may contain a marker that, if it is integrated into the genome of plant cells, it prevents these cells from developing into mature plants, and (3) the present vector does not contain a foreign selectable marker gene between P-DNA termini.

Surprisingly, it is shown here that the P-DNA fragments flanked by the similar border sequences support the transfer of Agrobacterium DNA into plant cells. P-DNA can be isolated from the genome of any plant by using primers that are designed on the basis of homology between the terminal boundaries of potato P-DNA and conventional T-DNA. Such fragments can then be tested and, if effective, used to transform that plant with exclusively native DNA. It is also possible to search plant genomic databases for DNA fragments for regions that show

ES 2 602 133 T3 homology to T-DNA borders by using programs such as 'blastn' (Altschul et al., J Mol. Biol 215: 403-10, 1990). The identified P-DNAs can be modified to increase their usefulness. For example, internal fragments of isolated P-DNAs can be removed and restriction sites can be added to facilitate cloning. It can also be effective to introduce point mutations in terminal sequences to make PDNA more effective at transferring DNA.

Any gene expression cassette can be inserted between similar border sequences of P-DNA. For transformation of potatoes, such an expression cassette may consist of a potato promoter, operably linked to a potato gene and / or leader sequence or trailer associated with that gene, and followed by a potato terminator. The expression cassette may contain additional potato genetic elements such as a signal peptide sequence fused in frame to the 5 'end of the gene, and a potato intron that can, for example, be located between the promoter and a gene of interest. to improve expression. For transformation of wheat with a modified P-DNA, all genetic elements that are inserted into the P-DNA of wheat, including the P-DNA itself will be derived from wheat or plant species that are sexually compatible with wheat.

Another way to isolate P-DNAs is by generating a library of Agrobacterium strains containing random plant DNA fragments instead of a T-DNA flanking a selectable marker gene. Explants infected with this library can be located in proliferation media containing an appropriate selectable agent by identifying P-DNAs that support transfer of the vector marker gene in Agrobacterium to the plant cell.

It is possible not only to co-transfer the native modified P-DNA, but also additional plasmid sequences from Agrobacterium to plant cells during the transformation procedure. For purposes of the present disclosure, this is an undesirable procedure because the plasmid backbone sequences represent foreign, non-plant DNA, such as bacterial DNA. The present disclosure prevents transformed plant cells containing backbone sequences from developing into mature plants. In this way, the present description makes it possible to distinguish spine-containing and spine-free transformation events during the regenerated sprout phase.

The method for selecting or screening against backbone integration events relies on the presence of an expression cassette for a marker, such as the isopentenyl phosphotransferase (IPT) gene, in the vector backbone, outside of the P-DNA. . Following backbone integration, the IPT-i-induced cytokine accumulation will alter the shape of transformed shoots, and prevent these shoots from developing roots. Instead of the IPT gene, any other gene that alters the shape, texture or color of transformed plant leaves, roots, stem, height or some other morphological characteristic can be used to screen and / or select against integration events of spine. Such a gene is indicated herein as a "backbone integration marker". Thus, the transformed plant exhibiting an altered morphological characteristic attributable to the expression of the spinal integration marker gene is known to contain foreign DNA in its genome in addition to the desired P-DNA. Consequently, plants exhibiting a desired phenotype with the backbone integration marker are undesirable.

The present description is not limited to the use of only one IPT gene as a marker of spinal integration; other genes can be used in such a way. For example, a spinal integration marker can be an Agrobacterium transzeatin synthase (TZS) gene (Krall et al., FEBS Lett 527: 315-8, 2002) or a recessive Arabidopsis gene hoc1 (Catterou et al. ., Plant J 30: 273-87, 2002). This method can be more easily applied to some methods that insert toxic genes into vector backbone sequences. See, for example, EP 1 009,842.

By positioning a backbone integration marker gene, such as a functional cytokine gene upstream or downstream of P-DNA, it is straightforward to distinguish between transformation events. Transformed plants exhibiting an altered morphological characteristic are discarded because they contain non-native DNA sequences integrated into the genome.

Another strategy to identify plants that are stably transformed with only native DNA is to employ the polymerase chain reaction. By using primers that are specifically designed to detect backbone sequences, plants can be identified and discarded that they contain foreign backbone sequences in addition to P-DNA. Other sets of primers can later be used to confirm intact transfer of the P-DNA. In this way, either by using gene expression to change a morphological characteristic of a plant, or by screening to stably integrate foreign DNA into a transformed plant, stably transformed plants with only DNA sequences can be identified and selected. native.

The genetic elements of a particular host plant can be inserted into the P-DNA sequence of a binary vector capable of replicating in both E. coli and Agrobacterium. Introduction of the resulting vectors into disarmed Agrobacterium strains such as LBA4404 can be achieved through electroporation, tryparental mating, or heat shock treatment of chemical component cells. You can use the

ES 2 602 133 T3 new strains to transform individual plant cells through infection of whole plants or explants.

The genetic elements of a particular host plant can be inserted into the P-DNA sequence of a binary vector capable of replicating in both E. coli and Agrobacterium. Introduction of the resulting vectors into Agrobacterium strains such as LBA4404 can be achieved through electroporation, triparental mating, or heat shock treatment of chemical component cells. The new strains can be used to transform individual plant cells through whole plant infection or explants. LBA4404 contains the disassembled Ti-plasmid pAL4404, which carries the functions of virulence and a streptomycin resistance gene.

LifeSupport Vectors

Although the stable integration of bacterial marker genes into plant cell genomes facilitates identification or transformation events, such modifications of plant genomes are not desired because the marker genes represent foreign DNA. The use of a marker gene can be avoided by developing new Agrobacterium-based transformation methods.

A preferred embodiment is a novel method that relies on the use of two Agrobacterium strains: one strain containing a binary vector with a selectable marker gene intended for transient expression in a plant nucleus, and another strain that carries the P- DNA with the actual sequences of interest intended for stable integration into the plant genome (see Example 7).

Upon co-infection with the Agrobacterium strains, some plant cells will receive both a T-DNA with the marker gene and a P-DNA with the sequences of interest. Rather than subsequently selecting for stable marker gene integration by subjecting the infected explants for a long period of time to the appropriate antibiotic, the explants are only briefly exposed to the antibiotic. In this way, all plant cells that transiently express the marker gene will survive. Because TDNAs will in most cases degrade due to endogenous nuclease activities rather than stably integrate into the host genome, most plants that survived by-pass selection are shown here to develop into shoots that they lack a marker gene. The present disclosure further demonstrates that a significant proportion of these shoots free from stably integrated P-DNA marker.

There are several tools to improve the efficiency of marker free transformation. First, the present disclosure demonstrates that this frequency can be increased by sequentially infecting explants with two Agrobacterium strains bearing the T-DNA / marker and P-DNA / sequence of interest, respectively. The explants are infected first with the P-DNA strain, and then for about 4 to 6 with the T-DNA strain.

Second, the T-DNA strain can be modified to express a mutated omega virD2 gene. The modified virD2 protein will support the transfer of T-DNA to the plant nucleus but will limit the efficiency of a subsequent genomic integration of the T-DNAs (Shurvinton et al., Proc Natl Acad Sci USA, 89: 11837-11841, 1992 ; Mysore et al., Mol Plant Microbe Interact, 11: 668-683, 1998). The most preferred method of expression of a virD2 gene is by inserting a mutated omega virD2 gene driven by the virD promoter into the backbone of the T-DNA vector.

Third, stable T-DNA integration can be further impaired by inserting telomeric sequences near the left and right border sequences of T-DNA (Chiurazzi &amp; Signer, Plant Mol. Biol., 26: 923-934, 1994 ).

Fourth, the size of the T-DNA region carried by the marker gene can be increased to improve the frequency of T-DNA and P-DNA moving together in the nucleus of plant cells, and to reduce the frequency of genomic integration of the T-DNA.

Fifth, the frequency of T-DNA and P-DNA can also be improved by moving together in the nucleus of plant cells by using a single Agrobacterium strain that carries two binary vectors compatible with T-DNA and P-DNA, respectively. An example of two compatible real vectors is a vector derived from pSIM 1301 and a vector derived from pBI121.

Because the transiently expressed marker gene will usually not integrate into the plant genome, it is not necessary that both this gene and its regulatory sequences represent native DNA. Indeed, it may be advantageous for the use of foreign regulatory sequences to promote high levels of transient gene expression in infected plant cells. A surprising discovery of the present invention is that an expression cassette containing the GUS gene followed by the yeast alcohol dehydrogenase 1 terminator (ADH1) was transiently expressed at high levels in potato cells. However it didn't work

ES 2 602 133 T3 suitably a similar construct with the yeast CYC1 terminator. It may also be possible to improve transient expression levels by operably linking a marker gene to a non-native promoter. Examples of such promoters are, for example, synthetic promoters such as glucocorticoid-inducible promoters (Mori et al., Plant J., 27: 79-86, 2001; Bohner et al., Mol. Gen. Genet., 264: 860-70 2001), and non-native promoters such as the 35S promoters of cauliflower mosaic virus and Scrofularia mosaic virus and fungal promoters.

As an alternative to the Agrobacterium two-chain mediated transformation approach described above, plants can also be transformed with a single chain containing a P-DNA with both a native marker gene and current sequences of interest. The present invention shows that it is possible to use salt tolerance genes as native markers for transformation. Such salt tolerance genes include homologous cultures of the Arabidopsis SOS1 genes (Shi et al., Nat Biotechnol. 2002), AtNHX1 (Apse et al., Science. 285: 1256-8, 1999), Avp1 (Gaxiola et al., Proc Natl Acad Sci USA 98: 11444-9, 2001), and CBF3 (Kasuga et al., Nat Biotechnol. 17: 287-91, 1999).

The rearrangement of genetic elements achieved through the Precise Reproduction methodology through the genetic recombination procedure can also occur spontaneously. For example, all plants contain elements that they can transpose from one chromosomal location to another. By inserting into promoters or genes, such transposing elements can enhance, alter, and / or reduce expression of the gene. For example, AMu4 insertion of the maize Mutator element into the promoter of the transcriptional regulatory P-wr gene causes red striped pericarp. The insertion of the same element in the promoter of the ZMM19 gene of specific MADS-box leaves resulted in the expression of this gene in maize inflorescences, which causes a leaf-like elongation of the glumes and other changes in the male and female inflorescences. , resulting in the famous pod corn phenotype. Due to its strange tassels and ears, pod corn was of religious significance to certain Native American tribes. Many genes are rearranged through other modifications introduced by rearrangements such as inversions, deletions, additions, and ectopic recombinations (Bennetzen, Plant Mol Biol 42: 251-69, 2000). Additionally, plant DNA rearrangements frequently occur through the intragenic recombination process. For example, by recombining genes involved in resistance against specific pathogens, plants are able to develop resistance genes with new specificities and thus co-evolve with their pathogens (Ellis et al., Trends Plant Sci 5: 373 -9, 2000). Another example of intragenic recombination relates to how plants reproduce: the transition of plants from cross-fertilization to self-fertilization by recombination of genes involved in self-incompatibility (Kusaba et al., Plant Cell 13: 627-43, 2001). Other methods that promote genomic evolution include, for example, chromosome breakage and interchromosomal recombination.

Increase the nutritional value of food crops and plants

To modify negative traits such as acrylamide accumulation during processing, glycoalkaloid accumulation, accumulation of undesirable advanced glycation products, accumulation of CIPC, low levels of resistant starch, susceptibility to bruising, cold-induced sweetener, susceptibility to disease, low production and low quality in crop plants through precise breeding, at least one specific expression cassette is incorporated into a host genome. Three different methods are used to eliminate negative traits: (1) overexpression of genes to prevent the occurrence of negative traits, (2) overexpression of mutated versions of genes associated with negative traits in order to assess wild-type gene products with non-functional proteins, and (3) silencing genes specific that are associated with a negative trait by expressing at least one copy of a leader or trailer fragment associated with that gene in the sense and / or antisense orientation.

An example of an endogenous gene that is associated with a negative trait in potato and can be modified in vitro so that it encodes a non-functional protein is the polyphenol oxidase (PPO) gene. Following impact injury, the plastid PPO gene product is released into the cytoplasm (Koussevitzky et al., J. Biol. Chem., 273: 27064-9, 1998), where the oxidation of phenols mediates to create a variety of phenoxy radicals and quinoid derivatives, which are toxic and / or ultimately form undesirable polymers that leave dark discolorations, or black spots. in cultivation.

Overexpression of a mutant PPO gene containing a non-functional copper binding domain can decrease the activity of all genes that are primarily expressed in tubers and associated organs such as shoots. The mutations render the polyphenol oxidase protein inactive because it is unable to bind copper. The skilled person will know where to make point mutations which could, in this case, understand the function of a gene product. Applicants identified the copper binding domain in potato PPO by aligning the potato PPO protein sequence with a sweet potato PPO protein sequence (Klabunde et al., Nat Struct. Biol., 5: 1084-90 , 1998). Conservation areas, particularly those containing conserved histidine residues at copper binding sites, were targeted to inactivate the transgene product. Due to the almost complete absence of PPO activity in such organs, the ability of the plant to resist pathogens can be negatively impacted, the present invention also describes an improved method of only downgrading a specific PPO gene that is predominantly expressed everywhere.

ES 2 602 133 T3 of the mature tuber except for the epidermis. Silencing this specific PPO gene through the use of a trailer sequence associated with the gene does not reduce PPO expression in tuber epidermis, the part of the tuber that is most directly exposed to pathogens they attempt to infect.

The enzymatic browning induced by the PPO gene not only reduces the quality of potato tubers; it also negatively affects food crops such as wheat, avocado, banana, lettuce, apple, and pears.

Other genes that are associated with negative traits can be silenced by using the leader or trailer sequences associated with those genes, including the potato R1 gene and L-type phosphorylase genes. Both genes are involved in the degradation of starch to reduce sugars, such as glucose and fructose, which upon heating participate in the Maillard reaction to produce toxic products such as acrylamide. The present disclosure demonstrates that a cold-induced sweetener reduction through decreased R1 or phosphorylase activity leads to a reduction in both non-enzymatic browning and acrylamide accumulation during the potato frying process.

The present disclosure also demonstrates the utility of overexpressing certain native genes in genetically modified crops. Levels of Maillard reaction products such as acrylamide were significantly reduced by decreasing the conversion of sucrose to reduce sugars through overexpression of a freshly isolated vacuolar invertase inhibitor gene in potato.

The present disclosure also predicts that potato tubers showing either an increased level of invertase inhibitor expression or a reduced level of R1 or phosphorylase expression will not require intensive treatment with chemical germination inhibitors such as CIPC prior to storage due to at their reduced levels of reducing sugars (1) they will delay sprouting, and (2) allow storage at lower temperatures, thus further delaying the outbreak. Highly reduced CIPC residue levels, or the absence thereof, further enhances the nutritional value of processed plant-derived foods containing certain modified P-DNAs described herein.

In this way, potato chips or potato chips containing the modified P-DNA will contain strongly reduced CIPC residue levels, further increasing their nutritional value.

The effect of simultaneously decreasing the regulation of PPO expression and either the R1 or phosphorylase genes in potato tubers is synergistic because reducing sugars are not only necessary for non-enzymatic browning through the Maillard reaction but also for PPO enzyme-mediated browning. Decreased levels of reducing sugars in transgenic potato tubers will also limit PPO activity and black spot hematoma susceptibility. In this way, the PPO, R1, and phosphorylase genes, and / of the leader or trailer sequences that are associated with these genes, represent DNA segments of interest that can be isolated, modified and reintroduced back into the plant to decrease regulating the expression of these genes.

Aside from developing resistance to bruising and reducing cold-induced sweetener, there are many other traits that can be introduced through Precise Reproduction without using foreign DNA. For example, disease resistance genes can be isolated from wild potato species and inserted into the genomes of varieties susceptible to the disease.

The environmental benefits of modified plants and crops

As described above, reduced levels of either R1 or phosphorylase result in reduced starch phosphorylation. This reduction in starch phosphorylation results in a 90% decrease in phosphate content of potato tubers (Vikso-Nielsen, Biomacromolecules, 2: 836-43, 2001). This will result in the reduction of phosphate levels in wastewater from potato processing plants, which are currently around 25-40 mg / L. In this way, the use of low phosphate tubers will reduce the release of phosphates into the environment and help protect important ecosystems. Additionally, low phosphate potatoes will require less phosphate fertilization for optimal growth and production, which will support more sustainable agriculture by delaying the depletion of available phosphate resources.

Improved agricultural performance of plant and food crops

In addition to reducing susceptibility to bruising and reducing cold sweetener, which are two important processing traits, the present disclosure also provides tolerance to salt, an increasingly important input trait. Some of the modified PDNA constructs described herein contain a salt tolerance gene as a native marker for transformation. Importantly, the utility of this gene is limited to one screening step in the transformation procedure. Overexpression of the salt tolerance gene in potato plants reduces stress symptoms induced by elevated soil salinity levels, and will make it possible to develop new varieties containing modified P-DNA on an increasing percentage of soils.

Agricultural ES 2 602 133 T3 containing salinity levels that exceed the maximum of 2 millimhos / cm of electrical conductivity levels that are optimal for developing conventional varieties.

Use of regulatory elements isolated from a selected plant species or from a sexually compatible species with the selected plant species

Once the leader gene, or trailer, has been isolated from the plant species of interest, and optionally modified, it can be operably linked to a plant promoter or similar regulatory element for appropriate expression in plants. Regulatory elements such as these serve to express untranslated sequences associated with a gene of interest in specific tissues or at certain levels or at particular times.

Depending on the strategy involved in modifying the trait, it will be necessary to limit silencing to a particular region of the plant. The promoter that normally drives endogenous gene expression may not be suitable for tissue-specific expression. As described in the previous section, stable integration of bacterial or viral regulatory components, such as the cauliflower mosaic virus 35S "super" promoter, can result in unpredictable and undesirable events. Thus, the promoters of the present disclosure that are isolated from the selected host plant species.

Preferably, for use in S. tuberosum, the leader or trailer sequences associated with R1, phosphorylase, and PPO genes are operably linked to the promoter of the granule-linked starch synthase gene (Rohde et al., J Gen &amp; Breed, 44, 311-315, 1990). This promoter has been used frequently by others to drive gene expression and is particularly active in potato tubers (van der Steege et al., Plant Mol Biol, 20: 19-30, 1992; Beaujean et al., Biotechnol. Bioeng, 70: 9-16, 2000; Oxenboll et al., Proc Natl Acad Sci USA, 9: 7639-44, 2000). This promoter can also be used, preferably, for expression of the modified leader or trailer sequences of R1, phosphorylase, and PPO genes.

Alternatively, other potato promoters can be operably linked to potato sequences of interest. Such promoters include the patatin gene promoter (Bevan et al., Nucleic Acids Res, 14: 4625-38, 1986), or a fragment thereof, which promotes expression in potato tubers, the UDP-gene promoter. glucose pyrophosphorylase (US document No. 5,932,783) and the promoter of the ubiquitin gene (Garbarino et al., Plant Physiol, 109: 1371-8, 1995).

The transcription of leaders and / or sequences can also be regulated through the use of inducible promoters and regulatory regions that are operably linked in a construct to a polynucleotide of interest. Examples of inducible promoters include those that are temperature sensitive, such as heat or cold shock promoters. For example, the potato ci21A-, and C17- promoters are cold inducible (Kirch et al., Plant Mol. Biol, 33: 897-909, 1997; Schneider et al., Plant Physiol, 113: 335-45, 1997).

Other inducible promoters that are sensitive to certain substrates such as antibiotics, or other chemicals, or pH can be used. For example, abscisic acid and gibberellic acid are known to affect the intracellular pH of plant cells and in doing so, regulate the Rab 16A gene and the 1 / 6-4 alpha-amylase promoter Heimovaara-Dijkstra et al., Plant Mol Biol, 4 815-20, 1995). Abscisic acid, lesions and methyl jasmonate are known to induce the potato pin2 promoter (Lorberth et al., Plant J, 2: 477-86, 1992).

In another example, some nucleotide sequences are under time regulation and are activated to express a downstream sequence only during a certain stage of plant development or during certain hours of the day. For example, the small subunit potato promoter of the ribulose-1,5-bisphosphate carboxylase (rbcS) gene can target cell-specific, light-regulated expression (Fritz et al., Proc Natl Acad Sci USA, 88: 4458-62, 1991). The skilled person is well versed in these exemplary ways of inducible promoters and regulatory sequences.

The use of certain polyadenylation signals may be useful in regulating expression, by varying the stability of mRNA transcription. In particular, some polyadenylation signals when operably linked to the '3 end of a polynucleotide caused the mRNA transcript to become accessible for degradation.

In this way, it is possible to regulate the expression of a gene by operably linking it to one or more such promoters, regulatory sequences, or 3 'polyadenylation signals, 3' untranslated regions, signal peptide, and the like. Consequently, DNA sequences and regulatory elements such as those described here are obtained, and which will ultimately be integrated into a plant genome, from DNA of the selected plant species that is going to be modified through the Reproduction procedure. Accurate That is, DNA sequences and regulatory elements that are derived, isolated, and cloned from other species, such as bacteria, viruses, organisms, mammals, birds, reptiles, and sexually incompatible plant species are not integrated into the genome of the transformed plant. . Foreign DNA for the genome of the selected plant species can be used to create a transformation construct, as long as that foreign DNA is not integrated into a plant genome.

ES 2 602 133 T3

Not only does the present disclosure provide a method for transforming a plant species by integration of DNA obtained from the selected plant species, or from a plant that is sexually compatible with the selected plant species, it also provides a means by which the expression of that DNA. Consequently, it is possible to optimize the expression of a certain sequence, either by specific tissue or some other strategy, as described above.

Use of 3 'terminator sequences isolated from a selected plant species

In addition to regulatory elements to initiate transcription, the native expression cassette also requires elements that terminate transcription at the 3 'end of the transcription initiation regulatory region. The transcription termination region and the transcription initiation region can be obtained from the same gene or from different genes. The transcription termination region can be selected, particularly to stabilize the mRNA to enhance expression.

This particular element, the so-called 3 'untranslated region, is important in transporting, stabilizing, locating, and terminating gene transcription. In this regard, it is well known to those in the art that the 3 'untranslated region can form a certain hairpin loop. Consequently, the possibility of operably linking a 3 'untranslated region to the 3' end of a cloned polynucleotide such as the resulting mRNA transcript is envisaged, it may be exposed to factors that act on sequences and structures conferred by the untranslated region 3 '.

This particular element, the so-called 3 'untranslated region, is important in transporting, stabilizing, locating, and terminating gene transcription. In this regard, it is well known to those in the art that the 3 'untranslated region can form a certain hairpin loop. Consequently, the possibility of operably linking a 3 'untranslated region to the 3' end of a cloned polynucleotide such as the resulting mRNA transcript is envisaged, it may be exposed to factors that act on sequences and structures conferred by the untranslated region 3 '.

A 3 'sequence of the ubiquitin gene can be subcloned from the plant species from which the promoter and transgene were isolated and inserted downstream of a transgene to ensure proper termination of transcription. Both exemplary transgenes can be fused to the terminator sequence of the potato ubiquitin gene (Ubi3) regardless of which promoter is used to drive its expression.

Examples

Example 1

P-DNA cloning

This example shows that the T-DNA borders are specific for Agrobacterium. It also shows that plants contain similar T-DNA border sequences, and supplies the sequence of isolated potato and wheat DNA fragments that are delineated by such similar border sequences.

Conventional transformation systems use Agrobacterium derived T-DNAs as vehicles for the transfer of foreign Agrobacterium DNA into plant cells (Schilperoort et al., US 4940838, 1990). Although T-DNAs usually comprise several hundred base pairs, delineated by a repeating left boundary (LB) and a right boundary (RB), they can also merely consist of such boundaries. T-DNA borders play an essential role in the DNA transfer process because they function as specific recognition sites for catalyzed virD2 notching reaction. Released single-stranded DNA complexed with virD2 and virE2 agrobacteria is transferred to plant cell nuclei where they usually integrate successfully into the plant genome. All T-DNA borders that have been used for foreign DNA transfer are derived from nopaline and octapine chains of Agrobacterium tumefaciens and A. rhizogenes (Table 2). These borders and usually some flanked Agrobacterium DNAs are present in hundreds of binary vectors including, for example, pPAM (AY027531), pJawohl (AF408413), pYL156 (AF406991), pINDEX (AF294982), pC1300 (AF294978), pBI78121 (AF485783) ), pLH9000 (AF458478), pAC161 (AJ315956), BinHyg-TOp (Z37515), pHELLSGATE (AJ311874), pBAR-35S (AJ251014), pGreen (AJ007829), pBIN19 (X77672), pBIN19 (X77672) (pX35CAMBIA) (AFX35-GFPIA) (pX35-CAMBIA) AF330636), pER8 (AF309825), pBI101 (U12639), pSKI074 (AF218466), pAJ1 (AC138659), pAC161 (AJ315956), pSLJ8313 (Y18556), and pGV4939 (AY147202). Recently, two T-DNA border homologs were identified in the chrisopin-like plasmid pTiChry5 Ti (Palanichelvam et al., Mol Plant Microbe Interact 13: 1081-91, 2000). The left border homologue is identical to an inactive border homolog located in the middle of the T-DNA of pTi15955. The right border homolog is unusually divergent from the sequence of functional T-DNA borders. It is therefore unlikely that these homologues are functionally active on the pTiChry5 DNA transfer support to plant cells.

ES 2 602 133 T3

The development of a new method that makes it possible to transform plants with only native DNA requires, first of all, a replacement of the T-DNA that includes LB and RB. Unfortunately, advanced BLAST searches of public databases including those maintained by the National Center for Biotechnology Information, the Institute for Genomic Research, and SANGER failed to identify any border sequences in plants. It was therefore necessary to consider plant DNA sequences that are similar but not identical to T-DNA boundaries, referred to herein as similar boundary (similar boundary). Examples of the plant-like border sequences that were identified in the databases are shown in Table 2. The challenge in trying to replace T-DNA borders with similar border sequences is that the border sequences are highly preserved (see Table 2). A large part of these sequences are also highly conserved in the notch regions of other bacterial DNA transfer systems such as those of IncP, PC 194, and φX174, indicating that these sequences are essential for similar conjugative DNA transfer ( Waters et al., Proc Natl Acad Sci 88: 1456-60, 1991). Because there are no reliable data on boundary sequence requirements, the complete boundary therefore appears important in the notching procedure. An individual study that attempted to address this issue by testing the efficacy of border mutants on DNA transfer support is unreliable because negative controls do not appear to work properly (van Haaren et al., Plant Mol Biol 13: 523 -531, 1989). Additionally, none of the results of this study were molecularly confirmed. Despite these concerns, two possibly effective borderline mutants are shown in Table 2 as well.

Based on the homology between border sequences, a T-DNA border pattern was identified (Table 2). Although these patterns comprise 13,824 variants, many of which may not work - or may be unsuitable - in DNA transfer, they represent the broadest possible definition of what a T-DNA border sequence is or can be. This border pattern was used to search publicly available DNA databases for homologues using the Motif Alignment and Search Tool (Bailey and Gribskov, Bioinformatics 14: 48-54, 1998) and advanced BLASTN (nucleotide mismatch penalty = -1; expect = 105; Altschul et al., Nucleic Acids Res 25: 3389-3402, 1997). Again, these searches did not identify any identical matches in organisms other than Agrobacterium.

To try to increase the possibility of isolating a potato DNA fragment containing similar border sequences corresponding to the border pattern, DNA from 100 genetically diverse adhesions was isolated (the so-called core collection, provided by the US Potato Genebank, WI). This DNA was pooled and used as a template for polymerase chain reactions that use a variety of oligonucleotides designed to hybridize to similar border or border sequences. The amplified fragments of sequence analyzed, and then the sequence was confirmed using reverse PCR with nested primers. One of the potato DNA fragments that was of particular interest contains a novel sequence without large open reading frames, which is delineated by similar border sequences (Table 2). One of the similar border sequences of this fragment contains at least 5 mismatches with T-DNA borders; the other similar boundary sequence contains at least 2 mismatches. Although both of these contain a mismatch with the border pattern, they were evaluated for their ability to support DNA transfer. For this purpose, the fragment was first reduced in size to 0.4-kilo base pairs by carrying out an Internal deletion (SEQ ID NO .: 1). The resulting fragment was designated P-DNA (plant DNA) to distinguish it from Agrobacterium-derived T-DNA. A similar fragment was isolated from the genome of the potato variety Russet Ranger, but has not been used for further experiments.

Based on the divergence between P-DNA and T-DNA boundaries, the elongase Life Technologies amplification system was used with the following degenerate primers to isolate a wheat P-DNA: 5'GTTTACANHNBNATATATCCTGYCA -3 '(Bor-F ) (SEQ ID NO. 56), and 5'-TGRCAGGATATATNVNDNTGTAAAC -3 '(Bor-R) (SEQ ID NO. 57). The resulting 825-bp fragment is shown in SEQ ID NO .: 2, and was used to replace the T-DNA of a standard binary vector. The efficacy of this construct can be tested by Inserting an expression cassette for the GUS gene between the terminal of PDNA, and by Infection of wheat with an Agrobacterium strain carrying the resulting vector.

Example 2

Tobacco transformation with P-DNA vectors

This example demonstrates that, despite structural (sequence divergence) and functional (transformation frequency) differences between the P-DNA terminal and T-DNA boundaries, a P-DNA can be used in a similar way as a T -DNA to transfer Agrobacterium DNA to tobacco cells.

A free T-DNA vector that can be maintained in both E. coli and A. tumefaciens was obtained by removing the entire T-DNA region from the conventional binary vector pCAMBIA1301 (Cambia, AU). This was achieved by simultaneous ligation of a 5.9 kb SacII-SphI fragment from pSIM1301 with 2 amplified fragments from pCAMBIA1301 using oligonucleotide pairs: 5'-CCGCGGTGATCACAGGCAGCAAC - 3 '(SEQ ID NO. 58) and 5'-ACCGCCATCCAGCCCT 3 '(SEQ ID NO. 59), and 5 'AAGCTTGGCTACTAGTGCGAGATCTCTAAGAGAAAAGAGCGTTTA-3' (SEQ ID NO. 60), and 5'GCATGCTCGAGATAGGTGACCACATACAAATGGACGAACGG-3 '(SEQ ID NO. 61), respectively.

ES 2 602 133 T3

To make it possible to screen against backbone integration events, an expression cassette comprising the Agrobacterium isopentenyl transferase (IPT) gene driven by the Ubi3 promoter and followed by the Ubi3 terminator (SEQ ID NO .: 3) as 2.6 kbp SacII fragment in the backbone of the T-DNA free vector described above, which produces pSIM100-OD-IPT. Transformed plant cells expressing the IPT gene are expected to accumulate cytokinins and grow into abnormal shoots that cannot develop roots.

The 0.4 kb P-DNA fragment described in Example 1 was inserted into pSIM100-OD-IPT to generate pSIM111 (Figure 1; SEQ ID NO .: 4).

To evaluate whether pSIM111 can be used to obtain transformed plants bearing P-DNA (including any sequence located between the P-DNA terminus) if the additional vector backbone, a neomycin phosphotransferase gene expression cassette (NPTII ) in the P-DNA of pSIM111 to create pSIM108 (Figure 1).

P-DNA terminal efficiency on DNA transfer support was tested by transformation frequency comparison between pSIM108 and a control vector containing a modified P-DNA with standard T-DNA borders. This control vector, designated pSIM109, was generated by amplifying the complete P-DNA containing the NPTII gene expression cassette with the oligonucleotide pairs: 5'ACTAGTGTTTACCCGCCAATATATCCTGTCAGAG-3 '(SEQ ID NO. 62), and 5'AAGCTTTGGCAGGATATATTGTGGTGTAAACGAAG-3 '(SEQ ID NO. 63). A second control vector that was used for these experiments is the binary vector pBI121 (Genbank accession number AF485783), which contains the same NPTII expression cassette inserted into a regular T-DNA. The binary vectors were introduced into Agrobacterium tumefaciens LBA4404 cells as follows. Competent LB4404 cells (50 uL) were incubated for 5 minutes at 37 ° C in the presence of 1 pg of vector DNA, frozen for approximately 15 seconds in liquid nitrogen (approximately -196 ° C), and incubated again at 37 ° C for 5 minutes. After adding 1 mL of liquid broth (LB), cells treated for 3 hours at 28 ° C and plated on LB / agar containing streptomycin (100 mg / L) and kanamycin (100 mg / L) were grown. DNA vectors were then isolated from overnight cultures of individual LBA4404 colonies and examined by restriction analysis to confirm the presence of intact plasmid DNA.

Test transformations of the tobacco plant model were carried out by growing a 10-fold dilution of growing LBA4404 :: pSIM108 cells overnight for 5-6 hours, precipitating the cells for 15 minutes at 2,800 RPM, washing them with MS liquid medium (Phytotechnology) supplemented with sucrose (3%, pH 5.7) and resuspension of the cells in the same medium at an OD600nm of 0.2. The suspension was used to infect 4-week-old in vitro grown Nicotiana tobacco plant leaf explants. Tobacco explants were incubated for 2 days in culture media (1/10 MS of salts, 3% sucrose, pH 5.7) containing 6 g / L of 25 ° C agar in a Percival growth chamber (16 hours of light) and subsequently transferred to M401 / agar medium containing timenthine (150 mg / L) and kanamycin (100 mg / L). The number of callus per explant that developed within the next 4 weeks is shown in Table 3. These data demonstrate that P-DNAs delineated by either native terminal or T-DNA borders are approximately 50% more effective at tobacco transformation than T-DNAs. The increased efficiency of P-DNA transfer may be due to either its different CG content or other unknown structural features of the PDNA. Example 3

Potato transformation with P-DNA vectors

This example demonstrates that a P-DNA can be used in a similar way as a T-DNA to transfer Agrobacterium DNA to potato cells.

Potato transformation was carried out by infection of in vitro grown 4 week old Russet Ranger seedling shoot explants with Agrobacterium strains according to the following procedure. Ten-fold dilutions of cultures grown overnight for 5-6 hours, precipitated for 15 minutes at 2,800 RPM, washed with MS liquid medium (Phytotechnology) supplemented with sucrose (3%, pH 5.7) and resuspension in the same medium were developed. at an OD600nm of 0.2. The resuspended cells were then used to infect 0.4-0.6 mm of potato internodal segments. Infected shoots were incubated for 2 days in coculture medium (1/10 MS of salts, 3% sucrose, pH 5.7) containing 6 g / L of agar at 22 ° C in a Percival growth chamber (16 hours of light ) and subsequently transferred to callus induction media (CIM, MS media supplemented with 3% sucrose 3, 2.5 mg / L of zeatin riboside, 0.1 mg / L of naphthalene acetic acid, and 6g / L of agar) that they contain timenthine (150 mg / L) and kanamycin (100 mg / L). After 1 month of culture in CIM, the explants were transferred to sprout induction medium (SIM medium, MS supplemented with 3% sucrose, 2.5 mg / L of zeatin riboside, 0.3 mg / L of GA3 gibberellic acid, and 6g / L agar) containing timenthine and kanamycin (150 and 100 mg / L respectively). After 3-4 weeks, the number of explants that developed transgenic callus and / or shoots were counted. As shown in tobacco, the number of explants from pSIM108 infected shoots showing callus was higher than those in control experiments with the conventional binary vector pBI121 (Table 3). The shoots that subsequently arose from these calluses may be

ES 2 602 133 T3 grouped into two different classes. The first class of shoots was phenotypically indistinguishable from control shoots transformed with LBA :: pBI121. The second class of shoots showed an IPT phenotype. Shoots of the latter class were stunted in growth, contained only very small leaves, showed a light green to yellow color, and were unable to take root after transfer to hormone-free medium. To confirm that shoots with an IPT phenotype contained the IPT gene stably integrated into their genomes, all shoots were transferred to Magenta boxes containing MS medium supplemented with 3% sucrose and 150 mg / L timentin, allowing growth for 3%. to an additional 4 weeks, and used to isolate DNA. This plant DNA served as a template in PCR reactions with a pair of oligonucleotides designed to hybridize to the IPT gene: 5'- GTC CAA CTT GCA CAG GAA AGA C-3 ', and 5'- CAT GGA TGA AAT ACT CCT GAG C-3 '. As shown in Table 4, the PCR experiment confirmed a strict correlation between the IPT phenotype and the presence of the IPT gene. The presence of backbone DNA was also examined in plants obtained from a transformation with pBI121. This was done by performing PCR reactions on DNA isolated from transformation events with the 'pBI121 backbone primers': 5'-CGGTGTAAGTGAACTGCAGTTGCCATG-3' (SEQ ID NO. 64), and 5'CATCGGCCTCACTCATGAGCAGATTG-3 '(SEQ ID NO. 65). Amplification of a 0.7 kbp band is indicative of backbone integration. By comparing the data presented in Table 4, it can be concluded that the backbone integration frequencies are similar for P-DNA vectors and T-DNA vectors.

A second PCR experiment was carried out to test whether the IPT-free plants did not contain any other backbone sequences. Because the IPT expression cassette is positioned close to the left similar border sequences, the oligonucleotide pair for this experiment was designed to hybridize to backbone sequences near right similar border sequences: 5'CACGCTAAGTGCCGGCCGTCCGAG-3 ' (SEQ ID NO. 66), and 5'-TCCTAATCGACGGCGCACCGGCTG-3 '(SEQ ID NO. 67). The data from this experiment confirm that plants that are positive for the IPT gene are also positive for this other part of the spine.

Similar experiments were carried out with the Russet Burbank potato variety. Based on an evaluation of the IPT phenotypes, the backbone integration frequencies for pSIM108 and pSIM109 were shown to be comparable to those in Russet Ranger (see Tables 4 and 5).

Example 4

Potato invertase inhibitor gene

Using conventional transformation methods, this Example demonstrates that overexpression of a novel potato invertase inhibitor gene improves the processing and health characteristics of potato tubers.

The following primers were designed to amplify a novel potato homologue of the tobacco vacuolar invertase inhibitor (Greiner et al., Nature Biotechnology, 17, 708-711, 1999): 5'AAAGTTGAATTCAAATGAGAAATTTATTC-3 '(SEQ ID NO. 68) , and 5'- TTTTAAGCTTTCATAATAACATTCTAAT -3 '(SEQ ID NO. 69). The amplification reaction was performed by mixing the following components: 4 µl of plant DNA, 2 µl of forward primer (10 pM / ml), 2 µl of reverse primer, 25 µl of Hot Start Master mix (Qiagen Catalog Nr. 203443), and 17 pl of water. This reaction mixture was subjected to the following polymerase chain reaction (PCR) conditions using a PTC-100 thermal cycler (MJ Research): (1) 5 minutes at 95 ° C (1 cycle), (2) 1 minute at 94 ° C, 1 minute at 45 ° C and 4 minutes at 72 ° C (35 cycles), and (3) 10 minutes at 72OC (1 cycle). The total product was loaded onto a 0.8% agarose gel, and a 540 base pair gel band was purified using QIAquick Gel Extraction Kit (Qiagen, CA). This purified fragment was then ligated into pGEM-T Easy (Promega, WI) and transformed into E. coli DH5-alpha using Maximum Efficiency Competing Cells (GibcoBRL, MD). Sequence analysis of isolated recombinant plasmid DNA from transformed DH5-alpha revealed the presence of a single open reading frame consisting of 543 base pairs encoding a putative 181 amino acid protein (SEQ ID NO .: 5); the Clustal alignment revealed 70% homology for Ntinhh (Figure 2). This high level of homology extends to the N-terminal domain of amino acid 15, indicating that the potato homolog is targeted to the vacuole. Interestingly, the potato invertase inhibitor homolog, designated Stinh1, shares only 43% homology with the proprietary tobacco cell wall invertase inhibitor, designated Nt-inh1 (WO98 / 04722; Figure 2).

Although the St-inh1 gene is present in unmodified potato tubers, its level of expression is inadequate for complete inhibition of invertase and reduced cold-induced sweetener. To increase the storage characteristics of potato, the Stinh1 gene was fused to a new improved tuber promoter of the granule-linked starch synthase (GBSS) gene, which is known to promote high levels of gene expression in tubers. The GBSS promoter from the potato variety Russet Ranger was isolated by carrying out a PCR reaction using the forward primer 5'-GAACCATGCATCTCAATC-3 '(SEQ ID NO. 70) and the reverse primer 5'GTCAGGATCCCTACCAAGCTACAGATGAAC-3' (SEQ ID NO. 71). Sequence analysis of the cloned amplified product in pGEM-T shows that this new promoter contains 658 base pairs (SEQ ID NO .: 6). The resulting promoter / gene fusion was then ligated to the 3 'regulatory sequence of the potato ubiquitin gene.

ES 2 602 133 T3 (UbiT; SEQ ID NO .: 7), thus ensuring proper termination of transcription of the invertase inhibitor gene.

This expression cassette was inserted between the T-DNA borders of a binary vector, and the resulting vector pSIM320 was used to transform Russet Ranger as described above. Three sections of nine independent transgenic lines were planted in the soil and developed for four weeks in a growth chamber (11 hours of light; 20 ° C). At least 3 tubercullets were collected from each line and transferred to a refrigerator set at 4 ° C to induce cold sweetener. After 4 weeks, glucose levels were determined in these cold-stored miners using either an Accu-Chek meter and test strips (Roche Diagnostics, IN) or a glucose oxidase / peroxidase reagent (Megazyme, Ireland). These levels were compared to the average glucose levels in both 6 non-transformed lines and 6 transformed control vector lines with a vector derived from pSIM110 lacking the invertase inhibitor gene. As shown in Table 6, three transgenic lines accumulated less than 40% of the glucose in the control vector lines demonstrating that the invertase inhibitor homolog is functionally active.

The following experiments showed that the amount of reducing sugars present in tubers correlates with acrylamide production during tuber processing. Russet Ranger potato tubers were recently harvested from the field and stored at 4 ° C to induce cold sweetener; Control tubers were stored at 18 ° C. After 4 weeks, glucose levels were determined in both groups of tubers. subsequently, the tubers were washed, blanched for either 8 minutes or 12 minutes at 165 ° F, cut into 0.290 x 0.290 strips of shoestring, dipped in a 1% sodium acid pyrophosphate solution at 160 ° F , dried at 160 ° F until 14 ± 2% drying weight loss is achieved, fried at 390 ° F for 40 seconds to reach 64 ± 2% of first frying moisture, and frozen for 20 minutes at 15 ° F , shaking the tray 2-3 times in the first 6 minutes. French fries were analyzed for acrylamide levels by the Covance Laboratory (WI). As shown in Table 7, glucose levels in tubers stored at 18 ° C were below detection levels of 0.1 mg / g while tubers stored cold contained on average 3.4 mg / g of glucose. This table also shows that French fries produced from the latter potatoes contained approximately 10 times higher levels of acrylamide than French fries produced from potatoes stored at 18 ° C. Even by using a shorter blanching time for potatoes stored at 18 ° C than for potatoes stored at 4 ° C, to produce crisps with a similar color (color ids of 78 and 71, respectively), a 5-fold difference in acrylamide accumulation (Table 7). Thus, there appears to be a direct correlation between the amount of reducing sugars such as glucose in tubers and the accumulation of acrylamide in potato chips derived from these with tubers.

To determine if the reduced glucose levels in the pSIM320 lines will limit the accumulation induced by acrylamide processing, miners were processed cold stored pSIM320 by cutting into pieces, blanching for 8 minutes, immersing in 0.5% SAPP for 30 seconds, drying for 4.5 minutes at 160 ° F, fry for 40 seconds at 380 ° F, freeze for minutes at -15 ° F, and finally dry for 3 minutes and 10 seconds at 160 ° F. The processed material was sent to the Covance laboratory for acrylamide determinations. As shown in Table 6, the potato chips obtained from minituber with the lowest amounts of glucose accumulated the lowest levels of acrylamide. A 40% reduction in glucose levels in lines 320-2 and 320-4 is associated with a 5-fold reduction in acrylamide levels.

Example 5

The trailer leader sequences associated with the potato R1 gene

By using conventional transformation methods, this Example demonstrates that a novel leader sequence associated with the potato R1 gene can be effectively used to improve the processing and health characteristics of potato tubers. It also predicts that a novel trailer associated with that same gene can be exploited in the same way.

As an alternative to overexpression of the invertase inhibitor gene, methods were developed to limit acrylamide production without the use of any actual gene sequence. Such a method is based on silencing the expressed tuber R1 gene. Previously, it was shown that this starch related gene can be silenced through antisense expression of a 1.9-kb gene fragment derived from that gene (Kossmann et al., US 6,207,880). However, the antisense expression of large DNA fragments is undesirable because such fragments contain new open reading frames (Table 1). As a safe approach to that described above, a small leader sequence associated with the potato R1 gene was isolated. This leader was obtained by performing rapid amplification of cDNA ends with the RACE 5 'kit supplied by GIBCO BRL in total RNA from tubers of Russet Ranger potato plants. Sequence analyzes demonstrated that the associated R1 leader consists of 179 base pairs (SEQ ID NO .: 8). Both a sense and an antisense copy of this leader sequence, separated by the potato Ubiquitin intron (SEQ ID NO .: 9), was located between the GBSS promoter and UbiT. The resulting expression cassette for the leader sequence associated with R1 is shown in Figure 3 (SEQ ID NO .: 10). A similar cassette is shown containing a derived spacer

ES 2 602 133 T3 of the GBSS promoter (SEQ ID NO .: 11) -in exchange for the Ubi intron that separates the sense and antisense copies of the R1 trailer in (Figure 3; SEQ ID NOs .: 12). Additional variants with a larger version of the GBSS promoter (SEQ ID NO .: 13) are shown in Figure 3 (SEQ ID NOs .: 14-15).

To test the efficacy of the associated R1 leader in limiting acrylamide production, the expression cassette shown in Figure 3 was inserted as a KpnI-XbaI fragment between the T-DNA borders of a binary vector. An Agrobacterium strain LBA4404 carrying the resulting vector pSIM332 was used to transform the Russet Ranger potato. To induce tuber formation, 25 shoots representing independent transformation events were transferred to the soil and placed in a growth chamber (11 hours of light, 25 ° C). After three weeks, at least 3 miners / line were stored for 4 weeks at 4 ° C to induce starch mobilization. Glucose levels in these cold-stored miners were subsequently determined as described in Example 4, and compared to average glucose levels in non-transformed plants and vector controls. As shown in Table 8, the miners derived from all 25 lines showed reduced glucose levels after cold storage. An approximately 2-fold reduction in standby acrylamide levels in miniature-derived potato chips showing reduced R1 expression levels, compared to controls. Much stronger effects of R1 downregulation gene expression were anticipated in mature tubers.

As an alternative to the leader-based approach, expression cassettes containing both a sense and an antisense copy of the R1-associated trailer sequence were generated. This trailer is obtained by performing a reverse transcription polymerase chain reaction (RT-PCR) on total RNA isolated from tubercles of the Russet Ranger potato variety. Complementary DNA was generated using the Omniscript RT Kit (Qiagen, CA) and then used as a template for the Hot start DNA polymerase PCR reaction (Qiagen, CA) with the gene-specific reverse primer R1-1 ( 5'-GTTCAGACAAGACCACAGATGTGA-3 '). Sequence analysis of the amplified DNA fragment cloned into pGEM-T showed that the trailer associated with R1 consists of 333 base pairs (SEQ ID NO .: 16). The sense and antisense copies of the trailer were separated by either the Ubi intron or the GBSS spacer - and sandwiched between the GBSS promoter and the Ubi3 terminator (Figure 3; SEQ ID NOs .: 17-18). Similar versions with the GBSS promoter are shown in Figure 3 (SEQ ID NOs .: 19-20).

Glucose and acrylamide levels can be determined as described above. Tubers showing approximately 50% or greater reductions in glucose concentrations are also expected to accumulate approximately 50% less acrylamide during the frying process. The improved health and storage characteristics of modified plants can be confirmed in mature field-grown tubers.

Phosphate levels in potato tubers can be determined using the AOAC Method 995.11 for Phosphorus (Total) in Foods (45.1.33 Official Methods of Analysis of AOAC International, 17th Edition). Mixtures were prepared by dry ashing in a muffle furnace followed by acid digestion. The dissolved samples are then neutralized and treated with a solution of molybdate-ascorbic acid and compared with a series of phosphorus standards (similarly treated). A double beam spectrophotometer will be used for colorimetric analysis at 823 nanometers. A significant decrease in phosphate content is expected, which is beneficial for the environment.

Example 6

Leader sequence associated with the alpha-glucan phosphorylase L gene

Using conventional transformation methods, this example demonstrates that a novel leader sequence associated with the potato alpha-glucan phosphorylase L gene can be used to effectively improve the processing and health characteristics of potato tubers.

Previously, it was shown that cold-induced sweetener can be reduced through antisense expression of 0.9-kb fragments derived from alpha-glucan phosphorylase genes (Kawchuk et al., US 5,998,701, 1999). However, the antisense expression of these relatively large DNA fragments is undesirable because they contain new and uncharacterized open reading frames that can impact the nutritional quality of foods if they are expressed in transgenic plants (Table 1).

As a safer approach than described above, small leader and trailer sequences that are associated with an L-type glucan phosphorylase gene were isolated from mature tuber RNA. The primer pair used for this purpose is: 5'-GGATCCGAGTGTGGGTAAGTAATTAAG-3 '(SEQ ID NO. 72), and 5'GAATTCTGTGCTCTCTATGCAAATCTAGC-3' (SEQ ID NO. 73). The resulting 273 bp leader sequence was applied and is shown in SEQ ID NO .: 21. Similarly, the forward primer, 5'-GGAACATTGAAGCTGTGG-3 '(SeQ ID NO. 74), was used with an oligo-dT primer to amplify a 158 bp "trailer sequence" that is associated with the type phosphorylase gene L (SEQ ID NO .: 22).

ES 2 602 133 T3

Expression cassettes were then designed that use these trailer or leader sequences to modify the expression of the L-type phosphorylase gene and thereby decrease acrylamide levels in fried products by limiting starch mobilization. These cassettes were constructed in a similar manner as described in Example 5, and are depicted in Figure 3 (SEQ ID Nos .: 23-26). An Agrobacterium strain containing a binary vector with this expression cassette, designated pSIM216, was used to infect potato shoots, and generate 25 transgenic plants. Minititters derived from these plants were stored for 4 weeks at 4 ° C to induce cold sweetener. The cold stored miners were then analyzed for glucose levels. As shown in Table 9, the miners of all transgenic lines showed reduced glucose levels.

Four lines that showed at least 50% reduced glucose concentrations (lines 216-2, 2165, 216-10, and 216-21) were used to evaluate the induced processing acrylamide levels. Although the acrylamide levels in fried tubers derived from the first three lines were similar to those of controls, the potato chips that were derived from line 216-21, accumulated only 45% of the wild-type acrylamide levels (136 vs. 305 parts per billion). These results confirmed the experiments described in Example 4 for tubers that overexpressed the potato invertase inhibitor gene, in these relatively large reductions in glucose (and fructose) concentrations it is necessary to limit the accumulation of acrylamide induced by heating in cold-stored miners. . Due to the silencing of the phosphorylase gene, expected to be more effective in mature tubers 216, reductions in acrylamide levels are also anticipated to be more pronounced in potato chips produced from such tubers. The improved health and storage characteristics of the modified plants can be confirmed in mature tubers.

Example 7

Modified polyphenol oxidase gene

By using conventional transformation methods, this Example demonstrates that a modified polyphenol oxidase gene lacking a functional copper binding site can be used effectively to reduce hematoma susceptibility in tubers.

Previously, it was shown that black spot hematoma susceptibility can be reduced through antisense expression of the 1.8-kb PPO gene (Steffens, US 6,160,204, 2000). However, expression of the reverse complement of this larger expressing gene is undesirable because it contains new and uncharacterized open reading frames that encode peptides consisting of more than 100 amino acids, which can potentially impact the nutritional quality of foods ( Table 1). As a safer approach than described above, the PPO gene was modified to encode a non-functional protein.

The wild type potato PPO gene was isolated from Russet Ranger using a polymerase chain reaction (PCR) method. First, genomic DNA was isolated from Russet Ranger shoots. The potato PPO gene was then amplified from potato genomic DNA using polymerase primers and 5 'oligonucleotides: CGAATTCATGGCAAGCTTGTGCAATAG-3' (PPO-F) (SEQ ID NO. 75), and 5'CGAATTCTTAACAATCTGCAAGACTGATPCOG-3 '(PPCOG-3' R) (SEQ ID NO. 76). These were designed to complement the 5'- and 3'- ends of the potato PPO gene. The amplified 1.6 kb fragment was cloned into a pGEM-T EASY vector (Promega) and confirmed to represent a functional PPO gene by sequence analysis (SEQ ID NO .: 27).

The copper binding domain in potato PPO was identified with a sweet potato PPO protein shown to contain conserved Cysteine ​​(Cys) residue at position 92, Glutamine (Glu) residue at position 236, and residues of Histidine (His) at positions 88, 109, 118, 240, 244 and 274 coordinating two active site coppers (Klabunde et al., Nature Structural Biol., 5: 1084-1090, 1998). These Cys, Glu, and His residues are also present in PPO.

The inactive PPO gene was created using a PCR m mutation replacement approach. Three fragments were amplified by Proof Start Taq DNA Polymerase (Qiagen) using 3 pairs of primers and wild type Russet Ranger PPO as a template. The sequences of the first pair, designated P1-F and P2-R, respectively, are: 5'-GAGAGATCTTGATAAGACACAACC-3 '(SEQ ID NO. 77), and 5'CATTACC1ATAAGCC2CAC3TGTATATTAGCTTGTTGC-3' (SEQ ID NO. 78) (1: A to C mutation, resulting in Cysteine ​​to Glycine substitution at position 186; 2: A to C mutation, resulting in Cysteine ​​to Tryptophan substitution at position 183; 3: A to C mutation, which substitution of Histine to Glutamine results at position 182). These second pair sequences, designated P3-F and P4-R, respectively, are 5'GTGCTTATAGAATTGGTGGC-3 '(SEQ ID NO. 79), and 5'-TAGTTCCCGGGAGTTCAGTG -3' (SEQ ID NO. 80). The sequences of the third pair, designated P5-F and P6-R, respectively, are 5'CTCCCGGGAACTATAGG4AAACATTCCTCT5CGGTCCTGTCCACATCTGGTC -3 '(SEQ ID NO. 81) and 5'GTGTGATATCTGTTCTTTTCC-3' A (SEQ ID NO. 82) to G, resulting in substitution of Glutamine to Glycine at position 326; 5: A to T mutation, resulting in substitution of Histine to Leucine at position 330).

ES 2 602 133 T3

An 80 bp fragment was amplified using primer P1-F and P2-R and digested with BglII. This fragment contains a sticky end (BglII) and a blunt end, carries three mutations in the copper I binding site. A 0.4 kb fragment was amplified using the primer P3-F and P4-R and digested with XmaI, it contains an end blunt and a sticky end (XmaI). A 0.2 Kb fragment was amplified using primer P5-F and P6-R and digested with XmaI and EcoRV. This third fragment with a sticky end (XmaI) and a blunt end (EcoRV) has two copper II binding site mutations. The cloned wild type potato PPO BglII and EcoRV fragment was then replaced with the above three ligated PCR amplified fragments. The presence of a total of 5 point mutations in the modified PPO gene was confirmed by sequence analysis (SEQ ID NO .: 28). To create a modified PPO expression cassette (mPPO), the following four fragments were simultaneously ligated: (1) a BamHI-HindIII fragment containing the GBSS promoter, (2) a HindIII-SacI fragment containing the PPO mutant , (3) a fragment of SacIKpnI containing the Ubi-3 terminator, and (4) pBluescript plasmid, digested KpnI and BamHI. The expression cassette was then inserted between the borders of a binary vector to create pSIM314.

The efficacy of the mPPO gene expression cassette was evaluated by transforming Russet Ranger stem explants with pSIM314. Nodal sections of transgenic plants containing this expression cassette were placed in MS medium supplemented with 7% sucrose. After a 5 week incubation period in the dark at 18 ° C, the tubercles were isolated and tested for PPO activity. For this purpose, 1 g of potato tubers was sprayed in liquid nitrogen. This powder was then added to 5 ml of 50 mM buffer (pH 6.5) of MOPS (3- (N-morpholino) propanesulfonic acid) containing 50 mM of catechol, and incubated at room temperature with rotation for approximately 1 hour. The solid fraction was then precipitated, and the supernatant was transferred to another tuber to determine PPO activity by measuring the change in OD-410 over time. As shown in Table 10, the tubercullets isolated from some of the transgenic lines showed significantly reduced polyphenol oxidase activity compared to either non-transformed controls or controls transformed with a construct that does not contain the mutant PPO gene. The strongest reduction in PPO activity was observed in lines 314-9, 314-17, and 314-29. To test whether the expression of the mutant PPO gene also reduced PPO activity in miniature minnows, rooted seedlings of transgenic lines were planted in soil and incubated in a growth chamber for 4 weeks. A PPO test in isolated minitubergines showed that reduced PPO activity was correlated in most cases with reduced activities in minitubergines (Table 10). Transgenic lines showing reduced PPO activity can both be propagated and tested in the greenhouse and in the field to confirm the low hematoma phenotype in mature tubers. Because micro and mini tubers express a variety of polyphenol oxidases, some of which share only limited sequence homology with the target polyphenol oxidase that is predominantly expressed in mature tubers, an even more profound reduction in activity can be anticipated. of PPO in mature tubers of lines such as 314-9 and 314-17. The data indicate that inactive overexpression of a PPO gene can functionally result in reduced susceptibility to hematoma. The improved health and storage characteristics of modified plants can also be confirmed in mature field-grown tubers.

Example 8

The trailer sequence of a polyphenol oxidase gene that is specific for non-epidermal tissues of potato tubers

By using conventional transformation methods, this Example demonstrates that a novel trailer sequence associated with the potato PPO gene can be used effectively to reduce hematoma susceptibility in tubers.

Reverse transcription PCR was used to also isolate the trailer sequence associated with the PPO gene expressed in potato tubers. The primers for the first PCR reaction were PPO-1 (5'GAATGAGCTTGACAAGGCGGAG-3 ', (SEQ ID NO. 83)) and oligo-dT; Primers for a second nested PCR reaction were PPO-2 (5'-CTGGCGATAACGGAACTGTTG-3 ', (SEQ ID NO. 84)) and oligo-dT. Sequence analysis of the amplified DNA fragments cloned into pGEM-T revealed a sequence of a 154-bp trailer (SEQ ID NO .: 29). A sense and antisense copy of this trailer, separated by the Ubi intron, was then fused to the GBSS promoter and the Ubi3 terminator as described above to generate an expression cassette shown in Figure 3 (SEQ ID NO .: 30). An alternative construct containing the trailer segments separated by a GBSS spacer shown in Figure 3 (SEQ ID NO .: 31). Similar versions with the larger GBSS promoter are shown in Figure 3 (SEQ ID NOs .: 32-33). Interestingly, the tow of a PPO gene that is predominantly expressed in mature tubers (indicated with P-PPO3 in Figure 4) is different from the tow of PPO genes that are predominantly expressed in other tissues including tubercles (indicated with PPOM-41 and PPOM-44 in Figure 4). Due to the low homology between the trailers associated with different PPO genes, the use of the P-PPO3 trailer will only result in silencing of the mature specific tuber PPO gene. This very specific gene silencing will be difficult to achieve with sequences derived from the PPO gene itself, thus demonstrating the advantage of using sequences that do not

ES 2 602 133 T3 code for gene silencing. To visualize the extent of PPO activity, 0.5 mL of 50 mM catechol was pipetted onto the cut surface of the genetically modified sliced ​​tubercles. Compared with controls, the visual obscuration of the tuber regions was approximately 5-10 10 times reduced. Interestingly though, no darkening was observed in the potato skin. It appears that the trailer sequence used specifically silenced the PPO gene, which is predominantly expressed in the cortex and medulla but not in the epidermal skin. This unexpected finding may be ben beneficial for tubers to protect them against some pathogens that try to infect through the skin because the PPO gene may play a role in certain defense responses. To quantitatively determine PPO activity, an assay was carried out as described in Example 7. Table 11 shows up to 80% reduction in PPO activity in transformed mink compared to non-transformed controls. The level of reduction is expected to be even greater in mature tubers because these tubers express the target PPO gene more predominantly than mini and micro tubers. These characteristics of lines such as 217-7 and 217-26 can be confirmed in mature tubers. Example 9

An expression cassette to increase levels of resistant starch

Increasing the amylose / amylopectin ratios in tubers can further improve the nutritional value of potato products. One method that makes it possible to increase the amylose content is based on the antisense expression of genes encoding the starch branching enzyme (SBE) I and II (Schwall et al., Nature Biotechnology 18: 551-554, 2000). The disadvantages of this method are that (1) the efficiency of simultaneously silencing two different genes through exploitation of antisense technologies is very low, (2) the antisense expression of the relatively large SBE-I and SBE-II sequences results in the undesirable expression of open reading frames (Table 1) (3) the corresponding constructs harboring two antisense expression cassettes are unnecessarily large and complex, thus, which increases the possibilities of recombination and decreases the frequencies of transformation.

The approach to increase the amylose content in potatoes is based on the expression of the trailer sequence that is associated with both genes. These trailers (SEQ ID No.:34 and 35) were isolated with the primer pairs 5'-GTCCATGATGTCTTCAGGGTGGTA-3 '(SEQ ID NO. 85), and 5'-CTAATATTTGATATATGTGATTGT -3' (SEQ ID NO. 86), and 5'-ACGAACTTGTGATCGCGTTGAAAG -3 '(SEQ ID NO. 87), and 5'-ACTAAGCAAAACCTGCTGAAGCCC 3' (SEQ ID NO. 88). A single promoter drives the expression of a sense and antisense fusion of both trailers, separated by the Ubiquitin-7 intron, and followed by the Ubiquitin-3 terminator. The size of the entire expression cassette is only 2.5-kb.

Example 10

Development of free marker transformation methods

This example demonstrates that plants can be effectively transformed without the need for stable integration of selectable marker genes.

This method is the first to take advantage of the phenomenon that DNAs targeted to the plant cell nucleus usually fail to later integrate into the plant cell genome. The inventors made the surprising discovery, that it is possible to select for cells temporarily expressing a non-integrating T-DNA containing a selectable marker gene by placing infected explants for 5 days in plant medium with the appropriate selective agent. A second phenomenon that was applied to develop the current method is that T-DNA from different binary vectors usually drives the same plant cell nucleus. By using two different binary vectors, one containing the selectable marker on a T-DNA, and the other carrying a T-DNA or P-DNA with the current sequences of interest, it was possible to apply a transient selection system and obtain callus, shoot or plant populations, a significant fragment of which represents marker-free transformation events.

A conventional vector designated pSIM011 was used to represent the vector with the sequence of interest, which is, in this test case, an expression cassette for the beta glucuronidase gene (GUS) located on a conventional T-DNA. The second binary vector that was used for these experiments contains an expression cassette comprising the neomycin phosphotransferase gene (NPTII) driven by the strong promoter of the Ubiquitin-7 gene and followed by the terminator sequences of the nopaline synthase gene (nos). between the T-ADn boundaries of a derived pSIM011.

Surprisingly, a strong level of expression levels of the transient NPTII gene can also be obtained by replacing the nos terminator with the yeast alcohol dehydrogenase gene 1 (ADH1) terminator (Genbank accession number V01292, SEQ ID NO. 56 ). This finding is interesting because the yeast ADH1 terminator does not share homology with any plant terminator. Importantly, it should be noted here that many yeast terminators do not work properly in plants. For example, almost no expression of the GUS gene was observed in a similar experiment as described above with the gene

ES 2 602 133 T3

GUS followed by the yeast iso-1-cytochrome c (CYC1) terminator (Genbank accession number SCCYT1). An improved vector carrying the selectable marker NPTII gene was generated by replacing the nos terminator with the yeast ADH1 terminator. The binary vector containing a selectable marker gene for transient transformation is designated LifeSupport (Figure 5).

Potato shoot explants were simultaneously infected with two LBA4404 strains of A. tumefaciens containing pSIM011 and LifeSupport, respectively. A 1/10 dilution of cultures grown overnight from each strain was developed for 5-6 hours before they were precipitated, washed, and resuspended at OD600nm of 0.4 as described in Example 3. The resuspended cells were then used to infect intermodal 0.4-0.6 cm potato segments at a final density of each bacterium of 0.2 (OD600nm). Infected shoots were treated as in Example 3 with one main difference: kanamycin selection was limited to the first 5 days of culture in callus induction medium. The explants were then allowed to grow further in fresh MIC and SIM containing only 150 mg / L timentine but no selective antibiotic. Within approximately 3 months from the day of infection, callus-derived shoot leaves developed in 40-60% of infected shoots were tested for both GUS expression and PCR analyzed to identify events that contained the sequences of interest but no gene. marker. As shown in Table 12, 11% of the shoots represented free marker transformation events.

The two chain approach described above was also used to transform tobacco. Shoots that developed within approximately 2 months were tested in GUS and analyzed by PCR. The high frequency of identified free marker transformation events (18%) implies that the developed method is applicable to plant species other than potato (Table 12).

Importantly, sequential rather than simultaneous infection with two different Agrobacterium strains resulted in an increase in the efficiency of free marker transformation. The surprising effect of sequential infections was discovered by infecting potato shoot explants with the Agrobacterium strain containing pSIM011, placing the infected explants in co-culture plates for 4 hours, and then re-infected with the LifeSupport vector. Doubly infected explants were treated as previously described in this example. As shown in Table 13, the 4 hour lag time between the two different infections resulted in a 2-fold increased frequency of potato free marker transformation events.

Example 11

Accurate Playback with pSIM340

This example demonstrates the efficiency of accurate reproduction. The health and agronomic characteristics of potato plants were improved by inserting potato genetic elements (see Examples 1, 4, and 7) into potatoes, using free marker transformation (Example 10).

A binary vector containing two expression cassettes for the invertase inhibitor and mutant polyphenol oxidase genes inserted between the P-DNA terminal, designated pSIM340 (Figure 1), was created by inserting both mutant PPO expression cassettes and invertase inhibitor in a binary vector pSIM 112 '. Potato shoot explants were simultaneously infected with pSIM340 and a further enhanced LifeSupport vector. The infected explants were then co-cultured, subjected to bystander selection, and induced to proliferate and develop shoots as discussed above. After 3 months, small shoots were transferred to fresh media and allowed to grow for an additional 3 weeks. Shoots were then phenotypically analyzed, and leaf material was collected for molecular analysis to determine the presence of backbone, marker gene, and P-DNA with the sequence of interest, as described in Examples 2 and 3. As shown in Table 14, 1.2% of the events represented a plant containing the modified P-DNA of pSIM340 without LifeSupport. This free marker transformation frequency is lower than that found for a T-DNA, which again reveals a functional difference between P-DNA and T-DNA.

Example 12

Select Against Stable Integration of LifeSupport T-DNA

This example demonstrates that the efficiency of precise breeding methods can be increased by selection against stable integration of LifeSupport T-DNA using the bacterial cytosine deaminase gene.

The above example demonstrates that the efficiency of free marker transformation is several times lower with modified P-DNA than with conventional T-DNA. To improve the efficiency of generation of shoots containing only a modified P-DNA, an expression cassette was inserted for a suicide gene fusion comprising the genes for bacterial cytosine deaminase (codA) and uracil phosphoribosyltransferase (UPP) (InvivoGen, CA ) between the T-DNA borders of the LifeSupport vector, which generates pSIM346 (Figure 5). The potato stem explants were infected with a strain that carries pSIM340 and another that carries pSIM346, and subsequently located in the

ES 2 602 133 T3 following means: (1) co-culture medium for 2 days, (2) CIMTK medium to select for transient marker gene expression for 5 days, (3) CIMT medium to allow proliferation of plant cells that transiently express the marker gene for 30 days , (4) SIMT medium with 500 mg / L of non-toxic 5-fluorocytosine (5-FC), which will be converted by plant cells that express codA :: upp into toxic 5-fluorouracil (5-FU), to select against stable integration of TADN from LifeSupport. The callus gave rise to outbreaks in SIMT within 4 weeks. These shoots were transferred to MS medium with timentine and allowed to grow until sufficient tissue was available for PCR analysis. DNA was then extracted from 100 shoots and used to determine the presence of P-DNA, LifeSupport backbone. As shown in Table 15, none of the shoots analyzed contained a LifeSupport T-DNA, indicating, for the first time, that the codA :: upp gene fusion can be used as a negative selectable marker prior to regeneration. Most importantly, the results demonstrated that a negative selection against LifeSupport T-DNA integration increases the frequency of sprouts that only contain a modified P-DNA. By coupling a positive selection for the expression of the transient marker gene with a negative selection against stable integration of the codA :: upp gene fusion, the frequency of outbreaks containing only a modified P-DNA is approximately 5 times higher than that of the use only positive selection for expression of the transient marker gene (Table 15).

An even greater increase in marker-free transformation efficiency was obtained by using the LifeSupport vector pSIM350 (Figure 5), which is similar to pSIM346 but contains the codA gene instead of the codA :: upp gene fusion. Potato shoot explants simultaneously infected with pSIM340 and pSIM350 were treated as described above, and 51 resulting shoots were molecularly tested for the occurrence of events containing only the T-DNA region of pSIM340. Interestingly, this PCR analysis revealed that some shoots contained the codA gene (Table 15). This finding demonstrates that codA is not as tight a negative selectable marker as codA :: upp in plants. Most importantly, a large number of shoots (29%) were shown to represent marker-free transformation events.

The efficiencies can be further increased by not infecting explants simultaneously with pSIM340 and pSIM350 but sequentially. By infecting explants with pSIM340 and reinfecting them with pSIM350 after 4 hours, the free marker transformation frequencies are expected to be approximately 30-40%.

Example 13

Impair LifeSupport T-DNA integration

This example demonstrates that the efficiency of accurate breeding methods can be increased by impairing the integration of LifeSupport T-DNAs into the genome of the plant using a mutated omega virD2 gene.

The omega domain of the Agrobacterium VirD2 protein has been shown to be important for the protein's ability to support T-DNA integration into plant genomes (Mysore et al, Mol Plant Microbe Interact 11: 668-83, 1998 ). Based on this observation, modified LifeSupport vectors were created containing an expression cassette for a mutated omega virD2 protein inserted into the SacII site in backbone sequences. The expression cassette was obtained by amplifying a 2.2-kb DNA fragment of plasmid pCS45 (courtesy of Dr. Walt Ream -Oregon State University, OR, USA-, SEQ ID NO .: 36). A LifeSupport derivative carrying this expression cassette, designated pSIM401Q (Figure 5), was used to support transformation of potato plants with the modified P-DNA of pSIM340. After bystander selection and shoot induction, 100 shoots were molecularly tested for the presence of transgenes. As shown in Table 15, 4.4% of the shoots contained only the modified P-DNA, indicating that the use of omega-virD2 increases the free marker transformation lifetime approximately 4 times (Table 15).

Efficiencies are further improved by increasing the size of the LifeSupport T-DNA from 3.7 kb (in pSIM401Q) to 8.1 kb (in the derived pSIM401Q designated pSIM341O; Figure 5). By regenerating shoots of potato shoot explants simultaneously infected with pSIM340 and pSIM341O, 7 of 81 events analyzed (7%) were shown to represent free marker transformation events (Table 15).

Further improvement can be obtained by infecting explants sequentially rather than simultaneously with pSIM340 and LifeSupport. In a similar way as described in Example 10, the frequency of plants containing only a modified P-DNA can be approximately doubled by infecting explants with pSIM340 and re-infected with LifeSupport after 4 hours.

Example 14

Development of a 1-strain approach

This example demonstrates that high frequencies of free marker transformation can also be obtained by using a single Agrobacterium strain containing both the P-DNA vector and LifeSupport.

ES 2 602 133 T3

Two compatible binary vectors were created that can be maintained simultaneously in Agrobacterium. Instead use this system to stably integrate two T-DNAs carrying the DNA of interest and a marker gene, respectively (Komari et al. US 5731179, 1998), this target for integration of only the modified PDNA.

The first vector, designated pSIM356, contains an expression cassette comprising a GUS gene driven by the Ubi7 promoter and followed by UbiT between the P-DNA terminus. The backbone fragment of this vector contains bacterial origins of replication of pVS1 and pBR322, a spectinomycin resistance gene for bacterial selection, and an expression cassette for the IPT gene to allow selection against backbone integration in plants (Figure 1). The second vector, designated pSIM363, contains an expression cassette comprising the NPTII gene driven by the Ubi7 promoter and followed by the yeast ADH1 terminator inserted between conventional T-DNA boundaries (Figure 5). The backbone fragment of this vector contains bacterial replication origins of ColE1 (Genbank number V00268) and ori V (Genbank number M20134), and a kanamycin resistance gene for bacterial selection.

The concept of increasing the free marker transformation sequences using pSIM356 and pSIM363 was tested in 100 tobacco buds. As shown in Table 16, approximately 19% of regenerated shoots contained the DNA of interest with no marker gene content. An increase in the efficiency of free marker transformation was also found by applying this 1-strain to potato approach. Nine of 60 independent shoots tested (15%) contained the pSIM340 T-DNA and lacked the LifeSupport T-DNA (Table 16).

The 1-strain approach can be combined with the method described in Example 12 to couple a positive selection for transient marker gene expression with a negative selection against stable integration of the codA gene. For this purpose, the LifeSupport vector pSIM365 was developed (Figure 5). An Agrobacterium strain carrying this vector in conjunction with a P-DNA vector can be used to efficiently grow plants that only contain an expression cassette of interest located within a P-DNA stably integrated into their genomes.

Example 15

Accurate playback method based on a native marker

In addition to transforming culture plants with P-DNAs that only contain the desirable sequences to introduce beneficial traits, the present disclosure also provides a method of transforming such plants with P-DNAs that contain an additional native marker gene. The novel and native marker genes of choice are potato homologues of the vacuolar Na + / H + detoxifying gene from Arabidopsis and alfin-1 gene from alfalfa. The expression of these genes not only allows the identification of transformation events, but also provides tolerance to the salt of the plant are formed. High levels of salinity in an increase in the acreage of agricultural land will therefore affect potato plants that contain the marker of tolerance to salt.

Two versions of a vacuolar Na + / H + detoxifying homolog, designated Pst (potato salt tolerance) cDNA from a late blight resistant variety obtained from US Potato Genbank (WI), designated LBR4, using oligonucleotide pair 5 were amplified. '-CcCGGGATGGCTTCTGTGCTGGCT -3' (SEQ ID NO. 89) and 5'GgTACCTCAtGgACCCTGTTCCGT-3 '(SEQ ID NO. 90). These sequences are shown in SEQ ID NO.:37 and 38. A third gene (SEQ ID NO.:39) was amplified with homology to LBR4 potato DNA alfin-1 using primers 5'-CCCGGGTATGGAAAATTCGGTACCCAGGACTG-3 '(SEQ ID NO. 91) and 5'ACTAGTTAAACTCTAGCTCTCTTGC -3' ( SEQ ID NO. 92). The efficiency of these Pst genes to function as transformation markers was evaluated by inserting a fusion with the Ubi7 promoter between conventional TDNA borders of a modified pSIM341 vector. After a period of transient selection, kanamycin resistant cells are allowed to proliferate and develop shoots. These shoots are then transferred to medium containing 100-150 mM sodium chloride. Salt tolerant shoots represent transformation events containing the modified pSIM341 T-DNA.

Example 16

Specific promoter of tubers

A recently isolated tuber specific promoter can replace the GBSS promoter used to develop the expression cassettes described in previous examples. The promoter was isolated from the Russet Burbank potato genome by using conservative reverse polymerase chain reaction specific for the potato proteinase inhibitor gene (Genbank accession D 17332) (SEQ ID NO. 39). The efficacy of the PIP promoter was tested by growing a binary vector containing the GUS gene driven by this promoter and an expression cassette for the NPTII marker gene. A similar construct was used with the PIP promoter replaced by the GBSS promoter as a control. The transformed shoots were obtained by infection of stem explants with Agrobacterium strains carrying the binary vectors, co-cultivation for 2 days, and selection in CIMTK medium by

ES 2 602 133 T3 months. These shoots were transferred to new media to induce root formation, and then planted in the ground. Tubers can be evaluated for GUS expression after a 3-month growth period in the Greenhouse.

Example 17

Preferred Constructs and Transformation Methods for Accurate Reproduction

A part of pSIM340, many readers can be used to improve potato plants by transforming them with modified P-DNAs. Two such vectors contain an expression cassette for a sense and antisense copy of the trailer associated with a PPO gene that is expressed in all tubers except for the epidermis (see Example 8). Vector pSIM370 contains an additional expression cassette for a sense and antisense copy of the leader associated with the phosphorylase gene (see Example 6). Vector pSIM371 contains a third expression cassette for the potato alfin-1 homolog (Figure 1).

A third alternative vector, designated pSIM372, contains both an expression cassette for the potato alfin-1 homolog, and an expression cassette for a sense and antisense copy of a fusion of the associated trailer, associated R1 leader, and associated phosphorylase leader. .

The preferred LifeSupport vector for a 1-strain approach is pSIM365. For a 2-strain approach, the preferred vector is pSIM367, which contains expression cassettes for both ΝΡΤΙΙ and codA between the T-DNA borders, an additional expression cassette for omega vlrD2 in the plasmid backbone (Figure 5).

The potato shoot explants are infected with 1 strain carrying both pSIM365 as well as any other vectors pSIM370, 371, and 372, or sequentially with 2 strains carrying pSIM366 and one of the preferred vectors of interest, respectively. After a 2-day co-culture and a 5-day transient selection period, the explants were transferred to media for Agrobacterium proliferation / regeneration and removal. Thirty days later, the explants were transferred again to the same medium but now containing 5-FU to eliminate LifeSupport T-DNA containing events. Subsequently arising shoots were transferred into calli to regeneration medium that may contain 100-200 mM salt to screen for salt tolerant events. Negative shoots are allowed to take root and develop on mature plants. A large proportion of these plants (10% -100%) are predicted to represent free marker and free column plants that contain a P-DNA with nucleotide sequences of interest stably integrated into their genomes.

Tablal. Uncharacterized peptides potentially expressed in antisense potato lines

<td>Gen (size or fragment used)</td><td>ORF-encoded predictive peptides in reverse complemented DNA</td><td rowspan="11">il i J V</td>

<td rowspan="3">R1 (1.9-kb)</td><td>MSSTSNVGQD CLAEVTISYQ WVGRVINYNF FLLIHWYTW EASTGITFQI FPIGIRSEDD Rí AWVT</td>

<td>MSSESTFSKT PNGRATDVGI PTEEGTFPFR YAILRDLAPT ISLVNSSADI A</td>

<td>MSEGVGFKSK ILPSFAWRSA NILGSKHVAK QTFPFLARTE TCERTSGMSG VIRATAPSGI S £ KTVGFS</td>

<td rowspan="3">GLTP (1kb)</td><td>VCSPALKADK SKSADGTCVD HSRRLIWLV LYPGMGTSYA TAFISSPPIQ YLFPSDPVET FP</td>

<td>MLGSLVLPKS PENRKQAVPN PHFQEQHLVP EKPHFLDCGQ GFSKLPQMHQ</td>

<td>MVNFLTQGIV DMETAFGSPK MGGFGKEQFG ACVSRSEMDE SGIGAVMVEQ VCSICSRHFV LSMQI</td>

<td rowspan="3">GHTP (0.9-kb)</td><td>MLEGSMWPWN QESMKRAFLN HHFLMLHLFP AQRPPQAADP VCLKHQHMHC GCLSFQLHLS KI SSMFALD</td>

<td>MKLCSSIILS IIKQKQVEIL RACFGFPETK TISVFSSVSW NWHIICKSL</td>

<td>MTKKPDRKDN IMPYNFPGTK FLQPIFRNFF LPSLCDKLLK KSISVPQAIT PCWKVQCGHG ΙΚΚΑ</td>

<td rowspan="2">PPO (1.8kb)</td><td>TILKLDLHTF NGHFFTASFW NQSHRNSIFI FQSNILQQFS YRQLESNTGN MISITSMNM RQJ RLIKLICIHS LVHVQKHIEP YIVPIIIRYF IECQYLLLLI FLLCCP</td>

<td colspan="2">MKGKEKPREM NLQFFTTNFV STVAISTMNI SLLFKAKRVK GVFIKFPHST RSQLILGYVL LIl AEFSHRRELV VRNTIDLIGY RRATTVYYIN TFFYMG5TTR LEIRRWYRCS SR</td>

ES 2 602 133 T3

MEWALARNRI PFFYCPNSLR TSHGKGYDFH RRKRIQSSTN LYLLNPFFSR QLISIHSTSC PHI DLNRVSRNYP CLHRFFDEVC HRSRCEPEYE GCFQ

SBE A (1.2-kb)

SBE B (2.6-kb)

MNNITHSPIL IPFLEQLNPF ISNCHMQPIV KANTPILNGN TKCRHSANIF TNGNCIWEKP MNl HNSIHISCES KVFLWPSES HR

MKFRYPSPPN PIVTSLIILC NAIPRSINDV DGLSRAIKSY ISLSISQNAI VLSPTRA

MVNIMTSSSM ATKFPSITVQ CNSVLPWQVT SNFIPFVCVL WVEVEYKYQV TTFKHNNLII IIHAAYYLFS

MAKLVTHEIE VPLSSQGHCE KMDHLVKRNS SINNRRSICQ ARHARIHLFV H

MFETKLNSGV VWNDWLTVNI RNSNTPNTKL VLLHHWRTV PSIEIANNFV FLSSRSPFTI DYj KF

MLYTSLYISY LSNSMLLPSW TNLHHSYSLN NLSTYLGLPL PGGNQNQFLP QKQAGQGPAY QKHLRQ

Table 3. Transformation efficiency

<td>Binarlo vector</td><td>Explants + SE of callus / tobacco leaf</td><td>Stem explant + SE callus / potato</td>

<td>pBI121</td><td> 7.8 + 0.6</td><td> 0.31 +0.10</td>

<td>pSIM108</td><td> 10.2 + 0.6</td><td> 0.59 + 0.07</td>

<td>pSIM109</td><td> 12.8 + 0.6</td><td> 0.47 + 0,05</td>

Table 4. Spine integration resulting from Russet Ranger transformation

<td>Binarlo vector</td><td>Total Nr.</td><td>IPT phenotype</td><td>PCFT for IPT</td><td>PCR * for 0.6 kb backbone fragment</td>

<td>pBI121</td><td> 98</td><td>NA</td><td>NA</td><td> 54 (55%)</td>

<td>pSIM108</td><td> 193</td><td> 138 (71%)</td><td> 137 (71%)</td><td>NA</td>

<td>pSIM109</td><td> 133</td><td> 82 (62%)</td><td> 80 (60%)</td><td>NA</td>

<td colspan="5">NA: not applicable</td>

Table 5 Spine integration resulting from Russet Burbank transformation

<td>Binarlo vector</td><td>Total Nr.</td><td>IPT phenotype</td>

<td>PSIM108</td><td> 79</td><td> 49 (60%)</td>

<td>PSIM109</td><td> 72</td><td> 60 (84%)</td>

Table 6. Acrylamide levels in cold-stored tubercle-derived potato chips pSIM320 15

<td>Line</td><td>Glucose mg / g (% -reduced)</td><td>Callback (PPB)</td>

<td>Not transformed</td><td> 10.2</td><td> 469</td>

<td>Vector control</td><td> 10.2</td><td>NA</td>

<td> 320-2</td><td> 5.4 (47%)</td><td> 95</td>

<td> 320-4</td><td> 5.8 (43%)</td><td> 107</td>

<td> 320-7</td><td> 8.7 (14%)</td><td> 353</td>

ES 2 602 133 T3

<td> 320-9</td><td> 7.4 (27%)</td><td> 137</td>

<td> 320-17</td><td> 6.0 (41%)</td><td> 506</td>

<td> 320-21</td><td> 8.5 (16%)</td><td> 428</td>

<td> 320-33</td><td> 6,6 (35%)</td><td> 516</td>

<td colspan="3">NA: not available</td>

Table 7 Acrylamide levels in potato chips derived from unprocessed ripe tubers

<td></td><td>Stored at 18 ° C (color id. *)</td><td>Stored at 4 ° C (color id. *)</td>

<td>Glucose levels</td><td>&lt;0.1 mg / g</td><td>3.4 mg / g</td>

<td>8 minute bleaching</td><td>53 PPB (78)</td><td>603 PPB (56)</td>

<td>12 minute bleaching</td><td>28 PPB (84)</td><td>244 PPB (71)</td>

<td colspan="3">*: a higher value indicates a brighter color of the finished fried product</td>

Table 8. Glucose levels in cold stored pSIM332 tubercles

<td>Line</td><td>Glucose mg / g (% -reduced)</td>

<td>Untransformed control</td><td> 11.6 + 0.5</td>

<td>Vector control</td><td> 11.5 + 0.5</td>

<td> 332-1</td><td> 5.4 (53%)</td>

<td> 332-2</td><td> 4.8 (58%)</td>

<td> 332-4</td><td> 7.0 (39%)</td>

<td> 332-5</td><td> 5.8 (50%)</td>

<td> 332-6</td><td> 6.9 (40%)</td>

<td> 332-7</td><td> 6.0 (48%)</td>

<td> 332-8</td><td> 6.8 (41%)</td>

<td> 332-9</td><td> 6.6 (43%)</td>

<td> 332-10</td><td> 5.4 (53%)</td>

<td> 332-11</td><td> 6.1 (47%)</td>

<td> 332-12</td><td> 6.4 (44%)</td>

<td> 332-13</td><td> 6.4 (44%)</td>

<td> 332-15</td><td> 7.7 (33%)</td>

<td> 332-16</td><td> 6.5 (43%)</td>

<td> 332-17</td><td> 5.3 (54%)</td>

<td> 332-18</td><td> 7.1 (38%)</td>

<td> 332-21</td><td> 6.3 (46%)</td>

<td> 332-22</td><td> 5.4 (53%)</td>

<td> 332-23</td><td> 4.2 (63%)</td>

<td> 332-31</td><td> 6.0 (48%)</td>

<td> 332-34</td><td> 6.2 (48%)</td>

ES 2 602 133 T3

<td> 332-35</td><td> 6.4 (44%)</td>

<td> 332-39</td><td> 6.7 (41%)</td>

<td> 332-40</td><td> 7.5 (35%)</td>

<td> 332-41</td><td> 5.7 (50%)</td>

Table 9. Glucose levels in cold stored pSIM216 minititers

<td>Line</td><td>Glucose mg / g (% -reduced)</td>

<td>Untransformed control</td><td> 11.6 + 0.5</td>

<td>Vector control</td><td> 11.5 + 0.5</td>

<td> 216-2</td><td> 5.5 (52%)</td>

<td> 216-3</td><td> 8.8 (23%)</td>

<td> 216-4</td><td> 7.4 (36%)</td>

<td> 216-5</td><td> 5.8 (50%)</td>

<td> 216-8</td><td> 8.4 (27%)</td>

<td> 216-10</td><td> 5.1 (56%)</td>

<td> 216-11</td><td> 10.1 (19%)</td>

<td> 216-12</td><td> 9.3 (19%)</td>

<td> 216-13</td><td> 6.4 (44%)</td>

<td> 216-15</td><td> 8.8 (23%)</td>

<td> 216-16</td><td> 9.7 (16%)</td>

<td> 216-17</td><td> 6.4 (44%)</td>

<td> 216-19</td><td> 8.7 (24%)</td>

<td> 216-21</td><td> 3.2 (72%)</td>

<td> 216-24</td><td> 9.4 (18%)</td>

<td> 216-26</td><td> 9.3 (19%)</td>

<td> 216-29</td><td> 7.1 (38%)</td>

<td> 216-30</td><td> 8.2 (29%)</td>

<td> 216-32</td><td> 9.3 (19%)</td>

<td> 216-34</td><td> 7.1 (38%)</td>

<td> 216-35</td><td> 7.8 (32%)</td>

<td> 216-38</td><td> 7.1 (38%)</td>

<td> 216-42</td><td> 8.1 (30%)</td>

<td> 216-44</td><td> 9.4 (18%)</td>

<td> 216-45</td><td> 10.2 (11%)</td>

Table 10. PPO activity in potato lines expressing a modified PPO gene

<td rowspan="2">Line</td><td colspan="2">DO-410 / gram</td>

<td>tubercullets (% reduced)</td><td>tubercullets (% -reduced)</td>

<td>Untransformed controls</td><td> 24.59 +2.22</td><td> 20.07 + 1.21</td>

<td>Vector controls</td><td> 22.59 + 3.36</td><td> 19.55 + 1.43</td>

<td></td><td></td><td></td>

ES 2 602 133 T3

<td> 314-1</td><td> 2.36 (90%)</td><td> 17.8 (11%)</td>

<td> 314-2</td><td> 41.52 (-76%)</td><td> 21.3 (-7%)</td>

<td> 314-4</td><td> 18.40 (22%)</td><td> 5.4 (73%)</td>

<td> 314-5</td><td> 8.49 (64%)</td><td> 19.1 (4%)</td>

<td> 314-7</td><td> 16.04 (32%)</td><td> 16 (20%)</td>

<td> 314-8</td><td> 14.86 (37%)</td><td> 17 (15%)</td>

<td> 314-9</td><td> 5.43 (77%)</td><td> 4.3 (78%)</td>

<td> 314-12</td><td> 19.35 (18%)</td><td> 19.6 (2%)</td>

<td> 314-13</td><td> 18.17 (23%)</td><td> 15.4 (23%)</td>

<td> 314-14</td><td> 18.64 (21%)</td><td> 17.32 (13%)</td>

<td> 314-16</td><td> 13.92 (41%)</td><td> 18.2 (9%)</td>

<td> 314-17</td><td> 5.19 (78%)</td><td> 2.4 (88%)</td>

<td> 314-20</td><td> 26.66 (-13%)</td><td> 13.2 (34%)</td>

<td> 314-21</td><td> 11.32 (52%)</td><td> 17.6 (12%)</td>

<td> 314-22</td><td> 13.45 (43%)</td><td> 18.8 (6%)</td>

<td> 314-23</td><td> 5.19 (78%)</td><td> 20.4 (-2%)</td>

<td> 314-24</td><td> 15.10 (36%)</td><td> 19.6 (2%)</td>

<td> 314-25</td><td> 23.12 (2%)</td><td> 19 (5%)</td>

<td> 314-26</td><td> 13.45 (43%)</td><td> 17.8 (11%)</td>

<td> 314-27</td><td> 26.42 (-12%)</td><td> 19.4 (3%)</td>

<td> 314-28</td><td> 31.85 (-35%)</td><td> 19.4 (3%)</td>

<td> 314-29</td><td> 3.77 (84%)</td><td> 14.8 (26%)</td>

<td> 314-31</td><td> 23.83 (-1%)</td><td> 21.2 (-6%)</td>

<td> 314-32</td><td> 28.78 (-22%)</td><td> 20 (0%)</td>

Table11. PPO activity in potato tubercles expressing a modified trailer sequence associated with the PPO gene

<td>Line</td><td>DO-410 / gram (% -reduced)</td>

<td>Untransformed controls</td><td> 20.6 + 1.3</td>

<td>Vector controls</td><td> 17.9 + 2.1</td>

<td> 217-1</td><td> 12.5 (39.4%)</td>

<td> 217-4</td><td> 12.6 (38.6%)</td>

<td> 217-5</td><td> 11.3 (45.0%)</td>

<td> 217-6</td><td> 6.1 (70.4%)</td>

<td> 217-7</td><td> 5.7 (72.5%)</td>

<td> 217-9</td><td> 10.4 (49.6%)</td>

<td> 217-10</td><td> 15.2 (26.3%)</td>

<td> 217-11</td><td> 15.2 (26.3%)</td>

<td> 217-12</td><td> 6.6 (67.9%)</td>

ES 2 602 133 T3

<td> 217-14</td><td> 15.4 (25.4%)</td>

<td> 217-15</td><td> 13.5 (34.6%)</td>

<td> 217-16</td><td> 6.0 (71.0%)</td>

<td> 217-17</td><td> 9.7 (53.0%)</td>

<td> 217-19</td><td> 8.6 (58.4%)</td>

<td> 217-21</td><td> 14.2 (31.1%)</td>

<td> 217-22</td><td> 9.7 (53.0%)</td>

<td> 217-23</td><td> 15.2 (26.3%)</td>

<td> 217-24</td><td> 8.2 (60.1%)</td>

<td> 217-25</td><td> 11.9 (42.2%)</td>

<td> 217-26</td><td> 3.1 (84.8%)</td>

<td> 217-27</td><td> 6.2 (69.9%)</td>

<td> 217-29</td><td> 7.2 (65.1%)</td>

Table 12. Free marker transformation with LifeSupport + vector pSIM011

<td>Plant</td><td>Co-transformed</td><td>Only marker</td><td>Gene of interest only</td><td>Not transformed</td>

<td>Potato</td><td> 0%</td><td> 33%</td><td> 11%</td><td> 56%</td>

<td>Tobacco</td><td> 20%</td><td> 26%</td><td> 18%</td><td> 36%</td>

<td colspan="5">Co-transformed: PCR-positive for both GUS and NPT Gene-of-interest only: PCR-positive for GUS Untransformed: Plants are PCR negative for both GUS and NPT</td>

Table 13. Sequential potato transformation with the LifeSupport vector and pSIM011

<td>Window weather</td><td>from</td><td>Co-transformed</td><td>Only marker</td><td>Gene of interest only</td><td>Not transformed</td>

<td colspan="2">Or hrs</td><td> 9%</td><td> 36%</td><td> 9%</td><td> 46%</td>

<td colspan="2">4 hrs</td><td> 20%</td><td> 30%</td><td> 20%</td><td> 30%</td>

<td colspan="6">Untransformed: Plants are PCR negative for marker and gene of interest</td>

Table 14. Free marker transformation with P-DNA vector pSIM340 + LifeSupport

<td>Plant</td><td>Co-transformed</td><td>Only marker</td><td>Gene of interest only</td><td>Not transformed</td>

<td>Potato</td><td> 17%</td><td> 52.8%</td><td> 1.2%</td><td> 29%</td>

<td colspan="5">Co-transformed: PCR positive for both the PPO gene from pSIM340 and the LifeSupport NPT gene Untransformed: Plants are PCR negative for PPO and NPTII</td>

Table15. Free Marker Potato Transformation with Vector pSIM340 + Enhanced LifeSupport