Mucin synthesis inhibitors

ES 2 282 235 T3

DESCRIPTION

Inhibitors of mucin synthesis.

This application claims the benefit of provisional application US 60 / 179,127, filed January 31, 2000, provisional application 60 / 193,111, filed March 30, 2000, provisional application 60 / 230,783, filed September 7, 2000, provisional application 60 / requested on October 23, 2000 and provisional application 60 / requested on November 20, 2000. All of the applications referenced above are titled "Mucin Synthesis Inhibitors" and the inventors are Yuhong Zhou, Roy C. Levitt, Nicholas C. Nicolaides, Steve Jones, and Mike McLane.

Field of the invention

This invention relates to the modulation of mucin synthesis and the therapeutic use of compounds to control mucin overproduction associated with diseases such as asthma, chronic bronchitis, inflammatory lung diseases, cystic fibrosis, and chronic or acute infectious respiratory diseases as well such as chronic obstructive pulmonary diseases (COPD).

Background of the invention

The airway epithelium is known to play an integral role in the defense mechanism of the airway through the mucociliary system and mechanical barriers. Recent studies indicate that airway epithelial cells (AECs) can be activated to produce and release important biological mediators in the pathogenesis of multiple airway diseases (Polito and Proud, 1998; Takizawa, 1998). . Evidence has shown that the epithelium is primarily diseased in chronic airway diseases such as asthma, chronic bronchitis, ephysema, and cystic fibrosis (Holgate et al., 1999; Jeffery PK, 1991; Salvato, 1968; Glynn and Michaels, 1960 ). One of the hallmarks of these airway diseases is the overproduction of mucus by ACS. The main macromolecular components of mucus are the large glycoproteins known as mucins. Recently, the molecular structure of at least 7 mucins of human origin was determined. The known mucin gene transcripts are heterogeneous with no sequence homology between the genes (Voynow and Rose, 1994), although they are similar in their overall repetitive structure.

Deleterious stimuli are known to activate AECs. These stimuli can range from antigens in allergic diseases to drugs or environmental pollutants, tobacco smoke, and infectious agents associated with forms of chronic obstructive pulmonary disease. Activation of ACS leads to impaired ion transport, changes in ciliary beat, and increased mucin production and secretion leading to increased mucus. Mediators produced in response to the activation of AECs include chemokines that promote the influx of inflammatory cells (Takizawa, 1998). These inflammatory cells can in turn produce mediators that can impair ACS. The deterioration of the ACS stimulates cell proliferation (hyperplasia of goblet cells and cells of the submucosal gland) that generate a wide and continuous source of pro-inflammatory products, including proteases as well as growth factors that promote remodeling of the wall of the pathway which can lead to lung destruction and loss of function (Holgate et al, 1999).

Mucus overproduction and alteration of its physiochemical characteristics can contribute to pulmonary pathology in several ways. The alteration of the mucociliary physiological clearance due to the overproduction of mucins can generate mucus plugs, air trapping and atelectasis that is usually complicated by infection.

Asthma is a chronic obstructive pulmonary disease that appears to be increasing in prevalence and severity (Gergen and Weiss, 1992). It is estimated that 30-40% of the population suffers from atopic allergy and 15% of children and 5% of adults in the population suffer from asthma (Gergen and Weiss, 1992).

In asthma, activation of the immune system by antigens leads to allergic inflammation. When this type of immune activation occurs it is accompanied by pulmonary inflammation, bronchial hypersensitivity, hyperplasia of goblet cells and of the submucosal gland, and overproduction and hypersecretion of mucin (Basle et al., 1989) (Paillasse, 1989) (Bosque et al. , 1990). Mucus overproduction and plugging associated with goblet cell and submucosal gland cell hyperplasia is an important part of asthma pathology and has been described by examining the airways of both moderate asthmatics and individuals who have died with asthmatic status ( Earle, 1953) (Cardell and Pearson, 1959) (Dunnill, 1960) (Dunnill et al., 1969) (Aikawa et al., 1992) (Cutz et al., 1978). Some inflammatory cells are important in this reaction including T cells, cells with antigens, B cells that produce IgE, basophils that bind IgE, and eosinophils. These inflammatory cells accumulate at the site of allergic inflammation, and the toxic products they release contribute to the destruction of ACS and other tissues related to these disorders.

In the related patent applications mentioned above, applicants have shown that interleukin 9 (IL9), its receptor and the activities effected by IL9 are appropriate targets for therapeutic intervention in atopic allergy, asthma and related diseases. The release of mast cell mediators by allergen has long been considered a critical onset allergy situation. IL9 was originally identified as

ES 2 282 235 T3 is a mast cell growth factor and IL9 has been shown to promote the expression of mast cell proteases including MCP-1, MCP-2, MCP-4 (Eklund et al., 1993) and granzyme B (Louahed et al., 1995). Thus, it appears that IL9 plays a role in mast cell proliferation and differentiation. Furthermore, IL9 favors the expression of the high affinity IgE receptor alpha chain (Dugas et al., 1993). Furthermore, both in vitro and in vivo studies have shown that IL9 enhances the release of IgE from masthead B cells (Petit-Frere et al., 1993).

IL9 has recently been shown to stimulate mucin synthesis and can determine even 50-60% of the mucin-stimulating activity of lung fluids in allergic respiratory tract diseases (Longpre et al., 1999). Exaggerated mucin synthesis and mucus overproduction occurs in transgenic mice expressing IL9 compared to mice expressing the genetic background strain. IL9 specifically expresses the MUC2 and MUC5AC genes and proteins in vitro and in vivo (Louahed et al., 2000). Furthermore, the IL9 neutralizing antibody completely inhibits mucin expression in response to antigen challenge in animal models of asthma (McLane et al., 2000)

Current asthma treatments suffer from several disadvantages. The main therapeutic agents, beta-receptor agonists, temporarily reduce symptoms by improving lung function, but they do not act on the causative inflammation or suppress mucin production. Furthermore, the constant use of beta-receptor agonists produces desensitization, reducing their efficacy and safety (Molinoff et al., 1995). Agents that can decrease the causative inflammation, and thereby reduce mucin production, such as anti-inflammatory steroids, have their own list of disadvantages that will range from immunosuppression to bone loss (Molinoff et al., 1995).

Chronic bronchitis is another form of chronic obstructive pulmonary disease. Almost 5% of adults have this lung disease. Chronic bronchitis is defined as the chronic overproduction of sputum. Mucus overproduction is generally associated with inflammation of the conductive airways. Inflammatory cell mediators including neutrophils and macrophages may be associated with increased mucin gene expression in this disease (Voynow et al., 1999; Borchers et al., 1999). The increased production of mucus is associated with airway obstruction, which is one of the cardinal characteristics of this lung disease. Therapy is largely symptomatic and focused on controlling the infection and preventing further loss of lung function. Decongestants, expectorants, and combinations of these agents, which are frequently used to treat bronchitis symptoms, are not believed to alter mucin production. Mucolytics can stimulate mucociliary clearance and provide symptomatic relief by reducing the viscosity and / or elasticity of airway secretions but do not inhibit mucin synthesis or mucus overproduction. (Takahashi et al., 1998)

Cystic fibrosis (CF) is yet another disease that affects the lung and is associated with thick secretions that cause airway obstruction and subsequent colonization and infection by inhaled pathogens (Eng et al., 1996). DNA levels increase significantly in the lung with cystic fibrosis and can increase the viscosity of sputum. Although aerosolized recombinant DNase is useful in these patients, there is no effective treatment for pathological mucus overproduction. Thus, there is a specific unmet need in the art to identify agents capable of inhibiting mucin overproduction by airway epithelial cells in cystic fibrosis. In addition to airway obstruction caused by mucin secretions, cystic fibrosis patients also suffer from mucus plugs in the pancreatic ducts that impede the supply of digestive enzymes to the GI tract. The result is malabsorption syndrome, steatorrhea, and diarrhea.

Although mucus overproduction is one of the hallmarks of the many chronic obstructive lung diseases, the technique lacks any method to block the synthesis or overproduction of mucins associated with these lung diseases. Thus, there is a specific need in the art to inhibit mucin overproduction and dissolve secretions from these patients to facilitate mucociliary clearance and preserve lung function.

Summary of the invention

The present invention relates to the discovery of agents that inhibit the synthesis and overproduction of mucin glycoproteins and the use of these molecules in the manufacture of a drug to treat the pathological overproduction of mucus in chronic obstructive pulmonary diseases and other diseases.

In one aspect, the present invention provides the use of a compound in the production of a drug for treating a subject with a respiratory disease characterized by mucin production, comprising administering to the subject an effective amount of a composition comprising at least a compound according to claim 1 that reduces the synthesis or levels of mucin in the lungs or in the GI tract. In some embodiments, mucin synthesis may be chloride channel dependent. In some embodiments, the compound reduces mucin synthesis in cells that express an ICACC chloride channel. The compositions of the present invention comprise talniflumate or a pharmaceutically acceptable derivative salt.

In another aspect of the present invention the compounds according to claim 1 that reduce mucin synthesis are also inhibitors of the enzyme cyclooxygenase. In a more preferred embodiment the compounds are specific inhibitors of the enzyme cyclooxygenase 2.

ES 2 282 235 T3

In another embodiment, the present invention provides drugs for treating a subject with a respiratory disease characterized by mucin production by administering the compositions of the invention by inhalation. In some embodiments, the composition is in liquid or powder form. In some embodiments, the composition is an aerosol. In other embodiments, the composition further comprises at least one expectorant, antihistamine, mucolytic, antibiotic, or decongestant agent. In some embodiments, the expectorant is guaifenesin. The compositions of the invention may further comprise at least one stabilizing agent, an absorption enhancing agent or a flavoring agent. In some preferred embodiments, the stabilizing agent is cyclodextran and / or the absorption enhancing agent is chitosan.

In some preferred embodiments, the compositions of the present invention can be used to treat a respiratory disease selected from the group consisting of chronic obstructive pulmonary disease (COPD), inflammatory lung disease, cystic fibrosis, and acute or chronic infectious disease. Treatment of any of these diseases can be by administration of one or more of the compositions of the invention by inhalation. In some embodiments, the composition is administered by inhalation to the lungs. In preferred embodiments, the present invention provides materials for treating COPD selected from the group consisting of ephysema, chronic bronchitis, and asthma.

In another preferred embodiment, the compositions of the present invention can be used to treat the GI complications of cystic fibrosis such as malabsorption syndrome, steatorrhea, and diarrhea. Treatment of this disease can be by administration of one or more of the compositions of the invention orally.

In another embodiment, the present invention provides a therapeutic composition formulated for administration by inhalation comprising an amount effective to reduce the production or levels of mucin or of at least one compound selected from the group consisting of talniflumate, and derived pharmaceutically acceptable salts. . In some embodiments, the composition is in liquid or powder form. In some embodiments, the composition further comprises at least one expectorant, mucolytic, antibiotic, antihistamine, or decongestant agent. In some embodiments, the expectorant is guaifenesin.

In addition to the agents described above, the pharmaceutical compositions of the present invention formulated for inhalation may further comprise at least one stabilizing agent, an absorption enhancing agent, or a flavoring agent. In some embodiments, the stabilizing agent is a cyclodextran and / or the absorption enhancing agent is chitosan.

Brief description of the figures

Figure 1 shows the effect of niflumic acid NFA (niflumic acid) on mucin production. The NFA inhibitor blocks the overproduction of mucin in vitro.

Figure 2 shows the ability of NFA and various compounds to suppress mucin overproduction by activated Caco2 cells. This figure shows the inhibition of mucin production in Caco2 cells activated by fenamates.

Figure 3 shows that treatment of the activated Caco2 cell line with NFA did not affect its viability. This figure shows that NFA does not affect epithelial cell proliferation.

Figure 4 shows the inhibition of epithelial cell production of the chemokine eotaxin. This figure shows that NFA blocks epithelial activation including chemokine production.

Figure 5 shows that intratracheal administration of NFA suppresses antigen-induced airway hypersensitivity (Af + NFA) compared to phosphate buffered saline (PBS). This figure shows that NFA blocks responses to epithelial antigen including airway hypersensitivity.

Figure 6 shows the results of intratracheal administration of NFA. This figure shows that NFA reduces antigen-induced pulmonary eosinophilia in vivo. This is seen by comparing eosinophilia after activation with Aspergillus in the presence of NFA (Af + NFA) with eosinophilia after activation in the absence of NFA with phosphate buffered saline (Af + PBS).

Figure 7 shows the results of intratracheal administration of NFA on antigen (mucin glycoconjugate) -induced increases in mucus (Af + NFA) compared to phosphate buffered saline (PBS). This figure shows that NFA blocks the increased expression of mucin by antigens in exposed mouse lungs.

Figure 8 shows that transgenic mice that express IL9 constitutively overproduce mucin in the airway as opposed to control mice that express FVB.

Figure 9 shows that the constitutive overproduction of mucin in the lung of transgenic mice expressing IL9 is associated with the specific expression of the stationary MUC2 and MUC5AC transcripts in

ES 2 282 235 T3 comparison with mice expressing the genetic background strain (FVB / NJ). This figure shows that mucin-specific genes are expressed in the lungs of transgenic mice expressing IL-9.

Figure 10 shows the effect of anti-IL-9 antibody on mucin overproduction in the lung of antigen-exposed mice. This figure shows that neutralization of the IL-9 antibody prevents mucin overproduction in antigen-exposed mice.

Figure 11 shows a generic formula for phenylanthranilic acid analogs that block mucin production where

X₁ to X₉ = each independently of the others can be C, S, O or N,

Ri to R₁₁ = each independently of the others can be hydrogen, alkyl, aryl, substituted alkyl, substituted aryl, halogen, halogen-substituted alkyl, halogen-substituted aryl, alkyl or aryl forming a ring, alkyl or substituted aryl forming a ring, hydroxyl, alkyl or aryl ether, amine, alkyl or aryl amine, alkyl or aryl ester, alkyl or aryl sulfonamide, thiol, alkyl or aryl thioether, alkyl or aryl sulfone, alkyl or aryl sulfoxide or sulfonamide,

Y = carboxylate, alkyl carboxylate, sulfate, sulfonate, phosphate, phosphonate, carboxylic acid amides, carboxylic acid esters, phosphoric acid amides, phosphoric acid esters, sulfonic acid amides, sulfonic acid esters, phosphonic acid amides , esters of phosphonic acids, sulfonamide, phosphonamide, tetrazole, hydroxamic acid or other isostero acid,

Z = O, NR₁₀, S, CR₁₀ R₁₁, sulfoxide or sulfone, m = 0 or 1, n = 1 or 2.

Figure 12 shows hICACC-1 induced mucin expression in NCI-H292 cells.

Figure 13 shows mucus overproduction in hICACC-1 overexpression NCI-H292 cells.

Figure 14 shows the inhibition of mucin production by talniflumate.

Figures 15 A and B show the inhibition of mucin overproduction by oral administration of talniflumate in mice. Figure 15A shows a lung section (H&E stained) from a mouse sensitized to Aspergillus fumigatus and regularly allowed to access mouse chow mouse food.

Figure 15B shows a lung section (H&E stained) from a mouse sensitized with Aspergillus fumigatus and allowed access to mouse chow food containing Talniumato.

Figure 16 shows the inhibition of pulmonary eosinophilia by oral administration of talniflumate in mice. This figure shows AHR373: The effect of talniflumate chow mouse food on BAL bronchoalveolar lavage of Aspergillus fumigatus sensitized male B6D2FIIJ mice.

Figure 17 shows the inhibition of MUC5AIC secretion by Nimesulide (reference)

Figure 18 shows the inhibition of MUC5AIC secretion by MSI-2079 (reference)

Figure 19 shows the structure of MSI-2079 (reference).

Detailed description of the invention

The present invention stems, in part, from the discovery that mucus overproduction resulting from activation of non-ciliated epithelial cells of the lung is caused by induction of mucin genes including MUC2 and MUC5AC. Thus, one aspect of the invention is the inhibition of epithelial cell activation. This inhibition of ACS activation reduces chemokine production, bronchial sensitivity, and mucin gene expression.

Agents That Reduce Mucin Synthesis or Levels

As described herein, the formulations and compositions of the invention include agents that reduce mucin synthesis or levels, or otherwise reduce mucin overproduction. As used herein, "reduce" is defined as a reduction in the level, activation, function, stability, or synthesis of mucin. Preferred agents reduce the chloride channel dependent level, activation, function, stability, or synthesis of mucin. As used herein, "chloride channel" refers to, but is not limited to, the ICACC chloride channel and related channels referred to in WO 99/44620.

ES 2 282 235 T3

The molecule that reduces mucin synthesis or levels is talniflumate.

Uses of Agents That Modulate Mucin Production

As provided in the examples, agents that modulate, decrease or reduce mucin expression can be used to modulate pathological and biological processes associated with mucin production.

Applicants have observed that IL9 selectively induces the expression of mucin gene products. Thus, the pleiotropic role of IL9, which is important for a number of antigen-induced responses, depends, in part, on mucin expression in ACS. When IL9 functions are reduced by neutralizing antibody treatment, animals can be fully protected from antigen-induced responses in the lung. These responses include: bronchial hypersensitivity, eosinophilia and elevated cell counts in bronchial lavage, elevated serum IgE, histologic changes in the lung associated with inflammation, and goblet cell and submucosal gland cell hyperplasia associated with mucus overproduction. Reduced IL9 and asthmatic-like responses are associated with reduced mucin expression (Figure 10). Thus, the manufacture of a drug for the treatment of such responses, which provoke the pathogenesis of asthma and are characterized by the allergic inflammation associated with this disorder, which reduce mucin production, is within the scope of this invention.

Histological analysis of the respiratory tract of transgenic mice expressing IL9 has shown mucin overproduction in non-ciliated epithelial cells (Temann et al., 1998; Louahed et al., 2000). Induction of mucin in the lung of the transgenic mouse expressing IL9 suggests that IL9 promotes mucus production by these cells (see Figure 8). Activated Caco2 cells expressing MUC1, MUC2, MUC3, MUC4, MUC5B and MUC5AC mRNA were produced and used to test inhibitors of mucin production. These cells can be stained for mucin using a periodic acid stain with Schiff's reagent (PAS). As shown in Figure 1A, the untreated activated Caco2 cells stain intensely by the PAS positive mucin glycoconjugates. Control and activated cells were cultured in the presence of niflumic acid (NFA) or 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS). PAS staining of inhibitor-treated activated cells revealed significantly fewer glycoconjugates with a positive staining compared to untreated cells (Figure 1D compared to 1B).

Although a therapeutic potential for mucin reduction in asthma has been identified, Applicants have also recognized a therapeutic potential for mucin reduction in cystic fibrosis. Cystic fibrosis patients are handicapped by a lung disease characterized by thick secretions that cause airway obstruction and subsequent colonization and infection by inhaled pathogens (Eng et al., 1996). Applicants accordingly provide a drug for treating cystic fibrosis by reducing mucin production in the lung.

Mucin overproduction in cystic fibrosis is also present in the pancreatic ducts that supply digestive enzymes to the GI tract producing malabsorption syndrome, steatorrhea and diarrhea. Applicants accordingly also provide a drug for treating cystic fibrosis by reducing mucin production in the pancreas.

Applicants have also identified a therapeutic potential for mucin reduction in chronic bronchitis and ephysema. Patients with chronic bronchitis and ephysema are handicapped by a lung disease characterized by thick secretions that cause airway obstruction and subsequent colonization and infection by inhaled pathogens (Eng et al., 1996). Applicants accordingly provide a drug for treating chronic bronchitis and ephysema by reducing mucin production in the lung.

As used herein, a subject can be any mammal, insofar as the mammal requires modulation of a pathological or biological process mediated by mucin production. The term "mammal" is understood as an individual belonging to the category of Mammals. The invention is particularly useful in the treatment of human subjects.

Pathological processes refer to a category of biological processes that produce a deleterious effect. For example, the overproduction of mucin of the invention may be associated with a respiratory disease, including chronic obstructive pulmonary disease (COPD), inflammatory lung disease, cystic fibrosis, and acute or chronic infectious disease. COPD includes bronchitis, asthma, and ephysema. Mucin overproduction can also be associated with GI diseases such as malabsorption syndrome, steatorrhea, and diarrhea that are present in cystic fibrosis.

As used herein, an agent is said to modulate a disease process when the agent reduces the degree or severity of the process. For example, airway obstruction or modulated disease progression can be prevented by the administration of agents that reduce or somehow modulate mucin synthesis, levels, and / or overproduction.

ES 2 282 235 T3

Therapeutic Compositions

The agents of the present invention can be provided alone or in combination with other agents that modulate a particular disease process. For example, an agent of the present invention can be administered in combination with anti-asthmatic agents. In another embodiment, an agent can be administered in combination with expectorants, mucolytics, antibiotics, antihistamines, or decongestants. In yet another embodiment, an agent may be administered with a surfactant, a stabilizing agent, an absorption enhancing agent, a beta adrenoceptor or purine receptor agonist, or a flavoring or other flavor enhancing agent. of the compositions. As an example, the compositions of the invention may contain, in addition to the active agent, an expectorant such as guaifenesin, a stabilizing agent such as cyclodextran and / or an absorption enhancing agent such as chitosan. Any such agent can be used in the compositions of the invention.

As used herein, two or more agents are said to be administered in combination when the agents are administered simultaneously or are administered independently such that the agents act at the same time.

The agents of the present invention can be administered parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, transdermally, topically, or orally. Alternatively, or at the same time, administration can be orally or nasally or directly to the lungs. In a preferred embodiment, the compounds of this invention can be administered by inhalation. For inhalation therapy the compound may be in a solution useful for administration by liquid aerosol, metered dose inhalers, or in a form suitable for a dry powder inhaler. The dosage administered will depend on the age, health, and weight of the recipient, type of coexisting treatment, if any, frequency of treatment, and the nature of the effect desired.

In some preferred embodiments, the agents of the present invention may be formulated as aerosols. Formulating pharmaceutical aerosols is routine for those of skill in the art, see for example, Sciarra, J. in Remington: The Science and Practice of Pharmacy 19^to Edition, Chapter 95, Mack Publishing, Easton, PA. The agents can be formulated as solution sprays, dispersion or suspension sprays of dry powders, emulsions, or semisolid preparations. The aerosol can be delivered using any propellant system known to those of skill in the art. The aerosols can be applied to the upper respiratory tract, for example by nasal inhalation, or to the lower respiratory tract or both.

The compounds used in the drugs of this invention can be administered systemically or topically, depending on considerations such as the condition to be treated, the need for site-specific treatment, amount of drug to be administered, and similar considerations.

Any common topical formation such as a solution, suspension, gel, ointment or balm can be employed. The preparation of such topical formulations are described and exemplified in the pharmaceutical formulation art, for example, by Remington's Pharmaceutical Sciences. For topical application, these compounds could also be administered as a powder or spray, particularly in the form of an aerosol. The active ingredient can be administered in pharmaceutical compositions adapted for systemic administration. As is known, if a drug is to be administered systemically, it can be prepared as a powder, pill, lozenge or as a syrup or elixir for oral administration. For intravenous, intraperitoneal, or intralesional administration, the compound will be prepared as a solution or suspension that can be administered by injection. In some cases, it may be useful to formulate these compounds in suppository form or as an extended release formulation for deposit under the skin or by intramuscular injection.

An effective amount of a composition or agent contained therein is that amount that will decrease, decrease, or reduce the activation, function, stability, or synthesis of mucin. Preferred compositions or agents lower, decrease, or reduce the chloride channel-dependent activation, function, stability, or synthesis of mucin, including the ICACC chloride channel-dependent activation, function, stability, or synthesis of mucin. A given effective amount will vary from condition to condition and in some cases may vary with the severity of the disease being treated and the sensitivity of the patient to the treatment. Accordingly, a given effective amount will best be determined at the time and place through routine experimentation. However, it is anticipated that in the treatment of chronic obstructive pulmonary diseases in accordance with the present invention, a formulation containing 0.001 to 5 percent by weight, preferably 0.01 to 1%, will normally constitute a therapeutically effective amount. When administered systemically, an amount between 0.01 and 100 mg per kg of body mass per day, although preferably 0.1 to 10 mg / kg / day, will produce a therapeutic result in most cases.

When administered by inhalation, an amount between 0.01 and 100 mg per kg of body mass per day, although preferably 0.10 to 10 mg / kg / day, will produce a therapeutic result in most cases. In some cases, a metered aerosol unit contains 0.8 mg of talniflumate. In this formulation, the maintenance dose for an adult is approximately 2 inhalations (1.6 mg) twice daily (3.2 mg).

The invention also includes pharmaceutical compositions comprising the compounds of the invention together with a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water is a preferred support when

ES 2 282 235 T3 pharmaceutical composition is administered intravenously or by inhalation. Saline or phosphate buffered saline can also be used as carriers, particularly for aerosol inhalation. Lactated saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, Mack Publishing, 1995.

In addition to the pharmacologically active agent, the compositions of the present invention may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries that facilitate the processing of the active compounds into preparations that can be used pharmaceutically for administration at the site of action. Formulations suitable for parenteral administration include aqueous solutions of the active compounds in water-soluble form, eg, water-soluble salts. In addition, suspensions of the active compounds may be administered as appropriate oleaginous injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils, eg, sesame oil, or synthetic fatty acid esters, eg, ethyl oleate or triglycerides. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol and / or dextran. Optionally, the suspension may also contain stabilizers as described above. Liposomes can also be used to encapsulate the agent for delivery into the cell.

The pharmaceutical formulation for systemic administration according to the invention can be formulated for enteral, parenteral or topical administration. In fact, these three types of formulations can be used simultaneously to achieve the systemic administration of the active substance.

Formulations suitable for oral administration include hard or soft gelatin capsules, pills, tablets, including coated tablets, elixirs, suspensions, syrups or inhalations, and controlled release forms thereof. Formulations suitable for oral inhalation or nasal inhalation include aqueous solutions with or without excipients well known in the art.

The practice of the present invention may employ the conventional terms and techniques of molecular biology, pharmacology, immunology, and biochemistry commonly known to those of skill in the art. For example, see Sambrook et al., Molecular Cloning: A Laboratory Manual, 2^to edition, Cold Spring Harbor Laboratory Press, 1985.

Without further description, it is believed that one skilled in the art can, using the foregoing description and the following illustrative examples, make and use the compounds of the present invention and practice the claimed methods. Accordingly, the following working examples specifically call for preferred embodiments of the present invention.

Examples

Example 1

NFA inhibits mucin production by activated Caco2 cells to overproduce mucin

Activated Caco2 cells expressing MUC1, MUC2, MUC3, MUC4, MUC5B and MUC5AC mRNA were produced and used to test for inhibitors of mucin production. These cells can be stained for mucin using periodic acid stain with Schiff's reagent (PAS). As shown in Figure 1, although control Caco2 cells showed basal PAS staining with small scattered glycoconjugate vesicles (panel A), activation of Caco2 cells dramatically increased the number and intensity of mucin-positive glycoconjugates of PAS (panel B). Activated Caco2 cells were cultured in the presence of niflumic acid (NFA) or 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS). At the indicated concentrations (100 pM for NFA and 300 pM for DIDS), PAS staining of activated Caco2 cells treated with an inhibitor revealed significantly less staining positive mucin glycoconjugates compared to untreated cells (Figure 1D compared with 1B). Furthermore, the slight staining seen in the control cells was also inhibited (Figure 1C compared to 1A). Mucin production by activated Caco2 cells could also be inhibited by other fenamates such as fluphenamate (FFA), tolfenamate (TFLA) and partially by mefenamate (MFA) and meclofenamate (MLFA) (Figure 2). The related compounds Naproxen (MMNA) and Sulindac were ineffective. This lower mucin production in NFA-treated cells was not due to the dramatic changes in the physiological condition of the cells, since their viability was not affected by even higher concentrations of NFA (Figure 3). Taken together, the results are consistent with those drugs that inhibit epithelial activation. Furthermore, the results clearly demonstrate a direct effect of NFA and its analogs (phenylanthranilic acid derivatives shown in Figure 11), DIDS, and SIDS on mucus overproduction, which is an identifying feature of multiple chronic obstructive lung diseases.

ES 2 282 235 T3

Example 2

NFA inhibits eotaxin production by activated Caco2 cells to overproduce mucin

Activated LHL4 cells expressing and secreting eotaxin were produced and used to test inhibitors of eotaxin production. Cells were evaluated for eotaxin in vitro by an ELISA technique well known in the art (R&D Systems). As shown in Figure 4, activated LHL4 cells were cultured in the absence (control) or presence of increasing concentrations of niflumic acid (NFA). Significant inhibition of eotaxin production was observed with increasing concentrations of NFA. Similar inhibition was seen with DIDS and SIDS in an identical experiment. Mad / C3 cells show similar inhibition of eotaxin production by NFA, DIDS, and SIDS. Taken together, these results clearly demonstrate a direct effect of NFA on eotaxin production.

Example 3

Inhibition of mucin overproduction in murine models of asthma by NFA

Male and female mice certified as virus free of the following strains, DBA, C57B6, and B6D2F1 were purchased from the National Cancer Institute or Jackson Laboratories (Bar Harbor ME). Transgenic IL-9 (Tg5) and parent strain (FVB) mice were obtained from the Ludwig Institute (Brussels, Belgium). Animals were housed in an air-passed facility through an absolute filter and allowed free access to food and water for 3 to 7 days before experimental handling. The facilities for the animals were kept at 22 ° C and the light: dark cycle was automatically controlled (10:14 light: dark hours).

Phenotyping and efficacy of pretreatment

Animals either received no pretreatment or were sensitized by nasal aspiration to Aspergillus fumigatus antigen to evaluate the effect of pretreatment on bronchial hypersensitivity, bronchoalveolar lavage fluid composition, mucin production, and serum IgE. Mice were challenged with Aspergillus or saline intranasally (on days 0, 7, 14, 21, and 22) and were phenotyped 24 hours after the last dose. Sensitized mice were treated on days 0-21 with either PBS or 100 pg NFA by intratracheal instillation (IT). Inhibition of mucus production and mucin expression in the lung was used to assess the effect of NFA treatment, or could be used to assess the effects of other drug candidates. To determine the bronchoconstrictive response, the pressure of the respiratory system in the trachea was measured and recorded before and during drug exposure. Mice were anesthetized and instrumented as described above. (Levitt et al., 1988; Levitt and Mitzner, 1989; Kleeberger et al., 1990; Levitt, 1991; Levitt and Ewart, 1995; Ewart et al., 1995). Airway sensitivity was measured for one or more of the following: 5-hydroxytryptamine, acetylcholine, atracurium, or a substance P analog. A simple and repeatable measure of the change in peak inspiratory pressure was used followed by the bronchoconstrictor provocation test which has been called the Airway Pressure Time Index (APTI) (Levitt et al., 1988; Levitt and Mitzner , 1989). The APTI was evaluated by the change in the maximum value of the integrated respiratory pressure from the time of injection until the maximum value of the pressure returns to the baseline or plateau. APTI was comparable to airway resistance, however APTI includes an additional component related to recovery from bronchoconstriction.

Prior to sacrifice, whole blood was collected for serum IgE measurements by needle puncture of the inferior vena cava in anesthetized animals. Samples were centrifuged to separate cells and serum was collected and used to measure total IgE levels. Samples that were not measured immediately were frozen at -20 ° C.

All IgE serum samples were measured using a Sandwich ELISA assay to detect antibodies. Microtiter plates, 50 µl per well, were coated with rat anti-murine IgE antibody (Southern Biotechnology) at a concentration of 2.5 pg / ml in sodium carbonate-sodium bicarbonate coating buffer with sodium azide. Plates were covered with plastic wrap and incubated at 4 ° C for 16 hours. Plates were washed three times with 0.05% Tween-20 wash buffer in phosphate buffered saline, incubating for five minutes for each wash. Blocking of non-specific binding sites was performed by adding 200 µl per well of 5% bovine serum albumin in phosphate buffered saline, covering with plastic wrap and incubating for 2 hours at 37 ° C. After washing three times with wash buffer, duplicate 50 µl assay samples were added to each well. The test samples were evaluated after being diluted 1: 10,1: 50 and 1: 100 with 5% bovine serum albumin in wash buffer. In addition to the test samples, a set of IgE standards (PharMingen) were evaluated at concentrations from 0.8 ng / ml to 200 ng / ml in 5% bovine serum albumin in wash buffer, to generate a standard curve. . A preliminary plate without sample or standard was used to zero the plate reader (bottom). After adding samples and standards, the plate was covered with plastic wrap and incubated for 2 hours at room temperature. After washing three times with wash buffer, 50 µl of a peroxidase conjugate was added to label the IgE by alfalfa of the anti-murine secondary antibody at a concentration of 250 ng / ml in 5% bovine serum albumin in wash buffer. The plate was covered with plastic wrap and incubated 2 hours at room temperature. After washing three times with wash buffer, 100 µl of 0.5 mg / ml o-phenylenediamine substrate in 0.1 M citrate buffer was added to each well. After 5-10 minutes the reaction was stopped with 50 µl of 12.5% ​​sulfuric acid and absorbance was measured.

ES 2 282 235 T3 at 490 nm on an MR5000 plate reader (Dynatech). A standard curve of IgE concentrations was constructed with antigen concentration on the X axis (log scale) and absorbance on the Y axis (linear scale). The IgE concentration in the samples was interpolated from the standard curve.

Bronchoalveolar lavage (BAL) and cell analysis were performed as previously described (Kleeberger et al., 1990). Lung histology was performed after either filling the lungs with fixative in situ and placing them in formalin, or immediately removed and frozen in liquid nitrogen. Since the above instrumentation can be misleading, separate animals were used for these studies. Thus, a small group of animals was treated in parallel in exactly the same way as the group that received several previous treatments except that these animals were not used for other tests apart from the bronchial sensitivity test. After testing for bronchial sensitivity, the lungs were removed and immersed in liquid nitrogen as above. Cryosectioning, staining, and histological examination were performed in a manner obvious to those of skill in the art.

NFA, which blocks epithelial cell activation and reduces mucin and eotaxin production in vitro, was used therapeutically to assess the importance of in vivo epithelial cell activation in antigen-induced mucin production, bronchial sensitivity, IgE serum and airway inflammation as assessed by BAL in mice. The effects of NFA treatment on airway sensitivity, BAL, mucus production, and serum IgE levels were determined relative to corresponding vehicle-treated controls. Figures 5 and 6 show that NFA is capable of suppressing airway hypersensitivity and BAL pulmonary eosinophilia respectively, however, there was no effect on serum IgE levels. In addition, NFA could also suppress the overproduction of mucus in the lung caused by exposure to antigens (Figure 7).

Example 4

Epithelial activation by IL9 in a transgenic mouse results in mucus overproduction and mucin gene expression. A model for drug selection

Male and female IL9 transgenic mice certified as virus-free (IL9TG5-FVB / N) of 56 weeks of age were bred in our laboratories. 5-6 week old male and female FVB / N mice were purchased from Jackson Laboratories (Bar Harbor ME). Animals were housed in an air-passed facility through an absolute filter and allowed free access to food and water for 3 to 7 days before experimental handling. The facilities for the animals were kept at 22 ° C and the light: dark cycle was automatically controlled (10:14 light: dark hours).

Phenotyping and efficacy of treatment

Animals were phenotyped before receiving anything or 24 hrs after receiving intratracheal (IT) pseudotreatment (vehicle), or drugs in the same vehicle as used in identically treated controls. Mice were treated IT once a day for three days. NFA (100 pg) or IL-9 antibody were administered in PBS IT. The responses to treatment were measured by assessing mucin inhibition by histological examination (PAS staining greater than 10 sections of the treated and control lungs or Western protein blots of MUC1, MUC2 and MUC3 expression from the same lungs. that IL-9 transgenic mice constitutively overproduce mucin compared to control FVB mice. A reduction of the high levels of constitutive mucin production that occurs in the transgenic asthmatic IL9 (Figure 8) (control with vehicle and receiving nothing) to levels comparable to the lower baseline mucin production found in FVB / lungs N (normal positive control) was considered significant for any drug. The expression of mucus production in the transgenic IL9 is specifically associated with higher stable mRNA levels of MUC2 and MUC5AC as demonstrated by reverse transcription polymerase chain reaction RTPCR (Figure 9).

The neutralizing IL-9 antibody was shown to produce a significant reduction in mucin production in the lungs of transgenic IL9s (Figure 10). The NFA also decreased mucin production in this model.

Example 5

Inhibition of mucin overproduction in murine models of asthma by talniflumate

Certified 5-6 week old B6D2F1 virus free male mice were purchased from Jackson Laboratories (Bar Harbor ME). Animals were housed in facilities with air passed through an absolute filter and allowed free access to food and water 5 to 7 days before experimental handling. The animals' facilities were kept at 22 ° C and the light: dark cycle was automatically controlled (12:12 hours of light: dark).

ES 2 282 235 T3

Phenotyping and efficacy of treatment

Animals were fed ad libitum with either talniflumate-containing mouse chow food or normal chow mouse chow. Animals either did not receive pretreatment or were sensitized by nasal aspiration of Aspergillus fumigatus antigen to evaluate the effect of pretreatment on bronchial hypersensitivity, bronchoalveolar lavage fluid composition, mucin production, and serum IgE. Mice were challenged with Aspergillus (on days 0, 7, 16, and 17) and were phenotyped 24 hours after the last dose. Inhibition of mucus production in the lung was used to evaluate the effect of talniflumate treatment, or could be used to evaluate the effects of treatment with other drug candidates. To determine the bronchoconstrictive response, the pressure of the respiratory system in the trachea was measured and recorded before and during drug exposure. Mice were anesthetized and instrumented as described above. (Levitt et al., 1988; Levitt and Mitzner, 1989; Kleeberger et al., 1990; Levitt, 1991; Levitt and Ewart, 1995; Ewart et al., 1995). Airway sensitivity was measured to one or more of the following: 5-hydroxytryptamine, acetylcholine, atracurium, or a substance P analog. A simple, repeatable measure of change in peak inspiratory pressure was used followed of the bronchoconstrictor provocation test that has been called the Airway Pressure Time Index (APTI) (Levitt et al., 1988; Levitt and Mitzner, 1989). The APTI was evaluated by the change in the maximum value of the integrated respiratory pressure from the time of injection until the maximum value of the pressure returns to the baseline or plateau. APTI was comparable to airway resistance, however APTI includes an additional component related to recovery from bronchoconstriction. Bronchoalveolar lavage (BAL) and cell analysis were performed as previously described (Kleeberger et al., 1990). Lung histology was performed after collecting the lungs and immediately freezing them in liquid nitrogen. After the bronchial sensitivity test, the lungs were removed and immersed in liquid nitrogen as above. Cryosectioning, staining, and histological examination were performed in a manner obvious to those of skill in the art. Responses to treatment were measured by assessing mucin inhibition by histological examination (PAS staining of control and treated lungs).

Oral treatment with talniflumate reduced mucin discoloration. Figure 15A shows PAS staining in a mouse lung obtained from Asp-sens mice that were fed normal chow mouse food. Figure 15B shows the results obtained from Asp-sens mice fed chow mouse food containing talniflumate. Figure 16 shows the results of feeding talniflumate-coated mouse chow mouse food in pulmonary eosinophilia determined by bronchoalveolar lavage. Talniflumate reduced the number of eosinophilic cells obtained from Aspergillus fumigatus sensitized mice compared to sensitized mice fed standard chow mouse chow.

Example 6

ICACC-1 overexpression in epithelial cell lines enhances mucin production

NCI-H292 cells, a human lung mucoepidermoid carcinoma cell line from the American Type Culture Collection (Manassas VA) were purchased and cultured in RPMI1640 medium supplemented with 10% FBS and 1% penicillin / streptomycin (Gibco / BRL ). The cells were grown in an incubator containing humidified air, supplemented with 5% CO.₂ at 37 ° C. Stable hICACC-1 overexpression cell lines NCI-H292 were established by transfection of 3-hICACC-1 cDNA using a Fujin transfection kit according to the manufacturer's instructions (Boehringer-Mannheim). A control cell line, NCI-H292 / ctl, was produced by transfection of pcDNA 3 (ctl) into the NCI-H292 cell line using the same procedure. The expression of the hICACC-1 gene was confirmed for the transfectant pcDNA 3-hICACC-1 by Northern analysis.

For the ELLA assay (enzyme-specific bound lectin assay), cells were placed in 24-well tissue culture plates and incubated for 72 hours until confluence. The supernatants were transferred to 96-well plates previously coated with 1 jug / ml of anti-MUC5AIC antibody (New marker, Fremont CA) and blocked with 1% BSA. Bound antibody MUC5A / C was then detected with HRP-lectin (Sigma).

For total RT-PCR, RNA was isolated from cell lines using Trizol reagent (Gibco / BRL) following the manufacturer's protocol. RT-PCR was performed by reverse transcription of 1 pg of total RNA and amplifying the cDNA with the appropriate primers by PCR. The products were separated by electrophoresis in 2% agarose gels and visualized by staining with ethidium bromide. The primer pairs used to generate the human ICACC-1 message were: 5'-GGCACAGATCTTTTCATTGCTA-3 'sense and 5'-GTGAATGCCAGGAATGGTGCT3' antisense which gave a product of 182 base pairs . The primer pairs used to generate mucin messages are listed in Table 1.

ES 2 282 235 T3

TABLE 1 (Numbers in parentheses refer to Za position of the oligonucleotide contained in the published cDNA).

<td>Gen (Input #)</td><td>Sense primer (5 '- 3')</td><td>Reversing primer (5 '- 3')</td>

<td>HMUC1 (J05582)</td><td>GCCAGTAGCACTCACCATAGCTCG (3113-3136)</td><td>CTGACAGACAGCCAAGGCAATGAG (3627-3605)</td>

<td>HMUC5AC</td><td>GTGGAACCACGATGACAGC</td><td>TCAGCACATAGCTGCAGTCG</td>

<td>(AF015521)</td><td> (610-629)</td><td> (1428-1408)</td>

<td>HPMS2 (U13696)</td><td>GGACGAGAAGTATAACTTCGAG (2133-2154)</td><td>CATCTCGCTTGTGTTAAGAGC (2505-2485)</td>

NCI-H292 cells express MUC1 constitutively, while mRNA expression of MUC2 and MUC5A / C are below baseline detection levels. Figure 12A shows the results of a Northern blot analysis of transfected ANDpc 3-hICACC-1 cells showing a higher level of expression for ICACC mRNA. Western blot analysis of whole cell lysate from clones overexpressing ICACC-1 revealed enhanced MUC2 protein production (Figure 12B). MUC5A / C expression increased significantly in ICACC-1 overexpression cells, while MUC1 did not vary in RT-PCR analysis (Figure 12C). ELLA specific analysis also revealed overproduction of MUC5A / C protein in ICACC-1 overexpression clones compared to non-transfected NCI-H292 cells or cells transfected with the empty vector (Figure 12D).

Example 7

Inhibition of mucus overproduction and expression of MUC 5A / C in hICACC-I overexpression NCI-H292 cells

For determination of mucosal glycoconjugate production, NCI-H292 / ctl and NCIH292 / hICACC-1 (AAF 15) cells were cultured in 24-well plates for 3 days. Cells were then fixed with Formalin and mucosal glycoconjugates were visualized by AB / PAS staining (Sigma). Although control NCIH292 cells showed basal PAS staining with a few scattered granules (Figure 13A), overexpression of ICACC-1 dramatically increased the number and intensity of PAS-positive muco-glycoconjugates (Figure 13B). For studies of chloride channel blockade, cells were cultured in the presence of niflumic acid (NFA) (Sigma) at a concentration of 100 pM, mephanamic acid (MFA) at 125 or 250 pM or talniflumate at 12.5, 25 or 50 pM, or media alone. PAS staining of NFA, MFA or talniflumate treated cells revealed significantly few positive stained muco-glycoconjugates compared to untreated cells (Figures 13C and D and Figure 14 insert). The PAS staining of the inhibitor-treated control cells showed practically no difference with the untreated cells (Figures 13A and C).

IC values₅₀ for talniflumate (figure 14), Nimesulide (reference Figure 17) and MSI-2079 (Figure 18, the structure of MSI-2079 is shown in figure 19 reference) were determined based on their inhibition of MUC5A / C secretion in hCLCA1-expressing H292 cells. Confluent cells were treated with the inhibitor at concentrations of 0 to 250 pM in OPTI MEM. Secreted MUC5A / C was detected 48 hours after adding the inhibitor by an ELLA assay as described in Example 5. IC50 values ​​were determined with GraphPad Prism data analysis software. The insert in Figure 14 shows intracellular mucin levels in response to talniflumate treatment detected by PAS staining.

References

Aikawa T, Shimura S, Sasaki H, Ebina M and Takishima T. Marked goblet cell hyperplasic with mucus accumulation in the airways of patients who died of severe acute asthma attack. Chest, 101, 916-21, 1992.

Alexander AG, Barnes NC and Kay AB. Trial of cyclosporin in corticosteroid-dependent chronic severe asthma. Lancet339, 324-328, 1992.

Basle, R., Roche, WR, Roberts, JA, and Holgate, ST Cellular events in the bronchi in mild asthma and after bronchial provocation. Am Rev Respir Dis 139, 806-17, 1989.

ES 2 282 235 T3

Borchers MT, Wesselkamper S, Wert SE, Shapiro SD and Leikauf GD. Monocyte inflammation augments acrolein-induced Muc5ac expression in mouse lung. Am J Physiol, 277 (3 Pt 1), L489-97, 1999.

Bosque, J., Chanez, P., Lacoste, JY, Barneon, G., Ghavanian, N., Enander, I., Venge, P., Ahlstedt, S., Simony Lafontaine, J., Godard, P., and et al. Eosinophilic inflammation in asthma [see comments]. NEngl JMed 323.10339, 1990.

Burrows B, Sears MR, Flannery EM, Herbison GP and Holdaway MD. Relationship of bronchial responsiveness assessed by methacholine to serum IgE, lung function, symptoms and diagnoses in 11-year-old New Zealand children. J. Allergy Clin. Immunol. 90, 376-385, 1992.

Burrows B, Martínez FD, Halonen M, Barbee RA and Cline MG. Association of asthma with serum IgE levels and skin-test reactivity to allergens. New Eng. J. Med. 320, 271-277, 1989.

Cardell BS and Pearson RSB. Death in asthmatics. Thorax 14, 341-52, 1959.

Chu JW and Sharom FJ. Glycophorin A interacts with interleukin-2 and inhibits interleukin-2-dependent Tlymphocyte proliferation. Cell. Immunol. 145, 223-239, 1992.

Clifford RD, Pugsley A, Radford M and Holgate ST. Symptoms, atopy and bronchial response to methacholine in parents with asthma and their children. Arch. Dis. Childhood 62, 66-73, 1987.

Cutz E, Levison H and Cooper DM. Ultrastructure of airways in children with asthma. Histopathology, 2, 40721, 1978.

Dugas B, Renauld JC, Pene J, Bonnefoy J, Peti-Frere C, Braquet P, Bosque J, Van Snick J, Mencia-Huerta JM. Interleukin-9 potentiates the interleukin-4-induced immunoglobulin (IgG, IgM and IgE) production by normal human B lymphocytes. Eur. J. Immunol. 23, 1687-1692, 1993.

Dunnill MS. The pathology of asthma, with special reference to changes in the bronchial mucosa. J Clin Invest, 13, 27-33, 1960.

Dunnill MS, Massarella GR and Anderson JA. A comparison of the quantitative anatomy of the bronchi in normal subjects, in asthmaticus, in chronic bronchitis, and in emphysema. Thorax, 24, 176-9, 1969.

Eklund KK, Ghildyal N, Austen KF and Stevens RL. Induction by IL-9 and suppression by IL-3 and IL-4 of the levels of chromosome 14-derived transcripts that encode late-expressed mouse mast cell proteases. J. Immunol. 151, 4266-4273, 1993.

Eng PA, Morton J, Douglass JA, Riedler J, Wilson J and Robertson CF. Short-term efficacy of ultrasonically nebulized hypertonic saline in cystic fibrosis. Pediatr Pulmonol. 21, 77-83, 1996.

Earle BV. Fatal bronchial asthma. Thorax 8, 195-206, 1953.

Ewart S, Levitt RC and Mitzner W. Respiratory system mechanics in mice measured by end-inflation occlusion. J. Appl. Phys. 79, 560-566, 1995.

Gergen PJ and Weiss KB. The increasing problem of asthma in the United States. Am. Rev. Respir. Dis. 146, 823824, 1992.

Gergen PJ. The association of allergen skin test reactivity and respiratory disease among whites in the US population. Arch. Intern. Med. 151,487-492, 1991.

Glynn AA and Michaels L. Bronchial biopsy in chronic bronchitis and asthma. Thorax, 15, 142-53, 1960.

Holgate, ST, Lackie, PM, Davies, DE, Roche, WR, and Walls, AF The bronchial epithelium as a key regulator of airway inflammation and remodeling in asthma. Clin Exp Allergy 29 Suppl 2, 90-5, 1999.

Halonen M, Stem D, Taussig LM, Wright A, Ray CG and Martinez FD. The predictive relationship between serum IgE levels at birth and subsequent incidences of lower respiratory illnesses and eczema in infants. Am. Rev. Respir. Dis. 146, 666-670, 1992.

Jeffery PK. Morphology of the airway wall in asthma and in chronic obstructive pulmonary disease. Am Rev Respir Dis, 143, 1152-8, 1991.

Kleeberger SR, Bassett DJ, Jakab GJ and Levitt RC. A genetic model for evaluation of susceptibility to ozoneinduced inflammation. Am. J. Physiol. 258, L313-320, 1990.

ES 2 282 235 T3

Levitt RC and Ewart SL. Genetic susceptibility to atracurium-induced bronchoconstriction. Am. J. Respir. Crit. Care. Med. 151, 1537-1542, 1995.

Levitt RC. Understanding biological variability in susceptibility to respiratory disease. Pharmacogenetics 1, 9497, 1991.

Levitt RC and Mitzner W. Autosomal recessive inheritance of airway hyper-reactivity to 5-hydroxytryptamine. J. Appl. Physiol. 67, 1125-1132, 1989.

Levitt RC, Mitzner W et al. Expression of airway hyper-reactivity to acetylcholine as a simple autosomal recessive trait in mice. FASEB J. 2, 2605-2608, 1988.

Louahed J, Kermouni A, Van Snick J and Renauld JC. IL-9 induces expression of granzymes and high affinity IgE receptor in murine T helper clones. J. Immunol. 154, 5061-5070, 1995.

Louahed J, Toda M, Jen J, Hamid Q, Renauld JC, Levitt RC and Nicolaides NC. Interleukin-9 up-regulates mucus expression in the airways. Accepted in The American Journal of Respiratory Cell and Molecular Biology, 12/21/99.

Marsh DG, Meyers DA and Bias WB. The epidemiology and genetics of atopic allergy. New Eng. J. Med. 305, 1551-1559, 1982.

Molinoff P et al., Goodman and Gilman's The Pharmacologic Basis of Therapeutics, MacMillan Publishing, New York NY, 1995.

McLane MP, Tepper J, Weiss C, Tomer Y, Taylor RE, Tumas D, Zhou Y, Haczku A, Nicolaides NC and Levitt, RC. Lung delivery of an Interleukin-9 antibody treatment inhibits airway hyper-responsiveness (AHR), LBA eosinophilia, mucin production and serum IgE elevation to natural antigens in a murine model of asthma. Summary of the AAAAI congress: 3 / 3- 3/8/2000 in San Diego, CA and of the ATS / ALA congress: 5/5/2000 in Toronto, Canada.

Paillasse, R. The relationship between airway inflammation and bronchial hyperresponsiveness. Clin Exp Allergy 19, 395-8, 1989.

Petit-Frere C, Dugas B, Braquet P, Mencia-Huerta JM. Interleukin-9 potentiates the interleukin-4-induced IgE and IgGl release from murine B lymphocytes. Immunology 79, 146-151, 1993.

Polito, AJ, and Proud, D. Epithelia cells as regulators of airway inflammation. J Allergy Clin Immunol 102, 7148, 1998.

Salvato G. Some histologic changes in chronic bronchitis and asthma. Thorax, 23, 168-72, 1968.

Sears MR, Burrows B, Flannery EM, Herbison GP, ​​Hewitt CJ and Holdaway MD. Relation between airway responsiveness and serum IgE in children with asthma and in apparently normal children. New Engl. J. Med. 325 (15), 1067-1071, 1991.

Takahashi K, Mizuno H, Ohno H, Kai H, Isohama Y, Takahama K, Nagaoka and Miyata T. Effects of SS320A, a new cysteine ​​derivative, on the change in the number of goblet cells induced by isoproterenol in rat tracheal epithelium. Jpn J Pharmacol, 77, 71-77, 1998.

Takizawa, H. Airway epithelial cells as regulators of airway inflammation (Review). Int J Mol Med 1, 367-78, 1998.

Temann, UA, Geba, GP, Rankin, JA, and Flavell, RA Expression of interleukin 9 in the lungs of transgenic mice causes airway inflammation, mast cell hyperplasia, and bronchial hyperresponsiveness. J Exp Med 188, 130720, 1998.

Voynow JA and Rose MC. Quantitation of mucin mRNA in respiratory and intestinal epithelial cells. Am J Respir Cell Mol Biol, 11, 742-750, 1994.

Voynow JA, Young LR, Wang Y, Horger T, Rose MC and Fischer BM. Neutrophil elastase increases MUC5AC mRNA and protein expression in respiratory epithelial cells. Am J Physiol, 276 (5 Pt 1), L835-43, 1999.