Composition of antibodies with high ADCC

The present invention relates to a composition comprising a monoclonal antibody, characterized in that the antibody has at its glycosylation site (Asn 297) of Fcγ glycan structures of biantennary type, with short chains, low sialylation, mannoses and GlcAc non-intercalary terminal point of attachment, selected from the forms:<img file="EP1518864B2_D0001.tif" />wherein the content of G0 + G1 + G0F + G1F forms is greater than 80%, the content of G0F + G1F forms is less than 30%, and the fucose content is less than 50%.

The present description also describes a process for obtaining and selecting monoclonal antibodies by an ADCC type test, said antibodies being able to activate Fcγ type III receptors. The present disclosure also discloses monoclonal antibodies having a particular glycan structure, cells producing said antibodies, methods for preparing the producer cells, as well as pharmaceutical compositions or diagnostic tests comprising said antibodies. The anti-D antibody compositions according to the invention can be used for the prevention of Rhesus isoimmunization of Rh negative individuals, in particular of the haemolytic disease of the newborn (MHNN) or in applications such as Idiopathic Thrombocytopenic Purpura. (PTI).

Passive immunotherapy with polyclonal antibodies has been carried out since the 1970s. However, the production of polyclonal immunoglobulins poses several problems:<ul id="ul0001" list-style="none" compact="compact"><li>Immunization of volunteers was interrupted in France in 1997 because of the ethical problems of such acts. In France, as in Europe, the number of immunized donors is too small to ensure a sufficient supply of certain antibodies so that it is necessary to import hyperimmune plasma from the United States for example.</li><li>Thus, this shortage of immunoglobulin does not make it possible to envisage an antenatal administration for the prevention of the MHNN.</li></ul>

Various studies have resulted in the production of human monoclonal antibodies to replace polyclonal antibodies obtained from the fractionation of plasma from volunteer donors.

Monoclonal antibodies have several advantages: they can be obtained in large quantities at reasonable prices, each batch of antibody is homogeneous and the quality of the different batches is reproducible because they are produced by the same cell line which is cryopreserved in nitrogen liquid. Product safety can be ensured regarding the absence of viral contamination.

Several publications describe the production of cell lines producing human IgG anti-Rh D monoclonal antibodies from immunized donor B cells. Boylston et al. 1980; Koskimies 1980; Crawford et al. 1983; Doyle et al. 1985; Goossens et al. 1987; Kumpel et al. 1989 (a) and Mc Cann-Carter et al. 1993 describe obtaining EBV-transformed B cell lines. Melamed et al. 1985; Thompson et al. 1986 and Mc Cann-Carter et al. 1993 relate to hetero-hybrids resulting from fusion B-lymphocytes (transformed by EBV) x murine myeloma. Goossens et al. 1987 relates to hetero-hybrids resulting from the fusion of B-lymphocytes (transformed by EBV) x human myeloma. Bron et al. 1984 and Foung et al. 1987 describe heterobybrids resulting from fusion of B-lymphocytes (transformed with EBV) x human-mouse heteromyeloma and finally, Edelman et al. 1997 relates to insect cells transfected with the gene encoding an anti-Rh (D) using the baculovirus system.

Among the patents and patent applications concerning such monoclonal antibodies and their secretory lines, mention may be made of:<patcit id="pcit0001" dnum="EP576093A"><text>EP 576093</text></patcit> (AETS (FR), Biotest Pharma GmbH (Germany), Composition for prophylaxis of the haemolytic disease of the newborn comprising two human monoclonal antibodies of subclass IgG1 and IgG3, which are active against the Rhesus D antigen), <patcit id="pcit0002" dnum="RU2094462"><text>RU 2094462</text></patcit>, <patcit id="pcit0003" dnum="WO8502413A"><text>WO 85/02413</text></patcit> (Board of Trustees of the Leland Stanford Jr. University, Human Monoclonal Antibody against Rh (D) Antigen and its Uses), <patcit id="pcit0004" dnum="GB8610106A"><text>GB 86-10106</text></patcit> (Central Blood Laboratories Authority, Production of heterohybridomas for the manufacture of human monoclonal antibodies to Rhesus D antigen), <patcit id="pcit0005" dnum="EP0251440A"><text>EP 0 251 440</text></patcit> (Central Blood Laboratories Authority, Human Anti-Rhesus D Producing Heterohybridomas), <patcit id="pcit0006" dnum="WO8902442A"><text>WO 89/02442</text></patcit>, <patcit id="pcit0007" dnum="WO8902600A"><text>WO 89/02600</text></patcit> and <patcit id="pcit0008" dnum="WO89024443A"><text>WO 89/024443</text></patcit> (Central Blood Laboratories Authority, Human Anti-Rh (D) Monoclonal Antibodies), <patcit id="pcit0009" dnum="WO8607740A"><text>WO 8607740</text></patcit> (Institut Pasteur, Protein Performance SA, Paris, FR, Obtaining a recombinant monoclonal antibody from a monoclonal human anti-rhesus D antibody, its production in insect cells and its uses), <patcit id="pcit0010" dnum="JP63050710A"><text>JP 88-50710</text></patcit> (International Reagents Corp., Japan, Reagents for Determination of Blood Substance Rh (D) Factor), <patcit id="pcit0011" dnum="JP58248865A"><text>JP 83-248865</text></patcit> (Mitsubishi Chemical Industries Co., Ltd., Japan, Preparation of Monoclonal Antibody to Rh (D) Positive Antigen), <patcit id="pcit0012" dnum="CA82406033"><text>CA 82-406033</text></patcit> (Queens University at Kingston, Human Monoclonal Antibodies) and <patcit id="pcit0013" dnum="GB8226513A"><text>GB 8226513</text></patcit> (University College London, Human Monoclonal Antibody Against Rhesus D Antigen).

While the use of monoclonal antibodies has many advantages over the use of polyclonal antibody pools, it can be difficult to obtain an effective monoclonal antibody. Indeed, it has been found in the context of the invention that the Fcγ fragment of the immunoglobulin obtained must have very particular properties in order to be able to interact and activate the effector cell receptors (macrophage, TH and NK lymphocyte).

The biological activity of certain immunoglobulins G is dependent on the structure of the oligosaccharides present on the molecule, and in particular on its part Fc. The IgG molecules of all human and murine subclasses have a N-oligosaccharide attached to the CH domain₂ each heavy chain (at residue Asn 297 for human IgG). The influence of this glycannic residue on the ability of the antibody to interact with effector molecules (Fc receptors and complement) has been demonstrated. The inhibition of glycosylation of a human IgG1, by culture in the presence of Tunicamycin, causes for example a 50-fold decrease in the affinity of this antibody for the FcγRI receptor present on monocytes and macrophages (Leatherbarrow et al, 1985). . FcγRIII receptor binding is also affected by the carbohydrate loss on IgG, since it has been described that unglycosylated IgG3 is unable to induce ADCC-type lysis via the FcγRIII receptor of NK cells. (Lund et al, 1990).

But, beyond the necessary presence of these glycan residues, it is more precisely the heterogeneity of their structure that can lead to differences in the ability to engage effector functions. Variable galactosylation profiles according to individuals (serum human IgG1) were observed. These differences probably reflect disparities in the activity of galactosyltransferases and other enzymes between the cell clones of these individuals (Jefferis et al, 1990). While this normal heterogeneity of post-translational processes generates different glycoforms (even in the case of monoclonal antibodies), it can lead to atypical structures associated with certain pathological conditions such as rheumatoid arthritis, Crohn's disease, for which a significant proportion of agalactosyl residues have been identified (Parekh et al, 1985).

The glycosylation profile of the purified molecule is the consequence of multiple effects, some parameters of which have already been studied. The IgG protein backbone and in particular the amino acids in contact with the N-acetylglucosamine (GlcNAc) and galactose residues of the α 1-6 mannose arm (aa 246 and 258 of IgG) can explain the existence of preferential structures (galactosylation). as shown by the study on murine and chimeric IgG of different isotypes (Lund et al, 1993).

The observed differences also highlight specificities related to the species and cell type used for the production of the molecule. Thus, the classical structure of the N-glycans of human IgG reveals a significant proportion of biantennary types with a GIcNAc residue in the bisecting position, a structure absent in the antibodies produced by murine cells. Similarly, the sialic acid residues synthesized by the CHO (Chinese Hamster Ovary) line are exclusively of the α 2-3 type whereas they are of the α 2-3 type and α 2-6 with the murine and human cells ( Yu Ip et al, 1994). The production of immunoglobulins in expression systems other than those derived from mammals can introduce much larger modifications such as the presence of xylose residues made by insect cells or by plants (Ma et al, 1995).

Other factors such as cell culture conditions (including culture medium composition, cell density, pH, oxygenation) appear to affect the glycosyltransferase activity of the cell and consequently the glycan structure of the cell. molecule (Monica et al, 1993, Kumpel et al, 1994b).

Wright &amp; Morrison, 1997 is a review of the effects of glycosylation on the functions of antibodies. The authors mention the results of Rothman et al., 1989 showing that antibodies produced by clones treated with Castanospermine (Cs), a glycosylation inhibitor leading to oligomannose-type oligosaccharide forms, were capable of inducing a good ADCC response by NK cells.<patcit id="pcit0014" dnum="WO9954342A1"><text>WO99 / ​​54342A1 and Umana et al, 1999</text></patcit> compare glycosylations and ADCC responses induced by different antibody compositions (chCE7). A correlation between the content of oligosaccharide structures with an intermediate GlcNAc and the level of ADCC observed is highlighted. The authors attribute the induction of a good ADCC to the GlcNAc spacer. Lifely-1995 compares glycosylations and ADCC responses induced by antibody compositions (CAMPATH-1H) produced by different cell lines. The authors note that compositions with a high proportion of oligosaccharide structures with an intermediate GlcNAc induce a good ADCC, and attribute this good ADCC to the intercalated GlcNAc.

However, it has been found that a biantennate type structure, with short chains, low sialylation, terminal mannoses and / or non-intermediate terminal GlcNAc is the common denominator of glycan structures conferring high ADCC activity to monoclonal antibodies. A method for the preparation of such antibodies capable of activating the effector cells via FcγRIII, in particular anti-Rh (D) antibodies, has also been developed.

The blood group antigens are classified into several systems depending on the nature of the membrane molecules expressed on the surface of red blood cells. The Rh system (Rh) comprises 5 molecules or antigens: D, C, c, E and e (ISSITT, 1988). D antigen is the most important of these molecules because it is the most immunogenic, that is, it can induce the production of anti-D antibodies if Rh D positive red blood cells are transfused to Rh negative subjects.

D antigen is normally expressed in 85% of Caucasoid subjects, these people are called Rh positive; 25% of these subjects are therefore Rh negative that is to say that their red blood cells do not present antigen D. The expression of D antigens has certain variants that can be related to either a low antigenic density, then we speak of weak D antigens, either with a different or partial antigenicity, we will then speak of partial D antigens. The weak D character is characterized by the fact that it is a normal antigen but whose number of sites per red blood cell is decreased to a greater or lesser extent; this character is transmissible according to the Mendelian laws. Partial D phenotypes were found in Rh D positive subjects who possessed serum anti-D antibodies; these partial D antigens can therefore be characterized as possessing only part of the mosaic. Studies carried out with polyclonal and monoclonal antibodies have made it possible to define 7 categories of partial D antigens with the description of at least 8 epitopes constituting the D antigen (LOMAS et al 1989, TIPETT 1988).

The importance of anti-Rh D antibodies arose with the discovery of mechanisms leading to haemolytic disease of the newborn (MHNN). This corresponds to the different pathological conditions observed in certain fetuses or in certain newborns when there is a fetomecoronergic blood group incompatibility which is responsible for the formation of maternal anti-Rh D antibodies capable of crossing the barrier. placenta. Indeed, the passage of Rh positive fetal red blood cells in an Rh negative mother can lead to the formation of anti-D antibodies.

After immunization of the Rh negative mother, the anti-D IgG class antibodies are able to cross the placental barrier and bind to the Rh positive fetal red cells. This binding leads to the activation of immunocompetent cells via their surface Fc receptors, thus inducing hemolysis of sensitized fetal red cells. Depending on the intensity of the reaction, several degrees of severity of the NHHN can be observed.

A diagnosis of the NHHN can be made before and after birth. Prenatal diagnosis is based on changes in maternal anti-D antibody levels using several immunohematological techniques. Postpartum diagnosis can be done from a cord blood sample by analyzing the following parameters: determination of fetal and father blood groups; search for anti-D antibodies; dosages of hemoglobin and bilirubin.

Prophylaxis of HRHN is currently routinely performed in all Rh-negative women with an Rh-positive child with human anti-D immunoglobulin injections. The first real trials of immunoprophylaxis began in 1964. For prevention to be effective, it is necessary that the immunoglobulins are injected before the immunization that is to say in the 72 hours which follow the delivery and that the doses of antibodies are sufficient (10 μg of antibodies anti -D for 0.5 ml of Rh + red blood cells).

Several anti-D monoclonal antibodies have been evaluated therapeutically: BROSSARD / FNTS 1990 (unpublished); THOMSON / IBGRL 1990; KUMPEL / IBGRL 1994; BELKINA / Institute of Hematology Moscow 1996; BIOTEST / LFB 1997 (unpublished). The clinical efficacy of antibodies to induce Rh (D) positive RBC clearance was assessed in Rh (D) negative volunteers. A single IgG1 antibody showed efficacy equivalent to anti-D polyclonal immunoglobulins but only in a few patients (KUMPEL et al, 1995).

The invention proposes to provide monoclonal antibodies answering the abovementioned problems, that is to say antibodies selected by a specific ADCC type test and / or antibodies having a glycan structure necessary for obtaining a good efficiency.

Description

Thus, the present invention relates to a composition comprising a monoclonal antibody, characterized in that the antibody has at its glycosylation site (Asn 297) of Fcγ glycan structures of biantennary type, with short chains, weak sialylation, mannoses and GlcNAc of the non-intercalary terminal attachment point, selected from the forms:<img file="EP1518864B2_D0002.tif" />wherein the content of G0 + G1 + G0F + G1F forms is greater than 80%, the content of G0F + G1F forms is less than 30%, and the fucose content is less than 50%.

The present description also relates to a method for preparing a monoclonal antibody capable of activating effector cells expressing FcγRIII, characterized in that it comprises the following steps:<ol id="ol0001" compact="compact" ol-style=""><li>a) purification of monoclonal antibodies obtained from different clones originating from cell lines selected from hybridomas, in particular hetero-hybridomas, and animal or human cell lines transfected with a vector comprising the gene coding for said antibody;</li><li>b) adding each antibody obtained in step a) to a separate reaction mixture comprising:<ul id="ul0002" list-style="dash" compact="compact"><li>the target cells of said antibodies,</li><li>effector cells comprising cells expressing FcγRIII,</li><li>polyvalent IgGs,</li></ul></li><li>c) determination of the percentage of lysis of the target cells and selection of the monoclonal antibodies which activate the effector cells causing a significant lysis of the target cells (FcγRIII type ADCC activity).</li></ol>

The clones can originate from hetero-hybrid cell lines obtained by fusion of human B lymphocytes (from immunized subjects) with murine, human or heterohybrid myeloma cells, especially K6H6-B5 myeloma (ATCC No. CRL 1823); or else animal or human cell lines transfected with a vector containing the gene coding for an IgG-type human immunoglobulin, said lines being able to be selected in particular from the CHO-K, CHO-Lec10 and CHO Lec-1 lines , CHO Pro-5, CHO dhfr-, Wil-2, Jurkat, Vero, Molt-4, COS-7, 293-HEK, YB2 / 0, BHK, K6H6, NSO, SP2 / O-Ag14 and P3X63Ag8.653 .

The polyvalent IgGs are used to inhibit the mechanism of lysis of effector cells via FcγRIII. In this process, antibodies having a FcγRIII type ADCC level of greater than 60%, 70%, 80% or preferably greater than 90% are selected. The target cells may be red cells treated with papain. In this case, one deposits per well:<ul id="ul0003" list-style="dash" compact="compact"><li>100 μl of monoclonal antibodies purified at about 200 ng / ml,</li><li>25μl of papainous red blood cells, approximately 1x10⁶ cell</li><li>25μl of effector cells, approximately 2x10⁶ cell</li><li>and 50 μl of polyvalent IgG, in particular TEGELINE ™ (LFB, France), at a concentration of between 1 and 20 mg / ml.</li></ul>It is thus possible to compare the amount of lysis of the target cells with two positive controls consisting of a chemical compound such as NH₄Cl and an active reference antibody <i>in vivo</i> and a negative control consisting of an inactive antibody <i>in vivo.</i>

Commercial polyclonal antibodies can also be used as positive controls and a monoclonal antibody that is incapable of inducing clearance. <i>in vivo</i> as a negative witness.

Advantageously, this method makes it possible to prepare monoclonal antibodies against Rh (D), as indicated previously. Rhesus D cells are then used as target cells.

The present description therefore describes the development of a biological activity test <i>in vitro</i> in which the measured activities correlate with the biological activity <i>in vivo</i> monoclonal or polyclonal antibodies already clinically evaluated for their potential to induce clearance of Rh (D) positive red blood cells in Rh (D) negative volunteers. This test makes it possible to evaluate the antibody-dependent lytic activity = ADCC (Antibody Dependent Cellular Cytotoxicity) induced essentially by the Fcγ type III (CD16) receptors, the Fcγ type I (CD64) receptors being saturated by the addition of human IgG immunoglobulins (in the form of therapeutic polyvalent IgGs). The FcγRIII specificity of this ADCC test was confirmed by inhibition in the presence of anti-FcγRIII monoclonal antibody (see<figref idref="f0006">figure 6</figref>). Mononuclear cells from healthy subjects are used as effector cells in an effector / target (E / C) ratio close to physiological conditions<i>in vivo.</i> Under these conditions the lytic activities of the polyclonal immunoglobulins and the ineffective anti-D monoclonal antibodies <i>in vivo</i> (DF5 Goossens et al., 1987 antibody and AD1 + AD3 antibodies, <patcit id="pcit0015" dnum="FR9207893"><text>FR 9207893</text></patcit> LFB / Biotest and FOG-1, <patcit id="pcit0016" dnum="GB2189506A"><text>GB 2189506</text></patcit>) are respectively strong and weak. The selection of the antibodies described in the present description was therefore carried out by evaluating their biological activity in this test of the ADCC type (see Example 1).

The antibodies that can be obtained from the process described above have FcγRIII type ADCC levels greater than 60%, 70%, 80% or preferably greater than 90% relative to the reference polyclonal. The monoclonal antibodies, directed against a given antigen, activate the effector cells expressing FcγRIII causing lysis greater than 60%, 70%, 80%, preferably greater than 90% of the lysis caused by polyclonal antibodies directed against said antigen. Advantageously, said monoclonal antibodies are directed against rhesus D. They may preferably be produced by clones derived from Vero (ATCC No. CCL 81) or YB2 / 0 (ATCC No. CRL 1662) and may belong to the class IgG1 or IgG3.

The present disclosure also relates to antibodies having a particular glycan structure conferring an FcγRIII dependent effector activity. Such antibodies can be obtained from a process explained above and have on their glycosylation site (Asn 297) of Fcγ glycan structures of the biantennary type, with short chains and low sialylation. Preferably, their glycan structure has end terminal mannoses and / or GlcNAc non-intercalary terminals.

Such antibodies are more particularly selected from the forms:<img file="EP1518864B2_D0003.tif" />

Thus, the present description aims a monoclonal antibody characterized in that it has on its glycosylation site (Asn 297) of Fcγ glycan structures of the biantennary type, with short chains, low sialylation, mannoses and GlcNAc of the d non-spacer terminals. Said antibodies, directed against a given antigen, activate the effector cells expressing FcγRIII causing lysis greater than 60%, 70%, 80%, preferably greater than 90% of the lysis caused by polyclonal antibodies directed against said antigen.

The invention relates to a composition comprising a monoclonal antibody, characterized in that the antibody has, on its glycosylation site (Asn 297) of Fcγ, glycan structures of biantennary type, with short chains, low sialylation, mannoses and GlcNAc non-intercalary terminal point of attachment, selected from the forms:<img file="EP1518864B2_D0004.tif" />wherein the content of G0 + G1 + G0F + G1F forms is greater than 80%, the content of G0F + G1F forms is less than 30%, and the fucose content is less than 50%.

More particularly, in the compositions according to the invention comprising the antibodies as defined above, the sialic acid content is less than 20% and may be less than 15%, or 10%, preferably 5%, 4%. % or 2%.

Similarly, in the compositions according to the invention comprising the antibodies as defined above, the fucose content is less than 50%, and may be less than 40%, or 30%. Preferably, the fucose content is between 20% and 45% or between 25% and 40%.<tables id="tabl0001" num="0001"><img file="EP1518864B2_D0005.tif" /></tables>

An alternative for specifically targeting FcγRIII is the preparation of high mannose type antibodies.

In another aspect, the present disclosure relates to an antibody-producing cell mentioned above. It may be a hybridoma, especially a hetero-hybridoma obtained with the fusion partner K6H6-B5 (ATCC No. CRL 1823); or an animal or human cell transfected with a vector comprising the gene coding for said antibody, in particular a cell derived from the Vero lines (ATCC No. CCL 81), or YB2 / 0 (ATCC No. CRL 1662 ). These cells correspond to the cell lines selected by the method described herein, said cells producing antibodies having the characteristics mentioned above.

A preferred antibody in the context of the invention shows a significant biological activity (greater than or equal to that of the reference anti-Rh (D) polyclonal antibody) in the ADCC test using FcγRIII positive effector cells. Its ability to activate FcγRIII receptors (after fixation) is confirmed on models <i>in vitro</i> that highlight the modification of intracellular calcium flux, the phosphorylation of activation signal transduction molecules or the release of chemical mediators. These properties are associated with a particular structure of the oligosaccharides of the N-glycosylation site of the Fc portion of the antibody: presence of short chains, weakly galactosylated, unsilylated, having end mannoses and / or terminal non-intercalar GlcNAc for example. This antibody has therapeutic applications: prevention of the MHNN, treatment of the ITP in individuals Rh (D) positive, and any other application concerned by the use of anti-D polyclonal immunoglobulins. A preferred antibody in the context of the invention may also have a specificity other than anti-Rh (D) (anti-cancer cell for example). It may possess the properties described above (functional activity dependent on a mechanism of attachment / activation at the FcγRIII receptors, particular oligosaccharide structure) and be used in the immunotherapy of cancers or any other pathology for which can be performed a curative or preventive treatment using a monoclonal antibody whose mechanism of action corresponds to a functional activity via the FcγRIII receptor.

Another aspect relates to a pharmaceutical composition comprising an antibody composition according to the invention and the use of said composition for the manufacture of a medicament.

Preferably, the invention relates to the use of a composition of an anti-Rh (D) antibody described above for the manufacture of a medicament intended for the prevention of rhesus alloimmunisation of Rh individuals. negative. The mode of action of anti-D immunoglobulins<i>in vivo</i> is a specific binding of antibodies to the Rh (D) positive red blood cell D antigen, followed by removal of these red blood cells from the circulation mainly at the level of the spleen. This clearance is associated with a dynamic mechanism of suppression of the primary immune response in individuals and thus prevents immunization. Thus, it is possible to use an antibody composition of the invention in a prophylactic manner for the prevention of the alloimmunization of a Rh-negative woman, immediately after the birth of a Rh-positive child, and to prevent, during subsequent pregnancies, the haemolytic disease of the newborn (MHNN); during abortions, ectopic pregnancies in a situation of incompatibility Rhesus D or in transplacental hemorrhages resulting from amniocentesis, chorionic biopsies, or traumatic obstetric manipulations in situations of incompatibility Rhesus D. In addition, an antibody composition of the invention may be used in the case of Rh transfusions incompatible with blood or labile blood derivatives.

The invention also relates to the use of a composition of an antibody of the invention for the manufacture of a medicament for therapeutic use in Idiopathic Thrombocytopenic Purpura (ITP).

The antibody compositions of the invention are also useful for the manufacture of a medicament for the treatment of cancers by immunotherapy or for the treatment of infections caused by viral or bacterial pathogens.

A complementary aspect of the present description relates to the use of said antibodies, in particular for diagnosis. The present description therefore aims at a kit comprising an antibody described above.

For the remainder of the description, reference will be made to the legends of the figures presented below.

legends

<ul id="ul0004" list-style="none" compact="compact"><li><figref idref="f0001"><b>Figure 1</b></figref><b>: ADCC evaluation of F60 and T125 YB2 / 0 (R270)</b>This figure represents the percentage of lysis obtained as a function of the concentration of antibodies in the presence of 100 and 500 μg / well of TEGELINE ™ (LFB, France). A high percentage of lysis is obtained for the antibody compositions F60 and T125.</li><li><figref idref="f0002"><b>Figure 2</b></figref><b>: binding of anti-D to the receptor (FcγRIII)</b>A strong binding index is obtained for the antibody compositions F60 and T125.</li><li><figref idref="f0003"><b>Figure 3</b></figref><b>: Construction of the expression vector T125-H26 for the expression of the H chain of T125.</b></li><li><figref idref="f0004"><b>Figure 4</b></figref><b>: construction of the expression vector T125-K47 for the expression of the L chain of T125</b></li><li><figref idref="f0005"><b>Figure 5</b></figref><b>: Construction of the expression vector T125-IG24 for the expression of the whole antibody T125.</b></li><li><figref idref="f0006"><b>Figure 6</b></figref><b>: ADCC inhibition in the presence of anti Fc RIII (CD16)</b>The ADCC test is established according to the procedure described in §3.3 in the presence of commercial anti-CD16 3G8 (TEBU) whose action is to block the FcRIII receptors present on the effector cells. The final concentration of 3G8 is 5 μg / well (25 μg / ml). A cookie is done in parallel in the absence of 3G8. The three antibodies tested are Poly-D WinRho, the antibody F60 (Pf 155 99/47) obtained according to the method described in Example I and R297 (Pf 210 01/76) obtained according to the method described in Example II.<b>Results:</b> inhibition is observed in the presence of 3G8, demonstrating that the ADCC induced by the three antibodies tested is mainly dependent on FcRIII. A slightly stronger inhibition is observed in the presence of Poly-D WinRho (83% compared to 68% and 61% inhibition for F60 and R297 respectively). This difference may be due to the presence in Poly-D of non-anti-D human IgG that will inhibit type 1 receptors (FCRI or CD64) and thus act synergistically with anti-CD16.</li><li><figref idref="f0007"><b>Figure 7</b></figref><b>: Characterization of Anti-D Glycans by Mass Spectrometry (MS).</b></li><li><figref idref="f0008"><b>Figure 8</b></figref><b>: Comparison of MS spectra of R 290 and DF5.</b></li><li><figref idref="f0009"><b>Figure 9</b></figref><b>: study of the glycosylation of D31DMM Anti-D by MS.</b></li></ul>

EXAMPLE 1 ESTABLISHMENT OF A HETEROHYBRID CELL LINE PRODUCING AN ANTI-RH (D) ANTIBODY

1- <u>Obtaining lymphoblastoid clones and heterohybrids:</u>

<i>1.1- Source of lymphocytes:</i>

The B-cell donor is selected from plasmapheresis anti-Rh (D) donors on the activity of its anti-Rh (D) serum antibodies in the ADCC activity test described in §33. After a donation of whole blood in 1998, the "buffy coat" fraction (leucocyte concentrate) is recovered.

<i>1.2-Immortalization of donor B lymphocytes</i>

Peripheral blood mononuclear cells are separated from other cells by centrifugation on Ficoll Plus (Pharmacia). They are then diluted to 10⁶ cells / ml in IMDM containing 20% ​​(v / v) fetal calf serum (FCS), to which 20% culture supernatant of the B95-8 line (ATCC-CRL1612), 0.1 μg / ml of cyclosporin are added A (Sandoz), 50 μg / ml gentamycin sulfate (Life Technologies), and divided into 24-well plates (P24 Greiner) or 96-well round bottom plates. They are then placed in an incubator at 37 ° C, 7% CO2. After 3 weeks, the presence of anticor ps anti-Rh (D) is sought by ADCC<ul id="ul0005" list-style="none" compact="compact"><li>Each of the 16 microwells of a positive P24 plate well is transferred to a new P24 well. This enrichment is repeated after 10 to 15 days of culture and each microwell is amplified in P96 and P24.</li><li>Positive P96 wells are taken up and amplified in flat-bottomed P24 (Nunc). After a few days of culture, the presence of anti-Rh (D) antibodies is sought by ADCC.</li></ul>

<i>1.3- Immune rosette enrichment (RI):</i>

The cells from one or more wells of P24 are enriched in specific cells by formation and separation of rosettes with papain-positive Rh (D) red blood cells: 1 volume of red blood cells washed in 0.9% NaCl is incubated for 10 minutes at 37 minutes. ° C with 1 volume of papain solution (Merck) at 1/1000^th (m / v), then washed 3 times with 0.9% NaCl. The cells are then washed once in Hanks solution, suspended in FCS and mixed with papain erythrocytes in the ratio of 1 cell to 33 RBCs. The mixture is placed in a conical bottom centrifuge tube, centrifuged for 5 minutes at 80 g and incubated for one hour in melting ice. The mixture is then gently stirred and the Ficoll deposited at the bottom of the tube for separation for 20 minutes at 900 g. The pellet containing the rosettes is hemolyzed in NH solution₄CI for 5 minutes and the cells cultured in P24 containing irradiated human mononuclear cells. After about 1 week, the supernatants are evaluated in CELA tests (paragraph 3.2) and ADCC for the presence of anti-Rh (D) antibodies having a good activity. A new enrichment cycle is performed if the percentage of rosetting cells increases significantly compared to the previous cycle.

<i>1.4-Cloning of lymphoblastoid cells:</i>

The RI-enriched cells are divided into 5 and 0.5 cells per well in 96-well round bottom plates containing irradiated human mononuclear cells.

After approximately 4 weeks of culture, the supernatants of the wells containing cell clusters are evaluated by ADCC test.

<i>1.5- Heterofusion:</i>

The cloning wells of the EBV transformed cells exhibiting an interesting ADCC activity are amplified in culture and then fused with the heteromyeloma K6H6-B5 (ATCC CRL-1823) according to the standard PEG technique. After fusion, the cells are distributed at a rate of 2⁴ cells / well in flat-bottomed P96 containing murine intraperitoneal macrophages and in a selective medium containing aminopterin and ouabain (Sigma).

After 3 to 4 weeks of culture, the supernatants of the wells containing cell clusters are evaluated by ADCC test.

<i>1.6- cloning of heterohydroids:</i>

Limit dilution cloning was performed at 4, 2 and 1 cells / well in flat-bottomed P96s. After 2 weeks, the microscopic appearance of the wells is examined to identify unique clones and then the medium is renewed. After about 2 weeks, the supernatants of the wells containing cell clusters are evaluated by ADCC test.

2- <u>History of the clones retained:</u>

<i>2.1- Clone Producing an IgG1</i>

The EBV transformation of the d13 donor cells allowed the selection of a well, designated T125 2A2 on which were successively carried out: 2 enrichments, 3 cycles of RI, and cloning at 5 cells / well to give 2 clones:<ol id="ol0002" compact="compact" ol-style=""><li>1) T125 2A2 (5/1) A2 from which the DNA was extracted for the preparation of the recombinant vector;</li><li>2) T125 (5/1) A2 which was fused with K6H6-B5 to give F60 2F6 and then after 5 clones F60 2F6 (5) 4C4, clone retained for the constitution of a cell stock prior to the preparation of libraries.</li></ol>

It is an IgG1 possessing a Kappa light chain.<img file="EP1518864B2_D0006.tif" />

<i>2.2- Clone Producing an IgG3</i>

According to the same method as that used for the preparation of the IgG1 isotype antibody, an IgG3 producing line was prepared. The original cells come from a whole blood donation, from another designated donor, whose "buffy coat" fraction (leukocyte concentrate) was recovered.

It is an IgG3 with a Kappa light chain.<img file="EP1518864B2_D0007.tif" />

3- <u>Methods of Evaluating Anti-Rh (D) Antibodies:</u>

After purification by affinity chromatography on Protein A Sepharose (Pharmacia) and dialysis in 25mM Tris buffer, 150mM NaCl, pH 7.4, the concentration of the T125 antibody is determined by ELISA technique. In vitro biological activity is then measured by the ADCC technique.

<i>3.1- Determination of the IgG level and the isotypes by ELISA technique</i> :

• Total IgG

Coating: anti-IgG (Calbiochem) at 2μg / ml in 0.05M carbonate buffer pH 9.5, overnight at 4 ° C. Saturation: dilution buffer (PBS + 1% BSA + 0.05% Tween 20, pH 7.2) 1h at room temperature. Washing (to be repeated at each stage): H2O + NaCl 150mM + 0.05% Tween 20. Dilution of the samples in dilution buffer at about 100ng / ml and the control range consisting of polyvalent human IgG LFB prediluted at 100ng / ml. Incubation 2h at room temperature. Conjugate: anti-IgG (Diagnostic Pasteur) diluted 1/5000, 2 hours at room temperature. Substrate: OPD at 0.5 mg / ml (sigma) in phosphate citrate buffer, Na perborate (Sigma), 10 minutes at oscillation. Stopping the reaction with 1N HCl and reading at 492 nm.

•

Dosage Kappa chain.

Coating: anti-Kappa (Caltag Lab) at 5μg / ml in 0.05M carbonate buffer pH 9.5.1 overnight at 4 ° C. Saturation: dilution buffer (PBS + 1% BSA + 0.05% Tween 20, pH 7.2) 1h at room temperature. Washing (to be repeated at each stage): H2O + NaCl 150mM + 0.05% Tween 20. Dilution of the samples in dilution buffer at approximately 100 ng / ml and the control range made from the monoclonal antibody AD3T1 LFB (Kappa / gamma 3) prediluted at 100 ng / ml. Incubation 2 hours at room temperature Conjugate: biotinylated anti-kappa (Pierce) diluted 1/1000 in the presence of streptavidin-peroxidase (Pierce) diluted 1/1500, 2 hours at room temperature. Substrate: OPD at 0.5 mg / ml (sigma) in phosphate citrate buffer, Na perborate (Sigma), 10 minutes in the dark. Stopping the reaction with 1N HCl and reading at 492 nm.

<i>3.2- Specific anti-D assay by CELA technique (Cellular Enzyme Linked Assay):</i>

This method is used for the specific assay of anti-D antibodies especially when it is culture supernatant at culture stages where other non-anti-D immunoglobulins are present in the solution (early steps after EBV transformation) .

<u>Principle</u> Anti-D antibody is incubated with Rhesus positive red cells and then revealed by alkaline phosphatase-labeled anti-human Ig.

100 μl of 10% Rh + red cells diluted in 1% Liss-BSA dilution buffer. Dilution of samples in dilution buffer at about 500 ng / ml and the control range consisting of a purified monoclonal human anti-D IgG (DF5, LFB) prediluted at 500 ng / ml. Incubation 45 min at room temperature. Wash (renew at each step): H2O + 150mM NaCl. Conjugate: Anti-Alkaline IgG phosphatase (Jackson) diluted 1/4000 in PBS + 1% BSA, 1h30 at room temperature. Substrate: PNPP at 1mg / ml (sigma) to 1M diethanolamine, 0.5mM MgCl2; PH 9.8. Stopping the reaction with 1N NaOH and reading at 405 nm.

<i>3.3- ADCC technique</i>

The Antibody-Dependent Cellular Cytotoxicity (ADCC) technique is used to evaluate the ability of antibodies (anti-D) to induce lysis of Rh-positive red blood cells in the presence of effector cells (mononuclear cells or lymphocytes).

Briefly, the red blood cell packed RBC cells are treated with papain (1 mg / ml, 10 min at 37 ° C) and then washed in 0.9% NaCl. The effector cells are isolated from a pool of at least 3 buffy coat, by centrifugation on Ficoll (Pharmacia), followed by an adhesion step in the presence of 25% FCS, so as to obtain a ratio lymphocytes / monocytes of the order of 9. In a microtitre plate (96 wells) was deposited per well: 100 .mu.l of purified anti-D antibody at 200 ng / ml, 25 .mu.l of Rh + papainous red cells (ie 1x10⁶), 25μl of effector cells (ie 2x10⁶) and 50 μl of polyvalent IgG (Tegelin LFB for example) at the usual concentrations of 10 and 2 mg / ml. Dilutions are made in IMDM 0.25% FCS. After incubation for one night at 37 ° C., the plates are centrifuged and the hemoglobin released into the supernatant is measured in the presence of a substrate specific for peroxidase activity (2.7 diaminofluorene, DAF). The results are expressed as a percentage of lysis, 100% corresponding to the total lysis of the red blood cells to NH4Cl (100% control), and 0% to the reaction mixture without antibodies (control 0%).

The specific lysis is calculated as a percentage according to the following formula: <maths id="math0001" num=""><math display="block"><mfrac><mrow><mfenced separators=""><mi>DO</mi><mspace width="1ex" /><mi>sample</mi><mo>−</mo><mi>DO</mi><mspace width="1ex" /><mi>witness</mi><mspace width="1ex" /><mi>0%</mi></mfenced><mo>×</mo><mn>100</mn></mrow><mrow><mi>DO</mi><mspace width="1ex" /><mi>witness</mi><mspace width="1ex" /><mi>100%</mi><mo>−</mo><mi>DO</mi><mspace width="1ex" /><mi>witness</mi><mspace width="1ex" /><mi>0%</mi></mrow></mfrac><mo>=</mo><mi>%</mi><mspace width="1ex" /><mi>ADCC</mi></math><img file="EP1518864B2_D0008.tif" /></maths>

The results presented at <figref idref="f0001">figure 1</figref> show the activity of the antibody produced by the F60 heterohybrid compared to those of the reference antibodies:<ul id="ul0006" list-style="dash" compact="compact"><li>polyclonal antibodies to Rh (D) POLY-D LFB 51 and WinRhO W03 (Cangene) = positive controls</li><li>monoclonal antibody DF5 (inactive <i>in vivo</i> on the clearance of Rh (D) positive RBCs (BROSSARD / FNTS, 1990, unpublished)) = negative control</li><li>purified IgG1 (separated from IgG3) from the WinRhO W03 polyclonal.</li></ul>

Two concentrations of human IgG (Tegelin LFB) are used to show that the inhibition of negative control activity is related to the binding of competing IgG on Fcγ type I receptors.

<i>3.4- FcγRIII fixation technique (CD16):</i>

This test makes it possible to assess the binding of anti-Rh (D) antibodies of IgG1 isotype on FcγRIII and in particular to differentiate IgG3 antibodies. Given the low affinity of this receptor for monomeric IgG, the prior binding of the antibodies to the D antigen is necessary.

<u>Principle</u> on Rh + red cell membranes coated in a microtitration plate, the antibody to be tested (anti-D) is added and then transfected Jurkat cells expressing on their surface the FcγRIII receptor. After centrifugation, the "Rh + / anti-D / Jurkat CD16 membrane" interaction is visualized by a homogeneous spread of Jurkat CD16 in the well. In contrast, the cells cluster in the center of the well in the absence of interaction. The intensity of the reaction is expressed in numbers of +.

<u>Method</u> : <ol id="ol0003" compact="compact" ol-style=""><li>1) Incubation for 1 hour at 37 ° C. of the anti-D antibody (50 .mu.l to 1 .mu.g / ml in IMDM) on Capture R plate (Immunochim), followed by washing in water + NaCl 0.9%. Addition of Jurkat CD16 (2.10⁶ cells / ml) in IMDM + 10% FCS. Incubation 20 min at 37 ° C followed by centrifugation and evaluation of cell adhesion (against a control range).</li><li>2) Revelation of anti-D fixed on Capture R plates by ELISA technique using anti-human IgG-Peroxidase at 1/5000 (Sanofi Diagnostics Pasteur) after lysing Jurkat CD16 cells with Tris 0.2M HCl, 6M Urea, pH 5.3-5.5. OPD revelation then reading of the optical density (OD) at 492 nm.</li></ol>

Expression of the results: we assign an arbitrary value of 0 to 3 depending on the fixation and spreading of Jurkat CD16 cells. These values ​​are assigned to each defined OD interval (0.1 to 0.1). We trace:<ul id="ul0007" list-style="none" compact="compact"><li>* a curve: adhesion of Jurkat cells (Y) as a function of the amount of anti-D fixed on the membranes of red blood cells (X).</li><li>* or a histogram of the corresponding "fixation indices" for each antibody, to the sum of each Jurkat cell binding value (0 to 3) affected per OD interval (on a portion common to all the antibodies tested).</li></ul>

An example of a histogram is presented at <figref idref="f0002">figure 2</figref>.

Anti-Rh (D) antibodies of IgG1 isotype (F60 and T125 YB2 / 0) show a binding index close to that of polyclonal IgG1 (WinRho), whereas the negative control antibodies DF5 and AD1 do not bind. In the same way, the IgG3 isotype antibody (F41) has a good binding index, slightly lower than that of IgG3 purified from the Winrho polyclonal and higher than that of the AD3 antibody (another IgG3 tested and ineffective in clinical trial, mixed with AD1 (Biotest / LFB, 1997, unpublished).

<u>Example 2</u>

<u>PRODUCTION OF RECOMBINANT ANTI-D (AN) ANTIBODY</u>

1- Isolation and amplification of the cDNAs encoding the heavy and light chains of Ac

<i>1.1- RNA extraction and cDNA synthesis</i>

The total RNAs were extracted from an anti-D (IgG G1 / Kappa) producing clone obtained by EBV transformation: T125 A2 (5/1) A2 (see paragraph 2, example 1). The corresponding cDNAs were synthesized by reverse transcription of the total RNAs using oligo dT primers.

<i>1.2- Amplification of the variable region of the T125-A2 heavy chain: VH sequence</i>/<i>T125-A2</i>

The VH / T125-A2 sequence is obtained by amplification of the cDNAs of T125-A2 using the following primers:<ul id="ul0008" list-style="dash" compact="compact"><li>A2VH5 primer located at 5 'of the leader region of the VH gene of T125-A2, introduces a consensus leader sequence (in bold) deduced from leader sequences already published and associated with VH genes belonging to the same VH3-30 family as the gene VH of T125-A2; this sequence also contains an Eco RI restriction site (in italics) and a Kozak sequence (underlined): A2VH5 (SEQ ID NO: 1): 5'- CTCTCC<i>GAATTC</i><u>GCCGCCACC</u><b>ATGGAGTTTGGGCTGAGCTGGGT</b> -3'</li><li>antisense primer GSP2ANP located 5 'of the constant region (CH) of T125-A2: GSP2ANP (SEQ ID NO: 2): 5'-GGAAGTAGTCCTTGACCAGGCAG -3 '.</li></ul>

<i>1.3- Amplification of the constant region of T125-A2: CH sequence</i>/<i>T125-A2</i>

The CH / T125-A2 sequence is obtained by amplification of the cDNAs of T125-A2 using the following primers:<ul id="ul0009" list-style="dash" compact="compact"><li>G1 primer localized 5 'of the CH region of T125-A2: G1 (SEQ ID NO: 3): 5'- <u>VS</u>CCTCCACCAAGGGCCCATCGGTC -3 ' The first G base of the CH sequence is here replaced by a C (underlined) in order to recreate an Eco RI site after cloning (see section 2.1.1).</li><li>H3'Xba antisense primer located 3 'of the CH of T125-A2, introduces an Xba I site (underlined) 3' of the amplified sequence: H3'Xba (SEQ ID NO: 4): 5'- GAGAGG<u>TCTAGA</u>CTATTTACCCGGAGACAGGGAGAG -3 '</li></ul>

<i>1.4- Amplification of the Kappa light chain: sequence K</i>/<i>T125-A2</i>

The entire Kappa chain of T125-A2 (K / T125-A2 sequence) is amplified from the T125-A2 cDNAs using the following primers:<ul id="ul0010" list-style="dash" compact="compact"><li>A2VK3 primer located 5 'of the leader region of the VK gene of T125-A2, introduces a consensus sequence (in bold) deduced from the sequence of several leader regions of VK VH genes belonging to the same VK1 subgroup as the VK gene of T125-A2; this sequence also contains an Eco RI restriction site (in italics) and a Kozak sequence (underlined): A2VK3 (SEQ ID NO: 5): 5'- CCTACC<i>GAATTC</i><u>GCCGCCACC</u><b>ATGGACATGAGGGTCCCCGCTCA</b> -3'</li><li>antisense KSE1 primer localized in 3 'of Kappa, introduces an Eco RI site (underlined): KSE1 (SEQ ID NO: 6): 5 '- GGTGGT<u>GAATTC</u>CTAACACTCTCCCCTGTTGAAGCTCTT -3 '.</li></ul>

The <figref idref="f0001">Fig. 1</figref> schematizes the heavy and light chain amplification strategies of T125-A2.

2- Construction of the expression vectors

<i>2.1- T125-A2 heavy chain expression vector: T125-H26</i>

The construction of T125-H26 is summarized <figref idref="f0002">Fig. 2</figref>. It is carried out in two steps: firstly, the construction of the V51-CH / T125-A2 intermediate vector by insertion of the T125-A2 constant region into the pICI-neo-derived V51 expression vector (<figref idref="f0003">Fig. 3</figref>) and then cloning the variable region into V51-CH / T125-A2.

2.1.1 cloning of the constant region of T125-A2

The amplified CH / T125-A2 sequence is inserted after phosphorylation at the Eco RI site of the V51 vector (<figref idref="f0003">Fig. 3</figref>). The ligation is carried out after prior treatment with the Klenow polymerase of the Eco RI cohesive ends of V51 in order to make them "free ends".

The primer G1 used for the amplification of CH / T125-A2 makes it possible to recreate, after its insertion in V51, a 5 'Eco RI site of CH / T125-A2.

2.1.2 variable region cloning of T125-A2

The VH / T125-A2 sequence obtained by amplification is digested with Eco RI and Apa I and then inserted at the Eco RI and Apa I sites of the V51-G1 / T125-A2 vector.

<i>2.2- Vector T125-A2 light chain: T125-K47</i>

The construction of T125-K47 is presented <figref idref="f0004">Fig.4</figref>. The K / T125-A2 sequence obtained by PCR is digested with Eco RI and inserted at the Eco RI site of the pICI-neo-derived V47 expression vector (<figref idref="f0005">Fig. 5</figref>).

<i>2.3- T125-A2 heavy and light chain vector: T125-IG24</i>

The construction of T125-IG24 is schematized <figref idref="f0006">Fig.6</figref>. This vector which contains the two T125-A2 heavy and kappa chain transcription units is obtained by insertion of the T125-K47 Sal I-Xho I fragment containing the K / T125-A2 transcription unit at the Xho sites. I and Sal I of T125-H26.

Thus the heavy and light chains of T125-A2 are expressed under the control of the CMV promoter; other promoters can be used: RSV, IgG heavy chain promoter, MMLV LTR, HIV, β actin, etc.

<i>2.4- T125-A2 heavy and light chain specific leader vector: T125-LS4</i>

A second T125-A2 expression vector is also constructed in which the consensus leader sequence of the Kappa chain is replaced by the actual sequence of the T125-A2 leader region previously determined by sequencing "5'-RACE PCR products. (Rapid Amplification of cDNA 5 'Ends).

The construction of this T125-LS4 vector is described <figref idref="f0007">Fig. 7</figref>. It is carried out in two steps: firstly the construction of a new Kappa chain expression vector of T125-A2, T125-KLS18, then the assembly of the final expression vector, T125-LS4, containing the two modified light chain and heavy chain transcription units.

2.4.1 construction of the vector T125-KLS18

The 5 'part of the Kappa consensus leader sequence of the T125-K47 vector is replaced by the T125 specific leader sequence (KLS / T125-A2) during an amplification step of the K / T125-A2 sequence carried out at using the following primers:<ul id="ul0011" list-style="dash" compact="compact"><li>primer A2VK9, modifies the 5 'part of the leader region (in bold) and introduces an Eco RI site (underlined) as well as a Kozak sequence (in italics): A2VK9: 5'- CCTACC<u>GAATTC</u><i>GCCGCCACC</i><b>ATGAGGGTCCCCGCTCAGCTC</b> - 3'</li><li>KSE1 primer (described in section 1.4)</li></ul>

The T125-KLS18 vector is then obtained by replacing the T125-K47 Eco RI fragment containing the original K / T125-A2 sequence with the new EcoRI-digested KLS / T125-A2 sequence.

2.4.2 construction of the final vector T125-LS4

The Sal I - Xho I fragment of T125-KLS18 containing the modified KLS / T125-A2 sequence is inserted into T125-H26 at the Xho I and Sal I sites.

3- Production of anti-D Ab in the YB2 / 0 line

<i>3.1- Without gene amplification</i>

Both T125-IG24 and T125-LS4 expression vectors were used for transfection of cells of the YB2 / 0 line (rat myeloma, ATCC line No. 1662). After transfection by electroporation and selection of transformants in the presence of G418 (neo selection) several clones were isolated. The production of recombinant anti-D Ab is approximately 0.2 μg / 10⁶ cells / 24h (<i>value obtained for clone 3B2 of R270</i>)<i>.</i> The ADCC activity of this recombinant Ac is greater than or equal to that of the poly-D controls <b>(</b><figref idref="f0001"><b>figure 1</b></figref><b>)</b>. The products produced using the two expression vectors are not significantly different in terms of production level or ADCC activity.

<i>3.2- With gene amplification</i>

The gene amplification system used is based on the selection of transformants resistant to methotrexate (MTX). It requires the prior introduction of a transcription unit coding for the DHFR enzyme (dihydrofolate reductase) in the recombinant Ac expression vector (SHITARI et al., 1994).

3.2.1 construction of the T125-dhfr expression vector 13

The scheme presented <figref idref="f0008">Fig. 8</figref> describes the construction of the T125-A2 expression vector containing the murine dhfr gene.

A first vector (V64) was constructed from a vector derived from pCI-neo, V43 (<figref idref="f0009">Fig. 9</figref>), by replacing, in 3 'of the SV40 promoter and in 5' of a synthetic polyadenylation sequence, the neo gene (Hind III-Csp 45 I fragment) by the cDNA of the murine dhfr gene (obtained by amplification from the plasmid pMT2). This vector is then modified to create a 5 'Cla I site of the dhfr transcription unit. The Cla I fragment containing the dhfr transcription unit is then inserted at the Cla I site of T125-LS4.

3.2.2 selection in the presence of MTX

◆ 1

era

strategy:

The YB2 / 0 cells transfected by electroporation with the T125-dhfr13 vector are selected in the presence of G418. Transformants producing recombinant Ac are then subjected to selection in the presence of increasing doses of MTX (from 25nM to 25μM). The evolution of recombinant Ac production, a control of the gene amplification process, is followed during the selection steps in MTX. MTX-resistant transformants are then cloned by limiting dilution. The level and stability of recombinant Ac production is evaluated for each clone obtained. The productivity of anti-D antibodies after gene amplification is approximately 13 (+/- 7) μg / 10⁶cells / 24 h.

◆ 2

th

strategy:

YB2 / 0 cells transfected by electroporation with T125-dhfr13 vector are selected in the presence of G418. The best transformants producing recombinant Ac are cloned by limiting dilution before selection in the presence of increasing doses of MTX. The evolution of the production of each clone, a control of the gene amplification process, is followed during the selection steps in MTX. The level and stability of recombinant Ac production is evaluated for each MTX-resistant clone obtained.

<i>4- Evaluation of the activity of the T125 antibody expressed in YB2</i>/<i>0</i>

After purification by affinity chromatography on Protein A Sepharose (Pharmacia) and dialysis in 25mM Tris buffer, 150mM NaCl, pH 7.4, the concentration of the T125 antibody is determined by ELISA technique. In vitro biological activity is then measured by the previously described ADCC test. The results are presented at<figref idref="f0001">figure 1</figref>.

<u>EXAMPLE 3: EVIDENCE OF THE RELATION BETWEEN GLYCANNIC STRUCTURE AND DEPENDENT ACTIVITY OF FCγRIII</u>

<i>1- Cell culture in the presence of Deoxymannojirimycin (DMM).</i>

Several studies describe the effect of enzymatic inhibitors on the glycosylation of immunoglobulins and on their biological activity. An increase in ADCC activity is reported by ROTHMAN et al. 1989, an increase not attributable to an improvement in the affinity of the antibody for its target. The modification of glycosylation caused by the addition of DMM consists of an inhibition of α1,2 mannosidase I present in the Golgi. It leads to the production of a larger proportion of polymannosylated, non-fucosylated structures.

Different lines producing anti-Rh (D) antibodies were placed in the presence of DMM and the functional activity of the monoclonal antibodies produced was evaluated in the form of culture supernatants or after purification.

Cells (hetero-hybrid or lymphoblastoid) are seeded between 1 and 3x10⁵ cells / ml, and cultured in IMDM culture medium (Life Technologies) with 10% FCS and in the presence of 20 μg / ml of DMM (Sigma, Boehringer). After 3 medium changes, the culture supernatants are tested by human IgG ELISA and then by ADCC.<tables id="tabl0002" num="0002"><table frame="all"><title>Table 2: Effect of culture in the presence of DMM on ADCC activity of different anti-Rh (D)</title><tgroup cols="4"><colspec colnum="1" colname="col1" colwidth="33mm" /><colspec colnum="2" colname="col2" colwidth="32mm" /><colspec colnum="3" colname="col3" colwidth="43mm" /><colspec colnum="4" colname="col4" colwidth="60mm" /><thead><row><entry morerows="1" align="center" valign="middle">Samples</entry><entry namest="col2" nameend="col3" align="center" valign="middle">ADCC activity In% of the activity of poly-DLFB51</entry><entry morerows="1" align="center" valign="middle">Minimum dose of DMM required μg / ml</entry></row><row><entry align="center" valign="middle">Culture without DMM</entry><entry align="center" valign="middle">Culture in the presence of DMM</entry></row></thead><tbody><row><entry align="center" valign="middle">F60</entry><entry align="center" valign="middle">109</entry><entry align="center" valign="middle">113</entry><entry align="center" valign="middle">NT</entry></row><row><entry align="center" valign="middle">D31</entry><entry align="center" valign="middle">19</entry><entry align="center" valign="middle">87</entry><entry align="center" valign="middle">10</entry></row><row><entry align="center" valign="middle">DF5</entry><entry align="center" valign="middle">26</entry><entry align="center" valign="middle">62</entry><entry align="center" valign="middle">20</entry></row><row><entry align="center" valign="middle">T125 RI (3)</entry><entry align="center" valign="middle">3</entry><entry align="center" valign="middle">72</entry><entry align="center" valign="middle">20</entry></row><row><entry align="center" valign="middle">T125-CHO</entry><entry align="center" valign="middle">0</entry><entry align="center" valign="middle">105</entry><entry align="center" valign="middle">5</entry></row></tbody></tgroup><tgroup cols="4" rowsep="0"><colspec colnum="1" colname="col1" colwidth="33mm" /><colspec colnum="2" colname="col2" colwidth="32mm" /><colspec colnum="3" colname="col3" colwidth="43mm" /><colspec colnum="4" colname="col4" colwidth="60mm" /><tbody><row><entry namest="col1" nameend="col4" align="justify"><u>NT = not tested</u></entry></row></tbody></tgroup></table></tables>• The culture in the presence of Deoxymannojirimycin (DMM) brings a significant improvement of the ADCC results for the weakly active antibodies previously produced by:<tables id="tabl0003" num="0003"><table frame="none"><tgroup cols="2" colsep="0" rowsep="0"><colspec colnum="1" colname="col1" colwidth="58mm" /><colspec colnum="2" colname="col2" colwidth="29mm" /><tbody><row><entry>A human-mouse hybridoma</entry><entry>D31</entry></row><row><entry>A human lymphoblastoid line</entry><entry>DF5</entry></row><row><entry>A transfected murine line</entry><entry>T125 in CHO</entry></row></tbody></tgroup></table></tables>• The addition of DMM can restore the ADCC activity of an antibody derived from clone T125 = T125 RI (3) (described in Example 1) and which has lost this activity by a prolonged culture. The strong activity of the antibody produced by the F60 hetero-hybridoma (the production of which is described in Example 1) is not modified by culture in the presence of DMM.

<i>2- Production of recombinant anti-D antibodies by different cell lines:</i>

2.1 Preparation of an Expression Vector for the DF5 Antibody

The nucleotide sequence of the DF5 antibody, a negative control in the ADCC test, is used to study the transfection of this antibody in a few lines, parallel to the transfection of the T125 antibody.

The sequences encoding the Ac DF5 are isolated and amplified according to the same techniques used for recombinant Ac T125-A2.<ul id="ul0012" list-style="bullet" compact="compact"><li>The corresponding cDNAs are first synthesized from total RNA extracted from the clone producing anti-D (IgG G1 / Lambda) 2MDF5 obtained by EBV transformation.</li><li>Amplification of the heavy and light chains is then carried out from these cDNAs using the primers presented below.</li><li>Amplification of the variable region of the DF5 heavy chain (VH / DF5 sequence):<ul id="ul0013" list-style="dash" compact="compact"><li>DF5VH1 primer located 5 'from the leader region (in bold) of the VH gene of DF5 (published sequence: Chouchane L et al.); this primer also contains an Eco RI restriction site (in italics) and a Kozak sequence (underlined): DF5VH1 (SEQ ID NO: 8):<img file="EP1518864B2_D0009.tif" /></li><li>antisense primer GSP2ANP located 5 'of the constant region (CH) already described in section 1.2 (example 2)</li></ul></li><li>Amplification of the constant region CH of DF5 (sequence CH / DF5): primers G1 and H3'Xba already described in paragraph 1.3 (Example 2).</li><li>DF5 Lambda light chain amplification (LBD / DF5 sequence):<ul id="ul0014" list-style="dash" compact="compact"><li>DF5VLBD1 primer located in the 5 'leading region of the DF5 VL gene, introduces a consensus sequence (in bold) deduced from the sequence of several leader regions of VL genes belonging to the same VL1 subgroup as the VL gene of 2MDF5; this sequence also contains an Eco RI restriction site (in italics) and a Kozak sequence (underlined): DF5VLBD1 (SEQ ID NO: 9): 5'CCTACC<i>GAATTC</i><u>GCCGCCACC</u><b>ATGGCCTGGTCTCCTCTCCTCCTCAC</b> -3'</li><li>LSE1 antisense primer located in 3 'of Lambda, introduces an Eco RI site (underlined): LSE1 (SEQ ID NO: 10): 5'- GAGGAG<u>GAATTC</u>ACTATGAACATTCTGTAGGGGCCACTGTCTT -3 '.</li></ul></li><li>The construction of the heavy chain (DF5-H31), light chain (DF5-L10) and heavy and light chains (DF5-IG1) expression vectors of the Ac DF5 is carried out according to a construction scheme similar to the vectors expressing the Ac T125-A2. All the original leader sequences (introduced at the level of the amplification primers) are conserved in these different vectors.</li></ul>

2.2- Transfection of Different Cell Lines with T125 and DF5 Antibodies

The three expression vectors T125-IG24, T125-LS4 and DF5-IgG1 are used for the transfection of cells of different lineages: Stable or transient transfections are performed by electroporation or transfection reagent.<tables id="tabl0004" num="0004"><table frame="all"><title>Table 3: Cell lines used for the transfection of anti-Rh (D) antibodies</title><tgroup cols="3"><colspec colnum="1" colname="col1" colwidth="18mm" /><colspec colnum="2" colname="col2" colwidth="51mm" /><colspec colnum="3" colname="col3" colwidth="98mm" /><thead><row><entry align="center" valign="top"><b>Last name</b></entry><entry align="center" valign="top"><b>Reference</b></entry><entry align="center" valign="top"><b>Cell type</b></entry></row></thead><tbody><row><entry align="center">CHO-K1</entry><entry align="center">ATCC CCL 61</entry><entry align="center">Chinese hamster ovary (epithelium like)</entry></row><row><entry align="center">CHO-Lec10</entry><entry><nplcit id="ncit0001" npl-type="s"><text>Fenouillet et al., 1996, Virology, 218, 224-231</text></nplcit></entry><entry align="center">Chinese hamster ovary (epithelium like)</entry></row><row><entry align="center">Jurkat</entry><entry align="center">ATCC TIB-152</entry><entry align="center">Human T cell (Leukemia T)</entry></row><row><entry align="center">Molt-4</entry><entry align="center">ATCC CRL 1582</entry><entry align="center">Human T cell (Acute lymphoblastic leukemia)</entry></row><row><entry align="center">WIL2-NS</entry><entry align="center">ATCC CRL 8155</entry><entry align="center">EBV-transformed human B-cell</entry></row><row><entry align="center">Vero</entry><entry align="center">ATCC CCL 81</entry><entry align="center">African green monkey kidney (fibroblast like)</entry></row><row><entry align="center">COS-7</entry><entry align="center">ATCC CRL 1651</entry><entry align="center">African green monkey kidney transformed SV40 (fibroblast like)</entry></row><row><entry align="center">HEK-293</entry><entry align="center">ATCC CRL 1573</entry><entry align="center">Primary Human Embryonic Kidney Transformed by DNA Adenovirus 5 Defective</entry></row><row><entry align="center">YB2 / 0</entry><entry align="center">ATCC CRL 1662</entry><entry align="center">Non-secretory rat myeloma</entry></row><row><entry align="center">BHK-21</entry><entry align="center">ATCC CCL 10</entry><entry align="center">Newborn hamster kidney (fibroblast like)</entry></row><row><entry align="center">K6H6-B5</entry><entry align="center">ATCC CRL 1823</entry><entry align="center">non-secretory human-mouse heteromyeloma</entry></row><row><entry align="center">NSO</entry><entry align="center">ECACC 85110503</entry><entry align="center">non-secretory mouse myeloma (lymphoblate like)</entry></row><row><entry align="center">SP2 / 0- Ag 14</entry><entry align="center">ECACC 85072401</entry><entry align="center">Mouse hybridoma x nonsecretory mouse</entry></row><row><entry align="center">CHO Lec-1</entry><entry align="center">ATCC CRL 1735</entry><entry align="center">Chinese hamster ovary</entry></row><row><entry align="center">CHO dhfr-</entry><entry align="center">ECACC 94060607</entry><entry align="center">Chinese hamster ovary</entry></row><row><entry align="center">CHO Pro-5</entry><entry align="center">ATCC CRL 1781</entry><entry align="center">Chinese hamster ovary</entry></row><row><entry align="center">P3X63 Ag8.653</entry><entry align="center">ATCC CRL 1580</entry><entry align="center">Non-secretory mouse myeloma</entry></row></tbody></tgroup></table></tables>

After selection of the transformants in the presence of G418 (neo selection) several clones were isolated.

The modification of effector activity of a humanized monoclonal antibody as a function of the expression cell has been described by CROWE et al (1992), with the cell lines CHO, NSO, YB2 / O.

The results obtained here confirm the importance of the expression cell line with respect to the functional characteristics of the antibody to be produced. Among the cells tested, only the Vero, YB2 / 0 and CHO Lec-1 lines make it possible to express recombinant anti-Rh (D) monoclonal antibodies with a strong lytic activity in the ADCC test (see Example 1 and Table 3).<tables id="tabl0005" num="0005"><img file="EP1518864B2_D0010.tif" /></tables>

3- study of glycan structures

The characterization of the glycan structures of the anti-Rh-D antibody was performed on four purified products having ADCC activity (F60, and three recombinant proteins derived from T125) in comparison with two purified products that were inactive or very weakly active in the ADCC test. described here (D31 and DF5).

In practice, the oligosaccharides are separated from the protein by a specific enzymatic deglycosylation by PNGase F at the level of Asn 297. The oligosaccharides thus released are labeled with a fluorophore, separated and identified by different complementary techniques that allow:<ul id="ul0015" list-style="dash" compact="compact"><li>A fine characterization of the glycanic structures by matrix-assisted laser desorption mass spectrometry (MALDI) by comparison of the experimental masses with the theoretical masses.</li><li>The determination of the ion exchange HPLC sialylation rate (GlycoSep C)</li><li>The separation and the quantification of the oligosaccharide forms according to criteria of hydrophilicity by HPLC in normal phase (GlycoSep N)</li><li>The separation and quantification of oligosaccharides by capillary electrophoresis with laser-induced fluorescence detection (HPCE-LIF).</li></ul>

1) Characterization of the Glycans of Active Forms

The different active forms studied are F60 and three recombinant antibodies, R 290, R 297 and R 270, derived from T125 and produced in YB2 / 0. The fine characterization of the glycan structures by mass spectrometry (<figref idref="f0007">figure 7</figref>) shows that these forms are all biantennées type. In the case of R 270, the majority form is of non-fucosylated agalactosylated type (G0, mass exp., 1459.37 Da,<figref idref="f0001">fig 1</figref>). Three other structures are identified: fucosylated agalactosylated (G0F to 1605.41 Da), nonfucosylated monogalactosylated (G1 to 1621.26 Da) and fucosylated monogalactosylated (G1F to 1767.43 Da) minority. These same four structures are characteristic of R 290, F 60 and R 297 (<figref idref="f0001">Figure 1</figref>).

These four antibodies active in ADCC are also characterized by the absence of oligosaccharides having a N-acetylglucosamine bisector residue.

Quantification of the glycan structures by the various HPLC and HPCE-LIF techniques (Table I) confirms the presence of the four forms identified by mass: G0, G0F, G1 and G1F. The sialylation rate is very low, especially for the recombinant products, from 1 to 9.4%, which is confirmed by the similarity of the mass spectra obtained before and after enzymatic desialylation. The fucosylation rate varies from 34 to 59%.

2) Inactive forms

The different inactive forms studied are D31 and DF5. The quantification of the glycanic structures by the various chromatographic and capillary electrophoresis techniques (Table I) reveals, for these two antibodies, a sialylation rate close to 50%, and a fucosylation rate of 88 and 100% for D31 and DF5, respectively. These levels of sialylation and fucosylation are much higher than those obtained from the active forms.

The characterization of the glycanic structures shows that the majority form is, for the two antibodies, of the fucosylated bigalactosylated monosialylated biantenea type (G2S1F, Table I). Characterization by mass spectrometry of D31 (<figref idref="f0007">figure 7</figref>) reveals that the neutral forms are predominantly monogalactosylated fucosylated type (G1F to 1767.43 Da) and fucosylated bigalactosylated (G2F to 1929.66 Da).

The inactive DF5 antibody is characterized by the presence of oligosaccharides having a spacer GIcNAc residue. In particular, mass analysis (<figref idref="f0008">figure 8</figref>) reveals the presence of a predominant neutral form of monogalactosylated fucosylated type Bisec-GlcNAc intercalary (G1FB 1851.03 Da). On the other hand, these structural forms are non-detectable or present in trace amounts on the active antibodies studied.

The ADCC activity of D31 after DMM action increases from 10% to 60%. The glycanic structures of D31 DMM differ from those of D31 by the presence of oligomannose forms (Man 5, Man 6 and Man 7) (see<figref idref="f0009">figure 9</figref>).

3) Conclusion

The different active antibodies are modified on Asn 297 by N-glycosylations of biantenné type and / or oligomanosidiques. For the biantenated forms they are very weakly sialylated short structures, weakly fucosylated, weakly galactosylated and without intermediate GlcNAc.

REFERENCES

<ul id="ul0016" list-style="none"><li><nplcit id="ncit0002" npl-type="s"><text>Boylston, JM, Gardner, B., Anderson, RL, and Hughes-Jones, NC Production of human IgM anti-D in tissue culture by EB-transformed lymphocyte viruses. Scand. J. Immunol. 12: 355-358 (1980</text></nplcit>).</li><li><nplcit id="ncit0003" npl-type="s"><text>Bron, D., Feinberg, MB, Teng, NNH and Kaplan, HS Production of Human IgG Monoclonal Antibodies against Rhesus (D) Antigen. Proc. Nat. Acad. Sci. USA 81: 3214-3217 (1984)</text></nplcit>).</li><li><nplcit id="ncit0004" npl-type="s"><text>Chouchane, L., Van Spronsen, A., Breyer, J., Guglielmi, P., and Strosberg, AD. Molecular characterization of a human anti-Rh (D) antibody with a segment encoded by a germ-line sequence. Eur. J. Biochem. 1; 207 (3): 1115-1121 (1992)</text></nplcit>).</li><li><nplcit id="ncit0005" npl-type="s"><text>Crawford, DH, Barlow, MJ, Harrison, JF, Winger, L. and Huehns, ER Production of human monoclonal antibody to rhesus D antigen. Lancet, i: 386-388 (1983)</text></nplcit>).</li><li><nplcit id="ncit0006" npl-type="s"><text>Doyle, A., Jones, TJ, Bidwell, JL and Bradley, A. In vitro development of human monoclonal antibody secreting plasmacytomas. Hmm. Immunol. 13: 199-209 (1985)</text></nplcit>).</li><li><nplcit id="ncit0007" npl-type="s"><text>Edelman, L., Margaritte, C., Chaabihi, H., Monchâtre, E., Blanchard, D., Cardona, A., Morin, F., Dumas, G., Petres, S. and Kaczorek, M. Obtaining a recombinant anti-rhesus (D) antibody using the baculovirus-insect cell expression system. Immunology, Vol. 91 (1), 13-19 (1997)</text></nplcit>).</li><li><nplcit id="ncit0008" npl-type="s"><text>Foung, SKH, Blunt, JA, Wu, PS, Ahearn, P., Winn, LC, Engleman, EG and Grumet, FC Human Monoclonal Antibodies to Rho (D). Vox Sang. 53: 44-47 (1987)</text></nplcit>).</li><li><nplcit id="ncit0009" npl-type="s"><text>Goossens, D., Champomier, F., Rouger, P., and Salmon, C. Human Monoclonal Antibodies against Blood Group Antigens: Preparation of a series of stable EBV immortalized B clones producing high levels of antibodies of different isotypes and specificities. J. Immunol. Methods 101: 193-200 (1987)</text></nplcit>).</li><li><nplcit id="ncit0010" npl-type="s"><text>Issitt, PD Genetics of the Blood Group Rh: Some Current Concepts. Med. Lab. Sci. 45: 395-404 (1988)</text></nplcit>).</li><li><nplcit id="ncit0011" npl-type="s"><text>Jefferis, R., Lund, J., Mizutani, H., Nakagawa, H., Kawazoe, Y., Arata, Y. and Takahashi, N. A comparative study of the N-linked oligosaccharide structure of human IgG subclass proteins. Biochem. J., 268: 529-537 (1990)</text></nplcit>).</li><li><nplcit id="ncit0012" npl-type="s"><text>Koskimies, S. Human Lymphoblastoid Cell Line Producing Specific Antibodies against Rh-Antigen D. Scand. Immunol. 11: 73-77 (1980</text></nplcit>).</li><li><nplcit id="ncit0013" npl-type="s"><text>Kumpel, BM, Goodrick, MJ, Pamphilon, DH, Fraser, ID, Poole GD, Morse, C., Standen, GR, Chapman, GE, Thomas, DP, and Anstee, DJ Human Rh D monoclonal antibodies (BRAD-3 and BRAD -5) Cause Accelerated Clearance of Rh D + Red blood cells and suppression of Rh D Immunization in Rh D Volunteers. Blood, Vol. 86, No. 5, 1701-1709 (1995)</text></nplcit>).</li><li><nplcit id="ncit0014" npl-type="s"><text>Kumpel, BM, Poole, GD and Bradley, BA Human Monoclonal Anti-D Antibodies. I. Their Production, Serology, Quantitation and Potential Use as Blood Grouping Reagents. Brit. J. Haemat. 71: 125-129 (1989a)</text></nplcit>).</li><li><nplcit id="ncit0015" npl-type="s"><text>Kumpel, BM, Rademacher, TW, Rook, GAW, Williams, PJ, Wilson, IBM Galacatosylation of human anti-D IgG produced by EBV-transformed B lymphoblastoid cell lines is dependent on culture method and affects Fc receptor mediated functional activity. Hmm. Antibodies and Hybridomas, 5: 143-151 (1994)</text></nplcit>).</li><li><nplcit id="ncit0016" npl-type="s"><text>Leatherbarrow, RJ, Rademacher, TW, Dwek, RA, Woof, JM, Clark, A., Burton, DR, Richardson, N. and Feinstein, A. Effector functions of monoclonal aglycosylated mouse IgG2a; C1 and interaction with human Fc receptor. Molec. Immun. 22, 407-415 (1985)</text></nplcit>).</li><li><nplcit id="ncit0017" npl-type="s"><text>Lifely MR, Hale C, Boyce S, Keen MJ, Phillips J. Glycosylation and biological activity of CAMPATH-1H expressed in different cell lines. Glycobiology. 1995 Dec; 5 (8): 813-22</text></nplcit>.</li><li><nplcit id="ncit0018" npl-type="s"><text>Lomas, C., Tippett, P., Thompson, KM, Melamed, MD, and Hughes-Jones, NC Demonstration of seven epitopes on the antigen D using human monoclonal anti-D antibodies and red cells from D categories. Vox Sang. 57: 261-264 (1989)</text></nplcit>).</li><li><nplcit id="ncit0019" npl-type="s"><text>Lund, J., Takahaski, N., Nakagawa, H., Goodall, M., Bentley, T., Hindley, SA, Tyler, R. and Jefferis, R. Control of IgG / Fc glycosylation: a comparison of oligosaccharides from chimeric human / mouse and mouse subclass immunoglobulin G5. Molec. Immun. 30, No. 8, 741-748 (1993)</text></nplcit>).</li><li><nplcit id="ncit0020" npl-type="s"><text>Lund, J., Tanaka, T., Takahashi, N., Sarmay, G., Arata, Y. and Jefferis, R. A structural protein changes in aglycosylated IgG3 correlates with loss of hu Fc □ RI and hu FcγRIII binding and / or activation. Molec. Immun. 27, 1145-1153 (1990)</text></nplcit>).</li><li><nplcit id="ncit0021" npl-type="s"><text>Ma, JK and Hein, MB. Immunotherapeutic potential of antibodies produced in plants.Trends Biotechnol. 13, 522-527 (1995)</text></nplcit>).</li><li><nplcit id="ncit0022" npl-type="s"><text>Mc Cann-Carter, MC, Bruce, M., Shaw, EM, Thorpe, SJ, Sweeney, GM, Armstrong, SS and James, K. The production and evaluation of two monoclonal human anti-D antibodies. Trans. Med. 3: 187-194 (1993)</text></nplcit>).</li><li><nplcit id="ncit0023" npl-type="s"><text>Melamed, MD, Gordon, J., Ley, SJ, Edgar, D. and Hughes-Jones, NC Senescence of a human lymphoblastoid clone producing anti-Rhesus (D). Eur. J. Immunol. 115: 742-746 (1985)</text></nplcit>).</li><li><nplcit id="ncit0024" npl-type="s"><text>Parekh, RB, Dwek, RA, Sutton, BJ, Fernandes, DL, Leung, A., Stanworth, D., Rademacher, TW, Mizuochi, T., Taniguchi, T., Matsuta, K., Takeuchi, F., Nagano, Y., Miyamoto, T. and Kobata, A. Association of rheumatoid arthritis and primary osteoarthritis with changes in the glycosylation pattern of total serum IgG. Nature, 316: 452-457 (1985)</text></nplcit>).</li><li><nplcit id="ncit0025" npl-type="s"><text>Rothman, RJ, Perussia, B., Herlyn, D. and Warren, L. Antibody-dependent cytotoxicity mediated by natural killer cells is enhanced by castanospermine-induced alterations of IgG glycosylation. Mol. Immunol. 26 (12): 1113-1123 (1989)</text></nplcit>).</li><li><nplcit id="ncit0026" npl-type="s"><text>Shitara K., Nakamura K., Tokutake-Tanaka Y., Fukushima M., and Hanai N. A new vector for the high level expression of chimeric antibodies to myeloma cells. J. Immunol. Methods 167: 271-278 (1994)</text></nplcit>).</li><li><nplcit id="ncit0027" npl-type="s"><text>Thompson, KM, Hough, DW, Maddison, PJ, Melamed, MD and Hughes-Jones, NC Production of human monoclonal IgG and IgM antibodies with anti-D (rhesus) specificity using heterohybridomas. Immunology 58: 157-160 (1986)</text></nplcit>)</li><li><nplcit id="ncit0028" npl-type="s"><text>Thomson, A., Contreras, M., Gorick, B., Kumpel, B., Chapman, GE Lane, RS, Teesdale, P. Hughes-Jones, NC and Mollison, PL Clearance of Rh D-positive red cells with monoclonal anti-D. Lancet 336: 1147-1150 (1990)</text></nplcit>).</li><li><nplcit id="ncit0029" npl-type="s"><text>Tippett, P. Subdivisions of the Rh (D) antigen. Med. Lab. Sci. 45: 88-93 (1988)</text></nplcit>).</li><li><nplcit id="ncit0030" npl-type="s"><text>Umaña P, Jean-Mairet J, Moudry R, ​​Amstutz H, Bailey JE. Engineered glycoforms of an antineuroblastoma IgG1 with antibody-dependent cytotoxic activity. Nat Biotechnol. 1999 Feb; 17 (2): 176-80</text></nplcit>.</li><li><nplcit id="ncit0031" npl-type="s"><text>Ware, RE and Zimmerman, SA Anti-D: Mechanisms of Action. Seminars in Hematology, vol. 35, No. 1, supp. 1: 14-22 (1998)</text></nplcit>).</li><li><patcit id="pcit0017" dnum="WO9954342A1"><text>WO99 / ​​54342A1</text></patcit></li><li><nplcit id="ncit0032" npl-type="s"><text>Wright A, Morrison SL. Effect of glycosylation on antibody function: implications for genetic engineering. Trends Biotechnol. 1997 Jan; 15 (1): 26-32</text></nplcit>.</li><li><nplcit id="ncit0033" npl-type="s"><text>Yu, IPC, Miller, WJ, Silberklang, M., Mark, GE, Ellis, RW, Huang, L., Glushka, J., Van Halbeek, H., Zhu, J. and Alhadeff, JA Structural characterization of the N -Glycans of a humanized anti-CD18 murine immunoglobulin G. Arch. Biochem. Biophys. 308, 387-399 (1994)</text></nplcit>).</li><li><nplcit id="ncit0034" npl-type="s"><text>Zupanska, B., Thompson, E., Brojer, E. and Merry, AH Phagocytosis of Erythrocytes Sensitized with Known Amounts of IgG1 and IgG3 anti-Rh antibodies. Vox Sang. 53: 96-101 (1987)</text></nplcit>).</li></ul>