Process for amplifying nucleic acid sequences

PATENT Case 2177,1 PROCESS FOR AMPLIFYING NUCLEIC ACID SEQUENCES The present invention relates to a process for amplifying existing nucleic acid sequences. More specifically, it relates to a process for producing any particular nucleic acid sequence from a given sequence of DNA or RNA in amounts which are large compared to the amount initially present. The DNA or RNA may be single- or double stranded and may be a relatively pure species or a component of a mixture of nucleic acids. The process of the invention utilizes a repetitive reaction to accomplish the amplification of the desired nucleic acid sequence.

For diagnostic applications in particular, the target nucleic acid sequence may be only a small portion of the DNA or RNA in question so that it may be difficult to detect its presence using nonisotopically labeled or end-labeled oligonucleotide probes. Much effort is being expended in increasing the sensitivity of the probe detection systems, but little research has been conducted on amplifying the target sequence so that it is present in quantities sufficient to be readily detectable using currently available methods.

Several methods have been described in the literature for I the synthesis of nucleic acids de nova or from an existing sequence.

These methods are capable of producing large amounts of a given nucleic acid of completely specified sequence, One known method for synthesizing nucleic acids de nova involves the organic synthesis of a nucleic acid from nucleoside derivatives This synthesis may be performed in solution or on a solid support. One type of organic synthesis is the phosphotriester method, which has been utilized to prepare gene fragments or short genes. In the phosphotriester method, oligonucleotides are prepared which can then be joined together to form longer nucleic acids. For a description of this method see Nearing, SPA., et Allah Moth, Enzymol., 68, 90 (1979) and US.

Patent No. 4,356,270. The patent describes the synthesis and cloning of the somatostatin gene.

AL Ed 3 I A second type of organic synthesis is the phosphodiester method, which has been utilized to prepare a tuna gene. See grown, EEL., et at., Moth.

Enzymol.~ 68, 109 (1979) for a description of this method. As in the phosphotriester method, the phosphodiester method involves synthesis of oligonucleotides which are subsequently joined together to form the desired nucleic acid.

Although the above processes for de nova synthesis may be utilized to synthesize long strands of nucleic acid, key are not very practical to use for the synthesis of large amounts of a nucleic acid. Both processes are laborious and time-consuming, require expensive equipment and reagents, and have a low overall efficiency.

The low overall efficiency may be caused by the inefficiencies of the synthesis of the oligonucleotides and of the joining reactions. In the synthesis of a long nucleic acid, or even in the synthesis of a large amount of a shorter nucleic acid, many oligonucleotides would need to be synthesized and many joining reactions would be required.

Consequently, these methods would not be practical for synthesizing large amounts of any desired nucleic acid.

Methods also exist for producing nucleic acids in large amounts from small amounts of the initial existing nucleic acid.

These methods involve the cloning of a nucleic acid in the appropriate host system where the desired nucleic acid is inserted into an appropriate vector which is used to transform the host. When the host is cultured the vector is replicated, and hence more copies of the desired nucleic acid are produced. For a brief description of sub cloning nucleic acid fragments, see Mounts, T., et aloud Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, pp. 390401 (1982). See also the techniques described in US. Patent Nos.

4,416,988 and 4,403,036.

A third method for synthesizing nucleic acids, described in US.

Patent No. 49293,652, is a hybrid of the above-described organic synthesis and molecular cloning methods.

In this process, the appropriate number of oligonucleotides to make up the desired nucleic acid sequence is organically synthesized and inserted sequentially lo q to into a Hector which is amplified by growth prior to each succeeding insertion.

The present invention bears some similarity to the molecular cloning method; however, it does not involve the propagation of any organism and thereby avoids the possible hazards or inconvenience which this entails. The present invention also does not require synthesis of nucleic acid sequences unrelated to the desired sequence, and thereby the present invention obviates the need for extensive purification of the product from a complicated biological mixture, The present invention resides in a process for amplifying one or more specific nucleic acid sequences present in a nucleic acid or mixture thereof using primers and inducing agents. The extension product of one primer when hybridized to the other becomes a template for the production of the desired specific nucleic acid sequence, and vice versa, and the process is repeated as often as is necessary to produce the desired amount of the sequence. This method is expected to be more efficient than the methods described above for producing large amounts of nucleic acid from a target sequence and to produce such nucleic acid in a comparatively short period of time. The present method it especially useful for amplifying rare species of nucleic acid present in a mixture of nucleic acids for effective detection ox such species.

More specifically, the present invention provides a process for amplifying at least one specific nucleic acid sequence contained in a nucleic acid or a mixture of nucleic acids, wherein each nucleic acid consists of two separate complementary strands, of equal or unequal length, wish process comprises:

(a) treating the strands with two primers, for each different specific sequence being amplified, under conditions such that for each different sequence being amplified an extension product of each primer is synthesized which is complementary to each nucleic acid strand, wherein said primer or primers are selected so as to be substantially complementary to different strands of each specific sequence such that the extension product synthesized from one primer, s when it is separated from its complement, can serve as a template for synthesis of the extension product of the other primer;

b) separating the primer extension products from the templates on which they were synthesized to produce single stranded molecules; and (c) treating the single-stranded molecules generated from step (b) with the primers of step (a) under conditions such that a primer extension product is synthesized using each of the single strands produced in step (b) as a template.

The steps may be conducted sequentially or simultaneously.

In addition, steps (b) and (c) may be repeated until the desired level of sequence amplification is obtained.

The steps may be conducted sequentially or simultaneously.

In addition, steps (b) and (c) may be repeated until the desired level of sequence amplification is obtained.

The present invention may be useful not only for producing large amounts of an existing nucleic acid of completely specified sequence, but also for producing nucleic acid sequences which are known to exist but are not completely specified. In either case an initial copy of the sequence to be amplified must be available, although it need not be pure or a discrete molecule.

Figure 1 illustrates a 94 base pair length sequence of human glob in desired to be amplified. The single base pair change which is associated with sickle cell anemia is depicted beneath the Myra.

Figure 2 illustrates an auto radiograph of polyacrylamide gel electrophoresis demonstrating amplification of the Myra contained in human wild type DNA and in a plasm id containing a 1.9 kb Bohemia fragment of the normal glob in gene (designated pBR3~8:HbA~.

Figure 3 illustrates an auto radiograph of polyacrylamide gel electrophoresis demonstrating amplification of any of the specific target Myra sequence present in pBR328:HbA~ a plasm id containing a 1.9 kb Bohemia fragment of the sickle cell allele of glob in (designated pBR32B:HbS), pBR32~:HbA where the sequence to be amplified I is cleaved with MstII, and pBR328 Hubs where the sequence to be amplified has been treated but not cleaved with MstII.

Figure 4 illustrates in detail the steps and products of the polymers chain reaction for amplification of the desired Myra sequence of human glob in for three cycles using two oligonucleotide primers.

Figure 5 represents an auto radiograph of polyacrylamide gel electrophoresis demonstrating amplification after four cycles of a Myra sequence in pBR328:HbA, where the allocates are digested with NcoI (Lane 3), MstlI (Lane 4) or HinfI (Lane I Lane 1 is the molecular weight standard and Lane 2 contains the intact 240-bp product Figure 6 illustrates the sequence of the normal (PA) and sickle cell (US) glob in genes in the region of the Dow and HinfI restriction sites, where the single lines for PA mark the position of the Dow site (CTGAG) and the double bars for PA and US mark the position of the HinfI site (GACTC).

Figure 7 illustrates the results of sequential digestion of normal glob in using a Myra probe and Dow followed by HinfI restriction enzymes Figure 8 illustrates the results of sequential digestion of sickle glob in using the same Myra probe as in Figure 7 end Duel followed by HinfI restriction enzymes.

Figure 9 illustrates an auto radiograph of polyacrylamide gel electrophoresis demonstrating the use of the same Myra probe as in Figure 7 to specifically characterize the beta-globin alleles present in samples of whole human DNA which have been subjected to amplification by the present method.

Figure 10 illustrates a photograph of a 6% NuSieve agrees gel visualized using ethidium bromide and US light. This photograph demonstrates amplification of a sub-fragment of a 110-bp amplification product which sub fragment is an inner nested set within the 110-bp fragment.

I lo The term "oligonucleotide" as used herein in referring to primers, probes, oligomer fragments to be detected, oliyomer controls and unlabeled blocking oligomers is defined as a molecule comprised of two or more deoxyribonucleotide or ribonucleotides, preferably more than three. Its exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide.

The term "primer" as used herein refers Jo an oligonucleotide whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an inducing agent such as DNA polymers and at a suitable temperature and phi The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature source of primer and use of the method. For example for diagnostics applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides. For other applications, the oligonucleotide primer is typically shorter, e.g., 7-15 nucleotides. Such short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with template.

The primers herein are selected to be "substantially" complementary to the different strands of each specific sequence to be amplified, This means that the primers must be sufficiently complementary to hybridize with their respective strands. Therefore, 35 the primer sequence need not reflect the exact sequence of the template. For example, a non-compl~mentary nucleated fragment may be 7~3S attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. alternatively, noncomplementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has -sufficient 5 complementarity with the sequence of the strand to be amplified to hybridize therewith and thereby form a template for synthesis of the extension product of the other primer.

As used herein, the terms "restriction endonucleases" and "restriction enzymes" refer to bacterial enzymes each of which cut 10 double-stranded DNA at or near specific nucleated sequence.

As used herein, the term "DNA polymorphism" refers to the condition in which two or more different nucleated sequences can exist at a particular site in DNA.

The term "restriction fragment length polymorphism" ("RFLP") lo refers to the differences among individuals in the lengths of restriction fragments formed by digestion with a particular restriction endonuclease.

The present invention is directed to a process for amplifying any one or more desired specific nucleic acid sequences 20 found in a nucleic acid. Because large amounts of a specific sequence may be produced by this process, the present invention may be used for improving the efficiency of cloning DNA or messenger ROY and for amplifying a target sequence to facilitate detection thereof. The present invention is also useful for obtaining large amounts of the 25 desired sequence from a mixture of nucleic acids resulting from an imperfect chemical synthesis.

In general, the present process involves a chain reaction for producing, in exponential quantities relative to the number of reaction steps involved, at least one specific nucleic acid sequence 30 given (a) that the ends of the required sequence are known in sufficient detail that oligonucleotides can be synthesized which will hybridize to them, and by that a small amount of the sequence is available to initiate the chain reaction. Toe product of the chain reaction will be a discrete nucleic acid duplex with terming 35 corresponding to the ends of the specific primers employed.

I US Any source of nucleic acid, in purified or non purified form, can be utilized as the starting nucleic acid or acids, provided it contains or is suspected of containing the specific nucleic acid sequence desired. Thus, the process may employ, for example, DNA or 5 RNA, including messenger RNA, which DNA or RNA may be single stranded or double stranded. In addition, a DNA-RNA hybrid which contains one strand of each may be utilized. A mixture of any of these nucleic acids may also be employed, or the nucleic acids produced from a previous amplification reaction herein using the same or different 10 primers may be so utilized. The specific nucleic acid sequence to be amplified may be only a fraction of a larger molecule or can be present initially as a discrete molecule, so that the specific sequence constitutes the entire nucleic acid. It is not necessary that the sequence to be amplified be present initially in a pure form;

15 it may be a minor fraction of a complex mixture, such as a portion of the glob in gene contained in whole human DNA or a portion of nucleic acid sequence due to a particular microorganism which organism might constitute only a very minor fraction of a particular biological sample. The starting nucleic acid may contain more than one desired 20 specific nucleic acid sequence which may be the same or different.

Therefore, the present process is useful not only for producing large amounts of one specific nucleic acid sequence, but also for amplifying simultaneously Gore than one different specific nucleic acid sequence located on the same or different nucleic acid molecules.

The nucleic acid or acids may be obtained from any source, for example, from plasmids such as pBR3~2, from cloned DNA or RNA, or from natural DNA or RNA from any source, including bacteria, yeast, viruses, and higher organisms such as plants or animals. DNA or RNA may be extracted from blood, tissue material such as chorionic villa 30 or amniotic cells by a variety of techniques such as that described by Mounts et at., Molecular Cloning ~1982), 280-281.

Any specific nucleic acid sequence can be produced by the present process, It it only necessary that a sufficient number of bases at both ends of the sequence be known in sufficient detail so 35 that two oligonucleotide primers can be prepared which will hybridize I to different strands of the desired sequence and at relative positions along the sequence such that an extension product synthesized from one primer, when it is separated from its template (complement), can serve as a template for extension of the other primer into a nucleic acid of 5 defined length. The greater the knowledge about the bases at both ends of the sequence, the greater can be the specificity of the primers for the target nucleic acid sequence, and thus the greater the efficiency of the process It will be understood that the word primer as used hereinafter may refer to more than one primer particularly in lo the case where where is some ambiguity in the information regarding the terminal sequence(s) of the fragment to be amplified. For instance, in the case where a nucleic acid sequence is inferred from protein sequence information a collection of primers containing sequences representing all possible cordon variations based on 15 degeneracy of the genetic code will be used for each strand. One primer from this collection will be 100% homologous with the end of the desired sequence to be amplified.

The oligonucleotide primers may be prepared using any suitable method, such as, for example, the phosphotriester and phosphodiester methods described above, or automated embodiments thereof. In one such automated embodiment diethylphosphoramidites are used as starting materials and may be synthesized as described by Beau cage et at., Tetrahedron Letters (1981), 22:18~9-186~. One method for synthesizing oligonucleotides on a modified solid support is 25 described in US.

Patent No. 4,458,066. It is also possible to use a primer which has been isolated from a biological source (such as a restriction endonuclease digest).

The specific nucleic acid sequence is produced by using the nucleic acid containing that sequence as a template. If the nucleic acid contains two strands, it is necessary to separate the strands of the nucleic acid before it can be used as the template either as a separate step or simultaneously with the synthesis of the primer extension products. This strand separation can be accomplished by any suitable method including physical, chemical or enzymatic means One physical method of separating the strands of the nucleic acid involves I heating the nucleic acid until it is completely (>99%) denatured.

Typical heat denaturation may involve temperatures ranging from about 80 to 105C for times ranging from about 1 to 10 minutes. Strand separation may also be induced by an enzyme from the classify enzymes 5 known as helicases or the enzyme Recap which has helicase activity and in the presence of riboATP is known to denature DNA. The reaction conditions suitable for separating the strands of nucleic acids with helicases are described by Kuhn Hoffmann-~erling, CSH-Quantitative Biology, 43:63 (197~), and techniques for using Recta are reviewed in 10 C.

Ridding, Ann.

Rev.

Genetics, 16:405-37 (1982).

If the original nucleic acid containing the sequence to be amplified is single stranded, its complement is synthesized by adding one or two oligonucleotide primers thereto. If an appropriate single primer is added, a primer extension product is synthesized in the lo presence of the primer, an inducer or catalyst of the synthesis and the four nucleotides described below. The product will be partially complementary to the single-stranded nucleic acid and will hybridize with the nucleic acid strand to form a duplex of unequal length strands that may then be separated into single strands as described 20 above to produce two single separated complementary strands.

Alternatively, two appropriate primers may be added to the singlestranded nucleic acid and the reaction carried out.

If the original nucleic acid constitutes the sequence to be amplified, the primer extension product(s) produced will be completely 25 complementary to the strands of the original nucleic acid and will hybridize therewith to form a duplex of equal length strands to be separated into single-stranded molecules.

hen the complementary strands of the nucleic acid or acids are separated, whether the nucleic acid was originally double or 30 single stranded, the strands are ready to be used as a template for the synthesis of additional nucleic acid strands. This synthesis can be performed using any suitable method. Generally it occurs in a buffered aqueous solution, preferably at a pi of 7-99 most preferably about 8. Preferably, a molar excess (for cloned nucleic acid, usually I about Lyle primer template and for genomic nucleic acid usually about 106:1 primer template of the two oligonucleotide primers is added to the buffer containing the separated template strands. It is understood, however, that the amount of complementary strand may not be known if the process herein is used for diagnostic applications so 5 that the amount of primer relative to the amount of complementary strand cannot be determined with certainty As a practical matter, however, the amount of primer added will generally be in molar excess over the amount of complementary strand (template) when the sequence to be amplified is contained in a mixture of complicated long-chain 10 nucleic acid strands. A large molar excess is preferred to improve the efficiency of the process.

The deoxyribonucleotide triphosphates date, dCTP, dGTP and TOP are also added to the synthesis mixture in adequate amounts and the resulting solution is heated to about 90-100C for from about 1 to 15 10 minutes, preferably from 1 to 4 minutes. After this heating period the solution is allowed to cool to room temperature, which is preferable for the primer hybridization. To the cooled mixture is added an appropriate agent for inducing or catalyzing the primer extension reaction (herein sailed "inducing agent"), and the reaction 20 is allowed to occur under conditions known in the art. This synthesis reaction may occur at from room temperature up to a temperature above which the inducing agent no longer functions efficiently. Thus, for example, if DNA polymers is used as inducing agent, the temperature is generally no greater than about 40C. Most conveniently the 25 reaction occurs at room temperature.

The inducing agent may be any compound or system which will function to accomplish the synthesis of primer extension products, including enzymes. Suitable enzymes for this purpose include, for example, E. golf DNA polymers I, Clown fragment of E. golf DNA 30 polymers I, To DNA polymers, other available DNA polymerizes, reverse transcripts, and other enzymes, including heat-stable enzymes, which will facilitate combination of the nucleotides in the proper manner to form the primer extension products which are complementary to each nucleic acid strand. Generally, the synthesis I will be initiated at the 3' end of each primer and proceed in the 5' direction along the template strand, until synthesis terminates, producing molecules of different lengths. There may be inducing agents, however, which initiate synthesis at the 5' end and proceed in the other direction, using the same process as described above.

The newly synthesized strand and its complementary nucleic acid strand form a double-stranded molecule which is used in the succeeding steps of the process. In the next step, the strands of the double-stranded molecule are separated using any of the procedures 10 described above to provide single-stranded molecules.

New nucleic acid is synthesized on the single-stranded molecules. Additional inducing agent, nucleotides and primers may be added if necessary for the reaction to proceed under the conditions prescribed above. Again, the synthesis will be initiated at one end 15 of the oligonucleotide primers and will proceed along the single strands of the template to produce additional nucleic acid. After this step, half of the extension product will consist of the specific nucleic acid sequence bounded by the two primers.

The steps of strand separation and extension product 20 synthesis can be repeated as often as needed to produce the desired quantity of the specific nucleic acid sequence. As will be described in further detail below the amount of the specific nucleic acid sequence produced will accumulate in an exponential fashion.

When it is desired to produce more than one specific nucleic 25 acid sequence from the first nucleic acid or mixture of nucleic acids, the appropriate number of different oligonucleotide primers are utilized. For example, if two different specific nucleic acid sequences are to be produced, four primers are utilized.

Two of the primers are specific for one of the specific nucleic acid sequences 30 and the other two primers are specific for the second specific nucleic acid sequence. In this manner, each of the two different specific sequences can be produced exponentially by the present process.

The present invention can be performed in a step-wise fashion where after each step new reagents are added, or ~37~ 13 simultaneously, where all reagents are added at the initial step, or partially step-wise end partially simultaneous, where fresh reagent is added after a given number of steps. If a method of strand separation, such as heat, is employed which will inactivate the 5 inducing agent as in the case of a heat-labile enzyme, then it is necessary to replenish the inducing agent aster every strand separation step.

The simultaneous method may be utilized inn an enzymatic means is used for the strand separation step. In the simultaneous procedure, the reaction mixture may contain, in addition 10 to the nucleic acid strands) containing the desired sequence the strand-separating enzyme (e.g., helicase), an appropriate energy source for the strand-separating enzyme, such as rat, the four nucleotides, the oligonucleotide primers in molar excess, and the inducing agent, e.g., Clown fragment of E. golf DNA pol~nerase I. If heat is used for denaturation in a simultaneous process, a heat-stable inducing agent such as a thermos table polymers may be employed which will operate at an elevated temperature, preferably 65-90C depending on the inducing agent at which temperature the nucleic acid will consist of single and double strands in equilibrium. For smaller lengths ox nucleic acid, lower temperatures of about 50~C may be employed. The upper temperature will depend on the temperature at which the enzyme will degrade or the temperature above which an insufficient level of primer hybridization will occur. Such a heatstable enzyme is described, ego, by A. S.

Kale din et at., Become, 45, 644-651 (~980)D Each step of the process will occur sequentially notwithstanding the initial presence of all the reagents. Additional materials may be added as necessary. After the appropriate length of time has passed to produce the desired amount of the specific nucleic acid sequence, the reaction may be halted by inactivating the enzymes in any known manner or separating the components of the reaction.

The process of the present invention may be conducted continuously. In one embodiment of an automated process, the reaction may be cycled through a denaturing region, a reagent addition region, and a reaction region.

In another embodiment, the enzyme used for the synthesis of primer extension products can be immobilized in a column.

I 5 14 The other reaction components can be continuously circulated by a pump through the column and a heating coil in series, thus the nucleic acids produced can be repeatedly denatured without inactivating the ensign.

The present invention is demonstrated diagrammatically below - where double-stranded DNA containing the desired sequence [S] comprised of complementary strands [S+] and [S ] is utilized as the nucleic acid During the first and each subsequent reaction cycle extension of each oligonucleotide primer on the original template will lo produce one new ssDNA molecule product of indefinite length which terminates with only one of the primers. These products, hereafter referred to as "long products," will accumulate in a linear fashion;

that is, the amount present after any number of cycles will be proportional to the number of cycles.

The long products thus produced will act as templates for one or the other of the oligonucleotide primers during subsequent cycles and will produce molecules of the desired sequence [S+} or So These molecules will also function as templates for one or the other of the oligonucleotide primers, producing further [S+] and So and 20 thus a chain reaction can be sustained which will result in the accumulation of [S] at an exponential rate net dti Ye to the number of cycles.

By-products formed by oligonucleotide hybridizations other than those intended are not self-catalytic (except in rare instances) us and thus accumulate at a linear rate.

The specific sequence to be amplified, US], can be depicted diagrammatically as:

[S+] 5' AXE 3' [S-] 3' TWIG 5' 30 The appropriate oligonucleotide primers would be:

Primer 1: GGGGGGGGGG Primer 2: AYE so that if DNA containing [S] ....zzzzzzzzzz2zzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCChihuahuas....

zzzzzzz2zzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzzz~ is separated into single strands and its single strands are hybridized 5 to Primers 1 and 2, the following extension reactions can be catalyzed - by DNA polymers in the presence of the four deoxyribonucleotide triphosphates:

3' 5' extends C - - GGGGGGGGGG Primer 1 SiouxChihuahuas....

lo original template strand+ original template strand stagGzzzzzzzzzzzzzzzz....

Primer 2 AYE > extends 5' 3' On denaturation of the two duplexes formed, the products are:

3' 5' stagG newly synthesized long product 1 5' 3' 20 SiouxChooses....

original template strand+ 3' 5' ~o~zzzzzzzzzzzzzzzzTTTTrrTTTTYYYYYYYYYYGGGGGGGGGG original template strand I 5' 3' Axis.....

newly synthesized long product 2 If these four strands are allowed to reboards with Primers 1 and 2 in the next cycle, inducing agent will catalyze the following reactions:

16 Primer 2 5' AYE - - - extends to here stagGGGGG 5' newly synthesized long product 1 extends GGGGGGGGGG S' Primer 1 5SiouxChihuahuas' - original template strand+ Primer 2 5' AYE extends 3'.~..zzzzzzzzzzzzzzz2zzTTTTTTTTTTYYYYYYYYYGGGGGGGGGGGzzzzzzzzzz....5' original template strand lo extends to here - GGGGGGGGGG 5' Primer 1 5'Axis'' newly synthesized long product 2 If the strands of the above four duplexes are separated, the following strands are found:

5' AXE 3' newly synthesized [So] stagGGGGGG 5' first cycle synthesized long product 1 3'....zzzzzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYG6GGGGGGGGG 5' 20 newly synthesized long product 1 SiouxCCCCCCzzzzzzzzz....3' original template strand+ 5'Axis3' newly synthesized long product 2 25stuccozzzzzzzzzzzzzzzz...5' original template strand3' TWIG 5' newly synthesized [So] 5' Axis' first cycle synthesized long product 2 I It is seen that each strand which terminates with the oligonucleotide sequence of one primer and the complementary sequence of the other is the specific nuclei acid sequence [So that is desired to be produced.

The steps of this process can be repeated indefinitely, being limited only by the amount of Primers 1 and 2, inducing agent and nucleotides present.

The amount of original nucleic acid remains constant in the entire process, because it is not replicated.

The amount of the long products increases linearly because they are 10 produced only from the original nucleic acid The amount of the specific sequence increases exponentially. Thus the specific sequence will become the predominant species. This is illustrated in the following table, which indicates the relative amounts of the species theoretically present after n cycles, assuming 100% efficiency 15 at each cycle:

Number of Double Strands After 0 to n Cycles Long Specific Cycle Number Template Products Sequence [S] 29 0 0 2 1 2 3 1 3 4 1 5 26 25 10 1 lo 1013 1 15 32,752 1 20 1,048,555 n 1 n (2n-n-1~ When a single-stranded nucleic acid is utilized as the template, only 30 one long product is formed per cycle.

~L~37~35 18 The method herein may be utilized to clone a particular nucleic acid sequence for insertion into a suitable expression vector The vector may then be used to transform an appropriate host organism to produce the gene product of the sequence by standard 5 methods of recombinant DNA technology.

In addition, the process herein can be used for in vitro mutagenesis. The oligodeoxyribonucleotide primers need not be exactly complementary Jo the DNA sequence which is being amplified. It is only necessary that they be able to hybridize to the sequence 10 sufficiently well to be extended by the polymers enzyme or by whatever other inducing agent is employed. The product ox a polymers chain reaction wherein the primers employed are not exactly complementary to the original template will contain the sequence of the primer rather than the template, thereby introducing an in vitro 15 mutation In further cycles this mutation will be amplified with an undiminished efficiency because no further mispaired priming are required. The mutant thus produced may be inserted into an appropriate vector by standard molecular biological techniques and might confer mutant properties on this vector such as the potential 20 for production of an altered protein.

The process of making an altered DNA sequence as described above could be repeated on the altered DNA using different primers so as to induce further sequence changes. In this way a series of mutated sequences could gradually be produced wherein each new 25 addition to the series could differ from the last in a minor way, but from the original DNA source sequence in an increasingly major way.

In this manner changes could be made ultimately which were not feasible in a single step due to the inability of a very seriously mismatched primer to function.

In addition, the primer can contain as part of its sequence a non-complementary sequence provided that a sufficient amount of the primer contains a sequence which is complementary to the strand to be amplified.

For example, a nucleated sequence which is not complementary to the template sequence (such as, e.g., a promoter, I 19 linker coding sequence, etc.) may be attached at the I' end of one or both of the primers, and thereby appended to the product of the amplification process. After the extension primer is added, sufficient cycles are run to achieve the desired amount of new S template containing the non-complementary nucleated insert.

This allows production of large quantities of the combined fragments in a relatively short period of time (e.g., two hours or less) using a simple technique.

The method herein may also be used to enable detection 10 and/or characterization of specific nucleic acid sequences associated with infectious diseases genetic disorders or cellular disorders such as cancer. Amplification is useful when the amount of nucleic acid available for analysis is very small, as, for example, in the prenatal diagnosis of sickle cell anemia using DNA obtained from fetal cells.

15 Amplification is particularly useful if such an analysis is to be done on a small sample using non-radioactive detection techniques which may be inherently insensitive, or where radioactive techniques are being employed but where rapid detection is desirable.

For purposes of this invention genetic diseases may include 20 specific deletions and/or mutations in genomic DNA from any organism, such as, e.g., sickle cell anemia, cystic fibrosis ~-thalessemia3 Ithalessemia, and the like. Sickle cell anemia can be readily detected via oligomer restriction analysis or a RFLP-like analysis following amplification of the appropriate DNA sequence by the present method.

25 a-Thalessemia can be detected by the absence of a sequence, and I thalessemia can be detected by the presence of a polymorphic restriction site closely linked to a mutation which causes the disease.

All of these genetic diseases may be detected by amplifying 30 the appropriate sequence and analyzing it by southern blots without using radioactive probes. In such a process, for example a small sample of DNA from, erg., amniotic fluid containing a very low level of the desired sequence is amplified, cut with a restriction enzyme, and analyzed via a Southern blotting technique. The use of non 6~5 radioactive probes is facilitated by the high level of the amplified signal.

In another embodiment a small sample of DNA may be amplified to a convenient level and then a further cycle of extension reactions 5 performed wherein nucleated derivatives which are readily detectable such as 32P-labeled or button labeled nucleoside triphosphates) are incorporated directly into the final DNA product, which may be analyzed by restriction and electrophoretic separation or any other appropriate method. An example of this technique in a model system is 10 demonstrated in Figure 5.

In a further embodiment demonstrated in a model system in Figure 3, the nucleic acid may be exposed to a particular restriction endonuclease prior to amplification. Since a sequence which has been cut cannot be amplified, the appearance of an amplified fragment, 15 despite prior restriction of the DNA sample, implies the absence of a site for the endonuclease within the amplified sequence. The presence or absence of an amplified sequence can be detected by an appropriate method.

A practical application of this technique can be illustrated 20 by its use in facilitating the detection of sickle cell anemia via the oligomer restriction technique described herein below and by R.

Seiko et at., Bio/Technolo~v, 3:1008-1012 (1985). Sickle cell anemia is a hemoglobin disease which is caused by a single base pair change in the sixth cordon of the glob in gene Figure 6 illustrates the sequences 25 of normal and sickle cell glob in genes in the region of their polymorphism, where the single bars mark the location of a Dow site present only in the normal gene and where the double bars mark the location of a HlnfI site which is non-polymorphic and thus present in both the normal and sickle cell alleles. Figure 7 illustrates the 30 process of oligomer restriction of normal glob in DNA using a probe spanning both restriction sites and labeled where the asterisk appears. The DNA, amplified as provided herein, is denatured and annealed to the labeled probe. The enzyme Dow cleaves the DNA at the reformed Dow site and generates a labeled octamer~ Under the ~3'7~ conditions used in the test the octamer is short enough to dissociate from the duplex The subsequent addition of the enzyme HinfI has no effect on the now single-stranded octamer. Figure 8 illustrates the same process applied to the sickle cell allele of glob in EDNA The 5 enzyme Dow cannot cleave the duplex formed by the amplified DNA and the labeled probe because of the A-A base pair mismatch. The enzyme HlnfI, however, does restrict the hybrid and a labeled triter is produced. In practice the method can diagnose the DNA of an individual as being either homozygous for the wild type, homozygous 10 for the sickle type or a heterozygous carrier of the sickle cell trait, since a specific signal is associated with the presence of either allele. Use of this above-described method to amplify the pertinent sequence allows for a rapid analysis of a single copy gene using a probe with only a single 32p label.

Various infectious diseases can be diagnosed by the presence in clinical samples of specific DNA sequences characteristic of the causative microorganism. These include bacteria, such as Salmonella, Chlamydia, Nasser; viruses, such as the hepatitis viruses, and protozoan parasites, such as the Plasm odium responsible for malaria.

20 US.

Patent 4,358,535 issued to Fallow describes the use of specific DNA hybridization probes for the diagnosis of infectious diseases. A problem inherent in the Fallow procedure is that a relatively small number of pathogenic organisms may be present in a clinical sample from an infected patient and the DNA extracted from these may 25 constitute only a very small fraction of the total DNA in the sample. Specific amplification of suspected sequences prior to immobilization and hybridization detection of the DNA samples could greatly improve the sensitivity and specificity of these procedures.

Routine clinical use of DNA probes for the diagnosis of 30 infectious diseases would be simplified considerably if nonradioactively labeled probes could be employed as described in EN ~3,879 to Ward. In this procedure biotin-containing DNA probes are detected by chromogenic enzymes linked to avid in or biotin-specific antibodies. This type of detection is convenient, but relatively insensitive. The combination of specific DNA amplification by the ~3'7~ present method and the use of stably labeled probes could provide the convenience and sensitivity required to make the Fallow and Ward procedures useful in a routine clinical setting.

The amplification process can also by utilized to produce S sufficient quantities of DNA from a single copy human gene such that detection by a simple non-specific DNA stain such as ethidium bromide can be employed so as to make a DNA diagnosis directly.

In addition to detecting infectious diseases and pathological abnormalities in the gnome of organisms, the process 10 herein can also be used to detect DNA polymorphism which may not be associated with any pathological state.

The following examples are offered by way of illustration and are not intended to limit the invention in any manner. In these examples all percentages are by weight if for solids and by volume if 15 for liquids and all temperatures are in degrees Celsius unless otherwise noted.

EXAMPLE 1 A 25 base pair sequence having the nucleated sequence 5' CCTCGGCACCGTCACCCTGGATGCT 3' 3' GGAGCCGTGGCAGTGGGACCTACGA 5' contained on a 47 base pair Foci restriction fragment of pBR322 obtainable from ATTICS was prepared as follows. A Foci digest of pBR322 containing the 47-bp fragment was produced by digesting pBR322 with Foci in accordance with the conditions suggested by the supplier, New England Bulbs Inc. The primers which were utilized were 5' d(CCTCGGCACCG) 3' and 5' d(AGCATCCAGGGTG) 3', and were prepared using conventional techniques. The following ingredients were added to 33 I of buffer which consisted of 25 my potassium phosphate, 10 my magnesium chloride and 100 my sodium chloride at pi 7.5: 2433 poles 39 of each of the primers described above, 2.4 poles of the Foci digest of pBR322, 12 moles of date, 22 moles of dCTP9 19 moles of dGTP and 10 moles of Typo I The mixture was heated to 85C for five minutes and allowed to cool to ambient temperature. Five units of the Clown fragment of E. golf DNA polymers I were added and the temperature was maintained for 15 minutes. After that time the mixture was again heated to 85~C for five minutes end allowed to cool Five units of the Clown fragment were again added and the reaction was carried out for 15 minutes. The heating, cooling and synthesis steps were repeated eleven more times After the final repetition, a 5 Al Alcott was removed from 10 the reaction mixture. This was heated to 85C for three minutes and allowed to cool to ambient temperature. 12.5 poles ox ape _ deoxycytidine triphosphate and 5 units of Clown fragment were added and the reaction was allowed to proceed or 15 minutes. The labeled products were examined by polyacrylamide gel electrophoresis. The Foci digest was labeled in a similar fashion and served as a control and molecular weight markers. The only heavily labeled band visible after the 13 cycles was the intended 25 base pair sequence.

EXAMPLE 2 The desired sequence to be amplified was a 94 base pair sequence contained within the human beta-globin gene and spanning the MstII site involved in sickle cell anemia. The sequence has the nucleated sequence shown in Figure 1.

I. Synthesis ox Primers The following two oligodeoxyribonucleotide primers were 2; prepared by the method described below:

5' CACAGGGCAGTAACG 3' Primer A and 5' TTTGCTTCTGACACA 3' Primer B Automated Synthesis Procedures: The diethylphosphoramidites, synthesized according to Beau cage and Caruthers (Tetrahedron Letters (1981) 22:1859-1862) were sequentially condensed to a nucleoside derivatized controlled pore glass support 24 using a Biosearch SAM-1. The procedure included detritylation with trichloroacetic acid in dichloromethane, condensation using benzotria~ole as activating proton donor, and capping with acetic android and dimethylaminopyridine in tetrahydrofuran and pardon.

5 Cycle time was approximately 30 minutes. Yields at each step were essentially quantitative and were determined by collection and spectroscopic examination of the dimethoxytrityl alcohol released during detritylation.

Oligodeoxyribonucleotide Deprotection and Purification 10 Procedures: The solid support was removed from the column and exposed to 1 ml concentrated ammonium hydroxide at room temperature for four hours in a closed tube. The support was then removed by filtration and the solution containing the partially protected oligodeoxynucleotide was brought to 55~C for five hours. ammonia was 15 removed and the residue was applied to a preparative polyacrylamide gel. Electrophoresis was carried out at 30 volts/cm for 90 minutes after which the band containing the product was identified by US shadowing of a fluorescent plate. The band was excised and eluded with 1 ml distilled water overnight at 4C. This solution was applied 20 to an Attach RP18 column and eluded with a 7-13% gradient of acetonitrile in 1% ammonium acetate buffer at pi 6Ø The elusion was monitored by US absorbency at 260 no and the appropriate fraction collected, quantitated by Us absorbency in a fixed volume and evaporated to dryness at room temperature in a vacuum centrifuge.

Characterization of Oligodeoxyribonucleotides: Test allocates of the purified oligonucleotides were 32p labeled with polynucleotide Cannes and POTPIE.

The labeled compounds were examined by auto radiography of 14-20% polyacrylamide gels after electrophoresis for 45 minutes at 50 volts/cm.

This procedure 30 verities the molecular weight. Base composition was determined by digestion of the oligodeoxyribonucleotide to nucleosides by use of venom dusters and bacterial alkaline phosphates and subsequent separation and quar,titation of the derived nucleosides using a reverse phase H~LC column and a 10% acetonitrile, 1% ammonium acetate mobile 35 phase.

~3'7~5 II. Source of DNA A Extraction of Whole Human Wild-T~pe_DNA .

Human genomic DNA homozygous for normal glob in was extracted from the cell line Molt (obtained from Human Genetic Mutant 5 Cell Repository and identified as G~2219c) using the technique described by Stealer et Allah Pro. Nat. Aged. Sat. ~1982), 79:59665970~ B. Construction of Cloned Glob in Genes A 1.9 kb Bohemia fragment of the normal glob in gene was 10 isolated from the cosmic pFC11 and inserted into the Bohemia site of pBR328 (Siberian, et at., Gene (1980) 9:287-305). This fragment, which encompasses the region that hybridizes to the synthetic Myra probe, includes the first and second eons, first intro, and 5' flanking sequences of the gene (Lawn et at., Cell (1978), 15:1157-1174). Tins 15 clone was designated pBR328:HbA and deposited under ATTICS No. 39,698 on May 25, 1984.

The corresponding 1.9 kb Bohemia fragment of the sickle cell allele of glob in was isolated from the cosmic pFC12 and cloned as described above. This clone was designated pBR328:HbS and deposited 20 under ATTICS No> 39,699 on May 259 1984.

Each recombinant plasm id was transformed into and propagated in E. golf M~294 (ATTICS No. 39,607).

C. Digestion of Cloned Go on Genes w _ h MstII A total of 100 go each of pBR328:HbA and pBR328:HbS were 25 individually digested with 20 units of sty (New England Bulbs) for 16 hours at 37C in 200 Al of 150 my Nail, 12 my Trip Hal (pi 7.5), 12 my McCauley 1 my dithiothreitol (DOT), and 100 gel bovine serum albumin (BRA). The products are designated pBR328:HbA/MstII and pBR328:HbS/MstlI, respectively.

26 III.

Polymers Chain Reaction To 100 Al of buffer consisting of 60 my sodium acetate 30 my Trip acetate and 10 my magnesium acetate at pi 8.0 was added 2 Al of a solution containing 100 picomoles of Primer A (of the sequence 5 d(CACAGGGCACTAACG)), 100 picomoles of Primer B (of the sequence d(TTTGCTTCTGACACA)) and 1000 picomoles each of date, dCTP, dGTP and TOP. In addition, one of the following sources of DNA described above was added:

10 It whole human wild-type DNA (Reaction I) 0.1 picomole pBR328:HbA (Reaction II) 0~1 picomole pBR328:HbS reaction III) 0.1 picomole pBR328:HbA/MstII (Reaction IV) 0.1 picomole pBR328:HbS/MstII (Reaction V) No target DNA (Reaction VI) Each resulting solution was heated to 100C for four minutes and allowed to cool to room temperature for two minutes, whereupon 1 Al containing four units of Clown fragment of E. golf DNA polymers was added. Each reaction was allowed Jo proceed for 10 minutes, after which the cycle of adding the primers, nucleotides and DNA, heating 20 cooling adding polymers, and reacting was repeated nineteen times for Reaction I and four times for Reactions II-VI.

Four micro liter allocates of Reactions I and II removed before the first cycle and after the last cycle of each reaction were applied to a 12~ polyacrylamide gel 0.089 M in Tris-borate buffer at 25 pi 8.3 and 2.5 my in ETA. The gel was electrophoresed at 25 volts/cm for four hours, transferred to a nylon membrane serving as solid phase support and probed with a 5'-3~P-labeled 40 by synthetic fragment prepared by standard techniques, of the sequence 5'd(TCCTGA6GAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAG~3' 30 in 30~ formamide, 3 x SPY, 5 x Denhardt's, 5% sodium dodecyl sulfate at pi 7.4. Figure 2 is an auto radiograph of the probed nylon membrane for Reactions I and II.

Lane 1 is 0.1 picomole of a 58-bp synthetic fragment control one strand of which is complementary to the above probe. Lane 2 is 4 Al of Reaction I prior to the first amplification cycle Lane 3 is 4 Al of Reaction I after the Thea amplification cycle. Lane 4 is 4 Al of Reaction II after five amplification 5 cycles. Lane 5 is a molecular weight standard consisting of a Foci - new England Bulbs) digest of pBR322 new England Bulbs) labeled with alpha-32P-dNTPs and polymers. Lane 3 shows that after twenty cycles the reaction mixture I contained a large amount of the specific sequence of the proper molecular weight and no other detectable 10 products. Reaction mixture II after five cycles also contained this product, as well as the starting nucleic acid and other products, as shown by Lane 4.

To 5.0 Al allocates of Reactions II-VI after the fourth cycle were added 5 poles of each primer described above. The solutions 15 were heated to 100C for four minutes and allowed to equilibrate to room temperature. Three poles each of alpha-32P-dATP, alpha-32PdCTP, alpha-32P-dGTP and alpha-32P-TTP and four units of Clown fragment were added. The reaction, in a final volume of 10 Al and at the salt concentrations given above, was allowed to proceed for 10 20 minutes. The polymers activity was terminated by heating for 20 minutes at 60~C. Four Al allocates of Reactions II-VI were loaded onto a 12% polyacrylamide gel 0.089 M in Tris-borate buffer at pi 8.3 and 2.5 my in ETA. The gel was electrophoresed at 25 volts/cm for four hours after which auto radiography was performed.

Figure 3 is an auto radiograph of the electrophoresis.

Lane 1 is a molecular weight standard, Lane 2 is Reaction II, Lane 3 is Reaction III, Lane 4 is Reaction IV and Lane 5 is Reaction V.

Another lane for Reaction VI with no DNA as control had no images in any of the lanes.

It can be seen from the figure that the 94-bp fragment 30 predicted from the target DNA was present only where intact glob in DNA sequences were available for amplification, i.e., pBR328:HbA (Lane 2), pBR328:HbS (Lane 3) and pBR328.HbS/MstII (Lane 5). MstII digestion cuts pBR328:HbA in the Myra sequence rendering it incapable of being amplified, and the Myra band does not appear in 35 Lane 4.

In contrast, the Myra sequence in pBR328:HbS does not cut ~L~3~5 28 when the plasm id is digested with MstII and thus is available for amplification as shown in Lane 5.

Figure 4 illustrates the chain reaction for three cycles in amplifying the 94-bp sequence. Pool and PC02 are Primers A and B.

5 The numbers on the right indicate the cycles whereas the numbers on - the left indicates the cycle number in which a particular molecule was produced.

EXAMPLE 3 This example illustrates amplification of a 110 by sequence 10 spanning the allelic MstII site in the human hemoglobin gene.

A total of 1.0 microgram whole human EDNA 100 picomoles d(ACACAACTGTGTTCACTAGC) and 100 picomoles d(CAACTTCATCCACGTTCACC) the primers having been prepared by the technique of Example 2, were dissolved in 100 Al of a solution which was:

IS 1.5 my in each of the four deoxyribonucleotide triphosphates 30 my in Trip acetate buffer at pi 7.9 60 my in sodium acetate 10 my in magnesium acetate 0.25 my in dithiothreitol The solution was heated to 100C for one minute and brought rapidly to 25C for one minute, after which was added 2.5 units Clown fragment of DNA polymers.

The polymers reaction was allowed to proceed for two minutes at 25C, after which the cycle of heating, cooling, adding Clown, and reacting was repeated as often as desired.

With a 70% efficiency at each cycle, 15 cycles resulted in the synthesis of 104 femtomoles of the desired 110 by fragment of the glob in gene.

~3'7~ 29 EXAMPLE 4 This example illustrates amplification of a 240 by sequence spanning the allelic MstII site in the human hemoglobin gene. This sequence contains NcoI, HinfI and MstII restriction sites.

To 100 Al of a mixture of 60 my sodium acetate, 30 my Trip acetate and 10 my magnesium acetate at pi 8.0 containing 0.1 pole pBR328:HbA was added 2 Al of Solution A containing:

100 poles d(GGTTG&CCAATCTACTCCCAGG~ primer 100 poles d(TAACCTTGATACCAAGCTGCCC) primer 1000 poles each of date, dCTP, dGTP and TOP The two primers were prepared by the technique described in Example 2. The solution was heated to 100~C for four minutes and allowed to cool in ambient air for two minutes, after which was added 1 Al containing four units Clown fragment of E. golf DNA 15 polymers. The reaction was allowed to proceed for 10 minutes after which the cycle of solution A addition, heating, cooling, adding polymers, and reacting was repeated three times. To a 5.0 Al Alcott of the reactions was added 5 picomoles of each oligonucleotide primer described above. The solution was heated to 100C for four 20 minutes and allowed to come to ambient temperature, after which 3 picomoles each of the alpha-32P-labeled deoxyribonucleotide triphosphates and 4 units Clown fragment were added. The reaction, in a final volume of 10 Al and at the salt concentrations given above, was allowed to proceed for 10 minutes. The polymers activity was 25 terminated by heating for 20 minutes at 60C. Two Al allocates were digested with NcoI, MstII, or HlnfI and loaded onto a 12% polyacrylamide gel 0.089 M in Tris-borate buffer at pi 8.3 and 2.5 my if, ETA. The gel was electrophoresed at 25 volts/cm for four hours and auto radiography was performed. Figure 5 illustrates the 30 auto radiograph of the electrophoresis, where Lane 1 is the molecular weight standard, Lane 2 is without digestion with enzyme (240 by intact), Lane 3 is digestion with NcoI (131 and 109 by), Lane 4 is digestion with M II (149 and 91 by), and Lane 5 is digestion with HinfI (144 and 96 by). The auto radiograph is consistent with the amplification of the 240 by sequence.

EXAMPLE This example illustrates use of the process herein to detect 5 sickle cell anemia by sequential digestion Synthesis and Yh_sphorylation of Oligodeoxyribonucleotides A labeled DNA probe, RS06, of the sequence:

5' *CTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGG 3' where * indicates the label, and an unlabeled blocking oligomer, RS10, 10 of the sequence 3' GACAGAGGTCACCTCTTCAGACGGCAATGACGGGACACCC 5' which has three base pair mismatches with RS06 were synthesized according to the procedures provided in Example I The probe RS06 was labeled by contacting five pole thereof with 4 units of To 15 polynucleotide Cannes (New England Bulbs) and 50 pole POTPIE (New England Nuclear, about 7200 Somali) in a 40 Al reaction volume containing 70 my Trip buffer (pi 7.6), 10 my McCoy, 1.5 my spermine, and 2.5 my dithiothreitol or 90 minutes at 37C. The total volume was then adjusted to 100 Al with 25 my ETA and purified according to 20 the procedure of Mounts et at., Molecular Cloning (1982), 464-465 over a 1 ml Boo Gel P-4 spin dialysis column from Byrd equilibrated with Tris-EDTA (TO) buffer (10 my Trip buffer, 0.1 my ETA, pi 8.0).

The labeled probe was further purified by electrophoresis on a 18% polyacrylamide gel (19:1 acrylamide:BIS, Byrd) in Tris-boric acid25 ETA (TUBE) buffer (89 my Trip, 89 my boric acid, 2.5 my ETA, pi pharaoh 500 vhr. After localization by auto radiography, the portion of the gel containing the labeled probe was excised, crushed and eluded into 0.2 ml TO buffer overnight at 4C. TEA precipitation of the reaction product indicated that the specific activity was 4.9 Somali 30 and the final concentration was 20 pmole/ml.

The unlabeled RS10 blocking oligomer was used at a concentration of 200 pmole/ml.

ok Isolation of Human Genomic DNA from Cell Lines High molecular weight genomic DNA was isolated from the lymphoid cell lines Molt, SC-1 and GM2064 using essentially the method of Stealer et at. 9 PEAS (1982), 79, 5966-5970 (for Molt) and 5 Mounts et at., Molecular Cloning (1982), 280-281.

Molt (Human Mutant Cell Repository, GM2219C) is a T cell line homo7ygous for normal glob in and SC-1, deposited with ATTICS on March 19, 1985, is an EBV-transformed B cell line homozygous for the sickle cell allele. GM2064 (Human Mutant Cell Repository, GM2064) was 10 originally isolated from an individual homozygous for hereditary persistence of fetal hemoglobin (HPFH) and contains no beta- or deltaglob in gene sequences. All cell lines were maintained in RPMI-1640 with 10% fetal calf serum.

Isolation of Human Genomic DNA from Clinical Blood Samples A clinical blood sample designated SHEA From a known sickle cell carrier (AS) was obtained from Dr. Bert ram Lyon of Children's Hospital in Oakland, California Genomic DNA was prepared from the bully coat fraction, which is composed primarily of peripheral blood lymphocytes using a modification of the procedure described by Nun berg et at., Pro.

Nat.

Aged.

Sue 75, 5553-5556 (1978).

_ The cells were resuspended in 5 ml Tris-EDTA-NaCl (TEN) buffer (10 my Trip buffer pi 8, 1 my ETA, 10 my Nail) and adjusted to 0.2 mg~ml protons K, 0.5% SDS, and incubated overnight at 37C.

Sodium per chlorate was then added to 0.7 M and the Lucite gently shaken for 1-2 hours at room temperature. The Lucite was extracted with 30 ml phenol/chloroform (1:1), then with 30 ml chloroform, and followed by ethanol precipitation of the nucleic acids. The pellet was resuspended in 2 ml of TO buffer and RNase A added to 0.005 mg/ml. After digestion for one hour at 37C, the DNA was extracted 30 once each with equal volumes of phenol, phenol/chloroform, and chloroform, and ethanol precipitated. The DNA was resuspended in 0.5 ml TO buffer and the concentration was determined by absorbency at 260 no.

I 32 Polymers Chain Reaction to Amplify Selectively Glob in Sequences _ Two micrograms of genomic DNA was amplified in an initial 100 Al reaction volume containing 10 my Trip buffer (pi 7.5), 50 my Nail, 10 my McCauley, 150 pole of Primer A of the sequence 5 d(CACAGGGCACTAACG~, and lS0 pole of Primer B of the sequence d(CTTTGCTTCTGACACA) and overplayed with about 100 Al mineral oil to prevent evaporation.

Each DNA sample underwent 15 cycles of amplification where one cycle is composed of three steps:

1) Denature in a heat block set at 95C for two minutes.

2) Transfer immediately to a heat block set at 30C for two minutes to allow primers and genomic DNA to anneal.

3) Add 2 Al of a solution containing 5 units of the Clown fragment of E. golf DNA polymers I (New England Bulbs 1 mole 15 each of date, dCTP, dGTP and TOP, in a buffer composed of 10 my Trip (pi 7~5~, 50 my Nail, 10 my McCauley, and 4 my dithiothreitol, This extension reaction was allowed to proceed for 10 minutes at 30C.

After the final cycle, the reaction was terminated by heating at 95C for two minutes. The mineral oil was extracted with 20 0.2 ml of chloroform and discarded. The final reaction volume was 130 I .

Hybridization/Digestion of Amplified Genomic DNA with Probes and DdeI/HinfI Forty-five micro liters of the amplified genomic DNA was 25 ethanol precipitated and resuspended in an equal volume of TO buffer. Ten micro liters (containing the pre-amplification equivalent of 154 no of genomic DNA) was dispensed into a 1.5 ml Microphage tube and 20 Al of TO buffer to a final volume of 30 Al. The sample was overplayed with mineral oil and denatured at 95C for 10 minutes. Ten 30 micro liters of 0.6 M Nail containing 0.02 pole of labeled RS06 probe was added to the tube, mixed gently, and immediately transferred to a 56C heat block for one hour Four micro liters of unlabeled RS10 ~3'7~ 33 blocking oligomer (0.8 pole) was added and the hybridization continued for an additional 10 minutes at the same temperature. Five micro liters of 60 my Mgcl2/o.l% BRA and 1 ill of Dow (10 units, New England Bulbs) were added and the Ronald DNA was digested for 30 5 minutes at 56~C. One micro liter of HinfI (10 units, ow England Bulbs) was then added and incubated for another 30 minutes. The reaction was stopped by the addition of 4 Al 75 my ETA and 6 Al tracking dye to a final volume of 61 Al.

The mineral oil was extracted with 0.2 ml chloroform, and 18 10 Al of the reaction mixture (45 no genomic EDNA was loaded onto a 30% polyacrylamide mini-gel (19:1, Boo Red) in a Hoofer SUE apparatus. The gel was electrophoresed at approximately 300 volts for one hour until the bromphenol blue dye front migrated to 3.0 cm offorigin. The top 1.5 cm of the gel was removed and the remaining gel 15 was exposed for four days with one intensification screen at -70C.

Discussion of Auto radiograph (Figure 9) Each lane contains 45 no of amplified genornic DNA. Lane A contains owlet DNA, Lane B, CM12; Lane C, SC-l; and Lane D, GM2064.

Molt represents the genotype of a normal individual with two copies 20 of the PA gene per cell (AA), SHEA is a clinical sample from a sickle cell carrier with one PA and one US gene per cell (AS, and SC-1 represents the genotype of a sickle cell individual with two copies of the US gene per cell (SO). GM2064, which contains no beta- or delta-globin sequences, is present as a negative control.

As seen in the autoradiogram, the DdeI-cleaved, Specific octamer is present only in those DNA's containing the PA gene (Lanes A and B) and the H7nfI-cleaved, Specific triter is present only in those DNA's containing the US gene (Lanes B end C).

The presence of both triter and octamer (Lane B) is diagnostic for a sickle cell 30 carrier and is distinguishable from a normal individual (Lane A) with only octamer and a sickle cell afflicted individual (Lane C) with only triter.

I 34 As a comparison, repeating the experiment described above using non-amplified genomic DNA revealed that the amplification increased the sensitivity of detection by at least 1000 fold.

EXAMPLE 6 This example illustrates direct detection of a totally unpurified single copy gene in whole human DNA on gels without the need for a labeled probe.

Using the technique described in Example 39 a 110-bp fragment from a sequence in the first eon of the beta~globin gene was 10 amplified from 10 micrograms of whole human DNA after 20 cycles. This 110-bp fragment produced after 20 cycles was easily visualized on gels stained with ethidium bromide.

The sequence was not amplified when it was first cut with the restriction enzyme Dow unless, as in the beta-globin S allele, 15 the sequence does not contain the restriction site recognized by the enzyme.

EXAMPLE 7 A. A total of 100 moles pBR328 containing a 1.9 kb insert from the human beta-globin A allele/ 50 moles each alpha-32P-dNTP at 20 500 Somali, and 1 mole of each of the primers used in Example 3 were dissolved in a solution containing 100 I 30 my Tris-acetate at pi 7.9, 60 my sodium acetate, 100 my dithiothreitol, and 10 my magnesium acetate. This solution was brought to 100C for two minutes and cooled to 25C for one minute. A total of 1 I containing 4.5 units 25 Clown fragment of E. golf DNA polymers I and 0.09 units inorganic pyrophosphatase was added to prevent the possible build up of pyrophosphate in the reaction mixture, and the reaction was allowed to proceed for two minutes at 25Cg after which the cycle of heating, cooling, adding enzyme, and reacting was repeated nine times. Tunnel 30 allocates were removed and added to 1 I 600 my ETA after each synthesis cycle. Each was analyzed on a 14% polyacrylamide gel in 90 my Tris-borate and 2.5 my ETA at pi 8.3 and 24 volts/cm for 2.5 hours. The completed gel was soaked for 20 minutes in the same buffer with the addition of 0.5 gel ethidium bromide washed with the original buffer and photographed in US light using a red filter.

The 110-bp fragment produced was excised from the gel under 5 ultraviolet light and the incorporated 32p counted by Cerenkov radiation. An attempt to fit the data to an equation of the form:

pmoles/10 Al = 0.01 ~(1+y)N-yN-1], where N represents the number of cycles and y the fractional yield per cycle, was optimal with y = 0.619. This indicates that a significant amplification is occurring.

B.

The above experiment was repeated except that 100 moles of each dNTP was added to a 100 Al reaction no radio label was employed, and allocates were not removed at each cycle Aster 10 cycles the reaction was terminated by boiling for two minutes and rehybridization was performed at 57C for one hour. The sequence of 15 the 110 by product was confirmed by subjecting 8 Al allocates to restriction analysis by addition of 1 Al bovine serum albumin (25 mgjml) and 1 Al of the appropriate restriction enzyme (HinfI, Mali, MstII, NcoI3 and by reaction at 37C for 15 hours. PAGE was performed as described above.

EXAMPLE 8 This example illustrates the use of different primers to amplify various fragments of pBR328 and 322.

A. The experiment described in Example PA was repeated except using the following primers: d~TTTGCTTCTGACACAACTGTGTTCACTAGC) 25 and d(GCCTCACCACCAACTTCATCCACGTTCACC) to produce a 130-bp fragment of pBR328.

B. The experiment described in Example PA was repeated except using the following primers: d(GGTTGGCCAATCTACTCCCAGG) and d(TGGTCTCCTTAAACCTGTCTTG) to produce a 262-bp fragment of pBR328. The 30 reaction time was 20 minutes per cycle.

C. The experiment described in Example 8B was repeated except that 100 moles of an MstII digest of pBR328 containing a 1.9 I 36 kb insert from the human beta-globin S allele was used as initial template. This plasm id was cleaved several times by MstlI but not inside the sequence to be amplified. In addition, the primers employed were as follows:

d(GGTTGGCCAATCTACTCCCAGG) and d(TAACCTTGAlACCAACCTGCCC) to produce a 240-bp fragment D. The experiment described in Example 7B was repeated except that 100 moles of an NruI digest of pBR322 was used as 10 template, 20Q moles of each dNTP were used in the 100 Al reaction, and the primers were:

d(TAGGCGTATCACGAGGCCCT) and d(CTTCCCCATCGGTGATGTCG) to produce a 500-bp fragment from pBR322. Reaction times were 20 15 minutes per cycle at 37C. Final rehybridization was 15 hours at 57C. Electrophoresis was on a 4% agrees gel.

EXAMPLE 9 This example illustrates the invention process wherein an in vitro mutation is introduced into the amplified segment.

A. A total of 100 moles of pBR322 linearized with NruI, 1 mole each of the primers:

d(CGCATTAAAGCTTATCGATG) and d(TAGGCGTATCACGAGGCCCT) designed to produce a 75-bp fragment, 100 mole each dNTP, in 100 Al 25 40 my Trip at pi 8, 20 my in McCauley, 5 my in dithiothreitol, and 5 mg/ml bovine serum albumin were combined. The mixture was brought to 100C for one minute, cooled for 0~5 minutes in a water bath at 23C, whereupon 4.5 units Clown fragment and 0.09 units inorganic pyrophosphatase were added and a reaction was allowed to proceed for 30 three minutes. The cycle of heating, cooling, adding enzymes, and reacting was repeated nine times, The tenth reaction cycle was terminated by freezing and an Al Alcott of the reaction mixture was applied to a 4% agrees gel visualized with ethidium bromide.

it 3 37 B. The experiment described in Example PA was repeated except that the oligonucleotide primers employed were:

d(cGcATTAAAGcTTATcGATr~) and d(AATTAATACGACTCACTATAGGGAGATAGGCGTATCACGAGGCCCT)..

5 These primers are designed to produce a 101~bp fragment, 26 nucleotides of which (in the second listed primer) are not present in pry. These nucleotides represent the sequence of the To promoter which was appended to the 75-bp sequence from pBR322 by using the primer with 20 complementary bases and a 26-base S' extension. The 10 procedure required less than two hours and produced two picomoles of the relatively pure 101-bp fragment from 100 moles of pBR322.

The To promoter can be used to initiate RNA transcription.

To polymers may be added to the 101-bp fragment to produce singlestranded RNA.

C.

The experiment described in Example ED was repeated except that the oligonucleotide primers employed were as follows:

d(TAGGCGTATCACGAGGCCCT) and d(CCAGCAAGACGTAGCCCAGC) to produce a 1000-bp fragment from pBR322~ D.

The experiment described in Example 9C was repeated except that the oligonucleotide primers employed were as follows:

d(TAGGCGTATCACGAG6CCCT) and d(AATTAATAC6ACTCACTATAGGGAGATAGGCGTATCACGAGGCCCT) so as to produce a 1026-bp fragment, 26 nucleotides of which (in the 25 second listed primer) are not present in pBR322 and represent the To promoter described above. The promoter has been inserted adjacent to a 1000-bp fragment from pyre.

The results indicate that a primer which is not a perfect match to the template sequence but which is nonetheless able to 30 hybridize sufficiently to be enzymatic ally extended produces a long product which contains the sequence of the primer rather than the corresponding sequence of the original template. The long product serves as a template for the second primer to introduce an in vitro mutation. In further cycles this mutation is amplified with an ~3'76~5 38 undiminished efficiency, because no further mispaired priming are required. In this case, a primer which carries a non-complementary extension on its it end was used to insert a new sequence in the product adjacent to the template sequence being copied.

E.

Because the reaction with polymers generates pyrophosphate and is theoretically reversible (Kornberg, A., DNQ Replication, WOW H.

Freeman San Francisco, 1980) 9 the effect of including an inorganic pyrophosphatase to avoid potential pyrophosphorolysis of the product was examined.

Qualitative 10 polyacrylamide gel electrophoresis examination of reactions plus and minus pyrophosphatase demonstrated a minor but significant increase in homogeneity of product as a result of the inclusion of this enzyme.

EXAMPLE 10 This example illustrates employing nested sets of primers to 15 decrease the background in the amplification of single copy genes.

Whole human DNA homozygous for the wild-type betaglobin allele was subjected to twenty cycles of amplification as follows: A total of 10 go DNA, 200 picomoles each of the primers:

d(ACACAACTGTGTTCACTAGC) and do CAACTTCATCCACGTTCACC) and 103 nanomoles each dNTP in 100 Al of 30 my Tris-acetate pi 7.9, 60 my sodium acetate, 10 my dithiothreitol, and 10 my magnesium acetate were heated to 100C for one minute, cooled to 25C for one minute, and treated with 2 units Clown fragment for two minutes.

The cycle 25 of heating, cooling and adding Clown was repeated 19 times. A tunnel Alcott was removed from the reaction mixture and subjected to a further ten cycles of amplification using each of the primers:

d(CAGACACCATGGTGCACCTGACTCCTG) and d(CCCCACAGGGCAGTAACGGCAGACTTCTCC), 30 which amplify a 58-bp fragment contained within the 110-bp fragment produced above. This final ten cycles of amplification was accomplished by diluting the 10-~l Alcott into 90 Al of the fresh Tris-acetate buffer described above containing 100 nanomoles each dNTP I 39 and 200 poles of each primer.

Reaction conditions were as above.

After ten cycles a 10-~l Alcott (corresponding to 100 nanogram of the original DNA) was applied to a 6% NuSieve (FMC Corp.) agrees gel and visualized using ethidium bromide.

Figure 10 illustrates this gel illuminated with US light and photographed through a red filter as is known in the art.

Lane 1 is molecular weight markers.

Lane 2 is an Alcott of the reaction described above.

Lane 3 is an Alcott of a reaction identical to that described above, except that the original wild-type DNA was cleaved 10 with Dow prior to amplification. Lane 4 is an Alcott of a reaction identical to that described above, except that human DNA homozygous for the sickle betaglobin allele was treated with Dow prior to amplification (the sickle allele does not contain a Dow site in the fragment being amplified here). Lane 5 is an Alcott of a reaction 15 identical to that described above, except that salmon sperm DNA was substituted for human DNA. Lane 6 is an Alcott of a reaction identical to that described above, except that the Alcott was treated with Dow after amplification ED I should convert the 58-bp wild-type product into 27-and 31-bp fragments). Lane 7 is an Alcott of the 20 Lane 4 material treated with Dow after amplification (the 58-bp sickle product contains no Dow site).

Detection of a 58-bp fragment representative of a singlecopy gene from one microgram of human DNA using only ethidium bromide staining of an agrees gel requires an amplification of about 5009000~ 25 fold. This was accomplished by using the two nested sets of oligonucleotide primers herein. The first set amplify en the llO-bp fragment and the inner nested set amplifies a sub-fragment of this product up to the level of convenient detection shown in Figure 10.

This procedure of using primers amplifying a smaller sequence 30 contained within the sequence being amplified in the previous amplification process and contained in the extension products of the other primers allows one to distinguish the wild-type from the sickle allele at the betaglobin locus without resorting to either radio isotopic or otherwise cumbersome methodology such as that of 35 Conner et at., PEAS (USA), 80:278 (1983) and leery et at., PEAS (USA), 80:4045 (1983) EXAMPLE 11 The present process is expected to be useful in detecting, in a patient DNA sample, a specific sequence associated with an infectious disease such as, ego, _ loomed using a biotinylated 5 hybridization probe spanning the desired amplified sequence and using the process described in US. 4,358,535, O The biotinylated hybridization probe may be prepared by intercalation and irradiation of a partially double-stranded DNA with a 4'-methylene substituted ~,5'-8-trimethylpsoralen attached to button via a spacer arm of the lo formula:

R R" -N-(CH2)2-O-CcH2)xo]y CH2CH2 N where R is -H or a -SHEA group R" is -H, x is a number from l to 4, and y is a number from 2 to 49 as described by EN 156,287. Detection of the buttonhole groups on the probe may be accomplished using a streptavidin-acid phosphates complex commercially obtainable from Eons biochemical using the detection procedures suggested by the manufacturer in its brochure. The hybridized probe is seen as a spot of precipitated stain due to the binding of the detection complex, and 20 the subsequent reaction catalyzed by acid phosphates, which produces a precipitable dye.

The cell line SC-1 (CTCC #0082) was deposited on March 19, 1985 with the American Type Culture Collection (ATTICS) 9 12301 Park lawn Drive, Rockville, Maryland 20852 USA, with ATTICS Accession No.

CREOLE.

The deposit of SC-1 was made pursuant to a contract between the ATTICS and the assignee of this patent application, Fetus Corporation. The contract with ATTICS provides for permanent availability of the progeny of this cell line to the public on the issuance of the US. patent describing and identifying the deposit or the publications or upon the laying open to the public of any US. or foreign patent application, whichever comes first, and for availability of the progeny of this cell line to one determined by the US. Commissioner of Patents and Trademarks to be entitled thereto ~2~7~ 41 according to 35 CUR 122 and the Commissioners rules pursuant thereto (including 37 CUR ~1,14 with particular reference to 886 OX 638). The assignee of the present application has agreed that if the cell line on deposit should die or be lost or destroyed when cultivated under 5 suitable conditions, it will be promptly replaced on notification with a viable culture of the same cell line In summary the present invention is seen to provide a process for amplifying one or more specific nucleic acid sequences using a chain reaction in which primer extension products are produced 10 which can subsequently act as templates for further primer extension reactions. The process is especially useful in detecting nucleic acid sequences which are initially present in only very small amounts.