Neurotrophin-3, a novel neurotrophic factor related to nerve growth factor and brain derived neurotrophic factor.

MAX PLANCK INSTITUT FUR PSYCHIATRIE & REGENERON PHARMACEUTICALS, INC., Are seeking the privilege of invention in Portugal.

SUMMARY The present invention relates to the process of producing neurotrophin-3 (NT-3), a member of the brain derived neurotrophic factor (BDNF) gene family. According to the present invention, BDNF shared homology regions and nerve growth factor (NGF) can be used to identify NT-3. 0 The present invention relates to the process of isolating genes and gene products from novel BDNF / NGF-related neurotrophic factors identified by these processes. According to the invention, NT-3 can be used in processes for diagnosing neurological disorders including, but not limited to, Alzheimer's and Parkinson's disease.

<img file="PT95153B_D0001.tif" />

71494

6526-040-118

-2Descriptive Memory

1. INTRODUCTION The present invention relates to the preparation of neurotropin-3 (NT-3), a newly discovered neurotrophic factor that is a member of the BDNF / NGF gene family. The NT-3 encoding gene has now been cloned and its sequence determined. and recombinant NT-3 has already been expressed in mammalian cells. Recombinant NT-3 has been shown to have a spectrum of biological activities that differ from those of BDNF and NGF. 0 The present invention provides the NT-3-encoding nucleic acid sequences for substantially pure NT-3 protein, peptide derivatives or derivatives thereof and antibodies directed to the NT-3 protein or peptides. The NT-3 gene products of the invention may be used in the diagnosis and therapy of various neurological disorders including in particular peripheral neuropathies, Alzheimer's disease and Parkinson's disease.

2. BACKGROUND OF THE INVENTION

2.1. THE ROLE OF NEUROTROPHIC FACTORS IN THE NERVOUS SYSTEM The development and conservation of the nervous system depends on the proteins known as neurotrophic factors. Common / neuronal death cells accompany the normal development of the central and peripheral nervous systems and apparently play a crucial role in regulating the number of neurons that project to a given objective field (Berg, DK, 1982,

Neuronal Development 297-331; Cowan et al., 1984, 225: 1258-65).

Studies of ablation and transplantation of peripheral objective tissues during development have shown that neuronal cell death results from competition between neurons in limited amounts of survival factors (neurotrophic factors) produced in their projection fields. These observations led to the identification of nerve growth factor (NGF) which remains by far the best characterized neurotrophic molecule (Levi-Montalcini and Angeletti, P, U „, 1968, Physiol. Rev, 4 = 534-69; Thoenen, H. and

Barde, YA, 1980. Rev. 60 = 1284-335), The understanding of the role and mechanism of action of NGF was greatly enhanced by the discovery.

71494

6526-040-118

<img file="PT95153B_D0002.tif" />

-3- an accidental source of this protein in the submaxillary glands of male mice, which allowed for purification and cloning (Ullrich et al., 1983, Nature 303 = 821-5; Scott et al., 1983, Nature 302 = 538-40). ) of NGF, as well as the creation of neutralizing antibodies. Since NGF only supports a limited set of neuronal populations, additional neurotrophic factors have long been postulated (Varon, S. and Adler, R. 1981, Adv, Cellular Neurobiol. 2: 115-63; Barde et al., 1987, Prog Brain Res 71 = 185-9; Snider, WD and Johnson, Ε. 1989., 1989, Ann. Neurol 26: 489-506). Although it is clear today that such factors exist, their extremely low abundance has hindered their molecular characterization. However, the purification of small amounts of two of these proteins, namely brain-derived neurotrophic factor (BDNF) and ciliary neurotrophic factor (CNTF), has recently allowed partial acid sequence determination. nucleic acids (Leibrock et al., 1989, Nature 341 = 149-52; Stockli et al., 1989, Nature 342 = 21-28 and Lin et al., 1989, Science 246 = 1023-25). Despite the specificity of the distinct neuronal populations BDNF and NGF (but not CNTF) have sufficient structural homology to be considered as members of a gene family (Leibrock et al., 1989, Nature 341 = 149-52).

2.2. OTHER NEURQTROPHIC FACTORS

In the past decade there have been numerous reports on neurotrophic activity in extracts from a wide variety of tissues and in conditioned culture media of very different cell types. In almost all cases, however, progress in purification and characterization of these activities has stumbled on the fact that these activities are present in extremely small amounts, from the order of picograms to nanograms per gram of tissue.

In addition, although appropriate biological assays for peripheral neurons have been established, the proposal for reliable, reproducible, and specific tests for the central nervous system has been shown to be problematic. While the

71494

6526-040-118

<img file="PT95153B_D0003.tif" />

Individual types of peripheral neurons turn out to be discrete, easily dissected ganglia and the central nervous system (CNS) neurons are invariably highly heterogeneous in their distribution. Specific markers are therefore needed both for identification and improvement of certain classes of CNS neurons. Progress in the production of these markers has been very limited, e.g. cell surface antibodies or cytoskeletal components or specific histological strains. Thus, characterization of neurotrophic factors that are (i) not as abundant as NGF, (ii) difficult to evaluate, and (iii) not available in sufficient quantities to elicit antibody production, proved to be an extremely difficult process. »

2.2.1. COMPARISON OF BRAIN DERIVED GROWTH FACTOR WITH 0 NERVE GROWTH FACTOR

Neurotrophic activity capable of maintaining the survival of chick embryo dorsal root ganglion neurons in vitro was identified in the conditioned medium where rat C-6 glioma cells had been cultured (Barde et al., 1978, Nature 274: 818). Activity was not neutralized by rat NGF antibodies, suggesting the presence of another neurotrophic factor in the conditioned medium. Similar activities that cannot be blocked by NGF antibodies were then revealed in normal adult rat brain astroglial cell cultures (Lindsay, 1979, Nature, 282 = 80-82; Lindsay et al., 1982, Brain Res. 243 = 529-345) and extracts from the brain of the adult rat and the growing rat (Barde et al., 1980, Proc. Natl, Acad. Sci. USA, 77 = 1199-1203) are from the mature or in the mature spinal cord. development (Lindsay and Peters, 1984, Neurosci., 12 = 45-51). However, in no case was any active factor identified or identified and it remains questionable to what extent the observed activities were due to the same or different factors,

Using the pig brain as starting material. Barde et al. (1982, EMBO J. 1 = 549-553) mentioned a factor, now

71494

6526-040-118

<img file="PT95153B_D0004.tif" />

It is called brain derived neurotrophic factor (BDNF) which appears to improve survival of dorsal root ganglion neurons in chick embryos E10 / E11. Neurotrophic activity was found to reside in a highly basic protein (isoelectric point, pi&gt; 10.1) that migrated during sodium dodecyl sulfate (SDS) gel electrophoresis as a single 12.3 kD molecular weight band. The purification factor was estimated at 1.4 χ 10⁶ but the yield was very low, with only about 1 ng of BDNF purified from 1.5 kg of pig brain. Also, as the last step of the purification process was preparative gel electrophoresis, BDNF activity was not could be completely restored due to the presence of residual SDS (Barde and Thoenen, 1985, in Hormones and Cell Regulation, Vol. 9, Dumont et al., eds. Elsevier Science Publishers, pp. 385-390). It was noted that the highly basic nature and molecular size of BDNF were very similar to those of the NGF monomer. BDNF however appeared to have properties that differed from the known properties of NGF since (a) in the evaluation of dorsal root ganglia of the chick, NGF antibodies had no apparent effect on the biological activity of BDNF; (b) in the same assessment, the effects of BDNF and NGF appeared to be additive; and (c) unlike NGF, it has been found that. BDNF had no effect on the survival of E12 chick sympathetic neurons. In addition, during the first studies with brain extracts, it was observed that neurotrophic activity in these sources appeared to act on sensory neurons at later stages of development than when associated with NGF. Using separate cultures of chick embryo neurons grown on a polycationic substrate such as polylysine or poliornitine, BDNF was found to support the survival of more than 30% of E10-11 chick embryo dorsal root ganglion neurons (embryonic day). ten or eleven) but seemed to have little effect on the survival of the same neurons in E6 (Barde et al., 1980. Proc. Natl. Acad. USA 77 = 1199-1203 supra), Under similar conditions, NGF supported the survival of 30-40¾ of dorsal root ganglion (DRG) neurons in E6. IS

71494

6526-040-118

It should be noted that it was later found that when grown on a substrate coated with the extracellular laminin glycoprotein matrix, both NGF and BDNF supported survival of about 50 cerca neurons / DRG from chick embryos of E6-E12 age. (Lindsay et al., 1985, Develop. Biol, 112: 519-328). Subsequent studies found that the effects of NGF and BDNF were additive when both were present at saturation concentrations.

Previous studies by Levi-Montalcini (1966, The Harvey Lectures 60 = 217-259) on the neuronal specificity of NGF suggested that NGF was not a ubiquitous neurotrophic factor even for sensory neurons, as NGF appears to have no effect on NGF. neurons of certain sensory ganglia of the chick skull, especially the nodular ganglion of the tenth cranial nerve. Further in vivo studies (Johnson et al., 1980, Science 210 = 916-918; Pearson et al., 1983 Develop. Biol. 96 = 32-3) showed that exclusion of NGF during embryogenesis had no effect on neuronal survival of most rat cranial sensory ganglia, while similar treatment lowered neuronal count in sensory ganglia derived from neural Christian . More detailed in vitro studies (Lindsay and Rohrer, 1985, Develop. Biol. 112 = 50-48; Davies and Lindsay, 1985, Develop. Biol. 111 = 62-72; Lindsay et al., 1985, J. Cell. Sci. Suppl 3 = 115-129). They have clearly shown that NGF supported the survival of most sensory neurons derived from the neural Christian but had no apparent effect on the survival of cranial sensory neurons derived from neural placodes.

The first demonstration of a distinct BDNF neuronal specificity from NGF was the in vivo demonstration that purified BDNF supports the survival of 40-50¾ of separate sensory neurons derived from the chick embryo neural placode derived from the E6, E9, or chick embryo. E12 (Lindsay et al., 1985, J. Cell Sci. Supp. 3 = 115-129). NGF had no apparent effect on these neurons either by itself or in conjunction with BDNF. It was later shown in crop studies that ^ o / BroF seemed

71494

6526-040-118

-7 Support the survival and development of neuritis of other sensory ganglia derived from neural placodes, including the geniculate, ventrolateral trigeminal (petrous) ganglia (Davies et al., 1986, J. Neurosci. 6 = 1897-1904) , none of which had been sensitive to NGF. In all of the above studies, neutralization of NGF antibodies had no effect on the observed activity of BDNF. In addition to its effect on cultured neurons from peripheral ganglia, BDNF has been found to stimulate survival and neuronal differentiation of cultured quail Christian neural cells (Kalcheim and Gentíreau, 1988, Develop. Brain. Res. 41 = 79 -86).

Prior to the present invention, the inability to produce sufficient amounts of BDNF for immunization prevented the production of anti-BDNF antibodies for comparison with anti-NGF antibodies for their effects on neuronal populations and precluded BDNF / NGF cross-neutralization experiments. Two recent studies with BDNF (Kalcheim et al., 1987, EMBO J. 6 = 2871-2873; Hofer and Barde, 1988, Nature 351 = 261-262), however, indicated a physiological role of BDNF in the development of PNS in birds. If an in ovo mechanical barrier is placed between the DR3 in E3 / E4 (dorsal root ganglia of 3 or 4 day embryos) and their CNS target in the neural tube, many DRG neurons are observed to die (Kalcheim and Le Douarin, 1986, Develop, Biol. 116 = 451-466). It was postulated that this neuronal death could be due to the loss of a CNS-derived neurotrophic factor (neural tube). It was then observed that BDNF, bound to a laminin-coated sialastic membrane, could prevent this cell death (Kalcheim et al., 1987, EMBO J. 6 = 2871-2873). Injections of BDNF into developing quail eggs have been found to reduce naturally occurring cell death in the knotted ganglia, an effect not yet observed with NGF (Hofer and Barde, 1988, Nature, 551 = 261-262). In addition to its effect on peripheral sensory neurons of both Christian neural and those of neural placode origin, BDNF has been shown to support the survival of developing CNS neurons. Johnson et al. (1986, J.

<img file="PT95153B_D0005.tif" />

71494

6526-040-118

-8 Neurosci., 6: 3031-3938) reported data indicating that BDNF supports survival of cultured retinal ganglion cells from E17 rat embryos. This expanded on previous studies showing that conditioned media and brain extracts prepared from retinal ganglion cells in certain regions seemed to support the survival of these neurons (McCaffery et al., 1982, Ex. Erain Res. 48:37 -386; Sarthy et al., 1983, J. Neurosci. 3 = 2532-2544; Turner et al., 1983, Dev. Brain Res. 6: 77-83).

In addition to the effects on survival of cultured developing neurons, BDNF has been shown to have effects on cultured neurons in the adult peripheral and central nervous system. BDNF as well as NGF have been found to stimulate axonal regeneration of cultured rat adult neuronal neurons (Lindsay, 1988, J. Neurosci. 8: 2394-2405) even though adult sensory neurons do not. appear to require neurotrophic factors for in vitro maintenance for 3 or 4 weeks. In addition, in adult rat retinal cultures, BDNF was found to improve both survival and axonal elongation of retinal ganglion cells (Thanos et al., 1989, Eur. J. Neurosci. JL: 19-26) . Table I shows the comparison of the biological effects of NGF and BDNF.

TABLE I

COMPARISON OF DQ BDNF AND NGF BIOLOGICAL ACTIVITIES *

71494

6526-040-118

<img file="PT95153B_D0006.tif" />

<td rowspan="2">PERIPHERAL NERVOUS SYSTEM</td><td colspan="2">SURVIVAL**</td>

<td>BDNF</td><td>NGF</td>

<td>(i) E6 chick DRG</td><td> -</td><td> ++</td>

<td>E10 chick DRG</td><td> +</td><td> ++</td>

<td>Friendly chick E12 (Barde et al .. 1980. supra)</td><td></td><td> ++</td>

<td>(ii) E6-E12 chick DRG</td><td> ++</td><td> ++</td>

<td>E6-E12 chick knot</td><td></td><td> -</td>

<td>Nice chick 12 pounds</td><td> -</td><td> ++</td>

<td>E12 chick ciliary (Lindsay et al. 1985. supra) (iii) Pinto E3-E14</td><td></td><td></td>

<td>Jugular</td><td> + /++</td><td> ++</td>

<td>Trigeminal DM</td><td>+ f ++</td><td> ++</td>

<td>Rock</td><td> +/++</td><td> -</td>

<td>Geniculate</td><td> +/++</td><td> -</td>

<td>VL-trigeminal</td><td> ++</td><td> -</td>

<td>Entrance exam</td><td> -</td><td> -</td>

<td>Mesencephalic (Davies et al. 1986. supra) (Barde et al., 1987, Prog. Brain Res., 71: 185-189) CENTRAL NERVOUS SYSTEM</td><td> ++</td><td></td>

<td>(i) Rat-retinal ganglion cells</td><td>E17 ++</td><td> -</td>

(Johnson et al., 1986,

J. Neurosci. 63031-3038) in chronological order according to the date of publication; in vitro effects without survival: (-); moderate survival (+); good survival (++)

71494

6526-040-118

<img file="PT95153B_D0007.tif" />

-102.2.2, NEUROTROPHIC FACTOR NEURAL TARGETS

BRAIN-DERIVATED

Sensory neurons of peripheral nerve ganglia have been found to arise from either of two distinct transient embryological structures, namely the neural Christian and the placodes'; The neural Christian seems to give rise to both the neurons and the satellite cells of autonomous ganglia and sensory ganglia of spinal nerves, ie DRG. The contribution of neural Christian and neural placodes to the cranial nerve sensory ganglia has been studied using the quail / chick chick transplantation system proposed by Le Douarin (Le Douarin, 1973, Develop, Biol, 20: 217- 222; Nodem, 1978, Develop.-Biol, 67 = 313-329; Narayanan and Narayanan, 1980, Anat Rec. 196 = 71-32; Ftyer-Le Lievre and Le Douarin, 1982, Develop, Biol. 94 = 29.1 D'fimico-Martel and Noden, 1983, Am. J. Anat. 166 = 445-468). According to the review by Lindsay et al. (1985, J. Cell. Sci, Supp. 3 = 115-129) it is now believed that, at least for birds, the distal ganglia neurons of the 72, 92 and 102 cranial nerves (geniculate, rock and nodular ganglia, respectively) and the neurons of the vestibuloacoustic complex of the 82 cranial nerve, are exclusively of neural placode origin, the trigeminal ganglion of the 52 cranial nerve contains neurons of both Christian and placode origin (predominating in the ventrolateral pole of the maxillo-mandibular lobe, placode-derived neurons) while satellite cells of all cranial ganglia have been shown to have Christian neural origin.

In in vitro experiments using separate, neuron-enriched explant cultures of sensory neurons from cranial and spinal nerves, it was found that sensory neurons of Christian neural origin respond to NGF; In contrast, neurons derived from neural placodes (including neurons from the ventrolateral portion of the trigeminal ganglion and the entire neuronal population of the vestibular, geniculate, cliff and nodular ganglia) have been shown to be largely insensitive to NGF throughout embryonic development. In contrast to . Yours

71494

6526-040-118

<img file="PT95153B_D0008.tif" />

Differences in need and response to NGF, both neural Christian-derived and placode-derived sensory neurons (Table I) have been shown to be sensitive to BDNF neurite survival and activity (Lindsay et al., 1985, J. Cell Sci. Supp. 3 = 115-129; Lindsay et al., 1985, Develop. Biol. 112 = 519-528 (Kalcheim and Gendreau, 1988, Develop. Brain Res. 41 = 79-86). Tebar and Barde (1988, J. Neurosci. 8 = 3337-3342) studied the binding parameters of radiolabelled BDNF to dorsal root ganglion neurons in the chick embryo; Their results are consistent with the existence of 2 BDNF receptor classes, one with high affinity for BDNF, the other with low affinity. No high affinity receptors were observed in sympathetic neurons.

The known neuronal targets of BDNF were further reviewed by Barde et al. (1987, Prog. Brain Res, 71 = 185-189). Prior to the present invention, it was not possible to identify cells that synthesize BDNF due to the lack of BDNF specific nucleic acid or antibody probes. There have been unsuccessful attempts to prepare both polyclonal and monoclonal antibodies to BDNF. This failure to produce antibodies has prevented the molecular cloning of BDNF, the determination of the physiological effect of depriving developing BDNF neurons in vivo, the quantification of BDNF in tissues using immunoassays, and the localization of BDNF using immunocytochemistry.

71494

6526-040-118

<img file="PT95153B_D0009.tif" />

-12 TABLE II

BDNF SENSITIVE AND NOT SENSITIVE NEURONS *

A. Sensitive neurons

I. Sensitive chick neurons of Christian neural origin = (a) in dorsal root ganglion (b) in jugular ganglion (c) in dorsomedial trigeminal ganglion (d) in mesencephalic trigeminal nucleus **

II. Chick sensory neurons of origin in the ectodermal placode no = (a) nodular ganglion (b) vestibular ganglion (c) rock ganglion (d) geniculate ganglion (e) ventrolateral trigeminal ganglion

III. Retinal ganglion cells: from rat

IV. Chick retinal ganglion cells ***

B. Non-Sensitive Neurons

I. Sympathetic chick and rat neurons

II. Sympathetic ciliary chick neurons De Barde et al., 1987, Prog. Brain Res. 71: 185-189 ** See Davies et al., 1986, Nature 519 = 497-499 *** Rodriguez-Tebar et al., 1989, Dev. Biol. 156 = 296-505

2.2.3. CLONATION OF GENE DQ BRAIN DERIVED NEUTRAL FACTOR

Cloning of the BDNF gene was first performed as described in U.S. Serial Application No. 2. 07 / 400,591, filed August 30, 1989, incorporated herein in its entirety by reference. Briefly, small amounts of pig brain BDNF protein were purified, allowing the determination of fragments of the amino acid sequence, which could in turn be used to plan the corresponding oligonucleotides. These synthetic oligonucleotides were

71494

6526-040-118

<img file="PT95153B_D0010.tif" />

They are then used as introducers in the polymerase chain reaction (PCR) with a cDNA standard prepared from BDNF producing cells. PCR products were used as probes to allow cloning of complete cDNA and / or genomic BDNF genes from several species, including man, pig, rat and mouse, and the sequences of these genes were determined. Expression of recombinant BDNF was achieved in COS cells.

3 SUMMARY OF THE INVENTION The present invention describes the process of preparing nsurotropin-3 (NT-3), a recently discovered member of the BDNF gene family. It is based in part on the identification of nucleic acid sequence hornology regions shared by BDNF and NGF (US Patent Application No. 07 / 400,591, filed August 30, 1989, incorporated herein by reference). In accordance with the present invention, these hornology regions may be used to identify new members of the SDNF / NGF gene family; This was the methodology used to identify NT-3. The present invention prepares genes and gene products of novel BDNF / NGF-related neurotrophic factors identified by this process.

The present invention partly describes recombinant DNA molecules encoding NT-3. In certain specific embodiments of the invention, DNA encoding NT-3 is derived from human DNA, murine DNA, or rat DNA. The present invention also prepares recombinant DNA molecules comprising at least a portion of the nucleic acid sequences as substantially as shown in Figure 2 (murine NT-3), Figure 7 (rat NT-3) or Figure 11 (NT -3). 0 The present invention also prepares recombinant DNA expression vectors that can be used to prepare recombinant NT-3 protein and related peptides.

In other arrangements, the present invention provides NT-3 proteins and related peptides and provides methods for producing and preparing such peptides and proteins. The present invention also relates to antibodies directed against proteins and peptides.

<img file="PT95153B_D0011.tif" />

71494

6526-040-118

-14from NT-3,

According to the invention, NT-3 may be used in the diagnosis and / or treatment of neurological disorders including (but not limited to) peripheral neuropathies such as diabetic neuropathies, toxic and nutritional neuropathies, hereditary neuropathies and neuropathies related to AIDS and degenerative diseases such as Alzheimer's disease. NT-3 has been shown to support the survival of dopaminergic neurons; thus, in preferred embodiments of the invention, NT-3 may be used in the treatment of Parkinson's disease. As NT-3 has been observed to exhibit a different spectrum of activity than the specificities of BDNF or NGF, NT-3 offers valuable new options for inducing central nervous system regrowth and restoration.

4 DESCRIPTION OF THE FIGURES

FIGURE 1. Comparison of BDNF and NGF sequences from various species. Sequence analysis of the gene encoding BDNF and deduction of its amino acid sequence revealed that this protein bears many structural similarities to NGF. The main sequence of mature BDNF as well as the general structure and likely mode of processing from a precursor protein strongly suggests that the NGF and BDNF genes may have evolved from a common ancestral gene. Within the mature polypeptide region, if only 3 gaps are introduced into NGF sequences to optimize imitation, a total of 51 amino acid identities are common to previously known NGFs of many species and pig and human BDNFs. These identities include all six cysteine ​​residues, suggesting that the NGF and BDNF share a very similar secondary structure. In addition, four segments of six or more amino acids can be seen where the NGFs of all the above species and the BDNF. pigs are identical or differ by no more than about a conservative amino acid substitution. Thus, it is reasonable to conclude that NGF and BDNF are close members of a gene family.

71494

6526-040-118

<img file="PT95153B_D0012.tif" />

FIGURE 2. Genomic sequence and deduced amino acid sequence of murine NT-3. The amino acid sequence begins with the first ATG codon found after 3 framed stop codons. The underlined sequences indicate the location of primers used in the first round of PCR. The single consensus N-glycosylation sequence is underlined and the arrow indicates the supposed onset of processed mature NT-3.

FIGURE 3. Comparison of amino acid sequences between mature mouse NT--3, NGF (Scott et al., 1983, Nature 302 = 538-540) and BDNF (Leibrock et al., 1989, Nature 341 = 149-152) . The sequence of mature mouse BDNF shown herein is 100% identical to that of pig BDNF. Bold letters and ceilings indicate amino acids found at identical positions in all 3 proteins and arrows point to all cysteine ​​residues. Asterisks indicate the ranges entered to optimize imitation. V1-V4 indicate the 4 variable domains consisting of more than 3 contiguous amino acids.

FIGURE 4. Tissue distribution of NT-3 mRNA in mouse. Twenty ng of total RNA was applied to each lane and hybridized with a 4 P-labeled double stranded DNA probe. (A) In all tissues a single band corresponding to about 1.4 kilobases can be seen, the weakest signal being seen in the lung and the strongest signal in the heart. The skeletal muscle was taken from the thighs. (8) In the brain the strongest signal is obtained in the hippocampus and cerebellum.

FIGURE 5. Survival of sensory neurons isolated from the knotted ganglia obtained in the embryonic 8-day-old chick. 5,000 cells were plated on a polyornithine-laminin substrate and surviving neurons were counted after 24 hours. The BDNF concentration used here is 3x the minimum concentration required to achieve maximum survival. No neuron was found to survive without addition, or with conditioned medium used at 1 = 50 dilution, of untransfected COS control cells.

or transfected cells with DNA from

71494

6526-040-118

(Ft) PCR product derived from the use of degenerate primers 1B and 2C (designated R13 / 2C) detects a new gene, NT-3, as well as the NGF and BDNF genes in mouse genomic DNA. (B) Restriction map of a mouse NT-3 genomic clone. Two independent bacteriophage clones specifically hybridizing to the R1B / 2C probe were isolated from a rat genomic library. A schematic representation of the restriction map of one of these clones is presented, containing a 19.5 kb insert. The solid line indicates the NT-3's open reading frame (ORF = open reading frame) (see Fig. 7A). The position of the probe R1B / 2C is indicated.

FIGURE 7. Sequence of rat NT-3 and its homology to rat NGF and rat BDNF. (A) NT-3 nucleotide and amino acid sequence. DNA sequence, encompassed by ORF, encoded by the NT-3 gene, with the amino acid translation indicated above in the DNA sequence; asterisks mark the beginning and end of the open reading frame. Amino acids are numbered at the +1 position assigned to the first residue of mature NT-3 (119 amino acids). 0 fission site that is used to release mature NT-3 is within a frame such as / is the conserved glycosylation site just above this fission site; another potential fission site which is similarly fixed at a site_z NGF intermediate processing propostq (Darling et al., 1987, Cold Spring Harb Symp Quant Biol 1 = 427-34) (but not conserved in BDNF), is also enclosed in a square and is marked with a 7CLEAVE ( ? Splitting). The six mature NT-3 cysteines are underlined. The methionine initiation codon for the short precursor form of NT-3 (at position -139) marking the start site B, as stated in the text, is also underlined. 0 The proposed location of the receptor / intron junction at the boundary above the start site B is shown in the figure. (B) Alignment of rat NT-3 sequence with rat NGF and rat BDNF. MacVector sequence analysis software (purchased from International Biotechnologies, Inc.) was used to align the mouse NT-3 ORF matrix with the NGF and BDNF gene ORFs.

71494

6526-040-118

<img file="PT95153B_D0013.tif" />

-17 (using a window size of 20 and a minimum adjustment of 20¾). The significant adjustments seen along the diagonal of this matrix are depicted below a schematic representation of the NT-3 protein product; are designated as 1s II, two regions of homology upstream of mature NT-3, viewed in comparison to both NGF and EDNF. create the short precursor form of NT-3, supporting the claim that there is a longer precursor. (C) Sequence comparison between NT-3, NGF and BDNF in homology regions I and II. Sequences in these regions are aligned to maximize homology, with alignment intervals indicated by either BDNF or NGF Identities with the NT-3 sequence indicated while NGF and BDNF identities are indicated by the NGF sequence. A + at the top of the sequence indicates residues that are completely conserved between rat NT-3 and NGF and BDNF sequences of all species examined. The following NGF-defined sites, previously predicted for BDNF and proposed herein for NT-3 = the methionine start codon of the start site Β; the splice site of the signal sequence (Edwards et al., 1988, Mol. Cell Biol. 8 = 2456-64); a proposed NGF intermediate cleavage site that is absent in BDNF but present in NT-3; a glycosylation acceptor site; a proteolytic cleavage site that releases mature factors, (D) Sequence comparison of mature forms of NT-3, BDNF and NGF. The conserved cysteines are marked below by a full diamond phew. and are as in panel C. The C-terminal cleavage site, only present in the NGF sequence, is indicated.

FIGURE 8, Comparison of the activities of NGF, BDNF, and NT-3 assessed explanted embryonic chick ganglia (8 days). Photomicrographs of dorsal root ganglia (DRG) (AD panels), knotted ganglia (NG) (EH panels) and sympathetic chain ganglia (SG) (IL panels) cultured for 24 h (DRG and NG) or 48 h (SG) either in the absence of any neurotrophic factor (control: A, Ε, I) or in the presence of cell supernatants

71494

6526-040-118

-18COS containing NGF (B, F, J) or BDNF (C, G, K) or NT-3 (D, H, L). There is almost no neurite growth in control cultures (500 µl COS cell supernatant obtained from falsely transfected cells). NGF (10 µl COS cell supernatant) produced intense development of DRG and SG fibers but not NG. Increasing NGF COS cell supernatant from 20 to 500 wl had no effect on NG. 0 BDNF (10 µl COS cell supernatant) produced DRG and NG but not SG fiber development; Larger quantities (20 to 500 wl) had no effect on SG. NT-3 (20 wl COS cell supernatant over DRG and NG, 200 wl over SG) produced development of. fibers in all three types of ganglia, although the onset of growth was slower and less intense in the SG. The ganglia were cultured as collagen gel explants (Lindsay, RM and Rohrer, H., 1985, Dev.

Biol. 112 = 30-48) in F14 medium supplemented with 5% horse serum as previously reported (Lindsay et al., 1985, Dev. Biol. 112: 319-28. Scale = 200 wm.

FIGURE 9. NT-3 promotes neurite survival and growth in highly enriched cultures of DRG neurons. Photomicrographs of neuron-enriched (&gt; 95% neurons) cultures of dissociated embryonic chick (8 days) DRG treated for 48 h with either: (A) supernatant (500 wl) falsely transfected COS cells or (B, C) supernatant (50 µl) of transfected NT-3 cells. A and B are dark field micrographs; in A (control culture) less than 5% of plaque neurons survived; in Β the number of neurons according to the process was approximately 60% of the plaque neurons. From a dose-response curve this value was found to correspond to the maximum effect of NT-3 on E8 chick DRG neurons. (C) A micrograph with higher phase contrast magnification of the same culture. observed in B. Note the large number of bright phase neuronal cell bodies and the virtual absence of any non-neuronal cells. Cultures were prepared as previously described (Lindsay et al., 1985, Dev. Biol. 112: 319-28). Scale = 150 wl

71494

6526-040-118

<img file="PT95153B_D0014.tif" />

(Ç).

FIGURE 10. Northern Blot Comparison of NT-3, NGF, and BDNF Expression in Rodent Tissues. RNA (Auffray, C. and Rougeon, F., 1980, Eur. J. Biochem. 107 = 303-14) was prepared from the indicated tissues of the rat (left panels) or mouse (right panels). Ten micrograms of RNA from the indicated sources were fractionated onto 1¾ formaldehyde / agarose gels and transferred to 10X SSC nylon membranes; Northern blots in triplicate were hybridized (Mahmoudi, M. and Lin, VK, 1989, Biotechniques 7 = 331-3) at 68 ° C with 22p-labeled DNA fragments (Feinberg, AP and Vogelstein, B., 1984, Anal Biochem 137 = 266-7) of NT-3 rat BDNF, rat NGF, and then washed at 68 ° C in 2XSSC, 0.1¾ SDS. NT-3, NGF and BDNF DNA fragments were obtained from expression constructs containing these genes in pCDMS. The approximately 775 bp XhoI inserts in these constructs were gel purified before radiolabeling. Included is a picture of the ethidium bromide stained gel, allowing comparison of the total amount of RNA per sample.

FIGURE 11. Aligned DNA sequences of mouse and human NT-3 genes. The predicted translation start site is indicated by PREPRO— and the predicted start for mature NT-3 is indicated by MATURE—. The mature mouse and human NT-3 proteins have identical amino acid sequences whereas their prepro regions differ by 11 positions which are underlined,

FIGURE 12. Expression of human NT-3 polypeptide detected by metabolic labeling. In 60 mm petri dishes, 5x10 4 COS-M5 cells were seeded per plate and grown overnight at 37 ° in DMEM medium complete with 10% fetal bovine serum (FBS). Cells were transfected (using the CaP04 method, described by Chen and Okayama, 1987, Mol. Cell. Biol. 7 = 2745-52) with 20 wg of plasmid pC8-hN3 (Pl) containing the human NT-3 gene under regulation of a cytomegalovirus promoter, or were simulated transfected (no human DNA).

71494

6526-040-118

<img file="PT95153B_D0015.tif" />

plasmid). 48 h later, the cells were washed and incubated for 1 h in 1 ml methionine and cysteine ​​free DMEM with 1¾ FBS. To each culture, a mixture of [4 S] methionine and [35 s] cysteine ​​(100 wCi each from New England Nuclear) was added, the cells incubated for a further 4 h at 37 ° and the medium was collected. 50 μΐ samples were mixed with 25 μΐ double-concentration sample buffer containing Na dodecyl sulfate (SDS), boiled for 5 min and subjected to 15¾ polyacrylamide gel electrophoresis in the presence of SDS ( Laemmli, 1970, Nature 227 = 680-685). Proteins were transferred by electrophoresis (3 h, 100 mA) to a nylon membrane (immobilon¹Millipore), using the buffers described by Towbin et al., 1979, Proc. Natl. Acad. Know. USA 76 = 4350-4354. The filters were air dried and labeled proteins were detected by autoradiography (16 h at room temperature using Kodak X-AR film with a Cronex, DuPont filter).

FIGURE 13. Bar graph showing number of surviving tyrosine hydroxylase cells by culture without NT-3 (0) supernatant or with MT-3-containing supernatant at dilutions of 1 = 300, 1 = 100, 1 = 50 or 1 = 25.

FIGURE 14. Bar graph as described for Figure 13 (supra) except that the cells were at a density of 900,000 cells per plate.

FIGURE 15. Comparison of synthetic transcripts of NT-3, BDNF, and NGF. By ping-spot hybridization, using a radiolabeled oligonucleotide, homologous to a 5 'end-shared sequence of all three transcripts, it is found that equal amounts (2 ng) of NT-3, BDNF and NGF synthetic transcripts, initially quantified spectrophotometry, are being used as defined standards. B. Determination of NT-3, BDNF, and NGF mRNA levels in total RNA prepared from adult rat brain by comparison to defined synthetic RNA standards. Ten micrograms of total RNA isolated from the adult rat brain and 4, 10 and 20 pg of the synthetic transcripts corresponding to

71494

6526-040-118

<img file="PT95153B_D0016.tif" />

Each of the neurotrophins was hybridized to each neurotrophin-specific radiolabelled probe.

FIGURE 16. Expression of NT-3, BDNF, NGF, and NGFR genes in total RNA (10 µg / lane) prepared from mouse embryos (A), developing rat brain (8), and from selected adult and adult tissues. perinatal arteries (C). Tissues = A.Br: adult brain sample standardized in Figure IB; PLAC: placenta; EMB: whole embryo; SP.C: spinal cord; THY = thymus; LIV = liver; HRT = heart; BR: brain. The size of the transcripts is indicated on the right (in kilobases (kb)).

FIGURE 17. NT-3, BDNF, NGF, and NGFR gene expression in total RNA (10 µg / lane) prepared from discrete regions of the newborn (A) and adult (B) nervous systems. Regions: A.BR: Adult brain sample, standardized in Figure IB; CBL: cerebellum; HBR- (hindbrain) posterior part of the brain; MBR: midbrain; DIEN: Diencephalon; STR; striatum; HIP: hippocampus: CTX: neocortex; OLF: olfactory bulb; BR = whole brain without cerebellum; ADR: adrenal gland; RET: retina: SC.N: sciatic nerve; SP.C: spinal cord.

FIGURE 18. Quantification of transcribed levels of NT-3, BDNF, and NGF in newborn and adult CNS regions and in peripheral tissues. Densitometric prospecting of multiple exposures of Northern blots including those depicted in Figures 16, 17, 19; Maisonpierre et al. (1990, Science 247: 1446-1451) was used for reference. All levels are standardized to neurotrophin levels in the adult brain; Adult brain levels, which are similar for all three neurotrophins (see text), were considered to be 1 for each neurotrophin. Out-of-scale values ​​are included on top of broken vertical bars. Neural and non-neural samples are shown in the figure »Samples: BRN: brain not including cerebellum; CBL: cerebellum; HBR: posterior part of the brain; MBR: midbrain; DIE = diencephalon; STR; striatum; HIP: hippocampus; CTX: neocortex; OLF: olfactory bulb; SP.C .: spinal cord; SC.N .: sciatic nerve;

71494

6526-040-118

<img file="PT95153B_D0017.tif" />

-22RET = retina; ADR; adrenal gland = HRT = heart; LIV: liver; THY = thymus; SKN = (skin) skin; MUS = skeletal muscle; LNG = lung; INT = intestine; KID = kidney; SPL = spleen.

FIGURE 19. Expression of NT-3, BDNF, NGF, and NGFR genes during spinal cord (A, E), cerebellum (B, F), and hippocampus (C, G) development. 10 µg total RNA prepared at the indicated developmental times were compared for expression of the various transcripts. Densitometric quantitation of transcribed neurotrophin levels is indicated in E, F and 6.

5 DETAILED DESCRIPTION OF THE INVENTION The present invention describes the preparation of neurotropin-3, a new member of the BDNF / NGF family of neurotrophic molecules, as well as other members of the BDNF / NGF family that can be identified using similar methodology. and not as a limitation thereof, the detailed description of the invention will be divided into the following subsections:

(i) identification of other members of the BDNF / NGF family;

(ii) the cloning of neurotrophin-3;

(iii) neurotropin-3 expression;

(iv) assessing the biological activity of neurotrophin-3;

(v) neurotrophin-3 genes and proteins;

(vi) creation of anti-neurotrophin-3 antibodies; and (vii) utility of the invention.

5.1. IDENTIFICATION OF OTHER BDNF / NGF FAMILY MEMBERS

NGF and BDNF are basic proteins of approximately 120 amino acids, which share about 50% amino acid sequence identity, including the absolute conservation of six cysteine ​​residues which in active NGF have been shown to form three disulfide bridges (Bradshaw, A., 1978, Ann. Rev.

Biochem. 47 = 191-216; Leibrock et al., 1989, Nature 341 = 149-52). Comparison of the NGF sequences of divergent evolutionary species revealed that the amino acids flanking these cysteine ​​residues constitute the most highly conserved regions of the molecule (Meier et al., 1986, EMBO J. 5 = 1489-93; Selby et al.,

71494

6526-040-118

<img file="PT95153B_D0018.tif" />

1987, J. Neurosci. Res. 18: 293-8). Notably these are also the most similar regions between BDNF and NGF (leibrock et al., 1989, Nature 341: 149-52).

Rational search for other members of the BDNF / NGF gene family can be performed using an approach that takes advantage of the strong hornology consexual segments between NGF and BDNF. For example, other members of the BDNF gene family can be identified by selecting from several nucleic acid sequences those that are homologous to BDNF and NGF and then identifying among the selected sequences those which also contain nucleic acid sequences that are not. homologous to NGF and BDNF. The terms "non-homologous" are intended to mean a region containing at least about 6 contiguous nucleotides, where at least about 2 nucleotides differ in NGF and BDNF sequences.

The present invention also relates to recombinant DNA molecules that are homologous to BDNF and NT-3 or, alternatively, to NGF and NT-3, but also containing non-homologous regions to BDNF and NT-3, or NGF and NT-3, respectively. These other members of the BDNF / NGF / NT-3 gene family can be identified using molecular probes that correspond to the hornology regions. Based on further analysis, these members of the BDNF / NGF / NT-3 gene family can be identified. they have sequences that differ from sequences of known members of the BDNF / NGF / NT-3 gene family.

For example, one of the preferred specific embodiments of the invention features the following process. Corresponding to each of the four coTrs.ewa.do (box) segments set forth in Table III below, degenerate sets of degenerate oligonucleotides of about 10 to 20 nucleotides representing all possible amino acid coding sequences can be synthesized. found in either NGF or BDNF for about 3 to 7 contiguous codons. By numbering, relative to the amino terminus, the mature polypeptides (such that His prepro BDNF His 134 is treated with His 1 on the mature protein), the four boxes can

71494

6526-040-118

<img file="PT95153B_D0019.tif" />

be characterized as follows (numbered with respect to mature proteins in man).

TABLE III

<td>Box 1:</td><td>NGF</td><td>Gly10</td><td>- Ser19</td>

<td></td><td>BDNF</td><td>Gly8</td><td>- Serl7</td>

<td>Box 2 '</td><td>NGF</td><td>LysSO</td><td>- Cys58</td>

<td></td><td>BDNF</td><td>LysSO</td><td>- Cys58</td>

<td>Box 3 =</td><td>NGF</td><td>Glyó7</td><td>- Asp72</td>

<td></td><td>BDNF</td><td>Gly67</td><td>- Asp72</td>

<td>Box 4:</td><td>NGF</td><td>Trp99</td><td>- CysllO</td>

<td></td><td>BDNF</td><td>TrplOO</td><td>- Cyslll</td>

Synthetic oligonucleotides, derived from the sequence pairs of boxes indicated in Table III, can be used as primers to PCR amplify sequences from a source (RNA or DNA) of potential interest. This may include mRNA or cDNA or genomic DNA of any eukaryotic species that may express a polypeptide closely linked to BDNF or NGF. Performing only six PCR reactions (namely: a Box 1 primer with a Box 2 primer; Box 1 with Box 3; Box 1 with Box 4; Box 2 with Box 3; Box 2 with Box 4; Box 3 with Box 4) it may be possible to detect a gene or gene product by sharing any 2 of the above 4 conserved sequence segments between NGF and BDNF. If one decides to synthesize several different degenerate primers from each box, it may still be possible to perform a complete search with a reasonably small number of PCR reactions. It is also possible to vary the stringency of the hybridization conditions used at the beginning of the PCR reactions to allow more or less similarity between the nucleotide sequences of the unknown gene and those of NGF or BDNF. If a segment of a previously unknown member of the BDNF / NGF gene family is successfully amplified, that segment can be molecularly cloned and sequenced, and used as a probe to isolate a complete cDNA or genomic clone. This, in turn, will allow the determination of the complete nucleotide sequence of the

71494

6526-040-118

-25 unknown gene, analysis of its expression and production of its protein for functional analysis.

In addition, the present invention discloses the use of sequential BDNF / NGF homologies in the preparation of novel recombinant molecules that are members of the BDNF / NGF gene family but cannot occur in nature. For example (and not as a limitation), a recombinant molecule may be constructed according to the invention comprising portions of NGF and BDNF genes. Such a molecule may show properties associated with both NGF and BDNF, and present a new profile of biological activities, including not only agonists, but also primary sequence of BDNG and NGF. It may also predict the tertiary structure of molecules using computer simulation (Hopper and Woods, 1981, Proc. Natl. Acad. Sci., USA 78: 3824-3828); BDNF / NGF chimeric recombinant genes can be prepared in light of the correlations between tertiary structure and biological function. Chimeric genes comprising portions of any or more members of the BDNF / NGF gene family may also be constructed.

antagonists. To be used for

5.2. CLONATION OF NEUROTROPHIN-50 The NT-3 gene of any organism can be identified using the BDNF and NGF shared homology regions using the above methods. In two preferred specific embodiments of the invention, the gene may be identified and cloned as follows.

In a preferred arrangement, a sense (or 5 ') primer with a nucleotide sequence (using the IUPAC nomenclature) GGGGATCCGC 6GI TGI MGI GGI ATH GA (primer 1 including Bam H1 and Sac II endonuclease cleavage sites) and a antisense initiator (or 3⁷), with the nucleotide sequence TCGAATTCTAG AT ICK IAT RAA ICK CCA (primer 2 including Eco RI and Xba I sites), may be used in a polymerase chain reaction (Saiki et al., 1985, Science 250: 1350-1354 ) with a commercial thermal cycler (eg Perkin-Elmer Cetus thermal cycler) and thermus aquati71494 thermostable DNA polymerase

6526-040-118

Polymerase (Taq polymerase). After about 4 cycles with a tempering temperature of 45 ° C, the remaining 36 cycles can be performed at tempering temperatures of 49 ° C. The resulting DNA amplification products can then be separated by polyacrylamide gel electrophoresis and the product of the expected size (about 137 base pairs) can be eluted, reamplified and then digested with two restriction endonucleases, one of which splits the sequence of the organism's NGF gene into the amplified segment, and the other splits the sequence of the organism's BDNF gene into the amplified segment. 0 Unsubstituted DNA (which presumably does not encode either NGF or BDNF because it has escaped restriction endonuclease cleavage) can then be separated from asymmetrically amplified eluted polyacrylamide gel cleaved DNA (Innis et al., 1988). Proc. Natl. Acad. Sci. USA, 85 = 9436-9440) and sequenced (Sanger et al., 1979, Proc. Natl. Acad. Sci. USA 72 = 5918-3921) using for example primers 1 and 2 . Based on the sequence thus obtained, other sense and antisense primers that more accurately reflect the sequence of the new gene may be prepared. For example, additional sense primers such as GGGATTGATGAG AAA (primer 3) and ACTCTCAGTGCAAAACTTCGC (primer 4) and antisense primer (5 may be used).^J) CGGATCCGAATTCTGCAG (T) 12 (primer 5), RNA, prepared from a tissue plausibly producing neurotrophic activity, such as the brain (using any standard method, as set forth in Okayama et al., 1987, Meth. Enzymol. 154 = 3-28) can be inversely transcribed using, e.g. e.g. primer 5 designed to simulate 3 'poly (A) tails and containing restriction endonuclease cleavage sites for Bam HI, Eco RI and Pst I (Leibrock et al., 1989, Nature 541 = 149-152) . 0 The resulting cDNA can then be PCR amplified using primers 3 and 5, and then reamplified using primers 4 and 5. A Southern blot can then be prepared using the last reaction products, and hybridized to a probe. 32p-end-labeled oligonucleotides corresponding to the downstream sequence of primer 3 and 4 sequences. The DNA fragments thus identified can then be cloned

71494

6526-040-118

<img file="PT95153B_D0020.tif" />

in a suitable vector and the longest insert obtained can be used to control the genomic information obtained from the organism concerned. Positive clones identified in this way can then be analyzed by standard restriction mapping and nucleotide sequencing techniques.

In another preferred embodiment of the invention, degenerate oligonucleotides corresponding to segments of highly conserved NG protein sequences can be synthesized.^Ç and BDNF. For example, these amino acid sequences (shown in Figure 7D) may be: (1) Gly-Glu- (Tyr / Phe) -Ser-Val-Cys-Asp-Ser; (2)

Lys-Gen-Tyr-Phe- (Tyr / Phe) -Glu-Thr-Lys-Cys; (3) Gly-Cys-Arg-Ile-Asp; and (4) Trp-Arg-Phe-Ile-Arg-Ile-Asp-Thr- (Ser / Ala) -Cys-Val-Cys. A series of sense and antisense degenerate oligonucleotides (containing a degenerate portion of 15-26 nucleotides in length, corresponding to 5-9 amino acids from the above protein sequences in both the sense and antisense directions, as well as a non-degenerate tail encoding restriction enzyme recognition sites) can be used in PCR reactions. Amplification reactions between pairs of upstream sense primers and downstream antisense primers may be carried out under classical conditions or, preferably, the optimal conditions for each pair of primers may be experimentally determined. For example, the sense primer (corresponding to amino acid sequence (1), supra)

5'GATTCGAGTCGACATCG-GTN-TGY-GAY-WSN-RTN-WS-3 'and the antisense primer (corresponding to amino acid sequence (2), supra)

5'-CCAAGCTTCTAGAATTC-CA-YTT-NGT-YTC-RWA-RAA-RTA-YTG-3 'can be used in the amplification reaction using cDNA or genomic DNA from a suitable source as standard. Amplification reaction products using upstream sense primer pairs and downstream antisense primers can be used as Southern blot probes of genomic DNA to identify the PCR product that hybridizes the genomic DNA sequence. which contains regions

<img file="PT95153B_D0021.tif" />

71494

6526-040-118

Homologous to those of the probes, as well as regions not homologous to those of the probes (e.g., non-NGF, non-BDNF sequences). A PCR product that identifies a new genomic DNA sequence can be used to control genomic or cDNA information and hence choose clones encoding new members of the BDNF / NGF gene family.

5-3. NEURQTROPHIN-5 EXPRESSION

The nucleotide sequence encoding the NT-3 protein or portion thereof may be inserted into an appropriate expression vector, that is, a vector containing the elements necessary for transcription and translation of the inserted sequence encoding the protein. The necessary transcription and translation signals may also be provided by the native NT-3 gene and / or its flank regions. Various host vector systems may be used to express the protein coding sequence. These include, but are not limited to, virus-infected mammalian cell systems (e.g., vaccinia virus, adenovirus, etc.); virus-infected insect cell systems (e.g. baculovirus); microorganisms such as yeast containing yeast vectors, or bacteria transformed by bacteriophage DNA, plasmid DNA or cosmid DNA. In preferred embodiments of the invention, expression of the vector may comprise the CMV promoter (Stephens and Cockett, 1989, Nucl. Acids Res. 17 : 7110) and the origin of the SV40 replica. The expression elements of these vectors vary in strength and specificity. Depending on the host vector system employed, any of several suitable transcription and translation elements may be used.

Any of the above described methods for inserting DNA fragments into a vector may be used to construct expression vectors containing a chimeric gene consisting of transcription / translation control signals and protein coding sequences. These processes may include in vitro recombinant DNA, synthesis techniques and in vivo recombination (genetic recombination). Nucleic acid sequence expression_? encoding an NT-3 protein or fragment

<img file="PT95153B_D0022.tif" />

<img file="PT95153B_D0023.tif" />

71494

6526-040-118

Peptide can be regulated by a second nucleic acid sequence such that the NT-3 or peptide protein is expressed in a host transformed by the recombinant DNA molecule. For example, NT-3 expression may be controlled by any promoter / enhancer element known in the art. Promoters that can be used to control NT-3 expression include, without limitation, the initial promoter region. SV40 (Bernoist and Chambon, 1981, Nature 290 = 304-310), the promoter contained in the 3 'long terminal repeat motif of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22 = 787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc, Natl, Acad. Know. USA 78 = 144-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296 = 39-42); prokaryotic expression vectors such as the β-lactamase promoter (Villa-Kamaroff et al., 1978, Proc. Natl, Acad, Sci, USA, 75 = 3427-3751) or the tac promoter (DeBoer et al., 1983, Proc Natl. Acad. Sci. USA 80 = 21-25), see also Useful proteins from recombinant bacteria in Scientific American, 1980, 242 = 74-94; plant expression vectors comprising the nopaline synthase promoter region (Herrera-Estrella et al., Nature 503 = 209-213) or the do-mosaic virus RNA promoter. dacouverflor. „35.S; (Gardner et al., 1981, Nucl. Acids Res. 9 = 2871) and the photosynthetic enzyme promoter ribulose bisphosphate carboxylase (Herrera-Estrella et al., 1984, Nature 510 = 115-120); yeast or other fungal promoter elements such as the Sal 4 promoter, the ADC (alcohol dehydrogenase) promoter, the PGK (phosphoglycerol kinase) promoter, the alkaline phosphatase promoter, and the following animal transcription control regions showing tissue specificity and which have been used in transgenic animals: elastase I gene control region that is active in pancreatic acinar cells (Swift et al., 1984, Cell 58 = 659-646; Ornitz et al., 1986, Cold Spring Harbor Symp. Qty Biol. 50 = 399-409; MacDonald, 1987, Hepatology 7 = 425-515); insulin gene control region that is active in pancreatic beta cells (Hanahan, 1985, Nature 515 = 115-122), immunoglobulin gene control region that is active in lymphoid cells (Grosschedl et al, 1984, Cell

71494

6526-040-118

<img file="PT95153B_D0024.tif" />

= 647-658; Adames et al., 1985, Nature 318 = 533-538; Alexander et al., 1987, Mol. Cell. Biol. 7 = 1436-1444), mouse mammary tumor virus control region that is active in testicular, cervical, lymphoid, and mast cells (Leder et al., 1986, Cell 45 = 485-495), albumin gene that is active in the liver (Pinkert et al., 1987, Genes and Devi. 1 = 268-276), control region of alpha-fetoprotein gene that is active in the liver (Krumlauf et al., 1985, Mol. Cell , Biol. 5 = 1639-1648; Hammer et al., 1987, Science 235 = 55-58); alpha-1-antitrypsin gene control region that is active in the liver (Kelsey et al., 1987, Genes and Deveri. = 161-171), beta-globin gene control region that is active in myeloid cells (Mogram et al., 1985, Nature 515 = 558-540; Kollias et al., 1986, Cell 46 = 89-94; myelin basic protein gene control region that is active on oligodendrocyte cells in the brain (Readhead et al., 1987, Cell 48 = 705-712); myosin light chain 2 gene control region that is active in muscle (skeletal (Sani, 1985, Nature 514 = 285-286) and the. gene hormone b? in ? liberation \ gonadotrophy.a^;in the hypothalamus (Mason et al., 1986, Science 254 = 1572-1578).

Expression vector insertions containing the NT-3 gene can be identified by 3 general procedures = (a) DNA-DNA hybridization, (b) presence or absence of gene marker functions and (c) expression of inserted sequences. In the first process, the presence of a foreign gene inserted into an expression vector can be detected by DNA-DNA hybridization using probes that include sequences homologous to the inserted gene NT-3. In the second process, the recombinant host / vector system may be identified and selected based on the presence or absence of certain "marker" functions of the gene (e.g. thymidine kinase activity, resistance to antibiotics, transformation phenotypes, formation of baculovirus occlusion bodies, etc.) caused by insertion of foreign genes into the vector »For example, if the NT-3 gene is inserted into the sequence of the vector marker gene, recombinants containing the NT-3 insert can be identified by the absence of the

<img file="PT95153B_D0025.tif" />

71494

6526-040-118

-31 marker gene function. In the third process, recombinant expression vectors can be identified by evaluating the foreign gene product expressed by the recombinant. These assessments may be based, for example, on the physical or functional properties of the NT-3 gene product in bioassessment systems.

Once a certain recombinant DNA molecule has been identified and isolated, various methods already known in the art may be used to propagate it. Once growth conditions and a suitable host system have been established, recombinant expression vectors can be propagated and prepared in appreciable amounts. As noted above, expression vectors which may be used include (but are not limited to) the following vectors or derivatives: human or animal viruses such as vaccinia virus or adenovirus; insect viruses such as baculovirus; yeast vectors; bacteriophage vectors (e.g. lambda) and plasmid and cosmid DNA vectors to name but a few,

In addition, a host cell strain that modulates expression of the inserted sequences or that modifies and processes the gene product in the specific manner desired may be chosen. Expression of certain promoters may be increased in the presence of certain inducers; thus, genetically engineered expression of NT-3 protein can be controlled. It also happens that different host cells have characteristic and specific mechanisms for translation processing, post-translation and modification (eg, glycosation, cleavage). of proteins. Appropriate cell lines or host systems may be chosen to ensure the desired modification and processing of the expressed foreign protein. For example, expression in a bacterial system may be used to produce a non-glycated core protein product. Expression in yeast will produce a glycoside product. Mammalian cell expression can be used to ensure native glycosation of the heterologous NT-3 protein. In addition the different vector / host expression systems may

71494

6526-040-118

<img file="PT95153B_D0026.tif" />

perform processing reactions such as proteolytic cleavages of different intensities.

In a specific arrangement of the invention, prepro NT-3 encoding DNA may be cloned into pCMV plasmid, amplified and then used to transfect COS cells by the calcium phosphate method (Chen and Qkayama, 1987, Mol. Cell. Biol. 7 = 2745-2752); NT-3 activity can then be collected from a cell culture medium (See Sections of Example 6 and 7, infra).

It has been emphasized that NGF is synthesized into two different precursor forms, one long form and one short form (Darling et al., 1983, Cold Spring Harbor Symp. Quant. Biol. 48 = 427-485). The shorter form is substantially analogous to the prepro forms of BDNF and NT-3. According to the invention, it may be desirable to use expression systems comprising DNA encoding a long analogous form of BDNF or NT-3. 0 DNA encoding these long precursor forms can be identified by determining the sequence of cDNA or genomic DNA regions from the coding regions of the NT-3 or mature BDNF peptides, and by locating the open translation reading frame. Alignment of the NT-3 gene sequence with the NGF and BDNF sequences has allowed the prognosis of long and short NT-3 protein precursors (Figure 7B). The effectiveness of mature BDNF or NT-3 expression of long or short precursor forms may depend on the expression system used and may vary from type to type of cell line.

5.3.1. EXPRESS GENE PRODUCT IDENTIFICATION AND PURIFICATION

Once the recombinant expressing the NT-3 gene is identified, the gene product can be analyzed. This is accomplished by assays based on the physical or functional properties of the product, including radiolabelling of the product followed by gel electrophoresis analysis.

Once the NT-3 protein is identified, it can be isolated and purified by classical methods such as chromatography (eg,

71494

6526-040-118

Ion exchange, affinity and column sorting), centrifugation, differential solubility or any other classical technique for protein purification. Functional properties may be assessed by any suitable assay including (but not limited to) the embryonic dorsal root ganglia, sympathetic ganglion neurons or chick neural placode derivatives.

5.4. EVALUATION OF THE BIOLOGICAL ACTIVITY OF NEUR0TROPHINE-5 Any method that qualitatively or quantitatively indicates the activity of NT-3 according to the present invention may be used. Like NT-3, in contrast to BDNF and NGF, it promotes the development of neuritis out of both the sympathetic and nodular ganglia-derived nodes, any of these systems, besides the dorsal root ganglion culture system ( DRG) may be used in the bioassay of NT-3. The DRG assay can be performed as described by Barde st al. (1980, Proc. Natl. Acad. Sci. USA 77: 1199-1205). The nodular ganglion assay system can be performed as described by Lindsay et al. (1985, Dev. Biol. 112: 519-328). The sympathetic ganglion assay system can be performed as described by Barde et al. (1982, EMBO J., 1: 549-553).

5.5. NEUR0TR0FINA-5 GENES AND PROTEINS Using the methods referred to above and those of

Examples 6 and 7, below, the following nucleic acid sequences were determined and their corresponding amino acid sequences deduced. The mouse NT-3 genomic sequence shown in Figure 2 was determined. The mouse NT-3 sequence is shown in Figure 7. The NT-3 DNA genomic sequence shown in Figure 11 was also determined. displays the mouse DNA sequences. Each of these sequences or their functional equivalents may be used in accordance with the invention. In addition, the invention relates to NT-3 genes and proteins isolated from porcine, cattle, felines, birds, horses or canines, as well as primates or any other species where NT-3 activity exists. The invention is also directed to the nucleic acid subsequences of NT-3 which comprise at least

71494

6526-040-118

<img file="PT95153B_D0027.tif" />

Less than ten nucleotides, these subsequences comprising hybridizable portions of the NT-3 sequence having application, e.g. e.g., in nucleic acid hybridization assays, Southern and Northern blot analyzes, etc. The invention also provides NT-3 protein and fragments and derivatives thereof, according to the amino acid sequences set forth in Figures 2, 7 and 11 or their functional equivalents. 0 The invention also prepares fragments or derivatives of NT-3 proteins comprising antigenic determinants or functionally active. Functionally active terms herein mean that they have positive activity in NT-3 known function assays, e.g. ex. nodal ganglion and sympathetic ganglion of the chick embryo.

For example, the nucleic acid sequences depicted in Figures 2, 7 and 11 may be altered by substitutions, additions or deletions that provide functionally equivalent molecules. Due to the degeneracy of nucleotide coding sequences, other DNA sequences encoding substantially the same amino acid sequences depicted in Figures 2, 7 and 11 may be used in the practice of the present invention. They include (but are not limited to) nucleotide sequences that comprise all or part of the NT-3 genes depicted in Figures 2, 7, and 11 that are altered by substituting the different codons encoding a functionally equivalent amino acid residue in the sequence. , thus producing a change without symptoms (silent change). Similarly, the NT-3 proteins or fragments or derivatives thereof of the invention include (without limitation) those which contain, as a major amino acid sequence, all or only part of the amino acid sequence, substantially as in Figures 2, 7 and 11, including altered sequences where functionally equivalent amino acid residues replace residues within the sequence, resulting in a symptomless change. For example, one or more amino acid residues within the sequence may be replaced by other amino acids of similar polarity that act as functional equivalents, resulting in a symptom-free change. The substitutes of a

<img file="PT95153B_D0028.tif" />

71494

6526-040-118

The amino acid within the sequence may be chosen from among other members of the class to which the amino acid belongs. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. Positively charged (basic) amino acids include arginine, lysine and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Also included within the scope of the invention are NT-3 proteins or fragments or derivatives thereof which are differentially modified during or after translation, e.g. eg, by glycosylation, proteolytic cleavage, binding to an antibody molecule or another cell ligand, etc.

In addition, a given NT-3 may, by in vitro or in vivo mutation, create and / or destroy translation, initiation and / or termination sequences, or create variations in coding regions and / or form new restriction sites. endonuclease or destroy pre-existing ones to facilitate further in vitro modifications. Any mutagenesis technique already known in the art, including (without limitation) site-directed in vitro mutagenesis (Hutchinsori et al., 1978, J. Biol. Chem. 253: 6551), the use of TAB (^) links (Pharmacia), etc.

5.6. CREATION OF ANTI-NEUR0TR0FINA-5 ANTIBODIES

According to the invention, the NT-3 protein or fragments or derivatives thereof may be used as an immunizer to raise anti-NT-3 antibodies.

To increase the likelihood of producing an anti-NT-3 immune response, the amino acid sequence of NT-3 can be analyzed to identify those parts of the molecule that may be associated with increased immunogenicity. The amino acid sequence may e.g. be subjected to a computer analysis to identify surface epitopes according to the method of Hopp and Woods (1981, Proc. Natl. Acad. Sci. USA 78: 3824-3828) which has been successfully applied to identify

71494

6526-040-118

<img file="PT95153B_D0029.tif" />

Hepatitis B surface antigen antigenic peptides. Alternatively, the deduced NT-3 amino acid sequences for the different species can be compared and the relatively non-homologous regions identified; These non-homologous regions are more likely to be immunogenic for the various species.

For preparing monoclonal antibodies directed to NT-3 any technique that produces antibody molecules by culturing continuous cell lines may be used; For example, the hybridoma technique, originally developed by Kohler and Hilstein (1975, Nature, 256 = 495-497), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al. 1983, Immunology Today 4:72) and the EBV-hybridoma technique for producing monoclonal antibodies in man (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96) and similar ones are within the scope of the present invention.

Monoclonal antibodies for therapeutic use may be human monoclonal antibodies or chimeric mouse (or other species) monoclonal antibodies. Human monoclonal antibodies can be prepared by any of the numerous techniques known in the art (e.g., Teng et al., 1983, Proc. Natl. Acad. Sci. USA 80: 7308-7312; Kozbor et al. 1983, Immunology Today 4 = 72-79 (Olsson et al. 1982, Meth. Enzymol 92 = 3-16). Chimeric antibody molecules may be prepared containing a mouse antigenic binding domain with human constant regions (Morrison et al., 1984, Proc. Natl. Acad. Sci. USA 81: 6851, Takeda et al., 1985, Nature 314 : 452).

Various methods already known in the art may be used to prepare polyclonal antibodies against NT-3 epitopes. For antibody production, various host animals may be immunized by injection with NT-3 protein or fragments or derivatives thereof, including (without limitation) rabbits, mice, rats, etc. Various adjuvants may be used to enhance response. depending on the host species, including (without

<img file="PT95153B_D0030.tif" />

71494

6526-040-118

Freund's reagent (complete and incomplete), mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol and potentially useful adjuvants for man such as BCG (Bacillus Calmette-Guerin) and Corynebacterium parvum.

A molecular clone of an antibody against an NT-3 epitope can be prepared by known techniques. Recombinant DNA methodology (see, e.g., Maniatis et al., 1982, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York) can be used to construct nucleic acid sequences encoding a monoclonal antibody molecule or antigen binding region thereof.

Antibody molecules may be purified by known techniques, e.g. by immunoabsorption or immunoaffinity chromatography, by chromatographic methods such as HPLC (high performance liquid chromatography) or a combination of these methods.

Antibody fragments containing the idiotype of the molecule may be prepared by known techniques. For example, such fragments include (but are not limited to): the F (ab ') 2 fragment that can be produced by pepsin digestion of the antibody molecule; Fab 'fragments which can be obtained by reducing the disulfide bridges of fragment F (ab') 2, β Fab or Fab 2 fragments which can be obtained by treating the antibody molecule with papain and a reducing agent.

5.7. UTILITY OF THE INVENTION The present invention relates to the preparation of the NT-3 nucleic acid sequence and that of substantially pure protein and fragments of peptides or derivatives derived therefrom. NT-3 can be prepared in sufficient amounts for diagnosis and therapeutic applications. Anti-NT-3 antibodies and NT-3 nucleic acids may also be used in diagnostics and therapeutic applications. For most purposes it is

<img file="PT95153B_D0031.tif" />

71494

6526-040-118

It is preferable to use NT-3 genes or gene products of the same species for diagnostic and therapeutic purposes, although the use of cross-species may be useful in specific arrangements of the invention.

5-7.1. DIAGNOSTIC APPLICATIONS The present invention which relates to nucleic acids encoding NT-3 and proteins, peptide fragments or derivatives as well as antibodies to NT-3 protein, peptides or derivatives may be used to diagnose diseases and disorders of the NT-3. nervous system that may be associated with changes in NT-3 expression pattern.

In various embodiments of the invention, NT-3 genes and their nucleic acid sequences and subsequences including complementary sequences may be used in diagnostic hybridization assays. NT-3 nucleic acid sequences, or their subsequences comprising about 15 nucleotides, may be used as hybridization probes. Hybridization assays may be used to detect, predict, diagnose or monitor conditions, disorders or diseases associated with changes in NT-3 expression, including in particular those resulting from damage to sensory neurons. These diseases and conditions include (but are not limited to) CNS trauma, infarction, infection, degenerative nerve diseases, malignant states, or postoperative changes including (but not limited to) Alzheimer's disease, Parkinson's disease, and Huntington's chorea. For example, total RNA in a patient's tissue sample can be evaluated by the presence of NT-3 mRNA, where a change in the amount of NT-3 mRNA is indicative of neuronal degeneration.

In other embodiments of the invention protein-directed antibodies, peptide fragments or NT-3 derivatives may be used to diagnose diseases and disorders of the nervous system, including in particular sensory disorders and degenerative retinal disorders, as well as above disorders and diseases. Antibodies of the invention may be used e.g. ex.

71494

6526-040-118

<img file="PT95153B_D0032.tif" />

In situ hybridization techniques using tissue samples obtained from a patient in need of such evaluation. In another example, the antibodies of the invention may be used in ELISA procedures to detect and / or measure amounts of NT-3 present in tissue samples or of fluids; Similarly, the antibodies of the invention may be used in Western blot analysis to detect and / or measure NT-3 present in tissue or fluid samples.

In other embodiments of the invention, NT-3 protein, peptide fragments or derivatives may be used to diagnose diseases and disorders of the nervous system. In a particular arrangement (and without limitation) labeled protein or peptide fragment may be used to identify tissues. or cells expressing the NT-3 receptor to identify aberrations of NT-3 receptor expression and, consequently, potential abnormalities in the tissue or cellular response to NT-3,

5,7,2. THERAPEUTIC APPLICATIONS The present invention which relates to nucleic acids encoding NT-3 and its protein, peptide fragments or derivatives thereof, as well as antibodies directed against NT-3 protein, peptides or derivatives may be used to treat disorders and disorders of the nervous system that may be associated with changes in NT-3 expression pattern or that may benefit from exposure to NT-3 or anti-NT-3 antibodies.

In various embodiments of the invention, NT-3 protein, peptide fragments or derivatives may be administered to patients whose nervous system has been affected by trauma, surgery, ischemia, infection, metabolic disease, nutritional deficiency, malignant conditions or toxic agents. . In various specific embodiments of the invention, NT-3 may be administered locally to sensory neurons that have been impaired by including (without limitation) neurons in the dorsal root ganglia or in any of the following tissues: geniculate, rock, and knotted ganglia; the vestibulo-acoustic complex of the 82 nerve

<img file="PT95153B_D0033.tif" />

71494

6526-040-118

-40 'cranial; the ventrolateral pole of the maxillo-mandibular lobe of the trigeminal ganglion, the mesencephalic trigeminal nucleus and the sympathetic ganglia. It may be desired to administer the NT-3 related peptides or NT-3 protein by membrane adsorption, e.g. eg, a silastic membrane that may be implanted near the affected nerve. The present invention may also be used e.g. ex. to accelerate the recovery of patients suffering from diabetic neuropathies, e.g. e.g. diabetic peripheral neuropathies and multiplex mononeuropathies.

In addition to diabetic neuropathies, NT-3 or NT-3-related peptides may also be used to treat other peripheral neuropathies including (but not limited to) the following virus-associated neuropathies, including acquired immunodeficiency syndrome-related neuropathy. (AIDS), polyneuritis infectious mononucleosis, viral hepatitis with polyneuritis; Guillian-Barre syndrome; botulism-related neuropathy; toxic polyneuropathies including lead and alcohol related neuropathies; nutritional neuropathies including subacute combined with degeneration; angiopathic neuropathies including neuropathies associated with systemic lupus erythematosus; sarcoid-associated neuropathy; carcinomatous neuropathy; compression neuropathy (eg carpal aeroembolism syndrome) and hereditary neuropathies. Hereditary neuropathies that can be treated using NT-3 or NT-3-related proteins include perineum muscle atrophy, family dysautomy, and progressive hypertrophic neuropathy.

In other embodiments of the invention, protein or peptide fragments or NT-3 derivatives may be used to treat congenital conditions or neurodegenerative disorders including (but not limited to) Alzheimer's disease, Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis and Huntington's chorea.

In a specific arrangement of the invention, administration of the

<img file="PT95153B_D0034.tif" />

71494

6526-040-118

The NT-3 protein, or peptide fragments or derivatives thereof, may be used in conjunction with surgical tissue implantation in the treatment of Alzheimer's disease and / or Parkinson's disease. As shown in Section 11, below, NT-3 improves survival of dopaminergic neurons; Since dopaminergic neurons are destroyed in Parkinson's disease, NT-3 can be used in methods of treating Parkinson's disease, which comprises administering an effective amount of NT-3 to a patient in need of such treatment. Approximately 35% of patients with Parkinson's disease were found to have Alzheimer's dementia; NT-3 produced according to the invention may prove to be a unique therapy agent useful for this disease complex. Similarly, NT-3 prepared according to the invention may be used to therapeutically treat Alzheimer's disease in conjunction with Down's syndrome. In addition, as shown in Section 12, below, NT-3 is expressed at high levels during nervous system development and differentiation; NT-3 can thus be used to treat disorders of the development of the nervous system, such as Down's syndrome, and also to treat disorders related to cell de-differentiation, such as in malignant states or disorders that may benefit from nervous system regeneration. NT-3 produced according to the invention can be used in the treatment of various types of dementia as well as in congenital learning disorders.

In other embodiments of the invention, NT-3 protein, fragments or derivatives may be used in conjunction with other cytokines to achieve a desired neurotrophic effect. For example (and not as a limitation), NT-3 prepared by the invention may be used in conjunction with a second agent, for example NGF -or BDNF to achieve a synergistic stimulatory effect on neuron growth and / or maintaining survival and / or restoring or improving functions where the term synergistic means that the effect of combining protein, peptide fragments or NT-3 derivatives with a second agent achieves a greater effect than the substance used.

71494

6526-040-118

-42 only individually. It is intended that NT-3 can function synergistically with other CNS-derived peptide factors already fully characterized in the growth, development, maintenance of differentiated function and survival of a large order of neuronal subpopulations of the central nervous system. Alternatively the effects of NT-3 and a second neurotropic agent may be additive.

It is also envisaged that, based on the full characterization of the NT-3 molecule, new fragments of NT-3 peptides, derivatives or mutants capable of acting as antagonists of some or all of the biological functions of NT may be developed. -3. These NT-3 antagonists may be useful in eliminating sensory neurons, e.g. eg in the treatment of chronic pain syndromes.

In still other embodiments of the invention, antibodies directed to the NT-3 protein or its peptide fragments or derivatives thereof may be administered to patients suffering from various neurological disorders and diseases and in need of such treatment. For example, patients suffering from excessive NT-3 production may require such treatment. Anti-NT-3 antibodies may be used to prevent abnormal regeneration of sensory neurons (e.g. after operation), or, as discussed above, in the treatment of chronic pain syndromes.

Tissue distribution of NT-3, as described in Sections 6 and 7 below, indicates that elevated levels of NT-3 mRNA are expressed in the brain, kidneys, heart and spleen, among other tissues. NT-3 produced in non-neural tissues may or may not be identical to NT-3 expressed in the brain. One species of NT-3 can function in both neural and nonneural tissues; Disorders in NT-3 expression may be the basis of diseases affecting the nervous system as well as other organ systems. On the other hand, a very close family of NT-3 molecules may serve different functions in neural and nonneural tissues. The NT-3 molecules of the invention may therefore be useful in treating diseases that also affect neural regulation of

71494

6526-040-118

<img file="PT95153B_D0035.tif" />

Non-neural tissues, including in particular the heart, hematopoietic, renal and reticuloendothelial systems,

As exemplified in Section 6, below, NT-3 expression is increased in immature animals compared to adult animals. According to the invention, NT-3 may be particularly useful in treating developmental disorders or, alternatively, in inducing nervous system renewal following CNS damage.

5.8. PHARMACEUTICAL CONSIDERATIONS

Active compositions of the invention, which may include part or all of the NT-3 gene product, including protein, peptide fragments or derivatives thereof or antibodies (or antibody fragments) directed against protein, peptide fragments or derivatives thereof. NT-3 or a combination of NT-3 and at least one other agent such as NGF or BDNF may be administered in any pharmaceutically biocompatible sterile vehicle including (but not limited to) saline, buffered saline, dextrose and water.

The protein, NT-3 peptide fragments or derivatives may comprise an amino acid sequence or a sequence thereof, substantially as shown in Figures 2, 7 or 11; It may be preferable to use NT-3 protein comprising in particular part or all of the amino acid sequence from about amino acid 140 to about amino acid 258, as shown in Figure 2, from about amino acid 1 to about amino acid 119. in Figure 7, or from the first mature labeled amino acid in Figure 11 to the end of the peptide sequence depicted therein, or a functionally equivalent sequence, since this subsequence is thought to comprise the functional part of the NT-3 molecule. NT-3 may be derived from sequences that match the NT-3 genes of any suitable species including (but not limited to) man, pig, rat, chicken, cow, dog, sheep, goat, the cat, the rabbit, etc.,

The amount of protein, peptide fragments or derivatives of NT-3, or antibody that is effective in treating a

71494

6526-040-118

<img file="PT95153B_D0036.tif" />

The particular disorder or condition depends on the nature of the disorder or condition and can be determined by classical clinical techniques. Wherever possible, it is desirable to determine the dose response curve of the pharmaceutical compositions of the invention first in vitro, e.g. ex. NT-3 bioassay systems described above, and then to useful animal model systems, prior to testing them in man. Based on the in vitro results, in one specific embodiment of the invention, a pharmaceutical composition effective in promoting survival of sensory neurons can provide a local concentration of NT-3 protein between about 0.1 and 10 ng / ml.

Methods of introduction include (without limitation) intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, oral and intranasal. Further it may be desirable to introduce the pharmaceutical compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, e.g. eg, connected to a reservoir, e.g. ex. an Ommaya reservoir.

In addition it may be desirable to administer the compositions of the invention locally in the area in need of treatment; this may be achieved, for example, and not as limitation, by local infusion during surgical operation, by injection, by means of a catheter or by means of an implant, said implant being a porous, non-porous or gelatinous, including membranes, e.g. sialastic membranes or fibers.

The invention also provides pharmaceutical compositions comprising NT-3 proteins, peptide fragments or derivatives administered via liposomes, microparticles or microcapsules. In various embodiments of the invention it may be useful to use such compositions to achieve delayed release of NT-3 or NT-3 related products.

It is intended to be possible to introduce cells actively producing NT-3, NT-3 related substances, NT-3 antagonists or anti-NT-3 antibodies into areas in need of

<img file="PT95153B_D0037.tif" />

71494

6526-040-118

-45 increased or decreased NT-3 concentrations.

6 EXAMPLE: CLONATION AND CHARACTERIZATION OF THE

Mouse NEUR0TR0FINA-3

6-1. MATERIALS AND METHODS

6.1.1. POLYMERASE CHAIN ​​REACTION Two oligonucleotide primers were synthesized based on 2 BDNF conserved amino acid sequences and all known NGFs (Leibrock et al., 1989, Nature 341 = 149-152). The sense (or 5 ') primer sequence was GGGGATCCGC GGI TGY MGI G6I ATH GA (primer 1, IUPAC nomenclature, I = inosine) and included BamHI and SacII sites, and the antisense (or 3') primer sequence was TCGAATTCTAG AT ICK IAT RAA ICK CCA and included EcoRI and Xbal sites (primer 2). PCR (Saiki et al., 1985, Science 250 = 1350-1554) was performed with 1 µg mouse genomic DNA using a Perkin-Elmer Cetus thermal cycler and Taq polymerase (Gene Amp ^). After 4 cycles at an annealing temperature of 45 ° C, the remaining 36 cycles were performed at temperatures of 49 ° C. The resulting amplified DNA products corresponding to size

<img file="PT95153B_D0038.tif" />

Expected (137 base pairs) were eluted from ura / acrylamide, reamplified and digested with HindII and Apal, the former to cleave mouse NGF, the latter to mouse BDNF. Undivided DNA was eluted, asymmetrically amplified (Innis et al., 1988, Proc. Natl. Acad. Sci. USA 85 = 9456-9440) and sequenced (Sanger et al., 1979, Proc. Natl. Acad. Sci. USA 72 = 5918-5921) using primers 1 and 2. Based on the signed sequence obtained, 2 more sense primers corresponding to nucleotide 802-822 (primer 3) and 824-844 (primer 4) were added to which the Sall and PstI sites were joined. RNA was extracted from the brain, liver and muscle of the adult mouse (Okayama et al., 1987, Meth. Enzymology 154 = 5-28) and inversely transcribed using the antisense primer (5 ') CGGATCCGAATTCTGCAG (T) i2^v(primer 5) to simulate 3 'poly (A) tails containing BamHI, EcoRI and PstI cloning sites (Leibrock et al., 1989, Nature 541 = 149-152). These cDNAs were first PCR amplified using primers 3 and 5 and re-amplified using primers 4 and

71494

6526-040-118

-465. Southern blot analysis was performed on the resulting reaction products and hybridized to an end-labeled oligonucleotide with³²P, corresponding to nucleotides 879-893. The DNA fragments thus identified were cloned into a Bluescript (R) SK + vector (Stratagene) and the longest insert obtained (460 base pairs) was used to screen an EM8L3 mouse genomic library (Clontech). 2 positive clones were found and DNA from one clone with various restriction enzymes was digested. Restriction fragments were probed with the insertion of 460 base pairs: a 770 base pair HindIII fragment and a 4000 base pair PstI fragment · were subcloned into Bluescript (^) SK +. HindIII- to the extent 3 'to 5' using the PstI fragment.

6.1.2. NORTHERN STAIN ANALYSIS

Total RNA was extracted from adult female tissues (Okayama et al., 1987, Meth. Enzym. 154: 5-28) and electrophoresed on agarose gels containing 1.3% formaldehyde (Hehrach et al. 1977, Biochem 16: 4745-4751). RNA was transferred to nylon membranes (Hybond-N, Amersham) and hybridized overnight at 42 ° C in 1 ml 200 mM sodium phosphate (pH 7.2) containing 40% formamide, SxDenhardt solution and 200 µg ml^-denatured salmon sperm DNA. The probe used was marked with ^ 2p_{s was a} double-loop probe with random primers (Feiberg et al., 1979, Anal. Biochem. 157: 266-267) corresponding to nucleotides 319-1093 (Fig. 2). Specific activity was 1.3x10⁸ cpm x wg^-1, and joined 10? to the hybridization buffer. The wash lasted 60 min at 60 ° C in 0.1xSSC containing 0.5¾ SDS. The filters were exposed for 5 days at -70 ° C with intensifier filters.

6.1.3. EXPRESSION OF NEURQTROPHIN-5 Oligonucleotide primers corresponding to the first 19 nucleotides (plus an EcoRI site) and the last 19 nucleotides (plus a BamHI site) of the open reading frame shown in Fig. 2 were synthesized. PstI genomic fragment (Fig. 2), the product

<img file="PT95153B_D0039.tif" />

71494

The resulting 6526-040-118 was cloned into the EcoRI-BamHI site of the pCMV expression vector (Anderson et al., 1989, J. Biol. Chem. 264: 8222-8229). The nucleotide sequence of the insertion of NT-3 into pCMV was determined. COS-1 cells were transfected using the calcium phosphate process (Chen and Okayama, 1987, Mol. Cell. Biol. 7 = 2745-2752) and the medium was collected as previously described (Leibrock et al., 1989, Nature 541 = 149-152K. Control media were obtained after treatment of COS-1 cells with calcium phosphate or a construction ^: pCMV / NT-3 where the stop codon of NT-3 had been rejected. Both media were devoid of biological activity at a dilution of 1 = 50. Knotted ganglia were dissociated, neurons cultured in 24-well plates (Lindsay et al., 1985, Dev. Biol. 112 = 319-328), and BDNF was purified from pig brain (Hofer and Barde, 1988 , Nature 551 = 261-262).

6.2. RESULTS AND DISCUSSION

An important problem in characterizing neurotrophic factors is their extremely low abundance. Both NGF and BDNF were characterized using protein assays based on biological assays to control their activity (Cohen et al., 1960, Proc. Natl. Acad. Sci. USA 46 = 302-311; Barde et al., 1982, EMBO J. 1 = 549-553). This approach was possible with NGF due to the extraordinary abundance of this protein in the submandibular gland of the adult male mouse and lately with BDNF due to the virtually unlimited availability of porcine brain tissue. The sequence identity detected in NGF and BDNF suggested that a different strategy could be used to characterize other members of what was determined to be a gene family (Leibrock et al., 1989, Nature 541 = 149-152). A detailed comparison of mouse NGF and BDNF amino acid (aa) sequences revealed 2 portions of aa (underlined in Fig. 2) that seem particularly suited for an approach that uses oligonucleotide primers in a polymerase chain reaction (PCR) ( Saiki et al., 1985, Science 250 = 1550-1554). Mouse genomic pattern was used because in the NGF and BDNF genes no intron interrupts the

71494

6526-040-118

<img file="PT95153B_D0040.tif" />

exon coding of biologically active proteins. This approach results in the expected amplification of NGF and BDNF sequences which were then digested using appropriate restriction enzymes. An intact DNA fragment was sequenced and the sequence was found not to correspond to either BDNF or NGF. Two sense primers (or 5 ') specific for new PCRs were sintered using complementary DNA prepared by reverse RNA transcription as standards. extracted from mouse brain, muscle and liver, and a primer 3¹ to simulate poly A sequences (Fig. 2). These three tissues gave amplified products of similar size, which were cloned and used to screen a mouse genomic library. One of the genomic clones thus obtained was sequenced (Fig. 2). An open reading frame indicates a 258 aa protein (starting at the first methionine found after 3 stop codons in the framework). In all respects, the overall protein structure indicated is similar to that established for NGF and BDNF = an assumed 18 aa signal sequence (showing 5 and 9 aa identities with BDNF and NGF respectively) is followed by a 121 aa sequence. These sequences, presumably implicated in the establishment and proper formation of the disulfide bridges of these proteins (Edwards et al., J. Biol. Chem. 263: 6810-6815), have been found in mouse NGE (103 aa) and BDNF (112 aa) from the mouse. A single potential N-glycosylation site is 9 aa (compared to 8 in BDNF and NGF) before what we propose to be the cleavage site, characterized by a group of basic residues, giving rise to mature NT-3 ( Fig. 2, arrow), The mature NT-3 is expected to be 119 aa (relative molecular mass 13,625 and p1 9.3). Comparison between mature mouse NGF, BDNF and NT-3 reveals 54 aa identities (Fig. 2). All 6 cysteine ​​residues known to be involved in the formation of disulfide bridges in NGF and BDNF (Leibrock et al., 1989, Nature 541 = 149-152); Angeletti, 1973, Biochemistry 12 = 100-115) are among the conserved residues (Fig. 3, arrows). It is remarkable that the addition of the NT-3 sequence to the NGF

<img file="PT95153B_D0041.tif" />

and BDNF reveal that only 7 identical aa have been lost (61 aa identical when comparing mouse NGF and BDNF). This conserves almost 50¾ of the primary structure and is probably necessary for the formation of a basic form.

3-dimensional common to all 3 proteins. In addition, comparison of the 3 sequences reveals 4 variable domains, each 7 to 11 aa in length (numbered VI through V4 in Fig. 3), presumably implicated in the neuronal specificity exerted by these proteins.

To study expression of the NT-3 gene, RNA was extracted from various mouse tissues and analyzed with a specific NT-3 probe (Fig. 4). A single band of about 1.4 kilobases was found in all tissues examined (Fig. 4A). However the expression level of this mRNA varies considerably. In the brain (Fig. 4B) there were marked regional differences with the highest mRNA levels observed in the cerebellum and hippocampus (Fig. 4B). These results demonstrate that the distribution of NT-3 mRNA in adult mouse tissue is very different from that of BDNF and NGF mRNA. In fact, BDNF mRNA is predominantly found in the brain, and NGF mRNA is difficult to detect in tissues such as liver or skeletal muscle (Heumann st al., 1984, EMBO 3.3 = 3138-3189), It is however intriguing to note that the hippocampus, known to express NGF mRNA (Korsching et al., 1985, EMBO 3. 4 = 1389 = 1393) also express BDNF and NT-3 mRNAs and in much larger amounts than in most other brain regions (Fig. 4B).

In order to investigate whether NT-3 is a secreted and biologically active protein, the entire protein coding sequence was cleaved into an expression vector (pCMV) used to transfect COS (monkey kidney) cells (Fig. 5). . Given the fact that NT-3 mRNA is found in peripheral tissues, we have cultivated several embryonic chick neurons known to project these tissues and to require tropic factors to survive. In the presence of NT-3, motor neurons purified from the spinal cord of 6-day-old embryos (E6) were not survived (Dohrmann et al = 1986, Dev,

<img file="PT95153B_D0042.tif" />

71494

6526-040-118

-50Biol. 118 = 209-221), ciliary neurons (E8) and dissociated sympathetic neurons (Eli). However, sensory neurons isolated from E8 primary sensory ganglia were found to respond. As shown here (Fig. 5), NT-3 supports the survival of about 30% of the isolated knot ganglion neurons. Moreover, this effect is additive to that of BDNF synthesized in the central projection fields, and is known to act on a subpopulation of knotted neurons (Lindsay et al., 1985, Dev, Biol, 112 = 319-328), and both combined factors save most neurons (90 () (Fig. 5). It is important to note that NT-3 mRNA is found in the visceral targets of this ganglion, including the heart, intestines, liver and lungs (Fig, 4A). ). Populations of NT-3-sensitive sensory neurons are also found in the dissociated dorsal root and trigeminal E8 ganglia and in E8 sympathetic ganglion explants. It thus appears that NT-3 has a hitherto uncharacterized biological activity present in a number of peripheral tissues including the liver (Lindsay and Tarbit, 1979, Neuro Sci, Lett. 12 = 195-200) and the skeletal muscle (Davies, 1986, Dev. Biol. 115 = 56-67), and is known to support the survival of visceral and proprioceptive sensory neurons that do not respond to NGF (for a review on the subject, see Davies, 1987, Development 101 = 185-208).

Taken together, these findings indicate that NT-3 is a neurotrophic factor linked, in both structure and function, to NGF and BDNF, the first two neurotrophins. We propose that the name neurotrophin (NT) apply to this class of protein and, in analogy with interleukins, number in the order of its discovery.

7 EXAMPLE: D0 GENE CLONATION AND CHARACTERIZATION

NEUROTROPHIN-3 P0 MOUSE

The homology between NGF and BDNF was used to establish a cloning strategy to search for new members of this gene family. ' We describe the cloning of a gene encoding a third member of the BDNF / NGF family, which we termed neurotrophin-3 (NT-3). This new factor reveals distinct biological activity and spatiotemporal expression when

71494

6526-040-118

-51compares with ο NGF and BDNF.

7.1. MATERIALS AND METHODS

7.1.1. Polymerase CAPE REACTIONS

Degenerate oligonucleotides corresponding to segments of four highly conserved protein sequences between NGF and BDNF were synthesized; the protein sequences (which can be found within the NGF / 8DNF sequences in Fig. 7D) were (1) Gly-Glu- (Tyr / Phe) -Ser-Val-Cys-Asp-Ser, (2) Lys-Gln -Tyr-Phe- (Tyr / Phe) -Glu-Thr-Lys-Cys, (3) Gly-Cys-Arg-Ile-Asp, and (4) Trp-Arg-Phe-Ile-Arg-Ile-Asp -Thr- (Ser / Ala) -Cys-Val-Cys. In the PCR reactions, a series of sense and antisense degenerate oligonucleotides (containing a degenerate portion of 15-26 nucleotides in length, corresponding to 5-9 amino acids from the protein sequences indicated in the sense and antisense directions as well as as a non-degenerate tail encoding restriction enzyme recognition sites). Amplification reactions between pairs of upstream, sense, and antisense primers_z downstream, were performed under the conditions recommended by Perkin-Elmer / Cetus, except that the quenching temperature, Mg⁺⁺ and extension time varied to determine optimal conditions for each pair of primers. The exact sequence of sense primer 1B (encoding a portion of the above protein sequence 1) was 5'-GACTCGAGTCGACATCG-GTN-TGY-GAY-WSN-RTN-WS-3 'and that of antisense primer 2C (corresponding to antisense codons of a portion of the protein sequence 2, above) was 5'-CCAAGCTTCTAGAATTC-CA-YTT-NGT-YTC-RWA-RAA-RTA-YTG-3 '(abbreviations for nucleotides according to IUPAC code) . Further analysis of the sequences showed that oligonucleotide 1B had a mismatch of 2 nucleotides with the NT-3 sequence while oligonucleotide 2C had a mismatch of 1-nucleotide with the sequence of NT-3. Radiolabeling was performed. by PCR according to the recommended gene amplification reaction by Perkin-Elmer / Cetus with the following modifications: 1 10 ng of the low melting agarose DNA standard was added to a reaction mixture containing unlabeled dATP, dGTP and DTTP at a final concentration of 50wM; 50 µl 32 µpec (3000 Ci / mmole) was added per 50 µl of the mixture.

71494

6526-040-118

The reagent was subjected to seven rounds of amplification. The amplification primers were identical to the degenerate primers used in the original PCR.

7.1.2. SOUTHERN STAIN OF MOUSE GENETIC DNA USING NT-3 PROBE

Obtained PCR product R1B / 2C by amplification of rat genomic DNA standard using degenerate primers 1B and 2C as described above in Section 7.1.1._z derived using degenerate primers 1B and 2C (called R1B / 2C), detects a new gene, NT-3, as well as the NGF and BDNF genes in the rat genomic DNA. DNA was prepared from the Fischer rat liver (Maniatis et al., 1982, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor)), digested with EcoRI and 10 µg fractionated on gel. at 1% agarose. DNA was transferred to nitrocellulose using 10X SSC (Maniatis et al., 1982, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor)), hybridized (Mahmoudi and Lin, 1989, Biotechniques 7: 331-3) with the R1B / 2C labeled PCR product ³²At 60 ° C, and washed in 2X SSC / 0.1% SDS at 65 ° C. NT-3, NGF and BDNF bands are indicated; The position of the NGF and BDNF bands were previously determined using specific probes. Sizes are indicated on the left in kilobases (kb).

7.1.3. NEURQTROPHIN-3 EXPRESSION

The NT-3 expression construct was obtained using PCR to amplify the coding region of the supposed short NT-3 precursor from a plasmid containing the 3.2 kb Sstl mouse genomic fragment (Fig. 6B) which encompasses the NT-3 gene; oligonucleotides used in the PCR reaction contained synthetic XhoI recognition sites at their ends to allow insertion of the amplified coding region into the XoI site into the pCDMS expression vector polylinker (Seed, 1987, Nature 329: 840 -42). The exact oligonucleotides, used to amplify the codon region of the raft NT-3 gene, were the primer upstream of 5'-CGG TAC CCTCGAGCC ACC ATG TCC ATC TTG TTT TATGTG-3 '( the ATG

71494

6526-040-118

-53 underlined corresponds to the start codon of the starting site B, with the downstream sequence of ATG simulating exactly the sequence of NT-3; upstream of the ATG the primer contains a synthesis site Xhol) and the downstream antisense primer 5 ”- CGG TAC CCT CGA GAT GCC AAT TCA TGT TCT TCC 6-3 '(the underlined triplet is complementary to the stop codon of NT-3 gene (this triplet is flanked by the NT-3 antisense sxact sequence, and there is an XhoI site at the 5 'end of this primer). 0 The resulting rat NT-3 expression plasmid was called pC8-rN3 (Pl). Similar strategies have previously been used to insert rat NGF and BDNF coding regions into the XhoI site of the same pCDMS vector. The expression constructs of NT-3, NGF and BDNF were transfected as described in Okayama s Berg (1982, Mol. Cell, Biol. 5 = 1136-42) in COS-M5 cells seeded at 5x10 4 cells per 60 mm plate and cultured in 2.5 ml Dulbecco's Modified Eagle's Medium containing high glucose (4500 mg / ml) and 10% fetal bovine serum; supernatants were harvested 72 h after transfection,

7.2, RESULTS

7.2.1, CLONATION OF NEUR0TR0FINA-5 GENE Desired size amplification products (predicted from NGF and BDNF sequences) were obtained using different pairs of degenerate oligonucleotides. These products were first subjected to restriction enzyme analysis for determine the relative content of NGF, BDNF or new sequences. In all cases, restriction fragments corresponding only to NGF and BDNF sequences were detectable by the ethidium bromide stain. However, the use of the same PCR products as Southern blot probes of mouse genomic DNA revealed that one product (designated R1B / 2C, see Fig. 6A) identified a new genomic DNA sequence in addition to NGF and BDNF. (Fig. 6A); thus screening for Southern blot PCR products allowed the identification of rare amplified sequences that were undetectable by other means. The R1B / 2C probe also detected new sequences in the DNA.

71494

6526-040-118

<img file="PT95153B_D0043.tif" />

genomic species have divergent evolution (including man, mouse, chicken, and Xenopus) suggesting that this probe identifies a functional gene.

In order to isolate this gene the R1B / 2C probe as well as NGF and BDNF specific probes were used to screen (Maniatis et al., 1932, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor)) a rat genomic DNA library (purchased from Clontech Laboratories, Inc., Palo Alto, CA) prepared from Sprague-Dawley rat DNA (partially digested with Sau3A restriction endonuclease and cloned into bacteriophage vector EMBL3 / SP6 / T7. Two independent bacteriophage clones were found that hybridized to the R1B / 2C probe but neither of the other two probes. Analysis of the restriction map of the rafo genomic insertions in these clones showed that they corresponded to the same gene (Fig. 6B). The longest inserting bacteriophage clone was named (J&gt; rN3 (Gl). Sequence analysis proved that the gene identified by R1B / 2C encodes a new member of the NGF / BDNF family (see Fig. 7) we called neurotrophin-3.

7.2.2. MATURE NEURQTROFIN-3 SEQUENCE ANALYSIS DNA sequencing was performed by the dideoxy nucleotide chain termination method (Sanger et al., 1977, Proc. Natl. Acad. Sci. USA 74 = 5463-7) using the SEQUENASE Version kit 2.0 provided by the United States Biochemical Corporation, using protocols recommended by the manufacturer.

NGF has two distinct precursor forms, called long (starting at starting site A) and short (starting at starting site B) that differ by the length of their N-terminal sequences (Darling et al., 1987, Cold Spring Harb). Quant. Biol. 1 = 427-34; Selby st. Al., 1987, Mol. Cell Biol. 7 = 3057-64; Edwards et al., 1988, Mol. Cell Biol. 8 = 2456-64). Both long and short precursors can be proteolytically cleaved, yielding the mature form of NGF which essentially constitutes the 120 amino acids of the carboxy terminus of each precursor. BDNF may also have long and precursor forms

71494

6526-040-1IS

<img file="PT95153B_D0044.tif" />

short

NGF gene sequencing from different species revealed that most of this additional N-terminal sequence is in separate exons except for 4 codons (Val-His-Ser-Val) which are included at the 5 'end of the coding exon. all short precursor (starting point B). We have previously demonstrated that 2 of these 4 codons (Val-XX-Val) as well as the preceding RNA junction receptor site are conserved just upstream of the 'B' start site conserved in BDNF genes isolated from different species; This discovery leads us to propose the existence of both long and short precursor forms of BDNF. There is conservation of the Val-XX-Val codons as well as the junction receptor site in the rat NT-3 gene; this junction receptor site and the proposed intron boundary are shown in Figure 7A. These sequence considerations lead us to predict the existence of upstream coding exons for the NT-3 gene, which would encode a long precursor form. The discovery of sequences conserved upstream of the supposed NT-3 start site A further reinforces our prediction of the existence of a long BDNF precursor and suggests an evolutionarily conserved important role of this long precursor to BDNF. all members of the NGF family. The predicted N-terminus of mature NT-3 follows a canonical protease cleavage sequence (Arg-Arg-Lys-Arg), very similar to those found in NGF and BDNF (Fig. 7A, C). In some species, the two C-terminal amino acids of NGF are also proteolytically removed. Unlike NGF, rat NT-3 does not have an obvious potential fission site at its C-terminus (Figure 7A, C) and we infer that, as with BDNF in all species examined so far, there are no proteolytic changes in the C-terminal. NT-3 terminal C.

Based on these considerations, the predicted size of mature NT-3 polypeptide is 119 amino acids with an estimated pi of about 9.5. Thus, in size and load, NT-3 closely resembles NGF and BDNF. The seven terminal amino acids

N of mature NT-3 differ completely from NGF and BDNF, departing from

71494

6526-040-118

<img file="PT95153B_D0045.tif" />

of the eighth amino acid of mature NT-3, optimal alignment required a simple 2 amino acid failure with respect to BDNF and a single amino acid insertion with respect to NGF (Fig. 7D). Mature rat NT-3 shows a 57¾ amino acid homology to rat NGF and a 58ologia amino acid homology to rat BDNF; 57 of the 120 residues (48¾) are for all three proteins (Fig, 2D). The six cysteine ​​residues found in NGF and BDNF are absolutely conserved in NT-3 and the regions of highest homology between the three proteins are clustered mainly around these cysteine ​​residues.

relationship to shared

7.2,3. NEURQTRQFINA-3 PRECURSOR ANALYSIS

Just upstream of the presumed fission site that releases mature NT-3 is a universal glycosylation receptor site (Asn-X-Thr / Ser, see Fig. 7A, C) which was also found in the same position in NGF and BDNF. (Ullrich et al., 1983, Nature 303: 821-5; Leibrock et al., 1989, Nature 341: 149-52). It remains unknown whether this glycosylation site plays a role in the processing of NT-3 precursors, NGF. or BDNF.

Further comparison of the sequence of NT-3 with the precursors of NGF and BDNF reveals two amino acid homology regions upstream of the mature NT-3 sequence (regions I and II in Fig. 7B, C). Homology region I leads us to predict the existence for rat NT-3 of a start site B (defined for NGF above) that would produce a short 258 amino acid precursor, similar in size to the short NGF precursors (241 amino acids) and SDNF (249 amino acids). 0 apparent initiation codon methionine, the secretory signal sequence and the splice site of the short precursor signal sequence of all 3 factors are conserved (Fig, 7C). As the homology region I extends upstream from the start site 8, we also anticipate the existence of a long NT-3 precursor that would start from the start site A (see Fig. 7A, B, C). As ss has seen for NGF (Ullrich et al., 1983, Nature 303: 821-5; Selby et al., 1987, Nol. Cell Biol, 7 = 3057-64) and proposed for BDNF, such a start site will presumably be coded over

71494

6526-040-118

-57 additional upstream of the single exon encoding the entire short precursor.

In addition to amino acid hornology regions I and II, comparison of hydrophilicity graphs of NT-3, NGF and BDNF reveals a similarity of precursor structure upstream of mature products.

7.2 = 4. NEUR0TR0FINA-3 HAS NEUROTROPHIC ACTIVITY

The shocking hornology between NT-3, NGF and BDNF strongly suggests that NT-3 must have neurotrophic activity. Each of the NGF and BDNF promotes the survival of selected populations of live and in vitro neurons from the central and peripheral nervous system (reviewed by Whittemore and Seiger, 1987, Brain Res, Rev. 12 = 439-64; Lindsay, 1988). in The Making of the Nervous System pp 149-65 (Davies 1988, Trends Genet. 4 = 139-43). For example, administration of either factor to developing bird embryos prevents naturally occurring neuronal death in specific peripheral ganglia (Hoffer and Barde, 1988, Nature 331: 261-2). When added to explant ganglia, NGF and BDNF induce neurite development (Davies et al., 1986, J. Neurosci. 6 = 1897-904); when added to dissociated ganglion neuron cultures, these factors support neuronal survival and differentiation (Lindsay et al., 1985, Dev. Biol, 112 = 319-28). These in vitro assays using various types of peripheral chick ganglia have been used to distinguish between the neurotrophic activities of NGF and those of BDNF. Although both factors act on the sensory neuron populations found in the dorsal root ganglia (DRG). ) of the Christian neural, only the BDNF helps the sensory neurons the nodular ganglion (NG) derived from the neural plaque (Lindsay et al., 1985, Dev. Biol. 112 = 319-28). In contrast, NGF, but not BDNF, may support the survival and growth of paravertebral chain sympathetic ganglion (SG) neurons (Barde et al., 1982, EMBO J. 1 = 549-53).

In order to determine the potential biological activity of NT-3, we inserted the rat NT-3 gene into a vector, pCDMS (Seed,

71494

6526-040-118

<img file="PT95153B_D0046.tif" />

1987, Nature 529: 840-42), previously used to transiently express BDNF and NGF in mammalian cells. This construction was designed to express the shape of the short precursor of NT-3; Expression of short NGF and BDNF precursor forms produced biologically active materials (Edwards et al., 1989, Mol. Cell Biol. 8 = 2456-64; Leibrock et al., 1989, Nature 541 = 149-52). The constructions of NT-3, NGF. and BDNF were transfected into COS cells; Culture supernatants were collected and first tested at various concentrations for their ability to induce neurite growth from DRG explants. As expected, NGF and BDNF promoted the growth of -neuritis in this assay (Fig. 8). In the first demonstration that the NT-3 gene actually encodes neurotrophic activity, the product of this gene induced intense neurite growth from the DRG explants (Figure S).

To demonstrate that NT-3 acts directly on neurons, we tested this factor in cultures highly enriched in dissociated DRG neurons (Fig. 9). In the virtual absence of 7Schwann cells and fibroblasts, NT-3 increased neurite survival and growth by approximately 60% of these DRG neurons. Since NGF and BDNF together support virtually 100% of DRG neurons in cultures (Lindsay et al., 1985, Dsv. Biol. 112 = 519-28) it must be accepted that NT-3 supports the survival of cells that also respond to at least one of the other two factors,

7.2.5. NT-5 NEUROTRUFFIC ACTIVITY IS

DG NGF AND BDNF DISTINCT

To further explore the neuronal specificity of NT-3, we tested the factor on NG and SG explants. As expected, in the control experiments it was found that NGF induced neurite growth from SG explants but not NG from E8 chick embryos, whereas BDNF induced neurite growth from NG but not SG explants. Interestingly, NT-3 induced neurite growth from both NG and SG explants (Fig. 8) suggesting a

71494

6526-040-118

<img file="PT95153B_D0047.tif" />

-59 broader specificity of both NGF and BDNF. NT-3, however, like NGF and BDNF, failed to promote survival or promote growth of neuritis, chick ciliary ganglion cultures, enriched with explant or dissociated neurons. As indicated above, parasympathetic neurons including the ganglion respond to rat CNTF, a neurotrophic factor unrelated to the NGF / BDNF / NT-3 family ((Manthorpe et al., 1986, Brain Res. 367 = 282-6); Stockli et al., 1989, Nature 342 = 21-28). No response was found in any of these assays using control vector transfected COS supernatants (Fig. 8).

Table IV shows the results of a representative experiment measuring responses of the explanted dorsal root ganglia (NG) and explanted paravertebral sympathetic ganglia (SG) of embryonic chick: - 8 days (E8 ) at increasing doses of NT-3. The ganglia were cultured for the times indicated as explants in 1 ml of collagen gel, (as described by Lindsay and Rohrer, 1985, Dev. Biol. 112 = 50-48). 0 Fiber growth was rated on a scale of 0 to 5, where 5 is the maximum fiber growth observed in dorsal root ganglia in response to a saturating dose of nerve growth factor (NGF) (1-10 ng / ml). Rat NT-3 was obtained as conditioned media from CQS-M5 cells transfected with plasmid pC8-rN3 (Pl), as described above as a control. Media conditioned from COS-M5 cells transfected by simulation. At all doses tested, over a 50-fold amplification zone, NT-3 promoted detectable fiber growth in all three types of explanted ganglia, although at low doses the responses had been weaker in the sympathetic ganglia. The maximum dorsal root ganglion fiber growth response to NT-3 was comparable to those observed with NGF or BDNF. The maximum node-node response to NT-3 was higher than the maximum response observed with BDNF. (Knotted ganglia do not show a fiber growth response to NGF). The maximum response of sympathetic ganglia to

<img file="PT95153B_D0048.tif" />

71494

6526-040-118

-60NT-3 was lower than the maximum response of these ganglia to NGF and was observed at higher concentrations than needed to obtain maximum NT-3 responses in dorsal root or knotted ganglia cultures,

TABLE IV

Mouse recombinant NT-3 promotes the growth of explant fibers of =

DRG = dorsal root ganglia of the chick embryo E8

NG = nodular ganglia of chick embryo E8

SC = E8 chick embryo paravertebral sympathetic chain ganglia

Control-simulated transfected COS cell supernatants, 500 u.1, control

<td colspan="2">NT-3, cell supernatant</td>

<td></td><td>COS, 10 Wl</td>

<td>NT-3,</td><td>cell supernatant COS, 50 ul</td>

<td>NT-3,</td><td>cell supernatant COS, 200 wl</td>

<td>NT-3,</td><td>cell supernatant COS, 500 wl</td>

<td colspan="3">Fiber Growth Score</td>

<td>DRG (24h)</td><td>NG 24h)</td><td>SC (24h)</td>

<td> 0-0,5</td><td> 0</td><td> 0</td>

<td> 2-3</td><td> 2-3</td><td> 0-0,5</td>

<td> 3-4</td><td> 4-5</td><td> 0-0,5</td>

<td> 5* *</td><td> 2-3*</td><td> 0-1</td>

<td> 5*</td><td> 0-2*</td><td> 1-2</td>

The results represent the fiber growth scoring zone of 4 to 6 ganglia in each case.

* At NT-3 supersaturation levels, fiber growth is reduced when determined by fiber length in DRG explants and number of fibers in NG explants.

7.2.6. NEUR0TR0FINA-3 D0 MOUSE IS ACTIVE ON MAMMALIAN NEURONS

In order to determine if rat NT-3 exhibits activity

494

6526-040-118

Under mammalian neurons, the explant assay was repeated using dissected dorsal root ganglia from 14-day-old rat embryos (Table V). Purified NGF was used as a control. E14 rat dorsal root ganglia explants (4 ganglia per 1 ml culture) were cultured for 24 h, essentially as described for chick ganglia (Fig. 8, Table IV), without added neurotrophic factor (control), with mouse submaxillary gland nerve growth factor (NGF) or with rafo recombinant NT-3 (conditioned conditioned from pC8 plasmid transfected COS-M5 cells -RN3 (P1) as described above). Each ganglion had fiber growth scored as described (see Table IV). The results show that, like NGF, NT-3 is highly active in promoting the growth of rat dorsal root ganglion explant fibers.

TABLE V

NT-3 PROMOTES THE GROWTH OF GANGLI EXPLANT FIBERS

DRAFT ROOT OF MOUSE EMBRYO

Fiber Growth Score

E14 Mouse DRG

Control 0,0,0,0 NGF (mouse, 5 ng / ml) 4,4,4,3 NT-3 = 20 µl of supernatant 3,3,3,4 dante of NT-3 COS cells of rat

Fiber growth score (0 to 5 scale) is given for 4 individual ganglia per culture.

Although each of the DRG, NG, and SG explants responded to at least 2 of the 3 neurotrophic factors concerned, the maximum response exhibited by a given ganglion depended on the factor used. In the case of DRG, the response to the safening levels of NGF, BDNF and

494

6526-040-118

<img file="PT95153B_D0049.tif" />

NT-3 was relatively equivalent. With NG, however, the maximum response to NT-3 was higher than do.BDNF, while with SG the maximum response to NT-3 was substantially lower and somewhat late than NGF.

7.2.7. EXPLORING NEUROTRQFINE-5 SYNTHESIS PLACES

During development, neuronal survival has been found to depend on the neurotrophic molecules of the target. Continuous survival, even in adults, may require persistence of a neurotrophic influence (Thoenen et al., 1987, Ciba Found, Symp, 126 = 82-95). In other cases the survival of mature neurons may no longer depend on a neurotrophic factor; However, these factors have been shown to profoundly affect the differentiated neuronal phenotypes (Linds and Harmar 1989, Nature 557 = 362-4). Determining the sites of synthesis of a neurotrophic molecule can therefore help to elucidate its physiological roles,

To explore NT-3 synthesis sites and to compare NT-3 expression with NGF and BDNF expression, northern spots, in triplicate, from RNA samples prepared from various tissues of the adult rat, were hydrated with specific probes. each of these genes (Figure 10). As previously demonstrated (Heumann et al., 1984, EMBQ 3.3 = 3183-9; Shelton and Reichardt, 1984, Proc. Natl, Acad, Sci. USA 81 = 7951-5), NGF mRNA expression was highest in the brain, heart and spleen; at least trace levels were detected in all other tissues examined, BDNF showed a more restricted expression pattern; higher brain levels were found (Leibrock et al., 1989, Nature 541 = 149-52) and significant levels were found in the heart, lung and muscles. Like NGF, the NT-3 transcript (1.4 kb) was detectable in all tissues studied. However, in all peripheral tissues examined the expression level of NT-3 mRNA was at least comparable to that observed in the adult brain and in some cases (eg kidney, spleen) was substantially higher.

<img file="PT95153B_D0050.tif" />

494

6526-040-118

We also compared the relative abundance of NGF, BDNF, and NT-3 transcripts in the brains of newborn and adult mice. In contrast to both NGF and BDNF, the level of NT-3 mRNA in the newborn brain was higher than in the adult brain (Fig. 8). Further analysis revealed that central nervous system NT-3 mRNA levels were dramatically higher during fetal development and then decreased to adult levels.

7.3. DISCUSSION

Structural comparisons between NGF, BDNF and the latest member of this gene family, NT-3, have highlighted several conserved regions and suggest that the functional differences between these proteins are determined by sequences located outside these conserved regions. The expected existence of long and short precursor forms of all three of these proteins raises intriguing questions about the relevance of both precursor forms in vivo. Long forms can be processed more efficiently than short forms. However, vectors expressing the short precursor forms of these factors produce biologically active material in COS cells.

Our finding that these three neurotrophic factors exhibit phase-specific and tissue-specific expression patterns confirms the notion that neural development depends on the distinct temporal and spatial expression of discrete neurotrophic activities. The developmental profile of NT-3 expression suggests that this factor may play a particularly important role in early nervous system development. Our initial characterization of in vitro neurotrophic activity, associated with the widespread prevalence of NT-3 mRNA in both adult brain and adult peripheral tissues, further suggests that NT-3 may have a wide influence on function and / or neuronal survival in the adult. The broader expression of NT-3 also raises the possibility that this factor acts on cells outside the nervous system as proposed for NGF (Otten et al., 1989, Proc. Natl.

494

6526-040-118

-64Acad. Know. USA 86: 10059-10063).

<img file="PT95153B_D0051.tif" />

Although it has not been clearly demonstrated - that neurons can simultaneously respond to more than one neurotrophic factor, evidence suggests that NGF and BDNF may act on common neuronal populations. For example, administration of both NGF and BDNF can save the vast majority of DRG neurons that would otherwise die during normal bird development (Hofer and Barde, 1988, Nature 331: 261-2). Our observations on the effects of NT-3 on the peripheral chick ganglia strongly confirm the intriguing possibility that individual neurons may respond to multiple, related stimuli. If this is the case, both mediation and physiological relevance of simultaneous response capacity would raise fascinating problems. For example, receptor components and / or signal transduction mechanisms for the three structurally related neurotrophic factors could be shared. . In principle, simultaneous response neurons could have multiple receptors, each being specific for a particular neutrophil factor, or a single receptor that could mediate a response to multiple neurotrophic factors. These various factors could, in vivo, be simultaneously presented to all responsive neurons. Most likely there will be spatio-temporal differences in the relative availability of individual factors (see eg Davies et al., 1987, Nature 526: 353-8). It may even be possible that different factors are available for different sites of the same neuron (eg, a sensitive neuron may receive distinct factors by its peripheral and central terminals) (Kalcheim et al., 1987, Le Douarin, EMBO J. 6: 2871-3). If multiple factors are simultaneously available to some neurons, their actions could be redundant or complementary.

The elucidation of the individual and potentially complementary roles of NGF, BDNF, and NT-3 will provide crucial information for understanding normal nervous system development and maintenance. Animal studies suggested that NGF may be

494

6526-040-118

<img file="PT95153B_D0052.tif" />

Valuable in the treatment of degenerative neurological conditions (Snider and Johnson, 1989, Ann. Neurol. 26 = 489-506; Fischer et al., 1987, Nature 329 = 65-8; Phelps et al. 1989, Neurobiol. Aging 10 = 205 -7). The cloning of a new member of the NGF / BDNF gene family and its potential interaction with other family members raises new hypotheses about the potential therapeutic applications of these proteins in neurodegenerative diseases.

8- EXAMPLE = GENE CLONING AND CHARACTERIZATION OF

NEURQTRQFINA-3 DQ MAN

8.1. RESULTS

The preparation of a probe (R1B / 2C) to identify the rat NT-3 gene was performed as described in Example Section 7, above. As described herein, the probe was prepared by polymerase chain reaction (PCR) from rat genomic DNA using degenerate oligonucleotide primers corresponding to 2 of the "boxes of the amino acid sequence homology shared by NGF and BDNF. The presence, within the R1B / 2C probe, of a population of DNA molecules representing a new gene was initially signaled by Southern blot hybridization to rat genomic DNA digested with EcoRI restriction endonuclease; the probe detected a new DNA fragment in addition to the expected fragments known to correspond to the NGF and BDNF genes.

When using as probe R1B / 2C, marked with 32p₅ To analyze Southern blots of human genomic DNA digested with various restriction endonucleases, such as rat DNA, not only hydration zones corresponding to the NGF and BDNF genes were observed, but also new zones. For example, with HindIII restriction endonuclease, a new (i.e. non-NGF, non-BDNF) zone of approximately 1.8 kb was observed; with BamHI a new 15 kb zone was observed; and with EcoRI new 8 and 12 kb zones were observed (the presence of 2 zones may have resulted from a polymorphism at EcoRI restriction sites in human genomic DNA). These results indicate that human DNA contains an NT-3 gene that is well conserved between rats and men,

494

6526-040-118

The human NT-3 gene was isolated by selection in a genomic library as described to isolate the mouse NT-3 gene (see Example Section 7). Briefly, a library consisting of Sau3A partial digestion products of human placental genomic DNA, cloned into bacteriophage vector 2eM8L3 / SP6 / T7 (purchased from Clontech Laboratories, Inc.), was selected by the R1B / 2C probe and NGF probes. rat and BDNF rat »Human NT-3 clone would be expected to hydride with R1S / 2C, but not with NGF or BDNF. One of these fanatic clones has been identified between approximately 8x10⁵ plates examined. These clones, designated &lt;?&gt; HN3 (Gl), contained an approximately 16 kb human DNA insert. Using standard methods the clone restriction map was established and selected restriction fragments were subcloned into plasmid pBluescriptII (Stratagene) for DNA sequence analysis. Figure 11 shows the sequence of the human NT-3 gene and the deduced amino acid sequence of its protein, aligned with the rat NT-3 sequences.

8.2. DISCUSSION

Sequence analysis results show a shockingly high degree of conservation in nucleic acids and amino acid sequence between rat and human NT-3. In the region encoding the mature polypeptide (119 amino acids), approximately 92% of the human and rat genes are homologous to the DNA sequence. However, none of the nucleotide sequence differences between man and rat in this region leads to amino acid substitutions; the deduced amino acid sequences of mature human and rat NT-3 (and mouse mature NT-3, see Section 6, supra) are absolutely identical. This is reminiscent of the high degree of conservation of BDNF which shows complete identity in the amino acid sequence of the mature polypeptide among rats, mice, men and pigs. In contrast, the amino acid sequences of mature NGFs in humans and rodents (mice and rats) differ by approximately 10¾. In addition, the amino acid sequences of the alleged human and rat NT-3 precursors also show some notable differences (underlined in

<img file="PT95153B_D0053.tif" />

494

6526-040-118

Figure 11). t-Logo · a- · · HKmtrante .'-. ·. of the predicted protease cleavage point, which would create the mature NT-3 polypeptide (Arg-Arg-Lys-Arg), following the human missing one (Pro) codon which is present in the rat sequence. A 4 amino acid block differs between rat and human prepro NT-3, and six more single amino acid substitutions are scattered between that block and the predicted protease cleavage site.

9 NT-3 HUMAN BIOLOGICAL ACTIVITY

Since the deduced amino acid sequence of human mature NT-3 is identical to that of rat mature NT-3, it is highly likely that human NT-3 proteins and thymus indicate indistinguishable biological activities. The neurotrophic activity of human NT-3 was confirmed by insertion of the cloned human gene into the pCDMS plasmid expression vector, transfection of the resulting plasmid pC8-hN3 (Pl) to COS-M5 cells (described by Chen and Okayama, 1987, Mol. Cell, Biol. 7 = 2745-52) and evaluation of neurotrophic activity in conditioned medium from transfected cells. The human NT3 gene was PCR amplified from the ohN3 bacteriophage (Gl) and inserting into the pCDMS plasmid expression vector as described for the mouse NT-3 gene (Example 7); the resulting plasmid was called pC8-hN3 (Pl). The nucleotide sequence of the entire NT-3 insert was determined and compared to the genomic sequence determined as described above to confirm that no mutations had been introduced during PCR amplification and cloning procedures. The transfection and evaluation procedures were essentially identical to those used in the assessment of rat NT-3 biological activity,

As predicted, human NT-3 was found to have neurotrophic activity when evaluated in explants of dorsal root ganglia and 9-day-old embryonic chick nodules (E9) (Table VI). The ganglia were cultured (see Figure 8, Table IV) for 24h in the presence of conditioned medium (supernatants) from mock transfected COS-M5 cells or plasmid transfected COS-M5 cells (all derived from the pCDMS expression vector) encoding the

494

6526-040-118

<img file="PT95153B_D0054.tif" />

chosen to have activity

Recombinant human BDNF, or rat recombinant NT-3 [rNT-3; plasmid pC8-rN3 (Pl)] or recombinant human NT-3 [hNT-3; plasmid -pC8-hN3 (Pl)]. 0 BDNF plasmid was positive control because neurotrophic BDNF is known to be present on both the dorsal root ganglia and the nodular ganglia. As shown in Table VI, both rat and human recombinant NT-3 at modest dose (compared to Table IV) show approximately the same level of activity as BDNF on dorsal root ganglia and significantly greater activity than BDNF on knotted ganglia. No differences were observed in human versus rat NT-3 activity.

Human recombinant NT-3 produced in COS cells is as active as recombinant rat NT-3 when evaluated in cultures of dorsal root ganglia or chick embryo nodal ganglia explants.

Fiber Growth Score

Control

BDNF ϊ 20 wl COS supernatant Mock: 20 wl COS human NT-3 supernatant: 20 wl COS supernatant

Mouse NT-3: 20 wl COS Supernatant

DRG NG

0,0,0,0,0.5 0,0

3.3.3.3.3 1,3

0,0.5,0,0,0 0

3.2.4.3 3,3

3,4,4,3,4 3,4

The score is the measure of fiber growth (0-5 scale) observed in 1 to 5 individual ganglia after 24h in culture. Each ganglion's score is shown individually,

10- NT-3 GENES PRODUCT IDENTIFICATION

METABOLIC MARKING HUMAN Predicted size of mature NT-3 polypeptide (rat or human) is 119 amino acids, with a molecular weight of 13.6

494

6526-040-118

<img file="PT95153B_D0055.tif" />

-69pCS-hN3 (Pl) dalton mixture, To experimentally determine the approximate size of the human mature NT-3 polypeptide, transfected cells were metabolically labeled with a human NT-3 expression plasmid and the conditioned medium was analyzed for presence of a new polypeptide. In the experiment shown in Figure 12, COS-M5 cells were transfected with the plasmid (described above), cells were labeled with a [³^ S] methionine and [³⁵In the cysteine, growth medium was collected and fractionated by denaturing electrophoresis on a 15% polyacrylamide gel, the proteins were transferred to a membrane filter (essentially as described in Towbin et al., 1979 , Proc, Natl. Acad. Sci. USA 76: 4350-4354) and labeled polypeptides were detected by autoradiography. Simulated transfected cells (lane marked “simulation”) were used as a control. As shown in Figure 12, the expression plasmid pC8-hN3 (Pl) guided the synthesis of a single approximately 14 kDa polypeptide (labeled NT-3 in the figure) that was not observed in the control. Within the resolution range of the technique, this agrees well with the expected size of the mature NT-3.

11 EXAMPLE: NEUROTROPHIN-3 SUPPORTS SURVIVAL

PE CULTURE DOMAIN NEURONS,

EMBRIOIWIQ RENT VENTRAL MESENEPHALE Cultures of the E14 rat embryo ventral midbrain were established as described in US patent application No. 2. 07 / 400,591, filed August 30, 1989, incorporated herein in its entirety for reference only. Cultures were seeded at a density of 50,000 cells / cm² (Fig. 13) or 100,000 cells / cm² (Fig. 14) and developed in the absence of neurotrophic factor control or in the presence of increasing amounts of COS cell supernatant containing recombinant human neurotropin-3 (NT-3). After 8 days in culture, the cells were fixed and stained with a monoclonal antibody against tyrosine hydroxylase (TH), a marker of dopaminergic neurons. As shown in Figures 13 and 14, increasing amounts of NT-3 were found to increase cell number.

494

6526-040-118

<img file="PT95153B_D0056.tif" />

TH positive survivors after 8 days, with a maximum 2.5-fold increase over control values ​​with a 1 = 25 dilution of NT-3 COS cell supernatant. Purified nerve growth factor appeared to have no effect but the effects of NT-3 were similar to those observed with BDNF.

12 EXAMPLE = NT-5, BDNF, and NGF NQ MOUSE NERVOUS SYSTEM DEVELOPMENT = PARALLEL AND EXPRESSION STANDARDS

ALSO RECIPROCES

12.1. LAW SUIT

12.1.1. MATERIALS AND DISSECTIONS Sprague-Dawley rats obtained from Harlan Sprague Dawley ... Inc .. were used in all dissections. Adult brain dissections were guided by conventional general anatomical references. Cortical samples included neocortex and dorsal portions of the olfactory cortex. The diencephalon samples were taken using the stria medullarís and the optic chiasm as dorsal and ventral limits, respectively. The midbrain samples were taken at the superior and inferior colliculi level, dorsally and extended to the ventral surface of the brain to the most extreme of the bridge face. Hindbrain samples had no cerebellum but included bridge and medulla. Note that only portions of the striatum rostrum were sampled to avoid contamination with thalamic tissue. Hippocampal samples were taken from the fimbria / fornix level to approximately the caudal pole. Newborn brain dissections used the same limits except for stria medullarís. Pregnancy-regulated rats were used to obtain embryonic tissues, with the positive sperm day designated day E1; the day of birth was designated as PO. Adult rats weighed on average 150-275 g (6 to 8 weeks of age).

12.1.2 »NORTHERN ARN AND SPOT PREPARATION

Selected tissues were dissected from Sprague-Dawley rats and immediately frozen in liquid nitrogen. RNAs were isolated by tissue homogenization in 3M LiCl / 6M Urea as

494

6526-040-118

<img file="PT95153B_D0057.tif" />

-71 is described (Bothwell et al., 1990, in Methods of Cloning and Analysis of Eukaryotic Genes, Jones and Bartlett, Boston, MA). RNAs (10 pg) were fractionated by electrophoresis by 1 ° C © / formaldehyde gels in quadruplicate (Bothwell et al., supra) followed by capillary transfer to nylon membranes (MagnaGraph, Micron Separations, Inc.) with 10X Standard saline citrate (SSC), pH 7. RNAs were UV-crosslinked to the membranes by exposure to ultraviolet light (STRATALINKER (R), Stratagene, Inc.) and hydrated at 68 ° C with radiolabelled probes in the presence of 0.5 M NaP04 (pH 7), 1¾ bovine serum albumin (fraction V, Sigma, Inc.), 1% SDS, 1mM EDTA (Mahmoudi and LIn, 1989, Biotechniques 7 = 31-33) and 100 µg / ml denatured salmon sperm DNA , treated by ultrasound. The filters were washed at 68 ° C with 2X SSC, 0.1¾ SDS and autoradiographed for 1 day to 2 weeks with 1-2 intensifying filters (CRGNEX (^), DuPont) and X-ray film. (XAR-5, Kodak) at -70 ° C. Ethidium bromide staining of quadruplicated gels demonstrated that equivalent total RNA levels were evaluated for different samples (as in Maisonpierre et al., 1990, Science 247 = 1446-1451); this was confirmed by probing several spots using a 28S rRNA specific probe,

12.1.3. NT-3, BDNF, NGF, and NGFR PROBE PREPARATION Molecular cloning of rat coding regions of NT-3, BDNF, and NGF into the pCDMS expression vector (Aruffo and Seed, 1987, Proc. Natl, Acad. Sci. , USA 84 = 8573-8577) has been previously described (Maisonpierre et al., Supra). The 800 base pair (bp) XhoI inserts of these plasmids were separated on acrylamide gels and recovered by electroelution (Bothwell et al. ., 1990) and then marked with³²P by random hexamer labeling (Bothwell et al., Supra); hybridization of each of these probes to NGF, NT-3 and BDNF synthesis transcripts (see below) demonstrated that the neurotrophin-specific probe did not hybridize to related neurotrophin transcripts. The mouse NGFR probe was a 1.6 kb cDNA cDNA fragment that encompasses the coding region of the mouse NGFR protein (Radeke

494

6526-040-118

<img file="PT95153B_D0058.tif" />

et al., 1987, Nature 325 = 593-597).

12.1.4. PRODUCTION AND QUANTIFICATION OF SYNTHESIS TRANSCRIPTS The T7 phage promoter present in the pCDMS / neurotropin expression constructs described above was used to produce synthetic RNA transcripts corresponding to the sense orientations of the NT-3, BDNF, and NGF coding regions. The amount of these synthesis transcripts was first determined by spectrophotometry. Transcripts were then evaluated using a labeled end-30-mer oligonucleotide probe (Bothwell et al., Supra) that hybridized to the common 5 'end (downstream'; T7 promoter) to the three transcripts, The Densitometric Search ( Computing Densitometer, Molecular Dynamics, Inc. 300 series of blot and Northern blot synthesis transcripts hybridized to the oligonucleotide probe (hybridization and washing performed at 55 ° C; otherwise, as described above) confirmed that equivalent levels of synthesis transcripts were being used as the defined standards (representative results indicated in Figure ISA).

12.1.5. DENSITOMETRIC QUANTIFICATION OF LEVELS

NEUROTROPHINE TRANSCRIPTS

Transcription levels in the various samples were normalized to the adult rat brain sample (see above) as follows. Equivalent aliquots of adult brain RNA sample were included in all Northern blots. A densitometric scan of the various autoradiographic exposures of each Northern blot was used to determine the signal intensities of each sample tested. For each exposure surveyed, the signal intensities of each sample were evaluated. For each exposure surveyed, the signal intensities of each sample were divided by the value obtained for the signal intensity in the adult brain sample at this exposure, which normalized all values ​​relative to the standard adult-brain samples. In Figure 18, the transcript levels in different samples were arranged relative to the levels in the adult brain sample, with the adult brain level arbitrarily set to 1.0, having determined

494

6526-040-118

<img file="PT95153B_D0059.tif" />

Neurotrophin transcript femtograms per total RNA microgram in the adult brain sample could determine the actual transcript levels (in fg / pg) in normalized samples relative to the adult brain sample.

12.2. RESULTS

12.2.1. Quantification and Comparison of NT-3, BDNF and NGF PE mRNA Levels in ADULT MOUSE BRAIN

We used the Northern blot evaluation system to quantify and compare NT-3, BDNF, and NGF transcript expression in various tissue-derived samples. The amount of each neurotropin transcript in the different samples was quantified against defined synthesis patterns. NT-3, BDNF, and NGF RNA synthesis transcripts, the amounts of which were precisely determined (see Figure 15A and legend), were included in Northern blots also containing 10 pg of total RNA isolated from adult rat brains. The spots were hybridized with neurotrophin-specific radiolabelled probes and then subjected to autoradiography (Fig. 15B). Densitometric scanning was then used to compare the hybridization signal intensities obtained from the adult brain sample and synthesis patterns. This quantification revealed that approximately equal mRNA levels existed (estimated at 40 fg NT-3 transcripts, 45 fg BDNF transcripts and 30 fg NGF transcripts per pg of total RNA) for all three brain neurotrophins. Adult rat. An aliquot of this standardized adult brain sample was included in all subsequent Northern blots, thus allowing quantitation of neurotrophin expression levels in new RNA samples by comparison (see below). To help visually compare the three neurotrophin transcripts between different samples, the exposures indicated in the following figures were chosen, so that the signal intensities in the standardized adult brain sample were similar in all three neurotrophins, thus normalizing the signals from other tissue samples to the defined pattern.

494

6526-040-118

<img file="PT95153B_D0060.tif" />

12.2.2 Expression of NT-3, BDNF, and NGF genes reveal not only common developmental characteristics as only examination of neurotrophin gene expression in rat embryos revealed that all three neurotrophins show a dramatic increase in their expression levels. between embryonic days H ® 12 (E11-E12) (Fig, 16A); All transcripts of the three neurotrophins are widely distributed throughout the embryo E12 and E13. The height of this adjusted rise in neurotrophin gene expression coincides with the period when neurogenesis (both peripheral and central) begins resolutely and with the initial elaboration of axons by these newly formed neurons (e.g. ftltman and Bayer, 1982, Adv. Anat, Embryol, Cell Biol, Vol. 74; Altmán and Bayer, 1984, ibid, Vol. 85).

Despite this coordinated establishment of neurotrophin gene expression during embryogenesis, comparison with the standardized adult brain sample reveals that NT-3 mRNA is by far the most abundant in younger embryos (180 fg / µg total RNA). ), while BDNF mRNA is at least abundant (5-10 fg / µg total RNA) and NGF mRNA is present at intermediate levels (30 fg / wg total RNA) (Fig. 6A). NT-3 and BDNF continue to show a reciprocal relationship when accompanying expression levels in the developing brain (Fig. 16B) or in the densely innervated heart (Fig. 16C) initially high NT-3 expression decreases while initially low BDNF expression increases until finally similar levels are reached in the adult; In contrast, NGF expression remains fairly constant, it is interesting to note that NT-3 expression increases during liver and thymus development, organs that are not densely innervated and do not express detectable BDNF mRNA (Fig. 16C).

Emotional expression of the NGFR transcript apparently precedes increased expression of neurotrophin genes, is surprisingly high in the spinal cord at the beginning, and decreases during prenatal brain development and postnatal heart development (Fig. 16A, B, C).

494

6526-040-118

12.2.3. NT-3 EXPRESSION COMPARISON. BDNF, NFG E

NGFR IN NEWBORN AND ADULT NERVOUS SYSTEM

To define the spatial distribution of nsurotropin gene expression in the rat nervous system and to understand how distinct developmental profiles in the whole brain relate to developmental changes in discrete brain regions, we examined gene expression. neurotrophin in the brains of newborns and adults. All three factors showed discrete spatial and temporal differences in their expression patterns (Fig. 17). Quantification of transcribed levels, including those of peripheral tissues, is shown graphically in Figure 4. The greatest similarity shared by all three factors is their uniformly high level of expression in the adult hippocampus. In contrast to the situation in adult peripheral tissues where NT-3 and NGF expressions are most similar in their wide distributions (Maisonpierre et al., Supra), NT-3 and BDNF show obvious parallelism in their patterns of expression. overall expression in the adult brain (Figure 17B, 18B); It is interesting to note that both factors are shockingly absent from striatum. However, NT-3 and BDNF also show the most interesting and seemingly reciprocal differences when the expression is compared between newborn and adult brains (Fig. 17A, 8 and Fig. 18A, B). The expression of NT-3 in the newborn is higher and much higher than in adults in more immature regions of the brain (ie, cerebellum, hippocampus and neocortex). BDNF expression is the lowest in these regions and the highest, and similar to adult levels, in more caudal regions of the brain that mature earlier (ie, the posterior brain, the midbrain and the diencephalon), As in the adult brain, NT-3 and BDNF transcripts are not detectable in the newborn striatum.

Compared with NT-3 and BDNF, NGF mRNA levels show less dramatic differences in the comparison of newborn versus adult brain (Fig. 17,18); olfactory bulb NGF levels are higher in the newborn whereas

494

6526-040-118

-76 hippocampal and neocortex NGF levels are higher in adults. NGFR mRNA levels were generally higher in the newborn's brain as opposed to the adult's, with exceptionally high levels in the cerebellum and posterior brain of the newborn (Figure 17A, B),

12.2,4. NT-5, NGF, and BDNF EXPRESSION EXAMINATION DURING THE DEVELOPMENT OF CNS DISCRETE REGIONS

To further study the notion that NT-3 is expressed notably earlier in the development of particular CNS regions, whereas BDNF is expressed predominantly later in the development of the same regions, we analyzed neurotrophin gene expression during the development of CNS. three CNS regions whose maturation follows very different precursors in time, neurogenesis, rapidly followed by a period of natural cell death, It begins very early in the spinal cord (E12-E13) and completes a few days before birth (Altman and Bayer, 1984, supra). In contrast, most neurons in the cerebellum in the hippocampus (responsible for their granular cell populations ) · Appear after birth (eg Altman, 1966, J. Comp. Neur. 128 = 431-474; Schlessinger et al., 1975, J. Comp. Neurol. 159 = 149-176). In the late-stage cerebellum there is intense neurogenesis, neuroblast migration, and neuronal differentiation during the first three weeks of life (eg, Altman, 1966, supra). It has been stated that hippocampal NGF mRNA levels do not provide easily detectable until about 2 weeks after birth (Large et al., 1986, Science 234 = 352-355); This increase occurs long after the prenatal establishment of intense granular cell proliferation (e.g. Altman, 1966, supra) and fiber invasion of the basal forebrain cholinergic neurons (Koh and Loy, 1989, J. Neurosci. 9 = 2999-3018) but coincides with subsequent cholinergic differentiation of these neurons (Large et al., Supra) .

our examination of the developing spinal cord (Fig. 5A, E) reveals high levels of NT-3 expression in E12-E13 (150-280 fg / ng total RNA) that decreases at birth and are

494

6526-040-118

Almost undetectable in adults. BDNF mRNA that is poorly detected in E12-E13 has a peak at birth (10-20 fg / ng total RNA) and then decreases in adulthood. NGF mRNA is expressed at the highest levels in the spinal cord E12-E13 (15-25 fg / pg total RNA) but at levels 10X lower than NT-3 mRNA levels in the same phase. Interestingly, NGFR is expressed at the highest levels in the developing spinal cord; this expression has already been correlated with the natural death period of newly formed motor neuron cells in the developing spinal cord (Ernfors et al., 1989, Neuron 2 = 1605-1613).

In the advanced developing cerebellum (Fig. 19B, F) remarkably high levels of NT-3 mRNA (500-820 fg / wg total RNA) persist over the first three weeks after birth, while BDNF expression begins to increase. only later in this period; Very low levels of NGF expression are detectable only in the early stages of cerebellum development. 0 JNG.ER is expressed at high levels at the beginning of cerebellum development and then decreases before the observed decrease in NT-3 expression.

In the hippocampus (Fig. 19C, G) both BDNF and NGF mRNA levels increase from low levels in E17 to intermediate levels at birth and reach the highest levels in adults. Although the transcripts of all three neurotrophins are expressed at similar levels in the adult hippocampus, NT-3 expression is notably higher than that of BDNF and NGF in E17 and hippocampus / newborn; NT-3 expression levels in the newborn's hippocampus are as high as those observed in the peri-natal cerebellum (820 fg / wg total RNA). In contrast to neurotrophins, NGFR expression decreases during hippocampal development.

In all three CNS regions examined above, NT-3 expression is remarkably high during its development and then decreases to adult levels, whereas BDNF levels / mRNA are initially low, increasing to

494

6526-040-118

<img file="PT95153B_D0061.tif" />

reach adult levels similar to those in NT-3. In contrast to the reciprocal profiles of NT-3 and BDNF, NGF expression shows no consistent pattern; It is preferably expressed (albeit at low levels) at the beginning of spinal cord and cerebellum development, but only later in the development of the hippocampus.

12.3. DISCUSSION

Our analysis revealed both similarities and differences between the spatiotemporal distributions of the three neurotrophins transcripts. All NT-3, BDNF, and NGF transcripts show a simultaneous increase in expression between the eleventh and twelfth day of rat embryogenesis, and are widely distributed in 12- and 13-day embryos. The timing of this common breakthrough of expression approximately coincides with the establishment of neurogenesis development (e.g. ex. see Altman and Bayer, 1982, supra; Altman and Bayer, 1984, supra). This association supports the notion that the three neurotrophins play, in development, roles of particular importance to the nervous system, and may mark the period when all neurotrophins first become generally necessary to maintain the survival of post-mitotic neurons. However, the appearance of its expression may also be indicative of other roles of neurotrophins in nervous system development (see below).

Although the establishment of gene expression occurs simultaneously for the three neurotrophins, the levels they reach in the first development of the embryos differ greatly, NT-3 mRNA is by far the most abundant in embryos, whereas BDNF mRNA is expressed at the lowest levels, This contrast between NT-3 and BDNF expressions remains in almost all cases examined. NT-3 expression is very pronounced in CNS regions where neurons and their precursors proliferate, migrate and differentiate, and generally decreases suddenly in CNS regions as they mature. In contrast, BDNF expression in the newborn is more pronounced in CNS regions where

494

6526-040-118

Neurogenesis has already occurred and generally increases in CNS regions as they mature. Interestingly, the levels that NT-3 and BDNF transcripts eventually reach in various regions of the adult CNS are quite similar. The reciprocal relationship between the expression of NT-3 and BDNF during development, coupled with their relatively similar profiles in the adult CNS, indicates that NT-3 and BDNF may, in some cases, act on the same neuronal populations in CNS If so, our results suggest that NT-3 would play an important role in the development of these neurons (perhaps during the establishment of target innervation), whereas BDNF could predominantly act later in the life of the same neurons (ie. as a maturation or maintenance factor). NGF expression varies locally during development but these variations do not follow a consistent pattern like NT-3 and BDNF. NGFR mRNA levels do not specifically mirror the expression of any of the three neurotrophin genes, which is consistent with their ability to serve as a common component of individual neurotrophin receptors (Rodriguez-Tebar et al., 1990, Neuron 4: 487 -492). NGFR expression tends to be very high early in the development of the CNS regions and our studies reveal interesting developmentally regulated changes in NGFR expression that are the subject of future research.

In contrast to their similar distributions in the adult CNS, NT-3 and BDNF show very different expression patterns in adult peripheral tissues; The wider peripheral distribution of NT-3 transcripts may reflect activity in a wider (and different) area of ​​cells (both neural and non-neural) in the periphery than in BDNF (Maisonpierre et al., supra).

Although there is considerable evidence to suggest that both NGF and BDNF early play an important role in nervous system development, our analysis reveals a much more consistent and striking correlation between the remarkably high expression of NT-3 and the onset of development.

6526-040-118

-80to neural. NT-3 mRNA levels in the developing cerebellum and hippocampus of the newborn are several times higher than the levels of either neurotrophin in any other brain tissue or region and more than twenty times the levels of any of the neurotrophins in the adult brain. The discovery of NT-3 as a new NGF-related protein that may support at least some BDNF and NGF-dependent neurons (Maisonpierre et al., Supra) and whose temporal expression very clearly parallels the critical periods of neural development, raises the possibility that NT-3 is the physiological agent normally responsible for some of the important developmental functions previously attributed to BDNF or -NGF. The re-exploration of the true developmental roles of all members of this family is further enhanced by the possibility that the antibodies of these related factors may react with each other (Whittemore and Seiger, 1987, Brain Res. Rev. 12 = 439-464). ,

Although we have previously demonstrated that NT-3 can act as a classic neuronal survival molecule (Maisonpierre et al., Supra). allowing NT-3 to act as a target-derived factor whose limited expression results in neuronal selection and readjustment, this in no way precludes other important developmental roles for, NT-3 (as well as other neurotrophins), 0 NT-3 expression pattern within the developing nervous system shares remarkable similarities with that of nestin (a novel filament intermediate protein whose expressions characteristic of neurogenic CNS regions - Lendahl et al., 1990) and with SNAP ( an antigenic marker of the onset of neurite development (Yamamoto et al., 1986, J, Neurosci. 6 = 3576-3594). Unlike the case with ç, NGF (Clegg et al., 1989, Devi. Biol. 134 = 30-37), high levels of NT-3 expression precede the arrival of sympathetic fibers in the heart. Thus, NT-3 may be particularly linked to developmental processes other than neuronal survival, including proliferation / differentiation of neuronal precursors and / or orientation of migrating cells or theirs.

<img file="PT95153B_D0062.tif" />

494

6526-040-118

-81axortions; Another suggestion of such potential physiological roles of NT-3 comes from the recent discovery that one of the neurotrophins (ie, NGF) may play a role in the proliferation of neuronal precursors in vitro. Conversely, BDNF, although present at the beginning of development, may play a generally more important role long after the initial period of neuronal death and selection.

The expression profiles of all three adult neurotrophins share a striking similarity = all three neurotrophins are expressed at comparably high levels in the adult hippocampus. The disruption of cholinergic neuronal extensions from basal forebrain to hippocampus results in atrophy and reduced synthesis of transmitters by these neurons (reviewed in Snider and Johnson, 1989, Ann. Neurol. 26 = 489-506). Similar atrophy is associated with poor efficacy in specific memory tasks in elderly rats and men with Alzheimer's disease. Atrophy of basal forebrain cholinergic neurons can be reversed in rat models by NGF administration. The results depicted here are consistent with the ability of the adult hippocampus to normally supply all three neurotrophins to the basal forebrain, suggesting that recent evidence of complementary actions of NGF and BDNF on cholinergic cultured neurons reflects the true physiological role of these molecules. However, NT-3 expression is noticeably elevated very early in hippocampal development, and then decreases to adult levels that are similar to those of NGF and BDNF. This early expression further suggests that NT-3 may play a unique role in early orientation or establishment of ligations from basal forebrain afferents or other hippocampal afferents, or proliferation of dentate granular cell precursors; relatively low levels of NGF during hippocampal development have attested to the performance of this role by the NGF (Large et al., supra),

<img file="PT95153B_D0063.tif" />

494

6526-040-118

-8213. DEPOSIT OF MICRORGANISMS

On February 28, 1990 the following deposits were made with the American Type Culture Collection, 12301 Parklawn

Drive, Rockville, Maryland 20852:

No. Access

<td></td><td>Strain</td><td>at ATCC</td>

<td>Bacteriophage DNA</td><td>$ hN3 (61)</td><td> 40763</td>

<td>Bacteriophage DNA</td><td>ΦγN3 (G1)</td><td> 40764</td>

<td>plasmid</td><td>pC8-rN3 (Pl)</td><td> 40766</td>

<td>plasmid</td><td>pC8-hN3 (Pl)</td><td> 40765</td>

<td>The present invention</td><td>doesn't have its scope</td><td>limited by</td>

specific arrangements described herein. Indeed, for those skilled in the art, various modifications of the invention, in addition to those described herein, are apparent from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the claims. Several publications are cited herein, the contents of which are incorporated herein by reference only.

<img file="PT95153B_D0064.tif" />

494