Circovirus sequences associated with porcine wasting disease (pwd)

The present invention relates to a compound for use as a medicament comprising a glycosylated polypeptide isolated from type Β circovirus. The invention also relates to a compound for use according to the invention, such as a medicament is a composition for treatment and / or prevention of medicament, wherein immunogenic or vaccine, a type B circovirus DEL infection.

The description refers to genomic sequences and nucleotide sequences encoding DEL circovirus polypeptides, such as structural and nonstructural polypeptides of said circovirus, as well as vectors including said sequences and the cells or animals transformed by these vectors. The description also relates to methods of detecting such nucleic acids or polypeptides and kits for diagnosing DEL circovirus infection. The disclosure also comprises a method of selecting compounds capable of modulating viral infection. Finally, the description includes pharmaceutical compositions, including vaccines, for the prevention and / or treatment of circovirus viral infection and the use of the vector according to the invention for the prevention and / or treatment of diseases by gene therapy.

Piglet slimming disease (SLI) or so-called fatal piglet wasting (DFL) has been widely described in North America (Harding, JC, 1997), and the authors have shown a relationship between this pathology and the presence of porcine circovirus (Daft, B. et al., 1996;

Clark, EG, 1997; Harding, JC, 1997; Harding, JC and

Clark, EG, 1997; Nayar, GP et al. , 1997). A porcine circovirus has already been evidenced in row-derived and chronically infected pig-derived cell cultures (Tischer, I., 1986, 1988, 1995; Dulac, GC, 1989; Edwards,

S. 1994; Allan, GM 1995 and McNeilly F. 1996). This virus, upon experimental infection of piglets, has not been shown to be pathogenic to pigs (Tischer, I., 1986, Horner,

GW, 1991) and its nucleotide sequence has been determined and characterized (Tischer, I., 1982; Meehan, BM et al., 1997;

Mankertz, A., 1997). 0 porcine circovirus, called virus

PCV belongs to the genus circovirus of the family circoviridae (Murphy, FA et al., 1995) whose virion has a circular DNA of between 1.7 and 2.3 kb, DNA comprising 3 open reading frames (0RF1 to 0RF3 ), which codes for a REP replication protein implicated in the circular rolling replication (RCR) ignition and termination phase (Heyraud-Nitschke, F., et al., 1995; Harding,

MR et al., 1993; Hanson, SF et al., 1995; Fontes, EPB et al. , 1994), which codes for a capsid protein (Boulton, LH et al., 1997; Hackland, AF et al., 1994; Chu. PWG et al., 1993), and which codes for a so-called non-structural protein known to spread. (Lazarowitz, SG et al., 1989).

The authors of the present invention have noted that the noticeable clinical manifestations in pig and linked to DEL circovirus infection are very individualized. These manifestations usually appear in pigs from 8 to 12 weeks of age, weaned from 4 to 8 weeks. The first signs are hypotonia without speaking of prostration. Quickly (48 hours), the flanks hollow, the dorsal line is drawn, the pigs whiten. These signs are usually accompanied by hyperthermia, anorexia and often respiratory manifestations (cough, dyspnea, polypnea). Transient diarrhea may also appear. The disease stage lasts for about a month after which mortality rates range from 5 to 20%. To these mortalities it is convenient to add a variable proportion of cadaverous animals (5-10%) that have no economic future. It should be noted that apart from this critical post-wasting end state, no anomaly is visible in the creations. In particular, the playback function is perfectly maintained.

At the epidemiological level, the first manifestations of this pathology appear in early 1995 in the east of the Cotes d'Armor department in France, and the number of affected farms cannot be accurately assessed due to the absence of a specific laboratory diagnostic method or epidemiological surveillance device for all head of cattle. Based on both clinical facts and necropsy test results provided by veterinarians, this number can be estimated to be several dozen (80-100). The contagiousness of the disease is weak to moderate. Cases outside the initial zone are reported and most are after the transfer of animals from farms that know the problem. In contrast, a particularity of the disease is its strong remnant. Thus, the creations achieved after one year are still relevant despite the massive application of therapies. Clinically expressive creations are recruited into the various categories of specialization (maternity-fattening, post-weaning-fattening) and different economic structures are affected. On the other hand, problems appear even in creations where the rules of zootechnics are respected.

Numerous necropsy examinations have been performed either in the creations or in the laboratory. The injury table elements are diverse. The most constant macroscopic lesions are sometimes interstitial pneumonia as well as lymph node hypertrophy. The other lesions mainly concern the thoracic viscera, especially pericarditis and pleuresia. But arthritis and gastric ulcers are also observed. The lesions revealed on histological examination are mainly at the pulmonary (interstitial pneumonia), ganglia (lymph node depletion of lymph nodes, giant cell) and renal (glomerulonephritis, vascularitis) levels. Infectious agents have been the subject of thorough investigations. The intervention of pestiviruses and Aujeszky's disease can be excluded. The disorders appear in seropositive SRRS (Swine Reproductive and Respiratory Syndrome) herds, but its role in the genesis of the disorders cannot be established (most of Brittany breeds are seropositive SRRS).

The publication by Meehan et al. (1998) describes the nucleotide sequence of porcine DNA and circovirus isolates predicting the amino acid sequence of the four major ORF products present in the genome of these circoviruses, including 0RF2. Among the amino acid sequences:

- Sequence AF055391 comprises a sequence of 92% identical to the sequence of SEQ ID No. 15,

- Sequence AF055392 comprises a sequence of 92% identical to the sequence of SEQ ID No. 15,

Sequence AF055393 comprises a 99% sequence identical to the sequence of SEQ ID No. 15, and

Sequence AF055394 comprises a 98% sequence identical to the sequence of SEQ ID No. 15.

However, this publication does not mention the particular importance of the protein encoded by 0RF2. This publication does not disclose an isolated glycosylated polypeptide sequence having at least 90% identity to sequence A SEQ ID NO: 15, and do not disclose a compound for use as a medicament comprising an isolated glycosylated polypeptide sequence having at least 90% of identity to the sequence SEQ ID No. 15.

The authors of the present invention, in order to identify the responsible etiologic agent of LED, performed contact tests between manifestly sick piglets and the IOPE pigs of the Center National d'Etudes Vétérinaires et Alimentaires, France ). This evidence allowed to observe the development in protected animal houses of manifestations comparable to those observed in creation. Mild manifestations such as mild hyperthermia, anorexia and intermittent diarrhea appeared after one week of contact. It should be noted that the SRRS virus only spread after clinical manifestations. On the other hand, inoculations of organs of diseased animals ground in healthy animals allowed to reproduce manifestations similar to those observed in the breeding, but with a lower incidence linked to the favorable conditions of keeping the animals in experimental facilities.

Thus, the authors of the present invention were able to show that pathological manifestations present themselves as a well-defined entity that affects the pig at a particular stage of its growth.

This pathology has never been described in France. However, especially Canadian scattered information reports similar facts.

The disorders cannot be treated by existing therapies.

The data collected in both creation and experimentation made it possible to highlight the following points:

- LED disease is transmissible but not contagious, its etiological origin is infectious and probably viral,

- LED disease is persistent in the affected creations.

There are considerable economic consequences for the creations.

Thus, an important need to date refers to a specific and sensitive diagnosis, practical and rapid, allowing early detection of the infection. A reliable, sensitive and practical test that distinguishes between porcine circovirus (PCV) strains is then strongly desired.

On the other hand, effective and well tolerated treatment of DEL circovirus infections remains desired, and no DEL circovirus vaccine is available today.

With regard to DEL circovirus, one should probably understand the role of immune defense in the physiology and pathology of the disease to develop satisfactory vaccines.

Broader information on the biology of these strains, their interactions with their hosts, associated inactivity phenomena, and especially those escaping host immune defenses, and ultimately their implication in the development of associated pathologies, will allow a better understanding of these strains. mechanisms. In the light of the foregoing considerations, which illustrate in particular the limitations of the means for combating DEL circovirus infection, it is therefore paramount today on the one hand to develop molecular tools, especially from a better genetic understanding of DEL circovirus, but also to optimize new preventive and therapeutic treatments, new diagnostic methods and new specific, effective and tolerated vaccine strategies. This is precisely the object of the present invention.

The present disclosure relates to the nucleotide sequences of the circovirus genome DEL of sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10 or one of its fragments.

The nucleotide sequences of sequences SEQ ID NO: 1 and SEQ ID NO: 2 correspond respectively to the genomic sequence of the polarity (+) and polarity (-) chain of the type A circovirus DEL (or PCVA), the sequence being SEQ ID NO: 2 is shown in orientation 5 '3'.

The nucleotide sequences of sequences SEQ ID NO: 9 and SEQ ID NO: 10 correspond respectively to the genomic sequence of the polarity (+) and polarity (-) chain of the type B (or PCVB) LED circovirus, the sequence being SEQ ID NO: 10 is shown in orientation 5 '3'.

The present description also relates to nucleotide sequences characterized in that they are chosen from:

a) a nucleotide sequence specific to a fragment of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 10 or a fragment thereof;

b) a nucleotide sequence that is homologous to a nucleotide sequence as defined in a);

c) a nucleotide sequence complementary to a nucleotide sequence as defined in a) or b), and its corresponding RNA nucleotide sequence;

d) a nucleotide sequence capable of hybridizing under stringent conditions to a sequence as defined in a), b) or c);

e) a nucleotide sequence comprising a sequence as defined in a), b), c) or d); and

f) a nucleotide sequence modified by a nucleotide sequence as defined in (a), (b), (c), (d) or (e).

Nucleotide, polynucleotide or nucleic acid sequence according to the present invention is understood to mean either double-stranded or single-stranded DNA in monomeric and dimeric (serially said) forms as transcription products of said DNAs.

It should be understood that the present disclosure does not relate to genomic nucleotide sequences taken in their natural environment, that is, in their natural state. These are sequences that have been isolated, purified or partially purified from such separation methods as for example ion exchange chromatography, molecular size exclusion, or by solubility based affinity or fractionation techniques. different solvents, or from genetic engineering methods such as amplification, cloning and subcloning, the sequences of the description may be performed by vectors.

The nucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 9 were obtained by genome sequencing by the Sanger method.

By nucleotide sequence fragment is meant any nucleotide fragment of the type A or B-growing circovirus DEL of at least 8 nucleotides, preferably at least 12 nucleotides, and most preferably at least 20 consecutive nucleotides of the sequence. which one is taken out.

By nucleotide sequence specific fragment is meant any nucleotide fragment of the circovirus DEL, type A or B, which shows, after alignment and comparison with the corresponding known porcine circovirus fragments, at least one nucleotide or base of a different nature. For example, type A circovirus-specific DEL nucleotide fragments can be readily determined by referring to Figure 3 of the present invention in which the nucleotides or bases of the sequence SEQ ID NO: 1 (circopordfp) which are different in nature are shown after aligning said sequence SEQ ID NO: 1 with the two other known porcine circovirus sequences (circopormeeh and circopormank).

By homologous nucleotide sequence within the meaning of the present invention is meant a nucleotide sequence having at least a percent base identity of a nucleotide sequence according to the invention of at least 80%, preferably 90% and 95%, which is The purely statistical percentage and the differences between the two nucleotide sequences can be randomly distributed over their entire length.

By specific homologous nucleotide sequence within the meaning of the present invention is meant a homologous nucleotide sequence having at least one specific fragment nucleotide sequence as defined above. Said specific homologous sequences may comprise, for example, sequences corresponding to the genomic sequence or sequences of its fragments representative of type A or B circovirus DEL variants. These specific homologous sequences may thus correspond to mutation-linked variations within the A and B type circovirus DEL strains, and especially correspond to the truncations, substitutions, deletions and / or additions of at least one nucleotide. Said homologous sequences may also correspond to variations linked to the degeneracy of the genetic code.

In the present description, "circovirus DEL" means the circoviruses associated with piglet slimming disease (DEL) type A (PCVA) or type B (PCVB), hereinafter defined by their genomic sequence, as well as those circoviruses whose nucleotide sequences are homologous to the type A or type B circovirus DEL sequences, such as especially the circoviruses corresponding to type A or type B variants.

By complementary nucleotide sequence of a sequence of the invention is meant any DNA whose nucleotides are complementary to those of the sequence of the invention and whose orientation is reverse (antisense sequence).

Hybridization under stringent conditions with a nucleotide sequence according to the invention means hybridization at temperature and ionic strength conditions chosen such that they allow maintenance of hybridization between two complementary DNA fragments.

By way of illustration, stringent stringency conditions of the hybridization step for defining the nucleotide fragments described below are advantageously as follows.

Hybridization is performed at a preferred temperature of 65 ° C in the presence of SSC buffer, 1 x SSC corresponding to 0.15 M NaCl and 0.05 M Na citrate. The washing steps may, for example, be as follows:

- 2 x SSC at room temperature followed by 2 washes at 2 x SSC, 0.5% SDS at 65 ° C; 2 x 0.5 x SSC, 0.5% SDS; at 65 ° C for 10 minutes each.

Intermediate stringency conditions, using for example a temperature of 42 ° C in the presence of a 2 x SSC buffer, or weak stringency, for example a temperature of 37 ° C in the presence of a 2 x SSC buffer, require respectively for hybridization between the two sequences a less important overall complementarity.

The stringent hybridization conditions described above for a polynucleotide of about 350 base size will be adapted by one of skill in the art for larger or smaller size oligonucleotides, according to the teachings of Sambrook et al., 1989.

Nucleotide sequences equally useful as primers or probes are described herein in methods which yield homologous sequences, such methods being polymerase chain reaction (PCR), cloning and nucleic acid sequencing well known to those skilled in the art. .

Among said nucleotide sequences according to the description, most preferred for use as primer or probe in methods for diagnosing the presence of circovirus or a variant thereof as defined below.

Also preferred nucleotide sequences according to the description are capable of modulating, inhibiting or inducing circovirus gene expression, and / or capable of modulating the circovirus replication cycle into the host cell and / or organism. It is intended to denote cycle replication, invasion, proliferation of circoviruses, and spreading host cells to host cells in the host organism.

Among said nucleotide sequences as described, the sequences of SEQ ID NO: 3 are finally preferred to those corresponding to open reading frames, called ORF (open reading trame) sequences, and encoding polypeptides, such as, for example (0RF1), SEQ ID NO: 4 (0RF2) and SEQ ID NO: 5 (0RF3), respectively, corresponding to the nucleotide sequence between positions 47-985 with respect to the position determined in the nucleotide sequence SEQ ID # 1, positions 1723-1022 and 658 for positions 38 with respect to position in nucleotide sequence SEQ ID NO: 2 (shown in orientation 3 '5'), the ends being included, or SEQ ID NO: 11 (ORF '1) , SEQ ID NO: 12 (ORF'2) and SEQ ID NO: 13 ORF '3) respectively corresponding to sequences between positions 51-995 with respect to the position determined in nucleotide sequence SEQ ID NO: 9, positions 1734-1033 and 670-357 positions , the positions being determined relative to the position of the nucleotide sequence of SEQ ID NO: 10 (shown in 3 '- 5' orientation), the ends being included.

Nucleotide sequence fragments may be obtained for example by specific amplification, such as PCR, or after digestion by appropriate restriction enzymes of nucleotide sequences, these methods being described in particular in the work of Sambrook et al., 1989. Representative compounds can also be obtained by chemical synthesis when their size is not too high and by methods well known to the person skilled in the art.

By modified nucleotide sequence is meant any sequence obtained by mutagenesis according to techniques well known to the person skilled in the art, and includes modifications to normal sequences according to the invention, for example mutations in regulatory and / or promoter sequences for polypeptide expression, especially leading to a modification of the expression rate of said polypeptide or a modulation of the replication cycle.

By modified nucleotide sequence is also meant any nucleotide sequence encoding a modified polypeptide as defined hereinbelow.

The present disclosure is directed to the circovirus DEL nucleotide sequences, characterized in that they are chosen from the sequences SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or one of its fragments.

The description also refers to nucleotide sequences characterized in that it comprises a nucleotide sequence selected from:

a) a nucleotide sequence SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or a fragment thereof;

b) a sequence-specific fragment nucleotide sequence as defined in a);

c) a homologous nucleotide sequence having at least 80% identity to a sequence as defined in a) or b);

(d) a complementary nucleotide sequence or RNA sequence corresponding to that defined in (a);

b) or c); and

e) a nucleotide sequence modified by a sequence as defined in a), b), c) or d).

As regards homology to nucleotide sequences SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or one of its fragments, homologous, especially specific sequences which prefer

<td>present</td><td>an</td><td>percentage</td><td>in</td><td>identity</td><td>with</td><td>an</td><td>of</td>

<td>sequences</td><td>SEQ ID</td><td>No. 3, SEQ</td><td>ID No.</td><td>4, SEQ ID</td><td>No. 5,</td><td>SEQ ID</td><td>No.</td>

<td>11, SEQ ID</td><td>No. 12,</td><td>SEQ ID NO:</td><td colspan="4">13 or one of its fragments</td><td>in</td>

<td>at least</td><td> 80 %,</td><td colspan="2">preferably</td><td>90% and 95</td><td>%. At</td><td colspan="2">referred to</td>

Specific homologous sequences may comprise, for example, sequences corresponding to the sequences of the type A or type B type A or type B circovirus variant DEL circovirus variant ORF1, ORF2, ORF2, ORF3, ORF'1, ORF'2 and ORF'3. likewise correspond to mutation-linked variations within the type A or type B circovirus DEL strains and especially correspond to truncations, substitutions, deletions and / or additions of at least one nucleotide.

Among the nucleotide sequences according to the description, sequence SEQ ID NO: 11, which has homology with more than 80% identity to sequence SEQ ID NO: 3 and SEQ ID NO: 12, is particularly preferred.

Preferably, the description refers to nucleotide sequences according to the description, characterized in that it comprises a nucleotide sequence selected from the following sequences:

a) 170 5'TGTGGCGA 3 ';

<td>B)</td><td> 450 5 '</td><td>AGTTTCCT 3 ';</td>

<td>ç)</td><td> 1026 5'</td><td>TCATTTAGAGGGTCTTTCAG 3 ';</td>

<td>d)</td><td> 1074 5'</td><td>GTCAACCT 3 ';</td>

<td>and)</td><td> 1101 5'</td><td>GTGGTTGC 3 ';</td>

<td>f)</td><td> 1123 5'</td><td>AGCCCAGG 3 ';</td>

<td>g)</td><td> 1 192 5</td><td>'TTGGCTGG 3';</td>

<td>H)</td><td> 1218 5'</td><td>TCTAGCTCTGGT 3 ';</td>

<td>i)</td><td> 1501 5'</td><td>ATCTCAGCTCGT 3 ';</td>

<td>j)</td><td> 1536 5'</td><td>TGTCCTCCTCTT 3 ';</td>

<td>k)</td><td> 1563 5'</td><td>TCTCTAGA 3 ';</td>

<td>D</td><td> 1632 5'</td><td>TGTACCAA 3 ';</td>

<td>m)</td><td> 5 1686'</td><td>TCCGTCTT 3 '; and its complementary sequence.</td>

In the list of nucleotide sequences) a) -m) above the underlined nucleotides are mutants in comparison to the two known, non-pathogenic porcine circovirus sequences. The number preceding the nucleotide sequence represents the position of said first nucleotide sequence having the sequence SEQ ID No. 1.

The present invention relates to a compound for use as a medicament comprising an isolated glycosylated sequence polypeptide having at least 90% identity to sequence SEQ ID NO: 15.

The description comprises the polypeptides encoded by a nucleotide sequence according to the invention, preferably a polypeptide whose sequence is represented by an especially specific fragment of one of the 6 amino acid sequences shown in Figure 2, which 6 amino acid sequences may correspond to the polypeptides. be encoded by one of the 3 possible reading frames of sequence SEQ ID NO: 1 or sequence SEQ ID NO: 2, or a polypeptide whose sequence is represented by an amino acid fragment corresponding to the polypeptides which may be encoded in one of the 3 possible reading frames of sequence SEQ IB No. 9 or sequence SEQ ID No. 10.

The invention relates to polypeptides characterized in that they contain an amino acid sequence polypeptide SEQ ID NO: 15 SEQ.

The description refers to polypeptides comprising a polypeptide chosen from amino acid sequences SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID No. 16 or one of its fragments, or a fragment of the sequence polypeptide SEQ ID NO: 15.

Among the polypeptides as described, including the preferred amino acid sequence polypeptide of SEQ ID NO: 14 which has homology with more than 80% identity to sequence SEQ ID NO: 6.

The description also refers to polypeptides characterized in that they contain a polypeptide selected from:

a) a specific fragment of at least 5 amino acids of a polypeptide of the amino acid sequence of description;

b) a homologous polypeptide of a polypeptide as defined in a);

c) a specific biologically active fragment of a polypeptide as defined in a) or b); and

d) a modified polypeptide as defined in a polypeptide), b) or c).

Also described herein are amino acid sequence polypeptides SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, and these polypeptides are especially capable of specifically recognizing antibodies raised when B-type DEL circovirus infection. These polypeptides thus have specific type B circovirus DEL epitopes and can then in particular be used in the diagnostic domain or as an immunogenic agent to provide protection in pig against DEL circovirus infection, especially type B.

In the present description, the terms polypeptide, peptide and protein are interchangeable.

The polypeptides described herein do not refer to polypeptides in their natural form, ie not collected in their natural environment but which could be isolated or obtained by purification from natural sources, or obtained by genetic recombination or by chemical synthesis and which may then include unnatural amino acids as will be described hereinafter.

By polypeptide fragment is meant a polypeptide comprising at least 5 amino acids, preferably 10 amino acids and 15 amino acids.

By "polypeptide specific fragment" is meant herein a polypeptide fragment encoded by a specific fragment nucleotide sequence according to the disclosure.

By homologous polypeptide is meant polypeptides which exhibit, relative to the natural polypeptide, certain modifications such as in particular deletion, addition, substitution of at least one amino acid, truncation, elongation, chimeric fusion, and / or mutation. Among homologous polypeptides, those whose amino acid sequence is at least 80%, preferably 90%, homology to the amino acid sequences of the polypeptides according to the invention are preferred.

By specific homologous polypeptide is meant homologous polypeptides as defined above and having a specific polypeptide fragment as described herein.

In the case of a substitution, one or more consecutive or non-consecutive amino acids are replaced by equivalent amino acids. The term amino acid equivalent is intended herein to mean any amino acid which may be substituted on one of the amino acids of the backbone without, however, substantially modifying the biological activities of the corresponding peptides and as defined below.

These equivalent amino acids can be determined either on the basis of their structure homology to the substituting amino acids, or on the basis of comparative biological activity test results between the different polypeptides that may be made.

By way of example, mention may be made of substitutions which may be made without substantially altering the biological activity of the corresponding modified polypeptides, for example substitutions of valine or isoleucine, aspartic acid for acid glutamic, glutamine by asparagine, ariginine by lysine, etc., and of course inverse substitutions should be considered under the same conditions.

Specific homologous polypeptides also correspond to polypeptides encoded by the specific nucleotide sequences as defined above and thus comprising in this definition mutated or variant corresponding polypeptides, which may exist in the circovirus DEL, and which correspond in particular to truncations, substitutions, deletions and / or additions of at least one amino acid residue.

By "biologically active specific fragment of a polypeptide" is meant in particular a specific polypeptide fragment as defined above which has at least one of the characteristics of the polypeptides, especially:

capable of inducing a directed immunogenicity reaction against a DEL circovirus; and / or

capable of being recognized by a polypeptide specific antibody according to the invention; and / or

capable of binding to a polypeptide or nucleotide sequence of DEL circovirus; and / or

capable of exercising even partial physiological activity, such as for example dissemination or structural activity (capsid); and / or

capable of modulating, inducing or inhibiting expression of the DEL circovirus gene or one of its variants, and / or capable of modulating the DEL replication cycle in the host cell and / or organism.

Polypeptide fragments may correspond to isolated or purified fragments naturally present in a DEL circovirus or to fragments which may be obtained by cleavage of said polypeptide by a proteolytic enzyme such as trypsin or chymotrypsin or collagenase, or a chemical reagent, such as cinnaogen bromide (CNBr) or by placing said polypeptide in a very acidic environment, for example at pH 2.5. Such polypeptide fragments may also be prepared indifferently by chemical synthesis from hosts transformed by an expression vector according to the invention containing a nucleic acid allowing expression of said fragments placed under the control of the regulatory and / or expression elements. appropriate.

By modified polypeptide of a polypeptide is meant a polypeptide obtained by genetic recombination or chemical synthesis as described below, having at least one change from the normal sequence. Such modifications may especially relate to amino acids to the origin of a specificity, pathogenicity and / or virulence, or to the origin of the structural conformation, and the membrane insertion capacity of the polypeptide according to the invention. Thus polypeptides of equivalent or increased or decreased activity and of narrower or broader equivalent specificity may be created. Modified polypeptides include polypeptides in which up to 5 amino acids can be modified, truncated at the N- or C-terminal end, or deleted or otherwise adjusted.

As indicated, modifications of the polypeptide will be aimed in particular at:

- make it capable of modulating, inhibiting or inducing expression of the DEL circovirus gene and / or capable of modulating the cycle of replication of DEL circovirus in the host cell and / or organism,

- allow their incorporation into vaccine compositions,

- modify its bioavailability as a compound for therapeutic use.

Methods for evidencing said modulations in eukaryotic or prokaryotic cells are well known to the person skilled in the art. Of course, nucleotide sequences encoding said modified polypeptides may be used for said modulations, for example by means of vectors according to the invention and hereinafter described, in order, for example, to prevent or treat infection-related conditions.

The foregoing modified polypeptides may be obtained using combinatorial chemistry, in which portions of polypeptide may be systematically varied prior to testing on models, for example cell cultures or microorganisms, to select the most active compounds or exhibiting the desired properties.

Chemical synthesis also has the advantage that it can use:

- unnatural amino acids, or

- non-peptide bonds.

Thus, in order to improve the life span of the polypeptides according to the invention, it may be interesting to use unnatural amino acids, for example in D form, or amino acid analogs, especially for example sulfur forms.

Finally, the structure of the polypeptides according to the invention, their specific or modified homologous forms, may be integrated into chemical structures of the polypeptide type or the like. Thus, it may be interesting to predict at the Net C-terminal compound ends not recognized by the proteases.

Also described in the description are nucleotide sequences encoded by a polypeptide according to the invention.

The invention also relates to nucleotide sequences used as primer or probe, wherein said sequences are selected from nucleotide sequences as described.

Among the pairs of nucleotide sequences that may be used as a primer pair according to the description, prefer primer pairs selected from the following pairs:

a) 5 'GTG TGC TCG ACA TTG GTG TG 3', et

5 'TGG AAT GTT AAC GAG CTG AG 3';

b) 5 'GTG TGC TCG ACA TTG GTG TG 3', et

5 'CTC GCA GCC ATC TTG GAA TG 3';

c) 5 'CGC GCG TAA TAC GAC TCA CT 3', et

5 'GTG TGC TCG ACA TTG GTG TG 3';

d) 5 'CGC GCG TAA TAC GAC TCA CT 3', et

5 'CTC GCA GCC ATC TTG GAA TG 3'; et

e) 5 'CCT GTC TAC TGC TGT GAG TAC CTT GT 3', and

5 'GCA GTA GAC AGG TCA CTC CGT TGT CC 3'.

The cloning and sequencing of the circoviruses DEL, type A and B, were identified after analysis with the nucleotide sequences of other porcine circoviruses, which were among these nucleic acid fragment sequences, which are strictly specific for the delirium type A circoviruses. , type B and type A and B, and those corresponding to a consensus sequence of different porcine circovirus type A and / or B circoviruses.

A great need also exists to have nucleotide sequences available for use as a primer or probe specific for the entire porcine and other known non-pathogenic circovirus.

Said consensus nucleotide sequences specific to all other than circovirus type A and circovirus B are readily identifiable from Figure 3 and SEQ ID NO: 9, and are part of the description.

Among these consensus nucleotide sequences referred to, it is preferred that it is part of the following primer pair:

(a) 5 '- TGC TCG ACA TTG GTG GTG TG 3' and 'TGG AAT GTT AAC CTC TAC AA 3.

The description also includes a nucleotide sequence according to the description, characterized in that said sequence is a different porcine circovirus consensus sequence other than type B circovirus DEL and is one of the primers of the following pair of primers:

a) 5 'GCG GCG GCC ATC GGT TGT AAC TT 3', and 'GAT GGC CCG GAA AGA CGG GTA TC 3.

It is understood that the present disclosure also refers to known porcine specific circovirus polypeptides, other than circovirus, encoded by said nucleotide consensus sequence which can be obtained by purification from natural polypeptides, by genetic recombination or by well-known chemical synthesis. of those skilled in the art and as described below, in particular the processes. Likewise, labeled or unlabelled mono- or polyclonal antibodies directed against said specific polypeptides encoded by said consensus nucleotide sequences are also part of the description.

Such consensus nucleotide sequences, said corresponding said antibodies and polypeptides directed against said polypeptides, may be used in detection and / or identification methods or kits as described below, instead of or in addition to nucleotide sequences, polypeptides or antibodies according to the description, for specific circovirus types A and / or B.

These protocols have been improved to detect differentially circular monomeric forms of specific replicon or virion or replicating DNA forms in the forms found in said dimeric constructs.

<td>molecular</td><td>in</td><td>tandem.</td><td></td><td></td><td></td>

<td>The description</td><td colspan="2">refers</td><td>is still</td><td>i use a sequence</td><td>in</td>

<td>nucleotides</td><td>in</td><td>wake up</td><td>with the</td><td>description as an initiator</td><td>or</td>

<td>probe for</td><td>The</td><td colspan="2">detection and / or</td><td>sequence amplification</td><td>in</td>

nucleic acids.

Nucleotide sequences according to the description may thus be used to amplify nucleotide sequences, notably by PCR (polymerase chain reaction) technique (Erlich, 1989, Innis et al, 1990; Rolfs et al. , 1991; and White et al., 1997).

The oligodeoxyribonucleotide or oligoribonucleotide primers preferably have a length of at least 8 nucleotides, preferably at least 12 nucleotides, and most preferably at least 20 nucleotides.

Other techniques for target nucleic acid amplification may advantageously be used as alternatives to PCR.

The nucleotide sequences of the disclosure, in particular primers as described, may also be used in other methods for amplifying a target nucleic acid, such as:

- the Transcription-based Amplification System (TAS) technique described by Kwoh et al. in 1989;

- the 3SR (Self-Sustained Sequence Replication) technique, described by Guatelli et al. in 1990;

- NASBA (Nucleic Acid Sequence Based Amplification) technique, described by Kievitis et al. in 1991;

- the Strand Displacement Amplification (SDA) technique or the brin replacement amplification technique (Walker et al., 1992);

- the Transcription Mediated Amplification (TMA) technique.

The polynucleotides of the disclosure may also be used in amplification or modification techniques of the nucleic acid serving as a probe, such as:

- the LCR (Ligase Chain Reaction) technique, described by Landegren et al. in 1988 and perfection by Barany et al. in 1991, which exemplifies a thermostable ligase;

- the Repair Chain Reaction (RCR) technique described by Segev in 1992;

- the CPR (Cycling Probe Reaction) technique, described by Duck et al. in 1990;

the Q-beta replication amplification technique described by Miele et al. in 1983 and perfection notably by Chu et al. in 1986, Lizardi et al. in 1988, puis by Burg et al., although by Stone et al. in 1996.

In the case where the target polynucleotide can be detected is an RNA, for example mRNA, it is possible to use prior to implementing an amplification reaction using at least one primer according to description or implementing a detection method using at least a probe of the description, reverse transcriptase enzyme, to obtain a cDNA from the RNA contained in the biological sample. 0 The obtained cDNA will then be targeted to the primers or the probe or used in the amplification or detection method as described.

The detection probe will be chosen so that it hybridizes to the target sequence or amplified fragment generated from the target sequence. Such a detection probe will be advantageous to have a sequence of at least 12 nucleotides, in particular at least 20 nucleotides, and preferably at least 100 nucleotides, in sequence.

The description also includes nucleotide sequences used as a probe or primer according to the description, characterized in that they are labeled with a radioactive compound or a non-radioactive compound.

Untagged nucleotide sequences used directly as probes or primers, however, the sequences are generally labeled with a radioactive element (³²P, ³⁵S, ³H, ¹²⁵I) or by a non-radioactive molecule (biotin, acetylaminofluorene, digoxigenin, 5bromodeoxyuridine, fluorescein) to obtain probes suitable for many applications.

Examples of non-radioactive nucleotide sequence labeling are described, for example, in French Patent No. 78, 10975 or by Urdea et al. or by SanchezPescador et al. 1988

In this case, any of the marking methods described in FR-2422956 and FR 2518755 may also be used.

The hybridization technique can be performed in several ways (Matthews et al. 1988). The most general method is to immobilize the cell nucleic acid extract on a support (e.g. nitrocellulose, nylon, polystyrene) and incubate under defined conditions the target nucleic acid immobilized with the probe. After hybridization, excess probe is removed and hybrid molecules formed are detected by an appropriate method (Measurement of radioactivity, fluorescence, or probe-bound enzyme activity).

The invention also comprises nucleotide sequences according to the description, which are immobilized on a covalent or non-covalent support.

According to another advantageous embodiment of the nucleotide sequences according to the description, the latter can be used immobilized on a support and thus serve to capture by specific hybridization of nucleic target acid obtained from the biological sample. to be tested. If necessary, the solid support is separated from the sample and the complex formed between hybridization of said capture probe and target nucleic acid is then detected using a second probe, called a development probe, labeled with an easily detectable element.

Another object of the present disclosure is a cloning and / or expression vector of a sequence, characterized in that it contains a nucleotide sequence according to the description.

Another object of the present disclosure is a cloning and / or expression vector of a sequence, characterized in that it contains a nucleotide sequence according to the description.

Vectors according to the description, characterized in that they include the elements that allow the expression and / or secretion of said nucleotide sequences in a given host cell, are also part of the description.

The vector should then include a promoter, translation initiation and termination signals, as well as appropriate transcriptional regulatory regions. It must be stable in the host cell and may possibly have particular signals specifying secretion of the translated protein. These different elements are chosen depending on the cell host used. For this purpose, nucleotide sequences according to the invention may be inserted into autonomously replicating vectors within the chosen host, or integrative vectors of the chosen host.

Such vectors are prepared by methods commonly used by one of ordinary skill in the art, and the resulting clones may be introduced into an appropriate host by conventional methods, such as for example lipofection, electroporation, thermal shock.

These vectors are for example vectors of plasmid or viral origin.

Vectors according to the description are for example plasmid or viral source vectors.

A preferred vector for expression of the polypeptides of the invention is baculovirus.

One can also cite the pBS KS vector into which the type A (or DFP) DEL circovirus serial DNA sequence is inserted and as deposited with the CNCM on July 3, 1997, number 1-1891.

These vectors are useful for transforming host cells to clone or express the nucleotide sequences of the disclosure.

The disclosure also comprises host cells transformed by a vector according to the disclosure.

Cells may be obtained by introducing into host cells a nucleotide sequence inserted into a vector as defined above, and then culturing said cells under conditions that permit replication and / or expression of the transfected nucleotide sequence.

Cell host can be chosen from prokaryotic or eukaryotic systems, such as bacterial cells (Olins and Lee, 1993), but also yeast cells (Buckholz, 1993), even animal cells, in particular mammalian cell cultures ( Edwards and Aruffo, 1993), and especially Chinese hamster ovary (CHO) cells, but also insect cells in which procedures such as baculoviruses (Luckow, 1993).

A host cell for protein expression consists of the sf9 insect cells.

E. coli, as filed with CNCM on July 3, 1997, under number 1-1891.

The description also refers to animals, comprising one of said cells transformed as described.

Obtaining transgenic animals according to the invention that overexpress one or more LED circovirus genes or part of the genes will preferably be carried out in rats, mice or rabbits by methods well known to the person skilled in the art such as transfections, viral or not viral. Transgenic animals that overexpress one or more of said genes may be obtained by transfecting multiple copies of said genes under the control of a promoter having an ubiquitous, or tissue type-selective nature. Transgenic animals may also be obtained by homologous recombination into embryonic stem cells, transfer of these stem cells to embryos, selection of affected chimeras at reproductive level, and growth of said chimeras.

Transformed cells as well as transgenic animals can be used in the recombinant polypeptide preparation processes.

Recombinant polypeptides can now be produced in relatively significant amounts by genetic engineering using expression vector transformed cells or using transgenic animals as described.

Procedures for preparing a polypeptide in recombinant form, characterized in that they use a vector and / or a cell transformed by a vector and / or a transgenic animal which includes said cells transformed according to the description, are in turn included herein. description.

Said procedures for preparing a polypeptide in recombinant form include, in particular, preparation processes using a vector and / or a cell transformed by said vector and / or a transgenic animal including one of said transformed cells. containing a nucleotide sequence according to the invention encoding a DEL circovirus polypeptide.

Recombinant polypeptides obtained as indicated above may either be in glycosylated or unglycosylated form and may or may not have the natural tertiary structure.

A preferred variant is to produce a recombinant polypeptide fused to a carrier protein (chimeric protein). The advantage of this system is that it allows stabilization and decreased proteolysis of the recombinant product, increased solubility during in vitro renaturation and / or simplification of purification when the fusion pair has affinity for a specific ligand.

More particularly, a process for preparing a polypeptide comprising the following steps is described:

a) culturing the transformed cells under conditions that allow expression of a recombinant nucleotide sequence polypeptide according to the description;

b) where appropriate, recovering said recombinant polypeptide.

When the process of preparing a polypeptide involves a transgenic animal according to the invention, the recombinant polypeptide is then extracted from said animal.

The description also refers to a polypeptide obtained by a method of the description as described above.

The description also includes a method for the preparation of a synthetic polypeptide, which uses an amino acid sequence of the polypeptides according to the description.

The description also refers to a synthetic polypeptide obtained by a method as described.

Polypeptides according to the description may also be prepared by conventional techniques in the field of peptide synthesis. This synthesis can be performed in homogeneous solution or in solid phase.

For example, the homogeneous solution synthesis technique described by Houbenweyl in 1974 may be used.

This synthesis method consists of successively condensing two successive amino acids in two in the required order, or condensing previously formed amino acids and fragments already containing several amino acids in the appropriate order, or several previously prepared fragments, of course taking care to protect previously all reactive functions on these amino acids or fragments except the amino functions of one and carboxyl of another or vice versa, which should normally intervene in the formation of peptide bonds, especially after activation of the carboxyl function, according to methods well known in peptide synthesis.

According to another preferred technique of description, the one described by Merrifield was used.

To make a peptide chain according to the Merrifield procedure, a very porous polymeric resin was used to attach the first C-terminal amino acid of the chain. This amino acid is fixed to a resin via its carboxylic group and its amino function is protected. Thus, one after the other is fixed the amino acids which will constitute the peptide chain in the previously unprotected amino group of the portion of the peptide chain already formed and which is attached to the resin. When the entire desired peptide chain is formed, the protecting groups of the different amino acids that make up the peptide chain are removed and the peptide removed from the resin with the aid of an acid.

The description further relates to hybrid polypeptides having at least one polypeptide as described and a sequence of a polypeptide capable of inducing an immune response in humans or animals.

Advantageously, the antigenic determinant is such that it is capable of inducing a humoral and / or cellular response.

Such a determinant may comprise a polypeptide according to the invention in glycosylated form used to obtain immunogenic compositions capable of inducing antibody synthesis against multiple epitopes. Said polypeptides or glycosylated fragments thereof are also part of the invention.

Such hybrid molecules may consist of part of a polypeptide carrier molecule or fragments thereof, as described, associated with an immunogenic part possibly, in particular, an epitope of diphtheria toxin, tetanus toxin, a surface antigen hepatitis B virus (FR 79 21811), the polio virus VP1 antigen or any other viral or bacterial toxin or antigen.

Processes for the synthesis of hybrid molecules comprise methods used in genetic engineering to construct nucleotide sequences encoding hybrid polypeptide sequences. It may, for example, advantageously refer to the technique for producing genes encoding fusion proteins described by Minton in 1984.

Said hybrid nucleotide sequences encoding a hybrid polypeptide, as well as hybrid polypeptides according to the description, characterized in that they are recombinant polypeptides obtained by expression of said hybrid nucleotide sequences also form part of the description.

The invention also comprises vectors comprising one of said hybrid nucleotide sequences. Host cells transformed with said vectors, the transgenic animal comprising one of said transforms and methods of preparing recombinant polypeptides using said vectors, said transformed cells and / or said transgenic animal cells are of course also part of the description.

Polypeptides as described, antibodies as described below and nucleotide sequences described as described may be advantageously used in methods for detecting and / or identifying circovirus, or circovirus other than a biological sample (tissue or fluid). which may contain them porcine circovirus. These methods, according to the specificity of the polypeptides, antibodies and nucleotide sequences according to the description to be used, may in particular detect and / or identify a circovirus or map other than a porcine circovirus or DEL circovirus with exception for circovirus Type B.

The polypeptides according to the description may be advantageously used in a method for detecting and / or identifying circovirus type A, type B, type A or B, others than porcine circovirus DEL type B, or others than type A circovirus or porcine circovirus in a biological sample (tissue or biological fluid) which may contain them, comprising the following steps:

(a) contacting said biological sample with a polypeptide or fragment thereof as described (under conditions permitting an immunological reaction between said polypeptide and the antibodies possibly present in the biological sample);

b) identification of the possibly antigen-antibody complexes formed.

In this specification, it is intended to denote circovirus, unless special mention is given, a type A or B circovirus DEL, and porcine circovirus except DEL, unless a special mention is given, a porcine circovirus other than a delusional circovirus. type A and B.

Preferably, the biological sample is comprised of a fluid, for example a pig serum, whole blood or biopsies.

Any conventional procedure may be implemented to achieve such detection possibly formed antigen-antibody complexes.

For example, a preferred method involves immunoenzymatic processes in accordance with ELISA, immunofluorescence, or radioimmunoassay logic (RIA) or equivalent.

Thus, the description also refers to the polypeptides according to the description, labeled with a suitable label, such as enzymes, fluorescent, radioactive.

Such methods include, for example, the following steps:

depositing determined amounts of a polypeptide composition as described in the wells of a microtiter plate

- introduction into said wells of increasing serum dilutions or other biological sample as defined above for analysis,

- microplate incubation

introduction to the wells of the pig immunoglobulin labeled antibody microtiter plate, the labeling of these antibodies has been performed using an enzyme selected from those capable of hydrolyzing a substrate by modifying the radiation absorption of the latter at least; at a given wavelength, for example at 550 nm,

- detect, by comparison with a control lamp, the amount of hydrolyzed substrate.

The description also relates to a kit or kit for the detection and / or identification of DEL circovirus, porcine circovirus other than circovirus or other type of circovirus B, characterized in that porcine circovirus includes the following elements:

- a polypeptide as described,

- optionally, the reagents to be the appropriate medium for the immunological or specific reaction,

optionally, reagents for detecting antigen-antibody complexes produced by the immunological reaction between the or polypeptides of the disclosure and the antibodies possibly present in the biological sample, such reagents may also contain a marker, or be capable of being recognized in turn. a labeled reagent, more particularly in case the description polypeptide is unlabeled,

- where appropriate, a reference biological sample (negative control) without antibodies recognized by a polypeptide according to the description, where appropriate, a reference biological sample ( positive control) containing a predetermined amount of antibodies recognized by a polypeptide according to the amount of description.

Polypeptides according to the description used to prepare monoclonal or polyclonal antibodies characterized in that they specifically recognize polypeptides according to the invention. The monoclonal antibody may be advantageously prepared from hybridomas according to the technique described by Kohler and Milstein in 1975 Polyclonal antibodies may be prepared, for example, by immunizing an animal, in particular a mouse, with a polypeptide according to the invention or a DNA as described, associated with an immune response adjuvant, and then purifying the antibodies. specific antibodies contained in the serum of the immunized animals on an affinity column in which it was previously bound to the polypeptide antigen used. Polyclonal antibodies as described may also be prepared by purification, on an affinity column in which polypeptide has been previously immobilized as described, the antibodies contained in the serum of a pig infected with a DEL circovirus.

The description also refers to mono or polyclonal antibodies or fragments thereof, or chimeric antibodies, characterized in that they are capable of specifically recognizing a polypeptide according to the description.

Antibodies of the specification may also be labeled in the same manner as described above for the nucleic probes of the disclosure as a labeling enzyme, fluorescent or radioactive.

The description further provides a method for detecting and / or identifying circovirus, porcine circovirus except circovirus, or other type B circovirus in a biological sample, comprising the steps of:

(a) contacting the biological sample (tissue or biological fluid) with a mono- or polyclonal as described (under conditions permitting an immunological reaction between said antibodies and the circovirus DEL polypeptides, porcine circovirus other than a DEL circovirus, porcine circovirus other than type B LED circovirus, possibly present in the biological sample);

b) identification of the antigen-antibody complex may be formed. Also within the scope of the specification, a kit or kit for the detection and / or identification of DEL circovirus, porcine circovirus other than a DEL circovirus or porcine circovirus other than type B DEL circovirus, characterized in that it comprises the following elements:

A monoclonal or polyclonal antibody according to the description, if appropriate placed;

Where appropriate, a reagent to provide the appropriate means for carrying out the immunological reaction;

Where appropriate, a reagent for detecting antigen-antibody complexes produced by the immunological reaction, this reagent may also contain a marker, or be capable of being recognized in turn by a labeled reagent, more particularly where said monoclonal or polyclonal antibody is not labeled;

- Where appropriate, reagents for performing lysis of the test sample cells.

The present disclosure also relates to a method for detecting and / or identifying LED, porcine circovirus other than DEL circovirus or non-circovirus type B porcine circovirus, in a biological sample, characterized in that it uses a sequence of nucleotides as described.

More particularly, the disclosure relates to a method for the detection and / or identification of DEL circovirus, porcine circovirus other than DEL circovirus or other type of porcine circovirus other than B-type circovirus, in a biological sample, characterized in that it comprises the following steps:

(a) where appropriate, the isolation of DNA from the biological sample to be analyzed;

b) specific amplification of the DNA sample with at least one primer or pair of primers as described;

c) identification of amplification products.

These can be detected, for example, by the molecular hybridization technique using a nucleic probe as described. This probe is advantageously characterized by a non-radioactive (cold probe) or radioactive element.

For the purposes of this description, it is to be understood as meaning DNA from the biological sample or DNA contained in the biological sample or DNA present in the biological sample concerned, or possibly cDNA obtained after the action of an RNA reverse transcriptase-type enzyme present in the said biological sample.

Another object of the present disclosure is a method as described, characterized in that it comprises the following steps:

(a) contacting a nucleotide probe as described with a biological sample the DNA contained in the biological sample and, if necessary, previously made accessible for hybridization under conditions permitting hybridization of the DNA probe from the sample;

b) demonstration of the hybrid formed between the nucleotide probe and the DNA of the biological sample.

The present invention also relates to a method as described comprising the following steps:

(a) contacting an immobilized nucleotide probe on a substrate as described with an organic sample, the sample DNA may have been previously made accessible for hybridization under conditions allowing hybridization of the probe to the sample DNA;

b) contacting the hybrid formed between the immobilized nucleotide probe on a support and the DNA contained in the biological sample, if any, after removal of the DNA from the biological sample not having hybridized to the probe with a nucleotide labeled probe. according to the description;

c) identification of the new hybrid formed in step b).

According to an advantageous embodiment of the detection and / or identification method defined above, it is characterized by the fact that prewash in step a), the DNA of the biological sample is first amplified using at least one primer as described.

The description further provides a kit or kit for the detection and / or identification of circovirus DEL, porcine circovirus except DEL circovirus or porcine circovirus except DEL type B circovirus, characterized in that it includes the following elements:

a) a nucleotide probe as described;

b) optionally, the reagents required for carrying out a hybridization reaction;

c) optionally at least one primer according to the description and reagents required for a DNA amplification reaction.

The invention also relates to a kit or kit for the detection and / or identification of DEL circovirus, porcine circovirus except DEL circovirus or porcine circovirus except DEL type B circovirus, characterized in that it comprises the following elements:

a) a nucleotide probe, called a capture probe, as described;

b) an oligonucleotide probe, said disclosure probe as described;

c) optionally at least one primer according to the description and reagents required for a DNA amplification reaction.

The description also relates to a kit or kit for detecting and / or identifying DEL circovirus, porcine circovirus other than a DEL circovirus or porcine circovirus other than type B circovirus DEL, comprising the following elements:

a) at least one initiator according to the description;

b) optionally performing the reaction reagents necessary for

c) if it is the verification of specifically with the invention.

DNA amplification; In this case, a component that allows the sequence of amplified fragments, an oligonucleotide probe according to

The description further relates to the use of a nucleotide sequence according to the description, a polypeptide according to the description, an antibody according to the description, a cell according to the description, and / or animals as described for the selection of organic or inorganic compounds capable of modulating, inhibiting or inducing gene expression, and / or modify the cellular replication of DEL circovirus or capable of inducing or inhibiting pathologies associated with DEL circovirus infection.

The description also includes a method of selecting compounds capable of binding to a polypeptide or fragment thereof as described, capable of binding to a nucleotide sequence as described, or an antibody capable of recognizing, as described, and / or capable of modulating, inhibiting or inducing gene expression, and / or modifying cellular circovirus DEL replication or capable of inducing or inhibiting

<td>pathological states</td><td colspan="2">associated with</td><td>the infection by</td><td>circovirus</td>

<td>DEL, featured</td><td>fur</td><td>fact that</td><td>understand the</td><td>following</td>

<td>phases:</td><td></td><td></td><td></td><td></td>

<td>a) the contact</td><td>of</td><td>referred</td><td>composed with the</td><td>referred</td>

<td>polypeptide,</td><td>in</td><td>that</td><td colspan="2">said sequence of</td>

<td colspan="2">nucleotides with</td><td>a cell</td><td>transformed</td><td>such as</td>

described and / or administering said compound to a transformed animal as described;

b) determining the ability of said compound to bind to said polypeptide or nucleotide sequence, or to modulate, inhibit or induce gene expression, or to modulate growth or replication of LED circovirus, or to induce or inhibit said animal disease. circuits related to DEL circovirus infection (called activity of said compound).

Compounds capable of being selected may be organic compounds, such as polypeptides or carbohydrates or other known inorganic or organic compounds, or novel organic compounds produced using molecular modeling techniques and obtained by chemical or biochemical synthesis, such techniques being known. by those skilled in the art.

Said selected compounds may be used to modulate cell replication of DEL circoviruses and thus to control infection by this virus. The methods for determining said modulations are well known to those skilled in the art.

Such variation may be obtained for example by an agent capable of binding to a protein and thus inhibiting or enhancing its biological activity, or capable of binding to an envelope of the outer surface protein of said virus and penetration of the protein. block said virus in the host cell or to promote the action of the infected organism's immune system directed against said virus. Such modulation may also be accomplished by an agent capable of binding to a nucleotide sequence of a DNA virus and said block of, for example, expression of a polypeptide whose biological or structural activity is required for replication and proliferation of the DNA. said host cell viruses to host animal host cells.

Description refers to compounds which may be selected from

<td>across</td><td>a method of agreement</td><td>with the</td><td>description.</td><td></td>

<td>The invention</td><td>also concerns</td><td>to one</td><td>compound for</td><td>use as a</td>

<td>medicine</td><td>which comprises</td><td>one</td><td>polypeptide</td><td>sequence</td>

<td>glycosylated</td><td>isolated possessing</td><td>fur</td><td>minus 90% of</td><td>identity</td>

SEQ ID NO: 15, wherein said medicament is an immunogenic composition for the treatment and / or prevention of type B circovirus DEL infection.

The invention also relates to a compound for use as a medicament comprising an isolated glycosylated sequence polypeptide having at least 90% identity to sequence SEQ ID NO: 15, wherein said medicament is a vaccine for the treatment and / or prevention of type circ DEL circovirus infection. The description also relates to an immunogenic composition and / or vaccine, which comprises an isolated glycosylated polypeptide sequence having at least 90% identity to sequence SEQ ID NO: 15, optionally together with a pharmaceutically acceptable carrier and where appropriate with one or more appropriate immunity adjuvants.

The invention also comprises an immunogenic and / or vaccine composition according to the invention, comprising an isolated glycosylated polypeptide sequence having at least 90% identity to sequence SEQ ID NO: 15, for the prevention or treatment of a DEL circovirus infection.

The invention also comprises a composition and / or immunogenic vaccine according to the invention, comprising an isolated glycosylated polypeptide sequence having at least 90% identity to sequence SEQ ID NO: 15, for prevention or treatment. of infection by a type B DEL circovirus.

The description also relates to a pharmaceutical composition comprising a compound selected from the following compounds:

a) a nucleotide sequence as described;

b) a polypeptide as described;

b) a vector, a viral particle or a transformed cell as described;

c) an antibody according to the description;

d) a compound capable of being selected by a selection method according to the description;

optionally in combination with a pharmaceutically acceptable carrier and, where appropriate, one or more appropriate immunity adjuvants.

The description also relates to an immunogenic composition and / or vaccine, characterized in that it comprises a compound selected from the following compounds:

a) a nucleotide sequence as described;

b) a polypeptide as described;

c) a vector or viral particle as described; and

d) a cell according to the description.

The description further relates to a vaccine composition according to the description, comprising a mixture of at least two of said compounds a), b), c) and d) above, and wherein both of these compounds are related to type A circoviruses and the other type B circoviruses.

A or B-type DEL circovirus compound means a compound obtained respectively from the sequence of the A or B-type circovirus DEL genome.

The description also relates to an immunogenic composition and / or vaccine, characterized in that it comprises at least one of the following compounds:

- A nucleotide sequence SEQ ID NO: 11, SEQ ID NO: 12, or a fragment thereof;

A polypeptide sequence of SEQ ID NO: 14 or a fragment thereof, a fragment of a polypeptide sequence SEQ ID NO: 15;

<td>- a vector,</td><td>or</td><td>a viral particle that</td><td>understand</td><td>an</td>

<td>sequence of</td><td colspan="2">nucleotides SEQ ID NO: 11, ID</td><td>SEQ No. 12,</td><td>or</td>

<td>a fragment;</td><td></td><td></td><td></td><td></td>

<td colspan="2">One cell</td><td>transformed capable of</td><td>express</td><td>one</td>

<td>polypeptide</td><td>in</td><td>SEQ ID No. 14, SEQ ID</td><td>No. 15, or</td><td>one</td>

<td>fragment; or</td><td></td><td></td><td></td><td></td>

<td colspan="2">A mix</td><td>of at least two</td><td colspan="2">of those</td>

compounds.

The description also includes an immunogenic composition and / or vaccine according to the description, characterized in that said mixture comprises at least two of said compounds as a combination product for simultaneous,

<td>separate</td><td>or</td><td>staggered</td><td>in time to</td><td>the prevention</td><td>or</td>

<td>treatment</td><td>in</td><td colspan="2">DEL circovirus infection,</td><td>especially</td><td>of</td>

<td>type B.</td><td></td><td></td><td></td><td></td><td></td>

<td>In a form</td><td>in</td><td>realization</td><td colspan="2">preferred, the vaccine composition</td><td>gives</td>

Description comprises mixing the following compounds:

A pcDNA3 plasmid containing a nucleic acid sequence of SEQ ID NO: 11;

a pcDNA3 plasmid containing a nucleic acid sequence of SEQ ID NO: 12;

A pcDNA3 plasmid containing a nucleic acid encoding the GM-CSF protein;

A recombinant vector containing a baculovirus nucleic acid sequence of SEQ ID NO: 11;

A recombinant vector containing a baculovirus nucleic acid sequence of SEQ ID NO: 12; and

- Where necessary, an adjuvant of adequate immunity, including AIF ™ adjuvant.

The description also relates to a pharmaceutical composition as described for the prevention or treatment of a circovirus infection.

The description also relates to a pharmaceutical composition as described for the prevention or treatment of type B circovirus DEL infection.

The description also relates to the use of a composition as described for the preparation of a medicament for the prevention or treatment of circovirus infection, preferably type B circovirus DEL.

In another aspect, the disclosure relates to a vector, a viral particle or a cell as described for the treatment and / or prevention of a disease by gene therapy.

Finally, the description includes the use of a vector, viral particle or cell as described for the preparation of a medicament for the treatment and / or prevention of a disease by gene therapy.

Polypeptides used in describing the immunogenic or vaccine compositions of the invention may be selected by techniques known to those skilled in the art, such as the ability of said polypeptides to stimulate T cells, which results for example in their proliferation or secretion of the interleukins, and leading to the production of antibodies against said polypeptides.

In pigs, as in mice, in which a dose of weight comparable to that used in humans administered vaccine composition, the antibody reaction was tested by collecting serum, followed by a study of the formation of a complex between the antibody. present in serum and the antigen of the vaccine composition according to standard techniques.

The compositions and / or immunogenic vaccine according to the invention contain an effective amount of the compounds of the disclosure, that is, a sufficient amount of said compound to achieve the desired effect, such as modulating cell replication of circovirus. Those skilled in the art will determine this amount, for example, depending on the age and weight of the subject being treated, disease progression, possible side effects, and the evaluation of the effects obtained with a sample population. known in these application areas.

Said vaccine compositions will preferably be in combination with a pharmaceutically acceptable carrier and, where appropriate, one or more appropriate immunity adjuvants.

Today, various types of vaccines are available to protect animals or humans against infectious diseases: live attenuated microorganisms (M. bovis - BCG for tuberculosis), inactivated microorganisms (influenza virus), acellular extracts (Bordetella pertussis for whooping cough), proteins. recombinants (hepatitis B surface antigen), polysaccharides (pneumococci). Vaccines prepared from synthetic peptides or genetically modified microorganisms expressing heterologous antigens are being tested. Even more recently, recombinant plasmid DNAs carrying genes encoding protective antigens have been proposed as an alternative vaccine strategy. This type of vaccination is performed with a particular plasmid derived from an E. coli, which does not replicate in vivo and encodes the vaccine protein only. Animals were immunized by simply injecting naked plasmid DNA into muscle. This technique leads to the expression of vaccine protein in situ and a cellular (CTL) and humoral (antibody) immune response. This dual induction of immune response is a major advantage of the naked DNA vaccination technique.

Vaccine compositions comprising nucleotide sequences or vectors into which said sequences are inserted are, in particular, described in International Patent Application No. WO 90/11092 and also in International Patent Application No. WO 95 / 11307.

The nucleotide sequence constituting the vaccine composition as described may be fed to the host after it has been coupled to compounds that promote the penetration of this polynucleotide into the cell or its transport to the cell nucleus. The resulting conjugates may be encapsulated in polymeric microparticles as described in International Patent Application No. WO 94/27238 (Medisorb Technologies International).

The meaning of pharmaceutically acceptable carrier, a compound or combination of compounds which enters a pharmaceutical composition or vaccine does not cause side reactions and, for example, facilitates administration of the active compound, increasing its life and / or efficacy thereof. increasing its solubility in solution, or to improve its storage. These pharmaceutically acceptable carriers are well known and can be adapted by one of skill in the art, depending on the nature and mode of administration of the active compound chosen.

With respect to vaccine formulations, these may include appropriate immunity adjuvants which are known to those skilled in the art, such as aluminum hydroxide, a representative of the muramyl peptide family, such as one of N-acetylmuramyl peptide derivatives, a bacterial lysate, or incomplete Freund's adjuvant.

These compounds may be administered systemically, in particular intravenously, intramuscularly, intradermally or subcutaneously, or orally. More preferably, the vaccine composition comprising polypeptides according to the invention will be administered intramuscularly, repeatedly dieted or nebulized, spaced over time.

Methods of administration, doses and dosage forms may be determined according to criteria generally taken into account to determine an appropriate treatment for an animal, such as age or weight, severity of condition, tolerability and side effects observed. .

The present invention also relates to the use of DEL circovirus nucleotide sequences according to the invention for the construction of self-replicating retroviral vectors and cellesci therapeutic applications, in particular in the field of in vivo human gene therapy.

The feasibility of gene therapy in humans is well established and it is about many therapeutic applications, such as genetic diseases, infectious diseases and cancers. Many prior art documents describe how to implement gene therapy, in particular by means of viral vectors. In general, vectors are obtained by deleting at least a portion of the viral genes, which are replaced by the genes of therapeutic interest. Such vectors may be propagated in a complementation cell line, which provides trans-deleted viral functions to generate a viral vector particle for defective replication, but which may infect a host cell. To date, retroviral vectors are the most widely used and in the mode of infection is widely described in the literature available to those skilled in the art.

The principle of gene therapy is the delivery of a functional gene, said gene of interest, the corresponding RNA or protein producing the desired biochemical effect on target cells or tissues. On the one hand, gene insertion allows extended and unstable complex molecules such as RNA or proteins that may be extremely difficult or impossible to directly obtain or administer expression. In addition, controlled insertion of the desired gene into specific target cells may regulate the expression product in tissues. To this end, it is necessary to be able to insert the desired cells into the selected therapeutic gene and therefore the insertion method to specifically target the selected cells or tissues.

Among methods of gene insertion, such as microinjection, including naked DNA plasmid injection (Derse, D. et al.

From 1995, and Zhao, TM et al. 1,996), homologous recombination, the use of viral particles, such as the retrovirus, is widespread. However, when applied in vivo, such gene transfer systems exhibit recombinant retroviral, both low infectivity (insufficient concentration of viral particles) and a lack of specificity with respect to selected target cells.

The embodiment of cell-specific viral vectors having tissue-specific tropism and transduction with the gene of interest may conveniently be carried out by target cells, for example, by fusion of a specific host cell ligand. N-terminal target portion of a circovirus envelope surface protein. These include for example the construction of retroviral particles containing the CD4 molecule on the box surface to target HIV-infected human cells (Young et al. JAT. Science 1990, 250, 1421-1423), viral particles. which have a peptide hormone with an envelope fusion protein to specifically infect cells expressing the corresponding receptor (Kasahara, N. et al. Science 1994, 266, 1373-1376) or alternatively with viral particles a fuse capable of binding to the epidermal growth factor (EGF) receptor (Cosset, FL et al. J. of Virology 1995, 69, 10, 6314-6322) polypeptide. In another approach, individual antibody fragments against chain surface antigens. Target cells are introduced by fusion with the N-terminal portion of the coat protein (VALSESIA-WITTMAN, S. et al, J. of Virology 1996, 70, 3, 2059-2064; TEARINA CHU, and TH ai. J. of Virology 1997, 71, 1, 720-725).

For purposes of this disclosure, a gene of interest in use in the disclosure may be obtained from a eukaryotic or prokaryotic organism or virus by any conventional technique. It is preferably capable of producing an expression product having a therapeutic effect and may be a homologous, or alternatively heterologous, product to the host cell. In the context of the present disclosure, a gene of interest may encode a product of (i) intracellular, (ii) present on the surface of the host cell membrane or (iii) secreted from the host cell. It may therefore comprise additional elements such as, for example, a sequence encoding a secretion signal. These signals are known to those skilled in the art.

According to the objects of the present invention, a gene of interest may encode an isolated protein corresponding to all or part of a native protein as found in nature. It may also be a chimeric protein, for example from fusion polypeptides of various origins or a mutant with improved and / or modified biological properties. Such a mutant may be obtained by conventional biology techniques by substitution, deletion and / or addition of one or more amino acid residues.

Particularly preferred is the use of a gene of therapeutic interest encoding an expression product capable of inhibiting or delaying the establishment and / or development of a genetic or acquired disease. A vector as described is particularly intended for the prevention or treatment of cystic fibrosis, hemophilia A or B, Duchenne or Becker muscular dystrophy, cancer, AIDS, and bacteria or other infectious diseases caused by a pathogenic organism. : viruses, bacteria, parasites or prion. The genes of interest used in the present description are those encoding, for example, the following proteins:

- a cytokine including interleukin, interferon, tissue necrosis factor and a growth factor including hematopoietic (G-CSF, GM-CSF),

- A factor or cofactor involved in coagulation and including Factor VIII, von Willebrand factor, antithrombin III, protein C, thrombin and hirudin,

An enzyme or enzyme inhibitor, such as viral protease inhibitors,

- a product of a suicide gene such as HSV thymidine kinase (herpes virus) expression type 1, - an ion channel activator or inhibitor,

- A protein whose absence, modification or deregulation of expression is responsible for a gene disease such as CFTR protein, dystrophin or minidistrophin, insulin, ADA (adenosine diaminose) glucocerebrosidase and phenylhydroxylase,

A protein capable of inhibiting cancer initiation or progression, such as tumor suppressor expression gene products such as p53 and the Rb genes,

A protein capable of stimulating an immune response or an antibody, and

A protein capable of inhibiting a viral infection, or its development, such as virus antigenic epitopes or altered variants of viral proteins capable of competing with the relevant native viral proteins.

The description therefore concerns vectors characterized in that they comprise a nucleotide sequence as described circovirus, and wherein they further comprise a gene of interest.

The present disclosure also relates to viral particles generated from said description vector. It further relates to methods for producing viral particles as described, characterized in that they employ a vector as described, including similar viral particles (VLP, Vrrus-Like Particles).

The description also refers to that transfected with a vector as described for animal cells.

Also included in the description of animal cells, in particular mammals, are those cells infected with a viral particle according to the description.

The present invention also relates to a vector, a viral particle or a cell according to the description for the treatment and / or prevention of a genetic or cancer disorder or a disease. It comprises a vector composition or an agent cell. therapeutic or vehicle aspects an acquired disease such as infectious. The description is also pharmaceutical comprising, as an agreement with the invention, for the prophylactic, in combination with pharmaceutically acceptable ones.

Other features and advantages of the invention appear in the following examples and figures:

Picture's description

Figure 1: Experimental scheme that allowed isolation and identification of type A and B-associated circoviruses.

Test 1: Experimental reproduction of LED by inoculation of shredded organs of pigs from breeds affected by LED. Test 2: experimental reproduction of LED.

Test 3: Experimental reproduction of LED.

Test 4: absence of experimental reproduction of LED.

Figure 2: Type A LED-associated circovirus genome organization (PCVA)

- polarity chain (+) (SEQ ID NO: 1);

- (-) polarity chain (SEQ ID NO: 2, shown following 3 '-&gt; 5' orientation);

amino acid sequences of proteins encoded by two strands of DNA in the three possible reading frames.

Figure 3: Alignment of nucleotide sequence SEQ ID NO: 1 of the type A circovirus DEL (PCVA) and the strain MEEHAN and strain MANKERTZ of porcine cell lines.

Figure 4: Alignment of amino acid sequence SEQ ID NO: 6 of polypeptide encoded by nucleotide sequence SEQ ID NO: 3 (0RF1) of type A circovirus DEL (PCVA) and corresponding nucleotide sequences of strain MEEHAN and MANKERTZ line strains porcine cell phones.

Figure 5: Alignment of amino acid sequence SEQ ID NO: 7 of polypeptide encoded by nucleotide sequence SEQ ID NO: 4 (0RF2) of type A circovirus DEL (PCVA) and corresponding nucleotide sequences of strain MEEHAN and MANKERTZ line porcine cell phones.

Figure 6: Alignment of amino acid sequence SEQ ID NO: 8 of polypeptide encoded by nucleotide sequence SEQ ID

<td>No. 5 (0RF3)</td><td>circovirus</td><td>LED of type</td><td colspan="2">A (PCVA) and</td>

<td>sequences</td><td>nucleotide</td><td>matching</td><td>From</td><td>circovirus</td>

<td colspan="2">MEEHAN strain and strain</td><td>MANKERTZ of</td><td>lines</td><td>cell phones</td>

<td>porcines.</td><td></td><td></td><td></td><td></td>

<td>Figure 7:</td><td>Analysis by</td><td>Western blot</td><td>of</td><td>proteins</td>

<td colspan="2">circovirus recombinants</td><td colspan="2">Type A LED (PCVA).</td><td>The analyses</td>

were performed on cell extracts from Sf9 cells obtained after infection by the recombinant PCV ORF 1 baculovirus. Figure 8: Type B-associated circovirus (PCVB) genome organization

- polarity chain (+) (SEQ ID NO: 9);

(-) polarity chain (SEQ ID NO: 10, shown following 3H5 'orientation);

amino acid sequences of proteins encoded by two strands of DNA in the three possible reading frames.

Figure 9: Evolution of the average daily gain (MMQ) of rearing pigs affected by piglet weight loss disease (SLF or LFL) under experimental conditions.

Figure 10: GMQ compared to the 3 pig lots (Fl, F3 and F4) calculated over a 28 day period after vaccination test.

Figure 11: Hyperthermia greater than 41 ° C, expressed as a percentage compared to the 3 pig lots (Fl, F3 and F4) calculated per week over a period of 28 days following vaccination test.

Figure 12: Membranes of the peptide spots corresponding to 0RF2 revealed with the aid of an infected pig serum from a conventional rearing.

The numbers of type B circovirus-specific peptides as well as their unreactive homologues (type A) are indicated in bold.

Non-specific immunogenic peptides are indicated in italics.

Figure 13: Alignment of amino acid sequences of proteins encoded by 0RF2 of type A circovirus DEL and 0RF2 of type circ circovirus DEL. The 4-peptide position corresponding to type B circovirus-specific DEL epitopes is indicated in the corresponding sequence with a thick stroke, the homologue in the sequence of type DEL circovirus is also indicated with a single stroke.

EXAMPLES

EXAMPLE 1: Cloning, Sequencing, and Characterization of Type A DEL Circovirus (PCVA)

1- Experimental Procedures

Experimental reproduction of the infection and its syndrome (cf. Figure 1).

A first test was carried out on pigs from a very large breed but affected by piglet slimming disease (SLD) or also called DFL (Fatal Piglet Withering). Contact tests with IOPE pigs (Exempt from specified pathogens) showed a transfer of contaminant (s) resulting in a complex pathology associated with hyperthermia, growth slowing, diarrhea and conjunctivitis. 0 SRRS virus (porcine reproductive and respiratory syndrome, infectious disease due to an arterivirus) was rapidly isolated from rearing pigs and contact pigs. The set of clinical signs could have been attributed to the presence of the SRRS virus. However, two rearing pigs showed signs of DFL without SRRS virus being isolated. Histological analyzes and blood formulas showed, however, that these pigs were afflicted with an infectious process of viral origin.

In a second test, 8-week IOPE pigs were inoculated intratracheally with shredded organs from the two pigs struck with DFL. Inoculated pigs had hyperthermia 8 to 9 days after infection, and their growth slowed. Other IOPE pigs placed in contact showed similar signs, attenuated 30 days after the initial test. No seroconversion to a European or Canadian strain of SRRS virus was recorded in these animals.

A third test made it possible to reproduce the syndrome from collections made on pigs from the second test.

Conclusion

The syndrome is reproduced under experimental conditions. It is determined by at least one direct contact transmissible infectious agent. Clinical constants are sometimes elevated hyperthermia (greater than or equal to 41.5 ° C) that develops 8 to 10 days after infection. A slowdown in growth may be observed. The other manifestations are an inversion of blood formula (inversion from lymphocyte / polynuclear ratio 70/30 to 30/70) and frequent ganglion lesions, especially those that drain the respiratory tract (ganglionic hypertrophy, loss of structure with necrosis and infiltration by giant mononuclear or polynuclear cells).

2- Laboratory studies

Several cell supports including primary or inbred pig kidney cells, pig testis cells, monkey kidney cells, pig lymphocytes, pig alveolar macrophages, circulating blood monocytes were used to highlight the possible presence of a virus. No cytopathic effect was evidenced in these cells. In contrast, the use of diseased pig serum after experimental infection has revealed an intracellular antigen in monocytes, macrophages and about 10% of the pig kidney (RP) cells infected with the ground organs. This indirect disclosure was made in kinetics at different culture times. It follows that the antigen initially appears in the nucleus of infected cells before propagating in the cytoplasm. Successive passages in cell culture did not allow signal amplification.

In organ electron microscopy, serum conditions were specifically visualized by the experimental conditions, estimated at 20 nm.

applied to the ground matter of marked spherical particles of sick pigs infected on the ground.

After two passages of this shredded organ matter in pig lymphocytes and then three passages in pig kidney or testis cells, a cytopathic effect developed and amplified. An electron microscope showed an adenovirus that under experimental conditions does not reproduce DFL (only one peak of hyperthermia is noted 24 to 48 hours after infection, and then nothing else).

DNA bands could be evidenced in certain samples of pigs infected under experimental conditions and showing signs of disease (results not shown). There is some correspondence between samples that give a positive cell culture result and those that have a DNA band.

Conclusion

At least two types of virus have been evidenced in the shredded organ matter of DFL sick pigs. One is adenovirus, but it does not itself produce the disease. The other type of virus is a circovirus and is associated with DFL. This circovirus, from which two types have been isolated and sequenced, hereinafter referred to as type A (or PCVA) DEL circovirus and type B (or PCVB) DEL circovirus, present mutations with respect to the known non-pathogenic circovirus sequences for the pig.

3- Cloning and sequencing of type A circovirus DEL DNA

Extraction of the replicative form of DNA (RF), cleavage by the enzyme Κρη I and amplification by a pair of primers flanking the restriction site Κρη I. Sequencing of the two strands at least twice by the Sanger method.

The nucleic sequence of the polarity (+) chain of the circovirus genome type (or PCVA) strain DFL, represented by the sequence SEQ ID NO: 1 sequences.

being nucleic in the chain list of the polarity (-) sequence of the type A circovirus DEL (or PCVA) genome by nucleic sequence 3 of figure 3 or by sequence SEQ ID NO: 2 (represented by the 5 '^ 3 orientation ') in the sequence list.

The amino acid sequences SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 from the sequence list representing, respectively, the protein sequences encoded by the nucleic sequences of the 3 open reading frames SEQ ID NO: 3 ( 0RF1), corresponding to protein REP, SEQ ID NO: 4 (0RF2) and SEQ ID NO: 5 (0RF3), determined from the sequence SEQ ID NO: 1 of the polarity (+) chain or the sequence SEQ ID NO: 2 of the polarity (-) chain of the type A circovirus DEL genome.

4- Comparison of nucleovide and amino acid sequences of delirium type A (or associated DEL) circoviruses with the corresponding MEEHAN and MANKERTZ circovirus sequences of porcine cell lines

Use of DNA sequence analysis software, ADNSIS.

Oligonucleotide sequences used as primers or probes in detection and or identification processes

1. specific detection of type A circovirus DEL:

PCV primer 5: 5 'GTG TGC TCG ACA TTG GTG TG 3';

PCV primer 10: 5 'TGG AAT GTT AAC GAG CTG AG 3';

2. Specific detection of circovirus cell lines:

PCV primer 5: 5 'GTG TGC TCG ACA TTG GTG TG 3';

MEEI primer: 5 'TGG AAT GTT AAC TAC ATC AA 3';

3 Differential detection:

Primer pairs used are those for example described in paragraphs 1 and 2 above;

4 detection of monomeric circular replicative forms (RF):

PCV primer 5: 5 'GTG TGC TCG ACA TTG GTG TG 3';

PCV primer 6: 5 'CTC GCA GCC ATC TTG GAA TG 3';

5 Detection of serial dimer-containing vectors:

Nar dimer:

KS 620 primer: 5 'CGC GCG TAA TAC GAC TCA CT 3';

PCV 5 primer: 5'GTG TGC TCG ACA TTG GTG TG 3 ';

Kpn dimer:

KS 620 primer: 5 'CGC GCG TAA TAC GAC TCA CT 3';

PCV primer 6: 5 'CTC GCA GCC ATC TTG GAA TG 3';

6 Differential detection:

primer pairs are those for example described in paragraphs 4 and 5 above.

The processes using the primer pairs described in paragraphs 4 and 5 are particularly interesting for detecting in a differential manner circular monomeric forms of replicating virion-specific or replicating DNA forms and dimeric forms found in the so-called molecular constructs.

Serial constructs of the viral genome (dimers) such as the constructs used for the preparation of the pBS KS + Tandem PCV Kpn 1 vector, deposited at CNCM No. 1-1891, July 3, 1997 (E. coli transformed by said vector) are very interesting for their use in sufficient methods of producing a DNA inoculum for virus production and this in the absence of a satisfactory cell-based virus production protocol. Said production methods using these serial constructs of the viral genome will allow virulence factors to be studied by mutation and therefore can be used for the manufacture of a virus collection with the indicated mutations in the construction of vectors that will show tropism and virulence. appropriate. These self-replicating framework vectors exhibit sought-after gene transfer properties, especially for their gene therapy and vaccinology applications.

Western blot analysis of recombinant type A circovirus DEL proteins

Results were obtained using a DEL circovirus-specific antiserum produced during assay 1 (ct.

D ·

Product Type Analyzed

Analyzes were performed on cell extracts from Sf9 cells obtained after infection by recombinant PCV ORF 1 baculovirus.

Sf9 cell culture was performed in a 25 cm Petri dish² according to conventional culture methods for these cells. After centrifugation, cell pellets are taken up by 300 µl PBS buffer (saline phosphate buffer).

Electrophoresis (SDS-PAGE)

Electrophoresis is performed on Sf9 cell extracts obtained previously in 5 samples (see table 1 below) under the following conditions:

% polyacrylamide gel: 8%; Conditions: Denaturants Voltage: 80 V; Duration: 135 minutes

Table 1: Nature of electrophoresed samples

<td>No. wells</td><td> 1</td><td> 2</td><td> 3</td><td> 4</td><td> 5</td>

<td>Deposits</td><td>PM</td><td>Raoul</td><td>Raoul</td><td>Raoul</td><td>Raoul</td>

<td></td><td>Rainbow</td><td>24 h</td><td>48 h</td><td>72 h</td><td>96 h</td>

<td>pL sample</td><td> 10</td><td> 15</td><td> 15</td><td> 15</td><td> 15</td>

<td>pL Laemli 4X</td><td> 0</td><td> 5</td><td> 5</td><td> 5</td><td> 5</td>

<td colspan="2">Table 1 Captions:</td><td></td><td></td><td></td><td></td>

<td colspan="2">Laemli 4X: Charge Buffer</td><td></td><td></td><td></td><td></td>

<td colspan="2">PM Rainbow: Markers of</td><td colspan="3">molecular weight (35, 52,</td><td> 77, 107,</td>

<td>160 and 250 kDa)</td><td>Raoul 24 h</td><td>48 h</td><td colspan="3">72 h and 96 h: products of</td>

<td colspan="3">DEL circovirus ORF1 expression</td><td colspan="2">type A.</td><td></td>

Western blot

After electrophoresis, the bands obtained in the different wells are transferred on a nitrocellulose membrane for 1 h at 100 V in a TGM (Tris-glycine-methanol) buffer.

Western blot is performed under the following conditions:

1) Saturation by a solution containing 5% skimmed milk;

0.05% Tween 20 in TBS IX buffer (Tris buffer saline) for 30 minutes.

2) 1st antibody:

ml of type A anti-circovirus DEL antibody are added diluted 1/100, and then the reaction medium is incubated overnight at 4 ° C. Three 10 min washes are performed in TBS IX.

3) 2nd antibody:

ml peroxidase-coupled rabbit anti-immunoglobulin rabbit P164 antibody (Dakopath) is added diluted 1/100, then the reaction medium is incubated 3 hours at 37 ° C. Three washes are performed 10 min in TBS IX.

4) Revelation

4-Chloro-1-naphthotol substrate is used for development in the presence of hydrogen peroxide.

Results

The results are represented in figure 7.

Kinetics of the appearance of antibodies specific for

<td>protein</td><td>recombinant REP of</td><td>circovirus</td><td>DEL</td><td>type A</td>

<td>express</td><td>in baculovirus after</td><td>infection</td><td>From</td><td>pigs at</td>

type A circovirus (assay 4, see Figure 1)

Following infection of the pigs, a serum sample is taken from each of the infected pigs at different times expressed in the table by the date of collection (performed here in the same year) and then analyzed by Western blot.

The disclosure of specific antibodies is performed as described above.

The results obtained are represented by table 2 below.

Table 2: Kinetics of appearance of specific antibodies

<td>Sample</td><td>Pig</td><td> 10/06</td><td> 16/06</td><td> 23/06</td><td> 01/07</td><td> 08/07</td><td> 15/07</td><td> 21/07</td>

<td>A3 Control</td><td> 1 2</td><td></td><td></td><td></td><td></td><td></td><td>Neg. Neg.</td><td></td>

<td>B2 Infect RP +</td><td> 1 2 3 4</td><td>Neg. Neg. Neg. Neg.</td><td>Neg. Neg. Neg. Neg.</td><td>Neg. Neg. Neg. Neg.</td><td>+ Neg. Neg. Neg.</td><td>+ Neg. + Neg.</td><td>+ + Neg. + Neg.</td><td>+++ Neg. + + +</td>

<td colspan="9">Table 2 Captions: A3 Control: uninfected control animals; B2 Infect. RP +: animals infected with pig kidney cells (RP) containing circovirus; Neg .: negative; +, ++, +++: positive reaction intensity scale; 6/10, 6/16, 6/23, 7/1, 7/8, 7/15, 7/21: dates expressed day / month for which the different samples were collected serum.</td>

EXAMPLE 2: Cloning, Sequencing, and Characterization of Type B Circovirus DEL (PCVB)

The techniques used for cloning, sequencing, and characterization of type B circovirus DEL (PCVB) are those used in example 1 above for type A circovirus DEL (PCVA).

The type B (or PCVB) DEL circovirus genome (+) polarity (+) chain nucleic sequence is represented by the sequence SEQ ID NO: 9 in the sequence list, with the genome (-) polarity (-) chain nucleic sequence being of the type B (or PCVB) DEL circovirus by the 3 '^ 5' nucleic sequence of Figure 8 or by the sequence SEQ ID No. 10 (represented by the 5 '^ 3' orientation) in the sequence list.

The amino acid sequences SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 from the sequence list representing, respectively, the protein sequences encoded by the nucleic sequences of the 3 open reading frames SEQ ID NO: 11 ( ORF'1), corresponding to the protein REP, SEQ ID NO: 12 (ORF'2) and SEQ ID NO: 13 (ORF'3), determined from the sequence SEQ ID NO: 9 of the (+) or of sequence SEQ ID NO: 10 of the polarity (-) chain of the type B circovirus DEL genome.

EXAMPLE 3: Comparative Analysis of Nucleotide (ORF1, ORF2, and Genomic) Sequences and Amino Acid Sequences Encoded by ORF1 and ORF2 of Type A (PCVA) and Type B (PCVB) circoviruses

Results expressed as% of homology are shown in the following tables 3 and 4.

Table 3: Comparative Analysis of Amino Acid Sequences

<td>% homology</td><td>ORF1</td><td>ORF2</td>

PCVA / PCVB

80,4

56,2

Table 4: Comparative Analysis of Nucleotide Sequences

<td>% homology</td><td>Genomics</td><td>ORF1</td><td>ORF2</td><td>0 left</td>

<td>PCVA / PCVB</td><td> 70,4</td><td> 80,4</td><td> 60, 1</td><td> 66,1</td>

EXAMPLE 4: Observation of disease and reproduction of disease under experimental conditions

a) Test No 1: Observation of the disease

The aim is to take farmed animals early in the disease and place them under experimental conditions to follow the pathology evolution and to describe the clinical manifestations. This first trial was carried out on 3 10-week-old rearing pigs of which 2 were already sick (withered) and 3 other 13-week-old pigs showing no signs of disease. Clinical observation lasted over a period of 37 days. Two 10-week pigs quickly withered (pig 1 and 2, figure 9) and had to be slaughtered 5 and 6 days after their arrival. Only one had hyperthermia at 5 days and diarrhea. Two other pigs had dyspnea and cough, one of which presented hyperthermia above 41 ° C during the first two days of their stay. Another pig slowed in the second week (pig 6, figure 9), with no other clinical signs being revealed. At the level of the lesions, 5 out of 6 pigs had macroscopic lesions of gray hepatization pneumonia, with the sixth healed lung lesions.

(b) Test No 2: Reproduction of the disease from inoculum prepared in farmed pigs.

The two sick pigs in trial 1 were used to prepare inocula which were tested in trial 2 in pigs free of specific pathogens (IOPE, SPF in the Anglo-Saxon version). IOPE pigs were 9 weeks old at the time of inoculation. Clinical and lesional results are presented in table 5.

Table 5: Recap of measurements made during experimental reproductions of LED (values ​​in parentheses are shown for control animals, underlined values ​​indicate a difference between infected and control animals)

<td>Test Measurement</td><td> 2</td><td> 3</td><td> 4</td><td> 5</td><td> 6</td><td> 7</td>

<td>Statute of</td><td>IOPE CNEVA</td><td>IOPE ground</td><td>IOPE CNEVA</td><td>IOPE CNEVA</td><td>Conventional</td><td>Conventional</td>

<td>pigs</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>Age</td><td>9 weeks</td><td>6 weeks</td><td>5 weeks</td><td>5 weeks</td><td>5 weeks</td><td>6-7 weeks</td>

<td>Number</td><td> 4</td><td> 6</td><td> 12</td><td> 8</td><td> 8</td><td> 8</td>

<td>Via</td><td>Via</td><td>Via</td><td>Via</td><td>Via</td><td>Via</td><td>Via</td>

<td>inoculation</td><td>intratracheal</td><td>intratracheal</td><td>intratracheal</td><td>intratracheal</td><td>intratracheal</td><td>intratracheal</td>

<td></td><td></td><td></td><td> +</td><td> +</td><td> +</td><td> +</td>

<td></td><td></td><td></td><td>intramuscular</td><td>intramuscular</td><td>intramuscular</td><td>intramuscular</td>

<td>Inoculum Title</td><td>ND *</td><td>ND *</td><td> 10^{, | B} TCIDso</td><td> 10^{, | B} TCIDso</td><td> 10⁴'^B ICIDso</td><td> 10⁴'^B ICIDso</td>

<td>per pig</td><td></td><td></td><td>per ml: 1 ml</td><td>per ml: 1 ml</td><td>per ml: 1 ml</td><td>per ml: 1 ml</td>

<td></td><td></td><td></td><td>IM + 5 ml II</td><td>IM + 5 ml II</td><td>IM t 5 ml II</td><td>IM t 5 ml II</td>

<td>Start of</td><td>10 days after</td><td>9-13 days after</td><td>12-13 days</td><td>9-14 days after</td><td>8-12 days after</td><td>12 days after</td>

<td>hyperthermia</td><td>infection</td><td>infection</td><td>post infection</td><td>infection</td><td>infection</td><td>infection</td>

<td>% of pigs in</td><td> 100¾</td><td> 83¾</td><td> 92¾</td><td> 100¾</td><td> 75¾</td><td> 88¾</td>

<td>hyperthermia</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>In the days of</td><td> 7</td><td> 15</td><td> 3,3</td><td> 5,8</td><td> 7,5</td><td> 11,6</td>

<td>hyperthermia by</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>pig "</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>Temperatures</td><td>40.4 to 41.7 ° C</td><td>40.6 to 42.3 ° C</td><td>40.2 to 41.6 ° C</td><td>40.3 to 40.8 ° C</td><td>40.6 to 42 ° C</td><td>40.2 to 41.9 ° C</td>

<img file="PT2000535E_D0001.tif" />

(continuation)

<td>Test Measurement</td><td> 2</td><td> 3</td><td> 4</td><td> 5</td><td> 6</td><td> 7</td>

<td>GMQ:</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>SI</td><td> 928 (1053)</td><td> 417 (357)</td><td> 564 (620)</td><td> 650 (589)</td><td> 401 (407)</td><td> 509 (512)</td>

<td>S2</td><td>P8 (1028)</td><td> 428 (812)</td><td> 503 (218)</td><td> 612 (584)</td><td> 294 (511)</td><td> 410 (310)</td>

<td>S3</td><td> 061 (1000)</td><td> 771 (642)</td><td> 381 (852)</td><td> 520 (851)</td><td> 325 (588)</td><td> 435 (440)</td>

<td>S4</td><td> 786 (1100)</td><td> 550 (852)</td><td> 764 (778)</td><td> 641 (696)</td><td> 123 (810)</td><td> 151 (881)</td>

<td>Streaming</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>pigs</td><td>Yes at 100 I</td><td>Yes at 75¾</td><td>Not tested</td><td>Not tested</td><td>Not tested</td><td>Not tested</td>

<td>contacts</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>llesões pulmonary 1 injuries ganglion</td><td> 25 17</td><td> 75 33</td><td> 0 67</td><td> 25 25</td><td> 25 50</td><td> 12 12</td>

<td colspan="7">* ND: not determined, “Hyperthermia when the temperature is above 40 ° C, range of maximum temperatures collected individually ““ The percentage corresponds to the number of temperature collections above 40 ° C divided by the number total temperature collections per week for all pigs.</td>

In this trial deceleration week after disease conditions.

no wasting occurred, much less growth to the second, third or fourth infection. These data illustrate that certain creations probably favor the expression of

c) Experimental tests No 3 to No

Reproduction of essays

Multiplication as an experimental objective. 0 table 5.

of experimental trials in pigs had dominate and better characterize the joint model of the results is presented in

Under experimental conditions, LED is thus characterized by a long incubation of 8 to 14 days, with clear hyperthermias for 2 to 8 days, a decrease in food consumption and a slowing of weight growth at the second, third or fourth week post-harvest. infection The lesion table associated with this clinical expression essentially includes ganglion hypertrophy and pneumonia lesions.

Conclusion

The optimization of this experimental model makes it possible to undoubtedly highlight the direct etiological role of LED circovirus in the disease. In addition, this model is the indispensable tool for understanding pathogenic mechanisms and studying future vaccine candidates.

EXAMPLE 5: Evidence of Protective Effectiveness of Vaccine Composition Prepared from DEL Circovirus Sequence Nucleic Fragments

1) Animals used for the study

Piglets exhibiting DEL disease, reproduced under the experimental conditions described in Example 4, paragraph c), were used in a vaccine composition efficacy evaluation protocol comprising DEL circovirus sequence nucleic fragments.

2) Tested vaccine composition and vaccination protocol

a) Compounds used for the study

Plasmids were obtained from INVITROGENE plasmid pcDNA3

- pcADN3 ORFE plasmids These plasmids are plasmids that do not contain any DEL circovirus nucleic acid insertion and are used as a negative control plasmid.

- pcADN30RFl + plasmid and pcADN3ORF2 + plasmid

The pcADN30RFl + and pcADN3ORF2 + plasmids are plasmids that contain a nucleic acid insert of the TYPE B circovirus DEL sequence, respectively an insert comprising the nucleic acid fragment SEQ ID NO: 11 (ORF '!) Encoding the sequence Rep protein SEQ ID NO: 14 and an insert comprising the nucleic acid fragment SEQ ID NO: 12 (ORF'2) encoding the sequence protein SEQ ID NO: 15, probably corresponding to the capsid protein, These nucleic constructs which include the sequence initiation codon ATG coding for the corresponding protein.

GMCSF + Plasmid

GM-CSF (colony-stimulating granulocyte / macrophage-factor) is a cytokine involved in the development, maturation and activation of antigen-presenting macrophages, granulocytes and dendritic cells. The generic contribution of GM-CSF in vaccination is estimated to be a cellular activation with especially the recruitment and differentiation of antigen presenting cells.

This pcDNA3-GMCSF + plasmid contains a nucleic acid insert encoding the granulocyte / macrophage colony stimulating factor, the GM-CSF protein.

The gene coding for this GM-CSF protein has been cloned and sequenced by Inumaru et al. (Immunol. Cell Biol., 1995, 73 (5), 474-476). The plasmid pcDNA3-G; CSF + was obtained from Dr. B. Charley of INRA de Jouy-en-Josas (78, France).

- Recombinant Baculoviruses

The so-called ORF- baculoviruses are non-inserting viruses comprising a nucleic acid fragment capable of expressing a DEL circovirus protein.

The said baculoviruses 0RF1 + (BAC 0RF1 +) or 0RF2 + (BAC 0RF2 +) are recombinant baculoviruses containing respectively an insert containing a nucleic acid fragment SEQ ID NO: 11 (ORF '!) And an insert containing the nucleic acid fragment SEQ ID NO. 12 (ORF'2).

- Adjuvant adjuvant supplied by Seppic Society, affiliate of AIR LIQUIDE is the adjuvant corresponding to the reference AIF SEPPIC.

b) Vaccination protocol

3 week old weaned piglets are divided into four lots A, B, C and D each containing 8 piglets.

3-week-old lots A, B and C each receive a first injection (1 ml injection) of 1 ml containing 200 micrograms of plasmids (naked DNA) in PBS, pH: 7.2 intramuscularly for each one of the following plasmids for each batch, and then at the age of 5 weeks a second injection (M2 injection) containing these same plasmids

One injection is practiced This third third simultaneously on the other side of the neck injection comprises 1 ml of a solution containing 5.10⁶recombinant baculovirus infected cells and 1 ml AIF SEPPIC adjuvant.

Lot A (Fl) (Control Lot):

- first injection

Plasmid pcADN3ORFl-, plasmid pcADN3ORF2- and plasmid GMCSF +.

- second and third injections (simultaneous)

PcADN3ORFl- plasmid, pcADN3ORF2- plasmid and GMCSF + plasmid; Baculovirus-transformed cells containing no nucleic acid insert encoding a circovirus DEL protein;

Adjuvant AIF SEPPIC.

Lot B (F2) (inspection lot)

- first injection

Plasmid pcADN30RFl-, plasmid pcADN3ORF2- and plasmid GMCSF +.

- second and third injections (simultaneous)

PcADN30RFl- plasmid, pcADN3ORF2- plasmid and GMCSF + plasmid; Baculovirus-transformed cells not containing nucleic acid insertion that co- differs to a DEL circovirus protein;

Adjuvant AIF SEPPIC.

Lot C (F3):

- first injection

PcADN30RFl + plasmid, pcADN3ORF2 + plasmid and GMCSF + plasmid;

- second and third injections (simultaneous)

PcADN30RFl + plasmid, pcADN3ORF2 + plasmid and GMCSF + plasmid;

Recombinant baculovirus transformed cells BAC 0RF1 + and BAC 0RF2 + capable of expressing SEQ ID NO: 14 sequence Rep protein and TYPE B DEL circovirus SEQ ID NO: 15 sequence protein, respectively. Lot D (F4) (control lot) : no injection.

Lots of piglets B, C and D are infected (tested) at the age of 6 weeks while lot A is not tested.

3) Batch monitoring

- sneezing cough count: 15 minutes / lot / day;

- consistency of faecal matter: every day;

usual records: weekly blood sampling, weighings;

- Weights of refused food: 3 times a week;

- calculation of average daily weight gain (gmq).

each one

Daily average gains were calculated for batches over a period of 28 days after the test (see Figure 10), an intermediate gmq calculation was also made for each batch in the first and second 14-day period. The results obtained are set forth below in Table 6.

Table 6: Average daily earnings

<td></td><td>F1</td><td>F2</td><td>F3</td><td>F4</td>

<td>j 0-j14</td><td>411g</td><td>450 g</td><td>511g</td><td>461g</td>

<td>j14-j 2 8</td><td>623g</td><td>362 g</td><td>6 01g</td><td>443g</td>

<td>j 0-j 2 8</td><td>554 g</td><td>406g</td><td>556 g</td><td>452g</td>

- Measurement of hyperthermia

Measurement of hyperthermia above 41 ° C (see Figure 11) and above 40.2 ° C was performed for each batch over a total period of 28 days after the test. The results obtained, corresponding to the ratio expressed as a percentage between the number of thermal samples above 41 ° C (or above 40,2 ° C) and the total number of thermal samples taken on all pigs per one week period , are shown hereinafter in Tables 7 and 8, respectively for hyperthermia measurements above 41 ° C and above 40.2 ° C.

Table 7: Hyperthermia&gt; 41 ° C

<td></td><td>F1</td><td>F2</td><td>F3</td><td>F4</td>

<td>SI</td><td> 4, 1</td><td> 0,</td><td> 0,</td><td> 0,</td>

<td>S2</td><td> 10, 7</td><td> 16,</td><td> 0,</td><td> 8,9</td>

<td>S3</td><td> 4, 7</td><td> 27,</td><td> 0,</td><td> 45,</td>

<td>S4</td><td> 0,</td><td> 0,</td><td> 0,</td><td> 7,5</td>

Table 8: Hyperthermia&gt; 40.2 ° C

<td></td><td>Fl</td><td>F2</td><td>F3</td><td>F4</td>

<td>SI</td><td> 29,1</td><td> 10, 41</td><td> 29, 1</td><td> 20,8</td>

<td>S2</td><td> 28,5</td><td> 39,2</td><td> 10, 7</td><td> 37,5</td>

<td>S3</td><td> 14,3</td><td> 68, 7</td><td> 25, 0</td><td> 81,2</td>

<td>S4</td><td> 3,3</td><td> 17,5</td><td> 20,0</td><td> 55</td>

4) Conclusion

Recordings clearly show that animals receiving the three injections of a vaccine composition comprising DEL circovirus nucleic acid fragments according to the invention and / or capable of expressing recombinant DEL circovirus proteins, in particular type B, did not exhibit hyperthermia. (see figure 10). These animals did not know, among others, a decrease in their growth, gmq being comparable to those of uninfected control animals (cf. Figure 9). They did not show any particular clinical signs.

These results show the effective protection of piglets against infection by a DEL circovirus of the invention, a primary agent responsible for DEL or DFL, conferred by a vaccine composition prepared from the nucleic acid fragment of the DEL circovirus nucleic sequence according to the invention, in particular type B, and / or from recombinant proteins encoded by these nucleic acid fragments.

These results show in particular that the proteins encoded by the DEL circovirus ORF1 and ORF2 according to the invention are immunogenic proteins that induce an effective protective response for the prevention of a DEL circovirus infection.

EXAMPLE 6: Serological Diagnosis of DEL Circovirus by Immunosage Using Recombinant Proteins or DEL Circovirus Synthesis Peptides

A- Serological Diagnosis by Recombinant Proteins

Identification and sequencing of porcine circovirus DEL allows the production of recombinant DEL circovirus proteins by genetic recombination techniques well known to the person skilled in the art.

particular proteins were expressed by the Sf9 insect cell ORF'2

By these techniques, recombinants are encoded in transformed circoviruses, type B, and then isolated.

These recombinant ORF'2 encoded proteins are extracted after cultured transformed sf9 cells by thermal cell lysis thanks to 3 freeze / thaw cycles -70 ° C / + 37 ° C. Untransformed healthy Sf9 or control Sf9 cells were lysed.

These two antigenic fractions from untransformed control Sf9 cells and ORf'2 expressing Sf9 cells are precipitated at 4 ° C by a solution of 60% plus or minus 5% saturated ammonium sulfate. A total protein dosage is performed with the aid of the Biorad kit. 500 ng of semi-purified ORF'2-expressing Sf9 control proteins and Sf9 proteins in solution in a 0.05 M bicarbonate buffer pH 9.6 are passively adsorbed to the bottom of 3 different domes of a Nunc Maxisorp microplate by incubation overnight at + 4 ° C.

The reactivity of pig sera with respect to each of these antigenic fractions is assessed by an indirect ELISA whose experimental protocol is detailed below:

- Saturation step: 200 µl / dome PBSIX / 3% semi-skimmed milk, incubation 1 h 30 to 37 ° C.

Wash: 200 µl / PBSIX / Tween 20 dome: 0.05%, 3 rapid washes.

- Serum incubation step: 100 µl / dome of 1/100 diluted serum in PBSIX / 1% semi-skimmed milk / Tween 20: 0.05%, incubation 1 h at 37 ° C.

Wash: 200 µl / PBSIX / Tween 20 dome: 0.05%, 2 rapid washes followed by 2 washes of 5 min.

Conjugate Incubation Step: 50 µl / dome rabbit anti-pig conjugate diluted 1/1000 in PBSIX / 1% semi-skimmed milk / Tween 20: 0.05%, incubation 1 h at 37 ° C.

Wash: 200 µl / PBSIX / Tween 20 dome: 0.05%, 2 rapid washes followed by 2 washes of 5 min.

- Developing step: 100 µl / OPD Substrate Dome / Citrate Buffer / fhCh, incubation 15 min at 37 ° C.

- Reaction Stop: 50 pL / H2SO4 IN dome.

- Spectrophotometer reading at 490 nm.

Results

The results obtained are presented here below in table 9.

Table 9:

<td>Antigens</td><td>Reactivity</td><td>Serum</td><td>Reactivity Serum</td>

<td></td><td>of pork</td><td>no</td><td>of inoculated pig</td>

<td></td><td>inoculated</td><td>fur</td><td>by the circovirus</td>

<td></td><td>Circovirus</td><td></td><td></td>

<td>Sf9 control purified</td><td> 0, 076</td><td> 0,080</td>

<td>Sf9 expressing Purified ORF'2</td><td> 0,071</td><td> 1,035</td>

Results are expressed as optical density measured with a spectrophotometer at 490 nm during ELISA analysis of the reactivity of pig sera inoculated or not by type B circovirus DEL according to the protocol given below.

B - Serological Diagnosis by Synthesis Peptide

Epitopic cartography of proteins encoded for example by the ORF1 and ORF2 sequences of the two types of DEL circoviruses (types A and B) has allowed, among others, to identify the immunogenic circoviral epitopes in the proteins encoded by the ORF'1 and ORF'2 nucleic sequences as well as the epitopes. specific for the protein encoded by the type B circovirus DEL nucleic sequence ORF'2 Four type B circovirus-specific epitopes and one epitope common to the two types of DEL circoviruses located on the proteins encoded by the ORF'2 nucleic sequence were synthesized as a peptide. Equivalent peptides in circovirus type A were similarly synthesized. All of these peptides were evaluated as diagnostic antigens in the course of performing a serological test.

Results

The results obtained are shown in table 10 below.

Table 10: Results of diagnostic antigen evaluation of synthetic peptides encoded by ORF2 and ORF'2 nucleotide sequences of delirium type A and B.

<td></td><td colspan="5">Reactivity Infected Pig Serum Circovirus B</td>

<td>Peptide</td><td>Circovirus Type DEL</td><td>Position Sequence AA IOPE D0 / D54</td><td>Conventional 1 D0 / D42</td><td>Conventional 2 D0 / D42</td><td>Specificity Epitopic</td>

<td> 121</td><td>B</td><td>71-85 VDMMRFNINDFLPPG +/-, +++</td><td> +/-, +++</td><td> -, +++</td><td>Circovirus B</td>

<td> 177</td><td>THE</td><td>70-34 NVNELRFMGQFLPP +/-, +</td><td> +/-, +/</td><td>+ / m “</td><td></td>

<td> 132</td><td>B</td><td>115-129 QGDRGVGSSAVILDD +/-, +/-</td><td> ++, ++</td><td>+ / m +</td><td>Circovirus B</td>

<td> 133</td><td>THE</td><td>114-127 TSNQRGVGSTWIL +/-, -</td><td>~ l + / “</td><td> +/-, +/</td><td></td>

<td> 133</td><td>B</td><td>119-134 GVGSSAVILDDNVFTK -, ++</td><td> ++, +++</td><td> +/-, ++</td><td></td>

<td> 189</td><td>THE</td><td>118-132 RGVGSTWILDANFV +/-, -</td><td>~ l + / “</td><td> +/-, +/</td><td></td>

<td> 146</td><td>B</td><td>171-185 FTIDYFQPNNKRNQL -, +/-</td><td></td><td>~ l + +</td><td>Circovirus A&amp;B</td>

<td> 152</td><td>B</td><td>195-209 VDHVGLGTAFENSIY -, ++</td><td> +++; +++</td><td> +/-, +</td><td>Circovirus B</td>

<td> 208</td><td>THE</td><td>194-203 NVEHTGLGYALQNAT -, -</td><td>~ f -</td><td>~ f -</td><td></td>

<td>+ / v E</td><td colspan="3">++, +++. Increasing reactivity intensities observed in Spot Peptides</td><td colspan="2"> in nitrocellulose membrane.</td>

<td colspan="2">The tested porcine sera</td><td colspan="4">come from animals experimentally infected with type B circovirus within the</td>

<td colspan="3">of the CNEVA animal houses. Animals are sampled before inoculation D54.</td><td>at D0 and 42 days or</td><td>54 days after</td><td>D42 inoculation,</td>

EXAMPLE 7: Characterization of type B circovirus DEL epitopes

The 0RF2-encoded proteins of porcine circoviruses type A and B are chosen for this study. For each of the 0RF2 (types A and 56), 56 15 amino acid overlapping peptides were synthesized, thus overlapping the protein (see table 11 below).

Table 11: Amino acid sequence of the 56 15-amino acid peptides synthesized from DEL circovirus nucleic sequence ORF '2 (type B) and 0RF2 (type A) with their corresponding spot number (see Figure 12)

<td>Spot</td><td>ORF'2 type B No. Sequence</td><td>Spot</td><td>ORF2 type A No. Sequence</td>

<td> 104</td><td>MTYPRRRYRRRRHRP</td><td> 160</td><td>MTWPRRRYRRRRTRP</td>

<td> 105</td><td>RRRYRRRRHRPRSHL</td><td> 161</td><td>RRRYRRRRTRPRSHL</td>

<td> 106</td><td>RRRRHRPRSHLGQIL</td><td> 162</td><td>RRRRTRPRSHLGNIL</td>

<td> 107</td><td>HRPRSHLGQILRRRP</td><td> 163</td><td>TRPRSHLGNILRRRP</td>

<td> 108</td><td>SHLGQILRRRPWLVH</td><td> 164</td><td>SHLGNILRRRPYLVH</td>

<td> 109</td><td>QILRRRPWLVHPRHR</td><td> 165</td><td>NILRRRPYLVHPAFR</td>

<td> 110</td><td>RRPWLVHPRHRYRWR</td><td> 166</td><td>RRPYLVHPAFRNRYR</td>

<td> 111</td><td>LVHPRHRYRWRRKNG</td><td> 167</td><td>LVHPAFRNRYRWRRK</td>

<td> 112</td><td>RHRYRWRRKNGIFNT</td><td> 168</td><td>AFRNRYRWRRKTGIF</td>

<td> 113</td><td>RWRRKNGIFNTRLSR</td><td> 169</td><td>RYRWRRKTGIFNSRL</td>

<td> 114</td><td>KNGIFNTRLSRTFGY</td><td> 170</td><td>RRKTGIFNSRLSREF</td>

<td> 115</td><td>FNTRLSRTFGYTVKR</td><td> 171</td><td>GIFNSRLSREFVLTI</td>

<td> 116</td><td>LSRTFGYTVKRTTVR</td><td> 172</td><td>SRLSREFVLTIRGGH</td>

<td> 117</td><td>FGYTVKRTTVRTPSW</td><td> 173</td><td>REFVLTIRGGHSQPS</td>

<td> 118</td><td>VKRTTVRTPSWAVDM</td><td> 174</td><td>LTIRGGHSQPSWNVN</td>

<td> 119</td><td>TVRTPSWAVDMMRFN</td><td> 175</td><td>GGHSQPSWNVNELRF</td>

<td> 120</td><td>PSWAVDMMRFNINDF</td><td> 176</td><td>QPSWNVNELRFNIGQ</td>

<td> 121</td><td>VDMMRFNINDFLPPG</td><td> 177</td><td>NVNELRFNIGQFLPP</td>

<td> 122</td><td>RFNINDFLPPGGGSN</td><td> 178</td><td>LRFNIGQFLPPSGGT</td>

<td> 123</td><td>NDFLPPGGGSNPRSV</td><td> 179</td><td>IGQFLPPSGGTNPLP</td>

<td> 124</td><td>PPGGGSNPRSVPFEY</td><td> 180</td><td>LPPSGGTNPLPLPFQ</td>

<td> 125</td><td>GSNPRSVPFEYYRIR</td><td> 181</td><td>GGTNPLPLPFQYYRI</td>

<td> 126</td><td>RSVPFEYYRIRKVKV</td><td> 182</td><td>PLPLPFQYYRIRKAK</td>

<td> 127</td><td>FEYYRIRKVKVEFWP</td><td> 183</td><td>PFQYYRIRKAKYEFY</td>

<td> 128</td><td>RIRKVKVEFWPCSPI</td><td> 184</td><td>YRIRKAKYEFYPRDP</td>

<td> 129</td><td>VKVEFWPCSPITQGD</td><td> 185</td><td>KAKYEFYPRDPITSN</td>

<td> 130</td><td>FWPCSPITQGDRGVG</td><td> 186</td><td>EFYPRDPITSNQRGV</td>

<td> 131</td><td>SPITQGDRGVGSSAV</td><td> 187</td><td>RDPITSNQRGVGSTV</td>

<td> 132</td><td>QGDRGVGSSAVILDD</td><td> 188</td><td>TSNQRGVGSTVVILD</td>

<td> 133</td><td>GVGSSAVILDDNFVT</td><td> 189</td><td>RGVGSTVVILDANFV</td>

<td> 134</td><td>SAVILDDNFVTKATA</td><td> 190</td><td>STVVILDANFVTPST</td>

(continuation)

<td colspan="2">ORF'2 type B</td><td rowspan="2">Spot</td><td rowspan="2">ORF2 type A No. Sequence</td>

<td>Spot #</td><td>Sequence</td>

<td> 135</td><td>LDDNFVTKATALTYD</td><td> 191</td><td>ILDANFVTPSTNLAY</td>

<td> 136</td><td>FVTKATALTYDPYVN</td><td> 192</td><td>NFVTPSTNLAYDPYI</td>

<td> 137</td><td>ATALTYDPYVNYS SR</td><td> 193</td><td>PSTNLAYDPYINYSS</td>

<td> 138</td><td>TYDPYVNYSSRHTIT</td><td> 194</td><td>LAYDPYINYSSRHTI</td>

<td> 139</td><td>YVNYSSRHTITQPFS</td><td> 195</td><td>PYINYSSRHTIRQPF</td>

<td> 140</td><td>SSRHTITQPFSYHSR</td><td> 196</td><td>YSSRHTIRQPFTYHS</td>

<td> 141</td><td>TITQPFSYHSRYFTP</td><td> 197</td><td>HTIRQPFTYHSRYFT</td>

<td> 142</td><td>PFSYHSRYFTPKPVL</td><td> 198</td><td>QPFTYHSRYFTPKPE</td>

<td> 143</td><td>HSRYFTPKPVLDFTI</td><td> 199</td><td>YHSRYFTPKPELDQT</td>

<td> 144</td><td>FTPKPVLDFTIDYFQ</td><td> 200</td><td>YFTPKPELDQTIDWF</td>

<td> 145</td><td>PVLDFTIDYFQPNNK</td><td> 201</td><td>KPELDQTIDWFQPNN</td>

<td> 146</td><td>FTIDYFQPNNKRNQL</td><td> 202</td><td>DQTIDWFQPNNKRNQ</td>

<td> 147</td><td>YFQPNNKRNQLWLRL</td><td> 203</td><td>DWFQPNNKRNQLWLH</td>

<td> 148</td><td>NNKRNQLWLRLQTAG</td><td> 204</td><td>PNNKRNQLWLHLNTH</td>

<td> 149</td><td>NQLWLRLQTAGNVDH</td><td> 205</td><td>RNQLWLHLNTHTNVE</td>

<td> 150</td><td>LRLQTAGNVDHVGLG</td><td> 206</td><td>WLHLNTHTNVEHTGL</td>

<td> 151</td><td>TAGNVDHVGLGTAFE</td><td> 207</td><td>NTHTNVEHTGLGYAL</td>

<td> 152</td><td>VDHVGLGTAFENSIY</td><td> 208</td><td>NVEHTGLGYALQNAT</td>

<td> 153</td><td>GLGTAFENSIYDQEY</td><td> 209</td><td>TGLGYALQNATTAQN</td>

<td> 154</td><td>AFENSIYDQEYNIRV</td><td> 210</td><td>YALQNATTAQNYVVR</td>

<td> 155</td><td>SIYDQEYNIRVTMYV</td><td> 211</td><td>NATTAQNYVVRLTIY</td>

<td> 156</td><td>QEYNIRVTMYVQFRE</td><td> 212</td><td>AQNYVVRL TIYVQF R</td>

<td> 157</td><td>IRVTMYVQFREFNFK</td><td> 213</td><td>VVRL TIYVQF RE FIL</td>

<td> 158</td><td>MYVQFREFNFKDPPL</td><td> 214</td><td>TIYVQFREFILKDPL</td>

<td> 159</td><td>VQFREFNFKDPPLNP</td><td> 215</td><td>YVQFREFILKDPLNE</td>

These peptides were synthesized by the spot method consisting of a simultaneous synthesis of a large number of peptides on a solid cellulose support, each peptide synthesis site constituting a spot (Synt: em, NIMES). This method implies an orientation of the peptides in the plate, which are covalently fixed at the carboxy terminal end. One spot represents about 50 nmole of peptide.

The reference of the spots and corresponding peptide sequences is given in table 11.

These membranes were used for immunoreactivity tests for serum from IOPE pigs infected or not experimentally infected with the DEL type B circoviral strain as well as for sera from infected pigs from conventional farms (conventional farms 1 or 2). This study showed evidence of type B circovirus-specific immunoreactive peptides corresponding to spots No. 121, No. 132, No. 133 and No. 152 (respectively amino acid sequences SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO: 20). An illustration is shown in Figure 12 where the membranes are developed with an infected pig serum from a conventional rearing. Non-specific immunoreactive peptides of the type between which the highly immunogenic peptide No. 146 is retained have also been evidenced.

A comparison between type A and B circovirus peptide sequences (Figure 13) indicates a divergence ranging from 20 to 60% for type B specific immunoreactive peptides, and a weaker divergence (13%) between non-peptide peptides. specific.

references

Allan, GM et al., 1995, Vet. Microbiol., 44: 49-64. Barany, F., 1911, PNAS. USA, 88: 189-193.

Boulton, LH et al. , 1997, J. Gen. Virol., 78 (Pt 6),

1265-1270.

Buckholz, RG, 1993, Yeast Systems for the expression of heterologous gene products. Curr. Op. Biotechnology, 4:

538-542 .

Burg, JL et al., 1996, Mol. And Cell. Probes, 10: 257271.

Chu, BCF et al., 1986, NAR, 14: 5591-5603.

Chu, PWG et al., 1993, Virus Research, 27: 161-171. Clark, EG, 1997, American Association of Swine

Practitioners, 499-501.

Daft, B. et al., 1996, American Association of Veterinary

Laboratory Diagnosticians, 32.

Derse, D. et al., 1995, J. Virol., 69 (3): 1907-1912.

Duck, P. et al., 1990, Biotechniques, 9: 142-147.

Dulac, GC et al., 1989, Can. J. Vet. Res., 53: 431-433. Edwards, CP, E Aruffo, A., 1993, Current applications of

COS cell based transient expression systems. Curr. Op. Biotechnology, 4: 558-563.

Edwards, S. et al., 1994, Vet. Rec., 134: 680-681.

Erlich, HA, 1989, In ​​PCR Technology. Principies and

Applications for DNA Amplification. New York: Stockton Press.

Felgner, et al., 1987, Proc. Natl. Acad. Sci. 84: 7413.

Fontes, EPB et al. , 1994, J. Biol. Chem., Vol. 269, No.: 8459-8465.

Fraley et al., 1980, J. Biol. Chem., 255: 10431.

Guateli, JC et al., 1990, PNAS. USA, 87: 1874-1878. Hackland, AF et al., 1994, Arch. Virol., 139: 1-22. Hanson, SF et al., 1995, Virology, 211: 1-9.

Harding, JC, 1997, American Association of Swine

Practitioners, 503.

Harding, RM et al., 1993, Journal of General Virology, 74: 323-328.

Harding, JC et Clark, EG, 1997, Swine Health and

Production, Vol. 5, No. 5: 201-203.

Heyraud-Nitschke, F. et al., 1995, Nucleic Acids Research,

Vol. 23, No. 6.

Horner, GW, 1991, Surveillance 18 (5): 23.

Houbenweyl, 1974, in Meuthode der Organischen Chemie, E. Wunsch Ed., Volume 15-1 and 15-11, Thieme, Stuttgart.

Huygen, K. et al., 1996, Nature Medicine, 2 (8): 893-898.

Innis, MA et al., 1990, in PCR Protocols. A guide to

Methods and Applications. San Diego: Academic Press. Kaneda, et al., 1989, Science, 243: 375.

Kievitis, T. et al., 1991, J. Virol. Methods, 35: 273-286. Kohler, G. et al., 1975, Nature, 256 (5517): 495-497.

Kwoh, DY et al., 1989, PNAS. USA, 86: 1173-1177.

Ladany, S. et al. , 1989, J. Clin. Microbiol., 27: 27782783.

Lazarowitz, SG et al. , 1989, The EMBO Journal, Vol. 8,

No. 4: 1023-1032.

Luckow, VA, 1993, Baculovirus Systems for the expression of human gene products. Curr. Op. Biotechnology, 4: 564572.

Mankertz, Matthews,

A. et al., 1997, J. Virol., 71: 2562-2566. JA et al., 1988, Anal. Biochem., 169: 1-25.

McNeilly, F. et al., 1996, Vet. Immunol. Immunopathol. , 49: 295-306.

Meehan, BM et al., 1997, J. Gen. Virol., 78: 221-227. Merrifield, RD, 1966, J. Am. Chem. Soc. 88 (21): 50515052.

Midoux, 1993, Nucleic Acids Research, 21: 871-878.

Miele, EA et al., 1983, J. Mol. Biol., 171: 281-295. Murphy, FA et al., 1995, Sixth Report of the

International Committee on Taxonomy of Viruses. Springer-

<td>Verlag</td><td>Vienna</td><td>New York.</td><td></td><td></td><td></td>

<td>Nayar,</td><td>GP</td><td>et al., 1997, Can.</td><td>Vet J.</td><td> 38(6) :</td><td> 385-386.</td>

<td>Olins,</td><td>POWDER</td><td>, he is . Ç.,</td><td> 1993,</td><td>Recent</td><td>advances in</td>

<td colspan="2">heterologous</td><td>gene expression</td><td>in E</td><td>coli.</td><td>Curr. Op.</td>

Biotechnology, 4: 520-525.

Pagano et al. , 1967, J. Virol., 1: 891.

Rolfs, A. et al., 1991, In PCR Topics. Usage of Polymerase Chain Reaction in Genetic and Infectious Disease. Berlin: Springer-Verlag.

Sambrook, J. et al., 1989, In ​​Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Sanchez-Fisher, R., 1988, J. Clin. Microbiol., 26 (10): 1934-1938.

Segev D., 1992, in Non-radioactive Labeling and Detection of Biomolecules. Kessler C. Springer Verlag, Berlin, New York: 197-205.

<td>Shiver,</td><td>JW, 1995, in Vaccines 1995</td><td>eds chanock</td><td>RM</td>

<td>Brown,</td><td>F. Ginsberg, HS &amp; Norrby,</td><td>AND . , pp.9 5-98,</td><td>Cold</td>

<td>Spring</td><td>Harbor Laboratory Press, Cold</td><td>Spring harbor,</td><td>New</td>

<td colspan="5">York.</td>

<td>Tascon, RE</td><td>. et</td><td>al.</td><td> , 1996</td><td>, Nature Medicine, 2 (8): 888-892</td>

<td>Tischer, I.</td><td>et</td><td>al.,</td><td> 1982,</td><td>Nature, 295: 64-66.</td>

<td>Tischer, I.</td><td>et</td><td>al.,</td><td> 1986,</td><td>Arch. Virol., 91: 271-276.</td>

<td>Tischer, I.</td><td>et al., 1988,</td><td>Zentralbl Bakteriol</td><td>Mikrobiol</td><td>Hyg</td>

<td colspan="2">[A] 270: 280-287.</td><td></td><td></td><td></td>

<td>Tischer, I.</td><td>et al., 1995,</td><td>Arch. Virol., 140:</td><td> 737-743.</td><td></td>

<td>Urdea, MS,</td><td>1988, Nucleic</td><td>: Acids Research, 11</td><td colspan="2"> : 4937-4957.</td>

<td>Walker GT</td><td>et al., 1992,</td><td>NAR 20: 1691-1696.</td><td></td><td></td>

<td>Walker GT</td><td>et al., 1992,</td><td>PNAS. USA, 89: 392</td><td> -396 .</td><td></td>

<td>White, BA</td><td>et al., 1997,</td><td>Methods in Molecular</td><td>Biology,</td><td> 67,</td>

Human Press, Towota.

Zhao, TM et al., 1996, Proc. Natl. Adac Sci. USA, 93 (13): 6653-6658.

LIST OF SEQUENCES

<td> &lt;110&gt;</td><td>WYETH</td>

<td> &lt;120&gt;</td><td>CIRCOVIRUS SEQUENCES ASSOCIATED WITH DISEASE PIGGY LOSS (DEL)</td>

<td> &lt;130&gt;</td><td>D17221</td>

<td> &lt;150&gt;</td><td>FR 97 15396</td>

<td> &lt;151&gt;</td><td> 1997-12-05</td>

<td> &lt;160&gt;</td><td> 20</td>

<td> &lt;170&gt;</td><td>Patentln Vers. 2.0</td>

<td> &lt;210&gt;</td><td> 1</td>

<td> &lt;211&gt;</td><td> 1759</td>

<td> &lt;212&gt;</td><td>Genomic DNA</td>

<td> &lt;213&gt;</td><td>DEL type A circovirus</td>

<td> &lt;220&gt;</td><td></td>

<td> &lt;223&gt;</td><td>Polarity Chain + (5'-3 ')</td>

<td> &lt;400&gt;</td><td> 1</td>

SCC &amp; gcgcac ttcggçagcg gcagcaectc ggcagcgtca gtgaaastgc caagcaagaa 60 aagcggcccg cââccccete agaggtgggt gttcaccctt aataatcctt ccgaggagga 1:20 gaaaaacaaa atacgggagc ttceaatctc cetttttgat tattttgttt gtggcgagga 180 aggtttggaa gagggtag &amp; the cfccctcacct ccaggggttfc gcgaattttg ctaagaagca 240 gacttttaac aaggtgaagt ggtattttgg -tgcccgctgc eaeatcgaga ãagcgaaagg 380 aaccgaccag cagaataaag aatactgcag rt &amp; agaaggc cacatactta tcgagtgtgg 350 agctccgcgg aaecagggga. agcgcagcga cctgfcctact gctgtgagta cccttttgga 420 gacggggtct ttggfcgactg tagccgagca gtttcctgta acgtatgtga gaaattfcccg 480 cgggctggct gaacttttga aagtgagcgg Gaag &amp; tgeag aagcgtgstt ggaagacagc 540 tgtacacgtc atagtgggcc cgcccggtfcg tgggaagagc cagtgggccc gtaattttgc 600 tgagcctagg gacacct ct &amp; ggaagccfcag tagaaateag tggtgggatg gatatcatgg 660 agaagaagtt. gttgttttgg atgattttta tggctggtta ccttgggatg atctactgag 720 actgtgtgac cggtatccat tgactgtaga gactaaaggg ggtactgtfcc cttttttggc 780 ccgeagtatt ttgattacca gcaateaggc cccccaggaa tggtaetect caaetgetgt 840 cccagctgta gaagctctct abcggaggat taetaettfcg caattttgga agactgctgg 900 agaacaatcc acggaggtac ccgaaggccg atttgaagca gtggacccac cctgtgccct 960 ttteecatat aaaataaate actgagtctt ttttgttate acatcgtaat ggfcttttatt 1020 tfcfcattcatt tagagggtcfc tfccaggataa attctetgaa ttgtacataa atagtcaacc 1080 ttaccacata attttgggct gtggttgcat tfctggagcgc atagcccagg cctgtgtgct 1140 egaeattggt gtgggtattt aaatggagcc acagctggtt · tcttttatta tttggctgga 1200 ac.caatcs.st tgtttggtct agctctggtt tggçggtgaa gtacctggag tggtaggtaa 1260 agggctgcct tatggtgtgg CGGG &amp; ggagt agtt.aat.ata ggggtcatag gceaagttgg 1320 tggagggggt tacaaagttg gcatccaaga taacaacagt ggacccaaca cctctttgat 1380 tagaggtgat ggggtetctg gggtaaaatt catatttagc ctttctaafca 1440 cggtagtatt ggaaaggtag gggfcaggggg ttggtgeçgc ctgagggggg gaggaactgg ccgatgttga 1500 atctcagctc gttaacattc caagatggct gcgagtgtec tcct.ctt.atg gtgagtacaa THAT attctctaga aaggcgggaa ttgaagatac ccgtcttfceg gegccatctg taacggtttc 1620 tgaaggcggg gtgtacesaa tatggtcttc tccggaggat gtttccaaga tggctgcggg 1680 ggcgggtccg tcttctgcgg taacgcctcc ttggceaegt catcctataa aagtgaaaga 1740 agtgcgctgc tgtagtatt í'J5S &lt;210&gt; 2 &lt;211&gt; 1759 &lt;212&gt; DNA &lt; 213&gt; DEL type A circovirus &lt;220&gt; Polarity chain - (5'— 3 ') &lt;400&gt; 2 aatacxacag cagcgcactt ctttcacttt tataggatga cgtggccaag gaggcgttac 60 cgcagaagac ggaecegccc ccgcagccat cttggaaacg tcctccggag aagaccatat 120 ttggtacacc cçgççttcag aaaccçttac agatggcgcc gaaagacggg tatctfccaat 180 teccgccttt ctagagaatt tgtactcacc ataagaggag gacactcgca gccatcttgg 240 aatgttaacg agctgagatt caacatcggc eagttcctcc ccccctcagg cggcaccaac 300 cccctacccc tacctttcca atactaccgt attagaaagg ctaaatatga attttacccc 360 agagaceeca teacctct &amp; the TCAA &amp; gaggt gttgggtcca ctgttgttat cttggatgcc 420 aactttgtaa ccccctccac eaaettggcc tatgacccct atafcfcaacta ctcctcccgc 480 eacaccataa ggcagccctt tacctaecac tccaggtact tcacccccaa accagagcta 540 gaccaaacaa tfcgattggfct ccagccaaat aataaaagaa accagctgtg o-tccafctta 600 aatacccaca ccaatgtega GCAC &amp; caggc ctgggctatg cgctccaaaa tgcaaccaca 660 gcccaaaatt atgtggtaag gttgactatt tatgtaeaat tcagagaatt tatcctgaaa 720 gaccctctaa atgaataaaa ataaaaacca ttacgatgtg ataacaaaaa agactcagta 780 atttacfetta tatgggaaaa gggcacaggg tgggtceact gcfefecaaafec ggccttcggg 840 tacctccgtg gattgtxcfec cagcagtctt ccaaaattgc aaagtagtaa tcctccgata 000 gagagcttcfe acagctggga cagcagttga ggagtáccat ectgattgct 960 tcctgggggg ggtaatcaaa atactgcggg ccaaaaaagg aacagtaccc cctttagtct ctacagtcaa 1020 tggataccgg fecacacagtc tcagtagatc atcccaaggt aaccagccat aaaaatcatc 'and 1080 acttcttctc caaaacaaca &amp; tgatatcc atcccaccac fcfcatttctac taggcttcca H4O gtaggtgtcc ctaggcteag caaaattacg ggcccactgg ctcttcccac aaccgggcgg .1200 gcççactatg acgtgtacag ctgtcttcca atcacgçtgc tgcatcttec cgctcacttt 1260 eaaaagfetca gccagcçcgc ggaaatttct caca.feacgt. fe acaggaaact gctcggcfeac 1,320 agtcaccaaa gaceccgtct ccaaaagggt actcacagca gtagacaggt cgctgcgctt 1380 cccctggttc cgcggagctc cacactcgat AAGT &amp; tgtgg ccfctctttac tgcagtattc 1440 tttattctgc tggtcggttc cttfccgcttt ctcgatgtgg cagcgggcac caaaatacca 1500 çttcaccttg ttaaaagtct gcttcttagc aaaattcgca aacccctgga ggtgaggagt 1560 tctaccctcfc tccaaacctt cctcgccaca aacaaaataa fccaaaaaggg agattggaag 1.620 ctcccgtatt ttgtttttct cctcctcgga aggatxabta agggtgaaca cccacctctt 1630 atggggttgc gggccgcttt tcttgctt.gg cattttcact gacgctgccg aggtgctgcc 1740 gctgccgaag tgcgctggt .1759 &lt;210&gt; 3 &lt;211&gt; 939 &lt;212&gt; DNA &lt;213&gt; DEL Type A Circovirus &lt;220&gt;

&lt;223&gt; ORF1 &lt;400&gt; 3

100 atgccaagca agaaesgcgg eccgcaaccc cstaagaggt gggfcgttcac ccttaataat 60 ccttccgagg aggggagaaa caaaatacgg gagctteeaa tctccctttt tgattatttt 120 gtttgtgçcg aggaaggttt ggaagagggt agaaetecte acctecaggg gtttgcgaat ioo tttgctaaça agcagacttt taacaaggtg aagtggtatt ttggtgcccg etggçacatc 240 gagaaagcga aaggaaccga ccagcagaat aaagsatact gcagtaaaga aggecacata 300 cttategage gtggagctcc geggaaccag gggasgegca gegaectgtc tae s.getgtg 360 agvacccttt tggagacggg gtcttsggtg actgtagccg agcagctccc tgtaaegt.at. 420 gfcgagaaatt fcccgcgggct ggcfcgaactt ttgãaagtga gcgggaagat gcagcagcgfc. 480 gattggaaga cagctgtaca çgfccatagtg ggçççgçççg gttgtgggaa gagccagtgg 540 gcççgtaatt ttgctgagcc tagggacacc tactggaagc ctagtagaaa taagtggtgg 600 gatggatatc atggagaags agtfcgttgtt ttggatgatt tttatggetg gttaccttgg 6 € 0 gatgatctac tgagactgtg tgaccggtat ccattgactg tagagactaa agggggfcact 720 gttccttttt tggcccgcag tattttgatt aeeagcaatt aggccccc-ca ggaatggtac 780 tccfceaactg ctgtcccagc fcgtagaàgct ctcfcatcgga ggattactac tttgcaattt 840 tggaagactg ctggagaaca atccacggag gtacccgaag gccgatttga agcagfcggac 800 ccaccctgtg cccttfctccc atataaaafca aattactga 939 &lt;210&gt; 4 &lt;211&gt; 702 &lt;212&gt; DNA &lt;213&gt; Circovirus DEL type A &lt;220&gt;

&lt;223&gt; ORF2 &lt;400&gt; 4 atgaegtggc caaggaggcg fcfcaccgcaga agacggaccc gcccccgcag ccatctfcgga SO aacatcctcc ggagaagacc atatttggta caccccgect tcagaaaccg ttacagatgg 120 cgccgaaaga cgggtafcctt caafctcccgc ctttctagag aatttgfcacfc ISO caccataaga ggaggacact cgcagccatc ttggaatgtt aacgagctga gattc &amp; ACAT cggccagttc 240 ctcceccccfc eaggcggeac caacccccfca cccctacctt tecaatacta ccgtattaga 300 aaggctaeat atgaatttta ccecagagae eccatcacct ctaatcaaag aggfcgttggg 360 tccactgttg ttatctfcgga tgccaacttt gtaaccccc-t ccaccaactt ggcctatgac 420 ccctatatta acfcactcctc ccgccacacc ataaggcage cctttaccta ccaetccagg «80 tacttc &amp; ccc ccaaaccaga. gctagaccaa acaâttgatt ggttccagce aaafcaataaa 540 · agaaaccagc tgtggctcca tttaa &amp; tacc cacaccaatg tcgagcacac aggcctgggc SOO tatgcgctcc aaaatgcaac caeageccâa aat &amp; atgtgg taaggttgac tatttatgta 660 caattcagag aatttatcct gaaagaccct ctaaatgaat aa 702 &lt;210&gt; 5 &lt;211&gt; 621 &lt;212&gt; DNA &lt;213&gt; Circovirus Type A DEL

101 &lt;220&gt;

&lt;223&gt; 0RF3 &lt;400&gt; 5 ^ afcgatateea aaaafcfcacgg tgtcttccaa ssaatttctc caââagggta acactcgafca tfctcgettfcc ettcfctagca ctcgccacaa ctccfccggaa cttgcttggc teceae &amp; sct gcceactggc tcacgctg-ct acatacgtta etcficagcáç agtatgfcggç tcgatgtggc aaattcgcaa acaasataafc ggattattaa attttcactg tâtttctâct tcfcteccaca gcatcttccc caggaaacfcg tagacaggtc cttcfcttact agegggcacc acccctggag caaaaaggga the gggtgaacâc

aggctteeag acegggcggg gctcactttc cfccggcfcaca gcfcgegcttc geagt.at.tc.fc aaaataccac gtgaggagtt. gattggaage ccacctctta taggt-gtc.cc cccactatga aaaagttc g &amp; gtcaccaaag ccetggttcc fctattctgcfc ttcaccttgfc ctaccctctt tççcgtattt tggggttgcg taggcteage 60 cgtgtacagc ISO 240 ISO ccagcccgcg accccgtctc gcggagctcc ggfccggttcc 300 cc to 360 aa taaaagtctg 4:20 cct c fc 4 &amp; tgfcttfctctc 0 540 600 ggccgctttt

621 &lt;210&gt; 6 &lt;211&gt; 312 &lt;212&gt; PRT &lt;213&gt; DEL Type A Circovirus &lt;400&gt; 6

<td>Met Fr ©</td><td>Fri</td><td>Lys</td><td>lys</td><td>To be</td><td>Gly</td><td>Pro</td><td>Gin</td><td>Fr ©</td><td>His</td><td>Lys</td><td>Atg</td><td>T rp</td><td>v.si</td><td>Phe</td>

<td> 1</td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 1.0</td><td></td><td></td><td></td><td></td><td> 15</td><td></td>

<td>Thr leu</td><td>Asn</td><td>Asn</td><td>Pro</td><td>To be</td><td>Glu</td><td>Glu</td><td>Glu</td><td>Lv.s</td><td>Asn</td><td>Lys</td><td>Ile</td><td>Arg</td><td>GLu</td><td>Read</td>

<td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 23</td><td></td><td></td><td></td><td></td><td>3rd</td><td></td><td></td>

<td>Prile</td><td>Set</td><td>Ltu</td><td>Phe</td><td>Asp</td><td>Tyr</td><td>Phe</td><td>val</td><td>Cya</td><td>Gly</td><td>HERE</td><td>Glu</td><td>Gly</td><td>Read</td><td>G.1 u</td>

40 45

102

<td colspan="2">Glu Gly</td><td rowspan="2">Arg</td><td rowspan="2">Thr</td><td rowspan="2">Prp</td><td rowspan="2">Kis Leis 55</td><td rowspan="2">Gin</td><td rowspan="2">Gly Phe Ala</td><td rowspan="2">A. $ n 6&gt; 3</td><td colspan="2" rowspan="2">Phe Ala Lys</td><td rowspan="2">Lys</td>

<td></td><td> 50</td>

<td>Gin</td><td>Thr</td><td>Phe</td><td>Asn</td><td>Lys</td><td>Va1 Lys</td><td>Trp</td><td>Tyr Phe Gly</td><td>Allah</td><td>Arg</td><td>Cys his</td><td>Ile</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td> 75</td><td></td><td></td><td></td><td> 80</td>

<td>Glu</td><td>Lys</td><td>Allah</td><td>Lys</td><td>Gly</td><td>Thr asp</td><td>Gin</td><td>6.1 rs Asn Lys</td><td>61 u</td><td>Tyr</td><td>Cys · Ser</td><td>Lys</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td> 90</td><td></td><td></td><td> 95</td><td></td>

<td>Glu</td><td>Gly</td><td>His</td><td>ile</td><td>Read</td><td>Ile glu</td><td></td><td>Gly Wing Pro</td><td>Arg</td><td>Asn</td><td>Gin Gly</td><td>Lys</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td> 110</td><td></td>

<td>Arg</td><td>To be</td><td>asp</td><td>Read</td><td>To be</td><td>Thr wing</td><td>Val</td><td>Be thr read</td><td>Read</td><td>Glu</td><td>Thr 61y</td><td>To be</td>

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td> 125</td><td></td><td></td>

<td>Read</td><td>Val</td><td>Thr</td><td>Val</td><td>Allah</td><td>Glu Gin</td><td>Phe</td><td>Pro Go Thr</td><td>Tyr</td><td>Val</td><td>Arg Asn</td><td>Phs</td>

<td></td><td> 130</td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td> 140</td><td></td><td></td><td></td>

<td>Arg</td><td>Gly</td><td>Read</td><td>Allah</td><td>Glu</td><td>Leu Leu</td><td>Lys</td><td>It's gonna be Gly</td><td>Lys</td><td>Met</td><td>Gin Gin</td><td>Arg</td>

<td> 145</td><td></td><td></td><td></td><td></td><td>ISO</td><td></td><td> 155</td><td></td><td></td><td></td><td>ISO</td>

<td>Asp</td><td>Trp</td><td>Lys</td><td>Thr</td><td>Allah</td><td>Val his</td><td>val</td><td>Ile Vai Gly</td><td>Pro</td><td>Pro</td><td>Gly cys</td><td>Gly</td>

<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td> 1.7 0</td><td></td><td></td><td> 175</td><td></td>

<td>Lys</td><td>To be</td><td>Gin</td><td>Trp</td><td>Allah</td><td>Arg aan</td><td>Phe</td><td>Glu Pro Wing</td><td>Arg</td><td>Asp</td><td>Thr tyr</td><td>Trp</td>

<td></td><td></td><td></td><td>ISO</td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td> 190</td><td></td>

<td>Lys</td><td>Pro</td><td>To be</td><td>Arg</td><td>ASn</td><td>Lys Trp</td><td>Trp</td><td>Asp Gly Tyr</td><td>Kis</td><td>Gly</td><td>Glu Glu</td><td>Val</td>

<td></td><td></td><td> 195</td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td> 205</td><td></td><td></td>

<td>Val</td><td>Go</td><td>Read</td><td>Asp</td><td>Asp</td><td>Phe tyr</td><td>Gly</td><td>Trp Read to</td><td>Trp</td><td>Aap</td><td>Asp Leu</td><td>Read</td>

<td></td><td> 210</td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td> 220</td><td></td><td></td><td></td>

<td>Arg</td><td>Read</td><td>Cys</td><td>Asp</td><td>Arg</td><td>Tyr pro</td><td>Read</td><td>Thr val glu</td><td>Thr</td><td>Lys</td><td>Gly Gly</td><td>Thr</td>

<td> 225</td><td></td><td></td><td></td><td></td><td> 2 30</td><td></td><td> 2 35</td><td></td><td></td><td></td><td> 240</td>

<td>Val</td><td>Pro</td><td>Phe</td><td>Read</td><td>Allah</td><td>Arg Ser</td><td>Ile</td><td>Read he thr</td><td>to be</td><td>Asn</td><td>Gin Wing</td><td>Pro</td>

<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td> 250</td><td></td><td></td><td> 255</td><td></td>

<td>Gin</td><td>Glu</td><td>Trp</td><td>Tyr 260</td><td>To be</td><td>To be thr</td><td>Αΐδ</td><td>Val Pro Wing 265</td><td>Val</td><td>Glu</td><td>Wing Leu 270</td><td>Tyr</td>

<td>Arg</td><td>Arg</td><td>Xle</td><td>Thr</td><td>Thr</td><td>Read Gin</td><td>Phe</td><td>Trp Lys Thr</td><td>At · ::</td><td>Gly</td><td>Glu Gin</td><td>To be</td>

<td></td><td></td><td> 275</td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td> 285</td><td></td><td></td>

<td>Thr</td><td>Glu</td><td>Val</td><td>Pro</td><td>Glu</td><td>Gly arg</td><td>Phe</td><td>Glu Wing Val.</td><td>Asp</td><td>Pro</td><td>Pro cys</td><td>Alas</td>

<td></td><td> 230</td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td> .300</td><td></td><td></td><td></td>

<td>Read</td><td>Phe</td><td>Pro</td><td>Tyr</td><td></td><td>Ile asn</td><td>Tyr</td><td></td><td></td><td></td><td></td><td></td>

30.5 310 &lt;210&gt; 7 &lt;211&gt; 233 &lt;212&gt; PRT

103 &lt;213&gt; Circovirus DEL type A &lt;400&gt; 7

<td>Met 1</td><td colspan="3">The Trp Pro</td><td>Arg 5th</td><td>Arg</td><td>Arg</td><td>Tyr</td><td>Arg</td><td>Arg 10</td><td>Arg</td><td>Arg</td><td>Thr</td><td>Arg</td><td>Pro iS</td><td>Arg</td>

<td>Sec</td><td>H 1, S</td><td>Read</td><td>Gly</td><td>Asn</td><td>ile</td><td>Read</td><td>Arg</td><td>Arg</td><td>Arg</td><td>Pro</td><td>Tyr</td><td>Read</td><td>go</td><td>His</td><td>Prp</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Allah</td><td>Phe</td><td>Arg</td><td>Asn</td><td>Arg</td><td>Tyr</td><td>Arg</td><td>Trp</td><td>Arg</td><td>Arg</td><td>Lys</td><td>The</td><td>Gly</td><td>i ie</td><td>Phe</td><td>Asn</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Set</td><td>Arg</td><td>Read</td><td>To be</td><td>Arg</td><td>Glu</td><td>Phe</td><td>Go</td><td>Read</td><td>The</td><td>Ile</td><td>Arg</td><td>Gly</td><td>Gly</td><td>His</td><td>to be</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> €0</td><td></td><td></td><td></td><td></td>

<td>GI π</td><td>P co</td><td>Sec</td><td>Trp</td><td>Asn</td><td>Val</td><td>Asn</td><td>Glu</td><td>Read</td><td>Arg</td><td>Phe</td><td>Asn</td><td>lie</td><td>Gly</td><td>Gin</td><td>Phe</td>

<td>ss</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Lexj</td><td>Pro</td><td>Pro</td><td>To be</td><td>€ iy</td><td>Gly</td><td>Thr</td><td>Asn</td><td>Pro</td><td>Read</td><td>Pco</td><td>Read</td><td>Pro</td><td>Phe</td><td>Gin</td><td>Tyr</td>

<td></td><td></td><td></td><td></td><td>SS</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Tyr</td><td>Arg</td><td>ile</td><td>Atg</td><td>Lys</td><td>AXâ</td><td>Lys</td><td>Tyr</td><td>Xu</td><td>Phe</td><td>Tyr</td><td>Pro</td><td>Arg</td><td>Asp</td><td>Pro</td><td>Ile</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td>The</td><td>Sec</td><td>Asn</td><td>Gin</td><td>Arg</td><td>Gly</td><td>Val</td><td>Glv</td><td>Sec</td><td>Thr</td><td>Val</td><td>Val</td><td>Ile</td><td></td><td>Asp</td><td>Allah</td>

<td></td><td></td><td>1X5</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

<td>Asn</td><td>i? Hey</td><td>Go</td><td>The</td><td>Pro</td><td>Sec</td><td>Thr</td><td>Asn</td><td>Read</td><td>Allah</td><td>Tyr</td><td>Asp</td><td>Pro</td><td>Tyr</td><td>Ile '</td><td>Asn</td>

<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>

<td>Tyr</td><td>Sec</td><td>To be</td><td>Arg</td><td>His</td><td>The</td><td>ile</td><td>Arg</td><td>Gin</td><td>Pro</td><td>Phe</td><td>Thr</td><td>Tyr</td><td>HIS</td><td>To be</td><td>Arg</td>

<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td>

<td>Tyr</td><td>Phe</td><td>The</td><td>Pro</td><td>L ys</td><td>Pro</td><td>Glu</td><td>Read</td><td>Asp</td><td>Gin</td><td>The</td><td>Ile</td><td>Asp</td><td>Trp</td><td>Phe</td><td>Gin</td>

<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td>

<td>Pro</td><td>Asn</td><td>Asn</td><td>Lys</td><td>Arg</td><td>Asn</td><td>Gin</td><td>Read</td><td>Trp</td><td>Read</td><td>Hls</td><td>Read</td><td>Asn</td><td>The</td><td>HIS</td><td>Thr</td>

<td></td><td></td><td></td><td>l§0</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td>

<td>Â II</td><td>Val</td><td>Glu</td><td>HIS</td><td>The</td><td>Gly</td><td>Read</td><td>Gly</td><td>Tyr</td><td>Al</td><td>Read</td><td>G1 n</td><td>Asn</td><td>Oh s</td><td>Thr</td><td>The</td>

<td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td>η · Γϊ A A. · · - 'V</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

<td>AX &amp;</td><td>Gin</td><td>Asn</td><td>Tyr</td><td>Val</td><td>V &amp; l</td><td>Arg</td><td>Read</td><td>The</td><td>Ile</td><td>Tyr</td><td>Go</td><td>Gin</td><td>Phe</td><td>Arg</td><td>Glu</td>

<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>

<td>Phe</td><td>Ile</td><td>LSii</td><td>Lvs</td><td>Asp</td><td>Pro</td><td>Read</td><td>Asn</td><td>Glu</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

225 230

104 &lt;210&gt;

&lt;211&gt; 206 &lt;212&gt; PRI &lt;213&gt; DEL Type A Circovirus &lt;400&gt; 8

<td>hfet 1</td><td>lie</td><td>To be</td><td>Ile</td><td>Pro 5th</td><td>Pro leu</td><td>Ile</td><td>To be</td><td>Thr 10</td><td>Arg</td><td>Léu</td><td>Pro</td><td>Val</td><td>Gly Val 15</td>

<td>Pr »</td><td>Arg</td><td>Read</td><td>To be 2nd</td><td>Lys</td><td>Ile thr</td><td>Gly</td><td>Pro 25</td><td>Read</td><td>Ale</td><td>Léu</td><td>P r o.</td><td>Thr 30</td><td>Thr^- Glv</td>

<td>Arg</td><td>Allah</td><td>His 35</td><td>Tyr</td><td>Asp</td><td>Val tyr</td><td>To be 40</td><td>Cys</td><td>Read</td><td>Prg</td><td>He</td><td>Thr 45</td><td>Read</td><td>Read his</td>

<td>Read</td><td>Pro 50</td><td>Allah</td><td>His</td><td>Phe</td><td>Gin Lys 55</td><td>Phe</td><td>To be</td><td>Gin</td><td>Pro</td><td>Ale 60</td><td>Glu</td><td>Ile</td><td>To be his</td>

<td>Ile 65</td><td>Arg '</td><td>Tyr</td><td>Arg</td><td>Ly s</td><td>Leu Leu 70</td><td>Gly</td><td>Tyr</td><td>To be</td><td>His 75</td><td>Gin</td><td>Arg</td><td>Pro</td><td>Arg Leu 80</td>

<td>61 n</td><td>Lys</td><td>Gly</td><td>Thr</td><td>His 85</td><td>To be to be</td><td>Arg</td><td>Gin</td><td>Vδ 1 90</td><td>Allah</td><td>Allah</td><td>Read</td><td>Pro</td><td>Read val 95</td>

<td>Pr c&gt;</td><td>Arg</td><td>To be</td><td>To be 100</td><td>Thr</td><td>Read asp</td><td>Ly®</td><td>Tyr 105</td><td>Val</td><td>Woe</td><td>Phe</td><td>Phe</td><td>Thr 110</td><td>Val Wing</td>

<td>Phe</td><td>Phe</td><td>Ile 115</td><td>Read</td><td>Read</td><td>Val gly</td><td>To be 120</td><td>Phe</td><td>Arg</td><td>Phe</td><td>Read</td><td>Asp 125</td><td>Val</td><td>Ala Ala</td>

<td>61 y</td><td>Thr 130</td><td>Lys</td><td>Ile</td><td>Pro</td><td>Read his 135</td><td>Read</td><td>Val</td><td>Lys</td><td>To be</td><td>Read 140</td><td>Read</td><td>Read</td><td>Be lys</td>

<td>Ile 145</td><td>Arg</td><td>Lys</td><td>Pro</td><td>Read</td><td>Glu Val 150</td><td>Arg</td><td>To be</td><td>To be</td><td>Thr 155</td><td>Read</td><td>Phe</td><td>Gin</td><td>Thr Phe 160</td>

<td>Read</td><td>Allah</td><td>Thr</td><td>Asn</td><td>Lys</td><td>lie</td><td>Ile</td><td>Lys</td><td>ij y .s</td><td>Gly</td><td>Asp Trp</td><td>Lys</td><td>Read</td><td>Pro</td><td>Tyr</td>

<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td> 175</td><td></td>

<td>Phe</td><td>Val</td><td>Phe</td><td>Read</td><td>Read</td><td>Read</td><td>Gly</td><td>Arg</td><td>Ile</td><td>lie</td><td>l.ys Gly</td><td>Glu</td><td>His</td><td>Pro</td><td>Pr&gt;</td>

<td></td><td></td><td></td><td>ISO</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td> 190</td><td></td><td></td>

<td>Read</td><td>Met</td><td>Gly</td><td>Read</td><td>Arg</td><td>Allah</td><td>Allah</td><td>Phe</td><td>Read</td><td>Allah</td><td>Trp his</td><td>Phe</td><td>His</td><td></td><td></td>

<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

105 &lt;210&gt; 9 &lt;211&gt; 1767 &lt;212&gt; DNA &lt;213&gt; DEL type Circ &lt;220&gt; Polarity chain + (5'-3 ') &lt;400&gt; 9 accagcgcac agaagaatgg ct fcccgaaga ttgttggcga itgtgaagaa agaaagcgaga tgatgcgcgtgtgtgtctgctgtgtctgtgtctctgtgtctgtctgtgtctgtgtctctgtctgtctgtgtgtgtgtgtgtgtgtgtggtgtggggggggggggggggt SSCCCCCCCCCC t ectecttect ect cat cat ect atacatggtt gaggcctacg gttgttfcggt ggagtggtag ataggtgagg tfccggcagcg aagaagcgga cgagcgcaag ggagggtaafc g and c gac 1t fc aggaacagat tgga.get.cet ggagagcggg ccgcgggctg taatgtacac tgcagacceg tggtgaagaa gagactgtgt ggcccgcagt tgteceagct tacagaacaa afcttecatat cattaagggt aeaeggatafc tggtetacafc tggaagtaat gagaagggct getgtggcefc gcagcacctc ccccaacccc aaaatacggg gaggaaggac aataaagtga cagcagaata OG &amp; tctcagg agtctggtga gctgaacttt gtcattgtgg gaaaccaeat gtggttgtta gategatate atfcctgatfca gtagaagetc tccacggagg gaaataaatt taagtggggg Ígfcattcctg ttecagcagt caafcagtgaa gggttatggt;

ttgttacaaa ggcagcacet atâaaaggtg atcttccaat gaacacctca agtggíattt aagaatactg gacaacggag ccgttgéaga tgaaagtgag ggeeacetgg actggaascc ttgatgactt.

cattgactgt ccagcaatca tttatcggag aagggggcca actgagtctt gtctttaaaa gtcgtatata fcfcgtagtctc atctaggaca atggegggag gfctafceatct càgcagcaac ggtgtfçaçt stecctattt ccfcccagggg gggtgccegç cagfcaaagaa tgacctgtcfc geagcaccct cgggaaaatg gtgtggtaaa ãeetagaaac ttafcggctgg ag &amp; gactaaa gaeceegttg gattacttcc gfcfccgtcacc ttttatcâct ttasattetc ctgfctttcga agccacagct ggtttggggg gagtagttta asaatsaesg atgcceagca ctgaataatc gattatttta ttcgetsatt fcgccacafccg ggcaacttac actgefcgtga gtaacgtttg cagaagcgfcg agcáââtggg aagtggtggg ctgcectggg 9 &lt;9tggaactg gaatggtact ttggtatttt ettfccceecc tcgtaatggt tgaafctgtk acgcagtgee ggt ttc ?. t tt taaagtaeeg cataggggtc cactggagcc

120

ISO

240

300

360

420

480

540

600

660

720

780

840

900

960

1020

1080

1140

1200

1260

1320

1380 cactcccctg tcaccctggg fcgatcgggga gcagggccag aattcaacct taacctfctct 1440 tattetgtag fcatteaaagg gcacagagcg ggggtttgac ccccctcctg ggggaagaaa 1SOO gtcattaata ttgaafcctca tcatgtccac cgcceaggag ggcgttctga ctgtggtteg 1560 ettgacagta tatccgaagg fcgcgggagag gcgggtgttg aagafcgccat fcfcfctccttet 1620 ccagcggtaa cggtggcggg ggtggacgag ccaggggcgg cggcggagga tctggccaag 1680 gggcggtgtc ttcttctteg gtaaçgcctc atggctgcgg cttggatacg tcatatctga 1740 aaacgaaaga agtgcgctgt aagtatt 1767 &lt;210&gt; 10 &lt;211&gt; 1767 &lt;212&gt; DNA &lt;213&gt; DEL type B circovirus

106 &lt;220&gt;

&lt;223&gt; Polarity chain + (5'-3^r) &lt;400&gt; 10 aetacttaca gcgcacttct ttcgttttca gatatgacgt adecaaggag gçgttaccga 60 AGA &amp; gfiágác accgececcg cagccatctt ggccagatcc tccgccgccg cccctggctc 120 gtccaccccc gccaccgtta ççgcfcggaga aggaaaaatg gcatcttcaa cacccgcctc ISO tcccgcacct tcggatatac tgtcaagcga accacagtca gaacgccctc ctgggcggtg 240 gacatgatga gattcaatat taatgacbtt cttcccccag gaggggggtc aaacccccgc 300 tctgtgccct ttgaat &amp; CTA cagaataaga aaggttaagg ttgaattctg gecctgctcc 360 ecgatcaccc agggtgacag gggagtgggc tccagtgctg ttatttcaga tgataacttt 420 gtaacaaagg ccacagccct cacctatgac ccctatgtea actactcctc ccgccatacc 480 cc ataacccagc ccttctccta &amp; ctcccgg tactttaccc ccaaacctgt cctagatttc 540 actattgatt acttccaacc aaacaacaaa agaaaccagc tgtggctgag actacaaact 600 gctggaaatg tagaccacgt aggccfccggc aetgcgttcg aaaacagtat atacgaccag 660 gaatacaata tccgtgtaac catgtatgta caattcagag aatttaattt taaagacccc ccacfctaaec ctt 720 &amp; atgaat. àataasaacc attacgaagt gataaaaaag actcagtaat 780 ttatttcata tggaaattca gggcatgggg gggaaagggt gacgaactgg cccccttcct 840 ccgtggattg ttctgtagca ttcttccaaa ataccaagga agtaatccfcc cgataaagag 500 cttctacagc tgggacagca gtfcgaggagt accattccaa cggggtctga fctgctggtaa 960 tcagaafcact gcgggccaaa aaaggtacag ttccaccttt agtctctaca gtcaatggat 1820 atcgatcaca cagtctcagt agatcatccc agggcagcca gccataaaag tcateaafcaa 1880 caaccacttc ttcaccabgg taaccatccc aecacttgtt tctaggtggt ttccagtatg 1140 tggtttccgg gtctgcaaaa ttagcagccc atttgctttfc accacacçca ggtggcccca 1200 caatgacgfcg tacattagtc ttccaatcac gcttctgcat tttcccgctc actfctcaaaa 1288 gttcagccag cccgcggaaa tttctgacaa acgttacagg gtgctgctct gcaacggtca 1320 ccagactccc gctctccaac aaggtactca cagcagtaga caggtcactc cgttgtccct. 1380 gagatctagg agcfcccacac tccatcagfca agttgccttc tttactgcag tattcfcfcfcat 1440 tctgctgatc fcgttcctttc gcttfccfccga tgtggcagcg ggcacccaaa taccacttca 1500 etttafcfcaaa agtctgctxc ttcacaaaat fcagcgaaccc ctggaggtga ggtgttcgtc 1560 cttcctcatfc accctccfccg ccaacaataa sataatcaaa tagggatatt ggaagatcee 1620 gtattttctt gcgctcgtct tcggaaggat tattcagagt gaacsccçaç cttttafcggg 1680 gttggggtcc gcttcttcca ttcttcttge tgggcatgtt gctgctgagg tgctgecgag 1740 gtgctgccgc tgccgaagtg cgctggt 1767 &lt;210&gt; 11 &lt;211&gt; 945 &lt;212&gt; DNA &lt;213&gt; Circovirus DEL type B &lt;220&gt;

&lt;223&gt; 0RF1 &lt;400&gt; 11

107 afcgcccagca agaagaatgg âagaagcgga ceecaaecec atâaaaggtg ggtgttcact SS ctgaataatc cttccgaaga çgagcgc &amp; ag aaaatacggg atcttccaat atccctattt 120 gattatfctta ttgttggçga ggagggtaat gaggaaggac gaacacctca cctccagggg 180 ttcgctaatt ttgtgaagaa gcagactttt aataaagtga agtggtattt gggtgcccgc 24 0 tgccaeatcg ggcaacfctac actgctgtga gtaacgtttg cagaagcgtg agcaaatggg aagtggtggg ctgccctggg ggtggaactg gaafcggtact ttggfcatttt ctttccccec ãgaaagcgaa tgatggagtg gtaccttgtt teagaaattt attggaagac ctgctaattt atggttacca atgatctact tacctttttt cctcaactge ggaagaatgc çatgçççxga aggaacagat tggagctcct ggagagcggg ecgcgggctg taatqtacac tgcagaeccg tggtgaagaa gagactgfcgfc ggcccgcagt fcgfctccsgcfc tacagaacaa attrccstat csgcagaata agatcfccagg agtctggtga gctgaacttt gtcattgtgg gaaaccacat gfcggttgfcta gatcgatalc attctgatta gtagasgctc tccacggagg gaaataaatt aagaatactg gacaacggag ccgttgcaga tgaaagtgag ggccacctgg actggaaacc ttgatgactt cattgacfcgt ccagcaafcca fcfctateggag asgggggcea actga cagtaaagaa tgacctgtct gcagcaccct cgggaaaatg gtgtggfcaâa acctagaaac ttatggctgg agagactated gaccccgttg gattacttcc gttcgteacc

300

360

42Θ

MO

600

660

720

840

900

945 &lt;210&gt; 12 &lt;211&gt; 702 &lt;212&gt; DNA &lt;213&gt; DEL B-type circovirus &lt;220&gt;

&lt;223&gt; ORF2 &lt;400&gt; 12 atgacgtatc cagatcctcc aaaaatggca acagtcagaa eeeceaggag gtfcaaggttg agtgctgtta tatgtaaact tttaccccca aaccagctgt gcgttcgaaa ttcagagaat caaggaggcg gccgccgccc tcttca &amp; cac cgccctcctg gggggtcaaa aattct.ggcc ttttag &amp; TGA actcctcccg aacctgtcct ggctgagacfc acagfcafcafca ttaattttaa fct &amp; ccgsâga ctggctcgfcc cegcetctcc ggcggfcggac cceccgctct ctgctccccg taacttfcgta ccataccata agattteact acaaactgct cgaccaggaa agacccccca agaagâcacc cacccccgcc egcaccttçç atgatgagat gtgccctfctg atcacccagg acaaaggcca acccagcccfc attgattact ggaaafcgtag tacaatatcc cttaaccctt gcccccgcag accgttaccg gatatacfcgt tcaatattaa aatactacag gfcgacaggggg cagccctcac tctccfcacca tccagacacg

âa ccatettggc ctggagaagg caagcgaacc tgactttctt aataagaaag agtgggctcc etetgacccc ctcccggtac caacaaaags cetcggcact gtatgfcacas

120

ISO

24Ô

300

360

420

480

540

600

660

702 &lt;210&gt; 13 &lt;211&gt; 315 &lt;212&gt; DNA &lt;213&gt; Type B DEL circovirus

108 &lt;220&gt;

&lt;223&gt; 0RF3 &lt;400&gt; 13 aaaattagea atggtaacca ágtcttçcaa gaaatttctg caacaaggfca acactccatc tc-ccaccact gcccatttgc tcaçgcttct acaascgtta ctcacagcag Agra tgtttctagg 1:11 fc accaca gcattttccc cagggtgctg fcagacaggtc tggtfctccag çeçaggtggcgctcacrtfcc ctctgcaaeg actccgttgt tatgtggttt çccacaatga aaaagttcag gtcaceagac CCC &amp; gagatç ccgggtctgc cgtgtacafct ccageecgog tcccgctctc 0 &amp; taggagctcc

120 ieo

240

300

315 &lt;210&gt; 14 &lt;211&gt; 314 &lt;212&gt; PRT &lt;213&gt; Type B DEL circovirus &lt;400&gt; 14

<td>Met 1</td><td>Pro</td><td>To be</td><td>Lys</td><td>Lys 5th</td><td>Asn</td><td>Gly</td><td>Arg</td><td>Sr</td><td>Gly 10</td><td>Pro</td><td>Gin</td><td>Pro</td><td>His</td><td>Lys 15</td><td>Cg</td>

<td>Tcp</td><td>Val</td><td>Phe</td><td>Thr</td><td>Read</td><td>Asn</td><td>Asn</td><td>Pro</td><td>To be</td><td>Glu</td><td>Asp</td><td>Glu</td><td>Arg</td><td>Lys</td><td>Lys</td><td>Ile</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Cg</td><td>Asp</td><td>your 35</td><td>Pro</td><td>Ile</td><td>To be</td><td>Read</td><td>Phe 40</td><td>Asp</td><td>W</td><td>Phe</td><td>I le</td><td>Va 1 45</td><td>Gly</td><td>Glu</td><td>Glu</td>

<td>Gly</td><td>Asn 50</td><td>Glu</td><td>Glu</td><td>Gly</td><td>Arg</td><td>Thr 55</td><td>Pro</td><td>Hrs</td><td>Read</td><td>Gin</td><td>Gly 60</td><td>Phe</td><td>Allah</td><td>Asn</td><td>Phe</td>

<td>Val 65</td><td>Lys</td><td>Lys</td><td>Gin</td><td>Thr</td><td>Phe 70</td><td>As st</td><td>Lys</td><td>Go</td><td>Lys</td><td>Trp 75</td><td>Tyr</td><td>Read</td><td>Gly</td><td>Al, ®</td><td>Arg 8Ô</td>

<td>Cys</td><td>Hrs</td><td>Ile</td><td>Glu</td><td>Lys 85</td><td>Allah</td><td>Lys</td><td>Gly</td><td>Thr</td><td>Asp 0C</td><td>Gin</td><td>Glii</td><td>Asn</td><td>Lys</td><td>Glu 55</td><td>Tyr</td>

<td>Cys</td><td>To be</td><td>Lys</td><td>Glu</td><td>Gly</td><td>Asn</td><td>Read</td><td>Read</td><td>Met</td><td>Glu</td><td>Cys</td><td>Gly</td><td>Allah</td><td>Pro</td><td>Arg</td><td>To be</td>

100 105 HO

109

<td>Gin</td><td>Gíy</td><td>Gin 115</td><td>Arg</td><td>To be</td><td>Asp</td><td>Read it.</td><td>To be 120</td><td>Thr</td><td>Oh</td><td>go</td><td>To be</td><td>Thr 125</td><td>your</td><td>Read</td><td>GiU</td>

<td>To be</td><td>Gly</td><td>Ssr</td><td>Read</td><td>Go</td><td>Thr</td><td>Val</td><td>Allah</td><td>Glu</td><td>Gin</td><td>His</td><td>Pro</td><td>Val</td><td>Thr</td><td>Ph ©</td><td>Val</td>

<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 1.40</td><td></td><td></td><td></td><td></td>

<td>Arg</td><td>Asn</td><td>Phe?</td><td>Arg</td><td>Gly</td><td>Read</td><td>Allah</td><td>Glu</td><td>Read</td><td>Read</td><td>LVS</td><td>Go</td><td>To be</td><td>Gly</td><td>Lys</td><td>Met</td>

<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 100</td>

<td>Glh</td><td>Lys</td><td>Arg</td><td>PS</td><td>Trp</td><td>Lys</td><td>Thr</td><td>ASn</td><td>Val</td><td>His</td><td>Go</td><td>ile</td><td>Val</td><td>Gly</td><td>Pro</td><td>Pro</td>

<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td> 175</td><td></td>

<td>Giy</td><td>Cys</td><td>Gly</td><td>Ly s</td><td>To be</td><td>Lys</td><td>Trp</td><td>A1 a</td><td>at a</td><td>ASS</td><td>Pb ©</td><td>A1 a.</td><td>Asp</td><td>Pro</td><td>Glu</td><td>Thr</td>

<td></td><td></td><td></td><td>ISO</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td>

<td>Thr</td><td>Tyr</td><td>Trp</td><td>Lys</td><td>Pro</td><td>Pro</td><td>Arg</td><td>Asn</td><td>Lys</td><td>Trp</td><td>Trp</td><td>Asp</td><td>GXy</td><td>Tyr</td><td>His</td><td>Gly</td>

<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

<td>Glu</td><td>Glu</td><td>Va 1.</td><td>Val</td><td>Val</td><td>lie</td><td>Asp</td><td>Asp</td><td>Phe</td><td>Tyr</td><td>Gly</td><td>Trp</td><td>Read</td><td>Pro</td><td>Trp</td><td>Asp</td>

<td></td><td> .210</td><td></td><td></td><td></td><td></td><td> 215·</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>

<td>Asp</td><td>Read</td><td>Read</td><td>Arg</td><td>Read</td><td>Cys</td><td>Asp</td><td>Arg</td><td>Tyr</td><td>Pro</td><td>Read</td><td>Thr</td><td>Val</td><td>Glu</td><td>Thr</td><td>Ly s</td>

<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 233</td><td></td><td></td><td></td><td></td><td> 2 40</td>

<td>Gly</td><td>Gly</td><td>Thr</td><td>Val</td><td>Pro</td><td>Phe</td><td>Read it.</td><td>Allah</td><td>Arg</td><td>To be</td><td>Ile</td><td>Read</td><td>ile</td><td>Thr</td><td>To be</td><td>Asn</td>

<td></td><td></td><td></td><td></td><td> .245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td>

<td>Glu</td><td>Thr</td><td>Pro</td><td>Read</td><td>Glu</td><td>Trp</td><td>Tvr</td><td>To be</td><td>To be</td><td>Thr</td><td>Allah</td><td>val</td><td>Pro</td><td>Allah</td><td>val</td><td>Glu</td>

<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td>

<td>A la</td><td>Read</td><td>Tyr</td><td>Arg</td><td>Arg</td><td>II ©</td><td>Thr</td><td>To be</td><td>Read</td><td>VS 1</td><td>Phe.</td><td>Trp</td><td>Lys</td><td>Asn</td><td>Allah</td><td>Thr</td>

<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td><td></td><td></td><td></td>

<td>G1u</td><td>Gin</td><td>To be</td><td>Thr</td><td>Glu</td><td>Glu</td><td>Gly</td><td>Gly</td><td>Q ± n</td><td>Phe</td><td>Val</td><td>Thr</td><td>Read</td><td>To be</td><td>Pro</td><td></td>

<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295·</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td>

<td>Cys</td><td>Fr o</td><td>Glu</td><td>Phe</td><td>Pro</td><td>Tyr</td><td>Glu</td><td>Ile</td><td></td><td>Tyr</td><td></td><td></td><td></td><td></td><td></td><td></td>

305 310 &lt;210&gt; 15 &lt;211&gt; 233 &lt;212&gt; PRT &lt;213&gt; DEL Circovirus Type Β &lt;400&gt; 15

110

<td>Het 1</td><td>Thr tyr</td><td>Pro</td><td>Arg 5th</td><td>Acg</td><td>Arg</td><td>Tyr</td><td colspan="3">Arg Atg Arg 16</td><td>Arg</td><td>His arg</td><td colspan="2">Pro Arg 15</td>

<td>To be</td><td>His leu</td><td>Gly</td><td>Gin</td><td>Ile</td><td>Read</td><td>Arg</td><td>Acg</td><td>Arg</td><td>Pro</td><td>Trp</td><td>Leu Vai</td><td>His</td><td>Pro</td>

<td></td><td></td><td>2 CS</td><td></td><td></td><td></td><td></td><td> .25</td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Acg</td><td>His arg</td><td>Tyr</td><td>Arg</td><td>Trp</td><td>Arg</td><td>Arg</td><td>Lys</td><td>Asn</td><td>Gly</td><td>ile</td><td>Phe asn</td><td>Thr</td><td>Arg</td>

<td></td><td> 35</td><td></td><td></td><td></td><td></td><td>4th</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td>

<td>L</td><td>To be Arg</td><td>Thr</td><td>Phe</td><td>Gly</td><td>Tyr</td><td>Thr</td><td>val</td><td>Lys</td><td>Acg</td><td>Thr</td><td>The val</td><td>Arg</td><td>Thr</td>

<td></td><td> 50</td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td>

<td>Pro</td><td>Be trp</td><td>Oh</td><td>Val</td><td>Asp</td><td>Het</td><td>Met,</td><td>Acg</td><td>Phe</td><td>Asn.</td><td>lie</td><td>Asn asp</td><td>Phe</td><td>Read</td>

<td> 05</td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td> 80</td>

<td>Pro</td><td>Pro gly</td><td>Gly</td><td>Gly</td><td>To be</td><td>Asn</td><td>Pro</td><td>Arg</td><td>Ser</td><td>Val</td><td>Pro</td><td>Phe Glu</td><td>Tyr</td><td>Tyr</td>

<td></td><td></td><td></td><td> 8 5</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Arg</td><td>T.le Arg</td><td>Lys</td><td>val</td><td>Lys</td><td>Val</td><td>Glu</td><td>Phe</td><td>Trp</td><td>Pro</td><td> , _ç\ y&gt; .-&gt;</td><td>To be pro</td><td>lie</td><td>The</td>

<td></td><td></td><td>lõõ</td><td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td>Gin</td><td>Gly asp</td><td>Arg</td><td>Gly</td><td>Val</td><td>Gly</td><td>To be</td><td>To be</td><td>Allah</td><td>Val</td><td>I Xe</td><td>Read asp</td><td>Asp</td><td>Asn</td>

<td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 1 25</td><td></td><td></td>

<td>Phe</td><td>Val. Thr</td><td>Lys</td><td>Allah</td><td>Thr</td><td>.Allah</td><td>Read</td><td>Th r</td><td>Tyr</td><td>Asp</td><td>Pro</td><td>Tyr will</td><td>Asn</td><td>Tyr</td>

<td></td><td> 130</td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td>

<td>To be</td><td>To be Arg</td><td>His</td><td>Thr</td><td>lie</td><td>Thr</td><td>G1Ϊ8</td><td>Pro</td><td>Phe</td><td>To be</td><td>“Yr</td><td>His ser</td><td>Arg</td><td>Tyr</td>

<td> 14 5</td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td> 160</td>

<td>Phe</td><td>Thr pro</td><td>Lys</td><td>Gold</td><td>Go</td><td>Read</td><td>ASp</td><td>Phe</td><td>Thr</td><td>I le</td><td>Asp</td><td>Tyr phe</td><td>Gin</td><td>Pro</td>

<td></td><td></td><td></td><td>1H5</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td> 175</td><td></td>

<td>Asn</td><td>AS ή Lys</td><td>Arg</td><td>Asn</td><td>Gin</td><td>Read</td><td>Trp</td><td>Read</td><td>Atg</td><td>Read</td><td>GXh</td><td>The wing.</td><td>GIv</td><td>Asn</td>

<td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td> 190</td><td></td><td></td>

<td>Val</td><td>Asp His</td><td>Go</td><td>Gly</td><td>Read</td><td>Gly</td><td>The</td><td>Allah</td><td>Phe</td><td>Glu</td><td>Asn</td><td>To be Ile</td><td>Tyr</td><td>Asp</td>

<td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td>

<td>Gin</td><td>Glu Tyr</td><td>Asn</td><td>Ile</td><td>Arg</td><td>val</td><td>Thr</td><td>Met</td><td>Tyr</td><td>Va 1</td><td>Gin</td><td>Phe arg</td><td>Glu</td><td>Phe</td>

<td></td><td> 210</td><td></td><td></td><td></td><td> 213</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td>

<td>Asn</td><td>Phe lys</td><td>Asp</td><td>Pro</td><td>Pro</td><td>hey</td><td>Asn</td><td>Pro</td><td></td><td></td><td></td><td></td><td></td><td></td>

225 230 &lt;210&gt; 16 &lt;211&gt; 104 &lt;212&gt; PRT &lt;213&gt; DEL Circovirus Type Β &lt;400&gt; 16

111

<td>Met 1</td><td>Val</td><td>Thr</td><td>Ile</td><td>Pro 5th</td><td>Pro</td><td>Read</td><td>Val</td><td colspan="2">To be Arg 10</td><td>Trp</td><td>Phe</td><td>Pro</td><td>Go</td><td>Cvs 15</td><td>Gly</td>

<td>Phe</td><td>Arg</td><td>Go</td><td>Cys 20</td><td>Lys</td><td>l le</td><td>To be</td><td>To be</td><td>Pro 25</td><td>phe</td><td>Allah</td><td>Phe</td><td>Thr</td><td>Thr 30</td><td>Pro</td><td>Arg</td>

<td>Trp</td><td>Pro</td><td>His</td><td>Asn</td><td>Asp</td><td>go</td><td>Tyr</td><td>He</td><td>To be</td><td>Léu</td><td>Pro</td><td>Ile</td><td>Thr</td><td>Lers</td><td>Léu</td><td>Kis</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Phe</td><td>Pro 50</td><td>Ale.</td><td>His.</td><td>Phe</td><td>Gin</td><td>Lys 55</td><td>Phe</td><td>To be</td><td>Gin</td><td>Pro</td><td>Allah 00</td><td>Glu</td><td>ile</td><td>To be</td><td>Asp</td>

<td>hya 65</td><td>Arg</td><td>Tyr</td><td>Arg</td><td>Vál</td><td>Read 70</td><td>Read</td><td>Cys</td><td>Asn</td><td>Gly</td><td>His 75</td><td>Gin</td><td>Thr</td><td>Pro</td><td>Allah</td><td>Léu 80</td>

<td>Gin</td><td>61 a</td><td>Gly</td><td>Thr</td><td>Ki S 65</td><td>To be</td><td>To be</td><td>Arg</td><td>61. n</td><td>Vál 90</td><td>Thr</td><td>Pro</td><td>Read</td><td>To be</td><td>Lev 95</td><td>Arg</td>

<td>To be</td><td>Arg</td><td>To be</td><td>To be</td><td>Thr</td><td>Read</td><td>Hi s</td><td>Gin</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

100 &lt;210&gt; 17 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; DEL Circovirus Type Β &lt;400&gt; 17

Val Asf »Met Met Arg Phe Asn Xle Asn Asp Phe Leu Pro Pro Gly

S 10 15 &lt;210&gt; 18 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; Type B Circovirus DEL &lt;400&gt; 18

112

Wing goes Ha Le »Asp &amp; $ p

15

GX «Gly

Arg Glv Val Gly Se: 5

<td> &lt;210&gt;</td><td> 19</td>

<td> &lt;211&gt;</td><td> 15</td>

<td> &lt;212&gt;</td><td>PRT</td>

<td> &lt;213&gt;</td><td>DEL type B circovirus</td>

<td> &lt;400&gt;</td><td> 19</td>

Gly Val Gly Ser Sar Sar Val ile Le »Asp Asp Asa Phe Val Thr 1 5 10 15 &lt;210&gt; 20 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; Type B DEL Circovirus &lt;400&gt; 20

Val Asp His Val Gly Le »Gly Thr Wing Phe 61» Wing Ser Ile Tyr

5 10 15

<td> &lt;210&gt;</td><td> 21</td>

<td> &lt;211&gt;</td><td> 8</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 21</td>

tgtggcga 8

113 &lt;210&gt; 22 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Circovirus &lt;400&gt; 22 agtttcct 8

<td> &lt;210&gt;</td><td> 23</td>

<td> &lt;211&gt;</td><td> 20</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 23</td>

tcatttagag ggtctttcag 20

<td> &lt;210&gt;</td><td> 24</td>

<td> &lt;211&gt;</td><td> 8</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 24</td>

Gtcaacct 8

<td> &lt;210&gt;</td><td> 25</td>

<td> &lt;211&gt;</td><td> 8</td>

<td> &lt;212&gt;</td><td>DNA</td>

&lt;213&gt; Circovirus &lt;400&gt; 25 gtggttgc 8

114

<td colspan="2"> &lt;210&gt; 26</td>

<td> &lt;211&gt;</td><td> 8</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 26</td>

<td colspan="2">Agcccagg 8</td>

<td> &lt;210&gt;</td><td> 27</td>

<td> &lt;211&gt;</td><td> 8</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 27</td>

<td colspan="2">Ttggctgg &lt;</td>

<td> &lt;210&gt;</td><td> 28</td>

<td> &lt;211&gt;</td><td> 12</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 28</td>

<td colspan="2">tctagctctg gt</td>

<td> &lt;210&gt;</td><td> 29</td>

<td> &lt;211&gt;</td><td> 12</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 29</td>

atctcagctc gt 12

115 &lt;210&gt; 30 &lt;211&gt; 12 &lt;212&gt; DNA &lt;213&gt; Circovirus &lt;400&gt; 30 tgtcctcctc tt 12

<td> &lt;210&gt;</td><td> 31</td>

<td> &lt;211&gt;</td><td> 8</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 31</td>

tctctaga 8

<td> &lt;210&gt;</td><td> 32</td>

<td> &lt;211&gt;</td><td> 8</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 32</td>

tgtaccaa 8

<td> &lt;210&gt;</td><td> 33</td>

<td> &lt;211&gt;</td><td> 8</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 33</td>

Tccgtctt 8

116

<td> &lt;210&gt;</td><td> 34</td>

<td> &lt;211&gt;</td><td> 20</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 34</td>

<td colspan="2">gtgtgctcga cattggtgtg</td>

<td> &lt;210&gt;</td><td> 35</td>

<td> &lt;211&gt;</td><td> 20</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 35</td>

<td colspan="2">tggaatgtta acgagctgag</td>

<td> &lt;210&gt;</td><td> 36</td>

<td> &lt;211&gt;</td><td> 20</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 36</td>

<td colspan="2">ctcgcagcca tcttggaatg</td>

<td> &lt;210&gt;</td><td> 37</td>

<td> &lt;211&gt;</td><td> 20</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 37</td>

cgcgcgtaat acgactcact 20 &lt;210&gt; 38

117

<td> &lt;211&gt;</td><td> 26</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 38</td>

cctgtctact gctgtgagta ccttgt 26

<td> &lt;210&gt;</td><td> 39</td>

<td> &lt;211&gt;</td><td> 26</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 39</td>

gcagtagaca ggtcactccg ttgtcc 26

<td> &lt;210&gt;</td><td> 40</td>

<td> &lt;211&gt;</td><td> 20</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 40</td>

tggaatgtta actacctcaa 20

<td> &lt;210&gt;</td><td> 41</td>

<td> &lt;211&gt;</td><td> 23</td>

<td> &lt;212&gt;</td><td>DNA</td>

<td> &lt;213&gt;</td><td>Circovirus</td>

<td> &lt;400&gt;</td><td> 41</td>

ggcggcgcca tctgtaacgg ttt 23

<td> &lt;210&gt;</td><td> 42</td>

<td> &lt;211&gt;</td><td> 23</td>

<td> &lt;212&gt;</td><td>DNA</td>

118 &lt;213&gt; Circovirus &lt;400&gt; 42 gatggcgccg aaagacgggt until 2