Circovirus sequences associated with porcine wasting disease (PWD)

The present invention relates to a compound for its use as a medicament comprising a glycosylated polypeptide isolated from circovirus MAP type B. The invention also relates to a compound for its use as a medicament according to the invention, said medicament being an immunogenic composition or a vaccine, for the treatment and / or prevention of infection with circovirus MAP type B.

The description relates to the genomic sequence and to nucleotide sequences encoding circovirus MAP polypeptides, such as the structural and non-structural polypeptides of said circovirus, as well as vectors including said sequences and cells or animals transformed by these vectors. The description also relates to methods for detecting these nucleic acids or polypeptides and to kits for diagnosis of circovirus MAP infection. The description also describes a method for selecting compounds capable of modulating viral infection. The description finally includes pharmaceutical compositions, in particular vaccine compositions, for the prevention and / or treatment of viral infections with circovirus MAP as well as the use of a vector according to the invention for the prevention and / or treatment of diseases by gene therapy. .

Piglet wasting disease (PAD) or also known as piglet wasting (DFP) has been widely described in North America (Harding, JC, 1997), and authors have reported the existence of a relationship between this pathology and the presence of porcine circovirus (Daft, B. et al., 1996; Clark, EG, 1997; Harding, JC, 1997; Harding, JC and Clark, EG, 1997; Nayar, GP et al., 1997) . A porcine circovirus has already been detected in cell cultures derived from pigs established in a line and chronically infected (Tischer, I., 1986, 1988, 1995; Dulac, GC, 1989; Edwards, S., 1994; Allan, GM , 1995 and McNeilly, F., 1996). This virus, during experimental infection of piglets, did not appear to be pathogenic for pigs (Tischer, I., 1986, Homer, GW, 1991) and its nucleotide sequence has been determined and characterized (Tischer, I., 1982; Meehan, BMet al., 1997; Mankertz, A., 1997). The porcine circovirus, called PCV virus, belongs to the genus circovirus of the family of circoviridae (Murphy, FA et al., 1995) whose virion has circular DNA of size between 1.7 and 2.3 kb, DNA which comprises 3 open reading frames (ORF1 to ORF3), coding for a REP replication protein involved in the initiation and termination phase of the rolling circular replication (RCR) (Heyraud-Nitschke, F., et al., 1995; Harding, MR et al., 1993; Hanson, SF et al., 1995; Fontes, EPB et al., 1994), coding for a capsid protein (Boulton, LH et al., 1997; Hackland, AF et al., 1994; Chu, PWG et al., 1993 and coding for a non-structural protein called dissemination (Lazarowitz, SG et al., 1989).

The authors of the present invention have noticed that the clinical manifestations perceptible in pigs and linked to infection with the circovirus MAP, are very individualized. These manifestations generally appear in pigs 8 to 12 weeks of age, weaned for 4 to 8 weeks. The first signs are hypotonia without speaking of prostration. Quickly (48 hours), the flanks widen, the back line is drawn, the pigs "whiten". These signs are generally accompanied by hyperthermia, anorexia and most often by respiratory manifestations (cough, dyspnea, polypnea). Transient diarrhea may also appear. The state phase of the disease lasts for about a month, at the end of which the mortality rates vary from 5 to 20%. To these mortalities should be added a variable proportion (5-10%) of cadaverous animals that can no longer represent an economic future. It should be noted that outside this critical stage at the end of post-weaning, no anomaly appears in the farms. In particular, the reproductive function is perfectly maintained.

On the epidemiological level, the first manifestations of this pathology appeared at the beginning of 1995 in the East of the Côtes d'Armor department in France, and the affected farms are mainly confined to this area of ​​the department. In December 1996, the number of farms concerned could not be assessed with precision because of the absence of a specific diagnostic method in the laboratory or of an epidemiosurveillance system for livestock. Based on the clinical facts and on the results of post mortem examinations provided by veterinarians, this number can be estimated at several tens (80-100). The contagiousness of the disease is low to moderate. Cases are reported outside the initial area and mostly follow the transfer of animals from farms with knowledge of the problem. On the other hand, a peculiarity of the affection is its strong persistence. Thus, farms affected for a year are still concerned despite the massive application of therapeutics. Clinically expressed farms are recruited from different specialization categories (hatchery-fatteners, post-weaners-fatteners) and different economic structures are concerned. In addition, the troubles appear even in farms where the rules of zootechnics are respected.

Numerous post mortem examinations have been carried out either on farms or in the laboratory. The elements of the lesion table are disparate. The most constant gross lesions are pneumonia, which sometimes presents as a checkerboard pattern, as well as an enlarged lymph node. The other lesions mainly concern the thoracic viscera, including pericarditis and pleurisy. But arthritis, gastric ulcers are also observed. The lesions revealed on histological examination are mainly located in the lungs (interstitial pneumonia), lymph nodes (lymphoid depletion of lymph nodes, giant cells) and renal (glomerulonephritis, vasculitis). Infectious agents have been the subject of extensive research. The intervention of pestiviruses and Aujeszky's disease could be excluded. The disorders appear in the herds SDRP (Dysgénésique Syndrome and Respiratory Porcine, infection linked to an arteriovirus) seropositive, but the role of this last in the genesis of the troubles could not be established (the majority of the farms of Brittany are SDRP seropositive) . Meehan's publication <i>et al.,</i> (1998) describes the DNA nucleotide sequence of porcine circovirus isolates and the amino acid sequence prediction of products of the four major ORFs present in the genome of these circoviruses, including ORF2. Among the amino acid sequences:<ul id="ul0001" list-style="dash" compact="compact"><li>the sequence AF055391 comprises a 92% sequence identical to the sequence SEQ ID No. 15,</li><li>the sequence AF055392 comprises a 92% sequence identical to the sequence SEQ ID No. 15,</li><li>the sequence AF055393 comprises a sequence 99% identical to the sequence SEQ ID No. 15, and</li><li>the sequence AF055394 comprises a sequence 98% identical to the sequence SEQ ID No. 15.</li></ul>

However, this publication does not mention the particular importance of the protein encoded by ORF2. This publication does not describe an isolated glycosylated polypeptide of sequence having at least 90% identity with the sequence SEQ ID No. 15, nor does it describe a compound for its use as a medicament comprising an isolated glycosylated polypeptide of sequence having at least minus 90% identity with the sequence SEQ ID N ° 15.

The authors of the present invention, with the aim of identifying the etiological agent responsible for the MAP, carried out "contact" tests between obviously "diseased" piglets and EOPS pigs (Free of Specific Pathogenic Organisms) from CNEVA (National Center for Veterinary and Food Studies, France). These tests made it possible to observe the development in protected animal facilities of events comparable to those observed in breeding. Discreet manifestations such as moderate hyperthermia, anorexia and intermittent diarrhea appeared after a week of contact. It should be noted that the PRRS virus only spread after clinical manifestations. In addition, inoculations of shredded organs from sick animals into healthy pigs made it possible to reproduce manifestations similar to those observed in farms, with, however, a lower incidence linked to the favorable conditions for maintaining animals in the facilities. experimental.

Thus, the authors of the present invention have been able to demonstrate that the pathological manifestations appear as a well-defined entity affecting the pig at a particular stage of its growth.

This pathology has never been described in France. However, scattered information, particularly from Canada, relates related facts.

The disorders cannot be controlled by existing therapies.

The data collected both in breeding and in experimentation made it possible to highlight the following points:<ul id="ul0002" list-style="dash" compact="compact"><li>MAP disease is transmissible but its contagiousness is low,</li><li>its etiological origin is infectious and probably viral,</li><li>MAP disease is persistent in affected farms.</li></ul>

This has considerable economic consequences for farms.

Thus, an important need to date concerns a specific and sensitive diagnosis, of practical and rapid realization, allowing the early detection of the infection. A reliable, sensitive and practical test, which allows the distinction between strains of porcine circovirus (PCV) is therefore highly desirable.

On the other hand, a need for effective and well-tolerated treatment of circovirus MAP infections also remains desired, no vaccine today is available against circovirus MAP.

With regard to the MAP circovirus, it will probably be necessary to understand the role of immune defense in the physiology and pathology of the disease in order to develop satisfactory vaccines.

More detailed information concerning the biology of these strains, their interactions with their hosts, the associated infectivity phenomena and those of escape from the host's immune defenses in particular, and their involvement finally in the development of associated pathologies, will allow a better understanding of these mechanisms. In view of the above and which shows in particular the limitations of the means of combating infection with the circovirus MAP, it is therefore essential today, on the one hand, to develop molecular tools, in particular from a better genetic knowledge of the circovirus MAP, but also to develop new preventive and therapeutic treatments, new diagnostic methods and new specific, effective and tolerated vaccine strategies. This is precisely the object of the present invention.

The present description relates to the nucleotide sequences of the circovirus MAP genome chosen from the sequences SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 9, SEQ ID No. 10 or one of their fragments.

The nucleotide sequences of sequences SEQ ID No. 1 and SEQ ID No. 2 correspond respectively to the genomic sequence of the polarity strand (+) and the polarity strand (-) of circovirus MAP type A (or PCVA), the sequence SEQ ID N ° 2 being represented according to the orientation 5 '→ 3'.

The nucleotide sequences of sequences SEQ ID No. 9 and SEQ ID No. 10 correspond respectively to the genomic sequence of the polarity strand (+) and the polarity strand (-) of circovirus MAP type B (or PCVB) the sequence SEQ ID N ° 10 being represented according to the orientation 5 '→ 3'.

The present description also relates to nucleotide sequences characterized in that they are chosen from:<ol id="ol0001" compact="compact"><li>a) a nucleotide sequence of a specific fragment of a sequence SEQ ID No 1, SEQ ID No 2, SEQ ID No 9, SEQ ID No 10 or one of their fragments;</li><li>b) a nucleotide sequence homologous to a nucleotide sequence as defined in a);</li><li>c) a nucleotide sequence complementary to a nucleotide sequence as defined in a) or b), and a nucleotide sequence of their corresponding RNA;</li><li>d) a nucleotide sequence capable of hybridizing under stringent conditions with a sequence as defined in a), b), or c);</li><li>e) a nucleotide sequence comprising a sequence as defined in a), b), c) or d); and</li><li>f) a nucleotide sequence modified from a nucleotide sequence as defined in a), b), c), d) or e).</li></ol>

The term “nucleotide sequence, polynucleotide or nucleic acid” will be understood, according to the present description, both a double stranded or single stranded DNA in monomeric and dimeric forms (called in tandem) as well as transcription products of said DNAs.

It should be understood that the present description does not relate to the genomic nucleotide sequences taken in their natural environment, that is to say in the natural state. These are sequences which could have been isolated, purified or partially purified, using separation methods such as, for example, ion exchange chromatography, exclusion based on molecular size, or affinity, or fractionation techniques based on solubility in different solvents, or from genetic engineering methods such as amplification, cloning and subcloning, the sequences of the description being able to be carried by vectors.

The nucleotide sequences SEQ ID No. 1 and SEQ ID No. 9 were obtained by genome sequencing by the Sanger method.

The term “nucleotide sequence fragment” according to the description is intended to denote any nucleotide fragment of the circovirus MAP, type A or B, of length at least 8 nucleotides, preferably at least 12 nucleotides, and even more preferably at least 20 consecutive nucleotides of the sequence from which it came.

The term “specific fragment of nucleotide sequence according to the description” is intended to denote any nucleotide fragment of the circovirus MAP, type A or B, having, after alignment and comparison with the corresponding fragments of known porcine circovirus, at least one nucleotide or base of different nature. For example, the specific nucleotide fragments of circovirus MAP type A can easily be determined by referring to the<figref idref="f0009 f0010 f0011">figure 3</figref> of the present description in which the nucleotides or bases of the sequence SEQ ID No. 1 (circopordfp) which are of a different nature are highlighted, after alignment of said sequence SEQ ID No. 1 with the two other sequences of known porcine circovirus (circopormeeh and circopormank).

By homologous nucleotide sequence within the meaning of the present description, is meant a nucleotide sequence having at least a percentage of identity with the bases of a nucleotide sequence according to the description of at least 80%, preferably 90% and 95%, this percentage being purely statistical and the differences between the two nucleotide sequences can be distributed randomly and over their entire length.

By specific homologous nucleotide sequence within the meaning of the present description is meant a homologous nucleotide sequence having at least one nucleotide sequence of specific fragment, as defined above. Said "specific" homologous sequences can comprise, for example, the sequences corresponding to the genomic sequence or to the sequences of its fragments representative of variants of circovirus MAP type A or B. These specific homologous sequences can thus correspond to variations linked to mutations within the strains of circovirus MAP type A and B, and correspond in particular to truncations, substitutions, deletions and / or additions of at least one nucleotide. Said homologous sequences can also correspond to variations linked to the degeneration of the genetic code.

In the present description, the term circovirus MAP will be understood to mean the circoviruses associated with piglet slimming disease (MAP) type A (PCVA) or type B (PCVB), hereinafter defined by their genomic sequence, as well as circoviruses whose nucleic acid sequences are homologous to the sequences of circoviruses MAP type A or B, such as in particular the circoviruses corresponding to variants of type A or of type B.

By nucleotide sequence complementary to a sequence of the description, is meant any DNA whose nucleotides are complementary to those of the sequence of the description, and whose orientation is reversed (antiparallel sequence).

Hybridization under conditions of stringency with a nucleotide sequence according to the description is understood to mean hybridization under conditions of temperature and ionic strength chosen so that they allow hybridization to be maintained between two complementary DNA fragments.

By way of illustration, conditions of high stringency of the hybridization step in order to define the nucleotide fragments described above are advantageously as follows.

Hybridization is carried out at a preferred temperature of 65 ° C. in the presence of SSC buffer, 1 × SSC corresponding to 0.15 M NaCl and 0.05 M Na citrate. The washing steps can, for example, be as follows:<ul id="ul0003" list-style="dash" compact="compact"><li>2 x SSC, at room temperature followed by 2 washes at 2 x SSC, 0.5% SDS at 65 ° C; 2 x 0.5 x SSC, 0.5% SDS; at 65 ° C for 10 minutes each.</li></ul>

The intermediate stringency conditions, for example using a temperature of 42 ° C in the presence of a 2 x SSC buffer, or of low stringency, for example a temperature of 37 ° C in the presence of a 2 x SSC buffer, require respectively for the hybridization between the two sequences a less important overall complementarity.

The stringent hybridization conditions described above for a polynucleotide with a size of about 350 bases, will be adapted by the skilled person for oligonucleotides of larger or smaller size, according to the teaching of Sambrook et al. ., 1989.

Among the nucleotide sequences according to the description, preference is also given to those which can be used as primer or probe in methods making it possible to obtain the homologous sequences according to the description, these methods such as the polymerase chain reaction (PCR), the cloning and the nucleic acid sequencing being well known to those skilled in the art.

Among said nucleotide sequences according to the description, those which can be used as primer or probe are also preferred in methods making it possible to diagnose the presence of circovirus MAP or one of its variants as defined below.

Preference is also given to the nucleotide sequences according to the description capable of modulating, inhibiting or inducing the expression of the circovirus MAP gene, and / or capable of modulating the replication cycle of circovirus MAP in the cell and / or the host organism. The term replication cycle will be understood to mean the invasion, the multiplication of circovirus MAP, and its propagation from host cells to host cells in the host organism.

Among said nucleotide sequences according to the description, finally, those corresponding to open reading frames, called ORF sequences (ORF for "open reading frame"), and coding for polypeptides, such as for example sequences SEQ ID No. 3, are preferred. (ORF1), SEQ ID N ° 4 (ORF2) and SEQ ID N ° 5 (ORF3) corresponding respectively to the nucleotide sequences between positions 47 to 985 determined relative to the position of the nucleotides on the sequence SEQ ID N ° 1, positions 1723 to 1022 and positions 658 to 38 relative to the position of the nucleotides on the sequence SEQ ID No. 2 (shown in the orientation 3 '→ 5'), the ends being included, or the sequences SEQ ID N ° 11 (ORF'1), SEQ ID N ° 12 (ORF'2) and SEQ ID N ° 13 (ORF'3), corresponding respectively to the sequences between positions 51 to 995 determined relative to the position of the nucleotides on the sequence SEQ ID N ° 9, positions 1734 to 1033 and positions 670 to 357, the positions being determined relative to the position of the nucleotides on the sequence SEQ ID No. 10 (shown in the orientation 3 '→ 5'), the ends being understood.

The nucleotide sequence fragments according to the description can be obtained for example by specific amplification, such as PCR, or after digestion with appropriate restriction enzymes of nucleotide sequences according to the description, these methods are in particular described in the book by Sambrook et al., 1989. These representative fragments can also be obtained by chemical synthesis when their size is not too large and according to methods well known to those skilled in the art.

By modified nucleotide sequence is meant any nucleotide sequence obtained by mutagenesis according to techniques well known to those skilled in the art, and comprising modifications with respect to the normal sequences according to the description, for example mutations in the regulatory sequences and / or promoters of the expression of polypeptide, in particular leading to a modification of the level of expression of said polypeptide or to a modulation of the replicative cycle.

The term “modified nucleotide sequence” will also be understood to mean any nucleotide sequence coding for a modified polypeptide as defined below.

The present description relates to nucleotide sequences of circovirus MAP according to the description, characterized in that they are chosen from the sequences SEQ ID N ° 3, SEQ ID N ° 4, SEQ ID N ° 5, SEQ ID N ° 11 , SEQ ID N ° 12, SEQ ID N ° 13 or one of their fragments.

The description also relates to the nucleotide sequences characterized in that they comprise a nucleotide sequence chosen from:<ol id="ol0002" compact="compact"><li>a) a nucleotide sequence SEQ ID No 3, SEQ ID No 4, SEQ ID No 5, SEQ ID No 11, SEQ ID No 12, SEQ ID No 13 or a fragment thereof;</li><li>b) a nucleotide sequence of a fragment specific for a sequence as defined in a);</li><li>c) a homologous nucleotide sequence comprising at least 80% identity with a sequence as defined in a) or b);</li><li>d) a complementary nucleotide or RNA sequence corresponding to a sequence as defined in a), b) or c); and</li><li>e) a nucleotide sequence modified from a sequence as defined in a), b), c), or d).</li></ol>

With regard to the homology with the nucleotide sequences SEQ ID N ° 3, SEQ ID N ° 4, SEQ ID N ° 5, SEQ ID N ° 11, SEQ ID N ° 12, SEQ ID N ° 13 or one of their fragments, the homologous sequences, in particular specific ones, are preferred, having a percentage of identity with one of the sequences SEQ ID N ° 3, SEQ ID N ° 4, SEQ ID N ° 5, SEQ ID N ° 11, SEQ ID N ° 12, SEQ ID No 13 or one of their fragments of at least 80%, preferably 90% and 95%. Said specific homologous sequences can comprise, for example, the sequences corresponding to the sequences ORF1, ORF2, ORF3, ORF'1, ORF'2 and ORF'2 of variant of circovirus MAP type A or type B. These specific homologous sequences can in the same way correspond to variations linked to mutations within strains of circovirus MAP type A or type B and correspond in particular to truncations, substitutions, deletions and / or additions of at least one nucleotide.

Among the nucleotide sequences according to the description, the sequence SEQ ID No. 11 which prefers a homology comprising more than 80% identity with the sequence SEQ ID No. 3, as well as the sequence SEQ ID No. 12, is particularly preferred.

Preferably, the description relates to the nucleotide sequences according to the description, characterized in that they comprise a nucleotide sequence chosen from the following sequences:<ol id="ol0003" compact="compact"><li>a) 170 5'TGTGGCGA 3 ';</li><li>b) 450 5 'AGTTTCCT 3';</li><li>c) 1026 5 'TCATTTAGAGGGTCTTTCAG 3';</li><li>d) 1074 5 'GTCAACCT 3';</li><li>e) 1101 5 'GTGG<u>T</u>TGC 3 ';</li><li>f) 1123 5 'AGCCCAGG 3';</li><li>g) 1192 5 'TTGG<u>VS</u>TGG 3 ';</li><li>h) 1218 5 'TCTAGCTCTGGT 3';</li><li>i) 1501 5 'ATCTCAGCTCGT 3';</li><li>j) 1536 5 'T<u>G</u>TCCTCCT<u>VS</u>TT 3 ';</li><li>k) 1563 5 'TCTCTAGA 3';</li><li>l) 1632 5 'TGTACCAA 3';</li><li>m) 1686 5 'TCCGTCTT 3'; and their complementary sequence.</li></ol>

In the list of nucleotide sequences a) -m) above, the underlined nucleotides are mutated with respect to the two known sequences of circoviruses which are not pathogenic for pigs. The number preceding the nucleotide sequence represents the position of the first nucleotide of said sequence on the sequence SEQ ID No. 1.

The subject of the present invention is a compound for its use as a medicament comprising an isolated glycosylated polypeptide of sequence having at least 90% identity with the sequence SEQ ID No. 15.

The description includes the polypeptides coded by a nucleotide sequence according to the description, preferably a polypeptide whose sequence is represented by a fragment, in particular specific, of one of the 6 amino acid sequences represented in the <figref idref="f0002 f0003 f0004 f0005 f0006 f0007 f0008">figure 2</figref>, these 6 amino acid sequences corresponding to the polypeptides which can be coded according to one of the 3 possible reading frames of the sequence SEQ ID No. 1 or of the sequence SEQ ID No. 2, or a polypeptide whose sequence is represented by a fragment, in particular specific, of one of the 6 amino acid sequences shown in the <figref idref="f0015 f0016 f0017 f0018 f0019 f0020 f0021">figure 8</figref>, these 6 amino acid sequences corresponding to the polypeptides which can be coded according to one of the 3 possible reading frames of the sequence SEQ ID No. 9 or of the sequence SEQ ID No. 10.

The subject of the invention is the polypeptides characterized in that they comprise an amino acid sequence polypeptide SEQ SEQ ID No. 15.

The description relates to the polypeptides characterized in that they comprise a polypeptide chosen from the amino acid sequences SEQ ID N ° 6, SEQ ID N ° 7, SEQ ID N ° 8, SEQ ID N ° 14, SEQ ID N ° 16 or a fragment thereof, or a fragment of the polypeptide of sequence SEQ ID No. 15.

Among the polypeptides according to the description, the polypeptide of amino acid sequence SEQ ID No. 14 which has a homology comprising more than 80% of identity with the sequence SEQ ID No. 6 is particularly preferred.

The description also relates to the polypeptides characterized in that they comprise a polypeptide chosen from:<ol id="ol0004" compact="compact"><li>a) a specific fragment of at least 5 amino acids of an amino acid sequence polypeptide according to the description;</li><li>b) a polypeptide homologous to a polypeptide as defined in a);</li><li>c) a specific biologically active fragment of a polypeptide as defined in a) or b); and</li><li>d) a modified polypeptide of a polypeptide as defined in a), b) or c).</li></ol>

Among the polypeptides according to the description, the polypeptides of amino acid sequences SEQ ID No 17, SEQ ID No 18, SEQ ID No 19 and SEQ ID No 20 are more preferred, these polypeptides being in particular capable of recognizing specifically the antibodies produced during infection by circovirus MAP type B. These polypeptides thus present specific epitopes of the circovirus MAP type B and can therefore in particular be used in the diagnostic field or as an immunogenic agent to confer protection in pigs against infection by circovirus MAP, in particular type B.

In the present description, the terms polypeptide, peptide and protein are interchangeable.

It should be understood that the invention does not relate to polypeptides in natural form, that is to say that they are not taken in their natural environment but that they could have been isolated or obtained by purification from natural sources, or else obtained by genetic recombination, or else by chemical synthesis and that they can then contain non-natural amino acids, as will be described below.

By polypeptide fragment according to the description is intended to denote a polypeptide comprising at least 5 amino acids, preferably 10 amino acids and 15 amino acids.

By specific fragment of polypeptide is meant in the present description a fragment of polypeptide encoded by a nucleotide sequence of specific fragment according to the description.

The term “homologous polypeptide” is intended to denote the polypeptides having, with respect to the natural polypeptide, certain modifications such as in particular a deletion, addition or substitution of at least one amino acid, a truncation, an elongation, a chimeric fusion, and / or a mutation. Among the homologous polypeptides, those whose amino acid sequence has at least 80%, preferably 90%, of homology with the amino acid sequences of the polypeptides according to the invention are preferred .

The term “specific homologous polypeptide” is intended to denote the homologous polypeptides as defined above and having a specific fragment of polypeptide according to the description.

In the case of a substitution, one or more consecutive or non-consecutive amino acids are replaced by "equivalent" amino acids. The term “equivalent” amino acid is intended here to denote any amino acid capable of being substituted for one of the amino acids of the basic structure without, however, essentially modifying the biological activities of the corresponding peptides and as defined by the following.

These equivalent amino acids can be determined either on the basis of their structural homology with the amino acids for which they are substituted, or on results of comparative tests of biological activity between the various polypeptides capable of being carried out.

By way of example, mention will be made of the possibilities of substitutions which may be carried out without resulting in an in-depth modification of the biological activity of the corresponding modified polypeptides, the replacements, for example, of leucine by valine or l isoleucine, aspartic acid by glutamic acid, glutamine by asparagine, arginine by lysine etc., the reverse substitutions being naturally possible under the same conditions.

The specific homologous polypeptides also correspond to the polypeptides coded by the specific homologous nucleotide sequences as defined above and thus include in this definition the mutated polypeptides or corresponding to variants, which may exist in circovirus MAP, and which correspond in particular to truncations, substitutions , deletions and / or additions of at least one amino acid residue.

The term “biologically active specific fragment of a polypeptide according to the invention” is intended to denote in particular a specific fragment of polypeptide, as defined above, having at least one of the characteristics of the polypeptides according to the invention, in particular in that he is :<ul id="ul0004" list-style="dash" compact="compact"><li>capable of inducing an immunogenicity reaction directed against a MAP circovirus; and or</li><li>capable of being recognized by an antibody specific for a polypeptide according to the description; and or</li><li>capable of binding to a polypeptide or a nucleotide sequence of circovirus MAP; and or</li><li>capable of exercising a physiological activity, even partial, such as for example a dissemination or structural activity (capsid); and or</li><li>capable of modulating, inducing or inhibiting the expression of the circovirus MAP gene or one of its variants, and / or capable of modulating the replication cycle of circovirus MAP in the host cell and / or organism .</li></ul>

The polypeptide fragments according to the description can correspond to isolated or purified fragments naturally present in a circovirus MAP or correspond to fragments which can be obtained by cleavage of said polypeptide by a proteolytic enzyme, such as trypsin or chymotrypsin or collagenase, or by a chemical reagent, such as cyanogen bromide (CNBr) or by placing said polypeptide in a very acidic environment, for example at pH 2.5. Such polypeptide fragments can also be prepared indifferently by chemical synthesis, from hosts transformed by an expression vector according to the description containing a nucleic acid allowing the expression of said fragments, placed under the control of regulatory elements and / or appropriate expression.

By "modified polypeptide" of a polypeptide according to the invention is meant a polypeptide obtained by genetic recombination or by chemical synthesis as will be described below, having at least one modification with respect to the normal sequence. These modifications may in particular relate to amino acids at the origin of a specificity, of the pathogenicity and / or of virulence, or at the origin of the structural conformation, and of the membrane insertion capacity of the polypeptide according to the invention. It will thus be possible to create polypeptides of equivalent, increased or decreased activity, and of equivalent specificity, narrower or wider. Among the modified polypeptides, mention should be made of the polypeptides in which up to 5 amino acids can be modified, truncated at the N- or C-terminal end, or else deleted, or else added.

As indicated, the modifications of the polypeptide will in particular aim:<ul id="ul0005" list-style="dash" compact="compact"><li>to make it capable of modulating, inhibiting or inducing the expression of the circovirus MAP gene and / or capable of modulating the replication cycle of circovirus MAP in the cell and / or the host organism,</li><li>to allow its incorporation into vaccine compositions,</li><li>to modify its bioavailability as a compound for therapeutic use.</li></ul>

The methods making it possible to demonstrate said modulations on eukaryotic or prokaryotic cells are well known to those skilled in the art. It is also understood that the nucleotide sequences coding for said modified polypeptides could be used for said modulations, for example by means of vectors according to the description and described below, in order, for example, to prevent or treat pathologies linked to infection.

The preceding modified polypeptides can be obtained using combinatorial chemistry, in which it is possible to systematically vary parts of the polypeptide before testing them on models, cell cultures or microorganisms for example, to select the most suitable compounds. active or having the desired properties.

Chemical synthesis also has the advantage of being able to use:<ul id="ul0006" list-style="dash" compact="compact"><li>unnatural amino acids, or</li><li>non-peptide bonds.</li></ul>

Thus, in order to improve the lifetime of the polypeptides according to the invention, it may be advantageous to use non-natural amino acids, for example in D form, or else amino acid analogs, in particular sulfur-containing forms. example.

Finally, the structure of the polypeptides according to the invention, its specific or modified homologous forms, may be integrated into chemical structures of the polypeptide or other type. Thus, it may be advantageous to provide at the Net C-terminal ends of compounds not recognized by the proteases.

Also included in the description are the nucleotide sequences coding for a polypeptide according to the invention.

The description also relates to nucleotide sequences which can be used as primer or probe, characterized in that said sequences are chosen from the nucleotide sequences according to the description.

Among the pairs of nucleotide sequences which can be used as a pair of primers according to the description, the pairs of primers chosen from the following pairs are preferred:<ol id="ol0005" compact="compact"><li>a) 5 'GTG TGC TCG ACA TTG GTG TG 3', and 5 'TGG AAT GTT AAC GAG CTG AG 3';</li><li>b) 5 'GTG TGC TCG ACA TTG GTG TG 3', and 5 'CTC GCA GCC ATC TTG GAA TG 3';</li><li>c) 5 'CGC GCG TAA TAC GAC TCA CT 3', and 5 'GTG TGC TCG ACA TTG GTG TG 3';</li><li>d) 5 'CGC GCG TAA TAC GAC TCA CT 3', and 5 'CTC GCA GCC ATC TTG GAA TG 3'; and</li><li>e) 5 'CCT GTC TAC TGC TGT GAG TAC CTT GT 3', and 5 'GCA GTA GAC AGG TCA CTC CGT TGT CC 3'.</li></ol>

The cloning and sequencing of circovirus MAP, type A and B, made it possible to identify, after comparative analysis with the nucleotide sequences of the other porcine circoviruses, which of the sequences of fragments of these nucleic acids were those which are strictly specific for the circovirus MAP type A, type B or type A and B, and those which correspond to a consensus sequence of porcine circoviruses other than circovirus MAP type A and / or B.

There is also a great need to be able to have nucleotide sequences which can be used as primer or probe specific for the set of other known and non-pathogenic porcine circoviruses.

These said consensus nucleotide sequences specific for the set of circoviruses, other than circovirus MAP types A and B, are easily identifiable from the <figref idref="f0009 f0010 f0011">figure 3</figref> and of the sequence SEQ ID No. 9, and form part of the description.

Among these said consensus nucleotide sequences, the one characterized in that it is part of the following pair of primers is preferred:<ol id="ol0006" compact="compact"><li>a) 5 'GTG TGC TCG ACA TTG GTG TG 3', and 5 'TGG AAT GTT AAC TAC CTC AA 3'.</li></ol>

The description also includes a nucleotide sequence according to the description, characterized in that said sequence is a specific consensus sequence of porcine circovirus other than circovirus MAP type B and in that it is one of the primers of the following pair of primers :<ol id="ol0007" compact="compact"><li>a) 5 'GGC GGC GCC ATC TGT AAC GGT TT 3', and 5 'GAT GGC GCC GAA AGA CGG GTA TC 3'.</li></ol>

It is understood that the present description also relates to the specific polypeptides of known porcine circoviruses other than circovirus MAP, encoded by said consensus nucleotide sequences, capable of being obtained by purification from natural polypeptides, by genetic recombination or by synthesis chemical by methods well known to those skilled in the art and as described in particular below. Likewise, mono or polyclonal antibodies, labeled or unlabeled, directed against said specific polypeptides encoded by said consensus nucleotide sequences, also form part of the description.

Said consensus nucleotide sequences, said corresponding polypeptides as well as said antibodies directed against said polypeptides, may be used in methods or kits for detection and / or identification as described below, in place of or in addition to nucleotide sequences, polypeptides or antibodies according to the description, specific for circovirus MAP type A and / or B.

These protocols have been improved to differentially detect circular monomeric forms of specific replicative forms of the virion or DNA in replication and the dimeric forms found in so-called tandem molecular constructions.

The description also relates to the use of a nucleotide sequence according to the description, as a primer or probe, for the detection and / or the amplification of nucleic acid sequences.

The nucleotide sequences according to the description can thus be used to amplify nucleotide sequences, in particular by the PCR technique (polymerase chain reaction) (Erlich, 1989; Innis et al., 1990; Rolfs et al., 1991; and White et al., 1997).

These oligodeoxyribonucleotide or oligo-ribonucleotide primers advantageously have a length of at least 8 nucleotides, preferably at least 12 nucleotides, and even more preferably at least 20 nucleotides.

Other techniques for amplifying the target nucleic acid can advantageously be used as alternatives to PCR.

The nucleotide sequences of the description, in particular the primers according to the description, can also be used in other methods of amplification of a target nucleic acid, such as:<ul id="ul0007" list-style="dash" compact="compact"><li>the TAS (Transcription-based Amplification System) technique, described by Kwoh et al. in 1989;</li><li>the 3SR (Self-Sustained Sequence Replication) technique, described by Guatelli et al. in 1990 ;</li><li>the NASBA (Nucleic Acid Sequence Based Amplification) technique, described by Kievitis et al. in 1991;</li><li>the SDA (Strand Displacement Amplification) technique or strand displacement amplification technique (Walker et al., 1992);</li><li>the TMA (Transcription Mediated Amplification) technique.</li></ul>

The polynucleotides of the description can also be used in techniques for amplification or modification of the nucleic acid serving as a probe, such as:<ul id="ul0008" list-style="dash" compact="compact"><li>the LCR (Ligase Chain Reaction) technique, described by Landegren et al. in 1988 and perfected by Barany et al. in 1991, which used a thermostable ligase;</li><li>the RCR (Repair Chain Reaction) technique, described by Segev in 1992;</li><li>the CPR (Cycling Probe Reaction) technique, described by Duck et al. in 1990 ;</li><li>the Q-beta-replicase amplification technique, described by Miele et al. in 1983 and improved in particular by Chu et al. in 1986, Lizardi et al. in 1988, then by Burg et al., as well as by Stone et al. in 1996.</li></ul>

In the event that the target polynucleotide to be detected is optionally an RNA, for example an mRNA, it is possible to use, prior to the implementation of an amplification reaction using at least one primer according to the description or the implementation of a detection method using at least one probe of the description, an enzyme of reverse transcriptase type in order to obtain a cDNA from the RNA contained in the biological sample. The cDNA obtained will then serve as a target for the primer (s) or the probe (s) used in the amplification or detection method according to the description.

The detection probe will be chosen in such a way that it hybridizes with the target sequence or the amplicon generated from the target sequence. Such a detection probe will advantageously have for sequence a sequence of at least 12 nucleotides, in particular of at least 20 nucleotides, and preferably of at least 100 nucleotides.

The description also includes the nucleotide sequences which can be used as probe or primer according to the description, characterized in that they are labeled with a radioactive compound or with a non-radioactive compound.

The unlabeled nucleotide sequences can be used directly as probes or primers, however the sequences are generally labeled with a radioactive element (³²P, ³⁵S, ³H, ¹²⁵I) or with a non-radioactive molecule (biotin, acetylaminofluorene, digoxigenin, 5-bromo-deoxyuridine, fluorescein) to obtain probes which can be used for numerous applications.

Examples of non-radioactive labeling of nucleotide sequences are described, for example, in French patent N ° <patcit id="pcit0001" dnum="FR7810975"><text>78.10975</text></patcit> or by Urdea et al. or by Sanchez-Pescador et al. in 1988.

In the latter case, one of the marking methods described in the patents may also be used. <patcit id="pcit0002" dnum="FR2422956"><text>FR-2 422 956</text></patcit> and <patcit id="pcit0003" dnum="FR2518755"><text>FR-2 518 755</text></patcit>.

The hybridization technique can be carried out in various ways (Matthews et al., 1988). The most general method consists in immobilizing the nucleic acid extracted from the cells on a support (such as nitro-cellulose, nylon, polystyrene) and in incubating, under well defined conditions, the target nucleic acid immobilized with the probe. After hybridization, the excess probe is eliminated and the hybrid molecules formed are detected by the appropriate method (measurement of radioactivity, fluorescence or enzymatic activity linked to the probe).

The description also includes the nucleotide sequences according to the description, characterized in that they are immobilized on a support, covalently or non-covalently.

According to another advantageous embodiment of the nucleotide sequences according to the description, the latter can be used immobilized on a support and thus serve to capture by specific hybridization the target nucleic acid obtained from the biological sample to be tested. If necessary, the solid support is separated from the sample and the hybridization complex formed between the so-called capture probe and the target nucleic acid is then detected using a second probe, called the detection probe, marked with an element easily. detectable.

Another object of the present description is a vector for the cloning and / or expression of a sequence, characterized in that it contains a nucleotide sequence according to the description.

The vectors according to the description, characterized in that they comprise the elements allowing the expression and / or the secretion of said nucleotide sequences in a determined host cell, also form part of the description.

The vector must then include a promoter, translation initiation and termination signals, as well as appropriate regions for transcription regulation. It must be able to be maintained stably in the host cell and may possibly have specific signals specifying the secretion of the translated protein. These different elements are chosen according to the cell host used. To this end, the nucleotide sequences according to the description can be inserted into vectors with autonomous replication within the chosen host, or integrative vectors of the chosen host.

Such vectors will be prepared according to the methods commonly used by those skilled in the art, and the resulting clones may be introduced into an appropriate host by standard methods, such as for example lipofection, electroporation, thermal shock.

The vectors according to the description are for example vectors of plasmid or viral origin.

A preferred vector for the expression of the polypeptides of the description is baculovirus.

Preference is also given to the vector pBS KS into which the DNA sequence in tandem of the circovirus MAP type A (or DFP) is inserted and as deposited at the CNCM on July 3, 1997, under the number I-1891.

These vectors are useful for transforming host cells in order to clone or express the nucleotide sequences of the description.

The description also includes the host cells transformed by a vector according to the description.

These cells can be obtained by introducing into host cells a nucleotide sequence inserted into a vector as defined above, then culturing said cells under conditions allowing replication and / or expression of the transfected nucleotide sequence.

The cell host can be chosen from prokaryotic or eukaryotic systems, such as for example bacterial cells (Olins and Lee, 1993), but also yeast cells (Buckholz, 1993), as well as animal cells, in particular cultures of mammalian cells (Edwards and Aruffo, 1993), and in particular Chinese hamster ovary cells (CHO), but also insect cells in which methods using baculoviruses can be used, for example (Luckow, 1993).

A preferred host cell for the expression of the proteins of the description consists of the insect cells sf9.

A more preferred host cell according to the description is E-coli, as deposited at the CNCM on July 3, 1997, under the number I-1891.

The description also relates to animals, comprising one of said cells transformed according to the description.

Obtaining transgenic animals according to the description overexpressing one or more of the circovirus MAP genes or part of genes will preferably be carried out on rats, mice or rabbits according to methods well known to those skilled in the art. such as by transfection, viral or non-viral. Transgenic animals overexpressing one or more of said genes can be obtained by transfection of multiple copies of said genes under the control of a powerful promoter of ubiquitous nature, or selective for a type of tissue. Transgenic animals can also be obtained by homologous recombination on embryonic stem cells, transfer of these stem cells to embryos, selection of the affected chimeras at the level of the reproductive lines, and growth of said chimeras.

The transformed cells as well as the transgenic animals according to the description can be used in processes for the preparation of recombinant polypeptide.

It is now possible to produce recombinant polypeptides in relatively large quantities by genetic engineering by using cells transformed by expression vectors according to the description or by using transgenic animals according to the description.

The methods for preparing a polypeptide of the description in recombinant form, characterized in that they use a vector and / or a cell transformed by a vector according to the description and / or a transgenic animal comprising one of said cells transformed according to the description, are themselves included in the present description.

Among said methods for preparing a polypeptide of the description in recombinant form, preference is given to methods of preparation using a vector, and / or a cell transformed by said vector and / or a transgenic animal comprising one of said transformed cells, containing a nucleotide sequence according to the description coding for a circovirus MAP polypeptide.

The recombinant polypeptides obtained as indicated above can be both in glycosylated and non-glycosylated form and may or may not have the natural tertiary structure.

A preferred variant consists in producing a recombinant polypeptide fused to a "carrier" protein (chimeric protein). The advantage of this system is that it allows stabilization and a decrease in the proteolysis of the recombinant product, an increase in the solubility during the in vitro renaturation and / or a simplification of the purification when the fusion partner has a affinity for a specific ligand.

More particularly, the description relates to a process for preparing a polypeptide of the description comprising the following steps:<ol id="ol0008" compact="compact"><li>a) culturing the transformed cells under conditions allowing the expression of a recombinant polypeptide of nucleotide sequence according to the description;</li><li>b) where appropriate, recovery of said recombinant polypeptide.</li></ol>

When the process for preparing a polypeptide of the description implements a transgenic animal according to the description, the recombinant polypeptide is then extracted from said animal.

The description also relates to a polypeptide capable of being obtained by a process of the description as described above.

The description also includes a process for preparing a synthetic polypeptide, characterized in that it uses an amino acid sequence of polypeptides according to the description.

The description also relates to a synthetic polypeptide obtained by a method according to the description.

The polypeptides according to the description can also be prepared by conventional techniques, in the field of peptide synthesis. This synthesis can be carried out in homogeneous solution or in solid phase.

For example, we will use the synthesis technique in homogeneous solution described by Houbenweyl in 1974.

This synthesis method consists in successively condensing two by two the successive amino acids in the required order, or in condensing amino acids and fragments previously formed and already containing several amino acids in the appropriate order, or several fragments previously as well. prepared, it being understood that care has been taken beforehand to protect all the reactive functions carried by these amino acids or fragments, with the exception of the amine functions of one and the carboxyl functions of the other or vice versa, which should normally intervene in the formation of peptide bonds, in particular after activation of the carboxyl function, according to the methods well known in the synthesis of peptides.

According to another preferred technique of the description, use is made of that described by Merrifield.

To manufacture a peptide chain according to the Merrifield method, use is made of a very porous polymer resin, on which the first C-terminal amino acid of the chain is fixed. This amino acid is attached to a resin through its carboxylic group and its amine function is protected. One fixes thus, one after the other, the amino acids which will constitute the peptide chain on the amine group each time deprotected beforehand from the portion of the peptide chain already formed, and which is attached to the resin. When the entire desired peptide chain is formed, the protective groups of the various amino acids constituting the peptide chain are removed and the peptide is detached from the resin using an acid.

The description also relates to hybrid polypeptides having at least one polypeptide according to the description, and a sequence of a polypeptide capable of inducing an immune response in humans or animals.

Advantageously, the antigenic determinant is such that it is capable of inducing a humoral and / or cellular response.

Such a determinant may comprise a polypeptide according to the invention in glycosylated form used for obtaining immunogenic compositions capable of inducing the synthesis of antibodies directed against multiple epitopes. Said polypeptides or their glycosylated fragments also form part of the invention.

These hybrid molecules can consist in part of a molecule carrying polypeptides or their fragments according to the description, associated with a possibly immunogenic part, in particular an epitope of diphtheria toxin, tetanus toxin, a surface antigen of the virus. hepatitis B (patent <patcit id="pcit0004" dnum="FR7921811"><text>FR 79 21811</text></patcit>), the polio virus VP1 antigen or any other toxin or viral or bacterial antigen.

The methods of synthesis of the hybrid molecules include the methods used in genetic engineering to construct hybrid nucleotide sequences coding for the polypeptide sequences sought. We can, for example, advantageously refer to the technique for obtaining genes coding for fusion proteins described by Minton in 1984.

Said hybrid nucleotide sequences coding for a hybrid polypeptide as well as the hybrid polypeptides according to the description, characterized in that they are recombinant polypeptides obtained by the expression of said hybrid nucleotide sequences, also form part of the description.

The description also includes the vectors characterized in that they contain one of said hybrid nucleotide sequences. The host cells transformed by said vectors, the transgenic animals comprising one of said transformed cells as well as the methods for preparing recombinant polypeptides using said vectors, said transformed cells and / or said transgenic animals are of course also part of the description.

The polypeptides according to the description, the antibodies according to the description described below and the nucleotide sequences according to the description can advantageously be used in methods for the detection and / or identification of circovirus MAP, or of porcine circovirus other than '' a MAP circovirus, in a biological sample (tissue or biological fluid) likely to contain them. These methods, according to the specificity of the polypeptides, antibodies and nucleotide sequences according to the description which will be used, may in particular detect and / or identify a circovirus MAP or a porcine circovirus other than a circovirus MAP or other than the circovirus MAP of type B.

The polypeptides according to the description can advantageously be used in a method for the detection and / or identification of circovirus MAP type A, type B, type A or B, of porcine circovirus other than circovirus MAP type B, or of porcine circovirus other than the circovirus MAP type A or B, in a biological sample (tissue or biological fluid) capable of containing them, characterized in that it comprises the following stages:<ol id="ol0009" compact="compact"><li>a) bringing this biological sample into contact with a polypeptide or one of its fragments according to the description (under conditions allowing an immunological reaction between said polypeptide and the antibodies possibly present in the biological sample);</li><li>b) highlighting of the antigen-antibody complexes possibly formed.</li></ol>

In the present description, the term “circovirus MAP”, unless a particular mention is indicated, will mean a circovirus MAP type A or type B, and by porcine circovirus other than MAP, unless a specific mention is indicated, a porcine circovirus other than a MAP circovirus type A and B.

Preferably, the biological sample consists of a fluid, for example a pig serum, whole blood or biopsies.

Any conventional procedure can be used to carry out such a detection of the antigen-antibody complexes that may be formed.

By way of example, a preferred method involves immunoenzymatic processes according to the ELISA technique, by immunofluorescence, or radio-immunological logic (RIA) or equivalent.

Thus, the description also relates to the polypeptides according to the description, labeled using an adequate marker such as the enzymatic, fluorescent, radioactive type.

Such methods include, for example, the following steps:<ul id="ul0009" list-style="dash" compact="compact"><li>depositing determined quantities of a polypeptide composition according to the description into the wells of a microtiter plate,</li><li>introduction into said wells of increasing dilutions of serum, or of other biological sample as defined above, to be analyzed,</li><li>microplate incubation,</li><li>introduction into the wells of the micro-titration plate of labeled antibodies directed against porcine immunoglobulins, the labeling of these antibodies having been carried out using an enzyme selected from those capable of hydrolyzing a substrate in modifying the radiation absorption of the latter, at least at a determined wavelength, for example at 550 nm,</li><li>detection, in comparison with a control witness, of the quantity of hydrolyzed substrate.</li></ul>

The description also relates to a kit or kit for the detection and / or identification of circovirus MAP, porcine circovirus other than a circovirus MAP or porcine circovirus other than circovirus MAP type B, characterized in that it comprises the following elements :<ul id="ul0010" list-style="dash" compact="compact"><li>a polypeptide according to the description,</li><li>where appropriate, the reagents for constituting the medium suitable for the immunological or specific reaction,</li><li>where appropriate, the reagents allowing the detection of the antigen-antibody complexes produced by the immunological reaction between the polypeptide (s) of the description and the antibodies possibly present in the biological sample, these reagents can also carry a marker, or be capable of '' be recognized in turn by a labeled reagent, more particularly in the case where the polypeptide according to the description is not labeled,</li><li>where appropriate, a reference biological sample (negative control) devoid of antibodies recognized by a polypeptide according to the description,</li><li>where appropriate, a reference biological sample (positive control) containing a predetermined quantity of antibodies recognized by a polypeptide according to the description.</li></ul>

The polypeptides according to the description make it possible to prepare monoclonal or polyclonal antibodies characterized in that they specifically recognize the polypeptides according to the invention. The monoclonal antibodies can advantageously be prepared from hybridomas according to the technique described by Kohler and Milstein in 1975. The polyclonal antibodies may be prepared, for example, by immunization of an animal, in particular a mouse, with a polypeptide according to the invention or a DNA according to the description, associated with an adjuvant of the immune response, then purification of the specific antibodies contained in the serum of animals immunized on an affinity column to which the polypeptide having served as an antigen has previously been fixed. The polyclonal antibodies according to the description can also be prepared by purification, on an affinity column, on which a polypeptide according to the description has previously been immobilized, of the antibodies contained in the serum of pigs infected with a circovirus MAP.

The description also relates to mono or polyclonal antibodies or their fragments, or chimeric antibodies, characterized in that they are capable of specifically recognizing a polypeptide according to the description.

The antibodies of the description may also be labeled in the same manner as described above for the nucleic probes of the description, such as labeling of the enzymatic, fluorescent or radioactive type.

The description also relates to a method for the detection and / or identification of circovirus MAP, of porcine circovirus other than a circovirus MAP, or other than circovirus MAP type B, in a biological sample, characterized in that it includes the following stages:<ol id="ol0010" compact="compact"><li>a) bringing the biological sample (tissue or biological fluid) into contact with a mono or polyclonal antibody according to the description (under conditions allowing an immunological reaction between said antibodies and the polypeptides of circovirus MAP, of porcine circovirus other than circovirus MAP, porcine circovirus other than circovirus MAP type B, possibly present in the biological sample);</li><li>b) highlighting of the antigen-antibody complex possibly formed. Also included in the description is a kit or kit for the detection and / or identification of circovirus MAP, porcine circovirus other than a circovirus MAP or porcine circovirus other than circovirus MAP type B, characterized in what it includes the following:<ul id="ul0011" list-style="dash" compact="compact"><li>a polyclonal or monoclonal antibody according to the description, optionally labeled;</li><li>where appropriate, a reagent for the constitution of the medium suitable for carrying out the immunological reaction;</li><li>where appropriate, a reagent allowing the detection of antigen-antibody complexes produced by the immunological reaction, this reagent can also carry a marker, or be capable of being recognized in turn by a labeled reagent, more particularly in the case where said monoclonal or polyclonal antibody is not labeled;</li><li>if necessary, reagents for carrying out the lysis of the cells of the test sample.</li></ul></li></ol>

The present description also relates to a method for the detection and / or identification of MAP, of porcine circovirus other than a circovirus MAP or of porcine circovirus other than circovirus MAP type B, in a biological sample, characterized in which it implements a nucleotide sequence according to the description.

More particularly, the description relates to a method for the detection and / or identification of circovirus MAP, of porcine circovirus other than a circovirus MAP or of porcine circovirus other than circovirus MAP type B, in a biological sample, characterized in what it involves the following steps:<ol id="ol0011" compact="compact"><li>a) if necessary, isolation of the DNA from the biological sample to be analyzed;</li><li>b) specific amplification of the DNA of the sample using at least one primer, or a pair of primers, according to the description;</li><li>c) highlighting of the amplification products.</li></ol>

These can be detected for example by the molecular hybridization technique using a nucleic probe as described. This probe will advantageously be marked by a non-radioactive (cold probe) or radioactive element.

For the purposes of the present description, the expression "DNA from the biological sample" or "DNA contained in the biological sample" means either the DNA present in the biological sample considered, or possibly the cDNA obtained after action of an enzyme of reverse transcriptase type on the RNA present in said biological sample.

Another object of the present description consists of a method according to the description, characterized in that it comprises the following steps:<ol id="ol0012" compact="compact"><li>a) bringing a nucleotide probe according to the description into contact with a biological sample, the DNA contained in the biological sample having, if necessary, previously been made accessible for hybridization, under conditions allowing the hybridization of the sample DNA probe;</li><li>b) demonstration of the hybrid formed between the nucleotide probe and the DNA of the biological sample.</li></ol>

The present description also relates to a method according to the description, characterized in that it comprises the following steps:<ol id="ol0013" compact="compact"><li>a) bringing a nucleotide probe immobilized on a support according to the description into contact with a biological sample, the DNA of the sample having, where appropriate, been made available beforehand for hybridization, under conditions allowing hybridization of the probe to the sample DNA;</li><li>b) bringing the hybrid formed between the nucleotide probe immobilized on a support and the DNA contained in the biological sample, if necessary after removing the DNA from the biological sample which has not hybridized with the probe, with a nucleotide probe labeled according to the description;</li><li>c) highlighting of the new hybrid formed in step b).</li></ol>

According to an advantageous embodiment of the method for detection and / or identification defined above, it is characterized in that, prior to step a), the DNA of the biological sample is previously amplified using at least one primer according to the description.

The description further relates to a kit or kit for the detection and / or identification of circovirus MAP, porcine circovirus other than circovirus MAP or porcine circovirus other than circovirus MAP type B, characterized in that it comprises the following elements :<ol id="ol0014" compact="compact"><li>a) a nucleotide probe according to the description;</li><li>b) where appropriate, the reagents necessary for carrying out a hybridization reaction;</li><li>c) where appropriate, at least one primer according to the description as well as the reagents necessary for a DNA amplification reaction.</li></ol>

The description also relates to a kit or kit for the detection and / or identification of circovirus MAP, porcine circovirus other than a circovirus MAP or porcine circovirus other than circovirus MAP type B, characterized in that it comprises the following elements :<ol id="ol0015" compact="compact"><li>a) a nucleotide probe, called capture probe, according to the description;</li><li>b) an oligonucleotide probe, called the revelation probe, according to the description;</li><li>c) where appropriate, at least one primer according to the description as well as the reagents necessary for a DNA amplification reaction.</li></ol>

The description also relates to a kit or kit for the detection and / or identification of circovirus MAP, porcine circovirus other than a circovirus MAP or porcine circovirus other than circovirus MAP type B, characterized in that it includes the following:<ol id="ol0016" compact="compact"><li>a) at least one primer according to the description;</li><li>b) if appropriate, the reagents necessary to carry out a DNA amplification reaction;</li><li>c) where appropriate, a component making it possible to verify the sequence of the amplified fragment, more particularly an oligonucleotide probe according to the invention.</li></ol>

The description also relates to the use of a nucleotide sequence according to the description, of a polypeptide according to the description, of an antibody according to the description, of a cell according to the description, and / or of an animal transformed according to the description, for the selection of organic or inorganic compound capable of modulating, inducing or inhibiting the expression of genes, and / or modify cellular replication of circovirus MAP or capable of inducing or inhibiting pathologies linked to infection with a circovirus MAP.

The description also includes a method of selecting compounds capable of binding to a polypeptide or a fragment thereof according to the description, capable of binding to a nucleotide sequence according to the description, or capable of recognizing an antibody according to the description, and / or capable of modulating, inducing or inhibiting the expression of genes, and / or modify the cellular replication of circovirus MAP or capable of inducing or inhibiting pathologies linked to an infection with a circovirus MAP, characterized in that it comprises the following stages:<ol id="ol0017" compact="compact"><li>a) bringing said compound into contact with said polypeptide, said nucleotide sequence, with a cell transformed according to the description and / or administration of said compound to an animal transformed according to the description;</li><li>b) determination of the capacity of said compound to bind with said polypeptide or said nucleotide sequence, or to modulate, induce or inhibit the expression of genes, or to modulate the growth or replication of circovirus MAP, or d 'inducing or inhibiting in said transformed animal the pathologies linked to an infection by circovirus MAP (called activity of said compound).</li></ol>

The compounds which can be selected can be organic compounds such as polypeptides or carbohydrates or any other organic or inorganic compounds already known, or new organic compounds produced using molecular modeling techniques and obtained by chemical or bio synthesis. chemical, these techniques being known to those skilled in the art.

Said selected compounds can be used to modulate cellular replication of circovirus MAP and thus to control infection by this virus. The methods for determining said modulations being well known to those skilled in the art.

This modulation can be carried out for example by an agent capable of binding to a protein and thus of inhibiting or potentiating its biological activity, or capable of binding to an envelope protein of the external surface of said virus and of blocking the penetration of said virus into the host cell or to promote the action of the immune system of the infected organism directed against said virus. This modulation can also be carried out by an agent capable of binding to a nucleotide sequence of a DNA of said virus and of blocking for example the expression of a polypeptide whose biological or structural activity is necessary for the replication or the proliferation of said host cell to host cell virus in the host animal.

The description relates to the compounds capable of being selected by a selection method according to the description.

A subject of the invention is also a compound for its use as a medicament comprising an isolated glycosylated polypeptide of sequence having at least 90% identity with the sequence SEQ ID No. 15, said medicament being an immunogenic composition for the treatment and / or prevention of infection with circovirus MAP type B.

A subject of the invention is also a compound for its use as a medicament comprising an isolated glycosylated polypeptide of sequence having at least 90% identity with the sequence SEQ ID No. 15, said medicament being a vaccine for the treatment and / or the prevention of infection with circovirus MAP type B. The description also relates to an immunogenic and / or vaccine composition, characterized in that it comprises an isolated glycosylated polypeptide of sequence having at least 90% identity with the sequence SEQ ID No. 15 optionally in combination with a pharmaceutically acceptable vehicle and , if necessary, with one or more appropriate adjuvants of immunity.

The invention also comprises an immunogenic and / or vaccine composition according to the invention, characterized in that it comprises an isolated glycosylated polypeptide of sequence having at least 90% of identity with the sequence SEQ ID N ° 15, for the prevention or treatment for MAP circovirus infection.

The invention also comprises an immunogenic and / or vaccine composition according to the invention, characterized in that it comprises an isolated glycosylated polypeptide of sequence having at least 90% of identity with the sequence SEQ ID N ° 15, for the prevention or treatment of infection with a type B MAP circovirus

The description also relates to a pharmaceutical composition comprising a compound chosen from the following compounds:<ul id="ul0012" list-style="none" compact="compact"><li>a) a nucleotide sequence according to the description;</li><li>b) a polypeptide according to the description;</li><li>b) a vector, a viral particle or a transformed cell according to the description;</li><li>c) an antibody according to the description;</li><li>d) a compound capable of being selected by a selection method according to the description;</li></ul>optionally in combination with a pharmaceutically acceptable vehicle and, where appropriate, with one or more appropriate immunity adjuvants.

The description also relates to an immunogenic and / or vaccine composition, characterized in that it comprises a compound chosen from the following compounds:<ol id="ol0018" compact="compact"><li>a) a nucleotide sequence according to the description;</li><li>b) a polypeptide according to the description;</li><li>c) a vector or a viral particle according to the description; and</li><li>d) a cell according to the description.</li></ol>

The description also relates to a vaccine composition according to the description, characterized in that it comprises a mixture of at least two of said compounds a), b), c) and d) and in that one of the two of said compounds relates to circovirus MAP type A and the other relates to circovirus MAP type B.

The term “compound relating to circovirus MAP type A or type B” is intended to denote here respectively a compound obtained from the genomic sequence of circovirus MAP type A or type B.

The description also relates to an immunogenic and / or vaccine composition, characterized in that it comprises at least one of the following compounds:<ul id="ul0013" list-style="dash" compact="compact"><li>a nucleotide sequence SEQ ID No 11, SEQ ID No 12, or a fragment thereof;</li><li>a polypeptide of sequence SEQ ID No. 14 or a fragment thereof, one of the fragments of a polypeptide of sequence SEQ ID No. 15;</li><li>a vector or a viral particle comprising a nucleotide sequence SEQ ID No 11, SEQ ID No 12, or a fragment thereof;</li><li>a transformed cell capable of expressing a polypeptide of sequences SEQ ID No. 14, SEQ ID No. 15, or a fragment thereof; or</li><li>a mixture of at least two of said compounds.</li></ul>

The description also includes an immunogenic and / or vaccine composition according to the description, characterized in that it comprises said mixture of at least two of said compounds as a combination product for simultaneous, separate or spread over time for the prevention or treatment of infection with a circovirus MAP, in particular of type B.

In a preferred embodiment, the vaccine composition according to the description comprises the mixture of the following compounds:<ul id="ul0014" list-style="dash" compact="compact"><li>a pcDNA3 plasmid containing a nucleic acid of sequence SEQ ID No. 11;</li><li>a pcDNA3 plasmid containing a nucleic acid of sequence SEQ ID No. 12;</li><li>a pcDNA3 plasmid containing a nucleic acid encoding the GM-CSF protein;</li><li>a recombinant baculovirus containing a nucleic acid of sequence SEQ ID No. 11;</li><li>a recombinant baculovirus containing a nucleic acid of sequence SEQ ID No. 12; and</li><li>if appropriate, an appropriate immunity adjuvant, in particular the AIF ™ adjuvant.</li></ul>

The description also relates to a pharmaceutical composition according to the description, for the prevention or treatment of an infection with a MAP circovirus.

The description also relates to a pharmaceutical composition according to the description, for the prevention or the treatment of an infection by the circovirus MAP type B.

The description also relates to the use of a composition according to the description, for the preparation of a medicament intended for the prevention or the treatment of infection by a circovirus MAP, preferably by circovirus MAP type B.

In another aspect, the description relates to a vector, a viral particle or a cell according to the description, for the treatment and / or prevention of a disease by gene therapy.

Finally, the description includes the use of a vector, a viral particle or a cell according to the description, for the preparation of a medicament intended for the treatment and / or prevention of a disease by gene therapy.

The polypeptides of the description used in the immunogenic or vaccine compositions according to the invention can be selected by techniques known to those skilled in the art, for example on the capacity of said polypeptides to stimulate T cells, which results, for example by their proliferation or the secretion of interleukins, and which results in the production of antibodies directed against said polypeptides.

In pigs, as in mice, in which a weight dose of the vaccine composition comparable to the dose used in humans is administered, the antibody reaction is tested by taking the serum followed by a study of the formation of a complex between the antibodies present in the serum and the antigen of the vaccine composition, according to the usual techniques.

The immunogenic and / or vaccine compositions according to the invention will contain an effective amount of the compounds of the description, that is to say in a sufficient amount of the said compound or compounds making it possible to obtain the desired effect, such as for example the modulation of cellular replication of circovirus MAP. Those skilled in the art will be able to determine this quantity, depending for example on the age and weight of the individual to be treated, the state of progress of the pathology, possible side effects and by means of test. evaluation of the effects obtained on a population sampling, these tests being known in these fields of applications.

Said vaccine compositions will preferably be in association with a pharmaceutically acceptable vehicle and, where appropriate, with one or more appropriate adjuvants of immunity.

Today, various types of vaccines are available to protect animals or humans against infectious diseases: live attenuated microorganisms (<i>M</i>. <i>bovis -</i> BCG for tuberculosis), inactivated microorganisms (influenza virus), cell-free extracts (<i>Bordetella pertussis</i> for whooping cough), recombinant proteins (hepatitis B virus surface antigen), polysaccharides (pneumococci). Vaccines prepared from synthetic peptides or genetically modified microorganisms expressing heterologous antigens are being tested. Even more recently, recombinant plasmid DNAs carrying genes coding for protective antigens have been proposed as an alternative vaccine strategy. This type of vaccination is carried out with a particular plasmid derived from a plasmid of <i>E</i>. <i>coli</i> which does not replicate <i>in vivo</i> and which codes only for the vaccinating protein. Animals have been immunized by simply injecting naked plasmid DNA into the muscle. This technique leads to the expression of the vaccine protein<i>in situ</i> and a cell type (CTL) and humoral type (antibody) immune response. This double induction of the immune response is one of the main advantages of the vaccination technique with naked DNA.

The vaccine compositions comprising nucleotide sequences or vectors into which said sequences are inserted, are in particular described in international application No. <patcit id="pcit0005" dnum="WO9011092A"><text>WO 90/11092</text></patcit> and also in international application N ° <patcit id="pcit0006" dnum="WO9511307A"><text>WO 95/11307</text></patcit>.

The nucleotide sequence constituting the vaccine composition according to the description can be injected into the host after being coupled to compounds which promote the penetration of this polynucleotide inside the cell or its transport to the cell nucleus. The resulting conjugates can be encapsulated in polymer microparticles, as described in international application No.<patcit id="pcit0007" dnum="WO9427238A"><text>WO 94/27238</text></patcit> (Medisorb Technologies International).

The term “pharmaceutically acceptable vehicle” is intended to denote a compound or a combination of compounds entering into a pharmaceutical or vaccine composition which does not cause side reactions and which allows for example the facilitation of the administration of the active compound, the increase in its duration life and / or its efficiency in the organism, the increase in its solubility in solution or the improvement of its conservation. These pharmaceutically acceptable vehicles are well known and will be adapted by those skilled in the art depending on the nature and the mode of administration of the active compound chosen.

Regarding vaccine formulations, these can include suitable immunity adjuvants which are known to those skilled in the art, such as, for example, aluminum hydroxide, a representative of the family of muramyl peptides. as one of the peptide derivatives of N-acetyl-muramyl, a bacterial lysate, or even the incomplete adjuvant of Freund.

These compounds can be administered systemically, in particular intravenously, intramuscularly, intradermally or subcutaneously, or orally. More preferably, the vaccine composition comprising polypeptides according to the invention will be administered intramuscularly, through food or by nebulization several times, over a period of time.

Their optimal modes of administration, dosages and dosage forms can be determined according to the criteria generally taken into account in establishing a treatment adapted to an animal such as for example age or weight, the severity of its general condition, tolerance to treatment and side effects noted.

The present description also relates to the use of the nucleotide sequences of circovirus MAP according to the invention, for the construction of self-replicating retroviral vectors and the therapeutic applications thereof, in particular in the field of human gene therapy in vivo.

The feasibility of gene therapy applied to humans is no longer to be demonstrated and this concerns many therapeutic applications such as genetic diseases, infectious diseases and cancers. Many documents of the prior art describe the means of implementing gene therapy, in particular by means of viral vectors. In general, the vectors are obtained by deletion of at least part of the viral genes which are replaced by the genes of therapeutic interest. Such vectors can be propagated in a complementation line which provides in trans the deleted viral functions to generate a viral vector particle defective for replication but capable of infecting a host cell. To date, retroviral vectors are among the most used and their mode of infection are widely described in the literature accessible to those skilled in the art.

The principle of gene therapy is to deliver a functional gene, called gene of interest, whose RNA or the corresponding protein will produce the desired biochemical effect in the targeted cells or tissues. On the one hand, the insertion of genes allows the prolonged expression of complex and unstable molecules such as RNAs or proteins which can be extremely difficult or even impossible to obtain or administer directly. On the other hand, the controlled insertion of the desired gene inside specific targeted cells makes it possible to regulate the expression product in defined tissues. For this, it is necessary to be able to insert the desired therapeutic gene inside selected cells and therefore to have an insertion method capable of specifically targeting the selected cells or tissues.

Among the methods of inserting genes, such as for example micro-injection, in particular the injection of naked plasmid DNA (Derse, D. et al., 1995, and Zhao, TM et al., 1996), electroporation, homologous recombination, the use of viral particles, such as retroviruses, is widespread. However, applied in vivo, gene transfer systems of the recombinant retroviral type exhibit both a low infectious power (insufficient concentration of viral particles) and a lack of specificity vis-à-vis the selected target cells.

The production of specific cell viral vectors, having a tissue-specific tropism, and the transduction of the gene of interest can be carried out adequately by the target cells, can be achieved for example by fusing a specific ligand of the target host cells to the N-terminal part of a surface protein of the MAP circovirus envelope. Mention may be made, for example, of the construction of retroviral particles having the CD4 molecule on the surface of the envelope so as to target human cells infected with the HIV virus (<nplcit id="ncit0001" npl-type="s"><text>YOUNG, JAT et al., Sciences 1990, 250, 1421-1423</text></nplcit>), of viral particles having a peptide hormone fused with an envelope protein to specifically infect cells expressing the corresponding receptor (<nplcit id="ncit0002" npl-type="s"><text>KASAHARA, N. et al., Sciences 1994, 266, 1373-1376</text></nplcit>) or alternatively viral particles having a fused polypeptide capable of binding to the epidermal growth factor (EGF) receptor (<nplcit id="ncit0003" npl-type="s"><text>COSSET, FL et al., J. of Virology 1995, 69, 10, 6314-6322</text></nplcit>). In another approach, single chain fragments of antibodies directed against surface antigens of target cells are inserted by fusion to the N-terminal part of the envelope protein (<nplcit id="ncit0004" npl-type="s"><text>VALSESIA-WITTMAN, S. et al., J. of Virology 1996, 70, 3, 2059-2064</text></nplcit> ; <nplcit id="ncit0005" npl-type="s"><text>TEARINA CHU, TH et al., J. of Virology 1997, 71, 1, 720-725</text></nplcit>).

For the purposes of the present description, a gene of interest used in the description can be obtained from a eukaryotic or prokaryotic organism or from a virus by any conventional technique. It is preferably capable of producing an expression product having a therapeutic effect and it may be a product homologous to the host cell or, alternatively, heterologous. In the context of the present description, a gene of interest can encode a product (i) intracellular (ii) membrane present on the surface of the host cell or (iii) secreted outside the host cell. It can therefore include appropriate additional elements such as, for example, a sequence coding for a secretion signal. These signals are known to those skilled in the art.

In accordance with the aims pursued by the present invention, a gene of interest can code for an isolated protein corresponding to all or part of a native protein as found in nature. It may also be a chimeric protein, for example originating from the fusion of polypeptides of various origins or a mutant exhibiting improved and / or modified biological properties. Such a mutant can be obtained by conventional biological techniques by substitution, deletion and / or addition of one or more amino acid residues.

It is particularly preferred to use a gene of therapeutic interest coding for an expression product capable of inhibiting or delaying the establishment and / or the development of a genetic or acquired disease. A vector according to the description is particularly intended for the prevention or treatment of cystic fibrosis, hemophilia A or B, Duchenne or Becker's myopathy, cancer, AIDS and other bacteria or infectious diseases due to a pathogenic organism: virus, bacteria, parasite or prion. The genes of interest which can be used in the present description are those which code, for example, for the following proteins:<ul id="ul0015" list-style="dash" compact="compact"><li>a cytokine and in particular an interleukin, an interferon, a tissue necrosis factor and a growth factor and in particular hematopoietic (G-CSF, GM-CSF),</li><li>a factor or cofactor involved in coagulation and in particular factor VIII, von Willebrand factor, antithrombin III, protein C, thrombin and hirudin,</li><li>an enzyme or an enzyme inhibitor such as viral protease inhibitors,</li><li>an expression product of a suicide gene such as HSV virus (herpes virus) type 1 thimidine kinase,</li><li>an ion channel activator or inhibitor,</li><li>a protein whose absence, modification or deregulation of expression is responsible for a genetic disease, such as the CFTR protein, dystrophin or minidystrophin, insulin, ADA (adenosine diaminose), glucocerebrosidase and phenylhydroxylase,</li><li>a protein capable of inhibiting the initiation or progression of cancers, such as the expression products of tumor suppressor genes, for example the P53 and Rb genes,</li><li>a protein capable of stimulating an immune response or an antibody, and</li><li>a protein capable of inhibiting a viral infection or its development, for example the antigenic epitopes of the virus in question or altered variants of viral proteins capable of entering into competition with the native viral proteins.</li></ul>

The description thus relates to the vectors characterized in that they comprise a nucleotide sequence of circovirus MAP according to the description, and in that they also comprise a gene of interest.

The present description also relates to viral particles generated from said vector according to the description. It further relates to methods for the preparation of viral particles according to the description, characterized in that they use a vector according to the description, including viral pseudoparticles (VLP, Virus-Like Particles).

The description also relates to animal cells transfected with a vector according to the description.

Also included in the description are animal cells, in particular mammalian cells, infected with a viral particle according to the description.

The present description also relates to a vector, a viral particle or a cell according to the description, for the treatment and / or prevention of a genetic disease or of an acquired disease such as cancer or an infectious disease. The description also relates to a pharmaceutical composition comprising, as therapeutic or prophylactic agent, a vector or a cell according to the invention, in combination with a vehicle which is acceptable from a pharmaceutical point of view.

Other characteristics and advantages of the invention appear in the following examples and figures:

Legends of the figures:

<ul id="ul0016" list-style="none" compact="compact"><li><figref idref="f0001"><u>Figure 1</u></figref><u>:</u> Experimental design that led to the isolation and identification of the circovirus associated with MAP type A and B. Trial 1: experimental reproduction of MAP by inoculation of shredded organ from pigs from farms suffering from MAP. Trial 2: experimental reproduction of the MAP. Trial 3: experimental reproduction of the MAP. Trial 4: no experimental reproduction of the MAP.</li><li><figref idref="f0002 f0003 f0004 f0005 f0006 f0007 f0008"><u>Figure 2</u></figref><u>:</u> Organization of the circovirus genome associated with MAP type A (PCVA)<ul id="ul0017" list-style="dash" compact="compact"><li>polarity strand (+) (SEQ ID No. 1);</li><li>polarity strand (-) (SEQ ID N ° 2, represented in the orientation 3 '→ 5');</li><li>amino acid sequences of proteins encoded by the two strands of DNA in the three possible reading frames.</li></ul></li><li><figref idref="f0009 f0010 f0011"><u>Figure 3</u></figref><u>:</u> Alignment of the nucleotide sequence SEQ ID N ° 1 of the circovirus MAP type A (PCVA) and of the circoviruses strain MEEHAN and strain MANKERTZ of porcine cell lines.</li><li><figref idref="f0012"><u>Figure 4</u></figref><u>:</u> Alignment of the amino acid sequence SEQ ID No. 6 of the polypeptide encoded by the nucleotide sequence SEQ ID No. 3 (ORF1) of the circovirus MAP type A (PCVA) and the corresponding nucleotide sequences of the circoviruses strain MEEHAN and strain MANKERTZ of porcine cell lines.</li><li><figref idref="f0013"><u>Figure 5</u></figref><u>:</u> Alignment of the amino acid sequence SEQ ID No. 7 of the polypeptide coded by the nucleotide sequence SEQ ID No. 4 (ORF2) of the circovirus MAP type A (PCVA) and the corresponding nucleotide sequences of the circoviruses strain MEEHAN and strain MANKERTZ of porcine cell lines.</li><li><figref idref="f0013"><u>Figure 6</u></figref><u>:</u> Alignment of the amino acid sequence SEQ ID No. 8 of the polypeptide coded by the nucleotide sequence SEQ ID No. 5 (ORF3) of the circovirus MAP type A (PCVA) and the corresponding nucleotide sequences of the circoviruses strain MEEHAN and strain MANKERTZ of porcine cell lines.</li><li><figref idref="f0014"><u>Figure 7</u></figref><u>:</u> Western blot analysis of the recombinant proteins of circovirus MAP type A (PCVA). The analyzes were carried out on cellular extracts of Sf9 cells obtained after infection with the recombinant baculovirus PCV ORF 1.</li><li><figref idref="f0015 f0016 f0017 f0018 f0019 f0020 f0021"><u>Figure 8</u></figref><u>:</u> Organization of the circovirus genome associated with MAP type B (PCVB)<ul id="ul0018" list-style="dash" compact="compact"><li>polarity strand (+) (SEQ ID No. 9);</li><li>polarity strand (-) (SEQ ID No. 10, shown in the orientation 3 '→ 5');</li><li>amino acid sequences of proteins encoded by the two strands of DNA in the three possible reading frames.</li></ul></li><li><figref idref="f0022"><u>Figure 9</u></figref><u>:</u> Evolution of the average daily gain (GMQ) of farmed pigs suffering from piglet weight loss disease (MAP or DFP), placed in experimental conditions.</li><li><figref idref="f0023"><u>Figure 10</u></figref><u>:</u> GMQ compared for the 3 lots of pigs (F1, F3 and F4) calculated over a period of 28 days, after vaccination test.</li><li><figref idref="f0024"><u>Figure 11</u></figref><u>:</u> Hyperthermia higher than 41 ° C, expressed as a percentage compared for the 3 groups of pigs (F1, F3 and F4) calculated per week over a period of 28 days, after vaccination test.</li><li><figref idref="f0025"><u>Figure 12</u></figref><u>:</u> Membranes of the peptide spots corresponding to the ORF2 revealed using an infected pig serum from a conventional breeding. The numbers of specific peptides of circovirus type B as well as their non-reactive counterparts (type A) are indicated in bold. Nonspecific immunogenic peptides are indicated in italics.</li><li><figref idref="f0026"><u>Figure 13</u></figref><u>:</u> Alignment of the amino acid sequences of the proteins coded by the ORF2 of the circovirus MAP type A and by the ORF'2 of the circovirus MAP type B. The position of 4 peptides corresponding to specific epitopes of the circovirus MAP type B is indicated on the corresponding sequence in bold line, their counterpart on the sequence of circovirus MAP type A is also indicated by a single line.</li></ul>

<u>EXAMPLES</u>

EXAMPLE 1:

Cloning, sequencing and characterization of circovirus MAP type A (PCVA)

1 -

Experimental procedures

Experimental reproduction of the infection and its syndrome (see Figure 1).

A first test was carried out with pigs from a very good breeding, but suffering from the piglet slimming disease (MAP) or also called DFP (Piglet Fatal Dieback). Contact tests with pigs EOPS (Free from specified pathogenic organisms) showed a transfer of contaminant (s) resulting in a complex pathology associating hyperthermia, slow growth, diarrhea and conjunctivitis. The PRRS virus (porcine reproductive and respiratory syndrome, an infectious disease caused by an arterivirus) was rapidly isolated from farmed pigs and contact pigs. All of the clinical signs could have been attributed to the presence of the PRRS virus. However, two farm pigs showed signs of DFP without the PRRS virus being isolated. Histological analyzes and blood formulas have shown, however, that these pigs were suffering from an infectious process of viral origin.

In a second trial, 8-week EOPS pigs were inoculated intratracheally with organ shreds from the two farmed pigs with DFP. The inoculated pigs showed hyperthermia 8 to 9 days post-infection, then their growth was slowed down. Other EOPS pigs placed in contact showed similar, attenuated signs 30 days after the initial test. No seroconversion against a European or Canadian strain of PRRS virus was recorded in these animals.

A third trial made it possible to reproduce the syndrome from samples taken from pigs from the second trial.

Conclusion

The syndrome is reproduced under experimental conditions. It is determined by at least one infectious agent, transmissible by direct contact. The clinical constants are sometimes high hyperthermia (greater than or equal to 41.5 ° C) which develops 8 to 10 days after infection. Slower growth can be observed. The other manifestations are an inversion of the blood formula (inversion of the lymphocyte / polynuclear ratio from 70/30 to 30/70) and frequent lesions on the lymph nodes, in particular those draining the respiratory system (lymph node hypertrophy, loss of structure with necrosis and infiltration by giant mononuclear or plurinucleated cells).

2 -

Laboratory studies

Various cell carriers including primary or line pig kidney cells, pig testis cells, monkey kidney cells, pig lymphocytes, pig alveolar macrophages, circulating blood monocytes, have been used for highlight the possible presence of a virus. No cytopathic effect has been demonstrated on these cells. On the other hand, the use of a sick pig serum after experimental infection has made it possible to reveal an intracellular antigen in monocytes, macrophages and approximately 10% of pig kidney cells (RP) infected with the comminuted organ. This indirect revelation was made in kinetics at different times of culture. It appears that the antigen initially appears in the nucleus of infected cells before spreading in the cytoplasm. Successive passages in cell culture did not make it possible to amplify the signal.

In electron microscopy on ground organ, it was visualized spherical particles marked specifically by the serum of sick pigs, infected under experimental conditions. The size of these particles is estimated at 20 nm.

After two passages of these shredded organs on pig lymphocytes and then three passages on kidney or testis cells from pigs, a cytopathic effect developed and was amplified. Under the electron microscope, an adenovirus was visualized which, under experimental conditions, did not reproduce DFP (there is only a peak of hyperthermia 24 to 48 hours after infection, then nothing).

DNA bands in certain samples of pigs infected under experimental conditions and having shown signs of the disease could be highlighted (results not shown). There is a certain correspondence between the samples giving a positive result in cell culture and those having a DNA band.

Conclusion

At least two types of virus have been detected in the shredded organs from pigs suffering from DFP. One is an adenovirus, but it does not reproduce the disease on its own. The other type of virus is a circovirus and is associated with DFP. This circovirus, of which two types have been isolated and sequenced, hereinafter called circovirus MAP type A (or PCVA) and circovirus MAP type B (or PCVB) have mutations compared to the known sequences of circoviruses which are not pathogenic for pigs .

3 -

Cloning and sequencing the DNA of circovirus MAP type A

Extraction of DNA replicative form (RF), cleavage by the enzyme Kpn I and amplification by a pair of primers flanking the restriction site Kpn I. Sequencing of the two strands at least twice by the Sanger method.

The nucleic sequence of the polarity strand (+) of the genome of the circovirus MAP type A (or PCVA), strain DFP, is represented by the sequence SEQ ID No. 1 in the list of sequences, the nucleic sequence of the polarity strand ( -) of the genome of the circovirus MAP type A (or PCVA) being represented by the nucleic sequence 3 '→ 5' of the <figref idref="f0009 f0010 f0011">figure 3</figref> or by the sequence SEQ ID N ° 2 (represented in the orientation 5 '→ 3') in the list of sequences.

The amino acid sequences SEQ ID No 6, SEQ ID No 7 and SEQ ID No 8 of the sequence list respectively represent the protein sequences encoded by the nucleic sequences of the 3 open reading frames SEQ ID No 3 (ORF1), corresponding to the REP protein, SEQ ID No. 4 (ORF2) and SEQ ID No. 5 (ORF3), determined from the sequence SEQ ID No. 1 of the polarity strand (+) or the sequence nucleic acid SEQ ID N ° 2 of the polarity strand (-) of the genome of the circovirus MAP type A.

4 -

Comparison of the nucleotide and amino acid sequences of circovirus MAP type A (or associated with MAP) obtained with the corresponding sequences of circulatory viruses MEEHAN and MANKERTZ of porcine cell lines

Use of DNA sequence analysis software, DNASIS.

Sequences of oligonucleotides used as primers or probes in detection and / or identification methods

<ol id="ol0019" compact="compact"><li>1. specific detection of circovirus MAP type A:<ul id="ul0019" list-style="none" compact="compact"><li>primer PCV 5: 5 'GTG TGC TCG ACA TTG GTG TG 3';</li><li>primer PCV 10: 5 'TGG AAT GTT AAC GAG CTG AG 3';</li></ul></li><li>2. specific detection of circovirus from cell lines:<ul id="ul0020" list-style="none" compact="compact"><li>primer PCV 5: 5 'GTG TGC TCG ACA TTG GTG TG 3';</li><li>primer MEE1: 5 'TGG AAT GTT AAC TAC CTC AA 3';</li></ul></li><li>3. differential detection:<ul id="ul0021" list-style="none" compact="compact"><li>the pairs of primers used are those described for example in paragraphs 1 and 2 above;</li></ul></li><li>4. detection of monomeric circular replicative forms RF (replicative forms):<ul id="ul0022" list-style="none" compact="compact"><li>primer PCV 5: 5 'GTG TGC TCG ACA TTG GTG TG 3';</li><li>primer PCV 6: 5 'CTC GCA GCC ATC TTG GAA TG 3';</li></ul></li><li>5. detection of vectors carrying the dimers in tandem:<ul id="ul0023" list-style="none" compact="compact"><li>Nar dimer:<ul id="ul0024" list-style="none" compact="compact"><li>primer KS 620: 5 'CGC GCG TAA TAC GAC TCA CT 3';</li><li>primer PCV 5: 5 'GTG TGC TCG ACA TTG GTG TG 3';</li></ul></li><li>Kpn dimer:<ul id="ul0025" list-style="none" compact="compact"><li>primer KS 620: 5 'CGC GCG TAA TAC GAC TCA CT 3';</li><li>primer PCV 6: 5 'CTC GCA GCC ATC TTG GAA TG 3';</li></ul></li></ul></li><li>6. differential detection:<ul id="ul0026" list-style="none" compact="compact"><li>the pairs of primers used are those for example described in paragraphs 4 and 5 above.</li></ul></li></ol>

The methods using the pairs of primers described in paragraphs 4 and 5 are particularly interesting for differentially detecting the circular monomeric forms of specific replicative forms of the virion or of the DNA in replication and the dimeric forms found in the so-called molecular constructions. tandem.

The tandem constructs of the viral genome (dimers) such as the constructs used for the preparation of the vector pBS KS + Tandem PCV Kpn 1, deposited at the CNCM under the number I-1891, on July 3, 1997 (E-coli transformed by said vector ) are very advantageous for their use in methods for producing a sufficient quantity of an inoculum consisting of DNA, intended for the production of virus and this in the absence of a satisfactory protocol for the production of virus on the cellular system. These production methods using these tandem constructions of the viral genome will make it possible to study, by mutation, the virulence factors and consequently may be used for the manufacture of a collection of viruses carrying the mutations indicated in the construction of the vectors which will present appropriate tropism and virulence. These vectors with a self-replicating structure exhibit properties which are sought after in gene transfer, in particular for their applications in gene therapy and in vaccinology.

Western blot analysis of the recombinant proteins of circovirus MAP type A

The results were obtained by using an antiserum specific for the circovirus MAP produced during test 1 (cf. <figref idref="f0001">figure 1</figref>).

Type of products analyzed

The analyzes were carried out on cellular extracts of Sf9 cells obtained after infection with the recombinant baculovirus PCV ORF 1.

The culture of Sf9 cells was carried out on a 25 cm Petri dish² according to standard culture methods for these cells. After centrifugation, the cell pellets are taken up in 300 μl of PBS buffer (phosphate buffered saline).

Electrophoresis (PAGE- SDS)

The electrophoresis is carried out on the cellular extracts of Sf9 cells obtained previously on 5 samples (cf. table 1 below) under the following conditions: % polyacrylamide gel: 8%; Conditions: denaturing Voltage: 80 V; Duration: 135 min.<tables id="tabl0001" num="0001"><table frame="all"><title><u>Table 1:</u> Nature of samples subjected to electrophoresis</title><tgroup cols="6"><colspec colnum="1" colname="col1" colwidth="23mm" /><colspec colnum="2" colname="col2" colwidth="23mm" /><colspec colnum="3" colname="col3" colwidth="20mm" /><colspec colnum="4" colname="col4" colwidth="20mm" /><colspec colnum="5" colname="col5" colwidth="20mm" /><colspec colnum="6" colname="col6" colwidth="20mm" /><thead><row><entry valign="top">Well No.</entry><entry align="center" valign="top">1</entry><entry align="center" valign="top">2</entry><entry align="center" valign="top">3</entry><entry align="center" valign="top">4</entry><entry align="center" valign="top">5</entry></row></thead><tbody><row><entry>deposits</entry><entry align="center">PM Rainbow</entry><entry align="center">Raoul 24 hours</entry><entry align="center">Raoul 48 hours</entry><entry align="center">Raoul 72 hours</entry><entry align="center">Raoul 96 h</entry></row><row><entry>µl sample</entry><entry align="center">10</entry><entry align="center">15</entry><entry align="center">15</entry><entry align="center">15</entry><entry align="center">15</entry></row><row><entry>µl Laemli 4X</entry><entry align="center">0</entry><entry align="center">5</entry><entry align="center">5</entry><entry align="center">5</entry><entry align="center">5</entry></row></tbody></tgroup><tgroup cols="6" rowsep="0"><colspec colnum="1" colname="col1" colwidth="23mm" /><colspec colnum="2" colname="col2" colwidth="23mm" /><colspec colnum="3" colname="col3" colwidth="20mm" /><colspec colnum="4" colname="col4" colwidth="20mm" /><colspec colnum="5" colname="col5" colwidth="20mm" /><colspec colnum="6" colname="col6" colwidth="20mm" /><tbody><row><entry namest="col1" nameend="col6" align="justify">Table 1 captions: Laemli 4X: charging pad PM Rainbow: molecular weight markers (35, 52, 77, 107, 160 and 250 kD) Raoul 24 h, 48 h, 72 h and 96 h: expression products of the ORF1 of the circovirus MAP type A.</entry></row></tbody></tgroup></table></tables>

Western-blot

After electrophoresis, the bands obtained in the various wells are transferred onto a nitrocellulose membrane for 1 h at 100 v in a TGM buffer (Tris-glycine-methanol).

The Western-blot is carried out under the following conditions:<ol id="ol0020" compact="compact"><li>1) Saturation with a solution containing 5% skim milk; 0.05% Tween 20 in 1X TBS buffer (Tris buffer saline) for 30 min.</li><li>2) 1st antibody:<ul id="ul0027" list-style="none" compact="compact"><li>10 ml of type A anticircovirus MAP antibodies are added diluted 1/100, then the reaction medium is incubated overnight at 4 ° C. Three washes of 10 min. in TBS 1X are performed.</li></ul></li><li>3) 2nd antibody:<ul id="ul0028" list-style="none" compact="compact"><li>10 ml of rabbit anti-pig immunoglobulin P164 antibody, coupled to peroxidase (Dakopath) are added diluted 1/100, then the reaction medium is incubated for 3 hours at 37 ° C. Three washes of 10 min. in TBS 1X are performed.</li></ul></li><li>4) Revelation The substrate 4-Chloro-1-Naphtol, in the presence of hydrogen peroxide is used for the development.</li></ol>

Results

The results are shown in the <figref idref="f0014">figure 7</figref>.

Kinetics of appearance of antibodies specific for the REP recombinant protein of circovirus MAP type A expressed in baculovirus after infection of pigs by circovirus MAP type A (test 4, cf. FIG. 1)

After infection of the pigs, a serum sample from each of the infected pigs is taken at different periods expressed in the table by the date of the sample (taken here the same year) and is then analyzed by Western blot.

The revelation of specific antibodies is carried out as described above.

The results obtained are shown in Table 2 below.<tables id="tabl0002" num="0002"><table frame="all"><title><u>Table 2:</u> Kinetics of appearance of specific antibodies</title><tgroup cols="9"><colspec colnum="1" colname="col1" colwidth="16mm" /><colspec colnum="2" colname="col2" colwidth="14mm" /><colspec colnum="3" colname="col3" colwidth="14mm" /><colspec colnum="4" colname="col4" colwidth="14mm" /><colspec colnum="5" colname="col5" colwidth="14mm" /><colspec colnum="6" colname="col6" colwidth="14mm" /><colspec colnum="7" colname="col7" colwidth="14mm" /><colspec colnum="8" colname="col8" colwidth="14mm" /><colspec colnum="9" colname="col9" colwidth="14mm" /><thead><row><entry>Echan.</entry><entry>Pigs</entry><entry>10/06</entry><entry>16/06</entry><entry>23/06</entry><entry>01/07</entry><entry>08/07</entry><entry>15/07</entry><entry>21/07</entry></row></thead><tbody><row rowsep="0"><entry>A3</entry><entry>1</entry>&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;<entry>Neg.</entry>&lt;entry /&gt;</row><row><entry>Witness-</entry><entry>2</entry>&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;&lt;entry /&gt;<entry>Neg.</entry>&lt;entry /&gt;</row><row rowsep="0"><entry>B2</entry><entry>1</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>+</entry><entry>+</entry><entry>++</entry><entry>+++</entry></row><row rowsep="0"><entry>Infec.</entry><entry>2</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry></row><row rowsep="0"><entry>RP +</entry><entry>3</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>+</entry><entry>+</entry><entry>+</entry></row><row>&lt;entry /&gt;<entry>4</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>Neg.</entry><entry>++</entry></row></tbody></tgroup><tgroup cols="9" rowsep="0"><colspec colnum="1" colname="col1" colwidth="16mm" /><colspec colnum="2" colname="col2" colwidth="14mm" /><colspec colnum="3" colname="col3" colwidth="14mm" /><colspec colnum="4" colname="col4" colwidth="14mm" /><colspec colnum="5" colname="col5" colwidth="14mm" /><colspec colnum="6" colname="col6" colwidth="14mm" /><colspec colnum="7" colname="col7" colwidth="14mm" /><colspec colnum="8" colname="col8" colwidth="14mm" /><colspec colnum="9" colname="col9" colwidth="14mm" /><tbody><row><entry namest="col1" nameend="col9" align="justify">Table 2 captions: A3 Control: uninfected control animals; B2 Infec. RP +: animals infected with pig kidney cells (RP) containing the circovirus; Neg. : negative; +, ++, +++: intensity scale of the positive reaction; 10/06, 16/06, 23/06, 01/07, 08/07, 15/07, 21/07: dates expressed in day / month on which the various serum samples were taken.</entry></row></tbody></tgroup></table></tables>

EXAMPLE 2:

Cloning, sequencing and characterization of circovirus MAP type B (PCVB)

The techniques used for cloning, sequencing and characterization of the circovirus MAP type B (PCVB) are those used in Example 1 above for the circovirus MAP type A (PCVA).

The nucleic sequence of the polarity strand (+) of the genome of the circovirus MAP type B (or PCVB) is represented by the sequence SEQ ID No. 9 in the list of sequences, the nucleic sequence of the polarity strand (-) of the genome of circovirus MAP type B (or PCVB) being represented by the nucleic sequence 3 '→ 5' of the <figref idref="f0015 f0016 f0017 f0018 f0019 f0020 f0021">figure 8</figref>. or by the sequence SEQ ID N ° 10 (represented in the orientation 5 '→ 3') in the list of sequences.

The amino acid sequences SEQ ID No 14, SEQ ID No 15 and SEQ ID No 16 of the sequence list respectively represent the protein sequences encoded by the nucleic sequences of the 3 open reading frames SEQ ID No 11 (ORF'1), corresponding to the REP protein, SEQ ID No.12 (ORF'2) and SEQ ID No.13 (ORF'3), determined from the sequence SEQ ID No.9 of the polarity strand ( +) or of the nucleic sequence SEQ ID N ° 10 of the strand of polarity (-) of the genome of the circovirus MAP type B.

EXAMPLE 3:

Comparative analysis of the nucleotide sequences (ORF1, ORF2 and genomics) and the amino acid sequences coded by the ORF1 and the ORF2 of the circoviruses MAP type A (PCVA) and type B (PCVB)

The results expressed as% homology are shown in Tables 3 and 4 below.<tables id="tabl0003" num="0003"><table frame="all"><title><u>Table 3:</u> Comparative analysis of amino acid sequences</title><tgroup cols="3"><colspec colnum="1" colname="col1" colwidth="34mm" /><colspec colnum="2" colname="col2" colwidth="29mm" /><colspec colnum="3" colname="col3" colwidth="29mm" /><thead><row><entry>% homology</entry><entry align="center">ORF1</entry><entry align="center">ORF2</entry></row></thead><tbody><row><entry valign="bottom">PCVA / PCVB</entry><entry align="center" valign="bottom">80,4</entry><entry align="center" valign="bottom">56,2</entry></row></tbody></tgroup></table></tables><tables id="tabl0004" num="0004"><table frame="all"><title><u>Table 4:</u> Comparative analysis of nucleotide sequences</title><tgroup cols="5"><colspec colnum="1" colname="col1" colwidth="24mm" /><colspec colnum="2" colname="col2" colwidth="23mm" /><colspec colnum="3" colname="col3" colwidth="16mm" /><colspec colnum="4" colname="col4" colwidth="16mm" /><colspec colnum="5" colname="col5" colwidth="16mm" /><thead><row><entry>% homology</entry><entry align="center">Genomics</entry><entry align="center">ORF1</entry><entry align="center">ORF2</entry><entry align="center">The rest</entry></row></thead><tbody><row><entry valign="bottom">PCVA / PCVB</entry><entry align="center" valign="bottom">70,4</entry><entry align="center" valign="bottom">80,4</entry><entry align="center" valign="bottom">60,1</entry><entry align="center" valign="bottom">66,1</entry></row></tbody></tgroup></table></tables>

EXAMPLE 4:

Observation of the disease and reproduction of the disease under experimental conditions

a) Test N ° 1: Observation of the disease

The objective is to take farm animals at the beginning of the disease and place them in the experimental conditions to follow the evolution of the pathology and describe all the clinical manifestations. This first trial was carried out on 3 10-week-old pigs, 2 of which were already sick (withering away), and on 3 other 13-week-old pigs, showing no signs of disease. The clinical observation was spread over a period of 37 days. Two 10-week-old pigs quickly perished (pigs 1 and 2, <figref idref="f0022">figure 9</figref>) and had to be euthanized 5 and 6 days after their arrival. Only one had hyperthermia over 5 days and diarrhea. Two other pigs had dyspnea and cough, one of which also developed hyperthermia, above 41 ° C, the first two days of his stay. Another pig had slowed growth in the second week (pig 6,<figref idref="f0022">figure 9</figref>), without any other clinical sign being noted. In terms of lesions, 5 pigs out of 6 presented gross lesions of gray pneumonia, the sixth presented scar lesions on the lung.

b) Test No. 2: Reproduction of the disease from inocula prepared on farmed pigs.

The two sick pigs in test 1 were used to prepare inocula which were tested in test 2 on pigs free of specific pathogenic organisms (EOPS, SPF in English version). EOPS pigs were 9 weeks old at the time of inoculation. The clinical and lesional results are presented in Table 5.<tables id="tabl0005" num="0005"><table frame="all"><title><u>Table 5:</u> summary of the measurements made during the experimental reproductions of the MAP. (in parentheses are reported the values ​​of control animals, the underlined values ​​indicate a difference between infected animals and control animals)</title><tgroup cols="7"><colspec colnum="1" colname="col1" colwidth="33mm" /><colspec colnum="2" colname="col2" colwidth="33mm" /><colspec colnum="3" colname="col3" colwidth="35mm" /><colspec colnum="4" colname="col4" colwidth="36mm" /><colspec colnum="5" colname="col5" colwidth="36mm" /><colspec colnum="6" colname="col6" colwidth="36mm" /><colspec colnum="7" colname="col7" colwidth="36mm" /><thead><row rowsep="0"><entry align="right" valign="top">Trial</entry><entry align="center" valign="top">2</entry><entry align="center" valign="top">3</entry><entry align="center" valign="top">4</entry><entry align="center" valign="top">5</entry><entry align="center" valign="top">6</entry><entry align="center" valign="top">7</entry></row><row><entry valign="top">Measured</entry><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /></row></thead><tbody><row rowsep="0"><entry align="center">Pig status</entry><entry align="center">EOPS CNEVA</entry><entry align="center">EOPS field</entry><entry align="center">EOPS CNEVA</entry><entry align="center">EOPS CNEVA</entry><entry align="center">Conventional</entry><entry align="center">Conventional</entry></row><row rowsep="0"><entry align="center">Age</entry><entry align="center">9 weeks</entry><entry align="center">6 weeks</entry><entry align="center">5 weeks</entry><entry align="center">5 weeks</entry><entry align="center">5 weeks</entry><entry align="center">6-7 weeks</entry></row><row rowsep="0"><entry align="center">Number</entry><entry align="center">4</entry><entry align="center">6</entry><entry align="center">12</entry><entry align="center">8</entry><entry align="center">8</entry><entry align="center">8</entry></row><row rowsep="0"><entry align="center" valign="middle">Inoculation route</entry><entry align="center" valign="middle">Intratracheal route</entry><entry align="center" valign="middle">Intratracheal route</entry><entry align="center" valign="middle">Intratracheal + intramuscular route</entry><entry align="center" valign="middle">Intratracheal + intramuscular route</entry><entry align="center" valign="middle">Intratracheal + intramuscular route</entry><entry align="center" valign="middle">Intratracheal + intramuscular route</entry></row><row rowsep="0"><entry align="center" valign="middle">Inoculum title per pig</entry><entry align="center" valign="middle">ND *</entry><entry align="center" valign="middle">ND *</entry><entry align="center" valign="middle">10^4.53 TCID₅₀ per ml: 1 ml IM + 5 ml IT</entry><entry align="center" valign="middle">10^4.53 TCID₅₀ per ml: 1 ml IM + 5 ml IT</entry><entry align="center" valign="middle">10^4.53 TCID₅₀ per ml: 1 ml IM + 5 ml IT</entry><entry align="center" valign="middle">10^4.53 TCID₅₀ per ml: 1 ml IM + 5 ml IT</entry></row><row rowsep="0"><entry align="center" valign="middle">Beginning of hyperthermia</entry><entry align="center" valign="middle">10 post-infection days</entry><entry align="center" valign="middle">9-13 days post-infection</entry><entry align="center" valign="middle">12-13 days post-infection</entry><entry align="center" valign="middle">9-14 days post-infection</entry><entry align="center" valign="middle">8-12 days post-infection</entry><entry align="center" valign="middle">12 post-infection days</entry></row><row rowsep="0"><entry align="center" valign="middle">% of pigs in hyperthermia **</entry><entry align="center" valign="middle">100%</entry><entry align="center" valign="middle">83 %</entry><entry align="center" valign="middle">92%</entry><entry align="center" valign="middle">100%</entry><entry align="center" valign="middle">75%</entry><entry align="center" valign="middle">88 %</entry></row><row><entry align="center" valign="middle">Nb of hyperthermia days per pig **</entry><entry align="center" valign="middle">7</entry><entry align="center" valign="middle">4,5</entry><entry align="center" valign="middle">3,3</entry><entry align="center" valign="middle">5,8</entry><entry align="center" valign="middle">7,5</entry><entry align="center" valign="middle">11,6</entry></row><row><entry colsep="0" align="center" valign="middle">Maximum temperatures ***</entry><entry colsep="0" align="center" valign="middle">40.4 to 41.7 ° C</entry><entry colsep="0" align="center" valign="middle">40.6 to 42.3 ° C</entry><entry colsep="0" align="center" valign="middle">40.2 to 41.6 ° C</entry><entry colsep="0" align="center" valign="middle">40.3 to 40.8 ° C</entry><entry colsep="0" align="center" valign="middle">40.6 to 42 ° C</entry><entry align="center" valign="middle">40.2 to 41.9 ° C</entry></row></tbody></tgroup><tgroup cols="7" colsep="0" rowsep="0"><colspec colnum="1" colname="col1" colwidth="33mm" /><colspec colnum="2" colname="col2" colwidth="33mm" /><colspec colnum="3" colname="col3" colwidth="35mm" /><colspec colnum="4" colname="col4" colwidth="36mm" /><colspec colnum="5" colname="col5" colwidth="36mm" /><colspec colnum="6" colname="col6" colwidth="36mm" /><colspec colnum="7" colname="col7" colwidth="36mm" colsep="1" /><thead><row><entry align="center" valign="middle">Hyperthermia ****% per week</entry><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /></row></thead><tbody><row><entry align="center" valign="middle">S1</entry><entry align="center" valign="middle">3,5 (3,5)</entry><entry align="center" valign="middle">17 (36)</entry><entry align="center" valign="middle">7(5)</entry><entry align="center" valign="middle">37 (17)</entry><entry align="center" valign="middle">16 (17)</entry><entry align="center" valign="middle">20 (28)</entry></row><row><entry align="center" valign="middle">S2</entry><entry align="center" valign="middle"><i><u>42 (3,5)</u></i></entry><entry align="center" valign="middle">7 (13)</entry><entry align="center" valign="middle"><i><u>13 (1)</u></i></entry><entry align="center" valign="middle"><i><u>21 (3)</u></i></entry><entry align="center" valign="middle"><i><u>52 (10)</u></i></entry><entry align="center" valign="middle">37 (28)</entry></row><row><entry align="center" valign="middle">S3</entry><entry align="center" valign="middle"><i><u>35 (3,5)</u></i></entry><entry align="center" valign="middle"><i><u>33 (10)</u></i></entry><entry align="center" valign="middle"><i><u>28 (7)</u></i></entry><entry align="center" valign="middle"><i><u>62 (2)</u></i></entry><entry align="center" valign="middle"><i><u>34 (12)</u></i></entry><entry align="center" valign="middle"><i><u>79 (17)</u></i></entry></row><row><entry align="center" valign="middle">S4</entry><entry align="center" valign="middle"><i><u>21 (3,5)</u></i></entry><entry align="center" valign="middle"><i><u>28 (7)</u></i></entry><entry align="center" valign="middle">5 (0)</entry><entry align="center" valign="middle">6 (3)</entry><entry align="center" valign="middle">25 (22)</entry><entry align="center" valign="middle"><i><u>55 (3)</u></i></entry></row><row rowsep="1"><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /></row></tbody></tgroup><tgroup cols="7" colsep="0" rowsep="0"><colspec colnum="1" colname="col1" colwidth="33mm" /><colspec colnum="2" colname="col2" colwidth="33mm" /><colspec colnum="3" colname="col3" colwidth="35mm" /><colspec colnum="4" colname="col4" colwidth="36mm" /><colspec colnum="5" colname="col5" colwidth="36mm" /><colspec colnum="6" colname="col6" colwidth="36mm" /><colspec colnum="7" colname="col7" colwidth="36mm" colsep="1" /><thead><row><entry valign="middle">GMQ:</entry><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /></row></thead><tbody><row><entry align="center" valign="middle">S1</entry><entry align="center" valign="middle">928 (1053)</entry><entry align="center" valign="middle">417 (357)</entry><entry align="center" valign="middle">564 (620)</entry><entry align="center" valign="middle">650 (589)</entry><entry align="center" valign="middle">401 (407)</entry><entry align="center" valign="middle">509 (512)</entry></row><row><entry align="center" valign="middle">S2</entry><entry align="center" valign="middle"><i><u>678 (1028)</u></i></entry><entry align="center" valign="middle"><i><u>428 (617)</u></i></entry><entry align="center" valign="middle"><i><u>503 (718)</u></i></entry><entry align="center" valign="middle">612 (584)</entry><entry align="center" valign="middle"><i><u>294 (514)</u></i></entry><entry align="center" valign="middle">410 (310)</entry></row><row><entry align="center" valign="middle">S3</entry><entry align="center" valign="middle"><i><u>661 (1000)</u></i></entry><entry align="center" valign="middle">771 (642)</entry><entry align="center" valign="middle"><i><u>381 (657)</u></i></entry><entry align="center" valign="middle"><i><u>520 (851)</u></i></entry><entry align="center" valign="middle"><i><u>375 (586)</u></i></entry><entry align="center" valign="middle">435 (440)</entry></row><row><entry align="center" valign="middle">S4</entry><entry align="center" valign="middle"><i>786 (1100)</i></entry><entry align="center" valign="middle"><i><u>550 (657)</u></i></entry><entry align="center" valign="middle">764 (778)</entry><entry align="center" valign="middle">641 (696)</entry><entry align="center" valign="middle"><i><u>473 (610)</u></i></entry><entry align="center" valign="middle"><i><u>451 (681)</u></i></entry></row><row><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /><entry align="center" valign="middle" /></row><row><entry align="center" valign="middle">Contact pig transmission</entry><entry align="center" valign="middle">100% yes</entry><entry align="center" valign="middle">Yes at 75%</entry><entry align="center" valign="middle">Not tested</entry><entry align="center" valign="middle">Not tested</entry><entry align="center" valign="middle">Not tested</entry><entry align="center" valign="middle">Not tested</entry></row><row><entry align="center" valign="middle">% lung lesions</entry><entry align="center" valign="middle">25</entry><entry align="center" valign="middle">75</entry><entry align="center" valign="middle">0</entry><entry align="center" valign="middle">25</entry><entry align="center" valign="middle">25</entry><entry align="center" valign="middle">12</entry></row><row rowsep="1"><entry align="center" valign="middle">% lymph node lesions</entry><entry align="center" valign="middle">17</entry><entry align="center" valign="middle">33</entry><entry align="center" valign="middle">67</entry><entry align="center" valign="middle">25</entry><entry align="center" valign="middle">50</entry><entry align="center" valign="middle">12</entry></row></tbody></tgroup><tgroup cols="7" rowsep="0"><colspec colnum="1" colname="col1" colwidth="33mm" /><colspec colnum="2" colname="col2" colwidth="33mm" /><colspec colnum="3" colname="col3" colwidth="35mm" /><colspec colnum="4" colname="col4" colwidth="36mm" /><colspec colnum="5" colname="col5" colwidth="36mm" /><colspec colnum="6" colname="col6" colwidth="36mm" /><colspec colnum="7" colname="col7" colwidth="36mm" /><tbody><row><entry namest="col1" nameend="col7" align="justify">* ND: not determined, ** hyperthermia when the temperature is above 40 ° C, *** range of maximum temperatures recorded at the individual level, **** the percentage corresponds to the number of temperature readings above 40 ° C divided by the total number of temperature readings in the week for all pigs.</entry></row></tbody></tgroup></table></tables>

In this trial, there was no wasting, at most a slowdown in growth in the second, third or fourth week after infection. These data illustrate that certain breeding conditions probably favor the expression of the disease.

c) Tests No. 3 to No. 7: Reproduction of the experimental tests

The multiplication of experimental tests on pigs has had the objective of mastering and better characterizing the experimental model. All the results are presented in Table 5.

Under experimental conditions, MAP is thus characterized by a long incubation, from 8 to 14 days, frank hyperthermia over 2 to 8 days, a reduction in food consumption and a slowing of weight gain in the second, third or fourth week post-infection. The lesion table associated with this clinical expression essentially includes lymph node enlargements and pneumonia lesions.

Conclusion

The development of this experimental model clearly demonstrates the direct etiological role of circovirus MAP in the disease. In addition, this model is the essential tool for the understanding of pathogenic mechanisms and the study of future vaccine candidates.

EXAMPLE 5:

Demonstration of the protective efficacy of a vaccine composition produced from nucleic fragments of circovirus MAP sequence

1) Animals used for the study

Piglets with MAP disease, reproduced under the experimental conditions described in paragraph c) of Example 4, were used in a protocol for evaluating the efficacy of a vaccine composition comprising nucleic fragments of MAP circovirus sequence.

2) Vaccine composition tested and vaccination protocol

a) Components used for the study

The plasmids were obtained from the pcDNA3 plasmid of INVITROGENE

- pcDNA3 ORF Plasmids

These plasmids are plasmids which do not carry a circovirus MAP nucleic acid insert and are used as negative control plasmid.

- pcDNA30RF1 + plasmid and pcDNA3ORF2 + plasmid

The plasmids pcDNA3ORF1 + and pcDNA3ORF2 + are plasmids which carry a nucleic acid insert of the sequence of the circovirus MAP TYPE B, respectively an insert comprising the nucleic acid fragment SEQ ID No. 11 (ORF'1) coding for the protein Rep of sequence SEQ ID No. 14 and an insert comprising the nucleic acid fragment SEQ ID No. 12 (ORF'2) coding for the protein of sequence SEQ ID No. 15, probably corresponding to the capsid protein, these nucleic constructs comprising the ATG codon for initiating the coding sequence of the corresponding protein.

- GMCSF + Plasmid

The GM-CSF (Granulocyte / macrophage-colony stimulating factor) is a cytokine which is involved in the development, maturation and activation of macrophages, granulocytes and dendritic cells presenting antigen. The beneficial contribution of GM-CSF in vaccination is estimated to be cellular activation with in particular the recruitment and differentiation of antigen-presenting cells.

This pcDNA3-GMCSF + plasmid carries a nucleic acid insert coding for the granulocyte / macrophage colony stimulating factor, the GM-CSF protein.

The gene coding for this GM-CSF protein has been cloned and sequenced by <nplcit id="ncit0006" npl-type="s"><text>Inumaru et al. (Immunol. Cell Biol., 1995, 73 (5), 474-476</text></nplcit>). The plasmid pcDNA3-GMCSF + was obtained from Dr. B. Charley of INRA in Jouy-en-Josas (78, France).

- Recombinant baculoviruses

Baculoviruses called ORF- are viruses which do not carry an insert comprising a nucleic acid fragment capable of expressing a circovirus MAP protein.

The baculoviruses called ORF1 + (BAC ORF1 +) or ORF2 + (BAC ORF2 +) are recombinant baculoviruses respectively carrying an insert comprising a nucleic acid fragment SEQ ID No. 11 (ORF'1) and an insert comprising the nucleic acid fragment SEQ ID N ° 12 (ORF'2).

- Adjuvant

The adjuvant supplied by the Seppic Company subsidiary of AIR LIQUIDE is the adjuvant corresponding to the AIF SEPPIC reference.

b) Vaccination protocol

Weaned piglets aged 3 weeks are divided into four lots A, B, C and D, each comprising 8 piglets.

Lots A, B and C, 3 weeks old, each receive a first injection (M1 injection) of 1 ml containing 200 micrograms of plasmids (naked DNA) in PBS, pH: 7.2, intramuscularly for each of the plasmids mentioned below for each batch, then, at the age of 5 weeks, a second injection (M2 injection) comprising these same plasmids. A third injection is given simultaneously on the other side of the neck. This third injection comprises 1 ml of a suspension containing 5.10⁶ cells infected with recombinant baculoviruses and 1 ml of AIF SEPPIC adjuvant. Lot A (F1) (Batch testimony):<ul id="ul0029" list-style="dash" compact="compact"><li>first injection PcDNA3ORF1- plasmid, pcDNA3ORF2- plasmid and GMCSF + plasmid.</li><li>second and third injection (simultaneous) PcDNA3ORF1- plasmid, pcDNA3ORF2- plasmid and GMCSF + plasmid; Baculovirus transformed cells containing no nucleic acid insert encoding a circovirus MAP protein; AIF SEPPIC adjuvant.</li></ul>Lot B (F2) (Control lot):<ul id="ul0030" list-style="dash" compact="compact"><li>first injection PcDNA3ORF1- plasmid, pcDNA3ORF2- plasmid and GMCSF + plasmid;</li><li>second and third injection (simultaneous) PcDNA3ORF1- plasmid, pcDNA3ORF2- plasmid and GMCSF + plasmid; Baculovirus transformed cells containing no nucleic acid insert encoding a circovirus MAP protein; AIF SEPPIC adjuvant.</li></ul>Lot C (F3):<ul id="ul0031" list-style="dash" compact="compact"><li>first injection PcDNA3ORF1 + plasmid, pcDNA3ORF2 + plasmid and GMCSF + plasmid;</li><li>second and third injection (simultaneous) PcDNA3ORF1 + plasmid, pcDNA3ORF2 + plasmid and GMCSF + plasmid; Cells transformed by recombinant baculoviruses BAC ORF1 + and BAC ORF2 + capable of expressing respectively the Rep protein of sequence SEQ ID No. 14 and the protein of sequence SEQ ID No. 15 of the MAP type B circovirus. Lot D (F4) (control lot): no injection Lots of piglets B, C and D are infected (tested) at the age of 6 weeks, while lot A is not tested.</li></ul>

3) Monitoring of lots

<ul id="ul0032" list-style="dash" compact="compact"><li>cough-sneeze count: 15 minutes / lot / day;</li><li>consistency of faeces: daily;</li><li>usual records: Weekly blood test, weighing;</li><li>weighing of food refusals: 3 times a week;</li><li>calculation of the average daily gain in weight (gmq);</li></ul>

The average daily earnings were calculated for each of the prizes over a period of 28 days following the trial (cf. <figref idref="f0023">figure 10</figref>), an intermediate calculation of the gmq was also carried out for each of the lots over the first and second period of 14 days. The results obtained are reported below in Table 6.<tables id="tabl0006" num="0006"><table frame="all"><title><u>Table 6:</u> Average daily earnings</title><tgroup cols="5"><colspec colnum="1" colname="col1" colwidth="14mm" /><colspec colnum="2" colname="col2" colwidth="14mm" /><colspec colnum="3" colname="col3" colwidth="14mm" /><colspec colnum="4" colname="col4" colwidth="14mm" /><colspec colnum="5" colname="col5" colwidth="14mm" /><thead><row>&lt;entry /&gt;<entry>F1</entry><entry>F2</entry><entry>F3</entry><entry>F4</entry></row></thead><tbody><row><entry valign="middle">d0-d14</entry><entry valign="middle">411 g</entry><entry valign="middle">450 g</entry><entry valign="middle">511 g</entry><entry valign="middle">461 g</entry></row><row><entry valign="middle">d14-j28</entry><entry valign="middle">623 g</entry><entry valign="middle">362 g</entry><entry valign="middle">601 g</entry><entry valign="middle">443 g</entry></row><row><entry valign="middle">d0-d28</entry><entry valign="middle">554 g</entry><entry valign="middle">406 g</entry><entry valign="middle">556 g</entry><entry valign="middle">452 g</entry></row></tbody></tgroup></table></tables>

- Measurement of hyperthermia

The hyperthermia measurement, above 41 ° C (cf. <figref idref="f0024">figure 11</figref>) and above 40.2 ° C, was carried out for each of the lots over a total period of 28 days following the test. The results obtained, corresponding to the ratio expressed as a percentage between the number of thermal readings above 41 ° C (or above 40.2 ° C) and between the total number of thermal readings carried out on all pigs per period of one week, are reported below in Tables 7 and 8, respectively for the hyperthermia measurements greater than 41 ° C and greater than 40.2 ° C.<tables id="tabl0007" num="0007"><table frame="all"><title><u>Table 7:</u> Hyperthermia&gt; 41 ° C</title><tgroup cols="5"><colspec colnum="1" colname="col1" colwidth="14mm" /><colspec colnum="2" colname="col2" colwidth="14mm" /><colspec colnum="3" colname="col3" colwidth="14mm" /><colspec colnum="4" colname="col4" colwidth="14mm" /><colspec colnum="5" colname="col5" colwidth="14mm" /><thead><row>&lt;entry /&gt;<entry>F1</entry><entry>F2</entry><entry>F3</entry><entry>F4</entry></row></thead><tbody><row><entry valign="middle">S1</entry><entry valign="middle">4.1</entry><entry valign="middle">0.</entry><entry valign="middle">0.</entry><entry valign="middle">0.</entry></row><row><entry valign="middle">S2</entry><entry valign="middle">10.7</entry><entry valign="middle">16.</entry><entry valign="middle">0.</entry><entry valign="middle">8.9</entry></row><row><entry valign="middle">S3</entry><entry valign="middle">4.7</entry><entry valign="middle">27.</entry><entry valign="middle">0.</entry><entry valign="middle">45.</entry></row><row><entry valign="middle">S4</entry><entry valign="middle">0.</entry><entry valign="middle">0.</entry><entry valign="middle">0.</entry><entry valign="middle">7.5</entry></row></tbody></tgroup></table></tables><tables id="tabl0008" num="0008"><table frame="all"><title><u>Table 8:</u> Hyperthermia&gt; 40.2</title><tgroup cols="5"><colspec colnum="1" colname="col1" colwidth="14mm" /><colspec colnum="2" colname="col2" colwidth="14mm" /><colspec colnum="3" colname="col3" colwidth="14mm" /><colspec colnum="4" colname="col4" colwidth="14mm" /><colspec colnum="5" colname="col5" colwidth="14mm" /><thead><row>&lt;entry /&gt;<entry>F1</entry><entry>F2</entry><entry>F3</entry><entry>F4</entry></row></thead><tbody><row><entry valign="middle">S1</entry><entry valign="middle">29.1</entry><entry valign="middle">10.41</entry><entry valign="middle">29.1</entry><entry valign="middle">20.8</entry></row><row><entry valign="middle">S2</entry><entry valign="middle">28.5</entry><entry valign="middle">39.2</entry><entry valign="middle">10.7</entry><entry valign="middle">37.5</entry></row><row><entry valign="middle">S3</entry><entry valign="middle">14.3</entry><entry valign="middle">68.7</entry><entry valign="middle">25.0</entry><entry valign="middle">81.2</entry></row><row><entry valign="middle">S4</entry><entry valign="middle">3.3</entry><entry valign="middle">17.5</entry><entry valign="middle">20.0</entry><entry valign="middle">55</entry></row></tbody></tgroup></table></tables>

4) Conclusion

The records made clearly show that the animals which received the three injections of a vaccine composition comprising nucleic acid fragments of circovirus MAP according to the description and / or capable of expressing recombinant proteins of circovirus MAP, in particular of the type B, did not have hyperthermia (cf. <figref idref="f0023">figure 10</figref>). These animals did not furthermore experience a decrease in their growth, the gmqs being comparable to those of the uninfected control animals (cf.<figref idref="f0022">figure 9</figref>). They showed no particular clinical signs.

These results demonstrate the effective protection of piglets against infection by a circovirus MAP of the invention, primary agent responsible for MAP or DFP, provided by a vaccine composition prepared from a nucleic acid fragment of the nucleic sequence. of MAP circoviruses according to the description, in particular of type B, and / or from recombinant proteins encoded by these fragments of nucleic acids.

These results show in particular that the isolated proteins coded by the ORF1 and ORF2 of circovirus MAP according to the invention are immunogenic proteins inducing an effective protective response for the prevention of infection by a circovirus MAP.

EXAMPLE 6:

Serological diagnosis of Circovirus MAP by immunoassay using recombinant proteins or synthetic peptides of Circovirus MAP

A - Serological diagnosis using recombinant proteins

The identification and sequencing of porcine circovirus MAP makes it possible to produce, by genetic recombination techniques well known to man, recombinant circovirus MAP proteins.

By these techniques, recombinant proteins encoded in particular by the ORF'2 of circovirus MAP, type B, were expressed by Sf9 insect cells transformed and then isolated.

These recombinant proteins encoded by ORF'2 are extracted, after culture of the transformed sf9 cells, by thermal cell lysis using 3 cycles of freezing / thawing -70 ° C / + 37 ° C. Untransformed healthy Sf9 or control Sf9 cells are also lysed.

These two antigenic fractions originating from untransformed control Sf9 cells and from Sf9 cells expressing ORF'2 are precipitated at 4 ° C. with a 60% solution plus or minus 5% of saturated ammonium sulfate. A total protein assay is carried out using the Biorad kit. 500 ng of control Sf9 proteins and of semi-purified ORF'2 expressing Sf9 proteins, in solution in 0.05 M bicarbonate buffer pH 9.6 are passively adsorbed at the bottom of 3 different wells of a Nunc Maxisorp microplate by incubation one night at + 4 ° C.

The reactivity of pig sera with respect to each of these antigenic fractions is evaluated by an indirect ELISA reaction, the experimental protocol of which is detailed below:<ul id="ul0033" list-style="dash" compact="compact"><li>Saturation step: 200 µl / cup of PBS1X / 3% semi-skimmed milk, incubation for 1 hour 30 minutes at 37 ° C.</li><li>Washing: 200 µl / cup of PBS1X / Tween 20: 0.05%, 3 quick washes.</li><li>Serum incubation step: 100 µl / cup of serum diluted 1/100 in PBS1X / Semi-skimmed milk, 1% / Tween 20: 0.05%, incubation for 1 hour at 37 ° C.</li><li>Washing: 200 µl / cup of PBS1X / Tween 20: 0.05%, 2 quick washes followed by 2 washes of 5 min.</li><li>Conjugate incubation step: 50 µl / cup of rabbit anti-pig conjugate diluted 1/1000 in PBS1X / Semi-skimmed milk, 1% / Tween 20: 0.05%, incubation for 1 h at 37 ° C.</li><li>Washing: 200 µl / cup of PBS1X / Tween 20: 0.05%, 2 quick washes followed by 2 washes of 5 min.</li><li>Revelation Stage: 100 µl / cup of OPD substrate / Citrate Buffer / H₂O₂, incubation for 15 min at 37 ° C.</li><li>Reaction Stop: 50 µl / cup H₂SO₄ 1N.</li><li>Reading with a spectrophotometer at 490 nm.</li></ul>

Results

The results obtained are presented below in Table 9.<tables id="tabl0009" num="0009"><table frame="all"><title><u>Table 9:</u></title><tgroup cols="3"><colspec colnum="1" colname="col1" colwidth="44mm" /><colspec colnum="2" colname="col2" colwidth="61mm" /><colspec colnum="3" colname="col3" colwidth="62mm" /><thead><row><entry align="center">Antigens</entry><entry align="center">Reactivity Serum Pork not inoculated by Circovirus</entry><entry align="center">Reactivity Pig serum inoculated with Circovirus</entry></row></thead><tbody><row><entry valign="bottom">Sf9 purified control</entry><entry align="center" valign="bottom">0,076</entry><entry align="center" valign="bottom">0,088</entry></row><row><entry valign="bottom">Sf9 expressing purified ORF'2</entry><entry align="center" valign="bottom">0,071</entry><entry align="center" valign="bottom">1,035</entry></row></tbody></tgroup></table></tables>The results are expressed in optical density measured at a spectrophotometer at 490 nm during the ELISA analysis of the reactivity of pig sera inoculated or not inoculated with the circovirus MAP type B according to the protocol indicated above.

B - Serological Diagnosis by Synthetic Peptide

The epitopic mapping of the proteins coded for example by the nucleic sequences ORF1 and ORF2 of the two types of circovirus MAP (types A and B) made it possible in addition to identify immunogenic circoviral epitopes on the proteins coded by the nucleic sequences ORF'1 and ORF'2 as well as the specific epitopes of the protein coded by the ORF'2 nucleic sequence of circovirus MAP type B. Four specific epitopes of the circovirus MAP type B and one epitope common to the two types of circovirus MAP located on the protein coded by the nucleic sequence ORF'2 were synthesized in the form of peptide. Equivalent peptides in type A circovirus have also been synthesized. All these peptides were evaluated as diagnostic antigens in the context of carrying out a serological test.

Results

The results obtained are shown in Table 10 below.<tables id="tabl0010" num="0010"><table frame="topbot"><title><u>Table 10:</u> Results of the evaluation as a diagnostic antigen of synthetic peptides encoded by the nucleic sequences ORF2 and ORF'2 of circovirus MAP type A and B.</title><tgroup cols="8" colsep="0"><colspec colnum="1" colname="col1" colwidth="25mm" /><colspec colnum="2" colname="col2" colwidth="30mm" /><colspec colnum="3" colname="col3" colwidth="26mm" /><colspec colnum="4" colname="col4" colwidth="42mm" /><colspec colnum="5" colname="col5" colwidth="25mm" /><colspec colnum="6" colname="col6" colwidth="32mm" /><colspec colnum="7" colname="col7" colwidth="32mm" /><colspec colnum="8" colname="col8" colwidth="32mm" /><thead><row><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry align="center" valign="top" /><entry namest="col5" nameend="col8" align="center" valign="top"><b>Reactivity Circovirus B Infected Pork Serum</b></entry></row><row><entry align="center" valign="top"><b>Peptide</b></entry><entry align="center" valign="top"><b>Circovirus MAP type</b></entry><entry align="center" valign="top"><b>Position</b></entry><entry align="center" valign="top"><b>AA sequence</b></entry><entry align="center" valign="top"><b>EOPS D0 / D54</b></entry><entry align="center" valign="top"><b>Conventional 1 D0 / D42</b></entry><entry align="center" valign="top"><b>Conventional 2 D0 / D42</b></entry><entry align="center" valign="top"><b>Epitopic specificity</b></entry></row></thead><tbody><row rowsep="0"><entry align="center">121</entry><entry align="center">B</entry><entry align="center">71-85</entry><entry align="center">VDMMRFNINDFLPPG</entry><entry>+/-, +++</entry><entry>+/-, +++</entry><entry>-, +++</entry><entry align="center">Circovirus B</entry></row><row><entry align="center">177</entry><entry align="center">AT</entry><entry align="center">70-84</entry><entry align="center">NVNELRFNIGQFLPP</entry><entry>+/-, +</entry><entry>+/-, +/-</entry><entry>+/-, -</entry><entry align="center" /></row><row rowsep="0"><entry align="center">132</entry><entry align="center">B</entry><entry align="center">115-129</entry><entry align="center">QGDRGVGSSAVILDD</entry><entry>+/-, +/-</entry><entry>++, ++</entry><entry>+/-, +</entry><entry align="center">Circovirus B</entry></row><row rowsep="0"><entry align="center">188</entry><entry align="center">AT</entry><entry align="center">114-127</entry><entry align="center">TSNQRGVGSTVVIL</entry><entry>+/-, -</entry><entry>-, +/-</entry><entry>+/-, +/-</entry><entry align="center" /></row><row rowsep="0"><entry align="center">133</entry><entry align="center">B</entry><entry align="center">119-134</entry><entry align="center">GVGSSAVILDDNVFTK</entry><entry>-, ++</entry><entry>++, +++</entry><entry>+/-, ++</entry><entry align="center" /></row><row><entry align="center">189</entry><entry align="center">AT</entry><entry align="center">118-132</entry><entry align="center">RGVGSTVVILDANFV</entry><entry>+/-, -</entry><entry>-, +/-</entry><entry>+/-, +/-</entry><entry align="center" /></row><row rowsep="0"><entry align="center">146</entry><entry align="center">B</entry><entry align="center">171-185</entry><entry align="center">FTIDYFQPNNKRNQL</entry><entry>-, +/-</entry><entry>-, ++</entry><entry>-, ++</entry><entry align="center">Circovirus A&amp;B</entry></row><row><entry align="center">202</entry><entry align="center">AT</entry><entry align="center">170-184</entry><entry align="center">DQTIDWFQPNNKRNQ</entry><entry>+++, +++</entry><entry>+/-, ++</entry><entry>+, ++</entry><entry align="center" /></row><row rowsep="0"><entry align="center">152</entry><entry align="center">B</entry><entry align="center">195-209</entry><entry align="center">VDHVGLGTAFENSIY</entry><entry>-, ++</entry><entry>+++; +++</entry><entry>+/-, +</entry><entry align="center">Circovirus B</entry></row><row><entry align="center">208</entry><entry align="center">AT</entry><entry align="center">194-208</entry><entry align="center">NVEHTGLGYALQNAT</entry><entry>-,-</entry><entry>-, -</entry><entry>-, -</entry><entry align="center" /></row></tbody></tgroup><tgroup cols="8" rowsep="0"><colspec colnum="1" colname="col1" colwidth="25mm" /><colspec colnum="2" colname="col2" colwidth="30mm" /><colspec colnum="3" colname="col3" colwidth="26mm" /><colspec colnum="4" colname="col4" colwidth="42mm" /><colspec colnum="5" colname="col5" colwidth="25mm" /><colspec colnum="6" colname="col6" colwidth="32mm" /><colspec colnum="7" colname="col7" colwidth="32mm" /><colspec colnum="8" colname="col8" colwidth="32mm" /><tbody><row><entry namest="col1" nameend="col8" align="justify">+/-, +, ++, +++. Increasing intensities of the reactivities observed in Spot-peptides on nitrocellulose membrane. The porcine sera tested come from animals experimentally infected with type B circovirus in CNEVA animal facilities. The animals are removed before inoculation on D0 and 42 days or 54 days after inoculation on D42, D54.</entry></row></tbody></tgroup></table></tables>

EXAMPLE 7:

Characterization of specific epitopes of circovirus MAP type B

The proteins encoded by the ORF2 of porcine circoviruses type A and B were chosen for this study. For each of the ORF2 (types A and B), 56 peptides of 15 amino acids which overlap every 4 amino acids were synthesized, thus covering the whole of the protein (cf. table 11 below).<tables id="tabl0011" num="0011"><table frame="all"><title><u>Table 11:</u> Amino acid sequence of the 56 peptides of 15 amino acids synthesized from the nucleic sequence ORF'2 (type B) and ORF2 (type A) of circovirus MAP with their corresponding spot number (see Figure 12)</title><tgroup cols="4"><colspec colnum="1" colname="col1" colwidth="41mm" colsep="0" /><colspec colnum="2" colname="col2" colwidth="43mm" /><colspec colnum="3" colname="col3" colwidth="41mm" colsep="0" /><colspec colnum="4" colname="col4" colwidth="43mm" /><thead><row rowsep="0"><entry namest="col1" nameend="col2" align="center" valign="top"><b>ORF'2 type B</b></entry><entry namest="col3" nameend="col4" align="center" valign="top"><b>ORF2 type A</b></entry></row><row><entry align="center" valign="top">Spot n °</entry><entry align="center" valign="top">Sequence</entry><entry align="center" valign="top">Spot n °</entry><entry align="center" valign="top">Sequence</entry></row></thead><tbody><row rowsep="0"><entry align="center">104</entry><entry>MTYPRRRYRRRRHRP</entry><entry align="center">160</entry><entry>MTWPRRRYRRRRTRP</entry></row><row rowsep="0"><entry align="center">105</entry><entry>RRRYRRRRHRPRSHL</entry><entry align="center">161</entry><entry>RRRYRRRRTRPRSHL</entry></row><row rowsep="0"><entry align="center">106</entry><entry>RRRRHRPRSHLGQIL</entry><entry align="center">162</entry><entry>RRRRTRPRSHLGNIL</entry></row><row rowsep="0"><entry align="center">107</entry><entry>HRPRSHLGQILRRRP</entry><entry align="center">163</entry><entry>TRPRSHLGNILRRRP</entry></row><row rowsep="0"><entry align="center">108</entry><entry>SHLGQILRRRPWLVH</entry><entry align="center">164</entry><entry>SHLGNILRRRPYLVH</entry></row><row rowsep="0"><entry align="center">109</entry><entry>QILRRRPWLVHPRHR</entry><entry align="center">165</entry><entry>NILRRRPYLVHPAFR</entry></row><row rowsep="0"><entry align="center">110</entry><entry>RRPWLVHPRHRYRWR</entry><entry align="center">166</entry><entry>RRPYLVHPAFRNRYR</entry></row><row rowsep="0"><entry align="center">111</entry><entry>LVHPRHRYRWRRKNG</entry><entry align="center">167</entry><entry>LVHPAFRNRYRWRRK</entry></row><row rowsep="0"><entry align="center">112</entry><entry>RHRYRWRRKNGIFNT</entry><entry align="center">168</entry><entry>AFRNRYRWRRKTGIF</entry></row><row rowsep="0"><entry align="center">113</entry><entry>RWRRKNGIFNTRLSR</entry><entry align="center">169</entry><entry>RYRWRRKTGIFNSRL</entry></row><row rowsep="0"><entry align="center">114</entry><entry>KNGIFNTRLSRTFGY</entry><entry align="center">170</entry><entry>RRKTGIFNSRLSREF</entry></row><row rowsep="0"><entry align="center">115</entry><entry>FNTRLSRTFGYTVKR</entry><entry align="center">171</entry><entry>GIFNSRLSREFVLTI</entry></row><row rowsep="0"><entry align="center">116</entry><entry>LSRTFGYTVKRTTVR</entry><entry align="center">172</entry><entry>SRLSREFVLTIRGGH</entry></row><row rowsep="0"><entry align="center">117</entry><entry>FGYTVKRTTVRTPSW</entry><entry align="center">173</entry><entry>REFVLTIRGGHSQPS</entry></row><row rowsep="0"><entry align="center">118</entry><entry>VKRTTVRTPSWAVDM</entry><entry align="center">174</entry><entry>LTIRGGHSQPSWNVN</entry></row><row rowsep="0"><entry align="center">119</entry><entry>TVRTPSWAVDMMRFN</entry><entry align="center">175</entry><entry>GGHSQPSWNVNELRF</entry></row><row rowsep="0"><entry align="center">120</entry><entry>PSWAVDMMRFNINDF</entry><entry align="center">176</entry><entry>QPSWNVNELRFNIGQ</entry></row><row rowsep="0"><entry align="center">121</entry><entry>VDMMRFNINDFLPPG</entry><entry align="center">177</entry><entry>NVNELRFNIGQFLPP</entry></row><row rowsep="0"><entry align="center">122</entry><entry>RFNINDFLPPGGGSN</entry><entry align="center">178</entry><entry>LRFNIGQFLPPSGGT</entry></row><row rowsep="0"><entry align="center">123</entry><entry>NDFLPPGGGSNPRSV</entry><entry align="center">179</entry><entry>IGQFLPPSGGTNPLP</entry></row><row rowsep="0"><entry align="center">124</entry><entry>PPGGGSNPRSVPFEY</entry><entry align="center">180</entry><entry>LPPSGGTNPLPLPFQ</entry></row><row rowsep="0"><entry align="center">125</entry><entry>GSNPRSVPFEYYRIR</entry><entry align="center">181</entry><entry>GGTNPLPLPFQYYRI</entry></row><row rowsep="0"><entry align="center">126</entry><entry>RSVPFEYYRIRKVKV</entry><entry align="center">182</entry><entry>PLPLPFQYYRIRKAK</entry></row><row rowsep="0"><entry align="center">127</entry><entry>FEYYRIRKVKVEFWP</entry><entry align="center">183</entry><entry>PFQYYRIRKAKYEFY</entry></row><row rowsep="0"><entry align="center">128</entry><entry>RIRKVKVEFWPCSPI</entry><entry align="center">184</entry><entry>YRIRKAKYEFYPRDP</entry></row><row rowsep="0"><entry align="center">129</entry><entry>VKVEFWPCSPITQGD</entry><entry align="center">185</entry><entry>KAKYEFYPRDPITSN</entry></row><row rowsep="0"><entry align="center">130</entry><entry>FWPCSPITQGDRGVG</entry><entry align="center">186</entry><entry>EFYPRDPITSNQRGV</entry></row><row rowsep="0"><entry align="center">131</entry><entry>SPITQGDRGVGSSAV</entry><entry align="center">187</entry><entry>RDPITSNQRGVGSTV</entry></row><row rowsep="0"><entry align="center">132</entry><entry>QGDRGVGSSAVILDD</entry><entry align="center">188</entry><entry>TSNQRGVGSTVVILD</entry></row><row rowsep="0"><entry align="center">133</entry><entry>GVGSSAVILDDNFVT</entry><entry align="center">189</entry><entry>RGVGSTVVILDANFV</entry></row><row rowsep="0"><entry align="center">134</entry><entry>SAVILDDNFVTKATA</entry><entry align="center">190</entry><entry>STVVILDANFVTPST</entry></row><row rowsep="0"><entry align="center">135</entry><entry>LDDNFVTKATALTYD</entry><entry align="center">191</entry><entry>ILDANFVTPSTNLAY</entry></row><row rowsep="0"><entry align="center">136</entry><entry>FVTKATALTYDPYVN</entry><entry align="center">192</entry><entry>NFVTPSTNLAYDPYI</entry></row><row rowsep="0"><entry align="center">137</entry><entry>ATALTYDPYVNYSSR</entry><entry align="center">193</entry><entry>PSTNLAYDPYINYSS</entry></row><row rowsep="0"><entry align="center">138</entry><entry>TYDPYVNYSSRHTIT</entry><entry align="center">194</entry><entry>LAYDPYINYSSRHTI</entry></row><row rowsep="0"><entry align="center">139</entry><entry>YVNYSSRHTITQPFS</entry><entry align="center">195</entry><entry>PYINYSSRHTIRQPF</entry></row><row rowsep="0"><entry align="center">140</entry><entry>SSRHTITQPFSYHSR</entry><entry align="center">196</entry><entry>YSSRHTIRQPFTYHS</entry></row><row rowsep="0"><entry align="center">141</entry><entry>TITQPFSYHSRYFTP</entry><entry align="center">197</entry><entry>HTIRQPFTYHSRYFT</entry></row><row rowsep="0"><entry align="center">142</entry><entry>PFSYHSRYFTPKPVL</entry><entry align="center">198</entry><entry>QPFTYHSRYFTPKPE</entry></row><row rowsep="0"><entry align="center">143</entry><entry>HSRYFTPKPVLDFTI</entry><entry align="center">199</entry><entry>YHSRYFTPKPELDQT</entry></row><row rowsep="0"><entry align="center">144</entry><entry>FTPKPVLDFTIDYFQ</entry><entry align="center">200</entry><entry>YFTPKPELDQTIDWF</entry></row><row rowsep="0"><entry align="center">145</entry><entry>PVLDFTIDYFQPNNK</entry><entry align="center">201</entry><entry>KPELDQTIDWFQPNN</entry></row><row rowsep="0"><entry align="center">146</entry><entry>FTIDYFQPNNKRNQL</entry><entry align="center">202</entry><entry>DQTIDWFQPNNKRNQ</entry></row><row rowsep="0"><entry align="center">147</entry><entry>YFQPNNKRNQLWLRL</entry><entry align="center">203</entry><entry>DWFQPNNKRNQLWLH</entry></row><row rowsep="0"><entry align="center">148</entry><entry>NNKRNQLWLRLQTAG</entry><entry align="center">204</entry><entry>PNNKRNQLWLHLNTH</entry></row><row rowsep="0"><entry align="center">149</entry><entry>NQLWLRLQTAGNVDH</entry><entry align="center">205</entry><entry>RNQLWLHLNTHTNVE</entry></row><row rowsep="0"><entry align="center">150</entry><entry>LRLQTAGNVDHVGLG</entry><entry align="center">206</entry><entry>WLHLNTHTNVEHTGL</entry></row><row rowsep="0"><entry align="center">151</entry><entry>TAGNVDHVGLGTAFE</entry><entry align="center">207</entry><entry>NTHTNVEHTGLGYAL</entry></row><row rowsep="0"><entry align="center">152</entry><entry>VDHVGLGTAFENSIY</entry><entry align="center">208</entry><entry>NVEHTGLGYALQNAT</entry></row><row rowsep="0"><entry align="center">153</entry><entry>GLGTAFENSIYDQEY</entry><entry align="center">209</entry><entry>TGLGYALQNATTAQN</entry></row><row rowsep="0"><entry align="center">154</entry><entry>AFENSIYDQEYNIRV</entry><entry align="center">210</entry><entry>YALQNATTAQNYVVR</entry></row><row rowsep="0"><entry align="center">155</entry><entry>SIYDQEYNIRVTMYV</entry><entry align="center">211</entry><entry>NATTAQNYVVRLTIY</entry></row><row rowsep="0"><entry align="center">156</entry><entry>QEYNIRVTMYVQFRE</entry><entry align="center">212</entry><entry>AQNYVVRLTIYVQFR</entry></row><row rowsep="0"><entry align="center">157</entry><entry>IRVTMYVQFREFNFK</entry><entry align="center">213</entry><entry>VVRLTIYVQFREFIL</entry></row><row rowsep="0"><entry align="center">158</entry><entry>MYVQFREFNFKDPPL</entry><entry align="center">214</entry><entry>TIYVQFREFILKDPL</entry></row><row><entry align="center">159</entry><entry>VQFREFNFKDPPLNP</entry><entry align="center">215</entry><entry>YVQFREFILKDPLNE</entry></row></tbody></tgroup></table></tables>

These peptides were synthesized according to the “spot” method which consists of a simultaneous synthesis of a large number of peptides on a solid cellulose support, each place of synthesis of a peptide constituting a spot (Synt: em, NIMES). This method involves orienting the peptides on the plate, these being covalently attached by the carboxy-terminal end. A spot represents approximately 50 nmole of peptide.

The reference of the spots and the corresponding peptide sequences is given in table 11.

These membranes have been used for immunoreactivity tests against serum from EOPS pigs infected or not experimentally with the circoviral MAP type B strain as well as against sera from infected pigs, from conventional breeding (conventional farms 1 or 2). This study made it possible to highlight specific immunoreactive peptides of type B circovirus corresponding to spots N ° 121, N ° 132, N ° 133 and N ° 152 (respectively of amino acid sequences SEQ ID N ° 17, SEQ ID N ° 18, SEQ ID N ° 19 and SEQ ID N ° 20). An illustration is presented in the<figref idref="f0025">figure 12</figref> where the membranes are revealed with an infected pig serum, from a conventional breeding. Immunoreactive type-specific immunoreactive peptides have also been highlighted among which we will retain peptide No. 146 which is highly immunogenic.

A comparison between the peptide sequences of type A and B circoviruses (<figref idref="f0026">figure 13</figref>) indicates a divergence ranging from 20 to 60% for the type B immunoreactive peptides, and a lower divergence (13%) between the non-specific peptides.

Bibliographic references

<ul id="ul0034" list-style="none" compact="compact"><li><nplcit id="ncit0007" npl-type="s"><text>Allan, GM et al., 1995, Vet. Microbiol., 44: 49-64</text></nplcit>.</li><li><nplcit id="ncit0008" npl-type="s"><text>Barany, F., 1911, PNAS. USA, 88: 189-193</text></nplcit>.</li><li><nplcit id="ncit0009" npl-type="s"><text>Boulton, LH et al., 1997, J. Gen. Virol., 78 (Pt 6), 1265-1270</text></nplcit>.</li><li><nplcit id="ncit0010" npl-type="s"><text>Buckholz, RG, 1993, Yeast systems for the expression of heterologous gene products. Curr. Op. Biotechnology 4: 538-542</text></nplcit>.</li><li><nplcit id="ncit0011" npl-type="s"><text>Burg, JL et al., 1996, Mol. and Cell. Probes, 10: 257-271</text></nplcit>.</li><li><nplcit id="ncit0012" npl-type="s"><text>Chu, BCF et al., 1986, NAR, 14: 5591-5603</text></nplcit>.</li><li><nplcit id="ncit0013" npl-type="s"><text>Chu, PWG et al., 1993, Virus Research, 27: 161-171</text></nplcit>.</li><li><nplcit id="ncit0014" npl-type="s"><text>Clark, EG, 1997, American Association of Swine Practitioners, 499-501</text></nplcit>.</li><li><nplcit id="ncit0015" npl-type="s"><text>Daft, B. et al., 1996, American Association of Veterinary Laboratory Diagnosticians, 32</text></nplcit>.</li><li><nplcit id="ncit0016" npl-type="s"><text>Derse, D. et al., 1995, J. Virol., 69 (3): 1907-1912</text></nplcit>.</li><li><nplcit id="ncit0017" npl-type="s"><text>Duck, P. et al., 1990, Biotechniques, 9: 142-147</text></nplcit>.</li><li><nplcit id="ncit0018" npl-type="s"><text>Dulac, GC et al., 1989, Can. J. Vet. Res., 53: 431-433</text></nplcit>.</li><li><nplcit id="ncit0019" npl-type="s"><text>Edwards, CP, and Aruffo, A., 1993, Current applications of COS cell based transient expression systems. Curr. Op. Biotechnology 4: 558-563</text></nplcit>.</li><li><nplcit id="ncit0020" npl-type="s"><text>Edwards, S. et al., 1994, Vet. Rec., 134: 680-681</text></nplcit>.</li><li><nplcit id="ncit0021" npl-type="b"><text>Erlich, HA, 1989, In ​​PCR Technology. Principles and Applications for DNA Amplification. New York: Stockton Press</text></nplcit>.</li><li><nplcit id="ncit0022" npl-type="s"><text>Felgner, et al., 1987, Proc. Natl. Acad. Sci., 84: 7413</text></nplcit>.</li><li><nplcit id="ncit0023" npl-type="s"><text>Fontes, EPB et al., 1994, J. Biol. Chem., Vol. 269, N ° 11: 8459-8465</text></nplcit>.</li><li><nplcit id="ncit0024" npl-type="s"><text>Fraley et al., 1980, J. Biol. Chem., 255: 10431</text></nplcit>.</li><li><nplcit id="ncit0025" npl-type="s"><text>Guateli, JC et al., 1990, PNAS. USA, 87: 1874-1878</text></nplcit>.</li><li><nplcit id="ncit0026" npl-type="s"><text>Hackland, AF et al., 1994, Arch. Virol., 139: 1-22</text></nplcit>.</li><li><nplcit id="ncit0027" npl-type="s"><text>Hanson, SF et al., 1995, Virology, 211: 1-9</text></nplcit>.</li><li><nplcit id="ncit0028" npl-type="s"><text>Harding, JC, 1997, American Association of Swine Practitioners, 503</text></nplcit>.</li><li><nplcit id="ncit0029" npl-type="s"><text>Harding, RM et al., 1993, Journal of General Virology, 74: 323-328</text></nplcit>.</li><li><nplcit id="ncit0030" npl-type="s"><text>Harding, JC and Clark, EG, 1997, Swine Health and Production, Vol. 5, N ° 5: 201-203</text></nplcit>.</li><li><nplcit id="ncit0031" npl-type="s"><text>Heyraud-Nitschke, F. et al., 1995, Nucleic Acids Research, Vol. 23, N ° 6</text></nplcit>.</li><li><nplcit id="ncit0032" npl-type="s"><text>Horner, GW, 1991, Surveillance 18 (5): 23</text></nplcit>.</li><li><nplcit id="ncit0033" npl-type="b"><text>Houbenweyl, 1974, in Meuthode der Organischen Chemie, E. Wunsch Ed., Volume 15-1 and 15-II, Thieme, Stuttgart</text></nplcit>.</li><li><nplcit id="ncit0034" npl-type="s"><text>Huygen, K. et al., 1996, Nature Medicine, 2 (8): 893-898</text></nplcit>.</li><li><nplcit id="ncit0035" npl-type="b"><text>Innis, MA et al., 1990, in PCR Protocols. A guide to Methods and Applications. San Diego: Academic Press</text></nplcit>.</li><li><nplcit id="ncit0036" npl-type="s"><text>Kaneda, et al., 1989, Science, 243: 375</text></nplcit>.</li><li><nplcit id="ncit0037" npl-type="s"><text>Kievitis, T. et al., 1991, J. Virol. Methods, 35: 273-286</text></nplcit>.</li><li><nplcit id="ncit0038" npl-type="s"><text>Kohler, G. et al., 1975, Nature, 256 (5517): 495-497</text></nplcit>.</li><li><nplcit id="ncit0039" npl-type="s"><text>Kwoh, DY et al., 1989, PNAS. USA, 86: 1173-1177</text></nplcit>.</li><li><nplcit id="ncit0040" npl-type="s"><text>Ladany, S. and. al., 1989, J. Clin. Microbiol. 27: 2778-2783</text></nplcit>.</li><li><nplcit id="ncit0041" npl-type="s"><text>Lazarowitz, SG et al., 1989, The EMBO Journal, Vol. 8 No. 4: 1023-1032</text></nplcit>.</li><li><nplcit id="ncit0042" npl-type="s"><text>Luckow, VA, 1993, Baculovirus systems for the expression of human gene products. Curr. Op. Biotechnology 4: 564-572</text></nplcit>.</li><li><nplcit id="ncit0043" npl-type="s"><text>Mankertz, A. et al., 1997, J. Virol., 71: 2562-2566</text></nplcit>.</li><li><nplcit id="ncit0044" npl-type="s"><text>Matthews, JA et al., 1988, Anal. Biochem., 169: 1-25</text></nplcit>.</li><li><nplcit id="ncit0045" npl-type="s"><text>McNeilly, F. et al., 1996, Vet. Immunol. Immunopathol., 49: 295-306</text></nplcit>.</li><li><nplcit id="ncit0046" npl-type="s"><text>Meehan, BM et al., 1997, J. Gen. Virol., 78: 221-227</text></nplcit>.</li><li><nplcit id="ncit0047" npl-type="s"><text>Meehan, BM et al., 1998, J. Gen. Virol., 79: 2171-2179</text></nplcit>.</li><li><nplcit id="ncit0048" npl-type="s"><text>Merrifield, RD, 1966, J. Am. Chem. Soc., 88 (21): 5051-5052</text></nplcit>.</li><li><nplcit id="ncit0049" npl-type="s"><text>Midoux, 1993, Nucleic Acids Research, 21: 871-878</text></nplcit>.</li><li><nplcit id="ncit0050" npl-type="s"><text>Miele, EA et al., 1983, J. Mol. Biol., 171: 281-295</text></nplcit>.</li><li><nplcit id="ncit0051" npl-type="b"><text>Murphy, FA et al., 1995, Sixth Report of the International Committee on Taxonomy of Viruses. Springer-Verlag Wien New York</text></nplcit>.</li><li><nplcit id="ncit0052" npl-type="s"><text>Nayar, GP et al., 1997, Can. Vet. J. 38 (6): 385-386</text></nplcit>.</li><li><nplcit id="ncit0053" npl-type="s"><text>Olins, PO, and Lee, SC, 1993, Recent advances in heterologous gene expression in E. coli. Curr. Op. Biotechnology 4: 520-525</text></nplcit>.</li><li><nplcit id="ncit0054" npl-type="s"><text>Pagano et al., 1967, J. Virol., 1: 891</text></nplcit>.</li><li><nplcit id="ncit0055" npl-type="b"><text>Rolfs, A. et al., 1991, In PCR Topics. Usage of Polymerase Chain reaction in Genetic and Infectious Disease. Berlin: Springer-Verlag</text></nplcit>.</li><li><nplcit id="ncit0056" npl-type="b"><text>Sambrook, J. et al., 1989, In ​​Molecular cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press</text></nplcit>.</li><li><nplcit id="ncit0057" npl-type="s"><text>Sanchez-Pescador, R., 1988, J. Clin. Microbiol., 26 (10): 1934-1938</text></nplcit>.</li><li><nplcit id="ncit0058" npl-type="b"><text>Segev D., 1992, in “Non-radioactive Labeling and Detection of Biomolecules”. Kessler C. Springer Verlag, Berlin, New York: 197-205</text></nplcit>.</li><li><nplcit id="ncit0059" npl-type="b"><text>Shiver, JW, 1995, in Vaccines 1995, eds Chanock, RM Brown, F. Ginsberg, HS &amp; Norrby, E., pp.95-98, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York</text></nplcit>.</li><li><nplcit id="ncit0060" npl-type="s"><text>Tascon, RE et al., 1996, Nature Medicine, 2 (8): 888-892</text></nplcit>.</li><li><nplcit id="ncit0061" npl-type="s"><text>Tischer, I. et al., 1982, Nature, 295: 64-66</text></nplcit>.</li><li><nplcit id="ncit0062" npl-type="s"><text>Tischer, I. et al., 1986, Arch. Virol., 91: 271-276</text></nplcit>.</li><li><nplcit id="ncit0063" npl-type="s"><text>Tischer, I. et al., 1988, Zentralbl Bakteriol Mikrobiol Hyg [A] 270: 280-287</text></nplcit>. <nplcit id="ncit0064" npl-type="s"><text>Tischer, I. et al., 1995, Arch. Virol., 140: 737-743</text></nplcit>.</li><li><nplcit id="ncit0065" npl-type="s"><text>Urdea, MS, 1988, Nucleic Acids Research, 11: 4937-4957</text></nplcit>.</li><li><nplcit id="ncit0066" npl-type="s"><text>Walker, GT et al., 1992, NAR 20: 1691-1696</text></nplcit>.</li><li><nplcit id="ncit0067" npl-type="s"><text>Walker, GT et al., 1992, PNAS. USA, 89: 392-396</text></nplcit>.</li><li><nplcit id="ncit0068" npl-type="b"><text>White, BA et al., 1997, Methods in Molecular Biology, 67, Humana Press, Towota</text></nplcit>. <nplcit id="ncit0069" npl-type="s"><text>Zhao, TM et al., 1996, Proc. Natl. Adac. Sci., USA, 93 (13): 6653-6658</text></nplcit>.</li></ul>

SEQUENCE LISTING

<ul id="ul0035" list-style="none"><li>&lt;110&gt; WYETH</li><li>&lt;120&gt; SEQUENCES OF CIRCOVIRUS ASSOCIATED WITH PIGLET LOSS DISEASE (MAP)</li><li>&lt;130&gt; D17221</li><li>&lt;150&gt; <patcit id="pcit0008" dnum="FR9715396"><text>FR 97 15396</text></patcit> &lt;151&gt; 1997-12-05</li><li>&lt;160&gt; 42</li><li>&lt;170&gt; PatentIn Vers. 2.0</li><li>&lt;210&gt; 1 &lt;211&gt; 1759 &lt;212&gt; DNA &lt;213&gt; Circovirus MAP type A</li><li>&lt;220&gt; &lt;223&gt; Polarity strand + (5'-3 ')</li><li>&lt;400&gt; 1 <img file="EP2000535B1_D0001.tif" /></li><li>&lt;210&gt; 2 &lt;211&gt; 1759 &lt;212&gt; DNA &lt;213&gt; Circovirus MAP type A</li><li>&lt;220&gt; &lt;223&gt; Polarity strand - (5'-3 ')</li><li>&lt;400&gt; 2 <img file="EP2000535B1_D0002.tif" /></li><li>&lt;210&gt; 3 &lt;211&gt; 939 &lt;212&gt; DNA &lt;213&gt; Circovirus MAP type A</li><li>&lt;220&gt; &lt;223&gt; ORF1</li><li>&lt;400&gt; 3 <img file="EP2000535B1_D0003.tif" /><img file="EP2000535B1_D0004.tif" /></li><li>&lt;210&gt; 4 &lt;211&gt; 702 &lt;212&gt; DNA &lt;213&gt; Circovirus MAP type A</li><li>&lt;220&gt; &lt;223&gt; ORF2</li><li>&lt;400&gt; 4 <img file="EP2000535B1_D0005.tif" /></li><li>&lt;210&gt; 5 &lt;211&gt; 621 &lt;212&gt; DNA &lt;213&gt; Circovirus MAP type A</li><li>&lt;220&gt; &lt;223&gt; ORF3</li><li>&lt;400&gt; 5 <img file="EP2000535B1_D0006.tif" /></li><li>&lt;210&gt; 6 &lt;211&gt; 312 &lt;212&gt; PRT &lt;213&gt; Circovirus MAP type A</li><li>&lt;400&gt; 6 <img file="EP2000535B1_D0007.tif" /><img file="EP2000535B1_D0008.tif" /></li><li>&lt;210&gt; 7 &lt;211&gt; 233 &lt;212&gt; PRT &lt;213&gt; Circovirus MAP type A</li><li>&lt;400&gt; 7 <img file="EP2000535B1_D0009.tif" /><img file="EP2000535B1_D0010.tif" /></li><li>&lt;210&gt; 8 &lt;211&gt; 206 &lt;212&gt; PRI &lt;213&gt; Circovirus MAP type A</li><li>&lt;400&gt; 8 <img file="EP2000535B1_D0011.tif" /><img file="EP2000535B1_D0012.tif" /></li><li>&lt;210&gt; 9 &lt;211&gt; 1767 &lt;212&gt; DNA &lt;213&gt; Circovirus MAP type B</li><li>&lt;220&gt; &lt;223&gt; Polarity strand + (5'-3 ')</li><li>&lt;400&gt; 9 <img file="EP2000535B1_D0013.tif" /><img file="EP2000535B1_D0014.tif" /></li><li>&lt;210&gt; 10 &lt;211&gt; 1767 &lt;212&gt; DNA &lt;213&gt; Circovirus MAP type B</li><li>&lt;220&gt; &lt;223&gt; Polarity strand - (5'-3 ')</li><li>&lt;400&gt; 10 <img file="EP2000535B1_D0015.tif" /></li><li>&lt;210&gt; 11 &lt;211&gt; 945 &lt;212&gt; DNA &lt;213&gt; Circovirus MAP type B</li><li>&lt;220&gt; &lt;223&gt; ORF1</li><li>&lt;400&gt; 11 <img file="EP2000535B1_D0016.tif" /><img file="EP2000535B1_D0017.tif" /></li><li>&lt;210&gt; 12 &lt;211&gt; 702 &lt;212&gt; DNA &lt;213&gt; Circovirus MAP type B</li><li>&lt;220&gt; &lt;223&gt; ORF2</li><li>&lt;400&gt; 12 <img file="EP2000535B1_D0018.tif" /></li><li>&lt;210&gt; 13 &lt;211&gt; 315 &lt;212&gt; DNA &lt;213&gt; Circovirus MAP type B</li><li>&lt;220&gt; &lt;223&gt; ORF3</li><li>&lt;400&gt; 13 <img file="EP2000535B1_D0019.tif" /></li><li>&lt;210&gt; 14 &lt;211&gt; 314 &lt;212&gt; PRT &lt;213&gt; Circovirus MAP type B</li><li>&lt;400&gt; 14 <img file="EP2000535B1_D0020.tif" /><img file="EP2000535B1_D0021.tif" /></li><li>&lt;210&gt; 15 &lt;211&gt; 233 &lt;212&gt; PRT &lt;213&gt; Circovirus MAP type B</li><li>&lt;400&gt; 15 <img file="EP2000535B1_D0022.tif" /></li><li>&lt;210&gt; 16 &lt;211&gt; 104 &lt;212&gt; PRT &lt;213&gt; Circovirus MAP type B</li><li>&lt;400&gt; 16 <img file="EP2000535B1_D0023.tif" /><img file="EP2000535B1_D0024.tif" /></li><li>&lt;210&gt; 17 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; Circovirus MAP type B</li><li>&lt;400&gt; 17 <img file="EP2000535B1_D0025.tif" /></li><li>&lt;210&gt; 18 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; Circovirus MAP type B</li><li>&lt;400&gt; 18 <img file="EP2000535B1_D0026.tif" /></li><li>&lt;210&gt; 19 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; Circovirus MAP type B</li><li>&lt;400&gt; 19 <img file="EP2000535B1_D0027.tif" /></li><li>&lt;210&gt; 20 &lt;211&gt; 15 &lt;212&gt; PRT &lt;213&gt; Circovirus MAP type B</li><li>&lt;400&gt; 20 <img file="EP2000535B1_D0028.tif" /></li><li>&lt;210&gt; 21 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 21 tgtggcga 8</li><li>&lt;210&gt; 22 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 22 agtttcct 8</li><li>&lt;210&gt; 23 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 23 tcatttagag ggtctttcag 20</li><li>&lt;210&gt; 24 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 24 gtcaacct 8</li><li>&lt;210&gt; 25 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 25 gtggttgc 8</li><li>&lt;210&gt; 26 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 26 agcccagg 8</li><li>&lt;210&gt; 27 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 27 ttggctgg 8</li><li>&lt;210&gt; 28 &lt;211&gt; 12 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 28 tctagctctg gt 12</li><li>&lt;210&gt; 29 &lt;211&gt; 12 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 29 atctcagctc gt 12</li><li>&lt;210&gt; 30 &lt;211&gt; 12 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 30 tgtcctcctc tt 12</li><li>&lt;210&gt; 31 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 31 tctctaga 8</li><li>&lt;210&gt; 32 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 32 tgtaccaa 8</li><li>&lt;210&gt; 33 &lt;211&gt; 8 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 33 tccgtctt 8</li><li>&lt;210&gt; 34 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 34 gtgtgctcga cattggtgtg 20</li><li>&lt;210&gt; 35 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 35 tggaatgtta acgagctgag 20</li><li>&lt;210&gt; 36 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 36 ctcgcagcca tcttggaatg 20</li><li>&lt;210&gt; 37 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 37 cgcgcgtaat acgactcact 20</li><li>&lt;210&gt; 38 &lt;211&gt; 26 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 38 cctgtctact gctgtgagta ccttgt 26</li><li>&lt;210&gt; 39 &lt;211&gt; 26 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 39 gcagtagaca ggtcactccg ttgtcc 26</li><li>&lt;210&gt; 40 &lt;211&gt; 20 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 40 tggaatgtta actacctcaa 20</li><li>&lt;210&gt; 41 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 41 ggcggcgcca tctgtaacgg ttt 23</li><li>&lt;210&gt; 42 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Circovirus</li><li>&lt;400&gt; 42 gatggcgccg aaagacgggt atc 23</li></ul>