Therapeutic replenishment and enrichment of ocular surface lubrication

[0001] This application reserves the rights arising from US Provisional Application No. 61/051112, filed May 7, 2008, which is incorporated herein by reference.

FIELD OF THE INVENTION [0002] The present invention relates to regulating eye lubrication. In particular, the present invention relates to pharmaceutical compositions for the treatment of diseases associated with impaired lubrication on the corneal and conjunctival surfaces.

BACKGROUND [0003] The proteoglycan 4 (prg4) gene encodes highly glycosylated proteins referred to as megakaryocyte stimulating factor (MSF), lubrycin and surface zone protein (SZP) (1)). Lubricin was first isolated from synovial fluid and showed in vitro lubrication capacity similar to synovial fluid at the cartilage-glass interface (2). Lubricin was later identified as a synovial fibroblast product (3) and was also shown to have border lubrication capability at the latex-glass interface in Jay et al. (3-9). It was then shown that the O-linked ol (1-3) Gal-GalNAc oligosaccharides within the large mucin-like domain with 940 amino acids (10) encoded by exon 6 mediate, in part, this border lubrication capacity (8). SZP was first located on the surface of the cartilage explant from the surface zone and isolated from conditioned medium (11). SZP also has the ability to lubricate on the beetle-glass interface (12). These molecules together are called PRG4. It has also been shown that PRG4 is also present on the surface of the synovium (58), tendon (13) and meniscus (14). In addition, PRG4 has been shown to contribute, at both physiological and pathophysiological concentrations, to border lubrication of juxtaposed articular cartilage surfaces (59).

[0004] The functional significance of prg4 has been demonstrated by mutations that cause camptodactylia-arthropathy-hip deformity-pericarditis (CACP) in humans. CACP manifests itself through camptodactyly, non-inflammatory arthropathy and hypertrophic synovitis with deformity in the form of deformed hip, pericarditis and pleural effusion (15). Cartilage deterioration and subsequent joint failure were also observed in mice without PRG4 (16). Thus, PRG4 expression is a necessary component of healthy synovial joints.

[0005] PRG4 is a member of the mucin family, which generally occur in large amounts on the epithelial lining and provides many functions, including lubrication and protection against invading microbes (17). The functional properties of mucins are generally determined by specialized glycosylation patterns and their ability to form multimers through intermolecular disulfide bonds (18), both of which change in chronic diseases (e.g. cystic fibrosis, asthma) (17). The biochemical characterization of PRG4 isolated from synovial fluid (2, 19) showed molecular heterogeneity in O-glycosylation, which appears to affect lubrication properties (8). Recently, bovine synovial fluid PRG4 has been shown to exist as dimers bound through disulfide bonds, in addition to monomeric forms, as suggested by cysteine-rich conserved domains at both the N- and C-terminus, together with unpaired cysteine ​​at the C-terminus (20 ).

[0006] In tissues such as synovial joints, physicochemical methods of lubrication have been classified as fluid film lubrication or border lubrication. The operational methods of lubrication depend on normal and tangential forces on articulated tissues, on the relative speed of the tangential movement between these surfaces and on the history of both load and movement. The friction coefficient, μ, provides a quantitative measurement and is defined as the ratio of the static friction force to the normal force. One type of fluid-mediated lubrication method is the hydrostatic type. At the beginning of loading and typically for a prolonged period, pressure builds up in the interstitial fluid within the cartilage due to the two-phase nature of the tissue; fluid may also be forced into the roughness between articular surfaces via a filtration mechanism. Interstitial fluid under pressure and trapped lubricant reservoirs can thus contribute significantly to the normal load transfer at low shear resistances, thus facilitating very low μ. Also, at the beginning of loading and / or movement there is fluid film lubrication of extruded film type, hydrodynamic and elastohydrodynamic, with pressure generation, movement and deformation having the effect of introducing a viscous lubricant from and / or by a break between two surfaces in relative movement.

[0007] The significant degree to which pressure / fluid film lubrication relative to the boundary occurs classically depends on a number of factors (31). When a lubricant film can flow between compatible sliding surfaces that can deform flexibly, elastohydrodynamic lubrication occurs. Pressure, surface roughness and relative sliding speed determine when interruption of full fluid lubrication begins and lubrication enters new regimes. As the speed further decreases, lubricant films adhering to articulated surfaces begin to take part and a mixed lubrication regime occurs. If the speed decreases further and only an ultra-thin lubricant layer consisting of several molecules remains, border lubrication occurs. The boundary lubrication method is therefore indicated by the coefficient of friction (the ratio of the measured friction force between two contacting surfaces in relative movement to the applied normal force) during constant sliding, which does not change with factors that affect the formation of the fluid film, such as relative slip velocity and axial load (35). In the case of articular cartilage, borderline lubrication has been found to occur for sure, although supplemented with fluid pressure and other mechanisms (36-39).

[0008] In boundary lubrication, the load is supported by surface-to-surface contact and the associated friction properties are determined by the lubricant's surface particles. It has been proposed that this method is important because opposing layers of cartilage contact in more than ~ 10% of the total surface and this may be where most of the friction occurs (30). In addition, with increasing load times and the dispersion of hydrostatic pressure, surfaces coated with a lubricant carry an increasing proportion of the load relative to the fluid under pressure and, as a consequence, this method is becoming increasingly dominant (31, 32). In fact, boundary lubrication reduces friction vibrations (31), and thus manifests itself as reduced drag during steady state motion and when motion begins. The last situation is appropriate for articulated surfaces carrying load after prolonged loading under pressure (e.g. sitting or in vivo condition) (33). Typical cartilage surface wear patterns (34) also suggest that border lubrication of articular cartilage is critical to protecting and maintaining articular surface structure.

[0009] With increasing load time and the dispersion of hydrostatic pressure, surfaces coated with a lubricant carry an increasing proportion of the load relative to the fluid under pressure and, as a consequence, μ may become increasingly dominated by this lubrication method. The limit lubrication method is indicated by μ values ​​during constant sliding, which do not change with the factors that affect the formation of the fluid film, such as relative slip velocity and axial load. Boundary lubrication, in essence, reduces frictional vibrations and thus manifests itself as reduced drag both during steady state motion and when motion begins.

[0010] Accumulation of PRG4 within the synovial fluid and on the articular surface are probably key functional determinants of PRG4's border lubrication ability. It has recently been found that significant, three-fold higher PRG4 secretion results from the dynamic shear load of cultured cartilage explants compared to free swelling or statically compressed cultures (27). This PRG4 synthesis and secretion by chondrocytes can significantly contribute to the concentration of PRG4 in synovial fluid, both in homeostatic and pathological conditions, where physiological regulators are present (23). Although the amount of surface-associated PRG4 does not appear to correlate with the rate of secretion, previous studies suggest that surface-associated PRG4 may exchange with endogenous PRG4 in synovial fluid (25), especially under the influence of mechanical disorders (26, 27). An explanation of the spatial and temporal aspects of PRG4 metabolism within the joint, especially on the joint surface, would also help to understand how PRG4 contributes to the low friction properties of articular cartilage and may lead to the development of therapies to prevent loss of this function (40, 41). More remains to be determined regarding the processing and potential additional or alternative functions of different PRG4 molecules with different molecular weights (10, 27, 28, 61). In addition, a combination of chemical and mechanical factors that stimulate PRG4 expression in chondrocytes close to the joint surface may be useful for tissue cartilage formation from isolated sub-populations (29) with a surface that is bioactive and functional in lubrication.

[0011] Precision boundary lubrication mechanisms on biological contact surfaces are not currently known. However, proteoglycan 4 (PRG4) may play a critical role as a border lubricant in joint joints. It is believed that this secreted glycoprotein protects cartilage surfaces against frictional forces, cell adhesion and protein deposition. Various native and recombinant lubrycin proteins and isoforms have been isolated and characterized. US 2007/275032 describes the lubricating effect of PRG4 in cartilage. PRG4 isolated from human articular cartilage is to act as a chondroprotective molecule that provides protection for the underlying cartilage cells. In US Patent Nos. 5,326558; 6433142; 7030223 and 7361738 disclose a family of human megakaryocyte stimulating factors (MSFs) and pharmaceutical compositions containing one or more of such MSFs for the treatment of disease states or disorders such as platelet deficiency. US Patent Nos. 6,960,562 and 6,743,774 also disclose a lubricating polypeptide, a tribonectin, comprising essentially pure MSF fragments, and methods for lubricating joints or other tissues by administering tribonectin systemically or directly to tissues.

[0012] US 2007/249557 discloses that PRG4 expressed by surface chondrocytes is involved in border lubrication of cartilage joints.

[0013] US 2005/009893 discloses an ophthalmic lubricating solution adapted for use in lasik-type surgical procedures, comprising a viscosity enhancer selected from proteoglycans, cellulose derivatives, collagen or modified collagen, galactomannans, xanthan gum, gellan gum, alginate, chitosans, poly (vinyl alcohol) and carboxyvinyl polymers.

SUMMARY OF THE INVENTION [0014] The present invention provides, in various forms, pharmaceutical compositions for regulating ocular lubrication, including therapeutically supplementing or enriching lubricant molecules bordering the eye surface. In some embodiments of the present invention, the observation is described that PRG4 mRNA is expressed in human corneal and conjunctival epithelial cells, as well as in the mouse tear glands and Meiboma, indicating that the PRG4 protein is present in these tissues on the surface of the eye. In some cases of the present invention, it has been observed that the role of the PRG4 protein on the eye surface is to protect the cornea and conjunctiva from significant shear forces generated during eyelid blinking, wearing contact lenses and other undesirable conditions. The effects of tear film, including the effects of inflammation, proinflammatory cytokines, imbalance of sex steroids and proteases on the composition and function of films suggest a course of therapy for ocular tissues that promote border lubrication.

[0015] In certain embodiments, the present invention provides a pharmaceutical composition suitable for topical application to the eye surface, comprising a therapeutically effective concentration of PRG4 protein suspended in an ophthalmically acceptable balanced salt solution. The pharmaceutical composition of the present invention may also contain one or more ophthalmically acceptable agents selected from the group consisting of an ophthalmically acceptable soothing agent, an ophthalmically acceptable excipient, an ophthalmically acceptable astringent, an ophthalmically acceptable vasoconstrictor, and an ophthalmically acceptable emollient.

[0016] Exemplary ophthalmically acceptable soothing agents contemplated by the present invention include, but are not limited to, sodium carboxymethyl cellulose (e.g., about 0.2 to 2.5% w / v), hydroxyethyl cellulose (e.g., about 0.2 to 2, 5% w / v), hypromellose (e.g. about 0.2 to 2.5% w / v), methylcellulose (e.g. about 0.2 to 2.5% w / v), dextran 70 (e.g. about 0.1% w / v), gelatin (e.g. about 0.01% w / v), glycerin (e.g. about 0.2 to 1% w / v), polyethylene glycol 300 (e.g. 0.2 to 1% w / v), polyethylene glycol 400 (e.g. about 0.2 to 1% w / v), polysorbate 80 (e.g. about 0.2 to 1% w / v) ), propylene glycol (e.g. about 0.2 to 1% w / v), polyvinyl alcohol (e.g. about 0.1 to 4% w / v), povidone (e.g. about 0.1 to 2% w / v). Exemplary ophthalmically acceptable excipients / softeners contemplated by the present invention include anhydrous lanolin (e.g., about 1 to 10% w / v), lanolin (e.g. about 1 to 10% w / v), light mineral oil (e.g. <about 50% w / v), mineral oil (e.g. <about 50% w / v), paraffin (e.g. < about 5% w / v), petrolatum (e.g. <about 100% w / v), wax ointment (e.g. <about 100% w / v), white petrolatum (e.g. <about 100% w / v), white wax (e.g. <about 5% w / v), yellow wax (e.g. <about 5% w / v). Exemplary ophthalmically acceptable astringent contemplated by the present invention includes zinc sulfate (e.g. 0.25% w / v). Exemplary ophthalmically acceptable vasoconstrictors contemplated by the present invention include ephedrine hydrochloride (e.g., about 0.123% w / v), naphazoline hydrochloride (e.g., about 0.01 to about 0.03% w / v), phenylephrine hydrochloride (e.g., about 0.08 to about 0.2% w / v) and tetrahydrozoline hydrochloride (e.g., about 0.01 to about 0.05% w / v).

[0017] In some of these forms, soothing agents, excipients, astringents, vasoconstrictors, emollients and electrolytes provide means for delivering the PRG4 protein in an ophthalmically acceptable manner. Ophthalmically acceptable compositions are suitable for topical application to the eye surface if, after application, they do not exhibit unacceptable eye toxicity, burning, itching, stickiness, blurred vision, etc.

[0018] In some embodiments, the pharmaceutical composition of the present invention further comprises a therapeutically effective concentration of one or more additional therapeutic agents, including sodium hyaluronate, hyaluronic acid and phospholipid. Exemplary phospholipids include La-dipalmitoyl phosphatidylcholine, phosphatidylcholine, phosphatidylethanolamine and sphingomyelin.

[0019] In some embodiments, the present invention provides a pharmaceutical composition suitable for topical application to the eye surface, comprising a therapeutically effective concentration of PRG4 protein suspended in an ophthalmically acceptable balanced salt solution, containing at least three electrolytes, including but not limited to sodium chloride (NaCl ) 0.64%, potassium chloride (KCl) 0.075%, calcium chloride dihydrate (CaCl2 <H2O) 0.048%, magnesium chloride hexahydrate (MgCl2 ^ 6H2O) 0.03%, sodium acetate trihydrate (C2H3NaO2AH2O) 0.39%, sodium citrate dihydrate (C6H5Na3O7 <H2O) 0.17%, sodium hydroxide and / or hydrochloric acid (to bring pI to about 7.5) with an osmolarity of about 300 milliosmoles / l.

[0020] In some embodiments, the present invention provides a pharmaceutical composition suitable for topical application to the eye surface comprising a therapeutically effective concentration of PRG4 protein suspended in an ophthalmically acceptable balanced salt solution consisting of sodium (Na +) at a concentration of about 128 mM, potassium (K +) at a concentration of about 24 mM, chloride (Cl-) at a concentration of about 113 mM, calcium (Ca2 +) at a concentration of about 0.4 mM, magnesium (Mg2 +) at a concentration of about 0.3 mM, HCO3 - at a concentration of about 5 mM, citrate at a concentration of about 1 mM, phosphate at a concentration of about 14 mM, acetate at a concentration of about 15 mM and sodium hydroxide and / or hydrochloric acid (to bring pI to about 7.5) with an osmolarity of about 300 milliosmoles / l.

[0021] The present document further describes a method of treating eye lubrication deficiency or related symptoms in an individual in need thereof. The method includes topical administration to the surface of an eye in need thereof, a pharmaceutical composition comprising a therapeutically effective concentration of PRG4 protein. In certain embodiments, a pharmaceutical composition comprising a PRG4 protein is administered in combination with an ophthalmically acceptable formulation containing one or more ophthalmically acceptable agents selected from the group consisting of an ophthalmically acceptable soothing agent, an ophthalmically acceptable excipient, an ophthalmically acceptable astringent, an ophthalmically acceptable vasoconstrictor, and ophthalmically acceptable emollient.

[0022] In some embodiments, the pharmaceutical composition comprising the PRG4 protein is administered in combination with an ophthalmically acceptable solution containing a therapeutically effective concentration of sodium hyaluronate or hyaluronic acid or phospholipid surfactant as discussed above. Still in some embodiments, the pharmaceutical composition comprising the PRG4 protein is administered in combination with a phosphate buffered saline solution or an ophthalmically acceptable balanced saline solution containing one or more electrolytes, as discussed above.

[0023] This document describes a method of treating or associated eye lubrication deficiency that is caused by loss of tears or an unstable tear film in an ocular border loop, such as androgen deficiency, Sjogren's syndrome and dry keratoconjunctivitis (KCS). Such a method involves topically administering to the surface of the eye of the patient in need a pharmaceutical composition of the present invention.

[0024] In some embodiments, the present document further describes a method of remedying and treating conditions associated with adverse or insufficient lubrication in the eye. Exemplary conditions include, but are not limited to, dry eye disease due to watery component deficiency or excessive evaporation, Sjogren's syndrome, dry keratoconjunctivitis, androgen deficiency, Meiboma gland disease, estrogen replacement therapy, wearing contact lenses, refractive surgery, allergy, reduced tear film interruption time, allergy, eye surface disorders, increased levels of tear film and eye surface proteases, chronic inflammation, hyperosmolarity and aging.

BRIEF DESCRIPTION OF THE DRAWINGS [0025]

Figure 1 shows feedback loops within boundary lubrication of the eye surface.

Figure 2 shows the expression of PRG4 mRNA in human corneal epithelial cells. Human corneal epithelial cells were isolated from corneal scleral rings from men and women as donors. The amplified samples were screened for the presence of PRG4 products using an Agilent 2100 Bioanalyzer device. Vertical paths include: L. Marker MW; 1. Control without matrix; 2. Corneal tissue from a 33-year-old woman; 4. Cultured corneal epithelial cells from a 70-year-old woman; 6. Cultured corneal epithelial cells from a 53-year-old male.

Figure 3 shows the expression of PRG4 mRNA in human conjunctival epithelial cells. Human corneal epithelial cells were isolated from corneal scleral rings from men and women as donors. The amplified samples were screened for the presence of PRG4 products using agarose gel electrophoresis. Vertical paths include: 1. Marker MW; 2. Control without matrix; 4. Human conjunctiva of women; 5. Human conjunctiva of men.

Figure 4 shows the expression of PRG4 mRNA in human corneal scleral ring tissue samples. L. Human corneal epithelial cells were isolated from corneal scleral rings from men and women as donors. The amplified samples were screened for the presence of PRG4 products using an Agilent 2100 Bioanalyzer device. Vertical paths include: Marker MW; 1. Human liver cDNA pattern; 2. Corneal scleral ring tissue from a 24-year-old woman; 3. Corneous-scleral ring tissue from a 51-year-old woman; 4. Human conjunctival epithelial cells.

Figure 5 shows the expression of PRG4 mRNA in human conjunctival cytological imprint samples. Conjunctival cytological specimens were isolated to men and women as donors. The amplified samples were screened for the presence of PRG4 products using an Agilent 2100 Bioanalyzer device. Vertical paths include: L. Marker MW; 1-9. Conjunctival cytological specimens; 10. Repetition with human conjunctival epithelial cells (lane 4 in Figure 3).

Figure 6 shows a friction test diagram. The corneal eye surface (605) was attached to the spherical neutral end of the impervious semi-rigid cylinder (603) of the rubber stopper (radius r = 6 mm). The plug cylinder (603) was attached to the rotary actuator of a mechanical testing machine (Bose ELF 3200), forming a bottom surface articulated. The ring (601) (outer radius = 3.2 mm, inner radius = 1.5 mm) is punched out of the eyelid (604). The ring (601) is connected to a linear actuator coupled to the load cells of axial load (N) and torsion (τ), forming the upper surface articulated. The lubricating bath (602) was created by attaching an inert tube around the plug cylinder (603). ω is the angular frequency.

Figure 7 shows the in vitro reduction of eyelid / corneal kinetic friction with the addition of the PRG4 (or lubricin) protein.

Figure 8 shows the in vitro reduction of eyelid / corneal kinetic friction measured 1 minute after the addition of PRG4 (or lubricin) protein.

Figure 9 shows the in vitro reduction of eyelid / corneal kinetic friction measured 5 minutes after the addition of PRG4 (or lubricin) protein.

Figure 10 shows the in vitro reduction of eyelid / corneal kinetic friction over time after the addition of PRG4 (or lubricin) protein.

DETAILED DESCRIPTION OF THE INVENTION [0026] In some embodiments, there is provided a pharmaceutical composition comprising PRG4 or a lubricating fragment thereof, for use in the treatment of, insufficiency in the eye or associated symptoms, by topical application to the eye surface. Also provided herein is a pharmaceutical composition suitable for topical application to the eye surface, comprising a therapeutically effective amount of PRG4 suspended in an ophthalmically acceptable balanced salt solution, and optionally also in combination with one or more ophthalmically acceptable agents selected from the group consisting of an ophthalmically acceptable soothing agent, an ophthalmically acceptable excipient, ophthalmically acceptable astringent, an ophthalmically acceptable vasoconstrictor and an ophthalmically acceptable emollient.

[0027] In some embodiments, pharmaceutical compositions are provided herein for the treatment of an eye lubrication deficiency on an ocular surface (e.g., deficiency such as reduced or undesirable ocular border lubrication). The pharmaceutical composition in certain embodiments of the present invention comprises an isolated or purified PRG4 protein suspended in an ophthalmically acceptable balanced salt solution in combination with one or more ophthalmic agents selected from the group consisting of an ophthalmic soothing agent, an excipient, an astringent, a vasoconstrictor, and an emollient. In some embodiments, any pharmaceutical composition provided herein further comprises one or more additional therapeutic agents selected from the group consisting of sodium hyaluronate, surfactant phospholipids, and electrolytes in a pharmaceutically acceptable topical carrier.

[0028] The present invention provides, in some embodiments, a new approach to regulating ocular lubrication, including therapeutic replenishment and enrichment of lubricant molecules bordering the surface of the eye. It should be noted that the importance and mechanism of border lubrication in the eye has not yet been recognized in the ophthalmic community. For years, the scientific consensus in the orthopedic research community was that hydrodynamic lubrication was until now the dominant way of lubricating articular cartilage, and that border lubrication was simply a later thought. In addition, these scientists investigating boundary lubrication on cartilage surfaces suggest that boundary lubrication is probably the only one important at "high load and low speed" that is opposed to conditions on the eye surface where there are relatively low axial loads and relatively high sliding speeds. See, e.g. (54). In addition, border lubrication involving corneal glycocalyx has not been considered to date. Jay et al. compared the purified lubricant from bovine synovial fluid with "mucous glycoprotein from human submandibular saliva and stimulated tears" and found that "mucin secreted by the lacrimal gland did not cause lubrication", not paying attention to the possibility that the corneal epithelium was the source of the lubricant or, that border lubrication was an important factor in the eye's surface. See, e.g. (55). The latest mathematical models of tear film dynamics also ignore the possibility of border lubrication, providing "approximate lubrication" to the height of the tear film so that the "mucus layer on the cornea can be compressed providing a non-slip surface for the water film", and that "it should be noted that the model only evolution before reaching [thickness of tear film] with a certain critical small value at which the model breaks down. "See, e.g. (57).

[0029] There is a need to regulate eye lubrication and protect the cornea and conjunctiva from significant shear forces generated by the undesirable conditions described herein, including, as a non-limiting example, dry eye disease resulting from a deficiency of aqueous component or from excessive evaporation, Sjogren's syndrome, dry inflammation conjunctiva and cornea, androgen deficiency, Meiboma gland disease, estrogen replacement therapy, wearing contact lenses, refractive surgery, allergy, reduced tear film interruption time, allergy, eye surface disorders, increased levels of tear film and ocular surface proteases, chronic inflammation, hyperosmolarity and aging.

[0030] In some cases, the load on the cornea and conjunctiva is probably dominated by shear forces. In some cases, eyelid blinking, as well as wearing contact lenses, creates significant stress on the epithelial cells of the eye surface, and this is especially true in the presence of a disturbed tear film. As shown in Figure 1, it is suggested that increased shear stress leads to instability of the tear film, evaporating loss of tears, hyperosmolarity, changes in edema pressure, and a reversal of shear stress. In some cases, it is also believed that increased shear stress causes inflammation, androgen deficiency, and reduced expression of proteoglycans. In some cases, increased shear stress and its consequences may, over time, lead to a loss of boundary lubrication on the eye surface.

[0031] Lubrication deficiency in the eye and related symptoms can be determined by any suitable method. In some cases, the lack of lubrication in the eye and the symptoms associated with it is determined either qualitatively (e.g., feeling of poor lubrication, dry eye, discomfort, etc.) or quantitatively (e.g., measured by mechanical, biochemical, electrical, optical or other quantitative methods of testing) ).

[0032] In some cases, under undesirable conditions for border lubrication in the eye, such as those resulting from dry eye disease resulting from a deficiency of watery component or from excessive evaporation, Sjogren's syndrome, dry keratoconjunctivitis, androgen deficiency, Meibom's disease, estrogen replacement therapy, wearing contact lenses, refractive surgery, allergies, reduced tear film break time, allergies, eye surface disorders, increased levels of proteases in the tear film and on the surface of the eye, chronic inflammation, hyperosmolarity and aging, there will be a disturbed tear film. In some of these situations, increased evaporation may exclude effective fluid film lubrication, but allows boundary lubrication and a molecular sacrificial mechanism to reduce shear stress on the cell surface. Certain embodiments of the present invention ensure that the therapeutic replenishment and enrichment of lubricant molecules border the eye surface disrupts the feedback loop through which adverse conditions associated with a lack of lubrication in the eye endanger the eye surface. [0033] In some cases, as provided herein, the PRG4 protein plays a critical role in the eye as a border lubricant. In some cases, this secreted glycoprotein protects the eye surface, protecting the cornea and conjunctiva from significant shear forces generated during eyelid blinking, wearing contact lenses and any other undesirable border lubrication in the eye caused by chronic inflammation and hyperosmolarity that result from dry eye disease, deficiency androgens, estrogen replacement therapy, disturbed tear film, allergies, aging, eye surface diseases and increased levels of proteases in the tear film and on the surface of the eye. Given the relationship between osmotic pressure and electromechanical interactions within charged molecules, the present invention provides, in some embodiments, a pharmaceutical composition for regulating ocular lubrication deficiency by modulating hyperosmolarity or osmolarity on the eye surface by disrupting feedback mechanisms that prevent reduction of friction coefficients by secreted components and mitigation of shear stress.

[0034] In another exemplary embodiment, the present invention includes a sacrificial mechanism for borderline lubrication through which surface-associated receptors reversibly bind one or more gel-forming or surfactant constructs. In some cases, gel forming or surfactant constructs detach during the shear event, thereby preventing shear stresses (or reducing shear stresses) from reaching the epithelial surface. In some embodiments, after a transient shear event, gel-forming and surfactant constructs that can return to their undisturbed equilibrium re-bind to surface-associated receptors. In some embodiments, the entire construct may detach during shearing. It is conceivable, in some cases, that, according to the thermodynamics of this equilibrium, the likelihood of release from receptors increases with increasing shear amplitude, but any of these connections is easily reversible.

[0035] In one embodiment of the present invention, a pharmaceutical composition comprising a PRG4 protein suspended in an ophthalmically acceptable balanced salt solution is applied topically to the surface of the eye where the PRG4 protein binds or binds. In some cases of this form, PRG4 acts as a membrane-bound receptor that can interact with endogenous proteins and proteoglycans within the tear film, establishing a sacrificial mechanism to reduce friction when blinking the eyelid on the eye surface, preventing protein adsorption on the eye surface and reducing dry spots caused by transient tear film.

[0036] In another embodiment of the present invention, PRG4 is used topically and binds or binds to the eye surface in combination with one or more hyaluronic acid and phospholipid constructs. In some cases of this form, PRG4 acts as a membrane-bound receptor that interacts with exogenously supplied hyaluronic acid and / or phospholipids, establishing a sacrificial mechanism to reduce friction when blinking the eyelid on the eye surface, prevent protein adsorption on the eye surface, and reduce dry spots caused by the impermanence of the tear film. In this embodiment, the hyaluronic acid and phospholipid constructs are dissociated from PRG4 during the shear event. In yet another embodiment, the entire construct detaches during a shear event to prevent shear stresses from reaching the epithelium.

[0037] In yet another embodiment, functional fragments, multimers (e.g. dimers, trimers, tetramers, etc.), PRG4 homologs or orthologs act as a surface receptor and / or gel forming constructs in a sacrificial mechanism. Functional fragments and homologues of PRG4 include those with fewer repeats within the central mucin-like domain with KEPAPTT repeats (SEQ ID NO: 4), glycosylated and non-glycosylated forms of the protein, splice variants, recombinant forms and the like. The lubricating fragment PRG4 exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of the ophthalmic lubricating effect of human PRG4, as measured qualitatively, mechanically, optically, electrically or in a test biochemical.

[0038] As used herein, the term "PRG4", "PRG4 protein" or the "proleoglycan 4" protein is used interchangeably with the term "lubrycin" protein. PRG4 as used herein also includes the term megakaryocyte stimulating factor (MSF) which has been accepted for the UCL / HGNC / HUGO Human Gene Nomenclature database and surface zone protein (SZP). The term PRG4 protein or lubricant as used herein refers to any isolated or purified native or recombinant lubrycin proteins, homologues, functional fragments or motifs, isoforms and / or their mutated forms. In some embodiments, an isolated or purified PRG4 protein comprises the amino acid sequence of human native or recombinant lubricin protein. In other embodiments, an isolated or purified PRG4 protein includes the amino acid sequence encoded by the exons of the prg4 gene that encode the primary full-length PRG4 protein structures or isoforms. The proteoglycan 4 (prg4) gene contains 12 exons. The PRG4 protein used herein includes the amino acid sequence encoded by exons 1-12 of the prg4 gene, more preferably exons 6-12, and most preferably exons 9-12.

[0039] The term PRG4 protein as used herein includes any PRG4 proteins currently known or described later. In some embodiments, a preferred amino acid sequence of the PRG4 protein is given as SEQ ID NO: 1. The PRG4 protein has the same primary amino acid structure as any known PRG4 proteins or isoforms with at least 60% homology, preferably 75% homology, more preferably 85%, 90%, 95%, 96%,

97%, 98%, 99% or more homology. In some embodiments, a preferred PRG4 protein has an average molar mass between 50 kDA and 400 kDa, comprising one or more biologically active parts of the PRG4 protein or functional fragments, such as a lubricating fragment or homologue thereof.

[0040] The term PRG4 protein as used herein includes the biologically active portion of the protein. As used herein, the term "biologically active portion" of a PRG4 protein includes a functional protein fragment comprising amino acid sequences sufficiently homologous to, or obtained from, an amino acid sequence of a protein that includes fewer amino acids than a full-length protein and has at least one full-length protein activity. Typically, the biologically active portion includes a functional domain or motif with at least one protein activity. The biologically active part of the protein may be a polypeptide that is, for example, 10, 25, 50, 100, 200 or more amino acids in length. In one embodiment, the biologically active portion of the PRG4 protein can be used as a therapeutic agent alone or in combination with other therapeutic agents for the treatment of unwanted or reduced border lubrication in the eye.

[0041] The nucleic acid and amino acid sequences of several native and recombinant PRG4 or lubrycin proteins and the characteristics of PRG4 proteins and various isoforms are disclosed, for example, in US Patent Nos. 5,326558; 6433142; 7030223; 7361738, Turner et al., And in US Patent Nos. 6,743,774 and 6,960,562, Jay et al. In US Publication No. 20070191268, Flannery et al. also disclosed are recombinant PRG4 or lubrycin molecules useful in the present invention.

[0042] Methods for isolating, purifying and recombinantly expressing a PRG4 protein are well known in the art. In some embodiments, the method is started by cloning and isolating mRNA and cDNA encoding PRG4 proteins or isoforms using standard molecular biology techniques such as PCR or RT-PCR. The isolated cDNA encoding the PRG4 protein or isoform is then cloned into an expression vector and further transformed with it and expressed in a host cell to produce a recombinant PRG4 protein.

[0043] The term "recombinant" as used herein refers to a polynucleotide synthesized or otherwise manipulated in vitro (e.g., "recombinant polynucleotide"), methods for using recombinant polynucleotides to produce gene products in cells or other biological systems, or an encoded polypeptide ("recombinant protein") by a recombinant polynucleotide. "Recombinant" also includes ligation of nucleic acids having different coding regions or domains or promoter sequences from various sources into an expression cassette or expression vector, e.g., with inducible or constitutive expression of a fusion protein comprising the active domain of the PRG4 gene, and a nucleic acid sequence amplified using a starter according to the invention.

[0044] In some embodiments, the PRG4 protein encoding the nucleic acid may contain one or more mutations, deletions or insertions. In such embodiments, the nucleic acid encoding the PRG4 protein has at least 60% homology, preferably 75% homology, more preferably 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homology to the nucleic acid encoding the protein Wild type PRG4.

[0045] The term "cDNA" as used herein includes DNA that is complementary to mRNA molecules present in the cell or mRNA in the body that can be converted to cDNA using an enzyme such as reverse transcriptase. In some embodiments, the cDNA encoding the PRG4 protein is isolated from PRG4 mRNA expressed in human corneal or conjunctival epithelial cells using an RTPCR method well known in the art.

[0046] As used herein, the terms "polynucleotide", "nucleic acid / nucleotide" and "oligonucleotide" are used interchangeably and include polymeric forms of nucleotides of any length, deoxyribonucleotides or ribonucleotides, or analogs thereof. Polinu11 kleotides may have any three-dimensional structure and may perform any function, known or unknown. Below are non-limiting examples of polynucleotides: gene or gene fragment, exons, introns, matrix RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, DNA, cDNA, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, any DNA of any kind sequence, isolated RNA of any sequence, nucleic acid probes and primers.

Polynucleotides can be naturally occurring, synthetic, recombinant or any combination thereof.

[0047] A polynucleotide may include modified nucleotides such as methylated nucleotides and nucleotide analogues. If present, modifications to the nucleotide structure may be violated before or after polymer assembly. Non-nucleotide components may be present as members in the nucleotide sequence. The polynucleotide can also be modified after polymerization, such as by coupling to a labeling component. The term also includes both double- and single-stranded molecules. Unless otherwise specified or required, any form of this invention that is a polynucleotide includes both a double-stranded form and each of two complementary single-stranded forms known or anticipated to form the double-stranded form.

[0048] The term "polynucleotide sequence" as used herein means an alphabetical representation of the polynucleotide molecule. A polynucleotide consists of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) in place of thymine when the polynucleotide is RNA instead of DNA. This alphabetic representation can be inserted into computer databases and used for bioinformatics applications such as functional genomics and homology search, for example.

[0049] The term "isolated polynucleotide / cDNA" as used herein includes polynucleotide molecules that have been separated from other polynucleotide molecules that are present in a natural polynucleotide source. For example, when referring to genomic DNA, the term "isolated" includes polynucleotide molecules that have been separated from the chromosome to which the genomic DNA is naturally associated. Preferably, the "isolated" polynucleotide is free of sequences that naturally flank the polynucleotide (ie, sequences located at the 5 'and 3' ends of the polynucleotide of interest) in the genomic DNA of the organism from which the polynucleotide was derived. For example, in various embodiments, an isolated polynucleotide molecule encoding a PRG4 protein used in the invention may contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank a polynucleotide molecule in the genomic DNA of the cell from which the polynucleotide was derived. In addition, an "isolated" polynucleotide molecule, such as a cDNA molecule, may be substantially free of other cellular material or culture medium, if produced by recombinant techniques, or substantially free of chemical precursors or other chemical agents when chemically synthesized.

[0050] The term "gene" as used herein includes a polynucleotide comprising at least one open reading frame that is capable of encoding a particular polypeptide or protein after transcription and translation. Any of the polynucleotide sequences described herein can also be used to identify larger fragments or full-length coding sequences of the gene to which they are associated. Methods for isolating larger sequence fragments are known to those skilled in the art. As used herein, the term "native or naturally occurring" polynucleotide molecule includes, for example, an RNA or DNA molecule having a nucleotide sequence that occurs in nature (eg, encodes a natural protein).

[0051] The terms "polypeptide" or "protein" as used herein are interchangeable and include the association of two or more amino acid subunits, amino acid analogs or peptidomimetics. The subunits can bind via peptide bonds. In other forms, the subunit may bind through other bonds, e.g., ester, ether, etc. The term "amino acid" as used herein includes natural and / or unnatural or synthetic amino acids, including glycine and optical D and L isomers and amino acid analogs and peptidomimetics. A peptide with three or more amino acids is commonly called an oligopeptide. Peptide chains larger than three or more amino acids are called a polypeptide or protein.

[0052] In some embodiments, the PRG4 protein used herein refers to PRG4 proteins or their various homologues or isoforms that are expressed naturally or recombinantly in humans or in other host cells. The term "express" or "expression" as used herein includes the process by which polynucleotides are transcribed into RNA and / or translated into polypeptides. If the polynucleotide was derived from genomic DNA, expression may include RNA splicing if the appropriate eukaryotic host was selected. The regulatory elements required for expression include promoter sequences for binding RNA polymerase and transcription initiation sequences for ribosome binding. For example, the bacterial expression vector contains a promoter, such as a lac promoter, and a Shine-Dalgarno sequence and AUG start codon for transcription initiation. Similarly, the eukaryotic expression vector includes a heterologous or homologous promoter for RNA II polymerase, the following polyadenylation signal, the AUG start codon and the ribonome termination codon. Such vectors can be obtained commercially or assembled via sequences described in methods well known in the art, for example, methods described below for constructing vectors in general. The term "vector" as used herein includes a self-replicating nucleic acid molecule that carries the inserted polynucleotide into and / or between host cells. The term is intended to include vectors whose function is primarily to introduce the nucleic acid molecule into the cell, replication vectors whose function is primarily to replicate the nucleic acid, and expression vectors whose function is to transcribe and / or translate DNA or RNA . Vectors that provide one or more of the above functions are also included.

[0053] The term "host cell" as used herein is intended to include any single cell or cell culture that may or may be the recipient of vectors or the inclusion of exogenous polynucleotides and / or polypeptides. It is also intended to include single cell offspring. The offspring need not necessarily be completely identical (in morphology or genomic or complete complementary DNA) to the original parent cell due to natural, accidental or deliberate mutation. Cells may be prokaryotic or eukaryotic and may include, but are not limited to, bacterial cells, yeast cells, insect cells, animal cells and mammalian cells, including, but not limited to, mouse, rat, monkey or human cells. The term "host cell" as used herein also includes genetically modified cells. The term "genetically modified cells" includes cells containing and / or expressing a foreign or exogenous gene or polynucleotide sequence, which in turn modifies the genotype or phenotype of the cell or its progeny. "Genetically modified" also includes a cell containing or expressing a gene or polynucleotide sequence that has been introduced into the cell. For example, in this form, a gene has been introduced into the genetically modified cell, which gene is also endogenous to the cell. The term "genetically modified" also includes any addition, deletion or disruption of endogenous nucleotides of the cell. As used herein, the "host cell" may be any cells that express the human PRG4 protein.

[0054] The term "homologs" as used herein is defined herein as two nucleic acids or peptides that have similar or substantially identical nucleic acids or amino acid sequences, respectively. The term "homologue" further includes nucleic acid molecules that differ from one of the nucleotide sequences due to the degeneracy of the genetic code and thus encode the same amino acid sequences. In one preferred embodiment, the homologues include allelic variants, orthologs, paralogs, agonists and antagonists of nucleic acids encoding the PRG4 protein (e.g., SEQ ID NO: 1).

[0055] The term "orthologs" as used herein refers to two nucleic acids from different species, but which have evolved from a common ancestor gene through speciation. Normally, orthologs encode peptides having the same or similar functions. In particular, orthologs according to the invention generally exhibit at least 80-85%, preferably 85-90% or 90-95%, and most preferably 95%, 96%, 97%, 98% or even 99% identity or 100% sequence identity , with all or part of the amino acid sequence of any of the known PRG4 proteins (e.g., SEQ ID NO: 1), isoforms or analogs thereof, and exhibit a similar function to these peptides. The term "paralogs" as used herein refers to two nucleic acids that are bound by genomic duplication. Paralogs usually have different functions, but these functions can be related.

[0056] To determine the percent sequence identity of two amino acid sequences, the sequences are aligned for optimal comparison (e.g., gaps can be inserted into the sequence of one polypeptide for optimal alignment with another polypeptide or nucleic acid). The amino acid residues are then compared at the corresponding amino acid positions. When the position in one sequence is occupied by the same amino acid residue as the corresponding position in the other sequence, then the molecules are identical in that position. The same type of comparison can be made between two nucleic acid sequences. The percent sequence identity between two sequences is a function of the number of identical positions common to those sequences (i.e., percent sequence identity = number of identical positions / total number of positions x 100). Preferably, the isolated amino acid homologues included in the present invention are at least about 50-60%, preferably at least about 60-70%, and more preferably at least about 70-75%, 75-80%, 80-85%, 85 -90% or 90-95%, and most preferably at least about 96%, 97%, 98%, 99% or more identical to the entire amino acid sequence of any known PRG4 protein (e.g., SEQ ID NO: 1).

[0057] In some embodiments, an isolated nucleic acid homologue encoding a PRG4 protein comprises a nucleotide sequence that is at least about 40-60%, preferably at least about 60-70%, more preferably at least about 70-75% , 75-80%, 80-85%, 85-90% or 90-95%, and more preferably at least about 95%, 96%, 97%, 98%, 99% or more identical to the nucleotide sequence , encoding the amino acid sequence of such a PRG4 protein (e.g., SEQ ID NO: 1).

[0058] Determining the percent sequence identity between two nucleic acid or peptide sequences is well known in the art. For example, the Vector NTI 6.0 (PC) software package (InforMax, Bethesda, MD) can be used to determine the percentage sequence identity between two nucleic acid or peptide sequences. In this method, a penalty for introducing a gap of 15 and a penalty for extending the gap of 6.66 are used to determine the percent identity of the two nucleic acids. To determine the percent identity of two polypeptides, a gap penalty of 10 and a gap penalty of 0.1 are used. All other parameters are set to the default settings. For multiple alignment purposes (Clustal W algorithm), the penalty for entering a gap is 10, and the penalty for extending the gap is 0.05 with the blosum62 matrix. It should be understood that for the purposes of determining sequence identity when comparing DNA sequences with RNA sequences, the thymidine nucleotide is equivalent to the uracil nucleotide.

[0059] In addition, the PRG4 protein used herein includes a PRG4 protein encoded by a polynucleotide that hybridizes to a polynucleotide encoding the PRG4 protein under stringent conditions. The term "hybridization" as used herein includes a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonding between bases of nucleotide residues. Hydrogen binding can occur by Watson-Crick base pairing, Hoogstein binding or any other sequence-specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing nothing and any combination thereof. The hybridization reaction can be a step in a more extensive process, such as initiating a PCR reaction or enzymatic digestion of a polynucleotide by ribozyme.

[0060] Hybridization reactions can be carried out under various stringent conditions. The present invention includes polynucleotides capable of hybridizing under reduced stringency conditions, more preferably under stringent conditions, and most preferably under very stringent conditions, with the polynucleotides encoding the PRG4 protein described herein. The term "stringent conditions" as used herein refers to hybridization overnight at 60 ° C in 10 x Denhart solution, 6xSSC, 0.5% SDS and 100 mg / ml denatured salmon sperm DNA. Blots are washed successively at 62 ° C for 30 minutes each in 3xSSC / 0.1% SDS, then 1xSSC / 0.1% SDS and finally 0.1xSSC / 0.1% SDS. Also used herein, in some embodiments, the term "stringent conditions" refers to hybridization in a 6xSSC solution at 65 ° C. In other embodiments, the term "very stringent conditions" refers to hybridization overnight at 65 ° C in 10x Denhart solution, 6xSSC, 0.5% SDS and 100 mg / ml denatured salmon sperm DNA. Blots are washed sequentially at 65 ° C for 30 minutes each in 3xSSC / 0.1% SDS, then 1xSSC / 0.1% SDS and finally 0.1xSSC / 0.1% SDS. Methods for hybridizing nucleic acids are well known in the art. Accordingly, the PRG4 proteins encoded by the nucleic acids used herein include nucleic acids having at least 60% homology, preferably 75% homology, more preferably 85%, more preferably 90%, most preferably 95%, 96%, 97%, 98%, 99% homology to a polynucleotide sequence that encodes a human PRG4 protein (e.g., SEQ ID NO: 1) or a specific isoform or homolog thereof.

[0061] In addition, the PRG4 proteins used herein may also be a chimeric or fusion protein. The term "chimeric protein" or "fusion protein" as used herein includes a first polypeptide operably linked to a second polypeptide. Chimeric proteins may optionally include a third, fourth or fifth polypeptide operably linked to the first or second polypeptide. Chimeric proteins can include two or more different polypeptides. Chimeric proteins can include multiple copies of the same polypeptide. Chimeric proteins can also include one or more mutations in one or more polypeptides. Methods for producing chimeric proteins are well known in the art. In some embodiments of the present invention, the chimeric protein is a chimeric PRG4 protein with other isoforms of the PRG4 protein.

[0062] As used herein, the term "isolated" or "purified" protein, polynucleotide or molecule means that they are removed from an environment in which they naturally occur, or substantially free of cellular material, such as other contaminating proteins from a cellular or tissue source, from which a protein, polynucleotide or molecule is obtained, or substantially free of chemical precursors or other chemical substances when chemically synthesized. The phrase "substantially free of cellular material" includes preparations separated from cellular components of the cells from which it was isolated or recombinantly produced or synthesized. In some embodiments, the phrase "substantially free of cellular material" includes PRG4 protein preparations having less than about 30% (dry weight) of other proteins (also referred to herein as "contaminating protein"), more preferably less than about 20%, even more preferably less than about 10%, and most preferably less than about 5% of other proteins. When the protein or polynucleotide is produced recombinantly, they are also preferably substantially free of culture medium, i.e. the culture medium constitutes less than about 20%, more preferably less than about 10%, and most preferably less than about 5% by volume of the protein preparation of interest.

[0063] In some embodiments, the present invention provides a pharmaceutical composition suitable for topical administration to the surface of an eye in need thereof, a pharmaceutically effective concentration of PRG4 protein suspended in an ophthalmically acceptable balanced salt solution and in combination with one or more ophthalmically acceptable agents. Ophthalmically acceptable agents can be selected from the group consisting of an ophthalmically acceptable soothing agent, excipient, astringent, vasoconstrictor and emollient. The term "effective concentration or amount" or "therapeutically effective concentration or amount" as used herein is intended to mean a non-toxic but sufficient concentration or amount of PRG4 protein or other therapeutic agents to provide the desired therapeutic effects. The concentration or amount that is effective will vary between individuals, depending on the age, general condition of the individual, individual agents, and the like. Thus, it is not always possible to determine the exact effective concentration or amount. However, the appropriate effective concentration or amount in any individual case may be determined by one skilled in the art using routine experimentation. In addition, the exact effective concentration or amount of PRG4 protein and other therapeutic agent included in the composition or dosage form of the present invention is not critical as long as the concentration is in a range sufficient to allow easy application of the solution or preparation to provide the amount of PRG4 protein and other agents. active, which is in a therapeutically effective range.

[0064] In some embodiments, the pharmaceutically effective concentration of PRG4 protein is in the range of 10-10000 μg / ml, preferably 50-500 μg / ml.

Ophthalmically acceptable agents used herein include ophthalmically acceptable soothing agents, excipients, astringents, vasoconstrictors and emollients are fully defined in Code of Federal Regulations 21CFR349. [0065] The term "topical administration" as used herein is used in its usual sense and means delivery of a composition comprising a PRG4 protein and one or more ophthalmically acceptable agents to the eye. Generally, topical administration is accomplished using a liquid eye drop or rinse formulation and provides a local effect.

[0066] In some embodiments, any pharmaceutical composition described herein comprises, or the above-mentioned ophthalmically acceptable agents are or may be combined with one or more of sodium carboxymethyl cellulose (e.g., about 0.2 to about 2.5% w / w v / v), hydroxyethyl cellulose (e.g. about 0.2 to about 2.5% w / v), hypromellose (e.g. about 0.2 to about 2.5% w / v), methyl cellulose (e.g. 0.2 to 2.5% w / v), dextran 70 (e.g. 0.1% w / v), gelatin (e.g., 0.01% w / v), glycerin (e.g., 0.2 to 1% w / v), polyethylene glycol 300 (e.g., about 0.2 to about 1% w / v), polyethylene glycol 400 (e.g., about 0.2 to about 1% w / v), polysorbate 80 (e.g., about 0.2 to about 1% w / v), propylene glycol (e.g. about 0.2 to about 1% w / v), polyvinyl alcohol (e.g. about 0.1 to about 4% w / v), povidone (e.g., about 0.1 to about 2% w / v), zinc sulfate (e.g. 0.25% w / v), anhydrous lanolin (e.g., about 1 to about 10% w / v); lanolin (e.g. about 1 to about 10% w / v), light mineral oil (e.g. <about 50% w / v), mineral oil (e.g. <about 50% w / v), paraffin (e.g. <about 5% w / v), petroleum jelly (e.g. <about 100% w / v), wax ointment (e.g. <about 100% w / v), white petrolatum (e.g. <about 100% w / v), white wax (e.g. <about 5% w / v), yellow wax (e.g. <about 5% w / v), ephedrine hydrochloride (e.g. about 0.123% w / v), naphazoline hydrochloride (e.g. about 0.01 to about 0.03% w / v), phenylephrine hydrochloride (e.g., about 0.08 to about 0.2% w / v) and tetrahydrozoline hydrochloride (e.g., about 0.01 to about 0.05% w / v). In some cases, the percentages used herein are amounts in percent by weight.

[0067] In further embodiments, the pharmaceutical composition of the present invention, comprising the PRG4 protein in combination with one or more ophthalmically acceptable agents discussed above, contains a therapeutically effective concentration of hyaluronic acid or sodium hyaluronate in the range of 10-100000 μg / ml, preferably 500 -5000 μg / ml. In addition, the pharmaceutical composition of the present invention further comprises one or more surface-active phospholipids in the range of 10-10000 μg / ml, wherein such surface-active phospholipids include, but are not limited to, L-dipalmitoyl phosphatidylcholine (DPPC), phosphatidylcholine (PC), phosphatidylethanolamine (PE) and sphingomyelia (Sp) or other neutral and polar lipids.

[0068] The pharmaceutical composition of the present invention may further comprise one or more pharmaceutically acceptable carriers or excipients comprising any acceptable materials and / or any one or more additives known in the art. The term "carrier" or "vehicle" as used herein refers to carrier materials suitable for topical drug administration. Carriers and substrates useful herein include any such materials known in the art that are not toxic and do not interact with other components of the composition in a detrimental manner. Various additives known to those skilled in the art can be included in the composition. For example, solvents, including relatively small amounts of alcohol, can be used to dissolve certain drug substances. Other optional additives include opacifiers, antioxidants, fragrance, coloring agent, gelling agents, thickeners, stabilizers, surfactants and the like. Other agents, such as antimicrobials, may also be added to prevent spoilage during storage, i.e. to inhibit the growth of microorganisms such as yeasts and molds. Suitable antimicrobials are usually selected from the group consisting of methyl and propyl esters of p-hydroxybenzoic acid (i.e. methyl and propylparaben), sodium benzoate, sorbic acid, imidourea and combinations thereof. Penetration enhancers and / or irritation suppressants may also be included in the pharmaceutical composition of the present invention.

[0069] In certain embodiments, the pharmaceutical composition of the present invention is prepared in a pharmaceutically acceptable carrier, such as a phosphate buffered saline solution or an osmotically balanced saline solution from tear electrolytes, comprising one or more of sodium chloride at a molar fraction of about 44% to about 54%, potassium chloride in a molar fraction of about 8% to about 14%, sodium bicarbonate in a molar fraction of about 8% to about 18%, potassium bicarbonate in a mole fraction of about 0% to about 4%, calcium chloride in a mole fraction of about 0% to about 4%, magnesium chloride in a mole fraction of about 0% to about 4%, trisodium citrate in a mole fraction of about 0% to about 4 % and hydrochloric acid in a mole fraction of about 0% to about 20% or sodium hydroxide in a mole fraction of about 0% to about 20%. In some embodiments, the pharmaceutical carrier may be formulated to form an aqueous electrolyte solution in the range of about 150-200 nM. Other suitable formulations, such as ointments, creams, gels, pastes and the like, suitable for topical administration, are also contemplated by the present invention. In some embodiments, the electrolytes provide a proper osmotic balance when combined with PRG4, making the solution ophthalmically acceptable.

[0070] The present document further describes a method of treating reduced or undesirable borderline lubrication in the eye, related symptoms or a condition which is associated with or causes a lack of lubrication in the eye of a subject in need thereof, comprising topical administration to the eye surface of the subject in need thereof, a pharmaceutical composition containing a therapeutically effective amount of PRG4 protein. In one embodiment, the method of the present invention comprises the topical administration of a pharmaceutical composition comprising a therapeutically effective amount of a PRG4 protein that is suspended in a phosphate buffered saline or in an ophthalmically acceptable balanced salt solution containing one or more electrolytes. In yet another embodiment, the method of the present invention comprises topical administration of a pharmaceutical composition comprising a PRG4 protein formulated in an ophthalmically acceptable formulation containing one or more additional ophthalmically acceptable agents as discussed above.

[0071] The term "treat or treatment" as used herein refers to reducing the severity and / or frequency of symptoms, removing symptoms and / or underlying causes, preventing the occurrence of symptoms and / or underlying causes, and improving or repairing damage. The term "treat or treat" also includes both preventing the disorder in a predisposed subject and treating the disorder in the subject with clinical symptoms.

[0072] In some embodiments, the reduced border lubrication in the eye causes increased loss of tears by evaporation or an unstable tear film in the ocular border loop. Such reduced or undesirable borderline lubrication in the eye is associated with dry eye disease resulting from watery component deficiency or from excessive evaporation, Sjogren's syndrome, dry keratoconjunctivitis (KCS), androgen deficiency, Meibom's disease of the glands, estrogen replacement therapy, wearing contact lenses , refractive surgery, allergies, reduced tear film break time, disturbed tear film, eye surface disorders, increased levels of proteases in the tear film and on the eye surface, chronic inflammation, hyperosmolarity and aging. As discussed above, increased shear stresses lead to tear film instability, tear loss by evaporation, hyperosmolarity, edema pressure changes, and back shear stress increases. Increased shear stress also causes inflammation, androgen deficiency, and reduced expression of proteoglycans. Over time, increased shear stress and its consequences lead to a loss of boundary lubrication on the eye surface. Accordingly, the present invention provides a method of reducing shear stress by supplementing and enriching expression of proteoglycans, such as the PRG4 protein on the surface of the eye, so as to prevent or increase border lubrication in the eye.

[0073] It should also be understood that the above relates to preferred embodiments of the present invention and that numerous changes can be made thereto without departing from the scope of the invention. The invention is further illustrated by the following examples.

EXAMPLES

EXAMPLE 1

Expression of PRG4 mRNA in human corneal and conjunctival epithelial cells [0074] Human corneal epithelial cells were isolated from the corneal sclerotic rings of men and women as donors. Cells were processed directly (n = 8) or first grown in serum-free and phenol red keratinocyte medium (n = 2). Eyeball conjunctiva (n = 2), conjunctival cytological specimens (n ​​= 9), immortalized human conjunctival epithelial cells after culture (n = 1), tear glands of NOD mice (n = 5 adult mice / sex, 10 glands / sample) and Meiboma glands of BALB / c mice (n = 7 adult mice / sex, gland with 28 eyelids / sample) were obtained during surgical procedures. These samples were processed for PRG4 mRNA analysis using first RT-PCR (n = 18 people, all mice) and Affymetrix GeneChips (n = 4 human corneas). PRG4 primers for PCR included 1 kb of intron sequences to inhibit amplification of contaminating chromosomal DNA (Table 1). The amplified samples were screened for the presence of PRG4 products using agarose gel electrophoresis and an Agilent 2100 Bioanalyzer device. To confirm the identity of the amplicons, PCR products from corneal (n = 2), conjunctival epithelial cells (n = 1) and human liver (n = 1) samples were sequenced using a 3100 Genetic Analyzer at Massachusetts Eye and Ear Infirmary DNA Sequencing Center for Vision Research (Boston, MA) and the data obtained was analyzed by BLASTn searches of the GenBank databases.

Table 1. Oligonucleotide primers designed for RT-PCR analysis of PRG4 mRNA

<td>Type</td><td>Orientation</td><td>Nucleotide sequence (5 '- 3')</td><td>exons</td>

<td>amplicon</td><td>Size (pz)</td><td></td><td></td>

<td>Man 526</td><td>meaningful</td><td>GATGCAGGGTACCCCAAA (SEQ ID NO: 2)</td><td> 9-12</td>

Antisense CAGACTTTGGATAAGGTCTGCC (SEQ ID NO: 3) [0075] PRG4 mRNA has been shown to be present in all human corneal and conjunctival epithelial cells and cytological imprint samples. The identity of PRG4 PCR products was confirmed by DNA sequence analysis (Table 2). The results show that PRG4 is transcribed in human corneal and conjunctival epithelial cells.

Table 2. Identification of the amplicon sequence from human cornea, conjunctiva and liver samples.

<td>Przeszu-</td><td>sequencing</td><td>Rooted base pairs</td><td>All base pairs</td><td>BLASTN</td>

<td>wagging</td><td>tioning Direction</td><td>to human PRG4</td><td>from amplicon</td><td>Identity</td>

<td colspan="3">Pattern from human liver A PRG4 Forward 495</td><td> 500</td><td>Man</td>

<td>A PRG4</td><td>Backwards</td><td> 488</td><td> 491</td><td>Man</td>

<td>B PRG4</td><td>Forward</td><td> 496</td><td> 499</td><td>Man</td>

<td>B PRG4</td><td>Backwards</td><td> 498</td><td> 500</td><td>Man</td>

Human cornea (24-year-old woman)

<td>A PRG4</td><td>Forward</td><td> 497</td><td> 499</td><td>Man</td>

<td>A PRG4</td><td>Backwards</td><td> 490</td><td> 492</td><td>Man</td>

<td>B PRG4</td><td>Forward</td><td> 500</td><td> 504</td><td>Man</td>

<td>B PRG4</td><td>Backwards</td><td> 498</td><td> 501</td><td>Man</td>

Human cornea (51-year-old woman)

<td>A PRG4</td><td>Forward</td><td> 498</td><td> 499</td><td>Man</td>

<td>A PRG4</td><td>Backwards</td><td> 474</td><td> 489</td><td>Man</td>

<td>B PRG4</td><td>Forward</td><td> 496</td><td> 498</td><td>Man</td>

<td>B PRG4</td><td>Backwards</td><td> 490</td><td> 491</td><td>Man</td>

Human conjunctival epithelial cells

<td>A PRG4</td><td>Forward</td><td> 496</td><td> 499</td><td>Man</td>

<td>A PRG4</td><td>Backwards</td><td> 490</td><td> 492</td><td>Man</td>

<td>B PRG4</td><td>Forward</td><td> 495</td><td> 499</td><td>Man</td>

<td>B PRG4</td><td>Backwards</td><td> 474</td><td> 491</td><td>Man</td>

Two different samples (A and B) from each preparation were sequenced forward and backward. Samples of the human conjunctiva were epithelial cells from the corneo-scleral rings from women as donors. The gene access number for human PRG4 is NM_005807.

EXAMPLE 2

Reduction of in vitro friction by the addition of PRG4 (Lubricin) [0076] A friction test with clinically suitable contact surfaces such as contact surfaces of the eye-eyelid surface and eye-contact lens surface is described below. There are currently no clinical suitable methods suitable for quantitative evaluation of the lubrication capacity of artificial tears. Friction tests using synthetic (e.g. latex and glass) or non-native "native" (e.g. umbilical vein segments) may facilitate some, but probably not all, of the molecular interactions that occur during articulation / blinking. In fact, the significance of data obtained using non-tissue contact surfaces is not clear.

[0077] The configuration of the disk rotational ring test has shown that it is ideal for testing lubrication at the joint surface of cartilage-cartilage. The boundary lubrication method is indicated by kinetic friction, which does not change with factors that affect fluid film formation, including slip speed and axial load. This is because there is surface-to-surface contact and surface-related particles contribute to lubrication (by reducing friction and wear). Border lubrication was found to be a critical and functional mechanism on the eye surface as well as on the surface of articular cartilage. Thus, the in vitro friction test previously developed and characterized as testing border lubrication at the joint cartilage-cartilage contact surface was modified to study the contact surface of the eye-eyelid surface and the eye-contact lens surface. [0078] To determine the test conditions in which boundary lubrication is predominant on the contact surfaces of the eye-eyelid surface and the eye-contact lens surface, the relationship of friction properties to axial load and sliding speed was examined. Normal fresh human eye surfaces (cut corneas from ~ 3 mm sclera) were obtained from the Lions Eye Bank of Alberta. The excised corneas were stored in Optisol-GS at 4 ° C and used for 2 weeks. Eyelids (age 60-80 years) were obtained from the Body Donation Program at the University of Calgary within 1-3 days after death and were used immediately or stored at -20 ° C in saline for a maximum of 2 weeks for use. Comparable lubricants consisted of sterile Lens Plus salt solution (Advanced Medical Optics) as a negative control; Systane lubricating eye drops^® (Alcon Laboratories), Refresh Tears (Allergan) lubricating eye drops, Aquify drops^® Long Lasting Comfort (CIBA Vision) and Blink lubricating eye drops^® Tears (Advanced Medical Optics) as test lubricants.

[0079] The friction test diagram is shown in Figure 6. The surface (605) of the corneal eye was attached to the spherical neutral end of the impervious semi-rigid cylinder (603) of the rubber stopper (radius r = 6 mm) by applying super glue to the sclera. This plug cylinder (603) is attached to the rotary actuator of a mechanical testing machine (BoseELF 3200), thereby forming a bottom surface articulated. The ring (601) (outer radius = 3.2 mm, inner radius = 1.5 mm) was punched out of the eyelid (604) and attached to a linear cylinder coupled to the load cells of axial load (N) and torsion (τ), forming in this way the top surface is articulated. A lubricating bath 602 was created by attaching an inert tube around the plug cylinder (603).

[0080] The samples were first tested in saline, then in one of three (3) test lubricants. The lubricating bath was filled with ~ 0.3 ml and the articulated surfaces were allowed to equilibrate with the lubricant. The sample surfaces were slowly (0.05 mm / s) brought into contact and compressed until the spherical plug flattened and the entire annular eyelid surface came into contact with the cornea (605). Normal stress obtained (calculated from the axial load, in units of MPa, as N / (n | r²external -²internal |) can be changed by using rubber plugs of varying stiffness to mimic physiological stress ~ 5 kPa. The test sequence was initiated by preconditioning the sample by rotating +4 revolutions (revolutions) and return to the initial state -4 revolutions at the physiologically appropriate effective linear slip speed, veff = 30 mm / s (where veff = ωReff, ω is the angular frequency, and Reff = 2.4 mm is the equivalent radius calculated by integrating the shear stress distribution in the annular contact area). The samples were then tested by rotating +4 revolutions, followed immediately by a return to baseline -4 revolutions at veff = 30, 10, 1, 0.3, followed by 30 mm / s with a stop time of 12 seconds between each revolutions. The test sequence was then repeated in the opposite direction of rotation.

[0081] To assess the lubricating properties of the eye surface, two coefficients of friction (μ) in the form g = T / (ReffN)), where it stands for torque, Reff stands for equivalent radius, and N stands for the axial load described above. The static friction coefficient, which reflects the resistance at the start of the movement, μstatic was calculated as the peak value μ, just after (within ~ 10 °) the start of rotation. The mean coefficient of kinetic friction, which reflects drag during steady state motion, &lt;gkinetic&gt; was calculated from μ averaged during the third and fourth full test rotation. Both μstatic and &lt;gkinetic&gt; were averaged for + and - RPM in each test to take into account the potential directional effects of τ measurements. Data was collected at 20 Iz.

[0082] The results for lubrycin (PRG4) added to the surface of the cornea at a concentration in the range of 100-300 µg / ml are shown in Figure 7. Lubrycin has a friction-reducing effect on the contact surface of the eyelid, both in terms of kinetic and static friction, with all speeds. At a concentration of 1/10 of the physiological concentration of hyaluronic acid, lubrycin was similar to Blink lubricating eye drops^® Tears that contain hyaluronic acid. In combination, both lubricants are better than each one alone.

[0083] Figure 8 shows the in vitro reduction of corneal / eyelid kinetic friction measured during the first minute after the addition of lubrycin compared to Aquify eye drops^®. Lubricants were thoroughly rinsed off the eye surface using saline solution between tests. The synergistic effect was pronounced (reduced gkinetic compared to any of the means alone) when Aquify^® (with hyaluronic acid) combined with lubrycin. A lower result was obtained for the salt solution repeat than for the original salt solution control. This demonstrates the inhibition of lubrycin even after flushing with saline, suggesting that the molecules bound to the surface of the eye and that lubrycin showed a higher retention time compared to sodium hyaluronate alone.

[0084] Figure 9 shows the in vitro reduction of corneal / eyelid kinetic friction measured during the 5th minute after the addition of lubrycin, compared to Aquify® eye drops. The synergistic effect was pronounced (reduced gkinetic compared to any of the means alone) when Aquify^® (with hyaluronic acid) combined with lubrycin. Aquify friction coefficient^® returned to statistical equivalence with the saline solution after 5 minutes, while lubrycin still had a lower result, as did the combination of lubrycin and hyaluronic acid.

[0085] Figure 10 shows the reduction of the kinetic friction coefficient with time after the addition of lubrycin. Again, continuous reduction suggests binding to the eye surface.

EXAMPLE 3

Treatment of borderline lubrication deficiency in vivo [0086] A patient complaining of eye surface irritation was examined for eye lubrication or conditions associated with eye lubrication deficiency by measuring symptoms of more than 2 positive responses in the McMonnies questionnaire, score greater than 5 in Ocular Surface Disease Index (OSDI) or by signs of some symptoms on a visual analog scale, in combination with objective images including one or more of the reduced tear film interruption time (less than ~ 10 seconds), the lateral lower tear meniscus osmolarity greater than 308 milliosmoles / L, low value for the Schirmer strip (less than ~ 10 mm) , fluorescein sodium staining of the cornea and conjunctiva (results&gt; 0 with many large dots), significant remains obtained from the cytological imprint, Meibom gland dysfunction determined in any way, reduction of contact lens displacement rate after blinking, changes in the spatial-temporal function of contact lens transfer after applying a series of pressure pulses, reduction of tear film relaxation index after blinking in interferometric examination, increase of proinflammatory cytokines, decrease in lactoferrin or lysozyme or increase in the decoherence index of the point dispersion function after a wink.

[0087] The patient administers 1 to 2 drops of a solution containing 200 μg / ml PRG4 protein suspended in an ophthalmically acceptable balanced salt solution to the surface of each eye. The patient was instructed to close his eyes for 10 seconds.

[0088] During follow-up visits, a reduction in lateral lower tear osmolarity, an increased tear film break time, or other previously mentioned symptoms may be traced. In particular, if the tear film osmolarity has decreased from an abnormal value (maybe 330 milliosmoles / L) to a more normal value (maybe 304 milliosmoles / L), therapeutic modulation and replenishment of eye surface lubrication is considered effective.

REFERENCES [0089]

1. GD Jay, Curr Opin Orthop 15, 355 (2004).

2. DA Swann, RB Hendren, EL Radin, SL Sotman, EA Duda, Arthritis Rheum 24, 22 (1981).

3. GD Jay, DE Britt, D.-J. Cha, J Rheumatol 27, 594 (2000).

4. GD Jay, Connect Tissue Res 28, 71 (1992).

5. GD Jay, BP Lane, L. Sokoloff, Connect Tissue Res 28, 245 (1992).

6. GD Jay, B.-S. Hong, Connect Tissue Res 28, 89 (1992).

7. GD Jay, K. Haberstroh, C.-J. Cha, J Biomed Mater Res 40, 414 (1998).

8. GD Jay, DA Harris, C.-J. Cha, Glycoconj J 18, 807 (2001).

9. GD Jay, U. Tantravahi, DE Britt, HJ Barrach, CJ Cha, J Orthop Res 19, 677 (2001).

10. CR Flannery et al., Biochem Biophys Res Commun 254, 535 (1999).

11. BL Schumacher, JA Block, TM Schmid, MB Aydelotte, KE Kuettner, Arch Biochem Biophys 311, 144 (1994).

12. T. Schmid, V. Soloveychik, K. Kuettner, B. Schumacher, Trans Orthop Res Soc 26, 178 (2001).

13. SG Rees et al., Matrix Biology 21, 593 (2002).

14. Schumacher BL, Schmidt TA, Voegtline MS, Chen AC, Sah RL. Proteoglycan 4 (PRG4) synthesis and immunolocalization in bovine meniscus. J Orthop Res. May 2005; 23 (3): 562-8.

15. J. Marcelino et al., Nat Genet 23, 319 (1999).

16. DK Rhee et al., J Clin Invest 115, 622 (2005).

17. B. Xia, JA Royall, G. Damera, GP Sachdev, RD Cummings, Glycobiology 15, 747 (August, 2005).

18. K. Godl et al., J Biol Chem 277, 47248 (December 6, 2002).

19. DA Swann, S. Sotman, M. Dixon, C. Brooks, Biochem J 161, 473 (1977).

twenty. Schmidt TA, Plaas AH, Sandy JD. Disulfide-bonded multimers of proteoglycan 4 (PRG4) are present in normal synovial fluids. Biochim Biophys Acta. March 27, 2009.

21. KA Elsaid, GD Jay, ML Warman, DK Rhee, CO Chichester, Arthritis Rheum 52, 1746 (June, 2005).

22. GD Jay et al., J Rheumatol 31, 557 (2004).

23. AM Malfait et al., J Rheumatol 21, 314 (February, 1994).

24. TA Schmidt et al., In: Physical Regulation of Skeletal Repair RK Aaron, ME Bolander, ed. (American Academy of Orthopedic Surgeons, Chicago, 2005) p. 151162.

25. Nugent-Derfus GE, Chan AH, Schumacher BL, Sah RL. PRG4 exchange between the articular cartilage surface and synovial fluid. J Orthop Res. October 2007: 25 (10): 1269-76.

26. TA Schmidt, BL Schumacher, GE Nugent, NS Gastelum, RL Sah, Trans Orthop Res Soc 30, 900 (2005).

27. Nugent GE, Aneloski NM, Schmidt TA, Schumacher BL, Voegtline MS, Sah RL. Dynamic shear stimulation of bovine cartilage biosynthesis of proteoglycan 4. Arthritis Rheum. June 2006; 54 (6): 1888-96.

28. DK Rhee et al., J Biol Chem 280, 31325 (2005).

29. TJ Klein et al., Osteoarthritis Cartilage 11, 595 (2003).

thirty. KC Morrell, WA Hodge, DE Krebs, RW Mann, Proc Natl Acad Sci USA 102, 14819 (October 11, 2005).

31. E. Meyer, RM Overney, K. Dransfeld, T. Gyalog, Nanoscience: Friction and Rheology on the Nanometer Scale (World Scientific Publishing Co. Pte. Ltd, River Edge, New Jersey, 2002), p. 373.

32. CW McCutchen, Fed Proceedings 25, 1061 (1966).

33. T. Murakami, Y. Sawae, M. Ihara, JSME Int J Series C-Mechanical Systems Machine Elements &amp; Manufacturing 46, 594 (2003).

34. G. Meachim, Ann Rheum Dis 31, 457 (1972).

35. D. Dowson, Proc Inst Mech Eng [H] 215, 335 (2001).

36. GA Ateshian, VC Mow, W: Basic Orthopedic Biomechanics and MechanoBiology VC Mow, R. Huiskes, ed. (Lippincott Williams &amp; Wilkins, Philadelphia, 2005) pp. 447-494.

37. F. Guilak. Arthritis Rheum 52, 1632 (June, 2005).

38. KC Morell, WA Hodge, DE Krebs, RW Mann, Proc Natl Acad Sci USA 102, 14819 (October 11, 2005).

39. SAV Swanson, In: Adult Articular Cartilage M. A, R. Freeman, ed. (Pitman Medical, Tunbridge Wells, England, 1979) pp. 415-460.

40. Elsaid KA, Jay GD, Chichester CO. Reduced expression and proteolytic susceptibility of lubricin / superficial zone protein may explain early elevation in the coefficient of friction in the joints of rats with antigen-induced arthritis. Arthritis Rheum 2007; 56: 108-116.

41. Elsaid KA, Jay GD, Warman ML, Rhee DK, Chichester CO. Association of articular cartilage degradation and loss of boundary-lubricating ability of synovial fluid following injury and inflammatory arthritis. Arthritis Rheum 2005; 52: 1746-1755.

42. Cutolo M, Capellino S, Sulli A, Serioli B, Secchi ME, Villaggio B, Straub RH. Estrogens and autoimmune diseases. Ann NY Acad Sci 2006; 1089: 538-547.

43. Cutolo M, Sulli A, Capellino S, Villaggio B, Montagna P, Pizzomi C, Paolino S, Seriolo B, Felli L, Straub RH. Anti-TNF and sex hormones. Ann NY Acad Sci 2006; 1069: 391-400.

44. Schmidt M, Naumann H, Weidler C, Schellenberg M, Anders S, Straub RH. Inflammation and sex hormone metabolism. Ann NY Acad Sci 2006; 1069: 236-246.

45. Rontzsch A, Thoss K, Petrow PK, Henzgen S, Brauer R. Amelioration of murine antigen-induced arthritis by dehydroepiandrosterone (DHEA). Inflamm Res 2004; 53: 189-198.

46. Zierhut M, Dana MR, Stem ME, Sullivan DA. Immunology of the Lacrimal Gland and Ocular Tear Film. Trends Immunol 2002; 23: 333-335.

47. Stem ME, Gao J, Siemasko KF, Beuerman RW, Pflugfelder SC. The role of the lacrimal functional unit in the pathophysiology of dry eye. Exp Eye Res 2004; 78: 409416.

48. Tomlinson A, Khanal S, Ramaesh K, Diaper C, McFadyen A. Tear film osmolarity: determination of a referent for dry eye diagnosis. Invest Ophthalmol Vis Sci

2006;47:4309-4315.

49. Sullivan DA, Sullivan BD, Evans JE, Schirra F, Yamagami H, Liu M, Richards SM, Suzuki T, Schaumberg DA, Sullivan RM, Dana MR. Androgen deficiency, meibomian gland dysfunction and evaporative dry eye. Ann NY Acad Sci 2002; 966: 211222.

50. Sullivan DA. Tearful relationships? Sex, hormones and aqueous-deficient dry eye. Ocular Surface 2004; 2: 92-123.

51. Schaumberg DA, Buring JE. Sullivan DA, Dana MR. Hormone replacement therapy and dry eye syndrome. JAMA 2001: 286: 2114-2119.

52. de Souza GA, Godoy LM, Mann M. Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors. Genome Biol.

2006; 7: R72. Epub 2006.

53. Schirra F, Suzuki T, Dickinson DP, Townsend DJ, Gipson IK, Sullivan DA. Identification of steroidogenic enzyme mRNAs in the human lacrimal gland, meibomian gland, cornea and conjunctiva. Cornea 2006; 25: 438-42.

54. Schwarz IM, Hills BA, Br. J. Rheum. 1998: 37: 21-26.

55. Jay GD, Hong BS. Connect Tissue Res, 1992; 28 (1-2): 89-98.

56. Matnelli F, Argueso P, Curr Opin Allergy Clin Immuno, 2008; 8 (5): 477-483.

57. Jones MB. et al. Mathematical Medicine and Biology 2005; 22, 265.

58. Schumacher BL, Hughes CE, Kuettner KE, Caterson B, Aydelotte MB. Immunodetection and partial cDNA sequence of the proteoglycan, superficial zone protein, synthesized by cells lining synovial joints. J Orthop Res. 1999 January; 17 (1): 110-20.

59. Schmidt TA, Gastelum NS, Nguyen QT, Schumacher BL, Sah RL. Boundary lubrication of articular cartilage: role of synovial fluid constituents. Arthritis Rheum. March 2007; 56 (3): 882-91.

60. Schmidt TA, Plaas AH, Sandy JD. Disulfide-bonded multimers of proteoglycan 4 (PRG4) are present in normal synovial fluids. Biochim Biophys Acta. 2009 March 27.

61. Sullivan DA. The definition and classification of dry eye disease: report of the Definition and Classification Subcommittee of the International Dry Eye WorkShop (2007). Ocular Surface. April 2007; 5 (2): 75-92.

[0090] The subject of the present application is further described in the following paragraphs:

1. A pharmaceutical composition suitable for topical application to the eye surface comprising a therapeutically effective concentration of PRG4 suspended in an ophthalmically acceptable balanced salt solution.

2. The pharmaceutical composition according to item 1, comprising one or more ophthalmically acceptable agents selected from the group consisting of an ophthalmically acceptable soothing agent, an ophthalmically acceptable excipient, an ophthalmically acceptable astringent, an ophthalmically acceptable vasoconstrictor and an ophthalmically acceptable emollient.

3. The pharmaceutical composition according to item 1, wherein the pharmaceutical composition comprises PRG4 in a therapeutically effective concentration of 10-10000 gg / ml.

4. The pharmaceutical composition according to item 1, wherein the pharmaceutical composition comprises PRG4 in a therapeutically effective concentration of 50-500 gg / ml.

5. The pharmaceutical composition according to item 1 containing a therapeutically effective concentration of sodium hyaluronate or hyaluronic acid.

6. The pharmaceutical composition according to item 5, wherein the pharmaceutical composition comprises sodium hyaluronate or hyaluronic acid in a therapeutically effective concentration of 10-100000 μg / ml.

7. The pharmaceutical composition according to item 5, wherein the pharmaceutical composition comprises sodium hyaluronate or hyaluronic acid in a therapeutically effective concentration of 500-5000 μg / ml.

8. The pharmaceutical composition according to item 1, further comprising a therapeutically effective concentration of a surface active phospholipid selected from the group consisting of L-dipalmitoyl phosphatidylcholine, phosphatidylcholine, phosphatidylethanolamine and sphingomyelin.

9. The pharmaceutical composition according to item 8, wherein the pharmaceutical composition comprises a surface-active phospholipid in a therapeutically effective concentration of 10-10000 μg / ml.

10. The pharmaceutical composition of item 1, wherein the ophthalmically acceptable balanced salt solution contains at least three different electrolytes selected from the group consisting of potassium chloride, sodium bicarbonate, potassium bicarbonate, calcium chloride, magnesium chloride, trisodium citrate, hydrochloric acid and sodium hydroxide.

11. The pharmaceutical composition according to item 1, wherein PRG4 has an average molar mass between 50 kDa and 400 kDa.

12. The pharmaceutical composition according to item 1, wherein PRG4 comprises a lubricating fragment, a multimer or a homologue thereof.

13. The pharmaceutical composition according to item 1, wherein PRG4 is a recombinant PRG4 protein or a functional fragment thereof.

14. The pharmaceutical composition according to item 1, wherein PRG4 is a purified naturally occurring PRG4 protein.

LIST OF SEQUENCES [0091] &lt;110&gt; THE REGENTS OF THE UNIVERSITY OF CALIFORNIA SCHEPENS EYE RESEARCH INSTITUTE, INC.

&lt;120&gt; THERAPEUTIC LUBRICATION SUPPLEMENT AND ADMINISTRATION

EYE SURFACE &lt;150&gt; 09743204.1 &lt;151&gt; 2009-04-08 &lt;150&gt; US20080051112P &lt;151&gt; 2008-05-07 &lt;160&gt; 4 &lt;170&gt; PatentIn version 3.5 &lt;210&gt; 1 &lt;211&gt; 1404 &lt;212&gt; PRT &lt;213 &gt; Homo sapiens &lt;400&gt; 1

<img file="PL2915529T3_D0001.tif" />

<img file="PL2915529T3_D0002.tif" />

<img file="PL2915529T3_D0003.tif" />

<img file="PL2915529T3_D0004.tif" />

Thr Thr Ala Lys Asp Lys Thr Thr Glu Arg Asp Leu Arg Thr Thr Pro 915 920 925

Glu Thr Thr Thr Ala Ala Pro Lys Met Thr Lys Glu Thr Ala Thr Thr 930 935 940

Thr Glu Lys Thr Thr Glu Ser Lys Ile Thr Ala Thr Thr Thr Gin Val 945 950 955 960

Thr Ser Thr Thr Thr Gin Asp Thr Thr Pro Phe Lys Ile Thr Thr Leu 965 970 975

Lys Thr Thr Thr Leu Ala Pro Lys Val Thr Thr Thr Lys Lys Thr Ile 980 985 990

Thr Thr Thr Glu Ile Met Asn Lys Pro Glu Glu Thr Ala Lys Pro Lys 995 1000 1005

Asp Arg Ala Thr Asn Ser Lys Ala Thr Thr Pro Lys Pro Gin Lys 1010 1015 1020

Pro Thr Lys Ala Pro Lys Lys Pro Thr Ser Thr Lys Lys Pro Lys 1025 1030 1035

Thr Met Pro Arg Val Arg Lys Pro Lys Thr Thr Pro Thr Pro Arg 1040 1045 1050

Lys Met Thr Ser Thr Met Pro Glu Leu Asn Pro Thr Ser Arg Ile 1055 1060 1065

Ala Glu Ala Met Leu Gin Thr Thr Thr Arg Pro Asn Gin Thr Pro 1070 1075 1080

Asn Cheese Lys Leu Val Glu Val Asn Pro Lys Cheese Glu Asp Ala Gly 1085 1090 1095

Gly Ala Glu Gly Glu Thr Pro His Met Leu Leu Arg Pro His Val 1100 1105 1110

Phe Met Pro Glu Val Thr Pro Asp Met Asp Tyr Leu Pro Arg Val 1115 1120 1125

Pro Asn Gin Gly Ile Ile Ile Asn Pro Met Leu Ser Asp Glu Thr 1130 1135 1140

Asn Ile Cys Asn Gly Lys Pro Val Asp Gly Leu Thr Thr Leu Arg 1145 1150 1155

<td>own</td><td>Gly 1160</td><td>Thr</td><td>Leu</td><td>val</td><td>ala</td><td>phe 1165</td><td>Arg</td><td>Gly</td><td>His</td><td>Tyr</td><td>phe 1170</td><td>Trp</td><td>Underworld</td><td>Leu</td>

<td>Cheese</td><td>Pro 1175</td><td>phe</td><td>Cheese</td><td>Pro</td><td>Pro</td><td>Cheese 1180</td><td>Pro</td><td>ala</td><td>Arg</td><td>Arg</td><td>How much 1185</td><td>Thr</td><td>Glu</td><td>val</td>

<td>Trp</td><td>Gly 1190</td><td>How much</td><td>Pro</td><td>Cheese</td><td>Pro</td><td>How much 1195</td><td>Asp</td><td>Thr</td><td>val</td><td>phe</td><td>Thr 1200</td><td>Arg</td><td>Cys</td><td>own</td>

<td>Cys</td><td>Glu 1205</td><td>Gly</td><td>lys</td><td>Thr</td><td>phe</td><td>phe 1210</td><td>phe</td><td>lys</td><td>Asp</td><td>Cheese</td><td>Gin 1215</td><td>Tyr</td><td>Trp</td><td>Arg</td>

<td>phe</td><td>Thr 1220</td><td>own</td><td>Asp</td><td>how much</td><td>lys</td><td>Asp 1225</td><td>ala</td><td>Gly</td><td>Tyr</td><td>Pro</td><td>lys 1230</td><td>Pro</td><td>how much</td><td>phe</td>

<td>lys</td><td>Gly 1235</td><td>phe</td><td>Gly</td><td>Gly</td><td>Leu</td><td>Thr 1240</td><td>Gly</td><td>Gin</td><td>how much</td><td>val</td><td>ala 1245</td><td>ala</td><td>Leu</td><td>Cheese</td>

<td>Thr</td><td>ala 1250</td><td>lys</td><td>Tyr</td><td>lys</td><td>own</td><td>Trp 1255</td><td>Pro</td><td>Glu</td><td>Cheese</td><td>val</td><td>Tyr 1260</td><td>phe</td><td>phe</td><td>lys</td>

<td>Arg</td><td>Gly 1265</td><td>Gly</td><td>Cheese</td><td>How much</td><td>Gin</td><td>Gin 1270</td><td>Tyr</td><td>How much</td><td>Tyr</td><td>lys</td><td>Gin 1275</td><td>Glu</td><td>Pro</td><td>val</td>

<td>Gin</td><td>lys 1280</td><td>Cys</td><td>Pro</td><td>Gly</td><td>Arg</td><td>Arg 1285</td><td>Pro</td><td>ala</td><td>Leu</td><td>own</td><td>Tyr 1290</td><td>Pro</td><td>val</td><td>Tyr</td>

<td>Gly</td><td>Glu 1295</td><td>Thr</td><td>Thr</td><td>Gin</td><td>val</td><td>Arg 1300</td><td>Arg</td><td>Arg</td><td>Arg</td><td>phe</td><td>Glu 1305</td><td>Arg</td><td>ala</td><td>How much</td>

<td>Gly</td><td>Pro 1310</td><td>Cheese</td><td>Gin</td><td>Thr</td><td>His</td><td>Thr 1315</td><td>How much</td><td>Arg</td><td>How much</td><td>Gin</td><td>Tyr 1320</td><td>Cheese</td><td>Pro</td><td>ala</td>

<td>Arg</td><td>Leu 1325</td><td>ala</td><td>Tyr</td><td>Gin</td><td>Asp</td><td>lys 1330</td><td>Gly</td><td>val</td><td>Leu</td><td>His</td><td>own 1335</td><td>Glu</td><td>val</td><td>lys</td>

<td>val</td><td>Cheese 1340</td><td>How much</td><td>Leu</td><td>Trp</td><td>Arg</td><td>Gly 1345</td><td>Leu</td><td>Pro</td><td>own</td><td>val</td><td>val 1350</td><td>Thr</td><td>Cheese</td><td>ala</td>

<td>How much</td><td>Cheese 1355</td><td>Leu</td><td>Pro</td><td>own</td><td>How much</td><td>Arg 1360</td><td>lys</td><td>Pro</td><td>Asp</td><td>Gly</td><td>Tyr 1365</td><td>Asp</td><td>Tyr</td><td>Tyr</td>

<td>ala</td><td>phe 1370</td><td>Cheese</td><td>lys</td><td>Asp</td><td>Gin</td><td>Tyr 1375</td><td>Tyr</td><td>own</td><td>How much</td><td>Asp</td><td>val 1380</td><td>Pro</td><td>Cheese</td><td>Arg</td>

<td>Thr</td><td>ala 1385</td><td>Arg</td><td>ala</td><td>How much</td><td>Thr</td><td>Thr 1390</td><td>Arg</td><td>Cheese</td><td>Gly</td><td>Gin</td><td>Thr 1395</td><td>Leu</td><td>Cheese</td><td>lys</td>

Val Trp Tyr Asn Cys Pro 1400 &lt;210&gt; 2 &lt;211&gt; 18 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Description of the artificial sequence: Synthetic primer &lt;400&gt; 2 gatgcagggt accccaaa 18 &lt;210&gt; 3 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Description of the artificial sequence: Synthetic primer &lt;400&gt; 3 cagactttgg ataaggtctg cc 22 &lt;210&gt; 4 &lt;211&gt; 7 &lt;212&gt; PRT &lt;213&gt; Homo sapiens &lt;400&gt; 4

Lys Glu Pro Ala Pro Thr Thr 1 5