Ophthalmic device, and method of use thereof, for increasing ocular boundary lubrication

ES 2 633 792 T3

DESCRIPTION

Therapeutic replenishment and enrichment of ocular surface lubrication

Cross reference to related requests

This patent application claims priority benefit from US Provisional Application No. 61 / 051,112 filed May 7, 2008, which is incorporated herein by reference.

Field of the invention

The present invention relates to the management of ocular lubrication. In particular, the present invention relates to pharmaceutical compositions for treating diseases associated with compromised lubrication on the corneal and conjunctival surfaces.

Background

The proteoglycan gene 4 (prg4) encodes highly glycosylated proteins called megakaryocyte stimulating factor (MSF), lubricin, and surface zone protein (SZP) (1)). Lubricin was first isolated from synovial fluid and demonstrated in vitro lubricating capacity similar to synovial fluid at the cartilage-glass interface (2). Lubricin was later identified as a product of synovial fibroblasts (3) and it was also shown to possess boundary layer lubricating capacity at a latex-glass interface by Jay et al. (3-9). O-linked e (1-3) Gal-GalNAc oligosaccharides in a large mucin-like domain of 940 amino acids (10), encoded by exon 6, were later shown to mediate, in part, this boundary layer lubricating ability ( 8). SZP was first localized to the superficial zone explant cartilage surface and isolated from the conditioned medium (11). SZP also demonstrated lubricating capacity at the cartilage-glass interface (12). These molecules are collectively referred to as PRG4. PRG4 was also shown to be present on the surface of the synovium (58), tendon (13), and meniscus (14). Furthermore, PRG4 has been shown to contribute, at both physiological and pathophysiological concentrations, to boundary layer lubrication of opposing articular cartilage surfaces (59).

The functional importance of prg4 was shown by mutations that cause camptodactyly-arthropathy-coxa vara-percarditis disease syndrome (CACP) in humans. CACP is manifested by camptodactyly, non-inflammatory arthropathy, and hypertrophic synovitis, with coxa vara deformity, percarditis, and pleural effusion (15). Also, in mice null for PRG4, cartilage deterioration and subsequent joint failure were observed (16). Therefore, PRG4 expression is a necessary component of healthy synovial joints.

PRG4 is a member of the mucin family, which are generally abundant in epithelial coatings and provide many functions, including lubrication and protection against invading microorganisms (17). The functional properties of mucins are generally determined by specialized glycosylation patterns and their ability to form multimers through intermolecular disulfide bonds (18), both of which are altered in chronic diseases (eg, cystic fibrosis, asthma) (17). The biochemical characterization of PRG4 isolated from synovial fluid (2, 19) showed molecular heterogeneity in Oglycosylation, which seems to influence the lubricating properties (8). Recently, bovine synovial fluid PRG4 has been shown to exist as disulfide-linked dimers, in addition to monomeric forms, as suggested by conserved cysteine-rich domains at the N- and C-termini, along with an unpaired cysteine ​​at the terminus. C (20).

In tissues such as the synovial joints, the physicochemical modes of lubrication have been classified as by fluid film or by boundary layer. The lubrication operating modes depend on the normal and tangential forces in the articulating tissues, the relative speed of the tangential movement between these surfaces, and the time history of both loading and movement. The coefficient of friction, μ, provides a quantitative measure, and is defined as the ratio of tangential friction force to normal force. One type of fluid-mediated lubrication mode is hydrostatic. At the onset of loading and typically for a prolonged duration, the interstitial fluid in the cartilage is pressurized, due to the biphasic nature of the tissue; fluid can also be forced into roughnesses between articular surfaces through a suppuration mechanism. Pressurized interstitial fluid and entrapped lubricant blends can therefore contribute significantly to normal load bearing with little resistance to shear force, providing a very low μ. Also, at the start of loading and / or movement, types of fluid film, pressure film, hydrodynamic, and elastohydrodynamic lubrication occur, with pressurization, movement, and deformation acting to direct the viscous lubricant from and / or through the gap. between two surfaces in relative motion.

The relevant degree to which fluid film pressure versus boundary layer lubrication occurs classically depends on a number of factors (31). When the lubricant film can flow between suitable sliding surfaces, which can be elastically deformed, elastohydrodynamic lubrication occurs. Pressure, surface roughness, and relative sliding speed determine when full fluid lubrication begins to fail and lubrication enters new regimes. As the speed decreases further, the lubricant films adhering to the articulating surfaces begin to contribute and a mixed lubrication regime occurs. If the speed decreases even more and only an ultra-fine lubricant layer composed of

ES 2 633 792 T3 a few molecules, boundary layer lubrication occurs. A boundary layer lubrication mode is therefore indicated by a coefficient of friction (ratio of the friction force measured between two surfaces in contact in relative motion with respect to the applied normal force) during stationary sliding not altering with factors influencing the the formation of a fluid film, such as relative sliding speed and axial load (35). For articular cartilage, it has been concluded that boundary layer lubrication is certain to occur, although supplemented by fluid pressurization and other mechanisms (36-39).

In boundary layer lubrication, the load is borne by surface-to-surface contact, and the associated frictional properties are determined by surface lubricating molecules. This mode has been proposed to be important because the opposing cartilage layers contact over ~ 10% of the total area, and this may be where most of the friction occurs (30). In addition, with increasing load time and hydrostatic pressure dissipation, the lubricant-coated surfaces bear an increasing part of the load relative to the pressurized fluid and, consequently, this mode may become more and more dominant (31, 32). . Boundary layer lubrication, in essence, mitigates stick-slip movement (31), and therefore manifests as decreased resistance to both stationary movement and initiation of movement. The latter situation is relevant for load-bearing articulating surfaces after prolonged compressive load (eg, sitting or standing in vivo) (33). The typical deterioration patterns of cartilage surfaces (34) also suggest that lubrication by the boundary layer of the articular cartilage is critical for the protection and maintenance of the structure of the articular surface.

With increasing load time and hydrostatic pressure dissipation, the lubricant-coated surfaces bear an increasing part of the load relative to the pressurized fluid and, consequently, μ can be increasingly dominated by this lubrication mode. A boundary layer lubrication mode is indicated by values ​​of μ during stationary sliding that are not altered by factors influencing fluid film formation, such as relative sliding speed and axial load. Boundary layer lubrication, in essence, mitigates stick-slip motion, and therefore manifests as decreased resistance to both stationary motion and initiation of motion.

The accumulation of PRG4 in the synovial fluid and on the articular surface are probably key functional determinants of the lubricating capacity per boundary layer of PRG4. Recently, a significant three-fold secretion of PRG4 was shown to result from dynamic shear loading of cultured cartilage explants, compared to statically compressed or free-swollen cultures (27). This synthesis and secretion of PRG4 by chondrocytes could contribute significantly to the concentration of PRG4 in the synovial fluid, both in homeostatic and pathological conditions in which physiological regulators are present (23). Although the amount of surface-bound PRG4 does not appear to correlate with secretion rates, previous studies suggest that surface-bound PRG4 can exchange with endogenous PRG4 in synovial fluid (25), especially under the influence of mechanical disturbance (26 , 27). Clarification of the spatial and temporal aspects of PRG4 metabolism in the joint, particularly at the joint surface, would advance the understanding of PRG4's contribution to the low-friction properties of articular cartilage, and possibly lead to treatments to prevent the loss of this function (40, 41). More remains to be determined about the processing, and potential additional or alternative functions of various PRG4 molecules of different molecular weight (10, 27, 28, 61). Furthermore, the combination of chemical and mechanical factors to stimulate PRG4 expression in chondrocytes near the articular surface may be useful to create tissue-engineered cartilage from isolated sub-populations (29) with a surface that is bioactive and functional in lubrication.

Currently, the precise mechanisms of boundary layer lubrication at biological interfaces are unknown. However, proteoglycan 4 (PRG4) may play a critical role as a boundary layer lubricant in articulating joints. This secreted glycoprotein is thought to protect cartilaginous surfaces against frictional forces, cell adhesion, and protein deposition. Several native and recombinant lubricin proteins and isoforms have been isolated and characterized. US 2007/275032 describes a lubricating effect of PRG4 on cartilage. PRG4 isolated from human joint cartilage is said to act as a chondroprotective molecule, providing protection for lower cartilage cells.

US Patent Nos. 5,326,558; 6,433,142; 7,030,223 and 7,361,738 describe a family of human megakaryocyte stimulating factors (MSF) and pharmaceutical compositions containing one or more of said MSFs for treating disease states or disorders, such as a platelet deficiency. US Patent Nos. 6,960,562 and 6,743,774 also describe a lubricating polypeptide, tribonectin, comprising a substantially pure fragment of MSF, and methods for lubricating joints or other tissues by administering tribonectin systemically or directly to tissues.

US 2007/249557 describes that PRG4 expressed by surface chondrocytes participates in boundary layer lubrication of cartilaginous joints.

US 2005/009893 describes an ophthalmic lubricant solution adapted for use in lasik surgery, comprising a viscosity increasing agent selected from proteoglycans, cellulose derivatives, collagen or collagen

Modified ES 2 633 792 T3, galactomannans, xanthan gum, gellan gum, alginate, chitosans, polyvinyl alcohol and carboxyvinyl polymers.

Summary of the invention

The present invention provides, in various embodiments, pharmaceutical compositions for the management of ocular lubrication, including the therapeutic replenishment and enrichment of lubricant molecules by boundary layer on the ocular surface. In certain embodiments of the present invention, the observation that PRG4 mRNA is expressed in human corneal and conjunctival epithelial cells, as well as in mouse lacrimal and meibomian glands, is described, indicating that the PRG4 protein is present in these tissues. on the ocular surface. In certain cases of the present invention, the observation that the role of the PRG4 protein serves on the ocular surface to protect the cornea and conjunctiva against significant shear forces generated during blinking, contact lens wear, and other conditions is described. unwished. The impact of the tear film, including the impact of inflammation, pro-inflammatory cytokines, imbalance of sex steroids and proteases on film composition and function, suggests a course of therapy for eye problems that stimulates boundary layer lubrication.

In certain embodiments, the present invention provides a pharmaceutical composition suitable for topical application to an ocular surface comprising a therapeutically effective concentration of a PRG4 protein suspended in an ophthalmically acceptable balanced salt solution. The pharmaceutical composition of the present invention may also comprise one or more ophthalmically acceptable agents selected from the group consisting of an ophthalmically acceptable demulcent, ophthalmically acceptable excipient, ophthalmically acceptable astringent, ophthalmically acceptable vasoconstrictor, and ophthalmically acceptable emollient.

Exemplary ophthalmically acceptable demulcents contemplated by the present invention include, but are not limited to, sodium carboxymethyl cellulose (eg, about 0.2 to 2.5% w / v), hydroxyethyl cellulose (eg, about 0.2 to 2.5% w / v), hypromellose (for example, about 0.2 to 2.5% w / v), methylcellulose (for example, about 0.2 to 2.5% w / v), dextran 70 ( eg about 0.1% w / v), gelatin (eg about 0.01% w / v), glycerin (for example, about 0.2 to 1% w / v), polyethylene glycol 300 (for example, about 0.2 to 1% w / v), pylethylene glycol 400 (for example, about 0.2 to 1% w / v), polysorbate 80 (for example, about 0.2 to 1% w / v), propylene glycol (for example, about 0.2 to 1% w / v), polyvinyl alcohol (for example, about 0, 1 to 4% w / v), povidone (eg, about 0.1 to 2% w / v). Exemplary ophthalmically acceptable excipients / emollients contemplated herein include anhydrous lanolin (eg, about 1 to 10% w / v), lanolin (eg, about 1 to 10% w / v), light mineral oil (eg , <approximately 50% w / v), mineral oil (for example, <approximately 50% w / v), paraffin (for example, <approximately 5% w / v), petrolatum (for example, <approximately 100% w / v), white ointment (for example, <about 100% w / v), white petrolatum (for example, <about 100% w / v), white wax (for example, <about 5% w / v), yellow wax (for example, <about 5% w / v). An exemplary ophthalmically acceptable astringent contemplated by the present invention includes zinc sulfate (eg, about 0.25% w / v). Exemplary ophthalmically acceptable vasoconstrictors contemplated by the present invention include ephedrine hydrochloride (eg, about 0.123% w / v), naphazoline hydrochloride (eg, about 0.01 to about 0.03% w / v), phenylephrine (eg, about 0.08 to about 0.2% w / v), and tetrahydrozoline hydrochloride (eg, about 0.01 to about 0.05% w / v).

In some of these embodiments, demulcents, excipients, astringents, vasoconstrictors, emollients, and electrolytes provide a means of delivering PRG4 protein in an ophthalmically acceptable manner. Ophthalmically acceptable compositions are suitable for topical application to the ocular surface if they lack toxicity, burning, itching, stickiness, blurred vision, etc. unacceptable to the eye, after application.

In certain embodiments, the pharmaceutical composition of the present invention further comprises a therapeutically effective concentration of one or more additional therapeutic agents, including, but not limited to, sodium hyaluronate, hyaluronic acid, and phospholipid. Exemplary phospholipid includes La-dipalmitoylphosphatidylcholine, phosphatidylcholine, phosphatidylethanolamine, and sphingomyelin.

In certain embodiments, the present invention provides a pharmaceutical composition which is suitable for topical application to an ocular surface and which comprises a therapeutically effective concentration of PRG4 protein suspended in an ophthalmically acceptable balanced salt solution and which comprises at least three electrolytes, including, but not limited to not limited to, sodium chloride (NaCl) 0.64%, potassium chloride (KCl) 0.075%, calcium chloride dihydrate (CaCl2 ^ 2H2O) 0.048%, magnesium chloride hexahydrate (MgCl2 ^ 6H2O) 0.03%, sodium acetate trihydrate (C2H3NaO2 ^ 3H2O) 0.39%, sodium citrate dihydrate (C6H5Na3O7 ^ 2H2O) 0.17%, sodium hydroxide and / or hydrochloric acid (to adjust the pH to approximately 7.5) with an osmolarity of approximately 300 mOsms / L.

ES 2 633 792 T3

In certain embodiments, the present invention provides a pharmaceutical composition suitable for topical application to an ocular surface comprising a therapeutically effective concentration of PRG4 protein suspended in an ophthalmically acceptable balanced salt solution, comprising approximately 128 mM sodium (Na +), potassium ( K +) of approximately 24 mM, chlorine (Cl-) of approximately 113 mM, calcium (Ca2 +) of approximately 0.4 mM, Magnesium (Mg2 +) of approximately 0.3 mM, HCO3- of approximately 5 mM, citrate of approximately 1 mM, phosphate of approximately 14 mM, acetate of approximately 15 mM, and sodium hydroxide and / or hydrochloric acid (to adjust the pH at approximately 7.5) with an osmolarity of approximately 300 mOsms / L.

The present document further describes a method of treating ocular lubrication deficiency, or symptoms associated with it, in an individual in need of it. The method comprises topically administering to the ocular surface of the individual in need thereof a pharmaceutical composition comprising a therapeutically effective concentration of a PRG4 protein. In certain embodiments, the pharmaceutical composition comprising the PRG4 protein is administered in combination with an ophthalmically acceptable formulation comprising one or more ophthalmically acceptable agents selected from the group consisting of an ophthalmically acceptable demulcent, ophthalmically acceptable excipient, ophthalmically acceptable astringent, ophthalmically vasoconstrictor. acceptable, and ophthalmically acceptable emollient.

In some embodiments, the pharmaceutical composition comprising the PRG4 protein is administered in combination with an ophthalmically acceptable solution comprising a therapeutically effective concentration of sodium hyaluronate or hyaluronic acid, or a surfactant phospholipid, as discussed above. In certain further embodiments, the pharmaceutical composition comprising the PRG4 protein is administered in combination with a phosphate buffered saline or an ophthalmically acceptable balanced salt solution comprising one or more electrolytes, as discussed above.

This document describes a method of treating an ocular lubrication deficiency, or symptoms associated with it, due to tear loss or unstable tear film in the ocular loop by boundary layer, such as androgen deficiency, Sjogren's syndrome and keratoconjunctivitis sicca ( KCS). Said method comprises administering topically to the ocular surface of a patient in need thereof the pharmaceutical composition of the present invention.

In certain embodiments, the present document further describes a method of addressing and treating conditions associated with unfavorable or poor eye lubrication. Exemplary conditions include, but are not limited to, watery or evaporative dry eye disease, Sjogren's syndrome, keratoconjunctivitis sicca, androgen deficiency, meibomian gland disease, estrogen replacement therapy, contact lens wear, surgery refractory, allergy, reduced tear film break time, allergy, ocular surface disorders, increased levels of proteases in the tear film and on the ocular surface, chronic inflammation, hyperosmolarity, and aging.

Brief description of the drawings

Figure 1 depicts feedback loops in boundary layer lubrication of the ocular surface.

Figure 2 illustrates PRG4 mRNA expression in human corneal epithelial cells. Human corneal epithelial cells were isolated from the corneascleral borders of male and female donors. Amplified samples were screened for the presence of PRG4 products using an Agilent 2100 Bioanalyzer. Vertical rails contain: L. MW ladder; 1. No mold control; 2. Corneal tissue from a 33-year-old woman; Four. Corneal epithelial cells cultured from a 70-year-old woman; 6. Corneal epithelial cells cultured from a 53-year-old man.

Figure 3 illustrates PRG4 mRNA expression in human conjunctival epithelial cells. Human corneal epithelial cells were isolated from the corneascleral borders of male and female donors. Amplified samples were screened for the presence of PRG4 products using agarose gel electrophoresis. The vertical rails contain: 1. MW ladder; 2. No mold control; 4. Conjunctiva of human female; 5. Conjunctiva of human male.

Figure 4 illustrates PRG4 mRNA expression in human corneascleral border tissue samples. L. Human corneal epithelial cells were isolated from the corneascleral borders of male and female donors. Amplified samples were screened for the presence of PRG4 products using an Agilent 2100 Bioanalyzer. Vertical lanes contain: MW ladder; 1. human liver cDNA standard; 2. Corneascleral border tissue from a 24-year-old woman; 3. Corneascleral border tissue from a 51-year-old woman; 4. Human conjunctival epithelial cells.

Figure 5 illustrates PRG4 mRNA expression in human conjunctival imprint cytology samples. Conjunctival impression cytology specimens were isolated from male and female donors. Amplified samples were screened for the presence of PRG4 products using an Agilent 2100 Bioanalyzer. Vertical lanes contain: L. MW ladder; 1-9. Conjunctival impression cytology specimens; 10. Human conjunctival epithelial cell repeat (Lane 4 in Figure 3).

ES 2 633 792 T3

Figure 6 illustrates a diagram of the friction test. The corneal ocular surface (605) was attached to the spherical end of an inert non-permeable semi-rigid rubber cylinder plug (603) (radius r = 6 mm). The cylinder plug (603) was attached to the rotational activator of the mechanical testing machine (Bose ELF 3200) forming the lower articular surface. A ring (601) (outer radius = 3.2mm, inner radius = 1.5mm) was pierced from the eyelid (604). Ring (601) joined the linear actuator coupled with axial load (N) and torsional load cells (τ), forming the upper articulating surface. A bath of lubricant (602) was formed by securing an inert tube around the cylinder plug (603). ω is the angular frequency.

Figure 7 illustrates the kinetic friction reduction of the eyelid / cornea in vitro with the addition of PRG4 protein (lubricin).

Figure 8 illustrates the in vitro eyelid / corneal kinetic friction reduction measured 1 minute after the addition of PRG4 protein (lubricin).

Figure 9 illustrates the in vitro eyelid / corneal kinetic friction reduction measured 5 minutes after the addition of PRG4 protein (lubricin).

Figure 10 illustrates the reduction in eyelid / cornea kinetic friction in vitro over time, after the addition of PRG4 protein (lubricin).

Detailed description of the invention

In certain embodiments herein, a pharmaceutical composition comprising PRG4, or a lubricating fragment thereof, is provided for use in treating, by topical application to the ocular surface, an ocular lubrication deficiency or symptoms associated therewith. . Also provided herein is a composition suitable for topical application to an ocular surface comprising a therapeutically effective amount of PRG4 suspended in an ophthalmically acceptable balanced salt solution, and which may also be in combination with one or more ophthalmically acceptable agents selected from the group consisting of an ophthalmically acceptable demulcent, an ophthalmically acceptable excipient, an ophthalmically acceptable astringent, an ophthalmically acceptable vasoconstrictor, and an ophthalmically acceptable emollient.

In some embodiments herein, pharmaceutical compositions are provided to treat a deficiency in ocular lubrication at the ocular surface (eg, a deficiency of, such as decreased or undesirable, ocular boundary layer lubrication). A pharmaceutical composition of certain embodiments of the present invention comprises an isolated or purified PRG4 protein suspended in an ophthalmically acceptable balanced salt solution in combination with one or more ophthalmically acceptable agents selected from the group consisting of a demulcent, excipient, astringent, vasoconstrictor, and emollient. ophthalmic. In some embodiments, any pharmaceutical composition provided herein further comprises one or more additional therapeutic agents selected from the group consisting of sodium hyaluronate, surface active phospholipids, and electrolytes in a pharmaceutically acceptable carrier for topical administration.

The present invention provides, in certain embodiments, a new strategy for managing ocular lubrication, including therapeutic replenishment and enrichment of lubricant molecules by boundary layer on the ocular surface. It should be noted that the importance and mechanism of boundary layer lubrication of the eye has hitherto not been recognized in the ophthalmic community. For years, the scientific consensus in the orthopedic research community was that hydrodynamic lubrication was by far the dominant mode of lubrication for articular cartilage, and that boundary layer lubrication was just an additional option. Furthermore, researchers studying boundary layer lubrication on cartilage surfaces suggest that boundary layer lubrication is probably only important under high load and low speed, which is the opposite of conditions on the ocular surface, where axial loads exist. relatively low and relatively fast sliding speeds. See, for example, (54). Furthermore, boundary layer lubrication involving corneal glycocalyx has not been considered until now. Jay et al. compared purified lubricating factor from bovine synovial fluid with mucinous glycoprotein from human submandibular saliva and stimulated tears and concluded that the mucin secreted by the lacrimal gland did not lubricate, ignoring the possibility that the corneal epithelium was a source of lubricant or that lubrication per boundary layer was a major contributor to the ocular surface. See, for example, (55). The most recent mathematical models of tear film dynamics also ignore the possibility of boundary layer lubrication, claiming an approach to lubrication for the tear film height so that the mucous layer on the cornea can be taken to provide a non-slip surface for the aqueous film and it should be noted that the model only predicts the evolution before the thickness [from the tear film] reach a critically thin value at which the model fails. See, for example, (57).

There is a need to manage ocular lubrication and protect the cornea and conjunctiva from significant shear forces generated from the undesirable conditions described herein, including, by way of non-limiting example, aqueous or evaporative dry eye disease, syndrome. Sjogren's, keratoconjunctivitis sicca,

ES 2 633 792 T3 androgen deficiency, meibomian gland disease, estrogen replacement therapy, contact lens wear, refractory surgery, allergy, reduced tear film break time, allergy, ocular surface disorders, levels increased proteases in the tear film on the ocular surface, chronic inflammation, hyperosmolarity, and aging.

In some cases, the loading of the cornea and conjunctiva is probably dominated by shear forces. In certain cases, blinking, as well as the use of contact lenses, places significant stress on the epithelial cells of the ocular surface, and this is especially true in the presence of a compromised tear film. As shown in Figure 1, it is suggested that increased shear stress leads to tear film instability, evaporative tear loss, hyperosmolarity, swelling pressure changes, and a feedback rise in shear stress. In some cases, the increased shear stress is also thought to stimulate inflammation, androgen deficiency, and decreased expression of proteoglycans. In certain cases the increased shear stress and its aftermath can, over time, lead to a loss of boundary layer lubrication at the ocular surface.

A deficiency in ocular lubrication and the symptoms associated with it can be determined by any suitable method. In some cases, a deficiency in ocular lubrication and the symptoms associated with it are defined either qualitatively (for example, a feeling of low lubrication, dry eye, discomfort, etc.) or quantitatively (for example, measured by mechanical, biochemical methods , electrical, optical or other quantitative tests).

In certain cases, in conditions undesirable for boundary layer lubrication of the eye, such as those resulting from aqueous or evaporative dry eye disease, Sjogren's syndrome, keratoconjunctivitis sicca, androgen deficiency, meibomian gland disease, replacement therapy estrogen, contact lens wear, refractory surgery, allergy, reduced tear film break time, allergy, ocular surface disorders, increased levels of proteases in the tear film and on the ocular surface, chronic inflammation, hyperosmolarity, and aging, there will be a compromised tear film. In some of these situations, increased evaporation may preclude effective fluid film lubrication, but allows boundary layer lubrication and a protective molecular mechanism to reduce shear stress at the cell surface. Certain embodiments of the present invention provide that therapeutic replenishment and enrichment of lubricant molecules by boundary layer on the ocular surface would disrupt the feedback loop whereby unfavorable conditions associated with a deficiency in ocular lubrication stimulate ocular surface distress. .

In certain instances, and as provided herein, the PRG4 protein plays a critical role in the eye as a boundary layer lubricant. In some cases, this secreted glycoprotein protects the ocular surface to protect the cornea and conjunctiva against significant shear forces generated during blink, contact lens wear, and any other undesirable boundary layer ocular lubrication caused by chronic inflammation and hyperosmolarity resulting from dry eye disease, androgen deficiency, estrogen replacement therapy, compromised tear film allergy, aging, ocular surface diseases and increased levels of proteases in the tear film and on the ocular surface. Given the relationship between osmotic pressure and electromechanical interactions in charged molecules, the present invention provides, in some embodiments, a pharmaceutical composition for managing a deficiency in ocular lubrication by modulating hyperosmolarity or osmolarity at the ocular surface by disrupting feedback mechanisms that prevent secreted components from reducing coefficients of friction and mitigating shear stress.

In another exemplary embodiment, the present invention features a boundary layer lubrication protection mechanism whereby surface-bound receptors are reversibly attached to one or more surfactant or gel-forming constructs. In some cases, surfactant or gel-forming constructs peel off during a shear event, thereby preventing shear stress from reaching (or reducing the extent of shear stress) the epithelial surface. In certain embodiments, after the temporary shear event, the gel-forming and surfactant constructs, which are allowed to return to their unaltered equilibrium, are reattached to the surface-bound receptors. In some embodiments, the entire construction can peel off during shearing. It could be imagined, in certain cases, that the thermodynamics of this equilibrium would increase the probability of receptor release with increasing shear amplitude, but that any association is easily reversible.

In one embodiment of the present invention, the pharmaceutical composition comprising a PRG4 protein suspended in an ophthalmically acceptable balanced solution is applied topically to the ocular surface, where the PRG4 protein associates or binds to it. In certain cases of this embodiment, PRG4 acts as the surface-bound receptor that is allowed to interact with endogenous proteins and proteoglycans in the tear film to establish a protective mechanism to reduce friction during blinks on the ocular surface, prevent adsorption of proteins on the ocular surface, and reduce dry spots caused by tear film instability.

ES 2 633 792 T3

In another embodiment of the present invention, PRG4 is applied topically and is associated or attached to the ocular surface, in combination with one or more of the hyaluronic acid and phospholipid constructs. In certain cases of this embodiment, PRG4 acts as the surface bound receptor that interacts with exogenously supplied hyaluronic acid and / or phospholipids to establish the protective mechanism to reduce friction during blinks on the ocular surface, prevent protein adsorption on the ocular surface, and reduce dry spots caused by tear film instability. In this embodiment, the hyaluronic acid and phospholipid constructs dissociate from PRG4 during a shear event. In yet another embodiment, the entire construction is peeled off during the shear event to prevent the shear stress from reaching equilibrium.

In yet another embodiment, functional fragments, multimers (eg, dimers, trimers, tetramers, etc.), homologs or orthologs of PRG4 act as the surface receptor and / or gel-forming constructs in the protection mechanism. Functional PRG4 fragments and homologs include those with fewer repeats in the central mucin-like KEPAPTt repeat domain (SEQ ID NO: 4), glycosylated and non-glycosylated forms of the protein, splice variants, recombinant forms, and similar. A lubricating fragment of PRG4 exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the ophthalmic lubricating effect of human PRG4, as measured qualitatively, mechanically, optically, electrically, or by a biochemical assay.

As used herein, the term PRG4 protein, PRG4 protein, or proteoglycan 4 is used interchangeably with the term lubricin protein. PRG4 is also used herein to encompass the term megakaryocyte stimulating factor (MSF), which has been accepted by the UCL / HGNC / HUGO Human Gene Nomenclature database and surface zone protein (SZP). The PRG4 protein or lubricin as used herein refers to any native or recombinant, isolated or purified lubricin protein, homologues, functional fragments or residues, isoforms, and / or mutants thereof. In certain embodiments, the isolated or purified PRG4 protein comprises an amino acid sequence for a native or recombinant human lubricin protein. In further embodiments, the isolated or purified PRG4 protein comprises an amino acid sequence encoded by exons of the prg4 gene that encode the full-length PRG4 protein or primary structures of isoforms. The proteoglycan gene 4 (prg4) contains 12 exons. The PRG4 protein used herein comprises an amino acid sequence encoded by exons 1-12 of the prg4 gene, more preferably exons 6-12, and most preferably exons 9-12.

As used herein, the PRG4 protein includes any PRG4 proteins currently known, or subsequently described. In certain embodiments, a preferred amino acid sequence of the PRG4 protein is provided in SEQ ID NO: 1. The PRG4 protein shares the primary amino acid structure of any known PRG4 proteins or isoforms with at least 60% homology, preferably 75% homology, more preferably 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homology. In certain embodiments, a preferred PRG4 protein has an average molar mass of between 50 kDa and 400 kDa, comprising one or more biological active parts of the PRG4 protein, or functional fragments, such as a lubricating fragment, or a homologue thereof.

As used herein, the PRG4 protein comprises an active biological part of the protein. As used herein, a biologically active part of the PRG4 protein includes a functional fragment of a protein that comprises amino acid sequences sufficiently homologous to, or derived from, the amino acid sequence of the protein, which includes fewer amino acids. than full-length protein, and exhibits at least one full-length protein activity. Typically, a biologically active portion comprises a functional residue domain with at least one protein activity. A biologically active part of a protein can be a polypeptide that is, for example, 10, 25, 50, 100, 200, or more amino acids in length. In one embodiment, a biologically active portion of the PRG4 protein can be used as a therapeutic agent alone or in combination with other therapeutic agents to treat undesirable or decreased boundary layer lubrication of the eye.

The nucleic acid and amino acid sequences of various native and recombinant PRG4 or lubricin proteins, and the characterization of PRG4 proteins and various isoforms are described, for example, in US Patent Nos. 5,326,558; 6,433,142; 7,030,223; 7,361,738 to Turner et al., And US Patent Nos. 6,743,774 and 6,960,562 to Jay et al. US Publication No. 20070191268 by Flannery et al. also describes recombinant PRG4 or lubricin molecules useful in the present invention.

Methods for the isolation, purification, and recombinant expression of a PRG4 protein are well known in the art. In certain embodiments, the method begins with the cloning and isolation of mRNA and cDNA encoding PRG4 proteins or isoforms using standard molecular biology techniques, such as PCR or RTPCR. The isolated cDNA encoding the PRG4 protein or isoform is cloned into an expression vector, and further transformed and expressed in a host cell to produce recombinant PRG4 protein.

As used herein, "recombinant" refers to a polynucleotide synthesized or otherwise manipulated in vitro (eg, recombinant polynucleotide), to methods of using recombinant polynucleotides to produce gene products in cells or other biological systems, or a polypeptide (recombinant protein) encoded by a recombinant polynucleotide. Recombinant also encompasses the ligation of

ES 2 633 792 T3 nucleic acids having several coding regions or promoter domains or sequences from different sources in an expression cassette or vector for the expression, eg, inducible or constitutive, of a fusion protein comprising an active domain of the gene PRG4 and a nucleic acid sequence amplified using a primer of the invention.

In certain embodiments, the nucleic acid encoding the PRG4 protein may contain one or more mutations, deletions, or insertions. In such embodiments, the nucleic acid encoding the PRG4 protein is at least 60% homologous, preferably 75% homologous, more preferably 85%, 90%, 95%, 96%, 97%, 98%, 99% or more homologous, to a nucleic acid encoding the wild-type PRG4 protein.

As used herein, the term "cDNA" includes DNA that is complementary to mRNA molecules present in the mRNA of a cell or organism that can be converted to cDNA with an enzyme such as reverse transcriptase. In certain embodiments, the cDNA encoding the PRG4 protein is isolated from PRG4 mRNA expressed in human conjunctival or corneal epithelial cells using a RT-PCR method well known in the art.

As used herein, the terms polynucleotide, nucleic acid / nucleotide, and oligonucleotide are used interchangeably, and include polymeric forms of nucleotides of any length, either deoxyribonucleotide or ribonucleotides, or analogs thereof. Polynucleotides can have any three-dimensional structure, and can perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, DNA, cDNA, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors , Isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides can be natural, synthetic, recombinant, or any combination of these.

A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polymer. The nucleotide sequence can be interrupted by components other than nucleotides. A polynucleotide can be further modified after polymerization, such as by conjugation with a label component. The term also includes both single and bi-stranded molecules. Unless otherwise specified or required, any embodiment of this invention that is a polynucleotide encompasses both the double-stranded form and each of the two complementary known or predicted single-stranded forms to prepare the double-stranded form.

As used herein, the term "polynucleotide sequence" is the alphabetical representation of a polynucleotide molecule. A polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) instead of thymine when the polynucleotide is RNA, instead of DNA. This alphabetical representation can be entered into databases on a computer and used for bioinformatics applications such as, for example, functional genomics and homology searching.

As used herein, the term "isolated polynucleotide / DNA" includes polynucleotide molecules that are separate from other polynucleotide molecules that are present in the natural source of the polynucleotide. For example, with respect to genomic DNA, the term "isolated" includes polynucleotide molecules that are separate from the chromosome with which genomic DNA is naturally associated. Preferably, an isolated polynucleotide lacks sequences that naturally flank the polynucleotide (ie, sequences located at the 5 'and 3' ends of the polynucleotide of interest) in the genomic DNA of the organism from which the polynucleotide is derived. For example, in various embodiments, the isolated polynucleotide molecule encoding the PRG4 protein used in the invention may contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb. of nucleotide sequences that naturally flank the polynucleotide molecule in the genomic DNA of the cell from which the polynucleotide is derived. Furthermore, an isolated polynucleotide molecule, such as a cDNA molecule, may be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemical compounds when chemically synthesized.

As used herein, a gene includes a polynucleotide that contains at least one open reading frame that is capable of encoding a particular polypeptide or protein after being transcribed and translated. Any of the polynucleotide sequences described herein can also be used to identify sequences of larger or full-length coding fragments of the gene with which they are associated. Methods for isolating larger fragment sequences are known to those of skill in the art. As used herein, a native or natural polynucleotide molecule includes, for example, an RNA or DNA molecule that has a nucleotide sequence that occurs in nature (eg, encodes a natural protein).

As used herein, the term polypeptide or protein is interchangeable, and includes a compound of two or more amino acid subunits, amino acid analogs, or peptidomimetics. The

ES 2 633 792 T3 subunits can be linked by peptide bonds. In another embodiment, the subunit can be linked by other bonds, eg, ester, ether, etc. As used herein, the term "amino acid" includes natural and / or non-natural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid and peptidomimetic analogs. A peptide of three or more amino acids is commonly referred to as an oligopeptide. Peptide chains of more than three or more amino acids are referred to as a polypeptide or protein.

In certain embodiments, the PRG4 protein used herein refers to PRG4 proteins or various homologs or isoforms thereof, which are naturally or recombinantly expressed in humans or other host cells. As used herein, "express" or "expression" includes the process by which polynucleotides are transcribed into RNA and / or translated into polypeptides. If the polynucleotide is derived from genomic DNA, expression can include RNA splicing, if an appropriate eukaryotic host is selected. Regulatory elements required for expression include promoter sequences for binding RNA polymerase and transcription initiation sequences for ribosome binding. For example, a bacterial expression vector includes a promoter such as the lac promoter and for the initiation of transcription the ShineDalgam sequence and the AUG start codon. Similarly, a eukaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the AUG start codon, and a stop codon for ribosome cleavage. Such vectors can be obtained commercially or assembled by the sequences described in methods well known in the art, for example, the methods described below for the construction of vectors in general. As used herein, the term "vector" includes a self-replicating nucleic acid molecule that transfers an inserted polynucleotide into and / or between host cells. The term is intended to include vectors that function primarily for the replication of a nucleic acid molecule in a cell, replication vectors that function primarily for the replication of nucleic acid, and expression vectors that function for the transcription and / or translation of DNA. or RNA. Vectors that provide more than one of the above functions are also intended.

As used herein, a host cell is intended to include any individual cell or cell culture that may be, or has been, a recipient for vectors or for the incorporation of exogenous polynucleotides and / or polypeptides. It is also intended to include single cell progeny. The progeny may not necessarily be completely identical (in morphology or in genomic or total DNA complement) to the original parental cell due to natural, accidental, or deliberate mutation. The cells can be prokaryotic or eukaryotic, and include but are not limited to bacterial cells, yeast cells, insect cells, animal cells, and mammalian cells, including but not limited to murine, rat, simian, or human cells. As used herein, a host cell also includes genetically modified cells. The term "genetically modified cells" includes cells that contain and / or express a foreign or exogenous gene or polynucleotide sequence which in turn modifies the genotype or phenotype of the cell or its progeny. Genetically modified also includes a cell that contains or expresses a gene or polynucleotide sequence that has been introduced into the cell. For example, in this embodiment, a gene has been introduced into a genetically modified cell, this gene also being endogenous to the cell. The term "genetically modified" also includes any addition, deletion, or interruption of the endogenous nucleotides of a cell. As used herein, a host cell can be any cell that expresses a human PRG4 protein.

As used herein, homologues are defined herein as two nucleic acids or peptides that have nucleic acid or amino acid sequences, respectively, similar, or substantially identical. The term homologous further encompasses nucleic acid molecules that differ from one of the nucleotide sequences due to the degeneracy of the genetic code and thus encode the same amino acid sequences. In one of the preferred embodiments, homologues include allelic variants, orthologs, paralogs, agonists, and antagonists of the nucleic acids encoding the PRG4 protein (eg,

SEQ ID NO: 1).

As used herein, the term "orthologous" refers to two nucleic acids from different species, but which have evolved from a common ancestral gene by speciation. Typically, orthologs encode peptides that have the same or similar functions. In particular, the orthologs of the invention will generally present at least 80-85%, more preferably 85-90% or 90-95%, and most preferably 95%, 96%, 97%, 98%, or even 99% of identity, or 100% sequence identity, with all or part of the amino acid sequence of any known PRG4 proteins (eg, SEQ ID NO: 1), isoforms, or analogs thereof, and will exhibit a function similar to these peptides. Also as used herein, the term paralogos refers to two nucleic acids that are related by duplication in a genome. Paralogs usually have different functions, but these anointings can be related.

To determine the percent sequence identity of two amino acid sequences, the sequences are aligned for optimal comparison purposes (eg, gaps can be introduced in the sequence of one polypeptide for optimal alignment with the other polypeptide or nucleic acid). The amino acid residues at corresponding amino acid positions are then compared. When a position in one sequence is occupied by the same amino acid residue as the corresponding position in the other sequence, then the

ES 2 633 792 T3 molecules are identical in that position. The same type of comparison can be made between two nucleic acid sequences. The percent sequence identity between two sequences is a function of the number of identical positions shared by the sequences (ie, percent sequence identity = number of identical positions / total number of positions x 100). Preferably, the isolated amino acid homologues included in the present invention are at least about 50-60%, preferably at least about 60-70%, and more preferably at least about 70-75%, 75-80%, 80-85% , 85-90%, or

90-95%, and most preferably at least about 96%, 97%, 98%, 99%, or more identical to a complete amino acid sequence of any known PRG4 protein (eg, SEQ ID NO: 1).

In certain embodiments, an isolated nucleic acid homologue encoding the PRG4 protein comprises a nucleotide sequence that is at least about 40-60%, preferably at least about 60-70%, more preferably at least about 70-75%, 75 -80%, 80-85%, 85-90%, or 90-95%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%, or more identical to a nucleotide sequence encoding amino acid sequences of said PRG4 protein (eg, SEQ ID NO: 1).

Determination of percent sequence identity between two nucleic acid or peptide sequences is well known in the art. For example, the Vector NTI 6.0 (PC) software package (InforMax, Bethesda, MD) can be used to determine percent sequence identity between two nucleic acid or peptide sequences. In this method, a gap opening penalty of 15 and a gap extension penalty of 6.66 are used to determine the percent identity of two nucleic acids. A gap opening penalty of 10 and a gap extension penalty of 0.1 are used to determine the percent identity of two polypeptides. All other parameters are set to the default settings. For multiple alignment purposes (Clustal W algorithm), the gap opening penalty is 10, and the gap extension penalty is 0.05 with the blosum62 matrix. It should be understood that for the purposes of determining sequence identity when comparing a DNA sequence to an RNA sequence, a thymidine nucleotide is equivalent to a uracil nucleotide.

Furthermore, the PRG4 protein used herein includes PRG4 protein encoded by a polynucleotide that hybridizes to the polynucleotide encoding PRG4 protein under stringent conditions. As used herein, hybridization includes a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonding between the bases of nucleotide residues. Hydrogen bonding can occur by Watson-Crick base pairing, Hoogstein bonding, or in any other sequence-specific manner. The complex may comprise two strands that form a duplex structure, three or more strands that form a multi-strand complex, a single strand that self-hybridizes, or any combination of these. A hybridization reaction can constitute one step in a more extensive process, such as the initiation of a PCR reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.

Hybridization reactions can be carried out under different stringent conditions. The present invention includes polynucleotides capable of hybridizing under conditions of reduced stringency, more preferably stringent conditions, and most preferably highly stringent conditions, with polynucleotides encoding the PRG4 protein described herein. As used herein, the term stringent conditions refers to hybridization overnight at 60 ° C in Denhart's 10x solution, 6xSSC, 0.5% SDS, and 100 mg / ml sperm DNA from denatured salmon. The blots are washed sequentially at 62 ° C for 30 minutes each in 3xSSC / 0.1% SDS, followed by 1xSSC / 0.1% SDS, and finally 0.1xSSC / 0.1% SDS. Also as used herein, in certain embodiments, the term "stringent conditions" refers to hybridization in 6xSSC solution at 65 ° C. In other embodiments, highly stringent conditions refer to hybridization overnight at 65 ° C in Denhart's 10x solution, 6xSSC, 0.5% SDS and 100 mg / ml denatured salmon sperm DNA. The blots are washed sequentially at 65 ° C for 30 minutes each in 3xSSC / 0.1% SDS, followed by 1xSSC / 0.1% SDS, and finally 0.1xSSC / 0.1% SDS. Methods for nucleic acid hybridizations are well known in the art. Accordingly, the nucleic acid-encoded PRG4 proteins used herein include nucleic acid that has at least 60% homology, preferably 75% homology, more preferably 85%, more preferably 90%, most preferably 95%. 96%, 97%, 98%, 99% homology to a polynucleotide sequence encoding a human PRG4 protein (eg, SEQ ID NO: 1) or a specific isoform or homologue thereof.

Furthermore, the PRG4 proteins used herein can also be chimeric proteins or fusion proteins. As used herein, a chimeric protein or fusion protein comprises a first polypeptide operably linked to a second polypeptide. Chimeric proteins can optionally comprise a third, fourth or fifth or other polypeptide operably linked to a first or second polypeptide. Chimeric proteins can comprise two or more different polypeptides. Chimeric proteins can comprise multiple copies of the same polypeptide. Chimeric proteins can also comprise one or more mutations in one or more of the polypeptides. Methods for preparing chimeric proteins are well known in the art. In certain embodiments of the present invention, the chimeric protein is a PRG4 protein chimera with other isoforms of the PRG4 protein.

ES 2 633 792 T3

As used herein, an isolated or purified protein, polynucleotide, or molecule means removal from the environment in which it occurs naturally, or is substantially devoid of cellular material, such as other contaminating proteins from the cell or tissue source of the cell. that derives the protein, polynucleotide, or molecule, or that is substantially free of chemical precursors or other chemical compounds when chemically synthesized. The language that is substantially free of cellular material includes separate preparations of cellular components of the cells from which it is isolated or recombinantly produced or synthesized. In certain embodiments, language that is substantially free of cellular material includes preparations of a PRG4 protein that have less than about 30% (by dry weight) of other proteins (also referred to herein as contaminating protein), more preferably less than about 20%, still more preferably less than about 10%, and most preferably less than about 5% of other proteins. When the protein or polynucleotide is produced recombinantly, preferably it is also substantially free of culture medium, that is, the culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation of interest.

In certain embodiments, the present invention provides a pharmaceutical composition suitable for topical administration to an ocular surface of an individual in need of a pharmaceutically effective concentration of PRG4 protein suspended in an ophthalmically acceptable balanced salt solution, and in combination with one or more agents. ophthalmically acceptable. Ophthalmically acceptable agents may be selected from the group consisting of an ophthalmically acceptable demulcent, excipient, astringent, vasoconstrictor, and emollient. As used herein, the term effective concentration or amount or therapeutically effective concentration or amount is intended to mean a non-toxic but sufficient concentration or amount of a PRG4 protein or other therapeutic agents to provide the desired therapeutic effects. The concentration or amount that is effective will vary between subjects, depending on the age and general condition of the individual, the particular agents, and the like. Thus, it is not always possible to specify an exact effective amount or concentration. However, an effective concentration or amount appropriate in any individual case can be determined by one of ordinary skill in the art using routine experimentation. In addition, the exact effective amount or concentration of a PRG4 protein and other therapeutic agent incorporated into a composition or dosage form of the present invention is not critical, as long as the concentration is in a sufficient range to allow easy application of the solution or Formulation such that an amount of the PRG4 protein and other active agents is administered that is in a therapeutically effective range.

In certain embodiments, the pharmaceutically effective concentration of PRG4 protein is in a range of

10-10,000 μg / mL, preferably 50-500 μg / mL. As used herein, ophthalmically acceptable agents comprising ophthalmically acceptable demulcents, excipients, astringents, vasoconstrictors, and emollients are fully defined in the Code of Federal Regulations.

21CFR349.

As used herein, the term "topical administration" is used in its conventional sense to mean administration of the composition comprising the PRG4 protein and one or more ophthalmically acceptable agents to the eye. In general, topical administration is achieved by a liquid formulation for eye drops or wash and provides a local effect.

In certain embodiments, any pharmaceutical composition described herein comprises or the ophthalmically acceptable agents mentioned above are or may be combined with one or more of sodium carboxymethylcellulose (eg, about 0.2 to about 2.5% w / v ), hydroxyethyl cellulose (for example, about 0.2 to about 2.5% w / v), hypromellose (for example, about 0.2 to about 2.5% w / v), methylcellulose (for example, about 0.2 to about 2.5% w / v), dextran 70 (for example, about 0.1% w / v), gelatin (for example, about 0.01% w / v) , glycerin (for example, about 0.2 to about 1% w / v), polyethylene glycol 300 (for example, about 0.2 to about 1% w / v), polyethylene glycol 400 (for example, about 0.2 at about 1% w / v), polysorbate 80 (for example, about 0.2 to about 1% w / v), propylene glycol (for example, about 0.2 to about 1% w / v), polyvinyl alcohol (for example, about 0.1 to about 4% w / v), povidone (for example, about 0.1 to about 2 % w / v) zinc sulfate (for example, about 0.25% w / v), anhydrous lanolin (for example, about 1 to about 10% w / v), lanolin (for example, about 1 to about 10% w / v), light mineral oil (for example, <approximately 50% w / v), mineral oil (for example, <about 50% w / v), paraffin (for example, <about 5% w / v), petrolatum (for example, <about 100% w / v), white ointment (for example, < about 100% w / v), white petrolatum (for example, <about 100% w / v), white wax (for example, <about 5% w / v), yellow wax (for example, <about 5% w / v), ephedrine hydrochloride (for example, about 0.123% w / v), naphazoline hydrochloride (for example, about 0.01 to about 0.03% w / v), phenylephrine hydrochloride (for example, about 0.08 to about 0.2% w / v), and tetrahydrozoline hydrochloride (for example, about 0.01 to about 0.05% w / v). In certain instances, the percent amounts used herein are percent amounts by weight.

ES 2 633 792 T3

In further embodiments, the pharmaceutical composition of the present invention comprising a PRG4 protein in combination with one or more ophthalmically acceptable agents discussed above further comprises a therapeutically effective concentration of hyaluronic acid or sodium hyaluronate in the range of 10,100,000 µg / mL, preferably 500-5,000 μg / mL. Furthermore, the pharmaceutical composition of the present invention further comprises one or more surface active phospholipids in the range of 10-10,000 μg / mL, said surface active phospholipids include, but are not limited to, La-dipalmitoylphosphatidylcholine (DPPC), phosphatidylcholine (PC), phosphatidylethanolamine (PE) and sphingomyelin (Sp), or other neutral and polar lipids.

The pharmaceutical composition of the present invention may further comprise one or more pharmaceutically acceptable carriers or vehicles comprising any acceptable materials, and / or any one or more additives known in the art. As used herein, the term "carriers" or "vehicle" refers to carrier materials suitable for topical drug administration. Carriers and vehicles useful herein include any such materials known in the art, which are non-toxic and do not interact with the other components of the composition in a deleterious manner. Various additives known to those skilled in the art can be included in the composition. For example, solvents, including relatively small amounts of alcohol, can be used to solubilize certain drug substances. Other optional additives include opacifiers, antioxidants, fragrance, colorant, gelling agents, thickening agents, stabilizers, surfactants, and the like. Other agents, such as antimicrobial agents, may also be added to prevent spoilage during storage, that is, to inhibit the growth of microbes such as yeast and fungi. Suitable antimicrobial agents are typically selected from the group consisting of the methyl and propyl esters of p-hydroxybenzoic acid (ie, methyl and propyl paraben), sodium benzoate, sorbic acid, imidurea, and combinations thereof. Permeation enhancers and / or additives that mitigate irritation can also be included in the pharmaceutical composition of the present invention.

In certain embodiments, the pharmaceutical composition of the present invention is prepared in a pharmaceutically acceptable carrier, such as a phosphate buffered saline or an osmotically balanced salt solution of tear electrolytes, including one or more of sodium chloride at about 44% a about 54% mole fraction, potassium chloride about 8% to about 14% mole fraction, sodium bicarbonate from about 8% to about 18% mole fraction, potassium bicarbonate from about 0% to about 4% mole fraction, calcium chloride from about 0% to about 4% mole fraction, magnesium chloride from about 0% to about 4% mole fraction, trisodium citrate at about 0% to about 4% mole fraction, and hydrochloric acid at about 0% to about 20% mole fraction or sodium hydroxide at about 0% to about 20% mole fraction. In certain embodiments, the pharmaceutical carrier can be formulated to generate an aqueous electrolyte solution in the range of about 150-200 mM. Other suitable formulations, such as ointments, creams, gels, pastes, and the like, suitable for topical administration, are also contemplated by the present invention. In certain embodiments, the electrolytes provide an appropriate osmotic balance when combined with PRG4 to prepare an ophthalmically acceptable solution.

The present document further describes a method of treating unwanted or diminished boundary layer ocular lubrication, symptoms associated therewith, or a condition that is associated with or causes a deficiency in ocular lubrication, in an individual in need, which comprises administering topically on the ocular surface of the individual in need thereof a pharmaceutical composition comprising a therapeutically effective amount of PRG4 protein. In one embodiment, the method of the present invention comprises topically administering a pharmaceutical composition comprising the therapeutically effective amount of the PRG4 protein that is suspended in a phosphate buffered saline or an ophthalmically acceptable balanced salt solution comprising one or more electrolytes. In yet another embodiment, the method of the present invention comprises topically administering a pharmaceutical composition comprising the PRG4 protein formulated in an ophthalmically acceptable formulation comprising one or more additional ophthalmically acceptable agents as discussed above.

As used herein, the term "treat" or "treatment" refers to reducing the severity and / or frequency of symptoms, eliminating symptoms and / or underlying cause, preventing the onset of symptoms and / or their cause. underlying; and improvement or remedy of the damage. The term "treating" or "treatment" also encompasses both the prevention of a disorder in a predisposed individual and the treatment of the disorder in a clinically symptomatic individual.

In certain embodiments, decreased boundary layer ocular lubrication is caused by increased evaporative tear loss or unstable tear film in the boundary layer eye loop. Such decreased or unwanted boundary layer ocular lubrication is associated with aqueous or evaporative dry eye disease, Sjogren's syndrome, keratoconjunctivitis sicca (KCS), androgen deficiency, meibomian gland disease, estrogen replacement therapy, lens wear. contact, refractory surgery, allergy, reduced tear film break time, compromised tear film, ocular surface disorders, increased levels of proteases in the tear film and on the ocular surface, chronic inflammation, hyperosmolarity, and aging. As discussed above, increased shear stress results in film instability.

ES 2 633 792 T3 tear, evaporative tear loss, hyperosmolarity, changes in swelling pressure, and a retrograde elevation of shear stress. Increased shear stress also stimulates inflammation, androgen deficiency, and decreased expression of proteoglycans. Over time, increased shear stress and its aftermath result in a loss of boundary layer lubrication at the ocular surface. Accordingly, the present invention provides a method of reducing shear stress by replenishing and enriching the expression of proteoglycans, such as PRG4 protein at the ocular surface, so that ocular boundary layer lubrication is prevented or increased. .

It should also be understood that the foregoing refers to preferred embodiments of the present invention and that numerous changes can be made thereto without departing from the scope of the invention. The Invention is further illustrated by the following examples.

Examples

Example 1

PRG4 mRNA expression in human corneal and conjunctival epithelial cells

Human corneal epithelial cells were isolated from the corneascleral borders of male and female donors. Cells were either processed directly (n = 8), or first cultured in medium without keratin serum without phenol red (n = 2). Bulbar conjunctivae (n = 2), Conjunctival Impression cytology specimens (n ​​= 9), Immortalized human conjunctival epithelial cells after culture (n = 1), NOD mouse lacrimal glands (n = 5 adult mice / sex, 10 glands / sample), and BALB / c mouse melbomalan glands (n = 7 adult mice / sex, 28-eyelid glands / sample) during surgical procedures. These samples were processed for PRG4 mRNA analysis using primarily RT-PCR (n = 18 human, all mouse) and Affymetrlx GeneChlps (n = 4 human corneas). The PRG4 primers for PCR spanned more than 1 kbp of intron sequences, in order to suppress the amplification of contaminating chromosomal DNA (Table 1). Amplified samples were screened for the presence of PRG4 products using agarose gel electrophoresis and an Agllent2100 Bloanallzer. To confirm the identity of amplicons, the PCR products of corneal samples (n = 2), conjunctival epithelial cells (n = 1), and a human liver standard (n = 1) were sequenced with a 3100 Genetic Analyzer in Massachusetts. Eye and Ear Inflrmary DNA Sequencing Center for Vision Research (Boston, MA) and the resulting data were analyzed with BLAST searches of GenBank databases.

Table 1. Olligonucleotide primers designed for RT-PCR analysis of PRG4 mRNA

Species Orientation Nucleotide sequence Í5'-3'Í Exons

Ampllcón

Size (pbl

Consent Human GATGCAGGGTACCCCAAA (SEQ ID ϊ> ίθ.2) 9-12

526

Antlsentldo CAGACTTTGGATAAGGTCTGCC (SEQ ID NO: 3)

PRG4 mRNA was shown to be present in all human corneal and conjunctival epithelial cells and Impression cytology samples. The Identity of the PRG4 PCR products was confirmed by DNA sequence analysis (Table 2). The results show that PRG4 is transcribed in human conjunctival and corneal epithelial cells.

Table 2. Identification of amplification sequences of human cornea, conjunctival and liver samples

Human Liver Standard

TO

<td>Sequencing</td><td>Aligned Base Pairs</td><td>Total Base Pairs</td><td>Search BLASTn</td>

<td>Direction</td><td>A PRG4 Human</td><td>by Ampllcón</td><td>Identity</td>

<td>Direct</td><td> 495</td><td> 500</td><td>Human</td>

PRG4

ES 2 633 792 T3

<td></td><td>Sequencing Direction</td><td>Aligned Base Pairs A PRG4 Human</td><td>Total Base Pairs by Amplicón</td><td>Search BLASTn Identity</td>

<td>TO</td><td>Reverse</td><td> 488</td><td> 491</td><td>Human</td>

<td>PRG4</td><td></td><td></td><td></td><td></td>

<td>B</td><td>Direct</td><td> 496</td><td> 499</td><td>Human</td>

<td>PRG4</td><td></td><td></td><td></td><td></td>

<td>B</td><td>Reverse</td><td> 498</td><td> 500</td><td>Human</td>

PRG4

Human Cornea (24-year-old female)

<td>TO</td><td>Direct</td><td> 497</td><td> 499</td><td>Human</td>

<td>PRG4 TO</td><td>Reverse</td><td> 490</td><td> 492</td><td>Human</td>

<td>PRG4 B</td><td>Direct</td><td> 500</td><td> 504</td><td>Human</td>

<td>PRG4 B</td><td>Reverse</td><td> 498</td><td> 501</td><td>Human</td>

PRG4

Human Cornea (51-year-old female)

<td>TO PRG4</td><td>Direct</td><td> 498</td><td> 499</td><td>Human</td>

<td>TO PRG4</td><td>Reverse</td><td> 474</td><td> 489</td><td>Human</td>

<td>B PRG4</td><td>Direct</td><td> 496</td><td> 498</td><td>Human</td>

<td>B</td><td>Reverse</td><td> 490</td><td> 491</td><td>Human</td>

PRG4

Human Conjunctival Epithelial Cells

<td>TO</td><td>Direct</td><td> 496</td><td> 499</td><td>Human</td>

<td>PRG4 TO</td><td>Reverse</td><td> 490</td><td> 492</td><td>Human</td>

<td>PRG4 B</td><td>Direct</td><td> 495</td><td> 499</td><td>Human</td>

<td>PRG4 B</td><td>Reverse</td><td> 474</td><td> 491</td><td>Human</td>

PRG4

ES 2 633 792 T3

Two different samples (A and B) of each preparation were sequenced in forward and reverse directions. The human corneal samples were epithelial cells from the corneascleral edges of female donors. The gene accession number for human PRG4 is NM_005807.

Example 2

In vitro friction reduction with the addition of PRG4 (lubricin)

An in vitro friction test with clinically relevant interfaces, such as an ocular surface-eyelid and ocular surface-contact lens interface, is described below. Currently there are no clinically relevant methods capable of quantitatively evaluating the lubricating capacity of artificial tears. Friction tests with synthetic surfaces (eg, latex and glass) or non-ocular native surfaces (eg, umbilical cord vein segments) may facilitate some, but probably not all, of the molecular interactions that occur during articulation / flicker. In fact, the relevance of the data obtained with non-tissue interfaces is not clear.

A rotational disc ring test setup has been shown to be ideal for studying boundary layer lubrication at a cartilage-cartilage joint interface. A boundary layer lubrication mode is indicated because kinetic friction is not altered by factors that influence fluid film formation, including sliding speed and axial load. This is because surface-to-surface contact is occurring, and molecules attached to the surface contribute to lubrication (decreasing friction and deterioration). Boundary layer lubrication has been found to be a critical and operative mechanism on the ocular surface, as it is on the articular cartilage surface. Therefore, the in vitro friction test previously developed and characterized to study boundary layer lubrication at a cartilage-cartilage joint interface was modified to study the ocular surface-eyelid and ocular surface-contact lens interfaces.

To determine the test conditions in which boundary layer lubrication is dominant at the ocular surface-eyelid and ocular surface-contact lens interfaces, the dependence of frictional properties on axial load and sliding speed was examined. Fresh normal human eye surfaces (resected corneas with ~ 3mm sclera) were obtained from the Lions Eye Bank of Alberta. The resected corneas were stored in Optisol-GS at 4 ° C and used within 2 weeks. Eyelids (age 60-80 years old) were obtained from the University of Calgary Body Donation Program within 1-3 days after death and were either used immediately or stored at -2 ° C in saline for up to 2 weeks until use. Comparative lubricants consisted of Lens Plus Sterile Saline Solution (Advanced Medical Optics) as a negative control; Systane® Lubricant Eye Drops (Alcon Laboratories), Refresh Tears Lubricant Eye Drops (Allergan), Aquify® Long Lasting Comfort Drops (CIBA Vision) and Blink® Tears Lubricant Eye Drops (Advanced Medical Optics) as trial lubricants.

The friction test scheme is shown in Figure 6. The corneal ocular surface (605) was fixed to the spherical end of an inert non-permeable semi-rigid rubber cylinder plug (603) (radius r = 6 mm) by applying super glue to the sclera. This cylinder plug (603) was attached to the rotational activator of the mechanical testing machine (BoseELF 3200) thus forming the lower articular surface. A ring (601) (outer radius = 3.2mm, inner radius = 1.5mm) was pierced from the eyelid (604) and attached to the coupled linear activator with an axial load (N) and torsional load cell ( τ), thus forming the upper articulating surface. A bath of lubricant 602 was formed by securing an inert tube around the cylinder plug (603).

Samples were tested first in saline, then in one of the three (3) test lubricants. The lubricant bath was filled with ~ 0.3 ml, and the articulating surfaces were allowed to equilibrate with the lubricant. The sample surfaces were slowly (0.05 mm / s) brought into contact and compressed until the spherical plug flattened and the entire annular lid surface was in contact with the cornea (605). The resulting normal stress (calculated from the axial load as, in units of MPa, as N / (n [r²exterior - Atenor]) can be varied using rubber plugs with different degrees of stiffness to mimic physiological stresses ~ 5 kPa. The test sequence was started by preconditioning the sample by rotation of +4 revolutions (rev) and readjustment with -4 revolutions at a physiologically relevant effective linear sliding speed, veff = 30 mm / s (where veff = ωReff, ω is the angular frequency, and Reff = 2.4 mm is the effective radius calculated by integrating the distribution of the shear stress over the annular contact area). The samples were tested rotating +4 revolutions, followed immediately by -4 reset revolutions at veff = 30, 10, 1, 0.3 and then 30 mm / s, with a dwell time of 12 seconds between each revolution. The test sequence was repeated in the opposite direction of rotation.

To evaluate the lubrication properties of the ocular surface, two coefficients of friction (μ) of the form μ = T / (ReffN)) where is torque, Rf is effective radius, and N is axial load, described above. A coefficient of static friction, reflecting the resistance at the beginning of the movement, was calculated as the value of the peak of μ, just after (by ~ 10 °) the beginning of the rotation. An average coefficient of kinetic friction, reflecting resistance to motion at steady state, &lt;pkinetic&gt; was calculated from the average μ during the third and fourth complete test revolutions. Both postatic and &lt;pkinetic&gt; were averaged for the + and - revolutions in

ES 2 633 792 T3 each trial to account for potential directional effects on τ measurements. Data was collected at a frequency of 20 Hz.

The results of lubricin (PRG4) added to the corneal surface at a concentration in the range of 100- 300 μg / mL are shown in Figure 7. Lubricin had a friction-reducing effect on the eyelid interface, both in terms of kinetic friction as static, at all speeds. At 1/10 that of physiological hyaluronic acid, lubricin was similar to Blink® Tears Lubricant Eye Drops, which contains hyaluronic acid. In combination, the two lubricants are better than each of them alone.

Figure 8 demonstrates the in vitro corneal / eyelid kinetic friction reduction measured during the first minute after lubricin addition, compared to Aquify® eye drops. The lubricants were thoroughly washed from the ocular surface using saline between tests. A synergistic effect (physics reduced more than each of them alone) was evident when Aquify® (with hyaluronic acid) was combined with lubricin. The saline repeat was less than the original saline control. This showed a retention of the effect of lubricin even after washing with saline, suggesting that the molecules were binding to the ocular surface, and that lubricin demonstrated a longer retention time compared to sodium hyaluronate alone.

Figure 9 demonstrates the reduction in in vitro corneal / eyelid kinetic friction measured during the 5th minute after the addition of lubricin, compared to Aquify® eye drops. A synergistic effect ^ kinetics reduced more than each of them alone was evident when Aquify® (with hyaluronic acid) was combined with lubricin. The Aquify® coefficient of friction had returned to statistical equivalence with saline after 5 minutes, while lubricin remained lower, as did the combination of lubricin and hyaluronic acid.

Figure 10 shows the reduction of the coefficient of kinetic friction with time, after the addition of lubricin. Again, continued reduction suggested attachment to the ocular surface.

Example 3

In vivo poor boundary layer eye lubrication treatment

A patient complaining of ocular surface irritation is examined for ocular lubrication or conditions associated with a deficiency in ocular lubrication by measuring symptoms greater than 2 positive responses on the McMonnies questionnaire, greater than a score of 5 on the Disease Index of Ocular Surface (OSDI), or through the evidence of some symptoms on the Visual Analogue Scale, in combination with objective signs including one or more reduced tear film break time (less than = 10 seconds), lower lateral tear meniscus osmolarity greater than 308 mOsms / L, low Schirmer strip value (less than = 10 mm), corneal or conjunctival staining with sodium fluorescein (scores&gt; 0 with multiple macro dots), significant remains resulting from impression cytology, meibomian gland dysfunction determined by any means, a decrease in the post-blink displacement speed of a contact lens, a change in the space-time transfer function of a contact lens after the application of a series of pressure pulses, a decrease in the relaxation rate of post-blink interferometric tear film, an increase in the concentration of pro-inflammatory cytokines, a reduced concentration of lactoferrin or lysozyme, or an increase in the decoherence rate of the post-blink point scattering function.

The patient is administered 1 to 2 drops to the surface of each eye of a solution containing 200 µg / mL of PRG4 protein suspended in an ophthalmically acceptable balanced salt solution. The patient is instructed to close their eyes for 10 seconds.

Follow-up visits may monitor a reduction in lower lateral tear osmolarity, increased tear film break time, or the other signs mentioned above. In particular, if the osmolarity of the tear film is reduced from an abnormal value (perhaps 330 mOsms / L) to a more normal value (perhaps 304 mOsms / L), modulation and therapeutic replenishment of ocular surface lubrication is would consider successful.

ES 2 633 792 T3

REFERENCES

1. G, D, Jay, Cun Opio Onhop J5_F 355(2004)

two. DA Swann, R B. Hendren. E L. Radin, SL Solivian, E A. Duda, Anhnlis Rheum 24, 22 (1981).

GD Jny. D E. Brili; D.-J Cha, J Rheumaiol 27, 594 (2000).

Four. GD Jay, Connect Tissue Res 28, 71 (1992).

5. G. O Jay, BP Lañe, L. SokolofT, Conneci Tissue Res 28, 245 &lt;1992).

6. GD Jay. B -S Hong, Conneci Tissue Res 28_F 89 (1992).

7. G- D- Jay, K Habersiroh. C, -J, Cha, J Biomed Mater Res 40, 414 (1998).

GD Jay DA Harris, C.-J. Cha. Glycoconj J 18, 807 (200.1)

9. GD Jav, U Tantravahi, D. E Brin_} H J. Barrach, C J. Cha, J Onhop Res 19,

677 (2001),

10. CR Flannei et al., Biochenn Biophys Res Commun 254,535 (1999),

B. L Schumacher, JA Block, TM Schmid, Μ. B, Aydelolle, K. E- Kuetlner, Arch Biochem Biophys 311, 144 (1994).

T. Schmid, V. Soloveychik, K. Kueiiner, B Schumacher, Trans Onhop Res Soc 26. 178 (2001).

(3 S. G Rees el al ·. Mairix Biology 21. 593 (2002)

14. Schtimacher BL, Schmidt TA, Voeglltne MS, Chen AC, Sah RL. Proteoglycan (PRG4) synihesis and jmmunolocalizalion in bovine menisci. J Onhop Res. 2005 May, 2 3 (3); 562-8.

fifteen. ). Marcelino el al., Nal Genel 23,319 (J999).

16. DK Rhee el al ·, J Clin Invesi 115.622 (2005)

B. Xia, JA Royatl, G. Damera, G. P Sachdev, R. □, Cummings, Glycobiology 15, 747 (Aug, 2005)

K. Godl el al., J Biol Chem 277, 47248 (Dec 6, 2002).

19. DA Swann, S. Sol man, M. Dixon, C. Brooks, Biochem J 161, 473 (1977),

twenty. Schmidl TA, Plaas AH, Sandy JD Disulfide-bonded m ullimers of proleoglycan 4 (PRG4) are present in normal synovtal fluids. Biochím Biophys Acia, 2009 Mar 27.

ES 2 633 792 T3

K, A Efsaid, G. D Jay, M L. Warman, D. K Rhee. C. O Chichester, Arthritis Rheum 52. 1746 (Jun, 2005J

GD Jny el al, J Rheumatol 31, 557 (2094).

A M. Mallad el aL, J Rheumaiol 2 L 314 (Feb. 1994),

TA Schmidl et al._rin Physical Regulalion of Skeleial Repair RK, Aaron, ME Bol arder, Eds. (American Academy of Medical Surgeons, Chicago, 2005) pp. 151-162

25. Nugenl-Derfus GE. Chan AH, Schumacher BL, Sah RL. PRG4 excitar ge betvveen the articular canilage surface and synovial fluid. J Orthop Res. 2007 Od; 25 (10) 1 269-76

T, A. Schmidl, B, L Schumacher, GE Nugeni, N, S Gasielum, R, L. Sah, Trans Onhop Res Soc 30, 900 (2005),

Nugeni GE, Aneloski NM, SchmidrTA, Schumacher BL, Voegtltne MS, Sah RL Dynamic shear sti mal aitón of bovine kanil a ge biosynihesis of proteoglycan 4. Arlhntis Rheum. 2006 Jun; 54 (6): I 888-96.

D. K Rhee et al. J Biol Chem 280, 31325 (2005).

29. TJ, Klein el al, Osieoarihriiis Cartilage 1 I, 595 (2003)

30. K_T C, Morrell, W. A, Hodge. OF Krebs. R- W, Mann, Proc Nati Acad Sci USA J02, l48 | 9 (Oct 11, 2005).

31. E Meyer. RM Ovemev, K. DransfeJd. T. GyaJog, Nanosdence: Friction and Rheology on the Nonomeier Scále (World Science Publishing Co. Pie Lid, River Edge, New Jersey, 2002), pp, 373.

32. CW McCulchen, Fed Prüceedings 25,1061 f 1966).

T. MurakamL Y Sawae, M Ihara, JSME Ini J Series C-Mechanical Sysiems Machine Elements &amp; Manufaciuring 46. 594 (2003)

3. 4. G. Meachim, Ann Rheum Dis 31, 457 (1972)

D. Dotvson, Prrtc Inst Mech Eng [H | 215, 335 (2001).

36. G, A. Ateshian, V C. Mow. In Basic Orlhopedíc Biomechanics and MechanoBiology VC Mcw, R. H uiskes, Eds. (Lippincoil Williams &amp; Wilkins, Philharielfia,

2005) pp. 447-494,

F Guilak. Arthri tis Rheum 52, 1632 (Jun, 2005).

38. K. C Mordí, W, A. Hodge, D E. Krebs, RW Mann, Proc Nati Acad Sci USA 102. 14819 (Ocl I), 2005)

39, S, A, V, Swanson. in Adull Articular Cariilage M, AR Freeman, Ed, (Priman Medical, Tunbridge Wells, England, 1979) pp. 415460

ES 2 633 792 T3

40. Eisaid KA, Jay GD, Chichester CO. fteduced expression and proieolyiic suscepiíbility οΓ lubncín / superftcial zone protein may explain early elevation in ihe coefificient o fin cl ion in thejoinls of rais wiih aniigen-induced anhriiis Anhriiis Rheum 2OI) 7; S6. IOR-1 16,

Eisaid KA, Jay GD, Warman ML, Rhee DK, Chichester CO. Associalíon of anicular cariilage degradaron and loss of boundary-tubricaiing abiliiv of synovial fluid following injury and inUammalorv arthrilis. Anhriiis Rheum 2005; 52: 1746-1755.

42. Cutolo M, Cape! Lino S, Sulli A_t Senoli 6. Secchi ME. V¡11 aggio B, Slraub RH Esirogens and immune diseases Ann NY Acad Sc¡ 2006; IOS 9; 5 38-54 7,

Cuiolo M, Sulli A. CapeHino £_T Villaggio B, Montagna P, Pizzomi C, Paolino S, Seriólo B, Felli L, Slraub RH Αηΐι-TNF and sex hormones. Ann NY Acad Sci 20 06; 1069; 391-400.

44. Schmidl M, Naumann H, Weidler C, ScheHenberg M, Anders S, Slraub RH. Inílammalion and sex hormone met abol ism. Ann NY Acad Sci 2006; 1069: 236-246,

Four. Five. Rontzsch A₌ Thoss K, Peirow PK_t Henzgen S, Brauer R. Amelioraiion οΓ murine aniigen-induced artbritis by dehydroepiandrosierone fDHEA). Infiamm Res 2OO4; 53; lK9-m.

46. Zierhul M, Dana MR, Stem ME, Suilivan DA. Immunology of (he Lacrimal Gland and Ocular Tear Film, Trends Immunol 2002: 23; 333-335

47. Siem ME, Gao J. Siemasko KF, Beuerman RW, Pflugfelder SC. The role of the lacrimal funclional unit in ihe palhophysiology οΓdry eye Exp Eye Res 20Q4: 78: 409416

4B, Tomlinson A, Khanal S, Ramaesh K. Di aper C, McFadyen A. Tear film osmolariiy; determine! ion of a referent Γογ diy eye diagnosis. Invest Ophlhalmol Vis Sci 2006: 4 7: 4309-43 3 5.

49. Suilivan DA. Sulli van BD, Evans JE, Schirra F, Yamagaini H, Liu M, Richards SM, Suzuki T, Schaumberg DA. Suilivan RM, Dana MR Androgen deficiency, meiborman gland dysfunction and evaporative dry eye. Ann NY Acad Sci 2002; 966: 211-222?

50, Suilivan DA. Tearful relationships? Sex. hormones and aqueous-defícieni dry ey e. Ocular Surface 2004; 2: 92-123 '

5 !, Schaumberg DA, Bunng JE. Suilivan DA, Dana MR, Hormone replacemeni Üierapv and dry⁷ eye yes ndrome JAMA 2OÚt: 2ft6: 21 J4-2 I 19,

52. de Souza GA, Godoy LM, Mann M. Identification of 491 proleins in ihe learned fluid proteome review a Jarge number of proieases and protease inhibitors. Geno me Biol- 2006; 7: R72. Epüb 2006

53, Schirra F, Suzuki T, Dickmson DP.Townsend DJ, Gipson IK, Suilivan DA Identification of ser oido gene ic enzyme mRNAs in the human lacrimal gland, meiborman gland, comea and conjunctiva. Comea 2006: 25: 438-42

ES 2 633 792 T3

54, Schwarz IM, Hills BA. 8r. J Rheum 1998: 37: 21-26.

55, Jay GD_r Hong BS Conneci Tissue Res, Ι99Ξ, 2 «(1.2): 89-98.

56, Mainelli F, ArgüesoP. CurrOpin Allergy Clin Immuno, 2008. 8 (5) 477-483,

57, Jones MB. he al M alhema! i cal Medicine and Biolcgy 2065; 22, 265

58, Schumacher BU, Hughes CE, Kuetlner KE, Calerson B, Aydeione MB Immunodeieciion and partía! cDNA sequence heard the proteoglycan, superficial zone protein, svnthesized bv cells li ni ng synovial jomls. J Orthop Res. 1999 Jan; J 7 (1) :) 1020.

59. Schmidt TA, Gas leí um NS, Nguyen QT, Schumacher BL, Sah RL. Boundary lubricate on articular ear canil age: role of synovial (luid corso luems Anhrius Rheum 2007 Mar; 56í3): flB2-9l,

60. Schmidl TA, Plaas AH, Sandy JD, DisuJfide-bonded mullí mees oí proieoglytan 4 {PRG4) are presertl in normal synovial íluids Biochim Biophys Acia 2009 Mar 27

Stillivan DA. The definition and classifícaiion oFdry eye disease repon oF ihe Defin mon and Cías si ficat ion Subcommillee of the Internationa] Dry Eye WorkShop (2007). Ocular Surface 2007 ahr: 5 (2): 75-92

The object of the present application is further described in the following points:

1. Pharmaceutical composition suitable for topical application to an ocular surface, and comprising a therapeutically effective concentration of PRG4 suspended in an ophthalmically acceptable balanced salt solution.

two. Pharmaceutical composition according to item 1, comprising one or more ophthalmically acceptable agents selected from the group consisting of an ophthalmically acceptable demulcent, an ophthalmically acceptable excipient, an ophthalmically acceptable astringent, an ophthalmically acceptable vasoconstrictor and an ophthalmically acceptable emollient.

3. Pharmaceutical composition according to item 1, wherein the pharmaceutical composition comprises PRG4 in the therapeutically effective concentration of 10-10,000 pg / mL.

Four. Pharmaceutical composition according to item 1, wherein the pharmaceutical composition comprises PRG4 in the therapeutically effective concentration of 50-500 pg / mL.

5. Pharmaceutical composition according to item 1, comprising a therapeutically effective concentration of sodium hlaluronate or hlaluronlc acid.

6. Pharmaceutical composition according to item 5, wherein the pharmaceutical composition comprises sodium hlaluronate or hlaluronyl acid in the therapeutically effective concentration of 10-100,000 pg / mL.

7. Pharmaceutical composition according to item 5, wherein the pharmaceutical composition comprises sodium hlaluronate or hlaluronyl acid in the therapeutically effective concentration of 500-5,000 pg / mL.

8. Pharmaceutical composition according to item 1, comprising a therapeutically effective concentration of surfactant phospholiplate selected from the group consisting of La-dlpalmltollfosfatldlIcollna, phosphatldllcollna, phosphatldlethanolamine and sphingollen.

9. Pharmaceutical composition according to item 8, in which the pharmaceutical composition comprises the surfactant phospholipid in the therapeutically effective concentration of 10-10,000 pg / mL.

10. Pharmaceutical composition according to item 1, in which the ophthalmically acceptable balanced salt solution comprises at least three different electrolytes selected from the group consisting of potassium chloride,

ES 2 633 792 T3 sodium bicarbonate, potassium bicarbonate, calcium chloride, magnesium chloride, trisodium citrate, hydrochloric acid and sodium hydroxide.

eleven. Pharmaceutical composition according to point 1, in which PRG4 has an average molar mass between 50 kDa and 400 kDa.

12. Pharmaceutical composition according to item 1, in which PRG4 comprises a lubricating fragment, or a multimer or a homologue thereof.

13. Pharmaceutical composition according to item 1, in which PRG4 is a recombinant PRG4 protein, or a functional fragment thereof.

14. Pharmaceutical composition according to point 1, in which the PRG4 is a purified natural PRG4 protein chelated.