Antimicrobial compositions and related methods of use

Description

Background of the invention

[0001] Considerable progress has been made towards the identification and development of biocides for the control of various molds, plant diseases and the like. However, most commercial biocides or pesticides in use are compounds that are classified as carcinogenic or toxic to wildlife and other non-target species. For example, methyl bromide is widely used as a soil fumigation agent and in the treatment of bacterial infections after harvest. Human toxicity and harmful environmental effects will eventually lead to the discontinuation of the use of methyl bromide and various other synthetic biocides / pesticides. As a result, recent efforts have been directed towards identifying and developing natural or biomimetic compositions showing comparable antimicrobial or pesticidal activity.

[0002] One such approach deals with endophytes and their associated volatile by-products. Endophytes are defined in the art as microorganisms found in the interstitial spaces of living plant tissue but are generally not considered parasitic. Endophytes found in combination with tropical forest plants in particular have aroused considerable interest for reasons related to the antibiotic nature of their volatile by-products. Several members of the genus Muscodor (ie M. albus, M. roseus and M. vitigenus) have been shown to produce volatile by-products that are antibiotic or insecticidal in nature. The use of Muscodor albus is discussed in "New endophytic isolates of Muscodor albus, a volatile-antibiotic-producing fungus" (Ezra et al .; Microbiology, Society for General Microbiology, Reading, GB; vol. 150, no. Part 12, December 1, 2004, pp. 4023-4031).

However, a suitable by-product of each grade includes various naphthalene and / or azulene derivatives. Such compounds, along with other components of the by-product, may be toxic or otherwise unhealthy, and the respective mixtures are considered unacceptable for a variety of end uses. Accordingly, there is an ongoing research in the art to identify natural compositions and to develop biomimetic compositions without such compounds that are safe for humans and exhibit effective antimicrobial properties. The discovery of the new genus Muscodor is described in "Muscodor crispans, a novel endophyte from Ananas ananassoides in the Bolivian Amazon" (Mitchell et al; Fungal Diversity Press, Hong Kong, HK; Vol. 31, Jul 1, 2008, pp. 37-43).

Summary of the invention

[0003] In view of the above, it is an object of the invention to provide flavorings that have antimicrobial compositions and / or methods of use thereof, thereby overcoming various drawbacks and deficiencies of the prior art, including those described above. It will be understood by those skilled in the art that one or more aspects of the invention may fulfill certain purposes, while one or more other aspects may serve certain other purposes. Each objective may not apply equally to every aspect of this invention in all respects. As such, the following items may be viewed alternatively in relation to any aspect of this invention.

[0004] The invention provides an antimicrobial composition consisting of acetaldehyde; ethyl acetate; 2-butanone; propionic acid, 2-methyl-, methyl ester; ethanol; acetic acid, 2-methylpropyl ester; propionic acid, 2-methyl-, 2-methylpropyl ester; 1-propanol, 2-methyl-; 1-butanol, 3-methyl, acetate; propionic acid, 2-methyl, 2-methylbutyl ester; 1-butanol, 3-methyl; propionic acid, 2-methyl; and acetic acid, 2-phenylethyl ester, in conjunction with a methodology for preventing, inhibiting and / or eradicating microbial infections.

It may be a further object of the invention to provide a system comprising a Muscodor species or a strain thereof and a related volatile by-product in combination with a non-local medium or substrate for use against a microbial infection.

Another object of the invention may be to provide such a system and / or related methodology for use, without limitation, in the context of human and animal food, production, plants, plant parts, seeds, agricultural crops and other organic materials, packaging, building materials. , fibers, fabrics, apparel, and pharmaceutical and / or medical applications.

[0007] Another object of the invention may be to provide, alternatively or in combination therewith, a series of biomimetic man-made compositions exhibiting antimicrobial activity comparable to such Muscodor species.

[0008] It may be an object of the invention to provide one or more such compositions of edible or otherwise safe ingredients for human use and consumption.

[0009] Another object of the invention may be to provide a system, composite or article comprising such an unnatural biomimetic composition in combination with a substrate or substrate for the prevention, inhibition and / or eradication of microbial infections. Another object of the invention may be to provide such a system, composite and / or article for use in the context of the type described above or illustrated elsewhere herein.

[0010] It may also be an object of the invention to provide an antimicrobial and / or pesticidal treatment method comprising such a composition, without being limited to a vehicle, carrier or substrate.

[0011] Other objects, features, benefits and advantages of the invention will be apparent from this summary and the following descriptions of some embodiments, and will be apparent to those skilled in the art with knowledge of various antimicrobial compositions and related therapies. Such items, features, advantages, and benefits will be apparent from the foregoing in conjunction with the accompanying examples, data, figures, and any rational conclusions that may be drawn therefrom, alone or with reference to them.

[0012] In part the invention may be directed to a system comprising at least one M. crispans strain, a volatile by-product thereof or a vapor of such volatile by-product and a non-native substrate or substrate. Such supports or substrates may be as described herein or otherwise be understood by those skilled in the art. Regardless, such a strain may be provided as a biologically pure culture, optionally in combination with a carrier component suitable for contact with the substrate / substrate or end use, such culture is sufficiently viable to generate a volatile by-product. According to this invention, the by-product or by-product modification of M. crispans or the corresponding vapor is described elsewhere for the composition herein.

[0013] Accordingly, the invention may also be directed to the use of such a system and / or volatile fungal by-products to provide an antimicrobial effect. Such a method may include providing a non-native substrate or medium capable of supporting the activity or growth of microorganisms; and contacting said substrate or medium with a culture of the M. crispans strain, its volatile by-product and / or steam from such by-product. In some embodiments, such contact may include such a strain on, about or in proximity to such substrate or substrate. In certain other embodiments, a volatile by-product or modifications of the M. crispans by-product or a suitable vapor may coalesce with or otherwise contact such substrate or substrate.

[0014] Without being limited to any such system or method, such substrate may be selected from a foodstuff or product, food packaging element or other perishable item, fiber, garment or clothing item, building or structural element, plant, plant surface. , soil, litter or debris. Such contact may be bioactive with regard to the presence of microbes and / or prophylaxis.

[0015] In part, the invention may be directed to a non-naturally occurring antimicrobial composition, whether the components thereof are of natural origin, chemically synthesized, or a combination thereof. Such a composition may contain compounds selected from alcohol, aldehyde, ketone, acidic and / or acid ester components of the Muscodor sp. Biomimetic by-product composition, such a composition may be aromatic-free, condensed aromatic compounds, substituted fused aromatic compounds and hydro-derivatives of such unions. In certain non-limiting embodiments, such a composition may contain an acid component selected from acetic acid, isobutyric acid, propionic acid, and combinations thereof.

[0016] In some embodiments, the invention can be directed to a naturally derived antimicrobial composition comprising an acid component C2 - about C5; the C2 ester component - about C5; and at least two C2 - about C5 components that can be isolated from the volatile by-product of an isolated Muscodor crispans culture, such a composition that may have a pathogen activity profile different from that of an isolated, cultured Muscodor sp. pathogen, its volatile by-product and / or a synthetic mixture of such a volatile by-product. The acid component can be selected from isobutyric acid, propanoic acid, and combinations thereof. Independently, such an ester component can be selected from C4 acetate ester, C5 acetate ester, and combinations thereof.

[0017] Without limitation, in some embodiments, such a composition may contain about 8 - about 10 ingredients otherwise isolated from the volatile by-product of M. crispans. In certain such embodiments, each component of the composition can be isolated from such volatile by-product. As such a composition may be of natural origin, any such component may be a fermentation product, and the fermentation may be selected from bacterial, yeast and / or fungal fermentation. Regardless, each such component of such a composition can be generally considered safe for human consumption pursuant to Section 21 of the United States Code of Federal Regulations and its relevant sections and / or regulations.

[0018] Regardless, in certain non-limiting embodiments, such an insulating component may be isobutyric acid. In certain such embodiments, propanoic acid may be at least in part replaced with isobutyric acid. In these or other non-limiting embodiments, such insulating component may be 2-butanone. In certain such embodiments, acetic acid, propanoic acid, or a combination thereof may be at least partially substituted with 2-butanone. In these or yet other non-limiting embodiments, such an insulating component may be ethanol. In certain such embodiments, the acetic acid may be at least partially replaced with ethanol. Regardless of the identity or amount of any such acid component, ester component and / or separable component, such a naturally obtained composition may contain a surfactant component. In certain such embodiments, a biosurfactant may be included. Without limitation, the biosurfactant can be a rhamnolipid component selected from monoramnolipid, diramnolipid, and combinations thereof.

[0019] Alternatively, the invention may be directed to a synthetic, non-naturally derived antimicrobial composition. Such a composition may include an acid component C2 - about C5; the C2 ester component - about C5; and at least two C2 - about C5 components that can be isolated from the volatile by-product of an isolated Muscodor crispans culture, such a composition that can have a pathogen activity profile different from that of an isolated, cultured Muscodor sp. or an isolated by-product thereof. Such acid, ester and / or isolable components may be as described above or illustrated elsewhere herein. Regardless, such an antimicrobial composition may include a surfactant component. In some embodiments, a surfactant may be incorporated. Without limitation, such a biosurfactant can be a rhamnolipid component selected from monoramolipids, diramnolipids, and combinations thereof.

[0020] In part, the invention may be directed to a biomimetic, antimicrobial composition comprising a liquid mixture of compounds selected from C2 to about C5 alcohols, aldehydes, ketones, acids and acid esters, and combinations and combinations thereof, such as a non-isolated composition from Muscodor sp. discussed elsewhere, such a liquid mixture may be volatile at room and / or ambient temperature. With respect to such a composition and its compounds, the term "about" may mean, as understood by one skilled in the art, carbon and / or methylene homologues of the appropriate molecular weight and / or structural isomerism limited only by a mixture with one or more other ingredients, compounds and at least partially volatile at room / ambient temperature of the resulting composition. With respect to certain non-limiting embodiments, such a composition may contain alcohol, aldehyde, ketone, acid and acid ester compounds selected from components of a M. crispans biomimetic by-product composition of the kind described below. Such a composition may contain chemically synthesized compounds, compounds isolated from bacterial fermentation, and combinations of such compounds. In certain such embodiments, such a composition may contain an acid component selected from acetic acid, isobutyric acid, propionic acid, and combinations thereof.

[0021] In part, the invention may also be directed to a non-naturally occurring, natural and / or chemically synthesized antimicrobial composition comprising compounds selected from C2 to about C5 alcohols, aldehydes, ketones, acids and acid esters, and combinations and combinations of such compounds, such selected compounds generally recognized as safe ("GRAS") for human consumption, such designation is set forth in Chapter 21 of the US Code of Federal Regulations and their respective sections and / or regulations. In certain non-limiting embodiments, such compounds may be selected from alcohol, ketone, acid, and / or acid ester components of the M. crispans biomimetic by-product composition. In some embodiments, the microbial activity / mortality profile differs from that of M. crispans or M. albus, their volatile by-product compositions and / or corresponding synthetic by-products. Regardless, in certain such embodiments, such a composition may contain an acid component selected from acetic acid, isobutyric acid, propionic acid, and combinations thereof.

[0022] In part, the invention may include a composition comprising the composition of the invention; and a surfactant, such as the surfactant itself or which can be incorporated into the carrier component. In certain embodiments, such a surfactant may be a biosurfactant, such a biosurfactant, which may be a rhamnolipid component selected from monoramnolipid, diramnolipid, and combinations thereof.

[0023] In part, the invention may also be directed to a system or composite comprising the composition of the invention and a substrate or substrate component. Such a composition may be as described above or as illustrated elsewhere herein. Without limitation, the substrate may be selected from a comestible or product, packaging element (e.g. foil or wrapping) for food or other perishable object, fiber, fabric or garment, building or construction element, human tissue, plant, plant surface, soil, garbage or debris. In some embodiments, such a composition, whether liquid or gaseous, may be incorporated into or otherwise in contact with such substrate, substrate, or substrate surface.

[0024] Accordingly, the invention may also be directed to a method of treating microorganisms or insects, preventing, inhibiting, eradicating and / or otherwise influencing the activity of microorganisms or insects. Such a method may include providing a composition of the invention including, but not limited to, one or more of the compositions provided herein; and contacting the microorganism or insect or article / substrate capable of supporting the activity of the microorganisms or insects with said composition in an amount at least partially sufficient to affect the activity of the microorganism or insects. Such a microorganism (e.g. a fungus, bacterium or virus) or insect may be present in the substrate, on or near the surface of the substrate discussed above. Accordingly, such contact may be direct and / or after volatilization of such composition. Regardless, such treatment may be microbial or insect active and / or prophylactic. As illustrated elsewhere herein, treatment may be contemplated in the context of the death of microorganisms or insects and / or inhibition of growth or activity.

[0025] According to certain embodiments of the invention, compositions containing certain food and flavor compounds (FFCs) are particularly inhibitory and / or lethal to certain pathogenic fungi, bacteria and other microbes of agricultural, medicinal, commercial or industrial importance. Such compositions can be distinguished from any previous mixture containing compounds of biological origin: for example, the compositions do not contain any naphthalene or azulene derivative substances (non-GRAS compounds). Conversely, such compositions may contain a mixture of organic compounds, each of which may be treated (ie GRAS) in a different way as a food or flavoring material.

[0026] The invention demonstrates the nature of such compositions, their preparation and application to a variety of items (e.g., without limitation, food, fibers, tools and construction surfaces) to maintain their integrity and prevent deterioration by various fungi (molds and other microorganisms). Such compositions can also be applied to the construction of buildings, parts of plants and even articles of clothing for maintenance purposes. Moreover, as demonstrated below, such a composition may negatively affect Mycobacterium tuberculosis - the tuberculosis causing microorganism - comprising at least 3 strains which are otherwise drug resistant. Brief description of the figures.

[0027]

Fig. 1 Photographs illustrating the effect of killing FFCs on clinical cultures of drug-resistant Mycobacterium tuberculosis after 2 days exposure.

Fig. 2. A series of photographs illustrating the prevention of fungus (mold) growth on cheese by several methods using FFC.

Figure 3. Protective effect of FFCs on sweet potatoes when stored in the presence of 0.2 ml of the FFC composition for 2 days. The sweet potatoes were then photographed 10 days later. (The test group is on the left and the control is on the right.) Fig. 4. Protective effect of FFCs in the context of spoilage of garbage kept for 10 days at 30 ° C.

Fig. 5. Demonstration of the anti-rot / wilt effect of tomato, on the left is a C. michiganense control plate and on the right is a plate treated with microliters of the FFC composition according to the invention.

Figure 6. Demonstration of the effect of the FFC composition of the invention incorporated in a cream skin product.

Figures 7A-B and 8 illustrate structures of several non-limiting, representative monoramnolipid and diramnolipid compounds, according to certain non-limiting embodiments of the invention.

Fig. 9 shows two embodiments of the rhamnolipid component, designated R1 and R2 for the respective mono- and diramnolipid structures, which may be used singly or in combination with each other, as described in several examples below, in accordance with some non-limiting embodiments of this invention. .

Detailed description of certain embodiments.

[0028] As illustrated in several non-limiting embodiments, this invention relates to the use of a new Muscodor grade and / or its volatile by-products and the development of unnatural, lab-obtained biomimetic compositions containing common food products and flavoring compounds that, when added to various media, applied to surfaces or introduced into the atmosphere, space or volume, they decontaminate a desired surface medium or volume with otherwise unsightly, harmful, and / or pathogenic microorganisms, including plants, fungi, and the tuberculosis pathogen. The invention has extremely important implications and applications for modern agriculture, human medicine, food science, and industry. The compositions of this invention are not obvious to have antimicrobial properties, given that no single ingredient is biologically active per se. The synergistic combination of ingredients manifests itself in its full potential antimicrobial activity.

[0029] With regard to the use of such a species of Muscodor, a volatile by-product thereof, or a non-natural biomimetic composition containing FFC, contact may be direct or by exposure to steam associated with such species, a by-product of the biomimetic composition. As illustrated below, in the context of certain embodiments, while exposure to steam may inhibit growth, direct microbial contact may be required for bacterial or fungal death.

[0030] Regardless of the method of contact, the compositions of the invention may be prepared in the laboratory, contain chemically synthesized ingredients, ingredients of natural origin, or a combination of such synthetic or natural ingredients. Regardless, such compositions can be biomimetic with respect to the effect of a Muscodor by-product on a particular species of bacteria or fungi. Alternatively, such a composition, by relative concentration or selection of any one or more FFC components, may exhibit varying or enhanced antimicrobial activity as compared to the fungal by-product of Muscodor.

[0031] In certain such embodiments, such a composition may be or may be applied to a substrate or medium containing a protein or cellulose component that may be, is capable of, or supports the growth of microbes. Without limitation, some embodiments may include plants, plant components (e.g., roots, stems, leaves or foliage, crops, and the like), and any derived shoot or seed. In particular, without limitation, such compositions may be on any plant product, be it fruit, vegetables, tubers, flowers, seeds or nuts, whether pre- or post-harvest. Certain such plants and / or their products are known in the art either individually or in combination as agricultural crops. Accordingly, in some embodiments, a composition of this invention may be present or applied to such a plant at any time during development, pre-harvest and / or post-harvest. Likewise, a composition of this invention may be applied to or incorporated into a drink, food product (e.g., human, pet and / or animal), or an article of manufacture that may be, is capable of, or sustains microbial growth.

[0032] In certain other embodiments of this invention, such a composition may be present or may be applied to a substrate or surface that supports or promotes the growth of microorganisms (e.g. yeast and / or fungi and / or virus). Accordingly, such a substrate or surface may include any material that can be, is capable of, or supports the growth of microorganisms. Such substrates include, but are not limited to, wood, ceramics, porcelain, stone, plaster, drywall, cement, fabrics, leather, plastics, and the like.

[0033] In certain other embodiments, the various compositions of the invention may be in contact with, or applied to or administered to, a substrate or surface containing mammalian or human tissue, including, but not limited to, nails, hair, teeth, or mouth. skin and other cellular material, in the context of a pharmaceutical formulation or for personal care or care for the treatment or prevention of growth or infection with microorganisms. Representative compositions are described below with respects at least in part applied to one or more other embodiments.

[0034] The endophytic fungus was recovered from inside the tissues of a wild pineapple plant (Ananas ananassoides) growing in the Bolivian Amazon. Ultimately, it has been shown to produce a mixture of volatile compounds with antimicrobial activity. Using molecular techniques, the fungus was found to display sequence similarities to members of the genus Muscodor. These fungi are known to produce volatile organic compounds that can act as antimicrobials that are effective against both human and plant pathogens. Muscodor species members were identified using methods such as mapping phylogenetic forms using 18S rDNA and ITS-5.8S rDNA sequence analyzes. Sequences found in the fungus and other Muscodor spp. BLAST was searched at GenBank and compared to other fungi (Bruns et al., 1991, Reynolds and Taylor 1993, Mitchell et al., 1995, Guarro et al., 1999, Taylor et al., 1999). Ultimately, these isolates were found to be related to Xylaria (Worapong et al., 2001a and b). All the isolated Muscodor taxa have similar characteristics, such as relatively slow growth, having felt-like mycelium, production of biologically active volatile compounds, and no harm to the plants in which they originally lived. Finally, they each have similar rDNA sequences (Ezra et al., 2004).

[0035] Although the present fungus shares all the common features mentioned above, there are a number of different aspects of this taxon that set it apart from all other Muscodor spp species and isolates. As shown in more detail in the examples below, these unique features support the establishment of the present fungus as a new species. The proposed name for this new endophytic fungus is Muscodor crispans.

[0036] According to GC / MS analysis, the isolated fungus produced low molecular weight alcohols, esters and acids in the gas phase when grown on potato dextrose agar (PDA). As shown in Table 1 below, such compounds include propionic acid, 2-methyl; 1-butanol, 3-methyl, acetate; 1-butanol and ethanol. Neither naphthalene nor azulene derivatives (non-GRAS compounds) were produced by this organism during its growth on PDA, distinguishing it from all other Muscodor spp species studied to date. The odor produced by the fungus becomes noticeable after about 1 week and appears to increase over time up to and including at least three weeks. As illustrated below, the volatiles of this fungus show inhibitory and lethal biological activity against many plant and human pathogens using standard biological technique (Strobel et al., 2001).

Table 1

<td>Retention time (min.)</td><td>Relationship</td><td>MW</td>

<td> 2:05</td><td>Acetaldehyde</td><td> 44,03</td>

<td> 03:40</td><td>Ethyl acetate</td><td> 88,05</td>

<td> 03:51</td><td>2-Butanone</td><td> 72,06</td>

<td> 04:08</td><td>Propionic acid, 2-methyl-, methyl ester</td><td> 102,07</td>

<td> 04:18</td><td>Ethanol</td><td> 46,04</td>

<td> 05:29</td><td>Acetic acid, 2-methylpropyl ester</td><td> 116,08</td>

<td> 06:39</td><td>Propionic acid, 2-methyl, 2-methylpropyl ester</td><td> 144,12</td>

<td> 06:46</td><td>1-propanol, 2-methyl-</td><td> 74,07</td>

<td> 06:52</td><td>2-propanol, 2-methyl-, (E) -</td><td> 84,06</td>

<td> 07:12</td><td>1-Butanol, 3-methyl-, acetate</td><td> 130,10</td>

<td> 8:18</td><td>Hexane, 2,3-dimethyl-</td><td> 114,14</td>

<td> 08:21</td><td>Propionic acid, 2-methyl, 2-methylbutyl ester</td><td> 158,13</td>

<td> 8:31</td><td>1-Butanol, 3-methyl-</td><td> 88,09</td>

<td> 13:37</td><td>Propionic acid, 2-methyl-</td><td> 88,05</td>

<td> 14:41</td><td>Formamide, N- (1-methylpropyl) -</td><td> 101,08</td>

<td> 16:44</td><td>Acetic acid, 2-phenylethyl ester</td><td> 164,08</td>

<td> 20:44</td><td>Cyclohexane, 1,2-dimethyl-3,5-bis (1-methylethenyl) -</td><td> 192,19</td>

[0037] As discussed above, the invention includes the use of M. crispans and / or its volatile by-product in combination with a non-local substrate, substrate and / or volume for an antimicrobial effect. Such use and / or uses may be as described or otherwise understood by those skilled in the art including, without limitation, the use and application of the method described in US Patent No. 6,911,338.

[0038] Alternatively, a wide range of natural and synthetic biomimetic compositions can be used with a comparable or enhanced effect or, as evidenced by one or more embodiments, to obtain results hitherto not available using a fungus or its volatile by-product. As a departure from the prior art and by-product, M. crispans, such antimicrobial compositions may contain food and flavor compounds generally recognized as safe for use and consumption in humans. Representative, non-limiting, biomimetic compositions thereof are shown in Tables 2-7 below.

Various other compositions may contain combinations of compounds selected from one or more of Tables 2-7. Alternatively, any such composition may contain a component compound in addition to or replacing any said compound to increase volatility or modify any other end-use or performance characteristics. In certain such compositions, such a replacement or additional compound may be GRAS-designated and / or so labeled at the levels used. Such compositions may, alternatively, contain an ingredient present in the volatile by-product of M. crispans and / or not present in the volatile by-product of another Muscodor sp.

[0039] Any such compound may be provided at an effective concentration or percentage range, and is commercially available or may be obtained by those skilled in the art. With respect to the latter, fermentation techniques can be used to naturally produce and isolate such compounds. Alternatively, such compounds may be chemically synthesized. With respect to several non-limiting embodiments of this invention, any compound of Tables 2-7 can be obtained as a fermentation product, such products and corresponding compositions are available under the trademark Flavorzon from Jeneil Biotech, Inc. of Saukville, Wisconsin.

Table 2. The composition of the biomimetic according to this invention containing:

Relationship

Acetaldehyde

Ethyl acetate

2-Butanone

Propionic acid, 2-methyl, methyl ester

Ethanol

Acetic acid, 2-methylpropyl ester

Propionic acid, 2-methyl, 2-methylpropyl ester

1-propanol, 2-methyl, 1-Butanol, 3-methyl-, acetate

Propionic acid, 2-methyl, 2-methylbutyl ester

1-Butanol, 3-methyl Propionic acid

Acetic acid, 2-phenylethyl ester

Table 3. The composition of the biomimetic according to this invention containing

Relationship

Acetaldehyde

Ethyl acetate

2-Butanone

Propionic acid, 2-methyl, methyl ester

Ethanol

Acetic acid, 2-methylpropyl ester

Propionic acid, 2-methyl, 2-methylpropyl ester

1-propanol, 2-methyl, 1-Butanol, 3-methyl-, acetate

Propionic acid, 2-methyl, 2-methylbutyl ester

1-Butanol, 3-methyl Propionic acid, 2-methyl Acetic acid, 2-phenylethyl ester

Propanoic acid

Table 4. Composition of a biomimetic according to this invention containing

Relationship

Acetaldehyde

Ethyl acetate

2-Butanone

Propionic acid, 2-methyl, methyl ester

Acetic acid

Acetic acid, 2-methylpropyl ester

Propionic acid, 2-methyl, 2-methylpropyl ester

1-propanol, 2-methyl, 1-Butanol, 3-methyl-, acetate

Propionic acid, 2-methyl, 2-methylbutyl ester

1-Butanol, 3-methyl Propionic acid, 2-methyl Acetic acid, 2-phenylethyl ester

Table 5. The composition of the biomimetic according to this invention containing

Relationship

Acetaldehyde

Ethyl acetate

Acetic acid

Propionic acid, 2-methyl, methyl ester

Ethanol

Acetic acid, 2-methylpropyl ester

Propionic acid, 2-methyl, 2-methylpropyl ester

1-propanol, 2-methyl, 1-Butanol, 3-methyl-, acetate

Propionic acid, 2-methyl, 2-methylbutyl ester

1-Butanol, 3-methyl Propionic acid, 2-methyl Acetic acid, 2-phenylethyl ester

Table 6. The composition of a biomimetic according to this invention containing

Relationship

Acetaldehyde

Ethyl acetate

Propanoic acid

Propionic acid, 2-methyl-, methyl ester

Ethanol

Acetic acid, 2-methylpropyl ester

Propionic acid, 2-methyl-, 2-methylpropyl ester

1-propanol, 2-methyl, 1-Butanol, 3-methyl-, acetate

Propionic acid, 2-methyl, 2-methylbutyl ester

1-Butanol, 3-methyl Propionic acid, 2-methyl Acetic acid, 2-phenylethyl ester

Table 7. A biomimetic composition of this invention containing various combinations of compounds selected from or including the following compounds:

<td> %</td><td>Relationship</td>

<td>about 0.1 - about 10</td><td>Acetaldehyde</td>

<td>about 0.5 - about 25</td><td>Ethyl acetate</td>

<td>about 0.1 - about 15</td><td>2-Butanone</td>

<td>around 4 - around 99</td><td>Propionic acid, 2-methyl-, methyl ester</td>

<td>about 1.5 - about 40</td><td>Ethanol</td>

<td>about 0.1 - about 10</td><td>Acetic acid, 2-methylpropyl ester</td>

<td>about 0.1 - about 15</td><td>Propionic acid, 2-methyl-, 2-methylpropyl ester</td>

<td>about 0.1 - about 10</td><td>1-propanol, 2-methyl-</td>

<td>about 0.5 - about 25</td><td>1-Butanol, 3-methyl-, acetate</td>

<td>about 0.5 - about 25</td><td>Propionic acid, 2-methyl-, 2-methylbutyl ester</td>

<td>around 2 - around 50</td><td>1-Butanol, 3-methyl-</td>

<td>about 10 to about 99</td><td>Propionic acid, 2-methyl-</td>

<td>about 0.1 - about 10</td><td>Acetic acid, 2-phenylethyl ester</td>

[0040] With respect to any FFC composition of the invention, it is contemplated that any compound component thereof - including any compound component described or suggested herein, such as but not limited to any component in Tables 1-7 and 10 and the isomers structural and / or carbon and methylene homologues thereof - may be present in an amount or range separately and independently of any other component of the composition. Accordingly, without limitation, each such component of the compound may be present in an amount or in the range of about 0.1 wt%, (or less) about 0.2 wt%, about 0.3 wt%. % or about 0.4 wt.%. ... or / up to about 1.0 wt.%, about 1.1 wt.%, about 1.2 wt.%, about 1.3 wt.% % or about 1.4 wt. or / up to about 2.0 wt.%, about 2.1 wt.%, about 2.2 wt.%, about 2.3 wt.%. or about 2.4 wt.%, or / up to about 3.0 wt.%, about 3.1 wt.%, about 3.2 wt.%, about 3.3 wt.%. or about 3.4 wt.%. or / to about 4.0 wt.%, about 4.1 wt.%, about 4.2 wt.%, about 4.3 wt.%. or about 4.4 wt.%, or / up to 5.0 wt.%, about 5.1 wt.%, about 5.2 wt.%, about 5.3 wt.%. or about 5.4 wt.%, or / to about 6.0 wt.%, about 6.1 wt.%, about 6.2 wt.%, about 6.3 wt.%. or about 6.4 wt.%, or / up to about 7.0 wt.%, about 7.1 wt.%, about 7.2 wt.%, about 7.3 wt.%. or about 7.4 wt.% or / up to about 8.0 wt.%, about 8.1 wt.%, about 8.2 wt.%, about 8.3 wt.%. or about 8.4 wt.%. or / to about 9.0 wt.%, about 9.1 wt.%, about 9.2 wt.%, about 9.3 wt.%. or about 9.4 wt.% or / to about 10.0 wt.%; and or / up to about 10.1 wt.% or / up to about 20.0 wt.%, according to such incremental variation; or / up to about 20.1 wt.% or / to about 30.0 wt.%, according to such incremental variation; or / up to about 30.1 wt.% or / to about 40.0 wt.%, according to such incremental variation; or / to about 40.1 wt.%. or / up to about 50.0 wt.%, according to such incremental variation; % or / to about 50.1 wt.%. or / up to about 60.0 wt.%, consistent with such incremental variations; or / up to about 60.1 wt.% or / to about 70.0 wt.%, in accordance with such an incremental embodiment; or / up to about 70.1 wt.% or / to about 80.0 wt.%, in accordance with such an incremental embodiment; or / up to about 80.1 wt.% or / to about 90.0 wt.%, according to such incremental variation; or / to about 90.1 wt.%.

or / to about 99.9 wt.%. (or more) according to such an incremental variety. Likewise, without limitation, any composition of the invention - regardless of the identity or amount of any particular ingredient or combination of compounds - may be present in an amount (wt%) or range of wt%. with an incremental variable as described above from 0.1 wt. % up to 99.9 wt.% any composition or vehicle (e.g., in any range from about 0.1 wt% to about 1.0 wt%, about 2.0 wt%, about 4.0 wt%). or up to about 10.0 wt.%) therein or in the article or application substrate.

[0041] Unless otherwise indicated, all numbers expressing amounts, concentrations, or amounts of components or ingredients, properties such as molecular weight, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless otherwise indicated, the numerical parameters set forth in this description and appended claims are approximations that may vary depending on the desired properties to be obtained by the invention. At least, and not in an attempt to limit the application of the equivalence doctrine to the scope of the claims, each numerical parameter should be interpreted at least in light of the number of significant figures reported and using common rounding techniques.

[0042] While the numerical ranges and parameters defining the broad scope of this invention are approximations, the numerical values ​​and examples given are given as accurately as possible. However, each numerical value may inherently contain some error due to the standard deviation found in the corresponding test measurement.

[0043] The compositions and methods of this invention may suitably comprise, consist of, or consist essentially of any compound component or amount / concentration thereof disclosed, mentioned or suggested herein - including, but not limited to, any compound component of Tables 1-7. and 10, together with any structural isomers, carbon and / or methylene homologues thereof of any such alcohol component, aldehyde component, ketone component, an acid component and / or an ester component, whether or not it is of acidic and / or alcoholic origin. Regardless of the amount / concentration, each such compound component or moiety / substituent is distinguishable in composition, contrasting, and may be used in conjunction with the compositions and methods separately and independently of other such amounts / concentrations of the component or other compound component (or moiety). / substituent) or amount / concentration. Accordingly, it is to be understood that the compositions of the invention and / or methods as illustrated herein may be practiced or used with a variation in amount or concentration in the absence of any compound component (or moiety and / or substituent thereof) in the case of such a compound. (or a moiety / substituent thereof) or amounts / concentrations thereof, which may or may not be specifically disclosed, listed, or suggested herein, alteration or absence thereof may or may not, be specifically disclosed, mentioned or suggested.

[0044] In preferred embodiments, a biologically effective composition of such FFCs (obtained as a liquid mixture) is readily evaporated at room temperature and diffused into an enclosed space to effectively inhibit and / or kill unwanted contaminating fungi (molds) on surfaces where it is desirable to rid such harmful microorganisms. The mixture can be applied as a spray (e.g. pressurized can) or simply place in a container and allow it to evaporate in a closed container or a tightly closed bag.

[0045] Regardless, the FFC compositions of this invention can be incorporated into a variety of final compositions, limited only by use. Such compositions include, but are not limited to, those targeting human / animal food or nutrients, personal care, healthcare, agricultural, industrial, residential, medical, and consumer applications. In certain non-limiting embodiments, the FFC composition and / or component (i) thereof may be present in an amount from about 0.1 wt.%. % or less to about 99.9 wt.%. or more of a particular end use composition. This level of incorporation is only limited by the desired antimicrobial effect and / or formulation considerations.

[0046] The current FFC compositions, at effective dose levels, are effective in killing many plant pathogens, fungi that can cause food spoilage, microbes that can cause serious disease in humans, and microbes that can contaminate work surfaces, homes, and other buildings. An unlimited list of such uses is provided below:

1. For the treatment of cheeses during storage or in preparation for the control of unsightly mold contamination of the surface and possible deterioration of the cheese blocks.

2. For the treatment of various parts of plants in storage, including roots, tubers, stems, seeds and other organs that may eventually be used for food, planting and regeneration, or for agricultural purposes.

3. For use in the decontamination of buildings that may have moldy surfaces or be contaminated to a level at which a mold problem may arise.

4. For use in the conservation of garbage during its transportation by long sea voyage from one port to another for final fermentation into energy related products.

5. For the decontamination of soils that may contain microorganisms that are potential plant pathogens.

6. For the treatment of patients with tuberculosis and other mycobacterial infections.

7. For treatment to control nasal infections and to clear the nasal passages.

8. For bonding with specially designed polymers that can be used for wrapping and thus preserving materials including food, fibers and other objects for long-term safe storage.

[0047] In general, the compositions of this invention can be used to inhibit the growth or kill an organism selected from the group consisting of a fungus, bacteria, a microorganism, and a variety of other microorganisms or pests. Using methods well known to those skilled in the art, the composition is contacted with the organism in an amount at least partially effective to kill or inhibit the growth of the organism. Alternatively, it can be used for the treatment of human or animal waste, e.g.

as a component of waste water or in the treatment or treatment of solid materials. Such compositions are also useful for the decontamination of human and animal waste, e.g., reducing or removing bacterial and fungal contamination. Furthermore, such a composition can be used to treat or prevent mold on building materials and buildings by contacting the building, building materials or spaces between building materials with an effective amount or vapors thereof. By way of illustration only, an effective amount of such a composition can be used alone or in combination with other fumigants or actives in a room, or alternatively in whole building fumigation.

[0048] In agricultural applications, the invention provides a method of treating or protecting a fruit, seed, plant, or soil surrounding the plant from invasion by an organism such as a fungus or bacteria, by contacting the microorganism with an effective amount of one or more compositions of the type described herein.

[0049] As discussed above, the invention provides a method of preventing, treating, inhibiting and killing bacterial, fungal, viral and / or other microbial infections. Such a method may involve administering to the product, an animal / mammalian or plant substrate having such infection or growth, or capable of supporting such infection or growth, an effective amount of a composition of the invention - alone or such as may be incorporated into the composition or formulation. Accordingly, the invention provides one or more compositions for pharmaceutical, personal (e.g., without limitation, cosmetic), industrial, and / or agricultural use.

[0050] Treatment of microorganisms can be achieved by contacting the bacteria, fungus, virus and / or other microorganism with an effective amount of the composition of the invention. The contacting may take place in vitro or in vivo. "Contacting" means that such a composition of the invention and said microorganism are combined in a manner sufficient to prevent, inhibit and / or eliminate infection and / or growth of the microorganisms. Effective amounts of such a composition for such treatment can be determined empirically, and it is within the skill of the art to make such determinations. Inhibition includes both the reduction and elimination of the growth / activity of microorganisms.

[0051] The compositions of the invention may be administered to or contacted with a human, animal, or plant substrate or article substrate surface by any suitable route, including, but not limited to, orally or intranasally (e.g., for pharmaceutical or personal care applications) and topically, such as in for powders, granules, liquids, sprays, ointments, lotions or creams. Accordingly, the compositions of the invention may contain suitable ingredients in admixture with one or more acceptable carriers and, optionally, with one or more other compounds or other materials. Such a carrier should be "acceptable" in the sense of being compatible with the other components / ingredients of the formulation and not deleterious to the desired effect or use.

Regardless of the route of delivery, treatment or administration chosen, the compositions of the invention can be formulated to provide acceptable concentrations or dosage forms by conventional methods known to those skilled in the art. The amount or concentration of any such composition or component thereof, with or without a carrier, will vary depending upon the target microorganism / substrate / subject treated, particularly the mode of administration / delivery, and all other factors described above. The amount combined with the carrier material will generally be that amount of such composition to provide the lowest or minimum effective concentration to elicit the desired antimicrobial effect.

[0053] The relative amounts or concentrations of the FFC compositions and other optional ingredient in the compositions of the invention can vary widely within the effective ranges, as shown in the examples below. The concentrations and / or dosages used are preferably selected so as to achieve enhanced or increased activity over the individual components of the prior art and / or to maximize the activity of the composition at the lowest effective concentration (s) of the component. Accordingly, the weight ratios and / or percentages that yield such enhanced activity depend not only on the particular FCC composition used, but on the specific end use of the composition, including, but not limited to, climate, soil composition, nature of the substrate, article, and / or host of the microorganism. to be treated and / or potential exposure to a specific microorganism.

[0054] The methods of preparing a formulation or composition include the step of bringing the composition of the invention or one or more component compounds into association with the carrier and, optionally, one or more accessory ingredients. Generally, the formulations are prepared by bringing the composition / ingredient into association with the carrier (e.g. a liquid or finely divided solid carrier) and, if desired, shaping the product.

The formulations related to the invention, whether the composition of this invention or any article of manufacture containing such a composition, may be in the form of capsules, wafers, pills, tablets, powders, granules, paste, or as a solution or suspension in aqueous solution. or as a non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion or as an elixir or syrup or as lozenges (using an inert vehicle, such as gelatin and glycerin or sucrose and acacia) and / or as cleansing agents (e.g. mists, sprays or oral agents) and the like, each containing a predetermined amount of the composition of the invention or its ingredients.

[0056] In other such solid formulations (e.g. capsules, tablets, pills, dragees, powders, granules and the like) the composition of the invention may be mixed with one or more other active ingredients and / or acceptable carriers such as sodium citrate or dicalcium phosphate and / or any of the following: (1 ) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol and / or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and / or acacia; (3) humectants such as glycerol; (4) disintegrants, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) dissolution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, the compositions may also contain buffering agents. Solid compositions of a similar type may also be used as fillers in soft or hard filled gelatin capsules using excipients such as lactose or lactic sugars, and high bulk polyethylene glycols. molecular weight and the like.

[0057] A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using a binder (e.g., gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (e.g., sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered active ingredient (s) moistened with an inert liquid diluent.

[0058] Tablets and other solid forms of such compositions or articles containing such compositions such as dragees, capsules, pills and granules may optionally be scored or made with coatings and shells such as enteric coatings and other coatings well known in the formulation art. They may also be formulated to provide slow or controlled release of the active ingredient (s) using, for example, hydroxypropyl methylcellulose in various proportions to provide the desired release profile, other polymer matrices, liposomes and / or microspheres. These compositions may also optionally contain opacifying agents and may be compositions which release only the active ingredient (s) or preferably, in some part of the gastrointestinal tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. The active ingredient (s) may also be in micro-encapsulated form.

[0059] Liquid forms for using or administering this invention include pharmaceutically or otherwise acceptable emulsions, mixtures, microemulsions, solutions (including those in distilled or purified water), suspensions, mists, syrups and elixirs. In addition to the composition of the invention or the component (s) of the compound thereof, the liquid form may contain inert or other diluents commonly used in the art such as, for example, water or other solvents, solubilizers and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate. , ethyl acetate, propylene glycol, 1,3-butylene glycol, oils (especially cotton seed oil, peanut oil, corn oil, germ oil, olive oil, castor and sesame), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and sorbitan fatty acid esters, and mixtures thereof.

[0060] In addition to inert diluents, such compositions and / or related articles may also contain adjuvants such as, but not limited to, wetting, emulsifying and suspending agents (e.g., adhesives and spreading agents for agricultural use), coloring, perfuming and one or more more preservatives. The suspensions may contain suspending agents such as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar and tragacanth and mixtures thereof.

[0061] Formulations of the compositions of the invention and / or articles or products containing such compositions of the invention for administration / delivery to a substrate or topically (e.g. in the context of a personal care or hygiene product), include powders, sprays, ointments, pastes, creams, liquids, gels, solutions, patches and inhalants. Such ointments, pastes, creams and gels may contain, in addition to the compositions according to the invention, auxiliary substances such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth and other gums, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid. , talc and zinc oxide or mixtures thereof. Likewise, powders and sprays can contain excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, and polyamide powder, or mixtures of these substances. Sprays may additionally contain customary propellants such as volatile unsubstituted hydrocarbons such as butane and propane, or may be delivered under positive air pressure.

Examples of suitable aqueous and non-aqueous vehicles that can be used in the compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils such as olive oil, olive and organic esters such as ethyl oleate. The proper fluidity can be maintained, for example, by coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, or by the use of surfactants.

[0063] Depot forms of articles or products containing the composition of the invention can be made by forming microencapsule matrices of the active ingredient (s) in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of the active ingredient (s) to the polymer and the type of polymer used, it is possible to control the release rate of the active ingredient (s). Examples of other biodegradable polymers include poly (orthoesters) and poly (anhydrides). Depot injectable formulations are also prepared by entrapping the active ingredient (s) in liposomes or microemulsions that are compatible with body tissue.

[0064] Furthermore, the compositions of the invention and / or articles or products containing such a composition may contain additional chemical and / or biological, multi-site or single-site antifungal, antibacterial and antimicrobial agents with similar and / or different modes of action as will be appreciated by those skilled in the art. . Such agents may include, but are not limited to, potassium bicarbonate, silica, copper or sulfur compounds, and / or vegetable oils (e.g., neem oil). Additionally, such agents may include, but are not limited to, azoles; polyenes such as amphotericin B and nystatin; purine or pyrimidine nucleotide inhibitors such as flucytosine; polyoxins such as niccomycins; other chitin inhibitors, elongation factor inhibitors such as sordarin and analogs thereof; mitochondrial respiration inhibitors, sterol biosynthesis inhibitors and / or any other fungicidal or biocidal compositions known to those skilled in the art suitable for the treatment or prevention of yeast or fungal, bacterial, viral and / or other microbial infections of plants, other substrates, animals and / or humans or which may be found on or in another article of manufacture.

[0065] In certain embodiments, articles or products containing compositions of the invention may also contain one or more preservative ingredients known in the art, including, but not limited to, sorbic or benzoic acid; sodium, potassium, calcium and ammonium salts of benzoic, sorbic, hydroxymethylglycine and propionic acid; and methyl, ethyl, propyl and butyl paraben and combinations thereof.

[0066] The compositions of the invention may contain a compound containing an acidic or basic functional group and are therefore capable of forming pharmaceutically or otherwise acceptable salts with pharmaceutically or otherwise acceptable acids and bases. The term "pharmaceutically acceptable salts" refers to the relatively non-toxic, inorganic and organic acid and base addition salts of such compounds. Regardless, such salts can be obtained by reacting such a compound with an appropriate acid or base. Suitable bases include hydroxide, carbonate, or bicarbonate with such an acceptable metal cation, ammonia, or such an acceptable organic primary, secondary, or tertiary amine. Representative alkali or alkaline earth metal salts include lithium, sodium, potassium, calcium, magnesium and aluminum salts and the like. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piper and the like. Representative acid addition salts include hydrobromide, hydrochloride, sulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, mesylate, mesilate, glucoheptanoate, lactobionate and lauryl sulfonate and the like.

[0067] The compositions of the invention can be used as aqueous dispersions or emulsions and are available as a concentrate containing a high proportion of the FFC composition (with or without surfactant) and may be diluted (e.g. with water or other liquid ingredient) prior to use. Emulsifiable concentrates or emulsions may be prepared by dissolving the compositions of the invention, together with any other desired active ingredient, in a solvent optionally containing a wetting or emulsifying agent, and then adding the mixture to water, which may also contain a wetting or emulsifying agent. Suitable organic solvents include alcohols and glycol ethers. These concentrates should preferably be capable of withstanding storage for an extended period of time, and after such storage may be diluted with water to produce aqueous formulations that remain homogeneous for a sufficient time to permit use with conventional spray equipment.

[0068] Depending on the nature of the end use, articles or products containing the compositions of the invention may also contain any other required ingredients, including, but not limited to, solid or liquid carriers for ease of use, surfactants including biosurfactants, protective colloids, adhesives, thickeners, thixotropic agents, penetrating agents, stabilizers, sequestrants, texturing agents, flavorings (e.g. for post-harvest use or for processed food / drink products), sugars, colorants etc. as will be well known to those skilled in the art.

[0069] For example, such compositions and / or related articles or products may be used for agricultural purposes and formulated with such a carrier or diluent. The compositions may be applied, formulated or unformulated, directly to the leaves of the plant, to seeds or other substrate in which the plants are growing or to be planted, or they may be sprayed, sprayed or applied as cream or paste formulations or may be applied as a vapor. or slow release granules. The application may be for any part of the plant, including leaves, stems, branches or roots, or the soil surrounding the roots, fruit or vegetables (before or after harvest) or seeds before planting, or soil in general, irrigation water or hydroponic growing systems. The compositions of the invention may also be injected into plants or sprayed onto vegetation (including fruits and vegetables) using low pressure or pressure or electrodynamic spraying techniques or any other treatment known in the art or industry.

[0070] In certain embodiments, whether or not they are agricultural or food processing products, the compositions and / or articles or products containing the compositions of the invention may be in the form of dustable powders or granules containing solids. diluent or carrier, for example fillers (also such as animal or cat litter), kaolin, bentonite, diatomaceous earth, dolomite, calcium carbonate, talc, powdered magnesium oxide, fuller's earth, gypsum, diatomaceous earth and china clay. Such granules may be pre-formed granules suitable for use without further processing. These granules can be prepared by impregnating the filler pellets with a composition according to the invention or another active ingredient, or by granulating a mixture of the active ingredient and a powdered filler. For example, seed treatment compositions can include an agent (e.g., mineral oil) to aid adhesion of the composition to the seed; alternatively, the active ingredient may be formulated for the purpose of treating seed with an organic solvent. The compositions may also be in the form of wettable powders or water-dispersible granules containing wetting or dispersing agents to facilitate dispersion in liquids. The powders and granules can also contain fillers and suspending agents. Alternatively, the compositions may be used in microencapsulated form. They can also be formulated in biodegradable polymer formulations to achieve a slow, controlled release of the active ingredient.

[0071] Regardless, such solid formulations containing such a composition of the invention may be provided in a variety of products or articles in a variety of forms, shapes, or forms including, but not limited to, cylinders, sticks, blocks, capsules, tablets, pills, lozenges (e.g., pet food), strips, spikes and the like.

Alternatively, the granular or powdered material may be compressed into tablets or used to fill a series of capsules or shells. As discussed above, any such composition of this invention, whether formulated or not, may be used alone, applied to a substrate, or incorporated into a product or article for a wide variety of end uses, including, but not limited to, pharmaceutical compositions. , personal, industrial and agricultural and related uses.

Examples of the invention.

[0072] The following non-limiting examples and data illustrate various aspects and features of the compositions and / or methods of the invention, including the preparation and use of antimicrobial compositions containing various component compounds as described. Compared with the prior art, the present compositions and methods provide results and data that are surprising, unexpected and contradictory. While the utility of this invention is illustrated by the use of several compositions and component compounds that can be used, those skilled in the art will understand that comparable results can be obtained with various other compositions and ingredients that are commensurate with the scope of this invention.

Example 1a

[0073] Isolation of fungi. Several small pineapple ananassoides stems were harvested from a plant growing in the Bolivian Amazon in March 2007. They were collected in an area of ​​the savannah adjacent to the tropical forest at the coordinates 1 2 ° 40'07 "S and 68 ° 41'58" W and immediately transported for analysis. Several small (2-5 inch) pieces of stem were cut and placed in 70% ethanol for 30 seconds in a laminar flow hood. A pair of sterile tweezers was used to hold the shoots apart in a flame to remove excess alcohol. Then, small pieces of inner tissue (below the bark) were cut and placed on dextrose potato agar (PDA) with an actively growing M. albus 620 isolate on one side of the plate, the center of which was well removed. Effectively, this technique can be used to select other Muscodor isolates (Worapong et al., 2001a and b). During the two-week incubation period, the petri dishes were periodically examined for any fungal growth. Upon observation of the hyphae, the hyphae tips were excised aseptically from the agar and placed on fresh PDA. Thus, an isolate was found. Several Petri dishes (PDAs) were used to determine if the fungus was producing volatile antibiotics. This procedure involved removing a 1 inch slice of agar from the center of the plate, seeding the stopper of the isolate on one side and leaving it for a few days, then seeding the test organisms on the other side of the slit.

Example 1b:

[0074] Taxonomy of fungi. The fungus in nature is related to A. ananassoides and is an imperfect fungus belonging to the mycelia sterilia. Mushroom colonies whitish on all tested media when not exposed to direct sunlight. Mushroom colonies turn pink on all tested media when exposed to direct sunlight. Spores or other fruiting bodies were not observed under any conditions. Hyphae (0.6-2.7 µm) commonly growing by branching, sometimes forming perfect coils (about 40 µm) and having cauliflower bodies (3.5-14 µm) associated with them. Hyphae, newly formed, grow in a wavy manner, observed under all conditions with all tested media. The mycelium on PDA covers the pan in 3-4 weeks and produces a fruity odor. [0075] Holotype: Endophyte on A. ananassoides. Harvested in the Bolivian Amazon in the area of ​​the Heath River. The holotype comes from only one A. annisoides, collected in the land of the River Heath. The live stock is deposited as Muscodor crispans in the Living Mycological Collection of the University of Montana under harvest number 2347 (2/29/2008). The 18S and ITS M. crispans (B-23) rDNA sequences were submitted to GenBank with an assigned serial number - EU195297.

[0076] Telomorph: The telomorph of this fungus can be found in Xylariaceae, based on the similarity of 18S rDNA gene sequence data between M. crispans and the Xylariaceae family in the GenBank database (Bruns et al., 1991, Reynolds and Taylor 1993; Mitchell et al. 1995, Guarro et al., 1999, Taylor et al., 1999). The molecular data from the sequence of the M. crispans 18S rDNA gene show 100% homology with the M. albus 620 isolate.

[0077] Etymology: The genus name Muscodor comes from a Latin word that means musty. This is consistent with the odor characteristic produced by the first three isolates of the genus. The species name is crispans, from the Latin meaning "curly, wavy". Hyphae grow in regular undulating patterns.

Example 2a

[0078] Scanning electron microscopy. Scanning electron microscopy was performed on the isolate of Example 1 following the procedures described by Castillo et al. (2005). Agar pieces and pieces of host plants to promote fungal growth were placed in filter paper packets and then placed in 2% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.2-7.4) with Triton X 100 wetting agent , evaporated for 5 minutes and left overnight. The next day, the pieces were washed with six x 15-minute changes in 1: 1 aqueous buffer, followed by a 15-minute change to 10% ethanol, a 15-minute change to 30% ethanol, a 15-minute change to 50% ethanol, five x 15-minute changes to 70% ethanol and then left overnight or longer in 70% ethanol. It was then rinsed six times for 15 minutes at 95%, followed by three 15-minute changes to 100% ethanol followed by three 15-minute changes to acetone. The microbial material was critical point dried, gold plated in a magnetic field, and images were recorded with an XL30 ESEM FEG in high vacuum mode using an Everhart-Thornley detector. The hyphae were measured with the Image J software available on-line.

Example 2b

[0079] Biology of fungi. The fungus produced white mycelium on a water-based medium. No fruiting structures or spores were found under any laboratory conditions. Hyphae tend to intertwine to form coils. Other Muscodor species also show this trend (Worapong et al., 2001a). Newly developing hyphae tend to grow in a wavy pattern rather than the usual straight pattern and usually intertwine to form linear structures. This growth pattern may prove useful as a diagnostic tool for identifying this organism in in vivo inoculation studies. The fungus also produces cauliflower-like structures that appear to be connected to the hyphae by tiny spirals. These bodies do not germinate under any conditions and do not appear to be spores. This observation appears to be unique to Muscodor spp. And has not been found in any other fungal species - at all.

Example 3a

[0080] Growth and storage of fungi. The isolate was found not to produce spores or any other fruiting bodies when several pieces of clove leaf were placed on top of an actively growing isolate to encourage spore production and such structures were not observed after one week of incubation at 23 ° C. The mushroom was also plated on several different media, including Cellulose Agar CA, Malt Agar (MA), and Corn Meal Agar (CMA) to determine if spore production would be demonstrated. Except for the slower growth rate of some media, other fungal characteristics were not different and no fruiting bodies or spores were observed.

[0081] Several methods were used to store the isolated fungus as pure culture, one of which was the filter paper technique. The fungus could also grow on PDA and then cut into small squares which were placed in vials containing 15% glycerol and stored at -70 ° C. The mushroom was also stored at 4 ° C in a similar manner, using distilled water instead of glycerol. However, the most effective method of storage was on contaminated sterile barley at -70 ° C.

Example 3b:

[0082] Other, more classic features of the isolated M. crispans were also tested and compared to M. albus. Muscodor crispans produced a slowly growing, dense, white mycelium on all media tested, unless placed in direct sunlight, which made the mycelium a light pink color. This contrasts with M. albus which produces a whitish mycelium in all comparable media and conditions tested (Worapong et al., 2001a). The young hyphae also developed in a wavy rather than the characteristic straight rope way as commonly observed in M. albus (Strobel et al., 2001). Spores, including those containing host plant material or clove leaves, did not develop on any of the substrates. The hyphae varied in diameter (0.8-3.6 µm) and were often intertwined to form more complex structures and even hyphae spirals (Figs. 1-3). These hyphae were generally larger than those of M. albus (Worapong et al., 2001a).

Example 4

[0083] Qualitative analysis of volatile substances. The method used for airspace gas analysis over a 10-day-old culture of mycelium growing in Petri dishes was comparable to that used for the original isolate of the M. albus cz-620 strain (Strobel et al., 2001). First, a capped syringe "Solid Phase Micro Extraction" (Supelco) of 50/30 divinylbenzene / carburen on polydimethylsiloxane on a stable elastic filament was placed through a small hole drilled into the side of a Petri dish showing fungal growth. The fiber was exposed to the mushroom vapor phase for 45 minutes. The syringe was then placed in the injection port without a run of a Hewlett Packard 6890 gas chromatograph containing 30 m × 0.25 mm LD. Wax capillary column ZB, 0.50 mm thick. The column was temperature programmed as follows: 30 ° C for 2 min and then up to 220 ° C at 5 ° C / min. The carrier gas was ultra high purity helium (local distributor) and the initial pressure in the column head was 50 kPa. Before trapping volatiles, the fiber was conditioned at 240 ° C for 20 minutes under a stream of helium gas. A 30 second injection time was used to introduce the fiber sample into the GC. The gas chromatograph was connected to a Hewlett Packard 5973 mass detector (mass spectrometer) operating with unit resolution. Data acquisition and data processing were performed on the Hewlett Packard ChemStation software system. Initial identification of compounds in the volatile mixture produced by the fungus was made by comparing libraries using the NIST database.

Example 5a

[0084] Fungal DNA isolation and retrieval of ITS-5,8S rDNA sequence information.

A 10-day culture of the present fungus, growing on PDA, was used as the DNA source after incubation at 25 ° C with Rapid Homogenization: Plant leaf DNA Amplification Kit (Cartagen; Washington, USA). Some of the techniques used were comparable to those used for the genetic characterization of other M. albus isolates from Australia (Ezra et al., 2004). Squares of cultivated mycelium (0.5 cm²) was cut from one-week-old cultures. The agar was scraped off the bottom of the pieces to exclude as much agar as possible. The pieces were placed in 1.5 ml Eppendorf tubes and incubated for approximately 10 minutes at -80 ° C. The DNA was then extracted according to the kit manufacturer's instructions. The extracted DNA was diluted (1: 9) in double-distilled sterile water and 1 ml of the sample was used for PCR amplification. The ITS1, 5.8S ITS2 rDNA sequence was amplified by the polymerase chain reaction using the ITS 1 (TCCGTAGGTGAACCTGCGGG) and ITS4 (TCCTCCGCTTATTGATATATGC) primers. The PCR procedure was performed in 14 μl of the reaction mixture containing 1 μl of DNA extracted from fungal culture (1: 9 dilution), 0.5 ml of ITS1 primer and 0.5 μl of ITS4 primer, 7 μl of RedMixTM plus PCR mix with 1.5 mM MgCl2 ( GeneChoice, Inc., Maryland, USA) and 5 µl PCR grade ddH2O (Fisher Scientific, Wembley, Western Australia, Australia). PCR amplification was performed on a personal Biometra cycler (Goettingen, Germany): 96 ° C for 5 minutes followed by 35 cycles at 95 ° C for 45 seconds, 50 ° C for 45 seconds and 72 ° C for 45 seconds, followed by a cycle 72 ° C for 5 minutes. The PCR products were tested by gel electrophoresis on a 1.3% agarose gel for 30 minutes at 100V using TAE buffer (GelXLUltra V-2 Labnet International, Inc., (Woodbridge, NJ, USA) or the Wealtec GES cell system from ( Wealtec Inc., Georgia, USA). The gels were soaked in 0.5 µg ml-1 ethidium bromide for 5 minutes and then washed in distilled water for 5 minutes. Gel imaging was performed under UV light in a Bio-Imaging System (model 202D, DNR-Imaging Systems, Kiryat Anavim, Israel). The -500 bp PCR product was purified using the UltraClean PCR Clean Up DNA Purification Kit (MO BIO

Laboratories, Inc., California, USA). Purified products were sent for direct PCR sequencing. Sequencing was performed on both strands of the PCR product using the ITS1 and ITS4 primers. Sequencing was performed using DYEnamic ET terminators in the MegaBACETM1000 analysis system (Danyel Biotech Ltd., Rehovot, Israel). The sequences were submitted to GenBank on the NCBI website. The sequences obtained in this study were compared to the GenBank database using the BLAST software on the NCBI website.

Example 5b:

[0085] Molecular biology of Muscodor crispans. The 18S rDNA partial sequences, ITS1, 5,8S and ITS2 have been shown to be highly conserved regions of DNA and therefore very useful in the classification of organisms (Mitchell et al., 1995). These molecularly distinctive M. crispans partial sequences were obtained and compared with data at GenBank. After screening the 18S rDNA sequence, 525 bp of M. crispans was subjected to an advanced BLAST search. The results showed 100% identity to 525 bp M. albus (AF324337). Comparative analysis of partial rDNA sequences ITS 1 and 2 and 5.8S M. crispans hit ITS 1 and 2 M. albus (AF324336), M. roseus (AY034664), X. enteroleuca CBS 651.89 (AF163033), X. arbuscula CBS 452.63 (AF163029) and Hypoxylon fragiform (HFR246218) with 95, 95, 90, 90 and 91% homology, respectively.

Example 5c

[0086] While this invention is partially described in connection with isolated novel fungi, it will be understood that variants and mutants of such fungi - as will be understood in the art - are also contemplated in the context of the invention. The terms "variant" and "mutant" may be defined as described in US Patent No. 6,911,338. Accordingly, the invention may be directed to dissimilar or mutant strains of M. crispans and corresponding compositions thereof.

Example 6a

[0087] Bioassays for M. crispans against plant pathogens. M. crispans volatile by-product vapor was tested for microbial inhibitory activity using a relatively simple test as previously described in the literature (Strobel, et al., 2001). The agar strip (2 cm wide) in a standard PDA Petri dish was removed and M. crispans was inoculated and allowed to grow on one side of the plate for about a week. The test fungus or bacterium was then inoculated on the other side of the Petri dish using small fungus agar plugs. Bacteria and yeasts were plated on agar (1.5 cm long). The dish was then wrapped with one piece of Parafilm and incubated at 23 ° C for 48 hours. The effect of M. crispans on the growth of the test organisms was observed and determined first by checking for the presence or absence of growth at the vaccination site. If growth was observed, diameter measurements were made at the two hyphae sites. The bioactivity of the vapors on bacteria and yeast was assessed by estimating the extent to which their growth was influenced as a percentage of that in a control pan (Strobel et al., 2001). If no growth was observed, the test organism was aseptically removed from the test plate and inoculated onto a fresh PDA plate at some time point after steam exposure to determine the viability of the test organism.

[0088] Using the above methodology, when M. crispans was grown for 7-10 days at 23 ° C on PDA, the volatile by-product of the fungus was shown to be lethal to several fungi and bacteria. Gram-negative and Gram-positive bacteria as well as yeasts and each of the major classes of fungi were used as test organisms. Most of the test organisms were 100% inhibited and died after two days of exposure to the M. crispans by-product. (See Table 8) Some of the test organisms did not succumb to the volatile components of M. crispans after the two-day exposure, but their growth was significantly inhibited by the volatile by-product and died after the four-day exposure. Such organisms include, but are not limited to, Penicillium roquefortii, Bipolaris sorokiniana, Stagonospora sp., And Fusarium oxysporum.

Table 8. Effect of M. crispans volatile by-product on many fungal plant pathogens and some selected bacteria. Inhibition values ​​were calculated as% growth inhibition compared to the untreated control test organism. Tests were repeated at least 3 times with comparable results. Inhibition of the test organisms was recorded 48 hours after exposure to the fungus and fungal volatile by-product vapors.

<td>Test organism</td><td colspan="2">Inhibition (%) after 48 Live</td><td>after</td><td>48 alive after</td><td> 96</td>

<td></td><td colspan="4">Hours of exposure Hours of exposure Hours of exposure</td><td></td>

<td>Alternaria helianthi</td><td> 100</td><td>N</td><td></td><td>exposure N</td><td></td>

<td>Aspergillus fumigatus</td><td> 100</td><td>Y</td><td></td><td>N</td><td></td>

<td>Bacillus subtilis *</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>Bipolaris sorokiniana</td><td> 100</td><td>Y</td><td></td><td>N</td><td></td>

<td>Botrytis cinerea</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>Candida albicans *</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>Cephalosporium</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>gramineum Ceratocystis ulmi</td><td> 100</td><td>Y</td><td></td><td>N</td><td></td>

<td>Cochiolobolus</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>carbonum Colletotrichum</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>lagenarium Curvularia lunata</td><td> 100</td><td>Y</td><td></td><td>N</td><td></td>

<td>Drechslera teres</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>Drechslera tritici-</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>repentis Dreschlera portulacae</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>Escherichia coli *</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>Fusarium avenaceum</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>Fusarium culmorum</td><td> 100</td><td>N</td><td></td><td>N</td><td></td>

<td>Fusarium oxysporum</td><td> 100</td><td>Y</td><td></td><td>N</td><td></td>

<td>Fusarium solani</td><td> 50</td><td>Y</td><td></td><td>Y</td><td></td>

<td>Ganoderma sp.</td><td> 100</td><td>Y</td><td>N</td>

<td>Geotrichum candidum</td><td> 100</td><td>Y</td><td>N</td>

<td>Mycosphaerella</td><td> 100</td><td>N</td><td>N</td>

<td>fijiensis</td><td></td><td></td><td></td>

<td>Penicillium roquefortii</td><td> 100</td><td>Y</td><td>N</td>

<td>Phytophthora</td><td> 100</td><td>N</td><td>N</td>

<td>cinnamomi</td><td></td><td></td><td></td>

<td>Phytophthora</td><td> 100</td><td>N</td><td>N</td>

<td>palmivora</td><td></td><td></td><td></td>

<td>Pythium ultimum</td><td> 100</td><td>N</td><td>N</td>

<td>Rhizoctonia solani</td><td> 100</td><td>N</td><td>N</td>

<td>Saccharomyces</td><td></td><td></td><td></td>

<td>cerevisiae *</td><td> 90 -95</td><td>N</td><td>N</td>

<td>Sclerotinia</td><td> 100</td><td>N</td><td>N</td>

<td>sclerotiorum</td><td></td><td></td><td></td>

<td>Stagonospora sp.</td><td> 100</td><td>Y</td><td>N</td>

<td>Tapesia yallundae</td><td> 100</td><td>N</td><td>N</td>

<td>Trichoderma viridae</td><td> 10</td><td>Y</td><td>Y</td>

<td>Verticillium dahliae</td><td> 100</td><td>Y</td><td>N</td>

<td>Xanthomonas</td><td></td><td></td><td></td>

<td>axonipodis</td><td></td><td></td><td></td>

<td>pv citri *</td><td> 100</td><td>N</td><td>N</td>

* Indicates that these organisms were plated on a test dish and that growth was indicated when the colony eventually developed. After appropriate exposure to the volatile by-product of M. crispans, the streaked area was compared to the growth in a control plate and assessed for% inhibition. Eventually, each organism was re-plated with a PDA to check its viability.

Example 6b

[0089] Referring to Table 8, the effect of the vapor of the volatile by-product of M. crispans on Botrytis is quite noticeable - especially against B. cinerea, the cause of gray mold in various plants. The inhibitory and killing effects also apply to Botrytis allii, which causes gray mold - onion neck rot. Without limitation, such results suggest that the invention can be effectively used to modify the surface of a product or the atmosphere of post-harvest storage to prevent mold and related problems. Likewise, such results support the use of the FFC compositions of the invention in the treatment of onions (for example, Vidalia onions), shallots and garlic to prevent or control fungal growth.

Example 6c

The volatile substances of M. crispans are also effective against many fungi that cause decomposition and growth of fungi on the grain (e.g. corn, wheat, barley, rice, etc.) and the invention may be used in combination with a variety of fruits and vegetables. such as potatoes, beets, carrots, sweet potatoes - in the case of such cereals, fruits or vegetables, before or after harvest, during storage or shipment. Accordingly, the compositions and methods of this invention can be applied to some of the major fungal problems in agriculture and food processing and can be used to control organisms such as, but not limited to, Alternaria, Cladosporium, Aspergillus, Penicillium, Diplodia, Fusarium, and Gibberella. . (see eg Table 8): Example 6d

[0091] The steam from the M. crispans by-product was effective against the fungus Mycosphaerella fjiensis. (see Table 8): Accordingly, the invention can be used as a treatment for the fungus-related Black Sigatoka disease of bananas and paradise figs.

Example 6e

[0092] Citrus gangrene threatens the US citrus industry. As shown in

In Table 8, vapors from the M. crispans by-product are effective in killing the gangrene causing pathogen Xanthomonas axonipodis pv citri. These results suggest that the FFC compositions and related methods of the invention can be effectively used to treat seeds, seedlings, orchards, equipment or apparatus (including e.g. work equipment and clothing) and / or harvested fruit to prevent, inhibit or control cancer. ..

Example 7

[0093] As a continuation of the tests and results of Example 6, vapor bioassays of the volatile M. crispans by-product were performed against a variety of other pathogenic fungi and bacteria. (see Table 9 below). The fungus was grown on X-plates with one-quadrant PDA and incubated for 3-5 days at room temperature before inoculating with one or more test organisms. Control plates were prepared at the same time of inoculation and grown in the same medium that was optimal for a single test organism. The test organisms, Staphylococcus aureus 6538, Salmonella cholerasuis 10708, Escherichia coli 11229, S. aureus ATCC 43300 (MRSA) and Vibrio cholerae ATCC 14035, were grown on Trypticase Soy Agar (TSA) in the three remaining quadrants of the X-dish. Three dishes of each organism, with appropriate controls, were exposed to vapor of the fungus by-product for approximately two, four, and six days at room temperature. To check the viability of the test organism, the fungus was physically removed and the control and test plates were placed in an incubator at 35 ± 1 ° C for at least three to four days, except for Mycobacterium spp. Which were incubated for approximately one additional month. This was done to determine if the by-product vapor inhibited or killed the test organism, and the viability of the organism was assessed. The same protocol was used for Yersinia pestis and Bacillus anthracis, except that the exposure times were changed to 3 and 5 days and Y. pestis was incubated at 28 ± 1 ° C and 5% CO2 after fungus exposure. Mycobacterium marinum ATCC 927 was grown on 7H11 agar (Difco Co) in the remaining three quadrants using the previously described protocol and incubated at 33 ± 1 ° C. All three replicates performed identically with each organism.

[0094] For all Mycobacterium tuberculosis strains, also grown on

7H11, a fragment of the agar plate was cut from the plate and fungus B-23 (on PDA) was inserted. The plates were then inoculated from the broth culture. Control plates lacking fungus were also inoculated. At each designated time interval, the agar fragment was removed from the dishes and transferred to a separate empty plate and placed in an incubator at 35 ± 1 ° C to determine the viability of the microorganism. The plates 5 were placed in a plastic bag with moistened paper towels to prevent drying out.

[0095] Pseudomonas aeruginosa 15442 and Burkholderia thailandensis 70038 were grown on TSA agar. They were left at room temperature for the organism's optimal growth time, and then transferred to an incubator at 35 ± 1 ° C and observed. It should be noted that all tests using human pathogens were performed under stringent and federally approved biosafety conditions. All human pathogen tests were repeated at least twice.

Table 9. Effect of the volatile by-product of M. crispans on different species of Gram + and Gram - bacteria. The exposure times varied with the specific organism of interest and the viability of the test organism after this period was determined (listed as growth or no growth).

<td>Organism</td><td>Cell wall type</td><td>Time exposure</td><td>Increase / none Growth comments (r the presence of M. crispans)</td>

<td colspan="2">S. aureus 6538 Gram + S. cholerasuis Gram - 10708 P. aeruginosa Gram -</td><td>2, 4 and 6 days 2, 4 and 6 days 2 days</td><td>No growth No growth Growth No noticeable difference</td>

<td colspan="2">15442 M. marinum ATCC Sour -</td><td>2, 4 and 6 days</td><td>between the tiles exposure and control. No growth</td>

<td>Organism Wall type</td><td>Time</td><td colspan="2">Increase / no Comments</td>

<td>cellular 927 fast</td><td>exposure</td><td>growth presence crispans)</td><td>(in M.</td>

<td>B. thailandensis gram - 70038</td><td>2 days</td><td>Increase</td><td>There is no visible difference between the tiles exposure and control.</td>

<td>S. aureus Gram + ATCC43300 (MRSA)</td><td>2, 4 and 6 days</td><td>Increase</td><td>They did not develop actual colonies only a small cinematic increase.</td>

<td>E. coli 11229 Gram -</td><td>2, 4 and 6 days</td><td>Increase</td><td>There is no visible difference between the tiles exposure and control.</td>

<td>V cholerae ATCCGram - 14035</td><td>2, 4 and 6 days</td><td>Increase</td><td>The increase on days 4 and 6 of the exposure appeared to be only slightly inhibited compared to the control plates.</td>

<td>Y. pestis 91-3365 Gram -</td><td>3 and 5 days</td><td colspan="2">No growth</td>

<td>B. anthracis A2084 Gram +</td><td>3 and 5 days</td><td>Increase</td><td>Only a few colonies remained after exposure and after more incubation increased.</td>

M.

tuberculosis Acid 2, 4, 7 and 14 No growth

<td>Organism Wall type cellular</td><td>Time exposure</td><td>Increase / no Comments growth (v</td>

<td>3081 (resistant fast isoniazid)</td><td>days</td><td>the presence of M. crispans)</td>

<td>M. tuberculosis Sour - 50001106 (resistantfast to streptomycin)</td><td>2, 4, 7 and 14 days</td><td>No growth</td>

<td>M. tuberculosis Sour - 59501228 (resistantfast on streptomycin / ethambutol)</td><td>2, 4, 7 and 14 days</td><td>No growth</td>

<td>M. tuberculosis Sour - 59501867 fast</td><td>2, 4, 7 and 14 days</td><td>No growth</td>

(susceptible)

[0096] As shown in Table 9, all four acid resistant bacteria (Mycobacterium tuberculosis strains) were killed after 2, 4, 7 and 14 days of exposure to actively growing M. crispans (6-10 day culture). Other bacteria killed after a minimum 2 day exposure to M. crispans include: Staphylococcus aureus 6538, Mycobacterium marinum,

Yersinia pestis and Salmonella choleraesuis. Relatively somewhat or completely insensitive to exposure to M. crispans were: Pseudomonas aeruginosa, Burkholderia thailandensis, Staphylococcus aureus (MRSA), Escherichia coli, Vibrio cholera, and Bacillus anthracis. However, the growth of S. aureus (MRSA) was only a slimy film and not distinct colonies and was therefore influenced by the VOC of M. crispans. Moreover, on the display pan B. anthracis only a few colonies remained, but more colonies grew after the removal of M. crispans and further incubation. Therefore, it is suspected that M. crispans by-product pairs are effective only against B. anthracis vegetative cells, but not against spores. One month after the last observation time (14 days), no growth was observed in any of the fungus-exposed plates and growth was observed in all of the control plates.

[0097] The experiments in the following examples illustrate different variants of the compositions according to the invention and their suitability. One representative composition, with no component amount, concentration, or ratio limitation, is provided in Table 10. In some embodiments, the amount of isobutyric acid may be replaced with propionic acid at the same or approximately the same level. In certain such or other embodiments, ethanol may be replaced with acetic acid and / or 2-butanone may be replaced with acetic or propionic acid. In addition, various esters may be replaced with isomers or homologues (e.g., without limitation, 3-methylbutyl ester of propanoic acid, its 2-methylbutyl ester) of said esters. The results observed in the examples below were obtained with the compositions of the compounds listed in Table 10. Accordingly, various other compositions having a comparable effect can be used.

Table 10. Food composition and flavorings useful in controlling harmful microorganisms.

Compound * in the FFC series

Acetaldehyde

Ethyl acetate

2-Butanone

Propionic acid, 2-methyl-, methyl ester

Ethanol

Acetic acid, 2-methylpropyl ester

Propionic acid, 2-methyl-, 2-methylpropyl ester

1-propanol, 2-methyl, 1-Butanol, 3-methyl-, acetate

Propionic acid, 2-methyl-, 2-methylbutyl ester

1-Butanol, 3-methyl Propionic acid, 2-methyl Acetic acid, 2-phenylethyl ester * Each of these compounds is liquid at room temperature and can be used with each other to provide a liquid composition that volatilizes easily at room temperature or at temperatures and pressures that would otherwise allow for volatilization.

FFC composition used for the control of plant diseases.

Example 8a

[0098] The relative ability of the FFC to inhibit and kill the test organisms was measured. Test solutions were prepared by placing compounds in vials in the relative proportions given in Table 10. The test mixture (20 microliters) was placed in a pre-sterilized microtube (4x6 mm) placed in the center of a Petri dish containing PDA. When not in use, the mixture was stored at 0 ° C. Test organisms (as mentioned in Table 9), fresh growing and cut on 3 mm agar blocks³ (at least 3 blocks of agar per test fungus, placed 2-3 cm from the microtube, and the plates were wrapped with two layers of parafilm. Mycelium growth was measured from the edge of the agar blocks after a certain time. visible growth and viability by re-seeding from the original area of ​​the agar plate that has been inoculated. Appropriate controls were also prepared in which the test solution was not added to the microtube. Tests on 20 μl of the FFC mixture were performed at least twice with comparable results. Example 8b

[0099] Viability of test microorganisms was obtained by aseptically removing a small agar block and placing it on a PDA plate and observing it for growth after 1-3 days or replating Geotrichum candidum in a fresh PDA plate. In this way, the viability of the microorganisms can be assessed. The results presented in Table 11a indicate that all organisms listed below are inhibited by a particular FFC composition and in most cases are killed by exposure to them. The above include Aspergillus niger, Penicillium sp. On cheese, Cercospora beticola, Verticillum dahaliae, Pythium ultimum, Phytophthora palmivora, Mycophaeraella fjiensis, T Rhizoctonia solani, Aspergillus fumigatus, Geotrichum candidum Trichodermia alli, and Ganvoderma viridia all. Accordingly, when properly applied, the FFC composition has the ability to control these pathogenic microorganisms. Such results indicate that many other pathogenic microorganisms can be inhibited or killed by this mixture.

Table 11a. Brief list of various plant pathogens and their sensitivity to a representative FFC composition of the invention when exposed to 20 microliters of the mixture for 2 days at 23 ° C on Dextrose Potato Agar (PDA) in a Petri dish sealed with parafilm. The agar plugs with the test microbe were finally tested for viability after removal and placing in a standard PDA petri dish.

<td>Test organism</td><td>Impact on growth</td><td>Alive or dead after 48 hours</td>

<td>Aspergillus niger</td><td>No growth</td><td>Dead</td>

<td>Penicillium sp. On cheese</td><td>95% inhibition</td><td>Alive</td>

<td>Cercospora beticola</td><td>No growth</td><td>Dead</td>

<td>Verticillum dahaliae</td><td>No growth</td><td>Dead</td>

<td>Pythium ultimum</td><td>No growth</td><td>Dead</td>

<td>Phytophthora palmivora</td><td>No growth</td><td>Dead</td>

<td>Mycophaeraella fjiensis</td><td>No growth</td><td>Dead</td>

<td>Rhizoctonia solani</td><td>No growth</td><td>Dead</td>

<td>Aspergillus fumigatus</td><td>No growth</td><td>Dead</td>

<td>Geotrichum candidum</td><td>No inhibition</td><td>Alive</td>

<td>Trichoderma viridi</td><td>60% inhibition</td><td>Alive</td>

<td>Ganoderma sp</td><td>No growth</td><td>Dead</td>

<td>Curvularia sp</td><td>No growth</td><td>Alive</td>

<td>Botrytis alli</td><td>No growth</td><td>Dead</td>

Example 8c

[0100] Referring to the data in Table 11a, the activity profile of the compositions used

The FFC shows, in a few instances, a different and / or enhanced antimicrobial effect compared to M. crispans and the vaporized by-products.

Example 8d

[0101] Referring to the previous example and using comparable techniques and procedures, the same pathogens were treated with propionic acid vapor. Comparative results are shown in Table 11b below, with the data in Table 11a reproduced in columns A and B, and the observed effects of propanoic acid alone, provided in column C (% inhibition). At 20 mL, the amount of propionic acid is comparable to the level of propionic acid in certain example embodiments of this invention. Propionic acid is representative of various compounds known individually in the prior art that are known to exhibit some antimicrobial activity. However, as demonstrated by the comparative data in Table 11b, the compositions provide novel and synergistic results beyond what can be expected independently of the prior art component alone, outside the context of this invention. As shown, although the prior art is only inhibitory at best, the compositions of the invention eliminate (ie, kill) many of the pathogens tested. Similar results can be obtained compared to other such compounds / compositions according to the prior art.

Table 11b. Comparative results showing increased antimicrobial activity compared to propionic acid.

<td>Test organism</td><td>Influence on height (A)</td><td></td><td>Alive or dead after 48 h (B)</td><td>Propionic acid alone at 20 μΐ after 24 h (C)</td>

<td>Aspergillus niger</td><td>No growth</td><td></td><td>Dead</td><td>0% alive</td>

<td>Penicillium sp. On cheese</td><td>95% inhibition</td><td></td><td>Alive</td><td></td>

<td>Cercospora beticola</td><td>No growth</td><td></td><td>Dead</td><td>75% alive</td>

<td>Verticillum dahaliae</td><td>No growth</td><td></td><td>Dead</td><td></td>

<td>Pythium ultimum</td><td>No growth</td><td></td><td>Dead</td><td>80% Alive</td>

<td>Phytophthora palmivora</td><td>No growth</td><td></td><td>Dead</td><td>100% N / A *</td>

<td>Mycophaeraella fijiensis</td><td>No growth</td><td></td><td>Dead</td><td></td>

<td>Rhizoctonia solani</td><td>No growth</td><td></td><td>Dead</td><td>80% Alive</td>

<td>Aspergillus fumigatus</td><td>No growth</td><td></td><td>Dead</td><td>0% alive</td>

<td>Geotrichum</td><td>No inhibition</td><td></td><td>Alive</td><td>0% alive</td>

<td>candidum</td><td></td><td></td><td></td><td></td>

<td>Trichoderma viridi</td><td>60% inhibition</td><td></td><td>Alive</td><td></td>

<td>Ganoderma sp</td><td>No growth</td><td></td><td>Dead</td><td></td>

<td>Curvularia sp</td><td>No growth</td><td></td><td>Alive</td><td></td>

<td>Botrytis alil</td><td>No growth</td><td></td><td>Dead</td><td>0% alive</td>

<td colspan="5">* 100% inhibition but lifetime indefinite (ND).</td>

Use of FFC compositions for the treatment of tuberculosis and other human pathogens Example 9a

[0102] Isolates of four drug-resistant clinical strains of M. tuberculosis (5901867, 50001106, 59501228 and 3081) were exposed to the FFC composition. For each isolate, 10 µl of the culture was placed in the center of the 7H11 agar dish, and then spread evenly over the entire surface of the dish with a sterile plastic sponge. Lids from 0.65 ml microcentrifuge tubes (microcentrifuge) were cut and autoclaved at 121 ° C for 15 minutes in an autoclaving tube with a screw cap. Sterile forceps were used to remove the microflora and placed in the center of the inoculated dish. The control pans (one for each isolate) did not receive a microfiber. Three plates were prepared for each isolate and 5, 10, or 20 µl of FFC were placed in each of the three microvessels of the appropriate dishes. The plates were then placed in a sealed plastic bag with a damp paper towel and incubated at 36 ° C 1 ° C for approximately 28 days. After approximately 48 hours of exposure, the microfiber was removed and discarded and the dishes were returned to the incubator. Paper towels were checked frequently and re-moistened to prevent dehydration of the substrate. All control plates showed growth. All plates exposed to 5 and 10 μl of volatile substances showed growth. Only one isolate (50001106) exposed to 20 μl of volatile substances showed an increase. Note that each isolate of M. tuberculosis is a clinically resistant strain of this organism. All experiments were conducted under US Government Approved Biosafety Laboratory Conditions. [0103] Control pans and pans exposed to 5 and 10 µM of volatiles were plated on 4/14/08. The dishes exposed to 20 μΐ of volatile substances were plated on 4/22/08. All dishes were checked multiple times. A final check was performed on 5/19/08 and non-surviving organisms are listed as "-" in Table 12.

Table 12. Inhibitory effects of FFCs on the development of drug-resistant M. tuberculosis

<td>M. tuberculosis isolate</td><td>5 μΐ</td><td>10 μΐ</td><td>20 μΐ</td>

<td> 5901867</td><td> +</td><td> +</td><td> —</td>

<td> 50001106</td><td> +</td><td> +</td><td> +</td>

<td> 59501228</td><td> +</td><td> +</td><td> —</td>

<td> 3081</td><td> +</td><td> +</td><td> —</td>

[0104] The actual effects of the FFC compositions of the invention on another TB strain are shown in Figure 1: FFC killing effect on M. tuberculosis strain (110107). The dish on the left is a control dish that has not been treated with 20 microliters of FFC for 48 hours, while the dish on the right has been treated for 48 hours, both dishes were then incubated for 28 days at 36 ° C. It is clear from these experiments that the FFCs were able to kill 3/4 of the drug resistant isolates of M. tuberculosis. There is now the prospect of animal and ultimately human research using such FFC compositions in the treatment of tuberculosis.

Example 9b

[0105] According to the data of the previous example, broader aspects of the invention can be shown. Live cultures and appropriate media are prepared using materials and techniques well known to those skilled in the art.

For example, exposure to the FFC composition of this invention (e.g., by direct contact of the liquid composition or its vapors) may result in inhibition of growth or death of the following coliform bacteria (Gram staining and morphology): Escherichia coli (Gram-negative rod), Salmonella enteritidis (Gram negative rod), Pseudomonas aeruginosa (Gram negative rod), Staphylococcus aureus (Gram positive rod) and Listeria monocytogenes (Gram positive rod).

[0106] Similarly, such results can also be obtained and demonstrated for a variety of other Gram-negative and / or Gram-positive bacteria such as, but not limited to, Bacillus cereus (Gram positive rod) and Clostridium botulinum (Gram positive, rod).

Example 10

[0107] The IC50 was calculated for some test organisms that were tested against the artificial composition to mimic the M. crispans volatile by-product. (see Table 1): With reference to Table 12, all test organisms were 100% inhibited with 15 µl of the artificial mixture and several were killed with only 10 µl. Verticillium dahliae, Botrytis cinerea and Aspergillus fumigatus were not killed by even the largest volume of the mixture (30 µl), but all three were 100% inhibited with 10 or 15 µl of the test mixture. The most sensitive organism was Pythium ultimum, which was killed with 10 μL and 100% inhibited with 2.5 μL, therefore the IC50 values ​​do not necessarily reflect the ability of the volatiles to kill, since both P. ultimum and Botrytis cinerea have practically the same IC50 values, but one is killed and the other is not (Table 13).

Table 13. IC50 of the artificial mixture of M. crispans volatile by-product components against various plant pathogens. Amounts of the mixture ranging from 1 µl to 30 µl were added to a sterile plastic well in the center of the test plate, and pathogenic organisms were placed around the edge of the dish. The viability after 48 hours was assessed and compared to a control dish without addition of the mixture but with a sterile plastic well placed. Any organisms that did not grow after this period were determined to be 100% inhibited, and those that did not grow after 48 hours and showed no growth after isolation on PDA immediately after 48 hr evaluation were considered dead. The IC50 calculation was determined by dividing the amount of the artificial mixture required to induce 50% inhibition (in µl) by the total air space in the petri dish (50 ml).

<td></td><td>Minimal</td><td>volume</td><td></td>

<td></td><td>impressive</td><td>100% Volume</td><td>impressive</td>

<td>Test organism</td><td>inhibition (μΐ)</td><td>death (μl)</td><td>IC 50 (μΐ ml^-1)</td>

<td>Pythium ultimum</td><td> 2,0</td><td> 10,0</td><td> 0,030 ± 0,004</td>

<td>Phytophthora</td><td></td><td></td><td></td>

<td>cinnamomi</td><td> 5,0</td><td> 30,0</td><td> 0,056 ± 0,009</td>

<td>Sclerotinia</td><td></td><td></td><td></td>

<td>sclerotiorum</td><td>on</td><td> &gt;30</td><td> 0,15 ± 0,016</td>

<td>Botrytis cinerea</td><td> 10,0</td><td> &gt;30</td><td> 0,035 ± 0,004</td>

<td>Rhizoctonia solani</td><td> 20,0</td><td> 15,0</td><td> 0,039 ± 0,006</td>

<td>Aspergillus fumigatus</td><td> 2,0</td><td> 20</td><td> 0,031 ± 0,003</td>

<td>Verticillium dahliae</td><td> 5,0</td><td> &gt;30</td><td> 0,062 ± 0,004</td>

<td>Phytophthora</td><td> 1,0</td><td> 5,0</td><td> &lt;0,02</td>

<td>palmivora</td><td></td><td></td><td></td>

<td colspan="2">Application of the FFC composition to</td><td>garbage treatment in</td><td>to control decomposition</td>

microbiological.

Example 11

[0108] The artificial mixture of items that would normally be considered garbage was folded into two ammunition boxes. These items consisted of grain waste, flower parts, meat waste, newspaper fibers, and various other waste. In one box was placed a small beaker containing 0.2 ml of the above-mentioned FFC composition. A beaker without FFC was placed in the second box.

Both boxes were incubated for 10 days at 80 ° F. At the end of this period, the boxes were opened and examined. It was obvious that there had been no breakdown in the FFC box. On the other hand, the contents of the control box had a complete, massive disintegration. The use of an FFC garbage treatment composition provides an opportunity to keep the garbage intact during transportation to facilities around the world that ferment garbage into energy related products such as methane. Fig. 4 illustrates that the FFC composition protected the garbage from microbial degradation under the conditions of this experiment.

Use of an FFC composition in the treatment of cheeses to control fungal breakdown

Example 12

[0109] A vial containing 10 ml of the above-mentioned FFC composition was incorporated in or with and / or was used to impregnate a 10 x 10 inch piece of Saran® clear plastic film. The plastic film was immersed in the FFC composition for 6 days, drip-dried and then used as a wrapper for a piece of cheese, thoroughly inoculating with the cheese strain of Penicillum sp. In another experiment, a piece of cheese was inoculated with a mushroom and then wrapped in plain Saran® film followed by injection of 10 microliters of FFC. Appropriate controls are indicated in the illustration above with Penicillium sp. Alone, with foil pack treated only, with FFC only, and with control (no treatment). The experimental cheese pieces were incubated for 1 week at room temperature, and then aliquots of each cheese piece were subjected to an eating test conducted by laboratory personnel. It should be noted that there were no adverse effects of storage in this way along with the deterioration of the taste of the cheese compared to a freshly cut fresh piece of cheese kept in the refrigerator. The piece of cheese completely contaminated with fungus was not eaten. From Fig. 2 it is clear that the application of the FFC composition under the foil or with the treated package resulted in virtually complete protection of the cheese piece from decomposition and colonization of the cheese by Penicillum sp. This was the case with the treated foil and injection of 10 microliters of the FFC separately under the Saran foil which the cheese was wrapped.

Use of an FFC composition for the treatment of food and plant parts (e.g. plant products) to control fungal breakdown Example 13a

[0110] Several sweet potatoes were harvested for these experiments. It is believed that surface contaminating microorganisms causing final degradation would be present in sufficient quantity for inoculation. Therefore, two pieces of sweet potato were placed in a plastic box with a tightly closed lid in the presence of a small beaker containing 0.2 ml of FFC. The control box contained a beaker without FFC. The sealed boxes were then stored at room temperature for 10 days and then tested. It was evident that no superficial and deeper contamination of the treated sweet potato pieces developed, while the sweet potato control produced many areas of surface blemishes and decay, as shown in Fig. 3: Untreated sweet potato is on the left and treated with FFC - on the right. Note the large area of ​​fungal decay on the upper left side of the sweet potato.

Example 13b

[0111] As a related end use, the FFC composition and / or a component thereof may be applied to harvested fruit or vegetables to compensate for the removal of any natural, waxy or protective coating. For example, harvested squash and similar products with cut stems can be treated with an FFC composition (e.g., by spray application) to control / inhibit microbial growth, improve marketability, and extend shelf life.

Example 14

[0112] The synthetic FFC composition of the invention, according to compositions similar to those described in Tables 2-7 and 10, compared favorably with the use of live M. albus to control sugar beet (Beta vulgaris L.) seedling diseases caused by Pythium ultimum, Rhizoctonia solani AG 2-2 i

Aphanomyces cochlioides, root tumor, Meloidogyne incognito, on tomato (Lycopersicon esculentum). The synthetic composition provided a wilt control equal to the living fungus starch-based formulation against all three sugar beet pathogens and significantly reduced the number of root knuckle tumors on tomato roots. The quantitative tests of the applied FFC composition showed a concentration of 2 μΐ / cm³ and 0.75 μΐ / cm³ the solid carrier / substrate component provided good control of wilting in sugar beet caused by Rhizoctonia and Pythium, respectively. Concentration 5 μl / cm³ sand provided 100% mortality within 24 hours for M. incognito. By comparison, using in vitro studies, the same index of bioavailable agents provided a lower number of root-nodule tumors than the M-infested barley formulation. albus applied at 5 g / l sand. Example 15

[0113] Corynebacterium michiganese causes severe loss of tomatoes through wilt and tissue rot. An authentic culture of this bacterium was plated on agar with nutirnet broth and a micro-lid was placed in the center of the plate. 20 microliters of an artificial, laboratory-prepared FFC composition according to the invention was placed in the lid. The control board did not contain the FFC composition. Plates were incubated for 24 hours and then examined. There was no growth on the FFC treated plate. (See Fig. 5.) As such, the FFC composition of this invention can be used, without limitation, in the treatment of seeds, plants or tomato products. Alternatively, the FFC composition can be mixed with soil pre-soak water.

Example 16

[0114] With reference to the above, and in accordance with several of the above examples, the scope of the FFC compositions of this invention may be used either prophylactically or in the treatment of active disease states such as, without limitation, diseases affecting, but not limited to, sugar beet, tomato , onions, cereals, bananas and paradise figs, as well as citrus plants.

[0115] More generally, the compositions and methods can be directed to treating and increasing the viability of seeds, plants, products, and / or related food products - whether prophylactically or in the presence of fungal or bacterial microorganisms, regardless of the stage of the life cycle (e.g., zoospores, etc. ), the development, growth or extent of infection. Accordingly, as understood by those skilled in the art, such compositions may contain and / or be used in whatever form (e.g. powder, granules, liquid, mist, suspension, steam, pastes, gels, coatings, etc.) on the surface or in contact with seeds, cuttings or plants (e.g. roots, stems, leaves, etc.) or their products (e.g. before or after harvest).

Example 17

[0116] The FFC compositions and / or components thereof, alone or as may be incorporated into various other compositions, can be used in a variety of end uses in poultry, manufacturing, and related food industries. Several such non-limiting uses are given in the examples below.

Example 17a

[0117] The FFC composition of this invention, in accordance with compositions of the type described in Tables 2-7 and 10, is used to treat a variety of egg products including, but not limited to, whole egg and liquid whole egg, fortified whole egg, and liquid fortified egg. whole egg, whole egg with salt and liquid whole egg with salt, whole egg with sugar and liquid whole egg with sugar, and mixtures of such products - liquid or not - with sugar, solid syrups, syrups, dextrose and dextrins and / or gums and thickening agents, including scrambled eggs and liquid scrambled mixtures, egg products with reduced cholesterol and liquid products and mixtures thereof and related products containing less than 10% of egg solids, egg shells and egg components, including but not limited to cholesterol-free yellow eggs. Such terms will be understood by those skilled in the art and will have standard meanings in accordance with accepted industrial and regulatory use.

Example 17b

[0118] Likewise, various FFC compositions of the invention, including, but not limited to, those using propionic acid with at least partial substitution of isobutyric acid, can be used to prepare and / or package liquid egg products with an extended shelf life. food intake (ESL), including but not limited to whole eggs, scrambled eggs, egg yolk liquid products, and egg whites.

Example 17c

[0119] Likewise, various FFC compositions of this invention may be used in the processing of cracked, empty egg shells. As understood in the art, using available processing techniques and equipment, the FFC composition and / or its component alone or as a component of another composition may be applied (e.g., sprayed) to empty shells prior to further processing, for example into a nutraceutical product. Likewise, one or more of the compositions of the invention may be used or incorporated or otherwise used to treat a poultry carcass, meat or related meat product using apparatus and techniques known in the art. Moreover, one of ordinary skill in the art will understand that the invention is also applicable to other types of animal carcasses, meat, processed meat products, and all other forms of animal meat (e.g. mammals, birds, fish, snails, clams, crustaceans, seafood and other edible species) as well as illustrated in one or more of the following examples.

Example 17d

[0120] As an extension to the preceding example, such an FFC composition can be incorporated into such a processed nutraceutical product (e.g. capsules or tablets of herbs and spices) to inhibit the growth of bacteria / fungi.

Example 17e

[0121] While the above examples illustrate various downstream processing applications, the invention may be applied more widely in the context of egg and poultry production. Without limitation, the FFC compositions or related ingredients of this invention may be introduced into any poultry or egg production facility and / or applied to any equipment or machinery associated therewith. For example, air treatment or surface treatment of a cage or folding / lifting object can control, reduce and / or inhibit airborne and surface contamination and the further growth of microbes therein.

Example 18

[0122] The FFC composition or one or more ingredients thereof may be incorporated into a variety of other processed foods, including foods with water activity, otherwise promoting the growth of microorganisms. For example, such a composition or ingredient can be incorporated into humus, peanut butter and other such spreads, dips, and mixtures. Referring to the peanut cultivation and processing industry, the compositions and related ingredients of the invention can be applied to peanuts before and after breaking the shells, after initial washing of the nuts, to a related processed product (e.g. peanut butter ) and / or packaging and equipment. packing materials.

Example 19

[0123] Likewise, an FFC composition / component of the invention (e.g., one or more or the compositions of Tables 2-7 and 10 above, or variations of the type described herein) may be used as or be incorporated into a wide variety of skin care products or regardless of the formulation (e.g., lotion, ointment, cream, etc.).

Example 19a

[0124] For example, acne is commonly caused by one or more species of bacteria that attack the hair follicles. In demonstrating a further use of this invention, an aqueous formulation of a propionic acid-substituted FFC composition of the invention was prepared and used to treat an adolescent male subject showing age-related acne. One application every three days for three weeks significantly reduced the number and severity of acne lesions under visual observation.

Example 19b

[0125] In demonstrating another use of this invention in the context of a consumer and / or health product, the FFC composition of this invention was incorporated (approximately 2 wt.%) Into a representative over-the-counter skin cream formulation. With reference to Fig. 6, a PDA plate was prepared and incubated for one day with control cream (no FFC component or composition), left top; control cream contaminated with bacterial cells, top right; cream "treated" with FFC composition, left side bottom; and cream treated with bacterial contamination, bottom right. As demonstrated by the inclusion of a low concentration of the FFC compositions of the invention, bacterial growth was prevented in such a skin cream product.

Example 20

[0126] Likewise, the invention may be used in conjunction with a wide variety of oral care, care and treatment products. Without limitation, the following examples demonstrate the use of a substituted propanoic acid FFC composition of the kind described above. Alternatively, various other FFC compositions as set forth in Tables 2-7 and 10, above, or variations thereof, as described elsewhere herein, may be used.

Example 20a

[0127] For example, by illustrating one such oral care / hygiene product, a mouth wash / rinse product using about 1% of such FFC composition was prepared. Such a product was obtained by incorporating such an FFC composition into a commercially available finished mouthwash / rinse product. The FFC compositions of the invention, regardless of concentration or dose level, may also be incorporated into a toothpaste / gel or related gum, mouth, oral or dental care product.

Example 20b

[0128] Lichen planus (LP) is an autoimmune disease of the skin that can occur in the mouth or other mucous membranes. As the membranes become unstable, bacteria or fungi can colonize these areas and cause pain, redness, infection, bleeding, and swelling of the tissues. To reduce the cause of the external involvement of bacteria in this disease, an oral rinse product containing

1% aqueous solution of such an FFC composition. The patient's mouth was rinsed twice to three times a day for at least 3-4 minutes and then spat out. Pictures were taken before applying the treatment and after three weeks of treatment. After 3 weeks, the results showed an almost complete reduction in gingival redness, accompanied by an almost complete reduction in pain in the mouth and gums, and a return to an almost normal color of the gums and the color of other mucous membranes. The patient reported an almost complete cessation of pain / bleeding and the greatest relief from LP compared to previous experience.

Example 20c

[0129] A 1% solution of the above-mentioned FFC composition in ready-made mouthwash was used to reduce plaque and treat other bacterial problems related to oral problems. Daily use with 3-4 rinses / day for two months resulted in little or no plaque build-up. Gums that were initially described as red, swollen and bleeding easily (according to the notes actually kept by the dentist) now showed as normal for color and did not bleed when probed with the "explorer" instrument.

Example 20d

[0130] To confirm the effectiveness of such an FFC composition, the saliva obtained from the previous example was placed on one side of a nutrient agar dish, on the other side of the same dish was washed with a commercial fluid without FFC, the saliva without washing was placed in another dish. The saliva was then incubated for two days. For comparison: unwashed saliva had a high bacterial load; Lavage saliva without FFC had, as would be expected, a reduced bacterial load; but the FFC lavage saliva contained no detectable bacteria.

Example 20e

[0131] In another example, the maxillofacial surgeon tested the FFC composition (eg, as 1% of a commercial rinse / rinse product) prior to oral surgery. The patient placed the untreated saliva on an agar plate (nutrient agar), rinsed his mouth with the FFC lavage solution, and placed this saliva on another agar plate. After two to three days of incubation, the FCC-treated plate showed no bacterial colonies indicating pre- and post-oral surgery to treat or inhibit tooth infections or other oral infections.

Example 21

[0132] Mastitis in dairy cows is caused by a complex of bacteria associated with the udder. In accordance with various non-limiting embodiments of the invention, an FFC composition or a rhamnolipid-modified FFC composition of the type described below may be applied to the udder during milking to reduce the chance of bacterial infections and contamination of the dairy product.

Example 22

[0133] The various FFC compositions of the invention can be used to reduce microbial loads in industrial / medically important biofilms. Regarding the latter, objects ranging from dentures to artificial joints may be treated with the FFC composition of this invention prior to surgical implantation.

Example 23

[0134] The FFC compositions of the invention can be used to combat fungal and bacterial degradation of garments, especially those exposed to a moist environment (i.e. leather, shoes, belts, ties, trouser belts). For example, an application of 0.2 ml of a 1% FFC composition of the type described above was placed in shoes that were completely wet. The boots were closed to keep the generated vapors for several hours and then exposed to dry air. The results showed no decomposition and the shoes were dry with no mold smell remaining.

Example 24

[0135] The compositions of the invention may contain various FFC components and may be formulated as would be understood by those skilled in the art having knowledge of the invention. Without limitation, irrespective of the end use or treatment, one or more of the FFC components present and / or related compositions can be incorporated into various antibacterial or antifungal compositions. Without limitation, such a composition may contain a rhamnolipid surfactant, alone or in combination with an antibacterial and / or antifungal component of the type known in the art. With respect to the latter, such compositions may contain the component syringomycin and / or pseudomycin.

[0136] More specifically, as would be understood by those skilled in the art, the rhamnolipid component may include one or more of the compounds described in US Patent Nos. 5,455,232 and 5,767,090. Such a rhamnolipid compound, now known in the art or isolated and / or characterized in the future, may have the structure disclosed therein or a different one, as would also be understood by those skilled in the art. For example, without limitation, obtained synthetically or naturally occurring (e.g. from the species Pseudomonas or a strain thereof) in acid form and / or as a suitable acid salt, such a compound may be alkyl and / or acyl substituted (e.g. with methyl and / or acetyl and higher homologues thereof, respectively) in one or more the hydroxyl positions of the saccharide. Likewise, whether in mono- and / or diramino form, any such compound may be altered by a hydrophobic moiety. As a non-limiting example, referring to Fig. 7A and 7B, m and n can independently range from about 4 to about 20, whether such moieties are saturated, monounsaturated or polyunsaturated, or the hydrophobic moiety is protonated, present as a base conjugated to any counterion, or otherwise derivatized. In accordance with the broader aspects of the invention, the rhamnolipid useful in such compositions is structurally limited only by the resulting surface activity function and / or antimicrobial effect in combination with the FFC composition of the invention. Accordingly, structural variants of the type described in international publication WO 99/43334 are also contemplated in the context of this invention. See also non-limiting rhamnolipid components / structures of Figures 8-9.

[0137] Regardless of antimicrobial or rhamnolipid identity, the carrier component of the composition of the invention may include a fluid selected from, but not limited to, water, alcohol, oil, gas, and combinations thereof. For example, although such compositions are unlimited in amount or concentration (e.g. % w / w) of the antimicrobial amount or rhamnolipids, a water and / or alcohol-containing vehicle can be used to achieve the desired formulation, transportation, storage and / or use properties, as well as an effective concentration and resulting activity.

[0138] Such rhamnolipid surfactant ingredients, antifungal ingredients and / or related compositions include, but are not limited to, those described in co-pending application serial number 11 / 351,572, especially Examples 9-15, filed February 10, 2006. Such rhamnolipid surfactant components, antifungal components and / or related compositions may contain or be used in combination with one or more FFC components and / or FFC compositions of the invention. Such antibacterial and / or antifungal ingredients are known to those skilled in the art and are commercially available. Various rhamnolipid components and related surfactants are available from Jeneil Biosurfactant, LLC under the trademark Zonix.

Example 25

[0139] For example, by illustrating such rhamnolipid-related variants, a series of compositions can be prepared with one or more rhamnolipid components and one or more FFC compositions of this invention (and / or one or more FFC components thereof), for use as or in conjunction with post-harvest washing or treatment of a wide variety of fruits and vegetables. Without limitation, in such a composition, a rhamnolipid component (e.g. % as described in the above-mentioned '572 application) may be present in an amount in the range of about 0.1 wt. % to about 99.9 wt.% and the composition / component of the FFC (e.g., the compositions of Tables 2-7 and 10 above) may be present in an amount in the range of about 99.9 wt.%. % to about 0.1 wt.% With regard to the current EPA regulations, there is no tolerance limit for the above mentioned Zonix rhamnolipid surfactants. Likewise, there is no tolerance limit for the FFC compositions / components of the invention. Accordingly, foods treated with such rhamnolipid / FFC compositions can be consumed without further washing. Example 25a

[0140] Accordingly, a rhamnolipid / FFC composition may be used to wash the citrus fruit. One such wash / bath composition was prepared using an 8.5% rhamnolipid solution (in water) and a 5% FFC solution (e.g. the composition of Table 10 in water). One gallon of a 95: 5 mixture (v / v) was diluted to 425 gallons. Using procedural protocols known in the industry or otherwise required under applicable state or federal regulations, the composition has been successfully applied to clean and penetrate citrus peel - killing surface and internal bacteria and fungi. While effective for citrus fruits, these and related rhamnolipid / FFC compositions can be used comparably in combination with post-harvest washing or treatment of any fruit or vegetable (e.g., without limitation, berries, tomatoes, grapes, onions, sugar beet, sweet potato, apples, pears, pineapples, and various other tropical products such as, but not limited to, noni fruit and acai berries, etc.). A fruit / vegetable washed or treated with the FFC composition of this example would be considered safe and hygienic for human consumption.

Example 25b

[0141] Whether or not containing a rhamnolipid component, the various FFC compositions of this invention can be used to treat a variety of fruits and vegetables (e.g., without limitation, pears, peaches, apples, tomatoes, apricots, mangoes, and the like) before or after. in packaging or in canning to reduce bacterial / fungal burden.

Example 26

[0142] Recovery of FFC Component Compounds. The ingredients of the compounds for use in the compositions of the invention may be obtained commercially or obtained using synthetic sorting techniques of the kind well known or otherwise described in the literature. (See e.g., U.S. Patent No. 6,911,338)

[0143] Alternatively, as may be beneficial in combination with certain embodiments, including, but not limited to, animal and human food and drink, personal care and cosmetic products and related processing and manufacturing techniques, GRAS compound ingredients and related FFC compositions of the invention can be obtained by natural fermentation techniques and are available under the trademark Flavorzon from Jeneil Biotech, Inc. of Saukville, Wisconsin. Accordingly, the various compositions of this invention, depending on the end use or application, may include bacterial fermented compounds, chemically synthesized compounds, and various mixtures of fermentable and synthetic compounds.

[0144] With reference to the above, the following examples illustrate the non-limiting use or inclusion of one or more compositions of the invention, such use or inclusion as would be understood by those skilled in the art having knowledge of the invention and described in the context of several prior patents.

Example 27

[0145] Illustrating other embodiments, various compositions of this invention may be formulated for use as an additive to a fruit drink, such as described in US Patent No. 6,566,349. For example, the compositions of the invention may be added to the juice in combination with or as a substitute for the flavonoid compound and / or antioxidant, or may be used prior to processing to extend the shelf life of the products. It will be appreciated by those skilled in the art that such compositions of the '349 Patent can be modified to include one or more compositions of the invention in an amount which can be determined for any end use application in a simple manner without undue experimentation.

Example 28

[0146] The compositions of the invention may also be formulated for use in preserving tea beverages and tea / fruit mixtures, such as those described in US Patent No. 5,866,182. For example, the compositions of the invention can be used in combination with or as a replacement for K-sorbate and / Na-benzoate, ascorbic acid and dimethyl dicarbonate. As will be appreciated by those skilled in the art, such beverages described in the '182 patent (e.g. Example 1) therein may be modified to contain one or more compositions according to the invention, the amount of which for any particular application can be determined simply without undue experimentation.

Example 29

[0147] The compositions of the invention may also be formulated for use in maintaining and / or enhancing the antimicrobial effect of antiperspirants and deodorants as described in US Patent No. 5,176,903. For example, the compositions of the invention can be used in conjunction with the replacement of parabens, imidazolidinyl urea, quaternium-15, benzyl alcohol, phenoxyethanol, and various other suitable preservatives (e.g. as described in Examples 1-3) and added to such an antiperspirant / deodorant to protect against degradation, extend shelf life and / or increase efficacy, one or more such compositions will be present in an amount that can be easily determined without undue experimentation , a person skilled in the art.

Example 30

[0148] The compositions of the invention may also be formulated for use in antiperspirants, such as those described in US Patent No. 4,548,808. For example, one or more of the compositions of the invention may be added to the substantially anhydrous non-alcoholic antiperspirant products described in the '808 Patent (e.g. in examples 1-6 thereof) in effective amounts that will be readily determined without undue experimentation by one skilled in the art - to extend the shelf life and enhance the antimicrobial effect.

Example 31

[0149] The compositions of the invention may also be formulated for use in animal / pet food, for example, dog food such as described in US Patent No. 3,119,691. One of skill in the art will appreciate that one or more of the compositions can be added to low hydration dog food, high hydration dog food and rehydratable dog food (e.g. to the product formulations described therein) to extend the shelf life of the products described in the '691 patent, such composition (s) will be in an amount readily determined without undue experimentation.

Example 32

[0150] Compositions of the invention may also be formulated for use in cat litter, such as described in U.S. Patent Nos. 5,060,598 and 4,721,059. Various absorbent materials, including, for example, clay, alfalfa, wood chips and sawdust, and enhanced materials. absorbencies including clay-like filler (patent 059) and peat (patent 598) are used to absorb urine odor and control. One or more compositions of the invention may be used in conjunction with these materials (e.g. by spraying or otherwise incorporated) to reduce or eliminate microbial activity and control odor after application of the grit, such compositions will be present in an amount readily determinable without undue experimentation. Example 33

[0151] The compositions of the invention may also be formulated for use in spray disinfection applications such as those described in US Patent No. 6,250,511. The '511 patent describes, inter alia, a treatment solution in a spray bottle containing from about 25% to 75% of at least one glycol compound, from 0.2% to 60% antimicrobial component, from about 5% to 45% surfactant, and optionally effective the amount of fragrances, dyes and other additives (in col. 3). For example, one or more of the compositions of the invention may be used in conjunction with the disinfectant of the '511 Patent as a replacement for, or in addition to, an antimicrobial component, such compositions (s) being readily determined by one of skill in the art without undue experimentation.

Example 34

[0152] The compositions of the invention may also be formulated to clean and / or disinfect food and beverage processing equipment, such as that described in US Patent No. RE 40,050. Although the re-issued '050 discloses a chlorine dioxide composition, such a formulation could be modified by one of skill in the art to replace one or more compositions of the invention, such composition (s) would be present in an amount readily determined without undue experimentation and contacted with or applied to such a formulation. processing equipment using apparatus and techniques of the kind described in the '050 reissue (e.g., as described in col. 3-4 therein).

Example 35

[0153] The compositions of the invention may also be formulated for use in the preservation of wood, such as described in US Patent No. 4,988,576 (and in lignocellulose-based composites described in incorporated US Patent No. 7,449,130). The '576 patent describes impregnation of wood with a solution of a preservative composition comprising a graft lignosulfonate copolymer, hydroxybenzyl alcohol and a metal salt or metal salt mixture, or alternatively at least one metal salt of a graft copolymer of lignosulfonate, the copolymer being the reaction product of lignosulfonate and acrylic monomers. For example, one or more of the compositions of the invention may be used alone or in combination with those preservatives described in the '576 patent (or in the' 130 patent) as described in Examples 1-4 and 1-2 thereof, respectively, to impregnate and preserve wood. such composition (e) would be present in an amount readily determined by a person skilled in the art without undue experimentation.

Example 36

[0154] The compositions of the invention may also be formulated for use with tissues and / or disinfectants, such as those described in US Patent No. 4,575,891, which discloses a pad partially impregnated with a disinfectant (e.g., col. 2 found therein). The '891 patent describes suitable disinfectants such as alcoholic solutions and other antiseptic solutions. For example, one or more compositions of the invention may be used alone or in combination with such disinfectants and incorporated into such wiping material, such composition (s) would be in an amount readily determined and introduced by one skilled in the art without undue experimentation.

Example 37

[0155] The compositions of the invention may also be formulated for use with a hand sanitizer, such as described in US Patent No. 6,187,327. For example, one or more of the compositions of the invention may be formulated to add and act in conjunction with the lotion of the '327 Patent or to replace any of the active ingredients of the lotion to improve the antibacterial effect. The '327 patent also describes various other known hand sanitizers (e.g. amphoteric cationic surfactant, cationic surfactant, wetting agent and non-ionic regression agent). Regardless, the composition of the invention may be incorporated as a replacement or used in conjunction with any of the active ingredients in any such hand sanitizer, such composition (s) would be present in an amount readily determined without undue experimentation.

Example 38

[0156] The compositions of the invention may also be formulated for use in treating edible or cultivated seed, such as described in US Patent No. 4,581,238, which describes contacting the seed with steam containing sorbate dispersed therein (e.g., in col. 2-5). For example, using the techniques and apparatus disclosed therein, one or more of the compositions of the invention may be volatilized or otherwise applied to such seeds, such composition (s) would be present in an amount readily determined by one skilled in the art without undue experimentation.

Example 39

[0157] The compositions of the invention may also be formulated for use in preventing or inhibiting the growth of spoilage organisms, such as described in US Patent No. 4,356,204, which describes contacting the food with an effective growth-inhibiting amount of ketohexanoic acid (e.g., in col. 2- contained therein). 3). One or more compositions of the invention may be used alone or with such ketohexanoic acid to further inhibit and / or kill spoilage organisms. Similarly, US Patent No. 2,711,976 suggests the use of amino acids to increase the resistance of pudding foods to spoilage organisms and Staphylococcus species. Again, one or more inventive compositions may be used alone or in combination with or as a substitute for such amino acids. Likewise, US Patent No. 2,876,819 suggests the use of sorbic acid as a preservative in food. Again, one or more of the compositions of the invention may be used alone or in combination or as a substitute for sorbic acid. Similarly, US Patent No. 2,910,368 discloses the use of EDTA with sorbic acid to increase the shelf life of vegetables. Again, one or more of the compositions of the invention may be used alone or in combination with EDTA and / or sorbic acid. In any event, such a composition according to the invention can be used in an amount readily determined by a person skilled in the art without undue experimentation.

Example 40

[0158] The compositions of the invention may also be formulated for use in treating fruit, seeds, grains, and legumes, such as those described in US Patent No. 5,273,769, which describes placing any of the items to be treated in a container followed by the introduction of carbon dioxide and ammonia. . For example, using the apparatus and techniques described herein (e.g. Examples 1-4), one or more compositions of the invention can be effectively used as would be understood in the art without undue experimentation.

Example 41

[0159] The compositions of the invention may also be formulated for use in treating dental and medical articles / devices and implants, the latter being further described in US Patent No. 6,812,217, which describes an antimicrobial polymer film applied to the outer surface of an implantable medical device. For example, using techniques of the kind described therein, one or more compositions of the invention may also be deposited or otherwise incorporated into such a device or article (medical or dental) or a polymer film thereon (e.g., as described in col. 5-6) in order to obtain an antimicrobial effect, such composition (e) would be present in an amount readily determined by a person skilled in the art without undue experimentation. Example 42

[0160] The compositions of the invention may also be formulated for use in treating textiles, such as in US Patent No. 5,968,207, which describes the use of a triclosan ester on textile fibers or fabric by diffusion or impregnation. For example, one or more of the compositions of the invention may be formulated for use alone or in combination with such a compound to improve the antimicrobial properties of textiles or fibers thereof, whether it is a man-made, natural, or blend (e.g. . as described in col. 2-3 of the '207 patent), such composition (e) would be in an amount readily determined by one skilled in the art without undue experimentation.

Example 43

[0161] The compositions of the invention may be formulated to treat the surface of a food processing object, related equipment and comestibles, as described in US Patent No. 7,575,744. For example, using techniques and apparatus of the type described herein, one or more compositions of the invention can be formulated and placed on food devices and surfaces in a wide variety of food processing facilities to reduce or eliminate microbial activity, such devices / equipment include, but are not limited to, snacks, poultry, citrus, peanuts and related food processing plants / equipment (see e.g. col 20). Such composition (s) can be used in an amount readily determined by one skilled in the art without undue experimentation.

Example 44

[0162] The compositions of the invention may also be formulated for use in the treatment of diseases related to microbes (i.e. mastitis, hoof and mouth inflammation, etc.) in livestock and livestock and to inhibit the growth of microorganisms on crops, plants, grains, and other foodstuffs, such as those described in US Patent No. 7,192,575 which describes the use and composition of the oil clove oil, eucalyptus oil, lavender oil, tea and orange oil. For example, one or more compositions of the invention may be formulated for use alone or in combination with the invention in the '575 patent (e.g., examples 1-2 thereof), such composition (s) would be present in an amount readily determined by one skilled in the art without undue delay. experimenting.

Example 45

[0163] The compositions of the invention may also be formulated for use in the preservation of food products such as dressings, sauces, pickles, condiments, spreads, butters, margarines, dairy-based products and the like among those exposed to microbial degradation such as those described herein. in US Patent No. 6,156,362, which describes a combination of antimicrobial ingredients. One or more of the compositions of the invention may be formulated for use alone or in combination with one or more of the ingredients of the '362 Patent (e.g., Examples 1-4 thereof), such composition (s) would be present in an amount readily determined by one skilled in the art without undue delay. experimenting.

Example 46

[0164] The compositions of the invention can be formulated for inclusion in a wide variety of water-based and organic paints, stains, and related surface coatings, such as those described in US Patent No. 7,659,326 and the references cited therein (e.g., Kirk-Othmer-Paint, pp. 1046-1049, Vol. 17, 1996 by Arthur A. Leman). For example, one or more compositions of the invention may be formulated for use alone or in combination with another antimicrobial ingredient described in the Detailed Description and Examples 1 and 3 in the '326 Patent, such composition (s) would be present in an amount readily determined by one skilled in the art without experimenting unnecessarily.

Example 47

[0165] Compositions of the invention may also be formulated for use or incorporation in aftershave products such as those described in US Patent No. 6,231,845. For example, one or more of the compositions of the invention may be used in conjunction with ingredients of the type described in Examples 1-6 of the '845 Patent to provide the antimicrobial effect of such prior art aftershave products. Such compositions can be present in an amount readily determined by one skilled in the art without undue experimentation. Example 48

[0166] The compositions of the invention may also be formulated for use or incorporation into a carcass, meat, or meat product treatment product (e.g., from mammals, birds, fish, clams, crustaceans, and / or other forms of seafood and other edible species) such as as described in US Patent No. 7,507,429. For example, one or more compositions of the invention may be formulated for use alone or in combination with another antimicrobial ingredient for incorporation into a product described in the '429 patent. Such composition (s) may be present in an amount readily determined by one skilled in the art without undue experimentation, and the respective product (s) may be applied or otherwise utilized using the techniques and apparatus described in the '429 patent or as otherwise would be understood by the person skilled in the art. those skilled in the art having knowledge of this invention. (See, e.g., the sections meat processing, spraying, dipping and handling, composition and ingredients in the detailed '429 patent).

Example 49

[0167] The compositions of the invention may also be formulated for use in or incorporation into a material (e.g., a coating material or other incorporation) of a food product, such products include, but are not limited to, snacks, cereal products and other food ingredients such as snacks and products. cereals and materials of this type are described in US Patent No. 7,163,708. Without limiting the manner in which such materials may be used, one or more of the compositions of the invention may be used alone or in combination with one or more antimicrobial or preservative component of such materials as described in the detailed description of food products and coating materials of the '708 patent. Accordingly, as will be appreciated by one skilled in the art, such a composition can be present in an amount readily determined without undue experimentation.

Example 50

[0168] The compositions of the invention may be formulated for inclusion in a variety of edible spread compositions including, but not limited to, peanut butter compositions such as those described in US Patent No. 7,498,050. For example, as understood by one of skill in the art, one or more of the compositions of the invention may be used in conjunction with such spreads to provide or otherwise enhance antimicrobial activity, as described in Examples 1-2 of the '050 Patent, such a composition ( (e) can be present in an amount which is easily determined without undue experimentation.

Example 51

[0169] The compositions of the invention may be formulated for inclusion in a wide variety of pest control compositions, such as those described in US Patent No. 6,720,450 (eg, in Sections 2-3 of the Detailed Description therein). For example, one or more of the compositions of the invention may be formulated for use alone or in combination with another anti-pesticide ingredient, such as that described in the '450 patent. Likewise, one or more of the compositions of the invention may be formulated as described therein with a suitable carrier component for use against a variety of bloodsucking insects including, but not limited to, various types of mosquitoes and agricultural insect pests. The compositions can be used as described therein for the direct contact, inhibition and / or elimination of mosquitoes, including their larvae, pupae and / or adults. Alternatively, the compositions may be used and / or formulated for a detaching effect. Regardless, such composition (e) may be present in an amount readily determined by one skilled in the art without undue experimentation, and may optionally include a surfactant. Such a surfactant may be a biosurfactant. Without limitation, such a biosurfactant can be selected from monoramnolipids, diramnolipids, and combinations thereof.