Antimicrobial compositions and related methods of use

Antimicrobial compositions and associated methods of use [0001] This application claims the advantage of the priority of American application serial number 1'3 / 815 839 filed on March 15, 2013, which is incorporated herein by reference in its entirety.

Background of the invention.

Significant progress has been made in the identification and development of biocides to control different molds, plant pathologies and the like. However, most of the commercial biocides or pesticides used are compounds which are classified as carcinogens or which are toxic to wild fauna and flora and other non-target species. For example, methyl bromide is widely used as a soil drainer and in the postharvest treatment of microbial infections. Toxicity to humans and adverse environmental effects will ultimately result in the discontinuation of the use of methyl bromide and various other synthetic biocides / pesticides. Consequently, recent efforts have focused on the identification and development of natural or biomimetic compositions revealing a comparable antimicrobial or pesticidal effect.

Such an approach relates to endophytes and associated volatile side products. Endophytes are defined in the art as microorganisms that reside in the interstitial spaces of living plant tissue, but they are generally not considered to be parasitic. In particular, endophytes discovered in association with rainforest plants have aroused considerable interest for reasons related to the antibiotic nature of their volatile side products. Several members of the geme Muscodor (namely, M. albus, M. roseus and M. vitigenus) have been shown to produce volatile side products revealing an antibiotic or insecticidal nature. However, the respective by-product of each species contains various derivatives of naphthalene and / or azulene. Such compounds, as well as other components of by-products, can be toxic or otherwise unhealthy and the corresponding mixtures are considered to be unacceptable for various end use applications. Therefore, research is continued in the art to identify natural compositions and develop mimetic compositions free of these compounds, which are harmless for human use and reveal effective antimicrobial properties.

0ΜΑ

38484Β1

Summary of the invention.

In view of the above, it is an object of the present invention to provide flavorings which have antimicrobial compositions and / or methods for their use, thus bridging various faults and weaknesses of the prior art, especially those set out above. It will be understood by those skilled in the art that one or more aspects of the present invention may meet certain objectives, while one or more other aspects may meet other objectives. Each objective may not apply in the same way, in all its aspects, to each aspect of the present invention. As such, the following objects can be considered as another possibility with respect to any aspect of the present invention.

It may be an object of the present invention to provide a species of Muscodor and a volatile secondary product thereof, associated compounds free of naphthalene and azulene (ηοη-GRAS compounds), in association with a methodology for the prevention, inhibition and / or eradication of a microbial infection.

It may be another object of the present invention to provide a system comprising such a species or strain thereof and a volatile by-product associated in association with a non-native medium or substrate intended for use against microbial infection .

It may be another object of the present invention to provide such a system and / or such an associated methodology for the use, without limitation, in the context of food for humans and animals, of products, of plants, parts of plants, seeds, agricultural crops and other organic materials, packaging, building materials, fibers, fabrics, clothing and pharmaceutical and / or medical applications.

It may be another object of the present invention to provide, instead of or together with it, a range of artificial biomimetic compositions revealing an antimicrobial activity comparable to such a species of Muscodor.

It may be an object of the present invention to provide one or more of these compositions of edible components or otherwise harmless for use and consumption by humans.

It may be another object of the present invention to provide a system, composite or article comprising such a non-natural, biomimetic composition, in association with a medium or substrate for the prevention, inhibition and / or the eradication of a microbial infection. It may be another object of the present invention to provide

MY

38484Β1 such a system, composite and / or article for use in ؛ a context of the kind described above or illustrated elsewhere herein.

It may also be an object of the present invention to provide a method for antimicrobial and / or pesticide treatment comprising such a composition, without limitation as to the medium, support or substrate.

Other objects, characteristics, interests .and advantages of the present invention will be obvious from this summary and the following descriptions of certain embodiments and will be easily obvious to those skilled in the art knowing various antimicrobial compositions and the associated treatments. These objects, characteristics, interests and advantages will be evident from the above considered in association with the accompanying examples, data, figures and all the deductions which can be drawn from them, alone or taking into account the references incorporated herein.

In part, the present invention may relate to a system comprising at least one strain of M. crispans, a volatile secondary product thereof or a vapor of such a volatile secondary product and a non-native medium or substrate. Such media or substrates can be as described herein or as would be understood by those of skill in the art. Independently, such a strain can be provided in the form of a biologically pure culture, optionally in combination with a support component suitable for contact with the medium / substrate or an end-use application, such a culture being sufficiently viable for the production of a volatile secondary product. According to the present invention, a secondary product or a modification of a secondary product of M. crispans or a vapor corresponding thereto, is as described in terms of composition elsewhere herein.

Therefore, the present invention may also relate to such a system and / or the volatile fungal side products thereof to provide an antimicrobial effect. Such a method may include providing a non-native substrate or medium capable of supporting microbial activity or growth; and bringing such a medium or substrate into contact with a culture of a strain of M. crispans, a volatile secondary product thereof and / or a vapor of such a secondary product. In certain embodiments, such a contact can comprise such a strain on, around or near such a medium or substrate. In certain other embodiments, a volatile side product or modifications of a side product of M. crispans, or a corresponding vapor, can infuse or be brought into contact with such a medium or substrate.

MA خم

Without limitation as to such a system or process, such a substrate can be selected between a foodstuff or a namrel foodstuff product, a packaging component for a foodstuff or other perishable article, a fiber, clothing or clothing, a building or building component, a plant, a plant surface, soil, garbage or waste. Such contact can be bioactive with respect to the present microbial and / or prophylactic.

In part, the present invention may relate to an antimicrobial composition derived from an unnatural source, whether the components thereof are derived from a natural source, chemically synthesized or a combination of these. Such a composition can comprise compounds selected from alcohol, aldehyde, ketone, acid and / or components of acid esters of a biomimetic composition of a secondary product of Muscodor sp., such a composition such that it can be free from condensed aromatic compounds, from substituted condensed aromatic compounds and from hydro-derivatives of such compounds. In certain non-limiting embodiments, such a composition may include an acid component selected from acetic acid, isobutyric acid, propanoic acid and combinations of these.

In certain embodiments, the present invention may relate to an antimicrobial composition derived from a natural source comprising an acid component 2 ء to Cs approximately; an ester component 2 ء to Cs approximately; and at least two components 2 ء to Cs approximately which can be isolated from a volatile secondary product of a culture isolated from Muscodor crispans, a composition such that it may have a pathogenic activity profile different from a d profile. pathogenic activity of a Muscodor sp. cultivates, isolates, a volatile secondary product thereof and / or a synthetic mixture of such a volatile secondary product. Such an acid component can be selected from isobutyric acid, propanoic acid and combinations of these. Independently, such an ester component can be selected from C4 ester acetate, Cs ester acetate, and combinations thereof.

In some other embodiments, such a composition may comprise propanoic acid and a component selected from an ester of about C2 to Cs acid, an aldehyde and combinations of these. In some of these embodiments, an acid ester component can be selected from acetic acid esters, isobutyric acid esters, and combinations thereof. Such an embodiment can consist essentially of propanoic acid and isobutyrate .MA

38484Β1 isobutyl. Such another embodiment can consist essentially of propanoic acid, isoamyl acetate and an aldehyde such as benzaldehyde.

Without limitation, in certain other embodiments, such a composition can comprise approximately 8 to 10 components which can be otherwise isolated from a volatile secondary product of M. crispans. In some of these embodiments, each component of such a composition can be isolated from such a volatile by-product. As such a composition can be derived from a natural source, each of these components can be a fermentation product, and the fermentation can be chosen from bacterial, yeast and / or fungal fermentations. Independently, each of these compounds of such a composition can generally be recognized as harmless for human consumption according to Chapter 21 of the code "United States Code of Federal Regulations", and the sections and / or corresponding provisions thereof.

Independently, in certain nonlimiting embodiments, one such component which can be isolated can be isobutyric acid. In some of these embodiments, propanoic acid may be at least partially substituted for isobutyric acid. In such nonlimiting or other embodiments, one such component which can be isolated can be 2-butanone. In some of these embodiments, acetic acid, propanoic acid or a combination of these may at least in part be substituted for 2-butanone. In these or other non-limiting embodiments, one such component which can be isolated can be ethanol. In some of these embodiments, acetic acid may at least in part be substituted for ethanol. Regardless of the identity or the amount of such an acid component, ester component and / or component which can be isolated, such a composition derived from a natural source may comprise a surfactant component. In some of these embodiments, a biological biosurfactant can be incorporated therewith. Without limitation, a biosurfactant may be a rhanmolipid component selected from a monorhamnolipid, a dirhamnolipid and combinations thereof.

Alternatively, the present invention may relate to a synthetic antimicrobial composition, derived from an unnatural source. Such a composition can comprise an acid component 2 ء to Cs approximately; an ester component 2 ء to Cs approximately; and at least two components c١2 to Cs approximately which can be isolated from a volatile secondary product of a culture isolated from Muscodor crispans, this composition such that it may have a profile of pathogenic activity different from a profile of pathogenic activity of a (MA

38484Β1 species of isolated or cultivated Muscodor or of a volatile secondary product thereof. Such acidic components, esters and / or which can be isolated can be as described above or illustrated elsewhere herein. Independently, such an antimicrobial composition may include a surfactant component. In some of these non-limiting embodiments, such a surfactant can be a rhanmolipid component selected from a monorhanmolipid, a dirhanmolipid and combinations thereof.

In part, the present invention may relate to an antimicrobial, biomimetic composition, comprising a liquid mixture of compounds chosen from alcohols 2 ء to Ci approximately, aldehydes, ketones, acids and esters of acids and combinations and sub-combinations of these, such a composition not being isolated from Muscodor sp. As noted elsewhere herein, such a liquid mixture can be volatile at ambient temperatures. Compared to such a composition and to the compounds thereof, the term "approximately" may mean, as the skilled person would understand, carbon and / or methylene homologues with the corresponding molecular weights and / or isomerism structural limited only by mixing with one or more other components, compounds and the at least partial volatility at room temperature of the resulting composition. Compared to certain nonlimiting embodiments, such a composition can comprise an alcohol, an aldehyde, a ketone, an acid and acid ester compounds selected from the components of a biomimetic composition of by-product of M. crispans, as described below. Such a composition can include chemically synthesized compounds, compounds isolated from bacterial fermentation, or combinations of these compounds. In some of these embodiments, such a composition may include an acid component selected from acetic acid, isobutyric acid, propanoic acid and combinations of these.

In part, the present invention may also relate to an antimicrobial composition, which is not found in nature, whether it is derived from a natural source and / or chemically synthesized comprising compounds selected from alcohols c ؛ to 5 ء approximately, aldehydes, ketones, acids and acid esters and combinations and sub-combinations of such compounds, these selected compounds being generally recognized as harmless (“GRAS”) for human consumption, such a designation as provided for in Chapter 21 of the code “United States Code of Federal Regulations” and in the corresponding sections and / or provisions thereof. In certain nonlimiting embodiments, of, MA

38484Β1 such compounds can be selected from an alcohol, a ketone, an acid and / or acid ester components of a biomimetic composition of secondary products of M. crispans. In some embodiments, a microbial activity / death profile thereof differs from that of either M. crispans or M. albus, a volatile by-product thereof and / or synthetic by-product compositions corresponding. Independently, in some of these embodiments, such a composition may include an acid component selected from acetic acid, isobutyric acid, propanoic acid and combinations of these.

In part, the present invention may include a composition comprising a composition of the present invention; and a surfactant component, such a surfactant component being alone or as it can be incorporated into a support component. In certain embodiments, such a surfactant can be a biotensioactiftel q.u'un rhamnolipid component selected from a monorhamnolipid, a dirhamnolipid and combinations thereof.

In part, the present invention may also relate to a system or composite comprising a composition of the invention and a substrate or medium component. Such a composition can be as described above or illustrated elsewhere herein. Without limitation, a substrate can be selected from a foodstuff or natural foodstuff, a packaging component (for example, a film or wrapping paper) for a foodstuff or other perishable product, a fiber, a fabric or garment, a building or construction component, a human tissue, a plant, a plant surface, soil and waste and garbage. In certain embodiments, such a composition, whether liquid or gaseous, can be incorporated or brought into contact with such a medium, substrate or substrate surface.

In part, the present invention can relate to an article of manufacture, such an article such that it can comprise a solid support component and a volatile antimicrobial composition absorbed therein, adsorbed thereon or coupled therewith. ci or otherwise incorporated therewith. Such an antimicrobial composition can include propanoic acid; and a component selected from a C1 ester of about 5 ح, an aldehyde and combinations thereof. In certain embodiments, such an acid ester can be selected from acetic acid esters, isobutyric acid esters and combinations thereof; and / or an aldehyde component can be selected from an aldehyde component 2 ء to Cs approximately. In some of these embodiments, an acid ester can be isobutyl isobutyrate; or such an aldehyde component, MA

38484Β1 can be benzaldehyde. Independently, such an antimicrobial composition can be incorporated with a support component comprising a clay. In some of these embodiments, such a support component may include a bentonite clay.

Independently, such a composition can comprise one or more optional component or adjuvants, including without limitation a rhamnolipid component.

As a variant, such an article of manufacture can be envisaged with an antimicrobial composition incorporated as it can comprise propanoic acid and an ester of approximately C1 to Cs acid comprising at least one alkylcarbonyl group. RC (O) -١ in which R comprises an isopropyl, fragment (CH3) 2CH-, and an alkoxy group, -OR ', in which R' comprises an isopropyl, fragment -CH (CH3) 2. In certain embodiments, such an acid ester can be selected from isoamyl acetate, isobutyl isobutyrate and a combination thereof. In some of these embodiments, such an antimicrobial composition may consist of a propanoic acid and an isobutyl isobutyrate. In some of these other embodiments, such a composition may consist of a propanoic acid, an isoamyl acetate and a benzaldehyde. Independently, such a solid support component can comprise a clay.

Consequently, such an article may comprise a support component comprising a bentonite clay and an antimicrobial composition incorporated therein. Without limitation, such an antimicrobial composition can be selected from a composition consisting essentially of propanoic acid and isobutyl isobutyrate; and a composition consisting essentially of propanoic acid, isoamyl acetate and benzaldehyde.

In part, the present invention may also relate to an article of manufacture comprising granules of a solid support component and an antimicrobial composition incorporated therein. Such a composition can comprise an acid component 2 ء to Cs approximately; at least one component C2 to Cs approximately which can be isolated from a volatile secondary product of an isolated culture of Muscodor crispans cultivated on agar dextrosed with potato; and a component selected from at least one ester of about C2 to Cs acid, an aldehyde, and combinations thereof. With regard to such an article, such granules of solid support component in which the composition is integrated can be supplied in a vapor-permeable enclosure.

In some embodiments, such a solid support and such antimicrobial compositions can be as specified above or illustrated

MY

38484Β1 elsewhere herein. In some of these embodiments, such an antimicrobial composition may be from about 0.01% by weight to about 10.0% by weight of such an article. In some of these embodiments, such a composition can be from about 0.20 ٠/٥ by weight to about 10.0% by weight. In still other embodiments, such a composition can be from about 1.0% by weight to about 3% by weight of such an article. Without limitation as to the solid support component or the antimicrobial composition incorporated therein, such an enclosure may comprise a woven mesh and / or a nonwoven material as may be configured in the form of a flexible bag or sachet. Independently, such an article of manufacture can be supplied in a container with a perishable food product.

Therefore, the present invention may also relate to a method of treatment, prevention, inhibition, eradication of microbes or insects and / or to otherwise affect the activity of microbes or insects. Such a method may include providing a composition of the present invention, including but not limited to one or more compositions of the kind illustrated herein; and contacting a microbe or insect or an article / substrate capable of maintaining the activity of a microbe or an insect with such a composition in an amount at least partially sufficient to affect the activity microbe or insect. Such a microbe (for example, a fungus, bacteria or virus) or insect may be in a medium, on or near a surface of a substrate of the kind specified above. Consequently, such contact can be direct and / or volatilize such a composition. Independently, such a treatment can be active in relation to the presence of a microbe or insect and / or prophylactic. As illustrated elsewhere herein, treatment can be considered in the context of death and / or growth or inhibited activity of the microbe or insect.

In part, the present invention may also relate to a method for affecting microbial activity. With respect to such a method, the present invention may include providing an article of the kind described above or illustrated elsewhere herein; and contacting the vapor of an antimicrobial composition of such an article with a microbe and / or a food product capable of maintaining microbial activity, such composition being in sufficient quantity to affect microbial activity. In some embodiments, such a food product may include a natural post-harvest food product. In combination with an article of the present invention, this product may optionally be placed in a container at a given point in the supply chain of the natural food product. Without limitation ,.

,MY

38484Β1 the introduction of the natural food product may be at a point of harvest, a point of processing, a point of wholesale distribution, a point of retail and combinations of these. Regardless of the natural food product or point of introduction, such an antimicrobial composition may be as described above or illustrated elsewhere herein.

As specified below and illustrated by several nonlimiting examples, the present invention may include one or more acid salts. Therefore, in part, the present invention may relate to one or more compositions comprising a propanoic acid component; and a component selects from an acid salt component 4 to approximately C 6, an acid ester component from Cl to Cs approximately, an aldehyde component 2 ء to approximately Cs and combinations thereof. In certain embodiments, such an acid salt component can be selected from isobutyric acid salts, citric acid salts and combinations of these. In some of these embodiments, such an acid salt component can be selected from isobutyric acid salts and combinations thereof. Without limitation, such a salt can be selected from potassium and ammonium salts of butyric acid. Regardless of the presence of an acid salt component, such an ester component can be selected from esters of a 4 acide acid and combinations thereof. Likewise, independently of the presence of an acid salt component and / or ester component, such an aldehyde component can be benzaldehyde. In certain other embodiments, independently of the presence of an acid salt component, ester component and / or aldehyde component, such a composition may comprise an approximately C2 to C6 acid component in addition to propanoic acid. In some of these embodiments, such an additional acid component can be selected from acetic acid, isobutyric acid, citric acid and combinations of these.

Without limitation, such a composition may comprise propanoic acid and at least one C4 acid salt. In certain embodiments, such an acid salt can be selected from potassium and ammonium salts of isobutyric acid. In some of these embodiments, such a composition may include an acid component in addition to propanoic acid. Such an additional acid component can be selected from acetic acid, isobutyric acid, citric acid and combinations of these. In certain other embodiments, such a composition can comprise propanoic acid and at least one ester component of approximately C2 to Cs acid. Some of these embodiments may include at least one C4 acid ester. Independently, such a composition can comprise an acid component in

MY

38484Β1 in addition to propanoic acid, such an additional acid component as it can be selected from acetic acid, isobutyric acid, citric acid and combinations thereof.

In part, the present invention may also relate to compositions comprising propanoic acid and at least one salt component of acid 4 ء to 6 ء approximately. In certain embodiments, such an acid salt component can be selected from isobutyric acid salts, citric acid salts and combinations of these. In some of these embodiments, such an acid salt may be an isobutyric acid salt. Without limitation, such an acid salt component can be selected from potassium and ammonium salts of isobutyric acid and combinations thereof. Regardless of the identity of such an acid salt component, such a composition may include an acid component in addition to propanoic acid, such as an additional acid component as it can be selected from 2 ء to About and combinations of these. In certain embodiments, such an additional acid component can be selected from acetic acid, isobutyric acid, citric acid and combinations of these. Without limitation, such a composition can be selected from a composition consisting essentially of propanoic acid and a salt of isobutyric acid; and a composition consisting essentially of propanoic acid, a salt of isobutyric acid and at least one acid selected from acetic acid and citric acid.

As stated above and illustrated below, such compositions can be incorporated into an article of manufacture. Consequently, in part, the present invention may relate to an article of manufacture comprising one or more compositions, of the kind specified above, comprising propanoic acid. In certain embodiments, such an article can be selected from a food product for humans, an food product for animals, a care product for animals, a packaging product and a solid support component. Without limitation, a solid support component may include a clay. In certain other embodiments, such a food product for humans can be selected from processed foods. These various items are illustrated below, including but not limited to, cheese and associated dairy products.

According to certain embodiments of the present invention, compositions comprising certain food and flavoring compounds (CAA) are particularly inhibitory and / or lethal for certain pathogenic fungi, bacteria and

MY

38484Β1 other microbes of concern in the agricultural, medicinal, commercial or industrial fields. Such compositions can be differentiated from any other previous mixture containing compounds derived from biological sources: for example, the present compositions do not contain substances derived from naphthalene or from azulene (non-GRAS compounds). Conversely, such compositions may include a mixture of organic compounds, each of which is otherwise considered (i.e., GRAS) as a food or flavoring substance.

The present invention demonstrates the nature of such compositions, their preparation and their application to various products (for example, without limitation, food, fibers, instruments and construction surfaces) to preserve their integrity and prevent their destruction by various fungi ( molds and other microorganisms). Such compositions can also be applied to building structures, parts of plants and even clothing for their preservation. In addition, as shown below, such a composition can negatively affect Mycobacterium tuberculosis, the microorganism that causes tuberculosis, including at least 3 strains that are otherwise resistant to drugs.

Brief description of the drawings.

Figure 1. Photographs illustrating the lethal effect of CAA tale of clinical cultures of Mycobacterium tuberculosis resistant to drugs after a 2-day exposure.

Figure 2. Series of photographs illustrating the prevention of fungal growth (mold) on cheese by several methods using CAA.

Figure 3. Protective effect of CAA on yams stored in the presence of 0.2 ml of a composition with CAA for two days. Then the yams were photographed after days. (The test is on the left and the witness on the right.) [0042]. Figure 4. Protective effect of CAA on cabbage decay guard during days at 30٥ c.

Figure 5. Demonstration of the effect against canker / bronzed tomato disease, on the left is the control dish of c michiganense and on the right is the dish treated with 20 microliters of a CAA composition according to the present invention.

Figure 6. Demonstration of the effect of a CAA composition of the present invention incorporated into a skin cream product.

..MY

Figures 7Α-Β and 8. They illustrate the structures of several monorhamnolipid and dirhamnolipid compounds which are representative and nonlimiting, according to certain nonlimiting embodiments of the present invention.

Figure 9. It provides two embodiments of a rhamnolipid component, designated RI and R2 for the respective mono- and dirhamnolipid structures, which can be used alone or in combination with each other, as it is. described in several of the following examples, according to certain non-limiting embodiments of the present invention.

Figure 10. It provides the nomenclature and possible structures of CAA useful in association with various antimicrobial compositions, according to certain non-limiting embodiments of the present invention.

Figures 11Α-Β. They provide digital images (A) of a natural post-harvest food product preserved for 7 days in the presence of bentonite granules impregnated with an antimicrobial composition of the present invention; and, by way of comparison (B), a control system showing the degradation after 7 days in the presence of granules without incorporated antimicrobial composition.

Detailed description of certain embodiments.

[0049]. As illustrated by several nonlimiting embodiments, the present invention relates to the use of a new species of Muscodor and / or of its volatile secondary products and the development of biomimetic compositions, prepared in the laboratory, non-natural comprising common food and flavoring compounds which, when incorporated into different media, applied to surfaces or introduced into an atmosphere, space or volume, cause decontamination of the intended medium, surface or volume of otherwise unsightly, harmful and / or pathogenic microorganisms including parasitic plant fungi and the agent responsible for tuberculosis. The invention has extremely important implications and applications for modern agriculture, human medicine, food science and industry. The fact that the compositions of the present invention have antimicrobial properties is not obvious since no individual ingredient, in or of itself, is biologically active. A synergistic combination of component ingredients reveals the full potential antimicrobial activity.

[0050]. Compared to the use of such a species of Muscodor, of a volatile secondary product thereof or of a biomimetic composition derived from an unnatural source comprising CAA, contact may be direct or by exposure. at a steamer, MA

38484Β1 associated with such a species, such a secondary product of biomimetic composition. As described below, in the context of certain embodiments, although exposure to vapor may inhibit growth, direct microbial contact may be necessary to kill bacteria and fungi.

Regardless of the mode of contact, the compositions of the present invention can be manufactured in the laboratory, comprising chemically synthesized components, components derived from a natural source, or a combination of these synthetic and natural components. Independently, such compositions may be biomimetic with respect to the effect of a side product of Muscodor on a particular species of bacteria or fungi. Alternatively, such a composition, by the relative concentration or selection of any one or more CAA components thereof, may reveal varied or improved antimicrobial activity, compared to a fungal side product of Muscodor.

In some of these embodiments, such a composition can be on, or as it can be applied to, a substrate or medium comprising a protein or cellulosic component which can maintain, is capable of maintaining or maintains a microbial growth. Without limitation, certain embodiments may include plants, plant elements (eg, roots, stems, leaves or foliage, products and the like) and any shoots and seeds which are derived therefrom. In particular, without limitation, such compositions can be on any vegetable product, whether it is described as fruit, vegetable, tuber, flower, seed or nut, either before or after harvest. Some of these plants and / or some of these products are recognized in the art, alone or collectively, as agricultural crops. Therefore, in certain embodiments, a composition of the present invention can be over or applied to a crop at any time during its development, before harvest and / or after harvest. Likewise, a composition of the present invention can be applied to or incorporated into a drink, a food product (eg, intended for humans, domestic animals and / or animals) or an article of manufacture which can maintain, is capable of nurture or maintain microbial growth.

[0053]. In certain other embodiments of the present invention, such a composition may be on, or as it may be applied to, a substrate or surface supporting or encouraging the growth of a microbe (for example, yeast and / or fungus bacteria and / or virus). Consequently, such a substrate or such a surface can comprise any material which can maintain, is capable of maintaining or violates the .1.4 .MA

38484Β1 microbial growth. Such substrates include but are not limited to wood, ceramic, porcelain, stone, flat, drywall, cement, fabric, leather, plastics and the like.

In certain other embodiments, different compositions of the present invention can be on, in contact with, or as applied or administered to a substrate or surface comprising mammalian or human tissue, including but not limited to , nails, hair, teeth or mouth, skin and other cellular material, in the context of a pharmaceutical presentation or personal hygiene or hygiene for the treatment or prevention of microbial growth or infection. Representative compositions are described below in terms at least in part which apply to one or more other embodiments.

An endophytic fungus was removed from the tissue of a wild pineapple (Ananas ananassoides) which grows in the Bolivian Amazon. Finally, it has been shown to produce a mixture of volatile compounds with antimicrobial activities. Using molecular techniques, it has been observed that the fungus has sequence similarities with members of the genus Muscodor. These fungi are known to produce volatile organic compounds that can act as antimicrobials that are effective against both human and plant pathogens. Members of the Muscodor species have been identified using methods such as phylogenetic character mapping using 18S rDNA and ITS-5.8S rDNA sequence analyzes. The sequences found in the present fungus and other Muscodor species have been researched by BLAST in GenBank and compared with other fungi (Bruns et al., 1991; Reynolds and Taylor 1993; Mitchell et al., 1995;

Guarro et al., 1999; Taylor et al., 1999). Finally, these isolates were determined to be related to Xylaria (Worapong et al., 2OOla & b) ٠ All isolated taxa that belonged to Muscodor had similar characteristics, such as relatively slow growth, possession of a similar mycelium to felt, the production of biologically active volatile compounds and the fact that they did not harm the plants in which they originally resided. Finally, they all share very similar rDNA sequences (Ezra et al., 2004).

Although the present fungus shared all the same common characteristics mentioned above, there were a number of different aspects compared to the taxon which distinguished it from all other Muscodor species and other isolates. As illustrated in more detail in the following examples, these

MN

38484Β1 unique characteristics support the establishment of the present fungus as a new species. The name proposed for this new endophytic fungus is Muscodor crispans.

According to the CG / SM analysis, the isolated fungi produced alcohols, esters and acids of low molecular mass, in the gas phase, when they were grown on dextrose potato agar ( PDA). As shown in Table 1, below, these compounds include propanoic acid, 2-methyl;

1-butanol, 3-methyl, acetate; 1-butanol and ethanol. No naphthalene or azulene derivative (non-GRAS compounds) was produced by this organism when cultivated on PDA, which distinguishes it from all the other Muscodor species studied so far. The odor produced by the fungus becomes noticeable after about 1 week and seems to increase over time up to and for at least three weeks. As illustrated below, the volatile products of this fungus have inhibitory and lethal biological activity against a number of plant and human pathogens using the conventional bioassay technique (Strobel et al, 2001).

Table 1.

<td>Retention time in min</td><td>Compound</td><td>MM</td>

<td> 2:05</td><td>acetaldehyde</td><td> 44.03</td>

<td> 3:40</td><td>Ethyl acetate</td><td> 88.05</td>

<td> 3:51</td><td>2-Butanone</td><td> 72.06</td>

<td> 4:08</td><td>Propanoic acid, 2-methyl-, methyl ester</td><td> 102.07</td>

<td> 4:18</td><td>Ethanol</td><td> 46.04</td>

<td> 5:29</td><td>Acetic acid, 2-methylpropyl ester</td><td> 116.08</td>

<td> 6:39</td><td>Propanoic acid, 2-methyl-, 2-methylpropyl ester</td><td> 144.12</td>

<td> 6:46</td><td>1-Propanol, 2-methyl-</td><td> 74.07</td>

<td> 6:52</td><td>2-Butenal, 2-methyl-, (E) -</td><td> 84.06</td>

<td> 7:12</td><td>l-Butanol, 3-methyl-, acetate</td><td> 130.10</td>

<td> 8:18</td><td>Hexane, 2,3-dimethyl-</td><td> 114.14</td>

<td> 8:21</td><td>Propanoic acid, 2-methyl-, 2-methylbutyl ester</td><td> 158.13</td>

<td> 8:31</td><td>l-Butanol, 3-methyl-</td><td> 88.09</td>

<td> 13:37</td><td>Propanoic acid, 2-methyl-</td><td> 88.05</td>

<td> 14:41</td><td>Formamide, N- (Lmethylpropyl) -</td><td> 101.08</td>

<td> 16:44</td><td>Acetic acid, 2-phenyléhyl ester</td><td> 164.08</td>

<td> 20:44</td><td>Cyclohexane, 1,2-dimethyl-3,5-bis (1-methylethenyl) -</td><td> 192.19</td>

As stated above, the present invention comprises the use of M. crispans and / or a volatile secondary product thereof in association with a non-native medium, substrate and / or volume for an antimicrobial effect. Such use and / or applications may be as described herein or

HA

38484Β1 as they would be understood otherwise by a person skilled in the art, including but not limited to the use and application of the kind described in American patent n ° 6,911,338, the entirety of which is incorporated herein reference.

Alternatively, a wide range of natural and synthetic biomimetic compositions can be used with a comparable or improved effect or, as evidenced by one or more embodiments, to provide results not previously available with use either the fungus or its volatile byproduct. As a departure from the prior art and the secondary product of M. crispans, such antimicrobial compositions include food and flavoring compounds generally recognized to be harmless for human use and consumption. To illustrate this, several nonlimiting biomimetic compositions are provided in Tables 2 to 7 below. Various other compositions may include combinations of compounds selected from one or more of Tables 2 to 7 (see, for example, Examples 52 to 56). Alternatively, such a composition may include a component compound in addition to or in replacement of any of the listed compounds, to improve volatility or modify any other end use or performance property. In some of these compositions, such a replacement or additional compound may have a GRAS designation and / or be thus designated at the levels used; these compositions as they can be considered essentially free from any component or material which would not be generally recognized as harmless (GRAS) according to the code "United States Code of Federal Regulations". Such compositions may, alternatively, comprise a component found in a volatile side product of M. crispans and / or not in a volatile side product of another species of Muscodor.

Each of these compounds can be provided in an effective concentration or a range of percentages and is either commercially available or can be prepared by those skilled in the art. Regarding this last point, fermentation techniques can be used to naturally prepare and isolate these compounds. Alternatively, such compounds can be synthesized chemically. Compared to several non-limiting embodiments of the present invention, each compound of Tables 2 to 7 can be obtained as a fermentation product, these products and corresponding compositions as they are available under the trademark Flavorzon from Jeneil Biotech, Inc. from Saukville, Wisconsin.

MY;

38484Β1

Table 2. Biomimetic composition of the present invention comprising:

<td>Compound</td>

<td>acetaldehyde</td>

<td>Ethyl acetate</td>

<td>2-Butanone</td>

<td>Propanoic acid, 2-methyl-, methyl ester</td>

<td>? Etao</td>

<td>Acetic acid, 2-methylpropyl ester</td>

<td>Propanoic acid, 2-methyl-, 2-methylpropyl ester</td>

<td>1-Propanol, 2-methyl-</td>

<td>l-Buanol, 3-methyl-, acetate</td>

<td>Propanoic acid, 2-methyl-, 2-methylbutyl ester</td>

<td>1-Butanol, 3-methyl-</td>

<td>Propanoic acid</td>

<td>Acetic acid, 2-phenylethyl! ester</td>

Table 3. Biomimetic composition of the present invention comprising:

<td>Compound</td>

<td>acetaldehyde</td>

<td>Ethyl acetate</td>

<td>2-Butanone</td>

<td>Propanoic acid, 2-methyl-, methyl ester</td>

<td>Ethanol</td>

<td>Acetic acid, 2-methylpropyl ester</td>

<td>Propanoic acid, 2-methyl-, 2-methylpropyl ester</td>

<td>1-Propanol, 2-methyl-</td>

<td>l-Butanol, 3-methyl-, acetate</td>

<td>Propanoic acid, 2-methyl-, 2-methylbutyl ester</td>

<td>1-Butanol, 3-methyl-</td>

<td>Propanoic acid, 2-methyl-</td>

<td>Acetic acid, 2-phenyléhyl ester</td>

<td>Propanoic acid</td>

Table 4. Biomimetic composition of the present invention comprising:

Compound

Acetaldehyde ___

Ethyl acetate __ _____

2-Butanone

Propanoic acid, 2-methyl-, methyl ester

Acetic acid______________________________

Acetic acid, 2-methylpropyl ester

Propanoic aid, 2-methyl-, 2-methylpropyl, MA

38484Β1 ester! -Propanol, 2-methyl -______________________! -Butanol, 3-methyl-, acetate ________________

Propanic acid, 2-methyl-, 2-methylbutyl ester l-Butanol, 3-methylPropanoic acid, 2-methylAcetic acid, 2-phenylethyl! ester

Table 5. Biomimetic composition of the present invention comprising:

<td>Compound</td>

<td>acetaldehyde</td>

<td>Ethyl acetate</td>

<td>Acetic acid</td>

<td>Propanoic acid, 2-methyl-, methyl ester</td>

<td>Ethanol</td>

<td>Acetic acid, 2-methylpropyl ester</td>

<td>Propanoic acid, 2-methyl-, 2-methylpropyl ester</td>

<td>1-Propanol, 2-methyl-</td>

<td>1-Butanol, 3-methyl-, acetate</td>

<td>Propanoic acid, 2-methyl-, 2-methylbutyl ester</td>

<td>l-Butanol, 3-methyl-</td>

<td>Propanoic acid, 2-methyl-</td>

<td>Acetic acid, 2-phenylethyl! ester</td>

Table 6. Biomimetic composition of the present invention comprising:

<td>Compound</td>

<td>acetaldehyde</td>

<td>Ethyl acetate</td>

<td>Propanoic acid</td>

<td>Propanoic acid, 2-methyl-, methyl ester</td>

<td>Ethanol</td>

<td>Acetic acid, 2-methylpropyl ester</td>

<td>Propanoic acid, 2-methyl-, 2-methylpropyl ester</td>

<td>1-Propanol, 2-methyl-</td>

<td>l-Butanol, 3-methyl-, acetate</td>

<td>Propanoic acid, 2-methyl-, 2-methylbutyl ester</td>

<td>l-Butanol, 3-methyl-</td>

<td>Propanoic acid, 2-methyl-</td>

<td>Acetic acid, 2-phenylethyl! ester</td>

MY

38484Β1

Table 7. Biomimetic composition of the present invention comprising various combinations of compounds selected from the following compounds or comprising the following compounds:

<td> ٥/٥</td><td>Compound</td>

<td>about 0.1 to about 10</td><td>acetaldehyde</td>

<td>about 0.5 to about 25</td><td>Ethyl acetate</td>

<td>about 0.1 to about 15</td><td>2-Butanone</td>

<td>about 4 to about 99</td><td>Propanoic acid, 2-methyl-, methyl ester</td>

<td>about 1.5 to about 40</td><td>ethanol</td>

<td>about 0.1 to about 10</td><td>Acetic acid, 2-methylpropyl ester</td>

<td>about 0.1 to about 15</td><td>Propanoic acid, 2-methyl-, 2-methylpropyl ester</td>

<td>about 0.1 to about 10</td><td>l-Propanol, 2-methyl-</td>

<td>about 0.5 to about 25</td><td>l-Butanol, 3-methyl-, acetate</td>

<td>about 0.5 to about 25</td><td>Propanoic acid, 2-methyl-, 2-methylbutyl ester</td>

<td>about 2 to about 50</td><td>1-Butanol, 3-methyl-</td>

<td>about 10 to about 99</td><td>Propanoic acid, 2-methyl-</td>

<td>about 0.1 to about 10</td><td>Acetic acid, 2-phenylethyl! ester</td>

Compared to the composition with CAA of the present invention, it is envisaged that any component composed thereof, including any compound component described referenced or deduced herein, such as any compound but without limitation in the Tables 1 to 7 and 10 and the structural and / or carbon isomers and methylene homologs thereof, may be present in a quantity or range distinct and separate from any other component of the composition. Therefore, without limitation, each compound component may be present in an amount or range of about 0.1% by weight, (or less) about 0.2% by weight, about 0.3% by weight, or about 0.4% by weight, ... or / about 1.0 ٥/٥ by weight, about 1.1% by weight, about 1.2 ٥/٠ by weight, about 1.3% by weight , or approximately 1.4 ٥/٠ by weight ... or / approximately 2.0 ٠/٥ by weight, approximately 2.1% by weight, approximately 2.2% by weight, approximately 2.3% by weight , or about 2.4 ٠/٠ by weight ... or / about 3.0% by weight, about 3.1% by weight, about 3.2% by weight, about 3.3% by weight, or about 3.4 ٥/٠ by weight ... or to about 4.0% by weight, about 4.1% by weight, about 4.2% by weight, about 4.3% by weight, or about 4.4 ٥/٠ by weight ... or / to 5 , 0% by weight, approximately 5.1% by weight, approximately 5.2% by weight, approximately 5.3 ٥/٥ by weight, or approximately 5.4% by weight ... or / about 6.0% by weight, about 6.1% by weight, about 6.2% by weight, about 6.3% by weight, or about 6.4% by weight ... or / about 7.0% by weight, approximately

7.1% by weight, approximately 7.2 ٥/٠ by weight, approximately 7.3 ٥/٠ by weight, or approximately 7.4 ٥/٠ by weight ... or / approximately 8.0% by weight, approximately 8.1% by weight, approximately 8.2 ٥/٠ by weight, approximately 8.3% by weight, or approximately 8.4% by weight ... or / approximately 9.0% by weight, approximately

9.1 ٥/٠ by weight, about 9.2% by weight, about 9.3% by weight, or about 9.4% by

MY

38484Β1 weight ... or / about 10.0% by weight; and / or approximately 10.1% by weight ... or / approximately 20.0 ٥/٥ by weight, according to such an incremental variation; or / about 20.1% by weight ... or / about 30.0 ٥/٠ by weight, according to such an incremental variation; or / about

30.1% by weight ... or / about 40.0% by weight, according to such an incremental variation; or / about 40.1 ٥/٠ by weight ... or / about 50.0% by weight, according to such an incremental variation; or / about 50.1% by weight ... or / about 60.0% by weight, according to such an incremental variation; or / about 60.1% by weight ... or / about 70.0% by weight, according to such an incremental variation; or / about 70.1% by weight ... or / about 80.0 ٠/٥ by weight, according to such an incremental variation; or / about 80.1% by weight ... or / about 90.0% by weight, according to such an incremental variation; or / about

90.1 ٥/٥ by weight ... or / about 99.9 ٥/٠ by weight (or more), according to such an incremental variation. Likewise, without limitation, any composition of the present invention, regardless of the identity or amount of any particular compound component or any particular combination, may be present in an amount (٥/٠ by weight) or an interval of% by incrementally variable weight, as described above, from 0.1% by weight to 99.9% by weight of any composition or medium (for example, in any range of about 0.1% by weight to about 1.0% by weight, about 2.0 ٥/٠ by weight, about 4.0% by weight or about 10.0% by weight) incorporated therein or applied to any article or substrate.

Unless otherwise indicated, all numbers expressing quantities, concentrations or quantities of components or ingredients, properties such as molecular weight, reaction conditions and so on used in the specification and claims should be understood as being modified in all cases by the term "approx. Consequently, unless otherwise indicated, the numerical parameters indicated in this specification and the appended claims are approximations which may vary depending on the desired properties which it is desired to obtain by the present invention. At a minimum, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be interpreted in light of the number of significant digits reported and by applying ordinary rounding techniques .

Although the numerical intervals and the parameters indicated exposing the extended scope of the present invention are approximations, the numerical values ​​indicated and the examples are reported as precisely as possible. Any value

MY

38484Β1 numeric, however, may inherently contain some error resulting from the standard deviation found in a respective test measurement.

The compositions and methods of the present invention may suitably comprise, consist of or consist essentially of any compound component or amount of concentration thereof revealed - referenced or deduced herein, including but not limited to any compound component in Tables 1 to 7 and 10, in combination with any structural isomer thereof, carbon and / or methylene homologs of such an alcohol component, aldehyde component, ketone component, acid component and / or ester component, either the fragment derived from an acid and / or derived from an alcohol thereof. Regardless of the quantity / concentration, each of these compound components or fragments / substituents thereof can be distinguished by its composition, is contrasted by its characteristics and can be used in combination with the present methods and compositions, distinct and separate from any other amount / concentration of component or other compound component (or fragment / substituent) or amount / concentration. Therefore, it should be understood that the compositions and / or methods of the invention, as described by way of example herein, can be claimed, practiced, or used with changes in quantity or concentration in the absence of any compound component (or fragment and / or substituent thereof), such a compound (or fragment / substituent thereof) or quantity / concentration thereof may or may not be specifically described, referenced or inferred herein, the change or absence of which may or may not be specifically described, referenced or inferred herein.

In the preferred embodiments, a biologically effective composition of these CAA (prepared in the form of a liquid mixture) is easily volatilized at room temperature and differs throughout a closed space to effectively inhibit and / or kill undesirable contaminating fungi (molds) on surfaces that Ι'οη wishes to free from such harmful microbes. The mixture can be applied in the form of a spray (for example, a spray can with ingredients under pressure) or simply placed in a container and left to evaporate in the closed container or sealed bag.

Independently, the CAA compositions of this invention can be incorporated into a variety of end use compositions, limited only by application. Such compositions include but are not limited to those intended for food or nutrients for humans / animals, personal hygiene, health,

MK

38484Β1 agriculture, industry, residential, medical and consumer applications. In certain nonlimiting embodiments, a composition with CAA and / or a component (s) thereof may be present in a proportion of approximately 0.1 ٥/٥ by weight or less of approximately 99, 9 ٥/٥ by weight or more of a particular end use composition. Such a level of incorporation is limited only by the desired antimicrobial effect and / or presentation considerations.

The present compositions with CAA, at effective dose levels, are effective in killing many plant pathogens, fungi which can cause food breakdown, microbes which can cause major human diseases and microbes which can contaminate work surfaces, dwellings and other buildings. A non-exhaustive list of these applications is given below:

1. For the treatment of cheeses in storage or in preparation to control unsightly contamination by molds on surfaces and the possible deterioration of blocks of cheese.

2. For the treatment of various parts of plants in storage, including roots, tubers, stems, seeds and other organs that could possibly be used for food preparation or for planting and revegetation or for agricultural purposes.

3. For the decontamination of buildings which can either have moldy surfaces or be infested to a point where a mold problem may develop.

4. For storage of garbage during long distance transport from one port to another for possible fermentation in energy related products.

5. For the decontamination of soils which could harbor microbes which could be pathogens of possible plants.

6. For the treatment of patients with ttrberculosis and other mycobacterial infections.

7. For treatment to control nasal infections or to clear the nasal passages.

8. For combination with specifically designed polymers which can be used to package and thus preserve materials, including food, fiber and other items, for longer term safe storage.

More generally, the compositions of the present invention can be used to inhibit the growth of an organism or kill an organism

ΜΑ 38484Β1 selects from the group comprising a fungus, a bacterium, a microorganism and a range of other harmful microbes or organisms. Using methods well known to those skilled in the art, such a composition is brought into contact with the organism in an amount at least partially effective in killing or inhibiting the growth of the organism. Alternatively, it can be used to treat human or animal waste, for example, as a component of the management or treatment of wastewater or solid waste. Such compositions are also useful for decontaminating human and animal waste, for example, reducing or eliminating bacterial and fungal contamination. Likewise, such a composition can be used to treat or prevent mold on building materials and in buildings by bringing the building. building materials or spaces between building materials in contact with an effective amount thereof or the vapors thereof. By way of example only, an effective amount of such a composition can be used alone or in combination with other fumigants or active agents in a room or alternatively, during the fumigation of an entire building.

When used in agricultural applications, the invention provides a method for treating or protecting fruits, seeds, plants or the soil surrounding plants against infestation by an organism such as a fungus or a bacteria, in bringing the microorganism into contact with an effective amount of one or more compositions of the kind described herein.

As stated above, the present invention provides a method for preventing, treating, inhibiting or killing a bacteria, a fungus, a viral infection and / or other microbial infection. Such a method may include administering to an article, animal / mammal or plant substrate, having such infection or growth or capable of supporting such infection or growth, an effective amount of a composition of the invention, alone or as it can be incorporated into a composition or presentation. Therefore, the present invention provides one or more compositions for pharmaceutical, personal (e.g., without limitation, cosmetic), industrial, and / or agricultural use.

Microbial treatment can be obtained by bringing a bacterium, a fungus, a virus and / or another microbe into contact with an effective amount of a composition of the invention. The contacting can take place in vitro or in vivo. "Contacting" means that such a composition of the present invention and such a microbe are combined in a sufficient manner to prevent, inhibit and / or eliminate an infection and / or

MY

38484Β1 microbial growth. The amounts of such a composition effective for such treatment can be determined empirically and a person skilled in the art will know how to make such determinations. Inhibition includes both reduction and elimination of growth / microbial activity.

The compositions of the present invention can be administered or brought into contact with a human, an animal or a plant or an article substrate surface by any suitable route, including without limitation by oral or nasal route (for example , for pharmaceutical or personal hygiene applications) and topically, such as with powders, granules, liquids, sprays, ointments, lotions or creams. Therefore, the compositions of the invention may comprise the respective component compounds in admixture with one or more acceptable carriers and, optionally, with one or more other compounds or other materials. Such a support should be "acceptable" in the sense that it is compatible with the other components / ingredients of the presentation and not harmful to the desired effect or application.

Regardless of the route of release, treatment or administration selected, the compositions of the invention can be presented to provide acceptable concentrations or presentations by conventional methods known to those skilled in the art. The amount or concentration of such a composition or component thereof, with or without a carrier, will vary depending on the microbe / substrate / target article treated, the particular mode of administration / release and all other factors described. above. The amount combined with a carrier material will generally be that amount of such a composition providing the lowest or minimum effective concentration to produce a desired antimicrobial effect.

The relative amounts or concentrations of a composition with CAA and of another optional component in the compositions of the present invention can vary widely within the effective ranges, as demonstrated in the examples which follow. The concentrations and / or doses used are preferably selected to obtain an improved or increased activity compared to the individual components alone of the prior art and / or to maximize the activity of the composition at the lowest or effective concentrations of the components . Consequently, the weight ratios and / or concentrations in percentage providing such an improved activity depend not only on the composition with specific CAA used, but also on the specific application of the end use of the composition comprising, but without limitation, the

Wk

38484Β1 climate, soil composition, nature of substrate, article and / or microbial host to be treated and / or potential exposure to a particular microbe.

The methods of preparing presentations or compositions include the steps of bringing a composition of the present invention, or one or more component compounds, in association with a carrier and optionally, one or more accessory ingredients. In general, presentations are prepared by providing such a composition / component in association with a carrier (eg, liquid or finely divided solid carriers) and, if desired, shaping the product.

The presentations relating to the invention, either a composition of the present invention or any article of manufacture incorporating such a composition, may be in the form of capsules, cachets, pills, tablets, powders, granules, paste or in the form a solution or a suspension in an aqueous or non-aqueous liquid, or in the form of an oil-in-water-OR water-in-oil emulsion, or in the form of an elixir or syrup, or in the form of lozenges (using an inert base, such as gelatin and glycerin, or sucrose and gum arabic) and / or in the form of washing solutions (for example, mist, spray or mouthwash) and the like, each containing a predetermined amount of a composition of the invention or components thereof.

In other solid presentations (for example, capsules, tablets, pills, dragees, powders, granules and the like), a composition of the present invention can be mixed with one or more other acceptable active ingredients and / or carriers, such as sodium citrate or dicalcium phosphate and / or any of the following: (1) filling or developing agents, such as starches, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and / or gum arabic; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates and sodium carbonate; (5) solution retardants, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and

MY

38484Β1 pills, the compositions may also include tampons. Solid compositions of a similar type can also be used as fillers in soft and hard gelatin capsules filled using excipients such as lactose or milk sugars, as well as high molecular weight polyethylene glycols and Similar.

A tablet can be manufactured by compression or molding, optionally with one or more accessory ingredients. Compressed tablets can be prepared using a binding agent (for example, gelatin or hydroxypropyl methylcellulose), a lubricant, an inert diluent, a preservative, a disintegrant (for example, sodium starch glycolate or crosslinked sodium carboxymethylcellulose), a surfactant or dispersant. Molded tablets can be made by molding in a suitable machine a mixture of the active ingredient or powdered active ingredients moistened with an inert liquid diluent.

Tablets and other solid forms of these compositions or articles containing such compositions, such as dragees, capsules, pills and granules, can optionally be incised or prepared with coatings and tunics, such as enteric coatings and other coatings well known in the art. They can also be presented so as to provide slow or controlled release of the active ingredient or active ingredients therein using, for example, hydroxypropyl methylcellulose in various proportions to provide the desired release profile, other polymer matrices, liposomes and / or microspheres. These compositions may also optionally contain opacifiers and may be a composition which releases the active ingredient or active ingredients only, or preferably, in a certain part of the gastrointestinal tract, optionally, in a delayed manner. Examples of incorporation compositions which can be used include polymeric substances and waxes. The active ingredient or the active ingredients can also be in a micro-encapsulated form.

Liquid forms intended for the use or administration of the present invention include emulsions, mixtures, microemulsions, solutions (including those in distilled or purified water), suspensions, mists, syrups and elixirs acceptable pharmaceutically or otherwise. In addition to a composition of the invention or one or more components composed thereof, a liquid form may contain inert diluents or the like commonly used in the art, such as, for example, water or other solvents, solubility agents and emulsifiers, such as ethyl alcohol,

ΜΑ 38484Β1 اية) 'isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3u٦ ؛ butylene glycol, oils (in particular, coconut seed, peanut, corn, sprouts, olive, castor and sesame), glycerol, tetrahydro urfuryl alcohol, polyethylene glycols and esters of sorbitan fatty acids, and melahge's of these.

: 5 - 0081] تن ؛] In addition to inert diluents, such compositions and / or such articles

؛. ؛؛ associates ؛ may also include adjuvants such as, but not limited to, wetting agents, emulsifying agents and suspending agents (for example,

- of adhesion and spreading for agricultural application), dyes, perfumes and one or more other preservatives. The suspensions may include suspending agents such as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar and tragacanth and mixtures of Céux-là.

The presentations of the compositions of the present invention and / or articles or products containing such compositions of the invention for administration / release on a substrate or topical (for example, in the context of a personal hygiene product or hygiene) of the present invention, include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, plasters and products for inhalation. Such ointments, pastes, creams and gels may contain, in addition to a composition of the present invention, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth and other gums, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures of these. Likewise, powders and sprays may contain excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. The sprays can additionally contain common propellants such as volatile unsubstituted hydrocarbons, such as butane and propane, or be released under positive air pressure.

Examples of suitable aqueous and non-aqueous carriers which can be used in the compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like) and suitable mixtures of these, vegetable oils, such as olive oil, and organic esters, such as ethyl oleate. Good fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.

Wk ٩ü crc. ':: ٢ ::: [O | l]' 'Des'foine with a retadd effect o articleso u of products containing pccornpcstiohde the pesehte invention can be made by adorning dies of' micrOencapsulationOf an ouplysieursingedientientsin biodegradable polymers such as biodegradable polymers such as -pblyglyacolide. Depending on the ratio between the QU active ingredients 55 and the foliar, and the number of the particular polymer used, the speed of release of the aid (s): 'active ingredients can be controlled'. Examples of other biodegradable fabrics include p01y (0rh esters) and poly (anhydrides). Injectable presentations ?; with delay effect are also prepared by trapping the active ingredient or the active ingredients dafis t liposomes or microemusions that are compatible with the body tissue.

In addition, the compositions of the present invention and / or the articles or products-contained in such a composition may include additional chemical and / or biological genites, ahtimycotics or antifungals, antibacterials and? إدلال d-; antjhr٠i'çrçbie.ns,. has multiple sites and / or single site, with similar modes of action and / or ddffe ents, as it will be ororinu from the history of the profession. Such agents may include, but not limited to, Je, 'potassium' bicarbonate, silica cuivre copper or deÿ sulfur-based compounds and / or botanical oils (eg neem oil). In addition, such agftits can be understood, but without initiation, azo] és'; polyenes, such as amphotericin cjB. and la'nystatinc; eotidic purine or pyrimidine inhibitors, such as flucytosine; polyoxins, such as nkkmycins; other inhibitors of 20 'inhibitors of elongation factors, such as sordarin and analogues thereof; dgs djnhibieurideja'respiration mitoChohdriale, -inhibitors of sterol biosynthesis and / or qt any other fungicidal or biocidal composition known to Thornme of the art adapted to treat or prevent infections by evidences or infections by bacteria or bacteria, viral and / or microbial plants, other substrates, animals and / or humans, or which can

225 trouyer surou dns early item of manufacture. ٠ ٠

b ..: 0086]: -. ' · .- ع] '' In certain embodiments, articles or products containing the compositions of the present invention may also include one or more preservative components known in the art, including 'without limitation, soric or be٥ic acid; the ael'.dé. sodium, potassium, calciuiri and ammonium benzoic acid, sorbic, 3Ο, hydroxynhyl glycinic and propionic; and methyl, ethyl, propyl and butyl parabens and combinations thereof. - أذت ن: م The compositions of the present intention can contain an oposed sçomprenarft tin acidic or basic functional group and are, thus, capable of forming pharmaceutically acceptable salts or otherwise with acceptable acids and bases

&lt;؟ ٢2, MA

38484Β1

- or otherwise. The term "pharmaceutically acceptable salts" refers to relatively non-toxic, inorganic and organic acid and base addition salts of these compounds. Independently, such salts can be prepared by causing such a compound to react with a suitable acid or base. Suitable bases include hydroxide, carbonate or bicarbonate of such an acceptable metal cation, ammonia or an acceptable primary, secondary or tertiary organic amine. Representative alkali or alkaline earth salts include lithium, sodium, potassium, calcium, magnesium and aluminum salts and the like. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine and the like. Representative acid addition salts include hydrobromide, hydrochloride, sulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthalate, mesylate, glucoheptonate, lactobionate and laurylsulphonate and the like.

The compositions of the present invention can be used in the form of aqueous dispersions or emulsions and are available in the form of a concentrate containing a high proportion of composition with CAA (with or without surfactant), such as it can be diluted (for example, in water or another liquid component) before use. The emulsifiable concentrates or emulsions can be prepared by dissolving a composition of the present invention, together with any other active ingredient desired, in a solvent optionally containing a wetting or emulsifying agent and then adding the mixture into water which may also contain a wetting or emulsifying agent. Suitable organic solvents include alcohols and glycol ethers. These concentrates should preferably be able to withstand storage for extended periods of time and after such storage be capable of being diluted with water to form aqueous preparations which remain homogeneous for a period sufficient for them to be applied using conventional spraying equipment.

Depending on the type of application of the end use, the articles or products containing compositions of the present invention may also include any other necessary components including, but not limited to, solid or liquid carriers to facilitate application , surfactants including biosurfactants, protective colloids, adhesives, thickeners, thixotropic agents, penetrating agents, sabilisants, chelators, texturing agents, flavoring agents

MY

38484Β1 (for example, for applications related to processed or post-harvest food / beverages), sugars, colorants, etc., as will be well known to those skilled in the art.

For example, such compositions and / or such articles or associated products can be used for agricultural purposes and presented with a support or diluent. The compositions can be applied, shaped or unformed, directly to the foliage of a plant, to seeds or other medium in which the plants grow or are to be planted, or they can be sprayed, sprinkled or applied in the form of a cream or paste presentation, or they can be applied in the form of a vapor or sustained release granules. Application can be made to or near any part of the plant including foliage, stems, branches or roots, or to the soil surrounding the roots, fruits or vegetables (before or after harvest) or the seed before it is planted or soil generally, irrigation water or hydroponics systems. The compositions of the invention can also be injected into plants or sprayed on vegetation (including fruits and vegetables) using low volume or pressure or electrodynamic spraying techniques or any other treatment method known in the art. or industry.

In certain embodiments, whether or not agricultural or linked to food processing, the compositions and / or articles or products impregnated with and / or incorporating compositions of the present invention may be in the form powders or granules capable of dusting sulfur comprising a diluent or solid support, for example, filling agents (also such as litter for cats or animals), kaolin, bentonite, Kieselguhr, dolomite, calcium carbonate, talc, powdered magnesia, fuller's earth, gypsum, diatomaceous earth, Chinese earth and other materials capable of being impregnated. Such granules can be preformed granules suitable for application without additional treatment. These granules can be produced either by impregnating pellets of filling agent with a composition of the invention or another active ingredient or by transforming into pellets a mixture of active ingredient and filling agent in powder form. For example, compositions for coating seedlings may include an agent (e.g., mineral oil) to facilitate adhesion of the composition to the seedling; alternatively the active ingredient can be shaped for coating the seedlings using an organic solvent. The compositions may also be in the form of wettable powders or water dispersible granules comprising wetting or dispersing agents to facilitate dispersion in liquids. Powders and granules may also contain agents

MY

38484Β1 filling and suspension agents. Alternatively, the compositions can be used in a micro-encapsulated form. They can also be presented in biodegradable polymer presentations to obtain a controlled, slow release of the active substance.

Independently, such solid presentations comprising such a composition of the invention can be supplied in a range of products or articles in different forms or moldings, including but not limited to cylinders, rods, blocks, capsules, tablets, pills , dumplings (eg, also dog food), bands, picks and the like. Alternatively, a granulated or powdered material can be compressed into tablets or used to fill a range of capsules or coats. As stated above, such a composition of the present invention, whether shaped or not shaped, can be used alone, applied to a substrate or incorporated into a product or article of manufacture for a large range of end-use applications, including but not limited to pharmaceutical, personal, industrial and agricultural compositions and associated methods of use.

In general, a useful solid support component may comprise any material which is at least somewhat porous and / or may contain an abovementioned antimicrobial composition without excessive swelling. In conjunction with materials of the kind described above and elsewhere herein, examples of these support components include silica gels, zeolites, calcium silicate, clays, activated carbon, alumina, 1 ' allophane, vermiculite, various absorbent and / or sustained release polymers and combinations thereof, as will be understood in the art by those who are aware of the present invention. In some embodiments, such a support component may include one or more clay materials, examples of which are useful in the context of the present invention include, but are not limited to, clays of attapulgite, montmorillonite, bentonite , hectorite, sericite and kaolin and mixtures of these. Without limitation, it has been observed that bentonite clays, such as those comprising colloidal hydrated aluminum silicate containing various amounts of iron, alkali and / or alkaline earth metals, are particularly useful. Bentonite clay materials and related processed products are commercially available from a number of sources, including the American Colloid Company of Arlington Heights, Illinois, under the brand name Bentonite AE H, as well as other sources. identified herein or which would be known to those of skill in the art.

MY

According to a particular article or a particular end-use application, a volatile antimicrobial composition can be used pure or in combination with one or more solvent or diluent components such as, but not limited to water, aqueous alcohol and other solvents compatible with such an antimicrobial composition and / or a CAA component thereof. On the other hand, the release or the volatility of such an antimicrobial composition can be varied or adjusted by the presence of any solvent or diluent component.

The production of various articles of the present invention generally involves the additional mixing of an antimicrobial composition of the present invention and a suitable solid support component. Additional mixing can be accomplished using any technique known in the art. At a minimum, the technique and the duration of the additional mixing should be sufficient to disperse an antimicrobial composition on or through a solid support component. The order of the mixed association can vary. For example, a solid support component can be provided or prepared first, followed by the addition of an antimicrobial composition. Alternatively, such an antimicrobial composition and all of the components used to produce a support component can be combined in admixture. Regarding this last point, the components can be combined in pure mixture or with a solvent (for example, water and / or an alcohol), a dispersant or one or more other adjuvants. Relative to a shaping technique, the components used to produce a solid support and the antimicrobial composition can be combined in admixture with the latter, optionally, in the form of an aqueous solution. In yet another embodiment, a powder form of a suitable carrier component may be combined in admixture with an antimicrobial composition and a suitable binder component to provide agglomeration of particles or granules of suitable size. Regardless of the identity of the carrier, the shaping technique or the size of the granules, an antimicrobial composition may be present in an amount of from about 1.0 to about 3.0% by weight of such an article. and the associated support component.

An article of the present invention can be arranged and arranged in association with a package or an enclosure for the release or volatilization of an antimicrobial composition. A bag, lid, inner liner, covered dish or cup, carton, vial and any other art known in the art may be used which provide sufficient retention of the article and antimicrobial release / vaporization from it. Examples of useful and permeable gas and

MY

38484Β1 steam includes those configured in the form of a flexible bag, a package, a sachet made in a mesh net or a nonwoven fabric composed of a material permeable to gas.

The articles described herein are useful for affecting microbial activity, including for inhibiting microbial growth, on and / or near a foodstuff, thereby extending the shelf life of the foodstuff. To this end, such an article, whether alone, without enclosure or optionally presented in association with a flexible bag or sachet, can be positioned in relation to a container or placed in a container for shipping, storage or the exposure of a desired foodstuff (for example, without limitation, fruit, vegetables and other agricultural product), such a container being selected or designed according to the foodstuff in question. The placement of the article inside such a container can take place at any point or at several points of the corresponding supply and distribution food chain .

Examples of the invention.

The following nonlimiting examples and data illustrate various aspects and characteristics concerning the compositions and / or methods of the present invention, comprising the preparation and the use of antimicrobial compositions comprising various component compounds, as described herein. Compared to the prior art, the present compositions and methods provide results and data which are surprising, unexpected and contrary to it. Although the utility of the present invention is illustrated through the use of several compositions and component compounds which can be used therewith, it wi ll be understood by those skilled in the art that comparable results can be obtained with various other compositions and component compounds, as they are to the same extent as the scope of the present invention.

Example la [0099] 'Fungal isolation. Several small stems d^,Ananassoides pineapples were taken from a plant that grows in the Bolivian Amazon in March 2007. They were harvested in a savannah region at the edge of the rainforest at 12٥40'07 s and 68٥41'58 W and they were transported immediately to be analyzed. Several small pieces (2 to 5 inches) of the stems were cut and placed in 70% ethanol for 30 seconds under a laminar flow host. A pair of sterile fine forceps was used to hold the stems separately in the flame to extract excess alcohol. Then, small pieces of internal tissue (under the bark) were excised and placed on agar

Γ. μα 38484Β1 potato dexfrosee (PDA) with an actively growing isolate 620 of M. albus on one side of the dish fr om which a central well has been removed. In reality, this technique can be used to select other Muscodor isolates (Worapong et al., 2001a &amp; b). During an incubation period of two weeks, the Petri dishes were examined periodically for any fungal growth. Once hyphae were observed, the tips of the hyphae were septically cut from the agar and placed on fresh PDA. The isolate was obtained in this manner. Several Petri dishes (PDA) were used to determine if the fungus produced volatile antibiotics. This procedure included the steps of extracting an inch-sized section of the agar from the middle of the dish, spreading a nut of the isolate on one side and letting it grow for several days, and then spreading the test organisms on the other side of the opening.

Example lb [0100] Fungal taxonomy: the fungus by its nature is associated with A. ananassoides and it is a deuteromycete belonging to the order of mycelia sterilia. Whitish fungal colonies on all tested media when left out of direct light. Rosary fungal colonies on all media tested when exposed to direct light. No spore or other fruiting body was observed under any of the conditions. Hyphae (0.6 to 2.7 µm) commonly grow by branching, sometimes forming perfect coils (about 40 µm) and having bodies similar to cauliflower (3.5 to 14 µm) associated with them. The hyphae, which begin to develop, grow in an undulating pattern when they are observed in all conditions with all the media tested. The mycelium on the PDA covers the plaque in 3 to 4 weeks and produces a fruity odor.

Holotype: endophyte on A. ananassoides. Harvests have been made in the Bolivian Amazon in the Heath River region. The holotype comes from a single stem of A. annisoides, harvested in the Heath River country. A living culture is deposited under the name Muscodor crispans in the living mycological collection of the State University of Montana under the acquisition number 2347 (2/29/2008). The 18S rDNA and ITS (internal spacer arm transcribed) sequences of M. crispans (Β-23) were both delivered to GenBank under the assigned serial number -EU195297.

Teleomorph: the teleomorph of this fungus can be found in Xylariaceae, based on the similarity of the 18S rDNA genetic sequence data between M. crispans and the family Xylariaceae in the GenBank database (Bruns et al., 1991; Reynolds and Taylor 1993; Mitchell et al., 1995; Guano et al., 1999;

MY

38484Β1

Taylor et al., 1999). The molecular data of the 18S rDNA genetic sequences of

M. crispans reveals a 100 ٥ / o homology with isolate 620 from M. albus.

Etymology: the name of the genus, Muscodor, comes from the Latin word which means musty. This corresponds to the quality of the odor produced by the first three isolates of the genus. The name of the species is crispans, from the Latin meaning "curved, wavy". The hyphae grow in regular wavy patterns.

Example 2a [0104] Scanning electron microscopy. Scanning electron microscopy was performed on the isolate of Example 1 according to procedures described by Castillo et al. (2005). Pieces of agar and pieces of the host plant serving as support for fungal growth were placed in packets of filter paper and then placed in 2 ٥/٥ glutaraldehyde in 0.1 M sodium cacodylate buffer ( pH 7.2 to 7.4) with Triton X 100, a wetting agent, aspirated for 5 minutes and left overnight. The next day, the pieces were washed with 6 changes of water and 1: 1 buffer of 15 minutes, then a change of 15 minutes in 10% ethanol, a change of 15 minutes in ethanol at 30 ٥/٥, a 15 minute change in 50% ethanol, five 15 minute changes in 70 ٥/٥ ethanol, and were left overnight or longer in ethanol at 70%. Then they were rinsed six times for 15 minutes in 95% and then three 15-minute changes in 100% ethanol, followed by three 15-minute changes in acetone. The microbial material was thoroughly dried under critical conditions, spray coated with gold, and samples were recorded with an ESEM FEG XL30 in high vacuum mode using the Everhart-Thomley detector. The hyphae were measured using Image ل software available online.

Example 2b [0105] Fungal biology. The fungus produces a white mycelium on a water-based support. No fruiting structure or any kind of spore was observed under laboratory conditions. The hyphae tend to form curls. Other Muscodor species also have this tendency (Worapong et al., 2001a). The hyphae that are beginning to develop tend to grow in a wavy form rather than the typical straight pattern which intertwines curving up to form rope-like structures. This growth model can be useful as a diagnostic tool to identify this organism in in vivo inoculation studies. The fungus also produces cauliflower-like structures that appear to be

٢٦٢

38484Β1 connected to the hypha by small strands. These bodies do not germinate under any of the conditions and do not appear to be spores. This observation seems to be unique for Muscodor spp. and it has not been noted as being present in other fungal species in general.

Example 3a

101061 Fungal growth and storage. The isolate was determined not to produce a spore or a fruiting body when several pieces of carnation leaves were placed over a pushing activating isolate to encourage spore production, and none of these sfructres was observed after a week of incubation at 23 ٥c.

The fungus was also spread on several different media including cellulose agar (CA), malt extract agar (MA) and corn flour agar (CMA) to determine if the spore production would appear. With the exception of slower growth in some of the environments, no other characteristic of the fungus seemed different and no fruiting body or spore was observed.

Several methods have been used to store isolated mushrooms as a pure culture, one of which was the filter paper technique. The fungus was allowed to grow on PDA, and then it was cut into small dice which were placed in vials containing 15% glycerol and stored at -70 ٥c. The mushroom was also stored at 4٥ C by a similar process, using water instead of glycerol. However, the most efficient method of storage was on sterile barley seeds infested at -70 ٠c.

Example 3b [0108] Other more conventional characteristics of the isolated M. crispans were also examined and compared with M. albus. Muscodor crispans produced a dense white mycelium which grew slowly on all the tested media, except when placed in direct light, which caused the mycelium to develop a pink color. This contrasts with

M. albus which produces a whitish mycelium on all comparable media and under the conditions tested (Worapong et al., 2001a). Young hyphae also grew in a wavy, rather than the characteristic straight, cable-like manner as is commonly observed with M. albus (Strobel et al., 2001). No spores have formed on

The hyphae were of different diameters (0.8 to 3.6 µm) and often intertwined to make more complex structures and even windings of hyphae (Figures 1 to 3). These hyphae were generally larger than those of M. albus (Worapong et al., 2001a).

supports, including those containing host plant material or carnation leaves.

MY

38484Β1

Example 4

101091 Qualitative analyzes of volatile products. The method used to analyze gases in the airspace above a day culture of mycelium growing in Petri dishes was comparable to that used on the original isolate of M. albus strain cz-620 ( Strobel et al., 2001). First, a heated “solid phase micro-extraction” syringe (Supelco) consisting of 50/30 divinylbenzene / carburen on polydimethylsiloxane on a stable flexible fiber was placed through a small hole drilled in the side of the growing Petri dish fungal. The fiber was exposed to the vapor phase of the fungus for 45 min. The syringe was then inserted into the slitless injection port of a Hewlett Packard 6890 gas chromatograph containing an ID ZB Wax capillary column of 30 m X 0.25 mm with a film thickness of 0.50 mm . The column temperature was programmed as follows: 30 ° C for 2 min then 220 ° C at 5 ٠c / min. The support gas was ultra-high purity helium (local distributor) and the head pressure of the initial column was 50 kPa. Before trapping volatile products, the fiber was conditioned at 240 ° C for 20 minutes under a flow of helium gas. An injection time of 30 seconds was used to introduce the fiber sample into the GC. The gas chromatograph was interfaced with a mass selective detector 5976 from Hewlett Packard (mass spectrometer) operating in unit resolution. Data acquisition and data processing were carried out on the Hewlett Packard ChemStation software system! The initial identification of the compounds in the mixture of volatile products produced by the fungus was carried out by comparison with a library using the NIST database.

Example 5a

101101 Information relating to the isolation of fungal DNA and the acquisition of rDNA sequences ITS-5.8S. An evergreen culture of the present fungus, growing on PDA, was used as the DNA source after incubation at 25 ° C using! Rapid homogenization: Vegetable DNA amplification kit! (Cartagen; Washington,

USA). Some of the techniques used were comparable to those used to genetically characterize other isolates of M. albus from Australia (Ezra et al., 2004). Cultivated mycelium cubes (0.5 cm²) have been cut out from week-long cultivators. The agar was scraped from below the pieces, to exclude as much agar as possible. The pieces were placed in 1.5 ml Eppendorf flasks and incubated for approximately (my

38484Β1 minutes at -80 ٥c. Then, the DNA was extracted according to the instructions of the kit manufacturer. The extracted DNA was diluted (1: 9) in sterile, double-distilled water, and 1 μΐ samples were used for amplification by PCR. The rDNA sequence ITS1, 5.8S ITS2 was amplified by the polymerase chain reaction using the primers ITS1 (TCCGTAGGTGAACCTGCGGG) and ITS4 (TCCTCCGCTTATTGATATGC). The PCR procedure was carried out in a reaction mixture of 14 μΐ containing 1 μΐ of DNA extracted from the fungal culture (dilution 1: 9), 0.5 μΐ of ITS1 primer and 0.5 μΐ of ITS4 primer, 7 μΐ of RedMixTM plus the PCR mixture with 1.5 mM of MgCl (GeneChoice, Inc., Maryland, USA) and 5 μΐ of ddHO of PCR quality (Fisher Scientific, Wembley, Western Australia, Australia). The PCR amplification was carried out in a Biometra personal cycler (Goettingen, Germany): at 96 ٥c for 5 minutes then 35 cycles of 95 ٥C for 45 seconds, 50 ٥c for 45 seconds and 72 ٥c for 45 seconds, followed by a cycle at 72٥c for 5 minutes. The PCR products were examined using gel electrophoresis, on a 1.3% agarose gel for 30 minutes at 100 V with TAE buffer (GelXLUltta V-2 from Labnet International, Inc., ( Woodbridge, NJ, USA) or a GES cell system from Wealtec (Wealtec Inc., Georgia, USA). The gels were soaked in 0.5 pg ml-1 ethidium bromide solution for 5 minutes and then washed in distilled water for 5 minutes. The imaging of the gel was carried out under ultra-violet lighting in a Bio-Imaging system (model 2O2D; DNR-Imaging Systems, Kiryat Anavim, Israel). A PCR product of approximately 500 bp was purified using the UlttaClean PCR Clean Up DNA purification redhead (MO BIO Laboratories, Inc., California, USA). The purified products were sent for direct PCR sequencing. The sequencing was carried out on the two strands of the PCR product using the primers ITS1 and ITS4. Sequencing was performed using DYEnamic ET terminators on a MegaBACETMlOOO analysis system (Danyel Biotech Ltd., Rehovot, Israel). The footage was submitted to GenBank on the NCBI website. The sequences obtained in this study were compared to the GenBank database using BLAST software on the NCBI website.

Example 5b

01111 Molecular biology of Muscodor crispans. The partial sequences of 18S rDNA, ITSl, 5.8S, and ITS2 have been shown to be highly conserved regions of DNA and therefore very useful for the classification of organisms (Mitchell et al., 1995). These molecularly distinctive partial sequences of M. crispans were obtained and compared with the data in GenBank. After searching for rDNA sequences, my

38484Β1

18S, 525 bp of M. crispans were subjected to an advanced BLAST search. The results revealed a 100% identity with 525 bp of M. albus (AF324337). The comparative analysis of the partial rDNA sequences ITS 1 &amp; 2 and 5.8S of M. crispans retained ITS 1 and 2 of ط albus (Æ324336), M. roseus (ΑΥ034664), X enteroleuca CBS 651.89 (AFl 63033), Al arbuscula CBS 452.63 (AF163O29), and Hypoxylonfragiform (HFR246218) with homologies of 95, 95, 90, 90 and 91%, respectively.

Example 5c [0112] Although this invention is, in part, described in association with the new isolated fungi, it will be understood that the variants and mutants of these fungi, as will be understood in the art, are also contemplated in the art. context of the present invention. The terms “variant” and “mutant” can be defined according to the provisions of American patent η٥6,911,338, the entirety of which is incorporated herein by reference. Therefore, the present invention may relate to variants or mutants of the M. crispans strains and the corresponding compositions thereof.

Example 6a Biological assays for M. crispans against plant pathogens. The vapor of the volatile by-product of M. crispans was tested for the inhibitory activity against microbes using a relatively simple test, as described previously in the literature (Strobel, et al., 2001). An agar strip (2 cm wide) in a PDA Petri dish was removed and M. crispans was inoculated and left to grow on one side of the box for a week. Then the test fungus or test bacteria was inoculated on the other side of the Petti box, using small agar nuts for the mushrooms. The bacteria and yeasts were deposited in continuous bands on the agar (1.5 cm long). Then the box was wrapped with a piece of Parafilm and incubated at 23 ° C for 48 h. The effect of M. crispans on the growth of test organisms was determined first by verifying the presence or absence of growth where the inoculations had taken place. If growth was observed, diameter measurements at the two locations of the fungal hyphae were taken. The biological activity of the vapor on bacteria and yeasts was evaluated by estimating the extent to which their growth had been affected as a percentage of growth on a control dish (Sttobel et al., 2001). If no growth was observed, the test organism was aseptically removed from the test dish and inoculated on a dish of fresh PDA at a given time point after exposure to steam to determine viability. of the test organism.

٠ΜΑ 38484Β1 Using the above methodology, after M. crispans has been cultivated for 7 to 10 days at 23 ° C. on PDA, the volatile byproduct of the fungus has proved to be lethal for several fungi and bacteria. Gram negative and gram positive bacteria, as well as yeast and each of the major classes of fungi, were used as test organisms. Most test organisms were 100% inhibited and would die after 2 days of exposure to the byproduct of

Mr. crispans. (see Table 8). Some test organisms did not succumb to the volatile products of M. crispans after two days of exposure, but their growth was significantly inhibited by the volatile byproduct and they died after four days of exposure. Such organisms include Penicillium roquefortii, Bipolaris sorokiniana, Stagonospora sp., And Fusarium oxysporum, among others.

Table 8. Effects of the volatile side product of M. crispans on many fungal plant pathogens and some different bacteria. The inhibition values ​​were calculated as the inhibition of growth in% relative to an untreated control test organism. The tests were repeated at least 3 times with comparable results.

The inhibition of the test organisms was recorded 48 hours after exposure to the fungus and to the vapor of the volatile fungal by-product.

<td></td><td>Inhibition</td><td></td><td></td>

<td></td><td>(نره) after 48</td><td>Alive after</td><td>Alive after</td>

<td></td><td>hours</td><td>48 hours</td><td>96 hours</td>

<td>Test organism</td><td>exhibition</td><td>exhibition</td><td>exhibition</td>

<td>Alternarla helianthl</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Aspergillus fumigatus</td><td> 100</td><td>O</td><td>NOT</td>

<td>Bacillus subtilis *</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Bipolaris sorokiniana</td><td> 100</td><td>O</td><td>NOT</td>

<td>Botrytis cinerea</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Candida albicans *</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Cephalosporium gramineum</td><td> 100</td><td>NOT.</td><td>NOT</td>

<td>Ceratocystis ubni</td><td> 100</td><td>O</td><td>NOT</td>

<td>Coch olobolus carbonum</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Colletotrichum lagenarium</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Curvularia lunata</td><td> 100</td><td>O</td><td>NOT</td>

<td>Drechslera teres</td><td> 100</td><td>NOT</td><td>NOT</td>

ΜΑ 38484Β1

<td></td><td>Inhibition</td><td></td><td></td>

<td></td><td>(%) after 48</td><td>Alive after</td><td>Alive after</td>

<td></td><td>hours</td><td>48 hours</td><td>96 hours</td>

<td>Test organism</td><td>exhibition</td><td>exhibition</td><td>exhibition</td>

<td>Drechslera tr ttci-repentis</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Dreschlera portulacae</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Escherichia coli *</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Fusarium avenaceum</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Fusarium culmorum</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Fusarium oxysporum</td><td> 100</td><td>O</td><td>NOT</td>

<td>Fusarium solani</td><td> 50</td><td>O</td><td>O</td>

<td>Ganodermasp.</td><td> 100</td><td>O</td><td>NOT</td>

<td>Geotrichum candidum</td><td> 100</td><td> 0</td><td>NOT</td>

<td>Mycosphaerellafijiensis</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Penicillium roque otii</td><td> 100</td><td>O</td><td>NOT</td>

<td>Phytophthora cinnamomi</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Phytophthora palmivora</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Pythium ultimum</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Rhizoctonia solani</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Saccharomyces cerevisiae *</td><td> 90-95</td><td>NOT</td><td>NOT</td>

<td>Sclerotinia sclerotiorum</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Stagonosporasp.</td><td> 100</td><td>O</td><td>NOT</td>

<td>Tapesiayallundae</td><td> 100</td><td>NOT</td><td>NOT</td>

<td>Trichoderma viridae</td><td> 10</td><td>O</td><td>O</td>

<td>Verticillium dahliae</td><td> 100</td><td>O</td><td>NOT</td>

<td>Xanthomonas axonipodis pv citri *</td><td> 100</td><td>NOT</td><td>NOT</td>

* indicates that these organisms were spread out in continuous bands on the dish and that an indication of growth was made if a colony development had ended up taking place. After appropriate exposure to the volatile byproduct of M. crispans, the continuous band deposition area 5 was compared to growth on the control dish and estimated for 'MA

38484Β1 determine the inhibition in%. Finally, each organism was redeposited in a continuous strip on a PDA dish to assess viability.

Example 6b With reference to Table 8, the effect of the vapor of the volatile secondary product of M. crispans on gray rot is quite remarkable, in particular on 5. cinerea, which is the cause of gray mold on various plants. The inhibitory and lethal effects also apply to Botrytis went to the origin of the gray mold of the rot of the collar of the onion. Without limitation, such results suggest that the present invention can be used effectively to modify the surface area of ​​the product or the post-harvest storage atmosphere to prevent mold and associated problems. Likewise, these results support the use of a composition with CAA of the present invention to treat products such as onion (for example, Vidalia onions), shallots and garlic to prevent or control growth. fungal.

EXAMPLE 6c The vapor of the volatile products of M. crispans is also effective against many fungi which cause decomposition and fungal growth on cereals (for example, corn, wheat, barley, rice etc.), and present it. The invention can be used in combination with various fruits and vegetables such as potatoes, beets, carrots, sweet potatoes, such cereals, fruits or vegetables, before or after harvest, during storage or shipment. Therefore, the compositions and methods of the present invention can be applied to some of the major fungal problems in the fields of agriculture and food processing, and can be used to target organisms such as, but without limitation, Alternaria, Cladosporium,

Aspergillus, Penicillium, Diplodia, Fusarium Gibberella. (١.صد \ ة ٦, ةهة ؛ ٦.؟ تةلآ, اًةلآ

Example 6d [0117] Steam from the by-product of M. crispans was effective against the fungus Mycosphaerellafijiensis (see. Table 8). Consequently, the invention can be used as a treatment against black Sigatoka, a disease linked to fungi which affect bananas and plantains.

Example 6e [0118] The bacterial citrus canker threatens the very existence of the citrus industry in the United States. As shown in Table 8, the vapor of the by-product of M. crispans is effectively the pathogen responsible for canker Xanthomonas, MA

38484Β1 axonipodis ρ.ν. citri. Such results suggest that the compositions with CAA and associated methods of the present invention can be effectively used to treat seeds, seeds, orchards, equipment or apparatus (including, for example, workers' equipment and clothing) and / or fruits harvested to prevent, inhibit or control canker disease.

EXAMPLE 7 In the context of monitoring the tests and results of Example 6, biological tests with the vapor of the volatile secondary product of M. crispans were carried out with various other fungi and bacteria which are pathogenic in plants and humans ( see. Table 9, below). The fungus was cultured on X-dishes with PDA in a quadrant and incubated for 3 to 5 days at room temperature before inoculation with one or more test organisms. Control dishes were made at the time of inoculation and cultured on the same medium which was optimal for the individual test organism. Test organizations. Staphylococcus aureus 6538, Salmonella cholerasuis 10708, Escherichia coli 11229, S. aureus ATCC 43300 (MRSA) and Vibrio cholerae ATCC 14035, were cultured on Trypticase soy agar (TSA) in the remaining three quadrants of the X dish. Three dishes from each organism, with the appropriate controls, were exposed to the vapor of the side product of the fungus for approximately two, four and six days at room temperature. In order to verify the viability of the test microbe, the fungus was then physically extracted and the control and test dishes were placed in an incubator at 35 ± 1 ٥c for a minimum of three to four days, except Mycobacterium species which have been incubated for approximately an additional month. This was done to check whether the vapor of the by-product had inhibited or killed the test organism and the viability of the organism was assessed. The same protocol was followed for Yersinia pestis and Bacillus anthracis, except that the exposure times were modified to 3 and 5 days and Y. pestis was incubated at 28 ± 1 ٠c and in c٠2 at 5% after exposure to the fungus. Mycobacterium marinum ATCC 927 was cultured on agar 7Η11 (Difco Co) in the three remaining quadrants, using the same protocol indicated above and incubated at 33 ± 1 ° C. The three subsamples in the tests with each organism all behaved in the same way.

For all strains of Mycobacterium tuberculosis, also cultivated on 7Η11, an agar section was extracted from the dish and the fungus Β-23 (on 'PDA) was inserted. Then, the dishes were inoculated with a culture broth. Control μα 38484Β1 dishes, where there was no champigon present, were also incubated. At each designated time interval, a section of agar was removed from the dishes and transferred to a separate, empty dish and placed in an incubator at 35 ± 1 ٠c to determine the viability of the microbe. The dishes were placed in a plastic bag with moistened paper towels to prevent drying.

Pseudomonas aeruginosa 15442 and Burkholderia thailandensis 70038 were both cultured on TSA agar. They were left at room temperature for the optimum growth time for the organism and then moved to an incubator at 35 ± 1 ٥c and observed. It should be noted that all trials using human pathogens have been conducted under stringent biologically safe conditions and approved at the federal level. All tests on human pathogens have been repeated at least twice.

Table 9. Effects of the volatile by-product of M. crispans on different species of bacteria Gam ا and Gram The exposure times were varied depending on the particular organism in question and the viability of the test organism a been determined after this period (indicated as "growth" or "no growth").

Growth / none

<td></td><td>Type of</td><td></td><td>growth (in</td><td></td>

<td></td><td>wall</td><td>Time</td><td>presence of</td><td></td>

<td>Organization</td><td>cellular</td><td>exhibition</td><td>M. crispansj</td><td>comments</td>

<td>S. aureus 6538</td><td>Gram +</td><td>2,4 and 6 days</td><td>Any</td><td></td>

<td></td><td></td><td></td><td>growth</td><td></td>

<td>S. cholerasuis 10708</td><td>Gram</td><td>2,4 and 6 days</td><td>Any</td><td></td>

<td></td><td></td><td></td><td>growth</td><td></td>

<td>م. aeruginosa 15442</td><td>Gram -</td><td>2 days</td><td>Growth</td><td>No difference</td>

<td></td><td></td><td></td><td></td><td>visible between dishes</td>

<td></td><td></td><td></td><td></td><td>presentations and witnesses.</td>

<td>M. marinum cc 9ΤΙ</td><td>acid-</td><td>2, 4 and 6 days</td><td>Any</td><td></td>

<td></td><td>resistant</td><td></td><td>growth</td><td></td>

<td>B. thailandensis ٦٠%</td><td>Gram</td><td>2 days</td><td>Growth</td><td>No difference</td>

<td></td><td></td><td></td><td></td><td>visible between dishes</td>

<td></td><td></td><td></td><td></td><td>presentations and witnesses.</td>

<td>5. aureus AC 43300</td><td>Gramt</td><td>2, 4 and 6 days</td><td>Growth</td><td>No real colony</td>

<td>(MRSA)</td><td></td><td></td><td></td><td>only formed</td>

<td></td><td></td><td></td><td></td><td>a growth</td>

<td></td><td></td><td></td><td></td><td>slightly film-coated.</td>

<td>£. co / - 11229</td><td>Gram</td><td>2,4 and 6 days</td><td>Growth</td><td>No difference</td>

<td></td><td></td><td></td><td></td><td>visible between dishes</td>

<td></td><td></td><td></td><td></td><td>presentations and witnesses.</td>

<td>V. cholerae ATCC 14035</td><td>Gram -</td><td>2, 4 and 6 days</td><td>Growth</td><td>Growth in</td>

days 4 and 6 of exposure appear to be slightly inhibited compared to control dishes.

MY

38484Β1

<td></td><td></td><td></td><td>Growth/</td>

<td></td><td></td><td></td><td>any</td>

<td></td><td>Type of</td><td></td><td>growth (in</td>

<td></td><td>wall</td><td>Time</td><td>presence of</td>

<td>Organization</td><td>cellular</td><td>exhibition</td><td>M. crispans)</td>

<td>Y. pestis 91-3365</td><td>Gram</td><td>3 and 5 days</td><td>Any</td>

<td></td><td></td><td></td><td>growth</td>

<td>"Anthracis Α2084</td><td>Gramt</td><td>3 and 5 days</td><td>Growth</td>

comments

Only a few colonies remain after exposure and when incubated, others have developed.

<td>M. tuberculosis 3081 (resistant</td><td>acid-</td><td>2,4, 7 and 14 days</td><td>Any</td>

<td>àl'isoniazide)</td><td>resistant</td><td></td><td>growth</td>

<td>M. tuberculosis</td><td>acid-</td><td>2, 4, 7 and 14 days</td><td>Any</td>

<td>50001106 (resistant to</td><td>resistant</td><td></td><td>growth</td>

<td>streptomycin)</td><td></td><td></td><td></td>

<td>M. tuberculosis</td><td>acid-</td><td>2,4, 7 and 14 days</td><td>Any</td>

<td>59501228 (resistant to</td><td>resistant</td><td></td><td>growth</td>

<td>streptomycin / ethambutol)</td><td></td><td></td><td></td>

<td>M. tuberculosis</td><td>acid-</td><td>2, 4, 7 and 14 days</td><td>Any</td>

<td>59501867 (likely)</td><td>resistant</td><td></td><td>growth</td>

As shown in Table 9, the four acid-resistant bacteria (strains of Mycobacterium tuberculosis) were all killed after an exposure of 2, 4, 7, and 14 days to M. crispans in active growth (culture of 6 10 days). The other bacteria that were killed after at least 2 days of exposure to M. crispans were: Staphylococcus aureus m, Mycobacterium marinum. Yersiniapestis, and Salmonella choleraesuis. The following were minimally affected or not affected at all by exposure to M. crispans: Pseudomonas aeruginosa, Burkholderia thailandensis, Staphylococcus aureus QfÀ١, Escherichia coli, Vibrio choiera and Bacillus anthracis. However, the growth of 5 '. aureus (MRSA) was only a viscous film rather than separate colonies and was affected by M. crispans cov. In addition, there were only a few colonies left in B's dish. anthracis on the display dish, but several colonies grew after the withdrawal of M. crispans and the subsequent incubation. Therefore, it is suspected that the vapor of M. crispans from the by-product is only effective against vegetative cells of B. anthracis, but not against spores. One month after the last observation time (14 days), no growth was observed on the dishes exposed to the fungus and growth was observed on all the control dishes.

The experiments of the following examples illustrate various embodiments of the compositions of the invention and the utility of the latter. A representative composition, without limitation as to the quantity, concentration or proportion of, MA

38484Β1 components, is provided in Table 10. In certain embodiments, an amount of isobutyric acid can be replaced by propanoic acid at the same level or at about the same level. In some of these or other embodiments, the ethanol can be replaced with acetic acid and / or 2-butanone can be replaced with either acetic acid or propanoic acid. Also, various esters can be replaced by isomers or homologs (for example, without limitation, a 2-methylbutyl ester of propanoic acid with a 3-methylbutyl ester thereof) of the esters listed. The results observed in the following examples were obtained with a composition of the compounds listed in Table 10. In accordance with this, various other compositions can be used with a comparable effect.

Table 10. Composition of food compounds and flavorings useful in the control of harmful microorganisms.

<td>Compose * in a series of CAA</td>

<td>acetaldehyde</td>

<td>Ethyl acetate</td>

<td>2-Butanone</td>

<td>Propanoic acid, 2-methyl-, methyl ester</td>

<td>Ethanol</td>

<td>Acetic acid, 2-methylpropyl ester</td>

<td>Propanoic acid, 2-methyl-, 2-methylpropyl ester</td>

<td>l-Propanol, 2-methyl-</td>

<td>l-Butanol, 3-methyl-, acetate</td>

<td>Propanoic acid, 2-methyl-, 2-methylbutyl ester</td>

<td>1-Butanol, 3-methyl-</td>

<td>Propanoic acid, 2-methyl-</td>

<td>Acetic acid, 2-phenylethyl! ester</td>

* Each of these compounds is present as a liquid at room temperature and can be used with each other to provide a liquid composition which readily volatilizes at ambient temperatures or temperatures and pressures which otherwise allow volatilization.

Composition with CAA used for the control of plant diseases.

Example 8a The relative ability of the CAAs to inhibit and kill the test organisms was measured. Test solutions were prepared by placing the compounds in vials. The test mixture (20 microliters) was placed in a previously sterilized micro-dish (4 × 6 mm) located in the center of a Petri dish containing PDA. When not in use, the mixture was stored at 0 ٥c. Test organisms (as listed in Table 9), freshly growing and excised on 3 mm agar blocks³ (at least 3 agar blocks per test mushroom), were placed at a distance of 2 to 3 cm from the (MA

38484Β1 micro-cut and the dish wraps with two layers of Parafilm. The measurements were taken on the mycelial growth from the edge of the agar blocks after a given period of time. However, in the case of Geotrichum candidum they were deposited in a continuous band and were observed to verify the presence of any new visible growth and viability by a new deposition in continuous band from the initial surface of the agar plate which had been inoculated. Appropriate controls were also formed, in which no test solution was placed in the micro-section. Tests on 20 μΐ of the CAA mixture have been carried out at least twice with comparable results.

Example 8b The viability of the test microbes was achieved by aseptically removing the small block of agar and placing it on a PDA dish and observing the growth after 1 to 3 days or by re-depositing Geotrichum candidum in continuous strip on a fiaiche PDA dish. In this way, the viability of the microbes could be assessed. The results shown in Table 1a indicate that the organisms listed below are all inhibited by the composition with particular CAA and in most cases filtered by exposure to it. They include Aspergillus niger, Penicillium sp. on cheese, Cercospora beticola, Verticillum dahaliae, Pythium ultimum, Phytophthorapalmivora, Mycophaeraellafijiensis, Rhizoctonia solani, Aspergillusfumigatus, Geotrichum candidum, Trichoderma viridi, Ganoderma sç., Curvularia ٦١ &lt;؟ and Botrytis alli. خلتغشم, when eWe is applied correctly, a composition with CAA has the ability to control these pathogens. Such results indicate that many other pathogens can be either inhibited or filtered out by this mixture.

Table 1 la. A brief list of various plant pathogens with their sensitivities to a composition with CAA representative of the present invention, with exposure to 20 microliters of the mixture for 2 days at 23 ° C on dextrosed potato agar ( PDA) in a Petri dish seals with Parafilm. The agar nuts with the test microbe were finally tested to detect viability after reettage and placement on a regular Petri dish of PDA.

<td>Test organism</td><td>Effect on growth</td><td>Alive or dead after 48 h</td>

<td>Aspergillus niger</td><td>No growth</td><td>death</td>

<td>Penicillium sç. SOI لمه cheese</td><td>95% inhibition</td><td>Living</td>

<td>Cercospora beticola</td><td>No growth</td><td>death</td>

<td>Verticillum dahaliae</td><td>No growth</td><td>death</td>

<td>Pythium ultimum</td><td>No growth</td><td>death</td>

<td>Phytophthora palmivora</td><td>No growth</td><td>death</td>

<td>Mycophaeraella fijiensis</td><td>No growth</td><td>death</td>

MY

38484Β1

<td>Test organism</td><td>Effect on growth</td><td>Alive or dead after 48 h</td>

<td>Rhizoctonia solani</td><td>No growth</td><td>death</td>

<td>Aspergillus fumigatus</td><td>No growth</td><td>death</td>

<td>Geotrichum candidum</td><td>No inhibition</td><td>Living</td>

<td>Trichoderma viridi</td><td>60% inhibition</td><td>Living</td>

<td>Ganoderma sp</td><td>No growth</td><td>death</td>

<td>Curvulariasp</td><td>No growth</td><td>Living</td>

<td>Botrytis alli</td><td>No growth</td><td>death</td>

Example 8c With regard to the data in Table 11a, the activity profile of the composition with CAA used indicates, in several cases, a different and / or improved antimicrobial effect, compared to M. crispans and to vapors of the volatile by-product thereof.

Example 8d As regards the previous example and using comparable techniques and procedures, the same pathogens were treated with propanoic acid vapors. The results compared are shown in Table 1b, below, the data in Table 11a being reproduced in columns A and B, and the observed effects of propanoic acid, alone, being provided in column c ( inhibition in%). At 20 μΐ, the amount of propanoic acid is comparable to a level of propanoic acid in certain embodiments of the present invention. Propanoic acid is representative of various isolated compounds of the prior art known to have a certain antimicrobial effect. However, as demonstrated by the comparative data in Table 1b, the present compositions provide new and synergistic results superior and beyond those which could be expected independently of a compound isolated from the prior art. outside the context of the present invention. As shown here, although the prior art is at best simply an inhibitor, the compositions of the invention eliminate (i.e., kill) many of the pathogens tested. Similar results can be obtained by comparison with other isolated compounds / compositions of the prior art.

Table 1 lb. Compared results showing improved antimicrobial activity compared to propanoic acid.

<td>Test organism</td><td>Effect on growth (A)</td><td></td><td>Alive or dead after 48 h (B)</td><td>Propanoic acid alone 20 pl after 24 h (VS)</td>

<td>Aspergillus niger</td><td>No growth</td><td></td><td>death</td><td>0% Alive</td>

<td>Penicillium sp. on some</td><td>95٥ / ο inhibition</td><td></td><td>Living</td><td></td>

, ΜΑ 38484Β1

<td>Test organism</td><td>Effect on growth (A)</td><td></td><td>Alive or dead after 48 h (B)</td><td>Propanoic acid alone 20 μΐ after 24 h (VS)</td>

<td>cheese</td><td></td><td></td><td></td><td></td>

<td>Cercospora beticola</td><td>No growth</td><td></td><td>death</td><td>75% Alive</td>

<td>Verticillum dahaliae</td><td>No growth</td><td></td><td>death</td><td></td>

<td>Pythium ultimum</td><td>No growth</td><td></td><td>death</td><td>80% Alive</td>

<td>Phytophthora palmivora</td><td>No growth</td><td></td><td>death</td><td>100% ND *</td>

<td>Mycophaeraella fijiensis</td><td>No growth</td><td></td><td>death</td><td></td>

<td>Rhizoctonia solani</td><td>No growth</td><td></td><td>death</td><td>80% Alive</td>

<td>Aspergillus fumigatus</td><td>No growth</td><td></td><td>death</td><td>0% Alive</td>

<td>Geotrichum candidum</td><td>No inhibition</td><td></td><td>Living</td><td>0% Alive</td>

<td>Trichoderma viridi</td><td>60 ٥/٥ inhibition</td><td></td><td>Living</td><td></td>

<td>Ganodermasp</td><td>No growth</td><td></td><td>death</td><td></td>

<td>Curvulariasp</td><td>No growth</td><td></td><td>Living</td><td></td>

<td>Botrytis alli</td><td>No growth</td><td></td><td>death</td><td>0% Alive</td>

* 100 ٠/٠ inhibition, but viability not determined (ND).

Use of the compositions with CAA name to treat tuberculosis and other human pathogens

EXAMPLE 9a [0128] Four strains resistant to clinical drugs of isolates of

M. tuberculosis (5901867, 50001106, 59501228 and 3081) were exposed to a composition with CAA. For each isolate, 10 µL of the culture was placed in the middle of a 7Η11 agar dish and then spread evenly over the entire surface of the dish with a sterile plastic loop. 0.65 ml microcentrifuge tube sections (micro sections) were cut and autoclaved at 121 ° C for 15 minutes inside an autoclavable tube with a screw lid. Three dishes for each isolate were prepared and 5, 10 or 20 µL of CAA were placed in each of the three micro-sections of the respective dishes.

The dishes were then placed in a zippered plastic bag with a damp paper towel and incubated at 36٥ CIC for approximately 28 days. After about 48 hours, the micro-section was removed and discarded and the dishes were returned to the incubator.

MY

38484Β1

The paper towels were checked frequently and re-wetted to prevent dehydration of the medium. All of the control dishes showed growth. All the pl.ats which had been exposed to 5 and 10 μL of volatile products revealed growth. Only one isolate (50001106) exposed to 20 L of volatile product showed growth. It should be noted that each M. tuberculosis isolate is a strain of this organism that is resistant to clinical drugs. All the experiments were carried out under laboratory biological safety conditions approved by the United States Government.

The control dishes and the dishes exposed to 5 and 10 μL of volatile products were prepared on 04/14/08. The dishes exposed to 20 pL of volatile products were prepared on 04/22/08. All dishes have been checked several times. The final verification was carried out on 05/19/08 and these organisms which did not survive are indicated in Table 12 by "-". Table 12. CAA inhibitory effects on growth of drug-resistant M. tuberculosis

<td>M. tuberculosis isolate</td><td>5 μι</td><td>10 pL</td><td>20 pL</td>

<td> 5901867</td><td> +</td><td> +</td><td> —</td>

<td> 50001106</td><td> +</td><td>ب</td><td> +</td>

<td> 59501228</td><td> +</td><td>t</td><td> --</td>

<td> 3081</td><td>t</td><td> +</td><td> --</td>

The real effects of a composition with CAA of the present invention on another strain of TB are shown in Figure 1: Lethal effect of CAA on a strain (110107) of M. tuberculosis. The left dish is a control dish which has not been treated with 20 microlites of CAA for 48 hours, while the right dish has been treated for 48 hours. The two dishes were then incubated for 28 days at 36 ° C. It is evident from these experiments that the AACs were able to kill 3/4 of the drug resistant isolates of M. tuberculosis. From now on, a prospect is emerging for animal trials then human trials using compositions with CAA in the treatment of tuberculosis.

Example 9b [0131] According to the data of the previous example, more general aspects of the present invention can be demonstrated. Viable cultures and suitable media are prepared using materials and techniques well known to those skilled in the art. For example, exposure to a CAA composition of the present invention (for example, by direct contact with a liquid composition or by vapors thereof) may result in inhibition of the growth or death of coliform bacteria (gram staining

0ΜΑ

38484Β1 and morphology): Escherichia coli (gram negative, stick), Salmonella enteritidis (gram negative, stick). Pseudomonas aeruginosa (gram negative, stick). Staphylococcus aureus (gram positive, coccidia) and Listeria monocytogenes (gram positive, stick).

Likewise, such results can also be obtained and demonstrated with various other gram negative and / or gram positive bacteria such as, but without limitation. Bacillus cereus (Gram positive, rod) and Clostridium botulinum (Gram positive.

rod).

Example 10 The IC was calculated for some of the test organisms which were tested against an artificial composition to mimic the volatile side product of M. crispans. (see. Table 1.) With respect to Table 12, all test organisms were 100% inhibited with the use of 15 µL of the artificial mixture and several of them were killed with as little as 10 pL. Verticillium dahliae, Botrytis cinerea and Aspergillusfumigatus were not killed by even the largest volume of the mixture (30 pL), but all three were inhibited at 100 ٥/٠ with 10 or 15 pL of the test mixture. The most sensitive organism was Pythium ultimum, which was killed with 10 pL and inhibited at 100 نره with 2.5 pL, so the cio values ​​do not necessarily reflect the lethal capacity of volatile products like p. ultimum and Botrytis cinerea both have almost identical CIs, but one was killed and the other was not (Table 13).

Table 13. cio of the artificial mixture of the components of the volatile by-product of M. crispans on various plant pathogens. Amounts of the mixture, varying from 1 µL to 30 µL, were added to a sterile plastic well in the center of the test dish and the pathogens were placed around the edge of the plate. Viability was assessed after 48 hours and compared to a control dish with no mixture added but with the sterile well in place. Any organism that showed no growth after this period was considered to be 100% inhibited, while those that showed no growth after 48 hours and no growth after isolation on PDA immediately after the 48 hour evaluation were considered to be dead. The CIO calculation was determined by dividing the amount of the artificial mixture necessary to cause inhibition at 50 ٥/٠ (in pL) by the total air space in the Petri dish (50 mL).

<td></td><td>Minimum volume for</td><td></td><td></td>

<td></td><td>cause inhibition to</td><td>Volume to talk</td><td></td>

<td>Test organism</td><td>100% (pL)</td><td>death (pL)</td><td>Cl 50 (pLmL٠]</td>

<td>Pythium ultimum</td><td> 2.0</td><td> 10.0</td><td> 0.030 ±0.004</td>

<td>Phytophthora cinnamomi</td><td> 5.0</td><td> 30.0</td><td> 0.056 ±0.009</td>

<td>Sclerotinia sclerotiorum</td><td>n / A</td><td> &gt;30</td><td> 0.15 ±0.016</td>

<td>Botrytis cinerea</td><td> 10.0</td><td> &gt;30</td><td> 0.035 ±0.004</td>

,MY

38484Β1

<td></td><td>Minimum volume for</td><td></td><td></td>

<td></td><td>cause inhibition to</td><td>Volume to talk</td><td></td>

<td>Test organism</td><td>1OO0 / 0D</td><td>death (pL)</td><td>Cl 50 (pLmL¹</td>

<td>Rhizoctonia solani</td><td> 20.0</td><td> 15.0</td><td> 0.039 ±0.006</td>

<td>Aspergillus fumigatus</td><td> 2.0</td><td> 20</td><td> 0.031 ±0.003</td>

<td>Verticillvum dahlias</td><td> 5.0</td><td> &gt;30</td><td> 0.062 ±0.004</td>

<td>Phytophthora palmwora</td><td> 1.0</td><td> 5.0</td><td> &lt;0.02</td>

Use of a Composition with CAA for the treatment of refuse to control microbial decomposition.

Example 11

0134] An artificial mixture of items, which would normally be considered garbage, was assembled in two ammunition boxes. These items consisted of grain waste, pieces of flowers, meat waste, newspaper fiber and various other waste. A small beaker containing 0.2 ml of the above-mentioned CAA composition was placed in a crate. In the other case, a beaker was placed without CAA. The two cases were incubated for 10 days at 80 ٥ F. At the end of this period, the funds were opened and examined. It was evident that no decomposition had taken place in the box containing the CAA. In addition, the test case had completely transformed into an enormous amount of decomposition. The use of the composition with CAA for the treatment of garbage is an opportunity to keep the garbage intact and prevent it from decomposing in transit to installations around the world which ferment garbage into products associated with energy such than methane. Figure 4 illustrates that the composition with CAA protected the garbage against microbial decomposition under the conditions of this experiment.

Use of a Composition with CAA for the treatment of cheese to control fungal decomposition

Example 12 A bottle containing 10 ml of the above-mentioned CAA composition was incorporated into or with and / or used to dip a 10 by 10 inch piece of Saran® clear plastic packaging. The plastic packaging was been soaked in the composition with CAA for 6 days, dried by suspension and then used to package the piece of cheese carefully inoculated with a cheese strain Penicillum sp. In another experiment, the piece of cheese was inoculated with the mushroom, then wrapped with ordinary Saran® packaging and then injected with 10 microliters of CAA.

.MY

38484Β1

Appropriate controls are shown in the illustration above with Penicillium sp. only, with package treated only, CAA only and control (no treatment). The cheese pieces of the experiment were incubated for 1 week at room temperature and then portions of each cheese item were tasted by laboratory staff. It should be noted that there was no negative effect due to storage in this manner with an alteration in the taste of the cheese compared to a piece of freshly cut and fresh cheese which had been stored in the refrigerator. The piece of cheese completely infested with mushrooms was not eaten. It is obvious from Figure 2 that the use of a composition with CAA under the package or with the treated package caused the almost complete protection of the piece of cheese against the decomposition and colonization of the cheese by Penicillum.؟ p. This was true with the treated packaging and with the injection of 10 microliters of CAA under the cheese wrapped with ordinary Saran.

Use of a composition with CAA for the treatment of pieces of food or plants (for example, plant product) to control fungal decomposition

Example 13a [0136] Several yams were obtained for these experiments. It was thought that microbes contaminating the surface and causing possible decomposition would be abundant enough for the inoculum. Thus, two pieces of yam were placed in a plastic box whose lid was closed in the presence of a small beaker containing 0.2 ml of CAA. The control box contained a beaker without CAA. Then the sealed boxes were kept at room temperature for the day and then examined. It was evident that no surface and deeper contamination had developed on the treated yam pieces, while the control yams developed multiple areas of surface stains and the beginning of decomposition as shown in Figure 3 : the untreated yam is found on the left and the one on the right has been treated with CAA. Note the large area of ​​fungal decomposition on the upper end of the yam on the left.

EXAMPLE 13b As an associated end-use application, a composition with CAA and / or a component thereof can be applied to harvested fruits or vegetables to compensate for the withdrawal of any natural, waxy or protective coating on those -the. For example, harvested squash and similar products, with cut stems, can be sucked with a composition with CAA (for example, with an application by ، MA

38484Β1 spray) to control / inhibit microbial growth, improve marketability and extend shelf life.

Example 14 A composition with synthetic CAA of the present invention, in accordance with the compositions of the kind described in Tables 2 to 7 and 10, supported the comparison with the use of live M. albus for controlling seedling diseases. sugar beet (Beta vulgaris L.) caused by Pythium ultimum, Rhizoctonia solani AG 2-2 and Aphanomyces cochlioides, and root gall nematode, Meloidogyne incognita, on tomatoes (Lycopersicon esculentum). The synthetic composition provided control of seedling loss equal to a starch-based presentation of the live fungus for the three sugar beet pathogens and significantly reduced the number of root galls on tomato roots. Studies of reports with the composition with CAA used revealed that concentrations of 2 μΐ / em³ and 0.75 μΐ / cm³ of a soil medium / support component provided good control of rhizoctonia and damping-off of pythium seedlings, respectively, of sugar beet. A concentration of 5 μΐ / crn³sand provided 100% mortality in 24 hours for 44. incognita. In comparison, using in vitro studies, the same biorational ratio provided fewer root galls than a presentation of ground barley infested with M. albus applied to 5 g / l of sand.

Example 15 [0139] Corynebacterium michiganese causes serious loss of tomatoes due to wilting and tissue rot. An authentic culture of this bacteria was spread in continuous strips on culture broth agar and a small cup was placed in the middle of the dish. Into the section were placed 20 microliters of an artificial CAA composition of the present invention prepared in the laboratory. A control dish did not contain a composition with CAA. The dishes were incubated for 24 h, then examined. There was no growth of the bacteria on the flat treated with CAA. (see, Fig. 5.) As such, a CAA composition of the present invention can be used, without limitation, to treat seeds, plants or tomato products. Alternatively, a composition with CAA can be mixed with water as a soil drench solution before transplanting.

Example 16 [0140] With reference to the foregoing and in accordance with several of the following examples, a range of CAA compositions of the present invention can be used.

38484Β1 either prophylactically or in the treatment of active disease states, such diseases including, without limitation, diseases affecting sugar beet, tomato, onion, cereals, banana and plantain, and crops citrus among others.

More generally, the compositions and methods present can be oriented towards the treatment and improved viability of seeds, plants, products and / or associated food products; whether prophylactically or in the presence of fungal or bacterial microbes, regardless of the stage of their life cycle (eg zoospore etc.), development, growth or extent of infection. Consequently, as will be understood by a person skilled in the art, such compositions can comprise and / or be applied, regardless of the form (for example powder, granules, liquid, mist, suspension, vapor, pastes, gels, coatings etc.), on the surface or in contact with a seed, seedling or plant (for example, roots, stems, leaves etc.) or product of these (for example, either before or after harvest).

Example 17 [0142] The compositions with CAA and / or components thereof, either alone or as they can be incorporated into various other compositions, can be used in a range of end use applications in industry poultry, the food industry and the associated food industry. Several of these nonlimiting applications are provided in the following examples.

Example 17a [0143] A CAA composition of the present invention, in accordance with the compositions of the kind described in Tables 2 to 7 and 10, is used to treat a range of egg products including, but not limited to, whole egg and liquid whole egg, fortified whole egg and liquid fortified whole egg, salted whole egg and liquid salted whole egg, sweet whole egg and liquid sweet whole egg and mixtures of these products, whether liquid or not, with sugar, syrup solids, syrups, dextrose and dextrins and / or gums and thickeners, in conjunction with scrambled egg mixtures and liquid scrambled egg mixtures, reduced cholesterol egg products and liquid products and mixtures thereof, and associated products containing less than about 10% or so of egg solids, shell eggs and egg components including but not limited to cholesterol-free egg yolk. These terms will be understood by a person skilled in the art and have the standard meaning according to regulatory and accepted industry usage.

MY

38484Β1

EXAMPLE 17b Likewise, various compositions with CAA of the present invention, including without limitation, those using propanoic acid as an at least partial replacement for isobutyric acid, can be used in the preparation and / or packaging of liquid egg products with an extended shelf life (ESL), including without limitation whole egg, scrambled mixtures, egg yolk and liquid products of egg whites and yolks.

Example 17c Similarly, various compositions with CAA of the present invention can be used in the treatment of empty, broken eggshells. As will be understood in the art, using available treatment techniques and equipment, a composition with CAA and / or a component thereof, alone or incorporated into another composition, can be applied (e.g., sprays) on empty shells before further processing, for example into a nutriceutical. Likewise, one or more compositions of the present invention can be applied or incorporated or otherwise used to transform poultry carcasses, meat or an associated cam product, using the apparatuses and techniques known in the art. By extension, a person skilled in the art will understand that the present invention can also be used with other types of animal carcass, meat, processed cam products and all other forms of animal flesh (for example, mammals, birds, fish , snails, clams, crustaceans, seafood and other edible species), as illustrated in one or more of the following examples.

Example 17d [0146] Following on from the previous example, such a composition with CAA can be incorporated into such a processed nutriceutical product (for example, capsules or tablets based on plants or spices) to inhibit bacterial growth. fungal.

Example 17e Although the previous examples illustrate various downstream processing applications, the present invention can be more widely used in the context of egg and poultry production. Without limitation, the compositions with CAA or associated components of the present invention can be introduced into any poultry or egg production installation and / or applied on any equipment or machines

38484Β1 associated with that one. For example, aerial or surface treatment of a henhouse or brooding / laying facility can control, reduce and / or inhibit atmospheric contaminants or deposited on the surface and subsequent microbial growth on that surface.

Example 18 A composition with CAA or one or more components thereof can be incorporated into various other processed food products, including food products having water-related activity that otherwise maintains microbial growth. For example, such a composition or component can be incorporated into humus, peanut butter and other spreads, dips and mixtures. With regard to the peanut culture and processing industries, the compositions and associated components of the present invention can be applied to peanuts before and after breaking the shells, after an initial washing of the peanuts, on a processed product. combination (eg, peanut butter) and / or on packaging equipment and packaging materials.

Example 19 [0149] Likewise, a composition with CAA / a component of the present invention (for example, one or more compositions of Tables 2 to 7 and 10, above, or variations of the kind described herein) can be used in the form of, or incorporated into, various skin care or skin care products, regardless of presentation (e.g., lotion, ointment, cream, etc.).

Example 19a [0150] For example, acne is commonly caused by one or more species of bacteria which invade the follicles of the skin. To demonstrate further use of the present invention, an aqueous presentation of a CAA composition of the present invention comprising substitution with propanoic acid was prepared and used to treat a teenage boy with acne related to 'age. One application every three days for three days significantly reduced, by visual observation, the number and intensity of acne-related lesions.

Example 19b To demonstrate another use of the present invention in the context of a personal care and / or health care product, a CAA composition of the present invention was incorporated (at about 2% by weight) in one, my

38484Β1 representative over-the-counter skin cream preparation. With reference to FIG. 6, a dish of PDA was prepared and incubated for one day with a control cream (without composition or CAA component), at the top left; a control cream contaminated with bacterial cells, top right; a cream "treated" with a composition with CAA, bottom gacuhe; and a cream treated with a bacterial composition, bottom right. As noted, bacterial growth in such a skin cream product has been prevented by incorporating a modest concentration of a CAA composition of the present invention.

Example 20 [0152] Likewise, the present invention can be used in association with a range of hygiene, care and treatment products for the mouth. Without limitation, the following examples demonstrate such use of a composition with CAA comprising substitution with propanoic acid of the kind described above. Alternatively, various other compositions with CAA may be used, in accordance with the compositions of Tables 2 to 7 and 10, above, or variations thereof as described elsewhere herein.

Example 20a For example, to illustrate such an oral care / hygiene product, an oral bath / rinse product was shaped using approximately l٥ / o of such a composition with CAA. Such a product was prepared by incorporating such a composition with CAA into a commercially available over-the-counter oral bath / rinse product. The CAA compositions of the present invention, regardless of concentration or dose level, can also be incorporated into a toothpaste / gel for the teeth or an associated oral, dental, gum or mouth care product.

Example 20b [0154] Lichen planus (LP) is an autoimmune skin disease which appears inside the mouth or on other mucous membranes. As the membranes become unstable, bacteria or fungi can settle in these areas and cause pain, redness, infection, bleeding and swelling of the tissue. In order to reduce the cause of the external involvement of bacteria in this disease, a mouthwash product was prepared which contained a 1% aqueous solution of such a composition with CAA. The patient's mouth was rinsed two to three times daily for, MA

38484Β1 at least 3 to 4 minutes and then emptied. The photos were taken before the treatments were applied and after three weeks of treatment. After 3 weeks, the results revealed an almost total reduction in redness of the gums, accompanied by an almost total reduction in oral and gingival pain as well as a return to an almost normal color of the gums and other mucous membranes. The patient reported almost complete cessation of bleeding pain and better LP relief compared to previous experience.

Example 20c [0155] A 1% solution of the above-mentioned CAA composition in an over-the-counter mouthwash was used to reduce plaque and to treat other problems arising from bacteria associated with oral problems. Daily use, with 3-4 mouthwashes per day for two months, has resulted in little or no buildup of dental plaque. The gums that were originally described as red, swollen and bleeding easily (from notes taken by the dentist) now appeared to be normal in color and no longer bleed when examined with the probe instrument.

Example 20d [0156] To confirm the effectiveness of such a composition with CAA, the oral saliva of the preceding example was placed on one side of a nutritive agar dish, the saliva of a bath of commercially available mouth without CAA was placed on the other side of the same dish and unswashed saliva was placed on another dish. Then the saliva was incubated for two days. By comparison: the non-rinsed saliva had a high bacterial load; the saliva rinsed without the CAA had, as might be expected, a reduced bacterial load; but the CAA-rinsed saliva did not contain any detectable bacteria.

Example 20e In another example, a stomatological surgeon tested a composition with CAA (for example, 1% of a commercially available rinse / bath product) before an oral surgical intervention. The patient placed untreated saliva on an agar dish (nutrient agar), rinsed with the CAA rinse solution and placed this saliva on another agar dish. After two days of incubation, there were no longer any bacterial colonies SUT the dish containing the rinse aid containing CAA, indicating

MY

38484Β1 use before and after oral surgery to treat or inhibit dental and other oral infections.

Example 21 [0158] Mastitis in milk cows is caused by a complex of bacteria associated with the udder. In accordance with various non-limiting embodiments of the present invention, a composition with CAA or a composition with CAA modified with a rhamnolipid of the kind described below can be applied to the udder at the time of milking to reduce the prospect of bacterial infections and contamination of the dairy product.

Example 22 Various compositions with CAA of the present invention can be used to reduce the microbial loads on biofilms important from the industrial / medical point of view. With regard to the latter, articles ranging from dentures to artificial joints can be treated with a CAA composition of the present invention prior to surgical implantation.

Example 23 The compositions with CAA of the present invention can be used to control the fungal and bacterial decomposition on clothes, in particular those exposed to wet environments (leather clothes, shoes, boots, straps, laces, hangers) . For example, the application of 0.2 ml of a composition with 1% CAA of the kind described above was placed in boots which had been completely wet. The boots were locked up to maintain the resulting vapors for a few hours, and then exposed to dry air. The results showed no decomposition and the boots dried without residual moldy odor.

Example 24 The compositions of the present invention can comprise various CAA components and can be shaped as will be understood by a person skilled in the art having familiarized with the present invention. Without limitation, regardless of the end use application or treatment, one or more of the CAA components present and / or associated compositions can be incorporated into various antibacterial or antimycotic compositions. Without limitation, such a composition may comprise a rhamnolipid surfactant component, either alone or in combination with an antibacterial component and / or

Wk

38484Β1 antimycotic agent of the kind known in art. Relative to the latter, such compositions may include a syringomycin and / or a pseudomycin component.

More specifically, as will be understood by a person skilled in the art, a rhamnolipid component can comprise one or more compounds of the kind described in US Pat. Nos. 5,455,232 and 5,767,090, which are each incorporated herein as referenced in their entirety. Such a rhamnolipid compound, whether presently known in the art or isolated and / or characterized thereafter, may have a structure described herein or be different, as will also be understood by those skilled in the art. For example, without limitation, whether synthetically derived or present in nature (for example, from a species of Pseudomonas or a strain thereof) in the form of an acid and / or in the form of a corresponding acid salt, such a compound may be substituted with alkyl and / or acyl (for example, methyl and / or acetyl, respectively and higher homologs than these) in one or more hydroxy saccharide positions. Likewise, whether in monorhamno and / or dirhamno form, such a compound can be modified by a hydrophobic fragment. As a nonlimiting example, with reference to FIGS. 7Α and 7Β, metn can independently vary from approximately 4 to approximately 20, whether these fragments are saturated, monounsaturated or polyunsaturated, whether the hydrophobic fragment is protonated, present as the base of the conjugate with any counterion or derivative otherwise. In accordance with the broader aspects of the present invention, a rhamnolipid useful in such compositions is structurally limited only by the resulting surface active function and / or the antimicrobial effect in combination with a composition with CAA of the present invention. Therefore, structural variations of the kind described in international publication wo 99/43334 are also contemplated in the context of the present invention, such publication being incorporated herein by reference in its entirety. See also the non-limiting rhamnolipid components / structures of FIGS. 8 and 9.

Regardless of the antimicrobial or rhamnolipid identity, a support component of the compositions of the invention may comprise a fluid selected from, but not limited to, water, an alcohol, an oil, a gas and combinations thereof. For example, while such compositions are unlimited with respect to the amount or concentration (for example, ٥ / o by weight) of the antimicrobial or rhamnolipid amounts, a carrier comprising water and / or an alcohol can be used for facilitate the desired presentation, storage and / or application properties, as well as the effective concentration as well as the activity which results therefrom.

MY

Such rhamnolipidic surfactant compounds, antimycotic components and / or associated compositions include, but are not limited to, those described in pending application η٥ 11/351,572, in specific examples 9 to 15 thereof, such application having been filed on February 10, 2006 and being incorporated herein by reference in its entirety. Such rhamnolipid surfactant components, antimycotic components and / or associated compositions may contain or be used in conjunction with one or more CAA components and / or CAA compositions of the present invention. Such antibacterial and / or antimycotic components are known to those skilled in the art and available commercially. Various rhamnolipid components and various associated surfactant compositions are available from Jeneil Biosurfactant Co., LLC, under the trademark Zonix.

Example 25 For example, to illustrate such variations related to rhanmolipids, a range of compositions can be prepared with one or more rhanmolipid components and one or more compositions with CAA of the present invention (and / or one or more CAA components of it), for use in or in combination with post-harvest washing or treatment of a wide variety of fruits and vegetables. Without limitation, in such a composition, a rhanmolipid component, (for example, as described in the aforementioned application '572) may be present in an amount ranging from about 0.1% by weight to about 99.9 % by weight and a CAA composition / component (e.g., compositions of Tables 2 to 7 and 10, above) may be present in an amount ranging from about 99.9% by weight to about 0.1% by weight . With reference to the current regulations of 1ΈΡΑ, there is no tolerance limit for the aforementioned Zhanix rhanmolipid surfactants. Likewise, there is no tolerance limit for the CAA compositions / components of the present invention. Therefore, foods treated with such rhanmolipid / CAA compositions can be consumed without additional washing.

Example 25a [0166] In accordance with the above, a rhamnolipid / CAA composition can be used to wash citrus fruits. Such a wash / bath composition was prepared using an 8.5% rhamnolipid solution (in water) and a 5 ٥/٥ CAA solution (for example, the composition of Table 10 in 1 'water). One gallon [3.785 liters] of a 95: 5 (v / v) mixture was diluted to 425 gallons. Using procedure protocols known to the industry or otherwise required according to state or federal regulations.

I

MN

38484Β1 the composition has been used effectively to cleanse and penetrate the skin of citrus fruits, killing bacteria and fungi both on the surface and inside. Although the concrete results have been demonstrated with a citrus fruit, this one and the associated rhanmolipid / CAA compositions can be used in comparison with a post-harvest washing or treatment of any fruit or vegetable (for example, without limitation , blueberries, tomatoes, reasons, onions, sugar beets, sweet potatoes, apples, pears, pineapple and various other tropical fruits and vegetables such as but not limited to noni and aça'i etc.). Fruits / vegetables washed or treated with compositions with CAA of this example would be recognized as harmless and hygienic for human consumption.

Example 25b [0167] Whether or not having a rhamnolipid component incorporated, various compositions with CAA of the present invention can be used to treat various fruits and vegetables (for example, without limitation, pears, peaches, apples, tomatoes, apricots, mangoes and the like) before or packaging or canning to reduce bacterial / fungal loads.

Example 26

101681 Supply of CAA component compounds. The component compounds for use in the compositions of the present invention can be obtained commercially or prepared using synthetic techniques well known or otherwise described in the literature. (see for example, incorporated US patent no. 6911 338, the entirety of which is incorporated herein by reference.) [0169] Alternatively, as may be preferable in combination with certain embodiments, including but not limited to food and beverage items and humans, personal hygiene and cosmetic products and associated processing and manufacturing techniques, the GRAS component compounds and the associated CAA compositions of the present invention can be derived from natural sources using fermentation techniques and are available under the trademark Flavorzon from Jeneil Biosurfactant Co., LLC of Saukville, Wisconsin. Therefore, various compositions of the present invention, depending on their end use or application, may include compounds derived from bacterial fermentation, chemically synthesized compounds, and various mixtures of compounds derived from fermentation and synthesis.

MY

With reference to the above, the following examples illustrate the non-limiting use or incorporation of one or more compositions of the present invention, such use or incorporation being as understood by man of the profession having taken cognizance of the present invention, and described in the context of several prior patents, each of which is incorporated herein by reference for the purpose of demonstrating that those skilled in the art will understand such use or incorporation of the present invention.

Example 27 [0171] To illustrate other embodiments, various compositions of the present invention may be shaped to be used as an additive for a fruit drink, such as that described in U.S. Patent No. 6,566,349 . For example, the compositions of the present invention can be added to a juice in combination with or as a flavonoid compound and / or an antioxidant or can be applied beforehand on fruits and vegetables before transfomation to increase the shelf life of the product. . As those skilled in the art will understand, such compositions of the '349 patent can be modified to include one or more compositions of the present invention in an amount which can be determined depending on the end use application, easily without undue recourse to experimentation.

Example 28 The compositions of the present invention can also be shaped to be used in the preservation of tea and drinks with fruit and tea mixtures, as described in the incorporated US patent 5,866 182. For example, the compositions of the present invention can be used in combination with or as a replacement for K sorbate and Na benzoate, ascorbic acid and dimethyl dicarbonate. As will be understood by those skilled in the art, these drinks of the '182 patent (for example, Example 1 thereof) can be modified to include one or more compositions of the present invention, in an amount which can be determined by depending on the particular application, easily without undue recourse to experimentation.

Example 29 The compositions of the present invention can also be presented for use in the preservation and / or the improvement of the antimicrobial effect of antiperspirants and deodorants, such as those described in the incorporated US patent 5,176,903 For example, the compositions of the present invention can be used

MY

38484Β1 in combination with or in replacement of parabens, imidazolidinyl-urea,

- · benzyl alcohol, phenoxyethanol and various other suitable preservatives (for example, as described in Examples 1 to 3 thereof) and added to such antiperspirant / deodorant to protect against degradation, prolonging the life and / or improving the efficiency, one or more of these compositions being in an amount which can be easily determined without undue recourse to experimentation by a person skilled in the art.

Example 30 The compositions of the present invention can also be shaped to be used in antiperspirants, such as those described in the incorporated US patent 4,548,808. For example, one or more compositions of the present invention may be added to essentially anhydrous non-alcoholic antiperspirant products described in the '808 Patent (e.g., Examples 1 to 6 thereof) in effective amounts readily determined without undue recourse to experimentation by a person skilled in the art, in order to prolong the life and improve the antimicrobial effect.

Example 31 [0175] The compositions of the present invention can also be shaped for use in animal / pet food, for example dog food, such as those described in the incorporated US patent 3,119,691 . Those skilled in the art will recognize that one or more of the present compositions can be added to low-hydration dog foods, high-humidity dog ​​foods and rehydratable dog foods (for example, to the product presentations described in that -ci) to prolong the life of the products described in the patent '691, such or such compositions being in a quantity determined easily without undue recourse to experimentation!

Example 32 The compositions of the present invention can also be shaped for use in cat litter, such as that described in the incorporated US patents Nos. 5,060,598 and 4,721,059. Various absorbent materials, including, for example, clay, alfalfa, wood shavings and sawdust and improved absorption materials including a clay-like filler ('059 patent) and peat ('598 patent) are used to absorb urine and control odor. One or more compositions of the present invention may be used in combination with these materials (for example, sprayed on them or otherwise incorporated therein) to

MY

38484Β1 reduce or eliminate microbial activity and control the odor after the use of litter boxes. such (s) composition (s) being in a quantity easily determined without undue recourse to experimentation.

Example 33 The compositions of the present invention can also be shaped to be used in applications of disinfectant sprays, such as those described in the incorporated American patent No. 6,250,511. The '511 patent describes the inclusion of a treatment solution in the vaporizer comprising at least one glycol compound in a proportion of between about 25 ٥ / o and 75%, an antimicrobial component in a proportion of between 0.2 ٥ / o and 60 ٥ / o, a surfactant in a simulated proportion between about 5 ٥/٠ and 45 ٥/٥, and optionally effective amounts of perfumes, dyes and other additives (in col. 3 thereof). For example, one or more compositions of the present invention may be used in combination with a disinfectant of the '511 patent to replace the antimicrobial component or as an additive thereof, such composition (s) being in an amount readily determined by a person skilled in the art without undue recourse to experimentation.

Example 34 The compositions of the present invention can also be shaped to clean and / or disinfect the equipment for processing food and beverages, such as that described in the incorporated American patent No. RE 40,050. Although the '050 reissue issues a halogen dioxide composition, such a presentation could be modified by those skilled in the art to replace one or more compositions of the present invention, such or such compositions being in a quantity easily determined without undue recourse to experimentation and brought into contact with or applied to such processing equipment using the devices and techniques of the kind described in the reissue - '050 (by example, as described in columns 3 and 4 thereof).

Example 35 The compositions of the present invention can also be shaped to be used in the preservation of wood, as described in the US patent incorporates 4,988,576 (and for composites based on lignocellulosic materials described in U.S. Patent No. 7,449,130). The '576 patent describes!' Impregnation of wood with a solution of a preservative composition

HA

38484Β1 comprising a lignosulfonate graft copolymer, hydroxybenzyl alcohol and a metal salt or a mixture of metal salts, or as a variant at least one metal salt of a lignosulfonate graft copolymer, the copolymer being a reaction product of lignosulfonate and acrylic monomers. For example, one or more compositions of the present invention can be used alone or in combination with these preservatives described in the '576 patent (or the' 130 patent), as described, respectively, in Examples 1 to 4 and 1 and 2 thereof, to impregnate and preserve the wood, such or such compositions being in a quantity easily determined by the skilled person without undue recourse to experimentation.

Example 36 The compositions of the present invention may also be shaped for use with sanitizing and / or disinfecting wipes, as described in the incorporated US patent no. 4,575,891, which describes a partially saturated tampon with a disinfectant (eg, col. 2 thereof). The '891 patent describes suitable disinfectants such as alcoholic solutions and other antiseptic solutions. For example, one or more compositions of the present invention can be used alone or in combination with such disinfectants and incorporated into such a wipe material, such or such compositions being in an amount easily determined and incorporated by humans. art without undue recourse to experimentation.

Example 37 [0181] The compositions of the present invention can also be shaped for use with a lotion for disinfecting the hands, as described in the incorporated US patent no. 6 187 327. For example, one or more compositions of the present invention may be shaped to be added to and function in association with the lotion of the '327 patent or to replace any of the active ingredients in the lotion to enhance the antimicrobial effect . The '327 patent also describes various other hand sanitizers (eg, an amphoteric cationic surfactant, a cationic surfactant, a wetting agent and a nonionic regressing agent). Independently, a composition of the present invention may be incorporated as a replacement for or used in combination with any of the active ingredients in such a hand sanitizer, such composition (s) being in an amount readily determined without undue recourse to !'experimentation.

MY

38484Β1

Example 38 [0182] The compositions of the present invention can also be shaped for use in the treatment of edible or agricultural seeds, as described in the American patent incorporates no. 4,581,238, which describes the contacting of seeds with steam in which a sorbate is dispersed (for example, in columns 2 to 5 thereof). For example, using the techniques and apparatus described therein, one or more compositions of the present invention can be volatilized or otherwise applied to these seeds, such or such compositions in an amount readily determined by those skilled in the art without undue recourse to experimentation.

Example 39 [0183] The compositions of the present invention can also be shaped for use in preventing or inhibiting the growth of decomposing organisms, as described in the US patent incorporates no. 4,356,204, which describes contacting foods with an effective amount inhibiting the growth of a ketohexanoic acid (for example, in columns 2 and 3 thereof). One or more compositions of the present invention can be used alone or with such a ketohexanoic acid to further inhibit and / or kill the decomposing organisms. Likewise, the incorporated American patent No. 2,711,976 proposes the use of amino acids to increase the resistance of egg cream foods to decomposing organisms and Staphylococcus species. Again, one or more compositions of the present invention could be used alone or in combination with or as a replacement for these amino acids. Likewise, the incorporated US patent No. 2,866,819 proposes the use of sorbic acid as a food preservative. Again, one or more compositions of the present invention could be used alone or in combination with or as a replacement for sorbic acid. Likewise, the US patent incorporates No. 2,910,368 describes the use of EDTA with sorbic acid to increase the shelf life of vegetables. Again, one or more compositions of the present invention can be used alone or in combination with EDTA and / or sorbic acid. In each case, such or such compositions of the present invention can be used in an amount easily determined by a person skilled in the art without undue recourse to experimentation.

MY

38484Β1

Example 40 [0184] The compositions of the present invention may also be shaped for use in the treatment of fruits, seeds, grains and vegetables, as described in US Patent 5,273,769, which describes placing any of the items to be treated in a container and then introducing carbon dioxide and ammonia. For example, using the apparatuses and techniques described therein (e.g., Examples 1-4), one or more compositions of the present invention can be used effectively as will be understood in the art without undue recourse to experimentation.

Example 41 [0185] The compositions of the present invention can also be shaped to be used in the treatment of articles / products and dental and medical implants, the implants being as described in the American patent incorporates No. 6,812 217, which describes an antimicrobial polymer film applied to the exterior surface of an implantable medical device. For example, using techniques of the kind described therein, one or more compositions of the present invention may also be deposited on or otherwise incorporated with such a device or article (whether medical or dental) or polymeric film on it (for example, as described in columns 5 to 6) to provide an antimicrobial effect, such or such compositions being in an amount easily determined by a person skilled in the art without undue recourse to experimentation.

Example 42 [0186] The compositions of the present invention may also be shaped for use in the treatment of textiles, such as in US Pat. No. 5,968,207, which describes the application of triclosan ester to fabrics. textile fibers or fabric by diffusion or impregnation. For example, one or more compositions of the present invention can be shaped to be used alone or in combination with such a compound to improve the antimicrobial properties of a textile or fibers thereof, whether synthetic , natural or a mixture (for example, as described in columns 2 and 3 of the '207 patent), such or such compositions being in an amount easily determined by a person skilled in the art without undue recourse to experimentation.

38484Β1

Example 43 The compositions of the present invention can be shaped for the treatment of surfaces of a food processing installation, the equipment and associated foodstuffs, as described in the US patent incorporates no. 7,575,744. For example, using the techniques and apparatuses of the kind described therein, one or more compositions of the present invention can be shaped and arranged on equipment and food surfaces in a wide variety of facilities food processing to reduce or eliminate microbial activity, such facilities / equipment including but not limited to snacks, poultry, citrus, peanuts and associated food processing facilities / equipment (see, for example, col. 20). Such composition (s) can be used in an amount easily determined by a person skilled in the art without undue recourse to experimentation.

Example 44 [0188] The compositions of the present invention may also be shaped for use in the treatment of diseases associated with microbes (i.e. mastitis, foot and mouth disease etc.) in livestock and livestock, and to inhibit microbial growth on crops, plants, grains and other foodstuffs, as described in the incorporated US patent no. 7 192,575, which describes a composition comprising clove oil, eucalyptus oil, lavender oil, tea tree and orange essential oil and application of it. For example, one or more compositions of the present invention may be shaped to be used alone or in combination with that of the '575 patent (e.g., Examples 1 to 2 thereof), such composition (s) being in a quantity easily determined by a person skilled in the art without undue recourse to experimentation.

EXAMPLE 45 The compositions of the present invention can also be shaped to be used for the preservation of foodstuffs such as seasonings, sauces, marinades, condiments, spreads, butters, margarine, products based on products dairy and the like against microbial degradation, as described in the US patent incorporates no. 6,156,362, which describes a combination of antimicrobial components. One or more compositions of the present invention may be shaped to be used alone or in combination with one or more others

MY

38484Β1 components of the '362 patent (for example, examples 1 to 4 thereof), such or such compositions being in an amount easily determined by a person skilled in the art without undue recourse to experimentation.

Example 46 The compositions of the present invention can be shaped to be incorporated with a wide range of paints, stains and associated surface coatings based on water or on organic basis, as described in the patent. American incorporated no. 7,659,326 and the sources cited therein (e.g., Kirk-Othmer-Paint; pp. 1046-1049, Vol. 17; 1996, by Arthur A. Leman, whose revelations are incorporated herein by reference in their entirety). For example, one or more compositions of the present invention may be shaped to be used alone or in combination with another antimicrobial component described in the detailed description and Examples 1 and 3 of the '326 patent, such composition (s) being in a quantity easily determined by a person skilled in the art without undue recourse to experimentation.

Example 47 The compositions of the present invention can also be shaped to be used or incorporated in after-shave products, such as those described in the incorporated US patent η٥ 6,231,845. For example, one or more compositions of the present invention may be used in combination with components of the kind described in Examples 1 to 6 of the '845 patent, to provide an antimicrobial effect to such aftershave products. prior art. Such compositions can be present in an amount easily determined by those skilled in the art without undue recourse to experimentation.

Example 48 The compositions of the present invention can also be shaped to be used or incorporated into a product for the treatment of a carcass, meat or a cameo product (for example, mammals, birds, fish, clams, cmstaceae and / or other forms of seafood and other edible species), as described in US Pat. No. 7,507,429. For example, one or more compositions of the present invention may be shaped to be used alone or in combination with another antimicrobial component, to be incorporated into a product as described in the '429 patent. Such composition (s) may be present in an amount readily determined by one skilled in the art.

MY

38484Β1 trade without undue recourse to experimentation, and the corresponding product (s) can be applied or otherwise used with techniques and apparatus described in the '429 patent or as understood by the person skilled in the art having read of the present invention, (see, for example, the sections relating to the processing, spraying, immersion and treatment of meat, as well as the composition and components of the detailed description of the '429 patent.)

Example 49 The compositions of the present invention may also be shaped to be used or incorporated into a material (eg, a material for coating or other incorporation) for a food product, such products including but not limited to snacks, cereals and other food components, such as snacks and cereal products and materials of the kind described in US Patent No. 7,163,708. Without limiting the manner in which these materials can be applied, one or more compositions of the present invention may be used alone or in combination with one or more of the antimicrobial components or preservatives of such materials, as described in the detailed description food and coating materials, from the '708 patent. Consequently, as will be understood by a person skilled in the art, such a composition can be present in an easily determined amount without undue recourse to experimentation.

Example 50 The compositions of the present invention may be shaped to be incorporated with a variety of edible spread compositions, including but not limited to peanut butter compositions, such as those described in the patent incorporated number 7 498 050. For example, as will be understood by those skilled in the art, one or more compositions of the present invention can be used in combination with such edible spreads to provide or otherwise enhance the antimicrobial effect, as described in Examples 1 and 2 of the '050 patent, such or such compositions as they may be present in an easily determined amount without undue recourse to experimentation.

Example 51 [0195] The compositions of the present invention can be shaped to be incorporated with a wide range of pest control compositions, such as those described in incorporated US Patent No. 6,720,450 (for example, in

MY

38484Β1 sections 2 to 3 of the detailed description thereof). For example, one or more compositions of the present invention can be shaped to be used alone or in combination with another pesticidal component, such as that described in the '450 patent. Likewise, one or more compositions of the present invention may be shaped as described herein, with a suitable carrier component, for use against various hematophagous insects, including but not limited to various types of mosquitoes and insects agricultural crop pests. The present compositions can be used as described herein for direct contact, inhibition and / or elimination of mosquitoes, including larvae, nymphs and / or adult forms thereof. Alternatively, the present compositions can be used and / or shaped for a repellent action. Independently, such or such compositions may be present in an amount easily determined by a person skilled in the art without undue recourse to experimentation and may optionally comprise a surfactant component. Such a surfactant can be a biotensioactive. Without limitation, such a biosurfactant can be selected from monorhamnolipids, dirhamnolipids and combinations thereof.

With reference to paragraphs [0046], [0047], [0051], [0052] and [0105] and to the variants of compositions of the kind described in and available by means of the use of the CAA of Tables 2 to 7 and 10 , the following examples demonstrate the use of several of these compositions with CAA and associated articles, according to this invention.

Example 52 Several assays were carried out using representative antimicrobial compositions against different test organisms. Inoculum nuts (3 × 3 mm) were deposited in a continuous strip at a minimum level, then exposed, respectively, to vapors of the BàL compositions placed in the micro-section of a central well. The radial growth of each nut was measured (mm) after 38 hours at room temperature.

Table 14.

<td>Test column</td><td>Pythium</td><td>Rhizoc</td><td>Green</td><td>Asp</td><td>Phyto</td><td>Fus</td><td>Botr</td><td>Salt</td><td>Bacillus</td><td>E. coli</td>

<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>AT</td><td> 31</td><td> 8</td><td> 2.5</td><td> 3.5</td><td> 3.0</td><td> 9.5</td><td> 5.5</td><td> ٦</td><td>growth</td><td>growth</td>

<td>B</td><td> 0</td><td> 0</td><td> 0</td><td> 1</td><td> 0</td><td> 0.2</td><td> 0.5</td><td> 1.7</td><td>light</td><td> 0</td>

<td>VS</td><td> 0</td><td> 0</td><td> 0</td><td> 0.5</td><td> 0</td><td> 0.7</td><td> 0.2</td><td> 0.8</td><td>trace</td><td> 0</td>

<td>D</td><td> 0</td><td> 0</td><td> 0</td><td> 0.45</td><td> 0</td><td> 0.7</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

,MY

38484Β1

<td>E</td><td> 0</td><td> 0</td><td> 0</td><td> 0.4</td><td> 0</td><td> 0.5</td><td> 0.1</td><td> 0.7</td><td> 0</td><td> 0</td>

<td>F</td><td> 0</td><td> 0</td><td> 0</td><td> 0.1</td><td> 0.1</td><td> 0</td><td> 0.1</td><td> 0.7</td><td>trace</td><td> 0</td>

<td>G</td><td> 0</td><td> 0</td><td> 0</td><td> 0.2</td><td> 0.1</td><td> 0.1</td><td> 0.1</td><td> 3.5</td><td> 0</td><td> 0</td>

<td>H</td><td> 0</td><td> 0</td><td> 0</td><td> 0.1</td><td> 0.15</td><td> 1.5</td><td> 0.2</td><td> 0.15</td><td> 0</td><td> 0</td>

<td>I</td><td> 0</td><td> 0</td><td> 0</td><td> 0.15</td><td> 0</td><td> 0.3</td><td> 0.1</td><td> 0.15</td><td> 0</td><td> 0</td>

<td>ل</td><td> 0</td><td> 0</td><td> 0</td><td> 0.7</td><td> 0</td><td> 0.1</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td>

<td>K</td><td> 0</td><td> 0</td><td> 0</td><td> 0.7</td><td> 0</td><td> 0.3</td><td> 0.15</td><td> 1.7</td><td> 0</td><td> 0</td>

<td>The</td><td> 0</td><td> 0</td><td> 0</td><td> 0.07</td><td> 0</td><td> 1.5</td><td> 0</td><td> 0.8</td><td> 0</td><td> 0</td>

Antimicrobial compositions tested:

A = control (no treatment)

B = composition of Table 10, above; 10 microliters

C = propanoic acid: isoamyl acetate, 7: 2 (v / v); 9 microliters D = propanoic acid: isobutyl isobutyrate, 7: 2 (v / v); 9 microliters E = propanoic acid: isopentyl isobutyrate, 7: 2 (v / v); 9 microliters F = propanoic acid: allyl acetate, 7: 2 (v / v); 9 microliters G = propanoic acid: methyl isobutyrate, 7: 2 (v / v); 9 microliters H = propanoic acid: phenylethyl acetate, 7: 2 (v / v); 9 microliters I = propanoic acid: benzaldehyde, 7: 2 (v / v); 9 microliters ل = propanoic acid: isoamyl acetate: benzaldehyde, 7: 2: 2 (v / v / v); 11 microliters K = propanoic acid: all of the above esters in an equal mixture, 7: 2 (v / v); 9 microliters

L = propanoic acid: all esters from above in equal mixture: benzaldehyde, 7: 2: 2 (ν / ν / ν); 11 microliters.

Test organisms: Pythium ultimum (Pythium); Rhizoctonia solani pzoc١ ·, Verticullum dahllae لآع ert) -١ Aspergillusfumigatus AN -١ Phytophthora cmnamomi ·, Fusarium solani (Tus) -, Botrytis cinerea QBotf) -, Sclerotinia sclerotiorum (Sd١ -, Bacillus subtilus (Bacillus subtilus) . colt).

As demonstrated above, specific compositions of the present invention can be designed for a differential antimicrobial effect. For example, while composition B was slightly less advantageous against the species Botrytis and Sclerotinia, composition D completely inhibited growth, under the dosage conditions employed. Independently, an antimicrobial composition of the present invention, whether used pure, in the form of vapor or incorporated with a support component, may reveal advantageous results with a propanoic acid component present in a proportion of at least about 7 for 1 approximately with respect to any other component of the composition, (see FIG. 10 for the structures and nomenclafiire of the CAAs used in compositions B to L) With respect to the compositions

Ί5 _rMY

38484Β1

B to L, it will be understood by those skilled in the art that although certain acid esters are specifically referred to, various other acid esters 2 ء to Cs approximately and combinations of these can be used with an effect comparable.

Example 53 [0200] According to and to illustrate the use of various articles of the present invention, granules of bentonite clay (for example, from Al Harvey of Lovell, Wyoming) were impregnated with a composition representative of Table 10 , above, (about 0.80 ml / g of bentonite) and placed in an open enclosure. The granules in this item and part of a bunch of raspberries (i.e., a perishable foodstuff after harvest) were placed in a sealed container. After seven days, some mold or other microbial growth was evident (see Figure 11 A.) By comparison, using a bentonite granule control system without incorporated antimicrobial composition, raspberries from the same cluster were kept in a container. container sealed during the same period; excessive degradation has been observed, (see. Figure 11Β.)

Example 54 [0201] Various other compositions of the present invention, including without limitation compositions B to L of Example 52, can be incorporated with a solid support component. For example, commercially available bentonite clay granules can be impregnated with such a composition, for use in association with a vapor permeable enclosure, such as a sealed or resealable bag or sachet. Whether it is an appropriately sized mesh or a porous non-woven Tyvek® or functionally similar material, such a bag / sachet can provide an article with all of the components (i.e., an antimicrobial composition, carrier and pregnant) meeting the FDA (Federal Food and Drug Administration) specifications for food processing and contact.

Example 55 [0202] With reference to paragraphs [0055] and [0119] and to Example 11, above, bentonite clay granules can be impregnated with a composition from Table 10, then packed in a permeable bag. steam, or similar enclosure, and positioned near a human waste or refuse depot or collection. Without limitation, such an article can be placed in or near a human waste container, easily as a preliminary measure en route to treatment and / or final disposal.

Example 55a

Wk [0203] With reference to paragraphs [0057] to [0062] and [0119], an antimicrobial composition useful in association with the end use application of Example 55 is shown below.

Acétaldéhyde__

Ethyl acetate___

Propanoic acid, 2-methyl-, methyl ester

Ethanol

Acetic acid, 2-methylpropyl ester________________

Propanoic acid, 2-methyl-, 2-methylpropyl ester! -Propanol, 2-methyl-Butanol, 3-methyl-, acetate ___

Propanoic acid, 2-methyl-, 2-methylbutyl ester

Acetic acid, 2-phenylethyl! ester

Example 55b [0204] Again, with reference to paragraphs [0057] to [0062] and [0119], another antimicrobial composition useful in association with the end use application of Example 55 is shown below.

acetaldehyde

Ethyl acetate

Propanoic acid, 2-methyl-, methyl ester

Acetic acid, 2-methylpropyl ester

Propanoic acid, 2-methyl-, 2-methylpropyl ester

1-Propanol, 2-methyl1-Butanol, 3-methyl-, acetate

Propanoic acid, 2-methyl-, 2-methylbutyl ester

Acetic acid, 2-phenylethyl! ester

Example 55c [0205] In addition, with reference to paragraphs [0057] to [0062] and [0119], another antimicrobial composition useful in association with the end use application of Example 55 is shown below. .

Ethyl acetate

Propanoic acid, 2-methyl-, methyl ester

Acetic acid, 2-methylpropyl ester

Propanoic acid, 2-methyl-, 2-methylpropyl ester

1-Prop n 1, 2-methyll-Butanol, 3-methyl-, acetate

Propanoic acid, 2-methyl-, 2-methylbutyl ester

Acetic acid, 2-phenylethyl! ester; MA

38484Β1

Example 56 [0206] With reference also to paragraphs [0077] and [0087] to [0091], to

Tables 2 to 7 and 10 and in Examples 32 and 33, various CAA compositions of the present invention can be used to prepare cat litter and related animal care products. For example, granules of bentonite clay or other solid support components are brought into contact or impregnated with an antimicrobial composition (for example, from 0.20% by weight to about 10.0 ٥/٥ by weight or.

in some embodiments, from about 1.0 ٥/٠ by weight to about 3.0 ٥/٠ by weight) as shown below.

<td>% in weight</td><td>Compound</td>

<td>about 0.1 to about 10</td><td>acetaldehyde</td>

<td>about 0.5 to about 10</td><td>Ethyl acetate</td>

<td>about 0.1 to about 10</td><td>2-Butanone</td>

<td>about 4 to about 20</td><td>Propanoic acid, 2-methyl-, methyl ester</td>

<td>about 1.5 to about 15</td><td>Ethanol</td>

<td>about 0.1 to about 10</td><td>Acetic acid, 2-methylpropyl ester</td>

<td>about 20 to about 40</td><td>Propanoic acid, 2-methyl-, 2-methylpropyl ester</td>

<td>about 0.1 to about 10</td><td>1-Propanol, 2-methyl-</td>

<td>about 20 to about 40</td><td>1-Butanol, 3-methyl-, acetate</td>

<td>about 1.0 to about 30</td><td>Propanoic acid, 2-methyl-, 2-methylbutyl ester</td>

<td>about 2 to about 10</td><td>1-Butanol, 3-methyl-</td>

<td>about 40 to about 80</td><td>Propanoic acid, 2-methyl-</td>

<td>about 0.1 to about 10</td><td>Acetic acid, 2-phenylethyl! ester</td>

Alternatively, the compositions of the kind described in Examples 52 (BàL compositions) and Examples 55a to 55c can also be used in the preparation of a litter article. Independently, the relative quality of a component can be adjusted for any particular presentation, any desired antimicrobial effect and / or to adapt to the presence of one or more additives of the kind described in these including but not limited to perfumers / fragrances.

Example 57 [0207] With reference to paragraphs [0026] and [0087] and to Example 52, above, the compositions of the present invention can be prepared using propanoic acid in combination with one or more salts of acids, including but not limited to the salts of one or more acids 2 ء to Ce approximately. Such acid salts, including those of food grade quality, can be prepared as described below and can be obtained from sources well known to those skilled in the art, including without limitation from Sigma Aldrich (St. Louis, MO).

. MY

38484Β1

Example 57a [0208] According to certain embodiments of the present invention and with reference to paragraph [0061], the following compositions can be envisaged without limitation as an amount or concentration of component, such compositions comprising:

A. propanoic acid: a 4 d'acide acid salt:

B. propanoic acid: a salt of Cs acid;

C. propanoic acid: a salt of C6 acid;

D. propanoic acid: a combination of salts of 4 ides acids;

E. propanoic acid: a combination of salts of 5 ides acids;

F. propanoic acid: a combination of salts of 6 ides acids; and

G. propanoic acid: a combination of salts of 4 ء àCô acids.

Such salts of 4 ء to Ce acids and combinations thereof can be without limitation selected from salts of n-C4 to n-C6 monocarboxylic acids and structural isomers thereof and polycarboxylic and hydroxypolycarboxylic acids Corresponding suitable C4 to C6 comprising, but not limited to salts of 2-methylpropanoic acid, 2-methylbutanoic acid, 3-methylbutanoic acid, 2,3-dimethylpropanoic acid, 2,2-dimethylpropanoic acid ic, tartaric acid, citric acid and other mono- and (hydroxy) polycarboxylic C4-C6 acids, as will be understood by a person skilled in the art having taken cognizance of the present invention, these salts being able to be, without limitation.

chosen from alkaline (for example, sodium, potassium, etc.), alkaline earth (for example, calcium, magnesium, etc.) and quaternary amine (for example, ammonium, etc.) salts of these acids. Such compositions can be prepared by mixing the components

Example 57c [0210] With reference to any composition of Examples 57a and b, various other compositions of the present invention may comprise one or more components pure or with a suitable solvent or diluent such as, but not limited to, water and / or an aqueous alcohol and, optionally, in the presence of a surfactant component such as a rhanmolipid.

EXAMPLE 57b [0209] With reference to any composition of Example 57a, various other compositions of the present invention may comprise one or more esters of one or more acids C2 to C5 approximately and structural isomers of these, in addition or replacing such an acid salt component.

MY

38484Β1 aldehyde (aCs approximately more or in replacement of such an acid salt component and / or acid ester.

Example 57d [0211] With reference to the compositions of Examples 57a to c, various other compositions of the present invention may comprise another acid component 2 2 to Ce approximately. Without limitation, such an additional acid component can be selected from acetic acid, isobutyric acid, citric acid and combinations thereof, in addition to or in partial replacement for propanoic acid.

Example 57e [0212] Notwithstanding the compositions of Examples 57 and 57a-d, compositions of propanoic acid and at least one salt of acid 4 ء to 6 ء approximately, compositions of propanoic acid and at least one acid component 2 ح to Cô about additional and propanoic acid compositions and at least about 4 ء to C6 acid salt providing the absence of an acid ester, aldehyde and / or ketone can be used. Independently, as stated above, any composition of the present invention may be free from compounds derived from naphthalene and azulene and other condensed aromatic compounds and hydro derivatives thereof.

Example 58 [0213] With reference to any of the preceding compositions of Examples 57 and 57a-e, such composition (s) may be incorporated into an article of manufacture, including without limitation those of the kind described therein. there or otherwise used as described above. Generally, without limitation and as described above, one or more of these compositions can be incorporated into a food or nutriceutical ingredient (eg. Example 17d), a range of food products (eg, in paragraphs [0032 ], And [0066]) including processed foods such as peanut butter, humus and various dips and spreads (for example. Example 18), cheeses (for example, in paragraph [0067]) and other dairy and related products, solid support components (for example. Examples 53 to 56), and these support components in association with permeable enclosures. steam (eg. Examples 53-55) and as a substitute for sorbic acid, benzoic acid and benzoate salts (eg. Examples 28 and 39).

.MY

38484Β1

Example 59 [0214] With reference to Examples 57 and 57a-e, a comparative test of a composition representative of pro panoic acid and a salt of isobutyric acid (for example, potassium) demonstrated that this invention provided an antimicrobial effect when it was incorporated into a food product. More specifically, 0.1 gram of potassium isobutyrate was added to 20 microliters of propanoic acid. (Likewise, several control compositions were also prepared, as indicated in Table 15, below.) The test and control compositions were mixed by hand in 10 grams of fresh chilled humus (Costco) and placed in a sealed container. The treated and control containers were kept at 25 ° C. then examined and sampled on days 10 and 18. Sampling of each container was carried out with a sterile transfer needle, with approximately 1 mg spread in a continuous strip on a Petri dish of potato dextrosed agar (PDA), incubated for 30 hours, then examined. The results are summarized in Table 15, below.

Table 15.

Treatment

Appearance (Days)

Taste (Days)

Appearance (18 days)

Taste (18 days)

<td>Witness</td><td>Odorous product;</td><td>Was not</td><td>Growth</td><td>Odour</td>

<td>10 g humus</td><td>growth</td><td>evaluated</td><td>advanced fungal</td><td>totally</td>

<td></td><td>visible fungal;</td><td></td><td>on almost all</td><td>نم I disgusting; the</td>

<td></td><td>growth</td><td></td><td>the surface of the</td><td>taste was not</td>

<td></td><td>considerable on the</td><td></td><td>food product</td><td>evaluated</td>

<td></td><td>PDA</td><td></td><td></td><td></td>

<td>AT</td><td>The product</td><td>Excellent taste.</td><td>The product</td><td>The taste stays</td>

<td></td><td>seemed normal.</td><td>as for</td><td>seemed normal.</td><td>comparable to</td>

<td></td><td>like humus</td><td>humus</td><td>as for</td><td>that of the product</td>

<td></td><td>original; no</td><td>original</td><td>original humus;</td><td>humus</td>

<td></td><td>growth</td><td></td><td>no growth</td><td>refrigerated</td>

<td></td><td>microbial</td><td></td><td>microbial</td><td>original</td>

<td></td><td>detectable on the</td><td></td><td>surface of</td><td></td>

<td></td><td>PDA plate</td><td></td><td>product; any</td><td></td>

<td></td><td></td><td></td><td>growth</td><td></td>

<td></td><td></td><td></td><td>microbial</td><td></td>

<td></td><td></td><td></td><td>detectable on the</td><td></td>

<td></td><td></td><td></td><td>PDA plate</td><td></td>

B

The product tastes acidic and almost seemed to taste sour as the original sweet humus; lightweight

Colonies Mild sour acid and fungal flavor developed on the unacceptable product surface

MY

38484Β1 microbial growth pattern on the PDA plaid

<td>VS</td><td>The product looked normal, like the original humus; considerable microbial growth on the PDA dish</td><td>Acid taste</td><td>No fungal or other bacterial growth on the surface of the product</td><td>Strong acid taste</td>

<td>D</td><td>Fragrant;</td><td>Putrid taste</td><td>A little of</td><td>Putrid taste</td>

<td></td><td>growth</td><td></td><td>growth</td><td></td>

<td></td><td>microbial</td><td></td><td>microbial</td><td></td>

<td></td><td>important on the</td><td></td><td>product surface</td><td></td>

PDA plate

A: 0.1 g K of isobutyrate in 20 μl of propanoic acid, in 10 g of humus B: 20 ​​μΐ of propanoic acid, in 10 g of humus

C: 0.2 g of Na2HP٠4 in 100 μΐ of propanoic acid, in 10 g of humus D: 0.1 g K of isobutyrate, in 10 g of humus

Example 60a [0215] Purpose: To Determine Whether a Composition of the Present Invention Will Inhibit Mold in an Enzyme Modified Cheese (EMC CH) Cheddar Product (EMC CH) Which Is Predisposed to Mold Growth Due to its pH high and low titratable acidity (TA). Procedure: prepare a composition, obtain an EMC cheddar product and prepare a blue cheese porridge as a source of mold spores to deliver a sample of 1 to 10 CFU / 100 grams. Test the effectiveness of the composition.

Preparation of the antimicrobial composition;

1. Prepare a 4 M solution of potassium isobutyrate (Κ-ΙΒ) by adding

394.92 g of isobutyric acid and 498.76 g of 45% KOH (potassium hydroxide) in a 1 L volumetric flask

2. add deionized water to bring the volume up to 1 L.

3. Temper to room temperature and readjust the volume.

4. Measure pH = 8.11

MY

38484Β1

5. Weigh all the ingredients in the percentages in the table below, including:

Potassium isobutyrate, propionic acid, acetic acid and citric acid to prepare the final composition.

The composition of this example (designated FF # 2) consists of potassium isobutyrate, propionic acid, acetic acid and citric acid.

It has 5.39.

<td>Ingredient</td><td> ٥/٥</td><td>grams</td>

<td>Κ-ΙΒΑ (4 M)</td><td> 67,0</td><td> 16,75</td>

<td>Propionic acid</td><td> 20,0</td><td> 5,00</td>

<td>Acetic acid</td><td> 10,0</td><td> 2,50</td>

<td>Citric acid</td><td> 3,0</td><td> 0,75</td>

<td></td><td> 100,0</td><td> 25,00</td>

Enzyme Modified Cheese Cheddar Cheese Product (EMC CH) [Production Lot # 140210];

<td>Specifications</td><td>EMC CH</td><td>Target</td>

<td>% Humidity</td><td> 43,5</td><td>42 to 46</td>

<td>٥/٠ Fat</td><td> 28,0</td><td>26 to 30</td>

<td>TA (titratable acidity)</td><td> 18,5</td><td>20 to 24</td>

<td>٥/٥ Salt</td><td> 2,1</td><td>LA2</td>

<td>pH</td><td> 5,9</td><td>5.2 to 6.0</td>

<td>Mold count (cfil / g)</td><td> &lt;10</td><td> &lt;10</td>

<td>GC / CL dosage</td><td>(Mg / g)</td>

<td>Isobutyric acid</td><td> 2,112</td>

<td>Propionic acid</td><td> 0,024</td>

<td>Acetic acid</td><td> 2,307</td>

Preparation of blue cheese porridge (BM) (blue mold)

1. The continuous strip deposition produced 3.4 billion CFU / g of Penicillium roqueforti in blue cheese.

2. Add lg of blue cheese to 9 ml of sodium citrate buffer (2.0%) (dilution 1/10).

3. Make a dilution (1/10) and 3 serial dilutions of 0.1 ml in 9.9 ml of sodium citrate buffer.

4. Spread 0.2 ml on each sample and the controls "c" and "D".

5. BM calculation to equal 6.8 CFU / sample.

, MY

38484Β1

Experience:

1. Place 100 g of EMC CH as negative control "Aa" in white sections and "Ab" in sterile sections.

2. Place 99 g of EMC CH as negative control "B" with 1 ml of FF # 2 (1.0%) in a white dish.

3. Place 100 g of EMC CH with 0.2 ml of BM on the upper surface as a positive control "C" in a white dish.

4. Place 100 g of EMC CH with 0.2 ml of BM mixed in as the positive control "D" in a white cup.

5. The white "E" test sections will have 1 ml of FF # 2 (1.0%) in 99 g of EMC CH with 0.2 ml of BM inoculated on the upper surface.

6. The white "F" test sections will have 1 ml of FF # 2 (1.0%) in 99 g of EMC CH with 0.2 ml of BM inoculated inside the product.

7. Number and label the white test sections.

8. Incubate at 25٥ c for 12 weeks (84 days).

9. Sample a test section for initial pH, BP, and mold count.

10. Test mold counts using PDA (potato dextrose agar / 1% by weight tartaric acid) at weeks 2, 4, 8, and 12.

11. Perform final pH and BP sampling at 12 weeks.

12. Save the results.

13. Obtain a CG / SM assay from samples A and B to compare the chemical effects of FF # 2 in the product.

<td>Testing, sampling</td><td>EMC CH ٠ Witness “A”</td><td>EMC CH 1% FF # 2 "B"</td><td>EMC CH BM upper surface " VS "</td><td>EMC CH BM mix "D"</td><td>EMC CH 1% FF2 BM upper surface "E"</td><td>EMC CH 1 ٥/٥ FF2 BM mixture "F"</td>

<td>Week 1, day 6</td><td>AAb-1</td><td>bl</td><td>Cl</td><td>Dl</td><td>El</td><td>fl</td>

<td>Week 2, day 14</td><td>Aa / Ab-2</td><td>Β2</td><td>C2</td><td>D2</td><td>Ε2</td><td>F2</td>

<td>Week 4, day 28</td><td>Aa / Ab-3</td><td>Β3</td><td>C3</td><td>D3</td><td>Ε3</td><td>F3</td>

,MY

38484Β1

<td>Week 8, day 56</td><td>Aa / Ab-4</td><td>Β4</td><td>C4</td><td>D4</td><td>Ε4</td><td>F4</td>

<td>Week 12, day 84</td><td>AAb-5</td><td>Β5</td><td>C5</td><td>D5</td><td>Ε5</td><td>F5</td>

RESULTS:

<td>Sample cup</td><td></td><td>YOUR</td><td>Visible mold (yes / no)</td><td>CFU / g mold count</td>

<td>Aal-departure</td><td> 6.08</td><td> 19.68</td><td>No</td><td> &lt;10</td>

<td>Aal-day.7</td><td></td><td></td><td>No</td><td>n</td>

<td>Aa2-j0url4</td><td></td><td></td><td>Yes</td><td></td>

<td>Aa3-jour28</td><td></td><td></td><td>Yes</td><td></td>

<td>Aa4-jour56</td><td></td><td></td><td></td><td></td>

<td>Aa5-day 84</td><td></td><td></td><td></td><td></td>

<td>Abl departure</td><td> 5.96</td><td> 19.81</td><td>No</td><td> &lt;10</td>

<td>Ab6-day.7</td><td></td><td></td><td>No</td><td>n</td>

<td>Ab2-j0url4</td><td></td><td></td><td>No</td><td></td>

<td>Ab3-day 28</td><td></td><td></td><td>Yes</td><td></td>

<td>Ab4-jour56</td><td></td><td></td><td></td><td></td>

<td>Ab5-day 84</td><td></td><td></td><td></td><td></td>

<td>Bl-starting</td><td> 5.71</td><td> ٦٦٠٦</td><td>No</td><td> &lt;10</td>

<td>Bl-day7</td><td></td><td></td><td>No</td><td>n</td>

<td>B2-day 14</td><td></td><td></td><td>No</td><td></td>

<td>Β3-day 28</td><td></td><td></td><td>No</td><td></td>

<td>B4-day 56</td><td></td><td></td><td></td><td></td>

<td>B5-day 84</td><td></td><td></td><td></td><td></td>

<td>Cl-starting</td><td> 6.03</td><td> 20.88'</td><td>No</td><td> 6.8</td>

<td>Cl-day7</td><td></td><td></td><td>No</td><td>n</td>

<td>C2-day 14</td><td></td><td></td><td>No</td><td></td>

<td>C3-day 28</td><td></td><td></td><td>No</td><td></td>

<td>C4-day 56</td><td></td><td></td><td></td><td></td>

<td>C5-day 84</td><td></td><td></td><td></td><td></td>

<td>Dl-departure</td><td> 5.92</td><td> 20.61</td><td>No</td><td> 6.8</td>

<td>Dl-day.7</td><td></td><td></td><td>No</td><td>n</td>

<td>D2-day 14</td><td></td><td></td><td>No</td><td></td>

<td>D3-day 28</td><td></td><td></td><td>No</td><td></td>

<td>D4-day 56</td><td></td><td></td><td></td><td></td>

<td>D5-day 84</td><td></td><td></td><td></td><td></td>

<td>ΕΙ-departure</td><td> 5.63</td><td> 20.3</td><td>No</td><td> 6.8</td>

<td>Day 7</td><td></td><td></td><td>No</td><td>n</td>

<td>E2-day.14</td><td></td><td></td><td>No</td><td></td>

<td>Ε3-day 28</td><td></td><td></td><td>No</td><td></td>

<td>E4-day 56</td><td></td><td></td><td></td><td></td>

,MY

38484Β1

<td>E5-day 84</td><td></td><td></td><td></td><td></td>

<td>Fl-departure</td><td> 5.53</td><td> 19.1</td><td>No</td><td> 6.8</td>

<td>or R 7; -Fl</td><td></td><td></td><td>No</td><td>n</td>

<td>F2-day 14</td><td></td><td></td><td>No</td><td></td>

<td>F3-day 28</td><td></td><td></td><td>No</td><td></td>

<td>F4-day 56</td><td></td><td></td><td></td><td></td>

<td>F5-day 84</td><td></td><td></td><td></td><td></td>

Example 60b [0216] Purpose: To determine if FF # 2 will inhibit mold in a lipolized cream (LC) product which is predisposed to mold growth due to its high pH and its low TA. Procedure: prepare FF # 2, obtain a lipolyzed cream product without potassium sorbate and prepare a blue cheese slurry as a source of mold spores to produce a sample of 1 to 10 CFU / 100 grams. Test the effectiveness of FF # 2.

Preparation of FF # 2:

1. Prepare a 4 molar solution of potassium isobutyrate (Κ-ΙΒ) adding 4 Men

394.92 g of isobutyric acid and 498.76 g of 45% KOH (potassium hydroxide) in a 1 L volumetric flask

2. add deionized water to bring the volume up to 1 L.

3. Temper to room temperature and readjust the volume.

4. Measure pH 8.11

5. Weigh all the ingredients in the percentages in the table below, including:

Potassium isobutyrate, propionic acid, acetic acid and citric acid to prepare the final ff # 2.

FF # 2 consists of potassium isobutyrate, propionic acid, acetic acid and citric acid.

It has a pH of 5.39.

<td>Ingredient</td><td> %</td><td>grams</td>

<td>Κ-ΙΒΑ (4M)</td><td> 67,0</td><td> 16,75</td>

<td>Propionic acid</td><td> 20,0</td><td> 5,00</td>

<td>Acetic acid</td><td> 10,0</td><td> 2,50(</td>

<td>Citric acid</td><td> 3,0</td><td> 0,75</td>

<td></td><td> 100,0</td><td> 25,00</td>

<td>Lipoly cream product.</td><td colspan="3">؛ E (LC) [Production batch # 140205 [</td>

<td>Specifications</td><td>LC</td><td>Target</td><td rowspan="4"></td>

<td>% humidity</td><td> 54.61</td><td> 54-59</td>

<td>٥/٥ of fat</td><td> 38.5</td><td> 34-39</td>

<td>TA (titratable acidity)</td><td> 8.5</td><td> 9-13</td>

٢ΜΑ 38484Β1

<td>pH</td><td> 4.41</td><td> 4.2-5.2</td>

<td>Mold count (cfu / g)</td><td> &lt;10</td><td> &lt;10</td>

<td>Dosage CG / CL</td><td>(Mg / g)</td>

<td>Isobutyric acid</td><td> 0,07</td>

<td>Propionic acid</td><td> 0,00</td>

<td>Acetic acid</td><td> 0,20</td>

Preparation of blue cheese porridge (BM) (blue mold)

1.

2.

3.

4.

5.

The continuous strip deposition produced 3.4 billion CFU / g of Penicillium roqueforti in blue cheese.

Add 1 g of blue cheese to 9 ml of sodium citrate buffer (2.0%) (1/10 dilution).

Make a dilution (1/10) and 3 serial dilutions of 0.1 ml in 9.9 ml of sodium citrate buffer.

Spread 0.2 ml on each sample and the controls "c" and "D".

BM calculation to equal 6.8 CFU / sample.

Experience;

2.

3.

4.

6.

7.

Place 100 g of LC as negative control "Aa" in these white sections and "Ab" in sterile sections.

Place 99 g of LC as negative control "B" with 1 ml of FF # 2 (1.0%) in a white dish.

Place 100 g of LC with 0.2 ml of BM on the upper surface as a positive control "C" in a white dish.

Place 100 g of LC with 0.2 ml of BM mixed in as the positive control "D" in a white cup.

The white "E" test sections will have 1 ml of FF # 2 (1.0%) in 99 g of LC with 0.2 ml of BM inoculated on the upper surface.

The white "F" test sections will have 1 ml of FF # 2 (1.0%) in 99 g of LC with 0.2 ml of BM inoculated inside the product.

Number and label the white test cups.

Incubate at 25٥ c for 12 weeks (84 days).

MY;

38484Β1

9. Sample a test section for initial pH, BP, and mold count.

10. Test mold counts using PDA (potato dextrose agar / 1% by weight tartaric acid) at weeks 2, 4, 8, and 12.

11. Perform final pH and BP sampling at 12 weeks.

12. Save the results.

13. Obtain a CG / SM assay from samples A and B to compare the chemical effects of FF # 2 in the product.

<td>Sampling test</td><td>LC + Witness "A"</td><td>LC 1% FF # 2 "B"</td><td>LC BM upper surface " VS "</td><td>LC BM mixed "D"</td><td>LC 1% FF2 BM upper surface "E"</td><td>LC l٥ / ٥FF2 BM mixed “F”</td>

<td>Week 1, day 7</td><td>Aa / Ab-1</td><td>bl</td><td>Cl</td><td>Dl</td><td>El</td><td>fl</td>

<td>Week 2, day 14</td><td>AAb-2</td><td>Β2</td><td>C2</td><td>D2</td><td>Ε2</td><td>F2</td>

<td>Week 4, day 28</td><td>Aa / Ab-3</td><td>Β3</td><td>C3</td><td>D3</td><td>Ε3</td><td>F3</td>

<td>Week 8, day 56</td><td>Aa / Ab-4</td><td>Β4</td><td>C4</td><td>D4</td><td>Ε4</td><td>F4</td>

<td>Week 12, day 84</td><td>Aa / Ab-5</td><td>Β5</td><td>C5</td><td>D5</td><td>Ε5</td><td>F5</td>

RESULTS:

<td>Test cut</td><td>pH</td><td>YOUR.</td><td>Visible mold (yes / no)</td><td>CFU / g mold count</td>

<td>Aal-departure</td><td> 4.55</td><td> 9.73</td><td>no</td><td> &lt;10</td>

<td>Aal-day.7</td><td></td><td></td><td>no</td><td>n</td>

<td>Aa2-day 14</td><td></td><td></td><td>no</td><td></td>

<td>Aa3-jour28</td><td></td><td></td><td>Yes</td><td></td>

<td>Aa40jour56</td><td></td><td></td><td></td><td></td>

<td>Aa5-day 84</td><td></td><td></td><td></td><td></td>

<td>Abl departure</td><td> 4.49</td><td> 9.8</td><td>no</td><td> &lt;10</td>

<td>Abl day.7</td><td></td><td></td><td>no</td><td>n</td>

<td>Ab2-day 14</td><td></td><td></td><td>Yes</td><td></td>

<td>Ab3-jour28</td><td></td><td></td><td>Yes</td><td></td>

<td>Ab4-jour56</td><td></td><td></td><td></td><td></td>

<td>Ab5-day 84</td><td></td><td></td><td></td><td></td>

<td>Bl-starting</td><td> 4.66</td><td> 9.79'</td><td>no</td><td> &lt;10</td>

<td>Bljour7</td><td></td><td></td><td>no</td><td>n</td>

<td>Β2-day 14</td><td></td><td></td><td>no</td><td></td>

<td>B3-day 28</td><td></td><td></td><td>no</td><td></td>

<td>B4-day 56</td><td></td><td></td><td></td><td></td>

'MY

38484Β1

<td>B5-day 84</td><td></td><td></td><td></td><td></td>

<td>Cl-starting</td><td> 4.58</td><td> 9.53</td><td>no</td><td> 6.8</td>

<td>Day 7</td><td></td><td></td><td>no</td><td>n</td>

<td>C2-day 14</td><td></td><td></td><td>Yes</td><td></td>

<td>C3-day 28</td><td></td><td></td><td>Yes</td><td></td>

<td>C4-day 56</td><td></td><td></td><td></td><td></td>

<td>C5 jour84</td><td></td><td></td><td></td><td></td>

<td>Dl-departure</td><td> 4.64</td><td> 9.37</td><td>no</td><td> 6.8</td>

<td>Dl-day.7</td><td></td><td></td><td>no</td><td>n</td>

<td>D2-day 14</td><td></td><td></td><td>no</td><td></td>

<td>D3-day 28</td><td></td><td></td><td>no</td><td></td>

<td>D4-day 56</td><td></td><td></td><td></td><td></td>

<td>D5-day 84</td><td></td><td></td><td></td><td></td>

<td>El-departure</td><td> 4.67</td><td> 10</td><td>no</td><td> 6.8</td>

<td>El-day.7</td><td></td><td></td><td>no</td><td>n</td>

<td>Ε2-day 14</td><td></td><td></td><td>no</td><td></td>

<td>Ε3-day 28</td><td></td><td></td><td>no</td><td></td>

<td>Ε4-day 56</td><td></td><td></td><td></td><td></td>

<td>E5-jou 84</td><td></td><td></td><td></td><td></td>

<td>Fl-departure</td><td> 4.72</td><td> 10.74</td><td>no</td><td> 6.8</td>

<td>Fl-day.7</td><td></td><td></td><td>no</td><td>n</td>

<td>F2-day 14</td><td></td><td></td><td>no</td><td></td>

<td>F3-jour28</td><td></td><td></td><td>no</td><td></td>

<td>F4-jour56</td><td></td><td></td><td></td><td></td>

<td>F5-day 84</td><td></td><td></td><td></td><td></td>

As the results of Examples 60a and b show, a representative composition of the present invention can be used to effectively inhibit the growth of mold in otherwise predisposed food products.

Example 61 The composition of Examples 60a and b (FF # 2) was tested against representative strains of fungi and bacteria. The composition was placed in a micro-cut in the center of a dish of potato dextrose agar with small inoculum nuts spaced around the central well of the micro-cut to 2 cm. The section contained the amounts of composition which are indicated in Table 16. The dishes were incubated for 24 hours at room temperature and measured. The measurements were carried out on a control dish and the amount of inhibition expressed for the composition is presented as the amount of growth relative to the growth of the control dish (without composition). The percent inhibition results were calculated after a minimum of two measurements for each test organism was performed.

م ΜΑ 38484Β1

Table 16.

<td>Test organism</td><td>6 pl in the ٠/٥ inhibition micro-cup</td><td>12.5 μl in the micro-cut% inhibition</td><td>25 μl in the micro-cut% inhibition</td>

<td>Rhizoctonia solani</td><td> 66</td><td> 80</td><td> 100</td>

<td>Phytophthora cinnamomi</td><td> 73</td><td> 100</td><td> 100</td>

<td>Verticillum dahliae</td><td> 40</td><td> 80</td><td> 100</td>

<td>Sclerotiorum sclerotiorum</td><td> 19</td><td> 60</td><td> 100</td>

<td>Penicillumsp.</td><td> 15</td><td> 10</td><td> 100</td>

<td>Aspergillus .fumigatus</td><td> 80</td><td> 80</td><td> 100</td>

<td>Fusarium solani</td><td> 45</td><td> 63</td><td> 100</td>

<td>Pythium ultimum</td><td>ND</td><td> 100</td><td> 100</td>

<td>Bortytis cinerea</td><td>ND</td><td> 50</td><td> 95</td>

<td>E.coli</td><td>ND</td><td>Trace</td><td> 100</td>

<td>Bacillus subtilus</td><td>ND</td><td>Trace</td><td>Trace</td>

In another test against the same fungi and bacteria, the composition was placed directly in the form of a drop in the center of a dish of potato dextrosed agar with small inoculum nuts spaced around from the center at 2 cm intervals. The dishes were incubated for 24 hours at room temperature and measured. The amount of composition applied is indicated in Table 17. The measurements were carried out on a control dish and the test dishes. The amount of inhibition expressed for the composition is presented as the amount of growth relative to the growth of the control dish.

Table 17.

<td>Test organism</td><td>6 μl on agar% inhibition</td><td>12.5 μl on agar% inhibition</td>

<td>Rhizoctonia solani</td><td> 100</td><td> 100</td>

<td>Phytophthora cinnamomi</td><td> 52</td><td> 78</td>

<td>Verticillum dahliae</td><td> 0</td><td> 0</td>

<td>Sclerotiorum sclerotiorum</td><td> 0</td><td> 64</td>

<td>Penicillumsp.</td><td> 0</td><td> 33</td>

<td>Aspergillus fumigatus</td><td> 30</td><td> 60</td>

<td>Fusarium solani</td><td> 0</td><td> 32</td>

<td>Pythium ultimum</td><td> 100</td><td> 100</td>

<td>Bortytis cinerea</td><td> 0.</td><td> 50</td>

<td>E.coli</td><td>ND</td><td>No growth</td>

<td>Bacillus subtilus</td><td>ND</td><td>Trace</td>

ND = not determined

The control bacteria grew well and the indication “trace” indicates that a weak growth took place compared to the control.

MA 38484131 The results of this example show that the composition is active in the aqueous phase, since all the organisms, at one or all of the concentrations, were affected during at least 24 hours. At 25 μl, the effect was maximized since most of the organisms were 100% inhibited (Table 16). When the composition was placed directly in the middle of the dish on the surface, the influence of the composition was somewhat reduced, since there was undoubtedly a diffusion in the agar bed. Nevertheless, antimicrobial activity was observed (Table 17). The highest concentration (12.5 µl) affected both the fungi and the test bacteria more than the lower dose (6 µl) on the agar bed, except for Verticillum.