PL2118276T3

Starch hydrolysis using phytase with an alpha amylase

Abstract

This record has no abstract on file.

Term

No projected expiry on record.

10 claims: 1 independent, 9 dependent

1
Patent claims Zastrzeżenia patentowe 1. A method for liquefying starch, the method comprising:1. Sposób upłynniania skrobi, przy czym sposób obejmuje: (a) incubating the suspension containing the granular starch substrate with the enzyme composition at a temperature that is above 55 ° C and below the initial temperature, gelatinization of the starch for the granular starch substrate for from about 2 min to about 4 hours. in the pH range from about 4.0 to about 6.2. (a) inkubowanie zawiesiny zawierającej ziarnisty substrat skrobiowy z kompozycją enzymów w temperaturze, która jest powyżej 55°C i poniżej temperatury początkowej żelatynizowanie skrobi dla ziarnistego substratu skrobiowego przez od około 2 min do około 4 godz. w zakresie pH od około 4,0 do około 6,2. (b) podwyższanie temperatury o od 0 do około 45°C powyżej temperatury początkowej żelatynizowanie skrobi na od około 5 min do około 6 godz. w pH między pH około 4,0 a około 6,2 i otrzymywanie upłynnionej skrobi;(b) raising the temperature from 0 to about 45 ° C above the initial temperature, gelatinizing the starch for about 5 min to about 6 hours. at a pH between pH about 4.0 and about 6.2 and obtaining liquefied starch;przy czym kompozycja enzymów zawiera mieszaninę fitazy i alfa-amylazy, przy czym fitaza ma sekwencję aminokwasową wykazującą co najmniej 90% identyczności sekwencji z sekwencją BP-WT: wherein the enzyme composition comprises a mixture of phytase and alpha-amylase, wherein the phytase has an amino acid sequence having at least 90% sequence identity with the BP-WT sequence: NDTPASGYQV EKWILSRHG VRAPTKMTQT MRDVTPNTWP EWPVKLGYIT NDTPASGYQV EKWILSRHG VRAPTKMTQT MRDVTPNTWP EWPVKLGYIT PRGEHLISLM GGFYRQKFQQ QGILSQGSCP TPNSIYVWAD VDQRTLKTGE PRGEHLISLM GGFYRQKFQQ QGILSQGSCP TPNSIYVWAD VDQRTLKTGE AFLAGLAPQC GLTIHHQQNL EKADPLFHPV KAGTCSMDKT QVQQAVEKEA AFLAGLAPQC GLTIHHQQNL EKADPLFHPV KAGTCSMDKT QVQQAVEKEA QTPIDNLNQH YIPFLALMNT TLNFSTSAWC QKHSADKSCD LGLSMPSKLS QTPIDNLNQH YIPFLALMNT TLNFSTSAWC QKHSADKSCD LGLSMPSKLS IKDNGNKVAL DGAIGLSSTL AEIFLLEYAQ GMPQAAWGNI HSEQEWASLL IKDNGNKVAL DGAIGLSSTL AEIFLLEYAQ GMPQAAWGNI HSEQEWASLL KLHNVQFDLM ARTPYIARHN GTPLLQAISN ALNPNATESK LPDISPDNKI KLHNVQFDLM ARTPYIARHN GTPLLQAISN ALNPNATESK LPDISPDNKI LFIAGHDTNI ANIAGMLNMR WTLPGQPDNT PPGGALVFER LADKSGKQYV LFIAGHDTNI ANIAGMLNMR WTLPGQPDNT PPGGALVFER LADKSGKQYV SVSMVYQTLE QLRSQTPLSL NQPAGSVQLK IPGCNDQTAE GYCPLSTFTR SVSMVYQTLE QLRSQTPLSL NQPAGSVQLK IPGCNDQTAE GYCPLSTFTR WSQSVEPGC QLQ lub z sekwencją BP-11: WSQSVEPGC QLQ or with the BP-11 sequence: NDTPASGYQV EKWILSRHG VRAPTKMTQT MRDVTPNTWP EWPVKLGYIT PRGEHLISLM GGFYRQKFQQ QGILSQGSCP TPNSIYVWTD VDQRTLKTGE AFLAGLAPQC GLTIHHQQNL EKADPLFHPV KAGICSMDKT QVQQAVEKEA QTPIDNLNQH YIPSLALMNT TLNFSKSPWC QKHSADKSCD LGLSMPSKLS IKDNGNEVSL DGAIGLSSTL AEIFLLEYAQ GMPQAAWGNI HSEQEWALLL KLHNVYFDLM ERTPYIARHK GTPLLQAISN ALNPNATESK LPDISPDNKI LFIAGHDTNI ANIAGMLNMR WTLPGQPDNT PPGGALVFER LADKSGKQYV SVSMVYQTLE QLRSQTPLSL NQPAGSVQLK IPGCNDQTAE GYCPLSTFTR WSQSVEPGC QLQ or sequence of BP-17: NDTPASGYQV EKWILSRHG VRAPTKMTQT MRDVTPNTWP EWPVKLGYIT PRGEHLISLM GGFYRQKFQQ QGILSQGSCP TPNSIYVWTD VDQRTLKTGE AFLAGLAPQC GLTIHHQQNL EKADPLFHPV KAGICSMDKT QVQQAVEKEA QTPIDNLNQH YIPSLALMNT TLNFSKSPWC QKHSADKSCD LGLSMPSKLS IKDNGNEVSL DGAIGLSSTL AEIFLLEYAQ GMPQAAWGNI HSEQEWALLL KLHNVYFDLM ERTPYIARHK GTPLLQAISN ALNPNATESK LPDISPDNKI LFIAGHDTNI ANIAGMLNMR WTLPGQPDNT PPGGALVFER LADKSGKQYV SVSMVYQTLE QLRSQTPLSL NQPAGSVQLK IPGCNDQTAE GYCPLSTFTR WSQSVEPGC qlq lub z sekwencją BP-17: NDTPASGYQV EKWILSRHG VRAPTKMTQT MRDVTPNTWP EWPVKLGYIT PRGEHLISLM GGFYRQKFQQ QGILSQGSCP TPNSIYVWTD VAQRTLKTGE AFLAGLAPQC GLTIHHQQNL EKADPLFHPV KAGICSMDKT QVQQAVEKEA NDTPASGYQV EKWILSRHG VRAPTKMTQT MRDVTPNTWP EWPVKLGYIT PRGEHLISLM GGFYRQKFQQ QGILSQGSCP TPNSIYVWTD VAQRTLKTGE AFLAGLAPQC GLTIHHQQNV QQAGQFQQQQQEA QTPIDNLNQH YIPSLALMNT TLNFSKSPWC QKHSADKSCD LGLSMPSKLS QTPIDNLNQH YIPSLALMNT TLNFSKSPWC QKHSADKSCD LGLSMPSKLS IKDNGNEVSL DGAIGLSSTL AEIFLLEYAQ GMPQAAWGNI HSEQEWALLL IKDNGNEVSL DGAIGLSSTL AEIFLLEYAQ GMPQAAWGNI HSEQEWALLL KLHNVYFDLM ERTPYIARHK GTPLLQAISN ALNPNATESK LPDISPDNKI KLHNVYFDLM ERTPYIARHK GTPLLQAISN ALNPNATESK LPDISPDNKI LFIAGHDTNI ANIAGMLNMR WTLPGQPDNT PPGGALVFER LADKSGKQYV LFIAGHDTNI ANIAGMLNMR WTLPGQPDNT PPGGALVFER LADKSGKQYV SVSMVYQTLE QLRSQTPLSL NQPAGSVQLK IPGCNDQTAE GYCPLSTFTR SVSMVYQTLE QLRSQTPLSL NQPAGSVQLK IPGCNDQTAE GYCPLSTFTR WSQSVEPGC QLQ. WSQSVEPGC QLQ.

518 paragraphs in 171 sections, as filed

[0001] The invention relates to enzyme compositions containing at least one phytase and at least one alpha-amylase, methods for liquefying starch and methods for producing end products such as glucose and alcohols (e.g. ethanol).

BACKGROUND OF THE INVENTION [0002] In industrial fermentation, as a raw material for the production of many end products, such as enzymes, proteins, amino acids, organic acids, sugar alcohols, pharmaceuticals and other biochemical agents, glucose is usually used. In many applications, glucose is produced by enzymatic conversion of substrates containing starch and cellulose (e.g., ground whole cereal grains). Starch, which contains two polysaccharide fractions, amylose and amylopectin, accumulates in plant cells in the form of granular particles. The partially crystal structure of these grains causes insolubility in cold water, and as a result, solubilization of starch grains in water generally requires thermal energy to disrupt the crystal structure of the grain. Numerous methods have been used to solubilize starch and include direct and indirect heating of granular starch containing substrates. (See, for example, STARCH CHEMISTRY AND TECHNOLOGY, Eds RL Whistler et al., 2nd Ed., 1984 Academic Press Inc., Orlando FL and STARCH CONVERSION TECHNOLOGY, Eds GMA Van Beynum et al., Food Science and Technology Series 1985 Marcel Dekker Inc. NY).

[0003] The processing of starch into glucose generally consists of two stages and these stages include liquefying starch and saccharification of liquefied starch. Further steps may include (a) purification and isomerization if the desired end product is purified dextrose or fructose, or (b) fermentation and distillation if the desired end product is, for example, alcohol (e.g. ethanol).

[0004] The purpose of the starch liquefaction process is to convert a suspension of starch polymer grains into a solution of dextrins with shorter chains, low viscosity. This is an important step for convenient handling of industrial equipment used in starch conversion methods. Usually, starch is liquefied using high temperature and enzymatic bioconversion. For example, a common method of enzymatic liquefaction involves the addition of a thermostable bacterial alpha-amylase (e.g. SPEZYME® PRIME and SPEZYME® FRED, SPEZYME® XTRA (Genencor International Inc.) or TERMAMYL SC, TERMAMYL SUPRA or TERMAMYL 120L (Novozymes)) for a suspension containing a substrate including granular starch and a pH adjustment between 5.5 and 6.5, and temperatures higher than 90 ° C. Starch is gelatinized and then can be treated with saccharification enzymes. Usually saccharification occurs in the presence of glucoamylase enzymes such as glucoamylase from Aspergillus niger (e.g. OPTIDEX L-400 (Genencor International Inc.)) at a more acidic pH than the pH of the liquefaction step. The pH for a typical saccharification step is from about pH 4.0 to 5.0.

[0005] WO2006 / 043178 describes the cloning of the phytase gene from Buttiauxella sp. P1-29.

[0006] WO96 / 28567 describes the use of a phytase to improve the flow of starch. WO01 / 62947 describes the fermentation of a phytic acid containing material in the presence of phytase.

[0007] There are many varieties of liquefaction and saccharification of the starch substrate, and despite advances in the prior art, there remains a need for more effective starch liquefaction agents.

SUMMARY OF THE INVENTION [0008] The invention provides a method for liquefying starch, the method comprising:

(a) incubating the suspension containing the granular starch substrate with the enzyme composition at a temperature that is above 55 ° C and below the initial gelatinization temperature of the starch for the granular starch substrate for about 2 min to about 4 hours. in the pH range from about 4.0 to about 6.2.

(b) raising the temperature by 0 to about 45 ° C above the initial temperature, gelatinizing the starch for about 5 min to about 6 hours. at a pH between pH about 4.0 and about 6.2 and obtaining liquefied starch;

wherein the enzyme composition comprises a mixture of phytase and alpha-amylase, wherein the phytase has an amino acid sequence having at least 90% sequence identity with the BP-WT sequence:

NDTPASGYQV EKWILSRHG VRAPTKMTQT MRDVTPNTWP EWPVKLGYIT PRGEHLISLM GGFYRQKFQQ QGILSQGSCP TPNSIYVWAD VDQRTLKTGE AFLAGLAPQC GLTIHHQQNL EKADPLFHPV KAGTCSMDKT QVQQAVEKEA QTPIDNLNQH YIPFLALMNT TLNFSTSAWC QKHSADKSCD LGLSMPSKLS IKDNGNKVAL DGAIGLSSTL AEIFLLEYAQ GMPQAAWGNI HSEQEWASLL KLHNVQFDLM ARTPYIARHN GTPLLQAISN ALNPNATESK LPDISPDNKI LFIAGHDTNI ANIAGMLNMR WTLPGQPDNT PPGGALVFER LADKSGKQYV SVSMVYQTLE QLRSQTPLSL NQPAGSVQLK IPGCNDQTAE GYCPLSTFTR WSQSVEPGC QLQ or sequence of BP-11:

NDTPASGYQV

PRGEHLISLM

AFLAGLAPQC

QTPIDNLNQH

IKDNGNEVSL

KLHNVYFDLM

LFIAGHDTNI

SVSMVYQTLE

WSQSVEPGC

EKWILSRHG

GGFYRQKFQQ

GLTIHHQQNL

YIPSLALMNT

DGAIGLSSTL

ERTPYIARHK

ANIAGMLNMR

QLRSQTPLSL

QLQ

VRAPTKMTQT

QGILSQGSCP

EKADPLFHPV

TLNFSKSPWC

AEIFLLEYAQ

GTPLLQAISN

WTLPGQPDNT

NQPAGSVQLK

MRDVTPNTWP

TPNSIYVWTD

KAGICSMDKT

QKHSADKSCD

GMPQAAWGNI

ALNPNATESK

PPGGALVFER

IPGCNDQTAE

EWPVKLGYIT

VDQRTLKTGE

QVQQAVEKEA

LGLSMPSKLS

HSEQEWALLL

LPDISPDNKI

LADKSGKQYV

GYCPLSTFTR or with the BP-17 sequence:

NDTPASGYQV

PRGEHLISLM

AFLAGLAPQC

QTPIDNLNQH

IKDNGNEVSL

KLHNVYFDLM

LFIAGHDTNI

SVSMVYQTLE

WSQSVEPGC

EKWILSRHG

GGFYRQKFQQ

GLTIHHQQNL

YIPSLALMNT

DGAIGLSSTL

ERTPYIARHK

ANIAGMLNMR

QLRSQTPLSL

QLQ.

VRAPTKMTQT

QGILSQGSCP

EKADPLFHPV

TLNFSKSPWC

AEIFLLEYAQ

GTPLLQAISN

WTLPGQPDNT

NQPAGSVQLK

MRDVTPNTWP

TPNSIYVW.TD

KAGIĆSMDKT

QKHSADKSCD

GMPQAAWGNI

ALNPNATESK

PPGGALVFER

IPGCNDQTAE

EWPVKLGYIT

VAQRTLKTGE

QVQQAVEKEA

LGLSMPSKLS

HSEQEWALLL

LPDISPDNKI

LADKSGKQYV

GYCPLSTFTR [0009] Alpha-amylase may be from Bacillus sp., E.g. Bacillus stearothermophilus or Bacillus licheniformis.

[0010] The composition may be a starch hydrolyzing composition.

[0011] The phytase may exhibit, for example, at least 95% sequence identity with the BP-WT, BP-11 or BP-17 sequence, or may contain the BP-11 or BP-17 sequence.

[0012] The method may further include the steps of saccharifying the liquefied starch to obtain dextrins; and dextrin recovery. The method may further comprise the step of fermenting dextrins under suitable fermentation conditions to obtain final products. Such end products can include alcohol (e.g., ethanol), organic acids, sugar alcohols, ascorbic acid intermediates, amino acids and proteins.

BRIEF DESCRIPTION OF THE FIGURES [0013]

Fig. 1 schematically shows an embodiment of the invention that includes a pre-treatment (first liquefaction) step.

Fig. 2 shows a decrease in viscosity of a 36% ds suspension of ground whole maize exposed to phytase and alpha-amylase at 85 ° C, pH 5.8 and reference is made to Example 8.

Fig. 3 shows the decrease in viscosity of a 30% ds slurry of corn flour at pH 5.8 with a combination of SPEZYME XTRA and BP-17, as further described in Example 9.

Fig. 4 shows the pTREX4 / phytase fusion construct that was used for heterologous expression of both wild type Buttiauxella phytases and BP-17 variant.

Fig. 5 shows the direct construct pTREX4 / phytase which was used for heterologous expression of both wild type Buttiauxella phytases and BP-17 variant.

DETAILED DESCRIPTION OF THE INVENTION

Definitions [0014] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In Singleton, et al., DICTIONARY OF MICROBIOLOGY AND

MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994) and Hale &

Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY

(1991) one of ordinary skill in the art will find the general meanings of many of the terms used herein. However, some terms are defined below for clarity and ease of reference.

[0015] The term "phytase" as used herein refers to an enzyme that is capable of catalyzing the hydrolysis of phosphoric acid esters, including phytate, and releasing inorganic phosphate and inositol. In some embodiments, in addition to phytate, the phytase may have the ability to hydrolyze at least one of the inositol phosphates from intermediate levels of phosphorylation.

[0016] The term "wild type" as used herein refers to an enzyme naturally occurring (native) in a host cell. In some embodiments, the term "parent" or "parent sequence" is used interchangeably with the term wild type.

[0017] The term "wild-type Buttiauxella phytase (WT-BP)" refers to an enzyme with the amino acid sequence of SEQ ID NO: 1.

[0018] The term "Buttiauxella (BP-11) phytase" refers to a variant phytase enzyme having the amino acid sequence of SEQ ID NO: 2.

[0019] The term "Buttiauxella (BP-17) phytase" refers to a variant phytase enzyme having the amino acid sequence of SEQ ID NO: 3.

[0020] "Alpha-amylases" are α-1,4-glucan-4-glucanhydrolase (EC 3.2.1.1) and are enzymes that cleave or hydrolyze the internal α-1,4-glycosidic linkages in starch (e.g. amylopectin polymers or amylose).

[0021] The term "functional equivalent" means that the enzyme has the same functional enzymatic properties as Buttiauxella sp. Phytase (WT-BP) and is derived from wild-type phytase.

[0022] The term "variety" used in reference to an enzyme (e.g., alpha-amylase, phytase and the like) means an enzyme derived from a naturally occurring (wild-type) enzyme but with the substitution, insertion or deletion of one or more amino acids in compared to a naturally occurring enzyme. The term includes hybrid forms of the enzyme in which the enzyme, for example, may have a C-terminus derived from one Bacillus sp. (E.g., B. licheniformis) and the N-terminus derived from another Bacillus sp. (e.g. B. stearothermophilus). A variety may have one or more altered properties compared to the wild type, such as, but not limited to, increased thermal stability, increased proteolytic stability, increased specific activity, broader substrate specificity, broader pH activity, or combinations thereof.

[0023] The term "contacting" refers to placing at least one enzyme close enough to its respective substrate to allow the enzyme (om) to convert the substrate to at least one final product. Those skilled in the art will recognize that mixing of at least one solution containing at least one enzyme with the appropriate enzyme substrate (s) results in "contacting".

[0024] "Liquefaction" or "liquefying" means a method in which starch is converted into dextrins with shorter chains and lower viscosity.

[0025] "Dextrins" are short-chain glucose polymers (e.g., from 2 to 10 units).

[0026] The term "starch" as used herein refers to any material containing complex polysaccharide plant carbohydrates consisting of amylose and amylopectin of formula (C6H10O5) x, where x can be any number.

[0027] The term "granular starch" means raw starch, that is, starch that has not been subjected to gelatinization temperatures.

[0028] The terms "saccharification enzyme" and "glucoamylase (EC 3.2.1.3)" are used interchangeably herein to refer to any enzyme capable of catalyzing the release of D-glucose from non-reducing ends of starch and related oligo- and polysaccharides.

[0029] The term "oligosaccharides" refers to any compound having from 2 to 10 monosaccharide units linked by glycosidic bonds. These short chain polymers of simple sugars include dextrins.

[0030] The term "DE" or "glucose equivalent" is an industrial standard for measuring the concentration of total reducing sugars, calculated as D-glucose based on dry matter. Non-hydrolyzed granular starch has a DE that is generally 0 and D-glucose has a DE of 100.

[0031] The term "glucose syrup" refers to an aqueous composition containing glucose solids. The glucose syrup will have a DE of at least 20. In some embodiments, the glucose syrup will not contain more than 21% water and will not contain less than 25% reducing sugar calculated as dextrose. In one embodiment, the glucose syrup will contain at least 90% D-glucose, and in another embodiment, the glucose syrup will contain at least 95% D-glucose. In some embodiments, the terms glucose and glucose syrup are used interchangeably.

[0032] The term "total sugar content" refers to the total sugar content present in the starch composition.

[0033] The term "dry substances (ds)" refers to the total solids in suspension in% on a dry matter basis.

[0034] As used herein, "percent (%) sequence identity" relative to the amino acid or nucleotide sequences set forth herein is defined as the percentage of amino acid residues or nucleotides in the candidate sequence that are identical to the amino acid residues or nucleotides in the sequence after matching sequence and introducing breaks, if necessary, to achieve the maximum percentage of sequence identity, without being considered that any conservative substitutions form part of sequence identity. Methods for performing sequence alignment and determining sequence identity are known to those skilled in the art, can be carried out without undue experimentation, and precise calculations of identity values can be obtained. See for example Ausubel, et al., Eds. (1995) Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN program (Dayhoff (1978) in Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research Foundation, Washington, DC). Many algorithms are available for sequence alignment and sequence identity determination, and include, for example, a homology alignment algorithm Needlemana et al., (1970) J. Mol. Biol. 48: 443; Smith's local homology algorithm, et al., (1981) Adv. Appl. Math. 2: 482; Pearson's similarity search method et al. (1988) Proc. Natl. Acad. Sci. 85: 2444; Smith's Waterman algorithm (Meth. Mol. Biol. 70: 173-187 (1997); and the BLASTP, BLASTN and BLASTX algorithms (see Altschul et al., (1990) J. Mol. Biol. 215: 403-410). Computer programs utilizing these algorithms are also available and include but are not limited to: ALIGN or Megalign (DNASTAR) or WU-BLAST-2 software (Altschul et al., Meth. Enzym., 266: 460-480 (1996)); or GAP, BESTFIT, BLAST (Altschul, et al.), supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, Version 8, Madison, Wis., USA; and CLUSTAL in the PC / Gene program from Intelligenetics, Mountain View, Calif. Those skilled in the art may determine appropriate parameters for measuring alignment, including the algorithms needed to achieve maximum alignment over the length of compared sequences. Sequence identity is preferably determined using default parameters specified by the program. Sequence identity can be specifically determined using a Smith-Waterman homology search algorithm (Meth. Mol. Biol. 70: 173-187 (1997)), implemented in the MSPRCH (Oxford Molecular) program using search with affine gap penalties with the following search parameters: gap opening penalty of 12 and gap extension penalty of 1. Comparisons of paired amino acids can preferably be made using the GAP program from the GCG sequence analysis software package from Genetics Computer Group, Inc., Madison, Wis., Using the blosum62 amino acid substitution matrix, with a gap weight of 12 and a gap length weight of

2. Compared with the optimal alignment of the two amino acid sequences, the adjacent segment of the variant amino acid sequence may have additional amino acid residues or deleted amino acid residues compared to the amino acid reference sequence. The adjacent segment used for comparison with the amino acid reference sequence will comprise a string of at least 20 amino acid residues and may include 30, 40, 50 or more amino acid residues. Corrections in terms of increased sequence identity associated with the inclusion of gaps in the derivative of the amino acid sequence can be made by determining gap penalties.

[0035] The term "% homology" is used interchangeably with the term "% identity". Exemplary computer programs that can be used to determine the identity of two sequences include but are not limited to a BLAST program package, e.g., BLASTN, BLASTX and TBLASTX, BLASTP and TBLASTN, and are generally available on the Internet (see, for example, the BLAST page on the National Center for Biotechnology Information). See also Altschul, et al., 1990 and Altschul, et al., 1997.

[0036] Sequence searching is typically performed using the BLASTN program when a given nucleic acid sequence is evaluated against nucleic acid sequences from the GenBank DNA Sequences database and other publicly available databases. The BLASTX program is beneficial when looking for nucleic acid sequences that have been translated in all reading frames, among the amino acid sequences from GenBank Protein Sequences and other publicly available databases. Both BLASTN and BLASTX operate using default parameters with a gap penalty of 11.0 and a gap penalty of 1.0, and use the BLOSUM-62 matrix. (See, e.g. Altschul, et al., 1997.) [0037] Advantageous matching of selected sequences to determine "% identity" between two or more sequences is performed using, for example, the CLUSTAL-W program in Mac Vector version 6.5 running with default parameters, including penalty for a break of 10.0, penalty for prolongation of a break of 0.1 and similarity matrix BLOSUM 30.

[0038] The term "ground" as used herein refers to plant material whose size has been reduced, such as by milling, crushing, fractionating or otherwise reducing the size of the particles. Grinding includes dry or wet milling. "Dry milling" refers to the milling of all dry grain. "Wet milling" refers to the way in which the grain is first soaked (soaked) in water to soften the grain.

[0039] The term "gelatinization" means solubilization of a starch molecule, generally by cooking, to form a viscous suspension.

[0040] The term "gelatinization temperature" refers to the lowest temperature at which gelatinization of the starch containing substrate begins. The exact temperature of gelatinization depends on the specific starch and may vary depending on factors such as plant species and environmental and growth conditions.

[0041] The term "below gelatinization temperature" refers to a temperature that is lower than the gelatinization temperature.

[0042] The term "suspension" refers to an aqueous mixture containing insoluble solids (e.g., granular starch).

[0043] The term "fermentation" refers to the enzymatic and anaerobic digestion of organic substances by microorganisms to produce simpler organic compounds. Although fermentation occurs under anaerobic conditions, it is not intended to be limited to strict anaerobic conditions because fermentation also occurs in the presence of oxygen.

[0044] The expression "simultaneous saccharification and fermentation (SSF)" refers to a method for producing end products in which a fermentation organism, such as an ethanol producing microorganism, and at least one enzyme, such as a saccharification enzyme, is combined in the same process step in the same dish.

[0045] The term "rare stillage" means the liquid part of the stillage separated from the solids (e.g., by screening or centrifugation), which contains suspended fine particles and dissolved material. The terms "counter-current" and / or "make-up water" are generally used to refer to the rare stillage returned to circulation.

[0046] The term "end product" refers to any product derived from a carbon source that is enzymatically converted from a fermentable substrate. In some preferred embodiments, the end product is alcohol (e.g., ethanol).

[0047] The term "derived" includes the terms "resulting from", "obtained", "obtained" or "obtainable from" and "isolated from" and in some embodiments, as used herein, means that the polypeptide encoded by the nucleotide sequence is produced by a cell in which the nucleotide is naturally occurring or into which the nucleotide has been introduced.

[0048] As used herein, the term "fermentative organism" refers to any microorganism or cell that is suitable for use in fermentation for direct or indirect production of the final product.

[0049] As used herein, the term "ethanol producer" or "ethanol producing microorganism" refers to a fermentation organism that is capable of producing ethanol from a mono- or oligosaccharide.

[0050] As used herein, the terms "downloaded", "isolated" and "separated" refer to a protein, cell, nucleic acid or amino acid that has been removed from at least one component with which it is naturally associated.

[0051] The terms "protein" and "polypeptide" are used interchangeably herein. The disclosure and claims use traditional one-letter and three-letter amino acid residue codes. The 3-letter amino acid code is defined according to the [recommendations] of the IUPAC-IUB Joint Biochemical Nomenclature Commission (JCBN). It is also understood that a polypeptide may be encoded by more than one nucleotide sequence because the genetic code is degenerated.

[0052] The term "operably linked" refers to a combination in which the elements are arranged so that they can be functionally linked. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence.

[0053] The term "selection marker" refers to a gene capable of expression in a host that allows easy selection of those hosts containing the introduced nucleic acid or vector. Examples of selectable markers include, but are not limited to, antimicrobial agents (e.g., hygromycin, bleomycin or chloramphenicol) and / or genes that provide the host cell with metabolic benefit, such as food benefit.

[0054] The term "heterologous" when referring to a polynucleotide or protein refers to a polynucleotide or protein that does not occur naturally in the host cell. In some embodiments, the protein is a commercially important industrial protein. The term is intended to include proteins that are encoded by naturally occurring genes, mutated genes, and / or synthetic genes.

[0055] The term "endogenous" when referring to a polynucleotide or protein refers to a polynucleotide or protein that occurs naturally in a host cell.

[0056] As used herein, the terms "transformed", "stably transformed" and "transgenic" when used in reference to a cell mean that the cell has a non-native (i.e. heterologous) nucleic acid sequence incorporated into its genome or as an episomal plasmid that is maintained by many generations.

[0057] The term "expression" as used herein refers to a process by which a polypeptide based on a gene nucleic acid sequence is produced. The process involves both transcription and translation.

[0058] The term "introduced" in the context of inserting a nucleic acid sequence into a cell means "transfection", "transformation" or "transduction" and includes reference to the incorporation of the nucleic acid sequence into a eukaryotic or prokaryotic cell, wherein the nucleic acid sequence may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted to autonomous replicon or transiently expressed (e.g., transfected mRNA).

[0059] It should be noted that the singular, as used herein and in the appended claims, includes the plural, unless the context clearly indicates otherwise. Thus, for example, reference to "a cell" includes reference to one or more cells and their equivalents known to those skilled in the art, and so on.

[0060] Where a range of values is given, it should be understood that each intermediate value, up to a tenth of the lower limit unit, unless the context clearly indicates otherwise, between the upper and lower limits of this range is also disclosed in detail. Any narrower range between any given value or intermediate value within the given range and any other given or intermediate value within that given range is encompassed by the invention. The upper and lower limits of such narrower ranges may independently be or not within the range, and any range in which one, none or both of the limits are within the narrower ranges is also encompassed by the invention, subject to any specifically excluded limit in the range given. Where the ranges given include one or both limits, ranges excluding one or both of these included limits are also included in the invention.

[0061] Other definitions or terms may appear throughout the description.

Before the exemplary embodiments are described in more detail, it should be understood that this invention is not limited to the specific embodiments described and, of course, they may vary.

Exemplary Embodiments [0062] The inventors have found that the addition of phytase, particularly wild-type Buttiauxella sp. (E.g., P1-29, SEQ ID NO: 1) and variants thereof (e.g., BP-11, SEQ ID NO: 2 and BP-17, SEQ ID NO: 3) for a method of starch hydrolysis comprising alpha-amylase provides certain advantages over using alpha-amylase without phytase. In addition, the inventors have found that the use of wild-type Buttiauxella sp. Phytase (e.g. P 1-29) and its varieties provides ways to increase the efficiency of starch hydrolysis.

[0063] Current ethanol methods require pH adjustment before and after liquefaction of starch to provide suitable conditions for liquefaction enzymes and yeast fermentation. PH regulation leads to numerous disadvantages. For example, pH regulation results in a high salt concentration that can inhibit fermentation organisms. If sulfuric acid is used, this can also result in problems with sulfur removal. In addition, pH regulation requires additional steps in the method, which reduces efficiency. By stabilizing liquefying enzymes (e.g., alpha-amylases) with phytase, it was found that liquefaction could occur at a lower pH than would normally be required. In fact, treatment with phytases could result in liquefaction at the pH of the suspension of ground whole grains without adjusting the pH, even if the suspension of ground whole grains contains high levels of rare stillage. This allowed the elimination of pH regulation by alkali or acids during the conversion of whole grains to ethanol. This in turn enabled the conversion of starch to glucose in a single liquefaction step without pH adjustment or in two liquefaction stages using low doses of enzyme. As an added advantage, this enabled the process to proceed with simultaneous saccharification and fermentation without any further pH regulation. In addition, even if the pH-controlled method is allowed to be carried out, this results in increased thermostability of alpha-amylase.

Phytases [0064] In some embodiments, the at least one phytase useful in the invention is that derived from the bacterium Buttiauxella spp. Buttiauxella spp. Includes B. agrestis, B. brennerae, B. ferragutiase, B. gaviniae, B. izardii, B. noackiae, and B. warmboldiae. Strains of the Buttiauxella species are available from DSMZ, the German national resource center for biological materials (InhoHenstraBe 7B, 38124 Braunschweig, Germany). Strain Buttiauxella sp. P1-29 deposited under accession number NCIMB 41248 is an example of a particularly useful strain from which a phytase can be obtained that can be used according to the invention. Phytases from Buttiauxella spp. Can be identified by the methods described in WO 06/043178, for example by hybridization techniques.

[0065] In a preferred embodiment, the phytase useful in this invention is that which exhibits at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98% and at least 99 % sequence identity with the amino acid sequence depicted in SEQ ID NO: 1 (see Table 1). More preferably, the phytase useful in the invention is one which exhibits from at least 95% to 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 or variants thereof. In some embodiments, the phytase comprises the amino acid sequence of SEQ ID NO: 1.

Table 1: BP-WT polypeptide sequence (SEQ ID NO: 1)

NDTPASGYQV EKWILSRHG VRAPTKMTQT MRDVTPNTWP EWPVKLGYIT

PRGEHLISLM GGFYRQKFQQ QGILSQGSCP TPNSIYVWAD VDQRTLKTGE

AFLAGLAPQC GLTIHHQQNL EKADPLFHPV KAGTCSMDKT QVQQAVEKEA

QTPIDNLNQH YIPFLALMNT TLNFSTSĄWC QKHSADKSCD LGLSMPSKLS

IKDNGNKVAL DGAIGLSSTL AEIFLLEYAQ GMPQAAWGNI HSEQEWASLL

KLHNVQFDLM ARTPYIARHN GTPLLQAISN ALNPNATESK LPDISPDNKI

LFIAGHDTNI ANIAGMLNMR WTLPGQPDNT PPGGALVFER LADKSGKQYV

SVSMVYQTLE QLRSQTPLSL NQPAGSVQLK IPGCNDQTAE GYCPLSTFTR

WSQSVEPGC QLQ (SEQIDNO: 1) [0066] In some other embodiments, the phytase is a phytase variety having an amino acid sequence as shown in SEQ ID NO: 1. Some preferred variants are the variants disclosed in PCT Patent Publication WO 2006/043178.

[0067] Other preferred variants of SEQ ID NO: 1 include polypeptides having a mutation in at least one of the following positions of SEQ ID NO: 1 according to this disclosure: 26, 37, 89, 92, 134, 160, 164, 171, 176, 178 , 188, 190, 192, 207, 209, 211, 235, 248, 256, 261, 270, 306 or 318. In some embodiments, the variant will include phytase polypeptides having a mutation in the following positions corresponding to SEQ ID NO: 1: 89, 134, 164, 176, 178, 207, 209, 248, 256, 261 and 270. In other embodiments, the variation will include at least 1 additional mutation at a position corresponding to SEQ ID NO: 1.

[0068] In other embodiments, the phytase will contain at least one mutation in the position corresponding to K26E, T134V / I, F164S, T176K, K207T / E, D211C or Q256Y. In other embodiments, the variation comprises polypeptides containing a combination of mutations. For example, reference should be made to Table 1 of WO 2006/043178, in which the numbering refers to SEQ ID NO: 3 of the published PCT application. In some embodiments, the variety exhibits at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or 100% phytase activity against the parent or wild type phytase from SEQ ID NO: 1.

[0069] In some embodiments, the phytase comprises or consists of the amino acid sequence of SEQ ID NO: 2 or phytases exhibiting with it at least 95%, at least 96%, at least 97%, at least 98% and at least 99% amino acid sequence identity. Phytase containing or consisting of the amino acid sequence of SEQ ID NO: 2 herein is also disclosed in WO 2006/043178 as a wild-type Buttiauxella spp. This variation is referred to herein as BP-11. There are 11 amino acid residues that differ in the amino acid sequence of SEQ ID NO: 1 (BP-WT) and variant BP-11 (SEQ ID NO: 2) and these residues are bold and underlined in Table 2 in the amino acid sequence of SEQ ID NO: 2. In some embodiments, the phytase will include a BP-11 phytase in which 1, 2, 3, or more amino acid changes can occur.

Table 2: Differences between the BP-WT and BP-11 amino acid sequence (SEQ ID NO: 2)

NDTPASGYQV

PRGEHLISLM

AFLAGLAPQC

QTPIDNLNQH

IKDNGNEVSL

KLHNVYFDLM

LFIAGHDTNI

SVSMVYQTLE

WSQSVEPGC

EKWILSRHG VRAPTKMTQT GGFYRQKFQQ QGILSQGSCP GLTIHHQQNL EKADPLFHPV YIPSLALMNT TLNFSKSPWC DGAIGLSSTL AEIFLLEYAQ ERTPYIARHK GTPLLQAISN ANIAGMLNMR WTLPGQPDNT QLRSQTPLSL NQPAGSVQLK QLQ (SEQ ID NO: 2)

MRDVTPNTWP EWPVKLGYIT TPNSIYVWTD VDQRTLKTGE KAGICSMDKT QVQQAVEKEA QKHSADKSCD LGLSMPSKLS GMPQAAWGNI HSEQEWALLL ALNPNATESK LPDISPDNKI PPGGALVFER LADKSGKQYV IPGCNDQTAE GYCPLSTFTR [0070] In some Ex Adach embodiment variant BE will comprise or consist of substitutions of amino acid residues corresponding to the positions of residues A89, D92, T134, F174, T186, A188 , K207, A209, S248, Q256, A261 and N269 in SEQ ID NO: 1. In some embodiments, the phytase comprises or consists of the amino acid sequence of SEQ ID NO: 3 or phytases exhibiting with it at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% amino acid sequence identity. The SEQ ID NO: 3 variation is referred to herein as BP-17. There are 12 amino acid residues that differ in the amino acid sequence of SEQ ID NO: 1 and variant BP-17 (SEQ ID NO: 3), and the reference is to the following substitutions A89T, D92A, T134I, F174S, T186K, A188P, K207E, A209S, S248L , Q256Y, A261E and N269K. In addition, BP-17 differs from BP-11 by one amino acid substitution at the position corresponding to residue 92. Thus, in some embodiments, the variety exhibits at least 90%, 95%, 96%, 97%, 98% and 99% sequence identity with SEQ ID NO: 1, and at least has alanine as amino acid 92. In other embodiments, the variety exhibits at least 95%, 96%, 97%, 98% and 99% sequence identity with SEQ ID NO: 3 and at least has alanine as amino acid 92. In other embodiments, the variety exhibits at least 95%, 96%, 97%, 98% and 99% sequence identity with SEQ ID NO: 1 and at least has alanine as amino acid 92 and has at least one other amino acid substitution selected from the group: A89T , T134I, F174S, T186K, A188P, K207E, A209S, S248L, Q256Y, A261E and N269K. The differences between the residues in BP-WT and BP-17 are extruded and highlighted in Table 3 below:

Table 3: Differences in the amino acid sequence BP-WT and BP-17 (SEQ ID NO: 3)

NDTPASGYQV

PRGEHLISLM

AFLAGLAPQC

QTPIDNLNQH

IKDNGNEVSL

KLHNVYFDLM

LFIAGHDTNI

SVSMVYQTLE

WSQSVEPGC

EKWILSRHG GGFYRQKFQQ GLTIHHQQNL YIPSLALMNT DGAIGLSSTL ERTPYIARHK ANIAGMLNMR QLRSQTPLSL QLQ (SEQIDT

VRAPTKMTQT

QGILSQGSCP

EKADPLFHPV

TLNFSKSPWC

AEIFLLEYAQ

GTPLLQAISN

WTLPGQPDNT

NQPAGSVQLK

0:3)

MRDVTPNTWP

TPNSIYVWTD

KAGICSMDKT

QKHSADKSCD

GMPQAAWGNI

ALNPNATESK

PPGGALVFER

IPGCNDQTAE

EWPVKLGYIT

VAQRTLKTGE

QVQQAVEKEA LGLSMPSKLS

HSEQEWALLL

LPDISPDNKI

LADKSGKQYV

GYCPLSTFTR [0071] In some embodiments, the phytase having at least 95% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 3 will contain a conservative amino acid substitution. Conservative amino acid substitutions include, for example, for Ala, Gly or Cys substitution; for Arg substitution Lys, Met or Ile; for Asn substitution Asp or Glu; for Asp substitution with Asn or Gln; for Cys substitution Met or Thr; for Gln, substitution with Asn, Glu, or Asp; for Gly, Ala or Pro substitution; for Ile, Val, Leu, or Met substitution; for Leu, substitution of Val or Met; for Lys Arg, Met or Ile substitution; for Met substitution Cys, Ile, Leu or Val; for Phe substitution Tyr, His, Trp; for Ser substitution Thr, Met or Cys; for Thr substitution Ser, Met or Val; for Tyr Phe or His substitution and for Val Leu, Ile or Met substitution.

Alpha-amylases [0072] In some embodiments, the alpha-amylase is an acid stable alpha-amylase, which when added in an effective amount exhibits activities in the pH range from 3.0 to 7.0, preferably from 3.5 to 6.5 . The alpha-amylases useful according to the invention may be fungal alpha-amylases or bacterial alpha-amylases. In addition, the alpha-amylase may be wild-type alpha-amylase, a variant or fragment thereof, or a hybrid alpha-amylase, which is derived, for example, from a catalytic domain from one microbial source and a starch binding domain from another microbial source.

[0073] Some examples of fungal alpha-amylases include those obtained from filamentous fungal strains, including but not limited to Aspergillus strains (e.g., A. niger, A. kawachi and A. oryzae); Trichoderma sp., Rhizopus sp., Mucor sp., And Penicillium sp.

[0074] More preferably, the acid stable alpha-amylase is derived from bacterial strains. Bacterial strains include, but are not limited to Bacillus sp., Streptomyces sp. And Lactobacillus sp. Some bacterial strains include Bacillus sp. Such as B. licheniformis, B. stearothermophilus, B. amyloliquefaciens, B. subtilis, B. lentus, and B. coagulans. Especially B. licheniformis, B. stearothermophilus and B. amyloliquefaciens.

Preferably, one of the bacterial alpha-amylases used in the compositions and methods of the invention includes alpha-amylases described in USP 5,093,257; USP 5,763,385; USP 5,824,532; USP 5,958,739; USP 6,008,026; USP 6,093,563; USP 6,187,576; USP 6,297,038; USP 6,361,809; USP 6,867,031; US 2006/0014265; WO 96/23874, WO 96/39528; WO 97/141213, WO 99/19467; and WO 05/001064.

[0076] Commercially available alpha-amylases that are contemplated for use in the compositions and method of the invention include: SPEZYME® AA; SPEZYME® FRED; SPEZYME® XTRA; GZYME 997; and CLARASE L (Genencor International Inc.); TERMAMYL 120-L, LC and SC and SUPRA (Novozymes Biotech); LIQUOZYME X and SAN SUPER (Novozymes A / S) and ULTRA THIN (Diversa / Valley Research). In some embodiments, SPEZYME XTRA and / or SPEZYME FRED, as described in WO 05/111203, is used in combination with a Buttiauxella phytase or variant.

[0077] In some embodiments, the alpha-amylase is Termamyl-like alpha-amylase. Termamyl-like alpha-amylases are intended to mean alpha-amylases that, at the amino acid level, show substantial homology with B. licheniformis alpha-amylase, such as having at least 75% sequence identity, including 80%, 85%, 90%, 95 %, 99% and 100% sequence identity with B.licheniformis alpha-amylase designated SEQ ID NO: 4 in WO 06/066594.

[0078] The enzyme compositions used according to the invention may include mixed or formulated enzyme compositions. Enzymatic components can be used as a mixed formulation containing at least two enzymatic components mixed together (mixture), or the enzymatic components can be added individually during one or more process steps. This may include adding separate enzymatic components over time in such a way that the ratio of phytase to amylase enzymes is maintained, for example components are added simultaneously. By formulated enzyme compositions is meant that the enzymes are provided separately in a formulated manner, such as a certain ratio. In some embodiments, the compositions will contain a phytase having at least 90% sequence identity to SEQ ID NO: 1; and / or a phytase having at least 95% sequence identity to SEQ ID NO: 2; and / or a phytase showing at least 95% sequence identity with SEQ ID NO: 3 and alpha-amylase.

[0079] In some embodiments, the alpha-amylase will include an alpha-amylase derived from Bacillus sterarothermophilus, such as SPEZYME AA, LIQUOZYME or SPEZYME XTRA. In some embodiments, the alpha-amylase will include alpha-amylase derived from Bacillus licheniformis. In some embodiments, alphaamylase will be a hybrid enzyme, for example a hybrid enzyme, which may contain fragments derived from the B. stearothermophilus strain and the B. licheniformis strain.

[0080] In some embodiments, the enzyme compositions or blends will comprise: a) BP-WT, SPEZYME XTRA and optionally SPEZYME FRED; b) BPWT, SPEZYME XTRA and optionally SPEZYME FRED; c) BP-17, SPEZYME XTRA and optionally SPEZYME FRED. In some embodiments, the composition comprises alpha-amylase and Buttiauxella phytase. In some embodiments, the composition comprises SPEZYME ™ XTRA and BP-WT. In some embodiments, the composition comprises SPEZYME ™ XTRA and BP-17. In some embodiments, the composition comprises SPEZYME ™ XTRA and a phytase having at least 75% sequence identity with SEQ ID NO: 1, SEQ ID NO: 2 and / or SEQ ID NO: 3, including 80%, 85%, 90%, 95% and 99% sequence identity. In some embodiments, the composition comprises SPEZYME ™ FRED and BP-WT. In some embodiments, the composition comprises SPEZYME ™ FRED and BP-17. In some embodiments, the composition comprises SPEZYME ™ FRED and a phytase having at least 75% sequence identity with SEQ ID NO: 1, SEQ ID NO: 2 and / or SEQ ID NO: 3, including 80%, 85%, 90%, 95% and 99% sequence identity.

[0081] Enzyme compositions comprising phytase and alpha-amylase in a mixed formulation or separately include starch hydrolyzing compositions, for example, MAXALIQ ™ One from Danisco US, Inc., Genencor Division. In some embodiments, the phytase may be combined with an alpha-amylase such as LIQUOZYME, TERMAMYL LC or SUPRA. Mixtures of alpha-amylases for use in liquefying starch are known and reference should be made to USP 4,933,279, which discloses a mixed enzyme product containing a mixture of alpha-amylase from B. licheniformis alpha-amylase from B. stearothermophilus.

[0082] In some embodiments, the inclusion of phytase and alpha-amylase, regardless of whether the enzymes are provided in a blend or separately, allows the starch liquefaction method to be carried out at a lower pH than that which would be used to provide alpha-amylase without phytase . For example, the process for liquefying starch can be carried out at a pH about 0.5 to 1.5 units lower (e.g. about 0.2, 0.3, 0.4, 0.5, 0.7, 0.8, 1.0, 1.2 or 1.5 units lower) than when using alpha-amylase without phytase covered by the invention.

[0083] In some embodiments, when the phytase composition and alpha-amylase composition are used, such as in a starch hydrolysis method, the ratio of phytase (FTU / g ds) to alpha-amylase (AAU / g ds) is from about 15: 1 to about 1:15, alternatively about 10: 1 to about 1:10, alternatively about 5: 1 to about 1: 5, alternatively about 3: 1 to about 1: 2, including about 1: 1, about 1, 1: 1, about 1.2: 1, about 1.3: 1, about 1.4: 1, about 1.5: 1, about 1.6: 1, about 1.7: 1, about 1.8 : 1, about 1.9: 1 and about 2: 1.

[0084] Some useful enzyme compositions containing phytase into alpha-amylase in a mixed formulation or separately include starch hydrolyzing compositions, which are discussed in more detail under the heading "Methods".

Secondary enzymes [0085] While some embodiments of the invention include a composition or blend of alpha-amylase and phytase, the composition may optionally contain other enzymes. Other enzymes may alternatively be added separately from the composition at different times during the methods of the invention at the same time as the composition or at other times in the method. For example, other components useful during liquefaction include, but are not limited to: cellulases, hemicellulases, xylanases, proteases, phytases, pullulanases, betaamylases, lipases, cutinases, pectinases, beta-glucanases, beta-glucosidases, galactosidases, esterases, transglycosyltransferases, C-cyclodextrases) beta-amylases and combinations thereof.

[0086] Glucoamylases (EC 3.2.1.3.) Can be derived from the expression of heterologous or endogenous proteins from bacterial, plant and / or fungal sources. Some glucoamylases useful in the invention are produced by several filamentous fungi and yeast strains. In particular, glucoamylases secreted by Aspergillus and Trichoderma are commercially important. Suitable glucoamylases include naturally-occurring wild-type glucoamylases as well as variants and genetically engineered glucoamylase mutants (e.g., hybrid glucoamylases). The following glucoamylases are non-limiting examples of glucoamylases that can be used in the methods of the invention. Aspergillus niger G1 and G2 glucoamylase (see, e.g., Boel et al., (1984) EMBO J. 3: 1097 - 1102; WO 92/00381, WO 00/04136 and USP 6,352,851); Aspergillus awamori glucoamylase (see, e.g., WO 84/02921); Aspergillus oryzae glucoamylases (see, e.g., Hata et al., (1991) Agric. Biol. Chem. 55: 941 - 949) and Aspergillus shirousami. (See, e.g., Chen et al., (1996) Prot. Eng. 9: 499-505; Chen et al. (1995) Prot. Eng. 8: 575-582; and Chen et al., (1994) Biochem. J. 302: 275-281).

[0087] Glucoamylases are also obtained from Talaromyces strains, such as those derived from T. emersonii, T. leycettanus, T. duponti and T. thermophilus (see, e.g., WO 99/28488; USP RE RE: 32,153; USP No. 4,587,215 ); Trichoderma strains such as T. reesei, and especially glucoamylases having at least about 80%, 85%, 90% and 95% sequence identity with SEQ ID NO: 4 disclosed in Pub. Stalemate. USA No. 2006-0094080; Rhizopus strains, such as R. niveus and R. oryzae; Mucor strains and Humicola strains such as H. grisea (See, e.g., Boel et al., (1984) EMBO J. 3: 1097-1102; WO 92/00381; WO 00/04136; Chen et al., ( 1996 Prot. Eng. 9: 499-505; Taylor et al., (1978) Carbohydrate Res. 61: 301-308; USP. 4,514,496; USP 4,092,434; USP 4,618,579; Jensen et al., (1988) Can. J. Microbiol. 34: 218-223 and SEQ ID NO: 3 of WO 2005/052148). In some embodiments, glucoamylase will exhibit at least about 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98% and 99% amino acid sequence identity with SEQ ID NO: 3 of WO 05/052148 . Other glucoamylases useful in the invention include those obtained from Athelia rolfsii and variants thereof (see, e.g., WO 04/111218). For examples of other glucoamylases, see also saccharification discussion here.

Commercially used enzymes having glucoamylase activity are produced, for example, by Aspergillus niger (see, e.g., trade name DISTILLASE, OPTIDEX L-400 and G ZYME G990 4X from Danisco US, Inc., Genencor Division) or types of Rhizopus (see e.g. ., trade name CU CONC from Shin Nihon Chemicals, Japan). Also a commercial digestive enzyme with the trade name GLUCZYME from Amano Pharmaceuticals, Japan (see, e.g., Takahashi et al. (1985) J. Biochem. 98: 663-671). Additional enzymes include three forms of glucoamylase (EC 3.2.1.3) from Rhizopus sp., Namely "Gluc1" (MW 74,000), "Gluc2" (MW 58,600) and "Gluc3" (MW 61,400). Also, an enzyme preparation (Danisco US, Inc., Genencor Division) finds use in the invention. The above glucoamylases and commercial enzymes are not intended to limit the invention, but are provided by way of example only.

[0089] In some embodiments, the additional enzyme is a second alpha-amylase, such as bacterial or fungal alpha-amylase, and in other embodiments, the amylase is a derivative, mutant or variant of the fungal or bacterial alpha-amylase. Any alpha-amylases can be used, including those known in the art, as well as those discussed herein. Non-limiting examples of alpha-amylases useful in combinations with at least one alpha-amylase and phytase of the invention are those derived from Bacillus, Aspergillus, Trichoderma, Rhizopus, Fusarium, Penicillium, Neurospora and Humicola.

[0090] Some additional alpha-amylases are derived from Bacillus, including B. licheniformis, B. lentus, B. coagulans, B. amyloliquefaciens, B. stearothermophilus, B sublilis and their hybrids, mutants and variants (see, e.g., USP 5,763,385 ; USP 5,824,532; USP 5,958,739; USP 6,008,026 and USP 6,361,809). Some of these amylases are commercially available, e.g. TERMAMYL and SUPRA available from Novo Nordisk A / S, ULTRATHIN from Diversa, LIQUEZYME SC from Novo Nordisk A / S and SPEZYME FRED, SPEZYME XTRA and GZYME G997 available from Danisco US, Inc., Genencor Division.

[0091] In another embodiment, the invention will include the addition of a second phytase.

Any phytases discussed in the phytase section can be used.

[0092] Cellulases may also be included with alpha-amylase and glucoamylase. Cellulases are enzymatic compositions that hydrolyze cellulose (e-1,4-D-glucan linkages) and / or derivatives thereof, such as cellulose swelled in phosphoric acid. Cellulases include the group of exocellobiohydrolases (CBH), endoglucanases (EG) and β-glucosidases (BG) (EC 3.2.191, EC 3.2.1.4 and EC 3.2.1.21). Examples of cellulases include cellulases from Penicillium, Trichoderma, Humicola, Fusarium, Thermomonospora, Cellulomonas, Clostridium and Aspergillus. Commercially available cellulases sold for feed applications are beta-glucanases such as ROVABIO (Adisseo), NATUGRAIN (BASF), MULTIFECT BGL (Danisco US, Inc., Genencor Division) and ECONASE (AB Enzymes).

[0093] Xylanases can also be included. Xylanases (e.g. endo-e-xylanases (EC 3.2.1.8)) that hydrolyze the xylan backbone can be derived from bacterial sources such as

Bacillus, Streptomyces, Clostridium, Acidothermus, Microtetrapsora or Thermonospora. Additionally, xylanases may be derived from fungal sources such as Aspergillus, Trichoderma, Neurospora, Humicola, Penicillium or Fusarium. (See, e.g., EP 473 545; USP 5 612 055; WO 92/06209; and WO 97/20920). Commercial preparations include MULTIFECT and FEEDTREAT Y5 (Danisco US, Inc., Genencor Division), RONOZYME WX (Novozymes A / S) and NATUGRAIN WHEAT (BASF).

[0094] Proteases can also be included. Proteases can be derived from Bacillus, such as B. amyloliquefaciens, B. lentus, B. licheniformis, and B. subtilis. These sources include subtilisin, such as B. amyloliquefaciens obtainable subtilisin and its mutants (USP 4,760,025). Suitable commercial protease includes MULTIFECT P 3000 (Danisco US, Inc., Genencor Division) and SUMIZYME FP (Shin Nihon). Proteases are also derived from fungal sources such as Trichoderma (e.g., NSP-24), Aspergillus, Humicola and Penicillium.

[0095] In some embodiments, combinations of two or more enzymes selected from alpha-amylases, glucoamylases, phytases, cellulases, hemicellulases, and xylanases may be included.

[0096] Acid fungal proteases (AFP) may also be included in the enzyme compositions and mixtures of the invention. Fungal proteases include, for example, those obtained from Aspergillus, Trichoderma, Mucor and Rhizopus, such as A. niger, A. awamori, A. oryzae and M. miehei (see, e.g., US Application No. 11 / 312,290, filed December 20). 2005, in terms of AFP useful in the invention).

Methods of use [0097] The methods of the invention include the use of the phytase of the invention with alpha-amylase during liquefaction of starch in a starch conversion method, which results in a method that can be run at a lower pH. In some embodiments, the method no longer requires the addition of acids or alkali for pH adjustment. The methods include a first liquefaction step and a second liquefaction step. In some embodiments, the method results in the production of fermentable sugars. In some embodiments, it leads to ethanol.

[0098] Substrates useful according to the invention include grains and / or plant material comprising granular starch. Plant material can be obtained from plants, including but not limited to wheat, corn, rye, sorghum (sugar), rice, millet, barley, triticale, cassava (tapioca), potato, sweet potato, sugar beet, sugar cane and legumes such as soybean and peas. The plant material that can be used in the invention includes corn, barley, wheat, rice, sugar sorghum and combinations thereof. Plant material may include hybrid and genetically modified varieties (e.g., transgenic corn, barley or soy containing heterologous genes). Any part of the plant can be used to provide the substrate, including but not limited to parts of the plant, such as leaves, stems, scales, shells, tubers, cobs, grains and the like. In some embodiments, the plant may generally be used whole, for example, corn straw may be used entirely. In some embodiments, whole grains may be used as the source of granular starch. Whole grains include corn, wheat, rye, barley, sorghum and combinations thereof. In other embodiments, granular starch may be obtained from fractionated cereal grains, including fiber, endosperm, and / or germ components. Methods for fractionating plant material such as corn and wheat are known in the art. In some embodiments, plant material obtained from various sources can be mixed together to obtain substrates used in the methods of the invention (e.g., corn and sugar sorghum or corn and barley).

[0099] In some embodiments, the plant material can be prepared by methods such as milling. Two main milling methods are preferred for the methods of the invention and these include wet milling and dry milling. For example, in dry milling, all grain is ground and used in the process. In wet milling, the grain is separated (e.g., flour germ). In particular, methods for grinding whole cereal grains are well known and include the use of beater mills and roller mills. Grinding methods are well known in the art and reference should be made to THE ALCOHOL TEXTBOOK: A REFERENCE FOR THE BEVERAGE, FUEL AND INDUSTRIAL ALCOHOL INDUSTRIES 3rd ED. KA Jacques et al., Eds, (1999) Nottingham University Press. See Chapters 2 and 4.

[0100] In some embodiments, the plant material, whether or not comminuted by milling or other means, will be combined with the solution, resulting in a suspension containing a starch substrate. In some embodiments, the suspension may include a side stream from starch processing, such as countercurrent. In some embodiments, the suspension will contain from 15-55% ds (e.g., from 20-50%, from 25-45%, from 25-40% and from 20-35% ds).

[0101] In some embodiments, a combination of phytase and alpha-amylase may be added to the suspension of ground starch substrate (e.g., ground beans). The suspension is maintained in the pH range from about 4.0 to about 6.2, also in the pH range from about 4.5 to less than about 6.0, and preferably in the pH range from about 5.0 to about 6.0 (e.g. from about

5.4 to about 5.8), and the ground granular starch in suspension can be contacted with the enzyme composition for a period of 2 min to 8 hours. (e.g. 5 min to 6 hours, 5 min to 4 hours and 30 min to 4 hours) to obtain liquefied starch. In some embodiments, the temperature will be in the range of 40 to 115 ° C. In some embodiments, the temperature will be in the range of 40 to 110 ° C; also from 50 to 110 ° C; also from 60 to 110 ° C; also from 60 to 100 ° C, as well as from 70 to 95 ° C.

[0102] In some embodiments, the phytase is added to the suspension in an amount sufficient to allow the process to be performed at a lower pH, even as low as the pH of the suspension without the addition of acid or base. In some embodiments, the phytase reduces levels of phytic acid in an amount sufficient to increase the thermostability of alpha-amylase. In some embodiments, IP6 phytic acid is reduced. IP6 is defined as inositol containing 6 phosphate groups. IP6 usually occurs with its derivatives in varying amounts, each with 1 to 5 phosphate groups (IPS-IP1).

[0103] In some embodiments, the phytase is added in an amount and time sufficient to cause an increase in thermostability of the alpha-amylase. In some embodiments, the phytase is added in an amount sufficient to allow hydrolysis of the starch in the presence of alpha-amylase at a lower pH. In some embodiments, the phytase is added in an amount sufficient to increase the thermostability of the alpha-amylase at a lower pH. It should be understood that even if pH regulation is included in the method, phytase causes increased thermostability of alpha-amylase, especially at a lower pH than that at which it would be stable without phytase.

[0104] One skilled in the art will be able to easily determine the effective dose of phytase and alpha-amylase for use in the methods of the invention. The optimal level of use in the liquefaction of starch depends on the processing parameters such as the type of plant material, viscosity, processing time, pH, temperature and As a general guideline in some embodiments, the amount (dose) of phytase used in the liquefaction process will range from about 0.001 to about 50 FTU / g ds, in some embodiments from about 0.01 to about 5.0 FTU / g ds; alternatively from about 0.05 to about 10 FTU / g ds, and also from about 0.10 to about 5.0 FTU / g ds

[0105] In some embodiments, the amount of alpha-amylase will be an effective amount of alpha-amylase, which is well known to one of skill in the art. In some embodiments, the range will be from about 0.05 to about 50 AAU / g ds, also from about 0.1 to about 20 AAU / g ds, and also from about 1.0 to about 10 AAU / g ds. In some embodiments, the alpha-amylase range will be from about 0.5 to about 100 LU / g ds, also from about 1.0 to about 50 LU / g ds, and also from about 5.0 to about 25 LU / g ds LU. In further embodiments, the dose of alpha-amylase will range from about 0.01 to about 10.0 kg / metric ton (MT) ds; also from about 0.05 to about 5.0 kg / MT ds; and from about 0.1 to about 4.0 kg / MT for

[0106] The invention includes subjecting a suspension comprising a substrate, such as a granular starch substrate (e.g., milled beans), to a pretreatment (incubation) step.

[0107] The incubation step involves contacting the suspension containing the starch substrate (e.g., milled grains) with phytases and alpha-amylase at a temperature above 55 ° C and below the gelatinization temperature of the starch for granular starch. This temperature can be from 0 to 25 ° C, from 0 to 20 ° C, from 0 to 15 ° C and from 0 to 10 ° C below the gelatinization temperature of starch. This specific value will vary and depends on the type of granular starch contained in the suspension. For example, the gelatinization temperature of corn starch is generally higher than the gelatinization temperature of rye or wheat starch. In some embodiments, the temperature will be below 68 ° C; below 65 ° C, below 62 ° C or below 60 ° C. In some embodiments, the incubation temperature will be between about 58 and about 72 ° C, and also between about 60 and about 68 ° C. Incubation is carried out in a pH range from about 4.0 to about 6.2, e.g. from about 4.0 to about 6.0 or from a pH of about 5.0 to about 6.0 for a time of about 2 minutes to about 4 hours (e.g., from about 5 min to about 3 hours; from about 15 min to about 2.5 hours and from about 30 min to about 2 hours). Phytase and alphaamylase can be added as a mixture or added sequentially during the incubation step.

[0108] In a further step, the incubated substrate is liquefied by exposing the incubated substrate to a temperature increase from 0 to 55 ° C above the gelatinization temperature of starch. (e.g. up to 65 ° C to 120 ° C, 70 ° C to 110 ° C, 70 ° C to 90 ° C) for 5 minutes to 6 hours (e.g. 5 minutes to 4 hours, and preferably from 1 hour to 2 hours) at a pH from about 4.0 to about 6.2.

[0109] In some embodiments, a thermostable alpha-amylase will be added in this step, but in other embodiments, no additional alpha-amylase will be added. In some embodiments, the pH of the incubation step and the increase in temperature will generally be carried out in the same pH range (e.g., pH from about

4.5 to about 6.0 or pH from about 5.0 to about 6.0).

[0110] In some embodiments, the incubation step will increase the stability of alpha-amylase during the temperature increase step. In some embodiments, the increase in stability of alpha-amylase is in the pH range from about 5.8 to about 5.2.

[0111] The method may further comprise saccharification of the liquefied substrate with a saccharification enzyme (e.g., OPTIDEX L-400, OPTIMAX 4060 VHP, FERMENZYME L-400, DISTILLASE, GZYME 480 (Danisco US, Inc. Genencor Division)) to obtain dextrins; and may include its recovery. These methods are well known in the art and include the addition of saccharification enzymes such as glucoamylases and optionally other secondary enzymes.

[0112] The saccharification process may take 12 to 120 hours. However, pre-saccharification for 30 minutes to 2 hours followed by saccharification during fermentation is commonly carried out. Sometimes referred to as simultaneous saccharification and fermentation (SSF). Saccharification is commonly carried out at temperatures from 30 to 65 ° C and usually at a pH of 4.0 to 5.0.

[0113] Glucoamylases (GA) (EC 3.2.1.3.) For use as saccharification enzymes may be any of those known to one of ordinary skill in the art as well as any of those discussed herein, such as in the section headed "Secondary enzymes".

[0114] The viscosity of the liquefied substrate that is obtained after raising the temperature may have a reduced value compared to the corresponding liquefied substrate that has not been incubated with the phytase of the invention. In some embodiments, the amount of alpha-amylase that will be used in the starch hydrolysis process will be less due to the decrease in viscosity. For example, under the same conditions, a dose of alpha-amylase that may be needed at the same pH (e.g. pH from about 5.5 to about 6.0) to achieve the same level of viscosity can be about 20%, 30%, 40%, 50% or 60% less when the alpha-amylase is combined with the phytase of the invention.

[0115] In some embodiments, the methods involving the use of a composition or mixture of Buttiauxella phytase or variants thereof and alpha-amylase give a lot of dextrose product. In some embodiments, the glucose yield by liquefaction and saccharification (percentage of glucose in total dry substances) is at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, and at least 95%.

[0116] In some embodiments, the glucose produced can be further used to produce high purity fructose or dextrose. In some embodiments, glucose will be separated from the treated mash by methods known in the art, such as centrifugation, membrane separation and conventional filtration methods. Glucose can be enzymatically converted to fructose syrup by methods known in the art.

[0117] In some embodiments, the method further comprises the use of dextrin (e.g. glucose) as a fermentation feed in microbial fermentations under suitable fermentation conditions to obtain end products such as alcohol (e.g. ethanol), organic acids (e.g. succinic acid, lactic acid), sugar alcohols (e.g. glycerol), ascorbic acid intermediates (e.g. gluconate, DKG, KLG), amino acids (e.g. lysine) and proteins (e.g. antibodies and fragments thereof).

[0118] The organism used in fermentations will depend on the desired end product. Typically, if the desired end product is ethanol, yeast will be used as the fermentation organism. In some embodiments, the ethanol producing microorganisms are yeast, and especially Saccharomyces, such as strains of S. cerevisiae (USP 4,316,956). Miscellaneous S. cerevisiae are commercially available and include, but are not limited to, FALI alcoholic yeast (Fleischmann's Yeast), SUPERSTART (Alltech), FERMIOL (DSM Specialties), RED STAR (Lesaffre) and Angel (Angel Yeast Company, China). The amount of leaven yeast used in the methods is an effective amount to produce a commercially significant amount of ethanol in an appropriate amount of time (e.g., to produce at least 10% ethanol from a substrate having between 25 and 40% DS in less than 72 hours). Yeast cells are generally supplied in quantities of 10 or more4 up to 1012, and preferably from 107 up to 1010 live yeast per ml fermentation medium. Fermentation may contain, in addition to fermentation microorganisms (e.g. yeast), nutrients, acid and / or additional enzymes, including but not limited to phytases.

[0119] The use of yeast in fermentations is well known and reference should be made to THE ALCOHOL TEXTBOOK, K. JACQUES ET AL., EDS. 1999, NOITINGHAM UNIVERSITY PRESS, UK. In some embodiments, the amount of ethanol produced by the methods of the invention will be at least 8%, at least 10%, at least 12%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18 %, at least 20% and at least 22% (v / v).

[0120] Optionally, after fermentation, the alcohol (e.g. ethanol) can be extracted, for example, by distillation. Ethanol can be used as fuel, consumption ethanol or industrial ethanol.

[0121] In some embodiments, the use of a phytase composition during the hydrolysis of starch may reduce the phytic acid content of the fermentation broth, the phytate content of rare stillage, and / or the phytic acid content of fermentation co-products such as dried stillage (DDG); dried still liquor with decoctions (DDGS); wet stillage (DWG) and wet stillage with solvents (DWGS). In some embodiments, the methods of the invention (including, but not limited to, incubation for 30 to 60 minutes, for example) can reduce phytic acid content in the resulting fermentation filtrate by at least 60%, 65%, 70%, 75%, 80%, 85% and 90 % and more compared to essentially the same method without phytase. In some embodiments, the amount of phytate found in DDGS may be at least 50%, at least 70%, at least 80%, and at least 90% lower compared to the content of phytate in DDGS from a corresponding method that is substantially the same as claimed method, but without the phytase of the invention. For example, while the% phytate content of commercial DDGS samples may vary, the overall% phytate range may be from about 1% to about 3% or more. In some embodiments, the% phytate in DDGS obtained in this method will be below 1.0%, below 0.8%, below 0.5%, and also below 0.3%. In some embodiments, the amount of phytate found in the rare stillage may be at least 50%, at least 70%, at least 80%, and at least 90% smaller compared to the content of phytate in the rare stillage from the corresponding method, which is essentially the same as the claimed method, but without the phytase of the invention.

[0122] In industrial ethanol processes, ethanol can be distilled from the filtrate, resulting in a portion of rare stillage that can be recycled to the fermentation stream (countercurrent), which is often done. The invention results in a rare stillage having a low phytate content compared to the rare phytate content of a corresponding stillage which is essentially the same as the claimed method but without the phytase of the invention. For example, the amount of phytate (ppm) in rare stillage having about 8% ds may be in the range of 2500 to

3000 ppm. In some embodiments, the content of phytate in the rare stillage may be below 2000 ppm, below 1000 ppm, below 500 ppm, below 100 ppm and below 50 ppm when the substrate is treated according to the methods herein.

EXPERIENCES [0123] The invention is described in more detail in the following examples, which are in no way intended to limit the scope of the claimed invention. The attached Figures should be considered integral parts of the specification and description of the invention. The following examples are provided for illustration and not to limit the claimed invention.

[0124] In the disclosure and experience section, which is below, the following abbreviations apply:

mass% (mass percentages); ° C (degrees Celsius); H2O (water); dH2O (deionized water);

DIH2O (deionized water, after Milli-Q filtration); g or gm (grams); μg (micrograms); mg (milligrams); kg (kilograms); μl (microliters); ml (milliliters); mm (millimeters); μm (micrometers); M (molar); mM (millimolar); μΜ (micromolar); U (unit); MW (molecular weight); s (seconds); min (minute / minutes); h. (Hour / hours); ds (dry substances); DO (dissolved oxygen); W / V (mass to volume ratio); W / W (mass to mass ratio); V / V (volume to volume ratio); Genencor (Genencor International, Inc., Palo Alto, CA); IKA (IKA Works Inc. 2635 North Chase Parkway SE, Wilmington, NC); Genencor (Danisco US Inc, Genencor Division, Palo Alto, CA); MT (metric ton); Ncm (newton centimeter); ETOH (ethanol); eq (equivalents); N (normal); ds or DS (dry matter content); / g ds (per gram of dry substances); SAPU (spectrophotometric unit of protease).

Methods [0125] Viscosity measurements: A glass cooker viscometer, IKA LR-2.ST system was used to assess viscosity. In short, the viscometer consists of a 2000 ml double-walled glass vessel with an anchor mixer which is moved by a Eurostar Labortechnik adjustable power viscosity meter (Viscoklick viscosity range is from 0-600 Ncm). Generally, for the examples described herein, a suspension containing a starch substrate and an appropriate amount of enzyme was poured into a viscometer vessel. The temperature and viscosity were recorded while heating to 85 ° C and incubation continued for an additional 60 to 120 min. Viscosity measured in Ncm was recorded at intervals.

[0126] Bicarbonate and alcohol analysis in high pressure liquid chromatography (HPLC): The composition of oligosaccharide reaction products was measured by HPLC (Beckman System Gold 32 Karat Fullerton system, CA equipped with an HPLC column (Rezex 8 u8% H, monosaccharides), maintained at 50 ° C, equipped with refractometric detector (RI) (ERC-7515A, RI detector (Anspec Company Inc.)) Saccharides were separated based on molecular weight. DP1 is a monosaccharide such as glucose; DP2 is a disaccharide such as maltose, DP3 is a trisaccharide such as maltotriose, and "DP4+"means an oligosaccharide with a degree of polymerization (DP) of 4 or more.

[0127] Phytase activity (FTU) was measured based on the release of inorganic phosphates. Inorganic phosphates form a yellow complex with the vanadate-molybdate acid reagent and the yellow complex was measured at 415 nm in a spectrophotometer, and the released inorganic phosphates were quantified using a phosphate calibration curve. One phytase enzyme unit (FTU) is the amount of enzyme that releases 1 micromole of inorganic phosphate from phytate per minute under the reaction conditions given in the European Standard (CEN / TC 327,2005-TC327WI 003270XX).

[0128] Phytic acid content: - Phytic acid was extracted from the sample by adjusting the pH of a 5% suspension (for dry samples) to pH 10.0, and then determined by HPLC using an ion exchange column. Phytic acid was eluted from the column using a NaOH gradient system. The content of phytic acid in the liquid was calculated by comparing phytic acid with the standard.

[0129] Alpha-amylase (AAU) activity can be determined by the rate of starch hydrolysis, reflected by the rate of decrease in iodine staining efficiency measured spectrophotometrically. One AAU of bacterial alpha-amylase activity is the amount of enzyme needed to hydrolyze 10 mg of starch per min under standardized conditions.

[0130] Alpha-amylase activity can also be determined in units of soluble starch (SSU) and this is based on the degree of hydrolysis of the soluble potato starch substrate (4% DS) by part of the enzyme sample at pH 4.5, 50 ° C. The reducing sugar content is measured using the DNS method as described in Miller, GL (1959) Anal. Chem. 31: 426-428.

[0131] Alpha-amylase activity in units called Liquefon Units (LU) was measured for SPEZYME FRED according to the method disclosed in USP 5,958,739. In short, the assay method uses p-nitrophenyl maltoheptoside as a substrate with chemically blocked non-reducing final sugar. The rate of release of p-nitrophenyl is proportional to alpha-amylase activity and release is monitored at 410 nm. Activity is calculated relative to standard control.

[0132] Units of glucoamylase activity (GAU) are determined by a PNPG test for measuring glucoamylase activity.

EXAMPLES

Example 1: SPEZYME XTRA and BP-WT [0133] An aqueous suspension (1.0 kg) of ground whole corn (36% ds, 800 g ground corn) was prepared. The pH of the suspension was adjusted to pH 5.8 with diluted H2SO4. The suspension was transferred to a bottle and SPEZYME XTRA (Genencor) was added in an amount of 2.8 AAU / g ds (+ or - BP-WT (SEQ ID NO: 1) with 7.2 FTU g ds or SPEZYME XTRA was added without phytase in an amount of 5 , 6 AAU / g ds and in all cases the suspension was incubated at 65 ° C for 30 min.

[0134] The preheated suspension of all ground maize was transferred to a sample vessel in a viscometer (IKA). The slurry was heated continuously until it reached

85 ° C, and then the suspension was kept at this temperature. The viscosity of the suspension was measured while increasing the temperature (Table 4).

Table 4

<td></td><td colspan="2">SPEZYME XTRA</td><td colspan="2">SPEZYME XTRA</td><td colspan="2">SPEZYME XTRA</td>

<td></td><td colspan="2">2.8 AAU / g for</td><td colspan="2">2.8 AAU / g ds + phytase 7.2 FTU g for</td><td colspan="2">5.6 AAU / g for</td>

<td></td><td colspan="2">Viscosity</td><td colspan="2">Viscosity</td><td colspan="2">Viscosity</td>

[0135] The viscosity data in Table 4 show that incubation of ground whole maize at 85 ° C with a standard dose of SPEZYME XTRA (5.6 AAU / g ds) gave a liquefied substrate with stabilized viscosity at 23.8 Ncm. In contrast, pretreatment of ground whole maize with half the dose of SPEZYME XTRA (2.8 AAU / g ds) and 7.2 FTU BP-WT resulted in lower viscosity of the liquefied substrate at 85 ° C.

Example 2: SPEZYME ETHYL and BP-WT [0136] The effect of SPEZYME ETHYL was studied during incubation of ground whole corn with Buttiauxella phytase (BP-WT). The conditions were the same as described in example 1 at pH 5.8. In addition, incubation of ground whole maize was carried out at a lower pH (pH

4,5, 65 ° C) before raising the temperature to 85 ° C. Starting from time 0, samples were taken every 30 s for the first 10 min and then every 4 minutes for 62 min. Some of the results are summarized in Table 5A (pH 5.8, 65 ° C, 30 min incubation) and Table 5B (pH 4.5, 65 ° C, 30 min incubation).

Table 5A - Effect of phytase on viscosity reduction at 85 ° C during incubation of ground whole maize. (35% ds) with SPEZYME ETHYL

<td colspan="2">SPEZYME ETHYL (5.6 AAU / g ds)</td><td colspan="2">SPEZYME ETHYL (2.8 AAU / g ds + phytase (7.2 FTU / g ds)</td>

<td colspan="2" rowspan="2">SPEZYME ETHYL (5.6 AAU / g ds)</td><td colspan="2">SPEZYME ETHYL (2.8 AAU / g ds + phytase (7.2</td>

<td colspan="2" rowspan="2">SPEZYME ETHYL (5.6 AAU / g ds)</td><td colspan="2">SPEZYME ETHYL (2.8 AAU / g ds + phytase (7.2</td>

Table 5B - Effect of phytase on viscosity reduction at 85 ° C during incubation of ground whole maize (35% ds) with SPEZYME ETHYL

<td colspan="2">SPEZYME ETHYL (1.85 AAU / g ds)</td><td colspan="2">SPEZYME ETHYL (1.85 AAU / g ds) + phytase (7.2 FTU / g ds)</td><td colspan="2">SPEZYME ETHYL (5.6 AAU / g ds)</td><td colspan="2">SPEZYME ETHYL (5.6 AAU / g ds) + phytase (7.2 FTU / g ds)</td>

Example 3: SPEZYME FRED and BP-WT [0137] The effect of SPEZYME FRED was studied during incubation of ground whole corn with Buttiauxella phytase (BP-WT). The conditions were the same as described in Example 1 (pH 5.8, 65 ° C, 30 min incubation) before raising the temperature to 85 ° C. From time 0, samples were taken every 30 s for the first 10 min and then every 4 minutes up to 62 min. The results are summarized in Table 6.

Table 6 - Effect of phytase on viscosity reduction at 85 ° C during incubation of ground whole maize (35% ds) with SPEZYME FRED

<td colspan="2">SPEZYME FRED, pH 5.8 10 LU / g ds, 65 ° C, 30 min (- phytase)</td><td colspan="2">SPEZYME FRED, pH 5.8 10 LU / g ds, 65 ° C, 30 min (+ phytase BP-WT 7.2 FTU / g ds))</td><td colspan="2">SPEZYME FRED, pH 5.8 20 LU / g ds, 65 ° C, 30 min (- phytase)</td>

<td colspan="2">SPEZYME FRED, pH 5.8 10 LU / g ds, 65 ° C, 30 min (- phytase)</td><td colspan="2">SPEZYME FRED, pH 5.8 10 LU / g ds, 65 ° C, 30 min (+ BP-WT 7.2 FTU / g ds) phytase)</td><td colspan="2">SPEZYME FRED, pH 5.8 20 LU / g ds, 65 ° C, 30 min (- phytase)</td>

[0138] The results presented in Table 6 show that incubation at pH 5.8, 65 ° C for 30 min with phytase and SPEZYME FRED resulted in a liquefied substrate with reduced viscosity.

Example 4: Viscosity effects in the presence of BP-WT [0139] Using a dilute HCl, the pH of the suspension containing 36% ground whole corn was adjusted to pH 5.8, pH 5.4, pH 5.2 or pH 5.0. SPEZYME XTRA (2.0 AAU / g ds) and BP-WT (3.6 FTU / g ds) were added to the suspension and held at 65 ° C for 30 min. SPEZYME XTRA (4.0 AAU / g ds at pH 5.8) without phytase was used as a control. The viscosity of the suspension was measured while heating to 85 ° C (Table 7).

Table 7

<td></td><td>SPEZYME XTRA (4 AAU / g ds) pH 5.8 (Ncm)</td><td>SPEZYME XTRA (2 AAU / g ds) + BPWT pH 5.8 (Ncm)</td><td>SPEZYME XTRA (2 AAU / g ds) + BPWT pH 5.4 (Ncm)</td><td>SPEZYME XTRA (2 AAU / g ds) + BPWT pH 5.2 (Ncm)</td>

[0140] Table 7 shows that at pH 5.8, 5.4 and 5.2, the viscosity reduction of the suspension with BPWT and SPEZYME XTRA (2.0 AAU / g ds) was comparable to the viscosity reduction of the suspension with the control SPEZYME XTRA ( 4.0 AAU / g ds) at pH 5.8. However, the combination alpha-amylase dose was half the dose in the control. Data for pH 5.0 not shown. The combination of SPEZYME XTRA and BP-WT did not reduce the viscosity of the suspension under test conditions relative to control.

Example 5: Effect on rare stillage and DDGS [0141] A suspension of ground whole maize (36% ds) was incubated at 65 ° C for 30 min, 60 min or 120 min in the presence of 2.0 AAU SPEZYME XTRA and 3.6 FTU phytase -WT Buttiauxella. The conditions were as described above in Example 1. After a certain time, the temperature was raised to 85 ° C and kept at this temperature for 60 min. The pH of the liquefied starch substrate was lowered to pH 4.2 and further evaluated under yeast fermentation conditions. % Ds liquefied starch was adjusted to 31% ds 0.4 GAU / g ds FERMENZYME ™ L-400 was added and fermentation using yeast was carried out at 32 ° C. The final alcohol concentration, residual starch content and phytic acid content in rare stillage and DDGS (Table 8).

Table 8

<td>Incubation at 65 ° C, pH 5.8 with 2.0 AAU SPEZYME XTRA</td><td>Heating 85 ° C</td><td colspan="4">Yeast fermentation</td>

<td>(Min)</td><td>(Min)</td><td>% alcohol (V / V) (60 h.)</td><td>% residual starch in DDGS</td><td>Phytic acid (ppm) 60 hours, culture filtrate</td><td>% phytic acid in DDGS</td>

<td>Control (minus BP-WT)</td><td> 60</td><td> 14,73</td><td> 9,77</td><td> 480</td><td> 1,02</td>

[0142] As observed from Table 8, an incubation time of only 30 minutes can significantly reduce the phytic acid content of the resulting fermentation filtrate. The standard control filtrate (without phytase) found 480 ppm compared to only 56 ppm in the filtrate from samples incubated for 30 min and 40 ppm in the filtrate from samples incubated for 120 min.

Example 6: Glucose production from liquefied starch - BP-WT [0143] A 36% ds suspension of ground whole corn was incubated at 65 ° C for 30 min in the presence of SPEZYME XTRA (2.0 AAU) and 3.6 FTU phytase-WT Buttiauxella in same conditions as described in example 1. After 30 min the temperature was raised to 85 ° C and kept at 85 ° C for an additional 60 min. The temperature of the liquefied substrate was reduced to 60 ° C and the pH was adjusted to pH 4.2. Liquefied starch was adjusted to 32% and 36% ds with H2O and saccharified at 60 ° C with OPTIMAX ™ 4060 VHP at a dose of 0.4 kg / MT ds corn. Samples were taken at various time intervals during incubation at 60 ° C and analyzed for glucose yield by HPLC (Table 9).

Table 9 - Glucose production from liquefied starch

<td>H.</td><td>% glucose</td><td>% DP2</td><td>% DP3</td><td>% DP4</td>

[0144] The resulting high dextrose product can be used as a raw material in the fermentation process for the production of end products, including but not limited to alcohol, organic acids, amino acids, ascorbic acid intermediates, sugar alcohols and the like.

Example 7: Effect of phytase incubation on viscosity [0145] The effect of phytase incubation on viscosity reduction at elevated 85 ° C was studied under various conditions when the suspension containing ground whole corn (36% ds) at pH 5.8, 65 ° C was incubated with BP-WT (3.6 FTU / g ds).

[0146] Condition 1 is the control to which no phytase was added and SPEZYME XTRA (4 AAU / g ds) was added for incubation that lasted only 30 minutes; Condition 2, BP-WT was added at the beginning of incubation and the suspension was incubated for 60 min. After about 60 min, SPEZYME XTRA (2 AAU / g ds) was added to the suspension; Condition 3, both BP-WT and SPEZYME XTRA (2 AAU / g ds) were added at the beginning of a 60-minute incubation; and Condition 4, SPEZYME XTRA (2 AAU / g ds) was added at the beginning of the incubation and the incubation lasted 30 min. In all cases, the temperature was raised to 85 ° C after the incubation period. Viscosity was measured over time.

Table 10 - Comparison of DE phytase incubation and starch solubilization (BRIX)

<td></td><td colspan="2">Incubation BP-WT + SPEZME XTRA</td><td colspan="2">Incubation only BP-WT</td>

Table 11

<td>Time (Min)</td><td>Condition (° C)</td><td>1 (Ncm)</td><td>Condition (° C)</td><td>2 (Ncm)</td><td>Condition 3 (° C)</td><td>(Ncm)</td><td colspan="2">Condition 4 (Ncm) (° C)</td>

[0147] As shown in Tables 10 and 11, at a gelatinization temperature from about 72-74 ° C, the viscosity peak decreased at a higher dose of SPEZYME XTRA (4 AAU / g ds as opposed to 2 AAU / g ds). However, incubation with BP-WT with or without SPEZYME XTRA resulted in a significant reduction in viscosity at 85 ° C, even with the SPEZYME XTRA dose reduced by 50% during the increased heating step at 85 ° C.

Example 8: Mixtures of alpha-amylases [0148] A suspension of 36% ds of ground whole corn was incubated at pH 5.8 for 30 min,

65 ° C. The suspension was contacted with one of the treatments below, heated and kept at 85 ° C. Viscosity measurements were made every 10-30 seconds during the pretreatment, temperature increase and temperature retention steps.

Machining 1 - SPEZYME FRED (10 LU) + SPEZYME XTRA (2 AAU);

Machining 2 - SPEZYME FRED (5 LU) + SPEZYME XTRA (1 AAU) + BP-WT (7.6 FTU / g ds);

Machining 3 - SPEZYME FRED (2.5 LU) + SPEZYME XTRA (2 AAU) + BP-WT (7.6 FTU / g ds);

Machining 4 - SPEZYME XTRA (2 AAU) + BP-WT (3.6 FTU); and

Machining 5 - SPEZYME XTRA (4 AAU).

[0149] The results are shown in Figure 2. The addition of phytase increased the stability of alpha-amylase, which was confirmed by the continuous decrease in viscosity (Ncm) (Y axis) over time (X axis) in Figure 2. At the viscosity peak (from about 72 to 75 ° C) SPEZYME XTRA very effectively reduced viscosity, but at higher temperatures the combination SPEZYME FRED; SPEZYME XTRA and BP-WT was better at reducing viscosity.

Example 9: Effect of SPEZYME XTRA and BP-17 on viscosity [0150] A 30% ds suspension of corn flour (pH 5.8) was preincubated at 65 ° C for 10 min without enzyme and then incubated at 65 ° C for 30 min the presence of SPEZYME XTRA (2.0 AAU / g and 4.0 AAU / g) without phytase or SPEZYME XTRA (2.0 AAU / g) + BP-17 (7.3 FTU / g). After 30 min pretreatment with the enzyme, the temperature was raised to 85 ° C, and the suspension was kept at 85 ° C for an additional 30 minutes. As shown in Fig. 3, when the viscosity (M (uNm) was measured in (min) the addition of BP-17 reduced the amount of alpha-amylase that was needed to lower the viscosity of the suspension.

Example 10: Effect of phytase on ethanol and DDGS yield [0151] The effect of phytase on ethanol and DDGS yield was analyzed during a conventional liquefaction process. Liquefied phytase treated substrates were not used in conventional yeast fermentation to compare DDGS compositions against phytic acid as well as compare ethanol yields. A suspension of ground whole corn, 32% ds maize containing 30% thin V / V distillers stock was used, the pH was adjusted to pH 5.8 with diluted sodium hydroxide and SPEZYME XTRA was added at 4 AAU / g maize and incubated at 70 ° C for 30 min The treated suspension was then passed through an experimental installation of a jet heater maintained at 225 ° F with a stop time of 3 min.

The gelatinized starch was then evaporated at atmospheric pressure and kept at 85 ° C. An additional dose of SPEZYME XTRA was added at 1.5 AAU / g ds corn to complete liquefaction and was held for another 90 min. A liquefied phytase-treated substrate was prepared, but the BP-17 phytase was added at 4 FTU / g ds corn during suspension treatment.

[0152] Then, the pH of the liquefied substrates was adjusted to pH 4.2 with diluted sulfuric acid and subjected to yeast fermentation. In each experiment, tare vessels were obtained before preparing the media. 800 grams of liquefied substrate containing 32% DS of corn was loaded into a 1 L bottle. The Red Star Ethanol Red yeast inoculum was prepared by adding 10 grams of yeast and 1 gram of glucose to 40 grams of water with gentle stirring for one hour. Five ml of yeast inocula were added to balanced fermenters. G Zyme ™ 480 Ethanol (Genencor - Danisco) was added at 0.4 GAU / g ds corn for simultaneous saccharification and fermentation initiation. The initial gross weight of the fermentation bottle was recorded and the fermentor was placed in a water bath maintained at 32 ° C. Ferments were carried out and the weight loss during fermentation was measured at various time intervals. Weight loss due to carbon dioxide loss was used to calculate alcohol yield. At the end of fermentation, the final gross mass was obtained. The medium was quantitatively transferred to a 5 L round bottom vessel. The distillation was carried out in vacuo until about 800 ml of distillate was collected in a container containing 200 ml of water. Ethanol was diluted to 2 L and analyzed by HPLC. Prior to drying, DS mass and distillation residue were obtained. Residual starch and phytic acid analysis was performed on DDGS and rare stillage. Stoichiometric calculations were made on the basis of weight loss, distillation and residual starch analysis as follows:

[0153] Calculation of ethanol using CO2 weight loss:

Ethanol production (mmol) = loss of CO2 (g) / 88

Ethanol production (g) = (CO2 loss (g) / 88) * 92 => CO2 loss (g) * 1.045

Ethanol production (ml) = ((CO2 loss (g) / 88) * 92) / 0.789 => CO2 loss (g) x 1.325

Table 12: Comparison of DDGS from the conventional liquefaction method and DDGS from the conventional method using SPEZYME XTRA and SPEZYME XTRA with the -BP-17 phytase

<td>Liquefaction conditions</td><td>Alcohol yield from weight loss</td><td>Phytic acid in DDGS (% ds)</td><td>Phytic acid in rare stillage</td>

<td>The conventional SPEZYME XTRA way</td><td>2.71 gallons / bushel</td><td> 1,21</td><td>480 ppm</td>

<td>Conventional SPEZYME XTRA method and BP17 phytase (PALS method)</td><td>2.69 gallons / bushel</td><td> 0,1-0,2</td><td>48 ppm</td>

[0154] The data in Table 12 show the main differences in phytic acid content in DDGS and rare stillage. The use of BP-17 resulted in a greater than 90% reduction of phytic acid in DDGS and rare stillage.

[0155] In the examples pd 11-15 wild-type Buttiauxella phytase and the variety were expressed directly or as a fusion protein in Trichoderma reesei. In all cases very strong expression levels were observed at more than 10 g / L.

Example 11 - Construction and expression of wild-type Buttiauxella phytase in T. reesei as a fusion protein without a Kex2 site [0156] DNA encoding the wild-type Buttiauxella phytase open reading frame was synthesized at GENEART AG (BioPark Josef-Engert-Str. 11, D-93053 Regensburg , Germany). SpeI and AscI restriction sites were included for cloning (see Table 13, SEQ ID NO: 4). An open phytase reading frame (SEQ ID NO: 4) was inserted into the vector, pTrex4, in the SpeI and AscI sites (see Figure 4). The resulting construct was biolistically transformed into T. reesei derived strains using the PDS-1000 / He biolistic particle delivery system from Bio-Rad (Hercules, CA). A transformation protocol was used as described by Foreman (WO 2005/001036). After obtaining stable transformants, these transformants were grown in shake bottle cultures for expression analysis of the Buttiauxella phytase protein as presented by Foreman (WO2005 / 001036). After several days of culturing on acetamide plates, transformants showing stable morphology were inoculated into 250 ml shake bottles containing 30 ml Proflo medium. Proflo medium contained: 30 g / l α-lactose; 6.5 g / l (NH4)2SO4; 2 g / L KH2PO4; 0.3 g / l MgSO4.7 H2ABOUT; 0.2 g / l CaCl2; 1 ml / l 1000X salt solution of trace elements; 2 ml / l 10% Tween 80; 22.5 g / l Proflo cotton seed flour (Traders Protein, Memphis, TN); and 0.72 g / L CaCO3. After two days of culture at 28 ° C and 225 rpm, 10% of the Proflo culture was transferred to a 250 ml shake bottle containing 30 ml lactose medium (Lactose Defined Media). The composition of the lactose medium was as follows: 5 g / L (NH4) 2SO4; 33 g / L PIPPS buffer; 9 g / l casein hydrolyzate casamino acid); 4.5 g / L KH2PO4; 1 g / l MgSO4 7 H2O; 5 ml / L of Mazu DF60-P antifoaming agent (mazur Chemicals, Gurnee, IL); 1 ml / l 1000X salt solution of trace elements; pH 5.5. 40 ml / L 40% (w / v) lactose solution was added to the sterilized medium. The shake bottles with lactose medium were incubated at 28 ° C, 225 rpm for up to 2-3 days. Culture supernatant samples were mixed with the appropriate volume of 4X NuPAGE sample buffer (Invitrogen Carlsbad, CA) with a reducing agent and subjected to polyacrylamide gel electrophoresis (PAGE) using previously poured NuPAGE gels and MOPS working buffer (Invitrogen Carlsbad, CA). Gels were stained for protein with Simply Blue Stain (Invitrogen Carlsbad, CA). A protein band with an apparent molecular weight of about 96 kDa was observed on the stained gel. The expected molecular weight of the fusion protein is about 96 kDa. Protein expression was found at more than 10 g / L.

Table 13: Wild type Buttiauxella phytase DNA sequence containing a SpeI site at the 5 'end and an AscI site at the 3' end.

ACTAGTAACGACACCCCCGCCAGCGGCTACCAGGTCGAGAAGGTCGTCATCCTCAG

CCGCCACGGAGTCCGCGCCCCCACCAAGATGACCCAGACCATGCGCGACGTCACCC

CCAACACCTGGCCCGAGTGGCCCGTCAAGCTCGGCTACATCACCCCCCGCGGCGAG

CACCTCATCAGCCTCATGGGCGGCTTCTACCGCCAGAAGTTCCAGCAGCAGGGCAT

CCTCAGCCAGGGCTCGTGTCCCACCCCCAACAGCATCTATGTCTGGGCCGACGTCGA

CCAGCGCACCCTCAAGACCGGCGAGGCCTTCCTCGCCGGCCTCGCCCCCCAGTGCG

GCCTCACCATCCACCACCAGCAGAACCTCGAGAAGGCCGACCCCCTCTTCCACCCC

GTCAAGGCCGGCACCTGCAGCATGGACAAGACCCAGGTCCAGCAGGCCGTCGAGA

AGGAGGCCCAGACCCCCATCGACAACCTCAACCAGCACTACATCCCCTTCCTCGCC

CTCATGAACACCACCCTCAACTTCAGCACCAGCGCCTGGTGCCAGAAGCACAGCGC

CGACAAGAGCTGCGACCTCGGCCTCAGCATGCCCAGCAAGCTCAGCATCAAGGACA

ACGGCAACAAGGTCGCCCTCGACGGCGCTATCGGCCTCAGCTCCACCCTCGCCGAG

ATCTTCCTCCTCGAGTACGCCCAGGGCATGCCTCAGGCTGCCTGGGGCAACATCCAC

AGCGAGCAGGAGTGGGCCAGCCTCCTCAAGCTCCACAACGTCCAGTTCGACCTCAT

GGCCCGCACCCCCTACATCGCCCGCCACAACGGCACCCCCCTCCTCCAGGCCATCA

GCAACGCCCTCAACCCCAACGCCACCGAGAGCAAGCTCCCCGACATCAGCCCCGAC

AACAAGATCCTCTTCATCGCCGGCCACGACACCAACATCGCCAACATCGCCGGCAT

GCTCAACATGCGCTGGACCCTCCCCGGCCAGCCCGACAACACCCCCCCCGGCGGCG

CTCTCGTCTTTGAGCGCCTCGCCGACAAGTCCGGCAAGCAATATGTCTCTGTCAGCA

TGGTCTACCAGACCCTCGAGCAGCTCCGCAGCCAGACCCCCCTCAGCCTCAACCAG

CGCGGCGGCAGCGTCCAGCTCAAGATCCCCGGCTGCAACGACCAGACCGCCGAGGG CTACTGCCCCCTCAGCACCTTCACACGGCGTCGTCAGCCAGAGCGTCGAGCCCGGCTG CCAGCTCCAGTAAGGCGCGCC (SEQ ID 140: 4)

Example 12 - Construction and expression of wild-type Buttiauxella phytase in T. reesei as a fusion protein with a Kex2 site [0157] The open reading frame of wild-type Buttiauxella phytase was amplified in polymerase chain reaction (PCR) using DNA synthesized by GENEART as template (see Table 13 , SEQ ID NO: 4). The PCR device used was the Peltier Thermal Cycler PTC-200 (MJ Research). The DNA polymerase used in the PCR was HERculase (Stratagene). The primers used to amplify the open phytase reading frame were SK667 (forward) 5 '

CACTACTAGTGTCGCTGTGGAGAAGCGCAACGACACCCCCGCCAG-3 '(SEQ ID NO: 6) and primer SK664 5' GAGTTCGGCGCGCCTTACTGGA-3 '(SEQ ID NO: 7). The forward stater contained the VAVEKR amino acid sequence (SEQ ID NO: 8) for effective cleavage by the Kex2 protease together with a SpeI site for cloning purposes. PCR conditions for amplification of the wild-type Buttiauxella phytase open reading frame were as follows: Step 1: 94 ° C for 1 min. Stage 2: 94 ° C for 30 sec. Stage 3: 58 ° C for 30 sec. Stage 4: 72 ° C for 1 min. Steps 2, 3 and 4 were repeated for an additional 24 cycles. Step 5: 72 ° C for 5 min. Stage 6: 4 ° C for storage. The PCR product was purified with the Qiaquick Gel Purification Kit (Qiagen) and digested with SpeI and AscI restriction enzymes (Roche). Digested DNA was purified using the Qiaquick PCR Purification Kit and ligated into the pTrex4 vector at the SpeI and AscI sites (see Figure 4). The ligation reaction was transformed into chemically competent E. coli TOP 10 cells (Invitrogen). The resulting construct was biolistically transformed into T. reesei derived strains using the PDS-1000 / He biolistic particle delivery system from Bio-Rad (Hercules, CA). The transformation protocol used was that described by Foreman (WO 2005/001036). Once stable transformants were obtained, these transformants were cultured and protein expression identified as described in Example 11. A protein band with an apparent molecular weight of approximately 96 kDa was observed on the stained gel. The expected molecular weight of the fusion protein is about 96 kDa. Protein was expressed at more than 10 g / L.

Example 13 - Construction and expression of wild type Buttiauxella phytase in T. reesei as a direct construct [0158] The open reading frame of wild type Buttiauxella phytase was amplified in polymerase chain reaction (PCR) using DNA synthesized by GENEART as template (see Table 13, SEQ ID NO: 4). The PCR device used was the Peltier Thermal Cycler PTC-200 (MJ Research). The DNA polymerase used in the PCR was HERculase (Stratagene). The primers used to amplify the open phytase reading frame were the SK680 primer (forward) 5'CACCATGCAGACCTTCGGTGCTTTTCTCGTTTCCTTCCTCGCCGCCAGCGGCCTGG CC GCGGCCAACGACACCCCCGCCAGC-3 '(SEQ IDCT 6' NO '). The forward primer contained an additional four nucleotides (-CACC sequence) at the 5 'end that were required for cloning into the pENTRY / D-TOPO vector (Invitrogen). PCR conditions for amplification of the wild-type Buttiauxella phytase open reading frame were as follows: Step 1: 94 ° C for 1 min. Stage 2: 94 ° C for 30 sec. Stage 3: 58 ° C for 30 sec. Stage 4: 72 ° C for 1 min. Steps 2, 3 and 4 were repeated for an additional 24 cycles. Step 5: 72 ° C for 5 min. Stage 6: 4 ° C for storage. The PCR product was purified using the Qiaquick Gel Purification Kit (Qiagen). The purified PCR product was initially cloned into the pENTRY / D TOPO vector (Invitrogen) and transformed into chemically competent E. coli TOP 10 cells (Invitrogen). The pENTR / D-TOPO vector with the correct sequence of the open phytase reading frame was recombined with the pTrex3g vector using LR Clonase II (Invitrogen) according to the manufacturer's instructions (see Figure 5). The resulting construct was transformed and the protein identified as described in Example 11. A protein band with an apparent molecular weight of approximately 46 kDa was observed on the stained gel. The expected molecular weight of the fusion protein is about 46 kDa. Protein was expressed at more than 10 g / L.

Example 14 - Construction and expression of Buttiauxella strain BP-17 phytase in T. reesei as a fusion protein with a Kex2 site [0159] DNA encoding the open reading frame of Buttiauxella strain BP-17 phytase was synthesized at GENEART AG (BioPark Josef-Engert-Str. 11 , D-93053 Regensburg, Germany) (see Table 14, SEQ ID NO: 5). The VAVEKR amino acid sequence (SEQ ID NO: 8) was included for cleavage of the fusion protein by Kex2 protease together with SpeI and AscI restriction sites for cloning purposes. The open phytase reading frame was inserted into the vector, pTrex4, in the SpeI and AscI sites (see Figure 4). The resulting construct was transformed and the protein identified as described in Example 11. A protein band with an apparent molecular weight of about 96 kDa was observed on the stained gel. The expected molecular weight of the fusion protein is about 96 kDa. Protein was expressed at more than 10 g / L.

Table 14: DNA sequence of the BP-17 Buttiauxella phytase containing a SpeI site at the 5 'end and an AscI site at the 3' end.

ACTAGTGTCGCCGTGGAGAAGCGCAACGACACCCCCGCCAGCGGCTACCAGGTCGA

GAAGGTCGTCATCCTCAGCCGCCACGGCGTCCGCGCCCCTACCAAGATGACCCAGA

CCATGCGCGACGTCACCCCCAACACCTGGCCCGAGTGGCCCGTCAAGCTCGGCTAC

ATCACCCCTCGCGGCGAGCACCTCATCAGCCTCATGGGCGGCTTCTACCGCCAGAA

GTTCCAGCAGCAGGGCATCCTCAGCCAGGGCTCGTGCCCCACCCCCAACAGCATCT

ACGTCTGGACCGACGTCGCCCAGCGCACCCTCAAGACCGGCGAGGCCTTCCTCGCC

GGCCTCGCCCCCCAGTGCGGCCTCACCATCCACCACCAGCAGAACCTCGAGAAGGC

CGACCCCCTCTTCCACCCCGTCAAGGCCGGCATCTGCAGCATGGACAAGACCCAGG

TCCAGCAGGCCGTCGAGAAGGAGGCCCAGACCCCCATCGACAACCTCAACCAGCAC

TACATCCCCAGCCTCGCCCTCATGAACACCACCCTCAACTTCAGCAAGAGCCCCTGG

TGCCAGAAGCACAGCGCCGACAAGAGCTGCGACCTCGGCCTCAGCATGCCCAGCAA

GCTCAGCATCAAGGACAACGGCAACGAGGTCTCCCTCGACGGCGCTATCGGCCTCA

GCTCCACCCTCGCCGAGATCTTCCTCCTCGAGTACGCCCAGGGCATGCCTCAGGCCG

CCTGGGGCAACATCCACAGCGAGCAGGAGTGGGCCCTCCTCCTCAAGCTCCACAAC

GTCTACTTCGACCTCATGGAGCGCACCCCCTACATCGCCCGCCACAAGGGCACCCCC

CTCCTCCAGGCCATCAGCAACGCCCTCAACCCCAACGCCACCGAGAGCAAGCTCCC

CGACATCAGCCCCGACAACAAGATCCTCTTCATCGCCGGCCACGACACCAACATCG

CCAACATCGCCGGCATGCTCAACATGCGCTGGACCCTCCCCGGCCAGCCCGACAAC

ACCCCCCCTGGCGGCGCTCTCGTCTTTGAGCGCCTCGCCGACAAGTCCGGCAAGCA

GTACGTCAGCGTCAGCATGGTCTACCAGACCCTCGAGCAGCTCCGCAGCCAGACCC

CCCTCAGCCTCAACCAGCCTGCCGGCAGCGTCCAGCTCAAGATCCCCGGCTGCAAC

GACCAGACCGCCGAGGGCTACTGCCCCCTCAGCACCTTCACCCGCGTCGTCAGCCA

GAGCGTCGAGCCCGGCTGCCAGCTCCAGTAAGGCGCGCC (SEQ ID NO: 5).

Example 15 - Construction and expression of Buttiauxella strain BP-17 phytase in T. reesei as a direct construct [0160] The open reading frame of Buttiauxella strain BP-17 phytase was amplified in polymerase chain reaction (PCR) using DNA synthesized by GENEART as template (see Table 14, SEQ ID NO: 5). The PCR device used was the Peltier Thermal Cycler PTC-200 (MJ Research). DNA polymerase used in

PCR was HERculase (Stratagene). The primers used to amplify the open phytase reading frame were the SK680 primer (forward) 5'CACCATGCAGACCTTCGGTGCTTTTCTCGTTTCCTTCCTCGCCGCCAGCGGCCTGG CC GCGGCCAACGACACCCCCGCCAGC-3 '(SEQ IDCT 6' NO '). The forward primer contained an additional four nucleotides (-CACC sequence) at the 5 'end that were required for cloning into the pENTRY / D-TOPO vector (Invitrogen). PCR conditions for amplification of the wild-type Buttiauxella phytase open reading frame were as follows: Step 1: 94 ° C for 1 min. Stage 2: 94 ° C for 30 sec. Stage 3: 58 ° C for 30 sec. Stage 4: 72 ° C for 1 min. Steps 2, 3 and 4 were repeated for an additional 24 cycles. Step 5: 72 ° C for 5 min. Stage 6: 4 ° C for storage.

The PCR product was purified using the Qiaquick Gel Purification Kit (Qiagen). The purified PCR product was initially cloned into the pENTRY / D-TOPO vector (Invitrogen) and transformed into chemically competent E. coli TOP 10 cells (Invitrogen). The pENTR / D-TOPO vector with the correct sequence of the open phytase reading frame was recombined with the pTrex3g vector using LR Clonase II (Invitrogen) according to the manufacturer's instructions (see Figure 5). The resulting construct was transformed and protein expression was identified as described in Example 11. Simply Blue staining analysis resulted in the observation of a protein band of approximately 46 kDa. A protein band with an apparent molecular weight of approximately 46 kDa was observed on the stained gel. The expected molecular weight of the fusion protein is about 46 kDa. Protein expression was found at more than 10 g / L.

[0161] Examples 16-20 provide more data showing that the combination of Buttiauxella alpha-amylase and phytase reduces inhibition of alpha-amylase and allows ethanol fermentation to take place at lower pH even without the addition of alkali or acid.

EXAMPLE 16: Effect of elimination of phytic acid inhibition on the thermostability of alpha-amylase [0162] An aqueous solution of ground whole maize (from 32-40% ds maize, containing 50% thin stillage) was incubated at pH 5.8, 70 ° C. Thermostable phytase (BP-17) and two liquefying thermostable SPEZYME ™ XTRA and SPEZYME ™ ETHYL alphaamylases from Danisco US Inc., Genencor Division were used for comparison.

[0163] Ground whole maize (Badger State Ethanol, Monroe, WI) was mixed with water containing 50% (V / V) of rare distillers to a final concentration of 32%. Corn solids were prepared in a mantle pot. The suspension was then mixed well and the pH of the suspension was adjusted with sodium carbonate or sodium hydroxide to pH 5.8, which is the typical pH for liquefaction in a commercial ethanol process. This suspension was mixed in a jacketed cauldron and brought to a pre-treatment temperature of 65-70 ° C. Just before reaching 70 ° C, SPEZYME ™ XTRA liquefying enzymes (10 AAU per gram of corn) or genetically modified Bacillus stearothermophilus alpha-amylase (SPEZYME ™ ETHYL from Danisco US Inc., Genencor Division) were added and the timer for starting the first liquefaction step (liquefaction 1 °, see Figure 1). The suspension was incubated for 40 minutes in the presence of enzymes with or without added BP-17 phytase (12 FTU per gram ds corn). The pre-treated suspension was then passed through a jet heater (from 82-107 ° C, 180-225 ° F), which was pre-heated to the desired temperature with steam and water. The slurry was passed through the stream at maximum speed (setting 1.5) about 4 liters / minute. The use of the first three loops of the stop coil resulted in a stop time of just over 3 minutes. When all the water had displaced and the desired temperature remained constant, part of the dissolved corn mash was collected and placed in a second bath (top drive agitator) at 85 ° C to start the second liquefaction (liquefaction 2 °) stage. Samples were taken for viscosity testing (using Brookfield), brix and DE (using Schoorls) at 0, 30, 60 and 90 minutes. The results are summarized in Table 15.

[0164] Table 15 shows a comparison of the effect of the first liquefaction conditions on the thermostability of various alpha-amylases after passing through the conditions of a jet preheater (225 ° F) for whole ground corn. The conditions for the first liquefaction are: 32% suspension of ground whole corn in water, pH adjusted to pH 5.8, incubated at 70 ° C for 40 min in the presence of various enzymes. The conditions of the jet heater are 107 ° C (225 ° F) for 3 minutes.

Table 15:

<td>Enzyme treatment</td><td>Phytase (BP-17) in liquefaction 1 °</td><td>Time in 85 ° C</td><td>DE</td><td>Viscosity, CP</td>

<td>SPEZYME ™ XTRA 10 AAU / g for</td><td></td><td> 0</td><td> 9,56</td><td> 6840</td>

<td>corn, 32% DS corn suspension</td><td>No</td><td>30 minutes</td><td> 9,41</td><td> 9900</td>

<td>containing 50% rare broth</td><td></td><td>60 min</td><td> 9,95</td><td> 9880</td>

<td>distillery, pH 5.8</td><td></td><td>90 min</td><td> 9,78</td><td> 9800</td>

<td>SPEZYME ™ ETHYL 10 AAU / g for</td><td>No</td><td> 0</td><td> 7,55</td><td> 5060</td>

<td>corn, 32% DS corn suspension</td><td></td><td>30 minutes</td><td> 7,88</td><td> 4340</td>

<td>containing 50% rare broth</td><td></td><td>60 min</td><td> 8,15</td><td> 4240</td>

<td>distillery, pH 5.8</td><td></td><td>90 min</td><td> 8,44</td><td> 3750</td>

<td>SPEZYME ™ XTRA 10 AAU / g for</td><td>Yes</td><td> 8,27</td><td> 11,04</td><td> 1060</td>

<td>maize + 12 FTU, BP-17 phytase / g maize ds</td><td></td><td>30 minutes</td><td> 15,73</td><td> 700</td>

[0165] The addition of BP-17 phytase during the first liquefaction reduced the phytic acid content of ground whole maize from 0.60% ds maize to 0.09% ds maize (reduction> 85%). The data in Table 15 show, based on an increase in DE or a decrease in viscosity, that SPEZYME ™ XTRA and SPEZYME ™ ETHYL were completely deactivated at a jet preheater temperature of 107 ° C (225 ° F). However, the elimination of phytic acid inhibition by phytase prior to jet heating resulted in a significant increase in the thermostability of alpha-amylases, as demonstrated by an increase in DE and a decrease in viscosity at 85 ° C during the second liquefaction step. The results showed that phytic acid inhibited alpha-amylase and that elimination of inhibition increased thermostability and / or pH stability of liquefying thermostable alpha-amylase.

EXAMPLE 17: Effect of elimination of phytic acid inhibition on the pH stability of alpha-amylase [0166] Ground whole maize was suspended in a 32% (maize) suspension using a 50:50 ratio of water and rare stillage. The slurry pH was measured and the pH was 5.15. The suspension was heated to 70 ° C (158 ° F) with water and steam in a jacketed boiler. Liquefying enzymes (SPEZYME XTRA and BP-17) were added and the suspension was pre-treated by maintaining the temperature at 70 ° C for 40 minutes. [0167] Table 16 shows an increase in DE and a decrease in viscosity during liquefaction of ground whole corn without any change in pH. The data showed that SPEZYME ™ XTRA or SPEZYME ™ ETHYL can be successfully used in the liquefaction process of ground whole corn at pH 5.2, if phytic acid inhibition of alpha-amylase is eliminated.

Table 16:

<td>Enzyme treatment</td><td>Phytase (BP-17) liquefaction stage 1 ° (40 min 70 ° C)</td><td>% deleted acid phytic</td><td>Time in 85 ° C</td><td>DE</td><td>Viscosity, CP</td>

<td>SPEZYME ™ XTRA 10</td><td>12.8 FTU / g for</td><td></td><td> 0</td><td> 10,38</td><td> 3620</td>

<td>AAU / g ds corn, 32% ds corn suspension</td><td>corn</td><td></td><td>30 minutes</td><td> 12,69</td><td> 1630</td>

<td>containing 50% rare</td><td></td><td></td><td>60 min</td><td> 14,69</td><td> 1740</td>

<td>stillage, pH 5.15</td><td></td><td></td><td>90 min</td><td> 15,62</td><td> 2140</td>

<td>SPEZYME ™ ETHYL 10</td><td>12.8 FTU / g for</td><td></td><td> 0</td><td> 8,38</td><td> 2200</td>

<td>AAU / g ds corn, 32% ds corn suspension</td><td>corn</td><td></td><td>30 minutes</td><td> 9,78</td><td> 1280</td>

<td>containing 50% rare</td><td></td><td></td><td>60 min</td><td> 11,70</td><td> 1250</td>

<td>stillage, pH 5.15</td><td></td><td></td><td>90 min</td><td> 12,54</td><td> 1290</td>

[0168] The results in Table 15 and Table 16 showed that the reduction of inhibition of SPEZYME ™ XTRA and SPEZYME ™ ETHYL by phytic acid prior to jet heating at high temperature of 107 ° C (225 ° F) ground whole corn resulted in a significant increase in activity stability at low pH stability, as demonstrated by the constant increase in DE growth at 85 ° C with a simultaneous decrease in the viscosity of the liquefied substrate.

EXAMPLE 18: Single dose compared to the divided dose of alpha-amylase [0169] This example shows the comparison of the addition of a single dose and the divided dose of alpha-amylase in a method for liquefying ground whole corn. Ground whole corn was suspended in 40% (ds corn) using water and rare stillage (2.8% of the total). Then the pH of this suspension was adjusted to 5.2 with 6 N sulfuric acid. The suspensions were heated to 68 ° C (155 ° F) with water and steam in a jacketed boiler. SPEZYME XTRA and BP-17 phytase were added in amounts of 10 AAU / g ds corn and 12.8 FTU / g ds corn, respectively. The suspension was pre-treated by maintaining at 68 ° C (155 ° F) for 40 minutes. After 40 minutes of pre-treatment, the suspension was passed through a jet preheater maintained at 107 ° C (225 ° F) with a one-minute hold time using an experimental jet plant (equipped with an M103 steam jet heater). Liquefied substrate was collected from the stream and placed in an 85 ° C water bath for second liquefaction. Three separate second liquefaction were carried out 1) without additional SPEZYME XTRA, 2) with an additional dose of 1 AAU / g ds corn alpha-amylase and 3) with additional 2 AAU / g ds corn alpha-amylase. The liquefied substrate was continuously stirred and held at 85 ° C for 90 minutes. Samples were taken at 0, 35 and 60 minutes. All samples were tested for Brix, DE (using the Schoorls method) and for viscosity (Brookfield viscometer with mandrel 2 at 20 rpm); Table 17

[0170] Table 17 is a comparison of a single dose (first liquefaction) and a divided dose (second liquefaction) of SPEZYME ™ XTRA.

Table 17:

<td>1 ° liquefaction conditions</td><td>Additive SPEZYME ™ XTRA in 2 ° liquefaction</td><td>Time at 85 ° C</td><td>DE</td><td>Viscosity, CP</td>

<td>SPEZYME XTRA in</td><td>No additions</td><td> 0</td><td> 11,87</td><td> 3220</td>

<td>10 AAU / g ds corn + BP phytase</td><td>Single dose</td><td>35 min</td><td> 14,63</td><td> 1440</td>

<td>17 in an amount of 12,0 FTU / g</td><td></td><td>60 min</td><td> 15,36</td><td> 1330</td>

<td rowspan="2">corn maize, 40% corn ds suspension</td><td>1 AAU / g for corn</td><td> 0</td><td> 11,87</td><td> 3220</td>

<td rowspan="2">Split dose</td><td rowspan="2">35 min</td><td rowspan="2"> 15,78</td><td rowspan="2"> 1130</td>

<td>containing 2.8%</td>

<td>rare decoction</td><td></td><td>60 min</td><td> 16,75</td><td> 1170</td>

<td>distillery, pH 5.15. Incubation at 70 ° C for</td><td>2 AAU / g for corn</td><td> 0</td><td> 11,87</td><td> 3220</td>

<td>40 min</td><td>Split dose</td><td>35 min</td><td> 16,77</td><td> 860</td>

[0171] The data in Table 17 showed that a significant amount of SPEZYME ™ XTRA activity survived the jet heat temperature of 107 ° C (225 ° F) due to the stabilization of SPEZYME ™ XTRA in the first liquefaction step. Both increases in DE and decreases in viscosity were observed without the addition of a second dose of SPEZYME ™ XTRA in the second liquefaction step. However, the addition of a second dose of SPEZYME ™ XTRA in the second liquefaction step further enhanced the DE increase as well as the viscosity decrease.

EXAMPLE 19: Effect on DDGS and ethanol production [0172] Liquefied substrates were used as fermentation raw materials in ethanol fermentation for alcohol production. Liquefied substrate # 1 (32% ds maize containing 50% thin stillage) from a conventional liquefaction method using SPEZYME ™ XTRA at pH 5.8 without phytase in the first liquefaction step was used. In addition, the liquefied substrate of Example 17, liquefied substrate # 2, was used using SPEZYME ™ XTRA with phytase treatment in the first liquefaction step and without adjusting the pH prior to fermentation. The pH of the liquefied starting control # 1 was adjusted to 4.2 with dilute sulfuric acid according to the conventional ethanol process, while the liquefied substrate of Example 17 (liquefied substrate # 2) was used without any further change in pH. The fluidized substrate of example 17 was used as the test without pH adjustment in the method of the invention. In each experiment, tare vessels were obtained before preparing the media. Liquefied 32% DS corn substrate (2 liters) was transferred to a 2 L bottle. The Red Star Ethanol Red (RED STAR (Lesaffre)) inocula was prepared by adding 10 grams of yeast and 1 gram glucose to 40 grams of water with gentle stirring for one hour. Five ml of each inoculum was added to equilibrated fermenters, followed by the addition of G Zyme ™ 480 Ethanol (Danisco US Inc., Genencor Division) at 0.4 GAU / g ds corn for simultaneous saccharification and fermentation initiation. An initial gross weight was recorded and the bottle was placed in a 32 ° C water bath. Samples were taken at various time intervals and analyzed for carbohydrate and ethanol content by HPLC. Fermentations were also carried out using one kilogram of each liquefied substrate and the weight loss during fermentation was measured at various time intervals. Alcohol was measured based on weight loss due to carbon dioxide loss (Table 18). At the end of fermentation, the final gross mass was obtained. The medium was quantitatively transferred to a 5 L round bottom vessel. The distillation was carried out in vacuo until about 800 ml of ethanol was collected in a container containing 200 ml of water. Ethanol was diluted to 2 L and analyzed by HPLC. Prior to drying, DS mass and distillation residue were obtained. Residual starch analysis was performed on DDGS. Stoichiometric calculations were carried out based on the analysis of weight loss, distillation and residual starch.

[0173] Calculations of ethanol using CO2 weight loss:

Ethanol production (mmol) = loss of CO2 (g) / 88

Ethanol production (g) = (CO2 loss (g) / 88) * 92 => CO2 loss (g) * 1.045

Ethanol production (ml) = ((CO2 loss (g) / 88) * 92) / 0.789 => CO2 loss (g) x 1.325

Table 18: Comparison of DDGS from the conventional liquefaction process and DDGS from the method without pH adjustment

<td rowspan="2">Terms of liquefaction neither a</td><td rowspan="2">Alcohol yield from weight loss</td><td rowspan="2">Starch</td><td colspan="3">DDGS,% on</td><td rowspan="2">Sulphate (mg / g ds)</td>

<td>Acid phytic</td><td>% IP 6</td><td>Slow phosphate</td>

<td>Conventional method - pH 5.8 (liquefied substrate # 1)</td><td>2.70 gallons / bushel</td><td> 7,25</td><td> 0,6</td><td> 100</td><td> 1,20</td><td> 1,92</td>

<td>No change in pH - pH 5.2 (liquefied substrate # 2)</td><td>2.69 gallons / bushel</td><td> 9,28</td><td> 0,2</td><td> 0</td><td> 1,33</td><td> 0,23</td>

[0174] The data in Table 18 showed the main differences in free sulfate and phytic acid content between methods. The elimination of thermostable alpha-amylase inhibition by phytic acid in the first liquefaction resulted in DDGS with reduced phytic acid, greater free available phosphate, and reduced sulfate. Thus, the method without pH regulation provided pH stability at low pH for liquefying thermostable alpha-amylase in the liquefaction method of starch.

Piotr Godlewski Patent Attorney

Contents171

63 members in 14 offices

This recordMember, by publication datePriority claim4 more offices are in the list below

Priority claims14

Priority claims
Document	Office	Kind	Date
90023707	United States of America	P	2007-02-07
90023707	United States of America	P	2007-02-07
71448707	United States of America	A	2007-03-06
71448707	United States of America	A	2007-03-06
90522207	United States of America	P	2007-03-06
90522207	United States of America	P	2007-03-06
08725297	European Patent Office (EPO)	A	2008-02-06
2008001647	United States of America	W	2008-02-06
2008001647	United States of America	W	2008-02-06
EP20080725297	–	–	–
US20070714487	–	–	–
US20070900237P	–	–	–
US20070905222P	–	–	–
WO2008US01647	–	–	–

Members63

Family members, oldest first
Document	Office	Kind
CA2677342A1	Canada	A1	2008-08-14
CA2677643A1	Canada	A1	2008-08-14
WO2008097619A2	World Intellectual Property Organization (WIPO)	A2	2008-08-14
WO2008097620A1	World Intellectual Property Organization (WIPO)	A1	2008-08-14
US2008220498A1	United States of America	A1	2008-09-11
WO2008097619A3	World Intellectual Property Organization (WIPO)	A3	2008-10-16
US2008299622A1	United States of America	A1	2008-12-04
WO2008150376A1	World Intellectual Property Organization (WIPO)	A1	2008-12-11
WO2008153712A2	World Intellectual Property Organization (WIPO)	A2	2008-12-18
WO2008153712A3	World Intellectual Property Organization (WIPO)	A3	2009-02-12
US2009098249A1	United States of America	A1	2009-04-16
AU2008318644A1	Australia	A1	2009-05-07
CA2704548A1	Canada	A1	2009-05-07
WO2009058956A1	World Intellectual Property Organization (WIPO)	A1	2009-05-07
MX2009007999A	Mexico	A	2009-08-07
WO2009100183A2	World Intellectual Property Organization (WIPO)	A2	2009-08-13
MX2009008000A	Mexico	A	2009-08-18
US2009221030A1	United States of America	A1	2009-09-03
WO2009100183A3	World Intellectual Property Organization (WIPO)	A3	2009-10-08
EP2115143A2	European Patent Office (EPO)	A2	2009-11-11
EP2118276A1	European Patent Office (EPO)	A1	2009-11-18
CN101636496A	China	A	2010-01-27
EP2147104A1	European Patent Office (EPO)	A1	2010-01-27
EP2152892A2	European Patent Office (EPO)	A2	2010-02-17
CN101688192A	China	A	2010-03-31
JP2010517572A	Japan	A	2010-05-27
JP2010517573A	Japan	A	2010-05-27
EP2203556A1	European Patent Office (EPO)	A1	2010-07-07
CN101842479A	China	A	2010-09-22
CO6210760A2	Colombia	A2	2010-10-20
US2010304468A1	United States of America	A1	2010-12-02
JP2011502483A	Japan	A	2011-01-27
US2011027830A1	United States of America	A1	2011-02-03
US8093016B2	United States of America	B2	2012-01-10
US8143046B2	United States of America	B2	2012-03-27
MX301786B	Mexico	B	2012-07-27
JP5150647B2	Japan	B2	2013-02-20
MX307871B	Mexico	B	2013-03-13
EP2152892B1	European Patent Office (EPO)	B1	2013-05-01
AU2008318644B2	Australia	B2	2013-05-02
US8450098B2	United States of America	B2	2013-05-28
JP2013121354A	Japan	A	2013-06-20
JP5252746B2	Japan	B2	2013-07-31
JP5463146B2	Japan	B2	2014-04-09
BRPI0807086A2	Brazil	A2	2014-04-29
EP2733209A2	European Patent Office (EPO)	A2	2014-05-21
CN101636496B	China	B	2014-06-25
EP2115143B1	European Patent Office (EPO)	B1	2014-07-16
EP2733209A3	European Patent Office (EPO)	A3	2014-08-27
DK2115143T3	Denmark	T3	2014-10-13
BRPI0818273A2	Brazil	A2	2014-10-14
ES2513217T3	Spain	T3	2014-10-24
JP2015027308A	Japan	A	2015-02-12
EP2118276B1	European Patent Office (EPO)	B1	2015-07-29
EP2147104B1	European Patent Office (EPO)	B1	2015-09-09
DK2118276T3	Denmark	T3	2015-10-12
ES2550477T3	Spain	T3	2015-11-10
DK2147104T3	Denmark	T3	2015-12-14
PL2118276T3This record	Poland	T3	2016-01-29
HUE026038T2	Hungary	T2	2016-05-30
CA2677643C	Canada	C	2016-06-07
CA2677342C	Canada	C	2016-06-14
BRPI0807757A2	Brazil	A2	2017-05-02