Starch hydrolysis using phytase with an alpha amylase

(54) Title: FITASES VARIANTES DE BUTTIAUXELLA (57) Abstract: SP. WITH CHANGED PROPERTIES (30) Unionist Priority: 3/6/2007 us 11/714,487, 7/7/2007 US 60 / 900,237, 3/6/2007 US 60 / 905,222, 3/6/2007 US 60 / 905,222, 06 / 03/2007 US 60 / 905,222, 07/02/2007 US 60 / 900,237 (73) Holder (s): danisco us inc., Genencor division (72) Inventor (s): Andrei Miasnikov, Birgitta Leuthner, Klaus Pellengahr, Marguerite A. Cervin, Michael Ward, Oliver Kensch, Steve Kim, Ulrich Kettling (74) Attorney (s): Dannemann, Siemsen, Bigler & Ipanema Moreira (86) International Application: pct US2OO8OO1646 of 06/02/2008 (87) International Publication: wo 2008 / 0976i9de 14/08/2008

Effect of pepsin on Buttiauxella phytase (wt and Bp17)

<img file="BRPI0807086A2_D0001.tif" />

Descriptive Report of the Invention Patent for VARIANT PHYTASES OF BUTTIAUXELLA SP. WITH CHANGED PROPERTIES. FIELD OF THE INVENTION

The present invention relates to variant phytases of Buttiauxella spp., To nucleic acids encoding phytases and to a heterogeneous expression method. The phytases encompassed by the invention can be used in industrial applications, including methods for liquefying starch, alcohol fermentations and to enhance the digestion of phosphate in food and animal feed.

BACKGROUND OF THE INVENTION

Phosphorus (P) is an essential element for growth. A substantial amount of the phosphorus found in conventional livestock feeds, for example, cereal grains, oilseed meal and in products that originate from seeds, is in the form of phosphate that is covalently bound in a molecule known as phytate. The bioavailability of phosphorus in this form is generally very low for non-ruminants, such as poultry and pigs, because they do not have digestive enzymes to separate phosphorus from the phytate molecule.

Several important consequences of the inability of non-ruminants to use phytate can be indicated. For example, costs are incurred when inorganic phosphorus (eg dicalcium phosphate, defluorinated phosphate) or animal products (eg meat and bone meal, fish meal) are added to meet the animals' nutritional phosphorus requirements. . In addition, phytate can bind to or chelate numerous minerals (for example, calcium, zinc, iron, magnesium and copper) in the gastrointestinal tract, thus making them unavailable for absorption. In addition, most of the phytate present in the feed passes through the gastrointestinal tract, increasing the amount of phosphorus in the manure. This leads to an increased ecological phosphorus load in the environment.

Microbial phytase, as a feed additive, has been found to improve the bioavailability of phytate phosphorus in typical diets for non-ruminants (see, for example, Cromwell, et al., 1993). The result is less need to add inorganic phosphorus to animal feed, as well as lower levels of phosphorus in excreted manure (see, for example, Kornegay, et al., 1996). In addition to feed additives, phytases can be used for the production of low phytin food fractions. For example, phytases can be used in wet grain milling for the production of, for example, low phytin corn infusion liquor and low phytin corn gluten or in a dry milling process in combination with enzymes of hydrolysis of starch for the production of glucose and alcohols (eg ethanol).

Despite the advantage of using phytases in these applications, surprisingly few known phytases have gained wide acceptance in the feed, starch liquefaction and alcohol fermentation industries. The reasons for this vary from enzyme to enzyme. Typical concerns relate to high manufacturing costs and / or low stability / activity of the enzyme in the desired application environment. Numerous enzyme criteria have to be met by a phytase if it is to be attractive for widespread use in industrial applications. The most important enzymatic criteria include a high specific global activity, a low optimum pH, resistance to gastrointestinal proteases and thermostability.

Thermostability is one of the most important prerequisites for a successful application of phytase as a food enzyme and for use in starch liquefaction processes, because the phytase in the ratio and / or processes is exposed to high temperatures. For example, in feed pelletizing processes, temperatures are between 60 and 95 ° C and, in starch liquefaction processes, temperatures are between 75 and 120 ° C.

The DNA sequence of a gene from Buttiauxella sp P1-29, which encodes a phytase, was presented in WO 06/043178, published on April 27, 2006. Reference is made to SEQ ID NO: 1 and SEQ ID NO : 2 and the amino acid sequence of the phytase gene from Buttiauxella sp P1-29 (SEQ ID NO: 3) presented there. Based on several intrinsic properties, the phytase of Buttiauxella sp P1-29 represented an excellent starting point from which to start a mutagenesis program for a thermostable phytase for various commercial applications. WO 06/043178 discloses numerous variants of the phytase of Buttiauxella sp P1-29 (see, for example, table 1). At least one variant presented in WO 06/043178 and designated here as BP-11 has been further modified. The present invention relates to variants with altered properties, such as improved properties, including, but not limited to, a) better thermostability, b) increased specific activity and / or c) increased specific activity with retention of thermostability, compared to phytase of Buttiauxella sp P1-29 or with the BP-11 variant.

SUMMARY OF THE INVENTION

In one aspect, the invention relates to a phytase which is the expression product of a mutated DNA sequence encoding a phytase, the mutated DNA sequence being derived from a phytase precursor of Buttiauxella spp. In one embodiment, phytase is derived from Buttiauxella sp. strain P1-29.

In a further aspect, the invention relates to a variant of phytase, said variant comprising a substitution corresponding to positions A122, D125, T167, F197, T209, A211, K240, A242, S281, Q289, A294 and N303 in one phytase derived from Buttiauxella sp. strain P1-29.

In another aspect, the invention relates to an isolated phytase comprising a replacement corresponding to positions A122, D125, T167, F197, T209, A211, K240, A242, S281, Q289, A294 and N303 of SEQ ID NO: 1 and with hair at least 95% sequence identity including variant substitutions of amino acid residues 34 - 446 of SEQ ID NO: 1. In one embodiment, the substitution comprises A122T, D125A, T167I, F197S, T209K, A211P, K240E, A242S, S281L , Q289Y, A294E and N303K of SEQ ID NO: 1. In another modality, the substitution corresponds to positions R51, R55, T58, K59, D125, R127, K164, N239, G248, T252, E255, E276, H286, F290, M293, N303, H339, D340, T341 and / or D361 SEQ ID NO: 1.

In a further aspect, the invention relates to a variant of phytase called BP-11, said variant comprising a replacement corresponding to positions R24, R28, T31, K32, D98, R100, K137, N212, G221, T225, E228 , E249, H259, F263, M266, N276, H312, D313, T314 and / or D334 of SEQ ID NO: 4. In one embodiment, the BP-11 variant has a replacement in a position corresponding to D98. In a preferred embodiment, the replacement is D98A.

In yet another aspect, the invention relates to a polypeptide with phytase activity, comprising SEQ ID NO: 3. In one embodiment, the invention relates to a polypeptide with phytase activity consisting of the amino acid sequence of SEQ ID NO: 3.

In a further aspect, the invention relates to an isolated DNA encoding a variant of phytase encompassed by the invention and expression vectors including said DNA.

In yet another aspect, the invention relates to a variant of Buttiauxella sp. with enhanced phytase characteristics. In one embodiment, the enhanced phytase characteristic will be better thermal stability compared to Buttiauxella sp. native and, more specifically, the phytase of Buttiauxella sp. derived from the P1-29 strain. In other embodiments, the variant will have improved features compared to BP-11.

In other respects, the invention relates to enzyme compositions comprising a protein with phytase activity, in which the enzyme composition is used in commercial applications. In one embodiment, the enzyme composition can be an animal feed composition. In other embodiments, the enzyme composition can be used in starch hydrolysis processes (for example, liquefaction). In additional embodiments, an enzyme composition comprising a phytase encompassed by the invention will include additional enzymes, such as glucamylases, alpha amylases, protease, cellulases and combinations thereof.

In one aspect, the present invention relates to a fermentation medium including a Buttiauxella phytase or its variant of a filamentous fungal cell culture. In one aspect, the filamentous fungal cells are Trichoderma cells, like T. reesei. In one aspect, phytase has an amino acid sequence with at least 75% sequence identity with SEQ ID NO: 1, such as SEQ ID NO: 1, SEQ, D NO: 2 or SEQ ID NO: 3.

In an additional aspect, the present invention relates to methods for producing phytase in a filamentous fungal host cell by transforming a filamentous fungal host cell with a DNA construct including a promoter with transcriptional activity in the filamentous fungal host cell operably linked to a heterologous polynucleotide that encode a phytase with phytase activity and an amino acid sequence with at least 75% sequence identity to SEQ ID NO: 1, cultivation of the filamentous fungal host cell in a suitable culture medium, to allow the expression of said phytase, and production of phytase. The method may also include recovering the phytase produced. In one embodiment, the filamentous fungal host cell is a Trichoderma cell, like T. reesei. In one aspect, phytase has at least 95% amino acid sequence identity to SEQ ID NO: 1. In a further aspect, the phytase has the sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. In another aspect, the invention is a Trichoderma cell obtained according to the method outlined above.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1A represents a polypeptide encoded by the Buttiauxella P1-29 phytase gene (BP-WT) SEQ ID NO: 1), including the native signal sequence and the mature protein (SEQ ID NO: 2). The signal sequence is underlined.

Figure 1B represents the mature protein of the BP-11 variant without a signal sequence, but including His N-terminal tags (SEQ ID NO: 4). The BP-11 variant has a replacement for 11 amino acid residues when aligned with BP-WT. These substitutions are highlighted and underlined in the figure.

Figure 1C represents the mature protein of the Buttiauxella phytase variant (BP-17) (SEQ ID NO: 3). The BP-17 variant has the same 11 amino acid substitutions as BP-11 plus one (1) additional substitution, which is highlighted and underlined in the figure.

Figure 2 illustrates the expression vector pCDP (SHOK) as described in more detail in Example 3.

Figure 3 shows the comparison of the pH profile of BP-17 expressed in E. coli and BP-WT, as described in more detail in Example 3.

Figure 4 shows the pepsin resistance of BP-WT and the BP-17 mutant, as described in more detail in Example 3.

Figure 5 illustrates the pTREX4 / phytase fusion construct, as described in more detail in Example 4.

Figure 6 illustrates the direct construct pTREX4 / phytase, as described in more detail in Example 6.

DETAILED DESCRIPTION OF THE INVENTION

Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as is commonly understood by those skilled in the art to which this invention belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2^The Ed., John Wiley and Sons, New York (1994), and Hale &amp; Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991), present those skilled in the art with a generic dictionary of many of the terms used in this invention.

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. The numerical ranges are inclusive of the numbers that define the range. Unless otherwise indicated, nucleic acid sequences are written from left to right, in the 5 'to 3' orientation; the amino acid sequences are written from left to right in the amino orientation for carboxy, respectively.

The headings presented here are not limitations on the various aspects or modalities of the invention that can be taken by reference to the report as a whole. Therefore, the terms defined immediately below are defined in more detail by reference to the report as a whole.

Definitions:

As used herein, the term phytase or phytase activity refers to a protein or polypeptide that is capable of catalyzing the hydrolysis of phytate in (1) myoinositol and / or (2) its mono-, di-, tri-, tetra- and / or pentaphosphates and (3) inorganic phosphate. For example, enzymes with catalytic activity as defined in EC Enzyme Commission number 3.1.3.8 or EC number 3.1.3.26.

The term a phytase of Buttiauxella spp., As used herein, refers to a phytase protein obtained from a Buttiauxella spp. In one embodiment, the phytase of Buttiauxella spp. comprises the amino acid sequence of NCIMB (National Collections of Industrial Marine and Food Bacteria, Scotland, UK) NCIMB accession number 41248. In a preferred embodiment, a phytase of Buttiauxella spp. comprises the amino acid sequence of SEQ ID NO: 2 or amino acid residues 34 to 446 of SEQ ID NO: 1.

The term corresponding to a phytase of Buttiauxella spp., As used herein, refers to an enzyme with the same functional characteristics as a phytase of Buttiauxella spp., But not necessarily obtained from a source of Buttiauxella spp.

The term Buttiauxella refers to a genus of gram negative, optionally anaerobic bacteria in the Enterobacteriaceae family, and Buttiauxella spp includes B. agrestis, B. brennerase, B. ferragutiae, B. gaviniae, B. izardii, B. noackiae and B. warmboldiae. Strains of Buttiauxella species are available, for example, from the American Type Culture Collection (ATCC) and DSMZ, the German Center for Natural Resources for Biological Material.

The term wild-type or wild-type phytase refers to an enzyme with an amino acid sequence found in nature.

The term phytase variant of Buttiauxella spp. means a phytase enzyme with an amino acid sequence derived from the amino acid sequence of a parent phytase or precursor phytase, but differing in at least one amino acid substitution, insertion and / or deletion which are called together mutations.

The term mature phytase refers to phytase after signal processing, such as removing secretion signal sequences.

The term BP-11 designates a phytase comprising the amino acid sequence of positions 7 to 419 of SEQ ID NO: 4. BP-11 is a phytase turning point of Buttiauxella spp. wild type with SEQ ID NO: 1.

The term BP-17 designates a phytase comprising the amino acid sequence of SEQ ID NO: 3.

Protein, as used herein, includes proteins, polypeptides and peptides. As will be appreciated by those skilled in the art, the nucleic acid sequences of the invention, as defined below and described here in more detail, can be used to generate protein sequences.

The terms amino acid residue equivalent to, amino acid corresponding to and its grammatical equivalents are used herein to refer to an amino acid residue of a protein with a similar position and effect to those indicated in the particular amino acid sequence of a particular protein. Those skilled in the art will recognize the equivalence of specific residues in comparable phytase proteins.

Percentage of sequence identity, with respect to two sequences of amino acids or polynucleotides, refers to the percentage of residues that are identical in the two sequences when the sequences are optimally aligned. Thus, 80% amino acid sequence identity means that 80% of the amino acids in two optimally aligned polypeptide sequences are identical. The percentage of identity can be determined, for example, by directly comparing the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shortest sequence and multiplying the result per 100. Readily available computer programs can be used to aid analysis, such as ALIGN, Dayhoff, MO in Atlas of Protein Sequence and Structure, MO Dayhoff ed., Suppl. 3: 353-358, National Biomedical Research Foundation, Washington, DC, which adapts the local homology algorithm of Smith and Waterman (1981) Advances in Appl. Math. 2: 482-489, for peptide analysis. Programs to determine nucleotide sequence identity are available in the Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, Wl), for example, BESTFIT, FASTA and GAP programs, which are also based on the algorithm Smith and Waterman. These programs are readily used with the predetermined parameters recommended by the manufacturer and described in the aforementioned Wisconsin Sequence Analysis Package. An example of an algorithm that is suitable for determining sequence similarity is the BLAST algorithm, which is described in Altschul, et al., J. Mol. Biol. 215: 403-410 (1990). The software for performing BLAST analyzes is in the public domain by the National Center for Biotechnological Information (http://www.ncbi.nlm.nih.gov/).

The term property or its grammatical equivalents in the context of a polypeptide, as used herein, refers to any characteristic or attribute of a polypeptide that can be selected or detected. These properties include, but are not limited to, oxidative stability, substrate specificity, catalytic activity, thermal stability, pH activity profile and the ability to be secreted.

The terms thermally stable and thermostable refer to phytases of the present invention that retain a specified amount of enzyme activity after exposure to elevated temperature.

The term increased stability, in the context of a property such as thermostability, refers to an enzyme activity maintained in a high manner over time compared to other phytases.

The terms polynucleotide and nucleic acid, used here interchangeably, refer to a polymeric form of nucleotides of any length, whether ribonucleotides or deoxyribonucleotides. These terms include, but are not limited to, single, double or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid or a polymer comprising purine and pyrimidine bases, or other biochemically modified, natural, nucleotide bases , unnatural or derivatized.

As used herein, the term gene refers to a polynucleotide (for example, a segment of DNA) that encodes a polypeptide and includes regions preceding and following the coding regions, as well as intervening sequences (introns) between individual coding segments (exons).

As used herein, the terms DNA construct, transforming DNA and expression vector are used interchangeably to refer to DNA used to introduce sequences into a host cell or organism. DNA can be generated in vitro by PCR or any other suitable technique known to those skilled in the art. The DNA construct, transforming DNA or recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector, DNA construct or transforming DNA includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter. In preferred embodiments, expression vectors have the ability to incorporate and express heterologous DNA fragments in a host cell.

As used herein, the term vector refers to a polynucleotide construct designed to introduce nucleic acids into one or more types of cells. Vectors include cloning vectors, expression vectors, launcher vectors, plasmids, cassettes and the like.

As used herein in the context of introducing a nucleic acid sequence into a cell, the term introduced refers to any suitable method for transferring the nucleic acid sequence to a cell. Such methods for introduction include, but are not limited to, protoplast fusion, transfection, transformation, conjugation and transduction and include references to the incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell in which the nucleic acid sequence can be incorporated in the cell's genome (for example, chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous or transiently expressed replicon (for example, transfected mRNA).

The term optimal alignment refers to the alignment that provides the highest percentage of identity count.

The terms protein and polypeptide are used interchangeably here. In the present description and claims, conventional one-letter and three-letter codes for amino acid residues are used. The 3 letter code for amino acids, as defined according to the Joint Commission IUPAC-IUB For Biochemical Nomenclature (JCBN). It should also be understood that a polypeptide can be encoded by more than one sequence of nucleotides, due to the degeneration of the genetic code.

Variants of the invention are described by the following nomenclature: [original amino acid residue / position / substituent amino acid residue]. For example, the replacement of arginine (R) with glutamic acid (E) at position 51 of SEQ ID NO: 1 is represented as R51E. When more than one amino acid is substituted at a given position, the substitution is represented as 1) R51E, R51A, R51H or R51W; 2) R51E, A, H or W or c) R51 / E / A / H / W. When a suitable substitution position is identified here without a specific suggested amino acid, it should be understood that any amino acid residue can replace the amino acid residue present in the position. When a phytase variant contains a deletion compared to other phytases, the deletion is indicated with For example, a deletion at position R51 is represented as R51 *. A deletion of two or more consecutive amino acids is indicated, for example, as (51 to 54) *.

A prosequence is a sequence of amino acids between the signal sequence and the mature protein that is required for protein secretion. Pro-sequencing divage will result in a mature active protein.

The term signal sequence or signal peptide refers to any sequence of nucleotides and / or amino acids that may participate in the secretion of the mature or precursor forms of the protein. This definition of signal sequence is functional, intending to include all amino acid sequences encoded by the N-terminal part of the protein gene that participate to effect the secretion of the protein. Often, but not universally, they are linked to the N-terminal part of a protein or to the N-terminal part of a precursor protein.

Host strain or host cell refers to a host suitable for an expression vector comprising DNA according to the present invention.

The terms derived from and obtained from refer to not only a phytase produced or produced by a strain of the organism in question, but also a phytase encoded by a DNA sequence isolated from that strain and produced in a host organism containing that DNA sequence . In addition, the term refers to a phytase that is encoded by a sequence of DNA of synthetic origin and / or cDNA and that has the identifying characteristics of the phytase in question.

The term isolated, recovered or purified refers to a material that has been removed from its original environment.

A ration and a food mean, respectively, any diet, meal or similar natural or artificial or components of these meals intended for or suitable to be eaten, ingested, digested by an animal or a human being, respectively.

A food or feed additive is an essentially pure compound or a multi-component composition intended or suitable to be added to a food or feed. It normally comprises one or more compounds such as vitamins, minerals or feed-enhancing enzymes and suitable vehicles and / or excipients and is usually presented in a form that is suitable for addition to an animal feed.

The term starch liquefaction refers to a process by which the starch is converted into shorter and less viscous chain dextrins.

The term native Buttiauxella phytase (n-Buttiauxella phytase) refers to a Buttiauxella phytase produced by the endogenous expression of Buttiauxella phytase. For example, the term n-Buttiauxella phytase means the endogenous expression of a Buttiauxella phytase (i.e., SEQ ID NO: 1) of a species of Buttiauxella.

The terms recombinant Buttiauxella phytase (rButtiauxella phytase), recombinantly expressed Buttiauxella phytase and recombinantly produced Buttiauxella phytase refer to a mature Buttiauxella phytase protein sequence or variant that is produced in a host cell by expression of a heterologous polynucleotide. For example, the term r-Buttiauxella phytase means that Buttiauxella phytase (ie SEQ ID NO: 1, 2 or 3) is expressed in a host into which a polynucleotide encoding Buttiauxella phytase or a variant.

A promoter is a regulatory sequence that is involved in binding to RNA polymerase to initiate transcription of a gene.

Under transcriptional control is a well-understood term in the art, which indicates that the transcription of a polynucleotide sequence, usually a DNA sequence, depends on being operationally linked to an element that contributes to the initiation of or promotes transcription.

Under translation control is a well-understood term in the art, which indicates a regulatory process that occurs after the mRNA has been formed.

As used here when describing proteins and genes that encode them, the term for the gene is in italics (for example, the gene that codes for Buttiauxella phytase). The term for protein in general is not in italics, and the first letter is usually capitalized.

The term 'Operationally linked refers to the juxtaposition in which the elements are in an arrangement that allows them to be functionally related. For example, a promoter is operationally linked to a coding sequence if it controls the transcription of the sequence.

The term selective marker refers to a gene capable of expression in a host that allows easy selection of hosts that contain an introduced nucleic acid or vector. Examples of selectable markers include, but are not limited to, antimicrobials (e.g., hygromycin, bleomycin or chloramphenicol) and / or genes that confer a metabolic advantage, such as a nutritional advantage, to the host cell.

The term heterologous with reference to a polynucleotide or protein refers to a polynucleotide or protein that does not occur naturally in a host cell.

The term endogenous with reference to a polynucleotide or protein refers to a polynucleotide or protein that occurs naturally in a host cell.

The terms recovered, isolated and separated, as used herein, refer to a compound, protein, cell, nucleic acid or amino acid that is removed from at least one component with which it is naturally associated.

As used herein, the terms transformed, transformed in a stable and transgenic manner, used with reference to a cell, mean that the cell has a non-native (for example, heterologous) nucleic acid sequence integrated into its genome or as an episomal plasmid that is maintained across multiple generations.

As used herein, the term expression refers to the process by which a polypeptide is produced based on the nucleic acid sequence of a gene. The process includes both transcription and translation.

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, exemplary and preferred methods and materials are now described. All publications mentioned herein are hereby incorporated by reference to expose and describe the methods and / or materials with respect to which the publications are cited.

Other definitions of terms may appear throughout the report. Before the exemplary modalities are described in more detail, it should be understood that this invention is not limited to the particular modalities described, as these, of course, vary. It should also be understood that the terminology used here is only for the purpose of describing particular modalities and is not intended to be limiting, as the scope of the present invention will be limited only by the appended claims.

When presenting a range of values, it should be understood that each intermediate value, up to one tenth of the lower limit unit, unless the context clearly determines otherwise, between the upper and lower limits of that range, is also specifically presented . Each minor range between any mentioned value or intermediate value in a mentioned range and any other mentioned or intermediate value in that mentioned range is included in the invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range, and each range in which any, none or both limits are included in the smaller ranges is also encompassed by the invention, subject to any limit specifically excluded in the mentioned range. When the mentioned range includes one or both of the limits, ranges that exclude either or both of the included limits are also included in the invention.

It should be noted that, as used herein and in the appended claims, the singular forms one, one, and the and include the respective plurals, unless the context clearly determines otherwise. Thus, for example, the reference to a gene includes a plurality of such candidate agents, and the reference to the cell includes the reference to one or more cells and their equivalents known to those skilled in the art, and so on.

The publications discussed here are presented only for their exposure prior to the filing date of this application. Nothing here should be taken as an admission that the present invention does not precede that publication by virtue of a previous invention.

Phytase enzymes / variants:

Phytase enzymes used as parent enzymes or precursors include a phytase from Buttiauxella sp. and those enzymes corresponding to a phytase from Buttiauxella sp. In some embodiments, the phytase of Buttiauxella sp. of origin comprises the amino acid sequence of NCIMB (National Collections of Industrial Marine and Food Bacteria, Scotland, UK) NCIMB accession number 41248. In some embodiments, the phytase of Buttiauxella sp. of origin comprises the amino acid sequence of SEQ ID NO: 1 or amino acid residues 34 to 446 of SEQ ID NO: 1 (for example, SEQ ID NO: 2). In some embodiments, the phytase of Buttiauxella sp. of origin is derived from B. agrestis, B. brennerase, B. ferragutiae, B. gaviniae, B. izardii, B. noackiae and B. warmboldiae. Reference is made to WO 2006/043178, which is specifically incorporated by reference and which describes phytases obtainable or derived from a phytase from Buttiauxella sp. of origin and phytases corresponding to a phytase enzyme from Buttiauxella sp .. In some embodiments, a phytase from Buttiauxella sp. wild type has at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98% and at least minus 99% amino acid sequence identity with the polypeptide of SEQ ID NO: 1 or the polypeptide of SEQ ID NO: 2.

The present invention relates to variant phytases (for example, variant phytases from Buttiauxella sp.). Specifically, WO 2006/043178 describes the mutagenesis of a wild-type phytase enzyme with the sequence presented here as SEQ ID NO: 3 and referred to in the present application as SEQ ID NO: 1 and SEQ ID NO: 2. Numerous preferred mutations are taught in WO 2006/043178. A variant phytase will contain at least one amino acid substitution, deletion or insertion, with amino acid substitutions being particularly preferred. The substitution, insertion or deletion of amino acids can occur at any residue within the phytase peptide. A phytase variant of the present invention is a variant that does not have an amino acid sequence identical to the amino acid sequence of the present SEQ ID NO: 2.

In preferred embodiments of the present invention, the variant will comprise a substitution corresponding to positions A122, D125, T167, F197, T209, A211, K240, A242, S281, Q289, A294 and N303 in a phytase of Buttiauxella sp. and, more specifically, corresponding to said equivalent positions in SEQ ID NO: 1. In some embodiments, the substitution comprises any of the remaining 19 amino acids corresponding to A, C, D, E, F, G, Η, I, K, L, Μ, N, P, Q, R, S, T, V, W or V. In some embodiments, the variant comprises the following amino acid substitutions: A122T, D125A, T167I, F197S, T209K, A211P, K240E, A242S, S281L, Q289Y, A294E and N303K corresponding to SEQ ID NO: 1.

In some embodiments, phytase is a variant of the phytase called BP-11, said BP-11 variant comprising amino acid residues 7 to 419 of SEQ ID NO: 4. BP-11 is a variant of BP-WT (SEQ ID NO: 1 and SEQ ID NO: 2).

In some embodiments, said BP-11 phytase variant comprises at least one substitution corresponding to positions R24, R28, T31, K32, D98, R100, K137, N212, G221, T225, E228, E249, H259, F263, M266, N276, H312, D313, T314 and / or D334 of SEQ ID NO: 4 or a sequence with at least 95%, at least 96%, at least 97%, at least 98% and at least 99% sequence identity amino acids, including variant substitutions of amino acid residues 7 - 419 of SEQ ID NO: 4. In some embodiments, the variant will include more than one substitution, for example, two, three, four or more substitutions. In another modality, the BP-11 variant has a replacement in the position corresponding to D98. Although the substitution can be any of the remaining 19 amino acids, in a preferred embodiment, the substitution is D98A. In additional modalities, the BP-11 variant with a substitution corresponding to position D98 will include one or more substitutions of the group corresponding to positions R24, R28, T31, K32, R100, K137, N212, G221,

Τ225, Ε228, Ε249, Η259, F263, Μ266, Ν276, Η312, D313, Τ314 and / or D334 of SEQ ID NO: 4. In some embodiments, the variant has an activity equal to or greater than the BP-11 phytase.

In a particularly preferred embodiment, the phytase variant comprises the polypeptide of SEQ ID NO: 3. In another embodiment, the phytase variant consists of the polypeptide of SEQ ID NO: 3.

In some embodiments, the variant according to the invention, including an amino acid substitution at positions A122, D125, T167, F197, T209, A211, K240, A242, S281, Q289, A294 and N303 of SEQ ID NO: 1, also will comprise a phytase with at least 90%, at least 92%, at least 93%, at least 94% and at least 95% sequence identity, including variant substitutions, with amino acid residues 34 to 446 of the phytase type wild SEQ ID NO: 1.

In some embodiments, a variant according to the invention will include, in addition to a replacement corresponding to positions A122, D125, T167, F197, T209, A211, K240, A242, S281, Q289, A294 and N303 of SEQ ID NO: 1, one or more substitutions corresponding to amino acid residues 59, 70, 193, 204, 221, 223, 225, 268, 336 and 351. In some embodiments, the variant will include substitutions corresponding to K59E, N70Y, H193R, T204I, S221N, D223E, G225A, A268V, I336F and N351 of SEQ ID NO: 1.

In some embodiments, a variant according to the invention will include a functional fragment. A functional fragment means a part of the phytase from Buttiauxella spp. that retains the enzyme function, preferably that the fragment retains essentially the same amount of enzyme function or a greater amount of enzyme function compared to the phytase polypeptide from which it was derived. In some embodiments, the variant that is a fragment will include a replacement corresponding to positions A122, D125, T167, F197, T209, A211, K240, A242, S281, Q289, A294 and N303 of SEQ ID NO: 1 and at least 350, at least 375 or at least 400 amino acid residues of SEQ ID NO: 1. In some embodiments, a variant according to the invention (for example,

SEQ ID NO: 3) will be a fragment with at least 350, at least 375 or at least 400 amino acid residues.

Variants can be prepared by random mutagenesis, site saturation mutagenesis and site-specific mutagenesis of nucleotides in the DNA encoding the phytase protein, using a cassette or PCR mutagenesis or other techniques well known in the art, to produce variants that can then be produced in cell culture. Reference is made to Morinaga et al., (1984) Biotechnology 2: 646-649; Nelson and Long, (1989) Analytical Biochem., 180: 147-151, and Sarkar and Sommer (1990) Biotechniques 8: 404-407. Fragments of variant phytase protein can also be prepared by in vitro synthesis using established techniques.

Polynucleotides:

The present invention also encompasses polynucleotides that encode the variant phytases according to the invention. Those skilled in the art are aware that, due to the degeneration of the genetic code, nucleotide sequences can be produced in which the use of the triplet codon for some of the amino acids encoded by an original sequence has been altered, thereby producing a different nucleotide sequence, but encoding the same phytase as the original nucleotide sequence. For example, a nucleotide sequence with a change in the third position of the triplet codon for all triplet codons would be about 66% identical to the original sequence; however, the amended nucleotide sequence would encode the same phytase (for example, with the same primary amino acid sequence).

Polynucleotides can be obtained by standard procedures known in the art, for example, from cloned DNA (for example, a DNA library), by chemical synthesis, by cDNA cloning, by PCR (United States patent No. 4,683. 202 or Saiki et al., (1988) 239: 487-491), by synthetically established methods (Beucage et al., (1981) Tetrahedron Letters 22: 1859 - 1869, and Matthes et al., (1984) EMBO J. 3: 801-895) or by cloning genomic DNA, or fragments thereof, substantially purified from a desired cell, such as Buttiauxella sp. (see, for example, Sambrook et al., 2001, Molecular Cloning, A Laboratory Manual, 3^The Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; Glober, DM and Hames, BD (Eds.), 1995, DNA Cloning 1: A Practical Approach and DNA Cloning 2: A Practical Approach, Oxford University Press, Oxford). Sequences of nucleic acids derived from genomic DNA, and their derivatives, may contain regulatory regions, in addition to coding regions.

Table 1: BP-WT polynucleotide sequence

TTTCACATAGCAAACAACAACGAGACGAACTCGACGTTACCGCTTTGCTT

CTGGAGTATATTTATCAGACTCAAACACCCCAAAGAAAAGAGGCTGTAAA

TGACGATCTCTGCGTTTAACCGCAAAAAACTGACGCTTCACCCTGGTCTG

TTCGTAGCACTGAGCGCCATATTTTCATTAGGCTCTACGGCCTATGCCAA

CGACACTCCCGCTTCAGGCTACCAGGTTGAGAAAGTGGTAATACTCAGCC

GCCACGGGGTGCGAGCACCAACCAAAATGACACAGACCATGCGCGACGTA

ACACCTAATACCTGGCCCGAATGGCCAGTAAAATTGGGTTATATCACGCC

ACGCGGTGAGCATCTGATTAGCCTGATGGGCGGGTTTTATCGCCAGAAGT

TTCAACAACAGGGCATTTTATCGCAGGGCAGTTGCCCCACACCAAACTCA

ATTTATGTCTGGGCAGACGTTGATCAGCGCACGCTTAAAACTGGCGAAGC

TTTCCTGGCAGGGCTTGCTCCGGAATGTCATTTAACTATTCACCACCAGC

AGGACATCAAAAAAGCCGATCCGCTGTTCCATCCGGTGAAAGCGGGCACC

TGTTCAATGGATAAAACTCAGGTCCAACAGGCCGTTGAAAAAGAAGCTCA

AACCCCCATTGATAATCTGAATCAGCACTATATTCCCTTTCTGGCCTTGA

TGAATACGACCCTCAACTTTTCGACGTCGGCCTGGTGTCAGAAACACAGC

GCGGATAAAAGCTGTGATTTAGGGCTATCCATGCCGAGCAAGCTGTCGAT

AAAAGATAATGGCAACAAAGTCGCTCTCGACGGGGCCATTGGCCTTTCGT

CTACGCTTGCTGAAATTTTCCTGCTGGAATATGCGCAAGGGATGCCGCAA

GCGGCGTGGGGGAATATTCATTCAGAGCAAGAGTGGGCGTCGCTACTGAA

ACTGCATAACGTCCAGTTTGATTTGATGGCACGCACGCCTTATATCGCCA

GACATAACGGCACGCCTTTATTGCAGGCCATCAGCAACGCGCTGAACCCG

AATGCCACCGAAAGCAAACTGCCTGATATCTCACCTGACAATAAGATCCT GTTTATTGCCGGACACGATACCAATATTGCCAATATCGCAGGCATGCTCA ACATGCGCTGGACGCTACCTGGGCAACCCGATAACACCCCTCCGGGCGGC GCTTTAGTCTTTGAGCGTTTGGCCGATAAGTCAGGGAAACAATATGTTAG CGTGAGCATGGTGTATCAGACTCTCGAGCAGTTGCGCTCCCAAACACCAC TTAGCCTTAATCAACCTGCGGGAAGCGTACAGCTAAAAATTCCTGGCTGT AACGATCAGACGGCTGAAGGATACTGCCCGCTGTCGACGTTCACTCGCGT GGTTAGCCAAAGCGTGGAACCAGGCTGCCAGCTACAGTAAATATCAGACA AAAAAAATGCCGCTCGCGATTAAGCGAACGGCATTACTTCCTAGCTTCCC AGCTCGGATTAGCATGGCGAGAGCCGAAAAACTT (SEQ ID NO: 5)

It should be noted that the polynucleotide sequences presented in WO 2006/043178 (SEQ ID NO: 1 and SEQ ID NO: 2) will be useful for obtaining identical or homologous polynucleotide fragments from other strains that encode enzymes with phytase activity. The po5 linucleotide sequence (SEQ ID NO: 5) that makes up the Buttiauxella P1-29 phytase gene (BP-WT) is illustrated below in table 1. The polynucleotide sequence (SEQ ID NO: 14) that makes up the BP-17 variant phytase gene is shown in table 2 below.

Table 2: BP-17 polynucleotide sequence AACGACACCCCCGCCAGCGGCTACCAGGTCGAGAAGGTCGTCATCCTCAGCCGCCA CGGCGTCCGCGCCCCTACCAAGATGACCCAGACCATGCGCGACGTCACCCCCAACA CCTGGCCCGAGTGGCCCGTCAAGCTCGGCTACATCACCCCTCGCGGCGAGCACCTC ATCAGCCTCATGGGCGGCTTCTACCGCCAGAAGTTCCAGCAGCAGGGCATCCTCAG CCAGGGCTCGTGCCCCACCCCCAACAGCATCTACGTCTGGACTGACGTCGCCCAGC GCACCCTCAAGACCGGCGAGGCCTTCCTCGCCGGCCTCGCCCCCCAGTGCGGCCTC ACCATCCACCACCAGCAGAACCTCGAGAAGGCCGACCCCCTCTTCCACCCCGTCAA GGCCGGCATCTGCAGCATGGACAAGACCCAGGTCCAGCAGGCCGTCGAGAAGGAGG CCCAGACCCCCATCGACAACCTCAACCAGCACTACATCCCCAGCCTCGCCCTCATG AACACCACCCTCAACTTCAGCAAGAGCCCCTGGTGCCAGAAGCACAGCGCCGACAA GAGCTGCGACCTCGGCCTCAGCATGCCCAGCAAGCTCGCCACA

ACGAGGTCTCCCTCGACGGCGCTATCGGCCTCAGCTCCACCCTCGCCGAGATCTTC

CTCCTCGAGTACGCCCAGGGCATGCCTCAGGCCGCCTGGGGCAACATCCACAGCGA

GCAGGAGTGGGCCCTCCTCCTCAAGCTCCACAACGTCTACTTCGACCTCATGGAGC

GCACCCCCTACATCGCCCGCCACAAGGGCACCCCCCTCCTCCAGGCCATCAGCAAC

GCCCTCAACCCCAACGCCACCGAGAGCAAGCTCCCCGACATCAGCCCCGACAACAA

GATCCTCTTCATCGCCGGCCACGACACCAACATCGCCAACATCGCCGGCATGCTCA

ACATGCGCTGGACCCTCCCCGGCCAGCCCGACAACACCCCCCCTGGCGGCGCTCTC

GTCTTTGAGCGCCTCGCCGACAAGTCCGGCAAGCAGTACGTCAGCGTCAGCATGGT

CTACCAGACCCTCGAGCAGCTCCGCAGCCAGACCCCCCTCAGCCTCAACCAGCCTG

CCGGCAGCGTCCAGCTCAAGATCCCCGGCTGCAACGACCAGACCGCCGAGGGCTAC

TGCCCCCTCAGCACCTTCACCCGCGTCGTCAGCCAGAGCGTCGAGCCCGGCTGCCA GCTCCAGTAA (SEQ ID NO: 14)

Properties:

In some embodiments, a variant phytase according to the invention will have altered properties. Preferably, a variant according to the invention will have improved properties. In some modalities, the altered, for example, improved properties will be substrate specificity, catalytic activity, thermal stability, pH activity profile, specific activity and / or the ability to release phytate phosphate groups.

In some embodiments, a variant encompassed by the invention will have increased thermal stability compared to a phytase of origin (for example, BP-WT or BP-11). In some embodiments, the variant will have a difference in thermal stability (TD) of at least 1.5, at least 2.0, at least 2.5, at least 3.0, at least 5.0, at least 8, 0, at least 10.0, at least 15.0, at least 18.0 and at least 20.0 compared to BP-WT or BP-11.

In some embodiments, a variant encompassed by the invention (for example, BP-17) will have an increase in thermostability of at least 3 ° C, at least 5 ° C, at least 10 ° C, at least 12 ° C, at least 15 ° C and at least 20 ° C at a pH of 4.5, 5.0, 5.5 or 6.0. More specifically, a variant of the invention (for example, BP-17) will be thermostable at about 65 ° C, about 70 ° C, about 75 ° C, about 80 ° C or more. In some embodiments, a phytase according to the invention is considered thermostable if the enzyme retains more than 50% of its activity after exposure to a specified temperature for 10 minutes at pH 5.5.

In some embodiments, a variant will have a higher proteolytic stability (residual activity). Proteolytic stability can be determined by the methods presented in WO 2006/043178, and specific reference is made to its example 12. In some embodiments, the variant encompassed by the invention will have a residual activity of at least 45%, at least 50%, at least at least 55%, at least 60%, at least 65%, at least 70% and at least 85%.

In some embodiments, the phytase variant will have a specific activity greater than 100%, greater than 105%, greater than 110% and also greater than 120% of an original phytase or its thermostable variant (for example, BP-WT, SEQ ID NO: or BP-11) at pH 4.0, pH 4.5 and pH 5.0. In some embodiments, the variant will have at least 5%, at least 10%, at least 15%, at least 20% and at least 25% more specific activity compared to BP-11 phytase or BP-WT (SEQ ID NO: 2). In some embodiments, a variant encompassed by the invention will retain essentially the same level of thermostability as BP-WT or BP-11, but will have an increase in specific activity under essentially the same conditions (for example, pH).

In some embodiments, the variant phytase according to the invention will have a specific activity of at least 100 U / mg, at least 200 U / mg, at least 300 U / mg, at least 350 U / mg, at least 400 U / mg, at least 450 U / mg, at least 500 U / mg, at least 600 U / mg, at least 700 U / mg, at least 800 U / mg, at least 900 U / mg, at least 1,000 U / mg and at least 1,200 U / mg, where specific activity is determined by incubating the phytase in a solution containing 2 mM phytase, CaCI₂ at 0.8 mM in 200 mM sodium acetate buffer at pH 3.5, as detailed in example 1 of WO 2006/043178. In some embodiments, the specific activity is determined at an optimum pH of 4.0.

In some embodiments, a variant phytase encompassed by the invention will have a specific activity ratio, when compared to the phytase encoded by SEQ ID NO: 5, of at least 110, at least 120 and at least 130.

In some embodiments, the maximum activity pH will be at least 0.1, at least 0.15, at least 0.2, at least 0.25, at least 0.3, at least 0.5, at least 0, 6, at least 0.7, at least 0.8 and at least 1.0 pH unit lower than that of Buttiauxella sp. corresponding (for example, SEQ ID NO: 1 or SEQ ID NO: 2), or at least 0.1, at least 0.15, at least 0.2, at least 0.25, at least 0.3, at least at least 0.5, at least 0.6, at least 0.7, at least 0.8 and at least 1.0 pH unit lower than that of BP-11 phytase. In some embodiments, a variant encompassed by the invention will have activity in the range of pH 2.0 to 6.0 and, in some embodiments, a maximum activity around pH 4.0 to pH 5.5 and also around pH 4 , 0 to pH 4.5.

In some embodiments, the variant encompassed by the invention can be used in a method of producing a phosphate compound, comprising treating a phytate with a variant phytase encompassed by the invention (for example, BP-17). The phytate can be myoinositol, di-, tri-, tetra- and / or pentaphosphates. Other suitable organic phosphates include inositol tetraphosphates and inositol oligophosphates.

Phytase production in host cells:

In some embodiments, the invention features a method of producing an enzyme with phytase activity, comprising: (a) providing a host cell transformed with an expression vector comprising a polynucleotide encoding a variant phytase enzyme according to the invention, said variant comprising at least one modification of at least one amino acid residue as described herein; (b) culturing the transformed host cell under conditions suitable for the host cell to produce phytase; and (c) recovering phytase.

In some embodiments, the expression vector will comprise a polynucleotide encoding a phytase comprising an amino acid sequence with a substitution in the amino acid residues corresponding to positions A122, D125, T167, F197, T209, A211, K240, A242, S281, Q289, A294 and N303 of SEQ ID NO: 1, and in other embodiments, the replacement corresponds to A122T, D125A, T167I, F197S, T209K, A211P, K240E, A242S, S281L, Q289Y, A294E and N303K of SEQ ID NO: 1. In some embodiments, the expression vector comprises a polynucleotide encoding a variant phytase comprising a substitution corresponding to positions R24, R28, T31, K32, D98, R100, K137, N212, G221, T225, E228, E249, H259, F263, M266, N276, H312, D313, T314 and / or D334 of SEQ ID NO: 4. In other embodiments, the vector includes a polynucleotide encoding a phytase comprising SEQ ID NO: 3.

In some embodiments of the invention, the host strain is genetically engineered to express heterologous phytases or variants with phytase activity according to the present invention.

Host cells

Host cells usable for the production of a phytase encompassed by the invention include bacterial cells, fungal cells and plant cells. Host cells include both cells, and the progeny of cells and protoplasts created from cells that can be used to produce a variant phytase according to the invention.

In some embodiments, the host cells are fungal cells and, preferably, filamentous fungal host cells. The term filamentous fungi refers to all filamentous forms in the Eumycotina subdivision (see, Alexopoulos, CJ (1962), INTRODUCTORY MYCOLOGY, Wiley, New York). These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, cellulose and other complex polysaccharides. The filamentous fungi of the present invention are morphological, physiological and genetically distinct from yeasts. The cells of filamentous fungal origin can be a cell including, but not limited to, Trichoderma sp. (for example, Tríchoderma reesei, the asexual form of Hypocrea jecorina, formerly classified as T. longibrachiatum, Trichoderma viride, Trichoderma koningii, Trichoderma harzianum); Pnicillium sp., Humicola sp. (for example, H. insolens, H. lanuginosa and H. gray); Chrysosporium sp. (for example, C. Iucknowense), Gliocladium sp., Aspergillus sp. (for example, A. oryzae, A. niger, A. soye, A. japonicus, A. nidulans and A. awamori), Fusarium sp. (for example, F. roseum, F. graminum, F. cerealis, F. oxysporium and F. venenatum), Neurospora sp. (N. crassa), Hypocrea sp., Mucor sp. (M. miehei), Rhizopus sp. and Emericella sp. (see also Innis et al., (1985) Sci. 228: 21-26). Aspergillus strains usable for expressing the phytases (and / or alpha amylases) of the invention are presented, for example, in Ward et al. (1993) Appl. Microbiol. Biotechnol. 39: 738-743 and Goedegebuur et al., (2002) Curr. Gene 41: 89-98. In some embodiments, the host is a strain of Trichoderma and, particularly, a strain of T. reesei. T. strains reesei are known and non-limiting examples include, for example, ATCC No. 13631, ATCC No. 26921, ATCC No. 56764, ATCC No. 56765, ATCC No. 56767 and NRRL 15709. In some embodiments, the host strain is a derived from RL-P37. RL-P37 is presented in Sheir-Neiss et al. (1984) Appl. Microbiol. Biotechnology 20: 46-53.

In some embodiments, the host cells are gram-positive bacterial cells. Non-limiting examples include strains of Streptomyces (for example, S. lividans, S. coelicolor and S. griseus) and Bacillus. As used herein, the genus Bacillus includes all species within the genus Bacillus, as is known to those skilled in the art, including, but not limited to, B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. clausii, B. halodurans, B. megaterium, B. coagulans, B. circulans, B. lautus and B. thuringiensis.

In some embodiments, the host cell is a gram-negative bacterial strain, such as E. coli or Pseudomonas sp.

In other embodiments, the host cells can be yeast cells, such as Saccharomyces, Schizosaccharomyces sp., Pichia sp.

or Candida sp.

In some embodiments, the host strain may have been previously manipulated by genetic engineering. In some embodiments, several genes native to the fungal host cell will have been inactivated. These genes include, for example, genes encoding cellulolytic enzymes, such as endoglucanases (EG) and exocelobiohydrolases (CBH) (for example, cbh1, cbh2, egl1, egl2 and egl3). For example, U.S. Patent No. 5,650,322 has strains derived from RL-P37 with deletions in the cbh1 gene and the cbh2 gene (see, for example, U.S. Patent No. 5,847,276 and WO 05/001036 ).

In other embodiments, the host cell may be a plant cell, and the invention is applicable to both dicotyledonous plants (e.g., tomato, potato, soy, cotton and tobacco), and to monocotyledonous plants, including, but not limited to, monocotyledonous grasses, such as wheat (Triticum spp.), rice (Oryza spp.), barley (Hordeum spp.), oats (Avena spp.), rye (Secale spp.), corn (Zea mays), sorghum (Sorghum spp.) and millet (Pennisetum spp.).

Vector

Usable vectors including DNA constructs that comprise a polynucleotide encoding a phytase of the invention and methods of transforming host cells are well known in the art, and standard techniques and methodology can be used.

According to the invention, a DNA construct comprising nucleic acid encoding a variant phytase encompassed by the invention is constructed to transfer and / or express the variant in a host cell. In one embodiment, the DNA construct is transferred to a host cell by an expression vector that comprises regulatory sequences (for example, promoters, ribosome binding sites, translation start and stop sequences, start and stop sequences translation, enhancers, activator sequences, cell specific expression sequences, signal sequences and / or terminators) operationally linked to the variant phytase coding sequence.

An expression vector comprising a DNA construct with a polynucleotide that encodes a variant phytase can be any vector that is capable of autonomous replication in a given fungal host organism or of integration into the host's DNA. In some embodiments, the expression vector is a plasmid or bacteriophage. In some embodiments, the expression vector is pre-assembled and contains sequences required for high-level transcription and a selectable marker. In some embodiments, the coding region of the variant phytase gene or part of it is inserted into this general purpose expression vector, so that it is under the transcriptional control of the promoter and terminator sequences of the expression construct. In some embodiments, genes or parts of them are inserted downstream of the strong cbh1 promoter.

Briefly, with regard to the production of phytase in fungal host cells, reference is made to Sambrook et al., (1989) supra, Ausubel (1987) supra, van den Hondel et al. (1991) in Bennett and Lasure (Eds.) MORE GENE MANIPULATIONS IN FUNGI, Academic Press (1991) pp. 70 - 76 and 396 - 428; Nunberg et al., (1984) Mol. Cell Biol. 4: 2306-2315; Boel et al., (1984) EMBO J. 3: 1581-1585; Finkelstein in BIOTECHNOLOGY OF FILAMENTOUS FUNGI, Finkelstein et al. Eds., Butterworth-Heinemann, Boston, MA (1992), Chap. 6; Kinghorn et al. (1992) APPLIED MOLECULAR GENETICS OF FILAMENTOUS FUNGI, Blackie Academic and Professional, Chapman and Hall, London; Kelley et al., (1985) EMBO J. 4: 475-479; Penttila et al., (1987) Gene 61: 155-164; and U.S. Patent No. 5,874,276. A list of suitable vectors can be found in the Strains Catalog of the Fungal Genetic Stock Center (FGSC, www at fgsc.net). Suitable vectors include those obtained, for example, from Invitrogen Life Technologies and Promega. Specific vectors suitable for use in fungal host cells include vectors such as pFB6, pBR322, pUC18, pUC100, pDON®201, pDONR®221, pENTR®, pGEM®3Z and pGEM®4Z.

In some embodiments, the vector can be any vector that, when introduced into a fungal host cell, is integrated into the cell's genome and replicated. Some non-limiting examples of these vectors are presented in the Strains Catalog of the Fungal Genetic Stock Center (FGSC, &lt;www.fgsc.net&gt;). Additional examples of suitable expression and / or integration vectors are presented in Sambrook et al., (1989) supra, Ausubel (1987) supra, van den Hondel et al. (1991) in Bennett and Lasure (Eds.) MORE GENE MANIPULATIONS IN FUNGI, Academic Press (1991) pp. 70 - 76 and 396 - 428, and in U.S. Patent No. 5,874,276. Particularly useful vectors include pTREX, pFB6, pBR322, pUC18, pUC100 and pENTR / D. Plasmids suitable for use in bacterial cells include pBR322 and pUC19, which allow replication in E. coli, and pE194, for example, which allow replication in Bacillus.

In some embodiments, nucleic acids encoding the variant phytase encompassed by the invention are operably linked to a suitable promoter, which shows transcriptional activity in the host cell. In general, expression of the variant phytase is performed under any suitable promoter known or discovered in the art. In some embodiments, the variant phytase is expressed under a host's native promoter. In some embodiments, the phytase variant is expressed under a heterologous promoter that is active in the host cell. For example, if a Trichoderma cell is used as the host cell, the promoter is preferably active in a Trichoderma host cell.

In some embodiments, the promoter is a constitutive or inducible promoter. A constitutive promoter is a promoter that is active under most environmental and developmental conditions. An inducible or repressible promoter is a promoter that is active under environmental or development regulation. In some modalities, promoters are inducible or repressible due to changes in environmental factors, including, but not limited to, availability of carbon, nitrogen or other nutrient, temperature, pH, omolarity, presence of heavy metal (s), concentration of inhibitor (s), stress or a combination of the precedents, as is known in the art. In some embodiments, inducible or repressible promoters are inducible or repressible by metabolic factors, such as the level of certain carbon sources, the level of certain energy sources, the level of certain catabolites, or a combination of the precedents, as is known in the technical. In one embodiment, the promoter is one that is native to the host cell. For example, when T. reesei is the host, the promoter is a native T. promoter. reesei, as the cbh1 promoter, who is deposited with GenBank under Accession Number D86235.

Suitable non-limiting examples of promoters include cbh1, cbh2, egl1, egl2, egl3, egl4, egl5, xyn1 and xyn2, the suppressible P. chrysogenus acid phosphatase (phoA) gene promoter (see, for example, Graessle et al. , (1997) Appl. Environ. Microbiol., 63: 753-756), glucose-repressible PCK1 promoter (see, for example, Leuker et al., (1997), Gene, 192: 235-240), inducible MET3 promoter for maltose, repressible for glucose (see Liu et al, (2006), Eukary. Cell, 5: 638-649), pKi promoter and cpc1 promoter. Other examples of usable promoters include promoters of A. awamori and A. niger glucoamylase genes (see, for example, Nunberg et al, (1984) Mol. Cell Biol. 4: 2306-2315, and Boel et al, (1984 ) EMBO J. 3: 1581-1585). Likewise, promoters of the T. reesei xln1 gene can be used (see, for example, EPA 137280A1).

In some embodiments, the promoter is a temperature sensitive promoter. Preferably, the activity of the temperature sensitive promoter is suppressed by elevated temperature. In some embodiments, the promoter is a promoter suppressed by catabolite or a promoter suppressed by changes in osmolarity. In some modalities, the promoter is inducible or repressible by the levels of polysaccharides, disaccharides or monosaccharides present in the culture medium.

In some embodiments, the variant phytase coding sequence is operationally linked to a signal sequence. The signal sequence is not critical to the invention, but it can be any signal sequence that is active as a signal sequence in the host cell. The DNA encoding the signal sequence may be that which is naturally associated with the host cell, promoter or phytase. In some embodiments, the signal sequence is naturally associated with the variant phytase gene to be expressed. In additional embodiments, a signal sequence and a promoter sequence that make up a DNA construct or vector to be introduced into a fungal host cell are derived from the same source. For example, in some embodiments, the signal sequence is the signal sequence cbh1 that is operably linked to a cbh1 promoter.

In some embodiments, the expression vector also includes a transcription termination sequence downstream of the structural gene, to provide efficient termination. In some embodiments, the termination sequence and the promoter sequence are derived from the same source. In other embodiments, the termination sequence is homologous to the host cell. A particularly suitable termination sequence is cbh1, derived from a strain of Trichoderma and, particularly, from T. reesei. Other usable fungal terminators include the A. niger or A. awamori glucoamylase gene terminator (see, for example, Nunberg et al. (1984) supra, and Boel etal., (1984) supra).

In some embodiments, the expression vector includes a selectable marker. Examples of preferred selectable markers include those that confer antimicrobial resistance (for example, hygromycin and phleomycin). Selective nutritional markers also find use in the present invention, including those markers known in the art as amdS, argB and pyr4. Markers usable in vector systems for Trichoderma transformation are known in the art (see, for example, Finkelstein, chapter 6 in BIOTECHNOLOGY OF FILAMENTOUS FUNGI, Finkelstein et al. Eds. Butterworth-Heinemann, Boston, MA (1992), Chap. 6 and Kinghorn etal. (1992) APPLIED MOLECULAR GENETICS OF FILAMENTOUS FUNGI, Blackie Academic and Professional, Chapman and Hall, London). In some modalities, the selective marker is the amdS gene, which encodes the enzyme acetamidase, allowing transformed cells to grow with acetamide as a nitrogen source. The use of the amdS gene of A. nidulans as a selective marker is described, for example, in Kelley et al., (1985) EMBO J. 4: 475-479, and Penttila etal., (1987) Gene 61: 155- 164.

Methods used to link the DNA construct comprising a polynucleotide that encodes a phytase variant, a promoter, a terminator and other sequences and for inserting them into a suitable vector are well known in the art. The bonding is generally carried out by bonding at convenient restriction sites. If these sites do not exist, synthetic oligonucleotide links are used according to conventional practice (see, for example, Sambrook (1989) supra, and Bennett and Lasure, MORE GENE MANIPULATIONS IN FUNGI, Academic Press (1991) pp. 70 - 76 ). In addition, vectors can be constructed using known recombination techniques (for example, Invitrogen Life Technologies, Gateway Tecnology). Transformation, expression and culture of host cells

The introduction of a DNA construct or vector into a host cell includes techniques such as transformation, electroporation, nuclear microinjection, transduction, transfection (for example, lipofection-mediated and DEAE-Dextrin-mediated transfection), incubation with DNA phosphate precipitate. calcium, high-speed bombardment with DNA-coated microprojectiles and protoplast fusion.

Transformation methods for Aspergillus and Trichoderma are described, for example, in Yelton et al. (1984) Proc. Natl. Acad. Know. USA 81: 1470-1474; Berka et al., (1991) in Applications of Enzyme Biotechnology, Eds. Kelly and Baldwin, Plenum Press (NY); Cao et al., (2000) Sci. 9: 9911001; Campbell et al., (1989) Curr. Genet. 16: 53-56; Pentilla et al., (1987) Gene 61: 155-164); de Groot et al., (1998) Nat. Biotechnol. 16: 839-842; US patents No. 6,022,725 and 6,268,328 and European patent 238,023. The expression of heterologous protein in Trichoderma is described in U.S. Patent Nos. 6,022,725 and 6,268,328; Harkki et al. (1991); Enzyme Microb. Technol. 13: 227-233; Harkki et al., (1989) Bio Technol. 7: 596-603; European patents 244,234 and 215,594; and Nevalainen et al., The Molecular Biology of Trichoderma and its Application to the Expression of Both Homologous and Heterologous Genes, in MOLECULAR INDUSTRIAL MYCOLOGY, Eds. Leong and Berka, Marcei Dekker Inc., NY (1992) pp. 129-148). Reference is also made to WO 96/00787 and Bajar et al., (1991) Proc. Natl. Acad. Know. USA 88: 8202-28212 for the transformation of Fusarium strains.

Methods for preparing DNA constructs usable in plant transformation and methods for plant transformation are also known. Some of these methods include gene transfer mediated by Agrobacteríum tumefaciens, bombardment with microprojectiles, transformation of protoplasts mediated by PEG, electroporation and the like. Reference is made, for example, to US patents No. 5,780,708, 6,803,499 and 6,777,589, Fromm et al. (1990) Biotechnol. 8: 833839, Potrykus et al. (1985) Mol. Gen. Genet. 199: 169-177, Brisson et al., (1984) Nature 310: 511-514, Takamatsu et al., (1987) EMBO J. 6: 307-311, Coruzzi et al., (1984) EMBO J. 3 : 1671-1680, Broglie et al (1984) Science 224: 838-843, Winter J and Sinibaldi RM (1991) Results Probl Cell Differ 17: 85-105, Hobbs S or Murry LE (1992) in McGraw Hill Yearbook of Science and Technology, McGraw Hill, New York, NY, pp. 191-196, and Weissbach and Weissbach (1988) Methods for Plant Molecular Biology, Academic Press, New York, NY, pp. 421-463. Transformed cells can be cultured using standard techniques, under suitable conditions, in small-scale or large-scale fermentations by shaking bottle cultivation (including continuous, batch and batch fermentations with feed), in laboratory or industrial fermenters, with suitable medium containing physiological salts and nutrients (see, for example, Pourquie, J. et al., BIOCHEMISTRY AND GENETICS OF CELLULOSE DEGRADATION, eds. Aubert, JP et al., Academic Press, pp. 71-86, 1988, and llmen, M. et al., (1997) Appl. Environ. Microbiol. 63: 1298-1306). Common commercially prepared media (for example, Yeast Malt Extract (YM) broth, Luria Bertani broth (LB) and Sabouraud Dextrose broth (SD)) find use in the present invention. Preferred culture conditions for filamentous fungal cells are known in the art and can be found in the scientific literature and / or in the source of the fungi, such as the American Type Culture Collection (ATCC) and Fungal Genetic Stock Center.

In some embodiments, genetically stable transformants are constructed with vector systems in which the nucleic acid encoding a phytase variant is stably integrated into a host cell chromosome. The transformants are then purified by known techniques.

In a non-limiting example, stable transformants including an amdS marker are distinguished from unstable transformants by their faster growth rate and by the formation of circular colonies with a smooth, rather than serrated, outline in solid culture medium containing acetamide. In addition, in some cases, an additional stability test is conducted by culturing the transformants in a solid non-selective medium (ie, medium devoid of acetamide), collecting spores from that culture medium and determining the percentage of those spores that subsequently germinate and grow in a selective medium containing acetamide. Alternatively, other methods known in the art can be used to select transformants.

In a specific embodiment, the preparation of Trichoderma sp. for transformation involves the preparation of protoplasts from fungal mycelia (see Campbell et al., (1989) Curr. Genet. 16: 53-56). In some embodiments, mycelia are obtained from germinated vegetative spores. Mycelia are treated with an enzyme that digests the cell wall, resulting in protoplasts. The protoplasts are then protected by the presence of an osmotic stabilizer in the suspension medium. Such stabilizers include sorbitol, mannitol, potassium chloride, magnesium sulfate and the like. Typically, the concentration of these stabilizers varies between 0.8 M and 1.2 M. It is preferable to use a sorbitol solution at about 1.2 M in the suspension medium.

After fungal growth has been established, the transformed cells are exposed to conditions effective to cause or allow the expression of phytase variants as defined herein. In cases where the phytase variant coding sequence is under the control of an inducible promoter, the inducing agent (for example, a sugar, metal salt or antimicrobial) is added to the medium at an effective concentration to induce expression.

Assays for phytase expression / activity

To evaluate the expression of phytase variants with phytase activity by a cell line that has been transformed with a heterologous polynucleotide that encodes a phytase variant with phytase activity encompassed by the invention, assays at the protein level can be performed at the RNA level or with the use of particular functional bioassays for phytase activity and / or production. In general, the assays employed include Northern blotting, dot blotting (DNA or RNA analysis), RTPCR (polymerase chain reaction with reverse transcriptase) or in situ hybridization using an appropriately labeled probe (based on the nucleic acid coding sequence) and conventional Southern blotting and autoradiography.

In addition, the production and / or expression of a phytase variant with phytase activity can be measured in a sample directly, for example, by assays that directly measure phytase activity (FTU) by releasing inorganic phosphate. The inorganic phosphate forms a yellow complex with an acid molybdate / vanadate reagent, and the yellow complex was measured at a wavelength of 415 nm on a spectrophotometer, and the inorganic phosphate release was quantified with a standard phosphate curve. A unit of phytase (FTU) is the amount of enzyme that releases 1 micromol of inorganic phytate phosphate per minute under the reaction conditions given in the European Standard (CEN / TC 327.2005-TC327WI 003270XX).

In addition, gene expression can be assessed by immunological methods, such as immunohistochemical colomeration of cells, tissue sections or immunoassay of tissue culture medium, for example, by Western blot or ELISA. These immunoassays can be used to qualitatively and quantitatively evaluate the expression of a phytase. The details of these methods are known to those skilled in the art, and many reagents for the practice of these methods are commercially available.

Assays for phytase activity are well known in the art, and one example is a classic inorganic phosphate release assay developed by Fiske and SubbaRow, Journal of Biological Chemistry 66: 37536

392 (1925). A variation of this method is found in Mitchell et al., Microbiol. 143: 245-252 (1997). An alternative method is described in FOOD CHEMICALS CODEX, 4^The Edition, Food Chemicals Code Committee, Institute of Medicine, National Academy Press, Washington, DC, 1996, pages 809-810. Each of these references is incorporated here. In many of these assays, a colorimetry is then performed using a spectrophotometer, with comparison to controls of known concentration of inorganic phosphate (Pj) and / or controls produced by reactions with enzymes with known phytase activity. A Unit of activity is determined as the amount of enzyme sample required to release 1 pmol of Pj per minute of phytate, under defined reaction conditions. Reference is also made to US patents No. 6,221,644 and 6,139,902.

In some embodiments of the invention, the phytase variants with phytase activity expressed by a host Trichoderma or Aspergillus will be more than 1 gram of protein per liter (g / L), more than 2 g / L, more than 5 g / L , more than 10 g / L, more than 20 g / L, more than 25 g / L, more than 30 g / L, more than 50 and also more than 100 g / L of culture medium.

Protein recovery

Polypeptides produced by expression of the nucleic acid sequences of this invention can be recovered or isolated from fermentation of cell cultures and substantially purified in several ways, according to techniques well established in the art. Those skilled in the art are able to select the most appropriate isolation and purification techniques. The phytase of the invention can be recovered from the culture medium or from host cell lysates. If attached to the membrane, it can be released from the membrane using a suitable detergent solution (for example, Triton-X 100) or by enzymatic divination. The cells used in phytase expression can be disrupted by various physical or chemical means, such as freeze-thaw cycles, sonication, mechanical disruption or cell lysis agents. It may be desirable to purify the phytase from recombinant cell proteins or polypeptides. The following procedures are examples of suitable purification procedures: by fractionation in an ion exchange column; ethanol precipitation; Reverse phase HPLC; chromatography on silica or on a cation exchange resin, such as DEAE; chromatofocalization; SDS-PAGE; precipitation with ammonium sulfate; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants; and metal chelation columns to bind to shapes marked on the phytase epitope. Various methods of protein purification can be employed, and these methods are known in the art and described, for example, in Deutscher, METHODS IN ENZYMOLOGY, 182 (1990); Scopes, PROTEIN PURIFICATION: PRINCIPLES AND PRACTICE, Springer-Verlag, New York (1982). The purification step (s) selected will depend, for example, on the nature of the production process used and the particular shape of the phytase produced.

In general, a phytase variant (including nButtiauxella phytase or r-Buttiauxella phytase) produced in cell culture is secreted into the medium and can be purified or isolated, for example, by removing undesirable components from the cell culture medium. In some cases, the phytase variant can be produced in a cellular form that requires recovery of a cell lysate. In these cases, the enzyme is purified from the cells in which it was produced using techniques routinely employed by those skilled in the art. Examples include, but are not limited to, affinity chromatography (see, for example, Tilbeurgh et al., (1984) FEBS Lett. 16: 215); chromatographic ion exchange methods (see, for example, Goyal et al., (1991) Biores. Technol. 36: 37; Fliess et al., (1983) Eur. J. Appl. Microbiol. Biotechnol. 17: 314; Bhikhabhai et al. (1984) J. Appl. Biochem. 6: 336; and Ellouz et al., (1987) Chromatography 396: 307), including ion exchange using materials with high resolving power (see, for example, Medve et al., (1998) J. Chromatography A 808: 153); hydrophobic interaction chromatography (see, for example, Tomaz and Queiroz, (1999) J. Chromatography A 865: 123); two-phase partition (see, for example, Brumbauer et al., (1999) Bioseparation 7: 287); ethanol precipitation; H38

Reverse phase PLC; chromatography on silica or an ion exchange resin such as DEAE; chromatofocalization; SDS-PAGE; precipitation with ammonium sulfate; and / or gel filtration using, for example, Sephadex G-75. Fermentations

In some embodiments of the present invention, fungal cells that express heterologous phytase variants are cultured under batch or continuous fermentation conditions. A classic batch fermentation is a closed system, in which the composition of the medium is established at the beginning of the fermentation and is not subjected to artificial changes during fermentation. Thus, at the beginning of fermentation, the medium is inoculated with the desired organism (s). In this method, fermentation is allowed to occur without adding any components to the system. Typically, a batch fermentation qualifies as a batch with respect to the addition of the carbon source, and attempts are often made to control factors such as pH and oxygen concentration. The metabolite and biomass compositions of the batch system change constantly until fermentation stops. In batch cultures, cells progress from a phase of static retardation to a phase of high iogarhythmic growth and, finally, to a stationary phase, in which the growth rate is slowed or stopped. If left untreated, cells in the stationary phase finally die. In general, cells in the logarithmic phase are responsible for most of the production of the final product.

A variation of the standard batch system is the fed batch fermentation system, which also finds use in the present invention. In this variation of a typical batch system, the substrate is added in increments as the fermentation progresses. Feed batch systems are useful when repression of catabolites is able to inhibit cell metabolism and when it is desirable to have limited amounts of substrate in the medium. The measurement of the actual substrate concentration in fed batch systems is difficult and, therefore, is estimated based on changes in measurable factors, such as pH, dissolved oxygen and partial pressure of exhaust gases, such as CO2. Batch and batch batch fermentations are common and well known in the art.

Continuous fermentation is an open system to which a defined fermentation medium is added continuously to a bioreactor, and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density, where the cells are mainly in the logarithmic phase growth.

Continuous fermentation allows the modulation of a factor or any number of factors that affect cell growth and / or the concentration of the final product. For example, in one embodiment, a limiting nutrient, such as the carbon source or nitrogen source, is maintained at a fixed rate, and all other parameters are left to moderate. In other systems, numerous factors that affect growth can be changed continuously, while the cell concentration, measured by the turbidity of the medium, is kept constant. Continuous systems seek to maintain growing conditions in a constant state. Thus, the loss of cells due to removal of the medium has to be balanced against the rate of cell growth in fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes, as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology.

Applications and methods of use

In an embodiment of the invention, an enzyme composition comprising at least one phytase according to the invention is provided. Compositions according to the invention can be prepared according to methods known in the art and can be in the form of a liquid or dry composition.

Liquid compositions need not contain anything other than the phytase enzyme, which can be a substantially purified or unpurified form, preferably in a substantially purified form. Normally, however, a stabilizer, such as glycerol, sorbitol or monopropylene glycol, is also added. The liquid composition can also comprise one or more other additives, such as salts, sugars, preservatives, pH adjusting agents (i.e. buffering agents), proteins or phytate (a phytase substrate). Typical liquid compositions are aqueous or oil based suspensions.

Dry compositions can be spray-dried compositions, in which case the composition need not contain anything other than the enzyme in a dry form. Usually, however, the dry compositions are called granules, which can be readily mixed with, for example, food or feed components or, more preferably, form a component of a premix. The droplet size of the enzyme granules is preferably compatible with that of the other components of the mixture.

In some embodiments, an enzyme composition including a variant phytase encompassed by the invention will optionally be used in combination with any one or combination of the following enzymes: glucoamylases, alpha amylases, proteases, pululanases, isoamylases, cellulases, hemicellulases, xylanases, cyclodextrin glyotransferases, lipases , phytases, laccases, oxidases, esterases, cutinases, other phytases and their combinations.

In some embodiments, the composition of phytase is a composition of food or animal feed. A food or feed composition may comprise phytase at a concentration of 10 to 15,000 U / kg of feed or food (for example, 100 to 5,000 U / kg, 200 - 2,000 U / kg and also 500 - 1,000 U / kg). The phytase composition can be used as an additive that is active in the digestive tract of farm animals, such as avez and swine, and aquatic farm animals, including fish and shrimp. The present invention considers a method for the production of a food or animal feed, characterized by the fact that the phytase according to the invention is mixed with said food or animal feed. Liquid compositions can be added to a food or feed after its optional pelletization.

In some embodiments, animal feed will comprise one or more of the following components: a) cereals, such as small grains (for example, wheat, barley, rye, oats and their combinations) and / or large grains, such as corn or sorghum; b) cereal products, such as corn gluten flour, Distillers Dry Grain Soluble (DDGS), wheat bran, inferior wheat, wheat shavings, rice bran, rice husks, oat husks, palm kernels and pulp of citrus fruits; c) protein obtained from sources such as soy, sunflower, peanuts, lupins, peas, broad beans, cotton,

I canola, fish meal, dry plasma protein, meat and bone meal, potato protein, whey, copra, sesame; d) oils and fats obtained from plant and animal sources; e) minerals and vitamins; f) supplements, such as enzymes, betaine, flavors, essential oils, antibiotic growth promoters, coccidiostats, prebiotics and prebiotics.

There is also a method for reducing phosphorus levels in animal manure, characterized by the fact that an animal is fed an animal feed according to the invention, in an effective amount to convert the phytate contained in said feed to animals.

In addition, the phytase compositions encompassed by the invention can be used in a starch hydrolysis method. The phytase composition can be added during a starch liquefaction step, a saccharification step and / or during a fermentation step. Alpha-amylases are used to degrade starch bonds 1-4 during industrial starch hydrolysis processes using reduced plant material, such as ground grains, as a raw material (e.g. beverage fermentation and bread making). Amylases are required to degrade starch, and obtaining adequate activity from these enzymes is sometimes problematic. Phytate has been known for some time to have an inhibitory effect on amylases. Consequently, enzyme compositions comprising a phytase according to the invention can be used in starch hydrolysis processes to reduce the inhibiting effect of phytate on alpha amylase (EP 0 813607B).

Phytases, phytate and lower phosphate phytate derivatives find many other uses in personal care products, medium products and food and nutritional products, as well as various industrial applications, particularly in cleaning, textile, lithographic and chemical techniques.

The following examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way. EXPERIMENTAL PART

Abbreviations

In the following exhibition and experimental section, the following abbreviations apply: ° C (degrees centigrade); rpm (revolutions per minute); H₂O (water); dH₂O (deionized water); IHL₂O (deionized water, filtration by Milli-Q); aa or AA (amino acid); bp (base pairs); kb (base kilopares); kD (kilodaltons); g (grams); pg (micrograms); mg (milligrams); pL (microliters); mL (milliliters); mm (millimeters); pm (micrometers); M (molar); mM (millimolar); pM (micromolar); U (units); V (volts); PM (molecular weight); s (seconds / seconds); min (minute / minutes); h (hour / hours); AMM solution (H₂ONLY₄ at 7.5 N, 15 mM ammonium molybdate and acetone (1: 1: 2)); ABS (absorbance); EtOH (ethanol); PPS (physiological saline); m / v (mass / volume); and MTP (microtiter plate).

The following tests and methods are used in the examples shown below:

The methods used to provide the variants are described below. However, it should be noted that different methods can be used to provide variants of a molecule of origin, and the invention is not limited to the methods used in the examples. It is intended that any suitable means for the preparation of variants and selection of variants can be used.

Buttiauxella sp. strain P1-29 was deposited with NCIMB under accession number 41248. The isolation of this strain from plant material and taxonomic identification are described in WO 2006/043178 (see Examples 1 to 4). In addition, the cloning of chromosomal DNA, amplification and expression of the phytase gene from Buttiauxella sp. strain P1-29 in E. coli are also described (see Examples 5 - 6). The phytase of Buttiauxella sp. strain

Ρ1-29 described in WO 2006/043178 is also referred to here as BP-WT, and reference is made to the present SEQ ID NO: 1 and SEQ ID NO: 2.

Phytase enzyme activity assay

These tests were performed on 2 buffer systems. For pH 4.0 to 5.5, sodium acetate buffers were used. These were prepared by titrating 250 mM sodium acetate with HCI to the indicated pH value. Buffers for pH 2.0 to 3.5 were prepared by titrating 250 mM glycine with HCI to the indicated pH value. The pH 4.0 assay was used as a standard. In addition to the buffer, the reaction mixture contained 6 mM phytate and 1.0 mM CaCb and 0.05 mg / mL BSA. Reactions were allowed to proceed for 1 h at 37 ° C. Phosphate release was measured using a molybdate assay, as shown in Heinonen et al. (Heinonen, J. K „Lahti, RJ, Anal. Biochem. 113 (2), 313-317, (1981)). Briefly, 200 µl of freshly prepared AMM solution was added to 100 µl of reaction mixture in each well of the microtiter plate. The absorbance at 390 nm was measured not before 10 min and not after 30 min after adding the AMM reagent. The amount of phosphate was determined by constructing a calibration curve with phosphate solution of known concentrations. The specific absorption values ​​(A280) of phytase variants were calculated based on the amino acid composition of the protein using the Vector NTI software (Invitrogen).

Specific Activity Essay

Phytase activity was determined in microticulation plates using a coupled enzyme assay: enzyme preparations were diluted in dilution buffer (50 mM sodium acetate, 0.05% Pluronic F-68, 1 mg / mL of BSA). To 5 pL of the enzyme solution, 75 pL of phytase assay mixture (500 mM glycine / HCI, pH 4.0, 10.67 mM phytate, 1 mM CaCI was added₂, 0.05% (w / v) of Pluronic F-68). The assay was incubated 1 h at 37 ° C. Then, 10 pL of the assay was mixed with 40 pL of the detection assay mixture (1 M Tris / HCI, pH 7.0, 0.01% (v / v) Triton X-100, 25 pM ADHP ( MoBiTec, Göttingen, Germany), 0.25 U / ml maltosphosphorylase, 0.3125 mM maltose, 1.5625 U / ml oxy44 glucose, 0.3125 U / ml horseradish peroxidase, 1 mM EDTA, 0.35 mg / ml BSA) and incubated 1 h at 37 ° C. The reaction was stopped by adding 30 μΙ_ of catalase at 2,700 U / mL in H₂O. The fluorescence at 595 nm was then measured using 535 nm as the excitation wavelength. The amount of phosphate was determined using a calibration curve with phosphate solutions of known concentrations.

Protein determination was done by measuring absorption at A280nm. The specific absorption values ​​(A280) of phytase variants were calculated based on the amino acid compositions of the protein using the method of Gill and von Hippel (Anal. Biochem. 182: 319-326 (1989)).

Thermostability

The thermostability of variants was characterized by the enzyme inactivation temperature. The inactivation temperature was determined by measuring the residual activity of the phytase enzyme after incubation for 10 min at different temperatures and subsequent cooling to room temperature. The inactivation temperature is the temperature at which the residual activity is 50% compared to the residual activity after incubation for the same duration under the same conditions at room temperature. To determine the temperature corresponding to 50% of residual activity, interpolations and extrapolations were computed from the measured activity data, when appropriate. The differences in thermostability in ° C were calculated by subtracting the inactivation temperatures of two enzymes from each other.

Purification of BP-11 mutants

Purification was performed by culturing Bacillus subtilis, transformed with a plasmid encoding BP-11, in shaking flasks at 37 ° C and 160 rpm, using standard LB medium with the addition of 20 mg / L of neomycin. At this stage, the culture medium accumulated a significant amount of phytase activity. About 2 L of the culture broth was adjusted to pH 8.0, filtered and applied to a column filled with 10 mL of Ni-NTA Sepharose resin (Qiagen). The column was washed with 50 mM Tris-HCI bread, 300 mM NaCI, pH 8.0, until OD280 fell below 0.05. Subsequently, the bound phytase was eluted with the same buffer containing 250 mM imidazole hydrochloride. The eluate was dialyzed against 50 mM sodium acetate buffer, pH 5.0, and stored at 4 ° C. The enzyme solution was then applied to a Resource S column equilibrated with 20 mM sodium acetate buffer, pH 5.0, and eluted using a 0 to 1 M NaCI salt gradient over 10 column volumes. Optionally, the eluate was dialyzed against 20 mM sodium acetate buffer, pH 5.0, before being stored at 4 ° C.

Pepsin stability

The pepsin stability of these variants was characterized by residual activities measured at pH 3.5, 37 ° C, after incubation with pepsin, compared to control conditions (residual activity = activity after incubation with pepsin / activity after incubation under conditions of The incubation with pepsin was carried out for 2 hours at pH 2.0, 0.25 mg / ml of pepsin, 1 mM of CaCb and 5 mg / ml of BSA at 37 ° C. The control conditions were 2 hours at pH 5.0, 1 mM CaCb and 5 mg / ml BSA at 37 ° C.

In the examples which follow, amino acid residues in the sequence of phytase variants are numbered according to the BP-WT sequence (SEQ ID NO: 1), unless otherwise indicated.

Example 1 - Generation and characterization of phytase variants

In general, the phytase variants were constructed by mutagenesis of the nucleotide sequence SEQ ID NO: 5 using mutagenesis methods, such as the methods presented in Morinaga et al. (Biotechnology (1984) 2, pp. 646-649); in Nelson and Long (Analytical Biochemistry (1989), 180, pp. 147-151); or the Error Threshold Mutagenesis protocol described in WO 92/18645. Another suitable method for mutagenic PCR is presented by Cadwell and Joyce (PCR Methods Appl. 3 (1994), 136-140).

Variants of the phytase enzyme were characterized after heterologous expression in one or more of the following expression hosts: Escherichia coli K12; Bacillus subtilis; Saccharomyces cerevisiae. Phytase variants were derived that differed in one or more amino acid positions from SEQ ID NO: 1, including two positions, three positions, four positions, five positions, six positions, seven positions, eight positions, nine positions, ten positions, eleven positions, twelve positions. When appropriate, iterative rounds of mutagenesis were performed. Following the protocols described in WO 2006/043178, several mutations were observed in BP-WT. In particular, a mutant was observed, A122T / D125A / T167I / F197S / T209K / A211P / K240E / A242S / S281L / Q289Y / A294E / N303K, called BP-11, with greater thermostability with respect to BP-WT (see amino acid residues 7 - 419 of SEQ ID NO: 4, which corresponds to SEQ ID NO: 6).

Example 2 - Variants of BP-11

Three different strategies were used to obtain BP-11 variants, which included random mutagenesis, targeted mutagenesis and site saturation mutagenesis.

A. Random mutagenesis and high-throughput screening were performed according to the teachings described in WO 2006/043178 for obtaining BP-WT mutants, such as BP-11.

A specific variant of BP-11 obtained by this method was called BP-19. BP-19 differs from BP-11 by a substitution in position 54 (Y54H), 84 (S84G), 190 (S190G), 220 (I220V) and 289 (N289D), corresponding to SEQ ID NO: 4.

Using the assay described above to measure specific activity, it was determined that BP-19 has a specific activity at pH 4.0 that is 26% higher than that of BP-11, and reference is made to Table 3.

B. Targeted mutagenesis of three specific residues was performed on the main structure of BP-WT and the main structure of BP-11, which correspond to positions G221S, T225M and N276R of SEQ ID NO: 4. The BP-15 mutant was obtained from the main structure of BP-WT, and the mutant BP-16 was obtained from the main structure of BP-11. The specific activity with respect to the phytases of origin is described in Table 3.

C. Libraries of site-saturation mutagenesis were performed based on the BP-11 variant molecule at various positions. Positions included R24, R28, T31, K32, D98, R100, K137, N212, G221, T225, E228, H259, F263, M266, N276, H312, D313, T314 and D334 of SEQ ID NO: 4. The libraries they were initially screened for improved activity in high-throughput screening, and then some variants were screened for specific activity, as described above. The selected variant was further purified to about 97% purity and analyzed for specific activity. Two variants in position D98 provided specific improved activity (D98A and D98Q). The winged mutant (A) instead of asp (D) (D98A) was isolated and designated BP-17 (see

SEQ ID NO: 3). The gin (Q) mutant instead of asp (D) (D98Q) has been isolated and designated BP-20.

The BP-11 variants, which include BP-16, BP-17, BP-18, BP19 and BP-20, were all tested as described above for phytase activity.

Table 3

Specific activity (U / mg, pH 4.0, 97% enzyme purity)

<td>VARIANT</td><td>Specific activity (A G)</td><td>Specific activity (% of activity BP-WT)</td><td>Specific activity (% of activity BP-11)</td>

<td>BP-WT (P1-29)</td><td> 936</td><td> 100</td><td> 142</td>

<td>BP-11</td><td> 632</td><td> 70</td><td> 100</td>

<td>BP-15</td><td> 790</td><td> 85</td><td> 121</td>

<td>BP-16</td><td> 760</td><td> 74</td><td> 106</td>

<td>BP-17</td><td> 1017</td><td> 109</td><td> 156</td>

<td>BP-18</td><td> 1005</td><td> 107</td><td> 153</td>

<td>BP-19</td><td> 822</td><td> 88</td><td> 126</td>

<td>BP-20</td><td> 840</td><td> 93</td><td> 133</td>

Example 3 - Expression of BP-17 in E. coli

The DNA sequence of the BP-17 mutant was modified for expression in E. coli by including DNA sequences that encode the signal sequence of wild-type Buttiauxella phytase, followed by a 6xHis tag and the coded sequence corresponding to the mutant BP17 of mature Buttiauxella phytase. Using standardized genetic engineering methods, this nucleotide sequence was inserted between the promoter of the E. dps gene. coli and the transcription terminator of the tufA gene, also derived from E. coli.

The expression cassette was inserted between the Saci and Apal restriction sites of the E. coli pCR 2.1 vector (Invitrogen), resulting in the plasmid pCDP (SHOK). The structure of the pCDP (SHOK) expression vector is illustrated in figure 2.

E. coli strain XL-Blue MRF 'transformed with pCDP (SHOK) was grown in shake flasks at 37 ° C and 200 rpm using standard LB medium with the addition of 50 mg / L kanamycin. At this stage, the culture medium accumulated a significant amount of phytase activity, which was not detectable in the recipient strain transformed with pCR2.1 and grown in the same medium. About 2 L of this culture broth was adjusted to pH 8.0 and applied to a column filled with 25 mL of Ni-NTA agarose (Invitrogen). The column was washed with 20 mM Tris-HCI buffer, pH 8.0, until the OD₂₈o dropped below 0.05, followed by elution of bound phytase with the same buffer containing 200 mM imidazole hydrochloride. The eluate was dialyzed against 20 mM sodium acetate buffer, pH 5.5, and stored at 4 ° C or frozen at -20 ° C. No loss of activity was observed with repeated freeze-thaw.

The pH profiles of BP-17 expressed in E. coli from wild-type Buttiauxella phytase (BP-WT) were measured as follows. Solutions containing 250 mM sodium acetate and 7.5 mM sodium phytate adjusted to pH 6, 5.5, 4.5, 4.25, 4.0, 3.75, 3.5 with hydrochloric acid were used to build the pH profiles in the range of pH 3.5 to pH 6.0. Enzyme activity at pH values ​​of 3.0 to 2.5 was measured in substrate solutions containing 250 mM glycine and 7.5 mM sodium phytate adjusted to the pH indicated with hydrochloric acid. It was found (Figure 3) that the pH profile of BP-17 produced in E. coli deviated significantly from the pH profile of wild-type Buttiauxella phytase.

The enzymes (diluted to about 30 U / ml) were treated with different concentrations of pepsin in 0.25 M glycine-hydrochloride buffer, pH 2.0, containing 3 mg / ml BSA at 37 ° C for 2 hours. After incubation, the remaining activity was tested at pH 5.5. As shown in figure 4, BP-17 is essentially stable to pepsin. The high pepsin stability of BP-17 is in contrast to the very low pepsin stability of wild-type Buttiauxella phytase, which is essentially completely degraded by 1 pg / ml pepsin (figure 4).

In examples 4 to 8, wild-type and variant Buttiauxella phytase were expressed directly or as a fusion protein in Trichoderma reesei. In all cases, very strong levels of expression were observed at more than 10 g / L.

Example 4 - Construction and expression of wild-type Buttiauxella phytase in T. reesei as a fusion protein without a Kex2 site

DNA encoding the wild-type Buttiauxella phytase open reading frame was synthesized by GENEART AG (BioPark JosefEngert-Str. 11, D-93053 Regensburg, Germany). The Spel and Ascl restriction sites have been included for cloning purposes (see table 4, SEQ ID NO: 8). The phytase open reading frame (SEQ ID NO: 8) was inserted into the vector, pTrex4, at the Spel and Ascl sites (see figure 5). The resulting construct was biolistically transformed into a strain derived from T. reesei using Bio-Rad's Biolistic PDS-1000 / He Particle Distribution System (Hercules, CA). The transformation protocol used was as described by Foreman (WO 2005/001036). After stable transformants were obtained, these transformants were cultured in shake flask cultures for analysis of Buttiauxella phytase protein expression, as outlined by Foreman (WO 2005/001036). The WO 2005/001036 transformation and expression analysis protocols are hereby incorporated by reference in their entirety. After several days of growth on MM acetamide plates, transformants that showed stable morphology were inoculated into 250 ml shake flasks containing 30 ml of Proflo medium. Proflo medium contains 30 g / L of a-lactose, 6.5 g / L of (NH₄)₂ONLY₄, 2 g / L KH₂POWDER₄, 0.3 g / L MgSO₄.7H₂O, 0.2 g / L CaCI₂, 1 mL / L of 1000X residual element salt solution, 2 mL / L of 10% Tween 80, 22.5 g / L of Proflo cottonseed flour (Traders Protein, Memphis, TN) and 0, 72 g / L of CaCO3. After two days of growth at 28 ° C and 225 rpm, 10% of the Proflo culture was transferred to a 250 ml shake flask containing 30 ml of Defined Lactose Medium. The composition of the Defined Lactose Medium is as follows: 5 g / L of (NH₄)₂ONLY₄, 33 g / L of PIPPS buffer, 9 g / L of amino acids, 4.5 g / L of KH₂POWDER₄, 1 g / L MgSO₄.7H₂0.5 ml / L of defoamer Mazu DF60-P (mazur Chemicals, Gurnee, IL), 1 ml / L of 1000X residual element salt solution, pH 5.5. 40 mL / L of 40% (w / v) lactose solution was added to the medium after sterilization. The Lactose Defined Medium shake flasks were incubated at 28 ° C, 225 rpm, for 2 to 3 days. Samples of the culture supernatant were mixed with an appropriate volume of 4X NuPAGE sample buffer (Invitrogen Carlsbad, CA) with reducing agent and subjected to βίβλοι 5 polyacrylamide gel foresis (PAGE) using NuPAGE 4 pre-melted gels 12% and MOPS operating buffer (Invitrogen Carlsbad, CA). The gels were stained for protein detection with Simply Blue Dye (Invitrogen Carlsbad, CA). A protein band with an apparent molecular mass of approximately 96 kDa was observed in the stained gel. The expected molecular mass of the fusion protein is approximately 96 kDa. The protein was found to be expressed at more than 10 g / L.

Table 4: DNA sequence of wild-type Buttiauxella phytase containing a Spel site at the 5 'end and an Ascl site at the 3' end.

ACTAGTAACGACACCCCCGCCAGCGGCTACCAGGTCGAGAAGGTCGTCATCCTCAG

CCGCCACGGAGTCCGCGCCCCCACCAAGATGACCCAGACCATGCGCGACGTCACCC

CCAACACCTGGCCCGAGTGGCCCGTCAAGCTCGGCTACATCACCCCCCGCGGCGAG

CACCTCATCAGCCTCATGGGCGGCTTCTACCGCCAGAAGTTCCAGCAGCAGGGCAT

CCTCAGCCAGGGCTCGTGTCCCACCCCCAACAGCATCTATGTCTGGGCCGACGTCGA

CCAGCGCACCCTCAAGACCGGCGAGGCCTTCCTCGCCGGCCTCGCCCCCCAGTGCG

GCCTCACCATCCACCACCAGCAGAACCTCGAGAAGGCCGACCCCCTCTTCCACCCC

GTCAAGGCCGGCACCTGCAGCATGGACAAGACCCAGGTCCAGCAGGCCGTCGAGA

AGGAGGCCCAGACCCCCATCGACAACCTCAACCAGCACTACATCCCCTTCCTCGCC

CTCATGAACACCACCCTCAACTTCAGCACCAGCGCCTGGTGCCAGAAGCACAGCGC

CGACAAGAGCTGCGACCTCGGCCTCAGCATGCCCAGCAAGCTCAGCATCAAGGACA

ACGGCAACAAGGTCGCCCTCGACGGCGCTATCGGCCTCAGCTCCACCCTCGCCGAG

ATCTTCCTCCTCGAGTACGCCCAGGGCATGCCTCAGGCTGCCTGGGGCAACATCCAC

AGCGAGCAGGAGTGGGCCAGCCTCCTCAAGCTCCACAACGTCCAGTTCGACCTCAT

GGCCCGCACCCCCTACATCGCCCGCCACAACGGCACCCCCCTCCTCCAGGCCATCA

GCAACGCCCTCAACCCCAACGCCACCGAGAGCAAGCTCCCCGACATCAGCCCCGAC

AACAAGATCCTCTTCATCGCCGGCCACGACACCAACATCGCCAACATCGCCGGCAT

GCTCAACATGCGCTGGACCCTCCCCGGCCAGCCCGACAACACCCCCCCCGGCGGCG

CTCTCGTCTTTGAGCGCCTCGCCGACAAGTCCGGCAAGCAATATGTCTCTGTCAGCA

TGGTCTACCAGACCCTCGAGCAGCTCCGCAGCCAGACCCCCCTCAGCCTCAACCAG

CCCGCCGGCAGCGTCCAGCTCAAGATCCCCGGCTGCAACGACCAGACCGCCGAGGG

CTACTGCCCCCTCAGCACCTTCACCCGCGTCGTCAGCCAGAGCGTCGAGCCCGGCTG

CCAGCTCCAGTAAGGCGCGCC (SEQ ID NO: 8)

Example 5 - Construction and expression of wild-type Buttiauxella phytase in T. reesei as a fusion protein with a Kex2 site

The wild-type Buttiauxella phytase open reading frame was amplified by polymerase chain reaction (PCR) using the DNA synthesized by GENEART as the template (see Table 4, SEQ ID NO: 8). The PCR machine used was a Peltier Thermal Cycler PTC-200 (MJ Research). The DNA polymerase used in PCR was HERculase (Stratagene). The primers used to amplify the phytase open reading frame were the SK667 (direct) primer

5 'CACTACTAGTGTCGCTGTGGAGAAGCGCAACGACACCCCCGCCAG 3' (SEQ ID NO: 9) and the SK664 5 'GAGTTCGGCGCGCCTTACTGGA 3' primer (SEQ ID NO: 13). The direct primer contained the amino acid sequence VAVEKR (SEQ ID NO: 10) for efficient cleavage by the protease Kex2, together with a Spel site for cloning purposes. The PCR conditions for amplifying the open reading frame of wild-type Buttiauxella phytase were as follows: Step 1: 94 ° C for 1 min. Step 2: 94 ° C for 30 s. Step 3: 58 ° C for 30 s. Step 4: 72 ° C for 1 min. Steps 2, 3 and 4 were repeated for an additional 24 cycles. Step 5: 72 ° C for 5 min. Step 6: 4 ° C for storage. The PCR product was purified using the Qiaquick Gel Purification Kit (Qiagen) and digested with the restriction enzymes Spel and Ascl (Roche). Digested DNA was purified using the Qiaquick PCR Purification Kit and ligated into the pTrex4 vector at the Spel and Ascl sites (see figure 5). The ligation reaction was transformed into chemically competent TOP 10 E. coli cells (Invitrogen). see the

Example 4 for transformation and identification of protein expression. A protein band with an apparent molecular mass of approximately 96 kDa was observed in the stained gel. The expected molecular mass of the fusion protein is approximately 96 kDa. The protein was expressed at more than 10 g / L.

Example 6 - Construction and expression of wild-type Buttiauxella phytase in T. reesei as a direct construct

The wild-type Buttiauxella phytase open reading frame was amplified by polymerase chain reaction (PCR) using the DNA synthesized by GENEART as the template (see Table 5, SEO ID NO: 6). The PCR machine used was a Peltier Thermal Cycler PTC-200 (MJ Research). The DNA polymerase used in PCR was HERculase (Stratagene). The primers used to amplify the phytase open reading frame were the SK680 (direct) primer

5'CACCATGCAGACCTTCGGTGCTTTTCTCGTTTCCTTCCTCGCCGCCAG CGGCCTGGCCGCGGCCAACGACACCCCCGCCAGC 3 '(SEQ ID NO: 11) and the SK6 5' CCTTACTGGAGCTGGCAG 3 'initiator (SEQ ID NO:. The direct primer contained four additional nucleotides (sequence - CACC) at the 5 'end, which were required for cloning into the pENTRY / DTOPO vector (Invitrogen). The PCR conditions for amplifying the open reading frame of wild-type Buttiauxella phytase were as follows: Step 1: 94 ° C for 1 min. Step 2: 94 ° C for 30 s. Step 3: 58 ° C for 30 s. Step 4: 72 ° C for 1 min. Steps 2, 3 and 4 were repeated for an additional 24 cycles. Step 5: 72 ° C for 5 min. Step 6: 4 ° C for storage. The PCR product was purified using the Qiaquick Gel Purification Kit (Qiagen). The purified PCR product was initially cloned into the pENTRY / D TOPO (Invitrogen) vector and transformed into chemically competent TOP 10 E. coli cells (Invitrogen). A pENTR / D-TOPO vector with the correct sequence of the phytase open reading frame was recombined with the pTrex3g vector using LR clonase II (Invitrogen), according to the manufacturers' instructions (see figure 6). The resulting construct was transformed, and the protein expression was identified as in Example 4. The expected molecular mass of the fusion protein is approximately 46 kDa. The protein was expressed at more than 10 g / L.

Example 7 - Construction and expression of the Buttiauxella BP17 variant phytase in T. reesei as a fusion protein with a Kex2 site

The DNA encoding the BP-17 variant's open reading frame was synthesized by GENEART AG (BioPark Josef-Engert-Str. 11, D-93053

Regensburg, Germany) (see Table 5, SEQ ID NO: 7). The VAVEKR amino acid sequence (SEQ ID NO: 10) was included for dividing by the Kex2 protease from the fusion protein, along with the Sepl and Ascl restriction sites for cloning purposes. The phytase open reading frame (SEQ ID NO: 7) was inserted into the vector, pTrex4, at the Spel and Ascl sites (see figure

5). The resulting construct was transformed and expressed as in Example

4. The expected molecular mass of the fusion protein is approximately 96 kDa. The protein was expressed at more than 10 g / L.

Table 5: DNA sequence of the Buttiauxella phytase BP-17 variant containing a Sepl site at the 5 'end and an Ascl site at the 3' end.

ACTAGTGTCGCCGTGGAGAAGCGCAACGACACCCCCGCCAGCGGCTACCAGGTCGA

GAAGGTCGTCATCCTCAGCCGCCACGGCGTCCGCGCCCCTACCAAGATGACCCAGA

CCATGCGCGACGTCACCCCCAACACCTGGCCCGAGTGGCCCGTCAAGCTCGGCTAC

ATCACCCCTCGCGGCGAGCACCTCATCAGCCTCATGGGCGGCTTCTACCGCCAGAA

GTTCCAGCAGCAGGGCATCCTCAGCCAGGGCTCGTGCCCCACCCCCAACAGCATCT

ACGTCTGGACCGACGTCGCCCAGCGCACCCTCAAGACCGGCGAGGCCTTCCTCGCC

GGCCTCGCCCCCCAGTGCGGCCTCACCATCCACCACCAGCAGAACCTCGAGAAGGC

CGACCCCCTCTTCCACCCCGTCAAGGCCGGCATCTGCAGCATGGACAAGACCCAGG

TCCAGCAGGCCGTCGAGAAGGAGGCCCAGACCCCCATCGACAACCTCAACCAGCAC

TACATCCCCAGCCTCGCCCTCATGAACACCACCCTCAACTTCAGCAAGAGCCCCTGG

TGCCAGAAGCACAGCGCCGACAAGAGCTGCGACCTCGGCCTCAGCATGCCCAGCAA

GCTCAGCATCAAGGACAACGGCAACGAGGTCTCCCTCGACGGCGCTATCGGCCTCA

GCTCCACCCTCGCCGAGATCTTCCTCCTCGAGTACGCCCAGGGCATGCCTCAGGCCG

CCTGGGGCAACATCCACAGCGAGCAGGAGTGGGCCCTCCTCCTCAAGCTCCACAAC

GTCTACTTCGACCTCATGGAGCGCACCCCCTACATCGCCCGCCACAAGGGCACCCCC

CTCCTCCAGGCCATCAGCAACGCCCTCAACCCCAACGCCACCGAGAGCAAGCTCCC

CGACATCAGCCCCGACAACAAGATCCTCTTCATCGCCGGCCACGACACCAACATCG

CCAACATCGCCGGCATGCTCAACATGCGCTGGACCCTCCCCGGCCAGCCCGACAAC

ACCCCCCCTGGCGGCGCTCTCGTCTTTGAGCGCCTCGCCGACAAGTCCGGCAAGCA

GTACGTCAGCGTCAGCATGGTCTACCAGACCCTCGAGCAGCTCCGCAGCCAGACCC

CCCTCAGCCTCAACCAGCCTGCCGGCAGCGTCCAGCTCAAGATCCCCGGCTGCAAC

GACCAGACCGCCGAGGGCTACTGCCCCCTCAGCACCTTCACCCGCGTCGTCAGCCA

GAGCGTCGAGCCCGGCTGCCAGCTCCAGTAAGGCGCGCC (SEQ ID NO: 7).

Example 8 - Construction and expression of the BP-17 variant of Buttiauxella phytase in T. reesei as a direct construct

The open reading frame of the BP-17 variant of Buttiauxella phytase was amplified by polymerase chain reaction (PCR) using the DNA synthesized by GENEART as the template (see Table 5, SEQ ID NO: 7). The PCR machine used was a Peltier Thermal Cycler PTC-200 (MJ Research). The DNA polymerase used in PCR was HERculase (Stratagene). The primers used to amplify the phytase open reading frame were the primer

SK680 (direct)

5'CACCATGCAGACCTTCGGTGCTTTTCTCGTTTCCTTCCTCGCCGCCAGCGGCCT GGCCGCGGCCAACGACACCCCCGCCAGC 3 '(SEQ ID NO: 11) and the SK6 5' CCTTACTGGAGCTGGCAG 3 '(SEQ ID NO: 12). The direct primer contained four additional nucleotides (sequence - CACC) at the 5 'end, which were required for cloning into the pENTRY / D-TOPO (Invitrogen) vector. The PCR conditions for amplifying the open reading frame of wild-type Buttiauxella phytase were as follows: Step 1: 94 ° C for 1 min. Step 2: 94 ° C for 30 s. Step 3: 58 ° C for 30 s. Step 4: 72 ° C for 1 min. Steps 2, 3 and 4 were repeated for an additional 24 cycles. Stage

5: 72 ° C for 5 min. Step 6: 4 ° C for storage. The product of

PCR was purified using the Qiaquick Gel Purification Kit (Qiagen). The purified PCR product was initially cloned into the pENTRY / D TOPO vector (Invitrogen) and transformed into chemically competent TOP 10 E. coli cells (Invitrogen). A pENTR / D-TOPO vector with the correct sequence of the phytase open reading frame was recombined with the pTrex3g vector using LR clonase II (Invitrogen), according to the manufacturers' instructions (see figure 6). The resulting construct was transformed, and the expression was identified as in Example 4. A protein band with an apparent molecular mass of approximately 46 kDa was observed in the dyed gel. The expected molecular mass of the fusion protein is approximately 46 kDa. The protein was expressed at more than 10 g / L.