Methods for protecting allogeneic islet transplant using soluble ctla4 mutant molecules

Description of the invention

Field of the Invention

The invention relates to the use of a soluble CTLA4 mutant molecule. The present invention relates generally to the field of inhibiting pancreatic islet cell transplant rejection and allows the implementation of diabetes treatments, including type 1 diabetes and type 2 diabetes, by administering to a subject an effective amount of soluble CTLA4 mutant molecules.

Background of the invention

Organ transplantation has emerged as a beneficial treatment for many forms of life-threatening disease associated with organ destruction. The improvement in clinical transplant outcomes has been achieved primarily by the use of ever increasing strength non-specific immunosuppressive drugs to inhibit the rejection response (Lancet, 345: 1321-1325 (1995)). While there has been an improvement in short-term outcomes, the long-term effects remain inadequate. Life-long immunosuppressants are currently required to combat chronic organ transplant rejection, and their use dramatically increases the risk of cardiac vascular disease, infection, and cancer.

Developing strategies to stimulate allogeneic tissue uptake without the need for chronic immunosuppression can reduce the risk of these life-threatening complications and greatly extend the use of organ, tissue and cellular transplants in diseases such as hemoglobinopathies, genetic immunodeficiencies and autoimmune diseases.

Insulin-dependent diabetes mellitus (IDDM) is one of the most common metabolic disorders in the world. In the United States, IDDM affects nearly one in 300 to 400 people, and epidemiological studies suggest that the incidence of IDDM is increasing steadily. IDDM is caused by an autoimmune response that results in the destruction of insulin-producing pancreatic islet cells as a result of the action of T cells.

Once the clinical symptoms of IDDM become evident, replacement therapy with exogenous insulin is the most commonly used therapy to control the clinical symptoms of IDDM. Although insulin replacement therapy allows most IDDM patients to lead a near normal life, it does not restore full metabolic homeostasis, as a result of which severe complications involving eye, heart, and other organ dysfunction are common in diabetics on insulin replacement therapy.

Islet transplantation is a long sought therapy for IDDM patients. However, transplanted insulin-producing islet cells are often rapidly destroyed by the same autoimmune response that previously destroyed its own islet cells. Of the 260 allografts performed since 1990, only 12.4% resulted in insulin independence for more than one week and only 8.25% resulted in insulin independence for more than one year (Linsley et al., Diabetes (1997) 46: 1120-3 ). In most of these procedures, the primary immunosuppression regimen was the induction of antibodies with anti-lymphocyte globulin combined with cyclosporine, azathioprine, and glucocorticoids.

For any type of transplant procedure, a key factor for its clinical acceptance is the balance between efficacy and toxicity. In the case of islet transplantation, an additional concern is the large number of current immunosuppressants, especially glucocorticosteroids or calcineurin inhibitors such as Tarcolimus, which destroy beta cells or induce peripheral insulin resistance (Zeng et al., Surgery (1993) 113: 98-102).

A steroid-free immunosuppressive protocol ("Edmonton protocol), which includes sirolimus, low dose Tarcolimus, and monoclonal antibodies (mAbs) against the IL-2 receptor, was used in a single islet transplant trial in patients with type 1 diabetes (Shapiro, AMJ et al. (2000 ), N.Eng.J. Med. 343: 230-238).

The recent success of the Edmonton Protocol has restored enthusiasm for the use of islet transplantation in the treatment of diabetes. However, concerns about the toxicity of Tarcolismus may limit the use of this therapy in humans. Biological agents that block key T cell costimulatory signals, in particular the CD28 pathway, are a potential alternative to protecting allogeneic islets. Examples of agents that block the CD28 pathway include, without limitation, soluble CTLA4 including mutant CTLA4 molecules.

PL 204 899 B1

Summary of the invention

The present invention relates to the use of a soluble CTLA4 mutant molecule in the manufacture of a medicament for inhibiting islet cell transplant rejection, wherein the soluble CTLA mutant molecule comprises a mutant CTLA4 extracellular domain having

a) an amino acid sequence that starts with methionine at position +1 and ends with aspartic acid at position +124 as shown in Figure 3 or that starts with alanine at position -1 and ends with aspartic acid at position +124 as shown in Fig. 3.

b) an amino acid sequence that starts with methionine at position +1 and ends with aspartic acid at position +124 as shown in Figure 19 or that starts with alanine at position -1 and ends with aspartic acid at position +124 as shown in Fig. 19.

c) an amino acid sequence that starts with methionine at position +1 and ends with aspartic acid at position +124 as shown in Figure 20 or that starts with alanine at position -1 and ends with aspartic acid at position +124 as shown in Fig. 20.

d) an amino acid sequence that starts with methionine at position +1 and ends with aspartic acid at position +124 as shown in Figure 21 or that starts with alanine at position -1 and ends with aspartic acid at position +124 as shown in Fig. 21.

(e) an amino acid sequence that starts with methionine at position +1 and ends with aspartic acid at position +124 as shown in Figure 22 or that starts with alanine at position -1 and ends with aspartic acid at position +124 as shown in Fig. 22.

In a preferred embodiment of the use of the invention, islet cell transplantation is for the treatment of diabetes mellitus, and more preferably for the treatment of type 1 or 2 diabetes.

In a further alternative embodiment, the islet cell transplant comprises encapsulated islet cells.

In a preferred embodiment of the invention, inhibiting islet cell transplant rejection comprises administering a soluble CTLA4 mutant molecule prior to, during, or after the islet cell transplant.

Also preferably, the extracellular domain is fused to a non-CTLA4 molecule. In a more preferred embodiment, the non-CTLA4 molecule comprises an immunoglobulin molecule, and even more preferably the immunoglobulin molecule is an immunoglobulin constant region or part thereof.

In the use of the invention, the immunoglobulin constant region or portion thereof preferably contains one or more mutations to reduce effector function.

The constant region of an immunoglobulin comprises the CH2 or CH3 hinge region of an immunoglobulin molecule. In a further preferred embodiment, or a portion thereof, the immunoglobulin constant region is a human or simian immunoglobulin constant region.

The use according to the invention is further characterized in that the soluble CTLA4 mutant is:

a) L104EA29YIg as shown in Figure 3, starting with Ala at -1 or Met at +1 and ending with Lys at +357 (SEQ ID NO: 6, starting with Ala at position 26 and ending with Lys at 383, or starting with Met at position 27 and ending with Lys at position i 383),

b) L104EIg as shown in Fig. 19 starting with Ala at position -1 or Met at position +1 and ending with Lys at position +357 (SEQ ID NO: 8, starting with Ala at position 26 and ending with Lys at position 383 or beginning with Met at position 27 and ending with Lys at position i 383),

c) L104EA29LIg as shown in Fig. 20 starting with Ala at position -1 or Met at position +1 and ending with Lys at position +357 (SEQ ID NO: 10, starting with Ala at position 26 and ending with ending with Lys at position 383, or beginning with Met at position 27 and ending with Lys at position i 383),

d) L104EA29TIg as shown in Fig. 21 starting with Ala at position -1 or Met at +1 and ending with Lys at position +357 (SEQ ID NO: 12, starting with Ala at position 26 and ending with Lys at position +357). 383, or starting with Met at position 27 and ending with Lys at position 383), or

e) L104EA29WIg as shown in Figure 22, starting with Ala at position -1 or Met at +1 and ending with Lys at position +357 (SEQ ID No .: 14, starting with Ala at position 26 and ending with Lys at position 383, or starting with Met at position 27 and ending with Lys at position 383), with the soluble CTLA4 mutant molecule preferably being used in conjunction with either

The at least one additional compound is selected from the group consisting of immunosuppressive compounds, immunomodulatory compounds, and anti-inflammatory compounds.

More preferably, such a compound is selected from the group consisting of anakinra, adrenocorticosteroids, azathioprine, basilixmab, calcineurin inhibitors, chloroquine, corticosteroids, cyclosporin, prednisone, cyclophosphamide, cytoxane, 15-deoxyspergaline and its analogues, D-penicillamine, FTH720-etatrimercept, acetate, glycine. and its analogs, glucocorticoids, gold salts, equine anti-human thymocyte globulin (ATGAM), humanized anti-TAC (HAT), hydroxychloroquine, infiximab, interferon bata-1a, iterferon beta-1b, leflunomide, and its analogs, lymphocyte immunoglobulin, lymphocyte homing agents, methoxalene, methotrexate, mitoxantrone hydrochloride, mycophenolic acid, mycophenolate mofetil, miziribin, NSAIDE, rabbit anti-Rho-globulin, antihuman globulin (rapamycin) and its derivatives (e.g., 40-0- (2-hydroxy) ethyl rapamycin), sulfasalazopyrine, sulfasalazine, tacrolimus (FK-506) thalidomide, TNFα blockers and biological agents that target inflammatory cytokines, TOR inhibitors, compounds that interact with CD40 and 0D154, soluble gp39, soluble 0D29, soluble CD40, soluble CD80 (e.g., ATCC 68627), soluble CD86, soluble CD28, soluble CD56, soluble Thy-I, Soluble CD3, Soluble TCR, Soluble VLA-4, Soluble VCAM-1, Soluble LECAM-1, Soluble ELAM-1, Soluble CD44, gp39 reactive antibodies (e.g., ATCC HB-10916, ATCC HB-12055 and ATCC HB-12056), CD40-reactive antibodies (e.g., ATCC HB-9110), B7-reactive antibodies (ATCC HB-253, ATCC CRL-2223, ATCC CRL-2226, ATCC HB-301, ATCC HB-11341), CD28 reactive antibodies (e.g., ATCC HB-11944 or mAb 9.3) LFA-1 reactive antibodies (e.g., ATCC HB-9579 and ATCC TIB-213, antibodies LFA-2 reactive, IL-2 reactive antibodies, IL-12 reactive antibodies, IFN-gamma-reactive antibodies, CD2-reactive antibodies, CD48-reactive antibodies, ICAM-reactive antibodies (e.g., ICAM-1 (ATCC CRL-2252, ICAM-2, and ICAM-3), CTLA4-reactive antibodies (e.g., ATCC HB-304, Thy-1 reactive antibodies, CD56-reactive antibodies, CD3-reactive antibodies, CD29-reactive antibodies, TCR-reactive antibodies, VLA-4-reactive antibodies, antibodies reactive with VCAM-1, antibodies reactive with LECAM-1, antibodies reactive with ELAM-1, antibodies reactive with CD44, monoclonal antibodies to leukocyte receptors, e.g., MHC, CD2, CD3, CD4, CDtla / CD18, CD7, CD25 , CD27, B7, CD40, CD45, CD137, ICOS, CD150, (SLAM), OX40, 4-1BB or their ligands, CTLA4 / CD28-1g, LFA-1 antagonists, selectin antagonists and VLA-4 antagonists and anti-human IL-2RmAbs.

The soluble CTLA4 mutant molecule and the additional compound are administered simultaneously, optionally the soluble CTLA4 mutant molecule and the additional compound are administered together or sequentially.

In the use of the invention, inhibiting cell transplant rejection preferably comprises an additional immunosuppressive regimen, which is more preferably glucocorticoid-free, or may include corticosteroids.

The above-mentioned additional immunosuppressive regimen of the invention is calcineurin inhibitor-free. It may also include one or more compounds as defined above.

In a further preferred embodiment, the additional immunosuppressive regimen comprises a TOR inhibitor and / or a biological agent that targets IL-2, more preferably the TOR inhibitor is rapamycin (sirolimus) or derivatives thereof.

Said biological agent that targets IL-2 may preferably be an IL-2 reactive antibody or an anti-human IL-2R mAb, and more preferably the anti-human IL-2R variant is basiliximab.

The use according to the invention is further characterized in that the additional immunosuppressive regimen comprises mycophenolic acid or mycophenolate mofetil.

Moreover, in a further preferred embodiment, the additional immunosuppressive regimen comprises a compound that interferes with binding of CD40 to CD154, more preferably the compound that interferes with binding of CD40 to CD154 is anti-CD40 antibodies, or is optionally anti-154 antibodies.

In the use according to the invention, inhibiting islet cell transplant rejection comprises administering T-depleted bone marrow cells, wherein according to the invention this administration of the T-depleted bone marrow cells takes place approximately.

It is at the same time as placement of the islet cell transplant, or alternatively precedes placement of the islet cell transplant. The administration of T cell depleted bone marrow cells preferably comprises a first dose and a second dose.

The present invention allows for the implementation of methods of treating diseases of the immune system by administering to the treated subject soluble, mutant CTLA4 molecules that bind CD80 and / or CD86 molecules on CD80 and / or CD86 positive cells, thereby inhibiting the binding of endogenous CD80 and / or CD86 molecules. with CTLA4 and / or CD28 on T cells, thus blocking key costimulatory signals of T cells, particularly the CD28 pathway.

Brief description of the figures

Figure 1 describes the complete nucleotide (SEQ ID NO: 1) and amino acid sequences (SEQ ID NO: 2) for the human CTLA4 receptor fused to the Oncostatin M signal peptide. Oncostatin M signal peptide is indicated at position -25 to -1.

Figure 2 describes the nucleotide (SEQ ID NO: 3) and amino acid sequence (SEQ ID NO: 4) of a CTLA4Ig having a signal peptide; wild-type amino acid sequence of CTLA4 extracellular domains starting at methionine at position +1 to aspartic acid at position +124, or starting at alanine at position -1 to aspartic acid at position +124; and the Ig region.

Figure 3 describes the nucleotide (SEQ ID NO: 5) and amino acid sequence (SEQ ID NO: 6) of the CTLA4 mutant molecule (L104EA29YIg) including the signal peptide; a mutated CTLA4 extracellular domain starting with methionine at the +1 position and ending with aspartic acid at the +124 position, or starting with alanine at the -1 position and ending with aspartic acid at the +124 position; and the Ig region as described in Example 1, below.

Fig. 4 is a line graph illustrating the fasting plasma glucose level of a normal subject as described in Example 3, below.

Fig. 5 is a line graph illustrating the fasting plasma glucose level of a pancreatic removed subject who has been transplanted with pancreatic islet cells as described in Example 3. Animals with islet cells on day 0, and either treated with an immunosuppressive regimen including L104EA29YIg and primary immunosuppressive regimen (treated), or only primary immunosuppressive regimen (control). The primary immunosuppressive regimen included rapamycin and anti-human IL2R antibodies.

Fig. 6 is a line graph illustrating the insulin requirements of islet cell transplanted subjects as described in Example 3. Animals were transplanted with islet cells on day 0, and were treated with an immunosuppressive regimen including L104EA29YIg and a baseline immunosuppressive regimen (treated), or only basic immunosuppressive regimen (control).

Fig. 7 is a line graph illustrating blood glucose levels in an intravenous glucose tolerance test before and after islet transplantation as described in Example 3.

Fig. 8 depicts a schematic diagram of the vector piLN-L104EA29Y having the L104EA29YIg insert.

Figures 9A and 9B illustrate data from FACS assays showing L104EA29YIg, L104EIg, and CTLA4Ig binding to CHO cells transfected with human CD80 or CD86 as described in Example 2, below.

Figures 10A and 10B describe the inhibition of proliferation of CD80 and CD86 positive CHO cells as described in Example 2 below.

Figures 11A and 11B show that L104EA29YIg is more effective than CTLA4Ig at inhibiting the proliferation of primary and secondary allostimulated T cells as described in Example 2, below.

Figures 12A-C illustrate that L104EA29YIg is more effective than CTLA4Ig at inhibiting the production of the cytokines IL-2 (Figure 12A), IL-4 (Figure 12B) and γ-interferon (Figure 12C) of allostimulated human T cells. as described in Example 2 below.

Figure 13 shows that L104EA29YIg is more effective than CTLA4Ig at inhibiting phytohaemagglutinin (PHA) stimulated monkey T cell proliferation as described in Example 2, below.

Figures 14A-C show the SDS gel (Figure 14A) for CTLA4Ig (lane 1), L104EIg (lane 2), and L104EA29YIg (lane 3A); and CTLA4Ig gel chromatograms (Fig. 14B) and L104EA29YIg (Fig. 14C).

PL 204 899 B1

Figures 15A and 15B illustrate a band diagram of the extracellular splicing of a V-like CTLA4 Ig prepared from a solution structure determined by NMR spectroscopy. Fig. 15B shows an enlarged view of the S25-R33 region and the MYPPPY region showing the position and side chain orientation of the avidity enhancing mutations, L104 and A29.

Fig. 16 describes fasting blood glucose levels for LEA29YIg treated recipients (A) and control recipients (B) of allogeneic islets (representative animals) before and after transplantation. All animals underwent surgical removal of the pancreas at least 2 weeks prior to transplantation (mean pre-transplant insulin requirement 8.76 ± 0.18 units / day). (C) Following infusion into the portal vein of allogeneic islets, recipients quickly became euglycemic, requiring no exogenous post-transplant insulin. (D) Diabetes induction and post-transplant islet function were confirmed by intravenous glucose tolerance test pre-transplant and at 1 month and 3 months post-transplant as described in Example 3, below.

Fig. 17 describes (A) the immunohistology of functional, grafted islets, confirmed by positive staining for insulin. (B) an islet from an animal receiving a control regimen surrounded by mononuclear infiltration, indicating rejection, as described in Example 3, below.

Figure 18 describes the suppression of anti-donor T and B cell responses by the L104EA29Y regimen. (A) Anti-donor IFN-y-ELISpot response corresponds to control rejection time (~ 1 week post-transplant). (B) The L104EA29Y regimen is effective in suppressing the generation of anti-donor T cell responses. (C) Animals receiving rapamycin and anti-IL-2R mAb rapidly developed detectable anti-donor antibodies as measured by flow cytometric methods at the time of rejection. (D) Islet recipients receiving the regimen comprising L104EA29Y failed to generate a detectable anti-donor antibody response during treatment as described in Example 3, below.

Figure 19 shows the nucleotide and amino acid sequences of L104EIg (SEQ ID NO: 7-8) as described in Example 2, below.

Figure 20 shows the nucleotide and amino acid sequences of L104EA29LIg (SEQ ID NOs: 9-10).

Figure 21 shows the nucleotide and amino acid sequences of L104EA29TIg (SEQ ID NOs: 11-12).

Figure 22 shows the nucleotide and amino acid sequences of L104EA29WIg (SEQ ID NOs: 13-14).

Figure 23 shows the nucleotide sequence of a CTLA4Ig (SEQ ID NO: 15) having a signal peptide; wild-type amino acid sequence of CTLA4 extracellular domain starting at methionine at position +1 to aspartic acid at position + 124, or starting at alanine at position -1 to aspartic acid at position +124; and the Ig region.

Figure 24 shows the nucleotide sequence of a CTLA4Ig (SEQ ID NO: 16) having a signal peptide; wild-type amino acid sequence of CTLA4 extracellular domain starting at methionine at position +1 to aspartic acid at position +124, or starting at alanine at position -1 to aspartic acid at position +124; and the Ig region.

Detailed Description of the Invention

Definitions

All scientific and technical terms used in this application have the meanings commonly used in the art unless otherwise noted. As used in this application, the following words or phrases have the meanings listed.

"Wild-type CTLA4 has the amino acid sequence of naturally occurring full-length CTLA4 (US Patent Nos. 5,434,131, 5,844,095, 5,851,795), or any extracellular domain thereof that binds the B7 molecule (CD80 and / or CD86), or interferes with binding to B7 ( e.g. CD80 and / or CD86) so that it blocks binding to their ligands or blocks binding to CTLA4 extracellular domains or parts thereof. In particular embodiments, wild-type CTLA4 starts with methionine at +1 position and ends at aspartic acid at +124 or wild-type CTLA4 starts at alanine at -1 and ends at aspartic acid at +124. In other embodiments, wild-type CTLA44 comprises 187 amino acids for the CTLA4 receptor as described in Figure 3 of US Patent No. 5,434,131, 5,844,095, 5,851,795, and shown herein as Figure 1. Wild-type CTLA4 is a cell surface protein having an N-terminal extracellular domain, a transmembrane domain, and a C-terminal cytoplasmic domain. The extracellular domain binds to target antigens such as CD80 and CD86. In the cell, the wild-type naturally occurring CTLA4 protein undergoes

The immature polypeptide undergoes a post-translational processing that includes cleavage and removal of the signal peptide to yield a CTLA4 cleavage product having a newly formed N-terminus that differs from the N-terminus in immature form. . One skilled in the art will appreciate that additional post-translational processing may occur that removes one or more amino acids from the newly formed N-terminus of the CTLA4 cleavage product. The mature form of the CTLA4 molecule includes the extracellular domain of CTLA4, or any portion thereof that binds to CD80 and / or CD86.

"The CTLA4 extracellular domain is the portion of the CTLA4 receptor that extends beyond the cell membrane and includes any portion of CTLA4 that extends beyond the cell membrane that recognizes and binds CTLA4 ligands, such as a B7 molecule (e.g., CD80 and / or CD86 molecules). For example, the extracellular domain of CTLA4 includes methionine at the +1 position to aspartic acid at the +124 position (Figure 2). Alternatively, the CTLA4 extracellular domain comprises alanine at position +1 to aspartic acid at position +125 (Figure 1). The extracellular domain includes CTLA4 fragments or derivatives that bind to a B7 molecule (e.g., CD80 and / or CD86).

"Non-CTLA4 protein sequence or" non-CTLA4 molecule is defined as any molecule that does not bind CD80 and / or CD86 and does not interfere with CTLA4 binding to its target. An example includes, without limitation, an immunoglobulin (Ig) constant region or a portion thereof. Preferably, the Ig constant region is a human or monkey constant region, e.g., human C (gamma) 1, including the hinge, CH2 and CH3 regions. The Ig constant region can be mutated to reduce its effector functions (US Patent Nos. 5,637,481; and 6,090,914).

"Soluble" refers to any molecule or fragment or derivative thereof, not bound or attached to the cell, ie circulating. For example, CTLA4, L104EA29YIg, B7, or CD28 can be made soluble by attaching an immunoglobulin (Ig) moiety to the extracellular domain of CTLA4, B7, or CD28, respectively. Other molecules may include the papillomavirus E7 gene product (E7) melanoma-associated antigen (p97) or HIV envelope protein (env gp120). Alternatively, a molecule such as CTLA4 can be made soluble by removing its transmembrane domain. Typically, the soluble molecules used in the methods of the invention do not contain a signal (or leader) sequence.

"CTLA4Ig is a soluble fusion protein comprising the extracellular domain of CTLA4 or a portion thereof that binds CD80 and / or CD86 fused to an Ig tail. A particular embodiment comprises a wild-type CTLA4 extracellular domain beginning at methionine at the +1 position and ending at aspartic acid at the +124 position; or starting at alanine at the -1 position through to aspartic acid at the +124 position; a junction glutamine amino acid residue at position +125; and an immunoglobulin portion comprising glutamic acid at position +126 to lysine at position +357 (Figure 2). The DNA encoding CTLA4Ig was deposited on May 31, 1991 at the American Type Culture Collection (ATCC), 10801 University Blvd, Manassas, VA 20110-2209 under the terms of the Budapest Treaty, and was assigned ATCC accession number 68629; Linsley, P. et al., 1994 Immunity 1: 793-80). CTLA4Ig-24, a Chinese Hamster Ovary (CHO) cell line expressing CTLA4Ig was deposited on May 31, 1991 with the accession number ATCC CRL-10762. The soluble CTLA4Ig molecules used in the appropriate methods and / or kits may or may not include a signal (leader) peptide sequence. Typically, in these methods and / or kits, the molecules do not contain the signal peptide sequence.

"Soluble CTLA4 molecules are CTLA4 molecules (wild type or mutant) not bound to the cell surface (i.e. circulating) or any functional portion of a CTLA4 molecule that binds B7 together, but not limited to: CTLA4Ig fusion proteins (e.g. ATCC 68629), wherein the CTLA4 extracellular domain is fused to an immunoglobulin (Ig) fusion moiety rendering the fusion molecule soluble, or fragments and derivatives of the foregoing; a protein with a CTLA4 extracellular domain fused or fused to a biologically active or chemically active protein, such as papilomavirus E7 gene product (CTLA4-E7), melanoma-associated antigen p97 (CTLA4-p97), or HIV envelope protein (CTLA4-env gp120 ), or fragments and derivatives of the above; hybrid (chimeric) fusion proteins such as CD28 / CTLA4Ig or fragments and derivatives of the above; CTLA4 molecules with the transmembrane domain removed, rendering the protein soluble (Oaks, MK et al., 2000 Cellular Immunology 201: 144-153) or fragments and derivatives of the above. "Soluble CTLA4 molecules also include fragments, portions or derivatives of the above, and soluble CTLA4 mutant molecules having CTLA4 binding activity. Soluble

CTLA4 molecules used in the methods and / or kits may or may not include a signal (leader) peptide sequence. Typically, in the methods and / or kits of the invention, the molecules do not contain signal peptide sequences.

"A fusion protein is defined as one or more amino acid sequences linked together using methods well known in the art and as described in US Patent Nos. 5,434,131 or 5,637,481. The linked amino acid sequences thereby form a single fusion protein.

"A mutant CTLA4 molecule is a molecule which may be a full length CTLA4 or part thereof (derivatives or fragments) having a mutation or multiple mutations in CTLA4 (preferably in the extracellular domain of CTLA4) such that it is similar but not identical to the wild type CTLA4 molecule . CTLA4 mutant molecules bind to a B7 molecule (e.g., either CD80 or CD86 or both). The mutant CTLA4 molecules can include or link to biologically or chemically active non-CTLA4 molecules. The mutant molecules can be soluble (i.e. circulating) or bound to the surface. CTLA4 mutant molecules can include the entire extracellular domain of CTLA4 or a portion thereof, e.g., fragments or derivatives. CTLA4 mutant molecules can be made synthetically or recombinantly.

"A mutation is a change in the nucleotide or amino acid sequence of a wild-type polypeptide. The present invention describes a mutation or change in the wild-type CTLA4 extracellular domain. Wild-type CTLA4 sequence changes include conservative and non-conserved changes. The change may be an amino acid change and include substitutions, deletions, additions, or truncations. A mutant molecule may have one or more mutations. Mutations in the nucleotide sequence may or may not result in a mutation in the amino acid sequence as is known in the art. In this regard, certain nucleotide codons code for the same amino acid. Examples include the nucleotide codons CGT, CGG, CGC, and CGA encoding the amino acid arginine (R); or GAT and GAC codons encoding the amino acid aspartic acid (D). Thus, a protein may be encoded by one or more nucleic acid molecules that differ in the specific nucleotide sequence but still encode protein molecules having identical sequences. The amino acid coding sequences are as follows:

<td>Amino acid</td><td>Symbol</td><td>Symbol single letter</td><td>Codons</td>

<td> 1</td><td> 2</td><td> 3</td><td> 4</td>

<td>Alanine</td><td>Ala</td><td>AND</td><td>GCU, GCC, GCA, GCG</td>

<td>Cysteine</td><td>Cys</td><td>C.</td><td>UGU, UGC</td>

<td>Aspartic acid</td><td>Asp</td><td>D</td><td>GAU, GAC</td>

<td>Glutamic acid</td><td>Glu</td><td>E.</td><td>GAA, GAG</td>

<td>Phenyl alanine</td><td>Phe</td><td>F.</td><td>UUU, UUC</td>

<td>Glycine</td><td>Gly</td><td>G.</td><td>GGU, GGC, GGA, GGG</td>

<td>Histidine</td><td>His</td><td>H.</td><td>CAU, CAC</td>

<td>Isoleucine</td><td>De</td><td>AND</td><td>AUU, AUC, AUA</td>

<td>Lysine</td><td>Lys</td><td>K.</td><td>AAA, AAG</td>

<td>Leucine</td><td>Leu</td><td>L.</td><td>UUA, UUG, CUU, CUC, CUA, CUG</td>

<td>Methionine</td><td>Underworld</td><td>M.</td><td>AUG</td>

<td>Asparagine</td><td>Asn</td><td>N</td><td>AAU, AAC</td>

<td>Proline</td><td>Pro</td><td>P.</td><td>CCU, CCC, CCA, CCG</td>

<td>Glutamine</td><td>Main</td><td>Q</td><td>CAA, CAG</td>

<td>Arginine</td><td>Arg</td><td>R</td><td>CGU, CGC, CGA, CGG, AGA, AGG</td>

<td>Serine</td><td>Cheese</td><td>S.</td><td>UCU, UCC, UCA, UCG, AGU, AGC</td>

To be continued

<td> 1</td><td> 2</td><td> 3</td><td> 4</td>

<td>Threonine</td><td>Thr</td><td>T.</td><td>ACU, ACC, ACA, ACG</td>

<td>Valine</td><td>Val</td><td>V</td><td>GUU, GUC, GUA, GUG</td>

<td>Tryptophan</td><td>Trp</td><td>IN</td><td>UGG</td>

<td>Tyrosine</td><td>Tyr</td><td>Y</td><td>U AU, U AC</td>

"L104EA29YIg is a fusion protein that is a soluble CTLA4 mutant molecule comprising the wild-type CTLA4 extracellular domain having amino acid changes A29Y (tyrosine amino acid residue replaces alanine at position 29) and L104E (glutamic acid amino acid residue replaces leucine at position +104) which binds the B7 molecule linked to the Ig tail (included in Fig. 3; The DNA encoding L104EA29YIg was deposited with the American Type Culture Collection on June 20, 2000 and has been assigned ATCC accession number PTA-2104). Soluble L104EA29YIg molecules used in the use of the invention may or may not contain a signal (leader) peptide sequence. Typically, these molecules do not contain signal peptide sequences.

A mutant molecule may have one or more mutations. As used herein, "non-CTLA4 protein sequence or" non-CTLA4 molecule "means any molecule that does not bind B7 and does not interfere with CTLA4 binding to its target. An example includes, but is not limited to, an immunoglobulin (Ig) constant region or a portion thereof. Preferably, the Ig constant region is a human or simian Ig constant region, e.g., human C (gamma) 1, including the hinge, CH2 and CH3 regions. The Ig constant region can be mutated to reduce its effector functions (US Patent Nos. 5,637,481; and 6,132,992).

A "fragment or" portion means any portion or segment of a molecule, e.g., CTLA4 or CD28, preferably the extracellular domain of CTLA4 or CD28, or a portion or segment thereof, that recognizes and binds to its target, e.g., a B7 molecule.

"B7 refers to the B7 family of molecules including, B7-1 (CD80) (Freeman et al., 1989, J Immunol. 143: 2714-2722; B7-2 (CD86) (Freeman et al., 1993, Science 262: 909-). 911; Azuma et al., 1993, Nature 366: 76-79, which can recognize and bind CTLA4 and / or CD28.

"CD28 refers to a molecule that recognizes and binds B7 as described in US Serial Nos. 5,580,756 and 5,521,288 (incorporated herein by reference in its entirety).

"B7 positive cells are all cells which express one or more types of B7 molecules on the cell surface.

"Derivative" means a molecule that shares the similarity and activity of its parent molecule. For example, a CTLA4 derivative comprises a soluble CTLA4 molecule having at least 70% amino acid sequence similarity in the wild-type CTLA4 extracellular domain, and which recognizes and binds B7, e.g., CTLA4Ig or the soluble CTLA4 mutant molecule, L104EA29YIg.

"To block or" inhibit a receptor, signal, or molecule "means to interfere with the activation of a receptor, signal, or molecule as detected by assays known in the art. For example, blockade of a cell-mediated immune response can be detected by determining the reduction of symptoms associated with rheumatic disease. The blockage or inhibition may be partial or complete.

"Blocking B7 interactions means interfering with the binding of B7 to its ligands such as CD28 and / or CTLA4, thereby stopping the interaction of T cells and B7 positive cells." Examples of agents that block B7 interactions include, but are not limited to, molecules such as antibodies (or a portion or derivative thereof) that recognize and bind to each of the CTLA4, CD28, or B7 molecules (e.g. B7-1, B7-2); the soluble form (or a portion or derivative thereof) of molecules such as soluble CTLA4; a peptide fragment or other small molecule designed to interfere with cellular signal through CTLA4 / CD28 / B7 interaction. In a preferred embodiment, the blocking agent is a soluble CTLA4 molecule such as CTLA4Ig (ATCC 68629) or L104EA29YIg (ATCC PTA-2104), a soluble CD28 molecule such as CD28Ig (ATCC 68628), a soluble B7 molecule such as B7Ig (ATCC 68627) ), an anti-B7 monoclonal antibody (e.g. ATCC HB-253, ATCC CRL-2223, ATCC CRL-2226, ATCC HB-301, ATCC HB-11341 and monoclonal antibodies as described in references 82-83) and / or a monoclonal antibody anti-CC28 (e.g.

PL 204 899 B1

ATCC HB 11944 and mAb 9.3 as described by Hansen (Hansen et al., 1980. Immunogenetics 10: 247-260) or Martin (Martin et al., 1984, J.Clin.Immun. 4 (1): 18-22)).

"Immune system disease" means any disease mediated by T-cell interaction with B7-positive cells, including autoimmune diseases, transplant related diseases, and immunoproliferative diseases. Examples of immune system diseases include graft versus host disease (GVHD) (e.g. such as may result from bone marrow transplantation or induction of tolerance), immune disorders associated with transplant rejection, chronic rejection, and tissue or cellular allo- or xenografts involving solid organs, skin, islets, muscles, liver cells, neurons. Examples of immunoproliferative diseases include, but are not limited to, psoriasis, T cell lymphoma, T cell acute lymphoblastic leukemia, central vascular T cell lymphoma, benign lymphocytic vasculitis, lupus (e.g., lupus erythematosus, lupus nephritis), Hashimoto's thyroiditis , primary myxedema, Graves' disease, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, diabetes mellitus (e.g. insulin-dependent diabetes, type I diabetes, type II diabetes), Good Pasture's syndrome, myastenia gravis, pemphigus, Crohn's disease, sympathetic uveitis, autoimmune uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, chronic hepatitis, ulcerative colitis, Sjogren's syndrome, rheumatic diseases (e.g. rheumatoid arthritis), polymyositis, scleroderma and mixed connective tissue disease.

The subject includes, without limitation, human, non-human primates (e.g., ape), sheep, rabbit, pig, dog, cat, mouse, or rat.

"A tissue transplant is defined as the tissue of all or part of an organ that is transplanted into the subject recipient. In some embodiments, the tissue is derived from one or more solid organs. Examples of tissues or organs include, but are not limited to, skin, heart, lung, pancreas, liver, bone marrow, pancreatic islet cells, multi-directional stem cells, cell suspensions, and genetically engineered cells. The tissue can be removed from a subject donor or it can be cultured in vitro. The transplant may be an autograft, isograft, allograft, or xenograft, or a combination thereof.

“Graft rejection is defined as the near-complete or complete loss of viable graft tissue by the subject recipient.

"Encapsulation is defined as the process of the immuno-isolation of cells and / or cell groups by which substances, eg insulin, are produced and secreted for the medical use of these preparations." The encapsulation process involves placing the cells and / or cell groups within the semipermeable barrier prior to transplantation to avoid rejection by the immune system. The molecular weight of the encapsulating membrane cutoff can be controlled during the encapsulation process so as to disable inward diffusion and complement lytic factors, but allow for the passage of smaller molecules such as glucose and insulin. Encapsulation allows islet cells to respond physiologically to changes in blood glucose levels, but prevents contact with components of the immune system. Methods for encapsulating pancreatic islet cells are described in US Patent No. 6,080,412.

"Ligand refers to a molecule that specifically recognizes and binds to another molecule, eg, the ligand for CTLA4 is CD80 and / or CD86."

"The soluble ligand that recognizes and binds the CD80 and / or CD86 antigen includes ligands such as CTLA4Ig, CD28Ig or other soluble forms of CTLA4 and CD28; recombinant CTLA4 and CD28; CTLA4 mutant molecules such as L104EA29YIg; and any antibody molecule, fragment thereof, or recombinant binding protein that recognizes and binds a CD80 and / or CD86 antigen. These agents are also considered "immunosuppressants."

“The costimulatory pathway is defined as the biochemical pathway resulting from the interaction of costimulatory signals on T cells and antigen presenting cells (APCs). Costimulatory signals help determine the magnitude of the immune response to the antigen. One costimulatory signal is provided by interaction with CD28 and CTLA4 T cell receptors with CD80 and / or CD86 molecules on APC.

CD80 and / or CD86 includes B7-1 (also called CD80), B7-2 (also called CD86), B7-3 (also called CD74) and the B7 family, e.g. the combination of B7-1, B7- 2 and / or B7-3.

"Costimulatory blockade is defined as a protocol for administering to a subject one or more agents that disrupt or block the costimulatory pathway, as described above. Examples of agents that disrupt costimulatory blockade include, but are not limited to, soluble CTLA4, mutant CTLA4, soluble CD28, anti-B7 monoclonal antibodies (mAbs), soluble CD40, and anti-gp39 mAbs. In one embodiment, L104EA29YIg is a beneficial agent that interferes with costimulatory blockade.

"T cell depleted bone marrow is termed bone marrow removed from bone that has been exposed to the anti T cell protocol. The anti T cell protocol is termed T cell removal procedure from bone marrow. Methods for selectively removing T cells are well known in the art. An example of an anti-T cell protocol is the exposure of the bone marrow to a T cell specific antibody, wherein the antibodies are cytotoxic to the T cells. Alternatively, the antibodies can be conjugated to magnetic particles allowing the removal of T cells from the bone marrow using a magnetic field. Another example of an anti-T cell protocol is the exposure of bone marrow T cells to anti-lymphocyte serum or anti-thymocyte globulin.

"The dose of T cell depleted bone marrow inducing tolerance is defined as the subsequent dose of T cell depleted bone marrow administered to a subject to inactivate potentially donor reactive T cells."

"The implanting dose of T cell depleted bone marrow is defined as the subsequent dose of T cell depleted bone marrow that is administered to a subject to establish mixed hematopoietic chimerism. The implanting dose of the T cell depleted bone marrow will therefore be administered after the tolerance inducing dose of the cell depleted bone marrow.

'Mixed hematopoietic chimerism is defined as the presence of the daughter and recipient's daughter and recipient blood cells (e.g., blood-derived cells) in the absence (or undetectable) of an immune response.

"Donor-recipient pairings are determined by molecular typing using a panel of predetermined major histocompatibility complex alleles (Class 8 I and Class II) (Lobashevsky A, et al., Tissue Antigens 54: 254-263 (1999); Knapp LA et al, Tissue Antigens 50: 657-661 (1997); Watkins DI Crit Rev Immunol 15: 1-29 (1995)). Pairings maximized the difference in both Class I and II loci.

"Administering or" administration to the subject includes, without limitation, intravenous (iv) administration, intraperitoneal (ip) administration, intramuscular (im) administration, subcutaneous administration, oral administration, administration as a suppository or by topical contact, or implantation of a slow-release device such as like a mini-osmotic pump.

"A pharmaceutically acceptable carrier includes any material that, when combined with the reactive agent, retains the biological activity of the reactive agent, e.g., binding specificity, and does not react with the subject's immune system. Examples include, but are not limited to, any of the standard pharmaceutical carriers such as phosphate buffered saline, water, emulsions such as an oil / water emulsion, and various types of moisturizers. Other carriers may also include sterile solutions, tablets, combination with coated tablets and capsules. Typically, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or its salts, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols or other known excipients. Compositions containing such carriers are prepared by well-known, conventional methods.

"Immunosuppressants are defined as a composition having one or more types of molecules that either prevent the occurrence of an immune response or suppress the immune system of a subject." Preferably, the agents reduce or prevent T cell proliferation. Certain agents can inhibit T cell proliferation by inhibiting T cell interaction with other antigen presenting cells (APCs). An example of an APC is the B cell. Examples of agents that interfere with T cell interaction with APC, and thus inhibit T cell proliferation, include, without limitation, soluble CTLA4, soluble CTLA4 mutant, soluble CD28, or monoclonal antibodies that recognize and bind CD80 and / or CD86 antigens, or thereto. fragments. A preferred agent is L104EA29YIg. Ligands for the CTLA4 or CD28 antigens include monoclonal12 antibodies

Those which recognize and bind CD80 and / or CD86 antigens, or fragments thereof. Other ligands for CTLA4 or CD28 include soluble CD80 and / or CD86 molecules such as CD80 and / or CD86Ig. Those skilled in the art will readily understand that other agents or ligands can be used to inhibit the interaction of CD28 with CD80 and / or CD86.

Immunosuppressants include methotrexate, cyclophosphamide, cyclosporin, cyclosporin A, chloroquine, hydroxychloroquine, sulfasalazine (sulfosalazopyrine), gold salts, D-penicillamine, leflunomide, azathioprine, anakinra, infliximab (REMICADE^r), etanercept, TNFα blockers, a biological agent that integrates into an inflammatory cytokine, and non-steroidal anti-inflammatory drugs (NSAIDs). NSAIDs include, without limitation, acetylsalicylic acid, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclfenamate, naproxen, nabumetone, phenylbutazone, prioxicam, sulindac, tolmetadol, and Coxuprofen, inhibitors and Coxuprofen, inhibitors and Coxuprofen.

CTLA4 molecules, with mutant or wild-type sequences, can be made soluble by deleting the CTLA4 transmembrane segment (Oaks, MK et al., 2000 Cellular Immunology 201: 144-153).

Alternatively, the soluble CTLA4 molecules, with mutant or wild-type sequences, can be fusion proteins in which the CTLA4 molecules are fused to non-CTLA4 molecules, such as immunoglobulin (Ig) molecules that render the CTLA4 molecules soluble. For example, a CTLA4 fusion protein can include a CTLA4 extracellular domain fused to an immunoglobulin constant domain to form the CTLA4Ig molecule (Figure 2) (Linsley, PS et al., 1994, Immunity 1: 793-80).

For clinical protocols it is preferred that the immunoglobulin region does not induce a deleterious immune response in a subject. The preferred moiety is an immunoglobulin constant region, including human or monkey immunoglobulin constant regions. An example of a suitable immunoglobulin region is human Cy1, including the hinge, CH2 and CH3 regions, which can mediate effector functions such as binding to Fc receptors, mediating complement dependent cytotoxicity (CDC), or mediate cell-mediated cytotoxicity. antibodies (ADCC). The immunoglobulin particle can include one or more mutations (e.g. in a CH2 domain, to reduce effector functions such as CDC or ADCC), where the mutation modulates the ability of the immunoglobulin to bind to its ligand by increasing or decreasing the ability of the immunoglobulin to bind to Fc receptors. For example, mutations in an immunoglobulin can include changes to any or all of the cysteine ​​residues in the hinge domain, e.g., the cysteines at positions +130, +136, and +139 are serine-substituted (Figure 24). The immunoglobulin molecule may also contain proline at position +148 with a serine displacement as shown in Figure 24. Further, mutations in the immunoglobulin moiety may include a leucine substitution at position +144 with phenylalanine, a leucine substitution at position +145 with glutamic acid, or a glycine substitution at position +147 alanine.

Additional non-CTLA4 particles for use in soluble CTLA4 molecules or soluble CTLA4 mutant molecules include, but are not limited to, a p97 molecule, an env gp120 molecule, an E7 molecule, and an ova molecule (Dash, B. et al., 1994 J. Gen. Virol. 75 (Pt6): 1389-97; Ikeda, T. et al., 1994 Gene 138 (1-2): 193-6; Falk, K. et al., 1993 Cell. Immunol. 150 (2): 447-52; Fujisaka, K. et al. 1994 Virology 204 (2): 789-93). Other molecules are also possible (Gerard, C. et al., 1994 Neuroscience 62 (3): 721; Byrn, R. et al. 1989 63 (10): 4370; Smith, D. et al. 1987 Science 238: 1704; Lasky, L. 1996 Science 233: 209).

The present invention describes a soluble CTLA4 molecule comprising a signal peptide sequence linked to the N-terminus of the extracellular domain of the CTLA4 portion of the molecule. The signal peptide may be any sequence which will allow secretion of the molecule, including the signal peptide from Oncostatin M (Malik, et al. (1989) Molec.Cell. Biol. 9: 2847-2853) or CD5 (Jones, NH et al., (1986) Nature 323: 346-349) or a signal peptide from any extracellular protein. A soluble CTLA4 molecule used in accordance with the invention may include an oncostatin M signal peptide fused to the N-terminus of the CTLA4 extracellular domain and a human immunoglobulin molecule (e.g., hinge, CH2 and CH3) fused to the C-terminus of an extracellular domain (wild type or mutant ) CTLA4. This molecule comprises the oncostatin M signal peptide comprising an amino acid sequence having a methionine at position -26 to an alanine at position -1, a portion of CTLA4 comprising an amino acid sequence having a methionine at position +1 to aspartic acid at position +124, a nodal amino acid residue, methionine at position +125, and an immunoglobulin portion comprising an amino acid sequence having glutamic acid at position +126 to lysine at position +357.

In one embodiment, the soluble CTLA4 mutant molecules of the invention, including the mutant CTLA4 sequences described below, are fusion molecules containing human IgC (gamma) 1 (or IgCY1) particles fused to mutant CTLA4 fragments. The soluble CTLA4 mutant molecules can contain one or more mutations (e.g., amino acid substitutions, deletions, or insertions) in the CTLA4 extracellular domain.

For example, the soluble CTLA4 mutant molecules may contain a mutation or mutations within or in close proximity to the serine region at position +25 to arginine at position +33 (e.g., S25-R33, using standard single letter amino acid symbols). The mutant CTLA4 molecules can include an amino acid substitution at any one or more of the following positions: S25, P26, G27, K28, A29, T30, E31, or R33.

In another embodiment, the soluble CTLA4 mutant molecules may include a mutation or mutations within or in close proximity to the region encompassed by glutamic acid at position +95 to glycine at position +107 (e.g., E95-G107). The mutant CTLA4 molecules can include an amino acid substitution at any one or more of the following positions: K93, L96, M97, Y98, P99, P100, P101, Y102, Y103, L104, G105, I106, and G107.

Additionally, the invention describes soluble CTLA4 mutant molecules having a mutation or mutations within or in close proximity to the region encompassed by asparagine +108 to isoleucine at position +115 (e.g., N108-I115). The mutant CTLA4 molecules can include an amino acid substitution at any one or more of the following positions: L104, G105, I106, G107, Q11, Y113, or I115.

In one embodiment, the soluble CTLA4 mutant molecules contain IgCY1 fused to a CTLA4 fragment comprising a single site mutation in the extracellular domain. The CTLA4 extracellular domain includes methionine at the +1 position to aspartic acid at the +124 position (e.g., Figure 1). The extracellular portion of CTLA4 may contain an alanine at the -1 position to an aspartic acid at the +124 position (e.g., Fig. 1).

Examples of single site mutations include the following with the leucine at position +104 being replaced with any other amino acid:

<td>Single Place Mutant:</td><td>Codon change:</td>

<td>L104EIg</td><td>Glutamic acid GAG</td>

<td>L104SIg</td><td>AGT serine</td>

<td>L104Tig</td><td>ACG threonine</td>

<td>L104AIg</td><td>Alanine GCG</td>

<td>L104WIg</td><td>Tryptophan TGG</td>

<td>L104QIg</td><td>Glutamine CAG</td>

<td>L104KIg</td><td>AAG Lysine</td>

<td>L104RIg</td><td>Arginine CGG</td>

<td>L104GIg</td><td>Glycine GGG</td>

Additionally, the invention provides mutant molecules having a CTLA4 extracellular domain with two mutations fused to an IgCY1 molecule. Examples include the following wherein leucine at position +104 is replaced with another amino acid (e.g. glutamic acid) and glycine at position +105, serine at position +25, threonine at position +30 or alanine at position +29 is replaced with any other amino acid:

PL 204 899 B1

<td>Double Place Mutants:</td><td>Codon change:</td>

<td>L104EG105FIg</td><td>Phenylalanine TTC</td>

<td>L104EG105WIg</td><td>Tryptophan TGG</td>

<td>L104EG105LIg</td><td>Leucine CTT</td>

<td>L104ES25RIg</td><td>Arginine CGG</td>

<td>L104ET30GIg</td><td>Glycine GGG</td>

<td>L104ET30NIg</td><td>Asparagin AAT</td>

<td>L104EA29YIg</td><td>Tyrosine TAT</td>

<td>L104EA29LIg</td><td>Leucine TTG</td>

<td>L104EA29TIg</td><td>Threonine ACT</td>

<td>L104EA29WIg</td><td>Tryptophan TGG</td>

Still further, the invention provides mutant molecules having a CTLA4 extracellular domain comprising three mutations, fused to an Ig Cy1 particle. Examples include the following whereby the leucine at position +104 is replaced with a different amino acid (e.g., glutamic acid), the alanine at position +29 is replaced with a different amino acid (e.g., tyrosine), and the serine at position +25 is replaced with a different amino acid :

<td>Three-place mutants:</td><td>Codon changes:</td>

<td>L104EA29YS25KIg</td><td>AAA Lysine</td>

<td>L104EA29YS25KIg</td><td>AAG Lysine</td>

<td>L104EA29YS25NIg</td><td>Asparagin AAC</td>

<td>L104EA29YS25RIg</td><td>Arginine CGG</td>

The soluble CTLA4 mutant molecules can have a linkage amino acid residue that is positioned between the CTLA4 portion and the Ig portion of the molecule. The junction amino acid can be any amino acid, including glutamine. The linkage amino acid can be introduced by molecular or chemical synthesis by methods known in the art.

The invention describes soluble CTLA4 mutant molecules comprising a single site mutation in the extracellular domain of CTLA4, such as L104EIg (as set forth in Figure 19) or L104SIg, where L104EIg and L104SIg are mutated in CTLA4 sequences such that leucine at position +104 is substituted , respectively glutamic acid or serine. Molecules with single-site mutations additionally contain CTLA4 portions including methionine at position +1 to aspartic acid at position +124, a linking amino acid residue, glutamine at position +125, and an immunoglobulin portion comprising glutamic acid at position +126 to lysine at position +357 . The immunoglobulin portion of the mutant molecule can also be mutated such that the cysteines at positions +130, +136, and +139 are substituted with serine, and the proline at position +148 is substituted with serine. Alternatively, the soluble single-site mutant CTLA4 molecule can have a CTLA4 portion comprising an alanine at position -1 to aspartic acid at position +124.

The invention discusses soluble CTLA4 mutant molecules comprising mutations at a dual site in the CTLA4 extracellular domain such as L104EA29YIg, L104EA29LIg, L104EA29TIg or L104EA29WIg wherein the leucine at position +104 is substituted with glutamic acid and alanine is substituted at position +29, respectively. tyrosine, leucine, threonine and tryptophan. The sequences for L104EA29YIg, L104EA29LIg, L104EA29TIg or L104EA29WIg, starting with methionine at +1 and ending with lysine at +357, plus the signal (leader) peptide sequence are provided in the sequences shown in Figures 3 and 20-22, respectively. Double-site mutant molecules include CTLA4 portions containing methionine at position +1 to aspartic acid at position +124, amino acid residue glutamine at position +125, and an immunoglobulin portion comprising glutamic acid at position +126 to lysine at position +124. position +357. The immunoglobulin portion of the mutant molecule can be mutated such that the cysteines at positions +130, +136, and +139 are substituted with serine, and the proline at position +148 is substituted with serine. Alternatively, these mutant molecules may have a CTLA4 portion comprising alanine at position -1 to aspartic acid at position +124.

The invention describes soluble CTLA4 mutant molecules containing a double site mutation in the CTLA4 extracellular domain, such as L104EG105FIg, L104EG105WIg and L104EG105LIg, wherein the leucine at position +104 is substituted with glutamic acid and the glycptin at position +105 is substituted with phenyl, respectively, and leucine. Double-site mutant molecules include CTLA4 portions containing methionine at position +1 to aspartic acid at position +124, linking amino acid residue glutamine at position +125, and an immunoglobulin portion comprising glutamic acid at position +126 to lysine at position +357. The immunoglobulin portion of the mutant molecule can be mutated such that the cysteines at positions +130, +136, and +139 are substituted with serine, and the proline at position +148 is substituted with serine. Alternatively, these mutant molecules may have a CTLA4 portion comprising alanine at position -1 to aspartic acid at position +124.

The invention describes L104ES29RIg which is a dual site mutant molecule comprising a CTLA4 portion containing a methionine at position +1 to aspartic acid at position +124, a linking amino acid residue, glutamine at position +125, and an immunoglobulin portion containing glutamic acid at position +126 to lysine at position +357. The portion containing the extracellular domain of CTLA4 is mutated such that the serine at position +25 is substituted with arginine and the leucine position at position +104 is substituted with glutamic acid. Alternatively, L104ES29RIg can have a CTLA4 portion comprising alanine at position -1 to aspartic acid at position +124.

The invention describes soluble CTLA4 mutant molecules containing a double site mutation in the CTLA4 extracellular domain, such as L104ET30GIg and L104ET30NIg, wherein the leucine at position +104 is substituted with glutamic acid and the threonine at position +30 is substituted with glycine or asparagine, respectively. Double-site mutant molecules further include CTLA4 portions containing methionine at position +1 to aspartic acid at position +124, linking amino acid residue glutamine at position +125, and an immunoglobulin portion containing glutamic acid at position +126 to lysine at position + 357. The immunoglobulin portion of the mutant molecule can also be mutated such that the cysteines at positions +130, +136, and +139 are substituted with serine, and the proline at position +148 is substituted with serine. Alternatively, these mutant molecules may have a CTLA4 portion spanning alanine -1 to aspartic acid at position +124.

The invention provides soluble CTLA4 mutant molecules comprising a triple site mutation in the CTLA4 extracellular domain such as L104EA29YS25KIg, L104EA29YS25NIg, L104EA29YS25RIg wherein the leucine at position +104 is substituted with glutamic acid, alanine at position +29 is substituted with tyrosine and 25 is changed to lysine, asparagine or arginine, respectively. Triple-site mutant molecules further include CTLA4 portions containing methionine at position +1 to aspartic acid at position +124, linking amino acid residue glutamine at position +125, and an immunoglobulin portion containing glutamic acid at position +126 to lysine at position +357 . The immunoglobulin portion of the mutant molecule can also be mutated such that the cysteines at positions +130, +136, and +139 are substituted with serine, and the proline at position +148 is substituted with serine. Alternatively, these mutant molecules may have a CTLA4 portion spanning alanine -1 to aspartic acid at position +124.

Other embodiments of soluble CTLA4 mutant molecules include chimeric CTLA4 / CD28 mutant homolog molecules that bind B7 (Peach, RJ et al., 1994 J. Exp. Med. 180: 204 9-2058). Examples of these CTLA4 / CD28 mutant chimeric molecules include HS1, HS2, HS3, HS4, HS5, HS6, HS4A, HS4B, HS7, HS8, HS9, HS10, HS11, HS12, HS13, and HS14 (US Patent No. 5,773,253) .

Preferred embodiments of the invention are soluble CTLA4 molecules such as CTLA4Ig (as shown in Figure 2, starting with methionine at +1 position and ending with lysine at position +357) and soluble CTLA4 mutant L104EA29YIg (as shown in Figure 3, starting with methionine at position +1 and ending c with lysine at position +357).

PL 204 899 B1

The invention further provides nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequences corresponding to the soluble CTLA4 molecules of the invention. In one embodiment, the nucleic acid molecule is DNA (e.g., cDNA) or a hybrid thereof. The DNA encoding CTLA4Ig (Figure 2) was deposited on May 31, 1991 with the American Type Culture Collection (ATCC) 10801 University Blvd., Manassas, VA 20110-2209 and has been assigned ATCC accession number 68629. The DNA encoding L104EA29YIg (sequence set out in Figure 3) was deposited on June 19, 2000 with the ATCC and has been granted ATCC accession number PTA-2104. Alternatively, the nucleic acid molecules are RNA or a hybrid thereof.

CTLA4 hybrids

The present invention describes soluble CTLA4 mutant molecules comprising at least the extracellular domain of CTLA4, or a portion thereof, that binds CD80 and / or CD86. The extracellular portion of CTLA4 includes methionine at the +1 position to aspartic acid at the +124 position (e.g., Fig. 1). The extracellular portion of CTLA4 may include the alanine at the -1 position to the aspartic acid at the +124 position (e.g., Figure 1). The extracellular portion of CTLA4 may include glutamic acid at position +95 to cysteine ​​at position +120. The extracellular portion of CTLA4 may include methionine at position +1 and glutamic acid at position +95 to aspartic acid at position +122. The extracellular portion of CTLA4 may include methionine at position +1 to tyrosine at position +23 and valine at position +32 to aspartic acid at position +122. The extracellular portion of CTLA4 may include alanine at position +24 to glutamic acid at position +31 and glutamic acid at position +95 to isoleucine at position +112. The extracellular portion of CTLA4 may include alanine at position +24 to glutamic acid at position +31 and tyrosine at position +113 to aspartic acid at position +122. The extracellular portion of CTLA4 may include alanine at position +50 to glutamic acid at position +57 and glutamic acid at position +95 to aspartic acid at position +122. The extracellular portion of CTLA4 may include alanine at position +24 to glutamic acid at position +31; alanine at position +50 to glutamic acid at position +57; and glutamic acid at position +95 to aspartic acid at position +122. The extracellular portion of CTLA4 may include alanine at position +50 to glutamic acid at position +57 and glutamic acid at position +95 to isoleucine at position +112. The extracellular portion of CTLA4 may include alanine at position +24 to glutamic acid at position +31; alanine at position +50 to glutamic acid at position +57; and glutamic acid at position +95 to aspartic acid at position +122. The extracellular portion of CTLA4 may include the alanine at position +24 to the valine at position +94. The extracellular portion of CTLA4 may include alanine at position -1 to cysteine ​​at position +21. The extracellular portion of CTLA4 may include the methionine at the +1 position to the cysteine ​​at the +21 position. The extracellular portion of CTLA4 may include glutamic acid at position +95 to aspartic acid at position +122. The extracellular portion of CTLA4 may include the alanine at the -1 position to the valine at the +94 position. The extracellular portion of CTLA4 may include the methionine at the +1 position to the valine at the +94 position. The extracellular portion of CTLA4 may include alanine at position +24 to glutamic acid at position +31. The extracellular portion of CTLA4 may include the alanine at the -1 position to the tyrosine at the +23 position. The extracellular portion of CTLA4 may include the methionine at the +1 position to the tyrosine at the +23 position. The extracellular portion of CTLA4 may include valine at position +32 to aspartic acid at position +122. The extracellular portion of CTLA4 may include glutamic acid at position +95 to isoleucine at position +112. The extracellular portion of CTLA4 may include alanine at position +50 to glutamic acid at position +57.

Methods of Producing CTLA4 Mutant Molecules

CTLA4 mutant molecules can be expressed in prokaryotic cells. Most often, prokaryotic organisms are represented by various strains of bacteria. The bacteria can be gram positive or gram negative. Other microbial strains can also be used.

Sequences encoding CTLA4 mutant molecules can be inserted into a vector designed to express foreign sequences in prokaryotic cells such as E. coli. These vectors may include commonly used prokaryotic control sequences, which are defined herein to include transcription initiation promoters, optionally with an operator, together with ribosome binding site sequences, including such commonly used promoters as beta lactamase (penicillinase) and lactose (lac) promoter systems. ) (Chang, et al. (1977) Nature 198: 1056),

PL 204 899 B1 tryptophan (trp) promoter system (Goeddel, et al. (1980) Nucleic Acids Res. 8: 4057) and lambda-derived PL promoter and N-gene ribosome binding site (Shimatake, et al., (1981) Nature 292: 128).

Such expression vectors will also include origins of replication and selectable markers such as the beta-lactamase or neomycin phosphotransferase gene conferring resistance to antibiotics so that vectors that can replicate in bacteria and plasmid-bearing cells can be selected during cultivation in the presence of antibiotics such as ampicillin or kanamycin.

The expression plasmid can be introduced into prokaryotic cells by a variety of standard methods, including but not limited to CaCl2 shock (Cohen, (1972) Proc. Natl. Acad. Sci. USA 69: 2110. And Sambrook et al. (Editors) "Molecular Cloning: A Laboratory Manual , 2nd edition, Cold Spring Harbor Press, (1989)) and electroporation.

In accordance with the practice of the invention, eukaryotic cells are also suitable host cells. Examples of eukaryotic cells include any animal cell, whether primary or immortalized, yeast (e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Pichia pastoris), and plant cells. Myeloma cells, COS and CHO are examples of animal cells that can be used as hosts. Particular CHO cells include, but are not limited to, DG44 (Chasin, et al. 1986 Som. Cell. Molec. Genet. 12: 555-556; Kolkekar 1997 Biochemistry 36: 10901-10909), CHO-K1 (ATCC No. CCL-61 ), CHO-K1 Tet-On cell line (Clontech), CHO designated ECACC 85050302 (CAMR, Salisbury, Wiltshire, UK), CHO 13 clone (GEIMG, Genova, IT), CHO clone B (GEIMG, Genova, IT), CHO-K1 / SF designated ECACC 93061607 (CAMR, Salisbury, Wiltshire, UK) and RR-CHOK1 designated ECACC 92052129 (CAMR, Salisbury, Wiltshire, UK). Exemplary plant cells include tobacco (whole plants, cell culture, or callus), corn, soybean, and rice cells. Corn, soybean and rice seeds are also acceptable.

Nucleotide sequences encoding CTLA4 mutant molecules can also be inserted into a vector designed to express foreign sequences in a eukaryotic host. The regulatory elements of the vector may vary according to the particular eukaryotic host. The nucleic acid molecule which encodes L104EA29YIg is contained in pD16 L104EA29YIg and was deposited on June 19, 2000 at the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, VA 20110-2209 (ATCC No. PTA-2104). The vector pD16 L104EA29YIg is derived from the vector pcDNA3 (INVITROGEN).

Commonly used eukaryotic control sequences for use in expression vectors include promoters and control sequences compatible with mammalian cells, such as, for example, the CMV promoter (CDM8 vector) and avian sarcoma virus (ASV) (nLN vector). Other commonly used promoters include the Simian Virus 40 early and late promoters (SV40) (Fiers, et al. (1973) Nature 273: 113), or other viral promoters such as those derived from polyoma, adenovirus 2 and bovine papillomavirus. An inducible promoter such as hMTII (Karin, et al. (1982) Nature 299: 797-802) may also be used.

Vectors for the expression of CTLA4 mutant molecules in eukaryotes may also carry sequences called enhancer regions. They are important in optimizing gene expression and are found either upstream or downstream of the promoter region.

Examples of expression vectors for eukaryotic host cells include, but are not limited to, vectors for mammalian host cells (e.g., BPV-1, pHyg, pRSV, pSV2, pTK2 (Maniatis); pIRES (Clontech); pRc / CMV2, pRc / RSV, pSFV1 (Life Technologies); pVPakc vectors, pCMV vectors, pSG5 vectors (Stratagene), retroviral vectors (e.g. pFB vectors (Stratagene)), pCDNA-3 (Invitrogen) or its modified forms, adenoviral vectors; adenovirus related viral vectors, baculovirus vectors, yeast vectors (e.g. pESC vectors (Stratagene)).

Nucleotide sequences encoding CTLA4 mutant molecules can integrate into the genome of the eukaryotic host cell and replicate with replication of the host genome. Alternatively, the vector carrying the CTLA4 mutant molecules may contain origins of replication allowing for extra-chromosomal replication.

For expression of the nucleic acid sequence in Saccharomyces cerevisiae, the origin of replication of the endogenous yeast plasmid, the 2P circle can be used (Broach, (1983) Meth. Enz. 101: 307). Alternatively, sequences from the yeast genome capable of promoting autonomous replication can be used (see, e.g., Stinchcomb et al. (1979) Nature 282: 39); Tschemper et al. (1980) Gene 10: 157; and Clarke et al. (1983) Meth. Enz. 101: 300).

PL 204 899 B1

Transcriptional control sequences for yeast vectors include promoters for the synthesis of glycolytic enzymes (Hess et al. (1968) J. Adv. Enzyme Reg. 7: 149; Holland et al. (1978) Biochemistry 17: 4900). Other promoters known in the art include the CMV promoter contained in the CDM8 vector (Toyama and Okayama, (1990) FEBS 268: 217-221); 3-phosphoglycerate kinase promoter (Hitzeman et al. (1980) J. Biol. Chem. 255: 2073) and those for other glycolytic enzymes.

Other promoters are inducible because they can be regulated by environmental stimuli or the growth medium of the cells. These inducible promoters include those of the genes for heat shock proteins, alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, enzymes involved in nitrogen catabolism, and enzymes responsible for maltose and galactose utilization.

Regulatory sequences may also be located 3 'to the coding sequence. These sequences can act to stabilize messenger RNA. Such terminators are found in the 3 'untranslated region, downstream of the coding sequences, in several yeast and mammalian genes.

Exemplary vectors for plants and plant cells include, but are not limited to, Agrobacterium Ti plasmids, Cauliflower Mosaic Virus (CaMV), and Tomato Golden Mosaic Virus (TGMV).

General aspects of transforming a mammalian host cell system have been described by Axel (US Patent No. 4,399,216 published August 16, 1983). Mammalian cells can be transformed by methods including, but not limited to, transfection in the presence of calcium phosphate, microinjection, electroporation, or by transduction with viral vectors. Methods for introducing foreign DNA sequences into plant and yeast genomes include (1) mechanical methods, such as microinjecting DNA into single cells or protoplasts, centrifuging glass bead cells in the presence of DNA, or impinging tungsten or gold beads coated with DNA into cells or protoplasts; (2) introducing DNA through the cell membrane made permeable to macromolecules by treatment with polyethylene glycol or by exposure to high voltage electrical pulses (electroporation); or (3) using liposomes (containing cDNA) that fuse with cell membranes.

Expression of CTLA4 mutant molecules can be detected by methods known in the art. For example, mutant molecules can be detected by SDS-PAGE gels with Coomassie staining and immune print using antibodies that bind CTLA4. Protein recovery can be performed using standard protein purification means, e.g., affinity chromatography or ion exchange chromatography, to yield a substantially pure product (R. Scopes in "Protein Purification. Principles and Practice 3rd edition, Springer-Verlag (1994)).

The invention further describes soluble CTLA4 mutant molecules produced by the above-described method.

Codon Based CTLA4Ig Mutagenesis

In one embodiment, site-directed mutagenesis and a new screening procedure are used to identify several mutations in the CTLA4 extracellular domain that improve CD86 avidity. In this embodiment, the mutations were made at residues in the regions of the CTLA4 extracellular domain from serine to arginine 33, the C 'strand (alanine 49 and threonine 51), the F strand (lysine 93, glutamic acid 95, and leucine 96), and the region from methionine 97 to tyrosine 102, tyrosine 103 to glycine 107 and in the G-strand at positions glutamine 111, tyrosine 113, and isoleucine 115. These sites were selected based on studies of CD28 / CTLA4 chimeric fusion proteins (Peach et al., J. Exp. Med., 1994, 180: 2049-2058) and in a model predicting which side chains of amino acid residues would be exposed to solvent and the lack of identity or homology of amino acid residues at certain positions between CD28 and CTLA4. Also, any residue that is in close proximity (5 to 20 Angstrom units) to the identified residues is considered part of the present invention.

To synthesize and screen soluble CTLA4 mutant molecules with altered affinity for CD80 and / or CD86, a two-step strategy was adapted. The experiments involved first generating a mutation library at a specific codon of the extracellular portion of CTLA4, and then screening them by BIAcore analysis to identify mutants with altered reactivity to CD80 or CD86. The Biacore test system (Pharmacia, Piscataway, NJ) uses an array of surface plasmon resonance detectors that essentially involves covalent bonding of either CD80Ig or CD86Ig to a dextran coated sensor plate located in the detector. The test particle can then be injected into the chamber

Containing the sensor plate and estimate the amount of bound complement protein based on the changes in molecular weight that is physically bound to the dextran coated side of the sensor plate; the change in molecular weight can be measured with a detector system.

The invention allows for the preparation of a pharmaceutical composition for use in the treatment of diseases of the immune system comprising pharmaceutically effective amounts of soluble CTLA4 mutant molecules. In some embodiments, immune system diseases are mediated by CD28 and / or CTLA4 positive cellular interactions with CD80 and / or CD86 positive cells. Soluble CTLA4 molecules are preferably soluble CTLA4 molecules with wild-type sequence and / or soluble CTLA4 molecules having one or more mutations in the CTLA4 extracellular domain. The pharmaceutical composition may contain soluble CTLA4 molecules or mutant CTLA4 molecules and / or nucleic acid molecules and / or vectors encoding these molecules. The soluble CTLA4 mutant molecule has the amino acid sequence of the CTLA4 extracellular domain as shown in each Figure 3 (L104EA29Y). The soluble CTLA4 mutant molecule may preferably be -L104EA29YIg as described herein and shown in Figure 3. The compositions may further include other therapeutic agents including immunosuppressants, NSAIDs, corticosteroids, glucocorticoids, drugs, toxins, enzymes, antibodies or conjugates.

An embodiment of the pharmaceutical composition comprises an effective amount of a soluble CTLA4 molecule alone or in combination with an effective amount of at least one therapeutic agent including an immunosuppressive agent or an NSAID.

Effective amounts of soluble CTLA4 in the pharmaceutical composition can range from about 0.1 to 100 mg / kg of the subject's body weight. In another embodiment, an effective amount can be an amount of about 0.5 to 5 mg / kg of the subject's weight, about 5 to 10 mg / kg of the subject's weight, about 10 to 15 mg / kg of the subject's weight, about 15 to 20 mg / kg of the subject's weight. subject weight, about 20 to 25 mg / kg subject weight, about 25 to 30 mg / kg subject weight, about 30 to 35 mg / kg subject weight, about 35 to 40 mg / kg subject weight, about 40 to 45 mg / kg subject weight about 45 to 50 mg / kg subject weight, about 50 to 55 mg / kg subject weight, about 55 to 60 mg / kg of subject weight, about 60 to 65 mg / kg of subject weight, about 65 to 70 mg / kg of subject weight, about 70 to 75 mg / kg of subject weight, about 75 to 80 mg / kg of subject weight, about 80 to 85 mg / kg of subject weight, about 85 to 90 mg / kg of subject weight, about 90 to 95 mg / kg of subject weight, about 95 to 100 mg / kg of subject weight. In an embodiment, an effective amount is 2 mg / kg of subject weight. In an embodiment, an effective amount of soluble CTLA4 molecule is 2 mg / kg of subject weight. In an embodiment, an effective amount of soluble CTLA4 molecule is 10 mg / kg of subject weight.

The amount of immunosuppressive agent administered to a subject varies depending on several factors including drug efficacy for a particular subject and the toxicity (i.e., the tolerability) of the drug by a particular subject.

Methotrexate is commonly administered in amounts of about 0.1 to 40 mg per week, with common dosages in the range of about 5 to 30 mg per week. Methotrexate can be administered to a subject in varying increments: about 0.1 to 5 mg / week, about 5 to 10 mg / week, about 10 to 15 mg / week, about 15 to 20 mg / week, about 20 to 25 mg / week, about 25 to 30 mg / week, about 30 to 35 mg / week, or about 35 to 40 mg / week. In one embodiment, an effective amount of an immunosuppressant, including methotrexate, is an amount of about 10 to 30 mg / week.

Effective amounts of methotrexate are about 0.1 to 40 mg / week. In one embodiment, the effective amount is about 0.1 to 5 mg / week, about 5 to 10 mg / week, about 10 to 15 mg / week, about 15 to 20 mg / week, about 20 to 25 mg / week, about 25 to 30 mg / week, about 30 to 35 mg / week, or about 35 to 40 mg / week. In one embodiment, the methotrexate is administered in an amount of about 10 to 30 mg / week.

Cyclophosphamide, an alkylating agent, can be administered in doses ranging about 1 to 10 mg / kg body weight per day.

Cyclosporin (e.g. NEORAL^R), also known as cyclosporin A, is commonly administered in doses ranging from about 1 to 10 mg / kg body weight per day. Dosages in the range of about 2.5 to 4 mg per body weight are commonly used.

PL 204 899 B1

Chloroquine or hydroxychloroquine (e.g. PLAQUENIL^R), are commonly administered in doses ranging about 100 to 1000 mg per day. Preferred dosages are about 20-600 mg per daily administration.

Sulfasalazine (e.g. AZULFIDINE EN-tabsR) is commonly administered in amounts in the range of about 50 to 5000 mg per day, with a typical dosage of about 2000 to 3000 mg per day for adults. Dosages for children are typically about 5 to 100 mg / kg of body weight, up to 2 grams per day.

Gold salts are developed for two types of administration: injection or oral. Injectable gold salts are commonly prescribed in dosages of about 5 to 100 mg dosed every two to four weeks. Orally administered gold salts are typically prescribed in dosages in the range of about 1 to 10 mg per day.

D-penicillamine or penicillamine (CUPRIMINE^R) are typically administered in doses of about 50 to 2000 mg per day, with preferred doses being about 125 mg per day to 15,000 mg per day.

Azathioprine is usually administered in doses of about 10 to 250 mg per day. Preferred dosages are about 25 to 200 per day.

Anakinra (e.g. KINERET^R) is an interleukin-1 receptor antagonist. The usual dosage range for anakinra is about 10 to 250 mg per day, with a recommended dosage of about 100 mg per day.

Infliximab (REMICADE^R) is a chimeric monoclonal antibody that binds to tumor necrosis factor alpha (TNF?). Infliximab is usually given at doses of approximately 1 to 20 mg / kg body weight every four to eight weeks. Dosages of about 3 to 10 mg / kg body weight may be administered every four to eight weeks depending on the subject.

Etanercept (e.g. ENBREL^R) is a dimeric fusion protein that binds tumor necrosis factor (TNF) and blocks interactions with TNF receptors. Commonly administered doses of etanercept are about 10 to 100 mg per week for adults with 50 mg per week being preferred. Dosages for adolescents are about 0.1 to 50 mg / kg body weight per week, with a maximum of about 50 mg per week.

Leflunomide (ARAVA^R) is commonly administered in doses of about 1 and 100 mg per day. The usual daily dose is about 10 to 20 mg per day.

The pharmaceutical compositions preferably also contain suitable carriers and adjuvants, including any material that when combined with a molecule of the invention (e.g., a soluble CTLA4 mutant molecule, e.g., L104EA29YIg), retains the activity of the molecule and is not reactive with the subject's immune system. Examples of suitable carriers and adjuvants include, but are not limited to, human serum albumin; ion exchangers; alumina; lecithin; buffer substances such as phosphates; glycine; sorbic acid; potassium sorbate; and salts or electrolytes such as protamine sulfate. Other examples include any of the standard pharmaceutical carriers such as phosphate buffered saline; water; emulsions such as an oil / water emulsion; and various types of moisturizers. Other carriers may also include sterile solutions; tablets, including coated tablets and capsules. Typically, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or its salts, calcium or magnesium stearate, talc, vegetable fats or oils, gums, glycols or other known excipients. Such carriers may also include flavorings or dyes or other ingredients. Compositions containing such carriers are prepared by well-known, conventional methods. Such compositions may also be formulated into various fatty compositions such as, e.g., liposomes, as well as into various polymeric compositions, such as polymer microspheres.

The pharmaceutical compositions can be administered using conventional modes of administration including, but not limited to, intravenous (iv) administration, intraperitoneal (ip) administration, intramuscular (im) administration, subcutaneous administration, oral administration, administration by suppository or by topical contact, or implanting a slow-release device into the subject, such as a mini-osmotic pump.

The pharmaceutical compositions can be in a variety of dosage forms, including, but not limited to, liquid solutions or suspensions, tablets, pills, powders, suppositories, polymer microcapsules or microbubbles, liposomes, and injection or infusion solutions. The preferred form depends on the mode of administration and therapeutic application.

PL 204 899 B1

The most effective mode of administration and dosing regimen for the above compositions depends on the severity and course of the disease, the patient's health and response to treatment, and the judgment of the treating physician. Accordingly, the dosage of the compositions should be titrated to the individual patient.

The soluble CTLA4 mutant molecules can be administered to a subject in an amount and for a period of time (e.g., a length of time and / or a multiple of time) sufficient to block the subject from binding endogenous B7 molecules (e.g., CD80 and / or CD86) to their respective ligands. Blocking endogenous B7 / ligand binding thereby inhibits interactions between B7-positive cells (e.g., CD80- and / or CD86-positive cells) and CD28- and / or CTLA4-positive cells. The dosage of the therapeutic agent depends on many factors including, but not limited to, the type of diseased tissue, the type of autoimmune disease being treated, the severity of the disease, the subject's health, and the subject's response to treatment with the agents. Accordingly, dosages of the agents may vary depending upon the subject and the mode of administration. The soluble CTLA4 mutant molecules can be administered in an amount between 0.1 to 20.0 mg / kg patient weight / day, preferably between 0.5 to 10.0 mg / kg / day. The administration of the pharmaceutical compositions prepared according to the invention can be carried out at different times. In one embodiment, the pharmaceutical composition can be administered for one or more hours. In addition, administration may be repeated depending on the severity of the disease as well as other factors known in the art.

Methods of the invention

The present invention allows for the implementation of treatment of immune system diseases and autoimmune diseases in a subject, comprising administering to the subject an effective amount of a soluble CTLA4 molecule or mutant CTLA4 molecule that binds CD80 and / or CD86 molecules on Cd80 and / or CD86 positive cells so as to inhibit binding to CD80 and / or CD86. CD80 and / or CD86 of CTLA4 and / or CD28. The method of treatment comprises administering a therapeutic composition comprising the soluble CTLA4 molecules or mutant CTLA4 molecules of the invention to a subject in an effective amount to relieve at least one symptom associated with an immune system disease. In addition, the invention may provide long-term therapy for immune system diseases by blocking T cell / B7 positive cell interaction, thereby blocking T cell activation / stimulation through costimulatory signals such as B7 binding to CD28, leading to the induction of T cell anergy or tolerance. .

Soluble CTLA4 molecules or CTLA4 mutant molecules exhibit inhibitory properties in vivo. Under conditions of T cell / B7 positive cell interaction, e.g., T cell / B cell interaction, by contact between T cells and B7 positive cells, the binding of the introduced CTLA4 molecules reactive with B7 positive cells, e.g. cells, can interfere with or inhibit T cell / B7 positive cell interactions, thereby regulating immune responses. Inhibiting the T cell response by administering the soluble CTLA4 molecule may also be useful in the treatment of autoimmune disorders. Many autoimmune disorders result from the abnormal activation of T cells that react against autoantigens and stimulate the production of cytokines and autoantibodies associated with the disease pathology. Administration of the L104EA29YIg molecule to a subject suffering from or suspected of having an autoimmune disorder may prevent activation of autoreactive T cells and may reduce or eliminate disease symptoms. The method may also include administering to the subject the L104EA29Yg molecule of the invention, alone or together with additional ligands, such as those reactive with IL-2, IL-4, or γ-interferon.

The invention describes methods of regulating immune responses. Immune responses may be suppressed (reduced) by soluble CTLA4 particles or mutant molecules by inhibiting or blocking an immune response that is already in progress, or may include preventing the induction of an immune response. Soluble CTLA4 molecules or mutant CTLA4 molecules can inhibit activated T cell functions such as T cell proliferation and cytokine secretion by inhibiting T cell responses or by inducing specific tolerance in T cells, or both. Further, soluble CTLA4 or CTLA4 mutant molecules, by disrupting the CTLA4 / CD28 / B7 pathway, can inhibit T cell proliferation and / or secretion22.

The production of cytokines and thus less tissue damage and induction of unresponsiveness or T anergic cells.

The invention further describes methods for inhibiting organ or tissue transplant rejection in a subject, comprising administering an effective amount of at least one soluble CTLA4 molecule or CTLA4 molecule, e.g., L104EA29YIg, to the subject before, during, and / or after transplantation. It is also possible to administer to the subject at least one soluble CTLA4 molecule or mutant CTLA4 molecule in combination with at least one other therapeutic agent in combination with, but not limited to, a drug, toxin, enzyme, antibody, or conjugate.

An organ or tissue transplant can come from any type of organ or tissue suitable for transplantation. In one embodiment, the transplanted tissue may be pancreatic tissue. Pancreatic islet cells are also the tissue of the transplant. The invention also describes methods of treating type 1 and / or type 2 diabetes in subjects by inhibiting islet cell transplant rejection.

The present invention further describes a method for inhibiting islet transplant rejection in a subject, the subject being a recipient of the graft tissue. Typically in tissue transplants, rejection of a transplant is initiated by T-cells recognition as foreign, followed by an immune response that destroys the graft. Administration of the soluble CTLA4 molecule inhibits T cell proliferation and / or cytokine secretion, resulting in less tissue damage and induction of antigen-specific T cell failure, which can result in long-term graft acceptance without the need for generalized immunosuppression.

A preferred embodiment of the invention comprises the use of the soluble CTLA4 mutant molecule, L104EA29YIg, to regulate functional interactions of CTLA4 and CD28 positive cells with B7 positive cells, to treat diseases of the immune system such as diabetes and / or to suppress immune responses. The L104EA29YIg of the invention is a soluble CTLA4 mutant molecule containing at least two amino acid changes, leucine (L) to glutamic acid (E) at position +104 and alanine (A) to tyrosine (Y) at position +29. The L104EA29YIg molecule may include mutations in addition to the two listed herein.

The method may further comprise administering to the subject together with soluble CTLA4 mutant molecules a primary immunosuppressive regimen. A primary immunosuppressive regimen may include (but is not limited to): cyclosporin, azathioprine, methotrexate, cyclophosphamide, lymphocyte immune globulin, anti-CD3 antibodies, Rho (D) immune globulin, adrenocorticosteroids, sulfasalazine, FK-506, methoxalene, mycophenolate mofetil (CELLCEPTomin (THUS), anti-equine mofetil (CELLCEPTimin), anti-equine globulin, Mofetil , thalidomide, methotrexate, chloroquine, hydroxychloroquine, sulfasalazine, sulfasalazopyrine, leflunomide, gold salts, D-penicillamine, azathioprine, anakinra, infliximab, etanercept, TNF? blockers or biological agents that integrate with an inflammatory cytokine. In a preferred embodiment, the base immunosuppressive regimen is steroid-free. More preferably, the primary immunosuppressive regimen comprises rapamycin and an anti-human IL-2R mAb.

An embodiment of the invention includes the use of a molecule to block the interaction between B7 and CTLA4 in combination with an immunosuppressive agent to regulate an immune response to treat an immune system disease such as diabetes. The molecule used to block B7 / CTLA4 interactions may be soluble CTLA4 such as CTLA4Ig, CTLA4Ig / CD28 or L104EA29YIg, soluble CD28 such as CD28Ig, soluble B7 (B7-1 or B7-2) such as B7Ig, anti- CTLA4, anti-CD28 monoclonal antibodies or anti-B7 monoclonal antibodies.

Subjects treated by using the soluble CTL4 mutant molecule in a drug include mammalian subjects, including human, monkey, tailless, dog, cat, cow, horse, goat, pig, rabbit, mouse, and rat.

The present invention describes various methods, local or systemic, for administering therapeutic compositions such as the soluble CTLA4 molecule alone or in combination with an immunosuppressant and / or other therapeutic agent. The methods include intravenous, intramuscular, intraperitoneal, oral, inhalation, and subcutaneous methods, as well as implantable pump, continuous infusion, gene therapy, liposomes, suppositories, topical contact, vesicles, capsules.

And injections. The therapeutic agent, formulated with the carrier, is usually lyophilized for storage and reconstituted with water or a buffered solution at a neutral pH (about pH 7-8, e.g. pH 7.5) prior to administration.

As is standard practice in the art, the compositions described hereinabove may be administered to a subject in any pharmaceutically acceptable form.

Administration of the soluble CTLA4 molecules to the subject is done to regulate the interaction of CD28 and / or CTLA4 positive cells with B7 positive cells. B7-positive cells are contacted with an effective amount of the soluble CTLA4 molecules of the invention, or fragments or derivatives thereof, to form soluble CTLA4 / B7 complexes. The complexes disrupt the interaction between endogenous CTLA4 and CD28 molecules with molecules of the B7 family.

The soluble CTLA4 molecules can be administered to a subject in an amount and for a period of time (e.g., a length of time and / or a multiple) sufficient to block the subject from binding endogenous B7 molecules to their respective ligands. Blockade of endogenous B7 / ligand binding thereby inhibits interactions between B7 positive cells and CD28 and / or CTLA4 positive cells.

The dosage of the therapeutic agent is dependent on many factors including the type of tissue affected, the type of autoimmune disease being treated, the severity of the disease, the health of the subject, and the response to treatment with the agents. Accordingly, dosages of the agents may vary depending upon each subject and the mode of administration. Soluble CTLA4 molecules can be administered in an amount from about 0.1 to 100 mg / kg patient body weight / day.

The above-described composition can also be used together with other pharmaceutical agents for the treatment of diseases of the immune system. For example, diabetes can be treated with the molecules described in the invention in combination with immunosuppressants such as corticosteroids, cyclosporine (Mathiasen 1989 Cancer Lett. 44 (2): 151-156), prednisone, azathioprine, methotrexate (R. Handschumacher, in "Drugs Used for Immunosupression, pages 1264-1276), TNFα blockers or antagonists (New England Journal of Medicine, vol. 340: 253-259) , 1999; The Lancet, vol. 354: 193239, 1999, Annals of Internal Medicine, vol. 130: 478-486) ​​or any other biological agent that integrates with an inflammatory cytokine, non-steroidal anti-inflammatory drug / Cox-2 inhibitor, hydroxychloroquine, sulfasalazopyrine, gold salts, etanercept , infliximab, rapamycin, mycophenolate mofetil, azathioprin, tacrolimus, basiliximab, cytoxane, interferon beta-1a, interferon beta-1b, glatiramer acetate, mitoxantrone hydrochloride, anakinra and / or other biological agents.

Soluble CTLA4 mutant molecules (preferably, L104EA29YIg) can also be used in combination with one or more of the following agents to regulate the immune response: soluble gp39 (also known as CD40 ligand (CD40L), CD154, T-BAM, TRAP), soluble CD29, Soluble CD40, Soluble CD80 (e.g. ATCC 68627), Soluble CD86, Soluble CD28 (e.g. ATCC 68628), Soluble CD56, Soluble Thy-1, Soluble CD3, Soluble TCR, Soluble VLA-4, Soluble VCAM-1, Soluble LECAM-1, Soluble ELAM-1, Soluble CD44, gp39 reactive antibodies (e.g. ATCC HB -10916, ATCC HB-12055 and ATCC HB-12056), CD40-reactive antibodies (e.g. ATCC HB-9110), B7-reactive antibodies (e.g. ATCC HB-253, ATCC CRL-2223, ATCC CRL-2226, ATCC HB-301, ATCC HB-11341, etc.), antibodies reactive with CD28 (e.g. ATCC HB11944 or mAb 9.3 as described by Martin et al. (J.Clin. Immun. 4 (1): 18-22, 1980), antibodies reactive with LFA-1 (e.g. ATCC HB-9579 and ATCC TIB-213), antibodies LFA-2 reactive antibodies, IL-2 reactive antibodies, IL-12 reactive antibodies, IFN-gamma-reactive antibodies, CD2-reactive antibodies, CD48-reactive antibodies, antibodies reactive with any ICAM (e.g. ICAM-1 (ATCC CRL-2252), ICAM-2 and ICAM-3), antibodies reactive with CTLA4 (e.g. ATCC HB-304, antibodies reactive with Thy-1, antibodies reactive with CD56, antibodies reactive with CD3, antibodies reactive with CD29, antibodies reactive with TCR, antibodies reactive with VLA-4, antibodies reactive with VCAM-1, antibodies reactive with LECAM -1, antibodies reactive with ELAM-1, antibodies reactive with CD44. In some embodiments, monoclonal antibodies are preferred. In other embodiments, antibody fragments are preferred. As those skilled in the art will readily appreciate, the combinations may include the soluble CTLA4 molecules described in the invention and one other immunosuppressant, soluble CTLA4 molecules with two other immunosuppressants, soluble CTLA4 molecules.

With three other immunosuppressants, etc. The optimal combination and dosage can be determined and optimized using methods well known in the art.

Some specific combinations include the following: L104EA29YIg and CD80 monoclonal antibodies (mAbs); L104EA29YIg and CD86 mAbs; L104EA29YIg, CD80 mAbs and CD86 mAbs; L104EA29YIg and the gp39 mAb; L104EA29YIg and CD40 mAbs; L104EA29YIg and CD28 mAb; L104EA29YIg, CD80 and CD86 mAbs, and gp39 mAbs; L104EA29YIg, CD80 and CD86 mAbs, and CD40 mAbs; and L104EA29YIg, anti-LFA1 mAb, and anti-gp39 mAb. A specific example of a gp39 mAb is MR1.

The soluble CTLA4 molecules of the invention, e.g. L104EA29YIg, can be administered as the sole active ingredient or together with other drugs in an immunomodulating regimen or other anti-inflammatory agents, e.g. in the treatment or prevention of acute or chronic allograft or xenograft rejection or inflammatory or autoimmune disorders, or to induce tolerance. For example, they can be used in combination with a calcineurin inhibitor, e.g. cyclosporin A or FK506; an immunosuppressive macrolyte, e.g. rapamycin or a derivative thereof; e.g. 40-O- (2-hydroxy) ethyl rapamycin, a lymphocyte return agent, e.g. FTY720 or an analog thereof; corticosteroids; cyclophosphamide; azathioprene; methotrexate; leflunomide or an analog thereof; mizoribine; mycophenolic acid; mycophenolate mofetil; 15-deoxyspergualin or an analog thereof; immunosuppressive monoclonal antibodies, e.g. monoclonal antibodies to leukocyte receptors, e.g. MHC, CD2, CDS, CD4, CD11a / CD18, CD7, CD25, CD27, B7, CD40, CD45, CD58, CD137, ICOS, CD150 (SLAM), OX40,4-1BB or their ligands ; or other immunomodulatory compounds e.g. CTLA4 / CD28-Ig, or other adhesion molecule inhibitors e.g. mAbs or low molecular weight inhibitors including LFA-1 antagonists, selectin antagonists and VLA-4 antagonists. The compound is particularly useful in combination with a compound that disrupts CD40 and its ligand, e.g., antibodies to CD40 and antibodies to CD40-L.

Where soluble CTLA4 mutant molecules are administered in combination with another immunosuppressive / immunomodulatory or anti-inflammatory therapy, e.g. as mentioned above, the dosage of the co-administered immunosuppressive, immunomodulatory or anti-inflammatory compound will, of course, vary depending on the type of drug concomitantly used e.g. or cyclosporine, from the specific drug used, from the condition being treated, and so on.

Accordingly, the present invention describes in the methods as mentioned above, including co-administering, e.g. simultaneously or in sequence, a therapeutically effective amount of soluble CTLA4 molecules, e.g. L104EA29YIg, in free form or in pharmaceutically acceptable salt form, and a second drug substance. wherein said second drug substance is an immunosuppressive, immunomodulatory or anti-inflammatory drug, e.g. as noted above.

Additionally, therapeutic combinations are described, e.g., a kit comprising a soluble CTLA4 molecule, in free form or in pharmaceutically acceptable salt form, for use simultaneously or sequentially with at least one pharmaceutical composition comprising an immunosuppressive, immunomodulatory or anti-inflammatory drug. The kit may contain instructions for administering the medication.

In another embodiment of the invention, tissue or organ transplant rejection is inhibited by administering to the subject soluble CTLA4 and the T cell depleted bone marrow cells. Administration of the T cell depleted bone marrow cells may occur at approximately the same time the subject receives the tissue or organ transplant, or some other time. Administration of the bone marrow at approximately the same time indicates that the bone marrow is administered to the subject as part of the preparation for tissue or organ transplant administration procedures. It is not necessary for the bone marrow to be transplanted at the exact same time (i.e. within minutes) as the organ transplant.

In preferred embodiments, the T cell depleted bone marrow is administered prior to organ transplantation. Particular embodiments include administering T cell depleted bone marrow during the day, within twelve hours, or within six hours of solid organ transplantation. However, the T cell depleted bone marrow may be administered earlier as long as the effect of the T cell depleted bone marrow in connection with organ or tissue transplantation is still achieved. In alternative embodiments, it may be desirable to administer T cell depleted bone marrow following organ transplantation.

PL 204 899 B1

In one embodiment, the method comprises administering to the subject a dose of T cell depleted bone marrow cells (tolerance dose), and then administering to the subject an additional dose of T cell depleted bone marrow cells (implant dose dose). In some embodiments, the immunosuppressive agent comprises at least one or more types of ligands that interfere with the binding of the CD28 antigen to the CD80 and / or CD86 antigen. As described above, the ligand is preferably a mutant CTLA4 molecule such as L104EA29YIg.

In addition, the amount of T cell depleted bone marrow can be determined by routine experimentation and optimized empirically. For example, the amount of T cell depleted bone marrow can be fine-tuned during routine experimentation to determine an amount sufficient to achieve the desired effects.

The methods of the invention may also be practiced by administering to a subject, in addition to the soluble CTLA4 mutant molecule, two or more doses of T cell depleted bone marrow, alone or in combination with one or more immunosuppressants.

As discussed herein in the methods, administration of the soluble CTLA4 molecule or mutant CTLA4 molecule can be accomplished by a variety of routes, including local or systemic administration routes. For example, soluble CTLA4 mutant molecules can be administered intravenously, intramuscularly, or intraperitoneally. Alternatively, the mutant CTLA4 can be administered orally or subcutaneously. Other methods of administration will be recognized by those skilled in the art. Likewise, T cell depleted bone marrow can be administered in a variety of ways as are known to those skilled in the art. An example is the infusion route.

The immunosuppressive agent (s) may be administered before or after administration of the soluble CTLA4 mutant and / or before or after the organ / tissue transplant. Preferably, the bone marrow and the immunosuppressant are administered prior to the administration of the soluble CTLA4 mutant molecule. In one embodiment, the first dose of T cell depleted bone marrow (tolerant dose) and the immunosuppressive agent are administered at approximately the same time as the organ transplant.

The following examples are presented to illustrate the present invention.

Example 1

This example describes the methods used to generate the nucleotide sequences encoding the soluble CTLA4 mutant molecules of the invention. A single site mutant L104EIg was created and tested for binding kinetics for CD80 and / or CD86. The nucleotide sequence of L104EIg was used as a template to generate a CTLA4 mutant double site sequence, L104EA29YIg, which was tested for binding kinetics to CD80 and / or CD86.

Codon-based CTLA4Ig mutagenesis:

A mutagenesis and screening strategy was used to identify mutant CTLA4Ig molecules that had a lower dissociation rate ("off rates) than binding to CD86 molecules. Nucleotide sequences mutated at one site were created using CTLA4Ig as template (US Patent Nos. 5,844,095; 5,851,795; and 5,885,796; ATCC Accession Number 68629). Mutagenic PCR oligonucleotide primers were designed to randomly mutagenize a specific cDNA codon leaving bases at positions 1 and 2 of the codon, but only guanine or thymine at position 3 (XXG / T; also known as NNG / T). In this way, a specific codon encoding an amino acid could be randomly mutated to encode each of the 20 amino acids. In this regard, XXG / T mutagenesis resulted in 32 potential codons for each of the 20 amino acids. The PCR products encoding mutations in close proximity to -M97-G107 CTLA4Ig (see Figs. 1 or 2) were digested with SacI / Xbal and subcloned into a similarly cleaved nLN expression vector CTLA4Ig. This method was used to generate a CTLA4 molecule, L104EIg, mutated in a single site.

For mutagenesis in the vicinity of S25-R33 of CTLA4Ig, a silent NheI restriction site was first introduced, 5 'to this loop, by PCR primer driven mutagenesis. The PCR products were digested with NheI / Xbal and subcloned into similarly cleaved CTLA4Ig or L104EIg expression vectors. This method was used to generate a CTLA4 L104EA29YIg molecule mutated in a double site (Figure 3). In particular, a nucleic acid molecule encoding a single-site mutant CTLA4 molecule, L104EIg, was used as a template to generate a dual-site CTLA4 mutant molecule, L104EA29YIg.

PL 204 899 B1

Example 2

This example provides a description of the screening methods used to identify single- and double-site mutant CTLA4 polypeptides expressed from the constructs described in Example 1 that showed a higher avidity for CD80 and CD86 antigens compared to non-mutated CTLA4Ig molecules.

Recent in vitro and in vivo studies show that CTLA4Ig alone is unable to fully block the induction of antigen-specific activated T cells. In vitro studies with CTLA4Ig and either a CD80-specific monoclonal antibody or CD86 measuring inhibition of T cell proliferation show that the antibody monoclonal anti-CD80 did not potentiate CTLA4Ig inhibition. However, the anti-CD86 monoclonal antibody enhanced the inhibition showing that CTLA4Ig did not block the CD86 interaction as effectively. These data support the earlier findings of Lindley et al (Immunity, (1994), 1: 793-801) showing that inhibition of CD80-mediated cell responses required approximately 100-fold lower concentration of CTLA4Ig than for CD86-mediated response. Based on these findings, it was speculated that soluble CTLA4 mutant molecules with higher avidity for CD86 than wild-type CTLA4 should block the stimulation of antigen-specific activated cells better than CTLA4Ig.

To this end, the soluble CTLA4 mutant molecules described in Example 1 above were screened using a new screening procedure to identify several mutations in the CTLA4 extracellular domain that improve the avidity for CD80 and CD86. This screening strategy provided an efficient method for direct identification of mutants with markedly lower "off rates" without the need for protein purification or quantification as the determination of the "off factor" is concentration independent (O'Shannessy et al. (1993) Anal. Biochem., 212: 457-468).

COS cells were transfected with individual miniprep purified plasmid DNA and grown for several days. The conditioned culture media for three days was applied to BIAcore biosensor plates (Pharmacia Biotach AB, Uppsala, Sweden) coated with soluble CD80Ig or CD86Ig. The specific binding and dissociation of the mutant proteins was measured by surface plasmon resonance (O'Shannessy, DJ, et al. (1993) Anal. Biochem. 212: 4 57-468). All experiments were performed on the BIAcore ™ or BIAcore ™ 2000 biosensors at 25 ° C. Ligands were immobilized on NCM5 research sensor plates (Pharmacia) using standard N-ethyl-N '- (dimethylaminopropyl) carbodiimido-N-hydroxysuccinimide coupling (Johnsson, B., et al. (1991) Anal. Biochem. 198: 268-277. Khilko, SN et al. (1993) J. Biol. Chem 268: 5425-15434.

Screening method

COS cells, cultured in 24-well tissue culture dishes, were transiently transfected with DNA encoding the mutant CTLA4Ig. Culture media containing the isolated, soluble, mutant CTLA4Ig was harvested 3 days later.

The conditioned culture media of the COS cells were allowed to flow through the BIAcore biosensor plates derivatized with CD86Ig or CD80Ig (as described in Greene et al., 1996 J. Biol. Chem. 271: 26762-26771) and the mutant molecules were identified by measuring the "off rate". slower than observed with wild type CTLA4Ig. cDNAs corresponding to selected media samples were sequenced and DNA generated to perform a large-scale short-term transfection of COS cells from which a mutant CTLA4Ig protein was prepared following purification of the culture media with protein A.

BIAcore analysis conditions and analysis of the binding equilibrium data were performed as described in J. Greene et al. 1996 J. Biol. Chem. 271: 26762-26771, and as described herein.

BIAcore data analysis

The sensor reading baselines were normalized to zero response units (RU) prior to analysis. Samples were run over mock derivatized flowing cells to establish background response unit (RU) values ​​due to bulk refractive index differences between the solutions. The equilibrium dissociation constants (Kd) were calculated from the plots of Req versus C, where Req is the stability state response minus the response on the mock derivatized plate and C is the molar concentration of the analyte. Binding curves were analyzed using a commercial nonlinear curve fitting computer program (Prism, GraphPAD Software).

PL 204 899 B1

The experimental data were first fitted to a single ligand binding model to a single receptor (1-site model, i.e. simple Langmuir system, A + B&gt;&gt; AB), and the association equilibrium constants (K_d= [AHB] \ [AB]) calculated from the equation R = R_max^ C \ (Kd + C). The data was then fitted to the simplest two-site ligand binding model (i.e., with a receptor having two non-interacting, independent binding sites as described by equation^{R = R}max1 • C \ (K_d1 + C) + Rmax2 &lt;\ (K_d2+ C)).

The fit quality of the two models was analyzed visually by comparison with experimental data and statistically, the sum of squares F test. The simpler, single-site model was chosen as the best fit, unless the two-site model fit significantly better (p &lt;0.1).

Association and dissociation analyzes were performed using the BIA 2.1 Software (Pharmacia) evaluation. The association rate constants kon were calculated in two ways, assuming both homogeneous single-site interactions and parallel two-site interactions. For single-site interactions, kon values ​​were calculated according to the equation Rt = Req (1-exp^{-ks (mt}0), where Rt is the answer at a given time t; R_eq is the response in a steady state; vol₀ is the injection start time; ik_s= dR / dt = k_he&lt;k_off, and where C is the concentration of the analyte, calculated in terms of monomeric binding sites. For two-site interactions, the kon values ​​were calculated according to the equation Rt = Req (1-exp-^{ks1 (tt}0) + Req2 (1-exp^{-x1 (mp}0). For each model, the kon values ​​were determined from the calculated decrease (to about 70% of the maximum association) of the ks plots against C.

Dissociation data was analyzed according to a single site (AB = A + B) or a dummy model (AiBj = Ai + Bj) and rate constants (koff) were calculated from the best curve fits. A binding site model was used except when the debris was larger than the background of the device (2-10 RU, by machine), in which case a two-site binding model was used. Half time of receptor occupation was calculated using the compound t1 / 2 = 0.693 / koff.

Flow cytometry:

Mouse mAb L307.4 (anti-CD80) was purchased from Becton Dickinson (San Jose, California) and IT2.2 (anti-B7-0 [also known as CD86]), from Pharmingen (San Diego, California). For immunostaining, CD80-positive and / or CD86-positive CHO cells were removed from their culture vessels by incubation in phosphate buffered solution (PBS) containing 10mM EDTA. CHO cells (1-10 x 10⁵) were first incubated with mAbs or immunogobulin fusion proteins in DMEM containing 10% Fetal Bovine Serum (FBS), then washed and incubated with second stage reagents, goat anti-mouse or anti-human immunoglobulin, conjugated with fluorescein isocyanate (Tago, Burlingame, California ). Cells were finally washed and analyzed on a FACScan (Becton Dickinson).

SDS-PAGE and gel permeation chromatography

SDS-PAGE was performed on 4-20% Tris / glycine acrylamide gels (Novex, San Diego, CA). Analytical gels were stained with Coomassie Blue, and images of wet gels were obtained by digital scanning. CTLA4Ig (25 μg) and L104EA29YIg (25 μg) were analyzed by gel permeation chromatography using a TSK-GEL G300 SWXL column (7.8 x 300mm, Tosohaas, Montgomeryville, PA) equilibrated in phosphate buffered saline containing 0.02% NAN3, with a flow rate of 1.0 ml / minute.

CTLA4XC120S and L104EA29YXC120S.

A single chain CTLA4KSC120S was prepared as previously described (Linsley et al. (1995) J. Biol. Chem., 270: 15417-15424). Briefly, CTLA4 oncostatin M expression plasmid (OMCTLA4) was used as template, primer compatible, GAGGTGATAAAGCTTCACCAATGGGTGTACTGCTCACACAG (SEQ ID NO: 17) was selected to align the sequences in the vector; and the reverse primer, GTGGTGTATTGGTCTAGATCAATCAGAATCTGGGCACGGTTC (SEQ ID NO: 18) which corresponded to the last seven amino acids (i.e. amino acids 118-124) in the CTLA4 extracellular domain and contained a restriction enzyme site and a stop codon (TGA). The reverse primer showed a C120S mutation (cysteine ​​to serine at position 120). In particular, the GCA nucleotide sequence (nucleotides 34-36) of the reverse primer shown above is replaced with one of the following nucleotide sequences: AGA, GGA, TGA, CGA, ACT, or GCT. As will be readily understood by those skilled in the art, the GCA nucleotide sequence is the reverse complement of the TGC codon for cysteine. Similarly, the nucleotide sequences of AGA, GGA, TGA, CGA, ACT, or GCT are reverse complement codons for serine. The polymerase chain reaction products were digested with HindIII / XbaI and directionally subcloned into the nLN expression vector (Bristol-Myers Squ28

Ibb Company, Princeton, NJ). L104EA29YXC120S was prepared in an identical manner. Each construction was verified by DNA sequencing.

Identification and biochemical characterization of high avidity mutants

Twenty-four amino acids were selected for mutagenesis and the resulting mutant proteins were tested for CD86Ig binding by surface plasmon resonance (SPR; as described above). The major effects at each site are discussed in Table II. Random mutagenesis of certain amino acids in S25-R33 did not appear to alter ligand binding. Mutagenesis of E31 and R33 and of residues M97-Y102 apparently resulted in a suppression of ligand binding.

Mutagenesis of residues S25, A29 and T30, K93, L96, Y103, L104 and G105 resulted in proteins with a slow "on and / or slow" off index. These results support previous findings that residues in the S25-R33 region and residues in or beside M97-Y102 have an effect on ligand binding (Peach et al. (1994) J. Exp. Med., 180: 2049-2058).

The mutagenesis of the S25, T30, K93, L96, Y103, and G105 sites allowed the identification of some mutant proteins that had slower off rates than CD86Ig. However, in these cases, the slow "off" index was disrupted by the slow "on" index, resulting in mutant proteins with a complete avidity for CD86Ig that was apparently similar to that seen with wild-type CTLA4Ig. In addition, K93 mutagenesis resulted in significant aggregation that could be responsible for the observed kinetic changes.

Random mutagenesis of L104, followed by transfection of COS cells and SPR screening of the culture media samples with immobilized CD86Ig, resulted in six media samples containing mutant proteins with an approximately 2-fold slower off rate than wild-type CTLA4Ig. After sequencing the corresponding cDNA of these mutants, it turned out that each was coding for a leucine mutation to glutamic acid (L104E). Apparently, the substitution of leucine 104 for aspartic acid (L104D) did not affect CD86Ig binding.

The mutagenesis was then repeated at each site listed in Table II, this time using L104E as the PCR template instead of wild-type CTLA4Ig as described above. SPR analysis, again using immobilized CD86Ig, identified six alanine mutagenesis 29 culture medium samples, with proteins having approximately 4 times slower off rates than wild-type CTLA4Ig. The slowest substitutions were tyrosine (L104EA29Y), two were leucine (L104EA29L), one was tryptophan (L104EA29W) and one was threonine (L104EA29T). Apparently, no mutants with slow "off" rates have been identified for the random mutation of Alanine 29 alone, in the wild-type CTLA4Ig.

The relative molecular weights and aggregation state of the purified L104E and L104EA29YIg were estimated by SDS-PAGE and gel permeation chromatography. L104EA29YIg (~ 1 μg; lane 3) and L104EIg (~ 1 μg; lane 2) apparently had the same electrophoretic mobility as CTLA4Ig (~ 1 μg; lane 1) under reducing conditions (~ 50kDa; + eME; plus 2-mercaptoethanol) and non-reducing (~ 100kDa; -eME) (Fig. 14A). Gel chromatography showed that L104EA29YIg (Fig. 14C) apparently had the same mobility as the dimeric CTLA4Ig (Fig. 14B). The major peaks represent dimeric proteins, while the faster eluting minor peak in Figure 14B shows higher molecular weight aggregates. Approximately 5.0% of the CTLA4Ig was present as higher molecular weight aggregates, but there was no evidence of L104EA29YIg or L104EIg aggregation. Thus, the stronger binding to CD86Ig seen for L104EIg and L104EA29YIg could not be ascribed to mutagenesis-induced aggregation.

Equilibrium analysis and binding kinetics

Equilibrium and binding kinetic analyzes were performed on protein A-purified CTLA4Ig, L104EIg and L104EA29YIg using surface plasmon resonance (SPR). The results are shown in Table I. The observed equilibrium dissociation constants (Kd; Table I) were calculated from the binding curves generated over the concentration range (5.0-200 nM). L104EA29YIg binds CD86Ig more strongly than L104EIg or CTLA4Ig. A lower Kd of L104EA29YIg (3.21 nM) than L104EIg (6.06 nM) or CTLA4Ig (13.9 nM) indicates a higher avidity for L104EA29YIg binding to CD86Ig. A lower Kd of L104EA29YIg (3.66 nM) than L104EIg (4.47 nM) or CTLA4Ig (6.51 nM) indicates a higher avidity for L104EA29YIg binding to CD80Ig.

Binding kinetic analysis revealed that the comparable "on rates for CTLA4Ig, L104EIg, and L104EA29YIg binding to CD80 were similar as were the" on rates for CD86Ig (Table I). However, the off rates for these molecules were not equal (Table I). Compared to CTLA4Ig, L104EA29YIg had an "off speed" approximately 2 times slower than CD80Ig and approximately

PL 204 899 B1

4 times slower off speed than CD86Ig. L104E had intermediate rates between L104EA29YIg and CTLA4Ig. Since the introduction of these mutations did not significantly affect the "on rates", the increase in the CD80Ig and CD86Ig avidity observed with L104EA29YIg was probably due primarily to the decrease in the "off rate".

To determine whether the increase in the avidity of L104EA29YIg for CD86Ig and CD80Ig was due to mutations affecting the way each monomer associates to the dimer, or if there were structural changes to increase the avidity introduced into each monomer, single chain extracellular domain constructs CTLA4 and L104EA29Y were generated, and then mutagenesis of cysteine ​​120 to serine was performed as described above and by Linsley et al. (1995) J. Biol. Chem., 270: 15417-15424. Gel permeation chromatography revealed that the purified CTLA4XC120S and L104EA29YXC120S proteins are monomers (Linsley et al. (1995), supra), prior to analyzing their ligand binding properties by SPR. The results showed that the binding affinity of both monomeric proteins for CD86Ig was approximately 35-80-fold lower than that observed for their corresponding dimers (Table I). This supports previously published data that CTLA4 dimerization is necessary for high avidity for ligand binding (Greene et al. (1996) J. Biol. Chem., 271: 26762-26771).

L104EA2 9YXC120S bound about 2-fold higher affinity than CTLA4XC120S to both CD80Ig and CD86Ig. The higher affinity was due to the approximately 3-fold slower dissociation rate than both ligands. Thus, the stronger ligand binding by L104EA29Y was most likely due to the avidity enhancing structural changes that were introduced for each monomer chain, rather than the changes in which the molecule dimerized.

Location and structural analysis of mutations enhancing greed

The structure of the CTLA4 extracellular IgV-like domain solution was recently determined by NMR spectroscopy (Metzler et al., (1997) Nature Struct. Biol., 4: 527-531. This allowed for the exact location of leucin 104 and alanine 29 in a three-dimensional assembly (Fig. 15A). -B) Leucine 104 is located next to the highly conserved amino acid sequence of MYPPPY Alanine 29 is located next to the C terminus of the S25-R33 region which is spatially contiguous to the MYPPPY region. Although there is a significant interaction between the residues at the base of these two regions, apparently there is no direct interaction between L104 and A29 although both include the contiguous portion of the hydrophobic core in the protein. The structural consequences of the two greed-enhancing mutants were estimated by modeling. The A29Y mutation can be readily adapted to the cleft between the S25-R33 region and the MYPPPY region, and this can serve to stabilize the conformation of the MYPPPY region. In wild-type CTLA4, L104 forms extensive hydrophobic interactions with L96 and V94 adjacent to the MYPPPY region. It is highly unlikely that the glutamic acid mutation adjusts the conformation similar to L104, for two reasons. First, there is insufficient space to align the longer glutamic acid side chain with the structure without significantly disrupting the S25-R33 region. Second, the energy cost of hiding the negative charge of the glutamic acid side chain in the hydrophobic region would be great. Instead, modeling studies predict that the glutamic acid side chain will be projected to the surface where its charge can be stabilized by solvation. This conformational change can be aligned with G105 with minimal disruption to other residues in the regions.

Binding of high avidity mutants to CHO cells expressing CD80 or CD865 FACS analysis (Fig. 9) of CTLA4Ig binding and mutant molecules with stably transfected CD80 + and CD86 + CHO cells was performed as described herein. CHO cells positive for CD80 and positive for CD86 were incubated with increasing concentrations of CTLA4Ig, L104EA29YIg, or L104EIg and then washed. Bound immunoglobulin fusion protein was detected using fluorescein isocyanate-conjugated goat anti-human immunoglobulin.

As shown in Figure 9, CHO cells positive for CD80 or positive for CD86 (1.5x10⁵) were incubated with defined concentrations of CTLA4Ig (solid squares), L104EA29YIg (circles) or L104EIg (triangles) for 2 hours at 23 ° C, washed and incubated with fluorescein-conjugated goat anti-human immunoglobulin antibodies. Binding was analyzed on a total of 5,000 viable cells (single determination) on the FACScan and the mean fluorescence intensity (MFI) was determined from the data histograms using PC-LYSYS. Data

Corrected background for fluorescence was measured on cells incubated with second stage reagents only (MFI = 7). Control L6 mAb (80 µg / ml) gave an MFI of &lt;30. These results are representative of four independent experiments.

Binding of L104EA29YIg, L104EIg and CTLA4Ig to CD80-transfected human CHO cells is approximately equal (Fig. 2A). L104EA29YIg and L104EIg bind more strongly to CHO cells stably transfected with human CD86 than does CTLA4Ig (Fig. 2B).

Functional tests:

Human T cells positive for CD4 were isolated by immunomagnetic negative selection (Linsley et al. (1992) J. Exp. Med. 176: 1595-1604). The isolated CD4-positive T cells were stimulated with phorbol myristate acetate (PMA) plus CHO cells CD80 positive or CD86 positive in the presence of titrated inhibitor concentrations. CD4-positive cells (8-10 x 10⁴/ well) was grown in the presence of 1 nM PMA with or without irradiated CHO cell stimulators. Proliferative responses were measured by adding 1 µCi / well [3 H] thymidine during the final 7 hours of 72 hour culture. Inhibition of PMA plus CD80 positive CHO or CD86 positive CHO stimulated T cells by L104EA29YIg and CTLA4Ig was performed. The results are shown in Fig. 10. L104EA29YIg inhibited proliferation of CD80-positive PMA treated CHO cells more than CTLA4Ig (Fig. 10A). L104EA29YIg is also more effective than CTLA4Ig at inhibiting the proliferation of CD86-positive PMA treated CHO cells (Figure 10B). Thus, L104EA29YIg is a more potent inhibitor of T cell costimulation mediated by both CD80 and CD86.

Figure 11 shows the inhibition by L104EA29YIg and CTLA4Ig of allostimulated human T cells prepared above and further allostimulated with a human B lymphoblastoid (LCL) cell line called PM which expressed CD80 and CD86 (3.0 x 10 10 T cells).⁴/ well and PM in the amount of 8.0 x 10³/ well). Primary allostimulation was for 6 days, then cells were pulsed with [3 H] thymidine for 7 hours before determining the introduced radiotracer.

Secondary allostimulation was performed as follows. Seven days old primary allostimulated T cells were harvested on lymphocyte separation medium (LSM) (ICN, Aurora, OH) and left for 24 hours. The T cells were then restimulated (secondary), in the presence of titer amounts of CTLA4Ig or L104EA29YIg, by adding PM in the same ratio as above. Stimulation was for 3 days, then cells were pulsed with radiolabel and harvested as above. The effect of L104EA29YIg on primary allostimulated T cells is shown in Figure 11A. The effect of L104EA29YIg on secondary allostimulated T cells is shown in Figure 11B. L104EA29YIg inhibits both primary and secondary T cell proliferative responses better than CTLA4Ig.

To measure cytokine production (Figure 12), duplicate secondary allostimulated plates were prepared. After 3 days, the culture media was tested using ELISA kits (Biosource, Camarillo, CA) using the manufacturer's recommended conditions. L104EA29YIg was found to be more potent than CTLA4Ig at blocking the production of the cytokines IL-2, IL-4, and γ-IFN by T cells following a secondary allogeneic stimulus (Figures 12A-C).

The effect of L104EA29YIg and CTLA4Ig on monkey mixed lymphocyte (MLR) response is shown in Figure 6. Peripheral blood mononuclear cells (PBMC; 3.5x10⁴ cells / well for each monkey) from 2 monkeys, purified on Lymphocyte Separation Medium (LSM) and mixed with 2 µg / ml phytohaemagglutinin (PHA). Cells were stimulated for 3 days, then pulsed with the radiotracer 16 hours prior to harvest. L104EA29YIg inhibited monkey T cell proliferation better than CTLA4Ig.

Table I:

The equilibrium and apparent kinetic constants are given in the following table (values ​​represent mean ± standard deviation from three different experiments):

<td>Immobilized protein</td><td>Analyt</td><td>kon (x10⁵) M.¹ S.¹</td><td>koff (x10^-3) s^-1</td><td>Kd nM</td>

<td> 1</td><td> 2</td><td> 3</td><td> 4</td><td> 5</td>

<td>CD80Ig</td><td>CTLA4Ig</td><td> 3,44 ± 0,29</td><td> 2,21 ± 0,18</td><td> 6,51 ± 1,08</td>

<td>CD80Ig</td><td>L104EIg</td><td> 3,02 ± 0,05</td><td> 1,35 ± 0,08</td><td> 4,47 ± 0,36</td>

PL 204 899 B1 cont. Table I

<td>and</td><td> 2</td><td> 3</td><td> 4</td><td> 5</td>

<td>CD8OIg</td><td>L1O4EA29YIg</td><td>2.96 ± 0.2O</td><td>1.08 ± O, O5</td><td> 3,66 ± 0,41</td>

<td>CD8OIg</td><td>CTLA4Xci20s</td><td> 12,0 ± 1,0</td><td>23O ± 1O</td><td> 195 ± 25</td>

<td>CD8OIg</td><td>L104EA29YXci20s</td><td>8.3 ± 0.26</td><td> 71 ± 5</td><td>85.0 ± 2.5</td>

<td>CD86Ig</td><td>CTLA4Ig</td><td>5.95 ± 0.17</td><td> 8,16 ± 0,52</td><td> 13,9 ± 2,27</td>

<td>CD86Ig</td><td>L1O4EIg</td><td>7, O3 ± O.22</td><td> 4,26 ± 0,11</td><td>6.06 ± O, O5</td>

<td>CD86Ig</td><td>L1O4EA29YIg</td><td>6.42 ± 0.4O</td><td> 2,06 ± 0,03</td><td> 3,21 ± 0,23</td>

<td>CD86lg</td><td>CTLA4Xci2os</td><td>16.5 ± 0.5</td><td>84O ± 55</td><td> 511 ± 17</td>

<td>CD86Ig</td><td>L1O4EA29YXci2os</td><td> 11,4 ± 1,6</td><td>3OO ± 10</td><td> 267 ± 29</td>

Table II

The effect on CD86Ig binding by CTLA4Ig mutagenesis at the sites mentioned was determined by the SPR as described above. The predominant influence is indicated by the "+" sign.

<td>Mutagenesis site</td><td colspan="3">Effect on mutagenesis</td>

<td></td><td>No visible impact</td><td>Slow speed on / slow speed "off"</td><td>Reduced ligand binding</td>

<td>S25</td><td></td><td> +</td><td></td>

<td>P26</td><td> +</td><td></td><td></td>

<td>G27</td><td> +</td><td></td><td></td>

<td>K28</td><td> +</td><td></td><td></td>

<td>A29</td><td></td><td> +</td><td></td>

<td>T3O</td><td></td><td> +</td><td></td>

<td>E31</td><td></td><td></td><td> +</td>

<td>R33</td><td></td><td></td><td> +</td>

<td>K93</td><td></td><td> +</td><td></td>

<td>L96</td><td></td><td> +</td><td></td>

<td>M97</td><td></td><td></td><td> +</td>

<td>Y98</td><td></td><td></td><td> +</td>

<td>P99</td><td></td><td></td><td> +</td>

<td>Pioo</td><td></td><td></td><td> +</td>

<td>P1O1</td><td></td><td></td><td> +</td>

<td>Y1O2</td><td></td><td></td><td> +</td>

<td>Y1O3</td><td></td><td> +</td><td></td>

<td>L1O4</td><td></td><td> +</td><td></td>

<td>G1O5</td><td></td><td> +</td><td></td>

<td> 1106</td><td></td><td></td><td></td>

<td>G1O7</td><td> +</td><td></td><td></td>

<td>Q111</td><td> +</td><td></td><td></td>

<td>Y113</td><td> +</td><td></td><td></td>

<td> 1115</td><td> +</td><td></td><td></td>

PL 204 899 B1

Example 3

This example describes donor pancreatectomy and islet isolation and islet transplantation procedures in an animal model.

Materials and methods

Animals. Captive bred adolescent male rhesus monkeys (Macaca mulatta) (~ 4-20 kg) were used as recipients and donors. The absence of donor-specific preformed antibodies in recipients was confirmed prior to transplant. All potential donors and recipients were tested for anti-CMV antibody and only CMV seropositive animals were used as recipients.

Donor pancreatectomy and islet isolation. Donor pancreatectomy was performed one day before transplantation. The procedure was performed under general anesthesia (combination of parenteral ketamine and inhaled isoflurane) through a midline abdominal incision. The ligaments of the spleen and kidneys as well as the spleen and colon were divided so that the spleen, along with the pancreatic tail, were mobile. The head of the pancreas and the second part of the duodenum were activated following the Kocher maneuver. After administration of heparin (200 U / kg), the aorta was catheterized just above the branch and the animal was exsanguinated. The cold, half-melted ice was immediately placed in the smaller bag and behind the body of the pancreas. The body and neck of the pancreas were carefully severed with a sharp incision, taking care not to disturb the pancreatic capsule. The common bile duct, main and accessory pancreatic ducts were identified and ligated, and the head of the pancreas was severed from the other part of the duodenum.

Islet isolation from rhesus monkeys was completed by minor modifications to the automated human islet isolation method (Ricordi (1988) Diabetes, 37: 413; Ranuncoli (2000) Cell Trasplant 9: 409) using Liberase (Roche / Boehringer Mannheim, Indpls, IN) at a concentration of 0.47-0.71 mg / ml. A three-layer discontinuous Euroficoll gradient (densities 1.108, 1.097, 1.037; Meditech, Herndon, VA and a Cobe 2991 blood cell processor (Gambro, Lakewood, CO) were used to clear islets of pancreatic digestion products. Samples of the final islet preparation were stained with dithizone dye. (Sigma, St. Louis, MO) and the formulation was evaluated by calculating the number of islets in each of the following size ranges: 50-100, 100-150, 150-200,

200-250, 250-300, 300-350 and 350-400 μm. The data was mathematically transformed to determine the number of islets with an average diameter of 150 nm and expressed as islet equivalents (IEQ) (Ricordi C. et al., Acta Diabetol Lat 27: 185-195).

Recipient pancreatectomy and hepatic islet cell transplant. A complete pancreatectomy, without duodenalectomy or spleenectomy, was performed at least one week prior to transplantation. The tail and body of the pancreas were severed along the spleen artery and vein which were carefully secured by ligating and separating only the pancreatic branches. The minor mesenteric and middle colon veins were identified and secured during dissection of the pancreatic body. The portal and mesenteric veins were diagnosed, and the pancreatic veins were ligated and separated.

The duodenum and pancreatic-duodenal vessel branches that entered the pancreas were mobilized, ligated and detached, leaving the duodenal branches intact. The common bile duct was identified and secured during a blunt incision between the head of the pancreas and the c-loop of the duodenum. The main and accessory pancreatic ducts were ligated, detached, and the pancreas was removed from the abdominal cavity. All animals underwent an intravenous glucose tolerance test to evaluate the effectiveness of the pancreatectomy procedure. All documented negative for c-peptide prior to islet transplantation.

Islets grown overnight were washed in transplant medium consisting of RPMI 1640 medium (Mediatech) supplemented with 2.5% human serum albumin and counted to determine the IEQ number. The islets were pelleted and resuspended in 20 ml of transplant medium supplemented with 200 units of heparin. The hepatic islet transplant was performed by gravity drainage into the sigmoid colon or branch of the left colonic vein draining the portal vein through intravenous catheter No. 22.

Blood glucose monitoring, isulin administration and rejection determination. Fasting and postprandial blood glucose were monitored twice daily (before breakfast and after lunch) by ear puncture followed by blood testing with elite glucometer (Bayer, Elkhart, IN). Insulin (NPH, Ultralente; Eli Lilly, Indianapolis, IN) was administered three times daily in an attempt to maintain a fasting glucose level of &lt;300 mg / dL in pancreatectomy, pre-transplant animals, or allograft rejection.

PL 204 899 B1

Experimental groups and immunosuppressive protocols. Two treatment protocols were tested: (1) Edmonton protocol, using Tacrolimus, Sirolimus and anti-IL-2R mAb (Shapiro, AMJ et al. (2000), N.Engl. J. Med., 343: 230-238) and ( 2) L104EA29Y-Edmonton protocol, using L104EA29YIg, Sirolimus and anti-IL-2R mAb. The control group included recipients treated with the "basic immunosuppressive regimen using rapamycin and anti-IL-2R alone." Tacrolimus was administered 0.05 mg / kg twice daily, days postoperatively 0-14 (target level 5-8) and 0.06 mg / kg daily (target level 3-5), days postoperatively 15-120. L104EA29YIg was administered intravenously to the operating site (10 mg / kg) and on day 4 after surgery (15 mg / kg), 14, 28, 42, 56, 70, 84, 98, 112, 126 (20 mg / kg) to maintain serum at a level greater than 30 μg / ml. Chimeric anti-human IL-2R mAbs (0.3 mg / kg iv) were administered to the surgical site the day after surgery 4. Sirolimus (Rapamune®) was administered orally 1.25 mg / kg twice daily (target level 10-15), postoperative day 0-50, 1 mg / kg twice daily (target level 7-10), days postoperative 50 -100 and then tapered down to completion to day 130. Sirolimus (Rapamune®) and Tacrolimus (Prograf®) were purchased from Emory University Hospital Pharmacy. Chimeric anti-human IL-2R mAb (Simulect®) was supplied from Novartis Pharma AG (Basel, Switzerland).

Autopsy. All recipients had a full postmortem examination carried out by the Yerkes Veterinary Staff immediately after death.

Detection of anti-donor antibodies. The presence of detectable donor specific alloantibodies was determined by flow cytometry. Peripheral blood leukocytes served as target cells for pre-transplant analysis. Leukocytes isolated from mesenteric lymph nodes during transplantation were the target cells for post-transplant testing.

Statistics. Islet graft survival in the experimental group was compared using the Mann-Whitney-Wilcoxon test (Armitage et al. (1987) Statistical methods in Medical Research, Blackwell Scientific Publication, Oxford).

Anti-donor enzyme immunoassay. Responses were measured by interferon-γ (IFN-γ) enzyme immunoassay (ELISpot) using peripheral blood leukocytes obtained from recipient and donor animals. Equal numbers of irradiated stimulators (donor leukocytes) and respondents (recipient leukocytes) were added to cellulose ester backed plates (Millipore, Bedford, MA) coated with anti-human IFN-γ uptake antibody (GZ-4 clone; Mebtech, Sweden) . After 14-16 hours of incubation, biotinylated mouse anti-human IFN-γ (clone 7-B6-1; Mebtech, Sweden) was added, unbound antibody was removed, and horseradish-Avidin D peroxidase (Vector, Burlingame, CA) was added. Each spot represented an IFN-γ secreting cell; the frequency of these cells can be determined by dividing the number of stains produced by the total number of responder cells coated.

Results:

CD28 pathway blockade therapy prolongs islet allograft survival in rhesus macaques. Diabetes was induced by surgical excision of the pancreas of recipient animals and confirmed by intravenous glucose tolerance test, prior to transplant. The donor-recipient pairing was determined by molecular typing using a panel of predetermined major histocompatibility alleles (8 class I and 12 class II) (Lobashevsky A. et al., Tissue Antigens 54: 254-263 (1999); Knapp LA et al. Tissue Antigens 50: 657-661 (1997); Watkins DI Crit Rev Immunol 15: 1-29 (1995)). Mating maximized mismatch in loci of both Class I and II. Rejection was defined as two consecutive fasting blood glucose values&gt; 125 mg / dL on consecutive days. Portal vein infusion of allogeneic islets (&gt; 10,000 IEQ / kg) resulted in initial restoration of euglycemia and insulin independence in diabetic monkeys in both groups.

Treatment of pancreatic removed macaques with the L104EA2 9YIg / Rapamycin / anti-IL-2R mAb regimen significantly prolonged islet allograft survival (204, 190, 216,&gt; 200 and 56 days, respectively). Animals receiving the L104EA29YIg / Rapamycin / anti-IL-2R mAb regimen showed adequate glucose control, as indicated by fasting blood glucose (Figures 5 and 16B). In addition, these animals did not require insulin replacement therapy for a much longer period of time (Fig. 6). In contrast, those animals that received the basal regimen alone (Rapamycin / anti-IL-2R mAb) rejected islet transplant within one week (Fig. 16C). Control animals showed significantly elevated plasma glucose levels (Fig. 5). Further, control animals required insulin replacement therapy within one week of islet transplantation (Figure 6). Four of the five animals receiving the L104EA29YIg regimen enjoyed the experience

No rejection, for the duration of the treatment period (Table III). The intravenous glucose tolerance test with measurement of insulin and glucose levels confirmed the islet function after transplantation (representative animal, Figures 7 and 16D).

Table III

Islet allograft survival and treatment

<td colspan="6">Mismatch MHC (n)</td>

<td></td><td>IEQ / kg</td><td>Experience *</td><td>Treatment</td><td>Class I</td><td>Class II</td>

<td>RKf-7</td><td> 22,250</td><td> 204</td><td>LEA29Y / Rapa / aIL-2R</td><td> 2</td><td>ND</td>

<td>RUf-7</td><td> 17,087</td><td> 190</td><td>LEA29Y / Rapa / aIL-2R</td><td>ND</td><td> 3</td>

<td>RRe-7</td><td> 20,266</td><td> 216</td><td>LEA29Y / Rapa / aIL-2R</td><td> 2</td><td> 6</td>

<td>RWt-6</td><td> 16,033</td><td> 56</td><td>LEA29Y / Rapa / aIL-2R</td><td> 2</td><td> 3</td>

<td>RMv-6</td><td> 8,201</td><td> &gt;220</td><td>LEA29Y / Rapa / aIL-2R</td><td> 1</td><td> 3</td>

<td>RQz-6</td><td> 12,980</td><td> 7</td><td>Rapa / aIL-2R</td><td> 2</td><td> 5</td>

<td>RIb-7</td><td> 10,903</td><td> 7</td><td>Rapa / aIL-2R</td><td> 1</td><td> 4</td>

Insulin independence. ND, not detected in alleles that were typed.

At 100 days post-transplant, rapamycin dosing was reduced and minimized to zero on day 121. The animals still maintained insulin independence while receiving treatment with L104EA29YIg alone. At ~ 150 days post-transplant, the remaining islet recipients received their final dose of L104EA29YIg, terminating any immunosuppressive therapy.

As expected, ~ 1-2 months after discontinuation of therapy, recipients developed hyperglycemia and required therapy with exogenous insulin. Histological analysis revealed mononuclear cell infiltration strongly suggesting rejection as the etiology of loss of glucose control (Figure 17). In the intravenous glucose tolerance test, test animals receiving the L104EA29YIg / Rapamycin / anti-IL-2R mAb regimen showed normal glucose levels after islet transplantation (Figures 7 and 16D).

The frequency of anti-donor IFN-γ producing cells was detected by ELISpot and analyzed using the Immunospot imaging system. Animals receiving the basal immunosuppressive regimen alone demonstrated greater numbers of donor-reactive IFNγ-producing T cells (84 ± 4.6 cells), while animals receiving the L104EA29YIg regimen showed no detectable response (2 ± 0.56 cells).

L104EA29YIg therapy inhibits the anti-donor T and B cell response. The frequency of stimulated alloreactive T cells can be effectively detected using the ELISpot assay, which can discriminate IFN-γ production at the single cell level. Peripheral blood samples from islet recipients were analyzed at various time points both before and after transplantation for their ability to produce IFN-γ in response to the donor antigen. Animals treated with the basal regimen alone rapidly developed a measurable anti-donor response that coincided with rejection 1 week post-transplant. In contrast, the frequency of anti-donor IFN-γ producing cells in animals receiving the L104EA29YIg regimen was undetectable until treatment discontinued (representative animals, Figures 18A and B). Thus, the L104EA29YIg regimen successfully blocked the generation of an anti-donor T cell response as measured by the ability to produce IFN-γ.

Flow cytometry was used to test the development of an anti-donor antibody response. One animal in the control group generated a strong anti-donor Ab response, while the other failed to develop a detectable response, possibly because it was anesthetized before it was possible to measure the generation of an antibody response (Fig. 18C). In contrast, four out of five animals failed to generate an antibody response while receiving L104EA29YIg therapy. This is consistent with the previously described

Using CTLA4-Ig in an islet transplant model (Levisetti, MG et al., J Immunol 159: 5187-5191, 1997) as well as our experiments in a renal allograft model where the recipient failed to generate an anti-donor antibody (Pearson T et al., (Abbreviation) In programs and acronyms of the 17th American Society of Transplant Physicians Annual Meeting, Chicago, May 10-14, 1997, Chicago, American Society of Transplant Physicians). One animal in five recipients had a rejection episode while receiving L104EA29YIg therapy and subsequently developed an anti-donor antibody response. As expected, the remaining four animals receiving the L104EA29YIg regimen in agreement developed an anti-donor antibody response around the rejection time (~ 200 days post-transplant, 50 days after the last dose of L104EA29YIg).

Islet transplantation is rapidly becoming a feasible option for patients with brittle type 1 diabetes. Recent reports describing a steroid-free immunosuppressive regimen resulting in satisfactory insulin independence after islet transplantation have given rise to new optimism regarding the practical use of islet transplantation. While the elimination of glucocorticoids from immunosuppressive regimens is a major step towards strenuous treatment of type 1 diabetes, relying on calcineurin inhibitor therapy for primary immunosuppression may limit the use of this approach. Calcineurin inhibitors have numerous undesirable side effects, including nephrotoxicity, diabetes, hypertension, disruption of fat metabolism, and hirsutism (Kahan BD et al., N Engl J Med 321: 1725-1738, 1989; Group TUSMFLS: A comparison of tacrolimus (FK 506) and cyclosporine for immunosupression in liver transplantation: the US Multicenter FK506 Liver Study Group. N Engl J Med 331: 1110-1115,1994; de Mattos AM et al., Am J Kidney Disease 35: 333-346,2000). Even when drug levels are kept low, significant side effects can develop. This is especially true in the diabetic patient population where renal function may already be impaired. In fact, in the most recent report from Edmonton, two patients with mildly elevated creatinine levels before transplantation had significantly reduced kidney function during calcineurin inhibitor therapy and strongly required withdrawal of the drug (Ryan EA et al., Diabetes 50: 710-719, 2001) . In the same report, two-thirds of recipients developed some degree of glucose intolerance, with one-fourth developing true post-transplant diabetes considered to be related to tacrolimus use. This underlines the appealing and essential nature of a calcineurin-free immunosuppressive regimen, especially in islet transplantation.

Blockade of T cell costimulatory pathways is a promising strategy to develop nontoxic, immunosuppressive and potentially tolerant regimens. This approach takes into account those T cells that receive "signal 1 during the dosing period." For example, treatment in the peri-transplant period is believed to render allospecific T cells powerless when encountering the new organ or tissue, while other T cells remain undisturbed (Li Y et al., Nat Med 5: 1298-1302, 1999). The blockade of the CD28 / B7 pathway has proved to be of great promise in experimental autoimmune and transplant models, making this blockage a particularly appealing immunosuppressive target in islet transplantation where both autoimmune and alloimmune obstacles are likely to exist. The potential for blocking CD28 in a large animal transplant model has been reported by Levisetti MG et al (J Immunol 159: 5187-5191, 1997). CTLA4-Ig treatment was found to have a significant, though moderate, prolongation of islet allograft survival in non-human primates (Levisetti MG et al., J Immunol 159: 5187-5191, 1997). CTLA4-Ig monotherapy slightly prolongs renal allograft survival (Pearson T et al., (Abbreviation). Programs and Abstracts of the 17th American Society of Transplant Physicians Annual Meeting, Chicago, May 10-14, 1997, Chicago, American Society of Transplant. Physicians). Recently, there have been several reports of long-term survival of islet allografts in non-human primate models. Anti-CD40L mAb therapy gave the greatest results, however, as in the experiments using the kidney transplant model, no tolerance was achieved, along with withdrawal of therapy, transplant rejection occurred (Kenyon NS et al., Proc. Natl. Acad. Sci. USA 96: 8132 8137 (1999); Kirk AD et al., Nat. Med. 5, 686-693 (1999). In another encouraging report, Thomas et al. (Diabetes 50: 1227-1236, (2001)) recently described the use of the anti-CD3 immunotoxin and the DSG immunomodulatory agent (15-deoxyspergualin) as significantly prolonging islet survival in streptozotocin-induced diabetic primates. While promising, these reports used therapeutic agents whose clinical potential at the present time is still uncertain.

PL 204 899 B1

In vivo data using L104EA29YIg, a mutant form of CTLA4-Ig in a rhesus islet allograft model, is consistent with in vitro evidence that this second generation molecule is a more potent inhibitor of T cell responses than the parent molecule. Considering that CTLA4-Ig has already shown efficacy in a clinical trial in patients with psoriasis (Abrams JR et al., J.Clin. Invest. 103: 1243-1252 (1999)), there is considerable enthusiasm for these attempts using L104EA29YIg as the primary immunosuppressant. It is clearly compatible, if not synergistic, with clinically accepted immunosuppressants (anti-IL2R mAb and rapamycin) to aid in the planning of clinical trials. Initial human trials with L104EA29YIg are already taking place in rheumatoid arthritis patients and kidney transplant recipients. Although no direct comparison of the tacrolimus-based protocol with the L104EA29YIg regimen has been attempted, due to the reported unacceptable toxicity in non-human primates (Montgomery SP et al., Am J. Transplant 1 (Appendix 1): 438, 2001), our results suggest that L104EA29YIg has the potential to be at least as effective as tacrolimus as an immunosuppressant.

Conclusions:

A novel immunosuppressive regimen devoid of calcineurin inhibitor / steroids is described that provides significant protection against rejection and prolongs islet allograft survival in non-human primates. The biological agent L104EA29YIg is a potent immunosuppressant. L104EA29YIg can replace Tacrolimus in the Edmonton protocol, thereby eliminating the undesirable side effects of the calcineurin inhibitor.

PL 204 899 B1

Sequence List &lt;110&gt; Emory University

Larsen, Christian P. Pearson, Thomas C. Adams, Andrew B. &lt;120&gt; Methods of protecting islet allograft using soluble CTLA4 mutant molecules &lt;130&gt; D0173PCT / 30436.62WOU1 &lt;140&gt; PCT / US02 / 16708 &lt;141&gt; 2002-05 -23 &lt;150&gt; 60/293 402 &lt;151&gt; 2001-05-23 &lt;160&gt; 18 &lt;170&gt; Patentln version 3.1 &lt;210&gt; 1 &lt;211&gt; 636 &lt;212&gt; DNA &lt;213&gt; Homo sapiens &lt;400&gt; 1

<td>atgggtgtac</td><td>tgctcacaca</td><td>gaggacgctg</td><td>ctcagtctgg</td><td>tccttgcact</td><td>cctgtttcca</td><td> 60</td>

<td>agcatggcga</td><td>gcatggcaat</td><td>gcacgtggcc</td><td>cagcctgctg</td><td>tggtactggc</td><td>cagcagccga</td><td> 120</td>

<td>ggcatcgcca</td><td>gctttgtgtg</td><td>tgagtatgca</td><td>tctccaggca</td><td>aagccactga</td><td>ggtccgggtg</td><td> 180</td>

<td>acagtgcttc</td><td>ggcaggctga</td><td>cagccaggtg</td><td>actgaagtct</td><td>gtgcggcaac</td><td>ctacatgatg</td><td> 240</td>

<td>gggaatgagt</td><td>tgaccttcct</td><td>agatgattcc</td><td>atctgcacgg</td><td>gcacctccag</td><td>tggaaatcaa</td><td> 300</td>

<td>gtgaacctca</td><td>ctatccaagg</td><td>actgagggcc</td><td>atggacacgg</td><td>gactctacat</td><td>ctgcaaggtg</td><td> 360</td>

<td>gagctcatgt</td><td>acccaccgcc</td><td>atactacctg</td><td>ggcataggca</td><td>acggaaccca</td><td>gatttatgta</td><td> 420</td>

<td>attgatccag</td><td>aaccgtgccc</td><td>agattctgac</td><td>ttcctcctct</td><td>ggatccttgc</td><td>agcagttagt</td><td> 480</td>

<td>tcggggttgt</td><td>ttttttatag</td><td>ctttctcctc</td><td>acagctgttt</td><td>ctttgagcaa</td><td>aatgctaaag</td><td> 540</td>

<td>aaaagaagcc</td><td>ctcttacaac</td><td>aggggtctat</td><td>gtgaaaatgc</td><td>ccccaacaga</td><td>gccagaatgt</td><td> 600</td>

PL 204 899 B1

<td>gaaaagcaat</td><td>ttcagcctta ttttattccc atcaat</td><td> 636</td>

<td> &lt;210&gt;</td><td> 2</td><td></td>

<td> &lt;211&gt;</td><td> 212</td><td></td>

<td> &lt;212&gt;</td><td>PRT</td><td></td>

<td> &lt;213&gt;</td><td>Homo sapiens</td><td></td>

<td> &lt;400&gt;</td><td> 2</td><td></td>

<td colspan="2">Met Gly Val Leu Leu Thr Gin Arg Thr Leu Leu Ser Leu Val Leu Ala</td><td></td>

10 15

Leu Leu Phe Pro Ser Met Ala Ser Met Ala Met His Val Ala Gin Pro

25 30

Ala Val Val Leu Ala Cheese Arg Gly Ile Ala Cheese Phe Val Cys Glu

40 45

Tyr Ala Ser Pro Gly Lys Ala Thr Glu Val Arg Val Thr Val Leu Arg

55 60

Gin Ala Asp Ser Gin Val Thr Glu Val Cys Ala Ala Thr Tyr Met Met

70 75 80

Gly Asn Glu Leu Thr Phe Leu Asp Asp Ser Ile Cys Thr Gly Thr Ser

90 95

Ser Gly Asn Gin Val Asn Leu Thr Ile Gin Gly Leu Arg Ala Met Asp

100 105 110

Thr Gly Leu Tyr Ile Cys Lys Val Glu Leu Met Tyr Pro Pro Pro Tyr

115 120 125

Tyr Leu Gly Ile Gly Asn Gly Thr Gin Ile Tyr Val Ile Asp Pro Glu

130 135 140

Pro Cys Pro Asp Ser Asp Phe Leu Leu Trp Ile Leu Ala Ala Val Ser

145 150 155 160

Cheese Gly Leu Phe Phe Tyr Cheese Phe Leu Leu Thr Ala Val Ser Leu Ser

165 170 175

Lys Met Leu Lys Lys Arg Ser Pro Leu Thr Thr Gly Val Tyr Val Lys

PL 204 899 B1

180 185 190

Met Pro Pro Thr Glu Pro Glu Cys Glu Lys Gin Phe Gin Pro Tyr Phe

195 200 205

Ile Pro Ile Asn

210 &lt;210&gt; 3 &lt;211&gt; 1152 &lt;212&gt; DNA &lt;213&gt; Dummy &lt;220&gt;

&lt;223&gt; Artificial sequence description: CTLA4Ig sequence &lt;400&gt; 3

<td>atgggtgtac</td><td>tgctcacaca</td><td>gaggacgctg</td><td>ctcagtctgg</td><td>tccttgcact</td><td>cctgtttcca</td><td> 60</td>

<td>agcatggcga</td><td>gcatggcaat</td><td>gcacgtggcc</td><td>cagcctgctg</td><td>tggtactggc</td><td>cagcagccga</td><td> 120</td>

<td>ggcatcgcta</td><td>gctttgtgtg</td><td>tgagtatgca</td><td>tctccaggca</td><td>aagccactga</td><td>ggtccgggtg</td><td> 180</td>

<td>acagtgcttc</td><td>gg caggctga</td><td>cagccaggtg</td><td>actgaagtct</td><td>gtgcggcaac</td><td>ctacatgatg</td><td> 240</td>

<td>gggaatgagt</td><td>tgaccttcct</td><td>agatgattcc</td><td>atctgcacgg</td><td>gcacctccag</td><td>tggaaatcaa</td><td> 300</td>

<td>gtgaacctca</td><td>ctatccaagg</td><td>actgagggcc</td><td>atggacacgg</td><td>gactctacat</td><td>ctgcaaggtg</td><td> 360</td>

<td>gagctcatgt</td><td>acccaccgcc</td><td>atactacctg</td><td>ggcataggca</td><td>acggaaccca</td><td>gatttatgta</td><td> 420</td>

<td>attgatccag</td><td>aaccgtgccc</td><td>agattctgat</td><td>caggagccca</td><td>aatcttctga</td><td>caaaactcac</td><td> 480</td>

<td>acatccccac</td><td>cgtccccagc</td><td>acctgaactc</td><td>ctgggtggat</td><td>cgtcagtctt</td><td>cctcttcccc</td><td> 540</td>

<td>ccaaaaccca</td><td>aggacaccct</td><td>catgatctcc</td><td>cggacccctg</td><td>aggtcacatg</td><td>cgtggtggtg</td><td> 600</td>

<td>gacgtgagcc</td><td>acgaagaccc</td><td>tgaggtcaag</td><td>ttcaactggt</td><td>acgtggacgg</td><td>cgtggaggtg</td><td> 660</td>

<td>cataatgcca</td><td>agacaaagcc</td><td>gcgggaggag</td><td>cagtacaaca</td><td>gcacgtaccg</td><td>ggtggtcagc</td><td> 720</td>

<td>gtcctcaccg</td><td>tcctgcacca</td><td>ggactggctg</td><td>aatggcaagg</td><td>agtacaagtg</td><td>caaggtctcc</td><td> 780</td>

<td>aacaaagccc</td><td>tcccagcccc</td><td>catcgagaaa</td><td>accatctcca</td><td>aagccaaagg</td><td>gcagccccga</td><td> 840</td>

<td>gaaccacagg</td><td>tgtacaccct</td><td>gcccccatcc</td><td>cgggatgagc</td><td>tgaccaagaa</td><td>ccaggtcagc</td><td> 900</td>

<td>ctgacctgcc</td><td>tggtcaaagg</td><td>cttctatccc</td><td>agcgacatcg</td><td>ccgtggagtg</td><td>ggagagcaat</td><td> 960</td>

<td>gggcagccgg</td><td>agaacaacta</td><td>caagaccacg</td><td>cctcccgtgc</td><td>tggactccga</td><td>cggctccttc</td><td> 1020</td>

PL 204 899 B1

<td>ttcctctaca</td><td>gcaagctcac</td><td>cgtggacaag</td><td>agcaggtggc</td><td>agcaggggaa</td><td>cgtcttctca</td><td> 1080</td>

<td>tgctccgtga</td><td>tgcatgaggc</td><td>tctgcacaac</td><td>cactacacgc</td><td>agaagagcct</td><td>ctccctgtct</td><td> 1140</td>

<td>ccgggtaaat</td><td>ga</td><td></td><td></td><td></td><td></td><td> 1152</td>

&lt;210&gt; 4 &lt;211&gt; 383 &lt;212&gt; PRT &lt;213&gt; Dummy &lt;220&gt;

&lt;223&gt; Artificial sequence description: CTLA4Ig sequence &lt;400&gt; 4

Met Gly Val Leu Leu Thr Gin Arg Thr Leu Leu Ser Leu Val Leu Ala

10 15

Leu Leu Phe Pro Ser Met Ala Ser Met Ala Met His Val Ala Gin Pro

25 30

Ala Val Val Leu Ala Cheese Arg Gly Ile Ala Cheese Phe Val Cys Glu

40 45

Tyr Ala Ser Pro Gly Lys Ala Thr Glu Val Arg Val Thr Val Leu Arg

55 60

Gin Ala Asp Ser Gin Val Thr Glu Val Cys Ala Ala Thr Tyr Met Met

70 75 80

Gly Asn Glu Leu Thr Phe Leu Asp Asp Ser Ile Cys Thr Gly Thr Ser

90 95

Ser Gly Asn Gin Val Asn Leu Thr Ile Gin Gly Leu Arg Ala Met Asp

100 105 110

Thr Gly Leu Tyr Ile Cys Lys Val Glu Leu Met Tyr Pro Pro Pro Tyr

115 120 125

Tyr Leu Gly Ile Gly Asn Gly Thr Gin Ile Tyr Val Ile Asp Pro Glu

130 135 140

Pro Cys Pro Asp Ser Asp Gin Glu Pro Lys Ser Ser Asp Lys Thr His

PL 204 899 B1

145 150 155 160

Thr Ser Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val

165 170 175

Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

180 185 190

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

195 200 205

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

210 215 220

Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr Tyr Arg Val Val Ser

225 230 235 240

Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys

245 250 255

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

260 265 270

Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro

275 280 285

Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val Ser Leu Thr Cys Leu

290 295 300

Val Lys Gly Phe Tyr Pro Cheese Asp Ile Ala Val Glu Trp Glu Cheese Asn

305 310 315 320

Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

325 330 335

Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg 340 345 350

Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu 355 360 365

His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Pro Gly Lys

370 375 380

PL 204 899 B1 &lt;210&gt; 5 &lt;211&gt; 1152 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Artificial sequence description: L104EA29YIg sequence &lt;400&gt; 5

<td>atgggtgtac</td><td>tgctcacaca</td><td>gaggacgctg</td><td>ctcagtctgg</td><td>tccttgcact</td><td>cctgtttcca</td><td> 60</td>

<td>agcatggcga</td><td>gcatggcaat</td><td>gcacgtggcc</td><td>cagcctgctg</td><td>tggtactggc</td><td>cagcagccga</td><td> 120</td>

<td>ggcatcgcta</td><td>gctttgtgtg</td><td>tgagtatgca</td><td>tctccaggca</td><td>aatatactga</td><td>ggtccgggtg</td><td> 180</td>

<td>acagtgcttc</td><td>ggcaggctga</td><td>cagccaggcg</td><td>accgaagccc</td><td>gcgcggcaac</td><td>ccacatgacg</td><td> 240</td>

<td>gggaatgagt</td><td>tgaccttcct</td><td>agatgattcc</td><td>atctgcacgg</td><td>gcacctccag</td><td>tggaaatcaa</td><td> 300</td>

<td>gtgaacctca</td><td>ctatccaagg</td><td>actgagggcc</td><td>atggacacgg</td><td>gactctacat</td><td>ctgcaaggtg</td><td> 360</td>

<td>gagctcatgt</td><td>acccaccgcc</td><td>atactacgag</td><td>ggcataggca</td><td>acggaaccca</td><td>gatttatgta</td><td> 420</td>

<td>attgatccag</td><td>aaccgtgccc</td><td>agattctgat</td><td>caggagccca</td><td>aatcttctga</td><td>caaaactcac</td><td> 480</td>

<td>acatccccac</td><td>cgtccccagc</td><td>acctgaactc</td><td>ctggggggat</td><td>cgtcagtctt</td><td>cctcttcccc</td><td> 540</td>

<td>ccaaaaccca</td><td>aggacaccct</td><td>catgatctcc</td><td>cggacccctg</td><td>aggtcacatg</td><td>cgtggtggtg</td><td> 600</td>

<td>gacgtgagcc</td><td>acgaagaccc</td><td>tgaggtcaag</td><td>ttcaactggt</td><td>acgtggacąg</td><td>cgtggaggtg</td><td> 660</td>

<td>cataatgcca</td><td>agacaaagcc</td><td>gcgggaggag</td><td>cagtacaaca</td><td>gcacgtaccg</td><td>tgtggtcagc</td><td> 720</td>

<td>gtcctcaccg</td><td>tcctgcacca</td><td>ggactggctg</td><td>aatggcaagg</td><td>agtacaagtg</td><td>caaggtctcc</td><td> 780</td>

<td>aacaaagccc</td><td>tcccagcccc</td><td>catcgagaaa</td><td>accatctcca</td><td>aagccaaagg</td><td>gcagccccga</td><td> 840</td>

<td>gaaccacagg</td><td>tgtacaccct</td><td>gcccccatcc</td><td>cgggatgagc</td><td>tgaccaagaa</td><td>ccaggtcagc</td><td> 900</td>

<td>ctgacctgcc</td><td>tggtcaaagg</td><td>cttctatccc</td><td>agcgacatcg</td><td>ccgtggagtg</td><td>ggagagcaat</td><td> 960</td>

<td>gggcagccgg</td><td>agaacaacta</td><td>caagaccacg</td><td>cctcccgtgc</td><td>tggactccga</td><td>cggctccttc</td><td> 1020</td>

<td>ttcctctaca</td><td>gcaagctcac</td><td>cgtggacaag</td><td>agcaggtggc</td><td>agcaggggaa</td><td>cgtcttctca</td><td> 1080</td>

<td>tgctccgtga</td><td>tgcatgaggc</td><td>tctgcacaac</td><td>cactacacgc</td><td>agaagagcct</td><td>ctccctgtct</td><td> 1140</td>

<td>ccgggtaaat</td><td>ga</td><td></td><td></td><td></td><td></td><td> 1152</td>

&lt;210&gt; 6 &lt;211&gt; 383

PL 204 899 B1 &lt;212&gt; PRT &lt;213&gt; Dummy &lt;220&gt;

&lt;223&gt; Artificial sequence description: L104EA29YIg sequence &lt;400&gt; 6

Met Gly Val Leu

Leu Leu Phe Pro

Ala Val Val Leu

Tyr Ala Ser Pro

Gin Ala Asp Ser.

Gly Asn Glu Leu

Gly Asn Gin Cheese

100

Thr Gly Leu Tyr

115

Tyr Glu Gly Ile

130

Pro Cys Pro Asp

145

Thr Ser Pro Pro

Phe Leu Phe Pro

180

Leu Thr Gin Arg

Met Ala Cheese Ser

Ala Cheese Ser Arg

Gly Lys Tyr Thr

Gin Val Thr Glu

Thr Phe Leu Asp

Val Asn Leu Thr

How many Cys Lys Val

120

Gly Asn Gly Thr

135

Asp Gin Glu cheese

150

Pro Ala Pro cheese

165

Pro Lys Pro Lys

Thr Leu Leu Ser

Met Ala. Met His

Gly Ile Ala Ser

Glu Val Arg Val

Val Cys Ala Ala

Asp Cheese Ile Cys

How many Gin Gly Leu

105

Glu Leu Met Tyr

Gin Ile Tyr Val

140

Pro Lys Ser Ser

155

Glu Leu Leu Gly

170

Asp Thr Leu Met

185

Leu Val Leu Ala

Val Ala Gin Pro

Phe Val Cys Glu

Thr Val Leu Arg

Thr Tyr Met Met

Thr Gly Thr Ser

Arg Ala Met Asp

110

Pro Pro Pro Tyr

125

How Much Asp Pro Glu

Asp Lys Thr His

160

Gly Cheese Val Cheese

175

How Much Ser Arg Thr

190

PL 204 899 B1

<td>Pro</td><td>Glu</td><td>Val 195</td><td>Thr</td><td>Cys</td><td>Val</td><td>Val</td><td>Val 200</td><td>Asp</td><td>Val</td><td>Cheese</td><td>His</td><td>Glu 205</td><td>Asp</td><td>Pro</td><td>Glu</td>

<td>Val</td><td>Lys</td><td>Phe</td><td>Asn</td><td>Trp</td><td>Tyr</td><td>Val</td><td>Asp</td><td>Gly</td><td>Val</td><td>Glu</td><td>Val</td><td>His</td><td>Asn</td><td>Ala</td><td>Lys</td>

<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>

<td>Thr</td><td>Lys</td><td>Pro</td><td>Arg</td><td>Glu</td><td>Glu</td><td>Gin</td><td>Tyr</td><td>Asn</td><td>Cheese</td><td>Thr</td><td>Tyr</td><td>Arg</td><td>Val</td><td>Val</td><td>Cheese</td>

<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>

<td>Val</td><td>Leu</td><td>Thr</td><td>Val</td><td>Leu</td><td>His</td><td>Gin</td><td>Asp</td><td>Trp</td><td>Leu</td><td>Asn</td><td>Gly</td><td>Lys</td><td>Glu</td><td>Tyr</td><td>Lys</td>

<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td>

<td>Cys</td><td>Lys</td><td>Val</td><td>Cheese</td><td>Asn</td><td>Lys</td><td>Ala</td><td>Leu</td><td>Pro</td><td>Ala</td><td>Pro</td><td>How much</td><td>Glu</td><td>Lys</td><td>Thr</td><td>How much</td>

<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td>

<td>Cheese</td><td>Lys</td><td>Ala</td><td>Lys</td><td>Gly</td><td>Gin</td><td>Pro</td><td>Arg</td><td>Glu</td><td>Pro</td><td>Gin</td><td>Val</td><td>Tyr</td><td>Thr</td><td>Leu</td><td>Pro</td>

<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td><td></td><td></td><td></td>

<td>Pro</td><td>Cheese</td><td>Arg</td><td>Asp</td><td>Glu</td><td>Leu</td><td>Thr</td><td>Lys</td><td>Asn</td><td>Gin</td><td>Val</td><td>Cheese</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td>

<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td>

<td>Val</td><td>Lys</td><td>Gly</td><td>Phe</td><td>Tyr</td><td>Pro</td><td>Cheese</td><td>Asp</td><td>How much</td><td>Ala</td><td>Val</td><td>Glu</td><td>Trp</td><td>Glu</td><td>Cheese</td><td>Asn</td>

<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td>

<td>Gly</td><td>Gin</td><td>Pro</td><td>Glu</td><td>Asn</td><td>Asn</td><td>Tyr</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Cheese</td>

<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td>

<td>Asp</td><td>Gly</td><td>Cheese</td><td>Phe</td><td>Phe</td><td>Leu</td><td>Tyr</td><td>Cheese</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Asp</td><td>Lys</td><td>Cheese</td><td>Arg</td>

<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>

<td>Trp</td><td>Gin</td><td>Gin</td><td>Gly</td><td>Asn</td><td>Val</td><td>Phe</td><td>Cheese</td><td>Cys</td><td>Cheese</td><td>Val</td><td>Underworld</td><td>His</td><td>Glu</td><td>Ala</td><td>Leu</td>

<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>

<td>His</td><td>Asn</td><td>His</td><td>Tyr</td><td>Thr</td><td>Gin</td><td>Lys</td><td>Cheese</td><td>Leu</td><td>Cheese</td><td>Leu</td><td>Cheese</td><td>Pro</td><td>Gly</td><td>Lys</td><td></td>

370 375 380

<td> &lt;210&gt;</td><td> 7</td>

<td> &lt;211&gt;</td><td> 1152</td>

<td> &lt;212&gt;</td><td>GOUT</td>

<td> &lt;213&gt;</td><td>Sequence</td>

<td> &lt;220&gt;</td><td></td>

Artificial sequence description: L104EIg sequence &lt;400&gt; 7

<td>atgggtgtac</td><td>tgctcacaca</td><td>gaggacgctg</td><td>ctcagtctgg</td><td>tccttgcact</td><td>cctgtttcca</td><td> 60</td>

<td>agcatggcga</td><td>gcatggcaat</td><td>gcacgtggcc</td><td>cagcctgctg</td><td>tggtactggc</td><td>cagcagccga</td><td> 120</td>

<td>ggcatcgcta</td><td>gctttgtgtg</td><td>tgagtatgca</td><td>tctccaggca</td><td>aagccactga</td><td>ggtccgggtg</td><td> 180</td>

<td>acagtgcttc</td><td>ggcaggctga</td><td>cagccaggtg</td><td>actgaagtct</td><td>gtgcggcaac</td><td>ctacatgatg</td><td> 240</td>

<td>gggaatgagt</td><td>tgaccttcct</td><td>agatgattcc</td><td>atctgcacgg</td><td>gcacctccag</td><td>tggaaatcaa</td><td> 300</td>

<td>gtgaacctca</td><td>ctatccaagg</td><td>actgagggcc</td><td>atggacacgg</td><td>gactctacat</td><td>ctgcaaggtg</td><td> 360</td>

<td>gagctcatgt</td><td>acccaccgcc</td><td>atactacgag</td><td>ggcataggca</td><td>acggaaccca</td><td>gatttatgta</td><td> 420</td>

<td>attgatccag</td><td>aaccgtgccc</td><td>agattctgat</td><td>caggagccca</td><td>aatcttctga</td><td>caaaactcac</td><td> 480</td>

<td>acatccccac</td><td>cgtccccagc</td><td>acctgaactc</td><td>ctggggggat</td><td>cgtcagtctt</td><td>cctcttcccc</td><td> 540</td>

<td>ccaaaaccca</td><td>aggacaccct</td><td>catgatctcc</td><td>cggacccctg</td><td>aggtcacatg</td><td>cgtggtggtg</td><td> 600</td>

<td>gacgtgagcc</td><td>acgaagaccc</td><td>tgaggtcaag</td><td>ttcaactggt</td><td>acgtggacgg</td><td>cgtggaggtg</td><td> 660</td>

<td>cataatgcca</td><td>agacaaagcc</td><td>gcgggaggag</td><td>cagtacaaca</td><td>gcacgtaccg</td><td>tgtggtcagc</td><td> 720</td>

<td>gtcctcaccg</td><td>tcctgcacca</td><td>ggactggctg</td><td>aatggcaagg</td><td>agtacaagtg</td><td>caaggtctcc</td><td> 780</td>

<td>aacaaagccc</td><td>tcccagcccc</td><td>catcgagaaa</td><td>accatctcca</td><td>aagccaaagg</td><td>gcagccccga</td><td> 840</td>

<td>gaaccacagg</td><td>tgtacaccct</td><td>gcccccatcc</td><td>cgggatgagc</td><td>tgaccaagaa</td><td>ccaggtcagc</td><td> 900</td>

<td>ctgacctgcc</td><td>tggtcaaagg</td><td>cttctatccc</td><td>agcgacatcg</td><td>ccgtggagtg</td><td>ggagagcaat</td><td> 960</td>

<td>gggcagccgg</td><td>agaacaacta</td><td>caagaccacg</td><td>cctcccgtgc</td><td>tggactccga</td><td>cggctccttc</td><td> 1020</td>

<td>ttcctctaca</td><td>gcaagctcac</td><td>cgtggacaag</td><td>agcaggtggc</td><td>agcaggggaa</td><td>cgtcttctca</td><td> 1080</td>

<td>tgctccgtga</td><td>tgcatgaggc</td><td>tctgcacaac</td><td>cactacacgc</td><td>agaagagcct</td><td>ctccctgtct</td><td> 1140</td>

ccgggtaaat ga &lt;210&gt; 8 &lt;211&gt; 383 &lt;212&gt; PRT &lt;213&gt; Dummy &lt;220&gt;

&lt;223&gt; Artificial sequence description: L104EIg sequence &lt;400&gt; 8

PL 204 899 B1

<img file="PL204899B1_D0001.tif" />

PL 204 899 B1

225 230 235 240

<td>Val</td><td>Leu</td><td>Thr</td><td>Val</td><td>Leu 245</td><td>His</td><td>Gin</td><td>Asp</td><td>Trp</td><td>Leu 250</td><td>Asn</td><td>Gly</td><td>Lys</td><td>Glu</td><td>Tyr 255</td><td>Lys</td>

<td>Cys</td><td>Lys</td><td>Val</td><td>Cheese</td><td>Asn</td><td>Lys</td><td>Ala</td><td>Leu</td><td>Pro</td><td>Ala</td><td>Pro</td><td>How much</td><td>Glu</td><td>Lys</td><td>Thr</td><td>How much</td>

<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td>

<td>Cheese</td><td>Lys</td><td>Ala</td><td>Lys</td><td>Gly</td><td>Gin</td><td>Pro</td><td>Arg</td><td>Glu</td><td>Pro</td><td>Gin</td><td>Val</td><td>Tyr</td><td>Thr</td><td>Leu</td><td>Pro</td>

<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td><td></td><td></td><td></td>

<td>Pro</td><td>Cheese</td><td>Arg</td><td>Asp</td><td>Glu</td><td>Leu</td><td>Thr</td><td>Lys</td><td>Asn</td><td>Gin</td><td>Val</td><td>Cheese</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td>

<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td>

<td>Val</td><td>Lys</td><td>Gly</td><td>Phe</td><td>Tyr</td><td>Pro</td><td>Cheese</td><td>Asp</td><td>How much</td><td>Ala</td><td>Val</td><td>Glu</td><td>Trp</td><td>Glu</td><td>Cheese</td><td>Asn</td>

<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td>

<td>Gly</td><td>Gin</td><td>Pro</td><td>Glu</td><td>Asn</td><td>Asn</td><td>Tyr</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Cheese</td>

<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td>

<td>Asp</td><td>Gly</td><td>Cheese</td><td>Phe</td><td>Phe</td><td>Leu</td><td>Tyr</td><td>Cheese</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Asp</td><td>Lys</td><td>Cheese</td><td>Arg</td>

<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td></td><td> 350</td>

<td>Trp</td><td>Gin</td><td>Gin</td><td>Gly</td><td>Asn</td><td>Val</td><td>Phe</td><td>Cheese</td><td>Cys</td><td>Cheese</td><td>Val</td><td>Underworld</td><td>His</td><td>Glu</td><td>Ala</td><td>Leu</td>

<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>

<td>His</td><td>Asn</td><td>His</td><td>Tyr</td><td>Thr</td><td>Gin</td><td>Lys</td><td>Cheese</td><td>Leu</td><td>Cheese</td><td>Leu</td><td>Cheese</td><td>Pro</td><td>Gly</td><td>Lys</td><td></td>

<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td><td></td>

<td colspan="2"> &lt;210&gt;</td><td> 9</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td colspan="2"> &lt;211&gt;</td><td colspan="2"> 1152</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td colspan="2"> &lt;212&gt;</td><td colspan="2">GOUT</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td colspan="2"> &lt;213&gt;</td><td colspan="3">Sequence a</td><td colspan="3">artificial</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

&lt;220&gt;

&lt;223&gt; Artificial sequence description: L104EA29LIg sequence &lt;400&gt; 9

<td>atgggtgtac</td><td>tgctcacaca</td><td>gaggacgctg</td><td>ctcagtctgg</td><td>tccttgcact</td><td>cctgtttcca</td><td> 60</td>

<td>agcatggcga</td><td>gcatggcaat</td><td>gcacgtggcc</td><td>cagcctgctg</td><td>tggtactggc</td><td>cagcagccga</td><td> 120</td>

<td>ggcatcgcta</td><td>gctttgtgtg</td><td>tgagtatgca</td><td>tctccaggca</td><td>aattgactga</td><td>ggtccgggtg</td><td> 180</td>

PL 204 899 B1

<td>acagtgcttc</td><td>ggcaggctga</td><td>cagccaggtg</td><td>actgaagtct</td><td>gtgcggcaac</td><td>ctacatgatg</td><td> 240</td>

<td>gggaatgagt</td><td>tgaccttcct</td><td>agatgattcc</td><td>atctgcacgg</td><td>gcacctccag</td><td>tggaaatcaa</td><td> 300</td>

<td>gtgaacctca</td><td>ctatccaagg</td><td>actgagggcc</td><td>atggacacgg</td><td>gactctacat</td><td>ctgcaaggtg</td><td> 360</td>

<td>gagctcatgt</td><td>acccaccgcc</td><td>atactacgag</td><td>ggcataggca</td><td>acggaaccca</td><td>gatttatgta</td><td> 420</td>

<td>attgatccag</td><td>aaccgtgccc</td><td>agattctgat</td><td>caggagccca</td><td>aatcttctga</td><td>caaaactcac</td><td> 480</td>

<td>acatccccac</td><td>cgtccccagc</td><td>acctgaactc</td><td>ctggggggat</td><td>cgtcagtctt</td><td>cctcttcccc</td><td> 540</td>

<td>ccaaaaccca</td><td>aggacaccct</td><td>catgatctcc</td><td>cggacccctg</td><td>aggtcacatg</td><td>cgtggtggtg</td><td> 600</td>

<td>gacgtgagcc</td><td>acgaagaccc</td><td>tgaggtcaag</td><td>ttcaactggt</td><td>acgtggacgg</td><td>cgtggaggtg</td><td> 660</td>

<td>cataatgcca</td><td>agacaaagcc</td><td>gcgggaggag</td><td>cagtacaaca</td><td>gcacgtaccg</td><td>tgtggtcagc</td><td> 720</td>

<td>gtcctcaccg</td><td>tcctgcacca</td><td>ggactggctg</td><td>aatggcaagg</td><td>agtacaagtg</td><td>caaggtctcc</td><td> 780</td>

<td>aacaaagccc</td><td>tcccagcccc</td><td>catcgagaaa</td><td>accatctcca</td><td>aagccaaagg</td><td>gcagccccga</td><td> 840</td>

<td>gaaccacagg</td><td>tgtacaccct</td><td>gcccccatcc</td><td>cgggatgagc</td><td>tgaccaagaa</td><td>ccaggtcagc</td><td> 900</td>

<td>ctgacctgcc</td><td>tggtcaaagg</td><td>cttctatccc</td><td>agcgacatcg</td><td>ccgtggagtg</td><td>ggagagcaat</td><td> 960</td>

<td>gggcagccgg</td><td>agaacaacta</td><td>caagaccacg</td><td>cctcccgtgc</td><td>tggactccga</td><td>cggctccttc</td><td> 1020</td>

<td>ttcctctaca</td><td>gcaagctcac</td><td>cgtggacaag</td><td>agcaggtggc</td><td>agcaggggaa</td><td>cgtcttctca</td><td> 1080</td>

<td>tgctccgtga</td><td>tgcatgaggc</td><td>tctgcacaac</td><td>caccacacgc</td><td>agaagagcct</td><td>ctccctgtct</td><td> 1140</td>

ccgggtaaat ga 1152 &lt;210&gt; 10 &lt;211&gt; 383 &lt;212&gt; PRT &lt;213&gt; Dummy &lt;220&gt;

&lt;223&gt; Artificial sequence description: L104EA29LIg sequence &lt;400&gt; 10

<td>Underworld</td><td>Gly</td><td>Val</td><td>Leu</td><td>Leu</td><td>Thr</td><td>Gin</td><td>Arg</td><td>Thr</td><td>Leu</td><td>Leu</td><td>Cheese</td><td>Leu</td><td>Val</td><td>Leu</td><td>Ala</td>

<td> 1</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td><td></td>

<td>Leu</td><td>Leu</td><td>Phe</td><td>Pro</td><td>Cheese</td><td>Underworld</td><td>Ala</td><td>Cheese</td><td>Underworld</td><td>Ala</td><td>Underworld</td><td>His</td><td>Val</td><td>Ala</td><td>Gin</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ala</td><td>Val</td><td>Val</td><td>Leu</td><td>Ala</td><td>Cheese</td><td>Cheese</td><td>Arg</td><td>Gly</td><td>How much</td><td>Ala</td><td>Cheese</td><td>Phe</td><td>Val</td><td>Cys</td><td>Glu</td>

PL 204 899 B1

40 45

Tyr Ala Ser Pro Gly Lys Leu Thr Glu Val Arg Val Thr Val Leu Arg

55 60 ~

Gin Ala Asp Ser Gin Val Thr Glu Val Cys Ala Ala Thr Tyr Met Met

70 75 80

Gly Asn Glu Leu Thr Phe Leu Asp Asp Ser Ile Cys Thr Gly Thr Ser

90 95

Ser Gly Asn Gin Val Asn Leu Thr Ile Gin Gly Leu Arg Ala Met Asp

100 105 110

Thr Gly Leu Tyr Ile Cys Lys Val Glu Leu Met Tyr Pro Pro Pro Tyr

115 120 125

Tyr Glu Gly Ile Gly Asn Gly Thr Gin Ile Tyr Val Ile Asp Pro Glu

130 135 140

Pro Cys Pro Asp Ser Asp Gin Glu Pro Lys Ser Ser Asp Lys Thr His

145 150 155 160

Thr Ser Pro Pro Ser Pro Ala Pro Glu Leu Leu Gly Gly Ser Ser Val

165 170 175

Phe, Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr

180 185 190

Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu

195 200 205

Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

210 215 220

Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr Tyr Arg Val Val Ser

225 230 235 240

Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys

245 250 255

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

260 265 270

PL 204 899 B1

<td>Cheese</td><td>Lys</td><td>Ala 275</td><td>Lys</td><td>Gly</td><td>Gin</td><td>Pro</td><td>Arg 280</td><td>Glu</td><td>Pro</td><td>Gin</td><td>Val</td><td>Tyr 285</td><td>Thr</td><td>Leu</td><td>Pro</td>

<td>Pro</td><td>Cheese</td><td>Arg</td><td>Asp</td><td>Glu</td><td>Leu</td><td>Thr</td><td>Lys</td><td>Asn</td><td>Gin</td><td>Val</td><td>Cheese</td><td>Leu</td><td>Thr</td><td>Cys</td><td>Leu</td>

<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td>

<td>Val</td><td>Lys</td><td>Gly</td><td>Phe</td><td>Tyr</td><td>Pro</td><td>Cheese</td><td>Asp</td><td>How much</td><td>Ala</td><td>Val</td><td>Glu</td><td>Trp</td><td>Glu</td><td>Cheese</td><td>Asn</td>

<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td>

<td>Gly</td><td>Gin</td><td>Pro</td><td>Glu</td><td>Asn</td><td>Asn</td><td>Tyr</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Cheese</td>

<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td>

<td>Asp</td><td>Gly</td><td>Cheese</td><td>Phe</td><td>Phe</td><td>Leu</td><td>Tyr</td><td>Cheese</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Asp</td><td>Lys</td><td>Cheese</td><td>Arg</td>

<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>

<td>Trp</td><td>Gin</td><td>Gin</td><td>Gly</td><td>Asn</td><td>Val</td><td>Phe</td><td>Cheese</td><td>Cys</td><td>Cheese</td><td>Val</td><td>Underworld</td><td>His</td><td>Glu</td><td>Ala</td><td>Leu</td>

<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>

<td>His</td><td>Asn</td><td>His</td><td>Tyr</td><td>Thr</td><td>Gin</td><td>Lys</td><td>Cheese</td><td>Leu</td><td>Cheese</td><td>Leu</td><td>Cheese</td><td>Pro</td><td>Gly</td><td>Lys</td><td></td>

370 375 380 &lt;210&gt; 11 &lt;211&gt; 1152 &lt;212&gt; DNA &lt;213&gt; Dummy &lt;220&gt;

&lt;223&gt; Artificial sequence description: L104EA29TIg sequence &lt;400&gt; 11

<td>atgggtgtac</td><td>tgctcacaca</td><td>gaggacgctg</td><td>ctcagtctgg</td><td>tccttgcact</td><td>cctgtttcca</td><td> 60</td>

<td>agcatggcga</td><td>gcatggcaat</td><td>gcacgtggcc</td><td>cagcctgctg</td><td>tggtactggc</td><td>cagcagccga</td><td> 120</td>

<td>ggcatcgcta</td><td>gctttgtgtg</td><td>tgagtatgca</td><td>tctccaggca</td><td>aaactactga</td><td>ggtccgggtg</td><td> 180</td>

<td>acagtgcttc</td><td>ggcaggctga</td><td>cagccaggtg</td><td>actgaagtct</td><td>gtgcggcaac</td><td>ctacatgatg</td><td> 240</td>

<td>gggaatgagt</td><td>tgaccttcct</td><td>agatgattcc</td><td>atctgcacgg</td><td>gcacctccag</td><td>tggaaatcaa</td><td> 300</td>

<td>gtgaacctca</td><td>ctatccaagg</td><td>actgagggcc</td><td>atggacacgg</td><td>gactctacat</td><td>ctgcaaggtg</td><td> 360</td>

<td>gagctcatgt</td><td>acccaccgcc</td><td>atactacgag</td><td>ggcataggca</td><td>acggaaccca</td><td>gatttatgta</td><td> 420</td>

<td>attgatccag</td><td>aaccgtgccc</td><td>agattctgat</td><td>caggagccca</td><td>aatcttctga</td><td>caaaactcac</td><td> 480</td>

PL 204 899 B1

<td>acatccccac</td><td>cgtccccagc</td><td>acctgaactc</td><td>ctggggggat</td><td>cgtcagtctt</td><td>cctcttcccc</td><td> 540</td>

<td>ccaaaaccca</td><td>aggacaccct</td><td>catgatctcc</td><td>cggacccctg</td><td>aggtcacatg</td><td>cgtggtggtg</td><td> 600</td>

<td>gacgtgagcc</td><td>acgaagaccc</td><td>tgaggtcaag</td><td>ttcaactggt</td><td>acgtggacgg</td><td>cgtggaggtg</td><td> 660</td>

<td>cataatgcca</td><td>agacaaagcc</td><td>gcgggaggag</td><td>cagtacaaca</td><td>gcacgtaccg</td><td>tgtggtcagc</td><td> 720</td>

<td>gtcctcaccg</td><td>tcctgcacca</td><td>ggactggctg</td><td>aatggcaagg</td><td>agtacaagtg</td><td>caaggtctcc</td><td> 780</td>

<td>aacaaagccc</td><td>tcccagcccc</td><td>catcgagaaa</td><td>accatctcca</td><td>aagccaaagg</td><td>gcagccccga</td><td> 840</td>

<td>gaaccacagg</td><td>tgtacaccct</td><td>gcccccatcc</td><td>cgggatgagc</td><td>tgaccaagaa</td><td>ccaggtcagc</td><td> 900</td>

<td>ctgacctgcc</td><td>tggtcaaagg</td><td>cttctatccc</td><td>agcgacatcg</td><td>ccgtggagtg</td><td>ggagagcaat</td><td> 960</td>

<td>gggcagccgg</td><td>agaacaacta</td><td>caagaccacg</td><td>cctcccgtgc</td><td>tggactccga</td><td>cggctccttc</td><td> 1020</td>

<td>ttcctctaca</td><td>gcaagctcac</td><td>cgtggacaag</td><td>agcaggtggc</td><td>agcaggggaa</td><td>cgtcttctca</td><td> 1080</td>

<td>tgctccgtga</td><td>tgcatgaggc</td><td>tctgcacaac</td><td>cactacacgc</td><td>agaagagcct</td><td>ctccctgtct</td><td> 1140</td>

ccgggtaaat ga 1152 &lt;210&gt; 12 &lt;211&gt; 383 &lt;212&gt; PRT &lt;213&gt; Dummy &lt;220&gt;

&lt;223&gt; Artificial sequence description: L104EA29TIg sequence &lt;400&gt; 12

Met Gly Val Leu Leu Thr Gin Arg Thr Leu Leu Ser Leu Val Leu Ala

10 15

Leu Leu Phe Pro Ser Met Ala Ser Met Ala Met His Val Ala Gin Pro

25 30

Ala Val Val Leu Ala Cheese Arg Gly Ile Ala Cheese Phe Val Cys Glu

40 45

Tyr Ala Ser Pro Gly Lys Thr Thr Glu Val Arg Val Thr Val Leu Arg

55 60

Gin Ala Asp Ser Gin Val Thr Glu Val Cys Ala Ala Thr Tyr Met Met

70 75 80

PL 204 899 B1

Gly Asn Glu Leu Thr Phe Leu Asp

Cheese Gly Asn Gin Val Asn Leu Thr

100

Thr Gly Leu Tyr Ile Cys Lys Val

115 120

Tyr Glu Gly Ile Gly Asn Gly Thr

130 135

Pro Cys Pro Asp Ser Asp Gin Glu

145 150

Thr Ser Pro Pro Ser Pro Ala Pro

165

Phe Leu Phe Pro Pro Lys Pro Lys

130

Pro Glu Val Thr Cys Val Val Val

195 200

Val Lys Phe Asn Trp Tyr Val Asp

210 215

Thr Lys Pro Arg Glu Glu Gin Tyr

225 230

Val Leu Thr Val Leu His Gin Asp

245

Cys Lys Val Ser Asn Lys Ala Leu

260

Lys Ala Cheese Lys Gly Gin Pro Arg

275 280

Pro Ser Arg Asp Glu Leu Thr Lys

290 295

Val Lys Gly Phe Tyr Pro Ser Asp

Asp Ser Ile Cys Thr Gly Thr Ser

95

Ile Gin Gly Leu Arg Ala Met Asp

105 110

Glu Leu Met Tyr Pro Pro Pro Tyr

125

Gin Ile Tyr Val Ile Asp Pro Glu

140

Pro Lys Ser Ser Asp Lys Thr His

155 160

Glu Leu Leu Gly Gly Cheese Cheese Val

170 175

Asp Thr Leu Met Ile Ser Arg Thr

185 190

Asp Val Ser His Glu Asp Pro Glu

205

Gly Val Glu Val His Asn Ala Lys

220

Asn Ser Thr Tyr Arg Val Val Ser

235

Trp Leu Asn Gly Lys Glu Tyr Lys

250 255 '

Pro Ala Pro Ile Glu Lys Thr Ile

265 270

Glu Pro Gin Val Tyr Thr Leu Pro

285

Asn Gin Val Ser Leu Thr Cys Leu

300

Ile Ala Val Glu Trp Glu Cheese Asn

PL 204 899 B1

<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td>

<td>Gly</td><td>Gin</td><td>Pro</td><td>Glu</td><td>Asn</td><td>Asn</td><td>Tyr</td><td>Lys</td><td>Thr</td><td>Thr</td><td>Pro</td><td>Pro</td><td>Val</td><td>Leu</td><td>Asp</td><td>Cheese</td>

<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td>

<td>Asp</td><td>Gly</td><td>Cheese</td><td>Phe</td><td>Phe</td><td>Leu</td><td>Tyr</td><td>Cheese</td><td>Lys</td><td>Leu</td><td>Thr</td><td>Val</td><td>Asp</td><td>Lys</td><td>Cheese</td><td>Arg</td>

<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>

<td>Trp</td><td>Gin</td><td>Gin</td><td>Gly</td><td>Asn</td><td>Val</td><td>Phe</td><td>Cheese</td><td>Cys</td><td>Cheese</td><td>Val</td><td>Underworld</td><td>His</td><td>Glu</td><td>Ala</td><td>Leu</td>

<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>

<td>His</td><td>Asn</td><td>His</td><td>Tyr</td><td>Thr</td><td>Gin</td><td>Lys</td><td>Cheese</td><td>Leu</td><td>Cheese</td><td>Leu</td><td>Cheese</td><td>Pro</td><td>Gly</td><td>Lys</td><td></td>

370 375 380 &lt;210&gt; 13 &lt;211&gt; 1152 &lt;212&gt; DNA

<td colspan="2">&lt;213&gt; sequence</td><td colspan="5">artificial</td>

<td> &lt;220&gt;</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td colspan="6">&lt;223&gt; Artificial sequence description: L104EA29WIg sequence</td><td></td>

<td> &lt;400&gt; 13</td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>atgggtgtac</td><td>tgctcacaca</td><td>gaggacgctg</td><td>ctcagtctgg</td><td>tccttgcact</td><td>cctgtttcca</td><td> 60</td>

<td>agcatggcga</td><td>gcatggcaat</td><td>gcacgtggcc</td><td>cagcctgctg</td><td>tggtactggc</td><td>cagcagccga</td><td> 120</td>

<td>ggcatcgcta</td><td>gctttgtgtg</td><td>tgagtatgca</td><td>tctccaggca</td><td>aatggactga</td><td>ggtccgggtg</td><td> 180</td>

<td>acagtgcttc</td><td>ggcaggctga</td><td>cagccaggtg</td><td>actgaagtct</td><td>gtgcggcaac</td><td>ctacatgatg</td><td> 240</td>

<td>gggaatgagt</td><td>tgaccttcct</td><td>agatgattcc</td><td>atctgcacgg</td><td>gcacctccag</td><td>tggaaatcaa</td><td> 300</td>

<td>gtgaacctca</td><td>ctatccaagg</td><td>actgagggcc</td><td>atggacacgg</td><td>gactctacat</td><td>ctgcaaggtg</td><td> 360</td>

<td>gagctcatgt</td><td>acccaccgcc</td><td>atactacgag</td><td>ggcataggca</td><td>acggaaccca</td><td>gatttatgta</td><td> 420</td>

<td>attgatccag</td><td>aaccgtgccc</td><td>agattctgat</td><td>caggagccca</td><td>aatcttctga</td><td>caaaactcac</td><td> 480</td>

<td>acatccccac</td><td>cgtccccagc</td><td>acctgaactc</td><td>ctggggggat</td><td>cgtcagtctt</td><td>cctcttcccc</td><td> 540</td>

<td>ccaaaaccca</td><td>aggacaccct</td><td>catgatctcc</td><td>cggacccctg</td><td>aggtcacatg</td><td>cgtggtggtg</td><td> 600</td>

<td>gacgtgagcc</td><td>acgaagaccc</td><td>tgaggtcaag</td><td>ttcaactggt</td><td>acgtggacgg</td><td>cgtggaggtg</td><td> 660</td>

<td>cataatgcca</td><td>agacaaagcc</td><td>gcgggaggag</td><td>cagtacaaca</td><td>gcacgtaccg</td><td>tgtggtcagc</td><td> 720</td>

<td>gtcctcaccg</td><td>tcctgcacca</td><td>ggactggctg</td><td>aatggcaagg</td><td>agtacaagtg</td><td>caaggtctcc</td><td> 780</td>

PL 204 899 B1

<td>aacaaagccc</td><td>tcccagcccc</td><td>catcgagaaa</td><td>accatctcca</td><td>aagccaaagg</td><td>gcagccccga</td><td> 840</td>

<td>gaaccacagg</td><td>tgtacaccct</td><td>gcccccatcc</td><td>cgggatgagc</td><td>tgaccaagaa</td><td>ccaggtcagc</td><td> 900</td>

<td>ctgacctgcc</td><td>tggtcaaagg</td><td>cttctatccc</td><td>agcgacatcg</td><td>ccgtggagtg</td><td>ggagagcaat</td><td> 960</td>

<td>gggcagccgg</td><td>agaacaacta</td><td>caagaccacg</td><td>cctcccgtgc</td><td>tggactccga</td><td>cggctccttc</td><td> 1020</td>

<td>ttcctctaca</td><td>gcaagctcac</td><td>cgtggacaag</td><td>agcaggtggc</td><td>agcaggggaa</td><td>cgtcttctca</td><td> 1080</td>

<td>tgctccgtga</td><td>tgcatgaggc</td><td>tctgcacaac</td><td>cactacacgc</td><td>agaagagcct</td><td>ctccctgtct</td><td> 1140</td>

ccgggtaaat ga 1152 &lt;210&gt; 14 &lt;211&gt; 383 &lt;212&gt; PRT &lt;213&gt; Dummy &lt;220&gt;

&lt;223&gt; Artificial sequence description: L104EA29WIg sequence &lt;400&gt; 14

<td>Underworld</td><td>Gly</td><td>Val</td><td>Leu</td><td>Leu</td><td>Thr</td><td>Gin</td><td>Arg</td><td>Thr</td><td>Leu</td><td>Leu</td><td>Cheese</td><td>Leu</td><td>Val</td><td>Leu</td><td>Ala</td>

<td> 1</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td><td></td>

<td>Leu</td><td>Leu</td><td>Phe</td><td>Pro</td><td>Cheese</td><td>Underworld</td><td>Ala</td><td>Cheese</td><td>Underworld</td><td>Ala</td><td>Underworld</td><td>His</td><td>Val</td><td>Ala</td><td>Gin</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ala</td><td>Val</td><td>Val</td><td>Leu</td><td>Ala</td><td>Cheese</td><td>Cheese</td><td>Arg</td><td>Gly</td><td>How much</td><td>Ala</td><td>Cheese</td><td>Phe</td><td>Val</td><td>Cys</td><td>Glu</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Tyr</td><td>Ala</td><td>Cheese</td><td>Pro</td><td>Gly</td><td>Lys</td><td>Trp</td><td>Thr</td><td>Glu</td><td>Val</td><td>Arg</td><td>Val</td><td>Thr</td><td>Val</td><td>Leu</td><td>Arg</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Gin</td><td>Ala</td><td>Asp</td><td>Cheese</td><td>Gin</td><td>Val</td><td>Thr</td><td>Glu</td><td>Val</td><td>Cys</td><td>Ala</td><td>Ala</td><td>Thr</td><td>Tyr</td><td>Underworld</td><td>Underworld</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Gly</td><td>Asn</td><td>Glu</td><td>Leu</td><td>Thr</td><td>Phe</td><td>Leu</td><td>Asp</td><td>Asp</td><td>Cheese</td><td>How much</td><td>Cys</td><td>Thr</td><td>Gly</td><td>Thr</td><td>Cheese</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Cheese</td><td>Gly</td><td>Asn</td><td>Gin</td><td>Val</td><td>Asn</td><td>Leu</td><td>Thr</td><td>How much</td><td>Gin</td><td>Gly</td><td>Leu</td><td>Arg</td><td>Ala</td><td>Underworld</td><td>Asp</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td>Thr</td><td>Gly</td><td>Leu</td><td>Tyr</td><td>How much</td><td>Cys</td><td>Lys</td><td>Val</td><td>Glu</td><td>Leu</td><td>Underworld</td><td>Tyr</td><td>Pro</td><td>Pro</td><td>Pro</td><td>Tyr</td>

PL 204 899 B1

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

<td>Tyr</td><td>Glu</td><td>Gly</td><td>How much Gly</td><td>Asn</td><td>Gly</td><td>Thr</td><td>Gin</td><td>How much</td><td>Tyr</td><td>Val</td><td>How much</td><td>Asp</td><td>Pro</td><td>Glu</td>

<td></td><td> 130</td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>

<td>Pro</td><td>Cys</td><td>Pro</td><td>Asp Ser</td><td>Asp</td><td>Gin</td><td>Glu</td><td>Pro</td><td>Lys</td><td>Cheese</td><td>Cheese</td><td>Asp</td><td>Lys</td><td>Thr</td><td>His</td>

<td> 145</td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td>

<td>Thr</td><td>Cheese</td><td>Pro</td><td>Pro Ser</td><td>Pro</td><td>Ala</td><td>Pro</td><td>Glu</td><td>Leu</td><td>Leu</td><td>Gly</td><td>Gly</td><td>Cheese</td><td>Cheese</td><td>Val</td>

<td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td>

<td>Phe</td><td>Leu</td><td>Phe</td><td>Pro Pro</td><td>Lys</td><td>Pro</td><td>Lys</td><td>Asp</td><td>Thr</td><td>Leu</td><td>Underworld</td><td>How much</td><td>Cheese</td><td>Arg</td><td>Thr</td>

<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td>

<td>Pro</td><td>Glu</td><td>Val</td><td>Thr Cys</td><td>Val</td><td>Val</td><td>Val</td><td>Asp</td><td>Val</td><td>Cheese</td><td>His</td><td>Glu</td><td>Asp</td><td>Pro</td><td>Glu</td>

<td></td><td></td><td> 195</td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>

<td>Val</td><td>Lys</td><td>Phe</td><td>Asn Trp</td><td>Tyr</td><td>Val</td><td>Asp</td><td>Gly</td><td>Val</td><td>Glu</td><td>Val</td><td>His</td><td>Asn</td><td>Ala</td><td>Lys</td>

215 220

Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr Tyr Arg Val Val Ser ²²⁵ 230 235 240

Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys

245 250 255

Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile

260 265 270

Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro

275 280 285

Pro Ser Asp Glu Leu Thr Lys Asn Gin Val Ser Leu Thr Cys Leu

290 295 300

Val Lys Gly'Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn ³⁰⁵ 310 315 320

Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser

325 330 335

Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg

340 345 350

PL 204 899 B1

<td>Trp</td><td>Gin</td><td>Gin</td><td>Gly</td><td>Asn</td><td>Val</td><td>Phe</td><td>Cheese</td><td>Cys</td><td>Cheese</td><td>Val</td><td>Underworld</td><td>His</td><td>Glu</td><td>Ala Leu</td>

<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td>

<td>His</td><td>Asn</td><td>His</td><td>Tyr</td><td>Thr</td><td>Gin</td><td>Lys</td><td>Cheese</td><td>Leu</td><td>Cheese</td><td>Leu</td><td>Cheese</td><td>Pro</td><td>Gly</td><td>Lys</td>

<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td>

&lt;210&gt; 15 &lt;211&gt; 1152 &lt;212&gt; DNA &lt;213&gt; Dummy &lt;220&gt;

&lt;223&gt; Artificial sequence description: CTLA4Ig sequence &lt;400&gt; 15

<td>atgggtgtac</td><td>tgctcacaca</td><td>gaggacgctg</td><td>ctcagtctgg</td><td>tccttgcact</td><td>cctgtttcca</td><td> 60</td>

<td>agcatggcga</td><td>gcatggcaat</td><td>gcacgtggcc</td><td>cagcctgctg</td><td>tggtactggc</td><td>cagcagccga</td><td> 120</td>

<td>ggcatcgcca</td><td>gctttgtgtg</td><td>tgagtatgca</td><td>tctccaggca</td><td>aagccactga</td><td>ggtccgggtg</td><td> 180</td>

<td>acagtgcttc</td><td>ggcaggctga</td><td>cagccaggtg</td><td>actgaagtct</td><td>gtgcggcaac</td><td>ctacatgatg</td><td> 240</td>

<td>gggaatgagt</td><td>tgaccttcct</td><td>agatgattcc</td><td>atctgcacgg</td><td>gcacctccag</td><td>tggaaatcaa</td><td> 300</td>

<td>gtgaacctca</td><td>ctatccaagg</td><td>actgagggcc</td><td>atggacacgg</td><td>gactctacat</td><td>ctgcaaggtg</td><td> 360</td>

<td>gagctcatgt</td><td>acccaccgcc</td><td>atactacctg</td><td>ggcataggca</td><td>acggaaccca</td><td>gatttatgta</td><td> 420</td>

<td>attgatccag</td><td>aaccgtgccc</td><td>agattctgat</td><td>caggagccca</td><td>aatcttctga</td><td>caaaactcac</td><td> 480</td>

<td>acatccccac</td><td>cgtccccagc</td><td>acctgaactc</td><td>ctggggggat</td><td>cgtcagtctt</td><td>cctcttcccc</td><td> 540</td>

<td>ccaaaaccca</td><td>aggacaccct</td><td>catgatctcc</td><td>cggacccctg</td><td>aggtcacatg</td><td>cgtggtggtg</td><td> 600</td>

<td>gacgtgagcc</td><td>acgaagaccc</td><td>tgaggtcaag</td><td>ttcaactggt</td><td>acgtggacgg</td><td>cgtggaggtg</td><td> 660</td>

<td>cataatgcca</td><td>agacaaagcc</td><td>gcgggaggag</td><td>cagtacaaca</td><td>gcacgtaccg</td><td>tgtggtcagc</td><td> 720</td>

<td>gtcctcaccg</td><td>tcctgcacca</td><td>ggactggctg</td><td>aatggcaagg</td><td>agtacaagtg</td><td>caaggtctcc</td><td> 780</td>

<td>aacaaagccc</td><td>tcccagcccc</td><td>catcgagaaa</td><td>accatctcca</td><td>aagccaaagg</td><td>gcagccccga</td><td> 840</td>

<td>gaaccacagg</td><td>tgtacaccct</td><td>gcccccatcc</td><td>cgggatgagc</td><td>tgaccaagaa</td><td>ccaggtcagc</td><td> 900</td>

<td>ctgacctgcc</td><td>tggtcaaagg</td><td>cttctatccc</td><td>agcgacatcg</td><td>ccgtggagtg</td><td>ggagagcaat</td><td> 960</td>

<td>gggcagccgg</td><td>agaacaacta</td><td>caagaccacg</td><td>cctcccgtgc</td><td>tggactccga</td><td>cggctccttc</td><td> 1020</td>

<td>ttcctctaca</td><td>gcaagctcac</td><td>cgtggacaag</td><td>agcaggtggc</td><td>agcaggggaa</td><td>cgtcttctca</td><td> 1080</td>

PL 204 899 B1 tgctccgtga tgcatgaggc tctgcacaac cactacacgc agaagagcct ctccctgtct 1140 ccgggtaaat ga 1152 &lt;210&gt; 16 &lt;211&gt; 383 &lt;212&gt; PRT &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Artificial sequence description: CTLA4Ig sequence

<td colspan="2"> &lt;400&gt;</td><td colspan="14"> 16</td>

<td>Underworld</td><td>Gly</td><td>Val</td><td>Leu</td><td>Leu</td><td>Thr</td><td>Gin</td><td>Arg</td><td>Thr</td><td>Leu</td><td>Leu</td><td>Cheese</td><td>Leu</td><td>Val</td><td>Leu</td><td>Ala</td>

<td> 1</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td><td></td><td> 15</td><td></td>

<td>Leu</td><td>Leu</td><td>Phe</td><td>Pro</td><td>Cheese</td><td>Underworld</td><td>Ala</td><td>Cheese</td><td>Underworld</td><td>Ala</td><td>Underworld</td><td>His</td><td>Val</td><td>Ala</td><td>Gin</td><td>Pro</td>

<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>

<td>Ala</td><td>Val</td><td>Val</td><td>Leu</td><td>Ala</td><td>Cheese</td><td>Cheese</td><td>Arg</td><td>Gly</td><td>How much</td><td>Ala</td><td>Cheese</td><td>Phe</td><td>Val</td><td>Cys</td><td>Glu</td>

<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>

<td>Tyr</td><td>Ala</td><td>Cheese</td><td>Pro</td><td>Gly</td><td>Lys</td><td>Ala</td><td>Thr</td><td>Glu</td><td>Val</td><td>Arg</td><td>Val</td><td>Thr</td><td>Val</td><td>Leu</td><td>Arg</td>

<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>

<td>Gin</td><td>Ala</td><td>Asp</td><td>Cheese</td><td>Gin</td><td>Val</td><td>Thr</td><td>Glu</td><td>Val</td><td>Cys</td><td>Ala</td><td>Ala</td><td>Thr</td><td>Tyr</td><td>Underworld</td><td>Underworld</td>

<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>

<td>Gly</td><td>Asn</td><td>Glu</td><td>Leu</td><td>Thr</td><td>Phe</td><td>Leu</td><td>Asp</td><td>Asp</td><td>Cheese</td><td>How much</td><td>Cys</td><td>Thr</td><td>Gly</td><td>Thr</td><td>Cheese</td>

<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td>

<td>Cheese</td><td>Gly</td><td>Asn</td><td>Gin</td><td>Val</td><td>Asn</td><td>Leu</td><td>Thr</td><td>How much</td><td>Gin</td><td>Gly</td><td>Leu</td><td>Arg</td><td>Ala</td><td>Underworld</td><td>Asp</td>

<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>

<td>Thr</td><td>Gly</td><td>Leu</td><td>Tyr</td><td>How much</td><td>Cys</td><td>Lys</td><td>Val</td><td>Glu</td><td>Leu</td><td>Underworld</td><td>Tyr</td><td>Pro</td><td>Pro</td><td>Pro</td><td>Tyr</td>

<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>

<td>Tyr</td><td>Leu</td><td>Gly</td><td>How much</td><td>Gly</td><td>Asn</td><td>Gly</td><td>Thr</td><td>Gin</td><td>How much</td><td>Tyr</td><td>Val</td><td>How much</td><td>Asp</td><td>Pro</td><td>Glu</td>

<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>

<td>Pro</td><td>Cys</td><td>Pro</td><td>Asp</td><td>Cheese</td><td>Asp</td><td>Gin</td><td>Glu</td><td>Pro</td><td>Lys</td><td>Cheese</td><td>Cheese</td><td>Asp</td><td>Lys</td><td>Thr</td><td>His</td>

145 150 155 160

PL 204 899 B1

Glu Leu Leu Gly Gly Cheese Cheese Val

170 175

Asp Thr Leu Met Ile Ser Arg Thr

185 190

Asp Val Ser His Glu Asp Pro Glu

205

Gly Val Glu Val His Asn Ala Lys

220

Asn Ser Thr Tyr Arg Val Val Ser

235 240

Trp Leu Asn Gly Lys Glu Tyr Lys

250 255

Pro Ala Pro Ile Glu Lys Thr Ile

265 270

Glu Pro Gin Val Tyr Thr Leu Pro

285

Asn Gin Val Ser Leu Thr Cys Leu

300

Ile Ala Val Glu Trp Glu Cheese Asn

315 320

Thr Thr Pro Pro Val Leu Asp Ser

330 335

Lys Leu Thr Val Asp Lys Ser Arg

345 350

Cys Ser Val Met His Glu Ala Leu

365

Leu Ser Leu Ser Pro Gly Lys

380

Thr Ser Pro Pro Ser Pro Ala Pro

165

Phe Leu Phe Pro Pro Lys Pro Lys

180

Pro Glu Val Thr Cys Val Val Val

195 200

Val Lys Phe Asn Trp Tyr Val Asp

210 215

Thr Lys Pro Arg Glu Glu Gin Tyr

225 230

Val Leu Thr Val Leu His Gin Asp

245

Cys Lys Val Ser Asn Lys Ala Leu

260

Lys Ala Cheese Lys Gly Gin Pro Arg

275 280

Pro Ser Arg Asp Glu Leu Thr Lys

290 295

Val Lys Gly Phe Tyr Pro Ser Asp

305 310

Gly Gin Pro Glu Asn Asn Tyr Lys

325

Asp Gly Cheese Phe Phe Leu Tyr Ser

340

Trp Gin Gin Gly Asn Val Phe Ser

355 360

His Asn His Tyr Thr Gin Lys Ser

370 375 &lt;210&gt; 17

PL 204 899 B1 &lt;211&gt; 41 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Artificial sequence description: CTLA4 compatible primer oncostatin M (0MCTLA4) &lt;400&gt; 17 gaggtgataa agcttcacca atgggtgtac tgctcacaca g 41 &lt;210&gt; 18 &lt;211&gt; 42 &lt;212&gt; DNA &lt;213&gt; Artificial sequence &lt;220&gt;

&lt;223&gt; Artificial sequence description: reverse primer CTLA4 oncostatin M (OMCTLA4) &lt;400&gt; 18 gtggtgtatt ggtctagatc aatcagaatc tgggcacggt tc 42