Methods for protecting allogeneic islet transplant using soluble ctla4 mutant molecules

ES 2 302 811 T3

DESCRIPTION

Procedure for protecting allogeneic islet transplants using soluble CTLA4 mutant molecules.

Field of the invention

The present invention relates generally to the field of islet cell transplantation inhibition. In particular, the invention relates to methods of treating diabetes, including type 1 and type 2 diabetes, by administering to a subject an effective amount of CTLA4 mutant molecules.

Background of the invention

Organ transplantation has emerged as a preferred method of treatment for many forms of life-threatening diseases involving organ damage. Improved results in clinical transplantation have been achieved primarily up to the development of increasingly powerful non-specific immunosuppressive drugs that inhibit rejection responses (Lancet, 345: 1321-1325 (1995)). While short-term results have improved, long-term successes are inadequate. Currently, long-lived immunosuppressive agents are required to combat chronic rejection of the transplanted organ, and the use of these agents markedly increases the risks of cardiovascular disease, infections and malignancies.

Developing strategies to promote acceptance of allogeneic tissues without the need for chronic immunosuppression can reduce the risk of these life-threatening complications, and greatly extend the application of organ, tissue, and cell transplantation for diseases such as hemoglobinopathies, genetic immunodeficiencies, and autoimmune diseases.

Insulin-dependent diabetes mellitus (IDDM) is one of the most common metabolic disorders in the world. In the United States, IDDM affects approximately one in 300 to 400 people, and epidemiological studies suggest that the incidence of IDDM is continuously increasing. IDDM is elicited by an immune response that results in the T-lymphocyte-mediated destruction of the insulin-producing islet cells of the pancreas.

Once the clinical symptoms of IDDM have become apparent, the most commonly employed therapy to control the clinical symptoms of IDDM is exogenous insulin replacement. Although insulin replacement therapy allows most IDDM patients to lead some normal lives, it does not completely restore metabolic homeostasis, and as a result, serious complications including dysfunctions of the eye, kidney, heart, and other organs are common. diabetic patients undergoing insulin replacement therapy.

A long-term treatment for IDDM patients is islet transplantation. However, transplanted islet cells that produce insulin are often rapidly destroyed by the same immune response that previously destroyed patients' own islet cells. Of the 260 allografts transplanted since 1990, only 12.4% resulted in insulin independence for periods of more than a week, and only 8.25% have been insulin independent for periods of more than a year (Linsley et al. al. Diabetes (1997) 46: 1120-3). In most of these procedures, the background regimen of immunosuppression consisted of antibody induction with an anti-lymphocyte immunoglobulin combined with cyclosporine, azathiprine, and glucocorticoids.

For any type of transplant procedure, a balance between efficacy and toxicity is a key factor in its clinical acceptance. With regard to islet transplantation, an additional issue is that many of the current immunosuppressive agents with particular glucocorticoids or a calcineurin inhibitor, such as Tarcolimus, damage beta cells or induce insulin resistance (Zeng et al. Surgery (1993 ) 113: 98-102).

A protocol of nonsteroidal immunosuppressants ("Edmonton Protocol") that includes sirolimus, low-dose Tarcolimus, and a monoclonal antibody (mAb) against the IL-2 receptor has been used in an islet transplant trial only for patients with diabetes. of type 1 (Shapiro, AMJ et al, (2000), N. Eng. J. Med, 343: 230-238).

Recent success using the "Edmonton Protocol" has renewed enthusiasm for the use of islet transplantation to treat diabetes. However, issues regarding Tarcolimus toxicity may limit the application of this therapy in humans. Biological agents that block key T cell costimulatory signals, particularly the CD28 pathway, are potential alternatives to protect allogeneic islets. Examples of agents that block the CD28 pathway include but are not limited to soluble CTLA4 including mutant CTLA4 molecules.

Summary of the invention

The present invention relates to the use of a mutant CTLA4 molecule in the manufacture of a medicament for inhibiting islet cell transplantation rejection, wherein the soluble CTLA4 mutant molecule comprises a mutated extracellular domain of CTLA4, the domain having CTLA4 mutated extracellular

ES 2 302 811 T3

a) an amino acid sequence that begins with methionine at position +124 as shown in Figure 3, or that begins with alanine at position -1 and ends with aspartic acid at position +124 as shown in Figure 3 ;

b) an amino acid sequence that begins with methionine at position +1 and ends with aspartic acid at position +124 as shown in Figure 19, or that begins with alanine at position -1 and ends with aspartic acid at position position +124 as shown in Figure 19;

c) an amino acid sequence that begins with methionine at position +1 and ends with aspartic acid at position +124 as shown in Figure 20, or that begins with alanine at position -1 and ends with aspartic acid at position position +124 as shown in Figure 20;

d) an amino acid sequence that begins with methionine at position +1 and ends with aspartic acid at position +124 as shown in Figure 21, or that begins with alanine at position -1 and ends with aspartic acid at position position +124 as shown in Figure 21; or

e) an amino acid sequence that begins with methionine at position +1 and ends with aspartic acid at position +124 as shown in Figure 22, or that begins with alanine at position -1 and ends with aspartic acid at position position +124 as shown in Figure 22.

The present invention also relates to a soluble CTLA4 mutant molecule for use in inhibiting islet cell transplant rejection, wherein the soluble CTLA4 mutant molecule is as defined above.

According to a particular embodiment of the invention, the islet cell transplantation is to treat diabetes, in particular type 1 diabetes or type 2 diabetes. The islet cell transplantation can comprise encapsulated islet cells.

Inhibition of islet cell transplant rejection may comprise administration of the soluble CTLA4 mutant molecule before, during or after islet cell transplantation.

According to a particular embodiment of the invention, the extracellular domain of CTLA4 is fused to a non-CTLA4 residue, the non-CTLA4 residue comprising an immunoglobulin residue, for example, an immunoglobulin constant region or part thereof such as a comprising one or more mutations to reduce effector function. The immunoglobulin constant region can also comprise the CH2 and CH3 hinge regions of an immunoglobulin molecule. Furthermore, the immunoglobulin constant region or part thereof may be a human or monkey immunoglobulin constant region.

According to a particular embodiment of the invention, the soluble CTLA4 mutant molecule is:

a) L104EA29YIg as shown in Figure 3 starting with Ala at position -1 or Met at position +1 and ending with Lys at position +357 (SEQ ID NO: 6, starting with Ala at position 26 and ending with Lys at position 383, or beginning with Met at position 27 and ending with Lys at position 383);

b) L104EIg as shown in Figure 19 starting with Ala at position -1 or Met at position +1 and ending with Lys at position +357 (SEQ ID NO: 8, starting with Ala at position 26 and ending with Lys at position 383, or beginning with Met at position 27 and ending with Lys at position 383);

c) L104EA29LIg as shown in Figure 20 starting with Ala at position -1 or Met at position + 1 and ending with Lys at position +357 (SEQ ID NO: 10, starting with Ala at position 26 and ending with Lys at position 383, or beginning with Met at position 27 and ending with Lys at position 383);

d) L104EA29TIg as shown in Figure 21 starting with Ala at position -1 or Met at position + 1 and ending with Lys at position +357 (SEQ ID NO: 12, starting with Ala at position 26 and ending with Lys at position 383, or beginning with Met at position 27 and ending with Lys at position 383; or

e) L104EA29WIg as shown in Figure 22 starting with Ala at position -1 or Met at position + 1 and ending with Lys at position +357 (SEQ ID NO: 14, starting with Ala at position 26 and ending with Lys at position 383, or beginning with Met at position 27 and ending with Lys at position 383).

According to a particular embodiment of the invention, the soluble CTLA4 mutant molecule and at least one additional compound are therefor. The additional compound can be selected from the group consisting of immunosuppressive compounds, immunomodulatory compounds, and anti-inflammatory compounds. In particular, the compound can be selected from the group consisting of anakinra, adrenocorticosteroids, azathioprine, basiliximab, calcineurin inhibitors, chloroquine, corticosteroids, cyclosporine, prednisone, cyclophosphamide, cytoxan,

ES 2 302 811 T3

15-deoxyspergualine and its analogs, D-penicillamine, etanercept, glatiramer acetate, FTY720 and its analogues, glucocorticoids, gold salts, horse anti-human thymocyte globulin (ATGAM), humanized anti-TAC (HAT), hydroxychloroquine, infliximab, interferon beta-1a, interferon beta-1b, leflunomide and its analogues, lymphocyte immune globulin, lymphocyte-seeking agents, methoxsalen, methotrexate, mitoxantrone hydrochloride, mycophenolic acid, mycophenolate mofetil, mizoribine, NSAIDs, rabbit anti-human thymocyte globulin, Rho (D) immune globulin, sirolismus (rapamycin) and its derivatives (for example 40-0- (2-hydroxy) ethylrapamycin), sulfasalazopyrin, sulfasalzinae, tacrolismus (FK-506) , thalidomide, TNFa blockers and biological agents that target an inflammatory cytokine, TOR inhibitors, compounds that interfere with CD40 and CD154, soluble gp39, soluble CD29, soluble CD40, soluble CD80 (for example ATCC 68627), soluble CD86, soluble CD28 , Soluble CD56, Soluble Thy-1, Soluble CD3, Soluble TCR, Soluble VLA-4, Soluble VCAM-1, Soluble LECAM-1, Soluble ELAM-1, Soluble CD44, gp39-reactive Antibodies (for example ATCC HB-10916, ATCC HB-12055 and ATCC HB-12056), CD40-reactive antibodies (for example ATCC HB-9110), B7-reactive antibodies (for example ATCC HB253, ATCC CRL-2223, ATCC CRL-2226, ATCC HB-301, ATCC HB -11341), CD28-reactive antibodies (for example ATCC HB-11944 or mAb 9.3), LFA-1 reactive antibodies (for example ATCC HB-9579 and ATCC TIB213), LFA-2 reactive antibodies, IL-2 reactive antibodies, IL-12 reactive antibodies, IFN-gamma reactive antibodies, CD2 reactive antibodies , antibodies reactive with CD48, antibodies reactive with any ICAM (for example, with ICAM-1 (ATCC CRL-2252), ICAM-2 and ICAM-3), antibodies reactive with CTLA4 (for example ATCC HB-304), reactive antibodies with Thy-1, CD56-reactive antibodies, CD3-reactive antibodies, CD29-reactive antibodies, TCR-reactive antibodies, VLA-4-reactive antibodies, VCAM-1-reactive antibodies, LECAM-1-reactive antibodies, ELAM1-reactive antibodies, CD44-reactive antibodies, monoclonal antibodies to receptors from leukocytes, for example MHC, CD2, CD3, CD4, CDIIa / CD18, CD7, CD25, CD27, B7, CD40, CD45, CD58, CD137, ICOS, CD150 (SLAM), OX40, 41BB or their ligands, CTLA4 / CD28 -Ig; LFA-1 antagonists, selectin antagonists and VLA-4 antagonists and anti-human IL-2R mAbs. The soluble CTLA4 mutant molecule and the additional compound can be co-administered, administered simultaneously, or in sequence.

According to a particular embodiment of the invention, the inhibition of islet cell transplant rejection comprises an additional immunosuppressive regimen. The additional immunosuppressive regimen may be without a glucocorticoid or comprise a corticosteroid. According to one embodiment of the invention, the additional immunosuppressive regimen is without a calcineurin inhibitor.

In particular, the additional immunosuppressive regimen may comprise one or more of the above compounds to be used in combination with the soluble CTLA4 mutant molecule. It may comprise a TOR inhibitor, for example rapamycin (sirolismus) or its derivative, and / or a biological agent that targets IL-2, for example an IL-2 reactive antibody or an anti-human IL-2R mAb such as basiliximab; mycophenolic acid or mycophenolate mofetil; or a compound that interferes with the binding of CD40 to CD154, for example an anti-CD40 antibody or an anti-CD154 antibody.

According to a particular embodiment of the invention, the inhibition of islet cell transplant rejection comprises the administration of T-cell depleted bone marrow cells. The administration of T-cell depleted bone marrow cells can be approximately the same time than islet cell transplant placement or before islet cell transplant placement. Administration of the T cell depleted bone marrow cells may comprise a first dose and a second dose.

The soluble CTLA4 mutant molecules of the invention bind to CD80 and / or CD86 molecules on CD80 and / or CD86 positive cells, thereby inhibiting endogenous CD80 and / or CD86 molecules from binding to CTLA4 and / or CD28. on T cells, and thus block costimulatory signals from key T cells, in particular the CD28 pathway.

Brief description of the figures

Figure 1 shows the complete nucleotide (SEQ ID NO .: 1) and amino acid (SEQ ID NO .: 2) sequence for human CTLA4 receptor fused to oncostatin M signal peptide. Oncostatin signal peptide M is indicated at position -25 to -1.

Figure 2 shows a nucleotide (SEQ m NO .: 3) and amino acid (SEQ ID NO .: 4) sequence of a CTLA4Ig having a signal peptide; a wild-type amino acid sequence of the extracellular domain of CTLA4 starting at methionine at position +1 to aspartic acid at position +124, or starting at alanine at position -1 to aspartic acid at position +124; and a region of Ig.

Figure 3 shows a nucleotide (SEQ ID NO .: 5) and amino acid (SEQ ID NO .: 6) sequence of a CTLA4 mutant molecule (L104EA29YIg) comprising a signal peptide; a mutated extracellular domain of CTLA4 that begins in methionine at position +1 and ends in aspartic acid at position +124, or that begins in alanine at position -1 and ends in aspartic acid at position +124; and an Ig region as described in Example 1, below.

Figure 4 is a line graph illustrating the fasting plasma glucose level in a normal subject, as described in Example 3, below.

ES 2 302 811 T3

Figure 5 is a line graph illustrating plasma glucose level in pancreatectomized subjects with transplanted pancreatic islet cells as described in Example 3. Animals were transplanted with islet cells on day 0, and were either treated with an immunosuppressive regimen containing L104EA29YIg, and a background immunosuppressive regimen (treated), or just a background immunosuppressive regimen (control). The background immunosuppressive regimen contained rapamycin and anti-human IL2R.

Figure 6 is a line graph illustrating insulin requirement in subjects with islet cells transplanted as described in Example 3. Animals were transplanted with islet cells on day 0, and treated with an immunosuppressive regimen containing L104EA29YIg and a background immunosuppressive regimen (treated), or only a background immunosuppressive regimen (control).

Figure 7 is a line graph illustrating blood glucose level in an intravenous glucose tolerance test before and after islet transplantation, as described in Example 3.

Figure 8 shows a schematic diagram of a vector, piLN-L104EA29Y, having the insertion L104EA29YIg.

Figures 9A and 9B illustrate data from FACS assays showing the binding of L104EA29YIg, L104EIg, and CTLA4Ig to CD80- or CD86 transfected CHO cells as described in Example 2, below.

Figures 10A and 10B show inhibition of CD80-positive and CD86-positive CHO cell proliferation as described in Example 2, below.

Figures 11A and 11B show that L104EA29YIg is more effective than CTLA4Ig in inhibiting primary and secondary T cell proliferation as described in Example 2, below.

Figures 12A-C illustrate that L104EA29YIg is more effective than CTLA4Ig in inhibiting IL-2 (Fig. 12A), IL4 (Fig. 12B), and y-interferon cytokine production (Fig. 12C) from allostimulated human T cells. as described in Example 2, below.

Figure 13 demonstrates that L104EA29YIg is more effective than CTLA4Ig in inhibiting proliferation of phytohemagglutinin- (FA) -stimulated monkey T cells as described in Example 2, below.

Figures 14A-C are SDS gel (Fig. 14A) for CTLA4Ig (lane 1), L104EIg (lane 2), and L104EA29YIg (lane 3A); and size exclusion chromatographies of CTLA4Ig (Fig. 14B) and L104EA29YIg (Fig. 14C).

Figures 15A and 15B illustrate a band diagram of the extracellular Ig type V fold of CTLA4 generated from the solution structure determined by NMR spectroscopy. Fig. 15B shows an expanded view of the S25-R33 region and MYPPPY region indicating the location and orientation of the side chain of the avidity-enhancing mutations, L104 and A29.

Figure 16 shows fasting blood glucose for LEA29YIg (A) and control (B) treated recipients of allogeneic islets (representative animals) before and after transplantation. All animals underwent surgical pancreastectomy at least 2 weeks before transplantation (mean insulin requirement before transplantation 8.76 ± 0.18 units / day) (C) After intraportal infusion of allogeneic islets, recipients they quickly became euglycemic that did not require subsequent exogenous insulin transplantation. (D) The induction of diabetes and islet function after transplantation was confirmed by intravenous glucose tolerance test before transplantation 1 month and 3 months after transplantation, as described in Example 3, below.

Figure 17 shows (A) immunohistology of functional transplanted islet confirmed by positive staining for insulin. (B) Islet of an animal receiving control regimen surrounded by mononuclear infiltrate, indicating rejection, as described in Example 3, below.

Figure 18 shows the suppression of anti-donor T- and B-cell responses by the L104EA29Y regimen. (A) The anti-donor IFN-y-FLISpot response corresponds to the rejection schedule in the controls. (~ 1 week after transplant). (B) The L104EA29Y regimen effectively suppresses the generation of anti-donor T cell response. (C) Animals receiving rapamycin anti-IL-2R mAb rapidly produce detectable anti-donor antibody, as measured by flow cytometric procedures at the time of rejection. (D) Islet recipients receiving the L104EA29Y-containing regimen do not generate an anti-donor antibody response while being treated, as described in Example 3, below.

Figure 19 shows the nucleotide and amino acid sequences of L104EIg (SEQ ID NOs .: 7-8), as described in Example 2, below.

Figure 20 shows the nucleotide and amino acid sequences of L104EA29LIg (SEQ ID NOs .: 9-10).

Figure 21 shows the nucleotide and amino acid sequences of L104EA29TIg (SEQ ID NOs .: 11-12).

ES 2 302 811 T3

Figure 22 shows the nucleotide and amino acid sequences of L104EA29WIg (SEQ ID NOs .: 13-14).

Figure 23 shows the nucleotide sequence of a CTLA4Ig (SEQ ID NO .: 15) having a signal peptide; a wild-type amino acid sequence of the extracellular domain of CTLA4 starting at methionine at position +1 to aspartic acid at position +124, or starting at alanine at position -1 to aspartic acid at position +124; and an Ig region.

Figure 24 shows the amino acid sequence of CTLA4Ig (SEQ ID NO .: 16) having a signal peptide; a wild-type amino acid sequence of the extracellular domain of CTLA4 starting at methionine at position +1 to aspartic acid at position +124, or starting at alanine at position -1 to aspartic acid at position +124; and an Ig region.

Detailed description of the invention

Definitions

All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified. As used in this application, the following words or phrases have the specified meanings.

As used herein "wild-type CTLA4" has the naturally occurring amino acid sequence, full-length CTLA4 (US Patent Numbers 5,434,131, 5,844,095, 5,851,795), or any of its parts that binds to the B7 molecule (CD80 and / or CD86), or interferes with a B7 molecule (for example, CD80 and / or CD86) in a way that blocks its binding to its ligand, or blocks its binding to the extracellular domain of CTLA4 or its parts. In particular embodiments, wild-type CTLA4 begins with methionine at position +1 and ends in aspartic acid at position +124, or wild-type CTLA4 begins with alanine at position -1 and ends in aspartic acid at position +124 . In other embodiments, wild-type CTLA4 consists of the 187 amino acids of the CTLA4 receptor as described in Fig. 3 of US Patent Nos. 5,434,131. 5,844,095. 5,851,795. and is shown herein as Figure 1. Wild-type CTLA4 is a cell surface protein, having an N-terminal extracellular domain, a transmembrane domain, and a C-terminal cytoplasmic domain. The extracellular domain binds to target antigens, such as CD80 and CD86. In a cell, the wild-type, naturally occurring CTLA4 proteins are translated as an immature polypeptide, which includes a signal peptide at the N-terminus. The immature polypeptide undergoing post-translational processing, including cleavage and removal of the signal peptide to generate a CTLA4 cleavage product having a newly generated N-terminal end from the N-terminal end in the immature form . Those skilled in the art will appreciate that additional post-translational processing may occur, which removes one or more of the amino acids from the newly generated N-terminus of the CTLA4 cleavage product. The mature form of the CTLA4 molecule includes the extracellular domain of CTLA4, or any part thereof, that binds to CD80 and / or CD86.

As used herein "the CTLA4 extracellular domain" is the part of the CTLA4 receptor that extends outside the cell membrane, and includes any part of CTLA4 that extends outside the cell membrane that recognizes and binds ligands. of CTLA4, such as a B7 molecule (eg, CD80 and / or CD86 molecules). For example, an extracellular domain of CTLA4 comprises methionine at position +1 to aspartic acid at position +124 (Figure 2). Alternatively, an extracellular domain of CTLA4 comprises alanine at position +1 to aspartic acid at position +125 (Figure 1). The extracellular domain includes fragments or derivatives of CTLA4 that bind to a B7 molecule (eg, CD80 and / or CD86).

As used herein a "non-CTLA4 protein sequence" or "non-CTLA4 molecule" is defined as any molecule that does not bind to CD80 and / or CD86 and does not interfere with the binding of CTLA4 to its target. An example includes, but is not limited to, an immunoglobulin (Ig) constant region or part thereof. Preferably, the constant Ig region is an Ig constant region, eg, human C (gamma) 1, including the hinge, CH2 and CH3 regions. The constant region of Ig can be mutated to reduce its effector functions (US Patent Numbers: 5,637,481; and 6,090,914).

As used herein, "soluble" refers to any molecule, or its fragments or derivatives, unbound or attached to the cell, ie, circulating. For example, CTLA4, L104EA29YIg, B7, or CD28 can be made soluble by attaching an immunoglobulin (Ig) residue to the extracellular domain of CTLA4, B7, or CD28, respectively. Other molecules can be papillomavirus E7 gene product (E7), melanoma associated antigen p97 (p97), or HIV env protein (env gp120). Alternatively, a molecule such as CTLA4 can be made soluble by removing its transmembrane domain. Typically, the soluble molecules in the methods of the invention do not include a signal (or guide) sequence.

"CTLA4Ig" is a soluble fusion protein comprising an extracellular domain of CTLA4, or a part thereof that binds to CD80 and / or CD86, which binds to the Ig tail. A particular embodiment comprises the extracellular domain of wild-type CTLA4 that begins in methionine at position +1 and ends in aspartic acid at position +124; or starting from alanine at position -1 to aspartic acid at position +124; a glutamine connecting amino acid residue at position +125; and an immunoglobulin part comprising acid

ES 2 302 811 T3 glutamic at position +126 via lysine at position +357 (Figure 2). DNA encoding CTLA4Ig was deposited on May 31, 1991 with the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, VA 20110-2209 under the provisions of the Budapest Treaty, and has been agreed upon in accession number from ATCC ATCC 68629; Linsley, P., et al., 1994 Immunity 1: 793-80). CTLA4Ig-24, a Chinese Hamster Ovary (CHO) cell line that expresses CTLA4Ig was deposited on May 31, 1991 under the ATCC identification number CRL-10762). The soluble CTLA4Ig molecules used in the methods and / or kits of the invention may or may not include a signal (leader) peptide sequence. Typically, in the methods and / or kits of the invention, the molecules do not include a signal peptide sequence.

As used herein, "soluble CTLA4 molecules" means CTLA4 molecules not bound to the surface of cells (ie, circulating) (wild type or mutant) or any functional part of a CTLA4 molecule that binds to B7 which includes, but is not limited to: CTLA4Ig fusion proteins (eg, ATCC 68629), wherein the extracellular domain of CTLA4 is fused to an immunoglobulin (Ig) residue that makes the fusion molecule soluble, or its fragments and derivatives; proteins with the extracellular domain of CTLA4 fused or attached to a part of a biologically active or chemically active protein such as the papillomavirus E7 gene product (CTLA4-E7), melanone-associated antigen p97 (CTLA4-p97), or HIV env protein (CTLA4-env gp 120), or its fragments or derivatives; hybrid (chimeric) fusion proteins such as CD28 / CTLA4Ig, or their fragments and derivatives; CTLA4 molecules with the transmembrane domain removed to make the protein soluble (Oaks, M.

K., et al., 2000 Cellular Immunology 201: 144-153), or their fragments and derivatives. "Soluble CTLA4 molecules" also include their fragments, parts, or derivatives, and soluble CTLA4 mutant molecules that have CTLA4 binding activity. The soluble CTLA4 molecules used in the methods of the invention may or may not include a signal (leader) peptide sequence. Typically, in the methods of the invention, the molecules do not include a signal peptide sequence.

As used herein, "fusion protein" is defined as one or more amino acid sequences linked together using procedures well known in the art and described in US Patent Nos. 5,434,131 or 5,637,481. Therefore the linked amino acid sequences form a fusion protein.

As used herein a "CTLA4 mutant molecule" is a molecule that can be full-length CTLA4 or parts thereof (derivatives or fragments) that have a multiple mutation or mutations in CTLA4 (preferably in the extracellular domain of CTLA4) so that it is similar but not identical to the wild-type CTLA4 molecule. Mutant CTLA4 molecules bind to a B7 molecule (eg, either CD80 or CD86, or both). Mutant CTLA4 molecules can include a non-CTLA4 biologically or chemically active molecule in or attached to it. Mutant molecules can be soluble (ie, circulating) or surface bound. Mutant CTLA4 molecules can include the entire extracellular domain of CTLA4 or parts thereof, eg, fragments or derivatives. Mutant CTLA4 molecules can be made synthetically or recombinantly.

As used herein, the term "mutation" is a change in the nucleotide or amino acid sequence of a wild-type polypeptide. The present invention provides a mutation or change in the extracellular domain of wild-type CTLA4. Changes in the wild-type CTLA4 sequence include conservative and non-conservative changes. The change can be an amino acid change that includes substitutions, deletions, additions, or truncations. A mutant molecule can have one or more mutations. Mutations in a nucleotide sequence may or may not result in a mutation in the amino acid sequence as is well understood in the art. In this regard, certain nucleotide codons code for the same amino acid. Examples include the nucleotide codons CGT, CGG, CGC, and CGA that encode the amino acid, arginine (R); or codons GAT, and GAC encoding the amino acid, aspartic acid (D). Thus, a protein can be encoded by one or more nucleic acid molecules that differ in their specific nucleotide sequence, but still encode protein molecules that have identical sequences. The sequence encoding the amino acids is as follows:

<td>Amino acid</td><td>Symbol</td><td>Symbol of a lyrics</td><td>Codons</td>

<td>To the girl</td><td>To</td><td>TO</td><td>GCU, GCC, GCA, GCG</td>

<td>Cysteine</td><td>Cys</td><td>C</td><td>UGU, UGC</td>

<td>Aspartic acid</td><td>Asp</td><td>D</td><td>GAU, GAC</td>

<td>Glutamic acid</td><td>Glu</td><td>AND</td><td>GAA, GAG</td>

<td>Phenylalanine</td><td>Phe</td><td>F</td><td>UUU, UUC</td>

ES 2 302 811 T3

<td>Amino acid</td><td>Symbol</td><td>Symbol of a lyrics</td><td>Codons</td>

<td>Wisteria</td><td>Gly</td><td>G</td><td>GGU, GGC, GGA, GGG</td>

<td>Histidine</td><td>His</td><td>H</td><td>CAU, CAC</td>

<td>Isoleucine</td><td>lie</td><td> 1</td><td>AUU, AUC, AUA</td>

<td>Lysine</td><td>Lys</td><td>K</td><td>AAA, AAG</td>

<td>Leucine</td><td>Leu</td><td>L</td><td>UUA, UUG, CUU, CUC, CUA, CUG</td>

<td>Methionine</td><td>Met</td><td>M</td><td>AUG</td>

<td>Asparagine</td><td>Asn</td><td>N</td><td>AAU, AAC</td>

<td>Proline</td><td>Pro</td><td>P</td><td>CCU, CCC, CCA, CCG</td>

<td>Glutamine</td><td>Gln</td><td>Q</td><td>CAA, CAG</td>

<td>Arginine</td><td>Arg</td><td>R</td><td>CGU, CGC, CGA, CGG, AGA, AGG</td>

<td>Serine</td><td>To be</td><td>S</td><td>UCU, UCC, UCA, UCG, AGU, AGC</td>

<td>Threonine</td><td>Thr</td><td>T</td><td>ACU, ACC, ACA, ACG</td>

<td>Valine</td><td>Val</td><td>V</td><td>GUU, GUC, GUA, GUG</td>

<td>Tryptophan</td><td>Trp</td><td>W</td><td>UGG</td>

<td>Tyrosine</td><td>Tyr</td><td>Y</td><td>UAU, UAC</td>

"L104EA29YIg" is a fusion protein that is a soluble CTLA4 mutant molecule comprising a wild-type CTLA4 extracellular domain that has amino acid changes A29Y (a tyrosine amino acid residue that is replaced by an alanine at position 29) and L104E (a glutamic acid amino acid residue that is replaced by a leucine at position +104), or its part that binds to a B7 molecule, attached to an Ig tail (included in Figure 3; DNA encoding L104EA29YIg was deposited with the American Type Culture Collection on June 20, 2000 and assigned ATCC number PTA-2104). The soluble L104EA29YIg molecules used in the methods and / or kits of the invention may or may not include a signal (guide) peptide sequence. Typically, in the methods and / or kits of the invention, the molecules do not include a signal peptide sequence.

The mutant molecule can have one or more mutations. As used herein, a "non-CTLA4 protein sequence" or "non-CTLA4 molecule" means any protein molecule that does not bind to B7 and does not interfere with the binding of CTLA4 to its target. An example includes, but is not limited to, an immunoglobulin (Ig) constant region or part thereof. Preferably, the Ig constant region is a human or monkey Ig constant region, eg, human C (gamma) 1, which includes the CH2 and CH3 hinge regions. the Ig constant region can be mutated to reduce its effector functions (US Patent Nos. 5,637,481, 5,844,095 and 5,434,131).

As used herein, a "fragment" or "part" is any part or segment of a molecule for example CTLA4 or CD28, preferably the extracellular domain of CTLA4 or CD28 or its part or segment, that recognizes and binds to its target, for example, a B7 molecule.

As used herein, "B7" refers to the B7 family of molecules including, but not limited to, B7-1 (CD80) (Freeman et al, 1989, J Immunol. 143: 2714-2722, incorporated herein by reference in its entirety), B7-2 (CD86) (Freeman et al, 1993, Science 262: 909-911, incorporated herein by reference in its entirety; Azuma et al. al, 1993, Nature 366: 76-79 incorporated herein by reference in its entirety) that can recognize and bind CTLA4 and / or CD28.

ES 2 302 811 T3

As used herein, "CD28" refers to the molecule that recognizes and binds to B7 as described in US Serial Nos. 5,580,756 and 5,521,288 (incorporated herein by reference. In its whole).

As used herein, "B7 positive cells" are any with one or more types of B7 molecules expressed on the cell surface.

As used herein, a "derivative" is a molecule that shares sequence similarity and activity with its parent molecule. For example, a derivative of CTLA4 includes a soluble CTLA4 molecule that has an amino acid sequence at least 70% similar to the extracellular domain of wild-type CTLA4, and that recognizes and binds to B7 e.g. CTLA4Ig or soluble CTLA4 mutant molecule. L104EA29YIg.

As used herein, "block" or "inhibit" a receptor, signal, or molecule that interferes with activation of the receptor, signal, or molecule, as detected by an art-recognized assay. For example, the blockade of a cell-mediated immune response can be detected by determining the reduction of symptoms associated with rheumatic diseases. The blockage or inhibition can be partial or total.

As used herein, "blocking the B7 interaction" means that it interferes with the binding of B7 to its ligands, such as CD28 and / or CTLA4, thereby obstructing T cell and B7 positive cell interactions. Examples of agents that block the interactions of B7 including, but not limited to, molecules such as an antibody (or its part or derivative) that recognizes and binds to any of the CTLA4, CD28 or B7 molecules (for example B7-1 , B7-2); a soluble form (or its part or derivative) of the molecules such as soluble CTLA4; a peptide fragment or other small molecule designed to interfere with the cell's signal through CTLA4 / CD28B7-mediated interaction. In a preferred embodiment, the blocking agent is a soluble CTLA4 molecule, such as CTLA4Ig (ATCC 68629) or L104EA29YIg (ATCC PTA-2104), a soluble CD28 molecule such as CD28Ig (ATCC 68628), a soluble B7 molecule such such as B7Ig (ATCC 68627), an anti-B7 monoclonal antibody (for example ATCC HB-253, ATCC CRL-2223, ATCC CRL-2226, ATCC HB-301, ATCC HB-11341, and monoclonal antibodies as described by Anderson et al. United States No. 6,113,898 or Yokochi et al., 1982. J. Immun., 128 (2): 823-827), an anti-CTLA4 monoclonal antibody (eg ATCC HB-304, and monoclonal antibodies as described in references 82-83) and / or an anti-CTLA4 monoclonal antibody. CD28 (for example ATCC HB 11944 and mAb 9.3 as described by Hansen (Hansen et al., 1980. Immunogenetics 10: 247-260) or Martin (Martin et al., 1984. J. Clin. Immun., 4 (1) : 18-22)).

As used herein, "immune system disease" means any disease mediated by T cell interactions with B7 positive cells including, but not limited to, autoimmune diseases, graft-related disorders, and immunoproliferative diseases. Examples of diseases of the immune system include host versus graft disease (GVHD) (for example, such as those that occur from bone marrow transplantation, or in the induction of tolerance), immune disorders associated with transplant rejection of grafts, chronic rejection, and homologous or heterologous tissue or cell transplants, including solid organs, skin, islets, muscles, hepatocytes, neurons. Examples of immunoproliferative diseases include, but are not limited to, psoriasis, T-cell lymphoma, T-cell acute lymphoblastic leukemia, testicular angiocentric T-cell lymphoma, benign lymphatic angiitis, lupus (e.g. lupus erythematosus, lupus nephritis), thyroiditis Hashimoto's, primary myxedema, Graves' disease, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, diabetes (e.g. insulin-dependent diabetes mellitus, type I diabetes mellitus, type II diabetes mellitus), Good Pasture syndrome, miastemoa gravis, pemphigus, Crohn's disease, sympathetic ophthalmia, autoimmune uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, action hepatitis chronic, ulcerative colitis, Sjogren's syndrome, rheumatic diseases (eg rheumatoid arthritis), polymyositis, scleroderma, and mixed connective tissue disease.

As used herein, "subject" includes but is not limited to humans, non-human primates (eg, mouse, monkey), sheep, rabbit, pig, dog, cat, mouse, or rat.

As used herein, "tissue transplantation" is defined as tissue from all or part of an organ that is transplanted into a recipient subject. In certain embodiments, the tissue is derived from one or more solid organs. Examples of tissues or organs include, but are not limited to, skin, heart, pancreas, kidney, liver, bone marrow, pancreatic islet cells, pluripotent stem cells, cell suspensions, and genetically modified cells. The tissue can be removed from a donor subject, or it can be grown in vitro. The transplantation can be an autotransplantation, isotransplantation, allogeneic or heterotransplantation or their combination.

As used herein, "transplant rejection" is defined as the almost complete or complete loss of viable graft tissue from the recipient subject.

As used herein, "encapsulation" is defined as a method that immunologically isolates cells and / or groups of cells, which produce and secrete therapeutic substances, eg insulin, and the medical use of these formulations. The encapsulation procedure involves placing cells and / or groups of cells within a semi-permeable membrane barrier prior to transplantation in order to avoid rejection by the immune system. The molecular weight cutoff of the encapsulating membrane can be controlled by the encapsulation procedure in a way that excludes diffusion into the interior of immunoglobulin and factors.

ES 2 302 811 T3 lytic cells of the complement system, but allows the passage of smaller molecules such as glucose and insulin. Encapsulation allows islet cells to respond physiologically to changes in blood glucose but prevents contact with components of the immune system. Procedures for encapsulating pancreatic islet cells are described in US Patent No. 6,080,412.

As used herein, "ligand" refers to a molecule that recognizes and specifically binds to another molecule, eg, a ligand for CTLA4 is a CD80 and / or CD86 molecule.

As used herein, "a soluble ligand that recognizes and binds CD80 and / or CD86 antigen" includes ligands such as CTLA4Ig, CD28Ig, or other soluble forms of CTLA4 and CD28; Recombinant CTLA4 and CD28; mutant CTLA4 molecules such as L104EA29YIg; and any antibody molecule, its fragment or recombinant binding protein that recognizes and binds CD80 and / or CD86 antigen. These agents are also considered "immunosuppressive agents."

As used herein, "costimulatory pathway" is defined as a biochemical pathway that occurs from the interaction of costimulatory signals on T cells and antigen presenting cells (APCs). Costimulatory signals help determine the magnitude of the immune response to an antigen. A costimulatory signal is provided by interaction with the CD28 and CTLA4 T cell receptors with the CD80 and / or CD86 molecules on APCs.

As used herein, "CD80 and / or CD86" includes B7-1 (also called CD80). B7-2 (also called CD86), B7-3 (also called CD74), and the B7 family, for example, a combination of B7-1, B7-2, and / or B73.

As used herein, "costimulatory blockade" is defined as a protocol of administration to a subject, one or more agents that interfere with or block a costimulatory pathway, as described above. Examples of agents that interfere with costimulatory blockade include, but are not limited to, soluble CTLA4, mutant CTLA4, soluble CD28, anti-B7 monoclonal antibodies (mAbs), soluble CD40, and anti-gp39 mAbs. In one embodiment, L104EA29YIg is a preferred agent that interferes with costimulatory blockade.

As used herein, "T cell depleted bone marrow" is defined as bone marrow removed from bone that has been exposed to an anti-T cell protocol. An anti-T cell protocol is defined as a procedure to remove T cells from the bone marrow. Procedures of selectively removing T cells are well known in the art. An example of a T-cell protocol is the exposure of the bone marrow to specific T-cell antibodies, such as anti-CD3, anti-CD4, anti-CD5, anti-CD8, and anti-CD90 monoclonal antibodies, in which the antibodies are cytotoxic to T cells. Alternatively, the antibodies can be coupled to magnetic particles that allow removal of the T cells from the bone marrow using magnetic fields. Another example of an anti-T cell protocol is exposing bone marrow T cells to anti-lymphocyte serum or anti-thymocyte globulin.

As used herein, "T-cell depleted bone marrow tolerance dose" is defined as an initial dose of T-cell depleted bone marrow that is administered to a subject for the purpose of inactivating potential reactive T cells. donor.

As used herein, "T-cell depleted bone marrow graft dose" is defined as a subsequent dose of T-cell depleted bone marrow that is administered to a subject for the purpose of establishing a mixed hematopoietic chimera. The T-cell depleted bone marrow graft dose will be administered appropriately after the T-cell depleted bone marrow tolerance dose.

As used herein, "mixed hematopoietic chimera" is defined as the presence of parent and mature cells from donor and recipient blood (eg, blood-derived cells) in the absence (or undetectable presence) of an immune response.

As used herein "donor-recipient pairing" is defined based on molecular typing using a panel of previously defined major histocompatibility alleles (8 classes I and 12 classes II) (Lobashevsky A, et al., Tissue Antigens 54: 254-263, (1999); Knapp LA, et al., Tissue Antigens 50: 657-661, (1997); Watkins DI, Crit Rev Immunol 15: 1-29, (1995)). The mismatch of matches maximized at both class I and II loci.

As used herein, "administering" or "administering" to a subject includes but is not limited to intravenous (iv) administration, intraperitoneal (ip) administration, intramuscular (im) administration, subcutaneous administration, oral administration, administration by injection, such as a suppository, or implantation of a slow-release device such as a miniosmotic pump to the subject.

As used herein, "pharmaceutically acceptable carrier" includes any material that, when combined with the reactive agent, maintains the biological activity of the reactive agent, eg, binding specificity, and is non-reactive with the subject's immune system. . Examples include, but are not limited to, any of the conventional pharmaceutical carriers such as phosphate buffered saline, water, emul

ES 2 302 811 T3 sions such as oil / water emulsion, and various types of wetting agents. Other carriers can also include sterile solutions, tablets, including coated tablets and capsules. Typically, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or salts thereof, magnesium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients. Such vehicles can also include flavor and color additives or other ingredients. Compositions comprising such carriers are formulated by well known standard procedures.

As used herein, "immunosuppressive agents" are defined as a composition having one or more types of molecules that prevent the onset of an immune response, or weaken an immune system of the subject. Preferably, the agents reduce or prevent T cell proliferation. Some agents can inhibit T cell proliferation by inhibiting the interaction of T cells with other antigen presenting cells (APCs). An example of APCs is B cells. Examples of agents that interfere with T cell interactions with, and therefore inhibit T cell proliferation, include, but are not limited to, ligands for CD80 antigens and / or CD86, ligands for the CTLA4 antigen, and ligands for the CD28 antigen. Examples of ligands for CD80 and / or CD86 antigens include, but are not limited to, soluble CTLA4, soluble CTLA4 mutant, soluble CD28, or monoclonal antibodies that recognize and bind CD80 and / or CD86 antigens, or fragments thereof. . A preferred agent is L104EA29YIg. Ligands for CTLA4 or CD28 antigens include monoclonal antibodies that recognize and bind CTLA4 and / or CD28, or their fragments. Other ligands for CTLA4 or CD28 include soluble CD80 and / or CD86 molecules, such as CD80 and / or CD86Ig. Those skilled in the art will readily understand that other agents or ligands can be used to inhibit the interaction of CD28 with CD80 and / or CD86.

Immunosuppressive agents include, but are not limited to, methotrexate, cyclophosphamide, cyclosporine, cyclosporine A, chloroquine, hydroxychloroquine, sulfasalazine (sulfasalazopyrine), gold salts, D-penicillamine, leflunomide, azathioprine, anakinra, infliximab (REMICADE ^R), etanercept, TNFa blockers, a biological agent that targets an inflammatory cytokine, a non-steroidal anti-inflammatory drug (NSAIDs). NSAIDs include, but are not limited to acetyl salicylic acid, choline magnesium salicylate, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, nabutabumeclofenone, phenolmeclofenone, , piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors, and tramadol.

Compositions of the invention

CTLA4 molecules, with the mutant or wild-type sequences, can be made soluble by deleting the trans-membrane segment of CTLA4 (Oaks, MK, et al, 2000 Cellular Immunology 201: 144-153).

Alternatively, soluble CTLA4 molecules, with mutant or wild-type sequences, can be fusion proteins, in which the CTLA4 molecules are fused to non-CTLA4 residues such as immunoglobulin (Ig) molecules that make the molecules of CTLA4 are soluble. For example, a CTLA4 fusion protein can include the extracellular domain of CTLA4 fused to an immunoglobulin constant domain, resulting in the CTLA4Ig molecule (Figure 2) (Linsley, PS, et al., 1994 Immunity 1: 793- 80).

For clinical protocols, it is preferred that the immunoglobulin moiety does not induce a deleterious immune response in a subject. The preferred moiety is the immunoglobulin constant region, which includes the human and monkey immunoglobulin constant regions. An example of a suitable immunoglobulin region is human Cyl, which includes the CH2 and CH3 hinge regions that can mediate effector functions such as binding to Fc receptors, that mediate complement-dependent cytotoxicity (CDC), or mediate Antibody-dependent cell-mediated cytotoxicity (ADCC). The immunoglobulin residue may have one or more mutations in it (for example, in the CH2 domain, to reduce effector functions such as CDC or ADCC) where the mutation modulates the ability of the immunoglobulin to its ligand, by increasing or decreasing of the immunoglobulin binding capacity to Fc receptors. For example, mutations in the immunoglobulin residue can include changes in any or all of its cysteine ​​residues within the hinge domain, for example, the cysteines at positions +130, +136, and +139 are substituted with serine (Figure 24 ). The immunoglobulin moiety can also include proline at position +148 substituted with a serine, as shown in Figure 24. In addition, mutations in the immunoglobulin moiety may include having leucine at position +144 substituted with phenylalanine, leucine at position +145 substituted with glutamic acid, or glycine at position +147 substituted with alanine.

Additional non-CTLA4 residues for use in soluble CTLA4 molecules or soluble CTLA4 mutant molecules include, but are not limited to, p97 molecule, env gp 120 molecule, E7 molecule, and ova molecule (Dash, B. et al. al. 1994 J. Gen. Virol. 75 (Pt 6): 1389-97; Ikeda, T., et al. 1994 Gene 138 (1-2): 193-6; Falk, K., et al. 1993 Cell Immunol. 150 (2): 447-52; Fujisaka, K. et al. 1994 Virology 204 (2): 789-93). Other molecules are also possible (Gerard, C. et al. 1994 Neuroscience 62 (3): 721; Byrn, R et al. 1989 63 (10): 4370; Smith, D. et al. 1987 Science 238: 1704; Lasky, L. 1996 Science 233: 209).

The present invention provides soluble CTLA4 molecules that include a signal peptide sequence attached to the N-terminus of the extracellular domain of the CTLA4 portion of the molecule. Signal peptide

ES 2 302 811 T3 can be any sequence that will allow secretion of the mutant molecule, including the oncostatin M signal peptide (Malik, et al., 1989 Molec. Cell. Biol. 9: 2847-2853), or CD5 (Jones, NH et al., 1986 Nature 323: 346-349), or the signal peptide of any of any extracellular protein. The soluble CTLA4 molecule of the invention can include the oncostatin M signal peptide attached to the N-terminus of the extracellular domain of CTLA4, and the human immunoglobulin molecule (eg, hinge, CH2, and CH3) attached to the C-terminus. terminal of the extracellular domain (wild type or mutated) of CTLA4. This molecule includes the oncostatin M signal peptide that spans an amino acid sequence that has methionine at position -26 through alanine at position -1, the part of CTLA4 that spans an amino acid sequence that has methionine at position + 1 to aspartic acid at position +124, a glutamine amino acid residue bond at position +125, and the immunoglobulin part that encompasses an amino acid sequence having glutamic acid at position +126 to lysine at position +357.

In one embodiment, the soluble CTLA4 mutant molecules of the invention, comprising the mutated CTLA4 sequences described below, are fusion molecules comprising human IgC (gamma) 1 residues (i.e., IgCyl) fused to the fragments of CTLA4. Soluble CTLA4 mutant molecules may comprise one or more mutations (eg, amino acid substitutions, deletions, or insertions) in the extracellular domain of CTLA4.

For example, soluble CTLA4 mutant molecules may include a mutation (s) within or in close proximity to the region spanned by serine at position +25 to arginine at position +33 (e.g., S25-R33, which uses the conventional one-letter amino acid symbols). Mutant CTLA4 molecules can include an amino acid substitution at any of positions: S25, P26, G27, K28, A29, T30, E31, or R33.

In another embodiment, the soluble CTLA4 mutant molecules may include a mutation or mutations within or in close proximity to the region spanned by glutamic acid at position +95 to glycine at position +107 (eg, E95-G107). CTLA4 mutants can include an amino acid substitution at one or more of the following positions: K93, L96, M97, Y98, P99, P100, P101, Y102, Y103, L104, G105, I106, and G107.

Additionally, the invention provides soluble CTLA4 mutant molecules having a mutation (s) within or in close proximity to the region spanned by asparagine +108 to isoleucine at position +115 (eg, N108-I115). The mutant CTLA4 molecule can include an amino acid substitution at any or more of positions: L104, G105, I106, G107, Q111, Y113, or I115.

In one embodiment, the soluble CTLA4 mutant molecules comprise IgCy1 fused to a CTLA4 fragment comprising a single site mutation in the extracellular domain. The extracellular domain of CTLA4 comprises methionine at position +1 to aspartic acid at position +124 (eg, Figure 1). The extracellular part of CTLA4 can comprise alanine at position -1 to aspartic acid at position +124 (eg Figure 1).

Examples of single site mutations include the following in which leucine at position +104 is changed to any other amino acid:

<td>Single-site Mulant:</td><td>Codon change:</td>

<td>L104Elg</td><td>Glutamic acid GAG</td>

<td>L104Slg</td><td>Serine AGT</td>

<td>L104Tlg</td><td>Threonine ACG</td>

<td>L104Alg</td><td>alanine GCG</td>

<td>L104Wlg</td><td>Tryptophan TGG</td>

<td>L104Qlg</td><td>Glutamine CAG</td>

<td>L104Klg</td><td>Lysine AAG</td>

<td>L104Rlg</td><td>Arginine CGG</td>

<td>L104Glg</td><td>Glycine GGG</td>

ES 2 302 811 T3

Furthermore, the invention provides mutant molecules having the CTLA4 extracellular domain with two mutations, fused to an Ig Cy1 residue. Examples include the following where leucine at position +104 is exchanged for another amino acid (e.g. glutamic acid) and glycine at position +105, serine at position +25, threonine at position +30, or Alanine at position +29 is changed to any other amino acid:

<td>Double-site mule:</td><td>Codon change:</td>

<td>L104EG105Flg</td><td>Phenylalanine TTC</td>

<td>L104EG105 Wlg</td><td>Tryptophan TGG</td>

<td>L104EG105Llg</td><td>Leucine CTT</td>

<td>L104ES25Rlg</td><td>Arginine CGG</td>

<td>L104ET30Glg</td><td>Glycine GGG</td>

<td>L104ET30Nlg</td><td>Asparagine AAT</td>

<td>L104EA29Ylg</td><td>Tyrosine TAT</td>

<td>L104EA29Llg</td><td>Leucine TTG</td>

<td>L104EA29Tlg</td><td>Threonine ACT</td>

<td>L104EA29Wlg</td><td>Tryptophan TGG</td>

Still further, the invention provides mutant molecules having the extracellular domain of CTLA4 comprising three mutations, fused to an Ig Cy1 residue. Examples include the following where leucine at position +104 is changed by another amino acid (for example glutamic acid), alanine at position +29 is changed by another amino acid (for example tyrosine) and serine at position +25 is changed by another amino acid:

<td>Triple site mutants:</td><td>Codon change:</td>

<td>L104EA29YS25Klg</td><td>Lysine AAA</td>

<td>L104EA29YS25Klg</td><td>Lysine AAG</td>

<td>L104EA29YS25Nlg</td><td>Asparagine AAC</td>

<td>L104EA29YS25Rlg</td><td>Arginine CGG</td>

Soluble CTLA4 mutant molecules can have a binding amino acid residue that is located between the CTLA4 part and the Ig part of the molecule. The linking amino acid can be any amino acid, including glutamine. The linking amino acid can be introduced by molecular or chemical synthetic procedures known in the art.

The invention provides soluble CTLA4 mutant molecules comprising a single site mutation in the extracellular domain of CTLA4 such as L104EIg (as included in Figure 19) or L104SIg, wherein L104EIg and L104SIg are mutated in their CTLA4 sequences. so that the leucine at position +104 is substituted with glutamic acid or serine, respectively. Single-site mutation molecules further include parts of CTLA4 that span methionine at position +1 through aspartic acid at position +124, a glutamine-binding amino acid residue at position +125, and an immunoglobulin part that encompasses glutamic acid at position +126 to lysine at position +357. The immunoglobulin part of the mutant molecule can also be mutated such that cysteines at positions +130, +136, and +139 are substituted with serine, and proline at position +148 is substituted with serine. Alternatively, a single site soluble CTLA4 mutant molecule may have a CTLA4 portion spanning alanine at position -1 to aspartic acid at position +124.

ES 2 302 811 T3

The invention provides soluble CTLA4 mutant molecules that comprise a double site mutation in the extracellular domain of CTLA4, such as L104EA29YIg, L104EA29LIg, L104EA29TIg or L104EA29WIg, in which leucine at position +104 is substituted with glutamic acid and alanine in the +29 position is changed to tyrosine, leucine, threonine, and tryptophan, respectively. The sequences for L104EA29YIg, L104EA29LIg, L104EA29TIg, and L104EA29WIg, starting with methionine at position +1 and ending with lysine at position +357, plus a signal (guide) peptide sequence are included in the sequences as shown in Figures 3 and 20-22 respectively. Double-site mutant molecules further comprise parts of CTLA4 spanning methionine at position +1 through aspartic acid at position +124, a glutamine-binding amino acid residue at position +125, and an immunoglobulin part spanning glutamic acid. at position +126 to lysine at position +357. The immunoglobulin part of the mutant molecule can also be mutated, such that cysteines at positions +130, +136, and +139 are substituted with serine, and proline at position +148 is substituted with serine. Alternatively, these mutant molecules may have a CTLA4 portion spanning alanine at position -1 to aspartic acid at position +124.

The invention provides soluble CTLA4 mutant molecules comprising a double-site mutation in the extracellular domain of CTLA4, such as L104EG10SFIg, L104EG105WIg and L104EG105LIg, in which leucine at position +104 is substituted with glutamic acid and glycine at position +105 is substituted with phenylalanine, tryptophan, and leucine, respectively. Double-site mutant molecules further comprise parts of CTLA4 spanning methionine at position +1 through aspartic acid at position +124, a glutamine-binding amino acid residue at position +125, and an immunoglobulin part spanning glutamic acid. at position +126 to lysine at position +357. The immunoglobulin part can also be mutated, such that cysteines at positions +130, +136, and +139 are substituted with serine, and proline at position +148 is substituted with serine. Alternatively, these mutant molecules can have a CTLA4 portion spanning alanine at position -1 to aspartic acid at position +124.

The invention provides L104ES25RIg which is a double site mutant molecule that includes a portion of CTLA4 spanning methionine at position +1 to aspartic acid at position +124, a glutamine binding amino acid residue at position +125, and the part of immunoglobulin spanning glutamic acid at position +126 to lysine at position +357. The part having the extracellular domain of CTLA4 is mutated so that serine at position +25 is substituted with arginine, and leucine at position +104 is substituted with glutamic acid. Alternatively, L104ES25RIg may have a CTLA4 portion spanning alanine at position -1 to aspartic acid at position +124.

The invention provides soluble CTLA4 mutant molecules comprising a double-site mutation in the extracellular domain of CTLA4, such as L104ET30GIg and L104ET30NIg, in which leucine at position +104 is substituted with glutamic acid and threonine at position +30. it is substituted with glycine and asparagine, respectively. Double-site mutant molecules further comprise parts of CTLA4 spanning methionine at position +1 through aspartic acid at position +124, a glutamine-binding amino acid residue at position +125, and an immunoglobulin part spanning glutamic acid. at position +126 to lysine at position +357. The immunoglobulin part of the mutant molecule can also be mutated, such that cysteines at positions +130, +136, and +139 are substituted with serine, and proline at position +148 is substituted with serine. Alternatively, these mutant molecules can have a portion of CTLA4 spanning alanine at position -1 to aspartic acid at position +124.

The invention provides soluble CTLA4 mutant molecules comprising a triple site mutation in the extracellular domain of CTLA4, such as L104EA29YS25KIg, L104EA29YS25NIg, L104EA29YS25RIg, in which leucine at position +104 is substituted with glutamic acid, alanine at position +29 is changed to tyrosine and serine at position +25 is changed to lysine, asparagine, and arginine, respectively. Triple-site mutant molecules further comprise parts of CTLA4 spanning methionine at position +1 through aspartic acid at position +124, a glutamine-binding amino acid residue at position +125, and an immunoglobulin part spanning glutamic acid. at position +126 to lysine at position +357. The immunoglobulin part of the mutant molecule can also be mutated, such that cysteines at positions +130, + 136, and +139 are substituted with serine, and proline at position +148 is substituted with serine. Alternatively, these mutant molecules can have a CTLA4 portion spanning alanine at position -1 to aspartic acid at position +124.

Additional embodiments of soluble CTLA4 mutant molecules include homologous CTLA4 / CD28 mutant molecules that bind to a B7 (Peach, RJ, et al., 1994 J Exp Med 180: 2049-2058). Examples of these CTLA4 / CD28 chimeric mutant molecules include HS1, HS2, HS3, HS4, HS5, HS6, HS4A, HS4B, HS7, HS8, HS9, HS10, HS11, HS 12, HS13, and HS14 (US Patent No. 5,773,253).

Preferred embodiments of the invention are soluble CTLA4 molecules such as CTLA4Ig (as shown in Figure 2, starting at methionine at position +1 and ending at lysine at position +357) and CTLA4 soluble mutant L104EA29YIg ( as shown in Figure 3, starting at methionine at position +1 and ending at lysine at position +357).

The invention further provides nucleic acid molecules comprising nucleotide sequences that encode the amino acid sequences that correspond to the soluble CTLA4 molecules of the invention. In

In one embodiment, the nucleic acid molecule is a DNA (eg, cDNA) or its hybrid. DNA encoding CTLA4Ig (Figure 2) was deposited on May 31, 1991 with the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, VA 20110-2209 and has been agreed with the ATCC accession number ATCC 68629. The DNA encoding L104EA29YIg (statement included in Figure 3) was deposited on June 19, 2000 with the ATCC and the ATCC accession number PTA-2104 has been agreed. Alternatively, the nucleic acid molecules are RNA or one of its hybrids.

CTLA4 hybrids

The present invention provides soluble CTLA4 mutant molecules that comprise at least the extracellular domain of CTLA4 or its parts that bind to CD80 and / or CD86. The extracellular part of CTLA4 comprises methionine at position +1 through aspartic acid at position +124 (eg, Figure 1). The extracellular part of CTLA4 can comprise alanine at position -1 to aspartic acid at position +124 (eg, Figure 1). The extracellular part of CTLA4 can comprise glutamic acid at position +95 up to cysteine ​​at position + 120. The extracellular part of CTLA4 can comprise methionine at position +1 up to cysteine ​​at position +21 and glutamic acid at position + 95 to aspartic acid at position +122. The extracellular part of CTLA4 can comprise methionine at position +1 to tyrosine at position +23 and valine at position +32 to aspartic acid at position +122. The extracellular part of CTLA4 can comprise alanine at position +24 to glutamic acid at position +31 and glutamic acid at position +95 to aspartic acid at position +122. The extracellular part of CTLA4 can comprise alanine at position +24 to glutamic acid at position +31 and glutamic acid at position +95 to isoleucine at position +112. The extracellular part of CTLA4 can comprise alanine at position +24 to glutamic acid at position +31 and tyrosine at position +113 to aspartic acid at position +122. The extracellular part of CTLA4 can comprise alanine at position +50 to glutamic acid at position +57 and glutamic acid at position +95 to aspartic acid at position + 122. The extracellular part of CTLA4 can comprise alanine at position +24 to glutamic acid at position +31; alanine at position +50 to glutamic acid at position +57; and glutamic acid at position +95 to aspartic acid at position +122. The extracellular part of CTLA4 may comprise alanine at position +50 to glutamic acid at position +57 and glutamic acid at position +95 to isoleucine at position +112. The extracellular part of CTLA4 can comprise alanine at position +24 to glutamic acid at position +31; alanine at position +50 to glutamic acid at position +57; and glutamic acid at position +95 to aspartic acid at position +122. The extracellular part of CTLA4 can comprise alanine at position +24 through valine at position +94. The extracellular part of CTLA4 can comprise alanine at position -1 through cysteine ​​at position +21. The extracellular part of CTLA4 can comprise methionine at position +1 through cysteine ​​at position +21. The extracellular part of CTLA4 can comprise glutamic acid at position +95 to aspartic acid at position +122. The extracellular part of CTLA4 can comprise alanine at position -1 to valine at position +94. The extracellular part of CTLA4 can comprise methionine at position +1 through valine at position +94. The extracellular part of CTLA4 can comprise alanine at position +24 to glutamic acid at position +31. The extracellular part of CTLA4 can comprise alanine at position -1 to tyrosine at position +23. The extracellular part of CTLA4 can comprise methionine at position +1 through tyrosine at position +23. The extracellular part of CTLA4 can comprise valine at position +32 to aspartic acid at position +122. The extracellular part of CTLA4 can comprise tyrosine at position +113 to aspartic acid at position +122. The extracellular part of CTLA4 can comprise glutamic acid at position +95 to isoleucine at position +112. The extracellular part of CTLA4 can comprise alanine at position +50 to glutamic acid at position +57.

Procedures for producing the molecules of the invention

The expression of the mutant CTLA4 molecules can be in prokaryotic cells. Prokaryotes are most often represented by various strains of bacteria. Bacteria can be either great positive or great negative. Other microbial strains can also be used.

The nucleotide sequences of mutant CTLA4 molecules can be inserted into a vector designed to express foreign sequences in prokaryotic cells such as E. coli. These vectors may include commonly used prokaryotic control sequences which are defined herein to include promoters for initiation of transcription, optionally with an operator, along with ribome binding site sequences, include such promoters used from common as the beta-lactamase (penicillinase) and lactose (lac) promoter systems (Chang, et al., (1977) Nature 198: 1056), the tryptophan (trp) promoter system (Goeddel, et al., (1980) Nucleic Acids Res. 8: 4057) and the P promoter_L derived from lambda and the ribosome binding site of the N gene (Shimatake, et al., (1981) Nature 292: 128).

Such inclusion vectors will also include origins of replication and selectable markers, such as a beta-lactamase or neomycin phosphotransferase gene that confers antibiotic resistance, so that the vectors can replicate in bacteria and cells that carry the plasmids can be selected. when developed in the presence of antibiotics, such as ampicillin or kanamycin.

ES 2 302 811 T3

The spreading plasmid can be introduced into prokaryotic cells by a variety of standard procedures, including but not limited to CaCl cloning.₂ (Cohen, (1972) Proc. Natl. Acad. Sci. USA 69: 2110, and Sambrook et al. (Eds.), "Molecular Cloning: A Laboratory Manual", 2^to Edition, Cold Spring Harbor Press, (1989)) and electroporation.

In accordance with the practice of the invention, eukaryotic cells are also suitable host cells. Examples of eukaryotic cells include any animal cell, whether primary or immortalized yeast (eg, Saccharomyces cerevisiae, Schizosaccharomycespombe, and Pichia pastoris), and plant cells. Myeloma, COS, and CHO cells are examples of animal cells that can be used as hosts. Particular CHO cells include, but are not limited to, DG44 (Chasin, et al., 1986 Som. Cell. Molec. Genet. 12: 555-556; Kolkekar 1997 Biochemistry 36: 10901-10909), CHO-K1 (ATCC Do not. CCL-61), CHO-K1 Tet-A cell line (Clontech), CHO designated ECACC 85050302 (CAMR, Salisbury, Wiltshire, UK), CHO clone 13 (GEIMG, Genova, IT), CHO clone B (GEIMG, Genova, IT), CHO-K1 / SF designated ECACC 93061607 (CAMR, Salisbury, Wiltshire, UK), and RR-CHOK1 designated ECACC 92052129 (CAMR, Salisbury, Wiltshire, UK). Exemplary plant cells include tobacco cells (whole plants, cell culture, or callus), corn, soybeans, and rice. Corn, soy, and rice seeds are also acceptable.

The nucleotide sequences encoding the mutant CTLA4 molecules can also be inserted into a vector designed to express foreign sequences in a eukaryotic host. The regulatory elements of the vector can vary according to the particular eukaryotic host. The nucleic acid molecule encoding L104EA29YIg is contained in pD16 L104EA29YIg and was deposited on June 19, 2000 with the American Type Culture Collection (ATCC), 10801 University Blvd., Manases, VA 20110-2209 (ATCC No. PTA- 2104). The vector pD16 L104EA29YIg is a derivative of the vector pcDNA3 (INVITROGEN).

Commonly used eukaryotic control sequences for use in expression vectors include promoters and control sequences compatible with mammalian cells such as, for example, CMV promoter (CDM8 vector) and avian sarcoma virus (ASV) ( vector nLN). Other commonly used promoters include the late early early promoters of the Simian Virus 40 (SV40) (Fiers, et al., (1973) Nature 273: 113), or other viral promoters such as those derived from polyoma, Adenovirus 2, and bovine papilloma virus. An inducible promoter, such as hMII (Karin, et al., (1982) Nature 299: 797-802) can also be used.

Vectors for expressing mutant CTLA4 molecules in eukaryotes can also carry sequences called enhancer regions. These are important in optimizing gene expression and are either upstream or downstream of the promoter region.

Examples of expression for eukaryotic host cells include, but are not limited to, vectors for mammalian host cells (eg, BPV-1, pHyg, pRSV, pSV2, pTK2 (Maniatis); pIRES (Clontech); pRc / CMV2 , pRc / RSV, pSFV1 (Life Technologies); pVPakc vectors, pCMV vectors, pSG5 vectors (Stratagene)), retroviral vectors (e.g., pFB vectors (Stratagene)), pCDNA-3 (Invitrogen) or its modified forms, adenoviral vectors ; Adeno-associated virus vectors, baculovirus vectors, yeast vectors (eg, pESC vectors (Stratagene)).

Nucleotide sequences encoding mutant CTLA4 molecules can integrate into the genome of the eukaryotic host cell and replicate as the host genome replicates. Alternatively, the vector carrying mutant CTLA4 molecules may contain the origins of replication that allow for extrachromosomal replication.

For expression of the sequences in Saccharomyces cerevisiae, the plasmid origin of replication, the 2µ circle can be used. (Broach, (1983) Meth. Enz. 101: 307). Alternatively, yeast genome sequences capable of promoting autonomous replication can be used (see, for example, Stinchcomb et al., (1979) Nature 282: 39); Tschemper et al., (1980) Gene 10: 157; and Clarke et al., (1983) Meth. Enz. 101: 300).

The transcriptional transcription sequences for yeast vectors include promoters for the synthesis of glycolytic enzymes (Hess et al., (1968) J. Adv. EnzymeReg. 7: 149; Holland et al., (1978) Biochemistry 17: 4900) . Additional promoters known in the art include the CMV promoter provided in the CDM8 vector (Toyama and Okayama, (1990) FEBS 268: 217-221); the promoter for 3-phosphoglycerate kinase (Hitzeman et al., (1980) J. Biol. Chem. 255: 2073), and those for other glycolytic enzymes.

Other promoters are inducible because they can be regulated by environmental stimuli or the growth medium of the cells. These inducible promoters include those of the genes for heat shock proteins, alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, nitrogen-associated enzymes, and enzymes responsible for maltose and galactose utilization.

Regulatory sequences can also be placed at the 3 'end of the coding sequences. These sequences can act to stabilize messenger RNA. Such terminators are found in the 3 'untranslated region after the reporting sequences in several yeast and mammalian derived genes.

ES 2 302 811 T3

Exemplary vectors for plants and plant cells include, but are not limited to, Agrobacterium Ti plasmids, cauliflower mosaic virus (CaMV), and tomato yellow mosaic virus (TGMV).

General aspects of mammalian cell host system transformations have been described by Axel (US Patent No. 4,399,216 issued August 16, 1983). Mammalian cells can be transformed by procedures including, but not limited to, transfection in the presence of calcium phosphate, microinjection, electroporation, or by transduction with viral vectors. Procedures for introducing foreign DNA sequences into plant and yeast genomes include (1) mechanical procedures, such as microinjection of DNA into individual cells or protoplasts, cells shaken in a Voretx apparatus with glass beads in the presence of DNA, or firing of DNA-coated tungsten or gold spheres on cells or protoplasts; (2) introduction of DNA by preparing macromolecule permeable cell membranes by polyethylene glycol treatment or subjecting to high voltage electrical pulses (electroporation); or (3) the use of liposomes (containing cDNA) that fuse to cell membranes.

Expression of mutant CTLA4 molecules can be detected by staining of Coomassie stain SDS-PAGE gels and immunoblotting using antibodies that bind to CTLA4. Protein recovery can be performed using conventional protein purification means, for example, affinity chromatography or ion exchange chromatography, to produce substantially pure product (R. Scopes in: "Protein Purification, Principles and Practice", 3rd Edition, Springer-Verlag (1994)).

The invention further provides soluble CTLA4 mutant protein molecules produced by the methods herein.

Codon-based mutagenesis of CTLA4IG

In one embodiment, the novel site-directed mutagenesis and selection procedure were used to identify various mutations in the extracellular domain of CTLA4 that enhance binding activity for CD86. In this embodiment, mutations were carried out in the residues in the regions of the extracellular domain of CTLA4 from serine 25 to arginine 33, the C 'strand (alanine 49 and threonine 51), the F strand (lysine 93, glutamic acid 95 and leucine 96), and in the region from methionine 97 to tyrosine 102, tyrosine 103 to glycine 107 and in the G strand at the glutamine 111, tyrosine 113 and isoleucine 115 positions. These sites were chosen based on studies of chimeric CD28 / CTLA4 fusion proteins (Peach et al., J. Exp. Med., 1994, 180: 2049-2058), and on a prediction model of which side chains of amino acid residues would be solvent exposed, and a lack of identity or homology of amino acid residues at certain positions between CD28 and CTLA4. Also, any residue that is spatially in close proximity (5 to 20 Angstrom Units) to the identified residues is considered part of the present invention.

To synthesize and select for soluble CTLA4 mutant molecules with altered affinities for CD80 and / or CD86, a two-step strategy was adopted. The experiments resulted in first generating a library of mutations in a specific codon of an extracellular part of CTLA4 and then selecting these from BIAcore to identify mutants with altered reactivity to CD80 or CD86. The Biacore assay system (Pharmacy, Piscataway, NJ) uses a surface plasmon resonance detector system that essentially involves the covalent binding of either CD80Ig or CD86Ig to a dextran-coated sensor processor that locates in a detector. The test molecule can then be injected into the chamber containing the sensor processor and the amount of complementary protein that binds can be determined based on the change in molecular mass that is physically associated with the dextran-coated side of the sensor processor. &lt;molecular mass change can be measured by the detector system.

Pharmaceutical compositions of the invention

The invention includes pharmaceutical compositions for use in treating diseases of the immune system comprising pharmaceutically effective amounts of soluble CTLA4 mutant molecules. In certain embodiments, immune system diseases are mediated by interactions of CD28- and / or CTLA4-positive cells with CD80 and / or CD86-positive cells. The soluble CTLA4 molecules are preferably soluble CTLA4 molecules with wild-type sequence and / or soluble CTLA4 molecules having one or more mutations in the extracellular domain of CTLA4. The pharmaceutical composition may include mutant CTLA4 or CTLA4 protein molecules and / or nucleic acid molecules, and / or vectors encoding the molecules. In a preferred embodiment, the soluble CTLA4 mutant molecule has the amino acid sequence of the CTLA4 extracellular domain as shown in any of Figures 3 (L104EA29Y). Even more preferably, the soluble CTLA4 mutant molecule is L104EA29YIg as described herein and shown in Figure 3. The compositions may additionally include other therapeutic agents, including, but not limited to, immunosuppressive agents, NSAIDs, corticosteroids, glucococoticosteroids, drugs, toxins, enzymes, antibodies, or conjugates.

One embodiment of the pharmaceutical composition comprises an effective amount of a soluble CTLA4 molecule alone or in combination with an effective amount of at least one other therapeutic agent, including an immunosuppressive agent, or NSAIDs.

ES 2 302 811 T3

The effective amounts of soluble CTLA4 in the pharmaceutical composition can range from about 0.1 to 100 mg / kg by weight of the subject. In another embodiment, the effective amount may be an amount between about 0.5 and 5 mg / kg per weight of a subject, about 5-10 mg / kg per weight of a subject, about 10-15 mg / kg per weight of a subject, approximately between 15 and 20 mg / kg by weight of a subject, approximately between 20 and 25 mg / kg by weight of a subject, approximately between 25 and 30 mg / kg by weight of a subject, approximately between 30 and 35 mg / kg by weight of a subject, about 35-40 mg / kg by weight of a subject, about 40-45 mg / kg of a subject, about 45-50 mg / kg by weight of a subject, about 50-55 mg / kg by weight of a subject, approximately between 55 and 60 mg / kg by weight of a subject, approximately between 60 and 65 mg / kg by weight of a subject, approximately between 65 and 70 mg / kg by weight of a subject, approximately between 70 and 75 mg / kg by weight of a subject, about 75 to 80 mg / kg by weight of a subject, about 80 to 85 mg / kg by weight of a subject, about 85 to 90 mg / kg by weight of a subject, about 90 to 95 mg / kg by weight of a subject, or about 95-100 mg / kg by weight of a subject. In one embodiment, the effective amount is 2 mg / kg by weight of a subject. In another embodiment, the effective amount is 10 mg / kg by weight of a subject. In one embodiment, the effective amount of a soluble CTLA4 molecule is 2 mg / kg per weight of a subject. In one embodiment, the effective amount of a soluble CTLA4 molecule is 10 mg / kg per weight of a subject.

The amount of an immunosuppressive agent administered to a subject varies depending on several factors including the efficacy of the drug on a specific subject and the toxicity (ie, tolerance) of a drug to a subject.

Methotrexate is commonly administered in an amount between about 0.1 and 40 mg per week with a common dosage ranging from about 5 to 30 mg per week. Methotrexate can be administered to a subject in various increments: approximately 0.1 to 5 mg / week, approximately 5 to 10 mg / week, approximately 10 to 15 mg / week, approximately 15 to 20 mg / week, about 20-25 mg / week, about 25-30 mg / week, about 30-35 mg / week, or about 35-40 mg / week. In one embodiment, an effective amount of an immunosuppressive agent, including methotrexate, is an amount between about 10 and 30 mg / week.

The effective amounts of methotrexate range from about 0.1 to 40 mg / week. In one embodiment, the effective amount ranges from about 0.1 to 5 mg / week, about 5 to 10 mg / week, about 10 to 15 mg / week, about 15 to 20 mg / week, about 20 to 25mg / week, about 25-30mg / week, about 30-35mg / week, or about 35-40mg / week. In one embodiment, the methotrexate is administered in an amount ranging from about 10 to 30 mg / week.

Cyclophosphamide, an alkaline agent, can be administered in dosages ranging from about 1 to 10 mg / kg of body weight per day.

Cyclosporine (for example NEORAL^R) also known as Cyclosporin A, it is commonly administered in dosages ranging from about 1 to 10 mg / kg of body weight per day. Dosages ranging from about 2.5 to 4 mg per body weight per day are commonly used.

Chloroquine or hydroxychloroquine (for example PLAQUENIL^R); it is commonly administered in dosages ranging from about 100 to 1000 mg per day. Preferred dosages range from about 200-600 mg administered per day.

Sulfasalazine (for example, AZULFIDINE EN-tabs^R) is commonly administered in dosages ranging from about 50 to 5000 mg per day, with a common dosage of about 2000 to 3000 mg per day for adults. Dosages for children are commonly between about 5 and 100 mg / kg of body weight, up to 2 grams per day.

Gold salts are formulated for administration: injection or oral. Injectable gold salts are commonly prescribed in dosages between approximately 5 and 100 mg doses every two to four weeks. Orally administered gold salts are commonly prescribed in dosages ranging from about 1 to 10 mg per day.

D-penicillamine or penicillamine (CUPRIMINE^R) is commonly administered in dosages between about 50 and 2000 mg per day, with preferred dosages between about 125 mg per day up to 1500 mg per day.

Azathioprine is commonly administered in dosages between approximately 10 and 250 mg per day. Preferred dosages range from about 25-200 mg per day.

Anakinra (e.g. KINERET^R) is an interleukin-1 receptor antagonist. A dosage range for anakinra is between approximately 10 and 250 mg per day, with a recommended dosage of approximately 100 mg per day.

ES 2 302 811 T3

Infliximab (REMICADE^R) is a chimeric monoclonal antibody that binds to tumor necrosis factor alpha (TNFa). Infliximab is commonly administered in dosages between about 1 and 20 mg / kg of body weight every four to eight weeks. Dosages between about 3 and 10 mg / kg of body weight can be administered every four to eight weeks depending on the subject.

Etanercept (for example ENBREL^R) is a dimeric fusion protein that binds to tumor necrosis factor (TNF) and blocks its interactions with TNF receptors. Commonly administered dosages of etanercept are between about 10 and 100 mg per week for adults with a preferred dosage of about 50 mg per week Dosages for juvenile subjects range between about 0.1 and 50 mg / kg of body weight per week with a maximum of about 50mg per week.

Leflunomide (ARAVA^R) is commonly administered in dosages between about 1 and 100 mg per day. A common daily dosage is between approximately 10 and 20 mg per day.

Pharmaceutical compositions also preferably include suitable carriers and adjuvants including any material that when combined with the molecule of the invention (eg, a soluble CTLA4 mutant molecule, eg, L104EA29YIg) retains the activity of the molecule and is non-reactive. with the subject's immune system. Examples of suitable carriers and adjuvants include, but are not limited to, bovine serum albumin; ion exchangers; alumina; lecithin; buffer substances, such as phosphates; glycine; sorbic acid; potassium sorbate; and salts or electrolytes, such as protamine sulfate. Other examples include any of the conventional pharmaceutical carriers such as phosphate buffered saline; Water; emulsions, such as oil / water emulsion; and various types of wetting agents. Other vehicles also include sterile solutions; tablets, including coated tablets and capsules. Typically such vehicles contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or its salts, magnesium stearate or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients. Such vehicles can also include flavor and color additives or other ingredients. Compositions comprising such carriers are formulated by well known standard procedures. Such compositions can also be formulated into various lipid compositions, such as, for example, liposomes, as well as various polymer compositions, such as polymer microspheres.

The pharmaceutical compositions of the invention may be administered in conventional modes of administration including, but not limited to, intravenous (i. V) administration, intraperitoneal (ip) administration, intramuscular (im) administration, subcutaneous, oral, administration in the form of suppository, or in topical contact form, or implantation of a slow release device such as a miniosmotic pump, to the subject.

The pharmaceutical compositions of the invention may be in a variety of dosage forms, including, but not limited to, liquid solutions or suspensions, tablets, pills, powders, suppositories, polymeric microcapsules or microvesicles, liposomes, and injectable or infusible solutions. ; The preferred form depends on the mode of administration and the therapeutic application.

The most effective mode of administration and dosage regimen for the compositions of this invention depends on the severity and course of the disease, the health of the patient and response to treatment, and judgment of the treating physician. Accordingly, the dosages of the compositions should be adjusted for the individual patient.

The soluble CTLA4 mutant molecules can be administered to a subject in an amount in an amount and for a time (e.g. length of time and / or multiple times) sufficient to block endogenous B7 molecules (e.g. CD80 and / or CD86) binding to their respective ligands, in the subject. Blocking endogenous B7 / ligand binding therefore inhibits interactions between B7-positive cells (eg, CD80 and / or CD86-positive cells) with CD28- and / or CTLA4-positive cells. The dosage of a therapeutic agent depends on many factors including, but not limited to, the type of tissue affected, the type of autoimmune disease being treated, the severity of the disease, the health of the subject, and the response of the subject. to treatment with the agents. Accordingly, the dosages of the agents may vary depending on the subject and mode of administration. The soluble CTLA4 mutant molecules can be administered in an amount between 0.1 and 20.0 mg / kg of the patient's weight / day, preferably between 0.5 and 10.0 mg / kg / day. The administration of the pharmaceutical compositions of the invention can be carried out in several times. In one embodiment, the pharmaceutical composition of the invention can be administered over one or several hours. Furthermore, the administration of can be repeated depending on the severity of the disease as well as other factors as understood in the art.

Procedures of the invention

The present invention provides methods for treating immune system diseases and autoimmune diseases in a subject comprising administering to the subject an effective amount of a mutant CTLA4 or CTLA4 molecule that binds to CD80 and / or CD86 molecules on CD80 and / or CD86 cells. -positive in a way that inhibits the binding of CD80 and / or CD86 to CTLA4 and / or CD28. The methods comprise administering a therapeutic composition, comprising soluble mutant CTLA4 or CTLA4 molecules of the invention, to a subject in an amount effective to suppress at least one of the disease-associated symptoms of the system.

ES 2 302 811 T3 immune. Additionally, the invention can provide long-term therapy for immune system systems by blocking T cell / B7 positive cell interactions, thereby blocking T cell activation / stimulation by costimulation signals. such as binding of B7 to CD28, leading to induction of anergy or tolerance to T cells.

The mutant CTLA4 or CTLA4 molecules of the invention show inhibitory properties in vivo. Under conditions where positive T / B7 cell interactions, for example T cell / B cell interactions, occur as a result of contact between T cells and positive B7 cells, binding of introduced CTLA4 molecules that react with the B7 positive cells, for example B cells, can interfere with, ie, inhibit, T cell / B7 positive cell interactions that result in the regulation of immune responses. Inhibition of T cell responses by administration of a soluble CTLA4 molecule may also be useful in treating autoimmune disorders that result from inappropriate activation of T cells that are reactive against autoantigens, and that promote the production of cytokines and autoantibodies that are involved in the pathology of the disease. Administration of the L104EA29YIg molecule to a subject suffering from or susceptible to a susceptible disorder can prevent the activation of autoreactive T cells and can reduce or eliminate symptoms of the disease. This method may also comprise the administration to the subject of a L104EA29YIg molecule of the invention, alone or in conjunction, with additional ligands, such as those reactants with IL-2, IL-4, or γ-interferon.

The invention provides methods for regulating immune responses. Immune responses can be down-regulated (down-regulated) by the mutant CTLA4 or CTLA4 molecules of the invention, can be by inhibiting or blocking an immune response that is already underway, or can prevent the induction of an immune response. The mutant CTLA4 or CTLA4 molecules of the invention can inhibit T cell functions, such as T cell proliferation and cytokine secretion, by suppressing T cell responses or by inducing specific tolerance in cells. T cells, or both. In addition, mutant CTLA4 or CTLA4 molecules of this invention, which interfere with the CTLA4 / CD28 / B7 pathway can inhibit T cell proliferation and / or cytokine secretion, and thus result in the destruction of tissue and induction of T cell unresponsiveness or anergy.

The invention further provides methods for inhibiting organ or tissue transplant rejection in subjects comprising administering an effective amount of at least one soluble CTLA4 or CTLA4 molecule, eg, L104EA29YIg, to the subject before, during and / or after. transplant. In another embodiment, the method of the invention includes administering to a subject at least one CTLA4 molecule or soluble CTLA4 mutant in combination with at least one other therapeutic agent, including, but not limited to, a drug, an enzyme, a antibody, or a conjugate.

The organ or tissue transplantation can be from any type of organ or tissue capable of transplantation. In one embodiment, the transplanted tissue can be a pancratic tissue. In a preferred embodiment, the transplanted tissue is pancreatic islet cells. The invention also provides methods for treating type 1 diabetes and / or type 2 diabetes in subjects by inhibiting islet cell transplant rejection.

The present invention further provides a method of inhibiting pancreatic islet transplant rejection in a subject, the subject being a recipient of transplanted tissue. Typically, in tissue transplants, rejection of the grafts is initiated by their recognition as foreign by the T cells, followed by an immune response that destroys the graft. Administration of a soluble CTLA4 molecule in the method of this invention inhibits T cell proliferation and / or cytokine secretion, resulting in reduced tissue destruction and induction of non-responsiveness of specific T cells of antigen that can result in long-term acceptance, without the need for generalized immunosuppression.

A preferred embodiment of the invention comprises the use of the soluble CTLA4 mutant molecule L104EA29YIg to regulate the functional interactions of CTLA4- and CD28-positive cells with B7 positive cells, to treat diseases of the immune system such as diabetes and / or regulate down immune responses. The L104EA29YIg of the invention is a soluble CTLA4 mutant molecule comprising at least the two amino acid changes, leucine (L) to glutamic acid. (E) at position +104 and alanine (A) to tyrosine (Y) changed at position +29. The L104EA29YIg molecule may further encompass mutations beyond the two specified herein.

The method may further comprise administration with the soluble CTLA4 mutant molecules, a baseline immunosuppressive regimen to the subject. The background immunosuppressive regimen may include (but is not limited to: cyclosporine, azathioprine, methotrexate, cyclophosphamide, lymphocyte immune globulin, anti-CD3 antibodies, Rho (D) immune globulin, adrenocorticosteroids, sulfasalzine, FK-506. methoxsalen, mycophenolate mofetil (CELLCEPT), horse anti-human thymocyte globulin (ATGAM), humanized anti-TAC (HAT), basiliximab (SIMULECT), rabbit anti-human thymocyte globulin (THYMOGLOBULIN), sirolimus, thalidomide, methotrexate , chloroquine, hydroxychloroquine, sulfasalazine, sulfasalazopyrin, leflunomide, gold salts, D-penicillamine, azathioprine, anakinra, infliximab, etanercept, TNFa blockers, or a biological agent that targets an inflammatory cytokine. In a preferred embodiment, the background immunosuppressive regimen is steroid-free. More preferably, the background immunosuppressive regimen comprises rapamycin and anti-human IL-2 R mAb.

ES 2 302 811 T3

One embodiment of the invention comprises the use of a molecule that blocks the interaction between B7 and CTLA4 together with an immunosuppressive agent that regulates an immune response in order to treat a disease of the immune system such as diabetes. The molecule used to block the B7 / CTLA4 interaction can be a soluble CTLA4 such as CTLA4Ig, CTLA4Ig / CD28Ig or L104EA29YIg, a soluble CD28 such as CD28Ig, a soluble B7 (B7-1 or B72) such as B7Ig, anti monoclonal antibodies -CTLA4, anti-CD28 monoclonal antibodies or anti-B7 monoclonal antibodies.

Subjects treated by the present invention include mammalian subjects, including human, monkey, ape, dog, cat, cow, horse, goat, pig, rabbit, mouse, and rat.

The present invention provides various methods, local or systemic, for the administration of the therapeutic compositions of the invention such as a soluble CTLA4 molecule alone or in conjunction with an immunosuppressive agent and / or other therapeutic drug. Procedures include intravenous, intramuscular, intraperitoneal, oral, inhalation, and subcutaneous procedures, as well as implantable pump, continuous infusion, gene therapy, liposomes, suppositories, topical contact, vesicles, capsules, and injection. The therapeutic agent, in admixture with a carrier, is commonly lyophilized for storage and reconstituted with water or a neutral pH buffered solution (approximately pH 7-8, eg, pH 7.5) prior to administration.

As is conventional practice in the art, the compositions of the invention can be administered to the subject in any pharmaceutically acceptable form.

In accordance with the practice of the invention, the methods of the invention, the methods comprise administering to a subject the soluble CTLA4 molecules of the invention that regulate the interactions of CD28- and / or CTLA4 positive cells with B7 cells. -positive. The B7 positive cells are contacted with an effective amount of the soluble CTLA4 molecules of the invention, or their fragments or derivatives, such that they form soluble CTLA4 / B7 complexes. The complexes interfere with the interaction between endogenous CTLA4 and CD28 molecules with the B7 family molecules.

Soluble CTLA4 molecules can be administered to a subject in an amount and for a time (eg, length of time and / or multiple times) sufficient to block endogenous B7 molecules from binding to their respective ligands, in the subject. Thus inhibiting the blocking of endogenous B7 / ligand binding the interactions between B7 positive cells with CD28- and / or CTLA4 positive cells.

The dosage of a therapeutic agent depends on many factors including, but not limited to, the type of tissue affected, the type of autoimmune disease being treated, the disease severity of the disease, the subject's health and response. to treatment with agents. In accordance with the foregoing, the dosages of the agents may vary depending on each subject and the mode of administration. The soluble CTLA4 molecules can be administered in an amount of between about 0.1 and 100 mg / kg per patient weight / day.

The invention also encompasses the use of the compositions of the invention in conjunction with other pharmaceutical agents to treat diseases of the immune system. For example, diabetes can be treated with the molecules of the invention in conjunction with, but not limited to, immunosuppressive agents such as corticosteroids, cyclosporine (Mathiesen 1989 Cancer Lett. 44 (2): 151-156), prednisone, azathioprine, ( R. Handschumacher, in: "Drugs Used for Immunosuppression" pages 1264-1276), TNFa blockers or antagonists (New England Journal of Medicine, vol. 340: 253-259, 1999; The Lancet vol. 354: 1932-39, 1999, Annals of Internal Medicine, vol. 130: 478-486), or any other biological agent that targets any inflammatory cytokines, non-steroidal anti-inflammatory drugs / Cox-2 inhibitors, hydroxychloroquine, sulfasalazopriine, gold salts, etanercept, infliximab, rapamycin, mycophenolate mofetil, azathioprine, tacrolismus , basiliximab, cytoxan, interferon beta-1a, interferon beta-1b, glatiramer acetate, mitoxantrone hydrochloride, anakinra and / or other biological agents.

Soluble CTLA4 molecules (preferably, L104EA29YIg) can also be used in combination with one or more of the following agents that regulate an immune response: soluble gp39 (also known as CD40 ligand (CD40L), CD154, T-BAM, TRAP), soluble CD29, soluble CD40, soluble CD80 (for example ATCC 68627), soluble CD86, soluble CD28 (for example 68628), soluble CD56, Soluble Thy-1, soluble CD3, soluble TCR, soluble VLA-4, soluble VCAM-1, soluble LECAM-1, soluble ELAM-1, soluble CD44, gp39 reactive antibodies (for example ATCC HB-10916, ATCC HB-12055 and ATCC HB-12056), CD40-reactive antibodies (for example ATCC HB-9110), antibodies reactive with B7 (for example ATCC HB-253, AtCC CRL-2223, ATCC CrL-2226, ATCC HB-301, ATCC HB-11341, etc), antibodies reactive with CD28 (for example ATCC HB-11944 or mAb 9.3 as is described by Martin et al (J. Clin. Immun. 4 (1): 18 - 22, 1980), LFA1-reactive antibodies (for example ATCC HB-9579 and ATCC TIB-213), LFA-2-reactive antibodies, IL-2-reactive antibodies, IL-12-reactive antibodies, IFN-reactive antibodies gamma, antibodies reactive with CD2, antibodies reactive with CD48, antibodies reactive with any ICAM (for example, ICAM-1 (ATCC CRL-2252), ICAM-2 and ICAM-3), antibodies reactive with CTLA4 (for example ATCC HB- 304) ”antibodies reactive with Thy-1, CD56-reactive antibodies, CD3-reactive antibodies, CD29-reactive antibodies, TCR-reactive antibodies, VLA-4-reactive antibodies, VCAM-1-reactive antibodies, LECAM-1-reactive antibodies, ELAM-1-reactive antibodies, reactive antibodies with CD44. In certain embodiments, monoclonal antibodies are preferred. In other embodiments, antibody fragments are preferred. As those skilled in the art will readily understand, the combination may include the soluble CTLA4 molecules of the invention and another agent.

ES 2 302 811 T3 immunosuppressant, CTLA4 molecules soluble with two other immunosuppressive agents, CTLA4 molecules soluble with three other immunosuppressive agents, etc. Determination of the optimal combination and dosages can be determined and optimized using procedures well known in the art.

Some specific combinations include the following: L104EA29YIg and CD80 monoclonal antibodies (mAbs); L104EA29YIg and CD86 mAbs; L104EA29YIg, CD80 mAbs, and CD86; L104EA29YIg and gp39 mAbs; L104EA29YIg and CD40 mAbs; L104EA29YIg and CD28 mAbs; L104EA29YIg, CD80 and CD86 mAbs, and gp39 mAbs; L104EA29YIg, CD80 and CD86 mAbs and CD40 mAbs; and L104EA29YIg, anti-LFA1 mAb, and anti-gp39 mAb. A specific example of a gp39 mAb is MR1. Other combinations will be readily appreciated and understood by those skilled in the art.

The soluble CTLA4 molecules of the invention, for example L104EA29YIg, can be administered alone or in conjunction with other drugs in immunomodulation regimens or other anti-inflammatory agents, for example, for the treatment or prevention of acute or chronic rejection of homologous or heterologous transplants or inflammatory or autoimmune disorder, or to induce tolerance. For example, it can be used in combination with a calcineurin inhibitor, for example cyclosporin A or FK506; an immunosuppressive macrolide, for example rapamycin or its derivative (for example 40-O- (2-hydroxy) ethyl-rapamycin); to a lymphocyte search agent, for example FTY720 or its analog; corticosteroids; cyclophosphamide; azathioprene; methotrexate; leflunomide or its analog; mizoribine; mycophenolic acid; Mycophenolate Mofetil; 15-deoxyspergualine or its analog; Immunosuppressive monoclonal antibodies, eg monoclonal antibodies to leukocyte receptors, eg MHC, CD2, CD3, CD4, CD 11a / CD18, CD7, CD25, CD 27, B7, CD40, CD45, CD58, CD 137, ICOS, CD150 (SLAM), OX40, 4-1BB or their ligands; or other immunomodulatory compounds, for example CTLA4 / CD28-Ig, or other adhesion molecule inhibitors, for example mAbs or low molecular weight inhibitors including LFA-1 antagonists, Selectin antagonists and VLA-4 antagonists. The compound is particularly useful in combination with a compound that interferes with CD40 and its ligand, for example antibodies to CD40 and antibodies to CD40-L.

When the soluble CTLA4 mutant molecules of the invention are administered in conjunction with other immunosuppressive / immunomodulatory or anti-inflammatory therapy, for example as specified hereinbefore, the dosages of the immunosuppressive, immunomodulatory or anti-inflammatory compound administered concomitantly will naturally vary. depending on the type of co-drug used, for example if it is a steroid or a cyclosporine, on the specific drug used, of the condition, of the condition being treated and so on.

In accordance with the foregoing the present invention provides in still a further aspect methods as defined above comprising the co-administration, for example simultaneously or in sequence, of a therapeutically effective amount of soluble CTLA4 molecules of the invention, for example example CTLA4Ig and / or L104EA29YIg, in the free form or in the pharmaceutically acceptable salt form, and a second drug substance, said second drug substance being an immunosuppressive, immunomodulatory or anti-inflammatory drug, for example as indicated above.

Furthermore, therapeutic combinations are provided, for example a kit, comprising a soluble CTLA4 molecule, in free form or in the form of a pharmaceutically acceptable salt, to be used simultaneously or in sequence with at least one pharmaceutical composition comprising a immunosuppressive, immunomodulatory, or anti-inflammatory drug, eg, NSAID, glucocorticoid, or corticosteroid. The kit may comprise instructions for administration. The kits of the invention can be used in any in any method of the present invention.

In another embodiment of the invention, tissue or organ transplant rejection is inhibited by administering soluble CTLA4 and T-cell depleted bone marrow cells to the subject to a subject. Administration of T-cell depleted bone marrow can occur at approximately the same time as the subject receives the tissue or organ transplant or at a different time. Administration of bone marrow at approximately the same time indicates that the bone marrow is administered to the subject as part of preparation for procedures to administer the tissue or organ transplant. The bone marrow is not required to be transplanted into the exact same class (that is, in minutes) as the organ transplant.

In preferred embodiments, the T-cell depleted bone marrow is administered prior to organ transplantation. Particular embodiments include administration of T-cell depleted bone marrow within one day, twelve hours, or six hours of solid organ transplantation. However, T-cell depleted bone marrow can be delivered early, while the resulting effects of T-cell depleted bone marrow are still achieved in conjunction with organ or tissue transplantation. In alternative embodiments, it may be desirable to administer T-cell depleted bone marrow after organ transplantation.

In one embodiment, the method comprises administering a dose of T cell depleted bone marrow cells (tolerance dose) to a subject, and subsequently administering an additional dose of T cell depleted bone marrow cells (dose of graft) to the subject. In certain embodiments, the immunosuppressive agent comprises at least one or more types of ligands that interfere with the binding of CD28 antigen to CD80 and / or CD86 antigen. As described above, the ligand is preferably a CTLA4 mutant molecule, such as L104EA29YIg.

ES 2 302 811 T3

Furthermore, the amount of T-cell depleted bone marrow can be determined by routine experimentation and empirically optimized. For example, the amount of T-cell depleted bone marrow can be titrated during routine experimentation to adjust enough to achieve the desired effects.

The methods of the invention can also be practiced by administering, in addition to the soluble CTLA4 mutant molecule, two or more doses of T-cell depleted bone marrow to the subject, alone, or in combination with one or more immunosuppressive agents.

As described, in the methods of the invention, administration of a soluble mutant CTLA4 or CTLA4 molecule can be carried out in many different ways including local or systemic routes of administration. For example, soluble CTLA4 mutant molecules can be administered intravenously, intramuscularly, or intraperitoneally. Alternatively, mutant CTLA4 can be administered orally or subcutaneously. Other methods of administration will be recognized by those of skill in the art. Similarly, T cell depleted bone marrow can be administered in many different ways as is known to those of skill in the art. An example is by intravenous infusion.

The immunosuppressive agent (s) may be administered (before or after administration of the soluble CTLA4 mutant and / or before or after organ / tissue transplantation. Preferably, the bone marrow and immunosuppressive agent are administered prior to administration of soluble CTLA4 mutant molecule. In one embodiment, a first dose of T-cell depleted bone marrow (tolerance dose) and the immunosuppressive agent is administered at approximately the same time as the organ transplant.

The following examples are presented to illustrate the present invention. The methodology and results may vary depending on the proposed goal of treatment and the procedures used. The examples are not intended to limit the scope of the invention in any way.

Examples

Example 1

This example provides a description of the procedures used to generate the nucleotide sequences encoding the soluble CTLA4 mutant molecules of the invention. A single site mutant L104EIg was generated and tested for binding kinetics to CD80 and / or CD86. The nucleotide sequence of L104EIg was used as a template to generate the mutant CTLA4 double-site sequence, L104EA29YIg, which was tested for CD80 and / or CD86 binding kinetics.

CTLA4Ig codon-based mutagenesis

A mutagenesis and selection strategy was developed to identify mutant CTLA4Ig molecules that had slower dissociation rates ("shedding" rates) from the CD86 binding molecules. Single site mutant nucleotide sequences were generated using CTLA4Ig (US Patent Numbers: 5,844,095; 5,851,795; and 5,885,796; ATCC Accession No. 68629) as a template. Mutagenic oligonucleotide PCR primers were designed for random mutagenesis of a specific cDNA codon allowing any base at positions 1 and 2 of the codon, but only guanine or thymine at position 3 (XXG / T; also known as NNG / T). Thus, a specific codon that codes for an amino acid must be randomly mutated to code for each of the 20 amino acids. In this regard, XXG / T mutagenesis produces 32 potential codons encoding each of the 20 amino acids. PCR products encoding mutations in close proximity to CTLA4Ig -M97-G107 (see Figure 1 or 2), were digested with SacI / XbaI and subcloned into the CTLA4Ig nLN expression vector cut in a similar manner. This procedure was used to generate the single site CTLA4 mutant molecule L104EIg.

For mutagenesis in proximity to CTLA4Ig S25-R33, a silent 5 'NheI restriction site was first introduced to this loop, by PCR primer directed mutagenesis. The PCR products were digested with NheI / XbaI and subcloned into similar CTLA4Ig or L104EIg similarly cut vectors. This procedure was used to generate the L104EA29YIg double-site CTLA4 mutant molecule (Figure 3). In particular, the nucleic acid molecule encoding the mutant single-site CTLA4 molecule, L104EIg, was used as a template to generate the mutant double-site CTLA4 molecule, L104EA29YIg.

Example 2

The following provides a description of the selection procedures used to identify CTLA4 single- or double-site mutant polypeptides, expressed from the instructions outlined in Example 1, that showed increased binding avidity for CD80 antigens. and CD86, compared to the non-mutated CTLA4Ig molecules.

Current in vitro and in vivo studies indicate that CTLA4Ig by itself is unable to completely block the priming of specific antigen-activated T cells. In vitro studies with CTLA4Ig and any monoclonal antibodies specific for CD80 or CD86 that measure inhibition of T cell proliferation indicate that the an

ES 2 302 811 T3 anti-CD80 monoclonal antibody did not increase inhibition of CTLA4Ig. However, the antiCD86 monoclonal antibody did not increase inhibition, indicating that CTLA4Ig was not effective in blocking CD86 interactions. These data support previous findings by Linsley et al. (Immunity. (1994), 1: 793-801) showing that inhibition of CD80-mediated cellular responses required approximately 100-fold lower concentrations of CTLA4Ig than for CD86-mediated responses. Based on these findings, it was assumed that soluble CTLA4 mutant molecules having a higher avidity for CD86 than wild-type CTLA4 should be able to better block the priming of antigen-specific activated cells than CTLA4Ig.

To this end, the soluble CTLA4 mutant molecules described in Example 1 above were selected using a novel selection procedure to identify various mutations in the extracellular domain of CTLA4 that enhance binding avidity for CD80 and CD86. This selection strategy provided an efficient procedure to directly identify mutants with slower 'off' rates without the need for protein purification or quantification as the determination of 'off' rate is independent of concentration (O ' Shannessy et al. (1993) Anal. Biochem. 212: 457-468).

COS cells were transfected with individual miniprep purified plasmid DNA and propagated for several days. A conditioned culture medium was applied three days to BIAcore biosensor processors (Biotech AB Pharmacy, Uppsala, Sweden) coated with soluble CD80Ig or CD86Ig. Mutant protein and specific binding and dissociation was measured by surface plasmon resonance (O'Shannessy, DJ, et al., (1993) Anal. Biochem. 212: 457-468). All experiments were carried out in BIAcore ™ or BIAcore ™ 2000 biosensors at 25 ° C. Ligands were immobilized on research grade NCM5 (Pharmacy) sensor processors using coupling to N-ethyl-N '- (dimethylaminopropyl). carbodiimidN-hydroxysuccinimide (Johnsson, B., et al. (1991) Anal. Biochem. 198: 268-277; Khilko, SN, et al. (1993) J. Biol. Chem 268: 5425-15434).

Selection procedure

COS cells grown in 24-well tissue plates were transiently transfected with DNA encoding mutant CTLA4Ig. Culture medium containing secreted soluble mutant CTLA4Ig was harvested 3 days later.

The COS cell culture medium was allowed to cease to flow over CD86Ig or CD80Ig derivatized BIAcore biosensor processors (as described in Greene et al., 1996 J. Biol. Chem. 271: 26762-26771), and mutant molecules they were identified with slower "off" rates than observed for wild-type CTLA4Ig. The cDNAs corresponding to selected media samples were sequenced and DNA was prepared to perform transient transfection of COS cells on a larger scale, from which the CTLA4Ig protein was prepared after the purification of protein A from the culture medium.

The conditions of the BIAcore analysis and equilibrium data analysis were performed as described in J. Greene et al. 1996 J. Biol. Chem. 271: 26762-26771, and as described herein.

BIAcore data analysis

Senosorgram initiation conditions were normalized to zero response units (RU) prior to analysis. Samples were tested on simulated derivatized flow cells to determine background response unit (RU) values ​​due to differences in apparent refractive index between solutions. The equilibrium dissociation constants (K_d) were calculated from graphical representations of R_eq against C, where R_eq is the steady state response minus the response on a simulated derivatized processor and C is the molar analyte concentration. The binding curves were analyzed using commercial non-linear curve fitting software (Prism, GraphPAD Software).

The experimental data were first fitted to a model to a model for the binding of a single ligand to a single receptor (1-site model, i.e. a simple langmuir system, A + B AB), and equilibrium association constants. (K_d= [A] - [B] \ [AB]) were calculated from the equation R = R_max-C / (K_d+ C). The data were then fit to the simpler two-site model of ligand binding (i.e., to a receptor that has two independent non-interacting binding sites as described by the equation R = R_max1 C \ (K_d1+ C) + R_max2 • C \ (K_d2+ C)).

The goodness of fits of these two models were analyzed visually by comparison with the experimental data and statistically by means of an F-test of the sums of squares. The simplest one-site model was chosen as the best fit, unless the two-site model was a significantly better fit (p &lt;0.1).

Association and dissociation analyzes were performed using the BIA 2.1 Evaluation Software (Pharmacy). The association rate constants k_on they were calculated in two ways, both assuming both homogeneous single-site interactions and two-site interactions in parallel. For single site interactions , the values ​​of k_on were calculated according to the equation R_t = R_eq(1-exp^{-ks (tt}₀), where R_t is a response at a given time, t; R_eqis the response in constant time; t₀ is the time at the beginning of the injection; and k_s = dR / dt = k_on^ Ck_off, and where C is an analyte concentration, calculated in terms of monomeric binding sites. For interactions of two

ES 2 302 811 T3 sites k values_on were calculated according to the equation R_t = R_eq1 (1-exp ^{-ks1 (tt}0) + Req2 (1-exp^{ks2 (tt)}0. For each model, the values ​​of k_on were determined from the calculated slope (up to approximately 70% maximum association) of graphical representations of ks against C.

The dissociation data were analyzed according to the models of one site (AB = A + B) or two sites (AiBj = Ai + Bj), and the rate constants (k_off) were calculated from the best fit curves. The binding site model was used except when the residues were greater than the bottom of the machine (2-10 RU, according to the machine), in which case the two binding site model was used. Mean receiver occupancy times were calculated using the relationship ti_/2 = 0.693 / k_off.

Flow cytometry murine mAb L307.4 (anti-CD80) purchased from Becton Dickinson (San Jose, California) and IT2.2 (anti-B7-0 [also known as CD86]), from Farmingen (San Diego, California) . For immunological staining, CD80-positive and / or CD86-positive CHO cells were removed from culture vessels by incubation in phosphate buffered saline (PBS) containing 10 mM EDTA. CHO cells (1-10 x 10⁵) with mAbs or immunoglobulin fusion proteins in DMEM containing 10% fetal calf serum (FBS), then washed and incubated with goat anti-mouse or anti-human immunoglobulin second-step reagents conjugated to isothiocyanoate. fluorescein (Tago, Burlingame, California). Cells were given a final wash and analyzed on a FACScan (Becton Dickinson).

SDS-PAGE and Size Exclusion Chromatography

SDS-PAGE was performed on 4-20% acrylamide Tris / glycine gels (Novex, San Diego, CA). The analytical gels were stained with Coomassie blue, and the images of the wet gels obtained by differential scanning were obtained. CTLA4Ig (25 pg) and L104EA29YIg (25 pg) were analyzed by size exclusion chromatography using a TSK-GEL G300 SWxl column (7.8 x 300 mm, Tosohaas, Montgomeryville, PA) balanced in phosphate buffered saline containing 0.02% of NAN₃ at a flow rate of 1.0 ml / min.

^CTLA4XC120S ^{and L104}EA^29YXC12OS

CTLA4X_c120S Single chain was prepared as previously described (Linsley et al., (1995) J. Biol. Chem., 270: 15417-15424). In summary, an oncostatin M expression plasmid CTLA4 (OMCTLA4) was used as a template, the forward primer,

GAGGTGATAAAGCTTCACCAATGGGTGTACTGCTCACACAG (SEQ ID NO .: 17) was chosen to match the sequences in the vector; and the reverse primer,

GTGGTGTATTGGTCTAGATCAATCAGAATCTGGGCACGGTTC (SEQ ID NO .: 18) corresponded to the last seven amino acids (ie, amino acids 118-124) in the extracellular domain of CTLA4, and contained a restriction enzyme site, and a stop codon (TGA). The reverse primer specified a C120S mutation (cysteine ​​to serine at position 120). In particular, the GCA nucleotide sequence (nucleotides 34-36) of the reverse primer shown above is replaced with one of the following nucleotide sequences: AGA, GGA, TGA, CGA, ACT, or GCT. As those in the art will understand, the GCA nucleotide sequence is an inverse complementary sequence to the TGC codon for cysteine. Similarly, the nucleotide sequences AGA, GGA, TGA, CGA, ACT, or GCT are reverse complementary sequences of the codons for serine. The polymerase chain reaction products were digested with HindIII / XbaI and directionally subcloned into the nLN expression vector (Bristol-Myers Squibb Company, Princeton, NJ). L104EA29YX_c120S was prepared in an identical manner. Each construct was verified by DNA sequencing.

Identification and biochemical characterization of high avidity mutants

Twenty-four amino acids were chosen for mutagenesis and the resulting ~ 2300 mutant proteins were assayed for binding to CD86Ig by surface plasmon resonance (SPR; as described above). The predominant effects of mutagenesis at each site are summarized in Table II. Random mutagenesis of some amino acids in S25-R33 did not appear to alter ligand binding. Mutagenesis of E31 and R33 and residues M97-Y102 apparently resulted in reduced ligand binding. Mutagenesis of residues, S25, A29, and T30, K93, L96, Y103, L104, and G105, resulted in slow "on" and / or slow "off" rates. These results confirm previous findings of residues in the S25-R33 region, and residues at or near M97-Y102 influence ligand binding (Peach et al., (1994) J. Exp. Med., 180: 2049 2058.

Mutagenesis of the S25, T30, K93, L96, Y103, and G105 sites resulted in the identification of some mutant proteins that had slower CD86Ig "shedding" rates. However, in these cases, the slow "off" rate was resolved by a slow "off" rate that resulted in mutant proteins with an overall avidity for CD86Ig that was apparently similar to that seen with wild-type CTLA4Ig. Furthermore, mutagenesis of K93 resulted in the significant aggregation that has been responsible for the observed kinetic changes.

ES 2 302 811 T3

Random mutagenesis of L104 followed by COS cell transfection and SPR selection of culture medium samples on immobilized CD86Ig yielded six medium samples containing mutant proteins with approximately 2x slower "shedding" rates than CTLA4Ig. wild type. When the corresponding cDNA of these mutants was sequenced, each of them was found to encode a mutation from leucine to glutamic acid (L104E). Apparently, the substitution of leucine 104 to aspartic acid (L104D) did not affect the binding of CD86Ig.

Mutagenesis was then repeated at each site listed in Table II, this time using L104E as the PCR template instead of wild-type CTLA4Ig, as described above. SPR analysis, again using immobilized CD86Ig, identified six alanine 29 mutagenesis culture medium samples with proteins that had approximately 4 times slower "shedding" rates than wild-type CTLA4Ig. The two slowest were tyrosine substitutions (L104EA29Y), two were leucine (L104EA29L), one was tryptophan (L104EA29W), and one was threonine (L104EA29T). Apparently, no slow rate "shedding" mutants were identified when alanine 29 was randomly mutated, alone, in wild type CTLA4Ig.

The relative molecular weight and state of aggregation of purified L104E and L104EA29YIg was determined by SDS-PAGE and size exclusion chromatography. L104EA29YIg (~ 1 pg; lane 3) and L104EIg (~ 1 pg; lane 2) apparently had the same electrophoretic mobility as CTLA4Ig (~ 1 pg; lane 1) under reducing conditions (~ 50 kDa; + / IME; plus 2- mercaptoethanol) and non-reducing (~ 100 kDa; --SME) (Fig. 14A). Size exclusion chromatography showed that L104EA29YIg (Fig. 14C) apparently had the same mobility as dimeric CTLA4Ig (Fig. 14B). Major maxima represent protein dimer while the fastest eluting secondary maxima in Fig. 14B represents larger molecular weight aggregates. Approximately 5.0% CTLA4Ig was present as larger molecular weight aggregates but there was no evidence of aggregation of L104EA29YIg or L104EIg. Therefore, the stronger binding to CD86Ig observed with L104EIg and L104EA29YIg could not be attributed to mutagenesis-induced aggregation.

Equilibrium and Kinetic Union Analysis

Kinetic binding and equilibrium analysis was performed on CTLA4Ig, L104EIg, and L104EA29YIg purified from protein A using surface plasmon resonance (SPR). The results are shown in Table I. The observed equilibrium dissociation constants (K_d; Table I) were calculated from binding curves generated in a concentration range (5.0-200 nM). L104EA29YIg binds more strongly to CD86Ig than does L104EIg or CTLA4Ig. The value of K_d lower than L104EA29YIg (3.21 nM) than L104EIg (6.06 nM) or CTLA4Ig (13.9 nM) indicates the higher binding avidity of L104EA29YIg to CD86Ig. The smallest value of K_d of L104EA29YIg (3.66 nM) than L104EIg (4.47 nM) or CTLA4Ig (6.51 nM) indicates the higher binding avidity of L104EA29YIg to CD80Ig.

Kinetic binding analysis revealed that the comparative "turn-on" rates for CTLA4Ig, L104EIg, and L104EA29YIg binding to CD80 were similar, as were the "turn-on" rates for CD86Ig (Table I). However, the "off" rates for these molecules were not equivalent (Table I). Compared to CTLA4Ig, L104EA29YIg had approximately 2 times lower "off" speed of CD80Ig, and approximately 4 times lower "off" speed of CD86Ig. L104E had intermediate "dropout" rates between L104EA29YIg and CTLA4Ig. Since the introduction of these did not significantly affect "on" speeds, the increase in avidity for CD80Ig and CD86Ig observed with L104EA29YIg was probably due to a decrease in "off" speeds.

To determine whether the increase in avidity of L104EA29YIg for CD86Ig and CD80Ig was due to mutations that affect the way in which each monomer associates as a dimer, or if they were avid due to the enhancement of the structural changes introduced in each monomer, prepared single-chain constructs of CTLA4 and extracellular domains of L104EA29Y after mutagenesis from cysteine ​​120 to serine as described above, and by Linsley et al., (1995) J. Biol. Chem., 270: 15417-15424. The purified CTLA4X proteins_c120Sand L104EA29YX_c120S were shown to be monomeric by gel permeation chromatography (Linsley et al., (1995), above), before their ligand binding properties were analyzed by SPR The results showed that the binding affinity of both monomeric proteins for CD86Ig was approximately 35-80 times less than that observed for their respective dimers (Table I). This supports previously published data establishing that CTLA4 dimerization was required for high avidity ligand binding (Greene et al., (1996) J. Biol. Chem., 271: 26762-26771).

h104EA29YX_C12Os bound with approximately 2-fold higher affinity than CTLA4X_c120S to both CD80Ig and CD86Ig. The increase in affinity was due to the fact that the dissociation rate of both ligands was approximately 3 times lower. Therefore, the stronger ligand binding by L104EA29Y was most likely due to the avidity-enhancing structural changes that have been introduced into each monomer chain rather than the alterations in which the molecule is dimerized.

Location and structural analysis of mutations that enhance avidity

The structure of the solution of the extracellular IgV-like domain of CTLA4 has recently been determined by NMR spectroscopy (Metzler et al., (1997) Nature Struct. Biol., 4: 527-531. This allowed the precise localization of leucine 104 and Alanine 29 in the three-dimensional folds (Fig. 15A-B). Leucine 104 is located near the

ES 2 302 811 T3 highly conserved MYPPPY amino acid sequence. Alanine 29 is located near the C-terminus of the S25-R33 region, which is spatially adjacent to the MYPPPY region. While there is a significant interaction between the residues and the base of these two regions, there is apparently no direct interaction between L104 and A29 although they both comprise part of a continuous hydrophobic core in the protein. The structural consequences of the avidity-enhancing mutants were determined by modeling. The A29Y mutation can easily fit into the gap between the S25-R33 region and the MYPPPY region, and can serve to stabilize the conformation of the MYPPPY region. In wild-type CTLA4, L104 forms extensive hydrophobic interactions with L96 and V94 near the 1VIYPPPY region. It seems highly unlikely that the glutamic acid mutation will adopt a similar conformation to that of L104 for two reasons. First, there is insufficient space to accommodate the longest glutamic acid side chain in the structure without significant disturbance to the S25-R33 region. Second, the energy cost of hiding the negative charge of the glutamic acid side chain in the hydrophobic region would be large. Instead, modeling studies predict that the glutamic acid side chain moves to the surface where its charge can be stabilized by solvation. Such a conformational change can be easily accommodated by G105, with minimal distortion of other residues in the regions.

Binding of High Avidity Mutants to CHO Cells Expressing CD80 or CD86

FACS analysis (Fig. 9) of CTLA4Ig and mutant molecules that bind to stably transfected CD80 + and CD86 + CHO cells was performed as described herein. CD80-positive and CD86-positive CHO cells were incubated with increasing concentrations of CTLA4Ig, L104EA29YIg, or L104EIg, and then washed. Bound immunoglobulin fusion protein was detected using goat anti-human immunoglobulin conjugated to fluorescein isothiocyanoate.

As shown in Figure 9, CD80-positive and CD86-positive CHO cells (1.5 x 10⁵) were incubated with the indicated concentrations of CTLA4Ig (black squares), L104EA29YIg (circles), or L104EIg (triangles) for 2 hours at 23 ° C, washed and incubated with goat anti-human immunoglobulin antibody conjugated to goat isothiocynoate. fluorescein. Binding was analyzed on a total of 5,000 viable cells (single determination) on a FACScan, and mean fluorescence intensity (MFI) was determined from histogram data using PC-LYSYS. Data were corrected from background fluorescence measured on cells incubated with second stage reagent only (MFT = 7). Control mAb L6 (80 pg / ml) gave MFI &lt;30. These results are representative of four independent experiments.

The binding of L104EA29YIg, L104EIg, and CTLA4Ig to CD80-transfected CHO cells is roughly equivalent (Fig. 9A). L104EA29YIg and L104EIg bind more strongly to CHO cells stably transfected with human CD86 than does CTLA4Ig (Fig. 9B).

Functional tests

CD4-positive T cells were isolated by immunomagnetic negative selection (Linsley et. Al., (1992) J. Exp. Med. 176: 1595-1604). Isolated CD4-positive T cells were stimulated with forbal myristate acetate (PMA) plus CD80-positive or CD86-positive CHO cells in the presence of adjusted concentrations of inhibitor. CD4-positive T cells (8-10 x 10⁴/ well) were cultured in the presence of 1 nM PMA with or without CHO cell stimulators. Proliferative responses were measured by the addition of 1 pCi / well of [3H] thymidine during the final 7 hours of a 72 hour culture. Inhibition of PMA plus CD80-positive CHO, or CD86-positive CHO, T cells stimulated by L104EA29YIg and CTLA4Ig was performed. The results are shown in Fig. 10. L104EA29YIg inhibits the proliferation of CD80-positive PMA-treated CHO cells more than CTLA4Ig (Fig. 10A). L104EA29YIg is also more effective than CTLA4Ig in inhibiting the proliferation of CHO cells treated with CD86-positive PMA (Fig. 10B). Therefore, L104EA29YIg is a more potent inhibitor of both CD80- and CD86- mediated T-cell costimulation.

Figure 11 shows the inhibition by L104EA29YIg and CTLA4Ig of human T cells allostimulated with a human B lymphoblast cell line (LCL) called PM that expressed CD80 and CD86 (T cells at 3.0 x 10⁴/ well and MW at 8.0 x 10³/ well). Primary allostimulation occurred for 6 days, then the cells were pulsed with³H-thymidine for 7 hours, before the incorporation of radioactive label was determined.

Secondary allostimulation was performed as follows. Seven day old primary allostimulated T cells were harvested on Lymphocyte Separation Medium (LSM) (ICN, Aurora, OH) and allowed to stand for 24 hours. The T cells were then re-stimulated (secondary), in the presence of adjusted amounts of CTLA4Ig or L104EA29YIg, by adding PM in the same ratio as before. Stimulation occurred for 3 days, then cells were radioactively tagged and harvested as before. The effect of L104EA29YIg on primary allostimulated T cells is shown in Fig. 11A. The effect of L104EA29YIg on secondary allostimulated T cells is shown in Fig. 11B. L104EA29YIg inhibits both primary and secondary T cell proliferative responses better than CTLA4Ig.

To measure cytokine production (Figure 12), secondary allostimulation plates were set up in duplicate. After 3 days, culture media were tested using ELISA kits (Biosource, Camarillo, CA) using

ES 2 302 811 T3 the conditions recommended by the manufacturer. L104EA29YIg was found to be more potent than CTLA4Ig in blocking T cell production of IL-2, IL-4, and γ-IFN cytokines after secondary allogeneic challenge (Figs. 12A-C).

The effects of L104EA29YIg and CTLA4Ig on the response of monkey mixed lymphocytes (MLR) are shown in Figure 13. Peripheral blood mononuclear cells (PBMC'S; 3.5 x 10⁴ cells / well from each monkey) from 2 monkeys were purified on lymphocyte separation medium (LSM) and mixed with 2 jug / ml of phytohemagglutinin (FA). Cells were stimulated 3 days later radioactively tagged 16 hours prior to harvest. L104EA29YIg inhibited T cell proliferation better than CTLA4Ig.

TABLE I

<td colspan="5">The equilibrium constants and apparent kinetics are provided in the following Table (values ​​are means ± standard deviation of three different experiments):</td>

<td>Protein</td><td>Analyte</td><td>kon (X 10^&amp;)</td><td>k_off(x 10 '⁴)</td><td>K_d</td>

<td>immobilized</td><td></td><td>M ~ 'S¹</td><td>s-¹</td><td>nM</td>

<td>CD80lg</td><td>CTLA4lg</td><td> 3,44 ± 0,29</td><td> 2,21 ±0,18</td><td> 6,51 ± 1,08</td>

<td>CD80lg</td><td>L104Elg</td><td> 3,02 ± 0,05</td><td> 1,35 ±0,08</td><td> 4,47 ± 0,36</td>

<td>CD80lg</td><td>L104EA29Ylg</td><td> 2,96 ±0,20</td><td> 1,08 ±0,05</td><td> 3,66 ± 0,41</td>

<td>CD80lg</td><td>CTLA4Xci2os</td><td> 12,0 ± 1,0</td><td> 230 ± 10</td><td> 195 ±25</td>

<td>CD80lg</td><td>L1O4EA29YXci2os</td><td> 8,3 ± 0,26</td><td> 71 ±5</td><td> 85,0 ±2,5</td>

<td></td><td></td><td></td><td></td><td></td>

<td>CD86lg</td><td>CTLA4lg</td><td> 5,95 ±0,57</td><td> 8,16 ±0,52</td><td> 13,9 ±2,27</td>

<td>CD861g</td><td>L104Elg</td><td> 7,03 ± 0,22</td><td> 4,26 ±0,11</td><td> 6,06 ± 0,05</td>

<td>CD86lg</td><td>L104EA29Ylg</td><td> 6,42 ± 0,40</td><td> 2,06 ± 0,03</td><td> 3,21 ±0,23</td>

<td>CD86lg</td><td>CTLA4Xci2os</td><td> 16,5 ± 0,5</td><td> 840 ± 55</td><td> 511 ± 17</td>

<td>CD86lg</td><td>L1O4EA29YX_Ci2os</td><td> 11,4 ± 1,6</td><td> 300 ± 10</td><td> 267 ± 29</td>

ES 2 302 811 T3

TABLE II

<td colspan="4">The effect on CD86lg binding by CTLA4lg mutagenesis at the listed sites was determined by SPR, described above. The predominant effect is indicated by a + sign.</td>

<td>Site of Mutagenesis</td><td colspan="3">Mutagenesis Effects</td>

<td></td><td>No apparent effect</td><td>Slow "on" speed / slow off "speed</td><td>Reduced ligand binding</td>

<td>S25</td><td></td><td> +</td><td></td>

<td>Q26</td><td> +</td><td></td><td></td>

<td>G27</td><td> +</td><td></td><td></td>

<td>K28</td><td> +</td><td></td><td></td>

<td>A29</td><td></td><td> +</td><td></td>

<td>T30</td><td></td><td> +</td><td></td>

<td>E31</td><td></td><td></td><td> +</td>

<td>R33</td><td></td><td></td><td> +</td>

<td>K93</td><td></td><td> +</td><td></td>

<td>L96</td><td></td><td> +</td><td></td>

<td>M97</td><td></td><td></td><td> +</td>

<td>Y98</td><td></td><td></td><td> +</td>

<td>P99</td><td></td><td></td><td> +</td>

<td>P100</td><td></td><td></td><td> +</td>

<td>P101</td><td></td><td></td><td> +</td>

<td>Y102</td><td></td><td></td><td> +</td>

<td>Y103</td><td></td><td> +</td><td></td>

<td>L104</td><td></td><td> +</td><td></td>

<td>G105</td><td></td><td> +</td><td></td>

<td> 1106</td><td> +</td><td></td><td></td>

<td>G107</td><td> +</td><td></td><td></td>

<td>Q111</td><td> +</td><td></td><td></td>

ES 2 302 811 T3

<td colspan="4">The effect on CD86lg binding by CTLA4lg mutagenesis at the listed sites was determined by SPR, described above. The effect</td>

<td></td><td colspan="3">predominant is indicated by a + sign.</td>

<td>Site of Mutagenesis</td><td colspan="3">Mutagenesis Effects</td>

<td></td><td>No apparent effect</td><td>Slow "on" speed / slow off "speed</td><td>Reduced ligand binding</td>

<td>Y113</td><td> +</td><td></td><td></td>

<td> 1115</td><td> +</td><td></td><td></td>

Example 3

This example provides a description of donor pancreatectomy and islet isolation, and islet transplantation procedures in an animal model.

Materials and Procedure

Animals. Captive-bred adolescent male rhesus monkeys (Macaca mulatta) (~ 4-20 kg) were used as recipients and donors. The absence of donor-specific preformed antibodies in the recipient was confirmed before transplantation. All potential donors and recipients were tested for anti-CMV antibodies and only animals that were seropositive for CMV were used as recipients.

Pancreatectomy and isolation of donor islets. Donor pancreatectomy was performed one day before transplantation. The procedure was performed under general anesthesia (a combination of parenteral ketamine and isoflurane by inhalation) through a midline abdominal incision. The splenorenal and splenocolic ligaments were divided in such a way that the spleen was mobilized, together with the tail of the pancreas. The head of the pancreas and second part of the duodenum were mobilized after the Kocher maneuver. After the administration of heparin (200 U / kg), the aorta was cannulated just before its bifurcation and the animal was exsanguinated. The cold paste was immediately placed in the lower sac and behind the body of the pancreas. The body and neck of the pancreas were carefully excised by acute dissection taking care not to violate the pancreatic capsule. The common bile duct, the main and accessory pancreatic ducts were identified and ligated, the head of the pancreas was dissected from the second part of the duodenum.

Isolation of islets from rhesus monkeys was completed by secondary modifications of the automated procedure for human islet isolation (Ricordi, (1988) Diabetes, 37: 413; Ranuncoli, (2000) Cell Transplant 9: 409) using Liberase (Roche / Boehringer Mannheim, Indpls, IN) at a concentration of 0.47 - 0.71 mg / ml. Three-phase, discontinuous Euroficoll gradient (densities 1.108, 1.097, 1.037; Meditech, Hemdon, VA) and a Cobe 2991 blood cell processor were used. (Gambro, Lakewood, CO) were used for purification of islets from pancreatic digestion. The final islet preparation samples were stained with dithizone (Sigma, St. Louis, MO), and the preparation was assessed by counting the number of the number of islets in each of the following size ranges: 50 - 100, 100 - 150, 150 - 200, 200 - 250, 250 - 300, 300 - 350, and 350 - 400 pm. The data were mathematically converted to determine the number of islets with a mean diameter of 150pm and expressed as islet equivalents (IEQ) (Ricordi C. et al., Acta Diabetol Lat 27: 185-195, 1990).

Pancreatectomy and transplantation of the recipient's intrahepatic islet cells. Total pancreatectomy, without duodenoctomy or splenoctomy, was performed at least one week before transplantation. The tail and body of the pancreas were dissected together with the splenic artery and vein, which was carefully preserved by ligation and division of the pancreatic branches only. The inferior mesenteric and middle colic veins were identified and preserved during dissection of the body of the pancreas. The portal and superior mesenteric veins were recognized and the pancreatic veins were ligated and divided.

The duodenum was mobilized and the branches of the pancreaticoduodenal vessels entering the pancreas were ligated and divided, leaving the duodenal branches intact. The common bile duct was identified and preserved during blunt dissection between the head of the pancreas and the c-loop of the duodenum. The main and accessory pancreatic ducts were ligated, divided, and the pancreas was removed from the abdominal cavity. All animals were subjected to

ES 2 302 811 T3 intravenous glucose tolerance to evaluate the efficacy of the pancreatectomy procedure. All were documented to be c-peptide negative prior to islet transplantation.

The cultured islets were washed overnight in transplantation medium, which consisted of RPMI 1640 medium (Mediatech) supplemented with 2.5% bovine serum albumin, and counted to determine the number of IEQ. The islets were then sedimented and resuspended in 20 ml of transplantation medium supplemented with 200 units of heparin. Intrahepatic islet transplantation was performed by gravity drainage of the islets into a sigmoid or branch of the left colic vein that drains into the portal vein through a 22-gauge intravenous catheter.

Control of blood glucose, insulin administration, and definition of rejection. Fasting and post-prandial blood glucose levels were monitored twice daily (before breakfast and after lunch) by an ear sting, followed by blood testing with an elite glucometer (Bayer, Elkhart, IN ). Insulin (NPH, Ultralente; Eli Lilly, Indinapolis, IN) was administered three times daily with the intention of maintaining fasting blood glucose &lt;300 mg / dl in pancreatectomized animals prior to transplantation or in those that had rejected their transplants homologues.

Experimental groups and immunosuppressive protocols. Two treatment protocols were tested: (1) Edmonton protocol - using Tacrolimus, Sirolimus, and anti-IL-2R mAb (Shapiro, AMJ et al, (2000), N. Eng. J. Med., 343: 230 - 238) and (2) L104EA29Y-Edmonton protocol - using L104EA29YIg, Sirolimus, and anti-IL-2R mAb. The control group included recipients treated with a "background immunosuppressive regimen" having rapamycin and anti-IL2R alone. Tacrolimus was given at 0.05 mg / kg twice daily POD 0-14 (target levels 5-8) and 0.06 mg / kg daily (target levels 3-5) POD 15-120. L104EA29YIg was administered pro intravenously at operation (10 mg / kg) and postoperatively on days 4 (15 mg / kg), 14, 28, 42, 56, 70, 84, 98, 112, 126 (20 mg / kg) for keep serum levels greater than 30 jug / ml. The chimeric anti-human IL-2R mAb (0.3 mg / kg iv), was administered within the operation and 4 PODs. Sirolimus (Rapamune®) was administered orally 1.25 mg / kg twice daily (target levels 10-15) POD 0 - 50, 1 mg / kg twice daily (target levels 7-10) POD 50 - 100, and then reduced to finish dosing by POD130. Sirolimus (Rapamune®) and Tacrolimus (Prograf®) were purchased from the Emory University Hospital Pharmacy. The chimeric anti-human IL-2R mAb (Simulect^®) was provided by Novartis Farma AG (Basel, Switzerland).

Necropsy. All recipients had a full necropsy performed by Yerkes veterinary staff at the time of death.

Antidonor Antibody Detection. The presence of detectable donor specific alloantibody was determined using flow cytometry. Peripheral blood leukocytes served as the target cells for analysis before transplantation. Isolated lymph node leukocytes obtained at the time of transplantation were the target cells for post-transplantation tests.

Statistics. Survival of islet grafts among islet grafts between experimental groups is compared using the Mann-Whitaey-Wilcoxon assay (Armitage et al. (1987) Statistical methods in Medical Research, Blackwell Scientific Publication, Oxford).

Anti-donor enzyme-linked immunoblot assay. Responses were measured by enzyme-linked immunoblot assay (ELISpot) of interferon-γ (IFN-γ) using peripheral blood leukocytes obtained from recipient and donor animals. An equal number of stimulators (donor leukocytes) and responders (recipient leukocytes) were added to cellulose ester bottom plates (Millipore, Bedford, MA) coated with the capture antibody, mouse anti-human IFN-γ (clone GZ- 4; Mabtech, Sweden). After 14-16 h of incubation, biotinylated mouse anti-human IFN-γ (clone 7-B6-1; Mabtech, Sweden) was added, unbound antibody was removed, and horseradish peroxidase-Avidin D was added. (Vector, Burlingame, CA). The spots were developed with 3-amino9-ethylcarbazole (Sigma). Each spot represents a cell that secretes IFN-γ; the frequency of these cells can be determined by dividing the number of spots generated by the total number of responder cells seeded.

Results

Therapy based on blocking the CD28 pathway prolongs the survival of homologous transplants in Rhesus macaques. Diabetes was induced by surgical pancreatectomy of recipient animals and confirmed by intravenous glucose tolerance test prior to transplantation. Donor-recipient pairs were defined based on molecular typing using a panel of previously defined major histocompatibility alleles (8 classes I and 12 classes II) (Lobashevsky A, et al., Tissue Antigens 54: 254-263, (1999) ; Knapp LA, et al., Tissue Antigens 50: 657-661, (1997); Watkins DL, Crit Rev Immunol 15: 1-29, (1995)). Couples maximized disparity at both class I and II loci. Rejection was defined as two consecutive fasting blood glucose values&gt; 125 mg / dl on subsequent days. Intraportal infusion of homologous transplant islets (&gt; 10,000 IEQ / Kg) resulted in initial restoration of euglycemia and insulin independence in diabetic monkeys in both groups.

Treatment of pancreatectomized macaques with the L104EA29YIg / Rapamycin / anti-1L-2R mAb regimen significantly prolonged the survival of homologous islet transplants (204, 190, 216,&gt; 220 and 56 days,

ES 2 302 811 T3 respectively). Animals receiving the L104EA29YIg / Rapamycin / anti-IL-2R regimen resulted in adequate glucose control as indicated by blood glucose levels (Figures 5 and 16B). Furthermore, these animals did not require insulin replacement therapy for a significantly prolonged period of time (Figure 6). In contrast, animals receiving the background regimen alone (Rapamycin / anti-IL-2R mAb) rejected the transplanted islets within one week (Figure 16C). Control animals showed significantly elevated fasting plasma glucose levels (Figures 5). In addition, control animals required insulin replacement therapy within one islet transplant week (Figure 6). Four of the five animals that received the L104EA29YIg regimen had rejection-free survival during the treatment period (Table III). The intravenous glucose tolerance test with measurement of blood glucose and insulin levels confirmed islet function after transplantation (representative animal, Figures 7 and 16D).

TABLE III

Survival of homologous islet transplantation and treatment

<td rowspan="2"></td><td rowspan="2">lEQ ​​/ kg</td><td rowspan="2">Survival*</td><td rowspan="2">Treatment</td><td colspan="2">MHC No Matches (/?)</td>

<td>Class I</td><td>Class II</td>

<td>RKf-7</td><td> 22.250</td><td> 204</td><td>LEA29Y / Rapa / alL-2R</td><td> 2</td><td>ND</td>

<td>RUf-7</td><td> 17.087</td><td> 190</td><td>LEA29Y / Rapa / alL-2R</td><td>ND</td><td> 3</td>

<td>RRe-7</td><td> 20.266</td><td> 216</td><td>LEA29Y / Rapa / alL-2R</td><td> 2</td><td> 6</td>

<td>RWt-6</td><td> 16.033</td><td> 56</td><td>LEA29Y / Rapa / alL-2R</td><td> 2</td><td> 3</td>

<td>RMv-6</td><td> 8.201</td><td> &gt;220</td><td>LEA29Y / Rapa / ctlL-2R</td><td> 1</td><td> 3</td>

<td>RQz-6</td><td> 12.980</td><td> 7</td><td>Rapa / alL-2R</td><td> 2</td><td> 5</td>

<td>Rlb-7</td><td> 10.903</td><td> 7</td><td>Rapa / alL-2R</td><td> 1</td><td> 4</td>

Insulin Independence. ND, not detected in the alleles that were typed

At 100 days after transplantation, the rapamycin dosage was decreased and dropped to zero on day 121. Animals continued to maintain insulin dependence while receiving L104EA29YIg monotherapy. At ~ 150 days after transplantation, the remaining islet recipients received their final dose of L104EA29YIg, ceasing any immunosuppressant therapy.

As expected, ~ 1-2 months after discontinuation of therapy, the receptors became hyperglycemic and required exogenous insulin therapy. Histological analysis revealed a mononuclear infiltrate, strongly suggesting rejection as the etiology of loss of glucose control (Figure 17). In an intravenous glucose tolerance test, test animals receiving L104EA29YIg / Rapamycin / anti-IL-2R mAb regimen demonstrated normal glucose levels after islet transplantation (Figures 7 and 16D).

The frequency of IFN- and anti-donor producing cells was detected by ELISpot assay and analyzed using an immunoblot imaging system. Animals receiving the baseline immunosuppressive regimen demonstrated significantly increased numbers of donor-reactive IFNy-producing T cells (84t4.6 cells), while animals receiving the L104EA29YIg regimen had no detectable response (2 ± 0.56 cells ).

L104EA29YIg therapy inhibits the priming of anti-donor Ty B cell responses. The frequency of primed allo-reactive T cells can be efficiently detected using the ELISpot assay, which can discriminate IFN-y production at the single cell level. Peripheral blood samples from islet recipients were analyzed at various times both before and after transplantation for their ability to generate IFNy in response to donor antigen. Animals treated with the base regimen alone rapidly developed a measurable anti-donor response that coincided with rejection 1 week after transplantation. In contrast, the frequency of IFN- and anti-donor producing cells in animals receiving the regimen containing L104EA29YIg was undetectable until therapy was withdrawn (representative animals, Figure 18A and B). Thus, the L104EA29YIg regimen effectively blocked the generation of anti-donor T cell responses as measured by the ability to produce IFN-y.

ES 2 302 811 T3

Flow cytometry was used to examine the development of anti-donor antibody responses. one animal within the control group had a strong anti-donor Ab response, while the other did not develop a detectable response, presumably because they were euthanized before the antibody response could be measured to develop a detectable response (Figure 18C). In contrast, four of the five animals did not elicit an antibody response while receiving L104EA29YIg therapy. This is consistent with previously reported results using CTLA4-Ig in an islet transplant model (Levisetti, MG et al., J Immunol 159: 5187-5191, 1997) as well as our experience in a homologous kidney transplant model. where the recipients did not generate anti-donor antibodies (Pearsow T, ET AL., (Abstract). In the Programs and Summaries of the 17^to Annual Conference of the American Society of Transplant Physicians, Chicago, May 10-14, 1997. Chicago, American Society of Transplant Physicians). One animal of five recipients experienced a rejection episode while receiving L104EA29YIg therapy and subsequently developed an anti-donor antibody response. As expected, the remaining four animals receiving the L104EA29YIg regimen consistently developed anti-donor antibody responses at approximately the time of rejection (~ 200 days after transplantation, 50 days after the final L104EA29YIg dose).

Islet transplantation is quickly becoming a viable treatment option for patients with frail type 1 diabetes. Recent reviews describing nonsteroidal immunosuppressive regimens, which result in successful insulin independence after islet transplantation, have introduced renewed optimism for the practical application of islet transplantation. While removal of glucocorticoids from immunosuppressive regimens represents a major step forward in the effort to treat type 1 diabetes, reliance on calcineurin inhibitor therapy for primary immunosuppression may limit the application of this approach. Calcineurin inhibitors have numerous unwanted side effects, including nephrotoxicity, diabetes, hypertension, altered lipid metabolism, and hyrusitism (Kahan BD et al., N Engl J Med 321: 1725 1738, 1989; Group TUSMFLS: A comparison of tacrolimus (FK 506) and cyclosporine for immunosuppression in liver transplantation: the US Multicenter FK506 Liver Study Group. N Engl J Med 331: 1110-1115,1994; deMattos AM et al., Am J Kidney Disease 35: 333-346, 2000) . Even when drug levels are kept low, significant side effects can develop. This is particularly true in the diabetic patient population when kidney function may already be impaired. In fact, in the most recent reviews from Edmonton, two patients with slightly elevated pre-transplant creatinine levels had significant decreases in kidney function even though calcineurin inhibitor therapy was ultimately required to withdraw this drug (RyanE.A ., et al., Diabetes 50: 710-719, 2001). In the same review, two-thirds of recipients developed some degree of glucose intolerance, developing a fourth frank diabetes after transplantation that was thought to be related to tacrolimus use. This underscores the attractive and essential nature of an immunosuppressive regimen without a calcineurin inhibitor, particularly for islet transplantation.

Blocking T-cell costimulatory pathways is a promising strategy for the development of immunosuppressive and potentially tolerogenic regimens. This approach targets T cells that receive "signal 1" during the period of drug delivery. For example, treatment during the period after transplantation is believed to render allo-specific T cells impotent upon encountering the new organ or tissue, while other cells remain unchanged (Li Y, et al., Nat Med 5: 1298 - 1302, 1999). Blocking the CD28B7 pathway has shown notable promise in experimental autoimmunity and transplantation models, making it a particularly attractive immunosuppressive target in islet transplantation, where presumably both auto- and allo-immune obstacles exist. The potential for CD28 blocking in an animal islet transplantation model was described by Levisetti MG, et al., (J Immunol 159: 5187-5191, 1997). Treatment with CTLA4-Ig was found to significantly, although modestly, prolong the survival of homologous islet transplantation in non-human primates (Levisetti MG, et al., J Immunol 159: 5187-5191, 1997). CTLA4-Ig monotherapy poorly prolonged renal homologous transplant survival (Pearson T. et al., (Abstract). In Programs and Abstracts. From the 17th Annual Conference of the American Society of Transplant Physicians, Chicago, 10 - 14 May 1997. Chicago, American Society of Transplant Physicians). Recently, there are several reviews of long-term survival of homologous islet transplants in non-human primate models. Anti-CD40L mAb therapy has shown the most impressive results yet; however, similar to experiments using a kidney transplant model, tolerance was not achieved, as withdrawal of therapy eventually resulted in rejection (Kenyon, NS et al., Proc. Natl. Acad. Sci. USA 96: 8132-8137 (1999); Kirk, AD, et al., Nat. Med. 5, 686-693 (1999). IN another encouraging review, Thomas et al. (Diabetes 50: 1227 1236, (2001)) recently described the use of an anti-CD3 immunotoxin and the immune modulating agent DSG (15 deoxyspergualin) to markedly prolong islet survival in primates with streptozotocin-induced diabetes. Although promising, these reviews used therapeutic agents whose clinical potential is still uncertain at the present time.

In vivo data using L104EA29YIg, a mutant form of CTLA4-Ig, in the Rhesus islet homologous graft model is consistent with in vitro evidence indicating that this second-generation molecule is a more potent inhibitor of Rhesus responses. T cells than the precursor molecule. Since CTLA4-Ig has already shown efficacy in a clinical trial of psoriasis patients (Abrams, JR et al., J. Clin. Invest. 103: 1243-1252 (1999)), there is significant enthusiasm for the trial using L104EA29YIg as the primary imminosupersor. It is clearly evident, if not synergistic, with clinically approved immunosuppressive agents (anti-IL-2R mAb and rapamycin) that it facilitates clinical trial design. Initial human trials with L104EA29YIg are already underway in patients with rheumatoid arthritis and those undergoing kidney transplantation. Although a direct comparison of the tacrolimus-based protocol and the L104EA29YIg regimen was not attempted due to toxicities

ES 2 302 811 T3 reported intolerable in non-human primates (Montgomery, SP, et al., Am J. Transplant 1 (Suppl. 1): 438,2001), the inventors' results suggest that L104EA29YIg has the potential to be al less as effective as tacrolimus as a primary immunosuppressant.

Conclusions

An inhibitor / steroid-free immunosuppressive regimen is disclosed that provides significant protection from rejection and prolongs the survival of homologous islet transplants in non-human primates. The biological agent L104EA29YIg is a powerful immunosuppressant. L104EA29YIg can replace Tacrolimus in the Edmonton protocol, thereby eliminating the unwanted side effects of the calcineurin inhibitor.

As will be apparent to those skilled in the art to which the invention belongs, the present invention can be carried out in ways other than those specifically described above without departing from the essential characteristics of the invention. The particular embodiments of the invention described above, therefore, are to be considered as illustrative and not restrictive. The scope of the present invention is as set forth in the appended claims rather than being limited to the examples contained in the foregoing description.