Compositions and methods for control of insect infestations in plants

[0001] The present invention relates generally to the genetic control of pest infestation in plants and in animals and on animals. More specifically, the present invention relates to methods for modifying the endogenous expression of coding sequences in a cell or tissue of a given pest. More specifically, the present invention uses recombinant DNA technology for post-transcriptional repression or inhibition of expression of a target coding sequence in a pest cell by feeding the pests with one or more double-stranded or small interfering ribonucleic acid (RNA) molecules transcribed from all or part of the target coding sequence , which helps combat pest invasion. The present invention therefore relates to sequence-specific inhibition of expression of coding sequences using double-stranded RNA (dsRNA) or small interfering RNA (siRNA) to achieve the intended levels of pest control.

[0002] New, isolated and substantially purified nucleic acid molecules are also provided, including but not limited to non-naturally occurring nucleotide sequences and recombinant DNA constructs for transcription of dsRNA or siRNA molecules of the present invention that suppress or inhibit the expression of an endogenous coding sequence or target coding sequence in ransomware after introducing them to it. Transgenic plants are also provided that (a) contain nucleotide sequences encoding isolated and substantially purified nucleic acid molecules and non-naturally occurring recombinant DNA constructs for transcribing dsRNA or siRNA molecules to combat pest invasion of plants and (b) exhibit insect resistance and / or invasion . Also described herein are compositions containing increased tolerance to dsRNA nucleotide sequences of the invention for use in applications or animals or the animal environment to achieve the elimination of the present plant topicals or to reduce pest infestation.

Background Art [0003] The environment in which people live is full of pest invasion. Pests, including insects, arachnids, crustaceans, fungi, bacteria, viruses, nematodes, flatworms, roundworms, pinworms, hookworms, tapeworms, worms (trypanosomes), schistosomes, tumors, fleas, ticks, mites and lice, are ubiquitous in the human environment and many agents are used to try to combat the invasion by these pests. Compositions for controlling invasion by microscopic pests such as bacteria, fungi and viruses are provided in the form of antibiotic compositions, antiviral compositions and antifungal compositions.

Compositions for controlling the invasion of larger pests, such as nematodes, flatworms, roundworms, pinworms, heartworms, tapeworms, borers and schistosomes, are usually made in the form of chemical compositions that can be used on the surface of substrates pests are known to invade or eat the infected animal in the form of granules, powders, tablets, pastes or capsules. The present invention is directed to providing agents for controlling pest infestation improved compared to compositions known in the art.

[0004] Commercial crops are often the targets of an insect attack. Over the past few decades, significant progress has been made in developing more effective methods and compositions for combating insect invasion of plants. Chemical pesticides are very effective in controlling pest infestation. However, there are several disadvantages to using pesticide chemicals. Chemical pesticides are not selective. The use of chemical pesticides is aimed at controlling (controlling) invertebrate pests that are harmful to various crops and other plants. However, due to the lack of selectivity, chemical pesticides also exert their influence on non-target fauna, often effectively sterilizing the field for a time exceeding the use of the pesticide.

Chemical pesticides remain in the environment and are usually slowly metabolized or not metabolized at all. They accumulate in the food chain, especially in the accumulation of these pesticidal higher predators.

chemical agents develop resistance to agents in species higher on the evolutionary ladder; they act as mutagens and / or carcinogens, often causing irreversible and harmful genetic modifications. There has therefore long been a need for environmentally friendly methods of controlling or eliminating insect infestation on plants or in plants, i.e. methods that are selective, neutral to the environment, non-persistent and biodegradable, and that are well suited to pest management systems.

[0005] Compositions that contain Bacillus thuringiensis (Bt) have been commercially available and used as environmentally safe and acceptable insecticides for over thirty years. The insecticidal effect of Bt bacteria occurs as a result of the presence of proteins that are produced only by those bacteria that do not persist in the environment, are highly selective for the target species on which they act, and exert their effects only after eating by the target pest. They have been shown to be harmless to plants and other non-target organisms, including humans. Transgenic plants containing one or more genes encoding an insecticidal Bt protein are also known in the art; are significantly effective in controlling pest infestation. The main result of the use of recombinant plants expressing the insecticidal Bt protein is a significant decrease in the amount of chemical pesticides that are applied to the environment to combat pest invasion in arable fields in areas where such transgenic plants are used. The reduction in the use of chemical pesticides has resulted in cleaner soils and clean waters flowing from soils into surrounding streams, rivers, ponds and lakes. In addition to these environmental benefits, the number of beneficial insects in the arable fields is growing noticeably, where transgenic insect-resistant crop plants grow due to reduced use of chemical insecticides.

[0006] Antisense methods and compositions have been described in the art that are believed to exert their effect by synthesizing a single-stranded RNA molecule which in theory hybridizes in vivo to a molecule of essentially complementary sense strand RNA. Antisense technology was difficult to use in many systems for three main reasons. First, the antisense sequence expressed in the transformed cell is unstable. Second, the instability of the antisense sequence expressed in the transformed cell also creates difficulties in delivering the sequence to the host, cell type or type of biological system distant from the transgenic cell. Third, the difficulties encountered with instability and antisense sequence delivery are problematic when attempting to deliver a dose in a recombinant cell expressing the antisense sequence that can effectively modulate the expression level of the target sense nucleotide sequence. [0007] Only few improvements in technology for modulating the level of gene expression in a cell, tissue or body have been achieved, and in particular, no technologies have been developed to delay, repress or otherwise reduce the expression of specific genes using recombinant DNA technology. In addition, as a consequence of the unpredictability of these methods, there are no commercially available agents to modulate the level of expression of a particular gene in a eukaryotic or prokaryotic organism.

[0008] Double-stranded RNA inhibition of specific genes has previously been demonstrated in various pests. Methods using dsRNA for genetic control have been tested in fruit fly Drosophila melanogaster (Tabara et al., 1998, Science 282: 430431). Tabara et al. describe a method of delivering dsRNA, comprising producing transgenic insects expressing double-stranded RNA molecules, or injecting dsRNA solutions into the body of an insect or into a female egg sac before embryonic development or during embryonic development. Researchers have previously shown that gene suppression via double-stranded RNA can be obtained in nematodes by either feeding or dipping nematodes in solutions containing double-stranded RNA molecules or small interfering RNA or dsRNA molecules. Rajagopal et al.

the injection of molecules is described by unsuccessful attempts to suppress the endogenous gene in insect-larvae of the pest

Spodoptera lithium by either feeding or immersing newborn larvae in solutions containing a target gene specific dsRNA, but suppression was successful after injection of dsRNA larvae into stage 5 larva hemolymph using a microapplicator (J. Biol. Chem. 2002, 277: 46849- 46851). Similarly, Mesa et al. (US 2003/0150017) described as a potentially preferred locus for inhibiting Helicoverpa armiger butterfly larvae using dsRNA delivered to larvae by eating a transformed plant to produce dsRNA. It is believed that in most species of invertebrate pests it would be impractical to provide dsRNA molecules in the diet or to inject compositions containing dsRNA into their bodies. The method of supplying dsRNA molecules to invertebrate pests with food is impractical because RNA molecules, even stabilized double-stranded RNA molecules, are in fact very unstable in slightly alkaline or acidic environments, such as the environment in the digestive tract of most invertebrate pests, and are easily broken down by nucleases in environment. Therefore, there is a need for improved methods for modulating gene expression by repressing, delaying or otherwise reducing the expression of genes in a particular invertebrate pest to combat pest invasion or to introduce new phenotypic traits.

BRIEF DESCRIPTION OF THE INVENTION [0009] The present invention relates to (1) a composition containing two or more different pesticides, each of which is toxic to the same pest - corn rootworm, in which the first pesticide is a dsRNA molecule that acts to suppress essential biological function in one or more pest cells - Colorado corn beetle, and wherein the second pesticide is Bacillus thuringiensis insecticide;

(2) the preferred embodiment (1) above, wherein the Bacillus thuringiensis insecticidal protein is selected from Cry3, TIC851, CryET70, Cry22, VIP, TIC901, TIC1201, TIC407, TIC417, a binary insecticidal protein selected from CryET33 and CryET34, CryET80 and CryET80 and CryET80 TIC100 and TIC101 and PS149B1, insecticidal chimeras from any of the previous insecticidal proteins; and (3) a method of controlling the pest - Colorado corn beetle, in particular Western Colorado corn beetle (WCR). Western corn rootworm, Diabrotica virgifera virgifera LeConte), by supplying two or more insecticides toxic to the same insect species in the insect-pest food, wherein the first insecticide contains a dsRNA molecule expressed from a DNA sequence, and wherein this dsRNA molecule inhibits the biological function of this pest when it is eaten by that pest, part of that DNA sequence, consisting of at least 21 contiguous nucleotides, exhibits from 85% to 100% identity of the nucleotide sequence with the coding sequence selected from NR ID. SEQ. 1- 143, 169 174 and their additions, and wherein the second insecticide is provided with the first insecticide in the food, said second insecticide being as defined in claim 1. 1 or

2. Introduction of partial or fully stabilized double-stranded RNA (dsRNA) or its modified forms, such as small interfering RNA (siRNA) sequences, into cells or into an extracellular environment, such as the middle intestine, in the body of the pest - corn beetle root, where dsRNA or siRNA enters the cells and inhibits the expression of at least one or more target genes, and where inhibition of one or more target genes has a detrimental effect on the pest - corn beetle rootworm. Particularly, it is contemplated that the method and composition of the present invention will be useful in reducing or eliminating the infestation of the pest - corn beetle in the pest host or on the pest host, the pest symbion or in an environment that the pest prefers, by providing one or more compositions containing dsRNA molecules in the diet of the pest, as long as the pH of the digestive system of the pest is in the range from 4.5 to 9.5, from 5 to 9, from 6 to 8 and from 7.0.

[0010] The present application discloses an exemplary sequence list containing both the nucleotide and amino acid sequence of western corn rootworm (WCR - Diabrotica virgifera) as set forth in ID NO. SEQ. 1-ID NO. SEQ. 143 and ID NO SEQ. 169-ID NO. SEQ. 174.

[0011] The sequence list contains information regarding the list of Unigene sequences, corn rootworm, EST sequences, corn rootworm specific probe sequences, primer sequences, amplicon sequences and coding sequences for double-stranded RNA and V-ATPase sequences and other insect L1 ribosomal protein sequences, as described above (SEQ ID NO: 144-SEQ ID NO: 159).

[0012] A set of isolated and purified sequences is disclosed herein in ID NO. SEQ.

ID. SEQ. 169-ID NO. SEQ. 174, as shown in the provided sequence list. The nucleotide sequences disclosed herein, set forth in SEQ ID NO. SEQ. 1-ID NO. SEQ. 143, were isolated and substantially purified from complementary DNA (cDNA) libraries generated from WCR insect larvae. The nucleotide sequences disclosed herein, set forth in SEQ ID NO. SEQ. 169-ID NO. SEQ. 174 in the sequence listing, have been isolated and substantially purified from the genomic DNA of the southern corn root beetle insect or from the mRNA pool isolated from the insect pest, from cDNA nucleotide sequences derived from such mRNA pools or were synthesized de novo based on the nucleotide sequences disclosed herein or known in nucleotide as

1-ID NO. SEQ. 143 and NR of this field as phage T7 RNA polymerase promoter sequences. Also disclosed is a stabilized dsRNA or siRNA molecule or the expression of one or more miRNAs for inhibiting expression of a target gene in a invertebrate pest, such as a WCR insect. The stabilized dsRNA, miRNA or siRNA molecule may contain at least two coding sequences that are arranged in sense and antisense orientation relative to at least one promoter, wherein the nucleotide sequence that contains the sense strand and the antisense strand are bound or linked via a spacer sequence of at least five to a thousand nucleotides, the sense strand and the antisense strand are of different length and each of the two coding sequences exhibits at least 80% sequence identity, at least 90%, at least 95%, at least 98%, and even 100% sequence identity with the nucleotide sequence shown in one of the sequences of SEQ ID NO. SEQ. 1 - ID NO. SEQ. 143 or in one of the sequences of SEQ ID NO. SEQ. 169 - ID NO. SEQ. 174 in the sequence listing.

[0013] Non-naturally occurring (NNO) sequences that can be used to target genes in an invertebrate pest for double-stranded RNA suppression are also disclosed to achieve desired inhibition of target genes. Any of the nucleotide sequences as set forth in SEQ ID NO can be used to construct such a NNO nucleotide sequence. SEQ. 1 - 143 and ID NO. SEQ. 169 - 174.

[0014] Recombinant constructs are also disclosed

DNA encoding dsRNA molecules contemplated herein for introduction into a host cell. The recombinant DNA construct contains a nucleotide sequence that is transcribed into RNA in a host cell. After transcription, the RNA forms at least one dsRNA molecule, such that one strand of the dsRNA molecule is encoded by a portion of the nucleotide sequence having at least 80% to 100% identity with a nucleotide sequence selected from the group consisting of NR ID. SEQ. 1 - ID NO. SEQ. 143 and ID NO. SEQ. 169

- ID NO. SEQ. 174. The recombinant DNA construct is capable of producing dsRNA molecules in the host cell and inhibits expression of the endogenous gene or target gene or its derivative or sequences complementary to them in the host cell or in the pest cell after eating the transformed host cell by the invertebrate pest. The nucleotide sequence of the present invention is placed under the control of a promoter sequence that can act in a host cell and is expressed to produce ribonucleic acid sequences that form dsRNA molecules in the host cell. The dsRNA molecules can be further processed, either in the host cell or in the invertebrate pest, to form siRNA molecules.

[0015] Also disclosed are recombinant DNA sequences for plant transformation engineered to contain at least one non-naturally occurring nucleotide sequence that can be transcribed into a single-stranded RNA molecule.

A single-stranded RNA molecule creates by intermolecular hybridization in vivo a double-stranded RNA molecule that, when provided in the pest-invertebrate feed, inhibits the expression of at least one target gene in the invertebrate pest cell. The non-naturally occurring nucleotide sequence is operably linked to at least one promoter sequence that acts in a transgenic plant cell such that transcription of the operably linked non-naturally occurring nucleotide sequence to one or more ribonucleic acid sequences occurs. RNA sequences undergo self-assembly into double-stranded RNA molecules and are provided in the feed of the invertebrate pest that feeds on the transgenic plant. By providing dsRNA molecules in the pest food, the desired inhibition of expression of one or more target genes in the pest is achieved.

[0016] Also disclosed are recombinant host cells in which the genome has at least one recombinant DNA sequence transcribed in the host cell to produce at least one dsRNA molecule that works when eaten by the invertebrate pest, inhibiting expression of the target gene at the pest. The dsRNA molecule is encoded by a part of the nucleotide sequence that has at least 80 to 100% identity with the nucleotide sequence shown in SEQ ID NO. SEQ. 1-ID NO. SEQ. 143 and ID NO SEQ. 169-ID NO. SEQ. 174 in the sequence listing. Exemplary nucleotide sequences for use in the construction of dsRNA-based agents that target WCR genes to be suppressed are set forth in ID NO. SEQ. 1-ID NO. SEQ. 143 and ID NO SEQ. 169-ID NO. SEQ. 174 in the sequence listing.

[0017] Recombinant constructs are also disclosed

Plant transformation DNA, consisting of at least two different non-naturally occurring sequences which, when expressed in vivo to the RNA sequence and are provided in the pest invertebrate feed, inhibit the expression of at least two different target genes in the invertebrate pest cell . The first non-naturally occurring sequence is transcribed into RNA, which forms at least one first dsRNA molecule. One part of the first dsRNA molecule is encoded by part of the first non-naturally occurring sequence and has at least 80 to 100% identity with at least one of the nucleotide sequences set forth in SEQ ID NO. SEQ. 1-ID NO. SEQ. 143 or ID NO SEQ. 169-ID NO. SEQ. 174 in the sequence listing and to the nucleotide sequence of the first target gene, derivative thereof, or complementary sequence thereof. The second non-naturally occurring sequence is transcribed into RNA, which forms the second dsRNA molecule. One part of the second dsRNA molecule is encoded by part of the second non-naturally occurring sequence and has at least 80 to 100% identity with the nucleotide sequence selected from the group set forth in SEQ ID NO. SEQ. 1 - 143 and ID NO. SEQ. 169-174 in the sequence listing and with the nucleotide sequence of the second target gene, its derivative, or the complementary sequence thereof. Two non-naturally occurring sequences are placed in such a way that they can be operated under the control of at least one promoter sequence. The promoter sequence works to express the first and second dsRNA molecules in a transgenic plant cell. The dsRNA molecules are delivered in a concentration that inhibits pest-invertebrate in food of the pest-invertebrate feeding on the transgenic plant, and by eating the plant cells by the pest, the desired inhibition of expression of target genes in the pest is achieved.

[0018] Transformed plant cells in which the genome is at least one of the aforementioned recombinant DNA sequences for plant transformation are also disclosed. Transgenic plants are produced from the transformed plant cell, and progeny plants, seeds and plant products are produced from transgenic plants, each containing recombinant DNA.

[0019] The method and compositions of the present invention can be applied to any monocotyledonous and dicotyledonous plant, depending on the desired control of invertebrate pests, or can be applied via pharmaceutically acceptable compositions to vertebrate animals to provide some level of reduction of pest infestation. Specifically, plants are intended to include, but are not limited to:

alfalfa, dill, apple tree, apricot, artichoke, arugula, asparagus, avocado, banana, barley, beans, beetroot, blackberry, blueberry, broccoli, brussels sprouts, cabbage, rape, cantaloupe, carrot, cassava, cauliflower, celery, cherry , citrus fruit, clementine, coffee, corn, cotton, cucumber, Douglas fir, eggplant, chicory, escarole, eucalyptus, fennel, fig, calabash, grape, grapefruit, honeydew melon, trumpet, kiwi, lettuce, leek, lemon , taeda pine, mango, melon, mushrooms, nuts, oats, musk, onion, orange, ornamental plants, papaya, parsley, peas, peach, peanuts, pear, pepper, persimmon, pine, pineapple, banana, plum, pomegranate, poplar, potato, pumpkin, quince, California pine, lettuce, radish, raspberry, rice, rye, sorghum, southern pine, soybean, spinach, pumpkin, strawberry, sugar beet, sugar cane, sunflower, sweet potato, balsamic amber, tangerine, tea, tobacco, tomato grass grapevine, watermelon, wheat, sweet potatoes and zucchini.

[0020] The pest control agent of (1) above comprises a dsRNA molecule transcribed from the nucleotide sequence of the present invention. The nucleotide sequence has at least 80 to 100% sequence identity with at least one of the nucleotide sequences set forth in SEQ ID NO. SEQ. 1-ID NO. SEQ. 143 and ID NO SEQ. 169-ID NO. SEQ. 174 in the sequence listing. In one embodiment, the pest control agents comprise dsRNA molecules. In another embodiment, the pest control agents contain siRNA molecules. In yet another embodiment, the pest control agents comprise recombinant DNA sequences that encode mRNA molecules that form dsRNA or siRNA molecules intended for introduction into plants and microorganisms. In yet another embodiment, the pest control agents are microorganisms that contain recombinant DNA sequences that encode RNA molecules that form dsRNA or siRNA molecules. The pest control agent is a pest control agent - Colorado corn beetle.

[0021] The invention also discloses a combination of methods and compositions for controlling the invasion of the corn beetle root pest. One method provides dsRNA-based methods and compositions described herein for protecting plants against insect invasion along with one or more insecticides that exhibit characteristics other than those exhibited by dsRNA-based methods and compositions. When Bt proteins are provided in the insect-pest food, the exhibited mode of action for controlling insect-pests is, for example, completely different from the mode of action in the methods and compositions of the present invention. A composition prepared for topical administration or a composition that is derived from transgenic approaches that methods and uses combines dsRNA-based compositions with Bt-based methods and compositions results in synergy that was not previously known in the art in controlling pest invasion . Transgenic plants that produce one or more dsRNA or siRNA molecules that inhibit some important biological functions in the target pest together with one or more Bt insecticidal proteins that are the target pest, provide synergy. One synergy is toxic to the unexpected decrease in the level of expression required for either dsRNA (one or more) or Bt protein (s). When they are associated with each other, a lower effective dose of each pest control agent is needed. It is believed that insecticidal Bt proteins form entry pores through which dsRNA or siRNA molecules can penetrate more efficiently into the space distant from the intestine of insect-pests, or more efficiently to cells near the lesions formed by Bt proteins, thus requiring less Bt or dsRNA to achieve the desired insecticidal result or the desired inhibition or suppression of the target biological function in the target pest. The inventors describe a method of combating the infestation of the pest - corn beetle root - by providing the pest with an agent containing a ribonucleic acid or consisting of a ribonucleic acid which acts after being eaten by the pest, inhibiting expression of the target nucleotide sequence that is found in the cells of the pest. The ribonucleic acid that is provided in the food consists of a ribonucleotide sequence that is the target nucleotide sequence or which is complementary to the target nucleotide sequence. The ribonucleotide sequence is transcribed from a continuous DNA sequence that is at least 19 to 5000 nucleotides in length and which is selected from the group consisting of NR ID. SEQ. 1-ID NO. SEQ. 143, ID NO. SEQ. 169-ID NO. SEQ. 174 and their additions. The method provides a nucleotide sequence construction that can be used to express an RNA molecule that can be eaten by a pest in food supplied to the pest. The food may be an artificial food prepared to satisfy specific nutritional requirements to maintain the pest on such food, and be supplemented with the pest-controlling amount of RNA that has been purified from a separate expression system, the food being supplemented to determine the amount of the pest-controlling RNA composition or determining whether one or more specific RNAs constructed specifically, that they bind or hybridize in part to one or more target sequences in the pest, are functional in achieving some gene suppression activity after eating the supplemented food by the pest. The food may be a recombinant cell transformed with a DNA sequence constructed to express the agent, RNA, or gene suppressor. After ingestion of one or more of these transformed cells by the pest, the desired genotypic or phenotypic result is observed, indicating that the agent is acting to inhibit expression of the target nucleotide sequence that is found in the pest cells.

[0022] The length of the DNA sequence selected for use in the expression of the gene suppressant of the present invention is preferably at least 19 to 5000 nucleotides; the sequence is at least partially or substantially identical to the sense or antisense strand of the target sequence present in the DNA of one or more specific pest species. The expression "at least partially" is intended to refer to the concept that the DNA sequence selected for use in the expression of a gene suppressant may be constructed from a single sequence derived from one or more target pests and intended for use in the expression of RNA that acts on suppression of a single gene or gene family in one or more target pests, or that a DNA sequence can be constructed as a chimera from multiple DNA sequences. Each of the many DNA sequences may be derived from one or more nucleotide sequences from one pest, or one or more nucleotide sequences may be from many different pests. Specifically, the selected sequence should have from 80 to 100% identity of the nucleotide sequence with the DNA nucleotide sequence of the given pest species. The DNA of a given pest species can be identified by directly isolating the DNA of individual pest species or by identifying the RNA sequence of a given pest species and performing reverse translation of the RNA sequence into DNA. Sequences exemplifying the DNA of the corn root beetle pest are set forth in the sequence listing as ID NO. SEQ. 1-ID NO. SEQ. 143, ID NO. SEQ. 169 to ID no. SEQ. 174 and their additions.

[0023] DNA sequences selected for use in expressing the RNA molecule for gene suppression may be included in a polynucleotide composition for use in a plant cell. Specifically, the DNA sequences can be included in a vector for use to transform the genome of a plant cell and can be incorporated into an expression cassette containing at least one plant-promoting promoter operably linked to the selected DNA sequence along with other expression control elements desired for achieving a level of expression appropriate to the time in the cell or the spatial location in the plant.

The introduction of the polynucleotide composition into the genome of the plant cell provides a transformed cell that can be selected, provided that appropriate selection agents have been provided with the polynucleotide composition, and regenerated into a transgenic recombinant plant. A transgenic plant - an event - can be provided in the feed of a pest or pest to achieve pest control. A transgenic plant can yield progeny, plant cells and seeds; these plants, cells and seeds will contain the polynucleotide composition.

[0024] A method for protecting plants against insect invasion is disclosed by providing a pest with one or more plant cells, each of which expresses an RNA molecule for suppressing a gene from a DNA sequence that is selected from the group consisting of the sequences given herein by way of example.

Eating plant cells containing RNA for gene suppression, a pest or insect control agent, results in the inhibition of one or more biological functions in the pest or insect.

[0025] The composition according to item (1) above contains two or more different pesticides, each of which is toxic to the same species of pest or insect. As indicated herein, one of these pesticides is an RNA molecule that acts by suppressing important biological function in one or more pest cells. Along with the first, a second pesticide is included. The second agent is Bacillus thuringiensis insecticide protein, Bacillus sphearicus insecticide protein and lignin. The Bacillus thuringiensis insecticidal protein can be any of a variety of insecticidal proteins, including, but not limited to, Cry1, Cry3, TIC851, CryET70, Cry22, the binary insecticide protein CryET33 and CryET34, the binary insecticide protein CryET80 and CryET76, the binary Ticcanic protein B100 , VIP insecticidal protein, TIC900 or related protein, TIC901, TIC1201, TIC407, TIC417 and insecticidal chimeras of any of the previous insecticidal proteins.

[0026] A gene that is the target of suppression, either as a function in a pest cell, or as a physiological or metatabolic aspect of the pest that is enabled by the expression of the target gene, can encode a relevant protein whose predicted function is selected from the group consisting of muscle formation , formation of juvenile hormone, regulation of juvenile hormone, regulation and transport of ions, synthesis of digestive enzymes, maintenance of cell membrane potential, amino acid biosynthesis, amino acid degradation, sperm formation, pheromone synthesis, pheromone sensing, antenna formation, wing formation, leg formation, development and differentiation, egg formation, larva maturation, food enzyme formation, hemolymph synthesis, hemolymph synthesis, maintenance of hemolymph, neurotransmission, cell division, metabolism energy, respiration and apoptosis. It is preferred that the DNA sequence chosen for constructing the suppression construct is derived from the nucleotide sequences listed in the corn root beetle gene suppression sequence listing sequence.

It is envisaged that the method of controlling the pest infestation will comprise providing the pest-insect agent with food, for example the first ribonucleotide sequence of the expressed pest sequence,

DNA that acts after eating by inhibiting the biological function of the first by this pest, and that the first DNA sequence has from 85 to 100% sequence identity the coding sequence derived from the nucleotide from this pest.

The first ribonucleotide sequence can be hybridized with a second complementary or first ribonucleotide sequence that is substantially complementary to the second ribonucleotide, the ribonucleotide sequence is expressed from a second DNA sequence that corresponds to the coding sequence derived from the invertebrate pest selected from the sequences shown in the sequences listed here or their additions. It is preferred that the first and second DNA sequences contain a contiguous sequence or are identical to one or more sequences in the sequence listing and consist of 14-25 or more contiguous nucleotides.

[0027] The invention works optimally when a food containing a gene suppressing pest amount of an insecticide such as one or more molecules

RNA produced by the expression of one or more of the sequences shown in the sequence listing herein is delivered to the invertebrate pest, which has a gastrointestinal pH of from

4.5 to 9.5, from 5.0 to 9.0, from 5.5 to 8.5, from 6.0 to 8.0, from 6.5 to 7.0 or 7.0. Any of the methods described herein, nucleic acids, ribonucleic acids, ribonucleotide sequences, compositions, plants, plant cells, progeny plants, seeds, insect control agents, pest control agents, expression cassettes, are optionally functional when supplied in one feed or more pests whose gastrointestinal tract has such a pH.

[0028] The food of the present invention may be any food sufficient for the pest, including but not limited to food or artificial composition, plant cell, numerous plant cells, plant tissue, plant root, plant seed and plant grown from seed of the plant, wherein the food comprises pest-inhibiting amount of an RNA molecule encoded by a DNA sequence that is such as one or more continuous sequences of at least 19 to 5000 nucleotides, selected nucleotide sequences listed in the list of sequences or selected from nucleotide sequences derived from specific species of invertebrate pests, or being complementary to these sequences, is essentially such as these sequences, or is substantially complementary to these sequences.

[0029] The scope of the present invention is to include agricultural and commercial products and / or compositions considered important here, including but not limited to animal feed, foodstuffs and corn products and their by-products, intended for use as food for human consumption or use. in compositions and foodstuffs that are intended for human consumption, including but not limited to cornmeal, cornstarch, corn syrup, corn oil, corn starch, popcorn, corn cakes, corn-containing cereal products and corn by-products, if these products and compositions contemplated herein contain detectable amounts of nucleotide sequences, presented herein as diagnostic for any transgenic event containing such nucleotide sequences. These products are useful at least because they are likely to come from crops and crops that are produced in fields containing less pesticides and organic phosphates by including the nucleotides of the present invention to combat invertebrate-pest pest infestation. Such foodstuffs and commodity products are made from seeds obtained from transgenic plants, wherein the transgenic plant expresses RNA from one or more nucleotide sequences of the present invention or nucleotides from one or more invertebrate pests and their complements. Such foodstuffs and commodity products may also be useful in controlling invertebrate pests of such foodstuffs and commodity products, e.g., for controlling weevil, due to the presence in the foodstuff and commodity product of RNA suppressing the pest gene expressed from the gene sequence as described herein invention.

DETAILED DESCRIPTION OF THE INVENTION [0030] The following is a detailed description of the invention, provided to assist the skilled person in carrying out the present invention. Those skilled in the art can make modifications and changes to the embodiments described herein without departing from the spirit and scope of the present invention. [0031] The inventors here have found that, contrary to the state of the art, feeding with a composition comprising double-stranded RNA molecules consisting of sequences found in one or more expressed nucleotide sequences of some invertebrate species, this invertebrate species, with sequences nucleotides have been obtained, inhibiting one or more biological functions in this invertebrate species. Specifically, the inventors have found that feeding corn beetle root with double-stranded RNA molecules consisting of the corn root beetle RNA sequence results in death or inhibition of the development and differentiation of corn beetle that eats these compositions.

which results [0032] The inventors have identified the nucleotide sequences of thousands of cDNA sequences obtained from each of the invertebrate pest species. The amino acid sequences encoded by the cDNA sequences were deduced and compared to all known amino acid sequences. For many of the cDNA sequences, they are predicted to encode proteins to which certain information annotations are assigned. The annotation information that is assigned to a particular nucleotide sequence and the protein sequence encoded therein is based on the homology or similarity of the amino acid sequences deduced by translating the amino acid sequences described above, above the cDNA sequences and which are known in the art in publicly available databases.

The deduced amino acid depicted, as here, using known sequences, the functions of each sequence were subjected to BLASTX-ED analysis for all amino acids, and probable deduced amino acid sequences were assigned based on the alignment results. CDNA sequences coding for proteins or portions of proteins known in the art to be essential for life, such as amino acid sequences involved in various biochemical metabolic or catabolic pathways, cell division, reproduction, energy metabolism, digestion and neurological functions, have been selected for use in the production of double-stranded RNA molecules that were provided in the feed for the invertebrate pest. As described herein, eating a target pest of compositions comprising one or more dsRNA whose at least one segment corresponds to at least a substantially identical segment of RNA produced in target pest cells has resulted in death, growth inhibition, or other inhibition in the target pest. These results indicated that the nucleotide sequence, either DNA or RNA, derived from the invertebrate pest can be used to construct a recombinant host or symbiont for the pest that is the target of the pest invasion. The pest host or symbiont may be transformed to contain one or more nucleotide sequences derived from the invertebrate host. The nucleotide sequence transformed into the host or symbiont for the pest encodes one or more RNAs that form the sequence of dsRNA in cells or biological fluids within the transformed host or symbiont, whereby the dsRNA becomes available in the diet of the pest if / when the pest feeds on the transgenic host or symbiote, which results in suppression of the expression of one or more genes in the cells of the pest and ultimately death, growth inhibition or other inhibition of the pest.

[0033] The present invention generally relates to the control of genetic invasion of invertebrate pests in host organisms. More specifically, the present invention includes methods of means for controlling invertebrate pests. Such a pest control agent causes, directly or indirectly, impairment of the viability of the pest, its increase in the type of attack by the host pest or symbiont. Specifically, the present pest delivery or other target invention provides methods of using stabilized dsRNA molecules in pest food as a means to inhibit target genes in a pest, which achieves the desired control of pest invasion in a host or symbiont, or around a host or symbiont, for a pest.

Which is the purpose of using the methods of the present invention can be produced transgenic plants that express recombinant stabilized dsRNA or siRNA molecules.

[0034] In order to achieve the above, the present invention provides a method of inhibiting expression of the target gene in the invertebrate pest, in particular in western corn rootworm (WCR) or other species of insects from the order of burlyweed, which ceases feeding, reproduction, infectivity and to death pest.

growth, development, ultimately can The method includes bringing partially or fully stabilized double-stranded RNA (dsRNA) nucleotide molecules or their modified forms, such as small interfering RNA (siRNA) molecules, into a nutritional composition that provides food for the pest and providing the nutritional composition foraging for pests. Eating an nutritional composition containing double-stranded RNA or siRNA molecules results in the molecules being taken up by the pest cells, which leads to inhibition of expression of at least one target gene in the pest cells. Inhibition of the target gene has a detrimental effect on the pest. The dsRNA molecules or siRNA molecules consist of the nucleotide sequences set forth in any one of SEQ ID NOs. SEQ. 1 to ID NO. SEQ. 143 and from ID NO. SEQ. 169 to ID NO. SEQ. 174, the inhibition of which causes a reduction or removal of the protein or nucleotide sequence of the agent which is necessary for the growth and development or other biological function of the pest. The selected nucleotide sequence has from at least 80% to 100% sequence identity to one of the nucleotide sequences set forth in SEQ ID NO.

SEQ. 1 - 143 and ID NO. SEQ. 169-174 as shown in the list of sequences or their additions. Such inhibition is specific in that the nucleotide sequence is selected from a portion of the target gene from which the inhibitory dsRNA or siRNA is transcribed. The method is effective in inhibiting the expression of at least one target gene and can be used to inhibit many different types of target genes in a pest.

[0035] The present invention also provides various forms of pest control agents to achieve the desired reduction of pest infestation. In one embodiment, the pest control agents comprise dsRNA molecules. In another embodiment, the pest control agents contain siRNA molecules. In yet another embodiment, the pest control agents comprise recombinant DNA constructs that can be used to stably transform microbes or plants, allowing transformed microbes or plants to encode dsRNA or siRNA molecules. In another embodiment, the pest control agents are microorganisms that contain recombinant DNA constructs encoding dsRNA or siRNA molecules.

[0036] Pairs of isolated and purified nucleotide sequences based on information from cDNA libraries and / or genomic libraries are provided. The nucleotide sequence pairs are derived from any preferred invertebrate pest and are intended for use as primers in thermal amplification to produce dsRNA and siRNA molecules of the present invention.

[0037] The present invention provides recombinant DNA constructs for use to obtain stable transformation of a particular host or symbiont targeted by the pest. The transformed host or symbiont targeted by the pest expresses pesticidally effective levels of preferred dsRNA or siRNA molecules from recombinant DNA constructs and provides the molecule in the feed of the pest.

[0038] The present invention also provides, as an example, a transformed host or symbiont target pest, transformed plant cells and transformed plants and their progeny. Transformed plant cells and transformed plants express one or more dsRNA or siRNA sequences of the present invention from one or more of the DNA sequences set forth in SEQ ID NO. SEQ. 1 - 143 and ID NO. SEQ. 169 - 174, as shown in the list of sequences or their completions.

[0039] As used herein, the words "gene suppression" are intended to refer to any of the well-known methods for reducing levels of protein produced by transcribing a gene into mRNA and subsequent mRNA translation when used together. Gene suppression is also intended to mean a reduction in protein expression from the gene or coding sequence, including post-transcriptional gene suppression and transcriptional suppression. Post-transcriptional gene suppression is mediated by homology between all or part of the mRNA transcribed from the gene or coding sequence that is the target for suppression and the corresponding double-stranded RNA used for suppression, and refers to a substantial and measurable reduction in the amount of available mRNA available in the cell for binding through ribosomes. The transcribed RNA can exist in a sense orientation to perform so-called co-suppression, or in antisense orientation to perform so-called antisense suppression, or in both orientations, producing dsRNA to perform so-called RNA interference (RNAi). Transcriptional suppression occurs through the presence of dsRNA in the cell, a gene suppression agent that exhibits essential sequence identity with the DNA promoter sequence or its complement to carry out what is referred to as promoter suppression in the trans system. Gene suppression may be effective against a native plant gene associated with a trait, e.g. to provide plants with reduced levels of protein encoded by the native gene or with increased or reduced levels of the associated metabolite. Gene suppression may also be effective against target genes of plant pests that may eat plant material containing or that may contain gene suppressants;

they are agents specifically designed to inhibit or suppress the expression of one or more homologous or complementary sequences in pest cells.

[0040] Post-transcriptional gene suppression by RNA in antisense or sense orientation to regulate gene expression in plant cells is disclosed in US Patent Nos. 5,107,065, 5,759,829, 5,283,184 and 5,231,020. The use of dsRNA for gene suppression in plants is disclosed in WO 99/53050, WO 99/49029, US Patent Application Publication Nos. 2003/0175965 and 2003/0061626, US Patent Application Nos. 10 / 465,800 and US Patent Nos. 6,506,559 and 6,326,193.

[0041] A preferred method of post-transcriptional gene suppression in plants uses transcribed RNA in both sense and antisense orientation, which is stabilized, e.g. as a hairpin structure and a stem and loop. A preferred DNA construct for performing post-transcriptional gene suppression is one in which the first segment encodes an RNA with an antisense orientation, showing substantial identity with the segment of the gene being the target for suppression, which is connected to the second section encoding RNA showing substantial complementarity with the first segment. It can be expected that such a construct will form a stem and loop structure by hybridizing the first segment to the second segment and the loop structure from the nucleotide sequences connecting both sections (see WO94 / 01550, WO98 / 05770, US 2002/0048814 and US 2003/0018993).

[0042] The term "nucleic acid" as used herein refers to a single or double stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5 'to 3' end. "Nucleic acid" may also optionally contain non-naturally occurring or altered nucleotide bases that allow correct reading by the polymerase and do not reduce the expression of a polypeptide encoded by that nucleic acid. The term "nucleotide sequence" or "nucleic acid sequence" refers to both the sense and antisense strands of the nucleic acid either as individual single strands or in duplex. The term "ribonucleic acid" (RNA) includes RNAi (inhibitory RNA), dsRNA (double-stranded RNA), siRNA (small interfering RNA), mRNA (messenger RNA), miRNA (micro-RNA), tRNA (conveyor RNA, charged or uncharged acylated amino acid), and cRNA (complementary RNA), and the term "deoxyribonucleic acid" (DNA) includes cDNA and genomic DNA, and DNA-RNA hybrids. The terms "nucleic acid segment", "nucleotide sequence segment" or, more generally, "segment" will be understood by those skilled in the art as terms related to performing functions that include genomic sequences, ribosomal RNA sequences, conveyor RNA sequences, messenger RNA sequences, operon sequences and smaller nucleotide sequences that have undergone genetic engineering that are expressed or can be adapted to express proteins, polypeptides or peptides.

[0043] The term "pest" as used herein refers to insects, arachnids, crustaceans, fungi, bacteria, viruses, nematodes, flatworms, roundworms, pinworms, hookworms, tapeworms, roundworms, schistosomes, bumps, fleas, ticks, mites and lice ubiquitous in the human environment and which may eat or may have contact with one or more cells, tissues or fluids produced by the host or symbiont of the pest, transformed for expression or coated with a double-stranded gene suppressant, or which can eat plant material containing the gene suppressor. The term "pest resistance trait" as used herein is a property of a transgenic plant, transgenic animal, transgenic host or transgenic symbiont, which makes the plant, animal, host or symbiont resistant to attack by a pest that is usually capable of causing damage or loss of plant, animal, host or symbiote. Such pest resistance may result from a natural mutation or, more typically, from the incorporation of recombinant DNA that confers resistance to a pest. To confer insect resistance on a transgenic plant, the recombinant DNA may, for example, encode an insect-lethal or insect-inhibiting protein, such as delta endotoxin, derived from B. thuringiensis bacteria, e.g. as used in commercially available cotton and corn varieties, or transcribed into an RNA molecule that forms a dsRNA molecule in the tissues or fluids of the recombinant plant. The dsRNA molecule is contained in a portion of the RNA segment that is identical to the corresponding RNA segment encoded in the DNA sequence of the pest that prefers to feed on the recombinant plant. Gene expression in the target insect pest is suppressed by dsRNA, and suppression of gene expression in the target insect pest results in an insect resistant plant. Fire et al. (US Patent No. 6,506,599) generally described inhibiting pest infestation, providing, specifically, only a few nucleotide sequences that were effective for inhibiting gene function in the nematode species Caenorhabditis elegans. Similarly, Plaetinck et al. (US 2003/0061626) describe the use of dsRNA to inhibit gene function in various nematode pests. Mesa et al. (US 2003/0150017) describe the use of dsDNA sequences for transforming host cells to express appropriate dsRNA sequences that are substantially identical to target sequences in specific pathogens, and especially describes the construction of recombinant plants expressing such dsRNA sequences for eating by various plant pests, which helps reduce the level of gene expression in the pest genome and improve plant resistance to pest infestation.

[0044] The present invention provides inhibition of expression of one or more target genes in the target insect using methods using stabilized dsRNA. The invention is particularly useful for modulating the expression of eukaryotic genes, in particular modulating the expression of genes present in insects in which the pH level of the digestive system is from 4.5 to 9.5, more preferably from 5.0 to

8.0, and even more preferably from 6.5 to 7.5. Plant pests whose gastrointestinal pH does not fall within these ranges are not potentially beneficial for use in double-stranded RNA-mediated methods for gene suppression using a delivery method that involves eating preferred dsRNA molecules. The modulating effect applies to various genes expressed in pests, including, for example, endogenous genes responsible for cell metabolism or cellular transformation, including primary metabolism genes, transcription factors and other genes that encode polypeptides involved in cell metabolism.

[0045] The term "expression" as used herein refers to the transcription and stable accumulation of sense or antisense RNA derived from the nucleic acids disclosed in the present invention. Expression may also refer to translation of mRNA into a polypeptide or protein. The term "sense" RNA as used herein refers to an RNA transcript corresponding to a sequence or segment thereof, which, when produced by the target pest, is in the form of mRNA that can be translated into protein in the target pest cell. The term "antisense RNA" as used herein refers to an RNA transcript that is complementary to all or part of the mRNA that is normally produced in the target pest cell. Antisense RNA complementarity can refer to any portion of a particular gene's transcript, i.e., the 5 'non-coding sequence and the 3' untranslated sequence, introns or sequence

The term "RNA transcript" as used herein refers to a catalyzed DNA sequence.

complementary by

When a copy of the resulting coding.

polymerase transcript sequence product

RNA transcription RNA is accurate

DNA, it is referred to as the primary transcript or it may be an RNA sequence derived from post-transcriptional processing of the primary transcript; such RNA is referred to as mature RNA.

[0046] The expression "inhibiting gene expression" or "inhibiting target gene expression in an insect cell" as used herein refers to the absence (or noticeable reduction) of the product level - protein and / or mRNA from the target gene. Specificity refers to the ability to inhibit the target gene without visible effects on other cell genes and without any effect on any gene in the cell that produces the dsRNA molecule. Inhibition of target gene expression in the pest may result in new phenotypic traits in the insect-pest.

[0047] Without limiting the scope of the present invention, in one aspect there is provided a method of controlling target insect invasion using a stabilized dsRNA strategy. The method includes producing stabilized dsRNA molecules as one type of insect control agent to induce genes in the insect-pest.

Insect silencing agents of the present invention induce, directly or indirectly, transcriptional silencing events of the target gene in an insect. Reducing the level of expression of the target gene prevents the growth, development, reproduction and infectivity of the insect to the hosts or at least delays them. The expression "production of stabilized dsRNA molecule" as used herein refers to methods of using recombinant DNA technology readily available in the art (e.g., Sambrook, et al., In Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor

Press, Cold Spring Harbor, New York, 1989) to construct a DNA nucleotide sequence that produces a stabilized dsRNA transcript. Detailed construction methods of the present invention are disclosed below in this disclosure. The term "silencing" as used herein refers to the effective "down-regulation" of the expression of a target nucleotide sequence, and thus the elimination of the ability of the sequence to cause an effect in an insect cell.

[0048] The present invention provides, in part, an insect delivery system for controlling insects by exposing them to food comprising insect control agents according to the present invention. According to one embodiment, stabilized dsRNA or siRNA molecules may be incorporated into insect food or may be superimposed on top of the food for ingestion by the insect.

[0049] The present invention also provides, in part, an insect delivery system for controlling an microorganism comprising their exposure to such as an insect plant through or a host, the insect controlling agents of the present invention, by eating the microorganism or host cells or cell content. According to another embodiment, the present invention relates to the production of a transgenic plant cell or plant that comprises a transcriptional recombinant DNA construct for stabilized dsRNA molecules of the present invention. As used herein, the expression "the production of a transgenic plant cell or plant" refers to methods of using recombinant DNA technology readily available in the art (e.g., in Sambrook et al.) To construct a plant transformation vector transcribed into the stabilized dsRNA molecules of the present invention for transformation plant cell or plant and the production of a transgenic plant cell or transgenic plant, which contains transcribed stabilized dsRNA molecules. Specifically, the method of the present invention may comprise a recombinant construct in a plant cell, resulting in dsRNA transcripts that are substantially homologous to the RNA sequence encoded by the nucleotide sequence within the insect genome. In the event that the nucleotide sequence in the insect genome encodes a gene necessary for the viability and infectivity of the insect, a decrease in its expression level leads to a reduced ability of the insect to survive and infect the host cell. Therefore, such a decrease in expression levels results in a "detrimental effect" on maintaining the viability and infectivity of the insect, and thus eliminates or reduces the insect's ability to forage and survive on nutrients derived from host cells. Due to this reduction in insect viability and infectivity, plant cells acquire resistance and / or increased tolerance to infection by insects. Insect genes can be targeted at maturity (in adults), immaturity (in larvae), or eggs.

[0050] In yet another embodiment, non-pathogenic, attenuated strains of microorganisms can be used as carriers for insect control agents and, in this context, microorganisms containing such agents are also referred to as insect control agents. Microorganisms can be genetically engineered to express the target gene nucleotide sequence to form RNA molecules containing RNA sequences homologous or complementary to RNA sequences that are typically found in insect cells. Insect exposure to microorganisms leads to microbial eating and a reduction in the level of expression of target genes mediated, directly or indirectly, by RNA molecules, fragments or derivatives thereof.

[0051] The present invention alternatively provides insect exposure to insect control agents of the present invention disposed in a spray and applied to the surface of a host, such as a host-plant. In an exemplary embodiment, the insect ingesting insect control agents provides insect control agents to the intestine of the insect and then to cells in the body of the insect. In another embodiment, infection of the insect by insect control agents by other means, such as injection or other physical methods, also allows the delivery of insect control agents. In yet another embodiment, the RNA molecules themselves are encapsulated in a synthetic substrate, such as a polymer, and applied to the surface of a host, such as a plant. Ingestion of host cells by an insect enables delivery of insect control agents and results in a reduction in the expression of the target gene in the host.

It is envisaged that the compositions of the present invention may be incorporated into seeds of a given plant species, either as an expression product from a recombinant gene incorporated into the genome of plant cells, or by incorporating in the form of a coating or seed treatment agent that is applied to the seed

The plant cell is considered here before planting.

recombinant transgenic gene.

[0052] It is believed comprising, as an event, that seed treatment with pesticides can provide significant benefits in combination with a transgenic event that provides protection against pest-invertebrate invasion and which remains in a favorable range of efficacy against the target pest. In addition, it is believed that there are situations well known to those skilled in the art when it is preferred to have such transgenic events within a favorable range of efficacy. [0053] The present invention also includes seeds and plants containing more than one transgenic event. Such combinations are referred to as "stacked" transgenic events. These piled-up transgenic events can be events that are directed to the same target pest, or they can be directed to different target pests. In one preferred method, a seed having the ability to express a Cry 3 protein or insecticidal variant thereof also has the ability to express at least one other insecticide, including but not limited to a protein that is different from the Cry 3 protein and / or the RNA molecule whose sequence is derived from the RNA sequence expressed in the target pest and which forms the structure of a double-stranded RNA when expressed in seed or cells of a plant grown from seed, wherein eating one or more plant cells by the target pest results in suppression of RNA expression in the target pest cells.

[0054] In another preferred method, the seed expressing dsRNA, whose sequence is derived from the target pest, also contains a transgenic event that provides tolerance to is, provides a herbicide, is an event that provides resistance to glyphosate - N- (phosphonomethyl) glycine - including this herbicide in the form of the isopropylamine salt.

[0055] In the present method, seeds containing a transgenic event are treated with a pesticide.

[0056] It is believed that the combination of a transgenic seed having biological activity against a target pest as a result of the production of an insecticidal amount of insecticidal dsRNA in the cells of a transgenic seed or plant grown from seed, with seed treatment with certain chemical or protein pesticides, provides unexpected herbicide. Preferred transgenic, which if tolerance event versus synergistic benefits for seeds treated in this way, including an unexpectedly higher protection efficiency against damage to the resulting transgenic plant by the target pest. In particular, it is believed that the treatment of transgenic seed that is capable of expressing certain constructs that form dsRNA molecules whose sequence is derived from one or more sequences expressed in corn rootworm using 100 g to 400 g of certain pesticides per 100 kg of seeds provides unexpectedly better protection against corn rootworm. In addition, it is believed that such combinations are also effective in protecting the corn plants obtained from damage by the nailer to the farmer. It is also believed that the seeds of the present invention have the property of reducing pesticide costs because less pesticide can be used to achieve the required amount of protection than in the absence of the innovative composition and method. Furthermore, because less pesticide is used and because it is used before planting and without using a separate field, it is believed that the inventive method is therefore safer for the operator and the environment, and is potentially less expensive than conventional methods. [0057] When certain effects are said to be "synergistic", this is intended to include synergistic effects on the pesticidal activity (or efficacy) of the combination of transgenic event and pesticide. However, it is not intended to limit such synergistic effects to pesticidal activity, but also such unexpected benefits as increased range of activity, favorable activity profile regarding type and level of harm reduction, reduced cost of pesticide and its use, reduced should be included spread of pesticide in the environment, reduced exposure of personnel that produces, manipulates and plants corn seeds, and other benefits known to those skilled in the art.

[0058] Pesticides and insecticides useful in compositions in combination with the methods and compositions of the present invention, including those used as a treatment and coating agent, as well as methods of using such compositions can be found, for example, in US Patent No. 6,551,962, the whole of which is here enabled by recall.

[0059] The present invention has been found to be useful for protecting seeds and plants from a wide range of crop pests, including insects, mites, fungi, yeasts, molds, bacteria, nematodes, weeds, and parasitic and saprophytic plants.

[0060] It is preferred that the seed treatment and coating methods described herein are used together with the transgenic seeds of the present invention, specifically, by applying to the transgenic seeds a pesticide other than dsRNA molecules derived from the sequences described herein in SEQ ID NOs. SEQ. 1 - 143 and ID NO. SEQ. 169-174 as shown in the list of sequences or their complement. Although it is believed that seed treatment can be applied to transgenic seeds in any physiological state, it is preferred that the seed is in a sufficiently stable condition that it is not exposed to the risk of damage during the treatment process. Typically, the seed would be a seed that was harvested from the field, taken from a transgenic plant and separated from any other plant material other than seed. The seed would also be preferably biologically stable to the extent that treatment would not cause biological damage to the seed. In one embodiment, the treatment can be applied, for example, to corn seeds which have been harvested, cleaned and dried to a moisture content below 15% by weight. In an alternative embodiment, the seed may be a seed that has been dried and then primed with water and / or other material and then dried again before or during pesticide treatment. Within the restrictions just described, it is believed that the treatment can be applied to the seed at any time between harvesting the seed and sowing the seed. The term "non-sown seed" as used herein is intended to include seed at any time between harvesting the seed and sowing the seed into the ground for germination and plant growth.

[0061] When said non-sown seed is "treated" with a pesticide, such treatment is not meant to include those practices in which the pesticide is applied to the soil and not to the seed. Treatments such as, for example, the use of pesticides in bands, "T" bands, or furrows at the same time as the seed is sown are not considered to be within the scope of the present invention.

[0062] The pesticide or mixture of pesticides can be used as "pure", i.e. without any dilution or the presence of additional ingredients.

However, the pesticide is typically applied to seeds in the form of a pesticidal composition. This composition may contain one or more other desired ingredients, including, but not limited to, liquid diluents, binders, serving as a pesticide substrate, fillers to protect seed under stress conditions, and plasticizers to improve flexibility, adhesion and / or spreadability of the coating. In addition, in the case of oily pesticide compositions containing little or no filler, it may be desirable to add desiccants such as calcium carbonate, kaolin or bentonite clay, perlite, diatomaceous earth or other adsorbent material to the compositions. The use of such ingredients for seed treatment is known in the art - see, e.g., US Patent No. 5,876,739. The skilled person can easily select the desired ingredients for use in the pesticidal composition, depending on the type of seed to be treated and the particular pesticide selected. In addition, readily available commercial preparations of known pesticides can be used, as shown in the examples below.

[0063] These pesticides can be applied to seeds as a component of the seed coating. Seed coating methods and compositions that are known in the art are useful when modified by the addition of one embodiment of the combination of pesticides of the present invention. Such coating methods and devices for their use are described, for example, in US Patent Nos. 5,918,413, 5,891,246, 5,554,445, 5,389,399, 5,107,787, 5,080,925, 4,759,945 and 4,465,017, among others. Seed coating compositions are disclosed, for example, in US Patent Nos. 5,939,356, 5,882,713, 5,876,739, 5,849,320, 5,834,447, 5,791,084, 5,661,103, 5,622,003, 5,580,544, 5,328,942, 5,300,127, 4,735,015, 4,634,587, 4,38639, 4,32.47, 37.47, 43.47, 43.47, 4.27, 4.27

[0064] Pesticides that are useful in coating are the pesticides described herein. The amount of pesticide that is used for the treatment of seeds will vary depending on the type of seed and type of active substance, but the treatment will involve contacting the seed with such a combination of pesticides that is pesticidally effective. When the target pests are insects, the amount will be the amount of insecticide that is insecticidal. As used herein, an insecticidally effective amount means an amount of an insecticide that will kill insect-infested larvae or pupae or will consistently reduce or delay damage caused by insect-pests.

[0065] Generally, the amount of pesticide that is used to treat the seed will range from 10 g to 2000 g of the active pesticide ingredient per 100 kg of seed weight. Preferably, the amount of pesticide will be in the range of 50 g to 1000 g of active ingredient per 100 kg of seeds, more preferably in the range of 100 g to 600 g of active ingredient per 100 kg of seeds, and even more preferably in the range of 200 g to 500 g active ingredient per 100 kg of seed weight. Alternatively, it has been found to be advantageous if the amount of pesticide is above 60 g of active ingredient of the pesticide per 100 kg of seed, and more preferably more than 80 g per 100 kg of seed.

[0066] Pesticides that are used for treatment must not inhibit seed germination and should be effective in protecting the seed and / or plant during this life cycle of the target insect in which it causes damage to the seed or plant.

Generally, the coating will be effective for about 0-120 days after sowing.

[0067] The pesticides of the present invention can be applied to seeds in the form of a coating. The use of the coating is particularly effective at adapting to high amounts of pesticides, which may be required to treat typically resistant pests such as corn rootworm, while preventing phytotoxicity due to increased pesticide loading.

[0068] Coatings formed from the pesticidal compositions contemplated herein are preferably capable of efficiently releasing the pesticide by diffusion or movement through the substrate into the surrounding environment.

[0069] In addition to the coating layer, the seeds may be treated with one or more of the following ingredients:

another pesticide including fungicides and herbicides;

herbicidal protection agent; fertilizer and / or biological control agent. These ingredients can be added as separate layers or, alternatively, they can be added in the pesticidal coating layer. [0070] The pesticidal composition can be applied to seeds using conventional coating techniques and machines such as fluidized bed techniques, roller mill method, rotostatic seed treatment devices and drum coating machines. Other methods, such as spouted beds, may also be useful. Seeds can be sorted for dimensions before coating. After coating, the seeds are usually dried and then transferred to a sorting machine in terms of dimensions for sorting. Such procedures are known in the art.

[0071] The term "insect control agent" or "gene suppressant agent" as used herein refers to a specific RNA molecule consisting of a first RNA segment and a second RNA segment connected by a third RNA segment. The first and second RNA segments lie within the length of the RNA molecule and are essentially inverted repeats with respect to each other and are connected to each other via a third RNA segment. The result of the complementarity between the first and second RNA segment is the ability of the two segments to hybridize in vivo and in vitro to form a double-stranded molecule, i.e. a shaft, connected at one end of each segment, the first and second, with the third segment that forms a loop, so that the entire structure forms into the structure of the stem and loops, and that more hybridizing structures can form into the structure of the stem and loops with nodes. The first and second segments correspond invariably and absolutely to the sense and antisense sequences with respect to the target RNA transcribed from the target gene in the target insect pest which is suppressed by eating the dsRNA molecule. The insect control agent may also be a substantially purified (or isolated) nucleic acid molecule, and more specifically, nucleic acid molecules or nucleic acid fragment nucleic acid molecules (gDNA) or cDNA library derived therefrom. Alternatively, the fragments may contain smaller oligonucleotides containing from 15 to 250 nucleotide residues, and more preferably, from 15 to 30 nucleotide residues. The term "insect control agent" may also refer to a DNA construct that contains isolated and purified nucleic acid molecules or derived nucleic acid fragment molecules from gDNA or a cDNA library. The term "insect control agent" may further refer to a microorganism comprising such a DNA construct that contains isolated and purified nucleic acid molecules or derived nucleic acid fragment molecules from gDNA or a cDNA library. The expression "production of an insect control agent" as used herein refers to methods of using recombinant DNA technology readily available in the art (for example, in Sambrook, et al.) To produce a transcriptional recombinant DNA construct stabilized into dsRNA or siRNA molecules for construction a vector for transcription of stabilized dsRNA or siRNA molecules and / or for transformation and production of a cell or microorganisms, which contain transcribed stabilized dsRNA or siRNA molecules. The method of the present invention provides for the production of a dsRNA transcript whose nucleotide sequence is substantially homologous to the target RNA sequence encoded by the target nucleotide sequence in the genome of the target insect pest. [0072] As used herein, the term "genome", when referring to insect or host cells, includes not only chromosomal DNA found in the nucleus, but organelle DNA located within the intracellular compartments of the cell. The DNAs of the invention introduced into plant cells can therefore either be incorporated into the chromosome or located in organelles. The term "genome", when used in reference to bacteria, includes both chromosome and plasmids within the bacterial host cell. The DNA of the present invention introduced into the bacterial host cell can therefore either be incorporated into the chromosome or located on the plasmid.

[0073] Inhibition of target gene expression can be quantified by measuring either endogenous target RNA or protein produced by translation of the target RNA, and the consequences of inhibition can be confirmed by examining the external properties of the cell or organism. Techniques for quantifying RNA and proteins are well known to those skilled in the art. Many selection markers are available that bleomycin, kanamycin, confer resistance to ampicillin, chloramphenicol, gentamycin, hygromycin, lincomycin, methotrexate, phosphinothricin, puromycin, spectinomycin, rifampicin and tetracycline.

[0074] In some preferred embodiments, the gene expression is inhibited by at least 10%, preferably by at least 33%, more preferably by at least 50%, and even more preferably by at least 80%. In particularly preferred embodiments, the gene expression is inhibited by at least 80%, more preferably by at least 90%, more preferably by at least 95% or by at least 99% in insect cells, such that significant inhibition occurs. Significant inhibition is intended to refer to sufficient inhibition that results in a detectable phenotype (e.g., larval growth inhibition, paralysis or mortality) or a detectable reduction in the amount of RNA and / or protein corresponding to the target inhibitory gene. Although in some embodiments, inhibition occurs in essentially all insect cells, in other preferred embodiments, inhibition occurs only in a subset of cells that express the gene. For example, if the gene to be inhibited plays an important role in cells in the digestive tract of an insect, inhibition of the gene in these cells is sufficient to exert an adverse effect on the insect.

[0075] Advantages of the present invention may include, but are not limited to, the following features: ease of introduction of dsRNA into insect cells, low dsRNA or siRNA concentration that can be used, stability of dsRNA or siRNA, and inhibitory efficiency. The possibility of using a low concentration of stabilized dsRNA avoids several disadvantages of antisense interference. The present invention is not limited to in vitro use or composition of a particular sequence, to a specific set of target genes, a specific portion of the target gene nucleotide sequence or specific transgene or specific delivery method, unlike some available techniques known in the art, such as the antisense method and co-suppression. In addition, genetic manipulations in organisms that are not classical genetic models become possible.

[0076] In carrying out the present invention, it is important that the presence of nucleotide sequences that are transcribed from the recombinant construct is neither harmful to the cells of the plant in which they are expressed according to the invention, nor harmful to the animal food chain, in particular to humans. Since the product from the plant can be made available for human consumption, only the insect decreases expression of the target nucleotide sequence.

[0077] In order to inhibit the target gene selectively within the insect species to be controlled, the target gene should therefore preferably have a low degree of sequence identity with its corresponding genes in plants or in a vertebrate animal. Preferably, the degree of sequence identity is less than about 80%. More preferably, the degree of sequence identity is less than about 70%. Most preferably, the degree of sequence identity is less than about 60%. [0078] In accordance with one embodiment of the present invention, there is provided a nucleotide sequence that results in in vitro expression of transcription of a stabilized RNA sequence that is substantially homologous to an RNA molecule of a target gene in an insect that contains the RNA sequence encoded by the nucleotide sequence within the genome insect. Therefore, when an insect eats a stabilized RNA sequence incorporated into food or sprayed on the surface of a plant, there is a decrease in the expression level of the nucleotide sequence corresponding to the target gene in the target insect cells. Decreasing the expression level of the nucleotide sequence results in harmful effects on the persistence, viability, proliferation, reproduction and infectivity of the insect. The nucleotide sequence of the present invention may therefore be useful in modulating or controlling the invasion of many insects. [0079] According to another embodiment of the present invention, there is provided a nucleotide sequence for which the expression in a microbe cell results in the transcription of an RNA sequence that is substantially homologous to an RNA molecule of a target gene in an insect that contains the RNA sequence encoded by the nucleotide sequence within the genome insect. Therefore, after the insect eats the stabilized RNA sequence contained in the microbial cell, it will reduce the expression level of the target gene nucleotide sequence in the insect cells. Decreasing the expression level of the nucleotide sequence results in harmful effects on the persistence, viability, proliferation, reproduction and invasiveness of the insect. The nucleotide sequence of the present invention may therefore be useful in modulating or controlling the invasion of many insects. [0080] According to yet another embodiment of the present invention, there is provided a nucleotide sequence that results in the expression of a plant cell transcription of an RNA sequence that is substantially homologous to an RNA molecule of a target gene in an insect that contains the RNA sequence encoded by the nucleotide sequence within the genome insect. Therefore, after the insect eats the stabilized RNA sequence contained in the plant cell, it will reduce the expression level of the target gene nucleotide sequence in the insect cells. Decreasing the expression level of the nucleotide sequence results in harmful effects on the persistence, viability, proliferation, reproduction and invasiveness of the insect. The nucleotide sequence of the present invention may therefore be useful in modulating or controlling the invasion of many insects in plants. [0081] The term "substantially homologous" or "substantial homology" as used herein refers to a nucleotide sequence that hybridizes under stringent conditions to a coding sequence as set forth in any of SEQ ID NOs. SEQ. 1

- 143 or in any of ID no. SEQ. 169-174 as shown in the sequence listing or their additions. Sequences that hybridize under stringent conditions with ID NO. SEQ. 1 - 143 or with ID NO. SEQ. 169

174, as shown in the list of sequences, or with their complement, are sequences enabling anti-parallel alignment between two sequences; these two sequences can then, under stringent conditions, form hydrogen bonds with the appropriate bases on the opposite strand to form a duplex molecule that is sufficiently stable under stringent conditions to be detectable using methods well known in the art. Such substantially homologous sequences preferably have 65% to 70% sequence identity, more preferably 80% to 85% sequence identity, or most preferably 90% to 95% sequence identity, to 99% sequence identity with reference sequences. nucleotide depicted in any of SEQ ID NOs. SEQ. 1 - 143 or in any of ID no. SEQ. 169-174 as shown in the sequence listing or with their complement.

[0082] The term "sequence identity", "sequence similarity" or "homology" as used herein is used to describe the relationship of a sequence between two or more nucleotide sequences. The percentage of "sequence identity" between two sequences is determined by comparing two optimally matched sequences in the comparison window, wherein some of the sequences in the comparison window may contain additions or deletions (i.e. gaps) compared to the reference sequence (which does not contain addition or deletion) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which an identical nucleic acid base or amino acid residue is present in both sequences, resulting in the number of matched positions; when the number of matching items is divided by the total number of items in the compare window and the result is multiplied by 100, the percent sequence identity is obtained. A sequence that is identical in every position relative to a reference sequence is said to be identical to the reference sequence, and vice versa. The first nucleotide sequence, when observed in the 5 'to 3' direction, is said to be 'complement' or is complementary to the second or reference nucleotide sequence observed in the 3 'to 5' direction if the first nucleotide sequence shows complete complementarity with a second or reference sequence. As used herein, nucleic acid molecule sequences are said to exhibit "complete complementarity" when each nucleotide of one of the 5 'to 3' read sequences is complementary to each nucleotide of the other sequence when read from 3 'to 5' . A nucleotide sequence that is complementary to a reference nucleotide sequence will exhibit a sequence identical to the inverted sequence complement the reference nucleotide sequence. These terms and descriptions are well defined in the art and are easily understood by those of skill in the art.

[0083] As used herein, the term "comparison window" refers to a conventionally accepted stretch of at least 6 continuous positions, typically 50 to 100, more typically 100 to 150, in which the sequence is compared to a reference sequence with the same number of continuous positions after optimal matching of two sequences. The comparison window may contain additions or deletions (i.e. gaps) of 20% or less compared to the reference sequence (which does not contain addition or deletion) for optimal alignment of the two sequences. Specialists should refer to the detailed methods used for aligning sequences in the Wisconsin Genetics Software Package Release 7.0 (Genetics Computer Group, 575 Science Drive Madison, WI, USA) or to Ausubel et al. (1998) for a detailed discussion of sequence analysis .

[0084] The target gene of the present invention is from an insect cell or, alternatively, is a foreign gene, such as a foreign genetic sequence, derived for example from a virus, fungus, insect or nematode. By "derived" it is meant that the sequence is all or part of the naturally occurring nucleotide sequence of the target gene from the genome of the insect cell, specifically, all or part of the naturally occurring nucleotide sequence provided with a capped cap, intron free and polyadenylated mRNA resulting from the expression of the naturally occurring DNA sequence that occurs in a cell when the gene is a structural gene or a sequence of all or part of the RNA, which is other than a structural gene, including, but not limited to, tRNA, catalytic RNA, ribosomal RNA, and micro-RNA. The sequence is derived from one of these naturally occurring RNA sequences, if the sequence derived therefrom is generated based on the native RNA nucleotide sequence, exhibits 80% to 100% sequence identity with the native sequence, and hybridizes with the native sequence under stringent hybridization conditions. In one embodiment, the target gene comprises the nucleotide sequence set forth in any of ID NOs. SEQ. 1 - 143 or in any of ID no. SEQ. 169-174 as shown in the list of sequences or their additions. Depending on the specific target gene and dose of dsRNA molecules delivered, this process may provide partial or complete loss of target gene function or any desired intermediate level of suppression.

[0085] The present invention also provides an artificial DNA sequence that can be expressed in a cell or microorganism and that is capable of inhibiting expression of the target gene in an insect cell, tissue or organ, wherein the artificial DNA sequence comprises at least a dsDNA molecule encoding one or more molecules different nucleotide sequences, each of the different nucleotide sequences comprises a sense nucleotide sequence and an antisense nucleotide sequence joined by a spacer sequence and encodes a dsRNA molecule according to the present invention. The spacer sequence is part of the sense nucleotide or antisense nucleotide sequence and will form a loop within the dsRNA molecule between the sense and antisense sequences. The sense nucleotide sequence or antisense nucleotide sequence is substantially identical to the nucleotide sequence of the target gene or derivative thereof, or a complement thereof. The dsDNA molecule is placed in a manner that allows it to act under the control of a promoter sequence that acts in the cell, tissue or organ of the host in which dsDNA is expressed to produce dsRNA molecules. In one embodiment, the artificial DNA sequence may be derived from the nucleotide sequence set forth in SEQ ID NO. SEQ. 1 - 143 and ID NO. SEQ. 169-174 as shown in the sequence listing.

[0086] The invention also provides an artificial DNA sequence for expression in a plant cell, which sequence, after expression of the DNA on RNA and eating by the pest, ensures suppression of the target gene in the cell, tissue or organ of the insect. dsRNA contains at least one or more structural gene sequences, each of these structural gene sequences comprising a sense nucleotide sequence and an antisense nucleotide sequence joined by a spacer that forms a loop within the complementary and antisense sequences. The sense nucleotide sequence or antisense nucleotide sequence is substantially identical to the nucleotide sequence of the target gene, its derivative, or a complement thereof. One or more structural gene sequences are placed in a manner that allows the operation of one or more promoter sequences under control, at least one of which acts in a cell, tissue or organ of a prokaryotic or eukaryotic organism, in particular an insect. In one embodiment, the artificial DNA sequence comprises from NR ID. SEQ. 1 to ID NO. SEQ. 143 and from NR

ID. SEQ. 169 to ID NO. SEQ. 174, as shown in the list of sequences or their complement.

[0087] As used herein, the term "non-naturally occurring gene", "non-naturally occurring coding sequences", "artificial sequence" or "synthetic coding sequences" for transcribing dsRNA or siRNA according to the present invention or fragments thereof refer to those genes and sequences that are produced in a method involving any type of genetic isolation or manipulation that results in the generation of a coding sequence, which is transcribed into the dsRNA or siRNA of the present invention or to fragments thereof. This includes isolating the coding sequence from its naturally occurring state, modifications of the coding sequence, by (1) insertion, deletion or nucleotide substitution, (2) insertion, deletion or segment substitution, (3) chemical synthesis, such as phosphoramidite chemical reactions, site-directed mutagenesis , shortening the coding sequence or any other method of manipulation or isolation.

[0088] The non-naturally occurring gene sequence or fragment thereof according to this aspect of the invention for controlling WCR can be cloned between two tissue specific promoters, such as two root specific promoters that can act in and express the transgenic plant cell to produce in the plant cell transgenic mRNA that is formed there into dsRNA molecules. The dsRNA molecules contained in plant tissues are eaten by insects, so that the intended suppression of expression of the target gene is achieved.

[0089] The present invention also provides a method of obtaining a nucleic acid comprising a nucleotide sequence for producing dsRNA or siRNA according to the present invention. In a preferred embodiment, the method of the present invention for obtaining a nucleic acid comprises: (a) screening a cDNA or gDNA library using a hybridization probe containing all or part of the nucleotide sequence or homologue thereof from the target insect; (b) identifying a DNA clone that hybridizes with the hybridization probe; (c) isolating the DNA clone identified in step (b); and (d) sequencing the cDNA or gDNA fragment that contains the clone isolated in step (c), wherein the sequenced nucleic acid molecule is transcribed into all or a substantial portion of the RNA nucleotide sequence or homologue thereof.

[0090] In another preferred embodiment, the method of the present invention for producing a nucleic acid fragment comprising a nucleotide sequence for producing a substantial dsRNA or siRNA portion of the present invention comprises: (a) synthesizing a first and second oligonucleotide primer corresponding to a portion of one of the target insect nucleotide sequences; and (b) amplifying the cDNA or gDNA insert present in the cloning vector using the first and second oligonucleotide primers of step (a), wherein the amplified nucleic acid molecule is transcribed to a substantial portion of the major portion of the dsRNA or siRNA of the present invention.

[0091] In carrying out the present invention, the target gene may be from corn rootworm (CRW), such as WCR or SCR, or any insect species that causes crop damage and consequent crop loss. The present inventors believe that a number of criteria can be used to select preferred target genes. A gene is the gene whose protein product has a high turnover rate, so that inhibition by dsRNA will cause a rapid decrease in the level of protein. In some embodiments, it is preferable to select a gene for which a slight decrease in expression level results in harmful effects for insects. If it is desirable to target a wide range of insect species, a gene is selected that is highly conserved between these species. In contrast, in order to give specificity, in some embodiments of the invention, a gene is selected that contains regions that are poorly conserved between individual insect species or between insects and other organisms. In some embodiments, it may be desirable to select a gene that has no known homologues in other organisms.

[0092] The term "derived from" as used herein refers to a specific nucleotide sequence that can be obtained from a specific, specific source or species, but not necessarily directly from that specific source or species.

[0093] In one embodiment, a gene is selected that is expressed in the insect's gut. By targeting genes expressed in the gut, the requirement for dsRNA to spread in the insect is avoided. Target genes for use in the present invention may include, for example, those genes that exhibit substantial homology with the nucleotide sequences of known gut-expressing genes that encode protein components of cellular proton V-ATPase (Dow et al., 1997, J. Exp. Biol., 200: 237-245; Dow, Bioenerg. Biomemb., 1999, 31: 75-83). This protein complex is the only energy provider for epithelial ion transport and is responsible for the alkalization of the lumen of the middle intestine. V-ATPase is also expressed in Malpighi's coils - insects large intestine bumps, which play a role in maintaining fluid balance and detoxifying foreign compounds in a manner analogous to mammalian kidneys. [0094] In another embodiment, a gene is selected that plays an important role in insect growth, development and reproduction. Exemplary genes include, but are not limited to, the CHD3 gene and the β-tubulin gene. The CHD3 gene in Drosophila melanogaster encodes a protein with ATP-dependent DNA helicase activity that is involved in the assembly / disassembly of chromatin in the nucleus. Similar sequences have been detected in various organisms such as Arabidopsis thaliana,

Caenorhabditis elegans and Saccharomyces cerevisiae. The beta-tubulin gene family codes for microtubule associated proteins, which are a component of the cellular cytoskeleton. Related sequences are found in such different organisms as Caenorhabditis elegans and Manduca sexta.

[0095] Other target genes for use in the present invention may include, for example, genes that play an important role in viability, growth, development, reproduction and infectivity. These target genes may be genes selected from primary metabolism genes, transcription factors and insect-specific or lethal genes for Drosophila knockout mutations. Target genes for use in the present invention may also be genes from other organisms, e.g. from nematode (e.g. C. elegans). In addition, the nucleotide sequences for use in the present invention may also be derived from plant, viral, bacterial or fungal genes whose functions have already been established from the literature, and whose nucleotide sequences have a fundamental similarity to the target genes in the insect genome. In accordance with one aspect of the present invention for controlling WCR, target sequences may generally be derived from the target WCR insect. Some of the exemplary target sequences from the WCR cDNA library that encode proteins or fragments thereof from D. v. Virgifera, which are homologues of known proteins, can be found in the sequence listing.

[0096] D. virgifera nucleic acid molecules encoding homologues of known proteins are known (Andersen et al., U.S. Patent Application Serial No. 10 / 2055,189).

[0097] Although the sequences described in Andersen et al refer primarily to WCR, it is preferable to use DNA segments in the practice of the invention whose sequences have at least 80% identity, at least 90% identity, at least 95% identity. , at least from 98% identity or at least 100% identity with sequences corresponding to genes or coding sequences in the pest that is desired to be controlled. Sequences less than 80% identical to the target gene are less effective.

Inhibition is specific for the pest gene or genes to which the dsRNA sequence corresponds. The expression of unrelated genes is not affected. This specificity allows selective targeting of the pest species, resulting in no effect on other organisms exposed to the compositions of the present invention.

[0098] The length of DNA segment for use in the present invention is from 19 to 23 or from 23 to 100 nucleotides, but less than 2,000 nucleotides.

[0099] The invention is not limited to the specific genes described herein, but includes any gene whose inhibition has a harmful effect on insect pests.

[0100] For many insects that are potential control targets of the present invention, information regarding the sequence of most genes or a phenotype resulting from mutations of specific genes may be limited. In this regard, the present inventors recognize that the selection of appropriate genes from insect pests for use in the present invention can be made by using information available from testing of relevant genes in a model organism such as Drosophila, in some other insect species or even in nematode species, fungal species, plant species in which the properties of genes have been known. In some cases, it will be possible to obtain the appropriate target insect gene sequence by searching databases such as GenBank, using either the gene name or sequence, for example Drosophila, other insect, nematode, fungus or plants from which the gene has been cloned. Once the sequence has been obtained, PCR may be used to amplify the appropriately selected segment of the insect gene for use in the present invention.

[0101] In order to obtain a stretch of DNA from an appropriate gene from an insect species, PCR primers are designed based on the sequence detected in the WCR or other insects from which the gene has been cloned. Primers are designed to amplify a DNA segment of suitable length for use in the present invention. DNA (either genomic DNA or cDNA) is produced from a given insect species and PCR primers are used to amplify the DNA segment. The amplification conditions are selected such that amplification will occur even when the primers do not perfectly match the target sequence. Alternatively, the gene (or portion thereof) may be cloned from a gDNA or cDNA library generated from a pest-insect species, using the WCR gene or a gene of another known insect as a probe. Techniques for performing PCR and cloning from libraries are known. Further details of the process in which DNA segments from the target pest-insect species can be isolated based on the sequence of genes previously cloned from WCR or other insect species are given in the examples. The skilled person will recognize that various techniques can be used to isolate gene segments from insect-pest species that correspond to genes previously isolated from other species.

[0102] Insects that can cause damage to plants can generally be assigned to one of three categories based on their diet; these three categories are chewing, sucking and drilling insects respectively, which belong to the orders of Coleoptera, Lepidoptera, Diptera, Orthoptera, Heteroptera,

Ctenophalides, Arachnidiae and Hymenoptera. Chewing insects eat plant tissue such as roots, leaves, flowers, buds and twigs, causing considerable damage. Examples of this large category of insects include beetles and their larvae. WRC and SCR are chewing insects. Their larvae feed on the roots of plants, especially corn plants, and adults mainly on the leaves. Genes derived from WCR or SCR or from any species of the aforementioned orders may be considered as objectives of the present invention.

[0103] It has been found that the method of the present invention is useful for protecting seeds and plants from a wide range of crop pests, including insects, mites, fungi, yeasts, molds, bacteria, nematodes, weeds and parasitic and saprophytic plants.

[0104] When the target pest for the present invention is an insect, such pests include, but are not limited to, insects:

from the order Lepidoptera, for example Acleris spp., Adoxophyes spp., Aegeria spp., Agrotis spp., Alabama argillaceae, Amylois spp., Anticarsia gemmatalis, Archips spp, Argyrotaenia spp., Autographa spp., Busseola fusca, Cadra cautella, Carposina nipponensis,

Chilo spp., Choristoneura spp., Clysia ambiguella,

Cnaphalocrocis spp., Cnephasia spp., Cochylis spp., Coleophora spp., Crocidolomia binotalis, Cryptophlebia leucotreta, Cydia spp., Diatraea spp., Diparopsis castanea, Earias spp., Ephestia spp., Euctlama Eucosma ., Euxoa spp., Grapholita spp., Hedya nubiferana, Heliothis spp., Hellula undalis, Hyphantria cunea, Keiferia lycopersicella, Leucoptera scitella, Lithocollethis spp., Lobesia botrana, Lymantria spp., Lyonetia sppica, Malacos spp., Malacos spp. . Manduca sexta, Operophtera spp., Ostrinia nubilalis, Pammene spp., Pandemis spp., Panolis flammea, Pectinophora gossypiella, Phthorimaea operculella, Pieris rapae, Pieris spp., Plutella xylostella, Prays spp.,

Scirpophaga spp., Sesamia spp., Sparganothis spp., Spodoptera spp., Synanthedon spp., Thaumetopoea spp., Tortrix spp., Trichoplusia ni and Yponomeuta spp .;

from the order of Coleopter, for example Agriotes spp., Anthonomus spp., Atomaria linearis, Chaetocnema tibialis, Cosmopolites spp., Curculio spp., Dermestes spp., Diabrotica spp., Epilachna spp., Eremnus spp., Leptinotarsa ​​decemlinetr. .

<td>melolontha</td><td>spp.</td><td>Orycaephilus spp.,</td><td>Otiorhynchus</td><td>spp.</td>

<td>Phlyctinus</td><td>spp.</td><td>Popillia spp.,</td><td>Psylliodes</td><td>spp.</td>

<td>Rhizopertha</td><td>spp</td><td>., Scarabeidae,</td><td>Sitophilus</td><td>spp.</td>

<td>Sitotroga</td><td>spp.</td><td>Tenebrio spp.,</td><td colspan="2">Tribolium spp. I</td>

<td>Trogoderma</td><td>spp .;</td><td></td><td></td><td></td>

from the Orthoptera order, for example Blatt spp.,

Blattella spp., Gryllotalpa spp., Leucophaea maderae,

Locusta spp., Periplaneta ssp. And Schistocerca spp .;

from the order Isoptera, for example Reticulitemes ssp; from the order of Psocoptera, for example Liposcelis spp .; from the order Anoplura, for example Haematopinus spp.,

Linognathus spp., Pediculus spp., Pemphigus spp. And Phylloxera spp .;

from the order Mallophaga, for example Damalinea spp. and Trichodectes spp .;

from the order of Thysanoptera, for example Franklinella spp., Hercinothrips spp., Taeniothrips spp., Thrips palmi, Thrips tabaci and Scirtothrips aurantiii;

from the Heteroptera order, for example Cimex spp., Distantiella theobroma, Dysdercus spp., Euchistus spp., Eurygaster spp., Leptocorisa spp., Nezara spp., Piesma spp., Rhodnius spp., Sahlbergella singularis,

Scotinophara spp., Triatoma spp., Family Miridae spp., For example species such as Lygus hesperus and Lygus lineoloris, family Lygaeidae spp., E.g. species such as Blissus leucopterus and family Pentatomidae spp .;

from the order Homoptera, for example Aleurothrixus floccosus, Aleyrodes brassicae, Aonidiella spp.,

Aphididae, Aphis spp., Aspidiotus spp., Bemisia tabaci, Ceroplaster spp., Chrysomphalus aonidium, Chrysomphalus dictyospermi, Coccus hesperidum, Empoasca spp.,

Eriosoma larigerum, Erythroneura spp., Gascardia spp., Laodelphax spp., Lacanium corni, Lepidosaphes spp., Macrosiphus spp., Myzus spp., Spp., Paratoria spp.

Nehotettix

Pemphigus spp.

spp.

Nilaparvata

Planococcus spp., Pseudaulacaspis spp., Pseudococcus spp.

Psylla ssp.

Pulvinaria aethiopica,

Quadraspidiotus spp., Rhopalosiphum spp., Saissetia spp., Scaphoideus spp., Schizaphis spp., Sitobion spp., Trialeurodes vaporariorum, Trioza erytreae and Unaspis citri;

from the order of the Hymenoptera, e.g. Acromyrmex, Atta spp., Cephus spp., Diprion spp., Diprionidae, Gilpinia polytoma, Hoplocampa spp., Lasius sppp., Monomorium pharaonis, Neodiprion spp, Solenopsis spp. and Vespa ssp .;

from the order of the Dipter, for example Aedes spp.,

Antherigona soccata, Bibio hortulanus, Calliphora erythrocephala, Ceratitis spp., Chrysomyia spp., Culex spp., Cuterebra spp., Dacus spp., Drosophila melanogaster, Fannia spp., Gastrophilus spp., Glossina spp., Hypodypa ., Liriomysa spp., Lucilia spp., Melanagromyza spp., Musca ssp., Oestrus spp., Orseolia spp., Oscinella frit, Pegomyia hyoscyami, Phorbia spp., Rhagoletis pomonella, Sciara spp., Stomoxys spp., Tabanus spp. , Tannia spp. And Tipula spp .;

from the order of the Siphonaptera, for example Ceratophyllus spp. and Xenopsylla cheopis, and from the order of Thysanura, for example Lepisma saccharina.

[0105] The present invention has been found to be particularly effective when the insect pest is Diabrotica spp., And in particular, when the pest is Diabrotica virgifera virgifera (western corn rootworm, WCR), Diabrotica barberi (northern corn rootworm, NCR, ang Northern Corn Rootworm), Diabrotica virgifera zeae (Mexican corn beetle, MCR, English

Mexican Corn Rootworm), Diabrotica balteata (Brazilian Corn Rootworm), Brazilian Corn Rootworm complex (BCR, Brazilian Corn Rootworm complex) consisting of Diabrotica viridula and Diabrotica speciosa) or Dimpia broth southern corn beetle, SCR, Southern Corn Rootworm).

[0106] The present invention is also particularly effective in controlling insect species that pierce and / or suck fluids from plant cells and tissues, such as but not limited to bugs (Pentatomidae family) and Scabbard family

Miridae, e.g. Lygus hesperus (western tarnished plant bug), Lygus lineolaris (tarnished plant bug) and Lygus elisus (pale legume bug).

[0107] Modifications to the methods disclosed herein are surprisingly particularly useful in controlling butterfly pests.

[0108] The present invention provides stabilized dsRNA or siRNA molecules to combat invasion. The nucleotide sequences of the dsRNA or two polymerized strands may contain a sugar phosphate backbone,

Modifications to the RNA structure can be tailored to specific genetic inhibition.

[0109] In one embodiment, the dsRNA molecules can be modified by an enzymatic process such that siRNA molecules can be produced. siRNA can pest-insects.

siRNAs contain ribonucleotides and modifications of either the nucleoside.

effectively mediate in reducing the expression level of some target genes in some insects. This enzymatic process can be carried out through the use of the RNAse III enzyme or Dicer enzyme present in the cells of insects, vertebrate animals, fungi or plants in the eukaryotic RNAi pathway (Elbashir et al., 2002, Methods, 26 (2): 199-213; Hamilton and Baulcombe, 1999, Science 286: 950-952). This process may also utilize recombinant Dicer or RNAse III introduced into target insect cells via recombinant DNA techniques that are well known to those skilled in the art. Both the Dicer enzyme and RNase III, as naturally occurring in the insect or produced using recombinant DNA techniques, cut larger strands of dsRNA into smaller oligonucleotides. Dicer enzymes specifically cut dsRNA molecules into siRNA pieces, each of which is 19-25 nucleotides long, while RNase III enzymes typically cleave dsRNA molecules into siRNA composed of 12-15 base pairs. SiRNA molecules produced by any of these enzymes have 3 'overhangs of 2-3 nucleotides and 5'-phosphate and 3'-hydroxyl ends. The siRNA molecules produced by RNAse III are the same as the molecules produced by Dicer enzymes in the eukaryotic RNAi pathway, so they become targets and are degraded by the intracellular mechanism of RNA degradation, after which they are developed, separated into single-stranded RNA and hybridized with transcribed RNA sequences by the target gene. The result of this process is the effective degradation or removal of the RNA sequence encoded by the nucleotide sequence of the target gene in an insect.

The result is silencing nucleotide sequences specifically targeted at the insect. Detailed descriptions of enzymatic processes can be found in Hannon (2002, Nature, 418: 244-251).

[0110] Inhibition of the target gene using the stabilized dsRNA technologies of the invention is sequence specific, as the goal of genetic inhibition are nucleotide sequences corresponding to the duplex region in RNA. RNA containing nucleotide sequences identical to a portion of the target gene is preferred for inhibition. RNA sequences with insertions, deletions and single point mutations relative to the target sequence have also been found to be effective in inhibiting. In carrying out the present invention, it is preferred that the inhibitory dsRNA and a portion of the target gene exhibit at least 80% sequence identity, from 90% sequence identity, 95% sequence identity or from 99% sequence identity, and even 100% sequence identity. Alternatively, the duplex region in RNA may be defined in terms of function as a nucleotide sequence that is capable of hybridizing to the transcript portion of the target gene. A sequence smaller than full length, showing greater homology, compensates for a longer, less homologous sequence. The length of identical nucleotide sequences can be at least 25, 50, 100, 200, 300, 400, 500 or at least 1000 bases. Usually a sequence of more than 20-100 nucleotides should be used, although a sequence of more than 200-300 nucleotides would be preferred, and a sequence of more than 500-1000 nucleotides would be particularly preferred, depending on the size of the target gene. The invention has the advantage that it can tolerate sequence variation that would be expected due to genetic mutations, strain polymorphism or evolutionary divergence. The introduced nucleic acid molecule does not have to be absolutely homologous, it does not have to be full-length, either with respect to the original transcription product or with respect to the fully processed target gene mRNA. Therefore, those skilled in the art should know, as disclosed herein, that 100% sequence identity between RNA and the target gene is not necessary for carrying out the present invention.

[0111] dsRNA molecules can be synthesized either in vivo or in vitro. dsRNA can be formed by one internally complementary RNA strand or two complementary RNA strands. Endogenous RNA polymerase of the cell can mediate in vivo transcription, or cloned RNA polymerase can be used for in vivo or in vitro transcription. Inhibition can be targeted by specific transcription in an organ, tissue or cell type; stimulation with environmental conditions (e.g. infection, stress, temperature, chemical inducers); and / or causing transcription to occur at a given stage of development or age. RNA strands may or may not be polyadenylated; RNA strands may or may not be able to be translated into the polypeptide by the cell's translation apparatus.

[0112] RNA, dsRNA, siRNA or miRNAs of the present invention can be produced chemically or enzymatically by a specialist, by manual or automated reactions, or in vivo in another organism. RNA can be produced partially or completely by organic synthesis; any modified ribonucleotide may be introduced by in vitro enzymatic or organic synthesis. RNA can be synthesized by cellular RNA polymerase or bacteriophage RNA polymerase (e.g. T3, T7, SP6). The use and production of an expression construct are known in the art (see for example WO 97/32016; US Patent Nos. 5,593,874, 5,698,425, 5,712,135, 5,789,214 and 5,804,693). For chemical synthesis or in vitro enzymatic synthesis, RNA can be purified before entering the cell. For example, RNA can be purified from the mixture by using solvent or bed extraction, precipitation, chromatography, electrophoresis, or a combination thereof. Alternatively, RNA can be used without purification or with minimal purification to avoid losses due to sample processing. RNA can be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to facilitate binding and / or stabilization of the duplex strand. For transcription from an in vivo transgene or expression construct, a regulatory region (e.g. promoter, enhancer, polyadenylation silencer). In one embodiment, the nucleotide sequences for use at and region sequences for producing RNA molecules can thus be operably linked to one or more promoter sequences acting on the microorganism, fungus or plant-host cell. Ideally, the nucleotide sequences are placed under the control of an endogenous promoter normally found in the host genome. The nucleotide sequence of the present invention, under the control of the promoter operably linked, may also be flanked by additional sequences that advantageously affect its transcription and / or stability of the resulting transcript. Such sequences are generally located upstream of the promoter and / or below the 3 'end of the expression construct and may occur both above the promoter and below the 3' end of the expression construct, although such a sequence is only considered on the 5 'side .

[0113] In another embodiment, the nucleotide sequence of the present invention may comprise an inverted repeat separated by a "spacer sequence". The separating sequence may be a region comprising any nucleotide sequence that facilitates the formation of a secondary structure between each repetition where required. In one embodiment of the present invention, the spacer sequence is part of the sense or antisense mRNA coding sequence. Alternatively, the spacer sequence may contain any combination of nucleotides or homologues thereof which may be covalently linked to the nucleic acid molecule. The spacer sequence may comprise a nucleotide sequence of at least 10-100 nucleotides in length or, alternatively, at least 100-200 nucleotides in length, at least about 200400 nucleotides in length or at least 400-500 nucleotides in length.

[0114] For the purposes of this invention, dsRNA or siRNA molecules can be obtained from CRW by polymerase chain reaction (PCR) amplification of the target CRW gene sequence derived from the corn root beetle gDNA or cDNA library or part thereof. WCR larvae can be obtained using methods known to the skilled person and DNA / RNA can be extracted. Larvae of various sizes can be used for DNA / RNA extraction for the purposes of the present invention, ranging from 1. larval stage to completely adult CRW. Genomic DNA or cDNA libraries obtained from WCR can be used for PCR amplification to produce dsRNA or siRNA.

[0115] Target genes can then be amplified by PCR and sequenced using methods readily available in the art. The skilled person can easily modify the PCR conditions to ensure optimal formation of the PCR product.

The confirmed PCR product can be used as an in vitro transcription template to generate sense and antisense RNA using its minimal promoters.

[0116] The inventors of the present invention contemplate that nucleic acid sequences can be used to control WCR and other target insects in the present invention, for example in nucleic engineering, identified and isolated from any insect species in the insect kingdom. In one aspect of the present invention, the nucleic acid may be from a species belonging to the thick-coat. Specifically, the nucleic acid may be derived from the beetles belonging to the genus Diabrotica (Coleoptera, Chrysomelidae), and more specifically, the nucleic acid molecules of the present invention may be from virgifera species. More specifically, the nucleic acid molecules of the present invention may be derived from Diabrotica virgifera virgifera LeConte, which is usually referred to as WCR. The isolated acids may be useful on the target gene and the recombinant vector that produces the stabilized dsRNA or siRNA of the present invention, for protecting plants against WCR insect invasion.

[0117] In one embodiment, the present invention thus includes isolated and purified nucleotide sequences from WCR or from a gauge (Lygus) that can be used as insect control agents. Isolated and purified nucleotide sequences include the sequences set forth in SEQ ID NO. SEQ. 1 - 143 or in ID NO. SEQ. 169-174 as shown in the sequence listing.

[0118] Nucleic acids from WCR or other insects that can be used in the present invention may also contain isolated and substantially purified Unigene and EST nucleic acid molecules or molecules that are a fragment of these nucleic acids. EST nucleic acid molecules can encode a significant portion or, in fact, most of the polypeptides.

Alternatively, the fragments may contain a smaller nucleic acid "or purified oligonucleotide sequence containing from 15 to 250 nucleotide residues, and more preferably, from 15 to 30 nucleotide residues. Alternatively, the nucleic acid molecules for use in the present invention may be derived from WCR cDNA libraries, a sensor or other invertebrate pest species.

[0119] As used herein, the phrase "substantially purified nucleic acid", "artificial sequence", "substantially purified and isolated" isolated and substantially nucleotide "refers to a nucleic acid that is no longer accompanied by some of the materials with which it is naturally associated or acid nucleic acid with a structure that is not identical to any of the naturally occurring nucleic acid structures. Examples of a substantially purified nucleic acid include: (1) DNA that has a sequence of parts of naturally occurring genomic DNA molecules but is not flanked by two coding sequences that flank that portion of the molecule in the genome of the naturally occurring organism; (2) the nucleic acid incorporated into the vector or into the genomic DNA of the prokaryotic or eukaryotic organism in such a way that the resulting molecule is not identical to any of the naturally occurring vectors or genomic DNA; (3) a separate molecule such as a cDNA, genomic fragment, fragment produced by polymerase chain reaction (PCR) or restriction fragment, (4) recombinant DNA; and (5) synthetic DNA.

A substantially purified nucleic acid may also contain one or more cDNA, genomic DNA or synthetic DNA segments.

[0120] Nucleic acid molecules and fragments thereof from WCR, tag or other species of invertebrate pests can be used to obtain other nucleic acid molecules from other species for use in the present invention to produce the desired dsRNA and siRNA molecules. Such nucleic acid molecules include nucleic acid molecules that encode the entire protein coding sequence as well as promoters and flanking sequences of such molecules. In addition, such nucleic acid molecules include nucleic acid molecules that encode members of the gene family. Such molecules can easily be obtained by using the above-described nucleic acid molecules or fragments thereof to screen cDNA or gDNA libraries obtained from D. v. Virgifera or Lygus hesperus. Methods for producing such libraries are well known in the art.

[0121] Nucleic acid molecules and fragments thereof from the WCR or a substitute can also be used to obtain other nucleic acid molecules, such as nucleic acid homologues for use in the present invention to produce the desired dsRNA and siRNA molecules. Such homologues include nucleic acid molecules that encode, in whole or in part, homologues of proteins of other species, plants or other organisms. Such molecules can easily be obtained by using the above-described nucleic acid molecules or fragments thereof to screen EST, cDNA or gDNA libraries. Methods for producing such libraries are well known in the art. Such homologue molecules may differ in nucleotide sequence from molecules in one or more of ID NOs. SEQ. 1 - 143 and ID NO. SEQ. 169 174, as shown in the list of sequences or their complements, because complete complementarity is not necessary for stable hybridization. These nucleic acid molecules also include molecules that, although capable of specifically hybridizing with the nucleic acid molecules, may be devoid of full complementarity. In a specific embodiment, the 3 'or 5' RACE method can be used to obtain such sequences (Frohman, MA et al. Proc. Natl. Acad Sci. (USA) 85: 8998-9002 (1988); Ohara, O. et al. Proc. Natl. Acad. Sci. (USA) 86: 5673-5677 (1989)). In general, the ovine of the above-described nucleic acid molecules or fragments thereof can be used to produce dsRNA or siRNA that is suitable for use in a diet, atomizer or recombinant DNA construct of the present invention.

[0122] As used herein, the expression "coding sequence", "structural nucleotide sequence" or "structural nucleic acid molecule" refers to a nucleotide sequence that is translated into a polypeptide, usually via mRNA, when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by the translation start codon at the 5 'end and the translation stop codon at the 3' end. The coding sequence may include, but is not limited to, genomic DNA, cDNA, EST and recombinant nucleotide sequences.

[0123] The term "recombinant DNA" or "recombinant nucleotide sequence" refers to DNA that contains genetic engineering modifications by manipulation using mutagenesis and restriction enzymes.

[0124] Nucleic acid molecules, fragments of nucleic acid molecules or other WCR nucleic acid molecules are capable of specifically hybridizing with other nucleic acid molecules under certain conditions. As used herein, two nucleic acid molecules are said to be capable of specifically hybridizing to each other if the two molecules can form an anti-parallel, double-stranded nucleic acid structure. A nucleic acid molecule is said to complement another nucleic acid molecule if it shows complete complementarity. Two molecules are said to be "minimally complementary" if they can hybridize to each other with sufficient stability to allow them to remain together under conventional "low stringency" conditions. Similarly, molecules are said to be complementary if they can hybridize to each other with sufficient stability to allow them to remain together under conventional "high stringency" conditions. Conventional stringent conditions are described by Sambrook et al. And by Haymes et al. In Nucleic Acid

Hybridization, A Practical Approach, IRL Press, Washington, DC, USA (1985).

[0125] Deviations from full complementarity are therefore permissible as long as such deviations do not completely eliminate the ability of the molecules to form a double-stranded structure. Therefore, for a nucleic acid molecule or a fragment of a nucleic acid molecule to serve as a primer or probe, their sequence only needs to be complementary enough to form a stable double-stranded structure at the specific concentration of solvent and salt used.

[0126] Suitable stringency conditions that favor DNA hybridization are, for example, 6.0 x sodium chloride / sodium citrate (SSC) at 45 ° C, followed by washing in 2.0 x SSC at 50 ° C; these conditions are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley &amp; Sons, New York (1989), 6.3.1-6.3.6. For example, the salt concentration in the rinsing step can be selected from low sharpness: 2.0 x SSC at 50 ° C, to high sharpness: 0.2 x SSC at 50 ° C. In addition, the temperature in the rinsing step can be increased from low stringency conditions at room temperature (22 ° C) to high stringency conditions at 65 ° C. Both temperature and salt may be subject to change or the temperature or concentration of salt may be kept constant while another variable is being changed.

[0127] The nucleic acid for use in the present invention may specifically hybridize to one or more nucleic acid molecules with WCR or their complementary sequences under moderately stringent conditions, for example at 2.0 x SSC and 65 ° C. The nucleic acid for use in the present invention will include those nucleic acid molecules that specifically hybridize to one or more of the nucleic acid molecules disclosed herein as set forth in SEQ ID NOs. SEQ. 1 - 143 and ID NO. SEQ. 169 - 174, as shown in the list of sequences or their complements under high stringency conditions. Preferably, the nucleic acid for use in the present invention will have at least 80%, at least 90%, at least 95%, at least 98% or even 100% sequence identity with one or more nucleic acid molecules depicted in ID NO. SEQ. 1 - 143 and ID NO. SEQ. 169 - 174 as set out in the sequence listing or as disclosed herein; or the nucleic acid for use in the present invention will have from 80%, from at least 90%, from at least 95%, from at least 98% or even 100% sequence identity to one or more of the nucleic acid molecules set out in SEQ ID NOs. SEQ. 1 - 143 and ID NO. SEQ. 169 - 174, as shown in the sequence listing, isolated from the insect pest genomic DNA.

[0128] All or a substantial portion of the WCR nucleic acids can be used to isolate cDNA, gDNA and nucleic acids encoding homologues of Diabrotica proteins or fragments thereof from the same or different species. Detailed descriptions of the techniques for isolating and identifying nucleic acids of the present invention from cDNA or gDNA libraries are disclosed in the examples.

[0129] Nucleic acids of the invention may also be synthesized, either completely or partially, in particular when it is desired to provide plants preferred sequences using methods known in the art. All or part of the nucleic acid of the present invention can therefore be synthesized using codons preferred by the host of choice.

Codons preferred by a given species can be determined, for example, from the codons most commonly used in proteins expressed by a particular host species. Other modifications of the nucleotide sequences may result in mutants with slightly changed activity. [0130] The present invention provides, in part, a delivery system for delivering insect control agents to insects. The stabilized dsRNA or siRNA molecules of the present invention may be introduced directly into insect cells or introduced into the extracellular cavity, interstitial space, lymphatic system, gastrointestinal tract, into the circulation of the insect by oral ingestion or other means that a specialist can use. Methods of oral introduction may include direct mixing of RNA with the food of this insect, as well as genetic engineering methods in which the species that is used as food is manipulated to express dsRNA or siRNA and then feed the insect on which you want to influence. In one embodiment, the dsRNA or siRNA molecules, for example, can be incorporated into the insect's food or applied to the top of the insect's food. In another embodiment, RNA may be sprayed onto the surface of the plant. In yet another embodiment, the dsRNA or siRNA may be expressed in the microorganism and the microorganism may be applied to the surface of the plant or introduced into the root or stem using physical means such as injection. In yet another embodiment, the plant may be genetically engineered to express dsRNA or siRNA in an amount sufficient to kill insects known to infect plants.

[0131] Specifically, in carrying out the present invention in WCR, stabilized dsRNA or siRNA can be introduced into the intestinal median inside the insect and achieve the desired inhibition of target genes. The dsRNA or siRNA molecules can be incorporated into food or applied to food as discussed above, and can be eaten by insects. In any case, dsRNAs of the present invention are provided in the target pest food. The target pest of the present invention will have a gastrointestinal pH of 4.5 to 9.5, 5 to 8.5, 6 to 8, from

6.5 to 7.7 or 7.0. The digestive tract of the target pest is defined herein as a place within the pest organism where food that has been eaten by the insect pest is exposed to an environment that is beneficial to the uptake of dsRNA molecules according to the invention and does not expose them to pH so extreme that would dissociate hydrogen bonds between dsRNA double strands to form single-stranded molecules.

[0132] In addition, another method of plant protection for insects in plants is to combat insects by invading supply of dsRNA on plant surfaces by applying a spray. In this fermentation bacterium by engineering methods as well as agents protect dsRNA from UV protection, UV damage.

case can be subjected to a previously transformed genetic, so as to produce and accumulate dsRNA, and from fermentation products to produce a spray product compatible with commonly used practices in agriculture. The compositions may contain suitable adhesives and wetting agents required for efficient coating of the leaves to

Such additives are widely used in the biological insecticide industry and are well known to those skilled in the art. Similarly, compositions for administration to the soil may include granular compositions that serve as baits for soil larvae of insect pests, such as corn rootworm.

[0133] It is also anticipated that from dsRNA obtained by chemical or enzymatic synthesis, compositions can be prepared in a manner consistent with commonly used agricultural practices and used as spray products to combat insect invasion. The compositions may contain suitable adhesives and wetting agents required for efficient leaf coverage, as well as UV protective agents to protect dsRNA from UV damage. Such additives are insecticides to specialists.

commonly used in the biological industry and are well known. Such applications could be combined with other applications of the sprayed insecticide, biological or not, to increase plant protection against damage caused by insect feeding. [0134] The present inventors believe that bacterial strains producing insecticidal proteins may be used to produce dsRNA for insect control purposes. These strains may have improved insect control properties. A variety of bacterial hosts can be used to produce dsRNA for insect control. Exemplary bacteria may include E. coli, B. thuringiensis, Pseudomonas sp., Photorhabdus sp., Xenorhabdus sp., Serratia entomophila and related Serratia sp., B. sphaericus, B. cereus,

B. laterosporus, B. popilliae, Clostridium bifermentans and other Clostridium species or other spore-forming Gram-positive bacteria.

[0135] The present invention also relates to recombinant DNA constructs for expression in a microorganism. Exogenous nucleic acids from which the RNA of interest is transcribed can be introduced into a host microorganism cell, such as a bacterial cell or fungal cell, using methods known in the art.

[0136] The nucleotide sequences of the present invention can be introduced into various prokaryotic and eukaryotic host microorganisms to produce stabilized dsRNA or siRNA molecules.

The term "microorganism" includes prokaryotic and eukaryotic species of microorganisms such as bacteria and fungi. Mushrooms include, but are not limited to, yeast and filamentous fungi. Examples of both Gram-negative and Gram-positive prokaryotes are Enterobacteriaceae, such as Escherichia,

Erwinia, Shigella, Salmonella and Proteus; Bacillaceae; Rhizobiceae such as Rhizobium; Spirillaceae, such as Photobacterium, Zymomonas, Serratia, Aeromonas, Vibrio, Desulfovibrio, Spirillum; lactobacillaceae;

Pseudomonadaceae such as Pseudomonas and Acetobacter; Azotobacteraceae, Actinomycetales and Nitrobacteraceae. Eukaryotes include fungi such as Phycomycetes and Ascomycetes, which include yeast such as

Saccharomyces and Schizosaccharomyces; and Basidiomycetes yeast such as Rhodotorula, Aureobasidium and Sporobolomyces.

[0137] In order to protect plants from insects, many microorganisms known to inhabit the philosphere (plant leaf surface) and / or rhizosphere (soil surrounding plant roots) of many different important crop plants may also be desirable host cells for manipulation, propagation , storage, delivery and / or mutagenesis of the disclosed recombinant constructs. These microorganisms include bacteria, algae and fungi. Of particular interest are microorganisms such as bacteria, e.g. of the genus Bacillus (including B. thuringiensis kurstaki HD-1 species and subspecies, B. thuringiensis kurstaki HD-73, B. thuringiensis sotto,

B. thuringiensis berliner, B. thuringiensis

Acetobacter

Rhodobacter thuringiensis, B. thuringiensis tolworthi, B.

thuringiensis dendrolimus, B. thuringiensis alesti, B. thuringiensis galleriae, B. thuringiensis aizawai, B. thuringiensis subtoxicus, B. thuringiensis entomocidus,

B. thuringiensis tenebrionis and B. thuringiensis san diego); Pseudomonas, Erwinia, Serratia, Klebsiella, Zanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas, Methylophilius, Agrobacterium, Acetobacter,

Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc and Alcaligenes; fungi, especially yeast, e.g. genera Saccharomyces, Cryptococcus, Kluyveromyces,

Sporobolomyces, Rhodotorula and Aureobasidium.

Of particular interest are phytosphere bacterial species such as Pseudomonas syringae, Pseudomonas fluorescens, Serratia marcescens, xylinum, Agrobacterium sphaeroides, Xanthomonas

Rhizobium melioti, Alcaligenes eutrophus and Azotobacter vinlandia; and phytosphere yeast species such as Rhodotorula rubra, R. glutinis, R. marina, R. aurantiaca, Cryptococcus albidus, laurentii, Saccharomyces rosei, S.

cerevisiae, Sporobolomyces roseus, S. odorus,

Kluyveromyces veronae and Aureobasidium pollulans.

[0138] The bacterial vector for the recombinant DNA may be a linear or circular plasmid. The vector system can be a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the bacterial host. In addition, the bacterial vector may be an expression vector.

tumefaciens, campestris,

C. diffluens, C.

pretoriensis, S.

The nucleic acid molecules set out in SEQ ID NO. SEQ. 1 - 143 and ID NO. SEQ. 169 - 174, as shown in the sequence list, or fragments thereof, can, for example, be inserted into the vector appropriately under the control of a suitable promoter that acts in one or more microbial hosts, directing the expression of the attached coding sequence or other DNA sequences. Many vectors are available for this purpose, and the choice of the appropriate vector will mainly depend on the size of the nucleic acid to be inserted into the vector and the specific host cell to be transformed with the vector. Each vector contains different components depending on their function (DNA amplification or DNA expression) and the specific host cell with which it is compatible. Vector elements for bacterial transformation generally include, but are not limited to, one or more of the following: signal sequence, origin of replication, one or more selectable marker genes, and an inducible promoter allowing expression of exogenous DNA.

[0139] Expression and cloning vectors generally contain a selection gene, also referred to as a selection marker. This gene codes for the protein necessary for the survival or growth of transformed host cells cultured in selective culture medium. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g. ampicillin, neomycin, methotrexate or tetracycline, (b) supplement auxotrophic deficiencies or (c) provide key nutrients not available in complex media, such as the gene encoding Bacilli D-alanine racemase. Cells that have been successfully transformed with a heterologous protein or fragment thereof produce a protein that confers resistance to the drug, so they survive the selection regime.

[0140] The expression vector for mRNA production may also contain an inducible promoter that is recognized by the bacterial host and operably linked to a nucleic acid encoding, for example, a nucleic acid molecule encoding the mRNA of interest or a fragment from D. v. virgifera. Inducible promoters suitable for use with bacterial hosts include the β-lactamase promoter, P promoters_L and P._R E. coli λ phage and galactose promoter, arabinose promoter, alkaline phosphatase promoter, E. coli tryptophan promoter (TRP) and lactose operon promoter, and variants and hybrid promoters such as the tac promoter. However, other known inducible bacterial promoters are also suitable.

[0141] The term "operably linked", when used in reference to regulatory and structural nucleotide, means that the sequence causes regulated expression to the sequence of the nucleotide-linked regulatory sequence. The structural sequence terms 'regulatory sequences' or 'control elements' refer to the nucleotide sequences upstream (non-coding sequences on the 5 'side), within or below (non-translated sequences on the 3' side) of the structural nucleotide sequence that affects time the occurrence and level or amount of transcription, processing or stability of RNA or translation of the associated structural nucleotide sequence. Regulatory sequences may include promoters, translation leader sequences, introns, enhancers, stem and loop structures, repressor binding sequences, and polyadenylation recognition sequences.

[0142] Alternatively, expression constructs can be incorporated into the bacterial genome using an integration vector. Integration vectors typically contain at least one sequence homologous to the bacterial chromosome that enables vector integration. Integrations appear to occur as a result of recombination between homologous DNA in the vector and the bacterial chromosome. Integration vectors constructed from the DNA of different Bacillus strains are incorporated into, for example, the Bacillus chromosome (EP 0 127.332). Integration vectors may also consist of bacteriophage or transposon sequences. Suicide vectors are also known in the art.

[0143] Standard recombinant DNA techniques are used to construct suitable vectors containing one or more of the components listed above. Isolated plasmids or DNA fragments are cleaved, endowed with appropriate ends and ligated in the form desired to produce the required plasmids. Examples of available bacterial expression vectors include, but are not limited to, multifunctional vectors for cloning and expression in E. coli, such as

Bluescript ™ (Stratagene, La Jolla, California, USA) in which a protein or a fragment thereof from D. v. Virgifera can be, for example, ligated into a vector in frame with Met amino terminal sequences and 7 consecutive β-galactosidase residues, yes, that a hybrid protein is produced; pIN vectors (Van Heeke and Schuster, 1989, J. Biol. Chem. 264: 5503-5509).

[0144] The yeast recombinant construct can typically contain one or more of the following: promoter sequence, fusion partner sequence, leader sequence, transcription termination sequence, selection marker. These elements can be combined into an expression cassette that can be maintained in a replicon, such as an extrachromosomal element (e.g. plasmids) capable of stable persistence in a host such as yeast or bacteria. The replicon may have two replication systems, which allows it to persist, for example, in yeast for expression and in a prokaryotic host for cloning and amplification. Examples of such yeast-bacterial shuttle vectors include YEp24 (Botstein et al., 1979, Gene 8: 17-24), pCl / 1 (Brake et al., 1984, Proc. Natl. Natl. Acl. Acad. Sci USA, 81: 4642 -4646) and YRp17 (Stinchcomb et al., 1982, J. Mol. Biol., 158: 157). In addition, the replicon can be a plasmid with high or low copy number. The number of copies of a plasmid with a high number of copies will generally be in the range of 5 to 200, typically from 10 to 150. A host comprising a plasmid with a high number of copies will preferably contain at least 10, and more preferably at least 20 copies.

[0145] Useful yeast promoter sequences may be derived from genes encoding enzymes in the metabolic pathway. Examples of such genes include alcohol dehydrogenase (ADH) (EP 0 284044), enolase, glucokinase, glucose-6-phosphate isomerase, glyceraldehyde-3-phosphate dehydrogenase (GAP or GAPDH), hexokinase, phosphofuctuctase, pyrophosphokinase (EP 0 3215447). The yeast PHO5 gene encoding acid phosphatase (Myanohara et al. Proc. Natl. Acad. Sci. USA, 80: 1, 1983) also provides useful promoter sequences. In addition, synthetic promoters that do not occur in nature also function as yeast promoters. Examples of such hybrid promoters include the ADH regulatory sequence attached to the GAP transcription activation region (US Patent Nos. 4,876,197 and 4,880,734). Other examples of hybrid promoters include promoters consisting of the regulatory sequences of the ADH2, GAL4, GAL10 or PHO5 genes, linked to the transcription activation region of a glycolytic enzyme gene, such as GAP or PyK (EP 0 164556). In addition, the yeast promoter may include naturally occurring promoters of non-yeast origin that have the ability to bind RNA polymerase and initiate transcription.

[0146] Examples of transcription terminator sequences and other yeast recognition termination sequences, such as sequences encoding glycolytic enzymes, are known to those skilled in the art.

[0147] Alternatively, expression constructs can be incorporated into the yeast genome using an integration vector. Integration vectors typically contain at least one yeast chromosome homologous sequence that allows the vector to be integrated, and preferably consist of two homologous sequences flanking the expression construct. Integrations appear to be the result of recombination between homologous DNA in the vector and the yeast chromosome (Orr-Weaver et al., 1983, Methods in Enzymol., 101: 228245). The integration vector can be targeted to a particular yeast locus by selecting the appropriate homologous sequence for inclusion in the vector. See Orr-Weaver et al., Supra. Integration of one or more expression constructs may occur, which may affect the level of recombinant protein produced (Rine et al., 1983, Proc. Natl. Natl. Acad. Sci. USA, 80: 6750). The chromosomal sequences contained in the vector can occur either as a single segment in the vector, which leads to the integration of the entire vector, or as two segments homologous to adjacent sections in the chromosome and flanking the expression construct in the vector, resulting in stable integration of only the expression construct.

[0148] The present invention also relates to the transformation of the nucleotide sequence of the present invention into a plant to achieve a pest-inhibiting level of expression of one or more dsRNA molecules. The transformation vector can easily be generated using methods available in the art. The transformation vector contains one or more nucleotide sequences that may / may be transcribed into the RNA molecule and is / are substantially homologous and / or complementary to one or more nucleotide sequences encoded by the insect genome, such that after transcribed RNA is taken from one or more nucleotide sequence molecules by insects, there is a reduction in the expression level of at least one of the corresponding nucleotide sequence from the insect genome.

[0149] The transformation vector may further be a dsDNA construct and may also be considered, inter alia, as a recombinant molecule, insect control agent, genetic molecule or chimeric genetic construct. The chimeric genetic construct of the present invention may contain, for example, nucleotide sequences encoding one or more antisense transcripts, one or more sense transcripts, one or more of the above-mentioned, all or part of the transcripts derived therefrom being homologous to all or part of the RNA molecule containing the RNA sequence encoded by the nucleotide sequence within the insect genome.

[0150] In one embodiment, the plant transformation vector is an isolated and purified DNA molecule comprising a promoter attached to one or more nucleotide sequences of the present invention. The nucleotide sequence is selected from the group consisting of NR ID. SEQ. 1 - 143 and ID NO. SEQ. 169-174 as shown in the sequence listing. The nucleotide sequence comprises a stretch encoding all or part of the RNA present within the pest RNA transcript

100 target and may contain inverted repeats of all or part of the target pest RNA. The DNA molecule containing the expression vector may also contain a functioning intron sequence located either upstream of the coding sequence, or even within the coding sequence, and may also contain the untranslated leader sequence on the five (5 ') side (i.e. UTR or 5'-UTR) , located between the promoter and the translation initiation point.

[0151] The plant transformation vector may contain sequences from more than one gene, which allows the production of more than one dsRNA to inhibit the expression of two or more genes in target pest cells. One skilled in the art will readily understand that DNA segments whose sequence corresponds to the sequence present in different genes can be combined into one complex DNA segment for expression in a transgenic plant. Alternatively, the plasmid of the invention already containing at least one DNA segment can be modified by sequentially inserting additional DNA segments between the enhancer and promoter and the terminator sequences. In the insect control agent of the present invention designed to inhibit multiple genes, the genes to be inhibited can be obtained from the same insect species to increase the effectiveness of the insect control agent. In some embodiments, the genes may be from different insects to broaden the range of insects against which the agent is effective. When several genes form the target of suppression or a combination of expression and suppression, a polycistronic DNA element can be produced, as well

101 presented and disclosed in Fillatti, US Patent Application No. 2004-0029283.

[0152] When the nucleotide sequence of the present invention is to be used to transform a plant, a promoter having the ability to direct expression of the coding sequence in a particular plant species is selected. Promoters that work in various plant species are also well known in the art. Promoters useful for expressing polypeptides in plants are promoters that are inducible, viral, synthetic or constitutive, as described in Odell et al. (1985, Nature 313: 810-812), and / or promoters that are time regulated, spatially and spatio-temporally regulated. Preferred regulated promoters include the enhanced CaMV35S promoters and the FMV35S promoter. For the purposes of the present invention, for example to ensure optimal control of species that feed on the roots, it is preferable to achieve the highest level of expression of these genes in the roots of the plant. Many root boosted promoters have been identified and are known in the art (Lu et al., 2000, J. Phys. Plant., 156 (2): 277-283; US Patent Nos. 5,837,848 and 6,489,542). The recombinant DNA vector or construct of the invention will typically contain a selectable marker that conveys a selection phenotype in plant cells. Selective markers can also be used to select plants or plant cells that contain exogenous nucleic acids encoding the polypeptides or proteins of the present invention. Marker can

102 encode biocide resistance, antibiotic resistance (e.g. kanamycin, G418 bleomycin, hygromycin) or herbicide resistance (e.g. glyphosate). Examples of selectable markers include, but are not limited to, the neo gene that encodes kanamycin resistance and can be selected for use of kanamycin, G418; the bar gene that codes for bialafos resistance; a mutated EPSP synthase gene that codes for glyphosate resistance; a nitrilase gene that confers resistance to bromoxynil; a mutated acetolactate synthase (ALS) gene that confers imidazolinone or sulfonylurea resistance and methotrexate resistant DHFR gene.

[0153] The recombinant vector or construct of the present invention may also contain a marker for screening. Markers for screening can be used to monitor expression. Exemplary markers for screening include β-glucuronidase or the uidA gene (GUS), which encodes an enzyme for which various chromogenic substrates are known (Jefferson, 1987, Plant Mol. Biol, Rep 5: 387-405; Jefferson et al., 1987, EMBO J. 6: 3901-3907), the R locus gene, coding for a product that regulates the production of anthocyanin pigments (red) in plant tissues (Dellaporta et al., 1988, Stadler Symposium

11: 263-282); β-lactamase gene (Sutcliffe et al., 1978, Proc. Natl. Natl. Acad. Sci. 75: 3737-3741), a gene that codes for an enzyme for which various chromogenic substrates are known (e.g. PADAC, chromogenic cephalosporin) ; luciferase gene (Ow et al., 1986, Science 234: 856-859); xylE gene (Zukowsky et al., 1983, Proc. Natl. Natl. Acad.

Sci. 80: 1101-1105), which codes for dioxygenase

103 catechol, which can transform chromogenic catechin; α-amylase gene (Ikatu et al., 1990, Bio / Technol. 8: 241-242); tyrosinase gene (Katz et al., 1983, J. Gen. Microbiol. 129: 2703-2714), which encodes an enzyme capable of oxidizing tyrosine to DOPA and dopachinone, which in turn condenses into melanin; αgalactosidase, which catalyzes the α-galactose chromogenic substrate.

[0154] In general, it is preferred to introduce functional recombinant DNA at a non-specific site in the plant genome. In special cases, it may be advantageous to insert recombinant DNA via local integration. Several site-specific recombination systems known to act in plants include cre-Lox as disclosed in US Patent 4,959,317 and FLP-FRT as disclosed in US Patent 5,527,695.

[0155] In practice, DNA is only introduced into a small percentage of target cells in a single transformation experiment. Genes encoding selectable markers are used to provide an effective system for identifying those cells that are stably transformed with a specific transgenic construct. Preferred selection genes, selection, useful selection by adopting and incorporating the DNA construct into their genomes. markers provide markers that confer resistance to an agent such as an antibiotic or herbicide.

agents for use with markers are any herbicides that the plants of this invention may be resistant to.

104

Potentially transformed cells are exposed to a selection factor. Surviving cell populations will include those cells in which the gene conferring resistance is generally incorporated and expressed at levels sufficient to allow cell survival. Cells can be further tested to confirm stable integration of exogenous DNA. Commonly used selection marker genes include genes that confer antibiotic resistance such as kanamycin (nptII), hygromycin B (aph IV) and gentamicin (aac3 and aacC4) or herbicide resistance / tolerance such as glufosinate (bar or pat), glyphosate ( EPSPS) and AMPA (phnO). Examples of such selectable markers are set forth in US patents

United States 5,550,318; 5,633,435; 5,780,708 and 6,118,047. Markers for screening may also be used that provide visual identification capabilities of transformants, such as, for example, a gene expressed for colored or fluorescent protein, such as luciferase or green fluorescent protein (GFP), a gene expressed for beta-glucuronidase, or a uidA gene ( GUS), for which various chromogenic substrates are known. Preferred plant transformation vectors include vectors derived from the Ti plasmid from Agrobacterium tumefaciens (e.g., US Patent No. 4,536,475, 4,693,977, 4,886,937, 5,501,967 and EP 0 122 791). Agrobacterium rhizogenes plasmids (known as "Ri") are also useful in the art. Other preferred vectors for plant transformation include, for example, the vectors disclosed by Herrera-Estrella (1983, Nature

105

303: 209-213), Bevan (1983, Nature 304: 184-187), Klee (1985, Bio / Technol. 3: 637-642) and EP 0 120 516.

[0156] Methods and compositions for transforming plants by introducing a recombinant DNA construct into the plant genome include any of many methods known in the art. One way to construct transformed plants is by micro-missile bombing, as shown in US Patent 5,015,580, 5,550,318, 5,538,880, 6,153,812, 6,160,208, 6,288,312 and 6,399,861. Another way of constructing transformed plants is Agrobacterium-mediated transformation, as shown in US Patent Nos. 5,159,135, 5,824,877, 5,591,616 and 6,384,301. Alternatively, species other than Agrobacterium may be used, such as, for example, Rhizobium and other prokaryotic cells that have the ability to infect plant cells and introduce heterologous nucleotide sequences into the genome (s) of the infected plant cell.

[0157] The DNA constructs of the present invention can be introduced into the desired plant host genome using a variety of conventional transformation techniques that are well known to those skilled in the art. Suitable plant transformation vectors for Agrobacterium-mediated transformation include vectors derived from the Ti plasmid from Agrobacterium tumefaciens. In addition to Agrobacterium-mediated plant transformation vectors, alternative methods can be used to insert the DNA constructs of the present invention into plant cells. Such methods may include, but are not limited to

106 bombardment of the application in a way that dsRNA in the cell uses liposomes, electroporation, chemical compounds that increase the uptake of free DNA, the delivery of free DNA through micro-missiles, and transformation with viruses or pollen. Any of the isolated nucleic acid molecules of the invention can be introduced into the plant cell either permanently or transiently, along with other genetic elements such as promoters, introns, enhancers or non-translated leader sequences. Any of the nucleic acid molecules encoding RNA from burly insect species or RNA from puncturing insects and sucking insects or, more preferably, RNA from D. v. virgifera or RNA from Lygus hesperus, can be produced and introduced into a plant cell allows the production of plant molecules, providing an insecticidal amount of one or more specific dsRNAs in the feed of the target insect pest. The term "transgenic plant cell" or "transgenic plant" refers to a plant cell or plant that contains an exogenous nucleic acid that may be from a WCR or other insect species or any other species, not insects.

Transgenic plants are also intended to include the progeny (ancestors, descendants) of any generation of such transgenic plants or seed from any generation of such transgenic plants, wherein said progeny or seeds comprise a DNA sequence encoding RNA, sRNA, dsRNA, siRNA or a fragment thereof according to the present invention, which is also an important aspect of the present invention.

107 [0158] A transgenic plant generated using Agrobacterium transformation methods typically contains one simple recombinant DNA sequence inserted into one chromosome and is referred to as a transgenic event. Such transgenic plants can be regarded as heterozygous for the inserted exogenous sequence.

A transgene homozygous transgenic plant can be obtained by an inbred germinal cross of an independently sorted plant that contains a single exogenous F0 plant, for example (self pollination) transgenic, gene sequence, F1 seed production. A quarter of the F1 seed produced will be heterozygous for the transgene. Sprouting seeds in F1 will give plants that can be tested for heterozygosity, usually by using an SNP test or thermal amplification that allows discrimination between heterozygous and homozygous (i.e., zygosity) test. Crossing heterozygous plants with each other or with another heterozygous plant results in only heterozygous offspring.

[0159] In addition to direct transformation of the plant with a recombinant DNA construct, transgenic plants can be obtained by crossing the first plant containing the recombinant DNA construct with a second plant without this construct. For example, recombinant DNA for gene suppression can be introduced into a first plant line that is susceptible to transformation to produce a transgenic plant that can be crossed with a second plant line to

108 introgress the second plant line with recombinant DNA for gene suppression.

[0160] Transgenic plants that can be made by carrying out the present invention include, but are not limited to alfalfa, dill, apple, apricot, artichoke, arugula, asparagus, avocado, banana, barley, beans, beet, blackberry, bilberry, broccoli, Brussels sprouts, cabbage, rape, cantaloupe, carrot, cassava, cauliflower, celery, cherry, coriander, citrus, clementine, coffee, corn, cotton, cucumber, douglas, eggplant, chicory, escariole, eucalyptus, fennel, fig, calabash grapefruit, honeydew melon, angiosperm, kiwi, lettuce, leek, lemon, lime, taeda pine, mango, melon, mushrooms, nut, oats, musk, onion, orange, ornamental plant, papaya, parsley, peas, peach, nuts peanuts, pear, pepper, persimmon, pine, pineapple, banana, plum, pomegranate, poplar, potato, pumpkin, quince, California pine, chicory, radish, raspberry, rice, rye, sorghum, southern pine, soybean, spinach, pumpkin, strawberry, sugar beet, sugar cane, sunflower, sweet potato, balsamic ambergris, tangerine, tea, tobacco, tomato, grass, vine, watermelon, wheat, sweet potatoes and zucchini.

[0161] The present invention may, in practice, be associated with other insect control attributes in a plant to obtain desired characteristics for enhanced control of insect invasion. Combining insect control traits that use a different mode of action can provide insects with transgenic protection from insects

109 in relation to plants with one feature for controlling insects, due to the reduced probability that resistance will develop in the field. [0162] In the previous decade, the mechanism of insecticidal activity of crystal proteins has been extensively studied

B. thuringiensis. Crystal proteins have been shown to be toxic to larvae of insects only after eating the protein. In butterfly larvae, alkaline pH and proteolytic enzymes in the middle intestine of the insect dissolve the proteins, thus enabling the release of components that are toxic to the insect. These toxic ingredients break the cells of the middle intestine, cause the insect to stop feeding and eventually lead to the death of insects. Because of this, toxin B. thuringiensis proved to be insecticides effective and safe for the environment against various insect pests. Stagweed and bugs, and probably double-winged insects, the dipstick and other puncturing and sucking insects, show a pH in the intestine that is slightly acidic, Bt toxins that are effective against butterfly larvae, and are therefore ineffective against these pests. The slightly acidic intestinal pH of these insects is also considered more friendly to the compositions of the present invention, and without intending to be limited to any particular theory, it is likely that the alkaline intestinal pH of the butterfly larvae is the reason that previous attempts to demonstrate the efficacy of dsRNA have failed (Fire et al. United States Patent No. 6,506,559; Mesa et al. Patent Publication No. US2003 / 0150017; Rajagopal et al., 2002, J. Biol. Chem. 277: 46849-46851; Tabara et al., 1998,

110

Science 282: 430-431). It is therefore believed that the dsRNA methods disclosed herein should be advantageously used in compositions and in plants for controlling hookworms, bedbugs, double-winged insects, gauges and pricking and sucking insects. The methods and compositions presented herein are particularly useful for targeting genes for suppression in insects having a pH of 4.5 to 9.5, 5.0 to 9.0, 5.5 to 8.5, 6.0 to 8.0, 6.5 to 7.7, 6.8 to 7.6 or 7.0. However, insects and other pests that have a gut pH of 7.5 to 11.5, 8.0 to 11.0 or 9.0 to 10.0, e.g. insect butterfly larvae, are also intended to be included of the present invention. This is especially true when the dsRNA specific for gene inhibition in the butterfly larvae is provided in the larvae food together with one or more Bt proteins that, with respect to the Bt protein, would be normally toxic to that butterfly larvae if it was delivered in quantity equal to or higher than the threshold level. The presence of one or more Bt toxins that are toxic to the same insect species would effectively reduce the intestinal pH, providing a stable environment for double-stranded RNA molecules to influence their suppression of the target gene in the insect-pest.

[0163] It would be useful to associate one or more stabilized dsRNA constructs producing dsRNA molecules of the present invention in the diet of the target insect pest with one or more insecticidal proteins, so that the dsRNA and insecticidal protein are toxic to the same pest. The insecticidal protein may be from B.

111 thuringiensis, but also from other organisms known in the art to produce an insecticidal protein, such as bacterial symbionts for nematodes pathogenic to insects (e.g. Photorhabdus sp., Xenorhabdus sp.) Serratia entomophila and related Serratia sp., B. sphaericus, B. cereus, B. laterosponts, B. popilliae, Clostridium bifermentans or other gram-positive spore-forming bacteria that exhibit insecticidal properties. Similarly, it is envisaged that two or more different stabilized dsRNA constructs producing dsRNA molecules of the present invention may be supplied together in a single plant to ensure the persistence of the insect control phenotype. These dsRNA molecules could target the same gene for silencing or, alternatively, target different silencing target genes. Two or more dsRNAs can be associated in the same plant, each dsRNA is toxic to a different insect pest, and none of these dsRNAs are toxic to the same insect species.

[0164] It is predicted that the combination of certain stabilized dsRNA constructs with one or more insect-fighting protein genes will result in synergy that increases the phenotype of insect control of the transgenic plant. Insect bioassays using artificial food or whole plant tissue can be used to determine the dose-response relationship for larval mortality or growth inhibition using dsRNA and insect control proteins. The skilled person can examine mixtures of dsRNA molecules and proteins to control

112 insects in a bioassay to identify combinations of active substances that are synergistic, desirable and indicated for use in insect-protected plants (Tabashnik, 1992). Synergy in killing insect pests has been reported for various insect control proteins (for a review, see Schnepf et al., 1998). Synergy effects are expected to exist between some dsRNA and between some dsRNA and some insect control proteins.

[0165] It is also anticipated that dsRNA combinations will reveal unexpected toxicity to some pests. Rajagopol et al. (2002, J. Biol Chem. 277: 46849-46851) reported that feeding of the S. llura butterfly larvae dsRNA was ineffective in silencing the gene encoding midgut aminopeptidase. It is worth noting that the alkaline pH of the middle butterfly of a typical butterfly may be a hostile environment for dsRNA, since it would be expected that denaturation of RNA duplexes at alkaline pH will lead to rapid degradation. The pores formed by B. thuringiensis toxin proteins inserted into the midgut epithelial membrane result in neutralization of the midgut pH (review - Gill, 1995, Mem. Inst. Osaldo Cruz, Rio de Janeiro, 90: 69-74). Toxin B proteins thuringiensis, which have the ability to form only transient ion channels in the midgut epithelial membrane of butterflies without causing mortality, may therefore be sufficient to reduce midgut pH to levels more favorable for uptake of dsRNA by midgut epithelial cells. As one of

113 examples may be given that it is known that the CryIAc protein is not a toxin effective against Spodoptera exigua terrestrial fluorescent lamp (Chambers et al., 1991, J. Bacteriol. 173: 3966-3976). However, the transient lowering of mid-intestinal pH caused by the CryIAc protein could serve to stabilize concurrently eaten dsRNAs and make them effective in silencing S. exigua target genes, providing an unexpected way of controlling this insect pest. This effect could be observed using any protein, insecticidal or not, which interferes with the ion regulation of insect-butterfly midgut cells; this method can also be rows of burlyworms, bedbugs, gauges and other species of puncturing and sucking insects.

[0166] Some B. thuringiensis insecticidal proteins, such as Cyt proteins, can cause the formation of transient holes in the epithelial membrane of the middle intestine of sensitive insect larvae due to structured pores or general detergent-like protein

Appl. Environ. Microbiol. 69: 2415-2422 may facilitate the passage of dsRNA molecules into the midgut epithelial cells even at protein concentrations that are suboptimal mortality. It is anticipated that insecticides or not, which causes transient holes in the epithelial membranes of insects, can facilitate the passage of dsRNA molecules into insect cells and promote gene silencing.

effective in double-winged activity creation (Butko, 2003,

Such holes to cause any protein,

114 [0167] The nucleotide sequences provided in SEQ ID NO: SEQ. 1 - 143 and ID NO. SEQ. 169 - 174, as shown in the sequence list, fragments or complement thereof may be "provided" in a variety of carriers to facilitate their use. Such a carrier may also provide a subset of them in a form that allows the skilled person to study the sequence.

[0168] As embodiments of the present invention, commodity products containing one or more sequences of the present invention, prepared from a recombinant plant or seed containing one or more nucleotide sequences of the present invention are particularly contemplated. A commodity product containing one or more sequences of the present invention is intended to include, but is not limited to, flour, oil, comminuted or whole grains or seeds of a plant, or any food product containing flour, oil, comminuted or whole grains of a recombinant plant or seeds, containing one or more sequences of this invention. Detection of one or more of the sequences of the present invention contemplated herein in one or more commodity products is de facto evidence that the commodity product consists of a transgenic plant designed to express one or more nucleotide sequences of the present invention to combat insect invasion using suppression methods gene via dsRNA.

[0169] In one application of this embodiment, the nucleotide sequence of the present invention may be

115 recorded on a computer readable storage medium. As used herein, a "computer readable data carrier" refers to any real means of expression that can be read and directly accessible by a computer.

Such media include, but are not limited to: magnetic data storage media such as floppy disks, hard disk, data storage media and magnetic tape; optical storage media such as CD-ROMs; electric storage media such as RAM and ROM; formatted computer files for optical character recognition and hybrids of these categories, such as magnetic optical storage media. One of ordinary skill in the art can readily understand that any of the currently known computer readable media can be used to make a product comprising a computer readable data carrier with the nucleotide sequence recorded thereon. [0170] As used herein, "recorded" refers to a process of storing information on a computer readable storage medium. One of ordinary skill in the art can easily adapt any of the methods currently known to record information on a computer readable data carrier to produce a data carrier containing the nucleotide sequence information of the present invention. Various data storage structures are available to those skilled in the art for producing a computer readable data carrier with the nucleotide sequence of the present invention written thereon. Choice of structure for data storage

116 will generally be based on the methods chosen to access the information stored.

In addition, a variety of data processing programs and formats can be used to store information about the nucleotide sequence of the present invention on a computer readable medium. Sequence information can be contained in a word character text file formatted in commercially available software such as WordPerfect and Microsoft Word, or it can be saved as an ASCII text file stored in a database application such as DB2, Sybase or Oracle . The specialist can easily adapt any of many different formats of processor data structuring (e.g. example of text files or databases) to obtain a computer readable medium with information about the nucleotide sequence of the present invention recorded thereon. [0171] Computer software is publicly available, which allows a person skilled in the art to access sequence information available in a computer readable medium. To identify open reading frames (ORFs) within sequences such as Unigene and EST that are provided herein and which are homologous to ORFs or proteins from other organisms, software that uses BLAST search algorithms can be used (Altschul et al., J. Mol. Biol. 215: 403-410 (1990)) and BLAZE (Brutlag et al. Comp. Chem. 17: 203-207 (1993)) in the Sybase system. Such ORFs are fragments encoding a protein within the sequences of the present invention and are useful in the production of commercially important proteins such as enzymes

117 used in amino acid biosynthesis, metabolism, transcription, translation, RNA processing, nucleic acid and protein degradation, protein modification and replication, restriction, modification, recombination and DNA repair.

[0172] The present invention further provides systems, especially computer-based systems, that contain the sequence information described herein . Such systems are designed to identify commercially important fragments of the nucleic acid molecule of the present invention. As used herein, the term "computer system" refers to computer hardware, software, and data storage means used to analyze the nucleotide sequence information of the invention. The minimum of computer equipment for computer-based systems includes the central processing unit (CPU), inputs, outputs, and data storage. One of ordinary skill in the art can readily understand that any of the computer systems currently available is suitable for use in the present invention.

[0173] The most preferred target sequence length is from 10 to 100 amino acids, or from 23 to 300 nucleotide residues.

[0174] As used herein, the term "structural target motif" or "target motif" refers to any rationally selected sequence or combination of sequences in which the sequences or sequence (s) are selected based on the three-dimensional configuration that results from

118 folding of the target motive. Various target motifs are known in the art. Target motifs for the protein include, but are not limited to, enzymatic active sites and signal sequences. Target nucleic acid motifs include, but are not limited to, promoter sequences, cis elements, hairpin structures, and inducible expression elements (protein binding sequences).

EXAMPLES [0175] The inventors have identified here methods for controlling invertebrate pest infestation by providing a double-stranded ribonucleic acid molecule in the diet of the pest. The inventors have unexpectedly found that double-stranded ribonucleic acid molecules act when eaten by a pest, inhibiting biological function in the pest, which leads to one or more of the following characteristics: reduction of pest feeding, reduction of pest lifetime, pest death, inhibition of pest differentiation and development, no or limited possibilities: sexual reproduction by the pest, muscle formation, juvenile hormone formation, regulation of juvenile hormone, regulation and transport of ions, digestive enzyme synthesis, maintenance of cell membrane potential, amino acid biosynthesis, amino acid degradation, sperm formation, pheromone synthesis, pheromone sensing, antenna formation, formation wings, leg formation, development and differentiation, formation

119 eggs, maturation of larvae, digestive enzyme formation, hemolymph synthesis, maintenance of hemolymph, neurotransmission, cell division, energy metabolism, respiration, apoptosis and any component of the structure of the cytoskeleton of eukaryotic cells, such as actin and tubulin. One or any combination of these features can lead to effective inhibition of pest infestation and, in the case of plant pest control, to inhibit invasion of plants. When these agents are used, for example, as a food composition containing a sufficient amount of one or more double-stranded ribonucleic acid molecules delivered locally to the plant to inhibit pests, for seed treatment, soil treatment around the plant, or when they are produced by plants from a recombinant DNA molecule present in plant cells , invasion of plant pests is unexpectedly significantly reduced. The examples below illustrate the invention.

Example 1 [0176] This example illustrates the identification of nucleotide sequences that, if provided in the form of double-stranded RNA molecules in the diet of corn beetle root, are useful for controlling corn root beetle.

[0177] Corn root beetle (LIB149, LIB 150, LIB3027, LIB3373) cDNA libraries were constructed from whole larvae and from dissected parts of the intestine

120 middle sequence and nucleotide information was obtained (see Andersen et al., U.S. Patent Serial No. 10/205, 189 filed July 24, 2002, incorporated herein by reference in its entirety). In addition, whole-larvae cDNA libraries were constructed at different stages of development and at different times at each stage of development to increase the number of different EST sequences from the Diabrotica species. LIB5444 and LIB5462 libraries were constructed from a pool of mRNA obtained from the first (1 gram) and third (2.9 g) developmental stages of western corn larvae respectively. The collected insects were quickly frozen by introduction into liquid nitrogen. Insects were ground in a mortar, where the pestle was kept below -20 ° C by cooling in dry ice and / or by adding liquid nitrogen to the mortar until the tissue was ground to a fine powder. RNA was extracted using TRIzol® reagent (Invitrogen) according to the manufacturer's instructions. Poly A + RNA was isolated from the total RNA preparation using Dynabeads Oligo dT (Dynal Inc., NY, USA) following the manufacturer's instructions. The cDNA library was constructed from poly A + RNA using the SuperScript ™ Plasmid System (Invitrogen) plasmid system. cDNA was subjected to size using fractionation chromatography. they were subjected

Technologies restricted in places

The fourth and fifth fractions were collected and ligated into the pSPORT1 vector (Life

Inc., Gaithersburg, MD, USA) between recognized SalI and NotI by endonucleases and transformed into E. coli DH10B electrocompetent cells via

121 electroporation. 420,000 colony-forming units were obtained from the first larval stage library. From the third larval stage library was obtained

colonies

2.78 x 10⁶ colony forming units.

LIB149, LIB150 were washed plates, briefly mixed on a vortex until homogeneous and pooled in Tris-EDTA buffer. Half of the washed material was brought to 10% glycerol, aliquoted into cryofials and stored at 70 ° C. The other half was used to produce plasmid DNA using a Midi-Prep Quiagen purification column or equivalent. The purified plasmid DNA was aliquoted into microcentrifuge tubes and stored at -20 ° C. [0178] Colonies from the Diabrotica virgifera cDNA library, LIB5444 and LIB5462 were individually amplified in high viscosity medium. About 200,000 LIB5444 colony forming units and 600,000 LIB5462 colony forming units were mixed in a mixing plate separately in 500 ml LB medium containing 0.3% SeaPrep® agarose and 50 mg / L carbenicillin at 37 ° C, followed by quickly cooled in a water-ice bath for 1 hour, allowing even suspension of bacterial colonies. Inoculated libraries were then grown at 30 ° C for 42 hours. After incubation, the cells were mixed for 5 minutes in a mixing plate. The medium was then transferred to two 250-ml centrifuge bottles. Bacterial cells were centrifuged at 10,000 xg for 10 minutes. The medium was removed from the bottle and the cells were resuspended in a total of 20 ml LB medium with 50 mg / L

122 carbenicillin. Dimethyl sulfoxide up to 10% was added to protect cells from freezing. Both libraries₈ multiplied to final titer of 10⁸ colony forming units per milliliter. Samples of the Diabrotica virgifera, LIB5444 and LIB5462 cDNA libraries were pooled and adjusted to a DNA concentration of 1.25 micrograms per microliter in sterile, distilled and deionized water and aliquoted into 25 cryofials containing 8.75 micrograms of DNA each. These samples were deposited by the applicant (s) of the invention in the American Type Culture Collection (ATCC) located at: 10801 University Boulevard, Manassas, Virginia, USA, zip code 20110-2209, on June 10, 2004 and further are referred to as LIB5444 / 62. ATCC provided the applicant with a deposit receipt, assigning the deposit access number ATCC PTA-6072.

[0179] High molecular weight corn root beetle cDNA libraries, i.e. LIB5496 and LIB5498, were prepared essentially as described above for the production of corn rootworm cDNA libraries. LIB5496 and LIB5498 libraries were constructed from a pool of mRNA obtained from larvae in the first (1 gram) and second and third (1 gram) developmental stages of corn rootworm, respectively. Briefly, insects were quickly frozen in liquid nitrogen. Frozen insects have been reduced to a fine powder by grinding with a pestle in a mortar. RNA was extracted using TRIzol® reagent (Invitrogen) following the manufacturer's instructions. Poly A + RNA was isolated from the total RNA preparation using Oligo dT Dynabeads

123 (Dynal Inc., NY, USA). A high molecular weight cDNA library was generated from 20 micrograms of poly A + RNA using the SuperScript ™ Plasmid System (Invitrogen). The cDNA was fractionated in size on a 1% agarose gel in TAE, then cDNA was collected in the range of 1 kb to 10 kb and ligated into the pSPORT1 vector between SalI and NotI restriction sites and transformed into E. coli DH10B electrocompetent cells by electroporation. Total titre was obtained for LIB5496

3.5 x 10⁶ colony forming units. A total titre of 1.0 x 10 was obtained for LIB5498⁶ colony forming units. Colonies from the high molecular weight corn root beetle cDNA libraries LIB5496 and LIB5498 were individually amplified in high viscosity medium. About 600,000 colony forming units from

LIB5496 and LIB5498 were mixed in a mixing plate, separately, in 500 ml LB medium containing 0.3% SeaPrep® agarose and 50 mg / L carbenicillin at 37 ° C, followed by rapid cooling in a water-ice bath for 1 hour, allowing even suspension of the colonies bacterial. Inoculated libraries were then grown at 30 ° C for 42 hours. After incubation, the cells were mixed for 5 minutes in a mixing plate. The medium was then transferred to two 250-ml centrifuge bottles. Bacterial cells were centrifuged at 10,000 xg for 10 minutes.

The medium was removed from the bottle and the cells were resuspended in a total of 20 ml LB medium with 50 mg / L carbenicillin. Dimethyl sulfoxide up to 10% was added to protect cells from freezing. Both libraries

124 multiplied to final titer of 10⁸ colony forming units per milliliter. CDNA sequence information was obtained from species-specific plasmid libraries of maize Colorado beetle.

[0180] From the corn rootworm libraries according to Andersen et al., Together with additional sequences from LIB5444 and LIB5462 libraries, an initial of 18

415 individual EST sequences consisting of ₇ about 1.0 x 10⁷ nucleotide residues. The average length of the EST sequence was about 586 nucleotide residues.

Bioinformatic algorithms were applied to these EST sequences, which resulted in the assembly of sequence contigs, referred to herein as Unigene sequences, and individual EST sequences that could not be linked by the identity of overlapping sections with other EST sequences were referred to as singletons. LIB5444 and LIB5462 libraries were then subjected to much deeper sequencing, resulting in additional single EST sequences. EST sequences obtained from libraries, i.e. LIB149, LIB150, LIB3027, LIB3373, LIB5444, LIB5462, LIB5496 and LIB5503, are shown in sequence listing, from ID NO. SEQ. 1 to ID NO. SEQ. 143 and from ID NO. SEQ. 169 to ID NO. SEQ. 174.

[0181] EST sequences isolated from CRW cDNA libraries were assembled, where possible, into Unigene sets and these complex Unigene sequences are listed in the sequence listing as shown in. Unigene is a gene-targeted cluster formed of overlapping

ESTs within regions to create larger single sequence identity sequences

125 amino acid in assigned to the sequence. Pontius et al., Nucl Acids Res 31: 28-33 (2003). Each nucleotide sequence in the sequence listing was analyzed to identify the presence of open reading frames. Information on the amino acid sequence deduced from open reading frames was compared with known information on the amino acid sequence available in public databases to deduce the extent of identity or similarity of the amino acid sequence to known amino acid sequences. The biological function, if any, associated with known sequences of public databases was the amino acid sequence of deduced nucleotide sequence information from the cDNA library. The annotations provided information that suggested a function of the protein that can be expressed from a particular gene that gave a specific cDNA sequence, but this was not the final result. Based on the suggestive information in the annotation, some cDNA sequences have been identified as coding sequences for a protein that is probably involved in some biological function in corn beetle root cells that is either necessary for life, or necessary to ensure cell health and viability, or is likely to have participation in cellular integrity, cell persistence and reproductive capacity.

[0182] From this subset of cDNA sequences, several cDNA sequences likely coding for proteins whose inhibition may have caused CRW morbidity or mortality in cells or in cells were selected

126 other invertebrate species. These sequences were then used to construct double-stranded RNA molecules for incorporation into food for CRW.

[0183] Primer pairs for thermal amplification were designed based on the cDNA sequences described from the CRW cDNA library. Pairs of primers were constructed as a pair of nucleotide sequences, with each representative of the pair of primers showing perfect complementarity to either the sense or antisense sequence. The sequences of some primer pairs were constructed so that each member of the pair contained the sequence that contained, at the 5 'end, the T7 phage RNA polymerase promoter, as exemplified in NR ID. SEQ. 5 from nucleotide position 1 to nucleotide position 23. Preferably, the first amplification reaction with higher fidelity was performed using the first pair of primers without the T7 promoter to generate the first amplicon using CRW genomic DNA as template. Preferably, cDNA or mRNA sequences are used as template for the synthesis of dsRNA molecules for use in the present invention because it is known in the art that eukaryotic genome sequences contain sequences that are not present within the mature RNA molecule. A sample of the first amplicon generated from the first amplification reaction was then used as a template in the second thermal amplification reaction with the second pair of primers containing the T7 promoter sequence to produce a second amplicon that contained the T7 promoter at the 5 'end or within the 5' end of each strand of the second amplicon . Full sequence obtained

127 nucleotide of the second amplicon in both directions, was compared to the nucleotide sequence given for the cDNA and differences between the two sequences, if any, were noted. Generally, the sequences obtained using genomic DNA as template were not suitable for further use as dsRNA molecules to be used to achieve significant levels of suppression due to variation in genomic sequences that were not present within the mRNA or cDNA sequence.

[0184] The in vitro transcription reaction typically contained 1 to 2 micrograms of linearized template DNA, reaction buffer for T7 polymerase from 10X concentrate, ATP ribonucleotides, CTP, GTP and UTP at a final concentration of 50-100 mM and 1 unit of T7 RNA polymerase enzyme . The RNA polymerase reaction was incubated at 37 ° C, depending on the optimum temperature for the RNA polymerase used, according to the manufacturer's instructions, for a period of several minutes to several hours. In general, reactions were carried out from 2 to 6 hours for transcription of template sequences up to 400 nucleotides in length and up to 20 hours for transcription of template sequences longer than 400 nucleotides. Heating the reaction mixture to 65 ° C for 15 minutes stops RNA transcription. RNA transcription products were ethanol precipitated, washed, air dried and resuspended in RNAse free water to a concentration of 1 microgram per microliter. Most transcripts that used the opposite T7 promoter strategy outlined above produced in vitro transcription, double-stranded RNA in response, but higher yields

128 the mixture was purified, the double-stranded RNA manufacturer was obtained by heating the purified RNA to 65 ° C, followed by slow cooling to room temperature, to ensure proper sense and antisense RNA fusion. Double-stranded RNA products were then incubated with DNase I and RNase at 37 ° C for one hour to remove any DNA or single-stranded RNA present in the double-stranded RNA products on the column according to

Ambion Megascript RNAi kit) was suspended in 10 mM Tris-HCl (pH 7.5) or RNase free water to a concentration of 0.1 to 1.0 micrograms per microliter.

instructions and again [0185] A double-stranded RNA sample was either added directly to each well containing insect food as indicated above, or modified prior to addition to insect food. Double-stranded RNA modification was carried out according to the instructions for RNase III (Ambion Corporation, Austin, Texas, USA) or Dicer (Stratagene, La Jolla, California, USA) supplied by the manufacturer. Double-stranded RNAase RNA digestion resulted in twenty-one and twenty-double nucleotide duplexes containing phosphorylated 5 'ends and 3' hydroxyl ends with 2-3 protruding bases, similar to short interference RNA (siRNA) fragments - duplexes composed of ~ 21-26 base pairs produced by Dicer enzyme in the eukaryotic pathway identified by Hamilton et al. (Science, 1999, 286: 950-952) and Elbashir et al. (Genes &amp; Development, 2001, 15: 188-200). This collection

129 short interfering RNA duplexes were further purified and the sample properties determined using polyacrylamide gel electrophoresis to determine the integrity and efficiency of duplex formation. The purity and quantity of the sample were then determined using spectrophotometry at 250 nanometers and the unused sample was stored for further use by storing it at -20 ° C.

[0186] Samples of siRNA or double-stranded full-length RNA (dsRNA) were subjected to the bioassay using several selected target pests. Different doses of dsRNA or siRNA were used, applying them to artificial food for corn rootworm according to the following procedure. Diabrotica virgifera virgifera (WRC) eggs were obtained from Crop

Characteristics, Inc., Farmington, Minnesota, USA. Non-diapause WCR eggs were incubated in soil for 13 days at 24 ° C, 60% relative humidity, in total darkness. On day 13, the soil containing WRC eggs was placed on sieves with mesh No. 30 to No. 60 and the eggs were washed out of the soil using a high pressure garden hose. The egg surface was disinfected by soaking in lysol for three minutes, washed three times with sterile water, rinsed once with 10% formalin solution, and then rinsed an additional three times with sterile water. Eggs treated in this way were placed on sterile coffee filters and allowed to hatch overnight at 27 ° C, 60% relative humidity, in total darkness. Insect food was generally prepared according to Pleau et al.

130 (Entomologia Experimentalis et Applicata, 2002, 105: 111), with the following modifications. 9.4 g Serva agar was placed in 540 ml purified water and mixed until the agar was thoroughly distributed. The wateragar mixture was heated to boiling until the agar was completely dissolved and then poured into a Waring blender. The blender was kept at low speed by adding 62.7 grams of Bio-Serv Diet (F9757) mix, 3.75 g of freeze-dried maize roots, 1.25 milliliter of green food dye and 0.6 milliliter of formalin to the hot agar mixture. The mixture was then adjusted to pH 9.0 by the addition of a 10% potassium hydroxide solution. A volume of approximately 600 milliliters of liquid food was constantly mixed at high speed and kept at a temperature of 48 ° C to 60 ° C using a sterilized, coated Nalgene magnetic stirrer on a magnetic stirrer with a hot plate, separating into 200 microliter portions into each well of 96 wells , round-bottom Falcon microtiter plates. The plates were allowed to solidify and dried in the sterile biological digestor for 10 minutes.

[0187] 30 microliters of test samples of control reagents, either containing or double-stranded RNA in various amounts, were applied to the surface of the insect food in different amounts, micropipettes for multiple repetition. Insect food was left in the sterile fume cupboard for up to half an hour after application of the test samples to allow the reagents to diffuse into the food and to dry the food surface. Placed in each well

131 larvae mass at Data was analyzed using a thin paint brush one newborn WCR larvae. The plates were then sealed with Mylar foil and ventilated with an insect pin. 12-72 insect larvae were tested per dose depending on how the test was designed. The bioassay plates were incubated at 27 ° C, 60% relative air humidity in total darkness for 12-14 days. The number of surviving larvae per dose was recorded at a time point of 12-14 days. For each surviving larvae, the appropriate microbalance was determined using JMP statistical software^©4 (SAS Institute, 1995) and multifactorial ANOVA analysis was performed along with Dunnet's test, looking for treatment effects compared to untreated control (p &lt;0.05). To compare all treatment pairs, a Tukey-Kramer post hoc test was performed (p &lt;0.05). [0188] The following nucleotide sequences (Andersen et al., Ibid.) Were obtained as the first cDNA sequences identified in the middle intestinal cDNA library of corn beetle root; they have been adapted for use in the construction of double-stranded RNA molecules for use in testing the efficacy of inhibiting biological function in a pest by feeding double-stranded RNA molecules in food for the pest.

Chd3 homologous sequence [0189] CHD genes have been identified in many eukaryotes;

the corresponding proteins are believed to act as

132 chromatin remodeling factors. The term CHD is derived from three sequence homology domains found in CHD proteins: chromo domains (chromatin organization modifier), SNF2 / ATPase related helicase domains and DNA binding domains, each of which is considered to confer separate chromatin-related activity. CHD proteins are divided into two categories based on the presence or absence of another sequence homology domain, the PHD zinc finger domain, typically associated with chromatin-related activity. CHD3-related proteins have the PHD zinc finger domain, but CHD1-related proteins do not. Experimental observations suggest the role of CHD3 proteins in transcription repression, and in some species these proteins have been shown to be part of a complex that contains histone deacetylase as a subunit. Histone deacetylation is correlated with transcription inactivation, so it is postulated that CHD3 proteins act as transcription repressors as a component of the histone deacetylase complex (Ogas et al., 1999, PNAS 96: 13839-13844). Suppression of CHD3 protein synthesis may therefore be a useful target for double-stranded RNA-mediated invertebrate pest inhibition. ID NO SEQ. 4 corresponds to the cDNA nucleotide sequence from the CRW mid intestine, which after translation gives the amino acid sequence that has been deemed homologous to the amino acid sequence CHD3 Drosophila melanogaster (GenBank accession no. AF007780). ID NO SEQ. 5 and ID NO. SEQ. 40609 correspond to forward and right primers, respectively. reverse) for genome amplification (i.e. pair of primers) for use at

133 production of the amplicon from CRW genomic DNA, from a CRW mRNA pool, or from cDNA produced from such pools. The sequence of such an amplicon corresponds to the part of the CRW gene encoding the amino acid sequence homologue of CHD3 D. melanogaster. ID NO SEQ. 5 contains the T7 polymerase promoter sequence at its 5 'end (nucleotides 1-23) attached to the CRW genome primer sequence (arbitrarily taken as the left primer sequence), shown as

<td>shows</td><td>in</td><td>NO</td><td>ID. SEQ. 5, from</td><td>positions</td>

<td>nucleotide</td><td colspan="2">24 to</td><td>45, which corresponds</td><td>positions</td>

<td>nucleotide</td><td>from</td><td>31 to</td><td>52 as shown</td><td>in ID no.</td>

<td>SEQ. 4. NO</td><td>ID.</td><td>SEQ.</td><td>6 contains the sequence</td><td>promoter</td>

<td>T7 polymerase</td><td>on</td><td>his</td><td colspan="2">end 5 'as shown from</td>

nucleotide position 1 to 23. The T7 promoter sequence is joined at its 3 'end to an arbitrarily accepted genomic right primer sequence corresponding to nucleotide position 24 to 44 as shown in

<td>ID NO SEQ.</td><td> 6,</td><td colspan="4">inverted padding</td><td>sequence</td>

<td>presented</td><td>in</td><td>NO</td><td>ID.</td><td>SEQ.</td><td>4, from</td><td>positions</td>

<td>nucleotide</td><td> 298</td><td>down</td><td> 319.</td><td>At</td><td colspan="2">applying steam</td>

primers consisting of ID NO. SEQ. 5 and ID NO.

SEQ. 6, in an amplification reaction with CRW genomic DNA as template, an amplicon consisting of 335 base pair nucleotide sequence, containing the one presented in SEQ ID NO. SEQ ID of the CRW genome,

7, corresponding to the portion of the protein showing 66% which codes for identity with the amino acid sequence CHD3 Drosophila melanogaster. Nucleotides at position 1-23 and inverted complement of nucleotides at position 314-335 as shown in ID NO. SEQ. 7, correspond to T7 promoter sequences at any end of the amplicon. Duplicate

134 genomic nucleotide sequence set forth in SEQ ID NO. SEQ. 7, from nucleotide 24 to nucleotide 313, corresponds essentially to the cDNA nucleotide sequence as described in SEQ ID NO. SEQ. 4, from nucleotide 31 to nucleotide 319, with the difference that, as reported, nucleotides at positions 63, 87, 117, 177, 198, 213,

219-220, 246, 249 and 261 as shown in ID NO.

SEQ. 4, were, respectively, T, T, G, G, G, T, T, T, C, C and A, while the corresponding positions after alignment ID. SEQ. 7 contained C, C, A, A, A, C, A, CG, A and G at nucleotide positions 56, 80, 110,

170, 191, 206, 212-213, 239, 242 and 254. This difference corresponds to a 4% difference in the composition of the nucleotide sequence between the previously described cDNA sequence and the amplicon sequence generated from the genomic DNA template, which is in line with previous reports that the cDNA sequence is probably less than 99% accurate (Andersen et al., ibid).

[0190] An amplicon having a sequence corresponding to ID NO. SEQ. 7 was cloned into a plasmid replicable vector in E. coli and sufficient plasmid DNA was recovered to allow in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA was produced and subjected to a bioassay; one RNA segment consisting of the sequence shown in SEQ ID NO. SEQ. 7, from nucleotide position 24 to at least nucleotide position 313, except that the uridine residue is present at each position in which in ID NO. SEQ. 7 shows a thymidine residue, a second RNA segment, being essentially

135 inverted complement of the nucleotide sequence set forth in SEQ ID NO. SEQ. 7, from nucleotide position 313 to at least nucleotide position 24, with uridines in their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample was treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA were applied to CRW food in the bioassay as described above, and the larvae were allowed to feed for 13 days. CRW larvae glowing on food containing dsRNA corresponding to all or part of the sequence set forth in NR ID significant inhibition of growth compared to controls.

[0191] In parallel with the CHD3 sequences, other CRW-derived nucleotide sequences were also tested in a bioassay, including nucleotide sequences that annotate that they probably encode CRW equivalents of proteins such as beta-tubulin protein, 40 kDa V-ATPase subunit protein, factor proteins EF1a and EF1a 48D elongation proteins, p28 subunit protein 26S, juvenile hormone epoxide hydrolase protein, edema dependent protein of chloride channel, glucose-6-phosphate 1-dehydrogenase protein, actin 42A protein, ADPribosylation factor 1 protein, transcription factor IIB protein, chitinase protein and ubiquitin-binding enzyme protein.

SEQ. 4 showed and mortality in

Sequence homologous to beta-tubulin

136 [0192] Tubulin proteins are important structural components of many cellular structures in all eukaryotic cells, mainly in the formation of microtubules. Inhibiting microtubule formation in cells causes catastrophic effects, including disrupting mitotic spindle formation and blocking cell division. Suppression of tubulin protein formation may therefore be a useful target for double-stranded RNA-mediated inhibition.

[0193] A CRW-derived betatubulin related sequence has been identified for use in the present invention. ID NO. SEQ. 18 corresponds to the nucleotide sequence of cDNA from the middle intestine CRW, which after translation gives an amino acid sequence that has been found to be homologous partly to the amino acid sequence of Manduca sexta beta1-tubulin and partly to the amino acid sequence of beta-1-tubulin Drosophila melanogaster (GenBank Accession No. AF030547 and M20419). ID NO. SEQ. 19 and ID NO. SEQ. 20 correspond to primers for the amplification of the left and right genomes, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool or from cDNA produced from such pools. The sequence of such amplicon corresponds to all or part of the CRW gene encoding beta-1-tubulin. Each of ID NO. SEQ. 19 and ID NO SEQ. 20 contains the 23-nucleotide T7 promoter sequence at the nucleotide positions, respectively,

1-23. Nucleotides 24-44 as shown in SEQ ID NO. SEQ. 19, correspond to nucleotides 96-116, as shown in ID NO. SEQ. 18. Nucleotides 24-44, as shown in SEQ ID NO. SEQ. 20, correspond to the reverse

137 completing the sequence set out in SEQ ID NO. SEQ. 18, from nucleotide 428 to 448. Using a primer pair consisting of ID NO. SEQ. 19 and ID NO SEQ. In an amplification reaction with CRW genomic DNA as template, a 399 base pair amplicon containing the nucleotide sequence as shown in ID NO. Is produced. SEQ. 21, essentially corresponding to the part of the CRW genome encoding a protein having substantial identity with the betatubulin homologue present in Drosophila melanogaster and Manduca sexta. The nucleotide sequence set out in SEQ ID NO. SEQ. 21 corresponds essentially to the nucleotide sequence set forth in SEQ ID NO. SEQ. 18, from nucleotide 96 to 448. No sequence differences were observed between the genome amplicon sequence and the corresponding sequence within the cDNA sequence.

[0194] An amplicon having a sequence corresponding to NR

ID. SEQ. 21 was cloned into the plasmid vector and sufficient plasmid DNA was recovered to allow in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA was produced and subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 21 from nucleotide position 24 to at least nucleotide position 376, with the difference that the uridine residue is present at each position in which in ID NO. SEQ. 21 a thymidine residue is shown, the RNA segment being an inverted complement or the antisense strand being an essentially inverted complement

138 nucleotide sequence as set out in SEQ ID NO. SEQ. 21, from nucleotide position 376 to at least nucleotide position 24, with uridines in their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample was treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA were applied to CRW food in the bioassay as described above, and the larvae were allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 18 showed significant growth inhibition and mortality compared to controls.

40 kDa V-ATPase homologous sequence [0195] Energy metabolism in intracellular organelles in eukaryotic systems is an essential function. Vacuolar ATP synthases are involved in maintaining adequate ATP levels within the vacuole. Therefore, vacuolar ATP synthases may be a useful target for double-stranded RNA-mediated inhibition.

[0196] A nucleotide sequence coding for a protein was obtained which showed similarity to the 40 kDa V-ATPase derived from CRW. Amino acid sequence resulting from translation of ID NO. SEQ. 32 shows homology to the amino acid sequence of the 40kDa subunit of V-ATPase Manduca sexta (GenBank Accession No. X98825).

139

ID NO

SEQ.

and ID NO.

SEQ.

correspond to the left and right primers, respectively, for genome amplification (i.e. pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool, or from cDNA produced from such pools. The sequence of such amplicon should correspond to all or part of the CRW gene coding for a 40 kDa V-ATPase homologous protein. However, the amplicon nucleotide sequence obtained using CRW genomic DNA as template was incompatible with the described cDNA sequence as shown in ID NO. SEQ. 32.

[0197] ID NO. SEQ. 33 and ID NO SEQ. 34 shows primers for thermal amplification.

contains 23-nucleotide, respectively, from position

Each primer sequence T7 promoter, nucleotide 1 to 23.

Nucleotides 24-40 as shown in SEQ ID NO. SEQ. 33, correspond to nucleotides 95-111 as shown in ID NO. SEQ. 32. Nucleotides 24-43 as set out in NR

ID.

SEQ.

34, correspond to the reverse sequence complement as shown in ID NO. SEQ. 32, from nucleotide 362 to 381. Using a primer pair consisting of ID NO. SEQ. 33 and ID NO SEQ. 34 in an amplification reaction with CRW genomic DNA as template, a 291 base pair amplicon is produced containing the nucleotide sequence shown in NR

ID. SEQ. 35. ID NO SEQ. 35 from nucleotide 24 to nucleotide 268 showed only 50% homology with the nucleotide sequence set forth in SEQ ID NO. SEKW based on DNA alignment Martinez / NeedlemanWunsch. The amplicon sequence obtained using the selected pair of primers for thermal amplification was from

140 not in accordance with the sequence described in SEQ ID NO. SEQ. 32. Preferably, the amplicon is produced using a CRW mRNA pool or cDNA obtained from such a pool. [0198] An amplicon having a sequence corresponding to ID NO. SEQ. 32, from nucleotide position 95 to nucleotide position 381, was cloned into the plasmid vector and sufficient plasmid DNA was recovered to allow in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA was produced and subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 32 from nucleotide position 95 to at least nucleotide position 381, except that the uridine residue is present at each position in which in ID NO. SEQ. 32, a thymidine residue is shown, and an RNA segment of an inverted complement or an antisense strand, which is essentially an inverted complement of the nucleotide sequence as shown in SEQ ID NO. SEQ. 32, from nucleotide position 381 to at least nucleotide position 95, with uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample was treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA were applied to CRW food in the bioassay as described above, and the larvae were allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence

141 presented in ID NO. SEQ. 32 showed significant growth retardation and mortality compared to controls.

EF1a homologous sequence [0199] Transcription elongation and transcription termination factors are necessary in metabolic processes and may be preferred targets for double-stranded RNA-mediated inhibition.

[0200] At least two CRW cDNA sequences have been identified for use in the present invention, which are predicted to encode homologues of 1 alpha-elongation factor (EF1a).

[0201] Amino acid sequence after translation of the CRW singleton cDNA sequence as shown in SEQ ID NO. SEQ. 36, showed homology to the amino acid sequence EF-1 alpha Drosophila melanogaster (GenBank Accession No. X06870). Other sequences for which they were predicted to encode EF ^ homologous proteins have also been identified in the CRW mid intestinal cDNA library. These sequences were aligned to form the Unigene sequence shown in ID NO. SEQ. 40, for which it has been envisaged that it encodes the EF ^ protein homolog, referred to herein as 48D. For several sequences contained within this singleton, they were predicted to encode amino acid sequences showing sequence homology to various EF ^ homologous proteins, including but not limited to EF ^ Bombyx mori (GenBank accession no. D13338), EF ^ Alternia species (GenBank access no. X03704), EF ^ Spragueia

142 leo (GenBank Accession No. U85680), EF1a Apis mellifera (GenBank Accession No. AF015267), EFla Anisakis simplex (GenBank Accession No. AJ250539), EFla Papaipema species (GenBank Accession No. AF151628), EFla Ephedrus persicae (GenBank Accession No. Z83663), EFlaa garamas (GenBank access no. AF044833), EFla Alysia lucicola (GenBank access no. Z83667), EFla Bracon species (GenBank access no. Z83669), EFla Histeromerus mystacinus (GenBank Accession No. Z83666) and EFla Caenorhabditis elegans (GenBank Accession No. U41534).

[0202] One CRW cDNA sequence for which it is envisaged to encode part of the EF1 homologue is herein referred to as B2 sequence and is shown in ID NO. SEQ. 36. ID NO. SEQ. 37 and ID NO SEQ. 38 correspond to primers for the amplification of the left and right genomes, respectively (i.e. a pair of primers with respect to the sequence corresponding to or constituting the inverted complement of the sequence set forth in SEQ ID NO. 36) for use in the production of amplicon from CRW genomic DNA, from a CRW mRNA pool, or from cDNA produced from such pools. The sequence of such amplicon should correspond to all or part of the CRW gene encoding EFla homologous protein. However, the amplicon nucleotide sequence obtained using CRW genomic DNA as template was incompatible with the cDNA sequence described in SEQ ID NO. SEQ. 36.

[0203] ID NO. SEQ. 37 and ID NO SEQ. 38 show primer sequences for thermal amplification. Each primer contains the 23-nucleotide T7 promoter sequence, respectively, from nucleotide position 1-23. Nucleotides 24-44 as shown in SEQ ID NO. SEQ. 37, they answer

143 nucleotides 8-29 as set forth in SEQ ID NO. SEQ. 36. Nucleotides 24-42, as shown in SEQ ID NO. SEQ. 38, correspond to the reverse sequence complement as shown in SEQ ID NO. SEQ. 36 from nucleotide 310 to 328. When using a primer pair consisting of

ID NO SEQ. 37 and NR genomic amplification

ID. SEQ. CRW DNA in the reaction as a template, a 933 base pair amplicon is produced containing the nucleotide sequence shown in NR

ID. SEQ. 39. The nucleotide sequence set out in SEQ ID NO. SEQ. 39 was incompatible with the nucleotide sequence from nucleotide position 8 to nucleotide position 328, as shown in ID NO. SEQ. 36. Preferably, the amplicon is produced using a CRW mRNA pool or cDNA obtained from such a pool, such as, for example, ID NO. SEQ. 36.

[0204] An amplicon having the sequence corresponding to ID NO was prepared using a CRW mRNA pool or cDNA obtained from such pools. SEQ. 36, from the nucleotide position to nucleotide position 328, and it was cloned into the plasmid vector. Enough plasmid DNA was recovered to allow in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA was produced and subjected to a bioassay; one segment of RNA - sense strand - consisting of the sequence shown in ID NO.

SEQ. 36 from nucleotide position 8 to at least nucleotide position 328, except that the uridine residue is present at any position in which in NR

ID. SEQ. 36 thymidine residue and episode are shown

144

Inverted RNA complement or antisense strand, which is essentially an inverted complement of the nucleotide sequence set forth in SEQ ID NO. SEQ. 36, from nucleotide position 328 to at least nucleotide position 8, with uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample was treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA were applied to CRW food in the bioassay as described above, and the larvae were allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 36 showed significant growth retardation and mortality compared to control.

[0205] To design a pair of primers for use in amplifying a CRW genomic DNA sequence encoding a 48D homologous protein sequence

EF1. ID NO SEQ. 41 and ID NO SEQ. 42 correspond to the primers for amplifying the left and right genomes, respectively (i.e. pair of primers) the sequence shown in ID NO. Was used. SEQ. 40. Each of ID NO. SEQ. 41 and ID NO SEQ. 42 contains the 23-nucleotide T7 promoter sequence at the nucleotide positions, respectively,

1-23. Nucleotides 24-41 as set forth in SEQ ID NO. SEQ. 41, correspond to nucleotides 61-79 as set forth in SEQ ID NO. SEQ. 40. Nucleotides 24-45 as set forth in SEQ ID NO. SEQ. 42, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 40

145 from nucleotide 562-583. When using a primer pair consisting of ID NO. SEQ. 41 and ID NO SEQ. 42 by amplification reaction with CRW genomic DNA as template, a 569 base pair amplicon containing the nucleotide sequence is produced as shown in ID NO. SEQ. 43, essentially corresponding to the part of the CRW genome encoding a protein having substantial identity with the EF1a protein also present in Drosophila melanogaster. The nucleotide sequence set out in SEQ ID NO. SEQ. 43, from nucleotide 24 to nucleotide 546, corresponds essentially to the nucleotide sequence set forth in SEQ ID NO. SEQ. 40, from nucleotide 61 to 583. No sequence differences were observed between the genome amplicon sequence and the corresponding sequence in the cDNA sequence.

[0206] An amplicon having a sequence corresponding to ID NO. SEQ. 43 were cloned into the plasmid vector and sufficient plasmid DNA was recovered to allow in vitro transcription by T7 RNA polymerase from converging T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA was produced and subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 43 from nucleotide position 24 to at least nucleotide position 546, with the difference that the uridine residue is present at each position in which in ID NO. SEQ. 43, a thymidine residue is shown, and an RNA segment being an inverted complement or an antisense strand, which is essentially an inverted complement of the nucleotide sequence as shown in SEQ ID NO.

146

SEQ. 43, from nucleotide position 546 to at least nucleotide position 24, with the uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample was treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA were applied to CRW food in the bioassay as described above, and the larvae were allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 43 showed significant growth retardation and mortality compared to controls.

Sequence homologous to the p28 subunit of the proteosome

26S [0207] The 26S protein is a large, ATP-dependent, multi-subunit protease that is highly conserved in all eukaryotes. It performs a general function in the selective removal of various short-lived proteins that are first covalently attached to ubiquitin and then degraded by the 26S proteasome complex. The ubiquitin pathway plays an important role in regulating the cell cycle through the specific degradation of many regulatory proteins, including mitotic cyclins and cyclin dependent kinase inhibitors such as p27 in mammalian cells. Inhibition of 26S proteasome synthesis and inhibition of the synthesis of its subunits may

147 thus be a preferred target for double-stranded RNA-mediated inhibition (Smith et al., Phys. Plant. 1997,

113:281-291).

[0208] The cDNA sequence derived from the CRW middle intestine library was identified as partially homologous to the amino acid sequence of the 26S subunit of the proteosome and used in the present invention. ID NO SEQ. 44 essentially corresponds to the nucleotide sequence of cDNA from the CRW mid intestine. Amino acid sequence arising after translation of ID NO. SEQ. 44 showed homology to the p28 subunit of the 26S proteasome (GenBank Accession No. AB009619). ID NO SEQ. 45 and ID NO SEQ. 46 correspond to primers for the amplification of the left and right genomes, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool or from cDNA produced from such pools. The amplicon sequence generated in this way should display a sequence that encodes all or part of the CRW gene encoding the homologue of the 26S proteosome subunit protein. Each of ID NO. SEQ. 45 and ID NO SEQ. 46 contains the 23-nucleotide T7 promoter sequence at the nucleotide positions, respectively,

1-23. Nucleotides 24-46 as set forth in SEQ ID NO. SEQ. 45, correspond to nucleotides 130-152 as shown in SEQ ID NO. SEQ. 34. Nucleotides 24-41 as set forth in SEQ ID NO. SEQ. 46, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 44, from nucleotide 423 to 440. When using a primer pair consisting of ID NO. SEQ. 44 and ID NO SEQ. 46 by amplification with CRW genomic DNA as template, 1113 amplicon produced

148 base pairs containing the nucleotide sequence as shown in SEQ ID NO. SEQ. 47. Sequence shown in SEQ ID NO. SEQ. 47 does not correspond substantially to the nucleotide sequence set forth in SEQ ID NO. SEQ. 44, therefore, was not compatible with the cDNA sequence described in SEQ ID NO. SEQ. 44. Preferably, the amplicon is produced using a CRW mRNA pool or cDNA derived from such a pool.

[0209] An amplicon having a sequence corresponding to ID NO. SEQ. 44, from nucleotide 130 to nucleotide 440, were cloned into the plasmid vector and sufficient plasmid DNA was recovered to allow in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA was produced and subjected to a bioassay; one segment of RNA - sense strand - consisting of the sequence shown in ID NO. SEQ. 44, from nucleotide position 130 to nucleotide position at least 440, with the difference that a uridine residue is present at any position in which ID NO. SEQ. 44, a thymidine residue is shown, and an RNA segment of an inverted complement or an antisense strand, which is essentially an inverted complement of the nucleotide sequence as set forth in SEQ ID NO. SEQ. 44, from nucleotide position 440 at least to nucleotide position 110, with the uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample was treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15

149 parts per million siRNA or dsRNA were applied to CRW food in the bioassay as described above, and the larvae were allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 44 showed significant growth retardation and mortality compared to control.

Sequence homologous to the juvenile hormone epoxy hydrolase [0210] The insect juvenile hormone controls and regulates various essential biological processes in the insect life cycle, including metamorphosis, reproduction and diapause, among others. It is necessary to reach the peak of juvenile hormone (JH) concentration in the hemolymph in a timely manner in the form of a larval pest, especially in butterfly and burly larvae, and then it must be degraded to eliminate the effects of the hormonal response. Enzymes involved in reducing juvenile hormone levels work effectively through two basic metabolic degradation pathways. One route involves juvenile hormone esterase (JHE), which hydrolyses the methyl ester to provide the corresponding acid. The other way uses juvenile hormone epoxide hydrolase (JHEH) to obtain epoxide hydrolysis, leading to diol formation. The contribution of JHE to JH degradation is well known and found to be no different between butterfly species and

150 coleopteran. Inhibition of JH esterase has been associated with major morphological changes, including larval migration, delayed pupation, and intermediate.

the development of deformed forms, in contrast, JHEH's contribution to JH metabolism is less understood and has been shown to differ between species, but recent studies have provided evidence suggesting that JHEH may be the main pathway for JH metabolism (Brandon J. Fetterolf, PhD thesis, North Carolina State University (February 10, 2002) Synthesis and Analysis of Mechanism Based Inhibitors of Juvenile Hormone Epoxide Hydrolase from Insect In any case, disruption of JH degradation pathways using gene suppression technology could be an effective target for pest inhibition double-stranded RNA.

[0211] A sequence homologous to the juvenile hormone epoxy hydrolase sequence for use in SEQ ID was identified. 48 corresponds to the nucleotide sequence of cDNA from the CRW mid intestine. Amino acid sequence after translation of ID NO. SEQ. 48 predicted homology to juvenile hormone epoxide hydrolase (JHEH) from Manduca sexta (GenBank accession number U46682). ID NO SEKW correspond to the left and right primers, respectively (i.e. pair of primers) for use in the production of amplicon from CRW genomic DNA, from a CRW mRNA pool or from cDNA produced from such pools. The sequence of such an amplicon should be

Trichoplusia ni). any of the invention's origin.

from CRW

ID NO

hereby and ID NO.

amplification

SEQ. 50 genome,

151 correspond to all or part of the CRW gene coding for a JHEH homologous protein. Each of ID NO. SEQ. 49 and ID NO SEQ. 50 contains the 23-nucleotide sequence of the T7 promoter at nucleotide positions, respectively,

1-23. Nucleotides 24-42 as set out in SEQ ID NO. SEQ. 49, correspond to nucleotides 7-26, as shown in SEQ ID NO. SEQ. 48. Nucleotides 24-44 as shown in SEQ ID NO. SEQ. 50, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 48, from nucleotide 360-380. When using a primer pair consisting of ID NO. SEQ. 49 and ID NO SEQ. 50 by amplification with CRW genomic DNA as template, a 95 base pair amplicon is produced containing the nucleotide sequence as shown in ID NO. SEQ. 52. The amplicon sequence did not match the cDNA sequence set forth in SEQ ID NO. SEQ. 48. Preferably, the amplicon is produced using a CRW mRNA pool or cDNA derived from such a pool as a template nucleotide sequence in an amplification reaction.

[0212] An amplicon having a sequence corresponding to NR

ID. SEQ. 48, from nucleotide 130 to nucleotide 440 are cloned into a plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and the sample is subjected to a bioassay; one segment of RNA - sense strand - consisting of the sequence shown in ID NO. SEQ. 48, from nucleotide position 7 to at least the nucleotide position

152

380, with the difference that the uridine residue is present at each position in which it is in ID NO. SEQ. 48 is shown a thymidine residue, and an RNA segment of an inverted complement or an antisense strand, which is essentially an inverted complement of the nucleotide sequence as shown in SEQ ID NO. SEQ.

at nucleotide 380, at least nucleotide 7, with found uridines

48, from to position itself in the Sample appropriate positions at the thymidine site. double-stranded RNA (dsRNA) is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to food for CRW in the bioassay as described above, and the larvae are allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 48 show significant growth retardation and mortality compared to control.

Sequence homologous to the chloride channel edema dependent protein [0213] It has been postulated that the chloride channel edema dependent proteins play a key role in eukaryotic cell systems nucleotide sequence expression of animal osmoregulation.

showing

Therefore, the ability to make an amino acid that shows homology with previously identified proteins of the edema-dependent sequence channel

153 chloride, may be a useful target for RNA inhibition in a pest.

[0214] The amino acid sequence of the swelling dependent chloride channel (SDCC) homologue was deduced from the CRW cDNA library and used in the present invention. ID NO SEQ. 53 corresponds essentially to the nucleotide sequence of cDNA from the CRW mid intestine. It was found that the amino acid sequence resulting from the translation of ID NO. SEQ. 53 was homologous to the SDCC protein in zebrafish Danio rerio (GenBank accession number Y08484). ID NO SEQ. 54 and ID NO. SEQ. 55 correspond to primers for genome amplification, left and right, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool, or from cDNA produced from such pools. The sequence of such amplicon should correspond to all or part of the CRW gene encoding the SDCC homologous protein. Each of the sequences of ID NO. SEQ. 54 and ID NO SEQ. 55 contains the 23-nucleotide T7 promoter sequence at nucleotide positions 1-23, respectively. Nucleotides 24-43 as set forth in SEQ ID NO. SEQ. 45, correspond to nucleotides 78-97 as shown in ID NO. SEQ. 53. Nucleotides 24-41 as set forth in SEQ ID NO. SEQ. 55, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 53, from nucleotide 332 to 349. Using a primer pair consisting of ID NO. SEQ. 54 and ID NO SEQ. 55 in amplification reaction with CRW genomic DNA as a template, a 318 base pair amplicon is produced containing a nucleotide sequence like

154 shown in ID NO. SEQ. 56, which corresponds essentially to the portion of the CRW genome encoding a protein having substantial identity with the SDCC protein. The nucleotide sequence set out in SEQ ID NO. SEQ. 56, from nucleotide 24 to nucleotide 295, essentially corresponds to the nucleotide sequence set forth in SEQ ID NO. SEQ. 53, from nucleotide 78 to 349.

[0215] An amplicon having a sequence corresponding to ID NO. SEQ. 56 is cloned into a plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and the sample is subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 56, from nucleotide position 24 to at least nucleotide position 295, except that the uridine residue is present at each position in SEQ ID NO. SEQ. 56 is shown a thymidine residue, and an RNA segment of an inverted complement or an antisense strand, which is essentially an inverted complement of the nucleotide sequence set forth in SEQ ID NO. SEQ. 56, from nucleotide position 295 to at least nucleotide position 24, with the uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to food for CRW in the bioassay as described above, and

155 the larvae can feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 56 shows significant growth inhibition and mortality compared to controls.

Sequence homologous to glucose-6-phosphate 1-dehydrogenase protein [0216] The glucose-6-phosphate 1-dehydrogenase (G6PD) protein catalyzes the oxidation of glucose-6-phosphate to 6-phosphogluconate with the simultaneous reduction of the oxidized form of the phosphate dinotoxide NAD + NADPADENN. NADPH is known in the art as an indispensable cofactor in many eukaryotic biosynthesis reactions and is known to maintain glutathione in its reduced form. Reduced glutathione acts as a scavenger of dangerous oxidative metabolites in eukaryotic cells and transforms harmful hydrogen peroxide into water with the enzyme glutathione peroxidase (Beutler et al., 1991, N. Engl. J. Med. 324: 169 - 174). Therefore, G6PD may be the preferred target for double-stranded RNA-mediated inhibition in invertebrate pests.

[0217] The amino acid sequence homologous to glucose-6-phosphate 1-dehydrogenase protein was deduced from the CRW cDNA library and used in the present invention. ID NO SEQ. 57 essentially corresponds to the nucleotide sequence of CRD cDNA from the middle intestine. It was found that the amino acid sequence resulting from the translation of ID NO. SEQ. 57 showed homology with

156 Proteinaceous fish species (GenBank Accession No. U72484). ID NO SEQ. 58 and ID NO SEQ. 59 correspond to primers for the amplification of the left and right genome, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool or from cDNA produced from such pools. The sequence of such amplicon should correspond to all or part of the CRW gene encoding the G6PD homologous protein. Each of ID NO. SEQ. 58 and ID NO SEQ. 59 contains the 23-nucleotide T7 promoter sequence at the nucleotide positions, respectively,

1-23. Nucleotides 24-46 as set forth in SEQ ID NO. SEQ. 58, correspond to nucleotides 113-136, as shown in SEQ ID NO. SEQ. 57. Nucleotides 24-45, as shown in ID NO. SEQ. 59 correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 57, from nucleotide 374 to 394. Using a primer pair consisting of ID NO. SEQ. 58 and ID NO SEQ. 59 by amplifying the reaction with CRW genomic DNA as template, a 328 base pair amplicon containing the nucleotide sequence is produced as shown in ID NO. SEQ. 60, essentially corresponding to the portion of the CRW genome encoding a protein having substantial identity with the G6PD protein. The nucleotide sequence set out in SEQ ID NO. SEQ. 60, from nucleotide 24 to nucleotide 305, essentially corresponds to the nucleotide sequence set forth in SEQ ID NO. SEQ. 57, from nucleotide 113 to 349.

[0218] An amplicon having a sequence corresponding to NR

ID. SEQ. 60 are cloned into the plasmid vector and sufficient plasmid DNA is recovered

157 enabling in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and the sample is subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 60, from nucleotide position 24 to nucleotide position at least 305, with the difference that the uridine residue is present at each position in SEQ ID NO. SEQ. 60 the thymidine residue is shown, and the RNA segment being an inverted complement or antisense strand, which is essentially an inverted complement of the nucleotide sequence set forth in SEQ ID No. SEQ. 60, from nucleotide position 305 to at least nucleotide position 24, with the uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to the food for CRW in the bioassay as described above, and the larvae are allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 60 shows significant growth inhibition and mortality compared to controls.

Sequence homologous to the Act42A protein [0219] Actin is the ubiquitous and highly conserved eukaryotic protein necessary for

158 predicted, homologous cell motility and movement (Lovato et al., 2001, Insect Mol. Biol. 20: 333-340). Numerous CRW cDNA sequences have been identified that are predicted to likely encode actin or proteins exhibiting actin protein related amino acid structure. Therefore, genes encoding actin homologs in pest cells may be useful targets for double-stranded RNA-mediated inhibition.

[0220] One of the Unigene clusters identified in the mid-intestinal cDNA library of maize Colorado beetle root (Cluster 156_1) consisted of several singleton EST sequences, each encoding whole to actin. After singletons to the cluster, the highest match sequence was obtained, as shown in ID NO. SEQ. 61, which was predicted to encode the actin protein homolog. Sequences of actin protein homologous to this group included, among others, Drosophila melanogaster actin 3 fragments, Helicoverpa armiger cytoplasmic A3 actin (GenBank Accession No. X97614), Drosophila melanogaster Actin (GenBank Accession No. X06383), the Glossarynose no access or part of the proteins aligning these actin with actin

GenBank

X05739).

[0221] ID NO. SEQ. 62 and ID NO SEQ. 63 correspond to primers for the amplification of the left and right genomes, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from an mRNA pool

159

SEQ. 63 sequences

CRW or from cDNA produced from such pools. The sequence of such an amplicon should correspond to all or part of the CRW gene encoding the actin-homologous protein. Each of ID NO. SEQ. 62 and ID NO SEQ. 63 contains the 23 nucleotide sequence of the T7 promoter at nucleotide positions 1-23, respectively. Nucleotides 24-45 as set forth in SEQ ID NO. SEQ. 62, correspond to nucleotides 14-35 as set forth in SEQ ID NO. SEQ. 61. Nucleotides 24-45 as set forth in SEQ ID NO.

correspond to the reverse complement shown in ID NO. SEQ. 61, from nucleotide 449 to 470. When using a primer pair consisting of

ID NO SEQ. 62 and ID NO SEQ. By amplifying the reaction with CRW genomic DNA as template, a 503 base pair amplicon is produced containing the nucleotide sequence set forth in SEQ ID NO. SEQ. 64, essentially corresponding to the portion of the CRW genome encoding a protein having substantial identity with the actin protein. The nucleotide sequence set out in SEQ ID NO. SEQ. 64, from nucleotide 24 to nucleotide 480, essentially corresponds to the nucleotide sequence set forth in SEQ ID NO. SEQ. 61, from nucleotide 14 to 470.

[0222] An amplicon having a sequence corresponding to ID NO. SEQ. 64 are cloned into the plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by T7 RNA polymerase from converging T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and its sample is subjected to a bioassay; one section of RNA - sense strand 160 consisting of the sequence shown in ID NO. SEQ. 64, from nucleotide position 24 to at least nucleotide position 480, except that the uridine residue is present at each position in SEQ ID NO. SEQ. 64, a thymidine residue is shown, and an RNA segment of an inverted complement or an antisense strand, which is essentially an inverted complement of the nucleotide sequence as set forth in SEQ ID NO. SEQ. 64, from nucleotide position 480 to at least nucleotide position 24, with the uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to the food for CRW in the bioassay as described above, and the larvae are allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 64 shows significant growth retardation and mortality compared to controls.

Sequence homologous to ADP 1 ribosylation factor [0223] ADP ribosylation factors have been shown to be necessary for cell function, playing an integral role in DNA damage repair, carcinogenesis, cell death and genomic stability. The possibility of selectively interfering with the transcription of ADP ribosylation factors in species would therefore be beneficial

161 invertebrate pests using double-stranded RNA inhibition.

[0224] A number of CRW cDNA sequences have been identified that are predicted to encode amino acid sequences showing homology to ADP ribosylation factor proteins. In particular, one of the Unigene clusters (Cluster 88_1) consisted of thirty (30) EST singletons, each of which was envisaged to encode all or part of the homologous proteins for actin. After aligning these singletons with the cluster, the highest agreement sequence obtained in ID NO was obtained. SEQ. 65. The translation of the CRW singleton cDNA sequence containing this cluster into the amino acid sequence predicted an amino acid sequence showing homology to ADP ribosylation factor homologues. ADP ribosylation factor protein sequences showing significant homology to the amino acid sequence from the deduced ORF within ID NO. SEQ. 65, including but not limited to ADP ribrosylation factor Drosophila melanogaster (GenBank accession no. Y10618), ADP ribosylation factor Drosophila obscura (GenBank accession no. AF025798), ADP ribosylation factor Anopheles gambiae (GenBank accession no. L11617) and ADP ribosylation factor <a href="http://pl.wikipedia.org/w/index.php?title=Lucilia_australijska&amp;action=edit&amp;redlink=1">Australian Lucilia </a>(Lucilia cuprina (GenBank accession no. AF218587).

[0225] ID NO. SEQ. 66 and ID NO SEQ. 67 correspond to primers for the amplification of the left and right genomes, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool or from cDNA produced from such pools. The sequence of such amplicon should correspond to all or part of it

162 CRW gene encoding a protein homologous to the ADP ribosylation factor. Each of ID NO. SEQ. 58 and ID NO SEQ. 59 contains the 23-nucleotide T7 promoter sequence at nucleotide positions 1-23, respectively. Nucleotides 24-42 as set out in SEQ ID NO. SEQ. 66 correspond to nucleotides 70-88, as shown in ID NO. SEQ. 65. Nucleotides 24-40 as shown in SEQ ID NO. SEQ. 67, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 65, from nucleotide 352 to 368. When using a primer pair consisting of ID NO. SEQ. 66 and ID NO SEQ. 67 by amplifying the reaction with CRW genomic DNA as template, a 345 base pair amplicon is produced containing the nucleotide sequence set forth in SEQ ID NO. SEQ. 68, essentially corresponding to the portion of the CRW genome encoding a protein having substantial identity with the ADP ribosylation factor protein. The nucleotide sequence set out in SEQ ID NO. SEQ. 60, from nucleotide 24 to nucleotide 322, essentially corresponds to the nucleotide sequence set forth in SEQ ID NO. SEQ. 65, from nucleotide 70 to 368.

[0226] An amplicon having a sequence corresponding to ID NO. SEQ. 68 is cloned into the plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and its sample is subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 68, from nucleotide position 24 to at least up to

163 nucleotide position 322, except that the uridine residue is present at each position in which ID NO. SEQ. 68, a thymidine residue is shown, and an RNA segment representing an inverted complement or an antisense strand, which is essentially an inverted complement of the nucleotide sequence as set forth in SEQ ID NO. SEQ. 68, from nucleotide position 322 to at least nucleotide position 24, with the uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to the food for CRW in the bioassay as described above, and the larvae are allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 68 shows significant inhibition of growth and mortality compared to controls.

Sequence of the IIB transcription factor protein [0227] Transcription elongation factors and transcription termination, as indicated above, are necessary in metabolic processes and may be preferred targets for double-stranded RNA-mediated inhibition to combat or eliminate invertebrate pest invasion.

[0228] A CRW cDNA sequence has been identified that is predicted to encode the amino acid sequence

164 showing homology to IIB transcription factor protein. Sequence from ID NO. SEQ. 69 served as the basis for constructing a pair of primers for use in amplifying the sequence within the CRW genome encoding mRNA, which formed the basis for this cDNA sequence.

[0229] ID NO. SEQ. 70 and ID NO. SEQ. 71 correspond to left and right thermal amplification primers, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool, or from cDNA produced from such pools.

The sequence of such an amplicon should correspond to all or part of the CRW gene encoding the protein homologous to IIB transcription factor. Each of ID NO. SEQ. 70 and ID NO. SEQ. 71 contains the 23-nucleotide T7 promoter sequence at the nucleotide positions, respectively,

1-23. Nucleotides 24-44 as shown in SEQ ID NO. SEQ. 70 correspond to nucleotides 2-24, shown in ID NO. SEQ. 69.

shown in ID NO. SEQ. 71 correspond to the inverse complement of the sequence set forth in SEQ ID NO. SEQ. 69, from nucleotide 409 to 429. Using a primer pair consisting of ID NO. SEQ. 10 and ID No. SEQ. In an amplification reaction with CRW genomic DNA as a template, a 472 base pair amplicon is produced containing the nucleotide sequence set forth in SEQ ID NO. SEQ. 72. The nucleotide sequence set out in SEQ ID NO. SEQ. 72, from nucleotide 24 to nucleotide 449, essentially corresponds to the nucleotide sequence set forth in SEQ ID NO. SEQ. 69, from nucleotide 4 to

429.

how

Nucleotides 24-44, as

165 [0230] An amplicon having a sequence corresponding to ID NO. SEQ. 72 is cloned into the plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by T7 RNA polymerase from converging T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and the sample is subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 72, from nucleotide position 24 to at least nucleotide position 449, with the difference that the uridine residue is present at each position in SEQ ID NO. SEQ. 72, a thymidine residue is shown, and an RNA segment being an inverted complement or an antisense strand, which is essentially an inverted complement of the nucleotide sequence set forth in SEQ ID NO. SEQ. 72, from nucleotide position 449 to at least nucleotide position 24, with the uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to food for CRW in the bioassay as described above, and the larvae are allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 72 show significant growth retardation and mortality compared to controls.

166

Chitinase homologous sequences [0231]

Chitin is an e (1 ^ 4) homopolymer

Nacetylglucosamine and is found in exoskeletons of insects. Chitin acetylglucosamine chitin synthase.

is produced from UDP-N in a structural catalysed reaction

Chitin is a polysaccharide homopolymer and there are many enzymatic steps involved in the construction of this highly branched and crosslinked structure. Chitin provides insects with shape, stiffness and support, and forms a scaffold to which internal organs such as muscles are attached. Chitin must also be degraded to some extent to mediate the stages involved in the process of moulting insects. It is therefore believed that inhibition of proteins in these pathways via double-stranded RNA would be useful as a means of controlling invertebrate pest infestation.

[0232] Information on the amino acid sequence was identified from the sequence translation of a cDNA library from the middle intestine of corn beetle root that showed homology to chitinase proteins. One highest concordance sequence for chitinase (Unigene Cluster No. 716_1, SEQ ID NO: 73) was generated by alignment of two singleton EST sequences. The second sequence of highest agreement for chitinase (Unigene Cluster No. 1238_1, SEQ ID NO. 77) generated from alignment of four singleton sequences. Amino acid sequences derived from ORF translation within these Unigene have been

167 classified as the amino acid sequence of beetle chitinase (Phaedon cochleariae) (GenBank accession number Y18011). ID NO. SEQ. 73 and ID NO SEQ. 77 served as the basis for constructing primer pairs for use in the amplification of two sequences within the CRW genome, from a CRW mRNA pool, or from cDNA produced from such pools. The sequence of such amplicon should correspond to all or part of the gene encoding the chitinase homologous protein.

[0233] ID NO. SEQ. 74 and ID NO SEQ. 75 correspond to the left and right thermal amplification primers, respectively (i.e. a pair of primers) for use in the production of an amplicon from nucleotide sequences derived from corn rootworm. The sequence of such amplicon should correspond to all or part of the CRW gene encoding the chitinase homologous protein. Each of ID NO. SEQ. 74 and ID NO SEQ. 75 contains the 23-nucleotide T7 promoter sequence at nucleotide positions 1-23, respectively. Nucleotides 24-42 as set out in SEQ ID NO. SEQ. 74, correspond to nucleotides 1-19 as shown in SEQ ID NO. SEQ. 73. Nucleotides 24-47 as shown in SEQ ID NO. SEQ. 75, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 73, from nucleotide 470 to 493. Using a primer pair consisting of ID NO. SEQ. 74 and ID NO SEQ. 75 in the amplification reaction with CRW genomic DNA as a template, a 472 base pair amplicon is produced containing the nucleotide sequence shown in NR

ID. SEQ. 76, which corresponds essentially to a portion of the genome

CRW coding for a protein showing homology to a protein

168 chitinase. The nucleotide sequence set out in SEQ ID NO. SEQ. 76, from nucleotide 24 to nucleotide 516, essentially corresponds to the nucleotide sequence set forth in SEQ ID NO. SEQ. 76, from nucleotide 1 to 493.

[0234] An amplicon having a sequence corresponding to ID NO. SEQ. 76 are cloned into the plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by T7 RNA polymerase from converging T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and the sample is subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 76, from nucleotide position 24 to nucleotide position at least 516, with the difference that the uridine residue is present at any position in which ID NO. SEQ. 76, a thymidine residue is shown, and an RNA segment of an inverted complement or antisense strand, which is essentially an inverted complement of the nucleotide sequence set forth in SEQ ID NO. SEQ. 76, from nucleotide position 516 to at least nucleotide position 24, with the uridines at the appropriate positions at the thymidine site. double-stranded RNA (dsRNA) is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to the food for CRW in the bioassay as described above, and the larvae are allowed to feed for 13 days. Larvae feeding whole food containing dsRNA

169 or part of the sequence set forth in SEQ ID NO. SEQ. 76 show significant growth inhibition and mortality compared to controls.

[0235] ID NO. SEQ. 78 and ID NO SEQ. 79 correspond to the left and right thermal amplification primers, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool, or from cDNA produced from such pools. The sequence of such an amplicon should correspond to all or part of the CRW gene as shown in SEQ ID NO. SEQ. 77, encoding a homologous chitinase protein. Each of ID NO. SEQ. 78 and ID NO SEQ. 79 contains the 23-nucleotide sequence of the T7 promoter at nucleotide positions 1-23, respectively. Nucleotides 24-44 as shown in SEQ ID NO. SEQ. 78, correspond to nucleotides 64-84, as shown in SEQ ID NO. SEQ. 77. Nucleotides 24-44 as shown in SEQ ID NO. SEQ. 79, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 77, from nucleotide 779 to 799. Using a primer pair consisting of ID NO. SEQ. 78 and ID NO SEQ. 79 in an amplification reaction using CRW genomic DNA as template, a 912 base pair amplicon is produced containing the nucleotide sequence set forth in SEQ ID NO. SEQ. 80. Alignment of the cDNA sequence shown in SEQ ID NO. SEQ. 77 and the amplicon sequence showed that there is a significant lack of similarity between the two sequences, resulting in only 32% sequence identity. Preferably, the amplicon is produced using a pair of primers, such as primers, to avoid such incompatibilities

170 presented in ID NO. SEQ. 78 to 79 and mRNA or cDNA as template.

[0236] An amplicon having a sequence corresponding essentially to ID NO. SEQ. 77 are cloned into the plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and the sample is subjected to a bioassay; one segment of RNA - sense strand - consisting of the sequence shown in ID NO. SEQ. 77, from nucleotide position 64 to at least nucleotide position 799, except that the uridine residue is present at each position in SEQ ID NO. SEQ. 77, a thymidine residue is shown, and an RNA segment being an inverted complement or an antisense strand, which is essentially an inverted complement of the nucleotide sequence set forth in SEQ ID NO. SEQ. 77, from nucleotide position 799 to at least nucleotide position 64, with uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to food for CRW in the bioassay as described above, and the larvae are allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 77 show significant growth retardation and mortality compared to controls.

171

Sequence homologous to the ubiquitin-binding enzyme [0237] The ubiquitin pathway plays an important role in regulating the cell cycle through the specific degradation of many regulatory proteins, including mitotic cyclins and cyclin dependent kinase inhibitors such as p27 in mammalian cells. The genes encoding ubiquitin and its associated components may therefore be the preferred target for double-stranded RNA-mediated inhibition. (Smith et al., Phys. Plant. 1997, 113: 281-291). The ubiquitin-dependent proteolytic pathway is one of the main routes through which intracellular proteins in eukaryotes are selectively destroyed. The combination of ubiquitin with substrate proteins is mediated by a significantly differentiated set of enzymes. Proteolytic targeting can also be regulated at the stages between the ubiquitination of the substrate and its degradation to peptides by 26S multi-subunit protease. The complexity of the ubiquitin system suggests its central role in the circulation of proteins in the regulation of eukaryotic cells, and assumes the participation of other proteins in the pathway, including ubiquitin activating enzyme, ubiquitin binding enzyme, ubiquitin protein ligase and components of the 26S proteasome subunits. It is therefore believed that the inhibition of proteins in this pathway by double-stranded RNA would be useful as a means to combat invertebrate pest infestation. [0238] A sequence was identified in the CRW cDNA library that is predicted to encode an amino acid sequence showing homology to the enzyme

172 attaching ubiquitin. ID NO SEQ. 81 served as the basis for constructing a pair of primers to be used to produce an amplicon containing all or part of the ubiquitin-attaching enzyme of corn rootworm.

[0239] ID NO. SEQ. 82 and ID NO SEQ. 83 correspond to primers for the amplification of the left and right genomes, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool or from cDNA produced from such pools. The sequence of such amplicon should correspond to all or part of the CRW gene encoding the protein homologous to the ubiquitin-binding enzyme. Each of ID NO. SEQ. 82 and ID NO SEQ. 83 contains the 23-nucleotide T7 promoter sequence at the nucleotide positions, respectively,

1-23. Nucleotides 24-42 as set out in SEQ ID NO. SEQ. 82, correspond to nucleotides 16-34, as shown in ID NO. SEQ. 81. Nucleotides 24-42, as shown in SEQ ID NO. SEQ. 83, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 69, from nucleotide 295 to 313. Using a primer pair consisting of ID NO. SEQ. 82 and ID NO SEQ. 83 in an amplification reaction with CRW genomic DNA as a template, a 344 base pair amplicon is produced containing the nucleotide sequence set forth in SEQ ID NO. SEQ. 84, essentially corresponding to the part of the CRW genome encoding a protein having homology to the ubiquitin-binding enzyme protein. The nucleotide sequence set out in SEQ ID NO. SEQ. 84, from nucleotide 24 to nucleotide 321, corresponds essentially

173 the nucleotide sequence set forth in SEQ ID NO. SEQ. 81, from nucleotide 16 to 313.

[0240] An amplicon having a sequence corresponding to ID NO. SEQ. 84 are cloned into a plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by RNA polymerase

T7 from converging T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and the sample is subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 84, from nucleotide position 24 to at least nucleotide position 253, with the difference that the uridine residue is present at each position in SEQ ID NO. SEQ. 84 the thymidine residue is shown, and the RNA segment being an inverted complement or antisense strand, which is essentially an inverted complement of the nucleotide sequence set forth in SEQ ID No. SEQ. 84, from nucleotide position 253 to at least nucleotide position 24, with the uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to the food for CRW in the bioassay as described above, and the larvae are allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 84 show significant growth retardation and mortality compared to controls.

174

Sequence homologous to glyceraldehyde-3-phosphate dehydrogenase [0241] In most organisms, the glycolytic pathway is an essential pathway and is involved in the production of metabolic energy from glucose degradation. One of the important enzymes in the second stage of the glycolytic pathway is glyceraldehyde-3-phosphate dehydrogenase (G3PDH), which, in the presence of NAD + and inorganic phosphates, catalyzes the oxidation of 3-phosphoglyceraldehyde to 3-phosphoglyceryl phosphate with the formation of NADH. An important component of this reaction is the storage of energy through the formation of NADH. Genes encoding enzymes associated with the glycolytic pathway, and in particular genes encoding enzymes involved in steps useful in the formation of energy reserves, may be particularly useful targets for double-stranded RNA-mediated inhibition in invertebrate pest species.

[0242] A sequence was identified in the CRW cDNA library that is predicted to encode an amino acid sequence having homology to the glyceraldehyde-3-phosphate dehydrogenase (G3PDH) enzyme. The highest compliance sequence for the cluster, shown in ID NO. SEQ. 85, was composed of overlapping sequences of three EST singleton sequences. Amino acid sequence resulting from ORF translation within the nucleotide sequence of ID NO. SEQ. 85 showed homology with the G3PDH amino acid sequence derived from the G3PDH Crytococcus curvatus gene (no.

175 presented in ID NO. is part of the GenBank AF126158 access protein) and with the amino acid sequence of the G3PDH protein from the organism Drosophila pseudoobscura (GenBank Accession No. AF025809). With respect to the amino acid sequence resulting from the translation of the SEQ ID sequence. Therefore, 85 was predicted that the G3PDH CRW enzyme. The nucleotide sequence set out in SEQ ID NO. SEQ. 85 it served as the basis for constructing a pair of primers to be used for thermal amplification for the amplification of the coding sequence of the G3PDH enzyme sequence from CRW.

[0243] ID NO. SEQ. 86 and ID NO SEQ. 87 correspond to the left and right thermal amplification primers, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool, or from cDNA produced from such pools. The sequence of such an amplicon should correspond to all or part of the CRW gene encoding the G3PDH homologous protein. Each of ID NO. SEQ. 86 and ID NO SEQ. 87 contains the 23-nucleotide T7 promoter sequence at nucleotide positions 1-23, respectively. Nucleotides 24-45 as set forth in SEQ ID NO. SEQ. 86, correspond to nucleotides 103-124, as shown in SEQ ID NO. SEQ. 85. Nucleotides 24-45 as set forth in SEQ ID NO. SEQ. 87, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 85, from nucleotide 573 to 594. Using a primer pair consisting of ID NO. SEQ. 86 and ID NO SEQ. 87 in an amplification reaction with CRW genomic DNA as a template, a 538 base pair amplicon is produced containing the nucleotide sequence set forth in SEQ ID NO. SEQ. 88, essentially corresponding to part of the genome

176

CRW encoding a protein having homology to the ubiquitin-binding enzyme protein. The nucleotide sequence set out in SEQ ID NO. SEQ. 88, from nucleotide 24 to nucleotide 515, essentially corresponds to the nucleotide sequence set forth in SEQ ID NO. SEQ. 85, from nucleotide 103 to 594.

[0244] An amplicon having a sequence corresponding to ID NO. SEQ. 88 is cloned into a plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by RNA polymerase

T7 from converging T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and the sample is subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 88, from nucleotide position 24 to at least nucleotide position 515, except that the uridine residue is present at each position in SEQ ID NO. SEQ. 88 the thymidine residue is shown, and the RNA segment being an inverted complement or antisense strand, which is essentially an inverted complement of the nucleotide sequence set forth in SEQ ID NO. SEQ. 88, from nucleotide position 515 to at least nucleotide position 24, with uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to the food for CRW in the bioassay as described above, and the larvae are allowed to feed for 13 days. Larvae feeding

177 food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 88 show significant growth retardation and mortality compared to controls.

Sequence for ubiquitin B [0245] As described above, the ubiquitin pathway plays an important role in regulating the cell cycle by specifically degrading many regulatory proteins, including mitotic cyclins and cyclin dependent kinase inhibitors such as p27 in mammalian cells. The genes encoding ubiquitin and its associated components may therefore be the preferred target for double-stranded RNA-mediated inhibition. (Smith et al., Phys. Plant. 1997, 113: 281-291).

[0246] A sequence from the CRW cDNA library was identified, which is predicted to encode an amino acid sequence showing homology to a protein called ubiquitin B herein. The highest consensus sequence for the Unigene cluster, shown in SEQ ID NO. SEQ. 89, was composed of overlapping sequences from four EST singleton sequences. Amino acid sequence resulting from translation of ID NO. SEQ. 89 showed homology to the amino acid sequence of Amoeba proteus polyubiquitin (GenBank accession no. AF034789) and the ubiquitin protein sequence from Drosophila melanogaster (GenBank accession no. M22428). It was therefore thought that the amino acid sequence resulting from the translation of the sequence set forth in SEQ ID NO. SEQ. 89 encodes ubiquitin B. ID NO. SEQ. 89 served as a basis

178 for constructing a pair of primers for use in a thermal amplification reaction to amplify the nucleotide sequence encoding all or part of the amino acid sequence of ubiquitin B of corn rootworm.

[0247] ID NO. SEQ. 90 and ID NO SEQ. 91 correspond to the left and right thermal amplification primers, respectively (i.e. a pair of primers) for use in the production of an amplicon from CRW genomic DNA, from a CRW mRNA pool, or from cDNA produced from such pools. The sequence of such amplicon should correspond to all or part of the CRW gene encoding the ubiquitin B homologous protein. Each of ID NOs. SEQ. 90 and ID NO SEQ. 91 contains the 23-nucleotide T7 promoter sequence at nucleotide positions 1-23, respectively. Nucleotides 24-40 as shown in SEQ ID NO. SEQ. 90, correspond to nucleotides 62-78, as shown in ID NO. SEQ. 89. Nucleotides 24-47 as shown in SEQ ID NO. SEQ. 91, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 89, from nucleotide 399 to 422. Using a primer pair consisting of ID NO. SEQ. 90 and ID NO SEQ. 91 in an amplification reaction with CRW genomic DNA as a template, a 407 base pair amplicon is produced containing the nucleotide sequence set forth in SEQ ID NO. SEQ. 92, corresponding substantially to the portion of the CRW genome encoding a protein having homology to the ubiquitin-binding enzyme protein. The nucleotide sequence set out in SEQ ID NO. SEQ. 92, from nucleotide 24 to nucleotide 384, corresponds essentially

179 the nucleotide sequence set forth in SEQ ID NO. SEQ. 89, from nucleotide 62 to 422.

[0248] An amplicon having a sequence corresponding to ID NO. SEQ. 92 is cloned into the plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by T7 RNA polymerase from convergent T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and the sample is subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO. SEQ. 92, from nucleotide position 24 to nucleotide position at least 384, with the difference that a uridine residue is present at any position in SEQ ID NO. SEQ. 92, a thymidine residue is shown, and an RNA segment of an inverted complement or an antisense strand, which is essentially an inverted complement of the nucleotide sequence set forth in SEQ ID NO. SEQ. 92, from nucleotide position 384 to at least nucleotide position 24, with uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to the food for CRW in the bioassay as described above, and the larvae are allowed to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 92 show significant growth retardation and mortality compared to controls.

180

Juvenile hormone esterase homologue [0249] As indicated above, the insect juvenile hormone controls and regulates various necessary biological processes in the insect life cycle, including metamorphosis, reproduction and diapause, among others. Disruption of the JH synthesis or degradation pathway using gene suppression technology could be an effective target for double-stranded RNA-mediated pest inhibition. [0250] A homologous sequence to the juvenile hormone esterase sequence derived from CRW has been identified for use in the present invention. ID NO. SEQ. 93 essentially corresponds to the nucleotide sequence of cDNA from the CRW mid intestine. For the amino acid sequence after translation of ID NO. SEQ. Homology to juvenile hormone esterase (JHE) was predicted. ID NO. SEQ. 94 and ID NO SEQ. 95 correspond to the left and right thermal amplification primers, respectively (i.e. pair of primers) for use in the production of amplicon from CRW genomic DNA, from a CRW mRNA pool or from cDNA produced from such pools. The sequence of such amplicon should correspond to all or part of the CRW gene encoding the JHE homologous protein. Each of ID NO. SEQ. 94 and ID NO SEQ. 95 contains the 23-nucleotide T7 promoter sequence at nucleotide positions 1-23, respectively. Nucleotides 24-45 as set forth in SEQ ID NO. SEQ. 94, correspond to nucleotides 58-79 as set forth in SEQ ID NO. SEQ. 93. Nucleotides 24-46 as shown in SEQ ID NO. SEQ. 95, correspond to the reverse complement of the sequence set forth in SEQ ID NO. SEQ. 93, from nucleotide 338 to 360. When using a pair

181 primers consisting of ID NO. SEQ. 94 and ID NO SEQ. 95 amplification reaction with CRW genomic DNA as template produces a 348 base pair amplicon containing the nucleotide sequence set forth in SEQ ID NO. SEQ. 170. Preferably, the amplicon is produced using a CRW mRNA pool or cDNA derived from such a pool as a template nucleotide sequence in an amplification reaction.

[0251] An amplicon having a sequence corresponding to ID NO. SEQ. 170 is cloned into a plasmid vector and sufficient plasmid DNA is recovered to allow in vitro transcription by RNA polymerase

T7 from converging T7 promoters embedded at both ends of the cloned fragment. Double-stranded RNA is produced and the sample is subjected to a bioassay; one RNA segment - the sense strand consisting of the sequence shown in ID NO.

SEQ. 170, from nucleotide position 45 to at least nucleotide position 302, except that the uridine residue is present at any position in which in NR

ID. SEQ. 96 thymidine residue and episode are shown

Inverted RNA complement or antisense strand, which is essentially an inverted complement of the nucleotide sequence as set forth in SEQ ID NO. SEQ. 170, from nucleotide position 302 to at least nucleotide position 45, with the uridines at their respective positions at the thymidine site. A double-stranded RNA (dsRNA) sample is treated with Dicer or RNase III to produce enough small interfering RNA (siRNA). Samples containing 0.15 parts per million siRNA or dsRNA are applied to food

182 for CRW in the bioassay as described above, and allows larvae to feed for 13 days. Larvae feeding on food containing dsRNA corresponding to all or part of the sequence set forth in SEQ ID NO. SEQ. 170 show significant growth retardation and mortality compared to controls.

[0252] The ten double-stranded RNA molecules listed above were tested in a bioassay in parallel with small interfering RNAs made from double-stranded RNA molecules. Double-stranded RNA sequence samples or small interfering RNA samples generated from double-stranded RNA sequence samples, each of which corresponds to the amino acid sequences assigned to selected target gene homologues, including the V-ATPase 40 kDa homologue, EF-1 alpha homologue, p28 subunit homologue 26S, homolog juvenile hormone epoxy hydrolase, CHD3 homologue, beta-tubulin homologue, two chitinase homologues, transcription factor IIB homologue of juvenile hormone esterase (SEQ ID NO 35, SEQ ID NO, respectively)

and the homologue corresponds

39, ID NO.

SEQ. 47, ID NO. SEQ. 52, ID NO. SEQ. 7, ID NO. SEQ. 21, ID NO. SEQ. 76, ID NO. SEQ. 80, ID NO. SEQ. 72 and ID NO SEQ. 96), used in insect feed at a concentration of 10 parts per million (30 microliters of a solution containing double-stranded RNA samples adjusted to the appropriate concentration was added to the wells of a microtiter plate containing 200 microliters of insect food per well). In total, 18 wells were used for each sample. After diffusion of RNA samples into food, individual wells were placed in each well

183 larvae in the first developmental stage. The bioassay was carried out as described above for 13 days and morbidity and mortality were monitored daily. As a positive control to observe insecticide-specific bioactivity of the root beetle pest, the amino acid sequence of the insecticidal variant Cry3Bb1 crystal protein, called insecticidal protein 11231 in English et al. (US Patent No. 6,642,030) was used. Cry3Bb was used in the diet as outlined in English et al. With the difference that the concentration of Cry3Bb in the diet was adjusted to 200-300 parts per million. A separate control sample, treated only with buffer or water, was also included in the test. As an additional negative control, a double-stranded RNA control sample and a small interference RNA sample prepared from double-stranded RNA sequence samples (MEGAscript® RNAi Kit, Ambion, Austin, Texas, USA) were also included.

[0253] Initial evaluation using double-stranded RNA molecules derived from these ten sequences indicated that the larvae allowed to feed on double-stranded RNA containing food corresponding to a 40 kDa V-ATPase homolog (SEQ ID NO 35), CHD3 homolog (SEQ ID NO 7) and beta-tubulin homologue (SEQ ID NO 31), showed significant mortality compared to controls. Based on these results, additional bioassays were performed to determine if small interfering double-stranded RNA molecules would be more effective than full-length double-stranded RNA molecules.

184

Sequence homologous to tubulin alpha [0254] Eukaryotic cells generally use cytoskeletal structural elements that are important not only as a mechanical scaffold, but also to maintain the shape of the cell. Semi-flexible microfibers give cells mobility, facilitate mitotic division (cytokinesis), and in vertebrate and invertebrate animals - they are responsible for muscle contraction. Relatively rigid microtubules, which consist of tubulin alpha and beta proteins, play an important role in acting as a type of highway for the transport of vesicles and organelles and for the separation of chromosomes during mitosis (kariokinesis). Flexible intermediate fibers provide at least additional strength to the entire cellular structure. It is also known that the cytoskeleton is involved in signaling through cell cytoplasm. Considering these functions, it is believed that any disruption of the cytoskeleton or even subtle changes in its integrity can cause pathological consequences for the cell.

[0255] At least one sequence in the cDNA library has been identified that is predicted to encode an amino acid sequence showing homology to a protein referred to herein as tubulin alpha, more specifically, referred to herein as ID NO. SEQ. 163, as shown in the sequence listing. It is believed that as a result of translation into the amino acid sequence of the sequence set forth in NR

ID. SEQ. 163, tubulin alpha protein or a fragment thereof is formed. Sequence from ID NO. SEQ. 163 served as

185 a basis for constructing a sequence that is predicted to form double-stranded RNA when expressed in E. coli from the T7 promoter or in a plant from a plant promoter. The sequence that serves as the basis for such a double-stranded RNA coding sequence is ID NO. SEQ. 97 as shown in the sequence listing, from the nucleotide at position 58 to the nucleotide at position 1010. This sequence can be expressed as an RNA molecule and can be purified and tested in in vitro feeding assays to determine inhibition of corn beetle root disease.

[0256] Above the nucleotide sequence set forth in SEQ ID NO. SEQ. 97, from nucleotide at position 58 to nucleotide at position 1010, the T7 RNA polymerase promoter was introduced and RNA (pIC17527) was produced from this construct. Such RNA was tested in triplicate in an in vitro feeding test against corn rootworm, beta tubulin positive control (described above), 200 ppm Cry3Bb and untreated control, and average mortality was determined. Untreated control samples showed less than 3-5% mortality, while all other test samples showed 20 to 55% mortality. Cry3Bb samples showed 20 to 36% mortality, while pIC17527 samples (at 15 ppm) showed 38 to 45% mortality. Samples D8 (beta tubulin as outlined above), also at 15 ppm, showed 38 to 52% mortality. Based on these results, the tubulin alpha construct was placed under the control of a promoter acting in plants, used to transform transformation plants into

186 maize, and transformation events arising from the transformation were examined for their ability to resist the invasion of Colorado beetle root beetle. [0257] The roots of R0 maize plants transformed with the nucleotide sequence set out in SEQ ID NO: were examined. SEQ. 97. Briefly, the sequence coding for the dsRNA construct of SEQ ID NO. SEQ. 97, as described above, was linked at the 5 'end to a sequence that consisted of an e35S promoter operably linked to the maize hsp70 intron, and at the 3' end to a sequence of transcription termination and NOS3 'polyadenylation. This expression cassette was placed below the glyphosate selection cassette. These connected cassettes were then placed in a Agrobacterium tumefaciens-based transformation vector operating in plants and the new vector was named pMON72829 (alpha tubulin dsRNA construct), used to transform corn tissue for glyphosate tolerance, events selected and transferred to soil. The roots of R0 plants were fed larvae of western corn rootworm (WCR, Diabrotica virifera). The roots of transgenic maize were detached and placed in petri dishes with MS0D medium containing antibiotics and glyphosate for in vitro selection. Two WCR larvae per root were placed on each plate using the tip of a thin paint brush. The plates were sealed using Parafilm to prevent escape of larvae. Test plates were placed at 27 ° C in a 60% RH Percival incubator in complete darkness. Pollution contamination and quality were monitored. After six days

187 foraging on root tissue, larvae were transferred to WCR food in a 96 well plate. The larvae were allowed to feed for eight days, so the entire test lasted 14 days. Larvae weight and survival were recorded for analysis. One-way analysis of larval weight data and Dunnett's test were performed to look for statistical significance compared to LH244 untransformed negative control. WCR larvae were significantly inhibited (α = 0.05) after feeding on two events, ZM_S125922 and ZM_S125938, and compared to the growth of larvae fed with negative control plants (p &lt;0.02). The larvae feeding on negative control plants showed an average larvae weight of 0.6 to 0.8 mg, while larvae feeding on transgenic roots had an average larvae weight of 0.1 to 0.2 mg.

[0258] Transgenic maize (R0) plants produced using pMON72829 after reaching the appropriate size were planted in approximately 25 cm pots containing Metromix soil. When the plants reached the V4 growth stage, about 1000 eggs of western corn rootworm (WCR, Diabrotica virifera) were placed in the root zone. Non-transgenic maize of the same genotype was attacked at a similar growth stage to serve as a negative control. Eggs were preincubated so that hatching occurred within 24 hours of attack.

The larvae were allowed to feed on root systems for 3 weeks. Plants were removed from the soil and rinsed so that the roots could be evaluated for feeding

188 larvae. The degree of root damage was assessed using a Node Injury Scale (NIS) to estimate the level of damage, where 0 means no damage, 1 means that one root node was cut to a height of 1.5 cm, 2 means that 2 nodes were trimmed and 3 means that 3 nodes were trimmed. Because the plants used were directly taken from the culture for tissue evaluation because transgenic larva feeding events, after transformation and transformation are unique, only one plant per event was evaluated and statistics were not available. All plants in the test showed signs of larvae feeding indicating a successful invasion. Negative control plant roots were moderately to severely damaged, with an average of 1.9 on the node damage scale. Individual plants from eight different transgenic events were tested. The roots of three of these plants provided excellent control with an average of 0.2 or less on the node damage scale. Roots from two transgenic plants showed moderate foraging damage, and three other transgenic plants showed no control against larvae feeding. These data indicate that the double nucleotide sequence coding for the RNA sequence that can form dsRNA is fully capable of providing protection against invasion of root pests after expression in transgenic plants and that the plant is a root pest pest food.

189 [0259] One explanation for the lack of consistent observed mortality or other effects when using sequences selected for suppression of genes including EF1alpha, 26S proteasome subunit and various other cDNA sequences may be that for these genes there are expressed homologues present within the population genes that code for proteins that have similar functions but exhibit sufficient sequence differences so that the RNAi pathway doesn't work like that, that the homologue is suppressed using the sequences selected for suppression.

Example 2 [0260] This example illustrates the significant inhibition of the pest obtained by feeding the invertebrate pest with food containing double-stranded RNA sequences derived from that pest.

[0261] Artificial food was prepared sufficient to culture corn beetle root larvae using double-stranded RNA sequence samples derived from six different cDNA sequence libraries for corn root beetle. Corn beetle larvae were allowed to feed on food for several days and mortality, morbidity and growth inhibition were monitored compared to Colorado root beetle, which was only forage on control food.

nucleotide, which were used in the food, were derived from the sequences set forth in SEQ ID NO. SEQ. 35, ID NO.

SEQ. 39, ID NO. SEQ. 47, ID NO. SEQ. 52, ID NO.

allowed

sequences

190

SEQ. 7 and ID NO. SEQ. 31, each of which corresponds to the nucleotide sequences derived from the corn root beetle cDNA library for which the deduced amino acid sequence after translation corresponds, respectively, to proteins that have been classified as a 40 kDa V-ATPase homologue, EF1a homologue, 26S proteasome subunit homologue juvenile hormone epoxy hydroxylase, CHD3 homologue and β-tubulin homologue.

[0262] Double-stranded RNA (dsRNA) corresponding to these sequences were prepared as described above. siRNA was produced by cleavage of the corresponding dsRNA using the RNAse III enzyme, which is known to cleave dsRNA into 12-15-bp fragments of dsRNA containing 2 to 3 nucleotide 3 'overhangs and 5'-phosphate and 3'-hydroxyl ends . It was expected that siRNAs produced in this way would have the same properties as siRNAs that would be produced by the Dicer enzyme participating in the eukaryotic RNAi pathway. [0263] Samples of dsRNA and siRNA were applied to the food for CRW as indicated above in an amount of 0.15 ppm. 12 individual corn beetle larvae were tested separately for each dsRNA or siRNA sample as indicated above, and the results were evaluated after 13 days. [0264] A significant reduction in larvae weight (p &lt;0.05) was observed when the larvae were feeding on food containing 0.15 ppm dsRNA having the sequence set forth in ID NO. SEQ. 35, ID NO. SEQ. 52, ID NO. SEQ. 7 and ID NO. SEQ. 31 compared to untreated control plants (UTC). siRNA corresponding to the sequences shown in SEQ ID NO. SEQ.

191

35, ID NO. SEQ. 39, ID NO. SEQ. 47 and ID NO SEQ. 7 also resulted in a significant reduction in larvae weight (p &lt;0.05). However, the sample size of the larvae was insufficient to establish with certainty that the dsRNA or siRNA molecules that gave the largest decrease in larvae weight compared to the control were the result of accidental changes or were obviously the result of double-stranded RNA inhibition of certain biological functions in corn larvae Colorado beetle Based on these results, the RNA sequences corresponding to ID NO. SEQ. 35, ID NO. SEQ. 39, ID NO. SEQ. 7 and ID NO. SEQ. 31 were therefore re-evaluated on a larger sample of larvae.

[0265] In this evaluation, dsRNA or siRNA samples were applied to each of 72 wells for each of the four RNA sequences. 0.15 ppm dsRNA or siRNA was applied to each well as described above, applying a volume of 30 microliters containing RNA to the food surface and allowing the sample to soak and dry the food surface. Individual larvae were added to each well and incubated for 13 days. The larvae mortality and morbidity were assessed and the surviving larvae weight was determined. The results of the bioassay are shown in Table 1.

192

Table 1. Biological test results

<td>RNA</td><td>% mortality</td><td>Weight (mg)</td><td>STE</td>

<td colspan="4">Results of the dsRNA bioassay</td>

<td>ID NO SEQ. 35</td><td> 62,25</td><td> 0,42</td><td> 0,12</td>

<td>ID NO SEQ. 39</td><td> 50,5</td><td> 0,39</td><td> 0,05</td>

<td>ID NO SEQ. 7</td><td> 47,67</td><td> 0,37</td><td> 0,05</td>

<td>ID NO SEQ. 31</td><td> 92,24</td><td> 0,27</td><td> 0,05</td>

<td>Control dsRNA¹</td><td> 21,08</td><td> 0,58</td><td> 0,08</td>

<td>Cry3Bb²</td><td> 42,08</td><td> 0,21</td><td> 0,03</td>

<td>UTC</td><td> 5,58</td><td> 1,24</td><td> 0,33</td>

<td colspan="4">Results of the siRNA bioassay</td>

<td>ID NO SEQ. 35</td><td> 21,11</td><td> 0,45</td><td> 0,06</td>

<td>ID NO SEQ. 35</td><td> 21,39</td><td> 1,31</td><td> 0,16</td>

<td>ID NO SEQ. 7</td><td> 15,83</td><td> 0,73</td><td> 0,09</td>

<td>ID NO SEQ. 31</td><td> 20,00</td><td> 0,39</td><td> 0,07</td>

<td>Control siRNA¹</td><td> 6,52</td><td> 1,10</td><td> 0,16</td>

<td>Cry3Bb²</td><td> 27,78</td><td> 0,49</td><td> 0,05</td>

<td>UTC</td><td> 9,45</td><td> 1,25</td><td> 0,18</td>

<td colspan="3">All siRNA samples at 0.15 ppm per well</td><td></td>

<td>UTC - 10 mM Tris HCl</td><td>7, pH, 5</td><td></td><td></td>

<td colspan="3">STE - standard error</td><td></td>

<td>1 - phage dsRNA</td><td colspan="3">λ, Epicenter Technologies, Madison,</td>

<td colspan="2">Wisconsin, USA, in a bioassay</td><td colspan="2">dsRNA; MEGAscript®</td>

<td colspan="4">RNAi Kit, Ambion, Austin, Texas, USA in bioassay</td>

<td>siRNA</td><td></td><td></td><td></td>

<td>2 - Variant 11231</td><td colspan="3">Cry3Bb in the amount of 300 ppm in the test</td>

<td colspan="4">biological dsRNA, 200 ppm in the siRNA bioassay</td>

193 [0266] All samples were compared using the Tukey HSD method instead of any single control. Significant inhibition of larvae growth was observed for each dsRNA or siRNA tested, as assessed by a mean reduction in the weight of surviving larvae compared to untreated control larvae. More importantly, double-stranded, small interfering RNA samples showed the ability to cause mortality and morbidity (based on reduced larvae weight) at a level that is at least as effective as the positive control sample variant 11231 Cry3Bb. These results suggest that any double-stranded RNA molecule derived from the RNA information sequence present in corn beetle root cells may be effective when it is supplied to Colorado root beetle in its diet to suppress the invasion of a plant species.

Example 3 [0267] This example shows nucleotide sequences for expression in a plant cell and the effect of providing such nucleotide sequences in the diet of corn rootworm.

[0268] The CHD3 coding sequence, derived from the corn rootworm cDNA library, was used to construct the nucleotide sequence encoding the stabilized double-stranded RNA. The cDNA sequence shown in SEQ ID NO. SEQ. 171, coding for the part of the ortholog or homologue of the CHD3 amino acid sequence,

194 was used to construct a pair of primers for use in the thermal amplification reaction using genomic template DNA of corn rootworm. The primer pair as shown in ID NO. SEQ. 5 and ID NO. SEQ. 6, allowed for amplification from the genome of a double-stranded amplicon, one strand of which exhibited the sequence set forth in ID NO. SEQ. 7. From the nucleotide sequence set forth in SEQ ID NO. SEQ. 7 three sections of the nucleotide sequence were generated.

The first nucleotide segment (SEQ ID NO: 174) was generated using the nucleotide sequence set forth in SEQ ID NO. SEQ. 7 as a template in the thermal amplification reaction, together with a pair of thermal amplification primers with the sequences shown in ID NO. SEQ. 8 and ID NO. SEQ. 9. A second nucleotide segment (SEQ ID NO: 13) was prepared using the nucleotide sequence set forth in SEQ ID NO: SEQ. 7 as a template in the thermal amplification reaction, together with a pair of thermal amplification primers of the sequence set forth in ID NO. SEQ. 11 and ID NO. SEQ. 12. The third nucleotide segment (SEQ ID NO: 16) was prepared using the nucleotide sequence set forth in SEQ ID NO: 1. SEQ. 7 as a template in the thermal amplification reaction, together with a pair of thermal amplification primers with the sequences shown in ID NO. SEQ. 14 and ID NO SEQ. 15. The 3 'end of one of the threads of the first segment is complementary to the 3' end of one of the threads of the second segment so that in the thermal amplification reaction containing both these segments, these complementary ends hybridize and allow polymerase-mediated extension of both strands from their

195 corresponding 3 'ends. The 3 'end of the second strand of the second section is complementary to the 3' end of one of the strands of the third section so that in the thermal amplification reaction containing both these sections, these complementary ends hybridize and allow polymerase mediated elongation of both strands from their respective 3 'ends. In the thermal amplification reaction containing all three sections and their complementary sequences, i.e. first, second and third segment, together with primer sequences for thermal amplification, as shown in ID NO. SEQ. 8 and ID NO. SEQ. 15, a new sequence is prepared as shown in SEQ ID NO. SEQ. 17, which when placed under the control of a promoter that functions in plants, can produce an RNA nucleotide sequence substantially identical to the sequence set forth in ID NO. SEQ. 17, with the difference that uridine residues are present at the site of thymidine residues. This RNA nucleotide sequence can form into a stabilized RNA molecule due to the inverse complementarity of the third segment to the first segment in which the portion of ID NO. SEQ. 17 corresponding to the third segment, from nucleotide position 303 to nucleotide position 473, hybridizes to part of ID NO. SEQ. 17 corresponding to the first segment, from nucleotide position 1 to nucleotide position 171, and the first and third segments are connected by a second segment of the sequence which in this example part is

ID. SEQ. 17, nucleotide, shown corresponding to the nucleotide second segment, from position 172 to nucleotide position 302.

196

The result of the expression of the nucleotide sequence corresponding to ID NO. SEQ. 17 in plant cells is the synthesis of a stabilized RNA molecule. Plant cells in which the nucleotide sequence set forth in SEQ ID NO is transcribed. SEQ. 17 to the RNA sequence, they can be provided in the corn root beetle food. Corn beetle fed with such plant cells ceases to feed, cannot grow into an adult beetle, cannot grow further, dies or suffers from any or all of these effects as a result of inhibition of CHD3 homologous protein synthesis. [0269] The β-tubulin coding sequence, derived from the corn rootworm cDNA library, was used to construct the nucleotide sequence encoding the stabilized double-stranded RNA. The cDNA sequence shown in SEQ ID NO. SEQ. 18, encoding a portion of the ortholog or homologue of βtubulin amino acid sequence, was used to construct a pair of primers for use in a thermal amplification reaction using the genomic template DNA of corn rootworm. The primer pair as shown in ID NO. SEQ. 19 and ID NO SEQ. 20, allowed for amplification from the genome of a double-stranded amplicon, one strand of which exhibited the sequence set forth in ID NO. SEQ. 21. From the nucleotide sequence set out in SEQ ID NO. SEQ. 21 three segments of the nucleotide sequence were generated. The first nucleotide segment (SEQ ID NO: 173) was generated using the nucleotide sequence set forth in SEQ ID NO. SEQ. 21 as a matrix in the thermal amplification reaction, together with

197 a pair of primers for thermal amplification, with the sequences shown in SEQ ID NO. SEQ. 22 and ID NO

SEQ. 23. A second nucleotide segment (SEQ ID NO: 27) was generated using the nucleotide sequence set forth in SEQ ID NO: 2. SEQ. 21 as a template in the thermal amplification reaction, together with a pair of primers for thermal amplification of the sequence shown in NR

ID. SEQ. 25 and ID NO SEQ. 26. The third nucleotide segment (SEQ ID NO: 36) was prepared using the nucleotide sequence set forth in SEQ ID NO: 2. SEQ. 21 as a template in the thermal amplification reaction, together with a pair of thermal amplification primers with the sequences shown in ID NO. SEQ. 28 and ID NO. SEQ. 29.

The 3 'end of one of the threads of the first segment is complementary to the 3' end of one of the threads of the second segment, such that in a thermal amplification reaction containing both these segments, these complementary ends hybridize and allow polymerase mediated extension of both strands from their respective 3 'ends. The 3 'end of the second strand of the second section is complementary to the 3' end of one of the strands of the third section, such that in a thermal amplification reaction containing both these sections, these complementary ends hybridize and allow polymerase-mediated elongation of both strands from their respective 3 'ends. In the thermal amplification reaction containing all three sections and their complementary sequences, i.e. first, second and third episodes, together with primer sequences for thermal amplification, as shown in ID NO. SEQ. 22 and ID NO SEQ. 29, a new sequence is prepared as shown in SEQ ID NO. SEQ. 31 which,

198 when placed under the control of a promoter that acts in plants, it can generate an RNA nucleotide sequence substantially identical to the sequence set forth in ID NO. SEQ. 31, with the difference that uridine residues are present at the site of thymidine residues. This RNA nucleotide sequence can form into a stabilized RNA molecule due to the inverse complementarity of the third segment to the first segment in which the portion of ID NO. SEQ. 31 corresponding to the third segment, from nucleotide position 358 to nucleotide position 577, hybridizes to part ID NO. SEQ. 31 corresponding to the first segment, from nucleotide position 31 to nucleotide position 250, and the first and third segments are connected by a second segment of the sequence which in this example is through part ID NO. SEQ. 31, the second segment, from the position of nucleotide position 357. of the nucleotide sequence corresponding to SEQ ID NO. SEQ. 31 in plant cells there is a synthesis of a stabilized RNA molecule. Plant cells in which the nucleotide sequence set forth in SEQ ID NO is transcribed. SEQ. 31 to the RNA sequence, can be provided in the corn root beetle food. Corn beetle fed with such plant cells ceases to feed, cannot grow into an adult beetle, cannot grow further, dies or suffers from any or all of these effects as a result of inhibiting the synthesis of βtubulin homologous protein.

nucleotide, represented corresponding to nucleotide

The result

251 for expression

199

Example 4 [0270] This example illustrates the synergistic effect of providing the insect-invertebrate pest with one or more insecticide-effective compositions together with one or more double-stranded RNA sequences derived from the invertebrate pest when one or more dsRNA sequences have previously been shown to have a pesticidal effect. providing in pest food.

[0271] As shown in Example 3, the supply of a double-stranded RNA molecule derived from a pest in the invertebrate diet leads to inhibition of one or more biological functions in the pest, thus acts to achieve a pesticidal effect, causing mortality of the pest or other measurable trait which reduces the pest's ability to invade a particular environment or host. The addition of one or more other pesticides that differ from each other and each works towards achieving their pesticidal effect in ways that differ from the way the dsRNA works to achieve its pesticidal effect, may result in improved pest control and would further reduce the likelihood that the pest will develop resistance to any, one or more pesticide or dsRNA when used alone to obtain pest inhibition.

200 [0272] To test this thesis, CRW larvae were allowed to feed on food, in which various amounts of inhibitory protein for Cry3Bb rootworm were incorporated, and a constant amount of double-stranded RNA produced as described in Examples 2 and 3 above, such as dsRNA corresponding to ID NO . SEQ. 17 or ID NO SEQ. 31. A synergistic effect of pest inhibition is observed. As shown in examples 2 and 3, LD50 amounts of the Cry3Bb variant were used to achieve 50% insect larvae mortality with simultaneous deterioration of surviving larvae; the effect was assessed by reducing the weight of the larvae compared to the negative control. A decrease in the amount of insecticidal protein in the food results in a simultaneous reduction in mortality and an increase in the average weight of surviving larvae. Addition of the corresponding dsRNA or ID NO. SEQ. 31, or ID NO. SEQ. 17, results in almost complete mortality at each Cry3Bb concentration and a significant decrease in the survival mean larvae weight. This indicates a synergistic effect. Synergy can be achieved by disturbing the larvae in the middle intestine by introducing any amount of Cry3Bb, which has been shown to enter pores into the midgut membrane.

The pores may allow more double-stranded RNA to penetrate into the cells and even into the hemolymph, resulting in more efficient delivery of dsRNA types to the larvae, and thus lead to more effective reduction in suppression of the target mRNA. Specific combinations of pore-forming compositions together with double-stranded RNA compositions result in increased and synergistic

201 insecticidal effect, since dsRNA can now spread through the hemolymph and affect cells and tissues distant from the intestine of the pest. Specific pore-forming compositions include, but are not limited to, insecticidal toxin proteins derived from B. thuringiensis and related species, regardless of whether they have been shown to be insecticidal in a particular insect, and may also include pores forming such toxin domains. Such pore-forming compositions may also contain one or more of these pore-forming toxins or domains or a combination thereof, each different from the others, each having a different mechanism of action, as judged by the properties of each toxin or channel-forming domain, including ion channel kinetics, sizes conduction states, total membrane conductivity, ion specificity and gating properties of ion channels. Combinations of such pore-forming compositions together with dsRNA molecules specific to the suppression of one or more genes in a stocky species are specifically contemplated herein.

Example 5 [0273] This example illustrates that fragments of the V-ATPase nucleotide sequence, when provided as double-stranded RNA in the diet of the CRW species, are useful for controlling an insect pest.

[0274] The sequence set out in SEQ ID NO. SEQ. 104 is a cDNA clone that corresponds to 1,870 of 2,400 mRNA nucleotides

202 encoding a protein showing substantial sequence identity with Drosophila melanogaster vacuolar ATPase (68 kd, subunit 2). This cDNA clone was completely sequenced on both strands using primers designed based on preliminary sequence data. These sequencing primers are shown as ID NO. SEQ. 105 to ID NO. SEQ. 120. ID NO. SEQ. 121 and ID NO SEQ. 122; these are the primer sequences used to produce the copy of ID NO. SEQ. 104 with cDNA in the cloning vector pSPORT (Invitrogen). Each primer contained the 20-nucleotide sequence of the T7 promoter, from nucleotide position 1 to 20. Nucleotides 21-44 shown in ID NO. SEQ. 121 and nucleotides 21-45 of SEQ ID NO: SEQ. 122 correspond to the sequences in the pSPORT vector flanking the inserted cDNA. These primers allow the amplification of the DNA template containing the cDNA fragment flanked at both ends by T7 promoters, enabling in vitro production of double-stranded RNA using T7 RNA polymerase. When double-stranded RNA derived from ID NO. SEQ. 104 was included in food for CRW, 80% mortality was observed.

[0275] Six different ID NO regions were tested. SEQ. 104, using the following sets of amplification primers: ID NO. SEQ. 123 and ID NO. SEQ. 124, corresponding to nucleotides 1 to 291 (referred to as segment No. 1, 271 base pairs) of SEQ ID NO. SEQ. 1; ID NO SEQ. 125 and ID NO SEQ. 126 corresponding to nucleotides 292 to 548 (referred to as section 2, 260 base pairs); ID NO SEQ. 127 and ID NO SEQ. 128, corresponding to nucleotides 549 to 830 (referred to as

203 episode 3, 271 base pairs); ID NO SEQ. 129 and ID NO SEQ. 130, corresponding to nucleotides 840 to 1345 (referred to as episode No. 4, 505 base pairs); ID NO SEQ. 131 and ID NO SEQ. 132, corresponding to nucleotides 1360 to 1621 (referred to as episode No. 5, 261 base pairs); ID NO SEQ. 133 and ID NO SEQ. 136 corresponding to nucleotides 1540 to 1870 (referred to as episode No. 6, 278 base pairs). It should be noted that episodes 5 and 6 overlap over 80 base pairs. When these 6 episodes were included separately in the CRW diet, episodes Nos. 1, 2, 3 and 4 caused CRW mortality in the range of 94% to 100%. Sections Nos. 5 and 6 did not cause CRW mortality above the background seen in untreated controls. The sequence corresponding to episode # 1 is further divided into 3 smaller sections, and each of these three smaller sections corresponds to at least 150-180 continuous nucleotides within episode # 1, so that the first sub-episode in episode 1 overlaps the second sub-episode in episode No. 1, and the third sub-episode in part 1 is superimposed on the second sub-episode. Each of these subsections was tested separately in the CRW bioassay. pA mortality between 80 and 90% was observed using these three shorter sequences.

[0276] The second way to study the biological activity of dsRNA molecules derived from CRW genes is to construct an RNA molecule with internal complementarity. By combining the same DNA sequence in the T7 RNA reverse polymerase, you can synthesize a single RNA molecule that is internally complementary with the promoter.

204

One such RNA molecule was constructed by linking nucleotides 1 to 345 to nucleotides 50 to 325, from the nucleotide sequence set forth in ID NO. SEQ. The resulting sequence is shown in SEQ ID NO. SEQ. 137 and was named pIC17527. pIC17527 was cloned into pTOPT2.1 (Invitrogen). Using the T7 promoter in the pTOPO2.1 vector, a dsRNA of about 500 nucleotides was generated and incorporated into CRW food. The resulting mortality was between 80% and 100%.

Example 6 [0277] This example illustrates the toxicity of orally taken dsRNA to Colorado potato beetle larvae from

Colorado, Leptinotarsa ​​decemlineata.

[0278] Total RNA of Colorado potato beetle larvae (CPB, Colorado potato beetle), Leptinotarsa ​​decemlineata, was isolated using the Ambion mirVana kit (catalog number 1560) and recommended procedures (Ambion Inc, Austin, TX, USA). CPB larvae occupying approximately 200 μ 200 volume in a microcentrifuge tube were used for each preparation. To obtain cDNA, 5 micrograms of total RNA was used using the Invitrogen ™ Thermoscript RT-PCR System (catalog number 11146) and recommended procedures for cDNA synthesis via random primers (Invitrogen, Carlsbad, CA, USA). This cDNA was used as template to amplify the ortholog sequence of the 2 V-ATPase subunit using Taq DNA polymerase and pr 550 oligonucleotide primers (SEQ ID NO: 160) and pr552

205 (SEQ ID NO 161). These primers were designed by aligning the nucleotide sequences of the nearest V-ATPase A Manduca sexta orthologs (ID NO.

SEQ.

151)

Aedes aegypti

Drosophila melanogaster (ID NO.

virgifera (SEQ ID NO: 153) regions

SEQ.

152) and Diabrotica with minimal and select degeneration. The primer pr550 corresponds to nucleotides 230252 in the M. sexta gene sequence, while the primer pr552 corresponds to nucleotides 1354-1331 in the M. sexta gene sequence.

ZSO) [0279] Amplification was obtained using downward amplification procedures with the following cycle parameters:

Step 1. 94 ° C, 2 min;

Step 2. 94 ° C, 30 s;

Stage 3. 50 ° C, 2 min;

Step 4. 72 ° C, 2 min (35 cycles to steps 2-4, with a descent of 0.3 ° C per cycle in step 3);

Step 5. 72 ° C, 10 min;

Stage 6. 4 ° C.

[0280] The cDNA amplified DNA fragment about 1.2 kb was cloned into the pCR2.1-TOPO vector (Invitrogen), resulting in the recombinant plasmid pIC17105. The nucleotide sequence of the cloned insert (SEQ ID NO: 144) shows only 82% identity of the nucleotide sequence with the orthologous sequence of the VATPase 2 subunit of western corn rootworm, Diabrotica virgifera, but deduced sequences

206 amino acids for encoded VA ATPases have 97% sequence identity.

[0281] The sequence of the V-ATPase ortholog in the plasmid pIC17105 was amplified using primers pr568 (SEQ ID NO: 162) and pr569 (SEQ ID NO: 163), called 'universal' primers for producing DNA templates with flanking T7 polymerase promoter sequences from pCR2.1-TOPO clones. The amplified DNA served as a template for dsRNA synthesis using the Ambion MEGAscript ™ kit (catalog number 1626) and recommended procedures (Ambion Inc., Austin, TX, USA). Purified dsRNA derived from the L. decemlineata V-ATPase ortholog sequence was fed to L. decemlineata larvae in an insect feeding test.

[0282] CPB food consists of 13.2 g / L agar (Serva 11393), 140.3 g / L premix Bio Serve (F9380B), 5 ml / L KOH (18.3% w / w) and 1.25 ml / l formalin (37%).

The food was placed in 200 μΐ aliquots on 96 well plates and dried shortly before sample application. 20 L of test sample was applied to the well, with sterile water serving as the untreated control (UTC). The plates were allowed to dry before adding insect larvae. One newborn CPB larva was added per well using a thin paint brush. The plates were sealed with Mylar foil and ventilated using an insect pin. 40 larvae per treatment were tested. The bioassay plates were incubated at 27 ° C, 60% relative humidity, in total darkness, for 10-12 days. Plates were evaluated for growth inhibition and larval mortality. Data were analyzed at

207 application of the JMP 4 statistical program (SAS Institute, Cary, NC, USA).

Table 2. Oral toxicity of dsRNA to CPB larvae

<td>Treatment</td><td>% mortality</td><td>SD</td><td>SEM</td><td>95% CI</td>

<td>untreated</td><td> 8,33</td><td> 10,21</td><td> 4, 17</td><td> -2,38-</td>

<td>control</td><td></td><td></td><td></td><td> 19,04</td>

<td>V-ATPase A dsRNA</td><td> 87,5</td><td> 10, 83</td><td> 3, 61</td><td> 79,18-</td>

<td></td><td></td><td></td><td></td><td> 95,82</td>

[0283] Based on data from an oral bioassay bioassay using DSBNA specific for CPB V-ATPase, CPB invasion of plants can be combated by providing the plant cell with pest feed expressing one or more dsRNA sequences specific for suppression of one or more CPB pest genes.

Example 7 [0284] This example shows the results of bioassays for various butterfly larvae on artificial diet using insect-specific dsRNA.

[0285] Total RNA from 2-3 larvae of Spodoptera frugiperda, Helicoverpa zea, Agrotis ipsilon and Ostrinia nubilalis was isolated using Ambion mirVana (catalog number 1560) and recommended procedures (Ambion Inc, Austin, TX, USA). Larvae occupying approximately 200 μΐ were used for each preparation

208 volumes in a microcentrifuge tube. To obtain cDNA, 5 micrograms of total RNA was used using the Invitrogen ™ Thermoscript RT-PCR System (catalog number 11146) and recommended procedures for cDNA synthesis via random primers (Invitrogen, Carlsbad, CA, USA). This cDNA was used as template to amplify the ortholog sequence of the 2 V-ATPase subunit from

<td>using</td><td>polymerase</td><td>GOUT</td><td>Taq and</td><td>primers</td>

<td colspan="2">oligonucleotide pr</td><td>550 (NO</td><td>ID. SEQ. 160)</td><td>and pr552</td>

<td>(ID No. [0286]</td><td>SEQ. 161). These starters</td><td>left</td><td>designed</td><td>through</td>

alignment of the nucleotide sequences of the nearest orthologs V-ATPase A from Manduca sexta, Aedes aegypti,

Drosophila melanogaster and Diabrotica virgifera and selection of regions with minimal degeneration. The primer pr550 corresponds to nucleotides 230-252 in the M. sexta gene sequence, while the primer pr552 corresponds to nucleotides 1354-1331 in the M. sexta gene sequence.

[0287] Amplification was achieved using a downward PCR procedure as described in Example 6.

The amplified DNA products were cloned into the pCR2.1TOPO vector and sequenced to confirm their identity. Recombinant plasmids containing gene ortholog sequences are listed in Table 3.

209

Table 3. Sequences of the butterfly V-ATPase subunit 2 orthologs

<td>plasmid</td><td>Insect species</td><td>ID NO SEQ.</td>

<td>pIC17088</td><td>Spodoptera frugiperda</td><td>ID NO SEQ. 145</td>

<td>pIC17101</td><td>Agrotis ipsilon</td><td>ID NO SEQ. 146</td>

<td>pIC17102</td><td>Helicoverpa zea</td><td>ID NO SEQ. 147</td>

<td>pIC17103</td><td>Ostrinia nubilalis</td><td>ID NO SEQ. 148</td>

[0288] The sequences of V-ATPase A orthologs in plasmids pIC17088, pIC17101, pIC17102 were amplified using primers pr555 (SEQ ID NO 164) and pr556 (SEQ ID NO 165) designed to produce DNA fragments with flanking and opposing promoters T7 polymerase for in vitro synthesis of dsRNA.

[0289] Double-stranded RNA (dsRNA) was synthesized from these amplified DNA templates against FAW, BCW and CEW ortholog sequences using the Ambion MEGAscript ™ kit (catalog number 1626) and recommended procedures (Ambion Inc, Austin, TX, USA) and subjected to 10 ppm insect bio tests.

[0290] For these tests, artificial butterfly food (165 g / L Southland Multiple Species Diet, 14.48 g / L agar) was prepared and portioned into 128-well trays, 500 μΣ per well. The samples were applied to food and placed in a "drying" chamber at 27 ° C and 35% humidity, where the excess water was evaporated. After drying, each well was infested by one newborn larva and closed with a perforated Mylar sealant. The trays were incubated

210 for 6-8 days at 27 ° C. Untreated control insects had exhausted all food in their respective wells after 6-8 days. 50-well trays of 4 ml artificial food per well were prepared, and all insects that had exhausted or were close to depletion of food before the end of the test were transferred to new trays. These trays were sealed and transferred back to the incubator, and all bioassays were then evaluated after a total of 10-12 days.

[0291] The results of these biological tests of insect-butterfly species indicate no significant effect observed on larval mortality or weight gain compared to untreated control (comparison for all pairs using TukeyaKramera HSD analysis) and using this test scheme. Effects on larval mortality or weight gain were also not observed in biological tests using a combination of dsRNA and sub-lethal amounts of Bt insecticidal pore-forming proteins that are known from previous experiments to be toxic to these hepatocellular pests.

Example 8 [0292] This example illustrates a bioassay to determine the oral toxicity of dsRNA to cotton brood larvae Anthonomus grandis.

[0293] Total RNA was isolated from cotton boll weevil (BWV) larvae, Anthonomus grandis, using the Ambion mirVana kit (No.

211 1560) and recommended procedures (Ambion Inc, Austin, TX, USA). BWV larvae occupying about 200 μΐ volume in a microcentrifuge tube were used for each preparation. To obtain cDNA, 5 micrograms of total RNA was used using the Invitrogen ™ Thermoscript RTPCR System (catalog number 11146) and recommended procedures for cDNA synthesis via random primers (Invitrogen, Carlsbad, CA, USA). This cDNA was used as template for amplifying the ortholog sequence of the 2 V-ATPase subunit using Taq DNA polymerase and oligonucleotide primers pr 550 (SEQ ID NO: 160) and pr552 (SEQ ID NO: 161).

[0294] These primers were designed by aligning the nucleotide sequences of the nearest V-ATPase A orthologists from Manduca sexta, Aedes aegypti, Drosophila melanogaster and Diabrotica virgifera (WCR) and selecting regions with minimal degeneration. The primer pr550 corresponds to nucleotides 230-252 in the M. sexta gene sequence, while the primer pr552 corresponds to nucleotides 1354-1331 in the M. sexta gene sequence.

[0295] Amplification was achieved using a downward PCR procedure as described in Example 6. An approximately 1.2 kb DNA fragment amplified with cDNA was cloned into the pCR2.1-TOPO vector (Invitrogen) and the insert was sequenced for confirmation. The V-ATPase ortholog sequence in plasmid pIC17105 was amplified using primers pr568 (SEQ ID NO: 162) and pr569 (SEQ ID NO: 163), called "universal" primers for the production of DNA templates with flanking T7 polymerase promoter sequences from pCR2.1-TOPO clones.

212 [0296] Double-stranded RNA (dsRNA) was synthesized from this amplified DNA template using the Ambion MEGAscript ™ kit (catalog number 1626) and recommended procedures (Ambion Inc, Austin, TX, USA) and subjected to an insect bioassay.

[0297] Agar-based artificial food for insects (Bioserv ™ - F9247B; Gast and Davich, 1966) was used for the floriculture Anthonomus grandis Boheman, according to the manufacturer's instructions. About 200 μ 200 of the melted food was placed into 96 well microtiter plates and allowed to cool and solidify. Then a sample (20 μΣ) containing 10 ppm dsRNA corresponding to the sequence of the V-ATPase orthologist (SEQ ID NO. 149) and allowed to dry. Then, insect (0-14) eggs were applied to the food in 25 μΐ 0.1% agar. The plates were then sealed with perforated sealant (Zymark No. 72281). The test was incubated at 27 ° C for 10-12 days and evaluated for activity by determining faecal accumulation. No effect on larval mortality and weight gain was observed, but this may be due to the special feeding physiology of cotton flowers. Food intake can significantly reduce the dose of eaten dsRNA and thus significantly reduce the effect that would be seen with surface feeding physiology. Incorporating dsRNA in food in a uniform manner would probably result in significant mortality and reduced weight gain.

[0298] Sequences of other florida target genes can be cloned and used as templates for

213 in vitro dsRNA synthesis that can then be tested in an insect bioassay to assess their effectiveness. For example, the L19 ribosomal protein gene (rpl19) can be used as template for dsRNA synthesis. The nucleotide sequences of rpl19 orthologs were aligned with Bombyx mori (SEQ ID NO: 154), Drosophila melanogaster (SEQ ID NO: 155), Anopholes gambiae (SEQ ID NO: 156) and Diabrotica virgifera (SEQ ID NO: 157) and regions of highest compliance with minimal degeneration were identified to design degenerate oligonucleotide primers. Primers pr574 (SEQ ID NO: 166) and pr577 (SEQ ID NO: 168) or primers pr575 (SEQ ID NO: 167) and pr577 (SEQ ID NO: 6) can be used to amplify the sequence of the putative rpl19 orthologer of many different insect species. 168).

[0299] Amplification is achieved using a downward amplification procedure with cycle parameters as described in Example 6. A DNA fragment of approximately 0.4 kb amplified from the florid cDNA was cloned into the pCR2.1-TOPO vector (Invitrogen) and insert sequenced for confirmation. The rpl19 ortholog sequence (SEQ ID NO: 158) was amplified using primers pr568 (SEQ ID NO: 162) and pr569 (SEQ ID NO: 163), designed as 'universal' primers to generate DNA templates with flanking T7 polymerase promoter sequences from pCR2.1-TOPO clones.

214

Example 9 [0300] This example illustrates a bioassay for determining oral toxicity of dsRNA to biting larvae of Tribolium castaneum.

[0301] Some insect pests are commercially important because they invade commodity products and processed materials produced from a given crop. One such pest is the biting triplet. The presence of one or more species-specific dsRNAs for inhibiting one or more genes in such pests in a commodity product and processed materials produced from a given crop would be useful in combating such pest infestation.

[0302] Total RNA was isolated from red flour beetle (RFB) larvae, Tribolium castaneum, using the Ambion mirVana kit (catalog number 1560) and recommended procedures (Ambion Inc, Austin, TX, USA). RFB larvae occupying approximately 200 μl volume in a microcentrifuge tube were used for each preparation. To obtain cDNA, 5 micrograms of total RNA was used using the Invitrogen ™ Thermoscript RTPCR System (catalog number 11146) and recommended procedures for cDNA synthesis via random primers (Invitrogen, Carlsbad, CA, USA). This cDNA was used as template for amplifying the ortholog sequence of the 2 V-ATPase subunit using Taq DNA polymerase and oligonucleotide primers pr 550 (SEQ ID NO: 160) and pr552 (SEQ ID NO: 161).

215 [0303] These primers were designed by aligning the nucleotide sequences of the nearest V-ATPase A orthologists from Manduca sexta, Aedes aegypti, Drosophila melanogaster and Diabrotica virgifera (WCR) and selecting regions with minimal degeneration. The primer pr550 corresponds to nucleotides 230-252 in the M. sexta gene sequence, while the primer pr552 corresponds to nucleotides 1354-1331 in the M. sexta gene sequence.

[0304] Amplification is achieved using a downward amplification procedure with cycle parameters as described in Example 6.

An amplified DNA fragment of approximately 1.2 kb from cDNA was cloned into the pCR2.1-TOPO vector (Invitrogen) and the insert was sequenced for confirmation. The sequence of the V-ATPase ortholog (SEQ ID NO: 150) was amplified using primers pr568 (SEQ ID NO: 162) and pr569 (SEQ ID NO: 163), designed as 'universal' primers to produce DNA templates with flanking sequences T7 polymerase promoters from pCR2.1-TOPO clones.

[0305] Ambion MEGAscript ™ double-stranded RNA (dsRNAs) (catalog number 1626) and recommended procedures (Ambion Inc, Austin, TX, USA) were synthesized from this amplified DNA template and subjected to an insect bioassay. Wheat flour is mixed homogeneously with water and dsRNA corresponding to the sequence of the V-ATPase ortholog (NR ID is allowed to dry. Used as a substrate together with larvae of biting triplets. Insecticidal effects are observed after several days of incubation by extracting weevil larvae from the flour / dsRNA mixture.

SEQ. 150) and This composition is in the bioassay

216 [0306] Sequences of other biting triplet target genes can be cloned and used as templates for in vitro synthesis of dsRNA, which can then be tested in an insect bioassay to assess their efficacy. For example, the L19 ribosomal protein gene (rpl19) can be used as template for dsRNA synthesis. The nucleotide sequences for rpl19 orthologs were aligned with Bombyx mori, Drosophila melanogaster, Anopholes gambiae and Diabrotica virgifera and the highest compliance regions with minimal degeneration were identified to design degenerate oligonucleotide primers. Primers pr574 (SEQ ID NO: 166) and pr577 (SEQ ID NO: 168) or primers pr575 (SEQ ID NO: 167) and pr577 (SEQ ID NO: 1) can be used to amplify the sequence of the putative rpl19 orthologer from a variety of insect species. SEQ. 168). Amplification is achieved using a downward amplification procedure with cycle parameters as described in Example 6. An approximately 0.4 kb DNA fragment amplified from the biting triplet cDNA was cloned into the pCR2.1-TOPO vector (Invitrogen) and the insert was sequenced for confirmation. The ortholog sequence rpl19 (SEQ ID NO: 158) was amplified using primers pr568 (SEQ ID NO: 162) and pr569 (SEQ ID NO: 163), designed as 'universal' primers to generate DNA templates with flanking T7 polymerase promoter sequences from pCR2.1-TOPO clones.

217

Example 10 [0307] This example illustrates a bioassay to determine the oral toxicity of dsRNA to beetle larvae and bovine larvae.

[0308] Total RNA was isolated from beetle larvae and wireworm using the Ambion mirVana kit (catalog number 1560) and recommended procedures (Ambion Inc, Austin, TX, USA). Larvae occupying approximately 200 μl volume in a microcentrifuge tube were used for each preparation. To obtain cDNA, 5 micrograms of total RNA was used using the Invitrogen ™ Thermoscript RTPCR System (catalog number 11146) and recommended procedures for cDNA synthesis via random primers (Invitrogen, Carlsbad, CA, USA). This cDNA was used as template for amplifying the ortholog sequence of the 2 V-ATPase subunit using Taq DNA polymerase and oligonucleotide primers pr 550 (SEQ ID NO: 160) and pr552 (SEQ ID NO: 161).

[0309] These primers were designed by aligning the nucleotide sequences of the nearest V-ATPase A orthologists from Manduca sexta, Aedes aegypti, Drosophila melanogaster and Diabrotica virgifera (WCR) and selecting regions with minimal degeneration. The primer pr550 corresponds to nucleotides 230-252 in the M. sexta gene sequence, while the primer pr552 corresponds to nucleotides 1354-1331 in the M. sexta gene sequence.

[0310] Amplification is achieved using a downward amplification procedure with cycle parameters as described in Example 6.

An amplified DNA fragment of approximately 1.2 kb from cDNA was cloned into

218 the pCR2.1-TOPO vector (Invitrogen) and the insert were sequenced for confirmation. The sequence of the V-ATPase ortholog (SEQ ID NO: 150) was amplified using primers pr568 (SEQ ID NO: 162) and pr569 (SEQ ID NO: 163), designed as 'universal' primers to produce DNA templates with flanking sequences T7 polymerase promoters from pCR2.1-TOPO clones.

[0311] Double-stranded RNA (dsRNAs) is synthesized from this amplified DNA template using the Ambion MEGAscript ™ kit (catalog number 1626) and recommended procedures (Ambion Inc, Austin, TX, USA) and subjected to an insect bioassay. Insecticidal effects are observed after several days of conducting the biological test.

[0312] Sequences of other target genes from beetle and wireworm larvae can be cloned and used as templates for in vitro synthesis of dsRNA, which can then be tested in an insect bioassay to assess their efficacy. For example, the L19 ribosomal protein gene (rpl19) can be used as template for dsRNA synthesis. The nucleotide sequences for rpl19 orthologs were aligned with Bombyx mori, Drosophila melanogaster, Anopholes gambiae and Diabrotica virgifera, and the highest regions were identified with minimal degeneration of degenerate oligonucleotide primers in accordance with design. Primers pr574 (SEQ ID NO: 166) and pr577 (SEQ ID NO: 168) or primers pr575 (SEQ ID NO: 167) and pr577 (SEQ ID NO: 1) can be used to amplify the sequence of the putative rpl19 orthologer from a variety of insect species. SEQ. 168).

219 [0313] Amplification is achieved using a downward amplification procedure, with cycle parameters as described in Example 7. A DNA fragment of approximately 0.4 kb, amplified from cDNA, is cloned into the pCR2.1-TOPO vector ( Invitrogen) and insert is sequenced for confirmation. The sequence of the ortholog rpl19 (SEQ ID NO: 158) is amplified using primers pr568 (SEQ ID NO: 162) and pr569 (SEQ ID NO: 163), designed as 'universal' primers to generate DNA templates with flanking T7 polymerase promoter sequences from pCR2.1-TOPO clones.

Example 11 [0314] This example illustrates a bioassay for determining oral toxicity of dsRNA to Aedes aegypti mosquito larvae.

[0315] Total RNA was isolated from Aedes aegypti larvae using the Ambion mirVana kit (catalog number 1560) and recommended procedures (Ambion Inc, Austin, TX, USA). Aedes aegypti larvae occupying approximately 200 μΐ volume in a microcentrifuge tube were used for each preparation. To obtain cDNA, 5 micrograms of total RNA was used using the Invitrogen ™ Thermoscript RTPCR System (catalog number 11146) and recommended procedures for cDNA synthesis via random primers (Invitrogen, Carlsbad, CA, USA). This cDNA was used as template for amplifying the ortholog sequence of the 2 V-ATPase subunit using Taq DNA polymerase and oligonucleotide primers pr 550 (SEQ ID NO: 160) and pr552 (SEQ ID NO: 161).

220 [0316] These primers were designed by aligning the nucleotide sequences of the nearest V-ATPase A orthologists from Manduca sexta, Aedes aegypti, Drosophila melanogaster and Diabrotica virgifera (WCR) and selecting regions with minimal degeneration. The primer pr550 corresponds to nucleotides 230-252 in the M. sexta gene sequence, while the primer pr552 corresponds to nucleotides 1354-1331 in the M. sexta gene sequence.

[0317] Amplification is achieved using a downward amplification procedure with cycle parameters as described in Example 6. An amplified DNA fragment of approximately 1.2 kb from cDNA was cloned into the pCR2.1-TOPO vector (Invitrogen) and the insert was sequenced for confirmation. The sequence of the V-ATPase ortholog (SEQ ID NO: 150) was amplified using primers pr568 (SEQ ID NO: 162) and pr569 (SEQ ID NO: 163), designed as 'universal' primers to generate DNA templates with flanking T7 polymerase promoter sequences from pCR2.1-TOPO clones.

[0318] Double-stranded RNA (dsRNAs) are synthesized from this amplified DNA template using the Ambion MEGAscript ™ kit (catalog number 1626) and recommended procedures (Ambion Inc, Austin, TX, USA) and subjected to an insect bioassay. Effects on insect larvae are observed after several days of conducting the biological test.

[0319] Other mosquito target gene sequences can be cloned and used as templates for in vitro synthesis of dsRNA, which can then be tested in an insect bioassay to assess their efficacy. As a template for dsRNA synthesis, you can on

221 example, use the L19 ribosomal protein gene (rpl19). The nucleotide sequences for rpl19 orthologs were aligned with Bombyx mori, Drosophila melanogaster, Anopholes gambiae and Diabrotica virgifera and the highest compliance regions with minimal degeneration were identified to design degenerate oligonucleotide primers. Primers pr574 and pr577 or primers pr575 and pr577 can be used to amplify the sequence of a putative rpl19 ortholog from many different insect species.

[0320] Amplification is achieved using a downward amplification procedure with cycle parameters as described in Example 7. A DNA fragment of approximately 0.4 kb amplified from cDNA is cloned into the pCR2.1-TOPO vector (Invitrogen) and the insert is sequenced for confirmation. The sequence of the ortholog rpl19 (SEQ ID NO: 158) is amplified using primers pr568 (SEQ ID NO: 162) and pr569 (SEQ ID NO: 163), designed as 'universal' primers to generate DNA templates with flanking T7 polymerase promoter sequences from pCR2.1-TOPO clones.

[0321] Double-stranded RNA (dsRNAs) are synthesized from this amplified DNA template using the Ambion MEGAscript ™ kit (catalog number 1626) and recommended procedures (Ambion Inc, Austin, TX, USA) and subjected to an insect bioassay.

[0322] Other mosquito species are considered to be within the scope of the present invention. The corresponding target gene sequences of the Aedes, Culex and Anopholes species can be amplified using appropriate oligonucleotide primers, cloned into a vector

222 pCR2.1-TOPO (Invitrogen) and sequence the insert for confirmation. Cloned target sequences are amplified using primers pr568 (SEQ ID NO: 162) and pr569 (SEQ ID NO: 163) designed as "universal" primers to generate DNA templates with flanking T7 polymerase promoter sequences from pCR2.1- clones AFTER. Double-stranded RNA (dsRNAs) is synthesized from this amplified DNA template using the Ambion MEGAscript ™ kit (catalog number 1626) and recommended procedures (Ambion Inc, Austin, TX, USA) and subjected to an insect bioassay.

Example 12 [0323] This example illustrates how dsRNA generated from the 3'UTR region of V-ATPase showed a reduction in the level of expression of the target.

[0324] Sections (approx. 300 bp dsRNA) with 3 'UTR V-ATPase WCR were introduced into the WCR bioassay and did not show inhibition of growth and mortality over the 12 days of the bioassay. Size-comparable segments within the V-ATPase coding region cause significant growth inhibition and mortality at various concentrations. Northern analysis, examining total RNA extracted from WCR larvae fed for 4 days with 3 'UTR V-ATPase (and tested using a probe from the coding region), showed a significant decrease in the target V-ATPase mRNA relative to untreated control larvae (labeled NBP) No. 7497215). however, the mRNA remained detectable, indicating less

223 effective target elimination using the 3'UTR segment dsRNA (compared to the coding region segment) and / or the contribution of the putative second V-ATPase gene whose 3 'UTR deviates significantly from the original V-ATPase gene. Southern WCR data are consistent with more than one hybridizing gene sequence within the genome, but EST and a limited PCR family have not yet shown that the putative second gene is transcribed.

[0325] It is important to mention that although it is crucial to determine the potential for limiting growth and killing larvae, targets simply susceptible to RNAi strategies can also be found by simply monitoring the expression of the target gene by Northern or quantitative PCR. The above results plus other Northern experiments assessing the target - V-ATPase - showed that the effect on transcript RNA level is noticeable in insects within a few hours of the dsRNA presentation.

Example 13 [0326] This example illustrates one method of obtaining gene suppression in insect pests using siRNA-mediated silencing. [0327] An alternative way of silencing genes in plant pests utilizes the recently discovered class of trans-acting small interfering RNA (ta-siRNA) (Dalmay et al. Cell 101: 543-553, 2000; Mourrain et al., Cell 101: 533-542, 2000; Peragine et al., Genes

224 and Development, 18: 2368-2379, 2004; Vazquez et al., Mol Cell 16 (1): 69-79, 2004; Yu et al., Mol Plant Microbe Interact 16: 206-216, 2003). ta-siRNAs are derived from single-stranded RNA transcripts that are the target of naturally occurring miRNAs in the cell. Methods of using microRNA to trigger ta-siRNA for gene silencing in plants are described in United States Provisional Patent Application Serial No. 60 / 643,136 (Carrington et al. 2004), incorporated herein by reference in its entirety. At least one pest-specific miRNA identified in the intestinal epithelial cells of the corn beetle root beetle larvae has been identified. This pest-specific miRNA is then used to identify at least one sequence of a target RNA transcript complementary to miRNA that is expressed in the cell. A suitable target sequence is a short sequence of no more than 21 contiguous nucleotides, which, when part of an RNA transcript and in contact with the corresponding miRNA in a cell type with a functioning RNAi pathway, leads to cleavage of this transcript through "slicer" activity. Once the miRNA target sequences have been identified, at least one miRNA target sequence is attached to the second sequence that corresponds to the portion of the pest gene to be silenced using this method. The target sequence (s) for miRNA binds, for example, with the sequences of the ATPase vacuolar (V-ATPase) gene of corn beetle root. The miRNA target sequence can be located at the 5 'end, 3' end or embedded in the center

225 the V-ATPase gene. It may be advantageous to use multiple miRNA target sequences corresponding to multiple miRNA genes or to use the same miRNA target sequence multiple times in the chimer of the miRNA target sequence and V-ATPase sequence. The V-ATPase sequence can be any length, minimum 21 bp

[0328] The chimera of the target (target) miRNA and V-ATPase sequences are expressed in plant cells using any of a variety of suitable promoters and other transcriptional regulatory elements, as long as the transcription occurs in the cell types of the subject to be provided in food for pest, e.g., corn roots to combat corn beetle root.

[0329] This method may have the additional advantage of delivering longer RNA molecules to the target pest. Typically, dsRNAs produced in plants are quickly processed by Dicer to short RNAs, which may not be effective when externally fed with certain pests. In this method, a single-strand transcript is produced in a plant cell, taken by the pest and converted into dsRNA by the pest cells, where it is then processed into a ta-siRNA capable of post-transcriptively silencing one or more genes of one or more target pests.

Example 14 [0330] This example illustrates the comparison of CRW cDNA sequences with sequences from sources other than CRW and

226 identifying (1) common sequences with those sequences from other sources and (2) sequences that are unique to CRW. CDNA sequences that are conserved between two organisms are potentially suitable for use by RNAi, which can be used to target gene expression and act in both organisms. Alternatively, it may be desirable to select sequences for suppressing CRW genes for which there is no homologous sequence present in (a) other pest organisms, (b) non-target organisms, and (c) the plant genome selected for transformation with the CRW suppression sequence.

[0331] Six CRW cDNA sequences were selected for comparison with sequences from other sources. Specific sequences included coding sequences for alpha-tubulin, beta-tububulin, CHD3, proton subunit, A subunit

E vacuolar V-ATPase and thread-like protein pumps. Nucleotide sequences are shown

<td>respectively</td><td colspan="2">in ID NO. SEQ. 98, ID NO.</td><td>SEQ.</td><td> 99,</td><td>ID NO</td>

<td>SEQ. 100</td><td>ID NO SEQ.</td><td>101, ID NO.</td><td>SEQ.</td><td> 102,</td><td>ID NO</td>

<td>SEQ. 103.</td><td>compared</td><td>sequences</td><td>cDNAs</td><td>CRW</td><td>to</td>

<td>all</td><td>publicly</td><td>available</td><td>cDNAs</td><td>from</td><td>different</td>

organisms in GenBank using the Megablast program from NCBI (Altschul et al., J. Mol. Biol. 215: 403-410, 1990), with search parameters set as follows:

-W21 -b50 -v50 requiring at least 21-mer perfect fit and maintaining only the top 50 best alignment results. The results were

227 filtered to include only Insect organisms, excluding the honey bee (Apis mellifera).

Although only six CRW cDNA sequences have been analyzed, the same process can be used for all cDNA or Unigene sequences in CRW or other organism of interest without overloading or experimenting.

[0332] Using six CRW cDNA sequences, a total of 145 matches from 20 different insect organisms were identified. They included several pest species, such as pea aphids (Acyrthosiphon pisum), Asian citrus honeysuckle (Diaphorina citri) and human louse (Pediculus humanus).

[0333] The results are shown in Table 4 below, with matching coordinates for the query and hit sequence, percent identity and insect species from which the hit sequence originated. Stretch from nucleotide position 844 to 1528 in ID NO. SEQ. For example, 98 has been identified as being substantially identical to the stretch from nucleotide position 812 to 128 of sequence number GenBank GI: 47521748 derived from pea aphid (Acyrthosiphon pisum). The identity of these two sequences is 85%.

228

Table 4. Unigene sequences from CRW and insect nucleotide sequence homologues

<td>1 ID NO SEQ.</td><td>Identity position 2</td><td>Gene ID</td><td>Identity position ⁴</td><td>% identity 5</td><td>g Type of species</td>

<td> 98</td><td> 171-1529</td><td>GI: 14279671</td><td> 89-1447</td><td> 83%</td><td>Chironomus tentans</td>

<td> 98</td><td> 175-938</td><td>GI: 60297223</td><td> 69-832</td><td> 88%</td><td>Diaprepes abbreviatus</td>

<td> 98</td><td> 171-779</td><td> 01:49394745</td><td> 79-687</td><td> 89%</td><td>Drosophila melanogaster</td>

<td> 98</td><td> 769-1528</td><td>GI: 47537494</td><td> 827-68</td><td> 85%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 529-1339</td><td>GI: 55814359</td><td> 56-865</td><td> 85%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 729-1469</td><td>GI: 46995994</td><td> 1-741</td><td> 85%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 171-740</td><td>GI: 49395093</td><td> 79-652</td><td> 88%</td><td>Drosophila melanogaster</td>

<td> 98</td><td> 166-903</td><td> 01:60297353</td><td> 68-804</td><td> 85%</td><td>Diaprepes abbreviatus</td>

<td> 98</td><td> 171-875</td><td>GI: 37593891</td><td> 66-769</td><td> 85%</td><td>Pediculus humanus</td>

<td> 98</td><td> 844-1528</td><td>GI: 47521748</td><td> 812-128</td><td> 85%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 351-1255</td><td> 01:55798571</td><td> 1-903</td><td> 83%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 862-1528</td><td> 01:55815587</td><td> 8-674</td><td> 86%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 415-1520</td><td> 01:19773419</td><td> 309-1414</td><td> 81%</td><td>Bombyx mori</td>

<td> 98</td><td> 171-296</td><td> 01:19773419</td><td> 65-190</td><td> 88%</td><td>* Mori bombs</td>

<td> 98</td><td> 415-1520</td><td>GI: 60 8680</td><td> 309-1414</td><td> 81%</td><td>Bombyx mori</td>

<td> 98</td><td> 171-296</td><td> 01:608680</td><td> 65-190</td><td> 88%</td><td>Bombyx mori</td>

<td> 98</td><td> 738-1434</td><td>GI: 55811699</td><td> 1-697</td><td> 85%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 171-899</td><td>GL37593910</td><td> 70-799</td><td> 85%</td><td>Pediculus humanus</td>

<td> 98</td><td> 171-1029</td><td>GI: 55799535</td><td> 53-911</td><td> 83%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 817-1492</td><td>GI: 35508998</td><td> 7-681</td><td> 85%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 171-845</td><td> 01:25959177</td><td> 50-724</td><td> 85%</td><td>Meladema coriacea</td>

<td> 98</td><td> 862-1528</td><td>GI: 55 803725</td><td> 726-60</td><td> 85%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 171-695</td><td> 01:49394718</td><td> 79-603</td><td> 88%</td><td>Drosophila melanogaster</td>

<td> 98</td><td> 838-1528</td><td> 01:55813912</td><td> 827-137</td><td> 85%</td><td>Acyrthosiphon pisum</td>

229

<td>1 ID NO SEQ.</td><td>Position Identity - 2 pieces</td><td> ___ ³Gene ID</td><td>Identity position 4</td><td>% identity 5</td><td>Type of species ⁶</td>

<td> 98</td><td> 171-692</td><td> 01:49395499</td><td> 54-575</td><td> 88%</td><td>Drosophila melanogaster</td>

<td> 98</td><td> 171-1025</td><td>GI: 46997250</td><td> 92-945</td><td> 83%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 171-1022</td><td>GI: 47533429</td><td> 4-855</td><td> 83%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 171-998</td><td> 01:34788002</td><td> 122-949</td><td> 83%</td><td>Callosobruchus maculatus</td>

<td> 98</td><td> 171-839</td><td> 01:25959137</td><td> 50-717</td><td> 85%</td><td>Meladema coriacea</td>

<td> 98</td><td> 171-677</td><td>GI: 49395221</td><td> 84-590</td><td> 88%</td><td>Drosophila melanogaster</td>

<td> 98</td><td> 171-809</td><td>GI: 2595913ó</td><td> 50-688</td><td> 86%</td><td>Meladema coriacea</td>

<td> 98</td><td> 171-816</td><td>GI: 3 7593 801</td><td> 66-712</td><td> 85%</td><td>Pediculus humanus</td>

<td> 98</td><td> 171-816</td><td>GI: 37593472</td><td> 67-712</td><td> 85%</td><td>Pediculus humanus</td>

<td> 98</td><td> 171-848</td><td>GL25959229</td><td> 47-724</td><td> 85%</td><td>Meladema coriacea</td>

<td> 98</td><td> 171-677</td><td>GI: 4939 5496</td><td> 75-581</td><td> 88%</td><td>Drosophila melanogaster</td>

<td> 98</td><td> 171-659</td><td> 01:49395250</td><td> 83-571</td><td> 89%</td><td>Drosophila melanogaster</td>

<td> 98</td><td> 171-1029</td><td>GI: 46997155</td><td> 98-953</td><td> 83%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 904-1528</td><td>GI: 47519891</td><td> 752-128</td><td> 86%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 199-1061</td><td>GL55813341</td><td> 8-870</td><td> 83%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 760-1430</td><td>GI: 60298750</td><td> 9-679</td><td> 85%</td><td>Diaphorina citri</td>

<td> 98</td><td> 171-998</td><td>GI: 46997667</td><td> 106-933</td><td> 83%</td><td>Acyrthosiphon pisum</td>

<td> 98</td><td> 171-785</td><td>GI: 25959104</td><td> 69-684</td><td> 85%</td><td>Meladema coriacea</td>

<td> 98</td><td> 922-1528</td><td>GI: 25959369</td><td> 697-91</td><td> 86%</td><td>Meladema coriacea</td>

<td> 98</td><td> 922-1528</td><td>GL25959412</td><td> 698-92</td><td> 86%</td><td>Meladema coriacea</td>

<td> 98</td><td> 171-772</td><td>GL25959233</td><td> 68-669</td><td> 86%</td><td>Meladema coriacea</td>

<td> 98</td><td> 171-677</td><td>GL49395I21</td><td> 74-582</td><td> 88%</td><td>Drosophila melanogaster</td>

<td> 98</td><td> 199-1029</td><td> 01:47534273</td><td> 1-830</td><td> 83%</td><td>Acyrthosiphon pisum</td>

<td> 99</td><td> 90-1385</td><td> 01:34787982</td><td> 56-1351</td><td> 83%</td><td>Callosobruchus maculatus</td>

<td> 99</td><td> 74-797</td><td> 01:25958562</td><td> 14-739</td><td> 88%</td><td>Curculio glandium</td>

<td> 99</td><td> 572-1374</td><td>GI: 60297081</td><td> . 25-827</td><td> 86%</td><td>Diaprepes abbreviatus</td>

<td> 99</td><td> 100-1425</td><td>GI: 19773425</td><td> 91-1416</td><td> 81%</td><td>Bombyx mori</td>

<td> 99</td><td> 100-1425</td><td>GI: 2073100</td><td> 111-1436</td><td> 81%</td><td>Bombyx mori</td>

<td> 99</td><td> 55-738</td><td> 01:60297565</td><td> 7-684</td><td> 87%</td><td>Diaprepes abbreviatus</td>

<td> 99</td><td> 131-1425</td><td>GI: 39842328</td><td> 28-1322</td><td> 81%</td><td>Laodelphax striatcllus</td>

<td> 99</td><td> 688-1449</td><td> 01:60298019</td><td> 9-770</td><td> 85%</td><td>Diaprepes abbreviatus</td>

230

<td>1 ID NO SEQ.</td><td>Identity position ²</td><td>Gene ID ³</td><td>Identity position 4</td><td>% identity 5</td><td>Type of species ⁶</td>

<td> 99</td><td> 61-606</td><td>GI: 49394901</td><td> 10-557</td><td> 87%</td><td>Drosophila melanogaster</td>

<td> 99</td><td> 61-605</td><td> 01:49395418</td><td> 12-558</td><td> 87%</td><td>Drosophila melanogaster</td>

<td> 99</td><td> 100-1008</td><td> 01:2613140</td><td> 68-976</td><td> 81%</td><td>Manduca sexta</td>

<td> 99</td><td> 1064-1416</td><td> 01:2613140</td><td> 1032-1384</td><td> 83%</td><td>Manduca sexta</td>

<td> 99</td><td> 61-573</td><td> 01:49395445</td><td> 15-528</td><td> 87%</td><td>Drosophila melanogaster</td>

<td> 99</td><td> 40-582</td><td> 01:49395189</td><td> 4-551</td><td> 86%</td><td>Drosophila melanogaster</td>

<td> 99</td><td> 104-918</td><td>GI: 47518537</td><td> 27-841</td><td> 82%</td><td>Aeyrthosiphon pisum</td>

<td> 99</td><td> 104-784</td><td>GI: 25959017</td><td> 39-719</td><td> 83%</td><td>Meladema coriacea</td>

<td> 99</td><td> 104-879</td><td> 01:47538212</td><td> 85-860</td><td> 82%</td><td>Aeyrthosiphon pisum</td>

<td> 99</td><td> 104-852</td><td> 01:47520002</td><td> 32-780</td><td> 82%</td><td>Aeyrthosiphon pisum</td>

<td> 99</td><td> 104-789</td><td>GI: 47519819</td><td> 118-803</td><td> 83%</td><td>Aeyrthosiphon pisum</td>

<td> 99</td><td> 104-789</td><td>GI: 47532797</td><td> 106-791</td><td> 83%</td><td>Aeyrthosiphon pisum</td>

<td> 99</td><td> 100-708</td><td>GI: 53910346</td><td> 73-681</td><td> 84%</td><td>Heliconius erato petiverana</td>

<td> 99</td><td> 100-880</td><td> 01:6902132</td><td> 54-834</td><td> 82%</td><td>Bombyx mori</td>

<td> 99</td><td> 104-789</td><td> 01:46999310</td><td> 91-777</td><td> 83%</td><td>Aeyrthosiphon pisum</td>

<td> 101</td><td> 113-263</td><td> 01:41578101</td><td> 124-274</td><td> 90%</td><td>Culicoides sonorensis</td>

<td> 101</td><td> 113-263</td><td> 01:41577171</td><td> 65-215</td><td> 90%</td><td>Culicoides sonorensis</td>

<td> 101</td><td> 113-308</td><td>GI: 15466250</td><td> 140-335</td><td> 86%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 15 530478</td><td> 140-335</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 112-308</td><td>GI: 15516090</td><td> 140-336</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 49393479</td><td> 52-247</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-263</td><td>GI: 41577256</td><td> 99-249</td><td> 88%</td><td>Culicoides sonorensis</td>

<td> 101</td><td> 113-308</td><td>GI: 41403307</td><td> 84-279</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 41402978</td><td> 79-274</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td> 01:41401487</td><td> 82-277</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td> 01:38628155</td><td> 176-371</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 118-293</td><td> 01:16901350</td><td> 70-245</td><td> 87%</td><td>Ctenocephalides felis</td>

<td> 101</td><td> 118-293</td><td> 01:16900951</td><td> 78-253</td><td> 87%</td><td>Ctenocephalides felis</td>

<td> 101</td><td> 113-308</td><td> 01:14708726</td><td> 170-365</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 1470792 3</td><td> 171-366</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 14708035</td><td> 139-334</td><td> 85%</td><td>Drosophila melanogaster</td>

231

<td>1 ID NO.</td><td>Identity position ²</td><td>_TTX 3 Gene ID</td><td>Identity position ⁴</td><td>% identity 5</td><td>Type of species θ</td>

<td> 101</td><td> 113-308</td><td> 01:14705944</td><td> 135-330</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 14705959</td><td> 95-290</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 14705165</td><td> 108-303</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td> 01:14703451</td><td> 150-345</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td> 01:14703188</td><td> 95-290</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td> 01:14700853</td><td> 108-303</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 14700635</td><td> 136-331</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td> 01:14699645</td><td> 95-290</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td> 01:14697887</td><td> 94-289</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 14697103</td><td> 136-331</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 14696099</td><td> 137-332</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 14696107</td><td> 136-331</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td> 01:14695238</td><td> 95-290</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 14693081</td><td> 133-328</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 101</td><td> 113-308</td><td>GI: 14691490</td><td> 138-333</td><td> 85%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 694-1364</td><td> 01:2454487</td><td> 811-1481</td><td> 84%</td><td>Aedes aegypti</td>

<td> 102</td><td> 715-1220</td><td>GI: 22039978</td><td> 3-507</td><td> 86%</td><td>Ctenocephalides felis</td>

<td> 102</td><td> 694-1175</td><td> 01:4734043</td><td> 166-647</td><td> 85%</td><td>Aedes aegypti</td>

<td> 102</td><td> 895-1286</td><td>GI: 16899106</td><td> 3-393</td><td> 87%</td><td>Ctenocephalides felis</td>

<td> 102</td><td> 895-1286</td><td> 01:16899780</td><td> 6-395</td><td> 87%</td><td>Ctenocephalides felis</td>

<td> 102</td><td> 895-1286</td><td> 01:16899721</td><td> 6-396</td><td> 86%</td><td>Ctenocephalides felis</td>

<td> 102</td><td> 961-1286</td><td> 01:22039013</td><td> 8-333</td><td> 87%</td><td>Ctenocephalides felis</td>

<td> 102</td><td> 874-1327</td><td> 01:33376955</td><td> 30-483</td><td> 83%</td><td>Glossina morsitans morsitans</td>

<td> 102</td><td> 636-1136</td><td> 01:46997165</td><td> 360-859</td><td> 81%</td><td>Acyrthosiphon pisum</td>

<td> 102</td><td> 874-1220</td><td> 01:33376948</td><td> 25-371</td><td> 84%</td><td>Glossina moisitans morsitans</td>

<td> 102</td><td> 943-1364</td><td>GI: 3514814</td><td> 74-495</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 943-1364</td><td>GI: 24583987</td><td> 1055-1476</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 694-884</td><td>GL24583987</td><td> 806-996</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 943-1364</td><td> 01:24583985</td><td> 967-1388</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 694-884</td><td>GI: 24583985</td><td> 718-908</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 943-1364</td><td> 01:24583983</td><td> 1052-1473</td><td> 82%</td><td>Drosophila melanogaster</td>

232

<td>1 ID NO SEQ.</td><td>Identity position 2</td><td>³Gene ID</td><td>Identity position 4</td><td>% identity</td><td>Type of species ⁶</td>

<td> 102</td><td> 694-884</td><td> 01:24583983</td><td> 803-993</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 943-1364</td><td>GI: 18467973</td><td> 1049-1470</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 694-884</td><td>GI: 18467973</td><td> 800-990</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 943-1364</td><td>GI: 19527546</td><td> 1052-1473</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 694-884</td><td> 01:19527546</td><td> 803-993</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 1045-1365</td><td>GI: 4734199</td><td> 1-321</td><td> 84%</td><td>Aedes aegypti</td>

<td> 102</td><td> 943-1280</td><td> 01:51961912</td><td> 81-418</td><td> 83%</td><td>Drosophila simulans</td>

<td> 102</td><td> 734-947</td><td>GI: 22039138</td><td> 73-285</td><td> 87%</td><td>Ctenocephalides felis</td>

<td> 102</td><td> 959-1364</td><td> 01:24583991</td><td> 1081-1486</td><td> 81%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 959-1364</td><td>GI: 18467977</td><td> 1081-1486</td><td> 81%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 943-1340</td><td> 01:21355198</td><td> 994-1391</td><td> 81%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 694-884</td><td>GI: 21355198</td><td> 745-935</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 959-1364</td><td>GI: 19528270</td><td> 1021-1426</td><td> 81%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 959-1364</td><td>GI: 18859618</td><td> 951-1356</td><td> 81%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 943-1340</td><td>GI: 1373432</td><td> 994-1391</td><td> 81%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 694-884</td><td> 01:1373432</td><td> 745-935</td><td> 82%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 959-1364</td><td>GI: 5 851682</td><td> 1021-1426</td><td> 81%</td><td>Drosophila melanogaster</td>

<td> 102</td><td> 142-345</td><td>GI: 22039875</td><td> 163-366</td><td> 87%</td><td>Ctenocephalides felis</td>

<td> 102</td><td> 142-345</td><td> 01:16901137</td><td> 217-420</td><td> 87%</td><td>Ctenocephalides felis</td>

<td> 102</td><td> 82-595</td><td> 01:34787824</td><td> 112-625</td><td> 79%</td><td>Callosobruchus maculatus</td>

<td> 102</td><td> 142-345</td><td> 01:16901267</td><td> 156-360</td><td> 87%</td><td>Ctenocephalides felis</td>

<td> 102</td><td> 771-1022</td><td>GI: 22005558</td><td> 58-309</td><td> 84%</td><td>Aedes aegypti</td>

<td> 102</td><td> 96-357</td><td> 01:46996282</td><td> 118-379</td><td> 83%</td><td>Aeyrthosiphon pisum</td>

<td> 102</td><td> 963-1364</td><td>GI: 18898890</td><td> 11-412</td><td> 80%</td><td>Anopheles gambiae</td>

<td> 102</td><td> 967-1364</td><td> 01:18936027</td><td> 25-422</td><td> 80%</td><td>Anopheles gambiae</td>

<td> 102</td><td> 61-344</td><td> 01:37952369</td><td> 124-407</td><td> 81% \</td><td>Ips pini</td>

<td> 103</td><td> 1230-1251</td><td> 01:33371240</td><td> 247-268</td><td> 100%</td><td>Glossina morsitans morsitans</td>

<td> 103</td><td> 1230-1251</td><td> 01:33374947</td><td> 249-270</td><td> 100%</td><td>Glossina morsitans morsitans</td>

1. ID NO SEQ. WCR as shown in the sequence listing;

2. The nucleotide position in ID NO. SEQ. 1 in column 1 which shows substantial identity with the gene ID in column 3 in the same row;

233

3. The gene access number of the corresponding matching sequence identified in the publicly available database that has substantial identity with NR ID. SEQ. from column 1;

4. The nucleotide position of the sequence identified in column 3 that matches the CRW nucleotides specified in the same row;

5. The percent identity between ID NOs. SEQ. WCR and gene ID (comparison of identity between the sequences of column 2 and column 4 in any of the following rows); and

6. The type and species of the organism from which the gene sequence with the given access number comes.

Example 15 [0334] This example illustrates the identification of predicted functional protein domains and gene families from the translation of the nucleotide sequences disclosed herein using sequence alignment with known sequences and existing domain models with the highest compatibility.

[0335] Protein sequences were first generated using a "translate" program that translates the Unigene sequence into peptide sequences in the following steps: homology to known proteins; predicting ab initio gene structure on a model basis; and the longest open reading frame (ORF). Frame offset resulting from sequencing has been corrected. The protein sequences were then searched against the Pfam database - a large collection of multiple sequence alignments and hidden Markov models (HMM) covering many of the common gene families (The

234

Pfam Protein Families Database, Bateman et al., Nucleic Acids Research 32: D138-D141, 2004). HMM protein models were screened using the HMMPAM program (Durbin et al., Biological Sequence Analysis: Probabilistic Models of Proteins and Nucleic Acids, Cambridge University Press, 1998), with default fortifications. Further filtering was performed to stop only matches with an expected value of 0.1 or less as meaningful matches. Of the 20303 peptide sequences of corn beetle root, 4199 (21%) with 1317 distinct protein domains and families were identified.

[0336] The results of the analysis were presented in the property fields in the sequence listing file with the following attributes: name Pfam, description Pfam and level of matching with the result HMMPFAM, expected value (E value

<td>expectation) peptide.</td><td>and number of copies</td><td>domain</td><td>in sequence</td>

<td colspan="4">Example 16</td>

<td>[0337] Ten</td><td>example illustrates</td><td>way</td><td>delivery</td>

<td>DNA sequence</td><td colspan="2">for silencing genes for</td><td>through</td>

dsRNA. More specifically, this example describes the selection of improved DNA useful for dsRNA-mediated gene silencing by a) selecting from the target gene an output DNA sequence containing more than 21 contiguous nucleotides; (b) identifying at least one shorter DNA sequence derived from regions of the original DNA sequence, consisting of regions for which they are not expected to produce

235 undesirable polypeptides; and (c) selecting a DNA sequence for dsRNA-mediated gene silencing that includes at least one shorter DNA sequence. Undesirable polypeptides include, but are not limited to, polypeptides homologous to allergenic polypeptides and polypeptides homologous to known toxins. WCR V-ATPase has been shown to work in foraging tests to test dsRNA-mediated gene silencing as a method of controlling larvae growth. The cDNA sequence from the ATPase vacuolar gene (Western Maize Colorado root beetle (WCR) gene (Diabrotica virgifera virgifera LeConte) gene was chosen for use as DNA (SEQ ID NO:

starting output regions containing nucleotide matching

SEQ.

104)

This DNA sequence was screened for within which each continuous fragment of at least 21 nucleotides had less than 21 out of 21 continuous vertebrate sequences.

as to known

Three sequence sections larger than 100 contiguous nucleotides were identified that were free of such 21/21 positive results; a first segment of the sequence corresponding to nucleotide position 739-839, a second segment of the sequence corresponding to nucleotide position 849-987 and a third segment of the sequence corresponding to nucleotide position 998-1166, as shown in SEQ ID NO. SEQ. 104. These three sequence sections were joined together to construct a chimeric DNA sequence (SEQ ID NO: 1) for use in gene silencing via dsRNA the corresponding CRW V-ATPase coding sequence. The new chimeric DNA sequence was tested in the CRW bioassay described above.

236

Sequence list [0338] &lt;110&gt; Monsanto Technology LLC

Baum, James A.

Gilbertson, Larry A.

Kovalic, David K.

LaRosa, Thomas J.

Lu, Maolong

Munyikwa, Tichifa RI

Roberts, James K.

Wu, Wei

Zhang, Bei &lt;120&gt; Compositions and methods for combating insect invasion in plants &lt;130&gt; 38-21 (53597) &lt;150&gt; 60560842 &lt;151&gt; 2004-04-09 &lt;150&gt; 60565632 &lt;151&gt; 2004-04-27 &lt;150 &gt; 60579062 &lt;151&gt; 2004-06-11 &lt;150&gt; 60603421 &lt;151&gt; 2004-08-20 &lt;150&gt; 60617261 &lt;151&gt; 2004-10-11 &lt;150&gt; 60xxxxxx &lt;151&gt; 2005-04-07 &lt;160&gt; 174 &lt;210&gt; 1 &lt;211&gt; 409 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 1

<td>ggacaagaaa</td><td>cttgcccaac</td><td>gtaagcactt</td><td>cccttcagta</td><td>gactggcttg</td><td>gatcatattc</td><td> 60</td>

<td>caaatattta</td><td>agagcattgg</td><td>acgactttta</td><td>tgacaaaaac</td><td>tttattcctc</td><td>ttagaaccaa</td><td> 120</td>

<td>agttaaggaa</td><td>attcttcagg</td><td>aagaagatga</td><td>tctagccgaa</td><td>attgtgcagc</td><td>tggtaggtaa</td><td> 180</td>

<td>agcatctctg</td><td>gcagaaacgg</td><td>acaaaatcac</td><td>cttggaaatt</td><td>gccaggcttc</td><td>ttaaagaaga</td><td> 240</td>

<td>caaaactcat</td><td>actcttctta</td><td>tgacagattc</td><td>tgtccattct</td><td>ataaaactgt</td><td>cggtatgttg</td><td> 300</td>

<td>agaaacatga</td><td>tcggtttgta</td><td>cgacatggcg</td><td>agacacgctg</td><td>tagaatcaac</td><td>cgcacaatca</td><td> 360</td>

<td>gaaaataaga</td><td>tcacttggaa</td><td>cgtaataaga</td><td>gattcaatga</td><td>gtggaattt</td><td></td><td> 409</td>

237 &lt;210&gt; 2 &lt;211&gt; 157 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 2 atgtttcagg tgggctcaat aagcaccaac tttcaatttt atttttcatt tttgtattta 60 tttacagtaa ctcctctttt&gt; ttctctatatatatta &gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 3

<td>atttttattc</td><td>tgttaatagt</td><td>ttttcacatt</td><td>tcatgtttca</td><td>cacatactta</td><td>gatctagtca</td><td> 60</td>

<td>agattgttag</td><td>agttttggca</td><td>aagaaattaa</td><td>ataaaaatto</td><td>ttttoataaa</td><td>aatcatttct</td><td> 120</td>

<td>ttaatattac</td><td>attagagaaa</td><td>aattatattt</td><td>ttatactgag</td><td>tacaaatttg</td><td>aacaagttat</td><td> 180</td>

<td>taattttaag</td><td>ttacaaaata</td><td>cgcttttata</td><td>ggttaacaat</td><td>tatcaaagcg</td><td>cttaaatcta</td><td> 240</td>

<td>atagatacta</td><td>cacaacatta</td><td>aggactgcaa</td><td>accatatctt</td><td>tcaogaagta</td><td>atccctacta</td><td> 300</td>

<td>gtgaccaatt</td><td>gctcgctagg</td><td>agcagatgca</td><td>aattacac</td><td></td><td></td><td> 338</td>

&lt;210&gt; 4 &lt;211&gt; 458 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 4

<td>aaaagagtga</td><td>ggaaacaggt</td><td>taattataat</td><td>gacggaggaa</td><td>tgacaactga</td><td>cacacgagaa</td><td> 60</td>

<td>gatacgacat</td><td>ggcaagaaaa</td><td>tctctctgat</td><td>taccattctg</td><td>acttttctgc</td><td>gggatcggat</td><td> 120</td>

<td>gaggataagg</td><td>aagacgatga</td><td>tttcgatgag.</td><td>aagaacgacg</td><td>ccgatttaag</td><td>cagaaggagt</td><td>ISO</td>

<td>cgaagaaaga</td><td>tggaaaggaa</td><td>agacgagaag</td><td>gatcgtcctt</td><td>taccacogtt</td><td>actagccaga</td><td> 240</td>

<td>gttggcggca</td><td>atattgaagt</td><td>actcggtttt</td><td>aatgccaggc</td><td>agcgtaaagc</td><td>gttccttaat</td><td> 300</td>

<td>gctattatgc</td><td>gctacggaat</td><td>gccaccacaa</td><td>gacgctttca</td><td>attcacagtg</td><td>gctggtgaga</td><td> 360</td>

<td>gatcttcgag</td><td>gaaaatctga</td><td>gaagatattc</td><td>aagg.cttacg</td><td>tgtctctctt</td><td>tatgaggcat</td><td> 420</td>

<td>ctttgcgaac</td><td>ctggtgcaga</td><td>taatgctgat</td><td>acgtttgc</td><td></td><td></td><td>4S8</td>

&lt;210&gt; 5 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 5 taatacgact cactataggg agagacggag gaatgacaac tgaca 45 &lt;210&gt; 6 &lt;211&gt; 44

238 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 6 taatacgact cactataggg agattccgta gcgcataata gcat 44 &lt;210&gt; 7 &lt;211&gt; 335 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 7

<td>taatacgact</td><td>cactataggg</td><td>agagacggag</td><td>gaatgacaac</td><td>tgacacacga</td><td>gaagacacga</td><td> 60</td>

<td>catggcaaga</td><td>aaatctctcc</td><td>gattaccatt</td><td>ctgacttttc</td><td>tgcgggatca</td><td>gatgaggata</td><td> 120</td>

<td>aggaagacga</td><td>tgatttcgat</td><td>gagaagaacg</td><td>acgccgattt</td><td>aagcagaaga</td><td>agtcgaagaa</td><td> 180</td>

<td>agatggaaag</td><td>aaaagacgag</td><td>aaggaccgtc</td><td>cactaccacc</td><td>gttactagcc</td><td>agagttgggg</td><td> 240</td>

<td>gaaatattga</td><td>agtgctcggt</td><td>tttaatgcca</td><td>ggcągcgtaa</td><td>agcgttcctt</td><td>aatgctatta</td><td> 300</td>

<td>tgcgctacgg</td><td>aatctcccta</td><td>tagtgagtcg</td><td>Tatt</td><td></td><td></td><td> 335</td>

&lt;210&gt; 8 &lt;211&gt; 29 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 8 tctgaattct ccgtagcgca taatagcat 29 &lt;210&gt; 9 &lt;211&gt; 21 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 9 gacgccgatt taagcagaag a 21 &lt;210&gt; 10 &lt;211&gt; 171 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; artificial sequence

239 &lt;400&gt; 10 tctgaattct ccgtagcgca taatagcatt aaggaacgct ttacgctgcc tggcattaaa 60 accgagcact tcaatatttc ccccaactct ggctagtaac ggtggtagtg gacggtcctt ctcgtcttcttt cttttcatct 171 &lt;210&gt; 11 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 11 tcttctgctt aaatcggcgt cgaagacacg acatggcaag aaaat 45 &lt;210&gt; 12 &lt;211&gt; 32 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 12 gatcccgcag aaaagtcaga atggtaatcg ga 32 &lt;210&gt; 13 &lt;211&gt; 112 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 13 tcttctgctt aaatcggcgt cgaagacacg acatggcaag aaaatctctc cgattaccat 60 tctgactttt ctgcgggatc tccgattacc attctgactt ttctgcggga tc 112 &lt;210&gt; &lt;12&gt; &lt;&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 14 ctccgattac cattctgact tttc &lt;210&gt; 15 &lt;211&gt; 30 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; artificial sequence

240 &lt;400&gt; 15 tctggatcct tccgtagcgc ataatagcat 30 &lt;210&gt; 16 &lt;211&gt; 245 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial Sequence &lt;400&gt; 16 ctccgattac cattctgact tttctgcggg atcagatgag gataaggaag acgatgattt 60 cgatgagaag aaogacgccg atttaagcag aagaagtcga agaaagatgg aaagaaaaga 120 cgagaaggac cgtccactac caccgttact agccagagtt gggggaaata ttgaagtgct ISO cggttttaat gccaggcagc gtaaagcgtt ccttaatgct attatgcgct acggaaggat 240 CCAG 245 &lt;210&gt; 17 &lt;211&gt; 473 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 17

<td>tctgaattct</td><td>ccgtagcgca</td><td>taatagcatt</td><td>aaggaacgct</td><td>ttacgctgcc</td><td>tggcattaaa</td><td> 60</td>

<td>accgagcact</td><td>tcaatatttc</td><td>ccccaactct</td><td>ggctagtaac</td><td>ggtggtagtg</td><td>gacggtcctt</td><td> 120</td>

<td>ctcgtctttt</td><td>ctttccatct</td><td>ttcttcgact</td><td>tcttctgctt</td><td>aaatcggcgt</td><td>cgaagacacg</td><td> 130</td>

<td>acatggcaag</td><td>aaaatctctc</td><td>cgattaccat</td><td>tctgactttt</td><td>ctgcgggatc</td><td>tccgattacc</td><td> 240</td>

<td>attctgactt</td><td>ttctgcggga</td><td>tcagatgagg</td><td>ataaggaaga</td><td>cgatgatttc</td><td>gatgagaaga</td><td> 300</td>

<td>acgacgccga</td><td>tttaagcaga</td><td>agaagtcgaa</td><td>gaaagatgga</td><td>aagaaaagac</td><td>gagaaggacc</td><td> 360</td>

<td>gtccactacc</td><td>accgttacta</td><td>gccagagttg</td><td>939gaaatat</td><td>tgaagtgotc</td><td>gttttaatgc</td><td> 420</td>

<td>caggcagcgt</td><td>aaagcgttcc</td><td>ttaatgctat</td><td>tatgcgctac</td><td>ggaaggatcc</td><td>aga</td><td> 473</td>

&lt;210&gt; 18 &lt;211&gt; 536 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera

241 &lt;400&gt; 18

<td>accgccatca</td><td>tgttattggc</td><td>atcacacatg</td><td>tgctgtgtga</td><td>gctctggaac</td><td>tttcaacggt</td><td> 60</td>

<td>ctgtattgtt</td><td>ggctgcctct</td><td>tgaggtgagt</td><td>ggagcgaatc</td><td>cgggoatgaa</td><td>gaagtggaga</td><td> 120</td>

<td>cgggggaagg</td><td>gaaccatgtt</td><td>gacagccaat</td><td>tttctaagat</td><td>cagćattcaa</td><td>ctgacctggg</td><td>iao</td>

<td>aacctaagac</td><td>aggtggttac</td><td>accggacatt</td><td>gtgagggata</td><td>ccaaatggtt</td><td>taagtctcca</td><td> 240</td>

<td>tatgtgggtg</td><td>ttgtgagttt</td><td>caaagttctg</td><td>aagcaaatgt</td><td>catagagagc</td><td>ttcattatca</td><td> 300</td>

<td>atacagtatg</td><td>tttcatctgt</td><td>gttttctacc</td><td>aattgatgta</td><td>ctgaaagtgt</td><td>ggcattgtat</td><td> 360</td>

<td>ggttctacta</td><td>cggtatctga</td><td>tactttgggt</td><td>gaggggacta</td><td>ctgagtatgt</td><td>gttcataatt</td><td> 420</td>

<td>ctgtctgggt</td><td>attcttcacg</td><td>gatttttgag</td><td>atagggaggg</td><td>tacccatacc</td><td>tgatccagta</td><td> 480</td>

<td>ccacctccaa</td><td>gtgagtgtgt</td><td>gagttggaat</td><td>ccttgtaaac</td><td>aatcacatga</td><td>tcagct</td><td> 536</td>

&lt;210&gt; 19 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 19 taatacgact cactataggg agagaatccg ggcatgaaga agtg &lt;210&gt; 20 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 20 taatacgact cactataggg agacaaaaat ccgtgaagaa tacc &lt;210&gt; 21 &lt;211&gt; 399 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 21

<td>taatacgact</td><td colspan="2">cactataggg agagaatccg</td><td>ggoatgaaga</td><td>agtggagacg</td><td>ggggaaggga</td><td> 60</td>

<td>accatgttga</td><td>cagccaattt</td><td>tctaagatca</td><td>gcattcaact</td><td>gacctgggaa</td><td>cctaagacag</td><td> 120</td>

<td>gtggttacac</td><td>cggacattgt</td><td>gagggatacc</td><td>aaatggttta</td><td>agtctceata</td><td>tgtgggtgtt</td><td> 180</td>

<td>gtgagtttca</td><td>aagttctgaa</td><td>gcaaatgtca</td><td>tagagagctt</td><td>cattatcaat</td><td>acagtatgtt</td><td> 240</td>

<td>tcatctgtgt</td><td>tttctaccaa</td><td>ttgatgtact</td><td>gaaagtgtgg</td><td>cattgtatgg</td><td>ttctactacg</td><td> 300</td>

<td>gtatctgata</td><td>ctttgggtga</td><td>ggggactact</td><td>gagtatgtgt</td><td>tcataattct</td><td>gtctgggtat</td><td> 3 60</td>

<td>tcttcacgga</td><td>tttttgtctc</td><td>cctatagtga</td><td>gtcgtatta</td><td></td><td></td><td> 309</td>

242

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>22 26 GOUT Artificial</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Artificial Sequence</td>

&lt;400&gt; 22 actgaattct ccgggcatga agaagt 26

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>23 19 GOUT Artificial</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Artificial Sequence</td>

&lt;400&gt; 23 tattcttcac ggatttgac 19

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>24 267 GOUT Artificial</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Artificial Sequence</td>

&lt;400&gt; 24 actgaattct ccgggcatga agaagtggag acgggggaag ggaaccatgt tgacagccaa 60 ttttctaaga tcagcattca actgacctgg gaacctaagg caggtggtta caccggacat 120 tgtgagggat accaaatggt ttaagtctcc gtatgtgggt gttgtgagtt tcaaagttct 180 gaagcaaatg tcatagagag cttcattatc aatacagtat gtttcatctg tgttttctac 240 caattgatgt caaatcogtg aagaata 267

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>25 17 GOUT Artificial</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Artificial Sequence</td>

&lt;400&gt; 25 caaatccgtg aagaata 17

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>26 19 GOUT Artificial</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Artificial Sequence</td>

243 &lt;400&gt; 26 ctgaaagtgt ggcgttgta 19 &lt;210&gt; 27 &lt;211&gt; 106 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 27 caaatccgtg aagaataccc agatagaatt atgaacacat actcagtagt cccctctccc 60 aaagtatcag ataccgtagt agaaccatac aacgccacac tttcag. 106 &lt;210&gt; 28 &lt;211&gt; 22 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 28 tagaaccata caacgccaca ct &lt;210&gt; 29 &lt;211&gt; 25 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 29 tctggatcca cgggggaagg gaacc &lt;210&gt; 30 &lt;211&gt; 257 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 30

<td>tagaaccata</td><td>caacgccaca</td><td>ctttcagtac</td><td>atcaattggt</td><td>agaaaacaca</td><td>gatgaaacat</td><td> 60</td>

<td>aotgtattga</td><td>taatgaagct</td><td>ctctatgaca</td><td>tttgcttcag</td><td>aactttgaaa</td><td>ctcacaacac</td><td> 120</td>

<td>ccacatacgg</td><td>agacttaaac</td><td>catttggtat</td><td>ccctcacaat</td><td>gtccggtgta</td><td>accacctgcc</td><td> 180</td>

<td>ttaggttccc</td><td>aggtcagttg</td><td>aatgctgatc</td><td>ttagaaaatt</td><td>ggctgtcaac</td><td>atggttccct</td><td> 240</td>

<td>tcccccgtgg</td><td>atccaga</td><td></td><td></td><td></td><td></td><td> 257</td>

&lt;210&gt; 31 &lt;211&gt; 586 &lt;212&gt; DNA &lt;213&gt; Artificial

244 &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 31

<td>actgaattct</td><td>ccgggcatga</td><td colspan="3">agaagtggag acgggggaag ggaaccatgt</td><td>tgacagccaa</td><td> 60</td>

<td>ttttctaaga</td><td>tcagcattca</td><td>actgacctgg</td><td>gaacctaagg</td><td>caggtggtta</td><td>caccggacat</td><td> 120</td>

<td>tgtgagggat</td><td>accaaatggt</td><td>ttaagtćtcc</td><td>gtatgtgggt</td><td>gttgtgagtt</td><td>tcaaagttct</td><td> 180</td>

<td>gaagcaaatg</td><td>tcatagagag</td><td>cttcattatc</td><td>aatacagtat</td><td>gtttcatctg</td><td>tgttttctac</td><td> 240</td>

<td>caattgatgt</td><td>caaatccgtg</td><td>aagaataccc</td><td>agatagaatt</td><td>atgaacacat</td><td>actcagtagt</td><td> 300</td>

<td>cccctctccc</td><td>aaagtatcag</td><td>ataccgtagt</td><td>agaaccatac</td><td>aacgccacac</td><td>tttcagtaca</td><td> 360</td>

<td>tcaattggta</td><td>gaaaacacag</td><td>atgaaacata</td><td>ctgtattgat</td><td>aatgaagctc</td><td>tctatgacat</td><td> 420</td>

<td>ttgcttcaga</td><td>actttgaaac</td><td>tcacaacacc</td><td>cacatacgga</td><td>gacttaaacc</td><td>atttggtatc</td><td> 480</td>

<td>cctcacaatg</td><td>tccggtgtaa</td><td>ccacctgcct</td><td>taggttccca</td><td>ggtcagttga</td><td>atgctgatct</td><td> 540</td>

<td>tagaaaattg</td><td>gctgtcaaca</td><td>tggttccctt</td><td>cccccgtgga</td><td>tccaga</td><td></td><td> 586</td>

&lt;210&gt; 32 &lt;211&gt; 399 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 32

<td>acgcgtccag</td><td colspan="2">ttaatatccc gtgagatatt</td><td>tttgcagtcc</td><td>ttttaataag</td><td>attcttcata</td><td> 60</td>

<td>attcaccątg</td><td>aagggctgcg</td><td>ttttcaacat</td><td>cgacaacggt</td><td>tatttggaag</td><td>gcctgtgtcg</td><td> 120</td>

<td>tggctttaaa</td><td>tgtgggatcc</td><td>tgaaacacgc</td><td>cgattatttg</td><td>aatttggtcc</td><td>agtgtgaaac</td><td> 180</td>

<td>tcttgaagat</td><td>ttaaaactgc</td><td>acttgcaagg</td><td>cactgactat</td><td>ggaacttttt</td><td>tggccaatga</td><td> 240</td>

<td>accttcacct</td><td>ttgtcagtat</td><td>ccgtcatcga</td><td>ttcaagactt</td><td>cgacaaaaac</td><td>tcctgattga</td><td> 300</td>

<td>gttccagcac</td><td>atgcgtaacc</td><td>aagcagtaga</td><td>gcctctctcg</td><td>acatttatgg</td><td>gcttcattac</td><td> 3 60</td>

<td>ctaęagttac</td><td>atgatcgaca</td><td>acataatttt</td><td>gcttattac</td><td></td><td></td><td> 399</td>

&lt;210&gt; 33 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 33 taatacgact cactataggg agaaacggtt atttggaagg 40 &lt;210&gt; 34 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 34 taatacgact cactataggg agattgtcga tcatgtaact gta 43

245 &lt;210&gt; 35 &lt;211&gt; 291 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 35

<td>taatacgact</td><td>cactataggg</td><td>agaaacggtt</td><td>atttgcaagg</td><td>tttgactgta</td><td>tattattatt</td><td> 60</td>

<td>tttatgtatc</td><td>gacatygatg</td><td>aattgattta</td><td>tttatcgtaa</td><td>agaaattcaa</td><td>atacatttaa</td><td> 120</td>

<td>agcttcaaat</td><td>attaataata</td><td>atgaacaagc</td><td>tttgaagggt</td><td>tacaaacaac</td><td>caatcgatct</td><td> 180</td>

<td>attaatatag</td><td>tctattgact</td><td>ctgaagttgc</td><td>aaacggtaat</td><td>agggccaatg</td><td>caatggtttg</td><td> 240</td>

<td>attctcccta</td><td>cagttacatg</td><td>atcgacaact</td><td>ccctatagtg</td><td>agtcgtatta</td><td>and</td><td> 291</td>

&lt;210&gt; 36 &lt;211&gt; 451 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 36

<td>ccacatacca</td><td>cgctatgaaa</td><td>cccccttata</td><td>tggggccgat</td><td>ctaacaggag</td><td>tgtggaactc</td><td> 60</td>

<td>tatatccatt</td><td>atatctaaaa.</td><td>tggttaacag</td><td>aaaagaattc</td><td>ataattaaca</td><td>ttcaattgcc</td><td> 120</td>

<td>attgtacacg</td><td>tatattctgg</td><td>taaatctact</td><td>actactggac</td><td>atttaattta</td><td>caaatgtagt</td><td> 180</td>

<td>ggtatcgaca</td><td>aacttaccat</td><td>cgaaaagttc</td><td>caaaaagaat</td><td>cccaacaaat</td><td>gggtaaaggc</td><td> 240</td>

<td>taattcaaat</td><td>atgcctgggt</td><td>actctacata</td><td>cttacagccc</td><td>atagagaacg</td><td>tggtattacc</td><td> 300</td>

<td>attgatattg</td><td>ctgtgcggaa</td><td>attcgaaaca</td><td>gctaaatact</td><td>attgaaccat</td><td>cattgatgcc</td><td> 360</td>

<td>cctggcacag</td><td>atatttcatt</td><td>aataacatta</td><td>tcactggtac</td><td>attacaatct</td><td>gactgtgctg</td><td> 420</td>

<td>tactcattga</td><td>tgcaactggt</td><td>acttggtaat</td><td>t '</td><td></td><td></td><td> 451</td>

&lt;210&gt; 37 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 37 taatacgact cactataggg agacacgcta tgaaaccccc ttat &lt;210&gt; 38 &lt;211&gt; 42 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 38 taatacgact cactataggg agatttcgaa tttccgcaca gc

246 &lt;210&gt; 39 &lt;211&gt; 933 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; Artificial sequence &lt;400&gt; 39

<td>taatacgact cactataggg agatttcgaa tttccgcaca gcaagtgtgt aacttaaatt</td><td> 60</td>

<td>tcaaaaaact tttcgttgtc ccaatttttt ttcataatct tagcggttac gattcgcata</td><td> 120</td>

<td>tgatgattag agatcttgcg aaaaatggta gtatcagctt actaccaata aataaggaaa</td><td> 180</td>

<td>agtatatttc atttacaata tacgattctg aggtcagtat taggttgagg ttcgttgatt</td><td> 240</td>

<td>cactgagatt tttaaattca tcattggaca agttggctgc cacattgcaa cctgaggatt</td><td> 300</td>

<td>taagatattt agctagcgaa tttccaaata ccactaccga acaaatggaa ttattgaaac</td><td> 360</td>

<td>gaaaaggcat attćccatac gaatatattg agtctttcaa taaattgaat gaaacgcaac</td><td> 420</td>

<td>taccatcaat tgataaattt tacagctcat tatcgggtga aaacatctcc aaaaatatgt</td><td> 480</td>

<td>atcatcatgc tcagaatgtt tggcagtcat tcggtattaa aaatattttg gaatatagta</td><td> 340</td>

<td>tgttgtacat gaaaactgat attatgttac tgacttgcat ttttgaaaat tttcgacaaa</td><td> 600</td>

<td>aatgtcgaag tacatacagt cttgatcctg catggtacta taccatgcct ggattttctt</td><td> 660</td>

<td>gggatgcaat gcttaaatat actggatgta aacttgaact gctgaatgat atcgataaaa</td><td> 720</td>

<td>tcatgtttat tgagaaagct atccgaggtg gtataagtca agtaagtaat cggtattctg</td><td> 780</td>

<td>aggcaaataa caaatacatg cataattatg atccatcaaa gcctagtaaa tatgtgctat</td><td> 840</td>

<td>atttagatgt caacaatttg tatggttggg caatgtctca attattacca taagggggtt</td><td> 900</td>

<td>tcatagcgtg tctccctata gtgagtcgta tta</td><td> 933</td>

&lt;210&gt; 40 10 &lt;211&gt; 918 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 40 cccaagcgtc cgcccacgcg tccgcccacg cggccccccc cgccgcccgc acggtgtgga 60

247

<td>cctcgcgcct</td><td>ggtgttacat</td><td>cccaagtagt</td><td>gttcctttta</td><td>ttctaagttt</td><td>aatttcgaac</td><td> 120</td>

<td>agttgcattt</td><td>actttatttc</td><td>caaacaatca</td><td>aaatgggtaa</td><td>agaaaagatt</td><td>catattaaca</td><td> 180</td>

<td>tcgttgtcat</td><td>tggacacgta</td><td>gattctggta</td><td>aatctactac</td><td>tactggacat</td><td>ttaatttaca</td><td> 240</td>

<td>aatgtggtgg</td><td>tatcgacaaa</td><td>cgtaccatcg</td><td>aaaagttcga</td><td>aaaagaagcc</td><td>caagaaatgg</td><td> 300</td>

<td>gtaaaggttc</td><td>attcaaatat</td><td>gcctgggtac</td><td>tcgacaaact</td><td>taaggccgag</td><td>agagaacgtg</td><td> 360</td>

<td>gtattaccat</td><td>tgatattgct</td><td>ttgtggaaat</td><td>tcgaaacagc</td><td>taaatactat</td><td>gtaaccatca</td><td> 420</td>

<td>ttgatgcccc</td><td>tggacacaga</td><td>gatttcatta</td><td>agaacatgat</td><td>cactggtaca</td><td>tcacaagctg</td><td> 430</td>

<td>actgtgctgt</td><td>actcattgtt</td><td>gcagctggta</td><td>ctggtgaatt</td><td>tgaagcaggt</td><td>atttcaaaga</td><td> 540</td>

<td>atggacaaac</td><td>acgtgaacat</td><td>gctcttcttg</td><td>ctttcaccct</td><td>tggtgtaaaa</td><td>caacttattg</td><td> 600</td>

<td>ttggtgtcaa</td><td>caaaatggac</td><td>tcgactgaac</td><td>cagcatacag</td><td>tgaatcacgt</td><td>ttcgaggaaa</td><td> 660</td>

<td>tcaagaagga</td><td>agtatcctca</td><td>tacatcaaga</td><td>aaattggtta</td><td>caacccagct</td><td>gccgttgctt</td><td> 720</td>

<td>tcgtaccaat</td><td>ttcaggatgg</td><td>cacggagaca</td><td>acatgttaga</td><td>aggatctgac</td><td>aagatgccat</td><td> 780</td>

<td>ggttcaaggg</td><td>atggcaaatc</td><td>gaacgtaaag</td><td>aaggaaaagc</td><td>tgaaggaaag</td><td>tgcttgattg</td><td> 840</td>

<td>aggctttgga</td><td>tgctatcctt</td><td>cccccacctc</td><td>gtccaactga</td><td>gaaacccctc</td><td>cgtcttccae</td><td> 900</td>

<td>tccaggatgt</td><td>ctacaaaa</td><td></td><td></td><td></td><td></td><td> 918</td>

<td></td><td></td><td> &lt;210&gt;</td><td> 41</td><td></td>

<td></td><td></td><td> &lt;211&gt;</td><td> 41</td><td></td>

<td></td><td> 5</td><td> &lt;212&gt;</td><td>GOUT</td><td></td>

<td></td><td></td><td> &lt;213&gt;</td><td>Artificial</td><td></td>

<td></td><td></td><td> &lt;220&gt;</td><td></td><td></td>

<td></td><td></td><td> &lt;223&gt;</td><td>Sequence</td><td>imitation</td>

<td></td><td></td><td> &lt;400&gt;</td><td> 41</td><td></td>

<td> 1</td><td> 0</td><td colspan="3">taatacgact cactataggg agacctcgcg cctggtgtta c</td>

<td></td><td></td><td> &lt;210&gt;</td><td> 42</td><td></td>

<td></td><td></td><td> &lt;211&gt;</td><td> 45</td><td></td>

<td></td><td></td><td> &lt;212&gt;</td><td>GOUT</td><td></td>

<td></td><td></td><td> &lt;213&gt;</td><td>Artificial</td><td></td>

<td> 1</td><td> 5</td><td> &lt;220&gt;</td><td></td><td></td>

<td></td><td></td><td> &lt;223&gt;</td><td>Sequence</td><td>imitation</td>

&lt;400&gt; 42 taatacgact cactataggg agaccaaggg tgaaagcaag aagag 45 &lt;210&gt; 43 &lt;211&gt; 569 &lt;212&gt; DNA &lt;213&gt; Artificial &lt;220&gt;

&lt;223&gt; artificial sequence

248 &lt;400&gt; 43 taatacgact cactataggg agacctcgcg cctggtgtta catcccaagt agtgttcctt ttattctaag tttaatttcg aacagttgca tttactttat ttccaaacaa tcaaaatggg taaagaaaag attcatatta acatcgttgt cattggacac gtagattctg gtaaatctac tactactgga cgaaaaagaa acttaaggcc agotaaatac gatcactggt atttgaagca ccttggtctc catttaattt gcccaagaaa gagagagaac tatgtaacca acatcacaag ggtatttcaa cctatagtga acaaatgtgg tgggtaaagg gtggtattac tcattgatgc ctgactgtgc agaatggaca gtcgtatta tggtatcgac ttcattcaaa cattgatatt ccctggacac tgtactcatt aacacgtgaa aaacgtacca tatgcctggg gctttgtgga agagatttca gttgcagctg catgctcttc tcgaaaagtt tactcgacaa aattcgaaac ttaagaacat gtactggtga ttgctttcac

SO

120

180

240

300

360

420

480

540

569 &lt;210&gt; 44 &lt;211&gt; 440 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 44

<td>tcgcgggccg</td><td>acacacgcct</td><td>ccatattaag</td><td>tcttgaaagt</td><td>catttttaaa</td><td>aacattttaa</td><td> 60</td>

<td>tttaaaagta</td><td>gtatttttaa</td><td>gatttttcat</td><td>tttcacacca</td><td>gttcataatg</td><td>gcatctggtt</td><td> 120</td>

<td>caatatacga</td><td>cgctgcacat</td><td>aagggagatt</td><td>ttgaatatgt</td><td>ttcccaaaag</td><td>attgaagagg</td><td> 180</td>

<td>atccactaat</td><td>tataaaagca</td><td>ccagactcta</td><td>gtaaaaggct</td><td>tctaattcat</td><td>tgggcagttc</td><td> 240</td>

<td>tcagcggaaa</td><td>tgtaaagctt</td><td>gttactcatt</td><td>tactggaact</td><td>tggatcttct</td><td>gtgaacccct</td><td> 300</td>

<td>cggatgatac</td><td>agatatgaca</td><td>ccattaatat</td><td>tagcttcatc</td><td>ggctggccat</td><td>accgaagttg</td><td> 360</td>

<td>tcaaattgtt</td><td>attaaaaaaa</td><td>tgtgatgatg</td><td>tcaatcataa</td><td>aaatgcacag</td><td>ggtcattcat</td><td> 420</td>

<td>cacttcagta</td><td>tgcagcctcc</td><td></td><td></td><td></td><td></td><td> 440</td>

&lt;210&gt; 45 &lt;211&gt; 46 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 45 taatacgact cactataggg agaacgctgc acataaggga gatttt &lt;210&gt; 46 &lt;211&gt; 41 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 46 taatacgact cactataggg agaggaggct gcatactgaa g 41

249 &lt;210&gt; 47 &lt;211&gt; 1113 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja Stuczna &lt;400&gt; 47

<td>TAATACGACT</td><td>cactataggg</td><td>agaacgctgc</td><td>acataaggga</td><td>gattttgact</td><td>atgtttcaga</td><td> 60</td>

<td>aaagattgaa</td><td>gagtttccaa</td><td>taattttaga</td><td>agcaccagac</td><td>tctgtaagtt-</td><td>gtaattattt</td><td> 120</td>

<td>gtatattatt</td><td>atctaacgtt</td><td>aatctctaga</td><td>cgaaccttta</td><td>ttatatccaa</td><td>tctctaccgt</td><td> 180</td>

<td>gcaatactaa</td><td>aatgtaccac</td><td>gtacatttgt</td><td>agttcctttg</td><td>atttttttaa</td><td>tttcattttt</td><td> 240</td>

<td>ttaacaggtt</td><td>ttgcaaatgt</td><td>atacattttt</td><td>attttggtta</td><td>catagtcagg</td><td>ttatacagtc</td><td> 300</td>

<td>cgtataattt</td><td>caataatttc</td><td>tctatctagt</td><td>atagaaccca</td><td>tgtcacctta</td><td>tcaacctatt</td><td> 360</td>

<td>atcctgcata</td><td>tttaaatgca</td><td>gtaaąaccac</td><td>atttaaaaac</td><td>atattttctg</td><td>gtatctcata</td><td> 420</td>

<td>gccatttgta</td><td>tcctctaatg</td><td>gatgtgcata</td><td>ggcttcttct</td><td>aaagttttct</td><td>agtttctatg</td><td> 480</td>

<td>aagttacaaa</td><td>gtagtttcct</td><td>gttattctct</td><td>tgagaacatt</td><td>tgttcatatg</td><td>ataggtggtt</td><td> 540</td>

<td>catattatct</td><td>gacagtttca</td><td>gcttacaagt</td><td>gaagcagtag</td><td>catctccaga</td><td>agatgccaac</td><td> 600</td>

<td>ccctagtgtt</td><td>ggtgaaacgt</td><td>cgagaactac</td><td>ttgacagtct</td><td>aagagcccca</td><td>acaaacagtt</td><td> 660</td>

<td>taacaagttg</td><td>gtgtgcattt</td><td>agttgataga</td><td>attctgtcag</td><td>gttcttggat</td><td>actccattgt.</td><td> 720</td>

<td>attggtttat</td><td>tttatttaac</td><td>taatttcctc</td><td>tctcttggtt</td><td>ctctttacta</td><td>ttccaaacct</td><td> ' 780</td>

<td>aaaaattttt</td><td>tattgtatag</td><td>attcattttg</td><td>ttgttgagct</td><td>tatatattgt</td><td>gctattgacc</td><td>Θ40</td>

<td>aataatcaaa</td><td>tactttttag</td><td>agtaagaggc</td><td>ttgtaattca</td><td>ttgggcagtt</td><td>ctcagcggaa</td><td> 900</td>

<td>atgtaaagct</td><td>tgttacctat</td><td>ttactgaaac</td><td>ttggatctcc</td><td>tgtgaactcc</td><td>tcagatgata</td><td> 960</td>

<td>cagatatgac</td><td>accattaata</td><td>ttagcttcat</td><td>cagctggcca</td><td>taccgaagtt</td><td>gtcaaattgt</td><td> 1020</td>

<td>tattaaaaaa</td><td>atgtgatgat</td><td>gtcaatcata</td><td>aaaatgcaca</td><td>gggccattca</td><td>tcacttcagt</td><td> 1080</td>

<td>atgcagcctc</td><td>cctccctata</td><td>gtgagtcgta</td><td>tta</td><td></td><td></td><td> 1113</td>

&lt;210&gt; 48 10 &lt;211&gt; 425 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 48

<td>aggattttct</td><td>gaagctgccg</td><td>aagtaactgg</td><td>actcaatcca</td><td>gcccaaatat</td><td>ccgtcattat</td><td> 60</td>

<td>gaagaacctg</td><td>atggctcgat</td><td>tgggattcca</td><td>gaagtactac</td><td>cttcagggag</td><td>gtgattgggg</td><td> 120</td>

<td>ttccgcaata</td><td>gtagccaact</td><td>tagcatcatt</td><td>attcccagaa</td><td>aaagtgctgg</td><td>gagtccattc</td><td> 180</td>

<td>caatatgtgt</td><td>atggtcaata</td><td>gtatgctttc</td><td>taatctaaaa</td><td>ttagcattgg</td><td>gtagttttat</td><td> 240</td>

<td>gccatccttg</td><td>attgttgatg</td><td>ctgacaagca</td><td>acatctcctt</td><td>tatcccagaa</td><td>tgaaacattt</td><td> 300</td>

<td>tggattcctt</td><td>atattggaaa</td><td>gtggttatat</td><td>gcatcttcag</td><td>ggtagtaaac</td><td>cagataccgt</td><td> 360</td>

<td>tggtgtcgct</td><td>ctacgtgata</td><td>gccctgtagg</td><td>tcttgcagct</td><td>tacatcatag</td><td>agaagtttca</td><td> 420</td>

<td>Cacao</td><td></td><td></td><td></td><td></td><td></td><td> 425</td>

&lt;210&gt; 49 &lt;211&gt; 42

250 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 49 taatacgact cactataggg agatctgaag ctgccgaagt aa 42 &lt;210&gt; 50 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 50 taatacgact cactataggg agatatcacg tagagcgaca ccaa &lt;210&gt; 51 &lt;211&gt; 47 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 51 taatacgact cactataggg agactatgat gtaagctgca agaccta 47 &lt;210&gt; 52 &lt;211&gt; 95 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 52 taatacgact cactataggg agatcgcgat gagtagaccc aacacctctg gtaagggctc 60 tcatgćattg tttctcccta tagtgagtcg tatta &lt;210&gt; 53 &lt;211&gt; 427 &lt;212&gt; DNA &lt;213&gt; Diaica &lt;213&gt;

251 &lt;400&gt; 53

<td>gacgcgcggg</td><td>tcgatgcaag</td><td>actctagata</td><td>gagtcgtaat</td><td>attgtcaact</td><td>ttttcgtttc</td><td> 60</td>

<td>ggtaaaattt</td><td>atactaacta</td><td>gccgtcagaa</td><td>aagttactaa</td><td>ttctccagtt</td><td>atttaattga</td><td> 120</td>

<td>gaatttgact</td><td>ttattcgtca</td><td>ctagcgcaat</td><td>aactcagtat</td><td>ggtgattatt</td><td>aattcattta</td><td> 180</td>

<td>aacaccccga</td><td>gtctcctatt</td><td>aggtatcaac</td><td>aggacgatgt</td><td>tcaagtctac</td><td>ttagacaaga</td><td> 240</td>

<td>aagatttggg</td><td>cctgggaact</td><td>ttatttgtta</td><td>gtgaaagcac</td><td>attatgctgg</td><td>caacaagaag</td><td> 300</td>

<td>agaacaatgg</td><td>ttttgctatt</td><td>gaatattcaa</td><td>gtatttcctt</td><td>gcatgccata</td><td>tctaaagatt</td><td> 360</td>

<td>taaacattca</td><td>ttctacagaa</td><td>tgtgtatacc</td><td>tcgtgacaga</td><td>tggacatatt</td><td>actatgccag</td><td> 420</td>

<td>gtgacag</td><td></td><td></td><td></td><td></td><td></td><td> 427</td>

&lt;210&gt; 54 &lt;211&gt; 43 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 54 taatacgact cactataggg agactagccg tcagaaaagt tac &lt;210&gt; 55 &lt;211&gt; 41 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 55 taatacgact cactataggg agaatggcat gcaaggaaat a &lt;210&gt; 56 &lt;211&gt; 318 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 56

<td>TAATACGACT</td><td>cactataggg</td><td>agactagccg</td><td>tcagaaaagt</td><td>tactaattct</td><td>ccagttattt</td><td> 50</td>

<td>aattgagaat</td><td>ttgactttat</td><td>tcgtcactag</td><td>cgcaataact</td><td>cagtatggtg</td><td>attattaatt</td><td> 120</td>

<td>catttaaaca</td><td>ccccgagtct</td><td>cctattaggt</td><td>atcaacagga</td><td>cgatgttcaa</td><td>gtctacttag</td><td> 180</td>

<td>acaagaaaga</td><td>tttgggcctg</td><td>ggaactttat</td><td>ttgttagtga</td><td>aagcacatta</td><td>tgctggcaac</td><td> 240</td>

<td>aagaagagaa</td><td>caatggtttt</td><td>gctattgaat</td><td>attcaagtat</td><td>ttccttgcat</td><td>gccattctcc</td><td> 300</td>

<td>ctatagtgag</td><td>tcgtatta</td><td></td><td></td><td></td><td></td><td> 318</td>

&lt;210&gt; 57 &lt;211&gt; 431 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera

252 &lt;400&gt; 57

<td>caattattca</td><td>cagaacaaca</td><td>attatacaga</td><td>atagaccact</td><td>atttgggtaa</td><td>ggaaatggta</td><td> 60</td>

<td>cagaatttaa</td><td>tgacacttcg</td><td>atttggtaac</td><td>agaatcttta</td><td>accccacatg</td><td>gaacagtgac</td><td> 120</td>

<td>catatagctt</td><td>ccatccaaat</td><td>aaattgtaag</td><td>gaacccttcg</td><td>gaactgaagg</td><td>cagaggaggg</td><td> 180</td>

<td>tattttgacg</td><td>aattcggcat</td><td>tattagggat</td><td>gtaatgcaga</td><td>atcatatttt</td><td>acaaattcta</td><td> 240</td>

<td>gctctagtag</td><td>ctatggaaaa</td><td>accagcttca</td><td>gttcaaccag</td><td>acgatataag</td><td>aaatgaaaag</td><td> 300</td>

<td>gtaaaggtat</td><td>taaaaagtat</td><td>agctccaata</td><td>aagctcaagg</td><td>acgttgtatt</td><td>gggtcagtac</td><td> 360</td>

<td>gttggaaatc</td><td>ctgatggaca</td><td>aggtaatgcg</td><td>aaattgggat</td><td>acttagatga</td><td>tccgagtgtt</td><td> 420</td>

<td>cctaaagatt</td><td>c</td><td></td><td></td><td></td><td></td><td> 431</td>

&lt;210&gt; 58 &lt;211&gt; 47 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 58 taatacgact cactataggg agaacagtga ccatatagct tccatcc &lt;210&gt; 59 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 59 taatacgact cactataggg agaatttcgc attaccttgt ccatc &lt;210&gt; 60 &lt;211&gt; 328 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja Stuczna &lt;400&gt; 60

<td>TAATACGACT</td><td>cactataggg</td><td>agaacagtga</td><td>ccatatagct</td><td>tccatccaaa</td><td>taaattgtaa</td><td> 60</td>

<td>ggaacccttc</td><td>ggaactgaag</td><td>gcagaggagg</td><td>gtattttgac</td><td>gaattcggca</td><td>ttattaggga</td><td> 120</td>

<td>tgtaatgcag</td><td>aatcatattt</td><td>tacaaattct</td><td>agctctagta</td><td>gctatggaaa</td><td>aaccagcttc</td><td> 180</td>

<td>agttcaacca</td><td>gacgatataa</td><td>gaaatgaaaa</td><td>ggtaaaggta</td><td>ttaaaaagta</td><td>tagctccaat</td><td> 240</td>

<td>aaagctcaag</td><td>gacgttgtat</td><td>tgggtcagta</td><td>cgttggaaat</td><td>cctgatggac</td><td>aaggtaatgc</td><td> 300</td>

<td>gaaattctce</td><td>ctatagtgag</td><td>tcgtatta</td><td></td><td></td><td></td><td> 328</td>

&lt;210&gt; 61 &lt;211&gt; 483 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera

253 &lt;400&gt; 61

<td>acccacgcct</td><td>accccgcccc</td><td>gtgatattta</td><td>gtgcttactt</td><td>ggtacagcag</td><td>tttcagtgct</td><td> 60</td>

<td>gtgctttaga</td><td>ataatttatt</td><td>ttttaacatt</td><td>tatatagaaa</td><td>tcaaatacta</td><td>accaatcaac</td><td> 120</td>

<td>atgtgtgaag</td><td>aagaagttgc.</td><td>cgctttagtc</td><td>gtagacaatg</td><td>gatccggtat</td><td>gtgcaaagct</td><td> 180</td>

<td>ggttttgctg</td><td>gggatgatgc</td><td>acctcgtgct</td><td>gtattccctt</td><td>caattgttgg</td><td>acgcccaaga</td><td> 240</td>

<td>catcagggtg</td><td>tgatggtagg</td><td>aatgggacaa</td><td>aaagattcct</td><td>atgtaggtga</td><td>tgaagctcaa</td><td> 300</td>

<td>agtaaaagag</td><td>gtatccttac</td><td>cttaaaatac</td><td>cccatcgagc</td><td>acggaatągt</td><td>cacaaactgg</td><td> 360</td>

<td>gatgatatgg</td><td>agaaaatttg</td><td>gcatcataca</td><td>ttctacaatg</td><td>aacteagagt</td><td>agccccagaa</td><td> 420</td>

<td>gaacaccctg</td><td>ttctgttgac</td><td>agaagctcct</td><td>ctcaacccca</td><td>aggccaacag</td><td>ggaaaagatg</td><td> 4 80</td>

aca. 4 83 &lt;210&gt; 62 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 62 taatacgact cactataggg agaccgcccc gtgatattta gtgct &lt;210&gt; 63 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 63 taatacgact cactataggg agactgttgg ccttggggtt gagag &lt;210&gt; 64 &lt;211&gt; 503 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja is a stuczna

254 &lt;400&gt; 64

<td>TAATACGACT</td><td>cactataggg</td><td>agaccgcccc</td><td>gtgatattta</td><td>gtgcttactt</td><td>ggtacagcag</td><td> 60</td>

<td>tttcagtgct</td><td>gtgctttaga</td><td>ataatttatt</td><td>ttttaacatt</td><td>tatatagaaa</td><td>tcaaatacta</td><td> 120</td>

<td>accaatcaac</td><td>atgtgtgaag</td><td>aagaagttgc</td><td>cgctttagtc</td><td>gtagacaatg</td><td>gatccggtat</td><td> 180</td>

<td>gtgcaaagct</td><td>ggttttgctg</td><td>gggatgatgc</td><td>acctcgtgct</td><td>gtattccctt</td><td>caattgttgg</td><td> 240</td>

<td>acgcccaaga</td><td>catcagggtg</td><td>tgatggtagg</td><td>aatgggacaa</td><td>aaagattcct</td><td>atgtaggtga</td><td> 300</td>

<td>tgaagctcaa</td><td>agtaaaagag</td><td>gtatccttac</td><td>cttaaaatac</td><td>cccatcgagc</td><td>acggaatagt</td><td> 360</td>

<td>cacaaactgg</td><td>gatgatatgg</td><td>agaaaatttg</td><td>gcatcataca</td><td>ttctacaatg</td><td>aactcagagt</td><td> 420</td>

<td>agccccagaa</td><td>gaacaccctg</td><td>ttctgttgac</td><td>agaagctcct</td><td>ctcaacccca</td><td>aggccaacag</td><td> 480</td>

<td>tctccctata</td><td>gtgagtcgta</td><td>tta</td><td></td><td></td><td></td><td> 503</td>

&lt;210&gt; 65 &lt;211&gt; 407 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 65

<td>aggtgaatgt</td><td>tatatcgttt</td><td>ttcaaagtgt</td><td>aaggtgttta</td><td>ttttcaaaaa</td><td>gtttataaaa</td><td> 60</td>

<td>taagcaatca</td><td>ctatgggtaa</td><td>tgtgtttgca</td><td>aatttattca</td><td>aaggcctctt</td><td>tggcaaaaag</td><td> 120</td>

<td>gaaatgagga</td><td>tattgatggt</td><td>acgactcgat</td><td>gcagctggta</td><td>aaaccacaat</td><td>tttatataaa</td><td> 180</td>

<td>cttaaattag</td><td>gagaaattgt</td><td>aacaactatt</td><td>ccaacaattg</td><td>gatttaatgt</td><td>ggagactgta</td><td> 240</td>

<td>gaatataaga</td><td>acattagttt</td><td>tacagtatgg</td><td>gatgtaggtg</td><td>gtcaagataa</td><td>aattaggcca</td><td> 300</td>

<td>ttgtggagac</td><td>actatttcca</td><td>aaacacacaa</td><td>cgcctaattt</td><td>tcgtagtaga</td><td>cagtaaccac</td><td> 360</td>

<td>acggaaacta</td><td>acactgagge</td><td>taaagattaa</td><td>ttaatgcgtt</td><td>agttggg</td><td></td><td> 407</td>

&lt;210&gt; 66 &lt;211&gt; 42 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 66 taatacgact cactataggg agaactatgg gtaatgtgtt tg 42 &lt;210&gt; 67 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 67 taatacgact cactataggg agagtttccg tgtggttact 40 &lt;210&gt; 68 &lt;211&gt; 345 &lt;212&gt; DNA &lt;213&gt; Sztuczny

255 &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 68

<td>TAATACGACT</td><td>cactataggg</td><td>agaactatgg</td><td>gtaatgtgtt</td><td>tgcaaattta</td><td>ttcaaaggcc</td><td> 60</td>

<td>tctttggcaa</td><td>aaaggaaatg</td><td>aggatattga</td><td>tggtacgact</td><td>cgatgcagct</td><td>ggtaaaacca</td><td> 120</td>

<td>caattttata</td><td>taaacttaaa</td><td>ttaggagaaa</td><td>ttgtaacaac</td><td>tattecaaca</td><td>attggattta</td><td> 180</td>

<td>atgtggagac</td><td>tgtagaatat</td><td>aagaacatta</td><td>gttttacagt</td><td>atgggatgta</td><td>ggtggtcaag</td><td> 240</td>

<td>ataaaattag</td><td>gccattgtgg</td><td>agacactatt</td><td>tccaaaacac</td><td>acaacgccta</td><td>attttcgtag</td><td> 300</td>

<td>tagacagtaa</td><td>ccacacggaa</td><td>actctcccta</td><td>tagtgagtcg</td><td>his</td><td></td><td> 345</td>

&lt;210&gt; 69 &lt;211&gt; 456 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 69

<td>tcgcgggtcg</td><td>atacaagcgt</td><td>ctaaacacac</td><td>gttctgatga</td><td>catcaatttc</td><td>taaaaatgtt</td><td> 60</td>

<td>cgcaaattcc</td><td>taccaaagcg</td><td>gcttcatttc</td><td>aatattctac</td><td>agcgtaggaa</td><td>gtaatccact</td><td> 120</td>

<td>agcattatgg</td><td>gacaagcagg</td><td>taaagaacgg</td><td>acatatcaga</td><td>cggattatgg</td><td>acgatgatgt</td><td> 180</td>

<td>gaaatcatta</td><td>gttttggaaa</td><td>tatctggaac</td><td>taatgtagct</td><td>actacttata</td><td>taacgtgccc</td><td> 240</td>

<td>catcaaacca</td><td>cgagcttcac</td><td>ttggaatcag</td><td>attacctttt</td><td>ctgattatga</td><td>ttataaagaa</td><td> 300</td>

<td>tatgaagaag</td><td>taetttacat</td><td>ttgaaattca</td><td>aatattagat</td><td>gataaagata</td><td>tgcgtagaag</td><td> 3 60</td>

<td>gtttagaata</td><td>tcaaatttcc</td><td>aatcatccac</td><td>caaagtgaga</td><td>ccgttctgta</td><td>caacgatgcc</td><td> 420</td>

<td>aatgggactc</td><td>agcagtggct</td><td>ggaatcaagt</td><td>tcaatt</td><td></td><td></td><td> 456</td>

&lt;210&gt; 70 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 70 taatacgact cactataggg agacgggtcg atacaagcgt ctaa &lt;210&gt; 71 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 71 taatacgact cactataggg agaagtccca ttggcatcgt tgta &lt;210&gt; 72 &lt;211&gt; 472 &lt;212&gt; DNA &lt;213&gt; Sztuczny

256 &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 72

<td>TAATACGACT</td><td>cactataggg</td><td>agacgggtcg</td><td>atacaagcgt</td><td>ctaaacacac</td><td>gttctgatga</td><td> 60</td>

<td>catcaatttc</td><td>taaaaatgtt</td><td>cgcaaattcc</td><td>taccaaagcg</td><td>gcttcatttc</td><td>aatattctac</td><td> 120</td>

<td>agcgtaggaa</td><td>gtaatccact</td><td>agcattatgg</td><td>gacaagcagg</td><td>taaagaacgg</td><td>acatatcaga</td><td> 180</td>

<td>cggattatgg</td><td>acgatgatgt</td><td>gaaatcatta</td><td>gttttggaaa</td><td>tatctggaac</td><td>taatgtagct</td><td> 240</td>

<td>actacttata</td><td>taacgtgccc</td><td>catcaaacca</td><td>cgagcttcac</td><td>ttggaatcag</td><td>attacctttt</td><td> 300</td>

<td>ctgattatga</td><td>ttataaagaa</td><td>tatgaagaag</td><td>tactttacat</td><td>ttgaaattca</td><td>aatattagat</td><td> 360</td>

<td>gataaagata</td><td>tgcgtagaag</td><td>gtttagaata</td><td>tcaaatttcc</td><td>aatcatccac</td><td>caaagtgaga</td><td> 420</td>

<td>ccgttctgta</td><td>caacgatgcc</td><td>aatgggactt</td><td>ctccctatag</td><td>tgagtcgtat</td><td>ta</td><td> 472</td>

&lt;210&gt; 73 &lt;211&gt; 503 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 73 cacgcgtcca 'gtaaggttct aaattgatga tggttttcga ccgctaaagt aatattggtt gaagaacttt gaggtacagt gatactatac aaatcaatcc aaaaccccag accttacgac tttccacggc tgactacgat gaatggtggt tactttggct tggaccttat cgactcaact ttgaaaaaag ggatacttat attccagcga gcttttgaca tactataata gcagatcctg gataaaaata tcacaacaat tac gcaacttcac taagtgcagc tttcaaagct actatgtagg ataaaacata caaaattaaa ataccgctct ctggatattt ggaactttta agctccggga actagacttg acatatctca caatgtggat cttgggtgtt atatgctcct gggatataat caaaaactta gcacgtgata gtcaatgtta ccgctttttc acaggaattc gtcgcttatg gtcaaaggtg gagatttgca

120

180

240

300

360

420

480

503 &lt;210&gt; 74 &lt;211&gt; 42 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 74 taatacgact cactataggg agacacgcgt ccaaaatcaa tc 42 &lt;210&gt; 75 &lt;211&gt; 47 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 75 taatacgact cactataggg agatcggtat agtatctgca aatctca 47

257 &lt;210&gt; 76 &lt;211&gt; 417 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja Stuczna &lt;400&gt; 76

<td>TAATACGACT</td><td>cactataggg</td><td>agacaaacat</td><td>caggtgcgga</td><td>aaaaacacga</td><td>gaggctaata</td><td> 60</td>

<td>ccaagtgatg</td><td>ccgacgttgc</td><td>caaatggaga</td><td>tgtgttggtc</td><td>ttctgtcagt</td><td>cacaaccgca</td><td> 120</td>

<td>aggcagtgtg</td><td>aaatgtgaag</td><td>ttatgtgatt</td><td>tactttgaaa</td><td>aaaacagata</td><td>aggattacgt</td><td> 180</td>

<td>aagatgagca</td><td>attcatgtac</td><td>tagtacaatt</td><td>aaagttattg</td><td>aaaataacac</td><td>aattcttgta</td><td> 240</td>

<td>gaatggcaaa</td><td>aacatcatta</td><td>tggtcatatt</td><td>tttgattcgc</td><td>aacatattaa</td><td>tttacaaaag</td><td> 300</td>

<td>aaagataata</td><td>acataatagg</td><td>ttcaaagcta</td><td>atatcggagt</td><td>cccatagcaa</td><td>aggtaaaaaa</td><td> 360</td>

<td>attgtttttc</td><td>ttttttttct</td><td>tacttaaaaa</td><td>attctctccc</td><td>tatagtgagt</td><td>cgtatta</td><td> 417</td>

&lt;210&gt; 77 10 &lt;211&gt; 927 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 77 aggtaaatgc tcaacatgaa ggtgctagtg ttactctcgg tactatctgc atttcttgtt 60 tgccaaacat caggtgcgga aaaacgggtc gtttgttatt tcgccagttg gaccatttat 120 agagcaagaa aaggtgcttt cgatgtcagt aatatagatc catcgctgtg tacacacatt 180 aattttgctt tccttggtct taatgaagat ggttctattc acattttgga ttcctgggag 240 tcaagtgatg ctggtggtca tgagggtttt aaacatctcg tagagcttaa aaagaccaat 300 cctgacctta aggtatgtgt aagtatgggc ggttggaacg aaggttccaa gcagtattca 360

<td>gcagtagcat</td><td>cagatccagc</td><td>aaaaagagta</td><td>aaacttgcag</td><td>atgaggtttt</td><td>agcttttatc</td><td> 420</td>

<td>gaaaattggg</td><td>gcttcgatgg</td><td>ttttgatttg</td><td>gattgggaat</td><td>atccaggatt</td><td>acgaggagga</td><td> 480</td>

<td>aacgaaacta</td><td>ttgataaaga</td><td>gaattatgtc</td><td>gaacttttga</td><td>aagctcttag</td><td>tgacgttctt</td><td> 540</td>

<td>gagcccaaag</td><td>gatacttact</td><td>cagtgtagcc</td><td>actgcaggcg</td><td>ccgttgaaaa</td><td>aatcgacgtt</td><td> 600</td>

<td>ggatttgacg</td><td>tctcagttat</td><td>aaatgagttg</td><td>gtggatatga</td><td>ttaacgttat</td><td>ggtttttgat</td><td> 660</td>

<td>tttcatggag</td><td>catttgagaa</td><td>ctttgtagga</td><td>cacgtttcac</td><td>cattgttccc</td><td>agctcaagtt</td><td> 720</td>

<td>gattacgaat</td><td>atgaagctaa</td><td>tagtacatac</td><td>aatgtagaca</td><td>caggaatcca</td><td>acactggata</td><td> 780</td>

<td>ttgagtggtg</td><td>cagatcccgc</td><td>aaaaataaac</td><td>ctcggcattg</td><td>tcacctatgg</td><td>aagaacctat</td><td>B40</td>

<td>accttagctg</td><td>ataaaaccaa</td><td>tacttctctt</td><td>tatgcaaatg</td><td>ttaccggtgg</td><td>tggtaataca</td><td> 900</td>

<td>gggccatatt</td><td>ctgcacaatc</td><td>tggatat</td><td></td><td></td><td></td><td> 927</td>

&lt;220&gt;

&lt;223&gt; Sekwencja Stuczna &lt;210&gt; 78 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Sztuczny

258 &lt;400&gt; 78 taatacgact cactataggg agacaaacat caggtgcgga &lt;210&gt; 79 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 79 taatacgact cactataggg agacgggatc tgcaccactc &lt;210&gt; 80 &lt;211&gt; 912 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja sztuczna &lt;400&gt; 80 aaaa the ATA TAATACGACT aaaaatatga taataaacta aagataaatt tgtttacatg tgcttctgct tattattaca taaacaaaca gaggtcgttt aaatagcgac gctttaatct tataagtttg attattttta aaatagtgta cttacgaagt tgagtcgtat cactataggg ctagttattc tgatttattt aatacagtca tttgtatact actgcaacta gtttctataa tatacgatct ttagtcacgt atctgataat gtgccttcta atataagtag gcacactcac tattaaggaa tgcttgacga ta agacgggatc agaagattta atcccgcggt aatactatta aacctgtaga cgttgagaac aagtattaaa gtcaaaagtg gatgccttct aaaatcgtga agaattgcaa atataagttt ttgctgccaa tgaactgact · ctgtattatt tgcaccactc atcataatct aaacactaaa atttattctc acgttattcc aagaagccat aaactaaaaa tcacaacaat ccatagattc actaattttc ggcaagacag gattattact caatactggc ggtcgcaagc tttccgcacc aataatatta aaaaaagtgc aacactatat tgaagtacgg tgaagatttt tattatgcac tattcgaaag cttaacgata taactcgatg gaaaccaaat acgttgataa tacaataggg cgcaaaacta tcttgcttgt tgatgtttgt aaactactat aatacatttt attafcacata gccattactt ttattaacat tatcacaata acaacaaacg tggccgaagt gtgtagacgc tcagaatttc agatgttaga acagcatcta ggtaatagag cggacctttc ctccctatag

120

180

240

300

360

420

480

540

600

660

720

780

840

900

912 &lt;210&gt; 81 &lt;211&gt; 342 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera

259 &lt;400&gt; 81 ggagcgaagg catctctctc catcccgacc tctcgtggcc gccgcgaaga aaaggagctt atcatggctt caaaacgtat cctgaaggaa ctgaaggact tgcagaaaga tcctccgaga tcatgcagtg caggtccttg tgcccgctt ggcaggcaac aattatgggt cctcctgata gtccctatgc tggaggtgtt ttcttagtga atatccattt ccccccggac tac.cccttca agcctccgaa ggtatcgttc aagacaaagg &lt;cttgcgagg &lt;cgaggag&gt;

&lt;223&gt; Sekwencja is a stuczna

120

180

240

300

342 &lt;400&gt; 82 taatacgact cactataggg agactctcca tcccgacctc tc &lt;210&gt; 83 &lt;211&gt; 42 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 83 taatacgact cactataggg agatgcctcc attgctattg at 42 &lt;210&gt; 84 &lt;211&gt; 344 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 84 taatacgact cactataggg agactctcca tcccgacctc. tcgtggccgc cgcgaagaaa 60 aggagcttat catggcttca aaacgtatcc tgaaggaact gaaggacttg cagaaagatc 120 ctccgagatc atgcagtgca ggtccttctg gcgaggatat gttccattgg caggcaacaa 180 ttatgggtcc tcctgatagt ccctatgctg gaggtgtttt cttagtgaat atccatttcc 240 ccccggacta ccccttcaag cctccgaagg tatcgttcaa gacaaaggtc ttccatccga 300 acatcaatag caatggaggc atctccctat agtgagtcgt atta 344 &lt;210&gt; 85 &lt;211&gt; 674 &lt;212&gt; DNA &lt; 213&gt; Diabrotica virgifera

260 &lt;400&gt; 85

<td>tcggcggccg</td><td>gtaaggaact</td><td>ttaaaccgga</td><td>atggtcaaaa</td><td>aacaaaatcc</td><td>tggcataatg</td><td> 60</td>

<td>gggaaaattg</td><td>gaattaacgg</td><td>ttttggccga</td><td>attggccgcc</td><td>tggtaccccg</td><td>tgcagctctt.</td><td> 120</td>

<td>gaaaaaggag</td><td>ttgaagtagt</td><td>agctgtcaac</td><td>gatcccttcc</td><td>ttgatgtcga</td><td>ctacatggta</td><td> 180</td>

<td>tacttgttca</td><td>aatttgactc</td><td>tacccacggt</td><td>cgctacaagg</td><td>gatgtgtcaa</td><td>cagtgatggc</td><td> 240</td>

<td>aaaaacttag</td><td>ttgttgatgg</td><td>caaagtcatt</td><td>tccgtacacc</td><td>aagaaagaga</td><td>cccagctgct</td><td> 300</td>

<td>attccatggg</td><td>gcaaagctgg</td><td>tgcagattat</td><td>gtagtagaat</td><td>ctaccggagt</td><td>gttcaccaca</td><td> 360</td>

<td>attgaaaagg</td><td>ccaagaaaca</td><td>tcttgacggt</td><td>ggtgctaaga</td><td>aagtcatcat</td><td>ctcagctcca</td><td> 420</td>

<td>tctgctgatg</td><td>ctccaatgta</td><td>tgtatgtggt</td><td>gttaacttgg</td><td>atgcctacaa</td><td>tccagctgat</td><td> 480</td>

<td>cccgtaatct</td><td>ctaacgcttc</td><td>ttgcactacc</td><td>aactgccttg</td><td>ctccactcgc</td><td>caaagtcatc</td><td> 540</td>

<td>cacgacaact</td><td>tcgaaatcgt</td><td>tgaaggtttg</td><td>atgaccaccg</td><td>tacatgccac</td><td>aaccgccaca</td><td> 600</td>

<td>caaaaaactg</td><td>tcgacggacc</td><td>ctctggaaaa</td><td>ttgtggcgtg</td><td>acggtcgtgg</td><td>tgccggacaa</td><td> 660</td>

<td>aacatcatcc</td><td>cagc</td><td></td><td></td><td></td><td></td><td> 674</td>

&lt;210&gt; 86 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 86 taatacgact cactataggg agagtacccc gtgcagctct tgaaa &lt;210&gt; 87 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 87 taatacgact cactataggg agaggttgtg gcatgtacgg tggtc 45 &lt;210&gt; 88 &lt;211&gt; 538 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja is a stuczna

261 &lt;400&gt; 88

<td>TAATACGACT</td><td>cactataggg</td><td>agagtacccc</td><td>gtgcagctct</td><td>tgaaaaagga</td><td>gttgaagtag</td><td> 50</td>

<td>tagctgtcaa</td><td>cgatcccttc</td><td>cttgatgtcg</td><td>actacatggt</td><td>atacttgttc</td><td>aaatttgact</td><td> 120</td>

<td>ctacccacgg</td><td>tcgctacaag</td><td>ggatgtgtca</td><td>acagtgatgg</td><td>caaaaactta</td><td>gttgttgatg</td><td> 180</td>

<td>gcaaagtcat</td><td>ttccgtacac</td><td>caagaaagag</td><td>acccagctgc</td><td>tattccatgg</td><td>ggcaaagctg</td><td> 240</td>

<td>gtgcagatta</td><td>tgtagtagaa</td><td>tctaccggag</td><td>tgttcaccac</td><td>aattgaaaag</td><td>gccaagaaac</td><td> 300</td>

<td>atcttgacgg</td><td>tggtgctaag</td><td>aaagtcatca</td><td>tctcagctcc</td><td>atctgctgat</td><td>gctccaatgt</td><td> 360</td>

<td>atgtatgtgg</td><td>tgttaacttg</td><td>gatgcctaca</td><td>atccagctga</td><td>tcccgtaatc</td><td>tctaacgctt</td><td> 420</td>

<td>cttgcactac</td><td>caactgcctt</td><td>gctccactcg</td><td>ccaaagtcat</td><td>ccacgacaac</td><td>ttcgaaatcg</td><td> 480</td>

<td>ttgaaggttt</td><td>gatgaccacc</td><td>gtacatgcca</td><td>caacctctcc</td><td>ctatagtgag</td><td>tcgtatta</td><td> 538</td>

&lt;210&gt; 89 &lt;211&gt; 551 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 89

<td>atagaagttg</td><td>aaccatctga</td><td>tactattgag</td><td>aatgtgaaag</td><td>ctaagatcca</td><td>agataaggaa</td><td> 60</td>

<td>ggtatcccac</td><td>cagaccagca</td><td>aagattgatc</td><td>tttgcaggta</td><td>aacagctgga</td><td>agatggtaga '</td><td> 120</td>

<td>accttgtctg</td><td>actataacat</td><td>ccagaaagag</td><td>tccactcttc</td><td>acttggtact</td><td>gagattgaga</td><td> 180</td>

<td>ggaggtatgc</td><td>agatcttcgt</td><td>caagacacta</td><td>actggaaaga</td><td>ccatcacttt</td><td>ggaagttgaa</td><td> 240</td>

<td>ccatctgata</td><td>ccattgagaa</td><td>tgtcaaagct</td><td>aagatccaag</td><td>ataaggaagg</td><td>tatcccacca</td><td> 300</td>

<td>gatcagcaaa</td><td>gattgatctt</td><td>tgcaggtaaa</td><td>cagctagaag</td><td>atggtagaac</td><td>tttgtctgat</td><td> 360</td>

<td>tataacatcc</td><td>agaaagagtc</td><td>cactcttcac</td><td>ttggtactta</td><td>gattgagagg</td><td>aggtatgcac</td><td> 420</td>

<td>attttcgtca</td><td>agacattgac</td><td>tggtaatacc</td><td>atcacattag</td><td>aagttgaacc</td><td>atctgatact</td><td> 480</td>

<td>attgagaatg</td><td>tgaaagctaa</td><td>gattcaagat</td><td>aaggaaggta</td><td>tcccaccaga</td><td>tcagcaaaga</td><td> 540</td>

<td>ttgatctttg</td><td>c</td><td></td><td></td><td></td><td></td><td> 551</td>

<td> &lt;210&gt;</td><td> 90</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 40</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td>Sekwencja stuttered</td><td></td><td></td>

<td> &lt;400&gt;</td><td> 90</td><td></td><td></td>

<td colspan="2">taatacgact cactataggg agagtatccc</td><td>accagaccag</td><td> 40</td>

<td> &lt;210&gt;</td><td> 91</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 47</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td>Sekwencja stuttered</td><td></td><td></td>

<td> &lt;400&gt;</td><td> 91</td><td></td><td></td>

<td colspan="2">taatacgact cactataggg agaatgtgca</td><td>tacctcctct</td><td>caatcta</td>

262 &lt;210&gt; 92 &lt;211&gt; 407 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja Stuczna &lt;400&gt; 92

<td>TAATACGACT</td><td colspan="2">cactataggg agagtatccc</td><td>accagaccag</td><td>caaagattga</td><td>tctttgcagg</td><td> 60</td>

<td>taaacagćtg</td><td>gaagatggta</td><td>gaaccttgtc</td><td>tgactataac</td><td>atccagaaag</td><td>agtccactct</td><td> 120</td>

<td>tcacttggta</td><td>ctgagattga</td><td>gaggaggtat</td><td>gcagatcttc</td><td>· gtcaagacac</td><td>taactggaaa</td><td> 180</td>

<td>gaccatcact</td><td>ttggaagttg</td><td>aaccatctga</td><td>taccattgag</td><td>aatgtcaaag</td><td>ctaagatcca</td><td> 240</td>

<td>agataaggaa</td><td>ggtatcccac</td><td>cagatcagca</td><td>aagattgatc</td><td>tttgcaggta</td><td>aacagctaga</td><td> 300</td>

<td>agatggtaga</td><td>actttgtctg</td><td>attataacat</td><td>ccagaaagag</td><td>tccactcttc</td><td>acttggtact</td><td> 360</td>

<td>tagattgaga</td><td>ggaggtatgc</td><td>acattctccc</td><td>tatactgagt</td><td>cgtatta</td><td></td><td> • 407</td>

&lt;210&gt; 93 &lt;211&gt; 401 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;220&gt;

&lt;221&gt; misc_feature &lt;222&gt; (369) .. (369) &lt;223&gt; n to a, c, g lub t &lt;400&gt; 93

<td>gtaatgttca</td><td>tgttttgtgt</td><td>gtagaaaaac</td><td>gctaaaactg</td><td>tgtgcagg.ca</td><td>catcctttcg</td><td> 60</td>

<td>cgatgagtag</td><td>acccaacaca</td><td>aactgttttc</td><td>aagtcttacc</td><td>gaacaatagc</td><td>agatggctat</td><td> 120</td>

<td>cgacacaaga</td><td>ttctggaatt</td><td>tttcccaaac</td><td>gtcacactga</td><td>ctactatgta</td><td>tttaatatgg</td><td> 180</td>

<td>gaagacagga</td><td>agtgttagtg</td><td>gaaggatggt</td><td>ggggaacaaa</td><td>actgggatgg</td><td>actggggttt</td><td> 240</td>

<td>tggatggagt</td><td>gaacctggcg</td><td>cctggcaatg</td><td>gttacagaat</td><td>tgtagtcagt</td><td>gataaaccat</td><td> 300</td>

<td>attttgtaac</td><td>agctgtgaaa</td><td>ataacaaata</td><td>aaacaactgt</td><td>aagggctctc</td><td>atgcattgtt</td><td> 360</td>

<td>ctgagatana</td><td>cggttatcct</td><td>ctgcggagtc</td><td>aaggaactga</td><td>c</td><td></td><td> 401</td>

&lt;210&gt; 94 &lt;211&gt; 45 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 94 taatacgact cactataggg agatcgcgat gagtagaccc aacac 45 &lt;210&gt; 95 &lt;211&gt; 46 &lt;212&gt; DNA &lt;213&gt; Sztuczny

263 &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 95 taatacgact cactataggg agaaacaatg catgagagcc cttaca &lt;210&gt; 96 &lt;211&gt; 348 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 96 taatacgact cactataggg agacgcgatg agtagaccca acacaaactg ttttcaagtc

46.

ttaccgaaca atagcagatg gctatcgaca caagattctg gaatttttcc caaacgtcac 120 actgactact atgtatttaa tatgggaaga caggaagtgt tagtggaagg atggtgggga 180 acaaaactgg gatggactgg ggttttggat ggagtgaacc tggcgcctgg caatggttac 240 agaattgtag tcagtgataa accatatttt gtaacagctg tgaaaataac aaataaaaca 300 actgtaaggg ctctcatgca ttgtttctcc ctatactgag tcgtatta 348 &lt;210&gt; 97 &lt;211&gt; 1168 15 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja Stuczna &lt;400&gt; 97

<td>acgctgacaa</td><td>gctgactcta</td><td>gcagatcacc</td><td>gtcttcgata</td><td>ccaagcggcc</td><td>tgaattcgcg</td><td> 60</td>

<td>tgaatcgtat</td><td>ctcagtccat</td><td>cgttggccaa</td><td>gccggagtcc</td><td>aaataggtaa</td><td>tgcctgctcg</td><td> 120</td>

<td>ggagttgtac</td><td>tcgcctggaa</td><td>cagggcatcc</td><td>aacctgacgg</td><td>tcagatgcca</td><td>tcagacaaga</td><td> 180</td>

<td>ctgttggagg</td><td>aggagatgac</td><td>agtttcaaca</td><td>cattcttcag</td><td>tgaaactggt</td><td>gccggcaaac</td><td> 240</td>

<td>atgtacctag</td><td>agcagtattt</td><td>gtagatttgg</td><td>aaccaacagt</td><td>agtagatgaa</td><td>gtacgtaccg</td><td> 300</td>

<td>gcacataccg</td><td>tcaattgttc</td><td>cacccagaac</td><td>aactcatcac</td><td>tggcaaagaa</td><td>gatgccgcca</td><td> 360</td>

<td>ataactacta</td><td>gaggtcacta</td><td>tacaattggt</td><td>aaagaaatag</td><td>ttgacttggt</td><td>attggacaga</td><td> 420</td>

<td>atccgtaaat</td><td>tggctgatca</td><td>atgccatagt</td><td>caacagatag</td><td>acgttccatc</td><td>aacaaagaag</td><td> 480</td>

<td>tgaaaccaga</td><td>tccagtacca</td><td>ccaccgaagg</td><td>agtggaagat</td><td>caagaaacct</td><td>tgaagtccag</td><td> 540</td>

<td>tacattgatc</td><td>agccaattta</td><td>cggattctgt</td><td>ccaataccaa</td><td>gtcaactatt</td><td>tctttaccaa</td><td> 600</td>

<td>ttgtatagtg</td><td>acctctagta</td><td>gttattggcg</td><td>gcatcttctt</td><td>tgccagtgat</td><td>gagttgttct</td><td> 660</td>

<td>gggtggaaca</td><td>attgacggta</td><td>tgtgccggta</td><td>cgtacttcat</td><td>ctactactgt</td><td>tggttccaaa</td><td> 720</td>

<td>tctacaaata</td><td>ctgctctagg</td><td>tacatgtttg</td><td>ccggcaccag</td><td>tttcactgaa</td><td>gaatgtgttg</td><td> 780</td>

<td>aaactgtcat</td><td>ctcctcctcc</td><td>aacagtcttg</td><td>tctgatggca</td><td>tctgaccgtc</td><td>aggttggatg</td><td> 840</td>

264

<td>ccctgttcca ggcgagtaca actcccgagc aggcattacc</td><td>tatttggact ccggcttggc</td><td> 900</td>

<td>caacgatgga ctgagatacg attcacgcat tttggttgat</td><td>gagtttttaa cttttacacc</td><td> 960</td>

<td>acaaatgaaa caaaattacg acagacgttc agattagcta</td><td>gtaatgcagc ggatccgatc</td><td> 1020</td>

<td>gttcaaacat ttggcaataa agtttcttaa gattgaatcc</td><td>tgttgccggt cttgcgatga</td><td> 1080</td>

<td>ttatcatata atttctgttg aattacgtta agcatgtaat</td><td>aattaacatg taatgcatga</td><td> 1140</td>

<td>cgttatttat gagatgggtt, tttatgat</td><td></td><td> 1168</td>

&lt;210&gt; 98 &lt;211&gt; 2131 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 98

<td>tcgcggcgac</td><td>acacacccct</td><td>ctaaacacgc</td><td>tatcattggt</td><td>cccacgcgcc</td><td>gctagctagc</td><td> 60</td>

<td>gatcgcgagc</td><td>gagcgcccgc</td><td>ccccccgccc</td><td>gggaagctgc</td><td>attactagct</td><td>aatctgaacg</td><td> 120</td>

<td>tctgtcgtaa</td><td>ttttgtttca</td><td>tttgtggtgt</td><td>aaaagttaaa</td><td>actcatcaac</td><td>caaaatgcgt</td><td> 180</td>

<td>gaatgtatct</td><td>cagtccatgt</td><td>tggccaagcc</td><td>ggagtccaaa</td><td>tcggtaatgc</td><td>ctgctgggag</td><td> 240</td>

<td>ttgtactgcc</td><td>tggaacatgg</td><td>catccaacc, t</td><td>gacggtcaga</td><td>tgccatcaga</td><td>caagactgtt.</td><td> 300</td>

<td>ggaggaggag</td><td>atgacagttt</td><td>caacacattc</td><td>ttcagtgaaa</td><td>ctggtgccgg</td><td>caaacatgta</td><td> 3 60</td>

<td>cctagagcag</td><td>tatttgtaga</td><td>tttggaacca</td><td>acagtagtag</td><td>atgaagtacg</td><td>taccggcaca</td><td> 420</td>

<td>taccgtcaat</td><td>tgttccaccc</td><td>agaacaactc</td><td>atcactggca</td><td>aagaagatgc</td><td>cgccaataac</td><td> 480</td>

<td>tatgctagag</td><td>gtcactatac</td><td>aattggtaaa</td><td>gaaatagttg</td><td>acttggtatt</td><td>ggacagaatc</td><td> 540</td>

<td>cgtaaattgg</td><td>ctgatcaatg</td><td>tactggactt</td><td>caaggtttct</td><td>tgattttcca</td><td>ctccttcggt</td><td> 600</td>

<td>ggtggtactg</td><td>gatctggttt</td><td>cacttctttg</td><td>ttgatggaac</td><td>gtctatctgt</td><td>tgactatggt</td><td> 660</td>

<td>aaaaaatcaa</td><td>aactggaatt</td><td>cgccatctac</td><td>ccagctcctc</td><td>aagtatctac</td><td>tgctgtagta</td><td> 720</td>

<td>gaaccataca</td><td>actccatctt</td><td>gaccacccac</td><td>accactcttg</td><td>aacaćtcaga</td><td>ctgtgccttt</td><td> 780</td>

<td>atggtagata</td><td>atgaagccat</td><td>ctatgacatc</td><td>tgcagacgta</td><td>atctagacat</td><td>cgagcgccca</td><td> 840</td>

<td>acctacacca</td><td>acttgaacag</td><td>acttattggc</td><td>caaatcgtat</td><td>cctcaatcac</td><td>agcttctcta</td><td> 900</td>

<td>agattcgatg</td><td>gtgctctaaa</td><td>tgttgacttg</td><td>acagaattcc</td><td>aaactaactt</td><td>ggttccttac</td><td> 960</td>

<td>cctcgtattc</td><td>acttccctct</td><td>tgtcacctat</td><td>gccccagtaa</td><td>tttccgctga</td><td>aaaggcttac</td><td> 1020</td>

<td>catgaacaac</td><td>tttccgtagc</td><td>tgaaatcacc</td><td>aatgcctgtt</td><td>tcgaacctgc</td><td>caaccagatg</td><td> 1080</td>

<td>gtaaaatgtg</td><td>atcccagaca</td><td>tggtaaatac</td><td>atggcttgct</td><td>gtatgttgta</td><td>cagaggggat</td><td> 1140</td>

<td>gttgtaccaa</td><td>aggatgtaaa</td><td>tgctgctatt</td><td>gcaaccatta</td><td>agaccaaacg</td><td>taccatccaa</td><td> 1200</td>

<td>ttcgtagact</td><td>ggtgtccaac</td><td>tggtttcaaa</td><td>gtaggtatca</td><td>actaccaacc</td><td>accaactgtt</td><td> 1260</td>

<td>gtacctggag</td><td>gtgatttggc</td><td>taaagtacaa</td><td>cgtgccgtat</td><td>gcatgttgtc</td><td>caacactaca</td><td> 1320</td>

<td>gctattgctg</td><td>aagcctgggc</td><td>aagattggac</td><td>cacaaattcg</td><td>atcttatgta</td><td>tgccaagaga</td><td> 1380</td>

<td>gctttcgtcc</td><td>actggtatgt</td><td>aggagagggt</td><td>atggaagaag</td><td>gtgaattctc</td><td>tgaagctcgt</td><td> 1440</td>

<td>gaagatttgg</td><td>ctgctttgga</td><td>gaaagattat</td><td>gaagaagttg</td><td>gtatggactc</td><td>cggagaaggt</td><td> 1500</td>

<td>gagggtgaag</td><td>gagctgaaga</td><td>atattaaatt</td><td>tgattccaaa</td><td>catgacaaat</td><td>cacttgtttt</td><td> 1560</td>

265

<td>taagacaaaa</td><td>aattcctttc</td><td>aattttttta</td><td>cactttttca</td><td>ttacttttct</td><td>gtgaaacgat</td><td> 1620</td>

<td>tatttaaagt</td><td>ctgatttaat</td><td>ttaatacaga</td><td>attttttacg</td><td>agcaaaaaaa</td><td>aaaaagggcg</td><td> 1680</td>

<td>gcccccgatt</td><td>gcgcatatag</td><td>ctacattaaa</td><td>gatcgtggcc</td><td>tctgtctaga</td><td>gactgactac</td><td> 1740</td>

<td>aagtatccat</td><td>gattaaacgg</td><td>agactgcaaa</td><td>cagtgtaatc</td><td>tcggttatca</td><td>ataaccatcc</td><td> 1800</td>

<td>aatgaactag</td><td>tgcatgctgt</td><td>agtatcataa</td><td>cacgaagtaa</td><td>gcatcttcac</td><td>ttgaggaatg</td><td> 1860</td>

<td>tattatactg</td><td>tgtgagccaa</td><td>tatcagtatg</td><td>tgacaacact</td><td>aaatgagact</td><td>ggccatagat</td><td> 1920</td>

<td>aaaacctaca</td><td>gcgcctttag</td><td>gacgacttcc</td><td>tatactagaa</td><td>tccggtggaa</td><td>aaccagttcc</td><td> 1980</td>

<td>tcaaagcact</td><td>gctatctgca</td><td>ggcatctgtc</td><td>taacgtatgc</td><td>aaatcttggt</td><td>ggtaaagacg</td><td> 2040</td>

<td>caaaggtaaa</td><td>tcttgttata</td><td>tatattgctg</td><td>atcaagcgta</td><td>tgatgatatg</td><td>aagaaaccta</td><td> 2100</td>

<td>tgggcgaata</td><td>catgagatac</td><td>agggatgaaa</td><td> 9</td><td></td><td></td><td> 2131</td>

&lt;210&gt; 99 &lt;211&gt; 1720 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 99

<td>gacacgggcc cgaatatccc cggccgctct ctacgatcaa cgcatcgaag agagcgttct</td><td> 60</td>

<td>gtgttttcta gtaatagtta tttaatacat tttataaatc aaaatgaggg aaatcgttca</td><td> 120</td>

<td>catccaagct ggacaatgcg gtaaccaaat tggagccaaa ttctgggaaa tcatctctga</td><td> 180</td>

<td>tgaacacgga atcgacccca ccggagccta ccatggagac tctgacctcc aacttgaaag</td><td> 240</td>

<td>aatcaatgtc tactacaacg aggcctccgg cggaaaatac gtaccccgcg ccatcctcgt</td><td> 300</td>

<td>cgacttggaa cccggtascca tggattcagt aaggtcgggt cccttcggac aaatcttcag</td><td> 360</td>

<td>accagacaac ttcgtgtttg gacagtctgg agctggaaac aactgggcca agggacatta</td><td> 420</td>

<td>cacagaaggt gctgaattag ttgattcagt attagatgtt gtaaggaaag aagctgaatc</td><td> 480</td>

<td>regtgattgt ttacaaggat tccaactcac acactcactt ggaggtggta ctggatcagg</td><td> 540</td>

<td>tatgggtacc ctccttatct caaaaatccg tgaagaatac ccagacagaa ttatgaacac</td><td> 600</td>

<td>atactcagta gtcccctcac ccaaagtatc agataccgta gtagaaccat acaatgccac</td><td> 660</td>

<td>actttcagta catcaattgg tagaaaacac agatgaaaca tactgtattg.ataatgaagc</td><td> 720</td>

<td>tctctatgac atttgcttca gaactttgaa actcacaaca cccacatatg gagacttaaa</td><td> 780</td>

<td>ccatttggta tccctcacaa tgtccggtgt aaccacctgt cttaggttoc caggtcagtt</td><td> 840</td>

<td>gaatgctgat cttagaaaat tggctgtcaa catggttccc ttcccccgtc tccacttctt</td><td> ' 900</td>

<td>catgcccgga ttcgctccac tcacctcaag aggcagccaa caatacagag cgttgacagt</td><td> 960</td>

<td>tccagagctc acacagcaaa tgtttgatgc caagaacatg atggcggctt gtgatcccag</td><td> 1020</td>

<td>acacggaagg taccttacag tagctgcagt attcagaggt aggatgtcaa tgaaagaagt</td><td> 1080</td>

<td>tgacgaacag atmctcaaca tccagaacaa gaacagcagc tacttcgtcg aatggatccc</td><td> 1140</td>

<td>caacaacgtt aaaacagccg tttgtgatat cccaccaaga ggtctcaaga tgtctgccac</td><td> 1200</td>

<td>tttcatcggc aactcaaccg ccatccaaga attgttcaaa cgtatctccg aacaatttac</td><td> 1260</td>

266

<td>agctatgttc</td><td>aggaggaaag</td><td>ctttcttgca</td><td>ttggtacacc</td><td>ggagaaggta</td><td>tggatgaaat</td><td> 1320</td>

<td>ggaattcacg</td><td>gaagcagaat</td><td>ccaacatgaa</td><td>cgacttggta</td><td>tcagaatacc</td><td>aacagtacca</td><td> 1380</td>

<td>agaagccaca</td><td>gctgacgaag</td><td>atgccgaatt</td><td>cgacgaagac</td><td>caggaagccg</td><td>aagtcgacga</td><td> 1440</td>

<td>gaactaaatt</td><td>tcatacgtta</td><td>attttggatc</td><td>tgaaatcaaa</td><td>gctttataac</td><td>ttttatattt</td><td> 1500</td>

<td>gtctcctctc</td><td>cttttatttt</td><td>ttatttaagc</td><td>atgttttttg</td><td>tacagtctct</td><td>acattcccgt</td><td> 1560</td>

<td>ttgtaaattt</td><td>cgaatacact</td><td>acttaaatta</td><td>ttccaagact</td><td>gactttttgt</td><td>tgcttgtgtt</td><td> 1620</td>

<td>tctggaattt</td><td>caggaagtgt</td><td>ttagatattt</td><td>aacatgtttt</td><td>gcgaactgtt</td><td>tttttatgaa</td><td> 1680</td>

<td>taggcattaa</td><td>aactgctgcc</td><td>attacttata</td><td>ctcagaggca</td><td></td><td></td><td> 1720</td>

&lt;210&gt; 100 &lt;211&gt; 1175 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 100

<td>tgacaactga</td><td>cacacgagaa</td><td>gatacgacat</td><td>ggcaagaaaa</td><td>tctctctgat</td><td>taccattctg</td><td> 60</td>

<td>acttttctgc</td><td>gggatcggat</td><td>gaggataagg</td><td>aagacgatga</td><td>tttcgatgag</td><td>aagaacgacg</td><td> 120</td>

<td>ccgatttaag</td><td>cagaaggagt</td><td>cgaagaaaga</td><td>tggaaaggaa</td><td>agacgagaag</td><td>gatcgtcctt</td><td> 180</td>

<td>taccaccgtt</td><td>actagccaga</td><td>gttggcggca</td><td>atattgaagt</td><td>actcggtttt</td><td>aatgccaggc</td><td> 240</td>

<td>agcgtaaagc</td><td>gttccttaat</td><td>gctattatgc</td><td>gctacggaat</td><td>gccaccacaa</td><td>gacgctttca</td><td> 300</td>

<td>attcacagtg</td><td>gctggtgaga</td><td>gatcttcgag</td><td>gaaaatctga</td><td>gaagatattc</td><td>aaggcttacg</td><td> 360</td>

<td>tgtctctctt</td><td>tatgaggcat</td><td>ctttgcgaac</td><td>ctggtgcaga</td><td>taatgctgat</td><td>acatttgcgg</td><td> 420</td>

<td>acggtgtgcc</td><td>gagggaagga</td><td>ctgagtaggc</td><td>aacatgtttt</td><td>gacaaggatt</td><td>ggtgtgatgt</td><td> 480</td>

<td>cacttataag</td><td>aaagaaggtt</td><td>caggagttcg</td><td>aacacatcaa</td><td>cggcgagtat</td><td>agcatgccgg</td><td> 540</td>

<td>aagtaatcaa</td><td>aaagagcatt</td><td>atggatcaaa</td><td>ataaaatcaa</td><td>tgccgccggc</td><td>accgccacea</td><td> 600</td>

<td>caagcgaagc</td><td>agaaacgcct</td><td>aaaagtgcta</td><td>ctaccagtac</td><td>tagtgctacg</td><td>ccagctacaa</td><td> 660</td>

<td>gtgctgctcc</td><td>cagtcccgct</td><td>cccacacaag</td><td>gagaagataa</td><td>agataaggat</td><td>aaagattccg</td><td> 720</td>

<td>ttcagagtga</td><td>cgaaaataaa</td><td>gataaagaag</td><td>tggttaataa</td><td>aacggaaacc</td><td>gaagatgaag</td><td> 780</td>

<td>agaagaaaac</td><td>gggagaatct</td><td>tcaacagaaa</td><td>agccgaaaac</td><td>tgaaccggaa '</td><td>gaagtgaaag</td><td> 840</td>

<td>aagcttctcc</td><td>gaaaaccgaa</td><td>attcccgaag</td><td>ctagttccga</td><td>agctgataaa</td><td>tctgagatca</td><td> 900</td>

<td>aatccgaagt</td><td>cgatacctcg</td><td>tctgtaacca</td><td>gcgaggaaaa</td><td>gaaagaagag</td><td>aaagaggaag</td><td> 960</td>

<td>aggccaaaaa</td><td>ggaagaaccc</td><td>gaagagacca</td><td>aaatggaaat</td><td>acaggaggag</td><td>gaacttgtta</td><td> 1020</td>

<td>aagaggagaa</td><td>aaaagaagaa</td><td>gaggatgata</td><td>agaagaagga</td><td>ggaasttaag</td><td>aaagaggtgg</td><td> 1080</td>

<td>aaaagaagga</td><td>agaggatgac</td><td>gttatggtta</td><td>ttgatgatga</td><td>taaagataag</td><td>aaggacaaaa</td><td> 1140</td>

<td>aggaaatcga</td><td>tctcgaagcc</td><td>aagaagcgtt</td><td>TCATGA</td><td></td><td></td><td> 1175</td>

&lt;210&gt; 101 10 &lt;211&gt; 1176 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera

267 &lt;400&gt; 101

<td>cccatgcggc</td><td>cgcccatttt</td><td>tattgagcaa</td><td>attgttcaga</td><td>aagttgctgg</td><td>gcgtagtcgg</td><td> 60</td>

<td>gaaaaacatt</td><td>gtttaaatcc</td><td>ctttaatttc</td><td>ctćtaagtcg</td><td>aaagaaaaag</td><td>gctcaaaatg</td><td> 120</td>

<td>gctctcagcg</td><td>acgcagatgt</td><td>acaaaagcag</td><td>atcaagcaca</td><td>tgatggcttt</td><td>cattgagcaa</td><td> 180</td>

<td>gaagccaatg</td><td>aaaaggccga</td><td>ggaaattgat</td><td>gcaaaggctg</td><td>aagaagaatt</td><td>caacatcgaa</td><td> 240</td>

<td>aagggccgtc</td><td>tggtccaaca</td><td>acagaggctc</td><td>aagattatgg</td><td>agtactacga</td><td>gaaaaaagag</td><td> 300</td>

<td>aagcaagtag</td><td>aactccagaa</td><td>aaaaatccaa</td><td>tcatcaaaca</td><td>tgttgaacca</td><td>ggcaagattg</td><td> 360</td>

<td>aaggtattga</td><td>aagtaaggga</td><td>agaccatgta</td><td>cgtgccgttt</td><td>tggaagatgc</td><td>tcgcaaacgt</td><td> 420</td>

<td>cttggtgagg</td><td>taaccagaga</td><td>ttcaggcaaa</td><td>tatacaćaaa</td><td>tcctggaaag</td><td>tctcatcctc</td><td> 480</td>

<td>caagggctct</td><td>atcagctctt</td><td>cgaaaaggac</td><td>atcaccatta</td><td>gagtacgccc</td><td>tcaggacaga</td><td> 540</td>

<td>gaattggtaa</td><td>aatctatcat</td><td>gcctaacgtę</td><td>tcccaaaagt</td><td>acaaggacat</td><td>aaccggtaaa</td><td> 600</td>

<td>gacgtaaatc</td><td>taaaaatcga</td><td>cgacgagagc</td><td>cacctttctc</td><td>aagaaaccac</td><td>cggaggaatc</td><td> 660</td>

<td>gaactgttgg</td><td>ccttgagaaa</td><td>caagatcaaa</td><td>atcaacaata</td><td>ctctggaagc</td><td>ccgtcttgag</td><td> 720</td>

<td>ctcatctcac</td><td>aacaattgat</td><td>tccccagatc</td><td>cgtaatgctc</td><td>tgttcggacg</td><td>caacgtcaac</td><td> 780</td>

<td>agaaaattca</td><td>ctgattaagt</td><td>attttttgga</td><td>tactgtgtat</td><td>tgcctgtatt</td><td>ttatatagta</td><td> 840</td>

<td>ttgtaaaaca</td><td>ttgttggttg</td><td>cttagacaga</td><td>tctteaaaaa</td><td>ccttttaaac</td><td>tactatgtat</td><td> 900</td>

<td>atacgatata</td><td>tataataaac</td><td>cattcctttt</td><td>tttgaagtat</td><td>tttaaacagt</td><td>taagtttgtt</td><td> 960</td>

<td>gttaccctaa</td><td>ttgtatcctt</td><td>gtcaagcaga</td><td>tattttttaa</td><td>aatccttaga</td><td>aaattattag</td><td> 1020</td>

<td>gtttcagtta</td><td>tactacctta</td><td>ttttttttct</td><td>caaatatatt</td><td>catattttat</td><td>gtttatatgt-</td><td> . 1080</td>

<td>atataaaaaa</td><td>attatttttt</td><td>tcttgtgaga</td><td>aaatcatcgc</td><td>aataaaattt</td><td>attgttagtc</td><td> 1140</td>

<td>caacaaaaaa</td><td>aaaatggtgg</td><td>ccgctttgtt</td><td>Tttt</td><td></td><td></td><td> 1176</td>

&lt;210&gt; 102 &lt;211&gt; 2410 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 102

<td>cggacgcgtg</td><td>ggggagaaac</td><td>ataacatcca</td><td>tccacaaata</td><td>tgtcgaaagt</td><td>aaggatcgga</td><td> 60</td>

<td>gatgaagaga</td><td>aggaagggca</td><td>gtatggttat</td><td>gtccatgctg</td><td>tctcaggtcc</td><td>agtcgttact</td><td> 120</td>

<td>gctgagaaaa</td><td>tgtctggttc</td><td>tgctatgtac</td><td>gaactggtac</td><td>gtgtcggata</td><td>ctatgagctg</td><td> 180</td>

<td>gtaggagaaa</td><td>tcattagatt</td><td>ggaaggtgac.</td><td>atggctacta</td><td>ttcaggtata</td><td>cgaagaaaca</td><td> 240</td>

<td>tcaggtgtaa</td><td>ctgttggtga</td><td>tccagtatta</td><td>agaactggta</td><td>aaccactttc</td><td>agtagaactt</td><td> 300</td>

<td>ggacctggta</td><td>ttatgggttc</td><td>catttttgat</td><td>ggtatccaac</td><td>gtccattgaa</td><td>agacatttgt</td><td> 360</td>

<td>gacgctactg</td><td>atagtattta</td><td>catccccaag</td><td>ggtattaacg</td><td>taccttcttt</td><td>ategagaaca</td><td> 420</td>

<td>gcaaaatggg</td><td>acttcaaccc</td><td>aatcaacatc</td><td>aagttgggat</td><td>ctcacttaac</td><td>tggaggtgat</td><td> 480</td>

<td>atatatggtc</td><td>tagttcatga</td><td>aaacaccctt</td><td>gtcaaacaca</td><td>aaatgattct</td><td>gcctcctaga</td><td> 540</td>

<td>gctaagggta</td><td>ctgtaaccta</td><td>cattgcagaa</td><td>ccaggaaact</td><td>acactgttga</td><td>tgaagtagta</td><td> 600</td>

<td>ttggaaactg</td><td>aatttgatgg</td><td>tgatcgtacc</td><td>aaatatacta</td><td>tgttgcaagt</td><td>atggcctgta</td><td> 660</td>

<td>cgtcaagcaa</td><td>ggccagtcag</td><td>tgaaaaatta</td><td>cctgccaacc</td><td>atcctctgct</td><td>tacaggacag</td><td> 720</td>

268

<td>cgtgtacttg forgctctttt cccatgtgta cagggtggta ctactgccat tcccggagct</td><td> 780</td>

<td>ttcggttgtg gaaaaactgt aatttcacaa tctctttcca aatattccaa ctctgatgtc</td><td> 840</td>

<td>attatctacg tcggttgcgg agaaagaggt aacgaaatgt ctgaagtatt gagagatttc</td><td> 900</td>

<td>cctgaattga ctgttgaaat tgacgggcac actgaatcta ttatgaaacg taccgcattg</td><td> 960</td>

<td>gtcgccaaca catctaacat gcctgtagct gctcgtgaag cttctatcta tactggtatt</td><td> 1020</td>

<td>actctttctg aatacttccg tgatatgggt tacaacgtat ctatgatggc tgactcgaca</td><td> 1080</td>

<td>tcacgttggg ccgaagcttt gagagaaatt tcaggtcgtt tggctgaaat gcctgccgat</td><td> 1140</td>

<td>tccggttatc cggcttactt aggtgcccgt ttggcttcct tctacgaacg tgctggtcgc</td><td> 1200</td>

<td>gttaaatgtt taggtaatcc agacagagaa ggatccgttt caattgtagg agccgtatca</td><td> 1260</td>

<td>cctcctggtg gtgatttctc agatcctgtt accactgcta ctcttggtat tgtacaggtg</td><td> 1320</td>

<td>ttctggggtt tggacaagaa acttgcccaa cgtaagcact tcccttcagt agactggctt</td><td> 1380</td>

<td>ggatcatatt ccaaatattt aagagcattg gacgactttt atmacaaaaa cttccaagag</td><td> 1440</td>

<td>tttattcctc ttagaaccaa agttaaggaa attcttcagg aagaagatga tctagccgaa</td><td> 1500</td>

<td>attgtgcagc tggtaggtaa agcatctctg gcagaaacgg acaaaatcac cttggaaatt</td><td> 1560</td>

<td>gccaggcttc ttaaagaaga tttcttgcaa caaaactcat actcttctta tgacagattc</td><td> 1620</td>

<td>tgtccattct ataaaactgt cggtatgttg agaaacatga tcggtttgta cgacatggcg</td><td> 1680</td>

<td>agacacgctg tagaatcaac cgcacaatca gaaaataaga tcacttggaa cgtaataaga</td><td> 1740</td>

<td>gattcaatga gtggaatttt atatcaactt agcagtatga aatttaagga tcccgtaaaa</td><td> 1800</td>

<td>gatggtgaag ctaaaatcaa ggcagatttt gatcaattat atgaagatat tcagcaggcc</td><td> 1860</td>

<td>ttcagaaact tagaagatta aatcttttta aggaaatttt cctattttgt tcatcagtgt</td><td> 1920</td>

<td>aagtttaaaa atatagcgat atttatcaaa aagaataata aggcctctat ccctcacttc</td><td> 1980</td>

<td>tgtgaatatt aatatggccg tactaaagat agtaactaaa gataggtttt ctcttttttg</td><td> 2040</td>

<td>atattatcct gtacaaaata aattatgtaa attgttgaat returning tttttttggg</td><td> 2100</td>

<td>tgagggtaca gtgcttatta aatacttttt aaacattttt cccgccattc caattactat</td><td> 2160</td>

<td>taagtttttt cgttttaata cttttttaaa tatacaggtg cttaatatcg tttatatttt</td><td> 2220</td>

<td>cagtattact tggttttctt catgtaaatt gttttaaatt tttcttttac ccttttaatc</td><td> 2280</td>

<td>ttgtatatta cattacccaa ttaaagttaa ttgtacagat taagataaac gagtatctta</td><td> 2340</td>

<td>taacatctat tagattgtta gaatcaataa atvtagtgta attgttctgt tttgaacaaa</td><td> 2400</td>

taaatgcatc 2410 &lt;210&gt; 103 &lt;211&gt; 1575 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 103 atctgaćagt ttctacagta tagttgcagt gttcagtgga aaatattcaa ttaagatatt 60 cctagcgttc agacgtgtgc tctgatagaa tggtagag

269

<td>ttacattcaa</td><td>aatatacctt</td><td>cttttggatg</td><td>tgtagaccaa</td><td>cctgacaacg</td><td>gctccaaaac</td><td> 180</td>

<td>aacaagagaa</td><td>tcattagtag</td><td>aagtgtcttc</td><td>atcacgtcca</td><td>cgccaagaag</td><td>actactcagt</td><td> 240</td>

<td>atatgagaac</td><td>agactggcat</td><td>ctttcactaa</td><td>ctggcccaac</td><td>acccaagtgt</td><td>caagagaatc</td><td> 300</td>

<td>attagctcga</td><td>gctggtttta</td><td>tatatacagg</td><td>tcaagatgac</td><td>atcgttatct</td><td>gccctatttg</td><td> 360</td>

<td>taagatagag</td><td>ggataccatt</td><td>gggtatcagg</td><td>agacaatcca</td><td>atggatgatc</td><td>atcgtgtttg</td><td> 420</td>

<td>gaatcccaac</td><td>tgcccctttc</td><td>ttaatagaag</td><td>agataacatc</td><td>gagcacgatc</td><td>actctgtagg</td><td> 480</td>

<td>ttctagagac</td><td>acttgtggac</td><td>tttttggcat</td><td>agaattgtta</td><td>ccaaattcag</td><td>ttcctgaaga</td><td> 540</td>

<td>taatacaagt</td><td>aatttacaaa</td><td>aattagggat</td><td>ccaacctgga</td><td>acaggtccac</td><td>aaaatcaaga</td><td> 600</td>

<td>caaaattacg</td><td>ttagaaagcc</td><td>ggttagcaac</td><td>attccagggt</td><td>tggccaaaga</td><td>gcattaaaca</td><td> 660</td>

<td>gaggccttct</td><td>gagttagctg</td><td>aggcgggatt</td><td>ttattacaca</td><td>ggagctgggg</td><td>accaaactgt</td><td> 720</td>

<td>gtgcttttat</td><td>tgtggtgggg</td><td>gattaaaaga</td><td>ctgggatgaa</td><td>ggagatgatc</td><td>cttgggagca</td><td> 780</td>

<td>acatgccctt</td><td>tggtttagca</td><td>aatgtgtgtt</td><td>tctcaatttg</td><td>aaaaagggca</td><td>aagaattcat</td><td> 840</td>

<td>cgatcaagta</td><td>aagaggaagg</td><td>ctgatccaca</td><td>attttcaatt</td><td>cctggaccta</td><td>gcggtactca</td><td> 900</td>

<td>agccaaagag</td><td>gaaccgactg</td><td>ctactgaatc</td><td>ttcaagtgat</td><td>aaacaaagtg</td><td>aaacagtgaa</td><td> 960</td>

<td>aacaaaatca</td><td>gatagggaaa</td><td>gtttcgcaac</td><td>tgacacaaet</td><td>ttgtgcaaaa</td><td>tttgctttaa</td><td> 1020</td>

<td>aaacgaactt</td><td>ggtgttgttt</td><td>tcttgccttg</td><td>tggacatatt</td><td>gttgcttgtg</td><td>tagattgtgc</td><td> 1080</td>

<td>tgctgcacta</td><td>aaaacatgtg</td><td>ctgtatgccg</td><td>aaaaccttta</td><td>gaggccacag</td><td>tcagagcgtt</td><td> 1140</td>

<td>cctatcataa</td><td>atttttattc</td><td>tgttaatagt</td><td>ttttcacatt</td><td>tcatgtttca</td><td>cacataetta</td><td> 1200</td>

<td>gatctagtca</td><td>agattgttag</td><td>agttttggca</td><td>aagaaattaa</td><td>ataaaaattc</td><td>ttttcataaa</td><td> 1260</td>

<td>aatcatttct</td><td>ttaatattac</td><td>attagagaaa</td><td>aattatattt</td><td>ttatactgag</td><td>tacaaatttg</td><td> 1320</td>

<td>aacaagttat</td><td>taattttaag</td><td>ttacaaaata</td><td>cgctttt.ata</td><td>ggttaacaat</td><td>tatcaaagcg</td><td> 1380</td>

<td>cttaaatcta</td><td>atagatacta</td><td>cacaacatta</td><td>aggactgcaa</td><td>accatatctt</td><td>tcacgaagta</td><td> 1440</td>

<td>atccctacta</td><td>gtgaccaatt</td><td>gctcgct.agg</td><td>agcagatgca</td><td>aattacacaa</td><td>atttactata</td><td> 1500</td>

<td>aatctgacat</td><td>taaaactt.ag</td><td>gtgtatgttt</td><td>gtgtgtatgt</td><td>tatgtattga</td><td>tcataataat</td><td> 1560</td>

<td>atagtaattt</td><td>ataat</td><td></td><td></td><td></td><td></td><td> 1575</td>

&lt;210&gt; 104 &lt;211&gt; 1870 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 104

<td>gtcgacccac</td><td>gcgtccgaat</td><td>ttgatggtga</td><td>tcgtaccaaa</td><td>tatactatgt</td><td>tgcaagtatg</td><td> 60</td>

<td>gcctgtacgt</td><td>caagcaaggc</td><td>cagtcagtga</td><td>aaaattacct</td><td>gccaaeeatc</td><td>ctctgcttac</td><td> 120</td>

<td>aggacagcgt</td><td>gtacttgatg</td><td>ctcttttccc</td><td>atgtgtacag</td><td>ggtggtacta</td><td>ctgccattcc</td><td> 180</td>

<td>cggagctttc</td><td>ggttgtggaa</td><td>aaactgtaat</td><td>ttcacaatct</td><td>ctttccaaat</td><td>attccaactc</td><td> 240</td>

<td>tgatgtcatt</td><td>atctacgtcg</td><td>gttgcggaga</td><td>aagaggtaac</td><td>gaaatgtctg</td><td>aagtattgag</td><td> 300</td>

<td>agatttccct</td><td>gaattgactg</td><td>ttgaaattga</td><td>cgggcacact</td><td>gaatctatta</td><td>tgaaacgtac</td><td> 360</td>

<td>cgcattggtc</td><td>gccaacacat</td><td>ctaacatgcc</td><td>tgtagctgct</td><td>cgtgaagctt</td><td>ctatctatac</td><td> 420</td>

270

<td>tggtattact ctttctgaat acttccgtga tatgggttac aacgtatcta tgatggctga</td><td> 480</td>

<td>ctcgacatca cgttgggccg aagctttgag agaaatttca ggtcgtttgg ctgaaatgcc</td><td> 5'40</td>

<td>tgccgattcc ggttatccgg cttacttagg tgcccgtttg gcttccttct acgaacgtgc</td><td> 600</td>

<td>tggtcgcgtt aaatgtttag gtaatccaga cagagaagga tccgtttcaa ttgtaggagc</td><td> 660</td>

<td>ągtatcacct cctggtggtg atttctcaga tcctgttacc actgctactc ttggtattgt</td><td> 720</td>

<td>acaggtgttc tggggtńtgg acaagaaact tgcccaacgt aagcacttcc cttcagtaga</td><td> 730</td>

<td>ctggettgga tcatattcca aatatttaag agcattggac gacttttatg acaaaaactt</td><td> 840</td>

<td>ccaagagttt attcctctta gaaccaaagt taaggaaatt cttcaggaag aagatgatct</td><td> 900</td>

<td>agccgaaatt gtgcagctgg taggtaaagc atctctggca gaaacggaca aaatcacctt</td><td> 960</td>

<td>ggaaattgcc aggcttctta aagaagattt cttgcaacaa aactcatact cttcttatga</td><td> 1020</td>

<td>cagattctgt ccattctata aaactgtcgg tatgttgaga aacatgatcg gtttgtacga</td><td> 1080</td>

<td>catggcgaga cacgctgtag aatcaaccgc acaatcagaa aataagatca cttggaacgt</td><td> 1140</td>

<td>aataagagat tcaatgagtg gaattttata tcaacttagc agtatgaaat ttaaggatcc</td><td> 1200</td>

<td>cgtaaaagat ggtgaagcta aaatcaaggc agattttgat caattatatg aagatattca</td><td> 1260</td>

<td>gcaggccttc agaaacttag aagattaaat ctttttaagg aaattttcct attttgttca</td><td> 1320</td>

<td>tcagtgtaag tttaaaaata tagcgatatt tatcaaaaag aataataagg cctctatccc</td><td> 1380</td>

<td>tcacttctgt gaatattaat atggccgtac taaagatagt aactaaagat aggttttctc</td><td> 1440</td>

<td>ttttttgata ttatcctgta caaaataaat tatgtaaatt gttgaatatg tgtatagttt</td><td> 1500</td>

<td>ttttgggtga gggtacagtg cttattaaat actttttaaa catttttccc gccattccaa</td><td> 1560</td>

<td>ttactafctaa gttttttcgt tttaatactt ttttaaatat acaggtgctt aatatcgttt</td><td> 1620</td>

<td>atattttcag tattacttgg ttttcttcat gtaaattgtt ttaaattttt cttttaccct</td><td> 1680</td>

<td>tttaatcttg tatattacat tacccaatta aagttaattg tacagattaa gataaacgag</td><td> 1740</td>

<td>tatcttataa catctattag attgttagaa tcaataaatg tagtgtaatt gttctgtttt</td><td> 1300</td>

<td>gaacaaata atmcatcaaa aaaaaaaaaa aaaaaaaaaa aaaggaaaaa aaaaaaaaaa</td><td> 1860</td>

gggcggccgc 1870 &lt;210&gt; 105 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 105 ctaatagatg ttataagata ctcg &lt;210&gt; 106 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja is a stuczna

271 &lt;400&gt; 106 cgagtatctt ataacatcta ttag 24

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>107 23 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 107 gtaatactga aaatataaac gat 23

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>108 23 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 108 atcgtttata ttttcagtat tac 23

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>109 20 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 109 agcactgtac cctcacccaa 20

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>110 20 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 110 ttgggtgagg gtacagtgct 20

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>111 21 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 111 gtgagggata gaggccttat t 21

272

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>112 21 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 112 aataaggcct ctatccctca c 21

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>113 19 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 113 aacttacact gatgaacaa 19

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>114 19 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 114 ttgttcatca gtgtaagtt 19

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>115 20 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 115 aggcctgctg aatatcttca 20

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>116 20 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 116 tgaagatatt cagcaggcct 20 &lt;210&gt; 117 &lt;211&gt; 21

273

<td> &lt;212&gt; &lt;213&gt;</td><td>DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 117 ctgccttgat tttagcttca c 21

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>118 21 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 118 gtgaagctaa aatcaaggca g 21

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>119 20 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 119 gattgtgcgg ttgattctac 20

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>120 19 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 120 gtagaatcaa ccgcacaat 19

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>121 43 DNA Sztuczny</td>

<td> &lt;220&gt; &lt;223&gt;</td><td>Sekwencja stuttered</td>

&lt;400&gt; 121 taatacgact cactataggg tacgtaagct tggatcctct aga 43

<td> &lt;210&gt; &lt;211&gt; &lt;212&gt; &lt;213&gt;</td><td>122 44 DNA Sztuczny</td>

274 &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 122

<td>taatacgact cactataggg tgcaggtacc</td><td>ggtccggaat</td><td>TCCC</td>

<td>&lt;210&gt; 123 &lt;211&gt; 41 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt; &lt;223&gt; Sekwencja is a stuczna &lt;400&gt; 123 taatacgact cactataggg cgcgtccgaa</td><td>tttgatggtg</td><td>the</td>

<td>&lt;210&gt; 124 &lt;211&gt; 41 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt; &lt;223&gt; Sekwencja is a stuczna &lt;400&gt; 124 taatacgact cactataggg gttacctctt</td><td>tctccgcaac</td><td>c</td>

<td>&lt;210&gt; 125 &lt;211&gt; 41 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt; &lt;223&gt; Sekwencja is a stuczna &lt;400&gt; 125 taatacgact cactataggg gaagtattga</td><td>gagatttccc</td><td>t</td>

<td>&lt;210&gt; 126 &lt;211&gt; 41 &lt;212&gt; DNA. &lt;213&gt; Sztuczny &lt;220&gt; &lt;223&gt; Sekwencja is a stuczna &lt;400&gt; 126 taatacgact cactataggg ggaatcggca</td><td>ggcatttcag</td><td>c</td>

<td>&lt;210&gt; 127 &lt;211&gt; 41 &lt;212&gt; DNA &lt;213&gt; Sztuczny</td><td></td><td></td>

&lt;220&gt;

&lt;223&gt; Sekwencja is a stuczna

275 &lt;400&gt; 127

<td colspan="2">taatacgact cactataggg</td><td>gcttacttag</td><td>gtgcccgttt g</td>

<td> &lt;210&gt;</td><td> 128</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 40</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td colspan="2">Sekwencja stuttered</td><td></td>

<td> &lt;400&gt;</td><td> 128</td><td></td><td></td>

<td colspan="2">taatacgact cactataggg</td><td>ataaaagtcg</td><td>tccaatgctc</td>

<td> &lt;210&gt;</td><td> 129</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 40</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td colspan="2">Sekwencja stuttered</td><td></td>

<td> &lt;400&gt;</td><td> 129</td><td></td><td></td>

<td colspan="2">taatacgact cactataggg</td><td>ccaagagttt</td><td>attcctctta</td>

<td> &lt;210&gt;</td><td> 130</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 41</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td colspan="2">Sekwencja stuttered</td><td></td>

<td> &lt;400&gt;</td><td> 130</td><td></td><td></td>

<td colspan="2">taatacgact cactataggg</td><td>gctatatttt</td><td>taaacttaca c</td>

<td> &lt;210&gt;</td><td> 131</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 40</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td colspan="2">Sekwencja stuttered</td><td></td>

<td> &lt;400&gt;</td><td> 131</td><td></td><td></td>

<td colspan="2">taatacgact cactataggg</td><td>gaataataag</td><td>gcctctatcc</td>

<td> &lt;210&gt;</td><td> 132</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 40</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td colspan="2">Sekwencja stuttered</td><td></td>

<td> &lt;400&gt;</td><td> 132</td><td></td><td></td>

<td colspan="2">taatacgact cactataggg</td><td>taaacgatat</td><td>taagcacctg</td>

276 &lt;210&gt; 133 &lt;211&gt; 40 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja Stuczna &lt;400&gt; 133

<td colspan="2">taatacgact cactataggg acatttttcc</td><td>cgccattcca</td><td colspan="2"> 40</td>

<td> &lt;210&gt;</td><td> 134</td><td></td><td></td><td></td>

<td> &lt;211&gt;</td><td> 39</td><td></td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td>Sekwencja stuttered</td><td></td><td></td><td></td>

<td> &lt;400&gt;</td><td> 134</td><td></td><td></td><td></td>

<td colspan="2">taatacgact cactataggg gatgcattta</td><td>tttgttcaa</td><td> 39</td><td></td>

<td> &lt;210&gt;</td><td> 135</td><td></td><td></td><td></td>

<td> &lt;211&gt;</td><td> 36</td><td></td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td>Sekwencja stuttered</td><td></td><td></td><td></td>

<td> &lt;400&gt;</td><td> 135</td><td></td><td></td><td></td>

<td colspan="2">gcgtagaatt cgttcaaaac agaacaatta</td><td>cactac</td><td> 36</td><td></td>

<td> &lt;210&gt;</td><td> 136</td><td></td><td></td><td></td>

<td> &lt;211&gt;</td><td> 56</td><td></td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td>Sekwencja stuttered</td><td></td><td></td><td></td>

<td> &lt;400&gt;</td><td> 136</td><td></td><td></td><td></td>

<td colspan="2">taatacgact cactataggg gcgtagaatt</td><td>cgttcaaaac</td><td>agaacaatta</td><td>cactac</td>

<td> 56</td><td></td><td></td><td></td><td></td>

<td> &lt;210&gt;</td><td> 137</td><td></td><td></td><td></td>

<td> &lt;211&gt;</td><td> 53</td><td></td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td>Sekwencja stuttered</td><td></td><td></td><td></td>

<td> &lt;400&gt;</td><td> 137</td><td></td><td></td><td></td>

<td colspan="2">ggccttaagc tagcgcaatt ggatcccatt</td><td>tattgattct</td><td>aacaatctaa</td><td>tag 53</td>

&lt;210&gt; 138 &lt;211&gt; 26

277 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 138 ggccttaagc tagcgcaatt ggatcc 26 &lt;210&gt; 139 &lt;211&gt; 25 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 139 gatggtgaag ctaaaatcaa ggcag 25 &lt;210&gt; 140 &lt;211&gt; 53 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 140 ctgccttgat tttagcttca ccatcggaaa ttttcctatt ttgttcatca gtg &lt;210&gt; 141 &lt;211&gt; 608 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 141

<td>gcgtagaatt</td><td>cgttcaaaac</td><td>agaacaatta</td><td>cactacattt</td><td>attgattcta</td><td>acaatctaat</td><td> 60</td>

<td>agatgttata</td><td>agatactcgt</td><td>ttatcttaat</td><td>ctgtacaatt</td><td>aactttaatt</td><td>gggtaatgta</td><td> 120</td>

<td>atatacaaga</td><td>ttaaaagggt</td><td>aaaagaaaaa</td><td>tttaaaacaa</td><td>tttacatgaa</td><td>gaaaaccaag</td><td> 180</td>

<td>taatactgaa</td><td>aatataaacg</td><td>atattaagca</td><td>cctgtatatt</td><td>taaaaaagta</td><td>ttaaaacgaa</td><td> 240</td>

<td>aaaac tta a t.</td><td>agtaattgga</td><td>atggcgggaa</td><td>aaatgtttaa</td><td>aaagtattta</td><td>ataagcactg</td><td> 300</td>

<td>taccctcacc</td><td>caaaaaaact</td><td>atacacatat</td><td>tcaacaattt</td><td>acataattta</td><td>ttttgtacag</td><td> 360</td>

<td>gataatatca</td><td>aaaaagagaa</td><td>aacctatctt</td><td>tagttactat</td><td>ctttagtacg</td><td>gccatattaa</td><td> 420</td>

<td>tattcacaga</td><td>agtgagggat</td><td>agaggcctta</td><td>ttattctttt</td><td>tgataaatat</td><td>cgctatattt</td><td> 480</td>

<td>ttaaacttac</td><td>actgatgaac</td><td>aaaataggaa</td><td>aatttcctta</td><td>aaaagattta</td><td>atcttctaag</td><td> 540</td>

<td>tttctgaagg</td><td>cctgctgaat</td><td>atcttcatat</td><td>aattgatcaa</td><td>aatctgcctt</td><td>gattttagct</td><td> 600</td>

tcaccatc 608 &lt;210&gt; 142 &lt;211&gt; 533 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera

278 &lt;400&gt; 142

<td>ggccttaagc</td><td>tagcgcaatt</td><td>ggatcccatt</td><td>tattgattct</td><td>aacaatctaą</td><td>tagatgttat</td><td> 60</td>

<td>aagatactcg</td><td>tttatcttaa</td><td>tctgtacaat</td><td>taactttaat</td><td>tgggtaatgt</td><td>aatatacaag</td><td> 120</td>

<td>attaaaaggg</td><td>taaaagaaaa</td><td>atttaaaaca</td><td>atttacatga</td><td>agaaaaccaa</td><td>gtaatactga</td><td> 180</td>

<td>aaatataaac</td><td>gatattaagc</td><td>acctgtatat</td><td>ttaaaaaagt</td><td>attaaaacga</td><td>aaaaacttaa</td><td> 240</td>

<td>tagtaattgg</td><td>aatggcggga</td><td>aaaatgttta</td><td>aaaagtattt</td><td>aataagcact</td><td>gtaccctcac</td><td> 300</td>

<td>ccaaaaaaać</td><td>tatacacata</td><td>ttcaacaatt</td><td>tacataąttt</td><td>attttgtaca</td><td>ggataatatc</td><td> 360</td>

<td>aaaaaagaga</td><td>aaacctatct</td><td>ttagttacta</td><td>tctttagtac</td><td>ggccatatta</td><td>atattcacag</td><td> '420</td>

<td>aagtgaggga</td><td>tagaggcctt</td><td>attattcttt</td><td>ttgataaata</td><td>tcgctatatt</td><td>tttaaactta</td><td> 430</td>

<td>cactgatgaa</td><td>caaaatagga</td><td>aaatttccga</td><td>tggtgaagct</td><td>aaaatcaagg</td><td>cag</td><td> 533</td>

&lt;210&gt; 143 &lt;211&gt; 1114 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 143

<td>cgtagaattc</td><td>gttcaaaaca</td><td>gaacaattac</td><td>actacattta</td><td>ttgattctaa</td><td>caatctaata</td><td> 60</td>

<td>gatgttataa</td><td>gatactcgtt</td><td>tatcttaatc</td><td>tgtacaatta</td><td>actttaattg</td><td>ggtaatgtaa</td><td> 120</td>

<td>tatacaagat</td><td>taaaagggta</td><td>aaagaaaaat</td><td>ttaaaacaat</td><td>ttacatgaag</td><td>aaaaccaagt</td><td> 180</td>

<td>aatactgaaa</td><td>atataaacga</td><td>tattaagcac</td><td>ctgtatattt</td><td>aaaaaagtat</td><td>taaaacgaaa</td><td> 240</td>

<td>aaacttaata</td><td>gtaattggaa</td><td>tggcgggaaa</td><td>aatgtttaaa</td><td>aagtatttaa</td><td>taagcactgt</td><td> 300</td>

<td>accctcaccc</td><td>aaaaaaacta</td><td>tacacatatt</td><td>caacaattta</td><td>cataatttat</td><td>tttgtacagg</td><td> 360</td>

<td>ataatatcaa</td><td>aaaagagaaa</td><td>acctatcttt</td><td>agttactatc</td><td>tttagtacgg</td><td>ccatattaat</td><td> 420</td>

<td>attcacagaa</td><td>gtgagggata</td><td>gaggccttat</td><td>tattcttttt</td><td>gataaatatc</td><td>gctatatttt</td><td> 480</td>

<td>taaacttaca</td><td>ctgatgaaca</td><td>aaataggaaa</td><td>atttccttaa</td><td>aaagatttaa</td><td>tcttctaagt</td><td> 540</td>

<td>ttctgaaggc</td><td>ctgctgaata</td><td>tcttcatata</td><td>attgatcaaa</td><td>atctgccttg</td><td>attttagctt</td><td> 600</td>

<td>caccatcgaa</td><td>attttcctat</td><td>tttgttcatc</td><td>agtgtaagtt</td><td>taaaaatata</td><td>gcgatattta</td><td> 660</td>

<td>tcaaaaagaa</td><td>taataaggcc</td><td>tctatccctc</td><td>acttctgtga</td><td>atattaatat</td><td>ggccgtacta</td><td> 720</td>

<td>aagatagtaa</td><td>ctaaagatag</td><td>gttttctctt</td><td>ttttgatatt</td><td>atcctgtaca</td><td>aaataaatta</td><td> 780</td>

<td>tgtaaattgt</td><td>tgaatatgtg</td><td>tatagttttt</td><td>ttgggtgagg</td><td>gtacagtgct</td><td>tattaaatac</td><td> 840</td>

<td>tttttaaaca</td><td>tttttcccgc</td><td>cattccaatt</td><td>actattaagt</td><td>tttttcgttt</td><td>taatactttt</td><td> 900</td>

<td>ttaaatatac</td><td>aggtgcttaa</td><td>tatcgtttat</td><td>attttcagta</td><td>ttacttggtt</td><td>ttcttcatgt</td><td> 960</td>

<td>aaattgtttt</td><td>aaatttttct</td><td>tttacccttt</td><td>taatcttgta</td><td>tattacatta</td><td>cccaattaaa</td><td> 1020</td>

<td>gttaattgta</td><td>cagattaaga</td><td>taaacgagta</td><td>tcttataaca</td><td>tctattagat</td><td>tgttagaatc</td><td> 1080</td>

<td>aataaatggg</td><td>atccaattgc</td><td>gctagcttaa</td><td>ggcc</td><td></td><td></td><td> 1114</td>

&lt;210&gt; 144 &lt;211&gt; 1125 &lt;212&gt; DNA &lt;213&gt; Leptinotarsa ​​decemlineata

279 &lt;400&gt; 144

<td>ggtgacatgg</td><td>ccaccatcca</td><td>ggtatatgaa</td><td>gaaacttctg</td><td>gagtaacggt</td><td>gggagatcct</td><td> 60</td>

<td>gtgttgcgta</td><td>ccggtaaacc</td><td>tctatctgtg</td><td>gaacttgggc</td><td>caggtattat</td><td>gggttccatc</td><td> 120</td>

<td>tttgatggta</td><td>tccaacgtcc</td><td>gctgaaagac</td><td>atctgcgaca</td><td>tgacggaaag</td><td>tatctacatt</td><td>IEO</td>

<td>cccaagggtg</td><td>tgaacgtgcc</td><td>ttcactctcc</td><td>agaactatca</td><td>aatgggaatt</td><td>caacccaatc</td><td> 240</td>

<td>aacatcaagt</td><td>tgggatccca</td><td>cttgacaggt</td><td>ggagatattt</td><td>atggtatggt</td><td>ccacgaaaac</td><td> 300</td>

<td>acccttgtta</td><td>agcacaaaat</td><td>gatcctccca</td><td>ccaaaatcta</td><td>agggaacagt</td><td>tacatacgtg</td><td> 360</td>

<td>gcagaaccag</td><td>gaaactatac</td><td>cgttgatgaa</td><td>gttgtattgg</td><td>aaactgaatt</td><td>tgatggagaa</td><td> 420</td>

<td>aggtcaaaat</td><td>acactatgtt</td><td>acaagtctgg</td><td>ccagttcgac</td><td>aggcaagacc</td><td>tgttagtgaa</td><td> 480</td>

<td>aaactcccag</td><td>ccaatcaccc</td><td>gcttctcaca</td><td>ggacagcgtg</td><td>tattggactc</td><td>tcttttccca</td><td> 540</td>

<td>tgtgtgcaag</td><td>gaggaaccac</td><td>tgctattccc</td><td>ggtgotttcg</td><td>gttgtggtaa</td><td>aactgtaatt</td><td> . 600</td>

<td>tcccagtcac</td><td>tttccaagta</td><td>ttccaactct</td><td>gatgtcattg</td><td>tgtatgtagg</td><td>ttgtggagag</td><td> 660</td>

<td>agaggtaatg</td><td>agatgtctga</td><td>agtattgaga</td><td>gatttccctg</td><td>aactgactgt</td><td>ggaaattggt</td><td> 720</td>

<td>ggtgagaccg</td><td>aatctatcat</td><td>gaaacgtacc</td><td>gccttggttg</td><td>caaacacctc</td><td>caacatgcct</td><td> 780</td>

<td>gtcgctgccc</td><td>gtgaggcttc</td><td>t ^ atttatact</td><td>ggtattaccc</td><td>tgtctgaata</td><td>tttccgtgat</td><td> 840</td>

<td>atgggttaca</td><td>acgtttctat</td><td>gatggctgac</td><td>tctacatcac</td><td>gttgggctga</td><td>agctttgaga</td><td> 900</td>

<td>gaaatttcag</td><td>gacgtttggc</td><td>tgaaatgcct</td><td>gctgattccg</td><td>gttacccagc</td><td>ctatttgggt</td><td> 960</td>

<td>gctcgtcttg</td><td>cctctttcta</td><td>tgaacgtgct</td><td>ggtcgcgtca</td><td>aatgtttggg</td><td>taaccctgac</td><td> 1020</td>

<td>agagaaggat</td><td>cggtttctat</td><td>tgtaggagca</td><td>gtatctccac</td><td>ccggtggtga</td><td>cttttcagat</td><td> 1080</td>

<td>cccgttactt</td><td>cagcaacttt</td><td>aggtatcgta</td><td>caggtgttct</td><td>GGGG</td><td></td><td> 1125</td>

&lt;210&gt; 145 &lt;211&gt; 1125 &lt;212&gt; DNA &lt;213&gt; Spodoptera frugiperda

280 &lt;400&gt; 145

<td>ggtgacatgg</td><td>ccaccatcca</td><td>ggtatacgaa</td><td>gaaacatcag</td><td>gcgtaactgt</td><td>aggtgacccc</td><td> 60</td>

<td>gtgctgcgta</td><td>ccggcaagcc</td><td>cctgtccgta</td><td>gagctcggac</td><td>ctggtatcct</td><td>cggctccatc</td><td> 120</td>

<td>tttgacggta</td><td>tccagcggcc</td><td>actgaaggac</td><td>atcaacgagc</td><td>tcacacagtc</td><td>catctaca.tc</td><td> 180</td>

<td>cccaagggtg</td><td>tcaacgtacc</td><td>ctgccttgga</td><td>cgtgatgtct</td><td>cctgggaatt</td><td>caaccccttg</td><td> 240</td>

<td>aatgttaagg</td><td>tcggctccca</td><td>catcaccgga</td><td>ggagacttgt</td><td>acggtatcgt</td><td>acacgagaac</td><td> 300</td>

<td>acattggtta</td><td>agcacaagat</td><td>gttgatccca</td><td>cccaaggcca</td><td>agggtaccgt</td><td>cacctacgtc</td><td> 3 60</td>

<td>gcgccctccg</td><td>gcaactacaa</td><td>agtcactgac</td><td>gtagtgttgg</td><td>agacggagtt</td><td>cgacggcgag</td><td> 420</td>

<td>aaggagaagt</td><td>acacgatgtt</td><td>gcaagtatgg</td><td>ccggtgcgcc</td><td>agccccgcęc</td><td>cgtcactgag</td><td> 480</td>

<td>aagctgcccg</td><td>ccaaccaccc</td><td>cctgctcacc</td><td>ggacagagag</td><td>tgctcgactc</td><td>tctcttccct</td><td> 540</td>

<td>tgtgtccagg</td><td>gtggtaccac</td><td>ggccatcccc</td><td>ggcgccttcg</td><td>gttgtggcaa</td><td>gactgtcgtc</td><td> 600</td>

<td>tcacaggctc</td><td>tgtccaagta</td><td>ctccaactct</td><td>gacgtcatca</td><td>tctacgtcgg</td><td>atgcggtgaa</td><td> 660</td>

<td>cgtggtaacg</td><td>agatgtctga</td><td>ggtactgcgt</td><td>gacttccccg</td><td>agctgacggt</td><td>ggagatcgag</td><td> 720</td>

<td>ggcatgaccg</td><td>agtccatcat</td><td>gaagcgtacc</td><td>gcgctcgtcg</td><td>ccaacacctc</td><td>caacatgcct</td><td> 780</td>

<td>gtagccgccc</td><td>gagaggcttc</td><td>catctacacc</td><td>ggtatcaccc</td><td>tctctgagta</td><td>cttccgtgac</td><td> 840</td>

<td>atgggttaca</td><td>acgtgtccat</td><td>gatggctgac</td><td>tccacctctc</td><td>gttgggccga</td><td>ggctcttcgt</td><td> 900</td>

<td>gagatctcag</td><td>gtcgtctggc</td><td>tgagatgcct</td><td>gccgactccg</td><td>gttaccccgc</td><td>ctacctggga</td><td> 960</td>

<td>gcccgtctgg</td><td>cctcgttcta</td><td>cgagcgtgcc</td><td>ggacgcgtga</td><td>agtgcctggg</td><td>taaccccgac</td><td> 1020</td>

<td>agggagggct</td><td>ccgtgtccat</td><td>cgtgggcgcc</td><td>gtgtcgccgc</td><td>ccggaggtga</td><td>cttctccgac</td><td> 1080</td>

<td>cccgtgacgg</td><td>ccgccacgct</td><td>gggtatcgtg</td><td>caggtgttct</td><td>GGGG</td><td></td><td> 1125</td>

&lt;210&gt; 146 &lt;211&gt; 1126 &lt;212&gt; DNA &lt;213&gt; Agrotis ipsilon &lt;400&gt; 146

<td>ggtgacatgg</td><td>ccaccatcca</td><td>ggtatacgaa</td><td>gaaacatcag</td><td>gtgtaacagt</td><td>gggcgacccc</td><td> 60</td>

<td>gtactgcgta</td><td>ctggCaagcc</td><td>tctgtccgtg</td><td>gaactgggtc</td><td>ctggtatcct</td><td>gggctccatc</td><td> 120</td>

<td>tttgacggta</td><td>tccagcgtcc</td><td>tctgaaggac</td><td>attaacgagc</td><td>tcacacagtc</td><td>catctacatc</td><td> 180</td>

<td>cccaagggtg</td><td>tgaacgtgcc</td><td>cagtctatcc</td><td>agggatatcg</td><td>cctgggaatt</td><td>tgagcccatg</td><td> ' 240</td>

<td>aacctgaaga</td><td>tcgggtccca</td><td>catcactggc</td><td>ggagacctgt</td><td>acgccatcgt</td><td>ccgcgagaac</td><td> 300</td>

<td>accctggtga</td><td>agcacaagat</td><td>gttgatcccg</td><td>cccaaggcca</td><td>agggtaccgt</td><td>cacatacatc</td><td> 360</td>

<td>gcgcccgctg</td><td>gcaactacca</td><td>cgtcactgac</td><td>gtggttctgg</td><td>agacagagtt</td><td>cgacggtgag</td><td> 420</td>

<td>aaggagaagt</td><td>acagcatgtt</td><td>acaagtgtgg</td><td>cccgtgaggc</td><td>agccgcggcc</td><td>ggtcgctgag</td><td> 480</td>

<td>aagctccccg</td><td>ccaaccatcc</td><td>gctgctcacc</td><td>gggcagaggg</td><td>tactcgactc</td><td>gctgttcccc</td><td> 540</td>

<td>tgtgtgcagg</td><td>gtggtacgac</td><td>ggccatcccc</td><td>ggagccttcg</td><td>gttgcgggaa</td><td>gactgtcatc</td><td> 600</td>

<td>tcacaggcgt</td><td>tgtccaagta</td><td>ctccaactcc</td><td>gatgtcatcg</td><td>tctacgtcgg</td><td>ttgcggagag</td><td> 660</td>

281

<td>cgtggtaacg</td><td>agatgtctga</td><td>agtactgcgg</td><td>gacttcccgg</td><td>agctgaccgt</td><td>agagatcggc</td><td> 720</td>

<td>ggcgtcaccg</td><td>agtccatcat</td><td>gaagagaacc</td><td>gcgctggtcg</td><td>ccaacacatc</td><td>caacatgcct</td><td> 780</td>

<td>gtcgccgcec</td><td>gagaggcttc</td><td>catctatacc</td><td>ggtatcactc</td><td>tgtcggagta</td><td>cttccgtgac</td><td> 840</td>

<td>atgggctaca</td><td>acgtgtccat</td><td>gatggccgac</td><td>tccacgtctc</td><td>gttgggcgga</td><td>ggccctccgt</td><td> 900</td>

<td>gagatctctg</td><td>gtcgtctggc</td><td>cgagatgccg</td><td>gcggactccg</td><td>ggtacccggc</td><td>ctacctggga</td><td> 960</td>

<td>gcacgactgg</td><td>cctccttcta</td><td>cgagcgagcc</td><td>ggacgagtca</td><td>agtgtctggg</td><td>taaccccgac</td><td> 1020</td>

<td>agggaaggtt</td><td>ccgtatccat</td><td>cgtgggcgcc</td><td>gtgtctcctc</td><td>ccggcggaga</td><td>cttctccgac</td><td> 1080</td>

<td>cctgtgacgg</td><td>ccgcgaccct</td><td>gggtatcgtg</td><td>caggtgttct</td><td>ggggta</td><td></td><td> 1126</td>

&lt;210&gt; 147 &lt;211&gt; 1126 &lt;212&gt; DNA &lt;213&gt; Helicoverpa zea &lt;400&gt; 147

<td>ggtgacacgg</td><td>ccaccatcca</td><td>ggtatacgag</td><td>gaaacctcag</td><td>gtgtaaccgt</td><td>gggtgacccc</td><td> 60</td>

<td>gtactccgta</td><td>ccggcaagcc</td><td>cctgtccgtg</td><td>gagttgggcc</td><td>ccggtatcct</td><td>gggctccatc</td><td> 120</td>

<td>tttgacggta</td><td>tccagcgtcc</td><td>cctgaaagac</td><td>attaacgagc</td><td>tcacacagtc</td><td>catctacatc</td><td> 180</td>

<td>cccaagggtg</td><td>tgaacgtacc</td><td>ctctctggct</td><td>agggatgtca</td><td>gctgggaatt</td><td>cgttcccatg</td><td> 240</td>

<td>aacgttaaga</td><td>cgggctccca</td><td>catcaccgga</td><td>ggagacctgt</td><td>acggtctggt</td><td>gcacgagaac</td><td> 300</td>

<td>acgctggtga</td><td>agcaccgcat</td><td>gctgatcccg</td><td>cccaaggcca</td><td>agggtaccgt</td><td>cacatacatc</td><td> 360</td>

<td>gcgcccgctg</td><td>gcaactacaa</td><td>agtcactgac</td><td>gtagtgctgg</td><td>agacggagtt</td><td>cgacggcgag</td><td> 420</td>

<td>agggagaagt</td><td>acacgatgtt</td><td>gcaggtgtgg</td><td>ccggtgcgcc</td><td>agccgcggcc</td><td>cgtcaccgag</td><td> 480</td>

<td>aagctccccg</td><td>ccaaccatcc</td><td>gctgctcacc</td><td>ggacagaggg</td><td>tgctcgactc</td><td>actcttccct</td><td> 540</td>

<td>tgcgtacagg</td><td>gtggtacaac</td><td>tgccatcccc</td><td>ggagctttcg</td><td>gttgcggcaa</td><td>gactgtcatc</td><td> 600</td>

<td>tcgcaggcgc</td><td>tgtccaagta</td><td>ctccaactcc</td><td>gatgtcattg</td><td>tgtacgtcgg</td><td>gtgcggagag</td><td> 660</td>

<td>cgtggtaacg</td><td>agatgtccga</td><td>agtactgcgt</td><td>gacttćcccg</td><td>agctgacggt</td><td>ggagatcgag</td><td> 720</td>

<td>ggcgtgacgg</td><td>agtccatcat</td><td>gaagcgaact</td><td>gccctcgtcg</td><td>ccaacacctc</td><td>caacatgcct</td><td> 780</td>

<td>gtcgcćgccc</td><td>gagaggcttc</td><td>catctacact</td><td>ggtatcactc</td><td>tatccgagta</td><td>cttccgtgac</td><td> 840</td>

<td>atgggttaca</td><td>acgtgtccat</td><td>gatggctgac</td><td>tccacgtccc</td><td>gttgggccga</td><td>agccctgcgt</td><td> 900</td>

<td>gagatctcgg</td><td>gtcgcctggc</td><td>ggagatgccg</td><td>gccgactccg</td><td>gctaccccgc</td><td>atacctgggc</td><td> 960</td>

<td>gctaggttag</td><td>cttccttcta</td><td>cgagagagcc</td><td>ggacgcgtca</td><td>agtgtctggg</td><td>taaccccgac</td><td> 1020</td>

<td>agggaaggtt</td><td>ccgtatccat</td><td>cgtgggtgcc</td><td>gtatctcccc</td><td>ccggaggtga</td><td>cttctctgac</td><td> 1080</td>

<td>cctgtaactg</td><td>cggccacgct</td><td>gggtattgtg</td><td>caggtgttct</td><td>ggggta</td><td></td><td> 1126</td>

&lt;210&gt; 148 &lt;211&gt; 1126 &lt;212&gt; DNA &lt;213&gt; Ostrinia nubilalis &lt;400&gt; 148 ggtgacacgg ccaccatcca ggtatacgaa gagacctcag gtgtgaccgt cggtgatccc 60

282

<td>gtgctccgaa</td><td>ccggcaagcc</td><td>tctgtccgtc</td><td>gagctgggtc</td><td>cgggtatcct</td><td>gggttccata</td><td> 120</td>

<td>ttcgacggca</td><td>tccagcgccc</td><td>gctgaaggac</td><td>atcaacgaac</td><td>tgacgcagtc</td><td>catctacatc</td><td> 180</td>

<td>cccaagggag</td><td>tcaacgtgcc</td><td>ctgcctggcc</td><td>aggaaccacg</td><td>actgggagtt</td><td>caacccgctt</td><td> 240</td>

<td>aacgttaagg</td><td>tcggctccca</td><td>catcaccggc</td><td>ggagacttgt</td><td>acggtatcgt</td><td>gcacgaaaat</td><td> 300</td>

<td>accctggtga</td><td>agcacaaaat</td><td>gctgatgccg</td><td>cccaaggcta</td><td>aaggcaccat</td><td>cacctacatc</td><td> 360</td>

<td>gcgcctgccg</td><td>gcaactacaa</td><td>cgtcactgat</td><td>gtggtgctgg</td><td>agacagagtt</td><td>tgacggcgaa</td><td> 420</td>

<td>aagaactcct</td><td>acaccatgtt</td><td>gcaagtgtgg</td><td>cccgtgcgcc</td><td>agcccagacc</td><td>ctgcaćtgag</td><td> 4 80</td>

<td>aagctgcccg</td><td>ccaaccaccc</td><td>gctgctaact</td><td>gggcagcgtg</td><td>tgctggactc</td><td>actcttcccc</td><td> 540</td>

<td>tgtgtccagg</td><td>gcggcaccac</td><td>cgccatcccc</td><td>ggcgccttcg</td><td>gttgcggcaa</td><td>gactgtcatc</td><td> . 600</td>

<td>tcgcaagcgc</td><td>tgtccaagta</td><td>ctccaactct</td><td>gacgtcatcg</td><td>tctacgtcgg</td><td>ctgcggagag</td><td> 660</td>

<td>cgtggtaacg</td><td>agatgtctga</td><td>ggtactgcga</td><td>gacttccctg</td><td>agctgagcgt</td><td>ggagatcgac</td><td> 720</td>

<td>ggcgtgacgg</td><td>aatccatcat</td><td>gaagcgcaca</td><td>gcgctcgtgg</td><td>ccaacacctc</td><td>caacatgcct</td><td> 780</td>

<td>gtggctgccc</td><td>gtgaggcctc</td><td>catctatact</td><td>ggtatcaccc</td><td>tatccgagta</td><td>cttccgcgac</td><td> 840</td>

<td>atgggttaca</td><td>acgtgtcaat</td><td>gatggcggat</td><td>tccacatcgc</td><td>gttgggcgga</td><td>ggcgctgcgc</td><td> 900</td>

<td>gagatctcgg</td><td>gccgtctggc</td><td>cgagatgccg</td><td>gcggattccg</td><td>gctacccggc</td><td>ctacctgggc</td><td> 960</td>

<td>gcccggctgg</td><td>cctccttcta</td><td>cgagcgagcg</td><td>ggacgcgtga</td><td>agtgtctcgg</td><td>aaaccccgac</td><td> 1020</td>

<td>agggaaggtt</td><td>ccgtatccat</td><td>cgtgggcgcc</td><td>gtgtcgccac</td><td>ccggaggaga</td><td>cttctcggac</td><td> 1080</td>

<td>ccggtgacgg</td><td>cggcgaccct</td><td>gggtatcgtg</td><td>caggtgttct</td><td>ggggta </td><td></td><td> 1126</td>

&lt;210&gt; 149 &lt;211&gt; 1125 5 &lt;212&gt; DNA &lt;213&gt; Anthonomus grandis

<td colspan="7"> &lt;400&gt; 149</td>

<td>ggtgacatgg</td><td>ccaccatcca</td><td>ggtatatgaa</td><td>gaaacctcag</td><td>gtgtaacagt</td><td>aggcgaccct</td><td> 60</td>

<td>gtcctaagaa</td><td>cgggcaaacc</td><td>tctgtcagta</td><td>gaactgggac</td><td>ctggtatcat</td><td>gggttccatt</td><td> 120</td>

<td>tttgatggta</td><td>tccaacgtcc</td><td>cttaaaagac</td><td>attaacgact</td><td>tgacccagtc</td><td>catttacatc</td><td> 180</td>

<td>cccaagggtg</td><td>taaatgtgcc</td><td>atgtctgtcc</td><td>aggacagccc</td><td>agtgggaatt</td><td>caatcccgtc</td><td> 240</td>

<td>cacatcaaga</td><td>tgggttctca</td><td>tttgaccgga</td><td>ggcgacatct</td><td>atggtatggt</td><td>ccatgaaaac</td><td> 300</td>

<td>actttggtga</td><td>aacacaaaat</td><td>gattttgcct</td><td>ccaaaggcaa</td><td>agggtactgt</td><td>gacatatatc</td><td> 3 60</td>

<td>gccgaggcag</td><td>gcaactatac</td><td>tgtggacgat</td><td>gtggtacttg</td><td>agaccgaatt</td><td>cgacggagaa</td><td> 420</td>

<td>cgcaccaaat</td><td>acaccatgtt</td><td>gcaagtgtgg</td><td>cccgtacgtc</td><td>aaccgagacc</td><td>tgtgagcgaa</td><td> 480</td>

<td>aaattgccgg</td><td>ccaaccaccc</td><td>actgctcacc</td><td>ggacaacgtg</td><td>tactcgattc</td><td>acttttcccc</td><td> 540</td>

<td>tgtgtgcaag</td><td>gaggtaccac</td><td>cgccatcccc</td><td>ggcgctttcg</td><td>gttgcggtaa</td><td>aaccgtaatt</td><td> 600</td>

<td>tcacaggcct</td><td>tgtccaaata</td><td>ttccaactcc</td><td>gatgtcatca</td><td>tttacgtcgg</td><td>ttgcggtgaa</td><td> 660</td>

<td>agaggtaacg</td><td>aaatgtctga</td><td>agtactacgt</td><td>gacttcccgg</td><td>agttaacggt</td><td>cgaaatcgac</td><td> 720</td>

<td>ggtgccaccg</td><td>aatccatcat</td><td>gaaacgtacc</td><td>gctttggtgg</td><td>cgaacacctc</td><td>caacatgccc</td><td> 780</td>

283 gtggccgccc gtgaggcctc catttatacc ggaatcactt tgtccgagta tttccgtgat 840 atgggttaca acgtttcgat gatggccgac tccacctcac gttgggccga agccttaaga 900 gaaatttcag gtcgtttggc tgaaatgccc gccgattccg gttatcccgc ttacttggga 960 gcacgtttgg cctcgttcta cgaacgtgcc ggtcgcgtta agtgtttagg taatccggac 1020 agagagggct ccgtgtccat cgtaggcgca gtatcgccac ctggtggtga cttctcagat 1080 cccgtcactt ccgccacttt gggtatcgta caggtgttct GGGG 1125 &lt;210&gt; 150 &lt;211&gt; 1125 &lt; 212&gt; DNA &lt;213&gt; firibolium castaneum &lt;400&gt; 150

<td>ggtgacatgg</td><td>ccaccatcca</td><td>ggtatacgaa</td><td>gaaacttcag</td><td>gtgttacggt</td><td>gggtgatcca</td><td> 60</td>

<td>gtcttacgaa</td><td>ctggtaaacc</td><td>cttgtcggtg</td><td>gagctgggcc</td><td>caggtattat</td><td>gggttcgatt</td><td> 120</td>

<td>tttgacggta</td><td>tccagagacc</td><td>gctgaaggac</td><td>atcaacgagc</td><td>tcacgcaaag</td><td>tatttacatt</td><td> 180</td>

<td>cctaagggtg</td><td>ttaatgtgcc</td><td>atcgttgtcg</td><td>cgtacgacta</td><td>agtgggagtt</td><td>tgccccattg</td><td> 240</td>

<td>aatatcaagt</td><td>tggggtcaca</td><td>tctgacaggc</td><td>ggtgatattt</td><td>acgggatcgt</td><td>ccatgaaaac</td><td> 300</td>

<td>actctcgtca</td><td>agcataaaat</td><td>gctgctgccg</td><td>cccaaagcca</td><td>aggggactgt</td><td>cacatacgtc</td><td> 360</td>

<td>gccgatcccg</td><td>gaaattacac</td><td>agtcgatgaa</td><td>gtcgtcttgg</td><td>agacggaatt</td><td>cgacggcgag</td><td> 420</td>

<td>aggaccaaat</td><td>acaccatgtt</td><td>gcaagtgtgg</td><td>cctgtgcgtc</td><td>agccccgccc</td><td>tgtcagcgag</td><td> 480</td>

<td>aaattgccag</td><td>ccaatcaccc</td><td>cctattaact</td><td>ggtcaacgcg</td><td>tactcgactc</td><td>acttttcccg</td><td> 540</td>

<td>tgcgtccaag</td><td>ggggtaccac</td><td>cgccattccc</td><td>ggagctttcg</td><td>gttgtggtaa</td><td>gaccgtaatc</td><td> 600</td>

<td>tcgcaatctc</td><td>tctccaaata</td><td>ttccaactct</td><td>gacgttatca</td><td>tttgcgtcgg</td><td>ttgcggggag</td><td> 660</td>

<td>cgtggtaacg</td><td>aaatgtctga</td><td>agtattgcgg</td><td>gacttccccg</td><td>aactgacagt</td><td>cgaaatcgaa</td><td> 720</td>

<td>ggccaaacag</td><td>agtctatcat</td><td>gaaacgtacc</td><td>gctcttgtcg</td><td>ccaacacctc</td><td>taacatgcct</td><td> 780</td>

<td>gtagccgccc</td><td>gtgaggcttc</td><td>aatttacacc</td><td>ggtattacac</td><td>tgtctgagta</td><td>tttccgtgat</td><td> 840</td>

<td>atgggttaca</td><td>aćgtgtcgat</td><td>gatggccgat</td><td>tccacctcgc</td><td>gttgggccga</td><td>agctttgaga</td><td> 900</td>

<td>gaaatttccg</td><td>gtcgtttagc</td><td>tgaaatgccc</td><td>gccgattctg</td><td>ggtaccccgc</td><td>gtatttgggg</td><td> 960</td>

<td>gcccgtttgg</td><td>cttcgtttta</td><td>cgagcgtgca</td><td>gggcgtgtta</td><td>aatgcttggg</td><td>taaccctgat</td><td> 1020</td>

<td>cgtgaaggtt</td><td>ccgtttctat</td><td>tgtcggggcc</td><td>gtatcgcccc</td><td>ctggtggtga</td><td>tttctctgat</td><td> 1080</td>

<td>cccgtcacct</td><td>cagctacctt</td><td>gggtatcgta</td><td>caggtgttct</td><td>GGGG</td><td></td><td> 1125</td>

&lt;210&gt; 151 10 &lt;211&gt; 2860 &lt;213&gt; DNA &lt;213&gt; manduca sexta &lt;400&gt; 151 ggttcgtctccccatcttt ctcgtctccccggcggaggcggcggcgg

120

180

284

<td>ggtgcgcgtc</td><td>ggttacaacg</td><td>agctggtggg</td><td>agaaatcatc</td><td>cgtcttgagg</td><td>gtgacatggc</td><td> 240</td>

<td>caccatccag</td><td>gtatacgagg</td><td>agacctcagg</td><td>cgtcacagtc</td><td>ggtgaccctg</td><td>tgctgcgtac</td><td> 300</td>

<td>cggcaagccc</td><td>ttgtccgtgg</td><td>aactcggccc</td><td>cggtatcctg</td><td>ggctccatct</td><td>ttgacggtat</td><td> 360</td>

<td>ccagcgtcca</td><td>ctgaaggaca</td><td>tcaacgagct</td><td>cacacaatcc</td><td>atctacatcc</td><td>ccaagggtgt</td><td> 420</td>

<td>gaacgtgccc</td><td>tcgctcgcca</td><td>gggaggttga</td><td>ctgggaattc</td><td>aaccccctca</td><td>atgttaaggt</td><td> 480</td>

<td>cggctcccac</td><td>atcaccggcg</td><td>gagacctgta</td><td>cggtatcgtg</td><td>cacgagaaca</td><td>cgctcgtgaa</td><td> 540</td>

<td>gcacaagatg</td><td>ttgatgccgc</td><td>cgcgcgccaa</td><td>gggtaccgtc</td><td>acctacatcg</td><td>cgcccgccgg</td><td> 600</td>

<td>caactacaaa</td><td>gtcactgatg</td><td>tagtgttgga</td><td>gacagagttc</td><td>gacggcgaga</td><td>aggcgcagta</td><td> 660</td>

<td>cacgatgttg</td><td>caggtgtggc</td><td>ccgtgcgtca</td><td>gccccgtccc</td><td>gtcaccgaga</td><td>agctccccgc</td><td> 720</td>

<td>caaccacccg</td><td>ctgctcactg</td><td>gacagagagt</td><td>actcgactcc</td><td>ctcttcccct</td><td>gtgtccaggg</td><td> 780</td>

<td>cggtaccact</td><td>gccatccccg</td><td>gagccttcgg</td><td>ttgcggcaaa</td><td>actgtcatct</td><td>cacaggcgct</td><td> 340</td>

<td>gtccaagtac</td><td>tccaactctg</td><td>acgtcatcat</td><td>ctacgtcggt</td><td>tgcggagagc</td><td>gtggtaacga</td><td> 900</td>

<td>gatgtctgag</td><td>gtactgcgtg</td><td>acttccctga</td><td>gctgacggtg</td><td>gagatcgagg</td><td>gtgtgacgga</td><td> 960</td>

<td>gtccatcatg</td><td>aagcgtaccg</td><td>ccctcgtcgc</td><td>caacacatcc</td><td>aacatgcctg</td><td>tcgctgcccg</td><td> 1020</td>

<td>tgaggcttcc</td><td>atctacacag</td><td>gaatcaccct</td><td>ttccgagtac</td><td>ttccgtgaca</td><td>tgggttacaa</td><td> 1080</td>

<td>tgtgtccatg</td><td>atggctgact</td><td>cgacctcccg</td><td>ttgggccgag</td><td>gctcttcgtg</td><td>agatctcagg</td><td> 1140</td>

<td>tcgtctagct</td><td>gagatgcctg</td><td>ccgattccgg</td><td>ttaccctgcg</td><td>tacctgggag</td><td>cccgtctggc</td><td> 1200</td>

<td>ctccttctac</td><td>gagcgtgccg</td><td>gtagagtcaa</td><td>gtgtctcgga</td><td>aaccctgaca</td><td>gggaaggttc</td><td> 1260</td>

<td>ggtgtccatc</td><td>gtgggtgccg</td><td>tgtcgccgcc</td><td>cggaggtgac</td><td>ttctcggacc</td><td>ccgtgacggc</td><td> 1320</td>

<td>ggccacgctg</td><td>ggtatcgtgc</td><td>aggtgttctg</td><td>gggtctcgac</td><td>aagaaactcg</td><td>egcagaggaa</td><td> 1380</td>

<td>gcacttcccc</td><td>tccatcaact</td><td>ggcttatctc</td><td>ttacagcaag</td><td>tacatgcgtg</td><td>ctttggatga</td><td> 1440</td>

<td>cttttatgag</td><td>aagaactacc</td><td>ccgaattcgt</td><td>gccccttagg</td><td>actaaggtca</td><td>aggagatcct</td><td> 1500</td>

<td>gcaggaggaa</td><td>gaggacctgt</td><td>cagaaatcgt</td><td>gcagttggtc</td><td>ggtaaagcct</td><td>cgctcgccga</td><td> 1560</td>

<td>gactgacaag</td><td>atcaccctcg</td><td>aggtcgccaa</td><td>actgcttaaa</td><td>gacgacttct</td><td>tgcaacagaa</td><td> 1620</td>

<td>cagctactcg</td><td>tcatacgatc</td><td>gattctgtcc</td><td>gttctacaag</td><td>accgtgggca</td><td>tgcttaagaa</td><td> 1680</td>

<td>catcatctcg</td><td>ttctacgaca</td><td>tgtcgcggca</td><td>cgcggtggag</td><td>tccacggccc</td><td>agtccgacaa</td><td> 1740</td>

<td>caaggtcacg</td><td>tggaacgtga</td><td>tccgcgacgc</td><td>catgggcaac.</td><td>gtactctacc</td><td>aactctcctc</td><td> 1800</td>

<td>catgaagttc</td><td>aaggacccag</td><td>tgaaagacgg</td><td>cgaggccaag</td><td>atcaaggcag</td><td>atttcgacca</td><td> 1860</td>

<td>gctgttggag</td><td>gatatgtccg</td><td>ccgccttccg</td><td>taacctcgag</td><td>gactaagcac</td><td>agccgtacta</td><td> 1920</td>

<td>cagtacagta</td><td>cagtagggag</td><td>cgcccacgag</td><td>ccgcgccgcg</td><td>acatcctccg</td><td>cagccgagag</td><td> 1980</td>

<td>gacatcttta</td><td>tcgacttgtt</td><td>ttcatgttgt</td><td>catttttatt</td><td>ataatttatt</td><td>gattaatatg</td><td> 2040</td>

<td>aggatatatt</td><td>ttttcgtatt</td><td>ctattcacgt</td><td>ccggagcgtt</td><td>ttgagacagt</td><td>tttttcgagt</td><td> 2100</td>

<td>ctggagtgtt</td><td>ttgcatttta</td><td>tcgatattat</td><td>cgagtgtcgg</td><td>gcgtcgttaa</td><td>ggcggtgctg</td><td> 2160</td>

<td>ttagcgaggt</td><td>atgcgttatg</td><td>acacacgcat</td><td>atatcgtaat</td><td>aacagcgttg</td><td>tttaaacggg</td><td> 2220</td>

<td>tctgtgcgca</td><td>ggcgcagttc</td><td>gtgggcggtc</td><td>gtgttgttat</td><td>agtaattatg</td><td>tagtgttaaa</td><td> 2280</td>

285

<td>tatattacaa catcgattcc agaggatggt gtcgcgggct agaactccga cagcgcgaaa gcctacaaag ggcgtggctt gtaaacggca caataaggcc gactaacaat tctccgttat</td><td> 2340 2400</td>

<td>ttgaaatagc agttcaaaca cagtcgtcac agtggcggta gtccgaatgt ttggacctgg</td><td> 24 60</td>

<td>gttggtgttt ataaagttcg cccaatctat tgtaaatata taacaggttc gctgttctag</td><td> 2520</td>

<td>cccgcgggcc gttacggcgt ttagttgttt tatgaaatct atttatgtac tatatcgatc</td><td> 2580</td>

<td>ggtaaaccgt gatttataat caaatatcct cttgcattcc acgttgttgt tagaaatata</td><td> 2640</td>

<td>gaattcaaaa cgtttgttgt tttcgagagc tttttacgct taatatggat gttcattcag</td><td> 2700</td>

<td>tattaatata atvcgtacga gtacgcagta acaatagtca gcactaatat gtctactcgc</td><td> 2760</td>

<td>tgtttgaaat tctgtgacgt tacgtgttga gaaattatta taaaaaaaaa taaaatattg</td><td> 2820</td>

<td>taaacaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa</td><td> 2860</td>

&lt;210&gt; 152 &lt;211&gt; 3097 &lt;212&gt; DNA &lt;213&gt; Aedes aegypti &lt;400&gt; 152

<td>caggttggcc</td><td>agtctttcag</td><td>tcagtcagtc</td><td>ttgtgatacc</td><td>attttgcttc</td><td>gctcggtgtg</td><td> 60</td>

<td>tggagtttgc</td><td>atttttccca</td><td>tcccatctct</td><td>ctcgacaact</td><td>gcagcaccta</td><td>agagcagaag</td><td> 120</td>

<td>gaagcagagc</td><td>aggaggaacg</td><td>gatcgtaaca</td><td>atgtccaccc</td><td>tgaagaagat</td><td>ctccgatgag</td><td> 180</td>

<td>gaccgcgagt</td><td>ccaaattcgg</td><td>atatgtgttc</td><td>gccgtatccg</td><td>gtcctgtcgt</td><td>cacggccgag</td><td> 240</td>

<td>cggatgtccg</td><td>gttcggctat</td><td>gtacgagttg</td><td>gtccgcgtcg</td><td>gttactacga</td><td>gctggtcggt</td><td> 300</td>

<td>gagatcatcc</td><td>gtttggaagg</td><td>tgacatggcc</td><td>accatccagg</td><td>tatacgagga</td><td>aacctccggt</td><td> 360</td>

<td>gtcaccgtcg</td><td>gcgatcccgt</td><td>gctgcgtacc</td><td>ggcaagcccc</td><td>tctccgtcga</td><td>actcggtcca</td><td> 420</td>

<td>ggtattatgg</td><td>gtagcatctt</td><td>tgacggtatc</td><td>cagcgtccac</td><td>tgaaggacat</td><td>taacgaactg</td><td> 480</td>

<td>accagctcga</td><td>tctacatccc</td><td>cgaagggtgt</td><td>gaacattccc</td><td>tgcttgtccc</td><td>gtacaggagg</td><td> 540</td>

<td>ctggggattc</td><td>aaccccttga</td><td>acgtaaaggg</td><td>ttgggctctc</td><td>acatcaccgg</td><td>aagagatctg</td><td> 600</td>

<td>tacggtttgg</td><td>tgcacgagaa</td><td>taccctggtc</td><td>aagcacaagc</td><td>tgttggtccc</td><td>gccacgcgcc</td><td> 660</td>

<td>aagggtacag</td><td>ttcgttacat</td><td>tgctccaccc</td><td>ggaaattaca</td><td>ccgtcgacga</td><td>catcattctg</td><td> 720</td>

<td>gagacggaat</td><td>tcgacggtga</td><td>gatcaacaag</td><td>tggtctatgt</td><td>tgcaggtgtg</td><td>gcccgtgcgt</td><td> 780</td>

<td>cagccacgtc</td><td>cagtgactga</td><td>gaagttgccc</td><td>gccaatcatc</td><td>ctctgctgac</td><td>tggtcagcgt</td><td> 840</td>

<td>gtgttggatt</td><td>cgctgttccc</td><td>ttgtgtccag</td><td>ggtggtacea</td><td>ctgccatccc</td><td>cggagctttc</td><td> 900</td>

<td>ggttgcggta</td><td>agactgtcat</td><td>ctcgcaggcc</td><td>ctgtccaagt</td><td>actccaactc</td><td>cgatgtcatt</td><td> 960</td>

<td>atctacgtcg</td><td>gttgcggaga</td><td>acgtggtaac</td><td>gaaatgtctg</td><td>aagtattgcg</td><td>tgatttccct</td><td> 1020</td>

<td>gagctgtcgg</td><td>ttgagattga</td><td>cggtgttacg</td><td>gagtccatca</td><td>tgaagcgtac</td><td>cgcgctggtt</td><td> 1080</td>

<td>gccaacacct</td><td>ccaacatgcc</td><td>tgtcgctgct</td><td>cgtgaagctt</td><td>ccatctacac</td><td>cggtattacc</td><td> 1140</td>

<td>ttgtccgagt</td><td>acttccgtga</td><td>tatgggttac</td><td>aacgtatcca</td><td>tgatggctga</td><td>ctcgacctct</td><td> 1200</td>

<td>cgttgggccg</td><td>aagctcttcg</td><td>agaaatttcc</td><td>ggtcgtctgg</td><td>ctgagatgcc</td><td>tgccgattcc</td><td> 1260</td>

<td>ggttatcctg</td><td>cctaectggg</td><td>tgcacgtttg</td><td>gcctccttct</td><td>acgagcgtgc</td><td>cggtcgtgtc</td><td> 1320</td>

286

<td>aagtgtctcg</td><td>gtaaccctga</td><td>acgtgaaggt</td><td>tcggtgtcca</td><td>tcgtcggtgc</td><td>cgtatcgccc</td><td> 1330</td>

<td>cctggtggtg</td><td>atttctccga</td><td>tcccgtcaca</td><td>tccgccaccc</td><td>tcggtatcgt</td><td>acaggtgttc</td><td> 1440</td>

<td>tggggtctgg</td><td>acaagaaact</td><td>ggcccagcgt</td><td>aagcatttcc</td><td>cctcgatcaa</td><td>ctggttgatc</td><td> 1500</td>

<td>tcctacagca</td><td>agtacatgcg</td><td>cgcccttgat</td><td>gacttctacg</td><td>ataagaactt</td><td>ccaggagttt</td><td> 1560</td>

<td>gtacccactg</td><td>cgtacaaggt</td><td>taaggagatc</td><td>ctgcaggagg</td><td>aagaagattt</td><td>gtccgaaatt</td><td> 1620</td>

<td>gtgcagctgg</td><td>tcggtaaggc</td><td>atcgctggca</td><td>gaaaccgata</td><td>agatcaccct</td><td>tgaggtagcc</td><td> 1630</td>

<td>aagctgctca</td><td>aggatgattt</td><td>cctgcagcag</td><td>aactcgtact</td><td>cggcgtacga</td><td>tcgattctgt</td><td> 1740</td>

<td>ccgttctaca</td><td>agacggtcgg</td><td>tcgtatgctg</td><td>cgaaacatga</td><td>tcggattcta</td><td>cgatatggct</td><td> 1800</td>

<td>cgccacgccg</td><td>tcgaaaccac</td><td>cgcccagtcg</td><td>gagaacaaga</td><td>tcacctggaa</td><td>cgtgatccgt</td><td> 1860</td>

<td>gactcgatgg</td><td>gcaacatcct</td><td>gtaccagctg</td><td>tcgtcgatga</td><td>agttcaagga</td><td>cccgggaagg</td><td> ' 1920</td>

<td>atggcgaaga</td><td>agatcaaggc</td><td>cgatttcgac</td><td>caactgtacg</td><td>aagacctgca</td><td>gcaggcgttc</td><td> 1980</td>

<td>cgcaacctgg</td><td>aagattaaat</td><td>tctcccgcac</td><td>attcgtggtc</td><td>tcttcaatgc</td><td>gaaattcttg</td><td> 2040</td>

<td>aacagtttat</td><td>tgtttcagta</td><td>acatagcaaa</td><td>gaaatgttcg</td><td>tagcatagtg</td><td>caaacaaaac</td><td> 2100</td>

<td>atcaaaatga</td><td>gaaacacgaa</td><td>acacagcaaa</td><td>agtgtagggc</td><td>cctccttggc</td><td>atcatgataa</td><td> 2160</td>

<td>accaacaaca</td><td>· tccattaagt</td><td>aaaatgcttc</td><td>taggtcacca</td><td>ttttacaggc</td><td>gtatttaggt</td><td> 2220</td>

<td>ttaaacattt</td><td>atttacacaa</td><td>attattgcaa</td><td>gaaaaagatt</td><td>aagagaacaa</td><td>atctataaag</td><td> 2280</td>

<td>cgagtgtaac</td><td>atatacattt</td><td>agaaacggcg</td><td>aaacactaca</td><td>acaactacag</td><td>aaccacacgg</td><td> 2340</td>

<td>cagaacagaa</td><td>acaaatttta</td><td>gtaggtaagt</td><td>gatattgcaa</td><td>gtgttgtccg</td><td>acggcgtagg</td><td> 2400</td>

<td>aaaaggttag</td><td>cgaacggaat</td><td>aacgttcaat</td><td>cggaaattgt</td><td>cttcgaaagt</td><td>ttccgcttgc</td><td> 2460</td>

<td>atgcgtgtct</td><td>caaatgcgaa</td><td>taaaacgtat</td><td>aaacaatcgt</td><td>ggtgaaactt</td><td>aacatcagtg</td><td> 2520</td>

<td>atgatataat</td><td>caaaggggat</td><td>taaaatgaaa</td><td>cacgtggaca</td><td>aaagatctat</td><td>aaagaaaaac</td><td> 2580</td>

<td>tctcagctag</td><td>aatagttcaa</td><td>gacgtggcga</td><td>agcgtatcat</td><td>aaatagaata</td><td>atatgtaaac</td><td> 2640</td>

<td>cacggttaat</td><td>gggaaaataa</td><td>gaagaaactt</td><td>tcgattgagt</td><td>atgttataga</td><td>aacttatcca</td><td> 2700</td>

<td>tgtatgatgt</td><td>ataaatcgct</td><td>aattaatcgt</td><td>ataagaaata</td><td>acagaacaag</td><td>ttttattata</td><td> 2760</td>

<td>ggtgtaagcc</td><td>aatcaagttg</td><td>ttatatcagt</td><td>ttaaatatta</td><td>tttagtgaat</td><td>atagttttac</td><td> 2820</td>

<td>ttttaatttt</td><td>gtagtgtcgt</td><td>ttttccatcg</td><td>gtaggatcgg</td><td>aaacgagaat</td><td>cgatgattga</td><td> 2880</td>

<td>ttgactgttg</td><td>acaaatgaaa</td><td>tgaaagttaa</td><td>atttattatg</td><td>cttttttgtt</td><td>tgtgtgaaca</td><td> 2940</td>

<td>gaattgaaga</td><td>gccgccgcgt</td><td>cgtttcggtc</td><td>aatgcaagcg</td><td>accgacggct</td><td>cgtatctgtc</td><td> 3000</td>

<td>ctgtacattt</td><td>ttgtcgatga</td><td>gcagaaaata</td><td>tatgagaata</td><td>aaaccctcta</td><td>aaaaattgca</td><td> 3060</td>

<td>ttccgcgtaa</td><td>aaaaaaaaaa</td><td>aaaaaaaaaa</td><td>aaaaaaa</td><td></td><td></td><td> 3097</td>

&lt;210&gt; 153 &lt;211&gt; 2533 &lt;212&gt; DNA &lt;213&gt; Drosophila melanogaster &lt;400&gt; 153 cgaaaacacg cacacagact gcaagtgtgt tagataataa gtgcagcaca agtccacact 60

287

<td>tgagtaaaat</td><td>aatccctaaa</td><td>aaagccgaat</td><td>atcaattagt</td><td>tttccaagga</td><td>gcttgaaaaa</td><td> 120</td>

<td>gtgcgtcgaa</td><td>aaaacagaat</td><td>aaagcaaaat</td><td>gtccaacctt</td><td>aagcgtttcg</td><td>atgatgagga</td><td> 180</td>

<td>gcgtgagtcc</td><td>aaatatggac</td><td>gtgtcttcgc</td><td>tgtctccggt</td><td>cctgtcgtca</td><td>ccgccgaggc</td><td> 240</td>

<td>catgtctgga</td><td>tcagctatgt</td><td>acgagttggt</td><td>ccgcgtcggc</td><td>taetacgagc</td><td>tggtgggcga</td><td> 300</td>

<td>gatcatęcgt</td><td>ctggagggtg</td><td>acatggccac</td><td>catccaggtg</td><td>tacgaggaga</td><td>cctctggcgt</td><td> 360</td>

<td>aactgtcgga</td><td>gatccggtgc</td><td>tgcgtaccgg</td><td>caagcctctt</td><td>tccgtggagc</td><td>tgggacccgg</td><td> 420</td>

<td>tatcatgggc</td><td>agcatctttg</td><td>acggtatcca</td><td>gcgtcccctg</td><td>aaggacatta</td><td>acgagctgac</td><td>4S0</td>

<td>cgaatccatc</td><td>tacatcccca</td><td>agggtgtgaa</td><td>cgtgcccagt</td><td>ttgtcccgcg</td><td>tggccagctg</td><td> 540</td>

<td>ggagttcaac</td><td>cccctgaacg</td><td>tcaaggtcgg</td><td>ctcccacatc</td><td>accggaggtg</td><td>acctgtacgg</td><td> 600</td>

<td>tctggtgcat</td><td>gagaacactc</td><td>tggtcaagca</td><td>caagatgatt</td><td>gtgaaccccc</td><td>gcgccaaggg</td><td> 660</td>

<td>aacagtgcgc</td><td>tacatcgccc</td><td>cctccggcaa</td><td>ctacaaggtc</td><td>gacgatgtcg</td><td>tcctggagac</td><td> 720</td>

<td>cgagttcgat</td><td>ggagagatca</td><td>ccaagcacac</td><td>catgttgcag</td><td>gtgtggccag</td><td>tgcgtcagcc</td><td> 780</td>

<td>acgtcccgtg</td><td>accgagaagc</td><td>tgcccgccaa</td><td>ccaccccctg</td><td>ctcaccggac</td><td>agcgtgtgct</td><td> 840</td>

<td>cgactcgctc</td><td>ttcccctgtg</td><td>tccagggcgg</td><td>taccaccgcc</td><td>attcccggag</td><td>ctttcggttg</td><td> 900</td>

<td>cggcaagact</td><td>gtgatctcgc</td><td>aggctctgtc</td><td>caagtactcc</td><td>aactccgatg</td><td>tcatcatcta</td><td> 960</td>

<td>cgtcggttgc</td><td>ggtgagcgtg</td><td>gtaacgagat</td><td>gtctgaggta</td><td>ctgcgtgact</td><td>tccccgagct</td><td> 1020</td>

<td>gtccgtggag</td><td>atcgacggtg</td><td>tcaccgagtc</td><td>catcatgaag</td><td>cgtaccgccc</td><td>ttgtggccaa</td><td> 1080</td>

<td>cacctccaac</td><td>atgcctgtgg</td><td>ctgctcgtga</td><td>ggcctccatc</td><td>tacactggta</td><td>tcaccttgtc</td><td> 1140</td>

<td>cgaatacttc</td><td>cgtgatatgg</td><td>gttacaacgt</td><td>gtccatgatg</td><td>gctgattcca</td><td>cctcccgttg</td><td> 1200</td>

<td>ggctgaggct</td><td>cttcgtgaaa</td><td>tttctggtcg</td><td>tctcgctgag</td><td>atgcctgccg</td><td>attccggcta</td><td> 12 60</td>

<td>cccagcctac</td><td>ttgggagccc</td><td>gtctggcctc</td><td>cttctacgag</td><td>cgtgccggtc</td><td>gcgttaagtg</td><td> 1320</td>

<td>cttgggtaac</td><td>cccgagcgcg</td><td>agggatccgt</td><td>gtccattgtc</td><td>ggagctgtgt</td><td>ctcctcctgg</td><td> 1380</td>

<td>tggtgacttc</td><td>tccgatcccg</td><td>tgacctccgc</td><td>cactctgggt</td><td>atcgtgcagg</td><td>tgttctgggg</td><td> 1440</td>

<td>tctcgacaag</td><td>aagttggccc</td><td>agcgcaagca</td><td>cttcccctcg</td><td>atcaactggc</td><td>tcatctccta</td><td> 1500</td>

<td>ctcgaagtac</td><td>atgcgtgctc</td><td>tggatgactt</td><td>ctatgacaag</td><td>aacttccccg</td><td>aattcgtgcc</td><td> 15 60</td>

<td>gctgcgtacc</td><td>aaggtcaagg</td><td>agatcctgca</td><td>ggaggaggag</td><td>gatctgtctg</td><td>agatcgtgca</td><td> 1620</td>

<td>actggtcggc</td><td>aaggcctctc</td><td>tggccgaaac</td><td>cgacaagatc</td><td>acgctggagg</td><td>tggccaagct</td><td> 1680</td>

<td>gctgaaggac</td><td>gatttcctgc</td><td>agcagaactc</td><td>ctactcctcg</td><td>tacgatcgct</td><td>tctgcccctt</td><td> 1740</td>

<td>ctacaagacc</td><td>gtgggcatgt</td><td>tgaggaacat</td><td>catcgacttc</td><td>tacgacatgg</td><td>cccgtcactc</td><td> 1800</td>

<td>cgtggagtct</td><td>acggctcagt</td><td>ctgagaacaa</td><td>gątcacctgg</td><td>aacgtgattc</td><td>gtgaggcaat</td><td> 18 60</td>

<td>gggcaacatt</td><td>atgtaccagc</td><td>tgtcatccat</td><td>gaagttcaag</td><td>gaccccgtta</td><td>aggatggtga</td><td> 1920</td>

<td>ggccaagatc</td><td>aaggctgact</td><td>tcgagcagct</td><td>gcacgaggac</td><td>ctgcagcagg</td><td>ccttcagaaa</td><td> 1980</td>

<td>tctggaggac</td><td>tagagaccgc</td><td>gctggcccta</td><td>cttttacact</td><td>ctaatcttat</td><td>atttgttata</td><td> 2040</td>

<td>tagttaacgt</td><td>ttaaaaatga</td><td>aagcagtcaa</td><td>aaaccatccg</td><td>aaaaagccta</td><td>atcaaacacc</td><td> 2100</td>

<td>aacaattccg</td><td>tgctgcattc</td><td>gatgaaaaac</td><td>aaąagtccaa</td><td>caaataccac</td><td>aacttcttgg</td><td> 2160</td>

288

<td>tgcctgcgag</td><td colspan="2">agatgtaaac attccggcct</td><td>gcggttaata</td><td>ctttccccta</td><td>accacgcccc</td><td> 2220</td>

<td>ctccgcccct</td><td>tgaagggcaa</td><td>ctctaggcaa</td><td>cagcaactac</td><td>aacgtcctgc</td><td>tatgtacttc</td><td> 2280</td>

<td>catttacaac</td><td>aacaacacca</td><td>acatacactt</td><td>gaataaaagt</td><td>acacggacac</td><td>tggcgcacac</td><td> 2340</td>

<td>acaacacata</td><td>cataaaagac</td><td>acaaatacaa</td><td>atgcatgcat</td><td>aaatagtatt</td><td>attgtttaat</td><td> 2400</td>

<td>gaatggaaat</td><td>tcttgtttat</td><td>ttgtgaaaaa</td><td>agtcatgttt</td><td>tctccctgtt</td><td>tgtttgttaa</td><td> 2460</td>

<td>atttatgtaa</td><td>atatttaaag</td><td>tatgaaatat</td><td>taaatgtacg</td><td>aataaagtgc</td><td>aacaaeaaat</td><td> 2520</td>

<td>acatttaatg</td><td>taa</td><td></td><td></td><td></td><td></td><td> 2533</td>

&lt;210&gt; 154 &lt;211&gt; 603 &lt;212&gt; DNA &lt;213&gt; Bombyx mori

<td colspan="7"> &lt;400&gt; 154</td>

<td>atgagttccc</td><td>tcaagctgca</td><td>gaagaggctt</td><td>gcagcctctg</td><td>ttatgcgatg</td><td>tggtaaaaag</td><td> 60</td>

<td>aaggtgtggt</td><td>tggatccaaa</td><td>tgaaatcaat</td><td>gagatcgcaa</td><td>acaccaactc</td><td>cagacagaac</td><td> 120</td>

<td>atccgtaaga</td><td>tgatcaagga</td><td>tggtętcgtc</td><td>atcaagaaac</td><td>ctgtagcagt</td><td>acactcccgc</td><td> 180</td>

<td>gctcgtgtcc</td><td>gcaaaaacac</td><td>agaagcacgt</td><td>agaaagggtc</td><td>gtcactgtgg</td><td>ctttggtaag</td><td> 240</td>

<td>agaagaggta</td><td>cagccaatgc</td><td>gcgtatgcca</td><td>cagaaggaac</td><td>tatgggtaca</td><td>aagacaaagg</td><td> 300</td>

<td>gttttaagaa</td><td>aattgctcct</td><td>gaagtacaga</td><td>actgccaaga</td><td>agattgacag</td><td>gcatctatac</td><td> 360</td>

<td>cactcactct</td><td>acatgaaggc</td><td>gaagggtaat</td><td>gtgttcaaga</td><td>acaagcgtgt</td><td>gctcatggag</td><td> 420</td>

<td>tacatccaca</td><td>ggaagaaggc</td><td>tgagaaggcc</td><td>aggacgaaga</td><td>tgcttagcga</td><td>ccaggctgag</td><td> 480</td>

<td>gcccgccgca</td><td>ataaagtgaa</td><td>ggaggcacgc</td><td>aagcgccgcg</td><td>aggaacgtat</td><td>tgccgccaag</td><td> 540</td>

<td>aaggaggaac</td><td>tgctgcagac</td><td>cttcgctaga</td><td>gaagacgaag</td><td>ccgcgcttac</td><td>cgctaagaag</td><td> 600</td>

taa 603 &lt;210&gt; 155 &lt;211&gt; 612 &lt;212&gt; DNA &lt;213&gt; Drosophila melanogaster &lt;400&gt; 155 atgagttctc aaggtctggt attcgcaagc taccgtgtgc cgtaagggta ttctgccgcc cacgacctgt tacatccaca gctcgccgac aagcaggagc gcgggtcact taaagctcca tggatcccaa ttatcaagga gcaaaaacac ctgcgaacgc gcctgttgaą acatgaagtg agaagaaggc agaaggtgcg tcatcgccct aa 'gaagaggctc tgaaatcaac tggtctgatc cgaggcccgc ccgcatgcct gaagtaccgc caagggtaac tgagaagcag tgaggcccgc gcatgctaag gcagcctccg gagatcgcta atcaagaagc cgcaaggacc accaagctgc gacagcaaga gtgttcaaga cgcagcaaga aagcgccgcg gaggacgaga tgctgcgatg acacaaactc ccgtcgtggt gtcactgcgg tgtggatgca agattgacag acaagcgcgt tgctggctga aggagcgtat tcgctgccaa cggcaagaag gcgtcagaac ccactcccgt attcggaaag gcgccagccg gcacctgtac cctcatggag tcaggccgag tgccaccaag ggccgccacc

120

180

240

300

360

420

480

540

600

612

289 &lt;210&gt; 156 &lt;211&gt; 567 &lt;212&gt; DNA &lt;213&gt; Anopheles gambiae 5 &lt;400&gt; 156

<td>atgcgatgcg</td><td>gcaagaagaa</td><td>ggtgtggttg</td><td>gatcctaatg</td><td>aaatcaacga</td><td>gattggaaac</td><td> 60</td>

<td>accaactcgc</td><td>gacaaaacat</td><td>tcgcaaactg</td><td>atcaaggatg</td><td>gtctgatcat</td><td>caagaagccg</td><td> 120</td>

<td>gtggtggtcc</td><td>actcgcgtta</td><td>ccgtgtgcgc</td><td>aaaaacacga</td><td>tcgctcgccg</td><td>caagggtcgc</td><td> 190</td>

<td>cactgcggtt</td><td>atggtaagcg</td><td>aaagggtacg</td><td>gccaatgccc</td><td>gtatgcccca</td><td>gaagctgctc</td><td> 240</td>

<td>tggatgaacc</td><td>gtatgcgtgt.</td><td>gctgcgtcgt</td><td>ctgctgaaga</td><td>agtaccgtga</td><td>ggcgaagaaa</td><td> 300</td>

<td>atcgaccgtc</td><td>acctgtacca</td><td>cgacctgtac</td><td>atgcgtgcga</td><td>agggtaacgt</td><td>gttcaagaac</td><td> 360</td>

<td>aagcgtatcc</td><td>tgatcgagca</td><td>catccacaag</td><td>aggaaggcgg</td><td>agaaggcccg</td><td>ctccaagatg</td><td> 420</td>

<td>ctgagcgatc</td><td>aggccgaagc</td><td>caagcgtacc</td><td>aaggttcgtg</td><td>aggcccgtcg</td><td>tcgtcgcgag</td><td> 480</td>

<td>gaacgtattg</td><td>ccaccaagcg</td><td>ccaggagctt</td><td>ctgcagacga</td><td>tcgctaagga</td><td>agaggagacc</td><td> 540</td>

<td>gcgcagcatg</td><td>ttgccgctac</td><td>tggaaag</td><td></td><td></td><td></td><td> 567</td>

&lt;210&gt; 157 &lt;211&gt; 652 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 157

<td>cacgttgaga</td><td>ggtgcatttg</td><td>cacgatgagt</td><td>tccttaaaac</td><td>ttcagaagag</td><td>gctagcagcc</td><td> 60</td>

<td>tctgttatgc</td><td>gatgtggtaa</td><td>aaagaaagta</td><td>tggttggacc</td><td>ctaatgaaat</td><td>caacgaaatt</td><td> 120</td>

<td>gccaacacta</td><td>actcaagaca</td><td>gaacatccgt</td><td>aagttgataa</td><td>aggatggtct</td><td>tattattaag</td><td>Iao</td>

<td>aagcćcgtag</td><td>ctgtacattc</td><td>ccgtgcccgt</td><td>gttcgcaaaa</td><td>acactgaagc</td><td>ccgcaggaaa</td><td> 240</td>

<td>ggaaggcact</td><td>gcggttttgg</td><td>taaaaggaag</td><td>ggtactgcta</td><td>atgcccgtac</td><td>cccgcaaaag</td><td> 300</td>

<td>gaattatgga</td><td>ttcaacgcat</td><td>gagagttttg</td><td>cgtcgtctcc</td><td>ttaaaaaata</td><td>cagggaagct</td><td> 360</td>

<td>aaaaaaattg</td><td>acagacatct</td><td>ataccactca</td><td>ctctacatga</td><td>aggccaaggg</td><td>taacgtattc</td><td> 420</td>

<td>aagaacaagc</td><td>gtgtccttat</td><td>ggaatacatc</td><td>cacaagaaga</td><td>aggcagagaa</td><td>agcccgtgcc</td><td> 480</td>

<td>aagatgttgg</td><td>cagaccaggc</td><td>caatgccaga</td><td>aggatgaagg</td><td>taaaacaggc</td><td>tagagaaaga</td><td> 540</td>

<td>cgtgaggaac</td><td>gtatcgccac</td><td>aaagaaacaa</td><td>gaagttttgc</td><td>agaactacat</td><td>gagggaggat</td><td> 600</td>

<td>gaagctgcgg</td><td>ccactaagaa</td><td>ataagttaat</td><td>tgttttataa</td><td>gatgactata</td><td>tt</td><td> 652</td>

&lt;210&gt; 158 &lt;211&gt; 402 &lt;212&gt; DNA &lt;213&gt; Anthonomus grandis &lt;400&gt; 158 tgagatgtgg taagaagaag gtatggttgg accctaatga aattaacgag attgccaaca ccaactcgag gcaaaacatg cgtaaattga tcaaggatgg tttgatcatt aagaaaccga

180

290 actgcggttt ggatccaaag tcgacaggca agagagtgtt cggtaagagg gatgcgtgtc tctgtaccac gatggaatac aaaggtacag ttgaggcgtc gccctgtaca atccacaaga cgaacgctcg tcctgaaaaa tgaaggccataggaagga

240

300

360

402 &lt;210&gt; 159 &lt;211&gt; 403 &lt;212&gt; DNA &lt;213&gt; Tribolium castaneum &lt;400&gt; 159

<td>tgagatgcgg</td><td>taagaagaag</td><td>gtatggttag</td><td>atccgaacga</td><td>aatcaacgag</td><td>atcgccaaca</td><td> 60</td>

<td>cgaattcacg</td><td>ccagaacatc</td><td>cgcaaattga</td><td>tcaaagatgg</td><td>tctcatcatc-</td><td>aaaaagcccg</td><td> 120</td>

<td>tcgctgtgca</td><td>ctccagagcc</td><td>cgcgtccgca</td><td>agaacacgga</td><td>ggcccgeagg</td><td>aagggacgcc</td><td> 180</td>

<td>attgcggctt</td><td>cggcaagagg</td><td>aaaggtacag</td><td>ccaatgcgcg</td><td>tatgccccag</td><td>aaggagctct</td><td> 240</td>

<td>ggatacagag</td><td>gatgcgggtc</td><td>ttgaggaggc</td><td>tcctcaagaa</td><td>gtatcgcgag</td><td>gccaaaaaga</td><td> 300</td>

<td>tcgacagaca</td><td>tctttaccat</td><td>tcgctgtata</td><td>tgaaggccaa</td><td>gggcaacgtc</td><td>ttcaagaaca</td><td> 360</td>

<td>agagggtcct</td><td>tatggagtac</td><td>atccacaaga</td><td>ggaaggccga</td><td>gaa</td><td></td><td> 403</td>

&lt;210&gt; 160 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 160 ggtgacatgg ccaccatcca ggt 23 &lt;210&gt; 161 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 161 accccagaac acctgyacra tacc 24 &lt;210&gt; 162 &lt;211&gt; 44 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;400&gt; 162 ttaatacgac tcactatagg gagaccagtg tgctggaatt cgcc 44

291

<td> &lt;210&gt;</td><td> 163</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 44</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td>Sekwencja stuttered</td><td></td><td></td>

<td> &lt;400&gt;</td><td> 163</td><td></td><td></td>

<td colspan="2">ttaatacgac tcactatagg gagaggatat</td><td>ctgcagaatt</td><td>CGCC</td>

<td> &lt;210&gt;</td><td> 164</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 45</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td>Sekwencja stuttered</td><td></td><td></td>

<td> &lt;400&gt;</td><td> 164</td><td></td><td></td>

<td colspan="2">ttaatacgac tcactatagg gagacctgtc</td><td>cgtagagctc</td><td>ggacc</td>

<td> &lt;210&gt;</td><td> 165</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 44</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td>Sekwencja stuttered</td><td></td><td></td>

<td> &lt;400&gt;</td><td> 165</td><td></td><td></td>

<td colspan="2">ttaatacgac tcactatagg gagaggcacg</td><td>ctcgtagaac</td><td>GAGG</td>

<td> &lt;210&gt;</td><td> 166</td><td></td><td></td>

<td> &lt;211&gt;</td><td> 22</td><td></td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td><td></td>

<td> &lt;220&gt;</td><td></td><td></td><td></td>

<td> &lt;223&gt;</td><td>Sekwencja stuttered</td><td></td><td></td>

<td> &lt;400&gt;</td><td> 166</td><td></td><td></td>

tgmgatgygg yaaraagaar gt 22 &lt;210&gt; 167 &lt;211&gt; 26 &lt;212&gt; DNA &lt;213&gt; Sztuczny &lt;220&gt;

&lt;223&gt; Sekwencja stuczna &lt;220&gt;

&lt;221&gt; misc feature &lt;222&gt; (23) .. (23) &lt;223&gt; n to a, c, g lub t

292 &lt;400&gt; 167 tgmgatgygg yaaraagaar gtntgg 26

<td> &lt;210&gt;</td><td> 168</td><td></td>

<td> &lt;211&gt;</td><td> 25</td><td></td>

<td> &lt;212&gt;</td><td>DNA</td><td></td>

<td> &lt;213&gt;</td><td>Sztuczny</td><td></td>

<td> &lt;220&gt;</td><td></td><td></td>

<td> &lt;223&gt;</td><td colspan="2">Sekwencja stuttered</td>

<td> &lt;220&gt;</td><td></td><td></td>

<td> &lt;221&gt;</td><td>misc_feature</td><td></td>

<td> &lt;222&gt;</td><td> (6)..(6)</td><td></td>

<td> &lt;223&gt;</td><td>n to a, c, g lub</td><td>t</td>

<td> &lt;400&gt;</td><td> 168</td><td></td>

<td colspan="2">ttctcngcct tcytcytgtg</td><td>gatgt</td>

&lt;210&gt; 169 &lt;211&gt; 2713 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera

293 &lt;400&gt; 169

<td>cggacgcgtg</td><td>agcggacgcg</td><td>tgggcggacg</td><td>cgtgggcgga</td><td>cgcgtgggcg</td><td>gacgcgtggg</td><td> 60</td>

<td>cggacgcgtg</td><td>ggcggacgcg</td><td>tgggtggcaa</td><td>cccacgcgtc</td><td>cgctagttag</td><td>tgctcgccgg</td><td> 120</td>

<td>cgagcgcccg</td><td>cgcccccgcc</td><td>ccgaaagctg</td><td>cattactagc</td><td>taatctgaac</td><td>gtctgtcgta</td><td> 180</td>

<td>attttgtttc</td><td>atttgtggtg</td><td>taaaagttaa</td><td>aactcatcaa</td><td>ccaaaatgcg</td><td>tgaatgtatc</td><td> 240</td>

<td>tcagtccatg</td><td>ttggccaagc</td><td>cggagtccaa</td><td>atcggtaatg</td><td>cctgctggga</td><td>gttgtactgc</td><td> 300</td>

<td>ctggaacatg</td><td>gcatccaacc</td><td>tgacggtcag</td><td>atgccatcag</td><td>acaagactgt</td><td>tggaggagga</td><td> 360</td>

<td>gatgacagtt</td><td>tcaacacatt</td><td>Gttcagtgaa</td><td>actggtgccg</td><td>gcaaacatgt</td><td>acctagagca</td><td> 420</td>

<td>gtatttgtag</td><td>atttggaacc</td><td>aacagtagta</td><td>gatgaagtac</td><td>gtaccggcac</td><td>ataccgtcaa</td><td> 480</td>

<td>ttgttccacc</td><td>cagaacaact</td><td>catcactggc</td><td>aaagaagatg</td><td>ccgccaataa</td><td>ctatgctaga</td><td> 540</td>

<td>ggtcactata</td><td>caattggtaa</td><td>agaaatagtt</td><td>gacttggtat</td><td>tggacagaat</td><td>ccgtaaattg</td><td> 600</td>

<td>gctgatcaat</td><td>gtactggact</td><td>tcaaggtttc</td><td>ttgattttcc</td><td>actccttcgg</td><td>tggtggtact</td><td> 660</td>

<td>ggatctggtt</td><td>tcacttcttt</td><td>gttgatggaa</td><td>cgtctatctg</td><td>ttgactatgg</td><td>taaaaaatca</td><td> 720</td>

<td>aaactggaat</td><td>tcgccatcta</td><td>cccagctcct</td><td>caagtatcta</td><td>ctgctgtagt</td><td>agaaccatac</td><td> 780</td>

<td>aactccatct</td><td>tgaccaccca</td><td>caccactctt</td><td>gaacactcag</td><td>actgtgcctt</td><td>tatggtagat</td><td> 840</td>

<td>aatgaagcca</td><td>tctatgacat</td><td>ctgcagacgt</td><td>aatctagaca</td><td>tcgagcgccc</td><td>aacctacacc</td><td> 900</td>

<td>aacttgaaca</td><td>gacttattgg</td><td>ccaaatcgta</td><td>tcctcaatca</td><td>cagcttctct</td><td>aagattcgat</td><td> 960</td>

<td>ggtgctctaa</td><td>atgttgactt</td><td>gacagaattc</td><td>caaactaact</td><td>tggttcctta</td><td>ccctcgtatt</td><td> 1020</td>

<td>cacttccctc</td><td>ttgtcaccta</td><td>tgccccagta</td><td>atttccgctg</td><td>aaaaggctta</td><td>ccatgaacaa</td><td> 1080</td>

<td>ctttccgtag</td><td>ctgaaatcac</td><td>caatgcctgt</td><td>ttcgaacctg</td><td>ccaaccagat</td><td>ggtaaaatgt</td><td> 1140</td>

<td>gatcccagac</td><td>atggtaaata</td><td>catggcttgc</td><td>tgtatgttgt</td><td>acagagggga</td><td>tgttgtacca</td><td> 1200</td>

<td>aaggatgtaa</td><td>atgctgctat</td><td>tgcaaccatt</td><td>aagaccaaac</td><td>gtaccatcca</td><td>attcgtagac</td><td> 1260</td>

<td>tggtgtccaa</td><td>ctggtttcaa</td><td>agtaggtatc</td><td>aactaccaac</td><td>caccaactgt</td><td>tgtacctgga</td><td> 1320</td>

<td>ggtgatttgg</td><td>ctaaagtaca</td><td>acgtgccgta</td><td>tgcatgttgt</td><td>ccaacactac</td><td>agctattgct</td><td> 1380</td>

<td>gaagcctggg</td><td>caagattgga</td><td>ccacaaattc</td><td>gatcttatgt</td><td>atgccaagag</td><td>agctttcgtc</td><td> 1440</td>

<td>cactggtatg</td><td>taggagaggg</td><td>tatggaagaa</td><td>ggtgaattct</td><td>ctgaagctcg</td><td>tgaagatttg</td><td> 1500</td>

<td>gctgcttttc</td><td>ttatcatctc</td><td>tatttttttt</td><td>acgatcctta</td><td>accgcataac</td><td>accgtatcta</td><td> 1560</td>

<td>tcattgtgaa</td><td>attaggtgtg</td><td>aaaggtgttt</td><td>aaaaatgagg</td><td>ttccttattc</td><td>tacttgccgt</td><td> 1620</td>

294

<td>attggctgta</td><td>gctgtgaatg</td><td>ctacatcaat</td><td>ccaccaacaa</td><td>tgggctacat</td><td>ttaaggtaaa</td><td> 1580</td>

<td>ccattccaag</td><td>aagtacggac</td><td>atcttaaaga</td><td>agagcaagtt</td><td>cgcttccaag</td><td>ttttctctca</td><td> 1740</td>

<td>aaatctccgc</td><td>aaaattgaag</td><td>aacacaatgc</td><td>aagataccag</td><td>aatggtgaag</td><td>tgtccttcta</td><td> 1800</td>

<td>cttgggggtt</td><td>aatcagttcg</td><td>cagatatgac</td><td>ttcagaggaa</td><td>ttcaaggcta</td><td>tgcttgactc</td><td> 1860</td>

<td>ccaactcatt</td><td>cacaagccta</td><td>agcgaaacat</td><td>tacatcccgć</td><td>tttgtagctg</td><td>atcctcaatt</td><td> 1920</td>

<td>gactgttcca</td><td>gaatcaattg</td><td>actggagaga</td><td>aaagggggca</td><td>gttgctccca</td><td>taagggacca</td><td> 1980'</td>

<td>agggcaatgc</td><td>ggatcatgtt</td><td>gggcatttag</td><td>tgcagctggt</td><td>gctcttgaag</td><td>gacaaagatt</td><td> 2040</td>

<td>tttaaagcag</td><td>aacgtactag</td><td>aagtactgag</td><td>tacccaacag</td><td>ttagtagatt</td><td>gttccggtga</td><td> 2100</td>

<td>ttacgacaat</td><td>gaaggctgca</td><td>atggtggttg</td><td>gccccattgg</td><td>gcatataact</td><td>acattaaaga</td><td> 2160</td>

<td>tcatggcctc</td><td>tgtctagagt</td><td>ctgattacaa</td><td>gtatcaagga</td><td>ttagacggtg</td><td>actgcaaaca</td><td> 2220</td>

<td>gtgtaatccg</td><td>gttatcaaaa</td><td>ccatcaatgg</td><td>ctatgcatct</td><td>gtagatcaaa</td><td>ctgaagaagc</td><td> 2280</td>

<td>acttaaggag</td><td>gctgtaggta</td><td>ctgctggccc</td><td>aatatcagta</td><td>tgtgtcaacg</td><td>ctaattggga</td><td> 2340</td>

<td>ctggcaactg</td><td>tacagcgggg</td><td>gtatccttga</td><td>tagccaaagt</td><td>tgtccaggcg</td><td>gcattttaaa</td><td> 2400</td>

<td>ccatgcagtt</td><td>ttagctgttg</td><td>gatatggttc</td><td>agaaaatggt</td><td>aaagactttt</td><td>ggcttatcaa</td><td> 2460</td>

<td>gaattcatgg</td><td>gacacttatt</td><td>ggggagaagc</td><td>aggttatttg</td><td>agattagtac</td><td>gtggtacaaa</td><td> 2520</td>

<td>ccagtgcggt</td><td>atcaatgaag</td><td>tggccgatta</td><td>tcctctccta</td><td>taattttaaa</td><td>aattgtcatg</td><td> 2580</td>

<td>ccttacagtt</td><td>tatataatga</td><td>aacatgaata</td><td>aaaatattat</td><td>aactttaaaa</td><td>aaaaaaaaaa</td><td> ' 2640</td>

<td>agggcggccg</td><td>acttttttta</td><td>aaaaaaaaaa</td><td>ci as a. &amp; 3. &amp;&amp; π a</td><td>aaaaaaaata</td><td>aaaaaaaaaa</td><td> 2700</td>

<td>agggggggcc</td><td>ccc</td><td></td><td></td><td></td><td></td><td> 2713</td>

&lt;210&gt; 170 &lt;211&gt; 1363 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 170

<td>cccacccgtc</td><td>ccgtggtcga</td><td>gaaaagtact</td><td>aatagtgata</td><td>tctacgtttt</td><td>tcgtttgttt</td><td> 60</td>

<td>aaaatgtagt</td><td>gacatttctg</td><td>ttaaagtctt</td><td>caaaaacgga</td><td>gacgtagtta</td><td>atttaaatat</td><td> 120</td>

<td>taactcaatt</td><td>tctgagttaa</td><td>agcaaaatgt</td><td>agtccacaga</td><td>ggtgaactag</td><td>acgacattga</td><td> 180</td>

<td>aattgaggac</td><td>caaaatgttc</td><td>cagtagtacc</td><td>aaacaatttg</td><td>ctgaatggaa</td><td>tcactgccac</td><td> 240</td>

<td>ggaacttcac</td><td>attattagat</td><td>cccaagtaag</td><td>agatgttgaa</td><td>cctggtgcat</td><td>tcgatggagc</td><td> 300</td>

<td>ttctatggtt</td><td>aacctaatgt</td><td>tgtatgaaaa</td><td>ccaaattgca</td><td>agaataagaa</td><td>aaggtatatt</td><td> 360</td>

<td>taacaaaaac</td><td>tcatttaata</td><td>tacttgcttt</td><td>gcagaataac</td><td>gttatatcta</td><td>atatagaaga</td><td> 420</td>

<td>tgaagccttt</td><td>gacggtacaa</td><td>ccatcgcgat</td><td>actggacttt</td><td>ggttttaaca</td><td>agatggaaaa</td><td> 480</td>

<td>attgacttca</td><td>aaaatgttcg</td><td>ctggttcaaa</td><td>tattacaaat</td><td>cttaacttac</td><td>aatcgaacct</td><td> 540</td>

<td>aataagtaac</td><td>atagaagatg</td><td>gtacctttca</td><td>gaaaatcgat</td><td>aatttgaata</td><td>aattagactt</td><td> 600</td>

<td>aagcggtaac</td><td>caattggaag</td><td>ttattggaca</td><td>cgtctttaga</td><td>aacctgacaa</td><td>acctaaatga</td><td> 660</td>

<td>attgcacttg</td><td>gatggaaacc</td><td>gaatćaaaac</td><td>acttgaacct</td><td>ggatgctttg</td><td>gtggttctgg</td><td> 720</td>

295

<td>gatctactgg</td><td>ctttattttg</td><td>caggtaacca</td><td>actgactcat</td><td>attgtaaagg</td><td>gagtgtttta</td><td> 780</td>

<td>taaagtacca</td><td>gtatccttat</td><td>tggatttcac</td><td>taataacaaa</td><td>atttcaaaaa</td><td>ttgataaagg</td><td> 840</td>

<td>agccttagct</td><td>ggtctttcaa</td><td>cgctaacatt</td><td>tgttcagtta</td><td>tctaataaca</td><td>atataggaga</td><td> 900</td>

<td>tttgaagctg</td><td>tccactcttg</td><td>gcgatctcaa</td><td>tactgcttta</td><td>aatggtctat</td><td>ctttgagtga</td><td> 960</td>

<td>taacggcatt</td><td>tcaaatatcg</td><td>atattggagt</td><td>gttcaaaaat</td><td>actaaaatcg</td><td>atatgttgga</td><td> 1020</td>

<td>cttaagcaaa</td><td>aaccatataa</td><td>aatcaattaa</td><td>aaaaggactg</td><td>ttccagaatg</td><td>ttaaaatgta</td><td> 1080</td>

<td>cactattaat</td><td>ttgagtgaaa</td><td>atgaaattac</td><td>tgaaatagag</td><td>gaagatgctt</td><td>ttggtgatat</td><td> 1140</td>

<td>cgaggattta</td><td>agtcacatag</td><td>atgtgagctt</td><td>gaacaaactt</td><td>acagaagtta</td><td>agaagagaat</td><td> 1200</td>

<td>gttcagtcta</td><td>ccattggatg</td><td>aagttaattg</td><td>gaagataatg</td><td>taataactaa</td><td>aatcgataat</td><td> 1260</td>

<td>gatgcccctc</td><td>gtgtccttcc</td><td>gctgtcacgt</td><td>cttcagataa</td><td>aaataatcct</td><td>attggctgca</td><td> 1320</td>

<td>agaacaaagc</td><td>ttaaaataat</td><td>ggtgtattta</td><td>ataataatgg</td><td>aat</td><td></td><td> 1363</td>

&lt;210&gt; 171 &lt;211&gt; 1215 5 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 171

<td>aaaagagtga ggaaacaggt taatataat gacggaggaa tgacaactga cacacgagaa</td><td> 60</td>

<td>gatacgacat ggcaagaaaa tctctctgat taccattctg acttttctgc gggatcggat</td><td> 120</td>

<td>gaggataagg aagacgatga tttcgatgag aagaacgacg ccgatttaag cagaaggagt</td><td> 180</td>

<td>cgaagaaaga tggaaaggaa agacgagaag gatcgtcctt taccaccgtt actagccaga</td><td> 240</td>

<td>gttggcggca atattgaagt actcggtttt aatgccaggc agcgtaaagc gttccttaat</td><td> 300</td>

<td>gctattatgc gctacggaat gccaccacaa gacgctttca attcacagtg gctggtgaga</td><td> 360</td>

<td>gatcttcgag gaaaatctga gaagatattc aaggcttacg tgtctctctt tatgaggcat</td><td> 420</td>

<td>ctttgcgaac ctggtgcaga taatgctgat acatttgcgg acggtgtgcc gagggaagga</td><td> 480</td>

<td>ctgagtaggc aacatgtttt gacaaggatt ggtgtgatgt. cacttataag aaagaaggtt</td><td> 540</td>

<td>caggagttcg aacacatcaa cggcgagtat agcatgccgg aagtaatcaa aaagagcatt</td><td> 600</td>

<td>atggatcaaa ataaaatcaa tgccgccggc accgccacca caagcgaagc agaaacgcct</td><td> 660</td>

<td>aaaagtgcta ctaccagtac tagtgctacg ccagctacaa gtgctgctcc cagtcccgct</td><td> 720</td>

<td>cccacacaag gagaagataa agataaggat aaagattccg ttcagagtga cgaaaataaa</td><td> 780</td>

<td>gataaagaag tggttaataa aacggaaacc gaagatgaag agaagaaaac gggagaatct</td><td> 840</td>

<td>tcaacagaaa agccgaaaac tgaaccggaa gaagtgaaag aagcttctcc gaaaaccgaa</td><td> 900</td>

<td>attcccgaag ctagttccga agctgataaa tctgagatca aatccgaagt cgatacctcg</td><td> 960</td>

<td>tctgtaacca gcgaggaaaa gaaagaagag aaagaggaag aggccaaaaa ggaagaaccc</td><td> 1020</td>

<td>gaagagacca aaatggaaat acaggaggag gaacttgtta aagaggagaa aaaagaagaa</td><td> 1080</td>

<td>gaggatgata agaagaagga gagaaag tag aaagaggtgg aaaagaagga agaggatgac</td><td> 1140</td>

<td>gttatggtta ttgatgatga taaagataag aaggacaaaa aggaaatcga tctcgaagcc</td><td> 1200</td>

<td>aagaagcgtt tcatg</td><td> 1215</td>

&lt;210&gt; 172 &lt;211&gt; 3363

296 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 172

<td>accacgcatc</td><td>cgcccacgcg</td><td>tccgcccacg</td><td>cgtccgccca</td><td>cgcgtccgat</td><td>tgaattactc</td><td> 60</td>

<td>taatattttt</td><td>tttttatttt</td><td>cattttttat</td><td>ttatttaata</td><td>atttaaacta</td><td>ttttaacttt</td><td> 120</td>

<td>aattataaac</td><td>caaaatattt</td><td>taaaactaaa</td><td>aaaactaatt</td><td>taaaattcaa</td><td>ttgaaaatga</td><td> 180</td>

<td>taataaattt</td><td>attttcttct</td><td>ttcgacccta</td><td>catctaattt</td><td>taatttacca</td><td>ataaactgat</td><td> 240</td>

<td>taagaacagt</td><td>attaggtcta</td><td>ttaattattc</td><td>catctagatt</td><td>ttgattaatc</td><td>ccctctcgtt</td><td> 300</td>

<td>ataattattt</td><td>atgaataaag</td><td>attattataa</td><td>cattacataa</td><td>agaatttaaa</td><td>gttttaattg</td><td> 360</td>

<td>gaaattataa</td><td>atcccaagga</td><td>agaacattaa</td><td>tttttatctc</td><td>actatttaga</td><td>ttaattttat</td><td> 420</td>

<td>ttaataattt</td><td>tcttggatta</td><td>ttcccgtata</td><td>tttttactag</td><td>aacaagacat</td><td>ataactttaa</td><td> 480</td>

<td>cattaagatt</td><td>agctttacca</td><td>ttatgattga</td><td>gatttataat</td><td>ttatggatga</td><td>ataaataata</td><td> 540</td>

<td>ctattcatat</td><td>attagctcat</td><td>ttagttcctc</td><td>aaggaactcc</td><td>tccgatttta</td><td>ataccattta</td><td> 600</td>

<td>tagtttgtat</td><td>tgaaacaatt</td><td>agaaatgtaa</td><td>ttcgacctgg</td><td>aacattagca</td><td>gtacgtttaa</td><td> 660</td>

<td>ctgctaatat</td><td>aatcgcagga</td><td>cacttattaa</td><td>taactctttt</td><td>aggaaatact</td><td>ggaccaataa</td><td> 720</td>

<td>tatcaatcta</td><td>tatattaaat</td><td>attttaatta</td><td>ttgtccaact</td><td>tttactatta</td><td>attttagaaa</td><td> 780</td>

<td>cagcagtatc</td><td>tataattcaa</td><td>tcttatgtat</td><td>ttgctgtttt</td><td>aagaacacta</td><td>tattctagag</td><td> 840</td>

<td>aagtaaatta</td><td>atgtcaaatc</td><td>ataaaaatca</td><td>tccttatcat</td><td>ttagtagata</td><td>ttagaceatg</td><td> 900</td>

<td>acctttatta</td><td>ggagctttta</td><td>gagcaatatt</td><td>aacaatatta</td><td>ggaataatta</td><td>aatgatttca</td><td> 960</td>

<td>tttatataat</td><td>aataatttac</td><td>taataattgg</td><td>attattaatt</td><td>acaagattaa</td><td>ttatatatca</td><td> 1020</td>

<td>atgatgacga</td><td>gatattgtac</td><td>gagaaggaac</td><td>ttatcaaggc</td><td>cttcatacct</td><td>ttagtagtta</td><td> 1080</td>

<td>ctaaaggttt</td><td>acgttgagga</td><td>ataattttat</td><td>ttattacttc</td><td>agaagtatta</td><td>tttttfcatat</td><td> 1140</td>

<td>catttttttg</td><td>aggatttttt</td><td>catagatcat</td><td>tagcaccaac</td><td>tattgaatta</td><td>ggaatacttt</td><td> 1200</td>

<td>gacctcctaa</td><td>aggaattcaa</td><td>gcctttaacc</td><td>cattagaaat</td><td>ccctttatta</td><td>aatactttaa</td><td> 1260</td>

<td>ttcttttaac</td><td>ttcgggatta</td><td>actgtaactt</td><td>gagcccatca</td><td>tagcctaata</td><td>gaaaaataat</td><td> 1320</td>

<td>ttttctcaag</td><td>gacttcaagg</td><td>attaattttt</td><td>acagtaacat</td><td>taggaattta</td><td>ttttactatt</td><td> 1380</td>

<td>ttacaaggat</td><td>atgaatatat</td><td>tgaatcacct</td><td>tttgcaattt</td><td>ctgattcaat</td><td>ttatggatct</td><td> 1440</td>

<td>tcatttttta</td><td>tagcaacagg</td><td>ttttcatgga</td><td>ttacatgtaa</td><td>ttattggaac</td><td>aaccttctta</td><td> 1500</td>

<td>ttaatttgtt</td><td>taattcgcca</td><td>ttatttaaat</td><td>catttttcat</td><td>cg.acacatca</td><td>ctttggtttt</td><td> 1560</td>

<td>gaagcagcag</td><td>cttgatactg</td><td>acattttgta</td><td>gatgtagtat</td><td>gattattctt</td><td>atatatttca</td><td> 1620</td>

<td>atttactgat</td><td>gaggtagatt</td><td>gagtaaatac</td><td>gtctaccgtt</td><td>ctcctttaaa</td><td>tgacgctatt</td><td> 1680</td>

<td>tgtgctcctg</td><td>aaagagagca</td><td>aaagtgccca</td><td>tggaatccga</td><td>aggctgacag</td><td>atctacctca</td><td> 1740</td>

<td>attcatacaa</td><td>cggtcaattg</td><td>gcaagctcca</td><td>cgtccaaaaa</td><td>tactgccaaa</td><td>tgccttgcac</td><td> 1800</td>

<td>gcaattggta</td><td>atactccatt</td><td>gatcaagctt</td><td>aacagaatac</td><td>ctcagcaaga</td><td>aggtttggaa</td><td> 1860</td>

297

<td>tgtgatatat</td><td>atgtaaaatg</td><td>tgagttcttt</td><td>aatcctggtg</td><td>gatcagtaaa</td><td>agatcgcatg</td><td> 1920</td>

<td>gcaaacagaa</td><td>tactgacaga</td><td>tgccgagaat</td><td>gaaggtatct</td><td>taaaaccagg</td><td>atgtaccatt</td><td> 1980</td>

<td>atagagccgt</td><td>cttcaggaaa</td><td>tactggcatt</td><td>ggtttggcta</td><td>tggcagctgc</td><td>tattaaagga</td><td> 2040'</td>

<td>tataggtgta</td><td>taatcgtaat</td><td>gtcagaaaaa</td><td>atatccaaag</td><td>agaaagaata</td><td>cgtaatgaga</td><td> 2100</td>

<td>gctttgggag</td><td>ctgaagttat</td><td>tagatgtcct</td><td>gtcacagcta</td><td>attcgttttc</td><td>tccatatgga</td><td> 2160</td>

<td>atgtttggta</td><td>ctgtccatcg</td><td>tttatcaaaa</td><td>gaaattccca</td><td>acagtattat</td><td>ttttgatcag</td><td> 2220</td>

<td>ttctctaatc</td><td>ccggaaatcc</td><td>actgactcac</td><td>tacgatacta</td><td>cagcagaaga</td><td>aatttatgat</td><td> 2280</td>

<td>caatgcgaca</td><td>aaaaagtaga</td><td>tatgataata</td><td>atgggagctg</td><td>gaacaggtgg</td><td>taccgttacg</td><td> 2340</td>

<td>ggtataggaa</td><td>gaaaatttaa</td><td>agagatttct</td><td>cccaatacgg</td><td>aaatcgtttg</td><td>tgcagatcca</td><td> 2400</td>

<td>attggatcat</td><td>cttttgcttt</td><td>accagaaatt</td><td>ataaataaaa</td><td>ctgacgttac</td><td>tttctgggag</td><td> 2460</td>

<td>atagaaggta</td><td>tgggctacga</td><td>tttcattccc</td><td>tcaaccttag</td><td>accgcaaagt</td><td>cattgacact</td><td> 2520</td>

<td>tggattaaag</td><td>taggtgatga</td><td>gaatgccctg</td><td>ccaatggcaa</td><td>gaaggttgat</td><td>taaggatgaa</td><td> 2580</td>

<td>ggccttttga</td><td>ttggggctag</td><td>cagtggagct</td><td>atgatgtggg</td><td>cggctattca</td><td>agcagcgaaa</td><td> 2640</td>

<td>gctaaaaatt</td><td>atggccctgg</td><td>taaaagggtt</td><td>gtagttatgt</td><td>taccagatag</td><td>tattaggaac</td><td> 2300</td>

<td>tacttaacaa</td><td>agttcgtatg</td><td>tgaccaatgg</td><td>atggaagagc</td><td>gaaatcttca</td><td>gccttgtgta</td><td> 2760</td>

<td>aatacaaaca</td><td>accacccgtg</td><td>gtggaattta</td><td>aatgtctccc</td><td>aattaaatct</td><td>tcctgtacca</td><td> 2820</td>

<td>caaactgtac</td><td>cgataaattc</td><td>ttccattgaa</td><td>cagactttga</td><td>atctaatgaa</td><td>gaaacttgga</td><td> 2880</td>

<td>cttaaccaga</td><td>tacctgcatt</td><td>ggatgatcaa</td><td>gggggtgttg</td><td>ttggagtact</td><td>ttcaatgcag</td><td> 2940</td>

<td>ctaattatta</td><td>acaaacttac</td><td>atctggtaat</td><td>gctacactca</td><td>atgacccaat</td><td>agcagatgct</td><td> 3000</td>

<td>atagaccgac</td><td>tttatcccag</td><td>agttgagaaa</td><td>tctgctaata</td><td>ttggactcgt</td><td>ctcaagagta</td><td> 3060</td>

<td>ttggaacgtg</td><td>agccttattt</td><td>ggtaattttg</td><td>gatacacaag</td><td>gtaaaggacc</td><td>ttccaagata</td><td> 3120</td>

<td>aataagcctg</td><td>caggcgttgt</td><td>aactccttta</td><td>gattttctac</td><td>agtttatcca</td><td>gaagcagcat</td><td> 3180</td>

<td>taaatataga</td><td>ggagactaat</td><td>atttccacca</td><td>tttaacaaaa</td><td>gtaatcacca</td><td>taaagtgata</td><td> 3240</td>

<td>aaataaataa</td><td>tacctaatat</td><td>aatagaaata</td><td>ttagaaataa</td><td>tagaaattat</td><td>agattataat</td><td> 3300</td>

<td>aaataaataa</td><td>gtattataat</td><td>caaaaaaaaa</td><td>aaaaaaaggg</td><td>gcggcgcccc</td><td>tttttttttt</td><td> 3360</td>

<td>ttt</td><td></td><td></td><td></td><td></td><td></td><td> 3363</td>

&lt;210&gt;

&lt;211&gt;

&lt;212&gt;

&lt;213&gt;

173

843

DNA

Diabrotica virgifera &lt;400&gt; 173

<td>ctcataatat</td><td>tatgccaaaa</td><td>atttaaaata</td><td>gtatttcgag</td><td>gagaaattct</td><td>ttataaaaaa</td><td> 60</td>

<td>aattgtatct</td><td>ttctttatat</td><td>ttctggtgat</td><td>atttatgaaa</td><td>aacacaccag</td><td>caatatgttt</td><td> 120</td>

<td>gctatatcga</td><td>ggagatcaat</td><td>agctgcttta</td><td>acacaaatca</td><td>gatcaaagac</td><td>agacaaggcc</td><td> 180</td>

<td>gttttggacg</td><td>aaattattcg</td><td>agtagatcat</td><td>gctggagaat</td><td>tgggagcaga</td><td>tcgtatttat</td><td> 240</td>

<td>gcaggccaga</td><td>tgttcattct</td><td>aggcagcact</td><td>tcaaaagcac</td><td>ctttgataag</td><td>acatatgtgg</td><td> 300</td>

<td>gaacaagaaa</td><td>aacatcacaa</td><td>agctacattc</td><td>gaagatctaa</td><td>ttagaaaaaa</td><td>acgtgttaga</td><td> 360</td>

298

<td>cctacagtaa</td><td>tgactcctat</td><td>ttggaatgtt</td><td>gcaggcttcg</td><td>ccttaggagc</td><td>aggatcagca</td><td> 420</td>

<td>ttgcttggag</td><td>acaaagcagc</td><td>tatggcgtgt</td><td>actgtggctg</td><td>tcgaaacagt</td><td>aattgtagat</td><td>4 SO</td>

<td>cattataatg</td><td>accaactgag</td><td>aactctgttg</td><td>gaagatccag</td><td>agtgtgataa</td><td>agagcttgta</td><td> 540</td>

<td>gaaactatta</td><td>agaagtttag</td><td>agacgaggaa</td><td>caagaacatc</td><td>atgaccatgg</td><td>cattgatcag</td><td> 600</td>

<td>ggagcaaagc</td><td>agactccttt</td><td>ttatgaagcg</td><td>tttactaatg</td><td>tcattaaagc</td><td>tggatgcaaa</td><td> 660</td>

<td>gcagctatag</td><td>caatatcgaa</td><td>agtagtttaa</td><td>cttgtgttta</td><td>tgtacatatt</td><td>atgtagttga</td><td> 720</td>

<td>ttgtgaaata</td><td>tatgttgtta</td><td>aatttgtaaa</td><td>gtattgacag</td><td>tattatatat</td><td>ttttggatat</td><td> 780</td>

<td>aaagttagtc</td><td>ccactatgtg</td><td>tacagaaaaa</td><td>tctaataaaa</td><td>taaaatcaat</td><td>ttaaatacag</td><td> 840</td>

<td>att</td><td></td><td></td><td></td><td></td><td></td><td> 843</td>

&lt;210&gt; 174 &lt;211&gt; 704 &lt;212&gt; DNA &lt;213&gt; Diabrotica virgifera &lt;400&gt; 174

<td>aaagaccttg</td><td>aagatcttct</td><td>ACCATGGC</td><td>gagaagcctg</td><td>tgaagataca</td><td>ggtcttagtt</td><td> 60</td>

<td>ctagacatgt</td><td>agagggacat</td><td>aatctgtgtt</td><td>atattttaga</td><td>tcacaaaaga</td><td>gtgcaattaa</td><td> 120</td>

<td>ggctgttgtg</td><td>tgatgagtac</td><td>tagacaggaa</td><td>gaaagagcag</td><td>actcccagga</td><td>tatctcgtgg</td><td> 180</td>

<td>ttgagtctta</td><td>tgatcaacaa</td><td>tatacatatt</td><td>ttgcatcaga</td><td>atcttgatag</td><td>atcaggctat</td><td> 240</td>

<td>cttctaatta</td><td>ttcttctatt</td><td>ttttgttttt</td><td>ttctcgagtt</td><td>agctcagttt</td><td>tttcctattt</td><td> 300</td>

<td>tttttttggt</td><td>acttttgcta</td><td>gatatatttt</td><td>acacatactc</td><td>atttttatga</td><td>gtcttaagtg</td><td> 360</td>

<td>caatacgttg</td><td>gtaacggaat</td><td>actggttatt</td><td>tgtcattcct</td><td>tccttgtcgt</td><td>acctaggttg</td><td> 420</td>

<td>tttctcttta</td><td>cttcaatagt</td><td>tacaatgact</td><td>atttgatttt</td><td>tgattgtgtc</td><td>aagctataca</td><td> 480</td>

<td>agaaataaga</td><td>gagtaatcag</td><td>gagagagaaa</td><td>gagagaaaag</td><td>attgagtaat</td><td>ctgtaagaca</td><td> 540</td>

<td>tcaaaagatg</td><td>aaaagaccta</td><td>gaacatcttc</td><td>tatcatagtt</td><td>gtaagaggat</td><td>gatgaaaggc</td><td> 600</td>

<td>acaggtatta</td><td>gttcaatcca</td><td>gataaaaaat</td><td>gaagtgttaa</td><td>aagacataga</td><td>agaaaaactt</td><td> 660</td>

<td>ttgtgtacag</td><td>tcgtacagta</td><td>gacataggaa</td><td>tacagcgaag</td><td>ATGC</td><td></td><td> 704</td>

Monsanto Technology LLC

pe łnomocnik:

299