MX359674B

Novel lipids and compositions for the delivery of therapeutics.

Abstract

The present invention provides lipids that are advantageously used in lipid particles for the in vivo delivery of therapeutic agents to cells. In particular, the invention provides lipids having the following structure (I) wherein R1 and R2 are each independently for each occurrence optionally substituted C10-C30 alkyl, optionally substituted C10-C30 alkenyl, optionally substituted C10-C30 alkynyl, optionally substituted C10-C30 acyl, or -linker-ligand; R3 is H, optionally substituted C1-C10 alkyl, optionally substituted C2-C10 alkenyl, optionally substituted C2-C10 alkynyl, alkylhetrocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonates, alkylamines, hydroxyalkyls, Ï-aminoalkyls, Ï -(substituted)aminoalkyls, Ï-phosphoalkyls, Ï -thiophosphoalkyls, optionally substituted polyethylene glycol (PEG, mw 100-40K), optionally substituted mPEG (mw 120-40K), heteroaryl, heterocycle, or linker-ligand; E is O, S, N(Q), C(O), N(Q)C(O), C(O)N(Q), (Q)N(CO)O, O(CO)N(Q), S(O), NS(O)2N(Q), S(O)2, N(Q)S(O)2, SS, O=N, aryl, heteroaryl, cyclic or heterocycle; and, Q is H, alkyl, Ï-aminoalkyl, Ï-(substituted)aminoalky, Ï-phosphoalkyl or Ï-thiophosphoalkyl.

MX359674B, drawing sheet 1 — Sheet 1 of 329

Term

3.1 yearsleft in the term

Expires 10 November 2029.

14 claims: 1 independent, 13 dependent

1
REIVINDICACIONES IMPI tst u «ümíoao IMOWS1YIAL 1.- Un lípido que posee la estructura o una sal o isómero del mismo.
2
2, - Una partícula lipídica, caracterizada porque comprende el lípido como se reclama en la reivindicación 1.
3
- La partícula lipídica de conformidad con la reivindicación 2, caracterizada además porque la partícula comprende adicionalmente un lípido neutro y un lípido capaz de reducir la agregación.
4
4, - La partícula lipídica de conformidad con la reivindicación 2, caracterizada además porque la partícula lipídica consiste esencialmente en a. un lípido como se reclama en la reivindicación 1; b. un lípido neutro seleccionado de DSPC, DPPC, POPC, DOPE y SM; c. esterol; y d. PEG-DMG o PEG-DMA, en una relación molar de aproximadamente 20-60% de lípido de la reivindicación 1:5-25% de lípido neutro:25-55% de esterol:0.5-15% de PEG-DMG o PEG-DMA.
5
- La partícula lipídica de conformidad con la reivindicación 2, caracterizada además porque comprende adícíonalmente un agente terapéutico.
6
- La partícula lipídica de conformidad con la reivindicación 5, caracterizada además porque el agente terapéutico es un ácido nucleico.
7
7, - La partícula lipídica de conformidad con la reivindicación 6, caracterizada además porque el ácido nucleico es un plásmido. 273 IMPI» INSTITUTO MEXICANO OE LA PROPIEDAD INDUSTRIAL
8
- La partícula lipídica de conformidad con la reivindicación 6, caracterizada además porque el ácido nucleico es un oligonucleótido inmunoestimulador.
9
- La partícula lipídica de conformidad con la reivindicación 6, caracterizada además porque el ácido nucleico se selecciona del grupo que consiste en un siARN, un 5 oligonucleótido antisentido, un microARN, un antagomir, un aptámero y una ribozima.
10
- La partícula lipídica de conformidad con la reivindicación 5, caracterizada además porque el agente terapéutico es siARN.
11
- La partícula lipídica de conformidad con la reivindicación 5, caracterizada además porque el agente terapéutico es microARN. 10
12
12,- La partícula lipídica de conformidad con la reivindicación 4, caracterizada además porque el esteral es colesterol.
13
- Una composición farmacéutica, caracterizada porque comprende una partícula lipídica como se reclama en la reivindicación 2 y un excipiente, portador o diluyente farmacéuticamente aceptable.
14
15 14.- Una composición farmacéutica, caracterizada porque comprende una partícula lipídica como se reclama en la reivindicación 5 y un excipiente, portador o diluyente farmacéuticamente aceptable. 274

Independent claims14

2,545 paragraphs in 228 sections, as filed

(54) Title: LIPIDS AND NEW COMPOSITIONS FOR THE SUPPLY OF THERAPEUTICS.

(54) Title: NOVEL LIPIDS AND COMPOSITIONS FOR THE DELIVERY OF THERAPEUTICS.

(57) Summary

The present invention relates to lipids that are advantageously used in lipid particles for the in vivo delivery of therapeutic agents to cells. In particular, the invention provides lipids having the following structure (I) where R 1 and R 2 are each for each occurrence for each occurrence optionally substituted C 10 -C 30 alkyl, optionally substituted C 10 -C 30 alkenyl, optionally substituted 10 to 30 carbon alkynyl, optionally substituted 10 to 30 carbon acyl or linker ligand; R3 is H, optionally substituted C 1-10 -alkyl, optionally substituted C2-10 alkenyl, optionally substituted 2-C10-alkynyl, alkylheterocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonates, alkylamines, hydroxyalkyls ,? -aminoalkyls,? -aminoalkyls (substituted),? -phosphoalkyls,? -thiophosphoalkyls, optionally substituted polyethylene glycol (PEG, mw 100-40K), optionally substituted mPEG (mw 120-40K), heteroaryl, heterocycle or linker ligand; E is O, S, N (Q), C (O), N (Q) C (O), C (O) N (Q), (Q) N (CO) O, O (CO) N (Q ), S (O), NS (O) 2N (Q), S (O) 2, N (Q) S (O) 2, SS, O = N, aryl, heteroaryl, cyclic or heterocycle; and, Q is H, alkyl,? -aminoalkyl,? -aminoalkyl (substituted),? -phospholkyl? -thiophosphoalkyl.

(57) Abstract

The present invention provides lipids that are advantageously used in lipid partiols for the in vivo delivery of therapeutic agents to cells. In particular, the invention provides lipids having the following structure (I) where R1 and R2 are each independently for each occurrence optionally substituted C10-C30 alkyl, optionally substituted C10-C30 alkenyl, optionally substituted C10-C30 alkynyl, optionally substituted C10-C30 acyl, or -linker-ligand; R3 is H, optionally substituted C1-C10 alkyl, optionally substituted C2-C10 alkenyl, optionally substituted C2-C10 alkynyl, alkylhetrocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonates, alkylamines, hydroxyalkyls, I #aminoalkyls, I # -) , l # -phosphoalkyls, I # -thiophosphoalkyls, optionally substituted polyethylene glycol (PEG, mw 100-40K), optionally substituted mPEG (mw 120-40K), heteroaryl, heterocycle, or linker-ligand; E is O, S, N (Q), C (O), N (Q) C (O), C (O) N (Q), (Q) N (CO) O, O (CO) N (Q ), S (O), NS (O) 2N (Q), S (O) 2, N (Q) S (O) 2, SS, O = N, aryl, heteroaryl, cyclic or heterocycle; and, Q is H, alkyl, í # -aminoalkyl, i # - (substituted) aminoalky, l # -phosphoalkyl or í # -thiophosphoalkyl.

IMPI

PATENT TITLE No. 359674

<td>Headlines):</td><td>ALNYLAM PHARMACEUTICALS, INC.</td>

<td>Home:</td><td>300 Third Street, Cambridge, Massachusetts, 02142, USA</td>

<td>Denomination:</td><td>LIPIDS AND NOVELTY COMPOSITIONS FOR THE SUPPLY OF THERAPEUTICS.</td>

Classification:

Inventor (s):

CIP: A61K9 / 127; A61K89 / 12; O12N1 / 15

CPC: A61K9 / 1272;, A®1K3 ^ 1 ^ CVN15 / 111.

or ”'·'. i /

MUTHIAH MANCHARAN; KALLANTHOTTÁfHJty G * RAJEEV; MUTHUSAMY JAYARAMAN: DAVID BUT ^ 3m «^ AKASH K IIARAYANANNAIR; MARTIN MAIEÉR; tAXMAN ELTERU '' V- *%,

Number:

MX / a / 2017/010204

Inteníacionali robra 2009

36.1919

Λ \ .........

. November 2008

- February 20, 2009 November 2029

Validity: Twenty years

Expiration Date: November 10, 2029

Issue Date: 5 ocjjbTe. / ·1? ·>

The reference patent «grants with foundation e41e <r8ftil¡ | 4os IX 2or fraccij (h V, 6 ° fracckjh íA ', and §9 of the Industrial Property Law.

In accordance with the article;! ® tiq the ^ Law of the ^ roptgtfi ^ lndustaal, the pr¿e ^ ejaeti8ftt4ti ^ e «o * <9encia of velhtgjíüSes non-extendable, counted from the date of filing of your original application | ^ s & rá βθβΚό pa ^ rate pap-hold agents right »^.

Who subscribes to the present title is based on | p arranged ¡article 6or <frnn <irinc III leaves the Industrial Property Law (Official Gazette of the Federation (θΛ.) · »Ι ^ 59ΤΓ ^ α ^^, βΙ 26β2 /« ^> Π7φ * 1999. 01/26/2004, 06/16 / 2005,

01/25/2006, 05/06/2009, 01/06/2010, ÍBTIfteefO, 28/061 »10, 27 / (Maj, í Wfarticles 1», 3rd fraction V subsection a), 4 “and 12th fractions I and III of the Regulation of M ^ titutaJ / toqg ^ g of the Pr ndustri / 1209997, amended on 07/01/2002, 07/15/2004,

07/28/2004 and 09/07/2007); items 1or, 3or. 4or. V ¡nasMÍjr '· Organic Structure of the Mexican Institute of

Industrial Property (OOF 12/27/1999. Reformed 07/29/2904, flUlIdST 7); oneor, 3rd and 5or clause a) of the Agreement that delegates powers to the Deputy Directors General, Coordinator, Director, Regional Offices, Divisional Deputy Directors,

Departmental Coordinators and other subordinates of the Instituto Metxícapo dá »ja Industrial Wopiety. (DOF 12/15/1999, amended on 02/04/2000, 07/29/2004, 08/04/2004 and 09/13/2007).

the Pr

ndustn

This letter is signed with an advanced electronic signature (FIEL), based on articles 7 BIS 2 of the Industrial Property Law; 3 of its Regulations, and 1 fraction III, 2 fraction V, 26 BIS and 26 TER of the Agreement establishing the guidelines for the use of the Electronic Payment and Services Portal (PASE) of the Mexican Institute of Industrial Property, in the procedures indicated

THE DIVISIONAL DIRECTOR OF PATENTS

NAHANNY CANAL REYES

Original string:

NAHANNY MARISOL CANAL REYES | 00001000000403252793 | Administration Service

Tax | 1695 || MX / 2018/85448 | MX / a / 2017/010204 | Normal patent title with divisional PCT¡1220 | RRGO | Page (s) 2 | yhw2BVDUII3NuoXyWI6NdUjBgvE =

Digital stamp:

GYxcDk7E0ogHSFq6ftAp7O4JjDgvBI71TfXE8aNFH / m1cupMXOBgc1AKKjuuzH6DhEamdvYEPSgG2WeeO + 8SJTshdj ncTXjRz2uiLEIQmMxR0mwYjAlpR4YOWHMagt8Hivv4wN6 + gh / nCK3WuaFYr615fYMvb5y + w + RdNXEWu2y0uB0v8GeN 3tym2LX35iuFyLÍ5SP0whdEfCQ / Mzsq0SGE + AAWC + JNd4ZVe2SaV5EZH5tYb7qDZLjSFR8pEKDC8LiVtAUqzgrSynZ CqMlvWJ6klz67rqtKH7HDSZBOiBRMKFJPdFo6cBsLfO + DlaeO / 3oNKj2hT + tuTkCvd5ouxGA /·.!icíií N :: ==> 'i ·' ... j, l:So l: l> i i <<[> ,! (I <ΐ (>!

, u 'iκι ii tri i> q>

C ntinuaci 'n Pri ridad s

Country:

Sheet:

No. r:

<td>US</td><td>April 21, 2009</td><td> 61/171,439</td>

<td>US</td><td>August 14, 2009</td><td> 61/234,098</td>

INDUSTRIAL lipids and novel compositions for supply

THERAPEUTICS

Priority claim

The present application claims priority from USSN

<td> 61/113,179,</td><td>filed</td><td>the</td><td colspan="2">November 10,</td><td> 2008;</td><td>USSN</td>

<td> 61/154,350,</td><td>filed</td><td>the</td><td> 20</td><td>February</td><td> 2009;</td><td>USSN</td>

<td> 61/171,439,</td><td>filed</td><td>the</td><td> 21</td><td>April</td><td> 2009;</td><td>USSN</td>

<td> 61/185,438,</td><td>filed</td><td>the</td><td> 9</td><td>June</td><td> 2009;</td><td>USSN</td>

<td> 61/225,898,</td><td>filed</td><td>the</td><td> 15</td><td colspan="2">July 2009; and</td><td>USSN</td>

<td> 61/234,098,</td><td>filed</td><td>the</td><td> 14</td><td colspan="2">August 2002</td><td>i whose</td>

Contents are incorporated herein by reference in their entirety.

Government support

The work described herein was carried out, at least in part, using US Government funds under grant number HHSN266200600012C issued by the National Institute of Allergy and Infectious Diseases. Accordingly, the government may have some rights regarding the invention.

Background

Technical field

The present invention relates to the field of

IMPI

MEXICAN INSTITUTE OF PROPERTY

... . , , z INDUSTRIAL administration of therapeutic agents using particles

Cationic lipids and lipid particles comprising these lipids, alive with acids that are advantageous for in nucleic administration, as well as nucleic acid-lipid particle compositions suitable for therapeutic use in vivo. Additionally, the present invention provides methods for making these compositions, as well as methods for introducing nucleic acids into cells using these compositions, eg. , for the treatment of various disease states.

Description of the related art

Therapeutic nucleic acids include, eg, small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, ribozymes, plasmids, immunostimulatory nucleic acids, antisense, antagomir, antimir, microRNA mimetic, supermir, Ul adapter, and aptamer . These nucleic acids act through various mechanisms. In the case of siRNA or miRNA, these nucleic acids can sub-regulate the intracellular levels of specific proteins through a process called RNA interference (iRNA). Following introduction of siRNA or miRNA into the cell cytoplasm, these double-stranded RNA constructs can bind to a

INSTITUTO MEXICANO DE 1.A ΙΊΟΜΕΙΤΑΓ) protein called RISC. The '^ deT or miRNA coding strand shifts from the RISC complex providing a template within RISC that can recognize and bind mRNA with a sequence complementary to that of the bound siRNA or miRNA. Once the complementary RNA is bound, the RISC complex cleaves the mRNA and releases the cleaved chains. IRNA can provide for the sub-regulation of specific proteins by directing the specific destruction of the corresponding mRNA encoding protein synthesis.

The therapeutic applications of iRNA are extremely broad, since the siRNA and miRNA constructs can be synthesized with any nucleotide sequence targeting a target protein. To date, siRNA constructs have shown the ability to specifically down-regulate target proteins in both in vitro and in vivo models. Furthermore, siRNA constructs are currently being evaluated in clinical studies.

However, two problems currently faced by siRNA or miRNA constructs are, first, their propensity for plasma nuclease digestion and, second, their limited ability to access the intracellular compartment where they can bind to RISC when administered. systemically as free siRNA or miRNA. These double filament constructions can be stabilized ι —m by

chemically modified within the mnlérnl ^ p ^ r- ojompl ·? ·, · phosphothioate groups. However, these chemical modifications provide only limited protection from nuclease digestion and may decrease construction activity. Intracellular administration of siRNA or miRNA can be facilitated by the use of carrier systems such as polymers, cationic liposomes or by chemical modification of the construct, for example by covalently binding cholesterol molecules. However, improved delivery systems are required to increase the potency of the siRNA and miRNA molecules and to reduce or eliminate the need for chemical modification.

Antisense ribozymes and oligonucleotides can also inhibit translation of mRNA into protein. In the case of antisense constructs, these single stranded deoxynucleic acids have a sequence complementary to that of the target protein mRNA and can bind to the mRNA by Watson-Crick base pairing. This binding prevents translation of the target mRNA and / or causes RNase H-mediated degradation of the mRNA transcripts. Consequently, antisense oligonucleotides possess enormous potential for specificity of action (i.e., down-regulation of a specific disease-related protein). To date, these compounds are in vitro and in vivo models, inflammatory, cancer and HIV.

I

JNSTITDTO MEXICANO promising respecté't ^ Ts ^ ve

including models of ρπίοη-ηρ ^ -, ς] (discussed in Agrawal, Trends in

Biotech. 14: 376-387 (1996))

The antisense can also affect specific cellular activity with chromosomal DNA.

through hybridization

Currently, advanced clinical evaluations are being carried out on humans of

<td>various</td><td>drugs</td><td>antisense.</td><td>The objectives</td><td>of</td><td>these</td>

<td>drugs</td><td>include</td><td>the genes of</td><td>apolipoprotein B</td><td>and</td><td>bcl2 and</td>

<td>products</td><td>of mRNA.</td><td></td><td></td><td></td><td></td>

<td>The</td><td>acids</td><td>nucleic</td><td>stimulants</td><td></td><td>system</td>

Immune systems include deoxyribonucleic acids and ribonucleic acids. In the case of deoxyribonucleic acids, some sequences or motifs have been shown not to allow immune stimulation in mammals. These sequences or motifs include the CpG motif, pyrimidine rich sequences, and palindromic sequences. The CpG motif in deoxyribonucleic acids is believed to be specifically recognized by an endosomal receptor, toll-like receptor 9 (TLR-9), which then causes both the innate and the acquired immune stimulation pathway. Some immune-stimulating ribonucleic acid sequences have also been recorded. These RNA sequences are believed to elicit immune activation by binding to toll-like receptors 6 and 7 (TLR-6 and TLR-7).

IMPI

MEXICAN INSTITUTE

Furthermore, it was also observed that the RNA of filamewSi0 '** cio

immune system stimulant and sp that activates by binding to TLR-3.

A known problem with the use of therapeutic nucleic acids phosphodiester linker to endonucleases relates to internucleotide nucleases. The stability of the binding the propensity for this presence of exonucleases and in serum results in the rapid digestion of nucleic acids that possess phosphodiester bonds and, consequently, therapeutic nucleic acids can have very short half-lives in the presence of serum or within the cells. (Zelphati, 0., et al.,

Antisense. Res. Dev.

3: 323-338 (1993); and Thierry, AR, et al., ppl47-161 in Gene

Regulation: Biology of Antisense RNA and DNA (Eds. Erickson, RP and Izant, JG; Raven Press, NY (1992)). The therapeutic nucleic acid currently being developed does not employ the basic phosphodiester chemistry found in natural nucleic acids, due to these and other known problems.

This problem has been partially overcome by chemical modifications that reduce serum or intracellular degradation. Modifications to the internucleotide phosphodiester bridge (eg, using phosphorothioate, methylphosphonate, or phosphoramidate linkages), at the nucleotide base (eg, 5-propynyl-pyrimidines), or in sugar (eg, modified sugars) have been tested at 2 ') (Uhlmann E., et

IMPIAS

Encyclopedia of al. Antisense: Chemical Modifications.

Cancer, Vol. X., pp 64-81 Academic Press Incl (1997)). Others have attempted to improve stability by using 2'-5 'sugar linkages (see, eg, US Patent No.

5,532,130).

Other changes have been attempted. However, none of these solutions have been completely satisfactory, and free therapeutic nucleic acids in vivo still have only limited efficacy.

Furthermore, as noted above in relation to siRNA and miRNA, problems persist regarding the limited ability of therapeutic nucleic acids to cross cell membranes (see, Vlassov, et al., Biochim. Biophys. Acta 1197: 95-1082 ( 1994)) and problems related to systemic toxicity, such as complement-mediated anaphylaxis, altered coagulant properties, and cytopenia (Galbraith, et al., Antisense Nucí. Acid Drug Des. 4: 201-206 (1994)).

To try to improve efficacy, researchers have also employed lipid-based carrier systems to deliver chemically modified or unmodified therapeutic nucleic acids. In Zelphati, O and Szoka, FC, J. Contr. I laughed 41: 99-119 (1996), the authors refer to the use of anionic (conventional) liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, and cationic / antisense aggregates. Similarly, siRNA is

IMPI

INSTITUTO MEXICANO has been administered systemically in 1 i pos orna and these nucleicolipid acid particles have been reported to provide enhanced sub-regulation of target proteins in mammals, including non-human primates (Zimmermann et al., Nature 441: 111-114 (2006)).

Despite this progress, there remains a need in the art for improved therapeutic compositions suitable for use.

Preferably, these general therapeutic nucleic acid-lipid compositions.

They would encapsulate nucleic acids with high efficacy, have high drug: lipid ratios, protect encapsulated nucleic acid from degradation or clearance in serum, be suitable for systemic administration, and provide intracellular administration of encapsulated nucleic acid. Furthermore, these lipid-nucleic acid particles should be well tolerated and provide an adequate therapeutic index, so that treatment of the patient at an effective dose of nucleic acid is not associated with considerable toxicity and / or risk to the patient. The present invention provides such compositions, methods of making the compositions, and methods of using the compositions to introduce nucleic acids into cells, including for the treatment of disease.

Short description

IMPI

MEXICO INSTITUTE »^ · IN E I.Á p »omí? AL · lipid ^ '^' S'tiónicos ·

The present invention provides novelties, comprise understanding

as well as particles —— 44 ^ ríxtttJaT “” which are the same.

These lipid particles can additionally be an active agent and used according to related methods of the invention to deliver the active agent to a cell.

In one aspect, the invention provides lipids and the corresponding salts and isomers thereof, having the structure,

XXXIII Donof:

Ri and R2 are each independently for each occurrence Cio-C alkyl3rd optionally substituted, optionally substituted C10-C30 alkenyl, Ci alkynylor-C3or optionally substituted, Cio-C acyl3O optionally substituted or linker ligand;

R3 is H, optionally substituted C1-C10 alkyl, C alkenyl2-Optionally substituted Cio, C-alkynyl2-Optionally substituted Cio, alkylhetrocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonates, alkylamines, hydroxyalkyl, ω-aminoalkyl, ω-aminoalkyl (substitute), ω-phosphoalkyl, ω-thiophosphoalkyl, poly (m-thiophosphoalkyl), optionally substituted mPEG (mw

IMPI

INSTITUTO MNUCANO DELA PROPIEDAD industrial 120-40K), heteroaryl, heterocycle or linker ligand;

E is O, S, N (Q), C (O), N (Q) C (O), C (O) N (Q), (Q) N (CO) O,

O (CO) N (Q), S (O), NS (O)2N (Q), S (O)2, N (Q) S (O)2, SS, O = N, aryl, heteroaryl, cyclic, or heterocycle; and,

Q is H, alkyl, ω-aminoalkyl, ω-aminoalkyl (substituted), ω-phosphoalkyl ω-thiophosphoalkyl.

In another aspect, the invention provides a lipid particle comprising the lipids of the present invention. In some embodiments, the lipid particle further comprises a neutral lipid and a lipid capable of reducing particle aggregation. In one embodiment, the lipid particle consists essentially of (i) at least one lipid of r

the present invention; (ii) a neutral lipid that is selected from DSPC, DPPC, POPC, DOPE and SM; (iii) sterol, eg. cholesterol; and (iv) peg-lipid, eg. PEG-DMG or PEG-DMA, in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid: 25-55% sterol; 0.5-15% PEG-lipid. In one embodiment, the lipid of the present invention is optically pure.

In further related embodiments, the present invention includes lipid particles of the invention that further comprise a therapeutic agent. In one embodiment, the therapeutic agent is a nucleic acid. In one embodiment, the nucleic acid is a plasmid, a

<td></td><td>IΜ PI Mexican Institute of Industrial Property</td>

<td>oligonucleotide</td><td>immunostimulator, an oligonucleotide effe</td>

single filament, eg. an antisense oligonucleotide, an antagomir; a double-stranded oligonucleotide, eg. a siRNA; an aptamer or a ribozyme.

In yet another related embodiment, the present invention includes a pharmaceutical composition comprising a lipid particle of the present invention and a pharmaceutically acceptable excipient, carrier or diluent.

The present invention further includes, in other related embodiments, a method of modulating the expression of a target gene in a cell, which comprises providing a cell with a lipid particle or pharmaceutical composition of the present invention. The target gene can be a wild type gene. In another embodiment, the target gene contains one or more mutations. In a particular embodiment, the method specifically comprises modulating the expression of a target gene that contains one or more mutations. In particular embodiments, the lipid particle comprises a therapeutic agent that is selected from an immunostimulatory oligonucleotide, a single-stranded oligonucleotide, eg. an antisense oligonucleotide, an antagomir; a double-stranded oligonucleotide, eg. a siRNA, an aptamer, a ribozyme. In one embodiment, the nucleic acid is a plasmid encoding a siRNA, an antisense oligonucleotide, an aptamer, or a ribozyme.

IMPIAS

MEXICAN INSTITUTE _,, _,,. _ D6 LA PROPlF.Í / AlJ

In one aspect of the invention, the gene

select from group consisting of Factor- VII> 'Eg5, PCOKD;

<td>FOS,</td><td>gene BCL-2, gene</td><td>of cyclin D, gene</td><td>VEGF,</td><td>gene</td><td>EGFR,</td>

<td>gene</td><td>of cyclin A,</td><td>cyclin E gene,</td><td>gene</td><td>WNT-1,</td><td>gene</td>

<td colspan="2">of beta-catenin,</td><td>gene c-MET, gene PKC,</td><td>gene</td><td>NFKB,</td><td>gene</td>

<td>STAT3</td><td colspan="2">, survivin gene, Her2 / Neu gene,</td><td>gene</td><td>SORT1,</td><td>gene</td>

topoisomerase II gene topoisomerase I gene,

XBP1, alpha, gene p73, gene p21 (WAF1 / CIP1), gene p27 (KIP1), gene

PPM1D, gene

RAS, caveolin gene

I, gene MIB I, gene

MTAI, gene

M68, mutations in tumor suppressor genes, tumor suppressor gene p53, and combinations thereof.

In another embodiment, the nucleic acid is a plasmid that encodes a polypeptide or a functional fragment or variant thereof, so as to increase the expression of the functional polypeptide or fragment or variant thereof.

In a still further related embodiment, the present invention includes a method of treating a disease or disorder characterized by polypeptide overexpression in a subject, which subject a lipid particle or the present invention, wherein a

<td>understands</td><td>provide</td><td>to the</td>

<td>composition</td><td>pharmaceutical</td><td>of</td>

<td>the agent</td><td>therapeutic</td><td>I know</td>

select from a siRNA, a microRNA, an oligonucleotide

INtTtTi

INSTITi

Antisense DS and a plasmid capable of expressing microRNA or an antisense oligonucleotide, 7 'UU11 microRNA or antisense RNA comprise a polynucleotide that specifically binds to a polynucleotide encoding the polypeptide or a complement thereof.

In another related embodiment, the present invention includes a method of treating a disease or disorder characterized by underexpression of a polypeptide in a subject, comprising providing the subject with the pharmaceutical composition of the present invention, wherein the therapeutic agent is a plasmid encoding the polypeptide or a fragment or functional variant thereof.

In a further embodiment, the present invention includes a method of inducing an immune response in a subject, which comprises providing the subject with a pharmaceutical composition of the present invention, wherein the therapeutic agent is an immunostimulatory oligonucleotide. In particular embodiments, the pharmaceutical composition is provided to the patient in combination with a vaccine or antigen.

In a related embodiment, the present invention includes a vaccine comprising the lipid particle of the present invention and an antigen associated with a disease or pathogen. In one embodiment, the lipid particle comprises an immunostimulatory nucleic acid or oligonucleotide. In a

MEXICAN INSTITUTE

OF THE PROPERTY

INDUSTRIAL

In a particular embodiment, the antigen is a humoral antigen. In another embodiment, the antigen is a viral antigen, a bacterial antigen, or a parasitic antigen.

The present invention further includes methods for preparing the lipid particles and pharmaceutical compositions of the present invention, as well as useful kits for the preparation of these lipid particles and pharmaceutical compositions.

In another aspect, the invention provides a method of evaluating a composition that includes an agent, eg. a therapeutic agent or diagnostic agent and a lipid of the present invention.

Brief description of the various views of the drawings

Figure 1. Schematic representation of an optically pure lipid with target conjugated ligands.

Figure 2. Schematic representation of lipid features of the present invention.

Figure 3. A graph illustrating the relative levels of FVII protein in animals administered 0.05 or 0.005 mg / kg of lipid particles containing different cationic lipids.

Figure 4. A table describing the EC50 and pKa values of lipid examples tested using the method described in the Examples.

Detailed description

The present invention is based, in part. in ai. discovery of cationic lipids that provide advantages when used in lipid particles for in vivo administration of a therapeutic agent. In particular, as illustrated by the accompanying Examples, the present invention provides nucleic acid-lipid particle compositions comprising a cationic lipid according to the present invention. In some embodiments, a composition described herein provides increased nucleic acid activity and / or improved tolerability of the compositions in vivo, which can result in a significant increase in therapeutic index as compared to lipid particle compositions. nucleic acid described above. Additionally, compositions and methods of use are described that may provide an improvement in toxicity observed with some therapeutic nucleic acid-lipid particles.

In certain embodiments, the present invention specifically provides improved compositions for delivery of siRNA molecules. These compositions are shown herein to be effective in down-regulating protein levels and / or mRNA levels of target proteins. Additionally, it is shown that the activity of these improved compositions depends on the

IMPI

MEXICAN INSTITUTE m la bctiwaii

INDUSTRIAL ^ -¾ .. 77 - presence of some cationic lipids and that the molar ratio of cationic lipid in the formulation may influence activity.

The lipid particles and compositions of the present invention can be used for a variety of purposes, including the administration of encapsulated or cell-associated therapeutic agents, both in vivo and in vitro. Accordingly, the present invention provides methods of treating diseases or disorders in a subject in need, by contacting the subject with a lipid particle of the present invention associated with a suitable therapeutic agent.

As described herein, the lipid particles of the present invention are particularly useful for the administration of nucleic acids, including, eg, plasmids and siRNA molecules. Accordingly, the lipid particles and compositions of the present invention can be used to modulate the expression of target genes and proteins both in vitro and in vivo by contacting cells with a lipid particle of the present invention associated with a nucleic acid that reduces the expression of the target gene (eg, a siRNA) or a nucleic acid that can be used to increase the expression of a desired protein (eg, a plasmid that encodes the desired protein).

IMPI

Mexican INSTITUTE OE INDUSTRIAL PROPERTY

Several> ΐι ·> ι --___ examples of modalities of cationic lipids of the present invention, as well as lipid particles and compositions comprising the same, and their use to administer therapeutic agents and modulate expression are described in more detail below. of genes and proteins.

Lipids

The present invention provides novel lipids that have some design features. As shown in Figure 2, the design features of lipids include at least one of the following: a major group with variant pKa, a monoamine, di, and triamine Ior, 2or and 3or cationic, oligoamine / polyamine, major groups with low imidazole pKa and pyridine, guanidinium, anionic, zwitterionic and hydrophobic tails may include symmetrical and / or asymmetric chains, longer and shorter, saturated and unsaturated, · skeleton includes glyceride skeleton and other acyclic analogs, cyclic, spiro, bicyclic and polycyclic bonds with ethers, esters, phosphate and analogs, sulfonate and analogs, disulfides, pH sensitive bonds such as acetals and ketals, imines and hydrazones, and oximes.

In one embodiment, the lipid has one of the following structures:

where:

Ri and R2 is each independently for each occurrence optionally substituted C10-C30 alkyl, optionally substituted C10-C30 alkenyl, optionally substituted C10-C30 alkynyl, optionally substituted C10-C30 acyl or -linker linker;

R3 is independently for each occurrence H, optionally substituted C1-C10 alkyl, C alkenyl2-Ci0 optionally substituted, alkynyl C2-Optionally substituted Cio, alkylhetrocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonates, alkylamines, hydroxyalkyl, ω-aminoalkyl, ω-aminoalkyl (substituted), ω-phosphoalkyl, ω-thiophosphoalkyl, polyethylene-, polyethylene-, polyethylene-, polyethylene-, polyurethane-alkyl, polyurethane, optionally substituted mPEG (mw 120-40K), heteroaryl, heterocycle or linker ligand;

X and Y are each independently O, S, alkyl or N (Q);

Qi is independently for each occurrence O or S;

Q2 is independently for each occurrence O, S,

N (Q), alkyl or alkoxy;

Ai, A2, TO4 already5 are

IMPIOUS

MEXICAN INSTITUTE BE THE FRCFltDAb each independently 'st

CH2, CHF or CF2; y and j are 0-10; or a salt or isomer thereof.

In one embodiment, X and Y can independently be (CO), O (CO), O (CO) N, N (CO) O, (C0) 0, O (CO) O, a sulfonate, or a phosphate.

Cationic lipids comprising unsaturated alkyl chains have been found to be particularly useful for forming lipid-nucleic acid particles with increased membrane fluidity. In one modality, at least one of Ri or R2 it comprises at least one, at least two or at least three unsaturation sites, eg. double bond or triple bond.

In one modality, only one of Ri or R2 it comprises at least one, at least two or at least three unsaturation sites.

In one modality, both Ri and R2 they comprise at least one, at least two or at least three unsaturation sites.

In one modality, Ri and R2 comprise different numbers

<td>unsaturation,</td><td>by</td><td colspan="2">eg one</td><td>of</td><td>Ri</td><td>and</td><td>r2</td><td>has a site</td><td>of</td>

<td>unsaturation and</td><td>the</td><td colspan="3">another has</td><td colspan="2">two</td><td>or</td><td>three sites</td><td>of</td>

<td>unsaturation.</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td colspan="3">In one modality,</td><td>both of them</td><td>Ri</td><td>and</td><td>r2</td><td colspan="3">comprise the same</td>

number of unsaturation sites.

IMPI

INSTITUTO .MRXICaN. > FROM THE 1'HOI'líti. · 1

INDUSTRIAL

In one modality, Rx and R2 comprise different types of unsaturation, eg unsaturation in one of Rx double bond and in the other the unsaturation is and R2 is triple bond.

In one modality, both Rx and R2 comprise the same type of unsaturation, eg. double bond or triple bond.

In one modality, at least one of Rx or R2 it comprises at least one double bond and at least one triple bond.

In one modality, only one of Rx or R2 it comprises at least one double bond and at least one triple bond.

In one modality, both Rx and R2 they comprise at least one double bond and at least one triple bond.

In one modality, Rx and R2 are both the same, eg. both Rx and R2 are linoleyl (C18) or Rx and R2 they are both heptadeca-9-enyl.

<td>In</td><td>a</td><td>modality,</td><td>Ri</td><td>and</td><td>r2</td><td>are</td><td>different</td><td>the one of</td>

<td>other.</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td>In</td><td>a</td><td>modality,</td><td colspan="5">at least one of Rx and R2 is</td><td>cholesterol.</td>

<td>In</td><td>a</td><td>modality,</td><td>one</td><td>of</td><td>Ri</td><td>and R2</td><td>is ligand</td><td>linker.</td>

<td>In</td><td>a</td><td>modality,</td><td>one</td><td>of</td><td>Ri</td><td>and R2</td><td>is ligand</td><td>linker and</td>

the ligand is a lipophilic.

In one modality, at least one of Rx or R2 comprises at least one CH group2 with one or both H replaced by F, eg. CHF or CF2. In one modality, both Rx or R2 comprise at least one CH group2 with one or two Hs replaced by F, eg.

IMPI

MEXICAN INSTITUTE

OF INDUSTRIAL PROPERTY

CHF or CF2.

In one modality, only one of Ri and R2 comprises at least one CH group2 with one or both Hs replaced by F.

In one modality, at least one of Ri or R2 ends in CH2F, CHF2 or CF3. In one modality, both Ri and R2 end in CH2F, CHF2 or cf3.

In one modality, at least one of Ri or R2 is - (CF2)and-Z (CH2)and-CH3, where each y is independently 1-10 and Z is O, S or N (Q).

In one modality, both Ri and R2 are - (CF2) and-Z- (CH2) andCH3, where each y is independently 1-10 and Z is O, So N (Q).

In one modality, at least one of Ri or R2 is - (CH2)and-Z (CF2)and-CF3, where each y is independently 1-10 and Z is O, S or N (Q).

In one modality, both Ri and R2 are - (CH2) and-Z- (CF2) andCF3, where each y is independently 1-10 and Z is O, So N (Q).

In one modality, at least one of Ri or R2 is - (CF2)and(CF2)and-CF3, where each and is independently 1-10.

In one modality, both Ri and R2 are - (CF2) and- (CF2) and-CF3, where each and is independently 1-10.

In one modality, R3 is chosen from a group consisting of methyl, ethyl, polyamine, - (CH2) h_heteroaryl, - (CH2)h~ N (Q)2p -ON (Q)2, - (CH2) h-Z '- (CH2) h-heteroaryl, linker ligand,

- (CH2) h-heterocycle, and

heterocycle where each

O, S or N (Q).

In one embodiment, the

In one embodiment, diastereomer,

90%, at least

In an i ivi ri

MEXICAN INSTITUTE OF PROPERTY

INDUSTRIAL

- (CH2)h-Z- (CH2)h-

it is independently 0-13 and Z is ligand is fusogenic peptide.

Lipid is a racemic mixture.

the lipid is enriched in an ex. lipid is at least 95%, at least

80% or at least 70% of diastereomeric excess.

modality, the lipid is enriched in an enantiomer, eg. lipid is at least 95%, at least

90%, at least 80% or at least 70% of enantiomeric excess.

In one embodiment, the lipid is chirally pure, eg. it is a unique optical isomer.

In one embodiment, the lipid is enriched for an optical isomer.

When a double bond is present (eg, carbon-carbon double bond or carbon-nitrogen double bond), there may be isomerism in the configuration about the double bond (ie, cis / trans or E / Z isomerism). When the configuration of a double bond is illustrated in a chemical structure, it is understood that the corresponding isomer may also be present. The amount of isomer present can vary, depending on the relative stabilities of the isomers and the energy required to convert between the isomers. Therefore, some double bonds are

IMPI

MEXICAN INSTITUTE OF THE PROPftDAÍ 'INDUSTRIAL practical effects, present only' in a single

<td>setting,</td><td>While</td><td>than</td><td>others (eg.</td><td>when</td><td>the</td>

<td>stabilities</td><td>relative</td><td>are</td><td>similar and the</td><td>Energy</td><td>of</td>

<td>conversion is</td><td>low)</td><td>they can</td><td>be present</td><td>how</td><td>a</td>

inseparable balanced mix of configurations.

In one aspect, the lipid is a compound of the formula

XXXIII,

XXXIII where:

Ri and R2 are each independently for each occurrence Cio-C alkyl3rd optionally substituted, optionally substituted C10-C30 alkenyl, optionally substituted C1Q-C30 alkynyl, optionally substituted C10-C30 acyl, or linker ligand;

R3 is H, optionally substituted C1-C10 alkyl, C alkenyl2-Optionally substituted Cio, C-alkynyl2-Ci0 optionally substituted, alkylhetrocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonates, alkylamines, hydroxyalkyl, ω-aminoalkyl, ω-aminoalkyl (substituted), optionally fos-phosphoalkyl, 40-glyphyl (m) substituted (mw 120-40K), heteroaryl, heterocycle or linker ligand;

E is O, S, N (Q), C (O), N (Q) C (O), C (O) N (Q), (Q) N (CO) O,

O (CO) N (Q), S (O), NS (O)2N (Q),

SW)2, N (Q) S (O)2,

IMPI

MÜUCAN INSTITUTE », OF THE PHOFIEDÁO

INDUSTRIAL SS, Ó = N, Í

heteroaryl, cyclic or heterocycle; and,

Q is H, alkyl, ω-aminoalkyl, ω-aminoalkyl (substituted), ω-phosphoalkyl or ω-thiophosphoalkyl; or a salt or isomer thereof.

In one modality, Ri and R2 are each independently for each occurrence optionally substituted C10-C30 alkyl, optionally substituted C1Q-C30 alkoxy, optionally substituted C10-C30 alkenyl, optionally substituted C10-C30 alkenyloxy, optionally substituted C10-C30 alkynyl, C10-C30 alkynyloxy or acyl Ci0-C30 optionally substituted.

In another modality, R3 is H, optionally substituted Cj-Cio alkyl, C alkenyl2-Ci0 optionally substituted, alkynyl C2-Optionally substituted cyo, optionally substituted alkylheterocycle, optionally substituted heterocycloalkyl, optionally substituted alkylphosphate, optionally substituted phosphoalkyl, optionally substituted alkylphosphorothioate, optionally substituted phosphorothioalkyl, optionally substituted alkylphosphorodioalkyl, optionally substituted alkylphosphorylidoalkyl, optionally substituted optionally substituted alkylamino, optionally substituted di (alkyl) amino, optionally aminoalkyl

IMPI

MEXICAN INSTITUTE OF PROPERTY

INDUSTRIAL ___ substituted, optionally substituted alkylaminoalkyl, optionally substituted di (alkyl) aminoalkyl, optionally substituted hydroxyalkyl, optionally substituted polyethylene glycol (PEG, mw

100-40K), optionally substituted mPEG (mw

120-40K), optionally substituted heteroaryl, optionally substituted heterocycle or linker ligand.

In yet another embodiment, E is -O-,

-S-, -N (Q) -, -C (O) -,

N (Q) C (O) -,

-C (O) N (Q) -,

-N (Q) C (0) 0-,

-OC (O) N (Q) -, S (0),

-N (Q) S (O)2N (Q) -, -S (0)2-,

-N (Q) S (O)2-,

-SS-, -0-N =, = NO-,

-C (O) -N (Q) -N =,

-N (Q) -N =,

-N (Q) -O-,

-C (O) S-, arylene, heteroarylene, cyclalkylene or heterocyclylene; And it is

H, alkyl, ω-aminoalkyl, ω-aminoalkyl (substituted), ω-phosphoalkyl ω-thiophosphoalkyl.

In another embodiment, lipid is a compound of the formula

XXXIII, where E is 0, S,

N (Q), C (O),

N (Q) C (O), C (O) N (Q), (Q) N (CO) O, O (CO) N (Q), S (O),

NS (O)2N (Q),

SW)2, N (Q) S (O)2, H.H,

O = N, aryl, heteroaryl, cyclic, or heterocycle.

In one embodiment, the lipid is a compound of formula XXXIII, where R3 is H, alkenyl C2-Ci0 optionally substituted, alkynyl C2-C10 optionally substituted, alkylhetrocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonates, alkylamines,

hydroxyalkyl, ω-aminoalkyl (substituted), ω-aminoalkyl, ω-phosphoalkyl, ω-thiophosphoalkyl, optionally substituted polyethylene glycol (PEG, mw 100-40K), optionally substituted mPEG (mw

120-40K), heteroaryl, heterocycle or linker ligand.

In yet another embodiment, the lipid is a compound of formula XXXIII, where Ri and R2 are each independently for each occurrence optionally substituted C10-C30 alkyl, optionally substituted C10-C30 alkynyl, Ci acyl0-C30 optionally substituted or linker ligand;

In one embodiment, the invention features a lipid of formula XXXVIII:

R1

XXXVIII where

E is O, S, N (Q), C (O), N (Q) C (O), C (O) N (Q), (Q) N (CO) O,

O (CO) N (Q), S (0), NS (O)2N (Q), S (O)2, N (Q) S (O)2, SS, O = N, aryl, heteroaryl, cyclic, or heterocycle;

Q is H, alkyl, ω-aminoalkyl,

-aminoalkyl (substituted), ω-phosphoalkyl or ω-thiophosphoalkyl;

Ri and R2 and Rx are each independently for each occurrence H, optionally substituted C1-C10 alkyl, alkyl

C10-Optionally substituted C30, alkenyl

C10-C30

IMPI

MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY

optionally substituted, optionally substituted C10-C30 alkynyl, optionally substituted C10-C30 acyl or linker ligand, provided that at least one of Ri, R2 and Rx don't be H;

R3 is H, Ci-C alkyl10 optionally substituted, alkenyl C2-C10 optionally substituted, alkynyl C2-Ci0 optionally substituted, alkylhetrocycle, alkylphosphate, alkylphosphorothioate, alkylphosphorodithioate, alkylphosphonates, alkylamines, hydroxyalkyl, ω-aminoalkyl, ω-aminoalkyl (substituted), optionally ω-phosphoalkyl, 40-glyphyl (m) substituted (mw 120-40K), heteroaryl, heterocycle or linker ligand; and n is 0, 1, 2 or 3;

or a salt or isomer thereof.

In some modalities, each of Ri and R2 is independently for each occurrence optionally substituted C10-C30 alkyl, optionally substituted C10-C30 alkenyl, C alkynyl10-C30 optionally substituted, optionally substituted C10-C30 acyl or linker ligand.

In some modalities, Rx it is H or optionally substituted C1-C10 alkyl.

In some modalities, Rx is alkyl Cio_C3or optionally substituted, optionally substituted C10-C30 alkenyl, Ci alkynyl0-C30 optionally substituted, acyl

Cio-C3or optionally substituted or linker ligand.

In one modality,

Ri and R2 is each one

IMPI ,,,.

INDEPENDENT MEXICAN INSTITUTE ^ Sten ^^ *

for each occurrence alkyl Ci0-C30 optionalmefTE ^ 'ngTOtrl-Luiüürr optionally substituted C10-C30 alkoxy, optionally substituted C10-C30 alkenyl, Ci alkenyloxy0-C30 optionally substituted, optionally substituted C10-C30 alkynyl, Ci alkynyloxy0-C30 optionally substituted or acyl Ci0-C30 optionally substituted or linker ligand.

In one modality, R3 is independently for each occurrence H, optionally substituted C1-C10 alkyl, C alkenyl2-Optionally substituted Cio, C-alkynyl2-C10 optionally substituted, optionally substituted alkylheterocycle, optionally substituted heterocycloalkyl, optionally substituted alkylphosphate, optionally substituted phosphoalkyl, optionally substituted alkylphosphorothioate, optionally substituted phosphorothioalkyl, optionally substituted, optionally substituted phosphorodithioalkyl, phosphorodithioalkyl, optionally substituted optionally substituted alkylamino, optionally substituted di (alkyl) amino, optionally substituted aminoalkyl, optionally substituted alkylaminoalkyl, optionally substituted di (alkyl) aminoalkyl, optionally substituted (PEG, mw

100-40K), optionally substituted hydroxyalkyl mPEG, optionally substituted optionally substituted polyethylene glycol, substituted or linker ligand.

In one embodiment, X and Y -O-, -S-, alkylene, -N (Q) -,

-N (Q) C (O) O-, -C (0) 0, -OC (O) O-,

heterocic Ί Γ> ηρΓ.ίηη3ΪτηοηΙ: α.

are each independently

-C (O) -, -O (CO) -, -OC (O) N (Q) -,

-OS (O) (Q2) O- or -OP (O) (Qs) O-.

In one embodiment, Q is H, alkyl, ω-aminoalkyl, ω-aminoalkyl (substituted), ω-phosphoalkyl, or ω-thiophosphoalkyl.

<td>In</td><td>a</td><td>modality,</td><td>Qi is independently</td><td>for</td><td>every</td>

<td>appearance</td><td>0 or</td><td>S.</td><td></td><td></td><td></td>

<td>In</td><td>a</td><td>modality,</td><td>Q2 is independently</td><td>for</td><td>every</td>

<td>appearance</td><td> 0,</td><td>S, N (Q) (Q),</td><td>alkyl or alkoxy,</td><td></td><td></td>

<td>In</td><td>a</td><td>modality,</td><td>Ai, A2, TO4, already5 are</td><td>every</td><td>one</td>

independently -O-, -S-, -CH2-, -CHR5-, -CR5R5-, -CHF- or

-CF2-.

In one embodiment, E is -O-, -S-, -N (Q) -, -C (O) -,

-C (O) N (Q) -, -N (Q) C (O) -, —S (O) -, -S (O)2-, -SS-, -ON =, = NO-, arylene, heteroarylene, cycloalkylene or heterocyclylene.

In one embodiment, i and j are each independently 0-10.

In some circumstances, R3 it is ω-aminoalkyl, ω-aminoalkyl (substituted), ω-phosphoalkyl or ω-thiophosphoalkyl; each of which is optionally substituted. Examples of ω-aminoalkyl groups (substituted)

IMPI ^ includes 2- (dimet i lamino) ethyl, 3- (άϋβορΓορϋβΛϊή ^ Γ ^ & ρΙ ^^^^

3- (N-ethyl-N-isopropylamino) -1-methylpropyl ._________.

In one embodiment, X and Y can independently be -O-, -S-, alkylene or —N (Q) -.

In one embodiment, the cationic lipid is chosen from the group consisting of lipids shown in Table 1 below.

Table 1: Some cationic lipids of the present invention.

<td>I |/ X / * \ ZXz'X = A == ZX / '' \ Z n = 0-6</td><td>Ζ '^ Χζ'χ -' ^ / ΧζΧΖ --- ' λ -Άζ-νΧΧζΧ = / \ = ZXXZ '^ nn = 0-6</td>

<td>pzXX / Vz / XX'Z'X xHXyF</ kz \ / \ X'vZ \ = / \ - / X / vz ' H</td><td></td>

IMP

MEXICAN INSTITUTE M INDUSTRIAL PROPERTY

<td></td><td>YXz ^ X ^ Xz ^ X = Z \ === z ^ XZ ~ N / 'vnA ^ / \ / XzzXz-'X¿ = / \ = z'X ^ 'X / 1</td>

<td></td><td>I ^zxx== andvz == ^^ ·</td>

<td>? z A ZX AV \ A / ~ \ z- '° B Vv -. ^ Z, .. / v _ / \ Zx /</td><td>- ^ nn ^ xcsCCCC</td>

<td>'' '// Λ ., - ',,. „... ,,. / -0 ~Ν~·<'-/</td><td>1% ZXZ- —x zAN-, , \ XXXXO> I saw n = 0-6</td>

IMPI

MEXICAN INSTITUTE. OF INDUSTRIAL PROPERTY

Although not all diastereomers for a lipid are shown, one aspect of the present invention is to provide all diastereomers, and as such chirally pure and diastereomerically enriched lipids are also part of the present invention.

In one modality, R3 is a linker ligand.

In particular embodiments, the lipids of the present invention are cationic lipids. As used herein, the term cationic lipid is intended to include lipid aguels having one or two fatty acid or fatty alkyl chains and a major amino group (including an alkylamino or dialkylamino group) that can be protonated to

IMPI form a cationic lipid at pH

INDUSTRIAL physiological. In

MEXICAN INSTITUTE OF PROPERTY

In some modalities, a cationic lipid is known as an amino lipid.

Other cationic lipids would include those that have alternative fatty acid groups or other dialkylamino groups, including those in which the alkyl substituents are different (eg, N-ethyl-N-methylamino-, N-propyl-N-ethylamino- and the like) . For those modalities where Rx and R2 they are both acyl or long chain alkyl groups, these can be the same or different. In general, lipids (eg, a cationic lipid) that have fewer saturated acyl chains are more easily dimensioned, particularly when complexes are dimensioned below 0.3 microns, for filter sterilization purposes. Cationic lipids containing unsaturated fatty acids with carbon chain length in the range of Cio to C are typical.2o Other scaffolds can also be used to separate the amino group (eg, the amino group from the cationic lipid) and the fatty acid or fatty alkyl portion of the cationic lipid. Suitable scaffolds are known to those of skill in the art.

In some embodiments, the cationic lipids of the present invention have at least one protonable or unprotonable group, so that the lipid is positively charged to

<td></td><td>37 IMPI INSTITUTO M £ XICAN <OF THE PROPERTY vVwáreMi INDUSTRIAL 7</td>

<td>a pH at physiological pH</td><td>or below it (eg pH 7.4),</td>

and neutral at a second pH, preferably at or above physiological pH. Such lipids are also known as cationic lipids. It will be understood, of course, that the addition or removal of protons as a function of pH is an equilibrium process, and that the reference to a charged or neutral lipid refers to the nature of the predominant species and does not require that all lipid is present in charged or neutral form. Lipids that have more than one protonable or deprotonatable group or that are zwitterionic are not excluded from use in the invention.

In some embodiments, the protonatable lipids (i.e., cationic lipids) according to the invention have a pKa from the protonatable group in the range of about 4 to about 11. Typically, the lipids will have a pKa of about 4 to about of 7, eg, between about 5 and 7, such as between about 5.5 and 6.8, when incorporated into lipid particles. Such lipids will be cationic at a lower pH formulation stage, while the particles will largely (but not completely) neutralize at the surface at physiological pH around pH 7.4. One of the benefits of a pKa in the range of around 4 and 7 is that at least some nucleic acid associated with the outer surface of the particle will lose its electrostatic interaction at physiological pH and will be removed by simple dialysis; that way

IMPI

INSTITUTO MEXICANO m la írofisuao reducing in grariNBHügdíd3

susceptibility of the particle to be purified.1 The pKa medigiunea of lipids within lipid particles can be carried out, for example, using the fluorescent 2- (p-toluidino) -6-naphthalene (TNS) fluorescent probe, using methods described in Cullis et al., ( 1986) Chem Phys Lipids

40, 127-144.

In one embodiment, the formulations of the invention are trapped by at least 75%, at least 80%, or at least 90%.

In one embodiment, the formulations of the invention additionally comprise an apolipoprotein. As used herein, the term "apolipoprotein or lipoprotein" refers to apolipoproteins known to those skilled in the art and variants and fragments thereof and to apolipoprotein agonists, analogs or fragments thereof described below.

Suitable apolipoproteins include, but are not limited to, ApoA-I, ApoA-II, ApoA-IV, ApoA-V, and ApoE, and active polymorphic forms, isoforms, variants, and mutants as well as fragments or truncated forms thereof. In some embodiments, apolipoprotein is a thiol-containing apolipoprotein. Thiol-containing apolipoprotein refers to an apolipoprotein, variant, fragment, or isoform that contains at least one residue of

IMPI

<td>cysteine.</td><td>MEXICAN INSTITUTE OF LA FROPIEDAl · » Thiol-containing apolipoproteinsNmoreTo thecommon</td>

are ApoA-I Milano (ApoA-IM) and ApoA-I Paris' (ΆρόΑ-ΊΡ) containing a cysteine residue (Jia et al., 2002, Biochem. Biophys. Res. Comm. 297: 206-13; Bielicki and Oda, 2002,

Biochemistry 41: 2089-96). ApoA-II, ApoE2 and ApoE3 are also thiol-containing apolipoproteins. Isolated ApoE and / or active fragments and polypeptide analogs thereof, including recombinantly produced forms thereof, are described in US Patent Nos. 5,672,685; 5,525,472; 5,473,039; 5,182,364; 5,177,189; 5,168,045; 5,116,739; the descriptions of which are incorporated herein by reference. ApoE3 is described in Weisgraber, et al., Human E apoprotein heterogeneity: cysteine-arginine interchanges in the amino acid sequence of the apo-E isoforms, J. Biol. Chem. (1981) 256: 9077-9083; and Rail, et al., Structural basis for receptor binding heterogeneity of apolipoprotein E from type III hyperlipoproteinemic subjects, Proc. Nat. Acad. Sci. (1982) 79: 4696-4700. See also GenBank accession number K00396.

In some embodiments, the apolipoprotein may be in its mature form, as a preproapolipoprotein, or as a proapolipoprotein. The homo- and heterodimers (when possible) of mature ApoA-I (Duverger et al., 1996, Arterioscler. Thromb. Vasc. Biol. 16 (12): 1424-29),

ApoA-I Milano (Klon et al., 2000, Biophys. J. 7 9: (3) 167 9-87.40

M.ÍXICaNQ XDUSTRtAl PROPERTY

DELA INSTITUTE

Franceschini et al., 1985, J. Biol. Chem. 2¿ ApoA-I Paris (Daum et al., 1999, J. Mol -22)

ApoA-II (Shelness et al., 1985, J. Biol. Chem. 260 (14): 863746; Shelness et al., 1984, J. Biol. Chem. 259 (15): 9929-35), ApoA-IV (Duverger et al., 1991, Euro. J. Biochem. 201 (2): 37383), and ApoE (McLean et al., 1983, J. Biol. Chem. 258 (14): 8993-9000) can also be used within the scope of the invention.

In some embodiments, the apolipoprotein may be a fragment, variant, or isoform of the apolipoprotein. The term fragment refers to any apolipoprotein that has a shorter amino acid sequence than that of a native apolipopoprotein and whose fragment retains the activity of the native apolipoprotein, including lipid binding properties. By variant is meant substitutions or alterations in the amino acid sequences of the apolipoprotein, whose substitutions or alterations, eg, additions and deletions of amino acid residues do not suppress the activity of native apolipoprotein, including lipid binding properties. Accordingly, a variant may comprise a protein or peptide having an amino acid sequence substantially identical to a native apolipoprotein provided herein in which one or more amino acid residues have been conservatively replaced with chemically similar amino acids. Examples

IMPI

INSTITUTO MEXICANO for conservative substitutions include the substitution and? W at least one hydrophobic residue such as isoleuc.ina ·, - ^ vaü-na ^, leucine or methionine for another. In the same way, the present invention contemplates, for example, the substitution of at least one hydrophilic residue such as, for example, between arginine and lysine, between glutamine and asparagine and between glycine and serine (see US Patent No. 6,004,925, 6,037,323 and 6,046,166). The term isoform refers to a protein that has the same function, major or partial, and similar, identical or partial sequence, and may or may not be the product of the same gene and usually tissue-specific (see Weisgraber 1990, J. Lipid Res. 31 (8): 1503-11, - Hixson and Powers 1991, J. Lipid Res. 32 (9): 1529-35; Lackner et al., 1985, J. Biol. Chem. 260 (2): 703-6 , - Hoeg et al., 1986, J. Biol. Chem. 261 (9): 3911-4, - Gordon et al., 1984, J. Biol. Chem.

259 (1): 468-74, - Powell et al., 1987, Cell 50 (6): 831-40, - Aviram et al., 1998, Arterioscler. Thromb. Go Biol. 18 (10): 161724; Aviram et al., 1998, J. Clin. Invest. 101 (8): 1581-90; Billecke et al., 2000, Drug Metab. Dispos. 28 (11): 1335-42, Draganov et al., 2000, J. Biol. Chem. 27 5 (43): 33435-42, Steinmetz and Utermann 1985, J. Biol. Chem. 2 60 (4): 2258 -64, Widler et al., 1980, J. Biol. Chem. 255 (21): 10464-71; Dyer et al., 1995, J. Lipid Res. 36 (1): 80-8, - Sacre et al., 2003, FEBS Lett. 540 (1-3): 181-7, - Weers, et al., 2003, Biophys. Chem. 100 (1-3): 481-92, - Gong et al., 2002, J. Biol. Chem.

277 (33): 29919-26; Ohta et al.,

1984,

IMPI

MEXICAN INSTITUTE OF LA, PROPERTY BreysTjuAL

259 (23): 14888-93 and US Patent No ·? —- 6, 372/806)

In some embodiments, the methods and compositions of the present invention include the use of an apolipoprotein chimeric construct. For example, a chimeric construct of an apolipoprotein may be comprised of an apolipoprotein domain with high lipid binding capacity associated with an apolipoprotein domain containing ischemic reperfusion protective properties. A chimeric construct of an apolipoprotein can be a construct that includes separate regions within an apolipoprotein (i.e., homologous construct) or a chimeric construct can be a construct that includes separate regions between different apolipoproteins (i.e., heterologous constructs). Compositions comprising a chimeric construct can also include segments that are apolipoprotein variants or segments designed to have a specific character (eg, lipid binding, receptor binding, enzymatic, enzyme activation, antioxidant, or reduction-oxidation property ) (see Weisgraber 1990, J. Lipid Res. 31 (8): 1503-11; Hixson and Powers 1991, J. Lipid Res. 32 (9): 1529-35, - Lackner et al., 1985, J. Biol Chem. 260 (2): 703-6, - Hoeg et al, 1986, J. Biol. Chem. 261 (9): 3911-4, - Gordon et al., 1984, J. Biol. Chem.

IMPI

MEXÍCaNi INSTITUTE,

OF THE PROTIEDAIÍ

INDUSTRIAL 259 (1): 468-74, - Powell et al., 1987, Cell 50 (6): 8? L-40; Aviram et al., 1998, Arterioscler. Thromb. Vasc. Biol. 18 (10): 161724; Aviram et al., 1998, J. Clin. Invest. 101 (8): 1581-90, Billecke et al., 2000, Drug Metab. Dispos. 28 (11): 1335-42; Draganov et al., 2000, J. Biol. Chem. 275 (43): 33435-42, Steinmetz and Utermann 1985, J. Biol. Chem. 2 60 (4): 2258-64, Widler et al., 1980, J. Biol. Chem. 255 (21): 10464-71, - Dyer et al., 1995, J. Lipid Res. 36 (1): 80-8, - Sorenson et al., 1999, Arterioscler. Thromb. Vasc. Biol. 19 (9): 2214-25, - Palgunachari 1996, Arterioscler. Throb. Vasc. Biol. 16 (2): 328-38: Thurberg et al., J. Biol. Chem. 271 (11): 6062-70, - Dyer 1991, J. Biol. Chem. 266 (23): 150009-15, - Hill 1998, J. Biol. Chem. 273 (47): 30979-84).

The apolipoproteins used in the invention also include recombinant, synthetic, semi-synthetic, or purified apolipoproteins. The methods for obtaining apolipoproteins or equivalents thereof used in the invention are well known in the art. For example, apolipoproteins can be separated from plasma or natural products by, for example, density gradient centrifugation or immunoaffinity chromatography, or produced synthetically, semi-synthetically, or using recombinant DNA techniques known to those skilled in the art (see, by eg, Mulugeta et al., 1998, J. Chromatogr. 798 (1-2): 83-90; Chung et al., 1980, J. Lipid Res. 21 (3): 28444

IMPI

MtXíCAHO INSTITUTE OF PROPERTY

INDUSTRIAL

91; Cheung et al., 1987, J. Lipid Res. 28 (8): 913-29; Persson, et al., 1998, J. Chromatogr. 711: 97-109; U.S. Patent Nos. 5,059,528, 5,834,596, 5,876,968 and

5,721,114; and PCT publications WO 86/04920 and WO 87/02062).

The apolipoproteins used in the invention additionally include apolipoprotein agonists such as peptides and peptide analogs that mimic the activity of ApoA-I, ApoA-I Milano (ApoA-IM) <ApoA-I Paris (ApoA-IP), ApoA-II, ApoA-IV, and ApoE. For example, the apolipoprotein may be any of those described in US Patent Nos. 6,004,925, 6,037,323, 6,046,166, and

5,840,688, the contents of which are incorporated herein by reference in their entirety.

The peptides or peptide analogs of apolipoprotein agonists can be synthesized or manufactured using any technique for peptide synthesis known in the art including, eg, the techniques described in US Patent Nos. 6,004,925, 6,037,323 and

6,046,166. For example, peptides can be prepared using the solid phase synthesis technique initially described in Merrifield (1963, J. Am. Chem. Soc. 85: 21492154). Other peptide synthesis techniques can be found in Bodanszky et al., Peptide Synthesis, John Wiley & Sons, 2to Ed., (1976) and other references available to those skilled in the art. A summary of polypeptide synthesis techniques can be found.

Young, Solid Phase Peptide.

Synthesis, T ± ·

INSTITUTO MF.XICAN ·. i DE LA PRONEDAt)

Company, Rockford, 111., (1984).

Peptides can also be synthesized by solution methods described in The

Proteins, Vol. II, 3d Ed., Neurath et. al., Eds.

Academic Press, New York, NY

(1976).

protectors suitable for use in different

p. 105-237,

Peptide synthesis groups are described in the texts mentioned above as well as in McOmie, Protective Groups in Organic

Chemistry, Plenum Press, New York, NY

(1973). The peptides of the present invention can also be prepared by chemical or enzymatic cleavage from larger portions of, for example, apolipoprotein AI.

In certain modalities, apolipoprotein can a mixture of apolipoprotein only type of apolipoprotein be apolipoproteins. In one embodiment, it can be a homogeneous mixture, i.e., apolipoproteins, heterogeneous apolipoproteins of the one apolipoprotein.

it can be that is, different.

one one

In another embodiment, the mixture mixes heterogeneously two or more

Modes of apolipoprotein mixtures may comprise, for example, an animal and a mixture of an apolipoprotein from an apolipoprotein source from a semisynthetic source. In some embodiments, a heterogeneous mixture may comprise, for example, a mixture of ApoA-I and ApoA-I Milano. In some modalities, a heterogeneous mixture can

MEXICAN INSTITUTE

DM INDUSTRIAL PROPERTY comprise, for example, a mixture of ApoA-I Milano and ApoA-I Paris. Mixtures suitable for use in methods and compositions of the invention will be apparent to one skilled in the art.

If apolipoprotein is obtained from natural sources, it can be obtained from a plant or animal source. If the apolipoprotein is obtained from an animal source, the apolipoprotein can be of any species. In some embodiments, apolipoprotein can be obtained from an animal source. In some embodiments, apolipoprotein can be obtained from a human source. In preferred embodiments of the invention, the apolipoprotein comes from the same species as the individual to whom the apolipoprotein is administered.

Lipid particles

The present invention also provides lipid particles comprising one or more of the cationic lipids described above. Lipid particles include, but are not limited to, liposomes. As used herein, a liposome is a structure that has lipid-containing membranes that enclose an aqueous interior. Liposomes can have one or more lipid membranes. The invention contemplates both single layer liposomes, termed unilamellar, and multilayer liposomes, termed multilamellar.

By complexing with nucleic acids, lipid particles

IMPI

MEXICAN INSTITUTE OF THE PKUHÍDAD also be

lipoplexes, which are composed of cationic lipid brcdpcl'a interspersed between layers of

DNA, as described, eg, in

Felgner, Scientific

The particles may comprise additional and / or other components

Other lipids can be included in liposomes of the present invention.

American.

additionally lipidic

<td colspan="2">the present</td><td>invention</td>

<td>one</td><td>or more</td><td>lipids</td>

<td>such</td><td colspan="2">like cholesterol.</td>

<td>the</td><td colspan="2">compositions of</td>

<td>for</td><td>various</td><td>effects,</td>

or to bind such as to prevent oxidation of lipid ligands to the liposome surface. Any amount of lipids can be present in liposomes of the present invention, including unfriendly, neutral, cationic and anionic lipids. Such lipids can be used alone or in combination. Specific examples of additional lipid components that may be present are described below.

Additional components that may be present in a lipid particle of the present invention include bilayer stabilizing components such as polyamide oligomers (see, eg, US Patent No. 6,320,017), peptides, proteins, detergents, lipid derivatives, such as PEG coupled to phosphatidylethanolamine and PEG conjugated to ceramides (see, US Patent No.

5,885,613).

IMPI

MEXICAN INSTITUTE

OF LA FROHEDAn

INDUSTRIAL

In particular embodiments, the lipid particles include one or more than a second amino lipid or cationic lipid, a neutral lipid, a sterol, and a lipid that is selected to reduce aggregation of lipid particles during formation, which may result from spherical stabilization. of particles that prevents charge-induced aggregation during formation.

Examples of lipids that reduce particle aggregation during formation include polyethylene glycol (PEG) modified lipids, monosialoganglioside Gml, and polyamide (PAO) oligomers such as (described in US Patent No. 6,320,017). Other hydrophilic and spherical barrier uncharged portion compounds that prevent aggregation during formulation, such as PEG, Gml, or ATTA, can also be lipid-coupled for use as in the methods and compositions of the invention. ATTA lipids are described, eg, in US Patent No. 6,320,017, and lipid PEG conjugates are described, eg. , in US Patent Nos. 5, 820, 873, 5, 534,499 and 5,885,613. Typically, the concentration of the lipid component selected to reduce aggregation is around 1 to 15% (per lipid mole percent).

Specific examples of PEG-modified lipids (or lipid-polyoxyethylene conjugates) that are useful in the present invention may have various lipid moieties.

MEXICAN INSTITUTE „. ί * η. ,, FROM THE PWI'IEUAIJ anchor to secure the PEG portion to the l'a! Xi;Lipid vesicle SWp. Lipid Examples — mod ^ -ficadub UdTf

Suitable PEGs include PEG-modified ceramide conjugates (eg PEG-CerC14 or PEG-CerC20), which are described in USSN 08 / 486,214 co-pending, incorporated herein by reference, PEG-modified dialkylamines and PEG-modified 1,2-diacyloxypropan-3-amines. PEG-modified diacylglycerols and dialkylglycerols are particularly preferred.

In embodiments where a spherically large portion such as PEG or ATTA is conjugated to a lipid anchor, the selection of the lipid anchor depends on what type of association the conjugate will have with the lipid particle. It is well known that mPEG (mw2000) diastearoylphosphatidylethanolamine (PEG-DSPE) will remain associated with a liposome until the particle is removed from circulation, possibly within days.

Conjugates such as PEG-CerC20 have resistance capabilities.

However, PEG-CerC14 is rapidly exchanged from the formulation after exposure to serum, with Ti / 2 less than 60 min. in some trials. As illustrated in US patent application SN

08 / 486,214, at least three characteristics influence the rate of change: length of the acyl chain, saturation of the

IΜ ΡI SiB

MEXICAN INSTITUTE

Industrial Industrial PROPERTY * to acyl chain and size of main group with steric barrier. Compounds having suitable variations of these characteristics can be useful for the invention. For some therapeutic applications it may be preferred that the PEG-modified lipid rapidly disappear from the nucleic acid-lipid particle in vivo and therefore the PEG-modified lipid will possess relatively short lipid anchors. In other therapeutic applications, it may be preferred that the nucleic acid-lipid particle exhibit a longer plasma circulation life and therefore the PEG-modified lipid will possess relatively longer lipid anchors.

It should be noted that compounds that prevent aggregation do not necessarily require lipid conjugation to function properly. Free PEG or free ATTA in solution may be sufficient to prevent aggregation. If the particles are stable after formulation, PEG or ATTA can be dialyzed prior to administration to a subject.

Neutral lipids, being present in the lipid particle, can be any of a number of lipid species that exist either in neutral zwitterionic form or without charge at physiological pH. Such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, and

IMPI.

Mexican Institute Í4 cerebrosidos. The selection of neutral lipids pajp & ^^^ i ^ n

Particles described herein are gj.1 lacia · taking into account, eg, the size of the liposome and the stability of the liposomes in the bloodstream.

Preferably, the neutral lipid component is a lipid having two acyl groups (i.e., diacylphosphatidylcholine and diacylphosphatidylethanolamine)

Lipids having different acyl chain groups of various chain lengths and degree of saturation are available or can be isolated or synthesized by well known techniques. In a group of modalities, lipids containing saturated fatty acids with carbon chain lengths in the Ci range are preferred0 a C2q.

In another group of modalities, lipids with mono or diunsaturated fatty acids with carbon chain lengths in the range of Cio to

C2or · Additionally, lipids having mixtures of saturated and unsaturated fatty acid chains can be used. Preferably, the neutral lipids used in the present invention are DOPE,

DSPC, POPC,

DPPC or any related phosphatidylcholine.

The neutral lipids useful in the present invention can also be composed of sphingomyelin, dihydrosphingomyelin, or phospholipids with other major groups, such as serine and inositol.

The sterol component of the lipid mixture, being

IM PI

MEXICAN INSTITUTE

OF THE PROPERTY

INDUSTRIAL present, can be any of those sterols conventionally used in the preparation of liposomes, lipid vesicles or lipid particles. A preferred sterol is cholesterol.

Other cationic lipids having a net positive charge of around physiological pH, in addition to those specifically described above, can also be included in lipid particles of the present invention. Such cationic lipids include, but are not limited to, N, N-dioleyl-N, N-dimethylammonium chloride (DODAC); N- (2,3-dioleyloxy) propyl-N, NN-triethylammonium chloride (DOTMA); N, N-distearyl-N, N-dimethylammonium bromide (DDAB); N- (2,3-dioleoyloxy) propyl) -N, N, N-trimethylammonium chloride (DOTAP); 1,2-Dioleyloxy-3-trimethylaminopropane chloride salt (DOTAP.Cl); 3 - (N- (N ', N'-dimethylaminoethane) carbamoyl) cholesterol (DC-Chol), N- (l (2,3-dioleyloxy) propyl) -N-2- (sperminecarboxamido) ethyl) -N trifluoroacetate, N-dimethyl ammonium (DOSPA), dioctadecylamidoglycyl carboxy spermine (DOGS),

1,2-dileoyl-sn-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-3dime tilamoni propane or (DODAP),

N, N-dimethyl-2,3-diioleyloxy) propylamine (DODMA), and N (1,2-dimyristyloxyprop-3-yl) -N, N-dimethyl-N-hydroxyethyl (DMRIE) ammonium bromide. Additionally, a number of commercial cationic lipid preparations can be used such as,

F5T · »

IMPI

MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY eg. , LIPOFECTIN (including DOTMA and DOPE, available in

GIBCO / BRL), and LIPOFECTAMINE (comprising DOSPA and DOPE, available at GIBCO / BRL). In particular embodiments, a cationic lipid is an amino lipid.

Anionic lipids suitable for use in lipid particles of the present invention include, but are not limited to, phosphatidylglycerol, cardiolipin, diacilfosfatidilserina, diacylphosphatidic acid, phosphatidylethanolamine N-dodecanoyl phosphatidylethanolamine N-succinyl phosphatidylethanolamine N-glutaryl, lisilfosfatidilglicerol and other anion modifying groups attached to neutral lipids.

In numerous embodiments, unfriendly lipids are included in lipid particles of the present invention.

Unfriendly lipids refer to any suitable material, where the hydrophobic portion of the lipid material is routed to the hydrophobic phase, while the hydrophilic portion is routed to the aqueous phase. Such compounds include, but are not limited to, phospholipids, aminolipids, and sphingolipids.

Representative phospholipids include sphingomyelin, phosphatidi1choline, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidiylcholine, dioleoylphosphatidylcholine, lysoliphatylphosphatidylcholine, lysoliphenylphosphatidylcholine, lysophilidine

IMPI

MEXICAN INSTITUTE. '

OF THE PROPERTY

INDUSTRIAL

dilinoleoylphosphatidylcholine. Other phosphorous-free compounds can also be used, such as sphingolipids, glycosphingolipid families, diacylglycerols, and δ-acyloxy acids.

Additionally, such unfriendly lipids can be easily mixed with other lipids, such as triglycerides and sterols.

Programmable fusion lipids are also suitable for inclusion in the lipid particles of the present invention. Such lipid particles have little tendency to fuse with cell membranes and manage their payload until a certain signal event occurs. This allows the lipid particle to distribute more evenly after injection into an organism or disease site before it begins to fuse with cells. The signal event may be, for example, a change in pH, temperature, ionic environment, or time. In the latter case, a hidden or fusion-retardant component, such as an ATTA-lipid conjugate or a PEG-lipid conjugate, may simply be exchanged from the lipid particle membrane over time. By the time the lipid particle is properly distributed in the body, it has lost enough hidden agent to be fusogenic. With other signal events, it is desired to choose a signal that is associated with the target cell or disease site, such as increased temperature at the site of the

inflammation.

Lipids of the present invention using target portions that are specific targeting of target portions, cell surface, of a tissue or cell type. Lipid particles using various such as ligands, glycoprotein receptors, vitamins (eg, riboflavin), and monoclonal antibodies have been previously described (see eg, US Patent Nos. 4,957,773 and 4,603,044). The target portions may comprise the entire protein or fragments thereof. Targeting mechanisms generally govern that target agents are positioned on the surface of the lipid particle such that the target portion is available to interact with the target, eg, a cell surface receptor. Various target agents and methods are known and available in the art, including those described, eg. , in Sapra, P. and Alien, TM, Prog. Lipid Res. 42 (5): 439-62 (2003); and Abra, RM et al., <J. Liposome Res. 12: 1-3, (2002).

The use of lipid particles, i.e. liposomes, with a surface coating of hydrophilic polymer chains, such as chains, has been proposed.

Biochimica et Biophysica Acta 1237: 99-108 (1995);

DeFrees, polyethylene glycol (PEG), for targeting (Alien, et al.,

HST1TUTO MEXICANA et al., Journal of the American Chemistry Socfety

6104 (nineteen ninety six); Blume, et al., Biochimica ot · yoophyoica Aofeia · 1149: 180-184 (1993); Klibanov, et al., Journal of Liposome Research 2: 321-334 (1992); US Patent No. 5,013556; Zalipsky, Bioconjugate Chemistry 4: 296-299 (1993); Zalipsky, FEBS Letters 353: 71-74 (1994); Zalipsky, in Stealth Liposomes Chapter 9 (Lasic and Martín, Eds) CRC Press, Boca Ratón F1 (1995). In one approach, a ligand, such as an antibody, to direct the lipid particle binds to a major polar group of lipids that form the lipid particle. In another approach, the target ligand binds to the distal ends of the PEG chains to form the hydrophilic polymeric coating (Klibanov, et al., Journal of Liposome Research 2: 321-334 (1992); Kirpotin et al., FEBS Letters 388: 115-118 (1996)).

Standard methods can be used for coupling of target agents. For example, phosphatidylethanolamine, which can be activated for binding of target agents or derived lipophilic compounds, such as a lipid derived bleomycin can be used. Antibody targeting liposomes can be constructed using, for example, liposomes incorporating protein A (see, Renneisen, et al., J. Bio. Chem., 265: 16337-16342 (1990) and Leonetti, et al., Proc. Nati Acad Sci. (USA), 87: 2448-2451 (1990). Other examples of antibody conjugation are

described in US Patent No. 6, 027, 72¿7 'JWyas' demos are incorporated into this reference. Examples of target portions can also include other proteins, specific to cellular components, including antigens associated with neoplasms or tumors. Proteins used as target portions can bind to liposomes through covalent bonds (see Heath, Covalent Attachsnent of Proteins to Liposomes, 149 Methods in Enzymology 111-119 (Academic Press, Inc. 1987)). Other target methods include the biotin-avidin system.

In an exemplary embodiment, the lipid particle comprises a mixture of a cationic lipid of the present invention, neutral lipids (other than cationic lipids), a sterol (eg, cholesterol), and a PEG-modified lipid (eg, a PEG-DMG or PEG-DMA). In some embodiments, the lipid mixture consists of or consists essentially of a cationic lipid of the present invention, a neutral lipid, cholesterol, and a PEG-modified lipid. In further preferred embodiments, the lipid particle consists of or consists essentially of the above lipid mixture in molar ratios of about 20-70% amino lipid: 5-45% neutral lipid: 20-55% cholesterol: 0.5-15 % of lipid modified with PEG.

In one embodiment, the lipid particle comprises at least two lipids described herein. For example,

IMPI

MEXICAN INSTITUTE

FROM LA FROPJEIJAL ·

<td>you can use a mix</td><td>INDUSTRIAL of cationic lipids '-' in a particle</td>

<td>lipid, so</td><td>that the mixture comprises 20-60% of the</td>

total lipid content on a molar basis.

In particular embodiments, the lipid particle consists of or consists essentially of a cationic lipid chosen from Table 1, DSPC, Col, and either PEG-DMG or PEG-DMA, eg, in a molar ratio of about 20-60 % cationic lipid: 5-25% DSPC: 25-55% Col: 0.5-15% PEG-DMG or PEG-DMA. In particular embodiments, the molar lipid ratio is approximately 40/10/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA), 35/15/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA) or 52/13/30/5 (mol% of cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA). In another group of modalities, the neutral lipid, DSPC, in these compositions is replaced with POPC, DPPC, DOPE or SM.

Lipid particle-therapeutic agent compositions and formulations

The present invention includes compositions comprising a lipid particle of the present invention and an active agent, where the active agent is associated with the lipid particle. In particular embodiments, the active agent is a therapeutic agent. In particular embodiments, the active agent is encapsulated within an aqueous interior of the lipid particle. In other embodiments, the active agent is present within a

MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY or more lipid layers of

lipid particle. In other embodiments, the active agent is attached to the outer or inner lipid surface of a lipid particle.

Fully encapsulated as used herein indicates that the nucleic acid in the particles does not degrade significantly after exposure to serum or a nuclease assay that would degrade free nucleic acids considerably. In a fully encapsulated system, less than 25% of the nucleic acid in the particle is preferably degraded in a treatment that would normally degrade 100% of the free nucleic acid, more preferably less than 10% and even more preferably less than 5% of the nucleic acid of the particle. Alternatively, complete encapsulation can be determined by an Oligreen® assay. Oligreen® is an ultra sensitive fluorescent nucleic acid strain for quantifying oligonucleotides and single stranded DNA in solution (available from Invitrogen Corporation, Carlsbad, CA). Fully encapsulated also suggests that

<td>particles are stable in</td><td colspan="3">serum which means it doesn't</td>

<td>quickly break down</td><td>in their</td><td colspan="2">component parts to</td>

<td>administered in vivo.</td><td></td><td></td><td></td>

<td>Active agents,</td><td>such as</td><td>is used in</td><td>Present,</td>

include any molecule or compound capable of exerting a ν

effects can be biological, physiological

IMPI

INSTITUTO MEXlCANt> DI INDUSTRIAL PROPERTY desired effect on a cell, tissue, organ or subject. Such or cosmetic, for

example.

The active agents can be of any type of compound molecule, including, eg, nucleic acids, polypeptide peptides, including, eg, antibodies, such as, eg, polyclonal antibodies, monoclonal antibodies, antibody fragments;

Humanized Antibodies, Recombinant Recombinant Antibodies, Human Antibodies and Primatized ™ Antibodies, Cytokines, Growth Factors, Apoptotic Factors, Differentiation-Inducing Factors, Cell Surface Receptors and Their Ligands; hormones and small molecules, including molecules or small organic compounds.

In one embodiment, the active agent is a therapeutic agent or a salt or derivative thereof. Derivatives of therapeutic agents can be therapeutically active in themselves or can be prodrugs, which become active upon further modification. Accordingly, in one embodiment, a therapeutic agent derivative retains little or all of the therapeutic activity compared to an unmodified agent, while in another embodiment, a therapeutic agent derivative lacks therapeutic activity.

In various modalities, effective therapeutic agents, such as anti-inflammatory compounds, include any therapeutically antidepressant, stimulant, analgesic agent or drug 'birth control medications

vasodilators, antiangiogens, cytovascular agents, signal transduction inhibitors, cardiovascular drugs, vasoconstrictors,

In certain eg, antiarrhythmic agents, hormones and spheroids.

In modalities, the therapeutic agent is an oncological drug, which also antitumor, anticancer drug, can be called a tumor drug, an antineoplastic agent or the like. Examples of oncological drugs that can be used in accordance with the invention include, but are not limited to, adriamycin, alkeran, allopurinol, altretamine, azathioprine, intravenous, carboplatin, amifostine, anastrozole, araC, arsenic trioxide, bexarotene, busulfan carmustine, biCN , oral,

CCNU, bleomycin, capecitabine busulfan (Xeloda), celecoxib, chlorambucil, cisplatin, cladribine, cyclosporin A, cytarabine, cytosine arabinoside, dexamethasone, doxorubicin, daunorubicin, dexrazoxane,

DTIC, phosphate, etoposide and fluorouracil, 5-FU, ozogamycin, idarubicin, cytoxan acetate, dodetaxel, daunorubicin, doxorubicin, epirubicin, estramustine, etoposide

VP-16, exemestane, FK506, fludarabine, gemcitabine gemtuzumabde ifosfamide, goserelin, hydrea mesylate, imatinib, hydroxyurea, interferon, irinotecan (Camptostar, leucovorin,

leustatin, leuprolide, levamisole, litretinoin, megaTstLrol7 melphalan, L-PAM, mesna, methotrexate, metoxsalen ramycin, mitomycin, mitoxantrone, nitrogen mustard, paclitaxel, pamidronate, Pegademasa, pentostatin, prednisone, rituxan, streptozocin, STI-571, tamoxifen, tamoxifen, teniposide, VM-26, topotecan (Hycamtin), toremifene, tretinoin, ATRA, valrubicin, velban, vinblastine, vincristine, VP16, and vinorelbine. Other examples of oncological drugs that can be used in accordance with the invention are ellipticin and ellipticin analogs or derivatives, epothilones, intracellular kinase inhibitors and camptothecins.

Nucleic acid-lipid particles

In some embodiments, the lipid particles of the present invention are associated with a nucleic acid, which results in a nucleic acid-lipid particle. In particular embodiments, the nucleic acid is completely encapsulated in the lipid particle. As used herein, the term nucleic acid is intended to include any oligonucleotide or polynucleotide. Fragments containing up to 50 nucleotides are generally called oligonucleotides, and longer fragments are called polynucleotides. In particular embodiments, the oligonucleotides of the present invention are 15-50

IMPIOS and , USTITUTO MSXXAN.>

nucleotides in length. 06^ noust ^ l

In the context of the present invention, the terms "polynucleotide" and "oligonucleotide" refer to a polymer or oligomer of nucleotide or nucleoside monomers consisting of naturally-occurring base, sugar and inter-sugar linkages. The terms polynucleotide and oligonucleotide also include polymers or oligomers that comprise monomers that are not naturally occurring or portions thereof that function similarly. Often such modified or substituted oligonucleotides are preferred over native forms due to properties such as, for example, improved cellular absorption and increased stability in the presence of nucleases.

The nucleic acid that is present in a lipid-nucleic acid particle according to the present invention includes any known form of nucleic acid. The nucleic acids used herein can be single-stranded DNA or RNA or double-stranded DNA or RNA or DNA-RNA hybrids. Examples of double stranded DNA include structural genes, genes including control and termination regions, and self-replicating systems such as viral or plasmid DNA. Examples of double stranded RNA include siRNA and other RNA interference reagents. Single-stranded nucleic acids include, eg. , antisense oligonucleotides, ribozymes, microRNAs and triplex-forming oligonucleotides. The nucleic acid that is present in a lipido-nucleic acid particle of this invention can include one or more of the oligonucleotide modifications described below.

The nucleic acids of the present invention can have different lengths, which generally depend on the particular form of the nucleic acid. For example, in particular modalities, the plasmids or genes can be about 1,000 to 100,000 nucleotide residues in length. In particular embodiments, the oligonucleotides can range from about 10 to 100 nucleotides in length. In various related embodiments, single-stranded, double-stranded, and triple-stranded oligonucleotides can range in length from about 10 to about 50 nucleotides, from about 20 to about 50 nucleotides, from about 15 to about 30 nucleotides, between about 20 and about 30 nucleotides in length.

In particular embodiments, the oligonucleotide (or a filament thereof) of the present invention specifically hybridizes with or is complementary to a target polynucleotide. Specifically hybridizable and complementary are terms used to indicate a sufficient level of complementarity such that stable and specific binding occurs between the target DNA or RNA and the

IMPI

MEXICAN INSTITUTE OF LA FROPIEL'AD

oligonucleotide. It is believed to be 100% industrial complementary that an oligonucleotide does not need its obj etive nucleic acid sequence to be specifically hybridizable.

An oligonucleotide is specifically hybridizable when the binding of the oligonucleotide to the target interferes with the normal functioning of the target molecule causing a loss of utility or expression thereof, and there is a sufficient level of complementarity to avoid non-specific binding of the oligonucleotide to non-target sequences. under conditions where the specific union is desired, that is, under physiological conditions in the case of in vivo tests therapeutic treatment or in the case of in vitro tests under conditions where the tests are conducted. Therefore, in other embodiments, this oligonucleotide includes

1,2 or base substitutions, eg. discrepancies, as compared to the region of a gene or mRNA sequence that it is specifically targeting or hybridizing to.

Nucleic acids from RNA interference

In particular embodiments, the nucleic acid-lipid particles of the present invention associate with RNA interference molecules (iRNA). RNA interference methods using iRNA molecules can be used to alter the expression of a gene or polynucleotide of interest. Small interference RNA (siRNA) essentially replaced the next generation ODN of

I

MLXICANO INSTITUTE antisense and ribo ^ fWá ^ sTwaom

oligonucleóh-í t drugs - í gi development.

SiRNAs are long-duplex RNA nucleotides typically 16-30 that can be associated with a multiprotein cytoplasmic complex known as iRNA-induced silencing complex (RISC). The RISC loaded with siRNA mediates the degradation of homologous mRNA transcripts, therefore, siRNA can be designed to reduce protein expression with high specificity. Unlike other antisense technologies, the function of siRNA through a natural mechanism evolved to control gene expression through non-coding RNA. This is generally considered the reason why its activity is more potent in vitro and in vivo than antisense ODNs or ribozymes. A variety of iRNA reagents, including siRNA targeting clinically relevant targets, are currently in pharmaceutical development, as described in eg. Fougerolles, A. et al., Nature Reviews 6: 443-453 (2007).

While the first described iRNA molecules were RNA: RNA hybrids comprising both sense RNA and antisense RNA strands, it has now been shown that sense DNA: antisense RNA hybrids, sense RNA: antisense DNA hybrids and DNA hybrids: DNA

they are capable of mediating iRNA (Lamberton, JS and Christian, AT, (2003) Molecular Biotechnology 24: 111-119). Therefore, the invention includes the use of iRNA molecules that comprise any of these different types of double-stranded molecules. Furthermore, it is understood that iRNA molecules can be used and introduced into cells in various ways. Accordingly, as used herein, iRNA molecules comprise any and all molecules capable of inducing an iRNA response in cells, including but not limited to double-stranded oligonucleotides that comprise two separate strands, this is, a sense filament and an antisense filament, eg. Small interference RNA (siRNA); a double-stranded oligonucleotide comprising two separate strands that are linked together by a non-nucleotidyl bond; oligonucleotides that comprise a hairpin loop of complementary sequences, which forms a double-stranded region, eg. iRNAsh molecules and expression vectors expressing one or more polynucleotides capable of forming a double-stranded polynucleotide alone or in combination with another polynucleotide.

A single stranded siRNA compound as used herein is a siRNA compound consisting of a single molecule. May include a double region formed by intra-filament mating, eg, may be or include

... Dl PROPERTY a fork or girdle structure. Compounds ^ fd ^ '- ^ i single filament can be antisense with ^ TOopeet a1 The target molecule.

A single stranded siRNA compound may be long enough to enter the RISC and participate in the RISC-mediated cleavage of a target mRNA. A single stranded siRNA compound is at least 14 and in other embodiments at least 15, 20, 25, 29, 35, 40 or 50 nucleotides in length. In some embodiments, it is less than 200, 100, or 60 nucleotides in length.

Hairpin-like siRNA compounds will have a double region equal to or at least 17, 18, 19, 29, 21, 22,

23, 24 or 25 nucleotide pairs. The double region will be equal to or less than 200, 100 or 50 in length. In some embodiments, the ranges for the double region are 15-30, 17-23, 19-23, and 19-21 nucleotide pairs in length. The fork may have a single strand surplus or odd terminal region. In some embodiments, the surplus is 2-3 nucleotides in length. In some embodiments, the surplus is located on the fork side and in some embodiments on the antisense side of the fork.

A double-stranded siRNA compound as used herein is a siRNA compound that includes more than one, in some cases two, strands where hybridization

MEXICAN INSTITUTE OF PROPERTY interchain can form a region of structure

The antisense strand of a double-stranded yi'RNft-compound can be equal to or at least 4, 15, 16, 17, 18, 19, 25, 29, 40 or 60 nucleotides in length. It can be equal to or less than 200, 100 or 50 nucleotides in length. Ranges can be 17 to 25, 19 to 23, and 19 to 21 nucleotides in length. As used herein, the term "antisense strand" means that the strand of a siRNA compound is sufficiently complementary to the target molecule, eg. an objective RNA.

The sense strand of a double-stranded siRNA compound can be equal to or at least 14, 15, 16, 17, 18, 19, 25, 29, 40 or 60 nucleotides in length. It can be equal to or less than 200, 100 or 50 nucleotides in length. Ranges can be 17 to 25, 19 to 23, and 19 to 21 nucleotides in length.

The double-stranded portion of a double-stranded siRNA compound can be equal to or at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 29, 40, or 60 pairs nucleotide in length. It can be equal to or less than 200, 100 or 50 nucleotide pairs in length. Ranges can be 15-30, 17-23, 19-23, and 19-21 nucleotide pairs in length.

In many embodiments, the siRNA compound is long enough to be cleaved by an endogenous molecule, eg, by Dicer,

INSTITUTO MÍXICAN ·),. FROM PROMtOAD to produce smaller siRNA © mpuest © eg siRNA agents ---- Sense and antisense strands can be chosen such that the double stranded siRNA compound includes a single strand or odd region at one or both ends of the molecule. Thus, a double-stranded siRNA compound can contain sense and antisense chains, arranged in pairs to contain a surplus, eg, one or two 5 'or 3' surpluses or a 3 'surplus of 1 3 nucleotides. Surpluses can result from one chain being longer than the other or from two chains of the same length being staggered. Some modalities will have at least a 3 'surplus. In one embodiment, both ends of a siRNA molecule will have a 3 'surplus. In some embodiments, the surplus is 2 nucleotides.

In some embodiments, the length of the double region is between 15 and 30, or 18, 19, 20, 21, 22, and 23 nucleotides in length, eg, in the range of the ssiRNA compound discussed above. The ssiRNA compounds can resemble in length and structure to natural Dicer processed products from long dsiRNAs. Also included are modalities where the two chains of the ssiRNA compound are linked, eg, covalently linked. Hairpins or other single strand structures that provide the required dual strand region and a 3 'surplus as well

IMPIg. INSTITUTO, S.lMlCAI'io are compreri ^, '^^ invention.

The siRNA compounds described herein, including the double-stranded siRNA compounds and the single-stranded siRNA compounds can mediate the silencing of a

Obj ective RNA, eg, mRNA, eg, a transcript of a gene encoding a protein.

For convenience, such mRNA is also referred to herein as mRNA to be silenced. Such a gene is also called a target gene. In general, the RNA to be silenced is an endogenous gene or a pathogenic gene.

In addition, non-mRNA RNAs, eg, tRNAs and viral RNAs, can also be targeted.

As used herein, it refers to the ability to silence the middle iRNA phrase of a target RNA in a specific sequence form. Without intending to limit yourself to

<td colspan="2">theory, it</td><td>do you think he</td><td colspan="2">silencing</td><td>uses</td><td>mechanisms</td><td>or</td>

<td>processes</td><td colspan="2">iRNA and an RNA</td><td>guide,</td><td>eg</td><td>a</td><td>compound</td><td>of</td>

<td>ssiRNA of</td><td>21 a</td><td>23 nucleotides</td><td> ! .</td><td></td><td></td><td></td><td></td>

<td>In</td><td>a</td><td>modality,</td><td>the</td><td>compound</td><td>of</td><td>siRNA</td><td>is</td>

sufficiently complementary to a target RNA, eg, a target mRNA, that the siRNA compound silences the production of a protein encoded by the target mRNA. In another embodiment, the siRNA compound is exactly complementary to the target RNA, eg, RNA

UNSUITED siRNA are tuned, exclusively by pairing the region of sufficiently complementary · Aryan target and compound to form a hybrid formed exact Watson-Crick bases. A target RNA can include an internal region (eg, at least 10 nucleotides) that is exactly complementary to a target RNA. Furthermore, in some embodiments, the siRNA compound specifically discriminates a single nucleotide difference. In this case, the siRNA compound only mediates iRNA if the exact complementarity is in the region (eg, within 7 nucleotides of) the difference of a single nucleotide.

MicroRNA

MicroRNAs (miRNAs) are a highly conserved class of small RNA molecules that are transcribed from DNA into plant and animal genomes, but are not translated into proteins. Processed miRNAs are single-stranded RNA molecules, having ~ 17-25 nucleotides (nt) that are incorporated into the RNA-induced silencing complex (RISC) and have been identified as key regulators of cell development, proliferation, apoptosis, and differentiation . These are believed to play a role in regulating gene expression by binding to the 3 'untranslated region of specific mRNAs. The RISC mediates sub73 translational regulation,

IMPI

INSTITUTO MtXiCANí> DE LA PROHfcüAl. · 'Gene expression through theNOT'i'ffhÍbi

the cleavage of the transcript- ty 'both ·. · The

RISC is also involved in transcriptional silencing in the nucleus of a eukaryote.

The number of wide range miRNA sequences identified to date is numerous and increasing; Illustrative examples of these can be found, for example, in: miRBase: microRNA sequences, targets and gene nomenclature Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. NAR, 2006, 34, Database Issue, D140-D144; The microRNA Registry Griffiths-Jones S. NAR, 2004, 32, Database Issue, D109-D111; and also at http://microrna.sanger.ac.uk/sequences/.

Antisense oligonucleotides

In one embodiment, a nucleic acid is an antisense oligonucleotide targeting a target polynucleotide.

The term antisense or simply antisense oligonucleotide is intended to include oligonucleotides that are complementary to a targeted polynucleotide sequence. Antisense oligonucleotides are filaments of

DNA or RNA that are complementary to a chosen sequence, eg. a target gene mRNA. Antisense oligonucleotides are believed to inhibit gene expression

IMPI ^

INSTITUTO MEXICAN · by binding to a complementary mRNA. The goal ^ sTÍ ^ t nwEK target can lead to inhibition d? .___ ιιη.? ^ xproGión · gene either avoiding the translation of complementary mRNA filaments by binding to is or leading to the degradation of the target mRNA. Antisense DNA can be used to target specific complementary RNA (coding or non-coding). If binding is performed this DNA / RNA hybrid can be degraded by the RNase H enzyme. In particular embodiments, antisense oligonucleotides contain from about 10 to about 50 nucleotides, more preferably from about 15 to about 30 nucleotides. . The term also encompasses antisense oligonucleotides that may not be exactly complementary to the desired target gene. Accordingly, the invention can be used in cases where specific non-target activities meet antisense or where an antisense sequence containing one or more discrepancies with the target sequence is most preferred for a particular use.

Antisense oligonucleotides have been shown to be effective and targeted inhibitors of protein synthesis, and consequently can be used to specifically inhibit protein synthesis by a targeted gene.

The efficacy of antisense oligonucleotides has been demonstrated to inhibit protein synthesis. For example, the

m ia rtKWSOA »; aáeTO synthesis of polygalactauronase and the muscarinic type 2 receptor are inhibited by - »c> 1'i gort u ul eút 'i ctos * antisense directed to their corresponding mRNA sequences (US patent 5,739,119 and US patent 5,759,829). Furthermore, examples of antisense inhibition have been demonstrated with cyclin nuclear protein, the multi-drug resistance gene (MDG1), ICAM-1, E-selectin, STK-1, GABA receptor.to striatal and human EGF (Jaskulski et al., Science. 1988 Jun 10; 240 (4858): 1544-6; Vasanthakumar and Ahmed, Cancer Commun. 1989; 1 (4): 225-32; Peris et al., Brain Res Mol Brain Res. 1998 Jun 15; 57 (2): 310-20; US Patent 5,801,154; US Patent 5,789,573; US Patent 5,718,709 and US Patent 5,610,288). Furthermore, antisense constructs that inhibit and can be used to treat various abnormal cell proliferations have also been described, eg. cancer (US Patent 5,747,470; US Patent 5,591,317 and US Patent 5,783,683).

Methods for producing antisense oligonucleotides are known in the art and can be easily adapted to produce an antisense oligonucleotide that targets any polynucleotide sequence. Selection of specific antisense oligonucleotide sequences for a given target sequence is based on analysis of the chosen target sequence and determination of structure

IMPI secondary, TmAntisense oligonucleotide stability, binding energy, and stability can be selected ^ based on their relative inability to form dimers, hairpins, or other secondary structures that would reduce or prohibit specific binding to the target mRNA in a host cell. Highly preferred target regions of mRNA include those regions at or near the AUG translation initiation codons and those sequences that are substantially complementary to 5 'regions of mRNA. These secondary structure analyzes and target site selection considerations can be carried out, for example, using v.4 of the OLIGO primer analysis software (Molecular Biology Insights) and / or the BLASTN 2.0.5 algorithm software ( Altschul et al., Nucleic Acids Res. 1997, 25 (17): 3389-402).

Antagomir

Antagomirs are RNA-like oligonuc leotides that host various modifications for ribonuclease protection and pharmacological properties, such as enhanced cell and tissue absorption. They differ from normal RNA in, for example, complete 2'-O-methylation of sugar, phosphorothioate skeleton, and, for example, a portion of cholesterol at the 3 'end. Antagomir can be used to efficiently silence endogenous miRNAs by

IMPI

MEXICAN INSTITUTE duplex formation comprising the antagomirP ^ N ^^ á

endogenously, thus preventing miRNA-induced gonírn silpnriamipntn. An example of antagomir-mediated miRNA silencing is miR-122 silencing, described in

Krutzfeldt et al, Nature, 2005, 438: 685-689, which is expressly incorporated herein by reference in its entirety. Antagomir RNAs can be synthesized using standard protocols for solid phase oligonucleotide synthesis. See US Patent Application Serial No. 11 / 502,158 and 11 / 657,341 (the disclosures of which are incorporated herein by reference).

An antagomir can include ligand-conjugated monomer subunits and monomers for oligonucleotide synthesis. Examples of monomers are described in US Application No. 10 / 916,185 filed August 10, 2004. An antagomir may have a ZXY structure, as described in PCT Application No. PCT / US2004 / 07070 filed March 8. 2004. An antagomir can form a complex with an unfriendly portion. Examples of unfriendly portions for use with oligonucleotide agents are described in PCT Application No. PCT / US2004 / 07070, filed March 8, 2004.

Aptamers

Aptamers are nucleic acid molecules or

DE IJk PRDPIRDAi) peptides that bind to a particular molecule of 'IW ^ éés ^ Wrr high affinity and specificity (Tuerk and Gold; —3eieiiUG 24 · 9! 50'3' (1990); Ellington and Szostak, Nature 346: 818 (1990)). DNA or RNA aptamers have been successfully produced and bind to several different entities from large proteins to small organic molecules. See Eaton, Curr. Opin. Chem. Biol. 1: 10-16 (1997), Famulok, Curr. Opin. Struct.

Biol. 9: 324-9 (1999), and Hermann and Patel, Science 287: 820-5 (2000). The aptamers can be based on RNA or DNA and can include a riboswitch. A riboswitch is part of a mRNA molecule that can bind directly to a small target molecule and whose binding to the target affects the activity of the gene. Thus, a mRNA containing a riboswitch is directly involved in regulating its own activity depending on the presence or absence of its target molecule. In general, aptamers are designed through repeated rounds of selection in vitro or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues, and organisms. The aptamer can be prepared by any known method including synthetic, recombinant and purification methods and can be used alone or in combination with other specific aptamers for the same purpose. Further,

<td>such as</td><td>,. ,,,,,, (Ν $ ΤΓΓΟ ΓΟ MEXICAN ♦ is described in more detail in</td>

The term aptamer specifically includes secondary aptamers that contain a unanimous sequence that arises from the comparison of two or more known aptamers with a given objective.

Ribozymes

According to another embodiment of the invention, the nucleic acid-lipid particles are associated with ribozymes. Ribozymes are complexes of RNA molecules that have specific catalytic domains that possess endonuclease activity (Kim and Cech, Proc Nati Acad Sci USA. 1987 Dec; 84 (24): 8788-92; Forster and Symons, Cell. 1987 Apr 24; 49 (2): 211-20). For example, large numbers of ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, generally cleaving only one of several phosphoesters on an oligonucleotide substrate (Cech et al., Cell. 1981 Dec; 27 (3 Pt 2): 487-96, - Michel and Westhof, J Mol Biol. 1990 Dio 5; 216 (3): 585-610; ReinholdHurek and Shub, Nature. 1992 May 14; 357 (6374): 173-6). Specificity has been attributed to the requirement that the substrate bind through specific base-pairing interactions with the ribozyme internal guide sequence (IGS) prior to the chemical reaction.

Today at least six basic varieties of naturally occurring enzyme RNA are known. 'one?

catalyze the hydrolysis of phosphodiester junctions of RNA in trans (and thus can cleave other RNA molecules) under physiological conditions. In general, enzymatic nucleic acids act by binding to a target RNA first. Such binding occurs through the target binding portion of an enzyme nucleic acid that is held in close proximity to an enzyme portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds to the target RNA through complementary base pairing, and once attached to the correct site, acts enzymatically to cut the target RNA.

Strategic cleavage of such a target RNA will destroy its ability to direct the synthesis of an encoded protein. After an enzyme nucleic acid has bound and cleaved its target RNA, it is released from the RNA to search for another target and can repeatedly bind and cleave new targets.

The enzymatic nucleic acid molecule can be formed into a hammerhead, hairpin, hepatitis δ virus, group I intron or RNasaP RNA (associated with a guide RNA sequence) or Neurospora VSARN, for example. Specific examples of hammerhead motifs are described in Rossi et al. Nucleic Acids Res. 1992 Sep hairpin in Hampel et al.

(European patent application ll; 20 (17): 4559-65.

Examples of motifs of published EP No. 0360257 are described),

Hampei and Tritz

IMPI

MÍXICAía INSTITUTE '

Jun 13; 28 (12): 4929-33; Hampei et al., Nucleic Acids Rps1QJan 9 25; 18 (2): 299-304 and US Patent 5,631,359. An example of the hepatitis δ virus motif is described in Perrotta and Been, Biochemistry. 1992 Dec 1; 31 (47): 11843-52; An example of the RNasaP motif is described in Guerrier-Takada et al., Cell. 1983 Dec; 35 (3 Pt 2): 849-57; Neurospora VS RNA ribozyme motifs are described in Collins (Saville and Collins, Cell. 1990 May 18; 61 (4): 685-96; Saville and Collins, Proc Nati Acad Sci USA. 1991 Oct 1; 88 (19): 8826-30; Collins and Olive, Biochemistry. 1993 Mar 23; 32 (11): 2795-9); and an example of the Group I intron is described in US Patent 4,987,071. Important features of enzymatic nucleic acid molecules used in accordance with the invention are that they possess a specific substrate binding site that is complementary to one or more DNA or RNA regions of the target gene and that they possess nucleotide sequences within or around the site binding to the substrate that impart RNA cleavage activity to the molecule. Therefore, ribozyme constructs should not be limited to specific reasons mentioned herein.

Methods of producing a ribozyme targeting any polynucleotide sequence are known in the art. Ribozymes can be designed as described in published International Patent Application No. WO

93/23569 and in the patent application

IMPI

INSTITUTO MEXICANO internaciTOflm, i $ & E>

No. WO 94/02595, each specifically incorporated by reference to ^ a .__________ and synthesized to be tested in vitro and in vivo, as described herein.

Ribozyme activity can be optimized by altering the length of ribozyme binding groups or by chemically synthesizing ribozymes with modifications that prevent their degradation by serum ribonucleases (see, eg, published International Patent Application

No.

WO 92/07065; Published international patent application

No.

WO 93/15187; Published international patent application

No.

WO 91/03162; European published international patent application No.

92110298.4; US patent

5,334,711; and request

WO 94/13688, which describe published international patent No. various chemical modifications that can be made to the sugar portions of enzymatic RNA molecules), modifications that improve their efficacy in cells and the removal of line II bases to shorten the RNA synthesis times and reduce chemical requirements.

Immunostimulatory oligonucleotides

The associated nucleic acids with lipid particles of the present invention can be immunostimulators

IMPI

MEXICAN INSTITUTE OF EROHEDAP INDUSTRY!

including immunostimulatory oligonucleotides, (ISS: single or double stranded) capable of inducing an immune response when administered to a subject that may be a mammal or another patient. ISS include, eg, some palindromes leading to hairpin-like secondary structures (see Yamamoto S., et al. (1992) J. Immunol. 148: 4072-4076), or CpG motifs, as well as other known traits of ISS (such as multi-G domains, see WO 96/11266).

The immune response can be an innate or adaptive immune response. The immune system is divided into a more innate immune system and an adaptive immune system acquired from vertebrates, the latter is further divided into humoral cellular components. In particular modalities, the immune response may be mucous.

In particular embodiments, an immunostimulatory nucleic acid is only an immunostimulator when administered in combination with a lipid particle and is not an immunostimulator when administered in its free form. According to the present invention, said oligonucleotide is considered an immunostimulator.

Immunostimulatory nucleic acids are considered non-sequence specific when they are not required to specifically bind and reduce the expression of a target polynucleotide to elicit an immune response. So,

IMPI

MEXICAN INSTITUTE

OF THE FnOFEPO

INDtjmíAL some immunostimulatory nucleic acids can

understanding a sequence that corresponds to a region of a gene or mRNA of natural origin but can still be considered non-sequence specific immunostimulatory nucleic acids.

In one embodiment, the immunostimulatory nucleic acid or oligonucleotide comprises at least one CpG dinucleotide. The CpG oligonucleotide or dinucleotide can be unmethylated or methylated. In another embodiment, the immunostimulatory nucleic acid comprises at least one CpG dinucleotide that possesses a methylated cytokine. In one embodiment, the nucleic acid comprises a single CpG dinucleotide where the cytokine in said CpG dinucleotide is methylated. In a specific embodiment, the nucleic acid comprises the sequence 5 'TAACGTTGAGGGGCAT 3'. In an alternative embodiment, the nucleic acid comprises at least two CpG dinucleotides where at least one cytokine in the CpG dinucleotide is methylated. In a further embodiment, each cytokine in the CpG dinucleotide present in the sequence is methylated. In another embodiment, the nucleic acid comprises a plurality of CpG dinucleotides where at least one of said CpG dinucleotide comprises a methylated cytokine.

In a specific embodiment, the nucleic acid comprises the sequence 5 'TTCCATGACGTTCCTGACGT 3'. In another specific embodiment, the sequence of

it comprises the sequence 5 'ΤΓΓΆταΑΓ.αττΓΓταΆΓ.ατ 7' the two cytokines indicated in bold are methylated. In particular modalities, the ODN is selected from a group of 5 ODNs consisting of ODN # 1, ODN # 2, ODN # 3, ODN # 4, ODN # 5,

ODN # 6, ODN # 7, ODN # 8, and ODN # 9, as shown below.

Table 3. Examples of immunostimulatory oligonucleotides (ODN).

<td>ODN NAME</td><td>SEQ ID</td><td>ODN SEQUENCE (5'-3 ')</td>

<td>ODN 1</td><td></td><td>5'-TAACGTTGAGGGGCAT-3</td>

<td>c-myc human</td><td></td><td></td>

<td>* ODN lm</td><td></td><td>5'-TAAZGTTGAGGGGCAT-3</td>

<td>ODN 2</td><td></td><td>5'-TCCATGACGTTCCTGACGTT-3</td>

<td>* ODN 2m</td><td></td><td>5'-TCCATGAZGTTCCTGAZGTT-3</td>

<td>ODN 3</td><td></td><td>5'-TAAGCATACGGGGTGT-3</td>

<td>ODN 5</td><td></td><td>5'-AACGTT-3</td>

<td>ODN 6</td><td></td><td>5'-GATGCTGTGTCGGGGTCTCCGGGC-3 '</td>

<td>ODN 7</td><td></td><td>5'-TCGTCGTTTTGTCGTTTTGTCGTT-3 '</td>

<td>ODN 7m</td><td></td><td>5'-TZGTZGTTTTGTZGTTTTGTZGTT-3 '</td>

<td>ODN 8</td><td></td><td>5'-TCCAGGACTTCTCTCAGGTT-3 '</td>

<td>ODN 9</td><td></td><td>5'-TCTCCCAGCGTGCGCCAT-3 '</td>

IMPI

KM'mruTO ydiiXA · '·

<td colspan="2">ODN NAME</td><td>SEQ ID</td><td>ODN SEQUENCE</td>

<td>ODN 10 Molecule</td><td>of</td><td></td><td>5'-TGCATCCCCCAGGCCACCAT-3. .</td>

<td>accession</td><td></td><td></td><td></td>

<td>intracellular murine</td><td> 1</td><td></td><td></td>

<td>ODN 11 Molecule accession</td><td>of</td><td></td><td>5'-GCCCAAGCTGGCATCCGTCA-3 '</td>

<td>intracellular human</td><td> 1</td><td></td><td></td>

<td>ODN 12 Molecule accession</td><td>of</td><td></td><td>5'-GCCCAAGCTGGCATCCGTCA-3 '</td>

<td>human intracellular</td><td> 1</td><td></td><td></td>

<td>ODN erb-B-2 human</td><td> 13</td><td></td><td>5'-GGT GCTCACTGC GGC-3 '</td>

<td>ODN c-myc human</td><td> 14</td><td></td><td>5'-AACC GTT GAG GGG CAT-3 '</td>

<td>c-myc human</td><td></td><td></td><td>GGC-3 '</td>

<td>ODN 16</td><td></td><td></td><td>5'-GTGCCG GGGTCTTCGGGC-3 '</td>

<td colspan="2">ODN 17 Receiver</td><td></td><td>5'-GGACCCTCCTCCGGAGCC-3 '</td>

<td>factor human</td><td>of</td><td></td><td></td>

<td colspan="2">type growth insulin 1</td><td></td><td></td>

IMPI

V.EXICaN INSTITUTE,

M LA? RO? IEOA.

INDUSTRY:

<td>ODN NAME</td><td>SEQ ID</td><td>ODN SEQUENCE (5'-3 ')</td>

<td>ODN 18 Human insulin-like growth factor receptor 1</td><td></td><td>5'-TCC TCC GGA GCC ÁGA CTT-3 '</td>

<td>ODN 19 Receiver human epidermal growth factor</td><td></td><td>5'-AAC GTT GAG GGG CAT-3 '</td>

<td>ODN 20 Factor receptor epidermal growth</td><td></td><td>5'-CCGTGGTCA TGCTCC-3 '</td>

<td>ODN 21 Human Vascular Endothelial Growth Factor</td><td></td><td>5'-CAG CCTGGCTCACCG CCTTGG-3 '</td>

<td>ODN 22 Murine phosphokinase C-alpha</td><td></td><td>5'-CAG COA TGG TTC CCC CCA AC- 3'</td>

<td>ODN 24 Bcl-2 human</td><td></td><td>5'-TCT CCCAGCGTGCGCCAT-3 '</td>

<td>ODN 25 c-Raf-s human</td><td></td><td>5'-GTG CTC CAT TGA TGC-3 '</td>

IMPI

MEXICAN INSTITUTE OF INDUSTRIAL PROWEUA

<td>ODN NAME</td><td>SEQ ID</td><td>ODN SEQUENCE (5'-3 ')</td><td></td>

<td>ODN # 26 Receiver</td><td></td><td>5'-GAGUUCUGAUGAGGCCGAAAGG-</td><td></td>

<td>Human Factor</td><td></td><td>CCGAAAGUCUG-3 '</td><td></td>

<td>increase</td><td></td><td></td><td></td>

<td>vascular endothelial</td><td></td><td></td><td></td>

<td>ODN # 27</td><td></td><td>5'-RRCGYY-3 '</td><td></td>

<td>ODN # 28</td><td></td><td>5'-AACGTTGAGGGGCAT-3 '</td><td></td>

<td>ODN # 29</td><td></td><td>5'-CAACGTTATGGGGAGA-3 '</td><td></td>

<td>ODN 30</td><td></td><td>5'-TAACGTTGAGGGGCAT-3 '</td><td></td>

<td>c-myc human</td><td></td><td></td><td></td>

Z represents a residue of methylated cytokine. 0DN14 is a 15-mer oligonucleotide and ODN1 is the same oligonucleotide that has thymidine added to the 5 'end forming ODN1 in a 16-mer. No differences in biological activity have been detected between ODN14 and 0DN1 and both exhibit similar immunostimulatory activity (Mui et al., 2001).

Additional oligonucleotide specific nucleic acid (ODN) sequences suitable for use in compositions and methods of the invention are described in

Raney et al

Journal of

Pharmacology and

Experimental

Therapeutics,

298: 1185-1192 (2001). In some embodiments, the ODNs used in the compositions and methods of the present invention have a phosphodiester (PO) skeleton or a phosphorothioate (PS) skeleton and / or at least one

IMPIOUS;

MBXiCAM INSTITUTE OF PROPERTY,. -INDUSTRIAL residue of methylated cytokine in a CpG motif.

Oligonucleotide decoys

Since transcription factors recognize their relatively short binding sequences, even in the absence of enveloping genomic DNA, short oligonucleotides that support the unanimous binding sequence of a specific transcription factor can be used as tools to manipulate gene expression in living cells. This strategy involves the intracellular administration of said decoy oligonucleotides that are then recognized and linked by the objective factor. The lure's occupation of the DNA binding site of the transcription factor renders the transcription factor unable to subsequently bind to the promoter regions of the target genes. Lures can be used as therapeutic agents, either to inhibit the expression of genes activated by a transcription factor or to upregulate genes that are suppressed by binding of a transcription factor. Examples of the use of decoy oligonucleotides can be found in Mann et al., J. Clin. Invest., 2000, 106: 1071-1075, which is expressly incorporated herein by reference in its entirety.

A supermir refers to an oligomer or polymer of

Supermir ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or both, single, double or partially double stranded or modifications thereof, having a nucleotide sequence that is substantially identical to a miRNA and that is antisense with respect to its objective. This term includes oligonucleotides composed of nucleobases, sugars, and covalent naturally occurring (skeleton) internucleoside linkages and containing a similarly non-naturally occurring portion. Such modified or substituted oligonucleotides are preferred over native forms due to desired properties such as, for example, improved cellular absorption, improved nucleic acid target affinity, and increased stability in the presence of nucleases. In a preferred embodiment, the supermir does not include a single chain and in another preferred embodiment, the supermir is not self-inhibiting to a considerable extent. A supermir presented in the invention may have a secondary structure but is s ubstantially single-stranded under physiological conditions. A supermir that has substantially a single strand is single stranded to the extent that less than about 50% (eg. , less than about 40%, 30%, 20%, 10% or 5%) of the supermir make a duplex with itself. The supermir may include a fork type segment, eg.

INST.TU ΓΟ MEXICANO r i> E LA ΡΚΟΡΙΕΡαΓ una ^ ¿'¿íféhcjSj ^ S11 preferably at the 3 'end it is possible to auEoTTiTri di ¿ai · -and form a double region, eg. , a double region of at least 1, 2, 3 or 4 and preferably less than 8, 7, 6 or n nucleotides, eg 5 nucleotides. The double region may be connected via a bond, eg, a nucleotide bond, eg, 3, 4, 5, or 6 dT, eg, modified dTs. In another embodiment, the supermir forms a duplex with a shorter oligo, eg. , 5, 6, 7, 8, 9 or 10 nucleotides in length, eg, at one or both 3 'and 5' ends or at one end and the nonterminal or middle of the supermir.

Mimics of mirna

MiRNA mimetics represent t a class of molecules that can be used to mimic the gene silencing ability of one or more miRNAs. Therefore, the term microRNA mimetic refers to synthetic non-coding RNAs (i.e. miRNA is not obtained by purification from a source of endogenous miRNA) that are able to enter the iRNA pathway and regulate gene expression.

MiRNA mimetics can be designed as mature molecules (eg single-stranded) or pre- or pre-miRNA mimetic precursors).

MiRNA mimetics can be composed of nucleic acid (modified or modified nucleic acids) including oligonucleotides that

IMPI

MEXICAN INSTITUTE

OF THE PROPERTY

INDUSTRIAL modified, DNA, comprise, without limitation, RNA,

RNA

Modified DNA, blocked nucleic acids, nucleic acids

2'-O, 4'-C-ethylene-bridged (ENA) or any combination of the above (including DNA-RNA hybrids). In addition, miRNA mimetics can comprise conjugates that can affect administration, intracellular compartmentalization, stability, specificity, functionality, chain use and / or potency. In one design, miRNA mimetics are double-stranded molecules (eg, with a double region between about 16 and about 31 nucleotides in length) and contain one or more sequences that have identity to the mature strand of a given miRNA. . The modifications may comprise 2 'modifications (including 2'-0-methyl modifications and 2' F modifications) in one or both chains of the molecule and internucleotide modifications (eg, phosphorothioate modifications) that improve stability and / or or specificity of the nucleic acid. Furthermore, miRNA mimetics may include surpluses. Surpluses can consist of 1-6 nucleotides at either the 3 'or 5' end of any strand and can be modified to improve stability or functionality. In one embodiment, a miRNA mimetic comprises a double region of between 16 and 31 nucleotides and one or more of the following chemical modification patterns: the single chain contains 2'-0-methyl modifications of nucleotides 1 and 2 (counting from of the

INSTITUTO MáXICaNu K Oí LA FROPIBDAD V extreme10^**1Di sense oligonucleotide) and all Cs and '' (TsT --- antisense chain modifications may comprise a 2'F modification of all Cs and Us, phosphorylation of the 5 'end of the oligonucleotide and associated stabilized internucleotide linkages with a surplus of 2 nucleotides in

Antimir or mirna inhibitor

The terms antimir, miRNA inhibitor, miR inhibitor, or inhibitor are synonyms and refer to oligonucleotides or modified oligonucleotides that interfere with specific miRNA capacity. In general, inhibitors are nucleic acids or nucleic acids modified in nature that include oligonucleotides that comprise RNA, modified RNA, DNA, modified DNA, blocked nucleic acids (LNA) or any combination of the above. Modifications include 2 'modifications (including 2'-0 alkyl modifications and 2' F modifications) and internucleotide modifications (eg, phosphorothioate modifications) that may affect administration, stability, specificity, intracellular compartmentalization, or potency. In addition, miRNA inhibitors may comprise conjugates that may affect administration, intracellular compartmentalization, stability, and / or

INSTITUTO MtXICAN 'power. TheDlKi] ^ £ fajíío can adopt a variety of configurationgno-1y single filament, double filament (duplex)

RNA / RNA or

RNA / DNA) and hairpin type, in general, microRNA inhibitors comprise one or more sequences or portions of sequences that are complementary or partially complementary to the mature chain (or chains) of the miRNA to be targeted, in addition, the miRNA inhibitor also it may comprise additional sequences located at positions 5 'and 3' to the sequence that are an inverse complement of mature miRNA. The additional sequences may be the inverse complements of the sequences that are adjacent to the mature miRNA in the pri-miRNA from which the mature miRNA comes, or the additional sequences may be arbitrary sequences (possessing a mixture of A, G, C or OR). In some embodiments, one or both of the additional sequences are arbitrary sequences capable of hairpin formation.

Thus, in some embodiments, the sequence that is the reverse complement of the miRNA is flanked on the 5 'side and on the 3' side by hairpin structures. Micro-RNA inhibitors, when double-stranded, can include incompatibilities between nucleotides on opposite strands. Furthermore, microRNA inhibitors can be attached to the conjugated portions to facilitate absorption of the inhibitor into the cell. For example, an inhibitor of

microRNA may be linked to iivi ri «Mexican NsTiniTo.

M LA PÍCRIEDAr INDUSTRIAL cholesteril 5- (bis (4 methoxyphenyl) (phenyl) methoxy) -3 hydroxypentylcarbamate) that allows the passive absorption of a microRNA inhibitor in a cell. MicroRNA inhibitors, including hairpin miRNA inhibitors, are described in detail in Vermeulen et al., Double-Stranded Regions Are Essential Design Components Of Potent Inhibitors of RISC Function, RNA 13: 723-730 (2007) and in W02007 / 095387 and WO 2008/036825, which are incorporated herein by reference in their entirety. A person skilled in the art can select a sequence from the database for a desired miRNA and design a useful inhibitor for the methods described herein.

Ul adapter

Ul adapters inhibit poiyA sites and are bifunctional oligonucleotides with a target domain complementary to a site in the terminal exon of the target gene and an Ul domain that binds to the smallest Ul nuclear RNA component of the ul snRNP (Goraczniak, et al., 2008, Nature Biotechnology, 27 (3), 257-263, which is expressly incorporated herein by reference in its entirety). The ul snRNP is a ribonucleoprotein complex that functions primarily to direct the first steps in the formation of the spleiceosome by

IMPI MEXICAN INSTITUTE OF THE owner;

of pre-mRNA exon-intron boundary binding (Brown and, NSimpson,

<td>1998 Annu</td><td>Rev</td><td>Plant</td><td>Physiol Plant</td><td>Mol</td><td>Biol</td><td> 49:77-95)</td><td>. The</td>

<td>nucleotides</td><td> 2-11</td><td>of the</td><td>5 'end of</td><td>pair</td><td>base</td><td>from snRNA</td><td>from U1</td>

<td colspan="2">unite with him</td><td>5 'ss</td><td>of the pre-mRNA.</td><td>In</td><td>a</td><td>modality</td><td>, the</td>

Oligonucleotides an U1 adapters. In the embodiment of the invention, the U1 adapter can be administered in combination with at least one other iRNA agent.

Oligonucleotide modifications

Unmodified oligonucleotides may not be optimal in some applications, eg, unmodified oligonucleotides may be prone to degradation by, eg, cell nucleases. Nucleases can hydrolyze the phosphodiester bonds of the nucleic acid. However, chemical modifications of the oligonucleotides can confer improved properties and, eg, can provide more stable oligonucleotides to the nucleases.

Because oligonucleotides are subunit polymers or monomers, many of the modifications described below occur at a repeating position within an oligonucleotide, eg, a modification of a base, a sugar, a phosphate moiety, or the oxygen without bridging a portion of phosphate. It is not necessary that all positions in a given oligonucleotide

IMPI

MÜXICAHII INSTITUTE

Dt THE PROPERTY

are modified uniformly and in fact ΙΝ0^ΙΑ1incorporate more than one of the modifications iiHÍanionada *.

in a single oligonucleotide or even in a single oligonucleoside within an oligonucleotide.

In some cases modification will occur at all subject positions on the oligonucleotide but in many cases, in fact in most, it will not. As an example, a modification can only occur in a 3 'or 5' end position, it can only occur in the inner region, it can only occur in a terminal region, eg. at a terminal nucleotide position or at the last 2, 3, 4, 5 or 10 nucleotides of an oligonucleotide. A modification can occur in a double-stranded region, a single-stranded region, or both. A modification can only occur in the double-stranded region of a double-stranded oligonucleotide or can only occur in a single-stranded region of a double-stranded oligonucleotide. For example. , a modification of phosphorothioate in an oxygen position without a bridge can only occur at one or both ends, it can only occur in a terminal region, eg. at a terminal nucleotide position or at the last 2, 3, 4, 5, or 10 nucleotides of a chain or can occur in single stranded and double stranded regions, particularly at the ends. The 5 'end or ends may be

MEXICAN INSTITUTE

PE PROPERTY V '«<,. ,,, INDUSTRIAL

A modification described herein may be the only modification or the only type of modification included in multiple nucleotides, or a modification may be combined with one or more other modifications described herein. The modifications described herein can also be combined into an oligonucleotide, eg, different nucleotides from an oligonucleotide have different modifications described herein.

In some embodiments, it is particularly preferred, eg. improve stability, include particular nucleobases in surpluses or include modified nucleotides or nucleotide substitutes, in single chain surpluses, eg. in a 5 'or 3' surplus or both. For example. it may be desired to include purine nucleotides in surplus. In some embodiments, all or some of the bases will be modified in a 3 'or 5' surplus, eg, with a modification described herein. Modifications may include, eg, the use of modifications to the OH 2 'group of ribose sugar, eg. the use of deoxyribonucleotides, eg. deoxythymidine, instead of ribonucleotides and modifications in the phosphate group, eg. modifications to phosphothioate. Surpluses need not necessarily be homologous to the target sequence.

Specific modifications are described in more detail below.

The phosphate group

The phosphate group is a charged species rHetra-va-mo n teu The charge is evenly distributed between the two oxygen atoms without bridging. However, the phosphate group can be modified by replacing one of the oxygens with a different substituent. A result of this modification to the RNA phosphate backbones may be the increased resistance of the oligoribonucleotide to nucleolytic decay. Therefore, without intending to be bound by theory, it may be desirable, in some embodiments, to introduce alterations that result in a no-load linker or a loaded linker with a non-symmetric load distribution.

Examples of modified phosphate groups include phosphorothioate, phosphoroselenates, borane phosphates, borane phosphate esters, hydrogen phosphonates, phosphoro amidates, alkyl or aryl phosphonates, and phosphotriesters. In certain embodiments, one of the non-bridging oxyphosphate atoms in the phosphate backbone portion can be replaced by any of the following: S, Se, BR3 (R is hydrogen, alkyl, aryl), C (i.e. an alkyl group, an aryl group, etc ...), H, NR2 (R is hydrogen, alkyl, aryl), or OR (R is alkyl or aryl). The phosphorous atom in an unmodified phosphate group is achiral. However, the replacement of one of the unbridged oxygens by

100

IΜ ΡI íj

MEXICAN INSTITUTE V *!

Dt THE PROPERTY one of the aforementioned atoms or groups of atoms ^ST'ttáce' that the phosphorus atom is chiral; in another "word", a phosphorus atom in a phosphate group modified in this way is a stereogenic center. The stereogenic phosphorus atom can have an R configuration (here, Rp) or S configuration (here, Sp).

Phosphorodithioates have both bridged oxygens replaced by sulfur. The phosphorus center in phosphorodithioates is achiral, which prevents the formation of oligoribonucleotide diastereomers. Therefore, without pretending to be bound by theory, modifications to both unbridged oxygens that remove the chiral center may be desired, eg. phosphorodithioate formation, since they cannot produce mixtures of diastereomers. Therefore, the bridged oxygens can independently be any of S, Se, B, C, Η, N or OR (R is alkyl or aryl).

The phosphate linker can also be modified by replacing the bridging oxygen (i.e., oxygen that binds phosphate to the nucleoside) with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene phosphonates). Replacement can occur in either one of the binding oxygens or both binding oxygens. When the bridging oxygen is the 3 'oxygen of a nucleoside, carbon replacement is preferred. When the bridging oxygen is the 5 'oxygen of a .nucleoside the

101

IMPI

MEXICAN INSTITUTE N OF THE PROPERTY OR INDUSTRIAL

replacement.

nitrogen.

Phosphate group replacement

The phosphate group can be replaced by connectors that do not contain phosphorous. Without wishing to be bound by theory, it is believed that because the charged phosphodiester group is the center of reaction in nucleolytic degradation, its replacement by neutral structural mimetics should provide improved nuclease stability. Again, without intending to be bound by theory, one may wish, in some way, to introduce alterations in which the charged phosphate group is replaced by a neutral portion.

Examples of portions that can replace the phosphate group include methyl phosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazole. , methylenedimethylhydrazo and methylenexymethylimino. Preferred replacements include the methylenecarbonylamino and methylene methyl amino groups.

Reference is also made to modified phosphate linkages where at least one of the phosphate-bound oxygens was replaced or the phosphate group was replaced.

102 by a non-phosphorous group as a link

INSTITUTO MEXICANO I> t LA FRUFIEDAD INDUSTRIAL de esguele phosphodiester.

Ribophosphate skeleton replacement

Scaffolds that mimic oligonucleotides can also be constructed where the phosphate linker and sugar ribose are replaced by nuclease-resistant nucleoside or nucleotide substitutes. Without wishing to be bound by theory, it is believed that the absence of a repeatedly loaded skeleton reduces binding to proteins that recognize polyanions (eg nucleases). Again, without intending to be bound by theory, one may wish, in some way, to introduce alterations in which the bases are linked by a neutral substitute skeleton. Examples include mofilino, cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside substitutes. A preferred substitute is a substitute for PNA.

Sugar modifications

A modified RNA can include modifications of all or some of the sugar groups of ribonucleic acid. For example, the 2'-hydroxyl (OH) group can be modified or replaced by a number of different oxy or deoxy substituents. Without limiting the theory, improved stability is expected because the hydroxyl can no longer

103 be deprotonated to form an ion

IMPI

INSTITUTO .MEXICANO

2'-alkoxide.THEin nitsíi \ al

Alkoxide can catalyze degradation by a —aXaque, intramolecular nucleophilic to the binding phosphorus atom.

Again, without wishing to be bound by theory, it may be desired, in some embodiments, to introduce alterations in which the formation of alkoxide at the 2 'position is not possible.

Examples of modifications of oxy-2'-hydroxyl groups include alkoxy or aryloxy (OR, eg, R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycols (PEG), O (CH2CH2OR)nCH2CH2OR; blocked nucleic acids (LNA) where the 2 'hydroxyl is connected, eg, via a methylene bridge to the 4' carbon of the same ribose sugar; O-AMINE (AMINE

NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine, polyamino) aminoalkoxy,

O (CH2) nAMINE, (eg.

AMINA nh2;

alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, ethylenediamine, polyamino). It should be noted that the oligonucleotides that only contain the methoxyethyl group (MOE), (OCH2CH2OCH3, a derivative of PEG), show nuclease stabilities that are modified from phosphorothioate.

can compare with those modified with the strong

104

Deoxy modifications include

IMPI

INSTITUTO MEXICANO Di LA PROPIEDAD hidrogeneé1

that is, deoxyribose sugars, which are of particular importance for the partially double-stranded surplus portions of RNA); halo (eg, fluoro), amino (eg,

NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino amino acid);

NH (CH2CH2NH) nCH2CH2-AMINE (AMINE

NH2;

alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino), -NHC (O) R (R alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto;

alkylthio-alkyl; thioalkoxy and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be optionally substituted by eg. for an amino functionality. Preferred substituents are

2'methoxyethyl, 2'-OCH3, 2'-0-allyl, 2'-C-allyl and 2'-fluoro.

The sugar group may also contain one or more carbons that possess the opposite stereochemical configuration to that of the corresponding carbon in ribose. Therefore, an oligonucleotide can include nucleotides that contain eg. arabinose like sugar. The monomer may have an alpha bond at the 1 'position of the sugar, eg. , alphanucleosides. Oligonucleotides can also include

These abasic sugars may also contain other abasic sugars that lack a C-l 'nucleobase.

modifications to one or more of the sugar atoms

Constitutive IMPI®. Oligonucleotides are also iÑlMJSflUAl 'l* K_ one or more sugars that are in L form, eg, L nucleosides.

Terminal modifications

The 3 'and 5' ends of an oligonucleotide can be modified. Such modifications can be at the 3 'end, the 5' end, or both ends of the molecule. They may include modification or replacement of a complete terminal phosphate or of one or more of the atoms of the phosphate group. For example, the 3 'and 5' ends of an oligonucleotide can be conjugated to other functional molecular entities such as labeling portions, eg, fluorophores (eg, pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes) or groups protectors (based on eg sulfur, silicon, boron or ester). Functional molecular entities can be attached to sugar through a phosphate group and / or a bond. The terminal atom of the bond can be connected to or replace the bonding atom of the phosphate group or the C-3 'or C-5' O, N, S or C group of the sugar. Alternatively, the bond can be connected to or replace the terminal atom of a nucleotide substitute (eg, PNA).

When a bond / phosphate-functional molecular entity-bond / phosphate arrangement comes between two chains of a

106

IMPI

MEXICAN INSTITUTE OF PROPERTY dsRNA, this arrangement can be a substitute for a buclore ™ áe hairpin in a hairpin RNA agent. '

Useful terminal modifications to modulate activity include modification of the 5 'end with phosphate or phosphate analogs. For example, in preferred embodiments, the dsRNA non-coding filaments are phosphorylated at

position 5 'or include a phosphoryl analog at the main 5' end. 5'-phosphate modifications include those that are compatible with RISC-mediated gene silencing. Suitable modifications include: 5'monophosphate ((HO) 2 (0) P-0-5 '); 5'-diphosphate ((HO) 2 (O) P-OP (HO) (0) -0-5 '); 5'-triphosphate ((HO) 2 (O) P-0- (HO) (O) P-0P (HO) (O) -0-5 '); 5'-guanosine coat (7-methylated or unmethylated) (7m-GO-5 '- (HO) (O) PO- (HO) (O) POP (HO) (0) -0-5');

5'-adenosine envelope (Άρρρ), and any modified or unmodified nucleotide envelope structures (N-0-5 '(HO) (0) PO- (HO) (0) POP (HO) (O) -0 -5');

5'-monothiophosphate (phosphorothioate;

(HO) 2 (S) P-0-5 ');

5'-monodithiophosphate (phosphorodithioate;

(H0) (HS) (S) P-0-5 '),

5'-phosphorothiolate ((H0) 2 (0) PS-5 ');

any additional combination of monophosphate, diphosphate and triphosphates replaced by oxygen / sulfur (eg 5'-alpha-thiothriphosphate, 5'-gammatiotriphosphate, etc.), 5'-phosphoramidates ((H0) 2 (0) P-NH- 5 ', (HO) (NH2) (0) P-0-5'), 5'-alkylphosphonates (R = alkyl = methyl, ethyl, isopropyl, propyl, etc., eg RP (OH) (0) -0-5'-,

107

(OH) 2 (O) P-5'-CH2-), (R = alkylether = methoxymethyl (MeOCH2-), eg RP (OH) (O) -0-5'-).

-ethoxymethyl alkyletherphosphonates, etc., by

Terminal modifications can also be useful for monitoring distribution and, in such cases, preferred groups to be added include fluorophores, eg. , fluorescein or an Alexa dye, eg. Alexa 488. Terminal modifications can also be helpful in improving absorption, useful modifications for this include cholesterol. Terminal modifications can also be useful for crosslinking an RNA agent to another portion, useful modifications for this include mitomycin C.

Nucleobases

Adenine, guanine, cytosine, and uracil are the most common bases found in RNA. These bases can be modified or replaced to provide RNA with improved properties. For example, nuclease resistant oligoribonucleotides can be prepared with these bases or with synthetic and natural nucleobases (eg inosine, thymine, xanthine, hypoxanthine, nubularin, isoguanisine, or tubercidine) and any of the aforementioned modifications. Alternatively, substituted or modified analogs of any of the above bases can be used, eg.

108

IMPIAS

INSTITUTO MSXICAM ,, 'í ^ S

OF THE PROPERTY rare bases, modified bases, bas'eé1^ nb natural and universal bases described in the foot ^ éllLar Examples include, but are not limited to, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2propyl and other alkyl derivatives of adenine and guanine, 5halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4thiouracil, 5-halouracil, 5- (2-aminopropyl) uracil, 5-amino allyl uracil, 8-halo, amino, thiol, thioalkyl, hydroxyl and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytokines, 7-methylguanine, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N6 and 0-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, dihydrouracil, 3deaza-5-azacytosine, 2-aminopurine, 5-alkyluracil, 7alkylguanine, 5-alkyl cytosine, 7-deazaadenine, al-6-diaminopyladenine, 2,6-diaminopyladenine, 2,6-diaminopyladenine -uracil, N3methyluracil, 1,2,4-substituted triazoles, 2-pyridinone, 5-nitroindole,

3-nitropyrrole, 5-methoxyuracil, uracil-5oxyacetic acid,

5-methoxycarbonylmethyluracil,

5-methyl-2thiouracil,

5-methoxycarbonylmethyl-2-thiouracil,

5methylaminomethyl-2-thiouracil, 3- (3-amino3carboxypropyl) uracil, 3-methylcytosine, 5-methylcytosine, N4acetyl cytosines, 2-thiocytosine, N6-methyladenine, N6isopentyladenine, 2-methylthio-N6-isopentenyladenine, N109 methylguanines or O-alkylated bases

IMPI

INSTITUTO MEXiCANl) f. of the ntqriEPAt), Purines and pgsiKMni

additional include those described 1- · ο · η. US No. 3,687,808, those described in the Concise Encyclopedia Of Polymer Science And Engineering, pages 858859, Kroschwitz, JI, ed. John Wiley & Sons, 1990 and those described by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613.

Cationic groups

Modifications to the oligonucleotides may also include the attachment of one or more cationic groups to the sugar, base, and / or the phosphorous atom of a phosphate or modified phosphate backbone moiety. A cationic group can be attached to any atom capable of substitution on a natural, rare, or universal basis. A preferred position is one that does not interfere with hybridization, that is, it does not interfere with the hydrogen binding interactions necessary for base pairing. A cationic group can join eg. through the C2 'position of a sugar or an analogous position in a cyclic or acyclic sugar substitute. Cationic groups can include eg protonated amino groups derived from eg. , O-AMINE (AMINE = NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino or diheteroaryl amino, ethylene diamine, polyamino); aminoalkoxy, eg, O (CH2) nAMINA, (for

110

<td>eg AMINE = NH2; alkylamino,</td><td>,. -,. η MEXICAN INSTITUTE) dialkylamino, tá * foi> r.VSJnirjP INDUSTRIAL 1</td>

arylamino, diaryl amino, heteroaryl amino or diheteroaryl amino, ethylene diamino, polyamino); amino (eg NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, diheteroaryl amino or amino acid); or

NH (CH2CH2NH) nCH2CH2-ZXMINA (AMINE = NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino or diheteroaryl amino).

Placement inside an oligonucleotide

Some modifications may preferably be included in an oligonucleotide at a particular location, eg. , at an internal position of a chain or at the 5 'or 3' end of an oligonucleotide. A preferred location of an oligonucleotide modification may grant preferred properties to the agent. For example, preferred locations of particular modifications may provide optimal gene silencing properties or increased resistance to endonuclease or exonuclease activity.

One or more nucleotides of an oligonucleotide can have a 2'-5 'bond. One or more nucleotides of an oligonucleotide can have reverse linkages, eg. 3'-3 ', 5'-5', 2'-2 'or 2'-3' links.

A double-stranded oligonucleotide can include the

111 minus one 5'-uridine-adenine-3 'dinucleotide

IMPI ^

Mexican INSTITUTE OF INDUSTRIAL PROPERTY XJn (5'-UA-3 ') where uridine is a 2'-modified nucleotide or a dinucleotide

5'-uridine-guanine-3 '(5'-UG-3') terminal, where 5'uridine is a 2'-modified nucleotide or a 5'cytidine-adenine-3 'dinucleotide (5'-CA-3 ') terminal, where the 5'-cytidine is a 2'-modified nucleotide or a 5'-uridinauridine-3' (5'-UU-3 ') terminal dinucleotide, where the 5'-uridine is a nucleotide

2'-modified or a 5'-cytidine cytidine-3 'dinucleotide where 5'-cytidine is a nucleotide

2'-modified or a terminal 5'-cytidineuridine-3 '(5'-CU-3') dinucleotide, where 5'-cytidine is a nucleotide

2'-modified or a terminal 5'-uridinacytidine-3 '(5'-UC-3') dinucleotide, where 5'-uridine is a nucleotide

2'-modified. Double-stranded oligonucleotides that include these modifications are particularly stabilized against endonuclease activity.

General references

The oligoribonucleotides and oligoribonucleosides used in accordance with this invention can be synthesized with solid phase synthesis, see for example Oligonucleotide synthesis, a practical approach, Ed. MJ Gait, IRL Press, 1984; Oligonucleotides and Analogues, A Practical Approach, Ed. F. Eckstein, IRL Press, 1991

112 (especially chapter 1,

Modern

IMPI

INSTITUTO MEXICANO machine-aided oligodeoxyribonucleotide synthesis,

CAELÍilllíL —___

Oligoribonucleotide synthesis, Chapter 3, 2'-O-Methyloligoribonucleotides: synthesis and applications, Chapter 4, Phosphorothioate oligonucleotides, Chapter 5, Synthesis of oligonucleotide phosphorodithioates, Chapter 6, Synthesis of oligo-2'-deoxyribonucleoside methylphos Oligodeoxynucleotides containing modified bases. Other particularly useful synthetic procedures, reagents, blocking groups and reaction conditions are described in Martín, P., Helv. Chim. Acta, 1995, 78, 486504; Beaucage, SL and Iyer, RP, Tetrahedron, 1992, 48,

2223-2311 and Beaucage, SL and Iyer, RP, Tetrahedron, 1993,

49, 6123-6194, or references mentioned therein. The modifications described in WO 00/44895, WOOl / 75164 or WO02 / 44321 can be used herein. The description of all publications, patents and published patent applications mentioned herein are incorporated herein by reference.

References

5,508,270.

The US patent

No.

describes in

alkyl phosphonate s is described in US Patent

No. 4,469,863.

The

113 oligoribonucleotide preparation

MEXICAN INSTITUTE

OF IA PROPERTY of fosforfflüna

described in the US patent

No. 5,2 5 g, 7 7T'-u-pj'Lente de USA No.

5,366,878. The preparation of phosphotriester oligoribonucleotides is described in US Patent No.

5,023,243. The preparation of borane phosphate oligoribonucleotides is described in US Patents.

No.

6,004,925, 5,130,302 and

5,177,198. The preparation of 3'-deoxy-3'-amino phosphoramidate oligoribonucleotides describes in US Patent No. 5,476,925.

3'-deoxy-3'-methylene phosphonate oligoribonucleotides are

Those are described in An, H, et al. J. Org. Chem. 2001, 66, 2789-2801.

The preparation of bridged sulfur nucleotides is described in Sproat et al. Nucleosides Nucleotides 1988, 7,651 and Crosstick et al. Tetrahedron Lett. 1989, 30, 4693.

References to sugar groups

Modifications to 2 'modifications can be found in Verma, S. et al. Annu. Rev. Biochem. 1998, 67, 99-134 and all references therein. Specific modifications to ribose can be found in the following references: 2'-fluoro (Kawasaki et. Al., J. Med. Chem., 1993, 36, 831-841), 2'-MOE (Martín, P. Helv. Chim. Acta 1996, 79, 1930-1938), LNA (Wengel, J. Acc. Chem.

Res. 1999, 32, 301-310.

114

References to the replacement of phosphate groups

The oligoribonucleosides bound to methylenemethylimino.

also identified herein as MMI-linked oligoribonucleosides, methylenedimethylhydrazo-linked oligoribonucleosides, also identified herein as MDH-linked oligoribonucleosides and methylenecarbonylamino-linked oligonucleosides, also identified herein as amide-3-linked oligoibonucleosides, and methonucleoside-linked oligonucleosides also identified herein as amide-4-linked oligoribonucleosides as well as mixed backbone compounds having, for example, alternate MMI and PO or PS linkages, can be prepared as described in US Patent Nos. 5,378,825, 5,386,023 , 5,489,677 and in published PCT applications PCT / US92 / 04294 and PCT / US92 / 04305 (published as WO 92/20822 and WO 92/20823, respectively). The formacetal and thioformacetal-linked oligoribonucleosides can be prepared as described in US Patent Nos. 5,264,562 and 5,264,564. Ethylene oxide-linked oligoribonucleosides can be prepared as described in US Patent No. 5,223,618. Siloxane replacements are described in Cormier, JF et al. Nucleic Acids Res. 1988, 16, 4583. Carbonate replacements are described in Tittensor, JRJ

115

Chem. Soc. C described in

IMPIAS «STrn / TOMeXíCANC

1971, 1933. The replacements for carboxM ^^ 'fiX'losi ^

Edge, MD et al. J. Chem. Porf ^ Trans. Ί

1972, 1991.

Carbamate replacements are described in

Stirchak, EP Nucleic Acids Res. 1989, 17, 6129.

References to the replacement of the main phosphate-ribose skeletons

Cyclobutyl sugar substitute compounds can be prepared as described in US Patent No. 5,359,044.

The pyrrolidine sugar substitute can be prepared as described in US Patent No. 5,519,134. Morpholino sugar substitutes can be prepared as described in US Patent Nos. 5,142,047 and 5,235,033 and other related patent descriptions. Peptide nucleic acids (PNAs) are known per se and can be prepared according to any of the various procedures referred to in Peptide Nucleic Acids (PNAs): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 523. They can also be prepared according to US Patent No. 5,539,083.

References to terminal modifications

Terminal modifications are described in

116

Manoharan,

IMPI

MEXICAN INSTITUTE. i,. · OF THE PRCMÉDAb,

M. et al. Antisense and NucleicΙΝ^ 0? Β

Development

12, 103-128 (2002) and the references on the same

Nucleobase references

N-2 substituted nucleoside amine purines can be prepared as described in US Patent No. 5,459,255. The 3-deaza purine nucleoside amidites can be prepared as described in US Patent No. 5,457,191. The 5,6-substituted pyrimidine nucleoside amidites can be prepared as described in US Patent No. 5,614,617. Pyrimidine nucleoside 5-propynyl amidites can be prepared as described in US Patent No. 5,484,908.

Linkers

The term "bonds" means an organic portion that connects two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR1, C (O), C (O) NH, SO, SO2, SO2NH or an atom chain, such as a substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkyl, arylalkyl, heteroarylalkyl, heteroarylalkyl, heteroarylalkyl,

117 heterocyclylalkyl,

IΜ PI 'Βτιτυτο Mexican DE LA PROPILDAI;

heterocyclic'I'STQUeri

heterociclolalquinilo, aryl, heteroariloT llbLbiucielil ^^ r & cycloalkyl, cycloalkenyl, alkylarylalkyl, alquilarilalquenilo, alquenilarilalquilo, alquenilarilalquinilo, alquinilarilalquenilo, alkylheteroarylalkyl, alquilheteroarilalquinilo, alquenilheteroarilalquenilo, alquinilheteroarilalquilo, alquinilheteroarilalquinilo, alquilheterociclilalquenilo, alquenilheterociclilalquilo, alquenilheterociclilalquinilo, alquinilheterociclilalquenilo, alquilarilalquinilo, alquenilarilalquenilo, alquinilarilalquilo, alquinilarilalquinilo, alquilheteroarilalquenilo, alquenilheteroarilalquilo, alquenilheteroarilalquinilo, alquinilheteroarilalquenilo, alkylheterocyclylalkyl, alquilhererociclilalquinilo, alquenilheterociclilalquenilo, alquinilheterociclilalquilo, alquinilheterociclilalquinilo, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alquenilheteroarilo, alquinilheteroarilo, where one or more methylenes may be interrupted or terminated by O, S, S (BEAR2, N (R1)2, C (0), cleavage linking groups, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R1 it is hydrogen, acyl, aliphatic, or substituted aliphatic.

In one embodiment, the linker is - [(PQR)what-X- (P'-Q'R ') q'] qT-, where:

118

IMPI

MEXICAN INSTITUTE *

US IX I'ROrlWAÍ.

P, R, T, P ', R' and T are each, indep £ fííííT & htém for each

CH2, ch2nh, appearance, absent, CO, NH, O, -S7 — OC (ÜT, —N'HC'tOT?

CH2OR; NHCH (Rto) C (O), -C (O) -CH (Rto) -NH-, CH = N-0

heterocyclyl;

appearance, or < s^.

Q 'are each, independently for each absent,

- (CH2)n-,

-C (RX) (R2) (CH2)n-,

- (CH2)nC (R1) (R2) -, - (CH2CH2OR) mCH2CH2- or - (CH2CH2OR) mCH2CH2NH-;

X is absent or is a cleaved linking group;

Rto it is H or an amino acid side chain;

R1 and R2 are each, independently for each occurrence, H, CH3, OH, SH or N (RN)2;

Rn is, independently for each occurrence, H, methyl, ethyl, propyl, isopropyl, butyl or benzyl;

q, q 'and q are each, independently for each occurrence, 0-20 and where the repeating unit may be the same or different;

n is, independently for each occurrence, 1-20 and m is, independently for each occurrence, 0-50.

In one embodiment, the linker comprises at least one cleaved linking group.

In some embodiments, the linker is a linker

119 branched. The

IMPIOUS9

INSTITUTO MÉXCanO

FROM THE INDUSTRIAL PRGPIEDa branching point of the branched linker may be at least trivalent, but may be a tetravalent, pentavalent or hexavalent atom or a group having such multiple valences. In some embodiments, the branch point is -N, -N (Q) -C, -OC, -SC,

-SS-C,

C (O) N (Q) -C, -OC (O) N (Q) -C,

-N (Q) C (O) -C or -N (Q) C (O) 0-C;

where Q is independently for each occurrence H or optionally substituted alkyl. In another embodiment, the branch point is glycerol or a glycerol derivative.

Splitting junction groups

A cleaved linking group is one that is stable enough outside the cell but upon cleavage to a target cell cleaves to release the two parts that the linker is binding. In a preferred embodiment, the cleaved linking group is cleaved at least times or more, preferably at least

100 times faster in the target cell or under a first reference condition (which can, for example, be selected to mimic or represent intracellular conditions) than in a subject's blood or under a second reference condition (which It can, for example, be selected to mimic or represent conditions found in blood or serum.)

The cleavable linking groups are prone to cleavage agents, eg pH, oxidoreduction potential or the

120 presence of degradation molecules.

IMPI

MEXICAN INSTITUTE Say THE PROPERTY GenerairaVé,

cleavage agents are more prevalent or áé endUéllLfáll useful!

higher levels or activities within cells than in serum or blood. Examples of such degradation agents include:

oxidoreduction agents that are selected for particular substrates or that do not have substrate specificity, including, oxidizing or reducing enzymes or reducing agents such as mercaptans, present in cells, that can degrade a cleavable oxidoreduction binding group by reduction; esterases; endosomes or agents that can create an acidic environment, eg, those that result in a pH of five or less; enzymes that can hydrolyze or degrade an acid cleavable linking group acting as a general acid, peptidases (which may be substrate specific), and phosphatases.

A cleavable linking group such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4 while the average intracellular pH is slightly lower, located in the range 7.1-7.3. Endosomes have a more acidic pH, in the 5.5-6.0 range, and lysosomes have an even more acidic pH of about 5.0. Some linkers will have a cleavable linker group that cleaves at a preferred pH, thereby releasing the cationic lipid from the ligand within the cell or within the desired cell compartment.

121

which is cleaved by a particular enzyme. The cleavage-binding gi-upiy .fcipt »incorporated into a bond may depend on the cell to be targeted. For example, ligands that target the liver can bind to cationic lipids through a bond that includes an ester group. Liver cells are rich in esterases and therefore the binding will cleave more efficiently in liver cells than in cell types that are not rich in esterase. Other esterase-rich cell types include cells from the lung, kidney cortex, and testes.

Linkers containing peptide bonds can be used when targeting peptidase types, such as cellular liver cells rich in synoviocytes.

In general, to assess whether a candidate cleavage linking group is suitable, the ability of an agent to cleave the candidate degradation (or condition) binding group is tested. You also want to test the candidate cleavage binding group to determine the ability to resist cleavage in blood or when in contact with other non-target tissue. Thus the propensity relative to cleavage between a first and a second condition can be determined, where the former is selected as being an indication of excision in a target cell and the latter is selected as being an indication of

122 blood excision or

IMPI

INSTITUTO MEXICANO in other tissues or fluidsL* iN * »ip ^ XL serum. Assessments can be1 1- ^ ar pahr-

cell-free systems, in cells, in cell cultures, in tissue organ cultures or in whole animals. It may be useful to perform initial evaluations under cell-free conditions or culture conditions to confirm by additional evaluations in whole animals.

In preferred embodiments, useful candidate compounds are cleaved at least 2, 4, or

100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

Cleavage groups cleaved by oxidoreduction

One class of cleavage linker groups are oxidoreduction cleavage linker groups that cleave upon reduction or oxidation. An example of a reduction cleaved linker is a disulfide (-SS-) linker. To determine whether a candidate cleavage linking group is a suitable cleavage cleavage group or for example is suitable for use with a particular iRNA moiety or a particular targeting agent, the methods described herein can be used. For example, a candidate can be evaluated by incubation with

123

IMPI INSTITUTO MEXiCANI dithiothreitol (DTT) or other reducing agentVTOiNDusr & iil reagents known in the art, which mimic the cleavage that would be observed in a cell, eg, a target cell. Candidates can also be evaluated under conditions that are selected to mimic blood or serum conditions. In a preferred embodiment, the candidate compounds are cleaved by a maximum of 10% in the blood. In preferred embodiments, useful candidate compounds degrade at least 2, 4, 10, or 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected for mimic extracellular conditions). The cleavage rate of candidate compounds can be determined using standard enzyme kinetic assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

Phosphate-based cleavable linker groups

The cleavable phosphate-based linking groups are cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate based linking groups are -0P (O) (ORk) -O-, -OP (S) (ORk) -O-, -OP (S) (SRk) -0-, -SP (0 ) (ORk) -

124

O-, -OP (O) (ORk) -S-, -SP (O) (ORk) -S-,

P (S) (ORk) -O-, -OP (O) (Rk) -O-, -fl-PLSHRlH-n-, -g_p (n).

-SP (S) (Rk) -O-, -SP (O) (Rk) -S-, -OP (S) (Rk) -S-, Preferred embodiments are: -OP (O) (OH) -O -, -OP (S) (OH) -O-, -0P (S) (SH) -O-, -SP (O) (OH) -O-, -OP (O) (OH) -S-, -SP (O) (OH) -S-, -0-P (S) (OH) -S-, -SP (S) (OH) -O-, -OP (O) (H) -O-, -OP (S) (H) -O-, -SP (O) (H) -O-, -SP (S) (H) -O-, -SP (O) (H) -S-, -OP (S) (H) -S-.

A preferred embodiment is -OP (O) (OH) -O-. These candidates can be evaluated using methods analogous to those described above.

Acid cleavage linking groups

Acid cleavage linker groups are linker groups that cleave under acidic conditions. In preferred embodiments the acidic cleavage linker groups are cleaved in an acidic environment with a pH of about 6.5 or less (eg, about 6.0, 5.5, 5.0 or less) or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleavage environment for acidic cleavage linkers. Examples of acid cleavable linking groups include, but are not limited to hydrazones, esters, and amino acid esters. Acid cleavable groups can have the general formula -C = NN-, C (O) O or -OC (O). A preferred modality is when the

125 carbon bound to ester oxygen

IMPI

MiXICANO INSTITUTE

PROPERTY,,, INDUSTRIAL (the alkoxy group)

it is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

Ester-based linking groups

Ester-based cleavable linker groups are cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linker groups include, but are not limited to esters of alkylene, alkenylene, and alkynylene groups. The cleavable ester linking groups have the general formula -C (O) O- or 0C (0) -. These candidates can be evaluated using methods analogous to those described above.

Peptide-based cleavable groups

Peptide-based cleavable linker groups are cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to provide oligopeptides (eg, dipeptides, tripeptides, etc.) and 'polypeptides. Peptide-based cleavable groups do not include the amide group (-C (O) NH-). The amide group can be formed between any alkylene, alkenylene, or

126

IMPI ^

INSTITUTO MEXICANO alkynylene. A peptide bond is a typept^ l ^^ L'a amide bond formed between amino acids to propnrc-innar peptides and proteins. The peptide-based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids providing peptides and proteins and does not include the entire amide functional group. Peptide-based cleavage linker groups have the general formula - NHCHRTOC (0) NHCHRBC (0) -, where RTO and Rb they are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

Ligands

A wide variety of entities can be coupled to the oligonucleotides and lipids of the present invention.

Ligands that are coupled, preferably covalently, either indirectly via an intermediate link are preferred portions.

In preferred embodiments, a ligand alters the distribution, targeting, or life of a molecule in which it is incorporated. In preferred embodiments a ligand provides an improved affinity for a chosen target, eg. molecule, cell or cell type, compartment, eg, a cell or organ compartment, tissue, organ, or body region compared to, eg, a species that

127 lacks said ligand.

improved affinity for a

MPH T . . . MEXICAN INSTITUTE

Ligands that pr®p®iy ^ r ^ na

chosen target are also called target ligands. Preferred ligands for conjugation of the lipids of the present invention are target ligands.

Some ligands may have endosomolytic properties. Endosomolytic ligands promote lysis of the endosome and / or transport of the inventive composition, or its components, from the endosome to the cytoplasm of the cell. The endosomolytic ligand can be a polyanionic or peptidomimetic peptide that exhibits pH dependent fusogenicity and membrane activity. In certain modalities, the endosomolytic ligand assumes its active conformation at endosomal pH. The active conformation is that conformation in which the endosomolytic ligand promotes lysis of the endosome and / or transport of the composition of the invention, or its components, from the endosome to the cytoplasm of the cell. Exemplary endosomolytic ligands include GALA peptide (Subbarao et al., Biochemístry, 1987, 26: 29642972), EALA peptide (Vogel et al., J. Am. Chem. Soc., 1996, 118: 1581-1586) and its derivatives (Turk et al., Biochem. Biophys. Acta, 2002, 1559: 56-68). In certain embodiments, the endosomolytic component may contain a chemical group (eg, an amino acid) that will undergo a change in charge or protonation in response to a change in pH. The

128

INSTITUTO MÍXtCANí i »E LA FmWDAti INDUSTRIAL endosomolytic component can be linear or branched. Example primary sequences of peptide-based endosomolytic ligands are shown in Table 4.

Table 4: List of peptides with endosomolytic activity.

<td>Name</td><td>Sequence (N to C)</td><td>Ref.</td>

<td>GALA</td><td>AALEALAEALEALAF.ALEALAEAAAAGGC</td><td> 1</td>

<td>EALA</td><td>AALAEALAEALAEALAEALAEALAAAAGGC</td><td> 2</td>

<td></td><td>ALEALAEALEALAEA</td><td> 3</td>

<td>INF-7</td><td>GLFEAIEGFIENGWEGMIWDYG</td><td> 4</td>

<td>Inf HA-2</td><td>GLFGAIAGFIENGWEGMIDGWYG</td><td> 5</td>

<td>diINF-7</td><td>GLF EAI EGFI ENGW EGMI DGWYGC GLF EAI EGFI ENGW EGMI DGWYGC</td><td> 5</td>

<td>diINF3</td><td>GLF EAI EGFI ENGW EGMI DGGC GLF EAI EGFI ENGW EGMI DGGC</td><td> 6</td>

<td>GLF</td><td>GLFGALAEALAEALAEHLAEALAEALEALAAGGSC</td><td> 6</td>

<td>GALA- INF3</td><td>GLFEAIEGFIENGWEGLAEALAEALEALAAGG SC</td><td> 6</td>

n, norleucine

References

one. Subbarao et al., Biochemistry, 1987, 26: 2964-2972.

Vogel et al., J. Am. Chem. Soc., 1996, 118: 1581-1586

129

IMPI

MEXICAN INSTITUTE

3. Turk, MJ, Reddy, JA et

Characterization of a novel pH-sensitive nent-ide + ha +.

enhancing drug release from folate-targeted liposomes at endosomal pHs. Biochim. Biophys. Act 1559, 56-68.

Four. Plank, C. Oberhauser, B. Mechtler, K. Koch, C.

Wagner, E. (1994). The influence of endosome-disruptive peptides on gene transfer using synthetic virus-like gene transfer systems, J. Biol. Chem. 269 12918-12924.

5. Mastrobattista, E., Koning, GA et al. (2002). Functional characterization of an endosome-disruptive peptide and its application in cytosolic delivery of immunoliposomeentrapped proteins. J. Biol. Chem. 277, 27135-43.

6. Oberhauser, B., Plank, C. et al. (nineteen ninety five). Enhancing endosomal exit of nucleic acids using pH-sensitive viral fusion peptides. Deliv. Strategies Antisense Oligonucleotide

Ther. 247-66.

Preferred ligands can improve transport, hybridization, and specificity properties and can also improve nuclease resistance of the resulting natural or modified oligoribonucleotide, or a polymer molecule comprising any combination of monomers described herein and / or natural ribonucleotides or modified.

Ligands in general can include modifiers

130

MEXICAN INSTITUTE z , t OF THE PROCEED <:>

therapeutic, eg. to improve absorption; 'NOTd®tttpué of diagnosis or indicator groups, eg parcr muiiiLuieui!1 Il * distribution; crosslinking agents and portions that confer nuclease resistance. General examples include lipids, spheroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimics.

Ligands can include a naturally occurring substance, such as a protein (eg.

human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin), a carbohydrate (eg, a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or a lipid. The ligand can also be a synthetic or recombinant molecule, such as a synthetic polymer, eg. a synthetic polyamino acid, an oligonucleotide (eg, an aptamer). Examples of polyamino acids include polyamino acids such as polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly (Lactide-co-glycolysate) copolymer, divinyl ether-maleic anhydride copolymer , N- (2-hydroxypropyl) methacrylamide (HMPA) copolymer, polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly (2-ethylacrylic acid), Nisopropylacrylamide or polyphosphazine polymers. Examples of polyamines include: polyethyleneimine, polylysine (PLL),

131

IMPI

MEXICAN INSTITUTE

OF THE PROPERTY

INDUSTRIAL spermine, spermidine, polyamine, pseudopeptide-polyamine, polyandry peptidomimetics, polyandry amidine, protamine, cationic lipid, quaternary salt of a polyandry

dendrimer, arginine, cationic porphyrin, or a helical alpha peptide.

Ligands can also include target groups, eg. an agent 'that targets a cell or tissue, eg. a lecithin, glycoprotein, lipid, or protein, eg. an antibody that binds to a specified cell type such as a kidney cell. A target group can be a thyrotropin, melanotropin, lectin, glycoprotein, protein

A surfactant, carbohydrate mucin, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, tricky multivalent N-acetyl-gulucosamine, multivalent fucose, glycosylated polyamino acids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, lipid, a lipid , bile acid, folate, vitamin B12, biotin, an RGD peptide, a mimetic of the RGD peptide or an aptamer. Table 5 shows some examples of target ligands and their associated receptors.

132

IMPI η- - e τ · ii j_ ·. JvUXICaNG INSTITUTE

Table 5: Target Ligands and Their Receptors

<td>Cells liver</td><td>Flirting</td><td> --- .......</td>

<td>1) Cell parenchymal (PC) (Hepatocytes)</td><td>Galactose</td><td>ASGP-R (Receiver of asiological glycoprotein)</td>

<td></td><td>Gal NAc (n-acetyl- galactosamine)</td><td>ASPG-R Gal NAc receiver</td>

<td></td><td>Lactose</td><td></td>

<td></td><td>Asialofetuine</td><td>ASPG-r</td>

<td>2) Cell endothelial sinusoidal (SEC)</td><td>Hyaluronan</td><td>Receiver hyaluronan</td>

<td></td><td>Procollagen</td><td>Receiver procollagen</td>

<td></td><td>Molecules with negative charge</td><td>Debugging receivers</td>

<td></td><td>Crafty</td><td>Crafty receivers</td>

<td></td><td>N-acetyl glucosamine</td><td>Debugging receivers</td>

133

IMPI

MEXICAN INSTITUTE

<td></td><td>Immunoglobulins</td><td>—------—— πτπαπσΐ'τππχπ Wjstrial receiver</td>

<td></td><td>LPS</td><td>GD14 receiver <·· · <</td>

<td></td><td>Insulin</td><td>Receptor-mediated transcytosis</td>

<td></td><td>Transíerrina</td><td>Mediated transcytosis per receiver</td>

<td></td><td>Albumins</td><td>Not specific</td>

<td></td><td>Conjugates of sugar-albumin</td><td></td>

<td></td><td>Crafty-6-phosphate</td><td>Mannose receptor- 6-phosphate</td>

<td>3) Cell Kupffer (KC)</td><td>Crafty</td><td>Crafty receivers</td>

<td></td><td>Fucosa</td><td>Fucosa receptors</td>

<td></td><td>Albumins</td><td>Not specific</td>

<td></td><td>Conjugates of mannose-albumin</td><td></td>

Other examples of ligands include dyes, intercalating agents (eg acridines), crosslinking agents (eg.

psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin,

Sapphyrin), polycyclic aromatic hydrocarbons (eg phenazine, dihydrophenazine), artificial endonucleases (eg

134 ex. EDTA), colic molecules, acetic acid mwucáno institute n. . FROM THE PROWKJaD '¿CLY.S · lipophilic, eg cholesterüll '/l'IAlacTsS & -i adamantane, butyric acid — í- pii?

dihydrotestosterone,

1,3-Bis-O (hexadecyl) glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, propanediol, heptadecyl group, palmitic acid,

1,3 myristic acid, acid acid

03 (oleoyl) edenic, dimethoxytryl or phenoxazine) and peptide conjugates (eg, peptide, antennapedia, peptide Tat), alkylating agents, phosphate, amino, mercapto, PEG (eg,

PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (eg, biotin), transport / absorption facilitators (eg, aspirin, vitamin E, folic acid), synthetic ribonucleases (eg, imidazole, bisimidazole , histamine, imidazole group, acridine-imidazole conjugates, Eu3 + complexes of tetraazamacrocycles), dinitrophenyl, HRP or AP.

Ligands can be proteins, eg. glycoprotein or peptides, eg. molecules that have a specific affinity for a co-ligand or antibodies eg. an antibody that binds to a specific cell type such as a cancer cell, endothelial cell, or bone cell. Ligands can also include hormones and hormone receptors. They may also include non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N135 acetyl-galactosamine, trickle

Multivalent MEXICAN INSTITUTE '· * ^^

glucosamine, multivalent fucose or aptamers. The ligand can be, for example, a lipopolysaccharide, a p38 MAP kinase activator, or an NF-kB activator.

The ligand can be a substance, eg. , a drug, which can increase the absorption of the iRNA agent into the cell, for example, by altering the cytoskeleton of the cell, eg. altering the cell's microtubules, microfilaments and / or intermediate filaments. The drug may be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholida A, indanocin or myoservin.

The ligand can increase the absorption of the iRNA agent in the cell by activating an inflammatory response, for example. Examples of ligands that would have such an effect include tumor necrosis factor alpha (TNFalpha), interleukin-1 beta, or gamma interferon.

In one aspect, the ligand is a lipid or a lipid-based molecule. Such a lipid or lipid-based molecule preferably binds a serum protein, eg. human serum albumin (HSA). An HSA binding ligand allows the distribution of the conjugate to a target tissue, eg. a non-kidney target tissue of the body. For example, the target tissue may be the liver, including liver parenchymal cells. Other molecules that can bind

136

IMPI

MEXICAN INSTITUTE,,, DE LA MOHEDAL

HSA can also be used as ligands. For example,

you can use neproxin or aspirin. A lipid-based lipid · or ligand can (a) increase resistance to conjugate degradation, (b) increase targeting or transport to a target cell or cell membrane, and / or (c) be used to adjust binding to a whey protein, eg. HSA.

A lipid-based ligand can be used to modulate, eg. control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be removed from the body. A lipid or lipid-based ligand that binds to HSA less tightly can be used to target the conjugate to the kidney.

In a preferred embodiment, the lipid-based ligand binds HSA. Preferably, it binds HSA with sufficient affinity such that the conjugate will preferentially distribute to non-kidney tissue. However, it is preferred that the affinity is not so strong that the HSA-ligand binding cannot be reversed.

In another preferred embodiment, the lipid-based ligand binds HSA weakly or directly does not bind, such that the conjugate will preferentially distribute to the kidney.

Other portions that target kidney cells too

137 they can be used instead of or in addition to lipids.

In another aspect, the ligand is a portion, eg. a vitamin, which is absorbed by a target cell, eg. a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, eg. of the malignant or non-malignant type, eg cancer cells. Sample vitamins include vitamins A, E, and K. Other example vitamins are B vitamins, eg, folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients absorbed by cancer cells. Also included are HAS, low-density lipoprotein (LDL), and high-density lipoprotein (HDL).

In another aspect, the ligand is a cell penetrating agent, preferably a helical cell penetrating agent. Preferably the agent is unfriendly. An example of an agent is a peptide such as tat or antenopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptidic or pseudo-peptidic bonds and the use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.

The ligand can be a peptide or a peptidomimetic. A peptidomimetic (also referred to herein as oligopeptidomimetic) is a molecule capable of

138 vJL Ά

M £ XICan INSTITUTE <·.

FROM THE FWHEUAl

INDUSTRY!

fold into a defined three-dimensional structure similar to a natural peptide. The peptide or peptidomimetic portion may be about 5-50 amino acids in length, eg. about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 amino acids in length (see Table 6, for example).

Table 6: Examples of Cell Penetration Peptides

<td>Cell Penetration Peptide</td><td>Amino acid sequence</td><td colspan="2">Reference</td>

<td>Penetratin</td><td>RQIKIWFQNRRMKWKK</td><td>Derossi et</td><td>to the.,</td>

<td>Fragment</td><td>GRKKRRQRRRPPQC</td><td>You live et</td><td>to the.,</td>

<td>Peptide</td><td>GALFLGWLGAAGSTMGAWSQPKKK</td><td>Chaloin et</td><td>to the.,</td>

<td>based on</td><td>RKV</td><td>Biochem.</td><td></td>

<td>sequence</td><td></td><td>Biophys.</td><td>Beef.</td>

<td>signal</td><td></td><td>Commun.,</td><td></td>

<td>PVEC</td><td>LL11LRRRIRKQAHAH SK</td><td>Elmquist</td><td>et</td>

139

IMPI

MEXICAN INSTITUTE

OF THE PROPERTY

<td>Transport it</td><td>GWTLNSAGYLLKINLKALAALAKK</td><td>Pooga</td><td>et</td><td>to the.,</td>

<td></td><td>IL</td><td>PHASEB</td><td></td><td>J.,</td>

<td>Peptide</td><td>KLALKLALKALKAALKLA</td><td>Oehlke</td><td>et</td><td>to the. ,</td>

<td>model</td><td></td><td>Mol.</td><td colspan="2">Ther.,</td>

<td>amphiphilic</td><td></td><td> 2:339,</td><td> 2000</td><td></td>

<td>Arg9</td><td>RRRRRRRRR</td><td colspan="2">Mitchell</td><td>et</td>

<td>Penetration</td><td>KFFKFFKFFK</td><td></td><td></td><td></td>

<td>mobile</td><td></td><td></td><td></td><td></td>

<td>bacterial</td><td></td><td></td><td></td><td></td>

<td>LL-37</td><td>LLGDFFRKSKEKIGKEFKRIVQRI</td><td></td><td></td><td></td>

<td></td><td>KDFLRNLVPRTES</td><td></td><td></td><td></td>

<td>Cecropin</td><td>SWLSKTAKKLENSAKKRISEGIAI</td><td></td><td></td><td></td>

<td>P1</td><td>AIQGGPR</td><td></td><td></td><td></td>

<td>a-defensin</td><td>ACYCRIPACIAGERRYGTCIYQGR</td><td></td><td></td><td></td>

<td></td><td>LWAFCC</td><td></td><td></td><td></td>

<td>b-defensin</td><td>DHYNCVSSGGQCLYSACPIFTKIQ</td><td></td><td></td><td></td>

<td></td><td>GTCYRGKAKCCK</td><td></td><td></td><td></td>

140

IMPI

<td>Bactenecin</td><td>RKCRIVVIRVCR</td><td>------ mlxio.nl, __ U-Tq; OF INDUSTRIAL PROPERTY</td><td></td>

<td>PR-3 9</td><td>RRRPRPPYLPRPRPPPFFPPRLPP RIPPGFPPRFPPRFPGKR-NH2</td><td></td><td></td>

<td>Indolicidin</td><td>ILPWKWPWWPWRR-NH2</td><td></td><td></td>

A peptide or peptidomimetic may be, for example, a cell penetrating peptide, cationic peptide, antipathetic peptide, or hydrophobic peptide (eg, consisting primarily of Tyr, Trp, or Phe). The peptide portion may be a dendrimer peptide, restricted peptide, or cross-linked peptide. In another alternative, the peptide portion may include a hydrophobic membrane translocation sequence (MTS). An example of a peptide containing a hydrophobic MTS is RFGF which has the amino acid sequence AAVALLPAVLLALLAP. An RFGF analog (eg, AALLPVLLAAP amino acid sequence) containing a hydrophobic MTS may also be a target moiety. The peptide portion can be a delivery peptide, which can transport large polar molecules including peptides, oligonucleotides, and proteins through cell membranes. For example, the sequences of the HIV Tat protein (GRKKRRQRRRPPQ) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK) have been found to be

141

IMPI

MEXICAN PROPERTY INSTITUTE capable of functioning as delivery peptides. ϋιΥ'θ'β ^ βΐίαΐίίΓ — cr peptidomimetic can be encoded by -ΤΠΤ3 · SéUtiyi'IUld 'of random DNA, such as an identified peptide' from a phage display library or a compound bead combinatorial library (OBOC) (Lam et al.,

Nature, 354: 82-84, 1991). Preferably the peptide or peptidomimetic linked to an iRNA agent by means of a built-in monomer unit is a cell-directed peptide such as an arginine-glycine-aspartide peptide- (RGD) or RGD mimetic: A portion of peptide it can range in length from about 5 amino acids to about 40 amino acids. The peptide portions may have a structural modification, such as to increase stability properties or direct conformational properties. Any of the structural modifications described below can be used.

A portion of RGD peptide can be used to target a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62: 5139-43, 2002). An RGD peptide can facilitate targeting of an iRNA agent to tumors from a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8: 783-787, 2001). Preferably, the RGD peptide will facilitate targeting of an iRNA agent to the

142 kidney. The RGD peptide can be

IMPI

MEXICAN INSTITUTE zóoírá. . _,. Orn the Puorni Aí linear or cyclomuyuiAipueSa be modified, eg. Glycosylated or methylated to faGIMATE the targeting to specific tissues. For example, a glycosylated RGD peptide can deliver an iRNA agent to a tumor cell that expressesvft3 (Haubner et al., Jour. Nucí. Med., 42: 326-336, 2001).

Peptides that target markers enriched in proliferative cells can be used. For example. RGD-containing peptides and peptidomimetics can target cancer cells, particularly cells that have an ανβ3 integrin. Therefore, RGD peptides, cyclic peptides containing RGD, RGD peptides including D-amino acids, as well as synthetic RGD mimetics could be used.

In addition to RGD, other portions that target the ανβ3 integrin ligand can be used. Generally, such ligands can be used to control proliferative cells and angiogenesis. Preferred conjugates of this type of ligand that target PECAM-1, VEGF, or another cancer gene, eg. a cancer gene described herein.

A cell penetrating peptide is capable of penetrating a cell, eg. a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell penetration peptide can be, for example, a linear peptide o143

IMPI

MEXICAN INSTITUTE

helical {eg LL-37 or Ceropina Pl), a pS ^ t! i'do ^ 8? it contains a disulfide bond {for --- er'dufmiuinur β-defensin or bactenecin) or a peptide containing only one or two dominant amino acids (eg PR-39 or indolicidin). A cell penetration peptide can also include a nuclear localization signal (NLS). For example, a cell-penetrating peptide may be a bipartisan antipathetic peptide, such as MPG, which comes from the domain of the HIV-1 fusion peptide gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucí. Acids Res .31: 2717-2724, 2003).

In one embodiment, a target peptide linked to an iRNA agent and / or the carrier oligomer may be an unfriendly α-helical peptide. Examples of unfriendly α-helical peptides include, but are not limited to, cecropins, licotoxins, paradoxins, buforin, CPF, bombinin-like peptide (BLP), cathelicidins, ceratotoxins, S. clava peptides, mixine intestinal antimicrobial peptides (HFIAP) , magainins, brevinins-2, dermaseptins, melittins, pleurocidin, H peptides2A, Xenopus peptides, esculentinis-1 and caerinas. Preferably a number of factors will be considered to maintain the integrity of the propeller stability. For example, a maximum number of helix stabilization residues (eg leu, ala or lys) and a minimum number of helix destabilization residues (eg proline or cyclic monomer units) will be used. The residue

144

IMPI ·.

ΙΝίΓΠΤυΤΟ MEXICAi * Yt

OF THE ΜΟΓΙίΟΑΐ · considered for example Gly is a coating will

Example of N- and / or TTa ^ amiHacioñ '^' T terminal residue can be used to provide an extra H bond to stabilize the helix. The formation of saline bridges between residues with opposite charges, separated by i ± 3, or i ± 4 positions, can provide stability. For example, cationic residues such as Usin, arginine, homo-arginine, ornithine, or histidine can form saline bridges with the glutamate or aspartate anionic residues.

Peptide and peptidomimetic ligands include those that have naturally occurring or modified peptides, eg. D or L peptides, α, β or γ peptides, N-methyl peptides, azapeptides, peptides having one or more amides, i.e. peptide, linkages replaced with one or more urea, thiourea, carbamate or sulfonylurea linkages or cyclic peptides .

The target ligand can be any ligand that is capable of targeting a specific receptor. Examples are: folate, GalNAc, galactose, mannose, mannose-6P, sugar groups such as GalNAc group, mannose group, galactose group or an aptamer. A group is a combination of two or more units of sugar. Target ligands also include integrin receptor ligands, chemokine receptor ligands, transerrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands. Ligands also .i

145 can be nucleic acid based,

IMPI:

INSTITUTO MEX) l> N ( 1 DF. LA PROHEDAÍ · inmistsiai. _ eg, an aptamer

The aptamer may be unmodified or it may have any combination of modifications described herein.

Endosomal release agents include imidazoles, poly or oligoimidazoles, PEIs, peptides, fusogenic peptides, polycarboxylates, polyacations, cations or anions masked, acetals, oligo or poly polyacetals, ketal / polykethels, non-masked cationic or anionic polymers masked, dendrimers with masked or unmasked cationic or anionic charges.

PK modulator means pharmacokinetic modulator. The PK modulator includes lipophiles, bile acids, spheroids, phospholipid analogs, peptides, protein / binding agents, PEGs, vitamins, etc. Examples of PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocolic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, etc. Oligonucleotides comprising a number of phosphothioate linkages are also known to bind to whey protein; therefore short oligonucleotides, eg. Oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple phosphorothioate linkages in the backbone can also be treated herein /

146

IMPI

INSTITUTO MEXION-. ·

OE IA PROMEDAP invention as ligands (eg as M ^ OT / addor ^ rs ligands

PK). —---------—— '

Furthermore, aptamers that bind serum components (eg serum proteins) can also be treated in the present invention as PK modulating ligands.

Other ligands that can be treated by the invention are described in co-pending applications USSN: 10 / 916,185, filed August 10, 2004; USSN: 10 / 946,873, filed September 21, 2004; USSN: 10 / 833,934, filed August 3, 2007; USSN: 11 / 115,989, filed on April 27, 2005 and USSN: 11 / 944,227 filed on November 21, 2007, which are incorporated herein by reference in their entirety for all purposes.

When two or more ligands are present, all ligands can have the same properties, all can have different properties, or some ligands can have the same properties while others have different properties. For example, a ligand can have targeting properties, have endosomolytic activity, or have PK modulatory properties. In a preferred embodiment, all ligands have different properties.

Ligands can be coupled to oligonucleotides at various locations, eg, 3 'end, 5' end, and / or internally. In preferred embodiments, the ligand is bound to the oligonucleotides by means of a

147

MÍXICAN INSTITUTE ·,

l> t LA rKUrlLUAI. ' intermediate link. The ligand or linked ligand '^ íV ^ íte present in a monomer when diclTO --- IflOfiómsrO --- £ STcT incorporated in the growing chain. In some embodiments, the ligand can be incorporated by coupling to a precursor monomer after said precursor monomer has been incorporated into the growing chain. For example, a monomer that has, eg, an amino-terminated bond (i.e., that does not have an associated ligand) eg. TAP (CH2)nNH2 can be incorporated into a growing sense or antisense filament. In a subsequent operation, that is, after incorporation of the precursor monomer into the chain, a ligand having an electrophilic group, eg. a pentafluorophenyl ester or an aldehyde group may subsequently be attached to the precursor monomer by coupling the electrophilic group of the ligand to the terminal nucleophilic group of the linker of the precursor monomer.

In the case of double-stranded oligonucleotides, the ligands can bind to one or both strands. In some embodiments, a double-stranded iRNA agent contains a ligand conjugated to the sense strand. In other embodiments, a double-stranded iRNA agent contains a ligand conjugated to the antisense strand.

In some embodiments, the ligands can be conjugated to the nucleobases, sugar moieties, or internucleoside linkages of nucleic acid molecules. The

148

INSTITUTO MtXiCAN · DE LA EROmUAr? INDUSTRIAL conjugation to purine nucleobases or derivatives thereof can occur at any position including, endocyclic and exocyclic atoms. In some embodiments, the 2-, 6-, 7-, or 8-positions of a purine nucleobase are attached to a conjugated portion. Conjugation to pyrimidine nucleobases or derivatives thereof can also occur at any position.

In some modalities, the positions

2-,

5- and 6- of a pyrimidine nucleobase can be replaced by a portion of sugar conjugated portion. Conjugation a of nucleosides can occur at any carbon atom. Examples of carbon atoms of a sugar moiety that can be attached to a conjugated moiety include the 2 ', 3' and 5 'carbon atoms. The 1 'position can also be attached to a conjugated portion such as an abasic residue. Internucleosidic bonds can also support conjugated portions. For phosphorous-containing bonds (eg, phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate, and the like), the conjugated portion may be directly attached to the phosphorus atom or to an O, N, or S atom attached to a phosphorus atom. For internucleoside linkages containing amine or amide (eg. PNA), the conjugated portion may be attached to the nitrogen atom of the amine or amide or to an adjacent carbon atom.

There are numerous methods for preparing conjugates of

149

INSTITUTO MEXICANO DE LA PROPERTY IMÍUSTRIAL oligomeric compounds. In general, an oligomeric compound is attached to a conjugated portion by contacting a reactive group (eg, OH, SH, amine, carboxyl, aldehyde, and the like) in the oligomeric compound with a reactive group on the conjugated portion. In some embodiments, one reactive group is electrophilic and the other is nucleophilic.

For example, an electrophilic group can be a carbonyl-containing functionality and a nucleophilic group can be an amine or a thiol. Conjugation methods of nucleic acids and oligomeric compounds related to and without linking groups are well described in the literature such as, for example, in Manoharan in Antisense Research and Applications, Crooke and LeBleu, eds., CRC Press, Boca Raton, Fia., 1993, chapter 17, which is incorporated herein by reference in its entirety.

Representative US patents that teach the preparation of oligonucleotide conjugates include, but are not limited to, US Patent No.

150

<td> 830;</td><td>IMPI MEXICAN INSTITUTE ZL · t> E LA PROFILPAli 5, 112, 963; , 7 ^ - ^</td>

5,688,941; 5,714,166; 6,153,

6,335,434; 6,335,437; 6,395,

6, 525,031; 6, 528, 631; 6,559,

475; 5,512,667; 5,514,785;

142; 5,585,481; 5,587,371;

923; 5, 599, 928; 5, 672,662;

737; 6,172,208; 6,300,319;

437; 6,444,806; 6,486,308;

279; each of which is incorporated herein by reference.

Characteristics of nucleic acid-lipid particles

In certain embodiments, the present invention relates to methods and compositions for producing lipid-encapsulated nucleic acid particles in which the nucleic acids are encapsulated with a lipid layer. Such nucleic acid-lipid particles incorporating siRNA oligonucleotides are characterized using a variety of biophysical parameters including: (1) drug-lipid ratio; (2) encapsulation efficiency and (3) particle size. High drug-lipid ratios, high encapsulation efficiency, good nuclease resistance and serum stability and a controllable particle size, generally less than 200nm in diameter, are desired. Furthermore, the nature of the nucleic acid polymer is

151 significant because the modification

nucleic acids in an effort to t-ransmii-iE -> -Qg; Nuclease increases the cost of therapeutic agents while in many cases it only provides limited resistance. Unless otherwise indicated, these criteria are calculated in this specification as follows:

The nucleic acid to lipid ratio is the amount of nucleic acid in a defined volume of preparation divided by the amount of lipid in the same volume. This can be on a mole-by-mole basis or on a weight-by-weight basis or on a weight-by-mole basis. For final formulations, ready for administration, the nucleic acid: lipid ratio is calculated after dialysis, chromatography and / or enzymatic digestion (eg. nuclease) to remove as much external nucleic acid as possible.

Encapsulation efficiency refers to the drug to lipid ratio of the initial mixture divided by the drug to lipid ratio of the final formulation, acceptable for administration. This is a measure of relative efficiency. For an absolute efficiency measure, the total amount of nucleic acid added to the initial mixture ending in the competent administration formulation can also be calculated. You can also calculate the

152

IMPI

MEXICAN INSTITUTE CE THE PROPERTY n INDUSTRIAL the amount of lipid that is lost during formulation. Efficiency is a measure of formulation waste and expense.

The size indicates the size (diameter) of the particles formed. Size distribution can be determined using near-elastic light scattering (QELS) on a Nicomp model 370 sub-micron particle meter. Particles smaller than 200 nm are preferred for distribution of neovascularized (leaking) tissues, such as neoplasms and sites of inflammation.

Pharmaceutical compositions

The lipid particles of the present invention, particularly when associated with a therapeutic agent, can be formulated as a pharmaceutical composition, eg. which also comprises a pharmaceutically acceptable diluent, excipient, or carrier, such as a saline or phosphate physiological buffer, selected in accordance with standard route of administration and pharmaceutical practice.

In particular embodiments, the pharmaceutical compositions comprising the lipid nucleic acid particles of the invention are prepared according to standard techniques and further comprise a pharmaceutically acceptable carrier.

Generally, it will be used

153

IMPI, normal saline as the pharmace'ü'fí'éam ^ S carrier

acceptable. Other suitable carriers include, by buffered water, 0.9% saline, 0.3% glycine, and the like, including glycoproteins for improved stability, such as albumin, lipoprotein, globulin, etc. In compositions comprising saline or other salt-containing carriers, the carrier is preferably added after the formation of lipid particles. Therefore, after nucleic acid lipid compositions are formed, the compositions can be diluted in pharmaceutically acceptable carriers such as normal saline.

The resulting pharmaceutical preparations can be sterilized by conventional sterilization techniques well known in the art. The aqueous solutions can then be packaged for use or filtered under aseptic conditions and lyophilized; The lyophilized preparation is combined with a sterile aqueous solution before administration. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting agents and buffers, tonicity adjusting agents, and the like, eg, sodium acetate, sodium lactate, chloride of sodium, potassium chloride, calcium chloride, etc. Additionally, the suspension

154

IMPI

HST1TUTO MEXICANO lipidies may include protective agents ofIUImpunity protects lipids against damage from free radicals and peroxidant lipid after storage. Free radical lipophilic extinguishers such as atocopherol and iron-specific water soluble chelating agents such as ferrioxamine are suitable.

The concentration of lipid particle or nucleic acid-lipid particle in pharmaceutical formulations can vary widely, i.e. from less than about 0.01%, generally to or at least about 0.05-5% to as much as 10 to 30% by weight and will be selected mainly for volumes, fluid viscosities, etc. according to the particular mode of administration chosen. For example, the concentration can be increased to reduce the fluid load associated with the treatment. This may be particularly desired in patients who have congestive heart failure associated with atherosclerosis or severe hypertension. Alternatively, complexes composed of irritating lipids can be diluted in low concentrations to decrease inflammation at the site of administration. In a group of modalities, the nucleic acid will have an attached label and will be used for diagnosis (by indication of the presence of complementary nucleic acid). In this case, the number of complexes administered

155

IMPI will depend on the particular label used, the disease being diagnosed and the criteria of the doctor, but it will generally be between around 0.01 and around 50 mg per kilogram of body weight, preferably between around 0.1 and around 5 mg / kg of body weight.

As indicated above, the particles of the lipid therapeutic agent eg. nucleic acid) of the invention can include phospholipids modified with polyethylene glycol (PEG), PEG-ceramide or lipids modified with ganglioside GMiu other lipids effective to prevent or limit aggregation. The addition of such components not only prevents complex aggregation. Preferably, it can also provide a means of increasing circulation life and increasing delivery of the nucleicolipid acid composition to target tissues.

The present invention also provides lipid-therapeutic agent compositions in kit form. The kit will typically comprise a container that is divided into compartments to hold the various kit items.

The kit will contain the pharmaceutical particles or compositions of the present invention, preferably in concentrated dehydrated form, with instructions for rehydration, dilution and administration. In certain while in other modalities, they do not.

modalities, the particles comprise the active agent,

156

Manufacturing methods

IMPI MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY

The methods and compositions of the invention use some cationic lipids, the synthesis, preparation and characterization of which is described below and in the accompanying Examples. Furthermore, the present invention provides methods for preparing lipid particles, including those associated with a therapeutic agent, eg, a nucleic acid. In the methods described herein, a lipid mixture is combined with an aqueous nucleic acid buffered solution to produce an intermediate mixture containing nucleic acid encapsulated in lipid particles where the encapsulated nucleic acids are present in a nucleic acid / lipid ratio of about 3% by weight to about 25% by weight, preferably 5 to 15% by weight. Optionally, the intermediate mixture can be resized to obtain lipid-encapsulated nucleic acid particles where the lipid portions are unilamellar vesicles, which preferably have a diameter of 30 to 150 nm, more preferably around 40 to 90 nm. The pH is then raised to neutralize at least a portion of the surface charges on the nucleic acid-lipid particles, thereby providing a lipid encapsulated nucleic acid composition with at least partially neutralized surface.

157

IMPI mexicanc institute

OF THE PROPERTY

INDUSTRIAL previously describes several of these

Such as cationic lipids pH below neutral

are aminolipids that are charged to a pKto of the amino group and are substantially at a pH above pKto. These cationic lipids are called titrable cationic lipids and can be used in steps.

forming other formulations of the invention using a two-process

First at the most component pH location, lipid vesicles can be lowered with titrable and vesicle cationic lipids in the presence of nucleic acids. In this way, the vesicles will encapsulate and trap surface acids to neutralize them, increasing pKto of the say, to a particularly nucleic.

vesicles

Second, the newly formed filler can be pH of the medium to a level above physiological pH or advantageous cationic lipids for easy removal of surface resulting liposomes such as that having any titratable vehicles present, is higher. Process aspects include both nucleic acid adsorbed on the nucleic acid delivery to a neutral surface. Se or neutral lipid particles avoid rapid clearance of some toxicities that are associated with cationic liposomes. They are provided with respect to the uses of such expected surface circulation and avoids with further detail preparations titrable cationic lipids in the formulation of nucleic acid particles158

IMPI

INSTITUTO MEXICANO lipid in US patent 6, 287.5ΦΪ'Λ ^ τίίβ ^ á33®fS * and US 6, 858,225, which are incorporated- = a ~ Xa-prosonto by reference.

It should also be noted that vesicles formed in this manner provide uniform vesicle size formulations with high nucleic acid content. Additionally, the vesicles have a size range of from about 30 to about 150nm, more preferably from 30 to about 90nm.

Without intending to be bound by any particular theory, the very high efficiency of nucleic acid encapsulation is believed to be a result of electrostatic interaction at low pH. At an acidic pH (eg pH 4.0) the surface of the gallbladder is charged and binds a portion of the nucleic acids through electrostatic interactions. When the external acidic damper is exchanged for a more neutral damper (eg. pH of 7.5) The surface of the lipid particle or liposome is neutralized, allowing any external nucleic acid to be removed. More detailed information on the formulation process is provided in various publications (eg, US Patent 6,287,591 and US Patent 6,858,225).

In view of the foregoing, the present invention provides methods for preparing nucleic acid / lipid formulations. In the methods described herein,

159

IMPI ^

MEXICAN INSTITUTE

OE LA nOHEOAP a mixture of lipids combines with a soludÍW "TOlacubeS · Nucleic Acid Buffered for prodt »e» r «na» tnezela intermedia containing nucleic acid encapsulated in lipid particles, eg, where the encapsulated nucleic acids are present in a nucleic acid / lipid ratio of about 10% by weight to about 20% by weight. Optionally, the intermediate mixture can be resized to obtain lipid encapsulated nucleic acid particles where the lipid portions are unilamellar ampoules, preferably having a diameter of 30 to 150 nm, more preferably around 40 to 90 nm. The pH is then raised to neutralize at least a portion of the surface charges on the nucleic acid-lipid particles, thereby providing a lipid encapsulated nucleic acid composition with at least partially neutralized surface.

In some embodiments, the lipid mixture includes at least two lipid components: a first lipid component of the present invention that is selected from lipids having a pKa such that the lipid is cationic at a pH below pKa and neutral to a pH above pKa and a second lipid component that is selected from lipids that prevent particle aggregation during nucleic acid-lipid particle formation. In particular embodiments, the aminolipid is a novel cationic lipid.

160 of the present invention.

IMPI

MEXICAN INSTITUTE · '

FROM THE fROMtl'.AL ¿INBL'STRIAf ·> = * Γ

In preparing the nucleic acid-lipid particles of the invention, the lipid mixture is typically a solution of lipids in an organic solvent. This lipid mixture can then be dried to form a thin film or lyophilized to form a powder before being hydrated with an aqueous buffer to form liposomes.

Alternatively, in a preferred method, the lipid mixture can be solubilized in a water-miscible alcohol, such as ethanol, and this ethanolic solution can be added to an aqueous buffer resulting in spontaneous liposome formation. In most modalities, alcohol is used in the form in which it is commercially available. For example, ethanol can be used as absolute ethanol (100%) or as 95% ethanol, the portion is water. This method is described in more detail in US Patent 5,976,567.

In one exemplary embodiment, the lipid mixture is a mixture of cationic lipids, neutral lipids (other than cationic lipids), a sterol (eg, cholesterol), and a PEG-modified lipid (eg, a

PEG-DMG or PEG-DMA) in an alcohol solvent. In lipid modalities it consists essentially of a preferred one, the mixture cationic lipid, a neutral lipid, cholesterol and lipid modified by PEG in alcohol, more preferably ethanol.

In modalities

161 additional preferred,

IMPI

MEXICAN INSTITUTE

PROPERTY the first solution coryS'iíS't ^

anterior lipid mixture in molar ratios of —algededoE · of 20-70% of cationic lipid: 5-45% of neutral lipid: 20-55% of cholesterol: 0.5-15% of lipid modified by PEG. In still

- Other preferred embodiments, the first solution consists essentially of a lipid chosen from Table 1, DSPC, Col and PEG-DMG or PEG-DMA, more preferably in a molar ratio of about 20-60% cationic lipid: 5- 25% DSPC: 25-55% Col: 0.5-15% PEG-DMG or PEG-DMA. In particular modalities, the molar lipid ratio is approximately 40/10/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEGDMA), 35/15/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA) or 52/13/30/5 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA). In another group of preferred embodiments, the neutral lipid in these compositions is replaced with POPC, DPPC, DOPE, or SM.

In accordance with the invention, the lipid mixture is combined with a buffered aqueous solution that may contain nucleic acids. The buffered aqueous solution of [sic] is typically a solution in which the buffer has a pH less than pKto of the protonable lipid in the lipid mixture. Examples of suitable buffers include citrate, phosphate, acetate, and MES. A particularly preferred buffer is citrate buffer. Preferred dampers will be in the range of

162

1-1000 mM of the anion, depending on the

1M rl · • iSTtTUTQ MEX1CA N 'M w INDU.'TRIAL chemical property of acidó

Nucleic that is being encapsulated buffer concentration can achieve high loading levels and the optimization ^ SeTT ^ is significant for (see, eg, US Patent 6,287,591 and US Patent 6,858,225).

Alternatively, pure water acidified to a pH 5-6 with chloride, sulfate or the like can be useful. In this case, it may be appropriate to add 5% glucose or other nonionic solute that will balance the osmotic potential across the particle membrane when the particles are dialyzed to remove ethanol, increase the pH, or mix it with a pharmaceutically acceptable carrier such as normal saline.

The amount of nucleic acid in buffer can vary, but will typically be from about 0.01 mg / mL to about 200 mg / mL, more preferably from about 0.5 mg / mL to about 50mg / mL.

The lipid mixture and the aqueous therapeutic nucleic acid buffered solution combine to provide an intermediate mixture. The intermediate mixture is typically a mixture of lipid particles that have encapsulated nucleic acids. Additionally, the intermediate mixture may also contain some portion of nucleic acids that are bound to the surface of lipid particles (liposomes or lipid vesicles) due to the ionic attraction of negatively charged nucleic acids and

163

IMPI

MKXIONO INSTITUTE positively charged lipids on the surface! Lt £ & H $ ^ r lipid (aminolipids or other lipids gne rr> nstitnyi> n the first protonable lipid component are positively charged in a buffer that has a pH lower than pKto of the protonable group in the lipid). In a group of

modalities lipid blending is a preferred solution,

<td>alcoholic</td><td>of lipids and</td><td>volumes</td><td>of each one</td><td>of</td><td>the</td>

<td>solutions</td><td>fits from</td><td>such way</td><td>what then</td><td>of</td><td>the</td>

<td>combination</td><td>, the content</td><td>resulting</td><td>alcohol</td><td>be</td><td>of</td>

45% in around

20% by volume to about volume. The method of combining the mixtures can include any one of a variety of processes, which generally depends on the scale of formulation produced. For example, when the total volume is around 10-20 mL or less, the solutions can be combined in a test tube and shaken together using a vortex mixer. Large-scale processes can be carried out in suitable production-scale glassware.

Optionally, lipid-encapsulated therapeutic agent complexes (eg nucleic acid) that are produced by combining the lipid mixture and the aqueous buffer of the therapeutic agents (nucleic acids) can be resized to achieve a desired size range and a relatively small distribution of lipid particle sizes. Preferably at

164 llvir • INDUSTRIAL * «- compositions provided herein will be sized to have an average diameter from about 70 to about 200 nm, more preferably around 90 to about 130 nm. There are various techniques to adjust the size of the liposomes to a desired size. A size adjustment method is described in US Patent No. 4,737,323, which is incorporated herein by reference. Sonication of a liposome suspension by either bath or tube sonication produces a progressive reduction in size to small unilamellar vesicles (SUVs) of less than about 0.05 microns in size. Homogenization is another method that relies on shear energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, the multilamellar vesicles are recirculated through a standard emulsion homogenizer until selected liposome sizes are observed, typically between about 0.1 and 0.5 microns. In both methods, the particle size distribution can be monitored by ray or laser particle size determination . For some methods herein, extrusion is used to obtain a uniform gallbladder size.

Extrusion of liposome compositions through a small pore polycarbonate membrane or membrane

165 Asymmetric ceramic results in a

MLX1CAW INSTITUTE., IA PROPERTY

... JNDUSTJUAL Ni.

relatively well defined · size distribution. Typically, --- Ι7Γ suspension is cycled through the membrane one or more times until the distribution size of the desired liposome complex is achieved. Liposomes can be extruded by passing them successively through smaller pore membranes, to achieve a gradual reduction in liposome size. In some cases, the nucleic acid-lipid compositions that form can be used without making any adjustments to their size.

In particular embodiments, the methods of the present invention further comprise a step of neutralizing at least some of the surface charges on the lipid portions of the nucleic acid-lipid compositions. Ά1 At least partially neutralizing surface charges, the unencapsulated nucleic acid is released from the lipid particle surface and can be removed from the composition using conventional techniques. Preferably, the non-encapsulated and surface absorbed nucleic acids are removed from the resulting compositions through the exchange of buffered solutions. For example, replacing a citrate buffer (pH around 4.0, used to form the compositions) with a buffered saline HEPES (HBS with a pH around 7.5), results in neutralization of the

166

IMPI

INSTITUTE liposome surface and the release of áci ^ & NwnB £ the surface. Nucleic Acid l-IbaraHn ριΊ<_l_ removed by chromatography using standard methods and can then be transformed into a buffer with a pH above the pKa of the lipid used.

Optionally, lipid vesicles (i.e. lipid particles) can be formed by hydration in an aqueous buffer and can be resized using any of the methods described above prior to the addition of nucleic acid. As described above, the aqueous buffer should be of a lower pH than the pKa of the aminolipid. A solution of the nucleic acids can then be added to these pre-formed, size-adjusted vesicles. To allow encapsulation of nucleic acids in such previously formed vesicles, the mixture should contain an alcohol such as ethanol. In the case of ethanol, it should be present in a concentration of around 20% (w / w) to around

45% (w / w) · In addition, it may be necessary to heat the mixture of previously formed vesicles and nucleic acid in the aqueous buffer-ethanol mixture to a temperature of around 25 ° C to around 50 ° C depending on the composition of lipid vesicles and the nature of nucleic acid. It will be apparent to the person skilled in the art that optimization of the encapsulation process to achieve a

167

desired level will require concentration

Nucleic acid IMPI in vesí''Steí¡ & ew<ÉÍAip:

INDUSTRY*.

manipulation of variables such as ethanol and temperature. Examples of suitable conditions for nucleic acid encapsulation are provided in the Examples section. Once the nucleic acids are encapsulated within the previously formed vesicles, the external pH can be increased to at least partially neutralize the surface charge. The non-encapsulated and surface adsorbed nucleic acids can then be removed as described above.

Methods of use

The lipid particles of the present invention can be used to administer a therapeutic agent to a cell, in vitro or in vivo. In particular embodiments, the therapeutic agent is a nucleic acid that is administered to a cell using nucleic acid lipid particles of the present invention. While the following description of various methods of using the lipid particles and related pharmaceutical compositions of the present invention are exemplified by means of a description related to nucleic acid lipid particles, it is understood that these methods and compositions can be readily adapted for delivery. of any therapeutic agent for the treatment of any disease or disorder that

168 would benefit from such treatment.

IMPI

MEX1CAN INSTITUTE ..

OF LA PLOPIEüa; .

INDUSTRIAL

In some embodiments, the present invention. provides methods for introducing a nucleic acid into a cell. Preferred nucleic acids for introduction into cells are siRNAs, immunostimulatory oligonucleotides, plasmids, antisenses, and ribosomes. These methods can be carried out by contacting the particles or compositions of the present invention with the cells for a period of time sufficient for intracellular administration to occur.

The compositions of the present invention can be adsorbed to any type of cell. Once adsorbed, the nucleic acid-lipid particles can be endocited by a portion of the cells, lipid exchange with cell membranes, or fusion with the cells. Transfer or incorporation of the nucleic acid portion of the complex can take place via either of these pathways. Without intending to limit the scope of the invention, it is believed that in the case of particles captured in the cell by endocytosis the particles then interact with the endosomal membrane, resulting in destabilization of the endosomal membrane, possibly by formation of non-bilayer phases, resulting in the introduction of encapsulated nucleic acid into the cell cytoplasm. Similarly, in

169 the case of direct merger of

IMPI i particle S ^ 'S ^ Ómo ^ a * óin¿

INDUSTRIAL plasma cell when fusion occurs, the membrane of

<td>liposome is</td><td>integrated in</td><td>the membrane</td><td>mobile</td><td>and the</td>

<td>contents of</td><td>liposome</td><td>combine</td><td>with the</td><td>fluid</td>

<td>intracellular.</td><td>The contact</td><td>between the</td><td>cells</td><td>and the</td>

Nucleic acid-lipid compositions, when carried out in vitro, will take place in a biologically compatible medium. The concentration of the compositions can vary widely depending on the particular application, but is generally around 1 pmol and around 10 mmol. In certain modalities, treatment of cells with nucleic acid-lipid compositions will generally be carried out at physiological temperatures (about 37 ° C) for periods of time from about 1 to 24 hours, preferably from about 2 to 8 hours. For in vitro applications, the administration of nucleic acids can be to any cell that grows in culture, whether of plant or animal origin, vertebrate or invertebrate and of any tissue or type. In preferred embodiments, the cells will be animal cells, more preferably mammalian cells, and even more preferably human cells.

In one group of modalities, a nucleic acid-lipid particle suspension is added to 60-80% of plated confluent cells' having a cell density of about 103 to around 105 cells / mL, more

170 preferably around

IMPI

INSTITUTE ΜΕΧΙΟΊ '...

x 104 ciW®mL'r

concentration of the added suspension, which looked -ee · preferably from about 0.01 to 20 pg / mL, more preferably about 1 pg / mL.

In another embodiment, the lipid particles of the invention can be nucleic to a tumor cell cell). Those used to administer an acid or cell line (eg, a non-limiting line example of such cell lines include: HELA (ATCC Cat N: CCL-2), KB

CCL-17),

HTB-77), (ATCC

Cat

N:

HEP3B (ATCC Cat N: HB-8064), SKOV-3

HCT-116 (ATCC Cat N: CCL-247), HT-29

PC-3 (ATCC Cat N:

185), MDA-MB-231 (ATCC Cat

Applications (ATCC (ATCC

Cat

N:

CRL-1435), A549 (ATCC Cat N: CCLtypes include using well-known procedures to provide intracellular delivery of siRNA to interfere or silence specific cellular targets.

applications include administration

Useful DNA or mRNA. Of diseases encoding this form, gene deficient genetics or Duchenne dystrophy, polypeptides provide

Alternatively, for therapeutically treating sequences for via the supply of gene-free products see Kunkel, et al., And for fibrosis (i.e.

Brit. Med.

cystic for

Bull.

see

Goodfellow, Nature 341: 102-103 (1989)). Other uses for

171

IMPI

MU INSTITUTE »* *

MU? * »® * · 'invention include the compositions herein

introduction of antiseptic oligonucleotides into cells (see, Bennett, et al.

Mol. Pharm. 41: 1023-1033 (1992)).

Alternatively, the compositions of the present invention can also be used for the administration of nucleic acids to cells in vivo, using methods that are known to those skilled in the art. Regarding administration of DNA or mRNA sequences, Zhu, et al., Science 261: 209-211 (1993), incorporated herein by reference, describes intravenous administration of cytomegalovirus (CMV) expression plasmid. -chloramphenicol acetyltransferase (CAT) using complexes

DOTMA-DOPE. Hyde, et al., Nature 362: 250-256 (1993), incorporated herein by reference, describes the administration of the cystic fibrosis transmembrane conductance regulator (CFTR) gene to the airway epithelium and alveoli in the lung of mice, using liposomes. Brigham, et al., Am. J. Med. Sci. 298: 278281 (1989), incorporated herein by reference, describes the in vivo transfection of mouse lungs with a functioning prokaryotic gene encoding the intracellular enzyme, chloramphenicol acetyltransferase (CAT). Therefore, the compositions of the invention can be used in the treatment of infectious diseases.

For in vivo administration, the compositions

172

IMPI

Mívir-iiu INSTITUTE. ·.

MEXICAN INSTITUTE.

PROPERTY Pharmaceuticals are preferably administered cie ^^ 'parenteral foríter, that is, intraarticularly, intÍdvéflüüd1, · Intraperitoneal, subcutaneous or intramuscular. In particular embodiments, the pharmaceutical compositions are administered intravenously or intraperitoneally by bolus injection. For an example, see Stadler, et al. US Patent No. 5,286,634, which is incorporated herein by reference. Intracellular nucleic acid administration has also been discussed in Straubringer, et al., Methods in Enzymology, Academic Press, New York. 101: 512-527 (1983); Mannino, et al., Biotechniques 6: 682-690 (1988); Nicolau, et al., Crit. Rev. Ther. Drug Carrier Syst. 6: 239-271 (1989), and Behr, Acc. Chem. Res. 26: 274-278 (1993). Even other methods of administering lipid-based treatments are described in, for example, Rahman et al., US Patent No. 3,993,754, Sears, US Patent No. 4,145,410; Papahadjopoulos et al., US Patent No. 4,235,871; Schneider, US Patent No. 4,224,179; Lenk et al., US Patent No. 4,522,803 and Fountain et al., US Patent No. 4,588,578.

In other methods, the pharmaceutical preparations can be contacted with the target tissue by directly applying the preparation to the tissue. The application can be by topical procedure, open or closed. By topic is meant the direct application of

173 the pharmaceutical preparation to such as the skin, oropharynx, the like. The procedures

IMPI

INSTITUTO MEXICAN · DE LA ΡΚΟΜΪΟΑ · 1NOUSTP.IAI tissue exposed to the environment,

External and open ear canal are those procedures that include making an incision in a patient's skin and directly visualizing the underlying tissue to which the pharmaceutical preparations are applied. This is generally accomplished by a surgical procedure, such as a thoracotomy to access the lungs, abdominal laparotomy to access the abdominal viscera, or another direct surgical approach to the target tissue. Closed procedures are invasive procedures in which the internal target tissues are not directly visualized, but are accessed through the insertion of instruments through small skin wounds. For example, the preparations can be administered to the peritoneum by needle washing.

Also, the pharmaceutical preparations can be administered to the meninges or the spinal cord by infusion during a lumbar puncture followed by proper positioning of the patient as is commonly done for spinal anesthesia or metrazamide imaging to the spinal cord.

Alternatively, the preparations can be administered by means of endoscopic devices.

The nucleic acid-lipid compositions can also be administered in an inhaled aerosol into the lungs.

174

INUUmiAL (see Brigham, et al., Am. J. Sci.

298 ((1989)) or by direct injection to the site of

Human Gene Therapy, MaryAnn Liebert, the disease (Culver,

Inc., Publishers, New

York. pp. 70-71 (1994)).

The methods of the present invention can be practiced on a variety of hosts. Preferred hosts include mammalian species, such as humans, non-human primates, dogs, cats, cattle, horses, sheep, and the like.

The doses for the therapeutic lipid agent particles of the present invention will depend on the ratio of the therapeutic agent to the lipid and the opinion of the physician administering it based on the age, weight and condition of the patient.

In one embodiment, the present invention provides a method of modulating the expression of a target polynucleotide or polypeptide. These methods generally comprise contacting a cell with a lipid particle of the present invention that is associated with a nucleic acid capable of modulating the expression of a target polynucleotide or polypeptide. As used herein, the term "modular" refers to altering the expression of a target polynucleotide or polypeptide. In different modalities, modular can mean increase or improve or can mean decrease or decrease. The methods to measure

175

ΟΕ LA * ΙΤ1 ·1 the level of expression of a polynucleotide or target are known and available include, eg. , methods that use reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemical techniques. In particular embodiments, the expression level of a target polynucleotide or polypeptide is increased or decreased by at least 10%, 20%, 30%, 40%, 50%, or more than 50% compared to a suitable control value.

For example, if increased expression of a polypeptide is desired, the nucleic acid may be an expression vector that includes a polynucleotide that encodes the desired polypeptide. On the other hand, if reduced expression of a polynucleotide or polypeptide is desired, then the nucleic acid can be, eg, an antisense oligonucleotide, siRNA, or microRNA comprising a polynucleotide sequence that specifically hybridizes to a polynucleotide encoding the target polypeptide, thereby altering the expression of the target polynucleotide or polypeptide. Alternatively, the nucleic acid can be a plasmid expressing such an antisense oligonucleotide, siRNA or microRNA.

In a particular embodiment, the present invention provides a method of modulating the expression of a polypeptide by a cell, which comprises providing the cell with a lipid particle consisting of or consisting of

176 I ask for chosen

INDUSTRIAL basically by 11

PEG-DMG or PEG-DMA, eg, in a molar ratio of about 20-60% cationic lipid: 5-25% DSPC: 25-55% Col: 0.5-15% PEG-DMG or PEG-DMA, where the lipid particle is associated with a nucleic acid capable of modulating the expression of the polypeptide. In particular embodiments, the molar lipid ratio is approximately 40/10/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA), 35/15/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA) or 52/13/30/5 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEGDMA). In another group of modalities, the neutral lipid in these compositions is replaced with POPC, DPPC, DOPE or SM.

In particular embodiments, the therapeutic agent is selected from a siRNA, a microRNA, an antisense oligonucleotide, and a plasmid capable of expressing a siRNA, a microRNA, or an antisense oligonucleotide, and where the siRNA, microRNA, or antisense oligonucleotide comprises a polynucleotide that is specifically binds to a polynucleotide encoding the polypeptide, or a complement thereof, such that expression of the polypeptide is reduced.

In other embodiments, the nucleic acid is a plasmid that encodes the polypeptide or a functional fragment or variant thereof, such that expression of the polypeptide or functional variant or fragment thereof is increased.

ai*

177

IMPI „,. . ,, η. . , MEXICAN INSTITUTE

In related embodiments, the presen® © * ^ oairovi provides a method of treating a disease or disorder characterized by overexpression of a polypeptide in a subject, which comprises providing the subject with a pharmaceutical composition of the present invention, where the therapeutic agent is selected of a siRNA, a microRNA, an antisense oligonucleotide and a plasmid capable of expressing a siRNA, a microRNA or an antisense oligonucleotide, and where the siRNA, the microRNA or antisense RNA comprises a polynucleotide that specifically binds to a polynucleotide that encodes the polypeptide or a complement thereof.

In one embodiment, the pharmaceutical composition comprises a lipid particle consisting of or consisting essentially of a lipid chosen from Table 1, DSPC, Col, and PEG-DMG or PEG-DMA, eg, in a molar ratio of about 20 -60% cationic lipid: 5-25% DSPC: 25-55% Col: 0.5-15% PEG-DMG or PEG-DMA, where the lipid particle is associated with therapeutic nucleic acid. In particular modalities, the molar lipid ratio is approximately 40/10/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA), 35/15/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA) or 52/13/30/5 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA). In another group of modalities, the neutral lipid in these compositions

178 it is replaced with POPC, DPPC, DOPE or SM.

ΙΜΡΙΓ

MSTITMTO MfcXJCANO í ia * »r> oirn. ,.

OF ΙΛ PROPERTY

INDI i.strial

In one embodiment, the pharmaceutical composition comprises a lipid particle that consists of or consists essentially of a lipid chosen from Table 1, DSPC, Col, and PEG-DMG or PEG-DMA, eg, in a molar ratio of about 20 -60% cationic lipid: 5-25% DSPC: 25-55% Col: 0.5-15% PEG-DMG or PEG-DMA, where the lipid particle is associated with therapeutic nucleic acid. In particular modalities, the molar lipid ratio is approximately 40/10/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA), 35/15/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA) or 52/13/30/5 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA). In another group of modalities, the neutral lipid in these compositions is replaced with POPC, DPPC, DOPE or SM.

The present invention further provides a method of inducing an immune response in a subject comprising providing the subject with the composition

179 the present industrial invention

Therapeutic pharmaceutical is an immunostimulatory oligonucleotide. In1 K.iianvi · «IΒΐΐιβι ,, ι ιΛ- (μιιιμμι <λ · ι ·) In some modalities, the immune response is a humoral or mucous immune response. In one embodiment, the pharmaceutical composition comprises a lipid particle consisting of or consisting essentially of a lipid chosen from Table 1, DSPC, Col, and PEG-DMG or PEG-DMA, eg, in a molar ratio of about 20 -60% cationic lipid: 525% DSPC: 25-55% Col: 0.5-15% PEG-DMG or PEG-DMA, where the lipid particle is associated with therapeutic nucleic acid. In particular modalities, the molar lipid ratio is approximately 40/10/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA), 35/15/40/10 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA) or 52/13/30/5 (mol% cationic lipid / DSPC / Col / PEG-DMG or PEG-DMA). In another group of modalities, the neutral lipid in these compositions is replaced with POPC, DPPC, DOPE or SM.

In additional embodiments, the pharmaceutical composition is provided to the patient in combination with a vaccine or antigen. Therefore, the present invention in itself provides vaccines comprising a lipid particle of the present invention, which comprises an immunostimulatory oligonucleotide and is also associated with an antigen from which an immune response is desired. In particular embodiments, the antigen is a tumor antigen.

180

or is associated with an infectious agent, such as INDUSTRIAL · »a virus, a bacterium or a parasite.

A variety of tumor antigens, infectious agent antigens, and antigens associated with another disease are well known in the art and examples of these are described in the references cited herein. Examples of antigens suitable for use in the present invention include, but are not limited to, polypeptide antigens and DNA antigens. Specific examples of antigens are Hepatitis A, Hepatitis B, smallpox, polio, anthrax, influenza, typhus, tetanus, measles, rotavirus, diphtheria, whooping cough, tuberculosis, and rubella antigens. In a preferred embodiment, the antigen is a recombinant Hepatitis B antigen. In other aspects, the antigen is a recombinant Hepatitis A antigen. In another aspect, the antigen is a tumor antigen. Examples of such tumor associated antigens are MUC-1 antigen, EBV and Burkitt lymphoma associated antigens. In a further aspect, the antigen is a tyrosinase-related recombinant tumor protein antigen antigen. Those skilled in the art will be aware of other antigens suitable for use in the present invention.

Tumor-associated antigens suitable for use in the present invention include mutated or non-mutated molecules that can indicate a single, shared tumor type.

181 between different types of tumors and / or

IMPI

MEXICAN INSTITUTE

overexpressed exclusively in cells - comparison with normal cells

In addition to proteins and glycoproteins, tumor-specific expression patterns of carbohydrates, gangliosides, glycolipids, and mucins have also been documented. Examples of tumor associated antigens for use in the cancer vaccines in question include oncogen protein products, tumor suppressor genes and other genes with unique mutations or new dispositions to tumor cells, reactivated embryonic gene products, oncofetal antigens, antigens. tissue-specific (but not tumor-specific) differentiation, growth factor receptors, cell surface carbohydrate residues, external viral proteins and a number of other auto-proteins.

Specific modalities of tumor associated antigens include, eg. , mutated antigens such as the protein products of the protoncogene Ras p21, tumor suppressor p53 and oncogene BCR-abl, as well as CDK4, MUM1, Caspase 8 and beta catenin; overexpressed antigens such as galectin 4, galectin 9, carbonic anhydrase, Aldolase A, PRAME, Her2 / neu, ErbB-2 and KSA, oncofetal antigens such as alpha fetoprotein (AFP), human chorionic gonadotrophin (hCG); autoantigens such as carcinoembryonic antigen

182

Mart 1 / Melan A, gplOO, (CEA) and melanrooiiitr differentiation antigens ^ s ^^ e ^

INO <Jffllt At gp75, Tyrosinase, TRP1 and TRP2;

prostate associated antigens such as PSA, PAP,

PSMA, PSM-P1 and PSM-P2;

reactivated embryonic gene products such as MAGE 1, MAGE

2, BAGE, RAGE and other antigens of

3, MAGE 4, GAGE 1, GAGE testicular cancer such as NY-ESO1, SSX2 and SCP1; mucins such as Muc-1 and Muc-2; gangliosides such as GM2, GD2 and GD3, glycolipids and neutral glycoproteins such as Lewis (y) and H-globe and glycoproteins such as Tn, Thompson-Freidenreich (TF) antigen and sTn. Also included herein are tumor associated antigens, whole cell and tumor cell lysates as well as immunogenic portions thereof, as well as immunoglobulin idiotypes expressed in monoclonal B lymphocyte proliferations for use against lymphocyte lymphomas.

Pathogens include, but are not limited to, infectious agents, eg, viruses that infect mammals and more particularly humans. Examples of infectious viruses include, but are not limited to: Retroviridae (eg, human immunodeficiency virus, such as HIV-1 (also called HTLV-III, LAV, or HTLV-III / LAV or

HIV-III and other isolated viral strains, such as HIV-LP;

Picornaviridae (eg, polio virus, hepatitis A virus;

enterovirus, virus

Human coxsackie, rhinovirus, ecovirus); Calciviridae (by

183 eg, strains that cause gastroenteritis);

IMPI

MÍXICAÍI INSTITUTE> OF INDUSTRIAL PROPERTY Togaviridae (

equine encephalitis virus, rubella virus); Flaviridae (eg, dengue virus, encephalitis virus, yellow fever virus); Coronoviridae (eg coronavirus); Rhabdoviradae (eg, vesicular stomatitis virus, rabies virus); Coronaviridae (eg coronavirus); Rhabdoviridae (eg, vesicular stomatitis virus, rabies virus); Filoviridae (eg Ebola virus); Paramyxoviridae (eg, influenza virus, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (eg, influenza virus); Bungaviridae (eg, Hantaan virus, bungavirus, phlebovirus, and Nairovirus); Viridae sand (hemorrhagic fever virus); Reoviridae (eg, reovirus, orbiviurs, and rotavirus); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviride (parvovirus); Papovaviridae (papilloma virus, polyoma virus); Adenoviridae (most adenoviruses); Herpesviridae herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes virus; Poxviridae (smallpox virus, vaccine virus, chickenpox virus) and Iridoviridae (eg, African swine fever virus) and unclassified viruses (eg, the etiologic agents of spongiform encephalopathies, the delta agent hepatitis (believed to be is a defective satellite of the hepatitis B virus), the hepatitis agents that are neither A nor B (class l = internally transmitted; class

184

Gram negative and gram positive bacteria also serve as antigens in vertebrate animals. Such gram positive bacteria include, but are not limited to the Pasteurella genus, Staphylococci genus, and Streptococcus genus. Gram negative bacteria include, but are not limited to Escherichia coli, Pseudomonas genus, and Salmonella genus. Specific examples of infectious bacteria include, but are not limited to: Helicobacterpyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (eg, M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M.

gordonae), Staphylococcus aureus,

Neisseria gonorrhoeae,

Neisseria meningitidis, Listeria monocytogenes

Streptococcus pyogenes (Group A Streptococcus),

Streptococcus agalactiae (group B Streptococcus), Streptococcus (group viridans),

Streptococcusfaecalis,

Streptococcus bovis,

Streptococcus (anaerobe sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus infuenzae, Bacillus anthracis, corynebacterium diphtheriae, bacteria, Closerbacterium, Corynebacterium sp., Erysipelothirix Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue,

185

Leptospira, Rickettsia and Actinomyces israelli. DC

INOUSTRIAL ***.

Additional examples of pathogens include, but are not limited to, infectious fungi that infect mammals and more particularly humans. Examples of infectious fungi include, but are not limited to

Cryptococcus neoformans,

Histoplasma capsulatum,

Coccidioides immitis,

Blastomyces dermatitidis,

Chlamydia trachomatis, Candida albicans. Examples of infectious parasites include Plasmodium such as Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, and Plasmodium vivax. Other infectious organisms (i.e., protists) include Toxoplasma gondii.

In one embodiment, the formulations of the invention can be used to silence or modulate a target gene such as but not limited to FVII, Eg5, PCSK9, TPX2, apoB, SZXA, TTR, RSV, PDGF beta gene, Erb-B gene, Src gene, CRK gene, GRB2 gene, RAS gene, MEKK gene, JNK gene, RAF gene, Erkl / 2 gene, PCNA gene (p21), MYB gene, JUN gene, FOS gene, BCL-2 gene, cyclin gene D, VEGF gene, EGFR gene, cyclin A gene, cyclin E gene, WNT-1 gene, beta catenin gene, c-MET gene, PKC gene, NFKB gene, STAT3 gene, survivin gene, Her2 / Neu gene, SORT1 gene, XBP1 gene, topoisomerase I gene, topoisomerase II alpha gene, gene p73, gene p21 (WAF1 / CIP1), gene p27 ( KIP1), PPM1D gene, RAS gene, caveolin I gene, MIB I gene, MTAI gene, M68 gene, tumor suppressor genes, tumor suppressor gene p53, DN-p63

186

MEXICAN INSTITUTE member of the p53 family, tumor suppressor gene tumor suppressor APC1, gene suppressor tnmnrai RRrair g ^np tumor suppressor PTEN, mLL fusion gene, BCR / ABL fusion gene, TEL / AML1 fusion gene, EWS / FLI1 fusion gene, TLS / FUS1 fusion gene, PAX3 / FKHR fusion gene, AML1 / ETO fusion gene , alpha v-integrin gene, Flt-1 receptor gene, tubulin gene, human papillomavirus gene, a gene required for replication of human papillomavirus, gene of human immunodeficiency virus, a gene required for virus replication of human immunodeficiency, Hepatitis A virus gene, a gene required for Hepatitis A virus replication, Hepatitis B virus gene, a gene required for Hepatitis B virus replication, Hepatitis C virus gene, a gene required for the replication of the Hepatitis C virus, gene for the Hepatitis D virus, a gene required for the replication of the Hepatitis D virus, gene for the Hepatitis E virus, a gene required for Hepatitis E virus replication, Hepatitis F virus gene, a gene required for Hepatitis F virus replication, Hepatitis G virus gene, a gene required for virus replication of Hepatitis G, gene of Hepatitis H virus, a gene required for replication of Hepatitis H virus, gene of respiratory syncytial virus, a gene required for replication of syncytial virus

187 respiratory, herpes virus gene

INSTITUTO MEXICANO Arfravffj, DE LA FRONEDAL · simple, iNqamiALgesgw required for the replication of the herpes cytomegalovirus gene, a replication gene for herpes cytomegalovirus, of · Ή? Γρ? Ο ci ^ p10 required for the herpes virus Epstein Barr gene, a gene required for the replication of herpes virus Epstein Barr, herpesvirus gene associated with Kaposi's sarcoma, a gene required for the replication of the herpesvirus gene associated with Kaposi's sarcoma , JC virus gene, human gene that is required for the replication of the JC virus, myxovirus gene, a gene that is required for the replication of the myxovirus gene, rhinovirus gene, a gene that is required for the replication of the rhinovirus, coronavirus gene, a gene that is required for the replication of the coronavirus, West Nile virus gene, a gene that is required for the replication of the West Nile virus, gene of San Luis encephalitis , a gene that is required for the replication of St. Louis encephalitis, gene for the tick-borne encephalitis virus, a gene that is required for the replication of tick-borne encephalitis, Murray Valley encephalitis virus gene, a gene that is required for replication of the Murray Valley encephalitis virus, dengue virus gene, a gene that is required for replication of the dengue virus gene, 40 virus gene of ape, a gene that is required for the replication of the

188

IMPI ~

MEXICAN INSTITUTE

FROM nOPIEPAD simian virus 40, gene of the fiumanb lymphotropic virus of T cells, a gene that is required for the Theology, the human lymphotropic virus of T cells, gene of the murine leukemia virus of Moloney, a gene that is required for the replication of the Moloney murine leukemia virus, the encephalomyocarditis virus gene, a gene that is required for the replication of the encephalomyocarditis virus, the measles virus gene, a gene that is required for the replication of the measles virus, the varicella zoster virus gene, a gene that is required for the replication of the varicella zoster virus, the adenovirus gene, a gene that is required for the replication of the adenovirus, gene of the yellow fever virus, a gene that is required for the replication of the yellow fever virus, poliovirus gene, a gene that is required for the replication of the poliovirus, the chickenpox virus gene, a gene that is required for the replication of the chickenpox virus, plasmodium gene, a gene that is required for the replication of the plasmodium gene, Mycobacterium ulcerans gene, a gene that is required for the replication of Mycobacterium ulcerans, Mycobacterium tuberculosis gene , a gene that is required for the replication of Mycobacterium tuberculosis, gene Mycobacterium leprae, a gene that is required for the replication of Mycobacterium leprae, gene Staphylococcus aureus, a gene that is required for replication of the

189

Staphylococcus aureus, gene

Streptococcus

IMPT ^

MMXICA INSTITUTE

FROM OWNERSHIP.O pneumonid ^ '-TWi which is required for the replication of the —Srf'epd'CUUUUS1 pneumoniae, Streptococcus pyogenes gene, a gene that is required for the replication of Streptococcus pyogenes, Chlamydia pneumoniae gene, a gene that is required for Chlamydia pneumoniae replication, Mycoplasma pneumoniae gene, a gene that is required for Mycoplasma pneumoniae replication, an integrin gene, a selectin gene, complement system gene, chemokine gene, chemokine receptor gene, GCSF gene, Grol gene, Gro2 gene, Gro3 gene, PF4 gene, gene the basic protein platelet, gene MIP-1I, gene

RANTES, gene MCP-1, gene MCP-2, gene MCP-3, gene

CMBKR2, CMBKR3 gene, CMBKR5v, AIF-1 gene, gene for a component of an ion channel, a neurotransmitter receptor, a gene for neurotransmitter, gene of the amyloid family,

<td>gene</td><td colspan="2">CMBKR1,</td>

<td>a</td><td colspan="2">ligand</td>

Presenilin, HD gene, DRPLA gene, SCA1 gene, SCA2 gene, gene

MJD1, CACNL1A4 gene, SCA7 gene, SCA8 gene, allele gene found in LOH cells or an allele gene of a polymorphic gene.

Definitions

Alkyl means a saturated, straight or branched chain, non-cyclic or cyclic aliphatic hydrocarbon, which

190

IMPI

MLXiCAN INSTITUTE; · & ** &&& Ά

OF THE FWHFJJAíj contains from 1 to 24 carbon atoms. Representative straight-chain alkylS ^ Sturad ^ include methyl, 'ethyl, ri ......

propyl, n-butyl, n-pentyl, n-hexyl, and the like; while the saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, and the like. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl and the like.

Alkenyl means an alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Representative straight or branched chain alkenyls include ethylenyl, propylene,

1- butenyl, 2-butenyl, isobutylene, 1-pentenyl, 2-pentenyl, 3-methyl-l-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl and the like.

Alkynyl means an alkyl or alkenyl, as defined above, that additionally contains at least one triple bond between adjacent carbons. Representative straight or branched chain alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl,

2- pentynyl, 3-methyl-l-butynyl and the like.

The term acyl refers to hydrogen, alkyl, partially saturated or fully saturated cycloalkyl,

191

partially heterocycle

INDUSTRIAL PROPERTY saturated or completely satu aryl and carbonyl groups substituted by heteroaryl. For example, acyl includes groups such as (C1-C20) alkanoyl (eg, formyl, acetyl, propionyl, butyryl, valeryl, caproyl, t-butylacetyl, etc.), cycloalkylcarbonyl (C3C20) (eg, cyclopropylcarbonyl, cyclobutylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl, etc.), heterocyclic carbonyl (eg, pyrrolidinylcarbonyl, pyrrolid-2one-5-carbonyl, piperidinylcarbonyl, piperazinylcarbonyl, tetrahydrofuranylcarbonyl, etc.), aroyl (eg. benzoyl) and heteroaryl (eg, thiophenyl-2-carbonyl, thiophenyl-3carbonyl, furanyl-2-carbonyl, furanyl-3-carbonyl, 1Hpiroyl-2-carbonyl, lH-pyrroyl-3-carbonyl, benzo [b] thiophenyl -2-carbonyl, etc.).

The term "aryl" refers to an aromatic, monocyclic, bicyclic, or tricyclic hydrocarbon ring system, where any ring atom may be substituted. Examples of aryl portions include, but are not limited to, phenyl, naphthyl, anthracenyl, and pyrene.

Heterocycle means a 5- to 7-membered monocyclic or 7 to 10-membered bicyclic heterocyclic ring, which is saturated, unsaturated, or aromatic and which contains 1 or 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur and where the heteroatoms of nitrogen and sulfur can be optionally

192 oxides and the nitrogen atom B'S®egí

INDUSTRIAL

optionally quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle may be attached via a heteroatom or carbon atom. Heterocycles include heteroaryls as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperizinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl and the like.

The term heteroaryl refers to an aromatic ring system, 5-8 membered monocyclic, 8-12 membered bicyclic or 11-14 membered tricyclic, which has 1-3 heteroatoms if monocyclic, 1-6 heteroatoms in in case of being bicyclic or 1-9 heteroatoms in case of being tricyclic, said heteroatoms are selected from O, N or S (ex. carbon atoms and 1-3, 1-6 or 1-9 heteroatoms of N, 0 or S (in case of being monocyclic, bicyclic or tricyclic, respectively) where any ring atom can be substituted. The heteroaryl groups described herein can also contain fused rings that share a common carbon-carbon bond. The term alkylheterocycle

193

-L XVI 1 i

INSTITUTO MEXICANO DE LA FROPIED »Ó industrial refers to a heteroaryl where at least one of the ring atoms is substituted by alkyl, alkenyl or alkynyl.

The term "substituted" refers to the replacement of one or more hydrogen radicals in a structure given by the radical of a specified substituent that includes, but is not limited to halo, alkyl, alkenyl, alkynyl, aryl, heterocyclyl, thiol, alkylthio, oxo, thioxy, arylthio, alkylthioalkyl, arylthioalkyl, alkylsulfonyl, alkylsulfonylalkyl, arylsulfonylalkyl, alkoxy, aryloxy, aralkoxy, aminocarbonyl, alkylaminocarbonyl, arylaminocarbonyl, alkoxycarbonyl, aryloxycarbonyl, haloalkyl, amino, trifluoromethyl, cyano, nitro, alkylamino, arylamino, alkylaminoalkyl, arylaminoalkyl, aminoalkylamino, hydroxy, alkoxyalkyl, carboxyalkyl, alkoxycarbonylalkyl, heterocarbonylalkyl, aryl, carboxylic acid, sulfonic acid and aliphatic. It is understood that the substituent may be additionally substituted.

Examples of substituents include amino, alkylamino, dialkylamino, and cyclic amino compounds.

Halogen means fluoro, chloro, bromo and iodo.

refer to -NH (alkyl) radicals

The terms alkylamine and dialkylamine are

194 respectively.

The term alkyl phosphate refers

R, where Q 'and Q are each independently 0, S, N (R)2, optionally substituted alkyl or alkoxy; and R is optionally substituted alkyl, ω-aminoalkyl ω-aminoalkyl (substituted).

The term "alkylphosphorothioate" refers to an alkylphosphate where at least one of Q 'or Q is S.

The term "alkylphosphonate" refers to an alkylphosphate where at least one of Q 'or Q is alkyl.

The term hydroxyalkyl means a -0alkyl radical.

The term "alkylheterocycle" refers to an alkyl where at least one methylene has been replaced by a heterocycle.

The term ω-aminoalkyl refers to a radical -alkyl-NH2. And the term ω-aminoalkyl (substituted) refers to a ω-aminoalkyl where at least one of Η or N has been replaced by alkyl.

The term ω-phosphoalkyl refers to -alkyl-0P (Q ') (Q)-OR, where Q 'and Q are each independently 0 or S and R optionally substituted alkyl.

The term ω-thiophosphoalkyl refers to ω-phosphoalkyl where at least one of Q 'or Q is S.

In some embodiments, the methods of the invention

195 can of the

MEXICAN <> INSTITUTE OF PROPERTY

I require the use of protecting groups. The WéfWdo

in the

Organic technique (see, for example, Protective Groups in

Synthesis, Green, TW et. al., Wiley-Interscience,

New York, 1999). Briefly, protecting groups within the context of this invention are any group that reduces or eliminates unwanted reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during some reactions, and then removed to reveal the original functional group. In some embodiments, an alcoholic protecting group is used. An alcoholic protecting group is any group that reduces or eliminates the unwanted reactivity of an alcoholic functional group. The protecting groups can be added and removed using techniques well known in the art.

The compounds of the present invention can be prepared by known organic synthesis techniques, including the methods described in more detail in the

Eg emplos.

Examples

Example 1:

Synthesis of methanesulfonic acid 2 octadeca-9,12-dienyl ester

Scheme 1

196

To a solution of the alcohol 1 (26.6 g, 100 mmol) in dichloromethane (100 mL), triethylamine (13.13 g, 130 mmol) was added and this solution was cooled in an ice bath. To this cold solution, a solution of mesyl chloride (12.6 g, 110 mmol) in dichloromethane (60 mL) was added dropwise, and after the addition was complete, the reaction mixture was allowed to warm to room temperature and stirred for the night. TLC of the reaction mixture showed that the reaction was complete. The reaction mixture was diluted with dichloromethane (200 mL), washed with water (200 mL), NaHCO3

197

IMPI INSTITUTO MEXICANO saturated (200 mL), brine (100 mL) and dried (organic Na ^ í ^ T ^ concentrated to obtain the product — scudo ·· - & epurified by column chromatography (silica gel) using 0-10% of Et2O in hexanes The pure product fractions were combined and concentrated to obtain pure product 2 as a colorless oil (30.6 g, 89%). XH NMR (CDC13, 400 MHz) δ = 5.42-5.21 (m, 4H), 4.20 (t, 2H), 3.06 (s, 3H), 2.79 (t, 2H), 2.19-2.00 (m, 4H), 1.90 -1.70 (m, 2H), 1.06-1.18 (m, 18H), 0.88 (t, 3H). 13C NMR (CDC13) δ = 130.76, 130.54, 128.6, 128.4, 70.67, 37.9, 32.05, 30.12, 29.87, 29.85, 29.68, 29.65, 29.53, 27.72, 27.71, 26.15, 25.94, 23.09, 14.60. MS. Molecular weight calculated for Ci9H36OR3S, Cal. 344.53, Found 343.52 (M-H ').

Synthesis of 18-Bromo-octadeca-6,9-diene 3

Mesylate 2 (13.44 g, 39 mmol) was dissolved in anhydrous ether (500 mL) and to that was added the complex MgBr.Et2Or (30.7g, 118mmol) in argon and the mixture was refluxed in argon for 26h after which time TLC showed that the reaction was complete. The reaction mixture was diluted with ether (200 mL) and ice water (200 mL) was added to this mixture and the layers were separated. The organic layer was washed with 1% K2CO3 aqueous (100 mL), brine (100 mL) and dried (Na2SO4 anhydrous). Concentration of the organic layer provided the crude product which was further purified

198 by column chromatography (silica gel)

IMP

MEX1C INSTITUTE. ..

OF PROPERTY Cja ·· industrial Exusing 0-1% of

Et2Or in hexanes to isolate bromide 3 (12Tb g, 94%) as a colorless oil. 4Η NMR (CDC13, 400 MHz) δ = 5.41-5.29 (m,

4H), 4.20 (d, 2H), 3.40 (t, J = 7 Hz, 2H), 2.77 (t, J = 6.6

Hz, 2H), 2.09-2.02 (m, 4H), 1.88-1.00 (m, 2H), 1.46-1.27 (m, 18H), 0.88 (t, J = 3.9 Hz, 3H). 13C NMR (CDC13) δ = 130.41,

130.25, 128.26, 128.12, 34.17, 33.05, 31.75, 29.82, 29.57,

29.54, 29.39, 28.95, 28.38, 27.42, 27.40, 25.84, 22.79,

14.28.

Synthesis of 18-Cyano-octadeca-6,9-diene 4

To a solution of the mesylate (3.44 g, 10 mmol) in ethanol (90 mL), a solution of KCN (1.32 g, 20 mmol) in water (10 mL) was added and the mixture was refluxed for 30 min. after which TLC of the reaction mixture showed that the reaction was complete, after which ether (200 mL) was added to the reaction mixture followed by the addition of water. The reaction mixture was extracted with ether, and the combined organic layers were washed with water (100 mL), brine (200 mL), and dried. Concentration of the organic layer provided the crude product which was purified by column chromatography (0-10% Et2Or in hexanes). Pure product 4 was isolated as a colorless oil (2g, 74%).TH NMR (CDC13, 400 MHz) δ = 5.33-5.22 (m, 4H), 2.70 (t, 2H), 2.27-2.23 (m, 2H), 2.00-1.95 (m, 4H), 1.61-1.54 (m, 2H),

199

1.39-1.20 (m, 18H), 0.82 (t, 3H)

129.96, 128.08, 127.87, 119.78, 70.76, 66.0Z,., ^ 32-52,,

29.57, 29.33, 29.24, 29.19, 29.12, 28.73, 28.65, 27.20,

27.16, 25.62, 25.37, 22.56, 17.10, 14.06. MS. Molecular weight calculated for Ci9H33N, Cal. 275.47, Found 276.6 (MH ").

Synthesis of Heptatriaconta-6,9,28,31-tetraen-19-one 7

To a 500 mL flame dried two neck round bottom flask, freshly activated Mg filings (0.144 g, 6 mmol) were added and the flask was equipped with a magnetic stir bar and reflux condenser. This system was degassed, purged with argon, and 10 mL of anhydrous ether was added to the flask by syringe. Bromide 3 (1.65 g, 5 mmol) was dissolved in anhydrous ether (10 mL) and added dropwise to the flask by syringe. An exothermic reaction was observed (to confirm / accelerate Grignard reagent formation, 2 mg of iodine was added and immediate discoloration was observed confirming Grignard reagent formation) and the ether started refluxing. After the addition was complete the reaction mixture was kept at 35 ° C for 1 h and then cooled in an ice bath. Cyanide 4 (1.38 g, 5 mmol) was dissolved in anhydrous ether (20 mL) and added dropwise to the reaction mixture with stirring. An exothermic reaction was observed and the reaction mixture was stirred overnight at temperature

200

IMPU environment. The reaction was extinguished by mediantiesTi ^ * ^ |,fti (^

INDUSTRIAL dropwise followed by ice water (60 mL). La was treated with H2SW4 aqueous (10% in mL of acetone drop reaction mixture volume,

200 mL) until the solution was homogenized and the layers were separated. The ether layers to obtain aqueous phase chromatography were extracted with ether (2x100 combined with the dried product (Na2SW4) and concentrated crude which was column-purified (silica gel,

0-10% ether in pure product fractions were evaporated to provide the pure ketone as a colorless oil (2g,

74%). NMR (CDC13,

4H), 2.30 (t, 4H),

1.35-1.15 (m, 18H),

130.63,

130.54,

29.89,

29.86,

14.05.

MS.

Weight

400 MHz)

5.33-5.21 (m, 8H), 2.69 (t,

2.05-1.95 (m, 8H), 1.55-1.45 (m, 2H),

0.82 (t, 3H). 13C NMR (CDC13) δ

128.47, 128.41, 43.27, 33.04, 32.01,

29.75, 29.74, 27.69, 26.11, 24.35, molecular calculated for C37H66O, Cal.

211.90,

30.93,

23.06,

526.92,

Found

Example 2: Alternative synthesis of ketone 7

201

Synthesis of compound 6b

To a 500 mL flame dried round bottom flask, freshly activated Mg filings (2.4 g, 100 mmol) were added and the flask was equipped with a magnetic stir bar, addition funnel and reflux condenser.

This system was degassed and purged with argon and 10 mL of anhydrous ether was added to the flask by means of a syringe. Bromide 3 (26.5 g, 80.47 mmol) was dissolved in anhydrous ether (50 mL) and added to the addition funnel. About 5 mL of this ether solution was added to the Mg filings while stirring vigorously. An exothermic reaction was observed (to confirm / accelerate Grignard reagent formation, mg of iodine was added and immediately a discoloration was observed confirming the formation of the reagent of

Grignard) the ether started refluxing. The bromide solution portion was added dropwise while maintaining the reaction at slight reflux upon cooling.

202 the flask in water. After completing

IMPI ^ la adim ^ e ^ ig ^

Reaction was held at 35 ° C for 1 hr and then cooled in.

ice bath. Ethyl formate (2.68 g, 36.2 mmol) was dissolved in anhydrous ether (40 transferred to the addition funnel and added dropwise to the reaction mixture with stirring. An exothermic reaction was observed and the reaction mixture started on Reflux.

After the start of the reaction, the portion of the ethereal formate solution was quickly squirted and the reaction mixture was stirred for a further period of 1 h at room temperature.

The reaction was quenched by adding 10 mL of acetone dropwise followed by ice water (60 mL). The reaction mixture was treated with H2SW4 aqueous (10% by volume, 300 mL) until the solution was homogenized and the layers were separated. The aqueous phase was extracted with ether (2x100 mL). The combined ether layers were dried (Na2SW4) and concentrated to obtain the crude product which was purified by column chromatography (silica gel, 0-10% ether in hexanes). The slightly less polar fractions were concentrated to obtain formate 6a (1.9 g) and the pure product fractions were evaporated to provide pure product 6b as a colorless oil (14.6 g, 78%).

Synthesis of compound 7

To a solution of alcohol 6b (3 g, 5.68 mmol) in CH2C12

203

IMPI

MEXICAN INSTITUTE Dt LA PROPIEOAD

(60 mL), 4 molecular sieves were added IND^TRIAJust activated (50 g) and to this solution P (JC powder (4.9 g, 22.7 mmol) was added in portions over a period of 20 minutes and the mixture was further stirred for 1 hour (note: careful monitoring of the reaction to obtain a good yield since the prolonged reaction times produce a lower yield) and the TLC of the reaction mixture was controlled every 10 minutes (5% ether in hexanes). After completion of the reaction, the reaction mixture was filtered through a pad of silica gel, and the residue was washed with CH2CI2 (400 mL). The filtrate was concentrated and the crude product obtained in this way was further purified by column chromatography (silica gel, 1% Et2Or in hexanes) to isolate pure product 7 (2.9 g, 97%) as a colorless oil. 1H NMR (CDCI3, 400 MHz) δ = 5.33-5.21 (m, 8H), 2.69 (t, 4H), 2.30 (t, 4H), 2.05-1.95 (m, 8H), 1.55-1.45 (m, 2H) , 1.35-1.15 (m, 18H), 0.82 (t, 3H). 13C NMR (CDCI3) δ = 211.90, 130.63, 130.54, 128.47, 128.41, 43.27, 33.04, 32.01, 30.93, 29.89,

29.86, 29.75, 29.74, 27.69, 26.11, 24.35, 23.06, 14.05. MS.

Molecular weight calculated for C37H66O, Cal. 526.92, Found 528.02 (M + H+) .

Example 3: Synthesis of asymmetric ketones 25 and 27.

204

Synthesis of heptatriaconta-6,9,28-trien-19-one 25

To a 50 mL two necked round bottom dry flask, freshly activated Mg filings (132 mg, 0.0054 mol) were added and the flask was equipped with a magnetic stir bar and reflux condenser. This system was degassed and purged with nitrogen and 10 mL of anhydrous ether was added to the flask by syringe. Bromide 24 (1.8 g, 0.0054 mol) was dissolved in anhydrous ether (10 mL) and added dropwise to the flask by syringe. An exothermic reaction was observed (reaction started with dibromoethane)

205 and the ether started refluxing. After

for 1 h and then the reaction mixture was kept at 35 ° C cooled in an ice bath at 10-15 °

C. Cyanide 4 (0.5

0.0018 mol) was dissolved in dry THF (5 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed and the reaction mixture was refluxed (at 70 C) for 12 hr and quenched with an ammonium chloride solution. It was then treated with 25% HC1 solution until the solution was homogenized and the layers were separated. The aqueous phase was extracted with ether. The combined ether layers were dried and concentrated to obtain the crude product which was purified by column chromatography. The pure product fractions were evaporated to provide the pure ketone 25 as a colorless oil.

Yield: 0.230 g (24%). XH-NMR (CDC13, 400MHz): δ = 5.37

5.30 (m, 6H), 2.77-2.74 (t, 2H), 2.38-2.34 (t, 4H), 2.05-1.95 (m, 8H), 1.56-1.52 (m, 4H), 1.35-1.25 (m, protons aliphatic),

0.89-0.85 (t, 6H). IR (cm-1): 2924, 2854,11717,1465,1049,721.

Synthesis of heptatriaconta-6,9-dien-19-one 27

To a 500 mL flame dried two neck round bottom flask, freshly activated Mg filings (0.144 g, 6 mmol) were added and the flask was equipped with a magnetic stir bar and reflux condenser.

This system was degassed and purged with argon and added

206

mL of anhydrous ether to the flask via bromide 26 (2.65 g, 5 mmol) commercially available and dissolved in anhydrous ether (10 mL) and added dropwise to the flask by syringe. After the addition was complete, the reaction mixture was kept at 35 ° C for 1 h and then cooled in an ice bath. Cyanide 4 (1.38 g, 5 mmol) was dissolved in anhydrous ether (20 mL) and added dropwise to the reaction mixture with stirring. An exothermic reaction was observed and the reaction mixture was stirred overnight at room temperature. The reaction was quenched by

<td>addition</td><td>of</td><td> 10</td><td>mL of acetone</td><td colspan="3">drop by drop followed</td><td>by water</td>

<td>frost</td><td> (60</td><td>mL)</td><td colspan="2">. The reaction mixture</td><td>I know</td><td>treatment</td><td>with H2SO4</td>

<td>aqueous</td><td> (10</td><td colspan="2">% by volume, 200</td><td>mL) up to</td><td>than</td><td colspan="2">the solution is</td>

<td colspan="2">homogenized</td><td>and</td><td>the layers are</td><td>separated.</td><td>The</td><td>phase</td><td>watery</td>

extracted with ether (2x100 mL). The combined ether layers were dried (Na2SO4) and concentrated to obtain the crude product which was purified by column chromatography to provide pure ketone 27 as a colorless oil. 1HNMR (CDC13, 400MHz): δ = 5.42-5.30 (m, 4H), 2.79-2.78 (t, 2H), 2.40-2.37 (t, 4H), 2.08-2.03 (m, 4H), 1.58-1.54 (m, 4H) , 1.36-1.26 (br m, aliphatic protons), 0.91-0.87 (t, 6H). IR (cm

1):2924, 2854, 1716, 1465, 1375, 721.

207

Example 4: Synthesis of asymmetric ketones with C12 chain.

Scheme 4

To a 50 mL two necked round bottom dry flask, freshly activated Mg filings (175 mg, 0.0072 mol) were added and the flask was equipped with a magnetic stir bar and reflux condenser. This system was degassed and purged with argon and 10 mL of anhydrous ether was added to the flask by means of a syringe. Bromide 28 (1.5 g, 0.006 mol) was dissolved in anhydrous ether (7 mL) and added dropwise to the flask by syringe. An exothermic reaction (reaction started with dibromoethane) was observed and the ether started refluxing. After completing the addition the reaction mixture was kept at 35 ° C for 1 h and then cooled in an ice bath at 10-15 ° C. Cyanide 4 (1 g,

0.0036 mol) was dissolved in anhydrous ether (7 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed and the reaction mixture was refluxed for 12 hr and quenched with a solution of

208

IMPI

MEXICAN INSTITUTE ammonium chloride. It was then treated with 25% strength / on until the solution was homogenized — and was not separated. The aqueous phase was extracted with ether. The combined ether layers were dried and concentrated to obtain the crude product which was purified by column chromatography.

The pure product fractions were evaporated to provide pure ketone 29 as a colorless oil.

Yield: 0.65 g (26%). 1H-NMR (δ ppm):

5,388-5,302 (m,

4H),

2.77 - 2.74 (t, 2H), 2.38 - 2.34 (t,

4H), 2.04-2.01 (m,

4H),

1.34

1.18

36H), 0.89

0.85 (m 6H). IR (cm

3009,

2920,

2851,

1711 (C = O), 1466, 1376,

1261.

Synthesis of

Example ketones

Scheme

To a dry 50 mL two-necked round bottom flask, freshly activated Mg filings (266 mg,

0.0109 mol) and the flask was equipped with a stir bar

209

IMPI

MEXICAN INSTITUTE magnetic and a reflux condenser. The emg ^ a and g were degassed and purged with nitrogen and 10 mL of anhydrous ether was added to the flask by syringe. The bromide (2.43 g, 0.0109 mol) was dissolved in anhydrous ether (7 mL) and added dropwise to the flask by syringe. An exothermic reaction (reaction started with dibromoethane) was observed and the ether started refluxing. After completing the addition the reaction mixture was kept at 35 ° C for 1 h and then cooled in an ice bath at 10-15 ° C. Cyanide (1 g, 0.0036 mol) was dissolved in anhydrous ether (7 mL ) and added dropwise to the reaction with stirring. An exothermic reaction was observed and the reaction mixture was stirred at room temperature for 2 hr. THF (4ml) was added to the reaction mixture and heated at 45-50 ° C for 4 hr until the cyano derivative was completely consumed. The reaction was quenched by adding 3 mL of acetone dropwise followed by ice water. The reaction mixture was treated with 25% HC1 solution until the solution was homogenized and the layers were separated. The aqueous phase was extracted with ether. The combined ether layers were dried and concentrated to obtain the crude product which was purified by column chromatography. The pure product fractions were evaporated to provide the pure ketone as a colorless oil. Yield: 0.93 gms (61%). 'ü-NMR (δ ppm): 5.37-5.302 (m,

4H), 2.77 - 2.74 (t, 2H), 2.38 - 2.34 (t, 4H), 2.05-2.00 (m,

210

IMPI (m 6H).

Example asymmetric ketones with cholesterol

4H), 1.

(cm _1) : 3009,

INSTITUTO MEXICANO D £ LA PROHEPAD 1.35 - 1.24 (m, 34H), 0? WTO THE2925, 2854, 1717 (C ^ O), 14 & 5, 137G.

used

Using ketone 31, the cholesteryl chloride that is

Similar procedure synthesis of converted to corresponding magnesium chloride followed by addition to linoleyl cyanide provided ketone 33.

Example 7: Synthesis of asymmetric ketones with cholesterol 35

211

cholesterol chloroformate with

3-bromopropylamine provided bromide 34 which became treatment in Grignard's reagent

Corresponding 34a which in treatment with linoleyl cyanide provided the corresponding asymmetric ketone 35 with good performance.

Example 8: Synthesis of asymmetric ketone 40

Scheme 8

212

IΜ PI

MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY ^ ¾ ..

LW1H4 t THF

1 HOUR

MeSO¿CI

Mg filings

Synthesis of compound 37

To a round bottom flask with two 500 ml necks containing LiAlH4 (1.02 g, 0.0269 mol) Anhydrous THF (20 mL) was added at room temperature under a nitrogen atmosphere. The suspension was stirred for 1 h at room temperature and then cooled to 0 ° C. To this mixture was added a solution of compound 1 (5 g, 0.01798 mol) in anhydrous THF (50 mL) slowly while maintaining the internal temperature at 0 ° C. After the addition was complete, the reaction mixture was warmed to room temperature and stirred for 1 h. The progress of the reaction was monitored by TLC. On completion of the reaction, the mixture was cooled to 0 ° C and quenched with saturated Na solution.2SW4 aqueous. The reaction mixture was stirred for 30 minutes and the solid formed was filtered through a celite pad and washed with ethyl acetate (100 mL). The filtrate and washes were combined and evaporated on a rotary evaporator to provide the

213 compound 37 as a colorless liquid,

IMPI

MEXICAN INSTITUTE OF PROPERTY to be takenpussxMno

for the next step Yield: (4.5 g, 95%); 1H

5.28 (m, 6H), 3.64-3.61 (t,

2.01 (m, 4H), 1.59-1.51 (m, aliphatic), 0.98-0.94 (t, 3H) without any »- purify item? or

NMR (400MHz, CDC13) δ = 5.392H), 2.81-2.78 (t, 4H), 2.102H), 1.29-1.22 (m, protons

Synthesis of compound 38

Compound 37 (14 g, 0.0530 mol) was dissolved in DCM (300 ml) in a 500 ml two neck round bottom flask and cooled to 0 ° C. To this solution, trethylamine (29.5 ml, 0.2121 mol) was added slowly under an inert atmosphere. The reaction mixture was then stirred for 10-15 minutes and mesyl chloride (6.17 mL, 0.0795 mol) was added slowly. After the addition was complete, the reaction mixture was allowed to warm to room temperature and stirred for 20 h. The reaction was monitored by TLC. On completion, the reaction mixture was diluted with water (200 mL), stirred for a few minutes, and the organic layer was separated. The organic phase was further washed with brine (1 x 70 mL), dried over Na2SO4 and the solvent was removed on a rotary evaporator to obtain crude compound 38 as a brown oil which was used as such for the following reaction. Yield: (17g, 93%)1H NMR (400MHz, CDC13) δ =

5.39-5.31 (m, 6H), 4.22-4.19 (t, 2H), 2.99 (s, 3H), 2.81-2.78

214

(m, 4H),

MEXICAN INSTITUTE OF PROPERTY 2.08-2.01 (m, 4H), 1.75.1.69 (m, 2H), Γε aliphatic protons), 0.98-0.94 (t, 3H).

Synthesis of compound 39

Mesylate 38 (10 g, 0.2923 mol) was dissolved in anhydrous ether (300 mL) in a 1000 mL two-necked round bottom flask and MgBr2.Et2O complex (22.63 g, 0.0877 mol) was added thereto in an atmosphere of nitrogen. The resulting mixture was then heated under reflux for 26 h. After completion of the reaction (by TLC), the reaction mixture was diluted with ether (300 mL) and ice water (200 mL), and the ether layer was separated. The organic layer was then washed with 1% aqueous K2CO3 (100 mL) followed by brine (80 mL). The organic phase was then dried over Na2SO4 anhydrous and the solvent was evaporated in vacuo to give the crude material which was chromatographed on silica gel (60-120 mesh) using 0-1% ethyl acetate in hexanes as the eluent system to provide the desired compound 39 as a oil. Yield: (7g, 73%)

NMR (400MHz, CDC13) δ = 5.39-5.31 (m, 6H), 3.41-3.37 (t, 2H), 2.81-2.78 (m, 4H), 2.08-2.02 (m, 4H), 1.86-1.80 (m, 2H), 1.42- 1.29 (m, aliphatic protons), 0.98-0.94 (t, 3H).

Asymmetric ketone synthesis 40

To a flame-dried 500 mL two-necked round-bottom flask, equipped with a magnetic stir bar

215

IMPÍfeg · and a reflux condenser, llWSteee * '' d ^ MSjí were added r · Newly activated industrial (0.88 g, 0.03636 mol). This system was degassed, purged with argon and ether (150 mL) was added to it. A few drops of bromine compound 4 (11.89 g, 0.03636 mol) in 50 mL of ether were added at the start to initiate the reaction (note; a catalytic amount of 1,2-dibromoethane was also added to accelerate the formation of grignard reagent). Upon initiation, the remaining solution of the bromine compound was slowly added to the ethereal solution at reflux. After the addition was complete, the reaction mixture was refluxed at 40 ° C for 1.5 hr. It was then cooled to 10 ° C and linoleyl cyanide 4 (5 g, 0.01818 mol) in 30 mL of dry ether was added dropwise and the resulting mixture was then heated at reflux for 20 h at 40 ° C. The progress of the reaction was monitored by TLC. After completing consumption of the cyano 40 derivative (by TLC), the mixture was cooled to room temperature and quenched with 30 mL of acetone followed by ice water (50 mL). This solution was further acidified with 10% HC1 solution and the ether layer was separated. The aqueous phase was further extracted with diethyl ether (2 x 100 mL). Solvent removal after drying over Na2SO4 Anhydrous provided the crude ketone which was purified by silica gel column chromatography (100-200 mesh) using 0-5% ether in hexanes as the eluant to give the compound of the

216 Title 40 as a pale yellow oil.

50.5%) XH NMR (400MHz, CDC13) δ = 5.38-5.28

(m, 10H), 2.80-2.74 (m, 6H), 2.38-2.34 (t, 4H), 2.08-2.00 (m, 8H), 1.55-1.52 (m,

4H), 1.35-1.26 (m, aliphatic protons),

0.98-0.94 (t, 3H),

0.89-0.85 (t, 3H). HPLC- 98.04%.

Example 9: Synthesis of oligonucleotides

All oligonucleotides were synthesized on an AKTAoligopilot synthesizer. A commercially available controlled pore glass solid support (dT-CPG, 500A, Main Synthesis) and RNA phosphoramidites with standard protecting groups, 5'-O-dimethoxytrylil N6-benzoyl-2'-tbutyldimethylsilyl-adenosine-3 'were used -ON, Ν'-diisopropyl-2cyanoethylphosphoramidite, 5'-0-dimethoxytryl-N4-acetyl-2 '-tbutyldimethylsilyl-cytidine-3'-ON, Ν'-diisopropyl-2cyanoethylphosphoramidite, 5'-0-dimethoxytryl-N2-isobutril-2 't-butyldimethylsilyl-guanosine-3'-ON, N'-diisopropyl-2-cyanoethylphosphoramidite and 5'-O-dimethoxytrylyl-2'-tbutyldimethylsilyl-uridine-3'-ON , Ν'-diisopropyl-2-cyanoethylphosphoramidite (Pierce Nucleic Acids Technologies) for the synthesis of oligonucleotides. 2'-F phosphoramidites, 5'-0-dimethoxytryl-N4-acetyl-2'-flurocytidine-3'-ON, Ν'-diisopropyl-2-cyanoethyl-phosphoramidite and 5 '-O-dimethoxytrylyl-2' were purchased - fluro-uridine-3'-ON, N'-diisopropyl-2-cyanoethyl-phosphoramidite from (Promega). All

217 phosphoramidites were used at a Ja-e ^ nPdJ concent

MEXICAN INSTITUTE OE THE PROPERTY. . τ industrial _ acetonitrile (CH3CN) except for guanosine that was used

a concentration of 0.2M in 10% THF / ANC (v / v). ITU 'docking / recycling time of 16 minutes was used. The activator was 5-ethyl thiotetrazole (0.75M, / huerican International

Chemicals), for oxidation

PO Iodine / Water / Pyridine was used and for oxidation

PS was used

PADS (2%) in

2,6-lutidine / ACN (1: 1 v / v).

The conjugated chains of 3 'ligand were synthesized using solid support containing the corresponding ligand.

For example, the introduction of cholesterol units into the sequence was carried out from hydroxyprolinol-cholesterol phosphoramidite.

Cholesterol was linked to trans-4-hydroxyprrolinol through a bond

6-aminohexanoate to obtain a portion of hydroxyprolinolcholesterol. Cy-3 and Cy-5.5 5 '-labeled siRNAs were synthesized from the corresponding phosphoramidite to Biosearch

Technologies.

Conjugation of the ligands to the 5 'end and / or internal position is accomplished by using the suitably protected ligand-phosphoramidite backbone. A 15 min extended coupling of phosphoramidite solution in CH3Anhydrous CN 0.IM in the presence of activator

5- (ethylthio) -lff-tetrazole to an oligonucleotide attached to a solid. Oxidation of Internucleotide Phosphite to Phosphate

218

IMPI * was carried out using standard iodine-water such

INDUSTRIAL (1) or by butyl / acetonitrile / water treatment (10:

with ter87: 3 hydroperoxide) with oligonucleotide conjugated with 10 min of oxidation waiting time. Phosphorothioate was introduced by oxidation of the phosphite to phosphorothioate using a sulfur transfer reagent such as DDTT (purchased from AM Chemicals), PADS and / or reagent from

Beaucage. Cholesterol phosphoramidite was synthesized at the site and used at a concentration of 0.1 M in dichloromethane.

The coupling time for cholesterol phosphoramidite was 16 minutes.

After completing the synthesis, the support was transferred to a 100 ml glass bottle (VWR). The oligonucleotide was cleaved from the support with simultaneous deprotection of the base groups and phosphate with 80 mL of a mixture of ethanolic ammonia [ammonia: ethanol (3: 1)] for 6.5 h at 55 ° C. The bottle was chilled on ice for a short period of time and then the ethanolic ammonia mixture was filtered into a new 250 ml bottle. The CPG was washed with 2 x 40 mL portions of ethanol / water (1: 1 v / v). The volume of the mixture was then reduced to ~ 30 ml by rotary evaporator. The mixture was then frozen in dyince [sic] and dried under vacuum in a speed vac type centrifugal concentrator.

The dry residue was resuspended in 26 ml of triethylamine, triethylamine trihydrofluoride (TEA.3HF) or

219

IMPI pyridine-HF and DMSO (3: 4: 6) and heated for minutes to remove tert-butyldimethylsilyl (TBDMS) groups at the 2 'position. The reaction was then quenched with 50 ml of 20mM sodium acetate and the pH adjusted to 6.5 and stored in a freezer until purification.

Oligonucleotides were analyzed by high performance liquid chromatography (HPLC) before purification and selection of the buffer and the column depends on the nature of the sequence and / or conjugated ligand.

Ligand-conjugated oligonucleotides were purified by preparative reverse phase HPLC. Unconjugated oligonucleotides were purified by anion exchange HPLC on a TSK gel column packed in place. The buffers were 20 mM sodium phosphate (pH 8.5) in 10% CH3CN (buffer A) and 20 mM sodium phosphate (pH 8.5) in 10% CH3CN, NaBr IM (buffer B). Fractions containing full length oligonucleotides were pooled, desalted, and lyophilized. Approximately 0.15 OD. Of the desalted oligonucleotides were diluted in water to 150 µΐ and then pipetted into special flasks for CGE and LC / MS analysis. Compounds were finally analyzed by LC-ESMS and CGE.

For the siRNA preparation, eguimolar amounts of sense and antisense chains were heated in lxPBS at 95 ° C

220

environment. Duplex integrity was confirmed by HPLC analysis.

Table 7: siRNA Duplexes for FVII Addressing and

Luc

<td>Duplex</td><td>Sense/ Antisense</td><td>Sequence 5'-3 '</td><td>I KNOW THAT ID NOT:</td><td>Objective</td>

<td></td><td> 1000/2434</td><td>CUU ACG CUG AGU ACU UCG AdTdT U * CG AAG fUAC UCA GCG fUAA GdT * dT</td><td></td><td>Luc</td>

<td></td><td> 2433/1001</td><td>C * Ufü ACG CUG AGfU ACU UCG AdT * dT UCG AAG UAC UCA GCG UAA GdTdT</td><td></td><td>Luc</td>

<td></td><td> 1000/1001</td><td>CUU ACG CUG AGU ACU UCG AdTdT UCG AAG UAC UCA GCG UAA GdTdT</td><td></td><td>Luc</td>

<td>AD-1596</td><td></td><td>GGAUCAUCUCAAGUCUUACdTdT GUAAGACUUGAGAUGAUCCdTdT</td><td></td><td>FVII</td>

<td>AD-1661</td><td></td><td>GGAfUfCAfüfCfUfCAAGfüfCfUfUAfCdTsdT GfUAAGAfCfUfUGAGAfUGAfUfCfCdT * dT</td><td></td><td>FVII</td>

Note: L8 is

lower case is phosphorothioate, fN is a nucleotide of 2'-fluoro, dN is nucleotide 2'-0-methyl modified, * are skeleton bonds

221 2'-deoxy nucleotide.

MEXICAN INSTITUTE OE LA PROFieOAÓ INtlUSTRIAL

Example 10: Serum stability test for siRNA

A medium yield test was performed for the initial selection of sequence-based stability by

<td>focus</td><td colspan="2">stains everything.</td><td>For</td><td>perform the test,</td><td>a</td><td>duplex</td>

<td>siRNA</td><td>I know</td><td>incubated in</td><td> 90%</td><td>from human serum to</td><td> 37</td><td>'C. I know</td>

<td colspan="2">extinguished</td><td>samples of</td><td>the</td><td>reaction mixture</td><td>to</td><td>various</td>

<td>intervals</td><td>of</td><td>time (to 0</td><td>min. ,</td><td colspan="2">15, 30, 60, 120 and 240 i</td><td>min.) and</td>

they were subjected to electrophoretic analysis (Figure 1). RNA cleavage over time provided information related to the susceptibility of the siRNA duplex to nuclease degradation in serum.

A serum and radiolabeled dsRNA stability assay was used to further characterize siRNA cleavage events. -First of all, a siRNA duplex is

<td>marked on the</td><td>extreme</td><td>5 'with</td><td> 32p</td><td>either in</td><td>the</td><td colspan="2">sense chain</td>

<td colspan="2">as antisense. The</td><td>duplex</td><td>of</td><td colspan="2">marked siRNA</td><td>incubated</td><td>with</td>

<td>90% whey</td><td>human</td><td>at 37 ° C,</td><td>and</td><td>it was deleted</td><td>a</td><td>sample of</td><td>the</td>

<td>solution and</td><td colspan="2">went extinct to</td><td colspan="2">intervals</td><td colspan="2">time every</td><td>time</td>

greater. The samples were analyzed by electrophoresis.

Example 11: Evaluation of FVII in vivo using liposomes derived from cationic lipids

In Vivo Silencing Experiments of Factor VII of

222

C57BL / 6 mice (Charles River Labs, MA) and rodent and ApoB rats.

Sprague-Dawley (Charles

River Labs, MA) received either saline or siRNA in desired formulations through an injection in mL / g. In several administration, inhalation separators levels in vein se of the intervals anesthetized isofluorane and determined

Factor VII,

Corporation, manufacturers.

Collected from mRNA experiments, tail fluid was withdrawn in a volume of 0.01 time then animals were collected from the blood via serum tubes by retroorbital bleeding. Serum from in samples

DiaPharma

OH) of

Animals were generated where the Factor protein was animals using a

Group, OH agreement

VII chromogenic assay or Biophen FVII, (Coaset

Aniara with standard curve protocols using serum treated evaluated solution levels were sacrificed and the various administration intervals instantly frozen. Liver tissue

Tissue and liver uses of Factor VII mRNA were prepared

Branched DNA (QuantiGene Assay, time frozen saline.

liver livers

In se in nitrogen after the spray.

levels and apoB were determined using a

Panomics, CA).

Example

12:

Preparation of

1,2-Di-O-alkyl-sn3223

Carbomoylglyceride (PEG-DMG) , NSTn UTO MtX ¡CANO

DEI.AFWV! £ IJAÍ <

INIXIjTUM) rct> ^ oh the R - C14H29

Ib R - C- | gH33

IC R = CigH37

DSC, TEA DCM 0 ° C-RT

lia R - C14H29 llb R = C16H33 lie R - CigH37

Py / DCM

0 ° C-RT

OR

Οχ>/ χΟΛΝ r.Ó H

IVa R = C14H2 g

IVb R = C- | gH33

IVe R = CigH37

IVa Preparation

1,2-Di-O-tetradecyl-sn-glyceride la (30 g,

61.80 mmol) and N, Ν'-succinimidylcarbonate (DSC, 23.76 g, 1.5 eq.) In dichloromethane (DCM, 500 mL) and stirred over an ice-water mixture. Triethylamine (TEA, 25.30 mL, 3 eq.) Was added to the stirring solution and then the reaction mixture was allowed to stir overnight at room temperature. The progress of the reaction was monitored by TLC. The reaction mixture was diluted with DCM (400 mL) and the organic layer was washed with water (2X500 mL), aqueous NaHCC solution> 3 (500 mL) followed by standard processing. The obtained residue was dried at room temperature under high vacuum overnight. After drying, the crude carbonate thus obtained was dissolved in dichloromethane (500 mL) and stirred on an ice bath. To the stirring solution,

224

IMPI

INSTITUTE MWiCaNv IM LA WIHEOAD added mPEG2ooo-NH2 (III, 103.00 g, 47.20 mmol ^^ eSttfcrá

NOF Corporation, Japan) and pyridine anhydrous (Ty, '8'σ ΙΠΕ7 excess) in argon. The reaction mixture was then allowed to stir at room temperature overnight. Solvents and

<td>volatile</td><td>I know</td><td>removed</td><td>to the</td><td>vacuum and residue</td><td>I know</td><td colspan="2">dissolved in</td>

<td>DCM (200</td><td>mL)</td><td colspan="2">and it was loaded</td><td>to a column of</td><td>gel</td><td>of</td><td>silica</td>

<td>packed</td><td>in</td><td>acetate</td><td>of</td><td colspan="2">ethyl. The spine</td><td>I know</td><td>eluted</td>

initially and

with ethyl acetate then with gradient

5-10% methanol in dichloromethane to provide the

PEG-Lipid

IVa desired as a white solid

4.18-4.01 (m, 2H) XH NMR (CDC13,, 3.80-3.70 (m,

400 MHz)

5.20-5.12 (m, 1H),

2H), 3.70-3.20 (m, -O-CH2-CH2-O4H), 1.31-1.15 (m, 48H), 0.84 (t, J = 6.5Hz, 6H). MS Rank Found: 2660-2836.

IVb Preparation

1,2-Di-O-hexadecyl-sn-glyceride Ib (1.00 g, 1848 mmol) and DSC (0.710 g, 1.5 eq.) Were mixed in dichloromethane (20 mL) and cooled to 0 ° C in a mixture of frozen water. Triethylamine (1.00 mL, 3 eq.) Was added and the reaction mixture was stirred overnight. The reaction was followed by TLC, diluted with DCM, washed with water (2 times), NaHCC solution> 3, and dried over sodium sulfate. Solvents were removed under reduced pressure and the residue

225 resulting from Ilb

This compound is

IMPI

INSTITUTE «KXICANU was kept under high vacuum

used directly for the next reaction without further purification. MPEG dissolved2ooo-NH2

III (1.50 g, 0.687 mmol, purchased from NOF Corporation, Japan) and

Ilb (0.702 g, in dichloromethane (20 mL) in argon.

The reaction was cooled to 0 ° C. Pyridine (1 mL, excess) was added and the reaction was stirred overnight. The reaction was monitored by

TLC. Solvents and volatiles were removed in vacuo and the residue was purified by chromatography (first ethyl acetate followed by 5-10% of

MeOH / DCM as elution gradient) to obtain the required compound IVb as a white solid (1.46 g, 76%). 1H NMR (CDC13, 400 MHz)

5.17 (t, J = 5.5Hz, 1H), 4.13 (dd, J =

4.00Hz, 11.00Hz,

1H), 4.05 (dd, J = 5.00Hz, 11.00 Hz,

1 HOUR) ,

3.82-3.75 (m, 2H),

3.70-3.20 (m, -O-CH2-CH2-O-, PEG-CH2) ,

2,051.90 (m, 2H),

1,351.17 (m, 56H),

0.85 (t, J = 6.5Hz, 6H). MS rank found:

2716-2892.

IVc Preparation

1,2-Di-O-octadecyl-sn-glyceride Ic (4.00 g, 6.70 mmol) and DSC (2.58 g, 1.5 eg.) Were mixed in dichloromethane (60 mL) and cooled to 0 ° C in a mixture of frozen water. Triethylamine (2.75 mL, 3 eq.) Was added and the reaction mixture was stirred overnight. The reaction was followed

226

IMPI

MEXICAN INSTITUTE

Dt THE PROPERTY

INDUSTRIAL by TLC, diluted with DCM, washed with water (2 times), NaHCO solution3 and dried over sodium sulfate. Solvents were removed under reduced pressure and the residue was maintained under high vacuum overnight. This compound was used directly for the next reaction without further purification. MPEG dissolved2ooo_NH2 III (1.50 g, 0.687 mmol, purchased from NOF Corporation, Japan) and lie (0.760g, 1.5 eq.) In dichloromethane (20 mL) in argon. The reaction was cooled to 0 ° C. Pyridine (1 mL, excess) was added and the reaction was stirred overnight. The reaction was monitored by TLC. Solvents and volatiles were removed in vacuo and the residue was purified by chromatography (ethyl acetate followed by 5-10% MeOH / DCM as elution gradient) to obtain the desired compound IVc as a white solid (0.92 g, 48% ). XH NMR (CDC13, 400 MHz) δ = 5.22-5.15 (m, 1H), 4.16 (dd, J =

4.00Hz, 11.00 Hz, 1H), 4.06 (dd, J = 5.00Hz, 11.00 Hz, 1H),

3.81-3.75 (m, 2H), 3.70-3.20 (m, -O-CH2-CH2-O-, PEG-CH2), 1.801.70 (m, 2H), 1.60-1.48 (m, 4H), 1.31-1.15 (m, 64H), 0.85 (t, J = 6.5Hz, 6H). MS Rank Found: 2774-2948.

Example 13:

227

Synthesis of 2005: To a solution of 2004 (50 g, 95 mmol) in DCM (400 ml) under Ar atmosphere, TEA (53 mL, 378 mmol) and DMAP (1.2 g, 9.5 mmol) were added and stirred at room temperature in Ar atmosphere. The reaction mass was cooled to -5 ° C and the mesyl chloride solution (15 mL, 190 mmol) in DCM (100 ml) was slowly added at a temperature below -5 ° C and allowed to warm to RT after addition. After 30 minutes (TLC), the reaction mass was quenched with ice water (20 ml). The organic layer was separated, washed with IN HCI (30 ml), water, brine, dried over sodium sulfate and evaporated under reduced pressure to obtain pure product (55g, 95.5%) as a yellow liquid. 1H NMR (400 MHz, CDCI3): δ 0.89 (t, 6H, J 6.8), 1.2-1.5 (m, 36H), 1.67 (m, 4H), 2.05 (q, 8H, J1 = 6.8, J2 = 6.8) , 2.77 (t, 4H, J = 6.4), 2.99 (s, 3H), 4.71 (m, 1H) and 5.36 (m, 8H).

Synthesis 2006: To a 2005 solution (50 g, 82 mmol)

228 in DMF (500 mL) under argon atmosphere,

410 mmol) and heated to 70 ° C and the

INSTITUTO MEXICANO DE IA PROPIEDAD se agredfÓ 's'Ná'N3 temperature · for four hours (TLC). The mixture was diluted with water and extracted with ethyl acetate (3x250 ml). The organic layer was washed with water, brine, dried over Na2SW4 and evaporated under reduced pressure to give the crude product, which was purified by chromatography on silica gel using hexanes / ether as the eluent. The product was eluted with 2% ether hexanes to obtain 2006 (36 g, 86%) as a pale yellow liquid.1H NMR (400 MHz, CDC13): δ 0.90 (t, 8H), 1.30 (m, 36H), 1.49 (t, 4H, J = 6.4 Hz) 2.04 (q, 8H, J1 = 7.6, J2 = 14Hz), 2.77 (t, 4H, J = 6.4 Hz), 3.22 (m, 1H), 5.34 (m, 8H). 13C NMR (400 MHz, CDC13): δ 14.1, 22.5, 25.6, 26.1, 27.2, 29.2, 29.3, 29.45,

29.65, 31.5, 34.1, 63.1, 127.9, and 130.1. IR (KBr): 2098.

Example 14:

Synthesis 2007: To a 2005 solution (76 g, 125

229

IMPI

INSTITUTO MEXICAIT, i mmol) in dimethylformamide (500 mL), added ^ & -TO^^ g sodium hydrosulfide (35 g, 625 mmol) at room temperature. The reaction mixture was heated to 70 ° C for 2 hrs (TLC). It was then cooled to room temperature and diluted with water (7V) and extracted with ether (3x5V). The combined ether layer was washed with water (2x3V), brine solution (2x3V), dried over sodium sulfate and evaporated under reduced pressure to obtain the crude product, which was purified by chromatography on silica gel using hexane. as eluent to obtain the 2007 product (43.6 g, 64%). MS: Calculated molecular weight for C37H68S 544.50, Found:

545.51 (M + H).

Synthesis 2008: To a solution of aldritiol (20.2 g, 92 mmol) in dichloromethane (400 ml), benzyl bromide (11 mL, 92 mmol) was added at 0 ° C. After stirring at 0 ° C for 15 min, it was warmed to room temperature and stirred for 15 min. The reaction mixture was recooled to 0 ° C and a 2007 solution (50g, 92mmol) in dichloromethane (100ml) was added followed by diisopropylethylamine (16mL, 92mmol). After the addition, it was heated under reflux for 2 hrs (TLC). Then it was dissolved with dichloromethane (10V), washed with water (2xlOV), brine solution (2xlOV), dried over sodium sulfate and evaporated under reduced pressure to obtain the crude product, which was

230

<td>purified by</td><td>silica gel chromatography</td>

<td>ether / hexanes</td><td>to provide the prnchirtn pnrn blunt. _a_.</td>

pale yellow liquid. (35g, 58%)ΧΗ NMR (400 MHz, CDC13): δ

29.5, 29.6, 31.5, 33.74, 52.9, 119.9, 120.4, 127.9, 128,

130.1, 130.2, 136.7, 149.3, 161.5. MS: Calculated molecular weight for C42H71NS2 653.50, Found: 654.49 (M + H).

Example 15:

Synthesis 2009 (ALNY-138): A 2005 solution (5g, 8mmol) in DMF and dimethylamine - 40% aqueous solution was placed in a sealed tube. The reaction mixture was heated at 90 ° C for 20 hours (TLC). It was then cooled to room temperature, poured into water, and extracted with ethyl acetate (3X 50ml). The organic layer was washed with water and brine, dried over Na2SO4 and evaporated to provide the pure product as a pale brown liquid

231 (2.00g, 45%) XH NMR (400 MHz, CDC13)

1.2-1.4 (m, 40H), 2.05 (q, 8H, Jx = 6.8Hz, J2 ~ 6.8 Hz), 2.2 (s, 6H), 2.77 (t, 4H, j = 6.4 Hz), 5.35 (m, 8H). 13C NMR (400 MHz, CDC13): δ 14.1, 22.5, 22.6, 27.1, 27.2, 29.3, 29.5,

29.57, 29.63, 29.67, 30.0, 31.5, 32.5, 40.5, 64.0, 127.9 and

130.1 MS: Calculated molecular weight for C39H73N 555.57,

Found: 556.55 (M + H).

2004

Summary of 2010: One

2010 2004 (30g, 56.8mmol) in toluene, N-Hydroxyphthalimide (13.9g, 85mmol) and TPP (22.30g, 85mmol) in argon were added. The reaction mass was cooled to -5 ° C, to this was added TEA (11.84 mL), followed by DEAD (13.14 ml). The reaction mass was allowed to stir for 12 hrs at room temperature (TLC). Then it was filtered through a pad of celite. The filtrate was evaporated under reduced pressure to obtain the crude product, which was purified by chromatography on silica gel to provide the pure product, which was eluted with 3% diethyl ether and hexanes to give the product 2010 (22.90 g,

60.50%) as a pale yellow liquid 1HNMR (400MHz, CDCI3,): δ 0.90 (6H, t, J = 7.2Hz), 1.2-1.4 (34H, m), 1.66232

1.70 (4Η, m),

2.03-2.08 (8H, m),

4.22 (1H, m), 5.29-5.43 (8H, m), 7.74-7.76 (2H, mi- 7.

(2H, m). 13CNMR (100MHz, CDC13,): δ 14.3, 22.5, 24.9, 25.6,

27.2, 27.20, 29.3, 29.3, 29.5, 29.5, 29.6, 29.7, 31.5, 32.4,

88.3, 123.3, 127.9, 129.0, 130.1, 134.3, 164.3. MS: Calculated molecular weight for C45H71NO3 673.54, Found:

674.55 (M + H).

Z, MsCI

2012

ACJO 1'DMAP

Bodü

2014

2013

BocN I

Lutidine, TBAI / DCM750C

Example 18:

2. MsCI

BocN. ACJO

DMAP

2016

2015

233

Example 19:

Synthesis of iMPra.

MEXICAN INSTITUTE

OF THE PROPERTYΓ · ί? <. Τ · <τ

3- (dimethylamino) -N- (('ΙϊΤ,' ί4Z)

((9Z, 12Z) -octadeca-9,12-dienyl) icosa-11,14-dienil) pr opa'namícta '(ALNY-201)

Scheme 1

To a stirred suspension of N, N-dimethylamino propionic acid hydrochloride (1, 0.198 g, 1.3 mmol, 1.0 eq.) In DCM HBTU (0.59 g, 1.56 mmol, 1.2 eq.) And DIPEA (0.71 mL, 3.9 mmol, 3.0 eq.) At room temperature. After stirring for 10 minutes, a solution of amine (2.7 g. 1.3 mmol, 1.0 eq.) In DCM was added dropwise at room temperature and stirring was continued until the reaction was complete. The reaction mixture was diluted with DCM, washed with saturated NaHCO solution3 followed by brine, the organic layer was separated and dried over MgSO4It was concentrated and purified by silica gel column chromatography using DCM.'MeOH (5%) as gradients to obtain pure compound 3 as an oil in 70% yield.

NMR (400 MHz, CDC13) δ 7.18 (brs, 1H), 5.47 - 5.19 (m, 8H),

3.18 - 3.07 (m, 4H), 2.76 (t, J = 6.5, 4H), 2.70 (s, 6H),

234

IMPI

Mexican WSTITUTO

Of LA Ι'ΚΟΡΙΪΓμι) -Ow— <

2.04 (q, J = 6.8, 9H), 1.48 'W lSv

2.60 (t, J = 6.0, 2H), for C43H80N2O: 640.6, found 641.5.

Synthesis of novel dilinoleyl derivatives

<td>No.</td><td>Compound</td><td>Name</td>

Compound 1 h2n. _ _ DSC

N ^ 'OH --10 I ch2ci2

235

Compound 2

IMPI

MEXICAN INSTITUTE OF PROPERTY

INDUSTRIAL

Compound 3

Compound 5

AcOH / EtOH —N

236

Compound 6

Mexican IMPI W THE 'noustrial PROPERTY

DSC

CH2CI2

Experimental details

Compound 1 (ALNY-192)

To a solution of N, W'-disuccinimidyl carbonate (5.50 g, 21.5 mmol) in CH2CI2 (200 mL), 3-dimethylamino-l-propanol (2.43 g, 23.6 mmol) was added dropwise. The resulting mixture was stirred at room temperature overnight. Once 50 mL of the solution were taken, they were added

Et3N (0.822 mL, 5.90 mmol) and ALN-SAN-30 (2.08 g, 3.93 the reaction mixture was stirred at room temperature mmol) and overnight. The reaction mixture was diluted with CH2C12 and washed with NaHCO3 ac. saturated. The organic layer was dried over MgSO4 anhydrous, filtered and concentrated.

The crude product was purified by column chromatography on silica gel (0-5%

MeOH in CH2C12) to give the compound (1.66 g,

2.53 mmol,

64%,

Rf = 0.22 with 5% MeOH in CH2C12) TH NMR (CDCI3, 400 δ 5.30-5.41 (m, 8 Η), 4.37 (d, J = 8.0 Hz,

4.09

Hz, 4

Η),

2.33 (t, J = 8.0 Hz, 2 Η), 2.23 (s, 6 Η), 2.02-2.06 (m, 8

Η), 1.76-1.80 (m, 2 Η), 1.27-1.45 (m, 40 Η), 0.89 (t, J = 8.0

237

Hz,

Η). 13C NMR (CDC13, 100 MHz)

128.2, 128.1, 63.2, 56.6, 51.4

45.7, 35.7, 31.7, 29.9, 29.8,

29.7, 29.6, 29.5, 27.7, 27.5, 27.4,

26.0, 25.8, 22.8, 14.3.

Molecular weight for C43H81N2O2 (M + H)+ Cale. 657.63, found

657.5.

Compound 2 (ALNY-200)

To a solution of N, N'-disuccinimidyl carbonate (5.50 g, 21.5 mmol) in CH2CI2 (200 mL), 3-dimethylamino-l-propanol (2.43 g, 23.6 mmol) was added dropwise. The resulting mixture was stirred at room temperature overnight. Once 50 mL of the solution were taken, Et was added3N (0.697 mL, 5.00 mmol) and ALN-SAN-30 (1.71 g, 3.15 mmol) and the reaction mixture was stirred at room temperature overnight. The reaction mixture was diluted with CH2C12 and washed with NaHCO3 ac. saturated. The organic layer was dried over MgSO4 anhydrous, filtered and concentrated. The crude product was purified by silica gel column chromatography (0-5% MeOH in CH2C12) to give compound 2 (1.14 g, 1.70 mmol, 54%, RF = 0.13 with 5% MeOH in CH2C12) · Molecular weight for C44H83N2O2 (M + H)+Calc. 671.65, Found 671.5.

Compound 3 (ALNY-175)

Dimethylaminoethyl hydrazine dihydrochloride (1.00 g, 5.70) was added to a flask containing EtOH (50 mL)

238

INSTITUTO MÜXICAN mmol) and ALNY-SAN-003 (2.00 g, 3.80 mmol) (heated at 60 ° C for 16 hours. After adding _F.t3N— (JX- & mL), the reaction mixture was evaporated. The residue was extracted with EtsO and NaHCO3 ac. saturated, and the organic layer was dried over MgSO4, filtered, and concentrated. The crude product was purified by silica gel column chromatography (CH2C12: MeOH: NH3 aq. = 95: 5: 0.5, RF = 0.29) to give compound 3 (1.78 g, 2.91 mmol, 76%) Molecular weight for C41H78N3 (M + H)+Calc. 612.62, Found 612.5.

Compound 4 (ALNY-187)

3-Dimethylaminopropionic acid hydrazide (Ryan Scientific, 500 mg, 3.89 mmol) in EtOH (10 mL) and dilinoleyl ketone (1.74 g, 3.31 mmol) in EtOH (20 mL) were mixed together. Acetic acid (0.038 mL, 0.662 mmol) was added to the solution, and the reaction mixture was heated at 65 ° C for 5 hours. After adding Et3N (0.5 mL), the reaction mixture was evaporated. The residue was extracted with CH2C12 and NaHCO3 ac. saturated, and the organic layer was dried over MgSO4, filtered, and concentrated. The crude product was purified by silica gel column chromatography (CH2Cl2: MeOH: NH3 ac. = 95: 5: 0.5, Rf = 0.30) to give compound 4 (1.40 g, 2.19 mmol, 66%) Molecular weight for C42H78N3O (M + H)+ Cale. 640.61, Found 640.5.

239

Compound 5 (ALNY-149)

ALY-SAN-031 (2.36 hydrazine monohydrate (0.424 mL) and EtOH (4 mL) over 2 resulting white precipitate,

I<img file="MX359674B_D0255.tif" />PI

Mexican Institute of Industrial Property

3.50 mmol) gp treated non mL, 5.60 mmol) in CH2CI2 hours. After filtering the filtrate was concentrated.

(36 the

The residue was extracted with Et2O and NaHCO3 ac. saturated, and the organic layer was dried over MgSO4, filtered and concentrated. The crude material was used in the next step without further purification. RF: 0.44 (10% EtOAC in hexanes). Molecular weight for C37H70NO (M + H)+Calc. 544.55, Found 544.2.

The aminooxy compound was dissolved in EtOH (30 mL), and 4- (dimethylamino) butan-2-one (Matrix Scientific, 500 mg, 4.34 mmol) and acetic acid (0.040 mL, 0.70 mmol) were added to the solution. The reaction mixture was stirred at room temperature for 14 hours. After adding Et3N (0.5 mL), the reaction mixture was evaporated. The residue was extracted with Et2O and NaHCO3 ac. saturated, and the organic layer was dried over MgSO4, filtered and concentrated. The crude product was purified by silica gel column chromatography (Hexanes: EtOAc = 1: 1) to give compound 5 as a mixture of E / Z isomers (1.90 g, 2.96 mmol, 85%, 2 steps, Rf = 0.39, 0.21 developed with Hexanes: EtOAc = 1: 1). Molecular weight for C43H8iN2O (M + H)+Calc. 641.63, Found 641.5.

Compound 6 (ALNY-202)

240

IMPI

MEXICAN INSTITUTE

To a solution of N ^ W'-Sistwowiiít ^ SSG carbonate (5.50 g, 21.5 mmol) in CH2CI2 (200 mT ), --- ee— added 3-dimethylamino-l-propanol (2.37 mL, 23.6 mmol) dropwise. The resulting mixture was stirred at room temperature overnight. Once 50 mL of the solution were taken, Et was added3N (0.822 mL, 5.90 mmol) and ALN-SAN-30 (2.07 g, 3.93 mmol) and the reaction mixture was stirred at room temperature overnight. The reaction mixture was diluted with CH2CI2 and washed with NaHC03 ac. saturated. The organic layer was dried over MgSO4 anhydrous, filtered and concentrated. The crude product was purified by silica gel column chromatography (0-5% MeOH in CH2C12) to give compound 6. Molecular weight for C42H79N2OR2 (M + H)+Calc. 643.61, Found 643.5.

The compounds of the present invention can be further synthesized by the procedures described in the following documents, which are incorporated herein in their entirety:

one. Schlueter, Urs; Lu, Jun; Fraser-Reid, Bert.

Synthetic Approaches To Heavily Lipidated

Phosphoglyceroinositides. Organic Letters (2003), 5 (3),

255-257

2. King, JF; Allbutt, AD Can. J. Chem. 1970, 48, 1754-1769

3. Mach, Mateusz; Schlueter, Urs; Mathew, Felix;

Fraser-Reid, Bert; Hazen, Kevin C. Comparing n-pentenyl

241

IMPI

INSTITUTO MEXICANO Di LA PROI'ltílAi 'orthoesters and n-pentenyl glycosides as alternatiW ^ i.1? donors. Tetrahedron (2002), 58 (36), 7 34 3 ^^ 54 r11 1

Example 20: Determination of the efficacy of lipid particle formulations containing various cationic lipids using a rodent Factor VII silencing model in vivo.

Factor VII (FVII), a prominent protein in the coagulation cascade, is synthesized in the liver (hepatocytes) and secreted into plasma. Plasma FVII levels can be determined by a simple plate-based colorimetric assay. As such, FVII represents a convenient model for determining siRNA-mediated sub-regulation of hepatocyte-derived proteins, as well as for monitoring plasma concentrations and tissue distribution of lipid nucleic acid and siRNA particles.

<td>Duplex</td><td>Sequence 5'-3 '</td><td>I KNOW THAT ID NOT:</td><td>Objective</td>

<td rowspan="2">AD-1661</td><td>GGAfUfCAfUfCfUfCAAGfUfCfUfUAfCdTsdT</td><td></td><td rowspan="2">FVII</td>

<td>GfUAAGAfCfUfUGAGAfUGAfUfCfCdTsdT</td><td></td>

The lowercase is 2 'OMe modification and Nf is a 2'/ 2'F modified nucleobase of F, dT is deoxythymidine, s is phosphothioate.

242

Mexican Institute of the IWWDAO The following cationic lipids were testedffffVmy

<td rowspan="2">Compound</td><td rowspan="2">Structure of the</td><td colspan="2" rowspan="2">compound —-</td><td></td>

<td>molecular</td>

<td>TO</td><td>0 i H</td><td></td><td></td><td>C42H77N3O Mol Weight; 640.08</td>

<td>B</td><td> 1 0H</td><td></td><td></td><td>C42H78N2O2 Weight MoL 643.08</td>

<td>C</td><td>\ / x / S— N</td><td></td><td></td><td>CíiHtvNSz MoL Weight: 648.19</td>

<td>D</td><td> 1 / Ν'χ- ^ Ν-Ν = <2 ^ H</td><td>Z 'ZSS ^JZ/ ,, S,>Xz/,/^=”'Z ^</td><td></td><td>C41H77N3 PfesoMoL: 612 07</td>

<td>AND</td><td> 0 1 H</td><td>-χ =></td><td></td><td>C43H80N2O2 MoL Weight: 657.11</td>

<td>F</td><td>or 1 HOUR</td><td></td><td></td><td>CíjHgoNjOj Weight MoL 657.11</td>

<td>G</td><td>0 1 HOUR</td><td></td><td></td><td>C44H82N2O2MoL Weight: 871,134</td>

<td>H</td><td>0 1 HOUR</td><td></td><td></td><td>^ Ηβο ^ ζθ MoL Weight: 641.108</td>

<td>I</td><td>\ = N-0—</td><td></td><td></td><td>C43H8on20 MoL Weight: 641.11</td>

<td>J</td><td>I 0- 0 N— <.</td><td></td><td>\ z//=\ z//\//\</td><td>C42H7gN2OR2MoL Weight: 643.081</td>

243

The cationic lipids shown above were used to formulate liposomes containing the duplex

AD-1661 using an online blending method, as described in the US Provisional Patent Application

61 / 228,373. The lipid particles were formulated using the following molar ratios: 50% cationic lipid / 10% distearoylphosphatidylcholine (DSPC)

38.5% Cholesterol / 1.5% PEG-DMG polyethylene glycol) -2,3-dimyristoylglycerol, (1- (monomethoxy with an average PEG molecular weight of 2000).

C57BL / 6 mice (Charles River Labs, MA) received either saline or formulated siRNA through an injection into the tail vein. Serum samples were collected at various time intervals after administration by retroorbital bleeding. Serum levels of Factor VII protein were determined in samples using a chromogenic assay (Biophen FVII, Aniara Corporation, OH). To determine liver levels of Factor VII mRNA, animals were sacrificed and livers were removed and instantly frozen in liquid nitrogen. Tissue specimens were prepared from frozen tissues and levels were quantified

244

Liver IMPIs of Factor VII mRNA using

INDUSTRIAL branched (QuantiGene Assay, Panomics, CA).

FVII activity was evaluated in animals treated with FVII siRNA 48 hours after intravenous (bolus) injection in C57BL / 6 mice. FVII was measured using a commercially available kit to determine protein levels in serum or tissue, following the manufacturer's instructions on a microplate scale. FVII reduction was determined against untreated control mice, and the results were expressed as% residual FVII. Two dose levels (FVII siRNA of 0.05 and 0.005 mg / kg) were used in the selection of each novel liposome composition. Figure 3 shows a graph illustrating the relative levels of FVII protein in animals administered 0.05 or 0.005 mg / kg of lipid particles containing different cationic lipids.

Example 21: formulation of siRNA using preformed vesicles

Cationic lipid containing particles were made using the preformed vesicle method. The cationic lipid, DSPC, cholesterol and PEG-lipid were solubilized in ethanol at a molar ratio of 40/10/40/10, respectively. The lipid mixture was added to an aqueous buffer (50 mM citrate, pH 4) and mixed until a final concentration of ethanol and lipids of 30% (vol / vol) was obtained and

245

IMPIg

MfcXICzW INSTITUTE OF THE MtOREOAC

6.1 mg / mL respectively and allowed to equilibrate tem ^ 'f ^ úra *' * 'room for 2 min before extrusion.1 '· Φρ3' ·· 1ίρ1όθΑ hydrated were extruded through two stacked 80nm pore size filters (Nuclepore) at 22 ° using Lipex Extruder (Northern Lipids, Vancouver, BC) until a vesicle diameter of 70-90nm was obtained , as determined by the Nicomp analysis. This generally required 1-3 passes. For some cationic lipid mixtures that did not form small vesicles that hydrate the lipid mixture with a lower pH buffer (50 mM citrate, pH 3) to protonate the phosphate group in the main group, DSPC helped form stable vesicles of 70-90 nm.

FVII siRNA (solubilized in 50 mM citrate, aqueous pH 4 solution containing 30% ethanol) was added to the vesicles, pre-equilibrated to 35 ° C, at a rate of ~ 5 mL / min by mixing. After a final siRNA / target lipid ratio of 0.06 (w / w) was reached, the mixture was incubated for 30 min. additional at 35 ° C to allow reorganization of the gallbladder and encapsulation of the FVII siRNA. The ethanol was then removed and the external buffer was replaced with PBS (155mM NaCl, 3mM Na2HPO4, 1mM KH2PO4, pH 7.5) either by dialysis or tangential flow diafiltration. The final encapsulated siRNA-lipid ratio was determined after removing unencapsulated siRNA using size exclusion columns or

246 .

ion exchange columns.

Example 22: Determination in vivo of novel lipid formulations

The test formulations are to determine their silencing of 7-9 weeks of age, 15-25 g,

0.1, 0.3, 1.0

5.0 mg / kg with treatment. All studies received either

MEXICAN INSTITUTE OF THE PKUFiEOAf INLHKmAt

Efficacy of FVII gene in female C57B1 / 6 female mice to mice per group was initially evaluated in animals that included phosphate buffered saline (PBS, control group) or a reference formulation. The formulations were diluted to the proper concentration in PBS immediately prior to testing. Mice were weighed and appropriate dose volumes calculated (10 µΙ / g body weight). Test and reference formulations as well as PBS (for control animals) were administered intravenously through the lateral tail vein. Animals were anesthetized 24 h later with an intraperitoneal injection of Ketamine / Xylazine and 500-700 µΐ of blood was collected by cardiac puncture in serum separator tubes (BD Microtainer). Blood was centrifuged at 2,000 xg for 10 min at 15 ° C and serum was collected and stored at -70 ° C until analysis. Serum samples were thawed at 37 ° C for 30 min, diluted in PBS, and aliquoted into assay plates.

247

IMPI

M £ XICAN INSTITUTE <

cavities. Factor VII levels are eva ^ m ^ & RAtu & K

a chromogenic assay (Biophen FVII kit, Hyphon according to manufacturer's instructions, and absorbance was measured in a microplate reader equipped with a 405nm wavelength filter. Plasma FVII levels were quantified and ED50 calculated ( doses resulting in a 50% reduction in plasma FVII levels compared to control animals) using a standard curve generated from a pooled serum sample from control animals. Those formulations of interest that show high levels of FVII gene silencing (ED50 «0.1 mg / kg) were retested in independent studies at a lower dose range to confirm potency and establish ED50.

Figure 4 provides a Table describing the EC50 of examples of compounds tested using this method.

Example 22Ά: Determination of the pKa of formulated lipids

The pKa of the various ionizable cationic lipids were determined essentially as described (Eastman et al 1992 Biochemistry 31: 4262-4268) using the 2- (p-toluidino) -6-naphthalenesulfonic acid (TNS) fluorescent probe, which is not fluorescent in water but becomes noticeably fluorescent when attached to membranes. Vesicles composed of cationic lipid / DSPC / CH / PEG-c-DOMG

248

A (molar ratio 40: 10:40:10) were diluted

INDUSTk ___ buffers (130 mM NaCl, 10 mM CH3COONH4, 10 mM MES, 10 mM HEPES) of different pH, ranging from 2 to 11. An aliquot of the aqueous TNS solution (1 µΜ final) was added to the diluted vesicles and after an equilibration period of 30 seconds the fluorescent of the TNS-containing solution was measured at excitation and emission wavelengths of 321 nm and 445 nm, respectively. The pKa of the cationic lipid-containing vesicles was determined by plotting the measured fluorescence as a function of the pH of the solutions and entering the data into a sigmoidal curve using the commercial IgorPro graphing program.

Figure 4 provides a Table representing the pKa of examples of compounds tested using this method.

Example 23: Synthesis of lipid bound to an amide

Ά A stirred suspension of N, N-dimethylamino propionic acid hydrochloride (1, 0.198 g, 1.3 mmol, 1.0 eq.) In DCM HBTU (0.59 g, 1.56 mmol, 1.2 eq.) Was added and

249

IMPig

MEXICAN INSTITUTE

DIPEA (0.71 mL, 3.9 mmol, 3.0 eq.) At temperatureOF THEaá®¿ ^ tit <§g

After stirring for 10 minutes, added originateiamine ion (2.7 g. 1.3 mmol, 1.0 eq.) in DCM dropwise at room temperature and stirring was continued until the reaction was complete. The reaction mixture was diluted with DCM, washed with saturated NaHCO solution3 followed by brine, the organic layer was separated and dried over MgSO4, concentrated and purified by silica gel column chromatography using DCM: MeOH (5%) as gradients to obtain

<td>compound 3</td><td>(AIiNY-201)</td><td>pure</td><td>in</td><td>shape</td><td>of</td><td colspan="2">oil at 70%</td><td>of</td>

<td>performance.</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

6H), 2.60 (t, J = 6.0, 2H), 2.04 (q, J = 6.8, 9H), 1.48 (brs,

1H), 1.40 - 1.14 (m, 43H), 0.88 (t, J = 6.8, 6H). 13C NMR (101 MHz, CDC13) δ 172.26, 130.41, 130.36, 128.17, 128.15,

77.54, 77.22, 76.90, 55.70, 43.85, 43.02, 37.90, 31.99,

31.74, 30.25, 29.92, 29.86, 29.81, 29.57, 27.47, 27.42,

26.84, 25.85, 22.79, 14.29. Mass calculated for C43H80N2O:

640.6, found 641.5.

Example 24: Synthesis of lipids linked to carbamate and urea

Compound 1033

250

INSTITUTE MtXKXwv Μ IA 1'IK.WltiAÍ tKTXXTSixf

Scheme 1

1033

1032

Stage 1:

<td>s. No.</td><td>Chemical compounds / React iv os and solvents</td><td>Molecular weight</td><td>Mol.</td><td>Eq.</td><td>Qty.</td>

<td> 1</td><td>Alcohol 1030</td><td> 528</td><td> 0.095</td><td> 1</td><td>50 g</td>

<td> 3</td><td>Triethylamine (TORCH)</td><td> 101.2</td><td> 0.378</td><td> 4</td><td>53 mi</td>

<td> 5</td><td>chloride mesil</td><td> 114.55</td><td> 0.19</td><td> 2</td><td>15 mi</td>

To a solution of Alcohol 1030 in DCM (400 ml) under Ar atmosphere, TEA and DMAP were added and stirred at room temperature under Ar atmosphere. The reaction mass was cooled to -5 ° C and the mesyl chloride solution in DCM (100 ml) was slowly added at a temperature below -5 ° C and allowed to warm to RT after addition. After 30 minutes (TLC), the reaction mass was

251 extinguished with ice water (20 mi).

The

IMPI

MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY

Organic layer was separated, washed with 1N HC1 (30 ml), water, brine, dried over sodium sulfate and evaporated under reduced pressure to obtain pure product 1031 (55 g, 95.5% yield) as a yellow liquid. HPLC: 99.8%;XH NMR (400 MHz, CDC13): δ 0.89

Stage 2:

<td>S. No</td><td>Chemical compounds / Reagents and solvents</td><td>Weight molecular</td><td>Mol.</td><td>Eq.</td><td>Qty.</td>

<td> 1</td><td>Mesylate 1031</td><td> 606</td><td> 0.0165</td><td> 1</td><td>log</td>

<td> 2</td><td>Tell me t i1f0 rmami da (DMF)</td><td></td><td></td><td></td><td>100 mi</td>

<td> 3</td><td>Sodium cyanide</td><td> 49</td><td> 0.0330</td><td> 2</td><td>1.617g</td>

To a solution of sodium cyanide in DMF under Ar atmosphere, the product from step-1 in DMF was added slowly and then heated to 55 ° C for 24 hrs (HPLC). It was then cooled to room temperature, diluted with water, and extracted with ethyl acetate (several times). The combined organic layer was washed with water, brine, dried over sulfate

252 sodium and evaporated

e <STt1l'TO MEXICANO under reduced pressure crude product, which was purified by chromatoaraph-Hp gei da silica using

1% ether / hexanes as eluant to provide pure product 1032 (5.8g, yield: (62%) as a pale yellow liquid. XH NMR (400MHz, CDC13): δ

0.87 (t, 6H, J = 6.8 Hz), 1.25 (m, 38H), 1.52 (m, 4H), 2.03 (q, 8H, J = 6.8Hz), 2.47 (m, 1H), 2.76 (t, 4H , J = 6.4Hz),

5.32 (m, 8H).

Stage-3:

<td>s. No</td><td>Chemical compounds / Reagents and solvents</td><td>Weight molecular</td><td>Mol.</td><td>Eq.</td><td>Qty.</td>

<td> 1</td><td>Nitrile 1032</td><td> 538</td><td> 0.0097</td><td> 1</td><td>5.2g</td>

<td> 2</td><td>Lithium hydride and aluminum</td><td> 38</td><td> 0.0387</td><td> 4</td><td>1.5g</td>

<td> 3</td><td>Tetrahydrofuran (THF)</td><td></td><td></td><td></td><td>52 mi</td>

To a suspension of lithium aluminum hydride in dry THF under Ar atmosphere was added the product from step 2 in THF at 0 ° C dropwise. It was then allowed to warm to room temperature (RT) and stirred for 20 hrs at RT 15 (TLC). Cooled to 0 ° C and quenched with saturated sodium sulfate solution. The quenched mass was filtered through a celite pad and washed with ethyl acetate.

The combined filtrate was evaporated under reduced pressure to

253

IMPI instituto mexícaní obtained the crude product, which was purified by silica gel using 10% acetate He — ho. »Anü> & · to provide the pure product 1033 (3.7 g, yield:

71%) as a. pale brown liquid, HPLC: 93.8%.XH NMR (400MHz, CDC13): δ 0.87 (t, 6H, J = 6.8 Hz), 1.27 (m, 48H),

2.03 (q, 8H, J = 6.8Hz), 2.60 (d, 2H, J = 4.0 Hz), 2.76 (t, 4H, J = 6.4Hz), 5.31 (m, 8H). 13CNMR (100MHz, CDC13): δ 14.1,

22.6, 25.6, 26.8, 27.1, 27.2, 29.3, 29.5, 29.6, 30.1, 31.5, 40.9, 45.2, 128.0, 130.1. LC-MS: 543 (M +).

Scheme 2 ooTOn.

H V'VX / 'V

1003 (ALNY-192) h2n

ALN-SAN-30 '1001

DSC ch2ci2

h2n

1033

H 'YN·

OR

1004 (ALNY-200)

Compound 1003 (ALNY-192)

To a solution of N, N'-disuccinimidyl carbonate (5.50 g, 21.5 mmol) in CH2CI2 (200 mL), was added

254

IMPI

MEXICAN INSTITUTE DB LA PROPIEDAD

3-Dimethylamino-l-propanol (1001, 2.43 g, 23.6 iíWl'y drop. The resulting mixture was stirred at empala Luía1 dmbientw at night. Once 50 mL of the solution were taken, Et was added3N (0.822 mL, 5.90 mmol) and ALN-SAN-30 (2.08 g, 3.93 mmol) and the reaction mixture was stirred at room temperature overnight. The reaction mixture was diluted with CH2CI2 and washed with NaHCO3 ac. saturated. The organic layer was dried over MgSO4 anhydrous, filtered and concentrated. The crude product was purified by silica gel column chromatography (0-5% MeOH in CH2C12) to give compound 1003 (1.66 g, 2.53 mmol, 64%, RF = 0.22 with 5% MeOH in

CH2C12).1H NMR (CDC13, 400 MHz) δ 5.30-5.41 (m, 8 Η), 4.37 (d, J = 8.0 Hz, 1 Η), 4.09 (t, J = 6.0 Hz, 2 Η), 3.57 (brs, 1 Η), 2.78 (t, J = 6.0 Hz, 4 Η), 2.33 (t, J = 8.0 Hz, 2 Η), 2.23 (s, 6 H), 2.02-2.06 (m, 8 Η), 1.76-1.80 (m, 2 Η), 1.27-1.45 (m, 40 H), 0.89 (t, J = 8.0 Hz, 6 H). 13C NMR (CDC13, 100 MHz) δ 156.5, 130.4, 130.3, 128.2, 128.1, 63.2, 56.6, 51.4, 45.7,

35.7, 31.7, 29.9, 29.8, 29.7, 29.6, 29.5, 27.7, 27.5, 27.4, 26.0, 25.8, 22.8, 14.3. Molecular weight for C43H81N2OR2 (M + H) + Cale. 657.63, Found 657.5.

Compound 1004 (ALNY-200)

To a solution of N, N'-disuccinimidyl carbonate (5.50 g, 21.5 mmol) in CH2CI2 (200 mL), was added

3-dimethylamino-l-propanol (1001, 2.43 g, 23.6 mmol) drop a

255

IMPIí

MEXICAN INSTITUTE I

O £ LA VHOPIF.OAO λa temperature «a» »,* & mt> 5

mL hp 1 i hear1 Ί1 amine 1033 (1.71 drop. The resulting mixture was stirred overnight. Once taken 50 added Et3N (0.697 mL, 5.00 mmol)

3.15 mmol) and the reaction mixture was stirred at room temperature overnight. The reaction mixture was diluted with CH2CI2 and washed with NaHCO3 ac. saturated. The organic layer was dried over MgSO4 anhydrous, filtered and concentrated. The crude product was purified by silica gel column chromatography (0-5% MeOH in CH2C12) to give compound 1004 (1.14 g, 1.70 mmol, 54%, RF = 0.13 with 5% MeOH in CH2C12). Molecular weight for C44H83N2OR2 (M + H)+ Cale. 671.65, found

671.5.

1008

256

Compound 1007

To a carbonate solution

from Μ, Ν1 di3ut! .i!, inimidil »(5.50 g, 21.5 mmol) in CH2CI2 (200 mL), 2-dimethylaminoethanol (1005, 2.37 mL, 23.6 mmol) was added dropwise. The resulting mixture was stirred at room temperature overnight. Once 50 mL of the solution were taken, they were added

Et3N (0.822 mL, 5.90 mmol) and ALN-SAN-30 (2.07 g, 3.92 mmol) and the reaction mixture was stirred at room temperature overnight. The reaction mixture was diluted with CH2CI2 and washed with NaHCO3 ac saturated. The organic layer was dried over MgSO4 anhydrous, filtered and concentrated. The crude product was purified by silica gel column chromatography (0-5% MeOH in CH2CI2) to give compound 1007 (1.78 g, 2.77 mmol, 71%, 2 steps, Rf = 0.26 developed with 5% MeOH in CH2C12). Molecular weight for C42H79N2OR2 (M + H)+ Cale. 643.61, Found 643.5.

Compound 1008

To a carbonate solution of

N, N '-disuccinimidyl (5.50 g, 21.5 mmol) in CH2CI2 (200 mL), 2-dimethylaminoethanol (1005, 2.37 mL, 23.6 mmol) was added dropwise. The resulting mixture was stirred at room temperature overnight. Once 50 mL of the solution were taken, Et was added3N (0.697 mL, 5.00 mmol) and 1033 (440 mg, 0.812 mmol) and the reaction mixture was stirred at room temperature during the

257 night. The reaction mixture was diluted

with NaHCO3 ac. saturated. The organic layer was dried over anhydrous Mg.FOj, filtered, and concentrated. The crude product was purified by column chromatography on silica gel (0-5%

MeOH in CH2C12) to give compound 8 (332 mg, 0.505 mmol,

62%, RF = 0.30 with 5% MeOH in CH2C12). Molecular weight for

C43H8iN2OR2 (M + H)+Calc. 657.63, Found 657.5.

Example 25: Synthesis of guanidinium-bound lipids

Guanidinium analogs

Synthesis of 2064 h2n

DCM / TFA

2058

NH

TO

H

TFA H2N

Synthesis of

SCH3

BocN ^ NHBoc

NBoc |

BocH | An '~' '-' 'NH 2063

2064

2063:

DMF / methylisothiourea (3.4 g,

To a solution of 2058 (6.7 g, 0.0112 acetate

0.0118 ethyl was added Bis-Boc-Smol) and triethylamine (3.5 mL,

0.246 mol) at 0 ° C. HgCl was added to the homogeneous solution2 (3.3 g, 0.0123 mol) at 0 ° C and stirred at RT for 1 hr. TLC showed the absence of starting material. The reaction mass was then diluted with ethyl acetate (100 ml). Filtered through a pad of celite and washed with ethyl acetate. The filtrate was washed with water (2x150 ml) and

258 brine

The organic layer

IMPI

INSTITUTO, MEXICANO 'opae «fé

again through a pad of celite / mesh Hp_____

<td> 230-400</td><td>Silica / Celite gel.</td><td>The</td><td>filtered out</td><td>it evaporated to</td>

<td>Pressure</td><td>reduced to get</td><td>the</td><td>product</td><td>raw</td>

<td>purified</td><td>by chromatography</td><td>in</td><td>alumina</td><td>neutral using</td>

DCM / hexanes as eluent. The product eluted 40% DCM in hexanes as a yellow liquid (Yield 5.2g, 55%).1H

NMR (400MHz, CDC13): 0.89 (t, 6H, J = 6.8Hz), 1.27 - 1.46 (m,

43H), 1.49 (s, 9H), 1.50 (s, 9H), 2.02 (q, 8H, Chi = 6.8Hz,

J2= 6.8Hz), 2.12 (d, 2H, J = 7.2Hz), 2.16 (s, 3H), 2.46 (t, 2H, J = 5.6Hz), 2.77 (t, 4H, J = 6Hz), 3.47 (m , 2H), 5.30 (m, 8H),

8.67 (s, 1H), 11.48 (9s, lH).

Synthesis of 2064 (ALNY-139): To a solution of 2063 (5.2 g, 0.0062 mol) in 10 ml of DCM at 0 ° C, 10 ml of TFA in 60 ml of DCM was added slowly. After addition, the reaction mass was stirred at RT for 3 hrs. TLC showed the absence of starting material. Excess TFA was removed in vacuo to obtain the required product as a viscous brown liquid (5.3 g, 78%).

XH NMR (400MHz, CDC13) :

0.89 (t, 6H, J = 6.8Hz), 1.27

1.46 (m, 44H), 1.78 (s, lH),

2.02 (q, 8H, Chi = 6.4Hz, J2= 6.8Hz),

2.77 (t, 4H,

J = 6.4Hz), 2.86 (s, 3H), 2.92 - 3.01 (m, 2H), 3.27-3.39 (m, 2H), 3.76-3.9 (m, 2H), 5.30 (m, 8H), 7.12 (m , 2H), 8.41 (m, lH), 10.02 (m, 3H). 13C

NMR (100MHz, CDC13) : 14.0, 22.5, 25.6, 25.8, 26.0, 27.17,

27.19, 27.6, 29.3, 29.33, 29.5, 29.6, 31.0, 31.5, 33.9, 36.3,

259

41.0, 54.1, 55.2, 62.0, 62.19,. 111.4

155.0, 157.4, 161.2,

127.9, 127.95, 130.1, 130.2, 152.1,

161.6, 161.96, 162.3. MS: 1093 (tetra TFA salt).

Example 26: Synthesis of lipids linked to oxime and hydrazone

Scheme 1

5006 (ALNY-175)

H n-nh2

2HCI

5005

EtOH

AcOH / EtOH

5007 (ALNY-187)

Experimental details

Compound 5006 (ALNY-175): To a flask containing

EtOH (50 mL) Dimethylaminoethyl hydrazine dihydrochloride (1.00 g, 5.70 mmol) and ketone 5005 (2.00 g, 3.80 mmol) were added. The mixture was heated at 60 ° C for 16 hours. After adding Et3N (0.5 mL), the reaction mixture was evaporated. The residue was extracted with Et2O and NaHCO3 ac. saturated, and the organic layer was dried over MgSO4, leaked and

260

concentrated.

MEX'CAN INSTITUTE

The crude product was purified by a silica gel column (CH2Cl2: MeOH: NH3 ac ... ~. 5 ·, —Rf——

0.29) to give compound 3 (1.78 g, 2.91 mmol, 76%). Molecular weight for C41H78N3 (M + H)+Calc. 612.62, Found 612.5.

Compound 5007 (ALNY-187): 3-Dimethylamino-propionic acid hydrazide (Ryan Scientific, 500 mg, 3.89 mmol) in EtOH (10 mL) and dilinoleyl ketone 5005 (1.74 g, 3.31 mmol) in EtOH were mixed together (20 mL). Acetic acid (0.038 mL, 0.662 mmol) was added to the solution, and the reaction mixture was heated at 65 ° C for 5 hours. After adding Et3N (0.5 mL), the reaction mixture was evaporated. The residue was extracted with CH2C12 and NaHCO3 ac. saturated, and the organic layer was dried over MgSO4, filtered and concentrated. The crude product was purified by silica gel column chromatography (CH2Cl2: MeOH: NH3 ac. = 95: 5: 0.5, RF = 0.30) to give compound 5007 (1.40 g, 2.19 mmol, 66%). Molecular weight for C42H78N3O (M + H)+Calc. 640.61, Found 640.5.

261

IMPI

MEXICAN INSTITUTE

FROM PROMEDAI:

INDUSTRIAL

Scheme 2

5011

Compound 5008b: To a solution of 5008a (30g, 56.8mmol) in toluene, N-Hydroxyphthalimide (13.9g, 85mmol) and TPP (22.30g, 85mmol) in argon were added. The reaction mass was cooled to -5 ° C, to this was added TEA (11.84 mL), followed by DEAD (13.14 ml). The reaction mass was allowed to stir for 12 hrs at room temperature (TLC). Then it was filtered through a pad of celite. The filtrate was evaporated under reduced pressure to obtain the crude product, which was purified by chromatography on silica gel to provide the pure product, which was eluted with 3% diethyl ether and hexanes to give product 5008b (22.90 g,

60.50%) as a pale yellow liquid 1HNMR (400MHz, CDCI3,): δ

0.90 (6H, t, J = 7.2Hz), 1.2-1.4 (34H, m), 1.66-1.70 (4H, m),

262

IMPI

2.03-2.08 (8H, m), 2.78 (4H, t, J = 12. (^

INDUSTRIAL

5.29-5.43 (8H, m), 7.74-7.76 (2H, m), 7.83-7.85 (2H, m).

13CNMR

27.20, (100MHz, CDCI3,): δ 14.3, 22.5, 24.9, 25.6, 27.2,

29.3, 29.3, 29.5, 29.5, 29.6, 29.7, 31.5, 32.4, 88.3,

123.3,

127.9, 129.0, 130.1, 134.3, 164.3.

MS: Calculated molecular weight for C45H71NO3 67 3.54, Found:

674.55 (M + H).

Compound 5010 (ALY-SAN-031):

(2.36 g, 3.50 mmol) was treated with hydrazine monohydrate (0.424 mL, 5.60 mmol) in

CH2CI2 (36 mL) and EtOH (4 mL) for hours. After filtering the resulting white precipitate, the filtrate was concentrated. The residue was extracted with Et2O and NaHCO3 ac. saturated, and the organic layer was dried over MgSO4, filtered and concentrated. Crude product 5008 was used in the next step without further purification. RF = 0.44 (10% EtOAC in Hexanes).

Molecular weight for C37H70NO (M + H)+ Cale. 544.55, Found 544.2.

Compound 5008 was dissolved in EtOH (30 mL), and 4- (dimethylamino) butan-2-one (Matrix Scientific, 500 mg, 4.34 mmol) and acetic acid (0.040 mL, 0.70 mmol) were added to the solution. The reaction mixture was stirred at room temperature for 14 hours. After adding Et3N (0.5 mL), the reaction mixture was evaporated. The residue was extracted with Et2O and NaHCO3 ac. saturated, and the organic layer was dried over MgSO4, filtered and concentrated. The crude product was purified by silica gel column chromatography (Hexanes: EtOAc =

263

IMPI ^ w,

MEXICAN INSTITUTE

1: 1) to give compound 5010 as a ^ gwfe ^ s

E / Z (1.90 g, 2.96 mmol, 85%, 2 steps. RF = 0.39, 0.21 developed with Hexanes: EtOAc = 1: 1). Molecular weight for C43HgiN2O (M + H)+Calc. 641.63, Found 641.5.

Compound 5009: Compound 5006 (800 mg, 1.47 mmol) was dissolved in EtOH (15 mL), (Dimethylamino) acetone (Aldrich, 0.220 mL, 1.91 mmol) and acetic acid (0.017 mL, 0.294 mmol) were added to the solution Then the reaction mixture was stirred at room temperature for 14 hours. After adding Et3N (0.5 mL), the reaction mixture was evaporated. The residue was extracted with EtgO and NaHCO3 ac. saturated, and the organic layer was dried over MgSO4, filtered and concentrated. The crude product was purified by silica gel column chromatography (Hexanes: EtOAc = 9: 1) to give compound 5009 (868 mg, 1.38 mmol, 94%, Rf = 0.22 developed with Hexanes: EtOAc = 9: 1) . Molecular weight for

C42H79N2O (M + H)+Calc. 627.62, Found 627.5.

Compound 5011: Compound 5006 (1.09 g, 2.00 mmol) was dissolved in EtOH (20 mL). L-Methyl-4-piperidone (Aldrich, 0.320 mL, 2.60 mmol) and acetic acid (0.40 mL, 0.400 mmol) were added to the solution, then the reaction mixture was stirred at room temperature for 14 hours. After adding Et3N (0.5 mL), the reaction mixture was evaporated. The residue was extracted with Et2O and NaHCO3 ac. saturated, and the organic layer was dried over MgSO4, leaked and

264

IMPI

MEXICAN INSTITUTE concentrated. The crude product was purified by craañwKa <íjr £

silica gel column (CH2C12: MeOH: mHjPH - α · 7 · ^ · η to give compound 5011 (1.11 g, 1.74 mmol, 87%, RF = 0.20 developed with CH2C12: MeOH: NH4OH = 97: 3: 0.3). Molecular weight for C43H79N2O (M + H)+Calc. 639.62, Found 639.5.

Example 27: Synthesis of other lipids

Synthesis of compound 2056 (ALNY-181)

2050

MsCI, TEA, DCM, DMAP

Synthesis of 2051: To a solution of 2004 (50 g, 95 mmol) in DCM (400 ml) under Ar atmosphere, TEA (53 mL, 378 mmol) and DMAP (1.2 g, 9.5 mmol) were added and stirred at room temperature in Ar atmosphere. The reaction mass was cooled to -5 ° C and the mesyl chloride solution (15 mL, 190 mmol) in DCM (100 ml) was slowly added at a temperature below -5 ° C and allowed to warm to ΤΆ after addition. After 30 minutes (TLC), the reaction mass was quenched with ice water (20 ml). The layer

265

IMPI INSTITUTO MEXICANO DE LA PROPERTY organic was separated, washed with IN HCI (3 (T 'x,ñH.TOI, brine, dried over sodium sulfate and evaporated1At reduced preaietr to obtain pure product (55 g, 95.5%) as a yellow liquid. 1H NMR (400 MHz, CDC13): δ 0.89 (t, 6H, J = 6.8), 1.2-1.5 (m, 36H), 1.67 (m, 4H), 2.05 (q, 8H, J1 = 6.8, J2 = 6.8), 2.77 (t, 4H , J = 6.4), 2.99 (s, 3H), 4.71 (m, 1H) and 5.36 (m, 8H).

Synthesis of 2052: To a stirred solution of sodium cyanide (1.70 g, 0.0330 mol) in DMF, compound 2051 (10 g, 0.0165 mol) in DMF (100 mL) was added slowly and heated to 55 ° C for 24 hrs (TLC). It was then cooled to room temperature, diluted with water, and extracted with ethyl acetate several times. The combined organic layers were washed with water, brine, dried over sodium sulfate and evaporated under reduced pressure to obtain the crude product, which was purified by chromatography on silica gel using 1% ether / hexanes as eluent to provide the product as a pale yellow liquid (5.80 g, 62%). XH NMR (400MHz, CDCI3): δ 0.87 (t, 6H, J = 6.8 Hz), 1.25 (m, 38H), 1.52 (m, 4H), 2.03 (q, 8H, J = 6.8Hz, J = 6.8Hz ), 2.47 (m, 1H), 2; 7 6 (t, 4H, J = 6.4Hz), 5.32 (m, 8H).

Synthesis of 2053: To a chilled suspension of LAH (1.50 g, 0.0387 mol) in THF (52 ml) at 0 ° C under argon, compound 2052 (5.2 g, 0.0097 mol) in THF was added dropwise. After the addition, it was allowed to warm to RT and

266 stirred for 20 quenched with hrs solution (TLC).

KtX INSTITUTE ·>. ': <

nt the i> m? wsu * ::

4— —1—1 1 <- x. , saturated with sodium sulfate followed by ethyl acetate. It was filtered through a celite pad and washed with ethyl acetate. The combined organic filtrate was evaporated under reduced pressure to obtain the crude product, which was purified by silica gel chromatography using 10% ethyl acetate in hexanes to provide the product as a pale brown liquid (3.70g,

71%). XH NMR (400MHz, CDC13): δ 0.87 (t, 6H, J = 6.8 Hz), 1.27 (m,

48H), 2.03 (q, 8H, 6.8Hz, 6.8Hz), 2.60 (d, 2H, J = 4.0 Hz),

2.76 (t, 4H, J = 6.4Hz), 5.31 (m, 8H). 13C NMR (100MHz, CDCI3): δ

14.1, 22.6, 25.6, 26.8, 27.1, 27.2, 29.3, 29.5, 29.6, 30.1,

31.5, 40.9, 45.2, 128.0, 130.1. Mass 543 (M +).

Synthesis of 2054: To a solution of compound 2053 (45 g, 0.083 mol) in DCM (450 mL) under argon atmosphere at 0 ° C, 2,6-Lutidine (19.3 mL, 0.166 mol) was added followed by chloroformate of benzyl (12.1 mL, 0.0847 mol) drop by drop. Then it was heated to 20 ° C and stirred for one hour at said temperature (TLC). Then it was diluted with DCM (200 ml), washed with 10% citric acid (2x200 ml), water, brine and dried over anhydrous sodium sulfate, evaporated under reduced pressure to obtain the crude product, which was purified by silica gel chromatography using 3% ether / hexanes to obtain the final product as a pale brown liquid

267 (36g,

1.28

64%). XH NMR (400MHz, CDCI3): δ (m, 44H), 2.02 (q, 8H, Jx = 6.8Hz,

0.87 IM1P I

MEXICAN INSTITUTE I

OF THE SPEED 6.8'W:1AL2S ^? ^

J2

4H, J = 6.4Hz), 3.11 (t, 2H, J = 5.6Hz), T.'b ((s, 111), 5.1 »(s, 2H), 5.30 (m, 8H), 7.31 (m, 4H).

Synthesis of 2055: To a suspension of lithium aluminum hydride (4.05 g, 0.1066 mol) in THF (360 mL) under argon at 0 ° C, a solution of 2054 (36 g, 0.0533 mol) in THF was added drop by drop. After addition, it was allowed to warm to room temperature and stirred for 15 hrs (TLC). The reaction mass was cooled to 0 ° C and quenched with saturated sodium sulfate solution followed by ethyl acetate. It was filtered through a celite pad and washed with ethyl acetate. The combined filtrates were evaporated and purified with silica gel using 100% methanol to obtain the final product (26 g, 87%). XH NMR (400MHz, CDC13) :

<td colspan="3">Synthesis of</td><td>2055a: The</td><td colspan="2">compound 2055</td><td> (4</td><td>g,</td><td> 0.0072</td><td>mol)</td>

dissolved in DCM (40 mL) under argon atmosphere and cooled to 0 ° C

2,6-Lutidine (1.7 mL,

0.0144 mol) dropwise followed by benzyl chloroformate (1.0 mL, 0.0074 mol). It was then allowed to warm to 20 ° C and stirred for one hour (TLC). Then it was diluted with DCM (200

268

IMPI

INSTITUTO MEXICANO mi), washed with 10% citric acid (2x? Ó1áro? 3§Xí¡ ?, brine. The organic layer was dried with anhydrous sodium coa-anifate and evaporated under reduced pressure to obtain the crude product, which Purified with silica gel using 3% ether / hexanes to obtain the final product (3.80 g, 76%). 3H NMR (400MHz, CDC13): δ 0.87 (t, 6H, J = 6.8Hz), 1.20 (m, 44H),

2.02 (q, 8H, Jx = 6.8Hz, J2 = 6.8Hz), 2.76 (t, 4H, J = 6.4Hz), 2.89 (d, 3H, J = 6Hz), 3.14 (m, 2H), 5.12 (s, 2H), 5.30 (m, 8H), 7.26 (m, 4H).

Synthesis of 2056: To a suspension of lithium aluminum hydride (0.52 g, 0.0138 mol) in THF under argon atmosphere at 0 ° C, a solution of 2055a (3.80 g, 0.0055 mol) in THF (38) was added. mL) drop by drop. After addition, it was allowed to warm to room temperature and stirred for 15 hrs (TLC). The reaction mass was cooled to 0 ° C and quenched with saturated sodium sulfate solution followed by ethyl acetate. The entire mass was filtered through a celite pad and washed with ethyl acetate. The combined filtrates were evaporated under reduced pressure to obtain the crude product, which was purified by chromatography on silica gel using 100% methanol to obtain the final product.

<td>how</td><td>a liquid</td><td>colorless</td><td>(2.20 g,</td><td> 70%)</td><td>1 HOUR</td><td>NMR</td><td>(400MHz,</td>

6.4Hz), 5.30 (m, 8H). 13C NMR (100MHz, CDC13): δ 14.0, 22.4,

269

25.5, 26.5, 27.0, 27.1, 29.2, 29.4,

35.6, 45.9, 64.8, 127.8, 130.0. ELSD: Q ° Μ? - · 57η 9.

Synthesis of

2062 (ALNY-141):

h3chn

2055

2061

LAH --► XN ^ CHO

Qbz ---- Cbz

NaBH (OAc)3 |

2062

Synthesis of 2061: To a solution of 2055 (5 g, 0.0089 mol) in 100 ml of DCM in argon at 0 ° C NaBH (OAc) was added3 (2.30 g, 0.0106 mol) and stirred for 20 minutes. Aldehyde (1.70 g, 0.0082 mol) in 700 ml of DCM was added slowly to the reaction mass over a period of 45 minutes. After the addition the reaction mass was allowed to stir at RT for 15-20 minutes. TLC showed the absence of starting material. The reaction mass was washed with NaHCO3 sat. (2x500 mi) and water (500 mi). The aqueous layer was re-extracted with DCM (500 ml). The combined organic layer was washed with brine (500 ml). The organic layer was dried over Na2SÜ4, filtered, and concentrated. The obtained crude product was purified by chromatography on silica gel and hexanes / diethyl ether as eluents. The product eluted 8% ether in hexanes as a brown liquid (yield 6.40g, 96%).1H NMR: (400MHz, CDC13): 0.89 (t, 6H, J = 7.2Hz), 1.26 - 1.43 (m, 40H), 1.85

270 (m, 1H), 2.06 (q, 8H, Jl = 6.8Hz, J2 = 6.8Hz),

IMPIí

MEXICAN INSTITUTE 2.15 ° W »

(s, 3H), 2.45 (m, 2H), 2.77 (t, 4H, .T = 6Mz). 9 Q5 <*. 3H).

3.35 (m, 2H), 5.12 (s, 2H), 5.32 (m, 8H), 7.35 (m, 5H).

Synthesis of 2062: To a suspension of lithium aluminum hydride (0.751 g, 0.0198 mol) in THF under argon atmosphere at 0 ° C, a solution of 2061 (5.7 g, 0.0076 mol) in THF was added dropwise. gout. After addition, it was allowed to warm to room temperature and stirred for 15 hrs (TLC). The reaction mass was cooled to 0 ° C and quenched with saturated sodium sulfate solution (50 ml) followed by ethyl acetate (100 ml). It was filtered through a celite pad and washed with ethyl acetate. The combined filtrates were evaporated under reduced pressure to obtain the crude product, which was purified by silica gel chromatography using DCM / ethyl acetate / Chloroform / Methanol as the eluent. The product eluted at 3% chloroform in methanol as a brown liquid (3.80 g, 80%)XH NMR: (400MHz, CDC13): 0.89 (t, 6H, J = 6.8Hz), 1.26-1.37 (m, 40H), 1.42 (m, 1H), 2.06 (q, 8H, Jl = 6.8Hz, J2 = 6.8Hz), 2.15 (d, 2H, J = 7.2Hz), 2.20 (s, 3H), 2.29 (s, 6H), 2.45 (s, 4H), 2.78 (t, 4H, J = 6.4Hz), 5.36 (m, 8H). 13C NMR: (100MHz, CDC13): 14.1, 22.6, 25.6, 26.6, 27.2, 27.22, 28.9, 29.3, 29.6, 29.7, 30.1, 31.5, 32.2, 35.8, 43.2, 45.7,

56.2, 57.2, 63.3, 127.9, 130.2. ELSD HPLC: 100% Mass: 627.53

The various modalities described above can be combined to provide additional modalities.

271

All US patents, US patent application,

IMPI

MEXICAN INSTITUTE the

For foreign patent applications and non-patent publications referred to in this specification and / or listed in the

Application Data Sheet, are incorporated into this mode of reference in its entirety.

Aspects of the modalities can be modified, if necessary to employ concepts from various patents, applications and publications, to provide still other additional modalities.

These and other changes can be made to the modalities in view of the detailed description above. In general, in the claims that follow, the terms used shall not be construed to limit the claims to the specific modalities described in the specification and claims, but will be interpreted to include all possible modalities together with the entire scope of the equivalents. to which these claims correspond. Accordingly, the claims are not limited by the description.

272

Contents228

329 sheets

Sheet 1
Sheet 2
Sheet 3
Sheet 4
Sheet 5
Sheet 6
Sheet 7
Sheet 8
Sheet 9
Sheet 10
Sheet 11
Sheet 12
Sheet 13
Sheet 14
Sheet 15
Sheet 16
Sheet 17
Sheet 18
Sheet 19
Sheet 20
Sheet 21
Sheet 22
Sheet 23
Sheet 24
Sheet 25
Sheet 26
Sheet 27
Sheet 28
Sheet 29
Sheet 30
Sheet 31
Sheet 32
Sheet 33
Sheet 34
Sheet 35
Sheet 36
Sheet 37
Sheet 38
Sheet 39
Sheet 40
Sheet 41
Sheet 42
Sheet 43
Sheet 44
Sheet 45
Sheet 46
Sheet 47
Sheet 48
Sheet 49
Sheet 50
Sheet 51
Sheet 52
Sheet 53
Sheet 54
Sheet 55
Sheet 56
Sheet 57
Sheet 58
Sheet 59
Sheet 60
Sheet 61
Sheet 62
Sheet 63
Sheet 64
Sheet 65
Sheet 66
Sheet 67
Sheet 68
Sheet 69
Sheet 70
Sheet 71
Sheet 72
Sheet 73
Sheet 74
Sheet 75
Sheet 76
Sheet 77
Sheet 78
Sheet 79
Sheet 80
Sheet 81
Sheet 82
Sheet 83
Sheet 84
Sheet 85
Sheet 86
Sheet 87
Sheet 88
Sheet 89
Sheet 90
Sheet 91
Sheet 92
Sheet 93
Sheet 94
Sheet 95
Sheet 96
Sheet 97
Sheet 98
Sheet 99
Sheet 100
Sheet 101
Sheet 102
Sheet 103
Sheet 104
Sheet 105
Sheet 106
Sheet 107
Sheet 108
Sheet 109
Sheet 110
Sheet 111
Sheet 112
Sheet 113
Sheet 114
Sheet 115
Sheet 116
Sheet 117
Sheet 118
Sheet 119
Sheet 120
Sheet 121
Sheet 122
Sheet 123
Sheet 124
Sheet 125
Sheet 126
Sheet 127
Sheet 128
Sheet 129
Sheet 130
Sheet 131
Sheet 132
Sheet 133
Sheet 134
Sheet 135
Sheet 136
Sheet 137
Sheet 138
Sheet 139
Sheet 140
Sheet 141
Sheet 142
Sheet 143
Sheet 144
Sheet 145
Sheet 146
Sheet 147
Sheet 148
Sheet 149
Sheet 150
Sheet 151
Sheet 152
Sheet 153
Sheet 154
Sheet 155
Sheet 156
Sheet 157
Sheet 158
Sheet 159
Sheet 160
Sheet 161
Sheet 162
Sheet 163
Sheet 164
Sheet 165
Sheet 166
Sheet 167
Sheet 168
Sheet 169
Sheet 170
Sheet 171
Sheet 172
Sheet 173
Sheet 174
Sheet 175
Sheet 176
Sheet 177
Sheet 178
Sheet 179
Sheet 180
Sheet 181
Sheet 182
Sheet 183
Sheet 184
Sheet 185
Sheet 186
Sheet 187
Sheet 188
Sheet 189
Sheet 190
Sheet 191
Sheet 192
Sheet 193
Sheet 194
Sheet 195
Sheet 196
Sheet 197
Sheet 198
Sheet 199
Sheet 200
Sheet 201
Sheet 202
Sheet 203
Sheet 204
Sheet 205
Sheet 206
Sheet 207
Sheet 208
Sheet 209
Sheet 210
Sheet 211
Sheet 212
Sheet 213
Sheet 214
Sheet 215
Sheet 216
Sheet 217
Sheet 218
Sheet 219
Sheet 220
Sheet 221
Sheet 222
Sheet 223
Sheet 224
Sheet 225
Sheet 226
Sheet 227
Sheet 228
Sheet 229
Sheet 230
Sheet 231
Sheet 232
Sheet 233
Sheet 234
Sheet 235
Sheet 236
Sheet 237
Sheet 238
Sheet 239
Sheet 240
Sheet 241
Sheet 242
Sheet 243
Sheet 244
Sheet 245
Sheet 246
Sheet 247
Sheet 248
Sheet 249
Sheet 250
Sheet 251
Sheet 252
Sheet 253
Sheet 254
Sheet 255
Sheet 256
Sheet 257
Sheet 258
Sheet 259
Sheet 260
Sheet 261
Sheet 262
Sheet 263
Sheet 264
Sheet 265
Sheet 266
Sheet 267
Sheet 268
Sheet 269
Sheet 270
Sheet 271
Sheet 272
Sheet 273
Sheet 274
Sheet 275
Sheet 276
Sheet 277
Sheet 278
Sheet 279
Sheet 280
Sheet 281
Sheet 282
Sheet 283
Sheet 284
Sheet 285
Sheet 286
Sheet 287
Sheet 288
Sheet 289
Sheet 290
Sheet 291
Sheet 292
Sheet 293
Sheet 294
Sheet 295
Sheet 296
Sheet 297
Sheet 298
Sheet 299
Sheet 300
Sheet 301
Sheet 302
Sheet 303
Sheet 304
Sheet 305
Sheet 306
Sheet 307
Sheet 308
Sheet 309
Sheet 310
Sheet 311
Sheet 312
Sheet 313
Sheet 314
Sheet 315
Sheet 316
Sheet 317
Sheet 318
Sheet 319
Sheet 320
Sheet 321
Sheet 322
Sheet 323
Sheet 324
Sheet 325
Sheet 326
Sheet 327
Sheet 328
Sheet 329

222 members in 20 offices

This recordMember, by publication datePriority claim10 more offices are in the list below

Priority claims13

Priority claims
Document	Office	Kind	Date
61113179	United States of America	–	2008-11-10
11317908	United States of America	P	2008-11-10
61154350	United States of America	–	2009-02-20
15435009	United States of America	P	2009-02-20
61171439	United States of America	–	2009-04-21
17143909	United States of America	P	2009-04-21
61185438	United States of America	–	2009-06-09
18543809	United States of America	P	2009-06-09
61225898	United States of America	–	2009-07-15
22589809	United States of America	P	2009-07-15
61234098	United States of America	–	2009-08-14
23409809	United States of America	P	2009-08-14
2009063931	United States of America	W	2009-11-10

Members222

Family members, oldest first
Document	Office	Kind
AU2009313201A1	Australia	A1	2010-05-14
AU2009313205A1	Australia	A1	2010-05-14
AU2009313206A1	Australia	A1	2010-05-14
CA2743135A1	Canada	A1	2010-05-14
CA2743136A1	Canada	A1	2010-05-14
CA2743139A1	Canada	A1	2010-05-14
CA3029724A1	Canada	A1	2010-05-14
CA3033577A1	Canada	A1	2010-05-14
CA3039251A1	Canada	A1	2010-05-14
CA3220821A1	Canada	A1	2010-05-14
WO2010054384A1	World Intellectual Property Organization (WIPO)	A1	2010-05-14
WO2010054401A1	World Intellectual Property Organization (WIPO)	A1	2010-05-14
WO2010054405A1	World Intellectual Property Organization (WIPO)	A1	2010-05-14
WO2010054406A1	World Intellectual Property Organization (WIPO)	A1	2010-05-14
MX2011004973A	Mexico	A	2011-07-29
MX2011004974A	Mexico	A	2011-07-29
IL212801A0	Israel	A0	2011-07-31
IL212801D0	Israel	D0	2011-07-31
IL212802A0	Israel	A0	2011-07-31
IL212802D0	Israel	D0	2011-07-31
KR20110091866A	Republic of Korea	A	2011-08-16
EP2355658A1	European Patent Office (EPO)	A1	2011-08-17
EP2355851A1	European Patent Office (EPO)	A1	2011-08-17
KR20110097823A	Republic of Korea	A	2011-08-31
EP2367571A1	European Patent Office (EPO)	A1	2011-09-28
CN102281899A	China	A	2011-12-14
US2011311582A1	United States of America	A1	2011-12-22
US2011311583A1	United States of America	A1	2011-12-22
US2012027796A1	United States of America	A1	2012-02-02
CN102361650A	China	A	2012-02-22
US2012058144A1	United States of America	A1	2012-03-08
EP2355658A4	European Patent Office (EPO)	A4	2012-03-28
JP2012508261A	Japan	A	2012-04-05
JP2012508263A	Japan	A	2012-04-05
JP2012508264A	Japan	A	2012-04-05
US2012095075A1	United States of America	A1	2012-04-19
EA201170554A1	Eurasian Patent Organization (EAPO)	A1	2012-04-30
EA201170553A1	Eurasian Patent Organization (EAPO)	A1	2012-05-30
EP2355851A4	European Patent Office (EPO)	A4	2012-08-29
EP2367571A4	European Patent Office (EPO)	A4	2012-08-29
SG195653A1	Singapore	A1	2013-12-30
US8722082B2	United States of America	B2	2014-05-13
NZ608756A	New Zealand	A	2014-12-24
US8999351B2	United States of America	B2	2015-04-07
JP2015078229A	Japan	A	2015-04-23
NZ608754A	New Zealand	A	2015-05-29
IL212801A	Israel	A	2015-06-30
IL212802A	Israel	A	2015-06-30
IL238884A0	Israel	A0	2015-06-30
IL238884D0	Israel	D0	2015-06-30
IL238885A0	Israel	A0	2015-06-30
IL238885D0	Israel	D0	2015-06-30
CN102281899B	China	B	2015-07-15
JP5747282B2	Japan	B2	2015-07-15
JP5774486B2	Japan	B2	2015-09-09
US2015265708A1	United States of America	A1	2015-09-24
US9186325B2	United States of America	B2	2015-11-17
JP2015214560A	Japan	A	2015-12-03
CN105152939A	China	A	2015-12-16
JP5832898B2	Japan	B2	2015-12-16
US9220683B2	United States of America	B2	2015-12-29
JP2016047832A	Japan	A	2016-04-07
CN102361650B	China	B	2016-04-20
MX338780B	Mexico	B	2016-05-02
AU2009313206B2	Australia	B2	2016-05-19
AU2009313201B2	Australia	B2	2016-06-16
AU2009313205B2	Australia	B2	2016-06-16
CN105709229A	China	A	2016-06-29
JP2016128498A	Japan	A	2016-07-14
US2016199485A1	United States of America	A1	2016-07-14
US2016213785A1	United States of America	A1	2016-07-28
AU2016208434A1	Australia	A1	2016-08-18
AU2016208436A1	Australia	A1	2016-08-18
AU2016216582A1	Australia	A1	2016-09-01
IL247646A0	Israel	A0	2016-11-30
IL247646D0	Israel	D0	2016-11-30
IL247647A0	Israel	A0	2016-11-30
IL247647D0	Israel	D0	2016-11-30
MX347860B	Mexico	B	2017-05-16
US9682139B2	United States of America	B2	2017-06-20
US9707292B2	United States of America	B2	2017-07-18
KR20170089976A	Republic of Korea	A	2017-08-04
EP3207944A1	European Patent Office (EPO)	A1	2017-08-23
JP6189461B2	Japan	B2	2017-08-30
US9764036B2	United States of America	B2	2017-09-19
EP2355658B1	European Patent Office (EPO)	B1	2017-09-27
MX351819B	Mexico	B	2017-10-30
EP3238738A1	European Patent Office (EPO)	A1	2017-11-01
JP2017197576A	Japan	A	2017-11-02
AU2017254919A1	Australia	A1	2017-11-23
KR20170143016A	Republic of Korea	A	2017-12-28
AU2016208434B2	Australia	B2	2018-01-18
AU2017279739A1	Australia	A1	2018-01-25
JP2018012724A	Japan	A	2018-01-25
JP6273234B2	Japan	B2	2018-01-31
US2018043009A1	United States of America	A1	2018-02-15
EP3284482A1	European Patent Office (EPO)	A1	2018-02-21
AU2018201038A1	Australia	A1	2018-03-01
US2018064807A1	United States of America	A1	2018-03-08
EP2355851B1	European Patent Office (EPO)	B1	2018-04-04

Showing 100 of 222