Polynucleotides, polypeptides and methods for increasing oil content, growth rate and biomass of plants.
Abstract
Provided are method of increasing oil content, growth rate, biomass, yield and/or vigor of a plant. The methods are effected by upregulating in the plant an expression level of a polypeptide comprising an amino acid sequence at least 90 % homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs: 199, 166-198, 200-221, 229-307, 311-330, 351-353, 355-361, 363-364, 366-368, 218, 222-228, 308-310, 350, 354, 362, 365, 523-649, 786-920, 1047 and 1048. Also provided are polynucleotides, nucleic acid constructs, polypeptides and transgenic plants expressing same which can be used to increase oil content, growth rate, biomass, yield and/or vigor of a plant and produce oil.

Term
1.5 yearsleft in the term
Expires 9 April 2028.
- Priority
- Filed
- Granted
- Today
- Expires
20 claims: 11 independent, 9 dependent
- 1CLAIMS REIVINDICACIONES 1. Un método para aumentar el conte»£«te-—de·· —asae-ifeo r rendimiento de aceite, rendimiento de semilla, peso de 1000 semillas, índice de cosecha, velocidad de crecimiento, biomasa, rendimiento y/o vigor de una planta; el método caracterizado porque comprende sobreexpresar dentro de la planta un polipéptido que comprende una secuencia de aminoácidos al menos 80% idéntica a la secuencia de aminoácidos detallada en SEQ ID NO:194, en comparación con una planta nativa de la misma especie la cual se cultiva bajo las mismas condiciones de crecimiento, incrementando de esta manera el contenido de aceite, rendimiento de aceite, rendimiento de semilla, peso de 1000 semillas, índice de cosecha, velocidad de crecimiento, biomasa, rendimiento y/o vigor de una planta. one. A method to increase the »£« te -— of ·· —asae-ifeo r oil yield, seed yield, 1000 seed weight, harvest rate, growth rate, biomass, yield and / or vigor of a plant;the method characterized in that it comprises overexpressing within the plant a polypeptide comprising an amino acid sequence at least 80% identical to the amino acid sequence detailed in SEQ ID NO: 194, compared to a native plant of the same species which is cultivated under the same growing conditions, thus increasing the oil content, oil yield, seed yield, 1000 seed weight, harvest index, growth rate, biomass, yield and / or vigor of a plant.
- 3A method of producing seeds from a crop, characterized in that it comprises:3. Un método para producir semillas de un cultivo, caracterizado porque comprende: (a) seleccionar una planta parental que sobreexpresa un (a) select a parent plant that overexpresses a 153 153 IMPIOS Mexican Institute FC;-L IMPIOS instituto mexicano fc;-L DE :.A ¡HCFIEDAD V»».2¡7-»WÍ£* ÍNDbSTF.IAL iT*polipéptido que exhibe al menos 80% de identidad de secuencia con el polipéptido detallado en SEQ ID NO:194, en comparación con una planta nativa de la misma especie la cual se cultiva bajo las mismas condiciones de crecimiento, en donde dicha planta parental exhibe un rasgo incrementado seleccionado del grupo que consiste en: contenido de aceite incrementado, rendimiento de aceite incrementado, rendimiento de semilla incrementado, peso de 1000 semillas incrementado, índice de cosecha incrementado, velocidad de crecimiento incrementada, biomasa incrementada, rendimiento incrementado y/o vigor de una r planta incrementado, en comparación con una planta no transformada la cual se cultiva bajo las mismas condiciones de crecimiento, y;FROM:. TO ¡HCFIEDAD V »». 2¡7- »WÍ £ * ÍNDbSTF.IAL Item* polypeptide that exhibits at least 80% sequence identity with the polypeptide detailed in SEQ ID NO: 194, compared to a native plant of the same species which is grown under the same growth conditions, where said parent plant exhibits an increased feature selected from the group consisting of: increased oil content, increased oil yield, increased seed yield, increased 1000 seed weight, increased harvest rate, increased growth rate, increased biomass, increased yield and / or vigor of an increased plant, compared to a non-transformed plant which is cultivated under the same growing conditions, and;(b) cultivar una planta productora de semillas a partir de la planta parental resultante de la etapa (a) , en donde la planta productora de semillas que comprende el polinucleótido exógeno tiene dicho rasgo incrementado, y;(b) cultivating a seed-producing plant from the parent plant resulting from step (a), wherein the seed-producing plant comprising the exogenous polynucleotide has said increased trait, and;(c) producing seeds from the seed-producing plant resulting from step (b), thereby producing the seeds of the crop. (c) producir semillas de la planta productora de semillas resultante de la etapa (b) , produciendo de esta manera las semillas del cultivo.
- 4Un método para seleccionar una planta que tiene contenido de aceite incrementado, rendimiento de semilla incrementado, peso de 1000 semillas incrementado, índice de cosecha incrementado, velocidad de crecimiento incrementada, biomasa incrementada, rendimiento incrementado y/o vigor de una Four. A method of selecting a plant that has increased oil content, increased seed yield, increased 1000 seed weight, increased harvest rate, increased growth rate, increased biomass, increased yield and / or vigor of one 154 154 1M r Μ 1M r Μ MEXICAN INSTITUTE increased plant; the method characterized by ^ JáSS ^ re (a) providing plants that overexpress §ajL-UQ-_paÜpópteide comprising an amino acid sequence which exhibits at least 80% sequence identity to the polypeptide detailed in SEQ ID NO:194, compared with a native plant of the same species which is grown under the same growing conditions, (b) select from the plants of step (a) a plant with increased oil content, increased oil yield, increased seed yield, increased 1000 seed weight, increased harvest rate, increased growth rate, increased biomass, increased yield and / or increased vigor, compared to a non-transformed plant which is grown under same growth conditions, selecting in this way the transformed plant that has increased oil content, increased oil yield, increased seed yield, increased 1000 seed weight, increased harvest index, increased growth rate, increased biomass, increased yield and / or increased vigor, compared to a non-transformed plant of the same species which is grown under the same growing conditions. ÍNSTITJTO MEXICANO planta incrementado;el método caracterizado porqü^JáSS^re (a) proporcionar plantas que sobreexpre§ajL-UQ-_paÜpópteideque comprende una secuencia de aminoácidos la cual exhibe al menos 80% de identidad de secuencia con el polipéptido detallado en SEQ ID NO:194, en comparación con una planta nativa de la misma especie la cual se cultiva bajo las mismas condiciones de crecimiento, (b) seleccionar a partir de las plantas de la etapa (a) una planta que tiene contenido de aceite incrementado, rendimiento de aceite incrementado, rendimiento de semilla incrementado, peso de 1000 semillas incrementado, índice de cosecha incrementado, velocidad de crecimiento incrementada, biomasa incrementada, rendimiento incrementado y/o vigor incrementado, en comparación con una planta no transformada la cual se cultiva bajo las mismas condiciones de crecimiento, seleccionando de esta manera la planta transformada que tiene contenido de aceite incrementado, rendimiento de aceite incrementado, rendimiento de semilla incrementado, peso de 1000 semillas incrementado, índice de cosecha incrementado, velocidad de crecimiento incrementada, biomasa incrementada, rendimiento incrementado y/o vigor incrementado, en comparación con una planta no transformada de la misma especie la cual se cultiva bajo las mismas condiciones de crecimiento.
- 5A method of producing oil, characterized in that it comprises:5. Un método para producir aceite, caracterizado porque comprende: 155 155 IMP (a) proporcionar la planta de conformidad»* de las reivindicaciones 1 a 4;y (b) extraer el aceite de la planta;IMP (a) provide the plant according to »* of claims 1 to 4;and (b) extract the oil from the plant;produciendo así el aceite. thus producing the oil.
- 6The method according to any of claims 1 to 5, characterized in that the polypeptide is expressed from a polynucleotide comprising a nucleic acid sequence at least 90% identical to the nucleic acid sequence detailed in SEQ ID NO:1036. 6. El método de conformidad con cualquiera de las reivindicaciones 1 a 5, caracterizado porque el polipéptido se expresa a partir de un polinucleótido que comprende una secuencia de ácidos nucleicos al menos 90% idéntica a la secuencia de ácidos nucleicos detallada en SEQ ID NO:1036.
- 9The method according to any of claims 1 to 5, characterized in that the amino acid sequence is at least 90% identical to the polypeptide detailed in SEQ ID NO:194. 9. El método de conformidad con cualquiera de las reivindicaciones 1 a 5, caracterizado porque la secuencia de aminoácidos es al menos 90% idéntica al polipéptido detallado en SEQ ID NO:194.
- 10The method according to any of claims 1 to 5, characterized in that the amino acid sequence is at least 95% identical to the polypeptide detailed in SEQ ID NO:194. 10. El método de conformidad con cualquiera de las reivindicaciones 1 a 5, caracterizado porque la secuencia de aminoácidos es al menos 95% idéntica al polipéptido detallado en SEQ ID NO:194.
- 11El método de conformidad con cualquiera de las reivindicaciones 1 a 5, caracterizado porque la secuencia eleven. The method according to any of claims 1 to 5, characterized in that the sequence 156 156 IMPI IMPI INSTITVTO MtXICANO amino acids is selected from the group INSTITVTO MtXICANO de aminoácidos se selecciona del grupo SEQ ID NOS:194 and 796 SEQ ID NOS:194 y 796
- 14The method according to any of claims 6 to 8, characterized in that the polynucleotide is comprised in a nucleic acid construct comprising a promoter to direct transcription of the nucleic acid sequence in a plant cell. 14. El método de conformidad con cualquiera de las reivindicaciones 6 a 8, caracterizado porque el polinucléotido está comprendido en un constructo de ácidos nucleicos que comprende un promotor para dirigir la transcripción de la secuencia de ácidos nucleicos en una célula vegetal.
- 20El método de twenty. The method of 5 Claims 1 to 18, dicot plant. 5 reivindicaciones 1 a 18, planta dicotiledónea. caracterizado porque la planta es una · jUUHil II— IO. characterized in that the plant is a · jUUHil II— IO. conformidad con cualquiera de las caracterizado porque la planta es una conformity with any of those characterized because the plant is a 158 158
Independent claims11
2,604 paragraphs in 92 sections, as filed
(54) Title: POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS TO INCREASE THE OIL CONTENT, THE GROWTH SPEED AND BIOMASS OF PLANTS.
(54) Title: POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS FOR INCREASING OIL CONTENT, GROWTH RATE AND BIOMASS OF PLANTS.
(57) Summary
The present invention relates to a method of increasing the oil content, growth rate, biomass, yield and / or vigor of a plant. The methods are carried out by upregulating in the plant, an expression level of a polypeptide that comprises an amino acid sequence at least 90% homologous to the amino acid sequence selected from the group consisting of NRs SEQ ID: 199, 166-198, 200 -221, 229-307, 311-330, 351-353, 355-361, 363-364, 366-368, 218, 222-228, 308-310, 350, 354, 362, 365, 523-649, 786 -920, 1047 and 1048. Also provided are polynucleotides, nucleic acid constructs, polypeptides, and transgenic plants expressing the same, which can be used to increase the oil content, growth rate, biomass, yield and / or vigor of a plant and to produce oil.
(57) Abstract
Provided are method of increasing oil content, growth rate, biomass, yield and / or vigor of a plant. The methods are effected by upregulating in the plant an expression level of a polypeptide comprising an amino acid sequence at least 90% homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs: 199, 166-198, 200-221, 229-307, 311-330, 351-353, 355-361,363-364, 366-368, 218, 222-228, 308-310, 350, 354, 362, 365, 523-649, 786-920, 1047 and 1048. Also provided are polynucleotides, nucleic acid constructs, polypeptides and transgenic plants expressing same which can be used to increase oil content, growth rate, biomass, yield and / or vigor of a plant and produce oil.
IMPI
PATENT TITLE No. 355608
Headlines):
Home:
EVOGENE LTD.
Gad Finstein Street, 76121, Rechovot, ISRAEL
Denomination: POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS TO INCREASE THE OIL CONTENT, THE GROWTH SPEED AND BIOMASS OF PLANTS.
Classification:
CIP: C12N15 / 82; A01H5 / 10; C07K14 / 415¿ C12N15 / 63
CPC: C12N15 / 82; C07K14 / 415; C12N15 / 8¿47, C12N.15 / 8261
Inventor (s):
EYAL EMMANUEL; GIL RONEN ^ OASAVR „
Numbers
MX / a / 2016/006396
<img file="MX355608B_D0001.tif" />
Yes·
RMF * · ^ ihw ^^ WftdlHntórBacional:
Divisional daWb ^ Í ^ t ^ M ^^ '^ 4 ^ 4
- pdé'aM ¢ ^ 2007-
<img file="MX355608B_D0002.tif" />
Number:
60 / 907,568 i '·'. i '
Country:
US
Validity: Twenty years
Expiration Date: April 9, 2028 Issue Date: April 24, cfe 2018.j. The patent of reference ^ bÉ ^ rga based on the articles ^ Llos / l
Λ-, li “'··. · RuK
2 »Mfction and, 5SWe the te) of the PTofAifllM
Industrial.
In accordance with artiljjo7flJ | from the filing date of xs pateMeMg0Bne.de veln ijete f pag <^> tferaM | uÍL {nM (Bner vlgert
Whoever subscribes to the present title is based on the dl ^^ uestapeLtoortlJuldfe 6 ° fracpAo * · III and 7 ° bis 2 (Je the Industrial Property Law (Official Gazette of the Federation ®CR) 27 / 0efi991, refprmájla Í2 ® »1994, 2β / 10 # 9Μ 26/12 / | ί9Τ. '» 17Λ5 / 1999, 01/26/2004, 06/16/2005, 01/25/2006, 06/05/2009 / 06.06 / 01 / 2010, 1 ^ 6/2 ^ 0, ^ 6 / 06Z2Ot.O; i7 / ®2012 * 0 ^ M / 2012ÍartjsuM<sup>or</sup>, 3Μτ «^ ώωφφ6 a), 4 ° and 12» fractions I and III of the Regulations of the Mexican Institute átela-, Px ^ iéflad hadMttnal '(BAJEL 14 «Xl909.» (Jlormadoel Ol / (57/2602, .lSrfZ<sup>!</sup>2OO4, 07/28/2004 and 09/07/2007); articles 1 », 3», 4º, 5º fraction V Clause a), ..- »Jraccion» i »l fclll and 30 cteR? eMltWtf<sup>,</sup>'6rganip®tlSUBStituí & MwtfelSno of Industrial Property (DOF 12/27/1999, amended on 10/10/2002, 07/29/26θ.4>'<sup>!</sup>64 / & 8 / 2β64γ) 4 ^ / (| 9 / 200Ι7); p% ^^^^^^ a ^^ FAc ^ drdo who delegates powers to the Deputy Directors General, Coordinator, Directors' tfvjatawfc », pinar» »íefa» », OT ^^ # e§fcrig | es, Divisional Deputy Directors, Departmental Coordinators and other subordinates of the Mexican Institute, ® laf · ^^ *
08/04/2004 and 09/13/2007).
I used it aex
<img file="MX355608B_D0003.tif" />
P ^ Bie ^ edJ ^ uetrial, añp ^ tfryiprorrogables, counted at dBrechos.
12/5/1999, amended on 02/04/2000, 07/29/2004,
This letter is signed with an advanced electronic signature (FIEL), based on articles 7 BIS 2 of the Industrial Property Law; 3rd of its Regulations, and 1 fraction III, 2 fraction V, 26 BIS and 26 TER of the Agreement establishing the guidelines for the use of the Electronic Payment and Services Portal (PASE) of the Mexican Institute of Industrial Property, in the procedures indicated.
THE DIVISIONAL DIRECTOR OF PATENTS
<img file="MX355608B_D0004.tif" />
NAHANNY CANAL REYES
Original string:
NAHANNY MARISOL CANAL REYES | 00001000000403252793 | Administration Service
Trlbutarla | 1695 (| MX / 2018/34329 | MX / a / 2016/006396 | Normal patent title with divisional PCT | 1220 | RRGO | Page (s) 1 | 59fJY4IJt3Wk0mpc87Dn09erEK8 =
Digital stamp:
JprZ7HrjwkgACpFHs5IVNPY5→8Up3l4SqREzlPKHBZjfNat4Y3 / 0n2qPlnx + KfQpK05V + okCBIbd6CoeOLy6YHdl
NIMjThe14JCrGr1FFZ4H2 / BZA0ddTYaL3vXGQhzn0dnm + TMbQeKUS34dHRpzHwNe + KqFHAHRqdDtHf7YqhcFqZhUfQ
T5eulSI5ZD / WUYklUUuKSrmjAycnXTqCpSUBX1jtCw3FkeBglVRkobFRGLsAwpFFBCh5 + 6b3W8bOR6q8uN3oCvOz4a
7Y3VL / cYYnfA927JwZBkn2SXWbscQmylOdB0hQ5BwM4dz7kcJQU0buyVve / H3g + j49DYsJtw ==
Arenal No, 550. Floor 1, Pueblo Santa María Tepepan. Xochlmiico. 16020. Mexico City.
(55) 53340700 www.gob. mx / impi
<img file="MX355608B_D0005.tif" />
MX / 2018/34329
20/
<img file="MX355608B_D0006.tif" />
POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS FOR
<img file="MX355608B_D0007.tif" />
OIL CONTENT, GROWTH SPEED AND ΒΪΟΪΰ ^ Α
THE PLANTS
FIELD AND BACKGROUND OF THE INVENTION
The present invention, in some of its embodiments, relates to polypeptides, polynucleotides that encode the same, transgenic plants that express them and methods to produce and use them and, more particularly, but not exclusively, to methods to increase the oil content, seed yield, growth rate, biomass and / or yield of a plant.
Vegetable or seed oils are the main source of energy and nutrition in the human and animal diet. They are also used for the production of industrial products, such as paints, inks, and lubricants. Furthermore, vegetable oils represent renewable sources of long-chain hydrocarbons that can be used as fuel. Since the normally used fossil fuels come from non-permanent sources that are gradually being depleted, they can be used as alternative fuels or raw materials for energy for rapidly growing biomass crops that can also reduce dependence on fossil energy supplies. However, the main bottleneck to increase the consumption of vegetable oils as bio-fuel is the price of oil, which is still higher than that of
IMPIOS
INSTITUTO .MSXICAW fossil fuel [Hypertext Transfer Protocol: // Woíl ^^ i ^^ (dot) eia (dot) gov / oiaf / analysispaper / biodiesel /;
Protocol: // World Wide Web doe
Ígüíl.tQ ±
Hypertext Transfer (dot) njbiz (dot) com / weekly_article.asp? AID = 19755147 (dot) 6122555 (dot) 957931 (dot) 7393254 (dot) 4337383 (dot)
561 & alD2 = 73678]. Furthermore, the speed of production of vegetable oil is limited by the availability of agricultural land and water. In this way, by increasing the yields of vegetable oil from the same growing area, the shortage of production space can be effectively resolved and, at the same time, the prices of vegetable oil can be reduced.
Studies aimed at increasing vegetable oil yields point to the identification of genes involved in oil metabolism as well as genes capable of increasing the yields of plants and seeds of transgenic plants.
Genes known to be involved in increasing vegetable oil yields include those that are involved in fatty acid synthesis or that are sequestrants such as desaturase [eg,
DELTA6, DELTA12 or acyl-ACP (Ssi2; Arabidopsis Information
Resource (TAIR; Hypertext Transfer Protocol ·: // World Wide Web (dot) arabidopsis (dot) org /), TAIR No. AT2G43710)],
OleosinA (TAIR No. AT3G01570) or FAD3 (TAIR No. AT2G29980), and
<img file="MX355608B_D0008.tif" />
various transcription factors and example acti, Lecl [TAIR No. AT1G21970, Lotan et al. 1998. oéil
26; 93 (7): 1195-205], Lec2 [TAIR No. AT1G28300, Santos Mendoza et al. 2005, FEBS Lett. 579 (21): 4666-70], Fus3 (TAIR No.
AT3G26790), ABI3 [TAIR No. AT3G24650, Lara et al. 2003. J
Biol Chem. 278 (23): 21003-11] and Wril [TAIR No. AT3G54320,
Cernac and Benning, 2004. Plant J. 40 (4): 575-85].
Zabrouskov V., et al., 2002 (Physiol Plant. 116: 172-185) demonstrated that upregulation of the endoplasmic reticulum (FAD3) and plastid fatty acid desaturases (FAD7) in potatoes increase the total lipid fraction in transgenic clones.
Wang HW et al., 2007 (Plant J. 52: 716-29. Epub 2007 Sep
18) discovered that the seeds of transgenic plants that overexpress the transcription factors GmDof4 and GmDofll, exhibit an increased content of fatty acids and total lipids.
Vigeolas H, and colab. [Plant Biotechnol J. 2007, 5 (3): 43141] and US Patent Application No. 20060168684 describe an increased seed oil content in rapeseed (Brassica napus L.) by overexpression of a glycerol-3 yeast -phosphate dehydrogenase under the control of a specific seed promoter.
Katavic V, et al., 2000 (Biochem Soc Trans. 28: 935-7) describe the use of FAE1 and yeast SLC1-1 genes to
IMPI
<img file="MX355608B_D0009.tif" />
. ,,. . INSTITUTO MÉXICANU., Produce improvements in the erucic acid and content of the rapeseed.
US Patent Application No. 20080076179 describes a moss nucleic acid encoding a lipid metabolism protein (LMP) and transgenic plants that express it with increased lipid levels.
US Patent Application No. 20060206961 describes a method of increasing the oil content in plants (eg, in plant seeds), by expressing the Yprl40w polypeptide in the plant.
US Patent Application No. 20060174373 describes a method of increasing the oil content in plants by expressing a nucleic acid encoding a triacylglycerol protein (TAG) that enhances protein synthesis in the plant (TEP).
US Patent Applications Nos.
20070169219, 20070006345, 20070006346 and 20060195943, describe transgenic plants with an improved efficiency in the use of nitrogen that can be used for conversion into fuel or chemical forages.
SUMMARY OF THE INVENTION
In accordance with one aspect of some embodiments of the present invention, a method is provided for increasing the oil content, growth rate, biomass,
T? one'
INSTITUTO MEXICANO yield and / or vigor of a plant, comprising ^ f ^^^ uc ^^ ÉDí ^ 'within the plant, an exogenous polynucleotide that. r.rxdi, fi.ca ... xux .., —... polypeptide comprising an amino acid sequence at least 90% homologous to the amino acid sequence selected from the group consisting of NR SEQ ID: 199, 166-198, 200-221, 229-307,
311-330, 351-353, 355-361, 363-364, 366-368, 218, 222-228, 308310, 350, 354, 362, 365, 523-649, 786-920, 1047 and 1048, thus increasing the oil content, the growth rate, biomass, yield and / or vigor of the plant.
In accordance with one aspect of some embodiments of the present invention, there is provided a method for producing oil, comprising: (a) providing the plant in accordance with the method of the invention, and (b) extracting the oil from the plant;
thus producing the oil.
In accordance with one aspect of some embodiments of the present invention, an isolated polynucleotide is provided comprising a nucleic acid sequence at least 90% identical to SEQ ID NOs: 34, 1-33, 35-52, 54-56, 64 -165, 332334, 336-342, 344-345, 347-349, 53, 57-63, 143-145, 331, 335,
343, 346, 369-522, 650-785, 1016-1046.
In accordance with one aspect of some embodiments of the present invention, a nucleic acid construct is provided, comprising the isolated polynucleotide of the invention and a promoter to direct transcription of the nucleic acid sequence.
IMPI
<img file="MX355608B_D0010.tif" />
In accordance with one aspect of some industrial area of the present invention, an isolated polypeptide is provided, comprising an amino acid sequence, at least 90% homologated to SEQ ID NOs: 199, 166-198, 200-221, 229-307, 311-330, 351353, 355-361, 363-364, 366-368, 218, 222-228, 308-310, 350,
354, 362, 365, 523-649, 786-920, 1047 and 1048.
In accordance with one aspect of some embodiments of the present invention, a plant cell is provided that exogenously expresses the polypeptide of the invention.
In accordance with one aspect of some embodiments of the present invention, a plant cell is provided that exogenously expresses the polynucleotide of the invention.
According to some embodiments of the invention, the polynucleotide comprises a nucleic acid sequence selected from the group consisting of NR SEQ ID: 34, 1-33, 3552, 54-56, 64-165, 332-334, 336-342 , 344-345, 347-349, 53, 5763, 143-145, 331, 335, 343, 346, 369-522, 650-785, 1016-1046.
In accordance with some embodiments of the invention, the amino acid sequence is selected from the group consisting of SEQ ID NOs: 199, 166-198, 200-221, 229-307, 3'll-330, 351-353,
355-361, 363-364, 366-368, 218, 222-228, 308-310, 350, 354,
362, 365, 523-649, 786-920, 1047 and 1048.
According to some embodiments of<sup>L</sup> the invention, the polynucleotide is selected from the group consisting of SEQ ID
NOs: 34, 1-33, 35-52, 54-56, 64-165, 332-334, 336-342, 344-345,
347-349, 53, 57-63, 143-145,
331, 335,
343
I wenMWMRfm
<img file="MX355608B_D0011.tif" />
785, 1016-1046.
In accordance with some embodiments of the invention, the polypeptide is selected from the group consisting of SEQ ID NOs:
199, 166-198, 200-221, 229-307, 311-330, 351-353, 355-361, 363364, 366-368, 218, 222-228, 308-310, 350, 354, 362, 365, 523649, 786-920, 1047 and 1048.
<td>Of</td><td>agreement</td><td>with</td><td>some</td><td>realizations</td><td>of</td><td>the</td><td>invention,</td><td>the</td>
<td>oil</td><td>understands</td><td colspan="3">seed oil.</td><td></td><td></td><td></td><td></td>
<td>Of</td><td>agreement</td><td>with</td><td>some</td><td>realizations</td><td>of</td><td>the</td><td>invention,</td><td>the</td>
<td>oil</td><td>understands</td><td>a</td><td>oil of</td><td colspan="3">vegetative portion.</td><td></td><td></td>
<td>Of</td><td>agreement</td><td>with</td><td>some</td><td>realizations</td><td>of</td><td>the</td><td>invention,</td><td>the</td>
plant cell forms a part of a plant.
Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning generally understood by the person skilled in the art to which the invention belongs. Although methods and materials similar or equivalent to those described herein may be used in the practice or testing of embodiments of the invention, exemplary materials and / or methods are described below. In case of conflict, the patent specification, including the definitions, predominates. Furthermore, the materials, methods and examples are illustrative only and are not intended to be necessarily limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
Τ '
Here some rs embodiments are described
P fa<sup>TO</sup> • Other property properties
<img file="MX355608B_D0012.tif" />
by way of example only, with reference to the accompanying drawings. Referring now specifically to the drawings, it is emphasized that the details shown therein are examples intended to provide an illustrative description of the embodiments of the invention. In this regard, the description in conjunction with the drawings makes it apparent to those skilled in the art how to practice the embodiments of the invention.
In the drawings:
FIGs. la-d are digital images of sheets illustrating sheet length (Figure la, sheet length is represented by arrow), sheet length (Figure Ib, sheet length is represented by arrow), sheet area (Figure 1c, the laminar area is represented by the white ellipse) and laminar width (Figure Id, the laminar width is represented by the arrow). The circularity of the blade was calculated as sheet width divided by sheet length.
FIGs. 2a-b are images illustrating the root development of plants grown on transparent agar plates.
The different ecotypes were cultivated on transparent agar plates for 17 days and the plates were photographed every day starting on the seventh. Figure 2a shows an exemplary image (taken after 12 days on the plates of
V τ, r -.of / · '' ·>.
I / Vf j> · j .C j ». A »- vA ·· '- ^ ¿t,,. ,, -,,,. ,. z INSTITUTOrMKXICANt · tLf'-v * ·. · -? bit agar). The length of the measured root is represented by? ^ Rk ^ A<sub>£</sub>S ^ / red arrow (Figure 2b).
FIG. 3 is an image showing iodine vapor staining of lipids isolated from transgenic plants expressing the genes listed in Table 56, Example 7 of section
Examples that follows. The arrow points to the triacil gjicerol bands.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS OF THE INVENTION
The present invention, in some of its embodiments, refers to isolated polypeptides and polynucleotides that encode them, and more particularly, but not exclusively, to methods of using them to increase oil content, growth rate, yield , biomass and / or vigor of a plant.
Before explaining in detail, at least one embodiment of the invention, it should be understood that the invention is not necessarily limited in its application to the details expressed in the following description or exemplified in the
Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
In putting the present invention into practice, the present inventors have identified novel polypeptides and polynucleotides that can be used to increase the oil content, seed yield, growth rate, biomass, yield and / or vigor of a plant.
In this way, as illustrated in section
<img file="MX355608B_D0013.tif" />
PE Ι.Λ PRílNEPAC INDUSTRIAL continues, the present inventors have used a bioinformatic method that compares the expression pattern of Arabidopsis-derived genes in 79 tissues or stages of development with that of Oil Hook (OHGs) genes. ) known to have a role in embryogenesis, seed development, and oil synthesis and accumulation, and genes that exhibit significant correlation were identified (Table 1, Example 1). Furthermore, using an oligonucleotide microarray, the present inventors determined the expression profile of the identified genes in tissues and stages of development of various Arabidopsis ecotypes (Table
3; Example 2) and correlated the expression profile with selected parameters related to performance or vigor (Tables 4, 5 and 6; Example 2). Genes that exhibit a significant correlation between the expression profile and the performance or vigor parameters of the ecotypes were identified (Table 7; Example 2). Among them, several genes were found to modulate in seed yield (Table 8), oil yield (Table 9), growth rate (Table 10), shape / size / length of the organ (Table 11), harvest index (Table 12), oil content per seed (Table
13), vegetable dry matter (Table 14) · and quantity of seeds per silicone (Table 15). Additional genes that are expected to increase oil content, yield of
IMPÍp ^ seed, growth rate, yield s' DE LA FROPlrl'AL
INDUSTRIAL --- · * a plant using bioinformatic tools (Table 2, Example 1). In addition, polypeptides and polynucleotides encoding the same and homologous to the predicted polypeptides of Tables 1 and 2 (Table 18, Example 5) were also identified. Furthermore, as described in Examples 3, 4, and 6 of the Examples section that follows, transgenic plants expressing the identified polynucleotides exhibit seed yield, oil yield, dry matter, harvest rate, growth rate, rosette area, percentage of seed oil and weight of 1,000 seeds increased (Tables 19-55; Example 6). Furthermore, transgenic plants expressing polynucleotides of the invention exhibited an increased oil content compared to control plants (Figure 3, Example 7). Taken together, these results suggest the use of the novel polynucleotides and polypeptides of the invention to increase the oil content, yield (including seed yield), growth rate, biomass, and / or vigor of a plant.
It should be noted that, as the oil content is affected by the intrinsic production of oil or the mass / size of the tissue that produces oil per plant / per growth period, any gene that affects these aforementioned processes is contemplated in the explanations
1Μ λ jl
INSTITUTO MSXICANC fe • ^ hi'ríy
INSTITUTE .
FROM THE? R0FltL'AD
INDUSTRIAL of the present invention.
Thus, in accordance with one aspect of the invention, a method is provided for increasing the oil content, yield, growth rate, biomass and / or vigor of a plant. The method is performed by introducing into the plant, an exogenous polynucleotide that encodes a polypeptide that comprises an amino acid sequence at least 90% homologous to the amino acid sequence selected from the group consisting of the NRs
SEQ ID: 166-221, 229-307, 311-330, 351-353, 355-361, 363364, 366-368, 218, 222-228, 308-310, 350, 354, 362, 365, 523649, 786-920, 1047 and 1048.
The phrase oil content as used here refers to the amount of lipids in a given plant organ, either from the seeds (oil content in the seed) or the vegetative portion of the plant (oil content vegetative) and typically expressed as a percentage of dry weight (10% of seed moisture) or wet weight (for the vegetative portion).
As mentioned, in one embodiment, the increase in the oil content of the plant can be achieved by increasing the size / mass of plant tissue / s comprising oil per growth period. In this way, the increased oil content of a plant can be achieved by increasing the yield, growth rate, biomass, and vigor of the plant.
IMPIO // fJSTITDTu MEXICANA, refers to the quantity (determined in weight / size) or quantity (number) of tissue (for example, seed, referred to as seed yield and vegetative portion) produced per plant or per growing season. Therefore, the increased yield could affect the economic benefit that could be obtained from the plant in a certain growth area and / or growth time.
As used here, the phrase plant biomass refers to the amount (measured in grams of air-dried tissue) of tissue produced from the plant in a growing season, which could also determine or affect the yield of the plant. plant or yield per growing area.
As used here, the phrase plant vigor refers to the amount (measured by weight) of tissue produced by the plant at a given time. Therefore, the increase in vigor could determine or affect the plant yield or yield · by growth time or growth area.
<td>How</td><td>I know</td><td>uses</td><td>here,</td><td>the term increase</td><td>I know</td><td>refers</td><td>to to</td>
<td colspan="4">minus about 2%,</td><td colspan="2">at least around the</td><td>3% at</td><td>less</td>
<td>around</td><td>of the</td><td> 4</td><td>% al</td><td>less around the</td><td> 5</td><td>% al</td><td>less</td>
<td>around</td><td>of the</td><td> 10</td><td>% al</td><td>less around the</td><td> 15</td><td>% al</td><td>less</td>
<td>around</td><td>of the</td><td> 20</td><td>% al</td><td>less around the</td><td> 30</td><td>% al</td><td>less</td>
<td>around</td><td>of the</td><td> 40</td><td>% al</td><td>less around the</td><td> 50</td><td>% al</td><td>less</td>
UNCLE around 60%, at least around 70
DF. lAWWDAC
ΙΝΓ) <1.Τ »Ι * Ι. * · _-About 80%, increase in oil content in the plant, seed yield (seed yield per plant and / or seed yield per growth area), plant yield, speed of growth, biomass and / or vigor compared to a natural plant [ie, a plant not modified with the biomolecules (polynucleotide or polypeptides) of the invention, for example, an untransformed plant of the same species, that developed under the same growing conditions].
As used herein, the phrase "exogenous polynucleotide" refers to a heterologous nucleic acid sequence that may not be naturally expressed within the plant or whose overexpression in the plant is desired. The exogenous polynucleotide can be introduced into the plant stably or transiently, so as to produce a ribonucleic acid (RNA) molecule and / or a polypeptide molecule. It should be noted that the exogenous polynucleotide can comprise a nucleic acid sequence that is identical or partially homologous to a plant endogenous nucleic acid sequence.
In accordance with some embodiments of the invention, the exogenous polynucleotide encodes a polypeptide comprising an amino acid sequence of at least about 60%, at least about 65%, at least about. 70
Ci.
'Or r at least
<img file="MX355608B_D0014.tif" />
jL at least around SíGnnere <sup>K</sup> WJ '/ TOM · about 75
<td>around</td><td>of the</td><td> 81</td><td>OR, ° f</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 82</td><td>or ° r</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 83</td><td> % <sub>r</sub></td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 84</td><td>or O f</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 85</td><td>or,<sup>0</sup> F</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 86</td><td>or, ° r</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 87</td><td>or<sup>0</sup> r</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 88</td><td>or. ° r</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 89</td><td>or. ° r</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 90</td><td>0 ° r</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 91</td><td>or. 0 t</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 92</td><td>or or</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 93</td><td>or 0 t</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 94</td><td>or. ° t</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 95</td><td>or<sup>0</sup> r</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 96</td><td>or or</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 97</td><td>or ° r</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 98</td><td>or 0 z</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 99</td><td>0, ° r</td><td>or</td><td colspan="2">more, that is,</td><td> 100 %</td><td colspan="3">homologous</td><td>to</td>
<td>sequence</td><td colspan="3">amino acid</td><td colspan="8">selected from the group formed by the SEQ</td>
<td colspan="2">ID NOs: 166-221</td><td colspan="2"> , 229-</td><td> 307</td><td colspan="4"> , 311-330, 351-353, 355-</td><td> 361,</td><td> 363</td><td> -364,</td>
<td> 366-368,</td><td> 218,</td><td> 222</td><td colspan="2"> -228,</td><td> 308-310,</td><td> 350, 354</td><td> , 3 62</td><td>t</td><td> 365,</td><td> 523</td><td> -649,</td>
786-920, 1047 and 1048.
Homology (eg, percent homology) can be determined using any homology comparison software including, for example, BlastP or
TBLASTN from National Center of Biotechnology Information (NCBI) for example, using default parameters when starting with a polypeptide sequence; or the tBLASTX algorithm (available from NCBI) for example, using default parameters, which compares the conceptual translation products of six frames of a nucleotide query sequence (both strands) against
,,,, Ϊ́Ννηπιτη MLXICANO a protein sequence databases. oflai *> pity.<sup>r</sup> INDUSTRIAL
<img file="MX355608B_D0015.tif" />
Homologous sequences include both orthologous and parologous sequences. The term paralogue refers to gene duplications within the genome of a species that lead to paralog genes. The term ortholog refers to homologous genes in different organisms due to an ancestral relationship.
One option to identify orthologs in a monocotyledonous plant species is to perform a reciprocal blast search. This can be done using a first blast search (lookup for similarities in a database) that includes comparing the sequence of interest with any sequence database, such as the public database available by NCBI which can be found at: Hypertext
Transfer Protocol: // World Wide Web (dot) nebí (dot) nlm (dot) nih (dot) gov. If orthologs were searched for in rice, the sequence of interest would be blast screened against eg the 28,469 full-length cDNA clones of
Oryza sativa Nipponbare available from NCBI. Blast search results can be filtered. Full length sequences of both filtered and unfiltered results are resubmitted to another blast search (second blast) against the sequences of the organism from which the sequence of interest is derived. The results of the first and second blast searches are then compared. An ortholog is identified when the resulting highest-scoring sequence on the first blast search identifies
<img file="MX355608B_D0016.tif" />
in the second blast the sequence asks (query) (sequence of original interest) as the best hit. Using the same logic, a paralog is found (homologous of a gene in the same organism). For large sequence families, the ClustalW program [Hypertext Transfer
Protocol: // World Wide Web (dot) ebi (dot) ac (dot) uk / Tools / clustalw2 / index (dot) html], followed by a neighbor tree that is assembled (Hypertext Transfer Protocol: // at (dot) wikipedia (dot org / wiki / Neighbor-joining) which helps visualize grouping.
In accordance with some embodiments of the invention, the exogenous polynucleotide encodes a polypeptide selected from the group consisting of SEQ ID NOs: 166-221, 229-30 ?, 311-330,
351-353, 355-361, 363-364, 366-368, 218, 222-228, 308-310, 350,
354, 362, 365, 523-649, 786-920, 1047 and 1048.
According to some embodiments of the invention the polynucleotide comprises a nucleic acid sequence that is
<td>at least</td><td colspan="2">around</td><td>of the</td><td> 60 %, ,</td><td>at least</td><td colspan="2">around</td><td>of the</td><td> 65</td><td>5, at</td>
<td colspan="2">least around</td><td>of the</td><td> 70 %</td><td colspan="4">, at least 'around 7</td><td> '5 %,</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 80 %</td><td>to</td><td>less</td><td>around</td><td>of the</td><td> 81</td><td>or z</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td>QO O. OR. '0</td><td>to</td><td>less</td><td>around</td><td>of the</td><td> 83</td><td>z</td><td>ai</td><td>less</td>
<td>around</td><td>of the</td><td> 84 %</td><td>to</td><td>less</td><td>about 1</td><td>of the</td><td> 85</td><td>z</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td>8 6 i</td><td>to</td><td>less</td><td>around</td><td>of the</td><td> 8 7</td><td>OR 0 z</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 88</td><td>or or</td><td>to the</td><td>less</td><td>around</td><td>of the</td>
<td>around</td><td>of the</td><td> 90</td><td>or, 0 r</td><td>to the</td><td>less</td><td>around</td><td>of the</td>
<td>around</td><td>of the</td><td> 92</td><td>or<sup>0</sup> r</td><td>to the</td><td>less</td><td>around</td><td>of the</td>
<td>around</td><td>of the</td><td> 93</td><td>or. ° r</td><td>to the</td><td>less</td><td>around</td><td>of the</td>
<td>around</td><td>of the</td><td> 95</td><td>or ° r</td><td>to the</td><td>less</td><td>around</td><td>of the</td>
<td>around</td><td>of the</td><td> 97</td><td>or, ° r</td><td>to the</td><td>less</td><td>around</td><td>of the</td>
IMPIOUS
OteSTITtfrO MEXICANO
INDUSTRIAL
<td>to the</td><td>less</td>
<td>to the</td><td>less</td>
<td>to the</td><td>less</td>
<td>to the</td><td>less</td>
<td>to the</td><td>less</td>
<td colspan="2">sequence</td>
<td>ace</td><td>SEQ ID</td>
NOs: 1-52, 54-56, 64-165, 332-334, 336-342, 344-345, 347-349,
53, 57-63, 143-145, 331, 335, 343, 346, 369-522, 650-785, 10161046.
Identity (eg, percent homology) can be determined using homology comparison software, including, for example, the BlastN software from the National Center of Biotechnology Information (NCBI) using, for example, the default parameters.
According to some embodiments of the invention the exogenous polynucleotide as determined by SEQ ID NOs: 1-52, 5456, 64-165, 332-334, 336-342, 344-345, 347-349, 53, 57-63, 143 145, 331, 335, 343, 346, 369-522, 650-785, 1016-1046.
As used herein, the term polynucleotide refers to a single or double-stranded nucleic acid sequence that is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence, and / or sequences of <sub>ΙΜ</sub>ρτ ^
<img file="MX355608B_D0017.tif" />
compound polynucleotides (for example, a comKW & WálcK
IND '.' STF.IAl.
above).
As used herein, the phrase "complementary polynucleotide sequence" refers to a sequence that results from reverse transcription of messenger RNA using a reverse transcriptase or any other RNA-dependent DNA polymerase. Said sequence can subsequently be amplified in vivo or in vitro using a DNA dependent DNA polymerase.
As used herein, the phrase "polynucleotide genomic sequence" refers to a sequence derived (isolated) from a chromosome, and therefore represents a contiguous portion of a chromosome.
As used herein, the phrase "polynucleotide composite sequence" refers to a sequence that is at least partially complementary and at least partially genomic.
A compound sequence can include some exonic sequences required to encode the polypeptide of the invention, as well as some intronic sequences that interpose each other. The intronic sequences can be from any source, including other genes, and will typically include conserved splice signal sequences. Said intronic sequences may, in addition, include regulatory elements of cis-acting expression.
The nucleic acid sequences encoding the polypeptides of the present expression. Non-invention, limiting examples
i. JL λ can
INDUSTRIAL optimized nucleic acid sequences are provided in SEQ ID NOs: 1040, 1041,
1042, 1043, 1044, 1045, and 1046 encoding polypeptides that comprise the amino acid sequences determined by NR ID DE
SEC: 167, 169, 1047, 181, 185, 189 and 196, respectively.
Examples of such sequence modifications include, but are not limited to, altered G / C content to come closer to that typically found in plant species of interest, and the codon removal atypically found in plant species, commonly referred to as codon optimization. .
The phrase "codon optimization" refers to the selection of suitable DNA nucleotides for use within a gene or structural fragment that includes the use of the codon within the plant of interest. Therefore, an optimized gene or nucleic acid sequence refers to a gene in which the nucleotide sequence of the native or natural gene has been modified to use statistically preferred or favorable codons within the plant.
Typically, the nucleotide sequence is examined at the DNA level and the coding region is optimized for expression in the given plant species using any suitable procedure, for example, that described in Sardana et al. (nineteen ninety six,
Plant Cell Reports 15: 677-681). In this method, the standard deviation of codon usage, a measure of codon usage bias, can be calculated by finding the quadratic proportional of prime utilization
<img file="MX355608B_D0018.tif" />
i i i
Dt LA PWJPJEI'M- 'sc
<img file="MX355608B_D0019.tif" />
native with respect to that of highly expressed genes in the plant, followed by the calculation of the mean square deviation. The formula used is: 1 SDCU = η = 1 N [(Xn - Yn) / Yn] 2 / N, where Xn refers to the frequency of use of codon n in highly expressed genes in the plant, Yn to the frequency of Codon utilization n in the gene of interest and N refers to the total number of codons in the gene of interest. A highly expressed gene codon utilization table from dicotyledonous plants was compiled using the data from Murray et al. (1989, Nuc Acids Res. 17: 477-498).
A method of optimizing the nucleic acid sequence according to the preferred codon usage for a particular plant cell type is based on the direct use, without performing any extra statistical calculations, of the codon optimization tables such as, those provided online in the Codon Utilization Database of the DNA bank of NIAS (National Institute of Agrobiological Sciences) of Japan (http://www.kazusa.or.jp/codon/). The Database of
Codon Utilization contains codon utilization tables for a number of different species, each codon utilization table has been statistically determined based on the data present in Genbank.
The codon of a natural nucleotide sequence can be optimized that encodes a protein of interest JfcalAI. Jsaí
í) H IA wir.iAL ·
ΙΜΓΛΗΤΓ.ΙΑΙ. ---- particular vegetable, using the above tables to determine the most preferred or favorite codons for each amino acid in a particular species (eg rice). This is done by replacing codons that may have a low statistical incidence in the genome of a particular species with corresponding codons, related to an amino acid, that are statistically more favorable. However, one or more less favorite codons can be selected to remove existing restriction sites to create potentially useful new splices (5 'and 3' ends to add signal peptide or termination cassettes, internal sites that could be used to cut and joining segments to produce a correct full-length sequence), or to remove nucleotide sequences that can negatively affect the stability or expression of mRNA.
The natural coding nucleotide sequence may already, before any modification, contain a number of codons that correspond to a statistically favored codon in a particular plant species. Therefore, optimization of codons of the natural nucleotide sequence, can comprise the determination of which codons, within the natural nucleotide sequence, are not statistically favored with respect to a particular plant, and modify these codons according to the table of use of codons of the particular plant to produce a
<img file="MX355608B_D0020.tif" />
Dt LA «ΟΜ» ΛΓ IMDUSTIUAi
<img file="MX355608B_D0021.tif" />
of the codon. A modified nucleotide sequence may be fully or partially optimized for the use of a plant codon provided that the protein encoded by the nucleotide sequence is produced at a higher level than the protein encoded by the corresponding native or natural gene. The construction of synthetic genes by altering codon utilization is described in, for example, the
PCT Patent Application 93/07278.
In accordance with some embodiments of the invention, expression of the polynucleotide of the invention results in downregulation of the level of expression and activity of the corresponding endogenous (eg, homologous) polypeptide.
In accordance with some embodiments of the invention, the exogenous polynucleotide is used for the co-suppression or sense suppression of an endogenous polypeptide. Thus, introduction of the exogenous polynucleotide into plant cells results in the transcription of an RNA molecule (in one sense relative to the corresponding endogenous gene) that suppresses translation of the corresponding endogenous RNA molecule, as described in US Patent No. 5,231,020 to Jorgensen, which is incorporated herein by reference in its entirety. For co-deletion, the exogenous polynucleotide does not require the complete nucleic acid sequence of the corresponding endogenous gene, nor does it require that the sequence
INSTITUTO -MEXICANO i »t THE WJflEDAU introduced is exactly identical to the embargo however, as with the antisense suppression, the<sup>Nl></sup> Suppressive efficiency is increased by increasing hybridization specificity, for example, when the introduced sequence is lengthened and / or the similarity between the introduced sequence and the endogenous gene is increased. For further details see US Patent Application No. 20050172364 which is incorporated herein in its entirety by reference.
In accordance with some embodiments of the invention, the exogenous polynucleotide comprises a non-translatable nucleic acid sequence, eg, a sequence comprising one or more premature stop codons, or nonsense mutations, such as, for example, those described in the Patent
U.S. No. 5,583,021.
Thus, the invention includes the isolated polynucleotides described above, fragments thereof, sequences hybridizable thereto, homologous sequences, sequences encoding similar polypeptides using different codons, altered sequences characterized by mutations such as deletion, insertion or replacement of one or more nucleotides, both natural and human-induced, in a random or directed manner.
As mentioned, the present inventors have revealed polypeptides that were not previously characterized.
Thus, the invention provides an isolated polypeptide
IMPÍ that has an amino acid sequence that is 70%, at least about 75%, at least about
<img file="MX355608B_D0022.tif" />
%, at least around 81%, at least around 82%, at least around 83%, at least around 84%, at least around 85%, at least around 86%, at least
<td>around</td><td>of the</td><td> 87</td><td>or ° t</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 88</td><td>or ° Z</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 89</td><td>or ° r</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 90</td><td>or<sup>0</sup> z</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 91</td><td>or<sup>0</sup> z</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 92</td><td>or ° Z</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 93</td><td>or z</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 93</td><td>c, ° Z</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 94</td><td>or or,</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 95</td><td>d. O r</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 96</td><td>or ° z</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 97</td><td>g. ° z</td><td>to the</td><td>less</td>
<td>around</td><td>of the</td><td> 98</td><td>or<sup>c</sup> z</td><td>to the</td><td>less</td><td>around</td><td>of the</td><td> 99</td><td>or. ° z</td><td colspan="2">or more is</td>
that is, 100% homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs: 166-221, 229-307, 311-330,
351-353, 355-361, 363-364, 366-368, 218, 222-228, 308-310, 350,
354, 362, 365, 523-649, 786-920, 1047 and 1048.
In accordance with some embodiments of the invention, an exogenous polypeptide selected from the group formed is provided.
<td>by</td><td>the NR ID</td><td>FROM SEC:</td><td> 166-221,</td><td> 229-307,</td><td> 311-330, 351-353,</td><td> 355-</td>
<td> 361,</td><td> 363-364,</td><td> 366-368</td><td> , 218,</td><td> 222-228,</td><td> 308-310, 350, 354,</td><td> 362,</td>
<td> 365,</td><td> 523-649,</td><td> 786-920,</td><td>1047 and</td><td> 1048 .</td><td></td><td></td>
<td></td><td colspan="2">The invention</td><td>too</td><td>It includes</td><td>fragments of</td><td>the</td>
polypeptides described above and polypeptides that have mutations, such as deletions, insertions or substitutions of one or more amino acids, both natural and
IMPI lítíhMíiioexde'P induced by man, randomly oi »ehMíto ^« tg¡g
INOOSTRIAL
The term plant as used herein includes whole plants, ancestors, and progeny of plants and parts of plants including seeds, shoots, stems, roots (including tubers), and plant cells, tissues, and organs. The plant can be of any shape including suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores. Plants that are particularly useful for the methods of the invention include all plants belonging to the superfamily.
Viridiplantae, in particular monocot and dicot plants including forage or forage legumes, ornamental plants, food crops, trees or shrubs selected from the list comprising Acacia spp. ,
Acer spp., Actinidia spp., Aesculus spp., Agathis australis,
Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africanae, Callia spp., Callia , Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chacoomeles spp., Cinnamomum cassia, Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneaster serótina, Crataegus spp., Cucumis spp., Cupressus spp., Cyathea dealbata, Cydonia oblonga, Cryptomeria japónica, Cymbopogon spp., Cynthea dealbata, Cydonia oblonga,
<img file="MX355608B_D0023.tif" />
SDD,
Monetary Dalbergia, Davallia divaricata, 15 ^^^ (5 ^^ 0
INOIISTRIAL
Dicksonia squarosa, Dibeteropogon amplectens_, Dioclea
Dolichos spp., Dorycnium rectum, Echinochloa pyramidalis,
Ehraffia spp., Eleus.ine coracana, Eragrestis spp., Erythrina spp., Eucalypfus spp., Euclea schimperi, Eulalia vi / losa,
Pagopyrum spp., Feijoa sellowlana, Fragaria spp., Flemingia spp, Freycinetia banksli, Geranium thunbergii, GinAgo biloba,
Glycine javanica, Gliricidia spp, Gossypium hirsutum, Grevillea spp., Guibourtia coieosperma, Iledysarum spp., Hemaffhia altissima, Heteropogon contoffus, Hordeum vulgare, Lepyria, Iruca, Heptaphenia, Hypeffhelia dissolute, Hypeffhelia .,
Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lotonus bainesli, Lotus spp., Macrotyloma axillare,<sup>:</sup>Málus spp., Manihot esculenta, Medicago saliva, Metasequoia glyptóstroboides, Musa sapientum, Nicotianum spp., Onobrychis spp., Ornithopus spp. ,
Cryza spp., Peltophorum africanum, Pennisetum spp., Persea gratissima, Petunia spp., Phaseolus spp., Phoenix canariensis, Phormium cockianum, Photinia spp., Picea glauca, Pinus spp.,
Fisum sativam, Podocarpus totara, Pogonarthria fleckii,
Pogonaffhria squarrosa, Populus spp., Prosopis cineraria,
Pseudotsuga menziesii, Pterolobium stellatum, Pyrus communis,
Quercus spp., Rhaphiolepsis umbeilata, Rhopaiostylis sapida,
Rhus natalensis, Ribes grossularia, Pibes spp., Robinia pseudoacacia, Rosa spp., Rubus spp., 3a] ix spp .., Schyzachyrium
IMPI
<img file="MX355608B_D0024.tif" />
sanguineum, Sciadopitys vef f icillata, Sequoiairn ™ ^^^ »£« ^ ii
INDUTnilAL
Sequoiadendron giganteum, Sorghum bicolor, Spinacia spp.,
Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Tadehagi spp, Taxodium distichum, Themeda triandra,
Trifolium spp., Triticum spp., Tsug.a heterophylla, Vaccinium spp., Vicia. spp., Vitis vinifera, Watsonia pyramidata,
Zantedeschia aethiopica, Zea mays, amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, cane, carrot, cauliflower, celery, collard, flax, kale, lentils, oilseed rape, okra, onion, potato, rice, poroto de soybean, straw, sugar beet, sugar cane, sunflower, tomato, pumpkin, corn, wheat, barley, rye, oat, peanut, pea, lentil and alfalfa, cotton, rapeseed, cane, pepper, sunflower, tobacco, eggplant , eucalyptus, a tree, an ornamental plant, perennial grass and forage crop.
Alternatively, algae and other non-Viridiplantae plants can be used for the methods of the present invention.
According to some embodiments of the invention, oil-producing plants can be seed crops to produce oil, soybeans, sunflower, Brassica napus, Brassica Júncea, corn zea, cotton, olive (Olea europaea), flax, Brassica nigra , Jatropha curcas, and castor bean (Ricinus communis).
The introduction of the exogenous polynucleotide of the invention into the plant can be carried out by transforming one or more
<img file="MX355608B_D0025.tif" />
plant cells with the exogenous polynucleotide,
I own the property;
INDUSTRIAL generation of a mature plant from transformed cells and cultivation of the mature plant under conditions suitable to express the exogenous polynucleotide within the mature plant.
According to some embodiments of the invention, the transformation is performed by introducing into the plant cell, a nucleic acid construct that includes the exogenous polynucleotide of some embodiments of the invention, and at least one promoter capable of directing transcription of the exogenous polynucleotide. in the plant cell. Hereinafter, more details of the appropriate transformation methods are provided.
As used herein, the term "promoter" refers to a region of DNA that is located upstream of the transcriptional initiation site of a gene to which RNA polymerase binds to initiate RNA transcription. The promoter controls where (for example, what portion of a plant) and / or when (for example, at what stage or condition in the life of an organism) the gene is expressed.
Any suitable promoter sequence can be used by the nucleic acid constructor of the present invention. In accordance with some embodiments of the invention, the promoter is a constitutive promoter, a tissue specific promoter, or developmental specific or
EMPIRE embryonic.
OF THE PROPERTY IfttM'TTRlAl
Suitable constitutive promoters include, for example,
<img file="MX355608B_D0026.tif" />
example, to the CaMV 35S promoter (SEQ ID NO: 921; Odell et al., Nature 313: 810-812, 1985); Arabidopsis promoter
At6669 (NR SEQ ID: 1015; see PCT Publication No.
W02004 / 104162); of maize Ubi 1 (Christensen et al., Plant Sol.
Biol. 18: 675-689, 1992); rice actin (McElroy et al.,
Plant Cell 2: 163-171, 1990); pEMU (Last et al., Theor. Appl.
Genet. 81: 581-588, 1991); CaMV 19S (Nilsson et al., Physiol.
Plant 100: 456-462, 1997); GOS2 (de Pater et al., Plant J
Nov; 2 (6): 837-44, 1992); rice cyclophilin (Bucholz et al.,
Plant Mol Biol. 25 (5): 837-43, 1994); histone H3 in corn (Lepetit et al., Mol. Gen. Genet. 231: 276-285, 1992); Actin (An et al., Plant J. 10 (1); 107-121, 1996) and synthetic Super MAS (Ni et al., The Plant Journal 7: 661-76, 1995).
Other constitutive promoters include those of the
US Patents N<sup>ros</sup> 5.659.026. 5.608.149; 5.608.144;
5,604,121; 5,569,597: 5,466,785; 5,399,680; 5,268,463; and
5.608.142.
Suitable tissue-specific promoters include, but are not limited to, preferred seed promoters (eg, seed-specific genes (Simon, et al., Plant Mol. Biol. 5. 191, 1985; Scofield, et al., J. Biol. Chem. 262: 12202, 1987; Baszczynski, et al., Plant Mol. Biol. 14: 633, 1990), Brazil nut albumin (Pearson 'et al.,
Plant Mol. Biol. 10: 203-214,
<img file="MX355608B_D0027.tif" />
(Takaiwa, et al., Mol. Gen. Genet. 208: 15-22, 1986; Takaiwa, et al., FEBS Letts. 221: 43-47, 1987), Zeína (Matzke et al.
Plant Mol Biol, 143: 323-32 1990), napA (Stalberg, et al.,
Plant 199: 515-519, 1996), SPA wheat (Albanietal, Plant Cell,
9: 171-184, 1997), oleosin in sunflower (Cummins, et al.,
Plant Mol. Biol. 19: 873-876, 1992)], leaf specific promoters [as described, for example, in Yamamoto et al., Plant J. 12: 255-265, 1997; Kwon et al., Plant Physiol.
105: 357-67, 1994; Yamamoto et al., Plant Cell Physiol.
35: 773-778, 1994; Gotor et al., Plant J. 3: 509-18, 1393;
Orozco et al., Plant Mol. Biol. 23: 1129-1138, 1993; and
Matsuoka et al., Proc. Nati. Acad. Sci. USA 90: 9586-9590,
1993], endosperm-specific promoters [eg wheat
LMW and HMW, glutenin-1 (Mol Gen Genet 216: 81-90, 1989; NAR
17: 461-2), gliadins a, b and g of wheat (EMBO3: 1409-15, 1984), ltrl promoter in barley, Bl, C, D hordein in barley (Theor
Appl Gen 98: 1253-62, 1999; PlanL J 4: 343-55, 1993; Mol Gen
Genet 250: 750- 60, 1996), DOF in barley (Mena et al., The
Plant Journal, 116 (1): 53-62, 1998), Biz2 (EP99106056.7), cmtétioo promoter (Vicente-Carbajosa et al., Plant J. 13:
629-640, 1998), rice prolamin NRP33, rice Glb-1 globulin (Wu et al., Plant Cell Physiology 39 (8) 885-889,
1998), rice alpha-globulin REB / OHP-1 (Nakase et al. Plant
ADP-glucose PP *
INDI IRTKIAl
Mol. Biol. 33: 513-S22, 1997),
Res 6: 157-68, 1997), gene family in the ESR region of maize (Plant J 12: 235-46, 199 '/), sorghum gamma-kafirin (PMB
32: 1029-35, 1996)], embryo-specific promoters [eg, rice OSH1 (Sato et al., Proc. Nati. Acad. Sci.
USA, 93: 8117-8122), KNOX (Postma-Haarsma et al., Plant Mol.
Biol. 39: 257-71, 1999), rice oleosin (Wu et al., J.
Biochem., 123: 386, 1998)], and flower specific promoters [eg, ALPRP4, sinLase (chsA) (Van der Meer, et al.,
Plant Mol. Biol. 15, 95-109, 1990), LAT52 (Twell et al., Mol.
Gen Genet. 217: 240-245; 1989), apétala- 3].
The nucleic acid construct of some embodiments of the invention may further include a suitable selectable marker and / or an origin of replication. In accordance with some embodiments of the invention, the nucleic acid construct is used in a transporter vector that can both propagate in E. coli (where the construct comprises a suitable selectable marker and a suitable origin of replication) and is compatible with propagation. in cells. The construct according to the present invention can be, for example, a plasmid, a bacmid, a phagemid, a cosmic, a phage, a virus or an artificial chromosome.
The nucleic acid construct of some embodiments of the invention can be used stably or transform vt-qetules cells. In the
P¿i ra
<img file="MX355608B_D0028.tif" />
stable transformation, the polynucleotide ex © m & S & £ S i '
INDUSTRIAL
IMPI
INDUSTRIAL within the plant genome and as such represents a stable and inherited characteristic. In transient transformation, the exogenous polynucleotide is expressed by the transformed cell but does not integrate within the genome and, as such, represents a transient characteristic.
There are several methods for introducing foreign genes into monocot and dicot plants (Potrykus, I., / Annu.
Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42: 205-225;
Shimamoto et al., Nature (1989) 338: 274-276).
Methods to produce the stable integration of exogenous DNA into plant genomic DNA include two main methods:
(i) Agrobacterium-mediated gene transfer: Klee et al. (1987) Annu. Rev. Plant Physiol. 38: 467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants,
Vol. 6, Molecular Biology of Plant Nuclear Genes, eds.
Schell, J., and Vasil, LK, Academic Publishers, San Diego,
Calif. (1989) pages 2-25; Gatenby, in Plant Biotechnology, eds. Kung, S. and Arntzen, CJ, Butterworth Publishers,
Boston, Mass. (1989) pages 93-112.
(ii) Direct DNA uptake: Paszkowski et al., in
Cell Culture and Somatic Cell Genetics of Plants, Vol. 6,
Molecular Biology of Plant Nuclear Genes eds. Schell, J., and
Vasil, LK, Academic Publishers, San Diego, Calif. (1989)
Ρ ί;
-LJ «pages 52-68; including the direct DNA inwstry methods in protoplasts, Toriyama, K. and colab. (1988)
Bio / Technology 6: 1072-1074. DNA uptake induced by electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988) 7: 379-384. Fromm and collaborated. Nature (1986)
319: 791-793. Injection of DNA into plant cells or tissues by particle bombardment, Klein et al. Bio / Technology (1988) 6: 559-563; McCabe and collaborated. Bio / Technology (1988) 6: 923926; Sanford, Physiol. Plant. (1990) 79: 206-209; through the use of micropipette systems: Neuhaus et al., Theor.
Appl. Genet. (1987) 75: 30-36; Neuhaus and Spangenberg,
Physiol. Plant. (1990) 79: 213-217; transformation with glass fibers and silicon carbide filaments of cell cultures, embryos or callus tissue, US Patent
No. 5,464,765 or by direct incubation of DNA with germinating pollen, DeWet and colab. at Experimental Manipulation of
Ovule Tissue, eds. Chapman, GP and Mantell, SH and
Daniels, W. Longman, London, (1985) pages 197-209; and ohta
Proc. Nati. Acad. Sci. USA (1986) 83: 715-719.
The Agrobacterium-mediated system includes the use of plasmid vectors containing defined DNA segments that are integrated into the genomic DNA of the plant. Plant tissue inoculation methods vary depending on the plant species and the Agrobacterium distribution system. A widely used method is the procedure with
<img file="MX355608B_D0029.tif" />
IMPI sheets, which can be done with any
INDUSTRIAL that provides a good source for initiating the differentiation of the complete plant. See for example
Horsch and collab. at Plant Molecular Biology Manual A5, Kluwer
Academic Publishers, Dordrecht (1988) pages 1-9. A supplementary method uses the distribution system of
Agrobacterium combined with vacuum infiltration. The Agrobacterium system is especially useful for creating transgenic dicot plants.
There are several methods of direct DNA transfer in plant cells. In electroporation, the protoplasts are briefly exposed to a strong electric field. In microinjection, DNA is mechanically injected directly into cells using micropipettes. In microparticle bombardment, DNA is adsorbed onto microprojectiles such as magnesium sulfate crystals or tungsten particles, and microprojectiles are physically accelerated within plant cells or tissues.
After stable transformation, plant propagation occurs. The most common method of propagation is by seed. However, the disadvantage of regeneration by seed propagation is the lack of uniformity in cultivation due to heterozygosity, since seeds are produced by plants according to genetic variants governed by Mendelian rules. In other words, each seed is genetically different and each Nsroroe ^^^ r 'INDUSTRIAL
IMPI “SÍSSlSW
INDUSTRIAL with its own specific characteristics. Therefore, it
<img file="MX355608B_D0030.tif" />
it prefers that the regeneration be carried out so that the regenerated plant has identical characteristics to those of the parental transgenic plant. Therefore, the preferred method of regenerating a transformed plant is by micropropagation that provides rapid, consistent reproduction of the transformed plants.
Micropropagation is a process for developing second generation plants from a simple tissue sample excised from a selected parent plant or culture. This process allows the mass reproduction of plants that have the preferred tissue and express a fusion protein.
The newly generated plants are genetically identical to, and have all the characteristics of the original plant. Micropropagation allows the mass production of quality plant material in a short period of time and offers a rapid multiplication of selected crops, preserving the characteristics of the original transgenic or transformed plant. The advantages of this method of plant cloning include the speed of plant multiplication and the quality and uniformity of the plants produced.
Micropropagation is a multistage procedure that requires alteration of the culture medium or development conditions between the stages. The process of
<img file="MX355608B_D0031.tif" />
.1 · - J * -.
INSTIT'JIG MEXICANO Z'i LA ΙΨ.ΩΡίΕΩΑΓ micropropagation includes four basic stages: éháp'á 'initial tissue culture; stage two, multiplied by tissue culture; stage three, differentiation and formation of the plant; and stage four, greenhouse cultivation and hardening. During stage one, tissue culture is determined and certified free of contaminants. During stage two, the initial tissue culture is multiplied to produce a sufficient number of tissue samples to achieve production goals. During stage three, samples of newly developed tissue divide and develop into individual seedlings. In stage four, the transformed seedlings are transferred to a greenhouse for hardening where the light tolerance of the plants is gradually increased so that they can continue development in the natural environment.
According to some embodiments of the invention, the transgenic plants are generated by transient transformation of leaf cells, meristematic cells or the ρI anta compteta.
Transient transformation can be performed by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.
Viruses' that have been shown to be useful in transforming host plants include CaMV, TMV and BV. The transformation of plants using impy virus rtrarsTo «s © cA« and “OBLA« OPIMA »
INDUSTRY!
<img file="MX355608B_D0032.tif" />
in US Patent No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Patent Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278, 667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Coid Spring Harbor Laboratory, New York, pages 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts include the plants described in WO 87/06261.
In accordance with some embodiments of the invention, the virus used for transient transformations is avirulent and therefore incapable of causing severe symptoms such as reduced growth rate, mosaic virus, chlorotic ring, rolled leaf, yellowing , veining, smallpox formation, tumor formation and pitting. A suitable avirulent virus can be a natural avirulent virus or an artificially attenuated virus. Virus attenuation can be performed using methods known in the art including, but not limited to, sublethal heating techniques, chemical treatment, or site-directed mutagenesis as described for example by Kurihara and
Watanabe (Molecular Plant Pathology 4: 259-269, 2003), Gal-on et al. (1992), Atreya et al. (1992) and Huet et al. (1994).
Suitable virus strains can be obtained from available sources such as the American Type Culture Collection
I Ινϊ Jr i nsTiTUTo mexicanc (American Type Culture Collection) (ATCC) or by isolating infected plants. Isolation of viruses from infected plant tissues can be accomplished by techniques well known in the art such as, for example, those described by Foster and Tatlor, Eds. Plant
Virology Protocols: From Virus Isolation to Transgenic
Resistance (Methods in Molecular Biology (Humana Pr), Vol 81),
Humana Press, 1998. Briefly, tissues from an infected plant believed to contain a high concentration of a suitable virus, preferably young leaves and flower petals, are ground in a buffer (eg phosphate buffer) to produce a sap infected with the virus that can be used for subsequent inoculations.
The construction of plant RNA viruses for the introduction and expression of non-viral exogenous polynucleotide sequences in plants is demonstrated in the above references as well as in Dawson, W. 0. et al., Virology (1989) 172: 285- 292; Takamatsu and collab. EMBO J. (1987) 6: 307311; French and collaborated. Science (1986) 231: 1294-1297; and Takamatsu and collaborated. FEBS Letters (1990) 269: 73-76.
When the virus is a DNA virus, appropriate modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid to facilitate construction of the desired viral vector with the foreign DNA.
The virus can then be extracted from the
<img file="MX355608B_D0033.tif" />
E LA fK * Hf DAD industrial
<img file="MX355608B_D0034.tif" />
virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA that is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein that will encapsulate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as cDNA and inserted into a plasmid. Then the plasmid is used to prepare all the constructs. The RNA virus is then produced by transcription of the plasmid viral sequence, followed by translation of the viral genes to produce the coat protein (s) that encapsulate the viral RNA.
In the previous references as well as in the
US Patent No. 5,316,931, the construction of plant RNA viruses for the introduction and expression in plants of non-viral exogenous nucleic acid sequences, such as, for example, those included in the construct of the invention, is demonstrated.
In one embodiment, a plant viral polynucleotide is provided where the natural coat protein coding sequence has been removed from a viral polynucleotide, and a natural or native plant (or plant) viral coat protein coding sequence has been inserted and a non-natural promoter, preferably a subgenomic promoter of the protein coding sequence of
IMPI unnatural coating, capable of expression n-néftμεΛ ^ νο
DA · THE INDUSTRIAL PROMO Host, packaging of the recombinant plant viral polynucleotide and ensuring a systemic infection of the host by means of the recombinant plant viral polynucleotide. Alternatively, the coat protein gene can be inactivated by insertion within it of a non-natural polynucleotide sequence so that a protein is produced. The recombinant plant viral polynucleotide may contain one or more additional unnatural subgenomic promoters. Each unnatural subgenomic promoter is capable of transcribing or expressing adjacent genes or polynucleotide sequences in the host plant and incapable of recombination with each other and with the natural subgenomic promoters. Non-natural (foreign) polynucleotide sequences can be inserted adjacent to the natural plant viral subgenomic promoter or to the non-natural plant viral subgenomic promoters if more than one polynucleotide sequence is included. Non-natural polynucleotide sequences are transcribed or expressed in the host plant under the control of the subgenomic promoter to produce the desired products.
In a second embodiment, a recombinant plant viral polynucleotide is provided as in the first embodiment except that the natural coat protein coding sequence is placed adjacent to one of the
X J.
subgenomic protein promoters of coat CT ^ K ^ '^ & tGC ^ íiSírg? instead of an unnatural coat protein coding sequence.
In a third embodiment, a recombinant plant viral polynucleotide is provided where the natural coat protein gene is adjacent to its subgenomic promoter and one or more unnatural subgenomic promoters have been inserted into the viral polynucleotide. The inserted non-natural subgenomic promoters are capable of transcribing or expressing adjacent genes in a host plant and are capable of recombination with each other and with the natural subgenomic promoters. Non-natural polynucleotide sequences can be inserted adjacent to natural subgenomic plant viral promoters such that the sequences are transcribed or expressed in the host plant, under the control of subgenomic promoters, to produce the desired product.
In a fourth embodiment, a recombinant plant viral polynucleotide is provided as in the third embodiment, except that the natural coat protein coding sequence is replaced by a non-natural coat protein coding sequence.
Viral vectors are encapsulated by the coat proteins encoded by the recombinant plant viral polynucleotide to produce a recombinant plant virus. The recombinant plant viral polynucleotide or
<img file="MX355608B_D0035.tif" />
MüüexN <p OF PROPERTY
INDI ISTHIAL
<img file="MX355608B_D0036.tif" />
Recombinant is used to infect suitable host plants. The recombinant plant viral polynucleotide is capable of replicating in the host, systemically dispersing in the host, and transcription or expression of foreign gene (s) (exogenous polynucleotide) in the host to produce the desired protein.
, Techniques for virus inoculation in plants can be found in Foster and Taylor, editors, Plant Virology.
Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), Vol 81), Humana
Press, 1998; Maramorosh and Koprowski, Editors, Methods in
Virology 7 volumes, Academic Press, New York 1967-1984;
Hill, SA Methods in Plant Virology, Blackwell, Oxford,
1984; Walkey, DGA Applied Plant Virology, Wiley, New York,
1985; and Kado and Agrawa, editors, Principies and Techniques in Plant Virology, Van Nostrand-Reinhold, New York.
In addition to the above, the polynucleotide of the present invention can also be introduced into a chloroplast genome thus allowing expression of the chloroplast.
A technique is known for introducing exogenous polynucleotide sequences into the chloroplast genome. This technique includes the following procedures. First, plant cells are chemically treated to reduce the amount of chloroplasts per cell to about one. Then, the polynucleotide is introduced
INDUSTRIAL
IMPI «w« sa »>
INDUSTRIAL cells, preferably by particle bombardment,
<img file="MX355608B_D0037.tif" />
in order to introduce at least one exogenous polynucleotide into the chloroplasts. Exogenous polynucleotides are selected to be able to integrate into the chloroplast genome by homologous recombination, which is done rapidly by the enzymes inherent in the chloroplast. At this point, the exogenous polynucleotide comprises, in addition to a gene of interest, at least one polynucleotide derived from the chloroplast genome. Furthermore, the exogenous polynucleotide comprises a selectable marker that, by means of sequential selection procedures, serves to allow the expert to determine that all or substantially all copies of the chloroplast genome, after said selection, will include the exogenous polynucleotide. More details regarding this technique can be found in the Patents
US Nos. 4,945,050 and 5,693,507, which are incorporated herein by reference. In this way, a polypeptide can be produced by the chloroplast protein expression system which integrates within the inner membrane of the chloroplast.
As the increase in oil content, yield, biomass, growth rate and / or vigor in plants can involve multiple genes that act additively or in synergy (see, eg, Quesda et al., Plant Physiol.
<img file="MX355608B_D0038.tif" />
IK <<sup>J</sup>
130: 951-063, 2002), the invention also
JND «J5TBIAL of a plurality of exogenous polynucleotides in a single host plant to achieve, thus, a higher increase in oil content, yield, biomass, growth rate and / or vigor in plants.
Expression of a plurality of exogenous polynucleotides in a single host plant can be accomplished by co-introducing multiple nucleic acid constructs, each of which includes a different exogenous polynucleotide, within a single plant cell. The transformed cell can then be regenerated into a mature plant using the methods described above.
Alternatively, expression of a plurality of exogenous polynucleotides in a single host plant can be accomplished by co-introducing into a single plant cell a single nucleic acid construct that includes a plurality of different exogenous polynucleotides. Said construct can be designed with a single promoter sequence that can transcribe a polycistronic messenger RNA that includes all the different exogenous polynucleotide sequences. To allow for the co-translation of the different polypeptides encoded by the polycistronic messenger RNA, the polynucleotide sequences can be interconnected by a sequence of the internal ribosome entry site (IRES), which
ΙΜΡ<sup>Τ</sup>
<img file="MX355608B_D0039.tif" />
facilitates the translation of sequences <sup>11</sup>
INDUSTRY !, positioned downstream of the IRES sequence. In this case, a transcribed polycistronic RNA molecule that encodes different polypeptides described above, will be translated from the 5 'end sequence with CAP (Cap) and from the two internal IRES sequences of the polycistronic RNA molecule to thus produce, in the cell, all different polypeptides.
Alternatively, the construct can include several promoter sequences, each linked to a different exogenous polynucleotide sequence.
The plant cell transformed with the construct that includes a plurality of different exogenous polynucleotides, can be regenerated into a mature plant, using the methods described above.
Alternatively, expression of a plurality of exogenous polynucleotides in a single host plant can be accomplished by introducing different nucleic acid constructs, including different exogenous polynucleotides within a plurality of plants. Regenerated transformed plants can then undergo cross fertilization and progeny selected to obtain superior oil content, growth rate, biomass, yield and / or vigor, using conventional techniques for plant reproduction.
Thus, the invention includes plants that express
<img file="MX355608B_D0040.tif" />
exogenously (as described previcW ^ rj '^ g ^^
INDUSTRIAL polynucleotide / s and / or polypeptide / s of the invention. Once expressed within the plant cell or the entire plant, the level of polypeptide encoded by the exogenous polynucleotide can be determined by methods well known in the art, such as activity assays, Western blots using antibodies capable of specifically binding the polypeptide, Enzyme-Linked Immunosorbent Assay (ELISA) radioimmunoassays (RIA), immunohistochemistry, immunofluorescence and similar assays.
Methods for determining the level in the plant of RNA transcribed from the exogenous polynucleotide are well known in the art and include, for example, analysis
Northern Blot, reverse transcription polymerase chain reaction (RT-PCR) (including, quantitative, semi-quantitative, or real-time RT-PCR) and RNA-in-situ hybridization.
The poiinucleotides and polypeptides described above can be used in a wide range of economically significant plants, safely and cost-effectively.
The effect of the transgene (exogenous polynucleotide that encodes the polypeptide.) On oil content, plant yield, seed yield, biomass, growth rate and / or vigor, can be determined using known methods.
<img file="MX355608B_D0041.tif" />
The oil content of a plant p______ _____ by extracting oil from the seed or vegetative source of the plant. In summary, lipids (oil) can be removed from the plant (for example, the seed) by grinding the tissue of the plant in the presence of specific solvents (for example, hexane or petroleum ether) and extract the oil with an extractor continuous. Indirect analysis of oil content can be carried out using various methods known as, for example, Magnetic Resonance Spectroscopy.
Nuclear (NMR), which measures the resonance energy absorbed by the hydrogen atoms in the sample in the liquid state [See, for example, Conway TF. and Earle FR. , 1963, Journal of the
American Oil Chemists' Society; Springer Berlin / Heidelberg,
ISSN: 0003-021X (Publication) 1558-9331 (Online)];
Infrared Near Spectroscopy (NI), which uses near-infrared (1100-2500 nm) energy absorption absorbed by the sample; and a method described in WO / 2001/023884, which is based on the extraction of oil with solvent, evaporating the solvent in a stream of gas that forms oil particles, and directing light into the stream of gas and oil particles they form detectable reflected light. Another method of determining oil content is described in
Example 7 of the Examples section below.
InMPel
MEXICAN INSTITUTE
<img file="MX355608B_D0042.tif" />
Pl;
The vigor of the increase in leaf growth parameters, rosette diameter, plant weight can be calculated similar as a function of time.
Growth rate can be measured using digital analysis of developing plants. For example, images of greenhouse growing plants can be captured based on a diagram every 3 days and the rosette area can be calculated by digital analysis. Rosette area growth is calculated using the difference in rosette area between sampling days divided by the difference in days between samples.
Seed yield measurements can be made by collecting the total seeds of 8-16 plants together, weighing them using an analytical balance, and dividing the total weight by the number of plants. The seed per growth area can be calculated in the same way, taking into account the given growth area for a single plant. Increased seed yield per growth area can be achieved by increasing seed yield per plant and / or by increasing the number of plants capable of growing in a given area.
Evaluation of seed yield per plant can be carried out by measuring the quantity (weight or size) or quantity (that is, number) of dry seeds produced and harvested by 8LA FRGWELA® industrial _ such as fresh area and plant parameters and dividing by the amount of planINSTlTUTt MEXICANA '
D £ LA RRA'HtfiAD V '- * INDUSTRIAL
Growth rate evaluation can be done by measuring the biomass of the plant produced, the rosette area, leaf size or root length as a function of time (can be measured in cm<sup>2</sup> per day of sheet area).
Thus, the present invention has a high agricultural value for promoting the yield of commercially desired crops (eg, seeds).
Any of the transgenic plants described above or parts thereof, can be processed to produce a food preparation, food, protein or oil, for example for ruminant animals.
The transgenic plants described above, which exhibit increased oil content, can be used to produce vegetable oil (by extracting the oil from the plant).
Vegetable oil (including seed and / or vegetative portion oil) produced according to the method of the invention, can be combined with a variety of other ingredients. The specific ingredients included in a product are determined according to the intended use. Exemplary products include animal feed, chemical modification raw material, biodegradable plastics, mixed edible products, for edible oil, biofuels, cooking oil, lubricants, biodiesel, snacks, cosmetics, and raw materials for processing processes.
IMPI
<img file="MX355608B_D0043.tif" />
fermentation. Examples of products to be inff ^ g ^ Qiíiáíáttó
ΙΛ THE PROHEBAD INOUSTTUAL vegetable oil include animal feed, human edible products such as extruded snacks, breads, as a binding agent for edibles, food for aquatic cultivation, fermentable mixtures, edible supplements, sports drinks, nutritional bars, multivitamin supplements , diet drinks and cereal foods.
As used here, the term around refers to + 10%.
. rr \\, including, including, its conjugations, mean
The terms comprise including, having and including but not limited to.
The phrase consists of means includes and limited to.
The phrase "essentially consists of" means that the composition, method or structure may include additional ingredients, steps and / or parts, but only if the additional ingredients, steps and / or parts do not materially alter the basic and new characteristics of the composition, method or claimed structure.
As used here, the singular form one, one and the include plurals unless the context clearly indicates otherwise. For example, the term a compound or at least one compound can include a plurality of compounds, including mixtures thereof.
IMPIOS through this application, you can
TO
- ΙΊ-. LA PKOWÍUAL) tito, ΪΝΓΊΛ'ΤΛΙΑΙ embodiments of this invention in range format. It should be understood that the description in range format is merely for the sake of convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention.
Thus, the description of a range should be considered as a specific description of all possible sub-ranges, as well as the individual numerical values included within that range. For example, the description of a range such as, between 1 and 6, should be considered as a specific description of sub-ranges such as, between 1 and 3, between 1 and 4, between 1 and 5, between 2 and 4, between 2 and 6, between 3 and 6, etc., as well as the individual numbers within that range, for example 1, 2, 3, 4, 5, and 6. This applies regardless of the width of the range.
Each time a range is indicated here, it is understood to include any number (fractional or integer) quoted within the indicated range. The phrases comprised between a first indicated number and a second indicated number and from a first indicated number to a second indicated number are used interchangeably herein and are understood to include the first and second indicated numbers and all included fractional or integers.
As used here, the term method 'refers to the ways, means, techniques, and procedures to accomplish a given task including, but not limited to,
INDtl «TWAL
ΙΜΡΙ tíl LA fturft »* ·
INDtl «TWAL means, techniques and procedures already known for or
<img file="MX355608B_D0044.tif" />
Easily developed from ways, means, techniques, and procedures known to those in the chemical, pharmacological, biological, biochemical, and medical arts.
It will be appreciated that certain features of the invention that are described for the purpose of clarity in the context of separate embodiments can also be provided in combination in a single embodiment. Conversely, various features of the invention which are described for brevity in the context of a single embodiment, may also be provided separately or in any suitable subcombination or, suitably in any other described embodiment of the invention. Certain features described in the context of various embodiments should not be considered essential features of such embodiments, unless the embodiment is inoperative without such elements.
Various embodiments and aspects of the present invention as detailed below and claimed in the claims section below, are experimentally supported in the following examples.
EXAMPLES
Reference will now be made to the following examples which, together with the descriptions above illustrate some
Τ Μ ϊ embodiments of the invention in a non-limiting manner.<sup>xx</sup> iNSTrrrT'j Mexican i? r '.a pkohfdao ínou <tpiai _
In general, the nomenclature used herein and the laboratory procedures used in the present invention include molecular, biochemical, microbiological, and recombinant DNA techniques. These techniques are explained in detail in the literature. See, for example, Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current Protocols in Molecular Biology
Volumes I-III Ausubel, RM, Editores (1994); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryiand (1989); Perbal, A Practical
Cuide to Molecular Cloning, John Wiley & Sons, New York (1988); Watson et al., Recombinant DNA, Scientific American
Books, New York; Birren and colab. (eds) Genome Analysis: A
Laboratory Manual Series, Volumes 1-4, Coid Spring Harbor
Laboratory Press, New York (1998); methodologies as described in US Patent No.<sup>s</sup> 4.666.828;
4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cell Biology: A
Laboratory Handbook, Volumes I-III Cellis, JE, Editor (1994); Current Protocols in Immunology Volumes I-III Coligan JE, Editor (1994); Stites and collab. (eds), Basic-and Ciinical Immunology (Eighth Edition), Appleton & Lange,
Norwalk, CT (1994); Mishell and Shiigi (eds), Selected Methods in Cellular Immunology, WH E'reeman and Co., New York (1980); available immunoassays are extensively described
<img file="MX355608B_D0045.tif" />
in the patent and scientific literature, see, and w »ΝΓ * l« T «IAL
US Patents N<sup>you</sup> 3.791.932; 3.839.153; 3.850.752;
3.850.578;
3.935.074;
3.853.987;
3.984.533;
3.901.654 ;
4.098.876;
3.867.517; 3.879.262;
3.996.345; 4.034.074;
4,879,219; 5,011,771 and 5,281,521; Oligonucleotide Synthesis
Gait, MJ, Editor, (1984); Nucleic Acid Hybridization
Hames, BD, and Higgins SJ, Editors, (1985);
Transcription and Translation Hames, BD, and Higgins S.
0., Eds. (1984); Animal Cell Culture Freshney, RI, Editor, (1986); Immobilized Cells and Enzymes IRL Press, (1986); TO
Practical Guide to Molecular Cloning Perbal, B., (1984) and
Methods in Enzymology Vol. 1-317, Academic Press; PCR
Protocols: A Guide To Methods And Applications, Academic
Press, San Diego, CA (1990); Marshak et al., Strategies for
Protein Purification and Characterization - A Laboratory Course
CSHL Press Manual (1996); all of them are incorporated here for reference as if they had been exposed here. Other references are provided in this document. The procedures mentioned herein are believed to be known in the art and offered for the convenience of the reader. All information contained herein is incorporated by reference.
EXAMPLE 1
IDENTIFICATION AND PREDICTION OF GENE FUNCTION USING
BIOINFORMATIC TOOLS
Genes encoding polypeptides, suitable for increasing seed oil and yield-fcífe · * -Ifc <sup>J</sup> «Snrrro mf.xicanc
OF THE «INDUSTRY OriFDAD !.
RNA expression profiles, sequence similarities, gene annotations, biochemical pathways, DNA, ESTs, protein databases and expression deposited on the Internet are identified by in-depth analysis.
Bioinformatics tools
In-silico gene identification - In the literature, to identify new genes that could greatly affect seed oil yield, genes were identified
OHGs ('oil hook genes'- OHGs) of Arabidopsis, which were already known to have a role in embryogenesis, seed development, oil synthesis and accumulation. The number of OHGs is in accordance with the TAIR website [Hypertext Transfer
Protocol: // World Wide Web (dot) arabidopsis (dot) org /] and includes all information about OHGs. OHGs include alleles of the Wild type of Ssi2 (AT2G43710), OieosinA (AT3G01570),
Lecl (AT1G21970), Lec2 (AT1G28300), Fus3 (AT3G26790), FAD3 (AT2G29980), ABI3 (AT3G24650) and Wril (AT3G54320). Comparison of gene expression profile at 79 different stages of Arabidopsis development was performed on OHGs genes and all other genes printed on the microarray (biochip) of the
Nottingham Arabidopsis Stock Center [(NASC), Hypertext Transfer
Protocol: // affymetrix (dot) arabidopsis (dot) info /)] describing the anatomy, development, and various stress experiments. Correlation was determined using statistical correlation analysis of
Protocol: // davidmlane (dot) html].
Pearson [Hvp
ΡΓ
INSTITIITO MEXICANO lom / hyperstat / X ^ íft'S ^ V
<img file="MX355608B_D0046.tif" />
<td></td><td>The</td><td>criterion</td><td colspan="2">used for each</td><td>of the</td><td>genes are</td>
<td>5 describe</td><td>in</td><td>detail</td><td>In the table</td><td colspan="3">1 later and covers a</td>
<td>variety</td><td>of</td><td>logical</td><td>biological</td><td>What do they use</td><td>various</td><td>methods</td>
<td colspan="3">bioinformatics. The</td><td>genes are</td><td>selected</td><td>for</td><td>produce</td>
changes in seed size and / or seed oil yield based on their highest correlation of expression (given as Pearson R values between 0.7 <R <1) to one or more of the OHGs. The list of identified genes and their correlation (R value) with each of the OHGs, is provided in Table '1, below.
Table 1
<td>Nr of Serie</td><td>Nucí. NR ID OF SEC:</td><td>Prot. NR ID OF SEC:</td><td>Nr BDL</td><td>TAIR- gene name</td><td>R wrll</td><td>R abi3</td><td>«Fus3</td><td>R oleosinA</td><td>R ssi2</td><td>Rfod3</td><td>R lecl</td><td>R Iec2</td>
<td> 1</td><td> 1</td><td> 166</td><td> 3</td><td>AT5G50770</td><td></td><td> 0,891</td><td> 0,986</td><td> 0,897</td><td> 0,791</td><td> 0,882</td><td></td><td></td>
<td> 2</td><td> 2</td><td> 167</td><td> 1</td><td>AT1G65090</td><td></td><td> 0,995</td><td> 0,921</td><td> 0,997</td><td> 0,715</td><td> 0,902</td><td></td><td></td>
<td> 3</td><td> 3</td><td> 168</td><td> 2</td><td>AT1G34580</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,955</td><td> 0,915</td>
<td> 4</td><td> 4</td><td> 169</td><td> 4</td><td>AT2G45420</td><td> 0,933</td><td></td><td> 0,893</td><td> 0,713</td><td> 0,74</td><td> 0,716</td><td> 0,759</td><td> 0,76</td>
<td> 5</td><td> 5</td><td> 170</td><td> 5</td><td>AT3G14360</td><td></td><td> 0,969</td><td> 0,96</td><td> 0,97</td><td> 0,731</td><td> 0,914</td><td></td><td></td>
<td> 6</td><td> 6</td><td> 171</td><td> 6</td><td>AT4G10490</td><td> 0,912</td><td></td><td> 0,88</td><td> 0,725</td><td> 0,76</td><td> 0,71</td><td> 0,757</td><td> 0,755</td>
<td> 7</td><td> 7</td><td> 172</td><td> 7</td><td>AT5G51490</td><td> 0,901</td><td> 0,722</td><td> 0,92</td><td> 0,745</td><td> 0,79</td><td> 0,797</td><td></td><td></td>
<td> 8</td><td> 8</td><td> 173</td><td> 8</td><td>AT3G03240</td><td></td><td> 0,947</td><td> 0,982</td><td> 0,956</td><td> 0,775</td><td> 0,912</td><td></td><td></td>
<td> 9</td><td> 9</td><td> 174</td><td> 9</td><td>AT5G24130</td><td></td><td> 0,988</td><td> 0,917</td><td> 0,987</td><td></td><td> 0,91</td><td></td><td></td>
<td> 10</td><td> 10</td><td> 175</td><td> 10</td><td>AT5G09640</td><td> 0,719</td><td> 0,905</td><td> 0,98</td><td> 0,91</td><td> 0,8</td><td> 0,908</td><td> —1</td><td></td>
<td> 11</td><td> 11</td><td> 176</td><td> 11</td><td>AT5G12460</td><td> 0,815</td><td></td><td></td><td></td><td></td><td></td><td> 0,969</td><td> 0,911</td>
IMPláSS
<td rowspan="2">Nr of Serie</td><td rowspan="2">Nucí. NR ID OF SEC:</td><td rowspan="2">Prot. NR ID OF SEC:</td><td rowspan="2">Nr BDL</td><td rowspan="2">TAIR- gene name</td><td rowspan="2">R wril</td><td rowspan="2">R abi3</td><td rowspan="2">Rfus3</td><td rowspan="2">R oleosInA</td><td>INS · R ssi2</td><td>ττυτοΜβ OE LA fRC INDI Rfad3</td><td>UCANO 'PIEDAD STPíAL Rlecl</td><td>Iec2</td><td></td>
<td></td><td></td><td></td><td></td><td rowspan="30"></td>
<td> 12</td><td> 12</td><td> 177</td><td> 12</td><td>AT4G08530</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,931</td><td> 0,919</td>
<td> 13</td><td> 13</td><td> 178</td><td> 14</td><td>AT1G53690</td><td> 0,931</td><td></td><td> 0,792</td><td></td><td> 0,74</td><td></td><td></td><td></td>
<td> 14</td><td> 14</td><td> 179</td><td> 15</td><td>AT1G68S10</td><td> 0,905</td><td></td><td></td><td></td><td></td><td></td><td> 0,938</td><td> 0,913</td>
<td> 15</td><td> 15</td><td> 180</td><td> 16</td><td>AT5G03800</td><td> 0,8</td><td> 0,878</td><td> 0,966</td><td> 0,894</td><td> 0,797</td><td> 0,882</td><td></td><td></td>
<td> 16</td><td> 16</td><td> 181</td><td> 17</td><td>AT5G36770</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,922</td><td> 0,921</td>
<td> 17</td><td> 17</td><td> 182</td><td> 18</td><td>AT5G40420</td><td></td><td> 0,997</td><td> 0,894</td><td> 0,9996</td><td></td><td> 0,886</td><td></td><td></td>
<td> 18</td><td> 18</td><td> 183</td><td> 19</td><td>AT2G02080</td><td></td><td> 0,702</td><td> 0,741</td><td> 0,72</td><td> 0,748</td><td></td><td></td><td></td>
<td> 19</td><td> 19</td><td> 184</td><td>20 a</td><td>AT1G47540.1</td><td></td><td> 0,993</td><td> 0,915</td><td> 0,995</td><td> 0,71</td><td> 0,892</td><td></td><td></td>
<td> 20</td><td> 20</td><td> 185</td><td>20b</td><td>AT1G47540.2</td><td></td><td> 0,993</td><td> 0,915</td><td> 0,995</td><td> 0,71</td><td> 0,892</td><td></td><td></td>
<td> 21</td><td> 21</td><td> 186</td><td> 21</td><td>AT3G62730</td><td></td><td> 0,995</td><td> 0,92</td><td> 0,993</td><td> 0,711</td><td> 0,903</td><td></td><td></td>
<td> 22</td><td> 22</td><td> 187</td><td> 22</td><td>AT2G27380</td><td></td><td> 0,995</td><td> 0,873</td><td> 0,997</td><td></td><td> 0,875</td><td></td><td></td>
<td> 23</td><td> 23</td><td> 188</td><td> 23</td><td>AT3G27785</td><td> 0,939</td><td></td><td></td><td></td><td></td><td></td><td> 0,867</td><td> 0,81</td>
<td> 24</td><td> 24</td><td> 189</td><td> 2991</td><td>AT5G15000</td><td></td><td> 0,955</td><td> 0,959</td><td> 0,957</td><td> 0,739</td><td> 0,902</td><td></td><td></td>
<td> 25</td><td> 25</td><td> 190</td><td> 25</td><td>AT3G20910</td><td></td><td> 0,963</td><td> 0,943</td><td> 0,962</td><td></td><td> 0,883</td><td></td><td></td>
<td> 26</td><td> 26</td><td> 191</td><td>26a</td><td>AT1G11170.1</td><td></td><td> 0,926</td><td> 0,981</td><td> 0,929</td><td> 0,765</td><td> 0,894</td><td></td><td></td>
<td> 27</td><td> 27</td><td> 192</td><td>26b</td><td>AT1G11170.2</td><td></td><td> 0,926</td><td> 0,981</td><td> 0,929</td><td> 0,765</td><td> 0,894</td><td></td><td></td>
<td> 28</td><td> 28</td><td> 193</td><td> 27</td><td>AT1G68380</td><td></td><td> 0,97</td><td> 0,965</td><td> 0,977</td><td> 0,77</td><td> 0,92</td><td></td><td></td>
<td> 29</td><td> 29</td><td> 194</td><td> 28</td><td>AT1G09380</td><td> 0,705</td><td> 0,899</td><td> 0,95</td><td> 0,91</td><td> 0,756</td><td> 0,897</td><td></td><td></td>
<td> 30</td><td> 30</td><td> 195</td><td> 29</td><td>AT1G60970</td><td> 0,92</td><td> 0,709</td><td> 0,908</td><td> 0,746</td><td> 0,78</td><td> 0,747</td><td> 0,742</td><td> 0,745</td>
<td> 31</td><td> 31</td><td> 196</td><td> 30</td><td>AT1G72580</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,935</td><td> 0,917</td>
<td> 32</td><td> 32</td><td> 197</td><td> 31</td><td>AT2G28490</td><td></td><td> 0,998</td><td> 0,871</td><td> 0,995</td><td></td><td> 0,882</td><td></td><td></td>
<td> 33</td><td> 33</td><td> 198</td><td>32a</td><td>AT2G46960.1</td><td> 0,89</td><td></td><td></td><td></td><td></td><td></td><td> 0,937</td><td> 0,9</td>
<td> 34</td><td> 34</td><td> 199</td><td>32b</td><td>AT2G46960.2</td><td> 0,89</td><td></td><td></td><td></td><td></td><td></td><td> 0,937</td><td> 0,9</td>
<td> 35</td><td> 35</td><td> 200</td><td> 166</td><td>AT1G71691</td><td> 0,938</td><td></td><td> 0,71</td><td></td><td></td><td></td><td> 0,723</td><td> 0,713</td>
<td> 36</td><td> 36</td><td> 201</td><td> 330</td><td>AT1G73220</td><td></td><td> 0,761</td><td> 0,755</td><td> 0,759</td><td></td><td> 0,768</td><td></td><td></td>
<td> 37</td><td> 37</td><td> 202</td><td> 3004</td><td>AT5G01790</td><td> 0,792</td><td></td><td></td><td></td><td></td><td></td><td> 0,899</td><td> 0,85</td>
<td> 38</td><td> 38</td><td> 203</td><td> 333</td><td>AT1G71120</td><td> 0,866</td><td></td><td></td><td></td><td></td><td></td><td> 0,925</td><td> 0,856</td>
<td> 39</td><td> 39</td><td> 204</td><td> 334</td><td>AT5G38170</td><td> 0,937</td><td></td><td> 0,869</td><td></td><td> 0,744</td><td></td><td> 0,81</td><td> 0,793</td>
<td> 40</td><td> 40</td><td> 205</td><td> 335</td><td>AT3G25160</td><td> 0,88</td><td></td><td> 0,874</td><td></td><td> 0,747</td><td> 0,761</td><td></td><td></td>
<td>Nr of Serie</td><td>Nucí. NR ID OF SEC:</td><td>Prot. NR ID OF SEC:</td><td>Nr BDL</td><td>TAIR- gene name</td><td>R wril</td><td>R abi3</td><td>Rfus3</td><td>R oleosinA</td><td>I INS R ssi2</td><td>JLVjl i ιτυτο my</td><td>π JüCANO «?</td><td></td>
<td> 41</td><td> 41</td><td> 206</td><td> 336</td><td>AT1G18100</td><td> 0,917</td><td></td><td> 0,851</td><td></td><td> 0,751-</td><td> 0,711</td><td></td><td></td>
<td> 42</td><td> 42</td><td> 207</td><td> 337</td><td>AT2G22620</td><td> 0,906</td><td></td><td></td><td></td><td></td><td></td><td> 0,927</td><td> 0,888</td>
<td> 43</td><td> 43</td><td> 208</td><td> 339</td><td>AT3G26480</td><td></td><td> 0,785</td><td> 0,717</td><td> 0,784</td><td></td><td></td><td></td><td></td>
<td> 44</td><td> 44</td><td> 209</td><td> 340</td><td>AT1G64660</td><td></td><td> 0,872</td><td> 0,854</td><td> 0,882</td><td></td><td> 0,808</td><td></td><td></td>
<td> 45</td><td> 45</td><td> 210</td><td> 341</td><td>AT5G52330</td><td> 0,811</td><td></td><td></td><td></td><td></td><td></td><td> 0,796</td><td> 0,774</td>
<td> 46</td><td> 46</td><td> 211</td><td> 341</td><td>AT5G52330</td><td> 0,811</td><td></td><td></td><td></td><td></td><td></td><td> 0,796</td><td> 0,774</td>
<td> 47</td><td> 47</td><td> 212</td><td> 342</td><td>AT1G52670</td><td> 0,802</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 48</td><td> 48</td><td> 213</td><td> 343</td><td>AT5G64080</td><td></td><td> 0,923</td><td> 0,876</td><td> 0,923</td><td></td><td> 0,92</td><td></td><td></td>
<td> 49</td><td> 49</td><td> 214</td><td> 343</td><td>AT5G64080</td><td></td><td> 0,923</td><td> 0,876</td><td> 0,923</td><td></td><td> 0,92</td><td></td><td></td>
<td> 50</td><td> 50</td><td> 215</td><td> 344</td><td>AT2G43060</td><td> 0,726</td><td></td><td></td><td></td><td></td><td></td><td> 0,857</td><td> 0,794</td>
<td> 51</td><td> 51</td><td> 216</td><td> 345</td><td>AT1G27330</td><td></td><td> 0,839</td><td> 0,856</td><td> 0,837</td><td></td><td> 0,814</td><td></td><td></td>
<td> 52</td><td> 52</td><td> 217</td><td> 2999</td><td>AT2G41340</td><td> 0,816</td><td></td><td> 0,745</td><td></td><td> 0,744</td><td></td><td></td><td></td>
<td> 53</td><td> 54</td><td> 219</td><td> 2810</td><td>AT2G13290</td><td></td><td> 0,878</td><td> 0,76</td><td> 0,876</td><td></td><td> 0,74</td><td></td><td></td>
<td> 54</td><td> 55</td><td> 220</td><td> 349</td><td>AT4G33670</td><td></td><td> 0,861</td><td></td><td> 0,855</td><td></td><td> 0,734</td><td></td><td></td>
<td> 55</td><td> 56</td><td> 221</td><td> 350</td><td>AT5G04500</td><td></td><td> 0,899</td><td> 0,702</td><td> 0,894</td><td></td><td> 0,756</td><td></td><td></td>
<td> 56</td><td> 64</td><td> 229</td><td> 358</td><td>AT3G01570</td><td></td><td> 0,996</td><td> 0,904</td><td> 1</td><td></td><td> 0,891</td><td></td><td></td>
<td> 57</td><td> 65</td><td> 230</td><td> 359</td><td>AT2G15010</td><td></td><td> 0,944</td><td> 0,955</td><td> 0,942</td><td> 0,763</td><td> 0,924</td><td></td><td></td>
<td> 58</td><td> 66</td><td> 231</td><td> 362</td><td>AT2G25940</td><td> 0,791</td><td> 0,873</td><td> 0,977</td><td> 0,885</td><td> 0,777</td><td> 0,873</td><td></td><td></td>
<td> 59</td><td> 67</td><td> 232</td><td> 364</td><td>AT1G04660</td><td> 0,94</td><td></td><td> 0,882</td><td></td><td> 0,763</td><td> 0,715</td><td> 0,777</td><td> 0,768</td>
<td> 60</td><td> 68</td><td> 233</td><td> 365</td><td>AT1G05160</td><td> 0,945</td><td></td><td></td><td></td><td></td><td></td><td> 0,857</td><td> 0,814</td>
<td> 61</td><td> 69</td><td> 234</td><td> 2992</td><td>AT1G05280</td><td> 0,939</td><td></td><td> 0,805</td><td></td><td></td><td></td><td> 0,859</td><td> 0,84</td>
<td> 62</td><td> 70</td><td> 235</td><td> 2993</td><td>AT1G19900</td><td></td><td> 0,975</td><td> 0,909</td><td> 0,962</td><td></td><td> 0,898</td><td></td><td></td>
<td> 63</td><td> 71</td><td> 236</td><td> 368</td><td>AT1G23200</td><td> 0,852</td><td></td><td></td><td></td><td></td><td></td><td> 0,957</td><td> 0,906</td>
<td> 64</td><td> 72</td><td> 237</td><td> 369</td><td>AT1G26680</td><td> 0,93</td><td></td><td></td><td></td><td></td><td></td><td> 0,738</td><td> 0,717</td>
<td> 65</td><td> 73</td><td> 238</td><td> 370</td><td>AT1G28590</td><td> 0,937</td><td></td><td></td><td></td><td></td><td></td><td> 0,855</td><td> 0,813</td>
<td> 66</td><td> 74</td><td> 239</td><td> 371</td><td>AT1G48910</td><td> 0,877</td><td> 0,753</td><td> 0,912</td><td> 0,77</td><td> 0,808</td><td> 0,807</td><td></td><td></td>
<td> 67</td><td> 75</td><td> 240</td><td> 2995</td><td>AT1G51000</td><td> 0,906</td><td></td><td></td><td></td><td></td><td></td><td> 0,785</td><td> 0,77</td>
<td> 68</td><td> 76</td><td> 241</td><td> 373</td><td>AT1G62340</td><td> 0,712</td><td></td><td></td><td></td><td></td><td></td><td> 0,978</td><td> 0,903</td>
<td> 69</td><td> 77</td><td> 242</td><td> 374</td><td>AT1G62610</td><td></td><td> 0,946</td><td> 0,909</td><td> 0,938</td><td></td><td> 0,891</td><td></td><td></td>
<td>Nr of Serie</td><td>Nucí. NR ID OF SEC:</td><td>Prot. NR ID OF SEC:</td><td>Nr BDL</td><td>TAIR- gene name</td><td>R wril</td><td>R abi3</td><td>Rfus3</td><td>R oleosinA</td><td>R SSÍ2</td><td>ra MTjtodSo D £ LA I</td><td>YOU 'ROHÍDAU OUSTRIAl</td><td>TO * YES</td>
<td rowspan="2"> 70</td><td rowspan="2"> 78</td><td rowspan="2"> 243</td><td rowspan="2"> 374</td><td rowspan="2">AT1G62610</td><td rowspan="2"></td><td rowspan="2"> 0,946</td><td rowspan="2"> 0,909</td><td rowspan="2"> 0,938</td><td></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td>
<td> 71</td><td> 79</td><td> 244</td><td> 374</td><td>AT1G62610</td><td></td><td> 0,946</td><td> 0,909</td><td> 0,938</td><td></td><td> 0,891</td><td></td><td></td>
<td> 72</td><td> 80</td><td> 245</td><td> 375</td><td>AT1G76290</td><td> 0,735</td><td> 0,91</td><td> 0,967</td><td> 0,923</td><td> 0,803</td><td> 0,904</td><td></td><td></td>
<td rowspan="2"> 73 74</td><td> 81</td><td> 246</td><td> 376</td><td>AT1G68470</td><td> 0,917</td><td></td><td> 0,814</td><td></td><td></td><td></td><td></td><td></td>
<td> 82</td><td> 247</td><td> 377</td><td>AT1G71250</td><td> 0,922</td><td></td><td></td><td></td><td></td><td></td><td> 0,93</td><td> 0,881</td>
<td> 75</td><td> 83</td><td> 248</td><td> 379</td><td>AT3G58200</td><td> 0,719</td><td> 0,897</td><td> 0,973</td><td> 0,907</td><td> 0,771</td><td> 0,914</td><td></td><td></td>
<td> 76</td><td> 84</td><td> 249</td><td> 380</td><td>AT1G78500</td><td> 0,731</td><td> 0,844</td><td> 0,964</td><td> 0,843</td><td> 0,788</td><td> 0,879</td><td></td><td></td>
<td> 77</td><td> 85</td><td> 250</td><td> 381</td><td>AT2G14690</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,972</td><td> 0,916</td>
<td> 78</td><td> 86</td><td> 251</td><td> 382</td><td>AT3G63040</td><td></td><td> 0,949</td><td> 0,979</td><td> 0,962</td><td> 0,783</td><td> 0,907</td><td></td><td></td>
<td> 79</td><td> 87</td><td> 252</td><td> 383</td><td>AT2G15325</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,978</td><td> 0,929</td>
<td> 80</td><td> 88</td><td> 253</td><td> 384</td><td>AT2G23510</td><td> 0,804</td><td> 0,767</td><td> 0,943</td><td> 0,777</td><td> 0,789</td><td> 0,85</td><td></td><td></td>
<td> 81</td><td> 89</td><td> 254</td><td> 385</td><td>AT2G26070</td><td> 0,927</td><td></td><td></td><td></td><td></td><td></td><td> 0,827</td><td> 0,762</td>
<td> 82</td><td> 90</td><td> 255</td><td> 2997</td><td>AT2G28650</td><td> 0,811</td><td></td><td> 0,711</td><td></td><td></td><td></td><td> 0,953</td><td> 0,939</td>
<td> 83</td><td> 91</td><td> 256</td><td> 2998</td><td>AT2G41290</td><td> 0,827</td><td></td><td> 0,869</td><td></td><td> 0,779</td><td> 0,786</td><td></td><td></td>
<td> 84</td><td> 92</td><td> 257</td><td> 389</td><td>AT2G42860</td><td> 0,903</td><td></td><td> 0,829</td><td></td><td> 0,727</td><td></td><td> 0,825</td><td> 0,813</td>
<td rowspan="3"> 85 86 87</td><td rowspan="2"> 93 94</td><td rowspan="2"> 258 259</td><td rowspan="2"> 390 391</td><td rowspan="2">AT2G47750 AT3G03230</td><td rowspan="2"> 0,906 0,828</td><td></td><td> 0,744</td><td></td><td></td><td></td><td> 0,784</td><td> 0,754</td>
<td> 0,844</td><td> 0,954</td><td> 0,854</td><td> 0,783</td><td> 0,833</td><td></td><td></td>
<td> 95</td><td> 260</td><td> 392</td><td>AT3G04200</td><td> 0,912</td><td></td><td> 0,827</td><td></td><td> 0,733</td><td></td><td></td><td></td>
<td> 88</td><td> 96</td><td> 261</td><td> 393</td><td>AT3G21840</td><td> 0,702</td><td></td><td></td><td></td><td></td><td></td><td> 0,968</td><td> 0,928</td>
<td> 89</td><td> 97</td><td> 262</td><td> 3000</td><td>AT3G22640</td><td></td><td> 0,995</td><td> 0,855</td><td> 0,991</td><td></td><td> 0,873</td><td></td><td></td>
<td> 90</td><td> 98</td><td> 263</td><td> 395</td><td>AT3G49380</td><td> 0,919</td><td></td><td> 0,724</td><td></td><td></td><td></td><td> 0,843</td><td> 0,784</td>
<td> 91</td><td> 99</td><td> 264</td><td> 3001</td><td>AT4G03050</td><td> 0,93</td><td></td><td> 0,847</td><td></td><td> 0,749</td><td></td><td></td><td></td>
<td> 92</td><td> 100</td><td> 265</td><td> 3001</td><td>AT4G03050</td><td> 0,93</td><td></td><td> 0,847</td><td></td><td> 0,749</td><td></td><td></td><td></td>
<td> 93</td><td> 101</td><td> 266</td><td> 3003</td><td>AT4G19380</td><td> 0,783</td><td> 0,792</td><td> 0,913</td><td> 0,803</td><td> 0,826</td><td> 0,839</td><td></td><td></td>
<td> 94</td><td> 102</td><td> 267</td><td> 398</td><td>AT4G27460</td><td></td><td> 0,992</td><td> 0,896</td><td> 0,985</td><td></td><td> 0,897</td><td></td><td></td>
<td> 95</td><td> 103</td><td> 268</td><td> 399</td><td>AT4G33280</td><td> 0,885</td><td> 0,715</td><td> 0,912</td><td> 0,732</td><td> 0,811</td><td> 0,8</td><td></td><td></td>
<td> 96</td><td> 104</td><td> 269</td><td> 400</td><td>AT4G33600</td><td> 0,917</td><td></td><td></td><td></td><td></td><td></td><td> 0,908</td><td> 0,851</td>
<td> 97</td><td> 105</td><td> 270</td><td> 401</td><td>AT5G07260</td><td> 0,956</td><td></td><td> 0,82</td><td></td><td> 0,73</td><td></td><td></td><td></td>
<td> 98</td><td> 106</td><td> 271</td><td> 3007</td><td>AT5G08460</td><td> 0,955</td><td></td><td> 0,768</td><td></td><td> 0,702</td><td></td><td> 0,757</td><td> 0,747</td>
<img file="MX355608B_D0047.tif" />
<td>Nr of Serie</td><td>Nucí. NR ID OF SEC:</td><td>Prot. NR ID OF SEC:</td><td>Nr BDL</td><td>- TAIR- gene name</td><td>. - R wrll</td><td>R ab! 3</td><td>Rfus3</td><td>R oleosinA</td><td>R SSÍ2</td><td> _</td><td>Easy & IND PROPiEDAI NDI '? T »IA</td><td>IV !</td><td></td>
<td rowspan="2"> 128</td><td rowspan="2"> 136</td><td rowspan="2"> 301</td><td rowspan="2"> 431</td><td rowspan="2">AT5G43860</td><td></td><td rowspan="2"> 0,866</td><td rowspan="2"> 0,916</td><td rowspan="2"> 0,868</td><td rowspan="2"> 0,776_</td><td rowspan="2"></td><td></td><td></td><td></td>
<td></td><td></td><td></td><td></td>
<td> 129</td><td> 137</td><td> 302</td><td> 432</td><td>AT5G57390</td><td></td><td> 0,989</td><td> 0,914</td><td> 0,987</td><td> 0,713</td><td> 0,916</td><td></td><td></td><td></td>
<td> 130</td><td> 138</td><td> 303</td><td> 433</td><td>AT5G62800</td><td></td><td> 0,961</td><td> 0,967</td><td> 0,962</td><td> 0,769</td><td> 0,913</td><td></td><td></td><td></td>
<td> 131</td><td> 139</td><td> 304</td><td> 435</td><td>AT5G52500</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,956</td><td> 0,876</td><td></td>
<td> 132</td><td> 140</td><td> 305</td><td> 436</td><td>AT5G24600</td><td></td><td> 0,956</td><td> 0,902</td><td> 0,954</td><td></td><td> 0,863</td><td></td><td></td><td></td>
<td> 133</td><td> 141</td><td> 306</td><td> 2818</td><td>AT2G23550</td><td> 0,829</td><td></td><td></td><td></td><td></td><td></td><td> 0,928</td><td> 0,839</td><td></td>
<td> 134</td><td> 142</td><td> 307</td><td> 2818</td><td>AT2G23550</td><td> 0,829</td><td></td><td></td><td></td><td></td><td></td><td> 0,928</td><td> 0,839</td><td></td>
<td> 135</td><td> 146</td><td> 311</td><td> 441</td><td>AT5G48100</td><td> 0,737</td><td> 0,923</td><td> 0,95</td><td> 0,944</td><td> 0,761</td><td> 0,864</td><td></td><td></td><td></td>
<td> 136</td><td> 147</td><td> 312</td><td> 442</td><td>AT1G14760</td><td> 0,708</td><td> 0,874</td><td> 0,93</td><td> 0,876</td><td> 0,831</td><td> 0,877</td><td></td><td></td><td></td>
<td> 137</td><td> 148</td><td> 313</td><td> 443</td><td>AT1G15150</td><td> 0,871</td><td></td><td></td><td></td><td></td><td></td><td> 0,971</td><td> 0,92</td><td></td>
<td> 138</td><td> 149</td><td> 314</td><td> 444</td><td>AT1G20500</td><td> 0,92</td><td></td><td> 0,783</td><td></td><td></td><td></td><td> 0,904</td><td> 0,874</td><td></td>
<td> 139</td><td> 150</td><td> 315</td><td> 445</td><td>AT1G56170</td><td> 0,966</td><td></td><td> 0,751</td><td></td><td></td><td></td><td> 0,782</td><td> 0,751</td><td></td>
<td> 140</td><td> 151</td><td> 316</td><td> 2996</td><td>AT1G62070</td><td> 0,956</td><td></td><td></td><td></td><td></td><td></td><td> 0,847</td><td> 0,797 .</td><td></td>
<td> 141</td><td> 152</td><td> 317</td><td> 447</td><td>AT1G67100</td><td></td><td> 0,967</td><td> 0,969</td><td> 0,973</td><td> 0,761</td><td> 0,914</td><td></td><td></td><td></td>
<td> 142</td><td> 153</td><td> 318</td><td> 448</td><td>AT3G21090</td><td> 0,902</td><td></td><td> 0,724</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 143</td><td> 154</td><td> 319</td><td> 449</td><td>AT3G24250</td><td> 0,826</td><td></td><td></td><td></td><td></td><td></td><td> 0,986</td><td> 0,931</td><td></td>
<td> 144</td><td> 155</td><td> 320</td><td> 450</td><td>AT3G50990</td><td> 0,715</td><td></td><td></td><td></td><td></td><td></td><td> 0,982</td><td> 0,914</td><td></td>
<td> 145</td><td> 156</td><td> 321</td><td> 451</td><td>AT4G00220</td><td> 0,905</td><td> 0,741</td><td> 0,923</td><td> 0,773</td><td> 0,782</td><td> 0,779</td><td> 0,7</td><td> 0,703</td><td></td>
<td> 146</td><td> 157</td><td> 322</td><td> 452</td><td>AT4G10150</td><td> 0,706</td><td> 0,875</td><td> 0,95</td><td> 0,883</td><td> 0,821</td><td> 0,886</td><td></td><td></td><td></td>
<td> 147</td><td> 158</td><td> 323</td><td> 3006</td><td>AT5G07190</td><td></td><td> 0,998</td><td> 0,903</td><td> 0,997</td><td></td><td> 0,901</td><td></td><td></td><td></td>
<td> 148</td><td> 159</td><td> 324</td><td> 3006</td><td>AT5G07190</td><td></td><td> 0,998</td><td> 0,903</td><td> 0,997</td><td></td><td> 0,901</td><td></td><td></td><td></td>
<td> 149</td><td> 160</td><td> 325</td><td> 455</td><td>AT5G10220</td><td> 0,722</td><td></td><td></td><td></td><td></td><td></td><td> 0,984</td><td> 0,917</td><td></td>
<td> 150</td><td> 161</td><td> 326</td><td> 456</td><td>AT5G209 40</td><td></td><td> 0,969</td><td> 0,901</td><td> 0,961</td><td></td><td> 0,901</td><td></td><td></td><td></td>
<td> 151</td><td> 162</td><td> 327</td><td> 457</td><td>AT5G51210</td><td> 0,907</td><td> 0,7</td><td> 0,925</td><td> 0,734</td><td> 0.788</td><td> 0,752</td><td> 0,702</td><td> 0,7</td><td></td>
<td> 152</td><td> 163</td><td> 328</td><td> 458</td><td>AT5G55620</td><td> 0,704</td><td> 0,769</td><td> 0,898</td><td> 0,776</td><td> 0,871</td><td> 0,8</td><td></td><td></td><td></td>
<td> 153</td><td> 164</td><td> 329</td><td> 459</td><td>AT5G60460</td><td></td><td> 0,987</td><td> 0,931</td><td> 0,988</td><td></td><td> 0,902</td><td></td><td></td><td></td>
<td><sup>154</sup></td><td> 165</td><td> 330</td><td> 460</td><td>AT5G65590</td><td> 0,793</td><td> 0,725</td><td> 0,882</td><td> 0,754</td><td> 0,733</td><td> 0.77</td><td>Ί</td><td></td><td></td>
<td> 155</td><td> 332</td><td> 351</td><td> 2991</td><td>AT5G15000</td><td></td><td> 0,955</td><td> 0,959</td><td> 0,957</td><td> 0,739</td><td> 0,902</td><td></td><td></td><td></td>
<td> 156</td><td> 333</td><td> 352</td><td> 2992</td><td>AT1G05280</td><td> 0,939</td><td></td><td> 0.805</td><td></td><td></td><td></td><td> 0,859 1</td><td> 0,84</td><td></td>
<td>Nr of Serie</td><td>Nud. NR ID OF SEC:</td><td>Prot. NR ID OF SEC:</td><td>Nr BDL</td><td>TAIR- gene name</td><td>R wril</td><td>R abi3</td><td>RfuS3</td><td>R oleosinA</td><td>R ssi2 i</td><td>ΓΜ (one</td><td>YOU ίουΓΤίΐΛΐ</td><td></td><td></td>
<td> 157</td><td> 334</td><td> 353</td><td> 2993</td><td>AT1G19900</td><td></td><td> 0,975</td><td> 0,909</td><td> 0,962</td><td></td><td></td><td></td><td></td><td rowspan="13"></td>
<td> 158</td><td> 336</td><td> 355</td><td> 2995</td><td>AT1G51000</td><td> 0,906</td><td></td><td></td><td></td><td></td><td></td><td> 0,785</td><td> 0,77</td>
<td> 159</td><td> 337</td><td> 356</td><td> 2996</td><td>AT1G62070</td><td> 0,956</td><td></td><td></td><td></td><td></td><td></td><td> 0,847</td><td> 0,797</td>
<td> 160</td><td> 338</td><td> 357</td><td> 2997</td><td>AT2G28650</td><td> 0,811</td><td></td><td> 0,711</td><td> 1</td><td></td><td></td><td> 0,953</td><td> 0,939</td>
<td> 161</td><td> 339</td><td> 358</td><td> 2998</td><td>AT2G41290</td><td> 0,827</td><td></td><td> 0,869</td><td></td><td> 0,779</td><td> 0,786</td><td></td><td></td>
<td> 162</td><td> 340</td><td> 359</td><td> 2999</td><td>AT2G41340</td><td> 0,816</td><td></td><td> 0,745</td><td></td><td> 0,744</td><td></td><td></td><td></td>
<td> 163</td><td> 341</td><td> 360</td><td> 3000</td><td>AT3G22640</td><td></td><td> 0,995</td><td> 0,855</td><td> 0,991</td><td></td><td> 0,873</td><td></td><td></td>
<td> 164</td><td> 342</td><td> 361</td><td> 3001</td><td>AT4G03050</td><td> 0,93</td><td></td><td> 0,847</td><td></td><td> 0,749</td><td></td><td></td><td></td>
<td> 165</td><td> 344</td><td> 363</td><td> 3003</td><td>AT4G19380</td><td> 0,783</td><td> 0,792</td><td> 0,913</td><td> 0,803</td><td> 0,826</td><td> 0,839</td><td></td><td></td>
<td> 166</td><td> 345</td><td> 364</td><td> 3004</td><td>AT5G01790</td><td> 0,792</td><td></td><td></td><td></td><td></td><td></td><td> 0,899</td><td> 0,85</td>
<td> 167</td><td> 347</td><td> 366</td><td> 3006</td><td>AT5G07190</td><td></td><td> 0,998</td><td> 0,903</td><td> 0,997</td><td></td><td> 0,901</td><td></td><td></td>
<td> 168</td><td> 348</td><td> 367</td><td> 3007</td><td>AT5G08460</td><td> 0,955</td><td></td><td> 0,768</td><td></td><td> 0,702</td><td></td><td> 0,757</td><td> 0,747</td>
<td> 169</td><td> 349</td><td> 368</td><td> 3008</td><td>AT5G49820</td><td> 0,905</td><td></td><td></td><td></td><td> 0,715</td><td></td><td></td><td></td>
Table 1
Table 2, below, provides additional predicted genes that affect seed oil synthesis and that were identified using bioinformatic tools.
Table 2
<td>Serial number</td><td>NR ID polynucleotide FROM SEC:</td><td>Polypeptide NR SEQ ID:</td><td>NrBDL</td><td>TAIR- gene name</td>
<td> 1</td><td> 53</td><td> 218</td><td> 3005</td><td>AT5G03450.1</td>
<td> 2</td><td> 57</td><td> 222</td><td> 351</td><td>AT1G27120.1</td>
<td> 3</td><td> 58</td><td> 223</td><td> 352</td><td>AT5G01820.1</td>
<td> 4</td><td> 59</td><td> 224</td><td> 353</td><td>AT2G32780.1</td>
<td> 5</td><td> 60</td><td> 225</td><td> 354</td><td>AT3G 16490.1</td>
<td> 6</td><td> 61</td><td> 226</td><td> 355</td><td>AT5G23050.1</td>
<td>Serial number</td><td>Polynucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>NrBDL</td><td>MEXICAN IKSTITUTO</td>
<td> 7</td><td> 62</td><td> 227</td><td> 3002</td><td>AT4®í6 & Sfta V,</td>
<td> 8</td><td> 63</td><td> 228</td><td> 2994</td><td>AT1G44760.1</td>
<td> 9</td><td> 143</td><td> 308</td><td> 438</td><td>AT1G72040</td>
<td> 10</td><td> 144</td><td> 309</td><td> 439</td><td>AT1G53070</td>
<td> 11</td><td> 145</td><td> 310</td><td> 440</td><td>AT1G50510</td>
<td> 12</td><td> 331</td><td> 350</td><td> 2990</td><td>AT5G14995</td>
<td> 13</td><td> 335</td><td> 354</td><td> 2994</td><td>AT1G44760</td>
<td> 14</td><td> 343</td><td> 362</td><td> 3002</td><td>AT4G16050</td>
<td> 15</td><td> 346</td><td> 365</td><td> 3005</td><td>AT5G03450</td>
Table 2.
EXAMPLE 2
PRODUCTION OF ARABIDOPSIS TRANSCRIPTOMA AND HIGH PERFORMANCE CORRELATION ANALYSIS USING A COMPLETE GENOMA OLIGONUCLEOTIDE MICRO-MATRIX (BIOCHIP) OF ARABIDOPSIS
44K
To produce a high throughput correlation analysis, the present inventors used an Arabidopsis thaliana oligonucleotide microchip (biochip) produced by Agilent Technologies [Hypertext
Transfer Protocol: // World Wide Web (dot) chem. (dot) agilent (dot) com / Scripts / PDS (dot) asp? lPage = 50879]. The matrix oligonucleotide represents about 40,000 A. thaliana genes and transcripts designed based on data from the TIGR ATH1 v.5 and Arabidopsis MPSS (University of Delaware) databases. In order to define the correlations
IMPI between RNA expression levels and
INDUSTRIAL related to performance or vigor components, it
<img file="MX355608B_D0048.tif" />
analyzed various characteristics of plants from 15 different ecotypes of Arabidopsis. Among them, nine ecotypes were selected that include the variation observed for the analysis of RNA expression. The correlation between RNA levels and the characterized parameters were analyzed using Pearson's correlation test [Hypertext Transfer Protocol: // World Wide Web (dot) davidmlane (dot) com / hyperstat / A34739 (dot) html].
Experimental procedures
RNA extraction - Samples were obtained from five tissues at different stages of development [root, leaf, flower in anthesis, seed 5 days after flowering (DAF) and seed at 12 days DAF], which represent different plant characteristics and RNA was extracted using TRIzol Reagent from Invitrogen [Hypertext Transfer
Protocol: // World Wide Web (dot) invitrogen (dot) com / content (dot) cfm? Pageid = 469]. For reasons of convenience, each tissue type with expression information on microarray (biochip) received a Group ID as synthesized in Table 3, below.
Table 3
Arabidopsis transcriptome experimental groups
<td>Expression group</td><td>Group id</td><td>—Hv [NSTn'u</td>
<td>Root</td><td colspan="2">TO</td>
<td>Sheet</td><td colspan="2">B _— </td>
<td>Flower</td><td colspan="2">C</td>
<td>seed 5 DAF</td><td colspan="2">D</td>
<td>seed 12 DAF</td><td colspan="2">AND</td>
Table 3
<img file="MX355608B_D0049.tif" />
NDViSTUlAL
Samples of approximately 30-50 mgr of tissue were taken. The heavy tissues were ground using hand and mortar in liquid nitrogen and resuspended in 500 μΐ of the reagent
TRIzol. 100 µΐ of chloroform was added to the homogenate lysate followed by precipitation using isopropanol and two washes with 75% ethanol. RNA was eluted in 30 µΐ of RNase free water. RNA samples were washed using Qiagen's RNeasy minikit wash protocol according to the manufacturer's directions.
Evaluation of parameters related to the performance and vigor component - 8 ecotypes of
Arabidopsis in 5 repetitive blocks (called A, B, C, D and E), each containing 20 plants per plot under controlled greenhouse conditions at 22 ° C, N: P: K fertilizer [nitrogen (N), phosphorus ( P) and potassium (K)] 20:20:20 (weight ratios). During this time, data was collected, documented, and analyzed. Additional data was collected during the seedling stage of plants grown in tissue culture on vertical clear agar plates. The parameters of the collected data are
<img file="MX355608B_D0050.tif" />
then.
Table 4
Correlated parameters in Arabidopsis (vectors)
<td>Parameter correlated with</td><td>ID of correlation</td>
<td>Root length day 13 (cm)</td><td> 1</td>
<td>Root length day 7 (cm)</td><td> 2</td>
<td>Relative root growth</td><td></td>
<td>(cm / day) day 13</td><td></td>
<td>Fresh weight per plant (gr) in floral induction stage</td><td> 4</td>
<td>Dry matter per plant (gr)</td><td> 5</td>
<td>Vegetative growth rate (cm<sup>2</sup> / day) up to 8 true sheets</td><td> 6</td>
<td>Blade circularity</td><td> 7</td>
<td>Sheet width (cm)</td><td> 8</td>
<td>Sheet width (cm)</td><td> 9</td>
<td>Total leaf area per plant (cm)</td><td> 10</td>
<td>Seed weight 1000 (gr)</td><td> 11</td>
<td>% oil per seed</td><td> 12</td>
<td>Seeds per silicone</td><td> 13 □</td>
<td>Silicone length (cm)</td><td> 14</td>
<td>Seed yield per plant (gr)</td><td> 15</td>
<td>Oil yield per plant (mgr)</td><td> 16</td>
<td>Harvest index</td><td> 17</td>
<td>Blade width / length</td><td> 18</td>
Table 4.
Most of the chosen parameters were analyzed by digital imaging.
WPUSTWAl
<img file="MX355608B_D0051.tif" />
Digital Imaging Capture images of seedlings seeded on square agar plates, a laboratory imaging system consisting of a DSLR (Canon EOS 300D) equipped with a 55mm focal length lens (Canon EF Series -S), mounted on a playback device (Kaiser RS), which included 4 light units (4 150-watt light bulbs) and located in a dark room.
The image capture process was repeated every other day beginning on day 7 through day 14. To capture images of larger plants, seeded in white trays in a controlled environment greenhouse (as seen in
Figure 2b), the same camera equipped with a 24mm focal length lens (Canon EF series), placed on a special iron bracket, was used. The white punts were prismatic in shape and measured 36 x 26.2 cm and 7.5 in depth. During the capture process, the trays were placed under the iron support, avoiding direct sunlight and casting shadow. This process was repeated every 3-4 days for up to 30 days.
An image analysis system consisting of a desktop personal computer (processor) was used.
Intel P4 3.0) and a public domain program - ImageJ 1.37 (Java based image processing program that was developed at the US National Institutes of Health and * 7'7 ·.
• λ. ”'·, ·» X:' -¿1: ·
b. Λ free Internet distribution in HypéTTg ^ t ^?, '^^ rjfeé¿ ^ s «i ^ 1NUUS ΓλίΛί,
Protocol: // rsbweb (dot) nih (dot) gov /). The images were captured at a resolution of 6 Mega Pixels (3072 x 2048 pixels) and stored in a low compression JPEG format (Joint Photographic Expert Group standard). The analyzed data was then saved in text files and processed using the JMP statistical analysis software (SAS
Institute).
Sheet Analysis - Using digital analysis, sheet data was calculated, including sheet quantity, area, perimeter, length, and width. On day 30, 3-4 representative plants were chosen from each plot of blocks A, B and C. The plants were dissected, each leaf was separated and placed between two glass trays, a photo of each plant was taken and the various parameters were calculated from the images (for example, total leaf area, laminar length, etc. .) (Figures la-d). The circularity of the blade was calculated as laminar width divided by the laminar length.
Root analysis - For 17 days, the different ecotypes were grown on transparent agar plates. Plates were photographed every 2 days beginning on day 7 in a photography room, and root development was documented (Figures 2a-b).
The growth rate was calculated according to the following formula 1.
Formula I:
growth area index (1 / Area tO)
<img file="MX355608B_D0052.tif" />
relative = (Δ Area / Át) *
At is the day the image was analyzed normal subtracted from the initial day (t-tO). Thus, the relative growth area index is expressed in units of 1 / day and the length growth index is expressed in units of
1 day.
Vegetative growth rate analysis - The growth rate was calculated by dividing the aggregate area (A Area) by the number of days in each interval (At). The analysis ended with the appearance of imbricated plants.
Growth rate was calculated according to formula II.
Formula II:
Growth rate - AÁrea / At.
To compare between ecotypes, the calculated speed was normalized using a plant development stage represented by the number of true leaves. In cases where plants with 8 leaves had been sampled twice (for example, on day 10 and 13), only the largest sample was chosen and added to the Anova comparison.
Analysis of seeds in silicuas - They were collected on the day
70, 15-17 siliques from each plot in blocks D and E. The
IMPI
ΙΛΚ'ΤΙΤι rrr \
Mexican INSTITUTE OF PROPERTY
OF THE PROPERTY
<img file="MX355608B_D0053.tif" />
, industrial, selected silicuas were light brown but were still intact. Siliques were opened in the photography room and the seeds were spread on a glass tray, a high resolution digital photo was taken of each plot. Using the images, the quantity of seeds per silicone was determined.
Average seed weight - At the end of the experiment, all the seeds from the AC plots were collected. An average weight of 0.02 grams of each sample was measured, the seeds were spread on a glass tray and a photo was taken. The amount of seeds was calculated using digital analysis.
Oil percentage in seeds - All seeds were collected from plots AC at the end of the experiment. Columbia seeds from 3 plots were ground and then placed in the extraction chamber. 210 ml of n-hexane (Cat No. 080951 Biolab Ltd.) was used as the solvent. The extraction was carried out for 30 hours at an average temperature of 50 ° C. After extraction was complete, n-hexane was evaporated using the evaporator at 35 ° C and vacuum conditions. The process was repeated twice. The information obtained in the extractor
Soxhlet (Soxhlet, F. Die gewichtsanalytische Bestimmung des
Milchfettes, Polytechnisches J. (Dingler's) 1879, 232, 461) was used to create a calibration curve for low resonance NMR. The oil content of the seed samples was determined using a low resonance NMR (MARAN Ultra72 —-<sup>χ</sup> ·· ι ^.
Oxford Instrument) and its Muϊΐ r iw o * is'Trial software package
Silica length analysis - On day 50 from sowing, 30 siliques of different plants were sampled in each plot in block A. The selected siliques were greenish-yellow in color and were collected from the bottom of a developed plant stem . A digital photograph was taken to determine the length of the silicone.
Dry weight and seed yield - On day 80 from sowing, plants from AC blocks were harvested and allowed to dry at 30 ° C in a drying chamber. The biomass was separated and the weight of the seeds of each plot was measured and divided by the number of plants. Dry weight = total weight of the vegetative portion underground (including the roots) after drying at 30 ° C in a drying chamber; ' seed yield per plant = total weight of seeds per plant (gr.).
Oil Yield - Oil yield was calculated using Formula III.
Formula III:
Yield of seed oil = seed yield per plant (gr.) *% Of oil in the seed harvest index - The harvest index was calculated using Formula IV. <sup>;</sup>
Formula IV:
harvest index = average seed yield per plant / percentage dry weight
Experimental results
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX355608B_D0054.tif" />
Nine different Arabidopsis ecotypes were developed and characterized according to 18 parameters (called vectors).
The characterized values were synthesized in Tables 5 and 6, below.
Table 5
Arabidopsis ecotypes, measured parameters
<td>Ecotype</td><td>Yielded seed by plant (gr)</td><td>Yielded of oil by plant (mgr)</td><td>%of oil per seed</td><td>Weight of 1,000 seeds (gr.)</td><td>matter dry per plant (gr.)</td><td>harvest index</td><td>Total leaf area per plant (cm)</td><td>Seeds by silicone</td><td>long. of silicone (cm)</td>
<td>An-1</td><td> 0,34</td><td> 118,63</td><td> 34,42</td><td> 0,0203</td><td> 0,64</td><td> 0,53</td><td> 46,86</td><td> 45,44</td><td> 1,06</td>
<td>Col-0</td><td> 0,44</td><td> 138,73</td><td> 31,19</td><td> 0,0230</td><td> 127</td><td> 0,35</td><td> 109,89</td><td> 53,47</td><td> 1,26</td>
<td>Ct-1</td><td> 0,59</td><td> 224,06</td><td> 38,05</td><td> 0,0252</td><td> 1,05</td><td> 0,56</td><td> 58,36</td><td> 58,47</td><td> 1,31</td>
<td>Cvi (N8580)</td><td> 0,42</td><td> 116,26</td><td> 27,76</td><td> 0,0344</td><td> 1,28</td><td> 0,33</td><td> 56,80</td><td> 35,27</td><td> 1,47</td>
<td>Gr-6</td><td> 0,61</td><td> 218,27</td><td> 35,49</td><td> 0,0202</td><td> 1,69</td><td> 0,37</td><td> 114,66</td><td> 48,56</td><td> 1,24</td>
<td>Kondara</td><td> 0,43</td><td> 142,11</td><td> 32,91</td><td> 0,0263</td><td> 1,34</td><td> 0,32</td><td> 110,82</td><td> 37,00</td><td> 1,09</td>
<td>Ler-1</td><td> 0,36</td><td> 114,15</td><td> 31,56</td><td> 0,0205</td><td> 0,81</td><td> 0,45</td><td> 88,49</td><td> 39,38</td><td> 1,18</td>
<td>Mt-0</td><td> 0,62</td><td> 190,06</td><td> 30,79</td><td> 0,0226</td><td> 1,21</td><td> 0,51</td><td> 121,79</td><td> 40,53</td><td> 1,18</td>
<td>Shakdara</td><td> 0,55</td><td> 187,62</td><td> 34,02</td><td> 0,0235</td><td> 1,35</td><td> 0,41</td><td> 93,04</td><td> 25,53</td><td> 1,00</td>
Table 5
Table 6
Arabidopsis ecotypes, additional parameters measured χ mrt
<td>Ecotype</td><td>Vegetative growth rate (cm<sup>2</sup> / day) up to 8 sheets true</td><td>I grew up. root relative (cm / day) day 13</td><td>Eong. root day 7 (cm)</td><td>Long. root day 13 (cm)</td><td>Weight fresh per plant (gr) in stage of induction floral</td><td>long. reed (cm)</td><td>-HW foil width (cm)</td><td>1 D »1; ΜΤχΐζ LA width / l ong of</td><td>....or t ».o ai aí. -i- shovel circularity</td>
<td>An-I</td><td> 0,313</td><td> 0,631</td><td> 0,937</td><td> 4,419</td><td> 1,510</td><td> 2,767</td><td> 1,385</td><td> 0,353</td><td> 0,509</td>
<td>Col-0</td><td> 0,378</td><td> 0,664</td><td> 1,759</td><td> 8,530</td><td> 3,607</td><td> 3,544</td><td> 1,697</td><td> 0,288</td><td> 0,481</td>
<td>Ct-1</td><td> 0,484</td><td> 1,176</td><td> 0,701</td><td> 5,621</td><td> 1,935</td><td> 3,274</td><td> 1,460</td><td> 0,316</td><td> 0,450</td>
<td>Cvi (N8580)</td><td> 0,474</td><td> 1,089</td><td> 0,728</td><td> 4,834</td><td> 2,082</td><td> 3,785</td><td> 1,374</td><td> 0,258</td><td> 0,370</td>
<td>Gr-6</td><td> 0,425</td><td> 0,907</td><td> 0,991</td><td> 5,957</td><td> 3,556</td><td> 3,690</td><td> 1,828</td><td> 0,356</td><td> 0,501</td>
<td>Kondara</td><td> 0,645</td><td> 0,774</td><td> 1,163</td><td> 6,372</td><td> 4,338</td><td> 4,597</td><td> 1,650</td><td> 0,273</td><td> 0,376</td>
<td>Lcr-1</td><td> 0,430</td><td> 0,606</td><td> 1,284</td><td> 5,649</td><td> 3,467</td><td> 3,877</td><td> 1.510</td><td> 0,305</td><td> 0,394</td>
<td>Mt-0</td><td> 0,384</td><td> 0,701</td><td> 1.414</td><td> 7,060</td><td> 3,479</td><td> 3,717</td><td> 1,817</td><td> 0,335</td><td> 0,491</td>
<td>Shakdara</td><td> 0,471</td><td> 0,782</td><td> 1,251</td><td> 7,041</td><td> 3,710</td><td> 4,149</td><td> 1,668</td><td> 0,307</td><td> 0,409</td>
Table 6
The selected genes, their R (calculated using the Pearson correlation), the characterized parameters used as the x-axis for correlation, and the correlated tissue transcriptome, were synthesized in Table 7, below.
Table 7
Selected Arabidopsis genes and their correlation with performance components between different transcriptome groups
<td></td><td>Nucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Gene name</td><td>Complex name (cluster)</td><td>Group exp.</td><td>Vector run.</td><td>R</td>
<td> 1</td><td> 3</td><td> 168</td><td>BDL2</td><td>arabidopsis | 6 | A T1G34580</td><td>B</td><td> 8</td><td> 0.77</td>
<td> 2</td><td> 3</td><td> 168</td><td>BDL2</td><td>arabidopsis | 6 | ATlG34580</td><td>D</td><td> 15</td><td> 0,75</td>
<td>• Ί</td><td> 3</td><td> 168</td><td>BDL2</td><td>arabidopsis) 6 | AT 1G34580</td><td>D</td><td> 16</td><td> 0,71</td>
<td> 4</td><td> 6</td><td> 171</td><td>BDE6</td><td>arabidops¡s | 6 | AT4G10490</td><td>AND</td><td> 12</td><td> -0,7</td>
<td> 5</td><td> 7</td><td> 172</td><td>BDI.7</td><td>arabidopsis | 6¡AT5G51490</td><td>TO</td><td> 15</td><td> 0,76</td>
<td> 6</td><td> 7</td><td> 172</td><td>BDL7</td><td>arabidopsis | 6 | AT5G51490</td><td>TO</td><td> 16</td><td> 0,74</td>
<td></td><td>Nucleotide NR SEQ ID:</td><td>Polypeptide, \ 7? SEC ID:</td><td>Name of! gen</td><td>Complex name (cluster)</td><td>Jí i. IN »</td><td></td><td></td>
<td rowspan="2"> 7</td><td rowspan="2"> 7</td><td rowspan="2"> 172</td><td rowspan="2">BDL7</td><td rowspan="2">arabidopsis | 6 | AT5G51490</td><td>B</td><td> 4</td><td> -0,78</td>
<td></td><td></td><td></td>
<td> 8</td><td> 7</td><td> 172</td><td>BDL7</td><td>arabidopsis | 6 | AT5G51490</td><td>B</td><td> 9</td><td> -0,77</td>
<td> 9</td><td> 7</td><td> 172</td><td>BDL7</td><td>arabidopsis | 6 | AT5G51490</td><td>B</td><td> 10</td><td> -0,73</td>
<td> 10</td><td> 7</td><td> 172</td><td>BDL7</td><td>arabidopsis | 6 | AT5G51490</td><td>B</td><td> 17</td><td> 0,88</td>
<td>II</td><td> 8</td><td> 173</td><td>BDL8</td><td>arabidopsis (6 | AT3G03240</td><td>D</td><td> 15</td><td> 0,87</td>
<td> 12</td><td> 8</td><td> 173</td><td>BDL8</td><td>arabidopsis | 6 | AT3G03240</td><td>D</td><td> 16</td><td> 0,89</td>
<td> 13</td><td> 9</td><td> 174</td><td>BDL9</td><td>arabidopsis | 6 | AT5G24130</td><td>D</td><td> 15</td><td> 0,75</td>
<td> 14</td><td> 9</td><td> 174</td><td>BDL9</td><td>arab idops is | 6 | AT5G24130</td><td>D</td><td><sup>16</sup></td><td> 0,75</td>
<td> 15</td><td> 9</td><td> 174</td><td>BDL9</td><td>arabidops is6 | AT5G24130</td><td>AND</td><td> 13</td><td> 0,75</td>
<td> 16</td><td> 10</td><td> 175</td><td>BD1.10</td><td>arabidopsis | 6 | AT5G09640</td><td>AND</td><td>II</td><td> 0,72</td>
<td> 17</td><td> 13</td><td> 178</td><td>BDL14</td><td>arabldopsis | 6 | AT 1G53690</td><td>B</td><td> 11</td><td> 0,87</td>
<td> 18</td><td> 13</td><td> 178</td><td>BDL14</td><td>arabidops is | 6 | AT1G53690</td><td>B</td><td> 12</td><td> -0.71</td>
<td> 19</td><td> 13</td><td> 178</td><td>BDLI4</td><td>arabidops is | 6 | AT1G53690</td><td>B</td><td> 14</td><td> 0,71</td>
<td> 20</td><td> 13</td><td> 178</td><td>BDL14</td><td>arabidupsis | 6 | ATlG53690</td><td>AND</td><td> 11</td><td> 0,72</td>
<td> 21</td><td> 14</td><td> 179</td><td>BDL15</td><td>arabidops is | 6 | AT 1G68510</td><td>AND</td><td> 15</td><td> 0,72</td>
<td> 22</td><td> 16</td><td> 181</td><td>BDLI7</td><td>arabidopsis | 6 | AT5G36770</td><td>D</td><td> 15</td><td> 0,75</td>
<td> 23</td><td> 18</td><td> 183</td><td>BDI.19</td><td>arabidopsis | 6 | AT2G02080</td><td>C</td><td> 16</td><td> 0,7</td>
<td> 24</td><td> 18</td><td> 183</td><td>BDL19</td><td>arabidopsis | 6 | A T2G02080</td><td>D</td><td rowspan="2"> 17 11</td><td> 0,72</td>
<td rowspan="2"> 25 26~</td><td> 19</td><td> 184</td><td>BDL20a</td><td>arab idops is | 6 | AT 1G47540</td><td>Λ</td><td> 0,85</td>
<td> 20</td><td> 185</td><td>BDL20b</td><td>arabidopsis | 6¡ATlG4754Ü</td><td>TO</td><td> 11</td><td> 0,85</td>
<td> 27</td><td> 21</td><td> 186</td><td>BDL21</td><td>arabidopsis | 6¡AT3G62730</td><td>D</td><td> 17</td><td> 0.8</td>
<td> 28</td><td> 21</td><td> 186</td><td>BDL21</td><td>arabidopsis | 6 | AT3G62730</td><td>AND</td><td> 11</td><td> 0,79</td>
<td> 29</td><td> 21</td><td> 186</td><td>BD1.21</td><td>arabidopsis | 6 | AT3G62730</td><td>AND</td><td> 14</td><td> 0.79</td>
<td> 30</td><td> 22</td><td> 187</td><td>BDL22</td><td>arabidopsis | 6 | AT2G27380</td><td>TO</td><td>II</td><td> 0,81</td>
<td> 31</td><td> 22</td><td> 187</td><td>BDL22</td><td>arabldopsis | 6 | AT2G27380</td><td>TO</td><td> 12</td><td> -0,75</td>
<td> 32</td><td> 23</td><td> 188</td><td>BDL23</td><td>arabidopsis | 6 | AT3G27785</td><td>AND</td><td> 11</td><td> 0,7</td>
<td> 33</td><td> 23</td><td> 188</td><td>BD1.23</td><td>arabidopsis | 6 | AT3G27785</td><td>AND</td><td> 12</td><td> -0,86</td>
<td> 34</td><td> 23</td><td> 188</td><td>BDL23</td><td>arabidopsis | 6 | AT3G27785</td><td>AND</td><td> 14</td><td> 0,71</td>
<td> 35</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>TO</td><td> 5</td><td rowspan="2"> 0.77 .... —</td>
<td> 36</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis) 6¡AT3G20910</td><td>TO</td><td> 8</td>
Λ f -ττ
<td></td><td>Nucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Gene name</td><td>Complex name (cluster)</td><td>-rrsTrrur 5E L, Group exp.</td><td>> WEXíO.NJ INDUSTRIAL run.</td><td></td>
<td> 37</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidops is | 6 | AT3G20910</td><td>b</td><td></td><td> 1. .</td>
<td> 38</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>B</td><td> 16</td><td> 0,75</td>
<td> 39</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsisjó AT3G20910</td><td>C</td><td> 15</td><td> 0,77</td>
<td> 40</td><td> 25</td><td rowspan="2"> 190 190</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>C</td><td> 16</td><td> 0,81</td>
<td> 41</td><td> 25</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>D</td><td> 12</td><td> 0,77</td>
<td> 42</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>D</td><td> 15</td><td> 0,73</td>
<td> 43</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>D</td><td> 16</td><td> 0,8</td>
<td> 44</td><td> 26</td><td> 191</td><td>BDL26a</td><td>arabidops¡s | 6 | AT 1G11170</td><td>C</td><td> 15</td><td> -0,77</td>
<td> 45</td><td> 27</td><td> 192</td><td>RD1.26h</td><td>arabidopsis | 6 | AT! Gl i 170</td><td>C</td><td> 15</td><td> -0.77</td>
<td> 46</td><td> 28</td><td> 193</td><td>BDL27</td><td>arabidopsis | 6 | ATl G68380</td><td>TO</td><td> 13</td><td> -0,71</td>
<td> 47</td><td> 28</td><td> 193</td><td>BD1.27</td><td>arabidopsis | 6 | A ΙΊ 068380</td><td>c</td><td> 13</td><td> -0,75</td>
<td> 48</td><td> 28</td><td> 193</td><td>BDL27</td><td>arabidopsis | 6 | ATlG68380</td><td>AND</td><td> 11</td><td> 0,71</td>
<td> 49</td><td> 28</td><td> 193</td><td>BDL27</td><td>arabidopsis | 6 | ATlG68380</td><td>AND</td><td> 14</td><td> 0,74</td>
<td> 50</td><td> 29</td><td> 194</td><td>BDL28</td><td>arabidops is | 6 | AT1G09380</td><td>C</td><td> 11</td><td> 0,87</td>
<td> 51</td><td> 29</td><td> 194</td><td>BDL28</td><td>arabidopsis | 6 | AT 1G09380</td><td>C</td><td> 12</td><td> -0,79</td>
<td> 52</td><td> 29</td><td> 194</td><td>BDL28</td><td>arabidops is | 6 | AT 1G09380</td><td>c</td><td> 14</td><td> 0,73</td>
<td> 53</td><td> 29</td><td> 194</td><td>BDL28</td><td>arabidops¡s | 6 | AT 1G09380</td><td>AND</td><td> 15</td><td> 0,83</td>
<td> 54</td><td> 29</td><td> 194</td><td>BDL28</td><td>arabidops is | 6) AT 1G09380</td><td>AND</td><td> 16</td><td> 0,8</td>
<td> 55</td><td> 30</td><td> 195</td><td>BDL29</td><td>arabidops is | 6 | AT 1G60970</td><td>B</td><td> 9</td><td> -0,74</td>
<td> 56</td><td> 30</td><td> 195</td><td>BDL29</td><td>arab ¡dops is | 6 | AT 1G60970</td><td>C</td><td>II</td><td> 0,76</td>
<td> 57</td><td> 30</td><td> 195</td><td>BDL29</td><td>arabidops is | 6 | AT 1G60970</td><td>D</td><td> 12</td><td> 0,87</td>
<td> 58</td><td> 30</td><td> 195</td><td>BDI.29</td><td>arab idops is 16¡ AT 1G60970</td><td>D</td><td> 15</td><td> 0,88</td>
<td> 59</td><td> 30</td><td> 195</td><td>BDL29</td><td>arabidopsis | 6 | A1 1G60970</td><td>D</td><td> 16</td><td> 0,93</td>
<td rowspan="2">60 ”6Ϊ </td><td> 30</td><td> 195</td><td>BDL29</td><td>arab idops is) 6 | AT 1G60970</td><td>AND</td><td> 11</td><td> 0,8</td>
<td> 32</td><td> 197</td><td>BDL31</td><td>arabidopsis | 6 | AT2G28490</td><td>TO</td><td> 11</td><td> 0,85</td>
<td> 62</td><td> 32</td><td> 197</td><td>BDL31</td><td>arabidops is | 61AT2O2 8490</td><td>TO</td><td> 12</td><td> -0,74</td>
<td> 63</td><td> 32</td><td> 197</td><td>BDL31</td><td>arabidopsis | 6 | AT2G28490</td><td>TO</td><td> 14</td><td> 0,71</td>
<td> 64</td><td> 35</td><td> 200</td><td>BDL166</td><td>arab ¡dops is | 6 | AT 1G71691</td><td>D</td><td> 12</td><td> 0.78</td>
<td> 65</td><td> 35</td><td> 200</td><td>BDL166</td><td>arab idops is | 6 | AT 1G71691</td><td>D</td><td> 17</td><td> 0,72</td>
<td> 66</td><td> 36</td><td> 201</td><td>BDL unnamed 330</td><td>arabidopsis | 6 | ATlG73220</td><td>B</td><td> 6</td><td> 0,8</td>
<td></td><td>Nucleotide NR IO OF SEC:</td><td>Polypeptide NR SEQ ID:</td><td>Name of! gen</td><td>Complex name (elusier)</td><td>Grworwfro Dfc lA P G</td><td>& éctL í i » OUSTIUAL</td><td></td>
<td> 67</td><td> 36</td><td> 201</td><td>BDL. unnamed 330</td><td>arabidopsis6 | AT 1G73220</td><td>c</td><td> 12</td><td> -0,78</td>
<td> 68</td><td> 36</td><td> 201</td><td>BDL unnamed 330</td><td>arabidopsis | 6 | AT 1G73220</td><td>c</td><td> 17</td><td> -0,77</td>
<td> 69</td><td> 36</td><td> 201</td><td>BDL_unnamed_330</td><td>arabidopsis | 6 | ATlG73220</td><td>D</td><td> 17</td><td> -0,76</td>
<td> 70</td><td> 37</td><td> 202</td><td>BDL iimiained_ 331</td><td>arabidopsis | 6 | AT5G01790</td><td>B</td><td> 5</td><td> 0,85</td>
<td> 71</td><td> 37</td><td> 202</td><td>BDL unnamed_331</td><td>arabidopsis | 6 | AT5U01790</td><td>AND</td><td> 14</td><td> 0,72</td>
<td> 72</td><td> 38</td><td> 203</td><td>BDl.unnamed 333</td><td>arabidops ts | 6 | AT 1G71120</td><td>B</td><td> 12</td><td> -0,77</td>
<td> 73</td><td> 38</td><td> 203</td><td>BDL unnamed 333</td><td>arabidopsis | 6 | AT! G71120</td><td>B</td><td> 14</td><td> 0,77</td>
<td> 74</td><td> 38</td><td> 203</td><td>BDL unnamed_333</td><td>arabidopsis, 6IATlG71120</td><td>AND</td><td> 11</td><td> 0,82</td>
<td> 75</td><td> 38</td><td> 203</td><td>BDL unnamed 333</td><td>arabidopsis | 6 | AT 1G71120</td><td>AND</td><td> 14</td><td> 0,88</td>
<td> 76</td><td> 39</td><td> 204</td><td>BDL unnamed_334</td><td>arabidopsis | 6 | AT5G38170</td><td>D</td><td> 15</td><td> 0,82</td>
<td>η</td><td> 39</td><td> 204</td><td>BDL unnamed 334</td><td>arabidopsis | 6 | AT5G38! 70</td><td>D</td><td> 16</td><td> 0.81</td>
<td rowspan="2"> 28</td><td> 39</td><td> 204</td><td>BDL unnamed 334</td><td>arabidopsis | 6 | A T5G38170</td><td>AND</td><td>eleven j- ....... .......</td><td> 0.87</td>
<td> 39</td><td> 204</td><td>BDI._unnamed_334</td><td>arabidopsis¡6 | AT5G38170</td><td>AND</td><td> 12</td><td> -0.75</td>
<td> 80</td><td> 39</td><td> 204</td><td>BDL unnamed 334</td><td>arabidopsis¡6¡ΑΊ 5G38¡70</td><td>AND</td><td> 14</td><td> 0.79</td>
<td> 81</td><td> 40</td><td> 205</td><td>BDL unnamed_335</td><td>arabidopsis! 6A'l 3G25160</td><td>TO</td><td>I</td><td> -0,89</td>
<td> 82</td><td> 40</td><td> 205</td><td>BDL unnamed__335</td><td>arabidopsisjó! AT3G25160</td><td>TO</td><td>X</td><td> -0,76</td>
<td> 83</td><td> 40</td><td> 205</td><td>BDLunnamed 335</td><td>arabidopsis¡6 | AT3G25160</td><td>AND</td><td> 11</td><td> 0.71</td>
<td> 84</td><td> 42</td><td> 207</td><td>BDL unnamed_337</td><td>arabidopsis | 6 | AT2G22620</td><td>TO</td><td> 13</td><td> -0,76</td>
<td> 85</td><td> 42</td><td> 207</td><td>BDL unnamed_337</td><td>arabidopsis | 6 | AT2G22620</td><td>AND</td><td> 15</td><td> 0,86</td>
<td> 86</td><td> 42</td><td> 207</td><td>BDL unnamed_337</td><td>arabidopsis | 6 | AT2G22620</td><td>AND</td><td> 16</td><td> 0 79</td>
<td> 87</td><td> 43</td><td> 208</td><td>BDL unnamed_339</td><td>arabidopsis | 6 | AT3G26480</td><td>TO</td><td> 11</td><td> 0.84</td>
<td> 88</td><td> 43</td><td> 208</td><td>BDL unnamed 339</td><td>arabidopsis | 6IAT3G26480</td><td>TO</td><td> 14</td><td> 0.73</td>
<td rowspan="2">89 NEITHER</td><td> 43</td><td> 208</td><td>BDL unnamed 339</td><td>arabidops isÍ6¡AT3G2 6480</td><td>C</td><td rowspan="2">II</td><td> 0,76</td>
<td> 43</td><td> 208</td><td>BDL unnamed 339</td><td>arabidopsis, 6iAT3G26480</td><td>c</td><td> 0.88</td>
<td rowspan="3"> 9! .--..- ---.-</td><td rowspan="2"> 44 44</td><td> 209</td><td>BDL unnamed 340</td><td colspan="2">arabidopsis! 6) ATlG64660 j A i .................. i ............... ........</td><td></td><td rowspan="2">0.83 (Ϊ7</td>
<td> 209</td><td>BDL_ unnamed 340</td><td>arabidops is | 6 | A'l IG64660</td><td>TO</td><td> 7</td>
<td> 46</td><td>21 i</td><td>BDL unnamed_341</td><td>arabidopsis¡ólÁT5G52330</td><td> 1·</td><td> 17</td><td> 0,85</td>
<td> 94</td><td> 49</td><td> 214</td><td>BD1. unnamed 343</td><td>arabidopsis, 6jAT5G64080</td><td>c</td><td> 12</td><td> 0.74</td>
<td> 95</td><td> 49</td><td> 214</td><td>BDL unnamed 343</td><td>arabidopsis6 | AT5G64080</td><td>c</td><td> 16</td><td> 0.77</td>
<td> 96</td><td> 50</td><td> 215</td><td>B DL_unnamed_344</td><td>arabidopsis | 6¡AT2G43060</td><td>B</td><td> 11</td><td> 0.89</td>
'o
Τ'i '
<td></td><td>Nucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Gene name</td><td>Complex name (cluster)</td><td>INSTITUTE A Grupo WÁa f IN</td><td>Tfc — X — 5 <OHEOAD DUÍWra ·</td><td></td>
<td> 97</td><td> 50</td><td> 215</td><td>BDL unnamed 344</td><td>arabidopsis | 6 | AT2G43060</td><td></td><td> 12</td><td> -0,73</td>
<td> 98</td><td> 50</td><td><sup>215</sup></td><td>B DL unnamed 344</td><td>arabidopsis¡6 | AT2G43060</td><td>B</td><td> 18</td><td> -0,81</td>
<td> 99</td><td> 50</td><td> 215</td><td>BDL unnamed 344</td><td>arabidopsis | 6 | AT2G43060</td><td>AND</td><td> 15</td><td> 0,8</td>
<td> 100</td><td> 52</td><td> 217</td><td>BDL_unnamed_346</td><td>arabidopsis | 6 | AT2G41340</td><td>TO</td><td> 13</td><td> -0,72</td>
<td> 101</td><td> 52</td><td> 217</td><td>BDL unnamed_346</td><td>arabidopsis | 6 | AT2G41340</td><td>B</td><td> 5</td><td> 0,72</td>
<td> 102</td><td> 52</td><td> 217</td><td>BDL unnamed_346</td><td>arab¡dops¡s | 6¡AT2G41340</td><td>B</td><td> 8</td><td> 0,81</td>
<td> 103</td><td> 53</td><td> 218</td><td>BDL unnamed_347</td><td>arabidopsis | 6 | AT5G03450</td><td>TO</td><td> 3</td><td> 0,76</td>
<td> 104</td><td> 53</td><td> 218</td><td>BDLunnamed_347</td><td>arabidopsis | 6 | AT5G03450</td><td>TO</td><td> 5</td><td> 0,74</td>
<td> 105</td><td> 53</td><td> 218</td><td>BDL_unnamed_347</td><td>arabidüpsis | 6 | AT5G03450</td><td>TO</td><td> 15</td><td> 0,74</td>
<td> 106</td><td> 53</td><td> 218</td><td>BDL unnamed_347</td><td>arabidopsis | 6 | AT5G03450</td><td>D</td><td> 15</td><td> 0,78</td>
<td> 107</td><td> 53</td><td> 218</td><td>BDLunnamed347</td><td>arabidopsis | 6 | AT5G03450</td><td>D</td><td> 16</td><td> 0,82</td>
<td> 108</td><td> 55</td><td> 220</td><td>BDL unnamed_349</td><td>arabidopsis | 6 | AT4G33670</td><td>TO</td><td> 5</td><td> 0,74</td>
<td> 109</td><td> 55</td><td> 220</td><td>B DL_unnamed_349</td><td>arabidopsis | 6 | AT4G33670</td><td>TO</td><td> 15</td><td> 0,78</td>
<td> 110</td><td> 55</td><td> 220</td><td>BDL unnamed 349</td><td>arabidopsis | 6¡AT4G33670</td><td>TO</td><td> 16</td><td> 0,73</td>
<td> 111</td><td> 55</td><td> 220</td><td>BDL unnamed_349</td><td>arabidopsis | 6 | AT4G33670</td><td>B</td><td> 5</td><td> 0,86</td>
<td> 112</td><td> 56</td><td> 221</td><td>BDL unnamed 350</td><td>arabidopsis | 6 | AT5G04500</td><td>TO</td><td> 13</td><td> -0.72</td>
<td> 113</td><td> 56</td><td> 221</td><td>BDL unnamed_350</td><td>arabidopsisl6 | AT5G04500</td><td>C</td><td> 15</td><td> 0.85</td>
<td> 114</td><td> 56</td><td> 221</td><td>BDL unnamed 350</td><td>arabidopsis | 6IAT5G04500</td><td>C</td><td> 16</td><td> 0,83</td>
<td> 115</td><td> 56</td><td> 221</td><td>BDL unnamed 350</td><td>arabidopsis | 6 | AT5G04500</td><td>AND</td><td> 11</td><td> -0,72</td>
<td> 116</td><td> 56</td><td> 221</td><td>BDL unnamed_35O</td><td>arabidopsis | 6 | AT5G04500</td><td>AND</td><td> 12</td><td> 0,73</td>
<td> 117</td><td> 56</td><td> 221</td><td>BDL_unnamed_350</td><td>arabidopsis | 6 | AT5G04500</td><td>AND</td><td> 17</td><td> 0,74</td>
<td> 118</td><td> 57</td><td> 222</td><td>BDLunnamed351</td><td>arab idops is | 6 | A 'Γ1G27120</td><td>B</td><td> 7</td><td> 0,78</td>
<td> 119</td><td> 57</td><td> 222</td><td>BDL unnamed 351</td><td>arabidopsis | 6 | AT 1G27120</td><td>B</td><td> 13</td><td> 0,74</td>
<td rowspan="2"> 120 12!</td><td> 57</td><td> 222</td><td>BDL unnamed_351</td><td>arabidopsis | 6¡ATlG27120</td><td>C</td><td> 15</td><td> 0,79</td>
<td> 57</td><td> 222</td><td>BDL unnamed 351</td><td>arabidopsis | 6 | AT 1G27120</td><td>C</td><td> 16</td><td> 0,82</td>
<td> 122</td><td> 57</td><td> 222</td><td>BDL unnamed 351</td><td>arabidopsis | 6 | AT 1G27120</td><td>D</td><td> 17</td><td> 0,74</td>
<td> 123</td><td> 58</td><td> 223</td><td>BDL unnamed 352</td><td>arabidopsis | 6 | AT5G01820</td><td>B</td><td> 4</td><td> -0,71</td>
<td> 124</td><td> 58</td><td> 223</td><td>BDL unnamed_352</td><td>arabidopsis¡6 (AT5G0l 820</td><td>B</td><td> 8</td><td> -0.7</td>
<td rowspan="2"> 125 126 -</td><td> 58</td><td> 223</td><td>BDL unnamcd352</td><td>arabidopsis | 6 | AT5G01820</td><td>C</td><td> 15</td><td> -0,74</td>
<td>58 L.</td><td> 223 ___________________</td><td>BDL unnamed 352</td><td>arabidopsis, 6) AT5G01820 ......</td><td>AND</td><td> 16</td><td> 0,71</td>
and
<td></td><td>Nucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Gene name</td><td>Complex name (cluster)</td><td>INSTITUTE a Grupo er / LA p IN</td><td>lOP ^ EDAg</td><td></td>
<td rowspan="2"> 127</td><td rowspan="2"> 60</td><td rowspan="2"> 225</td><td rowspan="2">BDLunnamed354</td><td rowspan="2">arabidops is | 6 AT3G16490</td><td>c</td><td> .. 16</td><td> 0,73</td>
<td></td><td></td><td></td>
<td> 128</td><td> 61</td><td> 226</td><td>BDL unnamed_355</td><td>arabidopsis | 6 | AT5G23050</td><td>D</td><td> 12</td><td> 0,72</td>
<td> 129</td><td> 62</td><td> 227</td><td>BDL_unnamed_356</td><td>arabidopsis | 6 | AT4G 16050</td><td>AND</td><td>II</td><td> 0,95</td>
<td> 130</td><td> 62</td><td> 227</td><td>BDL unnamed 356</td><td>arabidopsis | 6 | AT 4G16050</td><td>AND</td><td> 14</td><td> 0,77</td>
<td> 131</td><td> 63</td><td> 228</td><td>BDL_unnamed_357</td><td>arabidopsis | 6 | ATlG44760</td><td>B</td><td> 15</td><td> 0,73</td>
<td> 132</td><td> 63</td><td> 228</td><td>B Dl._unnamed3 5 7</td><td>arabidops is | 6 | AT1G44760</td><td>B</td><td> 16</td><td> 0,7</td>
<td> 133</td><td> 64</td><td> 229</td><td>B DL_unnamed_3 5 8</td><td>arabidopsis | 6 | AT3G01570</td><td>C</td><td> 16</td><td> 0,71</td>
<td> 134</td><td> 66</td><td> 231</td><td>BDL unnamed_362</td><td>arabidopsis | 6 | AT2G25940</td><td>B</td><td> 15</td><td> 0,83</td>
<td> 135</td><td> 66</td><td> 231</td><td>BDL unnamed 362</td><td>arabidopsis | 6 | AT2G25940</td><td>B</td><td> 16</td><td> 0,84</td>
<td> 136</td><td> 67</td><td> 232</td><td>BDL unnamed_364</td><td>arabidopsis | 6 | AT 1G04660</td><td>D</td><td> 12</td><td> 0,88</td>
<td> 137</td><td> 67</td><td> 232</td><td>BDL unnamed 364</td><td>aiabidops is | 6 | AT 1G04660</td><td>D</td><td> 15</td><td> 0,84</td>
<td> 138</td><td> 67</td><td> 232</td><td>BDL unnamed_364</td><td>arabidopsis | 6 | ATIG04660</td><td>D</td><td> 16</td><td> 0,91</td>
<td> 139</td><td> 68</td><td> 233</td><td>B DL unnamed 365</td><td>arabi dops is | 6 j AT 1G05160</td><td>C</td><td> 16</td><td> 0,71</td>
<td> 140</td><td> 68</td><td> 233</td><td>BDL unnamed_365</td><td>arabidopsis | 6 | AT 1G05160</td><td>D</td><td> 15</td><td> 0,72</td>
<td> 141</td><td> 68</td><td> 233</td><td>BDL_unnamed_365</td><td>arabidopsis | 6 | AT 1G05160</td><td>D</td><td> 16</td><td> 0,72</td>
<td> 142</td><td> 70</td><td> 235</td><td>BDI.unnamed_367</td><td>arabi dops isi6 | AT 1G19900</td><td>B</td><td> 6</td><td> 0,8</td>
<td> 143</td><td> 70</td><td> 235</td><td>BDL unnamed_367</td><td>arabidopsis | 6 | ATlG 19900</td><td>C</td><td> 12</td><td> -0,86</td>
<td> 144</td><td> 70</td><td> 235</td><td>BDL unnamed 367</td><td>arabi dops is | 6¡ AT 1G19900</td><td>C</td><td> 14</td><td> 0,73</td>
<td> 145</td><td> 70</td><td> 235</td><td>B DL unnamed_367</td><td>arabidopsis | 6AT AT 1G19900</td><td>AND</td><td> 15</td><td> 0,71</td>
<td> 146</td><td> 71</td><td> 236</td><td>BDL _unnamed_368</td><td>arabidopsis¡6¡ ATI G23200</td><td>D</td><td> 13</td><td> -0.78</td>
<td> 147</td><td> 71</td><td> 236</td><td>BDL unnamed 368</td><td>arabidopsis (6 | ATl G23200</td><td>AND</td><td> 17</td><td> -0.73</td>
<td> 148</td><td> 72</td><td> 237</td><td>BDL unnamed 369</td><td>arabidopsis | 6j AT 1G26680</td><td>TO</td><td> 1</td><td> 0,84</td>
<td rowspan="2">149 ~ Ϊ50 ~</td><td> 72</td><td> 237</td><td>BDL unnamed_369</td><td>arabidopsis¡6 | AT 1G26680</td><td>TO</td><td> 2</td><td> 0,75</td>
<td> 73</td><td> 238</td><td>BDL unnamed_370</td><td>arabidopsis | 6 | AT 1G28590</td><td>AND</td><td> 11</td><td> 0,9</td>
<td> 151</td><td> 73</td><td> 238</td><td>B DL_ unnamed 3 70</td><td>arabi dops is | 6¡ AT 1G28590</td><td>AND</td><td> 12</td><td> -0,72</td>
<td> 152</td><td> 74</td><td> 239</td><td>B DL unnamed_ 371</td><td>arabi dops is | 6 | At 1G48910</td><td>B</td><td> 12</td><td> 0,72</td>
<td> 153</td><td> 74</td><td> 239</td><td>BDL unnamed 371</td><td>arab i dops is¡ 6 | AT 1G48910</td><td>B</td><td> 15</td><td> 0,79</td>
<td> 154</td><td> 74</td><td> 239</td><td>BDL unnamed 371</td><td>arab i dops is | 6 | AT 1G48910</td><td>B</td><td> 16</td><td> 0,86</td>
<td> 155</td><td> 74</td><td> 239</td><td>B DL unnamed? 71</td><td>arabi dopsis | 6 | AT 1G48910</td><td>C</td><td> 17</td><td> 0,79</td>
<td> 156</td><td> 79</td><td> 244</td><td>BDL unnamed 374</td><td>arabidopsis | 6 | AT IG62610</td><td>D</td><td> 15</td><td> -0,74</td>
<td></td><td>Nucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Gene name</td><td>Name of! complex (cluster)</td><td>ι> ι <τ: τυΊθ Group βφΛΛ i</td><td>rdt—-</td><td> §2®</td>
<td> 157</td><td> 80</td><td> 245</td><td>BDL unnamed_375</td><td>arabidops is | 6 | AT1G76290</td><td>B</td><td></td><td></td>
<td> 158</td><td> 80</td><td> 245</td><td>BDl, _Linnamed375</td><td>arabidops is | 6 | AT1G76290</td><td>c</td><td> 17</td><td> 0,77</td>
<td> 159</td><td> 81</td><td> 246</td><td>BDL unnamed 376</td><td>arabidopsis | 6 | ATI G68470</td><td>B</td><td> 4</td><td> 0,76</td>
<td> 160</td><td> 81</td><td> 246</td><td>BDL unnamed 376</td><td>arabidopsis | 6 | AT 1G68470</td><td>B</td><td> 5</td><td> 0,77</td>
<td> 161</td><td> 81</td><td> 246</td><td>BDL_unnamed_376</td><td>arabidopsis | 6 | AT 1G68470</td><td>B</td><td> 8</td><td> 0,96</td>
<td> 162</td><td> 81</td><td> 246</td><td>BDL_unnamed_376</td><td>arabidopsis | 6 | AT 1G68470</td><td>B</td><td> 10</td><td> 0,89</td>
<td> 163</td><td> 81</td><td> 246</td><td>BDL unnamed 376</td><td>arabidopsis | 6 | ATlG68470</td><td>C</td><td> 15</td><td> 0,83</td>
<td> 164</td><td> 81</td><td> 246</td><td>B DL unnamed 3 76</td><td>arabidops is | 6 | AT 1G68470</td><td>C</td><td> 16</td><td> 0,74</td>
<td> 165</td><td> 81</td><td> 246</td><td>BDL unnamed 376</td><td>arabidopsis | 6 | AT 1G68470</td><td>D</td><td> 13</td><td> -0,81</td>
<td> 166</td><td> 81</td><td> 246</td><td>B DL unnamed_3 76</td><td>arabidopsis | 6 | AT 1G68470</td><td>D</td><td> 14</td><td> -0,82</td>
<td> 167</td><td> 82</td><td> 247</td><td>BDL_unnamed_377</td><td>arabidopsis | 6¡ AT 1G71250</td><td>AND</td><td> 11</td><td> 0,72</td>
<td> 168</td><td> 82</td><td> 247</td><td>BDL unnamed_377</td><td>arabidopsis | 6 | AT 1G71250</td><td>Π</td><td> 14</td><td> 0,8</td>
<td> 169</td><td> 82</td><td> 247</td><td>BDL_unnamed_377</td><td>arabidops is | 6 | AT 1G71250</td><td>AND</td><td> 17</td><td> -0.7</td>
<td> 170</td><td> 83</td><td> 248</td><td>BDL unnamed 379</td><td>arabidopsis | 6 | AT3G58200</td><td>B</td><td> 6</td><td> 0,75</td>
<td> 171</td><td> 84</td><td> 249</td><td>BDL unnamed 380</td><td>arabidopsis | 6 | ATIG78500</td><td>TO</td><td> 1</td><td> -0,74</td>
<td> 172</td><td> 84</td><td> 249</td><td>BDL unnamed 380</td><td>arabidopsis | 6¡ATlG7f> 500</td><td>B</td><td> 7</td><td> 0,75</td>
<td> 173</td><td> 84</td><td> 249</td><td>BDL unnamed 380</td><td>arabidopsis | 6 | AT 1G78500</td><td>B</td><td> 18</td><td> 0,84</td>
<td> 174</td><td> 85</td><td> 250</td><td>BDL unnamed 381</td><td>arabidopsis | 6 | AT2G 14690</td><td>AND</td><td> 15</td><td> -0.72</td>
<td> 175</td><td> 88</td><td> 253</td><td>BDL unnamed 384</td><td>arabidopsis | 6 | AT2G23510</td><td>B</td><td> 12</td><td> 0,74</td>
<td> 176</td><td> 88</td><td> 253</td><td>BDI unnamed_384</td><td>arabidopsis | 6 | AT2G235IO</td><td>B</td><td> 15</td><td> 0,71</td>
<td> 177</td><td> 88</td><td> 253</td><td>BDL unnamed_384</td><td>arabidopsis | 6 | AT2G235IO</td><td>B</td><td> 16</td><td> 0,8</td>
<td> 178</td><td> 89</td><td> 254</td><td>BDL unnamed_385</td><td>arabidopsis | 6 | AT2G26070</td><td>B</td><td> 15</td><td> 0,91</td>
<td> 179</td><td> 89</td><td> 254</td><td>BDL unnamed 3X5</td><td>arabidopsis | 6 | AT2G26070</td><td>B</td><td> 16</td><td> 0,88</td>
<td> 180</td><td> 90</td><td> 255</td><td>BDL_unnamed_386</td><td>arabidopsis | 6AT2G28650</td><td>D</td><td> 13</td><td> -0,93</td>
<td> 181</td><td> 90</td><td> 255</td><td>BDL unnamed_386</td><td>arabidopsis | 6 | AT2G28650</td><td>D</td><td> 14</td><td> -0,87</td>
<td> 182</td><td> 90</td><td> 255</td><td>BDL_unnamed_386</td><td>arabidopsis | 6] AT2G28650</td><td>AND</td><td> 15</td><td> 0,7</td>
<td> 183</td><td> 91</td><td> 256</td><td>BDL unnamed_388</td><td>arabidopsis | 6 | AT2G41290</td><td>AND</td><td> 11</td><td> 0,78</td>
<td> 184</td><td> 93</td><td> 258</td><td>BDL unnamed 390</td><td>arabidopsis | 6 | AT2G47750</td><td>B</td><td> 8</td><td> 0,79</td>
<td> 185</td><td> 93</td><td> 258</td><td>BDL unnamed_39O</td><td>arabidopsis | 6 [AT2G47750</td><td>D</td><td> 14</td><td> 0,84</td>
<td> 186</td><td> 93</td><td> 258</td><td>B DL unnamed 390</td><td>arabidopsis | 6 | AT2G47750</td><td>AND</td><td> 14</td><td> 0,71</td>
IMPJ
<td></td><td>Nucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Name of! gen</td><td>Complex name (cluster)</td><td>INSTITUTE Grupo dKp.LA</td><td>-kxíOTWAl</td><td></td>
<td> 187</td><td> 93</td><td> 258</td><td>BDL_unnamed_390</td><td>arabidopsis | 6 | AT2G47750</td><td>E ..</td><td></td><td>-.ÍI.7U—.</td>
<td> 188</td><td> 94</td><td> 259</td><td>BDL unnamed 391</td><td>arabidopsis | 6 | AT3G03230</td><td>D</td><td> 15</td><td> 0,96</td>
<td> 189</td><td> 94</td><td> 259</td><td>BDL unnamed_39l</td><td>arabidopsis | 6 | AT3G03230</td><td>D</td><td> 16</td><td> 0,95</td>
<td> 190</td><td> 94</td><td> 259</td><td>BDL unnamed_391</td><td>arabidopsis [6 | AT3G03230</td><td>AND</td><td> 14</td><td> -0,73</td>
<td> 191</td><td> 95</td><td> 260</td><td>liDLuiiiiamcd_392</td><td>arabidopsis | 6 | AT3G04200</td><td>B</td><td> 7</td><td> 0,85</td>
<td> 192</td><td> 95</td><td> 260</td><td>BDLunnamed 392</td><td>arabidopsis | 6 | AT3G04200</td><td>B</td><td> 9</td><td> -0,94</td>
<td> 193</td><td> 95</td><td> 260</td><td>BDL_unnamed_392</td><td>arabidopsis | or | AT3G04200</td><td>B</td><td> 13</td><td> 0,78</td>
<td> 194</td><td> 98</td><td> 263</td><td>BDL unnamed_395</td><td>arabidopsis | 6 | AT3G49380</td><td>B</td><td> 4</td><td> -0,78</td>
<td> 195</td><td> 98</td><td> 263</td><td>BDL_unnamed_395</td><td>arabidops¡s | 6 | AT3G49380</td><td>B</td><td> 9</td><td> -0,77</td>
<td> 196</td><td> 98</td><td> 263</td><td>BDL_unnamed_395</td><td>arabidopsis | 6 | AT3G49380</td><td>B</td><td> 10</td><td> -0,73</td>
<td> 197</td><td> 98</td><td> 263</td><td>BDL_unnamed_395</td><td>arabidopsis | 6 | AT3G49380</td><td>B</td><td> 17</td><td> 0,88</td>
<td> 198</td><td> 98</td><td> 263</td><td>BDL_unnamed_395</td><td>arabidopsis | 6 | AT3G49380</td><td>C</td><td> 12</td><td> 0,71</td>
<td> 199</td><td> 98</td><td> 263</td><td>BDL_unnamed_395</td><td>arabidopsis | 6 | AT3G49380</td><td>C</td><td> 15</td><td> 0,75</td>
<td> 200</td><td> 98</td><td> 263</td><td>BDL unnamed 395</td><td>arabidopsis | 6 | AT3G49380</td><td>C</td><td> 16</td><td> 0,82</td>
<td> 201</td><td> 98</td><td> 263</td><td>BDL unnamed_395</td><td>arabidupsis | 6 | AT3G49380</td><td>AND</td><td> 11</td><td> 0,82</td>
<td> 202</td><td> 104</td><td> 269</td><td>BDL unnamed 400</td><td>arabidopsis¡6 | AT4G33600</td><td>B</td><td> 12</td><td> 0,8</td>
<td> 203</td><td> 104</td><td> 269</td><td>B DL unnamed_400</td><td>arabidopsis | 6 | AT4G33600</td><td>AND</td><td> 11</td><td> 0,84</td>
<td> 204</td><td> 104</td><td> 269</td><td>BDl.unnamed400</td><td>arabidops¡s | 6 | AT4G33600</td><td>AND</td><td> 14</td><td> 0,8</td>
<td> 205</td><td> 106</td><td> 271</td><td>B DL unnamcd 402</td><td>arabidopsis | 6 | AT5G08460</td><td>D</td><td> 15</td><td> 0,77</td>
<td> 206</td><td> 106</td><td> 271</td><td>BDL unnamed_402</td><td>arabidopsis6 | AT5G08460</td><td>D</td><td> 16</td><td> 0,78</td>
<td> 207</td><td> 107</td><td> 272</td><td>BDL unnamed_403</td><td>arabidopsis | 6 | AT2G34700</td><td>C</td><td>II</td><td> 0,89</td>
<td> 208</td><td> 107</td><td> 272</td><td>BDL unnamed 403</td><td>arabidopsis | 6 | AT2G34700</td><td>C</td><td> 12</td><td> -0,71</td>
<td> 209</td><td> 108</td><td> 273</td><td>BDL unnamed 404</td><td>arabldopsis | 6 | AT5G 15740</td><td>B</td><td> 5</td><td> 0,74</td>
<td> 210</td><td> 108</td><td> 273</td><td>BDL unnamed 404</td><td>arabidopsis | 6 | AT 5G15 740</td><td>B</td><td> 8</td><td> 0,71</td>
<td> 211</td><td> 108</td><td> 273</td><td>B DL_unnamed_404</td><td>arabidopsis | 6 | AT5Gl 5740</td><td>F.</td><td> 15</td><td> 0,8</td>
<td> 212</td><td> 109</td><td> 274</td><td>BDI.unnamed_405</td><td>arabidops is | 6 | AT5G16230</td><td>TO</td><td> 1</td><td> -0,75</td>
<td> 213</td><td> 109</td><td> 274</td><td>BDL unnamed 405</td><td>arabidopsis | 6 | AT5G 16230</td><td>B</td><td> 8</td><td> 0,83</td>
<td> 214</td><td> 109</td><td> 274</td><td>BDL unnamed 405</td><td>arabidopsis | 6 | AT5G 16230</td><td>C</td><td> 12</td><td rowspan="2"> -0,8 ~ 0,73</td>
<td> 215</td><td> 109</td><td> 274</td><td>BDL unnamed 405</td><td>arabidopsis! 6 | AT5G 16230</td><td>D</td><td> 12</td>
<td> 216</td><td> 109</td><td> 274</td><td>BDL unnamed 405</td><td>arabidopsis | 6 | AT5G 16230</td><td>D</td><td> 16</td><td> 0.74</td>
tí 'l · ¿t p¡ y ;; i V i .....
<td></td><td>Nucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Gene name</td><td>Complex name (cluster)</td><td>---- H-— λ. ,, - ·> - .Λ-ΤΊνΤΟ? Group exp.A:</td><td>.....F u.ÁKfeüSír '</td><td></td>
<td> 217</td><td>mess</td><td> 275</td><td>BDL unnamed 406</td><td>arabidops¡s | 6 | AT5G 18290</td><td></td><td>_______IL</td><td> -0,76</td>
<td> 218</td><td> 112</td><td> 277</td><td>BDL unnamed_408</td><td>arabidopsis | 6 | AT5G39130</td><td>B</td><td> 12</td><td> 0,79</td>
<td> 219</td><td> 112</td><td> 277</td><td>BDL unnamed_408</td><td>arabidopsis | 6 | AT5G39130</td><td>B</td><td> 13</td><td> 0,76</td>
<td> 220</td><td> 112</td><td> 277</td><td>BDL unnamed 408</td><td>arabidopsis | 6 | AT5G39130</td><td>B</td><td> 16</td><td> 0,79</td>
<td> 221</td><td> 112</td><td> 277</td><td>BDLunnanied408</td><td>arabhodopsis | 6 | AT5G39! 30</td><td>C</td><td> 14</td><td> 0,79</td>
<td> 222</td><td> 112</td><td> 277</td><td>BDL_unnamed408</td><td>arabidopsis | 6 | AT5G39130</td><td>D</td><td> 14</td><td> 0,79</td>
<td> 223</td><td> 112</td><td> 277</td><td>BDI_unnanied408</td><td>arabidopsis | 6 | AT5G39130</td><td>AND</td><td> 12</td><td> 0,73</td>
<td> 224</td><td> 114</td><td> 279</td><td>BDL unnamed_409</td><td>arabidopsis | 6 | AT5G39160</td><td>B</td><td> 12</td><td> 0,79</td>
<td> 225</td><td> 114</td><td> 279</td><td>B DLunnamcd409</td><td>arab idops is | 6 | AT5G39160</td><td>B</td><td> 13</td><td> 0,76</td>
<td> 226</td><td> 114</td><td> 279</td><td>BDL unnamed_409</td><td>arabidopsis | 6 | AÍ5G39160</td><td> 13</td><td> 16</td><td> 0,79</td>
<td> 227</td><td> 114</td><td> 279</td><td>B DLunnamed 409</td><td>arabidopsis | 6 | AT5G3.9160</td><td>c</td><td> 14</td><td> 0,79</td>
<td> 228</td><td> 114</td><td> 279</td><td>BDI.unnamed409</td><td>arabidopsis | 6 | AT5G39160</td><td>D</td><td> 14</td><td> 0,79</td>
<td> 229</td><td> 114</td><td> 279</td><td>BDL_ unnamed_409</td><td>arab idops is | 6 | AT5G39160</td><td>F.</td><td> 12</td><td> 0,73</td>
<td> 230</td><td> 115</td><td> 280</td><td>BDL unnamed 410</td><td>arabidopsis | 6 (AT5G39190</td><td>B</td><td> 12</td><td> 0,79</td>
<td> 231</td><td> 115</td><td> 280</td><td>BD1. unnamed 410</td><td>arabidopsis6 '/ \ T5G39190</td><td>B</td><td> 13</td><td> 0,76</td>
<td> 232</td><td> 115</td><td> 280</td><td>BDL unnamed 410</td><td>arabidopsis 6 | AT5G39190</td><td>B</td><td> 16</td><td> 0,79</td>
<td> 233</td><td> 115</td><td> 280</td><td>BDL unnamed 410</td><td>arabidopsislój AT5G39190</td><td>C</td><td> 14</td><td> 0,79</td>
<td> 234</td><td> 115</td><td> 280</td><td>BDL_unnamed_410</td><td>arabidopsis | 6 | AT5G39190</td><td>D</td><td> 14</td><td> 0,79</td>
<td> 235</td><td> 115</td><td> 280</td><td>BDL unnamed 410</td><td>arabidopsis | 6 | AT5G39l90</td><td> 1:</td><td> 12</td><td> 0,73</td>
<td> 236</td><td> 116</td><td> 281</td><td>BDL unnamed 411</td><td>arabidopsis | 6 | A 15G44360</td><td>B</td><td> 10</td><td> -0.74</td>
<td> 237</td><td> 117</td><td> 282</td><td>BDL unnamed 412</td><td>arabidopsis | 6¡AT5G47670</td><td>AND</td><td> 11</td><td> 0,86</td>
<td> 238</td><td> 117</td><td> 282</td><td>BDL unnamed 412</td><td>arabidopsis | 6 | AT5G47670</td><td>AND</td><td> 14</td><td> 0,72</td>
<td> 239</td><td> 119</td><td> 284</td><td>BDL unnamed 414</td><td>arabidopsislój AT5G563OO</td><td>c</td><td> 15</td><td rowspan="2"> 0,77 0,78</td>
<td rowspan="2">240 24Ϊ ”</td><td> 119</td><td> 284</td><td>BDL_ unnamed 414</td><td>arabidops¡s | 6! AT5G56300</td><td>c</td><td>16 L</td>
<td> 119</td><td> 284</td><td>13 DI unnamed 414</td><td>arabidopsis | 6 | / \ l 5G56300</td><td><sup>D</sup></td><td rowspan="2"> 15</td><td rowspan="2"> 0,78 0.82</td>
<td> 212</td><td> 119</td><td> 284</td><td>BDL_unnamed 414</td><td>aiabidupsis! 6i AT5G56300</td><td>D</td>
<td> 243</td><td> 121</td><td> 286</td><td>BDL unnamcd_418</td><td>arabidopsis | 6¡ AT1G2864G</td><td colspan="2">B | <sup>18</sup>i</td><td> 0,81</td>
<td> 244</td><td> 122</td><td> 287</td><td>BDL unnamed_419</td><td>arabidopsisl6¡Al 1G22990</td><td>F-</td><td> 11</td><td> 0,95</td>
<td> 245</td><td> 122</td><td> 287</td><td>BDL unnamed 419</td><td>arabidops isi 6¡ AT 1G22990</td><td>L</td><td> 14</td><td> 0,8</td>
<td>24o</td><td> 123 _________________________________</td><td> 288</td><td>BDL unnamed 420</td><td>arabidopsis | 6¡ATlG64110</td><td>B</td><td> 6</td><td> 0,78</td>
IM F
<td></td><td>Nucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Gene name</td><td>Complex name (cluster)</td><td>MU Grupe tucpmoi INSTITUTE INDO</td><td>CtMecunfe</td><td></td>
<td rowspan="2"> 247</td><td rowspan="2"> 125</td><td rowspan="2"> 290</td><td rowspan="2">BDL unnamed_421</td><td>arabidopsis | 6 | ATlG04380 _</td><td>D</td><td> 15</td><td> 0,73</td>
<td></td><td></td><td></td><td></td>
<td> 248</td><td> 126</td><td> 291</td><td>BDLunnamed 422</td><td>arabi dops is¡ 6 | ATIG08810</td><td>B</td><td> 8</td><td> 0,8</td>
<td> 249</td><td> 126</td><td> 291</td><td>BDL unnamed_422</td><td>arabidopsis | 6 | ATlG08810</td><td>D</td><td> 14</td><td> -0,79</td>
<td> 250</td><td> 126</td><td> 291</td><td>BDL_unnamed_422</td><td>arab¡dopsis | 6¡AT 1G08810</td><td>D</td><td> 15</td><td> -0,82</td>
<td> 251</td><td> 126</td><td> 291</td><td>B DL unnamed_422</td><td>arabidops is | 6 | AT 1G08810</td><td>D</td><td> 16</td><td> -0,82</td>
<td rowspan="2"> 252 253</td><td> 128</td><td> 293</td><td>BDL unnamed_423</td><td>arabidopsis | 6 | AT 1G28170</td><td>B</td><td> 16</td><td> -0,71</td>
<td> 128</td><td> 293</td><td>BDL unnamed_423</td><td>arabidopsis | 6 | AT 1G28170</td><td>C</td><td> 11</td><td> 0,78</td>
<td> 254</td><td> 128</td><td> 293</td><td>BDL unnamed_423</td><td>arabidopsis | 6 | ATlG28170</td><td>C</td><td> 12</td><td> -0,79</td>
<td> 255</td><td> 128</td><td> 293</td><td>BDL unnamed 423</td><td>arabidops is | 6 | AT 1G28170</td><td>c</td><td> 14</td><td> 0,75</td>
<td> 256</td><td> 130</td><td> 295</td><td>BDL_unnamed_425</td><td>arabidopsis (6 | AT3G10590</td><td>AND</td><td> 13</td><td> 0,72</td>
<td> 257</td><td> 131</td><td> 296</td><td>B DL_unnamed_426</td><td>arabidopsis | 6 | AT3G58740</td><td>AND</td><td> 14</td><td> 0,75</td>
<td> 258</td><td> 131</td><td> 296</td><td>BDL unnamed 426</td><td>arabidopsis | 6 | AT3G58740</td><td>AND</td><td> 17</td><td> -0,72</td>
<td> 259</td><td> 132</td><td> 297</td><td>BDL unnamed 427</td><td>arabidopsis | 6¡AT4G02360</td><td>TO</td><td> 1</td><td> 0,85</td>
<td> 260</td><td> 132</td><td> 297</td><td>BDL unnamed 427</td><td>arabidopsis | 6 | AT4G02360</td><td>TO</td><td> 2</td><td> 0.76</td>
<td> 261</td><td> 134</td><td> 299</td><td>BDL unnamed 429</td><td>arabidopsis | 6) AT5G07200</td><td>C</td><td> 13</td><td> -0,76</td>
<td> 262</td><td> 134</td><td> 299</td><td>BDL unnamed 429</td><td>arabidopsis | 6 | AT5G07200</td><td>D</td><td> 15</td><td> 0,73</td>
<td> 263</td><td> 134</td><td> 299</td><td>BDL, unnamed 429</td><td>arabidopsis | 6 | AT5G07200</td><td>D</td><td> 16</td><td> 0,73</td>
<td> 264</td><td> 135</td><td> 300</td><td>BDL_unnamed_430</td><td>arabidopsis | 6 | AT5G22810</td><td>D</td><td> 12</td><td> 0,86</td>
<td> 265</td><td> 135</td><td> 300</td><td>BDL unnamed 430</td><td>arabidopsis | 6 | AT5G22810</td><td>D</td><td> 15</td><td> 0,71</td>
<td> 266</td><td> 135</td><td> 300</td><td>BDL unnamed_430</td><td>arabidopsis¡6 | AT5G22810</td><td>D</td><td> 16</td><td> 0,8</td>
<td> 267</td><td> 136</td><td> 301</td><td>BDIunnamed_431</td><td>arabidopsis | 6 | AT5G43860</td><td>TO</td><td> 11</td><td> 0,75</td>
<td> 268</td><td> 136</td><td> 301</td><td>BDL unnamed 431</td><td>arabidops¡s | 6 | AT5G43860</td><td>TO</td><td> 13</td><td> -0,77</td>
<td> 269</td><td> 136</td><td> 301</td><td>BDL unnamed_431</td><td>arab¡dops¡s | 6 | AT5G43860</td><td>C</td><td> 11</td><td> 0,72</td>
<td> 270</td><td> 136</td><td> 301</td><td>BDL unnamed_431</td><td>arabidopsis | 6¡AT5G43860</td><td>C</td><td> 17</td><td> -0,7</td>
<td> 271</td><td> 136</td><td> 301</td><td>BDL_unnamed431</td><td>arabidopsis | 6 | AT5G43860</td><td>D</td><td> 14</td><td> 0,71</td>
<td> 272</td><td> 137</td><td> 302</td><td>BDL unnamed 432</td><td>arabidopsis | 6 | AT5G57390</td><td>C</td><td> 15</td><td> 0,72</td>
<td> 273</td><td> 137</td><td> 302</td><td>BDL unnamed 432</td><td>arabidopsis | 6 | AT5G57390</td><td>C</td><td> 16</td><td> 0.76</td>
<td> 274</td><td> 137</td><td> 302</td><td>BDLunnamed432</td><td>arabidopsis | 6! AT5G57390</td><td>D</td><td> 17</td><td> 0,71</td>
<td> 275</td><td> 138</td><td> 303</td><td>BDL unnamed 433</td><td>arabidopsis | 6 | AT5G62800</td><td>D</td><td> 11</td><td> 0.76</td>
<td> 276</td><td> 138</td><td> 303</td><td>BDL_unnamed_433</td><td>arabidopsis | 6 | AT5G62800</td><td>AND</td><td> 17</td><td> -0,73</td>
<td></td><td>Nucleotide NR SEQ ID:</td><td>Poiypeptide NR SEQ ID:</td><td>Gene name</td><td>Name of! complex (clusterj</td><td>ΙΝ / ΠΤυΤΌ E Group</td><td></td><td></td>
<td> 277</td><td> 139</td><td> 304</td><td>BDL_unnamed_435</td><td>arabidopsis | 6 | AT5G52500</td><td></td><td>—S—</td><td></td>
<td> 278</td><td> 139</td><td> 304</td><td>BD1 unnamed_435</td><td>arabidopsis | 6 | AT5G52500</td><td>B</td><td> 8</td><td> -0,73</td>
<td> 279</td><td> 140</td><td> 305</td><td>BDL unnamed 436</td><td>arabidopsis | 6 | AT5G24600</td><td>TO</td><td> 3</td><td> -0,78</td>
<td> 280</td><td> 143</td><td> 308</td><td>BDLunnamed 438</td><td>arabidopsis | 6 | AT 1G72040</td><td>D</td><td> 13</td><td> 0,71</td>
<td> 281</td><td> 145</td><td> 310</td><td>BDL unnamed 440</td><td>arabidopsis | 6 | AT 1G50510</td><td>B</td><td> 8</td><td> 0,75</td>
<td> 282</td><td> 146</td><td> 311</td><td>BDL_unnamed_441</td><td>arabidopsis | 6 | AT5G48100</td><td>AND</td><td> 17</td><td> -0,77</td>
<td> 283</td><td> 147</td><td> 312</td><td>B DLunnained442</td><td>arabi dops is | 6 | AT1G14760</td><td>B</td><td> 6</td><td> 0,83</td>
<td> 284</td><td> 147</td><td> 312</td><td>BDL unnamed 442</td><td>arabidopsis | 6 | ATIG 14760</td><td>B</td><td> 7</td><td> -0,76</td>
<td> 285</td><td> 147</td><td> 312</td><td>BDL_unnamed_442</td><td>arabidopsis | 6 | AT 1G14760</td><td>B</td><td> 9</td><td> 0,75</td>
<td> 286</td><td> 148</td><td> 313</td><td>BDL unnamed_443</td><td>arabidopsis | 6 | AT 1G15150</td><td>B</td><td> 11</td><td> 0,9</td>
<td> 287</td><td> 148</td><td> 313</td><td>BDLunnamed443</td><td>arabidopsi s | 6¡ AT 1G15150</td><td>AND</td><td> 11</td><td> 0,76</td>
<td> 288</td><td> 149</td><td> 314</td><td>BDL. unnamed_444</td><td>arabidopsis | 6 | ATl G20500</td><td>D</td><td> 13</td><td> -0.78</td>
<td> 289</td><td> 150</td><td> 315</td><td>BDL unnamed_445</td><td>arabidopsis | 6 | ATlG56170</td><td>B</td><td> 6</td><td> 0,73</td>
<td> 290</td><td> 150</td><td> 315</td><td>BDL. unnamed_445</td><td>arab idops is | 6 | AT 1G56170</td><td>D</td><td> 15</td><td> 0,94</td>
<td> 291</td><td> 150</td><td> 315</td><td>B DL unnamed_445</td><td>arabidopsis | 6 | ATlG56170</td><td>D</td><td> 16</td><td> 0,93</td>
<td> 292</td><td> 151</td><td> 316</td><td>BDL_unnamed_446</td><td>arabidops¡s | 6 | ATlG62070</td><td>TO</td><td> 1</td><td> 0,77</td>
<td> 293</td><td> 151</td><td> 316</td><td>BDL unnamed 446</td><td>arabidopsisjó) AT 1G62070</td><td>TO</td><td> 2</td><td> 0,77</td>
<td> 294</td><td> 153</td><td> 318</td><td>BDL. unnamed_448</td><td>arabidopsis | 6 | AT3G21090</td><td>c</td><td> 13</td><td> 0,9</td>
<td> 295</td><td> 154</td><td> 319</td><td>BDL unnamed 449</td><td>arabidopsis | 6 | AT3G24250</td><td>B</td><td> 6</td><td> 0,8</td>
<td> 296</td><td> 154</td><td> 319</td><td>BDL unnamed 449</td><td>arabidopsis | 6jAT3G24250</td><td>C</td><td>II</td><td> 0,73</td>
<td> 297</td><td> 155</td><td> 320</td><td>BDL. unnamed 450</td><td>arabidopsis | 6 | AT3G50990</td><td>D</td><td> 13</td><td> -0.85</td>
<td> 298</td><td> 157</td><td> 322</td><td>BDL unnamed 452</td><td>arabidopsis | 6 | AT4G 10150</td><td>B</td><td> 17</td><td> -0,75</td>
<td> 299</td><td> 159</td><td> 324</td><td>BDL_unnamed_454</td><td>arabidopsis | 6 | AT5G07190</td><td>B</td><td> 17</td><td> 0,77</td>
<td> 300</td><td> 159</td><td> 324</td><td>BDL_unnamed_454</td><td>arabidopsis | 6 | AT5G07190</td><td>B</td><td> 18</td><td> 0.82</td>
<td> 301</td><td> 159</td><td> 324</td><td>BDL unnamed 454</td><td>arabidopsis | 6 | A T5G07190</td><td>D</td><td> 15</td><td> -0,92</td>
<td> 302</td><td> 159</td><td> 324</td><td>BDL unnamed 454</td><td>arabidopsis | 6 | AT5G07190</td><td>D</td><td> 16</td><td> -0,91</td>
<td> 303</td><td> 160</td><td> 325</td><td>BDL unnamed 455</td><td>arabi dops is | 6 | AT5G10220</td><td>TO</td><td> 10</td><td> -0,72</td>
<td> 304</td><td> 160</td><td> 325</td><td>BDL unnamed_455</td><td>arab i dops is 16 | AT5G10220</td><td>AND</td><td> 16</td><td> -0,72</td>
<td> 305</td><td> 161</td><td> 326</td><td>Bl) lunnamed456</td><td>arabidopsis | 6 | AT5G20940</td><td>D</td><td> 15</td><td> 0,76</td>
<td> 306</td><td> 161</td><td> 326</td><td>BD L_ un narned_45 6</td><td>arabidopsis | 6¡AT5G20940</td><td> 13</td><td> 16</td><td> 0,7</td>
<td></td><td>Nucteotide NR SEQ ID:</td><td>Potypeptide NR SEQ ID:</td><td>Name of! gen</td><td>Complex name (cluster)</td><td>INSTITUTO Mtxi ongBuwpop INOUS</td><td></td><td></td>
<td rowspan="2"> 307</td><td rowspan="2"> 162</td><td rowspan="2"> 327</td><td rowspan="2">BDL_unnamed_457</td><td rowspan="2">arabidopsis | 6 | AT5G51210</td><td>c</td><td> 17</td><td> 0,81</td>
<td></td><td></td><td></td>
<td> 308</td><td> 163</td><td> 328</td><td>BDL unnamed_458</td><td>arabidopsis | 6 | AT5G55620</td><td>TO</td><td> 13</td><td> -0,76</td>
<td> 309</td><td> 163</td><td> 328</td><td>BDL_unnamed_458</td><td>arabidopsis | 6 | AT5G55620</td><td>AND</td><td> 11</td><td> -0,81</td>
<td> 310</td><td> 163</td><td> 328</td><td>BDLunnamed 458</td><td>arabidopsis | 6 | AT5G55620</td><td>AND</td><td> 14</td><td> -0,71</td>
<td> 311</td><td> 164</td><td> 329</td><td>BDL unnamed 459</td><td>arabidopsis | 6 | AT5G60460</td><td>C</td><td> 14</td><td> 0,84</td>
<td> 312</td><td> 164</td><td> 329</td><td>BDl_unnamed459</td><td>arabidopsis (6 | AT5G60460</td><td>AND</td><td> 17</td><td> -0,72</td>
<td> 313</td><td> 165</td><td> 330</td><td>BDL_unnamed_460</td><td>arabidopsis | 6 | AT5G65590</td><td>D</td><td> 16</td><td> 0,72</td>
ίο
Table Ί. Correlation vector (Vector correl.) Unnamed = no name
The following Tables 8-15 present polynucleotides that were predicted based on microarray correlation analysis (biochip) to increase seed yield (Table 8), oil yield (Table 9), growth rate (Table 10). ), shape / size / length of the organ (Table 11), harvest index (Table 12), oil content per seed (Table 13), dry matter of the plant (Table 14) and quantity of seeds per silicone (Table 15 ). It should be noted that the additional polynucleotides described in the present application can be used to change the above characteristics in plants.
Table 8
Polynucleotides that impact on seed yield • t ·. I-T'X. i '. -Λ ·
<td></td><td>Polynucleotide NR SEQ ID:</td><td>NR SEQ ID: of the polypeptide encoded by the polynucleotide</td><td>IA INSTITU ' Gene name '</td>
<td> 1</td><td> 3</td><td> 168</td><td>BDL2</td>
<td> 2</td><td> 8</td><td> 173</td><td>BDL8</td>
<td> 3</td><td> 9</td><td> 174</td><td>BDL9</td>
<td> 4</td><td> 14</td><td> 179</td><td>BDL15</td>
<td> 5</td><td> 16</td><td> 181</td><td>BDL17</td>
<td> 6</td><td> 26</td><td> 191</td><td>BDL26a</td>
<td> 7</td><td> 27</td><td> 192</td><td>BDL26b</td>
<td> 8</td><td> 29</td><td> 194</td><td>BDL28</td>
<td> 9</td><td> 30</td><td> 195</td><td>BDL29</td>
<td> 10</td><td> 39</td><td> 204</td><td>BDL unnamed 334</td>
<td rowspan="2">eleven i '</td><td> 42</td><td> 207</td><td>BDL unnamed_337</td>
<td> 50</td><td> 215</td><td>B DL unnamed 344</td>
<td> 13</td><td> 53</td><td> 218</td><td>B DL unnamed 347</td>
<td> 14</td><td> 55</td><td> 220</td><td>BDL unnamed_349</td>
<td> 15</td><td> 56</td><td> 221</td><td>BDL unnamedJ550</td>
<td> 16</td><td> 57</td><td> 222</td><td>BDL unnamed 351</td>
<td> 17</td><td> 63</td><td> 228</td><td>BDL unnamed 357</td>
<td> 18</td><td> 66</td><td> 231</td><td>BDL unnamed 362</td>
<td> 19</td><td> 68</td><td> 233</td><td>BDL unnamed 365</td>
<td> 20</td><td> 70</td><td> 235</td><td>BDLunnamed 367</td>
<td> 21</td><td> 74</td><td> 239</td><td>BDL unnamed 371</td>
<td> 22</td><td> 79</td><td> 244</td><td>BDL unnamed 374</td>
<td> 23</td><td> 81</td><td> 246</td><td>BDL. unnamed 376</td>
<td> 24</td><td> 88</td><td> 253</td><td>BDL unnamed 384</td>
<td> 25</td><td> 89</td><td> 254</td><td>BDL unnamed 385</td>
<td> 26</td><td> 94</td><td> 259</td><td>BDL unnamed 391</td>
<td> 27</td><td> 98</td><td> 263</td><td>BDL unnamed 395</td>
INDUSTRIAL
Ρ Ϊ N '
<img file="MX355608B_D0055.tif" />
<td rowspan="2"></td><td rowspan="2">Polynucleotide NR ID DE SEC:</td><td rowspan="2">NRIDDE SEC: of the polypeptide encoded by the polynucleotide</td><td>I 1NS11 Gene name</td>
<td></td>
<td> 28</td><td> 106</td><td> 271</td><td>BDL unnamed 402</td>
<td> 29</td><td> 108</td><td> 273</td><td>BDL unnamed 404</td>
<td> 30</td><td> 119</td><td> 284</td><td>BDL unnamed 414</td>
<td> 31</td><td> 125</td><td> 290</td><td>BDL unnamed 421</td>
<td> 32</td><td> 126</td><td> 291</td><td>BDL unnamed 422</td>
<td> 33</td><td> 134</td><td> 299</td><td>B DL unnamed 429</td>
<td> 34</td><td> 137</td><td> 302</td><td>BDL unnamed 432</td>
<td> 35</td><td> 150</td><td> 315</td><td>BDL unnamed_445</td>
<td> 36</td><td> 159</td><td> 324</td><td>BDL unnamed 454</td>
<td> 37</td><td> 161</td><td> 326</td><td>BDL unnamed 456</td>
ιτυτο Mexican to νοκεπαι?
INDUSTRIAL
MLPI
Table 8.
Table 9
Polynucleotides that impact oil performance
<td></td><td>Polynucleotide NR SEQ ID:</td><td>NR SEQ ID: of the polypeptide encoded by the polynucleotide</td><td>Gene name</td>
<td> 1</td><td> 18</td><td> 183</td><td>BDL 19</td>
<td> 2</td><td> 25</td><td> 190</td><td>BDL25</td>
<td>• Λ</td><td> 49</td><td> 214</td><td>BDL unnamed 343</td>
<td> 4</td><td> 57</td><td> 222</td><td>BDL unnamed 351</td>
<td> 5</td><td> 60</td><td> 225</td><td>BDL unnamed 354</td>
<td> 6</td><td> 64</td><td> 229</td><td>BDL unnamed 358</td>
<td> 7</td><td> 67</td><td> 232</td><td>BDL unnamed 364</td>
<td> 8</td><td> 109</td><td> 274</td><td>BDL unnamed 405</td>
<td> 9</td><td> 135</td><td> 300</td><td>BDL unnamed 430</td>
<td> 10</td><td> 160</td><td> 325</td><td>BD1 unnamed 4 5 5</td>
<td> 1 1</td><td> 165</td><td> 330</td><td>BDL. unnamed 460</td>
IMPI0B3
INSTITUTO mEXICANL>. <”Tu-íí '
FROM THE FROI'IEDAD ijwurruAL -
Table 9.
Table 10
Polynucleotides that impact growth rate
<td></td><td>Polynucleotide NR SEQ ID:</td><td>NR SEQ ID: of the polypeptide encoded by the polynucleotide</td><td>Gene name</td>
<td> 1</td><td> 36</td><td> 201</td><td>BDL unnamed_330</td>
<td> 2</td><td> 70</td><td> 235</td><td>BDL unnamed 367</td>
<td> 3</td><td> 83</td><td> 248</td><td>BDL_unnamed_379</td>
<td> 4</td><td> 123</td><td> 288</td><td>BDL_unnamed_420</td>
<td> 5</td><td> 140</td><td> 305</td><td>BDL unnamed_436</td>
<td> 6</td><td> 147</td><td> 312</td><td>BDL unnamed_442</td>
<td> 7</td><td> 150</td><td> 315</td><td>BDL unnamed 445</td>
<td> 8</td><td> 154</td><td> 319</td><td>BDL unnamed 449</td>
Table 10
Table 11
Polynucleotides that impact the shape / size / length of the organ
<td></td><td>Polynucleotide NR SEQ ID:</td><td>NR SEQ ID: of the polypeptide encoded by e! polynucleotide</td><td>Name of! gen</td>
<td> 1</td><td> 10</td><td> 175</td><td>BDL10</td>
<td> 2</td><td> 13</td><td> 178</td><td>BDL14</td>
<td> 3</td><td> 19</td><td> 184</td><td>BDL20a</td>
<td> 4</td><td> 20</td><td> 185</td><td>BDL20b</td>
<td> 5</td><td> 21</td><td> 186</td><td>BDL21</td>
<td> 6</td><td> 22</td><td> 187</td><td>BDL22</td>
<td> 7</td><td> 28</td><td> 193</td><td>BDL27</td>
<td> 8</td><td> 38</td><td> 203</td><td>B DL unnamed 3 33</td>
<td> 9</td><td> 40</td><td> 205</td><td>BDL unnamed_335</td>
<td></td><td>Polynucleotide XR ID OF SEC:</td><td>V / C SEQ ID: of the polypeptide encoded by the polynucleotide</td><td>IM<sup>1</sup>NamevM'SWP <sup>M</sup>K LA PR¿ 1NI></td><td rowspan="2"></td>
<td rowspan="2"> 10</td><td rowspan="2"> 40</td><td rowspan="2"> 205</td><td></td>
<td>U UL 141 ί 1 i¿íí i <vu</td><td rowspan="27"></td>
<td> 11</td><td> 43</td><td> 208</td><td>BDL_unnamed_339</td>
<td> 12</td><td> 44</td><td> 209</td><td>BDL unnamed 340</td>
<td> 13</td><td> 62</td><td> 227</td><td>BDL_unnamed_356</td>
<td> 14</td><td> 72</td><td> 237</td><td>BDL_unnamed_369</td>
<td> 15</td><td> 73</td><td> 238</td><td>BDL unnamed 370</td>
<td> 16</td><td> 81</td><td> 246</td><td>BDL unnamed 376</td>
<td> 17</td><td> 82</td><td> 247</td><td>BDL unnamed 377</td>
<td> 18</td><td> 84</td><td> 249</td><td>BDL unnamed_38O</td>
<td> 19</td><td> 91</td><td> 256</td><td>BDL unnamed 388</td>
<td> 20</td><td> 93</td><td> 258</td><td>BDL unnamed 390</td>
<td> 21</td><td> 95</td><td> 260</td><td>BDL unnamed 392</td>
<td> 22</td><td> 104</td><td> 269</td><td>BDL unnamed 400</td>
<td> 23</td><td> 109</td><td> 274</td><td>BDL unnamed 405</td>
<td> 24</td><td> 110</td><td> 275</td><td>BDL unnamed_406</td>
<td> 25</td><td> 116</td><td> 281</td><td>BDL unnamed 411</td>
<td> 26</td><td> 117</td><td> 282</td><td>BDL unnamed 412</td>
<td> 27</td><td> 121</td><td> 286</td><td>BDL unnamed 418</td>
<td> 28</td><td> 122</td><td> 287</td><td>BDL unnamed 419</td>
<td> 29</td><td> 126</td><td> 291</td><td>BDL unnamed 422</td>
<td> 30</td><td> 128</td><td> 293</td><td>BDL unnamed 423</td>
<td> 31</td><td> 132</td><td> 297</td><td>BDL unnamed 427</td>
<td> 32</td><td> 136</td><td> 301</td><td>BDL unnamed 431</td>
<td> 33</td><td> 138</td><td> 303</td><td>BDL unnamed 433</td>
<td> 34</td><td> 145</td><td> 310</td><td>BDL unnamed 440</td>
<td> 35</td><td> 148</td><td> 313</td><td>BDL unnamed 443</td>
<td> 36</td><td> 151</td><td> 316</td><td>BDL unnamed 446</td>
<td></td><td>Polynucleotide NR SEQ ID:</td><td>NR SEQ ID: of the polypeptide encoded potypeptide</td><td>Not</td><td>¡> P · FROM LAPROHFD 'INDOS! RJ</td>
<td> 37</td><td> 154</td><td> 319</td><td>BDL.</td><td></td>
<td> 38</td><td> 163</td><td> 328</td><td>BDL</td><td>unnamed 458</td>
ί o
Ό <L
<img file="MX355608B_D0056.tif" />
Table 11. The shape / size / length of the organ includes for example, leaf length, leaf width, leaf circularity, seed size, or root length.
Table 12
Polynucleotides that impact the harvest index
<td></td><td>Polynucleotide NR SEQ ID:</td><td>NR SEQ ID: of the encoded potypeptide by the polynucleotide</td><td>Gene name</td>
<td> 1</td><td> 7</td><td> 172</td><td>BDL7</td>
<td> 2</td><td> 18</td><td> 183</td><td>BDL 19</td>
<td> 3</td><td> 36</td><td> 201</td><td>BDL unnamed 330</td>
<td> 4</td><td> 46</td><td> 211</td><td>BDL unnamed 341</td>
<td> 5</td><td> 56</td><td> 221</td><td>BDL unnamed 350</td>
<td> 6</td><td> 80</td><td> 245</td><td>BDL unnamed 375</td>
<td> 7</td><td> 93</td><td> 258</td><td>BDL unnamed 390</td>
<td> 8</td><td> 98</td><td> 263</td><td>BDL unnamed 395</td>
<td> 9</td><td> 131</td><td> 296</td><td>BDL_unnamed_426</td>
<td> 10</td><td> 136</td><td> 301</td><td>BDL unnamed 431</td>
<td> 11</td><td> 138</td><td> 303</td><td>BDL unnamed_433</td>
<td> 12</td><td> 146</td><td> 311</td><td>BDL_unnamed_441</td>
<td> 13</td><td> 157</td><td> 322</td><td>BDL_unnamed452</td>
<td> 14</td><td> 162</td><td> 327</td><td>BDL unnamed 457</td>
<td> 15</td><td> 164</td><td> 329</td><td>BDL unnamed 459</td>
Table 12
Table 13
IMPI ^ instituto mexican ',
Polynucleotides that impact the content<sup>OT</sup>¿TíDiS ^ íeit «seed
<td></td><td>Polynucleotide NR SEQ ID:</td><td>NR SEQ ID: of the polypeptide encoded by the polynucleotide</td><td>Gene name</td>
<td> 1</td><td> 6</td><td> 171</td><td>BDL6</td>
<td> 2</td><td> 23</td><td> 188</td><td>BDL23</td>
<td> 3</td><td> 56</td><td> 221</td><td>BDL unnamed 3 5 0</td>
<td> 4</td><td> 61</td><td> 226</td><td>BDLunnamed 355</td>
<td> 5</td><td> 1 12</td><td> 277</td><td>BDL unnamed 408</td>
<td> 6</td><td> 114</td><td> 279</td><td>BDL unnamed 409</td>
<td> 7</td><td> 115</td><td> 280</td><td>BDL unnamed 410</td>
<td> 8</td><td> 128</td><td> 293</td><td>BDLunnamed423</td>
<td> 9</td><td> 135</td><td> 300</td><td>BDL unnamed 430</td>
Table 13
Table 14
Polynucleotides that impact the dry matter of the plant
<td></td><td>NR polynucleotide SEC ID:</td><td>NR SEQ ID: of the polypeptide encoded by the polynucleotide</td><td>Gene name</td>
<td> 1</td><td> 37</td><td> 202</td><td>BDL unnamed 331</td>
<td> 2</td><td> 52</td><td> 217</td><td>BDL unnamed 346</td>
<td>Λ J</td><td> 55</td><td> 220</td><td>BDL. unnamed 349</td>
<td> 4</td><td> 139</td><td> 304</td><td>BDL unnamed 435</td>
Table 14
Table 15
Polynucleotides that impact the amount of seeds per silicone
<td></td><td>NR polynucleotide SEC ID:</td><td>NR SEQ ID: of the polypeptide encoded by the polynucleotide</td><td>Gene name</td>
<td></td><td>Polynucieotide NR ¡DEDE SEC:</td><td>NR SEQ ID: of the polypeptide encoded by the polynucleotide</td><td>-VV n Name ^ et ^ éir. X INSTITUI C »□. ΠΕ LA; „_TNQi i</td>
<td> 1</td><td> 57</td><td> 222</td><td>BDLunnamed351</td>
<td> 2</td><td> 71</td><td> 236</td><td>BDL iHwenwd ^ eT '</td>
<td> 3</td><td> 81</td><td> 246</td><td>BDL unnamed 376</td>
<td> 4</td><td> 90</td><td> 255</td><td>BDL unnamed_386</td>
<td> 5</td><td> 112</td><td> 277</td><td>B DLunnamed408</td>
<td> 6</td><td> 114</td><td> 279</td><td>BDL_unnamed_409</td>
<td> 7</td><td> 115</td><td> 280</td><td>BDL_unnamed_410</td>
<td> 8</td><td> 131</td><td> 296</td><td>B DLunnamed426</td>
<td> 9</td><td> 143</td><td> 308</td><td>BDL unnamed 438</td>
<td> 10</td><td> 149</td><td> 314</td><td>BDLunnamed 444</td>
<td> 11</td><td> 153</td><td> 318</td><td>BDL unnamed 448</td>
<td> 12</td><td> 155</td><td> 320</td><td>BDL unnamed 450 i ... i</td>
'jT
Table 15
EXAMPLE 3
GEN CLONING AND CREATION OF BINARY VECTORS FOR THE
EXPRESSION OF THE PLANT
Cloning strategy
Genes selected from those listed in the
Examples 1 and 2 above were cloned into binary vectors for the generation of transgenic plants. For cloning, the full-length open reading frame (ORF) was first identified. In the case of the ORF-EST complexes and in some cases, the mRNA sequences were analyzed to identify the complete open reading frame by comparing the results of various translation algorithms for known proteins from other plant species. To clone the cDNAs of longitu ^
IMPI
DE LA »« IKM INDUSTRIAL performed Reverse Transcription followed by PCR (RT-PCR) on total RNA extracted from Arabidopsis silicuas collected on days 3 and 13 after flowering (3 and 13 DAF). RNA was extracted using the Hot Borate RNA extraction protocol according to World Wide Web (dot) www (dot) eeob (dot) iastate (dot) edu / faculty / WendelJ / ultramicrorna (dot) html. CDNA production (using random hexamer and poly dT primers) and PCR amplification were performed using the standard protocols described in various documents (Sambrook J., EF Fritsch, and T. Maniatis. 1989. Molecular
Clone. A Laboratory Manual., Second Edition, Coid Spring
Harbor Laboratory Press, New York.) And routine to the art expert.
To clone the full-length genomic region of a gene, genomic DNA was extracted from wild-type Arabidopsis thaliana (WT) leaves (mini-team).
DNeasy Plant, Qiagen, Germany). All genes were amplified by nested PCR. The PCR products were purified using a Mini Elute PCR purification kit (Quiagen) and sequencing of the ampLified PCR products was performed using an ABI 377 sequencer (Applied Biosystems). To facilitate cloning of cDNAs / 'genomic sequences, an 8-12 bp extension was added to the 5' end of each primer. The primer extension includes an endonuclease restriction site. I know
<img file="MX355608B_D0057.tif" />
they selected the restriction sites using jdc
INST1T ¡70 MfcXíCANO níLAPRCmUAD (a) the site does not exist in the cDNA sequence; and (b) inWS<sup>or</sup>restriction siu in the forward primers e-¿ii'u cr ou'S designed such that the digested cDNA is inserted into the sense formation within the binary vector used for transformation.
PCR products were purified (purification kit
PCR Mini Elute, Qiagen, Germany) and were digested with the restriction sites according to the primers used (Roche, Switzerland). The digested PCR products were first subcloned into an elevated copy vector [(originated from the plasmid vector p-Biue-script KS http://www.stratagene.com/manuals/212205.pdf)] with the promoter
35S (SEQ ID NO: 921), and the NOS terminator (SEQ ID NO: 922) originated from binary vector pBI 101.3 (GenBank Accession No. U12640, bp 4417-4693)), followed by cloning of the entire cassette within the pGI or pRBArt binary vectors (according to Table 16, below). The digested PCR products and the linearized plasmid vector were ligated using the T4 DNA ligase enzyme (Roche, Switzerland). The following polynucleotides were cloned from RNA extracted from the tissues described above or genomic DNA using the primers provided in Table 17, below.
Table 16
Genes cloned into different binary vectors
<td></td><td>Bioinf. Identified Polynucleotide NR SEQ ID:</td><td>Bioinf. Identified Polypeptide NR SEQ ID:</td><td>gene TAIR name</td><td>Name internal</td><td>Cloned polynucleotide J NRIDDE i 'SEC:</td><td>Widop INSTITUFÍMÍRXlCAr DE LA PROPILr1NDUSTRI</td><td></td>
<td> 1</td><td> 1</td><td> 166</td><td>AT5C.50770</td><td>BDL3</td><td> 1017</td><td></td><td></td>
<td> 2</td><td> 4</td><td> 169</td><td>AT2G45420</td><td>BDL4</td><td> 1041</td><td></td><td>V</td>
<td> 3</td><td> 5</td><td> 170</td><td>AT3G14360</td><td>BDL5</td><td> 1018</td><td></td><td>V</td>
<td> 4</td><td> 6</td><td> 171</td><td>AT4G10490</td><td>BDL6</td><td> 1019</td><td>V</td><td></td>
<td> 5</td><td> 7</td><td> 172</td><td>AT5G51490</td><td>BDL7</td><td> 1020</td><td>V</td><td></td>
<td> 6</td><td> 8</td><td> 173</td><td>AT3G03240</td><td>BDL8</td><td> 1021</td><td></td><td>V</td>
<td> 7</td><td> 9</td><td> 174</td><td>AT5G24I30</td><td>BDL9</td><td> 1022</td><td></td><td>V</td>
<td> 8</td><td> 3</td><td> 168</td><td>AT1G34580</td><td>BDL2</td><td> 1016</td><td></td><td>V</td>
<td> 9</td><td> 11</td><td> 176</td><td>AT5G12460</td><td>BDL11</td><td> 1042</td><td></td><td>V</td>
<td> 10</td><td> 12</td><td> 177</td><td>AT4GO853O</td><td>BDL12</td><td> 1023</td><td>V</td><td></td>
<td> 11</td><td> 2</td><td> 167</td><td>AT1G65090</td><td>BDL1</td><td> 1040</td><td>V</td><td></td>
<td> 12</td><td> 13</td><td> 178</td><td>AT1G53690</td><td>BDL14</td><td> 1024</td><td>V</td><td></td>
<td> 13</td><td> 14</td><td> 179</td><td>AT1G685I0</td><td>BDL15</td><td> 1025</td><td>V</td><td></td>
<td> 14</td><td> 15</td><td> 180</td><td>AT5GO38OO</td><td>BDL16</td><td> 1026</td><td></td><td>V</td>
<td> 15</td><td> 16</td><td> 181</td><td>AT5G36770</td><td>BDL 17</td><td> 1043</td><td></td><td>V</td>
<td> 16</td><td> 17</td><td> 182</td><td>AT5G40420</td><td>BDL18</td><td> 1027</td><td>V</td><td></td>
<td> 17</td><td> 19</td><td> 184</td><td>AT1G47540.1</td><td>BDL.20a</td><td> 1029</td><td>V</td><td></td>
<td> 18</td><td> 20</td><td> 185</td><td>AT1G47540.2</td><td>BDL20b</td><td> 1044</td><td>V</td><td></td>
<td> 19</td><td> 21</td><td> 186</td><td>AT3G62730</td><td>BDL21</td><td> 1030</td><td></td><td>V</td>
<td> 20</td><td> 23</td><td> 188</td><td>AT3G27785</td><td>BDL23</td><td> 1031</td><td></td><td>V</td>
<td> 21</td><td> 24</td><td> 189</td><td>AT5G15000</td><td>BDL24</td><td> 1045</td><td>V</td><td></td>
<td> 22</td><td> 25</td><td> 190</td><td>AT3G20910</td><td>BDL25</td><td> 1032</td><td></td><td>V</td>
<td> 23</td><td> 26</td><td> 191</td><td>AT1G11170.1</td><td>BDL26a</td><td> 1033</td><td>V</td><td></td>
<td> 24</td><td> 27</td><td> 192</td><td>AT1G11170.2</td><td>BD1.26b</td><td> 1034</td><td>V</td><td></td>
<td> 25</td><td> 28</td><td> 193</td><td>AT1G68380</td><td>BDL27</td><td> 1035</td><td></td><td>V</td>
<td> 26</td><td> 29</td><td> 194</td><td>AT1G09380</td><td>BDL28</td><td> 1036</td><td></td><td>V</td>
<td> 27</td><td> 30</td><td> 195</td><td>AT1G60970</td><td>BDL29</td><td> 1037</td><td></td><td>V</td>
<td> 28</td><td> 31</td><td> 196</td><td>AT1G72580</td><td>BDL30</td><td> 1046</td><td>V</td><td></td>
<td> 29</td><td> 33</td><td> 198</td><td>AT2G46960.1</td><td>BDL32a</td><td> 1038</td><td></td><td>V</td>
4ifl>
<td></td><td>Bioinf. Identified Polynucleotide NR SEQ ID:</td><td>Bioinf. Identified Polypeptide NR SEQ ID:</td><td>gene TAIR name</td><td>Name internal</td><td>Cloned polynucleotide NR SEQ ID:</td><td>LMeP INDUSI</td><td>-B- W YEAR '·'</td><td></td>
<td> 30</td><td> 34</td><td> 199</td><td>AT2G46960.2</td><td>BDL32b</td><td> 1039 -</td><td></td><td>--and*-"</td><td></td>
<td> 31</td><td> 933</td><td> 183</td><td>AT2G02080.1</td><td>BDLI9gDNA</td><td> 1028</td><td></td><td>V</td><td></td>
<td> 32</td><td> -</td><td>AY254038</td><td>WRINKLEDI</td><td>WRI</td><td> 1050</td><td>V</td><td></td><td></td>
Table 16: Sequence identifiers of the bioinformatically identified polynucleotides and polypeptides (bioinf.) Are provided, as well as the sequence identifiers of the cloned polynucleotides.
In both cases, the translated polypeptide sequences of the cloned genes were different from the bioinformatically identified and predicted polypeptides (NR ID DE
<td>SEC:</td><td> 176</td><td>and</td><td>178) and</td><td>I know</td><td>provide</td><td>new identifiers of</td>
<td colspan="2">sequence</td><td>(is</td><td>say,</td><td>NR</td><td>SEC ID</td><td>: 1047 for the polypeptide</td>
<td colspan="2">translated</td><td>of the</td><td colspan="2">cloned gene</td><td>NR ID OF</td><td>SEC: 1042 and NR SEQ ID:</td>
<td colspan="2">1048 for</td><td>the</td><td>polypeptide</td><td>gone</td><td>translated</td><td>of the cloned gene NR ID DE</td>
<td>SEC:</td><td> 1024 )</td><td></td><td></td><td></td><td></td><td></td>
Table 17
Polynucleotides cloned from cDNA libraries or synthetically produced, and the primers used for cloning
<td>Gene name</td><td>Restriction enzymes used for cloning</td><td>Primers used for amplification (5 '-> 3')</td><td>NR SEQ ID:</td>
<td rowspan="3">BDL3</td><td rowspan="3">I went out, Xbal</td><td>Direct nested: BDL3 ORF NF I left AATGTCGACGATGCATGGATTCAATCAACA</td><td> 923</td>
<td>External Direct: BDL3 ORF EF I left TTTGTCGACCATTGTGAAGTATAGTCCTTGATG</td><td> 924</td>
<td>Reverse Nested: BDL3 ORF NR Xbal TATCTAGAACATAAACGGGGAGACTCAAG</td><td> 925</td>
<td>Gene name</td><td>Restriction enzymes used for cloning</td><td>TW Primers used for amplification (5 '-> 3 *) X INSTITUTES h</td><td>r ir * V • Nk-iDjpE ?; i MEXSÍXÓl / . INDUSTRIAL PROPERTY</td>
<td></td><td></td><td>External Reverse: BDL3 ORF ER Xbal - AATCTAGACTATGGTAACCCGAAGTTGTATAL</td><td> -·—936--</td>
<td>BDL4</td><td>SacI, Xbal</td><td>synthetic product</td><td> 1041</td>
<td rowspan="4">BDL5</td><td rowspan="4">I went out, Xbal</td><td>Direct Nested: BDE5 ORF NF Salt ACTGTCGACAGACATGCACAAAGACAACG</td><td> 927</td>
<td>External Direct: BDL5 ORF EF Salí - ATAGTCGACCAAAACCCAGAGACATGCAC</td><td> 928</td>
<td>Inverse Nested: BDL5 ORF NR Xbal - AATCTAGACACTTTTCAAAGAGAGGACATCT</td><td> 929</td>
<td>External Reverse: BDL5 ORF ER Xbal AGI CTAG ACCGGTTC ACTTAÁG ATTTATTC</td><td> 930</td>
<td rowspan="3">BDL6</td><td rowspan="3">I went out, Xbal</td><td>Direct: BDL6 ORF F1 I left - AAAGTCGACCAATCATGGCAGCATCAAAAC</td><td> 931</td>
<td>Inverse Nested: BDL6 ORF NR Xbal AGTCTAGACGGATGATTGATTCGATAGTACAC Phaseolus vulgaris</td><td> 932</td>
<td>External Reverse: BDL6 ORF ER SacI TGAGCTCCCAATCAAGAACTAAGGACCG</td><td> 933</td>
<td rowspan="3">BDL7</td><td rowspan="3">I went out, Xbal</td><td>Direct: BDL7 ORE F1 Salt - AATGTCGACAACAATGAATATGATGATGCAAAAACT C</td><td> 934</td>
<td>Reverse Nested: BDL7 ORE NR Xbal AATCTAGACGGTCTTTAGAGTCCAGAAGTG</td><td> 935</td>
<td>Inverse Reverse: BDL7 ORF ER Xbal AATCTAGAATCATTGCAACTTAAACAC'GA</td><td> 936</td>
<td rowspan="2">BDL8</td><td rowspan="2">Xbal, I went out</td><td>Direct: BDL8 gDNA F Sal- AATGTCGACCCTCTGTCTTG rCTTTTGG'n AGTA</td><td> 937</td>
<td>Reverse: BDL8 gDNA R Xb - AATCTAGACCTTCAACTACAAGCGGCTT</td><td> 938</td>
<td rowspan="3">BDL9</td><td rowspan="3">I went out, Xbal</td><td>Direct Nested: BDL9 ORF NF Salt! acggtcgacCTTACAATAAAATGGTGAAACTCG</td><td> 939</td>
<td>External Direct: BDL9 ORF EF SalíaatgtcgacCTCTCTAAACGCATAATCTTACA</td><td> 940</td>
<td>Reverse Nested: BDL9 ORF NR Xbal AATCTAGACAAAATATGTGGTCTCCGCAG</td><td> 941</td>
<img file="MX355608B_D0058.tif" />
Gene name
Restriction enzymes used for cloning
Primers used for amplification (5 '-> 3')
INSTITUTO BE LA exicano 'ϊ <Ot> lkr> AO dustmal
External Reverse: BDL9 ORF ER Xbal AGTCTAGACAAAAAGGAAACGAATCACA
Direct Nested: BDL2 ORF NF I left CAAGTCGACCGTAAGACATAAGCAAAATGGC
943
BDL2
I went out, Xbal
External Direct: BDL2_ORF_EF_SalI TTAGTCGACCACTTCATGCGTAAGACATAAGC
944
Inverse Nested: BDL2_ORF_NR_XbaI GCTCTAGAGCATCTTTTAAGTTGACGTCG
945
External Reverse: BDL2 ORF ER Xbal AATCTAGATCCATTGAAAATGCGAACC
946
BDL1
SacI, Xbal synthetic product
Direct Nested: BDL 12 gDNA NFSalI AATGTCGACGTTCTATCCCCAACTCTAAATG
947
BDL12
I went out, SacI
External Direct: BDL12 gDNA EF Xbal ATTCTAGATTGTTGTTTGTATCACTTTATTGG
948
Reverse Nested: BDL 12 gDNANRSacI AGAGCTCCTTAAAGTTCTATCGAGATAGTGC
949
External Reverse: BDL 12 gDNAER. SacI AGAGCTCTCAATGAAATTTTACATAACCATC
950
BDL1
Xbal, SacI synthetic product
Direct: BDL14 ORF Fl Departed ATGTCGACAACAATGGATCTACAACAGTCCGAAAC
951
BDL14
I went out, Xbal
Reverse Nested: BDL 14 ORF NR Xbal AATCTAGACACTCAGACAGCTGGGTATTAAAC <
> External Reverse: BDLI4 ORF ER SacI AGAGCTCGTTGTGGCACTCAGACAGCTG
Direct Nested: BDL 15 ORF NF SalTTCGTCGACAAAGGAATATGAGAATCAGCTG
External Direct: BDLI5 ORF EF Sai AACGTCGACCAAACACACATCATACGTATATTTG
Reverse Nested: BDL 15 ORFNR Xbal ATTCTAGAGAGTTTATGATAACCTAATGATTGAC
External Reverse: BDL 15 ORF ER Xbal GTTCTAGACAGAGTGAGTTTATGATAACCTAATG
952
953
954
955
BDL 15
I went out, Xbal
956
957
Gene name
Restriction enzymes used for cloning
Primers used for amplification (5 '-> 3')
INSTITUTE
OF THE
<img file="MX355608B_D0059.tif" />
Kon¡s®e IIIDUSTRIAL
Direct: BDL16_ORF_Fl_SalI - AATGTCGACAACAATGTCCACCGTTAATCATCAC
958
BDL 16
I went out, Xbal
Reverse Nested: BDL 16 ORF NR Xbal AATCTAGACAGAACCAAAACTCTCGTATTAAC
959
External Reverse: BDL 16 ORF ER Xbal AATCTAGAGAAACTTTGAATGGACTATGTAGC
960
BDL17
Sacl, Xbal synthetic product
1043
Direct Nested: BDL18 ORF NF Xbal AATCTAGATACAATGGCGGATACACACC
961
BDL18
Xbal, Sacl
External Direct: BDL18_ORF_EF_Xbal ATTCTAGAGCTTACAATGGCGGATACACA
962
Inverse Nested: BDL18_ORF_NR_SacI AGAGCTCGTGAAAACACATATCTACCGTTC
963
External Reverse: BDL18_ORF_ER_SacI AGAGCTCCTTGCGATCTTTCATGCTTAC
964
Direct Nested: BDLI9_gDNA NF Sacl AGAGCTCAGAGAGAGATAGGGCTTTGAGG
965
BDL 19
Sacl
External Direct: BDL 19 gDNA EF Sacl AGAGCTCGAAGAAGAACACAAAACAGTAGAG
966
Reverse: BDL19_gDNA_RI_SacI AGAGCTCGTGATTATGAAAACAACAAGCG
967
Direct: BDL20a ORF F1 I left AAAGTCGACAGAGACAAAGAAGTTGGCCA
968
BDL20a
I went out, Xbal
Reverse Nested: BDL20a_ORF_NR_XbaI TTTCTAGATGCAAGATTCAAATACGACTTAG
969
External Reverse: BDL20a ORF ER Sacl AGAGCTCGGACCATTTACCTTGATTTGTTAC
970
BDL20b
Smal + Sacl synthetic product
1044
Direct Nested: BDL21-ORF-NF-Sal AATGTCGACAAGCATGTTTAAACTCTGTCTCG
External Direct: BDL21-ORF-EF-Sal TTAGTCGACGAAAGGAAAAGCATGTTTAAAC
Reverse Nested: BDL21-ORF-NR-XbaI CCGTCTAGAGGAAACTTTTAATTGTCATGTGA
971
BDL21
I went out, Xbal
972
973
100
<td>Gene name</td><td>Restriction enzymes used for cloning</td><td>- INST1T1ITO Primers used for amplification (5 '- »3') i</td><td>4MJ1CANO</td>
<td></td><td></td><td>External Reverse: BDL21-ORF-ER-XbaI GGCTCTAGATTTTCTAGTGAATTGTATCAATGG</td><td> 974</td>
<td rowspan="3">BDL23</td><td rowspan="3">Xbal, SacI</td><td>Direct Nested: BDL23 ORF NF Xbal AATCTAGACATCATAATCATATGGAGTTCGA</td><td> 975</td>
<td>External Direct: BDL23 ORF EF Xbal AATCTAGAGATCTAGGGTTTCATGCTTCAC</td><td> 976</td>
<td>Reverse: BDL23 ORF Rl SacI - AGAGCTCGTTCGACTTGTTTATATTGCACG</td><td> 977</td>
<td>BDL24</td><td>Smal, SacI</td><td>synthetic product</td><td> 1045</td>
<td rowspan="3">BDL25</td><td rowspan="3">Xbal</td><td>Direct Nested: BDL25 ORF NF Xbal ATTCTAGACTCCGAGACTGTCTCCGATTG</td><td> 978</td>
<td>External Direct: BDL25 ORF EF Xbal ATTCTAGACAATCACCGTGGACACCTC</td><td> 979</td>
<td>Reverse: BDL25 ORF R Xbal - ATTCTAGAGTGGCAACATCTGAAGTATTCC</td><td> 980</td>
<td rowspan="4">BDL26a</td><td rowspan="4">SacI</td><td>Direct Nested: BDL26a ORF NF SacI AGAGCTCTCATTACAGTGACTCTGCATGC</td><td> 981</td>
<td>External Direct: BDL26a ORF EF SacI AGAGCTCTCTTGTCTACTTTCATTACAGTGAC</td><td> 982</td>
<td>Inverse Nested: BDL26a + b ORF NR SacI TAGAGCTCGAAAGTACATAATGGÁCATGAGC</td><td> 983</td>
<td>External Reverse: BDL26a + b ORF ER SacI TAGAGCTCGATTTTTAAAGTAGTTATAGTGATGAA</td><td> 984</td>
<td rowspan="4">BDL26b</td><td rowspan="4">SacI</td><td>Direct Nested: BDL26b ORF NF SacI AGAGCTCGTAATATTACCATAAGGTTCAGAAG</td><td> 985</td>
<td>External Direct: BDL26b ORF EF SacI AGAGCTCCATAATTTTTTCGTATTTAACTCTT</td><td> 986</td>
<td>Inverse Nested: BDL26a + b ORF NR SacI TAGAGCTCGAAAGTACATAATGGACATGAGC</td><td> 987</td>
<td>External reverse: BDL26a + b ORF ER SacI - TAGAGCTCGATTTTTAAAGTAGTTATAGTGATGAA</td><td> 988</td>
<td rowspan="2">BDI.27</td><td rowspan="2">Xbal, SacI</td><td>Direct Nested: BDL27 ORF NF Xbal AATCTAGACTCTTACACATGTATCGGTAGTTG</td><td> 989</td>
<td>External Direct: BDL27 ORF EF Xbal AATCTAGACTTAAAACATTGGAAACAAGAATTC</td><td> 990</td>
101
Name of the gene
Restriction enzymes used for cloning
Primers used for amplification (5 '-> 3')
INSTITUI **> MtXICA V
OF THE PROPIFI INl'l.'ST »i
IA
<img file="MX355608B_D0060.tif" />
BDL28
I went out, xbal
Inverse Nested: BDL27 ORF NR SacI - ______
AGAGCTCGATCAGAAATACATGACGATÁGATG
External Reverse: BDL27 ORF ER SacI AGAGCTCGCATCTTTGTTTTTGGACGA
Direct Nested: BDL28_ORF_NF_SalI AAAGTCGACGAGAGATGGCTAAATCAGATATG
External Direct: BDL28_ORF_EF_SaII AATGTCGACGAGAGTGAGAGATGGCTAAATCAG
Reverse Nested: BDL28_ORF_NR_XbaI ATTCTAGAAGAAGCAATCACCATTTTAAGG
-W
992
993
994
995
External Reverse: BDL28 ORF ER Xbal ATTCTAGACCGAAAATCCAATTTAGTTGC
996
Direct Nested: BDL29_ORF_NF_Sall AATGTCGACGATTTCTTCTCC Π AAGCCATG
997
BDL29
I went out, Xbal
External Direct: BDL29 ORF EF I left AATGTCGACGGAGAGTTTTTCTTTATTACTAGGG
998
Reverse Nested: BDL29 ORF NR XbaI AATCTAGACACACATCATTTCATAAGTGACC
999
External Reverse: BDL29 ORF ER Xbal AATCTAGACAACCATTATTACCGAAGAGC
1000
BDL30
Smal, SacI synthetic product
1046
Direct Nested: BDL32a_ORF NF Xbal AATCTAGAGAGGATAATGCGTAACACACAAG
1001
BDL32a
Xbal, SacI
External Direct: BDL32a ORF EFXbal AATCTAGAGATTTTATTCGAGGATAATGCG
1002
Reverse Nested: BDL32a + b ORF NR SacI AGAGCTCCATTAAGACATCCGATTTATTTG
1003
External Reverse: BDL32a + b ORF ER SacI AGAGCTCGAGACTTGTCACACACGTGAGG
1004
Direct nested: BDL32b ORFNF Xbal AATCTAGACACACACACAAACATAAGGAAA
External Direct: BDI.32b ORF EF Xbal AATCTAGAAACAATACACACACACAAACATAAG
Reverse Nested: BDL32a rb ORF NR Sad AGAGCTCCATTAAGACATCCGATTTATTTG
1005
BDL32b
Xbal, SacI
1006
1007
102
<td>Gene name</td><td>Restriction enzymes used for cloning</td><td>TMP Primers used for amplification (5 '- »3')<sup>one r</sup> ' <sup>7</sup> tNrrmro Mfczic r> F. ΓΗΟΗΙ INDOS<sup>-</sup>!</td><td>DAD RIAL, 2</td>
<td></td><td></td><td>External Reverse: BDL32a + b ORF ER SacI - AGAGCTCGAGACTTGTCACACACGTGAGG</td><td> “ 103«-</td>
<td></td><td></td><td></td><td></td>
<td rowspan="4">Wrinkle gave</td><td rowspan="4">I went out, Xbal</td><td>Direct nested: WRI NF ORF I left - AATGTCGACCAGAGTTTAATGAAGAAGCGCT</td><td> 1009</td>
<td>External Live: WRI EF Art Salí - AATGTCGACAAATCTAAACTTTCTCAGAG</td><td> 1010</td>
<td>Inverse Nested: WRI NR ORF Xbal - AATCTAGACTCTCTCAGACCAAATAGTTACAAG</td><td> 1011</td>
<td>External Reverse: WRI ER Art Xbal AATCTAGAGGCAAAGACATTGATTATTC</td><td> 1012</td>
<td rowspan="2">Napin</td><td rowspan="2">HindlII, I went out</td><td>Direct: Napin F HindlII - ATAAGCTTATTGATTCCTTTAAAGACTTATGTT</td><td> 1013</td>
<td>Reverse: Napin R Salí - TCGTCG ACGGGTGTA TGTTTTTAATCTTGT TT</td><td> 1014</td>
Table 17.
To optimize the coding sequence (In design
S-ilic ;, the codon usage tables calculated for the plant transcriptomes were used (examples of such Tables can be found in the Codon Usage Database available online at Hypertext Transfer Protocol: // World
Wide Web (dot) kazusa (dot) or (dot) jp / codon /). Optimized coding sequences were designed so as not to introduce changes in the encoded amino acid sequence (from the polypeptides selected from 'Table 1,
Example 1), using the preferred codons for expression in dicotyledonous plants mainly Arabidopsis, Cañóla and
103
<img file="MX355608B_D0061.tif" />
<img file="MX355608B_D0062.tif" />
Soy; and monocotyledonous plants as per. ex
INDUSTRIAL optimized sequences promote better translation and, therefore, higher levels of protein expression. To the optimized sequences flanking the additional unique restriction enzyme sites were added - Salí, Xbal,
BamHI, Smal at the 5 'end and SacI at the 3' end (except for a gene-BDL-1, in which the Smal site was excluded). Genes for which optimized sequences were prepared
<td>codon</td><td colspan="2">synthetic (</td><td colspan="3">artificial) were:</td><td>BDL-1</td><td>(NR</td><td>ID</td><td>OF</td>
<td>SEC: 1040),</td><td>BDL-4</td><td>(NR</td><td>ID</td><td>OF</td><td>SEC: 1041),</td><td>BDL-11</td><td>(NR</td><td>ID</td><td>OF</td>
<td>SEC: 1042),</td><td>BDL-17</td><td>(NR</td><td>ID</td><td>OF</td><td>SEC: 1043),</td><td>BDL-20b</td><td>(NR</td><td>ID</td><td>OF</td>
<td>SEC: 1044),</td><td>BDL-24</td><td>(NR</td><td>ID</td><td>OF</td><td>SEC: 1045),</td><td>BDL-30</td><td>(NR</td><td>ID</td><td>OF</td>
SEC: 1046). The artificial optimized polynucleotide sequences were synthesized by a commercial supplier [GeneArt, GmbH, (Hypertext Transfer Protocol: // World Wide Web (dot) geneart (dot) com /)].
Generation of binary vectors comprising BDL genes and plant functional promoters to induce expression thereof - The plasmid pPI was constructed by inserting a synthetic poly- (A) signal sequence, originating from the basic plasmid vector pGL3 (Promega, No. Access U47295;
bp 4658-4811) within the Hindlll restriction site of the binary vector pBI101.3 (Clontech, GenBank Accession No.
U12640). In some cases, the main chain binary plasmid used was pGI which is similar to pPI but the GUS gene
104
<img file="MX355608B_D0063.tif" />
was replaced by the GUS-Intron gene (Vancannd! g ^ T <í * & xic¿íi * c
Dt THE ΡΜβΡΙίΒΑΒ INDUSTRY!
MGG 220, 245-50, 1990). PGI was used to clone part of the polynucleotide sequences, initially under the control of the 35S promoter [Odell, JT, et al. Nature 313, 810 - 812 (28 of
February 1985); NR SEQ ID: 921]. Additional sequences were cloned into pMBLArt under the control of the promoter
5S.
Some polynucleotide sequences were cloned under other preferential promoters as will be described later. The promoter, called Napin originated in Brassica napus, which is characterized by a seed-specific promoter activity [Stuitje AR et al., Plant
Biotechnology Journal 1 (4): 301-309], was amplified by
Direct PCR on genomic DNA extracted from leaf tissue using the DNAeasy kit (Qiagen Cat. No. 69104) using the following primers:
Napin F
Hind
III (enzyme
HindII)
ATAAGCTTATTGATTCCTTTAAAGACTTATGTT (NR SEQ ID: 1013) (Enzyme
Salt
I) Napin R Sal I
TCGTCGACGGGTGTATGTTTTTAATCTTGTTT (NR SEQ ID: 1014).
The following genes were cloned downstream of the Napin promoter sequence: BDL-2, BDL-3, BDL-4, BDL-6, BDL-12,
BDL-14, BDL-15, BDL-17, BDL-18, BDL-21, BDL-23, BDL-25, BDL-27,
BDL-28, BDL-29, BDL-32b, Wrinklel. To control, the enzyme β-glucuronidase (GUS, NR SEQ ID: 1051) encoded by
105 the uid A gene (GUS-Intron, NR SEQ ID: 1049).
<img file="MX355608B_D0064.tif" />
MEXICAN INSTITUTE OF PROPERTY
INDUSTRIAL
<img file="MX355608B_D0065.tif" />
EXAMPLE 4
PRODUCTION OF TRANSGENIC ARABIDOPSIS PLANTS THAT EXPRESS
SEED OIL GENES
Materials and methods
The transformation of the plant was carried out according to (Clough SJ, Bent AF. 1998. Floral dip: a simplified method for
Agrobacterium-mediated transíormation of Arabidopsis thaliana.
Plant J. 16 (6): 735-43, Desfeux C, Clough SJ, Bent AF. 2000.
Female reproductive tissues are the primary targets of
Agrobacterium-mediated transíormation by the Arabidopsis floral-dip method. Plant Physiol. 123 (3): 895-904.).
Arabidopsis thaliana variety Columbia (plants T<sub>or</sub>) was transformed according to the floral immersion procedure described by Clough SJ, Bent AF. (1998) Floral dip: a simplified method for Agrobacterium-mediated cransformation of
Arabidopsis thaliana. Plant J. 16 (6): 735-43; and Desfeux C,
Clough SJ, Bent AF. (20000 Female reproductive tissues are the primary targets of Agrobacterium-mediated transíormation by the
Arabidopsis floral-dip method. Plant Physiol. 123 (3): 895-904) with minor modifications. In summary, T plants<sub>or</sub> of
Arabidopsis thaliana Columbia (ColO) were planted in pots of
250 my stuffed with a wet peat based growth mix. The pots were covered with aluminum foil and a plastic cover, kept at 4 ° C for 3-4 days,
106 then they were uncovered and incubated in a chamber,
<img file="MX355608B_D0066.tif" />
íuíó & gc 'OF LA «· ΠΪ · Α0 INDUSTRIAL
<img file="MX355608B_D0067.tif" />
at 18-24 ° C under 16/8 hour light / dark cycles. T plants<sub>or</sub> they were ready for transformation, six days before anthesis.
Agrobacterium single colonies bearing the binary vectors harboring the seed oil genes were grown in LB medium supplemented with kanamycin (50 mg / L) and gentamicin (50 mg / L). Cultures were incubated at 28 ° C for 48 hours under vigorous shaking and then centrifuged at 4,000 rpm for 5 minutes. Pellets comprising Agrobacterium cells were re-suspended in a medium concentration transformation medium containing Murashig-Skoog (Duchefa) (2.15 g / L); 0.044 µΜ benzylamino purine (Sigma); 112 μρ / L of vitamins Gambourg B5 (Sigma); 5% sucrose; and 0.2 ml / L Silwet L-77 (OSI Specialists, CT) in double distilled water, at a pH of 5.7.
The transformation of T plants<sub>or</sub> This was done by investing each plant in a suspension of Agrobacterium, so that the tissue of the plant above the ground was submerged for 3-5 seconds. Each floor T<sub>or</sub> inoculated was immediately placed on a plastic tray, then covered with a clear plastic lid to maintain moisture, and kept in the dark at room temperature for 18 hours to facilitate infection and transformation. The transformed (i.e. transgenic) plants are then
107
<img file="MX355608B_D0068.tif" />
<img file="MX355608B_D0069.tif" />
uncovered and transferred to a greenhouse
Bt LA PHOP16DAt> lNt> U $ TXlAt maturity. Transgenic Tq plants were grown in the greenhouse for 3-5 weeks until the siliques were brown and dry, then the seeds of the plants were harvested and kept at room temperature until sown.
To generate the T and T2 transgenic plants that harbor the genes, the seeds of the T transgenic plants<sub>or</sub> Collected, they were surface sterilized by soaking in 70% ethanol for 1 minute, followed by 5% sodium hypochlorite and 0.05% triton for 5 minutes. The surface sterilized seeds were thoroughly washed in sterile distilled water and then placed on culture plates containing Murashig-Skoog (Duchefa) medium concentration; 2% sucrose; 0.8% agar for plants; 50 mM kanamycin and 200 mM carbenicillin (Duchefa). The culture plates were incubated at 4 ° C for 48 hours, then transferred to a growth chamber at 25 ° C for an additional week of incubation.
Vital Arabidopsis Ti plants were transferred to fresh culture plates for another week of incubation. Following incubation, the T- plants were removed from the culture plates and planted in a growth mix contained in 250 ml pots. The transgenic plants were left to grow in a greenhouse until ripening. The seeds harvested from the Ti plants cultivated and
108 developed to maturity as a plant conditions used for cultivation and c
EXAMPLE 5
<img file="MX355608B_D0070.tif" />
Planting of Ti plants.
IDENTIFICATION OF ADDITIONAL SEQUENCES WITH THE MAJOR
LIKELIHOOD OF CONFERING SIMILAR FAVORABLE EFFECTS IN
TRANSGENIC PLANTS
Methods for searching and identifying seed yield polypeptide or polynucleotide homologs would be well within the scope of one skilled in the art. Searching for and identifying homologous genes includes selecting available sequence information, for example, in public databases, which include but are not limited to the Japan DNA Database (DDBJ), Genbank, and the European Molecular Biology Laboratory (EMBL) Nucleic Acid Sequence Databases or versions thereof, or MIPS databases. A number of different search algorithms have been developed, including but not limited to the group of programs referred to as BLAST programs.
There are five implementations of BLAST, three designed for nucleotide sequence query (BLASTN,
BLASTX, and TBLASTX) and two designed for the investigation of protein sequences (BLASTP and TBLASTN) (Coulson,
Trends in Biotechnology: 76-80, 1994; Birren et al., Genome
Analysis, I: 543, 1997). Such methods include alignment
109
<img file="MX355608B_D0071.tif" />
and sequence comparison. The algorithm
GIVE THE KROMEOAL · ♦ ND <> $ TR | AL percentage sequence identity and perform statistical analysis of similarities between two sequences. BLAST analysis software is available to the public through the National Center for Biotechnology
Information. Other such software or algorithms are GAP,
BESTFIT, FASTA and TFASTA. GAP used the algorithm of Needleman and Wunsch (J. Mol. Biol. 48: 443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps.
Homologous genes can belong to the same gene family. Analysis of a gene family can be carried out using sequence similarity analysis. To carry out this analysis, standard programs for multiple alignments can be used, for example, Clustal W. A tree that links neighboring protein homologs to the genes comprised in this invention can be used to provide an overview of ancestral and structural relationships. Sequence identity can be calculated using an alignment program as described above. Other plants are expected to carry a similar functional gene (ortholog) or a family of similar genes, and those genes will provide the same preferred phenotype as the genes presented here.
Advantageously, these family members can be useful
110
Examples
<img file="MX355608B_D0072.tif" />
INSTITVTl
Dt LA INlúVEDAD INIjVSTWAL barley (Hordeum vulgare), corn (Zea mays), cotton paddy (Oryza sativa), cane sorghum (Sorghum bicolor), for the methods of the invention.
include but are not limited to
Arabidopsis (Arabidopsis thaliana), (Gossypium), rapeseed (Brassica napus), sugar (Saccharum officinarum), soybean (Glycine max), sunflower (Helianthus annuus), tomato (Lycopersicon esculentum), wheat (Triticum aestivum).
The aforementioned analyzes for sequence homology are preferably carried out on a full length sequence, although they may also be based on a comparison of certain regions such as conserved domains. Identification of such domains could also be within the scope of the person skilled in the art and would involve, for example, a computer readable format of the nucleic acids of the present invention, the use of alignment software programs, and the use of publicly available information on protein domains, conserved motifs, and boxes. This information is available in the PRODOM database (Hypertext Transfer
Protocol: // World Wide Web (dot) biochem (dot) ucl (dot) ac (dot) uk / bsm / dbbrowser / protocol / prodomqry (dot) html),
PIR (Hypertext Transfer Protocol: // pir (dot) Georgetown (dot) edu /) or Pfam (Hypertext Transfer Protocol: // World Wide
Web (dot) sanger (dot) ac (dot) uk / Software / Pfam /). Sequence analysis programs designed for searching
111
<img file="MX355608B_D0073.tif" />
can be used for conserved domains of motif regions and the identification QíimKd®Mgig ^ j | m¡ <sup>L</sup> INDUSTRIAL as mentioned above.
Preferred computer programs include, but are not limited to, MEME, SIGNALSCAN, and GENESCAN.
The person skilled in the art can use the homologous sequences provided here, to find similar sequences in other species and organisms. Homologs of a protein include peptides, oligopeptides, polypeptides, proteins, and enzymes that have amino acid substitutions, deletions, and / or insertions related to the unmodified protein in question and that have biological and functional activities similar to those of the unmodified protein. which they derive.
To produce such homologs, the amino acids of the protein can be replaced by other amino acids that have similar properties (conservative changes, such as, for example, hydrophobicity, hydrophilicity, antigenicity, propensity to form or break α-helical structures or 3-amine structures). Conservative substitution tables are well known in the art (see, eg, Creighton (1984) Proteins.
WH Freeman and Company). Nucleic acid homologs include nucleic acids that have nucleotide substitutions, deletions and / or insertions related to the unmodified nucleic acid in question and that have biological and functional activities similar to those of the unmodified nucleic acid from which they are derived.
112
MEXICAN INSTITUTE the bases έίe \ o '“HISTRIAI.
Ü MEXICAN TO PROKEtaC »
INDUSTRIAL that share a high level of ios que de arabidopsis
Genes identified in publicly available sequences with respect to sequence homology identified herein are synthesized in Table 18-5 below. These genes are expected to possess similar functions when, when introduced exogenously into plants, to the identified arabidopsis genes. Homologous gene sequences are also provided.
Table 18
Polypeptides and polynucleotides encoding them and sharing high sequence homology with respect to the identified arabidopsis polypeptides of the invention
<td></td><td>Polynucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Organism</td><td>Homology with the NR SEQ ID:</td><td>% of identity</td><td>% of consultation coverage</td><td>Algorithm</td>
<td> 1</td><td> 369</td><td> 523</td><td>peanut</td><td> 51</td><td> 83</td><td> 48.4</td><td>tblastx</td>
<td> 2</td><td> 370</td><td></td><td>crude palm oil</td><td> 126</td><td> 78</td><td> 19,0</td><td>tblastx</td>
<td> 3</td><td> 371</td><td> 524</td><td>tobacco</td><td> 51</td><td> 88</td><td> 45,1</td><td>tblastx</td>
<td> 4</td><td> 372</td><td> 525</td><td>tobacco</td><td> 18</td><td> 85</td><td> 22.0</td><td>tblastx</td>
<td> 5</td><td> 373</td><td> 526</td><td>tobacco</td><td> 165</td><td> 85</td><td> 13.2</td><td>tblastx</td>
<td> 6</td><td> 374</td><td> 527</td><td>tobacco</td><td> 165</td><td>γ-7</td><td> 14.7</td><td>tblastx</td>
<td> 7</td><td> 375</td><td> 528</td><td>barley</td><td> 51</td><td> 85</td><td> 45,1</td><td>tblastx</td>
<td> 8</td><td> 376</td><td> 529</td><td>barley</td><td> 117</td><td> 85</td><td> 27.6</td><td>tbiastx</td>
<td> 9</td><td> 377</td><td> 530</td><td>barley</td><td> 126</td><td> 85</td><td> 31,5</td><td>tblastx</td>
<td> 10</td><td> 378</td><td> 531</td><td>barley</td><td> 137</td><td> 92</td><td> 25.4</td><td>tblastx</td>
<td>H</td><td> 379</td><td> 532</td><td>barley</td><td> 150</td><td> 65</td><td> 41,0</td><td>tblastx</td>
<td> 12</td><td> 380</td><td> 533</td><td>peach</td><td> 51</td><td> 90</td><td> 46,4</td><td>tblastx</td>
<td> 13</td><td> 381</td><td></td><td>thellungiella</td><td> 42</td><td> 86</td><td> 18,9</td><td>tblastx</td>
<td> 14 -</td><td> 382 _ .. __</td><td></td><td>thel lungiel la</td><td> 61</td><td> 88</td><td> 13,1</td><td>tblastx</td>
113
<td></td><td>Polynucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Organism</td><td>Homology with the NR SEQ ID:</td><td>% of identity</td><td>INDUSTRI</td><td>tD TO THE</td><td></td>
<td> 15</td><td> 383</td><td> 534</td><td>thellungiella</td><td> 66</td><td><sup>91</sup></td><td>I4U-</td><td>thlastv -</td><td></td>
<td> 16</td><td> 384</td><td></td><td>thellungiella</td><td> 70</td><td> 86</td><td> 20,5</td><td>tblastx</td><td></td>
<td> 17</td><td> 385</td><td> 535</td><td>thellungiella</td><td> 18</td><td> 95</td><td> 26,4</td><td>tblastx</td><td></td>
<td> 18</td><td> 386</td><td> 536</td><td>thellungiella</td><td> 163</td><td> 92</td><td> 27,7</td><td>tblastx</td><td></td>
<td> 19</td><td> 387</td><td> 537</td><td>Strawberry</td><td> 51</td><td> 83</td><td> 47,1</td><td>tblastx</td><td></td>
<td> 20</td><td> 388</td><td> 538</td><td>cannon</td><td> 36</td><td> 90</td><td> 28,5</td><td>tblastx</td><td></td>
<td> 21</td><td> 389</td><td></td><td>canda</td><td> 36</td><td> 88</td><td> 17,0</td><td>tblastx</td><td></td>
<td> 22</td><td> 390</td><td> 539</td><td>canda</td><td> 9</td><td> 89</td><td> 64,7</td><td>tblastx</td><td></td>
<td> 23</td><td> 391</td><td> 540</td><td>canda</td><td> 29</td><td> 88</td><td> 49,9</td><td>tblastx</td><td></td>
<td> 24</td><td> 392</td><td> 541</td><td>canda</td><td> 40</td><td> 87</td><td> 82,0</td><td>tblastx</td><td></td>
<td> 25</td><td> 393</td><td> 542</td><td>canda</td><td> 40</td><td> 87</td><td> 79,4</td><td>tblastx</td><td></td>
<td> 26</td><td> 394</td><td> 543</td><td>cannon</td><td> 40</td><td> 87</td><td> 82,0</td><td>tblastx</td><td></td>
<td> 27</td><td> 395</td><td></td><td>cannon</td><td> 40</td><td> 86</td><td> 46,5</td><td>tblastx</td><td></td>
<td> 28</td><td> 396</td><td> 544</td><td>canda</td><td> 41</td><td> 95</td><td> 36,5</td><td>tblastx</td><td></td>
<td> 29</td><td> 397</td><td> 545</td><td>canda</td><td> 41</td><td> 93</td><td> 36,5</td><td>tblastx</td><td></td>
<td> 30</td><td> 398</td><td> 546</td><td>canda</td><td> 44</td><td> 87</td><td> 41,1</td><td>tblastx</td><td></td>
<td> 31</td><td> 399</td><td> 547</td><td>canda</td><td> 51</td><td> 93</td><td> 49,0</td><td>tblastx</td><td></td>
<td> 32</td><td> 400</td><td> 548</td><td>canda</td><td> 51</td><td> 97</td><td> 51,0</td><td>tblastx</td><td></td>
<td> 33</td><td> 401</td><td> 549</td><td>canda</td><td> 51</td><td> 77</td><td> 64.7</td><td>tblastx</td><td></td>
<td> 34</td><td> 402</td><td> 550</td><td>canda</td><td> 54</td><td> 94</td><td> 22,3</td><td>tblastx</td><td></td>
<td> 35</td><td> 403</td><td> 551</td><td>canda</td><td> 55</td><td> 93</td><td> 59,3</td><td>tblastx</td><td></td>
<td> 36</td><td> 404</td><td></td><td>canda</td><td> 56</td><td> 85</td><td> 26,0</td><td>tblastx</td><td></td>
<td> 37</td><td> 405</td><td> 552</td><td>canda</td><td> 57</td><td> 94</td><td> 19,1</td><td>tblastx</td><td></td>
<td> 38</td><td> 406</td><td> 553</td><td>canda</td><td> 60</td><td> 90</td><td> 23,6</td><td>tblastx</td><td></td>
<td> 39</td><td> 407</td><td> 554</td><td>canda</td><td> 61</td><td> 88</td><td> 27,7</td><td>tblastx</td><td></td>
<td> 40</td><td> 408</td><td> 555</td><td>cannon</td><td> 63</td><td> 92</td><td> 47,5</td><td>tblastx</td><td></td>
<td> 41</td><td> 409</td><td> 556</td><td>canda</td><td> 10</td><td> 87</td><td> 49,7</td><td>tblastx</td><td></td>
<td> 42</td><td> 410</td><td> 557</td><td>canda</td><td> 66</td><td> 91</td><td> 24.9</td><td>tblastx</td><td></td>
<td> 43</td><td> 411</td><td></td><td>canda</td><td> 7</td><td> 87</td><td> 31,6</td><td>tblastx</td><td></td>
<td> 44</td><td> 412</td><td></td><td>canda</td><td> 14</td><td> 92</td><td> 44,1</td><td>tblastx</td><td></td>
114
<td></td><td>XR polynucleotide SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Organism</td><td>Homology with the NR SEQ ID:</td><td>% of identity</td><td>1 d ^^ erijfra j iNstmcansultaas Di '.A OWN IN.<sup>r</sup>'i.i5TRlA</td><td>- one L</td><td></td>
<td> 45</td><td> 413</td><td></td><td>cannon</td><td> 14</td><td> 92</td><td> 44,1</td><td colspan="2">tblastx</td>
<td> 46</td><td> 414</td><td></td><td>cannon</td><td> 81</td><td> 85</td><td> 36.3</td><td colspan="2">tblastx</td>
<td> 47</td><td> 415</td><td> 558</td><td>canda</td><td> 35</td><td> 90</td><td> 32,4</td><td colspan="2">tblastx</td>
<td> 48</td><td> 416</td><td> 559</td><td>cannon</td><td> 35</td><td> 88</td><td> 45,3</td><td colspan="2">tblastx</td>
<td> 49</td><td> 417</td><td> 560</td><td>canda</td><td> 35</td><td> 91</td><td> 45,3</td><td colspan="2">tblastx</td>
<td> 50</td><td> 418</td><td> 561</td><td>canda</td><td> 91</td><td> 88</td><td> 28,9</td><td colspan="2">tblastx</td>
<td> 51</td><td> 419</td><td> 562</td><td>canda</td><td> 93</td><td> 95</td><td> 14,5</td><td colspan="2">tblastx</td>
<td> 52</td><td> 420</td><td></td><td>canda</td><td> 101</td><td> 95</td><td> 11,3</td><td colspan="2">tblastx</td>
<td> 53</td><td> 421</td><td> 563</td><td>canda</td><td> 106</td><td> 84</td><td> 32,1</td><td colspan="2">tblastx</td>
<td> 54</td><td> 422</td><td></td><td>canda</td><td> 107</td><td> 83</td><td> 62,3</td><td colspan="2">tblastx</td>
<td> 55</td><td> 423</td><td> 564</td><td>canda</td><td> 108</td><td> 94</td><td> 14,4</td><td colspan="2">tblastx</td>
<td> 56</td><td> 424</td><td> 565</td><td>canda</td><td> 118</td><td> 90</td><td> 20,6</td><td colspan="2">tblastx</td>
<td> 57</td><td> 425</td><td> 566</td><td>cannon</td><td> 118</td><td> 95</td><td> 34,4</td><td colspan="2">tblastx</td>
<td> 58</td><td> 426</td><td> 567</td><td>cannon</td><td> 118</td><td> 95</td><td> 34,4</td><td colspan="2">tblastx</td>
<td> 59</td><td> 427</td><td> 568</td><td>canda</td><td> 119</td><td> 83</td><td> 57,2</td><td colspan="2">tblastx</td>
<td> 60</td><td> 428</td><td></td><td>canda</td><td> 125</td><td> 84</td><td> 28,1</td><td colspan="2">tblastx</td>
<td> 61</td><td> 429</td><td></td><td>canda</td><td> 135</td><td> 96</td><td> 24,6</td><td colspan="2">tblastx</td>
<td> 62</td><td> 430</td><td> 569</td><td>cannon</td><td> 137</td><td> 90</td><td> 32,7</td><td colspan="2">tblastx</td>
<td> 63</td><td> 431</td><td></td><td>cannon</td><td> 18</td><td> 93</td><td> 33,4</td><td colspan="2">tblastx</td>
<td> 64</td><td> 432</td><td> 570</td><td>canda</td><td> 21</td><td> 84</td><td> 83,9</td><td colspan="2">tblastx</td>
<td> 65</td><td> 433</td><td></td><td>cannon</td><td> 140</td><td> 92</td><td> 52,2</td><td colspan="2">tblastx</td>
<td> 66</td><td> 434</td><td> 571</td><td>canda</td><td> 143</td><td> 92</td><td> 41,7</td><td colspan="2">tblastx</td>
<td> 67</td><td> 435</td><td> 572</td><td>cannon</td><td> 143</td><td> 93</td><td> 41,0</td><td colspan="2">tblastx</td>
<td> 68</td><td> 436</td><td> 573</td><td>canda</td><td> 145</td><td> 89</td><td> 49,1</td><td colspan="2">tblastx</td>
<td> 69</td><td> 437</td><td> 574</td><td>cannon</td><td> 145</td><td> 91</td><td> 39,8</td><td colspan="2">tblastx</td>
<td> 70</td><td> 438</td><td></td><td>canda</td><td> 153</td><td> 94</td><td> 26,4</td><td colspan="2">tblastx</td>
<td> 71</td><td> 439</td><td> 575</td><td>cannon</td><td> 160</td><td> 89</td><td> 79,6</td><td colspan="2">tblastx</td>
<td> 72</td><td> 440</td><td> 576</td><td>canda</td><td> 163</td><td> 91</td><td> 27,7</td><td colspan="2">tblastx</td>
<td> 73</td><td> 441</td><td> 577</td><td>cannon</td><td> 164</td><td> 80</td><td> 76,6</td><td colspan="2">tblastx</td>
<td> 74</td><td> 442</td><td> 578</td><td>canda</td><td> 165</td><td> 85</td><td> 11.9</td><td colspan="2">tblastx</td>
115
<td></td><td>Polynucleotide \ DE SEQ ID:</td><td>Poiypeptide NR SEQ ID:</td><td>Organism</td><td>Homology with the NR SEQ ID:</td><td>% of identity</td><td>>? o & F LA RROFIEDAC INDUSTRIA</td><td> —*</td>
<td> 75</td><td> 443</td><td> 579</td><td>cantaloupe</td><td> 51</td><td> 84</td><td> 47,1</td><td>tblastx</td>
<td> 76</td><td> 444</td><td> 580</td><td>sugar cane</td><td> 137</td><td> 90</td><td> 25,7</td><td>tblastx</td>
<td>Π</td><td> 445</td><td> 581</td><td>sugar cane</td><td> 137</td><td> 88</td><td> 28,4</td><td>tblastx</td>
<td> 78</td><td> 446</td><td> 582</td><td>b rapa</td><td> 41</td><td> 95</td><td> 36.1</td><td>tblastx</td>
<td> 79</td><td> 447</td><td> 583</td><td>brapa</td><td> 57</td><td> 92</td><td> 9.5</td><td>tblastx</td>
<td> 80</td><td> 448</td><td></td><td>b rapa</td><td> 64</td><td> 86</td><td> 45,7</td><td>tblastx</td>
<td> 81</td><td> 449</td><td> 584</td><td>brapa</td><td> 10</td><td> 84</td><td> 39,0</td><td>tblastx</td>
<td> 82</td><td> 450</td><td></td><td>brapa</td><td> 4</td><td> 86</td><td> 40,5</td><td>tblastx</td>
<td> 83</td><td> 451</td><td> 585</td><td>b rapa</td><td> 35</td><td> 86</td><td> 17,2</td><td>tblastx</td>
<td> 84</td><td> 452</td><td> 586</td><td>brapa</td><td> 106</td><td> 78</td><td> 36,8</td><td>tblastx</td>
<td> 85</td><td> 453</td><td> 587</td><td>b rapa</td><td> 122</td><td> 94</td><td> 71,4</td><td>tblastx</td>
<td> 86</td><td> 454</td><td> 588</td><td>b rapa</td><td> 126</td><td> 87</td><td> 32,6</td><td>tblastx</td>
<td> 87</td><td> 455</td><td> 589</td><td>b rapa</td><td> 135</td><td> 86</td><td> 41,7</td><td>tblastx</td>
<td> 88</td><td> 456</td><td> 590</td><td>brapa</td><td> 137</td><td> 85</td><td> 17,8</td><td>tblastx</td>
<td> 89</td><td> 457</td><td> 591</td><td>brapa</td><td> 18</td><td> 94</td><td> 26,0</td><td>tblastx</td>
<td> 90</td><td> 458</td><td> 592</td><td>b rapa</td><td> 150</td><td> 82</td><td> 42,9</td><td>tblastx</td>
<td> 91</td><td> 459</td><td></td><td>b rapa</td><td> 152</td><td> 88</td><td> 32,6</td><td>tblastx</td>
<td> 92</td><td> 460</td><td> 593</td><td>b rapa</td><td> 165</td><td> 85</td><td> 11,9</td><td>tblastx</td>
<td> 93</td><td> 461</td><td> 594</td><td>corn</td><td> 137</td><td> 86</td><td> 24,1</td><td>tblastx</td>
<td> 94</td><td> 462</td><td> 595</td><td>corn</td><td> 137</td><td> 89</td><td> 14,0</td><td>tblastx</td>
<td> 95</td><td> 463</td><td> 596</td><td>corn</td><td> 137</td><td> 86</td><td> 24,1</td><td>tblastx</td>
<td> 96</td><td> 464</td><td> 597</td><td>corn</td><td> 165</td><td> 72</td><td> 15,5</td><td>tblastx</td>
<td> 97</td><td> 465</td><td> 598</td><td>almond</td><td> 18</td><td> 89</td><td> 20.8</td><td>tblastx</td>
<td> 98</td><td> 466</td><td> 599</td><td>sorghum</td><td> 123</td><td> 87</td><td> 20,6</td><td>tblastx</td>
<td> 99</td><td> 466</td><td> 599</td><td>sorghum</td><td> 124</td><td> 87</td><td> 20,5</td><td>tblastx</td>
<td> 100</td><td> 467</td><td> 600</td><td>sorghum</td><td> 123</td><td> 89</td><td> 19,8</td><td>tblastx</td>
<td>ΙΟΙ</td><td> 467</td><td> 600</td><td>sorghum</td><td> 124</td><td> 89</td><td> 19,6</td><td>tblastx</td>
<td> 102</td><td> 468</td><td> 601</td><td>sorghum</td><td> 137</td><td> 85</td><td> 12,6</td><td>tblastx</td>
<td> 103</td><td> 469</td><td></td><td>soy bean</td><td> 126</td><td> 97</td><td> 22,4</td><td>tblastx</td>
116
<td></td><td>Polynucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Organism</td><td>Homology with the NR SEQ ID:</td><td>% of identity</td><td>tNSTtfcmrcwMM / ftiÁN ' DE LA FhOHEDAL) INDUSTRIAL</td><td></td>
<td> 104</td><td> 470</td><td> 602</td><td>soy bean</td><td> 137</td><td> 92</td><td> 20,1</td><td>tblastx</td>
<td></td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> 105</td><td> 471</td><td> 603</td><td>soy bean</td><td> 137</td><td> 92</td><td> 11,2</td><td>tblastx</td>
<td> 106</td><td> 472</td><td> 604</td><td>soy bean</td><td> 137</td><td> 92</td><td> 20,1</td><td>tblastx</td>
<td> 107</td><td> 473</td><td> 605</td><td>soy bean</td><td> 137</td><td> 85</td><td> 13,1</td><td>tblastx</td>
<td> 108</td><td> 474</td><td> 606</td><td>soy bean</td><td> 137</td><td> 87</td><td> 17,0</td><td>tblastx</td>
<td> 109</td><td> 475</td><td> 607</td><td>soy bean</td><td> 137</td><td> 92</td><td> 11,2</td><td>tblastx</td>
<td> 110</td><td> 476</td><td> 608</td><td>soy bean</td><td> 137</td><td> 85</td><td> 32,3</td><td>tblastx</td>
<td> 111</td><td> 477</td><td> 609</td><td>soy bean</td><td> 18</td><td> 85</td><td> 28,0</td><td>tblastx</td>
<td> 112</td><td> 478</td><td> 610</td><td>soy bean</td><td> 18</td><td> 86</td><td> 28.0</td><td>tblastx</td>
<td> 113</td><td> 479</td><td> 611</td><td>soy bean</td><td> 150</td><td> 86</td><td> 52,8</td><td>tblastx</td>
<td> 114</td><td> 480</td><td> 612</td><td>soy bean</td><td> 150</td><td> 86</td><td> 52,8</td><td>tblastx</td>
<td> 115</td><td> 481</td><td> 613</td><td>soy bean</td><td> 150</td><td> 86</td><td> 52,8</td><td>tblastx</td>
<td> 116</td><td> 482</td><td> 614</td><td>rice</td><td> 137</td><td> 92</td><td> 23,6</td><td>tblastx</td>
<td> 117</td><td> 483</td><td> 615</td><td>rice</td><td> 137</td><td> 93</td><td> 20.6</td><td>tblastx</td>
<td> 118</td><td> 484</td><td> 616</td><td>rice</td><td> 137</td><td> 95</td><td> 23,6</td><td>tblastx</td>
<td> 119</td><td> 485</td><td> 617</td><td>sunflower</td><td> 150</td><td> 83</td><td> 44,0</td><td>tblastx</td>
<td> 120</td><td> 486</td><td></td><td>sunflower</td><td> 161</td><td> 90</td><td> 7,8</td><td>tblastx</td>
<td> 121</td><td> 487</td><td> 618</td><td>poplar</td><td> 51</td><td> 85</td><td> 45,1</td><td>tblastx</td>
<td> 122</td><td> 488</td><td> 619</td><td>poplar</td><td> 123</td><td> 89</td><td> 22,6</td><td>tblastx</td>
<td> 123</td><td> 488</td><td> 619</td><td>poplar</td><td> 124</td><td> 89</td><td> 22,5</td><td>tblastx</td>
<td> 124</td><td> 489</td><td> 620</td><td>poplar</td><td> 137</td><td> 87</td><td> 8,3</td><td>tblastx</td>
<td> 125</td><td> 490</td><td> 621</td><td>poplar</td><td> 18</td><td> 86</td><td> 15,8</td><td>tblastx</td>
<td> 126</td><td> 491</td><td> 622</td><td>poplar</td><td> 165</td><td> 85</td><td> 13,2</td><td>tblastx</td>
<td> 127</td><td> 492</td><td></td><td>b olaceous</td><td> 29</td><td> 92</td><td> 23.3</td><td>tblastx</td>
<td> 128</td><td> 493</td><td></td><td>boleracea</td><td> 50</td><td> 90</td><td> 20,7</td><td>tblastx</td>
<td> 129</td><td> 494</td><td> 623</td><td>boleracea</td><td> 51</td><td> 93</td><td> 51,6</td><td>tblastx</td>
<td> 130</td><td> 495</td><td> 624</td><td>boleracea</td><td> 55</td><td> 91</td><td> 43,7</td><td>tblastx</td>
<td> 131</td><td> 496</td><td></td><td>b olaceous</td><td> 107</td><td> 84</td><td> 62,3</td><td>tblastx</td>
<td> 132</td><td> 497</td><td> 625</td><td>b olaceous</td><td> 126</td><td> 88</td><td> 32,6</td><td>tblastx</td>
<td> 133</td><td> 498</td><td> 626</td><td>boleracea</td><td> 136</td><td> 85</td><td> 45,0</td><td>tblastx</td>
117
<td></td><td>Polynucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Organism</td><td>Homology with the NR SEQ ID:</td><td>% of identity</td><td colspan="2">iNsnatíídiwaN i DF LA nOREDA 0 INriJSTWML —7- *</td><td></td>
<td> 134</td><td> 499</td><td> 627</td><td>b olaceous</td><td> 136</td><td> »7</td><td> 75,3</td><td>tblastx</td><td></td>
<td> 135</td><td> 500</td><td> 628</td><td>grape</td><td> 51</td><td> 87</td><td> 46,4</td><td>tblastx</td><td></td>
<td> 136</td><td> 501</td><td></td><td>grape</td><td> 4</td><td> 84</td><td> 23,5</td><td>tblastx</td><td></td>
<td> 137</td><td> 502</td><td> 629</td><td>grape</td><td> 143</td><td> 90</td><td> 21.9</td><td>tblastx</td><td></td>
<td> 138</td><td> 503</td><td> 630</td><td>grape</td><td> 150</td><td> 93</td><td> 21,4</td><td>tblastx</td><td></td>
<td> 139</td><td> 504</td><td> 631</td><td>grape</td><td> 150</td><td> 84</td><td> 39,5</td><td>tblastx</td><td></td>
<td> 140</td><td> 505</td><td> 632</td><td>wheat</td><td> 123</td><td> 92</td><td> 14,9</td><td>tblastx</td><td></td>
<td> 141</td><td> 505</td><td> 632</td><td>wheat</td><td> 124</td><td> 92</td><td> 14,8</td><td>tblastx</td><td></td>
<td> 142</td><td> 506</td><td> 633</td><td>wheat</td><td> 126</td><td> 82</td><td> 32,9</td><td>tblastx</td><td></td>
<td> 143</td><td> 507</td><td> 634</td><td>wheat</td><td> 126</td><td> 87</td><td> 28,0</td><td>tblastx</td><td></td>
<td> 144</td><td> 508</td><td> 635</td><td>wheat</td><td> 126</td><td> 83</td><td> 32,1</td><td>tblastx</td><td></td>
<td> 145</td><td> 509</td><td> 636</td><td>wheat</td><td> 137</td><td> 91</td><td> 24,1</td><td>tblastx</td><td></td>
<td> 146</td><td> 510</td><td> 637</td><td>wheat</td><td> 137</td><td> 89</td><td> 32,3</td><td>tblastx</td><td></td>
<td> 147</td><td> 511</td><td> 638</td><td>wheat</td><td> 137</td><td> 95</td><td> 1 1,2</td><td>tblastx</td><td></td>
<td> 148</td><td> 512</td><td> 639</td><td>wheat</td><td> 150</td><td> 73</td><td> 53.9</td><td>tblastx</td><td></td>
<td> 149</td><td> 513</td><td> 640</td><td>wheat</td><td> 161</td><td> 86</td><td> 8.8</td><td>tblastx</td><td></td>
<td> 150</td><td> 514</td><td> 641</td><td>wheat</td><td> 161</td><td> 88</td><td> 7,8</td><td>tblastx</td><td></td>
<td> 151</td><td> 515</td><td> 642</td><td>wheat</td><td> 161</td><td> 92</td><td> 7,2</td><td>tblastx</td><td></td>
<td> 152</td><td> 516</td><td> 643</td><td>linen</td><td> 18</td><td> 74</td><td> 15.3</td><td>tblastx</td><td></td>
<td> 153</td><td> 517</td><td> 644</td><td>tomato</td><td> 51</td><td> 85</td><td> 45,8</td><td>tblastx</td><td></td>
<td> 154</td><td> 518</td><td> 645</td><td>tomato</td><td> 123</td><td> 92</td><td> 15.9</td><td>tblastx</td><td></td>
<td> 155</td><td> 518</td><td> 645</td><td>tomato</td><td> 124</td><td> 92</td><td> 15,8</td><td>tblastx</td><td></td>
<td> 156</td><td> 519</td><td> 646</td><td>tomato</td><td> 126</td><td> 94</td><td> 25,1</td><td>tblastx</td><td></td>
<td> 157</td><td> 520</td><td> 647</td><td>cotton</td><td> 51</td><td> 87</td><td> 45,8</td><td>tblastx</td><td></td>
<td> ¡58</td><td> 521</td><td> 648</td><td>cotton</td><td> 51</td><td> 88</td><td> 46,4</td><td>tblastx</td><td></td>
<td> 159</td><td> 522</td><td> 649</td><td>cotton</td><td> 123</td><td> 91</td><td> 18.8</td><td>tblastx</td><td></td>
<td> 160</td><td> 522</td><td> 649</td><td>cotton</td><td> 124</td><td> 91</td><td> 18.7</td><td>tblastx</td><td></td>
<td> 161</td><td> 650</td><td> 786</td><td>b rapa</td><td> 169</td><td> 88</td><td> 73.7</td><td>blastp</td><td></td>
<td> 162</td><td> 651</td><td> 787</td><td>cannon</td><td> 169</td><td> 93</td><td> 62.6</td><td>blastp</td><td></td>
<td> 163</td><td> 652</td><td> 788</td><td>radish</td><td> 169</td><td> 88</td><td> 77,1</td><td>blastp</td><td></td>
118 $
<td rowspan="2"></td><td rowspan="2">Polynucleotide NR SEQ ID:</td><td rowspan="2">Polypeptide NR SEQ ID:</td><td rowspan="2">Organism</td><td rowspan="2">Homology with the NR SEQ ID:</td><td colspan="2"></td><td rowspan="2">TRIAL -</td><td rowspan="2"></td>
<td>of identity</td><td>% dÁcobertnrff. , MEX INSTITUTE to consult INDO '</td>
<td> 164</td><td> 653</td><td>7V)</td><td>b olaceous</td><td> 174</td><td> 93</td><td></td><td></td><td></td>
<td> 165</td><td> 654</td><td> 790</td><td>b_rapa</td><td> 179</td><td> 94</td><td> 70,4</td><td>blastp</td><td></td>
<td> 166</td><td> 655</td><td> 791</td><td>cannon</td><td> 179</td><td> 88</td><td> 100,0</td><td>blastp</td><td></td>
<td> 167</td><td> 656</td><td> 792</td><td>cannon</td><td> 183</td><td> 85</td><td> 84,9</td><td>blastp</td><td></td>
<td> 168</td><td> 657</td><td> 793</td><td>cannon</td><td> 186</td><td> 89</td><td> 96.8</td><td>blastp</td><td></td>
<td> 169</td><td> 658</td><td> 794</td><td>cannon</td><td> 191</td><td> 89</td><td> 51,4</td><td>blastp</td><td></td>
<td> 170</td><td> 659</td><td> 795</td><td>b olaceous</td><td> 192</td><td> 88</td><td> 56,4</td><td>blastp</td><td></td>
<td> 171</td><td> 660</td><td> 796</td><td>cannon</td><td> 194</td><td> 85</td><td> 96,0</td><td>blastp</td><td></td>
<td> 172</td><td> 661</td><td> 797</td><td>brapa</td><td> 195</td><td> 90</td><td> 100,0</td><td>blastp</td><td></td>
<td> 173</td><td> 662</td><td> 798</td><td>cannon</td><td> 195</td><td> 91</td><td> 100,0</td><td>blastp</td><td></td>
<td> 174</td><td> 663</td><td> 799</td><td>cannon</td><td> 200</td><td> 90</td><td> 94,7</td><td>blastp</td><td></td>
<td> 175</td><td> 664</td><td> 800</td><td>cannon</td><td> 200</td><td> 90</td><td> 98,9</td><td>blastp</td><td></td>
<td> 176</td><td> 665</td><td> 801</td><td>b olaceous</td><td> 205</td><td> 87</td><td> 100,0</td><td>blastp</td><td></td>
<td> 177</td><td> 666</td><td> 802</td><td>b rapa</td><td> 205</td><td> 87</td><td> 69,1</td><td>blastp</td><td></td>
<td> 178</td><td> 667</td><td> 803</td><td>brapa</td><td> 205</td><td> 86</td><td> 73.5</td><td>blastp</td><td></td>
<td> 179</td><td> 668</td><td> 804</td><td>cannon</td><td> 205</td><td> 86</td><td> 61,4</td><td>blastp</td><td></td>
<td> 180</td><td> 669</td><td> 805</td><td>radish</td><td> 205</td><td> 87</td><td> 76.5</td><td>blastp</td><td></td>
<td> 181</td><td> 670</td><td> 806</td><td>cannon</td><td> 206</td><td> 93</td><td> 100,0</td><td>blastp</td><td></td>
<td> 182</td><td> 671</td><td> 807</td><td>radish</td><td> 206</td><td> 93</td><td> 100,0</td><td>blastp</td><td></td>
<td> 183</td><td> 672</td><td> 808</td><td>boleracea</td><td> 209</td><td> 87</td><td> 52 6</td><td>blastp</td><td></td>
<td> 184</td><td> 673</td><td> 809</td><td>b rapa</td><td> 209</td><td> 86</td><td> 51,9</td><td>blastp</td><td></td>
<td> 185</td><td> 674</td><td> 810</td><td>cannon</td><td> 209</td><td> 88</td><td> 100,0</td><td>blastp</td><td></td>
<td> 186</td><td> 675</td><td> 811</td><td>Apple</td><td> 216</td><td> 89</td><td> 100,0</td><td>blastp</td><td></td>
<td> 187</td><td> 676</td><td> 812</td><td>Apple</td><td> 216</td><td> 89</td><td> 100,0</td><td>blastp</td><td></td>
<td> 188</td><td> 677</td><td> 813</td><td>avocado</td><td> 216</td><td> 85</td><td> 100,0</td><td>blastp</td><td></td>
<td> 189</td><td> 678</td><td> 814</td><td>b_j lincea</td><td> 216</td><td> 97</td><td> 69,1</td><td>blastp</td><td></td>
<td> 190</td><td> 679</td><td> 815</td><td>b_juncea</td><td> 216</td><td> 98</td><td> 91,2</td><td>blastp</td><td></td>
<td> 191</td><td> 680</td><td> 816</td><td>b jurea</td><td> 216</td><td> 97</td><td> 100.0</td><td>blastp</td><td></td>
<td> 192</td><td> 681</td><td> 817</td><td>brapa</td><td> 216</td><td> 97</td><td> 100,0</td><td>blastp</td><td></td>
<td> 193</td><td> 682</td><td> 818</td><td>Bean</td><td> 216</td><td> 88</td><td> 100,0</td><td>blastp</td><td></td>
119
<td></td><td>Polynucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Organism</td><td>Homology with the NR SEQ ID:</td><td>% of identity</td><td>% of cabcrturí ^ c of cofeulfit * INSTITUTE r ΩΕ lA r ±</td><td>tt: tiCANV <sub>Λ</sub> (i'IVPA. HIJ: T »IAI.</td>
<td> 194</td><td> 683</td><td> 819</td><td>brachypodium</td><td> 216</td><td> 85</td><td> 100,0</td><td>blastp</td>
<td> 195</td><td> 684</td><td> 820</td><td>cassava</td><td> 216</td><td> 91</td><td>-w-</td><td>blastp</td>
<td> 196</td><td> 685</td><td> 821</td><td>cassava</td><td> 216</td><td> 86</td><td> 100,0</td><td>blastp</td>
<td> 197</td><td> 686</td><td> 822</td><td>castor bean</td><td> 216</td><td> 88</td><td> 100,0</td><td>blastp</td>
<td> 198</td><td> 687</td><td> 823</td><td>knapweed</td><td> 216</td><td> 86</td><td> 100,0</td><td>blastp</td>
<td> 199</td><td> 688</td><td> 824</td><td>knapweed</td><td> 216</td><td> 86</td><td> 100,0</td><td>blastp</td>
<td> 200</td><td> 689</td><td> 825</td><td>citric</td><td> 216</td><td> 89</td><td> 100,0</td><td>blastp</td>
<td> 201</td><td> 690</td><td> 826</td><td>citric</td><td> 216</td><td> 89</td><td> 100,0</td><td>blastp</td>
<td> 202</td><td> 691</td><td> 827 -</td><td>coffee</td><td> 216</td><td> 85</td><td> 100,0</td><td>blastp</td>
<td> 203</td><td> 692</td><td> 828</td><td>cotton</td><td> 216</td><td> 88</td><td> 100.0</td><td>blastp</td>
<td> 204</td><td> 693</td><td> 829</td><td>knife herb</td><td> 216</td><td> 86</td><td> 100,0</td><td>blastp</td>
<td> 205</td><td> 694</td><td> 830</td><td>Pomoea</td><td> 216</td><td> 88</td><td> 100,0</td><td>blastp</td>
<td> 206</td><td> 695</td><td> 831</td><td>lettuce</td><td> 216</td><td> 85</td><td> 100,0</td><td>blastp</td>
<td> 207</td><td> 696</td><td> 832</td><td>lettuce</td><td> 216</td><td> 85</td><td> 100,0</td><td>blastp</td>
<td> 208</td><td> 697</td><td> 833</td><td>lettuce</td><td> 216</td><td> 85</td><td> 100,0</td><td>blastp</td>
<td> 209</td><td> 698</td><td> 834</td><td>lettuce</td><td> 216</td><td> 85</td><td> 100,0</td><td>blastp</td>
<td> 210</td><td> 699</td><td> 835</td><td>lettuce</td><td> 216</td><td> 89</td><td> 100,0</td><td>blastp</td>
<td> 211</td><td> 700</td><td> 836</td><td>lettuce</td><td> 216</td><td> 88</td><td> 100,0</td><td>blastp</td>
<td> 212</td><td> 701</td><td> 837</td><td>Pepper</td><td> 216</td><td> 86</td><td> 100,0</td><td>blastp</td>
<td> 213</td><td> 702</td><td> 838</td><td>grass maid</td><td> 216</td><td> 88</td><td> 100,0</td><td>blastp</td>
<td> 214</td><td> 703</td><td> 839</td><td>petunia</td><td> 216</td><td> 88</td><td> 100,0</td><td>blastp</td>
<td> 215</td><td> 704</td><td> 840</td><td>Pope</td><td> 216</td><td> 86</td><td> 97,1</td><td>blastp</td>
<td> 216</td><td> 705</td><td> 841</td><td>radish</td><td> 216</td><td> 95</td><td> 100,0</td><td>blastp</td>
<td> 217</td><td> 706</td><td> 842</td><td>radish</td><td> 216</td><td> 95</td><td> 100,0</td><td>blastp</td>
<td> 218</td><td> 707</td><td> 843</td><td>radish</td><td> 216</td><td> 97</td><td> 100,0</td><td>blastp</td>
<td> 219</td><td> 708</td><td> 844</td><td>rose</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>
<td> 220</td><td> 709</td><td> 845</td><td>safflower</td><td> 216</td><td> 85</td><td> 100,0</td><td>blastp</td>
<td> 221</td><td> 710</td><td> 846</td><td>safflower</td><td> 216</td><td> 85</td><td> 100,0</td><td>blastp</td>
120
<td></td><td>Polynucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Organism</td><td>Homology with the NR SEQ ID:</td><td>% of identity</td><td>% X cftbejifirti dboiustiua INDU'-</td><td>•YEAR ΓΡ, ΑΙ —--</td>
<td> 222</td><td> 711</td><td> 847</td><td>safflower</td><td> 216</td><td> 86</td><td> 100,0</td><td>blastp</td>
<td> 223</td><td> 712</td><td> 848</td><td>soy bean</td><td> 216</td><td> 91</td><td> — 100.6'“</td><td>blastp</td>
<td> 224</td><td> 713</td><td> 849</td><td>soy bean</td><td> 216</td><td> 91</td><td> 100.0</td><td>blastp</td>
<td> 225</td><td> 714</td><td> 850</td><td>spurge</td><td> 216</td><td> 89</td><td> 97,1</td><td>blastp</td>
<td> 226</td><td> 715</td><td> 851</td><td>Strawberry</td><td> 216</td><td> 86</td><td> 100,0</td><td>blastp</td>
<td> 227</td><td> 716</td><td></td><td>thellungiella</td><td> 216</td><td> 90</td><td> 92,6</td><td>tblastn</td>
<td> 228</td><td> 717</td><td> 852</td><td>tobacco</td><td> 216</td><td> 88</td><td> 100,0</td><td>blastp</td>
<td> 229</td><td> 718</td><td> 853</td><td>radish</td><td> 219</td><td> 87</td><td> 100,0</td><td>blastp</td>
<td> 230</td><td> 719</td><td> 854</td><td>radish</td><td> 219</td><td> 92</td><td> 54,8</td><td>blastp</td>
<td> 231</td><td> 720</td><td> 855</td><td>b olaceous</td><td> 220</td><td> 93</td><td> 70,8</td><td>blastp</td>
<td> 232</td><td> 721</td><td> 856</td><td>b rapa</td><td> 220</td><td> 93</td><td> 99,1</td><td>blastp</td>
<td> 233</td><td> 722</td><td> 857</td><td>cannon</td><td> 220</td><td> 93</td><td> 81,5</td><td>blastp</td>
<td> 234</td><td> 723</td><td> 858</td><td>radish</td><td> 220</td><td> 93</td><td> 99,1</td><td>blastp</td>
<td> 235</td><td> 724</td><td> 859</td><td>radish</td><td> 220</td><td> 93</td><td> 99,4</td><td>blastp</td>
<td> 236</td><td> 725</td><td> 860</td><td>arabidopsis</td><td> 244</td><td> 96</td><td> 99.6</td><td>blastp</td>
<td> 237</td><td> 726</td><td> 861</td><td>arabidopsis</td><td> 244</td><td> 96</td><td> 99.3</td><td>tblastn</td>
<td> 238</td><td> 727</td><td> 862</td><td>b rapa</td><td> 246</td><td> 86</td><td> 52.1</td><td>blastp</td>
<td> 239</td><td> 728</td><td> 863</td><td>cannon</td><td> 246</td><td> 85</td><td> 53,4</td><td>blastp</td>
<td> 240</td><td> 729</td><td> 864</td><td>cannon</td><td> 258</td><td> 87</td><td> 100,0</td><td>blastp</td>
<td> 241</td><td> 730</td><td> 865</td><td>cannon</td><td> 266</td><td> 86</td><td> 51,5</td><td>blastp</td>
<td> 242</td><td> 731</td><td> 866</td><td>b olaceous</td><td> 272</td><td> 85</td><td> 97,1</td><td>blastp</td>
<td> 243</td><td> 732</td><td> 867</td><td>cannon</td><td> 272</td><td> 85</td><td> 97,1</td><td>blastp</td>
<td> 244</td><td> 733</td><td> 868</td><td>arabidopsis</td><td> 273</td><td> 87</td><td> 99,0</td><td>blastp</td>
<td> 245</td><td> 734</td><td> 869</td><td>b rapa</td><td> 273</td><td> 94</td><td> 81,1</td><td>blastp</td>
<td> 246</td><td> 735</td><td> 870</td><td>brapa</td><td> 273</td><td> 88</td><td> 60,8</td><td>blastp</td>
<td> 247</td><td> 736</td><td> 871</td><td>b rapa</td><td> 273</td><td> 94</td><td> 65,2</td><td>blastp</td>
<td> 248</td><td> 737</td><td> 872</td><td>radish</td><td> 273</td><td> 89</td><td> 75,4</td><td>blastp</td>
<td> 249</td><td> 738</td><td> 873</td><td>b_rapa</td><td> 274</td><td> 86</td><td> 81,0</td><td>blastp</td>
<td> 250</td><td> 739</td><td> 874</td><td>cannon</td><td> 274</td><td> 90</td><td> 100,0</td><td>blastp</td>
<td> 251</td><td> 740</td><td> 875</td><td>arabidopsis</td><td> 277</td><td> 85</td><td> 57,7</td><td>blastp</td>
<img file="MX355608B_D0074.tif" />
122
<td></td><td>Polynucleotide NR SEQ ID:</td><td>Polypeptide NR SEQ ID:</td><td>Organism</td><td>Homology with the NR SEQ ID:</td><td>% of identity</td><td>% of cXerhrA from cou & uAw * X INSTITUTE: Ut LA i l></td><td>~ ^ ígoi-itfíí ^<sup>:</sup>'' iHXIÜAN ,, ¢, /<sup>1</sup>í; 'rn; «At' nnsTRiAi</td><td>• '' t-iSi · '· ..-' T</td>
<td> 282</td><td> 771</td><td> 906</td><td>radish</td><td> 310</td><td> 92</td><td> 99,7</td><td>blastp</td><td></td>
<td> 283</td><td> 772</td><td> 907</td><td>arabidopsis</td><td> 313</td><td> 91</td><td> 99,8</td><td>blastp</td><td></td>
<td> 284</td><td> 773</td><td> 908</td><td>b olaceous</td><td> 317</td><td> 93</td><td> 63,9</td><td>blastp</td><td></td>
<td> 285</td><td> 774</td><td> 909</td><td>cannon</td><td> 317</td><td> 85</td><td> 100,0</td><td>blastp</td><td></td>
<td> 286</td><td> 775</td><td> 910</td><td>arabidopsis</td><td> 318</td><td> 85</td><td> 99,9</td><td>blastp</td><td></td>
<td> 287</td><td> 776</td><td> 911</td><td>cannon</td><td> 328</td><td> 85</td><td> 100,0</td><td>blastp</td><td></td>
<td> 288</td><td> 777</td><td> 912</td><td>b olaceous</td><td> 329</td><td> 93</td><td> 100,0</td><td>blastp</td><td></td>
<td> 289</td><td> 778</td><td> 913</td><td>brapa</td><td> 329</td><td> 88</td><td> 100,0</td><td>blastp</td><td></td>
<td> 290</td><td> 779</td><td> 914</td><td>brapa</td><td> 329</td><td> 94</td><td> 100.0</td><td>blastp</td><td></td>
<td> 291</td><td> 780</td><td> 915</td><td>cannon</td><td> 329</td><td> 88</td><td> 100.0</td><td>blastp</td><td></td>
<td> 292</td><td> 781</td><td> 916</td><td>cannon</td><td> 329</td><td> 94</td><td> 100,0</td><td>blastp</td><td></td>
<td> 293</td><td> 782</td><td> 917</td><td>radish</td><td> 329</td><td> 88</td><td> 54.1</td><td>blastp</td><td></td>
<td> 294</td><td> 783</td><td> 918</td><td>thellungiella</td><td> 329</td><td> 93</td><td> 88,1</td><td>blastp</td><td></td>
<td> 295</td><td> 784</td><td> 919</td><td>brapa</td><td> 354</td><td> 91</td><td> 100,0</td><td>blastp</td><td></td>
<td> 296</td><td> 785</td><td> 920</td><td>canda</td><td> 354</td><td> 89</td><td> 67,7</td><td>blastp</td><td></td>
Table 18.
EXAMPLE 6
IMPROVED BEHAVIOR OF THE TRANSGENIC PLANT
To analyze whether transgenic plants perform better, potted plants with an adequate amount of nutrients and water were developed. Plants were analyzed for their total size, growth rate, inflorescence emergence time (premature flowering), seed yield, seed oil content, weight of 1,000 seeds, dry matter and harvest index (IC— seed / dry matter yield). Performance was compared
123 of transgenic plants with ju-de · * plants
IMP 1 * developed in parallel in the same condfff3J® ^ KÍ.AÉ<sup>,</sup>l ^ a ^^^ transgenic-simulated that express the reporter gene uidA (GUSy_____
I'ntron) with the same promoter, were used as a control.
The parameters were measured as described in the
Examples 1 and 2.
Statistical analysis - To identify genes that confer significantly improved performance on the plant, the results obtained from the transgenic plants were compared with those obtained from the control plants.
Data on the growth rate of the plant, the area of the plant, the time for premature flowering, time for flowering, weight of 1,000 seeds, seed yield, oil yield, dry matter and harvest index were analyzed using One way ANOVA. To identify the genes and constructs of outstanding behavior, the results of the mixture of transformation events or independent events tested were analyzed. For gene versus control analysis, the T-test was applied using significance of p <0.05. The JMP statistical software package (Version 5.2.1, SAS Institute Inc., Cary,
NO, USA).
Experimental Results
The polynucleotide sequences of the invention were tested for a number of characteristics commercially
124 desired. JL 2V1 .'í7 jL
IHSi'lTUíG MEXICANO Κ, ΑDE LA rií'rlLliAI.i \? ^ Τ; ϊ; - 'ϊΛί # ·
Tables 19-24 illustrate seed yield analyzes on plants overexpressing the pollinyl teotides of the invention under the regulation of a constitutive (35S) promoter or seed specific promoter (napin). Each Table represents an independent experiment, using at least 5 independent events per gene. Genes not related to the same letter as that of the control (A, B) are significantly different from the control.
Table 19
Genes that show improved plant performance:
seed yield
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEC ID: del polynucleotide overexpressed</td><td rowspan="2">Under the regulation of</td><td colspan="3">Seed yield per plant (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL8</td><td> 1021</td><td>35S</td><td> 0,264</td><td>TO</td><td> 15,9</td>
<td>BDL25</td><td> 1032</td><td>35S</td><td> 0,239</td><td>B</td><td> 5,2</td>
<td>BDL27</td><td> 1035</td><td>35S</td><td> 0,238</td><td>B</td><td> 4,8</td>
<td>BDL29</td><td> 1037</td><td>35S</td><td> 0,235</td><td>B</td><td> 3,4</td>
<td>BDL32a</td><td> 1038</td><td>35S</td><td> 0,228</td><td>B</td><td> 0,4</td>
<td>CONTROL (CUS Intron)</td><td>1049 M</td><td>35S</td><td> 0,228</td><td>B</td><td> 0,0</td>
Table 19.
Table 20
Genes that show improved plant performance:
seed yield
125 ^ 7- X "
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td>Semi performance</td><td colspan="2">llafeoMftantaigrC VS iísTiTbro wf.Aeí.íe r; F la 1 »« '' P'LIJAI '</td>
<td>Least root mean square</td><td>SignificatíW (T-test compared, with control)</td><td>RTAL %of unejora</td>
<td>BDL3</td><td> 1017</td><td>35S</td><td> 0,447</td><td>TO</td><td> 10,9</td>
<td>BDL11</td><td> 1042</td><td>35S</td><td> 0,420</td><td>TO</td><td> 4,2</td>
<td>BDL17</td><td> 1043</td><td>35S</td><td> 0,426</td><td>TO</td><td> 5,8</td>
<td>CONTROL (GUSIntron)</td><td> 1049</td><td>35S</td><td> 0,403</td><td>TO</td><td> 0,0</td>
Table 20.
Table 21
Genes that show improved plant performance:
seed yield
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Seed yield per plant (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL3</td><td> 1017</td><td>Napin</td><td> 0,492</td><td>TO</td><td> 13,4</td>
<td>BDL6</td><td> 1019</td><td>Napin</td><td> 0,469</td><td>B</td><td> 8,1</td>
<td>BDL28</td><td> 1036</td><td>Napin</td><td> 0,470</td><td>B</td><td> 8,3</td>
<td>CONTROL (GUSIntron)</td><td> 1049</td><td>Napin</td><td> 0,434</td><td>B</td><td> 0,0</td>
Table 21.
Table 22
Genes that show improved plant performance:
seed yield
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Seed yield per plant (gr)</td>
<td>Half quadratic minimal</td><td>Significance (Essay T compared to control)</td><td>%of improvement</td>
<td>BDL1</td><td> 1040</td><td>35S</td><td> 0,359</td><td>TO</td><td> 23,5</td>
<td>BDL12</td><td> 1023</td><td>35S</td><td> 0,319</td><td>B</td><td> 9,7</td>
126
<img file="MX355608B_D0075.tif" />
Table 22.
Table 23
Genes that show improved plant performance:
seed yield
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Seed yield per plant (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL9</td><td> 1022</td><td>35S</td><td> 0,312</td><td>B</td><td> 10,1</td>
<td>BDL27</td><td> 1035</td><td>35S</td><td> 0,320</td><td>TO</td><td> 13,0</td>
<td>BDL32b</td><td> 1039</td><td>35S</td><td> 0,334</td><td>TO</td><td> 17,8</td>
<td>CONTROL (GUS Intron)</td><td> 1049</td><td>35S</td><td> 0,283</td><td>B</td><td> 0,0</td>
Table
Table 24
Genes that show improved plant performance:
seed yield
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Seed yield per plant (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL25</td><td> 1032</td><td>Napin</td><td> 0,41</td><td>B</td><td> 0,1</td>
127
<td>BDL29</td><td> 1037</td><td>Napin</td><td> 0,44</td><td>B tNSTlTVTC i *</td><td>pituiSTRIAL</td>
<td>BDL32b</td><td> 1039</td><td>Napin</td><td> 0,46</td><td>TO</td><td> 13,0</td>
<td>CONTROL (GUSIntron)</td><td> 1049</td><td>Napin</td><td> 0,41</td><td>B</td><td> 0,0</td>
Table 24
Jl »·, ·> · '. s
Tables 25-30 illustrate analyzes of oil yield in plants that overexpress the polynucleotides of the invention, under the regulation of the constitutive promoter (35S) or seed specific promoter (napin)). Each Table represents an independent experiment, using at least 5 independent events per gene. Genes not related to the same letter as that of the control (A, B) are significantly different from the control.
Table 25
Genes that show improved plant performance:
oil performance
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Oil yield per plant (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% of best to</td>
<td>BDL8</td><td> 1021</td><td>35S</td><td> 0,080</td><td>TO</td><td> 17.1</td>
<td>BDL25</td><td> 1032</td><td>35S</td><td> 0,074</td><td>B</td><td> 8,3</td>
<td>BDL27</td><td> 1035</td><td>35S</td><td> 0,070</td><td>B</td><td>2d</td>
<td>BDL32a</td><td> 1038</td><td>35S</td><td> 0,069</td><td>B</td><td> 1,1</td>
<td>CONTRO L (GUS Intron)</td><td> 1049</td><td>35S</td><td> 0,069</td><td>B</td><td> 0,0</td>
Table 25,
Table 26
Genes that show improved plant performance:
128
<img file="MX355608B_D0076.tif" />
Table 27
Genes that show improved plant performance:
oil performance
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Oil yield per plant (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL3</td><td> 1017</td><td>Napin</td><td> 0,149</td><td>TO</td><td> 13,7</td>
<td>BDL6</td><td> 1019</td><td>Napin</td><td> 0,143</td><td>B</td><td> 9,2</td>
<td>BDL28</td><td> 1036</td><td>Napin</td><td> 0,138</td><td>B</td><td> 5,3</td>
<td>CONTROL (GLS Intron)</td><td> 1049</td><td>Napin</td><td> 0,131</td><td>B</td><td> 0,0</td>
Table 27,
Table 28
Genes that show improved plant performance:
oil performance
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Oil yield per plant (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL1</td><td> 1040</td><td>35S</td><td> 0,108</td><td>TO*</td><td> 23,7</td>
aor ^ Mj
<img file="MX355608B_D0077.tif" />
Table 29
Genes that show improved plant performance:
oil performance
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Oil yield per plant (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared with control)</td><td>% improvement</td>
<td>BDL9</td><td> 1022</td><td>35S</td><td> 0,092</td><td>B</td><td> 6,2</td>
<td>BDL27</td><td> 1035</td><td>35S</td><td> 0,095</td><td>B</td><td> 9,1</td>
<td>BDL32b</td><td> 1039</td><td>35S</td><td> 0,101</td><td>TO</td><td> 16,4</td>
<td>CONTROL (GUSIntron)</td><td> 1049</td><td>35S</td><td> 0,087</td><td>B</td><td> 0,0</td>
Table 29,
Table 30
Genes that show improved plant performance:
Oil yield gene ID
NR SEQ ID: of the overexpressed polynucleotide
Under the regulation of
Oil yield per plant (gr)
Least root mean square
Significance (Test T compared to control)% improvement
130
<td>BDL25</td><td> 1032</td><td>Napin</td><td> 0,12</td><td>B £ 1NST1TU</td><td>i • or MMXICaN</td>
<td>BDL29</td><td> 1037</td><td>Napin</td><td> 0,14</td><td>TO</td><td></td>
<td rowspan="2">BDL32b</td><td rowspan="2"> 1039</td><td rowspan="2">Napin</td><td rowspan="2"> 0,15</td><td>TO</td><td> 20,6</td>
<td></td><td></td>
<td>CONTROL (GUSIntron)</td><td> 1049</td><td>Napin</td><td> 0,12</td><td>B</td><td> 0,0</td>
ί <λ- ~ μγΜ £
Table 30,
<img file="MX355608B_D0078.tif" />
Tables 31-32 illustrate dry matter analyzes in plants that overexpress the polynucleotides of the invention, under the regulation of the constitutive promoter (35S).
Each Table represents an independent experiment, using at least 5 independent events per gene. Genes not related to the same letter as that of the control (A, B) are significantly different from the control.
Table 31
Genes that show improved plant performance:
dry material
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Dry matter per plant (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared with control)</td><td>% improvement</td>
<td>BDL6</td><td> 1019</td><td>35S</td><td> 1,0277</td><td>TO</td><td> 7,9</td>
<td>BDL14</td><td> 1024</td><td>35S</td><td> 1,0444</td><td>TO</td><td> 9,7</td>
<td>BDL18</td><td> 1027</td><td>35S</td><td> 0,985</td><td>TO</td><td> 3,4</td>
<td>BDL20b</td><td> 1044</td><td>35S</td><td> 1,0656</td><td>TO</td><td> 11,9</td>
<td>CONTROL (GUSIntron)</td><td> 1049</td><td>35S</td><td> 0,9523</td><td>TO</td><td> 0,0</td>
Table 31.
Table 32
Genes that show improved plant performance:
131
IMPIOS ¡NSTlTl'Tt. MEXICANO fer ^ WJks. '* »-Λ dry matter of: .a
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">-———- ¡——— jni'u.miAi. Dry matter per plant (gr)</td>
<td>Half quadratic minimal</td><td>si gn i ffcancia - (Essay T compared to control)</td><td>% improvement</td>
<td>BDL3</td><td> 1017</td><td>35S</td><td> 1,3915</td><td>TO</td><td> 3,3</td>
<td>BDL11</td><td> 1042</td><td>35S</td><td> 1,3638</td><td>TO</td><td> 1,2</td>
<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 1,3474</td><td>TO</td><td> 0,0</td>
Table 32.
Tables 33-34 illustrate harvest index (CI) analyzes in plants that overexpress the polynucleotides of the invention, under the regulation of the constitutive promoter (35S) or seed specific promoter (napin). Each Table represents an independent experiment, using at least 5 independent events per gene. Genes not related to the same letter as that of the control (A, B) are significantly different from the control.
Table 33
Genes showing improved plant performance: harvest index (CI)
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: de) overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">IC</td>
<td>Half quadratic minimal</td><td>Significance (Test T compared to control)</td><td>% improvement</td>
<td>BDL3</td><td> 1017</td><td>35S</td><td> 0.3218</td><td>B</td><td> 7.2</td>
<td>BDL5</td><td> 1018</td><td>35S</td><td> 0.3094</td><td>B</td><td> 3.0</td>
<td>BDL8</td><td> 1021</td><td>35S</td><td> 0.3301</td><td>B</td><td> 9.9</td>
<td>BDL11</td><td> 1042</td><td>35S</td><td> 0.3063</td><td>B</td><td> 2.0</td>
132
IMPI
<td>BDL17</td><td> 1043</td><td>35S</td><td> 0.3526</td><td>iNfrmrro m DB LA FR INf</td><td>.χκ> 7 << 5 \ RÍFDAÜ 't'STRlAL</td><td rowspan="2"></td>
<td>BDL25</td><td> 1032</td><td>35S</td><td> 0.3016</td><td>B</td><td> 0.4</td>
<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.3002</td><td>B</td><td> 0.0</td><td></td>
Table 33
Table 34
Genes that show improved plant performance: harvest index (CI)
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the polynucleotide overexpress do</td><td rowspan="2">Under the regulation of</td><td colspan="3">IC</td>
<td>Half quadrati AC minimal</td><td>They mean Inc (Test T compared to control)</td><td>% of best to</td>
<td>BDL2</td><td> 1016</td><td>Napin</td><td> 0.342</td><td>B</td><td> 3.7</td>
<td>BDL3</td><td> 1017</td><td>Napin</td><td> 0.358</td><td>B</td><td> 8.8</td>
<td>BDL6</td><td> 1019</td><td>Napin</td><td> 0.365</td><td><sup>B</sup></td><td> 10.9</td>
<td>BDL28</td><td> 1036</td><td>Napin</td><td> 0.374</td><td>TO</td><td> 13.6</td>
<td>CONTROL (GUSJntr on)</td><td> 1049</td><td>Napin</td><td> 0.329</td><td>B</td><td> 0.0 ..</td>
Table 34
Tables 35-38 illustrate growth rate analyzes in plants that overexpress the polynucleotides of the invention, under the regulation of the constitutive promoter (35S). Each Table represents an independent experiment, using at least 5 independent events per gene. Genes not related to the same letter as that of the control (A, B) are significantly different from the control.
Table 35
Genes that show improved plant performance:
133 growth rate
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Growth rate (ctrb / day)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>%of improvement</td>
<td>BDL14</td><td> 1024</td><td>35S</td><td> 2.48</td><td>TO</td><td> 6.4</td>
<td>BDL18</td><td> 1027</td><td>35S</td><td> 2.41</td><td>TO</td><td> 3.5</td>
<td>BDL20a</td><td> 1029</td><td>35S</td><td> 2.50</td><td>TO</td><td> 7.1</td>
<td>CONTROL (GLS Intron)</td><td> 1049</td><td>35S</td><td> 2.33</td><td>TO</td><td> 0.0</td>
IMPIOS
MUCiCANO INSTITUTE Γ- M'tva'-iíí · Íí LE LA PF'WiEOAO v Ι / Λ -.- 'ϊ'?
Table 35.
Table 36
Genes that show improved plant performance:
growth rate
<td rowspan="2">Gene ID</td><td rowspan="2">NR1D OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Growth rate (cm '/ day)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>%of improvement</td>
<td>BDL11</td><td> 1042</td><td>35S</td><td> 1,80</td><td>TO</td><td> 15,4</td>
<td>CONTROL (GLSlntron)</td><td> 1049</td><td>35S</td><td> 1,56</td><td>TO</td><td> 0,0</td>
Table 36,
Table 37
Genes that show improved plant performance:
growth rate
<td rowspan="2">Gene ID</td><td rowspan="2">NRIDDE SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Growth rate (cm<sup>2</sup>/day)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL1</td><td> 1040</td><td>35S</td><td> 1,81</td><td>TO*</td><td> 17,1</td>
<td>BDL12</td><td> 1023</td><td>35S</td><td> 1.58</td><td>B</td><td> 2,0</td>
134
<img file="MX355608B_D0079.tif" />
Table 37, * P = 0.06
Table 38
Genes that show improved plant performance:
growth rate
<td rowspan="2">Gene ID</td><td rowspan="2">NR1DDE SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Growth rate (cirr / day)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>%of improvement</td>
<td>BDL32b</td><td> 1039</td><td>35S</td><td> 1,19</td><td>TO</td><td> 0,8</td>
<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 1,18</td><td>TO</td><td> 0,0</td>
Table 38.
Tables 39-42 illustrate rosette area analysis in plants overexpressing the polynucleotides of the invention, under the regulation of the constitutive promoter (35S) or seed specific promoter (napin). Each Table represents an independent experiment, using at least 5 independent events per gene. Genes not related to the same letter as that of the control (A, B) are significantly different from the control.
Table 39
Genes showing improved plant performance: area
135 rosette IMPI
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">RosetS'fW area ^ INPUíTKIA</td>
<td>Half quadratic minimal</td><td>Significance (In & apo 1 compared to control)</td><td>improvement</td>
<td>BDL6</td><td> 1019</td><td>35S</td><td> 9,73</td><td>TO</td><td> -10,2</td>
<td>BDL7</td><td> 1020</td><td>35S</td><td> 8,52</td><td>TO</td><td> -21,4</td>
<td>BDL14</td><td> 1024</td><td>35S</td><td> 11,83</td><td>TO</td><td> 9,2</td>
<td>BDL18</td><td> 1027</td><td>35S</td><td> 11,62</td><td>TO</td><td> 7,3</td>
<td>BDL20a</td><td> 1029</td><td>35S</td><td> 11,90</td><td>TO</td><td> 9,9</td>
<td>BDL20b</td><td> 1044</td><td>35S</td><td> 11,02</td><td>B</td><td> 1,7</td>
<td>BDL24</td><td> 1045</td><td>35S</td><td> 8,12</td><td>TO</td><td> -25,1</td>
<td>CONTROL (GUS_Intron)</td><td> 1049</td><td>35S</td><td> 10,83</td><td>B</td><td> 0,0</td>
Table 39: Increase in rosette area means better soil coverage and reduced soil water loss. The decrease in rosette area means that more plants could be placed per area, increasing yield.
Table 40
Genes that show improved plant performance: rosette area
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEC ID: del polynucleotide overexpressed</td><td rowspan="2">Under the regulation of</td><td colspan="3">Rosette area (cmj</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>%of improvement</td>
<td>BDL3</td><td> 1017</td><td>35S</td><td> 11,99</td><td>TO</td><td> -3,6</td>
<td>BDL5</td><td> 1018</td><td>35S</td><td> 11,36</td><td>TO</td><td> -8,6</td>
<td>BDL8</td><td> 1021</td><td>35S</td><td> 9,31</td><td>B</td><td> -25,1</td>
<td>BDL11</td><td> 1042</td><td>35S</td><td> 14,09</td><td>TO</td><td> 13,2</td>
<td>BDL16</td><td> 1026</td><td>35S</td><td> 10,91</td><td>TO</td><td> -12,3</td>
136
Gene ID
BDL17
BDL25
CONTROL (GUS_Intron)
NR1DDE SEC: of the overexpressed polynucleotide
1043
1032
1049
Rosej area (^ / ^
Under the regulation of
35S
35S
35S wynTUT MtxiCAN.)
Least root mean square
Significance · '' (Test T compared to control)
I Pi (PISPAD% improvement
<img file="MX355608B_D0080.tif" />
9,97
7,95
12,44
-19,9
-36,1
0,0
Table 40: Increase in rosette area means better soil coverage and reduced soil water loss. The decrease in rosette area means that more plants could be placed per area, increasing yield.
Table 41
Genes that show improved plant performance: rosette area
<td rowspan="2">Gene ID</td><td rowspan="2">NRIDDE SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Rosette area (cm<sup>2</sup>)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL1</td><td> 1040</td><td>35S</td><td> 9,13</td><td>B</td><td> 12,4</td>
<td>BDL12</td><td> 1023</td><td>35S</td><td> 7,92</td><td>B</td><td> -2,5</td>
<td>BDL14</td><td> 1024</td><td>35S</td><td> 9,96</td><td>TO</td><td> 22,7</td>
<td>BDL18</td><td> 1027</td><td>35S</td><td> 8,63</td><td>B</td><td> 6,3</td>
<td>BDL20a</td><td> 1029</td><td>35S</td><td> 8,03</td><td>B</td><td> -1,1</td>
<td>BDL20b</td><td> 1044</td><td>35S</td><td> 9,14</td><td>B</td><td> 12,6</td>
<td>BDL26a</td><td> 1033</td><td>35S</td><td> 8,51</td><td>B</td><td> 4,8</td>
<td>BDL26b</td><td> 1034</td><td>35S</td><td> 7,92</td><td>B</td><td> -2,5</td>
<td>BDL30</td><td> 1046</td><td>35S</td><td> 9,28</td><td>TO</td><td> 14,2</td>
<td>CONTROL (GUSIntron)</td><td> 1049</td><td>35S</td><td> 8,12</td><td>B</td><td> 0,0</td>
Table 41: The increase in the rosette area means a
137
ί. Ρ10 * 5 institute<sup>!</sup> p.- · '•• ví.t ·; ·', better ground cover and reduced loss of aué ^ ctá '^ l
The decrease in rosette area means that more plants could be placed per area, increasing yield.
Table 42
Genes that show improved plant performance: rosette area
<td rowspan="2">Gene ID</td><td rowspan="2">NRID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Rosette area (cm<sup>2</sup>)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL9</td><td> 1022</td><td>35S</td><td> 5,05</td><td>B</td><td> -17,0</td>
<td>BDL21</td><td> 1030</td><td>35S</td><td> 4,77</td><td>B</td><td> -21,5</td>
<td>BDL27</td><td> 1035</td><td>35S</td><td> 5,22</td><td>B</td><td> -14,2</td>
<td>BDL32b</td><td> 1039</td><td>35S</td><td> 6,19</td><td>TO</td><td> 1,8</td>
<td>CONTROL (GUSlntron)</td><td> 1049</td><td>35S</td><td> 6,08</td><td>TO</td><td> 0,0</td>
Table 42: The increase in rosette area means better soil coverage and reduced soil water loss. The decrease in rosette area means that more plants could be placed per area, increasing yield.
Tables 43-49 illustrate analyzes of the percentage of seed oil of plants that overexpress the polynucleotides of the invention, under the regulation of the constitutive promoter (35S) or seed specific promoter (napin). Each Table represents an independent experiment, using at least 5 independent events per gene. Genes not related to the same letter as control ia (A, B) are
138 significantly different from control
Table 43
IΜ PI
INSTITUTO Mt.XU '^ éUj nt iz r *
EXISTING (Al.
Genes that show improved plant performance:
seed oil percentage
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">% of seed oil</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>%of improvement</td>
<td>BDL8</td><td> 1021</td><td>35S</td><td> 30,542</td><td>TO</td><td> 1,1</td>
<td>BDL25</td><td> 1032</td><td>35S</td><td> 31,09</td><td>TO</td><td> 2,9</td>
<td>BDL32a</td><td> 1038</td><td>35S</td><td> 30,264</td><td>TO</td><td> 0,2</td>
<td>CONTROL (GUS Intron)</td><td> 1049</td><td>35S</td><td> 30,21</td><td>TO</td><td> 0,0</td>
Table 43.
Table 44
Genes that show improved plant performance:
seed oil percentage
<td rowspan="2">Gene ID</td><td rowspan="2">SEC NRID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">% of seed oil</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL6</td><td> 1019</td><td>35S</td><td> 30,565</td><td>B</td><td> 0,7</td>
<td>BDL14</td><td> 1024</td><td>35S</td><td> 31,31</td><td>B</td><td> 3,1</td>
<td>BDL18</td><td> 1027</td><td>35S</td><td> 30,56</td><td>B</td><td> 0,7</td>
<td>BDL20a</td><td> 1029</td><td>35S</td><td> 31,393</td><td>B</td><td> 3,4</td>
<td>BDL20b</td><td> 1044</td><td>35S</td><td> 31,928</td><td>TO</td><td> 5,2</td>
<td>BDL24</td><td> 1045</td><td>35S</td><td> 31,02</td><td>B</td><td> 2,2</td>
<td>CONTROL (GUS_lntrón)</td><td> 1049</td><td>35S</td><td> 30,355</td><td>B</td><td> 0,0</td>
Table 44.
139
Table 45
IK ητ κ i
MEXICAN INSTITUTE DF. LA ΜΙΟΠΙ-ΙιΑΟ
INDUSTRIAL
ΛΛ, · .;
· Ζ>
Genes that show improved plant performance:
seed oil percentage
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">% of seed oil</td>
<td>Half quadratic minimal</td><td>Significance (Test T compared to control)</td><td>%of improvement</td>
<td>BDL3</td><td> 1017</td><td>35S</td><td> 29,39</td><td>TO</td><td> 2,1</td>
<td>BDL5</td><td> 1018</td><td>35S</td><td> 29,29</td><td>TO</td><td> 1,8</td>
<td>BDL8</td><td> 1021</td><td>35S</td><td> 28,903</td><td>TO</td><td> 0,4</td>
<td>BDL11</td><td> 1042</td><td>35S</td><td> 29,216</td><td>TO</td><td> 1,5</td>
<td>BDL17</td><td> 1043</td><td>35S</td><td> 28,904</td><td>TO</td><td> 0,4</td>
<td>BDL25</td><td> 1032</td><td>35S</td><td> 29,514</td><td>TO</td><td> 2,6</td>
<td>CONTROL (GUS_lntrón)</td><td> 1049</td><td>35S</td><td> 28,78</td><td>TO</td><td> 0</td>
Table 45.
Table 46
Genes that show improved plant performance:
seed oil percentage
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">% of seed oil</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL3</td><td> 1017</td><td>Napin</td><td> 30,34</td><td>TO</td><td> 0,46</td>
<td>BDL6</td><td> 1019</td><td>Napin</td><td> 30,45</td><td>TO</td><td> 0,83</td>
<td>BDL28</td><td> 1036</td><td>Napin</td><td> 29,49</td><td>TO</td><td> 2,35</td>
<td>CONTROL (GLS Intron)</td><td> 1049</td><td>Napin</td><td> 30,2</td><td>TO</td><td> 0</td>
Table 46.
Table 47
140
Genes showing improved performance
<img file="MX355608B_D0081.tif" />
<img file="MX355608B_D0082.tif" />
DF LA HtOPIÍDAI? INDUSTRIAL percentage of oil in seed
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide 0</td><td rowspan="2">Under the regulation of</td><td colspan="3">% of Arpite «seed -</td>
<td>Square root to minimum</td><td>Significance (Test T compared to control)</td><td>%of best to</td>
<td>BDL12</td><td> 1023</td><td>35S</td><td> 31,30</td><td>TO</td><td> 3,7</td>
<td>BDL14</td><td> 1024</td><td>35S</td><td> 30,27</td><td>TO</td><td> 0,3</td>
<td>BDL18</td><td> 1027</td><td>35S</td><td> 30,39</td><td>TO</td><td> 0,7</td>
<td>BDL26a</td><td> 1033</td><td>35S</td><td> 30,33</td><td>TO</td><td> 0,5</td>
<td>BDL26b</td><td> 1034</td><td>35S</td><td> 30,43</td><td>TO</td><td> 0,8</td>
<td>BDL30</td><td> 1046</td><td>35S</td><td> 31,42</td><td>TO</td><td> 4,1</td>
<td>CONTROL (GUS Intron ) _</td><td> 1049</td><td>35S</td><td> 30,19</td><td>TO</td><td> 0,0</td>
Table 47.
Table 48
Genes that show improved plant performance:
seed oil percentage
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide 0</td><td rowspan="2">Under the regulation of</td><td colspan="3">% of seed oil</td>
<td>Square root to minimum</td><td>Significance (Test T compared to control)</td><td>% of best to</td>
<td>BDL21</td><td> 1030</td><td>35S</td><td> 30,55</td><td>TO</td><td> 1,8</td>
<td>BDL32b</td><td> 1039</td><td>35S</td><td> 30,35</td><td>TO</td><td> 1,1</td>
<td>CONTROL (GUS Intron)</td><td> 1049</td><td>35S</td><td> 30,01</td><td>TO</td><td> 0,0</td>
Table 48.
Table 49
141
Genes that show a better performance
<img file="MX355608B_D0083.tif" />
ϊ> ·· * asi tfr-sPMF
PIAL ------- percentage of oil in seed
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">% of seed oil</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>%of improvement</td>
<td>BDL25</td><td> 1032</td><td>Napin</td><td> 30,34</td><td>B</td><td> 1,5</td>
<td>BDL29</td><td> 1037</td><td>Napin</td><td> 31,54</td><td>TO</td><td> 5,5</td>
<td>BDL32b</td><td> 1039</td><td>Napin</td><td> 31,69</td><td>TO</td><td> 6,0</td>
<td>CONTROL (GUS Intron)</td><td> 1049</td><td>Napin</td><td> 29,90</td><td>B</td><td> 0,0</td>
Table 49.
Tables 50-55 illustrate analyzes of the weight of 1,000 5 seeds of plants that overexpress the polynucleotides of the invention, under the regulation of the constitutive promoter (35S) or seed specific promoter (napin). Each Table represents an independent experiment, using at least 5 independent events per gene. Genes not related to the same letter as that of the control (A, B) are significantly different from the control.
Table 50
Genes that show improved plant performance: 1,000 seed weight
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Weight of 1,000 seeds (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL8</td><td> 1021</td><td>35S</td><td> 0,019</td><td>B</td><td> 9,1</td>
<td>BDL21</td><td> 1030</td><td>35S</td><td> 0,018</td><td>B</td><td> 0,3</td>
<td>BDL25</td><td> 1032</td><td>35S</td><td> 0,018</td><td>B</td><td> 0,4</td>
142
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Weight of 1,000 swniflas fgrjr- INSTITUrdSlEXiCANt IX · ÓA FhOFIEDAL</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared © -control)</td><td>iNCMjmiAi %of</td>
<td>BDL32a</td><td> 1038</td><td>35S</td><td> 0,019</td><td>B</td><td> 5,5</td>
<td>BDL32b</td><td> 1039</td><td>35S</td><td> 0,020</td><td>TO</td><td> 14,2</td>
<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0,018</td><td>B</td><td> 0,0</td>
<img file="MX355608B_D0084.tif" />
Table 50.
Table 51
Genes that show improved plant performance: 1,000 seed weight
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Weight of 1,000 seeds (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>%of improvement</td>
<td>BDL6</td><td> 1019</td><td>35S</td><td> 0,019</td><td>B</td><td> 7,1</td>
<td>BDL7</td><td> 1020</td><td>35S</td><td> 0,018</td><td>B</td><td> 3,8</td>
<td>BDL14</td><td> 1024</td><td>35S</td><td> 0,019</td><td>B</td><td> 6,1</td>
<td>BDL18</td><td> 1027</td><td>35S</td><td> 0,019</td><td>B</td><td> 8,2</td>
<td>BDL20b</td><td> 1044</td><td>35S</td><td> 0,020</td><td>TO</td><td> 14,5</td>
<td>BDL24</td><td> 1045</td><td>35S</td><td> 0,018</td><td>B</td><td> 4,5</td>
<td>CONTROL (GUS Intron)</td><td> 1049</td><td>35S</td><td> 0,018</td><td>B</td><td> 0,0</td>
<sup>1</sup> Table 5T.
Table 52
Genes that show improved plant performance: 1,000 seed weight
Gene ID
NR SEQ ID: of the overexpressed polynucleotide
Under the regulation of
<td colspan="3">Weight of 1,000 seeds (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared</td><td>% improvement</td>
'1 14-1¾¾
143
<td></td><td></td><td></td><td></td><td>with control ^ INS</td><td>Me • ITUTO Mtx</td><td rowspan="3">»I - * · ^ <2, CANO re., ·. » TKIAl. YOU"</td>
<td>BDL3</td><td> 1017</td><td>35S</td><td> 0,0214</td><td>B</td><td>Dt LAjí'b »'t ·, Ί</td>
<td rowspan="2">BDL5</td><td rowspan="2"> 1018</td><td rowspan="2">35S</td><td rowspan="2"> 0,0205</td><td>B</td><td> 1,1</td>
<td></td><td></td><td rowspan="3"></td>
<td>BDL11</td><td> 1042</td><td>35S</td><td> 0,0235</td><td>TO</td><td> 15,7</td>
<td>CONTROL (GUS Intron)</td><td> 1049</td><td>35S</td><td> 0,0203</td><td>B</td><td> 0</td>
Table 52.
Table 53
Genes that show improved plant performance: 1,000 seed weight
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Weight of 1,000 seeds (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL2</td><td> 1016</td><td>Napin</td><td> 0,0290</td><td>TO</td><td> 30,7</td>
<td>BDL6</td><td> 1019</td><td>Napin</td><td> 0,0232</td><td>B</td><td> 4,3</td>
<td>BDL14</td><td> 1024</td><td>Napin</td><td> 0,0227</td><td>B</td><td> 2,3</td>
<td>BDL28</td><td> 1036</td><td>Napin</td><td> 0,0224</td><td>B</td><td> 1,0</td>
<td>CONTROL (GUS Intron)</td><td> 1049</td><td>Napin</td><td> 0,0222</td><td>B</td><td> 0,0</td>
Table 53.
Table 54
Genes that show improved plant performance: 1,000 seed weight
<td rowspan="2">Gene ID</td><td rowspan="2">NR SEQ ID: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Weight of 1,000 seeds (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL1</td><td> 1040</td><td>35S</td><td> 0,0235</td><td>B</td><td> 0,6</td>
<td>BDL12</td><td> 1023</td><td>35S</td><td> 0,0234</td><td>B</td><td> 0,1</td>
<td>BDL30</td><td> 1046</td><td>35S</td><td> 0,0252</td><td>TO</td><td> 7,8</td>
144
CONTROL (GUSIntron)
1049
35S
0,0234
INST
<img file="MX355608B_D0085.tif" />
1<sup>1</sup>! i¡ υ '.- λΐ
OF. iA PKOPI! N »U '·
<img file="MX355608B_D0086.tif" />
Table 54.
Table 55
Genes that show improved plant performance: 1,000 seed weight
<td rowspan="2">Gene ID</td><td rowspan="2">NR ID OF SEC: of the overexpressed polynucleotide</td><td rowspan="2">Under the regulation of</td><td colspan="3">Weight of 1,000 seeds (gr)</td>
<td>Half quadratic minimal</td><td>Significance (T-test compared to control)</td><td>% improvement</td>
<td>BDL12</td><td> 1023</td><td>Napin</td><td> 0,0206</td><td>B</td><td> 0,2</td>
<td>BDL18</td><td> 1027</td><td>Napin</td><td> 0,0214</td><td>B</td><td> 4,0</td>
<td>BDL25</td><td> 1032</td><td>Napin</td><td> 0,0208</td><td>B</td><td>L1</td>
<td>BDL27</td><td> 1035</td><td>Napin</td><td> 0,0211</td><td>B</td><td> 2,8</td>
<td>BDL29</td><td> 1037</td><td>Napin</td><td> 0,0211</td><td>B</td><td> 2,6</td>
<td>BDL32b</td><td> 1039</td><td>Napin</td><td> 0,0224</td><td>TO</td><td> 9,3</td>
<td>CONTROL (GUSJntron)</td><td> 1049</td><td>Napin</td><td> 0,0205</td><td>B</td><td> 0,0</td>
Table 55.
Taking into account the results obtained using these assays, the following BDL genes, when introduced exogenously into plants, induced a significant improvement in:
one. Seed yield
BDL27, BDL32b.
2. Oil yield
<td>BDL1,</td><td>BDL3,</td><td>BDL8,</td><td>BDL14</td>
<td>BDL1,</td><td>BDL3,</td><td>BDL8,</td><td>BDL14</td>
BDL29, BDL32b.
3. harvest index: BDL17, BDL28.
Four. Growth rate: BDL1, BDL14.
BDL32b
BDL32b
Rosette area
Percentage of
145
BDL14, BDL18, BDL20a seed oil:
<img file="MX355608B_D0087.tif" />
1,000 seed weight: BDL2, BDLll, BDL20b, BDL30,
EXAMPLE 7
INCREASED OIL CONTENT IN LEAVES
In general, the oil is made up primarily of triacyl glycerols (TAG). Arabidopsis seeds and other oil-containing seeds contain high amounts of TAG. TAGs are usually broken down into sugars through the germination process. Cermac and Benning (Plant journal 2004; 40, 575-585) in their report used an assay to quantify the production of TAG in seedlings grown in sucrose. They used this stage of development since, normally, the seedlings do not present TAGs at high levels. In their study, they demonstrated the importance of the wrinkled gene in controlling oil production by showing that transgenic seedlings that overexpress wrinkled cDNA produce high amounts of TAG.
Materials and experimental methods
The present inventors used the Cermac test and
Benning (Cermac and Benning, Plant journal 2004; 40, 575-585) introducing minor changes to rate the effect of
146
IMPI
<img file="MX355608B_D0088.tif" />
transgenes identified here according to their capacity<sup>N,</sup>'<sup>1</sup>®¿i<sup>i</sup>SicrSi4Sie
INDtlSTWAL TAGs in seedlings, similar to the wrinkled gene.
For the quantification of triacyl glycerol T<sub>2</sub>, transgenic seedlings were developed in 1/2 MS medium (Murashige and Skoog, 1962 Plant Physiology 15, 473-497), pH 5.9, 2% sucrose and 0.7% agar. The seeds were sterilized by evaporating with 100 ml of bleach (10%) and 4 ml of HC1 (37%) for 90 minutes in a 5.5 liter closed plastic chamber. Ammonium glufosinate and kanamycin added to final concentrations of 20 pg mi<sup>-1</sup> for glufosinate ammonium and 50 pg mi "<sup>1</sup> for kanamycin. After sterilization, the seeds were sown on agar plates. The plates were incubated for 3 days in the dark at 4 ° C before placing them in a growth chamber. The conditions in the growth chamber were 24 ° C, a 12 hour light period and a 12 hour dry period. The seedlings developed for 10-11 days.
Equal amounts of 11-day-old seedlings were ground in 1.5 ml polypropylene test tubes with a glass rod and the lipids were extracted in 50 ml of chloroform:
methanol: formic acid (10: 10: 1, vol / vol). After extraction with 12.5 ml of KC1 1M and H<sub>3</sub>PO<sub>4</sub> 0.2 M, and from the separation of the organic and aqueous phases by centrifugation at 16,000 g for 5 minutes, the lipids were separated in the
ΛχχιχΛΒαη;
<img file="MX355608B_D0089.tif" />
147 lower phase on a silica TLC plate
Baker, Philipsburg, NJ) developed with petroleum: ethyl ether: acetic acid. Be lipid by steam dyeing iodine.
The following were used as positive controls: naturally produced triacyl glycerols - extracted from natural arabidopsis seeds (lane 5, Figure 3); and transgenic seedlings expressing WRINKLED (wrinkled) cDNA (SEQ ID NO: 1050), known to produce significant amounts of leaf triacyl glycerols (Cernac A and
Benning C, The Plant Journal 2004, 40, 575-585). Transgenic seedlings expressing the gene were used as negative controls.
GUS-Intron (NR SEQ ID: 1049).
Experimental Results
Figure 3 illustrates iodine vapor staining of lipids isolated from transgenic plants of independent events (BDL9, WRINKLED) continuation of events (GUS-Intron) expressing the following genes according to Table 56, which follows. An independent event represents a single stable transformed plant resulting from the random integration of the transformed construct into the genome of
Arabidopsis. Progenies from an event harboring the transformed construct were used for gene evaluation separately as in the case of BDL9 genes and wrinkled genes or as a combination of events in the case
80: 20: 1, ether of visualized
148
<img file="MX355608B_D0090.tif" />
by GUS-Intrón
Table 56
<td>Track A '°</td><td>Description of the transformation of the plant</td><td>Name of the up-regulated gene or control plant</td>
<td> 1</td><td>Transformed with NR SEQ ID: 1022</td><td>BDL9 Event 1</td>
<td> 2</td><td>Transformed with NR SEQ ID: 1022</td><td>BDL9 Event 2</td>
<td> 3</td><td>Transformed with NR SEQ ID: 1022</td><td>BDL9 Event 3</td>
<td> 4</td><td>Plant transformed with control vector NR SEQ ID: 1049</td><td>GUS-intron</td>
<td> 5</td><td>untransformed plant</td><td>SEED</td>
<td> 6</td><td>Transformed with NR SEQ ID: 1050</td><td>Wrinkled Event 1</td>
<td> 7</td><td>Transformed with NR SEQ ID: 1050</td><td>Wrinkled Event 2</td>
<td> 8</td><td>Transformed with NR SEQ ID: 1050</td><td>Wrinkled Event 3</td>
Table 56.
As shown in Figure 3, transgenic plants expressing the BDL9 gene (NR SEQ ID: 1022) produce significantly higher oil content compared to the oil content produced by control plants expressing the GUS-intron ( NR SEQ ID: 1049). Furthermore, the amount of oil produced by BDL9 transgenic plants (for example, Figure 3, Track 2) is comparable to that produced by seeds (Figure 3, Track 5) or by transgenic plants that express the wrinkled gene. known
149 (Figure 3, Track 6).
SUMMARY
<img file="MX355608B_D0091.tif" />
The present inventors have identified genes from
Arabidopsis thaliana, which are important for embryogenesis, seed development, and oil synthesis and accumulation. These genes, when overexpressed in plants, can effectively increase the oil content of seeds or leaves or any other part of the plant. Embryonic tissue or specific expression in plants can result in an optimal increase in oil content in any plant tissue. In this way, transgenes can be expressed at certain stages of the embryo, seed development or stages of development of any tissue of interest, defined as tissue that accumulates oil. This unique expression profile can be achieved using specific promoters, such as developmental promoters, seed expression promoters, and seed specific promoters.
The present inventors demonstrated an improvement in oil synthesis and accumulation by increasing seed size, which allowed the synthesized oil to accumulate to a greater extent, within a larger volume.
Furthermore, oil augmentation can be achieved by controlling embryogenesis. The oil accumulates in the embryo of the developed seed. Some of the early embryonic development genes are directly in charge of the regulation of the
150 oil synthesis and storage.
IMPI
ΙΝΗΤΠ1ΤΟ MtXICANÜ EH- PMOIMEDaB
1ND «» <TWIAL
<img file="MX355608B_D0092.tif" />
The identified genes of the invention can improve oil performance in general and, more specifically, oil synthesis, oil accumulation, and seed size. The result of the bioinformatic method described here is a group of highly predictive genes that improve oil and seed yields by modifying their expression. Although each gene is predicted to have its own impact, modifying the mode of expression of more than one gene is expected to provide an additive or synergistic effect on the plant's seed / oil product yield. Altering the expression of each gene described here, alone or in a group of genes, increases the total yield of the oil, therefore, the price of vegetable oil is expected to decrease, as well as to increase productivity.
Although the invention has been described along with its specific embodiments, it is evident that many alternatives, modifications and variations will be obvious to the person skilled in the art. Accordingly, it is intended to include all such alternatives, modifications and variations that are within the spirit and broad scope of the appended claims.
All publications, patents and patent applications mentioned in this description are incorporated here
151
ΪΜΡΙ
MEXICAN INSTITUTE tfV complete for reference, as if each pub 1 icaci orP; 'óffiaügliffi! Your patent application would have been specific to the date ν.-ί dayJ-m ^ nJ indicated for reference here. Furthermore, each citation or identification of any reference in this application should not be construed as an acknowledgment that such reference is available as prior art of the invention. Where section titles are used, they should not necessarily be considered limiting.
CD-ROM Contents
The following is a listing of the file content of the
CD-ROM attached and submitted with the application. The file information is provided as: File name / byte size / date of creation / operating system / machine format (File name / byte size / creation date / operating system / machine format).
CD-ROM1 (1 file of SEQUENCE LISTING):
one. 44467 SEQUENCE LlSTING.doc / 6,681,088 bytes / July
3, 2008 / Microsoft Windows XP Professional / PC.
152
IM
<img file="MX355608B_D0093.tif" />
Contents92
1,083 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32 Sheet 33 Sheet 34 Sheet 35 Sheet 36 Sheet 37 Sheet 38 Sheet 39 Sheet 40 Sheet 41 Sheet 42 Sheet 43 Sheet 44 Sheet 45 Sheet 46 Sheet 47 Sheet 48 Sheet 49 Sheet 50 Sheet 51 Sheet 52 Sheet 53 Sheet 54 Sheet 55 Sheet 56 Sheet 57 Sheet 58 Sheet 59 Sheet 60 Sheet 61 Sheet 62 Sheet 63 Sheet 64 Sheet 65 Sheet 66 Sheet 67 Sheet 68 Sheet 69 Sheet 70 Sheet 71 Sheet 72 Sheet 73 Sheet 74 Sheet 75 Sheet 76 Sheet 77 Sheet 78 Sheet 79 Sheet 80 Sheet 81 Sheet 82 Sheet 83 Sheet 84 Sheet 85 Sheet 86 Sheet 87 Sheet 88 Sheet 89 Sheet 90 Sheet 91 Sheet 92 Sheet 93 Sheet 94 Sheet 95 Sheet 96 Sheet 97 Sheet 98 Sheet 99 Sheet 100 Sheet 101 Sheet 102 Sheet 103 Sheet 104 Sheet 105 Sheet 106 Sheet 107 Sheet 108 Sheet 109 Sheet 110 Sheet 111 Sheet 112 Sheet 113 Sheet 114 Sheet 115 Sheet 116 Sheet 117 Sheet 118 Sheet 119 Sheet 120 Sheet 121 Sheet 122 Sheet 123 Sheet 124 Sheet 125 Sheet 126 Sheet 127 Sheet 128 Sheet 129 Sheet 130 Sheet 131 Sheet 132 Sheet 133 Sheet 134 Sheet 135 Sheet 136 Sheet 137 Sheet 138 Sheet 139 Sheet 140 Sheet 141 Sheet 142 Sheet 143 Sheet 144 Sheet 145 Sheet 146 Sheet 147 Sheet 148 Sheet 149 Sheet 150 Sheet 151 Sheet 152 Sheet 153 Sheet 154 Sheet 155 Sheet 156 Sheet 157 Sheet 158 Sheet 159 Sheet 160 Sheet 161 Sheet 162 Sheet 163 Sheet 164 Sheet 165 Sheet 166 Sheet 167 Sheet 168 Sheet 169 Sheet 170 Sheet 171 Sheet 172 Sheet 173 Sheet 174 Sheet 175 Sheet 176 Sheet 177 Sheet 178 Sheet 179 Sheet 180 Sheet 181 Sheet 182 Sheet 183 Sheet 184 Sheet 185 Sheet 186 Sheet 187 Sheet 188 Sheet 189 Sheet 190 Sheet 191 Sheet 192 Sheet 193 Sheet 194 Sheet 195 Sheet 196 Sheet 197 Sheet 198 Sheet 199 Sheet 200 Sheet 201 Sheet 202 Sheet 203 Sheet 204 Sheet 205 Sheet 206 Sheet 207 Sheet 208 Sheet 209 Sheet 210 Sheet 211 Sheet 212 Sheet 213 Sheet 214 Sheet 215 Sheet 216 Sheet 217 Sheet 218 Sheet 219 Sheet 220 Sheet 221 Sheet 222 Sheet 223 Sheet 224 Sheet 225 Sheet 226 Sheet 227 Sheet 228 Sheet 229 Sheet 230 Sheet 231 Sheet 232 Sheet 233 Sheet 234 Sheet 235 Sheet 236 Sheet 237 Sheet 238 Sheet 239 Sheet 240 Sheet 241 Sheet 242 Sheet 243 Sheet 244 Sheet 245 Sheet 246 Sheet 247 Sheet 248 Sheet 249 Sheet 250 Sheet 251 Sheet 252 Sheet 253 Sheet 254 Sheet 255 Sheet 256 Sheet 257 Sheet 258 Sheet 259 Sheet 260 Sheet 261 Sheet 262 Sheet 263 Sheet 264 Sheet 265 Sheet 266 Sheet 267 Sheet 268 Sheet 269 Sheet 270 Sheet 271 Sheet 272 Sheet 273 Sheet 274 Sheet 275 Sheet 276 Sheet 277 Sheet 278 Sheet 279 Sheet 280 Sheet 281 Sheet 282 Sheet 283 Sheet 284 Sheet 285 Sheet 286 Sheet 287 Sheet 288 Sheet 289 Sheet 290 Sheet 291 Sheet 292 Sheet 293 Sheet 294 Sheet 295 Sheet 296 Sheet 297 Sheet 298 Sheet 299 Sheet 300 Sheet 301 Sheet 302 Sheet 303 Sheet 304 Sheet 305 Sheet 306 Sheet 307 Sheet 308 Sheet 309 Sheet 310 Sheet 311 Sheet 312 Sheet 313 Sheet 314 Sheet 315 Sheet 316 Sheet 317 Sheet 318 Sheet 319 Sheet 320 Sheet 321 Sheet 322 Sheet 323 Sheet 324 Sheet 325 Sheet 326 Sheet 327 Sheet 328 Sheet 329 Sheet 330 Sheet 331 Sheet 332 Sheet 333 Sheet 334 Sheet 335 Sheet 336 Sheet 337 Sheet 338 Sheet 339 Sheet 340 Sheet 341 Sheet 342 Sheet 343 Sheet 344 Sheet 345 Sheet 346 Sheet 347 Sheet 348 Sheet 349 Sheet 350 Sheet 351 Sheet 352 Sheet 353 Sheet 354 Sheet 355 Sheet 356 Sheet 357 Sheet 358 Sheet 359 Sheet 360 Sheet 361 Sheet 362 Sheet 363 Sheet 364 Sheet 365 Sheet 366 Sheet 367 Sheet 368 Sheet 369 Sheet 370 Sheet 371 Sheet 372 Sheet 373 Sheet 374 Sheet 375 Sheet 376 Sheet 377 Sheet 378 Sheet 379 Sheet 380 Sheet 381 Sheet 382 Sheet 383 Sheet 384 Sheet 385 Sheet 386 Sheet 387 Sheet 388 Sheet 389 Sheet 390 Sheet 391 Sheet 392 Sheet 393 Sheet 394 Sheet 395 Sheet 396 Sheet 397 Sheet 398 Sheet 399 Sheet 400 Sheet 401 Sheet 402 Sheet 403 Sheet 404 Sheet 405 Sheet 406 Sheet 407 Sheet 408 Sheet 409 Sheet 410 Sheet 411 Sheet 412 Sheet 413 Sheet 414 Sheet 415 Sheet 416 Sheet 417 Sheet 418 Sheet 419 Sheet 420 Sheet 421 Sheet 422 Sheet 423 Sheet 424 Sheet 425 Sheet 426 Sheet 427 Sheet 428 Sheet 429 Sheet 430 Sheet 431 Sheet 432 Sheet 433 Sheet 434 Sheet 435 Sheet 436 Sheet 437 Sheet 438 Sheet 439 Sheet 440 Sheet 441 Sheet 442 Sheet 443 Sheet 444 Sheet 445 Sheet 446 Sheet 447 Sheet 448 Sheet 449 Sheet 450 Sheet 451 Sheet 452 Sheet 453 Sheet 454 Sheet 455 Sheet 456 Sheet 457 Sheet 458 Sheet 459 Sheet 460 Sheet 461 Sheet 462 Sheet 463 Sheet 464 Sheet 465 Sheet 466 Sheet 467 Sheet 468 Sheet 469 Sheet 470 Sheet 471 Sheet 472 Sheet 473 Sheet 474 Sheet 475 Sheet 476 Sheet 477 Sheet 478 Sheet 479 Sheet 480 Sheet 481 Sheet 482 Sheet 483 Sheet 484 Sheet 485 Sheet 486 Sheet 487 Sheet 488 Sheet 489 Sheet 490 Sheet 491 Sheet 492 Sheet 493 Sheet 494 Sheet 495 Sheet 496 Sheet 497 Sheet 498 Sheet 499 Sheet 500 Sheet 501 Sheet 502 Sheet 503 Sheet 504 Sheet 505 Sheet 506 Sheet 507 Sheet 508 Sheet 509 Sheet 510 Sheet 511 Sheet 512 Sheet 513 Sheet 514 Sheet 515 Sheet 516 Sheet 517 Sheet 518 Sheet 519 Sheet 520 Sheet 521 Sheet 522 Sheet 523 Sheet 524 Sheet 525 Sheet 526 Sheet 527 Sheet 528 Sheet 529 Sheet 530 Sheet 531 Sheet 532 Sheet 533 Sheet 534 Sheet 535 Sheet 536 Sheet 537 Sheet 538 Sheet 539 Sheet 540 Sheet 541 Sheet 542 Sheet 543 Sheet 544 Sheet 545 Sheet 546 Sheet 547 Sheet 548 Sheet 549 Sheet 550 Sheet 551 Sheet 552 Sheet 553 Sheet 554 Sheet 555 Sheet 556 Sheet 557 Sheet 558 Sheet 559 Sheet 560 Sheet 561 Sheet 562 Sheet 563 Sheet 564 Sheet 565 Sheet 566 Sheet 567 Sheet 568 Sheet 569 Sheet 570 Sheet 571 Sheet 572 Sheet 573 Sheet 574 Sheet 575 Sheet 576 Sheet 577 Sheet 578 Sheet 579 Sheet 580 Sheet 581 Sheet 582 Sheet 583 Sheet 584 Sheet 585 Sheet 586 Sheet 587 Sheet 588 Sheet 589 Sheet 590 Sheet 591 Sheet 592 Sheet 593 Sheet 594 Sheet 595 Sheet 596 Sheet 597 Sheet 598 Sheet 599 Sheet 600 Sheet 601 Sheet 602 Sheet 603 Sheet 604 Sheet 605 Sheet 606 Sheet 607 Sheet 608 Sheet 609 Sheet 610 Sheet 611 Sheet 612 Sheet 613 Sheet 614 Sheet 615 Sheet 616 Sheet 617 Sheet 618 Sheet 619 Sheet 620 Sheet 621 Sheet 622 Sheet 623 Sheet 624 Sheet 625 Sheet 626 Sheet 627 Sheet 628 Sheet 629 Sheet 630 Sheet 631 Sheet 632 Sheet 633 Sheet 634 Sheet 635 Sheet 636 Sheet 637 Sheet 638 Sheet 639 Sheet 640 Sheet 641 Sheet 642 Sheet 643 Sheet 644 Sheet 645 Sheet 646 Sheet 647 Sheet 648 Sheet 649 Sheet 650 Sheet 651 Sheet 652 Sheet 653 Sheet 654 Sheet 655 Sheet 656 Sheet 657 Sheet 658 Sheet 659 Sheet 660 Sheet 661 Sheet 662 Sheet 663 Sheet 664 Sheet 665 Sheet 666 Sheet 667 Sheet 668 Sheet 669 Sheet 670 Sheet 671 Sheet 672 Sheet 673 Sheet 674 Sheet 675 Sheet 676 Sheet 677 Sheet 678 Sheet 679 Sheet 680 Sheet 681 Sheet 682 Sheet 683 Sheet 684 Sheet 685 Sheet 686 Sheet 687 Sheet 688 Sheet 689 Sheet 690 Sheet 691 Sheet 692 Sheet 693 Sheet 694 Sheet 695 Sheet 696 Sheet 697 Sheet 698 Sheet 699 Sheet 700 Sheet 701 Sheet 702 Sheet 703 Sheet 704 Sheet 705 Sheet 706 Sheet 707 Sheet 708 Sheet 709 Sheet 710 Sheet 711 Sheet 712 Sheet 713 Sheet 714 Sheet 715 Sheet 716 Sheet 717 Sheet 718 Sheet 719 Sheet 720 Sheet 721 Sheet 722 Sheet 723 Sheet 724 Sheet 725 Sheet 726 Sheet 727 Sheet 728 Sheet 729 Sheet 730 Sheet 731 Sheet 732 Sheet 733 Sheet 734 Sheet 735 Sheet 736 Sheet 737 Sheet 738 Sheet 739 Sheet 740 Sheet 741 Sheet 742 Sheet 743 Sheet 744 Sheet 745 Sheet 746 Sheet 747 Sheet 748 Sheet 749 Sheet 750 Sheet 751 Sheet 752 Sheet 753 Sheet 754 Sheet 755 Sheet 756 Sheet 757 Sheet 758 Sheet 759 Sheet 760 Sheet 761 Sheet 762 Sheet 763 Sheet 764 Sheet 765 Sheet 766 Sheet 767 Sheet 768 Sheet 769 Sheet 770 Sheet 771 Sheet 772 Sheet 773 Sheet 774 Sheet 775 Sheet 776 Sheet 777 Sheet 778 Sheet 779 Sheet 780 Sheet 781 Sheet 782 Sheet 783 Sheet 784 Sheet 785 Sheet 786 Sheet 787 Sheet 788 Sheet 789 Sheet 790 Sheet 791 Sheet 792 Sheet 793 Sheet 794 Sheet 795 Sheet 796 Sheet 797 Sheet 798 Sheet 799 Sheet 800 Sheet 801 Sheet 802 Sheet 803 Sheet 804 Sheet 805 Sheet 806 Sheet 807 Sheet 808 Sheet 809 Sheet 810 Sheet 811 Sheet 812 Sheet 813 Sheet 814 Sheet 815 Sheet 816 Sheet 817 Sheet 818 Sheet 819 Sheet 820 Sheet 821 Sheet 822 Sheet 823 Sheet 824 Sheet 825 Sheet 826 Sheet 827 Sheet 828 Sheet 829 Sheet 830 Sheet 831 Sheet 832 Sheet 833 Sheet 834 Sheet 835 Sheet 836 Sheet 837 Sheet 838 Sheet 839 Sheet 840 Sheet 841 Sheet 842 Sheet 843 Sheet 844 Sheet 845 Sheet 846 Sheet 847 Sheet 848 Sheet 849 Sheet 850 Sheet 851 Sheet 852 Sheet 853 Sheet 854 Sheet 855 Sheet 856 Sheet 857 Sheet 858 Sheet 859 Sheet 860 Sheet 861 Sheet 862 Sheet 863 Sheet 864 Sheet 865 Sheet 866 Sheet 867 Sheet 868 Sheet 869 Sheet 870 Sheet 871 Sheet 872 Sheet 873 Sheet 874 Sheet 875 Sheet 876 Sheet 877 Sheet 878 Sheet 879 Sheet 880 Sheet 881 Sheet 882 Sheet 883 Sheet 884 Sheet 885 Sheet 886 Sheet 887 Sheet 888 Sheet 889 Sheet 890 Sheet 891 Sheet 892 Sheet 893 Sheet 894 Sheet 895 Sheet 896 Sheet 897 Sheet 898 Sheet 899 Sheet 900 Sheet 901 Sheet 902 Sheet 903 Sheet 904 Sheet 905 Sheet 906 Sheet 907 Sheet 908 Sheet 909 Sheet 910 Sheet 911 Sheet 912 Sheet 913 Sheet 914 Sheet 915 Sheet 916 Sheet 917 Sheet 918 Sheet 919 Sheet 920 Sheet 921 Sheet 922 Sheet 923 Sheet 924 Sheet 925 Sheet 926 Sheet 927 Sheet 928 Sheet 929 Sheet 930 Sheet 931 Sheet 932 Sheet 933 Sheet 934 Sheet 935 Sheet 936 Sheet 937 Sheet 938 Sheet 939 Sheet 940 Sheet 941 Sheet 942 Sheet 943 Sheet 944 Sheet 945 Sheet 946 Sheet 947 Sheet 948 Sheet 949 Sheet 950 Sheet 951 Sheet 952 Sheet 953 Sheet 954 Sheet 955 Sheet 956 Sheet 957 Sheet 958 Sheet 959 Sheet 960 Sheet 961 Sheet 962 Sheet 963 Sheet 964 Sheet 965 Sheet 966 Sheet 967 Sheet 968 Sheet 969 Sheet 970 Sheet 971 Sheet 972 Sheet 973 Sheet 974 Sheet 975 Sheet 976 Sheet 977 Sheet 978 Sheet 979 Sheet 980 Sheet 981 Sheet 982 Sheet 983 Sheet 984 Sheet 985 Sheet 986 Sheet 987 Sheet 988 Sheet 989 Sheet 990 Sheet 991 Sheet 992 Sheet 993 Sheet 994 Sheet 995 Sheet 996 Sheet 997 Sheet 998 Sheet 999 Sheet 1000 Sheet 1001 Sheet 1002 Sheet 1003 Sheet 1004 Sheet 1005 Sheet 1006 Sheet 1007 Sheet 1008 Sheet 1009 Sheet 1010 Sheet 1011 Sheet 1012 Sheet 1013 Sheet 1014 Sheet 1015 Sheet 1016 Sheet 1017 Sheet 1018 Sheet 1019 Sheet 1020 Sheet 1021 Sheet 1022 Sheet 1023 Sheet 1024 Sheet 1025 Sheet 1026 Sheet 1027 Sheet 1028 Sheet 1029 Sheet 1030 Sheet 1031 Sheet 1032 Sheet 1033 Sheet 1034 Sheet 1035 Sheet 1036 Sheet 1037 Sheet 1038 Sheet 1039 Sheet 1040 Sheet 1041 Sheet 1042 Sheet 1043 Sheet 1044 Sheet 1045 Sheet 1046 Sheet 1047 Sheet 1048 Sheet 1049 Sheet 1050 Sheet 1051 Sheet 1052 Sheet 1053 Sheet 1054 Sheet 1055 Sheet 1056 Sheet 1057 Sheet 1058 Sheet 1059 Sheet 1060 Sheet 1061 Sheet 1062 Sheet 1063 Sheet 1064 Sheet 1065 Sheet 1066 Sheet 1067 Sheet 1068 Sheet 1069 Sheet 1070 Sheet 1071 Sheet 1072 Sheet 1073 Sheet 1074 Sheet 1075 Sheet 1076 Sheet 1077 Sheet 1078 Sheet 1079 Sheet 1080 Sheet 1081 Sheet 1082 Sheet 1083
28 members in 10 offices
Priority claims9
| Document | Office | Kind | Date |
|---|---|---|---|
| 60907568 | United States of America | – | |
| 90756807 | United States of America | P | |
| 90756807 | United States of America | P | |
| 2008000489 | Israel | W | |
| 2008000489 | Israel | W | |
| 60907568 | – | – | – |
| PCTIL2008000489 | – | – | – |
| US20070907568P | – | – | – |
| WO2008IL00489 | – | – | – |
Members28
| Document | Office | Kind | |
|---|---|---|---|
| AU2008236316A1 | Australia | A1 | |
| CA2683143A1 | Canada | A1 | |
| WO2008122980A2 | World Intellectual Property Organization (WIPO) | A2 | |
| WO2008122980A8 | World Intellectual Property Organization (WIPO) | A8 | |
| MX2009010858A | Mexico | A | |
| WO2008122980A9 | World Intellectual Property Organization (WIPO) | A9 | |
| EP2154946A2 | European Patent Office (EPO) | A2 | |
| IL201242D0 | Israel | D0 | |
| US2010154077A1 | United States of America | A1 | |
| EP2154946A4 | European Patent Office (EPO) | A4 | |
| CN101854798A | China | A | |
| ZA200907805B | South Africa | B | |
| WO2008122980A3 | World Intellectual Property Organization (WIPO) | A3 | |
| CN101854798B | China | B | |
| AU2008236316B2 | Australia | B2 | |
| EP2154946B1 | European Patent Office (EPO) | B1 | |
| US8513488B2 | United States of America | B2 | |
| US2013291223A1 | United States of America | A1 | |
| BRPI0809796A2 | Brazil | A2 | |
| MX341624B | Mexico | B | |
| US9487793B2 | United States of America | B2 | |
| US2016348125A1 | United States of America | A1 | |
| MX355608BThis record | Mexico | B | |
| CA2683143C | Canada | C | |
| US10036031B2 | United States of America | B2 | |
| BRPI0809796A8 | Brazil | A8 | |
| BR122020016899B1 | Brazil | B1 | |
| BRPI0809796B1 | Brazil | B1 |
Numbers
- Publication
- 355608
- Publication, DOCDB
- 355608
- Publication, EPODOC
- MX355608
- Application
- 2016006396
- Application, DOCDB
- 2016006396
- Application, EPODOC
- MX20160006396
Titles2
- English
- POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS FOR INCREASING OIL CONTENT, GROWTH RATE AND BIOMASS OF PLANTS.
- Spanish
- POLINUCLEOTIDOS, POLIPEPTIDOS Y METODOS PARA AUMENTAR EL CONTENIDO DE ACEITE, LA VELOCIDAD DE CRECIMIENTO Y BIOMASA DE LAS PLANTAS.
Classification
- CPC, 4
- C12N15/8247
- C07K14/415
- C12N15/8261
- Y02A40/146
- IPC, 4
- C12N15 82
- A01H5 10
- C07K14 415
- C12N15 63