Polynucleotides, polypeptides and methods for increasing oil content, growth rate and biomass of plants

(54) Title: METHOD OF INCREASING OIL CONTENT, GROWTH RATE, BIOMASS, FRUIT PRODUCTION AND / OR ENERGY OF A PLANT, ISOLATED POLYNUCLEOTIDE, BUILDING NUCLEIC ACIDS, INSULATED POLYTERTID AND CELL. 51. : A01H 5/00 (30) Unionist Priority: 09/04/2007 US 60 / 907,568 (73) Holder (s): EVOGENE LTD.

(72) Inventor (s): EYAL EMMANUEL; GIL RONEN; NOA SAVIR (74) Attorney (s): KASZNAR LEONARDOS INTELLECTUAL PROPERTY (86) International Application: PCT IL2008000489 of 04/09/2008 (87) International Publication: WO

2008/122980 of 10/16/2008

<img file="BRPI0809796A2_D0001.tif" />

* BRPIO8O9796A2 *

<img file="BRPI0809796A2_D0002.tif" />

1/119

METHOD OF INCREASING OIL CONTENT, GROWTH RATE, BIOMASS, FRUIT PRODUCTION AND / OR ENERGY OF A PLANT, ISOLATED POLYNUCLEOTIDE, NUCLEIC ACID CONSTRUCTION, ISOLATED POLYPEPTIDE AND PLANT CELL

FIELD AND HISTORY OF THE INVENTION

The present invention, in some of its configurations, concerns polypeptides, polynucleotides that encode them, transgenic plants expressing the same and methods of producing and using them and, more particularly, but not exclusively, methods of increasing the oil content, seed yield, growth rate, biomass and / or the yield of a plant.

Seed or vegetable oils are the main source of energy and nutrition in the human and animal diet. They are also used for the production of industrial products, such as paints and lubricants. In addition, vegetable oils represent renewable sources of long-chain hydrocarbons, which can be used as fuel. Since the fossil fuels currently used are finite sources and are being gradually depleted, fast-growing biomass crops can be used as alternative fuels or can be used as alternative fuels or for energy raw materials and can reduce dependence on energy resources. fossil energy. However, the main limiter to increase consumption

2/119 of vegetable oils as bio-fuel is the price of oil, which is, however, higher than fossil fuel [http: //www.eia. donate. gov / oiaf / analysispaper / biodiesel /; Http://www.njbiz.com/weekly_article.asp?aID=19755147.6122555 .957931.7393254.4337383.561 &amp; aID2 = 73678]. Furthermore, the rate of vegetable oil production is limited by the availability of land for planting and water. Thus, increasing the yield of vegetable oil from the same cultivation area can effectively overcome the lack of production space and can decrease the prices of vegetable oil at the same time.

Studies aimed at increasing vegetable oil yields focus on the identification of genes involved in oil metabolism, as well as on genes capable of increasing plant and seed yields in transgenic plants.

The genes known to be involved in increasing vegetable oil yields include those that participate in fatty acid synthesis or sequestration such as desaturase [eg, DELTA6, DELTA12 or acyl-ACP (Ssi2; Arabidopsis Information Source (TAIR; Http: // World Wide Web (dot) arabidopsis (dot) org /), TAIR No. AT2G43710)], OleosinA (TAIR No. AT3G01570) or FAD3 (TAIR No. AT2G29980) and various transcription factors and activators, such as Lecl [ TAIR No. AT1G21970, Lotan et al. 1998. Cell. 26; 93 (7):

1195-205], Lec2 [TAIR No. AT1G28300, Santos Mendoza et al. 2005, FEBS Lett. 579 (21): 4666-70], Fus3 (TAIR No.

AT3G26790), ABI3 [TAIR No. AT3G24650, Lara et al. 2003. J

3/119

Biol Chem. 278 (23): 21003-11] and Wril [TAIR No. AT3G54320,

Cernac and Benning, 2004. Plant J. 40 (4): 575-85].

Zabrouskov V., et al., 2002 (Physiol Plant. 116: 172-185) demonstrated that the endoplasmic reticulum (FAD3) overregulation and plastid fatty acid (FAD7) desaturases in the potato increases the fraction of total lipids in transgenic clones.

Wang HW et al., 2007 (Plant J.

52: 716-29. Epub 2007 Sep 18) found that seeds from transgenic plants overexpressing the transcription factors GmDof4 and GmDofll have an increased content of fatty acids and total lipids.

Vigeolas H, et al. [Plant Biotechnol J. 2007, 5 (3): 431-41] and the Patent Application

Americana No. 20060168684 disclose an increased seed oil content in canola (Brassica napus L.) by overexpression of glycerol-3-phosphate dehydrogenase in a yeast under the control of a specific seed promoter.

Katavic V, et al., 2000 (Biochem Soc Trans. 28: 935-7) describe the use of the Arabidopsis FAE1 and yeast SLC1-1 genes for improvements in erucic acid and oil content in canola.

The American Patent Application

No. 20080076179 discloses a nucleic acid isolated from moss encoding a lipid metabolism protein (LMP) and transgenic plants expressing the same with increased levels of lipids.

4/119

The American Patent Application

No. 20060206961 discloses a method of increasing the oil content in plants (e.g., in plant seeds) by expressing the Yprl40w polypeptide in the plant.

American Patent Application

No. 20060174373 discloses a method of increasing the oil content in plants by expressing a nucleic acid encoding a protein that stimulates the synthesis (TEP) of triacylglycerols (TAG) in the plant.

American Patent Applications

We. 20070169219, 20070006345, 20070006346 and 20060195943, reveal transgenic plants with increased efficiency in the use of nitrogen, which can be used for conversion into fuel or chemical raw materials.

SUMMARY OF THE INVENTION

According to an aspect of some configurations of the present invention, a method of increasing the oil content, growth rate, biomass, yield and / or vigor of a plant is provided, comprising introducing - into the plant - an exogenous polynucleotide encoding a polypeptide comprising an amino acid sequence at least 90% homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs: 199, 166-198, 200-221, 229307, 311-330, 351-353, 355-361, 363-364, 366-368, 218, 222228, 308-310, 350, 354, 362, 365, 523- 649, 786-920, 1047 and

1048 thus increasing the oil content, growth rate, biomass, yield and / or vigor of the plant.

5/119

According to an aspect of some configurations of the present invention, a method of producing oil is provided, comprising: (a) supplying the plant according to the method of the invention, and (b) extracting the oil from the plant; thus producing the oil.

According to an aspect of some embodiments of the present invention, an isolated polynucleotide is provided comprising a nucleic acid sequence at least 90% identical to SEQ ID NOs: 34, 133, 35-52, 54-56, 64-165, 332 -334, 336-342, 344-345, 347349, 53, 57-63, 143-145, 331, 335, 343, 346, 369-522, 650785, 1016-1046.

According to an aspect of some embodiments of the present invention, a nucleic acid construct is provided, comprising the isolated polynucleotide of the invention and a promoter for directing the transcription of the nucleic acid sequence.

According to an aspect of some embodiments of the present invention, an isolated polypeptide is provided, comprising an amino acid sequence at least 90% homologous to SEQ ID NO: 199, 166198, 200-221, 229-307, 311-330, 351-353, 355-361, 363-364, 366-368, 218, 222-228, 308-310, 350, 354, 362, 365, 523-649, 786-920, 1047 and 1048.

According to an aspect of some embodiments of the present invention, a plant cell is provided exogenously expressing the polypeptide of the invention.

6/119

According to one aspect of some embodiments of the present invention, a plant cell is provided exogenously expressing the polynucleotide of the invention.

According to some configurations of the invention, the polynucleotide comprises the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 34, 1-33, 35-52, 54-56, 64-165,

332-334, 336-342, 344-345, 347-349, 53, 57-63, 143-145, 331,

335, 343, 346, 369-522, 650-785, 1016-1046.

settings of the invention, selected from the group

According to some the sequence of amino acids

199, 166-198, 200-221

363-364, 366-368, 218,

523-649, 786-920, 1047

229-307

222-228, and 1048.

consisting of SEQ ID NOs:

311-330, 351-353, 355-361,

308-310, 350, 354, 362, 365,

According to some configurations of the invention, the polynucleotide is selected from the group consisting of SEQ ID NOs: 34, 1-33, 35-52,

54-56, 64-165, 332-334, 336-342, 344-345, 347-349, 53, 5763, 143-145, 331, 335, 343, 346, 369-522, 650-785, 10161046.

According to some configurations of the invention, the polypeptide is selected from the group consisting of SEQ ID NOs: 199, 166-198,

200-221, 229-307, 311-330, 351-353, 355-361, 363-364, 366368, 218, 222-228, 308-310, 350, 354, 362, 365, 523-649,

786-920, 1047 and 1048.

7/119

<td></td><td>In</td><td>wake up</td><td>with</td><td>some</td>

<td>invention configurations,</td><td>the oil</td><td colspan="2">comprises a</td><td>oil</td>

<td>seed.</td><td></td><td></td><td></td><td></td>

<td></td><td>In</td><td>wake up</td><td>with</td><td>some</td>

<td>invention configurations,</td><td>the oil</td><td colspan="2">comprises a</td><td>oil</td>

<td>vegetative portion.</td><td></td><td></td><td></td><td></td>

<td></td><td>In</td><td>wake up</td><td>with</td><td>some</td>

<td>invention configurations,</td><td>the cell</td><td>vegetable</td><td>form</td><td>a part</td>

of a plant.

Unless otherwise defined, all technical and / or scientific terms used here have the same meaning as is normally understood by someone of average skill in the art to which the invention relates. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of configurations of the invention, exemplary methods and / or materials are described below. In case of conflict, this will be mediated by the patent specification, including definitions. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE DRAWINGS

Some configurations of the invention are described here, by way of example only, with reference to the attached drawings. Now, with specific reference to the drawings in detail, emphasize that the details shown are given by way of example and for the purposes of illustrative discussion of the invention.

In this

8/119 sense, the description taken with the drawings makes it apparent to those skilled in the art, how the configurations of the invention can be practiced.

In the drawings:

<td>the figures</td><td>la-d are digital images of leaves depicting the leaf length (in Figure ia, the leaf length is represented by the arrow), the laminar length (in Figure ib, the laminar length is represented by arrow), the laminar area (in Figure lc, the</td>

<td>the figures</td><td>laminar is represented by the white ellipse) and the laminar width (in Figure ld, the width laminar is represented by the arrow). THE blade circularity was calculated as the laminar width being divided by the laminar length. 2a-b are images depicting the development of the root of plants grown on transparent agar. The different ecotypes were grown on agar plates transparent for 17 days and the plates were photographed every 2 days starting on the 7th.</td>

<td>figure 3</td><td>An exemplary image is shown in Figure 2a (obtained after 12 days on the agar plates). The measured length of the root is represented by the red arrow (Figure 2b). is an image depicting the steam dye of iodine from lipids isolated from the</td>

9/119 transgenic plants expressing the genes listed in Table 56, Example 7 of the Examples section that follows. The arrow indicates the triacyl glycerol bands.

DESCRIPTION OF SPECIFIC SETTINGS OF THE INVENTION

The present invention, in some of its configurations, concerns isolated polypeptides and polynucleotides encoding them and, more particularly, but not exclusively, methods of using them to increase oil content, growth rate, yield , biomass and / or the vigor of a plant.

Before explaining at least one configuration of the invention in detail, it should be understood that the invention is not necessarily limited in its application - to the details presented in the following description or exemplified by the Examples. The invention is capable of other configurations or to be practiced or carried out in various forms.

By reducing the present invention to practice, the present inventors have identified new polypeptides and polynucleotides that can be used to increase the oil content, seed yield, growth rate, biomass, yield and / or vigor of a plant .

Thus, as shown in the Examples section that follows, the present inventors employed a bio-informatics approach, which compares

10/119 the pattern of expression of genes derived from Arabidopsis in 79 tissues or stages of development to the pattern of oil hook genes (OHGs) that are known to play a role in embryogenesis, seed development and oil synthesis and accumulation, and identified genes that exhibited significant correlation (Table 1, Example 1). In addition, using an oligonucleotide microvanscan, the present inventors determined the expression profile of genes identified in the tissues and stages of development of various Arabidopsis ecotypes (Table 3; Example 2) and correlated the expression profile with selected yield parameters or related vigor (Tables 4, 5 and 6; Example 2). Genes were identified showing a significant correlation between expression profile and the parameters of yield or vigor of ecotypes (Table 7; Example 2). Of these, it was found that several genes modulate seed yield (Table 8), oil yield (Table 9), growth rate (Table 10), organ shape / size / length (Table 11), harvest index (Table 12), the oil content per seed (Table 13), the dry matter of the plant (Table 14) and the number of seeds per silica (Table 15). Through the use of bio-informatics tools, additional genes were identified, which were expected to increase the oil content, seed yield, growth rate, yield and / or biomass of a plant (Table 2, Example 1 ). Furthermore, polypeptides and polynucleotides encoding the same ones, which are the

11/119 homologues to the polypeptides predicted in Tables 1 and 2 (Table 18, Example 5). Further, as described in Examples 3, 4 and 6 of the Examples section below, transgenic plants expressing the identified polynucleotides show an increased yield of seeds, oil, dry matter, harvest index, growth rate, rosette area, percentage of oil in the seed and weight of 1000 seeds (Tables 19-55; Example 6). In addition, transgenic plants expressing the polynucleotides of the invention showed an increased oil content compared to control plants (Figure 3, Example 7). Altogether, these results suggest the use of the new polynucleotides and polypeptides of the invention to increase the oil content, yield (including seed yield), growth rate, biomass, and / or the vigor of a plant.

It should be noted that, since the oil content is affected by the production of intrinsic oil, or by the mass / size of the oil-producing tissue per plant / by growth period, any gene that affects these processes mentioned above is contemplated, according to the teachings of the present invention.

Thus, according to an aspect of the invention, a method of increasing the oil content, yield, growth rate, biomass and / or the vigor of a plant is provided. The method is carried out by introducing into the plant an exogenous polynucleotide encoding a polypeptide

12/119 comprising an amino acid sequence - at least 90% homologous to the amino acid sequence selected from the group consisting of SEQ ID NOs: 166-221, 229-307, 311-330,

351-353, 355-361, 363-364, 366-368, 218, 222-228, 308-310,

350, 354, 362, 365, 523-649, 786-920, 1047 and 1048.

The phrase oil content as used here refers to the amount of lipids in the organ of a given plant, whether they are the seeds (seed oil content) or the plant's vegetative portion (vegetative oil content) and typically expressed as a percentage dry weight (10% of seed moisture) or wet weight (for the vegetative portion).

As mentioned, in one configuration, the increase in the oil content of the plant can be achieved by increasing the size / mass of the tissue (s) of a plant, which comprises oil per growth period. Thus, the increased oil content of a plant can be achieved by increasing the yield, the growth rate, the biomass and the vigor of the plant.

As used here, the phrase plant yield refers to the volume (as established by weight / size) or quantity (number) of tissue (eg, seed, called seed yield and vegetative portion) produced per plant or season. cultivation. Therefore, the increased yield could affect the economic benefit that can be extracted from the plant in a certain growing area and / or growing season.

13/119

As used here, the phrase plant biomass refers to the amount (measured in grams of air-dried tissue) of tissue produced from the plant in a growing season, which could also determine or affect the yield of the plant or the yield per planting area.

As used here, the phrase plant vigor refers to the amount (measured by weight) of tissue produced by the plant at any given time. Therefore, increased vigor could determine or affect plant yield or yield by area of ​​cultivation and / or growing season.

As used here, the term increase refers to an increase of at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, over at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80% in the oil content of the plant, seed yield (seed yield per plant and / or seed yield per growing area), plant yield, growth rate, biomass, and / or vigor compared to a native plant [eg, a non modified with the biomolecules (polynucleotide or polypeptides) of the invention, (eg, an unprocessed plant of the same species, which is grown under the same growing conditions).

14/119

As used here, the phrase exogenous polynucleotide refers to a heterological nucleic acid sequence, which may not be expressed naturally within the plant, or whose overexpression in the plant is desired. The exogenous polynucleotide can be introduced into the plant in a stable or transient way, in order to produce a molecule of ribonucleic acid (RNA) and / or a polypeptide molecule. It should be noted that the exogenous polynucleotide may comprise a nucleic acid sequence, which is identical - or partially homologous - to an endogenous plant nucleic acid sequence.

According to some embodiments of the invention, the exogenous polynucleotide encodes a polypeptide comprising an amino acid sequence of at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least

<td>fence</td><td>in</td><td>85% at least</td><td>about 86%,</td><td>at least about 87</td><td>The, 'Of</td><td>to</td>

<td>any less</td><td colspan="3">about 88%, at least about 89</td><td>%, at least about</td><td> 90</td><td>Q. δζ</td>

<td colspan="2">at least &lt;</td><td>about 91%, when</td><td>less about</td><td>92%, at least</td><td colspan="2">fence</td>

<td>of 93</td><td>The. The z</td><td>at least about</td><td>94% when</td><td>less about 95</td><td>The. 'S z</td><td>to</td>

<td>any less</td><td colspan="2">about 96%, while</td><td>less about</td><td>97%, at least</td><td colspan="2">fence</td>

<td>of 98</td><td>The. z</td><td>at least about</td><td>99% or,</td><td>say, more than</td><td> 100</td><td>The. The</td>

<td colspan="2">counterpart</td><td>to the sequence of</td><td>amino acid</td><td colspan="2">selected from</td><td>of</td>

group consisting of SEQ ID NOs: 166-221, 229-307, 311-330,

351-353, 355-361, 363-364, 366-368, 218, 222-228,

350, 354, 362, 365, 523-649, 786-920, 1047 and 1048.

308-310,

15/119

Homology (e.g. , homology percentage) can be determined using any homology comparison software including, for example, the BLASTP or TBLASTN software from the National Center of Biotechnology Information (NCBI), either by using default parameters, when starting from a polypeptide sequence; or the tBLASTX algorithm (available via NCBI) either by using default parameters, which compares the products of the conceptual translation of six structures of a reference nucleotide sequence (both strands) with a database of the protein sequence .

Homologous sequences include both orthological and paralogical sequences. The term paralogical refers to the duplication of genes within the genome of a species leading to paralogical genes. The term orthologist refers to homologous genes in different organisms due to an ancestral relationship.

An option to identify orthologists in the monocotyledonous plant species is to perform a reciprocal BLAST (Basic Local Alignment Search Tool) search. This can be done through a first BLAST involving the search for the sequence of interest in comparison to any sequence database, such as the publicly available NCBI database, which can be found at: Http: // World Wide Web ( dot) ncbi (dot) nlm (dot) nih (dot) gov. If orthologists were sought

16/119 sequences filtered in rice, the sequence of interest would be searched in comparison to, for example, the 28,469 full-length cDNA clones of Oryza Sativa Nipponbare available at NCBI. BLAST results can be filtered. The full-length ones - both from results and unfiltered results - are searched back (sequel BLAST) compared to the sequences of the organism from which the sequence of interest is derived. The results of the first and second BLAST are compared below. An orthologist is identified when the sequence that results in the highest score (best hit) in the first BLAST identifies, in the second BLAST, the reference sequence (the original sequence of interest) as the best hit. A parallel is found (homologous to a gene in the same organism) using the same rationale. In the case of families of long strings, the ClustalW program can be used [Http: // World Wide Web (dot) ebi (dot) ac (dot) uk / Tools / clustalw2 / index (dot) html], followed by a tree neighbor-joining (Http: // en (dot) wikipedia (dot) org / wiki / Neighbor-joining), which helps to visualize the cluster.

According to some configurations of the invention, exogenous polynucleotide encodes a polypeptide selected from the group consisting of SEQ ID NOs: 166-221, 229-307, 311-330, 351353, 355-361, 363-364, 366-368, 218, 222-228, 308-310, 350,

354, 362, 365, 523-649, 786-920, 1047 and 1048.

Of configurations of the invention, the agreement with some exogenous polynucleotide

17/119 comprises a nucleic acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88 %, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, for , 100% identical to the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-52, 54-56, 64165, 332-334, 336-342, 344-345, 347-349, 53, 57-63, 143-145, 331, 335, 343, 346, 369-522, 650-785, 1016-1046.

Identity (eg, homology percentage) can be determined using any homology comparison software including, for example, the BLASTN software from the National Center of Biotechnology Information (NCBI) which is using default parameters.

According to some configurations of the invention, the exogenous polynucleotide is presented by SEQ ID NOs: 1-52, 54-56, 64-165, 332-334, 336-342, 344-345, 347-349, 53, 57- 63, 143-145, 331, 335, 343, 346, 369-522, 650-785, 1016-1046.

As used here, the term polynucleotide refers to a sequence of acid

18/119 nucleic, single or double stranded, which is isolated and provided in the form of an RNA Sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and / or a compound of polynucleotide sequences (for a combination of the above).

As used herein, the phrase complementary polynucleotide sequence refers to a sequence, which results from the reverse transcription of messenger RNA using a reverse transcriptase or any other RNA-dependent DNA polymerase. Subsequently, such a sequence can be amplified in vivo or in vitro DNA dependent DNA polymerase.

As used here, the phrase genomic polynucleotide sequence refers to a sequence derived (isolated) from a chromosome and thus represents a contiguous portion of a chromosome.

As used here, the phrase composed of polynucleotide sequences refers to a sequence, which is, at least partially, complementary and, at least partially, genomic. A sequence compound can include some exon sequences

<td>required</td><td>for</td><td>if</td><td>encode the polypeptide of</td><td colspan="2">gift</td>

<td>invention,</td><td colspan="2">as well as</td><td>some intronic strings</td><td>what</td><td>if</td>

<td>interpose</td><td>there .</td><td>At</td><td>intronic sequences can</td><td>come over</td><td>in</td>

any source, including other genes, and will typically include conserved splicing signal sequences. Such

19/119 intronic sequences can also include regulatory elements of cis active expression.

The nucleic acid sequences encoding the polypeptides of the present invention can be optimized for expression. Non-limiting examples of optimized nucleic acid optimized sequences are given in SEQ ID NOs: 1040, 1041, 1042, 1043, 1044, 1045 and 1046 which encode polypeptides comprising the amino acid sequences presented by SEQ ID NOs: 167, 169, 1047, 181, 185, 189 and 196, respectively. Examples of such sequence modifications include, but are not limited to, an altered G / C content to more closely address what is typically found in the plant species of interest, and the removal of the codons found atypically in the plant species - commonly called codon optimization.

The phrase codon optimization refers to the selection of DNA nucleotides appropriate for use within a structural gene or fragment there that addresses the use of codons within the plant of interest. Therefore, an optimized nucleic acid gene or sequence refers to a gene in which the nucleotide sequences of a native gene - or that occurs naturally - have been modified to use statistically - or statistically favored - preferred codons within the plant. Nucleotide sequences are typically examined at the DNA level and the coding region is optimized for expression in the given plant species

20/119 using any suitable procedure, for example, as described in Sardana et al. (1996, Plant Cell

Reports 15: 677-681). In this method, the standard deviation of codon usage, a measure of the trend in codon usage, can be calculated by finding, first, the square proportional deviation of the use of each codon of the native gene relative to that of highly expressed plant genes , followed by a calculation of the mean squared deviation. The formula used is: 1 SDCU = η = 1 N [(Xn - Yn) / Yn] 2 / N, where Xn refers to the frequency of use of codon n in highly expressed plant genes, where Yn refers to the frequency of use of codon n in the gene of interest, and N refers to the total number of codons in the gene of interest. A codon usage table for highly expressed genes from dicotyledonous plants is compiled using data from Murray et al. (1989, Nuc Acids Res. 17: 477498).

One method of optimizing the nucleic acid sequence according to the preferred codon usage for a particular plant cell type, without performing any extra statistical calculations, is based on the direct use of codon optimization tables such as those are made available online at the Codon Usage Database through the DNA bank of NIAS (National Institute of Agrobiological Sciences) in Japan (http://www.kazusa.or.jp/c0don/ ). The Codon Use Database contains codon usage tables for a number of different species,

21/119 particular nucleotide of occurrence use of each codon having been determined statistically based on the data present in Genbank.

By using the Tables above to determine the most preferred - or most favored codons - for each amino acid in a species in (for example, rice), a natural sequence, which encodes a protein of interest, can be optimized for codons for that particular plant species. This is done by replacing codons that may have a low statistical incidence in the genome of the particular species with corresponding codons that are statistically more favored, with respect to an amino acid. However, one or more less favored codons can be chosen to delete existing restriction sites, in order to create new locations at potentially useful junctions (5 'and 3' terminals to add signal peptide or termination cassettes, internal sites that can be used to cut and join segments so that a correct full-length sequence is produced), or to eliminate nucleotide sequences that can negatively affect stability or mRNA expression.

Naturally occurring nucleotide coding sequences can already contain, before any modification, a number of codons that correspond to a statistically favored codon in a particular plant species. Therefore, codon optimization of native nucleotide sequences can comprise the

22/119 determining which codons, within the native nucleotide sequence, are not statistically favored with respect to a particular plant, and modifying these codons according to a codon usage table for a particular plant to produce a codon-optimized derivative. A modified nucleotide sequence can be totally or partially optimized for codon use in the plant, provided that the protein encoded by the modified nucleotide sequences is produced at a higher level than the protein encoded by the native or naturally occurring gene. The construction of synthetic genes by altering the

<td>codon usage is described, for example</td><td>example,</td><td>in the PCT Patent</td>

<td>Application 93/07278.</td><td></td><td></td>

<td>In</td><td>wake up</td><td>with some</td>

embodiments of the invention, expression of the polynucleotide of the invention results in downward regulation of the activity or level of expression of the corresponding endogenous polypeptide (e.g., homologous).

According to some embodiments of the invention, the exogenous polynucleotide is used for the co-suppression or sense suppression of an endogenous polypeptide. In this way, introducing the exogenous polynucleotide into plant cells results in the transcription of an RNA molecule (in the sense orientation in relation to the corresponding endogenous gene), which suppresses the translation of the corresponding endogenous RNA molecule, as described in the Patent USA No. 5,231,020 for Jorgensen, which is incorporated here, in full, by

11/23 reference. For co-suppression, the exogenous polynucleotide does not require the entire nucleic acid sequence of the corresponding endogenous gene, nor does it require that the introduced sequence be exactly identical to the endogenous gene.

<td>However,</td><td>same way as in the suppression before,</td>

<td>the efficiency</td><td>suppressive is increased to the extent that</td>

<td>increases the</td><td>specificity of hybridization, e.g. ,</td>

<td>just like the</td><td>entered string has its length</td>

elongated, and / or how the sequence similarity between the introduced sequence and the endogenous gene is increased. For more details, see American Patent Application No.

<td>20050172364 o</td><td>which is incorporated here, in full, by</td>

<td>reference.</td><td></td>

<td>settings</td><td>According to some of the invention, the exogenous polynucleotide</td>

<td>comprises a</td><td>non-translatable nucleic acid sequence,</td>

e.g., a sequence comprising one or more premature stop codons, or nonsense mutations, as described in the U.S. Patent. No. 5,583,021.

Thus, the invention encompasses the isolated polynucleotides described above; its fragments, its other hybridizable sequences, pertinent homologous sequences, sequences that encode similar polypeptides with use of different codon, altered sequences characterized by mutations, such as deletion, insertion or substitution of one or more nucleotides, whether they occur naturally or are induced by man , either randomly or in a directed manner.

24/119

As present inventors have revealed previously characterized.

mentioned, polypeptides are not

Thus, the invention provides an isolated polypeptide having an amino acid sequence of at least about 70%, at least about 75%, at least

<td>fence</td><td>in</td><td> 80</td><td>THE, THE /</td><td>to</td><td>any less</td><td>fence</td><td>in</td><td> 81</td><td>Q, ot</td><td>to</td><td>any less</td><td>fence</td><td>in</td><td> 82</td>

<td>%, to</td><td colspan="2">any less</td><td colspan="2">fence</td><td>of 83</td><td>%, to</td><td colspan="2">any less</td><td colspan="2">fence</td><td>of 8 4</td><td>%, to</td><td colspan="2">any less</td>

<td>fence</td><td>in</td><td> 85</td><td>THE. ot</td><td>to</td><td>any less</td><td>fence</td><td colspan="2">of 86</td><td>Q. ot</td><td>to</td><td>any less</td><td>fence</td><td>in</td><td> 87</td>

<td>%, to</td><td colspan="2">any less</td><td colspan="2">fence</td><td>of 8 8</td><td>%, to</td><td colspan="2">any less</td><td colspan="2">fence</td><td>of 8 9</td><td>%, to</td><td colspan="2">any less</td>

<td>fence</td><td>in</td><td> 90</td><td>The.</td><td>to</td><td>any less</td><td>fence</td><td>in</td><td> 91</td><td>THE.</td><td>to</td><td>any less</td><td>fence</td><td>in</td><td> 92</td>

<td>%, to</td><td colspan="2">any less</td><td colspan="2">fence</td><td>of 93</td><td>%, to</td><td colspan="2">any less</td><td colspan="2">fence</td><td>of 93</td><td>%, to</td><td colspan="2">any less</td>

<td>fence</td><td>in</td><td> 94</td><td>THE. The t</td><td>to</td><td>any less</td><td>fence</td><td>in</td><td> 95</td><td>THE. * 6 i</td><td>to</td><td>any less</td><td>fence</td><td>in</td><td> 96</td>

<td>%, to</td><td colspan="2">any less</td><td colspan="2">fence</td><td>from 97</td><td>%, to</td><td colspan="2">any less</td><td colspan="2">fence</td><td>of 98</td><td>%, to</td><td colspan="2">any less</td>

<td>fence</td><td>in</td><td> 99</td><td>The. r</td><td colspan="2">or more</td><td>from, i</td><td colspan="2">let's say</td><td>r</td><td> 100</td><td colspan="2">% homologous</td><td>The</td><td>an</td>

amino acid sequence selected from the group

<td>consisting of</td><td>SEQ ID</td><td>NOs: 166-</td><td> 221,</td><td> 229-307, 311-330, 351-</td>

<td> 353, 355-361,</td><td> 363-364,</td><td> 366-368,</td><td> 218,</td><td> 222-228, 308-310, 350,</td>

<td> 354, 362, 365,</td><td> 523-649,</td><td> 786-920,</td><td> 1047</td><td>and 1048.</td>

<td></td><td></td><td>In</td><td colspan="2">according to some</td>

embodiments of the invention, an exogenous polypeptide selected from the group consisting of SEQ ID NOs: 166-221, 229-307, 311-330, 351-353, 355-361, 363-364, 366-368, 218, is provided 222-228, 308-310, 350, 354, 362, 365, 523-649,

786-920, 1047 and 1048.

The invention also encompasses fragments of the polypeptides described above and polypeptides that have mutations, such as deletions, insertions or

25/119 substitutions of one or more amino acids, whether they occur naturally or are induced by man, either randomly or in a directed manner.

The term 'plant, as used here, encompasses whole plants, ancestors and the progeny of plants or plant parts, including seeds, buds, stem, roots (including tubers) and plant cells, tissues and organs. The plant can be in any form, including suspension cultures, embryos, meristematic regions, callous tissue, leaves, gametophytes, sporophytes, pollen and micro-spores. Plants which are particularly useful in the methods of the invention include all those belonging to the Viridiplantae superfamily, in particular monocot and dicot plants, including fodder or forage vegetables, ornamental plants, food crops, trees or shrubs selected from the list comprising Acacia spp. , Acer spp., Actinidia spp., Aesculus spp., Spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga, Bétula spp. Brass ., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp,

Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chacoomeles spp., Cinnamomum cassia, Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneaster serotina, Crataegus spp., Cucumis spp.,

Cupressus spp.,

Cyathea dealbata,

Cydonia oblonga,

26/119

Cryptomeria japonica, Cymbopogon spp., Cynthea dealbata, Cydonia oblonga, Dalbergia monetária, Davallia divaricata, Desmodium spp., Dicksonia squarosa, Dibeteropogon amplectens, Dioclea spp, Dolichos spp. spp., Erythrina spp., Eucalyptus spp., Euclea schimperi, Eulalia vi / losa, Pagopyrum spp., Feijoa sellowlana, Fragaria spp., Flemingia spp, Freycinetia banksli, Geranium thunbergii, Ginkgo biloba, Glycine javanica, Gliricidia spp, Gossypium hirsutum, Grevillea spp., Guibourtia coleosperma, Hedysarum spp., Hight hemaffhia, Heteropogon contoffus, Hordeum vulgare, Hyparrhenia rufa, Hypericum erectum, Leptifolia, Hypeffhelia dissol, ., Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lotonus bainesli, Lotus spp., Macrotyloma axillare, Malus spp., Manihot esculenta, Medicago saliva, Metasequoia glyptostroboides, Musa sapientum, Nicotianum spp., Onobrychis spp., Ornithopus spp., Oryza spp., Peltophorum africanum, Pennisetum spp., Persea gratíssima, Petunia spp., Phaseolus spp., Phoenix canariensis, Phormium cookianum, Photinia spp., Picea glauca, Pinusp. Pisum sativam, Podocarpus totara, Pogonarthria fleckii, Pogonaffhria squarrosa, Populus spp., Prosopis cineraria, Pseudotsuga menziesii, Pterolobium stellatum, Pyrus communis, Quercus spp. Ribes grossularia, Ribes spp., Robinia pseudoacacia, Rosa spp., Rubus spp.,

27/119

Salix spp., Schyzachyrium sanguineum, Sciadopitys vefficillata, Sequoia sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia spp., Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Tadehagi spp, Spined distichum, Trodium distichum. heterophylla, Vaccinium spp., Vicia spp., Vitis vinifera, Watsonia pyramidata, Zantedeschia aethiopica, Zea mays, amarante, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, kale, flax, kale, lentil, rapeseed oil, okra, onion, potato, rice, soy, straw, sugar beet, sugar cane, sunflower, tomato, pumpkin, corn, wheat, barley, rye, oats, peanuts, peas, lentils and alfalfa, cotton, rapeseed, pepper, sunflower, tobacco, eggplant, eucalyptus, a tree, an ornamental plant, perennial grass, and forage. Alternative and non-Viridiplantae algae can be used for methods of the present invention.

According to some configurations of the invention, the oil-producing plant may be an oilseed crop, soybean, sunflower, Brassica napus, Brassica Juncea, zea maize, cotton, olive, (olea europaea), flax, Brassica nigra, Jatropha curcas, and castor bean (Ricinus communis).

exogenous of the invention

Introducing o into the plant can polynucleotide be effected by transforming one or more cells of the plant with the

28/119 exogenous polynucleotide, followed by the creation of mature plants from the transformed cells and cultivation of the mature plant under suitable conditions to remove the exogenous polynucleotide within the mature plant.

According to some embodiments of the invention, transformation is effected by introducing a nucleic acid construct into the plant cell that includes the exogenous polynucleotide of some configurations of the invention and at least one promoter capable of directing the transcription of the exogenous polynucleotide in the plant cell. More details of the appropriate transformation approaches are provided below.

As used here, the term promoter refers to a region of DNA that lies upstream of the transcriptional initiation site of a gene that RNA polymerase binds to initiate RNA transcription. The promoter controls where (for example, what portion of a plant) and / or when (for example, at what stage or condition in the life of an organism) the gene is removed.

<td></td><td colspan="2">Any</td><td>sequence of</td><td>district Attorney</td>

<td colspan="2">appropriate can be used</td><td>through the</td><td>construction</td><td>of acid</td>

<td>nucleic of</td><td>present invention.</td><td>In</td><td>a deal with</td><td>some</td>

<td>settings</td><td>of the invention, the</td><td colspan="2">prosecutor is a</td><td>district Attorney</td>

<td>constitutive,</td><td colspan="2">a tissue-specific</td><td colspan="2">or a promoter of</td>

developmental or embryonic-specific.

Suitable constitutive promoters include, for example, CaMV 35s promoter (SEQ ID NO: 921; Odell et al., Nature 313: 810-812, 1985); district Attorney

29/119

Arabidopsis At6669 (SEQ ID NO: 1015; see PCT Publication No. W02004 / 104162; Ubi 1 corn (Christensen et al., Plant Sol.

Biol. 18: 675-689, 1992); rice actin (McElroy et al.,

Plant Cell 2: 163-171, 1990); pEMU (Last et al., Theor. Appl.

Genet. 81: 581-588, 1991); CaMV 19S (Nilsson et al., Physiol.

Plant 100: 456-462, 1997); GOs2 (by Pater et al, Plant J Nov;

2 (6): 837-44, 1992); Rice cyclophylline (Bucholz et al,

Plant Mol Biol. 5 25 (5): 837-43, 1994); Corn histone H3 (Lepetit et al, Mol. Gen. Genet. 231: 276-285, 1992); Actin (An et al, Plant J. 10 (1); 107-121, 1996) and Super MAS Synthetic (Ni et al., The Plant Journal 7: 661-76, 1995). Other constitutive promoters include those in U.S. Pat. US Pat. We. 5,659,026, 5,608, 149; 5,608, 144; 5, 604,121;

5,569, 597: 5,466,785; 5, 399,680; 5, 268,463; and 5,608,142.

Suitable tissue-specific promoters include, but are not limited to, preferred seed promoters [for example, specific gene seeds (Simon, et al., Plant Mol.Biol.5.191, 1985;

Scofield, et al. , J. Biol. Chem. 262: 262: 12202, 1987;

Baszczynski, et al., Plant Mol.Biol.14: 633, 1990), Castanha do Pará albumin (Pearson 'et al., Plant Mol. Biol. 18: 235-245, 1992), legumin (Ellis, et al Plant Mol. Biol.

10: 203-214, 1988), Glutelin (rice) (Takaiwa, et al.,

Genet. Gen. Mol. 208: 15-22, 1986; Takaiwa, et al. , FEBS of

Latvia. 221: 43-47, 1987), Zein (Matzke et AL Plant Mol

Biol, 143: 323-32 1990), napA (Stalberg, et al, Plant 199:

515-519, 1996), Wheat SPA (Albanietal, Plant Cell, 9: 171184, 1997), sunflower oleosin (Cummins, et al., Plant

30/119

Mol. Biol. 19: 873-76 (1992)], specific leaf promoters [as described, for example, by Yamamoto et al, Plant J. 12: 255-265, 1997; Kwon et al., Plant Physiol.

105: 357-67, 1994; Yamamoto et al. , Plant Cell Physiol.

35: 773-778 1994; Gotor et al. Plant J. 3: 509-18, 1993; Orozco et

AL. Plant Mol. Biol. 23: 1129-1138, 1993; and Matsuoka et al, Proc. Acad. Nat. Cien. USA 90: 9586-9590, 1993], endosperm-specific promoters (Mol Gen Genet 216: 81-90, 1989; NAR 17: 461-2), wheat a, b and g gliadins (EMB03: ​​1409-15, 1984) , barley promoter ltrl promoter, barley barley hordein Bl, C, D

<td colspan="2">(Theor Appl Gen 98:</td><td rowspan="2">1253-62, 1999; Plant J 750-60, 1996), Barley</td><td rowspan="2">4: DOF</td><td rowspan="2">343-55, 1993; (Mena et al,</td>

<td>Mol</td><td>Gen Genet 250:</td>

<td>The</td><td>Plant Journal,</td><td> 116(1): 53-62, 1998),</td><td>Biz2</td><td>(EP99106056.</td>

<td> 7) ,</td><td colspan="2">Synthetic promoter (Vicente-Carbajosa</td><td>et</td><td>al. Plant J.</td>

<td> 13 :</td><td> 629-640, 1998),</td><td colspan="2">NRP33 rice prolamine,</td><td>globulin of</td>

rice Glb-1 (Wu et al, Plant Cell Physiology 39 (8) 885-889, 1998), rice alpha-globulin REB / OHP-1 (Nakase et al. Plant Mol. Biol. 33: 513-S22, 1997 ), Rice rice ADP-glucose PP (Trans Res 6: 157-68, 1997), ESR maize gene family (Plant J 12: 235-46, 1997), gamma-kafirin sorghum (PMB 32.:102935, 1996 )], embryo-specific promoters [eg, OSH1 rice (Sato et al, Proc. Nati. Acad. Sci. USA, 93: 8117-8122), KNOX (Postma-Haarsma et al, Plant Mol. Biol. 39: 257-71, 1999), rice oleosin (Wu et at, J. Biochem.,

123: 386, 1998)], and flower-specific promoters [e.g., AtPRP4, chalene synthase chsA) (Van der Meer, et al., Plant Mol. Biol. 15, 95-109, 1990), LAT52 (Twell et al Mol. Gen Genet. 217: 240-5 245; 1989), apetala-3].

31/119

The nucleic acid construct of some embodiments of the invention can later include an appropriate selective marker and / or an origin of replication. According to some configurations of the invention, the nucleic acid construct used is a bridge vector, which can propagate both in E. coli (where the construct comprises an appropriate selective marker and origin of replication) and be compatible with cell propagation. . The construction according to the present invention can be, for example, a plasmid, a bacmid, a phagemid, cosmid, phage, a virus or an artificial chromosome.

The nucleic acid construct of some configurations of the invention can be used to transform plant cells stably or transiently. In stable transformation, exogenous polynucleotide is integrated into the plant genome, and, as such, represents a stable and hereditary characteristic. In transient transformation, the exogenous polynucleotide is removed by the transformed cell, but it is not

<td>integrated</td><td>to</td><td>genome, and as</td><td>such, represents</td><td>an</td>

<td colspan="2">feature</td><td>transitory.</td><td></td><td></td>

<td></td><td></td><td>exist</td><td>various methods</td><td>in</td>

<td>introduction</td><td>in</td><td>exogenous genes in</td><td>plants of both</td><td>at</td>

<td colspan="2">monocots</td><td colspan="2">and dicots. Rev. Plant. Physiol., Plant.</td><td>Mol.</td>

Biol. (1991) 42: 205-225; Shimamoto et al., Nature (1989) 338: 274-276).

The principle methods of causing stable integration of exogenous DNA into plant genomic DNA include two main approaches:

32/119 (i) Agrobacterium-mediated gene transfer: Klee et al. (1987) Annu. Rev. Plant Physiol. 38: 467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, LK, Academic Publishers, San Diego, Calif. (1989) p. 2-25; Gatenby, in Plant Biotechnology, eds. Kung, S. and Arntzen, CJ, Butterworth Publishers, Boston, Mass. (1989) p. 93-112.

(ii) Direct DNA absorption: Paszkowski et al., in Cell

Culture and Somatic Cell Genetics of Plants, Vol. 6,

Molecular Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, LK, Academic Publishers, San Diego, Calif. (1989) p. 52-68; including methods for direct DNA absorption in protoplasts, Toriyama, K. et al. (1988) Bio / Technology 6: 1072-1074. Absorption of DNA introduced by short electrical shocks from plant cells: Zhang et al. Plant Cell Rep. (1988) 7: 379-384. Fromm et al. Nature (1986)

319: 791-793. Injection of DNA into plant cells or tissues by Bio / Technology bombardment (1988 of particles, Klein et al. 6: 559-563; McCabe et al.

Bio / Technology (1988) 6: 923-926; Sanford, Physiol. Plant.

1990:

79:206-209;

through the use of micropipette systems: Neuhaus et al., Theor. Appl. Genet.

1987

75: 30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79: (1990) 79: 213-217; glass fibers or silicon carbide whisker transformation of cell cultures, embryos or callus tissues, Pat. USA No .: 5,464,765 or by directly incubating DNA with pollen in

33/119 germination, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, GP and Mantell, SH and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad. Know. USA (1986) 83: 715-719.

The Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that it integrates into plant genomic DNA. Plant tissue inoculation methods vary depending on the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure that can be performed with any tissue explant that provides a good source for initiating complete plant differentiation. See, for example, Horsch and others in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicot plants.

There are several methods of direct DNA transfer in plant cells. In electroporation, protoplasts are briefly exposed to a strong electric field. In microinjection, DNA is mechanically injected directly into cells using small micropipettes. In the bombardment of microparticles, DNA is absorbed into microprojectiles like magnesium sulfate crystals or tungsten particles, and microprojectiles are physically accelerated in plant cells or tissues.

34/119

The next stable plant propagation transformation is carried out. The most common method of plant propagation is through seed. Regeneration by seed propagation, however, has the deficiency that due to heterozygosity, there is a lack of uniformity in the harvest, since seeds are produced by plants according to the genetic variations dominated by Mendelian rules. Basically, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferable that the transformed plant is produced in such a way that the regenerated plant has the same traits and characteristics as the transgenic mother plant. Therefore, it is preferable that the transformed plant is regenerated by micropropagation that provides rapid and consistent reproduction of the transformed plants.

Micropropagation is a process of growing new plants that generate a single fragment of tissue that has been taken from a selected parent plant or cultivars. This process allows the mass reproduction of plants with the preferred tissue by removing the fusion protein. The generating plants that are produced are genetically identical to, and have all the characteristics of, the original plant. Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of cultivars selected to preserve characteristics of the original transgenic or transformed plant. The advantages of cloning

35/119 plants are the speed of plant multiplication and the quality and uniformity of plants produced.

Micropropagation is a multi-step procedure that requires alteration of culture media or growth conditions between stages. Thus, the micropropagation process involves four basic stages: Stage one, initial tissue culture; stage two, multiplication of tissue culture; stage three, differentiation and plant formation; and stage four, greenhouse culture and hardening. During stage one, initial tissue culture, the tissue culture is established and certified as free from contaminants. During stage 2, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production targets. During stage three, the tissue samples grown in stage two are divided and grown on seedlings. In stage four, the transformed seedlings are transferred to a greenhouse for acclimation (hardening) where the tolerance of plants to light is gradually increased so that they can be grown in the natural environment.

According to some configurations of the invention, transgenic plants are generated by transient transformation of leaf cells, meristematic cells or the entire plant.

Transitional transformation can be carried out by any of the transfer methods

36/119 of direct DNA described above or by viral infection using modified plant viruses.

Viruses that have been shown to be useful for transforming plant hosts include CaMV, TMV and BV. The transformation of plants using plant viruses is described in Pat. US No .: 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 6314693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al. , Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudo-virus particles for use in removing exogenous DNA in various hosts, including plants, are described in WO 87/06261.

According to some configurations of the invention, the virus used for transient transformations is avirulent and thus is unable to cause severe symptoms such as reduced growth rate, mosaic, annular spots, leaf curl, yellowing, stretch marks, swelling, formation of tumor and perforations. A suitable avirulent virus can be a naturally occurring avirulent virus or an artificially attenuated virus. Virus attenuation can be performed using methods well known in the art, including, but not limited to, sublethal heating, chemical treatment or by direct mutagenesis techniques as described, for example, by Kurihara and Watanabe (Molecular Plant Pathology 4: 259 -269, 2003), Gal-on et al. (1992), Atreya et al. (1992) and Huet et al. (1994).

37/119

Suitable strains of viruses can be obtained from available sources such as the American Type culture Collection (ATCC) or by isolating infected plants. Virus isolation from infected plant tissues can be accomplished by techniques well known in the art as described, for example, by Foster and Tatlor, Eds. Plant Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), Vol 81), Humana Press, 1998. Briefly, tissues from an infected plant that possibly contain a high concentration of a suitable virus, preferably new leaves and flower petals, are sprayed in a buffer solution (for example, phosphate buffer solution) to produce a virus-infected sap that can be used in subsequent inoculations.

The construction of plant RNA viruses for the introduction and removal of non-viral exogenous polynucleotide sequences in plants is demonstrated in the references above, as well as by Dawson, WO et al., Virology (1989) 172: 285-292; Takamatsu et al. EMBO J. (1987) 6: 307-311; French et al. Science (1986) 231: 1294-1297; and

Takamatsu et al. FEBS Letters (1990) 269: 73-76.

When the virus is a DNA virus, appropriate modifications can be made to the virus itself. On the other hand, the virus can first be cloned into a bacterial plasmid to facilitate the construction of the desired viral vector with exogenous DNA. The virus can be removed

38/119 of the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be linked to viral DNA, which is then replicated by the bacteria. The transcription and translation of this DNA will produce the capsid protein that will encapsulate the viral DNA. If the virus is an RNA virus, it is usually cloned as a cDNA and inserted into the plasmid. The plasmid is then used to make all constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and the translation of the viral genes to produce the capsid protein (s) that encapsulate the viral RNA.

The construction of plant RNA viruses for the introduction of exogenous polynucleotide sequences such as those included in the construction of the present invention is demonstrated in the references above as well as in Pat. of the USA No .: 5,316,931.

In one embodiment, a plant viral polynucleotide is provided in which the coding sequence of the native capsid protein has been deleted from a viral polynucleotide, a codid sequence of capsid protein from a non-native viral plant and a non-native promoter, preferably the subgenomic promoter the coding sequence of the non-native capsid protein, capable of expression in the plant host, packaging of the recombinant viral polynucleotide of the plant, and guarantee of a systemic infection of the host by the viral recombinant polynucleotide of the plant, was inserted. On the other hand, the capsid protein gene can

39/119 be inactivated by inserting the sequence of non-native polynucleotides into the interior, so that the protein is produced. The plant's viral polynucleotide may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is able to transcribe or remove adjacent genes or polynucleotide sequences in the plant host and unable to recombine between them and with native subgenomic promoters. Non-native (exogenous) polynucleotide sequences can be inserted adjacent to the plant's native viral subgenomic promoter or to the plant's native and non-native viral subgenomic promoters if more than one polynucleotide sequence is included. The sequences of non-native polynucleotides are transcribed and expressed in the host plant under the control of the subgenomic promoter to produce the desired products.

In a second configuration, a recombinant viral polynucleotide from the plant is provided as in the first configuration, except that the native coding sequence for the capsid protein is located adjacent to one of the non-native subgenomic promoters of the capsid protein rather than a non-native coding sequence of capsid protein.

In a third configuration, a recombinant viral polynucleotide from the plant is provided in which the native gene of the capsid protein is adjacent to the subgenomic promoters and one or more non-native subgenomic promoters have been inserted into the viral polynucleotide. The inserted non-native subgenomic promoters are capable of

40/119 transcribe or remove adjacent genes in a plant host and unable to recombine between them and with native subgenomic promoters. Non-native polynucleotide sequences can be inserted adjacent to non-native subgenomic promoters so that the sequences are transcribed and expressed in the host plant under the control of the subgenomic promoters to produce the desired product.

In a fourth configuration, a recombinant viral polynucleotide from the plant is provided as in the third configuration, except that the native coding sequence for the capsid protein is replaced by a non-native coding sequence for the capsid protein.

Viral vectors are encapsulated by the capsid protein encoded by the plant's recombinant viral polynucleotide to produce a recombinant plant virus. The recombinant plant viral polynucleotide or recombinant plant virus is used to infect appropriate host plants. The plant's recombinant viral polynucleotide is capable of replication in the host, systemic dispersion in the host, and transcription or expression of exogenous gene (s) (exogenous polynucleotides) in the host to produce the desired protein.

Techniques for inoculating plant viruses can be found in Foster and Taylor, Eds. Plant Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Human

41/119

Pr), Vol 81), Humana Press, 1998; Maramorosh and Koprowski, eds. Methods in Virology 7 vols, Academic Press, New York 1967-1984; Hill, SA Methods in Plant Virology, Blackwell, Oxford, 1984; Walkey, DGA Applied Plant Virology, Wiley, New York, 1985; and Kado and Agrawa, eds. Principies and Techniques in Plant Virology, Van NostrandReinhold, New York.

In addition to the above, the polynucleotide of the present invention can also be introduced into a chloroplast genome, thus allowing expression of the chloroplast.

A technique for introducing exogenous polynucleotide sequences to the chloroplast genome is known. This technique involves the following procedures. First, plant cells are chemically treated in a way that reduces the number of chloroplasts per cell to approximately one. Then, the exogenous polynucleotide is introduced via particle bombardment into the cells in order to introduce at least one exogenous polynucleotide molecule into the chloroplasts. The selected exogenous polynucleotides are such that they can be integrated into the chloroplast genomes via homologous recombination that is carried out immediately by enzymes inherent to the chloroplast. To this end, the exogenous polynucleotide includes in addition to a gene of interest, at least one stretch of polynucleotide that is derived from the chloroplast genome. In addition, exogenous polynucleotide includes a selectable marker, which serves by selection procedures

42/119 sequence to certify that all or substantially all of the copies of the chloroplast genomes following such a selection will include the exogenous polynucleotide. More details related to these techniques are found in .Pat. From

USA Nos. 4,945,050; and 5,693,507 which are incorporated by reference. A polypeptide can thus be produced by the chloroplast protein expression system and become integrated into the chloroplast inner membrane.

Since the increase in oil content, production, biomass, growth rate and / or vigor in plants may involve multiple genes acting in addition or in synergy (see, for example, in Quesda et al., Plant Physiol. 130: 951- 063, 2002), the invention also contemplates expressing a plurality of exogenous polynucleotides in a single host plant to achieve a higher increase in oil content, production, biomass, growth rate and / or vigor in plants.

Expressing a plurality of exogenous polynucleotides in a single host plant can be accomplished by co-introducing nucleic acid construction, each including an exogenous polynucleotide, into a single plant cell. The transformed cell can then be regenerated into a mature plant using the methods described above.

On the other hand, the expression of a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing a nucleic acid construct into a single plant cell

43/119 including a plurality of different exogenous polynucleotides. Such a construct can be determined with a unique promoter sequence that can transcribe a polycistronic messenger RNA including all different sequences of exogenous polynucleotides. To enable the co-translation of different polypeptides encoded by the polycistronic messenger RNA, the polynucleotide sequences can be linked through an internal ribosome entry site (IRES) sequence that facilitates the translation of polynucleotide sequences positioned below the IRES sequence. In this case, a transcribed polycistronic RNA molecule encoding the different polypeptides described above will be translated both from the leveled end 5 and from the two internal IRES sequences of the polycistronic RNA molecule to thus produce all the different polypeptides in the cell. On the other hand, the construct can include several sequences of promoters, each linked to a different exogenous polynucleotide sequence.

The plant cell transformed with the construct, including a plurality of different exogenous polynucleotides, can be regenerated in a mature plant using the methods described above.

On the other hand, the expression a plurality of exogenous polynucleotides in a single host plant can be effected by introducing different nucleic acid constructs, including different exogenous polynucleotides in a plurality of plants. The transformed regenerated plants can then

44/119 are crossed and the resulting offspring selected for superior oil content, growth rate, biomass, harvest and / or vigor using conventional plant reproduction techniques.

Thus, the invention includes plants exogenously expressing (as described above) the polynucleotide (s) and / or polypeptide (s) of the invention. Once expressed within the plant cell or the entire plant, the level of polypeptide encoded by the exogenous polynucleotide can be determined by methods well known in the art such as activity assay, Western blot using antibodies capable of specifically binding the polypeptide, Immunosorbent Linked Assay Enzyme (ELISA), radioimmune assays (RIA), immunohistochemistry, immunofluorescence and the like.

Methods of determining the level of exogenous polynucleotide transcribed RNA in the plant are well known in the art and include, for example, Northern blot analysis, polymerase reverse transcription chain reaction (RT-PCR) assays (including quantitative, semi-quantitative or Real-time RT-PCR) and in situ hybridization of RNA.

The polynucleotides and polypeptides described above can be used in a wide range of economic plants, in a safe and cost effective way.

The effect of the transgene (the exogenous polynucleotide encoding the polypeptide) on

45/119 of oil, plant production, seed production, biomass, growth rate and / or vigor can be determined using known methods.

The oil content of a plant can be determined by extracting the oil from the seed or the vegetative portion of the plant. Briefly, lipids (oil) can be removed from the plant (for example, seed) by penetrating plant tissue in the presence of specific solvents (for example, hexane or petroleum ether) and extracting the oil in a continuous extractor. Indirect oil content analysis can be performed using several known methods, such as Nuclear Magnetic Resonance Spectroscopy (NMR), which measures the resonance energy absorbed by hydrogen atoms in the liquid state of the sample [See, for example, Conway TF. and Earle FR., 1963, Journal of the American Oil Chemists' Society; Springer Berlin / Heidelberg, ISSN: 0003-021X (Print) 1558-9331 (Online)]; the Near Infrared Spectroscopy (IVP), which uses energy absorption close to the infrared (1100-2500 nm) by the sample; and a method described in WO / 2001/023884, which is based on extracting oil from a solvent, evaporating the solvent in a gas stream that forms oil particles, and directing light into the gas stream and particles of oil that forms a detectable reflected light. Other methods of determining oil content are described in Example 7 of the Examples section that follows.

The vigor of the plant can be calculated by increasing growth parameters, such as

46/119 such as leaf area, rosette diameter, recent plant weight and the like by time.

The growth rate can be measured using a digital plant growth analysis. For example, images of plants growing in greenhouses on a batch basis can be captured every 3 days and the area of ​​the rosette can be calculated by digital analysis. The growth of the rosette area is calculated using the difference in rosette area between days of experiments divided by the difference in days between samples.

Seed production measurements can be made by collecting total seeds from 8-16 plants together, weighing them using an analytical balance and dividing the total weight by the number of plants. The seed per growing area can be calculated in the same way while taking into account the growth area given to a single plant. High seed production per growth area can be achieved by increasing the seed yield per plant, and / or increasing the number of plants capable of growing in certain areas.

The evaluation of the production of

<td colspan="4">seed per plant can be made by measuring the amount (weight or</td>

<td>size) or quantity (i</td><td>. and . ,</td><td>number) or</td><td>dry seeds</td>

<td>produced and harvested</td><td> 8-16</td><td>plants and</td><td>divided by</td>

<td>number of plants.</td><td></td><td></td><td></td>

<td></td><td>THE</td><td>evaluation</td><td>of the rate</td>

growth can be done by measuring the biomass of the plant produced, rosette area, leaf size or length

47/119 of the root per time (can be measured in cm² per day of leaf area).

Thus, the present invention is of high agricultural value to promote the production of desired commercialized crops (for example, seeds).

Any transgenic plants described above or parts of these can be processed to produce a food, meal, protein or oil preparation, such as ruminant animals.

The transgenic plants described here, which exhibit a high oil content can be used to produce vegetable oil (by extracting the oil from the plant).

Vegetable oil (including seed oil and / or vegetable oil) produced according to the method of the invention can be combined with a variety of other ingredients. The specific ingredients included in a product are determined according to the purpose of use. Exemplary products include animal feed, raw material for chemical modification, biodegradable plastic, mixed food, edible oil, biogas, cooking oil, lubricant, biodiesel, snack, cosmetics, and raw material for the fermentation process. Exemplary products to be incorporated into vegetable oils include animal feed, human foods such as extruded snacks, breads, as a food binding agent, sports drinks, nutritional bars, multi-vitamin supplements, diet drinks, and cereals.

48/119

As used herein, the term approximately refers to? 10%.

The terms covers, encompassing, includes, including, owning and their conjugates mean including, but not limited to.

The term consisting of includes and is limited to. The term essentially consisting of means that the composition, methods or structure may include additional ingredients, steps and / or parts, but only if the additional ingredients, steps and / or parts do not materially alter the basic and new characteristics of the claimed composition, method or structure.

As used here, a were simple one, one and one include references in the plural unless the context clearly speaks otherwise. For example, the term a compound or at least one compound can include a plurality of compounds, including mixtures thereof.

Through this application, various configurations of this invention can be presented in a varied format. It can be understood that the description in the in varied format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Therefore, the description of a variation should be considered specifically disclosed for all possible sub-variations as well as individual numerical values ​​within the variation. For example, the description of

49/119 a variation from 1 to 6 should be considered specifically disclosed sub-variations from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc .; as well as individual numbers within that range, for example, 1,2,3,5 and 6. This applies regardless of the range of variation.

When a numerical variation is indicated here, it means including any quoted numeral (fractional and integral) within the indicated variation. The phrases varying / varying between the first indicated number and a second indicated number and varying / variation from a first indicated number to a second indicated number are used interchangeably and are intended to include the first and second indicated numbers and all fractional numbers and integral among them.

As used herein, the term method refers to the manner, means, techniques and procedures for performing a given task including, but not limited to, those ways, means, techniques and procedures known or readily developed in known ways, means, techniques and procedures by practitioners of chemical, pharmacological, biological, biochemical and medical techniques.

Certain features of the invention are recognized, which are, for clarity, described in the context of separate configurations, can also be provided in combination in a single configuration. Conversely, several features of the invention, which are, for brevity, described in

50/119 in the context of a single configuration, can also be provided separately or in any appropriate sub-combination or as appropriate in any other described configuration of the invention. Certain features described in the context of various configurations are not considered essential features of those configurations, unless the configurations are inoperative without those elements.

Various configurations and aspects of the present invention as outlined above and as claimed in the claim section below find experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some configurations of the invention in an unlimited custom.

Generally, the nomenclature used here and the laboratory procedures used in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are fully explained in the literature. See, for example, Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current Protocols in Molecular Biology Volumes IIII Ausubel, RM, ed. (1994); Ausubel et al. , Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley &amp; Sons, New York (1988); Watson et al., Recombinant DNA, Scientific American Books,

51/119

3,791,932;

3,867,517;

New York; Birren et al. (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in US Pat. We. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and

5,272,057; Cell Biology: A Laboratory Handbook, Volumes IIII Cellis, JE, ed. (1994); Current Protocols in Immunology Volumes I-III Coligan JE, ed. (1994); Stites et al. (eds), Basic and Clinical Immunology (8th Edition), Appleton &amp; Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), Selected Methods in Cellular Immunology, WH Freeman and Co., New York (1980); available immunoassays are considerably described in the patent and scientific literature, see, for example, in Pat. Americana Nos. 3,850,752;

3,901,654;

3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and

5,281,521; Oligonucleotide Synthesis Gait, MJ, ed. (1984); Nucleic Acid Hybridization Hames, BD, and Higgins SJ, eds. (1985); Transcription and Translation Hames, BD, and Higgins SJ, Eds. (1984); Animal Cell Culture Freshney, RI, ed. (1986); Immobilized Cells and Enzymes IRL Press, (1986); A Practical Guide to Molecular Cloning Perbal, B., (1984) and Methods in Enzymology Vol.

1-317, Academic Press; PCR Protocols: A Guide To Methods And Applications, Academic Press, San Diego, CA (1990); Marshak et al. , Strategies for Protein Purification and Characterization - A Laboratory Course Manual CSHL Press (1996); all of which are incorporated by reference

3,850,578; 3,853,987;

3,935,074; 3,984,533;

3,839,153;

3,879,262;

52/119 as if completely demonstrated here. Other general references are provided in full in this document. The procedures here are believed to be well known in the art and are provided for the convenience of the reader. All information contained here is incorporated by reference.

EXAMPLE 1

GENE IDENTIFICATION AND FORECASTING THE GENE FUNCTION USING BIOINFORMATICS TOOLS

Qen encoding polypeptides, suitable for increasing seed oil and seed quantity were identified by in-depth analysis of RNA expression profiles, sequence similarities, qen annotations, biochemical pathways, DNA, ESTs, protein and expression of database deposited on the internet.

Bioinformatics Tools

Identification of qene in silicon - To identify new qenes that could significantly affect the amount of seed oil, Arabidopsis qenes, already found to play a key role in embryogenesis, seed development and oil synthesis and accumulation have been identified in the literature ('genes of the oil hook - GGOs). The number of the GGos is in accordance with the TAIR website [http://www.arabidopsis.org/] and includes all information about the GGOs. GGOs include wild type alleles of Ssi2 (AT2G43710), OlesinA (AT3G01570), Lecl (AT1G21970), Lec2 (atlg28300), Fus3 (AT3G26790), FAD3

53/119 (AT2G29980), ΑΒΙ3 (AT3G24650) and Wril (AT3G54320). The comparison of the gene expression profile at 79 different developmental stages of Arabidopsis was done on the GGOs genes and all other genes printed in Nottingham

Arabidopsis Stock Center

Nottingham] [(NASC), http://affymetrix.arabidopsis.info/)] micro essays describing autonomy, development and various stress experiments. The correlation was determined using Pearson's statistical correlation analysis [Http://davidmlane.com/hiperstat/A34739.html].

The criteria used for each of the genes are described in detail in Table 1 below and covers a variety of biological rationales that use various bioinformatics approaches. The genes were selected to cause changes in seed size and / or amount of seed oil based on their highest expression correlation (given as Pearson R values ​​between 0.7 &lt;R &lt;1) for one or more of the GGOs. The list of identified genes and their correlation (R value) for each of the GGos are provided in Table 1, below.

Table 1

<td>At the Serie and</td><td>Nucl SE QID At the:</td><td>Prot, SEQ ID At the:</td><td>BDL At the</td><td>TAIR-name gene</td><td>R wril</td><td>R abi3</td><td>R fus3</td><td>R oleosin The</td><td>R ssi2</td><td>R fad3</td><td>Rlecl</td><td>R Iec2</td>

<td> 1</td><td> 1</td><td> 166</td><td> 3</td><td>AT5G5077 0</td><td></td><td> 0,891</td><td> 0,986</td><td> 0,897</td><td> 0,791</td><td> 0,882</td><td></td><td></td>

<td> 2</td><td> 2</td><td> 167</td><td> 1</td><td>AT1G6509 0</td><td></td><td> 0,995</td><td> 0,921</td><td> 0,997</td><td> 0,715</td><td> 0,902</td><td></td><td></td>

<td> 3</td><td> 3</td><td> 168</td><td> 2</td><td>AT1G3458 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,955</td><td> 0,915</td>

<td> 4</td><td> 4</td><td> 169</td><td> 4</td><td>AT2G4542 0</td><td> 0,933</td><td></td><td> 0,893</td><td> 0,713</td><td> 0,74</td><td> 0,716</td><td> 0,759</td><td> 0,76</td>

<td> 5</td><td> 5</td><td> 170</td><td> 5</td><td>AT3G1436 0</td><td></td><td> 0,969</td><td> 0,96</td><td> 0,97</td><td> 0,731</td><td> 0,914</td><td></td><td></td>

<td> 6</td><td> 6</td><td> 171</td><td> 6</td><td>AT4G1049 0</td><td> 0,912</td><td></td><td> 0,88</td><td> 0,725</td><td> 0,76</td><td> 0,71</td><td> 0,757</td><td> 0,755</td>

54/119

<td>At the Seri and</td><td>Nucl SE QID At the:</td><td>Prot, SEQ ID At the:</td><td>BDL At the</td><td>TAIR-name gene</td><td>R wri1</td><td>R abi3</td><td>R fus3</td><td>R oleosin The</td><td>R ssi2</td><td>R fad3</td><td>Rlecl</td><td>R Iec2</td>

<td colspan="13">continuation of table 1</td>

<td> 7</td><td> 7</td><td> 172</td><td> 7</td><td>AT5G5149 0</td><td> 0,901</td><td> 0,722</td><td> 0,92</td><td> 0,745</td><td> 0,79</td><td> 0,797</td><td></td><td></td>

<td> 8</td><td> 8</td><td> 173</td><td> 8</td><td>AT3G0324 0</td><td></td><td> 0,947</td><td> 0,982</td><td> 0,956</td><td> 0,775</td><td> 0,912</td><td></td><td></td>

<td> 9</td><td> 9</td><td> 174</td><td> 9</td><td>AT5G2413 0</td><td></td><td> 0,988</td><td> 0,917</td><td> 0,987</td><td></td><td> 0,91</td><td></td><td></td>

<td> 10</td><td> 10</td><td> 175</td><td> 10</td><td>AT5G0964 0</td><td> 0,719</td><td> 0,905</td><td> 0,98</td><td> 0,91</td><td> 0,8</td><td> 0,908</td><td></td><td></td>

<td> 11</td><td> 11</td><td> 176</td><td> 11</td><td>AT5G1246 0</td><td> 0,815</td><td></td><td></td><td></td><td></td><td></td><td> 0,969</td><td> 0,911</td>

<td> 12</td><td> 12</td><td> 177</td><td> 12</td><td>AT4G0853 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,931</td><td> 0,919</td>

<td> 13</td><td> 13</td><td> 178</td><td> 14</td><td>AT1G5369 0</td><td> 0,931</td><td></td><td> 0,792</td><td></td><td> 0,74</td><td></td><td></td><td></td>

<td> 14</td><td> 14</td><td> 179</td><td> 15</td><td>AT1G6851 0</td><td> 0,905</td><td></td><td></td><td></td><td></td><td></td><td> 0,938</td><td> 0,913</td>

<td> 15</td><td> 15</td><td> 180</td><td> 16</td><td>AT5G0380 0</td><td> 0,8</td><td> 0,878</td><td> 0,966</td><td> 0,894</td><td> 0,797</td><td> 0,882</td><td></td><td></td>

<td> 16</td><td> 16</td><td> 181</td><td> 17</td><td>AT5G3677 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,922</td><td> 0,921</td>

<td> 17</td><td> 17</td><td> 182</td><td> 18</td><td>AT5G4042 0</td><td></td><td> 0,997</td><td> 0,894</td><td> 0,9996</td><td></td><td> 0,886</td><td></td><td></td>

<td> 18</td><td> 18</td><td> 183</td><td> 19</td><td>AT2G0208 0</td><td></td><td> 0,702</td><td> 0,741</td><td> 0,72</td><td> 0,748</td><td></td><td></td><td></td>

<td> 19</td><td> 19</td><td> 184</td><td>20th</td><td>AT1G4754 0.1</td><td></td><td> 0,993</td><td> 0,915</td><td> 0,995</td><td> 0,71</td><td> 0,892</td><td></td><td></td>

<td> 20</td><td> 20</td><td> 185</td><td>20b</td><td>AT1G4754 0.2</td><td></td><td> 0,993</td><td> 0,915</td><td> 0,995</td><td> 0,71</td><td> 0,892</td><td></td><td></td>

<td> 21</td><td> 21</td><td> 186</td><td> 21</td><td>AT3G6273 0</td><td></td><td> 0,995</td><td> 0,92</td><td> 0,993</td><td> 0,711</td><td> 0,903</td><td></td><td></td>

<td> 22</td><td> 22</td><td> 187</td><td> 22</td><td>AT2G2738 0</td><td></td><td> 0,995</td><td> 0,873</td><td> 0,997</td><td></td><td> 0,875</td><td></td><td></td>

<td> 23</td><td> 23</td><td> 188</td><td> 23</td><td>AT3G2778 5</td><td> 0,939</td><td></td><td></td><td></td><td></td><td></td><td> 0,867</td><td> 0,81</td>

<td> 24</td><td> 24</td><td> 189</td><td> 2991</td><td>AT5G1500 0</td><td></td><td> 0,955</td><td> 0,959</td><td> 0,957</td><td> 0,739</td><td> 0,902</td><td></td><td></td>

<td> 25</td><td> 25</td><td> 190</td><td> 25</td><td>AT3G2091 0</td><td></td><td> 0,963</td><td> 0,943</td><td> 0,962</td><td></td><td> 0,883</td><td></td><td></td>

<td> 26</td><td> 26</td><td> 191</td><td>26a</td><td>AT1G1117 0.1</td><td></td><td> 0,926</td><td> 0,981</td><td> 0,929</td><td> 0,765</td><td> 0,894</td><td></td><td></td>

<td> 27</td><td> 27</td><td> 192</td><td>26b</td><td>AT1G1117 0.2</td><td></td><td> 0,926</td><td> 0,981</td><td> 0,929</td><td> 0,765</td><td> 0,894</td><td></td><td></td>

<td> 28</td><td> 28</td><td> 193</td><td> 27</td><td>AT1G6838 0</td><td></td><td> 0,97</td><td> 0,965</td><td> 0,977</td><td> 0,77</td><td> 0,92</td><td></td><td></td>

<td> 29</td><td> 29</td><td> 194</td><td> 28</td><td>AT1G0938 0</td><td> 0,705</td><td> 0,899</td><td> 0,95</td><td> 0,91</td><td> 0,756</td><td> 0,897</td><td></td><td></td>

<td> 30</td><td> 30</td><td> 195</td><td> 29</td><td>AT1G6097 0</td><td> 0,92</td><td> 0,709</td><td> 0,908</td><td> 0,746</td><td> 0,78</td><td> 0,747</td><td> 0,742</td><td> 0,745</td>

<td> 31</td><td> 31</td><td> 196</td><td> 30</td><td>AT1G7258 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,935</td><td> 0,917</td>

<td> 32</td><td> 32</td><td> 197</td><td> 31</td><td>AT2G2849 0</td><td></td><td> 0,998</td><td> 0,871</td><td> 0,995</td><td></td><td> 0,882</td><td></td><td></td>

<td> 33</td><td> 33</td><td> 198</td><td>32a</td><td>AT2G4696 0.1</td><td> 0,89</td><td></td><td></td><td></td><td></td><td></td><td> 0,937</td><td> 0,9</td>

<td> 34</td><td> 34</td><td> 199</td><td>32b</td><td>AT2G4696 0.2</td><td> 0,89</td><td></td><td></td><td></td><td></td><td></td><td> 0,937</td><td> 0,9</td>

<td> 35</td><td> 35</td><td> 200</td><td> 166</td><td>AT1G7169 1</td><td> 0,938</td><td></td><td> 0,71</td><td></td><td></td><td></td><td> 0,723</td><td> 0,713</td>

55/119

<td>At the Be laugh and</td><td>Nucl SE QID At the:</td><td>Prot, SEQ ID At the:</td><td>BDL At the</td><td>TAIR-name gene</td><td>R wril</td><td>R abi3</td><td>R fus3</td><td>R oleosin The</td><td>R ssi2</td><td>R fad3</td><td>Rlecl</td><td>R Iec2</td>

<td colspan="13">continuation of table 1</td>

<td> 36</td><td> 36</td><td> 201</td><td> 330</td><td>AT1G7322 0</td><td></td><td> 0,761</td><td> 0,755</td><td> 0,759</td><td></td><td> 0,768</td><td></td><td></td>

<td> 37</td><td> 37</td><td> 202</td><td> 3004</td><td>AT5G0179 0</td><td> 0,792</td><td></td><td></td><td></td><td></td><td></td><td> 0,899</td><td> 0,85</td>

<td> 38</td><td> 38</td><td> 203</td><td> 333</td><td>AT1G7112 0</td><td> 0,866</td><td></td><td></td><td></td><td></td><td></td><td> 0,925</td><td> 0,856</td>

<td> 39</td><td> 39</td><td> 204</td><td> 334</td><td>AT5G3817 0</td><td> 0,937</td><td></td><td> 0,869</td><td></td><td> 0,744</td><td></td><td> 0,81</td><td> 0,793</td>

<td> 40</td><td> 40</td><td> 205</td><td> 335</td><td>AT3G2516 0</td><td> 0,88</td><td></td><td> 0,874</td><td></td><td> 0,747</td><td> 0,761</td><td></td><td></td>

<td> 41</td><td> 41</td><td> 206</td><td> 336</td><td>AT1G1810 0</td><td> 0,917</td><td></td><td> 0,851</td><td></td><td> 0,751</td><td> 0,711</td><td></td><td></td>

<td> 42</td><td> 42</td><td> 207</td><td> 337</td><td>AT2G2262 0</td><td> 0,906</td><td></td><td></td><td></td><td></td><td></td><td> 0,927</td><td> 0,888</td>

<td> 43</td><td> 43</td><td> 208</td><td> 339</td><td>AT3G2648 0</td><td></td><td> 0,785</td><td> 0,717</td><td> 0,784</td><td></td><td></td><td></td><td></td>

<td> 44</td><td> 44</td><td> 209</td><td> 340</td><td>AT1G6466 0</td><td></td><td> 0,872</td><td> 0,854</td><td> 0,882</td><td></td><td> 0,808</td><td></td><td></td>

<td> 45</td><td> 45</td><td> 210</td><td> 341</td><td>AT5G5233 0</td><td> 0,811</td><td></td><td></td><td></td><td></td><td></td><td> 0,796</td><td> 0,774</td>

<td> 46</td><td> 46</td><td> 211</td><td> 341</td><td>AT5G5233 0</td><td> 0,811</td><td></td><td></td><td></td><td></td><td></td><td> 0,796</td><td> 0,774</td>

<td> 47</td><td> 47</td><td> 212</td><td> 342</td><td>AT1G5267 0</td><td> 0,802</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>

<td> 48</td><td> 48</td><td> 213</td><td> 343</td><td>AT5G6408 0</td><td></td><td> 0,923</td><td> 0,876</td><td> 0,923</td><td></td><td> 0,92</td><td></td><td></td>

<td> 49</td><td> 49</td><td> 214</td><td> 343</td><td>AT5G6408 0</td><td></td><td> 0,923</td><td> 0,876</td><td> 0,923</td><td></td><td> 0,92</td><td></td><td></td>

<td> 50</td><td> 50</td><td> 215</td><td> 344</td><td>AT2G4306 0</td><td> 0,726</td><td></td><td></td><td></td><td></td><td></td><td> 0,857</td><td> 0,794</td>

<td> 51</td><td> 51</td><td> 216</td><td> 345</td><td>AT1G2733 0</td><td></td><td> 0,839</td><td> 0,856</td><td> 0,837</td><td></td><td> 0,814</td><td></td><td></td>

<td> 52</td><td> 52</td><td> 217</td><td> 2999</td><td>AT2G4134 0</td><td> 0,816</td><td></td><td> 0,745</td><td></td><td> 0,744</td><td></td><td></td><td></td>

<td> 53</td><td> 54</td><td> 219</td><td> 2810</td><td>AT2G1329 0</td><td></td><td> 0,878</td><td> 0,76</td><td> 0,876</td><td></td><td> 0,74</td><td></td><td></td>

<td> 54</td><td> 55</td><td> 220</td><td> 349</td><td>AT4G3367 0</td><td></td><td> 0,861</td><td></td><td> 0,855</td><td></td><td> 0,734</td><td></td><td></td>

<td> 55</td><td> 56</td><td> 221</td><td> 350</td><td>AT5G0450 0</td><td></td><td> 0,899</td><td> 0,702</td><td> 0,894</td><td></td><td> 0,756</td><td></td><td></td>

<td> 56</td><td> 64</td><td> 229</td><td> 358</td><td>AT3G0157 0</td><td></td><td> 0,996</td><td> 0,904</td><td> 1</td><td></td><td> 0,891</td><td></td><td></td>

<td> 57</td><td> 65</td><td> 230</td><td> 359</td><td>AT2G1501 0</td><td></td><td> 0,944</td><td> 0,955</td><td> 0,942</td><td> 0,763</td><td> 0,924</td><td></td><td></td>

<td> 58</td><td> 66</td><td> 231</td><td> 362</td><td>AT2G2594 0</td><td> 0,791</td><td> 0,873</td><td> 0,977</td><td> 0,885</td><td> 0,777</td><td> 0,873</td><td></td><td></td>

<td> 59</td><td> 67</td><td> 232</td><td> 364</td><td>AT1G0466 0</td><td> 0,94</td><td></td><td> 0,882</td><td></td><td> 0,763</td><td> 0,715</td><td> 0,777</td><td> 0,768</td>

<td> 60</td><td> 68</td><td> 233</td><td> 365</td><td>AT1G0516 0</td><td> 0,945</td><td></td><td></td><td></td><td></td><td></td><td> 0,857</td><td> 0,814</td>

<td> 61</td><td> 69</td><td> 234</td><td> 2992</td><td>AT1G0528 0</td><td> 0,939</td><td></td><td> 0,805</td><td></td><td></td><td></td><td> 0,859</td><td> 0,84</td>

<td> 62</td><td> 70</td><td> 235</td><td> 2993</td><td>AT1G1990 0</td><td></td><td> 0,975</td><td> 0,909</td><td> 0,962</td><td></td><td> 0,898</td><td></td><td></td>

<td> 63</td><td> 71</td><td> 236</td><td> 368</td><td>AT1G2320 0</td><td> 0,852</td><td></td><td></td><td></td><td></td><td></td><td> 0,957</td><td> 0,906</td>

<td> 64</td><td> 72</td><td> 237</td><td> 369</td><td>AT1G2668 0</td><td> 0,93</td><td></td><td></td><td></td><td></td><td></td><td> 0,738</td><td> 0,717</td>

56/119

<td>At the Serí and</td><td>Nucl SE QID At the:</td><td>Prot, SEQ ID At the:</td><td>BDL At the</td><td>TAIR-name gene</td><td>R wrí1</td><td>R abi3</td><td>R fus3</td><td>R oleosin The</td><td>R ss / 2</td><td>R fad3</td><td>Rlecl</td><td>R Iec2</td>

<td colspan="13">continuation of table 1</td>

<td> 65</td><td> 73</td><td> 238</td><td> 370</td><td>AT1G2859 0</td><td> 0,937</td><td></td><td></td><td></td><td></td><td></td><td> 0,855</td><td> 0,813</td>

<td> 66</td><td> 74</td><td> 239</td><td> 371</td><td>AT1G4891 0</td><td> 0,877</td><td> 0,753</td><td> 0,912</td><td> 0,77</td><td> 0,808</td><td> 0,807</td><td></td><td></td>

<td> 67</td><td> 75</td><td> 240</td><td> 2995</td><td>AT1G5100 0</td><td> 0,906</td><td></td><td></td><td></td><td></td><td></td><td> 0,785</td><td> 0,77</td>

<td> 68</td><td> 76</td><td> 241</td><td> 373</td><td>AT1G6234 0</td><td> 0,712</td><td></td><td></td><td></td><td></td><td></td><td> 0,978</td><td> 0,903</td>

<td> 69</td><td> 77</td><td> 242</td><td> 374</td><td>AT1G6261 0</td><td></td><td> 0,946</td><td> 0,909</td><td> 0,938</td><td></td><td> 0,891</td><td></td><td></td>

<td> 70</td><td> 78</td><td> 243</td><td> 374</td><td>AT1G6261 0</td><td></td><td> 0,946</td><td> 0,909</td><td> 0,938</td><td></td><td> 0,891</td><td></td><td></td>

<td> 71</td><td> 79</td><td> 244</td><td> 374</td><td>AT1G6261 0</td><td></td><td> 0,946</td><td> 0,909</td><td> 0,938</td><td></td><td> 0,891</td><td></td><td></td>

<td> 72</td><td> 80</td><td> 245</td><td> 375</td><td>AT1G7629 0</td><td> 0,735</td><td> 0,91</td><td> 0,967</td><td> 0,923</td><td> 0,803</td><td> 0,904</td><td></td><td></td>

<td> 73</td><td> 81</td><td> 246</td><td> 376</td><td>AT1G6847 0</td><td> 0,917</td><td></td><td> 0,814</td><td></td><td></td><td></td><td></td><td></td>

<td> 74</td><td> 82</td><td> 247</td><td> 377</td><td>AT1G7125 0</td><td> 0,922</td><td></td><td></td><td></td><td></td><td></td><td> 0,93</td><td> 0,881</td>

<td> 75</td><td> 83</td><td> 248</td><td> 379</td><td>AT3G5820 0</td><td> 0,719</td><td> 0,897</td><td> 0,973</td><td> 0,907</td><td> 0,771</td><td> 0,914</td><td></td><td></td>

<td> 76</td><td> 84</td><td> 249</td><td> 380</td><td>AT1G7850 0</td><td> 0,731</td><td> 0,844</td><td> 0,964</td><td> 0,843</td><td> 0,788</td><td> 0,879</td><td></td><td></td>

<td> 77</td><td> 85</td><td> 250</td><td> 381</td><td>AT2G1469 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,972</td><td> 0,916</td>

<td> 78</td><td> 86</td><td> 251</td><td> 382</td><td>AT3G6304 0</td><td></td><td> 0,949</td><td> 0,979</td><td> 0,962</td><td> 0,783</td><td> 0,907</td><td></td><td></td>

<td> 79</td><td> 87</td><td> 252</td><td> 383</td><td>AT2G1532 5</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,978</td><td> 0,929</td>

<td> 80</td><td> 88</td><td> 253</td><td> 384</td><td>AT2G2351 0</td><td> 0,804</td><td> 0,767</td><td> 0,943</td><td> 0,777</td><td> 0,789</td><td> 0,85</td><td></td><td></td>

<td> 81</td><td> 89</td><td> 254</td><td> 385</td><td>AT2G2607 0</td><td> 0,927</td><td></td><td></td><td></td><td></td><td></td><td> 0,827</td><td> 0,762</td>

<td> 82</td><td> 90</td><td> 255</td><td> 2997</td><td>AT2G2865 0</td><td> 0,811</td><td></td><td> 0,711</td><td></td><td></td><td></td><td> 0,953</td><td> 0,939</td>

<td> 83</td><td> 91</td><td> 256</td><td> 2998</td><td>AT2G4129 0</td><td> 0,827</td><td></td><td> 0,869</td><td></td><td> 0,779</td><td> 0,786</td><td></td><td></td>

<td> 84</td><td> 92</td><td> 257</td><td> 389</td><td>AT2G4286 0</td><td> 0,903</td><td></td><td> 0,829</td><td></td><td> 0,727</td><td></td><td> 0,825</td><td> 0,813</td>

<td> 85</td><td> 93</td><td> 258</td><td> 390</td><td>AT2G4775 0</td><td> 0,906</td><td></td><td> 0,744</td><td></td><td></td><td></td><td> 0,784</td><td> 0,754</td>

<td> 86</td><td> 94</td><td> 259</td><td> 391</td><td>AT3G0323 0</td><td> 0,828</td><td> 0,844</td><td> 0,954</td><td> 0,854</td><td> 0,783</td><td> 0,833</td><td></td><td></td>

<td> 87</td><td> 95</td><td> 260</td><td> 392</td><td>AT3G0420 0</td><td> 0,912</td><td></td><td> 0,827</td><td></td><td> 0,733</td><td></td><td></td><td></td>

<td> 88</td><td> 96</td><td> 261</td><td> 393</td><td>AT3G2184 0</td><td> 0,702</td><td></td><td></td><td></td><td></td><td></td><td> 0,968</td><td> 0,928</td>

<td> 89</td><td> 97</td><td> 262</td><td> 3000</td><td>AT3G2264 0</td><td></td><td> 0,995</td><td> 0,855</td><td> 0,991</td><td></td><td> 0,873</td><td></td><td></td>

<td> 90</td><td> 98</td><td> 263</td><td> 395</td><td>AT3G4938 0</td><td> 0,919</td><td></td><td> 0,724</td><td></td><td></td><td></td><td> 0,843</td><td> 0,784</td>

<td> 91</td><td> 99</td><td> 264</td><td> 3001</td><td>AT4G0305 0</td><td> 0,93</td><td></td><td> 0,847</td><td></td><td> 0,749</td><td></td><td></td><td></td>

<td> 92</td><td> 100</td><td> 265</td><td> 3001</td><td>AT4G0305 0</td><td> 0,93</td><td></td><td> 0,847</td><td></td><td> 0,749</td><td></td><td></td><td></td>

<td> 93</td><td> 101</td><td> 266</td><td> 3003</td><td>AT4G1938 0</td><td> 0,783</td><td> 0,792</td><td> 0,913</td><td> 0,803</td><td> 0,826</td><td> 0,839</td><td></td><td></td>

57/119

<td>At the Seri and</td><td>Nucl SE QID At the:</td><td>Prot, SEQ ID At the:</td><td>BDL At the</td><td>TAIR-name gene</td><td>R wri1</td><td>R abi3</td><td>R fus3</td><td>R oleosin The</td><td>R ss / 2</td><td>R fad3</td><td>R / ec1</td><td>R Iec2</td>

<td colspan="13">continuation of table 1</td>

<td> 94</td><td> 102</td><td> 267</td><td> 398</td><td>AT4G2746 0</td><td></td><td> 0,992</td><td> 0,896</td><td> 0,985</td><td></td><td> 0,897</td><td></td><td></td>

<td> 95</td><td> 103</td><td> 268</td><td> 399</td><td>AT4G3328 0</td><td> 0,885</td><td> 0,715</td><td> 0,912</td><td> 0,732</td><td> 0,811</td><td> 0,8</td><td></td><td></td>

<td> 96</td><td> 104</td><td> 269</td><td> 400</td><td>AT4G3360 0</td><td> 0,917</td><td></td><td></td><td></td><td></td><td></td><td> 0,908</td><td> 0,851</td>

<td> 97</td><td> 105</td><td> 270</td><td> 401</td><td>AT5G0726 0</td><td> 0,956</td><td></td><td> 0,82</td><td></td><td> 0,73</td><td></td><td></td><td></td>

<td> 98</td><td> 106</td><td> 271</td><td> 3007</td><td>AT5G0846 0</td><td> 0,955</td><td></td><td> 0,768</td><td></td><td> 0,702</td><td></td><td> 0,757</td><td> 0,747</td>

<td> 99</td><td> 107</td><td> 272</td><td> 403</td><td>AT2G3470 0</td><td> 0,932</td><td></td><td> 0,903</td><td></td><td> 0,783</td><td> 0,741</td><td></td><td></td>

<td> 100</td><td> 108</td><td> 273</td><td> 404</td><td>AT5G1574 0</td><td> 0,911</td><td></td><td> 0,712</td><td></td><td></td><td></td><td> 0,883</td><td> 0,818</td>

<td> 101</td><td> 109</td><td> 274</td><td> 405</td><td>AT5G1623 0</td><td> 0,812</td><td> 0,82</td><td> 0,961</td><td> 0,834</td><td> 0,773</td><td> 0,858</td><td></td><td></td>

<td> 102</td><td> 110</td><td> 275</td><td> 406</td><td>AT5G1829 0</td><td> 0,905</td><td></td><td> 0,722</td><td></td><td></td><td></td><td> 0,821</td><td> 0,803</td>

<td> 103</td><td> 111</td><td> 276</td><td> 2814</td><td>AT5G2547 0</td><td> 0,901</td><td></td><td></td><td></td><td></td><td></td><td> 0,748</td><td> 0,711</td>

<td> 104</td><td> 112</td><td> 277</td><td> 408</td><td>AT5G3913 0</td><td> 0,951</td><td></td><td> 0,726</td><td></td><td></td><td></td><td> 0,769</td><td> 0,75</td>

<td> 105</td><td> 113</td><td> 278</td><td> 409</td><td>AT5G3916 0</td><td> 0,94</td><td></td><td> 0,729</td><td></td><td></td><td></td><td> 0,829</td><td> 0,789</td>

<td> 106</td><td> 114</td><td> 279</td><td> 409</td><td>AT5G3916 0</td><td> 0,94</td><td></td><td> 0,729</td><td></td><td></td><td></td><td> 0,829</td><td> 0,789</td>

<td> 107</td><td> 115</td><td> 280</td><td> 410</td><td>AT5G3919 0</td><td> 0,951</td><td></td><td> 0,795</td><td></td><td> 0,706</td><td></td><td> 0,754</td><td> 0,737</td>

<td> 108</td><td> 116</td><td> 281</td><td> 411</td><td>AT5G4436 0</td><td> 0,828</td><td> 0,833</td><td> 0,975</td><td> 0,855</td><td> 0,804</td><td> 0,849</td><td></td><td></td>

<td> 109</td><td> 117</td><td> 282</td><td> 412</td><td>AT5G4767 0</td><td> 0,957</td><td></td><td></td><td></td><td></td><td></td><td> 0,797</td><td> 0,759</td>

<td> 110</td><td> 118</td><td> 283</td><td> 3008</td><td>AT5G4982 0</td><td> 0,905</td><td></td><td></td><td></td><td> 0,715</td><td></td><td></td><td></td>

<td> 111</td><td> 119</td><td> 284</td><td> 414</td><td>AT5G5630 0</td><td> 0,936</td><td></td><td> 0,823</td><td></td><td> 0,717</td><td></td><td> 0,712</td><td></td>

<td> 112</td><td> 120</td><td> 285</td><td> 416</td><td>AT5G5917 0</td><td></td><td> 0,995</td><td> 0,852</td><td> 0,991</td><td></td><td> 0,87</td><td></td><td></td>

<td> 113</td><td> 121</td><td> 286</td><td> 418</td><td>AT1G2864 0</td><td></td><td> 0,967</td><td> 0,949</td><td> 0,975</td><td> 0,752</td><td> 0,92</td><td></td><td></td>

<td> 114</td><td> 122</td><td> 287</td><td> 419</td><td>AT1G2299 0</td><td></td><td> 0,789</td><td> 0,889</td><td> 0,794</td><td></td><td> 0,738</td><td></td><td></td>

<td> 115</td><td> 123</td><td> 288</td><td>2816 The</td><td>AT1G6411 0.1</td><td></td><td> 0,883</td><td></td><td> 0,869</td><td></td><td> 0,701</td><td></td><td></td>

<td> 116</td><td> 124</td><td> 289</td><td>2816 B</td><td>AT1G6411 0.2</td><td></td><td> 0,883</td><td></td><td> 0,869</td><td></td><td> 0,701</td><td></td><td></td>

<td> 117</td><td> 125</td><td> 290</td><td> 421</td><td>AT1G0438 0</td><td> 0,971</td><td></td><td> 0,798</td><td></td><td> 0,717</td><td></td><td> 0,772</td><td> 0,749</td>

<td> 118</td><td> 126</td><td> 291</td><td> 2817</td><td>AT1G0881 0</td><td></td><td> 0,888</td><td> 0,948</td><td> 0,885</td><td> 0,831</td><td> 0,862</td><td></td><td></td>

<td> 119</td><td> 127</td><td> 292</td><td> 2817</td><td>AT1G0881 0</td><td></td><td> 0,888</td><td> 0,948</td><td> 0,885</td><td> 0,831</td><td> 0,862</td><td></td><td></td>

<td> 120</td><td> 128</td><td> 293</td><td> 423</td><td>AT1G2817 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,962</td><td> 0,903</td>

<td> 121</td><td> 129</td><td> 294</td><td> 424</td><td>AT1G2865 0</td><td> 0,821</td><td> 0,843</td><td> 0,974</td><td> 0,853</td><td> 0,801</td><td> 0,844</td><td></td><td></td>

<td> 122</td><td> 130</td><td> 295</td><td> 425</td><td>AT3G1059 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,969</td><td> 0,944</td>

58/119

<td>At the Se laughs and</td><td>Nucl SE QID At the:</td><td>Prot, SEQ ID At the:</td><td>BDL At the</td><td>TAIR-name gene</td><td>R wri1</td><td>R abi3</td><td>R fus3</td><td>R aleosin The</td><td>R ss / 2</td><td>R fad3</td><td>Rlecl</td><td>R Iec2</td>

<td colspan="13">continuation of table 1</td>

<td> 123</td><td> 131</td><td> 296</td><td> 426</td><td>AT3G5874 0</td><td> 0,948</td><td></td><td> 0,842</td><td></td><td> 0,745</td><td></td><td></td><td></td>

<td> 124</td><td> 132</td><td> 297</td><td> 427</td><td>AT4G0236 0</td><td></td><td> 0,941</td><td> 0,941</td><td> 0,937</td><td> 0,731</td><td> 0,915</td><td></td><td></td>

<td> 125</td><td> 133</td><td> 298</td><td> 428</td><td>AT4G3670 0</td><td></td><td> 0,965</td><td> 0,967</td><td> 0,976</td><td> 0,768</td><td> 0,899</td><td></td><td></td>

<td> 126</td><td> 134</td><td> 299</td><td> 429</td><td>AT5G0720 0</td><td> 0,957</td><td></td><td> 0,851</td><td></td><td> 0,753</td><td></td><td> 0,725</td><td> 0,71</td>

<td> 127</td><td> 135</td><td> 300</td><td> 430</td><td>AT5G2281 0</td><td> 0,958</td><td></td><td> 0,702</td><td></td><td></td><td></td><td> 0,86</td><td> 0,834</td>

<td> 128</td><td> 136</td><td> 301</td><td> 431</td><td>AT5G4386 0</td><td></td><td> 0,866</td><td> 0,916</td><td> 0,868</td><td> 0,776</td><td> 0,817</td><td></td><td></td>

<td> 129</td><td> 137</td><td> 302</td><td> 432</td><td>AT5G5739 0</td><td></td><td> 0,989</td><td> 0,914</td><td> 0,987</td><td> 0,713</td><td> 0,916</td><td></td><td></td>

<td> 130</td><td> 138</td><td> 303</td><td> 433</td><td>AT5G6280 0</td><td></td><td> 0,961</td><td> 0,967</td><td> 0,962</td><td> 0,769</td><td> 0,913</td><td></td><td></td>

<td> 131</td><td> 139</td><td> 304</td><td> 435</td><td>AT5G5250 0</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 0,956</td><td> 0,876</td>

<td> 132</td><td> 140</td><td> 305</td><td> 436</td><td>AT5G2460 0</td><td></td><td> 0,956</td><td> 0,902</td><td> 0,954</td><td></td><td> 0,863</td><td></td><td></td>

<td> 133</td><td> 141</td><td> 306</td><td> 2818</td><td>AT2G2355 0</td><td> 0,829</td><td></td><td></td><td></td><td></td><td></td><td> 0,928</td><td> 0,839</td>

<td> 134</td><td> 142</td><td> 307</td><td> 2818</td><td>AT2G2355 0</td><td> 0,829</td><td></td><td></td><td></td><td></td><td></td><td> 0,928</td><td> 0,839</td>

<td> 135</td><td> 146</td><td> 311</td><td> 441</td><td>AT5G4810 0</td><td> 0,737</td><td> 0,923</td><td> 0,95</td><td> 0,944</td><td> 0,761</td><td> 0,864</td><td></td><td></td>

<td> 136</td><td> 147</td><td> 312</td><td> 442</td><td>AT1G1476 0</td><td> 0,708</td><td> 0,874</td><td> 0,93</td><td> 0,876</td><td> 0,831</td><td> 0,877</td><td></td><td></td>

<td> 137</td><td> 148</td><td> 313</td><td> 443</td><td>AT1G1515 0</td><td> 0,871</td><td></td><td></td><td></td><td></td><td></td><td> 0,971</td><td> 0,92</td>

<td> 138</td><td> 149</td><td> 314</td><td> 444</td><td>AT1G2050 0</td><td> 0,92</td><td></td><td> 0,783</td><td></td><td></td><td></td><td> 0,904</td><td> 0,874</td>

<td> 139</td><td> 150</td><td> 315</td><td> 445</td><td>AT1G5617 0</td><td> 0,966</td><td></td><td> 0,751</td><td></td><td></td><td></td><td> 0,782</td><td> 0,751</td>

<td> 140</td><td> 151</td><td> 316</td><td> 2996</td><td>AT1G6207 0</td><td> 0,956</td><td></td><td></td><td></td><td></td><td></td><td> 0,847</td><td> 0,797</td>

<td> 141</td><td> 152</td><td> 317</td><td> 447</td><td>AT1G6710 0</td><td></td><td> 0,967</td><td> 0,969</td><td> 0,973</td><td> 0,761</td><td> 0,914</td><td></td><td></td>

<td> 142</td><td> 153</td><td> 318</td><td> 448</td><td>AT3G2109 0</td><td> 0,902</td><td></td><td> 0,724</td><td></td><td></td><td></td><td></td><td></td>

<td> 143</td><td> 154</td><td> 319</td><td> 449</td><td>AT3G2425 0</td><td> 0,826</td><td></td><td></td><td></td><td></td><td></td><td> 0,986</td><td> 0,931</td>

<td> 144</td><td> 155</td><td> 320</td><td> 450</td><td>AT3G5099 0</td><td> 0,715</td><td></td><td></td><td></td><td></td><td></td><td> 0,982</td><td> 0,914</td>

<td> 145</td><td> 156</td><td> 321</td><td> 451</td><td>AT4G0022 0</td><td> 0,905</td><td> 0,741</td><td> 0,923</td><td> 0,773</td><td> 0,782</td><td> 0,779</td><td> 0,7</td><td> 0,703</td>

<td> 146</td><td> 157</td><td> 322</td><td> 452</td><td>AT4G1015 0</td><td> 0,706</td><td> 0,875</td><td> 0,95</td><td> 0,883</td><td> 0,821</td><td> 0,886</td><td></td><td></td>

<td> 147</td><td> 158</td><td> 323</td><td> 3006</td><td>AT5G0719 0</td><td></td><td> 0,998</td><td> 0,903</td><td> 0,997</td><td></td><td> 0,901</td><td></td><td></td>

<td> 148</td><td> 159</td><td> 324</td><td> 3006</td><td>AT5G0719 0</td><td></td><td> 0,998</td><td> 0,903</td><td> 0,997</td><td></td><td> 0,901</td><td></td><td></td>

<td> 149</td><td> 160</td><td> 325</td><td> 455</td><td>AT5G1022 0</td><td> 0,722</td><td></td><td></td><td></td><td></td><td></td><td> 0,984</td><td> 0,917</td>

<td> 150</td><td> 161</td><td> 326</td><td> 456</td><td>AT5G2094 0</td><td></td><td> 0,969</td><td> 0,901</td><td> 0,961</td><td></td><td> 0,901</td><td></td><td></td>

<td> 151</td><td> 162</td><td> 327</td><td> 457</td><td>AT5G5121 0</td><td> 0,907</td><td> 0,7</td><td> 0,925</td><td> 0,734</td><td> 0,788</td><td> 0,752</td><td> 0,702</td><td> 0,7</td>

59/119

<td>At the Serê and</td><td>Nucl SE QID At the:</td><td>Prot, SEQ ID At the:</td><td>BDL At the</td><td>TAIR-name gene</td><td>R wrí1</td><td>R abi3</td><td>R fus3</td><td>R oleosin The</td><td>R ss / 2</td><td>R fad3</td><td>Rlecl</td><td>R Iec2</td>

<td colspan="13">continuation of table 1</td>

<td> 152</td><td> 163</td><td> 328</td><td> 458</td><td>AT5G5562 0</td><td> 0,704</td><td> 0,769</td><td> 0,898</td><td> 0,776</td><td> 0,871</td><td> 0,8</td><td></td><td></td>

<td> 153</td><td> 164</td><td> 329</td><td> 459</td><td>AT5G6046 0</td><td></td><td> 0,987</td><td> 0,931</td><td> 0,988</td><td></td><td> 0,902</td><td></td><td></td>

<td> 154</td><td> 165</td><td> 330</td><td> 460</td><td>AT5G6559 0</td><td> 0,793</td><td> 0,725</td><td> 0,882</td><td> 0,754</td><td> 0,783</td><td> 0,77</td><td></td><td></td>

<td> 155</td><td> 332</td><td> 351</td><td> 2991</td><td>AT5G1500 0</td><td></td><td> 0,955</td><td> 0,959</td><td> 0,957</td><td> 0,739</td><td> 0,902</td><td></td><td></td>

<td> 156</td><td> 333</td><td> 352</td><td> 2992</td><td>AT1G0528 0</td><td> 0,939</td><td></td><td> 0,805</td><td></td><td></td><td></td><td> 0,859</td><td> 0,84</td>

<td> 157</td><td> 334</td><td> 353</td><td> 2993</td><td>AT1G1990 0</td><td></td><td> 0,975</td><td> 0,909</td><td> 0,962</td><td></td><td> 0,898</td><td></td><td></td>

<td> 158</td><td> 336</td><td> 355</td><td> 2995</td><td>AT1G5100 0</td><td> 0,906</td><td></td><td></td><td></td><td></td><td></td><td> 0,785</td><td> 0,77</td>

<td> 159</td><td> 337</td><td> 356</td><td> 2996</td><td>AT1G6207 0</td><td> 0,956</td><td></td><td></td><td></td><td></td><td></td><td> 0,847</td><td> 0,797</td>

<td> 160</td><td> 338</td><td> 357</td><td> 2997</td><td>AT2G2865 0</td><td> 0,811</td><td></td><td> 0,711</td><td></td><td></td><td></td><td> 0,953</td><td> 0,939</td>

<td> 161</td><td> 339</td><td> 358</td><td> 2998</td><td>AT2G4129 0</td><td> 0,827</td><td></td><td> 0,869</td><td></td><td> 0,779</td><td> 0,786</td><td></td><td></td>

<td> 162</td><td> 340</td><td> 359</td><td> 2999</td><td>AT2G4134 0</td><td> 0,816</td><td></td><td> 0,745</td><td></td><td> 0,744</td><td></td><td></td><td></td>

<td> 163</td><td> 341</td><td> 360</td><td> 3000</td><td>AT3G2264 0</td><td></td><td> 0,995</td><td> 0,855</td><td> 0,991</td><td></td><td> 0,873</td><td></td><td></td>

<td> 164</td><td> 342</td><td> 361</td><td> 3001</td><td>AT4G0305 0</td><td> 0,93</td><td></td><td> 0,847</td><td></td><td> 0,749</td><td></td><td></td><td></td>

<td> 165</td><td> 344</td><td> 363</td><td> 3003</td><td>AT4G1938 0</td><td> 0,783</td><td> 0,792</td><td> 0,913</td><td> 0,803</td><td> 0,826</td><td> 0,839</td><td></td><td></td>

<td> 166</td><td> 345</td><td> 364</td><td> 3004</td><td>AT5G0179 0</td><td> 0,792</td><td></td><td></td><td></td><td></td><td></td><td> 0,899</td><td> 0,85</td>

<td> 167</td><td> 347</td><td> 366</td><td> 3006</td><td>AT5G0719 0</td><td></td><td> 0,998</td><td> 0,903</td><td> 0,997</td><td></td><td> 0,901</td><td></td><td></td>

<td> 168</td><td> 348</td><td> 367</td><td> 3007</td><td>AT5G0846 0</td><td> 0,955</td><td></td><td> 0,768</td><td></td><td> 0,702</td><td></td><td> 0,757</td><td> 0,747</td>

<td> 169</td><td> 349</td><td> 368</td><td> 3008</td><td>AT5G4982 0</td><td> 0,905</td><td></td><td></td><td></td><td> 0,715</td><td></td><td></td><td></td>

Additional genes that are predicted to affect the synthesis of Seed oil and that have been identified using bioinformatics tools are provided in Table 2, below.

Table 2

<td>In the Series</td><td>SEQ ID No Polynucleotide:</td><td>SEQ ID In Polypeptide:</td><td>BDL No.</td><td>TAIR- gene name</td>

<td> 1</td><td> 53</td><td> 218</td><td> 3005</td><td>AT5G03450.1</td>

<td> 2</td><td> 57</td><td> 222</td><td> 351</td><td>AT1G27120.1</td>

<td> 3</td><td> 58</td><td> 223</td><td> 352</td><td>AT5G01820.1</td>

<td> 4</td><td> 59</td><td> 224</td><td> 353</td><td>AT2G32780.1</td>

<td> 5</td><td> 60</td><td> 225</td><td> 354</td><td>AT3G16490.1</td>

<td> 6</td><td> 61</td><td> 226</td><td> 355</td><td>AT5G23050.1</td>

<td> 7</td><td> 62</td><td> 227</td><td> 3002</td><td>AT4G 16050.1</td>

<td> 8</td><td> 63</td><td> 228</td><td> 2994</td><td>AT1G44760.1</td>

60/119

<td>In the Series</td><td>SEQ ID No Polynucleotide:</td><td>SEQ ID In Polypeptide:</td><td>BDL No.</td><td>TAIR- gene name</td>

<td>continuation d</td><td colspan="4">table 2</td>

<td> 9</td><td> 143</td><td> 308</td><td> 438</td><td>AT1G72040</td>

<td> 10</td><td> 144</td><td> 309</td><td> 439</td><td>AT1G53070</td>

<td> 11</td><td> 145</td><td> 310</td><td> 440</td><td>AT1G50510</td>

<td> 12</td><td> 331</td><td> 350</td><td> 2990</td><td>AT5G14995</td>

<td> 13</td><td> 335</td><td> 354</td><td> 2994</td><td>AT1G44760</td>

<td> 14</td><td> 343</td><td> 362</td><td> 3002</td><td>AT4G16050</td>

<td> 15</td><td> 346</td><td> 365</td><td> 3005</td><td>AT5G03450</td>

Example 2

PRODUCTION OF ARABIDOPSIS TRANSCRIPTOM AND HIGH PERFORMANCE CORRELATION ANALYSIS USING FULL GENOME OLIGONUCLEOTIDE MICRO TEST

FROM ARABIDOPSIS 44 K

In order to produce a high yield correlation analysis, the present inventors using an oligonucleotide micro assay from Arabidopsis thaliana, produced by Agilent Technologies [http://www.chem.agilent.com/Scripts/PDS.asp?lPage= 50879]. The oligonucleotide assay represents about 40,000 A. thaliana and designated transcripts based on data from the TIGR ATH1 v.5 database and the Arabidopsis MPSS database (University of Delaware). In order to define the correlations between RNA expression levels and yield components or related vigor parameters, several characteristics of the plant of 15 different Arabidopsis ecotypes were analyzed. Among them, nine ecotypes encompassing the observed variance were selected for the analysis of RNA expression. The correlation between the RNA levels and the characterized parameters were analyzed using Pearson's correlation test [Http://www.davidmlane.com/hiperstate/A34 739.html].

61/119

Experimental Procedures

RNA extraction - Five tissues from different stages of development [root, leaf, flower in anthesis, seed in 5 days after flowering (DAF) and seed in 12 DAF], representing different characteristics of the plant, were sampled and the RNA was extracted using Invitrogen's TRIzole Reagent [http://www.invitrogen.com/content.cfm?pageid=469]. For convenience, each type of micro assay expression information tissue received an ID Set as summarized in

Table 3 below.

Table 3

Arabidopsis Transcriptom experimental sets

<td>Expression Group</td><td>GroupID</td>

<td>Root</td><td>THE</td>

<td>leaf</td><td>B</td>

<td>Flower</td><td>Ç</td>

<td>Seed 5 DAF</td><td>D</td>

<td>Seed 12 DAF</td><td>AND</td>

Approximately 30-50 mg of tissue was taken from the samples. Heavy tissues were

<td>ground with</td><td>mortar and</td><td>pestle</td>

<td>resuspended</td><td>in 50 0? 1</td><td>of</td>

<td>homogenized</td><td>lysate, 100</td><td>?1 of</td>

in liquid nitrogen and

TRIzol reagent. For chloroform was added followed by precipitation using isopropanol and two washes with 75% ethanol. The RNA was eluted in 30? 1 of RNase-free water. The RNA samples were cleaned using the Qiagen's RNeasy minikit cleaning protocol as the manufacturer's protocol.

Yield component and evaluation of parameters related to vigor - 8 ecotypes

62/119

Arabidopsis in 5 repetitive blocks (named A, B, CD and E), each containing 20 plants per plot grown under greenhouse control conditions 22? C, 20:20:20 (weight ratio) N: P fertilizer was added : K [nitrogen (N), phosphorus (P) and potassium (K)]. During this period the data were collected, documented and analyzed. Additional data were collected through the seedling phase of plants grown in tissue culture on transparent vertical growth agar plates. Parameters of collected data are summarized in Table 4, below.

Table 4

Correlated parameters of Arabidopsis (vectors)

<td>Parameters correlated with</td><td>Correlation ID</td>

<td>Root length at day 13 (cm)</td><td> 1</td>

<td>Root length at day 7 (cm)</td><td> 2</td>

<td>Relative root growth (cm / day) day 13</td><td> 3</td>

<td>Fresh weight per plant (gr) in the closing phase</td><td> 4</td>

<td>Dry matter per plant (gr)</td><td> 5</td>

<td>Vegetative growth rate (cm²/ day) up to 8 true sheets</td><td> 6</td>

<td>Blade circularity</td><td> 7</td>

<td>Blade width (cm)</td><td> 8</td>

<td>Blade length (cm)</td><td> 9</td>

<td>Total leaf area per plant (cm)</td><td> 10</td>

<td>Weight of 1000 seeds (gr)</td><td> 11</td>

<td>% oil per seed</td><td> 12</td>

<td>Porsilicate seeds</td><td> 13</td>

<td>Silica length (cm)</td><td> 14</td>

<td>Seed yield per plant (gr)</td><td> 15</td>

<td>Oil yield per plant (mg)</td><td> 16</td>

<td>harvest index</td><td> 17</td>

<td>Sheet width / length</td><td> 18</td>

Many of the choice parameters were analyzed by digital image.

Digital imaging - A laboratory image acquisition system, consisting of a digital reflex camera (Canon EOS 300 D) coupled with

63/119 55 mm focal length lenses (Canon EF-S series), mounted on a reproduction device (Kaiser RS), which included 4 light units (4 x 15 watt light bulb) and located in a dark room , was used to capture images of sawn seedlings on square agar plates.

The image capture process was repeated every 2 days starting on the 7th to the 14th. The same camera attached with a focal length 24mm lens (Canon EF series), placed on a pile of iron, was used to capture images of larger plants sawn in white tubes in a controlled environmental greenhouse (as seen in Figure 2b).

The white square tubes with measures of 3 6 x 2 6.2 cm and 7.5 cm deep. During the capture process, the tubes were placed under the pile of iron, while avoiding direct sunlight and shadows. This process was repeated every 3-4 days for up to 30 days.

An image analysis system was used, which consists of a personal desktop computer (Intel P4 3.0 GHz processor) and a public domain program - ImageJ 1.37 (Java based on the image processing program that was developed at the American National Institute of Health and freely available on the internet at http: //rsbweb.nih..gov/). The images were captured in 6 Mega Pixel resolution (3072 x 2048 pixels) and stored in low compression in the JPEG format (Joint Photographic Experts Group standard). Then data

64/119 analyzed were saved to text files and processed using the statistical analysis software JMP (instituto SAS).

Sheet analysis - using data from digital analysis sheets was calculated, including sheet number, area, perimeter, length and width. On day 30, 3-4 representative plants were chosen from each plot of blocks A, B and C. The plants were dissected, each leaf was separated and inserted between two glass trays, a photo of each plant was taken and the various parameters (such as total leaf area, laminar length, etc.) were calculated from the images (Figure 1 ad). The circularity of the blade was calculated as the laminar width divided by the laminar length.

Root analysis - For 17 days, the different ecotypes were grown on transparent agar plates. The plates were photographed every 2 days starting on the 7th in the photography room and the development of the roots was documented (Figures 2a-b).

The growth rate was calculated according to the following formula I.

Formula I:

Rate of area of ​​relative growth = (? Area /? T) * (1 / area t0) út is the day of the current analyzed image subtracted from the initial day (t-t0).

Thus, the rate of the relative growth area is in the unit of 1 / day and the growth rate is in the unit of 1 / day.

65/119

Analysis of the vegetative growth rate - The growth rate was calculated by dividing the added area (Δ area) by the number of days for each interval (At). The analysis was completed with the appearance of overlapping plants.

The growth rate was calculated according to formula II.

Formula II:

Growth rate = Δ area / At.

For comparison between ecotypes, the calculated rate was normalized using the plant development stage as represented by the number of true plants. In cases where plants with 8 leaves were sampled twice (for example, on the 10th and 13th day), only the largest sample was chosen and added for Anova comparison.

Seeds in silica analysis - On day 70, 15-17 silicas were collected from each plot in blocks D and E. The chosen silicas were brown in color, but still intact. The silicas were opened in the photography room and the seeds were dispersed on a glass tray, a high resolution digital figure was taken from each plot. Using the images, the number of seeds per silica was determined.

Average seed weight - At the end of the experiment, all seeds from the AC plots were collected. An average weight of 0.02 grams was measured from each sample, the seeds were dispersed on a tray

66/119 glass and a photograph was taken. Using digital analysis, the number of seeds in each sample was calculated.

Percentage of oil in the seeds - At the end of the experiment all seeds from the AC plots were collected. Columbia seeds from 3 plots were ground and mixed and then mounted in the extraction chamber. 210 ml of n-hexane (cat. No. 080951

Biolab Ltd.) were used as the solvent. The extraction was carried out for 30 hours in a medium heated to 50 ° C. Once the extraction was completed, the n-hexane was evaporated using the evaporator at 35 ° C and vacuum conditions. The process was repeated twice. The information acquired from the Soxhlet extractor (Soxhlet, F. Die gewichtsanalytische Bestimmung DES Milchfettes, Polytechnisches J. (Dingler's) 1879, 232, 461) was used to create a calibration curve for the

Low NMR Resonance. The oil content of all seed samples was determined using Low

NMR resonance (MARAN Ultra-Oxford Instrument) and its MultiQuant software package.

Silica length analysis - On day 50 of sowing, 30 silicas from different plants in each plot were sampled in block A. The silicas chosen were yellow-green in color and were collected from the deep parts of a growing plant trunk. A digital photograph was taken to determine the length of the silica.

Dry weight and seed yield - On day 80 of sowing, the plants in the AC blocks

67/119 were collected and allowed to dry at 30 ° C in a drying chamber. The biomass and seed weight of each plot were separated, measured and divided by the number of plants. Dry weight = total weight of the vegetative portion above the soil (excluding the roots) after drying at 30 ° C in a drying chamber; seed yield per plant = total seed weight per plant (gr).

Oil yield - Oil yield was calculated using Formula III.

Formula III:

Seed oil yield = seed yield per plant (gr) *% oil in the seed Harvest index - The harvest index was calculated using Formula IV.

Formula IV:

Harvest index = Average seed yield per plant / Average dry weight Experimental Results

Nine different Arabidopsis ecotypes grew and were characterized by 18 parameters (named as vectors). The characterized values ​​are summarized in Tables 5 and 6 below.

Table 5

Arabidopsis ecotypes, measured parameters

<td>Ecotype</td><td>Rend without. per plant (gr)</td><td>Rend oil per plant (mg)</td><td>% Oil per week.</td><td>1000 Weight Without. (Gr)</td><td>Dry matter per plant (gr)</td><td>Index Harvest</td><td>Area total per plant (cm)</td><td>Without. per siliqua</td><td>Length Siliqua (cm)</td>

<td>An-1</td><td> 0,34</td><td> 118,63</td><td> 34,42</td><td> 0,0203</td><td> 0,64</td><td> 0,53</td><td> 46,86</td><td> 45,44</td><td> 1,06</td>

<td>Col-0</td><td> 0,44</td><td> 138,73</td><td> 31,19</td><td> 0,0230</td><td> 1,27</td><td> 0,35</td><td> 109,89</td><td> 53,47</td><td> 1,26</td>

<td>Ct-1</td><td> 0,59</td><td> 224,06</td><td> 38,05</td><td> 0,0252</td><td> 1,05</td><td> 0,56</td><td> 58,36</td><td> 58,47</td><td> 1,31</td>

68/119

<td colspan="10">continuation of table 5</td>

<td>Cvi (N8580)</td><td> 0,42</td><td> 116,26</td><td> 27,76</td><td> 0,0344</td><td> 1,28</td><td> 0,33</td><td> 56,80</td><td> 35,27</td><td> 1,47</td>

<td>Gr-6</td><td> 0,61</td><td> 218,27</td><td> 35,49</td><td> 0,0202</td><td> 1,69</td><td> 0,37</td><td> 114,66</td><td> 48,56</td><td> 1,24</td>

<td>Kondara</td><td> 0,43</td><td> 142,11</td><td> 32,91</td><td> 0,0263</td><td> 1,34</td><td> 0,32</td><td> 110,82</td><td> 37,00</td><td> 1,09</td>

<td>Read-1</td><td> 0,36</td><td> 114,15</td><td> 31,56</td><td> 0,0205</td><td> 0,81</td><td> 0,45</td><td> 88,49</td><td> 39,38</td><td> 1,18</td>

<td>Mt-0</td><td> 0,62</td><td> 190,06</td><td> 30,79</td><td> 0,0226</td><td> 1,21</td><td> 0,51</td><td> 121,79</td><td> 40,53</td><td> 1,18</td>

<td>Shakdara</td><td> 0,55</td><td> 187,62</td><td> 34,02</td><td> 0,0235</td><td> 1,35</td><td> 0,41</td><td> 93,04</td><td> 25,53</td><td> 1,00</td>

Table 6

Arabidopsis ecotypes, additional parameters measured

<td>Ecotype</td><td>Rate of grow. Vegetative (cm² / day) till 8 true leaves</td><td>King activate root growth (cm / day) day 13</td><td>Comp. Root day 7 (cm)</td><td>Comp. Root day 13 (cm)</td><td>Weight fresh per plant (gr) in sieve</td><td>Comp. Roll to (cm)</td><td>Larg. Blade (cm)</td><td>Leaf width / comp.</td><td>Circularid Blade</td>

<td>An-1</td><td> 0,313</td><td> 0,631</td><td> 0,937</td><td> 4,419</td><td> 1,510</td><td> 2,767</td><td> 1,385</td><td> 0,353</td><td> 0,509</td>

<td>Col-0</td><td> 0,378</td><td> 0,664</td><td> 1,759</td><td> 8,530</td><td> 3,607</td><td> 3,544</td><td> 1,697</td><td> 0,288</td><td> 0,481</td>

<td>Ct-1</td><td> 0,484</td><td> 1,176</td><td> 0,701</td><td> 5,621</td><td> 1,935</td><td> 3,274</td><td> 1,460</td><td> 0,316</td><td> 0,450</td>

<td>Cvi (N8580)</td><td> 0,474</td><td> 1,089</td><td> 0,728</td><td> 4,834</td><td> 2,082</td><td> 3,785</td><td> 1,374</td><td> 0,258</td><td> 0,370</td>

<td>Gr-6</td><td> 0,425</td><td> 0,907</td><td> 0,991</td><td> 5,957</td><td> 3,556</td><td> 3,690</td><td> 1,828</td><td> 0,356</td><td> 0,501</td>

<td>Kondar The</td><td> 0,645</td><td> 0,774</td><td> 1,163</td><td> 6,372</td><td> 4,338</td><td> 4,597</td><td> 1,650</td><td> 0,273</td><td> 0,376</td>

<td>Read-1</td><td> 0,430</td><td> 0,606</td><td> 1,284</td><td> 5,649</td><td> 3,467</td><td> 3,877</td><td> 1,510</td><td> 0,305</td><td> 0,394</td>

<td>Mt-0</td><td> 0,384</td><td> 0,701</td><td> 1,414</td><td> 7,060</td><td> 3,479</td><td> 3,717</td><td> 1,817</td><td> 0,335</td><td> 0,491</td>

<td>Shakda frog</td><td> 0,471</td><td> 0,782</td><td> 1,251</td><td> 7,041</td><td> 3,710</td><td> 4,149</td><td> 1,668</td><td> 0,307</td><td> 0,409</td>

The selected genes, their R 5 (calculated using the Pearson correlation), the characterized parameters used as the x-axis for correlation and the tissue correlated with the transcriptom are summarized in

Table 7, below.

Table 7

Selected arabidopsis genes and their correlation with yield components between different sets of transcriptom

<td></td><td>SEQ ID In Nucleotide:</td><td>SEQ ID In Polypeptide:</td><td>Gene Name</td><td>Name Group</td><td>Gr. Exp.</td><td>Vector Corr.</td><td>R</td>

<td> 1</td><td> 3</td><td> 168</td><td>BDL2</td><td>arabidopsis | 61 AT 1G34580</td><td>B</td><td> 8</td><td> 0,77</td>

<td> 2</td><td> 3</td><td> 168</td><td>BDL2</td><td>arabidopsis | 61 AT 1G34580</td><td>D</td><td> 15</td><td> 0,75</td>

<td> 3</td><td> 3</td><td> 168</td><td>BDL2</td><td>arabidopsis | 61 AT 1G34580</td><td>D</td><td> 16</td><td> 0,71</td>

<td> 4</td><td> 6</td><td> 171</td><td>BDL6</td><td>arabi dopsi sj 6 J AT 4G10490</td><td>AND</td><td> 12</td><td> -0,7</td>

<td> 5</td><td> 7</td><td> 172</td><td>BDL7</td><td>arabidopsis | 6 | AT5G51490</td><td>THE</td><td> 15</td><td> 0,76</td>

69/119

<td></td><td>SEQ ID In Nucleotide:</td><td>SEQ ID In Polypeptide:</td><td>Gene Name</td><td>Name Group</td><td>Gr. Exp.</td><td>Vector Corr.</td><td>R</td>

<td colspan="8">continuation of table 7</td>

<td> 6</td><td> 1</td><td> 172</td><td>BDL7</td><td>arabi dopsi s 161AT5G51490</td><td>THE</td><td> 16</td><td> 0,74</td>

<td> 7</td><td> 7</td><td> 172</td><td>BDL7</td><td>arabidopsis | 6 | AT5G51490</td><td>B</td><td> 4</td><td> -0,78</td>

<td> 8</td><td> 7</td><td> 172</td><td>BDL7</td><td>arabidopsis | 6 | AT5G51490</td><td>B</td><td> 9</td><td> -0,77</td>

<td> 9</td><td> 7</td><td> 172</td><td>BDL7</td><td>arabidopsis | 6 | AT5G51490</td><td>B</td><td> 10</td><td> -0,73</td>

<td> 10</td><td> 7</td><td> 172</td><td>BDL7</td><td>arabidopsis | 6 | AT5G51490</td><td>B</td><td> 17</td><td> 0,88</td>

<td> 11</td><td> 8</td><td> 173</td><td>BDL8</td><td>arabidopsis | 6 | AT3G03240</td><td>D</td><td> 15</td><td> 0,87</td>

<td> 12</td><td> 8</td><td> 173</td><td>BDL8</td><td>arabidopsis | 6 | AT3G03240</td><td>D</td><td> 16</td><td> 0,89</td>

<td> 13</td><td> 9</td><td> 174</td><td>BDL9</td><td>arabidopsis | 6 | AT5G24130</td><td>D</td><td> 15</td><td> 0,75</td>

<td> 14</td><td> 9</td><td> 174</td><td>BDL9</td><td>arabidopsis | 6 | AT5G24130</td><td>D</td><td> 16</td><td> 0,75</td>

<td> 15</td><td> 9</td><td> 174</td><td>BDL9</td><td>arabidopsis | 6 | AT5G24130</td><td>AND</td><td> 13</td><td> 0,75</td>

<td> 16</td><td> 10</td><td> 175</td><td>BDL10</td><td>arabidopsis | 6 | AT5G09640</td><td>AND</td><td> 11</td><td> 0,72</td>

<td> 17</td><td> 13</td><td> 178</td><td>BDL14</td><td>arabidopsisj 61 AT 1G53690</td><td>B</td><td> 11</td><td> 0,87</td>

<td> 18</td><td> 13</td><td> 178</td><td>BDL14</td><td>arabidopsis [61 AT 1G53690</td><td>B</td><td> 12</td><td> -0,71</td>

<td> 19</td><td> 13</td><td> 178</td><td>BDL14</td><td>arabidopsis | 6 j AT 1G53690</td><td>B</td><td> 14</td><td> 0,71</td>

<td> 20</td><td> 13</td><td> 178</td><td>BDL14</td><td>arabi dopsis | 61 AT 1G53690</td><td>AND</td><td> 11</td><td> 0,72</td>

<td> 21</td><td> 14</td><td> 179</td><td>BDL15</td><td>arabidopsis | 6 | AT1 G68510</td><td>AND</td><td> 15</td><td> 0,72</td>

<td> 22</td><td> 16</td><td> 181</td><td>BDL17</td><td>arabidopsis | 6 | AT5G36770</td><td>D</td><td> 15</td><td> 0,75</td>

<td> 23</td><td> 18</td><td> 183</td><td>BDL19</td><td>arabidopsis | 6 | AT2G02080</td><td>Ç</td><td> 16</td><td> 0,7</td>

<td> 24</td><td> 18</td><td> 183</td><td>BDL19</td><td>arabidopsis | 6 | AT2G02080</td><td>D</td><td> 17</td><td> 0,72</td>

<td> 25</td><td> 19</td><td> 184</td><td>BDL20a</td><td>arabidopsis | 6 | AT 1G47540</td><td>THE</td><td> 11</td><td> 0,85</td>

<td> 26</td><td> 20</td><td> 185</td><td>BDL20b</td><td>arabidopsi s | 6 AT 1G47540</td><td>THE</td><td> 11</td><td> 0,85</td>

<td> 27</td><td> 21</td><td> 186</td><td>BDL21</td><td>arabidopsis | 6 AT3G62730</td><td>D</td><td> 17</td><td> 0,8</td>

<td> 28</td><td> 21</td><td> 186</td><td>BDL21</td><td>arabidopsis | 6 AT3G62730</td><td>AND</td><td> 11</td><td> 0,79</td>

<td> 29</td><td> 21</td><td> 186</td><td>BDL21</td><td>arabidopsis | 6 | AT3G62730</td><td>AND</td><td> 14</td><td> 0,79</td>

<td> 30</td><td> 22</td><td> 187</td><td>BDL22</td><td>arabidopsis | 6 | AT2G27380</td><td>THE</td><td> 11</td><td> 0,81</td>

<td> 31</td><td> 22</td><td> 187</td><td>BDL22</td><td>arabidopsis | 6 | AT2G27380</td><td>THE</td><td> 12</td><td> -0,75</td>

<td> 32</td><td> 23</td><td> 188</td><td>BDL23</td><td>arabidopsis | 6 | AT3G27785</td><td>AND</td><td> 11</td><td> 0,7</td>

<td> 33</td><td> 23</td><td> 188</td><td>BDL23</td><td>arabidopsis | 6 | AT3G27785</td><td>AND</td><td> 12</td><td> -0,86</td>

<td> 34</td><td> 23</td><td> 188</td><td>BDL23</td><td>arabidopsis | 6 AT3G27785</td><td>AND</td><td> 14</td><td> 0,71</td>

<td> 35</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 AT3G20910</td><td>THE</td><td> 5</td><td> 0,77</td>

<td> 36</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>THE</td><td> 8</td><td> 0,7</td>

<td> 37</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 AT3G20910</td><td>B</td><td> 12</td><td> 0,72</td>

<td> 38</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>B</td><td> 16</td><td> 0,75</td>

<td> 39</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>Ç</td><td> 15</td><td> 0,77</td>

<td> 40</td><td> 25</td><td> 190</td><td>BDL25</td><td>arab i dopsi s 16 | AT3G20910</td><td>Ç</td><td> 16</td><td> 0,81</td>

<td> 41</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>D</td><td> 12</td><td> 0,77</td>

<td> 42</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 | AT3G20910</td><td>D</td><td> 15</td><td> 0,73</td>

<td> 43</td><td> 25</td><td> 190</td><td>BDL25</td><td>arabidopsis | 6 AT3G20910</td><td>D</td><td> 16</td><td> 0,8</td>

<td> 44</td><td> 26</td><td> 191</td><td>BDL26a</td><td>arabidopsis | 6 | AT 1G11170</td><td>Ç</td><td> 15</td><td> -0,77</td>

<td> 45</td><td> 27</td><td> 192</td><td>BDL26b</td><td>arabidopsis | 6 | AT1G11170</td><td>Ç</td><td> 15</td><td> -0,77</td>

<td> 46</td><td> 28</td><td> 193</td><td>BDL27</td><td>arabidopsis | 61 AT 1G68380</td><td>THE</td><td> 13</td><td> -0,71</td>

<td> 47</td><td> 28</td><td> 193</td><td>BDL27</td><td>arabidopsis | 61 AT 1G68380</td><td>Ç</td><td> 13</td><td> -0,75</td>

<td> 48</td><td> 28</td><td> 193</td><td>BDL27</td><td>arabi dopsis | 61 AT 1G68380</td><td>AND</td><td> 11</td><td> 0,71</td>

<td> 49</td><td> 28</td><td> 193</td><td>BDL27</td><td>arabidopsis | 6 j AT 1G68380</td><td>AND</td><td> 14</td><td> 0,74</td>

<td> 50</td><td> 29</td><td> 194</td><td>BDL28</td><td>rabbi dopsi sj 6 AT 1G09380</td><td>Ç</td><td> 11</td><td> 0,87</td>

<td> 51</td><td> 29</td><td> 194</td><td>BDL28</td><td>arabidopsi s | 6 AT 1G09380</td><td>Ç</td><td> 12</td><td> -0,79</td>

<td> 52</td><td> 29</td><td> 194</td><td>BDL28</td><td>arabidopsis | 6 AT 1G09380</td><td>Ç</td><td> 14</td><td> 0,73</td>

<td> 53</td><td> 29</td><td> 194</td><td>BDL28</td><td>arabidopsis | 6 | AT 1G09380</td><td>AND</td><td> 15</td><td> 0,83</td>

<td> 54</td><td> 29</td><td> 194</td><td>BDL28</td><td>arabi dopsis | 6 j AT 1G09380</td><td>AND</td><td> 16</td><td> 0,8</td>

<td> 55</td><td> 30</td><td> 195</td><td>BDL29</td><td>arabidopsis | 61 AT 1G60970</td><td>B</td><td> 9</td><td> -0,74</td>

<td> 56</td><td> 30</td><td> 195</td><td>BDL29</td><td>arabidopsi s | 61 AT 1G60970</td><td>Ç</td><td> 11</td><td> 0,76</td>

<td> 57</td><td> 30</td><td> 195</td><td>BDL29</td><td>arabidopsi s | 61 AT 1G60970</td><td>D</td><td> 12</td><td> 0,87</td>

<td> 58</td><td> 30</td><td> 195</td><td>BDL29</td><td>arabidopsi s | 61 AT 1G60970</td><td>D</td><td> 15</td><td> 0,88</td>

<td> 59</td><td> 30</td><td> 195</td><td>BDL29</td><td>arabidopsis | 6 | AT 1G60970</td><td>D</td><td> 16</td><td> 0,93</td>

70/119

<td></td><td>SEQ ID In Nucleotide:</td><td>SEQ ID In Polypeptide:</td><td>Gene Name</td><td>Name Group</td><td>Gr. Exp.</td><td>Vector Corr.</td><td>R</td>

<td colspan="8">continuation of table 7</td>

<td> 60</td><td> 30</td><td> 195</td><td>BDL29</td><td>arabidopsis | 61 AT 1G60970</td><td>AND</td><td> 11</td><td> 0,8</td>

<td> 61</td><td> 32</td><td> 197</td><td>BDL31</td><td>arabidopsis | 6 | AT2G28490</td><td>THE</td><td> 11</td><td> 0,85</td>

<td> 62</td><td> 32</td><td> 197</td><td>BDL31</td><td>arabidopsis | 6 | AT2G28490</td><td>THE</td><td> 12</td><td> -0,74</td>

<td> 63</td><td> 32</td><td> 197</td><td>BDL31</td><td>arabidopsis | 6 | AT2G28490</td><td>THE</td><td> 14</td><td> 0,71</td>

<td> 64</td><td> 35</td><td> 200</td><td>BDL166</td><td>arabi dopsi s | 6 j AT 1G71691</td><td>D</td><td> 12</td><td> 0,78</td>

<td> 65</td><td> 35</td><td> 200</td><td>BDL166</td><td>arabidopsi s | 6 | AT 1G71691</td><td>D</td><td> 17</td><td> 0,72</td>

<td> 66</td><td> 36</td><td> 201</td><td>Unnamed BDL 330</td><td>arabidopsi s | 61 AT 1G73220</td><td>B</td><td> 6</td><td> 0,8</td>

<td> 67</td><td> 36</td><td> 201</td><td>Unnamed BDL 330</td><td>arabidopsis | 6] AT 1G73220</td><td>Ç</td><td> 12</td><td> -0,78</td>

<td> 68</td><td> 36</td><td> 201</td><td>Unnamed BDL 330</td><td>rabbi dopsi sj 6 j AT 1G73220</td><td>Ç</td><td> 17</td><td> -0,77</td>

<td> 69</td><td> 36</td><td> 201</td><td>Unnamed BDL 330</td><td>rabbi dopsi s 161 AT 1G73220</td><td>D</td><td> 17</td><td> -0,76</td>

<td> 70</td><td> 37</td><td> 202</td><td>Unnamed BDL 331</td><td>arabi dopsi s | 6 JAT5G01790</td><td>B</td><td> 5</td><td> 0,85</td>

<td> 71</td><td> 37</td><td> 202</td><td>Unnamed BDL 331</td><td>arabidopsis | 6 | AT5G01790</td><td>AND</td><td> 14</td><td> 0,72</td>

<td> 72</td><td> 38</td><td> 203</td><td>Unnamed BDL 333</td><td>arabidopsis | 61 AT 1G71120</td><td>B</td><td> 12</td><td> -0,77</td>

<td> 73</td><td> 38</td><td> 203</td><td>Unnamed BDL 333</td><td>arabidopsis | 61 AT 1G71120</td><td>B</td><td> 14</td><td> 0,77</td>

<td> 74</td><td> 38</td><td> 203</td><td>Unnamed BDL 333</td><td>arabidopsis | 61 AT 1G71120</td><td>AND</td><td> 11</td><td> 0,82</td>

<td> 75</td><td> 38</td><td> 203</td><td>BDLjjnnamed 333</td><td>arabidopsis | 61 AT 1G71120</td><td>AND</td><td> 14</td><td> 0,88</td>

<td> 76</td><td> 39</td><td> 204</td><td>Unnamed BDL 334</td><td>arabidopsis | 6 | AT5G38170</td><td>D</td><td> 15</td><td> 0,82</td>

<td> 77</td><td> 39</td><td> 204</td><td>Unnamed BDL 334</td><td>arabidopsis | 6 | AT5G38170</td><td>D</td><td> 16</td><td> 0,81</td>

<td> 78</td><td> 39</td><td> 204</td><td>Unnamed BDL 334</td><td>arabidopsis | 6 | AT5G38170</td><td>AND</td><td> 11</td><td> 0,87</td>

<td> 79</td><td> 39</td><td> 204</td><td>Unnamed BDL 334</td><td>arabidopsis | 6 | AT5G38170</td><td>AND</td><td> 12</td><td> -0,75</td>

<td> 80</td><td> 39</td><td> 204</td><td>Unnamed BDL 334</td><td>arabidopsis | 6 | AT5G38170</td><td>AND</td><td> 14</td><td> 0,79</td>

<td> 81</td><td> 40</td><td> 205</td><td>Unnamed BDL 335</td><td>arabidopsis | 6 | AT3G25160</td><td>THE</td><td> 1</td><td> -0,89</td>

<td> 82</td><td> 40</td><td> 205</td><td>Unnamed BDL 335</td><td>arabidopsis | 6 | AT3G25160</td><td>THE</td><td> 2</td><td> -0,76</td>

<td> 83</td><td> 40</td><td> 205</td><td>Unnamed BDL 335</td><td>arabidopsis | 6 | AT3G25160</td><td>AND</td><td> 11</td><td> 0,71</td>

<td> 84</td><td> 42</td><td> 207</td><td>Unnamed BDL 337</td><td>arabidopsis | 6 | AT2G22620</td><td>THE</td><td> 13</td><td> -0,76</td>

<td> 85</td><td> 42</td><td> 207</td><td>Unnamed BDL 337</td><td>arabidopsis | 6 | AT2G22620</td><td>AND</td><td> 15</td><td> 0,86</td>

<td> 86</td><td> 42</td><td> 207</td><td>Unnamed BDL 337</td><td>arabidopsis | 6 | AT2G22620</td><td>AND</td><td> 16</td><td> 0,79</td>

<td> 87</td><td> 43</td><td> 208</td><td>Unnamed BDL 339</td><td>arabidopsisJ6) AT3G26480</td><td>THE</td><td> 11</td><td> 0,84</td>

<td> 88</td><td> 43</td><td> 208</td><td>Unnamed BDL 339</td><td>arabidopsis | 6 | AT3G26480</td><td>THE</td><td> 14</td><td> 0,73</td>

<td> 89</td><td> 43</td><td> 208</td><td>Unnamed BDL 339</td><td>arabidopsis | 6 | AT3G26480</td><td>Ç</td><td> 11</td><td> 0,76</td>

<td> 90</td><td> 43</td><td> 208</td><td>Unnamed BDL 339</td><td>arabidopsis | 6 | AT3G26480</td><td>Ç</td><td> 14</td><td> 0,88</td>

<td> 91</td><td> 44</td><td> 209</td><td>Unnamed 340 BDL</td><td>arabidopsis | 61 AT 1G64660</td><td>THE</td><td> 1</td><td> 0,83</td>

<td> 92</td><td> 44</td><td> 209</td><td>Unnamed 340 BDL</td><td>arabidopsis | 61 AT 1G64660</td><td>THE</td><td> 2</td><td> 0,7</td>

<td> 93</td><td> 46</td><td> 211</td><td>Unnamed BDL 341</td><td>arabidopsis) 6 | AT5G52330</td><td>AND</td><td> 17</td><td> 0,85</td>

<td> 94</td><td> 49</td><td> 214</td><td>Unnamed BDL 343</td><td>arabidopsis | 6 | AT5G64080</td><td>Ç</td><td> 12</td><td> 0,74</td>

<td> 95</td><td> 49</td><td> 214</td><td>Unnamed BDL 343</td><td>arabidopsis | 6 | AT5G64080</td><td>Ç</td><td> 16</td><td> 0,77</td>

<td> 96</td><td> 50</td><td> 215</td><td>Unnamed BDL 344</td><td>arabidopsis | 6 | AT2G43060</td><td>B</td><td> 11</td><td> 0,89</td>

<td> 97</td><td> 50</td><td> 215</td><td>Unnamed BDL 344</td><td>arabidopsis | 6 | AT2G43060</td><td>B</td><td> 12</td><td> -0,73</td>

<td> 98</td><td> 50</td><td> 215</td><td>Unnamed BDL 344</td><td>arabidopsis | 6 | AT2G43060</td><td>B</td><td> 18</td><td> -0,81</td>

<td> 99</td><td> 50</td><td> 215</td><td>Unnamed BDL 344</td><td>arabidopsis | 6 | AT2G43060</td><td>AND</td><td> 15</td><td> 0,8</td>

<td> 100</td><td> 52</td><td> 217</td><td>Unnamed BDL 346</td><td>arabidopsis | 6 | AT2G41340</td><td>THE</td><td> 13</td><td> -0,72</td>

<td> 101</td><td> 52</td><td> 217</td><td>Unnamed BDL 346</td><td>arabidopsis | 6 | AT2G41340</td><td>B</td><td> 5</td><td> 0,72</td>

<td> 102</td><td> 52</td><td> 217</td><td>Unnamed BDL 346</td><td>arabidopsis | 6 | AT2G41340</td><td>B</td><td> 8</td><td> 0,81</td>

<td> 103</td><td> 53</td><td> 218</td><td>Unnamed BDL 347</td><td>arabidopsis | 6 | AT5G03450</td><td>THE</td><td> 3</td><td> 0,76</td>

<td> 104</td><td> 53</td><td> 218</td><td>Unnamed BDL 347</td><td>arabidopsis | 6 | AT5G03450</td><td>THE</td><td> 5</td><td> 0,74</td>

<td> 105</td><td> 53</td><td> 218</td><td>Unnamed BDL 347</td><td>arabidopsis | 6 | AT5G03450</td><td>THE</td><td> 15</td><td> 0,74</td>

<td> 106</td><td> 53</td><td> 218</td><td>Unnamed BDL 347</td><td>arabidopsis | 6 | AT5G03450</td><td>D</td><td> 15</td><td> 0,78</td>

<td> 107</td><td> 53</td><td> 218</td><td>Unnamed BDL 347</td><td>arabidopsis | 6 | AT5G03450</td><td>D</td><td> 16</td><td> 0,82</td>

<td> 108</td><td> 55</td><td> 220</td><td>Unnamed BDL 349</td><td>arabidopsis | 6 | AT4G33670</td><td>THE</td><td> 5</td><td> 0,74</td>

<td> 109</td><td> 55</td><td> 220</td><td>Unnamed BDL 349</td><td>arabidopsis | 6 | AT4G33670</td><td>THE</td><td> 15</td><td> 0,78</td>

<td> 110</td><td> 55</td><td> 220</td><td>Unnamed BDL 349</td><td>arabidopsis | 6 | AT4G33670</td><td>THE</td><td> 16</td><td> 0,73</td>

<td> 111</td><td> 55</td><td> 220</td><td>Unnamed BDL 349</td><td>arabidopsis | 6 | AT4G33670</td><td>B</td><td> 5</td><td> 0,86</td>

<td> 112</td><td> 56</td><td> 221</td><td>Unnamed BDL 350</td><td>arabidopsis | 6 | AT5G04500</td><td>THE</td><td> 13</td><td> -0,72</td>

<td> 113</td><td> 56</td><td> 221</td><td>Unnamed BDL 350</td><td>arabidopsis | 6 | AT5G04500</td><td>Ç</td><td> 15</td><td> 0,85</td>

71/119

<td></td><td>SEQ ID In Nucleotide:</td><td>SEQ ID In Polypeptide:</td><td>Gene Name</td><td>Name Group</td><td>Gr. Exp.</td><td>t / efor Corr.</td><td>R</td>

<td colspan="8">continuation of table 7</td>

<td> 114</td><td> 56</td><td> 221</td><td>BDLjjnnamed 350</td><td>arabidopsis | 6 | AT5G04500</td><td>Ç</td><td> 16</td><td> 0,83</td>

<td> 115</td><td> 56</td><td> 221</td><td>Unnamed BDL 350</td><td>arabidopsís | 6 | AT5G04500</td><td>AND</td><td> 11</td><td> -0,72</td>

<td> 116</td><td> 56</td><td> 221</td><td>Unnamed BDL 350</td><td>arabidopsis | 6 | AT5G04500</td><td>AND</td><td> 12</td><td> 0,73</td>

<td> 117</td><td> 56</td><td> 221</td><td>Unnamed BDL 350</td><td>arabidopsis | 6 | AT5G04500</td><td>AND</td><td> 17</td><td> 0,74</td>

<td> 118</td><td> 57</td><td> 222</td><td>Unnamed BDL 351</td><td>arabidopsis | 6 | AT 1G27120</td><td>B</td><td> 7</td><td> 0,78</td>

<td> 119</td><td> 57</td><td> 222</td><td>Unnamed BDL 351</td><td>arabidopsis j6 j AT 1G27120</td><td>B</td><td> 13</td><td> 0,74</td>

<td> 120</td><td> 57</td><td> 222</td><td>Unnamed BDL 351</td><td>arabidopsis | 61 AT 1G27120</td><td>Ç</td><td> 15</td><td> 0,79</td>

<td> 121</td><td> 57</td><td> 222</td><td>Unnamed BDL 351</td><td>arabidopsís | 6 | AT 1G27120</td><td>Ç</td><td> 16</td><td> 0,82</td>

<td> 122</td><td> 57</td><td> 222</td><td>Unnamed BDL 351</td><td>arabidopsis | 6 | AT 1G27120</td><td>D</td><td> 17</td><td> 0,74</td>

<td> 123</td><td> 58</td><td> 223</td><td>Unnamed BDL 352</td><td>arabidopsis | 6 | AT5G01820</td><td>B</td><td> 4</td><td> -0,71</td>

<td> 124</td><td> 58</td><td> 223</td><td>Unnamed BDL 352</td><td>arabidopsis | 6 | AT5G01820</td><td>B</td><td> 8</td><td> -0,7</td>

<td> 125</td><td> 58</td><td> 223</td><td>Unnamed BDL 352</td><td>arabidopsis | 6 | AT5G01820</td><td>Ç</td><td> 15</td><td> -0,74</td>

<td> 126</td><td> 58</td><td> 223</td><td>Unnamed BDL 352</td><td>arabidopsis | 6 | AT5G01820</td><td>AND</td><td> 16</td><td> 0,71</td>

<td> 127</td><td> 60</td><td> 225</td><td>Unnamed BDL 354</td><td>arabidopsis | 6 | AT3G16490</td><td>Ç</td><td> 16</td><td> 0,73</td>

<td> 128</td><td> 61</td><td> 226</td><td>Unnamed BDL 355</td><td>arabidopsis | 6 | AT5G23050</td><td>D</td><td> 12</td><td> 0,72</td>

<td> 129</td><td> 62</td><td> 227</td><td>Unnamed BDL 356</td><td>arabidopsis | 6 | AT4G16050</td><td>AND</td><td> 11</td><td> 0,95</td>

<td> 130</td><td> 62</td><td> 227</td><td>Unnamed BDL 356</td><td>arabidopsis | 6 | AT4G16050</td><td>AND</td><td> 14</td><td> 0,77</td>

<td> 131</td><td> 63</td><td> 228</td><td>Unnamed BDL 357</td><td>arabidopsis | 6 | AT1 G44760</td><td>B</td><td> 15</td><td> 0,73</td>

<td> 132</td><td> 63</td><td> 228</td><td>Unnamed BDL 357</td><td>rabbi dopsi s 161 AT 1G44760</td><td>B</td><td> 16</td><td> 0,7</td>

<td> 133</td><td> 64</td><td> 229</td><td>Unnamed BDL 358</td><td>arabidopsis | 6 | AT3G01570</td><td>Ç</td><td> 16</td><td> 0,71</td>

<td> 134</td><td> 66</td><td> 231</td><td>Unnamed BDL 362</td><td>arabidopsis | 6 | AT2G25940</td><td>B</td><td> 15</td><td> 0,83</td>

<td> 135</td><td> 66</td><td> 231</td><td>Unnamed BDL 362</td><td>arabidopsis | 6 | AT2G25940</td><td>B</td><td> 16</td><td> 0,84</td>

<td> 136</td><td> 67</td><td> 232</td><td>Unnamed BDL 364</td><td>arabidopsis | 61 AT 1G04660</td><td>D</td><td> 12</td><td> 0,88</td>

<td> 137</td><td> 67</td><td> 232</td><td>Unnamed BDL 364</td><td>arabidopsis [61 AT 1G04660</td><td>D</td><td> 15</td><td> 0,84</td>

<td> 138</td><td> 67</td><td> 232</td><td>Unnamed BDL 364</td><td>arabidopsis | 61 AT 1G04660</td><td>D</td><td> 16</td><td> 0,91</td>

<td> 139</td><td> 68</td><td> 233</td><td>Unnamed 365 BDL</td><td>arabidopsís | 6 | AT 1G05160</td><td>Ç</td><td> 16</td><td> 0,71</td>

<td> 140</td><td> 68</td><td> 233</td><td>Unnamed 365 BDL</td><td>arabidopsis | 6 | AT 1G05160</td><td>D</td><td> 15</td><td> 0,72</td>

<td> 141</td><td> 68</td><td> 233</td><td>Unnamed 365 BDL</td><td>a rab i dopsi s] 6 j AT 1G05160</td><td>D</td><td> 16</td><td> 0,72</td>

<td> 142</td><td> 70</td><td> 235</td><td>Unnamed BDL 367</td><td>arabidopsis | 6 | AT1 G19900</td><td>B</td><td> 6</td><td> 0,8</td>

<td> 143</td><td> 70</td><td> 235</td><td>Unnamed BDL 367</td><td>arabidopsis | 6 | AT1 G19900</td><td>Ç</td><td> 12</td><td> -0,86</td>

<td> 144</td><td> 70</td><td> 235</td><td>Unnamed BDL 367</td><td>arabi dopsis | 61 AT 1G19900</td><td>Ç</td><td> 14</td><td> 0,73</td>

<td> 145</td><td> 70</td><td> 235</td><td>Unnamed BDL 367</td><td>arabi dopsis | 61 AT 1G19900</td><td>AND</td><td> 15</td><td> 0,71</td>

<td> 146</td><td> 71</td><td> 236</td><td>Unnamed BDL 368</td><td>arabidopsis [61 AT 1G23200</td><td>D</td><td> 13</td><td> -0,78</td>

<td> 147</td><td> 71</td><td> 236</td><td>Unnamed BDL 368</td><td>arabidopsisf 6 | AT 1G23200</td><td>AND</td><td> 17</td><td> -0,73</td>

<td> 148</td><td> 72</td><td> 237</td><td>Unnamed BDL 369</td><td>arabidopsis | 61 AT 1G26680</td><td>THE</td><td> 1</td><td> 0,84</td>

<td> 149</td><td> 72</td><td> 237</td><td>BDL.unnamed.369</td><td>arabidopsis | 61 AT 1G26680</td><td>THE</td><td> 2</td><td> 0,75</td>

<td> 150</td><td> 73</td><td> 238</td><td>Unnamed BDL 370</td><td>arabidopsis | 61 AT 1G28590</td><td>AND</td><td> 11</td><td> 0,9</td>

<td> 151</td><td> 73</td><td> 238</td><td>Unnamed BDL 370</td><td>arabidopsis | 61 AT 1G28590</td><td>AND</td><td> 12</td><td> -0,72</td>

<td> 152</td><td> 74</td><td> 239</td><td>Unnamed BDL 371</td><td>Rabbi Dopsi s 161 AT 1G48910</td><td>B</td><td> 12</td><td> 0,72</td>

<td> 153</td><td> 74</td><td> 239</td><td>Unnamed BDL 371</td><td>arabi dopsi sj 6 j AT 1G48910</td><td>B</td><td> 15</td><td> 0,79</td>

<td> 154</td><td> 74</td><td> 239</td><td>Unnamed BDL 371</td><td>arabi dopsis | 61 AT 1G48910</td><td>B</td><td> 16</td><td> 0,86</td>

<td> 155</td><td> 74</td><td> 239</td><td>Unnamed BDL 371</td><td>arabidopsis | 6 | AT1 G48910</td><td>Ç</td><td> 17</td><td> 0,79</td>

<td> 156</td><td> 79</td><td> 244</td><td>Unnamed BDL 374</td><td>arabi dopsi s [61 AT 1G62610</td><td>D</td><td> 15</td><td> -0,74</td>

<td> 157</td><td> 80</td><td> 245</td><td>Unnamed BDL 375</td><td>arabidopsis | 61 AT 1G76290</td><td>B</td><td> 16</td><td> 0,72</td>

<td> 158</td><td> 80</td><td> 245</td><td>Unnamed BDL 375</td><td>arabidopsis | 61 AT 1G76290</td><td>Ç</td><td> 17</td><td> 0,77</td>

<td> 159</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td><td>arabidopsis, 6 | AT 1G68470</td><td>B</td><td> 4</td><td> 0,76</td>

<td> 160</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td><td>arabidopsi s | 61 AT 1G68470</td><td>B</td><td> 5</td><td> 0,77</td>

<td> 161</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td><td>arabidopsis | 6 j AT 1G68470</td><td>B</td><td> 8</td><td> 0,96</td>

<td> 162</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td><td>arabidopsis | 6 j AT 1G68470</td><td>B</td><td> 10</td><td> 0,89</td>

<td> 163</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td><td>arabidopsis | 61 AT 1G68470</td><td>Ç</td><td> 15</td><td> 0,83</td>

<td> 164</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td><td>arabidopsis | 61 AT 1G68470</td><td>Ç</td><td> 16</td><td> 0,74</td>

<td> 165</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td><td>arabidopsis J6 | AT 1G68470</td><td>D</td><td> 13</td><td> -0,81</td>

<td> 166</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td><td>arabi dopsi s | 61 AT 1G68470</td><td>D</td><td> 14</td><td> -0,82</td>

<td> 167</td><td> 82</td><td> 247</td><td>Unnamed BDL 377</td><td>arabi dopsis | 61 AT 1G71250</td><td>AND</td><td> 11</td><td> 0,72</td>

72/119

<td></td><td>SEQ ID In Nucleotide:</td><td>SEQ ID In Polypeptide:</td><td>Gene Name</td><td>Name Group</td><td>Gr. Exp.</td><td>Vector Corr.</td><td>R</td>

<td colspan="8">continuation of table 7</td>

<td> 168</td><td> 82</td><td> 247</td><td>Unnamed BDL 377</td><td>arabi dopsi s 161 AT 1G71250</td><td>AND</td><td> 14</td><td> 0,8</td>

<td> 169</td><td> 82</td><td> 247</td><td>Unnamed BDL 377</td><td>arabidopsis | 61 AT 1G71250</td><td>AND</td><td> 17</td><td> -0,7</td>

<td> 170</td><td> 83</td><td> 248</td><td>Unnamed BDL 379</td><td>arabidopsis | 6 | AT3G58200</td><td>B</td><td> 6</td><td> 0,75</td>

<td> 171</td><td> 84</td><td> 249</td><td>Unnamed BDL 380</td><td>arabidopsis | 6 j AT 1G78500</td><td>THE</td><td> 1</td><td> -0,74</td>

<td> 172</td><td> 84</td><td> 249</td><td>Unnamed BDL 380</td><td>arabidopsis | 61 AT 1G78500</td><td>B</td><td> 7</td><td> 0,75</td>

<td> 173</td><td> 84</td><td> 249</td><td>Unnamed BDL 380</td><td>arabidopsis | 61 AT 1G78500</td><td>B</td><td> 18</td><td> 0,84</td>

<td> 174</td><td> 85</td><td> 250</td><td>Unnamed BDL 381</td><td>arabidopsis | 6 | AT2G 14690</td><td>AND</td><td> 15</td><td> -0,72</td>

<td> 175</td><td> 88</td><td> 253</td><td>Unnamed BDL 384</td><td>arabidopsis | 6 | AT2G23510</td><td>B</td><td> 12</td><td> 0,74</td>

<td> 176</td><td> 88</td><td> 253</td><td>Unnamed BDL 384</td><td>the rabbi dopsi s 16 | AT2G23510</td><td>B</td><td> 15</td><td> 0,71</td>

<td> 177</td><td> 88</td><td> 253</td><td>Unnamed BDL 384</td><td>arabidopsis | 6 | AT2G23510</td><td>B</td><td> 16</td><td> 0,8</td>

<td> 178</td><td> 89</td><td> 254</td><td>Unnamed BDL 385</td><td>arabidopsis | 6 | AT2G26070</td><td>B</td><td> 15</td><td> 0,91</td>

<td> 179</td><td> 89</td><td> 254</td><td>Unnamed BDL 385</td><td>arabidopsis | 6 | AT2G26070</td><td>B</td><td> 16</td><td> 0,88</td>

<td> 180</td><td> 90</td><td> 255</td><td>Unnamed 386 BDL</td><td>arabidopsis [6 | AT2G28650</td><td>D</td><td> 13</td><td> -0,93</td>

<td> 181</td><td> 90</td><td> 255</td><td>Unnamed 386 BDL</td><td>arabidopsis | 6 | AT2G28650</td><td>D</td><td> 14</td><td> -0,87</td>

<td> 182</td><td> 90</td><td> 255</td><td>Unnamed 386 BDL</td><td>arabidopsis | 6 | AT2G28650</td><td>AND</td><td> 15</td><td> 0,7</td>

<td> 183</td><td> 91</td><td> 256</td><td>Unnamed BDL 388</td><td>arabidopsis | 6 | AT2G41290</td><td>AND</td><td> 11</td><td> 0,78</td>

<td> 184</td><td> 93</td><td> 258</td><td>Unnamed BDL 390</td><td>arabidopsis | 6 | AT2G47750</td><td>B</td><td> 8</td><td> 0,79</td>

<td> 185</td><td> 93</td><td> 258</td><td>Unnamed BDL 390</td><td>arabidopsis | 6 | AT2G47750</td><td>D</td><td> 14</td><td> 0,84</td>

<td> 186</td><td> 93</td><td> 258</td><td>B DL unnamed 390</td><td>arabidopsis | 6 | AT2G47750</td><td>AND</td><td> 14</td><td> 0,71</td>

<td> 187</td><td> 93</td><td> 258</td><td>Unnamed BDL 390</td><td>arabidopsis | 6 | AT2G47750</td><td>AND</td><td> 17</td><td> -0,79</td>

<td> 188</td><td> 94</td><td> 259</td><td>Unnamed BDL 391</td><td>arabidopsis | 6 | AT3G03230</td><td>D</td><td> 15</td><td> 0,96</td>

<td> 189</td><td> 94</td><td> 259</td><td>Unnamed BDL 391</td><td>arabidopsis | 6 | AT3G03230</td><td>D</td><td> 16</td><td> 0,95</td>

<td> 190</td><td> 94</td><td> 259</td><td>Unnamed BDL 391</td><td>arabidopsis | 6 | AT3G03230</td><td>AND</td><td> 14</td><td> -0,73</td>

<td> 191</td><td> 95</td><td> 260</td><td>Unnamed BDL 392</td><td>arabidopsis | 6 | AT3G04200</td><td>B</td><td> 7</td><td> 0,85</td>

<td> 192</td><td> 95</td><td> 260</td><td>Unnamed BDL 392</td><td>arabidopsis | 6 | AT3G04200</td><td>B</td><td> 9</td><td> -0,94</td>

<td> 193</td><td> 95</td><td> 260</td><td>Unnamed BDL 392</td><td>arabidopsis | 6 | AT3G04200</td><td>B</td><td> 13</td><td> 0,78</td>

<td> 194</td><td> 98</td><td> 263</td><td>Unnamed BDL 395</td><td>arabidopsis | 6 | AT3G49380</td><td>B</td><td> 4</td><td> -0,78</td>

<td> 195</td><td> 98</td><td> 263</td><td>Unnamed BDL 395</td><td>arabidopsis | 6 | AT3G49380</td><td>B</td><td> 9</td><td> -0,77</td>

<td> 196</td><td> 98</td><td> 263</td><td>Unnamed BDL 395</td><td>arabidopsis | 6 | AT3G49380</td><td>B</td><td> 10</td><td> -0,73</td>

<td> 197</td><td> 98</td><td> 263</td><td>Unnamed BDL 395</td><td>arabidopsis | 6 | AT3G49380</td><td>B</td><td> 17</td><td> 0,88</td>

<td> 198</td><td> 98</td><td> 263</td><td>Unnamed BDL 395</td><td>arabidopsis | 6 | AT3G49380</td><td>Ç</td><td> 12</td><td> 0,71</td>

<td> 199</td><td> 98</td><td> 263</td><td>Unnamed BDL 395</td><td>arabidopsis | 6 | AT3G49380</td><td>Ç</td><td> 15</td><td> 0,75</td>

<td> 200</td><td> 98</td><td> 263</td><td>Unnamed BDL 395</td><td>arabidopsis | 6 | AT3G49380</td><td>Ç</td><td> 16</td><td> 0,82</td>

<td> 201</td><td> 98</td><td> 263</td><td>Unnamed BDL 395</td><td>arabidopsis | 6 | AT3G49380</td><td>AND</td><td> 11</td><td> 0,82</td>

<td> 202</td><td> 104</td><td> 269</td><td>Unnamed 400 BDL</td><td>arabidopsis | 6] AT4G33600</td><td>B</td><td> 12</td><td> 0,8</td>

<td> 203</td><td> 104</td><td> 269</td><td>Unnamed 400 BDL</td><td>arabidopsis | 6 | AT4G33600</td><td>AND</td><td> 11</td><td> 0,84</td>

<td> 204</td><td> 104</td><td> 269</td><td>Unnamed 400 BDL</td><td>arabidopsis | 6 | AT4G33600</td><td>AND</td><td> 14</td><td> 0,8</td>

<td> 205</td><td> 106</td><td> 271</td><td>BDL unnamed 402</td><td>arabidopsis | 6 | AT5G08460</td><td>D</td><td> 15</td><td> 0,77</td>

<td> 205</td><td> 106</td><td> 271</td><td>BDL unnamed 402</td><td>arabidopsis | 6 | AT5G08460</td><td>D</td><td> 16</td><td> 0,78</td>

<td> 207</td><td> 107</td><td> 272</td><td>BDL unnamed 403</td><td>arabidopsis | 6 | AT2G34700</td><td>Ç</td><td> 11</td><td> 0,89</td>

<td> 208</td><td> 107</td><td> 272</td><td>BDL unnamed 403</td><td>arabidopsis | 6 | AT2G34700</td><td>Ç</td><td> 12</td><td> -0,71</td>

<td> 209</td><td> 108</td><td> 273</td><td>Unnamed 404 BDL</td><td>arabidopsis | 6 | AT5G15740</td><td>B</td><td> 5</td><td> 0,74</td>

<td> 210</td><td> 108</td><td> 273</td><td>Unnamed 404 BDL</td><td>arabidopsis | 6 | AT5G15740</td><td>B</td><td> 8</td><td> 0,71</td>

<td> 211</td><td> 108</td><td> 273</td><td>Unnamed 404 BDL</td><td>the rabbi dopsi s 16 | AT5G 15740</td><td>AND</td><td> 15</td><td> 0,8</td>

<td> 212</td><td> 109</td><td> 274</td><td>Unnamed BDL 405</td><td>arabidopsis | 6 | AT5G16230</td><td>THE</td><td> 1</td><td> -0,75</td>

<td> 213</td><td> 109</td><td> 274</td><td>Unnamed BDL 405</td><td>a rabidopsi s [61AT5G16230</td><td>B</td><td> 8</td><td> 0,83</td>

<td> 214</td><td> 109</td><td> 274</td><td>Unnamed BDL 405</td><td>Rabbi Dopsi s 161AT5 G16230</td><td>Ç</td><td> 12</td><td> -0,8</td>

<td> 215</td><td> 109</td><td> 274</td><td>Unnamed BDL 405</td><td>arabidopsis | 6 | AT5G16230</td><td>D</td><td> 12</td><td> 0,73</td>

<td> 216</td><td> 109</td><td> 274</td><td>Unnamed BDL 405</td><td>arabidopsis | 6 | AT5G16230</td><td>D</td><td> 16</td><td> 0,74</td>

<td> 217</td><td> 110</td><td> 275</td><td>Unnamed BDL 406</td><td>arabidops is | 6 | AT5G18290</td><td>AND</td><td> 11</td><td> -0,76</td>

<td> 218</td><td> 112</td><td> 277</td><td>Unnamed BDL 408</td><td>a rabidopsis | 6 j AT5G39130</td><td>B</td><td> 12</td><td> 0,79</td>

<td> 219</td><td> 112</td><td> 277</td><td>Unnamed BDL 408</td><td>rabbi dopsi s 161AT5G39130</td><td>B</td><td> 13</td><td> 0,76</td>

<td> 220</td><td> 112</td><td> 277</td><td>Unnamed BDL 408</td><td>arabi dopsi s [6 | AT5G39130</td><td>B</td><td> 16</td><td> 0,79</td>

<td> 221</td><td> 112</td><td> 277</td><td>Unnamed BDL 408</td><td>arabidopsis | 6 | AT5G39130</td><td>Ç</td><td> 14</td><td> 0,79</td>

73/119

<td></td><td>SEQ ID In Nucleofideo:</td><td>SEQ ID In Polypeptide:</td><td>Gene Name</td><td>Name Group</td><td>Gr. Exp.</td><td>Vector Corr.</td><td>R</td>

<td colspan="8">continuation of table 7</td>

<td> 222</td><td> 112</td><td> 277</td><td>Unnamed BDL 408</td><td>arabi dopsi s 161AT5G39130</td><td>D</td><td> 14</td><td> 0,79</td>

<td> 223</td><td> 112</td><td> 277</td><td>Unnamed BDL 408</td><td>arabi dopsi sj 61AT5G39130</td><td>AND</td><td> 12</td><td> 0,73</td>

<td> 224</td><td> 114</td><td> 279</td><td>Unnamed BDL 409</td><td>arabidopsis | 6 | AT5G39160</td><td>B</td><td> 12</td><td> 0,79</td>

<td> 225</td><td> 114</td><td> 279</td><td>Unnamed BDL 409</td><td>arabidopsis | 6 | AT5G39160</td><td>B</td><td> 13</td><td> 0,76</td>

<td> 226</td><td> 114</td><td> 279</td><td>Unnamed BDL 409</td><td>arabidopsis | 6 | AT5G39160</td><td>B</td><td> 16</td><td> 0,79</td>

<td> 227</td><td> 114</td><td> 279</td><td>Unnamed BDL 409</td><td>arabidopsis | 6 | AT5G39160</td><td>Ç</td><td> 14</td><td> 0,79</td>

<td> 228</td><td> 114</td><td> 279</td><td>Unnamed BDL 409</td><td>arabidopsis | 6 | AT5G39160</td><td>D</td><td> 14</td><td> 0,79</td>

<td> 229</td><td> 114</td><td> 279</td><td>Unnamed BDL 409</td><td>arabidopsis | 6 | AT5G39160</td><td>AND</td><td> 12</td><td> 0,73</td>

<td> 230</td><td> 115</td><td> 280</td><td>Unnamed BDL 410</td><td>arabidopsis | 6 | AT5G39190</td><td>B</td><td> 12</td><td> 0,79</td>

<td> 231</td><td> 115</td><td> 280</td><td>Unnamed BDL 410</td><td>arabidopsis | 6 | AT5G39190</td><td>B</td><td> 13</td><td> 0,76</td>

<td> 232</td><td> 115</td><td> 280</td><td>Unnamed BDL 410</td><td>arabidopsis | 6 | AT5G39190</td><td>B</td><td> 16</td><td> 0,79</td>

<td> 233</td><td> 115</td><td> 280</td><td>Unnamed BDL 410</td><td>arabidopsís | 6 | AT5G39190</td><td>Ç</td><td> 14</td><td> 0,79</td>

<td> 234</td><td> 115</td><td> 280</td><td>Unnamed BDL 410</td><td>arabidopsis | 6 | AT5G39190</td><td>D</td><td> 14</td><td> 0,79</td>

<td> 235</td><td> 115</td><td> 280</td><td>Unnamed BDL 410</td><td>arabidopsis | 6 | AT5G39190</td><td>AND</td><td> 12</td><td> 0,73</td>

<td> 236</td><td> 116</td><td> 281</td><td>Unnamed BDL 411</td><td>arabidopsis | 6 | AT5G44360</td><td>B</td><td> 10</td><td> -0,74</td>

<td> 237</td><td> 117</td><td> 282</td><td>Unnamed BDL 412</td><td>arabidopsis | 6 | AT5G47670</td><td>AND</td><td> 11</td><td> 0,86</td>

<td> 238</td><td> 117</td><td> 282</td><td>Unnamed BDL 412</td><td>arabidopsís | 6 | AT5G47670</td><td>AND</td><td> 14</td><td> 0,72</td>

<td> 239</td><td> 119</td><td> 284</td><td>Unnamed BDL 414</td><td>arabidopsis | 6 | AT5G56300</td><td>Ç</td><td> 15</td><td> 0,77</td>

<td> 240</td><td> 119</td><td> 284</td><td>Unnamed BDL 414</td><td>arabidopsis | 6 | AT5G56300</td><td>Ç</td><td> 16</td><td> 0,78</td>

<td> 241</td><td> 119</td><td> 284</td><td>Unnamed BDL 414</td><td>arabidopsis | 6 | AT5G56300</td><td>D</td><td> 15</td><td> 0,78</td>

<td> 242</td><td> 119</td><td> 284</td><td>Unnamed BDL 414</td><td>arabidopsis | 6 | AT5G56300</td><td>D</td><td> 16.</td><td> 0,82</td>

<td> 243</td><td> 121</td><td> 286</td><td>Unnamed BDL 418</td><td>arabidopsis | 61 AT 1G28640</td><td>B</td><td> 18</td><td> 0,81</td>

<td> 244</td><td> 122</td><td> 287</td><td>Unnamed BDL 419</td><td>arabidopsis | 6 j AT 1G22990</td><td>AND</td><td> 11</td><td> 0,95</td>

<td> 245</td><td> 122</td><td> 287</td><td>Unnamed BDL 419</td><td>arabidopsi s | 61 AT 1G22990</td><td>AND</td><td> 14</td><td> 0,8</td>

<td> 246</td><td> 123</td><td> 288</td><td>Unnamed BDL 420</td><td>arabidopsis | 61 AT 1G64110</td><td>B</td><td> 6</td><td> 0,78</td>

<td> 247</td><td> 125</td><td> 290</td><td>Unnamed BDL 421</td><td>arabidopsis | 6 j AT 1G04380</td><td>D</td><td> 15</td><td> 0,73</td>

<td> 248</td><td> 126</td><td> 291</td><td>Unnamed BDL 422</td><td>arabidopsis | 61 AT 1G08810</td><td>B</td><td> 8</td><td> 0,8</td>

<td> 249</td><td> 126</td><td> 291</td><td>Unnamed BDL 422</td><td>arabidopsis | 61 AT 1G08810</td><td>D</td><td> 14</td><td> -0,79</td>

<td> 250</td><td> 126</td><td> 291</td><td>Unnamed BDL 422</td><td>arabidopsis | 61 AT 1G08810</td><td>D</td><td> 15</td><td> -0,82</td>

<td> 251</td><td> 126</td><td> 291</td><td>Unnamed BDL 422</td><td>arabidopsis | 61 AT 1G08810</td><td>D</td><td> 16</td><td> -0,82</td>

<td> 252</td><td> 128</td><td> 293</td><td>Unnamed BDL 423</td><td>arabidopsis | 61 AT 1G28170</td><td>B</td><td> 16</td><td> -0,71</td>

<td> 253</td><td> 128</td><td> 293</td><td>Unnamed BDL 423</td><td>arabidopsis | 6 [AT 1G28170</td><td>Ç</td><td> 11</td><td> 0,78</td>

<td> 254</td><td> 128</td><td> 293</td><td>Unnamed BDL 423</td><td>arabidopsis | 61 AT 1G28170</td><td>Ç</td><td> 12</td><td> -0,79</td>

<td> 255</td><td> 128</td><td> 293</td><td>Unnamed BDL 423</td><td>arabidopsis | 61 AT 1G28170</td><td>Ç</td><td> 14</td><td> 0,75</td>

<td> 256</td><td> 130</td><td> 295</td><td>Unnamed BDL 425</td><td>arabidopsis | 6 | AT3G10590</td><td>AND</td><td> 13</td><td> 0,72</td>

<td> 257</td><td> 131</td><td> 296</td><td>Unnamed BDL 426</td><td>arabidopsis | 6 | AT3G58740</td><td>AND</td><td> 14</td><td> 0,75</td>

<td> 258</td><td> 131</td><td> 296</td><td>Unnamed BDL 426</td><td>arabidopsis | 6 | AT3G58740</td><td>AND</td><td> 17</td><td> -0,72</td>

<td> 259</td><td> 132</td><td> 297</td><td>Unnamed BDL 427</td><td>arabidopsis | 6 | AT4G02360</td><td>THE</td><td> 1</td><td> 0,85</td>

<td> 260</td><td> 132</td><td> 297</td><td>Unnamed BDL 427</td><td>arabidopsis | 6 | AT4G02360</td><td>THE</td><td> 2</td><td> 0,76</td>

<td> 261</td><td> 134</td><td> 299</td><td>Unnamed BDL 429</td><td>arabidopsis | 6 | AT5G07200</td><td>Ç</td><td> 13</td><td> -0,76</td>

<td> 262</td><td> 134</td><td> 299</td><td>Unnamed BDL 429</td><td>arabidopsis | 6 | AT5G07200</td><td>D</td><td> 15</td><td> 0,73</td>

<td> 263</td><td> 134</td><td> 299</td><td>Unnamed BDL 429</td><td>arabidopsrs | 6 | AT5G07200</td><td>D</td><td> 16</td><td> 0,73</td>

<td> 264</td><td> 135</td><td> 300</td><td>Unnamed BDL 430</td><td>arabidopsis | 6 | AT5G22810</td><td>D</td><td> 12</td><td> 0,86</td>

<td> 265</td><td> 135</td><td> 300</td><td>Unnamed BDL 430</td><td>the rabbi dopsi s 161AT5G22810</td><td>D</td><td> 15</td><td> 0,71</td>

<td> 266</td><td> 135</td><td> 300</td><td>Unnamed BDL 430</td><td>arabidopsis | 6 | AT5G22810</td><td>D</td><td> 16</td><td> 0,8</td>

<td> 267</td><td> 136</td><td> 301</td><td>Unnamed BDL 431</td><td>arabidopsis | 6 | AT5G43860</td><td>THE</td><td> 11</td><td> 0,75</td>

<td> 268</td><td> 136</td><td> 301</td><td>Unnamed BDL 431</td><td>arabidopsis | 6 | AT5G43860</td><td>THE</td><td> 13</td><td> -0,77</td>

<td> 269</td><td> 136</td><td> 301</td><td>Unnamed BDL 431</td><td>arabidopsis | 6 | AT5G43860</td><td>Ç</td><td> 11</td><td> 0,72</td>

<td> 270</td><td> 136</td><td> 301</td><td>Unnamed BDL 431</td><td>arabidopsis | 6 | AT5G43860</td><td>Ç</td><td> 17</td><td> -0,7</td>

<td> 271</td><td> 136</td><td> 301</td><td>Unnamed BDL 431</td><td>arabidopsis | 6 | AT5G43860</td><td>D</td><td> 14</td><td> 0,71</td>

<td> 272</td><td> 137</td><td> 302</td><td>Unnamed BDL 432</td><td>arabidopsis | 6 | AT5G57390</td><td>Ç</td><td> 15</td><td> 0,72</td>

<td> 273</td><td> 137</td><td> 302</td><td>Unnamed BDL 432</td><td>arabidopsisj6 | AT5G57390</td><td>Ç</td><td> 16</td><td> 0,76</td>

<td> 274</td><td> 137</td><td> 302</td><td>Unnamed BDL 432</td><td>arabidopsis | 6 | AT5G57390</td><td>D</td><td> 17</td><td> 0,71</td>

<td> 275</td><td> 138</td><td> 303</td><td>Unnamed BDL 433</td><td>arabidopsis | 6 | AT5G62800</td><td>D</td><td> 11</td><td> 0,76</td>

74/119

<td></td><td>SEQ ID In Nucleotide:</td><td>SEQ ID In Polypeptide:</td><td>Gene Name</td><td>Name Group</td><td>Gr. Exp.</td><td>Vector Corr.</td><td>R</td>

<td colspan="8">continuation of table 7</td>

<td> 276</td><td> 138</td><td> 303</td><td>Unnamed BDL 433</td><td>arabidopsis | 6 | AT5G62800</td><td>AND</td><td> 17</td><td> -0,73</td>

<td> 277</td><td> 139</td><td> 304</td><td>Unnamed BDL 435</td><td>arabidopsis | 6 | AT5G52500</td><td>B</td><td> 5</td><td> -0,75</td>

<td> 278</td><td> 139</td><td> 304</td><td>Unnamed BDL 435</td><td>arabidopsis | 6 | AT5G52500</td><td>B</td><td> 8</td><td> -0,73</td>

<td> 279</td><td> 140</td><td> 305</td><td>Unnamed BDL 436</td><td>arabidopsis | 6 | AT5G24600</td><td>THE</td><td> 3</td><td> -0,78</td>

<td> 280</td><td> 143</td><td> 308</td><td>Unnamed BDL 438</td><td>arabidopsis | 61 AT 1G72040</td><td>D</td><td> 13</td><td> 0,71</td>

<td> 281</td><td> 145</td><td> 310</td><td>Unnamed 440 BDL</td><td>arabidopsis | 6 | AT1G50510</td><td>B</td><td> 8</td><td> 0,75</td>

<td> 282</td><td> 146</td><td> 311</td><td>Unnamed BDL 441</td><td>arabidopsis | 6 | AT5G48100</td><td>AND</td><td> 17</td><td> -0,77</td>

<td> 283</td><td> 147</td><td> 312</td><td>Unnamed BDL 442</td><td>arabidopsis | 6 | AT1 G14760</td><td>B</td><td> 6</td><td> 0,83</td>

<td> 284</td><td> 147</td><td> 312</td><td>Unnamed BDL 442</td><td>arabidopsis | 6 | AT1 G14760</td><td>B</td><td> 7</td><td> -0,76</td>

<td> 285</td><td> 147</td><td> 312</td><td>Unnamed BDL 442</td><td>arabidopsis | 6 j AT 1G14760</td><td>B</td><td> 9</td><td> 0,75</td>

<td> 286</td><td> 148</td><td> 313</td><td>Unnamed BDL 443</td><td>arabidopsis | 6 | AT1 G15150</td><td>B</td><td> 11</td><td> 0,9</td>

<td> 287</td><td> 148</td><td> 313</td><td>Unnamed BDL 443</td><td>arabi dopsi s | 6 J AT 1G15150</td><td>AND</td><td> 11</td><td> 0,76</td>

<td> 288</td><td> 149</td><td> 314</td><td>Unnamed BDL 444</td><td>arabi dopsis | 6 j AT 1G20500</td><td>D</td><td> 13</td><td> -0,78</td>

<td> 289</td><td> 150</td><td> 315</td><td>Unnamed BDL 445</td><td>arabidopsi s | 6 j AT 1G56170</td><td>B</td><td> 6</td><td> 0,73</td>

<td> 290</td><td> 150</td><td> 315</td><td>Unnamed BDL 445</td><td>arabidopsis | 61 AT 1G56170</td><td>D</td><td> 15</td><td> 0,94</td>

<td> 291</td><td> 150</td><td> 315</td><td>Unnamed BDL 445</td><td>arabidopsis | 61 AT 1G56170</td><td>D</td><td> 16</td><td> 0,93</td>

<td> 292</td><td> 151</td><td> 316</td><td>Unnamed BDL 446</td><td>arabidopsis | 6 j AT 1G62070</td><td>THE</td><td> 1</td><td> 0,77</td>

<td> 293</td><td> 151</td><td> 316</td><td>Unnamed BDL 446</td><td>arabidops is | 61 AT 1G62070</td><td>THE</td><td> 2</td><td> 0,77</td>

<td> 294</td><td> 153</td><td> 318</td><td>Unnamed BDL 448</td><td>arabidopsis (6 | AT3G21090</td><td>Ç</td><td> 13</td><td> 0,9</td>

<td> 295</td><td> 154</td><td> 319</td><td>Unnamed BDL 449</td><td>arabidopsis | 6 | AT3G24250</td><td>B</td><td> 6</td><td> 0,8</td>

<td> 296</td><td> 154</td><td> 319</td><td>Unnamed BDL 449</td><td>arabidopsis | 6 | AT3G24250</td><td>Ç</td><td> 11</td><td> 0,73</td>

<td> 297</td><td> 155</td><td> 320</td><td>Unnamed BDL 450</td><td>arabidopsis | 6 | AT3G50990</td><td>D</td><td> 13</td><td> -0,85</td>

<td> 298</td><td> 157</td><td> 322</td><td>Unnamed BDL 452</td><td>rabbi dopsi s 161 AT 4G10150</td><td>B</td><td> 17</td><td> -0,75</td>

<td> 299</td><td> 159</td><td> 324</td><td>Unnamed BDL 454</td><td>arabidopsis | 6 | AT5G07190</td><td>B</td><td> 17</td><td> 0,77</td>

<td> 300</td><td> 159</td><td> 324</td><td>Unnamed BDL 454</td><td>arabidopsis | 6 | AT5G07190</td><td>B</td><td> 18</td><td> 0,82</td>

<td> 301</td><td> 159</td><td> 324</td><td>Unnamed BDL 454</td><td>arabidopsis | 6 [AT5G07190</td><td>D</td><td> 15</td><td> -0,92</td>

<td> 302</td><td> 159</td><td> 324</td><td>Unnamed BDL 454</td><td>arabidopsis | 6 | AT5G07190</td><td>D</td><td> 16</td><td> -0,91</td>

<td> 303</td><td> 160</td><td> 325</td><td>Unnamed BDL 455</td><td>arabidopsis | 6 | AT5G10220</td><td>THE</td><td> 10</td><td> -0,72</td>

<td> 304</td><td> 160</td><td> 325</td><td>Unnamed BDL 455</td><td>arabidopsis | 6 | AT5G10220</td><td>AND</td><td> 16</td><td> -0,72</td>

<td> 305</td><td> 161</td><td> 326</td><td>Unnamed BDL 456</td><td>arabidopsis | 6 | AT5G20940</td><td>D</td><td> 15</td><td> 0,76</td>

<td> 306</td><td> 161</td><td> 326</td><td>Unnamed BDL 456</td><td>arabidopsis | 6 | AT5G20940</td><td>D</td><td> 16</td><td> 0,7</td>

<td> 307</td><td> 162</td><td> 327</td><td>Unnamed BDL 457</td><td>arabi dopsi s | 61AT5G51210</td><td>Ç</td><td> 17</td><td> 0,81</td>

<td> 308</td><td> 163</td><td> 328</td><td>Unnamed BDL 458</td><td>arabidopsis | 6 | AT5G55620</td><td>THE</td><td> 13</td><td> -0,76</td>

<td> 309</td><td> 163</td><td> 328</td><td>Unnamed BDL 458</td><td>arabidopsis | 6 | AT5G55620</td><td>AND</td><td> 11</td><td> -0,81</td>

<td> 310</td><td> 163</td><td> 328</td><td>Unnamed BDL 458</td><td>arabidopsis | 6 | AT5G55620</td><td>AND</td><td> 14</td><td> -0,71</td>

<td> 311</td><td> 164</td><td> 329</td><td>Unnamed BDL 459</td><td>arabidopsis | 6 | AT5G60460</td><td>Ç</td><td> 14</td><td> 0,84</td>

<td> 312</td><td> 164</td><td> 329</td><td>Unnamed BDL 459</td><td>arabidopsis | 6 | AT5G60460</td><td>AND</td><td> 17</td><td> -0,72</td>

<td> 313</td><td> 165</td><td> 330</td><td>Unnamed BDL 460</td><td>arabidopsis | 6 | AT5G65590</td><td>D</td><td> 16</td><td> 0,72</td>

The following Tables 8-15 show the polynucleotides that are predicted based on the micro assay correlation analysis to increase seed yield in the plant (Table 8), oil yield (Table 9), growth rate (Table 10), shape / organ size / length (Table 11), harvest index (Table 12), Oil content per seed (Table 13), dry matter in the plant (Table 14) and seed number

75/119 per silica (Table 15). It was noted that the additional polynucleotides described in the immediate application can be used to alter the above characteristics in plants.

Table 8

Polynucleotides that impacted seed yield

<td></td><td>SEQ ID In Polynucleotide:</td><td>SEQ ID No: of the polypeptide encoded by polynucleotide</td><td>Gene Name</td>

<td> 1</td><td> 3</td><td> 168</td><td>BDL2</td>

<td> 2</td><td> 8</td><td> 173</td><td>BDL8</td>

<td> 3</td><td> 9</td><td> 174</td><td>BDL9</td>

<td> 4</td><td> 14</td><td> 179</td><td>BDL15</td>

<td> 5</td><td> 16</td><td> 181</td><td>BDL17</td>

<td> 6</td><td> 26</td><td> 191</td><td>BDL26a</td>

<td> 7</td><td> 27</td><td> 192</td><td>BDL26b</td>

<td> 8</td><td> 29</td><td> 194</td><td>BDL28</td>

<td> 9</td><td> 30</td><td> 195</td><td>BDL29</td>

<td> 10</td><td> 39</td><td> 204</td><td>Unnamed BDL 334</td>

<td> 11</td><td> 42</td><td> 207</td><td>Unnamed BDL 337</td>

<td> 12</td><td> 50</td><td> 215</td><td>Unnamed BDL 344</td>

<td> 13</td><td> 53</td><td> 218</td><td>Unnamed BDL 347</td>

<td> 14</td><td> 55</td><td> 220</td><td>Unnamed BDL 349</td>

<td> 15</td><td> 56</td><td> 221</td><td>Unnamed BDL 350</td>

<td> 16</td><td> 57</td><td> 222</td><td>Unnamed BDL 351</td>

<td> 17</td><td> 63</td><td> 228</td><td>Unnamed BDL 357</td>

<td> 18</td><td> 66</td><td> 231</td><td>Unnamed BDL 362</td>

<td> 19</td><td> 68</td><td> 233</td><td>Unnamed 365 BDL</td>

<td> 20</td><td> 70</td><td> 235</td><td>Unnamed BDL 367</td>

<td> 21</td><td> 74</td><td> 239</td><td>BDL.unnamed 371</td>

<td> 22</td><td> 79</td><td> 244</td><td>Unnamed BDL 374</td>

<td> 23</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td>

<td> 24</td><td> 88</td><td> 253</td><td>Unnamed BDL 384</td>

<td> 25</td><td> 89</td><td> 254</td><td>Unnamed BDL 385</td>

<td> 26</td><td> 94</td><td> 259</td><td>Unnamed BDL 391</td>

<td> 27</td><td> 98</td><td> 263</td><td>Unnamed BDL 395</td>

<td> 28</td><td> 106</td><td> 271</td><td>BDL unnamed 402</td>

<td> 29</td><td> 108</td><td> 273</td><td>Unnamed 404 BDL</td>

<td> 30</td><td> 119</td><td> 284</td><td>Unnamed BDL 414</td>

<td> 31</td><td> 125</td><td> 290</td><td>Unnamed BDL 421</td>

<td> 32</td><td> 126</td><td> 291</td><td>Unnamed BDL 422</td>

<td> 33</td><td> 134</td><td> 299</td><td>Unnamed BDL 429</td>

<td> 34</td><td> 137</td><td> 302</td><td>Unnamed BDL 432</td>

<td> 35</td><td> 150</td><td> 315</td><td>Unnamed BDL 445</td>

<td> 36</td><td> 159</td><td> 324</td><td>Unnamed BDL 454</td>

<td> 37</td><td> 161</td><td> 326</td><td>Unnamed BDL 456</td>

Table 9

76/119

Polynucleotides that impacted oil yield

<td></td><td>SEQ ID No Polynucleotide:</td><td>SEQ ID No: of the polypeptide encoded by polynucleotide</td><td>Gene Name</td>

<td> 1</td><td> 18</td><td> 183</td><td>BDL19</td>

<td> 2</td><td> 25</td><td> 190</td><td>BDL25</td>

<td> 3</td><td> 49</td><td> 214</td><td>Unnamed BDL 343</td>

<td> 4</td><td> 57</td><td> 222</td><td>Unnamed BDL 351</td>

<td> 5</td><td> 60</td><td> 225</td><td>Unnamed BDL 354</td>

<td> 6</td><td> 64</td><td> 229</td><td>Unnamed BDL 358</td>

<td> 7</td><td> 67</td><td> 232</td><td>Unnamed BDL 364</td>

<td> 8</td><td> 109</td><td> 274</td><td>Unnamed BDL 405</td>

<td> 9</td><td> 135</td><td> 300</td><td>Unnamed BDL 430</td>

<td> 10</td><td> 160</td><td> 325</td><td>Unnamed BDL 455</td>

<td> 11</td><td> 165</td><td> 330</td><td>Unnamed BDL 460</td>

Table 10 in the growth rate

Polynucleotides that impacted

<td rowspan="2"></td><td rowspan="2">SEQ Polinuc</td><td rowspan="2">ID No leotid:</td><td colspan="2">SEQ ID No: of the polypeptide</td><td rowspan="2">Gene Name</td>

<td>encoded polynucleotide</td><td>per</td>

<td> 1</td><td colspan="2"> 36</td><td colspan="2"> 201</td><td>Unnamed BDL 330</td>

<td> 2</td><td colspan="2"> 70</td><td colspan="2"> 235</td><td>Unnamed BDL 367</td>

<td> 3</td><td colspan="2"> 83</td><td colspan="2"> 248</td><td>Unnamed BDL 379</td>

<td> 4</td><td colspan="2"> 123</td><td colspan="2"> 288</td><td>Unnamed BDL 420</td>

<td> 5</td><td colspan="2"> 140</td><td colspan="2"> 305</td><td>Unnamed BDL 436</td>

<td> 6</td><td colspan="2"> 147</td><td colspan="2"> 312</td><td>Unnamed BDL 442</td>

<td> 7</td><td colspan="2"> 150</td><td colspan="2"> 315</td><td>Unnamed BDL 445</td>

<td> 8</td><td colspan="2"> 154</td><td colspan="2"> 319</td><td>Unnamed BDL 449</td>

Table 11

Polynucleotides that impacted the shape / size / length of the organ

<td></td><td>SEQ ID No Polynucleotide:</td><td>SEQ ID No: do polypeptide encoded by polynucleotide</td><td>Gene Name</td>

<td> 1</td><td> 10</td><td> 175</td><td>BDL10</td>

<td> 2</td><td> 13</td><td> 178</td><td>BDL14</td>

<td> 3</td><td> 19</td><td> 184</td><td>BDL20a</td>

<td> 4</td><td> 20</td><td> 185</td><td>BDL20b</td>

<td> 5</td><td> 21</td><td> 186</td><td>BDL21</td>

<td> 6</td><td> 22</td><td> 187</td><td>BDL22</td>

<td> 7</td><td> 28</td><td> 193</td><td>BDL27</td>

<td> 8</td><td> 38</td><td> 203</td><td>Unnamed BDL 333</td>

<td> 9</td><td> 40</td><td> 205</td><td>Unnamed BDL 335</td>

<td> 10</td><td> 40</td><td> 205</td><td>Unnamed BDL 335</td>

<td> 11</td><td> 43</td><td> 208</td><td>Unnamed BDL 339</td>

<td> 12</td><td> 44</td><td> 209</td><td>Unnamed 340 BDL</td>

77/119

<td></td><td>SEQ ID No Polynucleotide:</td><td>SEQ ID No: do polypeptide encoded by polynucleotide</td><td>Gene Name</td>

<td colspan="4">continuation of table 11</td>

<td> 13</td><td> 62</td><td> 227</td><td>Unnamed BDL 356</td>

<td> 14</td><td> 72</td><td> 237</td><td>Unnamed BDL 369</td>

<td> 15</td><td> 73</td><td> 238</td><td>Unnamed BDL 370</td>

<td> 16</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td>

<td> 17</td><td> 82</td><td> 247</td><td>Unnamed BDL 377</td>

<td> 18</td><td> 84</td><td> 249</td><td>Unnamed BDL 380</td>

<td> 19</td><td> 91</td><td> 256</td><td>Unnamed BDL 388</td>

<td> 20</td><td> 93</td><td> 258</td><td>Unnamed BDL 390</td>

<td> 21</td><td> 95</td><td> 260</td><td>Unnamed BDL 392</td>

<td> 22</td><td> 104</td><td> 269</td><td>Unnamed 400 BDL</td>

<td> 23</td><td> 109</td><td> 274</td><td>Unnamed BDL 405</td>

<td> 24</td><td> 110</td><td> 275</td><td>Unnamed BDL 406</td>

<td> 25</td><td> 116</td><td> 281</td><td>Unnamed BDL 411</td>

<td> 26</td><td> 117</td><td> 282</td><td>Unnamed BDL 412</td>

<td> 27</td><td> 121</td><td> 286</td><td>Unnamed BDL 418</td>

<td> 28</td><td> 122</td><td> 287</td><td>Unnamed BDL 419</td>

<td> 29</td><td> 126</td><td> 291</td><td>Unnamed BDL 422</td>

<td> 30</td><td> 128</td><td> 293</td><td>Unnamed BDL 423</td>

<td> 31</td><td> 132</td><td> 297</td><td>Unnamed BDL 427</td>

<td> 32</td><td> 136</td><td> 301</td><td>Unnamed BDL 431</td>

<td> 33</td><td> 138</td><td> 303</td><td>Unnamed BDL 433</td>

<td> 34</td><td> 145</td><td> 310</td><td>Unnamed 440 BDL</td>

<td> 35</td><td> 148</td><td> 313</td><td>Unnamed BDL 443</td>

<td> 36</td><td> 151</td><td> 316</td><td>Unnamed BDL 446</td>

<td> 37</td><td> 154</td><td> 319</td><td>Unnamed BDL 449</td>

<td> 38</td><td> 163</td><td> 328</td><td>Unnamed BDL 458</td>

Table 11.

shape / size / length of the organ includes, for example, leaf length, leaf width, leaf circularity, seed size, or root length.

Table 12

Polynucleotides that impacted the harvest index

<td></td><td>SEQ ID In Polynucleotide:</td><td>SEQ ID No: of the polypeptide encoded by polynucleotide</td><td>Gene Name</td>

<td> 1</td><td> 1</td><td> 172</td><td>BDL7</td>

<td> 2</td><td> 18</td><td> 183</td><td>BDL19</td>

<td> 3</td><td> 36</td><td> 201</td><td>Unnamed BDL 330</td>

<td> 4</td><td> 46</td><td> 211</td><td>Unnamed BDL 341</td>

<td> 5</td><td> 56</td><td> 221</td><td>Unnamed BDL 350</td>

<td> 6</td><td> 80</td><td> 245</td><td>Unnamed BDL 375</td>

<td> 7</td><td> 93</td><td> 258</td><td>Unnamed BDL 390</td>

<td> 8</td><td> 98</td><td> 263</td><td>Unnamed BDL 395</td>

<td> 9</td><td> 131</td><td> 296</td><td>Unnamed BDL 426</td>

<td> 10</td><td> 136</td><td> 301</td><td>Unnamed BDL 431</td>

78/119

<td></td><td>SEQ ID In Polynucleotide:</td><td>SEQ ID No: of the polypeptide encoded by polynucleotide</td><td>Gene Name</td>

<td colspan="4">continuation of table 12</td>

<td> 11</td><td> 138</td><td> 303</td><td>Unnamed BDL 433</td>

<td> 12</td><td> 146</td><td> 311</td><td>Unnamed BDL 441</td>

<td> 13</td><td> 157</td><td> 322</td><td>Unnamed BDL 452</td>

<td> 14</td><td> 162</td><td> 327</td><td>Unnamed BDL 457</td>

<td> 15</td><td> 164</td><td> 329</td><td>Unnamed BDL 459</td>

Table 13

Polynucleotides that impacted seed content

<td></td><td>SEQ ID In Polynucleotide:</td><td>SEQ ID No: of the polypeptide encoded by polynucleotide</td><td>Gene Name</td>

<td> 1</td><td> 6</td><td> 171</td><td>BDL6</td>

<td> 2</td><td> 23</td><td> 188</td><td>BDL23</td>

<td> 3</td><td> 56</td><td> 221</td><td>Unnamed BDL 350</td>

<td> 4</td><td> 61</td><td> 226</td><td>Unnamed BDL 355</td>

<td> 5</td><td> 112</td><td> 277</td><td>Unnamed BDL 408</td>

<td> 6</td><td> 114</td><td> 279</td><td>Unnamed BDL 409</td>

<td> 7</td><td> 115</td><td> 280</td><td>Unnamed BDL 410</td>

<td> 8</td><td> 128</td><td> 293</td><td>Unnamed BDL 423</td>

<td> 9</td><td> 135</td><td> 300</td><td>Unnamed BDL 430</td>

Table 14

Polynucleotides that impacted plant dry matter

<td></td><td>SEQ No. Polynucleotide:</td><td>SEQ No. 1: of the polypeptide encoded by the polynucleotide</td><td>Gene Name</td>

<td> 1</td><td> 37</td><td> 202</td><td>Unnamed BDL 331</td>

<td> 2</td><td> 52</td><td> 217</td><td>Unnamed BDL 346</td>

<td> 3</td><td> 55</td><td> 220</td><td>Unnamed BDL 349</td>

<td> 4</td><td> 139</td><td> 304</td><td>Unnamed BDL 435</td>

Table 15

Polynucleotides that impacted the number of seeds per silica

<td></td><td>SEQ No. Polynucleotide:</td><td>SEQ No. 1: of the polypeptide encoded by the polynucleotide</td><td>Gene Name</td>

<td> 1</td><td> 57</td><td> 222</td><td>Unnamed BDL 351</td>

<td> 2</td><td> 71</td><td> 236</td><td>Unnamed BDL 368</td>

<td> 3</td><td> 81</td><td> 246</td><td>Unnamed BDL 376</td>

<td> 4</td><td> 90</td><td> 255</td><td>Unnamed 386 BDL</td>

<td> 5</td><td> 112</td><td> 277</td><td>BDI unnamed 408</td>

<td> 6</td><td> 114</td><td> 279</td><td>Unnamed BDL 409</td>

<td> 7</td><td> 115</td><td> 280</td><td>Unnamed BDL 410</td>

<td> 8</td><td> 131</td><td> 296</td><td>Unnamed BDL 426</td>

<td> 9</td><td> 143</td><td> 308</td><td>Unnamed BDL 438</td>

<td> 10</td><td> 149</td><td> 314</td><td>Unnamed BDL 444</td>

<td> 11</td><td> 153</td><td> 318</td><td>Unnamed BDL 448</td>

<td> 12</td><td> 155</td><td> 320</td><td>Unnamed BDL 450</td>

79/119

EXAMPLE 3

GENE CLONING AND CREATION OF BINARY VECTORS FOR EXPRESSION OF THE PLANT Cloning Strategy

The selected genes from those listed in Example 1 and 2 above have been cloned into binary vectors for the generation of transgenic plants. For cloning, the opening reading structure (ALS) of the full length was first identified. In the case of the ELA-EST cluster and in some cases of mRNA sequences, they were analyzed to identify the reading structure of the total aperture by comparing the results of translation algorithms for recognized proteins from other plant species. To clone the full-length cDNAs, Reverse Transcription followed by PCR (TR-PCR) was performed on the total RNA extracted from Arabidopsis silica collected 3 and 13 days after flowering (3 and 13 DAF). The RNA was extracted using RNA extraction protocol with hot borate according to WWW.eeob.iastate.edu/faculty/WendelJ/ultramicroma.html. The production of cDNA (using random hexamer and precursor poly dT) and PCR amplification was performed using standard protocols described elsewhere (Sambrook J., E.

<td>F. Fritsch,</td><td>and T.</td><td>Maniatis</td><td> .1989.</td><td colspan="2">Molecular cloning. a</td>

<td>Laboratory</td><td>Manual.,</td><td> 2 ^The Ed.</td><td>Cold</td><td>Spring</td><td>Harbor laboratory</td>

<td>Press, Nova</td><td>York)</td><td>and they are</td><td>routine</td><td>for</td><td>those killed in</td>

<td>technical.</td><td></td><td></td><td>For</td><td>clone</td><td>the genomic region</td>

full length of a gene, the genomic DNA was extracted

80/119 of Arabidopsis thaliana wild type (TS) leaves (DNeasy mini plant kit, Qiagen, Germany).

All genes were amplified by PCR. The PCR products were purified using the Elute Mini PCR purification kit (Qiagen) and the amplified PCR products were sequenced using ABI 377 sequencer (Applied Biosystems). To facilitate the cloning of the cDNA genomic sequences, an extension of 8-12 bp was added to the starting end of each primer. The primer extension includes an endonuclease restriction site. Restriction locations are selected using two parameters: (a). The site does not exist in the cDNA sequence; and (b). The restriction sites on the initial and final primers are designated so that the digested cDNA is inserted in the direction of formation of the binary vector used for transformation.

The PCR products were purified (Mini Elute PCR purification kit, Qiagen, Germany) and digested with the restriction sites according to the primers used (Roche, Switzerland). The digested products of the PCR were first subcloned into a high copy vector [(originated from the KS plasmid vector pBlue-script http://www.stratagene.com/manuals/212205.pdf)] with the 35S promoter (SEQ ID NO: 921), and the NOS terminator (SEQ ID

NO: 922) originated from the binary vector pBI 101.3 (Genbank Access

No. U12640, BP 4417 to 4693), followed by cloning into binary vectors pGI or pMBArt (according to Table 16, below). The digested PCR products and the plasmid vector

81/119 linearized cells were ligated using T4 DNA ligase enzyme (Roche, Switzerland). The following polynucleotides were cloned from RNA extracted from the tissues described above or from genomic DNA using primers as provided in Table 17, below.

Table 16

Genes cloned in different binary vectors

<td></td><td>Polynucleotide identified by Bioinf. SEQ ID NO</td><td>Polypeptide identified by Bioinf. SEQ ID NO</td><td>TAIR gene name</td><td>Name internal</td><td>Polynucleotide Cionated SEQ ID NO</td><td>Powered by pGI</td><td>Cionated in pMBart</td>

<td> 1</td><td> 1</td><td> 166</td><td>AT5G50770</td><td>BDL3</td><td> 1017</td><td></td><td>V</td>

<td> 2</td><td> 4</td><td> 169</td><td>AT2G45420</td><td>BDL4</td><td> 1041</td><td></td><td>V</td>

<td> 3</td><td> 5</td><td> 170</td><td>AT3G14360</td><td>BDL5</td><td> 1018</td><td></td><td>V</td>

<td> 4</td><td> 6</td><td> 171</td><td>AT4G10490</td><td>BDL6</td><td> 1019</td><td>V</td><td></td>

<td> 5</td><td> 7</td><td> 172</td><td>AT5G51490</td><td>BDL7</td><td> 1020</td><td>V</td><td></td>

<td> 6</td><td> 8</td><td> 173</td><td>AT3G03240</td><td>BDL8</td><td> 1021</td><td></td><td>V</td>

<td> 7</td><td> 9</td><td> 174</td><td>AT5G24130</td><td>BDL9</td><td> 1022</td><td></td><td>V</td>

<td> 8</td><td> 3</td><td> 168</td><td>AT1G34580</td><td>BDL2</td><td> 1016</td><td></td><td>V</td>

<td> 9</td><td> 11</td><td> 176</td><td>AT5G12460</td><td>BDL11</td><td> 1042</td><td></td><td>V</td>

<td> 10</td><td> 12</td><td> 177</td><td>AT4G08530</td><td>BDL12</td><td> 1023</td><td>V</td><td></td>

<td> 11</td><td> 2</td><td> 167</td><td>AT1G65090</td><td>BDL1</td><td> 1040</td><td>V</td><td></td>

<td> 12</td><td> 13</td><td> 178</td><td>AT1G53690</td><td>BDL14</td><td> 1024</td><td>V</td><td></td>

<td> 13</td><td> 14</td><td> 179</td><td>AT1G68510</td><td>BDL15</td><td> 1025</td><td>V</td><td></td>

<td> 14</td><td> 15</td><td> 180</td><td>AT5G03800</td><td>BDL16</td><td> 1026</td><td></td><td>V</td>

<td> 15</td><td> 16</td><td> 181</td><td>AT5G36770</td><td>BDL17</td><td> 1043</td><td></td><td>V</td>

<td> 16</td><td> 17</td><td> 182</td><td>AT5G40420</td><td>BDL18</td><td> 1027</td><td>V</td><td></td>

<td> 17</td><td> 19</td><td> 184</td><td>AT1G47540.1</td><td>BDL20a</td><td> 1029</td><td>V</td><td></td>

<td> 18</td><td> 20</td><td> 185</td><td>AT1G47540.2</td><td>BDL20b</td><td> 1044</td><td>V</td><td></td>

<td> 19</td><td> 21</td><td> 186</td><td>AT3G62730</td><td>BDL21</td><td> 1030</td><td></td><td>V</td>

<td> 20</td><td> 23</td><td> 188</td><td>AT3G27785</td><td>BDL23</td><td> 1031</td><td></td><td>V</td>

<td> 21</td><td> 24</td><td> 189</td><td>AT5G15000</td><td>BDL24</td><td> 1045</td><td>V</td><td></td>

<td> 22</td><td> 25</td><td> 190</td><td>AT3G20910</td><td>BDL25</td><td> 1032</td><td></td><td>V</td>

<td> 23</td><td> 26</td><td> 191</td><td>AT1G11170.1</td><td>BDL26a</td><td> 1033</td><td>V</td><td></td>

<td> 24</td><td> 27</td><td> 192</td><td>AT1G11170.2</td><td>BDL26b</td><td> 1034</td><td>V</td><td></td>

<td> 25</td><td> 28</td><td> 193</td><td>AT1G68380</td><td>BDL27</td><td> 1035</td><td></td><td>V</td>

<td> 26</td><td> 29</td><td> 194</td><td>AT1G09380</td><td>BDL28</td><td> 1036</td><td></td><td>V</td>

<td> 27</td><td> 30</td><td> 195</td><td>AT1G60970</td><td>BDL29</td><td> 1037</td><td></td><td>V</td>

<td> 28</td><td> 31</td><td> 196</td><td>AT1G72580</td><td>BDL30</td><td> 1046</td><td>V</td><td></td>

<td> 29</td><td> 33</td><td> 198</td><td>AT2G46960.1</td><td>BDL32a</td><td> 1038</td><td></td><td>V</td>

<td> 30</td><td> 34</td><td> 199</td><td>AT2G46960.2</td><td>BDL32b</td><td> 1039</td><td></td><td>V</td>

<td> 31</td><td> 933</td><td> 183</td><td>AT2G02080.1</td><td>BDL19g DNA</td><td> 1028</td><td></td><td>V</td>

<td> 32</td><td> -</td><td>AY254038</td><td>WRINKLED1</td><td>WRI</td><td> 1050</td><td>V</td><td></td>

Table 16: Polynucleotide and polypeptide sequence identifiers are provided

82/119 identified informally (bioinf.), As well as the sequence identifiers of the cloned polynucleotides. In both cases, the polypeptide sequences translated from cloned genes were different from the predictable polypeptides identified by bioinformatics (SEQ ID

Nos: 176 and 178) and new sequence identifiers have been provided (ie SEQ OD NO: 1047 for the translated polypeptide of the cloned gene

SEQ ID NO: 1042 and SEQ ID NO: 1048 for the translated polypeptide of the cloned gene SEQ ID ΝΟ.Ί024).

Table 17

Cloned polynucleotides from the cDNA library, genomic or synthetically produced DNA and the primers used for cloning

<td>Gene name</td><td>Enzymes of restriction used for cloning</td><td>Primers used for amplification (5'— ♦ 3 ')</td><td>SEQ ID NO:</td>

<td rowspan="4">BDL3</td><td rowspan="4">Sall, Xbal</td><td>Fwd Nested: BDL3 ORF NF Sall AATGTCGACGATGCATGGATTCAATCAACA</td><td> 923</td>

<td>External Fwd: BDL3 ORF_EF Sall TTTGTCGACCATTGTGAAGTATAGTCCTTGATG</td><td> 924</td>

<td>Rev Nested: BDL3 ORF_NR Xbal TATCTAGAACATAAACGGGGAGACTCAAG</td><td> 925</td>

<td>External Rev: BDL3 ORF ER Xbal AATCTAGACTATGGTAACCCGAAGTTGTATAC</td><td> 926</td>

<td>BDL4</td><td>Saci, Xbal</td><td>synthetic product</td><td> 1041</td>

<td rowspan="4">BDL5</td><td rowspan="4">Sall, Xbal</td><td>Fwd Nested: BDL5 ORF_NF Sal ACTGTCGACAGACATGCACAAAGACAACG</td><td> 927</td>

<td>External Fwd: BDL5_0RF_EF_Sall ATAGTCGACCAAAACCCAGAGACATGCAC</td><td> 928</td>

<td>Rev Nested: BDL5_0RF_NR_Xbal AATCTAGACACTTTTCAAAGAGAGGACATCT</td><td> 929</td>

<td>External Rev: BDL5_0RF_ER Xbal ACTCTAGACCGGTTCACTTAAGATTTATTC</td><td> 930</td>

<td rowspan="3">BDL6</td><td rowspan="3">Sall, Xbal</td><td>Fwd: BDL6_0RF_F1_Sall AAAGTCGACCAATCATGGCAGCATCAAAAC</td><td> 931</td>

<td>Rev Nested: BDL6 ORF NR Xbal AGTCTAGACGGATGATTGATTCGATAGTACAC Phaseolus vulgaris</td><td> 932</td>

<td>External Rev: BDL6_ORF_ER_Sacl TGAGCTCCCAATCAAGAACTAAGGACCG</td><td> 933</td>

<td rowspan="3">BDL7</td><td rowspan="3">Sall, Xbal</td><td>Fwd: BDL7 ORF F1_Sal AATGTCGACAACAATGAATATGATGATGCAAAAACTC</td><td> 934</td>

<td>Rev Nested: BDL7_ORF_NR_Xbal AATCTAGACGGTCTTTAGAGTCCAGAAGTG</td><td> 935</td>

<td>External Rev: BDL7 ORF_ER Xbal AATCTAGAATCATTGCAACTTAAACACGA</td><td> 936</td>

<td rowspan="2">BDL8</td><td rowspan="2">Xbal, Sall</td><td>Fwd: BDL8 gDNA_F_Sal AATGTCGACCCTCTGTCTTGTCTTTTGGTTAGTA</td><td> 937</td>

<td>Rev: BDL8_gDNA R Xb AATCTAGACCTTCAACTACAAGCGGCTT</td><td> 938</td>

83/119

<td>Gene name</td><td>Enzymes of restriction used for cloning</td><td>Primers used for amplification (5'— ► 3j</td><td>SEQ ID NO:</td>

<td colspan="4">continuation of table 17</td>

<td rowspan="4">BDL9</td><td rowspan="4">Sall, Xbal</td><td>Fwd Nested: BDL9_ORF_NF_Sall acggtcgacCTTACAATAAAATGGTGAAACTCG</td><td> 939</td>

<td>External Fwd: BDL9 ORF EF Sall aatgtcgacCTCTCTAAACGCATAATCTTACA</td><td> 940</td>

<td>Rev Nested: BDL9 ORF NR Xbal AATCTAGACAAAATATGTGGTCTCCGCAG</td><td> 941</td>

<td>External Rev: BDL9_ORF_ER_Xbal AGTCTAGACAAAAAGGAAACGAATCACA</td><td> 942</td>

<td rowspan="4">BDL2</td><td rowspan="4">Sall, Xbal</td><td>Fwd Nested: BDL2 ORF NF Sall CAAGTCGACCGTAAGACATAAGCAAAATGGC</td><td> 943</td>

<td>External Fwd: BDL2 ORF EF Sall TTAGTCGACCACTTCATGCGTAAGACATAAGC</td><td> 944</td>

<td>Rev Nested: BDL2_ORF_NR_Xbal GCTCTAGAGCATCTTTTAAGTTGACGTCG</td><td> 945</td>

<td>External Rev: BDL2 ORF ER Xbal AATCTAGATCCATTGAAAATGCGAACC</td><td> 946</td>

<td>BDL11</td><td>Saci, Xbal</td><td>synthetic product</td><td></td>

<td rowspan="4">BDL12</td><td rowspan="4">Sall, Saci</td><td>Fwd Nested: BDL12 gDNA NF Sall AATGTCGACGTTCTATCCCCAACTCTAAATG</td><td> 947</td>

<td>External Fwd: BDL12 gDNA EF Xbal ATTCTAGATTGTTGTTTGTATCACTTTATTGG</td><td> 948</td>

<td>Rev Nested: BDL12 gDNA NR Saci AGAGCTCCTTAAAGTTCTATCGAGATAGTGC</td><td> 949</td>

<td>External Rev: BDL12_gDNA_ER_Sacl AGAGCTCTCAATGAAATTTTACATAACCATC</td><td> 950</td>

<td>BDL1</td><td>Xbal, Saci</td><td>synthetic product</td><td></td>

<td rowspan="3">BDL14</td><td rowspan="3">Sall, Xbal</td><td>Fwd: BDL14 ORF F1 Sall AATGTCGACAACAATGGATCTACAACAGTCCGAAAC</td><td> 951</td>

<td>Rev Nested: BDL14_ORF_NR_Xbal AATCTAGACACTCAGACAGCTGGGTATTAAAC</td><td> 952</td>

<td>External Rev: BDL14 ORF ER Saci AGAGCTCGTTGTGGCACTCAGACAGCTG</td><td> 953</td>

<td rowspan="4">BDL15</td><td rowspan="4">Sall, Xbal</td><td>Fwd Nested: BDL15_ORF NF Sal TTCGTCGACAAAGGAATATGAGAATCAGCTG</td><td> 954</td>

<td>External Fwd: BDL15 ORF EF Sal AACGTCGACCAAACACACATCATACGTATATTTG</td><td> 955</td>

<td>Rev Nested: BDL15_ORF_NR_Xbal ATTCTAGAGAGTTTATGATAACCTAATGATTGAC</td><td> 956</td>

<td>External Rev: BDL15 ORF ER Xbal GTTCTAGACAGAGTGAGTTTATGATAACCTAATG</td><td> 957</td>

<td rowspan="3">BDL16</td><td rowspan="3">Sall, Xbal</td><td>Fwd: BDL16 ORF F1 Sall AATGTCGACAACAATGTCCACCGTTAATCATCAC</td><td> 958</td>

<td>Rev Nested: BDL16 ORF NR Xbal AATCTAGACAGAACCAAAACTCTCGTATTAAC</td><td> 959</td>

<td>External Rev: BDL16_ORF_ER_Xbal AATCTAGAGAAACTTTGAATGGACTATGTAGC</td><td> 960</td>

<td>BDL17</td><td>Saci, Xbal</td><td>synthetic product</td><td> 1043</td>

<td rowspan="4">BDL18</td><td rowspan="4">Xbal, Saci</td><td>Fwd Nested: BDL18_ORF_NF_Xbal AATCTAGATACAATGGCGGATACACACC</td><td> 961</td>

<td>External Fwd: BDL18_ORF_EF_Xbal ATTCTAGAGCTTACAATGGCGGATACACA</td><td> 962</td>

<td>Rev Nested: BDL18_ORF_NR_Sacl AGAGCTCGTGAAAACACATATCTACCGTTC</td><td> 963</td>

<td>External Rev: BDL18 ORF ER Saci AGAGCTCCTTGCGATCTTTCATGCTTAC</td><td> 964</td>

84/119

<td>Gene name</td><td>Enzymes restriction used cloning</td><td>in for</td><td colspan="2">Primers used for amplification (5 '-&gt; 3')</td><td>SEQ ID NO:</td>

<td colspan="6">continuation of table 17</td>

<td></td><td></td><td></td><td>Fwd Nested: BDL19_gDNA_NF_Sacl AGAGCTCAGAGAGAGATAGGGCTTTGAGG</td><td> -</td><td> 965</td>

<td>BDL19</td><td>Saci</td><td></td><td>External Fwd: BDL19 gDNA_EF_Sacl AGAGCTCGAAGAAGAACACAAAACAGTAGAG</td><td></td><td> 966</td>

<td></td><td></td><td></td><td>Rev: BDL19_gDNA_R1_Sacl AGAGCTCGTGATTATGAAAACAACAAGCG</td><td> -</td><td> 967</td>

<td></td><td></td><td></td><td>Fwd: BDL20a_ORF F1 Sall AAAGTCGACAGAGACAAAGAAGTTGGCCA</td><td> -</td><td> 968</td>

<td>BDL20a</td><td>Sall, Xbal</td><td></td><td>Rev Nested: BDL20a ORF NR Xbal TTTCTAGATGCAAGATTCAAATACGACTTAG</td><td> -</td><td> 969</td>

<td></td><td></td><td></td><td>External Rev: BDL20a_ORF_ER_Sacl AGAGCTCGGACCATTTACCTTGATTTGTTAC</td><td></td><td> 970</td>

<td>BDL20b</td><td colspan="2">Smal + Sacl</td><td colspan="2">synthetic product</td><td> 1044</td>

<td></td><td></td><td></td><td>Fwd Nested: BDL21-ORF-NF-Sal AATGTCGACAAGCATGTTTAAACTCTGTCTCG</td><td> -</td><td> 971</td>

<td rowspan="2">BDL21</td><td rowspan="2">Sall, Xbal</td><td></td><td>External Fwd: BDL21-ORF-EF-Sal TTAGTCGACGAAAGGAAAAGCATGTTTAAAC</td><td> -</td><td> 972</td>

<td rowspan="2"></td><td rowspan="2">Rev Nested: BDL21-ORF-NR-Xbal CCGTCTAGAGGAAACTTTTAATTGTCATGTGA</td><td rowspan="2"> -</td><td rowspan="2"> 973</td>

<td></td><td></td>

<td></td><td></td><td></td><td>External Rev: BDL21-ORF-ER-Xbal GGCTCTAGATTTTCTAGTGAATTGTATCAATGG</td><td> -</td><td> 974</td>

<td></td><td></td><td></td><td>Fwd Nested: BDL23 ORF NF_Xbal AATCTAGACATCATAATCATATGGAGTTCGA</td><td> -</td><td> 975</td>

<td>BDL23</td><td>Xbal, Saci</td><td></td><td>External Fwd: BDL23 ORF EF_Xbal AATCTAGAGATCTAGGGTTTCATGCTTCAC</td><td> -</td><td> 976</td>

<td></td><td></td><td></td><td>Rev: BDL23 ORF R1 Saci AGAGCTCGTTCGACTTGTTTATATTGCACG</td><td> -</td><td> 977</td>

<td>BDL24</td><td colspan="2">Smal, Saci</td><td colspan="2">synthetic product</td><td> 1045</td>

<td></td><td></td><td></td><td>Fwd Nested: BDL25_ORF_NF_Xbal ATTCTAGACTCCGAGACTGTCTCCGATTG</td><td> -</td><td> 978</td>

<td>BDL25</td><td>Xbal</td><td></td><td>External Fwd: BDL25 ORF_EF_Xbal ATTCTAGACAATCACCGTGGACACCTC</td><td> -</td><td> 979</td>

<td></td><td></td><td></td><td>Rev: BDL25 ORF R Xbal ATTCTAGAGTGGCAACATCTGAAGTATTCC</td><td> -</td><td> 980</td>

<td></td><td></td><td></td><td>Fwd Nested: BDL26a_ORF_NF_Sacl AGAGCTCTCATTACAGTGACTCTGCATGC</td><td> -</td><td> 981</td>

<td rowspan="2">BDL26a</td><td rowspan="2">Saci</td><td></td><td>External Fwd: BDL26a ORF EF_Sacl AGAGCTCTCTTGTCTACTTTCATTACAGTGAC</td><td></td><td> 982</td>

<td rowspan="2"></td><td rowspan="2">Rev Nested: BDL26a + b_ORF_NR_Sacl TAGAGCTCGAAAGTACATAATGGACATGAGC</td><td rowspan="2"> -</td><td rowspan="2"> 983</td>

<td></td><td></td>

<td></td><td></td><td></td><td>External Rev: BDL26a + b ORF_ER_Sacl TAGAGCTCGATTTTTAAAGTAGTTATAGTGATGAA</td><td> —</td><td> 984</td>

<td></td><td></td><td></td><td>Fwd Nested: BDL26b_ORF_NF_Sacl AGAGCTCGTAATATTACCATAAGGTTCAGAAG</td><td> -</td><td> 985</td>

<td rowspan="2">BDL26b</td><td rowspan="2">Saci</td><td></td><td>External Fwd: BDL26b_ORF_EF_Sacl AGAGCTCCATAATTTTTTCGTATTTAACTCTT</td><td></td><td> 986</td>

<td></td><td>Rev Nested: BDL26a + b_ORF_NR_Sacl TAGAGCTCGAAAGTACATAATGGACATGAGC</td><td> -</td><td> 987</td>

<td></td><td></td><td></td><td>External rev: BDL26a + b_ORF_ER Saci TAGAGCTCGATTTTTAAAGTAGTTATAGTGATGAA</td><td> -</td><td> 988</td>

<td></td><td></td><td></td><td>Fwd Nested: BDL27_ORF_NF_Xbal AATCTAGACTCTTACACATGTATCGGTAGTTG</td><td> -</td><td> 989</td>

<td rowspan="2">BDL27</td><td rowspan="2">Xbal, Saci</td><td></td><td>External Fwd: BDL27_ORF_EF_Xbal AATCTAGACTTAAAACATTGGAAACAAGAATTC</td><td> -</td><td> 990</td>

<td></td><td>Rev Nested: BDL27 ORF NR_Sacl AGAGCTCGATCAGAAATACATGACGATAGATG</td><td></td><td> 991</td>

<td></td><td></td><td></td><td>External Rev: BDL27_ORF_ER_Sacl AGAGCTCGCATCTTTGTTTTTGGACGA</td><td> -</td><td> 992</td>

85/119

<td>Gene name</td><td>Enzymes restriction used cloning</td><td>in for</td><td colspan="2">Primers used for amplification (5'— ♦ 3 j</td><td>SEQ ID NO:</td>

<td colspan="6">continuation of table 17</td>

<td></td><td></td><td></td><td>Fwd Nested: BDL28_ORF_NF Sall AAAGTCGACGAGAGATGGCTAAATCAGATATG</td><td> -</td><td> 993</td>

<td rowspan="2">BDL28</td><td rowspan="2">Sal, xbal</td><td></td><td>External Fwd: BDL28_ORF_EF_Sall AATGTCGACGAGAGTGAGAGATGGCTAAATCAG</td><td> -</td><td> 994</td>

<td></td><td>Rev Nested: BDL28_ORF_NR_Xbal ATTCTAGAAGAAGCAATCACCATTTTAAGG</td><td> -</td><td> 995</td>

<td></td><td></td><td></td><td>External Rev: BDL28 ORF ER Xbal ATTCTAGACCGAAAATCCAATTTAGTTGC</td><td> -</td><td> 996</td>

<td></td><td></td><td></td><td>Fwd Nested: BDL29_ORF_NF Sall AATGTCGACGATTTCTTCTCCTTAAGCCATG</td><td> -</td><td> 997</td>

<td></td><td></td><td></td><td>External Fwd: BDL29_ORF_EF_Sall</td><td> -</td><td rowspan="2"> 998</td>

<td rowspan="2">BDL29</td><td rowspan="2">Sall, Xbal</td><td></td><td>AATGTCGACGGAGAGTTTTTCTTTATTACTAGGG</td><td></td>

<td></td><td>Rev Nested: BDL29 ORF NR Xbal AATCTAGACACACATCATTTCATAAGTGACC</td><td> -</td><td> 999</td>

<td></td><td></td><td></td><td>External Rev: BDL29 ORF ER Xbal AATCTAGACAACCATTATTACCGAAGAGC</td><td> -</td><td> 1000</td>

<td>BDL30</td><td colspan="2">Smal, Saci</td><td colspan="2">synthetic product</td><td> 1046</td>

<td></td><td></td><td></td><td>Fwd Nested: BDL32a ORF NF Xbal AATCTAGAGAGGATAATGCGTAACACACAAG</td><td> -</td><td> 1001</td>

<td rowspan="2">BDL32a</td><td rowspan="2">Xbal, Saci</td><td></td><td>External Fwd: BDL32a ORF EF Xbal AATCTAGAGATTTTATTCGAGGATAATGCG</td><td> -</td><td> 1002</td>

<td></td><td>Rev Nested: BDL32a + b_ORF_NR_Sacl AGAGCTCCATTAAGACATCCGATTTATTTG</td><td> -</td><td> 1003</td>

<td></td><td></td><td></td><td>External Rev: BDL32a + b_ORF_ER_Sacl AGAGCTCGAGACTTGTCACACACGTGAGG</td><td> -</td><td> 1004</td>

<td></td><td></td><td></td><td>Fwd nested: BDL32b_ORF_NF_Xbal AATCTAGACACACACACAAACATAAGGAAA</td><td> -</td><td> 1005</td>

<td rowspan="2">BDL32b</td><td rowspan="2">Xbal, Saci</td><td></td><td>External Fwd: BDL32b_ORF_EF_Xbal AATCTAGAAACAATACACACACACAAACATAAG</td><td> -</td><td> 1006</td>

<td></td><td>Rev Nested: BDL32a + b_ORF_NR_Sacl AGAGCTCCATTAAGACATCCGATTTATTTG</td><td> -</td><td> 1007</td>

<td></td><td></td><td></td><td>External Rev: BDL32a + b_ORF_ER_Sacl AGAGCTCGAGACTTGTCACACACGTGAGG</td><td> -</td><td> 1008</td>

<td></td><td colspan="2"></td><td colspan="2"></td><td></td>

<td></td><td></td><td></td><td>Fwd nested: WRI NF_ORF Sall AATGTCGACCAGAGTTTAATGAAGAAGCGCT</td><td> —</td><td> 1009</td>

<td rowspan="2">Wrinkledl</td><td rowspan="2">Sall, Xbal</td><td></td><td colspan="2">External Fwd: WRI_EF_Art_Sall AATGTCGACAAATCTAAACTTTCTCAGAG</td><td> 1010</td>

<td></td><td>Rev Nested: WRI NR ORF Xbal AATCTAGACTCTCTCAGACCAAATAGTTACAAG</td><td> —</td><td> 1011</td>

<td></td><td></td><td></td><td>External Rev: WRI_ER_Art Xbal AATCTAGAGGCAAAGACATTGATTATTC</td><td> -</td><td> 1012</td>

<td>Napin</td><td>Hindlll, Sall</td><td></td><td>Fwd: Napin F Hindlll ATAAGCTTATTGATTCCTTTAAAGACTTATGTT</td><td> —</td><td> 1013</td>

<td></td><td></td><td></td><td colspan="2">Rev: Napin R Sall - TCGTCGACGGGTGTATGTTTTTAATCTTGTTT</td><td> 1014</td>

Table 17.

To optimize the coding sequence (in the silicon project), Codon usage tables calculated from the plant's Transcriptoms were used (example of such Table can be found in

Codon Use database available online at

86/119

Example V expression

Http: //www.kazusa.or jp / codon /). The optimized coding sequences have been designed so that no changes have been made to the encoded amino acid sequence (from polypeptides selected from Table 1, while using codons preferred for dicotyledonous plants mainly

Arabidopsis, Canola and Soy; and monocotyledonous plants such as corn. Such optimized sequences promise better rate and translation and therefore higher levels of protein expression. For the optimized sequences accompanying additional unique restriction enzyme sites, Sal, Xbal, BamHI, Smal at the 5 'end and Saci at the 3' end were added (except for a BDL-1 gene, in which the Smal site was excluded). The genes by which the codon-optimized synthetic (artificial) sequences were prepared are: BDL-1 (SEQ ID NO: 1040), BDL-4 (SEQ ID NO: 1041), BDL-11 (SEQ ID NO, -1042) , BDL-17 (SEQ ID NO: 1043), BDL-20b (SEQ ID NO: 1044), BDL-24 (SEQ ID NO: 1045), BDL-30 (SEQ ID NO: 1046). The artificial polynucleotide sequences optimized have been synthesized commercial supplier

Http://www.geneart.com/)].

[GeneArt, for a

GmbH,

Generation of binary vectors comprises BDL genes and functional plant promoters for guiding its expression - The pPI plasmid was constructed by inserting a synthetic poly - (A) signal sequence, originating from the basic plasmid vector pGL3 (Promega, Acc No U47295 ; BP 4658-4811) at the HindII restriction site of the vector

87/119 binary pBI101.3 (Clontech, Genbank Access No U12640). In some cases the spinal binary plasmid used was pGI which is similar to pPI but the GUS qene was replaced by the GUS-Intron gene (Vancanneyt., G. et al MGG 220, 245-50, 1990). The pGi used to clone part of the polynucleotide sequences, initially under the control of the 35S promoter [Odell, JT, et al., Nature 313, 810-812 (28 February 1985); SEQ ID NO: 921]. The additional sequences were cloned into pMBArt under the control of the 35S promoter.

Some polynucleotide sequences have been cloned under another preferred promoter as described below. The promoter, named Napin from Brassica napus, which is characterized by a seed of specific promoter activity [Stuitje AR et al. Plant Biotechnology Journal 1 (4): 301-309], was amplified by direct PCR on the genomic DNA extracted from the leaf tissue using the DNAeasy kit (Qiagen Cat. No 69104) using the following prITiers:

Napin F Hind III (Enzyme HindIII) - 5'ATAAGCTTATTGATTCCTTTAAAGACTTATGTT (SEQ ID NO: 1013)

Napin R Sal I (Enzyme Sal 1) - 5'TCGTCGACGGGTGTATGTTTTTAATCTTGTTT (SEQ ID NO: 1014).

The following genes have been cloned downwards from the Napin promoter sequence: BDL-2, BDL-3, BDL-4, BDL-6, BDL-12, BDL-14, BDL-15,

BDL-17, BDL-18, BDL-21, BDL-23, BDL-25, BDL-27, BDL-28, BDL29, BDL-32b, Wrinkel. For proposed control, the enzyme

88/119 - glucuronidase (GUS, SEQ ID NO: 1051) encoded by the A uid gene (GUS-Intron, SEQ ID NO: 1049).

EXAMPLE 4

PRODUCTION OF TRANSGENIC ARABIDOPSIS PLANTS EXPRESSING SEED OIL GENES

Materials and methods

Plant transformation was performed according to (Clough SJ, Bent AF, 1998. Floral immersion: a simplified method for the mediated transformation of Agrobacterium from Arabidopsis thaliana. Plant J. 16 (6): 735-43, Desfeux C, Clough SJ , Bent AF.2000.

Female reproductive tissues are the primary targets for the mediated transformation of Agrobacterium by the Arabidopsis floral immersion method. Plant Physiol. 123 (3): 895-904).

Arabidopsis thaliana var Columbia (T plants_The) were transformed according to the floral immersion procedure described by Clough SJ, Bent AF. (1998) Floral immersion: a simplified method for the mediated transformation of Agrobacterium from Arabidopsis thaliana. Plant J. 16 (6): 735-43, Desfeux C, Clough SJ, Bent AF. (20,000 female reproductive tissues are the primary targets for the mediated transformation of Agrobacterium by the Arabidopsis floral immersion method. Plant Physiol. 123 (3): 895-904) with few modifications. Briefly, Arabidopsis thaliana Columbia (ColO) Plants To were sown in 250 ml containers filled with moist peat-based growth mixture. The containers were covered

89/119 with aluminum foil and a plastic dome, kept at 4 ° C for 3-4 days, then discovered and incubated in a growth chamber at 18-24 ° C under 16/18 hours of light / dark cycles. The T plants_The were ready for transformation six days before anthesis.

Single colonies of

Agrobacterium carrying the binary vectors harboring the seed oil genes were grown in LB medium supplemented with kanamycin (50 mg / L) and gentamycin (50 mg / L). The cultures were incubated at 28 ° C for 48 hours with vigorous agitation and centrifuged at 4000 rpm for 5 minutes. The pellets comprising the Agrobacterium cells were resuspended in a transformation medium containing half the concentration (2.15 g / L) Murashige-Skoog (Duchefa); 0.044 µM benzylamine purine (Sigma); 112 µg / L B5 Gambourg vitamins (Sigma); sucrose 5%; and 0.2 ml / L of Silwet L-77 (OSI Especialistas, CT) in double distilled water, at a pH of 5.7.

The transformation of T plants_The was carried out by inverting each plant in an Agrobacterium suspension such that the plant tissue above the ground was submerged for 3-5 seconds. Each inoculated T0 plant was immediately placed in a plastic tray, then covered with a transparent plastic dome to maintain humidity and keep in a dark room at a temperature for 8 hours to facilitate infection and transformation. Plants T_TheGM crops grew in the greenhouse for 3-5 weeks until silica became brown and dry, then the seeds were

90/119 collected from plants and kept at room temperature until sowing.

For the generation of transgenic plants Τχ and T₂ harboring the genes, seeds collected from transgenic T plants_The were sterilized on the surface by immersion in 70% ethanol for 1 minute, followed by immersion in 5% sodium hypochloride and 0.05% triton for 5 minutes. The seeds sterilized on the surface were thoroughly washed in sterile distilled water and then placed in culture dishes containing half the Murashige-Skoog concentration (Duchefa); sucrose 2%; agra plant 0.8%; 50 mM kanamycin; and 20 mM carbenicillin (Duchefa). The culture plates were incubated at 4 ° C for 48 hours and then transferred to a growth room at 25 ° C for an additional week of incubation. The Arabidopsis Τχ Vital plants were transferred to fresh culture plates for another week of incubation. After incubation, the Τχ plants were removed from the culture plates and planted in a growth mixture contained in the 250 mL containers. The transgenic plants were grown in a greenhouse for maturation. The seeds harvested from the TI plants were grown and grown for maturation like the T plants₂ under the same conditions as used for crop and plant growth Τχ.

EXAMPLE 5

ADDITIONAL IDENTIFICATION OF SEQUENCES WITH THE MOST PROBABILITY TO GIVE SIMILAR FAVORABLE EFFITS ON TRANSGENIC PLANTS

91/119

The methods for searching for and identifying homologues of the polypeptide or polynucleotide seed yield would be well within the skill of a person skilled in the art. The search for and identification of homogenous genes involves the selection of the sequence of available information, for example, the public database, which includes, but is not limited to, the Japan DNA Database (BDDJ), Genbank, and the Database of the Nucleic Acid Sequence of the European Molecular Biology Laboratory (LBME) or versions thereof or the MIPS database. A number of different search algorithms have been developed, including, but not limited to, programs referred to as BLAST programs. There are five implementations of BLAST, three designed for nucleotide sequences (BLASTIN, BLASTX, and TBLASTX) and two designed for protein sequences (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology: 76-80, 1994; Birren et al., Genome analysis, 1: 543, 1997). Such methods involve alignment and comparison of sequences. The BLAST algorithm calculates the percentage of sequence identity and performs a statistical analysis of similarity between the two sequences. The software for the performance of the BLAST analysis is publicly available through the National Center for Information in Biotechnology. Other software or algorithms are GAP, BESTFIT, FASTA and TFASTA. GAP uses the Needleman and Wunsch algorithm (J. Mol. Biol. 48: 443-453, 1970) to find the alignment of two complete sequences that maximize the number of pairs and minimize the number of gaps.

92/119

Homologous genes can belong to the same gene family. The analysis of a gene family can be performed using sequence similarity analysis. To perform this analysis one can be the standard program for multiple alignments, for example, Clustal W. A joint tree next to the proteins homologous to the genes in this invention can be used to provide an overview of the structure and previous relationships. The sequence identity can be calculated using an alignment program as described above. It is expected that other plants of similar genes and those genes will provide the same phenotype referred to as the genes presented here. Advantageously, these family members can be useful in the methods of the invention. Examples of other plants are included here, but are not limited to, barley (Hordeum vulgare), Arabidopsis (Arabidopsis thaliana), corn (Zea mays), cotton (Gossypium), Rapeseed oil (Brassica napus), Rice (Oryza sativa), sugar cane (Saccharum officinarum), Sorghum (Sorghum bicolor), Soy (Glycine max), Sunflower (Helinathus annuus), Tomato (Lycopersicon esculentum), Wheat (Triticum aestivum).

The aforementioned analyzes for sequence homology are preferably performed on a full length sequence, but can be based on comparing certain regions such as conserved domains. The identification of such domains would also be within the domain of the person skilled in the art and would involve, for example, a computer-readable format of

93/119 computer a, MEME, person qualified in the nucleic acids of the present invention, the use of alignment software programs and the use of publicly available information on protein domains, conserved motifs and boxes. This information is available in PRODOM (http://www.biochem.ucl.ac.uk/bsm/dbbrowser/protoco1/prodomq ry.html), PIR (http://pir.georgetown.edu/) or database Pfam (http://www.sanger.ac.uk/Software/Pfam).

The sequence analysis programs designed to search for the motif can be used to identify the conserved fragments, regions and domains as mentioned above.

Preferred programs include, but are not limited to

SIGNALSCAN, and GENESCAN.

One technique can use homologous sequences provided here to find similar sequences in other species and other organisms. The homologues of a protein encompass peptides, oilgopeptides, polypeptides, proteins and enzymes that have amino acid substitutions, deletions and / or insertions relative to an unmodified protein in question and have similar biological and functional activity as the unmodified protein they derive. To produce such homologues, the amino acids in proteins can be replaced by other amino acids having similar properties (conservation changes, such as hydrophobicity, hydrophilicity, similar antigenicity, propensity to form or break down

94/119 a-helical structures or 3-leaf structures). Conservative substitution tables are well known in the art (see, for example, Creighton (1984) proteins. WH Freeman and Company). Nucleic acid homologues encompass nucleic acids having nucleotide substitutions, deletions and / or insertions relative to the unmodified nucleic acid in question and having similar biological and functional activity and function as the unmodified nucleic acid they derive.

Genes identified in the publicly available sequence databases when they share a high homologous sequence for the arabidopsis genes identified here are summarized in Table 18 below. Those genes are expected to have similar functions when introduced exogenously into plants, such as the identified arabidopsis genes. Homologous genes are also provided.

Table 18

Polypeptides and polynucleotides that encode the same that share a high homology sequence for identified arabidopsis polypeptides of the invention.

<td></td><td>Polynucleoti in SEQJD N 0:</td><td>Polypeptide SEQJD_NO:</td><td>Organism</td><td>Homology to SEQJD_NO:</td><td>% identity</td><td>% query coverage</td><td>Algorithm</td>

<td> 1</td><td> 369</td><td> 523</td><td>peanut</td><td> 51</td><td> 83</td><td> 48.4</td><td>tblastx</td>

<td> 2</td><td> 370</td><td></td><td>oil palm</td><td> 126</td><td> 78</td><td> 19.0</td><td>tblastx</td>

<td> 3</td><td> 371</td><td> 524</td><td>tobacco</td><td> 51</td><td> 88</td><td> 45.1</td><td>tblastx</td>

<td> 4</td><td> 372</td><td> 525</td><td>tobacco</td><td> 18</td><td> 85</td><td> 22.0</td><td>tblastx</td>

<td> 5</td><td> 373</td><td> 526</td><td>tobacco</td><td> 165</td><td> 85</td><td> 13.2</td><td>tblastx</td>

<td> 6</td><td> 374</td><td> 527</td><td>tobacco</td><td> 165</td><td> 77</td><td> 14.7</td><td>tblastx</td>

<td> 7</td><td> 375</td><td> 528</td><td>barley</td><td> 51</td><td> 85</td><td> 45.1</td><td>tblastx</td>

<td> 8</td><td> 376</td><td> 529</td><td>barley</td><td> 117</td><td> 85</td><td> 27.6</td><td>tblastx</td>

<td> 9</td><td> 377</td><td> 530</td><td>barley</td><td> 126</td><td> 85</td><td> 31.5</td><td>tblastx</td>

<td> 10</td><td> 378</td><td> 531</td><td>barley</td><td> 137</td><td> 92</td><td> 25.4</td><td>tblastx</td>

<td> 11</td><td> 379</td><td> 532</td><td>barley</td><td> 150</td><td> 65</td><td> 41.0</td><td>tblastx</td>

95/119

<td></td><td>Polynucleoti in SEQJD_N 0:</td><td>Polypeptide SEQJD_NO:</td><td>Organism</td><td>Homology to SEQJD_NO:</td><td>% identity</td><td>% query coverage</td><td>Algorithm</td>

<td colspan="8">continuation of table 18</td>

<td> 12</td><td> 380</td><td> 533</td><td>peach</td><td> 51</td><td> 90</td><td> 46.4</td><td>tblastx</td>

<td> 13</td><td> 381</td><td></td><td>thellungiella</td><td> 42</td><td> 86</td><td> 18.9</td><td>tblastx</td>

<td> 14</td><td> 382</td><td></td><td>thellungiella</td><td> 61</td><td> 88</td><td> 13.1</td><td>tblastx</td>

<td> 15</td><td> 383</td><td> 534</td><td>thellungiella</td><td> 66</td><td> 91</td><td> 14.7</td><td>tblastx</td>

<td> 16</td><td> 384</td><td></td><td>thellungiella</td><td> 70</td><td> 86</td><td> 20.5</td><td>tblastx</td>

<td> 17</td><td> 385</td><td> 535</td><td>thellungiella</td><td> 18</td><td> 95</td><td> 26.4</td><td>tblastx</td>

<td> 18</td><td> 386</td><td> 536</td><td>thellungiella</td><td> 163</td><td> 92</td><td> 27.7</td><td>tblastx</td>

<td> 19</td><td> 387</td><td> 537</td><td>strawberry</td><td> 51</td><td> 83</td><td> 47.1</td><td>tblastx</td>

<td> 20</td><td> 388</td><td> 538</td><td>canola</td><td> 36</td><td> 90</td><td> 28.5</td><td>tblastx</td>

<td> 21</td><td> 389</td><td></td><td>canola</td><td> 36</td><td> 88</td><td> 17.0</td><td>tblastx</td>

<td> 22</td><td> 390</td><td> 539</td><td>canola</td><td> 9</td><td> 89</td><td> 64.7</td><td>tblastx</td>

<td> 23</td><td> 391</td><td> 540</td><td>canola</td><td> 29</td><td> 88</td><td> 49.9</td><td>tblastx</td>

<td> 24</td><td> 392</td><td> 541</td><td>canola</td><td> 40</td><td> 87</td><td> 82.0</td><td>tblastx</td>

<td> 25</td><td> 393</td><td> 542</td><td>canola</td><td> 40</td><td> 87</td><td> 79.4</td><td>tblastx</td>

<td> 26</td><td> 394</td><td> 543</td><td>canola</td><td> 40</td><td> 87</td><td> 82.0</td><td>tblastx</td>

<td> 27</td><td> 395</td><td></td><td>canola</td><td> 40</td><td> 86</td><td> 46.5</td><td>tblastx</td>

<td> 28</td><td> 396</td><td> 544</td><td>canola</td><td> 41</td><td> 95</td><td> 36.5</td><td>tblastx</td>

<td> 29</td><td> 397</td><td> 545</td><td>canola</td><td> 41</td><td> 93</td><td> 36.5</td><td>tblastx</td>

<td> 30</td><td> 398</td><td> 546</td><td>canola</td><td> 44</td><td> 87</td><td> 41.1</td><td>tblastx</td>

<td> 31</td><td> 399</td><td> 547</td><td>canola</td><td> 51</td><td> 93</td><td> 49.0</td><td>tblastx</td>

<td> 32</td><td> 400</td><td> 548</td><td>canola</td><td> 51</td><td> 97</td><td> 51.0</td><td>tblastx</td>

<td> 33</td><td> 401</td><td> 549</td><td>canola</td><td> 51</td><td> 77</td><td> 64.7</td><td>tblastx</td>

<td> 34</td><td> 402</td><td> 550</td><td>canola</td><td> 54</td><td> 94</td><td> 22.3</td><td>tblastx</td>

<td> 35</td><td> 403</td><td> 551</td><td>canola</td><td> 55</td><td> 93</td><td> 59.3</td><td>tblastx</td>

<td> 36</td><td> 404</td><td></td><td>canola</td><td> 56</td><td> 85</td><td> 26.0</td><td>tblastx</td>

<td> 37</td><td> 405</td><td> 552</td><td>canola</td><td> 57</td><td> 94</td><td> 19.1</td><td>tblastx</td>

<td> 38</td><td> 406</td><td> 553</td><td>canola</td><td> 60</td><td> 90</td><td> 23.6</td><td>tblastx</td>

<td> 39</td><td> 407</td><td> 554</td><td>canola</td><td> 61</td><td> 88</td><td> 27.7</td><td>tblastx</td>

<td> 40</td><td> 408</td><td> 555</td><td>canola</td><td> 63</td><td> 92</td><td> 47.5</td><td>tblastx</td>

<td> 41</td><td> 409</td><td> 556</td><td>canola</td><td> 10</td><td> 87</td><td> 49.7</td><td>tblastx</td>

<td> 42</td><td> 410</td><td> 557</td><td>canola</td><td> 66</td><td> 91</td><td> 24.9</td><td>tblastx</td>

<td> 43</td><td> 411</td><td></td><td>canola</td><td> 7</td><td> 87</td><td> 31.6</td><td>tblastx</td>

<td> 44</td><td> 412</td><td></td><td>canola</td><td> 14</td><td> 92</td><td> 44.1</td><td>tblastx</td>

<td> 45</td><td> 413</td><td></td><td>canola</td><td> 14</td><td> 92</td><td> 44.1</td><td>tblastx</td>

<td> 46</td><td> 414</td><td></td><td>canola</td><td> 81</td><td> 85</td><td> 36.3</td><td>tblastx</td>

<td> 47</td><td> 415</td><td> 558</td><td>canola</td><td> 35</td><td> 90</td><td> 32.4</td><td>tblastx</td>

<td> 48</td><td> 416</td><td> 559</td><td>canola</td><td> 35</td><td> 88</td><td> 45.3</td><td>tblastx</td>

<td> 49</td><td> 417</td><td> 560</td><td>canola</td><td> 35</td><td> 91</td><td> 45.3</td><td>tblastx</td>

<td> 50</td><td> 418</td><td> 561</td><td>canola</td><td> 91</td><td> 88</td><td> 28.9</td><td>tblastx</td>

<td> 51</td><td> 419</td><td> 562</td><td>canola</td><td> 93</td><td> 95</td><td> 14.5</td><td>tblastx</td>

<td> 52</td><td> 420</td><td></td><td>canola</td><td> 101</td><td> 95</td><td> 11.3</td><td>tblastx</td>

<td> 53</td><td> 421</td><td> 563</td><td>canola</td><td> 106</td><td> 84</td><td> 32.1</td><td>tblastx</td>

<td> 54</td><td> 422</td><td></td><td>canola</td><td> 107</td><td> 83</td><td> 62.3</td><td>tblastx</td>

<td> 55</td><td> 423</td><td> 564</td><td>canola</td><td> 108</td><td> 94</td><td> 14.4</td><td>tblastx</td>

<td> 56</td><td> 424</td><td> 565</td><td>canola</td><td> 118</td><td> 90</td><td> 20.6</td><td>tblastx</td>

<td> 57</td><td> 425</td><td> 566</td><td>canola</td><td> 118</td><td> 95</td><td> 34.4</td><td>tblastx</td>

<td> 58</td><td> 426</td><td> 567</td><td>canola</td><td> 118</td><td> 95</td><td> 34.4</td><td>tblastx</td>

<td> 59</td><td> 427</td><td> 568</td><td>canola</td><td> 119</td><td> 83</td><td> 57.2</td><td>tblastx</td>

<td> 60</td><td> 428</td><td></td><td>canola</td><td> 125</td><td> 84</td><td> 28.1</td><td>tblastx</td>

<td> 61</td><td> 429</td><td></td><td>canola</td><td> 135</td><td> 96</td><td> 24.6</td><td>tblastx</td>

<td> 62</td><td> 430</td><td> 569</td><td>canola</td><td> 137</td><td> 90</td><td> 32.7</td><td>tblastx</td>

<td> 63</td><td> 431</td><td></td><td>canola</td><td> 18</td><td> 93</td><td> 33.4</td><td>tblastx</td>

<td> 64</td><td> 432</td><td> 570</td><td>canola</td><td> 21</td><td> 84</td><td> 83.9</td><td>tblastx</td>

<td> 65</td><td> 433</td><td></td><td>canola</td><td> 140</td><td> 92</td><td> 52.2</td><td>tblastx</td>

<td> 66</td><td> 434</td><td> 571</td><td>canola</td><td> 143</td><td> 92</td><td> 41.7</td><td>tblastx</td>

<td> 67</td><td> 435</td><td> 572</td><td>canola</td><td> 143</td><td> 93</td><td> 41.0</td><td>tblastx</td>

<td> 68</td><td> 436</td><td> 573</td><td>canola</td><td> 145</td><td> 89</td><td> 49.1</td><td>tblastx</td>

<td> 69</td><td> 437</td><td> 574</td><td>canola</td><td> 145</td><td> 91</td><td> 39.8</td><td>tblastx</td>

96/119

<td></td><td>Polynucleoti in SEQJD_N 0:</td><td>Polypeptide SEQJD_NO:</td><td>Organism</td><td>Homology to SEQJD_NO:</td><td>% identity</td><td>% query coverage</td><td>Algorithm</td>

<td colspan="8">continuation of table 18</td>

<td> 70</td><td> 438</td><td></td><td>canola</td><td> 153</td><td> 94</td><td> 26.4</td><td>tblastx</td>

<td> 71</td><td> 439</td><td> 575</td><td>canola</td><td> 160</td><td> 89</td><td> 79.6</td><td>tblastx</td>

<td> 72</td><td> 440</td><td> 576</td><td>canola</td><td> 163</td><td> 91</td><td> 27.7</td><td>tblastx</td>

<td> 73</td><td> 441</td><td> 577</td><td>canola</td><td> 164</td><td> 80</td><td> 76.6</td><td>tblastx</td>

<td> 74</td><td> 442</td><td> 578</td><td>canola</td><td> 165</td><td> 85</td><td> 11.9</td><td>tblastx</td>

<td> 75</td><td> 443</td><td> 579</td><td>melon</td><td> 51</td><td> 84</td><td> 47.1</td><td>tblastx</td>

<td> 76</td><td> 444</td><td> 580</td><td>sugarcane</td><td> 137</td><td> 90</td><td> 25.7</td><td>tblastx</td>

<td> 77</td><td> 445</td><td> 581</td><td>sugarcane</td><td> 137</td><td> 88</td><td> 28.4</td><td>tblastx</td>

<td> 78</td><td> 446</td><td> 582</td><td>b boy</td><td> 41</td><td> 95</td><td> 36.1</td><td>tblastx</td>

<td> 79</td><td> 447</td><td> 583</td><td>b boy</td><td> 57</td><td> 92</td><td> 9.5</td><td>tblastx</td>

<td> 80</td><td> 448</td><td></td><td>b boy</td><td> 64</td><td> 86</td><td> 45.7</td><td>tblastx</td>

<td> 81</td><td> 449</td><td> 584</td><td>b boy</td><td> 10</td><td> 84</td><td> 39.0</td><td>tblastx</td>

<td> 82</td><td> 450</td><td></td><td>b boy</td><td> 4</td><td> 86</td><td> 40.5</td><td>tblastx</td>

<td> 83</td><td> 451</td><td> 585</td><td>b boy</td><td> 35</td><td> 86</td><td> 17.2</td><td>tblastx</td>

<td> 84</td><td> 452</td><td> 586</td><td>b boy</td><td> 106</td><td> 78</td><td> 36.8</td><td>tblastx</td>

<td> 85</td><td> 453</td><td> 587</td><td>b boy</td><td> 122</td><td> 94</td><td> 71.4</td><td>tblastx</td>

<td> 86</td><td> 454</td><td> 588</td><td>b boy</td><td> 126</td><td> 87</td><td> 32.6</td><td>tblastx</td>

<td> 87</td><td> 455</td><td> 589</td><td>b boy</td><td> 135</td><td> 86</td><td> 41.7</td><td>tblastx</td>

<td> 88</td><td> 456</td><td> 590</td><td>b boy</td><td> 137</td><td> 85</td><td> 17.8</td><td>tblastx</td>

<td> 89</td><td> 457</td><td> 591</td><td>b boy</td><td> 18</td><td> 94</td><td> 26.0</td><td>tblastx</td>

<td> 90</td><td> 458</td><td> 592</td><td>b boy</td><td> 150</td><td> 82</td><td> 42.9</td><td>tblastx</td>

<td> 91</td><td> 459</td><td></td><td>b boy</td><td> 152</td><td> 88</td><td> 32.6</td><td>tblastx</td>

<td> 92</td><td> 460</td><td> 593</td><td>b boy</td><td> 165</td><td> 85</td><td> 11.9</td><td>tblastx</td>

<td> 93</td><td> 461</td><td> 594</td><td>maize</td><td> 137</td><td> 86</td><td> 24.1</td><td>tblastx</td>

<td> 94</td><td> 462</td><td> 595</td><td>maize</td><td> 137</td><td> 89</td><td> 14.0</td><td>tblastx</td>

<td> 95</td><td> 463</td><td> 596</td><td>maize</td><td> 137</td><td> 86</td><td> 24.1</td><td>tblastx</td>

<td> 96</td><td> 464</td><td> 597</td><td>maize</td><td> 165</td><td> 72</td><td> 15.5</td><td>tblastx</td>

<td> 97</td><td> 465</td><td> 598</td><td>almond</td><td> 18</td><td> 89</td><td> 20.8</td><td>tblastx</td>

<td> 98</td><td> 466</td><td> 599</td><td>sorghum</td><td> 123</td><td> 87</td><td> 20.6</td><td>tblastx</td>

<td> 99</td><td> 466</td><td> 599</td><td>sorghum</td><td> 124</td><td> 87</td><td> 20.5</td><td>tblastx</td>

<td> 100</td><td> 467</td><td> 600</td><td>sorghum</td><td> 123</td><td> 89</td><td> 19.8</td><td>tblastx</td>

<td> 101</td><td> 467</td><td> 600</td><td>sorghum</td><td> 124</td><td> 89</td><td> 19.6</td><td>tblastx</td>

<td> 102</td><td> 468</td><td> 601</td><td>sorghum</td><td> 137</td><td> 85</td><td> 12.6</td><td>tblastx</td>

<td> 103</td><td> 469</td><td></td><td>soybean</td><td> 126</td><td> 97</td><td> 22.4</td><td>tblastx</td>

<td> 104</td><td> 470</td><td> 602</td><td>soybean</td><td> 137</td><td> 92</td><td> 20.1</td><td>tblastx</td>

<td> 105</td><td> 471</td><td> 603</td><td>soybean</td><td> 137</td><td> 92</td><td> 11.2</td><td>tblastx</td>

<td> 106</td><td> 472</td><td> 604</td><td>soybean</td><td> 137</td><td> 92</td><td> 20.1</td><td>tblastx</td>

<td> 107</td><td> 473</td><td> 605</td><td>soybean</td><td> 137</td><td> 85</td><td> 13.1</td><td>tblastx</td>

<td> 108</td><td> 474</td><td> 606</td><td>soybean</td><td> 137</td><td> 87</td><td> 17.0</td><td>tblastx</td>

<td> 109</td><td> 475</td><td> 607</td><td>soybean</td><td> 137</td><td> 92</td><td> 11.2</td><td>tblastx</td>

<td> 110</td><td> 476</td><td> 608</td><td>soybean</td><td> 137</td><td> 85</td><td> 32.3</td><td>tblastx</td>

<td> 111</td><td> 477</td><td> 609</td><td>soybean</td><td> 18</td><td> 85</td><td> 28.0</td><td>tblastx</td>

<td> 112</td><td> 478</td><td> 610</td><td>soybean</td><td> 18</td><td> 86</td><td> 28.0</td><td>tblastx</td>

<td> 113</td><td> 479</td><td> 611</td><td>soybean</td><td> 150</td><td> 86</td><td> 52.8</td><td>tblastx</td>

<td> 114</td><td> 480</td><td> 612</td><td>soybean</td><td> 150</td><td> 86</td><td> 52.8</td><td>tblastx</td>

<td> 115</td><td> 481</td><td> 613</td><td>soybean</td><td> 150</td><td> 86</td><td> 52.8</td><td>tblastx</td>

<td> 116</td><td> 482</td><td> 614</td><td>rice</td><td> 137</td><td> 92</td><td> 23.6</td><td>tblastx</td>

<td> 117</td><td> 483</td><td> 615</td><td>rice</td><td> 137</td><td> 93</td><td> 20.6</td><td>tblastx</td>

<td> 118</td><td> 484</td><td> 616</td><td>rice</td><td> 137</td><td> 95</td><td> 23.6</td><td>tblastx</td>

<td> 119</td><td> 485</td><td> 617</td><td>sunflower</td><td> 150</td><td> 83</td><td> 44.0</td><td>tblastx</td>

<td> 120</td><td> 486</td><td></td><td>sunflower</td><td> 161</td><td> 90</td><td> 7.8</td><td>tblastx</td>

<td> 121</td><td> 487</td><td> 618</td><td>poplar</td><td> 51</td><td> 85</td><td> 45.1</td><td>tblastx</td>

<td> 122</td><td> 488</td><td> 619</td><td>poplar</td><td> 123</td><td> 89</td><td> 22.6</td><td>tblastx</td>

<td> 123</td><td> 488</td><td> 619</td><td>poplar</td><td> 124</td><td> 89</td><td> 22.5</td><td>tblastx</td>

<td> 124</td><td> 489</td><td> 620</td><td>poplar</td><td> 137</td><td> 87</td><td> 8.3</td><td>tblastx</td>

<td> 125</td><td> 490</td><td> 621</td><td>poplar</td><td> 18</td><td> 86</td><td> 15.8</td><td>tblastx</td>

<td> 126</td><td> 491</td><td> 622</td><td>poplar</td><td> 165</td><td> 85</td><td> 13.2</td><td>tblastx</td>

<td> 127</td><td> 492</td><td></td><td>b oleracea</td><td> 29</td><td> 92</td><td> 23.3</td><td>tblastx</td>

97/119

<td></td><td>Polynucleoti in SEQJD_N 0:</td><td>Polypeptide SEQJD_NO:</td><td>Organism</td><td>Homology to SEQJDJVO:</td><td>% identity</td><td>% query coverage</td><td>Algorithm</td>

<td colspan="8">continuation of table 18</td>

<td> 128</td><td> 493</td><td></td><td>b oleracea</td><td> 50</td><td> 90</td><td> 20.7</td><td>tblastx</td>

<td> 129</td><td> 494</td><td> 623</td><td>b oleracea</td><td> 51</td><td> 93</td><td> 51.6</td><td>tblastx</td>

<td> 130</td><td> 495</td><td> 624</td><td>b oleracea</td><td> 55</td><td> 91</td><td> 43.7</td><td>tblastx</td>

<td> 131</td><td> 496</td><td></td><td>b oleracea</td><td> 107</td><td> 84</td><td> 62.3</td><td>tblastx</td>

<td> 132</td><td> 497</td><td> 625</td><td>b oleracea</td><td> 126</td><td> 88</td><td> 32.6</td><td>tblastx</td>

<td> 133</td><td> 498</td><td> 626</td><td>b oleracea</td><td> 136</td><td> 85</td><td> 45.0</td><td>tblastx</td>

<td> 134</td><td> 499</td><td> 627</td><td>b oleracea</td><td> 136</td><td> 87</td><td> 75.3</td><td>tblastx</td>

<td> 135</td><td> 500</td><td> 628</td><td>grape</td><td> 51</td><td> 87</td><td> 46.4</td><td>tblastx</td>

<td> 136</td><td> 501</td><td></td><td>grape</td><td> 4</td><td> 84</td><td> 23.5</td><td>tblastx</td>

<td> 137</td><td> 502</td><td> 629</td><td>grape</td><td> 143</td><td> 90</td><td> 21.9</td><td>tblastx</td>

<td> 138</td><td> 503</td><td> 630</td><td>grape</td><td> 150</td><td> 93</td><td> 21.4</td><td>tblastx</td>

<td> 139</td><td> 504</td><td> 631</td><td>grape</td><td> 150</td><td> 84</td><td> 39.5</td><td>tblastx</td>

<td> 140</td><td> 505</td><td> 632</td><td>wheat</td><td> 123</td><td> 92</td><td> 14.9</td><td>tblastx</td>

<td> 141</td><td> 505</td><td> 632</td><td>wheat</td><td> 124</td><td> 92</td><td> 14.8</td><td>tblastx</td>

<td> 142</td><td> 506</td><td> 633</td><td>wheat</td><td> 126</td><td> 82</td><td> 32.9</td><td>tblastx</td>

<td> 143</td><td> 507</td><td> 634</td><td>wheat</td><td> 126</td><td> 87</td><td> 28.0</td><td>tblastx</td>

<td> 144</td><td> 508</td><td> 635</td><td>wheat</td><td> 126</td><td> 83</td><td> 32.1</td><td>tblastx</td>

<td> 145</td><td> 509</td><td> 636</td><td>wheat</td><td> 137</td><td> 91</td><td> 24.1</td><td>tblastx</td>

<td> 146</td><td> 510</td><td> 637</td><td>wheat</td><td> 137</td><td> 89</td><td> 32.3</td><td>tblastx</td>

<td> 147</td><td> 511</td><td> 638</td><td>wheat</td><td> 137</td><td> 95</td><td> 11.2</td><td>tblastx</td>

<td> 148</td><td> 512</td><td> 639</td><td>wheat</td><td> 150</td><td> 73</td><td> 53.9</td><td>tblastx</td>

<td> 149</td><td> 513</td><td> 640</td><td>wheat</td><td> 161</td><td> 86</td><td> 8.8</td><td>tblastx</td>

<td> 150</td><td> 514</td><td> 641</td><td>wheat</td><td> 161</td><td> 88</td><td> 7.8</td><td>tblastx</td>

<td> 151</td><td> 515</td><td> 642</td><td>wheat</td><td> 161</td><td> 92</td><td> 7.2</td><td>tblastx</td>

<td> 152</td><td> 516</td><td> 643</td><td>flax</td><td> 18</td><td> 74</td><td> 15.3</td><td>tblastx</td>

<td> 153</td><td> 517</td><td> 644</td><td>tomato</td><td> 51</td><td> 85</td><td> 45.8</td><td>tblastx</td>

<td> 154</td><td> 518</td><td> 645</td><td>tomato</td><td> 123</td><td> 92</td><td> 15.9</td><td>tblastx</td>

<td> 155</td><td> 518</td><td> 645</td><td>tomato</td><td> 124</td><td> 92</td><td> 15.8</td><td>tblastx</td>

<td> 156</td><td> 519</td><td> 646</td><td>tomato</td><td> 126</td><td> 94</td><td> 251</td><td>tblastx</td>

<td> 157</td><td> 520</td><td> 647</td><td>cotton</td><td> 51</td><td> 87</td><td> 45.8</td><td>tblastx</td>

<td> 158</td><td> 521</td><td> 648</td><td>cotton</td><td> 51</td><td> 88</td><td> 46.4</td><td>tblastx</td>

<td> 159</td><td> 522</td><td> 649</td><td>cotton</td><td> 123</td><td> 91</td><td> 18.8</td><td>tblastx</td>

<td> 160</td><td> 522</td><td> 649</td><td>cotton</td><td> 124</td><td> 91</td><td> 18.7</td><td>tblastx</td>

<td> 161</td><td> 650</td><td> 786</td><td>b boy</td><td> 169</td><td> 88</td><td> 73.7</td><td>blastp</td>

<td> 162</td><td> 651</td><td> 787</td><td>canola</td><td> 169</td><td> 93</td><td> 62.6</td><td>blastp</td>

<td> 163</td><td> 652</td><td> 788</td><td>radish</td><td> 169</td><td> 88</td><td> 77.1</td><td>blastp</td>

<td> 164</td><td> 653</td><td> 789</td><td>b oleracea</td><td> 174</td><td> 93</td><td> 55.7</td><td>blastp</td>

<td> 165</td><td> 654</td><td> 790</td><td>b boy</td><td> 179</td><td> 94</td><td> 70.4</td><td>blastp</td>

<td> 166</td><td> 655</td><td> 791</td><td>canola</td><td> 179</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 167</td><td> 656</td><td> 792</td><td>canola</td><td> 183</td><td> 85</td><td> 84.9</td><td>blastp</td>

<td> 168</td><td> 657</td><td> 793</td><td>canola</td><td> 186</td><td> 89</td><td> 96.8</td><td>blastp</td>

<td> 169</td><td> 658</td><td> 794</td><td>canola</td><td> 191</td><td> 89</td><td> 51.4</td><td>blastp</td>

<td> 170</td><td> 659</td><td> 795</td><td>b oleracea</td><td> 192</td><td> 88</td><td> 56.4</td><td>blastp</td>

<td> 171</td><td> 660</td><td> 796</td><td>canola</td><td> 194</td><td> 85</td><td> 96.0</td><td>blastp</td>

<td> 172</td><td> 661</td><td> 797</td><td>b boy</td><td> 195</td><td> 90</td><td> 100.0</td><td>blastp</td>

<td> 173</td><td> 662</td><td> 798</td><td>canola</td><td> 195</td><td> 91</td><td> 100.0</td><td>blastp</td>

<td> 174</td><td> 663</td><td> 799</td><td>canola</td><td> 200</td><td> 90</td><td> 94.7</td><td>blastp</td>

<td> 175</td><td> 664</td><td> 800</td><td>canola</td><td> 200</td><td> 90</td><td> 98.9</td><td>blastp</td>

<td> 176</td><td> 665</td><td> 801</td><td>b oleracea</td><td> 205</td><td> 87</td><td> 100.0</td><td>blastp</td>

<td> 177</td><td> 666</td><td> 802</td><td>b boy</td><td> 205</td><td> 87</td><td> 69.1</td><td>blastp</td>

<td> 178</td><td> 667</td><td> 803</td><td>b boy</td><td> 205</td><td> 86</td><td> 73.5</td><td>blastp</td>

<td> 179</td><td> 668</td><td> 804</td><td>canola</td><td> 205</td><td> 86</td><td> 61.4</td><td>blastp</td>

<td> 180</td><td> 669</td><td> 805</td><td>radish</td><td> 205</td><td> 87</td><td> 76.5</td><td>blastp</td>

<td> 181</td><td> 670</td><td> 806</td><td>canola</td><td> 206</td><td> 93</td><td> 100.0</td><td>blastp</td>

<td> 182</td><td> 671</td><td> 807</td><td>radish</td><td> 206</td><td> 93</td><td> 100.0</td><td>blastp</td>

<td> 183</td><td> 672</td><td> 808</td><td>b oleracea</td><td> 209</td><td> 87</td><td> 52.6</td><td>blastp</td>

<td> 184</td><td> 673</td><td> 809</td><td>b boy</td><td> 209</td><td> 86</td><td> 51.9</td><td>blastp</td>

<td> 185</td><td> 674</td><td> 810</td><td>canola</td><td> 209</td><td> 88</td><td> 100.0</td><td>blastp</td>

98/119

<td></td><td>Polynucleoti in SEQ ID N 0:</td><td>Polypeptide SEQJD_NO:</td><td>Organism</td><td>Homology to SEQ_ID_NO:</td><td>% identity</td><td>% query coverage</td><td>Algorithm</td>

<td colspan="8">continuation of table 18</td>

<td> 186</td><td> 675</td><td> 811</td><td>apple</td><td> 216</td><td> 89</td><td> 100.0</td><td>blastp</td>

<td> 187</td><td> 676</td><td> 812</td><td>apple</td><td> 216</td><td> 89</td><td> 100.0</td><td>blastp</td>

<td> 188</td><td> 677</td><td> 813</td><td>avocado</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 189</td><td> 678</td><td> 814</td><td>bjuncea</td><td> 216</td><td> 97</td><td> 69.1</td><td>blastp</td>

<td> 190</td><td> 679</td><td> 815</td><td>bjuncea</td><td> 216</td><td> 98</td><td> 91.2</td><td>blastp</td>

<td> 191</td><td> 680</td><td> 816</td><td>bjuncea</td><td> 216</td><td> 97</td><td> 100.0</td><td>blastp</td>

<td> 192</td><td> 681</td><td> 817</td><td>b boy</td><td> 216</td><td> 97</td><td> 100.0</td><td>blastp</td>

<td> 193</td><td> 682</td><td> 818</td><td>bean</td><td> 216</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 194</td><td> 683</td><td> 819</td><td>brachypodium</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 195</td><td> 684</td><td> 820</td><td>cassava</td><td> 216</td><td> 91</td><td> 100.0</td><td>blastp</td>

<td> 196</td><td> 685</td><td> 821</td><td>cassava</td><td> 216</td><td> 86</td><td> 100.0</td><td>blastp</td>

<td> 197</td><td> 686</td><td> 822</td><td>castorbean</td><td> 216</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 198</td><td> 687</td><td> 823</td><td>centaurea</td><td> 216</td><td> 86</td><td> 100.0</td><td>blastp</td>

<td> 199</td><td> 688</td><td> 824</td><td>centaurea</td><td> 216</td><td> 86</td><td> 100.0</td><td>blastp</td>

<td> 200</td><td> 689</td><td> 825</td><td>citrus</td><td> 216</td><td> 89</td><td> 100.0</td><td>blastp</td>

<td> 201</td><td> 690</td><td> 826</td><td>citrus</td><td> 216</td><td> 89</td><td> 100.0</td><td>blastp</td>

<td> 202</td><td> 691</td><td> 827</td><td>coffea</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 203</td><td> 692</td><td> 828</td><td>cotton</td><td> 216</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 204</td><td> 693</td><td> 829</td><td>iceplant</td><td> 216</td><td> 86</td><td> 100.0</td><td>blastp</td>

<td> 205</td><td> 694</td><td> 830</td><td>ipomoea</td><td> 216</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 206</td><td> 695</td><td> 831</td><td>lettuce</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 207</td><td> 696</td><td> 832</td><td>lettuce</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 208</td><td> 697</td><td> 833</td><td>lettuce</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 209</td><td> 698</td><td> 834</td><td>lettuce</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 210</td><td> 699</td><td> 835</td><td>lotus</td><td> 216</td><td> 89</td><td> 100.0</td><td>blastp</td>

<td> 211</td><td> 700</td><td> 836</td><td>medicago</td><td> 216</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 212</td><td> 701</td><td> 837</td><td>pepper</td><td> 216</td><td> 86</td><td> 100.0</td><td>blastp</td>

<td> 213</td><td> 702</td><td> 838</td><td>periwinkle</td><td> 216</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 214</td><td> 703</td><td> 839</td><td>petunia</td><td> 216</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 215</td><td> 704</td><td> 840</td><td>potato</td><td> 216</td><td> 86</td><td> 97.1</td><td>blastp</td>

<td> 216</td><td> 705</td><td> 841</td><td>radish</td><td> 216</td><td> 95</td><td> 100.0</td><td>blastp</td>

<td> 217</td><td> 706</td><td> 842</td><td>radish</td><td> 216</td><td> 95</td><td> 100.0</td><td>blastp</td>

<td> 218</td><td> 707</td><td> 843</td><td>radish</td><td> 216</td><td> 97</td><td> 100.0</td><td>blastp</td>

<td> 219</td><td> 708</td><td> 844</td><td>rose</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 220</td><td> 709</td><td> 845</td><td>safflower</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 221</td><td> 710</td><td> 846</td><td>safflower</td><td> 216</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 222</td><td> 711</td><td> 847</td><td>safflower</td><td> 216</td><td> 86</td><td> 100.0</td><td>blastp</td>

<td> 223</td><td> 712</td><td> 848</td><td>soybean</td><td> 216</td><td> 91</td><td> 100.0</td><td>blastp</td>

<td> 224</td><td> 713</td><td> 849</td><td>soybean</td><td> 216</td><td> 91</td><td> 100.0</td><td>blastp</td>

<td> 225</td><td> 714</td><td> 850</td><td>spurge</td><td> 216</td><td> 89</td><td> 97.1</td><td>blastp</td>

<td> 226</td><td> 715</td><td> 851</td><td>strawberry</td><td> 216</td><td> 86</td><td> 100.0</td><td>blastp</td>

<td> 227</td><td> 716</td><td></td><td>thellungiella</td><td> 216</td><td> 90</td><td> 92.6</td><td>tblastn</td>

<td> 228</td><td> 717</td><td> 852</td><td>tobacco</td><td> 216</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 229</td><td> 718</td><td> 853</td><td>radish</td><td> 219</td><td> 87</td><td> 100.0</td><td>blastp</td>

<td> 230</td><td> 719</td><td> 854</td><td>radish</td><td> 219</td><td> 92</td><td> 54.8</td><td>blastp</td>

<td> 231</td><td> 720</td><td> 855</td><td>b oleracea</td><td> 220</td><td> 93</td><td> 70.8</td><td>blastp</td>

<td> 232</td><td> 721</td><td> 856</td><td>b boy</td><td> 220</td><td> 93</td><td> 99.1</td><td>blastp</td>

<td> 233</td><td> 722</td><td> 857</td><td>canola</td><td> 220</td><td> 93</td><td> 81.5</td><td>blastp</td>

<td> 234</td><td> 723</td><td> 858</td><td>radish</td><td> 220</td><td> 93</td><td> 99.1</td><td>blastp</td>

<td> 235</td><td> 724</td><td> 859</td><td>radish</td><td> 220</td><td> 93</td><td> 99.4</td><td>blastp</td>

<td> 236</td><td> 725</td><td> 860</td><td>arabidopsis</td><td> 244</td><td> 96</td><td> 99.6</td><td>blastp</td>

<td> 237</td><td> 726</td><td> 861</td><td>arabidopsis</td><td> 244</td><td> 96</td><td> 99.3</td><td>tblastn</td>

<td> 238</td><td> 727</td><td> 862</td><td>b boy</td><td> 246</td><td> 86</td><td> 52.1</td><td>blastp</td>

<td> 239</td><td> 728</td><td> 863</td><td>canola</td><td> 246</td><td> 85</td><td> 53.4</td><td>blastp</td>

<td> 240</td><td> 729</td><td> 864</td><td>canola</td><td> 258</td><td> 87</td><td> 100.0</td><td>blastp</td>

<td> 241</td><td> 730</td><td> 865</td><td>canola</td><td> 266</td><td> 86</td><td> 51.5</td><td>blastp</td>

<td> 242</td><td> 731</td><td> 866</td><td>b oleracea</td><td> 272</td><td> 85</td><td> 97.1</td><td>blastp</td>

<td> 243</td><td> 732</td><td> 867</td><td>canola</td><td> 272</td><td> 85</td><td> 97.1</td><td>blastp</td>

99/119

<td></td><td>Polynucleoti in SEQJD_N THE:</td><td>Polypeptide SEQJD_NO:</td><td>Organism</td><td>Homology to SEQJD_NO:</td><td>% identity</td><td>% query coverage</td><td>Algorithm</td>

<td colspan="8">continuation of table 18</td>

<td> 244</td><td> 733</td><td> 868</td><td>arabidopsis</td><td> 273</td><td> 87</td><td> 99.0</td><td>blastp</td>

<td> 245</td><td> 734</td><td> 869</td><td>b boy</td><td> 273</td><td> 94</td><td> 81.1</td><td>blastp</td>

<td> 246</td><td> 735</td><td> 870</td><td>b boy</td><td> 273</td><td> 88</td><td> 60.8</td><td>blastp</td>

<td> 247</td><td> 736</td><td> 871</td><td>b boy</td><td> 273</td><td> 94</td><td> 65.2</td><td>blastp</td>

<td> 248</td><td> 737</td><td> 872</td><td>radish</td><td> 273</td><td> 89</td><td> 75.4</td><td>blastp</td>

<td> 249</td><td> 738</td><td> 873</td><td>b boy</td><td> 274</td><td> 86</td><td> 81.0</td><td>blastp</td>

<td> 250</td><td> 739</td><td> 874</td><td>canola</td><td> 274</td><td> 90</td><td> 100.0</td><td>blastp</td>

<td> 251</td><td> 740</td><td> 875</td><td>arabidopsis</td><td> 277</td><td> 85</td><td> 57.7</td><td>blastp</td>

<td> 252</td><td> 741</td><td> 876</td><td>canola</td><td> 277</td><td> 90</td><td> 92.8</td><td>blastp</td>

<td> 253</td><td> 742</td><td> 877</td><td>radish</td><td> 277</td><td> 88</td><td> 99.1</td><td>blastp</td>

<td> 254</td><td> 743</td><td> 878</td><td>b oleracea</td><td> 282</td><td> 87</td><td> 75.2</td><td>blastp</td>

<td> 255</td><td> 744</td><td> 879</td><td>b boy</td><td> 283</td><td> 94</td><td> 74.6</td><td>blastp</td>

<td> 256</td><td> 745</td><td> 880</td><td>basilicum</td><td> 283</td><td> 85</td><td> 51.7</td><td>blastp</td>

<td> 257</td><td> 746</td><td> 881</td><td>canola</td><td> 283</td><td> 90</td><td> 58.1</td><td>blastp</td>

<td> 258</td><td> 747</td><td> 882</td><td>canola</td><td> 284</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 259</td><td> 748</td><td> 883</td><td>arabidopsis</td><td> 286</td><td> 88</td><td> 54.1</td><td>blastp</td>

<td> 260</td><td> 749</td><td> 884</td><td>arabidopsis</td><td> 286</td><td> 86</td><td> 98.2</td><td>blastp</td>

<td> 261</td><td> 750</td><td> 885</td><td>b boy</td><td> 286</td><td> 85</td><td> 59.2</td><td>blastp</td>

<td> 262</td><td> 751</td><td> 886</td><td>radish</td><td> 287</td><td> 91</td><td> 100.0</td><td>blastp</td>

<td> 263</td><td> 752</td><td> 887</td><td>thellungiella</td><td> 287</td><td> 93</td><td> 94.7</td><td>blastp</td>

<td> 264</td><td> 753</td><td> 888</td><td>canola</td><td> 288</td><td> 92</td><td> 60.4</td><td>blastp</td>

<td> 265</td><td> 754</td><td> 889</td><td>b oleracea</td><td> 297</td><td> 86</td><td> 96.1</td><td>blastp</td>

<td> 266</td><td> 755</td><td> 890</td><td>canola</td><td> 297</td><td> 85</td><td> 96.1</td><td>blastp</td>

<td> 267</td><td> 756</td><td> 891</td><td>canola</td><td> 297</td><td> 86</td><td> 96.1</td><td>blastp</td>

<td> 268</td><td> 757</td><td> 892</td><td>b oleracea</td><td> 299</td><td> 85</td><td> 53.2</td><td>blastp</td>

<td> 269</td><td> 758</td><td> 893</td><td>canola</td><td> 299</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 270</td><td> 759</td><td> 894</td><td>canola</td><td> 299</td><td> 85</td><td> 58.2</td><td>blastp</td>

<td> 271</td><td> 760</td><td> 895</td><td>canola</td><td> 300</td><td> 94</td><td> 51.9</td><td>blastp</td>

<td> 272</td><td> 761</td><td> 896</td><td>b boy</td><td> 301</td><td> 85</td><td> 98.1</td><td>blastp</td>

<td> 273</td><td> 762</td><td> 897</td><td>radish</td><td> 301</td><td> 86</td><td> 99.4</td><td>blastp</td>

<td> 274</td><td> 763</td><td> 898</td><td>b boy</td><td> 302</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 275</td><td> 764</td><td> 899</td><td>canola</td><td> 305</td><td> 92</td><td> 87.5</td><td>blastp</td>

<td> 276</td><td> 765</td><td> 900</td><td>canola</td><td> 305</td><td> 92</td><td> 94.8</td><td>blastp</td>

<td> 277</td><td> 766</td><td> 901</td><td>radish</td><td> 305</td><td> 92</td><td> 100.0</td><td>blastp</td>

<td> 278</td><td> 767</td><td> 902</td><td>b boy</td><td> 308</td><td> 91</td><td> 62.4</td><td>blastp</td>

<td> 279</td><td> 768</td><td> 903</td><td>radish</td><td> 308</td><td> 91</td><td> 51.4</td><td>blastp</td>

<td> 280</td><td> 769</td><td> 904</td><td>b boy</td><td> 310</td><td> 94</td><td> 89.1</td><td>blastp</td>

<td> 281</td><td> 770</td><td> 905</td><td>canola</td><td> 310</td><td> 93</td><td> 99.4</td><td>blastp</td>

<td> 282</td><td> 771</td><td> 906</td><td>radish</td><td> 310</td><td> 92</td><td> 99.7</td><td>blastp</td>

<td> 283</td><td> 772</td><td> 907</td><td>arabidopsis</td><td> 313</td><td> 91</td><td> 99.8</td><td>blastp</td>

<td> 284</td><td> 773</td><td> 908</td><td>b oleracea</td><td> 317</td><td> 93</td><td> 63.9</td><td>blastp</td>

<td> 285</td><td> 774</td><td> 909</td><td>canola</td><td> 317</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 286</td><td> 775</td><td> 910</td><td>arabidopsis</td><td> 318</td><td> 85</td><td> 99.9</td><td>blastp</td>

<td> 287</td><td> 776</td><td> 911</td><td>canola</td><td> 328</td><td> 85</td><td> 100.0</td><td>blastp</td>

<td> 288</td><td> 777</td><td> 912</td><td>b oleracea</td><td> 329</td><td> 93</td><td> 100.0</td><td>blastp</td>

<td> 289</td><td> 778</td><td> 913</td><td>b boy</td><td> 329</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 290</td><td> 779</td><td> 914</td><td>b boy</td><td> 329</td><td> 94</td><td> 100.0</td><td>blastp</td>

<td> 291</td><td> 780</td><td> 915</td><td>canola</td><td> 329</td><td> 88</td><td> 100.0</td><td>blastp</td>

<td> 292</td><td> 781</td><td> 916</td><td>canola</td><td> 329</td><td> 94</td><td> 100.0</td><td>blastp</td>

<td> 293</td><td> 782</td><td> 917</td><td>radish</td><td> 329</td><td> 88</td><td> 54.1</td><td>blastp</td>

<td> 294</td><td> 783</td><td> 918</td><td>thellungiella</td><td> 329</td><td> 93</td><td> 88.1</td><td>blastp</td>

<td> 295</td><td> 784</td><td> 919</td><td>b boy</td><td> 354</td><td> 91</td><td> 100.0</td><td>blastp</td>

<td> 296</td><td> 785</td><td> 920</td><td>canola</td><td> 354</td><td> 89</td><td> 67.7</td><td>blastp</td>

EXAMPLE β

IMPROVED TRANSGENIC PLANT PERFORMANCE

100/119

To analyze whether the transgenic plants perform better, the plants were grown in containers with an adequate amount of nutrient and water. Plants were analyzed for their size, growth rate, time to inflorescence (flowering), seed yield, seed oil content, weight of 1,000 seeds, dry matter and harvest index (CI - seed yield / dry matter ). The performance of transgenic plants was compared with control plants grown in parallel under the same conditions. The transgenic Mock plants expressing the uidA reporter gene (GUS-Intron) under the same promoter were used as controls.

The parameters were measured as described in Examples 1 and 2.

Statistical analysis - To identify genes that provide a significant improvement in plant performance, the results obtained from transgenic plants were compared to those obtained from control plants. The growth rate of the plant, plant area, sifting time, flowering time, 1,000 seed weight, seed yield, oil yield, dry matter, and harvest index area data were analyzed by single-ANOVA mode. To identify the overcome genes and constructs, the results of mixing the transformation events or independent events tested were analyzed. For gene in comparison with the control analysis, a t test was applied, using significance

101/119 of p &lt;0.05. The JMP statistical software package was used (Version 5.2.1., SAS Institute Inc., Cary. NC, United States).

Experimental results

The polynucleotide sequences of the invention were analyzed for a number of commercially desired traits.

Tables 19-24 represent the analysis of seed yield in plants that overexpress the polynucleotides of the invention under the regulation of a constituent (35S) or specific promoter (napin) of the seed. Each Table represents an independent experiment, using at least 5 independent events per gene. The genes not connected by the same letter as the control (A, B,) are significantly different from the control.

Table 19

Genes showing improved plant performance: seed yield

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the overexpressed polynucleotide</td><td rowspan="2">Under regulation</td><td colspan="3">Rend. without. per plant (gr)</td>

<td>Minimum Average Sq</td><td>Significance (t-Test compare to control)</td><td>% improvement</td>

<td>BDL8</td><td> 1021</td><td>35S</td><td> 0.264</td><td>THE</td><td> 15.9</td>

<td>BDL25</td><td> 1032</td><td>35S</td><td> 0.239</td><td>B</td><td> 5.2</td>

<td>BDL27</td><td> 1035</td><td>35S</td><td> 0.238</td><td>B</td><td> 4.8</td>

<td>BDL29</td><td> 1037</td><td>35S</td><td> 0.235</td><td>B</td><td> 3.4</td>

<td>BDL32a</td><td> 1038</td><td>35S</td><td> 0.228</td><td>B</td><td> 0.4</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.228</td><td>B</td><td> 0.0</td>

Table 20

Genes showing improved plant performance: seed yield

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the overexpressed polynucleotide</td><td rowspan="2">Under regulation</td><td colspan="4">Rend. without. per plant (gr)</td>

<td>Minimum Medium</td><td>Sq</td><td>Significance (t-Test compare to control)</td><td>% improvement</td>

<td>BDL3</td><td> 1017</td><td>35S</td><td colspan="2"> 0.447</td><td>THE</td><td> 10.9</td>

<td>BDL11</td><td> 1042</td><td>35S</td><td colspan="2"> 0.420</td><td>THE</td><td> 4.2</td>

<td>BDL17</td><td> 1043</td><td>35S</td><td colspan="2"> 0.426</td><td>THE</td><td> 5.8</td>

<td>CONTROL (GUS lntron)</td><td> 1049</td><td>35S</td><td colspan="2"> 0.403</td><td>THE</td><td> 0.0</td>

102/119

Table 21

Genes showing improved plant performance: seed yield_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: do polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="4">Rend. without. per plant (gr)</td>

<td>Minimum Medium Sq</td><td>Significance Test compare control)</td><td>(t- to</td><td>% improvement</td>

<td>BDL3</td><td> 1017</td><td>Napin</td><td> 0.492</td><td colspan="2">THE</td><td> 13.4</td>

<td>BDL6</td><td> 1019</td><td>Napin</td><td> 0.469</td><td colspan="2">B</td><td> 8.1</td>

<td>BDL28</td><td> 1036</td><td>Napin</td><td> 0.470</td><td colspan="2">B</td><td> 8.3</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>Napin</td><td> 0.434</td><td colspan="2">B</td><td> 0.0</td>

Table 22

Genes showing improved p1anta performance: seed yield_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: do polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Rend. without. per plant (gr)</td>

<td>Minimum Average Sq</td><td>Significance (t-Test compare to control)</td><td>% improvement</td>

<td>BDL1</td><td> 1040</td><td>35S</td><td> 0.359</td><td>THE</td><td> 23.5</td>

<td>BDL12</td><td> 1023</td><td>35S</td><td> 0.319</td><td>B</td><td> 9.7</td>

<td>BDL14</td><td> 1024</td><td>35S</td><td> 0.378</td><td>THE</td><td> 30.3</td>

<td>BDL18</td><td> .1027</td><td>35S</td><td> 0.334</td><td>B</td><td> 15.0</td>

<td>BDL20a</td><td> 1029</td><td>35S</td><td> 0.325</td><td>B</td><td> 12.0</td>

<td>BDL20b</td><td> 1044</td><td>35S</td><td> 0.323</td><td>B</td><td> 11.4</td>

<td>BDL26a</td><td> 1033</td><td>35S</td><td> 0.340</td><td>B</td><td> 17.0</td>

<td>BDL26b</td><td> 1034</td><td>35S</td><td> 0.318</td><td>B</td><td> 9.7</td>

<td>BDL30</td><td> 1046</td><td>35S</td><td> 0.340</td><td>B</td><td> 17.2</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.290</td><td>B</td><td> 0.0</td>

Table 23

Genes showing improved plant performance: seed yield_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: do polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="4">Rend. without. per plant (gr)</td>

<td>Minimum Medium Sq</td><td>Significance Test compare control)</td><td>(t- to</td><td>% improvement</td>

<td>BDL9</td><td> 1022</td><td>35S</td><td> 0.312</td><td colspan="2">B</td><td> 10.1</td>

<td>BDL27</td><td> 1035</td><td>35S</td><td> 0.320</td><td colspan="2">THE</td><td> 13.0</td>

<td>BDL32b</td><td> 1039</td><td>35S</td><td> 0.334</td><td colspan="2">THE</td><td> 17.8</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.283</td><td colspan="2">B</td><td> 0.0</td>

Table 24

Genes showing improved plant performance: seed yield_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: do polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="4">Rend. without. per plant (gr)</td>

<td>Minimum Medium Sq</td><td>Significance Test compare control)</td><td>(t- to</td><td>% improvement</td>

<td>BDL25</td><td> 1032</td><td>Napin</td><td> 0.41</td><td colspan="2">B</td><td> 0.1</td>

<td>BDL29</td><td> 1037</td><td>Napin</td><td> 0.44</td><td colspan="2">B</td><td> 8.3</td>

<td>BDL32b</td><td> 1039</td><td>Napin</td><td> 0.46</td><td colspan="2">THE</td><td> 13.0</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>Napin</td><td> 0.41</td><td colspan="2">B</td><td> 0.0</td>

103/119

Tables 25-30 describe the analysis of oil yield in plants that overexpress the polynucleotides of the invention under the regulation of a constituent (35S) or specific promoter (napin) of the seed. Each Table represents an independent experiment, using at least 5 independent events per gene. The genes not connected by the same letter as the control (A, B,) are significantly different from the control.

Table 25

Genes showing improved plant performance: oil yield_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: do polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="4">Oil yield per plant (gr)</td>

<td>Minimum Medium Sq</td><td>Significance Test compare control)</td><td>(t- to</td><td>% improvement</td>

<td>BDL8</td><td> 1021</td><td>35S</td><td> 0.080</td><td colspan="2">THE</td><td> 17.1</td>

<td>BDL25</td><td> 1032</td><td>35S</td><td> 0.074</td><td colspan="2">B</td><td> 8.3</td>

<td>BDL27</td><td> 1035</td><td>35S</td><td> 0.070</td><td colspan="2">B</td><td> 2.1</td>

<td>BDL32a</td><td> 1038</td><td>35S</td><td> 0.069</td><td colspan="2">B</td><td> 1.1</td>

<td>CONTROL (GUS Intron)</td><td> 1049</td><td>35S</td><td> 0.069</td><td colspan="2">B</td><td> 0.0</td>

Table 26

Genes showing improved plant performance: oil yield_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: do polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="4">Oil yield per plant (gr)</td>

<td>Minimum Medium Sq</td><td>Significance Test compare control)</td><td>(t- to</td><td>% improvement</td>

<td>BDL3</td><td> 1017</td><td>35S</td><td> 0.13</td><td colspan="2">THE</td><td> 13.7</td>

<td>BDL11</td><td> 1042</td><td>35S</td><td> 0.12</td><td colspan="2">THE</td><td> 7.0</td>

<td>BDL17</td><td> 1043</td><td>35S</td><td> 0.12</td><td colspan="2">THE</td><td> 6.5</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.12</td><td colspan="2">THE</td><td> 0.0</td>

Table 27

Genes showing improved plant performance: oil yield_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: do polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="4">Oil yield per plant (gr)</td>

<td>Minimum Medium Sq</td><td>Significance Test compare control)</td><td>fi- to</td><td>% improvement</td>

<td>BDL3</td><td> 1017</td><td>Napin</td><td> 0.149</td><td colspan="2">THE</td><td> 13.7</td>

<td>BDL6</td><td> 1019</td><td>Napin</td><td> 0.143</td><td colspan="2">B</td><td> 9.2</td>

<td>BDL28</td><td> 1036</td><td>Napin</td><td> 0.138</td><td colspan="2">B</td><td> 5.3</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>Napin</td><td> 0.131</td><td colspan="2">B</td><td> 0.0</td>

104/119

Table 28

Genes showing improved plant performance: oil yield_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: do polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Oil yield per plant (gr)</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL1</td><td> 1040</td><td>35S</td><td> 0.108</td><td>THE*</td><td> 23.7</td>

<td>BDL12</td><td> 1023</td><td>35S</td><td> 0.100</td><td>B</td><td> 14.2</td>

<td>BDL14</td><td> 1024</td><td>35S</td><td> 0.114</td><td>THE</td><td> 31.1</td>

<td>BDL18</td><td> 1027</td><td>35S</td><td> 0.102</td><td>B</td><td> 16.7</td>

<td>BDL20a</td><td> 1029</td><td>35S</td><td> 0.098</td><td>B</td><td> 12.0</td>

<td>BDL20b</td><td> 1044</td><td>35S</td><td> 0.098</td><td>B</td><td> 12.1</td>

<td>BDL26a</td><td> 1033</td><td>35S</td><td> 0.103</td><td>B</td><td> 18.0</td>

<td>BDL26b</td><td> 1034</td><td>35S</td><td> 0.097</td><td>B</td><td> 11.8</td>

<td>BDL30</td><td> 1046</td><td>35S</td><td> 0.107</td><td>B</td><td> 22.4</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.087</td><td>B</td><td> 0.0</td>

Table 28, * P = 0.07

Table 29

Genes showing improved plant performance: oil yield_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: do polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="4">Oil yield per plant (gr)</td>

<td>Minimum Medium Sq</td><td>Significance Test compare control)</td><td>(t- to</td><td>% improvement</td>

<td>BDL9</td><td> 1022</td><td>35S</td><td> 0.092</td><td colspan="2">B</td><td> 6.2</td>

<td>BDL27</td><td> 1035</td><td>35S</td><td> 0.095</td><td colspan="2">B</td><td> 9.1</td>

<td>BDL32b</td><td> 1039</td><td>35S</td><td> 0.101</td><td colspan="2">THE</td><td> 16.4</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.087</td><td colspan="2">B</td><td> 0.0</td>

Table 30

Genes showing improved 10 p1anta performance: oil yield_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: do polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="4">Oil yield per plant (gr)</td>

<td>Minimum Medium Sq</td><td>Significance Test compare control)</td><td>(t- to</td><td>% improvement</td>

<td>BDL25</td><td> 1032</td><td>Napin</td><td> 0.12</td><td colspan="2">B</td><td> 2.2</td>

<td>BDL29</td><td> 1037</td><td>Napin</td><td> 0.14</td><td colspan="2">THE</td><td> 15.8</td>

<td>BDL32b</td><td> 1039</td><td>Napin</td><td> 0.15</td><td colspan="2">THE</td><td> 20.6</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>Napin</td><td> 0.12</td><td colspan="2">B</td><td> 0.0</td>

Tables 31-32 represent analyzes of dry matter in plants that overexpress the polynucleotides of the invention under the regulation of a constituent (35S). Each Table represents an experiment

105/119 independent, using at least 5 independent events per gene. The genes not connected by the same letter as the control (A, B,) are significantly different from the control.

Table 31

Genes showing improved p1anta performance: dry matter_

<td rowspan="2">ld Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Dry matter per plant (gr)</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL6</td><td> 1019</td><td>35S</td><td> 1.0277</td><td>THE</td><td> 7.9</td>

<td>BDL14</td><td> 1024</td><td>35S</td><td> 1.0444</td><td>THE</td><td> 9.7</td>

<td>BDL18</td><td> 1027</td><td>35S</td><td> 0.985</td><td>THE</td><td> 3.4</td>

<td>BDL20b</td><td> 1044</td><td>35S</td><td> 1.0656</td><td>THE</td><td> 11.9</td>

<td>CONTROL (GUS Jntron)</td><td> 1049</td><td>35S</td><td> 0.9523</td><td>THE</td><td> 0.0</td>

Table 32

Genes showing improved plant performance: dry matter_

<td rowspan="2">ld Gene</td><td rowspan="2">SEQ ID No: of the overexpressed polynucleotide</td><td rowspan="2">Under regulation</td><td colspan="3">Dry matter per plant (gr)</td>

<td>Minimum Sq Medium</td><td>Significance (t-Test compare to control)</td><td>% improvement</td>

<td>BDL3</td><td> 1017</td><td>35S</td><td> 1.3915</td><td>THE</td><td> 3.3</td>

<td>BDL11</td><td> 1042</td><td>35S</td><td> 1.3638</td><td>THE</td><td> 1.2</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 1.3474</td><td>THE</td><td> 0.0</td>

Tables 33-34 represent the analysis of the harvest index (CI) in plants that overexpress the polynucleotides of the invention under the regulation of a constituent (35S) or specific promoter (napin) of the seed. Each Table represents an independent experiment, using at least 5 independent events per gene. The genes not connected by the same letter as the control (A,

B,) are significantly different from the control.

Table 33

106/119

Genes showing improved p1anta performance: harvest index (CI)

<td></td><td>SEQ</td><td>ID No: do</td><td rowspan="2">Under regulation</td><td colspan="3">Hl</td>

<td>ld Gene</td><td colspan="2">polynucleotide overexpressed</td><td>Minimum Medium Sq</td><td>Significance (t-Test compare to control)</td><td>% improvement</td>

<td>BDL3</td><td> 1017</td><td></td><td>35S</td><td> 0.3218</td><td>B</td><td> 7.2</td>

<td>BDL5</td><td> 1018</td><td></td><td>35S</td><td> 0.3094</td><td>B</td><td> 3.0</td>

<td>BDL8</td><td> 1021</td><td></td><td>35S</td><td> 0.3301</td><td>B</td><td> 9.9</td>

<td>BDL11</td><td> 1042</td><td></td><td>35S</td><td> 0.3063</td><td>B</td><td> 2.0</td>

<td>BDL17</td><td> 1043</td><td></td><td>35S</td><td> 0.3526</td><td>THE</td><td> 17.5</td>

<td>BDL25</td><td> 1032</td><td></td><td>35S</td><td> 0.3016</td><td>B</td><td> 0.4</td>

<td>CONTROL (GUS Jntron)</td><td> 1049</td><td></td><td>35S</td><td> 0.3002</td><td>B</td><td> 0.0</td>

Table 34

Genes showing improved plant performance: harvest index (CI) _

<td rowspan="2">ld Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Hl</td>

<td>Minimum Medium Sq</td><td>Significance (t-Test compare to control)</td><td>% improvement</td>

<td>BDL2</td><td> 1016</td><td>Napin</td><td> 0.342</td><td>B</td><td> 3.7</td>

<td>BDL3</td><td> 1017</td><td>Napin</td><td> 0.358</td><td>B</td><td> 8.8</td>

<td>BDL6</td><td> 1019</td><td>Napin</td><td> 0.365</td><td>B</td><td> 10.9</td>

<td>BDL28</td><td> 1036</td><td>Napin</td><td> 0.374</td><td>THE</td><td> 13.6</td>

<td>CONTROL (GUS lntron)</td><td> 1049</td><td>Napin</td><td> 0.329</td><td>B</td><td> 0.0</td>

Tables 35-38 represent the analysis of the harvest index (CI) in plants that overexpress the polynucleotides of the invention under the regulation of a constituent (35S) or specific promoter (napin) of the seed. Each Table represents an independent experiment, using at least 5 independent events per gene. The genes not connected by the same letter as the control (A, B,) are significantly different from the control.

Table 35

Genes showing improved plant performance: Growth rate_

<td rowspan="2">ld Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Growth Rate (cm²/ day)</td>

<td>Minimum Medium Sq</td><td>Significance (t-Test compare to control)</td><td>% improvement</td>

<td>BDL14</td><td> 1024</td><td>35S</td><td> 2.48</td><td>THE</td><td> 6.4</td>

<td>BDL18</td><td> 1027</td><td>35S</td><td> 2.41</td><td>THE</td><td> 3.5</td>

<td>BDL20a</td><td> 1029</td><td>35S</td><td> 2.50</td><td>THE</td><td> 7.1</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 2.33</td><td>THE</td><td> 0.0</td>

107/119

Table 36

Genes showing improved plant performance: Growth rate_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Growth Rate (cm²/ day)</td>

<td>Minimum Medium Sq</td><td>Significance (t-Test compare to control)</td><td>% improvement</td>

<td>BDL11</td><td> 1042</td><td>35S</td><td> 1.80</td><td>THE</td><td> 15.4</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 1.56</td><td>THE</td><td> 0.0</td>

Table 37

Genes showing improved plant performance: Growth rate_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="2">Growth Rate (cm²/ day</td><td></td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL1</td><td> 1040</td><td>35S</td><td> 1.81</td><td>THE*</td><td> 17.1</td>

<td>BDL12</td><td> 1023</td><td>35S</td><td> 1.58</td><td>B</td><td> 2.0</td>

<td>BDL14</td><td> 1024</td><td>35S</td><td> 1.95</td><td>THE</td><td> 26.3</td>

<td>BDL18</td><td> 1027</td><td>35S</td><td> 1.59</td><td>B</td><td> 3.1</td>

<td>BDL20Ó</td><td> 1044</td><td>35S</td><td> 1.77</td><td>B</td><td> 14.6</td>

<td>BDL26a</td><td> 1033</td><td>35S</td><td> 1.57</td><td>B</td><td> 1.9</td>

<td>BDL30</td><td> 1046</td><td>35S</td><td> 1.75</td><td>B</td><td> 13.0</td>

<td>CONTROL (GUS Intron)</td><td> 1049</td><td>35S</td><td> 1.55</td><td>B</td><td> 0.0</td>

Table 37, * P = 0.06

Table 38

Genes showing improved plant performance: Growth rate_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Growth Rate (cm²/ day)</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL32b</td><td> 1039</td><td>35S</td><td> 1.19</td><td>THE</td><td> 0.8</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 1.18</td><td>THE</td><td> 0.0</td>

Tables 39-42 represent the analysis of the harvest index (CI) in plants that overexpress the polynucleotides of the invention under the regulation of a constituent (35S) or specific promoter (napin) of the seed. Each Table represents an independent experiment, using at least 5 independent events per gene. The

108/119 genes not connected by the same letter as the control (A, B,) are significantly different from the control.

Table 39

Genes showing improved plant performance: Area Rossete_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Rosette area (cm²)</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL6</td><td> 1019</td><td>35S</td><td> 9.73</td><td>THE</td><td> -10.2</td>

<td>BDL7</td><td> 1020</td><td>35S</td><td> 8.52</td><td>THE</td><td> -21.4</td>

<td>BDL14</td><td> 1024</td><td>35S</td><td> 11.83</td><td>THE</td><td> 9.2</td>

<td>BDL18</td><td> 1027</td><td>35S</td><td> 11.62</td><td>THE</td><td> 7.3</td>

<td>BDL20a</td><td> 1029</td><td>35S</td><td> 11.90</td><td>THE</td><td> 9.9</td>

<td>BDL20b</td><td> 1044</td><td>35S</td><td> 11.02</td><td>B</td><td> 1.7</td>

<td>BDL24</td><td> 1045</td><td>35S</td><td> 8.12</td><td>THE</td><td> -25.1</td>

<td>CONTROL (GUS Intron)</td><td> 1049</td><td>35S</td><td> 10.83</td><td>B</td><td> 0.0</td>

Table 39: Area increase

Rossete means better oil coverage and reduced oil water loss. Decrease in the rossete area means that more plants could be placed per area increasing yield.

Table 40

Genes showing improved plant performance: Area Rossete_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Rosette area (cm²)</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL3</td><td> 1017</td><td>35S</td><td> 11.99</td><td>THE</td><td> -3.6</td>

<td>BDL5</td><td> 1018</td><td>35S</td><td> 11.36</td><td>THE</td><td> -8.6</td>

<td>BDL8</td><td> 1021</td><td>35S</td><td> 9.31</td><td>B</td><td> -25.1</td>

<td>BDL11</td><td> 1042</td><td>35S</td><td> 14.09</td><td>THE</td><td> 13.2</td>

<td>BDL16</td><td> 1025</td><td>35S</td><td> 10.91</td><td>THE</td><td> -12.3</td>

<td>BDL17</td><td> 1043</td><td>35S</td><td> 9.97</td><td>B</td><td> -19.9</td>

<td>BDL25</td><td> 1032</td><td>35S</td><td> 7.95</td><td>B</td><td> -36.1</td>

<td>CONTROL (GUS lntron)</td><td> 1049</td><td>35S</td><td> 12.44</td><td>THE</td><td> 0.0</td>

Table 40: Area increase

Rossete means better oil coverage and reduced oil water loss. Decrease in the rossete area means that more plants could be placed per area increasing yield.

109/119

Table 41

Genes showing improved plant performance: Area Rossete_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Rosette area (cm²)</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL1</td><td> 1040</td><td>35S</td><td> 9.13</td><td>B</td><td> 12.4</td>

<td>BDL12</td><td> 1023</td><td>35S</td><td> 7.92</td><td>B</td><td> -2.5</td>

<td>BDL14</td><td> 1024</td><td>35S</td><td> 9.96</td><td>THE</td><td> 22.7</td>

<td>BDL18</td><td> 1027</td><td>35S</td><td> 8.63</td><td>B</td><td> 6.3</td>

<td>BDL20a</td><td> 1029</td><td>35S</td><td> 8.03</td><td>B</td><td> -1.1</td>

<td>BDL20b</td><td> 1044</td><td>35S</td><td> 9.14</td><td>B</td><td> 12.6</td>

<td>BDL26a</td><td> 1033</td><td>35S</td><td> 8.51</td><td>B</td><td> 4.8</td>

<td>BDL26b</td><td> 1034</td><td>35S</td><td> 7.92</td><td>B</td><td> -2.5</td>

<td>BDL30</td><td> 1046</td><td>35S</td><td> 9.28</td><td>THE</td><td> 14.2</td>

<td>CONTROL (GUS Jntron)</td><td> 1049</td><td>35S</td><td> 8.12</td><td>B</td><td> 0.0</td>

Table 41: Area increase

Rossete means better oil coverage and reduced oil water loss. Decrease in the rossete area means that more plants could be placed per area increasing yield.

Table 42

Genes showing improved plant performance: Area Rossete __

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Rosette area (cm²)</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL9</td><td> 1022</td><td>35S</td><td> 5.05</td><td>B</td><td> -17.0</td>

<td>BDL21</td><td> 1030</td><td>35S</td><td> 4.77</td><td>B</td><td> -21.5</td>

<td>BDL27</td><td> 1035</td><td>35S</td><td> 5.22</td><td>B</td><td> -14.2</td>

<td>BDL32b</td><td> 1039</td><td>35S</td><td> 6.19</td><td>THE</td><td> 1.8</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 6.08</td><td>THE</td><td> 0.0</td>

Table 42: Area increase

Rossete means better oil coverage and reduced oil water loss. Decrease in the rossete area means that more plants could be placed per area increasing yield.

Tables 43-49 represent the analysis of the harvest index (CI) in plants that

111/119

Table 46

Genes showing improved plant performance:% oil in seed_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">% Oil in sem.</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL3</td><td> 1017</td><td>Napin</td><td> 30.34</td><td>THE</td><td> 0.46</td>

<td>BDL6</td><td> 1019</td><td>Napin</td><td> 30.45</td><td>THE</td><td> 0.83</td>

<td>BDL28</td><td> 1036</td><td>Napin</td><td> 29.49</td><td>THE</td><td> 2.35</td>

<td>CONTROL (GUS Intron)</td><td> 1049</td><td>Napin</td><td> 30.2</td><td>THE</td><td> 0</td>

Table 47

Genes showing improved plant performance:% oil in seed_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">% Oil in sem.</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL12</td><td> 1023</td><td>35S</td><td> 31.30</td><td>THE</td><td> 3.7</td>

<td>BDL14</td><td> 1024</td><td>35S</td><td> 30.27</td><td>THE</td><td> 0.3</td>

<td>BDL18</td><td> 1027</td><td>35S</td><td> 30.39</td><td>THE</td><td> 0.7</td>

<td>BDL26a</td><td> 1033</td><td>35S</td><td> 30.33</td><td>THE</td><td> 0.5</td>

<td>BDL26b</td><td> 1034</td><td>35S</td><td> 30.43</td><td>THE</td><td> 0.8</td>

<td>BDL30</td><td> 1046</td><td>35S</td><td> 31.42</td><td>THE</td><td> 4.1</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 30.19</td><td>THE</td><td> 0.0</td>

Table 48

Genes showing improved plant performance:% oil in seed_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">% Oil in sem.</td>

<td>Minimum Medium Sq</td><td>Significance (t- Test compare to control)</td><td>% improvement</td>

<td>BDL21</td><td> 1030</td><td>35S</td><td> 30.55</td><td>THE</td><td> 1.8</td>

<td>BDL32b</td><td> 1039</td><td>35S</td><td> 30.35</td><td>THE</td><td> 1.1</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 30.01</td><td>THE</td><td> 0.0</td>

Table 49

Genes showing improved plant performance:% oil in seed_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">% Oil in sem.</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL25</td><td> 1032</td><td>Napin</td><td> 30.34</td><td>B</td><td> 1.5</td>

<td>BDL29</td><td> 1037</td><td>Napin</td><td> 31.54</td><td>THE</td><td> 5.5</td>

<td>BDL32b</td><td> 1039</td><td>Napin</td><td> 31.69</td><td>THE</td><td> 6.0</td>

<td>CONTROL (GUS Intron)</td><td> 1049</td><td>Napin</td><td> 29.90</td><td>B</td><td> 0.0</td>

112/119

Tables 50-55 represent the analysis of the harvest index (CI) in plants that overexpress the polynucleotides of the invention under the regulation of a constituent (35S) or specific promoter (napin) of the seed. Each

Table represents an independent experiment, using at least 5 independent events per gene. The genes not connected by the same letter as the control (A, B,) are significantly different from the control.

Table 50

Genes showing improved plant performance: weight of

1,000 seeds

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the overexpressed polynucleotide</td><td rowspan="2">Under regulation</td><td colspan="3">Weight of WOO sem.s (gr)</td>

<td>Minimum Sq Average</td><td>Significance (tT est compare to control)</td><td>% improvement</td>

<td>BDL8</td><td> 1021</td><td>35S</td><td> 0.019</td><td>B</td><td> 9.1</td>

<td>BDL21</td><td> 1030</td><td>35S</td><td> 0.018</td><td>B</td><td> 0.3</td>

<td>BDL25</td><td> 1032</td><td>35S</td><td> 0.018</td><td>B</td><td> 0.4</td>

<td>BDL32a</td><td> 1038</td><td>35S</td><td> 0.019</td><td>B</td><td> 5.5</td>

<td>BDL32b</td><td> 1039</td><td>35S</td><td> 0.020</td><td>THE</td><td> 14.2</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.018</td><td>B</td><td> 0.0</td>

Table 51

Genes showing improved plant performance: weight of 1,000 seeds

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the overexpressed polynucleotide</td><td rowspan="2">Under regulation</td><td colspan="3">Weight of 1000 sem.s (gr)</td>

<td>Minimum Medium Sq</td><td>Significance (t-Test compare to control)</td><td>% improvement</td>

<td>BDL6</td><td> 1019</td><td>35S</td><td> 0.019</td><td>B</td><td> 7.1</td>

<td>BDL7</td><td> 1020</td><td>35S</td><td> 0.018</td><td>B</td><td> 3.8</td>

<td>BDL14</td><td> 1024</td><td>35S</td><td> 0.019</td><td>B</td><td> 6.1</td>

<td>BDL18</td><td> 1027</td><td>35S</td><td> 0.019</td><td>B</td><td> 8.2</td>

<td>BDL20b</td><td> 1044</td><td>35S</td><td> 0.020</td><td>THE</td><td> 14.5</td>

<td>BDL24</td><td> 1045</td><td>35S</td><td> 0.018</td><td>B</td><td> 4.5</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.018</td><td>B</td><td> 0.0</td>

Table 52

Genes showing improved plant performance: weight of 1,000 seeds

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Weight of WOO sem.s (gr)</td>

<td>Minimum Sq Average</td><td>Significance (t-Test compare to control)</td><td>% improvement</td>

<td>BDL3</td><td> 1017</td><td>35S</td><td> 0.0214</td><td>B</td><td> 5.8</td>

<td>BDL5</td><td> 1018</td><td>35S</td><td> 0.0205</td><td>B</td><td> 1.1</td>

<td>BDL11</td><td> 1042</td><td>35S</td><td> 0.0235</td><td>THE</td><td> 15.7</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.0203</td><td>B</td><td> 0</td>

113/119

Table 53

Genes showing improved plant performance: weight of 1,000 seeds_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Weight of 1000 sem.s (gr)</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL2</td><td> 1016</td><td>Napin</td><td> 0.0290</td><td>THE</td><td> 30.7</td>

<td>BDL6</td><td> 1019</td><td>Napin</td><td> 0.0232</td><td>B</td><td> 4.3</td>

<td>BDL14</td><td> 1024</td><td>Napin</td><td> 0.0227</td><td>B</td><td> 2.3</td>

<td>BDL28</td><td> 1036</td><td>Napin</td><td> 0.0224</td><td>B</td><td> 1.0</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>Napin</td><td> 0.0222</td><td>B</td><td> 0.0</td>

Table 54

Genes showing improved plant performance: weight of 1,000 seeds_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Weight of 1000 sem.s (gr)</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL1</td><td> 1040</td><td>35S</td><td> 0.0235</td><td>B</td><td> 0.6</td>

<td>BDL12</td><td> 1023</td><td>35S</td><td> 0.0234</td><td>B</td><td> 0.1</td>

<td>BDL30</td><td> 1046</td><td>35S</td><td> 0.0252</td><td>THE</td><td> 7.8</td>

<td>CONTROL (GUSJntron)</td><td> 1049</td><td>35S</td><td> 0.0234</td><td>B</td><td> 0.0</td>

Table 55

Genes showing improved plant performance: weight of 1,000 seeds_

<td rowspan="2">Id Gene</td><td rowspan="2">SEQ ID No: of the polynucleotide overexpressed</td><td rowspan="2">Under regulation</td><td colspan="3">Weight of 1000 sem.s (gr)</td>

<td>Minimum Sq Medium</td><td>Significance (tTest compare to control)</td><td>% improvement</td>

<td>BDL12</td><td> 1023</td><td>Napin</td><td> 0.0206</td><td>B</td><td> 0.2</td>

<td>BDL18</td><td> 1027</td><td>Napin</td><td> 0.0214</td><td>B</td><td> 4.0</td>

<td>BDL25</td><td> 1032</td><td>Napin</td><td> 0.0208</td><td>B</td><td> 1.1</td>

<td>BDL27</td><td> 1035</td><td>Napin</td><td> 0.0211</td><td>B</td><td> 2.8</td>

<td>BDL29</td><td> 1037</td><td>Napin</td><td> 0.0211</td><td>B</td><td> 2.6</td>

<td>BDL32b</td><td> 1039</td><td>Napin</td><td> 0.0224</td><td>THE</td><td> 9.3</td>

<td>CONTROL (GUS lntron)</td><td> 1049</td><td>Napin</td><td> 0.0205</td><td>B</td><td> 0.0</td>

Taking into account the results obtained using these assays, the following BDL genes, when introduced exogenously into plants, induced a significant improvement in:

1. Seed yield:

BDL1, BDL3, BDL8, BDL14, BDL2 7, BDL32B.

2. Oil yield: BDL1, BDL3,

BDL8, BDL14, BDL29, BDL32B.

114/119

3. harvest index: BDL17, BDL28.

4. Growth rate: BDL1, BDL14.

5. Pink Area: BDL14, BDL18, BDL20a, BDL30.

6. % of oil in the seed: BDL20b, BDL19, BDL32b.

7. Weight of 1000 seeds: BDL2, BDL11, BDL20b, BDL30,

BDL32b.

EXAMPLE 7

INCREASED OIL CONTENT ON SHEETS

In general, oils are composed mainly of triacylglycerols (TAG). Arabidopsis seeds and other oilseeds containing high amounts of TAG. Generally, TAGs are being broken down into sugars through the germination process. Cermac and Benning (Plant journal 2004; 40, 575-585) in their function used an assay to quantify TAG production in seedlings grown in sucrose. They use this stage of development since normally the seedlings do not present TAG at high levels. In their study, they demonstrated the importance of a wrinkled gene in controlling oil production by showing that transgenic changes overexpress the wrinkled cDNA and produce high amounts of TAG.

Materials and methods

Experimental

The present inventor used the Cermac and Benning assay (Cermac and Benning (Plant journal 2004; 40, 575-585) with few changes to qualify the effect of the transgenes identified here for their ability to increase TAG in seedlings, similar to the wrinkled gene .

115/119

For the quantification of triacylglycerol in transgenic T seedlings₂ they grew on half of the MS medium (Murashige and Skoog, 1962 Plan Physiology 15, 473-497), pH 5.9, sucrose 2% and Agar 0.7%. The samples were sterilized by evaporation of 100 ml of bleach (10%) and 4 ml of HCI (37%) for 90 minutes in a closed plastic chamber of 5.5L volume.

Ammonium glufosinate and kanamycin were added to final concentrations of 20? G.ml^_1 for ammonium glufosinate and 50? g.ml^_1 kanamycin. After sterilization, the seeds were sown on agar plates. Paws were incubated in the dark at 4 ° C before placing them in the growth room. The conditions in the growth room were 24 ° C, a 12 hour light period and a 12 hour light period. The seedlings grew for 10-11 days.

Seedlings with an equal amount of 11 days were grown in 1.5 ml polypropylene test tubes with a glass rod, and the lipids were extracted in 50 ml of chloroform: methanol: formic acid (10: 10: 1, v / v). After extraction with 12.5 ml of 1 M KCl and H₃POWDER₄ 0.2 M and separation of the organic and aqueous phases by centrifugation at 16,000 g for 5 minutes, the lipids in the lower phase were separated on a TLC silica plate (Si 250 PA, JT Paker, Philipsburg, NJ) developed with 80: 20: 1 , petroleum ether: ethyl ether: acetic acid. The lipids were visualized by the stain with iodide vapor.

As positive controls the following were used: Triacylglycerols naturally

116/119 produced - extracted from the wild type arabidopsis seeds (line 5, Figure 3); and transgenic seedlings express WRINKLED cDNA (SEQ ID No: 1050), which are known to produce significant amounts of triacylglycerols in leaves (Cermac A and Benning C, The Plant Journal 2004, 40,

575-585). As a negative control, transgenic seedlings express the GUS-Intron gene (SEQ ID No: 1049) were used.

Experimental Results

Figure 3 represents the iodide vapor in the lipid stain isolated from transgenic plants of independent events (BDL9, WRINKLED) or event pool (GUS-Intron) expressing the following genes according to Table 56, below. An independent event represents a single stable transformed plant that resulted from the random integration of the transformed construction into the Arabidopsis genome. Progenies of an event harboring the transformed construct were used for the evaluation of genes separately as in the case of BDL9 and wrinkled genes or as an event pool in the case of GUS-Intron.

Table 56

<td>Via No.</td><td>Description of plant transformation</td><td>Name of the irregular gene or control plant</td>

<td> 1</td><td>Transformed with SEQ ID NO: 1022</td><td>BDL9 Event 1</td>

<td> 2</td><td>Transformed with SEQ ID NO: 1022</td><td>BDL9 Event 2</td>

<td> 3</td><td>Transformed with SEQ ID NO: 1022</td><td>BDL9 Event 3</td>

<td> 4</td><td>Transformed plant with control vector SEQ ID NO: 1049</td><td>GUS-Intron</td>

<td> 5</td><td>Untransformed plant</td><td>WITHOUT.</td>

<td> 6</td><td>Transformed with SEQ ID N0: 1050</td><td>Wrinkled Event 1</td>

<td> 7</td><td>Transformed with SEQ ID N0: 1050</td><td>Wrinkled Event 2</td>

<td> 8</td><td>Transformed with SEQ ID NQ: 1050</td><td>Wrinkled Event 3</td>

As shown in Figure 3, transgenic plants expressing the BDL9 gene (SEQ ID No: 1022) produced a significantly higher oil content

117/119 when compared to the oil content produced by control plants expressing GUS-Intron (SEQ ID No: 1049). In addition, the amount of oil produced by BDL9 transgenic plants (for example, Figure 3, line 2) is comparable to that produced by seeds (Figure 3, line 5) or by transgenic plants expressing the known wrinkled gene (Figure 3, line 6).

resume

The present inventors have identified Arabidopsis thaliana genes, which are important for embryogenesis, seed development and oil synthesis and accumulation. These genes, when overexpressed in plants, can effectively increase the oil content in seeds or leaves or any other part of the plant. Expression of specific tissue or embryonic genes in plants can result in an optimal increase in oil content in any plant tissue. Thus, transgenes can be expressed at certain stages of the embryo, seed development or to the stage of development of any target tissue, defined as accumulation oil in the tissue. This unique expression profile can be achieved using specific promoters, such as development promoters, seed expression and specific seed promoters.

The present inventors demonstrated improvement in oil synthesis and accumulation by increasing the size of the seed, which allows the synthesized oil to be accumulated to a greater extent, within a large volume.

118/119

In addition, increased oil can be achieved by controlling embryogenesis. The oil is accumulated in the developed seed embryo. Some of the early embryo development genes are directly in charge of regulating oil synthesis and storage.

The identified genes of the invention can improve oil yield in general, and more specifically oil synthesis, oil accumulation and seed size. The yield of the bioinformatics method described here is a set of highly predicted genes to improve the yield of oil and seeds by modifying their expression. Although each gene is expected to have its own impact, modifying the expression mode of more than one gene is expected to provide an additive or synergistic effect on the performance of the seed / oil yield of the plant. Changing the expression of each gene described here alone or a set of genes together increases the overall yield of the oil, so it is expected to lower the price of vegetable oil, as well as increase productivity.

Although the invention is described in conjunction with specific configurations, it is evident that many alternatives, modifications and variations will be apparent from those skilled in the art. In this way, it is intended to cover such alternatives, modifications and variations that are inserted in the spirit and scope of the attached claims.

119/119

All publications, patents and patent applications mentioned in these specifications are hereby incorporated in their entirety by reference specifications, the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification by any reference in this application should not be construed as an admission that such reference is available as a prior art for the present invention. As the section headings are used, they should not be constructed when necessarily limiting.

CR-ROM content

The following list the contents of the CD-ROM file that is attached here and filed with the application. The file information is provided as: File name / size in bytes / creation date / operating system / machine format.

CD-ROM1 (1 LISTED SEQUENCE file):

1. 40040_st25.txt / l, 820,000 bytes / April 9, 2008 /

Microsoft Windows XP Professional / PC.

1/4