Folate receptor 1 antibodies and immunoconjugates and uses thereof.
Abstract
Novel anti-cancer agents, including, but not limited to, antibodies and immunoconjugates, that bind to human folate receptor 1 are provided. Methods of using the agents, antibodies, or immunoconjugates, such as methods of inhibiting tumor growth are further provided.

Term
4.4 yearsleft in the term
Expires 24 February 2031.
- Priority
- Filed
- Granted
- Today
- Expires
47 claims: 13 independent, 34 dependent
- 1REIVINDICACIONES Habiéndose descrito la invención como antecede, se reclama como propiedad lo contenido en las siguientes reivindicaciones:1. Un anticuerpo humanizado o fragmento del mismo que une antígeno que se une específicamente a receptor de folato humano I, caracterizado porque el anticuerpo o fragmento de unión a antígeno comprende: (a) una CDR1 de cadena pesada que comprende GYFMN (SEQ ID NO: 1) ;una CDR2 de cadena pesada que comprende RIHPYDGDTFYNQKFQG (SEQ ID NO: 2) ;y una CDR3 de cadena pesada que comprende YDGSRAMDY (SEQ ID NO: 3);y (b) una CDR1 de cadena ligera que comprende KASQSVSFAGTSLMH (SEQ ID NO: 7);una CDR2 de cadena ligera que comprende RASNLEA (SEQ ID NO: 8);y una CDR3 de cadena ligera que comprende QQSREYPYT (SEQ ID NO: 9) .
- 2Un inmunoconjugado caracterizado porque tiene la fórmula (A) - (L) - (C), en donde:(A) comprende el anticuerpo o fragmento de unión a antígeno de conformidad con la reivindicación 1;(L) comprende un enlazador;y (C) comprende un agente citotóxico, en donde el enlazador (L) enlaza (A) con (C).
- 3El inmunoconjugado de conformidad con la reivindicación 2, caracterizado porque (A) comprende un - 199 IMPI INSTITUTO MEXICANO BE LA PROPIEDAD INDUSTRIAL anticuerpo que comprende la cadena pesada de la SEQ ID NO:6 y la cadena ligera de la SEQ ID NO: 12 o la SEQ ID NO: 13.
- 4El inmunoconjugado de conformidad con la reivindicación 2, caracterizado porque (A) comprende un anticuerpo o fragmento de unión a antígeno codificado por el ADN del plásmido depositado en la ATCC el 7 de abril del 2010 y que tiene los números de depósito ATCC PTA-10772, PTA-10773 o 10774. de la SEQ ID NO:4 y el dominio variable de cadena ligera de la SEQ ID NO: 10 o SEQ ID NO: 11. 7. El inmunocon j ugado de conformidad con la reivindicación 2, caracterizado porque el anticuerpo o fragmento de unión a antígeno, (A) , se une a un receptor de folato humano I con una Kd de 10 nM o menor. 8. El inmunocon jugado de conformidad con la reivindicación 2, caracterizado porque (L) comprende un enlazador que se selecciona del grupo que consiste de 4- (2- 200 IMPI INSTITUTO MEXICANO Dt LA PROPIEDAD INDUSTRIAL piridilditio)pentanoato de N-succinimidilcr—ffilPP) 4- f2piridilditio)-2-sulfopentanoato de N-succinimidilo (sulfoSPP) ;4-(2-piridilditio)butanoato de N-succinimidilo (SPDB), 4-(2-piridilditio)-2-sulfobutanoato de N-succinimidilo
- 55 (sulfo-SPDB);4-(maleimidometil)ciclohexanocarboxilato de Nsuccinimidilo (SMCC);4-(maleimidometil)ciclohexanocarboxilato de N-sulfosuccinimidilo (sulfoSMCC);4(yodoacetil)-aminobenzoato de N-succinimidilo (SIAB);y [ (Nmaleimidopropionamido)-tetraetilenglicol]éster de N10 succinimidilo (NHS-PEG4-maleimida).
- 69. El inmunocon jugado de conformidad con la reivindicación 2, caracterizado porque (C) comprende un agente citotóxico que se selecciona del grupo que consiste de un maitansinoide, benzodiazepina, taxoide, CC-1065, 15 duocarmicina, caliqueamicina, dolastatina, auristatina, tomaimicina y leptomicina o un profármaco del agente citotóxico.
- 710. El inmunocon j ugado de conformidad con la reivindicación 2, caracterizado porque (C) comprende N(2')20 desacetil-N(2')-(3-mercapto-l-oxopropil)-maitansina o N(2’)desacetil-N2-(4-mercapto-4-metil-l-oxopentil)-maitansina.
- 811. El inmunocon j ugado de conformidad con la reivindicación 10, caracterizado porque (A) comprende un anticuerpo humanizado que 25 comprende un dominio variable de cadena pesada de la SEQ ID - 201 IMPI INSTITUTO MEXICANO PE LA ntOFIEBAC INDUSTRIAL NO:4 y un dominio variable de cadena 1 i ge yarda, la GEQ ID· NQ t. 10 O SEQ ID NO: 11;(L) comprende 4-(2-piridilditio)-2-sulfobutanoato de N-succinimidilo (sulfo-SPDB);y (C) comprende N(2')-desacetil-N2-(4-mercapto-4metil-l-oxopentil)-maitansina.
- 912. Una composición farmacéutica caracterizada porque comprende el inmunoconjugado de conformidad con la reivindicación 2 y un portador farmacéuticamente aceptable.
- 1013. La composición farmacéutica de conformidad con la reivindicación 12, caracterizada porque los inmunoconjugados tienen un promedio de aproximadamente 3 a aproximadamente 4 de (C) por (A).
- 1114. Un reactivo de diagnóstico caracterizado porque comprende el anticuerpo o fragmento de unión a antígeno de conformidad con la reivindicación 1, el cual está marcado.
- 1215. Un kit caracterizado porque comprende el anticuerpo o fragmento de unión a antígeno de conformidad con la reivindicación 1.
- 1316. El anticuerpo humanizado o fragmento de unión a antígeno de conformidad con la reivindicación 1, caracterizado porque el anticuerpo o fragmento de unión a antígeno comprende un dominio variable de cadena pesada de la SEQ ID NO:4 y un dominio variable de cadena ligera de la SEQ - 202 IMPI INSTITUTO MEXICANO DE LA MORI EDAD INDUSTRIAL ID NO: 10 o SEQ ID NO: 11.
- 1417. El anticuerpo humanizado o fragmento de unión a antígeno de conformidad con la reivindicación 1, caracterizado porque el anticuerpo o fragmento de unión a antígeno comprende una cadena pesada de la SEQ ID NO:6 y una cadena ligera de la SEQ ID NO: 12 o SEQ ID NO: 13.
- 1518. El inmunocon jugado de conformidad con la reivindicación 10, caracterizado porque:(A) comprende un anticuerpo humanizado que comprende un dominio variable de cadena pesada de la SEQ ID NO: 4 y un dominio variable de cadena ligera de la SEQ ID NO: 11;(L) comprende 4-(2-piridilditio)-2-sulfobutanoato de N-succinimidilo (sulfo-SPDB);y (C) comprende N(2')-desacetil-N2-(4-mercapto-4metil-l-oxopentil)-maitansina.
- 1619. Una composición farmacéutica caracterizada porque comprende el inmunoconjugado de conformidad con la reivindicación 11 y un portador farmacéuticamente aceptable.
- 1720. Una composición farmacéutica caracterizada porque comprende el inmunoconjugado de conformidad con la reivindicación 18 y un portador farmacéuticamente aceptable.
- 1821. Un anticuerpo para usarse en el tratamiento de cáncer en un sujeto, donde el anticuerpo se une específicamente a un receptor de folato humano y comprende:- 203 IMPI INSTmiTO MEXICANO »E LA PROPIEDAD INDUSTRIAL (a) una CDRl de cadena pesada qúC~'L.ÓIllpluiide CYTTMIg. (SEQ ID NO: 1) ;una CDR2 de cadena pesada que comprende RIHPYDGDTFYNQKFQG (SEQ ID NO: 2);y una CDR3 de cadena pesada que comprende YDGSRAMDY (SEQ ID NO: 3);y (b) una CDRl de cadena ligera que comprende KASQSVSFAGTSLMH (SEQ ID NO: 7);una CDR2 de cadena ligera que comprende RASNLEA (SEQ ID NO: 8);y una CDR3 de cadena ligera que comprende QQSREYPYT (SEQ ID NO: 9).
- 1922. El anticuerpo de conformidad con la reivindicación 21, donde compite con Movl9 quimérico para unión especifica a un receptor de folato humano; y en donde Movl9 quimérico comprende una cadena pesada de la SEQ ID NO:19 y una cadena ligera de la SEQ ID NO: 20.
- 2023. El anticuerpo de conformidad con la reivindicación 21, donde el anticuerpo comprende un dominio variable de cadena pesada de la SEQ ID NO:4 y un dominio variable de cadena ligera de la SEQ ID NO: 10 o SEQ ID NO: 11.
- 2124. El anticuerpo de conformidad con la reivindicación 21, donde el anticuerpo comprende una cadena pesada de la SEQ ID NO:6 y una cadena ligera de la SEQ ID NO: 12 o SEQ ID NO: 13.
- 2225. El anticuerpo de conformidad con la reivindicación 21, donde el anticuerpo comprende una cadena pesada codificada por el ADN plásmido depositado con la ATCC - 204 IMPI INSTITUTO MEXICANO DE LA MONEDAD INDUSTRIAL el 7 de abril del 2010 y que tiene el número de depósito ATCC PTA-10772 y una cadena ligera codificada por el ADN plásmido depositado con la ATCC el 7 de abril del 2010 y que tiene el número de depósito ATCC PTA-10773 o 10774.
- 2326. El anticuerpo de conformidad con la reivindicación 21, donde el cáncer se selecciona del grupo que consiste de:cáncer de ovario, cáncer de mama, cáncer uterino, cáncer endometrial, cáncer pancreático, cáncer renal y cáncer de pulmón.
- 2427. El anticuerpo de conformidad con la reivindicación 26, donde el cáncer es cáncer de ovario.
- 2528. El anticuerpo de conformidad con la reivindicación 26, donde el cáncer es cáncer de pulmón.
- 2629. El anticuerpo de conformidad con la reivindicación 26, donde el cáncer es cáncer endometrial.
- 2730. Un i nmunocon jugado para usarse en el tratamiento de cáncer en un sujeto, donde el inmunoconj ugado tiene la fórmula (A) - (L) - (C), en donde:(A) es un anticuerpo o fragmento de unión a antígeno del mismo que se une específicamente a un receptor de folato humano;(L) es un enlazador;y (C) es un agente citotóxico;en donde (L) enlaza (A) con (C), en donde el anticuerpo o fragmento de unión a - 205 ΙΜΡΙ INSTITUTO MEXICANO DE LA RR R1EDAC INDUSTRIAL antígeno del mismo comprende: , (a) una CDRl de cadena pesada que comprende GYFMN (SEQ ID NO: 1) ;una CDR2 de cadena pesada que comprende RIHPYDGDTFYNQKFQG (SEQ ID NO: 2);y una CDR3 de cadena pesada que comprende YDGSRAMDY (SEQ ID NO: 3);y (b) una CDRl de cadena ligera que comprende KASQSVSFAGTSLMH (SEQ ID NO: 7);una CDR2 de cadena ligera que comprende RASNLEA (SEQ ID NO: 8);y una CDR3 de cadena ligera que comprende QQSREYPYT (SEQ ID NO: 9) .
- 2831. El inmunoconj ugado de conformidad con la reivindicación 30, donde el anticuerpo o fragmento de unión a antígeno del mismo comprende un dominio variable de cadena pesada de la SEQ ID NO:4 y un dominio variable de cadena ligera de la SEQ ID NO: 10 o SEQ ID NO: 11.
- 2932. El inmunocon j ugado de conformidad con la reivindicación 30, donde el anticuerpo comprende una cadena pesada de la SEQ ID NO:16 y una cadena ligera de la SEQ ID NO: 12 o SEQ ID NO: 13.
- 3033. El inmunoconj ugado de conformidad con la 20 reivindicación 30, donde el anticuerpo comprende una cadena pesada codificada por el ADN plásmido depositado con la ATCC el 7 de abril del 2010 y que tiene el número de depósito ATCC PTA-10772 y una cadena ligera codificada por el ADN plásmido depositado con el ATCC el 7 de abril del 2010 y que tiene un 25 número de depósito ATCC PTA-10773 o PTA-10774. 206 IMPI INSTITUTO MEXICANO DE LA EROWEDAD industrial
- 3134. El inmunocon jugado de conformidad con la reivindicación 30, donde el cáncer se selecciona del grupo que consiste de:cáncer de ovario, cáncer de mama, cáncer uterino, cáncer endometrial, cáncer pancreático, cáncer renal y cáncer de pulmón. selecciona del grupo que consiste de: un enlazador 15 escindible, un enlazador no escindible, un enlazador hidrofílico y un enlazador basado en ácido dicarboxílico.
- 3239. El inmunocon jugado de conformidad con la reivindicación 30, donde (L) es un enlazador que se selecciona del grupo que consiste de 4- (220 piridilditio)pentanoato de N-succinimidilo (SPP) o 4-(2piridilditio)-2-sulfopentanoato de N-succinimidilo (sulfoSPP) ;4-(2-piridilditio)butanoato de N-succinimidilo (SPDB), 4-(2-piridilditio)-2-sulfobutanoato de N-succinimidilo (sulfo-SPDB);4-(maleimidometil)ciclohexanocarboxilato de N25 succinimidilo 4-(maleimidometil)ciclohexano(SMCC);- 207 carboxilato de N-sulfosuccinimidilo (SMÍfpSMCC) IMPI INSTITUTO MEXICANO DE LA MONEDAD INDUSTRIAL (yodoacetil)-aminobenzoato de N-succinimidilo (SIAB);y [ (Nmaleimidopropionamido)-tetraetilenglicol]éster de Nsuccinimidilo (NHS-PEG4-maleimida).
- 3340. El inmunocon j ugado de conformidad con la reivindicación 39, donde (L) es 4-(2-piridilditio)butanoato de N-succinimidilo (SPDB) o sulfobutanoato de N-succinimidilo (sulfo-SPDB).
- 3441. El inmunocon j ugado de conformidad con la reivindicación 30, donde (C) es un agente citotóxico que se selecciona del grupo que consiste de:un maitansinoide, taxoide, CC-1065, caliqueamicina, dolastatina, auristatina, tomaimicina leptomicina o un profármaco del agente citotóxico. 4- (2-piridilditio)-2benzodiazepina, duocarmicina, y mercapto-4-metil-l-oxopentil)-maitansina. reivindicación 30, donde el inmunoconjugado comprende: 208 IMPI INSTITUTO MEXICANO O£ LA FROFIEDAD INDUSTRIAL O υ™ fragmento de un dominio variable dominio variable de (A) un anticuerpo humanizado unión a antígeno del mismo que comprende la cadena pesada de la SEQ ID NO: 4, y el cadena ligera de la SEQ ID NO: 10 o SEQ ID NO: 11;(L) 4-(2-piridilditio)-2-sulfobutanoato de Nsuccinimidilo (sulfo-SPDB);y (C) N(2')-desacetil-N(2')-(4-mercapto-4-metil-loxopentil)-maitansina.
- 3546. Un inmunocon jugado para usarse en el tratamiento de cáncer en un sujeto, donde una cantidad terapéuticamente eficaz de un inmunoconjugado que tiene la fórmula (A) - (L) - (C) está adaptado para ser administrable y, en donde:(A) comprende un anticuerpo humanizado o fragmento del mismo que une antígeno que une específicamente un receptor folato humano;(L) comprende el enlazador 4-(2-piridilditio)-2sulfobutanoato de N-succinimidilo (sulfo-SPDB);y (C) comprende el agente citotóxico N(2')desacetil-N(2')-(4-mercapto-4-metil-l-oxopentil)-maitansina. en donde (L) enlaza (A) con (C), en donde el anticuerpo o fragmento de unión a antígeno del mismo comprende: (a) una CDR1 de cadena pesada que comprende GYFMN (SEQ ID NO: 1) ;una CDR2 de cadena pesada que comprende - 209 ΙΜΡΙ INSTITUTO MEXICANO M LA PROPIEDAD INDUSTRIAL RIHPYDGDTFYNQKFQG (SEQ ID NO: 2);y una CDR3 de cadena pesada que comprende YDGSRAMDY (SEQ ID NO: 3);y (b) una CDR1 de cadena ligera que comprende KASQSVSFAGTSLMH (SEQ ID NO: 7);una CDR2 de cadena ligera que comprende RASNLEA (SEQ ID NO: 8);y una CDR3 de cadena ligera que comprende QQSREYPYT (SEQ ID NO: 9).
- 3647. El inmunoconjugado de conformidad con la reivindicación 46, donde el anticuerpo o fragmento de unión a antígeno del mismo comprende un dominio variable de cadena pesada de la SEQ ID NO:4 y un dominio variable de cadena ligera de la SEQ ID NO: 10 o SEQ ID NO: 11.
- 3748. El inmunocon j ugado de conformidad con la reivindicación 47, donde el anticuerpo o fragmento de unión a antígeno del mismo comprende el dominio variable de cadena ligera de la SEQ ID NO:11.
- 3849. El inmunocon j ugado de conformidad con la reivindicación 46, donde el anticuerpo comprende una cadena pesada de la SEQ ID NO:6 y una cadena ligera de la SEQ ID NO: 12 o SEQ ID NO: 13.
- 3950. El inmunocon j ugado de conformidad con la reivindicación 46, donde el cáncer se selecciona del grupo que consiste de:cáncer de ovario, cáncer de mama, cáncer uterino, cáncer endometrial, cáncer pancreático, cáncer renal y cáncer de pulmón.
- 4051. El inmunocon j ugado de conformidad con la - 210 IMPI INSTmjTO MEXICANO w *ΛΛ’ θΜ ΕΒλΕ INDUSTRIAL reivindicación 50, donde el cáncer es cáncer de ovario.
- 4152. El inmunocon jugado de conformidad con la reivindicación 50, donde el cáncer es cáncer de pulmón.
- 4253. El inmunocon jugado de conformidad con la reivindicación 50, donde el cáncer es cáncer endometrial.
- 4354. El inmunocon jugado de conformidad con la reivindicación 46, donde el inmunoconjugado tiene de 3 a 4 (C) por (A) .
- 4455. El inmunocon jugado de conformidad con la 10 reivindicación 30, donde el cáncer es cáncer de cerebro y en donde el inmunoconjugado está adaptado para ser administrabie intracranealmente.
- 4556. El inmunocon jugado de conformidad con la reivindicación 55, donde el inmunoconjugado está adaptado 15 para ser administrable intratecalmente o intraventricularmente.
- 4657. El inmunocon jugado de conformidad con la reivindicación 46, donde el cáncer es cáncer de cerebro y en donde el inmunoconjugado está adaptado para ser administrable 20 intracranealmente.
- 4758. El inmunocon jugado de conformidad con la reivindicación 57, donde el inmunoconjugado está adaptado para ser administrable intratecalmente o intraventricularmente. IMPI INSTITUTO MEXICANO W LA MONEDAD industrial 211
Independent claims47
1,309 paragraphs in 215 sections, as filed
(54) Title: ANTIBODIES AND IMMUNOCONJUGATES OF THE RECEIVER 1 OF FOLATE AND USES OF THEM. (54) Title: FOLATE RECEPTOR 1 ANTIBODIES AND IMMUNOCONJUGATES AND USES THEREOF.
(57) Summary
Novel anticancer agents are provided, including, but not limited to, antibodies and immunoconjugates, which bind to human folate receptor 1. Methods of using the agents, antibodies, or immunoconjugates, such as methods of inhibiting growth are also provided.
(57) Abstract
Novel anti-cancer agents, including, but not limited to, antibodies and immunoconjugates, that bind to human folate receptor 1 are provided. Methods of using the agents, antibodies, or immunoconjugates, such as methods of inhibiting tumor growth are further provided.
<img file="MX340437B_D0001.tif" />
<img file="MX340437B_D0002.tif" />
PATENT TITLE NO. 340437 _SE_
SKKiaiA OI «OMOMY
Mexican Institute of Industrial Property
Owner (s): IMMUNOGEN, INC.
Address: 830 Winter Street, Waltham, Massachusetts, 02451, USA
Name: ANTIBODIES AND IMMUNOCONJUGATES OF THE FOLATE RECEIVER 1 AND USES THEREOF.
Classification: lnt.CI.8: A61K47 / 48; C07K16 / 28
Inventor (s): OLGAAB; DANIEL TAVARES; LINGYUN RUI; GILLIAN PAYNE; VIKTOR S.
GOLDMAKHER
REQUEST
Number: Intemacloruti filing date:
MX / a / 2012/009754 February 24, 2011
PRIORITY
<td>Country:</td><td></td><td>Date:</td><td>Number:;</td>
<td>US</td><td></td><td>February 24, 2010</td><td> 61/307,79?</td>
<td>US</td><td></td><td>May 20, 2010</td><td> 61/346,59^</td>
<td>US</td><td></td><td>November 12, 2010</td><td> 61/413,172</td>
Validity: Twenty years Expiration Date: February 24, 2031, the reference patent was granted foundation in articles 1, 2 fraction V. 6 fraction HI. t fl> (te MFLayflfriá Industrial property ® and in accordance with article 23 counted from the date of | rights. β 'who holds the title, Industrial property (Cario Oflcijj ¢ 6/01/2004, 06/16/2006 ^ 25/01/20 nclso a), subsection iiil formed on 07/01/200 | tO of the Organic Statute
08/04/2004 and 09/13/20 (1 of the Industrial Property Law, this patent has UTO WDeAOjftCte-Wirte aftoaJfrn extendable, Ihtefefefei ........
presentation of the international application and will be subje ct to (M0B da i does so based on the provisions of the articles of the Federation, (DO F.) 08/27/1081, amended on 06, 05/06 / 2009.06 / Wegfl, 18 / 0672ÍJ1W, 06/28 / gjJp ^ lotions I and III of the
14, 2B / 07/2004 and 7/09/200 '' Mexican Tutor of Property
<img file="MX340437B_D0003.tif" />
l peta manteffer valid los y 7 'Dis 2,
J 5/1996, 12/26/1 í 4/2012); articles j H | Kpiedad Industrial (Dq WSso a), sub Clause II), 16 f ri 2/1999, amended on 10/10/201
Subparagraph a) jr antepenultimate paragraph of the Agreement powers in the
Departmental and other subordinates of the Mexican Institute of Industrial Property. (DOF 12/15/1999, amended 07/29/2004, 04/08/2004 and 09/13/2007).
je the Law of the 7, 05/17/1999,
3rd fraction V ¡F. 14/12/1999 ,; I and III and
07/29/2004, you will be General Coordinators on 04/02/2000,
Issue Date: July 8, 2016
DIVISIONAL DEPUTY DIRECTOR OF EXAMINATION OF PATENT FUND, MECHANICAL, ELECTRICAL AREA AND REGISTRY OF INDUSTRIAL DESIGNS AND
<img file="MX340437B_D0004.tif" />
Arenal No. 550, Floor 1,
Col. Pueblo Santa María Tepepan. Xoohtrnicc CP. 16020.
Mexico City
Tea!. (55) 53 34 07 00 www.impi qob mx
NET
<img file="MX340437B_D0005.tif" />
<img file="MX340437B_D0006.tif" />
MX / 2016/53399
<img file="MX340437B_D0007.tif" />
<img file="MX340437B_D0008.tif" />
IMPI
<img file="MX340437B_D0009.tif" />
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0010.tif" />
ANTIBODIES AND IMMUNOCONJUGATES OF FOLATE RECEIVER 1 AND
USES OF THE SAME
FIELD OF THE INVENTION
The field of this invention relates, in general, to antibodies and immunoconjugates that bind to human folate receptor 1, as well as to methods of using the antibodies and immunoconjugates for the treatment of diseases such as cancer.
BACKGROUND OF THE INVENTION
Cancer is a leading cause of death in the developed world, with more than one million people diagnosed with cancer and 500,000 deaths per year in the United States alone. Overall, it is estimated that more than 1 in 3 people will develop some form of cancer during their lifetime. There are more than 200 different types of cancer, four of which — breast, lung, colorectal, and prostate — account for more than half of all new cases (Jemal et al.,
2003, Cancer J. Clin. 53: 5-26).
Folate receptor 1 (FOLR1), also known as folate receptor-alpha, or folate-binding protein, is an N-glycosylated protein that is expressed on the plasma membrane of cells. FOLR1 has a high affinity for folic acid and various reduced derivatives of
REF .: 233864
IMPI
MEXICAN INSTITUTE DF LA BltOBIEDAC INDUSTRIAL
<img file="MX340437B_D0011.tif" />
folic acid. FOLR1 mediates the delivery of the physiological folotgi, 5-methyltetrahydrofolate, into the cells.
FOLR1 is overexpressed in the vast majority of ovarian cancers, as well as in many cancers of the uterus, endometrium, pancreas, kidney, lung and breast, while the expression of FOLR1 on normal tissues is limited to the apical membrane of the epithelial cells in the proximal tubules of the kidney, alveolar pneumocytes of the lung, bladder, testes, choroid plexus, and thyroid (Weitman SD, et al., Cancer Res 52: 3396-3401 (1992);
Anthony AC, Annu Rev Nutr 16: 501-521 (1996); Kalli KR, and others. Gynecol Oncol 108: 619-626 (2008)). This pattern of expression makes FOLR1 a convenient target for FOLR1 targeted cancer therapy.
Because ovarian cancer is typically asymptomatic through the advanced phase, it is frequently diagnosed late, and has a poor prognosis when treated with currently available procedures, typically with chemotherapy drugs applied after cytoreductive surgery (von Gruenigen V et al., Cancer 112: 2221-2227 (2008); Ayhan A et al., Am J
Obstet Gynecol 196: 81 e81-86 (2007); Harry VN and others,
Obstet Gynecol Surv 64: 548-560 (2009)). Thus, there is a clear unmet medical need for more therapeutics.
IMPI
MEXICAN INSTITUTE Df THE INDUSTRIAL PROPERTY
<img file="MX340437B_D0012.tif" />
effective for ovarian cancers. —— <..
Three anti-FOLR1 antibodies have been tested as powerful anticancer drugs. Murine monoclonal antibodies Movl8 and Movl9 were isolated in the late 1980s (Miotti S et al., Int J Cancer 39: 297-303 (1987)); were confirmed for the FOLR1 target (Coney LR et al., Cancer Res 51: 6125-6132 (1991)); and were tested in pre-clinical studies for their ability to eradicate cancer cells that express the antigen when conjugated to the ribosome-inactivating cytotoxic protein (Conde FP et al., Eur J
Biochem 178: 795-802 (1989)).
Movl9 was tested as a bi-specific antibody directed at cytotoxic T cells and natural cytolytic cells (Mezzanzanica D et al., Int J Cancer 41: 609-615 (1988); Ferrini S et al., Int J Cancer Suppl 4: 53 -55 (1989); Ferrini S et al., Int J Cancer 48: 227-233 (1991)); and as a Movl9 single chain Fv (scFv) fusion protein with interleukin-2 in vivo (Melani C et al., Cancer Res 58: 4146-4154 (1998)). The chimeric anti-FOLRl antibodies (murine variable chain / human constant chain) of Movl8 and Movl9 have been pre-clinically examined for their ability to mediate cytotoxic immune cell dependent death in tumor cells expressing FOLR1 in vitro (Coney LR et al., Cancer Res 54: 2448-2455 (1994)); and a Movl8-chimeric IgE was tested in the models
IMPI
MEXICAN INSTITUTE OE THE PROPERTY
INDUSTRIAL
<img file="MX340437B_D0013.tif" />
dependent preclinical immunotherapeutics — [g ..... igg (Karagiannis SN et al., J Iiamunol 179: 2832-2843 (2007);
Gould HJ et al., Eur J Immunol 29: 3527-3537 (1999)).
Movl8 was studied as conjugates with different radionuclides in preclinical studies and then, in the early 1990s, in clinical trials (Zacchetti A et al., Nucí Med Biol 36: 759-770 (2009)); that ended without any drug being approved for clinical use.
MORAb003, a humanized form of the murine anti-FOLRl LK26 monoclonal antibody was evaluated pre-clinically as an unmodified antibody (Ebel W et al. Cancer Immun 7: 6 (2007)) and as a conjugate with the radionuclide
In<sup>111</sup> (Smith-Jones PM et al., Nucí Med Biol 35: 343-351 (2008)); and is currently being tested in clinical trials as an unmodified antibody (DK Armstrong et al., J. Clin. Oncol. 26 :, May 20, 2008, suppl; abstract
5500) .
SUMMARY OF THE INVENTION
The present invention provides novel antibodies that bind to human folate receptor 1, immunoconjugates comprising these antibodies, and methods for their use. The present invention further provides new polypeptides, such as antibodies that bind to human folate receptor 1, fragments of which
<img file="MX340437B_D0014.tif" />
antibodies, and other related polypeptides © -s — rare antibodies. Polynucleotides comprising the nucleic acid sequences encoding the polypeptides are also provided, as are vectors comprising the polynucleotides. Cells comprising the polypeptides and / or polynucleotides of the invention are further provided. Compositions (eg, pharmaceutical compositions); comprising new antibodies or immunoconjugates for folate receptor 1 are also provided. In addition, methods of preparing and using the new antibodies or immunoconjugates for folate receptor 1 are also provided, such as methods of using the new antibodies or immunoconjugates for folate receptor 1 to inhibit tumor growth and / or treat the Cancer.
Thus, in one aspect, the invention provides a humanized antibody or antigen-binding fragment thereof that specifically binds to a human folate receptor 1, where the antibody comprises (a) a heavy chain CDR1 that includes GYFMN (seo. with ident number: l); a heavy chain CDR2 comprising RIHPYDGDTFYNQXaaiFXaa<sub>2</sub>Xaa<sub>3</sub> (section with ident number: 56); and a heavy chain CDR3 comprising YDGSRAMDY (sec. with ID No.:3) and (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (sec. with ID No.:7); a CDR2 of
<img file="MX340437B_D0015.tif" />
<img file="MX340437B_D0016.tif" />
light chain comprising RASNLEA (se
<img file="MX340437B_D0017.tif" />
ident.:8); and a light chain CDR3 comprising QQSREYPYT (seo. with ident no .: 9); where Xaai is selected from K, Q, H and R; Xaa<sub>2</sub> is selected from Q, Η, N, and R, and Xaa3 is selected from G, E, T, S, A, and V. In a certain embodiment, the humanized antibody or antigen binding fragment thereof binds to a human folate receptor 1 with the same substantial affinity as the Movl9 chimeric antibody. In a certain embodiment, the humanized antibody or antigen binding fragment thereof comprises CDR2 of sequence RIHPYDGDTFYNQKFQG (seo. With ID #: 2) of a heavy chain.
In a certain embodiment, the binding affinity is measured by flow cytometry, Biacore, or radioimmunoassay.
In another embodiment, the invention provides a humanized antibody or antigen binding fragment thereof that specifically binds to a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising GYFMN ( section with ID number:
one) ; or a variant thereof comprising 1, 2, 3, or 4 conserved amino acid substitutions; a heavy chain CDR2 comprising RIHPYDGDTFYNQKFQG (sec. with ID #: 2); or a variant thereof comprising 1, 2, 3, or 4 conserved amino acid substitutions; and a heavy chain CDR3 comprising YDGSRAMDY (sec. no.
ΙΜΡΙ
MEXICAN INSTITUTE OF PROPERTY
INDUSTRIAL
<img file="MX340437B_D0018.tif" />
ident.:3); or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (sec. with ID No.:7); or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; a light chain CDR2 comprising RASNLEA (sec. no. of ident.:8); or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and a light chain CDR3 comprising QQSREYPYT (sec. ID No.:9); or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
In a certain embodiment, the invention provides a humanized antibody or antigen binding fragment thereof that specifically binds to human folate receptor 1 comprising a sec heavy chain. with no. ID: 6. In another embodiment, the humanized antibody or antigen-binding fragment thereof is encoded by the plasmid DNA deposited with the ATCC on April 7, 2010 and which has the deposit numbers of the ATCC PTA -10772 and PTA10773 or 10774.
In a certain embodiment, the invention provides a humanized antibody or antigen-binding fragment thereof that competes for binding to FOLRl with an antibody comprising (a) a heavy chain CDR1 comprising GYFMN (SEQ. No. ident.: 1); a heavy chain CDR2 that
ΙΜΡΙ
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0019.tif" />
comprises RIHPYDGDTFYNQXaaiFXaa2Xaa3 (seo. '-with ID No.:56); and a heavy chain CDR3 comprising YDGSRAMDY (sec. with ID No.:3); and (b) a light chain CDR1 comprises KASQSVSFAGTSLMH (sec. with ID No.:7); a light chain CDR2 comprising RASNLEA (SEQ ID NO: 8); and a light chain CDR3 comprising QQSREYPYT (sec. ID No.:9); where Xaa<sub>x </sub>is selected from K, Q, H, and R; Xaa2 is selected from Q, Η, N, and R, and Xaa3 is selected from G, E, T, S, A, and V. In a certain embodiment, the humanized antibody comprises CDR2 of sequence RIHPYDGDTFYNQKFQG (seq. No. Ident.:2) of a heavy chain.
In a certain embodiment, the invention provides a polypeptide, a humanized antibody, or an antigen-binding fragment thereof comprising a heavy chain variable domain at least about 90% identical to ia sec. with no. Ident .: 4, and a light chain variable domain at least about 90% identical to sec. with no. Ident. 10 or sec. with no. of ident.:11. In another embodiment, the humanized antibody or antigen-binding fragment comprises a heavy chain variable domain at least about 95% identical to sec. with no. Ident .: 4, and a light chain variable domain at least about 95% identical to sec. with no. Ident .: 10 o sec. with no. of ident.:11. In an additional modality, the
<img file="MX340437B_D0020.tif" />
IMPI • ΝίΤΓητη MEXICANO ° E Industrial PROPERTY
<img file="MX340437B_D0021.tif" />
humanized antibody comprises a domain το.Γί '* ^<sup>1</sup>»Has heavy chain at least about 99% identical to sec. with no. of ident.:4, and a light chain variable domain at least about 99% identical to sec. with no. Ident. 10 or sec. with no. of ident.:ll. In a certain embodiment, the humanized antibody comprises the heavy chain variable domain of sec. with no. Ident .: 4, and the light chain variable domain of sec. with no. Ident .: 10 o sec. with no. Ident .: 11. In certain embodiments, the invention provides a polypeptide, an antibody, or an antigen-binding fragment at least about 90% identical to sec. with no. of ident.:88-119. In certain embodiments, the invention provides a polypeptide, an antibody, or an antigen-binding fragment at least about 95% identical to sec. with no. Ident .: 88-119. In certain embodiments, the invention provides at least about 99% identical polypeptide, antibody, or antigen-binding fragment to sec. with no. of ident.:88-119.
In a certain embodiment, the invention provides a humanized antibody or antigen-binding fragment thereof that is expressed at least ten times more than chMovl9 in eukaryotic cells. In a certain embodiment, the eukaryotic cells are HEK-293T cells.
In certain embodiments, the invention provides a
IMPI
MUICANO INSTITUTE • t INDUSTRIAL FROFIFDAD
<img file="MX340437B_D0022.tif" />
Antibody or an antigvnu binding fragment del-miorno · qw 'specifically binds to a human folate receptor 1, where the antibody comprises:
(a) a heavy chain CDR1 comprising SSYGMS (sec. with ID No. 30); a heavy chain CDR2 comprising TISSGGSYTY (sec. ID No.:31); and / or a heavy chain CDR3 comprising DGEGGLYAMDY (sec. with ID #: 32); and / or (b) a light chain CDR1 comprising KASDHINNWLA (sec. ID No.:27); a light chain CDR2 comprising GATSLET (SEQ ID NO: 28); and a light chain CDR3 comprising QQYWSTPFT (sec. ID No.:29). In another embodiment, the invention provides an antibody or antigen-binding fragment thereof that specifically binds to a human folate receptor 1, where the antibody comprises: (a) a heavy chain CDR1 comprising TNYWMQ (sec with ident number: 60); a heavy chain CDR2 comprising AIYPGNGDSR (sec. with ID #: 61); and / or a heavy chain CDR3 comprising RDGNYAAY (sec. no. Ident .: 62); and / or (b) a light chain CDR1 comprising RASENIYSNLA (sec. with ID #: 57); a light chain CDR2 comprising AATNLAD (SEQ ID NO: 58); and a light chain CDR3 comprising QHFWASPYT (sec. ID No.:59). In another embodiment, the invention provides an antibody or antigen-binding fragment.
IMPI
MEXICAN INSTITUTE BE THE INDUSTRIAL PROPERTY
<img file="MX340437B_D0023.tif" />
thereof that specifically binds to a human i-folate receptor, where the antibody comprises: (a) a heavy chain CDR1 comprising TNYWMY (seq. with ID No.:66); a heavy chain CDR2 comprising AIYPGNSDTT (SEQ ID NO: 67); and / or a heavy chain CDR3 comprising RHDYGAMDY (sec. ID No.:68); and / or (b) a light chain CDRl comprising RASENIYTNLA (sec. with ID No.:63); a light chain CDR2 comprising TASNLAD (sec. with no. of ident.:64); and a light chain CDR3 comprising QHFWVSPYT (sec. ID No.:65). In another embodiment, the invention provides an antibody or antigen-binding fragment thereof that specifically binds to a human folate receptor 1, where the antibody comprises: (a) a heavy chain CDRl comprising SSFGMH (sec with ID number: 72); a heavy chain CDR2 comprising YISSGSSTIS (sec. with ident. no. : 73); and / or a heavy chain CDR3 comprising EAYGSSMEY (sec. ID No.:74); and / or (b) a light chain CDRl comprising RASQNINNNLH (sec. with ID No.:69); a light chain CDR2 comprising YVSQSVS (sec. with ID #: 70); and a light chain CDR3 comprising QQSNSWPHYT (sec. ID No.:71). In another embodiment, the invention provides an antibody or antigen-binding fragment thereof that specifically binds to a human folate receptor 1, where the
<img file="MX340437B_D0024.tif" />
Antibody comprises: (a) a heavy chain CDR1 comprising TSYTMH (seq. with ID No.:78); a heavy chain CDR2 comprising YINPISGYTN (sec. ID No.:79); and / or a heavy chain CDR3 comprising GGAYGRKPMDY (sec. ID No.:80); and / or (b) a light chain CDR1 comprising KASQNVGPNVA (sec. ID No.:75); a light chain CDR2 comprising SASYRYS (SEQ ID NO: 76); and a light chain CDR3 comprising QQYNSYPYT (sec. with no. ID: 77).
In certain embodiments, the polypeptides of the invention are full-length antibodies or antigen-binding fragments. In certain embodiments, the antibodies or antigen-binding fragments are a Fab, a Fab ', a F (ab') 2, an Fd, a Fv, or a single-chain scFv, a disulfide-linked Fv, a V-NAR domain , an IgNar, an intrabody, an IgG-CH2, a minibody, an F (ab ') 3, a tetrabody, a triabody, a diabody, a single domain antibody, DVD-Ig, Fcab, mAb2, a (scFv) 2, or an scFv-Fc.
In certain embodiments, an antibody or polypeptide of the invention binds to a human folate receptor 1 with a Kd of about 1.0 to about 10 nM. In one embodiment, the antibody or polypeptide binds to a human folate receptor 1 with a Kd of approximately 1.0 nM or better. In a certain embodiment, the binding affinity is measured by flow cytometry, Biacore, or radioimmunoassay.
IMPI
INSTITUTO MEXICANC • E LA FRORIEDAD INDUSTRIAL
<img file="MX340437B_D0025.tif" />
The invention also provides a method of preparing an antibody of the invention comprising culturing a cell that expresses the antibody, and (b) isolating the antibody from the cell in culture. In a certain embodiment, the cell is a eukaryotic cell.
The invention also provides an immunoconjugate having Formula (A) - (L) - (C); where: (A) is an antibody fragment or an antigen-binding fragment or a polypeptide of the invention; (L) is a ligand; and (C) is a cytotoxic agent, where ligand (L) binds (A) to (C).
In one embodiment, the ligand is selected from the group of a cleavable ligand, a non-cleavable ligand, a hydrophilic ligand, and a dicarboxylic acid-based ligand. In a further embodiment, the ligand is selected from the group consisting of: N-succinimidyl 4- (2-pyridyldithio) pentanoate (SPP) or N-succinimidyl 4- (2-pyridyldithio) -2-sulfopentanoate (sulfo-SPP); N-succinimidyl 4- (2-pyridyldithio) butanoate (SPDB) or W-succinimidyl 4- (2-pyridyldithio) -2-sulfobutanoate (sulfo-SPDB); N-succinimidyl 4- (maleimidamethyl) cyclohexanecarboxylate (SMCC); W-sulfosuccinimidyl 4 (maleimidemethyl) cyclohexanecarboxylate (sulfoSMCC); Nsuccinimidyl-4- (iodoacetyl) -aminobenzoate (SIAB); and the N-succinimidyl ester - [(N-maleimidepropionamide) tetraethylene glycol] (NHS-PEG4-maleimide). In a certain embodiment, the ligand is the W-succinimidyl ester - [(N14
IMPI
MEXICAN INSTITUTE BE THE INDUSTRIAL PROPERTY
<img file="MX340437B_D0026.tif" />
maleimidepropionamide) -tetraethylene glycol] maleimide).
In one embodiment, the immunoconjugates comprise a cytotoxic agent selected from the group of a maytansinoid, maytansinoid analog, benzodiazepine, taxoid, CC-1065, CC-1065 analog, duocarmycin, duocarmycin analog, dolastatin, calicheamicin derivative, dolastatin, analog of auristatin, derivative of tomaimycin and leptomycin or a prodrug of the agent. In a further embodiment, the cytotoxic agent is a maytansinoid. In another embodiment, the cytotoxic agent is N (2 ') - deacetyl-N (2') - (3mercapto-l-oxopropyl) -matansine or N (2 ') - deacetyl-N2- (4mercapto-4-methyl-l -oxopentyl) -maitansine.
In one embodiment the invention provides an immunoconjugate comprising: (A) a humanized antibody comprising the variable domain of a heavy chain of sec. with no. of ident.:4, and the variable domain of a light string of sec. with no. Ident. 10 or sec. with no. from ident.:ll; (L) the ester of A / -succinimidyl- [(Nmaleimidepropionamide) -tetraethylene glycol] (SNS-PEG4maleimide) and (C) the N (2 ') -deacetyl-N2- (4-mercapto-4-methyl-loxopentyl) - maytansine; where (L) links (A) to (C).
In one embodiment the invention provides an immunoconjugate comprising: (A) a humanized antibody comprising the variable domain of a heavy chain of
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0027.tif" />
sec. with no. of ident.:4, and the domain var'ta'ble has a · light chain of sec. with no. Ident. 10 or sec. with no. of ident .. · 11; (L) AZ-succinimidyl 4- (2-pyridyldithio) butanoate (SPDB) and (C) N (2 ') -deacetyl-N2- (4-mercapto-4-methyl-l-oxopentyl) -maitansine; where (L) links (A) to (C).
In one embodiment, the invention provides an immunoconjugate comprising: (A) a humanized antibody comprising the variable domain of a heavy chain of sec. with no. of ident.:4, and the variable domain of a light string of sec. with no. Ident. 10 or sec. with no. from ident.:ll; (L) W-succinimidyl 4- (2-pyridyldithio) 2-sulfobutanoate (sulfo-SPDB) and (C) N (2 ') -deacetyl-N2- (4mercapto-4-methyl-l-oxopentyl) -maitansine; where (L) links (A) to (C).
In one embodiment, the invention provides an immunoconjugate comprising: (A) a humanized antibody comprising the variable domain of a heavy chain of sec. with no. of ident. : 4, and the variable domain of a light chain of sec. with no. of ident. : 10 o sec. with no. of ident.:11; (L) W-succinimidyl 4- (2-pyridyldithio) -2sulfopentanoate (sulfo-SPP); and (C) N (2 ') -deacetyl-N (2') (3-mercapto-l-oxopropyl) -matansine; where (L) links (A) to (C).
In one embodiment, the invention provides an immunoconjugate comprising: (A) a humanized antibody
IMPI
MEXICAN INSTITUTE OF THE INDUSTRIAL RRORIFDAC
<img file="MX340437B_D0028.tif" />
comprising the variable domain of a heavy uatteny <sup>1</sup> of sec. with no. Ident .: 4, and the variable domain of a light chain of sec. with no. Ident .: 10 o sec. with no. Ident .: 11; (L) N-succinimidyl 4- (2-pyridyldithio) pentanoate (SPP); and (C) N (2 ') - deacetyl-N (2') - (3-mercapto1-oxopropyl) -matansine; where (L) links (A) to (C).
The invention also provides a pharmaceutical composition comprising an antibody, an antigen binding fragment, a polypeptide, or an immunoconjugate of the invention and a pharmaceutically acceptable carrier. In a certain embodiment, the pharmaceutical composition further comprises a second anticancer agent.
The invention also provides a diagnostic reagent comprising an antibody, an antigen-binding fragment, a polypeptide, or a labeled immunoconjugate of the invention. In one embodiment, labeling is selected from the group of a radiolabel, a fluorophore, a chromophore, an imaging agent, and a metal ion.
The invention also provides a kit comprising the antibody, antigen binding fragment, polypeptide, or immunoconjugate of the invention.
The invention also provides a method of inhibiting tumor growth in a subject, which comprises administering to the subject a therapeutically effective amount of the antibody, the antigen-binding fragment, the
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL MONEDAD
<img file="MX340437B_D0029.tif" />
polypeptide, the immunoconjugate, or the<sup>-</sup>-compooiff6 &
pharmaceutical of the invention. In a certain embodiment, the invention provides a method of inhibiting tumor growth in a subject comprising administering a therapeutically effective amount of an immunoconjugate having Formula (A) - (L) - (C); where: (A) is an antibody or antigen-binding fragment thereof that specifically binds to a human folate receptor 1; (L) is a ligand, and (C) is a cytotoxin selected from the group consisting of a maytansinoid and a maytansinoid analog; where (L) binds (A) to (C) and where the immunoconjugate reduces the mean tumor volume at least twice in a KB xenograft model. In a certain embodiment, the method comprises administering an antibody or antigen-binding fragment thereof comprising (a) a heavy chain CDRl comprising GYFMN (seq. With ID no .: 1); a heavy chain CDR2 comprising
RIHPYDGDTFYNQXaalFXaa2Xaa3 (sec. With ID #: 56); and a heavy chain CDR3 comprising YDGSRAMDY (sec. with ID No.:3) and (b) a light chain CDRl comprising KASQSVSFAGTSLMH (sec. with ID No.:7); a light chain CDR2 comprising RASNLEA (SEQ ID NO: 8); and a light chain CDR3 comprising QQSREYPYT (sec. with ID no .: 9); where Xaai is selected from K, Q, H and R; Xaa2 is selected from Q, Η, N, and
IMPI
INJTTTUTO MEXICANO W LA WOFIgBAP INROSTIUAL
<img file="MX340437B_D0030.tif" />
R, and Xaa<sub>3</sub> is selected from G, Ε, T, S, V. In a further embodiment, the antibody comprises a CDR2 comprising heavy chain RIHPYDGDTFYNQKFQG (SEQ ID NO: 2).
In a certain embodiment, the invention provides a method of inhibiting tumor growth which comprises administering an antibody or antigen binding fragment thereof encoded by plasmid DNA deposited with the ATCC on April 7, 2010 and having the numbers of deposit of the ATCC, PTA-10772 and PTA-10773 or PTA-10774.
In another embodiment, the method provides administering an immunoconjugate comprising a humanized antibody comprising the variable domain of a sec heavy chain. with no. of ident.:4, and the variable domain of a light string of sec. with no. Ident. 10 or sec. with no. from ident.:ll; (L) the N-succinimidyl ester - [(Nmaleimidepropionamide) -tetraethylene glycol] (SNS-PEG4maleimide) and (C) the N (2 ') - deacetyl-N2- (4-mercapto-4-methyl-loxopentyl) -maitansine .
In another embodiment, the method provides administering an immunoconjugate comprising a humanized antibody comprising the variable domain of a sec heavy chain. with no. of ident.:4, and the variable domain of a light string of sec. with no. Ident. 10 or sec. with no. from ident.:ll; (L) N-succinimidyl 4- (2-pyridyldithio) butanoate
ΙΜΡΙ
MEXICAN INSTITUTE K THE INDUSTRIAL PROPERTY
<img file="MX340437B_D0031.tif" />
(SPDB); and (C) N (2 ') -deacetyl-N2- (4-mercapto-4-methyl-loxopentyl) -matansine; where (L) links (A) to (C).
In another embodiment, the method comprises administering an immunoconjugate comprising (A) a humanized antibody comprising the variable domain of a heavy chain of sec. with no. of ident. : 4, and the variable domain of a light chain of sec. with no. of ident. : 10 o sec. with no. of ident.:11; (L) W-succinimidyl 4- (2-pyridyldithio) 2sulfobutanoate (sulfo-SPDB) and (C) N (2 ') - deacetyl-N2- (4mercapto-4-methyl-l-oxopentyl) -maitansine, where (L) links (A) to (C).
In another embodiment, the method comprises administering an immunoconjugate comprising (A) a humanized antibody comprising the variable domain of a heavy chain of sec. with no. Ident .: 4, and the variable domain of a light chain of sec. with no. of ident. : 10 o sec. with no. of ident.:11; (L) W-succinimidyl 4- (2-pyridyldithio) -2sulfopentanoate (sulfo-SPP); and (C) N (2 ') -deacetyl-N (2') (3-mercapto-l-oxopropyl) -matansine; where (L) links (A) to (C).
In another embodiment, the method comprises administering an immunoconjugate comprising (A) a humanized antibody comprising the variable domain of a heavy chain of sec. with no. of ident. : 4, and the variable domain of a light chain of sec. with no. Ident .: 10 o sec. with no.
<img file="MX340437B_D0032.tif" />
IMPI <sup>NST</sup>| S7?, ÍÍ «'CANO <sup>EC</sup> INDUSTRIAL property
<img file="MX340437B_D0033.tif" />
of ident.:11; (L) N-succinimidil<sup>¿</sup> i <»1 ' <sup>1</sup> i- ί n) pentanoate (SPP); and (C) N (2 ') - deacetyl-N (2') - (3-mercapto1-oxopropyl) -matansine; where (L) links (A) to (C).
In another embodiment, the method comprises administering an immunoconjugate comprising the FR-l-21hu antibody deposited with the ATCC on April 7, 2010 and having the ATCC deposit numbers, PTA-10775 and PTA-10776. In a certain embodiment, the FRl-21hu antibody comprises (a) a heavy chain CDRl comprising SSYGMS (sec. No.
<td>ident.:30);</td><td>a CDR2</td><td>chain</td><td>heavy</td><td>than</td><td>understands</td>
<td>TISSGGSYTY</td><td>(sec. with no.</td><td>Ident .:</td><td>31); and one</td><td>CDR3</td><td>chain</td>
<td>heavy that</td><td>i understand</td><td colspan="2">DGEGGLYAMDY (sec.</td><td>with</td><td>no. of</td>
<td>ident.:32);</td><td>and (b) a</td><td>CDRl of</td><td colspan="2">light chain</td><td>understands</td>
<td>KASDHINNWLA</td><td>(sec. with num</td><td>. of ident</td><td>.: 2 7); a</td><td>CDR2</td><td>chain</td>
light comprising GATSLET (sec. with ID no .: 28); and a light chain CDR3 comprising QQYWSTPFT (sec. ID No.:29). In certain embodiments, the method comprises administering an immunoconjugate comprising the antibody which is the FRl-48hu antibody comprising: (a) a heavy chain CDRl comprising TNYWMQ (seq. No.
of ident.:60); a heavy chain CDR2 comprising AIYPGNGDSR (sec. ID No.:61); and a heavy chain CDR3 comprising RDGNYAAY (sec. ID No.:62); and (b) a light chain CDRl comprises RASENIYSNLA (sec. with ID No.:57); a light chain CDR2 comprising
IMPI
MEXICAN INSTITUTE OF THE OWN EDA · INDUSTRIAL
<img file="MX340437B_D0034.tif" />
AATNLAD (section with ID number: 58); and a "light CDR3-of-" adona comprises QHFWASPYT (sec. with ID No.:59). In certain embodiments, the method comprises administering an immunoconjugate comprising the antibody which is the FRl-49hu antibody comprising: (a) a heavy chain CDR1 comprising TNYWMY (SEQ ID NO: 66); a heavy chain CDR2 comprising AIYPGNSDTT (SEQ ID NO: 67); and a heavy chain CDR3 comprising RHDYGAMDY (sec. no. Ident .: 68); and (b) a light chain CDR1 comprising RASENIYTNLA (sec. ID No.:63); a light chain CDR2 comprising TASNLAD (SEQ ID NO: 64); and a light chain CDR3 comprising QHFWVSPYT (sec. ID No.:65). In certain embodiments, the method comprises administering an immunoconjugate comprising the antibody which is the FRl-57hu antibody comprising: (a) a heavy chain CDR1 comprising SSFGMH (seq. No. of ident.:72); a heavy chain CDR2 comprising YISSGSSTIS (SEQ ID NO: 73); and a heavy chain CDR3 comprising EAYGSSMEY (sec. with ID #: 74); and (b) a light chain CDR1 comprises RASQNINNNLH (sec. with ID No.:69); a light chain CDR2 comprising YVSQSVS (sec. ID No.:70); and a light chain CDR3 comprising QQSNSWPHYT (sec. ID No.:71). In certain modalities, the method comprises administering a
<img file="MX340437B_D0035.tif" />
<img file="MX340437B_D0036.tif" />
immunoconjugate comprising the FRl-65hu antibody, comprising:
weighing comprising TSYTMH (seq. with ID no .: 78); a heavy chain CDR2 comprising YINPISGYTN (sec. ID No.:79); and a heavy chain CDR3 comprising GGAYGRKPMDY (sec. with ID #: 80); and (b) a light chain CDRl comprising KASQNVGPNVA (sec. with ID No.:75); a light chain CDR2 comprising SASYRYS (SEQ ID NO: 76); and a light chain CDR3 comprising QQYNSYPYT (sec. ID No.:77).
In one embodiment, the method inhibits the growth of ovarian tumor, brain tumor, breast tumor, uterine tumor, endometrial tumor, pancreatic tumor, kidney tumor, or lung tumor. In a certain embodiment, the method inhibits the growth of the ovarian tumor. In another embodiment, the invention inhibits the growth of the lung tumor. In a certain embodiment, tumor growth inhibition is used to treat cancer. In a further embodiment, the method comprises administering to the subject a second anticancer agent. In a certain embodiment, the second anticancer agent is a chemotherapeutic agent.
The invention also provides an isolated cell that produces the antibody, antigen binding fragment, or polypeptide of the invention.
The invention also provides a polynucleotide.
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0037.tif" />
isolate comprising a sequence at least 90% identical to a sequence selected from the group consisting of seo. with no. Ident .: 5, 14, 15, 37, 38, 43, 44, 47, 48 and 120127. In a certain embodiment, the isolated polynucleotide is at least 95% identical to a sequence selected from the group consisting of Sections. with no. Ident .: 5, 14, 15, 37, 38, 43, 44, 47, 48 and 120-127. In another embodiment, the isolated polynucleotide is at least 99% identical to a sequence selected from the group consisting of Sec. with no. Ident .: 5, 14, 15, 37, 38, 43, 44, 47, 48 and 120-127.
The invention also provides a vector comprising any of the polynucleotides of sec. with no. Ident .: 5, 14, 15, 37, 38, 43, 44, 47, 48 and 120-127. In another embodiment, the invention provides a host cell comprising a vector containing a sec polynucleotide. with no. Ident .: 5, 14, 15, 37, 38, 43, 44, 47, 48 and 120127.
BRIEF DESCRIPTION OF THE FIGURES
Figures 1A-1D. Surface residues of murine Movl9 (Movl9mu) and humanized (Movl9hu). (Fig. IA) Surface residues of a murine and humanized Movl9 light chain. The surface residues of the variable region frame of a murine and humanized Movl9 light chain and the position number (Kabat system) are given. The
IMPI
MEXICAN INSTITUTE »AND INDUSTRIAL PROPERTY
<img file="MX340437B_D0038.tif" />
human waste that is different from <sup>3 g</sup> Original nrines are underlined. * Position 74 is not a surface position, but to remove an N-consensus linked glycosylation site in version 1.00, this position was changed to a Threonine (the most common human residue at this position); resulting in version 1.60. (Fig. IB) Surface residues of a murine and humanized Movl9 heavy chain. The surface residues of the variable region frame of a murine and humanized Movl9 heavy chain and the position number (Kabat system) are given. Human residues that are different from the original murine sequences are underlined. Similar surface residues are provided for FR1-21 (Fig. IC) and (Fig. ID).
Figures 2A-2D. Alignments of the chimeric Movl9 and Movl9hu heavy and light chain variable domains and the FRl-21mu and FRl-21hu heavy and light chain variable domains. Alignment of coated sequences of Movl9 and Frl-21 variable regions with their murine counterparts. Fig. 2A) and Fig. 2C) light chain variable domains; Fig. 2B) and Fig. 2D) variable domain of a heavy chain. The dashes indicate identity with the murine sequence. CDRs (Kabat definition) are underlined.
Figure 3. Expression of chimeric Movl9 and Movl9hu in HEK cells. The chimeric and human Movl9 expression plasmids were transfected into the
ΙΜΡΙ
<img file="MX340437B_D0039.tif" />
Τ HEK293 suspension cells, ΤΤΙΤ3'δ ae3puS'5r were harvested, and the expressed antibody was determined by quantitative ELISA. The light chain and heavy chain plasmids were transfected to the respective molar ratios of either 3: 1 or 6: 1.
Figure 4. Binding specificity of antiFOLR1 antibodies, as detected by their binding to 300-19 cells expressing FOLR1. Binding of Movl9hu to 300-19FOLR1 cells by flow cytometry. The parent cells 300-19 that express FOLR-1. Solid gray shading represents cell autofluorescence, black dotted lines represent cells incubated with FITC-conjugated anti-human secondary antibody, solid black lines represent cells incubated with Mov-19hu antibody, and secondary conjugate anti-human antibody
FITC.
Figure 5. Binding affinities and cytotoxic activity, in vitro, of anti-FOLR1 and immunoconjugated antibodies. The binding affinity of Movl9hu and various murine and humanized FR-1 antibodies was measured in SKOV3 cells. The in vitro cytotoxic activity of the PEG4-Mal-DM4 conjugates with the mentioned antibodies was also tested.
Figure 6. Antibody-dependent cellular cytotoxicity of immunoconjugates. The ADCC activity of
<img file="MX340437B_D0040.tif" />
IMPI <sup>, NSTI</sup>57? Mexican<sup>W</sup> EA PROHtDAB INDUSTRIAL
<img file="MX340437B_D0041.tif" />
Movl9hu, FRl-21hu, and Mor003 were tested against Igrovl cells. Igrov 1s were incubated at 15,000 cells / well target: NK in the cell ratio of 1: 4.
Figure 7. Cytotoxic activity by continuous exposure of FRl-21hu-PEG4-mal-DM4 and Movl9hu-PEG4-mal-DM4 in KB cells. An excess of unconjugated antibodies suppressed the activity of the immunoconjugates when they co-incubated in the presence of KB cells, indicating that the cytotoxic activity is antigen-dependent.
Figure 8. Efficacy, in vivo, of Movl9hu-directed conjugates in a KB xenograft model. The Movl9hu-SPDB-DM4-cleaved conjugate directed to FOLR1 (B) compared to the non-FOLR1-directed C242hu-SPDB-DM4; and the non-cleavable Movl9hu-PEG4-Mal-DM4 (C) conjugate compared to non-targeted C242hu-PEG4-Mal-DM4 (E) were tested using a xenograft model established for KB cells that are implanted subcutaneously in SCID mice. Targeting Movl9hu to FOLR1 resulted in a significant decrease in the mean tumor volume.
Figures 9A-9D. Efficacy, in vivo, of Movl9hu-PEG4Mal-DM4 compared to murine anti-FOLR1 FR-1 antibodies in a KB xenograft model. FR-1 series antibodies, either unconjugated, or conjugated to PEG4-MalDM4 were tested for their ability to reduce mean tumor volume compared to Movl9hu-PEG4-Mal-DM4 in a
ΙΜΡΙ
MEXICAN INSTITUTE OF PROPERTY
INDUSTRIAL
<img file="MX340437B_D0042.tif" />
KB cell xenograft tumor model. {Tig. 9 AJ ΒΚ · 1 · 9, (Fig. 9B) FR-1-13, (Fig. 9C) FR-1-22, and (Fig. 9D) FR-1-23.
Figure 10. Efficacy, in vivo, of Movl9hu-PEG4-Mal-DM4 and FRl-21hu-PEG4-Mal-DM4 in a xenograft model with KB cells. Single injections with 10 mg / kg Movl9huPEG4-Mal-DM4 and FRl-21hu-PEG4-Mal-DM4 were performed on day 6 after inoculation. Both Movl9hu-PEG4-Mal-DM4 and FR121hu -PEG4-Mal-DM4 showed a significant reduction in mean tumor volume. The mean TV refers to the mean of the tumor volume.
Figure 11. Movl9hu-PEG4-Mal-DM4 shows dose-dependent activity in the KB cell xenograft model. The dose dependent activity of the immunoconjugate was tested over the entire range of tested doses. Weekly dosing resulted in improvement of antitumor activity. High drug loads only marginally improved activity in the 10 mg / kg dose groups, with reduced activity in the lower dose groups. DAR 3.7 refers to 3.7 drug molecules per antibody.
Figure 12. Efficacy, in vivo, of Movl9hu conjugated with DM1 and DM4 with different ligands. Movl9hu was conjugated with SMCC-DMl to 3.9 drug molecules per antibody; sulfo-Mal-DM4 to 3.7 drug molecules per antibody (B); and sulfo-Mal-DM4 to 8.23 drug molecules per
<img file="MX340437B_D0043.tif" />
IMPI
MKICANC INSTITUTE.
dt the rrariEDA · industrial antibody (C) and were tested for their ability to reduce mean tumor volume at different concentrations compared to Movl9hu-PEG4-Mal-DM4.
Figure 13. Efficacy, in vivo, of Movl9hu conjugated with DM1 and DM4 with different ligands. Movl9hu was conjugated with SPP-DM1 to 4.3 drug molecules per antibody; sulfo-SPDB-DM4 at 3.8 drug molecules per antibody, SPDB-DM4 at 3.8 drug molecules per antibody, and sulfo-SPDB DM4 at 6.8 drug molecules per antibody and were tested for their ability to reduce the mean tumor volume. Mice were treated with either 5 mg / kg (A) and 2.5 mg / kg (B) of one of the conjugates mentioned above or only with PBS.
Figure 14. Efficacy, in vivo, of Movl9hu-sulfo-SPDBDM4 in the OVCAR-3 xenograft tumor model. Mice were treated with 25, 50, or 100 pg / kg Movl9hu-sulfoSPDB-DM4 or PBS only.
Figure 15. Efficacy, in vivo, of Movl9hu-sulfo-SPDBDM4 in the IGROV-1 xenograft tumor model. Mice were treated with 25, 50, or 100 pg / kg Movl9hu-sulfoSPDB-DM4 or PBS only.
Figure 16. Efficacy, in vivo, of Movl9hu-sulfo-SPDBDM4 in the OV-90 xenograft tumor model. Mice were treated with 25, 50, or 100 pg / kg Movl9hu-sulfoSPDB-DM4 or PBS only.
IMPI mujcanc institute OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0044.tif" />
Figure 17. Effect of cleavable ligands and non-cleavable ligands on the efficacy of immunoconjugates in cell xenograft models.
KB.
Figures 18A-18B. Effect of cleavable ligands on the efficacy of immunoconjugates in (Fig. 18A) the KB xenograft model, (Fig. 18B) the OVCAR-3 xenograft model.
Figure 19. Efficacy in vitro and in vivo of FRl-48hu, FRl-49hu, FRl-57hu, and FRl-65hu-SMCC-DMl in KB and xenograft tumor models. Mice were treated with 200 pg / kg single dose.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides novel agents, including but not limited to polypeptides, such as antibodies, and immunoconceptions that bind to human folate receptor 1 (FOLR1). Related polypeptides and polynucleotides, compositions comprising FOLR1 binding agents, and methods for preparing FOLR1 binding agents are provided. Also provided are methods of using the novel FOLR1 binding agents, such as methods of inhibiting tumor growth and / or treating cancer.
IMPI <sup>, NÍT</sup>™ 7 «MEXICANC m the industrial noritruo
<img file="MX340437B_D0045.tif" />
I. Definitions
To facilitate an understanding of the present invention, a number of terms and phrases are defined below.
The terms "human folate receptor 1 or FOLR1", used herein, refer to any native human FOLR1, unless otherwise indicated. The term FOLR1 includes the full-length, unprocessed FOLR1 as well as any form of FOLR1 that results from processing within the cell. The term also includes naturally occurring FOLR1 variants, eg, splice variants, allelic variants, and isoforms. The FOLR1 polypeptides described herein can be isolated from different sources, such as from human tissue types or another source, or prepared by recombinant or synthetic methods. Examples of the FOLRl sequences include, but are not limited to NCBI reference numbers P15328, NP_001092242.1, AAX29268.1, AAX37119.1, NP_057937.1, and NP_057936.1.
The term antibody means an immunoglobulin molecule that specifically recognizes and binds to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing, through at least one recognition site. of the antigen within the variable region of the immunoglobulin molecule. As used in this document, the term
IMPI
ΓΝΓΠΤυΤΟ MEXICAN DE LA nOMEDA »
INDUSTRIAL
<img file="MX340437B_D0046.tif" />
Antibody includes intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (such as Fab, Fab ', F (ab') 2, and Fv fragments); single chain Fv (scFv) mutants, multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising a part for antigen determination of an antibody, and any other immunoglobulin molecule that comprises an antigen recognition site so extensive that the antibodies display convenient biological activity. An antibody can be from any of the five major immunoglobulin classes: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) of these (eg IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2); based on the identity of their heavy chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively. Different classes of immunoglobulins have different and well-known three-dimensional subunit structures and configurations. Antibodies can be stripped or conjugated to other molecules such as toxins, radioisotopes, etc.
A blocking antibody or antagonist antibody is one that inhibits or reduces the biological activity of the binding antigen, such as FOLR1. In a certain modality
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0047.tif" />
blocking antibodies or -antiq ani antibodies substantially or completely inhibit the biological activity of the antigen. It is convenient that the biological activity is reduced by 10%, 20%, 30%, 50%, 70%, 80%, 90%,
95%, or even 100%.
The term "anti-FOLRl antibody" or an antibody that binds FOLRl refers to an antibody that is capable of binding FOLRl with sufficient affinity such that the antibody is useful as a diagnostic agent and / or therapeutic agent directed at FOLRl. The magnitude of binding of an anti-FOLRl antibody to an unrelated protein, a protein without FOLRl is approximately less than 10% of the antibody binding to FOLRl when measured, for example, by a radioimmunoassay (RIA). In certain modalities,
<td>an antibody that binds to</td><td>FOLRl has</td><td>a</td><td>constant</td><td>of</td>
<td>dissociation (Kd) of ^ ΙμΜ, ^ 100</td><td>nM, <10 nM</td><td></td><td>1 nM, or</td><td> 0.1</td>
<td>nM.</td><td></td><td></td><td></td><td></td>
<td>The term fragment of</td><td>antibody</td><td>I know</td><td>It refers to</td><td>a</td>
part of an intact antibody and refers to the variable regions of antigenic determinants of an intact antibody. Examples of antibody fragments include, but are not limited to Fab, Fab ', F (ab') 2, and Fv fragments, linear antibodies, single chain antibodies, and multispecific antibodies formed from antibody fragments. .
IMPI
MEXICAN INSTITUTE OE INDUSTRIAL PROPERTY
<img file="MX340437B_D0048.tif" />
A monoclonal antibody is a homogeneous antibody »pnMapÍon involved in highly specific recognition and binding of a single antigenic determinant, or epitope. This is in contrast to polyclonal antibodies that typically include different antibodies directed against different antigenic determinants. The term monoclonal antibody includes both intact monoclonal antibodies and full-length monoclonal antibodies, as well as antibody fragments (such as Fab, Fab, F (ab ') 2, Fv); single chain mutants (scFv), fusion proteins comprising an antibody part, and any other modified immunoglobulin molecule comprising an antigen recognition site. In addition, monoclonal antibody refers to those antibodies prepared in many ways including but not limited to hybridoma, phage selection, recombinant expression, and transgenic animals.
The term humanized antibody refers to forms of non-human (eg, murine) antibodies that are the specific chains of immunoglobulins, the chimeric immunoglobulins, or fragments thereof that contain the minimum of non-human sequences (eg, murine). Typically, humanized antibodies are human immunoglobulins in which complementarity determining region (CDR) residues are replaced by
IMPI ÍNfTfn, Tf. MUONO<sup>to</sup>HE HAS <sub>;</sub> »</·>!
(ΝΠ · 1.S <sup>r</sup>GOES"
<img file="MX340437B_D0049.tif" />
the CDR residues of one of the non-human species Cprrr example, mouse, rat, rabbit, hamster) having the specificity, affinity, and capacity (Jones et al., 1986, Nature, 321: 522-525; Riechmann and others, 1988, Nature, 332: 323-327; Verhoeyen et al., 1988, Science, 239: 1534-1536). In some examples, Fv framework region (FR) residues of a human immunoglobulin are replaced by corresponding residues of an antibody of one of the non-human species having the appropriate specificity, affinity and capacity. The humanized antibody can be further modified by substituting additional residues either within the Fv framework region and / or within the replaced non-human residues to refine and optimize the specificity, affinity and / or capacity of the antibody. In general, the humanized antibody will comprise substantially all of at least one variable domain, and typically two or three variable domains containing all or substantially all of the CDR regions that correspond to non-human immunoglobulin, while in all or substantially all of the regions of FR are those of a consensus human immunoglobulin sequence. The humanized antibody may also comprise at least a part of an immunoglobulin (Fe) region or constant domain; typically from a human immunoglobulin. Examples of methods that
IMPI
MEXICAN INSTITUTE • E LA EROEIEDAP INDUSTRIAL
<img file="MX340437B_D0050.tif" />
described in the references used to generate humanized antibodies are US Pat. 5,225,539 or 5,639,641.
A variable region of an antibody variable region of an antibody light chain or to the variable region of an antibody heavy chain, either alone or in combination. Variable regions of a heavy and light chain each consisting of four framework regions (FR) are connected by three complementarity determining regions (CDRs); also known as hypervariable regions. The CDRs in each chain are held together at a short distance by the FRs and with the CDRs of the other chain, contribute to the formation of the binding site of the antibodies to the antigen. There are at least two techniques for determining CDRs: (1) an approach based on cross-species sequence variability (i.e., Kabat et al., Sequences of Proteins of Immunological Interest, (5th ed., 1991, National Institutes of Health , Bethesda Md.)); and (2) an approach based on crystallographic studies of antigen-antibody complexes (Al-lazikani et al. (1997) J. Molec. Biol. 273: 927-948)). Furthermore, combinations of these two approaches are sometimes used in the art to determine CDRs.
The Kabat numbering system is generally used to refer to a residue in the variable domain (approximately 1-107 residues of a light chain and of
IMPI
MEXICAN INSTITUTE OF THE NOPItOAD INtMISTRIAt
<img file="MX340437B_D0051.tif" />
1-113 heavy chain residues) (eg, Kabat et al., Sequences of Immunological Interest. 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md.
(1991)) .
Kabat amino acid position numbering refers to the numbering system used for heavy chain variable domains or light chain variable domains in the Antibody Compendium of Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991). By this numbering system, the present linear amino acid sequence may contain fewer or more amino acids that correspond to a reduction of, or an insert to, an FR or a CDR of the variable domain. For example, a heavy chain variable domain can include a single amino acid insert (residue 52a according to Kabat) after residue 52 of H2 and inserted residues (eg, residues of 82a, 82b, and 82c, etc.). according to Kabat) after FR residue 82 of a heavy chain. The Kabat numbering of the residues can be determined for an antibody given by aligning the homology regions of the antibody sequence with a standard sequence numbered by Kabat. Chothia, on the other hand, refers to the location of structural ties (Chothia and
Lesk J. Mol. Biol. 196: 901-917 (1987)). The loop terminal
ΙΜΡΙ
MEXICAN INSTITUTE W LA MONEDAD INDUSTRIAL
<img file="MX340437B_D0052.tif" />
Chothia's CDR-H1 when numbering using the ^ 'L'dll'. 'Unuiéii Uw Kabat numbering varies between H32 and H34 depending on the length of the loop (this is because the Kabat numbering scheme places the inserts in H35A and H35B, if neither 35A nor 35B is present, the loop ends at 32, if only 35A is present, the loop ends at 33, if both 35A and 35B are present, the loop ends at 34). The AbM hypervariable regions represent a compromise between the Kabat CDRs and the Chothia structural ties, and are used by the Oxford AbM Antibody Modeling Program.
Molecular.
<td>Tie</td><td>Kabat</td><td>AbM</td><td>Chothia</td>
<td>Ll</td><td>L24-L34</td><td>L24-L34</td><td>L24-L34</td>
<td>L2</td><td>L50-L56</td><td>L50-L56</td><td>L50-L56</td>
<td>L3</td><td>L89-L97</td><td>L89-L97</td><td>L89-L97</td>
<td>H1</td><td>H31-H35B</td><td>H26-H35B</td><td>H2 6-</td>
H32..34 (Kabat Numbering)
<td>H1</td><td>H31-H35</td><td colspan="2">H26-H35 H26-H32 (Chothia numbering)</td>
<td>H2</td><td>H50-H65</td><td>H50-H58</td><td>H52-H56</td>
<td>H3</td><td>H95-H102</td><td>H95-H102</td><td>H95-H102</td>
The term human antibody, denotes an antibody
ΙΜΡΙ
MEXICAN INSTITUTE OE INWISTRIAL PROPERTY
<img file="MX340437B_D0053.tif" />
produced by a human or an antibody — what —— tic? <sup>iiri</sup>= i amino acid sequence that corresponds to a human produced antibody that is prepared by any method known in the art. This definition of a human antibody includes intact or full length antibodies, fragments thereof, and / or antibodies comprising at least one human heavy chain and / or light chain polypeptide, such as, for example, an antibody that it comprises the murine light chain and human heavy chain polypeptides.
The term chimeric antibodies refers to antibodies where the amino acid sequence of the immunogiobulin molecule is derived from two or more species. Typically, the variable region of both light and heavy chains corresponds to the variable region of antibodies derived from one of the mammalian species (eg, mouse, rat, rabbit, etc.) with the specificity, affinity, and convenient capacity , while the constant regions are homologous to the sequences of the antibodies derived from another species (usually human) to avoid the induction of an immune response in these species.
The terms epitope or antigenic determinant are used interchangeably herein and refer to the part of an antigen capable of being specifically recognized and bound by a particular antibody. When the
IMPI
MEXICANC INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0054.tif" />
antigen is a polypeptide, epitopes can be composed of both contiguous amino acids and non-contiguous amino acids juxtaposed by tertiary folding of a protein.
<td>Epitopes</td><td>formed</td><td>of</td><td>the</td><td colspan="2">contiguous amino acids</td>
<td>normally</td><td>retain</td><td>with</td><td>the</td><td>denaturation of</td><td>the</td>
<td colspan="2">protein while</td><td>the</td><td colspan="2">epitopes formed by</td><td>the</td>
Tertiary folding is normally lost with protein denaturation. An epitope typically includes at least 3, and usually more, at least 5 or 8 to 10 amino acids in a single spatial conformation.
Binding affinity generally refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (eg, an antibody) and its binding partner (eg, an antigen). Unless otherwise indicated, as used herein, binding affinity refers to the intrinsic binding affinity that reflects a 1: 1 interaction between members of a binding pair (eg, antibody and antigen ). The affinity of a molecule of X for its partner Y can be represented in general by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein. Low-affinity antibodies generally bind slowly to the antigen and tend to dissociate easily, whereas antibodies
IMPI
INSTITUTO MEXICANO nt LA FHOMFOAn INDUSTRIAL
<img file="MX340437B_D0055.tif" />
High-affinity generally bind rapidly to the antigen and tend to stay longer. A variety of methods for measuring binding affinity are known in the art, some of which can be used for the purposes of the present invention. Specific illustrative modalities are described below.
When used herein or better to refer to binding affinity, it refers to a stronger binding between a molecule and its binding partner. When used in this document or better it refers to a stronger joint, which is represented by a smaller numerical value Kd. For example, an antibody that has an affinity for an antigen of 0.6 nM or better, the affinity of the antibody for the antigen is <0.6 nM, i.e. 0.59 nM, 0.58 nM, 0.57 nM etc. or any value less than 0.6 nM.
The phrase substantially similar, or substantially the same, as used herein, denotes a sufficiently high degree of similarity between two numerical values (usually one is associated with an antibody of the invention and the other is associated with a reference / comparison antibody) such that a person skilled in the art might consider that the difference between the two values would be of little or no biological and / or statistical significance in the context of the biological characteristics measured by the values (eg, Kd values). The
IMPI
MEXICANC INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0056.tif" />
difference between the two values is less than — epWKéwwretemeirte50%, less than about 40%, less than about
20%, or less than the value for
30%, less than about about 10% based on reference / comparison antibody.
A polypeptide, an antibody, a polynucleotide, a vector, a cell, or a composition that is isolated is a polypeptide, an antibody, a polynucleotide, a vector, a cell, or a composition that is in a form not found in nature. . Isolated polypeptides, antibodies, polynucleotides, vectors, cells, or compositions include those that have been purified to a degree that they are no longer in a way that they are found in nature. In some embodiments, an antibody, polynucleotide, vector, cell, or composition that is isolated is substantially pure.
As used herein, "substantially pure" refers to a material that is at least 50% pure (ie, free of contaminants); at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure.
The term immunoconjugate or conjugate as used herein, refers to a compound or a derivative thereof that binds to a cell binding agent (i.e., an anti-FOLRl antibody or a fragment thereof) and is defined by a generic formula: CLA, where C = cytotoxin, L = ligand, and A = cell binding agent or anticue
IMPI
<img file="MX340437B_D0057.tif" />
or
INSTTTUT MIXICANC DF LA ÍÍOFIf »A · INDUSTRIAL
<img file="MX340437B_D0058.tif" />
antibody fragment. Immunoconjugates can also be defined by the generic formula in the reverse order:
ALC.
A ligand is any chemical moiety that is capable of binding a compound, usually a drug, such as a maytansinoid, to a cell binding agent such as an anti-FOLRl antibody or a fragment thereof. Ligands can be susceptible or substantially resistant to acid-induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage, under conditions in which the compound or antibody remains active . Suitable ligands are well known in the art and include, for example, disulfide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups and esterase labile groups. Ligands also include charged ligand, and the hydrophilic forms thereof as described herein and are known in the art.
The terms cancer and cancerous refer to or describe physiological disease in mammals in which a population of cells is characterized by uncontrolled cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma,
ΙΜΡΙ ΐΝΓΤΤΤυΤΛ MBJUCANC nt la νοιιΙιλ · INDUSTRIAL
<img file="MX340437B_D0059.tif" />
sarcoma and leukemia. The most partiOTT3Yü5 examples “CR? USTUS cancers include squamous cell cancer, small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, and various types of head and neck cancers.
Tumor and neoplasm refer to any mass of tissue that results from excess cell growth or proliferation, either benign (non-cancerous) or malignant (cancerous) including pre-cancerous lesions.
The terms cancer cell, tumor cell, and grammatical equivalents refer to the total population of cells derived from a tumor or a pre-cancerous lesion, including both non-tumor cells, which comprise the removal of the tumor cell population. like the tumorigenic stem cells (cancer stem cells). As used herein, the term tumor cell will be modified by the term non-tumorigenic when referring
IMPI
INSTITUTO MEXICAN DE IA PROPIEDAD INniUTRI *!
<img file="MX340437B_D0060.tif" />
exclusively to those tumor cells that lack the ability to renew and differentiate to distinguish those tumor cells from cancer stem cells.
The term "subject" refers to any animal (eg, a mammal); which includes but is not limited to humans, non-human primates, rodents, and the like, which must be the recipient of a particular treatment. Typically, the terms subject, and patient are used interchangeably herein with respect to a human subject.
Administration in combination with one or more additional therapeutic agents includes simultaneous (concomitant) and consecutive administration in any order.
The term "pharmaceutical formulation" refers to a preparation that is in a way to allow the biological activity of the active ingredient to be effective, and that does not contain additional components that are toxic unacceptable to a subject for which the formulation could be administered. This formulation can be sterile.
An effective amount of an antibody as described herein is an amount sufficient to carry out a specifically stated purpose. An effective amount can be determined empirically and routinely, relative to stated purposes.
The term "therapeutically effective amount" is
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0061.tif" />
refers to an amount of an antibody or other drug effective to treat a disease or disorder in a subject or mammal. In the case of cancer, the therapeutically effective amount of the drug can reduce the number of cancer cells, reduce the size of the tumor, inhibit (that is, slow down to some extent and in a certain modality, stop) the infiltration of cancer cells into peripheral organs, inhibit (i.e., slow to some extent and in a certain modality, stop) tumor metastasis, inhibit, to some extent, tumor growth, and / or alleviate to some extent one or more of the symptoms associated with cancer. See the definition of dealing in this document. To the extent that the drug can prevent growth and / or kill existing cancer cells, it can be cytostatic or cytotoxic. A "prophylactically effective amount" refers to an amount effective, in dosage and for periods of time necessary, to achieve the convenient prophylactic result. Typically, but not necessarily, since a prophylactic dose is used in subjects before or at an early stage of the disease, the prophylactically effective amount will be less than the therapeutically effective amount.
The word "brand" when used herein, refers to a detectable compound or composition that is conjugated directly or indirectly to the antibody for the purpose
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0062.tif" />
to generate a labeled antibody. The -se— ρυι ^ ίΓ mark detects itself (for example, radioisotope markers or fluorescence markers) or, in the case of an enzyme marker, that can catalyze the chemical modification of a compound or a substrate composition that is detected.
A chemotherapeutic agent is a chemical compound useful in the treatment of cancer, regardless of the mechanism of action. Classes of chemotherapeutic agents include, but are not limited to: alkylating agents, antimetabolites, spindle poison plant alkaloids, cytotoxic / anti-tumor antibiotics, topoisomerase inhibitors, antibodies, photosensitizers, and kinase inhibitors. Chemotherapeutic agents include compounds used in targeted therapy and conventional chemotherapy.
Terms such as treatment or treatment or treatment or relief or alleviation refer to both 1) therapeutic measures that cure, slow down, decrease symptoms, and / or cessation of progression of an identified pathological condition or disorder and 2) prophylactic measures or preventive measures that prevent or decrease the development of an objective disease or pathological disorder. Thus, those who need treatment include those who are already with the disorder; those likely to have the
<img file="MX340437B_D0063.tif" />
IMPI Mexican institute of LA FROFIEDAD INDUSTRIAL disorder, and those in which the disorder should be avoided.
In certain embodiments, according to the methods of the present invention, a subject is successfully treated for cancer, if the patient exhibits one or more of the following effects: a reduction in the number or complete absence of cancer cells, a reduction in tumor size, inhibition, or an absence of infiltration of cancer cells into peripheral organs including, for example, the spread of cancer in soft tissue and bone; inhibition inhibition or an absence of tumor metastasis, the or an absence of tumor growth, attenuation of one or more of the symptoms associated with the specific cancer; reduction in morbidity and mortality, improvement in quality of life, reduction in tumorigenicity, tumorigenic frequency, or tumorigenic capacity, of a tumor, reduction in the number or frequency of cancer stem cells in a tumor, the differentiation of tumorigenic cells to a non-tumorigenic state, or some combination of effects.
As used interchangeably in this document, polynucleotide, or nucleic acid, refers to nucleotide polymers of any length, and includes DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, nucleotides or modified bases and / or their analogues, or any substrate that is
ΙΜΡΙ
MEXICAN INSTITUTE OF LA PRORÍDAD
INDUSTRIAL
<img file="MX340437B_D0064.tif" />
can be incorporated into a polymer by poly-house-of, .. SOI or RNA. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification to the nucleotide structure can occur before or after assembly of the polymer. The nucleotide sequence can be interrupted by components that are not nucleotides. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications include, for example, layers, substitution of one or more of the naturally occurring nucleotides with an analogue, internucleotide modifications such as, for example, those with uncharged ligands (eg, methyl phosphonates , phosphotriesters, phosphoamidates, carbamates, etc.) and with charged ligands (eg, phosphorothioates, phosphorodithioates, etc.); those containing pendant portions, such as, for example, proteins (eg, nucleases, toxins, antibodies, signal peptides, L-lysine-layer, etc.); those with intercalators (eg acridine, soralen, etc.); those that contain chelators (for example, metals, radioactive metals, boron, oxidizing metals, etc.); those containing the alkylating agents, those with modified linkages (eg alpha anomeric nucleic acids, etc.); as well as the unmodified forms of polynucleotide (s).
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0065.tif" />
Furthermore, any of the hydroxyl groups normally present in sugars can be replaced, for example, by phosphonate groups, phosphate groups, can be protected by standard protection groups, or can be activated to prepare additional linkages to additional nucleotides, or they can be combined with solid supports. The 5 'and 3' OH terminus can be phosphorylated or substituted with amines or moieties with organic layer groups of 1 to 20 carbon atoms. Other hydroxyls can also be derived to standard protecting groups. The polynucleotides may also contain the analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2'-0-methyl-, 2'-0alyl, 2'-fluoro- or 2'- azido-ribose, carbocyclic sugar analogs, alpha-anomeric sugars, epimeric sugars such as arabinose, xyloses or lixose, pyranous sugars, furanous, sedoheptulose sugars, acyclic analogs, and abasic nucleoside analogs, such as methyl riboside. One or more phosphodiester bonds can be replaced by alternative bonding groups. These alternative linking groups include, but are not limited to, modalities where phosphate is replaced by P (O) S (thioate); P (S) S (dithioate); (O) NR<sub>2</sub> (Amidate), P (O) R, P (O) OR, CO or CH<sub>2 </sub>(formacetal); wherein each R or R 'is the substituted or unsubstituted (1-20 C) alkyl independently of H which
<img file="MX340437B_D0066.tif" />
IMPI
INSTITUT · MEXICAN
OF THE PRORITY
INDUSTRIAL optionally contains an ether bond (—O—), '”aryl7' alkenyl, cycloalkyl, cycloalkenyl, or araldyl. Not all the bonds in a polynucleotide need to be identical. The above description applies to all polynucleotides referred to in this document, including RNA and DNA.
The term vector means a construct, which is capable of delivering, and expressing, one or more genes (s) or sequence (s) of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, expression vectors of DNA or RNA encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.
The terms polypeptide, peptide, and protein are used interchangeably throughout this document to refer to amino acid polymers of any length. The polymer can be linear or branched, can comprise modified amino acids, and can be interrupted by non-amino acids. The terms also include an amino acid polymer that has been modified naturally or by intervention, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a
<img file="MX340437B_D0067.tif" />
yes IMPI
MEXICAN INSTITUTE of industrial RRORIRDAD marked component. Also included in the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, artificial amino acids, etc.); as well as other modifications known in the art. It is understood that, because the polypeptides of this invention are antibody based, in certain embodiments, the polypeptides can appear as single chains or associated chains.
The terms identical or percent identity in the context of two or more nucleic acids or polypeptides, refer to two or more sequences or subsequences that are the same or have a specific percentage of nucleotides or amino acid residues that are the same, when compared and are aligned (introducing gaps, if necessary) for maximum correspondence, without considering any of the conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured by the sequence comparison program or algorithms or by visual inspection. Various algorithms and programs that can be used to obtain nucleotide or amino acid sequence alignments are known in the art. Such a non-limiting example of an algorithm for sequence alignment is the algorithm described in Karlin et al., 1990, Proc. Nati. Acad. Sci., 87: 2264-2268, as modified in Karlin et al., 1993, Proc. Nati. Acad.
<img file="MX340437B_D0068.tif" />
Sci., 90: 5873-5877, and incorporated in the NBLAST and XBLAST programs (Altschul et al., 1991, Nucleic Acids Res., 25: 33893402). In certain embodiments, the Gapped BLAST can be used as described in Altschul et al., 1997, Nucleic Acids Res. 25: 3389-3402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266: 460-480); ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or Megalign (DNASTAR) are additional publicly available software programs that can be used to align sequences. In certain embodiments, the percent identity between two nucleotide sequences is determined by the GAP program in the GCG software (for example, using a NWSgapdna.CMP matrix and a weight in the range of 40, 50, 60, 70, or 90 and a weight of the section of 1, 2, 3, 4, 5 or 6). In certain alternative modalities, the GAP program in the GCG program package, which incorporates the Needleman and Wunsch algorithm (J. Mol. Biol. (48): 444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (for example, using either a Blossum 62 matrix or a PAM250 matrix, and a weight in the range of 16, 14, 12, 10, 8, 6, or 4 and a weight of the section of 1, 2, 3, 4, 5). On the other hand, in certain modalities, the percent identity between nucleotide or amino acid sequences is determined by the Myers and Miller algorithm (CABIOS, 4: 11-17 (1989)). For example, percent identity can be
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL RRORIEDAD
<img file="MX340437B_D0069.tif" />
Determine by the ALIGN program (version - -and by a PAM120 with residual table, a penalty in the length of the interval of 12 and a penalty of the interval of 4. The appropriate parameters for maximum alignment by a particular alignment program are can be determined by a person skilled in the art In certain embodiments, the predetermined parameters of the alignment program are used. In certain embodiments, the percent identity X "of a first amino acid sequence to a second amino acid sequence is calculated as 100 x (Y / Z); where Y is the number of amino acid residues noted as identical counterparts in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is greater than the second sequence, the percent identity of the first sequence with the second sequence will be greater than the percent identity of the second sequence with the first sequence.
As a non-limiting example, if any particular polynucleotide has a certain percentage of sequence identity (eg, being at least 80% identical, at least 85% identical, at least 90% identical, and, in some embodiments, at least 95 %, 96%, 97%, 98% or 99% identical) with
<img file="MX340437B_D0070.tif" />
A reference sequence can, in certain ways, be determined using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park 575 Science Drive, Madison, WI 53711). Bestfit uses Smith and Waterman's local homology algorithm, Advances in Applied Mathematics 2: 482 489 (1981); to find the best homology segment between two sequences. When Bestfit or any other sequence alignment program is used to determine if a particular sequence is, for example, 95% identical to a reference sequence according to the present
<td>invention,</td><td>the</td><td>parameters are adjusted</td><td>so that</td><td>percentage</td><td>of</td>
<td>identity</td><td>I know</td><td>calculate on the</td><td>sequence</td><td>complete</td><td>of</td>
<td>nucleotides</td><td>of</td><td>full reference</td><td>and what is</td><td>allow</td><td>the</td>
<td>gaps in</td><td>the</td><td>homology of up</td><td colspan="2">5% of the total number</td><td>of</td>
<td>nucleotides</td><td>in</td><td colspan="2">the reference sequence.</td><td></td><td></td>
<td colspan="4">In some embodiments, two acids</td><td>nucleic</td><td>or</td>
Polypeptides of the invention are substantially identical, meaning that they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% identity of nucleotide or amino acid residues, when compared and aligned for maximum match, when measured by sequence comparison algorithm or by visual inspection. In certain modalities, the identity
ΙΜΡΙ
MEXICAN INSTITUTE • S LA FROFIEDAD INDUSTRIAL
<img file="MX340437B_D0071.tif" />
exists over a region of the sequences that is at least about 10, 20, 40-60 residues in length or any integral value between them, or over a region longer than 60 to 80 residues, at least about 90 -100 residues, or the sequences are substantially identical over the complete sequences being compared, such as, for example, the region encoding a nucleotide sequence.
A conservative amino acid substitution is one in which one amino acid residue is replaced with another amino acid residue that has a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (eg, lysine, arginine, histidine); acid side chains (eg, aspartic acid, glutamic acid); the uncharged polar side chains (eg asparagine, glutamine, serine, threonine, tyrosine, cysteine); nonpolar side chains (eg, glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); beta branched side chains (eg threonine, valine, isoleucine) and aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). For example, substituting a phenylalanine for a tyrosine is a
IMPI
MEXICAN INSTITUTE OF LA FRORIEDAD
INDUSTRIAL
<img file="MX340437B_D0072.tif" />
conservative substitution. In certain embodiments, conservative substitutions in the sequences of the polypeptides and antibodies of the invention do not abolish the binding of the amino acid sequence-containing polypeptide or antibody to the antigen (s); that is, the FOLR1 to which the polypeptide or antibody binds. Methods of identifying conservative nucleotide and amino acid substitutions that do not eliminate antigen binding are well known in the art (see, eg, Brummell et al., Biochem. 32: 1180-1 187 (1993); Kobayashi and others Protein Eng. 12 (10): 879-884 (1999); and Burks et al. Proc. Nati. Acad. Sci. United States 94: .412-417 (1997)).
As used in the present description and in the claims, the singular forms one, one, and, include the plural forms unless the context clearly indicates otherwise.
It is understood that wherever the modalities with the language it comprises are described herein, the contrary analogous modalities described in the terms consisting of and / or consisting essentially of are also provided.
The term and / or as used herein in a phrase such as A and / or B is intended to include both A and B, A or B, A and B. Similarly, the term and / or as used in
IMPI
MfcXfCANC INSTITUTE OF Industxial PROPERTY
<img file="MX340437B_D0073.tif" />
a phrase such as A, B, and / or C is intended to include each ühá of the following modalities: A, B, and C; A, B, or C; A or C; A or Β; B or C; Ay C; A and Β; B and C; A (alone); B (alone); and C (only).
II. Binding agents-FOLRl
The present invention provides agents that specifically bind human FOLRl. These agents are referred to herein as FOLRl binding agents. The full length amino acid (aa) and nucleotide (nt) sequences of FOLR1 are known in the art and are provided herein as represented by Sec. with no. Ident .: 25 and 26, respectively.
In certain embodiments, the FOLRl binding agents are antibodies, immunoconjugates, or polypeptides. In some embodiments, the FOLRl binding agents are humanized antibodies. In certain embodiments, the FOLR-1 binding agents are humanized versions of the murine Movl9 antibody (heavy and light chain variable are shown as ID #: 17 and 18, respectively).
In certain modalities, FOLRl binding agents have one or more of the following effects: it inhibits the proliferation of tumor cells, reduces the tumorigenicity of a tumor by reducing the frequency of cancer stem cells in the tumor, inhibits tumor growth, increases survival, triggers
IMPI
MEXICAN INSTALLATION OF THE INDUSTRIAL RROFIEDaC
<img file="MX340437B_D0074.tif" />
cell death of tumor cells, differentiates tumorigenic cells to a non-tumorigenic state, or prevents
<td colspan="5">tumor cell metastasis.</td>
<td colspan="2">In certain</td><td>modalities,</td><td>immunoconjugates u</td><td>others</td>
<td>agents who</td><td>of</td><td>specific way</td><td>join FOLR1</td><td>human</td>
<td>trigger</td><td>the</td><td>cell death</td><td>through a</td><td>agent</td>
<td>cytotoxic.</td><td>By</td><td>example in</td><td colspan="2">certain modalities, a</td>
<td>antibody</td><td>a</td><td>FOLR1 antibody</td><td>human conjugates</td><td>with a</td>
maytansinoid that is activated in tumor cells that express FOLR1 by internalizing the protein. In certain alternative embodiments, the agent or antibody is not conjugated.
In certain embodiments, FOLR1 binding agents are capable of inhibiting tumor growth. In certain embodiments, FOLR1 binding agents are capable of inhibiting tumor growth in vivo (eg, in a mouse and / or human xenograft model having cancer). In certain embodiments, FOLR1 binding agents are capable of inhibiting tumor growth in a human.
Thus, the invention provides a humanized antibody or antigen-binding fragment thereof that specifically binds to a human folate receptor 1, where the antibody comprises: (a) a heavy chain CDR1 comprising GYFMN (sec with ID number: 1) a CDR2 of
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0075.tif" />
heavy chain comprising RTHPYnGDTFVHnya ^^^ - ^ aa ·, (bac.
with no. Ident .: 56); and a heavy chain CDR3 comprising YDGSRAMDY (sec. with ID #: 3); and (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (sec. with ID #: 7); a light chain CDR2 comprising RASNLEA (SEQ ID NO: 8); and a light chain CDR3 comprising QQSREYPYT (sec. with ID #: 9); where Xaai is selected from K, Q, H and R; Xaa2 is selected from Q, Η, N, and R, and Xaa3 is selected from G, E, T, S, A, and V. In certain embodiments, the antibody is the Movl9hu antibody, which is the antibody described above that comprises the heavy chain CDR2 RIHPYDGDTFYNQKFQG (SEQ ID NO: 2).
In certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind to the FOLRl comprising Movl9hu CDRs with up to four (i.e. 0, 1, 2, 3, or 4) conservative substitutions of amino acids by CDR. Thus, in certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind to a human folate receptor 1, where the antibody comprises: (a) a heavy chain CDR1 comprising GYFMN sec. with no. Ident .:1), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; a heavy chain CDR2 that
IMPIj *
MEXICAN INSTITUTE 'ff ·
DE LA RROHEDAD C · INDUSTRIAL includes RIHPYDGDTFYNQKFQG (section with ID number: 2), or
<img file="MX340437B_D0076.tif" />
a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and a heavy chain CDR3 comprising YDGSRAMDY (sec. with ID #: 3), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions and / or (b) a CDRl of light chain comprising KASQSVSFAGTSLMH (sec. no. Ident .: 7), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; a light chain CDR2 comprising RASNLEA (SEQ ID NO: 8), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and a light chain CDR3 comprising QQSREYPYT (SEQ ID NO: 9), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
The invention also provides humanized (FRl-21hu) or an antigen-binding fragment thereof that specifically binds to a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDRl comprising SSYGMS ( sec.
ident.:30); a heavy chain CDR2 comprising TISSGGSYTY (sec. ID No.:31); and a heavy chain CDR3 comprising DGEGGLYAMDY (sec. ID No.:32); and / or (b) a light chain CDRl comprising KASDHINNWLA (seq. with ID no .: 27); a chain CDR2
<td>a</td><td>antibody</td>
<td colspan="2">to the antigen of</td>
<td colspan="2">receiver 1 of</td>
<td colspan="2">(a) a CDRl of</td>
<td>with</td><td>no. of</td>
<td>than</td><td>understands</td>
<td>CDR3</td><td>chain</td>
<td>with</td><td>no. of</td>
<td>to what</td><td>understands</td>
<td>CDR2</td><td>chain</td>
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0077.tif" />
light comprising GATSLET (sec. with ID no .: 28); and a light chain CDR3 comprising QQYWSTPFT (sec. with ID #: 29).
In certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind to FOLR1 comprising CDRs of FRl-21hu with up to four (i.e. 0, 1, 2, 3, or 4) substitutions. conservative amino acids by CDR. Thus, in certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind a human folate receptor, where the antibody comprises: (a) a heavy chain CDR1 comprising SSYGMS (sec. with ident #: 30) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a heavy chain CDR2 comprising TISSGGSYTY (sec. no. ident: 31) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a heavy chain CDR3 comprising DGEGGLYAMDY (sec. ID no: 32) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or (b) a light chain CDR1 comprising KASDHINNWLA (seq. no. ident: 27) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a light chain CDR2 comprising GATSLET (sec. with ident #:
ΙΜΡΙ
INSTTTVfO MEXICANC DE LA «OREDAD INDUSTRIAL
<img file="MX340437B_D0078.tif" />
28) or a variant thereof comprising — i, 2. 3. 6 4 conservative amino acid substitutions; and / or a light chain CDR3 comprising QQYWSTPFT (sec. ID no: 29) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
In certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind to FOLRl comprising CDRs of FRl-48hu with up to four (i.e. 0, 1, 2, 3, or 4) substitutions. conservative amino acids by CDR. Thus, in certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind a human folate receptor 1, where the antibody comprises: (a) a heavy chain CDRl comprising TNYWMQ (sec ident #: 60) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a heavy chain CDR2 comprising IYPGNGDSR (sec. no. ident: 61) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a heavy chain CDR3 comprising RDGNYAAY (sec. with ID #: 62) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or (b) a light chain CDRl comprising RASENIYSNLA (sec. with ID #: 57) or a variant thereof comprising 1, 2, 3, or 4
IMPI
INSTITUTO MEXICANO OE LA PROPIEDAD INDUSTRIAL conservative amino acid substitutions; and / or a light chain CDR2 comprising AATNLAD (SEQ ID NO: 58) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a light chain CDR3 comprising QHFWASPYT (sec. with ID #: 59) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
In certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind to FOLRl comprising the FRl-49hu CDRs with up to four (i.e. 0, 1, 2, 3, or 4) substitutions. conservative amino acids by CDR. Thus, in certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind to a human folate receptor 1, where the antibody comprises: (a) a heavy chain CDRl comprising CDRl TNYWMY (sec. with ident no .: 66) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions, and / or a heavy chain CDR2 comprising AIYPGNSDTT (sec. with no. Ident: 67) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions and / or a heavy chain CDR3 comprising RHDYGAMDY (seq. with ID #: 68) or a variant of this comprising 1, 2, 3, or 4 conservative amino acid substitutions, and / or (b) a chain CDRl
<img file="MX340437B_D0079.tif" />
<img file="MX340437B_D0080.tif" />
ΙΜΡΙ
MEXICAN INSTITUTE
OF THE «DHEDAD
Light INDUSTRIAL comprising RASENIYTNLA (sec. With ID no: 63) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions, and / or a light chain CDR2 comprising TASNLAD (sec. with ident #: 64) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions and / or a light chain CDR3 comprising QHFWVSPYT (seq. Ident: 65) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
In certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind to FOLR1 comprising CDRs of FRl-57hu with up to four (i.e. 0, 1, 2, 3, or 4) substitutions. conservative amino acids by CDR. Thus, in certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind to a human folate receptor 1, where the antibody comprises: (a) a heavy chain CDR1 comprising SSFGMH ( ID #: 72) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a heavy chain CDR2 comprising YISSGSSTIS (sec. no. ident: 73) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a heavy chain CDR3 comprising EAYGSSMEY (sec. with ID #: 74) or a
<img file="MX340437B_D0081.tif" />
is IMPI
MEXICAN INSTITUTE
Dt LA FHOREPAD
INDUSTRIAL variant of this comprising 1, 2, 3, or 4 * SUS Ll Luciunei »conservative amino acids; and / or (b) a light chain CDRl comprising RASQNINNNLH (sec. ID no: 69) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a light chain CDR2 comprising YVSQSVS (sec. no. ident: 70) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a light chain CDR3 comprising QQSNSWPHYT (sec. with ID #: 71) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
In certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind to FOLR1 comprising CDRs of FRl-65hu with up to four (i.e. 0, 1, 2, 3, or 4) substitutions. conservative amino acids by CDR. Thus, in certain embodiments, the invention provides humanized antibodies or antigen-binding fragments that specifically bind to a human folate receptor 1, where the antibody comprises: (a) a heavy chain CDRl comprising TSYTMH ( ID #: 78) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a heavy chain CDR2 comprising YINPISGYTN (seq. no. ident: 79) or a variant thereof comprising 1, 2, 3, or 4 substitutions
IMPI
MEXICAN INSTITUTE OE INDUSTRIAL PROPERTY
<img file="MX340437B_D0082.tif" />
conservative amino acids; and / or a peaadou CDR3 comprising GGAYGRKPMDY (sec. ID no: 80) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or (b) a light chain CDR1 comprising KASQNVGPNVA (sec. with ID #; 75) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a light chain CDR2 comprising SASYRYS (sec. no. ident: 76) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and / or a light chain CDR3 comprising QQYNSYPYT (sec. with ID #: 77) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
Polypeptides comprising one of the individual light chains or heavy chains described herein, as well as polypeptides (eg, antibodies) comprising both a light chain and a heavy chain are also provided. The polypeptides of sec. with no. ident: 4 and 6 comprise the variable domain of a Movl9hu heavy chain, and a Movl9hu heavy chain, respectively. The polypeptides of sec. with no. Ident: 10-13 comprise version 1.00 of the light chain variable domain, version 1.60 of the light chain variable domain, version 1.00 of light chain and version 1.60 of light chain of Movl9hu, respectively.
ΙΜΡΙ
MUDCAN INSTITUTE OF INDUSTRIAL RROHEDAD
<img file="MX340437B_D0083.tif" />
The polypeptides of sec. with no. ident: 42 and 4 6 comprise the variable domain of a FR121hu heavy chain, and a FRl-21hu heavy chain, respectively. The polypeptides of sec. with no. ident: 41 and 45 comprise the light chain and light chain variable domain of FRl-21hu, respectively. The polypeptides of sec. with no. Ident: 97 and 113 comprise the variable domain of a FRl-48hu heavy chain, and a FRl-48hu heavy chain, respectively. The polypeptides of sec. with no. Ident: 96 and 112 comprise the variable domain of a light chain and a light chain of FR148hu, respectively. The polypeptides of sec. with no. Ident: 99 and 115 comprise the variable domain of a FRl-49hu heavy chain, and a FRl-49hu heavy chain, respectively. The polypeptides of sec. with no. Ident: 98 and 114 comprise the variable domain of a light chain and a light chain of FRl-49hu, respectively. The polypeptides of sec. with no. Ident: 101 and 117 comprise the variable domain of a FR157hu heavy chain, and a FRl-57hu heavy chain, respectively. The polypeptides of sec. with no. Ident: 100 and 116 comprise the variable domain of a light chain and a light chain of FRl-57hu, respectively. The polypeptides of sec. with no. ident: 103 and 119 comprise the variable domain of a FRl-65hu heavy chain, and a
IMPI '^ ΉΤΤυΤ · MCXiCAPO OE LA ΓΜ · Ρ1ΕΟΑΟ INOUSTtlAI.
<img file="MX340437B_D0084.tif" />
FRl-65hu heavy chain, respectively. Tn? p <~> li pept - i Hr> =; of the sec. with no. Ident: 102 and 118 comprise the variable domain of a light chain and a light chain of FRl-65hu, respectively.
Also provided are polypeptides comprising: (a) a polypeptide having at least about 90% sequence identity with sec. with no. Ident: 4 or
6; and / or (b) a polypeptide having at least about
90% sequence identity with sec. with no. Ident: 10-13. Also provided are polypeptides comprising: (a) a polypeptide having approximately 90% sequence identity with sec. with no. from ident:
or 46; and / or (b) a polypeptide having at least about 90% sequence identity with sec. with no. ident: 41 and 45. Polypeptides are also provided comprising: (a) a polypeptide having at least about 90% sequence identity with sec. with no. Ident: 97 or 113; I (b) a polypeptide having at least about 90% sequence identity with sec. with no. Ident: 96 or 112. Also provided are polypeptides comprising: (a) a polypeptide having at least about 90% sequence identity with sec. with no. ident: 99 or 115; and / or (b) a polypeptide having at least about 90% sequence identity with sec.
ΙΜΡΙ
MEXICAN INSTITUTE »E LA MOREDA E> INDUSTRIAL
<img file="MX340437B_D0085.tif" />
with no. Ident: 98 or 114. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 90% sequence identity with seo. with no. ident: 101 or 117; and / or (b) a polypeptide having at least about 90% sequence identity with sec. with no. Ident: 100 or 116. Also provided are polypeptides comprising: (a) a polypeptide having at least about 90% sequence identity with sec. with no. ident: 103 or 119 and / or (b) a polypeptide having at least about 90% sequence identity with sec.
with no. Ident: 102 or 118. In certain embodiments, the polypeptide comprises a polypeptide having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the sequence identity with sec. with no. ident: 6, 4, 10-13, 41, 42, 45 or 46. Thus, in certain embodiments, the polypeptide comprises (a) a polypeptide that has at least about 95% sequence identity with sec. with no. Ident: 4 or
6, and / or (b) a polypeptide having at least about
95% sequence identity with sec. with no. Ident: 10-13. In certain embodiments, the polypeptide comprises (a) a polypeptide that has at least about 95% sequence identity with sec. with no. Ident: 42 i ivi ri
INSTITUTO MEXICANO Bf LA MOPIEDAO INDUSTRIAL or 46, and / or (b) a polypeptide having at least approximately 95% sequence identity with sec. with no. Ident: 41 or 45. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 95% sequence identity with sec. with no. ident: 97 or 113 and / or (b) a polypeptide having at least about 95% sequence identity with sec. with no. Ident: 96 or 112. Also provided are polypeptides comprising: (a) a polypeptide having at least about 95% sequence identity with sec. with no. ident: 99 or 115; and / or (b) a polypeptide having at least about 95% sequence identity with sec. with no. Ident: 98 or 114. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 95% sequence identity with sec. with no. ident: 101 or 117; and / or (b) a polypeptide having at least about 95% sequence identity with sec. with no. Ident: 100 or 116. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 95% sequence identity with sec. with no. Ident: 103 or
> 119; and / or (b) a polypeptide having at least about 95% sequence identity with sec. with no. Ident: 102 or 118. In certain modalities, the
IMPI
<img file="MX340437B_D0086.tif" />
Polypeptide comprises (a) a qpe L polypeptide reigning the amino acid sequence of seo. with no. of ident: 4; and / or (b) a polypeptide having the amino acid sequence of seo. with no. Ident: 10 o sec. with no. Ident: 11.
In certain embodiments, the polypeptide comprises (a) a polypeptide having the amino acid sequence of sec. with no. Ident: 45; and / or (b) a polypeptide having the amino acid sequence of sec. with no. Ident: 46. In certain embodiments, the polypeptide comprises (a) a polypeptide having the amino acid sequence of sec. with no. of ident: 6; and / or (b) a polypeptide having the amino acid sequence of sec. with no. Ident: 12 o sec. with no. Ident: 13. In certain embodiments, the polypeptide is an antibody and / or the polypeptide specifically binds to human folate receptor 1. In certain embodiments, the polypeptide is a humanized antibody that specifically binds to human folate receptor 1. For example, the invention provides a humanized antibody or antibody that specifically binds to a human FOLRl comprising (a) a polypeptide having the amino acid sequence of sec. with no. of ident: 4; and (b) a polypeptide having the amino acid sequence of sec. with no. Ident: 10 o sec. with no. Ident: 11.
In certain modalities of the polypeptide comprising sec. with no. ident: 4 is a heavy chain variable region.
IMPI
ΙΝΠΤΠΓΓΟ MUJCANO DE LA PROREDA · INDWTttlAL
<img file="MX340437B_D0087.tif" />
In certain embodiments, the polypeptide that occurs in Jas sec, with no. ident: 10 or 11 is a variable light chain region. The invention also provides an antibody or humanized antibody that specifically binds to a human FOLR1 comprising (a) a polypeptide having the amino acid sequence of sec. with no. of ident: 6; and (b) a polypeptide having the amino acid sequence of sec. with no. Ident: 12 or sec. with no. Ident: 13.
The invention also provides an antibody or humanized antibody that specifically binds to a human FOLR1 comprising (a) a polypeptide having the amino acid sequence of sec. with no. ident: 45, and (b) a polypeptide having the amino acid sequence of sec. with no. Ident: 46. The invention also provides an antibody or humanized antibody that specifically binds to a human FOLRl comprising (a) a polypeptide having the amino acid sequence of sec. with no. Ident: 112; and (b) a polypeptide having the amino acid sequence of sec. with no. Ident: 113. The invention also provides an antibody or humanized antibody that specifically binds to a human FOLRl comprising (a) a polypeptide having the amino acid sequence of sec. with no. Ident: 114; and (b) a polypeptide having the amino acid sequence of sec. with no. Ident: 115. The invention also provides an antibody or
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0088.tif" />
Humanized antibody that specifically binds-to-hear human FOLRl comprising (a) a polypeptide having the amino acid sequence of sec. with no. ident: 116; and (b) a polypeptide having the amino acid sequence of sec. with no. Ident .: 117. The invention also provides an antibody or humanized antibody that specifically binds to a human FOLRl comprising (a) a polypeptide having the amino acid sequence of sec. with no. Ident: 118; and (b) a polypeptide having the amino acid sequence of sec. with no. Ident: 119.
In certain embodiments, the polypeptide having a certain percentage of sequence identity with sec. with no. ident: 4, 6, 10-13, 41, 42, 45, 46, 96-103 and 112-119 differs from sec. with no. Ident: 4, 6, 10-13, 41, 42, 45, 46, 96-103, and 112-119 by conservative amino acid substitutions only.
In certain embodiments, the FOLRl binding agent comprises, consists in essence of, or consists of an anti-FOLRl antibody selected from the group consisting of the Movl9hu, FR-1-21, FR1-48, FR1-49, FR1- antibodies. 57, and
FR1-65.
In certain embodiments, the Movl9hu antibody is encoded by plasmids deposited with the American Type Culture Collection (ATCC) on April 7, 2010 and having ATCC deposit numbers PTA-10772 and
IMPI iNSTinrr · Mexican frbfieda »INBI ISTRIAL
<img file="MX340437B_D0089.tif" />
PTA-10773 or 10774. —______
In certain embodiments, the FR-1-21 antibody is encoded by ATCC plasmids deposited on April 7, 2010, and the deposit designation numbers PTA-10775 and 10776 are assigned.
In certain embodiments, humanized antibodies bind to FOLRl with substantially the same affinity as the Movl9 chimeric antibody. The affinity or avidity of an antibody for an antigen can be determined experimentally by any suitable well known method
<td colspan="2">in the art for example</td><td>the cytometry of</td><td colspan="2">flow test</td>
<td>immunosorbent</td><td>bound</td><td>to enzymes</td><td>(ELISA),</td><td>or</td>
<td>radioimmunoassay</td><td>(RIA), or</td><td>kinetic (for</td><td>example,</td><td>the</td>
<td>BIACORE ™ analysis)</td><td colspan="3">. Direct bond tests as well</td><td>how</td>
Competitive binding assay formats can be easily employed. (See, for example, Berzofsky, et al., Antibody-Antigen Interactions, in Fundamental Immunology, Paul, WE, Ed., Raven Press: New York, NY (1984); Kuby, Janis Immunology, WH Freeman and Company: New York , NY (1992); and the methods described in this document. The measured affinity of a particular antigen-antibody interaction can vary if measured under different conditions (eg, salt concentration, pH, temperature). Thus, measurements of affinity and other antigen binding parameters (eg, KD or Kd,
IMPI
MEXICAN INSTITUTE BE THE INDUSTRIAL PROPERTY
<img file="MX340437B_D0090.tif" />
K<sub>OR</sub>nr K<sub>OR</sub>ff) are prepared with the standardized antibody and antigen solutions, and a standardized buffer, as known in the art and as the buffer is described herein.
In one aspect, binding assays can be performed by flow cytometry on cells expressing the FOLR1 antigen on the surface. For example, FOLRl-positive cells such as SKOV3 were incubated with different concentrations of anti-FOLRl antibodies using 1 xl05 cells per sample in ΙΟΟμΙ of FACS buffer (RPMI-1640 medium supplemented with 2% normal sheep serum). The cells were then pelleted, washed, and incubated for 1 hr with 100 µΐ FITC-conjugated anti-ram mouse or anti-human IgG antibody in ram (as obtained from, for example, the Jackson Laboratory, 6 pg / ml in FACS buffer). Cells were pelleted again, washed with FACS buffer, and resuspended in 200 µΐ PBS with 1% formaldehyde. Samples were purchased, for example, using a FACSCalibur flow cytometer with the HTS multiwell dispenser and analyzed by CellQuest Pro (all from BD Biosciences, San Diego, USA). For each sample, the mean fluorescence intensity for FL1 (MFI) was exported and plotted against the antibody concentration in a semi-log plot to generate a binding curve. A sigmoidal dose curve76
<img file="MX340437B_D0091.tif" />
Response was adjusted for binding curves and EC50 values were calculated using programs such as GraphPad Prism v4 with default parameters (GraphPad software, San Diego, CA). EC50 values can be used as a measure for the apparent dissociation constant Kd or KD for each antibody.
Monoclonal antibodies can be prepared by hybridoma methods, such as those described by Kohler and Miistein (1975) Nature 256: 495. By the hybridoma method, a mouse, hamster, or other appropriate host animal is immunized as described above to induce the production of antibodies by lymphocytes that can specifically bind to an immunizing antigen. Lymphocytes can also be immunized in vitro. Following immunization, the lymphocytes are isolated and fused with a suitable myeloma cell line using, for example, polyethylene glycol, to form hybridoma cells that can be selected after lymphocytes and unfused myeloma cells. Hybridomas that produce monoclonal antibodies specifically directed against a selected antigen as determined by immunoprecipitation, immunoblotting, or by an in vitro binding assay (eg, radioimmunoassay (RIA); enzyme-linked immunosorbent assay (ELISA)) , can then be propagated either in vitro culture by
ΙΜΡΙ
MEXICAN INSTITUTE
OE LA TROTIEDAL - industrial W g standard methods (Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, 1986) or in vivo as ascites tumors in an animal. Monoclonal antibodies can be purified after culture medium or ascites fluid as described above for polyclonal antibodies.
Furthermore, monoclonal antibodies can also be prepared by recombinant DNA methods as described in US Pat. 4,815,567. Polynucleotides encoding a monoclonal antibody are isolated from mature B cells or hybridoma cells, such as by RT-PCR, specifically using oligonucleotide primers that specifically amplify genes encoding the heavy and light chains of the antibody. , and its sequence is determined by conventional procedures. The isolated polynucleotides encoding the heavy and light chains are then cloned into suitable expression vectors, which, when transfected into host cells, such as E. coli cells, ape COS cells, Chinese hamster ovary cells ( CHO), or myeloma cells that do not otherwise produce immunoglobulin protein, monoclonal antibodies are generated by host cells. Also, recombinant monoclonal antibodies or fragments thereof of suitable species can be isolated from
IMPI
INSTITUT · MEXICAN ° E LA MONEDA »INBOSTRIAL
<img file="MX340437B_D0092.tif" />
phage display libraries expressing the J LUR of 1 »convenient species as described (McCafferty et al., 1990, Nature, 348: 552-554; Clackson et al., 1991, Nature, 352: 624-628 ;. and Marks et al., 1991, J. Mol. Biol., 222: 581597).
The polynucleotide (s) encoding a monoclonal antibody can be further modified in a number of different ways by using recombinant DNA technology to generate alternative antibodies. In some embodiments, the light and heavy chain constant domains of, for example, a mouse monoclonal antibody can be replaced 1) by those regions of, for example, a human antibody to generate a chimeric antibody or 2) by a polypeptide non-immunoglobulin to generate a fusion antibody. In some embodiments, the constant regions are truncated or removed to generate the convenient antibody fragment of a monoclonal antibody. Variable region high-density or site-directed mutagenesis can be used to optimize specificity, affinity, etc. of a monoclonal antibody.
In some embodiments, the monoclonal antibody against human FOLR1 is a humanized antibody. In certain modalities, such antibodies are used therapeutically to reduce antigenicity and HAMA responses.
<img file="MX340437B_D0093.tif" />
(human anti-mouse antibody) when administered to a human subject.
Methods for modifying, humanizing, or coating non-human or human antibodies can also be used and are well known in the art. A modified, coated, or similarly humanized antibody may have one or more amino acid residues from a non-human source, for example, but is not limited to mouse, rat, rabbit, non-human primate, or other mammal. These non-human amino acid residues are replaced by residues that are often referred to as import residues, which are normally taken from an import, constant, or other variable domain of a known human sequence.
Such imported sequences can be used to reduce immunogenicity or to reduce, improve or modify binding, affinity, rate, out-of-rate, avidity, specificity, half-life, or any other suitable characteristic, as known in The technique. In general, CDR residues are directly and more substantially involved in influencing binding to FOLR1. Consequently, part or all of the non-human or human CDR sequences are maintained while the non-human sequences of the variable and constant regions can be replaced with human or other amino acids.
Antibodies can optionally be humanized,
ΙΜΡΙ
MEXICAN INSTITUTE OF INDUSTRIAL FRORITY
<img file="MX340437B_D0094.tif" />
coat, modify or even human antibodies are modified with high affinity retention for FOLR1 antigen and other favorable biological properties. To achieve this goal, humanized (or human) or modified anti-FOLR1 antibodies and coated antibodies can be prepared by an optional process of parental sequence analysis and various humanized and modified conceptual products using three-dimensional models of the modified, parental sequences, and humanized. Three-dimensional immunoglobulin models are commonly available and are familiar to those of skill in the art. Computer programs that illustrate and demonstrate the probable three-dimensional conformational structures of selected candidate immunoglobulin sequences are available. Inspection of these samples allows analysis of the likely role of residues in the functioning of the candidate immunoglobulin sequence, that is, analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen, such as FOLRl . In this way, the framework residues (FR) can be selected and combined from the imported and consensus sequences so that the convenient characteristic of the antibody is achieved, such as increased affinity for the target antigen (s).
Humanization, coating or modification of
IMPI
MEXICAN INSTITUTE OE LA FRORIEDAD INDUSTRIAL
<img file="MX340437B_D0095.tif" />
The antibodies of the present invention are pupHpn r ^ aIi zar using any known method, such as but not limited to those described in, Winter (Jones et al., Nature 321: 522 (1986); Riechmann et al., Nature 332: 323 ( 1988); Verhoeyen et al., Science 239: 1534 (1988)), Sims et al., J. Immunol. 151: 2296 (1993); Chothia and Lesk, J. Mol. Biol. 196: 901 (1987), Carter et al., Proc. Nati. Acad. Sci.
<td colspan="2">United States. 89: 4285</td><td>(1992); Presta and others,</td><td>J. Immunol.</td>
<td> 151:2623</td><td colspan="2">(1993), US Patent with numbers</td><td> 5,639, 641;</td>
<td> 5,723,323;</td><td> 5,976,862;</td><td> 5,824,514; 5,817,483;</td><td> 5,814,476;</td>
<td> 5,763,192;</td><td> 5,723,323;</td><td> 5,766,886; 5,714,352;</td><td> 6,204,023;</td>
<td> 6, 180,370;</td><td> 5,693,762;</td><td> 5,530,101; 5,585,089;</td><td> 5,225,539;</td>
<td> 4,816,567;</td><td colspan="2">PCT /: US98 / 16280; US96 / 18978;</td><td>US91 / 09630;</td>
<td>US91 / 05939</td><td>; US94 / 01234;</td><td>GB89 / 01334; GB91 / 01134;</td><td>GB92 / 01755;</td>
<td>WO90 / 14443</td><td>; WO90 / 14424;</td><td>W090 / 14430; EP 229246;</td><td> 7,557,189;</td>
<td> 7,538,195;</td><td>and 7,342,110,</td><td>each of which is</td><td>incorporates</td>
this document in its entirety for reference, including the references cited here.
In certain alternative modalities, the antibody stops
FOLRl is a human antibody. Human antibodies can be prepared directly by various techniques known in the art. Immortalized human B lymphocytes that are immunized in vitro or isolated from an immunized individual that produces an antibody directed against a target antigen can be generated (See, for
ΙΜΡΙ
MEXICAN INSTITUTE of INDUSTRIAL NATURE
<img file="MX340437B_D0096.tif" />
example, Colé et al., Monoclonal An-t - i hnH-ί
Therapy, Alan R. Liss, p. 77 (1985); Boemer et al., 1991, J. Immunol, 147 (1): 86-95; and US patent 5,750,373). Also, the human antibody can be selected from a phage library, where that phage library expresses human antibodies, as described, for example, in Vaughan et al., 1996, Nat. Biotech., 14: 309-314, Sheets et al., 1998, Proc. Nati. Acad. Sci., 95: 6157-6162, Hoogenboom and Winter, 1991, J. Mol. Biol., 227: 381, and Marks et al., 1991, J. Mol. Biol., 222: 581). Techniques for the generation and use of phage antibody libraries are also described in US Pat. nos. 5,969,108; 6,172,197; 5,885,793; 6,521,404; 6,544,731; 6,555,313; 6,582,915; 6,593,081; 6,300,064; 6,653,068; 6,706,484; and 7,264,963; and Rothe et al., 2007, J. Mol. Bio., Doi: 10.1016 / j.jmb.2007.12.018 (which are incorporated in their entirety by reference). Affinity maturation strategies and chain exchange strategies (Marks et al., 1992, Bio / Technology 10: 779-783, incorporated in its entirety by reference) are known in the art and can be used to generate antibodies high affinity humans.
Humanized antibodies can also be prepared in transgenic mice that contain the human immunoglobulin loci that are capable of producing in the
<img file="MX340437B_D0097.tif" />
immunization of the entire repertoire of antibodies — human a a. absence of endogenous immunoglobulin production. This approach is described in US Patents. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; and 5,661,016.
This invention also includes bispecific antibodies that specifically recognize a human folate receptor 1. Bispecific antibodies are antibodies that are capable of specifically recognizing and binding at least two different epitopes. Different epitopes can be either within the same molecule (eg, the same human folate receptor 1) or in different molecules such that, for example, both antibodies can specifically recognize and bind a human folate receptor 1, as well as , eg 1) a leukocyte effector molecule, such as a T cell receptor (eg CD3) or the Fe receptor (eg CD64, CD32, or CD16) or 2) a cytotoxic agent as described in detail below.
Illustrative bispecific antibodies can bind to two different epitopes, at least one of which originates from a polypeptide of the invention. Furthermore, an antiantigenic arm of an immunoglobulin molecule can be combined with an arm that binds to a leukocyte activation molecule such as a T-cell receptor molecule (eg, CD2, CD3, CD28, or B7 ), or
IMPI
INSTITUTO MEXICANO PE LA PROPIEDAD industrial
<img file="MX340437B_D0098.tif" />
Fe receptors for IgG by way of cellular defense mechanisms to the cell that expresses the particular antigen. Bispecific antibodies can also be used to target cytotoxic agents to cells that express a particular antigen. These antibodies possess an antigen-binding arm and an arm that binds a cytotoxic agent or a chelating radionuclide, such as EOTUBE, DTPA, DOTA, or TETA. Techniques for preparing bispecific antibodies are common in the art (Millstein et al., 1983, Nature 305: 537-539; Brennan et al., 1985, Science 229: 81; Suresh et al., 1986, Methods in Enzymol. 121: 120 ; Traunecker et al., 1991, EMBO J. 10: 3655-3659; Shalaby et al., 1992, J. Exp. Med. 175: 217225; Kostelny et al., 1992, J. Immunol. 148: 1547-1553; Gruber and others, 1994, J. Immunol 152: 5368; and US Patent 5,731,168). Antibodies with more than two valencies are also contemplated. For example, trispecific antibodies can be prepared (Tutt et al., J. Immunol. 147: 60 (1991)). Thus, in certain modalities the antibodies to FOLR1 are multispecific.
In certain embodiments, an antibody fragment is provided to, for example, increase tumor penetration. Different techniques are known for the production of antibody fragments. Traditionally, these fragments are obtained through the proteolytic digestion of the
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL RRORIEDAD
<img file="MX340437B_D0099.tif" />
intact antibodies (eg, Morimoto and ~ otfOS7-i-993 and Journal of Biochemical and Biophysical Methods 24: 107-117; Brennan et al., 1985, Science, 229: 81). In certain embodiments, the antibody fragments are produced by recombination. The Fab, Fv, and scFv antibody fragments can be expressed and secreted from E. coli cells or from other host cells, thus allowing the production of large numbers of these fragments. Such antibody fragments can also be isolated from the phage antibody libraries discussed above. The antibody fragment can also be from linear antibodies as described in US Patent No. 5,641,870, for example, and can be monospecific or bispecific. Other techniques for producing antibody fragments will be apparent to the experienced practitioner.
In accordance with the present invention, the techniques can be adapted for the production of single chain antibodies specific for human folate receptor 1 (see US Patent No. 4,946,778). In addition, the methods can be adapted for the construction of Fab expression libraries (Huse, et al., Science 246: 1275-1281 (1989)) to allow rapid and efficient identification of monoclonal Fab fragments with the specificity desirable for a folate receptor 1, or derivatives, fragments, analogs or
IMPI
MEXICAN INSTITUTE
MEXICAN
CURRENCY Π INDUSTRIAL
<img file="MX340437B_D0100.tif" />
their counterparts. Fragments of the -pos && antibodies can be produced by methods in the art that include but are not limited to: (a) an F (ab ') 2 fragment produced by the digestion of pepsin of an antibody molecule; (b) a Fab fragment generated by the reduction of the disulfide bridges of an F (ab ') 2 fragment, (c) a Fab fragment generated by the treatment of the antibody molecule with papain and a reducing agent, and (d) Fv fragments.
This may also be desirable, especially in the case of antibody fragments, to modify an antibody to increase its half-life in serum. This can be accomplished, for example, by incorporation of a salvage receptor binding epitope into the antibody fragment by mutation of the appropriate region in the antibody fragment or by incorporation of the epitope into a peptide tag that is it then fuses with the antibody fragment at either end or in the middle (eg, by DNA or peptide synthesis).
Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are made up of two covalently linked antibodies. Such antibodies have been proposed, for example, to target immune cells to unwanted cells (US Patent No. 4,676,980). Antibodies are contemplated to be prepared in vitro by methods
IMPI
MEXICAN INSTITUTE OF MORI AGE INDUSTRIAL
<img file="MX340437B_D0101.tif" />
known in synthetic protein chemistry to ^ -qua-iaciLi ^ ie to those involving crosslinking agents. For example, immunotoxins can be constructed by a disulfide exchange reaction or by the formation of a thioether bond. Examples of reagents suitable for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate.
For the purposes of the present invention, it will be appreciated that the modified antibodies can comprise any type of variable region that is provided for the association of the antibody with the polypeptides of a human FOLR1. In this sense, the variable region can comprise or be derived from any type of mammal that can be induced to accumulate a humoral response and generate immunoglobulins against the convenient tumor associated antigen. As such, the variable region of the modified antibodies can be, for example, of human, murine, non-human primates (eg, cynomolgus monkeys, macaques, etc.) or lupine. In some embodiments, both the variable and constant regions of the modified immunoglobulins are human. In other embodiments, the variable regions of compatible antibodies (usually derived from a non-human source) can be specifically modified or adapted to improve binding properties or reduce immunogenicity of the molecule. With
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0102.tif" />
In this regard, the variable regions useful in the present invention can be humanized or otherwise altered through the inclusion of imported amino acid sequences.
In certain embodiments, variable domains in both heavy and light chains are altered by at least partial substitution of one or more of the CDRs and, if necessary, by partial substitution of the framework region and sequence change. Although CDRs can be derived from an antibody of the same class or even subclass of the antibody from which the framework regions are derived, it is envisaged that CDRs may be derived from an antibody of a different class and, in certain embodiments, from an antibody of a different species. It may not be necessary to replace all CDRs with complete CDRs from the donor variable region to transfer antigen binding ability from one variable domain to another. Rather, it would only be necessary to transfer those residues that are necessary to maintain the activity of the antigen binding site. Taking into account the explanations established in US patents nos. 5,585,089, 5,693,761, and 5,693,762 will be well within the competence of those skilled in the art, whether it be performing routine experimentation or obtaining by trial and error testing a functional antibody with reduced immunogenicity.
IMPI
MEXICAN INSTITUTE oe ia inoustrial currency
<img file="MX340437B_D0103.tif" />
Despite alterations in the ^ cp-ón and s ^ Írible, those skilled in the art will appreciate that the modified antibodies of this invention will be able to comprise the antibodies (eg, full-length antibodies or immunoreactive fragments thereof) in which at least a fraction of one or more of the constant region domains has been removed or conversely altered to provide convenient biochemical characteristics such as increased tumor localization or to reduce serum half-life when compared to an antibody of approximately the same immunogenicity comprising a native or unaltered constant region. In some embodiments, the constant region of the modified antibodies may comprise a human constant region. Modifications of the constant region compatible with this invention comprise additions, deletions or substitutions of one or more amino acids in one or more domains.
That is, the modified antibodies described herein can comprise alterations or modifications in one or more of the three heavy chain constant domains (CHl, CH2 or CH3) and / or in the light chain constant domain (CL). In some embodiments, modified constant regions are contemplated where one or more domains are partially or completely removed. In some embodiments, the modified antibodies may comprise the constructs.
IMPI
INSTITUTO MEXICANO OE LA TROFIEOAD industrial
<img file="MX340437B_D0104.tif" />
domain names removed or variants where YES 'dumiitiu Gltt · complete has been removed (ACH2 constructs). In some embodiments, the omitted domain of the constant region will be replaced by an amino acid short spacer (eg, 10 residues) that provides some of the molecular flexibility normally given by the absent constant region.
In addition to its configuration, it is known in the art that the constant region mediates various effector functions. For example, binding of the Cl component of complement to antibodies activates the complement system. Complement activation is important in the opsonization and lysis of cellular pathogens. Complement activation also stimulates the inflammatory response and may also be involved in autoimmune hypersensitivity. In addition, antibodies bind to cells through the Fe region, with a Fe receptor site in the Fe region of antibody that binds to a Fe receptor (FcR) in a cell. There are a number of Fe receptors that are specific to different classes of antibodies, including IgG (gamma receptors), IgE (eta receptors), IgA (alpha receptors), and IgM (mu receptors). Binding of antibodies to Fe receptors on the cell surface triggers a number of important and diverse biological responses including engulfment and destruction of particles.
IMPI
MEXICAN INSTITUTE OE THE INDUSTRIAL FROF1IDAD
<img file="MX340437B_D0105.tif" />
coated with antibodies, elimination ski lea meets Jó *.? immune, lysis of target cells coated with antibodies by cytolytic cells (termed antibody-dependent cell-mediated cytotoxicity, or ADCC), release of inflammatory mediators, transfer to the placenta, and control of immunoglobulin production.
In certain modalities, FOLR1-binding antibodies provide altered effector functions which, in turn, affect the biological profile of the administered antibody. For example, deletion or inactivation (via point mutations or other method) of a constant region domain can reduce Fe receptor binding of circulating modified antibodies thereby increasing tumor location. In other cases, it could be that constant region modifications consistent with this invention moderate complement binding and thus reduce life, however other constant region modifications can be used to remove disulfide bonds or the portions of oligosaccharides that allow localization to be improved due to increased antigen specificity or antibody flexibility. Similarly, constant region modifications in accordance with this invention can be readily prepared by either biochemical or molecular engineering techniques.
ΙΜΡΙ
MEXICAN INSTITUTE of the η · ηπ> Λυ industrial
<img file="MX340437B_D0106.tif" />
known within the scope of the person with ™ -j + on technique.
In certain embodiments, an FOLRl binding agent that is an antibody does not have one or more effector functions. For example, in some embodiments, the antibody has no antibody-dependent cellular cytotoxicity (ADCC) activity and / or has no complement-dependent cytotoxicity (CDC) activity. In certain embodiments, the antibody does not bind to a Fe receptor and / or complement factors. In certain embodiments, the antibody has no effector function.
It will be noted that, in certain embodiments, the modified antibodies can be modified to fuse the CH3 domain directly to the hinge region of the respective modified antibodies. In other constructs it would be desirable to provide a spacer peptide between the hinge region and the modified CH2 and / or the CH3 domains. For example, compatible constructs could be expressed where the CH2 domain is removed and the remaining CH3 domain (modified or unmodified) binds to the hinge region with a 5-20 amino acid spacer. Such a spacer can be added, for example, to ensure that the constant domain regulating elements remain free and accessible or that the hinge region remains flexible. However, it should be noted that amino acid spacers may, in some cases, prove to be
ΙΜΡΙ
MEXICAN INSTITUTE OF INDUSTRIAL FROFIEDAD
<img file="MX340437B_D0107.tif" />
immunogenic and induce an immune response nn H ^ seada against the construct. Accordingly, in certain embodiments, any spacer added to the construct will be relatively non-immunogenic, or even omitted entirely, to maintain the desirable biochemical qualities of the modified antibodies.
In addition to removing the entire domains from the constant region, it will be appreciated that the antibodies of the present invention can be provided by the partial removal or substitution of a few or even a single amino acid. For example, mutation of a single amino acid in certain areas of the CH2 domain could be sufficient to substantially reduce Fc binding and thereby increase tumor localization. Similarly, it might be desirable to simply remove that part of one or more constant region domains that control the effector function (eg, C1Q binding of the complement) to be modulated. Such partial deletions of the constant regions can improve the selected characteristics of the antibody (serum half-life), while leaving intact other convenient functions associated with the domain of the constant region of the individual. Furthermore, as referred to above, the constant regions of the described antibodies can be modified through mutation or substitution of one or more amino acids that
<img file="MX340437B_D0108.tif" />
improve the profile of the resulting construct. In it would be possible to interrupt the activity that is provided by a conserved binding site (eg, binding to Fc), while substantially maintaining the configuration and immunogenic profile of the modified antibody. Certain modalities may comprise adding one or more amino acids from the constant region to enhance desirable characteristics, such as decreasing or increasing effector function or providing the link for more cytotoxin or carbohydrate. In such modalities it may be convenient to insert or reproduce specific sequences derived from selected domains of the constant region.
The present invention further encompasses variants and equivalents that are substantially homologous to human, humanized, and chimeric antibodies, or antibody fragments thereof, set forth herein. These may contain, for example, conservatively substituting mutations, that is, substituting one or more amino acids for similar amino acids. For example, conservative substitution refers to the substitution of one amino acid with another within the same general class such as, for example, an acidic amino acid with another acidic amino acid, a basic amino acid with another basic amino acid, or a neutral amino acid with another amino acid. neutral. What I know
IMPI
MEXICAN INSTITUTE • f LA FROFiEDAC INDUSTRIAL
<img file="MX340437B_D0109.tif" />
intends for a conservative d5 diulnuátidu substitution<sup>111</sup> u © know well in the art.
The polypeptides of the present invention may be recombinant polypeptides, natural polypeptides, or synthetic polypeptides that comprise an antibody, or fragment thereof, against a human FOLRl. It will be recognized in the art that some amino acid sequences of the invention can be varied without significant effect on the structure or function of the protein. Thus, the invention further includes variations of polypeptides that show substantial activity or that include regions of an antibody or fragment thereof, against a human folate receptor protein. Such mutants include deletions, insertions, inversions, repeats, and type substitutions.
Polypeptides and analogs can also be modified to contain additional chemical portions that are not normally part of the protein. Those derivative portions can improve the solubility, the biological half-life or the absorption of the protein. Servings can also reduce or eliminate any convenient side effects of proteins and the like. An overview of those portions can be found in REMINGTON'S PHARMACEUTICAL SCIENCES, 20th ed., Mack Publishing Co.,
Easton, PA (2000).
IMPI
Mexican INSTITUTE Dt LA FROFIÍDAt) INDUSTRIAL
<img file="MX340437B_D0110.tif" />
The isolated polypeptides described herein can be produced by any suitable method known in the art. Such methods range from direct synthetic methods for the protein to constructing the DNA sequence encoding the isolated polypeptide sequences and expressing those sequences in a suitable transformed host. In some embodiments, a DNA sequence is constructed using recombinant technology by isolating or synthesizing a DNA sequence that encodes a wild-type protein of interest. Optionally, the sequence can be mutated by site-specific mutagenesis to provide functional analogs of these. See, eg, Zoeller et al., Proc. Nati. Acad. Sci. United States 81: 5662-5066 (1984) and US Pat. no. 4,588,585.
In some embodiments, a DNA sequence encoding a polypeptide of interest may be constructed by chemical synthesis using an oligonucleotide synthesizer. Such oligonucleotides can be designed based on the amino acid sequence of the suitable polypeptide and select those codons that are favored in the host cell in which the recombinant polypeptide of interest can be produced. Standard methods can be applied to synthesize an isolated polynucleotide sequence that encodes an isolated polypeptide of interest. For example, a sequence
IMPI
MEXICAN INSTITUTE BE LA «OPKDA · INMCTRIAL
<img file="MX340437B_D0111.tif" />
Complete amino acid can be used to p-nnstniir a post-translated gene. Furthermore, a DNA oligomer can be synthesized that contains a nucleotide sequence that encodes the particular isolated polypeptide. For example, various small oligonucleotides that encode portions of the convenient polypeptide can then be synthesized and ligated. Individual oligonucleotides typically contain 5 'or 3' protruding ends for complementary assembly.
Once assembled (by synthesis, site-directed mutagenesis, or other method), polynucleotide sequences encoding a particular isolated polypeptide of interest can be inserted into an expression vector and operably linked to an appropriate expression control sequence for the protein expression in a suitable host. Correct assembly can be confirmed by nucleotide sequencing, restriction mapping, and expression of a biologically active polypeptide in a suitable host. As is well known in the art, to obtain high levels of expression of a gene transfected in a host, the gene must be operably linked to the transcription and translation expression control sequences that are functional in the chosen host. expression.
In certain modalities, expression vectors
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL MONEDAD
<img file="MX340437B_D0112.tif" />
Recombinant antibodies are used to amplify and express antibodies that encode DNA, or fragments thereof, against human FOLR1. Recombinant expression vectors are replicable DNA constructs that have synthetic DNA fragments or cDNA derivatives that encode a polypeptide chain of, or fragment thereof, of an anti-FOLRl antibody, operably linked to suitable regulatory or transcriptional regulatory elements derived from mammalian, microbe, virus or insect genes. A general transcriptional unit comprises an assembly of (1) a genetic element or elements that have a regulatory role in gene expression, for example, transcriptional promoters or enhancers, (2) a structural or coding sequence, which is transcribed to MRNA and is translated into protein, and (3) appropriate transcription and translation initiation and termination sequences, as described in detail below. Such regulatory elements may include an operator sequence to control transcription. The ability to replicate in a host is generally conferred by an origin of replication, and a selection gene can also be incorporated to facilitate recognition of transformants. DNA regions are operably linked when they are functionally related to each other. For example, the DNA of a signal peptide (secretion leader)
IMPI
MEXICAN INSTITUTE OF THE INDUSTRIAL FRORIEOAD
<img file="MX340437B_D0113.tif" />
is operably linked to DNA for a polypeptide if horn, is expressed as a precursor that participates in secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned to allow translation. Structural elements intended for use in yeast expression systems include a leader sequence that allows extracellular secretion of the translated protein by a host cell. On the other hand, where the recombinant protein is expressed without a leader or transport sequence, this may include a Nterminal methionine residue. This residue can optionally be subsequently cleaved from the expressed recombinant protein to provide a final product.
The choice of the expression control sequence and the expression vector may depend on the choice of host. A wide variety of host / expression vector combinations can be employed. Expression vectors useful for eukaryotic hosts include, for example, vectors comprising the expression control sequences of SV40, bovine papilloma virus, adenovirus, and cytomegalovirus. Expression vectors useful for bacterial hosts include those known
100
<img file="MX340437B_D0114.tif" />
Bacterial plasmids, such as plasmirt.g. Fs¡r: herichia coli, including pCR 1, pBR322, pMB9 and their derivatives, plasmids of the widest range of hosts, such as M13 and single-stranded DNA filamentous phages.
Suitable host cells for expression of a FOLR1-binding polypeptide or antibody (or a FOLR1 protein for use as an antigen) include prokaryotes, yeasts, insects, or eukaryotic higher cells under the control of the appropriate promoters. Prokaryotes include gram negative or gram positive organisms, eg, E. coli or bacilli. Eukaryotic higher cells include established cell lines of mammalian origin, as described below. Cell-free translation systems could also be employed. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian host cells are described by Pouwels et al. (Cloning Vectors: A Laboratory Manual, Elsevier, New York, 1985), the
<td>description</td><td colspan="2">relevant is</td><td>incorporates</td><td>in</td><td colspan="2">the present as</td>
<td>reference.</td><td>The</td><td>information</td><td>additional</td><td colspan="2">about the methods</td><td>of</td>
<td>production</td><td>of</td><td>proteins,</td><td colspan="2">what includes</td><td>the production</td><td>of</td>
<td>antibody,</td><td>I know</td><td colspan="2">You can find,</td><td>by</td><td>example in</td><td>the</td>
<td>publication</td><td>of</td><td>The patent</td><td>from USA</td><td>num</td><td> . 2008/0187954,</td><td>the</td>
<td>patent of</td><td>EE</td><td>.UU. no.</td><td> 6,413,746</td><td>and</td><td>6,660,501, and</td><td>the</td>
International Patent Publication WO No. 04009823, which
101
IMPI
OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0115.tif" />
they are incorporated herein in their entirety by reference.
Different mammalian or insect cell culture systems are also advantageously employed to express the recombinant protein. Expression of the recombinant proteins in mammalian cells can be accomplished because such proteins are generally correctly folded, appropriately modified, and fully functional. Examples of suitable mammalian host cell lines include HEK-293 and HEK-293T, COS-7 lines of monkey kidney cells, described by Gluzman (cell 23: 175, 1981), and other cell lines including eg L, C127, 3T3, Chinese Hamster Ovary (CHO), HeLa and BHK cell lines. Mammalian expression vectors may comprise non-transcribed elements such as an origin of replication, a suitable promoter and enhancer bound to the gene for expression, and other 5 'or 3' flanking non-transcribed sequences, and 5 'untranslated sequences. or 3 ', ribosome binding sites, as required, a polyadenylation site, donor site, and acceptor sites, and the transcriptional termination sequences. Baculovirus systems for the production of heterologous proteins in insect cells are reviewed by Luckow and Summers, Bio / Technology 6:47 (1988).
Proteins produced by a transformed host are
102
IMPI
MEXICAN INSTITUTE OF PROPERTY
INDUSTRIAL
<img file="MX340437B_D0116.tif" />
they can purify according to any suitable method. Such standard methods include chromatography (eg, ion exchange, affinity, and size column chromatography), centrifugation, differential solubility, or any other standard technique for protein purification. Affinity tags such as hexahistidine, maltose binding domain, influenza coat sequence, and glutathione-S-transferase can be attached to the protein to allow easy purification by passage through a suitable affinity column. Isolated proteins can also be physically characterized by techniques such as proteolysis, nuclear magnetic resonance, and X-ray crystallography.
For example, supernatants from systems that secrete the recombinant protein into the culture media can first be concentrated using a commercially available protein concentration filter, eg, an Amicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a suitable purification matrix. Furthermore, an anion exchange resin can be used, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) groups. The matrices can be acrylamide, agarose, dextran, cellulose or other types
<img file="MX340437B_D0117.tif" />
ιοί ΙΜΡΙ
MEXICAN INSTITUTE DF. the entanglement of iNmisniiAi commonly used in the purification of Ha. prntpines. Furthermore, a cation exchange step can be employed. Suitable cation exchangers include various insoluble matrices comprising the sulfopropyl or carboxymethyl cellulose groups. Finally, one or more steps of reverse phase high performance liquid chromatography (RP-HPLC) employing hydrophobic RPHPLC media, for example, silica gel that has hanging methyl or other aliphatic groups, can be used to further purify a FOLRl binding agent. Some or all of the preceding purification steps, in various combinations, can also be employed to provide a homogeneous recombinant protein.
Recombinant protein produced in bacterial culture can be isolated, for example, by initial extraction from cell pellets, followed by one or more concentration steps, salt precipitation, aqueous ion exchange chromatography, or size exclusion chromatography. . High performance liquid chromatography (HPLC) can be used for the final stages of purification. Microbial cells employed in expressing a recombinant protein can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or the use of cell lysing agents.
<img file="MX340437B_D0118.tif" />
IMPI
104 mexican instinct
OF IA PROPERTY
INDUSTRIAL
Methods known in the art for 'purlllLdr antibodies and other proteins also include, for example, those described in US Pat. no. 2008/0312425, 2008/0177048 and 2009/0187005, which are incorporated herein by reference in their entirety.
In certain embodiments, the FOLR1 binding agent is a polypeptide that is not an antibody. A variety of methods for identifying and producing non-antibody polypeptides that bind with high affinity to a protein target are known in the art. See, for example, Skerra, Curr. Opin. Biotechnol., 18: 295-304 (2007), Hosse et al., Protein Science, 15: 14-27 (2006), Gilí et al., Curr.
Opin. Biotechnol., 17: 653-658 (2006), Nygren, FEBS J.,
275: 2668-76 (2008), and Skerra, FEBS J., 275: 2677-83 (2008), which are incorporated herein by reference in their entirety. In certain modalities, phage display technology has been used to identify / produce the FOLR1 binding polypeptide. In certain embodiments, the polypeptide comprises a protein scaffold of a type selected from the group consisting of protein A, a lipocalin, a fribronectin domain, an ankirin consensus repeating domain, and thioredoxin.
In some embodiments, the agent is a non-protein molecule. In certain embodiments, the agent is a small molecule. Combinatorial chemistry libraries and techniques
105
ΙΜΡΙ
<img file="MX340437B_D0119.tif" />
Useful in identifying rp-protff and FOLRl binding agents are known to those of skill in the art. See, eg, Kennedy et al., J. Comb. Chem, 10: 345-354 (2008), Dolle et al., J.
Comb. Chem., 9: 855-902 (2007), and Bhattacharyya, Curr. Med.
Chem., 8: 1383-404 (2001), which are incorporated herein by reference in their entirety. In certain embodiments, moreover, the agent is a carbohydrate, a glycosaminoglycan, a glycoprotein, or a proteoglycan.
In certain embodiments, the agent is an aptamer nucleic acid. Aptamers are polynucleotide molecules that have been selected (eg, from random or mutagenized mixtures) based on their ability to bind to another molecule. In some embodiments, the aptamer comprises a DNA polynucleotide. In certain alternative embodiments, the aptamer comprises an RNA polynucleotide. In certain embodiments, the aptamer comprises one or more modified nucleic acid residues. Methods of generating and detecting aptameric nucleic acids to bind proteins are well known in the art. See, for example, US Pat. no. 5,270,163, US Patent No. no. 5,683,867, US Patent No. no. 5,763,595, US Patent No. no. 6,344,321, U.S. Patent No. no. 7,368,236, US Patent no. 5,582,981, US Patent No. no. 5,756,291, US Patent No. no.
106
IMPI
MEXICAN INSTITUTE • f the INDUSTRIAL nontMD
<img file="MX340437B_D0120.tif" />
5, 840,867, US Patent No. no. 7,312,325, ·· 1β US patent no. 7,329,742, International Patent Publication No. WO 02/077262, International Patent Publication No. WO 03/070984, US Patent Application Publication No. 2005/0239134, US Patent Application Publication No. 2005/0124565, and publication of US patent application no. 2008/0227735, which are incorporated herein by reference in their entirety.
III. Immunoconjugates
The present invention is also directed to conjugates (also referred to herein as immunoconjugates), which comprises anti-EOLR1 antibodies, antibody fragments, functional equivalents, enhanced antibodies and their aspects as described herein, bound or conjugated with a cytotoxin (drug) or prodrug. Thus, in a certain embodiment, the invention provides an immunoconjugate comprising a humanized antibody or an antigen-binding fragment thereof that specifically binds to a human folate receptor 1, where the antibody comprises: (a) a heavy chain CDRl comprising GYFMN (sec. with ID #: 1); a heavy chain CDR2 comprising RIHPYDGDTFYNQXaaiFXaa2Xaa<sub>3</sub> (section with ident number: 56); and one
107
IMPI
INSTITUTO MSXICANt 'Ot LA MOWFOAO INDUSTRIAL
<img file="MX340437B_D0121.tif" />
Heavy chain CDR3 comprising YDGSRAMDY (sec, with ID #: 3); and (b) a light chain CDRl comprising KASQSVSFAGTSLMH (sec. with ID #: 7); a light chain CDR2 comprising RASNLEA (sec. with ID #: 8); and a light chain CDR3 comprises QQSREYPYT (sec. with ID #: 9); where Xaai is selected from K, Q, H and R; Xaa<sub>2</sub> is selected from Q, Η, N, and R, and Xaa3 is selected from G, Ε, T, S, A, and V. In certain embodiments, the antibody is the Movl9hu antibody, which is the antibody described above that comprises CDR2 RIHPYDGDTFYNQKFQG (sec. With ID #: 2) heavy chain. In other embodiments, the antibody is FR1-21 and comprises (a) a heavy chain CDRl comprising SSYGMS (sec. With ID #: 30); a heavy chain CDR2 comprising TISSGGSYTY (sec. no. ident: 31); and / or a heavy chain CDR3 comprising DGEGGLYAMDY (sec. with ID #: 32); and (b) a light chain CDRl comprising KASDHINNWLA (sec. with ID #: 27); a light chain CDR2 comprising GATSLET (sec. ID no: 28); and a light chain CDR3 comprising QQYWSTPFT (sec. with ID #: 29). In other embodiments, the antibody is FR1-48 and comprises: (a) a heavy chain CDRl comprising TNYWMQ (seq. No. ident: 60); a heavy chain CDR2 comprising AIYPGNGDSR (sec. with ID #: 61); and / or a heavy chain CDR3 comprises RDGNYAAY (sec. with ident #:
108
IMPI
INSTITUTO MÉXíCANÍ 'Of IA industrial property
<img file="MX340437B_D0122.tif" />
62), and / or (b) a nnmprpnHe RA ^ ENIYSNLA light chain CDRl (sec. With ID #: 57); a light chain CDR2 comprising AATNLAD (SEQ ID NO: 58); and a light chain CDR3 comprising QHFWASPYT (sec. with ID #: 59). In other embodiments, the antibody is FRl-49 and comprises: (a) a heavy chain CDRl comprising TNYWMY (sec. With ID #: 66); a heavy chain CDR2 that
<td>understands</td><td>AIYPGNSDTT</td><td>(sec.</td><td>with</td><td>no.</td><td>from ident:</td><td>67); and / or a</td>
<td colspan="2">Heavy chain CDR3</td><td>than</td><td colspan="2">understands</td><td>RHDYGAMDY</td><td>(sec. with no.</td>
<td>from ident:</td><td>68); me</td><td>(b)</td><td>a</td><td>CDRl</td><td colspan="2">light chain that</td>
<td>understands</td><td>RASENIYTNLA</td><td>(sec</td><td>. with</td><td>no.</td><td>from ident:</td><td>63); a CDR2</td>
<td>chain</td><td>light that</td><td colspan="2">understands</td><td colspan="2">TASNLAD (sec,</td><td>with no. of</td>
ident: 64); and a light chain CDR3 comprising QHFWVSPYT (sec. with ID #: 65). In other embodiments, the antibody is FRl-57 and comprises: (a) a heavy chain CDRl comprising SSFGMH (sec. With ID #: 72); a heavy chain CDR2 comprising YISSGSSTIS (sec. with ID #: 73); and / or a heavy chain CDR3 comprises EAYGSSMEY (sec. with ID #: 74); and / or (b) a light chain CDRl comprising RASQNINNNLH (sec. no. Ident: 69); a light chain CDR2 comprising YVSQSVS (sec. with ID #: 70); and a light chain CDR3 comprising QQSNSWPHYT (sec. with ID #: 71). In yet another embodiment, the antibody is FR1-65 and comprises: (a) a heavy chain CDRl comprising TSYTMH (seq. No.
109
IMPI
INSTITUTO Mexicano OE LA EROMEDA »INDUSTRIAL
<img file="MX340437B_D0123.tif" />
ident: 78); a CDR2 chain pp ^ aHa-NomprAnrip YINPISGYTN (sec. with ident no .: 79); and / or a heavy chain CDR3 comprising GGAYGRKPMDY (sec. with ID #: 80); and / or (b) a light chain CDR1 comprising
KASQNVGPNVA (Sec. With ID #: 75); a light chain CDR2 comprising SASYRYS (SEQ ID NO: 76); and a light chain CDR3 comprises QQYNSYPYT (sec. with ID #: 77).
Suitable drugs or prodrugs are known in the art. In certain modalities, drugs or prodrugs are cytotoxic agents. The cytotoxic agent used in the cytotoxic conjugate of the present invention can be any compound that results in the death of a cell, or induces cell death, or in some way decreases cell viability, and includes, for example, maytansinoids and analogs of maytansinoids, benzodiazepines, taxoids, CC-1065 and CC-1065 analogs, duocarmycins and duocarmycin analogs, enedins, such as calicheamicin analogs, dolastatin and dolastatin analogues including auristatins, leptomycin, methotrexate derivatives, tomaymycin, cisplatin, vincristine, carboplatin derivatives, vinblastine, doxorubicin, daunorubicin, doxorubicin, melphalan, mitomycin C, chlorambucil. In certain modalities, cytotoxic agents are maytansinoids and maytansinoid analogs.
110
IMPI
MEXICAN INSTITUTE OE LA INDUSTRIAL FRORIEQaP
<img file="MX340437B_D0124.tif" />
Such conjugates can be made using a ligand group to bind a drug or prodrug to the antibody or its functional equivalent. Suitable ligand groups are well known in the art and include, for example, disulfide groups, thioether groups, labile acid groups, photolabile groups, labile peptidase groups, and labile esterase groups.
The drug or prodrug can, for example, be linked to the anti-FOLRl antibody or fragment thereof through a disulfide bond. The ligand molecule or crosslinking agent comprises a chemical reactive group that can react with the anti-FOLRl antibody or fragment thereof. In certain embodiments, the chemical reactive groups for reaction with the cell-binding agent are N-succinimidyl esters and N-sulfosuccinimidyl esters. Furthermore, the ligand molecule comprises a reactive chemical group, in certain embodiments a dithiopyridyl group that can react with the drug to form a disulfide bond. In certain embodiments, the ligand molecules include, for example, W-succinimidyl 3- (2-pyridyldithio) propionate (SPDP) (see, eg, Carlsson et al., Biochem J., 173: 723737 (1978)), U- succinimidyl 4- (2-pyridyldithio) butanoate (SPDB) (see, for example, US Patent No. 4,563,304), W-succinimidyl 4- (2-pyridyldithio) 2-sulfobutanoate (sulfo-SPDB) (see US publication
111
ΙΜΡΙ
MEXICAN INSTITUTE Γ> ϊ INDUSTRIAL PROPERTY
<img file="MX340437B_D0125.tif" />
no. 20090274713), N-succinimidyl 4 - (2-pifΙάΙ'ΓάϊΈloT pentanoate (SPP) (see, for example, CAS registry number 341498-08-6), 2-iminothiolane, or acetylsuccinic anhydride.
For example, the antibody or cell binding agent can be modified with the crosslinking reagents, and the antibody or cell binding agent containing free or thus protected thiol groups derived is then reacted with thiol or disulfide containing maytansinoid to produce the conjugates. Conjugates can be purified by chromatography, including, but not limited to, HPLC, size exclusion, adsorption, ion exchange, and affinity capture, dialysis, or tangential flow filtration. In certain embodiments, the anti-FOLR1 antibody binds to the cytoxin through an SPDB or sulfoSPDB ligand. In a certain embodiment, the Movl9hu antibody binds to a cytotoxin through an SPDB or sulfoSPDB ligand.
In another aspect of the invention, the antiFOLR1 antibody binds to cytotoxic drugs through disulfide bonds and a polyethylene glycol spacer to increase the potency, solubility, or efficacy of the immunoconjugate. Such hydrophilic cleavage ligands are described in W02009 / 0134976. The added benefit of this ligand design is the convenient high monomer ratio and minimal aggregation of drug conjugate112
IMPI
INSTITUTO MEXICANO DE LA FROFIEDAD INBUSTRIAL
<img file="MX340437B_D0126.tif" />
antibody. Specifically contemplated in this regard are conjugates of cell binding agents and drugs linked through disulfide groups (SS-) carried by polyethylene glycol spacers ((CH<sub>2</sub>CH<sub>2</sub>OR)<sub>n</sub> _ ii<sub>4</sub>) with a narrow drug load range of 2-8 are described which show relatively high potent biological activity towards cancer cells and have convenient biochemical properties of high conjugation performance and high monomer ratio with minimal protein aggregation.
Specifically contemplated in this regard is an anti-FOLR1 antibody drug conjugate of Formula (I) or a conjugate of Formula (I '):
A-tXi-í-CHz-CHzO-Jn-Y-CK (I)
A- [Xl - (- CH<sub>2</sub>-CH<sub>2</sub>OR-)<sub>n</sub>-YC]<sub>m</sub> (I) [CY - (- CH<sub>2</sub>-CH<sub>2</sub>OR-) <sub>n</sub>-Xi]<sub>m</sub>-A (I ') where:
A represents an anti-FOLR1 antibody or fragment;
C represents a cytotoxin or drug;
X represents an aliphatic, aromatic or heterocyclic unit linked to the cell binding agent through a thioether bond, an amide bond, a carbamate bond, or an ether bond;
Y represents an aliphatic, aromatic or heterocyclic unit linked to the drug through a disulfide bond;
is 0 or 1;
113
IMPI »·
INSTTTUTO M «(CAN or
DE LA MtBREBA »INDUSTRIAL m is an integer from 2 to 8, and n is an integer from 1 to 24.
In certain embodiments, m is an integer from 2 to 6.
In certain embodiments, m is an integer from 3 to 5.
Also, in certain embodiments, n is an integer from 2 to 8. On the other hand, as described in, for example, US Pat. Nos. 6,441,163 and 7,368,565, the drug can first be modified to introduce a reactive ester suitable to react with a cell binding agent. Reaction of these drugs containing an activated ligand region with a cell binding agent provides another method of producing a conjugate of the drug with the cell binding agent. The maytansinoids can also bind to the anti-FOLRl antibody or fragment via PEG ligand groups, as set forth for example in US Pat. 6,716,821. These PEG-binding non-cleavable groups are soluble in both water and nonaqueous solvents, and can be used to bind one or more cytotoxic agents to a cell binding agent. Illustrative groups that bind to PEG include heterobifunctional PEG ligands that react with cytotoxic agents and cell binding agents at opposite ends of the ligands through a sulfhydryl or disulfide functional group at one end, and an ester active at the other extreme. As a general example of the
114
IMPI
MEXICAN INSTITUTE
Dt LA FROHtlJAD INDUSTRIAL
<img file="MX340437B_D0127.tif" />
Synthesis of a cytotoxic conjugate by Uli tji'ujju that binds to PEG, the reference for US Pat. 6,716,821 which is incorporated herein by reference in its entirety. Synthesis begins with the reaction of one or more cytotoxic agents bearing a reactive PEG region with a cell-binding agent, resulting in the displacement of the terminal active ester of each PEG reactive region by an amino acid residue of the cell binding agent, to yield a cytotoxic conjugate comprising one or more cytotoxic agents covalently linked to a cell binding agent through a group that binds to PEG. Furthermore, cell binding can be modified with the bifunctional PEG crosslinker to introduce a disulfide reactive region (such as a pyridyldisulfide), which can then be treated with a thiol-containing maytansinoid to provide a conjugate. In another method, the binding cell can be modified with the bifunctional PEG crosslinker to introduce a thiol region, which can then be treated with a maytansinoid disulfide-containing reagent (such as a pyridyldisulfide), to provide a conjugate.
Antibody-maytansinoid conjugates with non-cleavable ligands can also be prepared. Such crosslinkers are described in the art (see ThermoScientific Pierce Crosslinking Technical Handbook and the publication of the
115
IMPI
INSTITUTO MEXICANO OI LA PROPftDAD INW / STRIM.
<img file="MX340437B_D0128.tif" />
US patent application no. 2005/0169933) and include, but are not limited to, W-succinimidyl 4- (maleimidomethyl) cyclohexanecarboxylate (SMCC), W-succinimidyl-4- (Nmaleiraidomethyl) -cyclohexane-1-carboxy- (6-amidocaproate), which is SMCC long-chain analog (LC-SMCC), κ-maleimidoundecanoic acid Wsuccinimidil ester (KMUA), N-succinimidyl ester of β-maleimidopropanoic acid (BMPS), 27-succinimidil ester of γ-maleimidobutyric acid (GMBS ), ε-maleimidocaproic acid (EMCS) W-hydroxysuccinimide ester, N-hydroxysuccinimide-m-maleimidobenzoyl ester (MBS), N- (α-maleimidoacetoxy) succinimide ester (AMAS), succinimidyl-6- (β-maleimidopropionamido) hexanoate (SMPH), Nsuccinimidyl 4- (p-maleimidophenyl) - butyrate (SMPB), and N- (pmaleimidophenyl) isocyanate (PMPI), W-succinimidyl-4 (iodoacetyl) -aminobenzoate (SIAB), N-succinimidyl iodoacetate (SIA), W-succinimidyl bromoacetate (SBA), and W-succinimid 3 (bromoacetamido) propionate (SBAP). In certain embodiments, the antibody is modified with crosslinking reagents, such as succinimidyl 4- (N-maleimidomethyl) -cyclohexane-1-carboxylate (SMCC), sulfo-SMCC, maleimidobenzoyl-Nhydroxysuccinimide ester (MBS), sulfo-MBS, or succinimidylodoacetate , as described in the literature, to introduce 1-10 reactive groups (Yoshitake et al., Eur. J. Biochem, 101: 395-399 (1979); Hashida et al., J. Applied Biochem., 56-63 (1984 ); and Liu et al., Biochem., 18: 690-697
116
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL MONEDAD
<img file="MX340437B_D0129.tif" />
(1979)). The modified antibody is then reacted with the thiol-containing maytansinoid derivative to produce a conjugate. The conjugate can be purified by gel filtration through a Sephadex G25 column or by dialysis or tangential flow filtration. The modified antibodies are treated with the thiol-containing maytansinoid (1 to 2 molar equivalent / maleimide group) and the maytansinoid / antibody conjugates are purified by gel filtration through a Sephadex G-25 column, chromatography on a ceramic column of hydroxyapatite, dialysis or tangential flow filtration, or a combination of these methods. Typically, an average of 1-10 maytansinoids are bound by antibodies. One method is to modify the antibodies with succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) to introduce the maleimide groups followed by reaction of the modified antibody with a thiol-containing maytansinoid to give a thioether-bound conjugate. Again conjugates with 1 to 10 drug molecules per antibody molecule result. Maytansinoid antibody conjugates, antibody fragments, protein hormones, protein growth factors, and other proteins are prepared in the same manner.
In another aspect of the invention, the FOLR1 antibody (eg Movl9hu, FR1-21, FRl-48, FR1-49, FR1-57, or FR1117
IMPI
1NSTTTUT · MEXICAN INDUSTRIAL PROPERTY
<img file="MX340437B_D0130.tif" />
65) binds to the drug via a non-cleavable bond through the intermediary of a PEG spacer. Suitable crosslinking reagents comprising the hydrophilic PEG chains that form ligands between a drug and the anti-FOLRl antibody or fragment are also well known in the art, or commercially available (eg, from Quanta Biodesign, Powell, Ohio ). Suitable PEG-containing crosslinkers can also be synthesized from the same commercially available PEGs by standard synthetic chemistry techniques known to those skilled in the art. Drugs can be reacted with cross-functional bifunctional ligands containing PEG to give compounds of the following Formula, ZXi- (-CH2-CH2-O-) n<sup>-</sup>And p<sup>-</sup>D, by the methods described in detail in US Pat. 20090274713 and in W02009 / 0134976, which can react with the cell binding agent to provide a conjugate. Furthermore, cell binding can be modified with the bifunctional crossover ligand of PEG to introduce a reactive thiol group (such as a maleimide or haloacetamide) which can then be treated with a thiol-containing maytansinoid to provide a conjugate. In another method, cell binding can be modified with the bifunctional PEG crosslinker to introduce a thiol region that can then be treated with a maytansinoid with a thiol
118
IMPI
Mexican INSTITUTE OF THE INDUSTRIAL PRORIEPAB
<img file="MX340437B_D0131.tif" />
reagent (such as a maytansinoid carrying a maleimide or ... haioacetamide) to provide a conjugate.
Accordingly, another aspect of the present invention is a drug conjugate of the anti-FOLR1 antibody of that of Formula (II) or Formula (II '):
A- [X<sub>1</sub>- (- CH<sub>2</sub>-CH<sub>2</sub>-OR-)<sub>n</sub>-Yp-C]<sub>ra</sub> (II) [CY<sub>p</sub>- (- CH<sub>2</sub>-CH<sub>2</sub>-OR-) <sub>n</sub>-Xi]<sub>m</sub>-A (II ') where, A represents an anti-FOLR1 antibody or fragment;
C represents a cytotoxin or drug;
X represents an aliphatic, aromatic, or heterocyclic unit attached to the cell-binding agent through a thioether bond, an amide bond, a carbamate bond, or an ether bond.
Y represents an aliphatic, aromatic or heterocyclic unit attached to the drug through a covalent bond selected from the group consisting of a thioether bond, an amide bond, a carbamate bond, an ether bond, an amide bond, a carbon-carbon bond and a hydrazone bond;
is 0 or 1;
p is 0 or 1;
m is an integer from 2 to 15; and n is an integer from 1 to 2000.
In a certain embodiment, m is an integer from 2 to 8; and n is an integer from 1 to 24.
119
<img file="MX340437B_D0132.tif" />
IMPI
M & XJGANO INSTITUTE OF INDUSTRIAL PROPERTY
<td>In</td><td>a</td><td>certain</td><td>modality,</td><td>m</td><td>is</td><td>a</td><td>number</td><td>eirLeru<sup>1</sup></td><td></td><td> -2-</td><td>ar</td><td>Ί5Τ</td>
<td>In</td><td>a</td><td>certain</td><td>modality,</td><td>n</td><td>is</td><td>a</td><td>number</td><td>whole</td><td>of</td><td> 2</td><td>to</td><td> 8.</td>
<td>In</td><td>a</td><td>certain</td><td>modality,</td><td>m</td><td>is</td><td>a</td><td>number</td><td>whole</td><td>of</td><td> 3</td><td>to</td><td> 5.</td>
In a certain embodiment, the antibody is Movl9hu. In another embodiment, the antibody is FR-1-21. In another embodiment, the antibody is FR-1-48. In another embodiment the antibody is FR1-49. In another embodiment, the antibody is FR-1-57. In another embodiment, the antibody is FR-1-65.
Examples of suitable PEG-containing ligands include ligands having an Nsuccinimidil ester or N-sulfosucinimidil ester region to react with the anti-FOLRl antibody or fragment thereof, as well as a maleimide or haloacetyl-based region, for reaction with the compound. A PEG spacer can be incorporated into any crosslinker known in the art by the methods described herein.
Many of the ligands described herein are described in detail in the US patent publications. nos. 20050169933 and 20090274713 and in W002009 / 0134976, the contents of which are incorporated in this document in their entirety by reference.
The present invention including aspects where approximately 2 to 8 drug molecules (drug loading), eg, the maytansinoid, bind to an anti-FOLRl antibody or a fragment thereof, the effect
120
ΙΜΡΙ
MEXICAN INSTITUTE OF THE INDUSTRIAL MOHEDAL
<img file="MX340437B_D0133.tif" />
antitumor of the conjugate is much more related? manHn ap compares to a drug load of fewer or more drugs bound to the same cell-binding agent. Drug loading as used herein refers to the number of drug molecules (eg, a maytansinoid), which can bind to a cell binding agent (eg, an anti-FOLRl antibody or a fragment thereof) ). In one aspect the number of drug molecules that can bind to the cell binding agent can average from about 2 to about 8 (per
<td>example</td><td> 1</td><td> .9, 2</td><td> .0, 2.1, 2.2,</td><td> 2.3,</td><td> 2.4,</td><td> 2.5,</td><td> 2.6,</td><td> 2.7,</td><td> 2.8,</td>
<td> 2.9, 3.</td><td>or,</td><td> 3.1,</td><td> 3.2, 3.3, 3.4,</td><td> 3.5,</td><td> 3.6,</td><td> 3.7,</td><td> 3.8,</td><td> 3.9,</td><td> 4.0,</td>
<td> 4.1, 4.</td><td> 2,</td><td> 4.3,</td><td> 4.4, 4.5, 4.6,</td><td> 4.7,</td><td> 4.8,</td><td> 4.9,</td><td> 5.0,</td><td> 5.1,</td><td> 5.2,</td>
<td> 5.3, 5.</td><td> 4,</td><td> 5.5,</td><td> 5.6, 5.7, 5.8,</td><td> 5.9,</td><td> 6.0,</td><td> 6.1,</td><td> 6.2,</td><td> 6.3,</td><td> 6.4,</td>
<td> 6.5, 6.</td><td> 6,</td><td> 6.7,</td><td> 6.8, 6.9, 7.0,</td><td> 7.1,</td><td> 7.2,</td><td> 7.3,</td><td> 7.4,</td><td> 7.5,</td><td> 7.6,</td>
7.7, 7.8, 7.9, 8.0, 8.1). In certain modalities, the drug is N<sup>2</sup>'-deacetyl-N<sup>2</sup>'- (3-mercapto-l-oxopropyl) -maitansine (DM1) or AF'-deacetyl-N<sup>2</sup>'- (4-mercapto-4-methyl-l-oxopentyl) maytansine (DM4). Thus, in a certain embodiment, the Movl9hu antibody is conjugated to DM1 or DM4. In another embodiment, the FR-1-21 antibody is conjugated to DM1 or DM4. In another embodiment, the FR-1-48 antibody is conjugated to DM1 or DM4. In another embodiment, the FR-1-49 antibody is conjugated to DM1 or DM4. In another embodiment, the FR-1-57 antibody is conjugated to DM1 or DM4. In another embodiment the FR-1-65 antibody is conjugated to DM1 or
121
<img file="MX340437B_D0134.tif" />
<img file="MX340437B_D0135.tif" />
DM4.
<img file="MX340437B_D0136.tif" />
Thus, in one aspect, an immunoconjugate comprises 1 maytansinoid per antibody. In another aspect, an immunoconjugate comprises 2 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 3 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 4 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 5 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 6 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 7 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 8 maytansinoids per antibody.
In one aspect, an immunoconjugate comprises from about 1 to about 8 maytansinoids per antibody. In another aspect, an immunoconjugate comprises from about 2 to about 7 maytansinoids per antibody. In another aspect, an immunoconjugate comprises from about 2 to about 6 maytansinoids per antibody. In another aspect, an immunoconjugate comprises from about 2 to about 5 maytansinoids per antibody. In another aspect, an immunoconjugate comprises from about 3 to about 5 maytansinoids per antibody. In another aspect an immunoconjugate comprises from about 3 to about 4 maytansinoids per
IMPI
INSTITUTO MEWCANO OE LA RRORIEI5AD industrial
<img file="MX340437B_D0137.tif" />
antibody.
In one aspect, a composition comprising immunoconjugates has an average of about 2 to
<td>approximately</td><td> 8 (</td><td>by</td><td>example 1.9,</td><td> 2.0,</td><td> 2.1,</td><td> 2.2,</td><td> 2.3,</td>
<td> 2.4, 2.5, 2.6,</td><td> 2.7,</td><td> 2.8,</td><td> 2.9, 3.0, 3.1,</td><td> 3.2,</td><td> 3.3,</td><td> 3.4,</td><td> 3.5,</td>
<td> 3.6, 3.7, 3.8,</td><td> 3.9,</td><td> 4.0,</td><td> 4.1, 4.2, 4.3,</td><td> 4.4,</td><td> 4.5,</td><td> 4.6,</td><td> 4.7,</td>
<td> 4.8, 4.9, 5.0,</td><td> 5.1,</td><td> 5.2,</td><td> 5.3, 5.4, 5.5,</td><td> 5.6,</td><td> 5.7,</td><td> 5.8,</td><td> 5.9,</td>
<td> 6.0, 6.1, 6.2,</td><td> 6.3,</td><td> 6.4,</td><td> 6.5, 6.6, 6.7,</td><td> 6.8,</td><td> 6.9,</td><td> 7.0,</td><td> 7.1,</td>
<td> 7.2, 7.3, 7.4,</td><td> 7.5,</td><td> 7.6,</td><td> 7.7, 7.8, 7.9,</td><td> 8.0,</td><td> 8.1)</td><td colspan="2">molecules</td>
<td>of drugs</td><td>(by</td><td colspan="5">example. maytansinoids) attached</td><td>by</td>
<td>antibody. In</td><td>a</td><td colspan="3">aspect, a composition</td><td>than</td><td colspan="2">understands</td>
Immunoconjugates have an average of about 1 to about 8 drug molecules (eg, maytansinoids) per antibody. In one aspect, a composition comprising immunoconjugates has an average of about 2 to about 7 molecules (eg maytansinoids) per antibody. In one aspect a composition comprising immunoconjugates has an average of about 2 to about 6 drug molecules (eg maytansinoids) per antibody. In one aspect a composition comprising immunoconjugates has an average of about 2 to about 5 drug molecules (eg maytansinoids) per antibody. In one aspect a composition comprising immunoconjugates averages from about 3 to about 5
123 drug molecules (eg maitair3inüigle.J)
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL MtORRDAD
<img file="MX340437B_D0138.tif" />
^ or · antibody. In one aspect a composition comprising immunoconjugates has an average of about 3 to about 4 drug molecules (eg maytansinoids) per antibody. In one aspect a composition comprising immunoconjugates has an average of about 3.5 to about 4 drug molecules (eg maytansinoids) per antibody.
In one aspect, a composition comprising 10 immunoconjugates has an average of about 2 ±
0.5, approximately 2.5 + 0.5, approximately 3 ± 0.5, approximately 3.5 ± 0.5 approximately 4 approximately 4.5 ± 0.5, approximately 5 approximately 5.5 15 approximately 6.5 ± 0.5, approximately 6 ± 0.5, approximately 7 ± 0.5, ± 0.5 ± 0.5, + 0.5, about 7.5 ± 0.5, about 8 ± 0.5 drug molecules (eg, maytansinoids) bound by antibody. In one aspect a composition comprising immunoconjugates has an average of about 3.5 ±
0.5, drug molecules (eg maytansinoids) per antibody.
The anti-FOLRl antibody or fragment thereof can be modified by reacting a bifunctional crosslinking reagent with the anti-FOLRl antibody or fragment thereof, thereby resulting in the covalent bonding of a
ΙΜΡΙ
124
TUTO MEXICANO LA MOMÍOAD <sup>, M</sup>nusnuAL
<img file="MX340437B_D0139.tif" />
molecule binding to the anti-FOLRl antibody or fragment thereof. As used herein, a bifunctional crosslinking reagent is any chemical region that covalently binds a cell binding agent to a drug, such as the drugs described herein. In another method a part of the binding region is provided by the drug. In this regard, the drug comprises a binding region that is part of a larger ligand molecule that is used to bind the cell-binding agent to the drug. For example, to form the maytansinoid DM1, the side chain of the maytansine C-3 hydroxyl group is modified to have a free sulfhydryl (SH) group. This thiol form of maytansine can react with a modified cell-binding agent to form a conjugate. Therefore, the final ligand is assembled from two components, one of which is provided by the crosslinking reagent, while the other is provided by a DM1 side chain.
The drug molecules can also be linked to the antibody molecules through an intermediate transporter molecule such as serum albumin.
As used herein, the term "binding to a cell binding agent or binding to an anti-FOLRl antibody or fragment" refers to the conjugated molecule comprising at least one drug derivative bound to an agent
125
IMPI
MEXICAN INSTITUTE M LA FR * MEDAO industrial
<img file="MX340437B_D0140.tif" />
binding to the cell, the anti-FOLRl antibody or fragment, via a suitable linking group, or a precursor thereof. In certain embodiments, the link group is SMCC.
In certain embodiments, the cytotoxic agents useful in the present invention are maytansinoids and maytansinoid analogs. Examples of suitable maytansinoids include maytansinol esters and maytansinol analogs. Included are some drugs that inhibit microtubule formation and that are highly toxic to mammalian cells, such as maitanasinol and maitanasinol analogs.
Examples of functional maytansinol esters include those that have a modified aromatic ring and those that have modifications at other positions. Such suitable maytansinoids are described in US Pat. nos. 4,424,219; 4,256,746; 4,294,757; 4,307,016; 4,313,946; 4,315,929; 4,331,598; 4,361,650; 4,362,663; 4,364,866; 4,450,254; 4,322,348; 4,371,533; 5,208,020; 5,416,064; 5,475,092; 5,585,499; 5,846,545; 6,333,410; 7,276,497 and 7,473,796.
In a certain embodiment, the immunoconjugates of the invention use the thiol-containing maytansinoid (DM1) formally designated N<sup>2</sup>'<sup>r</sup>-deacetyl-N<sup>2</sup>'- (3mercapto-l-oxopropyl) -maitansine, as the agent
126
<img file="MX340437B_D0141.tif" />
Mexican INSTITUTE OF THE PNOFIIOA · INDUSTRIAL cytotoxic. DM1 is represented by the following Structural Formula (III):
<img file="MX340437B_D0142.tif" />
(III)
In another embodiment, the conjugates of the present invention use the thiol-containing maytansinoid in N<sup>2</sup>'-deacetyl-N<sup>2</sup>'(4-methi 1-4-mercapto-1- oxopentyl) maytansine (eg DM4) as cytotoxic. DM4 is represented by the following
Structural formula (IV):
<img file="MX340437B_D0143.tif" />
the agent (IV)
Another maytansinoid comprising a side chain containing a thiol bond spherically hindered by
N<sup>2</sup>'-deacetyl-N- (4-mercapto-1-oxopentyl) -maitansine (called DM3) represented by the following Structural Formula (V)
<img file="MX340437B_D0144.tif" />
Each of the maytansinoids taught in US patents. nos. 5,208,020 and 7,276,497 can also be used in the conjugate of the present invention. In this regard, the full disclosure of 5,208,020 and 7,276,697 is incorporated herein by reference.
Many positions on maytansinoids can serve as the position for chemically binding to the binding region. For example, the C-3 position having a hydroxyl group, the C-14 position modified with hydroxymethyl, the C-15 position modified with hydroxy and the C-20 position having a hydroxy group, which are all expected to be useful. In certain modalities, the C-3 position is used. In certain embodiments, the C-3 position of maytansinol is used.
The structural representations of certain conjugates are shown below:
<img file="MX340437B_D0145.tif" />
<img file="MX340437B_D0146.tif" />
(VINE
<img file="MX340437B_D0147.tif" />
(VIII)
IΜ ΡI
<img file="MX340437B_D0148.tif" />
129
<img file="MX340437B_D0149.tif" />
<img file="MX340437B_D0150.tif" />
<img file="MX340437B_D0151.tif" />
130
<img file="MX340437B_D0152.tif" />
<img file="MX340437B_D0153.tif" />
In a certain embodiment, the antibody is Movl9hu. In another embodiment, the antibody is FR1-21.
Various descriptions for producing such a maytansinoid-antibody conjugate are provided in US Pat. no. 6,333,410, 6,441,163, 6,716,821, and 7,368,565 each of which is incorporated herein in its entirety.
In general, a solution of an antibody in an aqueous buffer can be incubated with a molar excess of
131
ΙΜΡΙ
INSTTTVTO MEXICAN · DE LA FROEIEDAO INDUSTRIAL
<img file="MX340437B_D0154.tif" />
maytansinoids that have a disulfide region that does not have a reactive group. The reaction mixture can be quenched by the addition of excess amine (such as ethanolamine, taurine, etc.). The maytansinoid-antibody conjugate can then be purified by gel filtration. The number of maytansinoid molecules bound per antibody molecule can be determined by spectrophotometric measurement of the absorbance ratio at 252nm and 280nm. An average of 1-10 maytansinoid molecules / antibody molecule is used and an average of 2-5 is also used in the given modalities. The average number of maytansinoid / antibody molecules can be, for example, approximately 1-10, 2-5, 3-4, 3.5-4, or 3.5. The average number of maytansinoid / antibody molecules is approximately 3,510.5. In one aspect, the average number of maytansinoid / antibody molecules is approximately 3.5-4.
Antibody conjugates with maytansinoid drugs can be evaluated for their ability to suppress the proliferation, in vitro, of various unwanted cell lines. For example, cell lines such as the human KB cell line, can easily be used for evaluation of the cytotoxicity of these compounds. The cells to be evaluated can be exposed to the aspects, the compound for 4 to 5 days and the surviving fractions.
132
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL MONEDAD
<img file="MX340437B_D0155.tif" />
of cells are measured in direct assays by known methods. IC values<sub>50</sub> they can then be calculated from the test results.
Benzodiazepine compounds described, for example, in the publication of the US patent application. no. 2010/0203007 (eg, indolinobenzodiazepines or oxazolidinobenzodiazepines), derivatives of these, intermediates thereof, could also be used to prepare fragments or conjugates of the anti-FOLR 1 antibody.
Useful benzodiazepines include the compounds of Formulas (XIV), (XV) and (XVI), in which the dimer compounds optionally carry a linking group that allows binding of the binding agents to the cell.
<img file="MX340437B_D0156.tif" />
AND
<img file="MX340437B_D0157.tif" />
<img file="MX340437B_D0158.tif" />
Re re
ADL-D'-A '
<img file="MX340437B_D0159.tif" />
(XVI)
133
IMPI
MEXICAN INSTITUTE OF «INBUSTRIAL OPIfTY
<img file="MX340437B_D0160.tif" />
where the double line "between N and C represents a single bond or a double bond, providing that when it is a double bond X is absent and Y is H, and when it is a single bond, X is H or an amine protection group that turns the compound into a prodrug;
Y is selected from -OR, an ester represented by -OCOR ', a carbonate represented by -OCOOR', a carbamate represented by -OCONR'R '', an amine or a hydroxy amine represented by NR'R '', amide represented by -NRCOR ', a peptide represented by NRCOP, where P is an amino acid or a polypeptide containing between 2 to 20 amino acid units, a thioether represented by SR', a sulfoxide represented by SOR ', a sulfone represented by -SO2R' , a -SO3 sulfite, a -OSO bisulfite<sub>3</sub>, a halogen, a cyano, an azido or a thiol, where R, R 'and R' 'are the same or different and are selected from H, substituted and unsubstituted, branched or cyclic linear, alkyl, alkenyl or alkynyl having 1 to 10 carbon atoms, one unit of polyethylene glycol (-OCH<sub>2</sub>CH<sub>2</sub>) n, where n is an integer from 1 to 2000, aryl having 6 to 10 carbon atoms, heterocyclic ring having 3 to 10 carbon atoms where the substituent is selected from a halogen, OR<sub>7</sub>, NRgRg, NO<sub>2</sub>, NRCOR ', SR10, a sulfoxide represented by SOR', a sulfone represented by -SO<sub>2</sub>R ', a sulfite -SO3, a bisulfite -OSO3, a sulfonamide represented by SO<sub>2</sub>NRR ',
134
IMPI
MEXICAN INSTITUTE '^ Ι / ^ ιιγτΓΖDE LA WOPIEDAL _25_
INDUSTRIAL S cyano, an azido, -CORn, OCORn or OCONRxi'í »! ^, Where the definitions for R7, Re, R9, Rioi R11 and R12 are given as above, optionally R '' is OH;
W is C = O, C = S, CH<sub>2</sub>, BH, SO or SO<sub>2</sub>;
Ri, R21 R3, R41 Ri ', R2', R3 'and R / are each independently selected from H, substituted and unsubstituted, branched or cyclic linear alkyls, alkenyls or alkynyls having 1 to 10 carbon atoms, a polyethylene glycol unit (-OCH<sub>2</sub>CH<sub>2</sub>) n, where n is an integer from 1 to 2000, or a substituent selected from a halogen, guanidinium [-NH (C = NH) NH<sub>2</sub>], OR<sub>7</sub>, NR<sub>8</sub>R<sub>9</sub>, NOT<sub>2</sub>, NRCOR ', SR<sub>10</sub>, a sulfoxide represented by SOR ', a sulfone represented by -SO<sub>2</sub>R ', a sulfite -SO3, a bisulfite -OSO3, a sulfonamide represented by SO<sub>2</sub>NRR ', cyano, an azido, -CORn, OCORn or OCONRnRi<sub>2</sub> where R<sub>7</sub>, R<sub>8</sub>, R9, Rio, Ru, and R12 are each independently selected from H, substituted, unsubstituted, branched, or cyclic linear alkyls, alkenyls, or alkynyls having 1 to 10 carbon atoms, one polyethylene glycol unit (-OCH<sub>2</sub>CH<sub>2</sub>)<sub>n</sub>, where n is an integer from 1 to 2000, aryl having 6 to 10 carbon atoms, heterocyclic ring having 3 to 10 carbon atoms, optionally Rio is SR13 or COR13, where R13 is selected from a linear, branched or cyclic alkyl, alkenyl or alkynyl having 1 to 10 carbon atoms, a polyethylene glycol unit (-OCH<sub>2</sub>CH<sub>2</sub>)<sub>n</sub>, where n is an integer of 1
135
IMPI
INSTITUTO MUUCANC K THE PROPERTY
UNBUSTUAL
<img file="MX340437B_D0161.tif" />
to 2000, aryl having 6 to 10 carbon atoms, heterocyclic ring having 3 to 10 carbon atoms, optionally Rn is ORi<sub>4</sub>where Ri<sub>4</sub> has the same definition as R, optionally any one of Ri, R<sub>2</sub>, R3, R<sub>4</sub>, Ri ', R<sub>2</sub>', R<sub>3</sub>', or R<sub>4</sub>'is a linking group that is capable of binding a cell binding agent via a covalent bond or is selected from a polypyrrolo, poly-indolyl, poly-imidazolyl, polypyrrolo-imidazolyl, poly-pyrrolo-indolyl unit or polyimidazole-indolyl optionally bearing a linking group that is capable of binding to a cell-binding agent;
Z is selected from (CH<sub>2</sub>)<sub>n</sub>, where n is 1, 2 or 3, CRi<sub>5</sub>Ri<sub>6</sub>, NR17, O or S, where R<sub>i5</sub>, Ri<sub>6</sub> and R17 are each independently selected from H, from a linear, branched or cyclic alkyl having 1 to 10 carbon atoms, a polyethylene glycol unit (-OCH<sub>2</sub>CH<sub>2</sub>)<sub>n</sub><where n is an integer from 1 to 2000;
R<sub>6</sub> is OR, SR or NRR ', where R and R' have the same definition as given above;
X 'is selected from CH<sub>2</sub>, NR, CO, BH, SO or SO<sub>2</sub> where R has the same definition as given above;
Y 'is O, CH<sub>2</sub>, NR or S, where R has the same definition as given above;
Z 'is CH<sub>2</sub> or (CH<sub>2</sub>)<sub>n</sub>, where n is 2, 3 or 4, providing that X ', Y' and Z 'are not all CH<sub>2</sub> at the same time;
<img file="MX340437B_D0162.tif" />
<sup>136</sup> IMPI
MEXICAN INSTITUTE
Dt LA FUjONEDAO
INDUSTRIAL
A and A 'are the same or different and are selected from O, CRR'O, S, -CRR'S, -NRis or CRR'NHRis, where R and R' have the same definition as given above; and where R<sub>i5</sub> it has the same definition given above for R;
D and D 'are the same or different and independently selected from linear, branched or cyclic alkyls, alkenyls or alkynyls, having 1 to 10 carbon atoms, optionally substituted 7 with any halogen, OR<sub>7</sub>, NRgRg, NO<sub>2</sub>, NRCOR ', SRio, a sulfoxide represented by SOR', a sulfone by -SO<sub>2</sub>R ', a sulphite SO3, a bisulfite -OSO3, a sulfonamide represented by
SO2NRR ', cyano, an azido, -CORn, OCORn or OCONR11R12, where the definitions of R<sub>7</sub>, R<sub>s</sub>, Rg, Rio, R11 and R12 are given above, a polyethylene glycol (-OCH2CH2) unit n, where n is an integer from 1 to 2000;
L is an optional phenyl group or a heterocyclic ring having 3 to 10 carbon atoms that are optionally substituted, where the substituent is a linking group that allows binding to a cell-binding agent through a covalent bond , or is selected from linear, branched or cyclic alkyls, alkenyls or alkynyls, having 1 to 10 carbon atoms, optionally substituted with any one halogen, 0R<sub>7</sub>, NR<sub>8</sub>R9, NO<sub>2</sub>, NRCOR ', SR10, a sulfoxide represented by SOR', a sulfone represented by -SO<sub>2</sub>R ', a -SO3 sulfite, a -OSO3 bisulfite, a sulfonamide
137
<img file="MX340437B_D0163.tif" />
<img file="MX340437B_D0164.tif" />
represented by SO2NRR ', cyano, an azido,, -COR11, OCORn or OCONR11R12, where the definitions of R<sub>7</sub>, R<sub>8</sub>, R<sub>9</sub>, Rio, R11 and R12 are given above, a polyethylene glycol unit (OCH<sub>2</sub>CH<sub>2</sub>) n, where n is an integer from 1 to 2000; optionally, L itself is a linking group capable of binding a cell-binding agent through a covalent bond; or its solvates, salts, hydrates, or hydrated salts, its optical isomers, racemates, diasteromers, enantiomers, or the crystalline polymorphic structures of these pharmaceutically acceptable compounds, providing that the compound has no more than one linking group capable of binding an agent of binding to the cell through a covalent bond.
In one aspect the double line ~ between N and C represents a single bond or a double bond, providing that when it is a double bond X is absent and Y is H, and when it is a single bond, X is H or a protection group amine, which converts the compound into a prodrug;
Y is selected from -OR, NR'R, a -SO3 sulfite, or a -OSO3 bisulfite, where R is selected from linear, branched, or cyclic alkyl, alkenyl, or alkynyl having 1 to 10 carbon atoms, a unit of polyethylene glycol (-OCH<sub>2</sub>CH<sub>2</sub>) ni where n is an integer from 1 to 2000, aryl having 6 to 10 carbon atoms, heterocyclic ring having 3 to 10 carbon atoms;
138
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL LIFE
<img file="MX340437B_D0165.tif" />
W is C = O, CH<sub>2</sub> bear<sub>2</sub>;
Ri, R2e R<sub>3</sub>to Ría Ri '· R2' · R<sub>3</sub>'and R4' are each independently selected from H, NO<sub>2</sub> or a linking group capable of binding a cell-binding agent through a covalent bond;
Ré is ORi8a where Rig has the same definition as R;
Z is selected from (CH<sub>2</sub>)<sub>n</sub>z where n is 1, 2 or 3, CR15R16, NR17, O or S, where R15, Ri6 and Ri? each is independently selected from H, from a linear, branched or cyclic alkyl having 1 to 10 carbon atoms, a polyethylene glycol unit (-OCH<sub>2</sub>CH<sub>2</sub>)<sub>n</sub>, where n is an integer from 1 to 2000;
X 'is selected from CH<sub>2</sub>, or C = O;
Y 'is O, NR, or S, where R is defined as above;
Z 'is CH<sub>2</sub> or (CH<sub>2</sub>)<sub>2</sub>;
A and A 'are each O;
D and D 'are the same or different and are independently selected from linear, branched or aromatic alkyl, alkenyl or alkynyl of 1 to 10 carbon atoms;
L is an optional phenyl group or a heterocyclic ring having 3 to 10 carbon atoms, which is optionally substituted, where the substituent is a linking group that allows binding to the cell-binding agent through a covalent bond , or is selected from alkyls,
139
ΙΜΡΙ <sup>04</sup> MOR MOR IDAD • NIMJSTBIAt
<img file="MX340437B_D0166.tif" />
linear, branched alkenyls or alkynyls. or cyclic having 1 to 10 carbon atoms, is optionally substituted with any one halogen, OR<sub>7</sub>, NRgRg, NO<sub>2</sub>, NRCOR ', SRior a sulfoxide represented by SOR', a sulfone represented by -SO<sub>2</sub>R ', a sulfite -SO3, a bisulfite -OSO3, a sulfonamide represented by SO<sub>2</sub>NRR ', cyano, an azido, CORn, OCORn or OCONR11R12, a unit of polyethylene glycol (OCH2CH<sub>2</sub>) n, where n is an integer from 1 to 2000; optionally, L itself is a linking group capable of binding a cell-binding agent through a covalent bond, or its solvates, salts, hydrates, hydrated salts, its optical isomers, racemates, diasteromers, enantiomers or crystalline polymorphic structures of these pharmaceutically acceptable compounds.
In another aspect the compound is represented by the
<img file="MX340437B_D0167.tif" />
(XVII) where the double line ~ between N and C represents a single bond, or a double bond, providing that when it is a double bond X is absent and Y is H, and when it is a single bond, X is H or a amine protection group that converts
140
ΙΜΡΙ
INSTITUTO MEXICAN9 Di LA MONEDAD
INDUSTRIAL
<img file="MX340437B_D0168.tif" />
the compound in a prodrug, and Y is selected from an OH, an ether represented by -OR, a -SO3 sulfite, or an OSO3 bisulfite, where R is selected from linear, branched, or cyclic alkyl, alkenyl, alkynyl, bearing 1 to 10 carbon atoms,
One of R2, R3 is a linking group capable of binding a cell binding agent through a covalent bond and the other is H,
One of L ', L' 'or L' is a linking group capable of binding to a cell binding agent while the others are H; L 'which may be the linking group and G is CH or N. Other examples are described in the US patent application: no. 61 / 150,201, the total content of which is incorporated into this document by reference. Thus in a certain embodiment, the Mol9hu antibody is conjugated to a benzodiazepene having a structure shown in XIX-XXII above. In another embodiment, the FR-1-21 antibody is conjugated to a benzodiazepene having a structure shown in XIX-XXII above.
IV. Polynucleotides
In certain embodiments, the invention includes polynucleotides that comprise polynucleotides that encode a polypeptide that specifically binds to the human FOLR1 receptor or a fragment of this polypeptide. For example, the invention provides a polynucleotide comprising a
141
<img file="MX340437B_D0169.tif" />
IMPI iNSTtTlIVrx ...... * · *
<img file="MX340437B_D0170.tif" />
nucleic acid sequence encoding a
<img file="MX340437B_D0171.tif" />
a human FOLR1 or encodes a fragment of this antibody. The polynucleotides of the invention can be in the form of RNA or in the form of DNA. DNA includes cDNA, genomic DNA and synthetic DNA and can be double-stranded or single-stranded and if single-stranded they can be either a coding chain or a non-coding (anti-sense) chain.
In certain embodiments, the polynucleotides are isolated. In certain embodiments, the polynucleotides are substantially pure.
The invention provides a polynucleotide comprising a polynucleotide encoding a polypeptide comprising a sequence selected from a group consisting of sec. with no. of ident. : 4, 10, 11, 41, 42, and 88-103. There is also provided a polynucleotide encoding a polypeptide having at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% of a sequence identity with sec. with no. ID: 4,
10, 11, 41, 42, and 88-103.
The polynucleotides of sec. with no. Ident .: 5, 14, and 15 comprise the sequence encoding the Movl9hu heavy chain variable domain, version 1.00 light chain variable domain, and version 1.60 light chain variable domain, respectively.
142
IMPI
MEXICAN INSTITUTE • E INJUSTRIAL PROPERTY
<img file="MX340437B_D0172.tif" />
The invention further provides a polynucleotide comprising a sequence that is selected from a group consisting of Seq. with no. Ident .: 5, 14, 15, 37,
38, 43, 44, 47, 48, and 120-127. Also included is a polynucleotide having at least about 95%, at
<td>less about</td><td> 96%,</td><td>to the</td><td>less</td><td>approximately</td><td> 97%</td><td>to the</td>
<td>less about</td><td> 98%,</td><td>to the</td><td>less</td><td>approximately</td><td> 99%</td><td>of</td>
<td>sequence identity</td><td>with</td><td>the</td><td>sec.</td><td colspan="2">with no. Ident .:</td><td> 5,</td>
14, 15, 37, 38, 43, 44, 47, 48, and 120-127. Thus, in certain embodiments, the polynucleotide comprises (a) a polynucleotide that has at least 95% sequence identity with sec. with no. ident: 5, and / or (b) a polynucleotide having at least about 95% sequence identity with sec. with no. ID: 14 or
fifteen. In certain embodiments, the polynucleotide comprises (a) a polynucleotide having the amino acid sequence of sec. with no. ident: 5, and / or (b) a polynucleotide having the amino acid sequence of sec. with no. Ident .: 14 or sec. with no. Ident. 15:15.
In certain embodiments, polynucleotides comprise the sequence encoding the mature polypeptide that fuses in the same reading frame to a polynucleotide that aids, for example, in the expression and secretion of a polypeptide from a host cell (eg, a sequence leader that works just like a secretive sequence
143
IMPI ^
INSTITUTO MEXICANO M LA «OMMJAD INDUSTRIAL to control the transport of pr> li pppt-ί Hn from the cell). The polypeptide having a leader sequence is a pre-protein and may have a leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides can also code for a pro-protein that is the mature protein in addition to amino acid residues added to the 5 'end. A mature protein that has a pro-sequence is a proprotein and is an inactive form of the protein. Once the pro-sequence is cleaved, the mature protein remains active.
In certain embodiments, polynucleotides comprise the
<td>sequence</td><td>than</td><td>encode</td><td>for</td><td>the</td><td>mature polypeptide that</td>
<td>merge</td><td>at</td><td>same</td><td>framework</td><td>of</td><td>reading to a stream</td>
<td>marker</td><td>than</td><td>It allows,</td><td>by</td><td colspan="2">example the purification of the</td>
encoded polypeptide. For example, the marker sequence may be a hexa-histidine tag supplied by the vector pQE-9 to provide purification of the mature polypeptide fused with the marker in the case of a bacterial host, or the marker sequence may be a hemagglutinin tag. (HA) derived from influenza hemagglutinin protein, when using a mammalian host (eg COS-7 cells).
The present invention further relates to the variants of the coding polynucleotides described above
144
IMPI • NSTnUTO Mexican INDUSTRIAL
<img file="MX340437B_D0173.tif" />
in this document, for example, fragments, analogs and derivatives.
Polynucleotide variants may contain alterations in the coding regions, in the non-coding regions, or both. In some embodiments, polynucleotide variants contain alterations that produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide. In some embodiments, nucleotide variants are produced by silent substitutions due to the degeneracy of the genetic code. Polynucleotide variants can be produced for a variety of reasons, for example to optimize codon expression for a particular host (codon changes in human mRNA to those of preference for the bacterial host such as E.coli).
Vectors and cells comprising the polynucleotides described herein are also provided.
V. Methods of use and pharmaceutical compositions.
The FOLR-1 binding agents (including antibodies, immunoconjugates, and polypeptides) of the invention are useful in a variety of applications including, but not limited to, therapeutic treatment methods, such as the treatment of cancer. In certain modalities,
145
ΙΜΡΙ <sup>, NST</sup>NYRO MEXICO OF THE INDUSTRIAL EHOFKDaD
<img file="MX340437B_D0174.tif" />
Agents are useful to inhibit tumor growth. induce differentiation, reduce tumor volume, and / or reduce malignancy of a tumor. The methods of use could be in vitro, ex vivo, or in vivo methods. In certain embodiments, the FOLRl binding agent, or the antibody or immunoconjugate, or the polypeptide is an antagonist of human FOLRl, to which it is bound.
In one aspect, anti-FOLR1 antibodies and immunoconjugates of the invention are useful in detecting the presence of FOLRl in a biological sample. The term detect as used herein includes quantitative or qualitative detection. In certain modalities, a biological sample comprises a cell or a tissue. In certain modalities, such tissues include normal or cancerous tissues that express FOLR1 at higher levels relative to other tissues. In certain modalities, overexpression of FOLRl detects the presence of ovarian cancer, lung cancer, brain cancer, breast cancer, uterine cancer, kidney cancer and pancreatic cancer.
In one aspect, the invention provides a method of detecting the presence of FOLR1 in a biological sample. In certain embodiments, the method comprises contacting the biological sample with an anti-FOLRl antibody under permissive conditions for binding of the anti-FOLRl antibody to FOLRl, and
146 way between the anti
<img file="MX340437B_D0175.tif" />
IMPI
<img file="MX340437B_D0176.tif" />
detect whether a complex is FOLRl and FOLR1.
<img file="MX340437B_D0177.tif" />
In one aspect, the invention provides a method of diagnosing a disorder associated with increased expression of FOLR1. In certain embodiments, the method comprises contacting a test cell with an anti-FOLRl antibody, determining the level of expression (either quantitatively or qualitatively) of FOLR1 by the test cell to detect binding of the anti-FOLRl antibody to FOLR1; and comparing the level of FOLR1 expression in the test cell with the level of FOLR1 expression by a control cell (eg, a normal cell of tissue origin similar to the test cell, or a cell that expresses FOLR1 at levels comparable to that of a normal cell) where a higher level of FOLR1 expression by the test cell when compared to the control cell indicates the presence of a disorder associated with increased FOLR1 expression. In certain embodiments, the test cell is obtained from an individual suspected of having a disorder associated with increased expression of FOLR1. In certain embodiments, the disorder is a cellular proliferative disorder, such as a cancer or a tumor.
In certain embodiments, a method for diagnosis or detection, such as those described above, comprises detecting binding of the anti-FOLRl antibody to FOLRl
147
IMPI 'NSTfTJJTO MEXICANO
OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0178.tif" />
that is expressed on the surface of a cell_ or in a preparation of a membrane that is obtained from a cell that expresses FOLRl on its surface. In certain embodiments, the method comprises contacting a cell with an antiFOLRl antibody under permissive conditions for binding of the anti-FOLRl antibody to FOLRl on the cell surface. An example assay to detect binding of an anti-FOLRl antibody to FOLRl that is expressed on the surface of a cell is a FACS assay.
Certain other methods can be used to detect binding of anti-FOLRl antibodies to FOLRl. These methods include, but are not limited to, antigen binding assays that are well known in the art such as immunoblotting, radioimmunoassays, ELISA (enzyme-linked immunosorbent assay), sandwich immunoassays, immunoprecipitation assays, fluorescence immunoassays, protein A immunoassays and immuno histochemistry (IHC).
In certain modalities, anti-FOLR1 antibodies are labeled. Labels include, but are not limited to, directly detectable labels or portions (such as fluorescent, chromophore, electrodense, chemiluminescent, and radioactive labels), as well as portions, such as enzymes or ligands, that are detected indirectly for example through a reaction
148
ΙΜΡΙ <sup>, NST</sup>nyro MEXICANO de la moheda n INDUSTRIAL
<img file="MX340437B_D0179.tif" />
enzymatic or a molecular interaction. _
In certain embodiments, anti-FOLR1 antibodies are immobilized on an insoluble matrix. Immobilization involves separating the anti-FOLR1 antibodies from any FOLR1 that remains free in the solution. This is conventionally accomplished either by insolubilizing the antiFOLR1 antibody prior to the assay procedure, or by absorption to a water-insoluble matrix or surface ((Bennich et al., US Patent No. 3,720,760), or by covalent coupling (eg, by crosslinking with glutaraldehyde), or by insolubilization of the anti-FOLRl antibody after the formation of a complex between the anti-FOLRl antibody and FOLRl, eg, by immunoprecipitation.
Any of the above diagnostic or detection modalities could be carried out using an immunoconjugate of the invention instead of or in addition to an anti-FOLR1 antibody.
In certain embodiments, the disease that is treated with the FOLRl binding agent or antagonist (eg, a Movl9hu antibody or immunoconjugate) is cancer. In certain embodiments, cancer is characterized by tumors that express the folate receptor 1 that binds to the FOLRl binding agent (eg, antibody).
The present invention provides the methods for
149
IMPI
MEXICAN INSTITUTE OE THE INDUSTRIAL AVERAGE
<img file="MX340437B_D0180.tif" />
treating cancer comprising administering a therapeutically effective amount of a FOLRl binding agent to a subject (eg, a subject in need of treatment). In certain modalities, the cancer is a cancer selected from a group consisting of colorectal cancer, pancreatic cancer, lung cancer, ovarian cancer, liver cancer, breast cancer, brain cancer, kidney cancer, prostate cancer, cancer gastrointestinal, melanoma, cervical cancer, bladder cancer, glioblastoma, head and neck cancer. In certain modalities, the cancer is an ovarian cancer. In certain modalities the cancer is a lung cancer. In certain modalities the subject is a human.
The present invention further provides the methods for inhibiting tumor growth using the antibodies or other agents described herein. In certain embodiments, the method of inhibiting tumor growth comprises contacting the cell in vitro with a FOLRl binding agent (eg, the antibody). For example, an immortalized cell line or a cancer cell line expressing FOLR1 is grown in the medium to which the antibody or other agent is added to inhibit tumor growth. In some embodiments, tumor cells are isolated from a Thai patient sample, such as a tissue biopsy, pleural effusion, or blood sample, and cultured in a medium to which a FOLRl binding agent is added.
150
<img file="MX340437B_D0181.tif" />
IMPI '^ STTíIM'cano <sup>THE A</sup>.í * ° nEDAn INDUSTRIAL
<img file="MX340437B_D0182.tif" />
to inhibit tumor growth. -.
In some embodiments, the method of inhibiting tumor growth comprises contacting the tumor or tumor cells in vivo with the FOLRl binding agent (eg, the antibody). In certain modalities, contacting a tumor or tumor cell line with the FOLRl binding agent is addressed in an animal model. For example, FOLRl binding agents can be administered to xenografts expressing one or more of the FOLRl that are grown in immunocompromised mice (eg, NOD / SCID mice) to inhibit tumor growth. In some embodiments, cancer stem cells are isolated from a patient sample such as, for example, a tissue biopsy, a pleural effusion, or a blood sample and are injected into immunocompromised mice, which are then administered a binding agent. FOLRl to inhibit tumor growth. In certain embodiments, the FOLRl binding agent is administered at the same time or shortly after the introduction of tumorigenic cells into the animal to prevent tumor growth. In some modalities, the agent of
<td>FOLRl binding is administered</td><td>as a therapeutic,</td><td>then</td><td>of</td>
<td>that tumor cells</td><td>have grown up</td><td colspan="2">a size</td>
<td>specific.</td><td></td><td></td><td></td>
<td>In certain modalities</td><td>, the method for</td><td>inhibit</td><td>the</td>
tumor growth comprises administering to a subject a
151
IMPI
MEXICAN INSTITUTE OF THE RROFHPAD industrial
<img file="MX340437B_D0183.tif" />
therapeutically effective amount of the FOLRl binding agent. In certain modalities the subject is a human. In certain modalities, the subject has a tumor or had a tumor removed.
In certain embodiments, the tumor expresses the folate receptor to which the FOLRl binding agent or antibody binds. In certain modalities, the tumor overexpresses human FOLR1.
In certain embodiments, the tumor is a tumor selected from the group consisting of brain tumor, colorectal tumor, pancreatic tumor, lung tumor, ovarian tumor, liver tumor, breast tumor, kidney tumor, prostate tumor, gastrointestinal tumor, melanoma, cervical tumor, bladder tumor, glioblastoma, and head and neck tumor. In certain modalities, the tumor is an ovarian tumor.
Furthermore, the invention provides a method of reducing the malignancy of a tumor in a subject, which comprises administering to the subject a therapeutically effective amount of the FOLRl binding agent. In certain modalities, the tumor comprises cancer stem cells. In certain embodiments, the frequency of cancer stem cells in the tumor is reduced by administration of the agent.
Thus, in certain embodiments, the inventions provide methods of treating cancer using the
152
ΙΜΡΙ
MEXICAN INSTITUTE OF PROPERTY
INDUSTRIAL
<img file="MX340437B_D0184.tif" />
antibody. Movl9hu and immunoconjugates. In certain modalities, the Movl9hu immunoconjugate is Movl9hu-SPDB-DM4;
Movl9hu-sulfo-SPP-DMl; Movl9hu-SPP-DMl; or Movl9hu-PEG4-MalDM4.
The invention further provides methods of differentiating tumor cells into non-tumor cells comprising contacting the tumor cells with a FOLR1 binding agent (eg, administering the FOLR1 binding agent to a subject having a tumor comprising the cells tumor or had a tumor removed). In certain embodiments, the tumor cells are ovarian tumor cells.
The present invention further provides methods for reducing activation of myofibroblasts in the stroma of a solid tumor, which comprises contacting the stroma with an effective amount of the FOLR1 binding agent, polypeptide, or antibody.
The present invention further provides the pharmaceutical compositions comprising one or more of the FOLR1 binding agents described herein. In certain embodiments, the pharmaceutical compositions further comprise a pharmaceutically acceptable carrier. These pharmaceutical compositions find use in inhibiting tumor growth and treating cancer in human patients.
153
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0185.tif" />
In certain embodiments, the formulations are prepared for storage and use by combining a purified antibody or agent of the present invention with a pharmaceutically acceptable vehicle (eg, carrier, excipient) (Remington, The Science and Practice of Pharmacy 20ma Mack Publishing Edition, 2000). Pharmaceutically acceptable carriers include, but are not limited to, non-toxic buffers such as phosphate, citrate, and other organic acids; salts such as sodium chloride; antioxidants including ascorbic acid and methionine; preservatives (for example octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride, benzalkonium chloride, benzetonium chloride, phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben, catechol, resorcinol; cyclohexanol; 3 pentanol and m-cresol); low molecular weight polypeptides (eg, less than about 10 amino acid residues); proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinyl pyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; carbohydrates such as monosaccharides, disaccharides, glucose, trickle, or dextrins; chelating agents such as EDTA, sugars such as sucrose, mannitol, trehalose, or sorbitol; against salt-forming ions such as sodium; metal complexes (for example
154
<img file="MX340437B_D0186.tif" />
IMPI
OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0187.tif" />
Zn-protein complexes); and non-ionic surfactants such as TWEEN or polyethylene glycol (PEG).
The pharmaceutical compositions of the present invention can be administered in any number of ways either by local or systemic treatment. Administration can be topical (such as a mucosal membrane that includes vaginal and rectal delivery) such as transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders; pulmonary (eg, by inhalation or insufflation of powders or aerosols, including nebulizer, intratracheal, intranasal, epidermal, and transdermal); oral; or parenteral, including intravenous, intra arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; or intracranial administration (eg, intrathecal or intraventricular).
An antibody or immunoconjugate of the invention can be combined in a pharmaceutical combination formulation, or dosage regimen such as combination therapy, with a second compound that has anti-cancer properties. The second compound of a pharmaceutical combination formulation or dosage regimen preferably has complementary activities to the ADC of the combination such that they do not adversely affect each other. Pharmaceutical compositions comprising the binding agent FOLRl and the second anticancer agent are provided
155
IMPI
FηίΤΟ MfXRANO OF INDUSTRIAL PROPERTY
<img file="MX340437B_D0188.tif" />
too. For the treatment of disease, the appropriate dose of an antibody or an agent of the present invention depends on the type of disease to be treated, the severity and course of the disease, the sensitivity of the disease, whether the antibody or the agent it is administered for therapeutic or preventive purposes, prior to therapy, the patient's medical history, and so on at the discretion of the treating physician. The antibody or agent can be administered once or in a series of treatments lasting from several days to several months, or until cure occurs or a decrease in disease status is achieved (eg, reduction in tumor size). Optimal dosage schedules can be calculated from measurements of drug accumulation in the patient's body and will vary depending on the relative potency of an individual antibody or agent. The doctor who administers it can easily determine the optimal doses, dosage methodologies, and recurrence rates. In certain modalities the dose is from 0.01 pg to 100 mg per kg of body weight and can be given once or more daily, weekly, monthly or annually. In certain embodiments, an antibody or other FOLR1 binding agent is administered once every two weeks or once every three weeks. In certain embodiments, the dose of the antibody u
156
<img file="MX340437B_D0189.tif" />
<img file="MX340437B_D0190.tif" />
another binding agent to FOLR1 is ~ iprc<sup>v</sup>lm? drtmcnt3 ma at approximately 20 mg per kg of body weight. The treating physician can estimate dose repetition rates based on measurement of residence times and drug concentrations in body fluids or tissues.
Combination therapy can provide synergy and test synergism, meaning the effect achieved when the active ingredients are used together is greater than the sum of the effects that result from using the compounds separately. A synergistic effect can be obtained when the active ingredients are: (1) co-formulated and administered or delivered simultaneously in a combined unit dose formulation, (2) delivered alternately or in parallel as the separate formulations; or (3) by any other regime. When delivered in an alternative therapy, a synergistic effect can be obtained when the compounds are administered or delivered sequentially, for example by different injections into separate syringes. In general, during alternative therapy, an effective dose of each active ingredient is administered sequentially, that is, consecutively, while in combination therapy, the effective doses of two or more active ingredients are administered together.
ΙΜΡΙ
157
MEXICAN INSTITUTE • í LA RRORíDAD
INDUSTRIAL
<img file="MX340437B_D0191.tif" />
SAW. Kits comprising FOLRl binding agents
The present invention provides kits that comprise the antibodies, immunoconjugates, or other agents described herein and can be used to perform the methods described herein. In certain embodiments, a kit comprises at least one purified antibody against human folate receptor 1 in one or more containers. In some modalities, the kits comprise all the components necessary and / or sufficient to carry out a detection test, which include all the controls, instructions to carry out the measurements, and some necessary program for the analysis and presentation of the results. A person skilled in the art will readily recognize that the disclosed antibodies, immunoconjugates, and other agents of the present invention can be readily incorporated into one of the established kit formats that are well known in the art.
Kits comprising the FOLRl binding agent (eg, a FOLRl binding antibody) as well as a second anticancer agent are also provided. In certain embodiments, the second anticancer agent is a chemotherapeutic agent (eg, gemcitabine or irinotecan).
The embodiments of the present description can be further defined by reference for the following non-limiting examples, which describe in detail the preparation of
158
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL FROFIEDAD
<img file="MX340437B_D0192.tif" />
antibodies determined from the present description and the methods for using the antibodies of the present description. It will be apparent to those skilled in the art that many modifications, both for materials and for methods, can be practiced without departing from the scope of the present disclosure.
EXAMPLES
It is understood that the examples and modalities described herein are for illustrative purposes only and that various modifications or changes in light thereof are suggested to persons with experience in the art and will be included in the spirit and scope of this application.
Example 1
Chimerization of the murine monoclonal antibody Movl9 The amino acid sequences of the variable region of
Movl9 were obtained from the NCBI database (accesses CAA68253 for a light chain (section with ID number: 24) and CAA68252 for a heavy chain (section with ID number: 23)) and then codons were optimized and synthesized by Blue Heron Biotechnology. The light chain variable region was cloned into the EcoRI and BsiWI sites of the plasmid pAbKZeo and the heavy chain variable region was cloned into the HindIII and Apal sites of the plasmid pAbGINeo.
159
IMPI
MEXICAN INSTITUTE be LA EROEIEDA · INDUSTRIAL
<img file="MX340437B_D0193.tif" />
Example 2
Humanization of murine Movl9 and monoclonal antibodies
FRl-21
Movl9 antibody was humanized following the framework region surface redesign methods described above (Roguska M. et al., Proc. Nati. Acad. Sci. United States, February 1994; 91: 969-973) and (Roguska et al., Protein Eng. 9 (10): 895-904 (1996)). In summary, the average solvent accessibility of each residue from the variable region framework region was calculated using the closely related antibody resolved structures from the PDB database, and positions with more than 30% Average accessibility were marked as residues on the surface (Pedersen JT et al., J. Mol. Biol. 1994; 235: 959-973). The surface of the replacement human sequence was selected by aligning the positions of the surface of the murine antibody sequences with the corresponding positions of the germline sequences of human antibodies in the Kabat database (Johnson, G. and Wu, TT (2001) Nucleic Acids Research, 29: 205-206). The surface of the human light chain variable region with the highest homology (clone DPK19, IMGT locus IGKV2D-30 * 01 for Movl9 and IMGT locus IGKV1 / OR20 * 01 for FRl-21) and surface of the human heavy chain variable region with the highest homology (clone 8M27, IMGT
160
IMPI
MEXICAN INSTITUTE OF INDUSTRIAL FROFIEDAD
<img file="MX340437B_D0194.tif" />
IGHV1-69 * O8 locus for Movl9 and IMGT locus IGHV5-51 * 02 for FRl-21) was selected to replace the positions of the surface of the murine framework region of Movl9, leaving the 6 CDRs (Table 1) unchanged . The positions of the surface and residues of Movl9 and FRl-21, murine and human are presented in Figures 1A-1D.
<td>CDR Moví9</td><td>CDR FRl-21</td>
<td>Light chain</td><td>Light chain</td>
<td>CDR1: KASQSVSFAGTSLMH (sec.</td><td>CDRl: KASDHINNWLA (sec. With</td>
<td>with no. ID: 7)</td><td>no. ID: 27)</td>
<td>CDR2: RASNLEA (sec. With no.</td><td>CDR2: GATSLET (sec. With no.</td>
<td>of ident.:8)</td><td>ID: 28)</td>
<td>CDR3: QQSREYPYT (sec. With no.</td><td>CDR3: QQYWSTPFT (sec. With no.</td>
<td>of ident.:9)</td><td>ID: 29)</td>
<td>Heavy chain</td><td>Heavy chain</td>
<td>CDRl: GYFMN (sec. With</td><td>CDRl: SSYGMS (sec. With</td>
<td>ident.:1)</td><td>ident.:30)</td>
<td>CDR2 (AbM): RIHPYDGDTF (sec.</td><td>CDR2 (AbM): TISSGGSYTY (sec.</td>
<td>with no. ID: 131)</td><td>with no. ID: 31)</td>
<td>CDR3: YDGSRAMDY (sec. With no.</td><td>CDR3: DGEGGLYAMDY (sec. With</td>
<td>Ident.:3)</td><td>no. ID: 32)</td>
<td>CDR2 Moví9 HC defined from</td><td>CDR2 FRl-21 HC defined from</td>
<td>Kabat</td><td>Kabat</td>
161
<img file="MX340437B_D0195.tif" />
ΙΜΡΙ
MEXICAN INSTITUTE I heard THE INDUSTRIAL EROMEUAD
<td>Murine HC CDR2: RIHPYDGDTFYNQNFKD (sec. ccn ident no .: 128)</td><td>Murine HC CDR2: TISSGGSYTYYPDGVKG (section with ID number: 33)</td>
<td>Human HC CDR2: RIHPYDGDTFYNQKFQG (sec. with ID number: 2)</td><td>Human HC CDR2: TISSGGSYTYYSPGFQG (sec. with ID number: 34)</td>
<td colspan="2">Table 1A: Movl9 and FR1-21 CDR Heavy and Light Chains as defined for the redesign of the surface it provide. The Kabat definition for CDR2 string Heavy is also given for murine and human antibodies.</td>
None of the residue changes caused problems by affecting the interactions of any of the Movl9 or FR1-21 CDRs with their target epitopes at the folate receptor 1, so reverse surface mutations were not considered for the humanized sequences of both antibodies. The redesigned Movl9 sequence however introduced a N74 glycosylation consensus site of one light chain (light chain version 1.00), whereby a second humanized version of a light chain was made to remove this site. A review of the Kabat human light chain sequence database revealed that threonine is the most common residue found at position 74 of a light chain, so version 1.60 of a humanized Movl9 light chain was constructed with a
162
ΙΜΡΙ
MEXICAN INSTITUTE OF INDUSTRIAL MONEDAD
<img file="MX340437B_D0196.tif" />
Threonine at position 74. Position 74 is not a surface residue so this residue substitution has no impact on humanization by redesigning the surface. The alignments of the murine and humanized Movl9 and FR1-21 variable region sequences are presented in Figures 2A-2D.
For the humanized Movl9 and FR1-21 variable region sequences, codons were optimized and synthesized by Blue Heron Biotechnology. The sequences are flanked by sites for restriction enzymes to facilitate in-frame cloning with the respective constant sequences in single chain plasmids for expression in mammals. The light chain variable region was cloned into the EcoRI and BsiWI sites of the plasmid pAbKZeo. DNA from the resulting plasmids encoding a huMovl9 light chain was deposited with the ATCC as no. ATCC PTA-10773 and PTA-10774 deposited and the resulting plasmid DNA encoding a light chain of huFRl21 was deposited as no. ATCC depot PTA-10776. The heavy chain variable region was cloned into the HindIII and Apal sites of the plasmid pAbGINeo. DNA from the resulting plasmid encoding a huMovl9 heavy chain was deposited with the ATCC as no. deposition of ATCC PTA-10772 and the resulting plasmid DNA encoding a huFRl-21 heavy chain was deposited with ATCC as no. deposit of the
163
IMPI • NSTrnrro Mexican DE LA RROPIiOAD industrial
<img file="MX340437B_D0197.tif" />
ATCC PTA-10775. These plasmids were transfected as described in Example 3 to produce huMovl9. The plasmid encoding any of the huMovl9 light chains (ie those deposited as ATCC depot number PTA-10773 or PTA-10774) can be combined with the plasmid encoding a huMovl9 heavy chain to create an antibody huMovl9 according to the methods provided herein as they are well known to someone with experience in the field.
Example 3
Expression of Recombinant Antibodies Chimeric and humanized antibody constructs were transiently produced either in HEK-293T adherent cells with a standard calcium phosphate procedure (BD Biosciences, CalPhos Mammalian Transfection Kit, Cat # 631312) or in HEK-293T cells adapted to suspension with a modified PEI procedure [Durocher Y, Perret S, Kamen A High-level and high-throughput recombinant protein production by transient transfection of suspension-growing human 293-EBNA1 cells. Nucleic Acids Res. January 15, 2002; 30 (2): E9] in shake flasks. Transient PEI transections were performed as previously described (Durocher, Y. et al., Nucleic Acids Res. 30 (2): E9 (2002)), except that HEK-293T cells were grown in Freestyle 293 (Invitrogen) and the volume of
164
IMPI
<img file="MX340437B_D0198.tif" />
<img file="MX340437B_D0199.tif" />
culture was not diluted after addition of complexes
PEI-DNA. Both adherent and suspension transient transections were incubated for one week and then the cleared supernatant was purified by a Protein A column followed by chromatography on a CM ion exchange column as described below. As shown in Figure 3, the expression of huMovl9 was at least 10 times higher than the expression of chimeric Moví9 in transfected cells.
Example 4
Antibody purification
Antibodies were purified from the clarified cell culture supernatant with standard methods, such as for example protein A or G chromatography (HiTrap Protein A or G HP, 1 ml, Amersham Biosciences). Briefly, the supernatant was prepared for chromatography by adding 1/10 of the volume of 1 M Tris / HCl, pH 8.0. The pH adjusted supernatant was filtered through a 0.22 pm filter membrane and loaded onto the equilibrated column with binding buffer (PBS, pH 7.3). The column was washed with binding buffer until a stable baseline without absorbance at 280 nm was obtained. The antibody was eluted with a 0.1 M acetic acid buffer containing 0.15 M NaCl, pH 2.8, with a flow of 0.5 ml / min. Fractions of about 0.25 ml are
165
IMPI 'NSTnyro Mexican M LA PROntDAD INDUTTWAL
<img file="MX340437B_D0200.tif" />
they were collected and neutralized by the addition of -i / 1n of the volume of 1 M Tris-HCl, pH 8.0. The maximum fraction (s) was dialyzed twice overnight against PBS lx and filter sterilized through a 0.2 pm filter membrane. The purified antibody was quantitated by the absorbance at A<sub>2</sub>8th
Protein A purified fractions were further purified using ion exchange chromatography (IEX) with carboxymethyl cellulose (CM) chromatography. Briefly, samples from the protein A purification were switched from the buffer to the starting buffer (10 mM potassium phosphate, 10 mM sodium chloride, pH 7.5) and filtered through 0.22 pm filing cabinet. The prepared sample was then loaded onto a fast flow CM resin (GE Lifesciences) which was equilibrated with the start buffer, at a flow of 120 cm / hr. The size of the column was chosen to have sufficient capacity to bind all the antibodies in the sample. The column was washed with binding buffer until a stable baseline without absorbance at 280 nm was obtained. The antibody was eluted by starting a gradient of sodium chloride from 10mM to 500mM in 20 column volumes (CV). Fractions with UV reading above 50 mAu from the main peak were collected. Purity (the percentage of monomer and high weight soluble aggregates
166
IMPI
MEXICAN INSTITUTE OF LA MONEDAD
INDUSTRIAL
<img file="MX340437B_D0201.tif" />
Molecular) was evaluated by Ha-avoinaiAn size chromatography (SEC) on a TSK G3000SWXL gel, 7.8 χ 300 mm, with a safety column SWXL, 6.0 χ 40 mm (Tosoh Bioscience, Montgomeryville, PA) using a Agilent HPLC 1100 (Agilent, Santa Clara, CA). Fractions with the desired purity (> 95%) were pooled, the buffer was exchanged for PBS (pH 7.4) using the TFF system, and filter sterilized through a 0.2 pm filter membrane. The purified antibody was further examined for its purity by SEC and the IgG concentration was determined by measuring the absorbance at 280 nm using an extinction coefficient of 1.47. Dilution was made when necessary.
Furthermore, ceramic hydroxyapatite (CHT) can be used to polish both murine and humanized antibodies with increased selectivity. The 40 µm Part II CHT Type II resin (Bio-Rad Laboratories) was applied to the polished antibodies with a protocol similar to IEX chromatography. The CHT start buffer was 20 mM sodium phosphate, pH 7.0 and the antibody was eluted with a gradient of sodium phosphate from 20 to 160 mM above 20
CV.
Example 5
Development of murine anti-FOLR1 antibodies
There were two different series of immunization detection. The
167
IMPI
MEXICAN INSTITUTE PE INDUSTRIAL PROPERTY
<img file="MX340437B_D0202.tif" />
first series has led to the generation of clone FR1-21, the second series has resulted in the generation of clones FR1-48, FR1-49, FR1-57 and FR1-65. In the first series, mice were immunized subcutaneously with approximately 5xl0<sup>6</sup> KB cells expressing FOLR1 (American Tissue Culture Collection, ATOO CCL-17). In the second series, cells 300-19 expressing human FOLR1 on their surface were used to immunize mice. To make these cells, the human amino acid sequence FOLRl was obtained from the NCBI website (access NP_057937), then codons were optimized, and it was synthesized by Blue Heron biotechnologies, flanked by EcoRI and Xbal restriction sites to facilitate cloning in the mammalian expression vector pSRa. Cells 300-19, a pre-B cell line derived from a Balb / c mouse (Reth et al., Nature, 317: 353-355 (1985)), were transfected with the expression plasmid pSRaFolRl to stably express high levels of human FOLR on the cell surface . Standard immunization protocols known to those of experience, for example, as used by ImmunoGen, Inc. were applied for both series. Mice immunized with antigen were challenged three days before being sacrificed for the generation of hybridomas. The spleens of the mice were collected according to the standard protocols of the animals, such as, for example, grinding the tissue between two microscopic slides.
168
IMPI
MEXICAN INSTITUTE
OF THE PRORIEDAD U INDUSTRIAL
<img file="MX340437B_D0203.tif" />
sterile ice creams, to obtain a suspension of individual cells in RPMI-1640 medium. Spleen cells were centrifuged, pelleted, washed, and fused with a murine myeloma, such as, for example, P3X63Ag8.653 cells (Kearney et al., J. Immunol., 123: 1548-1550 (1979)). by polyethylene glycol-1500 (Roche 783 641). The fused cells were resuspended in RPMI-1640 selection medium containing hypoxanthineaminopterin-thymidine (HAT) (Sigma, H-0262) and selected for growth in 96-well flat-bottom culture dishes (Corning-Costar 3596, 0.2 ml of cell suspension per well) at 37 ° C with 5% CO2. After 5 days of incubation, 0.1 ml of culture supernatant was removed from each well and replaced with 0.1 ml of RPMI-1640 containing the hypoxanthine-thymidine (HT) supplement (Sigma, H-0137). Incubation at 37 ° C with 5% CO2 was continued until the hydridoma clones were ready for antibody detection. Other hybridoma production and immunization techniques may also be used, including those described in Langone et al. (Eds., Immunochemical Techniques, Part I, Methods in Enzymology, Academic Press, Volume 121, Florida) and Harlow et al. (Antibodies: A Laboratory Manual; Coid Spring Harbor Laboratory Press, New York (1988)).
169
IMPI ilwrnvro MEXICANO Ȓ THE INDUSTRIAL PROPERTY
<img file="MX340437B_D0204.tif" />
Table IB: yii CDRs of FR1-48, 49, 57, and 65 are provided. The Kabat definition for heavy chain CDR2 is also given for murine and human antibodies.
<td>CDR FR1-48</td><td>CDR FR1-49</td><td>CDR FR1-57</td><td>CDR FR1-65</td>
<td>Light chain</td><td>Light chain</td><td>Light chain</td><td>Light chain</td>
<td>CDR1 -</td><td>CDR1 -</td><td>CDR1 -</td><td>CDR1 -</td>
<td>RASENIYSNLA</td><td>RASENIYTNLA</td><td>RASQNINNNLH</td><td>KASQNVGPNVA</td>
<td>(sec. with no.</td><td>(sec. with no.</td><td>(sec. with no.</td><td>(sec. with no.</td>
<td>of ident.:57)</td><td>ID: 63)</td><td>ID: 69)</td><td>ID: 75)</td>
<td>CDR2 -</td><td>CDR2 - TASNLAD</td><td>CDR2 - YVSQSVS</td><td>CDR2 - SASYRYS</td>
<td>AATNLAD (sec.</td><td>(sec. with no.</td><td>(sec. with no.</td><td>(sec. with no.</td>
<td>with no. of</td><td>ID: 64)</td><td>ID: 70)</td><td>ID: 76)</td>
<td>ident.:58)</td><td></td><td></td><td></td>
<td>CDR3 -</td><td>CDR3 -</td><td>CDR3 -</td><td>CDR3 -</td>
<td>QHFWASPYT</td><td>QHFWVSPYT</td><td>QQSNSWPHYT</td><td>QQYNSYPYT</td>
<td>(sec. with no.</td><td>(sec. with no.</td><td>(sec. with no.</td><td>(sec. with no.</td>
<td>ID: 59)</td><td>ID: 65)</td><td>ID: 71)</td><td>ID: 77)</td>
<td>Heavy chain</td><td>Heavy chain</td><td>Heavy chain</td><td>Heavy chain</td>
<td>CDR1 -TNYWMQ</td><td>CDR1 -TNYWMY</td><td>CDR1 -SSFGMH</td><td>CDR1 -TSYTMH</td>
<td>(sec. with no.</td><td>(sec. with no.</td><td>(sec. with no.</td><td>(sec. with no.</td>
<td>Ident.:60)</td><td>Ident.:66)</td><td>ID: 72)</td><td>ID: 78)</td>
170
<img file="MX340437B_D0205.tif" />
IMPI Mexican Institute
Dt THE INDUSTRIAL MODEL
<td rowspan="2">CDR2 - AIYPGNGDSR</td><td rowspan="2">CDR2 - AIYPGNSDTT</td><td></td><td></td>
<td>CDR2 - YISSGSSTIS</td><td>YINPISGYTN</td>
<td>(sec. with no.</td><td>(sec. with no.</td><td>(sec. with no.</td><td>(sec. with no.</td>
<td>Ident.:61)</td><td>ID: 67)</td><td>ID: 73)</td><td>ID: 79)</td>
<td>CDR3 -</td><td>CDR3 -</td><td>CDR3 -</td><td>CDR3 -</td>
<td>RDGNYAAY (sec.</td><td>RHDYGAMDY</td><td>EAYGSSMEY</td><td>GGAYGRKPMDY</td>
<td>with no. of</td><td>(sec. with no.</td><td>(sec. with no.</td><td>(sec. with no.</td>
<td>ident.:62)</td><td>ID: 68)</td><td>ID: 74)</td><td>Ident.:80)</td>
<td>CDR2 HC's</td><td>CDR2 HC's</td><td>CDR2 HC's</td><td>CDR2 HC's</td>
<td>Kabat</td><td>Kabat</td><td>Kabat</td><td>Kabat</td>
<td>Murine</td><td>Murine</td><td>Murine</td><td>Murine</td>
<td>AIYPGNGDSRYTQK</td><td>AIYPGNSDTTYNLK</td><td>YISSGSSTISYADT</td><td>YINPISGYTNYNQK</td>
<td>FKG (sec. With</td><td>FKG (sec. With</td><td>VKG (sec. With</td><td>FKD (sec. With</td>
<td>no. of</td><td>no. of</td><td>no. of</td><td>no. of</td>
<td>ident.:81)</td><td>ident: 130)</td><td>ident.:84)</td><td>ident.:86)</td>
<td>Human</td><td>Human</td><td>Human</td><td>Human</td>
<td>AIYPGNGDSRYTQK</td><td>AIYPGNSDTTYNQK</td><td>YISSGSSTISYADS</td><td>YINPISGYTNYNQK</td>
<td>FQG (sec. With</td><td>EQG (sec. With</td><td>VKG (sec. With</td><td>FQG (sec. With</td>
<td>no. of</td><td>no. of</td><td>no. of</td><td>no. of</td>
<td>ident.:82)</td><td>ident.:83)</td><td>ident.:85)</td><td>ident.:87)</td>
Example 6
Detection and selection of hybridoma
FOLRl-300-19 cells transected with human F0LR1 and KB cells are used in the first and second series of
171
ΙΜΡΐ * ^
MEXICAN INSTITUTE • t LA FROFIEDAD
INDUSTRIAL detections accordingly. The culture supernatants of the hybridomas were selected by flow cytometry for the secretion of monoclonal antibodies that bind to FOLRl positive cells, such as 300-19 cells that express FOLRl or KB cells, but not to FOLRl negative cells, such as untransfected 300-19 cells. 0.1 ml of hybridoma supernatant was incubated for 3 hours with either FOLRl-positive cells or 300-19 non-transfected cells (1 x 10<sup>5</sup> cells per sample) in 0.1 ml of FACS buffer (RPMI-1640 medium supplemented with 2% normal goat serum). The cells were then centrifuged, pelleted, washed, and incubated for 1 hour with 0.1 ml of a PE-conjugated goat anti-mouse IgG antibody (such as obtained from, for example, the Jackson Laboratory, 6 pg / ml in FACS buffer). Cells were spun down, pelleted again, washed with FACS buffer and resuspended in 0.2 ml PBS with 1% formaldehyde. Cell-associated fluorescence was measured using a FACSCalibur flow cytometer with the HTS multiwell sampler or with a FACSArray flow cytometer and analyzed by CellQuest Pro (all from BD Biosciences, San Diego, USA). Positive hybridoma clones were subcloned by limiting dilution. A subclone of each hybridoma, which showed the same reactivity against FOLRl as the cells
172
<img file="MX340437B_D0206.tif" />
<img file="MX340437B_D0207.tif" />
parents by flow cytometry, was chosen for further analysis. Stable subclones were cultured and the isotype of each secreted anti-FOLR1 antibody was identified using commercial isotyping reagents (Roche 1493027). Murine antibodies were purified with protein A from the clarified hybridoma culture media as described above. These antibodies were designated as FR-1 antibodies.
<img file="MX340437B_D0208.tif" />
Example 7
Purification of the murine monoclonal antibody
Antibodies were purified from hybridoma subclone supernatants using standard methods, such as, for example, protein A or G chromatography (HiTrap Protein A or G HP, 1 ml, Amersham Biosciences). Briefly, the supernatant was prepared for chromatography by adding 1/10 of the volume of 1 M Tris / HCl, pH 8.0. The pH adjusted supernatant was filtered through a 0.22 µm filter membrane and loaded onto the equilibrated column with binding buffer (PBS, pH 7.3). The column was washed with binding buffer until a stable baseline without absorbance at 280 nm was obtained.
The antibody was eluted with 0.1M acetic acid buffer containing 0.15M NaCl, pH 2.8, with a flow of 0.5 ml / min. Fractions of approximately 0.25 ml were collected and neutralized by the addition of 1/10 of the volume
173 1 M Tris-HCI, pH 8.0. The maximum fraction (s) were dialyzed overnight twice against PBS lx and filter sterilized through a 0.2 pm filter membrane.
The purified antibody was quantitated by the absorbance at A<sub>28</sub>or·
IMPI
MEXICAN INSTITUTE BE LA PROTIEDAP INBUSTRML
<img file="MX340437B_D0209.tif" />
Example 8
Binding characterization, by flow cytometry The binding specificity was verified by flow cytometry using purified antibodies. FACS histograms demonstrating the binding of anti-FOLRl antibodies to 300-19 FOLRl expressing cells and the absence of binding to parental 300-19 cells are shown in Figure 4. Each antibody was incubated for 3 hours with the 300-19 cells expressing FOLRl or with untransfected 30019 cells (lxlO<sup>5</sup> cells per sample) in 0.1 ml of FACS buffer (RPMI-1640 medium supplemented with 2% normal goat serum). The cells were then pelleted, washed, and incubated for 1 hour with 0.1 ml of a FITC-conjugated goat anti-mouse IgG antibody (such as those obtainable from, for example, the Jackson Laboratory, 6 pg / ml in FACS buffer). Cells were pelleted again, washed with FACS buffer and resuspended in 200 µl of PBS with 1% formaldehyde. Samples were obtained using a FACSCalibur flow cytometer with the sampler
174
IMPI
MEXICAN INSTITUTE OF EA INDUSTRIAL PROPERTY
<img file="MX340437B_D0210.tif" />
HTS multiwells or a FACSArray flow cytometer and analyzed by CellQuest Pro (all from BD Biosciences, San Diego, USA). FACS histograms of anti-FOLR1 antibodies showed a change in fluorescence, while parental 300-19 cells did not. Furthermore, no significant fluorescence change was detected when any of the cell lines were incubated only with a FITC-conjugated goat anti-human IgG antibody alone.
Example 9
Cloning and sequencing of the VL and VH regions of muFRl-21 Total cellular RNA was prepared from 5xl0<sup>6 </sup>hybridoma cells by using a RNeasy kit (QIAGEN) according to the manufacturer's protocol. The cDNA was subsequently synthesized from total RNA using the cDNA synthesis kit, SuperScript II (Invitrogen). The procedure for the first round of degenerate PCR reaction on hybridoma cell-derived cDNA was based on the methods described in Wang et al. ((2000) J Immunol Methods. January 13; 233 (1-2): 167-77 ) and Co et al., ((1992) J Immunol. fifteen February; 148 (4): 1149-54). VH sequences were amplified by PCR using the following degenerate primers: EcoMHl
CTTCCGGAATTCSARGTNMAGCTGSAGSAGTC (sec. With ID #: 50) EcoMH2 CTTCCGGAATTCSARGTNMAGCTGSAGSAGTCWGG (sec. With no.
Ident .: 51) and BamlgGl GGAGGATCCATAGACAGATGGGGGTGTCGTTTTGGC
175
IMPI
MEXICAN INSTITUTE OF LA FRORIEDAD
INDUSTRIAL
<img file="MX340437B_D0211.tif" />
(section with ID number: 52). VL sequences were amplified by PCR using the following degenerate primers: SacIMK GGAGCTCGAYATTGTGMTSACMCARWCTMCA (SEQ ID NO: 53) and HindKL
TATAGAGCTCAAGCTTGGATGGTGGGAAGATGGATACAGTTGGTGC (sec. With no.
Ident .: 54). (Mixed bases are defined as follows: N = G + A + T + C, S = G + C, Y = C + T, M = A + C, R = A + G, W = A + T).
The PCR reaction mixtures were run on a 1% low-fusion agarose gel, the 300-400 bp bands were cut, purified using Zymo DNA mini-columns, and sent to Agencourt Biosciences for sequencing. The respective 5'and 3 'PCR primers were used as sequencing primers to generate the variable region cDNA from both directions. The amino acid sequences of the VH and VL regions were obtained by translating the DNA resulting from the sequencing with VectorNTI software.
To identify artifacts from sequencing with the 5 'end primer in preliminary variable region cDNA sequences, the NCBI IgBlast site (www.ncbi.nlm.nih.gov/igblast/) was used to search for the sequences from the mouse germline from which the antibody sequences were derived. The clean variable region sequences were combined with the NCBI reference sequences for the constant regions of
176
ΙΜΡΙ
INSTITUTO MEXICANO DE LA MONEDAD INDUSTRIAL specific antibodies to assemble length sequences
<img file="MX340437B_D0212.tif" />
of the murine antibody. The molecular weight of the expected Frl-21 light and heavy murine chains were calculated and compared with the mass measured by liquid chromatography / mass spectrophotometric analysis (LC / MS). The murine FR1-21 heavy chain matched the measured mass, but for the light chain a sequencing effort of sequencing was required to determine the sequence of the 5 'end. The CD37-lLCleadl PCR primer (ttttgaattcgccaccatgaagtttccttctcaacttct) was designed to align to the germline sequence linked to the murine antibody leader so that this new PCR reaction would yield a complete variable region cDNA sequence unchanged by the primers . PCR reactions, band purifications, and sequencing were performed as described above, and the entire new sequence encoded a light chain that matched the mass of a Frl-21 light chain as measured by LC / MS.
Example 10
Expression of reference antibodies The amino acid sequence of the Morphotech anti-FOLRl antibody, MorAb-003 (Farletuzumab), was obtained from the list of the International Nonproprietary Names for pharmaceutical substances (INNs) of the World Health Organization (WHO) , and codons were optimized and synthesized
177
IMPI
MEXICAN INSTmjTO Say THE INWJSTRIAL PROPERTY
<img file="MX340437B_D0213.tif" />
using Blue Heron Biotechnology. The sequence of the light chain variable region is flanked by the sites for the restriction enzymes EcoRI and BsiWI and the sequence of the variable region of a heavy chain flanked by the sites for the restriction enzyme HindIII and Apal for cloning into the Frame of the respective constant sequences in single chain plasmids for expression in mammals. Cloning, expression and purification were carried out as described for the humanized Movl9 and Frl-21 cited above.
Example 11
HuMovl9 ADCC Activity
A lactate dehydrogenase (LDH) release assay was used to measure antibody-dependent cell-mediated cytotoxicity (ADCC) of tumor cell lines by using freshly isolated human natural killer (NK) cells as effector cells (eg. , Shields, J. Biol. Chem., 276 (9): 6591-6604 (2001)). NK cells were first isolated from human blood from a normal donor (Research Blood Components, Inc., Brighton, MA), using a modified protocol for the NK Isoiation Kit II (Miltenyi Biotech, 130-091. -152). The blood was diluted twice with PBS lx. 25 ml of diluted blood were carefully placed on 25 ml of Ficoll Pay in a 50 ml conical tube and
ΙΜΡΙ
178
MEXICAN INSTITUTE OF INDUSTRIAL MONETTY
<img file="MX340437B_D0214.tif" />
centrifuged at 400 g for 45 min at RT. Peripheral blood mononuclear cells (CMSP) were obtained from the interface, transferred to a new 50 ml conical tube, and washed once with PBS lx. Cells were resuspended in 2 ml of NK isolation buffer (1 x PBS, 0.5% BSA, 2mM EDTA), and 500 µΐ of the antibody-biotin cocktail was added to the cell suspension. The antibody-biotin cocktail contains biotinylated antibodies that bind to lymphocytes, except for NK cells, resulting in negative selection for NK cells. The mixture was incubated at 4 ° C for 10 minutes and then 1.5 ml of NK isolation buffer and 1 ml of anti-biotin microbeads were added. The antibody and cell mixture was incubated for another 15 minutes at 4 ° C. The cells were then washed once with 50 ml of NK isolation buffer and resuspended in 3 ml of NK isolation buffer. Then, a MACS LS column was mounted in the autoMACS separator (Miltenyi Biotech) and pre-washed with 3 ml of NK isolation buffer. The cell suspension was automatically applied to the column, washed and the effluent fraction with the unlabelled NK cells was collected in a new 50 ml conical tube. The resulting NK cells were seeded in 30 ml of complete RPMI medium (RPMI-1640 supplemented with 5% fetal bovine serum, 1% penicillin streptomycin, 1 mM HEPES, 1 mM sodium pyruvate, 1%
179
ΙΜΡΙ
MEXICAN INSTITUTE Dt LA FROFIEDAD INDUSTRIAL
<img file="MX340437B_D0215.tif" />
non-essential amino acid solution 100X MEM) overnight. Subsequent analysis and all dilutions were performed in RHBP medium (RPMI 1640 medium supplemented with 20 mM HEPES, pH 7.4, 0.1% BSA and 1% streptomycin penicillin). Various concentrations of antibodies in RHBP medium were distributed in duplicate in 50 µΐ aliquots / well in a 96 well round bottom plate. Target cells were resuspended at 10<sup>6</sup> cells / ml in RHBP medium and 100 µΐ / well was added to each well containing dilutions of the antibody. The plate containing the target cells and the antibody dilutions was incubated for 30 min at 37 ° C. NK cells were added to the wells containing the target cells at 50 µl / well. The typical ratio was approximately 1 target cell to 3-4 NK cells. At least the following controls were established for each experiment: NK cells alone, target cells alone (spontaneous LDH release), target cells with NK cells (antibody-independent LDH release), target cells with 10% Triton X-100 (maximum release of LDH). The mixtures were incubated at 37 ° C for 4 hours to allow cell lysis. The plates were spun for 10 minutes at 1200 rpm, and 100 µΐ of the supernatant was carefully transferred to a new 96-well flat-bottom plate. The LDH reaction mixture (100 µΐ / well) of the
180
IMPI
MEXICAN INSTITUTE OF TROPIEDAD
INOUSTRIAL
<img file="MX340437B_D0216.tif" />
Cytotoxicity Detection Kit (Roche 1 644 793) was added to each well and incubated at room temperature for 5 to 30 min. The optical density of the samples was measured at 490 nm (OD490). The percentage of specific lysis of each sample was determined using the following formula: percentage of specific lysis = (value of the sample spontaneous release) / (maximum release - spontaneous release) * 100.
Incubation with huMovl9 led to good activity
ADCC against IGROV-1 cells in the presence of NK effector cells. ADCC activity in IGROV-1 cells was compared for huMovl9, huFR-1-21, Mor003 and chTKl (isotype control) (Figure 6). Treatment with 0.9 ng / ml huMovl9 resulted in approximately 30% lysis of IGROV1 cells, similar to the activity observed with the other anti-FOLR1 antibodies. ADCC activity for huMovl9 had a CD<sub>5</sub>or 0.20 ng / ml, huFr-1-21 had an EC50 of 0.11 ng / ml, Mor003 of 0.16 ng / ml and chTKl showed no activity against IGROV-1 cells.
Example 12
Preparation of anti-FOLR1 immunoconjugates
Preparation of huM0V19vl.6-sulfO-SPDB-DM4
The exemplary 2-sulfo-SPDB ligand was dissolved in DMA. The huMOV19vl.6 antibody was incubated at 8 mg / ml with a 12-fold molar excess of the 2-sulfo-SPDB ligand for
181
<img file="MX340437B_D0217.tif" />
<img file="MX340437B_D0218.tif" />
approximately 2 hours at 25 ° C at pH 7.-5
<img file="MX340437B_D0219.tif" />
Reaction was purified by using a Sephadex ™ G25F column equilibrated with 50mM potassium phosphate buffer containing 50mM NaCl, 2mM EDTA, pH 6.5. Maytansinoid DM4 was dissolved in dimethylacetamide (DMA, final concentration 5%) and a 1.7-fold molar excess compared to the ligand was added dropwise to the sulfo-SPDB-modified antibody. The reaction mixture was adjusted to pH 7.5 with 1m HEPES buffer. After incubation overnight at room temperature, the conjugated antibody was purified by chromatography on Sephadex ™ G25F equilibrated with 10mM histidine, 250mM glycine, 1% sucrose, pH 5.5, the number of bound DM4 molecules per molecule. Antibody assay was determined using the previously reported extinction coefficients of the antibody and maytansinoid (Widdison, WC, et al., J Med Chem, 49: 4392-4408 (2006)). The percentage of total free maytansinoid species was determined as described above. Conjugates with 3.5-4 DM4 molecules per huMovl9vl.6 antibody were obtained with <1% present as unconjugated maytansinoid.
Preparation of huM0V19vl.6-SPP-DM1
Exemplary Nsuccinimidyl 4- (2-pyridyldithio) pentanoate ligand (SPP) was dissolved in ethanol. Antibody
182
IMPI
THE MEXICAN INSTITUTE OF INDUSTRIAL PROPERTY huMOV19vl.6 was incubated at 8 mg / ml with a molar excess of 6.5 a
<img file="MX340437B_D0220.tif" />
times of the SPP ligand for approximately 2 hours at room temperature in 50 mM potassium phosphate buffer (pH 6.5) containing 50 mM NaCl, 2 mM EDTA, and 5% ethanol. The modified SPP antibody was diluted twice in PBS, pH 6.5, and modified, with a 1.5-fold molar excess of maytansinoid DM1 by adding a concentrated solution (15-30 mM) of DM1 in dimethylacetamide (DMA). The DMA concentration was adjusted to 5% and after incubation overnight at room temperature, the conjugated antibody was purified by chromatography on Sephadex ™ G25F equilibrated 10mM, 250mM glycine, 1% sucrose pH 5.5. The number of bound DM1 molecules per antibody molecule was determined by using the extinction coefficients of the antibody and DM1 reported previously (Liu et al., Proc. Nati. Acad. Sci. United States, 93, 8618-8623 ( nineteen ninety six) ) . The percentage of free maytansinoid present after the conjugation reaction was determined by injecting 20 to 50 pg of the conjugate on a HiSepTM column equilibrated in 25% acetonitrile in 100mM ammonium acetate buffer, pH 7.0 and eluted in acetonitrile. The peak area of the total free maytansinoid species (eluted in the gradient and identified by comparison of the elution time with known standards) was measured with an absorbance detector
183
IMPI Mexican Institute Dt LA Μ · ΜΕ · ΑΒ INDUSTRY ·
<img file="MX340437B_D0221.tif" />
established at a wavelength of 252 nir and sti (JOllipcíbo with the area of peaks related to bound maytansinoid (eluted at the conjugated peak in the flow column through fractions) to calculate the percentage of the total free maytansinoid species. Those conjugated with 3.5-4 DM1 molecules by huMOV19vl.6 were obtained with <1% present as unconjugated maytansinoid.
Preparation of huMOV19vl.6 SPDB-DM4
The exemplary N-succinimidyl 4- (2-pyridyldithio) butanoate ligand (SPDB) was dissolved in ethanol. The huMOV19vl.6 antibody was incubated at 8 mg / ml with a 5.5-5 fold molar excess of the SPDB ligand for approximately 2 hours at room temperature in 50 mM Potassium Phosphate Buffer (pH 6.5) containing 50 mM NaCl, EDTA 2 mM, and 3% ethanol. The SPDB-modified antibody was diluted twice in PBS, pH 6.5, and modified, with a 1.5-fold molar excess of the maytansinoid DM4 by the addition of a concentrated solution (15-30 mM) of DM4 in dimethylacetamide (DMA). After incubation overnight at room temperature, the conjugated antibody was purified by chromatography on Sephadex ™ G25F equilibrated with 10mM histidine, 250mM glycine, 1% sucrose pH 5.5. The number of coupled DM4 molecules per antibody molecule was determined using the extinction coefficients for the antibody and
184
IMPI
MEXICAN INSTITUTE OF THE INDUSTRIAL ERORIEDAIJ
<img file="MX340437B_D0222.tif" />
previously reported maytansinoids (Widdison, WC, et al., J Med Chem, 49: 4392-4408 (2006)). The percentage of total free maytansinoid species was determined as described above. Conjugates with 3.5-4 DM4 molecules per huMOV19vl.6 antibody were obtained with <1% present as unconjugated maytansinoid.
Preparation of huM0V19vl.0-3-sulfo-mal-DM4
The NHS-3-sulfo-mal ligand and DM4 were separately dissolved in DMA. The ligand and thiol DM4 were mixed in a DMA solution containing 40% 200 mM succinate buffer, 2 mM EDTA, pH5.0 to give a molar ratio of DM4 to ligand of 1.6: 1 and a final concentration of DM4 equal to 10 mm. The mixture was reacted for 2 hours at 25C.
Without purification, the reaction mixture was added such that an equivalent of 9.6 molar excess of the ligand to the antibody was added to a solution of the antibody huMOV19vl.O in phosphate buffer (pH 7.5) under conditions of final conjugation of the 4mg / ml antibody, 90% phosphate buffer / 10% DMA pH 7.5 (v / v). After incubation overnight at room temperature, the conjugation mixture was purified by chromatography on Sephadex G25 equilibrated in PBS pH 7.5. The huMOV19vl.0-3-sulfo-mal-DM4 was then dialyzed in a buffer containing 9.55 mM phosphate, 139.6 mM NaCl, pH6.5. The number of DM4 molecules
185
ΙΜΡΙ
INSTITUTO MEXICANO DE LA rdrieiiai industrial coupled by antibody molecule was determined using the extinction coefficients of the antibody and maytansinoid previously reported (Widdison, WC, et al., J Med Chem, 49: 4392-4408 (2006)). The percentage of the total of the free maytansinoid species was determined as previously described. Conjugates with 3.5-4 DM4 molecules per huMOV19vl.O antibody were obtained with <1% present as unconjugated maytansinoid.
<img file="MX340437B_D0223.tif" />
Preparation of huM0V19vl.0-SMCC-DM1
The NHS-sulfo-SMCC ligand and DM1 were separately dissolved in the DMA. The thiol ligand and DM1 were mixed in a DMA solution containing 40% 200 mM succinate buffer, 2 mM EDTA, pH5.0 to give a 1.2: 1 DM1 to ligand molar ratio and a final DM1 concentration equal at 3.75 mM. The mixture was reacted for 75 minutes at
20 ° C. Without purification, the reaction mixture was added such that an equivalent of 6.4 molar excess of the ligand to antibody was added to a solution of the antibody huMOV19vl.O in phosphate buffer (pH 7.5) under final conjugation conditions of 4mg / ml antibody , 88% 50 mM Potassium Phosphate, 50 mM NaCl, 2 mM EDTA, pH 7.5 / 12% DMA pH 7.5 (v / v). After 2 hours incubation at 20 ° C, the conjugation mixture was purified by chromatography on Sephadex G25 equilibrated in PBS pH 7.5. HuM0V19vl.0-SMCC186
MEXICAN INSTITUTE OF LA MONEDAD
INBUSTRIAL
DM1 was then dialyzed in a buffer containing 250mM glycine, 10mM histidine pH 5.5. The number of coupled DM1 molecules per antibody molecule was determined using the previously reported antibody and maytansinoid extinction coefficients (Widdison, WC, et al., J Med Chem, 49: 4392-4408 (2006)). The percentage of total free maytansinoid species was determined as described above. Conjugates with 3.5-4 DM1 molecules per huMOV19vl.O antibody were obtained with <2.8% present as unconjugated maytansinoid.
Preparation of huM0V19vl.0-PEG4-mal-DMl
The NHS-PEG4-mal-DMl step 1 reagent was dissolved in the DMA. The huMovl9vl.O antibody was incubated at 5mg / ml with a 5.7-fold molar excess of NHS-PEG4-mal-DMl overnight at 25 ° C in 50mM KPi, 50mM NaCI, 2mM EDTA, pH 7.5 and 10 % of DMA by volume. The reaction mixture was purified by Sephadex G25 column equilibrated in PBS pH 7.5. HuM0V19vl.0-PEG4-mal-DMl was dialyzed in a buffer containing 250 mM glycine, 10 mM histidine pH 5.5. The number of coupled DM1 molecules per antibody molecule was determined using the extinction coefficients of the antibody and maytansinoid previously reported (Widdison, WC, et al., J Med Chem, 49: 4392187
4408 (2006))
The percentage of the tot
<img file="MX340437B_D0224.tif" />
Free maytansinoid was determined as described above. Conjugates with 3.5-4 DM1 molecules per huMOV19vl.O antibody were obtained with <1.1% present as unconjugated maytansinoid.
Example 13
Binding Affinity of Antibodies and Conjugates The binding affinity of anti-FOLR1 antibodies and their SPDB-DM4, PEG4Mal-DM4, SMCC-DM1, or anti-FOLRlsulfO-SPDB-DM4 conjugates were analyzed by flow cytometry. SKOV3 cells expressing FOLR1 were incubated with different concentrations of anti-FOLR1 antibodies or their conjugates and processed as described above for flow cytometric analysis. Data analysis was performed using CellQuest Pro (BD Biosciences, San Diego, United States) and for each sample the mean fluorescence intensity for FL1 (IFM) was exported and plotted against the concentration of the antibodies on a chart semi-logarithmic. A dose-response curve was generated by nonlinear regression and the value of the dissociation equilibrium constant (K<sub>d</sub>) Apparent of the samples examined for binding to SKOV3 cells was calculated by using
GraphPad Prism v4 (GraphPad software, San Diego, CA) and presented in Figure 5. The results demonstrate that conjugation to either DM1 or DM4 through either
IMPI Mexican Institute of INDUSTRIAL PROPERTY
<img file="MX340437B_D0225.tif" />
the ligands that are affinity of none huMovl9).
188 used, of which the antibodies do not noticeably alter (for example,
Example 14
In Vitro Cytotoxicity Assays The ability of exemplary muFRl-9, muFRl-13, muFRl-22, muFRl-23, huFRl-23, muFRl-21, and huFRl-21 conjugates to inhibit cell growth was measured by use of in vitro cytotoxicity assays by the method described in Kovtun YV et al. (Cancer Res 66 ·. 3214-3221 (2006)). A PEG4-mal-DM4 conjugate in various concentrations was added to KB cells expressing FOLR1 in a 96-well plate at 1,000 cells per well in 100 µΐ of complete RPMI medium (RPMI-1640, 10% fetal bovine serum, 2mM glutamine, 1% gentamicin, all Invitrogen reagents). Antibodies and conjugates were diluted in RPMI complete medium with a 3-fold dilution series and 100 µΐ per well was added. The final concentration was typically in the range of 3xl0<sup>8</sup> M at 4.6xl0 '<sup>12</sup> M. Control wells containing cells and medium, but lacking conjugates, and wells with medium alone, were included in each assay plate. The plates were incubated for four to six days at 37 ° C in a humidified atmosphere with 5% CO2. WST-8 reagent, 10% v / v (Dojindo Molecular Technologies, Gaithersburg, MD, United
189
IMPI
MEXICAN INSTITUTE OF THE INDUSTRIAL FROMIDaD
<img file="MX340437B_D0226.tif" />
States), was added to the wells and the plates were incubated at 37 ° C for 2-6 h. WST-8 was reduced by dehydrogenases in living cells to an orange (maximum formazan product that is soluble in tissue culture medium. The amount of formazan produced is directly proportional to the number of living cells. The plates were analyzed by Absorbance measurement at 450nm (A450) and 650nm (A650) in a multiwell plate reader. First, the background of the opalescence of the cells (Aéso) was subtracted from A650. The result of A *<sub>450</sub> it was used to determine the fraction of the surviving cells. Absorbance background Α *<sub>45</sub>ο was that of the wells with WST-8 medium only. The fraction of survivors was calculated as follows: Viability percentage = 100 x (A *<sub>450</sub> sample treated - bottom A *<sub>450</sub>) / (TO*<sub>45</sub>or untreated sample - bottom A *<sub>45</sub>o). Surviving fraction values were plotted against antibody or conjugate concentration on a semi-log graph for each treatment. From these data, IC50 values were determined using GraphPad Prism v4 (GraphPad software, San Diego, CA) and presented in Figure 5. The results shown in Figure 5 demonstrate that all conjugations are equally active in their cytotoxic potency against KB cells expressing FOLR1. In order to verify the specificity of the anti-FOLRl190 conjugates
<img file="MX340437B_D0227.tif" />
<img file="MX340437B_D0228.tif" />
maytansinoid towards FOLRl, his activities
<img file="MX340437B_D0229.tif" />
presence of excess unconjugated antibodies against KB cells. The addition of an excess of unconjugated competition antibodies to the conjugates suppressed their cytotoxicity, as seen in Figure 7. These data indicate that the conjugates kill KB cells in an antigen-dependent manner. Additional data demonstrated that huMovl9-SPDBDM4 induced cell cycle arrest in the G2 / M phase in KB cells in in vitro assays.
Example 15
Efficacy, in vivo, of the conjugates huMovl9-PEG4Mal-DM4 and huMovl9-SPDB-DM4 compared to similar conjugates that are not targeted in a xenograft KB model
The huMovl9-SPDB-DM4 cleavable conjugate that is targeted to FOLRl compared to the non-targeted huC242-SPDB-DM4 conjugate, and the huMovl9-PEG4-MalDM4 non-cleaved conjugate that was not targeted were tested by using an established model of KB cell xenotransplantation implanted subcutaneously in SCID mice. Mice were randomized by body weight in treatment groups and treated individually (SPDB conjugates) on day 3 after cell inoculation, or three times per week on days 3, 10, and 17 after inoculating cells with 5 and 10 mg / kg of a conjugate, respectively. Tumor volume
191
ΙΜΡΙ
MEXICAN INSTITUTE OE LA MONEDA · INDUSTRIAL
<img file="MX340437B_D0230.tif" />
The mean of the different treatment groups was depicted in Figure 8. Treatments with either huMovl9-SPDBDM4, or huMovl9-PEG4Mal-DM4 resulted in a decrease in the average tumor volume compared to the PBS control, while the Treatments with any of the respective conjugates that are not directed, did not produce any significant effect.
Example 16
Efficacy., In vivo, of anti-FOLRl-PEG4Mal-DM4 conjugates in a KB xenograft model
The PEG4Mal-DM4 conjugates of the exemplary anti-FOLRl antibodies huMovl9, muFR-1-9, muFR-1-13, muFR-1-22, muFR-123, and huFR-1-21 were tested using a template. established of KB cell xenografts implanted subcutaneously in SCID mice. Mice were randomized
<td>for him</td><td>weight</td><td>body in the</td><td>groups</td><td>treatment and</td><td>I know</td>
<td>they tried</td><td>a</td><td>time on day 3</td><td>then</td><td>inoculation</td><td>of</td>
<td>cells</td><td>with</td><td>10 mg / kg of one</td><td>of the</td><td colspan="2">enumerated conjugates</td>
<td colspan="2">previously</td><td>or only with PBS.</td><td colspan="2">Previously demonstrated</td><td>than</td>
HuMovl9-PEG4Mal-DM4 is similar to the PEG4Mal-DM4 conjugate of muFR-1-9, muFR-1-13, muFR-1-22, muFR-1-23, and huFR-1-21 in their cytotoxic potency in vitro. HuMovl9-PEG4Mal-DM4 and huFR-l-21-PEG4Mal-DM4 were significantly more potent in vivo than any of the other conjugates, resulting in a more pronounced decrease in tumor volume.
192
IΡI
MEXICAN INSTITUTE
OF the average INDUSTRIAL PROPERTY (Figures 9 and 10). Potency was also shown to be dose dependent (Figure 11) and ligand choice also plays a role (Figures 12 and 13).
Example 17
Efficacy, in vivo, of the anti-FOLRl-sulfo-SPDBDM4 conjugates in a xenograft model
The anti-FOLRl huMovl9-sulfo-SPDB-DM4 conjugates were tested on three ovarian serous adenocarcinoma xenografts: OVCAR-3, IGROV-1, and OV-90. Each of these tumor xenografts showed FOLR1 expression levels comparable to the tumors of the patients when measured by a calibrated immunohistochemical staining (IHC) method on paraffin-embedded and formalin-fixed sections. Mice bearing established subcutaneous tumor xenograft (approximately 100 mm<sup>3</sup>) were treated with a single intravenous injection of the conjugate huMovl9-sulfo-SPDB-DM4 at 1.2, 2.5, and 5.0 mg / kg (based on antibody concentration; Figures 14-16 show the concentration of the conjugated maytansinoid in pg / kg ). The conjugate was activated in the three models evaluated. In the OVCAR-3 xenograft, the minimum effective dose (SMD) was 1.2 mg / kg (Figure 14). The highest dose levels were highly active, leading to complete regressions (RC) in 4/6 and 2/6 mice in the 2.5 and 5.0 mg / kg treatment groups, respectively. Conjugate treatment
193
<img file="MX340437B_D0231.tif" />
<img file="MX340437B_D0232.tif" />
resulted in strong antitumor activity
<img file="MX340437B_D0233.tif" />
of IGROV-1 and OV-90 xenograft, with a DME of 2.5 mg / kg, with a single injection (Figures 15 and 16). These data demonstrate the strong antitumor activity of the huMovl9sulfo-SPDB-DM4 conjugates against ovarian tumor xenografts with FOLR1 expression levels comparable to patient tumors.
Example 18
Effect of couplers on the efficacy of immunoconjugates
The anti-FOLRl antibody huMovl9 was coupled to DM1 or DM4 via the SPP, SPDB, or sulfo SPDB cleavage containing couplings, or by the non-cleavable ligand SMCC. The in vitro cytotoxic activity of these conjugates on KB, IGROV-1 and JEG-3 cell lines was examined. FACS analysis indicated that KB cells (cervix) had> 2,000,000 antibody binding sites per cell. IGROV-1 cells (ovary) had 260,000 binding sites per cell, and JEG-3 cells (choriocarcinoma) had 40,000 binding sites per cell.
The results of in vitro cytotoxicity are summarized in
Table 2 below. The cleavable conjugates exhibited markedly greater in vitro activities compared to SMCC conjugates.
194
<img file="MX340437B_D0234.tif" />
IMPIféfe * <sup>, nst</sup>df7? íí "<sup>, canü</sup> i -.-. T · “Λΐ'-Ληνί industrial
Table 2: Effect of ligands on cytoxicity in vitro.
immunoco
<img file="MX340437B_D0235.tif" />
<td rowspan="2">Cells</td><td colspan="4">IC50, nM (n = 3), based- Ab</td>
<td>SPP-DM1</td><td>SPDB-DM4</td><td>Sulfo-SPDM- DM4</td><td>SMCC-DM1</td>
<td>KB</td><td> 0.1</td><td> 0.1</td><td> 0.1</td><td> 0.1</td>
<td>Igrov 1</td><td> 0.1</td><td> 0.1</td><td> 0.3</td><td> 1.0</td>
<td>Jeg3</td><td> 0.2</td><td> 0.2</td><td> 3.0</td><td> 20</td>
The in vivo activities of the conjugates in the KB and OVCAR-3-positive models for FOLR1 were also tested. The results shown in Figure 17 demonstrate that the SPDB-DM4 and sulfO-SPDB-DM4 cleavable conjugates are more potent than the non-cleavable SMCC-DM1 conjugate in vivo. Furthermore, among the cleavable conjugates, the SPP-DM1 conjugate was less active than either the SPDB-DM4 or sulfO-SPDB-DM4 conjugates, in both xenograft models (Figures 18A-18B). The last two conjugates were equally active against KB tumors, while the sulfo-SPDBDM4 conjugate was more active against the OVCAR-3 model. The data obtained using the OVCAR-3 model is summarized in the
Table 3 below.
195
<img file="MX340437B_D0236.tif" />
ΙΜΡΙ
INDUSTRIAL
<img file="MX340437B_D0237.tif" />
Table 3: Effect of Immunoconjugated Ligands on Tumor Size in OVCAR-3 Xenograft Model.
<td>Conjugate</td><td>Tumor on control (%)</td><td>Answer partial</td><td>Answer complete</td><td>Answer</td>
<td>SPP-DM1</td><td> 54</td><td> 0/6</td><td> 0/6</td><td>Inactive</td>
<td>SPDB-DM4</td><td> 9</td><td> 6/6</td><td> 1/6</td><td>Very active</td>
<td>Sulfo-DPDB-</td><td> 0</td><td> 6/6</td><td> 4/6</td><td>Very active</td>
<td>DM4</td><td></td><td></td><td></td><td></td>
These data demonstrate that immunoconjugates containing a cleavable ligand show greater efficacy both in vitro and in vivo, and anti-FOLR1 immunoconjugates containing sulfo-SPDB are highly active in tumor models.
Example 19
Efficacy in vitro and in vivo of the SMCC-DMl conjugates of the huFRl antibody
Anti-FOLRl huFRl-48, huFRl-49, huFRl-57, and huFRl-65 were conjugated to the SMCC and DM1 ligand and, as described above, the effects on KB cells were analyzed in vivo using the xenograft models previously described. Although each of the antibodies showed similar efficacy in the KB cell model, the
196 Immunoco samples huFRl-48, huFRl-49, hnFR- ^ T and huFRl-65 showed variable but significant efficacy in vivo at a dose of 200 pg / kg in a xenograft model system (Table 4 and Figure 19).
ÍMPI “la frofieoac industrial
<img file="MX340437B_D0238.tif" />
Table 4: Efficacy in vitro and in vivo of the SMCCDM1 conjugates of the huFRl antibody
<td>Clone #</td><td>Affinity</td><td>Activity of</td><td>Activity of</td>
<td></td><td>apparent</td><td>huAb-smcc-DMl</td><td>huAb-smcc-DMl</td>
<td></td><td>(nM)</td><td>in KB in</td><td>in vivo</td>
<td></td><td></td><td>vitro (nM)</td><td></td>
<td>huFRl-48</td><td> 0.13</td><td> 0.05</td><td> +</td>
<td>huFRl-49</td><td> 0.08</td><td> 0.10</td><td> +</td>
<td>huFRl-57</td><td> 0.14</td><td> 0.10</td><td> +</td>
<td>huFRl-65</td><td> 0.15</td><td> 0.10</td><td> +</td>
<td>huMovl9</td><td> 0.06</td><td> 0.10</td><td> ++</td>
All publications, patents, patent applications, Internet sites, and sequence access numbers / databases (including polynucleotide and polypeptide sequences) cited herein are incorporated by reference in their entirety for all purposes, in the same extent that each individual publication, patent, patent application, website,
197 o access number / sprnenrías databases is indicated specifically and individually to be incorporated as a reference.
It is noted that in relation to this date, the best method known by the applicant to put the aforementioned invention into practice is the one that is clear from the present description of the invention.
198
Contents215
339 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32 Sheet 33 Sheet 34 Sheet 35 Sheet 36 Sheet 37 Sheet 38 Sheet 39 Sheet 40 Sheet 41 Sheet 42 Sheet 43 Sheet 44 Sheet 45 Sheet 46 Sheet 47 Sheet 48 Sheet 49 Sheet 50 Sheet 51 Sheet 52 Sheet 53 Sheet 54 Sheet 55 Sheet 56 Sheet 57 Sheet 58 Sheet 59 Sheet 60 Sheet 61 Sheet 62 Sheet 63 Sheet 64 Sheet 65 Sheet 66 Sheet 67 Sheet 68 Sheet 69 Sheet 70 Sheet 71 Sheet 72 Sheet 73 Sheet 74 Sheet 75 Sheet 76 Sheet 77 Sheet 78 Sheet 79 Sheet 80 Sheet 81 Sheet 82 Sheet 83 Sheet 84 Sheet 85 Sheet 86 Sheet 87 Sheet 88 Sheet 89 Sheet 90 Sheet 91 Sheet 92 Sheet 93 Sheet 94 Sheet 95 Sheet 96 Sheet 97 Sheet 98 Sheet 99 Sheet 100 Sheet 101 Sheet 102 Sheet 103 Sheet 104 Sheet 105 Sheet 106 Sheet 107 Sheet 108 Sheet 109 Sheet 110 Sheet 111 Sheet 112 Sheet 113 Sheet 114 Sheet 115 Sheet 116 Sheet 117 Sheet 118 Sheet 119 Sheet 120 Sheet 121 Sheet 122 Sheet 123 Sheet 124 Sheet 125 Sheet 126 Sheet 127 Sheet 128 Sheet 129 Sheet 130 Sheet 131 Sheet 132 Sheet 133 Sheet 134 Sheet 135 Sheet 136 Sheet 137 Sheet 138 Sheet 139 Sheet 140 Sheet 141 Sheet 142 Sheet 143 Sheet 144 Sheet 145 Sheet 146 Sheet 147 Sheet 148 Sheet 149 Sheet 150 Sheet 151 Sheet 152 Sheet 153 Sheet 154 Sheet 155 Sheet 156 Sheet 157 Sheet 158 Sheet 159 Sheet 160 Sheet 161 Sheet 162 Sheet 163 Sheet 164 Sheet 165 Sheet 166 Sheet 167 Sheet 168 Sheet 169 Sheet 170 Sheet 171 Sheet 172 Sheet 173 Sheet 174 Sheet 175 Sheet 176 Sheet 177 Sheet 178 Sheet 179 Sheet 180 Sheet 181 Sheet 182 Sheet 183 Sheet 184 Sheet 185 Sheet 186 Sheet 187 Sheet 188 Sheet 189 Sheet 190 Sheet 191 Sheet 192 Sheet 193 Sheet 194 Sheet 195 Sheet 196 Sheet 197 Sheet 198 Sheet 199 Sheet 200 Sheet 201 Sheet 202 Sheet 203 Sheet 204 Sheet 205 Sheet 206 Sheet 207 Sheet 208 Sheet 209 Sheet 210 Sheet 211 Sheet 212 Sheet 213 Sheet 214 Sheet 215 Sheet 216 Sheet 217 Sheet 218 Sheet 219 Sheet 220 Sheet 221 Sheet 222 Sheet 223 Sheet 224 Sheet 225 Sheet 226 Sheet 227 Sheet 228 Sheet 229 Sheet 230 Sheet 231 Sheet 232 Sheet 233 Sheet 234 Sheet 235 Sheet 236 Sheet 237 Sheet 238 Sheet 239 Sheet 240 Sheet 241 Sheet 242 Sheet 243 Sheet 244 Sheet 245 Sheet 246 Sheet 247 Sheet 248 Sheet 249 Sheet 250 Sheet 251 Sheet 252 Sheet 253 Sheet 254 Sheet 255 Sheet 256 Sheet 257 Sheet 258 Sheet 259 Sheet 260 Sheet 261 Sheet 262 Sheet 263 Sheet 264 Sheet 265 Sheet 266 Sheet 267 Sheet 268 Sheet 269 Sheet 270 Sheet 271 Sheet 272 Sheet 273 Sheet 274 Sheet 275 Sheet 276 Sheet 277 Sheet 278 Sheet 279 Sheet 280 Sheet 281 Sheet 282 Sheet 283 Sheet 284 Sheet 285 Sheet 286 Sheet 287 Sheet 288 Sheet 289 Sheet 290 Sheet 291 Sheet 292 Sheet 293 Sheet 294 Sheet 295 Sheet 296 Sheet 297 Sheet 298 Sheet 299 Sheet 300 Sheet 301 Sheet 302 Sheet 303 Sheet 304 Sheet 305 Sheet 306 Sheet 307 Sheet 308 Sheet 309 Sheet 310 Sheet 311 Sheet 312 Sheet 313 Sheet 314 Sheet 315 Sheet 316 Sheet 317 Sheet 318 Sheet 319 Sheet 320 Sheet 321 Sheet 322 Sheet 323 Sheet 324 Sheet 325 Sheet 326 Sheet 327 Sheet 328 Sheet 329 Sheet 330 Sheet 331 Sheet 332 Sheet 333 Sheet 334 Sheet 335 Sheet 336 Sheet 337 Sheet 338 Sheet 339
207 members in 35 offices
Priority claims19
| Document | Office | Kind | Date |
|---|---|---|---|
| 30779710 | United States of America | P | |
| 30779710 | United States of America | P | |
| 61307797 | United States of America | – | |
| 34659510 | United States of America | P | |
| 34659510 | United States of America | P | |
| 61346595 | United States of America | – | |
| 41317210 | United States of America | P | |
| 41317210 | United States of America | P | |
| 61413172 | United States of America | – | |
| 2011026079 | United States of America | W | |
| 2011026079 | United States of America | W | |
| 61307797 | – | – | – |
| 61346595 | – | – | – |
| 61413172 | – | – | – |
| PCTUS2011026079 | – | – | – |
| US20100307797P | – | – | – |
| US20100346595P | – | – | – |
| US20100413172P | – | – | – |
| WO2011US26079 | – | – | – |
Members207
| Document | Office | Kind | |
|---|---|---|---|
| CA2790412A1 | Canada | A1 | |
| CA3014767A1 | Canada | A1 | |
| CA3206109A1 | Canada | A1 | |
| WO2011106528A1 | World Intellectual Property Organization (WIPO) | A1 | |
| TW201138816A | Taiwan Province of China | A | |
| US2012009181A1 | United States of America | A1 | |
| AR080301A1 | Argentina | A1 | |
| US2012120761A1 | United States of America | A1 | |
| US2012120763A1 | United States of America | A1 | |
| US2012120764A1 | United States of America | A1 | |
| US2012120765A1 | United States of America | A1 | |
| US2012120766A1 | United States of America | A1 | |
| US2012120767A1 | United States of America | A1 | |
| US2012123684A1 | United States of America | A1 | |
| CA2817532A1 | Canada | A1 | |
| CA2817561A1 | Canada | A1 | |
| WO2012064839A2 | World Intellectual Property Organization (WIPO) | A2 | |
| WO2012064842A2 | World Intellectual Property Organization (WIPO) | A2 | |
| AU2011220728A1 | Australia | A1 | |
| SG183144A1 | Singapore | A1 | |
| IL221241A0 | Israel | A0 | |
| IL221241D0 | Israel | D0 | |
| MX2012009754A | Mexico | A | |
| EP2538976A1 | European Patent Office (EPO) | A1 | |
| KR20130012117A | Republic of Korea | A | |
| CN103037900A | China | A | |
| AU2011326567A1 | Australia | A1 | |
| AU2011326570A1 | Australia | A1 | |
| WO2012064842A3 | World Intellectual Property Organization (WIPO) | A3 | |
| JP2013524773A | Japan | A | |
| WO2012064839A3 | World Intellectual Property Organization (WIPO) | A3 | |
| SG190251A1 | Singapore | A1 | |
| MX2013005333A | Mexico | A | |
| EP2538976A4 | European Patent Office (EPO) | A4 | |
| SG190791A1 | Singapore | A1 | |
| MX2013005146A | Mexico | A | |
| CN103282795A | China | A | |
| EP2637693A2 | European Patent Office (EPO) | A2 | |
| EP2638415A2 | European Patent Office (EPO) | A2 | |
| CN103329008A | China | A | |
| US8557966B2 | United States of America | B2 | |
| US2013295119A1 | United States of America | A1 | |
| EA201390693A1 | Eurasian Patent Organization (EAPO) | A1 | |
| EA201390696A1 | Eurasian Patent Organization (EAPO) | A1 | |
| JP2014500961A | Japan | A | |
| JP2014506317A | Japan | A | |
| RU2012135395A | Russian Federation | A | |
| NZ601617A | New Zealand | A | |
| AU2011326567B2 | Australia | B2 | |
| AU2014203172A1 | Australia | A1 | |
| AU2011220728B2 | Australia | B2 | |
| AU2014213540A1 | Australia | A1 | |
| EA201390696A8 | Eurasian Patent Organization (EAPO) | A8 | |
| AU2014256413A1 | Australia | A1 | |
| US8923092B2 | United States of America | B2 | |
| US8942063B2 | United States of America | B2 | |
| KR20150031488A | Republic of Korea | A | |
| SG10201501342UA | Singapore | A | |
| US9046620B2 | United States of America | B2 | |
| NZ621938A | New Zealand | A | |
| AU2011326570B2 | Australia | B2 | |
| US9110178B2 | United States of America | B2 | |
| US9110179B2 | United States of America | B2 | |
| US9133275B2 | United States of America | B2 | |
| JP5778700B2 | Japan | B2 | |
| TWI504408B | Taiwan Province of China | B | |
| AU2011326570C1 | Australia | C1 | |
| KR101580713B1 | Republic of Korea | B1 | |
| US9223039B2 | United States of America | B2 | |
| SG10201509344RA | Singapore | A | |
| JP2016000729A | Japan | A | |
| UA110783C2 | Ukraine | C2 | |
| TW201607555A | Taiwan Province of China | A | |
| US2016060339A1 | United States of America | A1 | |
| AU2014203172B2 | Australia | B2 | |
| US2016075781A1 | United States of America | A1 | |
| US2016083471A1 | United States of America | A1 | |
| CN103037900B | China | B | |
| US2016096887A1 | United States of America | A1 | |
| US2016096888A1 | United States of America | A1 | |
| AU2014256413B2 | Australia | B2 | |
| MX338705B | Mexico | B | |
| KR101637138B1 | Republic of Korea | B1 | |
| MX340437BThis record | Mexico | B | |
| KR20160083962A | Republic of Korea | A | |
| CN105777907A | China | A | |
| AU2016208340A1 | Australia | A1 | |
| BR112013011863A2 | Brazil | A2 | |
| BR112013011870A2 | Brazil | A2 | |
| JP2016153412A | Japan | A | |
| US9453926B2 | United States of America | B2 | |
| SG10201606573SA | Singapore | A | |
| NZ709390A | New Zealand | A | |
| EP2538976B1 | European Patent Office (EPO) | B1 | |
| JP6039751B2 | Japan | B2 | |
| AU2016265966A1 | Australia | A1 | |
| MX345001B | Mexico | B | |
| RU2610663C2 | Russian Federation | C2 | |
| DK2538976T3 | Denmark | T3 | |
| MX346092B | Mexico | B |
1 legal event, as the office reported them to INPADOC
Events
| Event | Code | |
|---|---|---|
| Grant or registrationFG | FG |
Numbers
- Publication
- 340437
- Publication, DOCDB
- 340437
- Publication, EPODOC
- MX340437
- Application
- 2012009754
- Application, DOCDB
- 2012009754
- Application, EPODOC
- MX20120009754
Titles2
- Spanish
- ANTICUERPOS E INMUNOCONJUGADOS DEL RECEPTOR 1 DE FOLATO Y USOS DE LOS MISMOS.
- English
- FOLATE RECEPTOR 1 ANTIBODIES AND IMMUNOCONJUGATES AND USES THEREOF.
Classification
- CPC, 53
- C07K16/28
- A61K39/39558
- A61K31/5365
- A61K39/3955
- A61K45/00
- A61K49/0002
- C07K16/3015
- C07K16/3023
- C07K16/303
- C07K16/3038
- C07K16/3069
- A61K2039/505
- C07K2317/732
- C07K2317/565
- C07K2317/56
- C07K2317/24
- A61K47/68033
- A61K47/6889
- A61K47/545
- A61K47/6849
- C07H21/00
- C12N15/62
- A61K31/537
- A61P35/00
- A61P35/02
- A61P35/04
- A61P43/00
- A61K45/06
- A61K47/6851
- C07K16/30
- C07K2317/14
- C07K2317/31
- C07K2317/52
- C07K2317/524
- C07K2317/526
- C07K2317/53
- C07K2317/54
- C07K2317/55
- C07K2317/622
- C07K2317/624
- C07K2317/626
- C07K2317/71
- C07K2317/73
- C07K2317/92
- C07K2317/94
- C12N5/16
- C12N15/70
- C12N2800/00
- C12N15/79
- C12N15/63
- A61K47/68031
- A61K2300/00
- A61K2121/00
- IPC, 2
- A61K47 48
- C07K16 28