Untitled record

١٨٨

41387Β1

-184-

(Production of vectors associated with hyper-sized antibodies)

Summary

The present invention relates to methods for producing an adenovirus (AAV) particle that contains the AAV genome resulting from hyper-coupled recombinases (i.e., more than 4.7 kb). In some features, the invention provides 887 particles and 887 vectors comprising hyper-sized rAAV genome variants. It also provides the cell lines produced to produce 887 particles containing very large genome variants.

١٨٨

41387Β1

(Production of vectors associated with hyper-volume glands) Full description

Cross-reference to relevant requests

(00001) The present application is based on precedence on US provisional patent application 62 / 144,862 (144/62, 862), filed on April 8, 2015, and US patent application 5 for provisional No. 62 / 220,067 (220/62, 067), For deposited on September 17, 2015; Their contents are included in the present application as a whole for all purposes.

Present the list of sequences in an ASCII text file

[00002 The content of the next progression on an ASCII text file is included in the current application for its entire reference

: Computer Readable Image (CRF) from Sequence List (Filename: 10

159792013240SEQLIST.txt; Date of registration corresponds to April 6, 2016, size: 27 KB) Technical area

[0003] The present invention relates to methods and cell strains to produce an adenovirus particle (887) to an over-sized 887 genome resulting from recombinant gene recombination 15 Technical background

[0004] The 887 vectors resulting from recombination (3887) have become attractive delivery vectors for gene transfer in hereditary and chronic diseases. One of the limitations of using rAAV vectors was that they were small

fill

4138731

It assessed the mobility that was hindering gene therapy for a number of clinical applications requiring 4: for example, FVIII (VIII), dystrophin, desferlin, and trans-membrane conduction regulator in cystic fibrosis (^ 0). Studies of early fatigue were identified as 4.7 to 4 and confirmed. (Dong, R-et 1996) Uh (Human Gene Therapy 7: 2101-2112)) 4.8 kilobase

The most recent studies have a limit on packaged vector genomes of approximately 5.0 to 5.2 kbps 5 as the volume of 42 445 O capsids. In these studies, genomes over-sized (or segmented) with both poles were typically deleted at the 5-pin and did not exceed the most populated genomes.

Lu, H. et 2008 (uh) Human Gene Therapy 19: 648-654; Wu, 2. et al. 5.2 kb. (2010) 440766174 Therapy Grose, WE et al. (2012) 18: 80-86: 0/05 One 7: 39233

[70005 Consequently, there is a need for better production platforms for hyper-volume vectors that allow the generation of stable 10 yields of adequate quality.

Disclosure of the invention

[0006] The present application describes a comprehensive analysis of the production of hypervelominated vectors with a generating cell strain platform (T15). As shown below, this [p] platform generates a higher yield of better quality hypervelominated vectors (rAAV). The rAA V vectors generated contain 15 higher quantities of genomes in larger capsids than is observed in a vector in a standard triple infection method. In addition, the cell strains are stable, and the vectors contain less aberrant contaminated DNA. The vectors subtract complete expression strips upon in vivo lysis and lead to production of a functional protein.

fill

4138731

10007 The invention provides a method for producing a glandular virus particle (887) including an over-sized 887 genome resulting from recombinant gene recombination, as the method includes (a) culturing the 887-producing cell line under conditions to generate rAAV particles, where the progenitor cell line تشتمل includes (1) A nucleic acid encoding the rep and cap genes of AAV, and (2) the rAAV genome, where the rAAV genome is larger than about 4.7 kb; (B) Provision of auxiliary functions for the 88; and (c) assembly of rAAV particles containing hyper-sized rAAV genomes. In some embodiments, the y DNA encoding the rep and cap genes of 9 587 genomes 2887 is statically preserved in the progenitor cell lineage. In some embodiments, the DNA encoding the rep and cap genes of AAV and / or the rAAV genome are statically incorporated into the genome of the producing cell lineage. In some embodiments, the rAAV genome includes one or more inverted terminal repeat units of ITRs ^ AAV ^ and an asymmetric transgenic gene. In some embodiments, the rAAV genome includes two of 115 44. In some embodiments, the rAAV genome ranges between about 4.7 kb base and about 9.4 kb base, optionally about 4.7 kb base and 6.7 kb base. In some embodiments, the 887 particles assembled in step (c) contain rAAV genomes larger than about 4.7 kb. In some embodiments, the 887 particles assembled in step (c) contain rAAV genomes between about 4.7 kb base and about 9.4 kb base, optionally about 4.7 kb base and 6.7 kb base. In some embodiments, the rAAV genome ranges between about 4.7 kb bases and about 5 kb bases, about 4.7 kb bases and about 6 kb bases, about 4.7 kb bases and about 7 kb bases, about 4.7 kb bases and about 8 kb bases, or about 4.7 kb bases and about 9 kb. Kilo base. In some embodiments, the rAAV genome is between about 4.7 kb base and 6.7 kb base or between about 5.2 kb base and about 8.7 kb base in some embodiment, the rAAV genome is larger.

١٨٨

41387Β1

From about any of 5.0kb base, 5.1kb base, 5.2kbase, 5.3kbase,

5.4 kilobase, 5.5 kilobase, 5.6 kilobase, 5.7 kilobase, 5.8 kilobase

5.9 kg base, 6.0 kilobase, 6.1 kilobase, 6.2 kilobase, 6.3 kilobase,

6.4 kilobases, 6.5 kilobases, 6.6 kilobases, 6.7 kilobases, 6.8 kilobas

6.9 Kilobase, 7.0 Kilobase, 8.0 Kilobase base, or 9.0 Kilobase in length or any value in between.

[0008] In some embodiments of the methods described above, the asymmetric GM gene encodes a therapeutic GM gene product. In some embodiments, the non-recombinant genetically modified gene is a human genetically modified Moore gene. In some embodiments, an asymmetric genetically engineered gene encodes for factor VIII, dystrophin, desferlene or a transient membrane conduction regulator in cystic fibrosis (CFT R). (8811). In some embodiments, the 887 • genome includes an intron. In other embodiments, the intron is a synthetic intron. In some embodiments, the 887 genome] includes a polyadenylated signal. In other embodiments, the signal for a polyadinyl treatment is a synthesized polyadenylated signal or a polyadinylated signal from bovine growth hormone.

[0009] In some embodiments of the methods shown above, the rAAV particle includes !, 42, AAVIO, AAV9, AAV R, AAVrh8, AAV8, AAV7, AAV6, AAV5, AAV4, AAV3, AAV2 Ν587Α, AAV DJ, AAV2 / 2-7m8 , AAV2R471A, AAV12, AAVll, AAVrhlO

AAV, AAV V708K, AAV2 Ν708Α, AAV2 Ε548Α from goats, AAV1 / AAV2 Khybery, 887 Yg, occapsed the pattern for rAAV2 / HBoVl serotype from 88 mouse capsid In some embodiments, the AAV serotype is AAV6, AAV6, 42!

fill

4138731

AAVIO, AAV9, AAVR, AAVrh8, AAV8, or AAVrhlO. In some of the road models shown above, ITRs 887 is 41 42 443 44 45 476, AAV12, AAVll, AAVrhlO, AAVIO, AAV9, AAVrh8R, AAVrh8, AAV8, AAV7.

AAV2R471A, [• 887, 887 goats, 887 bovine ITRs, or mouse AAV serotype. In some embodiments, 887 ITRs are 42 ITRs. In some embodiments, the rAAV capsid is derived from the same serotype 4. In some embodiments, the capsid 11 is derived from 42. In other embodiments, the ITR and the capsid 887 particles are derived from different serotypes 44. In some embodiments, the AAV comprise AAV2 ITRs and AAVrh8R Capsid. In some embodiments, the 8867 particles include 88272118 and the 8878 capsid.

10010 In some embodiments of the methods shown above, the cell lineage produced from primate cells is derived. In some embodiments, the lineage of cells produced is derived from cells 549, 293, HeLa, or Perc. In some embodiments, the lineage of cells produced for growth is initialized in a suspension. In some embodiments, the adenovirus or HSV 887 auxiliary functions are provided. In some embodiments, the 2887 particles are collected from between about 48 hours and about 96 hours after the auxiliary functions are provided. In some embodiments, the methods also include the purification of 3887 particles and in some embodiments, the purification includes one or more chromatographic steps. In some respects, the invention provides a 147 particle comprising the super-sized rAAV genome produced by the methods described in the present application.

100111 In some respects, the invention provides a formulation comprising rAAV particles containing at least about 15%, about 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%. %, At least about 50%, at least about 55%, at least about 60% or at least about

١٨٨

41387Β1

70% of a particle in capsid on the rAAV genome is greater than about 4.7 kb. In some embodiments, the rAAV genome includes one or more inverted terminal repeat units of the asymmetric genetically modified jj (ITRs) AAV. In some embodiments, the rAAV genome includes two out of 1115 4. In some embodiments, the rAAV genome ranges from about 4.7 kb to about 9.4 kb. In some embodiments, the rAAV genome ranges between about 4.7 kb bases and about 5 kb bases, about 4.7 kb bases and about 6 kb bases, about 4.7 kb bases and about 7 kb bases, about 4.7 kb bases and about 8 kb bases, or about 4.7 kb bases and about 9 kb. Kilo base. In some embodiments, the rAAV genome ranges between about 4.7 kb base and 6.7 kb base, or between about 5.2 kb base and about 8.7 kb base. In some embodiments, the rAAV genome is larger than about any of 5.0 kbps, 5.1 kbps, and 5.2 kb

Base, 5.3 kilobases, 5.4 kilobases, 5.5 kilobases, 5.6 kilobases, 5.7 kilos

Base, 5.8 kilobase, 5.9 kilobase, 6.0 base, 6.1 kilobase, 6.2 kilobase

Base, 6.3 Kilobase, 6.4 Kilobase, 6.5 Base Kil, 6.6 Base Kil, 6.7

Base, 6.8 kilobase, 6.9 kilobase, 7.0 kilobase, 8.0 kilobase base or 9.0 kilobase in length or any value in between.

[10012 In some embodiments of the combinations shown above, the asymmetric GM gene encodes a therapeutic GM gene product. In some embodiments, the gene for an asymmetric transgenic is a human transgenic gene. In some embodiments, the asymmetric transgenic elginate of factor VIII, dystrophin, desferlene or trans-membrane conduction regulator is encoded in fibrosis (1) and in some embodiments, the asymmetric transgenic gene effectively binds to a promoter. In other embodiments, the reinforcer is a mouse transethyrin promoter (1). In some embodiments, the rAAV genome includes an intron. In models

١٨٨

41387Β1

-٦-

Other, the intron is a synthetic intron. In some embodiments, the rAAV genome includes a polyadenylated signal. In other embodiments, the polyadenyl-treated signal is a synthesized poly-adenyl-treated signal or a poly-adenyl-treated signal from bovine growth hormone.

[0013] In some embodiments of the combinations shown above, the rAAV particle includes AAVl, AAVIO, AAV9, AAVrhSR, AVrh8, AAV8, AAV7, AAV6, AAV5, AAV4, AAV3, AAV2N587A, AAV DJ, AAV2 / 2-7R472A, AAV4, AAV3 , AAV12, AAVll, AAVrhlO

AAV, AAV V708K, AAV2 708Α, AAV2 548Α from goats, 8871/8872 chimeric, 887 bovine, serotype rAAV2 / HBoVl oxapside from murine 887 capsid. In some embodiments, the serotype 887 is 447 446 445 42, AAVl AAV10 49, AAVrhSR, AAVrh8, AAV8, or AAVrhlO. In some of the road embodiments shown above, AAV 115 is AAV5, 43, AAV5, 46, AAV2, AAVl, AAV12, AAVll, AAVrhlO, AAVIO, AAV9, AAVrh8R, AAVrh8, AAV8, AAV7.

AAVDJ, AAV2R471A, 887 goats, 887 bovine, or AAVITRs. In some embodiments, 1115 AAV are 442 ITRs and in some embodiments, ITR and rAAV particle capsid are derived from the same serotype 887. In some embodiments, 118 and capsid are derived from 442. In other embodiments, ITR and rAAV particle capsid are derived from different serotypes 887. In some embodiments, the 887 particles include AAV2 ITRs and AAVrh8R capsid. ^ In some embodiments, the 887 particles include 4472 ITRs.

[0014] In some embodiments of the combinations shown above, 887 particles containing the 887 genome are produced in the producer cell. In some embodiments, the lineage of cells produced is derived from cells of primates.

١٨٨

41387Β1

In some embodiments, the lineage of cells produced from 549, 293, HeLa, or 1.6 cells is derived and, in some embodiments, the lineage of growth producing cells is initialized in suspension. In some embodiments, adenovirus 887 or 115 auxiliary functions are provided and in some embodiments, rAAV particles are collected between about 48 hours and about 96 hours after the auxiliary functions are provided.

10015 In some aspects, the invention provides a method to enhance the expression of the hyper-sized rAAV genome, wherein the method includes the production of rAAV particles in the progenitor cell by providing AAV functions to aid the cell line, wherein the progenitor cells include (a) DNA encoding the rep and cap genes of 887, And (b) the rAAV genome, in which the rAAV genome is larger than about 4.7 kb. In some embodiments, the expression of the hyper-sized rAAV genome is greater than the expression of the hyper-sized rAAV genome of rAAV particles produced by accidental trauma of about 1.25 times, about 1.5 times, about 1.75 times, about 2.0 times, about 2.5 times, about 2.75 times, about 3 times, or about 5 times. In some embodiments, the expression kinetics of the rAAV genome of hyper-sized rAAV genome from particles produced by the progenitor cell represents faster expression kinetics compared to the expression kinetics of the rAAV genome hyper-sized of rAAV particles produced by accidental infection and, in some embodiments, the expression kinetics of the rAAV genome are over-sized of the product by the progeny. Produced cells are about 5% faster, about 10% faster, about 25% faster, about 50% faster, about 75% faster, or about 90% faster than expression kinetics Of the rAAV genome of hyper-sized rAAV particles produced by accidental infection.

00016 And in some embodiments of enhanced expression of the over-sized rAAV genome, the acid is retained

The nuclear that encodes the rep and cap genes of and / or the 887 genome] stably in the cell lineage

fill

4138731

Produced. In some embodiments, the DNA encoding the rep and cap genes from 887 and / or the 3887 genome is statically incorporated into the genome of the progenitor cell. In some embodiments, the rAAV genome includes one or more inverted terminal repeats of (]) and an asymmetric transgenic gene. In some embodiments, the rAAV genome includes two AAV ITRs. In some embodiments, the rAAV genome ranges from about 4.7 kb. And about 9.4 kilobase. In some embodiments, the rAAV genome ranges between about 4.7 kb bases and about 5 kb bases, about 4.7 kb bases and about 6 kb bases, about 4.7 kb bases and about 7 kb bases, about 4.7 kb bases and about 8 kb bases, or about 4.7 kb bases and about 9 kb. Kilo base. In some embodiments, the rAAV genome ranges from about 4.7 kb to 6.7 kb or about 5.2 kb to about 8.7 kb.

000171 In some embodiments of the enhanced expression of the hyper-sized rAAV genome, the asymmetric transgenic gene encodes a therapeutic GM gene product. In some embodiments, the asymmetric transgenic factor VIII, dystrophin, desferlene or trans-membrane conduction regulator is encoded in fibrosis (01). In some embodiments, the asymmetric transgenic gene is a human genetically modified gene. In some embodiments, the asymmetric GM gene is effectively linked to a promoter. In some embodiments, the enhancer is a mouse transethyrin enhancer (mTTR). In some embodiments, the rAAV genome includes an intron. In some embodiments, the intron is a synthetic intron. In some embodiments, the rAAV genome includes a polyadenylated signal flag. In some embodiments, the polyadenyl-processed signal is a synthetic PO-adenyl-processed signal or a polyadinyl-treated signal from bovine growth hormone [0018] and in some embodiments of enhanced expression of the over-sized rAAV genome, the rAAV particle includes 4471 472 4473) 444 4475 AAVrhS. 478 477, AAV6,

fill

4138731

-10AAV2 / 2-, AAV2R471A, AAV12, AAVU, AAVrhlO, AAVIO, AAV9, AAVrh8R

AAV, AAV V708K, AAV2N708A, AAV2 Ε548Α, AAV2 Ν587Α, AAV DJ, 7m8 goat, 88272 A 8871 chimeric, AAV bovine, serotype rAAV2 / HBoVl of the 448 capsidle 448, and some of the 8 capsidl 448 variants are 8 mice. 441118] 38] AAVIO, AAV9, or AAVrhlO. In some embodiments, the AAVITRs are 45 444 403 442, AAVl, AAVll, AAVrhlO, 4886 710, AAV9, AAVrh8R, AAVrh8, AAV8, AAV7, AAV6.

AAV, AAVDJ, AAV2R471A, AAV12 from goat, 887 bovine, or mouse serotype 11 [AAV. In some embodiments, 1115 AAV are 42 ITRs and in some embodiments, 118 and rAAV particle capsid are derived from the same serotype and in some embodiments, ITR and capsid are derived from 442. In some embodiments, ITR and 288 particle capsid are derived from the serotypes of the different 887 serotypes. In some embodiments, 887 particles include AAV2 ITRs co-capsid AAVrh8R ^ and in some embodiments, AAV particles include AAV2? *]] And capsid.

00019 In some embodiments of enhanced expression of the hyper-sized rAAV genome, the lineage of cells produced from primate cells is derived. In some embodiments, the cell lineage produced is derived from cells 11293, Α549, or Perc. In some embodiments, the growth-producing cell lineage is initialized in suspension. In some embodiments, the auxiliary 887 functions are provided by adenovirus, HSV or bacovirus. In some embodiments, 8867 * particles are collected from about 48 hours and about 96 hours after the auxiliary functions are provided. In some embodiments, the methods also include the purification of 3887 particles. In some embodiments, the purification includes one or more chromatographic steps.

١٨٨

41387Β1

10020 In some respects, the invention provides a cell lineage to produce an associated virus particle (887) comprising the over-sized AAV genome resulting from recombinant gene recombination, wherein the cell lineage includes (a) DNA encoding the 00 and cap genes of 887, and (b) the rAAV genome. , Where the rAAV genome is larger than about 4.7 kb. In some embodiments, the DNA encoding the rep and cap genes from and / or the 3887 genome is statically retained in the lineage of the producing cells. In some embodiments, the DNA encoding the rep and cap genes from 887 and / or the rAAV genome are statically incorporated into the genome of the producing cell lineage. In some embodiments, the rAAV genome includes one or more inverted terminal repeat units of ITRs ^ AAV ^ and an asymmetric transgenic gene. In some embodiments, the rAAV genome ranges from about 4.7 kb to about 9.4 kb. In some embodiments, the rAAV genome ranges between about 4.7 kb bases and about 5 kb bases, about 4.7 kb bases and about 6 kb bases, about 4.7 kb bases and about 7 kb bases, about 4.7 kb bases and about 8 kb bases, or about 4.7 kb bases and about 9 kb. Kilo base. In some embodiments, the rAAV genome ranges between about 4.7 kb base and 6.7 kb base, or between about 5.2 kb base and about 8.7 kb base. In some embodiments, the rAAV genome is greater than approximately any of 5.0 kb base, 5.1 kb base, 5.2 kb base, 5.3 kb base, 5.4 kb base, 5.5 kb base, 5.6 kbp,

5.7 kilobase, 5.8 kilobase, 5.9 kilobase, 6.0 kilobase, 6.1 kilobase

6.2 Kilobase, 6.3 Kilobase, 6.4 Kilo base, 6.5 Kilo base, 6.6 Kilo base,

6.7 kilobase, 6.8 kilobase, 6.9 kilobase, 7.0 kilobase, 8.0 kilobase

8.7 kb base, or 9.0 kb base, length or any value in between.

<img file="MA41387B1_D0001.tif" />

fill

4138731

[70021 In some models of cell lines, the asymmetric GM gene encodes a therapeutic GM gene product. In some embodiments, the asymmetric genetically modified gene is a human genetically modified gene. In some embodiments, the gene encodes the asymmetric factor VIII, dystrophin, desferlene or trans-membrane conduction regulator in fibrosis (01%). In some embodiments, the asymmetric transgenic gene effectively binds to a promoter. In others, the promoter is a mouse transtyretin enhancer (118). In some embodiments, the 3887 genome includes an intron. In other embodiments, the intron is a synthetic intron. In some embodiments, the rAAV genome includes polyadenylated signal boxes. In other embodiments, the PVA signal is a synthesized polyadenylated signal or a polyadenylated signal from bovine growth hormone.

10022 In some embodiments of the cell lines described above, the AAVl ^ rAAV particle includes AAVl ^ rAAV, AAV9, AAVrhSR, AAVih8, AAV8, AAV7, AAV6, AAV5, AAV4, AAV3, AAV2, AAV2, AAVDJ, AAV2 / 2-7m8, AAV2R471A, AAVrll, AAVr12. , AAVIO

V708K 442 Ν708Α 42 548Α, 587Α 887, AAV from goats, 8872/8871 chimeric, 887 bovine, oxapsid serotype 42/111301 from mouse 887 capsid. In some embodiments, the AAV serotype is 45 42, AAVl 46 477 AAVIO, AAV9 41180 4118, AAV8, or AAVrhlO. In some of the road models shown above, AAVITRs are 45 44 443 42, AAVl, AAVll, AAVrhlO, AAVIO, AAV9, AAVrh8R, AAVrh8 478, AAV7, AAV6.

AAV2R471A, AAV12, [• 887, 887 goats, 887 bovine, or mouse serotype AAVITRs. In some embodiments, the AVITRs are 42115. In some embodiments, ITR and '^ AVf' capsid are derived from the same serotype. In some embodiments, this is done

١٨٨

41387Β1

Derivation of ITR and the capsid from 42 In other embodiments, 111 and the capsid particles 87 H 38 are derived from the different AAV serotypes. In some embodiments, the AAV particles include AAVrhSR ^^ 42 ITRs. In some embodiments, 887 particles include 42

0AAV84 ^ ITRs

10023 In some examples of the Lahlai Lamina strains above, the Lahlai lineae produced from the primate cells is derived. In some embodiments, the lineage of cells produced from cells from HeLa, 549, 293 and Perc. In some embodiments, the lineage of growth producing cells is initialized in a suspension. In some embodiments, AAV particles are produced in the cell lineage to provide auxiliary 887 functions. In some embodiments, the auxiliary AAV functions are provided by the adenovirus or HSV and in some embodiments, the 3886 particles are collected from between about 48 hours and about 96 hours after the auxiliary functions are provided.

00024 In some respects, the invention provides a glandular virus particle (887) comprising the 3887 genome found in the 887 hocapsid capsid, wherein the 887 genome is larger than about 4.7 kb. In some embodiments, the 887 genome] includes one or more inverted terminal repeat units of ITRs ^ AAV ^ and an asymmetric transgenic gene. In some embodiments, the rAAV genome includes two AAV ITRs. In some embodiments, the 887 genome] ranges from about 4.7 kb to about 9.4 kb. In some embodiments, the rAAV genome ranges between about 4.7 kb bases and about 5 kb bases, about 4.7 kb bases and about 6 kb bases, about 4.7 kb bases and about 7 kb bases, about 4.7 kb bases and about 8 kb bases, or about 4.7 kb bases and about 9 kb. In some embodiments, the rAAV genome ranges between about 4.7 kb base and 6.7 kb base, or between about 5.2 kb base and about 8.7 kb.

fill

4138731

Base. In some embodiments, the 3887 genome is greater than approximately any of 5.0 kb base, 5.1 kb base, 5.2 kb base, 5.3 kb base, 5.4 kb base, 5.5 kb base kb, 5.6 kb base

Kilobase, 5.7 kilobase, 5.8 kilobase, 5.9 kilobase, 6.0 kilobase, 6.1

Base kilo, 6.2 base kilobase, 6.3 kilobase, 6.4 base kilobase, 6.5 base kilobase, 6.6

1 kilobase, 6.7 kilobase, 6.8 kilobase, 6.9 kilo base, 7.0 kilobase, 8.0

A kilobase, 8.7 or 9.0 kilobase, by length, or any value in between.

10025 In some embodiments, the invention provides particles containing the oversize 887 genome where the asymmetric transgenic gene encodes a therapeutic GM gene product. And, in some embodiments, the gene is the hub embodiments, the asymmetric GM is a human GM gene. In some embodiments, the asymmetric GM gene encodes for factor VIII, dystrophin, desferlene or a transient regulator of membrane transduction in fibrosis (0111) and in some embodiments, the asymmetric transgenic gene is associated with Effectively as a booster, in other embodiments, the enhancer is a mouse tertiary tertiary enhancer (mTTR). In some embodiments, the 887 • genome includes an intron. In others, the intron is a synthetic intron. In some embodiments, the 887 genome includes polyadenylated signal boxes. In other embodiments, the PVA signal is a synthesized polyadenylated signal or a polyadenylated signal from bovine growth hormone.

[0026] In some of the cell lineage embodiments shown above, the rAAV particle includes AAVl, AAV2, 88, AAV6, AAV5, AAV4, -887, AAV9, AAVihR, AAVh, AAV8,

AAV2, AAV DJ 48872 / 2-71118, AAV2R471A, AAV12, AAVll, AAVrhlO, AAVIO

AAV, AAV V708K 4472 Ν708Α, AAV2 Ε548Α, 587Α from goats, AAV1 / AAV2 bovine, AAV bovine, oCapsid serotype rAAV2ZHBoVl of capsid

١٨٨

41387Β1

887 Mouse. In some embodiments, the AAV serotype is 445 442, AAVl 446 47 48 4138 AAVIO, AAV9, AAVrhSR, or AAVrhlO. In some of the road models shown above, AAVITRs are 445 444 443, AAV2, AAVl, AAVll, AAVrhlO, AAVIO, AAV9, AAVrhSR, AAVrhS, AAV8, AAV7, AAV6.

4412 AAVDJ, AAV2R471A, 887 from goat, 887 bovine, or mouse serotype 8867 ITRs. In some embodiments, ITRs 887 are 442 ITRs and in some embodiments, ITR and particle capsid are derived from the same AAV sucking pattern ^ and in some embodiments, 11 are derived ] And the capsid from AAV2. In other embodiments, the particle capsid [11] and 3887 are derived from the different AAV serotypes. In some embodiments, the AAV particles include 42 ITRs and Ca ^. AAVhR. In some embodiments, the AAV particles comprise 472 ^ AAV84 ^ ITRs

000271 In some embodiments of the invention, 887 particles comprising the super-sized AAV genome are produced in a productive cell. In some embodiments, the lineage of cells produced is derived from cells of primates. In some embodiments, the cell lineage produced is derived from 1114 293, 549, or 6.Perc cells. In some embodiments, the growth-producing strain of cells is initialized in suspension. In some embodiments, the adenovirus 887 or 1187 auxiliary functions are provided. In some embodiments, 887 particles are collected from between about 48 hours and about 96 hours after the auxiliary functions are provided.

10028 In some embodiments, the invention provides a 887 particle comprising the 2887 hyper-sized genome where the rAAV genome of pin 5 'to 3' includes 442 ITR enhancement 0111 synthesized intron, human transgenic gene 7], a synthetic polyadenylated sequence, and AAV2 ITR. In some embodiments, the rAAV genome from 5 'to' 111 includes the 442 (111) mTTR promoter, an intron.

fill

4138731

Synthetic, genetically modified gene, human CHFRLA 171, gamete growth hormone in sequence treated with synthetic polyadenylated, 211 In some embodiments, ML671T1 includes deleting all or part of the B domain. In some embodiments, particle 8827 includes AAV capsidna. In some embodiments, the 887 particle has 88678 capsid.

F] In some respects, the invention provides its vector comprising the H genome], which includes 5

The 8827 genome * 5 to 3 contains 442 ITR enhancers 10111 synthetic intron, a transgenic gene encoding human [71], synthesized polyadinyls, and 442 ITRs, and in some embodiments, the 8867] genome of 5 to 3 includes 42 ITR promoter 0111, a synthetic intron, and a genetically modified gene encoding a human [71]. ] Human, synthetic polyadenylated sequence of bovine growth hormone, 42ITR.

And in some alumphs) include? To delete all or part of the scope of 10B

10030 In some embodiments, the invention provides a method for treating an individual suffering from a disease or disorder, which includes administering a chirp C. AAV containing a hypervolumeric rAAV genome, as a transgenic therapeutic virgin, in which a genetically modified therapeutic gene is suitable for treating the disease or disorder. In some embodiments, the individual is a mammal (for example, a human) and in some embodiments, the disease or disorder is hemophilia A. In some embodiments, the transgenic therapeutic gene encodes factor 15 1 to 271; for example, human factor VIII including human factor VIII from which the domain is deleted

13.

10031 In some embodiments, the invention provides toolkits comprising 88 particles comprising the hyper-sized rAAV genome, as the present application describes.

١٨٨

41387Β1

10032 All references cited in the current application, including patent applications and publications, are included for their entire reference

Brief description of the shapes

[0033] Fig. 1, Abt-Tantar al-Talbi, on hFviii, on MS-Thrusdress Vai (1011), ranged from vector genome sizes of 5.1 to 5.4 kilobase (as 5 shown). Sequence modifications are shown in the 1 to 4 HN F (open circuits) and 3 to 1 HNF (solid circuits) connectivity positions and their location. Abbreviations of Figures 1a, 1 and 1b1cr: ITRs, inverted terminal repeat units of rAAV; mTTR, mouse tert-transthyrin promoter (202 or 482 lead points); x-intron hybridized; 014, FVIII from 37111) human B domain deleted from; synpA, synp pA); BGH or bovine growth hormone (13011) poly 10. (pA) A.

[0034] Figure 1 shows the alignment of the reinforced sequences] 11 used in the experiments described by the application

Present.

[0035] Figure 1c, body-specific expression levels of jmTTR-FVIII were measured.

Plasmid vectors were injected intravenously with a large volume injection in 6 / C56BL mice, with factor levels.

111 Plasma test 15 .ELISA

00036 Figure 1 shows the structure of the expression bar expression 5.1 k-base 1111 This tape contains the inverted terminal repeat units of ITRs ^ rAAV ^, mouse tert-transtherin enhancer (mTTR), intron

Hybrid () (1), cDNA from 17,111 human with a deleted domain, and the synthetic poly-A sequence.

١٨٨

41387Β1

10037 Figure 1 is a TriplePlay plasmid containing genome 111] rep and cap genes from 887, as well as genes responsible for resistance to the drug puromycin and kanamycin.

10038 Figures 2 or 2b show Southern spot analyzes of genomic DNA from clonal eyes using! ^ The FVIII fragment is generated by TriplePlay. Fig. 2a (split plasmid). Selected Master (MWs)

Linearity is about 13 kb base. Using these as a comparative size of a TriplePlay unit length plasmid and a standard for fusion copy number. (Fig. 2b) The integration of the embedded vector genome by digestion was analyzed using 0 BglII. These enzymes express the ^ Fvn expression bar giving rise to two fragments 1.8 and 2.8 kb base. In both figures, diagrams are provided that show vectors and restraints

10039 Figures 3 or 3 are shown by analyzes of the yield and stability of AAVrh8R / mTTR-FVIII 5.1 kbps. (Fig. 3a) The production time pathway of AAVrhSR / transporter 5.1 kb. Shaker cultures were prepared with the untreated type of adenovirus (A), and samples were collected on days 2, 3 and 4, Fig. (VG / ml) in the vector genomes of qPCR and the vector yield was quantified by

B) Stability of high main eyes for single output rAAV transmission levels are shown for 414,287 (5.1 / 448kb), 1435 (5.1 / 4401081kb) and 163 # 5 AI AAVrh8R (MWKB). Principal eyes were passed to Corridor 20 or 26 and were completed

. Determine the DRP yield (rAAV / ml ^ quantified by) 9:

[0040] Its shape shows the rAAVrh8R / FVIII vectors quality analysis of 5.1 kbase. TXNPCL produced batches of 5.1 kb bus that were compared with AUC analysis. 5.1 KB FVIII / AAVrhSR was generated three times using 4335 (Fig. 4A) and compared to the same vector produced by method 1 (Fig. 4B). Vector quality was assessed by analysis by ultracentrifugation

١٨٨

41387Β1

Analytic (AUC) that measures differences in virus mass. The slug shows the percentage of capsids with different sedimentation values ​​(S). Typically empty capsids have a value - from 63 to 66, while the capsid with a transgenome of the untreated species size typically at S is between 100 to 103 0

[0041] Embry a kaleidoscope kissing Houda ^ () AAVrhSR / FVIII, excessive in size, with a base 5.4 yl. ] •• (Fig. A) and TXN (Fig. 5B) produced 5.4 kb base carrier batches compared to a 40 kb analysis. The entry shows the percentage of capsids with different (S) precipitation values. The percentages of empty capsids (645/635) and particles with larger genomes are circled (1O1S / 99S).

10042 Figure 6B and Figure 6B show description of vector genomes packed in ^ 5.1 / rAAVR kb base by Southern M spot isolation of vector genomes from the purified virions and analyzed with respect to volumes by electrophoresis in alkaline gel, followed by Southern spot with vector-specific probes (Fig. 6a) Southern analysis using LM probe) 4.0127 kbase (FVIII bands 1, A3, Α2 and Cl ^^ loaded at 6.01.1 VGlO)⁹ X / pathway was separated with 1% alkaline gel. The carrier]]] was compared to a 5.1136 kbps generator by MW # 35 (PCL) or triple infection with a carrier volume of 4.6 kbps (corresponding to the 5.1 / rh8Rbps carrier excluding the range! P that was omitted to form a normal size vector). (Fig. 6b) “The signal strength for each volume is quantitatively determined and represented graphically as a percentage of the total signal in each path.

[0043] Figures 7A, 7BU7 show descriptions of the ends (from vector genomes at 485 / 5.1 kb base generated by PCL or TXN by macular DNAÈ analysis. The vector batches used in FIG. 5 were analyzed by two dilutions of each vector on the membrane (beginning).

fill

4138731

From 2.4 10 X; And using decreasing vector concentrations of eight in total without genomes as a negative comparison material) each spot was hybridized with a low-nucleotide probe marked at the intermediate or end-limb of the vector genomes (positive or negative polarity). Signal strength was quantified and approximated to a 4.6 ke vector. Base (fully packed) Three concentrations were used to generate the standard error (Fig. 7a) A plot showing the location of the low nucleotide probes used. The values ​​show the distance in the nucleotides of the opposite '3' ends. (Fig. 7B) Negative strand analysis (Fig. 7c) Positive strand analysis.

10044 Figures 8a, 8b, 8 and 8 show descriptions of the ends 5 and 3 of vector genomes packed into kobase ^ 5.1 / rAAV kb-base generated by PCL or ^ 8 ^). ΤΧΝ a) A plot showing the location of the oligonucleotide probe with respect to terminals 50 and 3 of the positive and negative strands of the vector genomes used. Fig. 8b) Quantification of positive and negative strands from vector genomes of 5.1 kbps in each batch. The embedded resolver carrier was from 4.6mTTR-FVIU genomes of 4.6mTTR-FVIUbase or 5.1kbase. The carrier production method is indicated (PCL or TXN) · The vectors were purified in a similar manner. The analysis was done as shown in FIG. 5 with two serial dilutions of each vector on the membrane (starting from 3.0 109; eight decreasing concentrations of the carrier in total). CDNA plasmids containing FIX (negative comparison sample) or MFVIII positive comparison) were used as samples to compare the nature of the specific signal. (Fig. 8c) SouthernN analysis using oligonucleotide probes at the 3 and 5 terminals of the 5.1 kb vectors loaded at 1.5 and 7.5 VG10.⁹ A pathway and separated using 1% alkaline gel. Na was compared to a 5.1 kb base generatorBy MW # 35 (PCL) or triple infection () with a 4.6 kbp vector. Size tags (2.7, 5.14.7 kb) are shown. Top panel, positive strand analysis;

fill

4138731 .21-

Bottom Panel, Negative Braid Analysis. The oligonucleotides used for each plate are shown. White arrows show the missing signals. (Fig. 8B) Quantification of genome sizes in each vector. Signal intensity was quantified in panels with oligonucleotide probes at pin 3 (all packaged genomes detected) by 10 quantification of the intensity of each 70 distinct volume (greater than 4.7 kb base, 4.7 kb base and less than 4.7 kbps) and a corresponding graph. Seminal component of the total signal in each pathway

10045 Figures 9a, 9 and 9 show descriptions of the two sides (5 and 3 of vector genomes packed in the 5.4 / rAAVrh8R kB vectors generated by PCL or 1. (9a)) a diagram showing the location of the oligonucleotide probes with respect to both ends 5 and 3 of the negative and positive strings of the vector genomes used (Fig.9b) The negative and positive subtypes of vector genomes had 5.4 kbp in each batch by spot analysis.Analysis was done as shown in Fig. 8. (Fig. 9c) Southernline analysis of a vector 5.4 kb base using oligonucleotide probes at terminals 3'3 and 51. The experiment was performed as shown in Figure 8.

10046 Figures 10a and 10 show the activity of the kBase 5.1 / rAAVrh8R in vivo product by] • in vivo in mice infected with hemophilia A. The vector was administered to mice via a tail vein counting 3 DRP1010 x 4,101 x 7111 watt mice. In plasma to day 56. (Fig. 10a) Plasma FVIII protein activity. Activity was measured in plasma samples on days 7, 14, 28, 42 and 56 by testing 54 mA 0. (Fig. 10b) Clotting times at days 28 and 56. Clotting times were analyzed by activated partial thromboplastin time (011). Each treatment group contained 1 = 7-10 mice / group. Statistical significance is shown as follows: *, • less than 0.05; **, less than 0.01, ***, less than 0.001 with a T Student test.

fill

4138731

10047 Figures 11a, 1 1 poe 1 1g show a comparison of 5.1 k-base FVIIl / AAVrhSR vectors produced by TXNPCL in vivo using KO mice infected with hemophilia A vectors were given to mice by tail vein counting 4 drpIO.¹⁰ A mouse. (Fig. 11a) FVIII plasma protein activity. Activity was measured on samples on days 21, 35, 56, 70 and 84 by testing 5 mAh 00. (Fig. 11b) Plasma clotting times at day 21. (Fig. 11c) Plasma clotting times on day 56. Plasma clotting times were measured by test 411. Coagulation times of rat strains are shown. (1295U / 1813) for comparison. (Fig. 11d) Transcription of the vector genome (70) in the liver at day 84. The VG brain was quantified by qPCR and is shown in transcription image / 500 nanometers of the common liver DNA. Each treatment group contained 8- η mice / group. Statistical significance is shown as follows: *, P less than 0.05; *, less than 0.01, ***, • less than 0.001 with Student T test. The virus production method (PCL or) is indicated in each panel.

[0048] Figures 12a, 12p [c] show a comparison of the 5.4kp vector FVIIl / AAVrhSR produced by% L * 1 in vivo using 50 mice infected with hemophilia A. The vectors were administered to mice via tail vein at 4 X H0 DRP / mouse and two plasma eyes were collected on days 43,24 after vector administration. (Fig. 12 Activator 37) Activity was measured in plasma samples from days 24 and 43 with the Coatest test (Fig. 2Ab). Plasma clotting times at day 24 with the test] 1 pm (Fig. 12c) Transcription of the vector genome (76) in the liver on days 3 and 43. The animals were killed 433 days after the vector was administered, and copies were quantified by * • and shown by the unit of transcription 500 g of total DNA. Each defective group contained “= 8.6 mice / group. The statistical significance is shown as follows: *, less than 0.05 ; **, less than 0.01 * E, P less than 0.001 by Student's T test.

١٨٨

41387Β1

[0049] Figure 13 shows a plot of tastes ^ 5.9, 5.1 AAV2 / SEAP and 6.7 kilobase. Figure 13b shows data from individual prime eyes (MWs) with respect to the result of the transporter in the proportional and specific production tests (• = 2). The carrier yield is referred to using DRP as a detailed description of the invention

10050 As detailed in the current application, the inventors have developed a generative cell lineage platform that can generate a higher yield of higher quality rAAV vectors. This platform was described with rAAV vectors containing human cDNA Factor VIII as a representative combination. Compared to production using the standard triple infection method, this platform generated 887 vectors] with a higher quantity than the larger genomes of capsids. The 1 mole generated by this platform was also suitable for the gene transfer in the body of the organism that led to the production of functional factor VIII.

[0051] Consequently, the present invention provides methods for producing an adenovirus particle (887) containing an over-sized AAV genome resulting from recombinant gene recombination. In some embodiments, the methods include cultivating the 87M8-producing cell line under conditions that allow the generation of rAAV particles, with the 887-producing cell line containing () DNA encoding the rep and cap genes from 887, and (2) the rAAV genome, where the rAAV genome ranges between about 4.7 About 4.7 kilobases and about 9.4 kilobases, optionally about 4.7 kilobases and about 6.7 kilobases. (B) To assist 887 functions; and (c) to assemble rAAV particles containing 1887 over-sized genomes. In some embodiments, the rAAV genome is larger than about 5 kb. In some embodiments, the rAAV genome is greater than approximately any of 5.0 kb base, 5.1 kb base, 5.2 kb base, 5.3 kb base, 5.4 kb base, 5.5 kb base, 5.6 k base kb, 5.7 kb base, 5.8 kb base,

fill

4138731

H 0 0 e 3 o 2 bu mm-? Z ko AWJ de we love

(? M mm 6 '? 3 dl 6/96 e 3 d ^ 6/7 m; l 7) (ym • 17,656 mud 2 30 o 2 t 04 / combo AWJ btkh 062 gs' 877'2t'1' maw 6 km 6 m AWJ this is () Mm: 09 a.m. 60 jm a 6 ٢ 2 a word 2671 [ΐ00]

6٦0٣9

Ç1 TA 3M JD AW1 D? 6 d • l o w wth!] 655 b (e) 6 k * could awj n?

Lambi? Ni beth and 2 ^ a? 09922 jd 9 mazh alab aw dkny mu 65 (7) 1: rpm pk&gt; 6&gt; aa what ۴ a combined b * [500]

01 1535; Wave C2 AM Co; AVV-is 190 times AVVJ d

Ml x 1 d 6% 09 2 50 d (4% n ml 50 d) 0% ml 50 d (17% mL 1 m as 1% d^Dr 4% dilation, 4% ld, 4% mL, 5 md, md, 0-65 md (0-65%), 26%, 1%, 26, 50, from 26%, 241, for sleep. 5-What, with [500]

C0 m 69 A 12,626 m? 2 what?) ΧΠρ 2 26 days 016225 about s 9

Q2 A 72 877 D m from 90AV7J M 69 A Khum 9 or Wilm 26 * 6 mm brushed M 33 0656 L? 3 C? 0956 (J 0/56 'H3 D 6 6 F, 30 D ^ T99 (9-T9/6) and (9-1 96,? 3 and 2 m F0Q)

, 9 TU '? 3 Dat, Matthew, H (9 R 29 97-6 09 332 Mw 60

-H-

fill

4138731

-25 [- General mechanisms

[00055 The mechanisms and procedures described or referred to in the present application are generally well known and are commonly followed using traditional methods by those skilled in the art, including, for example, the widely used methods described in Molecular Cloning: A Laboratory.

Manual (Sambrook et al., 4^th ed., Cold Spring [([Laboratory Press, Cold Spring Harbor, Ν.Υ., 2012)]: Current Protocols in Molecular Biology (FM Ausubel, et al. eds., 2003): the series Methods in Enzymology (Academie Press) , Inc.); PCR 2: A Practical Approach (MJ MacPherson, BD Hames and GR Taylor eds., 1995): Antibodies, A Laboratory Manual (Harlow and Lane, eds., 1988); Culture of Animal 0115: A Manual of Basic Technique and Specialized Applications (RI Freshney, 6^th ed., J. Wiley and Sons, 2010); Oligonucleotide Synthesis (MJ Gait, 1984 f): Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JE Cellis, ed .. Academie Press, 1998); Introduction to Cell and Tissue Culture (Jp Mather and Ρ.Ε. Roberts, Plénum Press, 1998): Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths, and DG Newell, eds., J. Wiley and Sons, 1993-8); Handbook of Experimental Immunology (DM Weir and cc Blackwell, eds., 1996); Gene Transfer Vectors for Mammalian Cells (JM Miller and Μ.Ρ. Calos, eds., 1987): PCR: The Polymerase Chain Reaction, (Mullis et al., Eds., 1994): Current Protocols in Immunology (JE Coligan et al. ., eds., 1991): Short Protocols in Molecular Biology (Ausubel et al., eds.,. Wiley and Sons, 2002): 11000113010107 (CA Janeway et al., 2004): Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty.,. IRL Press, 1988-1989): Monoclonal Antibodies: A Practical Approach (P. Shepherd and c.

١٨٨

41387Β1

-26Dean, eds., Oxford University Press, 2000): Using Antibodies: 8 Laboratory Manual (E.

Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999): The Antibodies (1.

Zanetti and T.L. Capra, eds., Harwood Academie Publishers, 1995): and Cancer: Principles. And Practice of Oncology (1. DeVita et al., Eds., JB Lippincott Company, 2011)

II— Definitions

10056 A vector, as used in the present application, refers to a plasmid or virus resulting from recombinant gene expression that includes a nucleic acid being delivered to a host cell, either in the laboratory or in the body of an organism.

0057 The term polynucleotide or nucleotide to be used in the present application refers to a polymeric form of nucleotides of any length, ribonucleotides or deoxyribonucleotides. As such, the present terminology includes, but not exclusively, DNA or 28a] single-stranded, double-stranded, multi-stranded, genomic DNA 04, 34 DNA hybrids or polymers comprising purine and pyrimidine preparations, or other natural, chemically modified nucleotide bases. Or biochemically, unnatural, or derived. The main polynucleotide chain may include sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugars or phosphate groups. Alternatively, the polynucleotide main chain may comprise a synthetic subunit polymer such as phosphosphorous amides and thus may be a oligonucleotide phosphorous (1112) or a phosphorous oligomer and a phosphorous diyser. In addition, a double-stranded polynucleotide from a single-stranded polynucleotide product can be obtained from either chemosynthesis.

١٨٨

41387Β1

-Ή-

By synthesizing the complementary strand and annealing the strands under appropriate conditions, or by reconstructing the complementary strand using the enzyme polymerase 8 no] with an appropriate prefix.

00058 The terms polypeptyl and protein are used interchangeably in referring to a polymer of an amino acid building block, and are not limited to a minimum length. These amino acid building blocks may contain natural or abnormal amino acid building blocks, including, but not exclusively, peptides, oligopeptides, dimers, trimers, and maltimers of the amino acid building blocks. Full-length proteins and their fragments are considered within the definition. The two terms also include later modifications to the expression in the polypeptide, for example, treatment with glycosyl, treatment with silyl, treatment with acetylcysteine, phosphorylation, etc. Moreover, for the purposes of the present invention, the polypeptide refers to a protein that includes modifications, such as deletions, additives, Substitutions (generally conservative in nature), in the original sequence, as long as the protein maintains the desired activity. These modifications can be intentional, for example through site-directed mutagenesis, or they may be unintended, for example through host mutations that produce proteins or errors as a result of magnification 101.

10059 A viral vector resulting from recombinant gene expression refers to a polynucleotide resulting from a recombinant gene that includes one or more heterozygous sequences (i.e., a DNA sequence not of viral origin). In the case of the 887 vectors resulting from recombination, the DNA from recombination is surrounded by at least one of the reverse terminal repeat sequences (ITRs). In some embodiments, the DNA from recombination is surrounded by two ITRs.

١٨٨

41387Β1

10060 'A recombinant vector (rAAV vector)' denotes a polynucleotide containing one or more heterozygous sequences (i.e., nucleic acid sequences not of AAV origin) surrounded by at least one or two collated terminal repeat sequences (k ^) of AAV These vectors can be transcribed and packaged into infectious viral particles when present in a family cell that has been infected with a suitable adjuvant virus (or expresses appropriate auxiliary functions) and expresses the repellents of rep and cap from AAV ^ i.e., CapjRep proteins of 4). When including the rAAV vector, a larger polynucleotide (for example, in a chromosome or in another vector such as a plasmid used in cloning or infection), then the rAAV vector may be referred to as a primary vector that can be saved by copying and placement into capsid in the presence of 8867 filling and appropriate auxiliary functions. A vector 3887 can be in any number of forms, including, but not exclusively, plasmids, linear industrial chromosomes, complex with lipids, encapsulated in liposomes, and embedded in capsids in a viral particle, for example, particle 887. 887 to obtain a recombinant recombinant viral particle (rAAV particle).

10061 As used in the present application, the resulting cell line is a stable cell lineage that can produce 4 particles. In some embodiments, the AAV and / or capsid genes are statically conserved in the host cell lineage. In some embodiments, the AAV genome containing one or more of 115,887 DNA and heterozygous DNA (for example, an asymmetric GM gene) is maintained statically in the host cell lineage. In some embodiments, transcription and / or capsid genes are preserved with an AAV genome containing one or more of 887 ITRs and an acid.

Nuclear heterozygous (for example, an asymmetric genetically modified gene) is statically expressed in the cell lineage

١٨٨

41387Β1

the family. In some embodiments, one or more of the 887 transcription genes, the capsid genes, or the AAV genome comprising one or more M ^ ITRs 87 M8 are statically incorporated into the genome of the host cell lineage. Those skilled in the art can realize that DNA is retained and statically retained in the host cell lineage at multiple passes (for example, 5, 10, 15, 25, or more reflux operations).

[0062] It is an exclusion of a shahta, a form of a distinct yan, of a distinctive direction from the pattern of a mj of the rest of the entity to which it is compared, inserted, or included with it. For example, a polynucleotide introduced into genetic engineering mechanisms in a different cell type is a heterozygous modification of the nucleotide (and, when expressed, can encode a heteropeptide). Likewise, a cell sequence (for example, a gene or part thereof) embedded in a viral vector is a heterozygous nucleotide sequence with respect to the vector.

[10063 The term refers to a genetically modified gene for a polynucleotide inserted into a cell that can optionally be copied, transmitted and / or expressed under appropriate conditions. In aspects, it acquires a desirable characteristic of a cell in which it has been introduced, or otherwise leads to a desired therapeutic or diagnostic outcome. In another aspect, it can be transcribed into a molecule that leads to RNA interference, for example miRNA, siRNA, or shRNA.

00064 The term (T2I'R) refers to an amyl nucleotide sequence that can be derived

Gene expression derived from the transtheretin gene. In some embodiments, it may be a reinforcer of transethyretin from the mouse transgenetin (2118) (a pathway, for example, tsethylitin in a laparotomy, as annotated by 22139 GenBank Entrez Gene ID). Examples of reinforcers]] [are provided in Figure 1B.

<img file="MA41387B1_D0002.tif" />

fill

4138731

10065 The terminology particle (0) genome equivalents, or genome transcripts, to refer to a viral titre, refers to the number of virions containing the 887 DNA genome resulting from recombinant gene recombination, regardless of susceptibility to infection or function. Non-genome particles in a specific vector preparation can be measured by procedures such as those shown in the examples provided in the present application.

Clark et al. (1999) 1 Gene Ther., 10: 1031 -1039; Veldwijk et al. Or, for example, in

6: 272-278, ... / 7720AD (2002).

10066 The term may be used for transporters (depending on the requirement to be executed for one or more cases) of a nucleotide polynucleotide comprising a set of polynucleotide sequences from a vector, for example, a viral vector. The vector genome can be placed in capsid in a viral particle. Depending on the specific viral vector, the vector genome can include either single-stranded DNA, 8-0 double-stranded RNA, single-stranded RNA, or double-stranded RNA. A vector genome may contain endogenous sequences linked to a specific viral vector and / or any heterozygous sequences inserted into a viral vector defined by recombinant mechanisms. For example, the recombinant AAV ^ O genome could include at least one sequence surrounding a promoter, a given sequence (for example, an asymmetric transgenic gene), an optional intron, and a polyadenylated sequence. A complete vector genome can contain a complete set of polynucleotide sequences from a vector. In some embodiments, DNA transits from a viral vector can be measured on a 9 / mL basis. Suitable methods for measuring this titre are known in the art (for example, quantitative PCR).

[0067] The term can refer to an over-sized 887 genome resulting from recombinases to a genome resulting from 887 recombinases with a size (measured in nucleotide base pairs) greater than the conventional packing limit for the 887 genome, which was defined in the domain as 4.7 to 4.8.

fill

4138701

Kilobase (see, for example, -7: 2101 Dong, JY et al. (1996) 14746 / + 2 Therapy (2112).) In some embodiments, the hyperinsize 887 genome is greater than about 4.7 kilobases. A base.In some embodiments, the 887 genome of hyper-size, resulting from recombinase, is greater than about 5 kb. In some embodiments, the 887 genome is oversized by recombinant genome between about 4.7 kb base and about 9.4 kb, optionally about 4.7 kb. 1 kilobase and 6.7 kilobase

10068 The terms refer to an infectious unit (iu), infectious particle, or transcription unit, depending on the use in referring to a viral titre, to a number of infectious AAV vectors that are capable of transcription resulting from recombinant gene measured by an infectious marker test, also known as a transcription center test, as shown. For example, in 1963: 1963--62, 70 (1988) McLaughlin et al.

10069 The term transport unit (tu), as used in referring to a viral titre, refers to a number of AAV stir particles resulting from infectious gene recombination that lead to the production of a functional genetically modified gene product as measured in functional tests such as those shown in the examples in the present application. , Or, for example, in -144: 113, Xiao et al. (1997) Exp. Neurobiol 124; Or in 532-70: 520, .01L (1996) .etal. News of the LFU).

10070 Repetition unit, inverted blink or quadrant 1 ^ is a term well understood in the art and refers to relatively short sequences found at the ends of viral genomes that are opposite in direction.

[0071] The terminal iterative sequence of ITR (AAV), Salah is well understood in the field, and consists of a sequence of about 145 nucleotides found at both ends of the original 887 genome.

<img file="MA41387B1_D0003.tif" />

١٨٨

41387Β1

Single-stranded. [1] The twenty-five nucleotides farthest outward in two alternate directions can be found, resulting in a mismatch between the two different 887 genomes and between the two ends of a single 887 genome. The twenty-five nucleotides farther outward also contain many of the shorter autocomplete regions (referred to as Sphere 9). 9, A ', A, U

Lets pairing rules across strands in this section of 111.

10072 The terminal degradation sequence, or trs, is a sequence in a region of AAVITR that is divided by rep 887 proteins during viral DNA replication and is a mutant terminal degradation sequence resistant to cleavage by retinites rep 887

10073 The help 887 functions can be used to allow the transcription of AAV ^ 42 a defective cell. The assist 887 functions can be provided in any number of images, including, but not limited to, the helper virus or auxiliary virus genes that aid in the transcription and packaging of AAV. Other AAV auxiliary functions are known in the field as genotoxic agents.

10074 A helper virus refers to 887, indicating alvirus, which will allow the 887 (a small, defective virus) to be copied and packaged by a host cell. A number of these helper viruses have been identified, including adenoviruses, herpesviruses, poxviruses such as cowpox and bacovirus. Adenoviruses comprise a number of different subgroups, although the adenovirus type 5 of subgroup C () is the most commonly used. Various adenoviruses of human origin, non-human mammalian and avian origin are known and are available from repositories such as ATCC. Includes viruses from the herpes family, which are also available from repositories such as 410 for example, herpes simplex viruses (115), EBV viruses (Epstein-Barr), CMVs.

١٨٨

41387Β1

(7 * 2) and PRV. Examples of adenovirus helper jobs include AAV versions 114 jobs • 11, 124 jobs 78 and E4orf6 jobs. Includes Bacillus viruses available from MPV repositories (Autographa califomica)

00075 A formulation of 3887 is said to be substantially free of helper virus if the ratio of 887 infectious particles to infectious helper virus particles is at least about 102: [; at least about 104: 1, at least about 106: 1; Or z, less about 108: 1 or more. In some embodiments, preparations are also devoid of equivalent quantities of adjuvant virus proteins (that is, proteins that lead to this level of helper virus if the adjuvant particle impurities noted above are present in intermittent form). In general, viral and / or cellular protein contamination can be observed in the form of the presence of Coomassie staining bands on gel species? (For example, the emergence of domains other than those of the proteins-capsidlhah, which are VP1, 2? 7 and 3M.

10076 The percentage (/) of sequence congruence for a reference polypeptide or a reference nucleic acid sequence is defined as the percentage of amino acid building blocks or nucleotides in a candidate sequence identical to the building blocks of an amino acid or for nucleotides in the polypeptide or for the reference nucleic acid sequence, if necessary, after aligning the sequences and inserting , To find out the maximum percentage of congruence, and not taking into account any conservative substitutions as part of the sequence congruence. Alignments can be performed for the purposes of determining the percentage of matching of amino acid or nucleic acid sequences in a variety of ways that are considered skilled in the art, for example, using publicly available computer programs for example, those described in Current Protocols in including, Molecular Biology (Ausubel). et al., 05., 1987), Supp. 30, section 7.7.18, Table 7.7.1

١٨٨

41387Β1

This includes ALIGN, BLAST-2, BLAST or DNASTAR (Megalign) programs. An example of alignment software can be identified from ALIGN Plus (Scientific and Educational Software, Pennsylvania)

They are skilled in the field of appropriate variables to measure alignment, including any calculations necessary to achieve maximum alignment across the full length of the sequences being compared for purposes of the present application. The percentage of conformity of the amino acid sequences from the given amino acid sequence A, with, or against the sequence is calculated Certain amino acids B (which can be alternatively formulated as a specific amino acid sequence A comprising or characterized by a certain percentage match in the amino acid sequences to, with, or against the specific amino acid sequence B) as follows: : 100 in الجز /, where “is the number of amino acid building units that are considered identical according to the sequence alignment program in the alignment of that program for both A and B, and where it is the total number of amino acid building units in B. It should be understood that when the length of the amino acid sequence A is not equal to the length of the amino acid sequence B, the percentage of congruence of the amino acid sequence A with B is not equal to the percentage of congruence of the amino acid sequence B with A. For the purposes of the present application, the percentage of congruence of the sequence of nucleic acids in the sequence C to, with, or against the sequence of specific nucleic acids d (which can be expressed alternatively by the sequence of specific nucleic acids C that includes or have a certain percentage match of the sequence of acids Nucleic acid into, with, or opposite to a certain nucleic acid sequence d) as follows: 100 in the segment W / Z, where W is the non-nucleotides considered to be congruent according to the sequence alignment program in that program alignment for both C and D, and where Z is the total number of nucleotides in D and it should be understood that when the length of the nucleic acid sequence C is not equal For the length of the nucleic acid sequence, the percentage of congruence of the nucleic acid sequence c to d is not equal to the percentage of congruence of the nucleic acid sequence d to c.

fill

4138731

10077 An isolated molecule or cell (for example, nucleic acid or protein) means that it has been identified, separated, and / or recovered from a component in its natural environment.

0078] An effective amount is an amount sufficient to produce beneficial or desirable results, including clinical outcomes (eg, symptom relief, clinical endpoint achievement, etc.). An effective amount may be given in one or more administrations. For a disease, 5 effective amount is a sufficient amount to relieve, stabilize, or delay the progression of a disease.

[0079] A person or subject to treatment is a mammal. Mammals, but not exclusively, domestic animals (for example, cows, sheep, cats, dogs, and horses), rhesus (for example, humans and non-human primates such as monkeys), rabbits, and rodents (for example, mice and rats) . In certain embodiments, the individual or subject to treatment is a human being 10 10080 depending on its use in the current application. Treatment is a method of obtaining beneficial or desirable clinical results. For the purposes of the present invention, it includes beneficial or desirable clinical outcomes, but an exclusive form of vomiting, limiting the extent of disease, fig (for money, no worsening) disease status, preventing the spread (for example, penetration) of a disease, delaying or slowing down. Disease progression,

Alleviate or mitigate disease status, and induce remission (either partial or total), whether detected or not. 15 Treatment can also mean longer survival compared to the expected survival if no treatment is received.

[0081] According to its use in the present application, the term preventive treatment refers to a treatment, whereby an individual is known or suspected of having an affliction or faces the possibility of developing a disorder but has not shown any 8/41387Β1

Asymptomatic or showing marginal symptoms of the disorder. An individual may be treated with prophylaxis before the onset of symptoms.

[0082] Depending on the use of the money requested, a therapeutic agent (on LL, polypeptide, DNA, or GM gene) is a factor that provides a beneficial or desirable clinical outcome, such as the representative clinical outcomes shown above. As such, a therapeutic agent may be used in 5 treatments as described above.

[0083] As used in the present application, the value of the distribution with a differential parameter or (5) is an alternative to solutions of the diffusion equation 10 to describe the variations of the precipitate particles; for example during ultracentrifugation.

[0084] As used in the current application, Svedberg units refer to a unit sedimentation rate. 10 The sedimentation rate of a particle of a given size and shape measures the velocity of precipitation of a particle. One Svedberg unit equals 10 seconds. For example, Svedberg units are often used in inverse rate

Molecule transmission under centrifugal force in a centrifuge.

20085 Depending on their use in the present application, precipitation velocity conditions or

Precipitation velocity marginal conditions to any experimental conditions in which a sample solution is subjected to sedimentation velocity analysis 15 The sedimentation velocity enables the study of particles over a wide range of pH and ionic strength conditions and at temperatures from 4 to 40 ° C. The rate at which the sedimentation bound is moved is a measure of the sedimentation factor of the sediment type. The sedimentation factor depends on the molecular weight (the larger the particles settle faster) as well as the whole molecular weight. The minimum sedimentation limit width is related to the diffusion coefficient of the molecule; The presence of multiple species with identical precipitation coefficients causes the limit to be wider than what would be expected of 20

fill

4138731

Proliferation basis alone. Sedimentation velocity conditions may include non-exhaustively any conditions related to rotor velocity, distance between sample and rotor center, temperature, solvent, sample, buffer solution, ultracentrifugation time, detection interval, strip and optical window properties, 80 instruments (including In it the supercentrifuge unit and detector), solvent equilibrium dialysis for reference, and arithmetic operations for data analysis.

10086 As used in the present application, the term analytical intensity gradient sedimentation equilibrium relates to methods for measuring the floating intensity of a particle, or by using differences in floating intensities to separate different particle types. These methods may use, for example, sedimentation equilibrium mechanisms of 40. In these methods, a solution of particles (for example, not exclusively, a solution of a polypeptide, a polynucleotide, viral oxapsides) may be subjected to supercentrifugation in a gradient solute, such as Cesium chloride or cesium sulfate gradient, until equilibrium with solubility. At equilibrium, the particle solution is concentrated, or bands, at the gradient position where the intensity of the particle is equal to the solute intensity. The position of the bands can be used to calculate the intensity of the particles, or a band can be extracted to isolate a single particle type.

10087 As used in the current application,] 51011 arithmetic is an operation

Schuck (2000) Biophys. %,) Arithmetic allowing the analysis of dynamic water data such as sedimentation velocity

78: 1606-19). In SEDFIT computation, a network of sedimentation parameters is constructed over a predicted range. Precipitation limits are simulated using solutions to the Lamm equation for each sedimentation parameter, assuming a constant particle shape and solvent friction ratio.

١٨٨

41387Β1

10088 Depending on its use in the current application, the term statistic [or ratio] refers to the level of confidence. This variable controls the amount of organization used. And it has a different meaning for different ranges: from 0 to 0.5, no regulation is used. Values ​​from 0.5 to 0.999 correspond to probabilities (confidence levels). From these values ​​of m, the desired quadratic increase of chi available for constraint in regulation is computed with F stats A value of 051 results in very little regulation; Values ​​of 0.68 to 090 correspond to the commonly used confidence levels (typically, using 50 scans or have a minimized of the quadratic increment chi to correspond to a probability of 0.7 is about 100%), while values ​​close to 0.99 lead to a very high regulation. The relationship of these values ​​can be tested with Probabilities with the F stats calculator; since numbers larger than us are entered, they can be taken directly as chi-squared ratios (because it is not There are chances of a greater than!). For example, a value of 1.1 leads to a 10% regulation of the chi-squared node 10%

10089 Referring to an argument or variable in the request for a current (and describing) models attachment to that value or to a variable itself. For example, a description referring to about X includes a description of x

10090 According to its use in the present application, the use of the singular includes the meaning of the plural unless otherwise indicated 15.

[0091] It should be understood that aspects and models of the last mentioned in the present application include including, a component of, 9 components that constitute a basic part of the aspects and models.

III- Viral particles

fill

4138731

0092 Certain aspects of the present disclosure are related to glandular virus particles (887) containing the 887 recombinant genome (887) of an oversized size (for example, by product by methods and / or cell strains described in the present application). Certain aspects of the present disclosure relate to glandular virus particles (887) containing the rAAV genome between about 4.7 kb and about 9.4 kb, optionally about 4.7 kb and 6.7 kb. In some embodiments, the rAAV genome is greater than about 5 kb base in capsid by 887 capsid. In some embodiments, the rAAV particle comprises of the rAAV vector. In some embodiments, the rAAV vector contains the rAAV genome between about 4.7 kb base and about 9.4 kb, optionally about The rAAV genome is greater than about 5 kb base, and in some embodiments, the rAAV genome ranges between about 5 kb base and about 7.0 kb base, between about 4.7 kb base and about 9.4 kb base. Or between about 4.7 kilobase And about 6.7 kilobase. In some embodiments, the 3887 genome is larger than approximately 5.0 kb base, 5.1 kb base, 5.2 kb base, 5.3 kb base, and 5.4 kbps,

5.5 Kilobase, 5.6 Kilo base, 5.7 Kilo base, 5.8 Kilo base, 5.9 Kilo base,

6.0k base, 6.1kg base, 6.2kg base, 6.3kg base, 6.4k base,

6.5 kilobase, 6.6 kilobase, 6.7 base kilobase, 6.8 kilobase, 6.9 kilobase,

7 0Kb base, 7.1 Kilobase, 7.2 Kilobase, 7.3 Kilobase, 7.4 Base base,

7.5 Kilobase, 7.6 Kilo Base, 7.7 Kilo Base, 7.8 Kilo Base, 7.9 Kilo Base

8 .0 base kilobase, 8.1 kilobase, 8.2 kilobase, 8.3 kilobase, 8.4 kilobase

8.5 kilobases, 8.6 kilobases, 8.7 kilobases, 8.8 kilobases, 8.9 kilobases.

fill

4138731

9 0 kb base, 9.2 kb base, 9.3 kb base or 9.4 kb base in length or any value in between.

10093 In some embodiments, the viral particle is a recombinant 887 particle comprising a DNA heterozygous (for example, an asymmetric genetically modified gene) surrounded by one or two terminal repeats inverted from it (!). The 887 particle is a nucleic acid, which is a ficapsid. The 887 particle also includes capsid proteins. In some embodiments, the DNA comprises the respective coding sequences (for example, an asymmetric genetically modified gene) that is effectively linked to components in the transcription direction, comparison sequences including transcription initiation and termination sequences, thus creating an expression strand that forms a ribbon. The expression is surrounded by at least one function, '5 and 3, respectively. The ITR sequence 7 A 88 functional means that the ITR sequence is functioning as intended to rescue, copy and fill Virion.

Davidson et PNAS, 2000, 97 (7) 3428-32: Passini et 4., 7, 70., 2003, see. AAV 40-7034: (12) 77 and are all included in: and Pechan et 2 (6, uh. Ther., 2009, 16: 10-16,

The current application is for full reference. To practice some aspects of the invention, vectors resulting from recombinant gene recombination include at least all AAV sequences necessary for inclusion in capsid and the physical structures of infection by 3887. The AAV ITRs used in vectors in the invention do not necessarily have a nucleotide sequence of the untreated type (eg, As described in Kotin 1994,5: 793-801, .662 Ther, they can be altered by inserting, deleting or replacing nucleotides or AAV ITRs can be derived from any of the many AAV serotypes. More than 40 serotypes are now known from 887, and new serotypes and alternatives to serotypes are continuing to be recognized

Gao et ^ /., ^ 5,2002.99 (18): 11854 ^ Gao et al., PNAS, 2003,100 (10): 6081-current 0

١٨٨

41387Β1. Any serotype is used: and Bossis et 810-6799: (12) 77, 2003, 0 / l..ah.

87 M8 is included in the present invention. In some embodiments, the 887 vector is a derivative vector of the 887 serotype, including but not limited to, 44, AAV3 42, AAVl AAVrhlO, AAVIO, AAV9, AAVrhSR, AAVrhS 78 477, 76, 75; AAVl; AAV DJ, 88712, AAV2R471A, 887 goat, 887 bovine, or mouse 887 or so. For example, in some embodiments, the AAV serotype is AAVl 8876 (445, AAV2, AAV10 449, AAVrhSR, AAVrhS 48 47). , Or AAVrhlO In some embodiments, the DNA in AAV ITRs is 42, AAVl AAV3; 44 75 476 77 78, AAVIO, AAV9, AAVrhSR. , AAVrhS AAVrhlO; AAV2R471A, AAV12, AAVll, • 8867, AAV from goat, bovine AAV, or mouse serum patterns ITR 887 or so. In certain embodiments, DNA includes:

0AAV2 ITR on AAV

10094 In other embodiments, rAAV particles include AAVl capsid, AAV2 capsid, AAV4 capsid 443, 8875 capsid, 886 capsid (for example, unpainted AAV6 capsid, AAV6 opacid alternative to SHH10, as described in capsid AAV6. , AAVrh8 casside, AAVrh8R capsid, 8879 capsid (for example, AAV9 capsil of untreated type, or modified AAV9 capsid as described in 92013/0323226) AAVIO ^, (Us PG, capsid AAVrhlO, capsid 11 AAV, capsid 2a AAV, mutant tyrosine capsid, heparin binding capsid mutant, capase AAV2R471A, capsid AAVAAV2 / 2 ^ 7m8, Capsid (887) (e.g. Capsid 8 / AAV, DJ-AAV ^, Capsid 8 / AAV ^, DJ, Capsid AAV2R471A) Another capsid of the capsids shown

fill

4138731

-42472 E548A42 capsid Ν587Α ^^, (US PG Pub. 2012/0066783 at

27708 AAV capsid 77081, capsidl 8e from goats, capsid AAV1 / AAV2 chimeri, bovine capsid, 887 mouse capsid, rAAV2 / HBoV cassid, or capsid shown in US Patent No. 8,283,151 (8, 283, 151) or International Version 40/2003 (2003/042397). In some embodiments, a mutated capsid protein retains the ability to form 4 capsid. In some embodiments, the rAAV particle includes a mutant LV glycapsid. Zhong L. et 4., (2008) Proc Natl 4044 5: USA 105 (22): 7827-7832. 445

In other embodiments, the rAAV particle includes serotype 887 capsid proteins from Clades AF rAAV 080 (and in some embodiments, the rAAV particle, et al., 6381: (12) 78, 2004.10L)

Ilesproteincapsid AAV1 or a mutant thereof. In other embodiments, the rAAV particle includes or mutant AAV2 proteincapsid. In some embodiments, the AAV serotype is 41 AAV2, 445) 46 477 448 AAV10 479, AAVrhSR, AAVrh8, or AAVrhlO. In some embodiments, the rAAV particle includes a serotype 1 (4) rAAV particle, and in some embodiments, the rAAV particle includes serotype 2 (442) and in some embodiments, the rAAV particle includes or mutant AAVrh8R elkapsid.

10095 The different AAV serotypes are used in achieving the ideal from transporting specific target cells or targeting specific cell types in a specific target tissue (for example, liver or CNS tissue). The rAAV particle can include viral proteins and viral nucleic acids derived from the same serotype or different serotypes (eg, mixed serotype). For example, in some embodiments a particle may include at least one AAVl capsid and 8872 ITR proteins, or it can It includes the proteins AAV2 and AAVl capsid

fill

4138731

11 At least one, the present application provides any combination of 887 serotypes to produce a 487H 7 particle as well as a combination of less which has been explicitly described in the present application. In some embodiments, the invention provides 2887 particles comprising elkabsid 8871 and the rAAV vector included in the present disclosure (for example, an expression bar containing heterogenous nucleic acid). , Surrounded by at least one of 211 and in some embodiments, the invention provides AAV particles comprising glycapside 2. In some embodiments, 118 and the capsid are derived from 42. In other embodiments, ITR is derived from AAV2, and capsid is derived from AAVrhSR.

50096 Other aspects of the present disclosure relate to compositions comprising rAAV particles, which include at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least 35%, at least about 40 ° A, at least Least about 45% at least about 50% at least about 55%, at least about 60% or at least about 70% at least about 80% at least about 90% or at least about 495 of the 887 particles in the rAAV genome capsids between about 4.7 A kilo base and about 9.4 kilobases, optionally about 4.7 kilograms of base and about 6.7 kilograms Base. In some embodiments, rAAV particles include in genome capsids greater than about 5 kb. In some embodiments, rAAV haematomas include in genome capsids greater than about 5.0 kb-o, 5.1 k-base, 5.2 k-base, 5.3 k-base, 5.4 k-base, 5.5 k-base, 5.6 k-base.

Base, 5.7kg base, 5.8kg base, 5.9kg base, 6.0kg base, 6.1kg

Base, 6.2 Kilobase, 6.3 Kilo Base, 6.4 Kilo Base, 6.5 Kilo Base, 6.6 Kilo Base

Base, 6.7 Kilo Base, 6.8 Kilo Base, 6.9 Kilo Base, 7.0 Kilo Base, 8.0 Kilo Base

A base or 9.0 kb base length or any value in between and in some embodiments, does not contain a genome

fill

4138731

The 887 genome packaged with an amputation at pin 5 'In some embodiments, the 887 genome does not contain an amputation at pin 3 • Methods for testing the size of the 887 genome [887] are well known in the field and include not exclusively the Southern Spot and analytical ultracentrifugation, as described below.

10097 In some embodiments, the compositions in the present disclosure contain rAAV particles, containing at least about 15%, at least about 20%, at least about 25%, at least 30%, at least about 35%, at least about At least 40% about 45%, at least about 50%, at least about 55%, at least about 60% at least about 65% at least about 70% at least about 75% at least about 80%, at least about 85 %, At least about 90% or at least about 95% of the rAAV particles in the rAAV genome capsid are greater than About 4.7 kb base, greater than about 0. 5 Kilobase, greater than about 5.1 Kilobase, greater than about 5.2 Kilobase, greater than about 5.3 Kilobase, A greater than about 5.4 Kilobase, greater than about 5.5 base Kilo base, A greater than about 5.6 base Kilo base, A larger than About 5.7 kilobases, larger than about 5.8 kilobases, larger than about 5.9 kilobases, larger than about 6.0 kilobases, larger than about 6.5 kilobases, bigger than about 7.0k for base, bigger than about 7.5k for bases, bigger than about 8.0 kilobases, a larger than about 8.5 kilobases, greater than about 9.0 kilobases, or Greater than about 9.4 kilobase. And in some embodiments, the packaged 887 genome does not contain an amputation at pin 5. And in some embodiments, the packaged 887 genome does not contain an amputation at 'tip 3.

10098 In some embodiments of the invention, the viral particles resulting from the recombination in the composition are highly purified, buffered solution, concentrated, and in some embodiments,

fill

4138731

For viral particles MTCG to at least about 1 * 210 »/ ml to about vgio¹³9 Hope or any focus in between.

10099 As the present application describes, one of the mechanisms for describing a preparation of viral particles (for example, one or more characteristics associated with the size and / or integrity of the vector genome) is through the use of the Southern Spot. For example, as described in more detail in the examples Below, the 887 particle preparation (optionally purified as described in the present application) can be processed with 088 no nucleic acid not embedded in capsid, treated with a digestion-arresting agent 03 (eg, 101) digested with a proteinase enzyme, and then subjected to extraction of 04 packaged vector genomes. The vector genomes can then be separated by electrophoresis, cross-linked on a membrane, and tested with one or more of the numbered probes that are specifically transformed by the hybridization into the vector genome. Of specific size) the size of the vector genome. In addition, one or more probes that hybridize to known segments of the vector genome (eg, terminals 5 or 3) can be used. If one or more of these probes fail to hybridize to a vector genome, this indicates that the vector genome (s) of the preparation may be amputated or otherwise deleted, b being of a greater size than their expected full size because packing of 887 geomodes is known to be starting the ends (3). 3291-20: 3282 L 4080 (2001) eh, King, JA et al.), Hyper-sized vectors can lack sequences at the ends of negative strands when genome size exceeds 4.7 kilobases. In some embodiments, viral particles comprise hyper-sized genomes larger than about 5.0 kb. The viral genomes contained in capsid in rAAV particles include 50 and 3 (3) relatively intact terminals; for example, measured by hybridization into probe

١٨٨

41387Β1

Quality for the parties. And / or '3. Hybridization can be measured by methods known in the field including, but not exclusively, Southern Spot Analysis or 01] and in some embodiments, the packaged 887 genome does not contain an amputation at pin '5. And in some. Models, the packaged 887 genome does not contain an amputation at 'tip 3.

Analytical ultra-centrifugation

[0100] How much describes the order of Lali, one of the two mechanisms describing a preparation of Jasan Al-Fiosi 5 for example, one or more of the characteristics related to the size of the vector genome and / or its integrity) is made using analytical ultracentrifugation (0 not 8). Models, to evaluate the integrity of the vector genome in recombinant viral particles (rAAV) are used in the rAAV particle preparation to distinguish viral particles with intact whole genomes, viral blank capsids and viral particles with 10 genomes. Alternative viral (eg, amputations, agglomerates, impurities etc.). Further description of the use of analytical ultracentrifugation to characterize viral particles (eg, 887) can be found in the US provisional patent application with serial number 62 / 105,714.

Analytical Ultracentrifugation for Characterization of Recombinant, (7 14, 1 05/62)

viral Particles, filed on January 20, 2015, and is included in the current application for reference in its entirety. 15th

[0101] Analytical ultracentrifugation is a method for assessing the molecular weight, hydrodynamic, and thermodynamic properties of a protein or other large molecule or protein heterogeneity at a rapid rate of precipitation over a range of conditions including concentration, temperature, ionic strength, and pH. For example, Protein can be analyzed in a clinically relevant form. Use is provided

fill

4138731

-47Berkowitz, SA &amp; Philo. Expulsion for two supercentral analysis of the characterization of adenovirus preparations by JS, (2007) Anal. 7306726771., 362: 16-37

10 102 The 0na 8 analysis refers to quantitative methods for describing the biophysical properties of particles (for example, polypeptides, polynucleotides, and viral capsids) by measuring their migration through a solvent in a centrifugal solution. The 0 to 8 analysis has been well established over many decades and is considered highly temporary. Because its analysis relies on hydrodynamic and thermodynamic information from the first principle, it can be applied to determine the biophysical properties of many types of particles across a wide range of particle concentrations and sizes. An atypical analysis includes two main types of experiments: sedimentation velocity and sedimentation equilibrium The sedimentation equilibrium analysis leads to thermodynamic properties. They can be used to measure properties such as valence and quantitative correlation constants. The sedimentation velocity results in aqueous dynamic properties of the particles that can be used to measure properties such as size, shape, and concentration. One feature of the ALA analysis of viral preparations is that the same test conditions can be used in the analysis of different preparations of viral particles regardless of the nucleotide sequence in the viral genome or serotype. For capsid.

10103 Certain aspects of current detection relate to the use of sedimentation velocity analysis to characterize viral capsid properties. In some embodiments, sedimentation velocity analysis uses a two-segment hypercentrifugation velocity cell in dialysate equilibrium (one for an experimental sample and the other for a reference sample of solvent only), each containing two light windows that allow light to pass through the chamber. The ultracentrifugation applies an angular velocity to the cell and leads to the rapid sedimentation of soluble particles towards the bottom of the strip. With sedimentation occurring, the solute is carried out close to the crescent body at the apex of the cell, to form a sedimentation boundary between the depleted zone and the sedimentation melt. The rate of movement or carry over of the sedimentation limit is measured by taking comparative measurements

١٨٨

41387Β1

Characteristics of the sample and reference sectors with specific time intervals (for sedimentation velocity, these intervals are typically in minutes). In the presence of multiple solutes, this may lead to the formation of multiple sedimentation limits, each corresponding to a soluble species.

10104 Known in the field many methods of optical detection to limit the sedimentation rate of movement or its migration (for reference, see 79-84: 143, 2008) Methods Cell Biol (uh general •). In some embodiments, the reference sector and the sample segment may be tested by detecting absorption. In this detection method, the absorption at a specified wavelength of the sample sector and the reference sector can be measured at different radial positions within each sector. Alternatively, the absorption time pathway can be measured from a single diagonal position. Beer's law provides a mathematical relationship between absorption and solubility extinction coefficient.

10105 In some embodiments, the reference sector and the sample segment may be tested by interference detection (for example, Rayleigh interference detection). In Rayleigh's interference detection method, an interfering optical system has two parallel apertures. A single symmetric ray of light b splits as it passes through the two windows, and then the two rays are re-integrated when these two light waves merge, so they form an interfering pattern for the reciprocal margins of light and darkness. If the sample and the reference samples have identical refractive index, the resulting interference margins are perfectly straight. Increasing the solubility concentration increases the refractive index of the solution, thus obstructing the sample's sunlit ray and causing a vertical hem displacement. By measuring this offset of the foot, the solubility concentration in the sample can be measured. Unlike absorption detection, which measures the absolute values ​​of a sample and the reference, interference detection measures a relative difference between the sample and the reference. Nevertheless, interference detection results in peaks that are directly proportional to the concentration, and can be used for types of samples that are not highly absorbed. As a reference relating to the use of interference optics for Rayleigh optics using 40 see Furst. (1997) Ewr. Biophys. 7 35: 307-10

<img file="MA41387B1_D0004.tif" />

41387031

10106 The measurement of the rate at which the sedimentation bound is moving can be used to derive many of the physical properties of soluble particles. The rate of movement of the limit determines the sedimentation coefficient, and is based on the mass and shape (coefficient of friction) of the particle. The sedimentation coefficient of a particle, S, refers to the ratio of its velocity to the acceleration applied to it by a mercury ejection field. ). The sedimentation factor of a particle or solution particle depends on its 5 properties, for example molecular weight (buoyancy correction), and properties of the solvent.

[0107] The change in the concentration limit of a solute over time during supercirculation can be determined by the equation 78: 16O6-19 (Lamm, L. Schuck (2000) Biophys). In summary, an equation within a solute concentration limit calculates over time in response to the competing forces in sedimentation (which concentrates the solute) and diffusion (which disperses the solute), taking into account the segment-shaped cell and the centrifugal field generated by the rotor 10. The equation can be interpreted as follows:

Equation !: (2 + (/ 0)] p.2 / 2) [= /

Inductance (C) from the soluble wheel) • Till the price of a product, S, complete the Wasabi coefficient ® represents the angular velocity of the rotor, r is the radius, and what is the time.

10108 By configuring the unprocessed data for the solution to the equation “greased, it is possible to determine the properties of solute such as the sedimentation factor 15 and the change in the concentration variation. For example, the experimentally determined values ​​of the rate of change of a sedimentation limit can be modeled by using equation 141 to derive the sedimentation factor, the molecular mass, or the concentration of the soluble constituent of the bound.” Several well-known programs in the art, such as Schuck (2000) (SEDFIT 310,78: 1606-19) can be used to model AUC data in Equation 30o 1. These programs can also apply 0000] to solutions containing multiple solvents or multiple sedimentation limits. 20

fill

4138731

10109 An example of a suitable program for determining solute properties is the computation SEDFIT. In some embodiments, the SEDFIT calculation can be used to calculate the value of the distribution of the differential parameter, or (6) 0, using data No 8 solutions containing a mixture of types of particles (for reference, see 19-78: 1606,. Schuck (2000) Biophys. In arithmetic 7] [11] a network of sedimentation parameters is constructed over a predicted range. Precipitation limits are simulated with solutions of the Lamm equation for each sedimentation parameter, assuming constant particle size and solvent friction. The actual AUC data is then initialized for Lamm solutions to derive a distribution value for differential coefficients, or (5) 0. Many other programs can be identified for analyzing Cole and Hansen data, AUC (1999) 7.730 / 7707 Tech. 10: 163-76

[10 001 In some embodiments, the viral particles are generated in cells of a suitable family and purified. In some embodiments, the viral particles are purified by affinity chromatography. Methods for purifying AAV particles are well known in the art. For example, using a viral capsid protein antibody or a viral capsid protein binding complex on chromatography media

[0111] In some embodiments, the sedimentation velocity of analytical supercentrifugation (-87 ml8) is analyzed using an analytical supercentrifuge that can characterize a sample in its original state under conditions of bio-related solutions (for example, Beckman Coulter) p roteomeLabTM XL- Ι)) When using 1-ProteomeLab ™ XL, the sample is loaded into the sample segment from a two-segment velocity cell, and a vector contrast material (eg,? • no virus. Resulting from recombinant recombination) is loaded into the corresponding reference sector. The sample is placed in the rotor with the four cavities and allowed to be balanced in the tool until a temperature of about 20 ° C is maintained and a complete discharge of about one hour. In an analog embodiment, the centrifugation is carried out at a acceleration speed at about 20,000 rpm

fill

4138731

A minute, about 20 m, and about 0.003 cm, as a diagonal step, with no delay and no copies. As shown below, different variables of centrifugation can be used. In some embodiments, the absorption (260 nm) and / or the optical properties of the interference (for example, the optical properties of Rayleigh interference) are used in the simultaneous recording of the radial focus as a function of the right time that the smallest deposition component exits the optical window. In some embodiments, the radial concentration is recorded so that the sediment having the lowest density is removed from the sector. In some embodiments, sedimentation is monitored so that less dense viral particles resulting from recombination are deposited to the bottom of a section of a supercentrifuge. A strip may be part of a supercentrifuge; for example, a velocity cell from a supercentrifuge. In some embodiments, a strip may be a portion of a supercentrifuge in which samples are detected and in some embodiments, a supercentrifuge uses a supercentrifuge comprising a velocity cell from a supercentrifuge. In some embodiments, monitoring is done until viral particles resulting from recombinant gene recombination are deposited to the bottom of a velocity cell from a supercentrifuge. In some embodiments, sedimentation is monitored until less intense recombinant viral particles precipitate out of the light window. In some embodiments, the diagonal concentration is recorded for at least approximately 0.5 hours, 0.75 hours, 1.0 hours, 1.5 hours, 2.0 hours, 3.0 hours, 4.0 hours or 50 hours, and in some embodiments, the diagonal concentration is recorded at about 1.2 hours. The ideal operating conditions include, for example, continuing operation until all sediments are completely deposited to the bottom of the sector, while maintaining a constant temperature at 20 m and a speed between 18,000 rpm and 20,000 rpm. As noted below, temperatures and speeds can be used. Other

١٨٨

41387Β1

[0112] The percentage of complete capsid is determined by analyzing several scans (eg, 75) from each detection method using a continuous size distribution model 0C (S) SEDF! T The second derivative regulation is applied in the initialization. In some embodiments, the statistic confidence level is around 0.68. In some models, the statistical confidence level] is more than about any of the 0.68, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95 or 0.99, or any value in between. In some embodiments, the following C (S) variables are fixed: atomization is about 200S to about 5000S, s min is about 15 to about 1005, S max is about 100S to about 5000S, and the friction ratio is about 1.0 or allowed to float. To a specified value by the centrifuge program. In some embodiments, the decay is about any of 2005, 3005, 4005, 5005, 6005, 7005, 8005, 9005, or 1000S, or any value in between, and in some embodiments, the decay is about 2005 and in some embodiments, Smax is Around any of 1005, 2005,? 300, 4005, 5005, 6005, 7005, 8005, 9005, or 1000S or any value in between. In some embodiments, where Smax is about 2005 and in some embodiments, the friction ratio is allowed to float to a value specified by the centrifuge program. In some embodiments, the friction ratio is about 1.0 and in some embodiments, noise subtractions are applied that do not change with the diameter (51) 9 that change with time (TI). In some embodiments, the location of the meniscal body is allowed to float, which allows the program to choose the ideal position and in some models, the ratio of friction and buoyancy is available, in a way that allows the program to choose the ideal position. The model prepares the data for the Lamm equation, and the resulting volume distribution is the sedimentation distribution coefficients and looks like a color scheme B where the area under each vertex is proportional to the concentration in Fringe units or (00) the causation coefficient (in CFEDBJ units) and the relative concentration (in units of E 0) for each component in Distribution In some embodiments, the multiple AUC operations represent independent testing

fill

4138731

For each analysis the following features are monitored to ensure the quality of the results? Initialization quality (rmsd), uniformity of interference OD260 ratio (260 pulse / IF) for peak poke, saturation parameters of each type between runs, and the overall quality of scans.

13 101 In some embodiments of the invention, extinction coefficients are used to calculate the molar concentration and the actual percentage value of the intact carrier peak from the absorption data. The molar absorption extinction coefficients can be calculated for the empty capsids (5A »0 •• / 5260 = 3.7256) and the proper vector.

Sommer Aj al. (2003) Mol Ther., 7: 122 (3.00) based on published equations e7 = € 26o / vector)

8 ). Depression coefficients are available for empty capsid peaks and intact vectors. The values ​​of 0 (5) can be determined using the SEDFIT calculation shown by -78: 1606 and Schuck (2000) Biophys 19. The molar concentration of both the healthy carrier and the empty capsid can be calculated using Beer's law and calculate the percentage of full capsid from these values ​​and in some embodiments, the values ​​are recorded. Based on percentage of complete capsid.

[0114] In some embodiments, it is not experimentally possible to determine the extinction coefficient of specific types of viral particles resulting from recombination (eg, viral particles with segmented genomes of unknown size and sequence). The relationship between value? And genome size can be established by analyzing viral vector preparations resulting from recombinant viral genomes embedded in capsids of known nucleotide size and the corresponding S value is determined as the current application describes. The computed S values ​​can be represented graphically to obtain a standard curve that can compare recombinant viral species with unknown molecular weight or genomic size to alter the molecular weight of the unknown species.

fill

4138731

15th 01 In some aspects, the preparation of viral particles resulting from recombinant gene recombination (for example, rAAV particles) is described by (a) subjecting to an analytical supercomputer Mercury expulsion under conditions of marginal sedimentation velocity where the deposition of viral particles resulting from recombinant gene recombination is monitored at time intervals (at Example, one or more times), (B) the graphical representation of the value of the distribution of the differential sedimentation coefficient ((C (S)) versus the sedimentation factor in units of Svedberg (5), (C) the integration of the area under each vertex into the (C (S) distribution to determine the concentration Relative to each vertex, and Each vertex represents a type of viral particle resulting from recombination. In some embodiments, the type of viral particle resulting from recombinant gene recombination that is being recognized includes, but is not limited to: Complete viral particles resulting from recombination that do not contain intact viral genomes resulting from recombination, empty viral capsid particles resulting from recombination. Recombination, and recombinant viral particles including alternate viral genomes resulting from recombination. In some embodiments, the surrogate genomes are smaller than the healthy viral genome resulting from recombinant genomes (for example, truncated genomes). In some embodiments, the surrogate genomes are larger than the healthy viral genome resulting from recombinant genetic recombination (for example, clusters, recombinant elements, etc.). In some embodiments, a preparation of viral particles resulting from recombinases (for example, 3887 particles) is described by (a) subjecting the preparation to analytical ultra-centrifugation under marginal sedimentation velocity conditions where the precipitation of viral particles resulting from recombination is monitored at time intervals (at least). (For example, one or more times), (b) the graphical representation of the value of the differential sedimentation coefficient distribution (5) 0 versus the coefficient

Sedimentation in Svedberg units (?), (C) Identify the type of viral particles resulting from recurrence

١٨٨

41387Β1

Genetic association in the formulation with peaks on the curve corresponding to the value?, Where the genome size of a specific type of viral particle resulting from recombination is calculated by comparing the S value for the type of standard curve generated with values ​​of? Capsid is of other known size. In some embodiments, the methods also include integrating the area under each vertex into a distribution (5) to determine the relative concentration of each type of viral particle resulting from recombinant gene recombination. In some embodiments, the precipitation of viral particles resulting from recombination is monitored at a single time interval. In some embodiments, deposition of viral particles resulting from recombination is monitored at more than one time interval.

10116 In some embodiments, the precipitation of viral particles resulting from recombinases (eg, 3887 particles) is monitored with optical density measurement or absorption at about 260 tanometers and the means for measuring absorption are well known in the art. In some embodiments, a micro-centrifuge used in 0 to 8 is equipped with means to measure the uptake; in other embodiments, the deposition of viral particles resulting from recombinant gene interference is monitored. In some embodiments, the deposition of viral particles resulting from recombinases is monitored with the Rayleigh interference. Interferometers are known in the field (10-35: 307 L. Furst (1997) Eur. Biophys). In some embodiments, a supercentrifuge used in 0 to 8 is provided with an interferometer. In some embodiments, the deposition of viral particles resulting from recombinant gene uptake and interference is monitored. In some embodiments, the absorption and / or interference are measured using a reference standard. In some embodiments, the standard for the reference of the viral product solution resulting from recombination is identical except for the absence of the virus resulting from recombination. For example, the viral preparation may include

١٨٨

41387Β1

Resulting from recombination on a virus resulting from recombinant genetics in a buffer solution, such as phosphate buffered saline, in this example, the benchmark may be a phosphate buffered saline solution without viral particles resulting from recombinant genetics.

101171 In some embodiments, the sedimentation rate of viral particles during supercentrifugation is determined by continuously monitoring the precipitation of viral particles during the centrifugation. It is considered within the skilled vision to achieve the ideal image of the AUC variables for different types of viral particles. In some embodiments, information for 8867 particles is obtained at an AUC speed of about 000. About 20,000 languages ​​per minute and in some embodiments, data are analyzed for rAAV particles with a value of z 8 bands, which is about Smax-S, which is about 10005, and in some embodiments, data are analyzed for 4 particles with an accuracy of about 200S to about 1.0005. In some embodiments, the accuracy is about any of 2008, 3008, 4008, 5005, 6005, 7005, 8005, 9005, or 1000S, or any value in between, and in some embodiments, the accuracy is about 2008. In some embodiments, data are analyzed for rAAV particles with a Smaχ value of approximately any of 1008, 2008, 3008, 4008, 5008, 6008, -7008, 8008, 9008, or 1000S, or any value in between. In some embodiments, 52 is about 200S to about 50005. In some embodiments, where Smax is about 235 and in some models, noise subtractions that do not change with diameter (150) 9 change with time (TI) are applied. In some embodiments, the position of the meniscal body is available for buoyancy, in a way that allows the program to choose the ideal position and in some models, the ratio of friction and buoyancy is available, in a way that allows the program to choose the ideal position. In some embodiments, the particle data analysis is fixed at 1. In some embodiments, data analysis for particle buoyancy *] is available with the FIT command at an ideal value specified by linear regression.

١٨٨

41387Β1

-No.

10118 For recombinant viral particles (for example, rAAV particles), and in some embodiments, the rate of deposition of a recombinant virus during supercentrifugation is determined by monitoring (for example, scanning) the deposition of viral particles resulting from recombinant gene recombination. Once every more than about 15 seconds, 30 seconds, 45 seconds, 1 minute (60 seconds), 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes. Scanning operations may be required without delay as quickly as optical systems allow. Interferential scans are fast, one scan is completed in 10-15 sec, while absorption scans require -60 sec. When dual detection is used, the speed of each scan acquisition is determined by the absorption system. And in some embodiments of the invention, more than about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 are used. A scanning process to monitor the precipitation of viral particles resulting from recombinant gene reinsertion during expulsion to my superconcentrate. In some embodiments, a minimum of 30 scans are required for analysis, and scans are combined until the sedimentation process is complete. In some embodiments, the sedimentation process may typically be described by between 40 and 75 scans. In some embodiments, the sedimentation rate of viral particles resulting from recombination is determined on the basis of about 75 scans. In some embodiments, the sedimentation rate of viral particles resulting from recombinant gene recombination is determined on the basis of about 55 scans to about 75 scans. In some embodiments, the sedimentation rate of viral particles resulting from recombination is determined on the basis of about 55 scans to about 60 scans. In some embodiments, the sedimentation rate of viral particles resulting from recombination is determined on the basis of about 60 scans

١٨٨

41387Β1

To about 75 scans and in some embodiments, the sedimentation velocity of viral particles resulting from recombinant gene is determined on the basis of about 60 scans to about 70 scans. In some embodiments, the sedimentation rate of viral particles resulting from recombination is determined on the basis of multiple centrifugation processes (processes). In some embodiments, the sedimentation velocity of the two viral particles resulting from re-bonding to the Si is determined from any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of the expulsion runs of the lobe merger and in some embodiments, the use of Sediment velocities Determine values ​​of () • using the SEDFIT calculation • In some embodiments, a second derivative arrangement is applied at the body confidence level of the F statistic about 0.68. In some embodiments, the following (5) variables are fixed: Resolution 100S to about 2008, S min is about 1, s max is about 2005 to 3005, and the friction ratio is about 0.1 to 1.2S. In some embodiments, subtractions are applied. Noise does not change with change of diameter first, it changes with change of time (no) 0

9 1011 In some embodiments, the marginal sedimentation velocity of viral particles resulting from recombinases (for example, rAAV particles) is determined in a formulation of viral particles resulting from recombinant epigenetic recombination of supercentral superconcentrate to prepare viral particles resulting from recombinant gene at more than about Any of 5.000 rpm

Minute; 10,000 rpm; 15,000 rpm; 20,000 rpm

Minute; 25,000 rpm; 30,000 rpm; 35,000 rpm

Per minute; 40,000 rpm; 45,000 rpm? Or 50,000 languages ​​per minute, or whatever value in between. In some embodiments of the invention, the marginal precipitation velocity of viral particles is determined

Resulting from recombination in the form of viral particles resulting from recombination

<img file="MA41387B1_D0005.tif" />

١٨٨

41387Β1

Genomic ultracentrifugation of recombinant viral particles at approximately 20,000 rpm. And in some embodiments of the invention; The marginal sedimentation velocity of viral particles resulting from recombinant gene recombination in a viral particle preparation resulting from recombinant viral supercentrifugation resulting from recombinant viral particles is determined at about 15,000 rpm to about 20,000 rpm.

10120 In biting models, the tidal sediment velocity of the viral particles resulting from recombinant gene recombination in a formulation of viral particles resulting from recombinases (for example, 3887 particles) is challenged by the expulsion to the supercentricity of a preparation of viral particles resulting from recombinant gene recombination at about or more. From 4 C, 10 C, 15 C, 20 C, 25 C, or 30 C or any temperature in between. In some embodiments, the marginal sedimentation velocity of viral particles resulting from recombinant gene recombination is determined in the formulation of viral particles resulting from recombinant supercentrifugation of the viral particle preparation resulting from recombinant gene expression at about 20 ° C. In some embodiments, the marginal sedimentation velocity of viral particles resulting from recombinant gene recombination in the formulation of viral particles resulting from recombinases by supercentrifugation of the preparation of viral particles resulting from recombinant gene is determined at about 15 ° C to about 20 ° C.

Viral particles with enhanced expression

[0121] In some Jawali, the output provides phosphorescent sims comprising hyper-sized Jumans with enhanced expression, and in some embodiments, hyper-sized rAAV genomes exhibit enhanced expression when packed into 887 particles using a cell line produced compared to AAV particles trapped by

fill

4138731

Incidence of accidental infection of cells. In some embodiments, the invention provides methods to enhance the expression of the hyper-sized rAAV genome, wherein the method includes the production of rAAV particles in a progenitor cell line providing the 887 auxiliary functions of the cell line, wherein the producing cell lineage includes () a DNA encoding the 899 rep genes of AAV, and (b). RAAV genome, where the rAAV genome is larger than about 4.7 kb. In some embodiments, the expression of the rAAV genome is about 1.25-fold, about 1.5-fold, about 1.75-fold, about 2.0-fold, about 2.25-fold. My mobile is 22.5 times, about 2.75 times, About 3-fold, about 3.25-fold, about 3.5-fold, about 3.75 times, about 4-fold, about 4.25 times, about 5.04-fold, about 4.75-fold, or about 5-fold expression of the rAAV genome hypermortisone due to its production by accidental infection and in some embodiments , Expression specific to hypermeat rAAV genome is more rapid in the kinetics of expression compared to the kinematics of expression of the hypermeat rAAV genome of 887 particles produced by accidental infection. In some embodiments, the faster expression kinetics is a faster increase in the expression of the hyper-sized rAAV genome over time after the 887 particle comprising the hyper-sized rAAV genome was delivered to a cell. In some embodiments, the kinetics of the larger expression are time to reach maximum or constant expression levels for the hyper-size rAAV genome. The 887 particle containing the hyper-sized rAAV genome is the delivery of the 887 particle containing the hyper-volume rAAV genome compared to the expression levels of the hyper-volume rAAV genome by the non-delivery of the 887-containing particle. rAAV was excessive for rAAV particles inundated with accidental infection. In some embodiments, the expression kinetics of the hyper-volume rAAV genome produced by the progenitor cell line is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% faster. 65% 70%, 75%, 80%, 85%, 90%, 95%, or

fill

4138731

100% of the substrates expressing the over-sized rAAV genome of rAAV particles produced by accidental infection. In some embodiments, the hypergene vector is greater than about any of 5.0 kb base, 5.1 kb base, 5.2 kb base, 5.3 kb base, and 5.4 kbp.

Base, 5.5kg base, 5.6kg base station, 5.7kg base station, 5.8kg base station, 5.9kg base

Base, 6.0 Kilobase, 6.1 Kilo Base, 6.2 Kilo Base, 6.3 Kilo Base, 6.4 Kilo Base

Base, 6.5 kilobase, 6.6 kilobase, 6.7 kilobase, 6.8 kilo base

Base, 7.0 Kilobase, 7.1 Kilo Base, 7.2 Kilo Base, 7.3 Kilo Base, 7.4 Kilo Base

The base is 7.5 kg, the base is 7.6 kg, the base is 707 kg, the base is 7.8 kg, the base is 7.9 kg.

Base, 8.0 kilobases, 8.1 kilobases, 8.2 kilobases, 8.3 kilobases, 8.4 kilos

Base, 8.5 kilobase, 8.6 kilobase, 8.7 kilobase, 8.8 kilobase, 8.9

Base, 90 kilobases, 92 kilobases, 9.3 kilobases or 94 kilobases

Length or any value in between.

Class genes are not identical

[0122] In some embodiments, the fuso particle is a recombinant AAV particle comprising a hyper-sized genome vector comprising an heterozygous nucleic acid (eg, an asymmetric GM gene surrounded by one or two inverted terminal repeat units of ITRs) AAV). The nucleic acid is contained in the capsid in the AAV particle. In some embodiments, the rAAV genome presented in the present disclosure contains one or more of the inverted terminal repeats of ITRs ^ AAV ^ and an asymmetric genetically modified genome. For example, in some embodiments, the 3887 genome in the present disclosure contains two of the subunits. Inverted terminal iterations of AAV (ITRs) 0 In certain embodiments, the rAAV genome presented in the present disclosure contains two:

fill

4138731

From the inverted terminal repeat units from asymmetric genetically modified. In some embodiments, the vector genome is between about 4.7 kb base and about 9.4 kb base, optionally about 4.7 kb base and 6.7 kb base. In some embodiments, the vector genome is greater than about 5 kb. In some embodiments, the vector genome is between about 5 kb base and about 7 kb base, between about 4.7 kb base and about 9.4 kb base, or between about 4.7 kb base and 6.7 kb base, or any value in between. In some embodiments, the vector genome is greater than about any of the 5.0 kb base, 5.1 kb base, 5.2 kb base, 5.3 kb base, 5.4 kb base, 5.5 kb base, 5.6 kb base, 5.7 kb base, 5.8 kb base ke, 5.9 kb base,

6.0k base, 6.1kg base, 6.2kg base, 6.3kg base, 6.4k base,

6.5 kilobase, 6.6 kilobase, 6.7 base kilobase, 6.8 kilobase, 6.9 kilobase,

7.0 Kilobase, 7.1 Kilo Base, 7.2 Kilo Base, 7.3 Kilo Base, 7.4 Kilo Base,

7.5 Kilobase, 7.6 Kilo Base, 7.7 Kilo Base, 7.8 Kilo Base, 7.9 Kilo Base

8 .0 base kilobase, 8.1 kilobase, 8.2 kilobase, 8.3 kilobase, 8.4 kilobase

8.5 kilobases, 8.6 kilobases, 8.7 kilobases, 8.8 kilobases, 8.9 kilobases.

9 0 kb base, 9.2 kb base, 9.3 kb base or 9.4 kb base in length or any value in between.

10123 In some embodiments, the asymmetric transgenic gene encodes to produce a therapeutic GM. In some embodiments, the therapeutic transgenic product is a therapeutic polypeptide and may deliver a therapeutic polypeptide, for example, a polypeptide and / or enzyme activity that is not present or is present at a low level in a cell or organism. Alternatively, a therapeutic polypeptide may deliver a polypeptide and / or an enzymatic activity that indirectly equates to an imbalance in a cell or organism.

١٨٨

41387Β1

It delivers a therapeutic polypeptide for a disorder related to metabolism accumulation due to a deficiency in an enzyme, enzyme or lost metabolic activity, or it may deliver an enzyme or an alternate metabolic activity that results in reduced metabolism. A therapeutic polypeptide can also be used to reduce polypeptide activity (for example, it is overexpressed, activated by a function mutation, or otherwise disorganized activity) by acting, for example, as the predominant polypeptide.

0124 In some embodiments, the asymmetric transgenic gene encodes factor VIII. In some embodiments, Factor VIII is a human factor VIII coding sequence, including without limitation any coding sequence expressed by the human factor VIII gene. The human factor VIII gene (for example, 2157 GenBank Entrez GenelD) ^ is known as]] a, 6] 89/8, a] /, iFVIH and DXS1253E ^ In some embodiments, Factor 7111 includes the amino acid sequence of human Factor VIII (for example Example, as represented by GenBank Accession. 52484). For example, a non-homologous transgenic gene encoding factor VIII may be used to express factor VIII in an individual with hemophilia A, a recessive X-linked clotting disorder associated with a deficiency of factor VIII. The factor]] is known to contribute to blood clotting as alarmed by the auto-coagulation pathway and is naturally expressed by the sinus cells and endothelial cells of the body as a whole.

10125 In some embodiments, the gene encodes asymmetric dystrophin. In some embodiments, dystrophin is a human dystrophin coding sequence, including without limitation any coding sequence expressed by a human dystrophin gene. The human dystrophin gene (eg 1756 GenBank Entrez GenelD) is known as • A /, 202, 00039, MRX85 ,, DXS270, DXS269, DXS268, DXS239 758230 758206 1078164, DXS142

05272 In some embodiments, dystrophin comprising the amino acid sequence of human dystrophin (A.

fill

4138781

Example, as represented by GenBank Accession Νο. 53189). A non-homologous genetically engineered gene may be used for dystrophin, for example, to express dystrophin in an individual with Duchenne or Becker's muscular dystrophy, X-linked recessive muscular dystrophies associated with mutations in dystrophin. Becker's muscular dystrophy is considered to be a less severe disorder caused by loss of function mutations in dystrophin, where Donshine muscular dystrophy is associated with more severe loss of function and zero mutations (for example, nonsense or frame shift mutations) in dystrophin that dystrophin is known to act in the dystrophin glycoprotein complex ( DGC), required for the delivery of T-actin muscle cells to the extracellular matrix, and then fixation of the myofiber sheath during muscle contraction and extension.

10126 In some embodiments, the asymmetric transgenic gene encodes for the asymmetric fibrosis membrane transduction regulator (CFTR) 1 ^ (CFTR), also known as the C subfamily of the 411 individual's binding tape 7. In some embodiments, the CFTR is a human CFTR coding sequence, including some form. Not exhaustive: Any coding sequence expressed by a human CFTR gene. The human 0111 gene (for example, 1080 GenBank Entrez Gene ID) is known as (, 17,40035 4007, 0702 *) - * l), dj760C550b. In some embodiments, CFTR comprises an amino acid sequence of a human CFTR (eg, as represented by GenBank Accession 000483_Νο.Νο). For example, an autosomal recessive disorder associated with mutations in CFTR affecting the lungs, pancreas, gut, and many other organs CFTR is known to act as an ion channel opened by ATP is involved in the transport of CF ions Lack of sufficient CFTR function leads to multiple diseases; One example is blocking the transport of ions through epithelial cells, ma

fill

4138731

It leads to increased cell absorption of water, thickening of mucus and its accumulation in the lungs and other tissues

10127 In some embodiments, the therapeutic GM gene product is a therapeutic DNA. In some embodiments, it may include non-exclusive therapeutic nucleic acid shRNA, siRNA, RNA, miRNA, transcription-reversible RNAi, ribozyme or DNAzyme. As such, a therapeutic nucleic acid can encode RNA when it is transcribed from the nucleic acids into a carrier it can treat a disorder by interfering with the transcription or transcription of an abnormal or fleeting protein associated with the disorder. For example, a transgenic gene can encode an asymmetric RNA that treats a disorder by removing Or, to reduce the two specifics to a high degree for SHFR abnormal and / or excess proteins. RNA therapeutic sequences include RNA, small inhibitory RNA (miRNA) ^ RNA, (siRNA), and or ribonems (such as hammerhead ribozymes and needle ribonems) that can treat perturbations by highly specific removal or reduction of mRNA encoding abnormal and or excess proteins.

[10128 In some embodiments, the gene for a non-genetically modified symbiont is a gene. In some embodiments, a non-homologous transgenic gene is linked to a homologous transgenic and in some embodiments, the axon gene is genetically linked (for example, heterozygous nucleic acid present in the present order) effectively with a marker, which includes representative, but not exclusively, the early homologous locus of the virus. Cytomodulator (01) 853 MoMLV LTR, RSV LTR, Booster, Phosphoglycerate Kinase 1 (PGK) Booster, Simian Virus 40 (540) 06 Booster (TTR), Promoter [], Tetracycline Responder (HBV5 ^, (TRE, Booster)) shear ? Plants, chimeric-specific enhancers for the liver (5), E2F enhancer, Telomerase enzyme promoter (hTERT); Maaraz Mohsin Vios dressed for the cells Yata

Niwa et 1991, 2 (/ 6, .ah, lO8 (2): 193-; CAGj ^) chicken actin / 0-rabbit globin -

fill

4138731

-66Kim et al., Gene, 1990, 91 (2): 217-23 and Guo; c) (ώΙ-EFl) 9) and the prolonging factor 1 alpha booster)

802-10: (9) 3, 1996 71 Gene) and in some embodiments, a promoter includes a-glucuronidase promoter or a cytomegalovirus enhancer promoter associated with chicken 9-actin (04) and the promoter may be a formative promoter, inducible or reversible. To suppress. And in some embodiments, a reinforcer is a messianic expression of my mouse

10129 Examples include, non-exclusive, formative promoters 11 for the retrovirus Rous sarcoma virus (157) (optionally with induction factor 5) cytomegalovirus promoter (47a0) (optionally with an inducer) (see, for example, (1985) 530-41 : 521, Boshart et al, Cell], 740-goer, dihydrofolate reductase booster, 13-actin booster, phosphoglycerol kinase (5) booster, and an EFla (Invitrogen) promoter.

0130 It allows the melodic times to stain the Mayali, and it can be organized by bin compounds. It is provided from the outside, environmental factors such as temperature, or the presence of a specific physiological condition, for example, an acute phase, a specific case of cell differentiation, or only in cell copying. Inductors and inductive systems are available from a variety of commercial sources, including, without limitation, Invitrogen, 01000. Many other systems have been described and can be easily picked up by someone skilled in the art. Examples of inducible enhancers that are regulated by externally supplied promoters include zinc-induced metallothionine in sheep (MMV), MMTV (MMTV) (Dex), and polymerase enzyme system 17 (1 International Patent # 98/98). 10088 10088/98 (WO)); Acidison Insecticide Booster (ho

Gossen et al. The suppressive regimen of tetracycline, (i /. Acad. Sci. (54, 93: 3346-3351 (1996) e), The tetracycline inducible regimen., Proc. Natl. Acad. Sci. USA, 89: 5547-5551 (1992)

fill

4138731

61Harvey etal; Curr. 01 Chem. See also, Gossen et al., Science, 268: 1766-1769 (1995)) and Wang et al., Nat. Biotech., (RU486 (1998) 518-2: 512, ./70 (the induced system by 239-15: 243 1997) and the induced system (and Wang et al., 3602 7716 /., 4: 432-441) (1997) There are also other types (Magari et al., R. Clin. Invest., 100: 2865-2872 (1997)).

Among the inducible enhancers that could be useful in this context are those that are regulated by a specific physiological condition, for example, temperature, acute phase, a specific state of cellular differentiation, or only in cell transcription.

[0131] In another embodiment, the original buzz, or MH fragment, is culled, so as to genetically Haur the original promoter may be preferred when it is desired to mimic the expression of the genetically modified gene of the original expression. The original promoter can be used when expression of the transgenic gene needs to be regulated in temporal or evolutionary terms, or in a tissue-specific manner, or in response to specific transcription stimuli. In another embodiment, other elements may also be used to control the original expression, such as enhanced elements, polyadenylated sites, or Kozak (consensus sequences), simulating the original expression.

[0132] In some embodiments, regulatory sequences gain tissue-specific gene expression capabilities. In some cases, tissue-specific regulatory sequences link tissue-specific transcription factors that specifically induce transcription to tissues. For example, tissue-specific expression may be desirable in the liver, lungs, muscles, intestine, pancreas, and / or other tissues. Tissue-specific regulatory sequences (eg, enhancers, enhancers, etc.) are well known in the art. For example, and in some embodiments, a promoter is a mouse transtheretin enhancer (mTTR) and is known to induce gene expression in the liver.

١٨٨

41387Β1

10133 In some embodiments, the genome contains 887 intron. In some embodiments, the intron is a hybrid intron.

10134 In some embodiments, the genome of 3887 includes a polyadenylated signal. Many of the pretreatment signals are known as polyadenylated in the field. In some embodiments, the PDA signal is a synthetic PVA signal. In other embodiments, the polyadenyl-pretreatment signal is a 5-PPAD signal from bovine growth hormone ([]) for a larger detailed description of the polyadinyl-treated signal from BGH, see, for example, Goodwin, Ec and (1992). Rottman, FM. Biol. Chem. 267: 16330-16334

0135 In a stock of fishes, the other provides 887 labels, including the hyper-sized AAV genome; Where the AAV genome includes cells' 5 to '3' and AAV2ITR, mTTR202 strand, Etheron hybrid, 10 genetically modified factor VIII genes of B domain B deleted, a synthesized polyadenylated reference signal and on AAV2.

ITR In some embodiments, the hyper-sized AAV genome includes (5 to 3a and 42 ITR promoter mTTR202opt, a hybrid intron, a genetically modified factor VIII gene with a B-band deleted, a synthesized polyadenyl-treated signal that contains 111 42. In some embodiments, the hyper-sized 887 genome includes ( 5 to 113 442 promoter 1111482 hybrid intron, a genetically modified factor 15 gene

VIII, with a B-band deleted, synthesized polyadethyl-treated signal on AAV2ITR. In some embodiments, the oversize 887 genome includes a 5 to 442113 mTTR482 promoter, a hybrid intron, a genetically modified factor VIII gene with a B-domain deleted, a polyadenylated signal from bovine growth hormone, and a 442 ITR.

١٨٨

41387Β1

00136 The rAAV genome elements described above (eg, transgenic, intron, and polyadenylated signal) may exist alone or in any combination with an asymmetric GM gene reported in the present disclosure. The rAAV genome includes any element to establish the expression of an asymmetric GM gene, for example, a mole, an enzyme, heterozygous DNA, 111 rheosome binding elements, a termination agent, an enhancer, a selector marker, an enron, a polyA-processing signal, and or an origin of transcription. For example, in some embodiments, the rAAV genome contains an asymmetric transgenic gene and one or more of the elements selected from the enhancers included in the present disclosure, the intronward in the current disclosure, and the polyadenyloid-processed signal contained in the present disclosure. In some embodiments, the rAAV genome may include at least one ITR sequence surrounding an asymmetric GM gene, one or more of the elements selected from the augmented resources in the current disclosure, the intronward in the current disclosure, and a polyadenyloid-processed signal contained in the present disclosure.

10137 In some embodiments, the rAAV vector is a self-integrating rAAV vector that, for example, includes a recombinant self-integral genome (the term self-integrating can be used interchangeably in the present application). 88 viral particles with self-integrated genomes and methods for using 887 self-integrated genomes are described in US Patent Numbers 6,596,535 (6, 596, 535) 7,125,717 (7, 125, 717) 7465583 (7, 465, 583); 7,785,888 (7, 785, 888); 154,790, 7 (7,79, 154) 7846729 (7, 846, 729) 093054 (8, 093, 054); 8,361,457 (8, 361, 457); and 21111-10: 2105 Wang Z., et al., (2003) Gene Ther, each of which is included in the present application for full reference. RAAV is comprised of a double-stranded, fast, self-integrating genome ^ L by partially complementary sequences (for example, coding and non-coding complementary strands of a transgenic gene) and in some embodiments, the vector includes a first nucleic acid sequence

١٨٨

41387Β1

The heterozygous nucleic acid encodes a second nucleic acid sequence that encodes the DNA, where the first nucleic acid sequence can be base pairs between strands with the second nucleic acid sequence extending most of its length.

10138 In some embodiments, the first heterozygous nucleic acid sequence and the second heterozygous nucleic acid sequence are linked by a •]! Mutant (for example, the right ITR). And in biting the alveoli; ^ Includes nucleoid polymorphism 5'-CACTCCCTCTCTGCGCGC

TCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGC

• 008808-3 (sequence number: 24). The mutant ITR includes the deletion of a region containing the peripheral haemolytic sequence as a result, when copying the 887 Fuci genome; The transcriptional proteins do not divide the fusiform genome of a mutant * and as such, the genome of a recombinant fucus containing the following in the direction (5 to 3 phicapsid ^^: AAVITR, first heterozygous polynucleotide sequence including regulatory sequences, 1) The second polynucleotide heterozygous in the reverse direction of the heterozygous polynucleotide I and AAV ITR third. In some embodiments, the scAAV genome is larger than about 5.0 k

Base: 5 kg, Base 5.2 kg, Base: 5.3 kg, Base: 5.5 kg

Base, 5.6K base, 5.7K base, 5.8K base, 5.9K base, 6.0K base

Training, 6.1 kilograms of training, 6.2 kilograms of training, 6.3 kilograms of training, 6.4 kilograms of seats, 6.5 kilograms

Base, 6.6 kilobase, 6.7 base kilobase, 6.8 base kilobase, 6.9 base kilobase, or 7.0 base kilobase, or anything in between.

IV^- Methods for producing viral particles

١٨٨

41387Β1

10139 Certain aspects of the present disclosure relate to a risk to the production of an adenovirus particle (7e) containing the 887 oversize genome resulting from recombinases. In some embodiments, methods include culturing the progenitor cell line and 8867 under conditions that allow the generation of rAAV particles, with the AAV-producing cell line comprising (1) DNA encoding the rep and cap genes from 887, and (2) the rAAV genome, where the rAAV genome ranges between about 4.7 One kilobase and about 9.4 kilobases, optionally about 4.7 kilobases and 6.7 kilobases; (B) Provision of auxiliary 887 functions; and (c) assembly of rAAV particles containing 3887 oversize genomes. In some embodiments, the D887-producing cell lineage includes a statically retained nucleic acid encoding the rep and cap genes of AAV. In some embodiments, the lineage of 8867-producing cells includes a statically maintained rAAV genome, with the rAAV genome being between about 4.7 kb base and about 9.4 kb base, optionally about 4.7 kb base and 6.7 kb base. In some embodiments, the lineage of 887 cells includes statically retained DNA encoding rep and cap genes from AAV and the rAAV genome statically preserved, with the rAAV genome ranging from about 4.7 kb to about 9.4 kb, optionally about 4.7 kb. 6.7 kilobase. In some embodiments, the lineage of 887 cells includes a DNA encoding rep and cap genes from 887 statically incorporated into the lineage of 887 genomes. In some embodiments, the 887-producing cell line includes a genome * • firmly integrated into the genome of the cell line, with the rAAV genome ranging from about 4.7 kb base to about 9.4 kb, optionally about 4.7 kb base and 6.7 kb base. In some embodiments, the lineage of 887 cells includes DNA encoding the rep and cap genes of AAV and the 887 genome)] statically integrated into the genome of the cell line, where the rAAV genome ranges from about 4.7 kb to about 9.4 kb.

Ml

fill

4138731

Optionally, about 4.7 kg and 6.7 kg. In some of the embodiments shown above, it is

The rAAV genome is larger than approximately 5.0 kb-base, 5.1 k-base, 5.2 k-base,

5.3 kilobases, 5.4 kilobase, 5.5 kilobase, 5.6 kilobase, 5.7 kilobase

5.8 kilobase, 5.9 kilobase, 6.0 kilobase, 6.1 kilobase, 6.2 kilobase,

6.3 Kilobase, 6.4 Kilobase, 6.5 Base Kilo, 6.6 Base Kilo, 6.7 Base Kil

6.8 kilobase, 6.9 kilobase, 7.0 kilobase, 7.1 kilobase, 7.2 kilobase

7.3 Kilobase, 7.4 Kilo Base, 7.5 Kilo Base, 7.6 Kilo Base, 7.7 Kilo Base,

7.8 base, 7.9 base, 8.0 kilobase, 8.1 kilobase, 8.2 kilobase,

8.3 kilobases, 8.4 kilobases, 8.5 kilobases, 8.6 kilobases, 8.7 kilobase,

8.8 kilobases, 8.9 kilobases, 9.0 kilobases, 9.2 kilobases, 9.3 kilobases, or 9.4 kilobases in length, or any value in between. In some embodiments, the packaged 887 genome does not contain '5' tip amputations. In some embodiments, the packed AAV genome does not contain '3-tip amputation.

10140 Other aspects of the current disclosure relate to cell lineages to produce an adenovirus particle (887) that includes the over-sized 887 genome of recombinant recombination, where the cell lineage includes a) DNA encoding the rep and cap genes of 887, and (b) the rAAV genome, where it ranges from The rAAV genome is between about 4.7 kb base and about 9.4 kb base, optionally about 4.7 kb base and 6.7 kb base. In some embodiments, the lineage of 887 cells includes a statically retained DNA encoding the rep and cap of genes. In some embodiments, the AAV-producing cell line includes a statically preserved rAAV genome, with the rAAV genome ranging from about 4.7 kb to about 4.7 kb. 94 kilobases, optionally about 4.7 kilobases and about 6.7 kilobases, or about 5.2 kilobases to about 8.7 kilobases.

١٨٨

41387Β1

Ή-

In some embodiments, the lineage of 887-producing cells includes statically retained DNA encoding rep genes and cap of jAAV - the rAAV genome is statically retained, where the rAAV genome is between about 4.7 kb and about 9.4 kb, optionally about 4.7 kb. Base and about 6.7 kilobase or about 5.2 kilobase base to about 8.7 kilobase. In some embodiments, the lineage of 887 cells includes DNA encoding rep and cap genes from 887 statically integrated into the genome of the cell line and in some embodiments, the line of cells producing 887 includes the genome of 3887 statically integrated into the genome of the lineage of cells, with the rAAV genome being between approximately 4.7 Kilobases and about 9.4 Kilobases, optionally about 4.7 Kilobases and about 6.7 Kilobases or about 5.2 Kilobases to about 8.7Kbases. In some embodiments, the lineage of 887 cells includes DNA encoding the rep and cap genes of AAV and the 3887 genome is statically integrated into the genome of the cell line, where the rAAV genome ranges from about 4.7 kb base to about 94 kbps, optionally about 4.7 kb base and about 6.7 kb base. Or about 5.2 kilobases to about 8.7 kilobases. In some embodiments, the rAAV genome is larger than approximately 5.0 kb base, 5.1 kb base, 5.2 kb base, 5.3 kb base, 5.4 kb base, 5.5 kb base, 5.6 kb base, 5.7 kb base, 5.8 kb base,

9. 5K base, 6.0K base, 6.1K base, 6.2K base, 6.3K base,

6.4 kilobases, 6.5 kilobases, 6.6 kilobases, 6.7 kilobases, 6.8 kilobas

6.9 Kilobase, 7.0 Kil base, 7.1 Kilo base, 7.2 Kilo base, 7.3 Kil base

4. 7 Kilometers, 7.5 Kilometers, 7.6 Kilometers, 7.7 Kilometers, 7.8 Kilometers

7.9 kg base, 8.0 kg base, 8.1 kg base, 8.2 kg base, 8.3 kg base, 8.4 kg base, 8.5 kg base, 8.6 kg base, 8.7 kg base, 8.8 kg base,

fill

4138731

8.9 Kilobase, 9.0 Kilobase, 9.2 Kilobase, 9.3 Kilo base or 9.4 Base length, or any value in between.

10141 He knows in the art a variety of methods for producing the 3887 vectors, including infection, the production of stable cell lines, and infectious hybrid virus production systems that include adenovirus hybrids.

Conway, JE β /., (1997) R. Virology 71 (ll): 878O-) AAV Mash and Virus Hybrids, AAV

8789) and the bacovirus hybrids 8827 require 8867 production farms] to produce all 3887 viral particles; (() Suitable family cells, (2) suitable helper virus function, (3) rep and cap genes from 887 gene products; (4) DNA (such as therapeutic DNA) surrounded by at least one of the 887 ITR sequences (for example, the genome of the hyper-sized AAV vector); and (5) media and media components suitable to support the production of 887) and in some embodiments, the appropriate host cell is About a cell a family of primates. In some embodiments, a suitable host cell is human-derived cell lines such as 293, Α549, HeLa, or 6.Perc cells. In some embodiments, the appropriate virulent virus function is provided by an adenovirus of the untreated or mutant type (such as susceptible adenovirus). For temperature), mash virus (^!), Bac virus, or plasmid formulation that provides auxiliary functions. And in some embodiments, the cap jrep gene products of AAV can be any serotype 887 in general, but not compulsory, the rep gene product of AAV X is the same as the serotype of ITRs from the rAAV vector genome as long as the rep gene products can replicate and package RAAV genome · suitable media known in the art can be used to produce rAAV vectors. The media includes, without limitation, those produced by Hyclone Laboratories and 111 including Dulbecco's Modified Eagle Medium, (MEM) Modified Eagle Medium.

(DMEM), custom formulas such as those described in US Patent No. 6,566,118

<img file="MA41387B1_D0006.tif" />

١٨٨

41387Β1

(6, 566, 118), 5-900 II SFM media as defined in US Patent No. 6,723,551 (6, 723, 551), each of which is included in the present application as a whole for reference, especially for media formulas intended for use in the production of its vectors. Caused by recombination. In some embodiments, adenovirus or HSV auxiliary AAV functions are provided. In some embodiments, the auxiliary 887 functions are provided by the bacovirus, and the host cell is an insect cell (for example, ^ Sf9) Spodoptera frugiperdab).

10142 One method for producing particles 3887 is a triple infection method. Briefly, a plasmid containing two capsidic plates, with an adjuvant adenovirus plasmid, can be infected (eg, with the calcium phosphate method) in a cell line (eg, HEK-293 cells), and the virus can be collected and optionally purified. As such, and in some embodiments, the rAAV particle has been produced by infection with triple infection, a nucleic acid encoding the rAAV vector, DNA encoding rep and cap from 887, and DNA encoding functions of the AAV virus in a host cell, where the introduction of nucleic acid infection in host cells leads to a host cell that can RAAV particle production.

10143 In some embodiments, the 3887 particles can be produced by the progenitor cell lineage method, such as the representative progenitor cell method shown below (see Martin ei (2013)).

Therapy // 7,025 24: 253-269: us PG Pub. No. 52004/0224411: and Liu, 7 .. et al.

6: 293-299 71 (Gene 1999). Briefly, the cyclic strain can be infected, for example, the HeLa cell line; 293, 549, or 1.6) was stably infected with a plasmid containing two reps, a capsid gene, and an over-sized vector genome containing a flag enhanced by the heterozygous sequence. Cell strains can be examined by selecting a precursor to produce rAAV, which can then be expanded into a bioreactor and infused with an adjuvant (for example, adenovirus or HSV).

١٨٨

41387Β1

Production of rAAV Then the virus can be harvested, the adenovirus can be deactivated (for example, by heat) or removed, and the 3887 particles can be purified in this way, and in some embodiments, the 887 particle) was produced by a progenitor cell line comprising one or more cells. Nucleic acids encode the rAAV vector, nucleic acid vacates the rep of AAV, and nucleic acid encodes the functions of adjuvant AAV virus. As the current application describes, a vector-cell strain method could be useful in producing rAAV particles with an over-sized genome, compared to the triple-infection method.

10144 In some embodiments, the DNA encoding the rep and cap genes of 887 and or genomes 2887 are statically preserved in the vector cell lineage. In some embodiments, DNA encoding the rep and cap genes of AAV and / or the 887 genome on one or more plasmids are inserted into a cell line to produce a productive cell line. In some embodiments, the rep of cap, AAV from 887, and the genome of 3887 cells are inserted on the same plasmid. In other embodiments, rep of cap, AAV from AAV, and rAAV genome are inserted into a cell on different plasmids. In some embodiments, a stably infected cell line with a plasmid retains the plasmid for multiple stages of the cell line passage (eg, 5, 10, 20, 30, 40, 50 or more than 50 cell passages). For example, a plasmid can be copied. (Plasmids) as the cell is transcribed, or the plasmid (plasmids) can be incorporated into the cell's genome. A variety of sequences that allow the plasmid to be independently transcribed into a cell (eg, a human cell) have been identified (see, for example, and in some embodiments, it may contain (Krysan, PJ et al. (1989) Mol. Cell Biol. 9: 1026-1033

Plasmid (plasmids) on a selectable marker (eg, an antibiotic resistance marker) enables selection of cells that retain the plasmid. Selectable markers commonly used in mammary cells not exclusively include plastisidine, G418, hygromycin B, zeocine,

١٨٨

41387Β1

Puromycin and its derivatives, methods of introducing nucleic acids into a cell are well known in the field and include non-exclusive viral transport, cationic infection (for example, using a cationic polymer such as 81 T01 -dextran or a cationic lipid such as lipofectamine), infection with calcium phosphate, microinjection, particle detonation. Electrophoresis, and nanosomal infection (for greater details, see, for example, Kim, Τ.Κ. and Eberwine, JH (2010) Anal. Bioanal. Chem. 397: 3173-3178)

10145 In some embodiments, the DNA encoding the rep and cap genes of AAV and or the rAAV genome are statically incorporated into the genome of the progenitor cell. In some embodiments, a DNA encoding the rep and cap genes of AAV and / or the 887 genome on one or more plasmids are inserted into a cell line to obtain the produced cell lineage. In some embodiments, the rep of cap, AAV from 887, and the rAAV genome are inserted into a cell on the same plasmid. In other embodiments, cap, AAV rep 887, and the rAAV genome), a cell on different plasmids, are inserted. In some embodiments, the plasmid may contain a selectable marker (for example, an antibiotic resistance marker) that allows selection of cells that retain the plasmid. Methods for static incorporation of nucleic acids into a variety of cell strains are well known in the art (see examples below for a more detailed description of an representative progenitor cell formed by steady incorporation of nucleic acids). For example, repeated selection can be used (for example, through the use of Selectable marker (to select cells that have incorporated a nucleic acid containing a salvageable tag ^, cap from AAV, rep particles, or rAAV genome) In other embodiments, nucleic acids can be incorporated in a specific manner relative to the locus in a cell lineage to generate A productive cell lineage. Many recombination systems are domain-specific to loci, such as FLP / FRT (see, for example,

١٨٨

41387Β1

56/166251: 1351-1355 (1991).! 4 5), Ta 30/10 (0) (see, for example, Sauer, B. and 811-031: 0 (for example, Henderson, N. (1988)). 0/41 444 Sci. 85: 5166-5170. (Groth, Ac et al. (2000) Proc. Natl. Acad. Example, 6000-97: 5995 UHC.

10146 In some embodiments, the cell lineage produced by a primate cell lineage (for example, a non-human primate cell line, such as Vero cell lineage or 2- (1)) is derived. In some embodiments, the cell lineage is derived from a human cell line. In some embodiments, the cell lineage produced is derived from HeLa 4549, 293, or PERC® 6.Crucell® cells, for example, prior to the introduction or retention / fusion of DNA encoding rep and cap genes from 88 and / or the 3887 genome. Hyper-sized cell lineage To obtain a productive cell lineage, the cell lineage is 4549, 293 cell lineage, HeLa® or 6.CruceU (PERC)_، Or derived from it,

[0147] In some embodiments, the growth-producing cell line is vomited into a suspension. As is well known in the art, fixation dependent cells are typically not able to grow in a suspension without a substrate, for example fine carrier beads. It could include vomiting of a cell strain to grow in suspension, for example, the growth of the cell line in a rotating culture with a stirring stirrer, using a culture medium lacking calcium and magnesium ions to prevent agglomeration (and optionally an anti-foaming agent), using a culture vessel covered with silicate marinade, and selecting cells in The farm (not in huge agglomerations or on the sides of the bowl) at each pass. For further description, see, for example, ATCC frequently asked questions 4001 (at wi.atcc.org/Global/FAQs/9/l/Adapting%20a%20monolayer%20cell%201me5/o20to%20).

suspension40.aspx ^ and references indicated in the current application

١٨٨

41387Β1

10148 In some respects, a method is provided to produce any rAAV particle as described in the present application. It includes (a) cultivating a host cell under a condition that enables the production of rAAV particles, wherein the host cell contains (1) one or more of the 887 packing genes, where each gene encodes a globular AAV packing protein. Transcription of AAV and / or its inclusion in capsid; (2) a 887 elementary vector containing DNA encoding heterogeneous nucleic acid quantifies the present application surrounded by at least one of ITR 87, and (3) auxiliary function 887; and (b) extraction of rAAV particles produced by The host cell. In some embodiments, at least 111 887 the aforementioned slimes are selected from the group consisting of AAVl, AAV9, AAVrhSR, AAVh, AAV8, AAV7, AAV6, AAV5, and AAV4 43 442.

8710 E 8, AAVrhlO; AAV, AAV DJ, AAV2R471A, AAV12, AAVll from goats, AAV bovine, or AAVITR mouse serotypes etc. For example, in some embodiments, the serotype 887 is 41 4472 45 46 AAV8, AAV7, AAV10 449 1188 , AAVrh8, or AAVrhlO. In certain embodiments, the DNA in 887 comprises 42ITR and in some embodiments, the protein included in the aforementioned capsid is selected from the group consisting of AAV8, AAV7 446, AAV5 44 43 4472, AAVl, AAV2R471A, AAV12, AAVll, AAVrhlO, AAVIO, AAV9, AAVrh8R 118, AAV V708K, AAV2 708Α, AAV2 Ε548Α, AAV2 Ν587Α, AAV DJ 472 / 2-71108

AAV from goats, 8871/8872 chimeri, 887 bovine, or capsid proteins from mouse serotype 42/110301 to 88 or their mutants. In some embodiments, the encapsulation protein in the capsid is a 445 proteincapside including the AAV5 proteilicapside which has tyrosine capsid mutations. In some embodiments, the embedding protein in capsid is an 875 proteincapsid, including 8875 capsid proteins in which the capsid tyroside mutation is ITR ^, 442 ITR. In models

١٨٨

41387Β1

Other, the rAAV particle includes AAV serotype capsid proteins from Clades A ^ F. In some embodiments, the 887 serotype is AAV7, AAV6, AAV5 442, AAVl, 448 4188 4088 AAVIO, AAV9, or AAVrhlO. In some embodiments, the rAAV particle includes glycapsid serotype 1 (41). In some embodiments, the rAAV particle includes a telescope serotype 2 (442). In some embodiments, the rAAV particle includes, or mutant, AAVrh8R glycapsid. In some embodiments, the rAAV particles comprise AAV1 capsid and a recombinant genome comprising 442 442 ITRs mutant ITRs and DNA that encodes transgenic therapeutic acid. In some embodiments, 887 ITRs are ITRs. 887 are 46 4475 474 43 4472, AAVl, AAV12, AAVl, AAVrhlO, AAVIO, AAV9, AAVrhSR, AAVrh8, AAV8, AAV7.

44284714 [• 887,887 goats, AAV bovine, or AAV ITRs. In certain embodiments, the ITRs 887 are 42 ITRs and in some embodiments, the ITR is derived from AAV2, the capsid is derived from 442 and in some embodiments, the ITR is derived from AAV2, and the capsid is derived from ^ AAVrh8R.

10149 In the present invention, suitable rAAV culture media may be supplemented with serum or recombinant proteins derived from serum at a level of 0.5 / -20% (v / v or w / v). Alternatively, as is known in the art, rAAV vectors can be produced in serum-free conditions that may also be referred to in environments without animal-derived products. Those with ordinary skill in the art may realize that commercial or ad hoc environments designed to support the production of îrAAV vectors can supplement one or more components of the rAAV vectors in the field, including:

١٨٨

41387Β1

This is, without limitation, glucose, vitamins, amino acids, and / or growth factors, to increase Titer 3887 in microelements.

10150 3887 production farms can be grown under a variety of conditions (over a wide range of temperatures, for varying lengths of time, etc.) appropriate for the specific host cell being used. As it is known in the industry, it includes 1rAAV production farms. ^ Â ?? Bonding dependent which can be grown in suitable bonded vessels such as, for example, rotating bottles, hollow fiber filters, microcarriers, and bioreactors with packed or fluidized bed. That the 2887 conveyor streams also include cells prepared for suspensions such as 293 cells, HeLa, and wok cells that can be grown in a variety of methods including, for example, rotating flasks, stirred tank bioreactors, and single-use systems such as Wave bags system.

10151 Certain aspects of the present disclosure relate to the assembly of 887-particles containing over-sized genomes. The 887 particle vector in the invention may be harvested from 3887 production farms by dissolving the host cells in the production farm or by harvesting the depleted media from the production farm, provided the cells are grown under conditions known in the field. 887) in circles of healthy cells, as more fully described in US Patent No. 6,566,118 (6; 566, 118). Multiple freezing / smelting, ultrasound treatment, fine dilution, and treatment with chemicals, such as disinfectants and / or enzymesprotases.

0152 In some embodiments, the 887 particles assembled contain 4887 AKI genomes of about 5.0 kb. In some embodiments, the assembled rAAV particles contain genomes

١٨٨

41387Β1

rAAV is greater than approximately any of 5.0 kb base, 5.1 kb base, 5.2 kb base, 5.3 kb

1 kilobase, 5.4 kilobase, 5.5 kilobase, 5.6 kilobase, 5.7 kilobase, 5.8

1 kilo base, 5.9 kilobase, 6.0 kilobase, 6.1 kilo base, 6.2 kilo base, 6.3

Base kilobase, 6.4 base kilobase, 6.5 base kilobase, 6.6 base kilobase, 6.7 base kilobase, 6.8

A kilobase, 6.9 kilobase, or 7.0 kilobase, 8.0 kilobyte base, or 9.0 kilobase in terms of length, or any value between them in terms of length. In some embodiments, the collected 887 particles contain genomes between any of about 5.0 kb base and about 90 kb base, about 5.0 kb base and about 8.5 kb base, about 5.0 kb base and about 8.0 kb base, about 5.0 kb base and about 7.5 kb base, about 5.0 kb. A base kilo and about 7.0 kilobases, about 5.0 kilobase and about 6.5 kilobase, about 5.0 kilobase base and about 6.0 kilobase Base, about 5.2 kilobases and about 8.0 kilobase, about 5.2 kilobase and about 7.5 kilobase, about 5.2 kilobase and about 7.0 kilobase, about 5.2 kilobase and about 6.5 base kilo, about 5.2k base and about 6.0 base base, about 5.2 kilo A base and about 5.5 kilobases, about 5.5 kilobase and about 9.0 kilobase, about 5.5 kilobase and about 8.5 kilobase , around 5.5 Kilo base and about 6.5 Kilo base, about 5.5 Kilo base and about 6.0 Kilo base, about 6.0 Kilo base and about 9.0 Kilo base, about 6.0 Kilo base and about 8.5 Kilo base, about 6.0 Kilo base and about 8.0 Kilo base, about 6.0 Kilo base and about 7.5 A base kilo, about 6.0 kilograms

١٨٨

41387Β1

A base and about 7.0 kilobases, about 6.0 kilobase and about 6.5 kilobase, about 6.5 kilobase base and about 9.0 kilobase About 7.0 kilobases and about 9.0 kilobases, about 7.0 kilobases and about 8.5 kilos on bases, about 7.0 kilos on bases and about 8.0 kilos on bases, about 7.0 kilos on bases and about 7.5 kilos on bases, about 7.5 kilos on bases and about 9.0 kilos to about 7.5 kilos on bases and about 8.5 Kb base, about 7.5 kb base and about 8.0 kb base, about 8.0 kb base and about 9.0 kb base, about 8.0 kb base and about 8.5 kb base, or about 8.5 kb base and about 9.0 kb base, and in some embodiments, the collected rAAV particles contain rAAV genomes between About 4.7 kilobases and about 9.4 kilobases, optionally about 4.7 kilobases and about 6.7 kilobases, or about 5.2 kilobases, and about 8.7 kilobases.

[0153] In biting the samang, N. Two rAAv particles from Linn are about 48 hours and about 96 hours after the auxiliary functions are provided. For example, in some embodiments, the rAAV particles are collected after about 48 hours, about 60 hours, about 72 hours, about 84 hours, or about 96 hours of providing the auxiliary functions. In some embodiments, rAAV particles are collected after about 48 hours, about 96 hours, about 48 hours and about 84 hours, about 48 hours, about 72 hours, about 48 hours, about 60 hours, about 60 hours, about 96 hours, about 60 hours and about 84 hours, about 60 hours and about 72 hours, about 72 hours, about 96 hours, about 72 hours, about 84 hours, or about 84 hours, about 96 hours of the provision of auxiliary functions.

١٨٨

41387Β1

10154 In another embodiment, rAAV particles are purified. The term includes purified according to its use in demand for the present preparation of 8827 particles devoid of at least some other component that may also exist where rAAV particles exist naturally or from which rAAV particles were initially prepared in this way, for example, rAAV particles can be prepared Isolated using a purification mechanism to enrich them in a source mixture, such as farm bee product or production farm supernatant. Enrichment can be measured in a number of different ways, including, for example, the ratio of particles to resistance to DRPs (DNase) or copies of genomes (gc) present in solution, or by infection, or it can be measured with respect to a second substance, which is an overlap present in the mixture. To my sources, such as pollutants, including production farm pollutants or process pollutants, including helper virus, media components, etc.

10155 In some embodiments, the rAAV farm is harvested to remove family debris. In some embodiments, the production farm harvest is filtered through a series of depth filters including, for example, grade AIHC, grade DOHC Millipore Millistak + HC Pod Filter Millipore 14115+ HC Pod Filter, and Filter Opticap XLIO Millipore Express SHC 0.2 Hydrophilic Membrane. M Leaching can also take place with a variety of other standard mechanisms known in the field, for example, centrifugation or filtration through any cellulose acetate filter of 0.2 m or the larger pore size known in the field.

00156 In some embodiments, culture harvesting of rAAV production is further processed using BCnzonasc® to digest any of the alginate weight present in the production farm and in some embodiments, the Benzonase® is digested ^ standard conditions known in the fields including, for example, an alpha concentration of -1 2.5 mm mm 3020088 The temperature ranges from an ambient temperature of 37 ° C for one minute to many hours.

fill

4138731

[0157] The rAAV particles can be isolated or purified by using one or more of the following purification steps: equilibrium centrifugation; filtration for anionic exchange in the interstitial flow; Tangential flow filtration ^ TFF ^ for rAAV particle concentration; Capture rAAV with apatite chromatography; Deactivation of the helper virus with heat; Capture rAAV with hydrophobic reaction chromatography; Exchange of the buffer solution with a volume exclusion chromatograph (SEC); Nanofiltration; and rAAV capture by anoviodic exchange chromatography, cationic exchange chromatography, affinity chromatography. In some embodiments, the refining includes one or more of the chromatography steps (for example, one or more of the chromatography steps described above). These steps can be used alone, in a variety of combinations, or in different arrangements: in some embodiments, the method includes all of the steps in the order shown below. Methods for rAAV particle purification are found, for example, in Xiao et al., (1998) Journal of Virology 72: 2224-2232; US Patents No. J 6,989,264 (6, 989, 264) and 8,137,948 (8, 137, 948); and International Patent Application No. 2010/148143 148143/2010 (WO).

[0158] In some embodiments, the AAV particle is a pharmaceutical combination. In some embodiments, particle 38867 is a pharmaceutical composition containing pharmaceutically acceptable excipients. As is well known in the field, pharmaceutically acceptable excipients are relatively inert substances that facilitate the administration of a pharmacologically active substance that can be provided as solutions or liquid suspensions, as emulsions, or in solid forms suitable for solubility or suspension. In a liquid before use, for example, the excipient can give shape or consistency, or act as a diluent. Suitable excipients include non-exclusive stabilizers, wetting agents and emulsifiers, varying osmotic salts, softening agents, pH-regulating agents, and buffering solutions. These excipients include any pharmaceutical agent suitable for delivery to a targeted fusion that can be administered without excess toxicity including the pharmaceutically acceptable excipients, but not exclusively, Sorbitol,

fill

4138731

Any of TWEEN's various compounds, and liquids such as water, brine, glycerol and ethanol. Pharmaceutically acceptable salts may be included in it, for example, mineral acid salts such as hydrochloride compounds, hydrobromides, phosphates compounds, sulfate compounds, etc.; and salts of organic acids such as acetates, propionates, malones compounds, benzoates, etc. . A comprehensive discussion of pharmaceutically acceptable excipients is available at REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., NJ 1991).

10159 These pharmaceutically acceptable carriers can be sterile liquids, such as water and oil, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, etc. Use of saline and aqueous dextrose solutions, polyethylene glycol (1158) and glycerol as liquid carriers, especially for injectable solutions. The pharmaceutical composition may also include additional ingredients, for example preservatives, buffering solutions, stress control agents, antioxidants and stabilizers, non-ionic wetting or thinning agents, viscosity agents, etc. The pharmaceutical formulations indicated in the present application may be packed in doses. Mono units or in multiple dose forms. The formulations are generally formulated as a sterile and highly isotonic solution

7- Methods of administration

[0160] In some aspects, the procedure provides methods for treating a disease or disorder that need to be so, including administration of 4 particles. 887 particles may be administered into a specific tissue of interest, or they can be administered liaisonally and in some embodiments, an effective amount of AAV particles may be administered orally. . Non-oral methods of administration may include, but not exclusively, intravenous administration.

١٨٨

41387Β1

In the bone, in the artery, in the brain, in the muscle, in the tibia, under the skin, in the ventricle of the brain, etc. In some embodiments, an effective amount of 887 particles may be administered by any administration method and in some embodiments, a dependent amount of 887 particles of Jellal can be administered a combination of CARE from a single administration method. In some embodiments, the individual is a mammal. In some embodiments, the individual is a human being

10161 An effective amount of 887 particles including the 887 oversize genome is administered, depending on the goals of the treatment. For example, when a low percentage transfer rate can achieve the desired therapeutic effect, then the treatment goal is generally to meet or exceed that level of transfer. . In some examples, this level of transfer can be achieved by transferring only about 1 to 5% of target cells of the desired tissue type, in some embodiments at least about 20% of cells of the desired tissue type, and in some embodiments at least about 50%, and in some embodiments. The lowest is about 80 /, in some embodiments at least about 95%, and in some embodiments at least 99% of the cells are of the desired tissue type. As a guide, the number of particles administered per injection generally ranges between about 1 X 106 and about 1 4 X A 10 particles, between about 1 3 X 1107 X A 10 particles, between about 1 2 X 1910 X 10 particles, or about 1 109 X particles, about 1 0 X 10 particles, or about 1 X 10 particles. The combination of rAAV is by one or more administrations, during the same procedure or at intervals of days, weeks, months, or years. One or more of any of the methods of administration indicated in the present application may be used. In some embodiments, multiple vectors may be used for human manipulation.

10162 Methods for identifying cells transported with 88 viral particles are well known in the art; for example, immunohistochemistry or a marker such as fluorescent protein may be used.

fill

4138731

The green fluorescent enhancer is used to detect the transport of viral particles; for example, viral particles not including 887 glycapside have one or more amino acid substitutions.

10163 In some embodiments, the 8867 viral particles containing the hyper-sized AAV genome are administered to more than one site simultaneously or sequentially and in some embodiments, the multiple injection interval of 887 viral particles is not more than one hour, two hours, three hours, four hours, five hours, six hours. Nine hours, twelve hours or 24 hours in between,

[10164 In some embodiments, the invention provides methods for treating a disease or disorder in an individual that include the administration of an 887 particle comprising the hyper-sized AAV genome, where the over-sized 887 genome comprises a genetically modified spine suitable for treating the disorder. In some embodiments, phlebotomy provides methods for treating muscular dystrophy with an 887 particle containing the 887 hypervolum genome comprising a hypervolumental 887 genome. Genetically from dystrophin (for example, a genetically modified human dystrophin gene). In some embodiments, the invention provides methods for treating a deceverlin misfire with an 887 particle containing the 887 hypervolume genome of a Decferlin transgenic (for example, a genetically modified genome from a human desferlin). In some embodiments, the invention provides methods for treating cystic fibrosis with an 887 particle that includes a transgenic 887 transgenic 1 genome (for example, a transgenic gene from a human CFTR). However, the invention is not limited to diseases or disorders that require the expression of a GM genome greater than that can be accommodated in the genome of 887 vector 4.8 kb. For example, and in some embodiments, the invention provides 887 particles containing the 887 genome containing one or more of the ligated genes. Asymmetric genetically speaking, the combination of an asymmetric transgenic gene and factors lead

١٨٨

41387Β1

Regulatory (enhancers, enhancers, introns, etc.) to the 887 genome is larger than about 5.0 kb.

VI— Toolkits

0165, in some embodiments, the stamping includes toolkits equipped with resolvers 887 comprising the hyper-size genomes provided in the invention. In some embodiments, the kit also includes a device for the delivery (for example, non-oral administration) of the 3887 particle formulations. In some embodiments, the instructions for use include instructions according to one of the methods indicated in the present application and in some embodiments, the instructions are printed on a label that is provided. With a container (for example, install it in it). In some embodiments, instructions for use include instructions for treating a disease or disorder.

0166 In some names of SMVs, a tool kit includes a single fluid (for example, a pharmaceutically acceptable fluid comprising an effective gel from the carrier). In some embodiments, the tool kit includes two or more fluids and the fluid may include a whisk, a buffer solution, excipients, or any other liquid indicated in the current application or known in the field suitable for conducting, diluting, stabilizing, regulating, or otherwise transporting the AAV particle included in the disclosure. Present. In some embodiments, the system includes one or more buffers, for example, a buffer aqueous solution. Examples of buffer solutions may include non-exclusive buffers of phosphates, citrates, HEPES, Tris, and other organic acids.

10167 And in some embodiments, the kit includes a container. Suitable containers may include, for example, vials, bags, syringes, and bottles, and the container may be constructed from

<img file="MA41387B1_D0007.tif" />

fill

4138731

One or more such as glass, to metal, or plastic and in some embodiments, the container is used to hold the combination 38867 mentioned in the present disclosure and in some embodiments, the container may also carry a fluid and / or other therapeutic agent.

Examples

10168 The invention is fully understood with reference to the following examples. However, it should not be interpreted 5 as restricting the scope of the invention. It should be understood that the examples and models described in the present application are for illustrative purposes only, and that various modifications or changes may be suggested in light of which they will not be skilled in the fields and are considered within the content and visibility of the current application and the scope of the attached protections.

Example 1: Generation of cell lines produced with vectors 1] 1271 hyper-size of 5.1 kb

And 5.4K base 10

[0169] As described above, there is a need for a platform that can produce rAAV vectors with hyper-sized genomes with high yields, standardized product, and high-quality genomes. For example, greater than 5K base).

Methods 15

^^^ FVï ^ '^ Oversized pTP is 5.45.1 kbps

[0170] The FVIII-expressing strips were generated in 57-ammonium based plasmids consisting of

Costa, RH et al., Mol Cell Biol 1986, 6: 4697-4708.) (202 bp (mTTR) murine tert-transthyrin enhancer.

Jiang, H. et al.,) Hybrid intron, core sequence with and without 100 bp enhancer sequencer)

41387Β1

108: 107-115 1 1271 [1 cDNA omitted B-domain perfect human codon, sequences

Synthetic inverted terminal repeat or BGH polyA and rAAV2. This resulted in the generation of 2887 vectors with vector genome sizes ranging from 5.1 to 5.4 kbps (Figure 1A).

[0171] The plasmid vectors with expression strips 11] produced by 1111 were tested in vivo with high volume injection in non-normal mice. To form a product cell strain (* for vector 5

FVIII for AAVrh8R a 5.1 kb, pAFTGEN-SEAP- plasmid, TriplePlay caprh8R, BglII, was digested with a blunt tip. The FVIII vector genome was excised by branching 8872 ITRs by using (pITR-mTTR-hFVIIISQco-SpA) pUC57-mTTR-hFVIIIco Pin: 5 (3)

Sapb Pvul Placements. The blunt 5.5 kb PvuI / SapI fragment was attached to the dTriplePlay plasmid with a 5.1 kb FVIII vector and 411 888 cap gene A similar 10 structure containing the 0AAV8 cap gene was generated and TriplePlay plasmid with the AAVrhSR cap gene and a 5.4 kb transporter was made by replacing the synthetic polyA region With bovine growth hormone (BGH) polyA. The infection was transmitted to kanamycin resistance clones generated in 17 No 11 cells to test for protein 1111 production.

[0172] Confirmed by quantifying FVIII levels in the media by ELISA assay

Standard on production of FVIII x TriplePlay select plasmids. The vector generation of rAAV from 15 or pTGEN / AAVrh8R / mTTRhFVIII) was tested to select TriplePlay plasmids.

pTGEN / AAV8 / mTTRhFVIII) by co-infecting pAdhelper in 293 cells. Cell analysis products were pooled and [80] was performed using primer / ^ FVIIl to quantify the amount of genomes packed.

fill

4138731

[0173] The prefixes and prefixes (used in the examples for SS in the SSL) are found in the table

The formation of the cell strains producing 11 vectors with a size of 5.1 kb 5.4 kb

10174 The infection was transferred to the pTGEN / AAVrh8R / mTTR-hFVIII plasmid (using 5.1 or 5.4 kb vector) or the pTGEN / AAV8 / mTTR ^ hFVIII plasmid using the Lipofectamine and Plus reagent in HeLaS3 cells. The cells were placed in a plate on dishes with 60 96 eyes. The plates were washed and fed weekly. After selection, the plates were recorded to ensure the growth of the culture. The main eyes (045) were collected and transferred to a plate containing 24 eyes and collected according to the size in a plate containing 24 eyes.

10175 The main eyes were then placed in a plate on plates with 96 eyes for relative production (RP) and 108 positive eyes to confirm the production of the carrier and then the RP assays were tested and then tested for the specified production level (SP); For example, by qPCR (Martin, L. et 4., 2013 Hum. 3) 7 Ther. 412 24: 253-269) carrier production by

Characterization of genomic DNA of cell strains produced with FVIII vectors of size 5.1 kb and 5.4 kb.

10176 Genomic DNA DNA analysis to execute transcription from the vector, rep and puromycin sequences by qP CR using specific primers and probes for each sequence. Additionally, the size and integrity of the “TriplePlay ^^” plasmid was analyzed in Southern blot. For this purpose, 591 (single-cutter in Tripleplay plasmid) genomic DNA was digested to determine the size of the combined TriplePlay plasmid and with BglII / HincII to search for expression stripe integration. BglII / HincII &lt;digestion penetrates, enhanced

fill

4138731

mTTR, and FVIII cDNA and synthetic polyA generate 1.8 and 2.8 kb fragments. The digested genomic DNA was transferred and TriplePlay plasmid (peaked in genomic DNA and used as copy number and volume markers) onto 0.8% agarose gel. The DNA was transferred onto a nylon membrane and probed using a FVIII Ncol fragment encoded with 10 •

Characterization of AAV / mTTR-hFVIII vector production from the produced cell strains

[0177] Selected MWs were analyzed to produce the rAAV vector. For comparison, FVIII vectors with a volume of 5.1 and 5.4 kb were made by a triple infection transfer production method by the transporter plasmodium-057 • mTTR-hFVIIIco in 293 cells. Cells were pooled, lysed, and the comparative purification was performed by the method of producing cell strain. Samples from both methods of vector genomic copying were quantified by qPCR and virus extraction processes and production yields were calculated. Vector batch numbers were characterized by 148-505 and AUC analysis, and for packaged genome volumes (see below).

Characterization of rAAV / mTTR-hFVIII vector genomes generated from the progenitor cell lines

10178 Packaged carrier genomes (VGs) were extracted from purified capsids as follows. The virus was incubated with 110 units of Promega (045) at 37 ° C for an hour. 1014 was added to stop digestion, followed by incubation by digesting the enzyme proteinase K with N-lauryl sarcosil at 50 ° C for 45 minutes. The 28 acid was extracted with phenol: chloroform : Isomyl alcohol (25: 24: 1) was centrifuged at 14,000 rpm at 4 C for 10 minutes. DNA was precipitated with 100% ethanol and 3M T sodium acetate at 80 M for 1 hour, and centrifuged for 1 hour. DNA and corpuscle were resuspended in TE.

١٨٨

41387Β1

10179 To perform Southern analysis, the genomes were separated with 1% electrophoresis of an alkaline gel in a buffer solution consisting of 30 mM NaOH and 1 mM EDTA. Samples were transported and cross-linked on a membrane 1130 (ham), and probed with various fragments defined by the expression strip of FVIII. This included a 4 kb-sized fragment 7001-101 containing all of the FVIII domains except 02.Additionally, the strand-defined oligonucleotide 5 probes consisting of 25 to 30 units were used. The larger probes were coded using the AlkPhos Direct Labeling (Amersham) coding system. The oligonucleotide probes were coded at pin 3 'using a DIG Oligo coding kit at pin (10) 3 according to the manufacturer's instructions.

80 101 The normal properties of a 0, acid point-smudge analysis of VGs were removed in a TE buffer solution with pH 7 by heating at 100 M for 5 minutes followed by cooling for 5 minutes 10 on ice and placed manually on a nylon membrane using a multi-channel burette. UV synaptic. Hybridization was performed for each DG-encoded oligonucleotide probe at 50 M for 6 h in Easy Hyb buffer solution followed by high intensity washes, an inhibition step (30 min), and detection with 10 anti-DIG fragments conjugated with alkaline phosphatase (30 min). , Additional washes, reaction with a Zen (5 min) 15 and exposure to x-ray film according to the instruction of Roche '3-pin coding kit. Signal density in Southern and point smears was determined using ImageJ software (available at rsb.info.nih.gov/ij).

Table 1- Prefixes and probes

١٨٨

41387Β1

<td>The mouth sequence:</td><td>'Soualeh' .. 8</td><td></td>

<td colspan="3"></td>

<td> 5</td><td>GACGTGGTGCGCTTCGA</td><td>1 LM12711 - prefix Anterior</td>

<td> 6</td><td> (((1((1441((((11((31(11</td><td>7111 Α1- prefix Reversible</td>

<td> 1</td><td>AAGCGTGGCCAAGAAGCACCCC</td><td>FVIIIAl probe</td>

<td colspan="3">Quantification of the Ampicillin gene^R</td>

<td> 8</td><td>GTTGCCATTGCTACAGGCATC</td><td>Amp— forward prefix</td>

<td> 9</td><td>ACTCGCCTTGATCGTTGGG</td><td>0] 0 • M8-prefix Reversible</td>

<td> 10</td><td>13 / 1- ((() (1) 111 (1) (4) (3)) 311 (411) - TAMRA</td><td>Amp— Mubar</td>

<td colspan="3">Determine the limit for what time »</td>

<td> 11</td><td>GGACCGCCACATCGAGC</td><td>Puromycin-prefix Anterior</td>

did not

MA 4138731

<td> 12</td><td>CCCCGCTTCGACGCT</td><td>Puromycin-prefix Reversible</td>

<td> 13</td><td>FAM-TCACCGAGCTGCAAGAACTCTTCCTCAC- TAMRA</td><td>Puruma lysine - MSPA R.</td>

<td colspan="3">, The quantitative definition of lmj 3 * ': then.</td>

<td> 14</td><td> (4((4((((11104(4(31(3(+11</td><td>Rep— forward gesture</td>

<td> 15</td><td>GGCAGCCTTGATTTGGGA</td><td>Rep— A reverse prefix</td>

<td> 16</td><td>FAM-AATGCGGCCTCCAACTCGCG-TAMRA</td><td>Rep-probe</td>

<td colspan="3">Quantification of the T. gene</td>

<td> 17</td><td> ((4(1(((3(34(((+4(44</td><td>Ε6— forward prefix</td>

<td> 18</td><td>TCCAATACTGTCTTGCAATATACACAGG</td><td>Ε6— an inverse prefix</td>

<td> 19</td><td>FAM-TGCACGGAACTGAACACTTCACTACTGCAAG- TAMRA</td><td>Ε6— probe</td>

<td colspan="3">D 7 K.^:Zak 0 | Tel; G: -0.0 Bug |; Errz:;_:B; ^ a-lx; rk^؛:K ;; 0: 'clears 6b; | 0 ahaj' || 0 aa ^ t^;T;</td>

<td> 20</td><td>CCGTCGTGAATAGCCTGGACCCTC</td><td>Oligo # 4768 (+)</td>

<td> 21</td><td> 1(1((1(31((111111(3(31(3((3(3(</td><td>Oligo # 4924 (A)</td>

-9741387031

<td> 22</td><td>AATCCCAGTCCTCTTCCTCGGCGGCGATA</td><td>Oligo # 3342 (-)</td>

<td> 23</td><td>AGTATCGGAACACTCGCTCTACGAAATGT</td><td>Oligo # 4900 (-)</td>

AAV / mTTR-hFVin, ^ M cell strains produced in the in vivo

[0181] The AAV vector was evaluated in male KO mice with hemophilia C56BL / 6, C56BL / 6 (2&gt; A18-1295 new genes in exon 16)) at the age of 8-12 weeks (Jackson Laboratories). The reptiles (4, 10 and 0 3 DRPlO) were administered¹⁰ X / mouse) transverse a vein through a tail vein. Blood was collected through the retroorbital sinus in sodium citrate tubes and the plasma was stored frozen until analysis 5. Plasma samples were analyzed for FVIII activity levels with the Diapharma Coatest test according to the manufacturer's protocol (modified for coordination of 96 samples). The values ​​were measured as a percentage of FVIII activity present in normal plasma and converted to nan g / mL (100% FVIII = 150 ng / mL). Some samples were also tested for partial thromboplastin time (PTT 1001). FVIII protein levels were quantified by standard ELISA (10 Enzyme Research Laboratories) using pooled natural human plasma (Innovative Research) as standard.

[0182] Alkyd samples were collected at the end of each study. Livers (50-400 mg) were infused into RLTpius with 10 μl 8-mercaptoethanol and 1 mm beads of 1/4 inch zirconia homogenized using 16-beater beads. A stalk of this homogenate was placed in Trizol (for RNA) or 60-DNA DNA Stats). No 1 was purified using Protocol 11023 Purification 15 with a rotating column (Promega 3100) according to the manufacturer. ^^ Was filtered with nuclease-free water and centrifuged for 1 minute at 15,000 gX. 1 was used to generate cDNA (Invitrogen). DNA was purified by Purelink columns to extract (Invitrogen (DNA)) according to

4138731

To the manufacturer's instructions. Then VcDN and DNA were used to identify 1,104 genomes

The carrier, respectively, by r1J ^^ LqPCR primers and a probe specific to FVIII region 82 (Results Table

[0183] To generate a platform] • To produce the rAAV micro-size vector, new bands expressing 5 expression 711 T1 were generated. These bands were surrounded by 887 ITRs and ranged from vector genomes 5.1 to 5.4 kb (Fig. 1A). Each bar included a reinforcer derived from the 011% reinforcer, and 112 different alternatives were configured to examine their effects on expression (see Alignment and Interpretation of Alternatives in Figure B).

[0184] All of these expression strips were produced in the context of FVIII plasmids when tested in an antibody

Live cache in mice (Fig. 1c). The modifications to the HNF ^ HNF3 binding sites shown 10 in Figures 1a &amp; 1b increased the production of the FVIII زز promoter 0111 pulp (202) with additional modifications such as the mTTR enhancer, but this did not occur with 30111004 (1c). Figure 1d shows the expression bar diagram.

FVIII ^ Figure 1e shows a plasmid design. Tri plePlay

10185 Expression Strips were used with (5.1 ^ 'mTTR kbase) and Expression Strips with Enhancer,

mTTR and (5.4) BGH poly A kilobase) in the next test for PCL production of 15-size coarse FVIII vectors after generating a TriplePlay plasmid for each of them. The results of FVIII ELISA confirmed that

١٨٨

41387Β1

[91/111] the infected patient produced 1111 in vitro when introduced to the infection in 7Ts11 cells.]] 71 also was able to generate 887 plasmids in small-scale mobilization fights.

10186 For clearance, modifications of the promoter 0111 were generated that increased the expression of the in vivo promoter 011 pulpy. All TriplePIay enzymes expressed FVIII in vitro and were able to generate the virus in small-scale packaging experiments5.

[0187] To generate mTTR-FVIII-produced cell lines at 5.1 kbps, MWs ^ was analyzed with respect to rAAVrhSR / FVIII production levels. Among them, high products, medium products, and low products have been recognized as such, it turns out that PCLs can generate 1011-111 /] oversize.

Shall 2: The genome of an adult-producing cell line J ^ 10 mTTR-FVIII

[0188] To evaluate the combined copies of its plasmid with 11 labels 1 and the FVIII-expression stripe integration shown in Example 1, MWs containing 08 of 5.1 / 887 kb base, 5.4 / 441108 bases, or 5.1 / 8878 kbps of FVIII DNA analysis were selected.

10189 In ^ High Production (0435), Southern analysis revealed about 50 copies of the vector genome and cell lineage, while the average production was 272 x 17 less than 10 copies of each of them 15 according to Southern (Fig. 2A).

10190 Weights were analyzed for high and medium production molecular weights to produce 5.1 / AAVrh8R kb base, 504 / AAVrh8R kb base or 5.1 / 8878 kb base, using 3011-1) and 10 (Table 2). The copy numbers of the rep, FVIII and puroR genes were determined using the /

fill

4138731

-100-

Specific probes for each of them have been approximated by the number of copies of your genome (HeLaS3) contained in cells (ll), one copy per genome (Ha!). In a high molecular weight (14435) * •• analysis revealed about 67-59 copies of the vector, aa) and puromycin (Table 2), while production averaged 272 # 15mW to 18 copies of each كلm 0 mu (Table 2). These values ​​were slightly higher compared to the results. Obtained by Southern but had a similar rank (Figure 2A). For comparison, a normal volume vector (4.3 kb) expressing SEAP was packed into 472 88788 oCapsides and analyzed.

Table 2 - Genomic analysis of molecular weights selected for the combined TripIePIay۶ transcript.

<td rowspan="2">level Production</td><td colspan="3">Transcription / cell</td><td rowspan="2">The main eye</td><td rowspan="2">Cell lineage</td>

<td>Puromycin (What)</td><td>REP (stdev)</td><td>7111 (stdev)</td>

<td>high</td><td> (1)59</td><td> (0)65</td><td> (261</td><td>H</td><td>5.1FVI AAVrhSR Kilo base</td>

<td>Average</td><td> 18</td><td> 16</td><td> 15</td><td>MW # 272</td><td>Kilo base</td>

<td>high</td><td> 260</td><td> 195</td><td> 229</td><td>418 D.</td><td>] WMA] / [[[] 5.1 Kilo base</td>

fill

4138731

-101-

<td>Average</td><td> (12)196</td><td> )256 (1</td><td> 1)235 (3</td><td>MW # 61</td><td>5.4fVIII / AAVrhSR Kilo base</td>

<td>high</td><td> (5)237</td><td> )265 (1</td><td> 4)253 (0</td><td>MW # 163</td><td>5.4FVIII / AAVrhSR Kilo base</td>

<td>high</td><td> (13)266</td><td> )294 (6</td><td> 3)270 (8</td><td>m</td><td>5.1FVH! // 8 Kilo base</td>

<td>high</td><td> (4)108</td><td> )126 (2</td><td> 5)101</td><td>MW # 342</td><td>Kilo base</td>

<td>high</td><td> 4)1343 (2</td><td> 1499 (22)</td><td> )1362 (48</td><td>MW # 14</td><td>FVIIIopt AAVrhSR 5.1 kg base</td>

<td>Average</td><td> (1313</td><td> (3)82</td><td> (4)77</td><td>n</td><td>FVIIIopt / AAVrhSR 5.1 kg base</td>

<td>high</td><td> (2)70</td><td> (1)73</td><td> 0</td><td>control (7 + 156 SEAP)</td><td>AAV2 / SEAP</td>

<td></td><td> 0</td><td> 0</td><td> 0</td><td>HeLaS3</td><td></td>

(00191) Southernnell 04 spot analysis revealed a J-genome with a restriction enzyme (501) expected to cut only once in a 4Tripleplay / FVIII plasmid of the –13 kb domain that was similarly migrated to

fill

4138731

-102-

TripleplayZFVIIIA ^^ linear fixative in the J genome DNA. Therefore, all clones contained the entire plasmid integrated into the HeLaS3 genome.

01921 As shown in FIG. 2A, all molecular weights also had different sizes of the same low copies (one copy) representing the DNA of a genome surrounding the fusion sites. Whereas 272 (medium product) and 35 (high product) had a pattern indicative of a single fusion site (only two surrounding fragments observed), MW418 had multiple surrounding fragments plus a larger fragment (about 24 x 14 χ2 kb), possibly in tandem with both directions. Anterior and reverse of the combined plasmid. This indicates that MW418 is not a littermate.

00193 As shown in FIG. 2B, the vector genome integration was analyzed]]] by digestion by cleavage enantiomers (11, Hindi C) in the expression cassette 1111. Correctly sized fragments were observed on the basis of similar results obtained with ingestion of the original TriplePlay plasmodium compared to the comparison sample. These results showed that no vector rearrangements occurred upon merging. Similar analysis was performed for the cell strains produced with the 5.4 kbp transporter plus the 5.1 kbps transporter with 88788 capsids, and close results were obtained. To summarize, no rearrangements or deletions were observed in the 5.1 or 5.4 kbps of vector sequences streaked in the genomic DNA isolated from the progenitor cell lines. Generation of the progenitor cells containing the 8827 Oversized vector genomes was feasible.

Example 3: Production of an over-volume vector using the produced cell lines and vector analysis

[0194] Next, the production of vector 2887 was examined using the MW35 cell strain shown above. The high yield clone was tested for AAVrh8R / 50l / kb of [] [1 (435)].

١٨٨

41387Β1

-103-

With the production of the Raav vector, small-scale farms. RAAV-apical production was observed at day 3 and 4 and high production levels were maintained during the farm setup (Fig. 3a).

[0195] This was purified with a greater form by tangible in Table 3 below. Production fitting

MW # 35 for comparing carrier production levels. In addition, vector levels in cell pellet (cell) and culture media (CM) were quantified. A normal-sized AAV2 / SEAP was shown for comparison. 5

Table 3 - Production of Kilo Base Carrier 5.1 / AAVrh8R by MWA35.

<td>(%) CM</td><td>cell(%)</td><td>78: 5 / ml</td><td>FVIII MW # 35</td>

<td> 61</td><td> 39</td><td> 2.41«0٥</td><td>20 (4 106 cells)</td>

<td> 55</td><td> 45</td><td> 10102.64</td><td>250 mL (10145 cells)</td>

<td> 64</td><td> 35</td><td> 10103.17</td><td>1000ml (2 * 108 cells)</td>

<td>NT</td><td>NT</td><td></td><td>717156 A (• 8) 5): 20 ml</td>

[10196 For the serotype of the vector used, the vector was equally detected in cell pellets and culture media. Each of the 35 were 418_jMWs' ^ over the many crossings. MW35 maintained a high production level (greater than or equal to 1 mm DRP05 / ml) from transit 5 through transit 20 (Fig. 3b). Similarly, 127,418 (classified as intermediate product) maintained a yield of 10 constant intermediate level (greater than or equal to) drpio9 X / ml) from jumper 5 through jumper 21. Fixed carrier production was also shown for 287 Q. Naval gave birth to 5.1 kb with a different serotype of capsaicin (8878) (Fig. 3B).

fill

4138731

-104-

10197 The data show that a constant high production can be obtained from the hyper-volume vectors, independently of the pattern of the capsid serum, similar to what was previously shown for the life-size vectors (2216-21: 2205 2013) Molectdar Therapy (Uh. 1, • mother) . Production was obtained

5.4 Kb base and wire mesh, sane mTTR-FVHI conveyor is also used with conveyors

5.1Kb with 8878 capsids, for close results. 5

0198 YMD: You, the captain production was called for by culling high-production head eyes (3) 5.1 / 44 118K base AAV8 / 5.1 / JmW # 287, FVIII K base FVΠI and 163 # MW

5.4 / AAVrh8R kilobase]]]) to assess the yield and quality of the carrier (Table 4 and Figure 4A). Vector production was compared with the vector generated by the triple infection method (Table 4 and Figure 4B). Three i •• batches and two TXN batches were included as compared to 88a] 5.1 / 887 kbps of 7111 ^ 10 data are shown with AAV hR capsid using 5.1 kb genomes as an example.

Table 4. Comparison of 5.111 / 188 kb base generator by PCL or triple infection methods.

<td>Thalassemia infection</td><td>The progeny of producing cells</td><td>Analysis</td>

<td>3 with 109 cells</td><td>2 «0 cells</td><td>Cells / production</td>

<td>DRPsl013x6</td><td>DRPs101⁴x2</td><td>Total toll of the carrier</td>

<td>drp / 0x2 cell</td><td>1 DRP / 1O cell</td><td>Outcome / cell</td>

<td> . %30-24</td><td> %50-44</td><td>NAR containing VG virus</td>

41387Β1

-105-

<td> %50-43</td><td> %61.59</td><td>Viruses with a VG greater than 4.7 kb</td>

10199 Production runs] • using 435 resulted in stable properties as shown in the evaluation by analyzing 0 not 8 (Fig. 4A). As summarized in Table 4 above, the percentage of vector genomes containing gum capsids with this analysis was 5044% for the virus generated by PCL, while for the triple infection material was 5044%. Lower levels (30%; only 1-5% HLP19, the main chain vector plasmid). Moreover, there was a higher streak of virus with 5 larger genomes (greater than or equal to 4.7 kbp) in the PCL metastases. Yields for X1 vector / cell 080103 / high-yield PCL were 1--3 drpIO⁴ X / CellBy ™ 919 [1] and less than the largest major chains of vectors, 1 no DRP10³ /cell).

Table 5- Comparison of 5.4 FVII ^ U / AAVrh8R kilobase generator by PCL or triple infection infection methods. 10

<td>Triple infection</td><td>The progeny of producing cells</td><td>Analysis</td>

<td>10% 2 times</td><td>10% 2 times</td><td>Cells / production</td>

<td>DRPsl014x2</td><td>DRPslOⁱ³x2</td><td>Total carrier toll (raw)</td>

<td>DRP / 1Q4 x 7 cell</td><td>drp! () 4x2 cell</td><td>Outcome / cell</td>

<td> %23</td><td> 024</td><td>NAR containing VG virus</td>

١٨٨

41387Β1

-106-

<td> %39</td><td>9 ah 50</td><td>Viruses with VGs are greater than. Kilo base</td>

10200 A similar analysis showed a 5.4 kbp vector using [slightly lower / drp levels by PCL] compared to the triple infection (Table 5 above). Whereas the percentage of VG containing glycapsids was close, the PCL-generated virus had a higher level than the virus with larger genomes (Fig. 5b).

0201 When describing the triple infection with AUC, the 5-genome L-genome was twice as high in PCL (Fig. 5a) compared to the triple infection subject (Fig. 5b).

Table 6- Analysis of aberrant packing in the vector produced by]] and triple infection.

<td colspan="3">Caliber of al-dakil (ml)</td><td></td>

<td>/ Puromycin</td><td>Puromycin</td><td>FVIII</td><td>Transported by PCL</td>

<td> 0.44</td><td>5.40ΕΙ09</td><td>1.2Ε + 12</td><td>FVIII-5.1 / AAVrh8R</td>

<td> 0.20</td><td>1.54Ε + 0</td><td>7.6Ε + 12</td><td>FVIII-5.4 / AAVrh8R</td>

<td> 0.24</td><td>1.21Ε + 10</td><td></td><td>FVIII-5.1 / aAV8</td>

<td>Ampicillin%</td><td>Ampicillin</td><td>FVIII</td><td>Transferred by TXN</td>

fill

4138731

-107-

<td> 2.10</td><td>4.76Ε1</td><td>2.3Ε13</td><td>FVIII-5.1 / AAVrh8R</td>

<td> 3.40</td><td>5.38.011</td><td>1.6Ε + 13</td><td>FVIII-5.4 / AAVrh8R</td>

<td> 2.00</td><td> 2.4714+11</td><td>1.2Ε13</td><td>4.6111 / aavr kilo Base</td>

00202 The level of unwanted and irregular enveloping DNA as measured by the presence of a plasma-derived antibiotic resistance gene (pyromycin for PCL, ampicillin) in virus encapsulation was low in the virus and generated by (&lt;1%) PCL) (Table 6). Conversely, the virus generated by TXN is about 10 times greater than the level of the non-uniform encapsulation. 5

10203 In short; The data indicated that the strains of the selected lysate are able to produce high levels of a large carrier (greater than 19 100,000 / cell). In addition, these cells maintain the carrier production capacity for many paths (&gt; 20) which are phased out in terms of manufacturing in a greater quantity. A comparison of the PCL vectors generated by the transmission method showed that the PCL material includes a larger vector A genome with a virus and that there are 10 percent Aberman-sized unpaired or vector genomes containing the virus and a higher proportion of a volume of the untreated type or larger vector genomes and also related DNA. Not required from the conveyor or unwanted at a lower capacity.

Example # 4: Characteristics of vector genomes encapsulated in large-volume vectors produced by

PCL

١٨٨

41387Β1

-108-

10204 The vector genomes encapsulated in large-scale rAAV vectors produced by the PCL platform are then analyzed. The vector genomes were isolated from the purified copies and analyzed with respect to single standard genomes by gel electrophoresis by Western spotting using probes identified by a vector (Fig. 6) Southern spotting showed that there was an amount of 4.0 kbatum n fragment from the FVIII expression cassette showing that there were many volumes of VGs that had approximately 4.6 kbps or greater than the vectors generated by either method. (Fig. 6B). The intensity of Western spots was calculated using ImageJ software. (http: //rsb.inf0.nih.g0v/ii)

[0205] VGs were also analyzed with a strand specific to the Oligio-nucleotide probes in order to estimate the amount of termination produced '5. Where the encapsulation of the 887 and your genomes is), JA et al. (2001) EMBOJ. 20: 3282-3291) '3 It is well known and it happens from the parties

Large vectors lack a sequence in 5 'terminals with no and no strands when there is a genome size greater than 4.7 kb. The portions of the vector used in Fig. 4a &amp; 4b were analyzed by using two serial dilutions required for each transmitter on the membrane (beginning at 2.4 x 10 and; for a total of eight vector-specific deficiency concentrations plus no genomes used in the form of a negative comparison sample) . Each spot was made to have a numbered 3 'tip of the Oligio nucleotide probes identified by the 3' and 5 'terminals of the vector genomes (with or without polarization). The intensity of the signal was quantified and normalized at the bus 4.6 kbps (with full encapsulation). Three applications were used to generate a standard error.

[0206] The data showed that the comparison was fully performed for the 4.6 KiB bus (with the

Compared with 5.1 kbps at the bus except for the Cl-band region-specific coding

١٨٨

41387Β1

-100-

FVIII) vectors with 5.1 kb have a single, low density when there are complementary oligonucleotides of a region larger than 4.7 kb which are used in relation to polarizations of single stranded genomes (Figures 7 or 7b and 7c). This difference was higher than a third of the material transported compared to the PCL carrier of most of the 5 'probes used.

02071] The difference in terminals 5 'was also observed in the PCL and the third part that was transposed and generated from vectors was also observed when there was Southern spotting which was probed using Olegio nihilicwitted complementary probes * or strands. The distance of each Olegio nucleotide probe from the relevant limbs 3 is shown (Fig. 8). First, the first detection of PCL and transmission of the third (1) infection generated by the virus by DNA staining analysis was compared with the strand-specific Oligio-nucleotide probes that show a specific comparison of each virus for each strand (4.6 kb virus used in the form of a comparison sample with respect to an enveloped virus. FVII 117 plasmids are used in the form of a negative comparison sample and positive comparison samples for the detection characteristic) (Fig. 8B) When the Southern spots are probed using the 3 'end oligio nucleotide probes, both the PCL and the TXN are Generated and demonstrated the presence of or-strands (Fig. 8C and the left panels). Higher levels of vector genomes higher than 4.6 kb were detected in the PCL virus similar to the observations shown in Fig. 6A. When the Suthern stains are probed using Oligio nucleotides of the 5 'end, the vector is detected. PCL showed genomes greater than 4.6 kb while there was transmission of virus-induced infection showing a clear lack of reference to larger genomes.

(The used probe detected an area at 4.9 kb from pin 3)) (Fig. 8)

Mastermind

fill

4138731

-110-

Validation of the upper parts of the genes of 4.7 keol pitum and verified by quantitative calculation of signal intensity in a varied volume of genomes in the Southern stains (using a probe to the 3 'ends) (Figure 8). The quantitative computation also clarified the lower fragment / cue genomes. (&lt;4.7kbps) in PCL bus compared to TXN bus.

[0208] From PCL and TXN, the packing of a gene for a gene of 5.4 kbytes of a vector for FVIII-generated by PCL and TXN is evaluated by similar methods. The position of the similar sequence of each Oligio nucleotide probe in the 5.4 kb genome of the relevant end of 3 'is elucidated. (Figure A). Similarly to the results for 5.1 kb and -a- and- strands of vectors out of 5.4, a byte was detected in levels compared to the Oligio nucleotide probes with the 3 terminals, of the genomes (Fig. 9B). Nevertheless, the probes are specific to areas present and above 4.7 kb from the 3 'terminals that failed to detect the vector genomes generated by the TXN method (Fig. 9c). On the contrary, the vectors generated by the PCL method demonstrate The presence of a genome is greater than 4.7 kb (although not much larger than 5.4 kb).

10209 In summary, this data shows a higher level of encapsulation of the vector genome in vectors generated by the PCL method compared to the TXN method.

Example # 5: Activity of the large volume rAAV / mTTRFVIII vectors in live calin

[0210] After astronomy, the rAAV sequencing is generated via the PCL platform and is checked for activity in the organism. The vectors were administered to mice in a tail vein at 3 X 10 A and 4 X 10 DRplO / mice and analyzed until day 56. PCL produced from 5.1 / AAVrhSR performed.

Sleep

4138731

-111-

Kb of the mTTR-FVIII transporter was generated by the generation of a detectable active FVIII protein in plasma from mice infected with KO-A in a dose-dependent method (Fig. 0a). In addition to the activity test from Coatest, the activity of FVIII was evaluated with respect to efficacy by the coagulation parameters using the clotting time test ([MH)]. This test showed clotting times compared to a high level test thus demonstrating that there is a clinically relevant low dose. Sufficient to make it normal for 5 for the time to see the foral parameters of the supplied A KO (for GCL 10B).

10211 The PCL-generated vector was compared with a vector that delivers the triple infection using a clinically relevant dose (2 DRpi2 10 x / kg, 4 x 10 m * / mouse). The vectors were administered to mice with hemophilia A KO by a tail vein. A PCL virus was produced which is more potent than the FVIII protein compared to the TXN virus that was produced and as determined 10 by the Coatest Activity Test (Fig. 11a). This also correlates with a shorter clotting time at day 21 by the aPTT assay by a generated vector. From PCL (Fig. 11b) little difference was observed between PCL and TXN at Day 56 which suggests that there is a substance 101 that results in faster expression kinetics (Fig. 1c). The quantitative calculation of vector genome transcripts from the liver showed more resistant vector genomes in animals treated with PCL generated by the vector compared 15 with what was observed in L * 1 (Fig. 1d).

[0212] ^ The PCL and ™ generated is greater than the 5.4 kb transporter of FVIII and was tested in treated mice infected with MMF and at a similar wipe of 5.1 kb, the 5.4 kb transporter generated by the PCL showed FVIII activity through the Coatest test and time. Shorter late on day 24 (Fig. 12a, b). In order to analyze the kinetics of carrier genome levels in the liver 20, transcription of the vector genome is quantified for both day 3 and day 43 after the vector is given.

١٨٨

41387Β1

-112-

The data were elucidated on both days and were approximately two times the vector genomes of PCL-treated animals from the vector generated as compared to the given substance (Fig. 12c).

00213 In summary, the hypervolate rAAVZmTTR-FVIII is generated by

The PCL method results in two times more FVIII-specific activity and has shorter clotting times 5 compared to the TXN method when tested in vivo in the hemophilia A KO disease model. These results are correlated with two folds higher than the vector genome displayed in the liver from the treated animals. Thus, these results demonstrate that the observed differences in the quality of the packaged genomes are between two vectors from the production methods for each of its vectors.

Excessive volume, which was translated to higher levels of activity in the organism by means of 10 PCL vectors on low-dose contact lacquer with active lacquer gions specific to the phagocyte of a target organ. Money # 6: Create special live strains of the procedure in interchange 51 5.9 6.7 kb

SEAP from

00214 Methods: Large-scale AAV2-SEAP vector genomes were generated with significant increases in

Conveyor size (see Fig.13a) ranges from 5.1 kb batee to 5.9 and 6.7 kb 15

Byte. The filler material was enlarged from 41 DNA fragments at three lengths (0.8, 1.6 and 2.4 keV

Bytes) by PCR

Using it as a base image of the AAVsp7O plasmid and each of the filler fragment were transcribed into TriplePlay plasmids with AAV2 cap and transcription genes for each of the SEAP carrier genomes generated from clusters of 20 pAF-SEAP plasmids.

fill

4138731

-113-

[10215 For the establishment of cell strains for large-volume SEAP vectors the corresponding plasmids comprise vectors from the AAV2 genome and cap genes which were side-by-side compared with the ability to generate high-yielding cell strains in high throughput dishes of about 24 samples. Infection was transferred to 75 HeLaS3 cells using each of the constructs for each standard protocol. After one day of infection in eight dishes, 24 eyes were handled for each infection, using 75,000 cells / eye, and culture was carried out using 75,000 cells / eye from the selection of the drug that was inactivated. Samples were cultured and tested with regards to colony size of gyrus in a sample to check relative productivity.

[0216] Results: The plasmids with a volume greater than 5.1, 5.9 and 6.7 (Fig. 13) were first confirmed with regard to the filling of an infection transport solution in 1453 cells (5). The results showed that all the vectors of the plasmid medium of the encapsulation were (not achieved). Clarify its data).

[0217] Her report there are about 100-170 on it. It was examined with respect to each other and the test for relative production there would be relative positive diphtheria cells (those that were produced with more than 7101 DRP, hoping for a test for relative crowning, and the values ​​are high at the boundary (&gt; 80) %) With only 6.7KB of build that indicated less product amount (65.7%). In addition, during only the structure of about 5.1, there is a structure of mast cells produced in a higher proportion (&gt; 1&gt; 1010 DRP ml) ranging from (a total amount of up to three) of mast cells produced within a range of High-medium (DRP 9 h 10 xl / ml) was determined in all cells. The high relative mean and pattern expected with 5.1 kb at 20%, 5.9 kb at 15.4% and 6.7 kb at 10.7%.

١٨٨

41387Β1

-114-

10218 Then all mast cells eyes were subjected to analysis for a specific throughput. The results of two types of assay are shown in Fig. 13b (with gray and white rods) and compared with a relative yield value (black rods) for each eye of a mast clot: the results indicated that in many cells of the vectors, they remain constant in the types of throughput assay.

[0219] In summary, the data indicated cell lines that could be generated in vectors at, size of 6.7 kb.

The props

[0220] Adequate polypeptide calves are provided from the N-end to the end unless otherwise specified.

[0221] All nuclear sequences are advanced from 50 to unless otherwise specified. 10 (5,097 base points) mTTR2Q2-HI-hFVHIco-spA

GAGCTCTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCG

4((444(1(1(1(3((3(0(4((3(1(1((3(3((10(3((((((1((1(((0(1(4((3(4( (1(+(1(1(1(1(1(4(14.(14(1(1(14(11(1((1(144(11((341(1(11(1(1(1(111(((1(1((11 (1(1(3(((4(11(3(4((3(1(4(11(311(3(3(44(11(1441(1(((+( (3(

AAGGTTCATATTTGTGTAGGTTACTTATTCTCCTTTTGTTGACTAAGTCAATAA

TCAGAATCAGCAGGTTTGGAGTCAGCTTGGCAGGGATCAGCAGCCTGGGTTG

GAAGGAGGGGGTATAAAAGCCCCTTCACCAGGAGAAGCCGTCACACAGATCC

ACAAGCTCCTGCTAGCAGGTAAGTGCCGTGTGTGGTCCCGCGGGCCTGGCCT

fill

4138731

-115-

11 (68) 1) 81) 8 a) 1+ (68) 8) 3) 88 118 l) 11 (1) (31) (3) (111) 6) 6) 3) 1181)) (3) 1181)

11 (11) 11111 (4) (11) (411) 1 (1) 34 (3) 411 (4) (4) (341) 341 (11)

TACTATCTGGGCGCCGTGGAACTGAGCTGGGACTACATGCAGAGCGACCTGG GCGAGCTGCCCGTGGATGCCAGATTCCCTCCAAGAGTGCCCAAGAGCTTCCCC TTCAACACCTCCGTGGTGTACAAGAAAACCCTGTTCGTGGAATTCACCGACCA (3 (11 (311 (4141 ((3 ((4 ((1 ((4 (4 (((((0 + 10 (4103 ((((1 (([(((0 (4

CAATTCAGGCCGAGGTGTACGACACCGTCGTGATCACCCTGAAGAACATGGC CAGCCACCCCGTGTCTCTGCATGCCGTGGGAGTGTCCTACTGGAAGGCCTCTG

40))4) )٨ )44)))))))0)4))4)1)1)))3)314)34)))3))3)3)3)4

٨٨٨٨ 1) )1))] 1)3)) [)))))4)))14)3)3)4)3))))3)1)))31))3)4

CGGCCCCATGGCCTCCGACCCTCTGTGCCTGACATACAGCTACCTGAGCCACG TGGACCTCGTGAAGGACCTGAACAGCGGCCTGATCGGAGCCCTGCTCGTGTGT

AGAGAGGGCAGCCTGGCCAAAGAGAAAACCCAGACCCTGCACAAGTTCATCC TGCTGTTCGCCGTGTTCGACGAGGGCAAGAGCTGGCACAGCGAGACAAAGAA CAGCCTGATGCAGGACCGGGACGCCGCCTCTGCTAGAGCCTGGCCCAAAATG CACACCGTGAACGGCTACGTGAACAGAAGCCTGCCCGGACTGATCGGCTGCC ACCGGAAGTCTGTGTACTGGCACGTGATCGGCATGGGCACCACCCCTGAGGTG CACAGCATCTTTCTGGAAGGACACACCTTTCTCGTGCGGAACCACCGGCAGGC CAGCCTGGAAATCAGCCCTATCACCTTCCTGACCGCCCAGACACTGCTGATGG ACCTGGGCCAGTTTCTGCTGTTCTGCCACATCAGCTCCCACCAGCACGACGGC

fill

41387Β1

-116ATGGAAGCCTACGTGAAGGTGGGACAGCTGCCCCGAGGAACCCCAGCTGCGGA TGAAGAACAACGAGGAAGCCGAGGACTACGACGACGACCTGACCGACAGCG

AGATGGACGTGGTGCGCTTCGACGACGATAACAGCCCCAGCTTCATCCAGATC AGAAGCGTGGCCÀAGAAGCACCCCAAGACCTGGGTGCACTATATCGCCGCCG AGGAAGAGGACTGGGATTACGCCCCTCTGGTGCTGGCCCCCGACGACAGAAG CTACAAGAGCCAGTACCTGAACAATGGCCCCCAGCGGATCGGCCGGAAGTAT AAGAAAGTGCGGTTCATGGCCTACACCGACGAGACATTCAAGACCAGAGAGG CCATCCAGCACGAGAGCGGCATCCTGGGCCCTCTGCTGTATGGCGAAGTGGGC GACACCCTGCTGATCATCTTCAAGAACCAGGCCAGCAGACCCTACAACATCTA CCCTCACGGCATCACCGACGTGCGGCCCCTGTACTCCAGAAGGCTGCCCAAGG GCGTGAAACACCTGAAGGACTTCCCCATCCTGCCCGGCGAGATCTTCAAGTAC AAGTGGACCGTGACCGTGGAAGATGGCCCCACCAAGAGCGACCCCAGATGCC

TGACACGGTACTACAGCAGCTTCGTGAACATGGAACGGGACCTGGCCTCCGG CCTGATTGGCCCACTGCTGATCTGCTACAAAGAAAGCGTGGACCAGCGGGGC AACCAGATCATGAGCGACAAGCGGAACGTGATCCTGTTTAGCGTGTTCGATGA GAACCGGTCCTGGTATCTGACCGAGAATATCCAGCGGTTCCTGCCCAACCCTG CCGGCGTGCAGCTGGAAGATCCTGAGTTCCAGGCCTCCAACATCATGCACTCC ATCAATGGCTATGTGTTCGACAGCCTGCAGCTGAGCGTGTGCCTGCACGAGGT (3 (((14 (11 (3 (314 (41 (01 (((41 ((3 (((((((((0 (11 ((1 (51 (((11 (1 TCTTCTCCGGCTACACCTTCAAGCACAAGATGGTGTACGAGGATACCCTGACC CTGTTCCCCTTTAGCGGCGAAACCGTGTTCATGAGCATGGAAAACCCCCCGGCCT

4138731

-117GTGGATCCTGGGCTGCCACAACAGCGACTTCCGGAACAGAGGCATGACCGCC CTGCTGAAGGTGTCCAGCTGCGACAAGAACACCGGCGACTACTACGAGGACA GCTATGAGGACATCAGCGCCTACCTGCTGAGCAAGAACAATGCCATCGAGCC (1 (14 ((1 (4 ((3 (4 (44 ((((1 ((((((1 (4 (((((((4 (14 (14 (14 (3 (1) (3) 4 (3) (3) (3) 1 (4) 11) 3 (1) 14 (1) 14 (14) 1411 (141) (1411) (1) (1)

TCAGCGTGGAAATGAAGAAAGAAGATTTCGACATCTACGACGAGGACGAGAA ((3) (4) (3) 31 (14) (14) 44444 (0) (0) 4 (3) 111 (4) (1) (11) (3) 1 (4) 3 (3) 31 (3) (4) 14 (1) 3 (41) (3) (4) 4 (3) (3) (1) 1 (1) 11 (1) 4 (1) (4) 3 (0) (3) (4) 54 (3) 3 (4) 30 (31) (3) () (4) 311 (4) 1 (11) (1) (4) 3 (4

٨) 3))144)11)3))))3)))1)1))31)32))3)34)1))4)11)))1)))1)4)4)1

CCTGGGACTGCTGGGCCCCTATATCAGAGCCGAAGTGGAAGATAATATCATG () (11) (1) 4 (4) 3 (3) 1 (11) (1) 1 (1)) () () 114 (11) 14 (3) (1) 11 (41) 1 (3) 14 (44) 1 (4) 1) 4 (4) 4 (3) 3 (3) 3 (3) 31 (3) (3) 1 (1) (11) 34 (44)

AAGCCCAACGAGACTAAGACCTACTTTTGGAAGGTGCAGCACCACATGGCCC

6 (8) 3) 1) 81 () (3) 1) 311 (118) 1 (3)) 31 (1) 3) 88) 3) 1 a) 68) 31) 8) 6 (18) 68 (888) 3

CTGGAAAAGGACGTGCACTCTGGGCTGATCGGCCCCCTGCTCGTGTGCCACAC

(1)) 1881 (3) 8 (3) 1) 8) 8 (1) (188) 8 (x) 18 () () (1) 18) 1) (1) () 6) 6) 881) 1 (8) 888 (a) 1881 (8888) 3) 6 (8) 11 (118) 3 (11) 3) 8 (888) (6888) 3) 18 (1) 161 (8) 6) 68 1 311 (3171)

GGAAAGAAACTGCCGGGCTCCCTGCAACATCCAGATGGAAGATCCCACCTTC AAAGAGAACTACCGGTTCCACGCCATCAACGGCTACATCATGGACACACTGC (1) (110) 141 (11) 1 (1) 11 (1) 7 (141) 11) 1 (1) 11 (1) (1) 11 (11 (1) (1))

fill

4138731

-118-

1) 3 (1) 68 (612) (2) 68 (1) (03) (8) (1) 80 (a) 8) 1068 (81) (88) (68)) 88 (a) 6 (1)) 7 )

GCGGAAAAAAGAAGAGTACAAAATGGCCCTGTACAACCTGTACCCTGGGGTG TTCGAGACAGTGGAAATGCTGCCCAGCAAGGCCGGCATCTGGCGGGTGGAAT 31 (1) 41 (3) (4) (3) 4 (11)) (4)

AGCAACAAGTGCCAGACACCTCTGGGCATGGCCTCTGGCCACATCCGGGGACTTTCAGATCACAGCCAGCCAGCGGCCAGTATGGCCAGTGGGCCCCAAAACTGGCCAGA (11) (1) (14) (41) (31) (1) ((1) (11) () ((141) 41 (1) (3) 1441 (1441)) ()

GGCGCCAGACAGAAGTTCAGCAGCCTGTACATCAGCCAGTTCATCATCATGTA

1) 6 (68) () (7) 1) 68 (1) 6888) 3) 3) 1) 1) 3) 18 (6) 8 (8) 7)) 31) 88) 1) 888 1) 1) 68 (3)) 6) 3) 18) 111) 41) 44) 4) 3) 4114 (1) (1) 14)) 1) 7) 1) 31 (1) 44 3) (1) 311 (11)) 4) 1 (4) 4) 4) 4) 1) 14 (1) 1) 4)) 1)) 4) 4) 0 (3) 1) (411) 141 (3))) 0 (1) 44)

1(((3(11((4(3(3(3(1(1441((74(11(41(1(((1(1(3((1(11(14(1((11(10((

ATGCCCCTGGGGGATGGAAAGCAAGGCCATCTCCGACGCCCAGATCACCGCCT (4) (1) 11 (4) 14 (3) 11 (1) 3 (3) 4 (1) 1 (1) 11 (3) (41) (14) (1) (1) 310 (3) CATCTGCAGGGCAGAAGCAATGCTTGGAGGCCAAGTGAACAACCCCAAAG AATGGCTGCAGGTGGACTTCCAGAAACCATGAAAGTGACCGGCGTGACCAC (4) 44 (3) 1 (14) 1 (1) 31 (3) (14)) 41) CCAGCAGCCAGGACGGCCACCAGTGGACCCTGTTTTCCAGAACGGCAAAGT

GAAAGTGTTTCAGGGGAACCAGGACTCCTTCACCCCCGTCGTGAATAGCCTGG

١)٨)0)11)3)[)٦1٧1)٨)٨()1)٦))٨))٨1)1)1))11)1)٦٨1٨)١٨)١)٨)1))1)1٨)٦)11))٦)٨

-11941387031

CAGATTGCTCTGCGGATGGAAGTGCTGGGATGCGAGGCCCAGGACCTGTACT

GACACTAGTAATAAAAGATCAGAGCTGTAGAGATCTGTGTGTTGGTTTTTGT

GTGCGGCCGGTACCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGC

GCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGG

CTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGAGGGAGTGGCC

(Sequence number :!) mTTR2Q2opt

1(1(1(31(1((4(111((1(4(((14(1(1(3(1(344((1441(1((1(1((3(3( (444(3((1(41(4(14(3(11(31-111(11((11111(11(3(114((14414

ATCAGAATCAGCAGGTTTGGAGTCAGCTTGGCAGGGATCAGCAGCCTGGGTT (1) 44 (1) 34 (1) 3 (3) 1414444 () ((1) 11 () (3) 34 (4) (3) (1) (14) (1) +41 (

0808 0801001001860 (Serial Number: 2)

OP, t482mTTR

fill

4138731

-120-

(3) (10) 1) 11) 11888 (6) 1 (681) 888 (11) 1) 6) 1) 6 (3)) (1) 1)) 1) 8) 31) 3) 11) 6 (18) (14) (3) (11) (1) (1) 11 (3) 114 (1) 44 (1) (11) (1) (4) GGATCCTGTCTGTCTGCACATTTCGTAGAGCGAGTGTTTTGTGTGTTGTGTGTCCTCCCCGGGTCAAAGGTCGTC

TCAATAATCAGAATCAGCAGGTTTGGAGTCAGCTTGGCAGGGATCAGCAGCCT GGGTTGGAAGGAGGGGGTATAAAAGCCCCTTCACCAGGAGAAGCCGTCACAC

1 ((sign: 3) kilobase. L, A7rh8R with TriplePlay Cabid ^^) pTGENcaprh8R-ITRmTTRFVHI 13524 TR-mTTR-hFVIIIco base pickup

GAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATA AAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTA

GTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCCGCTAGA 4 (1 (1) 1441) (14) (3) 14 (1) (1) (14) (414) (114) (11) 3 (41) (1) () (14) (4) (4)

AGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAGTAAATTTGGGCGTAA CCGAGTAAGATTTGGGTGTCACGCTGGGTATTAAGCCCGAGTGAGCACGCA (3) 1 (1) 3 (4) 4111 (1) 44 (1)) 1 (1) TTACGAGATTGTGATTAAGGTCCCCAGCGACCTTGACGAGCATCTGCCCGGCA 111 (31) (4) 111 (1) (1) 44 (11)) 1 (1) (1) 14 (14) 3 (44) 1 (3) (311) (4) GATTCTGACATGGATCTGAATCTGATTGAGCAGGCACCCCTGACCGTGGCCGA

١٨٨

41387Β1

-121

GAAGCTGCAGCGCGACTTTCTGACGGAATGGCGCCGTGTGAGTAAGGCCCCG GAGGCCCTTTTCTTTGTGCAATTTGAGAAGGGAGAGAGCTACTTCCACATGCA CGTGCTCGTGGAAACCACCGGGGTGAAATCCATGGTTTTGGGACGTTTCCTGA GTCAGATTCGCGAAAAACTGATTCAGAGAATTTACCGCGGGATCGAGCCGAC TTTGCCAAACTGGTTCGCGGTCACAAAGACCAGAAATGGCGCCGGAGGCGGG AACAAGGTGGTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCA GCCTGAGCTCCAGTGGGCGTGGACTAATATGGAACAGTATTTAAGCGCCTGTT TGAATCTCACGGAGCGTAAACGGTTGGTGGCGCAGCATCTGACGCACGTGTCG CAGACGCAGGAGCAGAACAAAGAGAATCAGAATCCCAATTCTGATGCGCCGG TGATCAGATCAAAAACTTCAGCCAGGTACATGGAGCTGGTCGGGTGGCTCGTG (3044 (3 (3 ((4110 (1 (03 (34 (3 (3 ((1 (3 (310 ((3 ((3 (3 (0 (3 (3 ((0] ACATCTCCTTCAATGCGGCCTCCAACTCGCGGTCCCAAATCAAGGCTGCCTTG GACAATGCGGGAAAGATTATGAGCCTGACTAAAACCGCCCCCGACTACCTGG TGGGCCAGCAGCCCGTGGAGGACATTTCCAGCAATCGGATTTATAAAATTTTG GAACTAAACGGGTACGATCCCCAATATGCGGCTTCCGTCTTTCTGGGATGGGC CACGAAAAAGTTCGGCAAGAGGAACACCATCTGGCTGTTTGGGCCTGCAACT ACCGGGAAGACCAACATCGCGGAGGCCATAGCCCACACTGTGCCCTTCTACG

GGTGCGTAAACTGGACCACCAATGAGAACTTTCCCTTCAACGACTGTGTCGACAAGAGTCGGTGATCTGGTGGGAGGAGGGGGGAAGATGACCGCCAAGGTCGTGGAGTCGG CCAAAGCCTTCAACGACTGTCCCGTCGTCGACAAGGTCGGGGGGAAGATGACCGCCAAGGTCGTGGAGTCGG

١٨٨

41387Β1

-122GCGCCGTGATTGACGGGAACTCAACGACCTTCGAACACCAGCAGCCGTTGCA AGACCGGATGTTCAAATTTGAACTCACCCGCCGTCTGGATCATGACTTTGGGA AGGTCACCAAGCAGGAAGTCAAAGACTTTTTCCGGTGGGCAAAGGATCACGT GGTTGAGGTGGAGCATGAATTCTACGTCAAAAAGGGTGGAGCCAAGAAAAGA CCCGCCCCCAGTGACGCAGATATAAGTGAGCCCAAACGGGTGCGCGAGTCAG TTGCGCAGCCATCGACGTCAGACGCGGAAGCTrcGATCAACTACGCAGACAG GTACCAAAACAAATGTTCTCGTCACGTGGGCATGAATCTGATGCTGTTTCCCT GCAGACAATGCGAGAGAATGAATCAGAATTCAAATATCTGCTTCACTCACGG ACAGAAAGACTGTTTAGAGTGCTTTCCCGTGTCAGAATCTCAACCCGTTTCTG TCGTCAAAAAGGCGTATCAGAAACTGTGCTACATTCATCATATCATGGGAAAG GTGCCAGACGCTTGCACTGCCTGCGATCTGGTCAATGTGGATTTGGATGACTG CATCTTTGAACAATAAATGATTTAAATCAGGTATGGCTGCCGATGGTTATCTT CCAGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGACCT GAAACCTGGAGCCCCGAAACCCAAAGCCAACCAGCAAAAGCAGGACGACGG CCGGGGTCTGGTGCTTCCTGGCTACAAGTACCTCGGACCCTTCAACGGACTCG ACAAGGGGGAGCCCGTCAACGCGGCGGACGCAGCGGCCCTCGAGCACGACAA GGCCTACGACCAGCAGCTCAAAGCGGGTGACAATCCGTACCTGCGGTATAAC CACGCCGACGCCGAGTTTCAGGAGCGTCTGCAAGAAGATACGTCTTTTGGGGG CAACCTCGGGCGAGCAGTCTTCCAGGÇCAAGAAGCGGGTTCTCGAACCTCTCG GTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAAGAGACCGGTAGA GCAGTCACCAGCAGCAGAACCAGACTCCCATTCGGGCAGCAGACCGGTAGA

fill

4138731

-123CAGCCCGCTAAAAAGAGACTCAATTTTGGTCAGACTGGCGACTCAGAGTCAGT CCCCGACACAACCTCTCGGGAGAACCTCCAGAAGCCCCTCAGGTCTGGGAC

TGGGGGACAGAGTCATCACCACCAGCACCCGAACCTGGGCATTGCCCACCTA CAACAACCACCTCTACAAGCAAATCTCCAATGGAACATCGGGAGGAAGCACC AACGACAACACCTACTTTGGCTACAGCACCCCCTGGGGGTATTTTGACTTCAA CAGATTCCACTGCCACTTCTCACCACGTGACTGGCAGCGACTCATCAACAACA ACTGGGGATTCCGGCCAAAGAGACTCAACTTCAAGCTGTTCAACATCCAGGTC AAGGAGGTTACGACGAACGAAGGCACCAAGACCATCGCCAATAACCTTACCA GCACCGTCCAGGTCTTTACGGACTCGGAGTACCAGCTACCGTACGTCCTAGGC TCTGCCCACCAAGGATGCCTGCCACCGTTTCCTGCAGACGTCTTCATGGTTCCT CAGTACGGCTACCTGACGCTCAACAATGGAAGTCAAGCGTTAGGACGTTCTTC TTTCTACTGTCTGGAATACTTCCCTTCTCAGATGCTGAGAACCGGCAACAACTT TCAGTTCAGCTACACTTTCGAGGACGTGCCTTTCCACAGCAGCTACGCACACA GCCAGAGTCTAGATCGACTGATGAACCCCCTCATCGACCAGTACCTATACTAC CTGGTCAGAACACAGACAACTGGAACTGGGGGAACTCAAACTTTGGCATCA GCCAAGCAGGCCCTAGCTCAATGGCCAATCAGGCTAGAAACTGGGTACCCGG GCCTTGCTACCGTCAGCAGCGCGTCTCCACAACCACCAACCAAAATAACAACA

GCAACTTTGCGTGGACGGGAGCTGCTAAATTCAAGCTGAACGGGAGAGACTC GCTAATGAATCCTGGCGTGGCTATGGCATCGCACAAAGACGACGAGGACCGC

4138731

-124TTCTTTCCATCAAGTGGCGTTCTCTCATATTTGGCAAGCAAGGAGCCGGGAACGAGGGAGTCGACTACAGCCAGGTGCTGATTACAGATGAGGAAGAAAATTAAAGCC ACCAACCCTTCTCATATTTGGCAAGCAAGGAGCCGGGAACGAGGGAGTCGACTACAGCCAGGTGCTGATTACAGATGAGGAAGAAAATTAAAGCC ACCAACCCTTCTCATATTTGGCAAGCAAGGAGCCGGGAACGAGGGAGTCGACTACAGCCAGGTGCTGATTACAGATGAGGAAGAAAATTAAAGCC

GGTATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGCCCTATTTGGGCTAA

AATACCTCACACAGATGGCAACTTTCACCCGTCTCCTCTGATGGGTGGATTTG GACTGAAACACCCACCTCCACAGATTCTAATTAAAAATACACCAGTGCCGGCA GATCCTCCTCTTACCTTCAATCAAGCCAAGCTGAACTCTTTCATCACGCAGTAC

AGCACGGGACAAGTCAGCGTGGAAATCGAGTGGGAGCTGCAGAAAGAAAAC

AGCAAGCGCTGGAATCCAGAGATCCAGTATACTTCAAACTACTACAAATCTAC

AAATGTGGACTTTGCTGTCAATACCGAAGGTGTTTACTCTGAGCCTCGCCCCCCAGGTACTCGTTACCTCACCCGTAATTTGTAATTGCCTGTTAATCAATAAACCG GTTAATTCGTGTTTTACTCTGAGCCTCGCCCCCCAGAGTAGTACTCGTTACCTCACCCGTAATTTGTAATTGCCTGTTAATCAATAAACCG GTTAATTCGTTACGTACTGAACTTTGTCTCCCTGTACGTAGTACCGTACCGTTACCTGTGTTAATCAATAACCGGTTAATTCGTGTTTTACTCTGAGCCTCGCCCCCCAGAGTACGTACCGTTACCTGTTTAATCAATAAACCG

CGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCA

AGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCGGTCGCTTCGCTTCGCTTCGCTTCGTGTCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTCTTCGTACTACGTTCGCGTTTTCCGGTCGCTTCGCTTCGCTTCGTGCTTCGTGTCGGCGCGAAACCCGACAGGACTATAAAGATACCAGGCGTCGTCGTCGTCGCTTCGCTTCGCTTCGTGCTTCGGTCGTCCGGTCGTCCGCCTTCTTCGTTCGTTCGTCGTCGTCGTCGCTTC

AssociatesGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCC

AACCCGGTAAGACACGACTTATCGCCACTGGCAGTAGCCACTGGTAACAGGA

fill

4138731

-125TTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCT AACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCC AGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCG CTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAA GGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAA CGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCA CCTAGATCCTTTTCACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGG ATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGA GAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGT TTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAG GTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTG ATGGCGCAGGGGATCAAGATCCGATCAAGAGACAGGATGAGGATCGTTTCGC ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGA GGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCC GTGTTCCGGCTGTCAGCGCAGGGGCGCCTGGTTCTTTTTGTCAAGACCGACCT GTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTG GCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGG AAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTC ACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTG CATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAAACATCGCAT CGAGCGAGCACGTACTCGGGATGGAAGCCGGTCTGTCG

41387031

-126GACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGG CGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTG CCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCG GCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTG

CTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATC

GCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTC TGAATTAATTAAGCGGCCGCTCATGAGCGGATACATATTTGAATGTATTTAGA AAAATAAACAAAATAGGGGTTCCGCGCAACATTTCC

CGTCAGATCCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGA

TGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACG

TTGTAAAACGACGGCCGCCAGTGAATTCGCGAGCTCTTGGCCACTCCTCTCTGCGCGTCGTCGTCGTCGTCGACGGGCCGGGGCGGGGC

GTGTTCCGATACTCTAATCTCCCTAGGCAAGGTTCATATTTGTGTAGGTTACTT

ATTCTCCTTTTGTTGACTAAGTCAATAATCAGAATCAGCAGGTTTGGAGTCAG CTTGGCAGGGATCAGCAGCCTGGGTTGGAAGGAGGGGGTATAAAAGCCCCTT CACCAGGAGAAGCCGTCACACAGATCCACAAGCTCCTGCTAGCAGGTAAGTG CCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGC

CTTGAATTACTGACACTGACATCCACTTTTTCTTTTTCTCCACAGGTATCGATT

CTCTAGAGCCACCATGCAGATCGAGCTGTCTACCTGCTTCTTCCTGTGCCTGCT

١٨٨

41387Β1

-127GCGGTTCTGCCCTTCAGCGCCACCAGACGGGTACTATCTGGGCGCCGCCGTGGAACTGAGCTGGGACTACATGCAGAGCGACCTGGGCGAGCTGCCCGTGGATGCCAGATT CCCTCCTCCAAGTACTATCTGGGCGTCGCCGTGGAACTGAGCTGGGACTACATGCAGAGCGACCTGGGCGAGCTGCCCGTGGATGCCAGATT CCCTCCTCCAAGTACTATCTGGGCGTCGCCGTGGAACTGAGCTGGGACTACATGCAGAGCGACCTGGGCGAGCTGCCCGTGGATGCCAGATT CCCTCCTCCAAGTACTATCTGGGCGTCGCCGTGGACCACCGTGGGGGGTTC

AssociateTGGATGGGCGTGCTGGGACCTACAATTCAGGCCGAGGTGTACGACAC

CGTCGTGATCACCCTGAAGAACATGGCCAGCCACCACCGTGTCTCTGCATGCCGGTGGTCGTGTCCTACTGGAAGGGCCTCTGAGGGCGCCGAGTACGACGATCAGAC

CCTGACATACAGCTACCTGAGCCACGTGGACCTCGTGAAGGACCTGAACAGC

GGCCTGATCGGGAGCCCTGCTCGTGTGTAGAGAGAGGGCAGCCTGGCCAAAGAGA AAACCCAGACCCTGCACAAGTTCATCCTGCTGTTCGCCGTGTTCGACGAGGGTGTAGACGAGACGGGCAGCCTGGCCAAAGAGAAAACCCAGACCCTGCACAAGTTCATCCTGCTGTTCGCCGTGTTCGACGAGGGGCGCGACGACGACTGCGCGTGGTGTAGAGAGAGGGGCAGCCTGGCCAAAGAGAAAACCCAGACCCTGCACAAGTTCATCCTGCTGTTCGCCGTGTTCGACGAGGGTGTAGACGACGACGCGCGTGGGGGTGTAGACGACGACGACGGACGTGCGACGGACGGACGTGACGACGGACGTGGACGTGCGACGTGACGTGTGACGTGACGTGGAC

GAAGCCTGCCCGGACTGATCGGCTGCCACCGGAAGTCTGTGTACTGGCACGTG

ATCGGCATGGGCACCACCCCTGAGGTGCACACAGCATCTTTCTGGAAGGACACACGGCTCGTTCGTGCGGAACCACCGGCAGGCCAGCCTGGAAATCAGCCCTATCACCT TCCTGACCTGCCACAGCATCTTTCTGGAAGGACACGCGCTCGTTCGTGCGGAACCACCGGCAGGCCAGCCTGGAAATCAGCCCTATCACCT

GCTGCCCCGAGGAACCCCAGCTGCGGATGAAGAACAACGAGGAAGCCGAGG

ACTACGACGACGACCTGACCGACAGCGAGATGGACGTGGTGCGCTTCGACGA

41387031

-128CGATAACAGCCCCCCAGCTTCATCCAGATCAGAAGCGTGGCCAAGAAGCACCCC AAGACCTGGGTGCACTATATATCGCCGCCGAGGAAGAGGACTGGGGATTACGCCCAGATCAGAAGAAGCGTGGCCAAGAAGCACCCCGGTCGGTCGGTCGGTCGTGCACTATATCGCCGCCGAGGAAGAGGACTGGGGATTACGCCC

ACCGACGAGACATTCAAGACCAGAGAGGCCATCCAGCACGAGAGCGGCATCC

TGGGCCCTCTGCTGTATGGCGAAGTGGGCGACACCCTGCTGATCATCTTCAAG AACCAGGCCAGCAGACCCTACAACATCTACCCTCACGGCATCACCGACGTGC GGCCCCTGTACTCCAGAAGGCTGCCCAAGGGCGTGAAACACCTGAAGGACTr

CCCCATCCTGCCCGGCGAGATCTTCAAGTACAAGTGGACCGTGACCGTGGAAG

ATGGCCCCACCAAGAGAGCGACCCCAGATGCCTGACACGGTACTACAGCAGCTT

CGTGAACATGGAACGGCCCCCTGGCCTCCGGCCTGATTGGCCACTCCACTGCTGATCTGCTACGCTAAGAAGCGTGGACCAGCGGGGCAACCAGATCATGAGCGACAAGC

TGAGTTCCAGGCCTCCAACATCATGCACTCCATCAATGGCTATGTGTTCGACA

GCCTGCAGCTGAGCGTGTGCCTGCACGAGGTGGCCTACTGGTACATCCTGAGC ATCGGGGCCCAGACCGACTTCCTGTCCGTGTTCTTCTCCGGCTACACCTTCAAG CACAAGATGGTGTACGAGGATACCCTGACCCTGTTCCCCTTTAGCGGCGAAAC CGTGTTCATGAGCATGGAAAACCCCGGCCTGTGGATCCTGGGCTGCCACAACA

GCGACTTCCGGAACAGAGAGGCATGACCGCCCTGCTGAAGGTGTCCAGCTGCGA

CAAGAACACCGGCGACTACTACGAGGACAGCTATGAGGACATCAGCGCCTAC

١٨٨

41387Β1

-120CTGCTGAGCAAGAACAATGCCATCGAGCCCAGAAGCTTCAGCCAGAACCCCC CCGTGCTGAAGCGGCACCAGAGAGAGAGATCACCCGGACCACCCTGCAGTCCGA CCAGGAAGAGATCGATTACGACGACGACACCATCAGCGTGGAAATGAAAGAAGAA

GATTTCGACATCTACGACGAGGACGAGAACCAGAGCCCCCGGTCCTTTCAGA AAAAGACCCGGCACTACTTCATTGCCGCTGTGGAACGGCTGTGGGACTACGGC ATGAGCAGCAGCCCTCACGTGCTGAGAAACAGGGCCCAGAGCGGCAGCGTGC CCCAGTTCAAGAAAGTGGTGTTCCAGGAATTCACAGACGGCAGCTTCACCCAG CCTCTGTACCGCGGCGAGCTGAATGAGCACCTGGGACTGCTGGGCCCCTATAT CAGAGCCGAAGTGGAAGATAATATCATGGTCACCTTCCGGAATCAGGCCTCCC

GGCCCTACAGCTTCTACAGCTCCCTGATCAGCTACGAAGAGGACCAGAGACA GGGCGCTGAGCCCCGGAAGAACTTCGTGAAGCCCAACGAGACTAAGACCTAC TTTTGGAAGGTGCAGCACCACATGGCCCCTACAAAGGACGAGTTCGACTGCA AGGCCTGGGCCTACTTCTCCGATGTGGACCTGGAAAAGGACGTGCACTCTGGG CTGATCGGCCCCCTGCTCGTGTGCCACACCAACACCCTGAATCCCGCCCACGG CAGACAAGTGACAGTGCAGGAATTCGCCCTGTTCTTCACCATCTTCGACGAAA CAAAGAGCTGGTACTTCACCGAAAACATGGAAAGAAACTGCCGGGCTCCCTG CAACATCCAGATGGAAGATCCCACCTTCAAAGAGAACTACCGGTTCCACGCC ATCAACGGCTACATCATGGACACACTGCCCGGCCTCGTGATGGCTCAGGATCA GCGGATCCGGTGGTATCTGCTGTCCATGGGCTCCAACGAGAACATCCACAGCA

TCCACTTCAGCGGCCACGTGTTCACCGTGCGGAAAAAGAAGAGTACAAAAT GGCCCTGTACAACCTGTACCCTGGGGTGTTCGAGACAGTGGAAATGCTGCCCA

41387Β1

-130GCAAGGCCGGCATCTGGCGGGTGGAATGTCTGATCGGGCGAGCATCTGCACGCGGGCGGCGGCGGGCGGGCGGGCGGGGCGGGGGGGGGGGTGGAATGTCTGATCGGGCGAGCAGCATCTGCACGGG

5. CCTGGTCCACCAAAGAGCCCTTCAGCTGGATCAAGGTGGACCTGCTGGCTCCC ATGATCATCCACGGAATCAAGACCCAGGGCGCCAGACAGAAGTTCAGCAGCC TGTACATCAGCCAGTTCATCATCATGTACAGCCTGGACGGCAAGAAGTGGCAG ACCTACCGGGGCAATAGCACCGGCACCCTGATGGTGTTCTTCG AACGTGGA CTCCAGCGGCATTAAGCACAACATCTTCAACCCCCCCATCATTGCCCGGTACA

TCCGGCTGCACCCCACCCACTACAGCATCCGGTCCACCCTGAGAATGGAACTG ATGGGCTGCGACCTGAACTCCTGCAGCATGCCCCTGGGATGGAAAGCAAGG CCATCTCCGACGCCCAGATCACCGCCTCCAGCTACTTCACCAACAACATGTTCGCCTCCAGCTACTTCACCAACATGTTCGCCTCCAGCTACTTCACCAACATGTTCGCCTCCAGCTACTTCACCAACATGTTCGCC

ACCTGGTCCCCATCCAAGGCCCGGCTGCATCTGCAGGGCAGAAGCAATGCTTG GAGGCCCCAAGTGAACAACCCCAAAGAATGGCTGCAGGTGGACTTCCAGAAA

ACCATGAAAGTGACCGGCGTGACCACCCAGGGCGTGAAGTCTCTGCTGACCTC TATGTACGTGAAAGAGTTCCTGATCTCCAGCAGCCAGGACGGCCACCAGTGG

ACCCTGTTTTTCCAGAACGGCAAAGTGAAAGTGTTTCAGGGGAACCAGGACTC CTTCACCCCCGTCGTGAATAGCCTGGACCCTCCACTGCTGACCAGATACCTGC GGATCCACCCTCAGTGAAAGTGTTTCAGGGGAACCAGGACTCCTTCACCCCCGTCGTGAATAGCCTGGACCCTCCACTGCTGACCAGATACCTGC GGATCCACCCTCTGAAAGTGGGTGCACCAGATTGCTCTGGCGAT

GGATGCGAGGCCCAGGACCTGTACTGACAACTAGTAATAAAAGATCAGAGCT GTAGAGATCTGTGTGTTGGTTTTTTGTGTGCGGCCGGTACCCAGGAACCCCTA

4138731

-131GTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGGTCGGGGCGGCCTCAGTGAGTGCGCGAGCGCGTCAGTCAGGAAGGGAGTGCTGGGG

AGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACACAACATACGAGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCA CATTAATTGCGTTGCGCTCACTGCCCGCTTACCGTCGG

AGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGG GCGCTCTTCCGCTGATCTCATACTAGCGAACGCCAGCAAGACGTAGCCCAGCG CGTCGGCCCCGAGATGCGCCGCGTGCGGCTGCTGGAGATGGCGGACGCGATG GATATGTTCTGCCAAGGGTTGGTTTGCGCATTCACAGTTCTCCGCAAGAATTG ATTGGCTCCAATTCTTGGAGTGGTGAATCCGTTAGCGAGGTGCCGCCCTGCTT CATCCCCGTGGCCCGTTGCTCGCGTTTGCTGGCGGTGTCCCCGGAAGAAATAT ATTTGCATGTCTTTAGTTCTATGATGACACAAACCCCGCCCAGCGTCTTGTCAT TGGCGAATTCCGGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAG

GCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAAC CAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATG CATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCC CCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTT TATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGT GAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTGCATGCCTGCAG GTCGGCCGCCACGACCGGTGCCGCCACCATCCCCTGACCCACGCCCCTGACCC

41387Β1

-132CTCACAAGGAGACGACCTTCCATGACCGAGTACAAGACACACGGTGCGCCTCGGTCGTCGTCGTCGTCGGTCGTCCGGCCGGGGCCGTACGCACCTCGCCGCCGCCGCGTTCGCC

GTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGA

GCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTT GAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCG CACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGA CCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCG 10 gccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacct

CCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCG AAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGACGCCCGCC CCACGACCCGCAGCGCCCGACCGAAAGGAGCGCACGACCCCATGGCTCCGAC CGAAGCCACCCGGGGCGGCCCCGCCGACCCCGCACCCGCCCCCGAGGCCCAC 15 CGACTCTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGC

TTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAAT

(Sequence number: 4)

fill

4138731

-133-

List of sequences

Circa, geosteo more 2110

David, Souza

Karan Vincent

Production of a virus particle associated with gland-2120

Bacteria causing disease &lt;130&gt; 159792013240

Not yet set 140

In conjunction with this&gt; 141

&lt;15O&gt; US 62 / 144,862

4138731

134 = 1512 2015-04-08 = 150 us 62 / 220,067 &lt;151&gt; 2015-09-17 &lt;160&gt; 24

170 FastSEQ for Windows Version 4.0

210 1 &lt;211&gt; 5097 &lt;212&gt; DNA

Synthetic sequence &lt;213&gt;

220 15

Idiomatic construct &lt;223&gt;

P

41387031

-135400 1 gagctcttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 60 gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga 202808829 2888888888 120 ggagtggcca actccatcac taggggttcc tacgcgtgtc tgtctgcaca 11084888 1 80 cgagtgttcc gatactctaa tctccctagg caaggttcat atttgtgtag gttacttatt 240 ctccttttgttgactaagtc 00008 atcagcaggt ttggagtcag cttggcaggg 300 atcagcagcc tgggttggaa ggagggggta taaaagcccc ttcaccagga gaagccgtca 360 cacagatcca caagctcctg ctagcaggta agtgccgtgt gtggttcccg cgggcctggc42O ctctttacgg gttatggccc ttgcgtgcct tgaattactg acactgacat ccactttttc 480 tttttctcca caggtatcga ttctctagag ccaccatgca gatcgagctg tctacctgct 540 tcttcctgtg cctgctgcgg ttctgcttca gcgccaccag acggtactat ctgggcgccg 600 tggaactgag ctgggactac atgcagagcg acctgggcga gctgcccgtg gatgccagat 660 tccctccaag agtgcccaag agcttcccct tcaacacctc cgtggtgtac aagaaaaccc 720 tgttcgtgga attcaccgac cacctgttca atatcgccaa gcccagaccc ccctggatgg 780 gcctgctggg acctacaatt caggccgagg tgtacgacac cgtcgtgatc 08888 840

fill

4138731

136-acatggccag ccaccccgtg tctctgcatg ccgtgggagt gtcctactgg aaggcctctg 900 agggcgccga gtacgacgat cagaccagcc agcgcgagaa 2288889 aaggtgttcc 960 ctggcggcag ccacacctac gtgtggcagg tgctgaaaga aaacggcccc atggcctccg 1020 accctctgtg cctgacatac agctacctga gccacgtgga cctcgtgaag gacctgaaca 1080 gcggcctgat cggagccctg ctcgtgtgta gagagggcag cctggccaaa gagaaaaccc 1140 agaccctgca caagttcatc ctgctgttcg ccgtgttcga cgagggcaag agctggcaca 1200 gcgagacaaa gaacagcctg atgcaggacc 228020090 ctctgctaga gcctggccca 1260 aaatgcacac cgtgaacggc tacgtgaaca gaagcctgcc cggactgatc ggctgccacc 1320 ggaagtctgt gtactggcac gtgatcggcatgggcaccac ccctgaggtg cacagcatct 1380 ttctggaagg acacaccttt ctcgtgcggaaccaccggca 880002018 gaaatcagcc 1440 ctatcacctt cctgaccgcc cagacactgc tgatggacct gggccagttt ctgctgttct 1500 gccacatcag ctcccaccag cacgacggca tggaagccta cgtgaaggtg gacagctgcc 1560 ccgaggaacc ccagctgcgg atgaagaaca acgaggaagc cgaggactac gacgacgacc 1620 tgaccgacag 44 gtggtgcgct tcgacgacga taacagcccc agcttcatcc 1680 agatcagaag cgtggccaag aagcacccca agacctgggt gcactatatc gccgccgagg 1740 aagaggactg 8300 cctggtgc tggcccccga cgacagaagc tacaagagcc 1800

fill

4138731

-137agtacctgaa caatggcccc cagcggatcg gccggaagta taagaaagtg cggttcatgg 1860 cctacaccga cgagacattc aagaccagag aggccatcca 000080920 ggcatcctgg 1920 gccctctgct 190234 gtgggcgaca ccctgctgat catcttcaag aaccaggcca 1980 gcagacccta caacatctaccctcacggcatcaccgacgtgcggcccctg tactccagaa2O4O ggctgcccaa gggcgtgaaa cacctgaagg acttccccat cctgcccggc gagatcttca 2100 agtacaagtg gaccgtgacc gtggaagatg gccccaccaa gagcgacccc agatgcctga 2160 cacggtacta cagcagcttc gtgaacatgg aacgggacct ggcctccggc ctgattggcc 2220 cactgctgat ctgctacaaa gaaagcgtgg accagcgggg caaccagatc atgagcgaca 2280 agcggaacgt gatcctgttt agcgtgttcg atgagaaccg gtcctggtat ctgaccgaga 2340

0000 = 04 gttcctgccc aaccctgccg gcgtgcagct ggaagatcct gagttccagg 2400 cctccaacat catgcactcc atcaatggct atgtgttcga 090019049 ctgagcgtgt 2460 gcctgcacga ggtggcctac tggtacatcc tgagcatcgg 9000004066 gacttcctgt 2520 ccgtgttctt ctccggctac accttcaagc acaagatggt gtacgaggat accctgaccc 2580 tgttcccctt tagcggcgaa accgtgttca tgagcatgga aaaccccggc ctgtggatcc 2640

20100 20 ttccggaaca gaggcatgac cgccctgctg aaggtgtcca 2700 gctgcgacaa gaacaccggc gactacg aggacagcta 128 280 agcgcctacc 2760

<img file="MA41387B1_D0008.tif" />

١٨٨

41387Β1

-138tgctgagcaa gaacaatgcc atcgagccca gaagcttcag ccagaacccc cccgtgctga 2820 agcggcacca 04 280 acccggacca ccctgcagtc cgaccaggaa gagatcgatt 2880

04034 catcagcgtg 12428 aagaagattt cgacatctac 808828498 2940 agaaccagag cccccggtcc tttcagaaaa 4980009800 ctacttcatt gccgctgtgg 3000 aacggctgtg ggactacggc atgagcagca gccctcacgt 201084446 agggcccaga 3060 gcggcagcgt gccccagttc aagaaagtgg tgttccagga attcacagac ggcagcttca 3120 cccagcctct gtaccgcggc gagctgaatg agcacctggg actgctgggc ccctatatca 3180 gagccgaagt 4913 atcatggtca ccttccggaa tcaggcctcc cggccctaca 3240. gcttctacag ctccctgatc agctacgaag aggaccagag acagggcgct 88880888 3300 agaacttcgt 0200 gagactaaga cctacttttg gaaggtgcag caccacatgg 3360 cccctacaaa ggacgagttc gactgcaagg cctgggccta cttctccgat gtggacctgg 3420 aaaaggacgt gcactctggg ctgatcggcc ccctgctcgt gtgccacacc aacaccctga 3480 atcccgccca 22384 gtgacagtgc aggaattcgc cctgttcttc accatcttcg 3540 acgaaacaaa 8800 ttcaccgaaa 08083049 aaactgccgg gctccctgca 3600 acatccagat ggaagatccc accttcaaag 088004009 gttccacgcc atcaacggct 3660 acatcatgga cacactgccc ggcctcgtga 1992010888 tcagcggatc cggtggtatc 3720

fill

4138731

-139tgctgtccat gggctccaac 200400 acagcatcca cttcagcggc cacgtgttca 3780 ccgtgcggaa aaaagaagag tacaaaatgg ccctgtacaa cctgtaccct ggggtgttcg 3840 agacagtgga aatgctgccc agcaaggccg gcatctggcg ggtggaatgt ctgatcggcg 3900 agcatctgca cgctgggatg agcacactgt ttctggtgta 00040048 1982889 3960 ctctgggcat ggcctctggc cacatccggg actttcagat cacagccagc ggccagtatg 4020 gccagtgggc cccaaaactg gccagactgc 000048098 cagcatcaac gcctggtcca 4080 ccaaagagcc cttcagctgg atcaaggtgg acctgctggc tcccatgatc atccacggaa 4140 tcaagaccca gggcgccaga cagaagttca gcagcctgta catcagccag ttcatcatca 4200 tgtacagcct ggacggcaag aagtggcaga cctaccgggg caatagcacc ggcaccctga 4260 tggtgttctt cggcaacgtg 00008202 200908 caacatcttc aaccccccca 4320 tcattgcccg gtacatccgg ctgcacccca cccactacag catccggtcc accctgagaa 4380 tggaactgat gggctgcgac ctgaactcct gcagcatgcc cctggggatg gaaagcaagg 4440 ccatctccga cgcccagatc accgcctcca gctacttcac caacatgttc gccacctggt 4500 ccccatccaa ggcccggctg catctgcagg gcagaagcaa tgcttggagg ccccaagtga 4560 acaaccccaa agaatggctg caggtggacttccagaaaaccatgaaagtgaccggcgtga462O ccacccaggg cgtgaagtct ctgctgacct ctatgtacgt gaaagagttc ctgatctcca 4680

<img file="MA41387B1_D0009.tif" />

4138731

-140gcagccagga cggccaccag tggaccctgt ttttccagaa cggcaaagtg aaagtgtttc 4740 aggggaacca ggactccttc acccccgtcg tgaatagcct ggaccctcca ctgctgacca 4800 gatacctgcg gatccaccct cagagttggg tgcaccagat tgctctgcgg atggaagtgc 4860 tgggatgcga 2 2 ctgtactgac actagtaata aaagatcaga 2299 4920 tctgtgtgtt ggttttttgt gtgcggccgg taccaggaac ccctagtgat ggagttggcc 4980 actccctctc tgcgcgctcg ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc 5040 ccgggctttg cccgggcggc ctcagtgagc 2083209 0488888 agtggcc 5097 &lt;210&gt; 2 &lt;211&gt; 229 &lt;212&gt; DNA

Synthetic Sequence 2213

41387031

-141-

Synthetic mint &lt;223&gt;

&lt;400&gt; 2 tgtctgtctg cacatttcgt agagcgagtg ttccgatact ctaatctccc 000828 60 tcgtattgac ttaggttacttattctccttttgttgactaagtcaataatcagaatcagc 120 aggtttggag tcagcttggc agggatcagc agcctgggtt 8898288 ggtataaaag 180 ccccttcacc 94240 gtcacacaga tccacaagct cctgctagc 229 &lt;211&gt; 341 &lt;212&gt; DNA

Synthetic Sequence 213

Artificial construction &lt;223&gt;

١٨٨

41387Β1

-142-

Equ ctacctgctg atcgcccggc ccctgttcaa acatgtccta atactctgtc ggggcaaagg 60 tcggcagtag ttttccatct tactcaacat cctcccagtg tacgtaggat cctgtctgtc 120 tgcacatttc gtagagcgag tgttccgata ctctaatctc ccggggcaaa ggtcgtattg 180 acttaggtta cttattctcc ttttgttgac taagtcaata atcagaatca gcaggtttgg 240 agtcagcttg gcagggatca gcagcctggg ttggaaggag ggggtataaa agccccttca 300 ccaggagaag ccgtcacaca gatccacaag ctcctgctag c 341 &lt;210&gt; 4 &lt;211&gt; 13524 &lt;212&gt; DNA

Synthetic sequence 6213

220

Artificial construction &lt;223&gt;

١٨٨

41387Β1

-143 &lt;400&gt; 4 gaatgcaatt gttgttgtta acttgtttat tgcagcttat aatggttaca aataaagcaa 60 tagcatcaca aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc 120 caaactcatc aatgtatctt atcatgtctg gatccgctag aactaggaattcgctagcgg 180 taccgatatc ctagtggatc ccccgtacac aggaagtgac aattttcgcg cggttttagg 240 cggatgttgt agtaaatttg ggcgtaaccg agtaagattt gggtggtcac gctgggtatt 300 taagcccgag 1408 gggtctccat tttgaagcgg gaggtttgaa cgcgcagccg 360 ccatgccggg gttttacgag attgtgatta aggtccccag cgaccttgac gagcatctgc 420 ccggcatttc tgacagcttt gtgaactggg tggccgagaa ggaatgggag ttgccgccag 480 attctgacat 4044 ctgattgagc aggcacccct gaccgtggcc 498410 540 agcgcgactt tctgacggaa tggcgccgtg tgagtaaggc cccggaggcc cttttctttg 600 tgcaatttga gaagggagag agctacttcc acatgcacgt gctcgtggaa 0002000009 660 tgaaatccat ggttttggga cgtttcctga gtcagattcg cgaaaaactg attcagagaa 720 tttaccgcgg gatcgagccg actttgccaa actggttcgc ggtcacaaag accagaaatg 780 gcgccggagg cgggaacaag • 901909819 agtgctacat ccccaattac ttgctcccca 840 Aaacccagcc tgagctccag tgggcgtgga ctaatatgga acagtattta agcgcctgtt 900

fill

4138731

-144tgaatctcac ggagcgtaaa cggttggtgg cgcagcatct gacgcacgtg tcgcagacgc 960 0429 caaagagaat cagaatccca attctgatgc gccggtgatc 4008884 1020 cttcagccag gtacatggag ctggtcgggt ggctcgtgga caaggggatt 4008848 1080 agcagtggat 098 caggcctcat acatctcctt caatgcggcc tccaactcgc 1140 Ahham Mmagi caaggctgcc ttggacaatg cgggaaagat tatgagcctg actaaaaccg 1 200 cccccgacta cctggtgggc cagcagcccg tggaggacat ttccagcaat cggatttata 1260 aaattttgga actaaacggg tacgatcccc aatatgcggc ttccgtcttt ctgggatggg 1320 ccacgaaaaa gttcggcaag aggaacacca tctggctgtt tgggcctgca 4014008888 1380 agaccaacat cgcggaggcc 12000404 ctgtgccctt ctacgggtgc gtaaactgga 1440

944 ctttcccttc aacgactgtg tcgacaagat ggtgatctgg 2288829 1500 ggaagatgac cgccaaggtc gtggagtcgg ccaaagccat tctcggagga agcaaggtgc 1560 gcgtggacca 0209 tcctcggccc agatagaccc gactcccgtg atcgtcacct 1620 ccaacaccaa catgtgcgcc gtgattgacg ggaactcaac gaccttcgaa caccagcagc 1680 cgttgcaaga ccggatgttc aaatttgaac tcacccgccg tctggatcat gactttggga 1740

290008 gcaggaagtc aaagactttt 1008919809 aaaggatcac gtggttgagg 1800 tggagcatga attctacgtc aaaaagggtg gagccaagaa 92 cccagtgacg 1860

fill

4138731

145cagatataag 122024 cgggtgcgcg agtcagttgc gcagccatcg acgtcagacg 1920 cggaagcttc gatcaactac 2238 accaaaacaa atgttctcgt cacgtgggca 1980 tgaatctgat gctgtttccc tgcagacaat gcgagagaat gaatcagaat tcaaatatct 2040 gcttcactca cggacagaaa gactgtttag agtgctttcc cgtgtcagaa tctcaacccg 2100 tttctgtcgt 209 tatcagaaac tgtgctacat tcatcatatc 048048 2160 tgccagacgc ttgcactgcc tgcgatctgg tcaatgtgga tttggatgac tgcatctttg 2220 aacaataaat gatttaaatc aggtatggct gccgatggtt atcttccaga ttggctcgag 2280 gacaacctct ctgagggcat tcgcgagtgg tgggacctga aacctggagc cccgaaaccc 2340 aaagccaacc agcaaaagca 2088828 cggggtctgg tgcttcctgg ctacaagtac 2400 ctcggaccct tcaacggact cgacaagggg gagcccgtca acgcggcgga cgcagcggcc 2460 ctcgagcacg 032004 cgaccagcag ctcaaagcgg gtgacaatcc gtacctgcgg 2520 tataaccacg ccgacgccga gtttcaggag cgtctgcaag aagatacgtc ttttgggggc 2580 aacctcgggc gagcagtctt ccaggccaag aagcgggttc tcgaacctct cggtctggtt 2640 08 ctaagacggc 0001988809 aagagaccgg tagagcagtc 40084884 2700 ccagactcat cctcgggcat cgggcaaatca 2200490890 ccgctaaaaa 4808 2760 tttggtcaga ctggcgactc agagtcagtc cccgacccac aacctctcgg 2984 2820

١٨٨

41387Β1

-146 "gaagccccct caggtctggg acctaataca atggcttcag gcggtggcgc tccaatggca 2880 gacaataacg aaggcgccga cggagtgggt aattcctcgg gaaattggcattgcgattcc 2940 acatggctgg gggacagagt catcaccacc agcacccgaa cctgggcatt gcccacctac 3000 aacaaccacc tctacaagca aatctccaat ggaacatcgg gaggaagcac caacgacaac 3060 acctactttg gctacagcac cccctggggg tattttgact tcaacagatt ccactgccac 3120 ttctcaccac gtgactggca gcgactcatc aacaacaact ggggattccg gccaaagaga 3180 ctcaacttca agctgttcaa catccaggtc aaggaggtta cgacgaacga aggcaccaag 3240 accatcgcca ataaccttac cagcaccgtc caggtcttta cggactcgga gtaccagcta 3300 ccgtacgtcc taggctctgc ccaccaagga tgcctgccac cgtttcctgc agacgtcttc 3360 atggttcctc agtacggcta cctgacgctc aacaatggaa gtcaagcgtt aggacgttct 3420 tctttctact gtctggaata cttcccttct cagatgctga gaaccggcaa caactttcag 3480 ttcagctaca ctttcgagga cgtgcctttc cacagcagct acgcacacag ccagagtcta 3540 gatcgactga tgaaccccct catcgaccag tacctatact acctggtcag aacacagaca 3600 actggaactg ggggaactca aactttggca ttcagccaag 0499000149 ctcaatggcc 3660

1044 gaaactgggt acccgggcct tgctaccgtc agcagcgcgt ctccacaacc 3720 accaaccaaa ataacaacag caactttgcg tggacgggag 09080 00 104 3780

١٨٨

41387Β1

-147gggagagact 8893 tcctggcgtg gctatggcat cgcacaaaga 88888289 3840 cgcttctttc catcaagtgg cgttctcatatttggcaagc 4489890098 gaacgatgga 3900 gtcgactaca 0290 gattacagat 892900 ttaaagccac caaccctgta 3960 00088 aatacggagc 2200000 0000098 ccgctaacac gcaggcgcaa 4020 actggacttg tgcataacca gggagttatt cctggtatgg tctggcagaa ccgggacgtg 4080 tacctgcagg gccctatttg ggctaaaata cctcacacag atggcaactt tcacccgtct 4140 cctctgatgg gtggatttgg actgaaacac ccacctccac agattctaat taaaaataca 4200 ccagtgccgg cagatcctcc tcttaccttc aatcaagcca agctgaactc tttcatcacg 4260 cagtacagca cgggacaagt cagcgtggaa atcgagtggg agctgcagaa agaaaacagc 4320 aagcgctgga atccagagat ccagtatact tcaaactact acaaatctac aaatgtggac 4380 tttgctgtca ataccgaagg tgtttactct gagcctcgcc ccattggtac tcgttacctc 4440 acccgtaatt tgtaattgcc tgttaatcaa taaaccggtt aattcgtttc agttgaactt 4500 tggtctctgc gggccggcct 14108 gtgagcaaaa ggccagcaaa 4 = 0004888 4560 ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca 4620 caaaaatcga cgctcaagtc agaggtggcg 40009200 ggactataaa gataccaggc 4680 gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 4740

<img file="MA41387B1_D0010.tif" />

-14841387031 cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 4800 tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 4860 gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 4920 cttatcgcca ctggcagtag ccactggtaa 0229811099 agagcgaggt atgtaggcgg 4980 tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagaa cagtatttgg 5040 tatctgcgct ctgctgaagc cagttacctt 090002 gttggtagct cttgatccgg 5100 caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 5160 aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 5220 cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 5280 ccttttcacg 1000 gtccgcagaa acggtgctga ccccggatga atgtcagcta 5340 ctgggctatc tggacaaggg 8409002 09009898 aagcaggtag cttgcagtgg 5400 gcttacatgg cgatagctag actgggcggt tttatggaca gcaagcgaac cggaattgcc 5460 agctggggcg ccctctggta aggttgggaa 2000100008 gtaaactgga tggctttctt 5520 gccgccaagg atctgatggc gcaggggatc aagatccgat caagagacag gatgaggatc 5580 gtttcgcatg attgaacaag 4090011500 cgcaggttct ccggccgctt gggtggagag 5640 gctattcggc tatgactggg cacaacagac 0099010 tctgatgccg ccgtgttccg 5700

fill

4138731

-149gctgtcagcg caggggcgcc tggttctttt tgtcaagacc gacctgtccg gtgccctgaa 5760 tgaactgcaa 092002 cgcggctatc gtggctggcc acgacgggcg ttccttgcgc 5820 agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg gcgaagtgcc 5880 ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca tcatggctga 5940 tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc accaagcgaa 6000 acatcgcatc gagcgagcac 000291 ggaagccggt cttgtcgatc aggatgatct 6060 ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca aggcgagcat 6120

00498 gaggatctcg tcgtgaccca 100931900 tgcttgccga atatcatggt 6180

9849 cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg cggaccgcta 6240

044 gcgttggcta cccgtgatat 1090084989 0119909202 aatgggctga 6300 ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg ccttctatcgatcg 6360 ccttctcttgac gagttcttcg 6360 ccttctcttgac gagttcttctct ga

11416 gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac 6480 ctgacgtcag atccggtgcg ggcctcttcg ctattacgcc 29019092 agggggatgt 6540 gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg 6600 acggccagtg aattcgcgag ctcttggcca ctccctctct gcgcgctcgc tcgctcactg 6660

١٨٨

41387Β1

-150aggccgggcg accaaaggtc gcccgacgcc cgggctttgc 2825 tcagtgagcg 6720

32232 cagagaggga gtggccaact ccatcactag gggttcctac gcgtgtctgt 6780 ctgcacattt cgtagagcga gtgttccgat actctaatct ccctaggcaa ggttcatatt 6840.

tgtgtaggtt acttattctc cttttgttga ctaagtcaat aatcagaatc agcaggtttg 6900 gagtcagctt ggcagggatc agcagcctgg gttggaagga gggggtataa aagccccttc 6960

492 gccgtcacac 228000406 gctcctgcta gcaggtaagt gccgtgtgtg 7020 gttcccgcgg gcctggcctc 111802 atggcccttg cgtgccttga 1084 7080 ctgacatcca ctttttcttt ttctccacag gtatcgattc tctagagcca ccatgcagat 7140 cgagctgtct acctgcttct tcctgtgcct gctgcggttc tgcttcagcg 0042808 7200 gtactatctg ggcgccgtgg aactgagctg ggactacatg cagagcgacc tgggcgagct 7260 gcccgtggat gccagattcc ctccaagagt gcccaagagc ttccccttca acacctccgt 7320 ggtgtacaag aaaaccctgt tcgtggaatt caccgaccac ctgttcaata tcgccaagcc 7380 cagacccccc tggatgggcc tgctgggacc tacaattcag gccgaggtgt acgacaccgt 7440 cgtgatcacc ctgaagaaca tggccagcca ccccgtgtct ctgcatgccg tgggagtgtc 7500 ctactggaag gcctctgagg gcgccgagta 008008049 2000900090 gcgagaaaga 7560 ggacgacaag gtgttccctg 09009008 cacctacgtg tggcaggtgc tgaaagaaaa 7620

١٨٨

41387Β1

-51cggccccatg gcctccgacc ctctgtgcct gacatacagc tacctgagcc acgtggacct 7680 cgtgaaggac ctgaacagcg gcctgatcgg agccctgctc gtgtgtagag = 02007740 ggccaaagag aaaacccaga ccctgcacaa gttcatcctg ctgttcgccg tgttcgacga 7800 gggcaagagc tggcacagcgcagcctgatg caggaccggg acgccgcctc 7860

12 tggcccaaaa tgcacaccgt gaacggctac gtgaacagaa gcctgcccgg 7920 actgatcggc tgccaccgga agtctgtgta ctggcacgtg atcggcatgg gcaccacccc 7980 tgaggtgcac agcatctttc tggaaggaca cacctttctc gtgcggaacc accggcaggc 8040 cagcctggaa atcagcccta tcaccttcct gaccgcccag 0840100198 tggacctggg 8100 ccagtttctg ctgttctgcc acatcagctc ccaccagcac gacggcatgg aagcctacgt 8160 gaaggtggac agctgccccg aggaacccca gctgcggatg 4920009 aggaagccga 8220 ggactacgac gacgacctga ccgacagcga gatggacgtg gtgcgcttcg acgacgataa 8280 cagccccagc ttcatccaga tcagaagcgt 9002249 caccccaaga cctgggtgca 8340 ctatatcgcc gccgaggaag aggactggga ttacgcccct ctggtgctgg cccccgacga 8400 cagaagctac aagagccagt acctgaacaa tggcccccag 0220906 ggaagtataa 8460 gaaagtgcgg ttcatggcct acaccgacga gacattcaag accagagagg ccatccagca 8520 atcctgggcc ctctgctgta tggcgaagtg 080 tgctgatcat 8580

fill

4138731

-152cttcaagaac caggccagca gaccctacaa catctaccct cacggcatca ccgacgtgcg 8640 gcccctgtac tccagaaggc tgcccaaggg cgtgaaacac ctgaaggact tccccatcct 8700 gcccggcgag atcttcaagt acaagtggac cgtgaccgtg gaagatggcc 020022049 8760 cgaccccaga tgcctgacac ggtactacag cagcttcgtg 202199020 gggacctggc 8820 ctccggcctg attggcccac tgctgatctg ctacaaagaa agcgtggacc agcggggcaa 8880 ccagatcatg agcgacaagc ggaacgtgat cctgtttagc gtgttcgatg agaaccggtc 8940 ctggtatctg accgagaata tccagcggtt cctgcccaac cctgccggcg tgcagctgga 9000 agatcctgag ttccaggcct ccaacatcat gcactccatc aatggctatg tgttcgacag 9060 cctgcagctg agcgtgtgcc tgcacgaggt 900012 tacatcctga gcatcggggc 9120

009800 ttcctgtccg tgttcttctc cggctacacc ttcaagcaca agatggtgta 9180 cgaggatacc ctgaccctgt tcccctttag cggcgaaacc gtgttcatga gcatggaaaa 9240 ccccggcctg 1990 + 22 gctgccacaa cagcgacttc cggaacagag gcatgaccgc 9300 cctgctgaag gtgtccagct 0802002 caccggcgac 1001209499 acagctatga 9360 ggacatcagc gcctacctgc 18904446 caatgccatc 8000422 gcttcagcca 9420 gaaccccccc gtgctgaagc 0004049 agagatcacc cggaccaccc tgcagtccga 9480

00990902 atcgattacg acgacaccat cagcgtggaa atgaagaaag aagatttcga 9540

fill

4138731

-153catctacgac gaggacgaga accagagccc ccggtgcttt cagaaaaaga ccctgtgctttt cagaaaaaga cccggcacta 9600 cttcattgcc gctgtggaac ggctgtggga ctacggcatg agcagcagcc ctcacgtgctt 9660 gagaaacagc a gccggtgcca 9660 gagaaacagcg gccggtgcca 9660

890 agcttcaccc agcctctgta ccgcggcgag ctgaatgagc acctgggact 9780 gctgggcccc tatatcagag ccgaagtgga agataatatc atggtcacct 109044 9840 ggcctcccgg ccctacagct tctacagctc cctgatcagc 100909099 accagagaca 9900 gggcgctgag ccccggaaga acttcgtgaa gcccaacgag actaagacct acttttggaa 9960 ggtgcagcac cacatggccc ctacaaagga cgagttcgac tgcaaggcct gggcctactt 10020 ctccgatgtg 000122 aggacgtgca ctctgggctg atcggccccc tgctcgtgtg 10080 ccacaccaac accctgaatc ccgcccacgg cagacaagtg 200180490 aattcgccct 10140 gttcttcacc atcttcgacg aaacaaagag ctggtacttc accgaaaaca tggaaagaaa 10200 ctgccgggct ccctgcaaca tccagatgga agatcccacc ttcaaagaga actaccggtt 10260 ccacgccatc aacggctaca 04098040 actgcccggc ctcgtgatgg ctcaggatca 10320 gcggatccgg tggtatctgc tgtccatggg ctccaacgag aacatccaca gcatccactt 10380

42020 gtgttcaccg tgcggaaaaa agaagagtac aaaatggccc tgtacaacct 10440 gtaccctggg gtgttcgaga cagtggaaat gctgcccagc aaggccggca tctggcgggt 10500

fill

4138731

...

ggaatgtctg atcggcgagc atctgcacgc tgggatgagc acactgtttc tggtgtacag 10560 caacaagtgc cagacacctc tgggcatggc ctctggccac atccgggact ttcagatcac 10620 agccagcggc cagtatggcc agtgggcccc aaaactggcc 29001000 0090949 10680 catcaacgcc tggtccacca 39000 0090199800 aaggtggacc tgctggctcc 10740 catgatcatc cacggaatca agacccaggg cgccagacag aagttcagca gcctgtacat 10800 cagccagttc atcatcatgt acagcctgga • 990249809 tggcagacct accggggcaa 10860 tagcaccggc accctgatgg tgttcttcgg caacgtggac tccagcggca ttaagcacaa 10920 catcttcaac ccccccatca ttgcccggta catccggctg caccccaccc actacagcat 10980 ccggtccacc ctgagaatgg aactgatggg ctgcgacctg aactcctgca gcatgcccct 11040

829192 agcaaggcca tctccgacgc ccagatcacc gcctccagct acttcaccaa 11100 catgttcgcc acctggtccc catccaaggc ccggctgcat ctgcagggca gaagcaatgc 11160 ttggaggccc caagtgaaca accccaaaga atggctgcag gtggacttcc agaaaaccat 11220 gaaagtgacc ggcgtgacca cccagggcgt gaagtctctg ctgacctcta tgtacgtgaa 11280 agagttcctg atctccagca 004998099 ccaccagtgg accctgtttt tccagaacgg 11340 caaagtgaaa gtgtttcagg 2004988 ctccttcacc cccgtcgtga atagcctgga 11400 ccctccactg ctgaccagat acctgcggat ccaccctcag agttgggtgc accagattgc 1460 a

's

fill

4138731

-155tctgcggatg gaagtgctgg 40090 ccaggacctg tactgacaac tagtaataaa 11520 agatcagagc tgtagagatc tgtgtgttgg ttttttgtgt gcggccggta cccaggaacc 11580 cctagtgatg 9091199002 ctccctctct gcgcgctcgc tcgctcactg 990099909 11640 accaaaggtc gcccgacgcc cgggctttgg tcgggcggcc tcagtgagcg agcgagcgcg 11700 cagagaggga gtggccggaa gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa 11760 ttgttatccg ctcacaattc 02080202 20000908 agcataaagt gtaaagcctg 11820 gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca 11880 gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg 9029209 11940 tttgcgtatt gggcgctctt ccgctgatct 420209 aacgccagca agacgtagcc 12000 cagcgcgtcg 90000982 gcgccgcgtg cggctgctgg agatggcgga cgcgatggat 12060 atgttctgcc aagggttggt ttgcgcattc acagttctcc 040119 attggctcca 12120 attcttggag tggtgaatcc gttagcgagg tgccgccctg cttcatcccc gtggcccgtt 12180 gctcgcgttt • 0 + 99099 + 2 000092289 22180811 gcatgtcttt agttctatga 12240 tgacacaaac cccgcccagc gtcttgtcat 004810 cggctgtgga atgtgtgtca 12300 gttagggtgt 9084090000 caggctcccc 202900428 agtatgcaaa gcatgcatct 12,360 caattagtca gcaaccaggt gtggaaagtcccaggctcccc ccagcaggca gaagtatgca 12420

١٨٨

41387Β1

-156aagcatgcat ctcaattagt 820001 agtcccgccc ctaactccgc ccatcccgcc 12480 cctaactccg cccagttccg cccattctcc gccccatggc tgactaattt tttttattta 12540 tgcagaggcc gaggccgcct cggcctctga 201010029 aagtagtgag gaggcttttt 12600 tggaggccta ggcttttgca aaaagcttgc atgcctgcag gtcggccgcc acgaccggtg 12660 ccgccaccat cccctgaccc acgcccctga cccctcacaa ggagacgacc ttccatgacc 12720 gagtacaagc ccacggtgcg cctcgccacc • 909009809 tcccccgggc cgtacgcacc 12780 ctcgccgccg cgttcgccga ctaccccgcc 2090900882 ccgtcgaccc ggaccgccac 12840 atcgagcggg tcaccgagct gcaagaactc ttcctcacgc gcgtcgggct cgacatcggc 12900 aaggtgtggg tcgcggacga cggcgccgcg gtggcggtct ggaccacgcc ggagagcgtc 12960 gaagcggggg cggtgttcgc 098000820 0090902199 ccgagttgag cggttcccgg 13020 ctggccgcgc agcaacagat ggaaggcctc ctggcgccgc 0009800004 ggagcccgcg 13080 tggttcctgg ccaccgtcgg cgtctcgccc gaccaccagg gcaagggtct gggcagcgcc 13140 gtcgtgctcc ccggagtgga 22090089 cgcgccgggg tgcccgcctt cctggagacc 13200 tccgcgcccc gcaacctccc cttctacgag cggctcggct tcaccgtcac cgccgacgtc 13260 gaggtgcccg aaggaccgcg cacctggtgc atgacccgca agcccggtgc ctgacgcccg 13320 ccccacgacc cgcagcgccc 0088029 agcgcacgac cccatggctc +80082 13380

fill

4138731

-157cacccggggc ggccccgccg accccgcacc cgcccccgag gcccaccgac tctagaggat 13440 cataatcagc cataccacat ttgtagaggt tttacttgct 1000000 tcccacacct 13500 ccccctgaac DNA &lt;ctgaaacata2 &lt;102 135242 &lt;

Synthetic sequence &lt;213&gt; 10

Synthetic construction peridotomy &lt;400&gt; 5 gacgtggtgcgcttcga

Mk

4138731

-158 &lt;210&gt; 6 &lt;211&gt; 20 &lt;212&gt; DNA

Synthetic Sequence 213 5

Artificial construction &lt;223&gt;

&lt;400&gt; 6 gggcgtaatc ccagtcctct 20 &lt;210&gt; 7 &lt;211&gt; 22 &lt;212&gt; DNA

Synthetic Sequence 213

<img file="MA41387B1_D0011.tif" />

41387Β1

-159-

220

Artificial construction &lt;223&gt;

&lt;400&gt; 7 aagcgtggcc aagaagcacc cc &lt;210&gt; 8 &lt;211&gt; 21 &lt;212&gt; DNA

Synthetic Sequence -213

Artificial construction &lt;223&gt;

&lt;400&gt; 8

١٨٨

41387Β1

-160gttgccattg ctacaggcat c 21 &lt;210&gt; 9 &lt;211&gt; 19 &lt;212&gt; DNA

Synthetic Sequence -213

Artificial construction &lt;223&gt;

10 &lt;400&gt; 9 actcgccttg atcgttggg 19 &lt;210&gt; 10 &lt;211&gt; 28

<img file="MA41387B1_D0012.tif" />

١٨٨

41387Β1

-161-

Synthetic Sequence 213

Artificial construction &lt;223&gt;

5 &lt;400&gt; 10 acgctcgtcg 111912898 cttcattc 28 &lt;210&gt; 11 &lt;211&gt; 17 &lt;212&gt; DNA

Synthetic Sequence 213

220

Artificial construction &lt;223&gt;

fill

4138731

-162 &lt;400&gt; 11 ggaccgccac atcgagc &lt;210&gt; 12 &lt;211&gt; 15 &lt;212&gt; DNA

Synthetic Sequence 2213

2220

Synthetic construction &lt;223&gt; 10 ccccgcttcg acgct 15 &lt;210&gt; 13 &lt;211&gt; 28

fill

4138731

-163 &lt;212&gt; DNA

Synthetic Sequence 213

220

Synthetic Build -5223 5 &lt;400&gt; 13 tcaccgagct gcaagaactc ttcctcac 28 &lt;210&gt; 14 &lt;211&gt; 23 &lt;212&gt; DNA

Synthetic sequence &lt;213&gt;

Synthetic mint &lt;223&gt;

fill

4138731

-164gaccaggcct catacatctc ctt &lt;210&gt; 15 &lt;211&gt; 18 &lt;212&gt; DNA

Synthetic sequence Limit 213&gt;

220 10

Artificial construction &lt;223&gt;

&lt;400&gt; 15 ggcagccttgatttggga &lt;210&gt; 16

41387Β1

-165 &lt;211&gt; 20 &lt;212&gt; DNA

Synthetic sequence&gt; 213

220 5

Synthetic construction 5223 &lt;400&gt; 16 aatgcggcct ccaactcgcg &lt;210&gt; 17 &lt;211&gt; 19 &lt;212&gt; DNA

Synthetic Sequence 213

220

41387031

-166-

Artificial construction &lt;223&gt;

&lt;400&gt; 17 caacacggcg accctacaa 19 &lt;210&gt; 18 &lt;211&gt; 28 &lt;212&gt; DNA

Synthetic sequence &lt;213&gt;

Artificial construction&gt; 223

&lt;400&gt; 18 tccaatactg tcttgcaata tacacagg

4138731

-167 &lt;210&gt; 19 &lt;211&gt; 28 &lt;212&gt; DNA

Synthetic Sequence -213

Artificial construction &lt;223&gt;

&lt;400&gt; 19 tgcacggaac tgaacacttc actgcaag &lt;210 20 &lt;211&gt; 24 &lt;212&gt; DNA

Synthetic Sequence 213

41387031

-168-

4220

Artificial construction &lt;223&gt;

&lt;400&gt; 20 ccgtcgtgaatagcctggac cctc 24

210 21 &lt;211&gt; 28 &lt;212&gt; DNA

Synthetic Sequence 213 10

220

Artificial construction &lt;223&gt;

&lt;400&gt; 21 atctgtgtgt tggttttttg tgtgcggc

4138731

-169210 22 &lt;211&gt; 29 &lt;212&gt; DNA

Synthetic Sequence 213 5

6220

Artificial construction &lt;223&gt;

&lt;400&gt; 22 aatcccagtc ctcttcctcg gcggcgata 29

210 23 &lt;211&gt; 29 &lt;212&gt; DNA

Synthetic Sequence -213

41387031

-170-

220

Synthetic mint &lt;223&gt;

&lt;400&gt; 23 agtatcggaa cactcgctct acgaaatgt &lt;210&gt; 24 &lt;211&gt; 78 &lt;212&gt; DNA

Synthetic Sequence -213

220

Synthetic mint &lt;223&gt;

&lt;400&gt;24

<img file="MA41387B1_D0013.tif" />

١٨٨

41387Β1

...

cactccctct ctgcgcgctc gctcgctcac 140092 cgaccaaagg tcgcccacgc 60 ccgggctttg cccgggcg