Cells coexpressing vitamin K reductase and vitamin K dependent protein and use thereof to improve the productivity of said vitamin K dependent protein

[Statement of priority] The present invention is hereby referred to in its entirety under Article 119e of the United States Patent Act. Incorporated, US Provisional Patent Application No. 60 / 505,52 filed September 23, 2003 Claim the profit of No. 7.

[Government support] The present invention is partly subsidized by the National Institutes of Health No. 5 P01 HL06350-4. It was carried out with the support of No. 2 and No. 5-R01 HL48318. The U.S. government Clearly has certain rights.

[Field of invention] The present invention relates to an isolated nucleic acid, a host cell containing the isolated nucleic acid, and a method for using the isolated nucleic acid. Identification of single nucleotide polymorphisms (SNPs) within the vitamin K epoxide reductase (VKOR) gene And methods and compositions directed to correlate them with susceptibility to warfarin ..

Multiple glutamate residues are γ-carboxyglutamic for the functioning of a large number of proteins It needs to be modified to rutamic acid. The best known of these is bi Tamin K-dependent (VKD) coagulation protein, factor IX (Christmas factor), factor VII Child, and prothrombin. Matrix Gla protein gene knockout Observations that mice cause arterial calcification (Luo et al. (1997)) "Spontaneous calcification of arteries a nd cartilage in mice lacking matrix GLA "protein" Nature 386: 78-81) is a tongue that has functions other than coagulation. It emphasizes the importance of the vitamin K cycle for pak quality. In addition, the function is known Not Gas6 and other Gla proteins are expressed in nerve tissue and in utero Farin exposure causes mental retardation and facial malformations. This is an enzyme that modifies Gla Tissues with high expression of certain VKD carboxylase in the nervous system during early embryogenesis This is consistent with the observation that it is time regulated in a specific way. Accompanying carboxylation , Reduced vitamin K, which is a co-bottom of the reaction, is converted to vitamin K epoxide. Human Vitamin K epoxides reduce its deficiency because the amount of vitamin K contained in foods is limited. Reconverted to Vitamin K by Vitamin K Epoxide Reductase (VKOR) to prevent It must be. Warfarin, the most widely used anticoagulant, is VK It targets OR and interferes with vitamin K regeneration. As a result, the concentration of reduced vitamin K Reduced, which reduced the rate of carboxylation by γ-glutamyl carboxylase. Reduces and produces hypocarboxylated vitamin K-dependent protein.

Warfarin is prescribed to more than one million patients each year in the United States alone. And in the Netherlands, it is reported that about 2% of the population is receiving long-term warfarin therapy. There is. The dose of warfarin required for anticoagulant therapeutic levels varies widely from patient to patient Therefore, the use of warfarin carries the risk of serious side effects. For example, Walfari Serious bleeding symptoms occur in 1-2% of patients after the start of therapy, and 0.1-0 in patients Deaths have been reported in .7%. Despite these dangers It is estimated that the use of rufarin can prevent 20 seizures per induced bleeding symptom. It is underutilized, probably due to the risk of induced bleeding.

The present invention feels that single nucleotide polymorphisms in subjects have increased or decreased with respect to warfarin. Provides methods and compositions for correlating with responsiveness, thereby risking the subject. Allows more accurate and rapid determination of reduced therapeutic and maintenance doses Overcome previous shortcomings in the field.

The present invention includes human subjects with increased or decreased susceptibility to warfarin. This is a method of determining the presence of a single nucleotide polymorphism in the VKOR gene in the subject. The sensation that the single nucleotide polymorphism increased or decreased with respect to warfarin. Correlated with sex, thereby having increased or decreased susceptibility to warfarin Provided is a method including a step of identifying a subject.

In addition, identify human subjects with increased or decreased susceptibility to warfarin A) Increase the presence of single nucleotide polymorphisms in the VKOR gene to warfarin Steps to correlate with increased or decreased susceptibility, and b) step in the subject This is a step of detecting the single nucleotide polymorphism of p (a), whereby it is directed against warfarin. Provided are methods comprising identifying subjects with increased or decreased susceptibility. Will be done.

In yet another embodiment, the invention has increased or decreased susceptibility to warfarin. A method for identifying single nucleotide polymorphisms in the VKOR gene correlated with a) Stealing to identify subjects with increased or decreased susceptibility to warfarin With b) Steps to detect the presence of single nucleotide polymorphisms in the VKOR gene in the subject, and c) The presence of the single nucleotide polymorphism in step (b) is directed against warfarin in the subject. A step that correlates with increased or decreased susceptibility, thereby warfarin Single nucleotide polymorphisms in the VKOR gene correlated with increased or decreased susceptibility to A step of identification and a method including include are provided.

Furthermore, the present invention increases single nucleotide polymorphisms in the subject's VKOR gene to warfarin. A method of correlating with increased or decreased susceptibility, a) increasing for warfarin Steps to identify subjects with reduced susceptibility and b) Tests in step (a) Steps to determine the nucleotide sequence of the VKOR gene of the person and c) Step (b) Steps to compare the nucleotide sequence of the VKOR gene with the wild-type nucleotide sequence of the VKOR gene And d) the step of detecting a single nucleotide polymorphism in the nucleotide sequence of step (b), and And e) Single nucleotide polymorphism in step (d) against warfarin in the subject in step (a) Provided are methods that include steps to correlate with increased or decreased susceptibility.

Another aspect of the invention is vitamin K epoxide reductase (VKOR), especially mammals. An isolated nucleic acid encoding VKOR (eg, human, sheep, bovine, monkey, etc.). For example, (a) An isolated nucleic acid having the nucleotide sequence set forth in, for example, SEQ ID NO: 8 or SEQ ID NO: 9. To the nucleic acids disclosed herein and (b) the isolated nucleic acid of (a) above or its complement. Hybridize (eg, under stringent conditions) and / or above (for example) Has substantial sequence identity with the nucleic acid of a) (eg, 80, 85 with the nucleic acid of (a) above) , 90, 95 or 99% identity), and with nucleic acids encoding VKOR, In addition, (c) is different from the nucleic acid of (a) or (b) above due to the degeneracy of the genetic code, but the above Includes the nucleic acid encoding VKOR encoded by the nucleic acid of (a) or (b) of Get caught.

The term "stringent" as used herein is a necessity for hybridization methods. To the hybridization conditions generally understood in the art to define the product Related. Stringency conditions, those terms are commonly known in the art , Low, high, medium, as clearly recognized by those skilled in the art. Provided herein High nucleotides that allow allogeneic nucleotide sequences to hybridize to such nucleotide sequences. Trinency conditions are well known in the art. As an example, such an array Hybridization to nucleic acid molecules disclosed herein is about 60% homologous of sequences. 25% formamide at 42 ° C, 5 × SS to allow hybridization Can be performed in C, 5 × Denhardt solution and 5% dextran sulfate, After cleaning conditions of 25% formamide, 5 × SSC and 0.1% SDS at 42 ° C. Is used. Another example is a 6 × SSC, 0.1% SDS hybridize at about 45 ° C. Selection conditions, followed by 0.2 x SSC at 50-65 ° C, 0.1% Cleaning conditions for SDS Including. Another example of stringent conditions is using a standard hybridization assay. 0.3M NaCl, 0.03M Sodium Citrate, 0.1% at 60-70 ° C Represented by the SDS cleaning stringency (its content as a whole is for reference) SAMBROOK et al., EDS., MOLECULAR incorporated in the detailed book CLONING: A LABORATORY MANUAL 2d ed. (Cold See Spring Harbor, NY 1989)). In various embodiments The stringent condition is, for example, highly stringent (ie, high). Stringency) Conditions (eg 0.5M NaHP0 at 65 ° C)₄, 7% dodecyl Sodium Sulfate (SDS), Hybrid to Filter-Binding DNA in 1 mM EDTA Dimation) and / or moderately stringent (ie medium stringer) Includes conditions (eg, cleaning in 0.2 x SSC / 0.1% SDS at 42 ° C) be able to.

An additional aspect of the invention is the vitamin K described herein linked to a heterologous promoter. A recombinant nucleic acid containing a nucleic acid encoding an epoxide reductase.

Another aspect of the invention is a cell that contains and expresses the recombinant nucleic acid described above. Appropriate Cells include plant, animal, mammalian, insect, yeast and bacterial cells.

Another aspect of the invention is hybridizing to an isolated nucleic acid encoding the VKOR described herein. It is an oligonucleotide to be soybean.

Another aspect of the invention is isolation and purification encoded by the nucleic acids described herein. VKOR (eg, homogeneously purified VKOR). For example, the VKOR of the present invention is arranged. It may include the amino acid sequence shown in column number 10.

Another aspect of the present invention is a method of producing a vitamin K-dependent protein, which is a bita. Expressing a nucleic acid encoding a vitamin K-dependent protein in the presence of min K depends on vitamin K A step of culturing a host cell that produces a viable protein, and then depending on the vitamin K The host cell comprises vitamin K, comprising the step of removing the viable protein from the culture. The host cell contains and expresses a heterologous nucleic acid encoding a dependent carboxylase. Also contains a heterologous nucleic acid encoding Vitamin K Epoxide Reductase (VKOR), A method of expression and producing the VKOR described herein.

<figref num="1">Figures A to D show a comparison of warfarin doses in wild-type, heterozygous and homozygous subjects against the SNPs vk2581, vk3294 and vk4769, and a comparison of warfarin doses in wild-type and heterozygous subjects for P450 2Y9. Is.</figref><figref num="2">For each of the 13 siRNA pools, 3 T7 flasks containing A549 cells were transfected and VKOR activity was determined 72 hours later. A 25 μM vitamin K epoxide was used in the VKOR assay. One siRNA pool specific for the gene gi: 13124769 reduced VKOR activity by 64% to 70% in 8 repeated experiments.</figref><figref num="3">It is a figure which showed the time course of inhibition of VKOR activity by the siRNA pool specific with respect to gi: 13124769 in A549 cell. During this period, VKOR activity decreased persistently, but its mRNA levels rapidly decreased to about 20% of normal levels. 25 μM vitamin K epoxide was used in this assay. siRNA did not affect VKD carboxylase activity or Lamin A / C mRNA levels.</figref><figref num="4">VKOR activity was detected when mGC_11276 was expressed in Sf9 insect cells. In this assay, about 1x10⁶I used cells. The reaction was carried out in buffer D over 30 minutes at 30 ° C with 32 μM KO. Blank Sf9 cells served as a negative control and A549 cells as a standard.</figref><figref num="5">Inhibition of VKOR by warfarin. The reaction was performed in buffer D at 30 ° C. for 15 minutes with VKOR_Sf9 cells, 1.6 mg microsomal protein made from 60 μM KO, and various concentrations of warfarin.</figref>

As used herein, "one" or "that" may mean one or more. is there. For example, "one" cell can mean a single cell or multiple cells.

Hereinafter, the present invention will be described in more detail. This description is all about the variety in which the invention can be practiced. A detailed inventory of all the features that can be added to the present invention. I don't mean to. For example, the features exemplified for one embodiment are other embodiments. Features that can be incorporated into a state and exemplified with respect to a particular embodiment are those embodiments. You can also remove it from. Further, in light of the present disclosure, those skilled in the art will be provided in this specification. Numerous modifications and additions to the various embodiments will be apparent without departing from the present invention. So The following specification is intended to illustrate some specific embodiments of the present invention. It is not intended to specify all permutations, combinations and variants exclusively.

The "sequence list" attached herein is described as if it were fully described herein. Form part of a fine book.

The present invention is based on this disclosure, and those disclosures are fully described herein. Stafford and Wu, which is incorporated herein by reference in its entirety. To US Pat. No. 5,268,275 and to Stafford and Chang Including, but not limited to, those described in US Pat. No. 6,531,298, It may be carried out utilizing methods, components, and features known in the art.

"Nucleic acid" as used herein is cDNA, genomic DNA, synthetic (eg, chemically synthesized). Includes both RNA and DNA, including DNA and RNA and DNA chimeras Includes. The nucleic acid may be double-stranded or single-stranded. In the case of single strand, the nucleic acid It may be the sense strand or the antisense strand. Nucleic acid is an oligonucleotide analog if Or synthesized using derivatives (eg, inosine or phosphorothioate nucleotides) You can. Such oligonucleotides are, for example, altered base pairing ability or nucleoa. It can be used to prepare nucleic acids with increased resistance to roses.

An "isolated nucleic acid" is adjacent to it in the native genome of the organism from which it is derived (1). The book is on the 5'end and one is on the 3'end) not adjacent to either of the coding sequences DNA or RNA. Therefore, in one embodiment, the isolated nucleic acid is the chordin. Includes some or all of the 5'non-coding (eg, promoter) sequences adjacent to the sequence .. Therefore, the term is used, for example, in a vector, in a self-replicating plasmid or in a virus, Or integrated into the genomic DNA of prokaryotes or eukaryotes, or with other sequences Independently produced by individual molecules (eg, PCR or restriction endonuclease treatment c Contains recombinant DNA that exists as DNA or genomic DNA fragment). is this , Recombinant DNA that is part of a hybrid gene that encodes an additional polypeptide sequence Including further.

The term "isolated" is essentially a cellular, viral, or culture medium ( (If produced by recombinant DNA technology), or chemical precursors or other chemicals It may mean a nucleic acid or polypeptide that does not contain (when chemically synthesized). In addition, "isolated nucleic acid fragments" do not occur naturally as fragments, and A nucleic acid fragment that would not be found in its natural state.

The term "oligonucleotide" is used, for example, as a primer in PCR amplification, or For use as a probe in hybridization assays or microarrays Can be at least about 6 to about 100 nucleotides, eg about 15 to 30 Cleotide, or a nucleic acid sequence of about 15 to 30 nucleotides. Oligonucre Ochides can be natural or synthetic, such as DNA, RNA, or modified backbone. I.

A particular nucleotide sequence is said to have a particular identity (%) with a standard nucleotide sequence. If so, identity (%) is compared to the standard nucleotide sequence. For example, 100 Standard nucleotide sequence of base length and 50%, 75%, 85%, 90%, 95% or Nucleotide sequences that are 99% identical are 50, 75, 85, of the standard nucleotide sequence. 50, 75, 85, 90, which is exactly the same as the 90, 95 or 99 nucleotide sequence May have 95 or 99 bases. The nucleotide sequence further spans its entire length 50%, 75%, 85%, 90%, 95% or 99% identical to standard nucleotide sequence It may be a 100-base long nucleotide sequence. Of course, the same criteria are applied as well There are other nucleotide sequences that will be met.

A nucleic acid sequence that is "substantially identical" to the VKOR nucleotide sequence is SEQ ID NO: 8 or At least 80%, 85%, 90%, 95% or 99% identical to the 9 nucleotide sequence Is. To compare nucleic acids, the length of the standard nucleic acid sequence is generally at least 40 nucleo. It will be tide, eg at least 60 nucleotides or more. Sequence identity is sequence analysis software Wear (for example, University of Wisconsin Biotechnology Center (1710 Univ) ersity Avenue, 53705 Madison, Wisconsin) Genetics Compilation It can be measured using the sequence analysis software package of the tutor group).

Sequence identity of nucleic acids or amino acids with known sequences, as is known in the art. Or many different programs can be used to identify whether they have similarities it can. Sequence identity or similarity can be found in Smith &amp; Waterman, Adv.A Need, a local sequence identity algorithm from ppl.Math.2,482 (1981) Leman &amp; Wunsch, J.Mol.Biol.48,443 (1970) Column Identity Alignment Algorithm, Pearson &amp; Lipman, Proc.N About the similarity method of atl.Acad.Sci.USA 85,2444 (1988) Search for, computer execution of these algorithms (Wisconsin Gen) etics Software Package, Genetics Computer Group, 575 Science Drive (Madison, Wisconsin) GAP, BESTFIT, FASTA, and TFASTA), preferably by default Devereux et using the lt setting al., Nucl. Acid Res.12 , 387-395 (1984), Best Fit sequence Uses standards known in the art, including but not limited to programs or inspections Can be decided.

An example of a useful algorithm is PILEUP. PILEUP is a progressive pairwise Alignment is used to make multiple sequence alignments from a group of related sequences. PI LEUP further shows the clustering relationships used to make the alignment. You can plot the phylogenetic tree. PILEUP is Feng &amp; Doolittle, Innovative alignment method of J.Mol.E vol.35,351-360 (1987) Use the simplification of; this method is Higgins &amp; Sharp, CABIOS 5 , 151-153 (1989), similar to the method described.

Another example of a useful algorithm is Altschul et al., J. Mol. Biol. 215, 403-410, (1990) and Karlin et al., Proc.Natl.Acad.Sci.USA 90,5873-5787 (1993) ) Is the BLAST algorithm described in. A particularly useful BLAST program is A ltschul et al., Methods in Enzymology, 266 , 460-480 (1996) WU-BLAST-2 program. WU-BLAST-2 has several search parameters, preferably set to default values. Use data. These parameters are dynamic numbers for the construction of a particular array and for it. By the program itself, depending on the configuration of the particular database in which the sequence is retrieved Established; however, the numbers can be adjusted to increase susceptibility. With additional The algorithm for this is Altschul et al. Nucleic Acids R With gapped BLAST as reported by es.25,3389-3402 is there.

The CLUSTAL program can also be used to determine sequence similarity. This a Lugorism, Higgins et al. (1988) Gene 73: 237; H iggins et al. (1989) CABIOS 5: 151-153; Corp et et al. (1988) Nucleic Acids Res. 16: 1088 1-90; Huang et al. (1992) CABIOS 8: 155-65; And Pearson et al. (1994) Meth. Mol. Biol. 24: 3 Described by 07-331.

In addition, sequences containing more or less nucleotides than the nucleic acids disclosed herein. For, in one embodiment, sequence identity (%) is associated with the total number of nucleotide bases. It is understood that it is determined based on the number of the same nucleotides. So, for example For example, sequence identity of sequences shorter than those disclosed in detail herein is short in one embodiment. It will be determined using the number of nucleotide bases in the sequence. Calculation of identity (%) In, the relative load is divided into the manifestations of various sequence changes, such as insertions, deletions, and substitutions. I can't guess.

The VKOR polypeptides of the present invention include recombinant polypeptides, synthetic peptides and natural peptides. Contains, but is not limited to, repeptides. The present invention is further described in the natural form. Nucleic acid encoding the morphology of a VKOR polypeptide with altered or deleted amino acid sequences Contains an array. Preferred nucleic acids are polypeptides that are soluble under normal physiological conditions To code. Furthermore, in the present invention, all or part of VKOR is unrelated polypepti. (Eg, marker polypeptide or fusion partner) to create a fusion protein Includes nucleic acids encoding the fusion proteins produced. For example, polypeptides are expressed in bacteria To a hexahistidine tag to facilitate purification of the polypeptide, or in eukaryotic cells To the hemagglutinin tag to facilitate purification of the polypeptide expressed in, or Affini To facilitate purification of polypeptides by tee chromatography or immunity precipitation method Can be fused to HPC4 tags. The present invention includes isolation of first and second parts. It also includes polypeptides (and nucleic acids encoding these polypeptides), the first part. Contains, for example, all or part of a VKOR polypeptide, and the second part is, for example, Includes detectable markers.

The fusion partner may be, for example, a polypeptide that promotes secretion, such as a secretory sequence. I. Such fusion polypeptides are commonly referred to as preproteins. The secretory sequence is It can be cleaved by cells to form mature proteins. In addition, the Inactive Preta Contains nucleic acid encoding VKOR fused to a polypeptide sequence to produce a protein Get caught. The preprotein is converted to the active form of the protein by removal of the inactivating sequence. be able to.

The present invention further describes, for example, stringent hybridization conditions (as described herein). All or all of the nucleotide sequences of SEQ ID NOs: 1-6, 8 or 9 (as specified) It also includes nucleic acids that hybridize to some or their complement. In certain embodiments, high The hybridized portion of the bridging nucleic acid is generally at least 1 in length. 5 (eg, 20, 30, or 50) nucleotides. Hybridizing The hybridized portion of the nucleic acid is the portion of the nucleic acid encoding the VKOR polypeptide. Or at least 80% of the whole sequence, eg at least 95%, at least 98% It is 100% identical. The types of hybridized nucleic acids described herein are: For example, cloning probes, primers (eg PCR primers), or diagnostic pros. Can be used as a tube. The present invention includes, for example, as described herein and already in the art. Low molecular weight dryness that inhibits the function of VKOR, as determined in an activity assay such as knowledge Also included are interfering RNA (siRNA) and / or antisense RNA.

In yet another embodiment, the invention comprises cells containing the nucleic acids of the invention, such as transformed cells. It is characterized by. "Transformed cells" are VKOR polypeptides and / or antisen Nucleic acid encoding all or part of snucleic acid or siRNA depends on recombinant nucleic acid technology It is a cell that has been introduced into it (or into its ancestors). For example, bacteria, yeast, It includes both prokaryotic and eukaryotic cells such as insects, mice, rats, humans and plants.

The present invention provides transcriptional and / or translational styles that allow expression, such as expression vectors. A nucleic acid construct containing a nucleic acid of the invention that is functionally linked to a node element (eg, bek). Tar and plasmids) are also featured. "Functionally connected" means the above-mentioned adjustment d. For example, VKO so that the rement can regulate the transcription and / or translation of the selected nucleic acid. Selected nucleic acids, such as the DNA molecule encoding the R polypeptide, are sequence transcription and / Or placed adjacent to one or more regulatory elements that direct translation, such as promoters It means that it is.

The present invention is a fragment of the nucleic acid of the present invention that can be used as a primer or probe. Or oligonucleotides are further provided. Therefore, in some embodiments, the present invention Fragments or oligonucleotides of are described in SEQ ID NO: 8 or SEQ ID NO: 9. At least 10, 15, 20, 25, 30, 35, 40, 45, 50 of nucleotide sequences , 55, 60, 65, 70, 75, 80, 85, 90, 100, 125, 150, 175 , 200, 250, 300, 350, 400, 450, 500, 550, 600, 650 , 700, 750, 800, 850, 900, 1000, 1500, 2000, 2500 Alternatively, it is a nucleotide sequence that is 3000 consecutive nucleotides. Oligonuc of the present invention Examples of leotide are provided in the sequence listings included herein. If such a fragment Or oligonucleotides can be used, for example, as primers in amplification (eg, PCR) assays. Detectable to include and / or incorporate restriction enzyme cleavage sites when used It can be labeled or modified.

The present invention may be, for example, the amino acid sequence of SEQ ID NO: 10 or a bioactive fragment thereof. Is a polypeptide containing, essentially consisting of, and / or consisting of a peptide. Which purified or isolated VKOR polypeptide is further characterized. Such a flagmen The peptide or peptide is typically at least about 10 amino acids of the amino acid sequence of SEQ ID NO: 10. Noic acid (eg, 15, 20, 25, 30, 35, 40, 4 of the amino acid sequence of SEQ ID NO: 10) 5, 50, 55, 60, 65, 75, 85, 95, 100, 125, or 150 mysidacea No acid) and the amino acid of the VKOR protein (eg, as set forth in SEQ ID NO: 10) It may be a peptide or fragment of a sequence of consecutive amino acids. Fragment of the present invention The biological activity of the peptide or peptide provided herein and identifies the VKOR activity. Therefore, it can be determined according to a method known in the art. VKOR tongue of the present invention Pactic fragments and peptides are more active as antigens for producing antibodies May have. Identification of epitopes on fragments or peptides of the invention It is carried out by well-known protocols and is within the bounds of ordinary skill in the art.

Both "protein" and "polypeptide" as used herein are length or translation. Ami, independent of post-translational modifications (eg glycosylation, phosphorylation or N-myristylation) It means a chain of noic acid. Therefore, the term "VKOR polypeptide" is a full-length natural VKOR tongue. Paku quality, as well as full-length natural VKOR protein, or natural or synthetic VKOR Polypeptite produced by recombination or synthesis that matches a portion of the polypeptide Do are included respectively.

A "purified" or "isolated" compound or polypeptide is low by weight of the compound in question. At least 60% of the composition, such as at least natural microorganisms or other constituents of the virus Also generally associated with some, eg, cellular or viral structural components or their polypeptides Separated from other polypeptides or nucleic acids found in the It is a VKOR polypeptide or antibody that is not qualitatively contained. As used herein, " "Isolated" polypeptides are at least about 25%, 50%, 60%, 70%, 75%, 80% , 85%, 90%, 95%, 97%, 98%, 99% (w / w) or more pure. Prefer Or the preparation is at least 75% by weight of the compound (eg, at least 90% if Or 99%). Purity is a suitable standard method, such as column chromatography, poly It can be measured by acrylamide gel electrophoresis or HPLC analysis.

Preferred VKOR polypeptides include all or part of the native VKOR polypeptide. Contains sequences that are substantially identical to minutes. With the VKOR polypeptide sequences described herein The "substantially identical" polypeptide is the amino of the VKOR polypeptide of SEQ ID NO: 10. At least 80% or 85% (eg 90%, 95% or 99%) identical to the acid sequence It has an amino acid sequence. For comparison, standard VKOR polypeptide lengths are generally At least 16 amino acids, eg at least 20, 25, 30, 35, 40, 45, 50 , 75 or 100 amino acids.

For polypeptide sequences that are less than 100% identical to the standard sequence, the non-identical positions are: It is not always, but preferably a conservative substitution for the standard sequence. Typical for conservative replacement The following groups are: glycine and alanine; valine, isoleucine, and leucine; Aspartic acid and glutamic acid; asparagine and glutamine; serine and treo Includes nin; lysine and arginine; and substitutions within phenylalanine and tyrosine However, it is not limited to them.

When a particular polypeptide has a particular identity (%) with a standard polypeptide of specified length If so, the identity (%) is compared to the standard polypeptide. So, for example, 1 50%, 75%, 85%, 90%, 95 relative to standard polypeptides that are 00 amino acids long Polypeptides that are% or 99% identical are 50, 75, 85 of the standard polypeptide. 50, 75, 85, 90, which is exactly the same as the 90, 95 or 99 amino acid long portion It may be a 95 or 99 amino acid polypeptide. It is a standard port over its entire length 50%, 75%, 85%, 90%, 95% or 99% identical to the repeptide 100 It may be an amino acid length polypeptide. Of course, other polypeptides also have the same criteria. Will meet.

The present invention specifically binds to the VKOR polypeptide of the present invention or a fragment thereof. Purified or isolated antibodies are also further characterized. "Specifically binding" means that the antibody is specific An antigen, such as a VKOR polypeptide, or a fragment of a VKOR polypeptide Recognizes and binds to epitopes on peptides, but substantially other molecules in the sample It means that it does not recognize and combine with. In one embodiment, the antibody is monochrome It is a null antibody, and in other embodiments, the antibody is a polyclonal antibody. Chimera anti Monochrome containing body, humanized antibody, single chain antibody, bispecific antibody, antibody fragment, etc. Methods for producing both null and polyclonal antibodies are well known in the art.

In yet another aspect, the invention features a method of detecting a VKOR polypeptide in a sample. And. The method prepares the sample under conditions that allow the formation of a complex of antibody and VKOR. Contact with an antibody that specifically binds to the VKOR polypeptide or fragment thereof The production of the Tep and the complex, if any, of the VKOR polypeptide in the sample or Includes steps to detect as detection of that fragment. Such immunoassay Are well known in the art, immunoprecipitation assays, immunoblot assays, immunolabels Includes essays, ELISA, etc.

The present invention is a method for detecting a nucleic acid encoding a VKOR polypeptide in a sample. The sample was subjected to VKOR poly under conditions under which a hybridization complex could be formed. A nucleic acid of the invention encoding a peptide or fragment thereof, or VKOR or The step of contacting the complement of the nucleic acid encoding that fragment, and thereby the sump Formation of hybridization complex to detect nucleic acid encoding VKOR in Further provides a step of detecting and a method including. Such hybridization Assays are well known in the art, probe detection assays and nucleic acid amplification assays. Is included.

The present invention contains genes related to the VKOR gene (ie, its functional homologue). The method of hand is also included. Such a method coats all or part of VKOR. Obtain a detectably labeled probe containing the isolated nucleic acid to be depleted, or its homolog. Steps to generate and use the labeled probe to create a nucleic acid fragment library, Allows hybridization of probes to nucleic acid fragments in the library And the step of screening under conditions that thereby form nucleic acid overlap sites, and if Steps to isolate labeled overlap sites, if any, and inheritance associated with the VKOR gene Full-length gene from nucleic acid fragment within any labeled overlapping site to obtain offspring Includes steps to prepare the sequence.

Another aspect of the present invention is a method of producing a vitamin K-dependent protein, which is a bita. Expressing a nucleic acid encoding a vitamin K-dependent protein in the presence of min K depends on vitamin K A step of culturing a host cell that produces a viable protein, and then depending on the vitamin K The host cell comprises vitamin K, comprising the step of removing the viable protein from the culture. The host cell contains and expresses a heterologous nucleic acid encoding a dependent carboxylase. Also contains a heterologous nucleic acid encoding Vitamin K Epoxide Reductase (VKOR), A method of expression and producing the VKOR described herein. Of the nucleic acid encoding VKOR Expression and VKOR production are at the level at which cells would be produced in the absence of VKOR. Will induce the production of high levels of vitamin K-dependent protein.

Therefore, in some embodiments, the present invention is a method of producing a vitamin K-dependent protein. There, a) The nucleic acid encoding the vitamin K-dependent protein in the cell, thereby the nucleic acid Introduced under conditions where the vitamin K-dependent protein is expressed and produced in the presence of vitamin K A heterologous step in which the cells encode a vitamin K-dependent carboxylase. Containing nucleic acids, and further containing heterologous nucleic acids encoding vitamin K epoxide reductase With Tep and b) Including the step of optionally collecting the vitamin K-dependent protein from the cells. Provides more ways to do it. Vitamin K-dependent proteins that can be produced are Factor VII and Factor VII. All combinations of Factor IX, Factor X, Protein C, Protein S and Prothrombin Including, but not limited to, currently known, or essentially later It can be any vitamin K-dependent protein identified. Nucleic acids described herein All host cells that can be transformed with are used as described herein. However, in some embodiments, non-human or even non-mammalian host cells can be used. Honmei Nucleic acid encoding vitamin K-dependent carboxylase and vitamin K-dependent as described in the detailed document Nucleic acids encoding sex proteins are well known in the art and for expressing them. Intracellular introduction will be performed according to routine protocols.

In one embodiment of the invention, the therapeutic dose of warfarin in a subject for anticoagulant therapy is previously Can be correlated with the presence of one or more single nucleotide polymorphisms in the subject's VKOR gene It is based on the discovery of the present inventors. Therefore, the present invention is an increase for warfarin. A method of identifying a human subject with increased or decreased susceptibility to the subject. It is a step to detect the presence of a single nucleotide polymorphism in the VKOR gene, and is the above-mentioned single nucleotide polymorphism. Is correlated with increased or decreased susceptibility to warfarin, thereby warfarin Those who include steps to identify subjects with increased or decreased susceptibility to allin Provide more law.

An example of an SNP correlated with increased susceptibility to warfarin is the gadget of SEQ ID NO: 8. A standard sequence containing the nom sequence and approximately 1000 nucleotides before and after this sequence, Nucleotide 2581 (SEQ ID NO: 12) of the nucleotide sequence of SEQ ID NO: 11 (VKOR remains) In Intron 2 of the Denko; GenBank Access, which is incorporated herein by reference. This is the change from G to C at the option number refSNP ID: rs8050894). This arrangement The row has the genomic position "human chromosome 16p11.2", or human chromosome 16:31 Position on the physical map in the NCBI database as 009700-31013800 The placement can be determined.

An example of an SNP correlated with reduced susceptibility to warfarin is in SEQ ID NO: 11. Nucleotide sequence nucleotide 3294 (SEQ ID NO: 13) (VKOR gene intro) In 2; GenBank accession number re, which is incorporated herein by reference. Change of T C at fSNP ID: rs2359612) and Nucleo of SEQ ID NO: 11 Nucleotide 4769 (SEQ ID NO: 14) of the tide sequence (VKOR gene 3'UTR odor) GenBank Accession Number refSNP, which is incorporated herein by reference. It is a change of G A in ID: rs7294).

Subjects with "increased susceptibility to warfarin" as used herein The subject is a normal test with a suitable therapeutic or maintenance dose of warfarin for the subject. Subjects with less than the therapeutic or maintenance dose of warfarin that would be suitable for That is, it imparts an increased susceptibility phenotype to warfarin within the VKOR gene. Subjects who did not have SNP. On the contrary, as used herein, " Subjects with "reduced susceptibility to warfarin" are warfarins for said subjects. A suitable therapeutic or maintenance dose of phosphorus would be suitable for normal subjects. Subjects above the therapeutic or maintenance dose of allin, ie, Walf within the VKOR gene Subjects who did not have an SNP that imparted a reduced susceptibility phenotype to allin To. An example of a typical therapeutic dose of warfarin for normal subjects is 35 mg per week However, this amount can vary (eg Aithal et al. (199). 9) Lancet 353: 717-719 for 3.5-420 mg per week The quantity range is listed). Typical therapeutic doses of warfarin are described herein. Can be determined for a given study according to, which can be used to exceed this dose, or Identified subjects with lower warfarin therapeutic doses, thereby compensating for warfarin Subjects with reduced or increased susceptibility can be identified.

Further herein, humans with increased or decreased susceptibility to warfarin. A method for identifying a subject, a) a walfari for the presence of a single nucleotide polymorphism in the VKOR gene. And b) said subject with steps to correlate with increased or decreased susceptibility to In step (a), the step of detecting the single nucleotide polymorphism in step (a). Steps to identify subjects with increased or decreased susceptibility to farin, Methods to include are provided.

Furthermore, the present invention is correlated with increased or decreased susceptibility to warfarin. It is a method for identifying single nucleotide polymorphisms in the VKOR gene, and a) an increase in warfarin. Steps to identify subjects with increased or decreased susceptibility and b) in said subjects Steps to detect the presence of single nucleotide polymorphisms in the VKOR gene, and c) Steps (b) ) Increases or decreases the presence of the single nucleotide polymorphism with respect to warfarin in the subject A step that correlates with susceptibility to warfarin. Is a step to identify single nucleotide polymorphisms in the VKOR gene that are correlated with reduced susceptibility To provide a method including ,.

Furthermore, in the present specification, a single nucleotide polymorphism in the subject's VKOR gene is referred to as warfarin. A method of correlating with increased or decreased susceptibility, a) increased for warfarin. Steps to identify subjects with increased or decreased susceptibility and b) in step (a) Steps to determine the nucleotide sequence of the VKOR gene in the subject, and c) step Compare the nucleotide sequence of P (b) with the wild-type nucleotide sequence of the VKOR gene. Step and d) Step (b) to detect single nucleotide polymorphisms in the nucleotide sequence And e) the single nucleotide polymorphism of step (d) in the subject of step (a). Also provided are methods that include steps that correlate with increased or decreased susceptibility to allin. To do.

Subjects were given a therapeutic dose of warfarin for anticoagulant therapy according to a well-known protocol. Alternatively, the step of establishing a maintenance dose and the therapeutic or maintenance dose for that subject. Then the average or intermediate therapeutic or maintenance dose of warfarin is calculated 1 Correlates with increased or decreased susceptibility to normal subjects in the population (eg, warfarin) Walf for anticoagulant therapy in subjects who lack SNPs in the VKOR gene For warfarin by step comparing to therapeutic or maintenance dose of warfarin It is defined whether it has increased or decreased susceptibility. The average therapeutic dose of warfarin Is a therapeutic or maintenance dose of warfarin below the maintenance dose (eg, wild-type VKOR) Lacking a gene, i.e. a single nucleotide polymorphism associated with warfarin sensitivity The dose of warfarin that is therapeutic or provides maintenance levels for the subject) Subjects with are patients identified as having increased susceptibility to warfarin. .. Warfarin treatment doses that exceed the average or maintenance dose of warfarin Subjects with maintenance doses were identified as having reduced susceptibility to warfarin Subject. Average treatment of warfarin for subjects with the wild-type VKOR gene The dose or maintenance dose will be readily determined by one of ordinary skill in the art.

Nucleotide sequences of the subject's VKOR gene are standard in the art and herein. It is determined according to the method as described in the examples provided in the document. For example, genomic DNA Was extracted from the subject's cells and the VKOR gene was identified according to a known protocol Is sequenced. Single nucleotide polymorphisms in the VKOR gene can be found in subject sequences and in the art. By comparison with a known wild-type sequence (the standard sequence shown herein as SEQ ID NO: 11). Will be identified.

SNPs within the VKOR gene have increased or decreased susceptibility to warfarin That is, a maintenance dose of warfarin above or below the average dose One SNP or multiple within the VKOR gene of a subject identified as having a therapeutic dose One or more SNs according to the steps to identify the presence of SNPs and well-known statistical analysis methods Perform a statistical analysis of the correlation between P and increased or decreased susceptibility to warfarin Correlated with increased or decreased susceptibility to warfarin by Tep .. One or more SNPs (genotypes) and increased or decreased warfarin sensitivity (phenotypes) An analysis that identifies a statistical association (eg, a significant association) with one or more SNPs in a subject Correlation between the presence of and increased or decreased susceptibility to warfarin in the subject Establish a relationship.

The combination of elements containing the presence of one or more SNPs in the subject's VKOR gene is Can be correlated with increased or decreased susceptibility to warfarin in subjects It is intended to come. Such elements include cytochrome p450 2C9 polymorphisms, people Includes, but is not limited to, species, age, gender, smoking history and liver disease.

So in another embodiment, the invention increased or decreased relative to warfarin. A method for identifying susceptible human subjects, one or more bases of the VKOR gene. Polymorphism, one or more cytochrome p450 2C9 polymorphism, race, age, gender, smoking history, liver disease And to warfarin selected from the group consisting of two or more combinations of these elements Identify the presence of a combination of factors correlated with increased or decreased susceptibility to A step in which the combination of the elements increased or decreased relative to warfarin Correlates with susceptibility, thereby increasing or decreasing susceptibility to warfarin Provided is a method comprising the step of identifying a subject having.

In addition, as used herein, babies with increased or decreased susceptibility to warfarin. A method of identifying subjects, a) the presence of a combination of elements against warfarin A step that correlates with increased or decreased susceptibility, the element being VKOR inherited. One or more single nucleotide polymorphisms in offspring, one or more cytochrome p450 2C9 polymorphisms, race, age, Selected from a group consisting of gender, smoking history, liver disease and a combination of two or more of these factors And; and b) Examine the combination of elements in step (a) in the subject. Steps to take, thereby increasing or decreasing susceptibility to warfarin A method is provided that includes a step of identifying a subject having a.

Furthermore, the present invention is correlated with increased or decreased susceptibility to warfarin. A method for identifying a combination of elements, wherein the element is one or more of the VKOR genes. Single nucleotide polymorphism, one or more cytochrome p450 2C9 polymorphism, race, age, gender, smoking history, Selected from the group consisting of liver disease and two or more combinations of these factors, a) Walf Steps to identify subjects with increased or decreased susceptibility to allin, and b) The step of detecting the presence of the combination of the elements in the subject, and c) step. The presence of a combination of elements in p (b) also increases the presence of a combination of elements for warfarin in the subject. Or a step that correlates with reduced susceptibility to warfarin. Steps to identify combinations of factors correlated with increased or decreased susceptibility, Provide a method including.

In the present specification, there is also a method of correlating a combination of elements, wherein the elements are: One or more single nucleotide polymorphisms of the VKOR gene, one or more cytochrome p450 2C9 polymorphisms, Consists of race, age, gender, smoking history, liver disease and a combination of two or more of these factors A method of choice from the group: a) Increased or decreased susceptibility to warfarin And b) the combination of the elements in the subject Step (c) step (b) the combination of the elements of step (b) and the step of identifying the existence a) Correlation with increased or decreased susceptibility to warfarin in subjects Methods including, with Tep, are also provided.

The combination of elements described herein has an increased or decreased feeling of warfarin. Steps to identify the presence of a combination of elements in subjects identified as receptive , And according to well-known statistical analysis methods, the combination of elements and the increase for warfarin By performing statistical analysis on the association with increased or decreased susceptibility Correlated with increased or decreased susceptibility to warfarin. Combination of elements Statistical association with (increased or decreased) warfarin susceptibility phenotype (eg, significant association) The analysis to identify) is the existence of a combination of elements in the subject and the wal in that subject. Establish a correlation with increased or decreased susceptibility to farin.

As used herein, nucleic acids encoding VKOR and containing one or more of the SNPs described herein Further provided. Therefore, the present invention essentially relates to SEQ ID NOs: 12, 13, 14, 15 and Containing, essentially consisting of, and / or it containing the nucleotide sequences specified in 16. Further provides a nucleic acid consisting of these. The nucleic acid may be present in the vector The ter may be present in the cell. In addition, SEQ ID NOs: 12, 13, 14, 15 and 16 A protein encoded by a nucleic acid containing the nucleotide sequence specified in, as well as the sequence. By nucleic acid containing the nucleotide sequences specified in numbers 12, 13, 14, 15 and 16. Includes antibodies that specifically bind to the encoded protein. In the following examples, the present invention Will be described in more detail, but since many modifications and modifications will be apparent to those skilled in the art, the above facts The examples are intended to be merely exemplified.

<p num="0069">Increased or decreased perception of one or more SNPs and warfarin in the VKOR gene Correlation with sex The most major isoform of the VKOR gene is about 4 kb long and has three exons. And encodes a 163 amino acid enzyme with a mass of 18.4 kDa. In this test As SNPs (46.9%, 46.8% and 46.3% heterozygous rates, respectively) Three identified mutations vk2581 (G&gt; C), vk3294 (T&gt; C) and vk 4769 (G&gt; A) to achieve their presence and therapeutic response in subjects The correlation with the maintenance dose of warfarin required for this was tested.</p><p num="0070">1. Subject selection Subjects were obtained from the UNC Coagulation Clinic in the Outpatient Care Center. Remains of training Obtained informed consent from a biography counselor. A subject who cannot speak English fluently The examiner was excluded because there was no interpreter and the requirements for consent were not met. Suitable for this test Subjects have been taking warfarin for at least 6 months to become qualified Age 18+ and follow by UNC Coagulation Clinic at Outpatient Care Clinic -It was uploaded.</p><p num="0071">2. Extraction of genomic DNA from whole blood Genomic DNA is QIAamp DNA Blood Mini Kit (QIAGE) It was extracted from the whole blood of the subject using Company N product number 51104). DNA concentration is 10ng / Adjusted to μL.</p><p num="0072">3. Sequencing genomic DNA samples Approximately 10 ng of DNA was used for the polymerase chain reaction (PCR) assay .. The primers used to amplify the VKOR gene were: 5'- Exxon 1-5'CCAATCGCCGAGTCA for UTR and Exxon 1 Region GAGG (SEQ ID NO: 29) and Exxon 1-3'CCCAGTCCCCAGCACTG TCT (SEQ ID NO: 30); exon 2-5'AGGGGAGGA for exon 2 region TAGGGTCAGTG (SEQ ID NO: 31) and Exxon 2-3'CCTGTTAGTT ACCTCCCCACA (SEQ ID NO: 32); and exon 3 and 3'-UTR regions Exxons for 3-5'ATACGTGCGTAAGCCACCAC (SEQ ID NO: 33) And Exxon 3-3'ACCCAGATATGCCCCCTTAG (SEQ ID NO: 34). Automatic high-throughput capillary electricity to detect SNPs in the VKOR gene Electrophoretic DNA sequencing was used.</p><p num="0073">4. Detection of known SNPs using real-time PCR Assay reagents for SNP genotyping is an Assay-by-Design . ) Service (Applied Biosystems, product number 4332072) ). Primers and probes (FAM and VIC dyes Signs) were designed and applied using Primer Express software. It was synthesized in a synthesizer manufactured by Biosystems. Primer pair for each SNP is S DNA cells located upstream / downstream of the NP site and less than 100 bp long in the PCR reaction Can generate rugments. FAM and VIC dye-labeled probes are 1 Designed to cover SNP sites with a length of 5-16 nt. Each VKOR SN Primer and probe sequences for P are shown in Table 2.</p><p num="0074"> In the PCR reaction, 2 × TaqMan Universal PCR Maste r Mix, No AmpErase UNG (Applied Biosystems) Company, product number 4324018) was used. 40 cycles of real-time PCR is Op Conducted onboard ticon II (MJ Research). Preheated at 95 ° C for 10 minutes Then heated at 92 ° C for 15 seconds, then heated at 60 ° C for 1 minute, after which the plate reads Was done. The results were read according to the signal values of FAM and VIC dyes.</p><p num="0075">5. Statistical analysis The difference in average dose between different genotypes is SAS version 8.0 (SAS, North Carolina). Comparison by analysis of variance (ANOVA) using Curry, Lina). Both less than 0.05 The side p-value was considered significant. Distribution and residue of mean therapeutic doses between SNP groups Tests have shown that logarithmic transformation is essential to meet the assumption of variance homogeneity. ..</p><p num="0076">6. Correlation between SNP and warfarin dose VK by direct genomic DNA sequencing and SNP real-time PCR detection Five SNPs identified within the OR gene: one within the 5'-UTR and two intron I In I, one in the coding region and one in the 3'-UTR (Table 1).</p><p num="0077"> Among these SNPs, they have the vk563 and vk4501 SNP alleles. One of the 58 subjects in this study (and also had a 3'-UTR SNP allele, three Only heavy heterozygotes), other SNPs in 17-25 heterozygous patients Was identified.</p><p num="0078"> First, each marker was analyzed individually. Figure 1A features the vk2581 wild-type allele The average warfarin dose for patients was 50.19 ± 3.20 mg per week. However (n = 26), on the other hand, for the case of heterozygotes and homozygotes for this polymorphism The amounts are 35.19 ± 3.73 (n = 17) and 31.14 ± 6.2m per week, respectively. It shows that it was g (n = 15). Figure 1B shows the vk3294 wild-type allele. Average warfarin dose for patients preparing is 25.29 ± 3.05 mg per week Patients with heterozygous and homozygous alleles, however (n = 11), 41.6 ± 84.92 (n = 25) and 47.73 ± 2.75 mg per week, respectively It shows that it was n = 22). Figure 1C shows a patient with vk4769 SNP wild type Although the average warfarin dose for individuals was 35.35 ± 4.01 mg per week (n = 27), on the other hand, patients with heterozygous and homozygous alleles each 1 week 44.48 ± 4.80 (n = 19) and 47.56 ± 3.86 mg (n = 12) per interval ) Was required. In addition, P450 2C9 * 3 was previously reported. Like (Joffe et al. (2004) "Warfarin dosing a" nd cytochrome P450 2C9 polymorphisms "Thr omb Haemost 91: 1123-1128), significant effect on warfarin dose It was also observed to have (Fig. 1D). For patients with P450 2C9 * 1 (wild type) The average warfarin dose was 43.82 ± 2.75 mg (n = 50) per week. On the other hand, patients who were heterozygous for this allele were 22.4 ± 4 per week. Needed .34 mg (n = 8).</p><p num="0079">7. Statistical analysis Log_e(Average dose of warfarin) (LnDose) and SNP in the VKOR gene Associations were tested by analysis of variance (ANOVA). VKOR using SAS first A set of factors (race) to identify factors that may affect doses other than SNPs , Gender, smoking history, liver disease, SNP with cytochrome P450 2Y9 gene, etc.) The repeating procedure was carried out. P450 2C9 * 3 is statistically significant with mean dose of warfarin It was related to; so we concluded that this is a covariant component for detailed analysis. This amount Analysis shows that when including covariates, the SNPs of the three VKORs are still worries per week. It was shown to be statistically significantly associated with farin dose (vk2581, P &lt;0.000). 1; vk3294, P &lt;0.0001; and vk4769, P = 0.0041).</p><p num="0080"> Find out more about whether VKOR's three SNPs are independently associated with warfarin dose Two SNPs in the VKOR gene are included as covariates with other SNPs to test The analysis was repeated. The three VKOR SNPs were located within a distance of 2 kb from each other Therefore, it is expected to be closely linked. From inspection, at least for Caucasians, 1 Two haplotypes (guanine if A = vk2581 and a = vk2581) Cytosine; thiamine at B = vk3294 and cytosine at b = vk3924 Guanine for C = vk4769 and adenine for c = vk4769) is AAbbcc It was clear that the other was aaBBCC. Minutes of individual SNPs in patients Cloth was found to be statistically significantly correlated with other SNPs (R = 0.63 ~ 0. 87, p &lt;0.001). In fact, subjects (n = 7) with the haplotype AAbbcc , Warfarin dose in patients with haplotype aaBBCC (25.29 ± 3.05; p Warfarin dose significantly higher than &lt;0.001) (warfarin dose = 48.98) ± 3.93) was required.</p>

<p num="0081">siRNA design and synthesis siRNA is the latest version of rational design algorithms (Reynolds et al. (2004) "Rational siRNA design for RNA" interference "Nature Biotechnology 22: 326 Selected using -330). 4 s with the highest score for each of the 13 genes Select iRNA overlap sites and perform BLAST search using Human EST database carried out. Unrelated sequences to minimize the possibility of inaccurate silencing effects Only sequence targets with 4 or more mismatches were selected (Jackson et. al. (2003) "Expression profiling reveals o ff --target gene regulation by RNAi "Nat" Biotechnol 21: 635-7). All overlapping parts are 2'-ACE chem istry (Scaringe (2000) "Advanced 5'-silyl-2" '-orthoester approach to RNA oligonucleo tide synthesis "Methods Enzymol 317: 3-18) Dharmacon as a 21-mer with a UU overhang using a variant of Synthesized in Lafayette, Lorad), AS strands ensure maximum activity Chemically phosphorylated (Martinez et al. (2002) "Single" -stranded antisense siRNAs guide target RNA cleavage in RNAi "Cell 110: 563-74).</p>

<p num="0082">siRNA transfection The transfection was essentially previously described with only minor changes. It was a cage (Harborth et al. (2001) "Identificat" ion of essential genes in cultured mamma lian cells using small interfering RNAs " J Cell Sci 114: 4557-65).</p>

<p num="0083">Assay for VKOR activity Trypsinize siRNA-transfected A549 cells and use cold PBS 2 Washed twice. 1.5 x 10 for each VKOR assay⁷The cells were collected. 200 μL buffer D (250 mM Na)₂HPO₄-NaH₂PO₄, 500mM KCl, Add 20% glycerol and 0.75% CHAPS, pH 7.4) to cell pellets Then, the cell lysate was sonicated. Assay lysed microsomes For the purpose of microsomes (Lin et al. (2002) "The putativ" e vitamin K-dependent gamma-glutamyl car boxylase internal propeptide appears to be the propeptide binding site "J Biol Ch 2 × 10 as described in em 277: 28584-91)⁹Prepared from cells We used 10-50 μL of lysed microsomes for each assay. Vitamin K Epoxide was added to the concentration shown in the description of the figure and DTT was added to 4 mM to initiate the reaction. I let you. Incubate the reaction mixture at 30 ° C for 30 minutes under yellow light to 500 μL. 0.05M AgNO₃: Stop the reaction by adding isopropanol (5: 9) I let you. Add 500 μL of hexane and vortex the mixture vigorously for 1 minute. Vitamin K and KO were extracted by kissing. After centrifugation for 5 minutes, there is an upper layer Transfer the machine layer to a 5 mL brown vial and N₂Was dried using. 150 μL HPLC battery Vitamin with the addition of buffer, acetonitrile: isopropanol: water (100: 7: 2) Dissolve K and KO and sample the AC-18 column (Vydac, product number 21) 8TP54) Analyzed by HPLC on.</p>

<p num="0084">RT-qPCR (reverse transcriptase quantitative PCR) 1x10⁶Wash cells twice with PBS, manufacturer (Invitrogen) professional Total RNA was isolated using Trizol reagent according to Tocol. RQ1 DNase 1 μg of RNA was digested and heat inactivated by l (Promega). M-MLV reverse transcriptase First strand cDNA was prepared using the element (Invitrogen). Dy cDNA Mixed with NAmo SYBR Green qPCR premix (Finnzymes) Opticon II PCR Thermal Cycler (MJ Research) Real-time PCR was performed using. The following primers were used: 13124769-5'(F): (TCCAACAGCATATTCGGTTGC, array Number 1); 13124769-3 (R)': (TTCTTGGACCTTCCGGAAACT, sequence Number 2); GAPDH-F: (GAAGGTGAAGGTCGGAGTC, SEQ ID NO: 3); GAPDH-R: (GAAGATGGTGATGGGATTTC, SEQ ID NO: 4); Lamin-RT-F: (CTAGGTGAGGCCAAGAAGCAA, SEQ ID NO: 5) and Lamin-RT-R: (CTGTTCCTCTCAGCAGACTGC, SEQ ID NO: 6) ..</p>

<p num="0085">Overexpression of VKOR in Sf9 insect cell line The cDNA for the mGC11276 coding region is (Li et al. (2). 000) "Identification of a Drosophila vita min K-dependent gamma-glutamyl carboxyla se J Biol Chem 275: 18291-6), as described in PVL13 with HPC4 tag (EDQVDPRLIDGK, SEQ ID NO: 7) at the mino end It was cloned into 92 (Pharmingen) and expressed in Sf9 cells.</p>

<p num="0086">Gene selection Search for the VKOR gene is between the markers D16S3131 and D16S419. Concentrated on chromosome 16. This region is chromosome 1 at 50cM to 65cM on the genetic map. Matches number 6 and 26-46.3 Mb on the physical map. 190 predictions in this area Coding sequence for BLASTX search of NCBI non-redundant protein database Therefore, it was analyzed. Orthologs from their human genes and related species with known functions Was excluded. Since VKOR appears to be a transmembrane protein (Carlisle &amp; Suttie (1980) "Vitamin K dependent carbox ylase: subcellular location of the carbox ylase and enzymes involved in vitamin K metabolism in rat liver "Biochemistry 19: 1161-7), transliterate the remaining genes according to the cDNA sequence in the NCBI database Translated, programs TMHMM and TMAP (Biology Work Bench) , San Diego Supercomputer System) And predicted to have a transmembrane domain. Endogenous membrane protein for subsequent analysis We selected 13 genes that were predicted to encode.</p>

<p num="0087">Screening of cell lines for VKOR activity This method identifies cell lines that express high levels of VKOR activity and uses siRNAs throughout. It was for systematically knocking down 13 candidate genes. 21 ~ 23 Nukure SiRNA, a double-stranded RNA of ochide, causes specific RNA degradation in cell culture Has been proven (Hara et al. (2002) "Raptor, a bi" nding partner of target of rapamycin (TOR) ), Mediates TOR action "Cell 110: 177-89; Kr ichevsky &amp; Kosik (2002) "RNAi functions in cultured mammalian neurons "Proc Natl Ac ad Sci USA 99: 11926-9; Burns et al. (2003) "Silencing of the Novel p53 Target Gene Snk / Plk2 Leads to Mitotic Catastrophe in Paclitaxel (Taxol)-Exposed Cells "Mol Cel l Biol 23: 5556-71). However, large screens in mammalian cells Application of siRNA for lactation provides a functional target for specific mammalian cell mRNA Not previously reported due to its difficulty in identification (Holen et al. (2003) "Similar behavior of single-stran d and double-strand siRNAs suggests they act through a common RNAi pathway "Nucle ic Acids Res 31: 2401-7). Reasonable selection for siRNA design Development of Choice Algorithm (Reynolds et al.) Develops Specific SiRNA Increase the likelihood of being able to; in addition, pool four reasonably selected siRNAs This can increase the probability of success. For previously unidentified genes Using siRNA to search for more than one VKOR activity due to activity To determine the loss of enzyme activity, even when the product of the above gene is required , Screening still has the advantage of being effective.</p><p num="0088"> Warfarin-sensitive VKs screened for 15 cell lines and sufficient for easy measurement A human lung cancer cell line A549 showing OR activity was identified. Almost no VKOR activity is expressed The second human colorectal carcinoma cell line, HT29, was used as standard.</p>

<p num="0089">Inhibition of VKOR activity by siRNA in A549 cells Each of the 13 pools of siRNA was transfected into A549 cells three times, 72 After hours, VKOR activity was assayed. Special for gene gi: 13124769 One heterogeneous siRNA pool increased VKOR activity by 64% in 8 individual assays ~ It was reduced to 70% (Fig. 2).</p><p num="0090"> After 72 hours, VKOR activity was inhibited by only about 35% of its initial activity. One possible reason for this is that the half-life of mammalian proteins varies widely (minutes). From to several days) (Zhang et al. (1996) "The major ca lpain isozymes are longlived proteins.De sign of an antisense strategy for calpai n depletion in cultured cells "J Biol Che m 271: 18825-30; Bohley (1996) "Surface hydr" ophobicity and intracellular degradation of proteins "Biol Chem 377: 425-35; Dice &amp; Goldberg (1975) "Relationship between in in vivo degradative rates and isoelectric p oints of proteins "Proc Natl Acad Sci USA 72: 3893-7), and mRNA translation is inhibited, but enzyme activity is not. There is. For this reason, cells are retained throughout the 11 days and their VKOR activity is tracked. Ta. Figure 3 shows the normal levels of mRNA for gi: 13124769 mRNA. Shows a rapid decrease to about 20%, while a persistent decrease in VKOR activity during this period ing. This decrease in activity is the level of VKD carboxylase activity and Lami n General action of siRNA or cells as A / C mRNA remained constant Not the result of death. In addition, gi: 132124769 mRNA levels are high VK A quarter of HT-29 cells with lower VKOR activity than A549 cells showing OR activity It is 1. These data indicate that gi: 13124769 matches the VKOR gene. Is shown.</p>

<p num="0091">Identification of the gene encoding VKOR The gene IMAGE 3455200 (g) identified herein as encoding VKOR i: 13124769, SEQ ID NO: 8) is human chromosome 16p11.2, mouse chromosome 7F. Located at 3, and rat chromosome 1: 180.8Mb. 7 in the NCBI database There are 338 cDNA clones representing the splicing pattern of the species (NCBI) AceView program). These consist of all or part of 2 to 4 exons Made. The most important isoform of these, mGC11276, has three ecs. It has son cubano and is expressed at high levels in lung and hepatocytes. These three exon transcripts The product (SEQ ID NO: 9) is a predicted tampa consisting of 163 amino acids with a mass of 18.2 kDa. Code the quality (SEQ ID NO: 10). This depends on the program used for the prediction And a putative N-myristylated endoplasmic reticulum protein with 1 to 3 transmembrane domains To. This is consistent with the observation that enzyme activity depends on thiol reagents, seven cis. Has TEIN residues (Thijssen et al. (1994) "Microsom al lipoamide reductase provides vitamin K epoxide reductase with reducing equiva lents "Biochem J 297: 277-80). 5 out of 7 cysteines , Human, mouse, rat, zebrafish, Xenopus (Xenopus) And are preserved among Anopheles (Anopheles).</p><p num="0092"> To confirm that the VKOR gene was identified, the most important form of the enzyme ( 3 exons) Spodoptera frugiperda (Spodoptera frugiperda), Sf9 It was expressed intracellularly. Sf9 cells do not have measurable VKOR activity, but mGC1 When transfected with 1276 cDNA, it exhibits warfarin-sensitive activity ( Figure 4). VKOR activity is epitomic at either their amino or carboxyl ends Observed from structures with loop tags. This tag may be involved in the purification of VKOR U.</p><p num="0093"> VKOR should be warfarin sensitive and therefore express VKOR Sf Microsomes were generated from 9 cells and tested for warfarin sensitivity. VKOR activity Is warfarin sensitive (Fig. 5).</p><p num="0094"> In summary, the present invention siR in mammalian cells to identify unknown genes. The first example of using NA is provided. VKOR gene identity is associated with expression in insect cells Therefore, it was confirmed. The VKOR gene encodes several isoforms. Each isopho It will be important to characterize the activity and expression patterns of the worm. Millions of people around the world Warfarin is used to inhibit coagulation. This makes it safer and more effective Learn more about VKOR as it can result in more accurate dose setting or design of anticoagulants It is important to characterize.</p><p num="0095"> The above is an example of the present invention and should not be considered as limiting it. The present invention is a book Limited by the accompanying claims, along with the equivalent of the claims to be included in the specification.</p><p num="0096"> All publications, patent applications, patents, patent gazettes and other references mentioned herein. Is an important teaching for the text and / or paragraph in which the bibliography is presented. It is incorporated as a whole by referring to it.</p><p num="0097"><tables num="1"><img id="000002" he="194" wi="132" file="JP5840539B2_D0001.tif" img-format="tif" img-content="drawing" /></tables></p><p num="0098"><tables num="2"><img id="000003" he="244" wi="103" file="JP5840539B2_D0001.tif" img-format="tif" img-content="drawing" /></tables></p>