Cells coexpressing vitamin K reductase and vitamin K dependent protein and use thereof to improve the productivity of said vitamin K dependent protein

ES 2 339 710 T3

DESCRIPTION

Cells that co-express vitamin K reductase and vitamin K-dependent protein and their use to improve the productivity of said vitamin K-dependent protein.

Field of the invention

The present invention relates to isolated nucleic acids, to host cells containing the same, and to methods of using the same, as well as to methods for enhancing the productivity of vitamin K-dependent protein expression in a cell.

Background of the invention

The function of numerous proteins requires the modification of multiple glutamic acid residues to γ-carboxyglutamate. Among these, the vitamin K-dependent clotting proteins (VKD), FIX (Christmas factor), FVII, and prothrombin are the best known. The observation that inactivation of the matrix Gla protein gene results in calcification of mouse arteries (Luo et al. (1997) "Spontaneous calcification of arteries and cartilage in mice lacking matrix GLA protein" Nature 386: 78-81) emphasizes the importance of the vitamin K cycle for proteins with functions other than coagulation. In addition, Gas6 and other Gla proteins of unknown function are expressed in neural tissue, and exposure to warfarin in utero results in mental retardation and facial abnormalities. This is consistent with the observation that the expression of VKD carboxylase, the enzyme that achieves Gla modification, is temporally regulated in a highly expressed tissue-specific manner in the nervous system during early embryonic phases. Simultaneously with carboxylation, the reduced vitamin K, a cosubstrate of the reaction, is converted to vitamin K epoxide. Because the amount of vitamin K in the human diet is limited, vitamin K epoxide must be converted back to vitamin K by vitamin K epoxide reductase (VKOR) to avoid depletion. Warfarin, the most widely used anticoagulant drug, targets VKOR and prevents regeneration of vitamin K. The consequence is a decrease in the reduced vitamin K concentration, resulting in a reduced rate of carboxylation by γ-glutamyl carboxylase and the production of undercarboxylated vitamin K-dependent proteins.

In the United States alone, warfarin is prescribed to more than one million patients a year and in the Netherlands, approximately 2% of the population has been reported to be receiving long-term warfarin therapy. Because the dose of warfarin required for a therapeutic level of anticoagulation varies greatly between patients, the use of warfarin is accompanied by a significant risk of side effects. For example, major bleeding episodes have been reported after initiation of warfarin in 1-2% of patients and death in 0.1-0.7% of patients. Despite the dangers, it has been estimated that the use of warfarin can prevent 20 strokes per episode of induced bleeding and is probably being used less than it should because of fear of induced bleeding.

Summary of the invention

The present invention provides a transformed cell selected from:

a) a cell comprising a nucleic acid encoding a vitamin K epoxide reductase (VKOR) and an antisense nucleic acid that inhibits VKOR function;

b) a cell comprising a nucleic acid encoding a vitamin K epoxide reductase (VKOR) and siRNA which inhibits VKOR function;

c) a cell comprising an antisense nucleic acid that inhibits the function of vitamin K epoxide reductase (VKOR); or

d) a cell comprising a siRNA that inhibits the function of vitamin K epoxide reductase (VKOR).

Preferably, the transformed cell is either prokaryotic or eukaryotic.

A further aspect of the invention is a cell that contains and expresses a recombinant nucleic acid comprising a nucleic acid that encodes a vitamin K epoxide reductase operably associated with a heterologous promoter.

A further aspect of the invention is a method for improving the productivity of vitamin K-dependent protein expression in a host cell, comprising the steps of:

(a) introducing into a host cell a nucleic acid encoding a vitamin K-dependent protein;

ES 2 339 710 T3 (b) introducing into the host cell a recombinant nucleic acid encoding a vitamin K epoxide reductase (VKOR) and a recombinant nucleic acid encoding a vitamin K-dependent carboxylase; and (c) expressing the nucleic acids of steps (a) and (b).

A still further aspect of the invention is a method for improving the productivity of vitamin K-dependent protein expression in a host cell, comprising the steps of:

(a) providing a host cell that expresses a nucleic acid encoding a vitamin K-dependent protein;

(b) introducing a recombinant nucleic acid encoding a vitamin K epoxide reductase (VKOR) into the host cell and a recombinant nucleic acid encoding a vitamin K-dependent carboxylase; and (c) expressing the nucleic acids of steps (a) and (b).

A still further aspect of the invention is a method for improving the productivity of vitamin K-dependent protein expression in a host cell, comprising the steps of:

(a) providing a host cell that expresses a heterologous nucleic acid encoding a vitamin K epoxide reductase (VKOR);

(b) introducing a nucleic acid encoding a vitamin K-dependent protein into the host cell and a nucleic acid encoding a vitamin K-dependent carboxylase; and (c) expressing the nucleic acids of steps (a) and (b).

Preferably, in the methods of the invention, the nucleic acid encoding the vitamin K-dependent protein is selected from the group comprising factor VII, factor IX, factor X, prothrombin, protein C, and protein S.

Also described is a method of preparing a vitamin K-dependent protein which comprises culturing a host cell that expresses a nucleic acid that encodes a vitamin K-dependent protein in the presence of vitamin K and produces a vitamin K-dependent protein, and then collecting the vitamin K-dependent protein from the culture, the host cell containing and expressing a heterologous nucleic acid encoding a vitamin K-dependent carboxylase, and the host cell further containing and expressing a heterologous nucleic acid encoding a vitamin K epoxide reductase (VKOR) and producing VKOR as described herein.

Brief description of the drawings

Figure 1. For each of the 13 siRNA pools, three T7 flasks containing A549 cells were transfected and VKOR activity was determined after 72 h. 25 pM vitamin K epoxide was used in the VKOR assay. A set of siRNAs specific for the gi gene: 13124769 reduced VKOR activity by 64% -70% in eight repeats.

Figure 2. Time course of inhibition of VKOR activity by the siRNA pool specific for gi: 13124769 in A549 cells. VKOR activity decreased continuously during this time period while its mRNA level rapidly decreased to approximately 20% of normal. 25 µΜ vitamin K epoxide was used for this assay. SiRNA did not affect VKD carboxylase activity or lamin A / C mRNA level.

Figure 3. VKOR activity was detected when mGC_11276 was expressed in Sf9 insect cells. ~ 1X10 were used⁶cells in this assay. Reactions were performed using 32 µ 32 KO at 30 ° C for 30 minutes in buffer D. White Sf9 cells served as negative control and A549 cells as reference.

Figure 4. Inhibition of VKOR by warfarin. The reactions were carried out using 1.6 mg of microsomal proteins prepared from VKOR_Sf9, KO 60 μ células cells and various concentrations of warfarin at 30 ° C for 15 minutes in buffer D.

Detailed description of the invention

As used herein, "a", "an" or "the" can mean one or more than one. For example, "one" cell can mean a single cell or a multiplicity of cells.

ES 2 339 710 T3

The present invention is explained in more detail below. The description is not intended to be a detailed catalog of all the different ways in which the invention can be practiced, or all the features that can be added to the present invention. For example, features illustrated with respect to one embodiment can be incorporated into other embodiments, and features illustrated with respect to a particular embodiment can be removed from that embodiment. Furthermore, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the present disclosure that do not depart from the present invention. Therefore, the following specification is intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations, and variations thereof.

The "sequence listing" appended hereto forms a part of the present specification as if fully set forth therein.

The present invention can be carried out based on the present disclosure and further utilizing methods, components, and features known in the art, including but not limited to those described in US Patent No. 5,268,275 issued to Stafford and Wu and US Patent No. 6,531,298 issued to Stafford and Chang.

As used herein, "nucleic acids" encompass both RNA and DNA, including cDNA, genomic DNA, synthetic DNA (eg, chemically synthesized), and RNA and DNA chimeras. The nucleic acid can be double-stranded or single-stranded. When single stranded, the nucleic acid can be a sense strand or an antisense strand. Nucleic acid can be synthesized using oligonucleotide analogs or derivatives (eg, phosphorothioate or inosine nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids that have altered base-pairing capabilities or increased nuclease resistance.

An "isolated nucleic acid" is DNA or RNA that is not immediately contiguous with both coding sequences with which it is immediately continuous (one at the 5 'end and one at the 3' end) in the naturally occurring genome of the organism from which it is derived. Thus, in one embodiment, an isolated nucleic acid includes some or all of the 5 'non-coding sequences (eg, the promoter) that are immediately contiguous to the coding sequence. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector, an autonomously replicating virus or plasmid, or the genomic DNA of a prokaryote or eukaryote, or that exists as a separate molecule (for example, a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease treatment), independent of other sequences. It also includes a recombinant DNA that is part of a hybrid gene that codes for an additional polypeptide sequence.

The term "isolated" can refer to a nucleic acid or polypeptide that is substantially free of cellular material, viral material, or culture medium (when produced by recombinant DNA techniques), or chemical precursors or other chemicals (when chemically synthesized ). Furthermore, an "isolated nucleic acid fragment" is a nucleic acid fragment that does not occur naturally as a fragment and would not be found in the natural state.

The term "oligonucleotide" refers to a nucleic acid sequence of at least about six nucleotides to about 100 nucleotides, for example, from about 15 to 30 nucleotides, or from about 20 to 25 nucleotides, that can be used, for example, as primer in a PCR amplification or as a probe in a hybridization assay or on a microarray. The oligonucleotides can be natural or synthetic, eg, DNA, RNA, modified backbones, etc.

When a particular nucleotide sequence is said to have a specific percent identity to a reference nucleotide sequence, the percent identity is relative to the reference nucleotide sequence. For example, a nucleotide sequence that is 50%, 75%, 85%, 90%, 95%, or 99% identical to a reference nucleotide sequence that is 100 bases in length can be 50, 75, 85, 90 , 95 or 99 bases that are completely identical to a 50, 75, 85, 90, 95 or 99 nucleotide sequence of the reference nucleotide sequence. The nucleotide sequence can also be a 100 base long nucleotide sequence that is 50%, 75%, 85%, 90%, 95%, or 99% identical to the reference nucleotide sequence throughout its entirety. length. Of course, there are other nucleotide sequences that will meet the same criteria as well.

A nucleic acid sequence that is "substantially identical" to a VKOR nucleotide sequence is at least 80%, 85%, 90%, 95%, or 99% identical to the nucleotide sequence of SEQ ID NO: 8 or 9 For nucleic acid comparison purposes, the length of the reference nucleic acid sequence will generally be at least 40 nucleotides, eg, at least 60 nucleotides or more nucleotides. Sequence identity can be measured using sequence analysis software (eg, sequence analysis software package from the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705).

As is known in the art, several different programs can be used to identify whether a nucleic acid or amino acid has sequence similarity or identity to a known sequence. Sequence similarity or identity can be determined using standard techniques known in the art, including, but not limited to, the local sequence identity algorithm of Smith and Waterman, Adv. Appl. Math. 2, 482 (1981), by means of the

ES 2 339 710 T3 sequence identity alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48,443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85, 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA and TFASTA in the software package of Wisconsin Genetics, Genetics Computer Group, 575 Science Drive, Madison, WI), the sequence program Best Fit described by Devereux et al., Nucl. Acid Res. 12, 387-395 (1984), preferably using the default parameters, or by inspection.

An example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. You can also graphically represent a tree showing the grouping relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng and Doolittle, J. Mol. Evol. 35, 351-360 (1987); the method is similar to that described by Higgins and Sharp, CABIOS 5, 151-153 (1989).

Another example of a useful algorithm is the BLAST algorithm, described in Altschul et al., J. Mol. Biol. 215, 403-410, (1990) and Karlin et al., Proc. Natl. Acad. Sci. USA 90, 5873-5787 (1993). A particularly useful BLAST program is the WU-BLAST-2 program obtained from Altschul et al., Methods in Enzymology, 266, 460-480 (1996). WUBLAST-2 uses several search parameters, which are preferably set to the default values. The parameters are dynamic values ​​and are set by the program itself depending on the composition of the particular sequence and the composition of the particular database in which the sequence of interest is being searched; however, the values ​​can be adjusted to increase sensitivity. A further useful algorithm is gapped BLAST as reported by Altschul et al. Nucleic Acids Res. 25, 3389-3402.

The CLUSTAL program can also be used to determine sequence similarity. This algorithm is described by Higgins et al. (1988) Gene 73: 237; Higgins et al. (1989) CABIOS 5: 151-153; Corpet et al. (1988) Nucleic Acids Res. 16: 10881-90; Huang et al. (1992) CABIOS 8: 155-65; and Pearson et al. (1994) Meth. Mol. Biol. 24: 307-331.

Furthermore, for sequences containing either more or fewer nucleotides than the nucleic acids described herein, it is understood that in one embodiment, the percent sequence identity will be determined based on the number of identical nucleotides relative to the number total nucleotide bases. Thus, for example, the sequence identity of sequences shorter than a sequence specifically disclosed herein will be determined using the number of nucleotide bases in the shorter sequence, in one embodiment. In percent identity calculations, no relative weight is assigned to various manifestations of sequence variation, such as insertions, deletions, substitutions, etc.

VKOR polypeptides are not limited to recombinant polypeptides, synthetic peptides, and natural polypeptides. The invention also describes nucleic acid sequences that encode forms of VKOR polypeptides in which naturally occurring amino acid sequences are altered or deleted. Preferred nucleic acids encode polypeptides that are soluble under normal physiological conditions. Also described are nucleic acids that encode fusion proteins in which all or part of VKOR is fused with an unrelated polypeptide (eg, a marker polypeptide or a fusion partner) to create a fusion protein. For example, the polypeptide can be fused with a hexa-histidine tag to facilitate purification of bacterially expressed polypeptides, or with a hemagglutinin tag to facilitate purification of polypeptides expressed in eukaryotic cells, or with an HPC4 tag to facilitate purification of polypeptides by affinity chromatography or immunoprecipitation. Isolated polypeptides (and the nucleic acids encoding these polypeptides) that include a first part and a second part; the first part includes, for example, all or part of a VKOR polypeptide, and the second part includes, for example, a detectable marker.

The fusion partner can be, for example, a polypeptide that facilitates secretion, for example, a secretory sequence. Such a fused polypeptide is commonly referred to as a preprotein. The secretory sequence can be cleaved by the cell to form the mature protein. Also described are nucleic acids encoding VKOR fused to a polypeptide sequence to produce an inactive preprotein. Preproteins can be converted to the active form of the protein by removing the inactivating sequence.

Also described are nucleic acids that hybridize, for example, under stringent hybridization conditions (as defined herein) with all or part of the nucleotide sequence of SEQ ID NOS: 1-6, 8 or 9 or its accessories. In particular embodiments, the hybridization portion of the hybridizing nucleic acid is typically at least 15 (eg, 20, 30, or 50) nucleotides in length. The hybridizing part of the hybridizing nucleic acid is at least 80%, for example, at least 95%, at least 98% or 100% identical to the sequence of a part or all of a nucleic acid that encodes for a VKOR polypeptide. Hybridizing nucleic acids of the type described herein can be used, for example, as a cloning probe, primer (eg, PCR primer), or diagnostic probe. Also included within the invention are small inhibitory RNAs (siRNAs) and / or antisense RNAs that inhibit VKOR function, as determined, for example, in an activity assay, as described herein and as is known in the art.

In another embodiment, the invention features cells, eg, transformed cells, that contain a nucleic acid of this invention. A "transformed cell" is a cell into which (or an ancestor of which) a nucleic acid encoding all or part of the nucleic acid has been introduced by means of recombinant nucleic acid techniques.

ES 2 339 710 T3 of a VKOR polypeptide, and / or an antisense nucleic acid or siRNA. Both prokaryotic and eukaryotic cells are included, for example, from bacteria, yeast, insects, mice, rats, humans, plants, and the like.

Also described are nucleic acid constructs (eg, vectors and plasmids) that include a nucleic acid of the invention that is operably linked to transcriptional and / or translational control elements to allow expression, eg, expression vectors. By "operably linked" is meant that a selected nucleic acid, eg, a DNA molecule encoding a VKOR polypeptide, is positioned adjacent to one or more regulatory elements, eg, a promoter that directs transcription and / or translation. of the sequence so that regulatory elements can control the transcription and / or translation of the selected nucleic acid.

Also described are fragments or oligonucleotides of the nucleic acids, which can be used as primers or probes. Thus, in some embodiments, a fragment or oligonucleotide of this invention is a nucleotide sequence that has at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 , 80, 85, 90, 100, 125, 150, 175, 200, 250, 300, 350,400,450, 500, 550, 600, 650, 700,750, 800, 850, 900, 1000, 1500, 2000, 2500 or 3000 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 8 or SEQ ID NO: 9. Examples of oligonucleotides of this invention are provided in the sequence listing included herein. Such fragments or oligonucleotides can be detectably modified or labeled, eg, to include and / or incorporate a restriction enzyme cleavage site when used as a primer in an amplification assay (eg, PCR).

Also described are purified or isolated VKOR polypeptides, such as, for example, a polypeptide comprising, consisting essentially of and / or consisting of the amino acid sequence of SEQ ID nO: 10 or a biologically active peptide or fragment thereof. . Such fragments or peptides typically have at least about ten amino acids from the amino acid sequence of SeQ ID NO: 10 (eg, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 75, 85, 95, 100, 125 or 150 amino acids of the amino acid sequence of SEQ ID NO: 10) and may be peptides or a contiguous amino acid fragment of the amino acid sequence of the VKOR protein (for example, as set forth in SEQ ID NO: 10). The biological activity of a fragment or peptide of this invention can be determined according to the methods provided herein and as known in the art to identify VKOR activity. The VKOR protein fragments and peptides of this invention may also be active as antigens for the production of antibodies. The identification of epitopes in a fragment or peptide of this invention is carried out by well known protocols and would be within the knowledge of one of ordinary skill in the art.

As used herein, both "protein" and "polypeptide" mean any chain of amino acids, regardless of length or post-translational modification (eg, glycosylation, phosphorylation, or N-myristylation). Thus, the term "VKOR polypeptide" includes full-length, naturally-occurring VKOR proteins, respectively, as well as recombinantly or synthetically produced polypeptides that correspond to a full-length, naturally-occurring VKOR protein. , or to a part of a naturally or synthetic VKOR polypeptide.

A "purified" or "isolated" polypeptide or compound is a composition that has at least 60% by weight of the compound of interest, for example, an antibody or VKOR polypeptide that is separate or substantially free of at least some of the other components. from the virus or naturally occurring organism, for example, the viral or cellular structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide. As used herein, the "isolated" polypeptide is at least about 25%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98 %, 99% or more pure (w / w). Preferably, the preparation has at least 75% (eg, at least 90% or 99%) by weight of the compound of interest. Purity can be measured by any appropriate conventional method, eg, column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

Preferred VKOR polypeptides include a sequence substantially identical to all or a portion of a naturally occurring VKOR polypeptide. Polypeptides "substantially identical" to the VKOR polypeptide sequences described herein have an amino acid sequence that is at least 80% or 85% (eg, 90%, 95%, or 99%) identical to the sequence. of amino acids of the VKOR polypeptides of SEQ ID NO: 10. For comparison purposes, the length of the reference VKOR polypeptide sequence will generally be at least 16 amino acids, eg, at least 20, 25, 30, 35, 40, 45, 50, 75, or 100 amino acids.

In the case of polypeptide sequences that are less than 100% identical to a reference sequence, non-identical positions are preferably, but not necessarily, conservative substitutions for the reference sequence. Conservative substitutions typically include, but are not limited to, substitutions within the following groups: glycine and alanine; valine, isoleucine, and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine.

When a particular polypeptide is said to have a specific percent identity to a reference polypeptide of a defined length, the percent identity is relative to the reference polypeptide. Thus, for example, a polypeptide that is 50%, 75%, 85%, 90%, 95%, or 99% identical to a reference polypeptide that is 100 amino acids in length may be a 50, 75, 85 polypeptide. , 90, 95 or 99 amino acids

ES 2 339 710 T3 which is completely identical to a 50, 75, 85, 90, 95 or 99 amino acid long portion of the reference polypeptide. It can also be a 100 amino acid long polypeptide that is 50%, 75%, 85%, 90%, 95%, or 99% identical to the reference polypeptide throughout its length. Of course, other polypeptides will meet the same criteria as well.

A further aspect of the present invention is a method of preparing a vitamin K-dependent protein which comprises culturing a host cell that expresses a nucleic acid encoding a vitamin K-dependent protein in the presence of vitamin K and produces a vitamin K-dependent protein. vitamin K, and then collect the vitamin K-dependent protein from the culture, the host cell containing and expressing a heterologous nucleic acid encoding vitamin K-dependent carboxylase, and the host cell further containing and expressing a heterologous nucleic acid encoding vitamin K epoxide reductase (VKOR) and producing VKOR as described in This document. Expression of the nucleic acid encoding VKOR and production of VKOR causes the cell to produce higher levels of the vitamin K-dependent protein than it would in the absence of VKOR.

Thus, in some embodiments, the present invention also provides a method of producing a vitamin K-dependent protein, comprising:

a) introducing into a cell a nucleic acid encoding a vitamin K-dependent protein under conditions whereby the nucleic acid is expressed and the vitamin K-dependent protein is produced in the presence of vitamin K, wherein the cell comprises a heterologous nucleic acid encoding vitamin K-dependent carboxylase and further comprises a heterologous nucleic acid encoding vitamin K epoxide reductase; Y

b) optionally harvesting the vitamin K-dependent protein from the cell. The vitamin K-dependent protein that can be produced can be any vitamin K-dependent protein now known or identified below as such, including but not limited to factor VII, factor IX, factor X, protein C, protein S, and prothrombin, in any combination. Any host cell that can be transformed with the disclosed nucleic acids can be used as described herein, although non-human or even non-mammalian host cells can be used in some embodiments. Nucleic acids encoding vitamin K-dependent carboxylase and nucleic acids encoding vitamin K-dependent proteins as described herein are well known in the art and their introduction into cells for expression would be carried out according to routine protocols.

The present invention is more particularly described in the following examples which are intended to be illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art.

Examples

Example 1

SiRNA design and synthesis

SiRNAs were selected using an advanced version of a rational design algorithm (Reynolds et al. (2004) "Rational siRNA design for RNA interference" Nature Biotechnology 22: 326-330). For each of the 13 genes, four siRNA duplexes with the highest scores were selected and a BLAST search was performed using the Human EST database. To minimize the potential for off-target silencing effects, only those sequence targets with more than three mismatches were selected against unrelated sequences (Jackson et al. (2003) "Expression profiling reveals off-target gene regulation by RNAi" Nat Biotechnol 21: 635-7). All duplexes were synthesized at Dharmacon (Lafayette, CO) as 21-mer with UU projections using a modified 2'-ACE chemistry method (Scaringe (2000) “Advanced 5'-silyl-2'-orthoester approach to RNA oligonucleotide synthesis ”Methods Enzymol 317: 3-18) and the AS chain was chemically phosphorylated to guarantee maximum activity (Martínez et al. (2002)“ Single-stranded antisense siRNAs guide target RNA cleavage in RNAi ”Cell 110: 563-74) .

Example 2

SiRNA transfection

Transfection was essentially as previously described (Harborth et al. (2001) "Identification of essential genes in cultured mammalian cells using small interfering RNAs" J Cell Sci 114: 4557-65) with minor modifications.

ES 2 339 710 T3

Example 3

VKOR Activity Assay

SiRNA transfected A549 cells were trypsinized and washed twice with cold PBS. 1.5x10 were taken⁷cells for each VKOR assay. 200 µl of buffer D (250 mM Na2HPO4-NaH2PO4, 500 mM KCl, 20% glycerol and 0.75% CHAPS, pH 7.4) was added to the cell pellet, followed by sonication of the cell lysate. For assays of solubilized microsomes, microsomes were prepared from 2x10⁹ cells as described (Lin et al. (2002) "The putative vitamin K-dependent gamma-glutamyl carboxylase internal propeptide appears to be the propeptide binding site" J Biol Chem 277: 28584-91); 10 to 50 µl of solubilized microsomes were used for each assay. Vitamin K epoxide was added at the concentration indicated in the figure legends and DTT was added to 4 mM to initiate the reaction. The reaction mixture was incubated in yellow light at 30 ° C for 30 minutes and stopped by adding 500 µl of 0.05 M AgNO3: isopropanol (5: 9). 500 µl of hexane was added and the mixture was vortexed vigorously for 1 minute to extract vitamin K and KO. After a 5 minute centrifugation, the upper organic phase was transferred to a 5 ml brown vial and dried with N₂. 150 µl of HPLC buffer, acetonitrile: isopropanol: water (100: 7: 2), was added to dissolve vitamin K and KO and the sample was analyzed by HPLC on an A C-18 column (Vydac, no. Cat. 218TP54).

Example 4

RT-qPCR (quantitative reverse transcriptase PCR)

Washed 1x10⁶ cells with PBS twice and total RNA was isolated with Trizol reagent according to the manufacturer's protocol (Invitrogen). 1 pg of RNA was digested by RQ1 DNasel (Promega) and heat inactivated. The first strand cDNA was prepared with M-MLV reverse transcriptase (Invitrogen). CDNAs were mixed with DyNAmo SYBR Green qPCR premix (Finnzymes) and real-time PCR was performed with an Opticon II PCR thermal cycler (MJ Research). The following primers were used:

13124769-5 '(F): (TCCAACAGCATATTCGGTTGC, SEQ ID NO: 1);

13124769-3 (R) ': (TTCTTGGACCTTCCGGAAACT, SEQ ID NO: 2);

GAPDH-F: (GAAGGTGAAGGTCGGAGTC, SEQ ID NO: 3);

GAPDH-R: (GAAGATGGTGATGGGATTTC, SEQ ID NO: 4);

Lamin-RT-F: (CTAGGTGAGGCCAAGAAGCAA, SEQ ID NO: 5) and

Lamin-RT-R: (CTGTTCCTCTCAGCAGACTGC, SEQ ID NO: 6).

Example 5

VKOR overexpression in the Sf9 insect cell line

The cDNA for the mGC11276 coding region was cloned into pVL1392 (Pharmingen), tagged with HPC4 (EDQVDPRLIDGK, SEQ ID NO: 7) at its amino terminal end and expressed in Sf9 cells as described (Li et al. (2000) "Identification of a Drosophila vitamin K-dependent gamma-glutamyl carboxylase" J Biol Chem 275: 18291-6).

Example 6

Gene selection

The search for the VKOR gene focused on human chromosome sixteen between markers D16S3131 and D16S419. This region corresponds to chromosome 16 at 50 cM-65 cM on the genetic map and 26-46.3 Mb on the physical map. 190 predicted coding regions in this region were analyzed by a BLASTX search of the NCBI non-redundant protein database. Human and orthologous genes from related species with known function were deleted. Because VKOR appears to be a transmembrane protein (Carlisle and Suttie (1980) "Vitamin K dependent carboxylase: subcellular location of the carboxylase and enzymes involved in vitamin K metabolism in rat liver" Biochemistry 19: 1161-7), the genes were translated remaining according to the cDNA sequences in the NCBI database and were analyzed with the TMHMM and TMAP programs (Biology WorkBench, San Diego Supercomputer System) to predict those with transmembrane domains. Thirteen genes predicted to encode integral membrane proteins were chosen for further analysis.

ES 2 339 710 T3

Example 7

Cell line screening for VKOR activity

The strategy was to identify a cell line that expressed relatively high amounts of VKOR activity and use siRNA to systematically inactivate the thirteen candidate genes. SiRNA, a 21-23 nucleotide double-stranded RNA, has been shown to cause specific RNA degradation in cell culture (Hara et al. (2002) "Raptor, a binding partner of target of rapamycin (TOR), mediates TOR action" Cell 110: 177-89; Krichevsky and Kosik (2002) "RNAi functions in cultured mammalian neurons" Proc Natl Acad Sci USA 99: 11926-9; Burns et al. (2003) "Silencing of the Novel p53 Target Gene Snk / Plk2 Leads to Mitotic Catastrophe in Paclitaxel (Taxol) -Exposed Cells" Mol Cell Biol 23: 5556-71). However, the application of siRNA for large-scale screening in mammalian cells has not been previously reported due to the difficulty of identifying a functional target for a specific mammalian cell mRNA (Holen et al. (2003) "Similar behavior of single-strand and double-strand siRNAs suggests they act through a common RNAi pathway ”Nucleic Acids Res 31: 2401-7). The development of a rational selection algorithm (Reynolds et al.) For siRNA design increases the probability that a specific siRNA can be developed; furthermore, the probability of success can be increased by pooling four selected siRNAs in a rational manner. The use of siRNA to search for previously unidentified genes has the advantage that, although VKOR activity requires the product of more than one gene to determine activity, the test must still be effective because the assay determines the loss of enzyme activity. .

Fifteen cell lines were examined and one human lung carcinoma line, A549, was identified as exhibiting sufficient warfarin-sensitive VKOR activity to achieve easy measurement. A second human colorectal adenocarcinoma cell line, HT29, expressing very little VKOR activity, was used as a reference.

Example 8

SiRNA Inhibition of VKOR Activity in A549 Cells

Each of the thirteen siRNA pools were transfected in triplicate into A549 cells and assayed for VKOR activity after 72 hours. A set of siRNAs specific for the gi gene: 13124769 reduced VKOR activity by 64% -70% in eight separate assays (Figure 1).

One possible reason that VKOR activity was inhibited by only ~ 35% of its initial activity after 72 hours is that the half-life of mammalian proteins varies greatly (from minutes to days) (Zhang et al. (1996) “The major calpain isozymes are long-lived proteins. Design of an antisense strategy for calpain depletion in cultured cells ”J Biol Chem 271: 18825-30; Bohley (1996) "Surface hydrophobicity and intracellular degradation of proteins" Biol Chem 377: 425-35; Says and Goldberg (1975) "Relationship between in vivo degradative rates and isoelectric points of proteins" Proc Natl Acad Sci USA 72: 3893-7), and that mRNA translation is being inhibited, not enzymatic activity. Therefore, the cells were kept for eleven days and their VKOR activity was followed. Figure 2 shows that the mRNA level for gi: 13124769 mRNA decreased rapidly to approximately 20% of normal while VKOR activity decreased continuously during this time period. This reduction in activity is not a general effect of siRNA or the result of cell death because the level of VKD carboxylase activity and lamin A / C mRNA remained constant. Furthermore, the level of gi: 132124769 mRNA is four times lower in HT-29 cells, which have low VKOR activity, than in A549 cells which show high VKOR activity. These data indicate that gi: 13124769 corresponds to the VKOR gene.

Example 9

Identification of the gene encoding VKOR

The gene, IMAGE 3455200 (gi: 13124769, SEQ ID NO: 8), which is identified herein as encoding VKOR, is mapped onto human chromosome 16p11.2, mouse chromosome 7F3, and rat chromosome 1: 180.8 Mb. There are 338 cDNA clones in the NCBI database representing seven different splice patterns (NCBI AceView program). These are composed of all or part of two to four exons. Among these, the most prevalent isoform, mGC11276, has three exons and is expressed at high levels in liver and lung cells. This three exon transcript (SEQ ID NO: 9) codes for a predicted protein of 163 amino acids with a mass of 18.2 kDa (SEQ ID NO: 10). It is a putative N-myristylated endoplasmic reticulum protein with one to three transmembrane domains, depending on the program used for prognosis. It has seven cysteine ​​residues, which is consistent with the observations that enzyme activity depends on thiol reagents (Thijssen et al. (1994) “Microsomal lipoamide reductase provides vitamine K epoxide reductase with reducing equivalents” Biochem J 297: 277-80 ). Five of the seven cysteines are conserved among humans, mice, rats, zebrafish, Xenopus, and Anopheles.

To confirm that the VKOR gene had been identified, the most prevalent form of the enzyme (three exons) was expressed in Spodoptera frugiperda, Sf9 cells. Sf9 cells do not display measurable VKOR activity but show warfarin sensitive activity when transfected with mGC11276 cDNA (Figure 3). Activity was observed

ES 2 339 710 T3

VKOR from constructs with either an amino terminal or carboxyl terminal epitope tag at their end. This label should aid in the purification of VKOR.

VKOR must show sensitivity to warfarin, therefore microsomes were prepared from Sf9 cells expressing VKOR and tested for sensitivity to warfarin. VKOR activity is sensitive to warfarin (Figure 4).

In summary, the present invention provides the first example of the use of siRNA in mammalian cells to identify an unknown gene. The identity of the VKOR gene was confirmed by its expression in insect cells. The VKOR gene codes for several isoforms. It will be important to characterize the activity and expression pattern of each isoform. Millions of people around the world use warfarin to inhibit clotting; therefore, it is important to further characterize VKOR as it may lead to more precise dosing or design of safer, more effective anticoagulants.

The foregoing is illustrative of the present invention, and should not be construed as limiting it. The invention is defined by the following claims, including equivalents of the claims.