Antisense modulation of ptp1b expression

228773/2

ANTISENSE MODULATION OF PTP1B EXPRESSION

0 FIELD

Provided herein are methods, compounds, and compositions for reducing expression of PTP1B mRNA and protein in an animal. Such methods, compounds, and compositions are useful, for example, to treat, prevent, delay or ameliorate diseases associated with metabolic disorders, particularly disorders associated with diabetes. 5

BACKGROUND

Protein tyrosine phosphatase IB (PTP1B) is a member of a family of PTPs (Barford, et al., Science 1994. 263: 1397-1404) and is a cytosolic enzyme (Neel and Tonks, Curr. Opin. Cell Biol. 1997. 9: 193-204). PTP1B is expressed ubiquitously including tissues that are key regulators of insulin metabolism such as liver, 0 muscle and fat (Goldstein, Receptor 1993. 3: 1-15), where it is the main PTP enzyme. PTP1B is considered to be a negative regulator of insulin signaling. PTP IB interacts with and dephosphorylates the insulin receptor, thus attenuating and potentially terminating the insulin signaling transduction (Goldstein et al., J. Biol. Chem. 2000. 275: 4383-4389). The physiological role of PTP1B in insulin signaling has been demonstrated in knockout mice models. Mice lacking the PTP1B gene were :5 protected against insulin resistance and obesity (Elchebly et al., Science 1999. 283: 1544-1548). PTP1B- deficient mice had low adiposity, increased basal metabolic rate as well as total energy expenditure and were protected from diet-induced obesity. Insulin-stimulated glucose uptake was elevated in skeletal muscle, whereas adipose tissue was unaffected providing evidence that increased insulin sensitivity in PTP IB-deficient mice was tissue-specific (Klaman et al., Mol. Cell. Biol. 2000. 20: 5479-5489). These mice were ! 0 phenotypically normal and were also resistant to diet-induced obesity, insulin resistance and had significantly lower triglyceride levels on a high-fat diet. Therefore, inhibition of PTP IB in patients suffering from Type Π diabetes, metabolic syndrome, diabetic dyslipidemia, or related metabolic diseases would be beneficial.

Antisense inhibition of PTP IB provides a unique advantage over traditional small molecule inhibitors in that antisense inhibitors do not rely on competitive binding of the compound to the protein and inhibit 1 228773/3 activity directly by reducing the expression of PTP1B. Antisense technology is emerging as an effective means for reducing the expression of certain gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of PTP1B. US 2002/055479 discloses an antisense oligonucleotide having the sequence AAATGGTTTATTCCATGGCC - SEQ ID NO:315, which is a chimeric phosphorothioate oligonucleotide having 2'-MOE wings and a deoxy gap.

There is a currently a lack of acceptable options for treating metabolic disorders. It is therefore an object herein to provide compounds and methods for the treatment of such diseases and disorder.

SUMMARY

Provided herein are methods, compounds, and compositions for modulating expression of PTP1B and treating, preventing, delaying or ameliorating diseases associated with metabolic disorders, particularly disorders associated with diabetes and/or a symptom thereof.

BRIEF DESCRIPTION OF THE FIGURES

The numerous objects and advantages of the present invention can be better understood by those skilled in the art by reference to the accompanying figures, in which:

Figure 1 shows a western blot of PTP1B antisense oligonucleotides, ISIS 404173 and ISIS 142082, decreasing PTP1B protein expression at 8mgk/week demonstrating potency of the compounds. See Table 47.

Figure 2 is a summary table of key tolerability studies in cynomolgus monkeys (see Example 17).

Figure 3 is a graphical representation reduction of human PTP1B mRNA in a dose response preclinical study. Treatment with ISIS 404173 was compared with that of ISIS 113715, the previous clinical candidate. As shown here, dosing with ISIS 404173 was more potent and caused significant reduction in PTP1B mRNA levels compared to dosing with ISIS 113715. Particularly, at 0.3 μM dose, there was a fivefold decrease in PTP1B mRNA levels with ISIS 404173 compared to ISIS 113715.

DETAILED DESCRIPTION

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” 2 228773/2 means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise. 5 The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. 0 Definitions

Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical synthesis, and chemical analysis. 0 Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistiy, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical synthesis, and chemical analysis.

Unless otherwise indicated, the following terms have the following meanings: “2’-O-methoxyethyl” (also 2’-M0E and 2’-O(CH2)2-OCH3) refers to an O-methoxy-ethyl 1 0 modification of the 2’ position of a fiirosyl ring. A 2’-O-methoxyethyl modified sugar is a modified sugar. “2’-O-methoxyethyl nucleotide” means a nucleotide comprising a 2’-O-methoxyethyl modified sugar moiety. “3’ target site” refers to the nucleotide of a target nucleic acid which is complementaiy to the 3’-most nucleotide of a particular antisense compound. 3 WO 2012/142458 PCT/US2012/033588 “5’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5’-most nucleotide of a particular antisense compound. “5-methylcytosine” means a cytosine modified with a methyl group attached to the 5’ position. A 5- methylcytosine is a modified nucleobase. 5 “About” means within ±10% of a value. For example, if it is stated, “a marker may be increased by about 50%”, it is implied that the marker may be increased between 45%-55%. “Active pharmaceutical agent” means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments an antisense oligonucleotide targeted to PTP1B is an active pharmaceutical agent. . 0 “Active target region” or “target region” means a region to which one or more active antisense compounds is targeted. “Active antisense compounds” means antisense compounds that reduce target nucleic acid levels or protein levels. “Adipogenesis” means the development of fat cells from preadipocytes. “Lipogenesis” means the production or formation of fat, either fatty degeneration or fatty infiltration. .5 “Adiposity” or “Obesity” refers to the state of being obese or an excessively high amount of body fat or adipose tissue in relation to lean body mass. The amount of body fat includes concern for both the distribution of fat throughout the body and the size and mass of the adipose tissue deposits. Body fat distribution can be estimated by skin-fold measures, waist-to-hip circumference ratios, or techniques such as ultrasound, computed tomography, or magnetic resonance imaging. According to the Center for Disease 0 Control and Prevention, individuals with a body mass index (BMI) of 30 or more are considered obese. The term "Obesity" as used herein includes conditions where there is an increase in body fat beyond the physical requirement as a result of excess accumulation of adipose tissue in the body. The term “obesity” includes, but is not limited to, the following conditions: adult-onset obesity; alimentary obesity; endogenous or inflammatory obesity; endocrine obesity; familial obesity; hyperinsulinar obesity; hyperplastic-hypertrophic 5 obesity; hypogonadal obesity; hypothyroid obesity; lifelong obesity; morbid obesity and exogenous obesity. “Administered concomitantly” refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the 0 same time. The effects need only be overlapping for a period of time and need not be coextensive. “Administering” means providing an agent to an animal, and includes, but is not limited to, administering by a medical professional and self-administering. “Agent” means an active substance that can provide a therapeutic benefit when administered to an animal. “First Agent” means a therapeutic compound provided herein. For example, a first agent can be an 4 WO 2012/142458 PCT/US2012/033588 antisense oligonucleotide targeting PTP1B. “Second agent” means a second therapeutic compound of the invention (e.g. a second antisense oligonucleotide targeting ΡΊΡ1Β) and/or a non- PTP1B therapeutic compound. “Amelioration” refers to a lessening of at least one indicator, sign, or symptom of an associated 5 disease, disorder, or condition. The severity of indicators can be determined by subjective or objective measures, which are known to those skilled in the art. “Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees. “Antisense activity” means any detectable or measurable activity attributable to the hybridization of 0 an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid. “Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. “Antisense inhibition” means reduction of target nucleic acid levels or target protein levels in the 5 presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound. “Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid. “Bicyclic sugar” means a furosyl ring modified by the bridging of two non-geminal ring atoms. A 0 bicyclic sugar is a modified sugar. “Bicyclic nucleic acid” or “BNA” refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system. “Cap structure” or “terminal cap moiety” means chemical modifications, which have been 5 incorporated at either terminus of an antisense compound. “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2’-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2’-O-methoxyethyl modifications. 0 “Chimeric antisense compound” means an antisense compound that has at least two chemically distinct regions. “Co-administration” means administration of two or more agents to an individual. The two or more agents can be in a single pharmaceutical composition, or can be in separate pharmaceutical compositions. 5 WO 2012/142458 PCT/US2012/033588

Each of the two or more agents can be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration. “Cholesterol” is a sterol molecule found in the cell membranes of all animal tissues. Cholesterol must be transported in an animal’s blood plasma by lipoproteins including very low density lipoprotein 5 (VLDL), intermediate density lipoprotein (IDL), low density lipoprotein (LDL), and high density lipoprotein (HDL). “Plasma cholesterol” refers to the sum of all lipoproteins (VDL, IDL, LDL, HDL) esterified and/or non-esterified cholesterol present in the plasma or serum. “Cholesterol absorption inhibitor” means an agent that inhibits the absorption of exogenous cholesterol obtained from diet. . 0 “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid. “Contiguous nucleobases” means nucleobases immediately adjacent to each other. “Deoxyribonucleotide” means a nucleotide having a hydrogen at the 2’ position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents. . 5 “Diabetes mellitus" or "diabetes" is a syndrome characterized by disordered metabolism and abnormally high blood sugar (hyperglycemia) resulting from insufficient levels of insulin or reduced insulin sensitivity. The characteristic symptoms are excessive urine production (polyuria) due to high blood glucose levels, excessive thirst and increased fluid intake (polydipsia) attempting to compensate for increased urination, blurred vision due to high blood glucose effects on the eye's optics, unexplained weight loss, and ! 0 lethargy. “Diabetic dyslipidemia” or “type 2 diabetes with dyslipidemia” means a condition characterized by Type 2 diabetes, reduced HDL-C, elevated triglycerides, and elevated small, dense LDL particles. “Diluenf ’ means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, ! 5 e.g. saline solution. “Dyslipidemia” refers to a disorder of lipid and/or lipoprotein metabolism, including lipid and/or lipoprotein overproduction or deficiency. Dyslipidemias may be manifested by elevation of lipids such as cholesterol and triglycerides as well as lipoproteins such as low-density lipoprotein (LDL) cholesterol. “Dosage unit” means a form in which a pharmaceutical agent is provided, e.g. pill, tablet, or other i 0 dosage unit known in the art. In certain embodiments, a dosage unit is a vial containing lyophilized antisense oligonucleotide. In certain embodiments, a dosage unit is a vial containing reconstituted antisense oligonucleotide. “Dose” means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose can be administered in one, two, or more boluses, 6 WO 2012/142458 PCT/US2012/033588 tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections can be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses can be stated as the amount 5 of pharmaceutical agent per hour, day, week, or month. “Effective amount” or “therapeutically effective amount” means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount can vaiy among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the 0 composition, assessment of the individual’s medical condition, and other relevant factors. “Fully complementary” or “100% complementary” means each nucleobase of a nucleobase sequence of a first nucleic acid has a complementary nucleobase in a second nucleobase sequence of a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid. 5 “Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region can be referred to as a “gap segment” and the external regions can be referred to as “wing segments.” 0 “Gap-widened” means a chimeric antisense compound having a gap segment of 12 or more contiguous 2’-deoxyribonucleosides positioned between and immediately adjacent to 5’ and 3’ wing segments having from one to six nucleosides. “Glucose” is a monosaccharide used by cells as a source of energy and inflammatory intermediate. “Plasma glucose” refers to glucose present in the plasma. 5 “HMG-CoA reductase inhibitor” means an agent that acts through the inhibition of the enzyme HMG-CoA reductase, such as atorvastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin, and simvastatin. “Hybridization” means the annealing of complementaiy nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include an antisense compound and a target nucleic acid. 0 “Hyperlipidemia” or “hyperlipemia” is a condition characterized by elevated serum lipids or circulating (plasma) lipids. This condition manifests an abnormally high concentration of fats. The lipid fractions in the circulating blood are cholesterol, low density lipoproteins, very low density lipoproteins and triglycerides. “Hypertriglyceridemia” means a condition characterized by elevated triglyceride levels. 7 WO 2012/142458 PCT/US2012/033588 “Identifying” or “selecting an animal with metabolic” means identifying or selecting a subject having been diagnosed with a metabolic disease, or a metabolic disorder; or, identifying or selecting a subject having any symptom of a metabolic disease, including, but not limited to, metabolic syndrome, hyperglycemia, hypertriglyceridemia, hypertension increased insulin resistance, decreased insulin sensitivity, above normal 5 body weight, and/or above normal body fat or any combination thereof. Such identification may be accomplished by any method, including but not limited to, standard clinical tests or assessments, such as measuring serum or circulating (plasma) blood-glucose, measuring serum or circulating (plasma) triglycerides, measuring blood-pressure, measuring body fat, measuring body weight, and the like. “Immediately adjacent” means there are no intervening elements between the immediately adjacent 0 elements. “Individual” or “subject” or “animal” means a human or non-human animal selected for treatment or therapy. “Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity of a RNA or protein and does not necessarily indicate a total elimination of expression or activity. 5 “Insulin resistance” is defined as the condition in which normal amounts of insulin are inadequate to produce a normal insulin response from fat, muscle and liver cells. Insulin resistance in fat cells results in hydrolysis of stored triglycerides, which elevates free fatty acids in the blood plasma. Insulin resistance in muscle reduces glucose uptake whereas insulin resistance in liver reduces glucose storage, with both effects serving to elevate blood glucose. High plasma levels of insulin and glucose due to insulin resistance often 0 leads to metabolic syndrome and type 2 diabetes. “Insulin sensitivity” is a measure of how effectively an individual processes glucose. An individual having high insulin sensitivity effectively processes glucose whereas an individual with low insulin sensitivity does not effectively process glucose. “Intemucleoside linkage” refers to the chemical bond between nucleosides. 5 “Intravenous administration” means administration into a vein. “Linked nucleosides” means adjacent nucleosides which are bonded together. “Lipid-lowering therapy” or “lipid lowering agent” means a therapeutic regimen provided to a subject to reduce one or more lipids in a subject. In certain embodiments, a lipid-lowering therapy is provided to reduce one or more of ApoB, total cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL-C, triglycerides, small 0 dense LDL particles, and Lp(a) in a subject. Examples of lipid-lowering therapy include statins, fibrates, and MTP inhibitors. “Major risk factors” refers to factors that contribute to a high risk for a particular disease or condition. In certain embodiments, major risk factors for coronary heart disease include, without limitation, 8 WO 2012/142458 PCT/US2012/033588 cigarette smoking, hypertension, low HDL-C, family history of coronary heart disease, age, and other factors disclosed herein. “Metabolic disease” or “metabolic disorder” refers to a condition characterized by an alteration or disturbance in metabolic function. “Metabolic” and “metabolism” are terms well known in the art and 5 generally include the whole range of biochemical processes that occur within a living organism. Metabolic diseases or disorders include, but are not limited to, obesity, diabetes, hyperglycemia, prediabetes, nonalcoholic fatty liver disease (NAFLD), metabolic syndrome, insulin resistance, diabetic dyslipidemia, or hypertriglyceridemia or a combination thereof. “Metabolic syndrome” means a condition characterized by a clustering of lipid and non-lipid 0 cardiovascular risk factors of metabolic origin. In certain embodiments, metabolic syndrome is identified by the presence of any 3 of the following factors: waist circumference of greater than 102 cm in men or greater than 88 cm in women; serum triglyceride of at least 150 mg/dL; HDL-C less than 40 mg/dL in men or less than 50 mg/dL in women; blood pressure of at least 130/85 mmHg; and fasting glucose of at least 110 mg/dL. These determinants can be readily measured in clinical practice (JAMA, 2001,285: 2486-2497). 5 “Mismatch” or “non-complementaty nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid. “Mixed dyslipidemia” means a condition characterized by elevated cholesterol and elevated triglycerides. “Modified intemucleoside linkage” refers to a substitution or any change from a naturally occurring 0 intemucleoside bond (i.e. a phosphodiester intemucleoside bond). “Modified nucleobase” refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety or 5 modified nucleobase. “Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified intemucleoside linkage, or modified nucleobase. A “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety or modified nucleobase. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified nucleotide. 0 “Modified sugar” refers to a substitution or change from a natural sugar. “Motif’ means the pattern of chemically distinct regions in an antisense compound. “MTP inhibitor” means an agent inhibits the enzyme, microsomal triglyceride transfer protein. “Naturally occurring intemucleoside linkage” means a 3' to 5' phosphodiester linkage. “Natural sugar moiety” means a sugar found in DNA (2’-H) or RNA (2’-OH). 9 WO 2012/142458 PCT/US2012/033588 “Non-alcoholic fatty liver disease” or “NAFLD” means a condition characterized by fatty inflammation of the liver that is not due to excessive alcohol use (for example, alcohol consumption of over 20 g/day). In certain embodiments, NAFLD is related to insulin resistance and the metabolic syndrome. NAFLD encompasses a disease spectrum ranging from simple triglyceride accumulation in hepatocytes 5 (hepatic steatosis) to hepatic steatosis with inflammation (steatohepatitis), fibrosis, and cirrhosis. “Nonalcoholic steatohepatitis” (NASH) occurs from progression of NAFLD beyond deposition of triglycerides. A “second hit” capable of inducing necrosis, inflammation, and fibrosis is required for development of NASH. Candidates for the second-hit can be grouped into broad categories: factors causing an increase in oxidative stress and factors promoting expression of proinflammatoiy cytokines 0 “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA). A nucleic acid can also comprise a combination of these elements in a single molecule. “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. 5 “Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification. “Nucleoside” means a nucleobase linked to a sugar. “Nucleoside mimetic” includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example 0 nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics e.g. non furanose sugar units. “Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside. “Nucleotide mimetic” includes those structures used to replace the nucleoside and the linkage at one 5 or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=O)-O- or other non-phosphodiester linkage). “Oligomeric compound" or “oligomer” refers to a polymeric structure comprising two or more substructures and capable of hybridizing to a region of a nucleic acid molecule. In certain embodiments, oligomeric compounds are oligonucleosides. In certain embodiments, oligomeric compounds are : 0 oligonucleotides. In certain embodiments, oligomeric compounds are antisense compounds. In certain embodiments, oligomeric compounds are antisense oligonucleotides. In certain embodiments, oligomeric compounds are chimeric oligonucleotides. “Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. 10 WO 2012/142458 PCT/US2012/033588 “Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. Administration can be continuous, or chronic, or short 5 or intermittent. “Peptide” means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins. “Pharmaceutical agent” means a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeted to PTP1B is 0 pharmaceutical agent. “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition can comprise one or more active agents and a sterile aqueous solution. “Pharmaceutically acceptable carrier” means a medium or diluent that does not interfere with the 5 structure of the oligonucleotide. Certain, of such carries enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution. “Pharmaceutically acceptable derivative” encompasses pharmaceutically acceptable salts, conjugates, 0 prodrugs or isomers of the compounds described herein. “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto. “Phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is 5 modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified intemucleoside linkage. “Portion” means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound. 0 “Prevent” refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition. “Prodrug” means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions. 11 WO 2012/142458 PCT/US2012/033588 “Protein tyrosine phosphatase IB” or “PTP1B” (also known as PTPN1; protein tyrosine phosphatase, non-receptor type 1; ΡΊΡ-1Β; RKPTP) means any nucleic acid or protein of ΡΊΡ1Β. “PTP1B expression” means the level of mRNA transcribed from the gene encoding PTP1B or the level of protein translated from the mRNA. PTP1B expression can be determined by art known methods such 5 as a Northern or Western blot. “PTP1B nucleic acid” means any nucleic acid encoding PTP1B. For example, in certain embodiments, a PTP1B nucleic acid includes a DNA sequence encoding PTP1B, a RNA sequence transcribed from DNA encoding PTP1B (including genomic DNA comprising introns and exons), and a mRNA sequence encoding PTP1B. “PTP1B mRNA” means a mRNA encoding a PTP1B protein. . 0 “Side effects” means physiological responses attributable to a treatment other than the desired effects.

In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum can indicate liver toxicity or liver function abnormality. For example, increased bilirubin can indicate liver toxicity or liver function abnormality. . 5 “Single-stranded oligonucleotide” means an oligonucleotide which is not hybridized to a complementary strand. “Specifically hybridizable” refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding 0 is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments. “Statin” means an agent that inhibits the activity of HMG-CoA reductase. “Subcutaneous administration” means administration just below the skin. “Targeting” or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect. 5 “Target nucleic acid,” “target RNA,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds. “Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5’ target site” refers to the 5’-most nucleotide of a target segment. “3’ target site” refers to the 3’-most nucleotide of a target segment. 0 “Therapeutically effective amount” means an amount of an agent that provides a therapeutic benefit to an individual. “Therapeutic lifestyle change” means dietary and lifestyle changes intended to lower fat /adipose tissue mass and/or cholesterol. Such change can reduce the risk of developing heart disease, and may includes recommendations for dietary intake of total daily calories, total fat, saturated fat, polyunsaturated fat, 12 WO 2012/142458 PCT/US2012/033588 monounsaturated fat, carbohydrate, protein, cholesterol, insoluble fiber, as well as recommendations for physical activity. “Triglyceride” or “TG” means a lipid or neutral fat consisting of glycerol combined with three fatty acid molecules. 5 “Type 2 diabetes,” (also known as “type 2 diabetes mellitus” or “diabetes mellitus, type 2”, and formerly called “diabetes mellitus type 2”, “non-insulin-dependent diabetes (NIDDM)”, “obesity related diabetes”, or “adult-onset diabetes”) is a metabolic disorder that is primarily characterized by insulin resistance, relative insulin deficiency, and hyperglycemia. “Treat” refers to administering a pharmaceutical composition to an animal to effect an alteration or 0 improvement of a disease, disorder, or condition. “Unmodified nucleotide” means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and intemucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).

Certain Embodiments

5 Certain embodiments provide methods, compounds, and compositions for inhibiting PTP1B expression.

Certain embodiments provide antisense compounds targeted to a PTP1B nucleic acid. In certain embodiments, the PTP1B nucleic acid is any of the sequences set forth in GENBANK Accession No. NM 002827.2 (incorporated herein as SEQ ED NO: 1), GENBANK Accession No. NT 011362.9 truncated 0 from nucleotides 14178000 to 14256000 (incorporated herein as SEQ ED NO: 2); and a concatenation of sequences from exons 1-9, intron 9 and exon 10 of the rhesus monkey PTP1B scaffold (incorporated herein as SEQ ID NO: 3).

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 10 to 30 nucleosides having a nucleobase sequence comprising at least 8 5 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,20,21,22, 23,24,25, 26, 27,28,29 or 30 contiguous nucleobases complementaiy to an equal length portion of any of SEQ ID NOs: 1-3. 0 In certain embodiments, the compounds or compositions provided herein can consist of 10 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10,11, 12,13,14, 15,16, 17,18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 4-32 or 100-111. 13 WO 2012/142458 PCT/US2012/033588

In certain embodiments, the compounds or compositions provided herein can consist of 10 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 26 or 44.

In certain embodiments, the compounds or compositions provided herein can consist of 10 to 30 5 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10,11, 12,13, 14,15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of ISIS NOs: 404173, 410002,438373,438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions provided herein can consist of 10 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8,9,10,11, 12, 13, 14, 15, 16,17, 18, . 0 19, or 20 contiguous nucleobases of ISIS NO: 404173

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 15 to 30 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein comprise a modified . 5 oligonucleotide consisting of 15 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9,10,11, 12, 13,14,15,16,17, 18, 19, 20,21,22, 23,24,25, 26,27,28,29 or 30 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein can consist of 15 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9,10,11,12,13,14, 15,16, 17, 0 18, 19, or 20 contiguous nucleobases of any of SEQ ED NOs: 4-32 or 100-111.

In certain embodiments, the compounds or compositions provided herein can consist of 15 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ED NOs: 26 or 44.

In certain embodiments, the compounds or compositions provided herein can consist of 15 to 30 5 linked nucleosides and have a nucleobase sequence comprising at least 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of ISIS NOs: 404173, 410002, 438373,438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions provided herein can consist of 15 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 0 19, or 20 contiguous nucleobases of ISIS NO: 404173

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 18 to 21 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3. 14 WO 2012/142458 PCT/US2012/033588

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 18 to 21 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1 -3. 5 In certain embodiments, the compounds or compositions provided herein consist of 18 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8, 9,10,11,12,13, 14, 15, 16, 17,18,19, or 20 contiguous nucleobases of any of SEQ ID NOs: 4-32 or 39-49.

In certain embodiments, the compounds or compositions provided herein consist of 18 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8,9,10,11,12,13,14,15,16,17,18,19, or 20 contiguous nucleobases of any of SEQ ID NOs: 26 or 44.

In certain embodiments, the compounds or compositions provided herein consist of 18 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8,9,10,11,12,13, 14,15, 16, 17,18, 19, or 20 contiguous nucleobases of any of ISIS NOs: 404173,410002,438373,438383, 438445,438454,438463, or 438472.

In certain embodiments, the compounds or compositions provided herein consist of 18 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8,9,10,11,12,13, 14, 15,16, 17,18,19, or 20 contiguous nucleobases of ISIS NO: 404173.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 35 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,20,21,22,23,24,25,26,27, 28,29, 30, 31, 32, 33, 34 or 35 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 35 linked nucleosides and have a nucleobase sequence comprising at least 8, 9,10,11,12,13,14, 15,16,17,18, 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32 or 50.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 35 linked nucleosides and have a nucleobase sequence comprising at least 8, 9,10,11, 12,13, 14,15,16,17,18, 19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 35 linked nucleosides and have a nucleobase sequence comprising at least 8, 9,10,11, 12,13,14,15, 16, 17,18,19, or 20 contiguous nucleobases of any of ISIS NOs: 404173,410002,438373,438383,438445, 438454,438463, or 438472. 15 WO 2012/142458 PCT/US2012/033588

In certain embodiments, the compounds or compositions provided herein consist of 20 to 35 linked nucleosides and have a nucleobase sequence comprising at least 8,9,10,11, 12,13, 14, 15,16, 17,18, 19, or 20 contiguous nucleobases of ISIS NO: 404173.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 30 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9,10, 11, 12,13,14, 15,16,17, 18, 19,20, 21,22, 23, 24,25, 26,27, 28,29 or 30 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10,11, 12,13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of SEQ ID NO: 4-32 or 50.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8,9,10,11,12,13,14,15,16,17,18,19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8,9,10,11, 12,13, 14,15,16, 17, 18,19, or 20 contiguous nucleobases of any of ISIS NOs: 404173, 410002,438383,438445, 438454, 438463, or 438472,

In certain embodiments, the compounds or compositions provided herein consist of 20 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of ISIS NO: 404173.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 25 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 25 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 25 linked nucleosides and have a nucleobase sequence comprising at least 8, 9,10,11,12,13, 14, 15, 16, 17,18, 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32. WO 2012/142458 PCT/US2012/033588

In certain embodiments, the compounds or compositions provided herein consist of 20 to 25 linked nucleosides and have a nucleobase sequence comprising at least 8,9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of SEQ ED NO: 26.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 25 linked 5 nucleosides and have a nucleobase sequence comprising at least 8,9, 10,11, 12,13, 14,15,16,17, 18,19, or 20 contiguous nucleobases of any of ISIS NOs: 404173, 410002,438383, 438445,438454, 438463, or 438472,

In certain embodiments, the compounds or compositions provided herein consist of 20 to 25 linked nucleosides and have a nucleobase sequence comprising at least 8,9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, or 0 20 contiguous nucleobases of ISIS NO: 404173.

In certain embodiments, the compounds or compositions of the invention comprise a modified oligonucleotide consisting of 20 to 24 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ED NOs: 1-3. 5 In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 24 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,22, 23, or 24 contiguous nucleobases complementary to an equal length portion of any of SEQ ED NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 24 linked 0 nucleosides and have a nucleobase sequence comprising at least 8, 9, 10,11, 12,13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 24 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of SEQ ED NO: 26. 5 In certain embodiments, the compounds or compositions provided herein consist of 20 to 24 linked nucleosides and have a nucleobase sequence comprising at least 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of ISIS NOs: 404173,410002,438373,438383, 438445,438454,438463, or 438472.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 24 linked 0 nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of ISIS NO: 404173 17 WO 2012/142458 PCT/US2012/033588

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 23 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein comprise a modified 5 oligonucleotide consisting of 20 to 23 linked nucleosides and having a nucleobase sequence comprising at least 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,20, 21,22, or 23 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 23 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10,11,12,13, 14, 15, 16,17,18,19, or . 0 20 contiguous nucleobases of SEQ ID NOs: 4-32.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 23 linked nucleosides and have a nucleobase sequence comprising at least 8, 9,10,11, 12,13, 14, 15, 16, 17,18,19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 23 linked .5 nucleosides and have a nucleobase sequence comprising at least 8,9,10,11, 12,13,14,15, 16,17,18,19, or 20 contiguous nucleobases of any of ISIS NOs: 404173,410002, 438373, 438383, 438445, 438454,438463, or 438472.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 23 linked nucleosides and have a nucleobase sequence comprising at least 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or : 0 20 contiguous nucleobases of ISIS NO: 404173.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 22 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein comprise a modified : 5 oligonucleotide consisting of 20 to 22 linked nucleosides and having a nucleobase sequence comprising at least 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,20, 21, or 22 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1 -3.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 22 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 10 20 contiguous nucleobases of SEQ ID NOs: 4-32.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 22 linked nucleosides and have a nucleobase sequence comprising at least 8, 9,10,11,12,13,14, 15, 16,17,18, 19, or 20 contiguous nucleobases of SEQ ID NO: 26. 18 WO 2012/142458 PCT/US2012/033588

In certain embodiments, the compounds or compositions provided herein consist of 20 to 22 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10,11,12,13,14, 15,16, 17,18, 19, or 20 contiguous nucleobases of any of ISIS NOs: 404173, 410002,438373,438383, 438445, 438454,438463, or 438472. 5 In certain embodiments, the compounds or compositions provided herein consist of 20 to 22 linked nucleosides and have a nucleobase sequence comprising at least 8, 9,10,11,12,13, 14,15,16,17,18, 19, or 20 contiguous nucleobases of ISIS NO: 404173.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 21 nucleosides having a nucleobase sequence comprising at least 8 0 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 to 21 linked nucleosides and having a nucleobase sequence comprising at least 8,9, 10, 11,12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3. 5 In certain embodiments, the compounds or compositions provided herein consist of 20 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8,9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19, or 0 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions provided herein consist of 20 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8,9, 10, 11, 12,13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of ISIS NOs: 404173, 410002,438373,438383,438445,438454,438463, or 438472. 5 In certain embodiments, the compounds or compositions provided herein consist of 20 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8,9,10,11,12,13,14, 15,16, 17, 18,19, or 20 contiguous nucleobases of ISIS NO: 404173.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 nucleosides having a nucleobase sequence comprising at least 8 contiguous 0 nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3. 19 WO 2012/142458 PCT/US2012/033588

In certain embodiments, the compounds or compositions provided herein consist of 20 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10,11, 12,13,14,15,16, 17, 18,19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32.

In certain embodiments, the compounds or compositions provided herein consist of 20 linked 5 nucleosides and have a nucleobase sequence comprising at least 8, 9, 10,11,12,13,14,15, 16, 17, 18,19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions provided herein consist of any of ISIS NOs: 404173.410002.438373.438383, 438445, 438454,438463, or 438472.

In certain embodiments, the compounds or compositions provided herein consist of ISIS NO: .0 404173.

In certain embodiments, the compounds or compositions provided herein consist of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions provided herein comprise a salt of the modified oligonucleotide.

In certain embodiments, the compounds or compositions provided herein further comprise a .5 pharmaceutically acceptable carrier or diluent.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 70%, 75%, 80%, 85%, 90%, 95% , 96%, 97%, 98%, 99% or 100% complementary to any one of SEQ ID NOs: 1-3 as measured over the entirety of the modified oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide has at least 70%, 0 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO: 4-32 or 39- 50. as measured over the entirety of the modified oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO: 26 or 44. as measured over the entirety of the modified oligonucleotide. 5 In certain embodiments, the nucleobase sequence of the modified oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one ISIS NOs: 404173, 410002, 438373.438383, 438445, 438454, 438463, or 438472 as measured over the entirety of the modified oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide has at least 70%, 0 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to ISIS NO: 404173 as measured over the entirety of the modified oligonucleotide.

In certain embodiments, the compound provided herein consists of a single-stranded modified oligonucleotide. 20 WO 2012/142458 PCT/US2012/033588

In certain embodiments, the modified oligonucleotide consists of 8,9,10,11, 12,13,14,15, 16,17, 18, 19,20, 21,22,23,24,25, 26, 27, 28,29, 30, 31,32, 33, 34 or 35 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides. 5 In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage. In certain embodiments, each intemucleoside linkage is a phosphorothioate intemucleoside linkage.

In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine. 0 In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) a 5’ wing segment consisting of linked nucleosides; and c) a 3’ wing segment consisting of linked nucleosides. The gap segment is positioned between the 5’ wing segment and the 3’ wing segment and each nucleoside of each wing segment comprises a modified sugar.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap 5 segment consisting of ten linked deoxynucleosides, the 5’ wing segment consisting of five linked nucleosides, the 3’ wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap 0 segment consisting of eight linked deoxynucleosides, the 5’ wing segment consisting of six linked nucleosides, the 3’ wing segment consisting of six linked nucleosides, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap 5 segment consisting of thirteen linked deoxynucleosides, the 5’ wing segment consisting of two linked nucleosides, the 3’ wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides, the gap 10 segment consisting of eight linked deoxynucleosides, the 5 ’ wing segment consisting of five linked nucleosides, the 3’ wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine. 21 WO 2012/142458 PCT/US2012/033588

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3, wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5’ wing 5 segment consisting of five linked nucleosides; and c) a 3’ wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5’ wing segment and the 3’ wing segment, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions provided herein comprise a modified 0 oligonucleotide consisting of 18 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3, wherein the modified oligonucleotide comprises: a) a gap segment consisting of eight linked deoxynucleosides; b) a 5’ wing segment consisting of six linked nucleosides; and c) a 3’ wing segment consisting of six linked nucleosides. The gap segment is positioned between the 5’ wing segment and the 3’ wing segment, each 5 nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 19 contiguous nucleobases of SEQ ID NOs: 4-32, wherein the modified oligonucleotide comprises: a) a gap 0 segment consisting of ten linked deoxynucleosides; b) a 5’ wing segment consisting of five linked nucleosides; and c) a 3’ wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5’ wing segment and the 3’ wing segment, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine. 5 In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 19 contiguous nucleobases of SEQ ED NO: 26, wherein the modified oligonucleotide comprises: a) a gap segment consisting often linked deoxynucleosides; b) a 5’ wing segment consisting of five linked nucleosides; and c) a 3’ wing segment consisting of five linked nucleosides. The gap segment is positioned 0 between the 5’ wing segment and the 3’ wing segment, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having the nucleobase sequence of SEQ ED NO: 26, 22 WO 2012/142458 PCT/US2012/033588 wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5’ wing segment consisting of five linked nucleosides; and c) a 3’ wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5’ wing segment and the 3’ wing segment, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside 5 linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 19 contiguous nucleobases of SEQ ID NO: 26 or 44, wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5’ wing segment consisting of five linked 0 nucleosides; and c) a 3’ wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5’ wing segment and the 3’ wing segment, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine. In certain embodiments, the compound or composition comprises the compound of any of ISIS NOs: 404173,410002, 438383, 438445,438454, 438463, or 438472. 5 In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 20 contiguous nucleobases of SEQ ED NOs: 4-32, wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5’ wing segment consisting of five linked nucleosides; and c) a 3’ wing segment consisting of five linked nucleosides. The gap segment is positioned 0 between the 5’ wing segment and the 3’ wing segment, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 20 5 contiguous nucleobases of SEQ ID NO: 26, wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5’ wing segment consisting of five linked nucleosides; and c) a 3’ wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5’ wing segment and the 3’ wing segment, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each 0 cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 20 contiguous nucleobases of SEQ ED NO: 26, wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten Jinked deoxynucleosides; b) a 5’ wing segment consisting of five linked 23 WO 2012/142458 PCT/US2012/033588 nucleosides; and c) a 3’ wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5’ wing segment and the 3’ wing segment, each nucleoside of each wing segment comprises a 2’-O-methoxyethyl modified sugar, each intemucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine. In certain embodiments, the compound or composition comprises the 5 compound ISIS NOs: 404173.

Certain embodiments provide methods, compounds, and compositions for inhibiting PTP1B expression.

Certain embodiments provide a method of reducing PTP1B expression in an animal comprising administering to the animal a compound as described herein. In certain embodiments, the compound 0 comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 to 35 linked nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 to 25 linked nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 to 24 linked nucleosides in length targeted to PTP1B. In certain embodiments, the 5 compound comprises a modified oligonucleotide 20 to 23 linked nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 to 22 linked nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 to 21 linked nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 linked nucleosides in length targeted to PTP1B. 0 Certain embodiments provide a method of preventing, ameliorating or treating an metabolic disease in an animal comprising administering to the animal a compound as described herein. In certain embodiments, the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 linked nucleosides in length targeted to PTP1B. Examples of metabolic diseases or disorders include, but are not 5 limited to obesity, diabetes, hyperglycemia, prediabetes, non-alcoholic fatty liver disease (NAFLD), metabolic syndrome, insulin resistance, diabetic dyslipidemia, or hypertriglyceridemia or a combination thereof.

Certain embodiments provide a method of reducing glucose levels in an animal comprising administering to the animal a compound as described herein. In certain embodiments, the compound 0 comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 linked nucleosides in length targeted to PTP1B. In certain embodiments, reduction of glucose levels in an animal prevents, ameliorates or treats a metabolic disease. In certain embodiments, reduction of glucose levels in an animal prevents, ameliorates or treats diabetes. In certain embodiments, reduction of glucose levels in an animal prevents, ameliorates or 24 WO 2012/142458 PCT/US2012/033588 treats obesity. In certain embodiments, reduction of glucose levels in an animal prevents, ameliorates or treats metabolic syndrome. In certain embodiments, reduction of glucose levels in an animal prevents, ameliorates or treats insulin resistance. In certain embodiments, reduction of glucose levels in an animal prevents, ameliorates or treats hyperglycemia. In certain embodiments, reduction of glucose levels in an animal 5 prevents, ameliorates or treats NAFLD. In certain embodiments, reduction of glucose levels in an animal prevents, ameliorates or treats diabetic dyslipidemia. In certain embodiments, the glucose level is reduced by at least 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

In certain embodiments, PTP1B has the sequence as set forth in any of the GenBank Accession 0 Numbers GENBANK Accession No. NM_002827.2 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT 011362.9 truncated from nucleotides 14178000 to 14256000 (incorporated herein as SEQ ID NO: 2); and a concatenation of sequences from exons 1-9, intron 9 and exon 10 of the rhesus monkey PTP1B scaffold (incorporated herein as SEQ ID NO: 3). In certain embodiments, PTP1B has the human sequence as set forth in SEQ ED NOs: 1-2. In certain embodiments, PTP1B has the rhesus monkey sequence 5 as set forth in SEQ ED NOs: 3).

In certain embodiments, the compounds or compositions provided herein comprise a salt thereof, and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence recited in SEQ ID NOs: 4-32, 50 or : 0 a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 25 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence recited in SEQ ID NOs: 4-32, 50 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 linked nucleosides and having a .’5 nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence recited in SEQ ID NO: 4-32, 50 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the compounds or compositions provided herein comprise a salt thereof, and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence 10 comprising at least 20 contiguous nucleobases of a nucleobase sequence recited in SEQ ID NO: 26 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 25 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence recited in SEQ ED NO: 26 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the 25 WO 2012/142458 PCT/US2012/033588 composition comprises a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence recited in SEQ ID NO: 26 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the compounds or compositions of the invention comprise a salt thereof, and 5 a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in ISIS NOs: 404173, 410002,438383, 438445,438454,438463, or 438472 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition 0 comprises a modified oligonucleotide consisting of 20 to 25 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in ISIS NOs: 404173, 410002,438383,438445, 438454,438463, or 438472 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence 5 comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in ISIS NOs: 404173,410002,438383, 438445, 438454,438463, or 438472 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the compounds or compositions of the invention comprise a salt thereof, and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a 0 modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in ISIS NO: 404173 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 25 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase 5 sequence selected from among the nucleobase sequences recited in ISIS NO: 404173 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in ISIS NO: 404173 or a salt thereof and a pharmaceutically acceptable carrier or diluent. 0 Certain embodiments provide a method for treating an animal with a PTP1B related disease or condition comprising: a) identifying said animal with the PTP1B related disease or condition, and b) administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence at least 90% complementary to any of SEQ ID NOs: 1-3 as measured over the entirety of said modified oligonucleotide. In 26 WO 2012/142458 PCT/US2012/033588 certain embodiments, the therapeutically effective amount of the compound administered to the animal treats or reduces the PTP1B related disease or condition, or a symptom thereof, in the animal. In certain embodiments, the PTP1B related disease or condition is diabetes.

Certain embodiments provide a method for treating an animal with a PTP1B related disease or 5 condition comprising: a) identifying said animal with the PTP1B related disease or condition, and b) administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence at least 100% complementary to any of SEQ ID NOs: 1-3 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the therapeutically effective amount of the compound administered to the animal treats 0 or reduces the PTP1B related disease or condition, or a symptom thereof, in the animal. In certain embodiments, the PTP1B related disease or condition is diabetes.

Certain embodiments provide methods of treating, preventing, or ameliorating a metabolic disease. In certain embodiments the metabolic disease is obesity, diabetes, hyperglycemia, prediabetes, non-alcoholic fatty liver disease (NAFLD), metabolic syndrome, insulin resistance, diabetic dyslipidemia, or 5 hypertriglyceridemia or a combination thereof.

Certain embodiments provide methods of treating, preventing, or ameliorating a hyperproliferative disorder.

Certain embodiments provide methods comprising administering to an animal a compound as described herein to an animal. In certain embodiments, the method comprises administering to an animal a 0 modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence recited in SEQ ID NOs: 4-32 or 50 Certain embodiments provide methods comprising administering to an animal a compound as described herein to an animal. In certain embodiments, the method comprises administering to an animal a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at 5 least 20 contiguous nucleobases of a nucleobase sequence recited in SEQ ID NO: 26.

Certain embodiments provide methods comprising administering to an animal a compound as described herein to an animal. In certain embodiments, the method comprises administering to an animal a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase 0 sequences recited in ISIS NOs: 404173,410002, 438383, 438445,438454,438463, or 438472.

Certain embodiments provide methods comprising administering to an animal a compound as described herein to an animal. In certain embodiments, the method comprises administering to an animal a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence 27 WO 2012/142458 PCT/US2012/033588 comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in ISIS NO: 404173.

In certain embodiments, the animal is a human.

In certain embodiments, the administering prevents, treats, ameliorates, or slows progression of a 5 metabolic disease as described herein.

In certain embodiments, the administering prevents, treats, ameliorates, or slows progression of diabetes as described herein.

In certain embodiments, the compound is co-administered with a second agent.

In certain embodiments, the compound and the second agent are administered concomitantly. 0 In certain embodiments, the administering is parenteral administration.

Certain embodiments further provide a method to reduce PTP1B mRNA or protein expression in an animal comprising administering to the animal a compound or composition as described herein to reduce PTP1B mRNA or protein expression in the animal. In certain embodiments, the animal is a human. In certain embodiments, reducing PTP1B mRNA or protein expression prevents, treats, ameliorates, or slows 5 progression of metabolic disease. In certain embodiments, the metabolic disease or condition is diabetes.

Certain embodiments provide a method for treating a human with a metabolic disease comprising identifying the human with the disease and administering to the human a therapeutically effective amount of a compound or composition as described herein. In certain embodiments, the treatment reduces a symptom selected from the group consisting of metabolic syndrome, hyperglycemia, hypertriglyceridemia, 0 hypertension, increased glucose levels, increased insulin resistance, decreased insulin sensitivity, above normal body weight, and/or above normal body fat or any combination thereof.

Certain embodiments provide a method for treating a human with diabetes comprising identifying the human with the disease and administering to the human a therapeutically effective amount of a compound or composition as described herein. In certain embodiments, the treatment reduces a symptom selected from the 5 group consisting of metabolic syndrome, hyperglycemia, hypertriglyceridemia, hypertension, increased glucose levels, increased insulin resistance, decreased insulin sensitivity, above normal body weight, and/or above normal body fat or any combination thereof

Further provided is a method for reducing or preventing metabolic disease comprising administering to a human a therapeutically effective amount compound or composition as described herein, thereby 0 reducing or preventing metabolic disease.

Further provided is a method for reducing or preventing diabetes comprising administering to a human a therapeutically effective amount compound or composition as described herein, thereby reducing or preventing diabetes. 28 WO 2012/142458 PCT/US2012/033588

Further provided is a method for ameliorating a symptom of metabolic disease, comprising administering to a human in need thereof a compound comprising a modified oligonucleotide consisting of 20 to 35 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1, 2, or 3, thereby ameliorating a symptom of metabolic disease in the human. 5 Further provided is a method for ameliorating a symptom of diabetes, comprising administering to a human in need thereof a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1, 2, or 3, thereby ameliorating a symptom of diabetes in the human.

Further provided is a method for ameliorating a symptom of diabetes, comprising administering to a 0 human in need thereof a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1, 2, or 3, thereby ameliorating a symptom of diabetes in the human.

Further provided is a method for reducing the rate of progression of a symptom associated with metabolic disease, comprising administering to a human in need thereof a compound comprising a modified 5 oligonucleotide consisting of 10 to 30 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1, 2, or 3, thereby reducing the rate of progression a symptom of metabolic disease in the human.

Further provided is a method for reducing the rate of progression of a symptom associated with diabetes, comprising administering to a human in need thereof a compound comprising a modified 0 oligonucleotide consisting of 20 to 35 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1, 2, or 3, thereby reducing the rate of progression a symptom of diabetes in the human.

Further provided is a method for reducing the rate of progression of a symptom associated with diabetes, comprising administering to a human in need thereof a compound comprising a modified 5 oligonucleotide consisting of 20 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1,2, or 3, thereby reducing the rate of progression a symptom of diabetes in the human.

Also provided are methods and compounds for the preparation of a medicament for the treatment, prevention, or amelioration of metabolic disease. 0 Also provided are methods and compounds for the preparation of a medicament for the treatment, prevention, or amelioration of diabetes.

Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, ameliorating, or preventing metabolic disease. 29 WO 2012/142458 PCT/US2012/033588

Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, ameliorating, or preventing diabetes.

Certain embodiments provide a compound as described herein for use in treating, preventing, or ameliorating metabolic disease as described herein by combination therapy with an additional agent or 5 therapy as described herein. Agents or therapies can be co-administered or administered concomitantly.

Certain embodiments provide a compound as described herein for use in treating, preventing, or ameliorating diabetes as described herein by combination therapy with an additional agent or therapy as described herein. Agents or therapies can be co-administered or administered concomitantly.

Certain embodiments provide the use of a compound as described herein in the manufacture of a . 0 medicament for treating, preventing, or ameliorating metabolic disease as described herein by combination therapy with an additional agent or therapy as described herein. Agents or therapies can be co-administered or administered concomitantly.

Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, preventing, or ameliorating diabetes as described herein by combination therapy . 5 with an additional agent or therapy as described herein. Agents or therapies can be co-administered or administered concomitantly.

Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, preventing, or ameliorating metabolic disease as described herein in a patient who is subsequently administered an additional agent or therapy as described herein. 0 Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, preventing, or ameliorating diabetes as described herein in a patient who is subsequently administered an additional agent or therapy as described herein.

Certain embodiments provide a kit for treating, preventing, or ameliorating metabolic disease as described herein wherein the kit comprises: 5 (i) a compound as described herein; and alternatively (ii) an additional agent or therapy as described herein.

Certain embodiments provide a kit for treating, preventing, or ameliorating diabetes as described herein wherein the kit comprises: (i) a compound as described herein; and alternatively 0 (ii) an additional agent or therapy as described herein. A kit as described herein may further include instructions for using the kit to treat, prevent, or ameliorate metabolic disease as described herein by combination therapy as described herein. In certain embodiments, the metabolic disease is diabetes. 30 WO 2012/142458 PCT/US2012/033588

Antisense Compounds

Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound may be “antisense” to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense compound targeted to a PTP1B nucleic acid is 10 to 30 nucleotides in length. In other words, antisense compounds are from 10 to 30 linked nucleobases. In other embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8 to 80, 10 to 50, 15 to 30, 18 to 21,20 to 80,20 to 35,20 to 30, 20 to 29, 20 to 28, 20 to 27,20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21 or 20 linked nucleobases. In certain such embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8,9, 10, 11, 12, 13, 14, 15,16, 17, 18, 19,20, 21, 22, 23, 24, 25, 26,27, 28,29,30, 31, 32, 33, 34, 35, 36, 37, 38, 39,40, 41, 42, 43,44,45,46,47, 48,49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values.

In certain embodiments, the antisense compound comprises a shortened or truncated modified oligonucleotide. The shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5’ end (5’ truncation), or alternatively from the 3’ end (3’ truncation). A shortened or truncated oligonucleotide may have two nucleosides deleted from the 5’ end, or alternatively may have two subunits deleted from the 3’ end. Alternatively, the deleted nucleosides may be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having one nucleoside deleted from the 5 ’ end and one nucleoside deleted from the 3’ end.

When a single additional nucleoside is present in a lengthened oligonucleotide, the additional nucleoside may be located at the 5’ or 3’ end of the oligonucleotide. When two or more additional nucleosides are present, the added nucleosides may be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5’ end (5’ addition), or alternatively to the 3’ end (3’ addition), of the oligonucleotide. Alternatively, the added nucleoside may be dispersed throughout the antisense compound, for example, in an oligonucleotide having one nucleoside added to the 5’ end and one subunit added to the 3’ end. 31 WO 2012/142458 PCT/US2012/033588

It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. 5 Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an 0 oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358,1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence 5 of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Antisense Compound Motifs 0 In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Chimeric antisense compounds typically contain at least one region modified so as to confer 5 increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a 0 gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar 32 WO 2012/142458 PCT/US2012/033588 moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2’-modified nucleosides may include 2’-MOE and 2’-O-CH3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a 5 constrained ethyl). In certain embodiments, wings may include several modified sugar moieties, including, for example 2’-MOE and constrained ethyl. In certain embodiments, wings may include several modified and unmodified sugar moieties. In certain embodiments, wings may include various combinations of 2’-MOE nucleosides, constrained ethyl nucleosides, and 2’-deoxynucleosides.

Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties. 0 The wing-gap-wing motif is frequently described as “X-Y-Z”, where “X” represents the length of the 5’-wing, “Y” represents the length of the gap, and “Z” represents the length of the 3’-wing. “X” and “Z” may comprise uniform, variant, or alternating sugar moieties. In certain embodiments, “X” and “Y” may include one or more 2’-deoxynucleosides.“Y” may comprise 2’-deoxynucleosides. As used herein, a gapmer described as “X-Y-Z” has a configuration such that the gap is positioned immediately adjacent to each of the 5 5’-wing and the 3’ wing. Thus, no intervening nucleotides exist between the 5’-wing and gap, or the gap and the 3’-wing. Any of the antisense compounds described herein can have a gapmer motif. In certain embodiments, “X” and “Z” are the same, in other embodiments they are different. In certain embodiments, “Y” is between 8 and 15 nucleosides. X, Y, or Z can be any of 1, 2,3,4, 5, 6, 7, 8, 9,10,11,12,13,14,15, 16, 17, 18, 19,20,25, 30 or more nucleosides. 0 In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid possess a 5-10-5 gapmer motif.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid possess a 6-8-6 gapmer motif.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid possess a 5-8-5 : 5 gapmer motif.

In certain embodiments, an antisense compound targeted to a PTP1B nucleic acid has a gap-widened motif.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid possess a 2-13-5 gap-widened motif. 10

Target Nucleic Acids, Target Regions and Nucleotide Sequences

In certain embodiments, the PTP1B nucleic acid is any of the sequences set forth in GENBANK

Accession No. NM 002827.2 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT 011362.9 truncated from nucleotides 14178000 to 14256000 (incorporated herein as SEQ ID NO: 2); and 33 228773/2 a concatenation of sequences from exons 1-9, intron 9 and exon 10 of the rhesus monkey PTP IB scaffold (incorporated herein as SEQ ID NO: 3).

It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3’ UTR, a 5’ UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for PTP IB can be obtained by accession number from sequence databases such as NCBI. In certain embodiments, a target region may encompass the sequence from a 5’ target site of one target segment within the target region to a 3 ’ target site of another target segment within the same target region.

Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid. A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250,200, 150, 100, 90, 80,70, 60, 50,40,30,20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5’ target sites or 3’ target sites listed herein.

Suitable target segments may be found within a 5’ UTR, a coding region, a 3’ UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.

The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to 34 WO 2012/142458 PCT/US2012/033588 identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific maimer to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid 5 levels) of the antisense compounds within an active target region. In certain embodiments, reductions in PTP1B mRNA levels are indicative of inhibition of PTP1B expression. Reductions in levels of a PTP1B protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes are indicative of inhibition of PTP1B expression. In certain embodiments, reduced glucose levels, reduced lipid levels, and reduced body weight can be indicative of inhibition of PTP1B expression. In certain 0 embodiments, amelioration of symptoms associated with metabolic disease can be indicative of inhibition of PTP1B expression. In certain embodiments, amelioration of symptoms associated with diabetes can be indicative of inhibition of PTP1B expression. In certain embodiments, reduction of insulin resistance is indicative of inhibition of PTP1B expression. In certain embodiments, reduction of diabetes biomarkers can be indicative of inhibition of PTP1B expression. 5

Hybridization

In some embodiments, hybridization occurs between an antisense compound disclosed herein and a PTP IB nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of 0 the nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically 5 hybridizable with a PTP 1B nucleic acid.

Complementarity

An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, 0 such as a PTP 1B nucleic acid).

An antisense compound may hybridize over one or more segments of a PTP IB nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure). 35 WO 2012/142458 PCT/US2012/033588

In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a PTP1B nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined 5 using routine methods.

For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary 0 nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment 5 search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215,403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2,482 489). 0 In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, antisense compound may be fully complementary to a PTP1B nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target 5 nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be “fully complementary” to a target sequence that is 400 0 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on 36 WO 2012/142458 PCT/US2012/033588 whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The location of a non-complementary nucleobase may be at the 5’ end or 3’ end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position 5 of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

In certain embodiments, antisense compounds that are, or are up to 12,13,14,15,16,17, 18,19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non- 0 complementary nucleobase(s) relative to a target nucleic acid, such as a PTP1B nucleic acid, or specified portion thereof.

In certain embodiments, antisense compounds that are, or are up to 12,13, 14,15,16, 17, 18, 19, 20, 21,22, 23,24,25,26,27,28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to 5 a target nucleic acid, such as a PTP1B nucleic acid, or specified portion thereof.

The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense 0 compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are : 5 complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementaiy to at least a 16 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 17 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 18 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least SO a 19 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 20 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9,10,11,12,13,14,15,16, 17,18,19,20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity 37 WO 2012/142458 PCT/US2012/033588

The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA 5 sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that 0 have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

Modifications 5 A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a 0 linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the intemucleoside linkages of the oligonucleotide.

Modifications to antisense compounds encompass substitutions or changes to intemucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for 5 nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Intemucleoside Linkages 0 The naturally occurring intemucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over antisense compounds having naturally occurring intemucleoside linkages 38 WO 2012/142458 PCT/US2012/033588 because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphorus atom. 5 Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid comprise one or more modified intemucleoside linkages. In certain embodiments, the modified intemucleoside linkages are 0 phosphorothioate linkages. In certain embodiments, each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage.

Modified Sugar Moieties

Antisense compounds provided herein can optionally contain one or more nucleosides wherein the 5 sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include, without limitation, addition of substitutent groups (including 5' and 2' substituent groups); bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA); .’ 0 replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1 )(R)2 (R = H, C1-C12 alkyl or a protecting group); and combinations thereof. Examples of chemically modified sugars include, 2'-F-5'-methyl substituted nucleoside (see, PCT International Application WO 2008/101157, published on 8/21/08 for other disclosed 5', 2'-bis substituted nucleosides), replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see, published U.S. Patent Application US2005/0130923, published on June .’5 16,2005), or, alternatively, 5'-substitution of a BNA (see, PCT International Application WO 2007/134181, published on 11/22/07, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).

Examples of nucleosides having modified sugar moieties include, without limitation, nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH3, and 2'-O(CH2)2OCH3 substituent groups. The substituent at the 2’ position can also be selected from allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, ) 0 OCF3, O(CH2)2SCH3, O(CH2)2-O-N(Rm)(Rn), and O-CH2-C(=O)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl.

As used herein, “bicyclic nucleosides” refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, without limitation, nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein 39 WO 2012/142458 PCT/US2012/033588 include one or more bicyclic nucleosides wherein the bridge comprises a 4’ to 2’ bicyclic nucleoside. Examples of such 4’ to 2’ bicyclic nucleosides, include, but are not limited to, one of the formulae: 4'-(CH2)-0-2’ (LNA); 4’-(CH2)-S-2’; 4'-(CH2)2-O-2’ (ENA); 4’-CH(CH3)-O-2’ and 4’-CH(CH2OCH3)-O-2’, and analogs thereof (see, U.S. Patent 7,399,845, issued on July 15,2008); 4'-C(CH3)(CH3)-O-2', and analogs thereof (see, 5 published PCT International Application W02009/006478, published January 8, 2009); 4'-CH2-N(OCH3)-2', and analogs thereof (see, published PCT International Application W02008/150729, published December 11, 2008); 4'-CH2-O-N(CH3)-2' (see, published U.S. Patent Application US2004/0171570, published September 2, 2004); 4'-CH2-N(R)-O-2', wherein R is H, CrCi2 alkyl, or a protecting group (see, U.S. Patent 7,427,672, issued on September 23,2008); 4'-CH2-C(H)(CH3)-2' (see, Chattopadhyaya, et al., J. Org. Chem.,2009, 74,

0 118-134); and 4'-CH2-C(=CH2)-2', and analogs thereof (see, published PCT International Application WO 2008/154401, published on December 8,2008). Also see, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. 5. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8,2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 5 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001,2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum e/ al., Curr. Opinion Mol. Ther., 2001, 3,239-243; U.S. Patent Nos U.S. 6,670,461,7,053,207, 6,268,490,6,770,748, 6,794,499, 7,034,133, 6,525,191, 7,399,845; published PCT International applications WO 2004/106356, WO 94/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent Publication Nos. US2004/0171570, US2007/0287831, and US2008/0039618; and U.S. Patent Serial Nos. 12/129,154,

0 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844; and PCT

International Application Nos. PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.

Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25,1999 as WO 99/14226). 5 In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2’ position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[CiRaXR,.)].,-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)r, -S(=O)X-, and -N(Ra)-; wherein: 0 x is 0,1, or 2; n is 1,2, 3, or 4; each Ra and Rb is, independently, H, a protecting group, hydroxyl, CrC]2 alkyl, substituted CrC]2 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C]2 alkynyl, substituted C2-Ci2 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, 40 WO 2012/142458 PCT/US2012/033588 C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ] J2, SJi, N3, COOJi, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-Ji), or sulfoxyl (S(=O)-Ji); and each J] and J2 is, independently, H, CrCi2 alkyl, substituted CrCi2 alkyl, C2-Ci2 alkenyl, substituted C2-C]2 alkenyl, C2-C]2 alkynyl, substituted C2-Ci2 alkynyl, C5-C20 aryl, substituted C5-C20 aiyl, acyl (C(=O)- 5 H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, Ci-C]2 aminoalkyl, substituted C]-Ci2 aminoalkyl, or a protecting group.

In certain embodiments, the bridge of a bicyclic sugar moiety is, -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(RaRb)-N(R)-O- or, -C(RaRb)-O-N(R)-. In certain embodiments, the bridge is 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-O-N(R)-2', and 4’-CH2-N(R)-O-2’-, wherein each Ris, 0 independently, H, a protecting group, or Ci-C]2 alkyl.

In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4’-2’ methylene-oxy bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4’-CH2-O-2’) BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365- 5 6372).

In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L-Methyleneoxy (4’-CH2-O-2’) BNA, (B) β-D-Methyleneoxy (4’-CH2-O-2’) BNA , (C) Ethyleneoxy (4’-(CH2)2-O-2’) BNA, (D) Aminooxy (4’-CH2-O-N(R)-2’) BNA, (E) Oxyamino (4’-CH2-N(R)-O-2’) BNA, (F)

Methyl(methyleneoxy) (4’-CH(CH3)-O-2’) BNA, (G) methylene-thio (4’-CH2-S-2’) BNA, (H) methylene-0 amino (4’-CH2-N(R)-2’) BNA, (I) methyl carbocyclic (4’-CH2-CH(CH3)-2’) BNA, and (J) propylene carbocyclic (4’-(CH2)3-2’) BNA as depicted below.

<img img-format="tif" img-content="drawing" file="IL228773AD00021.tif" id="idf0001" />

<img img-format="tif" img-content="drawing" file="IL228773AD00022.tif" id="idf0002" />

(E)

<img img-format="tif" img-content="drawing" file="IL228773AD00023.tif" id="idf0003" />

41 WO 2012/142458 PCT/US2012/033588

<img img-format="tif" img-content="drawing" file="IL228773AD00024.tif" id="idf0004" />

wherein Bx is the base moiety and R is, independently, H, a protecting group or C1-C12 alkyl. In certain embodiments, bicyclic nucleoside having Formula I:

<img img-format="tif" img-content="drawing" file="IL228773AD00025.tif" id="idf0005" />

wherein:

Bx is a heterocyclic base moiety;

-Qa-Qb-Qc- is -CH2-N(Rc)-CH2-, -C(=O)-N(Rc)-CH2-, -CH2-O-N(Rc)-, -CH2-N(Rc)-O-, or -N(Rc)-O 0 CH2;

Rc is Ci-C12 alkyl or an amino protecting group; and

Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium.

In certain embodiments, bicyclic nucleoside having Formula II:

<img img-format="tif" img-content="drawing" file="IL228773AD00026.tif" id="idf0006" />

wherein:

Bx is a heterocyclic base moiety; 0 Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; 42 WO 2012/142458 PCT/US2012/033588

Za is Ci-C6 alkyl, C2-C6 alkenyl, C2-Ce alkynyl, substituted Ci-C6 alkyl, substituted C2-Ce alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol, or substituted thio.

In one embodiment, each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJC, NJcJ&lt;i, SJC, N3, OC(=X)Jc, and 5 NJeC(=X)NJcJd, wherein each Jc, Jd, and Je is, independently, H, Ci-Ce alkyl, or substituted Cj-Ce alkyl and X is O or NJC.

In certain embodiments, bicyclic nucleoside having Formula III:

Ta

I

<img img-format="tif" img-content="drawing" file="IL228773AD00027.tif" id="idf0007" />

0 wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium;

Zb is Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C]-C6 alkyl, substituted C2-C6 alkenyl, 5 substituted C2-C6 alkynyl, or substituted acyl (C(=O)-).

In certain embodiments, bicyclic nucleoside having Formula IV:

<img img-format="tif" img-content="drawing" file="IL228773AD00028.tif" id="idf0008" />

wherein: 0 Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium;

Rd is Ci-Ce alkyl, substituted CpCe alkyl, C2-Ce alkenyl, substituted C2-Ce alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; 43 WO 2012/142458 PCT/US2012/033588 each qt,, qc and qa is, independently, H, halogen, Ci-C6 alkyl, substituted Cj-Ce alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl, Cj-C6 alkoxyl, substituted Cr Ce alkoxyl, acyl, substituted acyl, Ci-C6 aminoalkyl, or substituted Ci-C6 aminoalkyl;

In certain embodiments, bicyclic nucleoside having Formula V:

<img img-format="tif" img-content="drawing" file="IL228773AD00029.tif" id="idf0009" />

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive 0 phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; qa, qb, Qe and qf are each, independently, hydrogen, halogen, C]-C]2 alkyl, substituted Cj-Ci2 alkyl, C2-

Cj2 alkenyl, substituted C2-Ci2 alkenyl, C2-C]2 alkynyl, substituted C2-Cj2 alkynyl, Cj-C12 alkoxy, substituted C,-C,2 alkoxy, OJj5 SJj9 SOJj5 SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj5 O-C(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk orN(H)C(=S)NJjJk; 5 or qe and qf together are =C(qg)(qh); qg and qh are each, independently, H, halogen, Cj-C^ alkyl, or substituted Ci-C12 alkyl.

The synthesis and preparation of the methyleneoxy (4’-CH2-O-2’) BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine, and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (see, e.g., Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). 0 BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.

Analogs of methyleneoxy (4’-CH2-O-2’) BNA, methyleneoxy (4’-CH2-O-2’) BNA, and 2'-thio- BNAs, have also been prepared (see, e.g., Kumar et al., Bioorg. Med. Chem. Lett., 1998,8,2219-2222). Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (see, e.g., Wengel et al., WO 99/14226). Furthermore, 5 synthesis of 2'-amino-BNA, a novel comformationally restricted high-affinity oligonucleotide analog, has been described in the art (see, e.g., Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-amino- and 2'-methylamino-BNA’s have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

In certain embodiments, bicyclic nucleoside having Formula VI: 44 WO 2012/142458 PCT/US2012/033588

<img img-format="tif" img-content="drawing" file="IL228773AD000210.tif" id="idf0010" />

wherein:

Bx is a heterocyclic base moiety; 5 Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; each qi5 qj, qk and qj is, independently, H, halogen, C1-C12 alkyl, substituted Ci-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxyl, substituted Cr C,2 alkoxyl, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj5 C(=O)NJjJk, C(=O)Jj, O-C(=O)NJjJk, 0 N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk, orN(H)C(=S)NJjJk; and q; and qj or qj and qk together are =C(qg)(qh), wherein qg and qh are each, independently, H, halogen, C1-C12 alkyl, or substituted C1-C12 alkyl.

One carbocyclic bicyclic nucleoside having a 4'-(CH2)3-2' bridge and the alkenyl analog, bridge 4'-CH=CH-CH2-2', have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997,25(22), 4429- 5 4443 and Albaek et al., J. Org. Chem., 2006, 77,7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Smastava et al., J. Am. Chem. Soc. 2007, 729(26), 8362-8379).

As used herein, “4’-2’ bicyclic nucleoside” or “4’ to 2’ bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting the 2’ carbon atom and the 4’ carbon 0 atom.

As used herein, “monocylic nucleosides” refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.

As used herein, “2’-modified sugar” means a furanosyl sugar modified at the 2’ position. In certain 5 embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2’ modifications are selected from substituents including, but not limited to: O[(CH2)nO]mCH3, O(CH2)„NH2, O(CH2)„CH3, O(CH2)„ONH2, OCH2C(=O)N(H)CH3, and 0 O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other 2'- substituent groups can also be selected from: C1-C12 alkyl; substituted alkyl; alkenyl; alkynyl; alkaryl; aralkyl; O-alkaiyl or O-aralkyl; SH; 45 WO 2012/142458 PCT/US2012/033588 SCH3; OCN; Cl; Br; CN; CF3; OCF3; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving pharmacokinetic properties; and a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In 5 certain embodiments, modifed nucleosides comprise a 2’-MOE side chain (see, e.g., Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2’- O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (see, e.g., Martin, 0 B.,Helv. Chim. Acta, 1995, 78,486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al.,

Biochem. Soc. Trans., 1996,24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997,16, 917-926).

As used herein, a “modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran “sugar” substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate). Modified THP nucleosides include, but are not limited to, what is 5 referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. &amp;amp; Med. Chem. (2002) 10:841-854), fhioro HNA (F-HNA), or those compounds having Formula X:

Formula X:

<img img-format="tif" img-content="drawing" file="IL228773AD000211.tif" id="idf0011" />

wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula X:

Bx is a heterocyclic base moiety; 0 T3 and T4 are each, independently, an intemucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T3 and T4 is an intemucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, 92, q3, q4, 9s, 96 and 97 are each, independently, H, Ci-C6 alkyl, substituted Ci-C6 alkyl, C2-C6 5 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and one of Ri and R2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJiJ2, SJb N3, OC(=X)J], OC(=X)NJiJ2, NJ3C(=X)NJjJ2, and CN, wherein X is O, S, or NJb and each Ji, J2, and J3 is, independently, H or Ci-C6 alkyl. 46 WO 2012/142458 PCT/US2012/033588

In certain embodiments, the modified THP nucleosides of Formula X are provided wherein qm, qn, qp, qr, qs, qti and qu are each H. In certain embodiments, at least one of qm, qn, qp, qr, qs, qt, and qu is other than H.

In certain embodiments, at least one of qm, qn, qp, qr, qs, qt and qu is methyl. In certain embodiments, THP nucleosides of Formula X are provided wherein one of Rj and R2 is F. In certain embodiments, Ri is fluoro 5 and R2 is H, Ri is methoxy and R2 is H, and R] is methoxyethoxy and R2 is H.

As used herein, “2’-modified” or “2’-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2’ position other than H or OH. 2’-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2’ carbon and another carbon of the sugar ring and nucleosides with non-bridging 2’substituents, such as 0 allyl, amino, azido, thio, O-allyl, O-CrCi0 alkyl, -OCF3, O-(CH2)2-O-CH3,2'-O(CH2)2SCH3, O-(CH2)2-O-N(Rm)(Rn), or O-CH2-C(=O)-N(Rm)(Rn), where each Rm and R„ is, independently, H or substituted or unsubstituted Cj-Cio alkyl. 2’-modifed nucleosides may further comprise other modifications, for example, at other positions of the sugar and/or at the nucleobase.

As used herein, “2’-F” refers to a sugar comprising a fluoro group at the 2’ position. 5 As used herein, “2’-OMe” or “2’-OCH3” or “2’-O-methyl” each refers to a sugar comprising an - OCH3 group at the 2’ position of the sugar ring.

As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA). 0 Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, e.g., review article: Leumann, J. C, Bioorganic &amp;amp; Medicinal Chemistry, 2002,10, 841-854).

Such ring systems can undergo various additional substitutions to enhance activity.

Methods for the preparations of modified sugars are well known to those skilled in the art. 5 In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2’-MOE. In certain embodiments, the 2’-M0E modified nucleotides are arranged in a gapmer motif. In certain embodiments, the modified sugar 0 moiety is a cEt. In certain embodiments, the cEt modified nucleotides are arranged throughout the wings of a gapmer motif.

Modified Nucleobases 47 WO 2012/142458 PCT/US2012/033588

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may impart nuclease stability, binding affinity or some other beneficial biological property to antisense 5 compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, .0 Boca Raton, 1993, pp. 276-278).

Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-CsC-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, 5 cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced 0 with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid comprise one or 5 more modified nucleobases. In certain embodiments, gap-widened antisense oligonucleotides targeted to a PTP1B nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Compositions and Methods for Formulating Pharmaceutical Compositions

Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert 0 substance for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Antisense compound targeted to a PTP1B nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or 48 WO 2012/142458 PCT/US2012/033588 carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a PTP1B nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the 5 pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite 0 or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

Pharmaceutically acceptable salts of the compounds described herein may be prepared by methods 5 well-known in the art. For a review of pharmaceutically acceptable salts, see Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley-VCH, Weinheim, Germany, 2002). Sodium salts of antisense oligonucleotides are useful and are well accepted for therapeutic administration to humans. Accordingly, in one embodiment the compounds described herein are in the form of a sodium salt. A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense 0 compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Conjugated Antisense Compounds

Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical : 5 conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease 10 stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5'-stabilizing groups that can be used to cap one or both ends of an 49 WO 2012/142458 PCT/US2012/033588 antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16,2003.

Cell culture and antisense compounds treatment

The effects of antisense compounds on the level, activity or expression of PTP1B nucleic acids can 5 be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and cells are cultured according to the vendor’s instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, primary hepatocytes, A549 cells, GM04281 0 fibroblasts and LLC-MK2 cells.

In vitro testing of antisense oligonucleotides

Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-5 80% confluence in culture.

One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, CA). Antisense oligonucleotides are mixed with LIPOFECTIN® in ΟΡΊΊ-ΜΕΜ® 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 0 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE 2000® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with LIPOFECTAMINE 2000® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically 5 ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with Cytofectin® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide. 0 Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.

Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic 50 WO 2012/142458 PCT/US2012/033588 acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the 5 art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000®, Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation. RNA Isolation

RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA 0 isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s recommended protocols.

Analysis of inhibition of target levels or expression

Inhibition of levels or expression of a PTP1B nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, 5 competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer’s instructions. : 0 Quantitative Real-Time PCR Analysis of Target RNA Levels

Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer’s instructions. Methods of quantitative real-time PCR are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which i 5 produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.

The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.

Gene (or RNA) target quantities obtained by real time PCR are normalized using either the

10 expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invitrogen, Inc. Eugene, OR). Methods of RNA quantification 51 WO 2012/142458 PCT/US2012/033588

by RIBOGREEN® are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN® fluorescence.

Probes and primers are designed to hybridize to a PTP1B nucleic acid. Methods for designing real time PCR probes and primers are well known in the art, and may include the use of software such as 5 PRIMER EXPRESS® Software (Applied Biosystems, Foster City, CA).

Analysis of Protein Levels

Antisense inhibition of PTP1B nucleic acids can be assessed by measuring PTP1B protein levels. Protein levels of PTP1B can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay 0 (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of human 5 and rat PTP1B are commercially available.

In vivo testing of antisense compounds

Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of PTP1B and produce phenotypic changes. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are 0 formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration. Following a period of treatment with antisense oligonucleotides, RNA is isolated from tissue and changes in PTP1B nucleic acid expression are measured. Changes in PTP1B protein levels are also measured.

Certain Indications 5 In certain embodiments, provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has metabolic related disease.

As shown in the examples below, compounds targeted to PTP1B, as described herein, have been shown to reduce the severity of physiological symptoms of metabolic related diseases, including metabolic 0 syndrome, diabetes mellitus, insulin resistance, diabetic dyslipidemia, hypertriglyceridemia, obesity and weight gain. In certain of the experiments, the compounds reduced blood glucose levels, e.g., the animals continued to experience symptoms, but the symptoms were less severe compared to untreated animals. In other of the experiments, however, the compounds appear to reduce the symptoms of diabetes; e.g., animals 52 WO 2012/142458 PCT/US2012/033588 treated for a longer period of time experienced less severe symptoms than those administered the compounds for a shorter period of time. In other of the experiments, however, the compounds appear to inhibit weight gain; e.g., animals treated for a longer period of time experienced less severe symptoms than those administered the compounds for a shorter period of time. In other of the experiments, however, the 5 compounds appear to inhibit hypertriglyceridemia; e.g., animals treated for a longer period of time experienced less severe symptoms than those administered the compounds for a shorter period of time. The ability of the compounds exemplified below to restore function therefore demonstrates that symptoms of the disease may be reversed by treatment with a compound as described herein.

Diabetes mellitus is characterized by numerous physical and physiological symptoms. Any symptom 0 known to one of skill in the art to be associated with Type 2 diabetes can be ameliorated or otherwise modulated as set forth above in the methods described above. In certain embodiments, the symptom is a physical symptom selected from the group consisting of increased glucose levels, increased weight gain, frequent urination, unusual thirst, extreme hunger, extreme fatigue, blurred vision, frequent infections, tingling or numbness at the extremities, dry and itchy skin, weight loss, slow-healing sores, and swollen 5 gums.

In certain embodiments, the symptom is a physiological symptom selected from the group consisting of increased insulin resistance, increased glucose levels, increased fat mass, decreased metabolic rate, decreased glucose clearance, decreased glucose tolerance, decreased insulin sensitivity, decreased hepatic insulin sensitivity, increased adipose tissue size and weight, increased body fat, and increased body weight. 0 In certain embodiments, the physical symptom is increased weight gain. In certain embodiments, the symptom is frequent urination. In certain embodiments, the symptom is unusual thirst. In certain embodiments, the symptom is extreme hunger. In certain embodiments, the symptom is extreme fatigue. In certain embodiments, the symptom is blurred vision. In certain embodiments, the symptom is frequent infections. In certain embodiments, the symptom is tingling or numbness at the extremities. In certain 5 embodiments, the symptom is dry and itchy skin. In certain embodiments, the symptom is weight loss. In certain embodiments, the symptom is slow-healing sores. In certain embodiments, the symptom is swollen gums. In certain embodiments, the symptom is increased insulin resistance. In certain embodiments, the symptom is increased fat mass. In certain embodiments, the symptom is decreased metabolic rate. In certain embodiments, the symptom is decreased glucose clearance. In certain embodiments, the symptom is 0 decreased glucose tolerance. In certain embodiments, the symptom is decreased insulin sensitivity. In certain embodiments, the symptom is decreased hepatic insulin sensitivity. In certain embodiments, the symptom is increased adipose tissue size and weight. In certain embodiments, the symptom is increased body fat. In certain embodiments, the symptom is increased body weight. 53 WO 2012/142458 PCT/US2012/033588

Liu and Chemoff have shown that PTP1B binds to and serves as a substrate for the epidermal growth factor receptor (EGFR) (Liu and Chemoff, Biochem. J., 1997, 327, 139-145). Furthermore, in A431 human epidermoid carcinoma cells, PT1B was found to be inactivated by the presence of H2O2 generated by the addition of EGF. These studies indicate that PTP1B can be negatively regulated by the oxidation state of the 5 cell, which is often deregulated during tumorigenesis (Lee et al., J. Biol. Chem., 1998,273,15366-15372).

Overexpression of PTP1B has been demonstrated in malignant ovarian cancers and this correlation was accompanied by a concomitant increase in the expression of the associated growth factor receptor (Wiener et al., Am. J. Obstet. Gynecol., 1994,170, 1177-1183). PTP1B has been shown to suppress transformation in NIH3T3 cells induced by the neu oncogene . 0 (Brown-Shimer et al., Cancer Res., 1992, 52,478-482), as well as in rat 3Y1 fibroblasts induced by v-srk, v- src, and v-ras (Liu et al., Mol. Cell. Biol., 1998,18, 250-259) and rat-1 fibroblasts induced by bcr-abl (LaMontagne et al., Proc. Natl. Acad. Sci. U. S. A., 1998, 95, 14094-14099). It has also been shown that PTP1B promotes differentiation of K562 cells, a chronic myelogenous leukemia cell line, in a similar manner as does an inhibitor of the bcr-abl oncoprotein. These studies describe the possible role of PTP1B in 5 controlling the pathogenesis of chronic myeloid leukemia (LaMontagne et al., Proc. Natl. Acad. Sci. U. S. A., 1998, 95,14094-14099).

Accordingly, provided herein are methods for ameliorating a symptom associated with hyperproliferative disorders in a subject in need thereof. In certain embodiments, the hyperproliferative disorder is cancer. In certain embodiments, provided herein are methods for ameliorating a symptom 0 associated with cancer. In certain embodiments, provided is a method for reducing the rate of onset of a symptom associated with hyperproliferative disorders. In certain embodiments, provided is a method for reducing the rate of onset of a symptom associated with cancer. In certain embodiments, provided is a method for reducing the severity of a symptom associated with hyperproliferative disorders. In certain embodiments, provided is a method for reducing the severity of a symptom associated with cancer. In such embodiments, 5 the methods comprise administering to an individual in need thereof a therapeutically effective amount of a compound targeted to a PTP1B nucleic acid.

In certain embodiments, provided are methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has metabolic related disease. 0 In certain embodiments, administration of an antisense compound targeted to a PTP1B nucleic acid results in reduction of PTP1B expression by at least about 15, 20,25,30, 35,40,45, 50, 55, 60, 65,70, 75, 80, 85, 90,95 or 99%, or a range defined by any two of these values. 54 WO 2012/142458 PCT/US2012/033588

In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to transthyretin are used for the preparation of a medicament for treating a patient suffering or susceptible to metabolic related disease.

In certain embodiments, the methods described herein include administering a compound comprising 5 a modified oligonucleotide having a contiguous nucleobases portion as described herein of a sequence recited in SEQ ID NO: 26 (ISIS 404173).

Administration

In certain embodiments, the compounds and compositions as described herein may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be 0 treated. Administration may be topical, pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. The compounds and compositions as described herein can be administered directly to a tissue or organ.

In certain embodiments, the compounds and compositions as described herein are administered parenterally. “Parenteral administration” means administration through injection or infusion. Parenteral 5 administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intracerebral administration, intrathecal administration, intraventricular administration, ventricular administration, intracerebroventricular administration, cerebral intraventricular administration or cerebral ventricular administration. Administration can be continuous, or chronic, or short or intermittent. : 0 In certain embodiments, parenteral administration is by injection. The injection can be delivered with a syringe or a pump. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to a tissue or organ.

In certain embodiments, the compounds and compositions as described herein are administered parenterally. .’ 5 In certain embodiments, parenteral administration is subcutaneous.

In further embodiments, the formulation for administration is the compounds described herein and saline.

In certain embodiments, an antisense oligonucleotide is delivered by injection or infusion once eveiy month, eveiy two months, eveiy 90 days, eveiy 3 months, eveiy 6 months, twice a year or once a year. 10

Certain Combination Therapies 55 WO 2012/142458 PCT/US2012/033588

In certain embodiments, one or more pharmaceutical compositions of the present invention are coadministered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions described herein. In certain embodiments, such one or more other 5 pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions described herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, one or more pharmaceutical compositions are coadministered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical . 0 agent. In certain embodiments, one or more pharmaceutical compositions are co-administered with another pharmaceutical agent to produce a combinational effect. In certain embodiments, one or more pharmaceutical compositions are co-administered with another pharmaceutical agent to produce a synergistic effect.

In certain embodiments, a first agent and one or more second agents are administered at the same . 5 time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.

In certain embodiments, the second compound is administered prior to administration of a 0 pharmaceutical composition of the present invention. In certain embodiments, the second compound is administered following administration of a pharmaceutical composition of the present invention. In certain embodiments, the second compound is administered at the same time as a pharmaceutical composition of the present invention. In certain embodiments, the dose of a co-administered second compound is the same as the dose that would be administered if the second compound was administered alone. In certain 5 embodiments, the dose of a co-administered second compound is lower than the dose that would be administered if the second compound was administered alone. In certain embodiments, the dose of a coadministered second compound is greater than the dose that would be administered if the second compound was administered alone.

In certain embodiments, the co-administration of a second compound enhances the effect of a first 0 compound, such that co-administration of the compounds results in an effect that is greater than the effect of administering the first compound alone. In certain embodiments, the co-administration results in effects that are additive of the effects of the compounds when administered alone. In certain embodiments, the co administration results in effects that are supra-additive of the effects of the compounds when administered 56 WO 2012/142458 PCT/US2012/033588 alone. In certain embodiments, the first compound is an antisense compound. In certain embodiments, the second compound is an antisense compound.

In certain embodiments, second agents include, but are not limited to, a glucose-lowering agent. The glucose lowering agent can include, but is not limited to, a therapeutic lifestyle change, PPAR agonist, a 5 dipeptidyl peptidase (IV) inhibitor, a GLP-1 analog, insulin or an insulin analog, an insulin secretagogue, a SGLT2 inhibitor, a human amylin analog, a biguanide, an alpha-glucosidase inhibitor, or a combination thereof. The glucose-lowering agent can include, but is not limited to metformin, sulfonylurea, rosiglitazone, meglitinide, thiazolidinedione, alpha-glucosidase inhibitor or a combination thereof. The sulfonylurea can be acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, a glipizide, a glyburide, or a 0 gliclazide. The meglitinide can be nateglinide or repaglinide. The thiazolidinedione can be pioglitazone or rosiglitazone. The alpha-glucosidase can be acarbose or miglitol.

In some embodiments, the glucose-lowering therapeutic is a GLP-1 analog. In some embodiments, the GLP-1 analog is exendin-4 or liraglutide.

In other embodiments, the glucose-lowering therapeutic is a sulfonylurea. In some embodiments, the 5 sulfonylurea is acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, a glipizide, a glyburide, or a gliclazide.

In some embodiments, the glucose-lowering drug is a biguanide. In some embodiments, the biguanide is metformin, and in some embodiments, blood glucose levels are decreased without increased lactic acidosis as compared to the lactic acidosis observed after treatment with metformin alone. 0 In some embodiments, the glucose-lowering drug is a meglitinide. In some embodiments, the meglitinide is nateglinide or repaglinide.

In some embodiments, the glucose-lowering drug is a thiazolidinedione. In some embodiments, the thiazolidinedione is pioglitazone, rosiglitazone, or troglitazone. In some embodiments, blood glucose levels are decreased without greater weight gain than observed with rosiglitazone treatment alone. ! 5 In some embodiments, the glucose-lowering drug is an alpha-glucosidase inhibitor. In some embodiments, the alpha-glucosidase inhibitor is acarbose or miglitol.

In a certain embodiment, a co-administered glucose-lowering agent is ISIS 113715.

In a certain embodiment, glucose-lowering therapy is therapeutic lifestyle change.

In certain embodiments, second agents include, but are not limited to, lipid-lowering agents. The 10 lipid-lowering agent can include, but is not limited to atorvastatin, simvastatin, rosuvastatin, and ezetimibe. In certain such embodiments, the lipid-lowering agent is administered prior to administration of a 57 WO 2012/142458 PCT/US2012/033588 pharmaceutical composition of the present invention. In certain such embodiments, the lipid-lowering agent is administered following administration of a pharmaceutical composition of the present invention. In certain such embodiments the lipid-lowering agent is administered at the same time as a pharmaceutical composition of the present invention. In certain such embodiments the dose of a co-administered lipid-lowering agent is 5 the same as the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is lower than the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is greater than the dose that would be administered if the lipid-lowering agent was administered alone. 0 In certain embodiments, a co-administered lipid-lowering agent is a HMG-CoA reductase inhibitor.

In certain such embodiments the HMG-GoA reductase inhibitor is a statin. In certain such embodiments the statin is selected from atorvastatin, simvastatin, pravastatin, fluvastatin, and rosuvastatin.

In certain embodiments, a co-administered lipid-lowering agent is a cholesterol absorption inhibitor. In certain such embodiments, cholesterol absorption inhibitor is ezetimibe.

5 In certain embodiments, a co-administered lipid-lowering agent is a co-formulated HMG-CoA reductase inhibitor and cholesterol absorption inhibitor. In certain such embodiments the co-formulated lipidlowering agent is ezetimibe/simvastatin.

In certain embodiments, a co-administered lipid-lowering agent is a microsomal triglyceride transfer protein inhibitor (MTP inhibitor). 0 In certain embodiments, a co-administered lipid-lowering agent is an oligonucleotide targeted to

ApoB.

In certain embodiments, second agents include, but are not limited to an anti-obesity drug or agent. Such anti-obesity agents include but are not limited to Orlistat, Sibutramine, or Rimonabant, and may be administered as described above as adipose or body weight lowering agents. In certain embodiments, the 5 antisense compound may be co-administered with appetite suppressants. Such appetite suppressants include but are not limited to diethylpropion tenuate, mazindol, orlistat, phendimetrazine, phentermine, and sibutramine and may be administered as described herein. In certain embodiment, the anti-obesity agents are CNS based such as, but not limited to, sibutramine or GLP-1 based such as, but not limited to, liraglutide.

Formulations 0 The compounds provided herein may also be admixed, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, or other formulations, for assisting in uptake, distribution and/or absorption. Representative 58 228773/2

United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S.: 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756 .

The antisense compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. 0 The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds provided herein: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. The term “pharmaceutically acceptable salt” includes a salt prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic or organic acids and bases. For oligonucleotides, preferred examples of pharmaceutically 5 acceptable salts and their uses are further described in U.S. Patent 6,287,860.

Sodium salts have been shown to be suitable forms of oligonucleotide drugs.

The term “pharmaceutically acceptable derivative” encompasses, but is not limited to, pharmaceutically acceptable salts, solvates, hydrates, esters, prodrugs, polymorphs, isomers, isotopically labeled variants of the compounds described herein. 0 The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds provided herein. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., : 5 intracerebral administration, intrathecal administration, intraventricular administration, ventricular administration, intracerebroventricular administration, cerebral intraventricular administration or cerebral ventricular administration.

Parenteral administration, is preferred to target PTP1B expression in the liver and plasma. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for 10 oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. 59 228773/2

The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and 5 intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non- 0 aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations 5 of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.

Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 pm in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in the aqueous phase, oily phase 0 or itself as a separate phase. Microemulsions are included as an embodiment of the present invention.

Emulsions and their uses are well known in the art and are further described in U.S. Patent 6,287,860,.

Formulations of the present invention include liposomal formulations. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical 5 bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationie liposomes have been used to deliver 0 DNA to cells.

Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Liposomes and their uses are further described in U.S. Patent 6,287,860. 60 228773/2

In another embodiment, formulations of the present invention include saline formulations. In certain embodiments, a formulation consists of the compounds described herein and saline. In certain embodiments, a formulation consists essentially of the compounds described herein and saline. In certain embodiments, the saline is pharmaceutically acceptable grade saline. In certain embodiments, the saline is buffered saline. In 5 certain embodiments, the saline is phosphate buffered saline (PBS).

In certain embodiments, a formulation excludes liposomes. In certain embodiments, the formulation excludes sterically stabilized liposomes. In certain embodiments, a formulation excludes phospholipids. In certain embodiments, the formulation consists essentially of the compounds described herein and saline and excludes liposomes. 0 The pharmaceutical formulations and compositions of the present invention may also include surfactants. Surfactants and their uses are further described in U.S. Patent 6,287,860.

In one embodiment, the present invention employs various penetration enhancers to affect the efficient delivery of nucleic acids, particularly oligonucleotides. Penetration enhancers and their uses are 5 further described in U.S. Patent 6,287,860.

One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.

Formulations for topical administration include those in which the oligonucleotides provided herein are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, 0 chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).

Compositions and formulations for parenteral administration, including intravenous, intraarterial, 5 subcutaneous, intraperitoneal, intramuscular injection or infusion, or intracranial may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

Certain embodiments provided herein provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents which function by a non-antisense S 0 mechanism. Examples of such chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, 61 228773/2 amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, 5 gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds provided herein, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal 0 anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions provided herein. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.

In another related embodiment, compositions provided herein may contain one or more antisense 5 compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Alternatively,, compositions provided herein may contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially. 0 Dosing

The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from 5 measurements of drug accumulation in the body of the patient. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC5os found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 pg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or at desired intervals. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the 0 recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 pg to 100 g per kg of body weight, once or more daily.

While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same. 62 228773/2

Certain Compounds

About two hundred and seventy six newly designed antisense compounds of various lengths, motifs and backbone composition were tested for their effect on human PTP1B mRNA in vitro in several cell types. 5 The new compounds were compared with about five hundred previously designed compounds including ISIS 107772, ISIS 107831, ISIS 142025, ISIS 142026, ISIS 142027, ISIS 142028, ISIS 142082, ISIS 146908, and ISIS 146909 which have previously been determined to be some of the most potent antisense compounds in vitro (see e.g., U.S. Patent Publication No.US 2003/0220282 published 11/27/2003 and PCT Patent Publication No. WO2007/131237 published 11/15/2007). Of the about two hundred and eight five newly

0 designed and previously designed antisense compounds, about eleven compounds were selected for further study based on in vitro potency. The selected compounds were tested for dose dependent inhibition in HuVEC, HepG2, HuVEC, LLC-MK2, and cynomolgus primary hepatocytes. Additional oligonucleotides were designed based on microwalk of ISIS 409826, one of the selected compounds which demonstrated significant reduction of PTP1B mRNA in all the cell lines tested. The oligonucleotides were tested in HuVEC 5 cells (Example 5) along with gapmers from the earlier screen (Example 1). Several antisense oligonucleotides from the screen in Example 5 were selected and tested for dose-dependent inhibition in HuVEC cells (Example 6) and HepG2 cells (Example 7). Additionally, two oligonucleotides were designed as shortmers to ISIS 1428082, one of the selected compounds. These two shortmers (ISIS 446431 and ISIS 446432), as well as five ISIS oligonucleotides selected from the study described in Examples 6 and 7 were tested in HepG2

0 cells, LLC-MK2 cells, HuVEC cells, and cynomolgus primary hepatocytes (Examples 8-11). ISIS oligonucleotides that demonstrated dose-dependent reduction of PTP1B mRNA in all cell lines were tested for in vivo tolerability. Two more oligonucleotides ISIS 446433 and ISIS 446434, designed as shortmers to ISIS 409826, were included in the in vivo tolerability studies as well.

The twelve gapmers chosen were tested in a mouse model (see Example 12) and a rat model ! 5 (Example 13). By virtue of their complementary sequence, the compounds are complementaiy to the regions 3291-3310, 989-1008,3290-3309, 3287-3306, 3291-3310, 3288-3307, 3292-3309, 3293-3308, 3288-3305, and 3289-3304 of SEQ ID NO: 1. In the in vivo models, body weights and organ weights, the liver metabolic markers, such as alanine transaminase, aspartate transaminase and bilirubin, kidney metabolic markers, such as BUN and creatinine, plasma glucose levels, cholesterol and triglyceride levels, and inflammatory cytokine 10 levels were measured. Of the twelve compounds tested, five compounds, ISIS 142082, ISIS 404173, ISIS 410003, ISIS 446431, and ISIS 446432 were selected and their viscosity was measured (Example 14). All the five oligonucleotides were considered optimal in their viscosity according to the criteria stated for the study. 63 WO 2012/142458 PCT/US2012/033588

Final evaluation of these studies (Examples 12-14), led to the selection of four compounds having a nucleobase sequence of a sequence recited in SEQ ID NO: 27 (ISIS 142082), 46 (ISIS 446431), 26 (ISIS 404173), and 23 (ISIS 409826). By virtue of their complementary sequence, the compounds are complementary to the regions 3291-3310, 3292-3309, 3290-3309, 3287-3306 of SEQ ID NO: 1. In certain 5 embodiments, the compounds targeting the listed regions, as further described herein, comprise a modified oligonucleotide having some nucleobase portion of the sequence recited in the SEQ ID NOs, as further described herein, In certain embodiments, the compounds targeting the listed regions or having a nucleobase portion of a sequence recited in the listed SEQ ID NOs can be of various length, as further described herein, and can have one of various motifs, as further described herein. In certain embodiments, a compound 0 targeting a region or having a nucleobase portion of a sequence recited in the listed SEQ ID NOs has the specific length and motif, as indicated by the ISIS NOs: ISIS 142082, ISIS 446431, ISIS 404173, and ISIS 409826.

Three compounds having a nucleobase sequence of a sequence recited in SEQ ID NO: 27 (ISIS 142082), 23 (ISIS 404173), and 46 (ISIS 446431), were further tested in a long-term, six month tolerability 5 study in a mouse model (See Example 15). The half life in the liver of CD1 mice of all four of the compounds having a nucleobase sequence of a sequence recited in SEQ ID NOs: 53 (ISIS 409826), 27 (ISIS 142082), 26 (ISIS 404173), and 46 (ISIS 446431) was also evaluated (Example 16).

These four compounds were tested for efficacy, pharmacokinetic profile and tolerability in cynomolgus monkeys (Example 17). The inhibition studies in these monkeys indicated that treatment with 0 some of these compounds caused reduction of PTP1B mRNA in the liver and fat tissues. Specifically, treatment with ISIS 409826, ISIS 142082, ISIS 446431 and ISIS 404173 caused 45%, 48%, 18 and 22% reduction of PTP1B mRNA in liver tissue, respectively compared to the PBS control. Treatment with ISIS 409826, ISIS 142082, ISIS 446431 and ISIS 404173 caused 21%, 28%, 12% and 31% reduction of PTP1B mRNA in fat tissue, respectively compared to the PBS control. It was noted that ISIS 404173 caused similar 5 reduction of PTP1B mRNA compared to ISIS 142082, even though the two oligonucleotides differ from each other by a single base-pair shift of their target region on SEQ ID NO: 1. Protein analysis of liver tissue was also conducted by western blot analysis. PTP1B mRNA reduction using ISIS 409826, ISIS 142082, ISIS 446431 and ISIS 404173 was measured at a maximum dose of 40 mgk/week for efficacy and at a lower dose of 8mgk/week for potency (See table 45). Protein analysis at a lower dose of 8 mgk/week demonstrated that 0 ISIS 404173 caused greater reduction (33 %) of PTP1B protein than ISIS 142082 (20 %) demonstrating that ISIS 404173 was more potent than ISIS 142082 (See Table 47 and Figure 1). Protein analysis at the higher

dose of 40 mg/week demonstrated that ISIS 404173 (60% protein reduction) was as efficacious as ISIS 142082 (65% protein reduction). Finally, treatment with ISIS 409826 and ISIS 142082 resulted in 22% 64 WO 2012/142458 PCT/US2012/033588 decrease in triglyceride levels while treatment with ISIS 404173 resulted in 37% decrease in triglyceride levels compared to the PBS control.

Tolerability studies in cynomolgus monkeys (Example 17) indicated that treatment with ISIS 142082 was not as tolerable to the primates as treatment with ISIS 404173. The levels of C-reactive protein, which is 5 synthesized in the liver and which serves as a marker of inflammation, were measured on day 93. At the higher dose of 40 mg/week, treatment with ISIS 142082 caused a significant increase of CRP levels of 12 mg/L compared to the control level of 1.2 mg/L. Treatment with ISIS 404173 at 40 mg/L caused an increase of CRP levels to 1.6 mg/L. The other compounds tested, ISIS 409826 and ISIS 446431 caused increase of CRP levels to 4.8 mg/L and 6.7 mg/L. Therefore, ISIS 404173 caused the least increase in CRP levels 0 indicating that ISIS 404173 is extremely tolerable and non-proinflammatory. Organ weights were also measured to evaluate the tolerability of ISIS oligonucleotides by the monkeys. Treatment with ISIS 142082 at a dose of 40 mg/L caused increases in kidney and liver weights of 21 g and 18 g respectively, which is twofold increase over the control (kidney 10 g and liver 10.5 g). Treatment with ISIS 409826 caused a two-fold increase in liver weight (18.5 g vs. 10.5 g of control) and a three-fold increase in spleen weight (6.0 g vs. 2.3 5 g of control). Treatment with ISIS 446431 caused a four-fold increase in spleen weight (9.6 g vs. 2.3 g control). Treatment with ISIS 404173 caused less than one-fold increase in all organs (kidney 14.8g; liver 15.5 g; spleen 3.7 g) See (Figure 2). Hence, treatment with ISIS 142082, ISIS 409826, and ISIS 446431 were not considered tolerable in the monkeys, whereas treatment with ISIS 404173 was tolerable.

Treatment with ISIS 142082 caused increase in organ weights and elevated levels of CRP, indicating 0 an inflammatory state. Treatment with ISIS 409826 also caused elevated levels of CRP and low complement C3 levels, indicating a diseased state. Treatment with ISIS 404173 and ISIS 446431 were considered optimal in terms of their tolerability profiles in cynomolgus monkeys. However, ISIS 446431 demonstrated less potency compared to ISIS 404173.

In case of the pharmacokinetic profile studies of the oligonucleotides in liver and kidney, none of the : 5 ISIS oligonucleotides demonstrated any abnormal ratios in concentration in the liver versus the kidney. ISIS 404173 was a better renal accumulator compared to ISIS 142082, as indicated in the results.

Hence, the in vivo studies, particularly in the cynomolgus monkeys, indicate that ISIS 404173 was just as potent and considerably more tolerable compared to the other compounds. The studies demonstrate that ISIS 142082, although shifted from ISIS 407173 by only one nucleobase, was as efficacious but less S 0 potent and tolerable than ISIS 404173, as demonstrated by assays for metabolic and inflammatory markers. Overall, ISIS 404173 was more potent and tolerable compared to any other compound.

Accordingly, provided herein are antisense compounds with any one or more of the improved characteristics. In a certain embodiments, provided herein are compounds comprising a modified 65 228773/2 oligonucleotide as further described herein targeted to or specifically hybridizable with the region of nucleotides of SEQ ID NO: 1.

Accordingly, provided herein are antisense compounds with any one or more of the improved characteristics. In a certain embodiments, provided herein are compounds comprising a modified 5 oligonucleotide as further described herein targeted to or specifically hybridizable with the region of nucleotides of SEQ ED NO: 2.

In certain embodiments, the compounds as described herein are efficacious by virtue of having at least one of an in vitro IC50 of less than 0.4 μΜ, less than 0.35 μΜ, less than 0.3 μΜ, less than 2.5 μΜ, less than 2.0 μΜ, less than 1.5 μΜ, less than 1.0 μΜ, when delivered to a cynomolgus monkey hepatocyte cell . 0 line using electroporation as described in Example 11. In certain embodiments, the compounds as described herein are highly tolerable, as demonstrated by having at least one of an increase an ALT or AST value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals; or an increase in liver, spleen or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5% or 2%.

.5 EXAMPLES

Non-limiting disclosure

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. 0

Example 1: Antisense inhibition of human PTP1B mRNA in HuVEC cells

Antisense oligonucleotides targeted to a human PTP1B nucleic acid were designed and tested for their effect on PTP1B RNA transcript in vitro. ISIS 107772, ISIS 107831, ISIS 142025, ISIS 142026, ISIS 5 142027, ISIS 142028, ISIS 142082, ISIS 146908, and ISIS 146909, claimed in a previous patent (BIOL001USP2) were included in this assay for comparison. Cultured HuVEC cells at a density of 5,000 cells per well were transfected using LipofectAMINE 2000® with 2 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR. PTP1B mRNA levels were adjusted according to total RNA content, as 0 measured by RIBOGREEN®. Results are presented as percent inhibition of PTP1B mRNA levels, relative to untreated control cells. 66 WO 2012/142458 PCT/US2012/033588

The antisense oligonucleotides in Table 1 are 5-10-5 MOE gapmers or 2-13-5 MOE gapmers. The 5-10-5 MOE gapmers have a gap segment comprising ten 2’-deoxynucleosides and two wing segment comprising five 2’-MOE nucleosides. The 2-13-5 MOE gapmers have a gap segment comprising thirteen 2’-deoxynucleosides, a 5’ wing segment comprising two 2’-MOE nucleosides, and a 3’ wing segment 5 comprising three 2’-MOE nucleosides. The intemucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. ‘Target start site’ indicates the 5’-most nucleotide to which the antisense oligonucleotide is targeted in the human gene sequence. ‘Target stop site’ indicates the 3’-most nucleotide to which the antisense oligonucleotide is targeted in the human gene sequence. All the antisense oligonucleotides listed in Table 1 0 target either the mRNA sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 002827.2) or the genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession NT 011362.9 truncated from nucleotides 14178000 to 14256000), or both.

Some of the human oligonucleotides of Table 1 are also fully cross-reactive with rhesus monkey gene sequences, ‘n/a’ indicates that there were more than 3 base mismatches between the human oligonucleotide 5 and the rhesus monkey gene sequence. The greater the complementarity between the human oligonucleotide and the rhesus monkey sequence, the more likely the human oligonucleotide can cross-react with the rhesus monkey sequence. The human oligonucleotides in Table 1 were compared to SEQ ID NO: 3 (exons 1-9, intron 9 and exon 10 from the rhesus monkey PTP1B scaffold). “Rhesus monkey Target start site” indicates the 5’-most nucleotide to which the gapmer is targeted in the rhesus monkey gene sequence. “Rhesus 0 monkey Target stop site” indicates the 3’-most nucleotide to which the gapmer is targeted rhesus monkey gene sequence.

Table 1

Inhibition of human PTP1B RNA transcript in HuVEC cells by antisense oligonucleotides targeting SEQ ID 5 NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 ISIS No Sequence Motif % inhibition Start Site at SEQ ID NO: 1 Start Site at SEQ ID NO: 2 Start Site at SEQ ID NO: 3 SEQ ID NO 142025 TTGTCGATCTGCTCGAACTC 5-10-5 43 190 1989 197 4 142026 GACTTGTCGATCTGCTCGAA 5-10-5 59 193 1992 989 5 107772 CCCGGACTTGTCGATCTGCT 5-10-5 66 197 1996 3754 6 142027 GCTCCCGGACTTGTCGATCT 5-10-5 55 200 1999 3759 7 142028 CCAGCTCCCGGACTTGTCGA 5-10-5 60 203 2002 4498 8 373125 GGCACCTTCGATCACAGCCA 5-10-5 55 989 70726 4487 9 113715 GCTCCTTCCACTGATCCTGC 5-10-5 50 1035 n/a 4500 10 107831 GGTCATGCACAGGCAGGTTG 5-10-5 70 2360 75039 3753 11 67 WO 2012/142458 PCT/US2012/033588 409988 AGGTCATGCACAGGCAGGTT 2-13-5 83 2361 75040 3759 12 409821 GATCAGGTCATGCACAGGCA 5-10-5 86 2365 75044 3575 13 404176 TGATCAGGTCATGCACAGGC 5-10-5 87 2366 75045 4493 14 146908 ACCCTTGGAATGTCTGAGTT 5-10-5 56 2544 75223 3746 15 404169 CCCATACCCTTGGAATGTCT 5-10-5 77 2549 75228 3756 16 409815 TCCCATACCCTTGGAATGTC 5-10-5 72 2550 75229 3566 17 146909 TTCCCATACCCTTGGAATGT 5-10-5 43 2551 75230 3569 18 409845 TATTCCATGGCCATTGTAAA 5-10-5 23 3283 75962 4485 19 410030 TTATTCCATGGCCATTGTAA 2-13-5 24 3284 75963 4486 20 409825 TTTATTCCATGGCCATTGTA 5-10-5 34 3285 75964 192 21 409883 GTTTATTCCATGGCCATTGT 3-14-3 36 3286 75965 198 22 409999 GGTTTATTCCATGGCCATTG 2-13-5 54 3287 75966 190 23 409826 GGTTTATTCCATGGCCATTG 5-10-5 73 3287 75966 201 23 410000 TGGTTTATTCCATGGCCATT 2-13-5 55 3288 75967 194 24 404172 TGGTTTATTCCATGGCCATT 5-10-5 61 3288 75967 192 24 410001 ATGGTTTATTCCATGGCCAT 2-13-5 51 3289 75968 198 25 409827 ATGGTTTATTCCATGGCCAT 5-10-5 44 3289 75968 195 25 410002 AATGGTTTATTCCATGGCCA 2-13-5 0 3290 75969 204 26 404173 AATGGTTTATTCCATGGCCA 5-10-5 48 3290 75969 201 26 410003 AAATGGTTTATTCCATGGCC 2-13-5 64 3291 75970 193 27 142082 AAATGGTTTATTCCATGGCC 5-10-5 52 3291 75970 190 27 410004 AAAATGGTTTATTCCATGGC 2-13-5 46 3292 75971 196 28 409828 AAAATGGTTTATTCCATGGC 5-10-5 44 3292 75971 194 28 409829 AAAAATGGTTTATTCCATGG 5-10-5 36 3293 75972 198 29 404161 GGTCATTTCCATGGCCAGAG 2-13-5 78 n/a 73855 3746 31 409975 GGAGGTCATTTCCATGGCCA 2-13-5 85 n/a 73858 n/a 32 409976 AGGAGGTCATTTCCATGGCC 2-13-5 85 n/a 73859 2379 30

Example 2: Dose-dependent antisense inhibition of human PTP1B mRNA in HuVEC cells

Several antisense oligonucleotides, which displayed significant antisense inhibition of PIP IB mRNA in the study described in Example lwere further tested in HuVEC cells at various doses. Cells were plated at 5 a density of 5,000 cells per well and transfected using LipofectAMENE 2000® with 0.9375 nM, 1.875 nM, 3.75 nM, 7.5 nM, 15 nM, and 30 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3000 (forward sequence CTGGTTTAACCTCCTATCCTTGGA, designated herein as SEQ ID NO: 33; reverse sequence 0 CAGAGCAGCTCGCTACCTCTCT, designated herein as SEQ ID NO: 34, probe sequence

CAGCTGGCTCTCCACCTTGTTACACATTATGT, designated herein as SEQ ID NO: 35). PTP1B mRNA 68 WO 2012/142458 PCT/US2012/033588 levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in Table 2 as percent inhibition of PTP1B mRNA, relative to untreated control cells.

Table 2

Dose-dependent antisense inhibition of human PTP1B in HuVEC cells ISIS No 0.9375 nM 1.875 nM 3.75 nM 7.5 nM 15.0 nM 30.0 nM ic50 (nM) 113715 0 0 2 11 23 33 &gt;30 404161 1 0 7 29 42 57 17 404169 0 6 17 37 57 72 7 404176 0 0 20 38 68 79 6 409815 0 0 7 30 48 65 12 409821 0 1 17 41 68 82 5 409826 0 0 10 30 47 64 12 409975 0 0 23 50 74 86 4 409976 0 0 21 46 65 82 5 409988 0 0 23 49 70 83 5 410003 0 0 4 16 28 46 &gt;30

Example 3: Dose-dependent antisense inhibition of PTP1B mRNA in LLC-MK2 cells

The antisense oligonucleotides from the study described in Example 2 are also cross-reactive with rhesus monkey the gene sequence (SEQ ID NO: 3) and were further tested in rhesus monkey LLC-MK2 cells at various doses. Cells were plated at a density of 3,000 cells per well and transfected using Lipofectin with 0 3.125 nM, 6.25 nM, 12.5 nM, 25 nM, 50 nM, and 100 nM concentrations of each antisense oligonucleotide.

After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using primer probe set RTS 198 (forward sequence GGAGTTCGAGCAGATCGACAA, designated herein as SEQ ID NO: 36; reverse sequence GGCCACTCTACATGGGAAGTC, designated herein as SEQ ID NO: 37, probe sequence 5 AGCTGGGCGGCCATTTACCAGGAT, designated herein as SEQ ID NO: 38). PTP1B mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in Table 3 as percent inhibition of PTP1B mRNA, relative to untreated control cells. The start and stop sites of each oligonucleotide on rhesus monkey SEQ ID NO: 3 (the concatenation of exons 1-9, intron 9 and exon 10 from the rhesus PTP1B scaffold (gene scaffold 240) are presented in Table 4. 0 Table 3

Dose-dependent antisense inhibition of PTP1B mRNA in LLC-MK2 cells ISIS No 3.125 6.25 12.5 25.0 50.0 100.0 ic50 nM nM nM nM nM nM (nM) 69 WO 2012/142458 PCT/US2012/033588 113715 9 18 18 42 71 88 12 404161 18 26 37 49 67 79 9 404169 9 33 36 . 52 70 85 8 404176 4 21 28 52 73 85 10 409815 19 27 32 51 67 83 9 409821 4 20 37 53 74 85 9 409826 7 31 63 46 62 78 8 409975 13 20 28 43 62 74 15 409976 12 20 37 42 65 77 12 409988 3 20 39 56 73 86 8 410003 16 24 36 43 65 80 11

Table 4

Target sites of antisense oligonucleotides targeting PTP1B on rhesus monkey gene sequence (SEQ ID NO: 3) ISIS No Start Site Stop Site 113715 1035 1054 404161 2385 2404 409975 2388 2407 409976 2389 2408 409988 3566 3585 409821 3570 3589 404176 3571 3590 404169 3754 3773 409815 3755 3774 409826 4491 4510 410003 4495 4514 5 Example 4: Dose-dependent antisense inhibition of PTP1B mRNA in cynomolgus primary hepatocytes

Some of the antisense oligonucleotides from the study described in Examples 1,2 and 3 were further tested in cynomolgus primary hepatocytes at various doses. Cells were plated at a density of 35,000 cells per well and transfected using Lipofectin with 6.25 nM, 12.5 nM, 25 nM, 50 nM, 100 nM, and 200 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the 0 cells and PTP1B mRNA levels were measured by quantitative real-time PCR using primer probe set RTS 198. PTP1B mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in Table 5 as percent inhibition of PTP1B mRNA, relative to untreated control cells.

Table 5

Dose-dependent antisense inhibition of PTP1B mRNA in cynomolgus primary hepatocytes 70 WO 2012/142458 PCT/US2012/033588 ISIS No 6.25 nM 12.5 nM 25.0 nM 50.0 nM 100.0 nM 200.0 nM ic50 (nM) 373125 16 4 13 32 48 67 104 404161 7 3 24 40 56 77 72 404169 0 13 27 44 57 77 67 404176 16 17 27 42 64 76 59 409815 0 24 26 40 57 75 69 409821 0 9 25 37 60 73 73 409826 8 28 10 37 56 71 82 409975 13 19 29 38 57 75 67 409976 2 18 13 35 60 80 70 409988 16 22 28 41 59 77 61 410003 17 10 37 46 60 78 56

Example 5: Antisense inhibition of human PTP1B mRNA in HuVEC cells by oligonucleotides designed by microwalk

Additional gapmers were designed based on ISIS 409826 that demonstrated significant inhibition of 5 PTP1B in all cell lines tested. These gapmers were designed by creating gapmers shifted slightly upstream and downstream (i.e. “microwalk”) of ISIS 409826. Oligonucleotides were also created with various motifs, e.g. 5-10-5 MOE, 5-8-5 MOE, 2-13-5 MOE, 6-8-6 MOE motifs, or were uniform oligonucleotides with deoxy and MOE units. These gapmers were tested in vitro. ISIS oligonucleotides ISIS 142082, ISIS 113715, ISIS 373125, ISIS 404161, ISIS 404172, ISIS 404173, ISIS 404176, ISIS 409825, ISIS 409827, ISIS 409828, 0 ISIS 409829, ISIS 409845, ISIS 409998, ISIS 409999, ISIS 410000, ISIS 410001, ISIS 410002, ISIS 410003, ISIS 410004, and ISIS 410030 (from Example 1), as well as ISIS 399038, ISIS 404159, and ISIS 404174, from a previous application (CORE0061 WO 15), were also included in the assay for comparison. Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 2,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the 5 cells and PTP1B mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3000 was used to measure PTP1B mRNA levels. PTP1B mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of PTP1B mRNA, relative to untreated control cells. The results are presented in Tables 6 and 7.

The 5-10-5 MOE gapmers are 20 nucleotides in length, wherein the central gap segment is comprised 0 of ten 2’-deoxynucleotides and is flanked on both sides (in the 5’ and 3’ directions) by wings comprising five nucleotides each. The 5-8-5 MOE gapmers are 18 nucleotides in length, wherein the central gap segment is comprised of eight 2’-deoxynucleotides and is flanked on both sides (in the 5’ and 3’ directions) by wings comprising five nucleotides each. The 2-13-5 MOE gapmers are 20 nucleotides in length, wherein the central gap segment is comprised of thirteen 2’-deoxynucleotides and is flanked on the 5’ and the 3’ directions with 71 WO 2012/142458 PCT/US2012/033588 wings comprising two and five nucleotides respectively. The 6-8-6 MOE gapmers are 18 nucleotides in length, wherein the central gap segment is comprised of eight 2’-deoxynucleotides and is flanked on both sides (in the 5’ and 3’ directions) by wings comprising six nucleotides each. For each of the motifs (5-10-5, 5-8-5, 2-13-5, and 6-8-6), each nucleotide in the 5’ wing segment and each nucleotide in the 3’ wing segment 5 has a 2’-MOE modification. The uniform oligonucleotides have deoxy and MOE units distributed throughout the length of the oligonucleotide. The symbols for the various unit chemistries in the uniform oligonucleotide sequences are as follows: ‘d’ = 2’-deoxyribose; ‘e’ = 2’-O-methoxyethyl ribose. The intemucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytidine residues throughout each gapmer are 5-methylcytidines. “Target start site” indicates the 5’-most nucleotide to which the gapmer is targeted. 0 “Target stop site” indicates the 3 ’-most nucleotide to which the gapmer is targeted. Each gapmer listed in Table 6 is targeted SEQ ID NO: 1 (GENBANK Accession No. NM 002827.2). All the antisense oligonucleotides listed in Table 7 target SEQ ID NO: 2 (GENBANK Accession NT_011362.9 truncated from nucleotides 14178000 to 14256000).

As shown in Tables 6 and 7, several of the gapmers exhibited at least 50% inhibition, including ISIS 5 numbers: 113715, 142082, 373125, 399038, 404159,404161,404172,404173,404176,409826,409827, 409999,410000,410001,410002,410003,410004,438371,438372,438373, 438374, 438375, 438377, 438379, 438380, 438381,438382, 438383, 438384,438439, 438442, 438443,438444, 438445, 438450, 438451,438452, 438453,438454, 438455,438456,438458, 438459, 438460, 438461, 438462,438464, 438465,438468,438469,438472, 438473, and 438474. 0 Several of the gapmers exhibited at least 60% inhibition, including ISIS numbers: 113715,142082, 373125, 399038, 404161, 404172, 404173,404176,409826, 409827,409999, 410000, 410001, 410002, 410003,438373,438374,438380, 438381, 438382,438442, 438444,438445, 438450, 438451,438452, 438453,438459, 438460,438461, 438462,438468, 438469, 438472, and 438474.

Several of the gapmers exhibited at least 70% inhibition, including ISIS numbers: 142082, 373125, 5 399038,404161, 404172,404173,404176, 409826,409827,409999,410000,410001,410002,410003, 438373,438374,438444,438451, 438452,438453, 438460, 438461, 438462,438468, 438469, 438472,and 438474.

Several of the gapmers exhibited at least 80% inhibition, including ISIS numbers: 142082, 404161, 404173, 404176, 409826,410000, 410001, 410002, 410003, 438451,438452, 438460,438461, and 438474. 0 Several of the gapmers exhibited at least 85% inhibition, including ISIS numbers: 142082, 404161, 404173, 404176, 409826,410001, 410002, and 410003.

Several of the gapmers exhibited at least 90% inhibition, including ISIS numbers: 142082, 404161, and 409826. 72 WO 2012/142458 PCT/US2012/033588

Table 6

Inhibition of human PTP1B mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ID NO: 1

Start Site Stop Site ISIS No Sequence Motif % inhibition SEQ ID NO 989 1008 373125 GGCACCTTCGATCACAGCCA 5-10-5 MOE 72 9 1035 1054 113715 GCTCCTTCCACTGATCCTGC 5-10-5 MOE 68 10 2366 2385 404176 TGATCAGGTCATGCACAGGC 5-10-5 MOE 89 14 3283 3302 409845 TATTCCATGGCCATTGTAAA 5-10-5 MOE 32 19 3284 3303 404174 TTATTCCATGGCCATTGTAA 5-10-5 MOE 47 20 3284 3303 410030 TTATTCCATGGCCATTGTAA 2-13-5 MOE 47 20 3284 3303 438377 T eT e AjT jT dCeCeAdT jGdGdCdCd AdTjT dGdT dAe Ae Deoxy and MOE units 52 20 3284 3303 438439 TeTeAdT dTdCdCd AdT dGeGeCdCd AdT dT dGdT d AeAe Deoxy and MOE units 53 20 3284 3303 438448 TeTeAeT dTdCeCe AdT dGdGdCdCd AdTdT dGdT e Ae Ae Deoxy and MOE units 34 20 3284 3303 438457 T eT e AeT dT dCdCd AeT eGdGdCdCd AdTdTdGdTe AeAe Deoxy and MOE units 35 20 3284 3303 438466 TTATTCCATGGCCATTGTAA 6-8-6 MOE 25 20 3285 3304 409825 TTTATTCCATGGCCATTGTA 5-10-5 MOE 47 21 3285 3304 409998 TTTATTCCATGGCCATTGTA 2-13-5 MOE 49 21 3285 3302 438368 TATTCCATGGCCATTGTA 5-8-5 MOE 32 39 3285 3304 438378 T eT eT d AdTdT eCeCd AdTdGdGdCdCd AdT dT dGdT eAe Deoxy and MOE units 46 21 3285 3304 438440 TeTeTdAdTdTdCdCdAdTeGeGdCdCdAdTdTdGdTeAe Deoxy and MOE units 30 21 3285 3304 438449 TeTeTeAdTdTeCeCdAdTdGdGdCdCdAdTdTdGeTeAe Deoxy and MOE units 43 21 73 WO 2012/142458 PCT/US2012/033588 3285 3304 438458 TeTeTAdTdTdCdCeAeTdGjGdCdCdAdTdTdGeTeAe Deoxy and MOE units 53 21 3285 3304 438467 TTTATTCCATGGCCATTGTA 6-8-6 MOE 33 21 3286 3305 399038 GTTTATTCCATGGCCATTGT 5-10-5 MOE 74 22 3286 3305 404159 GTTTATTCCATGGCCATTGT 2-13-5 MOE 54 22 3286 3303 438369 TTATTCCATGGCCATTGT 5-8-5 MOE 33 40 3286 3305 438379 GeT eT dT d AdT eT eCdCd AdT dGdGdCdCdAdT dT dG eT e Deoxy and MOE units 51 22 3286 3305 438441 GeTeTdTdAdTdTdCdCdA(:TeGdGdCtlCdAdTdTdGeTe Deoxy and MOE units 40 22 3286 3305 438450 GeTeTeTdAdTeTeCdCdAdTdGdGdCdCdAdTdTeGeTe Deoxy and MOE units 64 22 3286 3305 438459 GeTeTeTdAdTdTdCeCeAdTdGdGdCdCdAdTdTeGeTe Deoxy and MOE units 68 22 3286 3305 438468 GTTTATTCCATGGCCATTGT 6-8-6 MOE 76 22 3287 3306 409826 GGTTTATTCCATGGCCATTG 5-10-5 MOE 93 23 3287 3306 409999 GGTTTATTCCATGGCCATTG 2-13-5 MOE 75 23 3287 3304 438370 TTTATTCCATGGCCATTG 5-8-5 MOE 33 41 3287 3306 438380 GeGeTdTdTdAeTeTdCdCdAdTdGdGdCdCdAdTdTeGe Deoxy and MOE units 63 23 3287 3306 438442 GeGeTdTdTdAdTdTdCdCeAeTdGdGdCdCdAdTdTeGe Deoxy and MOE units 67 23 3287 3306 438451 GeGeTeTdTdAeTeTdCdCdAdTdGdGdCdCdAdTeTeGe Deoxy and MOE units 83 23 3287 3306 438460 GeGeTeTdTdAdTdTeCeCdAdTdGdGdCdCdAdTeTeGe Deoxy and MOE units 82 23 3287 3306 438469 GGTTTATTCCATGGCCATTG 6-8-6 MOE 71 23 3288 3307 404172 TGGTTTATTCCATGGCCATT 5-10-5 MOE 76 24 74 WO 2012/142458 PCT/US2012/033588 3288 3307 410000 TGGTTTATTCCATGGCCATT 2-13-5 MOE 83 24 3288 3305 438371 GTTTATTCCATGGCCATT 5-8-5 MOE 54 42 3288 3307 438381 TeGeGdTdTdTeAeTdTdCdCdAdTdGdGdCdCdATeTe Deoxy and MOE units 69 24 3288 3307 438443 TeGeGdTdTdTdAdTdTdCeCeAdTdGdGdCdCdAdTeTe Deoxy and MOE units 50 24 3288 3307 438452 TeGeGeTdTdTeAeTdTdCdCd AdTdGdGdCdCd AeTeTe Deoxy and MOE units 82 24 3288 3307 438461 TeGeGeTdTdTdAdTeTeCdCdAdTdGdGdCdCdAeTeTe Deoxy and MOE units 81 24 3288 3307 438470 TGGTTTATTCCATGGCCATT 6-8-6 MOE 46 24 3289 3308 409827 ATGGTTTATTCCATGGCCAT 5-10-5 MOE 74 25 3289 3308 410001 ATGGTTTATTCCATGGCCAT 2-13-5 MOE 85 25 3289 3306 438372 GGTTTATTCCATGGCCAT 5-8-5 MOE 52 43 3289 3308 438382 AeT eGdGdT dTeTeAdT dT dCdCdAdT dG dG dCdCd A/Γ e Deoxy and MOE units 65 25 3289 3308 438444 AeTeGdGdTdTdTdAdTdTeCeCdAdTdGdGdCdCdAeTe Deoxy and MOE units 72 25 3289 3308 438453 AeT eGeGdT dTeT eAdT dT dCdCdAdT dGdGdCdCe AeT e Deoxy and MOE units 72 25 3289 3308 438462 AeTeGeGdTdTdT dAeTeT dCdCdAdT dGdGdCdCe AeT e Deoxy and MOE units 70 25 3289 3308 438471 ATGGTTTATTCCATGGCCAT 6-8-6 MOE 45 25 3290 3309 404173 AATGGTTTATTCCATGGCCA 5-10-5 MOE 85 26 3290 3309 410002 AATGGTTTATTCCATGGCCA 2-13-5 MOE 85 26 3290 3307 438373 TGGTTTATTCCATGGCCA 5-8-5 MOE 70 44 3290 3309 438383 AeAeT dG dGdTeT eT dAdT dT dCdCdAdT dG dGdCdCe Ae Deoxy and MOE units 54 26 75 WO 2012/142458 PCT/US2012/033588 3290 3309 438445 AeAeTdGdGjTdTdTdAdTeTeCdCdAdTdGdGdCdCeAe Deoxy and MOE units 66 26 3290 3309 438454 AeAeTeGdGdTeTeTdAdTdTdCdCdAdTdGdGdCeCeAe Deoxy and MOE units 52 26 3290 3309 438463 AeAeTeGdGdTdTdTeAeTdTdCdCdAdTdGdGdCeCeAe Deoxy and MOE units 39 26 3290 3309 438472 AATGGTTTATTCCATGGCCA 6-8-6 MOE 73 26 3291 3310 142082 AAATGGTTTATTCCATGGCC 5-10-5 MOE 90 27 3291 3310 410003 AAATGGTTTATTCCATGGCC 2-13-5 MOE 86 27 3291 3308 438374 ATGGTTTATTCCATGGCC 5-8-5 MOE 79 45 3291 3310 438384 AeAeAdTdGdGeTeTdTdAdTdTdCdCdAdTdGdGdCeCe Deoxy and MOE units 53 27 3291 3310 438446 AeAeAdTdGdGdTdTdTdAeTeTdCdCdAdTdGdGdCeCe Deoxy and MOE units 38 27 3291 3310 438455 AeAeAeTdGdGeTeTdTdAdTdTdCdCdAdTdGdGeCeCe Deoxy and MOE units 58 27 3291 3310 438464 AeAeAeTdGdGdTdTeTeAdTdTdCdCdAdTdGdGeCeCe Deoxy and MOE units 58 27 3291 3310 438473 AAATGGTTTATTCCATGGCC 6-8-6 MOE 57 27 3292 3311 409828 AAAATGGTTTATTCCATGGC 5-10-5 MOE 43 28 3292 3311 410004 AAAATGGTTTATTCCATGGC 2-13-5 MOE 58 28 3292 3309 438375 AATGGTTTATTCCATGGC 5-8-5 MOE 55 46 3292 3311 438385 AeAeAdAdTdGeGeTdTdTdAdTdTdCdCdAdTdGdGeCe Deoxy and MOE units 36 28 3292 3311 438447 Ae Ae Ad AdT dG dG dT dT dT e AeT dT dCdCd AdT dGdGeCe Deoxy and MOE units 35 28 3292 3311 438456 AgAg Ae AdT dGeG eTdT dT d AdT dT dCdCd AdT dGeGeCe Deoxy and MOE units 58 28 3292 3311 438465 AeAeAeAdTdGdGTeTeTdAdTdTdCdCdAdTdGeGeCe Deoxy and MOE units 51 28 76 WO 2012/142458 PCT/US2012/033588 3292 3311 438474 AAAATGGTTTATTCCATGGC 6-8-6 MOE 82 28 3293 3312 409829 AAAAATGGTTTATTCCATGG 5-10-5 MOE 42 29 3293 3310 438376 AAATGGTTTATTCCATGG 5-8-5 MOE 36 47

Table 7

Inhibition of human PTP1B mRNA levels by chimeric antisense oligonucleotides targeted to SEQ ED NO: 2

Start Site Stop Site ISIS No Sequence Motif % inhibition SEQ ID NO 70726 70745 373125 GGCACCTTCGATCACAGCCA 5-10-5 MOE 72 9 73855 73874 404161 GGTCATTTCCATGGCCAGAG 2-13-5 MOE 93 31 75045 75064 404176 TGATCAGGTCATGCACAGGC 5-10-5 MOE 89 14 75962 75981 409845 TATTCCATGGCCATTGTAAA 5-10-5 MOE 32 19 75963 75982 404174 TTATTCCATGGCCATTGTAA 5-10-5 MOE 47 20 75963 75982 410030 TTATTCCATGGCCATTGTAA 2-13-5 MOE 47 20 75963 75982 438377 T eT eAdTdT dCeCe AdT dGdG dCdCd AdT dTdGdTd Ae Ae Deoxy and MOE units 52 20 75963 75982 438439 T eT ,AdT dT dCdCd AdT dGeGeCdCd AdT dTdGdTd Ae Ae Deoxy and MOE units 53 20 75963 75982 438448 T eT AeT dT dCeCe AdT dGdGdCdCdA,jT dTdGdTeAeAe Deoxy and MOE units 34 20 75963 75982 438457 TeT AeT dT dCdCd AeT eGdG dCdCd AdT dT dGdT eAe Ae Deoxy and MOE units 35 20 75963 75982 438466 TTATTCCATGGCCATTGTAA 6-8-6 MOE 25 20 75964 75983 409825 TTTATTCCATGGCCATTGTA 5-10-5 MOE 47 21 75964 75983 409998 TTTATTCCATGGCCATTGTA 2-13-5 MOE 49 21 75964 75981 438368 TATTCCATGGCCATTGTA 5-8-5 MOE 32 39 77 WO 2012/142458 PCT/US2012/033588 75964 75983 438378 TeTeTdAdTjTeCeCdAdTdGdGdCdCdAdTdTdGdTeAe Deoxy and MOE units 46 21 75964 75983 438440 TeTeTdAdTdTdCdCdAdTeGeGdCdCdAdTdTdGdTeAe Deoxy and MOE units 30 21 75964 75983 438449 TeTeTeAdTdTeCeCdAdTdGdGdCdCdAdTdTdGeTeAe Deoxy and MOE units 43 21 75964 75983 438458 T eT eT eAdT dT dCdCe AeT dG dGdCdCdAdTdT dGeTeAe Deoxy and MOE units 53 21 75964 75983 438467 TTTATTCCATGGCCATTGTA 6-8-6 MOE 33 21 75965 75984 399038 GTTTATTCCATGGCCATTGT 5-10-5 MOE 74 22 75965 75984 404159 GTTTATTCCATGGCCATTGT 2-13-5 MOE 54 22 75965 75982 438369 TTATTCCATGGCCATTGT 5-8-5 MOE 33 40 75965 75984 438379 GeTeTdTdAdTeTeCdCdAdTdGdGdCdCdAdTdTdGeTe Deoxy and MOE units 51 22 75965 75984 438441 GeT eT dT dAdTdT dCdCdAeTeGdGdCdCdAdTdT dGeT e Deoxy and MOE units 40 22 75965 75984 438450 GeTeTeT d AdT eT eCdCdAdTdGdGdCdCd AdTdTeGeTe Deoxy and MOE units 64 22 75965 75984 438459 GeTeTeTdAdTdTdCeCeAdTdGdGdCdCdAdTdTeGeTe Deoxy and MOE units 68 22 75965 75984 438468 GTTTATTCCATGGCCATTGT 6-8-6 MOE 76 22 75966 75985 409826 GGTTTATTCCATGGCCATTG 5-10-5 MOE 93 23 75966 75985 409999 GGTTTATTCCATGGCCATTG 2-13-5 MOE 75 23 75966 75983 438370 TTTATTCCATGGCCATTG 5-8-5 MOE 33 41 75966 75985 438380 GeGeTdTdTdAeTeTdCdCdAdTdGdGdCdCdAdTdTeGe Deoxy and MOE units 63 23 75966 75985 438442 GeGeTdTdT dAdT dT dCdCeAeTdGdG dCdCd AdTdTeGe Deoxy and MOE units 67 23 78 WO 2012/142458 PCT/US2012/033588 75966 75985 438451 GeGeTeTdTd AeTeTdCdC,j AdTdGdGdCdCdAdTeTeGe Deoxy and MOE units 83 23 75966 75985 438460 GeGeT eT dT dAdTdT eCeCdAdTdGdGdCdCdAdT eT eGe Deoxy and MOE units 82 23 75966 75985 438469 GGTTTATTCCATGGCCATTG 6-8-6 MOE 71 23 75967 75986 404172 TGGTTTATTCCATGGCCATT 5-10-5 MOE 76 24 75967 75986 410000 TGGTTTATTCCATGGCCATT 2-13-5 MOE 83 24 75967 75984 438371 GTTTATTCCATGGCCATT 5-8-5 MOE 54 42 75967 75986 438381 T eGeGdT dT dT eAeT dT dCdCdAdT dGdGdCdCdAT eT e Deoxy and MOE units 69 24 75967 75986 438443 T eGeGdT dTdT dAdT dT dCeCeAdT dGdGdCdCdAdT eTe Deoxy and MOE units 50 24 75967 75986 438452 TeGeGeTdTdTeAeTdTdCdCd AdTdGdGdCdCd AeTeTe Deoxy and MOE units 82 24 75967 75986 438461 TeGeGeT dT dT dAdT eT eCdCdAdT dGdGdCdCdAeTeT e Deoxy and MOE units 81 24 75967 75986 438470 TGGTTTATTCCATGGCCATT 6-8-6 MOE 46 24 75968 75987 409827 ATGGTTTATTCCATGGCCAT 5-10-5 MOE 74 25 75968 75987 410001 ATGGTTTATTCCATGGCCAT 2-13-5 MOE 85 25 75968 75985 438372 GGTTTATTCCATGGCCAT 5-8-5 MOE 52 43 75968 75987 438382 AeT eGdGdT dT eT eAdT dT dCdCdAdT dGdGdCdCd AeT e Deoxy and MOE units 65 25 75968 75987 438444 AeTeGdGdTdTdTdAdTdTeCeCdAdTdGdGdCdCdAeTe Deoxy and MOE units 72 25 75968 75987 438453 AeTeGeGdT dT eTeAdT dTdCdCdAdT dGdGdCdCe AeT e Deoxy and MOE units 72 25 75968 75987 438462 AeTeGeGdTdTdTd AeTeTdCdCdAdTdGdGdCdCe AeTe Deoxy and MOE units 70 25 79 WO 2012/142458 PCT/US2012/033588 75968 75987 438471 ATGGTTTATTCCATGGCCAT 6-8-6 MOE 45 25 75969 75988 404173 AATGGTTTATTCCATGGCCA 5-10-5 MOE 85 26 75969 75988 410002 AATGGTTTATTCCATGGCCA 2-13-5 MOE 85 26 75969 75986 438373 TGGTTTATTCCATGGCCA 5-8-5 MOE 70 44 75969 75988 438383 Ae AeTdG&lt;jG,]T eT eT jAdTjT dCdCdAdTdGdGdCdCe Ae Deoxy and MOE units 54 26 75969 75988 438445 AeAeTdGdGdTdTdTdAdTeTeCdCdAdTdGdGdCdCeAe Deoxy and MOE units 66 26 75969 75988 438454 AeAeTeGdGdTeTeTdAdTdTdCdCdAdTdGdGdCeCgAe Deoxy and MOE units 52 26 75969 75988 438463 AeAeTeGdGdTdTdTjAeTdTdCdCdAdTdGdGdCeCeAe Deoxy and MOE units 39 26 75969 75988 438472 AATGGTTTATTCCATGGCCA 6-8-6 MOE 73 26 75970 75989 142082 AAATGGTTTATTCCATGGCC 5-10-5 MOE 90 27 75970 75989 410003 AAATGGTTTATTCCATGGCC 2-13-5 MOE 86 27 75970 75987 438374 ATGGTTTATTCCATGGCC 5-8-5 MOE 79 45 75970 75989 438384 AeAeAdTdGdGeTeTdTdAdTdTdCdCdAdTdGdGdCeCe Deoxy and MOE units 53 27 75970 75989 438446 AeAeAdTdGdGdTdTdTdAeTeTdCdCdAdTdGdGdCeCe Deoxy and MOE units 38 27 75970 75989 438455 Ae Ae AeTdG dGeT eT dT dAdT dT dCdCdAdT dGdGeCeCe Deoxy and MOE units 58 27 75970 75989 438464 AeAeAeTdGdGdTdTeTeAdTdTdCdCdAdTdGdGeCeCe Deoxy and MOE units 58 27 75970 75989 438473 AAATGGTTTATTCCATGGCC 6-8-6 MOE 57 27 75971 75990 409828 aaaatggtttattccatggc 5-10-5 MOE 43 28 75971 75990 410004 AAAATGGTTTATTCCATGGC 2-13-5 MOE 58 28 75971 75988 438375 AATGGTTTATTCCATGGC 5-8-5 MOE 55 46 80 WO 2012/142458 PCT/US2012/033588 75971 75990 438385 AeAeAdAdTdGeGeTdTdTdAdTdTdCdCdAdTdGdGeCe Deoxy and MOE units 36 28 75971 75990 438447 Ae Ae Ad AdT dG dGdT dTdTeAeTdT dCdCdAdT dGdGeCe Deoxy and MOE units 35 28 75971 75990 438456 AeAeAeAdTdGeGeTdTdTdAdTdTdCdCdAdTdGeGeCe Deoxy and MOE units 58 28 75971 75990 438465 AeAeAeAdTdGdGTeTeTdAdTdTdCdCdAdTdGeGeCe Deoxy and MOE units 51 28 75971 75990 438474 AAAATGGTTTATTCCATGGC 6-8-6 MOE 82 28 75972 75991 409829 AAAAATGGTTTATTCCATGG 5-10-5 MOE 42 29 75972 75989 438376 AAATGGTTTATTCCATGG 5-8-5 MOE 36 47

Example 6: Dose-dependent antisense inhibition of human PTP1B mRNA in HuVEC cells

Several antisense oligonucleotides, which displayed significant antisense inhibition ofPTP1B mRNA 5 in the study described in Example 5 were further tested in HuVEC cells at various doses. Cells were plated at a density of 2,000 cells per well and transfected by electroporation with 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1000 nM, 2000 nM and 4000 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using primer probe set RTS3000. PTP1B mRNA levels were normalized to total 0 RNA content, as measured by RIBOGREEN®. Results are presented in Table 8 as percent inhibition of PTP1B mRNA, relative to untreated control cells.

Table 8

Dose-dependent antisense inhibition of human PTP1B in HuVEC cells ISIS No 31.25 nM 62.5 nM 125.0 nM 250.0 nM 500.0 nM 1000.0 nM 2000.0 nM 4000.0 nM ic50 (pM) 142082 15 30 40 42 71 84 90 94 0.2 404173 15 19 33 54 69 81 86 93 0.2 404176 9 26 34 34 67 80 88 94 0.3 409826 17 16 28 44 60 73 85 95 0.3 410002 0 0 24 52 54 77 90 96 0.4 410003 9 7 19 46 60 80 91 95 0.4 438374 20 22 40 44 59 70 79 85 0.3 438460 14 21 23 42 62 78 85 95 0.3 438474 27 0 13 34 42 68 74 86 0.6 81 WO 2012/142458 PCT/US2012/033588

Example 7: Dose-dependent antisense inhibition of human mRNA PTP1B in HepG2 cells

The antisense oligonucleotides, tested in the study described in Example 6, were further tested in HepG2 cells at various doses. Cells were plated at a density of 20,000 cells per well and transfected by electroporation with 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1000 nM, 2000 nM and 4000 nM 5 concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using primer probe set RTS3000. PTP1B mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in Table 9 as percent inhibition of PTP1B mRNA, relative to untreated control cells. The mRNA levels were also analyzed using rhesus monkey primer probe set RTS 198, and the results are 0 presented in Table 10. The start and stop sites of each oligonucleotide on rhesus monkey SEQ ID NO: 3 are presented in Table 11.

Table 9

Analysis of dose-dependent antisense inhibition of human PTP1B in HepG2 cells using RTS3000 ISIS No 31.25 nM 62.5 nM 125.0 nM 250.0 nM 500.0 nM 1000.0 nM 2000.0 nM 4000.0 nM IC50 (μΜ) 142082 0 0 7 0 26 38 60 82 1.4 404173 2 0 1 19 0 29 47 80 1.9 404176 0 0 5 13 2 33 62 79 1.7 409826 0 0 0 2 15 29 46 76 1.9 410002 13 6 0 11 8 28 44 75 2.0 410003 0 0 9 11 22 33 30 83 1.9 438374 0 0 17 11 23 38 33 61 2.9 438460 4 0 10 11 9 26 52 79 1.8 438474 0 0 2 11 6 20 52 54 2.8

Table 10

Analysis of dose-dependent antisense inhibition of human PTP1B in HepG2 cells using RTS 198 ISIS No 31.25 nM 62.5 nM 125.0 nM 250.0 nM 500.0 nM 1000.0 nM 2000.0 nM 4000.0 nM ic50 (μΜ) 142082 14 19 2 0 80 41 63 80 1.5 404173 0 0 2 0 16 26 60 83 1.6 404176 0 0 0 5 0 31 59 80 1.9 409826 0 0 0 16 23 10 49 72 2.3 410002 0 0 0 0 0 0 40 100 &gt;4.0 410003 0 1 12 0 10 41 51 82 1.6 438374 0 0 0 9 43 22 49 55 2.8 438460 0 0 0 9 30 42 47 81 1.4 438474 2 0 9 38 19 31 49 60 2.5 82 WO 2012/142458 PCT/US2012/033588

Table 11

Target sites of antisense oligonucleotides targeting PTP1B on rhesus monkey gene sequence (SEQ ID NO: 3)

OligoID Start Site Stop Site SEQ ID NO 142082 4495 4514 27 404173 4494 4513 26 404176 3571 3590 14 409826 4491 4510 23 410002 4494 4513 26 410003 4495 4514 27 438374 4495 4512 45 438460 4491 4510 23 438474 4496 4515 28 5 Example 8: Dose-dependent antisense inhibition of human PTP1B mRNA in HepG2 cells

Short antisense oligonucleotides to the target site of ISIS 142082 were designed. The target sites, motifs and sequence details of these shortmers are presented in Table 12. These antisense oligonucleotides were tested in HepG2 cells at various doses. Some of the antisense oligonucleotides from the study described in Example 7 were included in the assay for comparison. Cells were plated at a density of 20,000 cells per 0 well and transfected by electroporation with 78.125 nM, 156.25 nM, 312.5 nM, 625 nM, 1,250 nM, 2,500 nM, 5,000 nM and 10,000 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using primer probe set RTS3000. PTP1B mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in Table 13 as percent inhibition of PIP IB mRNA, 5 relative to untreated control cells.

Table 12

Target sites of antisense oligonucleotides targeting SEQ ID NO: 1 ISIS No Start Site Stop Site Sequence Motif SEQ ID NO 142082 3291 3310 AAATGGTTTATTCCATGGCC 5-10-5 27 446431 3292 3309 AATGGTTTATTCCATGGC 4-10-4 46 446432 3293 3308 ATGGTTTATTCCATGG 3-10-3 48

Table 13 0 Dose-dependent antisense inhibition of human PTP1B in HepG2 cells ISIS No 78.125 nM 156.25 nM 312.5 nM 625.0 nM 1250.0 nM 2500.0 nM 5000.0 nM 10000.0 nM IC50 (μΜ) 113715 6 12 17 17 16 45 61 86 3.3 83 WO 2012/142458 PCT/US2012/033588 142082 14 34 23 47 60 81 86 90 0.8 404173 8 22 29 45 60 73 83 88 0.8 409826 19 18 41 56 75 84 89 91 0.5 410003 0 0 19 39 55 81 91 92 1.0 446431 10 24 26 38 57 74 85 92 1.0 446432 0 8 10 10 10 26 40 67 6.0

Example 9: Dose-dependent antisense inhibition of PTP1B mRNA in LLC-MK2 cells

The antisense oligonucleotides from the study described in Example 8 are also cross-reactive with rhesus monkey PTP1B gene sequence (SEQ ID NO: 3) and were further tested in rhesus monkey LLC-MK2 5 cells at various doses. Cells were plated at a density of 25,000 cells per well and transfected using electroporation with 78.125 nM, 156.25 nM, 312.5 nM, 625 nM, 1250 nM, 2500 nM, 5,000 nM, and 10,000 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using primer probe set RTS198. PTP1B mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. 0 Results are presented in Table 14 as percent inhibition of PTP1B mRNA, relative to untreated control cells. The start and stop sites of each oligonucleotide on rhesus monkey SEQ ID NO: 3 are presented in Table 15.

Table 14

Dose-dependent antisense inhibition of PTP1B mRNA in LLC-MK2 cells ISIS No 78.125 nM 156.25 nM 312.5 nM 625.0 nM 1250.0 nM 2500.0 nM 5000.0 nM 10000.0 nM ic50 (μΜ) 113715 0 0 4 13 27 53 57 70 3.3 142082 2 12 31 41 69 74 80 92 0.9 404173 2 0 22 29 36 61 78 84 1.6 409826 12 0 19 38 66 66 82 92 1.2 410003 0 0 0 26 32 65 81 91 1.8 446431 0 0 9 32 45 70 79 58 1.4 446432 0 0 7 16 10 20 26 43 37.0 5 Table 15

Target sites of antisense oligonucleotides targeting SEQ ID NO: 3 ISIS No Start Site Stop Site Sequence SEQ ID NO 113715 1035 1054 GCTCCTTCCACTGATCCTGC 10 142082 4495 4514 AAATGGTTTATTCCATGGCC 27 404173 4494 4513 AATGGTTTATTCCATGGCCA 26 409826 4491 4510 GGTTTATTCCATGGCCATTG 23 410003 4495 4514 AAATGGTTTATTCCATGGCC 27 446431 4496 4513 AATGGTTTATTCCATGGC 46 84 WO 2012/142458 PCT/US2012/033588 446432 4497 4512 ATGGTTTATTCCATGG 48

Example 10: Dose-dependent antisense inhibition of human PTP1B mRNA in HuVEC cells

The antisense oligonucleotides, tested in the study described in Examples 8 and 9, were further tested in HuVEC cells at various doses. Cells were plated at a density of 20,000 cells per well and transfected by electroporation with 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1000 nM, 2000 nM and 4000 nM 5 concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and PTP IB mRNA levels were measured by quantitative real-time PCR using primer probe set RTS3000. PTP1B mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in Table 16 as percent inhibition of PTP1B mRNA, relative to untreated control cells.

Table 16 0 Dose-dependent antisense inhibition of human PTP IB in HuVEC cells ISIS No 31.25 nM 62.5 nM 125.0 nM 250.0 nM 500.0 nM 1000.0 nM 2000.0 nM 4000.0 nM ic50 (μΜ) 113715 10 0 22 24 65 86 92 98 0.2 142082 52 78 89 93 95 96 98 98 &lt;0.3 404173 35 66 80 89 95 98 97 97 0.05 409826 57 72 82 64 97 98 98 98 &lt;0.3 410003 43 47 75 84 48 95 96 91 0.05 446431 33 63 75 87 96 97 98 98 0.05 446432 0 11 30 45 66 79 85 76 0.3

Example 11: Dose-dependent antisense inhibition of PTP1B mRNA in cynomolgus primary hepatocytes

The antisense oligonucleotides from the study described in Examples 8-10 were further tested in 5 cynomolgus primary hepatocytes at various doses. Cells were plated at a density of 35,000 cells per well and transfected using electroporation with 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1,000 nM, 2,000 nM, and 4,000 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and PTP IB mRNA levels were measured by quantitative real-time PCR using primer probe set RTS198. PTP1B mRNA levels were normalized to total RNA content, as measured by 0 RIBOGREEN®. Results are presented in Table 17 as percent inhibition of PTP IB mRNA, relative to untreated control cells.

Table 17

Dose-dependent antisense inhibition of PTP IB mRNA in cynomolgus primary hepatocytes ISIS No 31.25 nM 62.5 nM 125.0 nM 250.0 nM 500.0 nM 1000.0 nM 2000.0 nM 4000.0 nM ic50 (μΜ) 85 WO 2012/142458 PCT/US2012/033588 113715 4 26 25 43 46 73 82 95 0.4 142082 25 37 50 67 74 87 86 88 0.1 404173 18 20 43 54 67 82 85 89 0.2 409826 34 47 51 65 76 87 88 90 0.1 410003 8 20 44 53 68 79 80 83 0.2 446431 9 14 35 54 57 79 79 88 0.3 446432 4 0 1 3 0 11 6 37 &gt;4.0

Example 12: Tolerability of antisense oligonucleotides targeting human PTP1B in a mouse model ISIS oligonucleotides that demonstrated dose-dependent inhibition in the studies described in Examples 8-11 were evaluated for tolerability in a mouse model by monitoring changes in the levels of 5 various metabolic markers in CD1 mice. Two more ISIS oligonucleotides, ISIS 446433 (4-10-4 MOE; 5’-GTTTATTCCATGGCCATT -3’ (SEQ ID NO: 42); target start site at SEQ ID NO: 1 is 3288) and ISIS 446434 (3-10-3; 5’- TTTATTCCATGGCCAT -3’ (SEQ ID NO: 49); target start site at SEQ ID NO: 1 is 3289) were designed as shortmers to ISIS 409826 (target start site at SEQ ID NO: 1 is 3287) and were also evaluated in this study. . 0 Treatment CD1 mice (available from Jackson Labs, Bar Harbor, ME) were maintained on a 12-hour light/dark cycle and fed ad libitum normal lab chow (Harlan Laboratories, Indianapolis, IN). Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 5 0.9% PBS for injection.

Groups of five CD1 mice each were injected subcutaneously twice a week with 100 mg/kg of ISIS 142082, ISIS 373125, ISIS 404173, ISIS 409826, ISIS 410002, ISIS 410003, ISIS 438452, ISIS 438460, ISIS 446431, ISIS 446432, ISIS 446433, or ISIS 446434 for 4 weeks. One group of five CD1 mice was injected subcutaneously twice a week with PBS for 4 weeks. This PBS group served as the control group. Blood 0 samples were collected via tail snipping. Two days after the last dose, body weights were taken, mice were euthanized and organs and plasma were harvested for further analysis.

Body and organ -weights

The body weights of the mice were measured weekly. The body weights are presented in Table 18. Liver, spleen and kidney weights were measured at the end of the study, and are presented in Table 19. The 5 results demonstrate that none of the ISIS oligonucleotides had any adverse effect on the overall health of the mice. 86 WO 2012/142458 PCT/US2012/033588

Table 18

Weekly body weights of CD1 mice during antisense oligonucleotide treatment (g)

Week 1 Week 2 Week 3 Week 4 PBS 29 31 32 34 ISIS 142082 31 34 34 36 ISIS 373125 29 31 32 35 ISIS 404173 31 33 34 36 ISIS 409826 31 34 34 37 ISIS 410002 32 35 35 36 ISIS 410003 31 34 34 37 ISIS 438452 32 35 36 39 ISIS 438460 31 34 34 37 ISIS 446431 30 33 33 36 ISIS 446432 27 30 30 33 ISIS 446433 30 33 33 37 ISIS 446434 30 33 34 37 5 Table 19

Organ weights of CD1 mice after antisense oligonucleotide treatment (g)

Liver Fat Spleen Kidney PBS 1.7 0.45 0.11 0.53 ISIS 142082 2.3 0.33 0.18 0.52 ISIS 373125 1.9 0.38 0.16 0.53 ISIS 404173 2.3 0.41 0.23 0.59 ISIS 409826 2.2 0.37 0.17 0.54 ISIS 410002 1.9 0.22 0.30 0.76 ISIS 410003 2.1 0.44 0.22 0.60 ISIS 438452 2.2 0.42 0.18 0.55 ISIS 438460 2.2 0.34 0.17 0.52 ISIS 446431 2.1 0.34 0.19 0.53 ISIS 446432 1.7 0.31 0.13 0.46 ISIS 446433 2.2 0.35 0.17 0.53 ISIS 446434 2.2 0.36 0.18 0.56

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases . 0 were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured bi-weekly.

The results are presented in Tables 20 and 21, and indicate that most of the ISIS oligonucleotides were considered tolerable in the mice, as demonstrated by their liver transaminase profile. 87 WO 2012/142458 PCT/US2012/033588

Table 20

Effect of antisense oligonucleotide treatment on ALT (IU/L) of CD1 mice

WeekO Week 2 Week 4 PBS 27 26 20 ISIS 142082 38 35 105 ISIS 373125 30 27 51 ISIS 404173 30 31 124 ISIS 409826 26 34 236 ISIS 410002 27 203 219 ISIS 410003 31 29 99 ISIS 438452 32 40 217 ISIS 438460 30 40 216 ISIS 446431 29 38 114 ISIS 446432 26 27 35 ISIS 446433 25 76 115 ISIS 446434 23 44 146

Table 21 5 Effect of antisense oligonucleotide treatment on AST (IU/L) of CD1 mice

WeekO Week 2 Week 4 PBS 54 62 50 ISIS 142082 75 59 103 ISIS 373125 55 57 97 ISIS 404173 52 61 117 ISIS 409826 49 59 192 ISIS 410002 51 151 417 ISIS 410003 64 47 122 ISIS 438452 59 56 157 ISIS 438460 65 56 217 ISIS 446431 56 66 140 ISIS 446432 50 51 74 ISIS 446433 54 87 121 ISIS 446434 42 64 132

Plasma glucose levels

To evaluate the effect of ISIS oligonucleotides on glucose metabolism, plasma levels of glucose were 0 measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in Table 22, expressed in mg/dL. None of the ISIS oligonucleotides had any adverse effects on the glucose metabolism of the mice.

Table 22 88 WO 2012/142458 PCT/US2012/033588

Effect of antisense oligonucleotide treatment on plasma glucose levels in CD1 mice

WeekO Week 2 Week 4 PBS 175 188 182 ISIS 142082 195 178 161 ISIS 373125 187 201 177 ISIS 404173 185 213 168 ISIS 409826 183 187 187 ISIS 410002 183 164 137 ISIS 410003 198 218 168 ISIS 438452 168 197 175 ISIS 438460 212 203 169 ISIS 446431 192 188 148 ISIS 446432 194 193 175 ISIS 446433 216 198 151 ISIS 446434 199 189 159

Plasma lipid and triglyceride levels

To evaluate the effect of ISIS oligonucleotides on cholesterol and triglyceride metabolism, plasma 5 levels of each were measured using an automated clinical chemistiy analyzer (Hitachi Olympus AU400e,

Melville, NY). Results are presented in Tables 23 and 24, expressed in mg/dL. Most of the ISIS oligonucleotides did not have any adverse effects of the lipid metabolism of the mice.

Table 23

Effect of antisense oligonucleotide treatment on plasma cholesterol levels in CD1 mice

WeekO Week 2 Week 4 PBS 162 145 153 ISIS 142082 156 136 126 ISIS 373125 137 106 104 ISIS 404173 162 124 154 ISIS 409826 153 142 146 ISIS 410002 136 63 47 ISIS 410003 160 131 96 ISIS 438452 143 128 121 ISIS 438460 146 140 129 ISIS 446431 139 124 116 ISIS 446432 146 135 137 ISIS 446433 152 144 145 ISIS 446434 147 147 144

Table 24

Effect of antisense oligonucleotide treatment on plasma triglyceride levels in CD1 mice 89 WO 2012/142458 PCT/US2012/033588

Week 0 Week 2 Week 4 PBS 153 153 162 ISIS 142082 170 153 114 ISIS 373125 142 116 112 ISIS 404173 195 140 107 ISIS 409826 182 120 80 ISIS 410002 137 99 51 ISIS 410003 152 138 102 ISIS 438452 123 134 93 ISIS 438460 165 146 85 ISIS 446431 131 160 123 ISIS 446432 168 194 136 ISIS 446433 186 117 133 ISIS 446434 145 101 84

Cytokine levels

To evaluate the effect of ISIS oligonucleotides on factors involved in inflammation, blood was collected after the end of the treatment period for measurement of cytokine levels. The samples were sent to 5 Aushon Biosystems (Woburn, MA) for analysis. Levels of murine IL-6, JE, MIP-Ια, and TNE-α were measured using murine antibodies. The results are presented in Table 25. Most of the ISIS oligonucleotides did not have any adverse effects on the cytokine levels of the mice.

Table 25

Effect of antisense oligonucleotide treatment on plasma cytokine levels in CD1 mice mIL-6 mJE mMIP-la mTNF-a PBS 250 20 1 4 ISIS 142082 225 145 4 23 ISIS 373125 77 91 3 17 ISIS 404173 88 155 1 24 ISIS 409826 33 112 3 15 ISIS 410002 113 225 28 84 ISIS 410003 111 138 4 24 ISIS 438452 62 148 1 15 ISIS 438460 64 184 2 9 ISIS 446431 52 170 1 15 ISIS 446432 57 75 1 3 ISIS 446433 64 138 3 61 ISIS 446434 59 127 0 21

Example 13: Tolerability of antisense oligonucleotides targeting human PTP1B in a rat model 90 WO 2012/142458 PCT/US2012/033588

The ISIS oligonucleotides from the study described in Example 12 were further evaluated for tolerability in a rat model by monitoring changes in the levels of various metabolic markers in Sprague Dawley rats.

Treatment 5 Sprague Dawley rats were maintained on a 12-hour light/dark cycle and fed ad libitum normal lab chow (Harlan Laboratories, Indianapolis, IN). Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

Groups of four rats each were injected subcutaneously twice a week with ISIS 142082, ISIS 373125, 0 ISIS 404173, ISIS 409826, ISIS 410002, ISIS 410003, ISIS 438452, ISIS 438460, ISTS 44643L ISIS 446432, ISIS 446433, or ISIS 446434 at a dose of 50 mg/kg twice a week for 4 weeks, followed by a dose of 30 mg/kg twice a week for 8 weeks. One group of four rats was injected subcutaneously twice a week with PBS for 12 weeks. This PBS group served as the control group. Blood samples were collected via tail snipping. Two days after the last dose, body weights were taken, rats were euthanized and organs and plasma were 5 harvested for further analysis.

Body and organ weights

The body weights of the rats were measured weekly. The body weights are presented in Table 26. Liver, spleen and kidney weights were measured at the end of the study, and are presented in Table 27. ‘n/a’ indicates no data being available for that particular group at that particular time point due to all the rats in the 0 group being euthanized before the time point.

Table 26

Bi-weekly body weights of Sprague Dawley rats during antisense oligonucleotide treatment (g)

Week 0 Week 2 Week 4 Week 6 Week 8 Week 10 Week 12 PBS 288 369 405 442 463 500 495 ISIS 142082 295 348 318 345 337 347 345 ISIS 373125 304 385 399 419 427 421 448 ISIS 404173 294 346 352 377 384 391 401 ISIS 409826 292 346 350 355 356 373 356 ISIS 410002 297 333 323 324 306 335 n/a ISIS 410003 299 341 328 320 307 305 301 ISIS 438452 301 327 335 333 327 347 332 ISIS 438460 304 345 346 347 356 377 n/a ISIS 446431 307 376 340 357 353 357 349 ISIS 446432 287 340 344 363 372 399 404 91 WO 2012/142458 PCT/US2012/033588 ISIS 446433 298 331 318 354 n/a n/a n/a ISIS 446434 303 366 356 n/a n/a n/a n/a

Table27

Organ weights of Sprague Dawley rats during antisense oligonucleotide treatment (g)

Liver Fat Spleen Kidney PBS 15.9 2.1 0.8 3.6 ISIS 142082 21.8 0.7 4.5 5.2 ISIS 373125 17.9 1.1 1.9 3.4 ISIS 404173 17.7 1.1 2.3 4.3 ISIS 409826 19.8 0.5 3.6 4.4 ISIS 410003 18.7 0.5 3.8 3.5 ISIS 438452 17.3 0.6 3.1 3.8 ISIS 446431 22.1 0.4 6.1 5.3 ISIS 446432 18.1 1.2 3.3 3.8 5 Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured bi-weekly. Plasma levels of bilirubin (mg/dL) were also measured using the same clinical chemistry analyzer. The 0 results are presented in Tables 28, 29 and 30. ‘n/a’ indicates no data being available for that particular group at that particular time point due to all the rats in the group being euthanized before the time point.

Table 28

Effect of antisense oligonucleotide treatment on ALT (IU/L) of Sprague Dawley rats

WeekO Week 2 Week 4 Week 6 Week 8 Week 10 Week 12 PBS 58 68 54 48 48 46 46 ISIS 142082 54 75 40 44 49 62 57 ISIS 373125 57 61 60 48 48 45 38 ISIS 404173 49 52 53 41 51 53 42 ISIS 409826 51 59 56 50 42 37 40 ISIS 410002 46 65 75 73 103 126 n/a ISIS 410003 49 78 62 49 61 59 66 ISIS 438452 46 57 58 53 51 52 50 ISIS 438460 49 88 162 96 114 91 n/a ISIS 446431 51 57 45 45 40 55 49 ISIS 446432 52 59 48 43 44 49 46 ISIS 446433 53 120 65 86 n/a n/a n/a ISIS 446434 53 76 161 n/a n/a n/a n/a 92 WO 2012/142458 PCT/US2012/033588

Table 29

Effect of antisense oligonucleotide treatment on AST (IU/L) of Sprague Dawley rats

WeekO Week 2 Week 4 Week 6 Week 8 Week 10 Week 12 PBS 84 92 86 79 91 74 81 ISIS 142082 87 89 86 126 136 154 149 ISIS 373125 79 72 93 124 111 95 81 ISIS 404173 75 69 88 75 89 96 83 ISIS 409826 75 74 96 112 108 90 106 ISIS 410002 67 87 155 173 229 245 n/a ISIS 410003 71 95 106 136 161 160 186 ISIS 438452 70 84 104 157 164 174 167 ISIS 438460 79 122 214 287 216 172 n/a ISIS 446431 73 79 93 137 129 158 153 ISIS 446432 80 76 86 99 96 105 102 ISIS 446433 77 151 128 234 n/a n/a n/a ISIS 446434 81 137 359 n/a n/a n/a n/a 5 Table 30

Effect of antisense oligonucleotide treatment on Bilirubin (mg/dL) of Sprague Dawley rats

Week 0 Week 2 Week 4 Week 6 Week 8 Week 10 Week 12 PBS 0.11 0.15 0.14 0.16 0.25 0.16 0.13 ISIS 142082 0.12 0.11 0.18 0.12 0.12 0.15 0.15 ISIS 373125 0.13 0.13 0.15 0.36 0.14 0.15 0.13 ISIS 404173 0.11 0.13 0.14 0.13 0.13 0.14 0.10 ISIS 409826 0.12 0.12 0.15 0.12 0.11 0.10 0.10 ISIS 410002 0.11 0.13 0.18 0.13 0.19 0.54 n/a ISIS 410003 0.12 0.12 0.14 0.16 0.14 0.17 0.14 ISIS 438452 0.12 0.13 0.15 0.13 0.14 0.13 0.13 ISIS 438460 0.11 0.14 0.22 0.28 0.15 0.17 n/a ISIS 446431 0.14 0.17 0.19 0.13 0.10 0.16 0.16 ISIS 446432 0.12 0.14 0.13 0.12 0.11 0.14 0.13 ISIS 446433 0.12 0.12 0.18 0.20 n/a n/a n/a ISIS 446434 0.12 0.17 0.20 n/a n/a n/a n/a

Kidney function . 0 To evaluate the effect of ISIS oligonucleotides on kidney function, plasma levels of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in Tables 31 and 32, expressed in mg/dL. The total urine protein to creatinine ratio was also calculated and the results are presented in Table 33. 93 WO 2012/142458 PCT/US2012/033588

Table 31

Effect of antisense oligonucleotide treatment on BUN (mg/dL) of Sprague Dawley rats

WeekO Week 2 Week 4 Week 6 Week 8 Week 10 Week 12 PBS 17 20 20 18 26 18 16 ISIS 142082 21 23 31 23 31 24 29 ISIS 373125 21 21 24 19 31 21 21 ISIS 404173 18 19 21 19 25 21 20 ISIS 409826 20 21 24 23 28 22 26 ISIS 410002 19 22 25 23 29 32 n/a ISIS 410003 18 20 23 23 30 29 26 ISIS 438452 19 22 27 25 29 22 24 ISIS 438460 20 23 25 26 31 24 n/a ISIS 446431 19 21 24 23 29 24 23 ISIS 446432 20 21 24 20 29 23 19 ISIS 446433 18 21 25 53 n/a n/a n/a ISIS 446434 18 23 120 n/a n/a n/a n/a

Table 32 5 Effect of antisense oligonucleotide treatment on creatinine (mg/dL) of Sprague Dawley rats

WeekO Week 2 Week 4 Week 6 Week 8 Week 10 Week 12 PBS 0.2 0.3 0.4 0.3 0.5 0.4 0.3 ISIS 142082 0.3 0.3 0.5 0.4 0.5 0.5 0.4 ISIS 373125 0.3 0.3 0.6 0.4 0.6 0.6 0.4 ISIS 404173 0.3 0.3 0.5 0.4 0.5 0.6 0.4 ISIS 409826 0.3 0.4 0.6 0.4 0.5 0.5 0.4 ISIS 410002 0.3 0.3 0.6 0.4 0.5 0.5 n/a ISIS 410003 0.3 0.3 0.6 0.4 0.6 0.6 0.4 ISIS 438452 0.3 0.3 0.6 0.4 0.5 0.5 0.4 ISIS 438460 0.3 0.4 0.5 0.3 0.5 0.5 n/a ISIS 446431 0.3 0.3 0.5 0.4 0.5 0.5 0.4 ISIS 446432 0.3 0.3 0.6 0.4 0.5 0.5 0.4 ISIS 446433 0.3 0.3 0.5 0.4 n/a n/a n/a ISIS 446434 0.3 0.4 0.8 n/a n/a n/a n/a

Table 33

Effect of antisense oligonucleotide treatment on total urine protein to urine creatinine ratio of Sprague Dawley rats

WeekO Week 2 Week 4 Week 6 Week 8 Week 10 Week 12 PBS 1.5 1.4 1.2 1.6 1.3 1.2 1.2 ISIS 142082 1.2 4.3 4.0 7.7 6.6 7.5 7.4 ISIS 373125 1.3 3.9 3.8 6.7 6.2 8.8 9.7 ISIS 404173 1.1 4.8 5.5 6.4 7.4 10.2 11.9 94 WO 2012/142458 PCT/US2012/033588 ISIS 409826 1.2 3.7 3.8 5.9 9.8 28.8 37.6 ISIS 410002 1.2 3.9 4.1 6.0 9.7 26.3 n/a ISIS 410003 1.3 4.5 5.3 5.9 7.6 10.8 18.0 ISIS 438452 1.4 3.3 3.1 5.1 8.0 9.2 10.5 ISIS 438460 1.3 4.0 4.5 7.3 16.0 53.9 n/a ISIS 446431 1.2 4.5 5.0 5.3 7.2 8.0 8.8 ISIS 446432 1.3 4.2 4.4 6.2 9.1 7.6 9.2 ISIS 446433 1.1 3.4 5.7 81.5 n/a n/a n/a ISIS 446434 1.1 3.7 25.8 n/a n/a n/a n/a

Plasma glucose levels

To evaluate the effect of ISIS oligonucleotides on glucose metabolism, plasma levels of glucose were measured using an automated clinical chemistiy analyzer (Hitachi Olympus AU400e, Melville, NY). Results 5 are presented in Table 34, expressed in mg/dL.

Table 34

Effect of antisense oligonucleotide treatment on plasma glucose levels in Sprague Dawley rats

WeekO Week 2 Week 4 Week 6 Week 8 Week 10 Week 12 PBS 150 140 155 152 163 138 144 ISIS 142082 153 137 155 145 142 130 135 ISIS 373125 153 135 136 143 133 106 135 ISIS 404173 162 138 149 152 145 144 154 ISIS 409826 155 141 150 145 143 132 135 ISIS 410002 152 139 148 151 130 124 n/a ISIS 410003 152 138 146 140 132 126 143 ISIS 438452 166 134 162 153 135 143 147 ISIS 438460 166 140 151 156 150 130 n/a ISIS 446431 154 143 155 147 153 139 145 ISIS 446432 159 141 155 152 152 138 153 ISIS 446433 158 138 141 118 n/a n/a n/a ISIS 446434 166 149 124 n/a n/a n/a n/a

Plasma lipid and triglyceride levels 0 To evaluate the effect of ISIS oligonucleotides on total cholesterol and triglyceride levels, plasma levels of each were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in Tables 35 and 36, expressed in mg/dL.

Table 35

Effect of antisense oligonucleotide treatment on plasma cholesterol levels (mg/dL) in Sprague Dawley rats

WeekO Week 2 Week 4 Week 6 Week 8 Week 10 Week 12 PBS 55 57 64 51 73 64 53 ISIS 142082 62 41 54 62 70 64 62 95 WO 2012/142458 PCT/US2012/033588 ISIS 373125 73 59 66 51 66 61 39 ISIS 404173 57 41 68 62 87 85 75 ISIS 409826 57 42 79 65 86 122 no ISIS 410002 69 57 75 65 73 96 n/a ISIS 410003 72 44 70 67 89 76 73 ISIS 438452 63 33 53 51 71 70 61 ISIS 438460 64 40 98 81 94 146 n/a ISIS 446431 64 41 56 54 63 68 59 ISIS 446432 62 44 70 50 80 80 65 ISIS 446433 59 63 95 139 n/a n/a n/a ISIS 446434 63 48 91 n/a n/a n/a n/a

Table 36

Effect of antisense oligonucleotide treatment on plasma triglyceride levels (mg/dL) in Sprague Dawley rats

WeekO Week 2 Week 4 Week 6 Week 8 Week 12 PBS 66 73 82 80 98 106 ISIS 142082 92 30 71 44 25 28 ISIS 373125 66 28 20 24 24 28 ISIS 404173 48 28 28 35 31 49 ISIS 409826 68 29 28 25 31 68 ISIS 410002 71 23 23 27 71 n/a ISIS 410003 78 22 22 37 30 64 ISIS 438452 89 33 39 34 50 35 ISIS 438460 98 20 34 35 33 n/a ISIS 446431 72 29 38 36 35 48 ISIS 446432 n/a 41 37 31 37 53 ISIS 446433 68 21 29 129 n/a n/a ISIS 446434 60 27 103 n/a n/a n/a

Cytokine levels

To evaluate the effect of ISIS oligonucleotides on factors involved in inflammation, blood was collected after the end of the treatment period for measurement of cytokine levels. The samples were sent to Aushon Biosystems (Woburn, MA) for analysis. Levels of rat IL-6, MCP-1, MIP-la, and TNF-α were 0 measured with their respective antibodies. The results are presented in Table 37.

Table 37

Effect of antisense oligonucleotide treatment on plasma cytokine levels in Sprague Dawley rats rIL-6 rMCP-1 rMIP-la rTNF- a PBS 315 403 6 77 ISIS 142082 74 3082 38 697 ISIS 373125 &lt;25 2215 7 15 96 WO 2012/142458 PCT/US2012/033588 ISIS 404173 125 2244 60 499 ISIS 409826 &lt;25 6041 52 100 ISIS 410003 245 3315 40 444 ISIS 438452 105 4513 26 519 ISIS 446431 924 3104 54 402 ISIS 446432 29 2007 46 610

Example 14: Measurement of viscosity of ISIS antisense oligonucleotides targeting human PTP1B

The viscosity of the antisense oligonucleotides selected from studies described in Examples 12 and 5 13 was measured with the aim of screening out antisense oligonucleotides which have a viscosity more than 40 cP at a concentration of 165-185 mg/mL. Oligonucleotides having a viscosity greater than 40 cP would be too viscous to be administered to any subject. ISIS oligonucleotides (32-35 mg) were weighed into a glass vial, 120 pL of water was added and the antisense oligonucleotide was dissolved into solution by heating the vial at 50°C. Part of (75 pL) the pre- 0 heated sample was pipetted to a micro-viscometer (Cambridge). The temperature of the micro-viscometter was set to 25°C and the viscosity of the sample was measured. Another part (20 pL) of the pre-heated sample was pipetted into 10 mL of water for UV reading at 260 nM at 85°C (Cary UV instrument). The results are presented in Table 38 and indicate that all the antisense oligonucleotides solutions are optimal in their viscosity under the criterion stated above. 5 Table 38

Viscosity and concentration of ISIS antisense oligonucleotides targeting human PTP1B ISIS No. Viscosity (cP) Concentration (mg/mL) 142082 3.8 188 404173 3.8 163 410003 4.5 176 446431 3.2 180 446432 2.4 175

Example 15: Six month tolerability study of antisense oligonucleotides targeting human PTP1B in a mouse model ’ 0 ISIS oligonucleotides selected from the studies described in Examples 12-14 were evaluated for long term tolerability in a mouse model by monitoring changes in the levels of various metabolic markers in CD1 mice. 97 WO 2012/142458 PCT/US2012/033588

Treatment

Male CD1 mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal lab chow (Harlan Laboratories, Indianapolis, IN). Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides were prepared in PBS and sterilized by 5 filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

Groups often CD1 mice each were injected subcutaneously twice a week with 25 mg/kg of ISIS 142082, ISIS 404173, or ISIS 446431 for 24 weeks. One group of ten CD1 mice was injected subcutaneously twice a week with PBS for 24 weeks. This PBS group served as the control group. Blood samples were collected on days 140 via mandibular bleeds. On day 168, blood was collected via terminal 0 cardiac puncture under CO2 anesthesia, the mice were euthanized and organs were harvested for further analysis.

Plasma glucose levels

To evaluate the effect of ISIS oligonucleotides on glucose metabolism, plasma levels of glucose were measured using an automated clinical chemistiy analyzer (Hitachi Olympus AU400e, Melville, NY). Results 5 are presented in Table 39, expressed in mg/dL.

Table 39

Effect of antisense oligonucleotide treatment on plasma glucose levels on day 168

Glucose PBS 214 ISIS 142082 177 ISIS 404173 204 ISIS 446431 191

Liver function 0 To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistiy analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) on day 168 were measured. Plasma levels of bilirubin (mg/dL) were also measured using the same clinical chemistry analyzer. Alkaline phosphatase, which is synthesized in increased amounts by damaged liver cells, is also a marker of liver 5 disease (Narayanan, S. Ann. Clin. Lab. Sci. 21: 12-8, 1991) and was similarly measured. Albumin, which is typically decreased in liver disease (Oettl, K. et al., Biochim. Biophys. Acta. 1782: 469-73, 2008), was also similarly measured. The results are presented in Table 40.

Table 40

Effect of antisense oligonucleotide treatment on liver metabolic markers on day 168 ALT AST Bilirubin Alkaline Albumin (IU/L) (IU/L) (mg/dL) phosphatase (g/dL) 98 WO 2012/142458 PCT/US2012/033588 (IU/L) PBS 50 82 0.2 44 2.5 ISIS 142082 148 197 0.1 56 2.3 ISIS 404173 68 137 0.1 57 2.5 ISIS 446431 115 173 0.1 42 2.4

Cardiac function

To evaluate the effect of ISIS oligonucleotides on heart function, plasma levels of creatine phosphokinase (CPK) were measured using an automated clinical chemistry analyzer (Hitachi Olympus 5 AU400e, Melville, NY) on day 168. An increased level of this marker indicates heart muscle injury (Barohn, R.J. In: Goldman L, Ausiello D, eds. Cecil Medicine. 23rd ed. Philadelphia, Pa: Saunders Elsevier; 2007: chapter 447). The results are presented in Table 41.

Table 41

Effect of antisense oligonucleotide treatment on cardiac marker CPK on day 168 CPK (IU/L) PBS 98 ISIS 142082 120 ISIS 404173 107 ISIS 446431 159

Pancreatic function

To evaluate the effect of ISIS oligonucleotides on pancreatic function, plasma levels of amylase were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) on day 168. An increased level of this marker indicates acute pancreatitis (Stemby, B. et al., Mayo Clin. Proc. 71: .5 1138-44, 1996). The results are presented in Table 42.

Table 42

Effect of antisense oligonucleotide treatment on pancreatic marker amylase on day 168

Amylase (IU/L) PBS 1101 ISIS 142082 1374 ISIS 404173 1280 ISIS 446431 1232

Kidneyfunction ’ 0 To evaluate the effect of ISIS oligonucleotides on kidney function, plasma levels of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in Table 43, expressed in mg/dL. 99 WO 2012/142458 PCT/US2012/033588

Table 43

Effect of antisense oligonucleotide treatment on kidney metabolic markers on day 168 BUN Creatinine PBS 20 0.3 ISIS 142082 24 0.2 ISIS 404173 21 0.2 ISIS 446431 19 0.3

Example 16: Measurement of half-life of antisense oligonucleotide in CD1 mouse liver 5 CD1 mice were treated with the ISIS antisense oligonucleotides selected from studies described in

Example 14, and the oligonucleotide half-life as well as the elapsed time for oligonucleotide degradation and elimination from the liver was evaluated.

Treatment

Groups of ten CD1 mice each were injected subcutaneously twice per week for 2 weeks with 50 .0 mg/kg of ISIS 142082, ISIS 446431, ISIS 404173, or ISIS 409826. Five mice from each group were sacrificed 3 days and 56 days following the final dose. Livers were harvested for analysis.

Measurement of oligonucleotide concentration

The concentration of the full-length oligonucleotide was measured. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a 5 phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2’-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ED NO: 50) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 pg/g. Half-lives were then calculated using WiriNonlin software 0 (PHARSIGHT).

The results are presented in Table 44. Antisense oligonucleotides with half-lives within 11-34 days were chosen for further studies.

Table 44

Full-length oligonucleotide concentration (pg/g) and half-life (days) of oligonucleotide in CD1 mouse liver

Days Full length cone. (mg/g) Half- life (days) 142082 3 265 19.8 56 42 446431 3 293 19.6 100 WO 2012/142458 PCT/US2012/033588 56 45 404173 3 281 14.8 56 24 409826 3 304 18.4 56 41

Example 17: Effect of ISIS antisense oligonucleotides targeting human PTP1B in cynomolgus monkeys

Cynomolgus monkeys were treated with ISIS antisense oligonucleotides from studies described in Examples 15 and 16. Antisense oligonucleotide efficacy and tolerability, as well as their pharmacokinetic 5 profile in the liver and kidney, were evaluated.

Treatment

Prior to the study, the monkeys were kept in quarantine for a 30-day time period, during which standard panels of serum chemistry and hematology, examination of fecal samples for ova and parasites, and a tuberculosis test, were conducted to screen out abnormal or ailing monkeys. Six groups of randomly 0 assigned three male and two female cynomolgus monkeys each were injected subcutaneously thrice per week for the first week, and subsequently, once a week for the next 12 weeks with either 8 mg/kg or 40 mg/kg of ISIS 142082, ISIS 446431, or ISIS 404173. One group of three male and two female cynomolgus monkeys was injected subcutaneously thrice per week for the first week, and subsequently, once a week for the next 12 weeks with 40 mg/kg of ISIS 409826. A control group of three male and two female cynomolgus monkeys 5 was injected subcutaneously thrice per week for the first week, and subsequently, once a week for the next 12 weeks with PBS. Terminal sacrifices of all groups were conducted 48 hours after the last dose, on day 93.

During the study period, the monkeys were observed daily for signs of illness or distress. Any animal showing adverse effects to the treatment was removed and referred to the veterinarian and Study Director.

Inhibition studies 0 RNA analysis RNA was extracted from liver and the abdominal adipose tissues for real-time PCR analysis of PTP1B using primer probe set 1 (forward sequence GACCAGCTGCGCTTCTCCTA, designated herein as SEQ ID NO: 51; reverse sequence CAGAGGAGTCCCCCATGATG, designated herein as SEQ ID NO: 52; probe sequence TTGGCTGTGATCGAAGGTGCCAAA, designated herein as SEQ ID NO: 53) or primer 5 probe set 2 (forward sequence GGGCCCTTTGCCTAACACA, designated herein as SEQ ID NO: 54; reverse sequence CGACACCCCTGCTTTTCTG, designated herein as SEQ ID NO: 55; probe sequence CGGTCACTTTTGGGAGATGGTGTGG, designated herein as SEQ ID NO: 56), each targeting different regions of the PTP1B mRNA. Results are presented as percent reduction of PTP1B mRNA, relative to PBS 101 WO 2012/142458 PCT/US2012/033588 control, normalized with RIBOGREEN®. As shown in Table 45, treatment with ISIS antisense oligonucleotides resulted in significant reduction of PTP1B mRNA in comparison to the PBS control. Treatment with ISIS 404173 caused reduction of PTP1B mRNA levels similar to that with treatment with ISIS 142082. 5 Table 45

Inhibition of PTP1B mRNA in the cynomolgus monkey liver and fat tissue relative to the PBS control ISIS No. Dose (mg/kg) % inhibition in liver (probe set 1) % inhibition in liver (probe set 2) % inhibition in fat (probe set 1) % inhibition in fat (probe set 2) 409826 40 38 45 17 21 142082 8 12 14 13 16 40 46 48 34 28 446831 8 0 8 6 1 40 8 18 14 12 404173 8 4 13 8 4 40 26 22 38 31

Protein analysis

Tissue was extracted from liver For measuring PTP1B protein levels by western blot analysis. . 0 Specifically, PTP1B protein samples from monkeys treated with ISIS 404173 were compared with those treated with ISIS 142082. The results are presented in Tables 46, 47 and 48 expressed as percentage reduction compared to control levels. The levels of PTP1B levels were normalized against total protein levels, as well as against a constitutively expressed protein, IR-β. Treatment with ISIS 404173 caused greater reduction of PTP1B liver protein to that with treatment with ISIS 142082 at the lower dose of 8 mg/kg (Table 47). 5 Table 46 PTP1B protein level reduction after treatment with ISIS 404173 in the cynomolgus monkey liver

Dose (mg/kg) % inhibition (normalized to total protein) % inhibition (normalized to IR-β) 8 49 42 40 67 66

Table 47 PTP1B protein level reduction after treatment with ISIS 404173 or ISIS 142082 at 8 mg/kg in the 0 cynomolgus monkey liver ISIS No % inhibition (normalized to total % inhibition (normalized to IR-β) 102 WO 2012/142458 PCT/US2012/033588 protein) 142082 20 4 404173 33 27

Table 48 PTP1B protein level reduction after treatment with ISIS 404173 or ISIS 142082 at 40 mg/kg in the cynomolgus monkey liver ISIS No % inhibition (normalized to total protein) % inhibition (normalized to IR-β) 142082 65 63 404173 60 56

Tolerability studies

Body and organ weight measurements

To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body and organ 0 weights were measured after terminal sacrifice. Body weights were measured and compared to that of the PBS control animals. Organ weights were measured and treatment group weights were compared to the corresponding PBS control weights. The data is presented in Table 49. Treatment with ISIS 142082 did cause increases in liver and kidney weights at the higher dose.

Table 49 5 Final body and organ weight weights in the cynomolgus monkey relative to the control

Dose (mg/kg) Body weight (kg) Kidney (g) Liver (g) Spleen (g) Gastocnemius muscle (g) PBS - 2.2 9.6 10.5 2.3 10.6 409826 40 2.3 14.0 18.5 6.0 8.8 142082 8 2.3 10.6 13.0 3.7 9.5 40 2.2 20.9 17.7 7.0 9.0 446431 8 2.3 11.6 12.7 4.8 10.2 40 2.3 15.9 16.1 9.6 7.7 404173 8 2.3 11.6 12.8 4.8 11.1 40 2.2 14.8 15.5 3.7 8.7

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, blood samples were collected from all the study groups 7 days before the start of treatment, as well as on days 30, 58, and 93 of the 103 WO 2012/142458 PCT/US2012/033588 treatment period. The blood samples were collected in tubes without any anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum.

Levels of transaminases were measured using a Toshiba 200FRNEO chemistry analyzer (Toshiba 5 Co., Japan). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Tables 50 and 51, expressed in IU/L. Alkaline phosphatase, which is synthesized in increased amounts by damaged liver cells and is also a marker of liver disease and was similarly measured, and the data is presented in Table 52. The levels of AST, ALT and alkaline phosphatase in all the treatment groups were similar to that of the PBS control group. 0 C-reactive protein (CRP), which is synthesized in the liver and which serves as a marker of inflammation, was also similarly measured, and the data is presented in Table 53. Treatment with ISIS 142082 and ISIS 409826 at the higher dose resulted in high levels of CRP, suggesting liver inflammation.

Bilirubin is also a liver metabolic marker and was similarly measured and is presented in Table 54, expressed in mg/dL. Bilurubin levels of all the treatment groups were found to be similar to that of the PBS 5 control group. Gamma-glutamyltransferase (GGT) is an enzyme produced in the liver and is a useful laboratory marker for early liver damage or cholestatic disease (Betro, M.G. et al., Am. J. Clin. Pathol. 60: 672-8,1973). GGT levels were measured and the results are presented in Table 55, and demonstrate no difference between the PBS control and the treatment groups. 0 Table 50

Effect of antisense oligonucleotide treatment on ALT (IU/L) in cynomolgus monkey serum

Dose (mg/kg) Day -7 Day 30 Day 58 Day 93 PBS 37 44 42 35 409826 40 39 51 86 74 142082 8 37 39 45 36 40 49 62 59 69 446431 8 52 54 67 86 40 38 58 87 99 404173 8 34 50 41 45 40 44 50 63 73

Table 51

Effect of antisense oligonucleotide treatment on AST (IU/L) in cynomolgus monkey serum

Dose (mg/kg) Day -7 Day 30 Day 58 Day 93 PBS 40 49 55 44 409826 40 48 53 73 59 142082 8 44 45 49 42 104 WO 2012/142458 PCT/US2012/033588 40 54 70 72 69 446431 8 57 43 48 50 40 41 60 63 81 404173 8 44 53 57 59 40 46 65 71 74

Table 52

Effect of antisense oligonucleotide treatment on alkaline phosphatase (IU/L) in cynomolgus monkey serum

Dose (mg/kg) Day -7 Day 30 Day 58 Day 93 PBS 784 834 1021 838 409826 40 728 883 1178 981 142082 8 718 739 788 688 40 666 656 711 774 446431 8 742 745 885 908 40 778 759 768 735 404173 8 888 957 1135 1155 40 931 958 1135 1263

Table 53

Effect of antisense oligonucleotide treatment on CRP (mg/L) in cynomolgus monkey plasma

Dose (mg/kg) Day -7 Day 30 Day 58 Day 93 PBS 1.0 1.8 1.4 1.2 409826 40 1.0 4.3 4.8 4.8 142082 8 0.8 1.2 0.9 1.0 40 0.8 2.6 3.4 12.1 446431 8 1.4 1.4 0.9 1.1 40 0.8 2.4 2.2 6.7 404173 8 1.4 1.9 1.5 1.8 40 3.1 1.6 1.2 1.6

Table 54

Effect of antisense oligonucleotide treatment on bilirubin (mg/dL) in cynomolgus monkey plasma

Dose (mg/kg) Day -7 Day 30 Day 58 Day 93 PBS - 0.19 0.20 0.20 0.17 409826 40 0.17 0.13 0.13 0.10 142082 8 0.17 0.18 0.16 0.14 40 0.16 0.13 0.13 0.08 446431 8 0.21 0.17 0.18 0.15 40 0.19 0.18 0.15 0.12 105 WO 2012/142458 PCT/US2012/033588 404173 8 0.23 0.19 0.20 0.16 40 0.22 0.15 0.14 0.13

Table 55

Effect of antisense oligonucleotide treatment on GGT (IU/L) in cynomolgus monkey plasma

Dose (mg/kg) Day -7 Day 30 Day 58 Day 93 PBS - 65 74 79 71 409826 40 84 86 94 87 142082 8 63 67 68 62 40 67 72 71 61 446431 8 60 62 62 63 40 61 58 62 60 404173 8 57 66 66 68 40 56 63 69 79

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, blood samples were collected from all the study groups. The blood samples were collected in tubes without any anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at 0 room temperature) to obtain serum. Levels of BUN and creatinine were measured 7 days before the start of treatment, as well as on days 30, 58, and 93 of the treatment period using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Results are presented in Tables 56 and 57, expressed in mg/dL. Treatment with ISIS oligonucleotides had no adverse effect on either BUN or creatinine levels.

Table 56 5 Effect of antisense oligonucleotide treatment on serum BUN levels (mg/dL) in cynomolgus monkeys

Dose (mg/kg) Day -7 Day 30 Day 58 Day 93 PBS 28 28 25 28 409826 40 32 30 28 32 142082 8 26 25 24 26 40 28 28 25 25 446431 8 28 27 25 26 40 28 27 25 28 404173 8 28 30 24 27 40 28 24 25 23

Table 57

Effect of antisense oligonucleotide treatment on serum creatinine levels (mg/dL) in cynomolgus monkeys 106 WO 2012/142458 PCT/US2012/033588

Dose (mg/kg) Day -7 Day 30 Day 58 Day 93 PBS 0.83 0.88 0.94 0.78 409826 40 0.77 0.84 0.92 0.82 142082 8 0.74 0.78 0.79 0.71 40 0.72 0.80 0.86 0.73 446431 8 0.79 0.75 0.83 0.71 40 0.76 0.83 0.88 0.77 404173 8 0.81 0.91 0.87 0.82 40 0.76 0.84 0.92 0.76

Cholesterol and triglyceride levels

To evaluate the effect of ISIS oligonucleotides on lipid metabolism, blood samples were collected 5 from all the study groups. The blood samples were collected in tubes without any anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. Concentrations of cholesterol and triglycerides were measured 7 days before the start of treatment, as well as on days 30, 58, and 93 of the treatment period using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Results are presented in Tables 58 and 59, expressed in 0 mg/dL. Treatment with ISIS oligonucleotides had no adverse effect on either cholesterol or triglyceride levels.

Table 58

Effect of antisense oligonucleotide treatment on serum cholesterol levels (mg/dL) in cynomolgus monkeys

Dose (mg/kg) Day- 7 Day 30 Day 58 Day 93 PBS 135 163 162 143 409826 40 153 150 140 116 142082 8 116 151 159 141 40 110 140 138 128 446431 8 125 144 141 133 40 93 99 95 81 404173 8 123 147 149 136 40 135 135 125 124

Table 59

Effect of antisense oligonucleotide treatment on serum triglyceride levels (mg/dL) in cynomolgus monkeys

Dose (mg/kg) Day- 7 Day 30 Day 58 Day 93 PBS - 47 55 45 54 409826 40 30 29 33 42 142082 8 23 31 37 32 5 107 WO 2012/142458 PCT/US2012/033588 40 28 28 35 42 446431 8 24 46 34 33 40 31 44 47 56 404173 8 28 38 25 28 40 30 38 45 34 .0

Hematology

To evaluate any inflammatory effect of ISIS oligonucleotides in cynomolgus monkeys, blood samples were approximately 0.5 mL of blood was collected from each of the available study animals in tubes containing the potassium salt of EDTA. Samples were analyzed for red blood cell (RBC) count, white blood cells (WBC) count, platelet count and hemoglobin content, using an ADVLA120 hematology analyzer (Bayer, USA). The data is presented in Tables 60-63. Treatment with ISIS oligonucleotides did not significantly alter the blood cell count or hemoglobin levels, compared to the control.

Table 60

Effect of antisense oligonucleotide treatment on WBC (x 103/pL) in cynomolgus monkeys

Dose (mg/kg) Day -7 Day 30 Day 58 Day 93 PBS 11.6 12.6 11.1 8.9 409826 40 12.4 12.7 15.3 10.8 142082 8 11.3 15.2 12.8 9.7 40 11.9 13.2 12.5 8.5 446431 8 9.7 13.4 12.7 9.3 40 10.7 11.5 11.9 10.2 404173 8 14.9 18.9 14.9 11.8 40 11.1 14.2 12.9 10.8

Table 61

Effect of antisense oligonucleotide treatment on RBC (x 106/pL) in cynomolgus monkeys

Dose (mg/kg) Day -7 Day 30 Day 58 Day 93 PBS - 5.5 5.6 5.8 5.1 409826 40 5.6 5.8 6.1 5.6 142082 8 5.4 5.4 5.6 5.2 40 5.7 5.6 5.8 5.5 446431 8 5.5 5.3 5.5 5.4 40 5.5 5.4 5.8 5.3 404173 8 5.9 5.9 6.1 5.7 40 5.1 5.4 5.5 5.5 5 Table 62 108 WO 2012/142458 PCT/US2012/033588

Effect of antisense oligonucleotide treatment on platelets (x 103/pL) in cynomolgus monkeys

Dose (mg/kg) Day-7 Day 30 Day 58 Day 93 PBS - 592 555 571 516 409826 40 536 493 400 338 142082 8 439 477 349 284 40 461 454 401 263 446431 8 438 397 359 282 40 516 337 369 323 404173 8 489 491 420 355 40 520 470 389 316

Table 63

Effect of antisense oligonucleotide treatment on hemoglobin levels (g/dL) in cynomolgus monkeys

Dose (mg/kg) Day-7 Day 30 Day 58 Day 93 PBS - 12.5 12.8 13.1 11.9 409826 40 12.6 12.8 13.3 12.5 142082 8 12.3 12.5 13.0 12.2 40 12.1 12.0 12.1 11.5 446431 8 12.3 12.1 12.4 12.6 40 12.7 12.6 13.3 12.4 404173 8 12.7 13.0 13.3 12.7 40 11.6 12.3 12.4 12.6

Analysis of factors of inflammation

To evaluate the effect of ISIS oligonucleotides for complement C3 analysis as an inflammation factor, blood was collected from all available animals in tubes without anticoagulant for serum separation. . 0 The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. Complement C3 was measured using an automatic analyzer (Toshiba 200 FR NEO chemistiy analyzer, Toshiba co., Japan). The data is presented in Table 64, expressed in mg/dL. Treatment with ISIS 409826 resulted in low complement C3 levels, indicating a diseased state.

Table 64 . 5 Effect of antisense oligonucleotide treatment on serum C3 levels (mg/dL) in cynomolgus monkeys

Dose (mg/kg) Day -7 Day -1 Day 30 Day 58 Day 93 PBS 136 138 148 149 129 409826 40 129 131 101 101 90 142082 8 126 135 126 127 111 109 WO 2012/142458 PCT/US2012/033588 40 133 134 106 121 111 446431 8 130 144 128 132 125 40 129 130 111 117 114 404173 8 127 136 137 136 127 40 125 134 101 103 102

Analysis of insulin levels

To evaluate the effect of ISIS oligonucleotides on the thyroid gland, blood was collected on days 42, 84 and 91 from animals fasted overnight in tubes treated with EDTA. The tubes were kept on ice and plasma 5 was obtained after centrifugation (3000 rpm for 10 min at 4°C) within 30 min of blood collection. Insulin levels were measured using an automatic analyzer (Toshiba 200 FR NEO chemistry analyzer, Toshiba co., Japan). The data is presented in Table 65, expressed in ng/mL.

Table 65

Effect of antisense oligonucleotide treatment on plasma insulin levels (ng/mL) in cynomolgus monkeys

Dose (mg/kg) Day 42 Day 84 Day 91 PBS 29 26 26 409826 40 14 22 15 142082 8 8 4 8 40 8 10 10 404173 8 9 10 7 40 6 3 2

Pharmacokinetic studies

Measurement of oligonucleotide concentration

The concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured. The method used is a modification of previously published 5 methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2’-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 50) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 pg/g. 0 The results are presented in Tables 66 and 67, expressed as pg/g tissue. The ratio of the concentrations in the kidney versus the liver was calculated. Treatment with ISIS oligonucleotides did not result in any abnormality in the ratio. The results indicate that ISIS 404173 is a better renal accumulator than ISIS 142082 at the higher dose. 110 WO 2012/142458 PCT/US2012/033588

Table 66

Total oligonucleotide concentration (pg/g) in the liver of cynomolgus monkey ISIS No. Dose (mg/kg) Kidney Liver Kidney/Liver ratio 409826 40 4424 954 4.64 142082 8 1688 1044 1.62 40 6385 1774 3.60 446431 8 1323 641 2.06 40 6662 1159 5.75 404173 8 971 712 1.36 40 7180 1464 4.90

Table 67

Full-length oligonucleotide concentration (gg/g) in the liver of cynomolgus monkey ISIS No. Dose (mg/kg) Kidney Liver Kidney/Liver ratio 409826 40 3472 728 4.77 142082 8 1232 653 1.89 40 4103 1244 3.30 446431 8 1204 416 2.89 40 5645 846 6.67 404173 8 650 424 1.53 40 5039 1094 4.61 111