Antisense modulation of ptp1b expression

ES 2 634 450 T3

Antisense modulation of PTP1B expression Description

COUNTRYSIDE

Described herein are methods, compounds, and compositions for reducing the expression of PTP1B mRNA and protein in an animal. Such methods, compounds and compositions are useful, for example, for treating, preventing, delaying or alleviating diseases associated with metabolic disorders, in particular disorders associated with diabetes.

BACKGROUND

Protein tyrosine phosphatase 1B (PTP1B) is a member of a family of PTPs (Barford, et al, Science 1994. 263: 1397-1404) and is a cytosolic enzyme (Neel and Tonks, Curr Opin Cell Biol 1997. 9 : 193-204). PTP1B is ubiquitously expressed including tissues that are the major regulators of insulin metabolism, such as liver, muscle, and fat (Goldstein, Receptor 1993. 3: 1-15), where it is the primary PTP enzyme.

PTP1B is considered to be a negative regulator of insulin signaling. PTP1B interacts with the insulin receptor and dephosphorylates it, thereby attenuating and potentially terminating insulin signaling transduction (Goldstein et al, J. Biol Chem 2000, 275: 4383-4389). The physiological role of PTP1B in insulin signaling has been demonstrated in knockout mouse models. Mice lacking the PTP1B gene were protected against insulin resistance and obesity (Elchebly et al, Science 1999 283: 15441548). PTP1B-deficient mice had low adiposity, increased basal metabolic rate as well as total energy expenditure, and were protected from diet-induced obesity. Insulin-stimulated glucose uptake was elevated in skeletal muscle, while adipose tissue was unaffected providing evidence that increased insulin sensitivity in PTP1B-deficient mice was tissue specific (Klaman et al, Mol Cell Biol 2000 20: 5479-5489). These mice were phenotypically normal and were also resistant to diet-induced obesity, insulin resistance, and had significantly lower triglyceride levels on a high-fat diet. Therefore, inhibition of PTP1B in patients suffering from type II diabetes, metabolic syndrome, diabetic dyslipidemia, or related metabolic diseases would be beneficial.

Antisense inhibition of PTP1B offers a unique advantage over traditional small molecule inhibitors in that antisense inhibitors do not rely on competitive binding of the compound to protein and directly inhibit activity by reducing PTP1B expression. Antisense technology is emerging as an effective means of reducing the expression of certain gene products and therefore may be uniquely useful in a number of research, diagnostic, and therapeutic applications for modulation of PTP1B.

US 2002/055479 describes antisense compounds targeting a nucleic acid encoding PTP1B.

At the moment there is a lack of acceptable options for the treatment of metabolic disorders. It is therefore an object to provide compounds and methods for the treatment of such diseases and disorders. RESUME

Described herein are methods, compounds and compositions for modulating the expression of PTP1B and treating, preventing, delaying or alleviating diseases associated with metabolic disorders, in particular disorders associated with diabetes and / or a symptom thereof.

SUMMARY OF THE INVENTION

The invention provides a compound comprising a modified single-stranded oligonucleotide, wherein said modified oligonucleotide consists of 20 linked nucleosides having a nucleobase sequence consisting of SEQ ID NO: 26, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked deoxynucleosides;

a 5 'wing segment consisting of five linked nucleosides;

a 3 'wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5 'wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-O-methoxyethyl modified sugar, wherein each bond The internucleoside of said modified oligonucleotide is a phosphorothioate bond, and wherein each cytosine residue of said modified oligonucleotide is a 5-methylcytosine.

ES 2 634 450 T3

The invention also provides a composition comprising the compound of the invention and at least one of a pharmaceutically acceptable carrier or diluent.

The invention also provides the compound or composition of the invention for use in

a) prevent, treat, ameliorate, slow the progression of, or delay the onset of a disease or condition associated with PTP1B in an animal; or

b) preventing or delaying the occurrence of increased blood glucose levels in an animal;

c) prevent, treat, ameliorate, or slow the progression of a metabolic disease or condition.

BRIEF DESCRIPTION OF THE FIGURES

The numerous objects and advantages of the present invention may be better understood by those skilled in the art by referring to the accompanying figures, in which:

Figure 1 shows a Western blot of the antisense oligonucleotides PTP1B, ISIS 404173 and ISIS 142082, demonstrating the decrease in expression of the PTP1B protein in 8mgk / week the potency of the compounds. See Table 47.

Figure 2 is a summary table of key tolerability studies in cynomolgus monkeys (see Example 17).

Figure 3 is a reduced graphical representation of human PTP1B mRNA in a preclinical dose response study. Treatment with ISIS 404173 was compared with that of ISIS 113715, the previous clinical candidate. As shown here, dosing with ISIS 404173 was more potent and caused a significant reduction in PTP1B mRNA levels compared to dosing with ISIS 113715. In particular, at doses of 0.3 mM, there was a five-fold decrease in PTP1B mRNA levels with ISIS 404173 compared to ISIS 113715.

DETAILED DESCRIPTION

It is to be understood that both the above general description and the following detailed description are exemplary and explanatory and are not restrictive of the invention, as claimed. In this document, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of or means and / or unless otherwise indicated. Furthermore, the use of the term including, as well as other forms, such as includes and included, is not limiting. Furthermore, terms such as element or component encompass both elements and components that comprise a unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

Definitions

Unless specific definitions are provided, the nomenclature used in connection with, and chemical analytical, synthetic organic chemistry, and medical and pharmaceutical chemistry techniques and procedures described herein are well known and commonly used in the art. Standard techniques can be used for chemical synthesis, and chemical analysis.

Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical synthesis, and chemical analysis. Unless otherwise stated, the following terms have the following meanings:

2'-O-methoxyethyl (also from 2'-MOE and 2'-O (CH2) 2-OCH3) Refers to an O-methoxy-ethyl modification of the 2 'position of a furosyl ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

2'-O-methoxyethyl nucleotide means a nucleotide comprising a modified 2'-omethoxyethyl sugar residue. 3 'target site refers to the nucleotide of a nucleic acid target that is complementary to the 3' nucleotide end of a particular antisense compound.

5 'target site refers to the nucleotide of a target nucleic acid that is complementary to the 5' nucleotide end of a particular antisense compound.

5-methylcytosine means a modified cytosine with a methyl group attached to the 5 'position. A 5-methylcytosine is a modified nucleobase.

Roughly means within + 10% of a value. For example, if it is stated, a marker can be increased by about 50%, it is implied that the marker can be increased between 45% -55%.

ES 2 634 450 T3

Active pharmaceutical agent means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments a PTP1B targeting oligonucleotide antisense is an active pharmaceutical agent.

Active target region or target region refers to a region to which one or more antisense active compounds is targeted. Active antisense compounds mean antisense compounds that reduce target nucleic acid levels or protein levels.

Adipogenesis means the development of fat cells from preadipocytes. Lipogenesis means the production or formation of fat, either fatty degeneration or fatty infiltration.

Adiposity or obesity refers to the state of being obese or an excessively high amount of body fat or adipose tissue in relation to lean body mass. The amount of body fat includes concern for both the distribution of fat throughout the body and the size and mass of adipose tissue stores. Body fat distribution can be estimated by skinfold measurements, waist-to-hip circumference ratios, or techniques such as ultrasound, computed tomography, or magnetic resonance imaging. According to the Center for Disease Control and Prevention, individuals with a body mass index (BMI) of 30 or more are considered obese. The term obesity as used herein includes conditions in which an increase in body fat beyond the physical requirement occurs as a result of excessive accumulation of adipose tissue in the body. The term obesity includes, but is not limited to, the following conditions: adult-onset obesity; dietary obesity; endogenous or inflammatory obesity; endocrine obesity; family obesity; hyperinsulin obesity; hyperplastic-hypertrophic obesity; hypogonadism obesity; hypothyroid obesity; lifelong obesity; Morbid obesity and exogenous obesity.

Concomitantly administered refers to the co-administration of two agents in any way in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents do not have to manifest at the same time. The effects only need to overlap for a period of time and do not need to be coextensive.

Administering means providing an agent to an animal, and includes, but is not limited to, administration by a medical professional and self-administration.

Agent means an active substance that can provide a therapeutic benefit when administered to an animal. "First agent" means a therapeutic compound provided herein. For example, a first agent can be a PTP1B that targets antisense oligonucleotide. Second agent means a second therapeutic compound of the invention (eg, a second PTP1B targeting antisense oligonucleotide) and / or a non-PTP1B therapeutic compound.

Amelioration refers to a decrease in at least one indicator, sign, or symptom of an associated disease, disorder, or condition. The severity of the indicators can be determined by subjective or objective measures, which are known to those of skill in the art.

Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or the protein encoded by such target nucleic acid.

Antisense compound refers to an oligomeric compound that is capable of undergoing hybridization with a target nucleic acid via hydrogen bonding.

Antisense inhibition refers to the reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the target nucleic acid. antisense compound.

Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that allows hybridization to a corresponding region or segment of a target nucleic acid.

Bicyclic sugar means a furosyl ring modified by the bridge of two non-geminal ring atoms.

A bicyclic sugar is a modified sugar.

ES 2 634 450 T3

Bicyclic nucleic acid or BNA refers to a nucleoside or nucleotide in which the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms in the furanose ring, thereby forming a bicyclic ring system.

Cap structure or end cap moiety means chemical modifications, which have been incorporated into either end of an antisense compound.

Chemically distinct region refers to a region of an antisense compound that is in some way chemically different from another region of the same antisense compound. For example, a region having 2'-O-methoxyethyl nucleotides is chemically distinct from a region having the unmodified 2'-O-methoxyethyl nucleotides.

Chimeric antisense compound refers to an antisense compound that has at least two chemically distinct regions.

Co-administration means the administration of two or more agents to an individual. The two or more agents can be in a single pharmaceutical composition, or they can be in separate pharmaceutical compositions. Each of the two or more agents can be administered via the same or different routes of administration. Co-administration encompasses parallel or sequential administration.

Cholesterol is a sterol molecule found in the cell membranes of all animal tissues. Cholesterol must be transported in the blood plasma of an animal by lipoproteins, including very low-density lipoproteins (VLDL), intermediate-denity lipoproteins (IDL), low-density lipoproteins (LDL), and high-density lipoprotein (HDL). . Plasma cholesterol refers to the sum of all esterified lipoproteins (VDL, IDL, LDL, HDL) and / or cholesterol present in unesterified plasma or serum.

Cholesterol absorption inhibitor means an agent that inhibits the absorption of exogenous cholesterol obtained from the diet.

Complementarity means the ability for nucleobase pairing of a first nucleic acid and a second nucleic acid.

Contiguous nucleobases mean nucleobases immediately adjacent to each other.

Deoxyribonucleotide means a nucleotide having a hydrogen at the position of the sugar portion of nucleotide 2 '. Deoxyribonucleotides can be modified with any of a variety of substituents.

Diabetes mellitus or diabetes is a syndrome characterized by abnormally high blood sugar metabolism (hyperglycemia) as a result of insufficient insulin levels or reduced insulin sensitivity. Characteristic symptoms are excessive urine production (polyuria) due to blood glucose levels, excessive thirst and increased fluid intake (polydipsia) trying to compensate for increased urination, blurred vision due to the effects of glucose in the blood in the optics of the eye, unexplained weight loss, and lethargy.

Diabetic dyslipidemia or type 2 diabetes with dyslipidemia refers to a condition characterized by type 2 diabetes, reduced HDL-C, elevated triglyceride levels, and small and dense elevated LDL particles.

Diluent means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid saline solution, for example.

Dyslipidemia refers to a disorder of lipid and / or lipoprotein metabolism, including lipid and / or lipoprotein from excess production or deficiency. Dyslipidemias can be manifested by elevation of lipids such as cholesterol and triglycerides, as well as lipoproteins such as low-density lipoproteins (LDL).

Dosage unit means a form in which a pharmaceutical agent is provided, for example pill, tablet, or other dosage unit known in the art. In certain embodiments, a dosage unit is a vial containing lyophilized antisense oligonucleotide. In certain embodiments, a dosage unit is a vial containing reconstituted antisense oligonucleotide.

Dose means a specified amount of a pharmaceutical agent provided in a single administration, or in a specified period of time. In certain embodiments, a dose can be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where

ES 2 634 450 T3 for subcutaneous administration, the desired dose requires a volume that is not easily accommodated by a single injection, therefore, two or more injections can be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses can be stated as the amount of pharmaceutical agent per hour, day, week, or month.

"Effective amount" or "therapeutically effective amount" means the amount of active pharmaceutical agent sufficient to effect a desired physiological result in an individual in need of the agent. The effective amount may vary between individuals, depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, the evaluation of the individual's medical condition, and other relevant factors.

Fully complementary or 100% complementary means each nucleobase of a nucleobase sequence of a first nucleic acid has a nucleobase complementary to a second nucleobase sequence of a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

Gapmer means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage between the external regions having one or more nucleosides is placed, wherein the nucleosides comprising the internal region are chemically other than the nucleoside or nucleosides comprising the outer regions. The inner region can be referred to as a gap segment and the outer regions can be referred to as a wing segment.

Gap-widened means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5 'and 3' wing segments having one to six nucleosides.

Glucose is a monosaccharide used by cells as an energy source and an inflammatory intermediate. Plasma glucose refers to glucose present in plasma.

HMG-CoA inhibitor means an agent that acts through the inhibition of the HMG-CoA enzyme reductase, such as atorvastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin, and simvastatin.

Hybridization means the hybridization of complementary nucleic acid molecules. In certain embodiments, the complementary nucleic acid molecules include an antisense compound and a target nucleic acid.

Hyperlipidemia or hyperlipidemia is a condition characterized by elevated serum lipids or circulating lipids (plasma). This condition manifests an abnormally high concentration of fat. The lipid fractions in circulating blood are cholesterol, low-density lipoproteins, very low-density lipoproteins, and triglycerides.

Hypertriglyceridemia refers to a condition characterized by elevated levels of triglycerides.

Identification or selection of an animal with metabolic means identifying or selecting a subject after being diagnosed with a metabolic disease, or a metabolic disorder; or, identify or select a subject who has any symptoms of a metabolic disease, including, but not limited to, metabolic syndrome, hyperglycemia, hypertriglyceridemia, hypertension, increased insulin resistance, decreased insulin sensitivity, above body weight normal, and / or above normal body fat or any combination thereof. Such identification can be made by any method, including, but not limited to, standard clinical tests or evaluations, such as serum or circulating (plasma) blood glucose measurement, measurement of circulating serum or triglycerides (plasma), blood pressure measurement, body fat measurement, body weight measurement, and the like.

Immediately adjacent means that there are no intermediate elements between the immediately adjacent elements.

Individual or subject or animal means a human or non-human animal selected for treatment or therapy.

Inhibiting expression or activity refers to a reduction or blocking of the expression or activity of an RNA or proteins and does not necessarily indicate a total elimination of expression or activity.

Insulin resistance is defined as the condition in which a normal amount of insulin is insufficient to produce a normal insulin response from fat, muscle and liver cells.

Insulin resistance in fat cells results in the hydrolysis of stored triglycerides, which increases free fatty acids in the blood plasma. Insulin resistance in the muscle reduces the uptake of

ES 2 634 450 T3 glucose while insulin resistance in the liver reduces glucose storage, both effects serving to raise blood glucose. High plasma levels of insulin and glucose due to insulin resistance often leads to metabolic syndrome and type 2 diabetes.

Insulin sensitivity is a measure of the level of efficiency with which an individual processes glucose. An individual who has a high insulin sensitivity efficiently processes glucose while an individual with low insulin sensitivity does not effectively process glucose.

Internucleoside bond refers to the chemical bond between nucleosides.

Intravenous administration means administration into a vein.

Linked nucleosides means adjacent nucleosides that are linked to each other.

Lipid-lowering therapy or lipid-lowering agent refers to a therapeutic regimen provided to a subject to lower one or more lipids in a subject. In certain embodiments, lipid-lowering therapy is provided to reduce one or more of ApoB, total cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL-C, triglycerides, LDL dense small particles, and Lp (a) on a subject. Examples of lipid-lowering therapy include statins, fibrates, and MTP inhibitors.

Major risk factors refers to factors that contribute to a high risk for a particular disease or condition. In certain embodiments, the major risk factors for coronary heart disease include, without limitation, smoking, hypertension, low HDL-C levels, family history of coronary heart disease, age, and other factors are described herein.

Metabolic disease or metabolic disorder refers to a condition characterized by an alteration or disturbance in metabolic function. Metabolic and metabolism are terms well known in the art and generally include the full range of biochemical processes that occur within a living organism. Metabolic diseases or disorders include, but are not limited to, obesity, diabetes, hyperglycemia, prediabetes, non-alcoholic fatty liver disease (NAFLD), metabolic syndrome, insulin resistance, diabetic dyslipidemia, or hypertriglyceridaemia or a combination of the themselves.

Metabolic syndrome refers to a condition characterized by a grouping of lipids and non-lipid cardiovascular risk factors of metabolic origin. In certain embodiments, the metabolic syndrome is identified by the presence of any 3 of the following factors: waist circumference greater than 102 cm in men or greater than 88 cm in women; serum triglycerides of at least 150 mg / dl; HDL-C of less than 40 mg / dl in men or less than 50 mg / dl in women; blood pressure of at least 130/85 mmHg; and fasting glucose of at least 110 mg / dL. These determinants can be easily measured in clinical practice (JAMA, 2001, 285: 2486-2497).

Mismatch or non-complementary nucleobase refers to the case where a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second nucleic acid or target nucleic acid.

Mixed dyslipidemia refers to a condition characterized by elevated levels of cholesterol and elevated triglycerides.

Modified internucleoside linkage refers to a substitution or any change of a natural internucleoside linkage (ie, a phosphodiester internucleoside linkage).

Modified nucleobase refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An unmodified nucleobase means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

Modified nucleoside means a nucleoside that independently has a modified sugar moiety or modified nucleobase.

Modified nucleotide means a nucleotide that independently has a modified sugar moiety, modified internucleoside linkage, or modified nucleobase. A modified nucleoside means a nucleoside that independently has a modified sugar moiety or modified nucleobase.

Modified oligonucleotide means an oligonucleotide comprising at least one modified nucleotide.

Modified sugar refers to the substitution or change of a natural sugar.

ES 2 634 450 T3

Motif means the pattern of chemically distinct regions in an antisense compound.

MTP inhibitor means that an agent inhibits the enzyme, the microsomal triglyceride transfer protein.

Natural internucleoside linkage means a 3 'to 5' phosphodiester linkage.

Natural sugar residue means a sugar found in DNA (2'-H) or RNA (2'-OH).

Nonalcoholic fatty liver disease or NAFLD means a condition characterized by fatty inflammation of the liver that is not due to excessive use of alcohol (for example, alcohol consumption of more than 20 g / day). In certain embodiments, NAFLD is associated with insulin resistance and the metabolic syndrome. NAFLD encompasses a spectrum of disease ranging from simple accumulation of triglycerides in hepatocytes (hepatic steatosis) to hepatic steatosis with inflammation (steatohepatitis), fibrosis, and cirrhosis.

Nonalcoholic steatohepatitis (NASH) occurs from the progression of NAFLD beyond the deposition of triglycerides. A second blow capable of inducing necrosis, inflammation, and fibrosis is needed for the development of NASH. Candidates for the second hit can be grouped into broad categories: factors that cause increased oxidative stress and factors that promote the expression of pro-inflammatory cytokines

Nucleic acid refers to molecules made up of monomeric nucleotides. A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small ribonucleic acids (siRNAs), and microRNAs (miRNAs). A nucleic acid can also comprise a combination of these elements in a single molecule.

Nucleobase means a heterocyclic moiety capable of base pairing with another nucleic acid.

Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.

Nucleosides refers to a nitrogenous base attached to a sugar.

Nucleoside mimetics include those structures used to replace sugar or sugar and base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicycles sugar mimetics or tricycles for example non-furanose sugar units.

Nucleotide means a nucleoside having a phosphate group covalently attached to the sugar portion of the nucleoside.

Nucleotide mimetic includes those structures used to replace the nucleoside and the bond at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by -N (H) -C (= O) -O- or other non-phosphodiester bond).

Oligomeric compound or oligomer refers to a polymeric structure that comprises two or more substructures and is capable of hybridizing to a region of a nucleic acid molecule. In certain embodiments, the oligomeric compounds are oligonucleosides. In certain embodiments, the oligomeric compounds are oligonucleotides. In certain embodiments, the oligomeric compounds are antisense compounds. In certain embodiments, the oligomeric compounds are antisense oligonucleotides. In certain embodiments, the oligomeric compounds are chimeric oligonucleotides.

"Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent of one another.

Parenteral administration refers to administration via injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, eg, intrathecal or intracerebroventricular administration. Administration can be continuous or chronic, or short or intermittent.

Peptide means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.

Pharmaceutical agent refers to a substance that provides a therapeutic benefit when administered for a particular indication. For example, in certain embodiments, an antisense oligonucleotide directed to

PTP1B is a pharmaceutical agent.

ES 2 634 450 T3

Pharmaceutical composition means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition can comprise one or more active agents and a sterile aqueous solution.

Pharmaceutically acceptable carrier means a medium or diluent that does not interfere with the structure of the oligonucleotide. Certain such carriers allow pharmaceutical compositions to be formulated as, for example, tablets, pills, lozenges, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution.

Pharmaceutically acceptable derivative encompasses pharmaceutically acceptable salts, conjugates, prodrugs, or isomers of the compounds described herein.

"Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of the antisense compounds, that is, salts that retain the desired biological activity of the parent oligonucleotide and do not impart unwanted toxicological effects.

Phosphorothioate bond means an inter-nucleoside bond where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate bond is a modified internucleoside bond.

Portion means a defined number of contiguous nucleobases (ie, bonds) of a nucleic acid. In certain embodiments, a part is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a part is a defined number of contiguous nucleobases of an antisense compound.

Prevent refers to delaying or preventing the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevention also means reducing the risk of developing a disease, disorder or condition.

Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.

Protein tyrosine phosphatase 1B or PTP1B (also known as PTPN1; protein tyrosine phosphatase, non-receptor type 1; PTP-1B; RKPTP) means any nucleic acid or protein of PTP1B.

PTP1B expression means the level of mRNA transcribed from the gene encoding PTP1B or the level of protein translated from the mRNA. Expression of PTP1B can be determined by methods known in the art such as a Northern or Western blot.

PTP1B nucleic acid means any nucleic acid encoding PTP1B. For example, in certain embodiments, a PTP1B nucleic acid includes a DNA sequence encoding PTP1B, an RNA sequence transcribed from DNA encoding PTP1B (including genomic DNA comprising introns and exons), and an mRNA sequence. encoding PTP1B. PTP1B mRNA means an mRNA encoding a PTP1B protein.

Side effects refers to physiological responses attributable to treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, kidney function abnormalities, liver toxicity, kidney toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased serum aminotransferase levels may indicate liver toxicity or abnormal liver function. For example, increased bilirubin may indicate liver toxicity or abnormal liver function.

Single stranded oligonucleotide means an oligonucleotide that does not hybridize to a complementary strand.

Hybridizing specifically refers to an antisense compound that has a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effect on non-target nucleic acids under conditions in which they are you want specific binding, that is, under physiological conditions in the case of in vivo tests and therapeutic treatments.

Statins means an agent that inhibits the activity of HMG-CoA reductase.

Subcutaneous administration refers to administration just under the skin.

ES 2 634 450 T3

Targeting or targeting means the process of designing and selecting an antisense compound that specifically hybridizes to a target nucleic acid and induces a desired effect.

Target nucleic acid, target RNA, and target RNA transcription all refer to nucleic acid capable of targeting antisense compounds.

Segment means the nucleotide sequence of a target nucleic acid to which an antisense compound is directed. 5 'target site refers to the 5' most nucleotides of a target segment. 3 '"target site" refers to the 3' most nucleotide of a target segment.

Therapeutically effective amount means an amount of an agent that provides a therapeutic benefit to an individual.

Therapeutic lifestyle change means diet and lifestyle changes aimed at reducing cholesterol and / or fat / adipose tissue mass. Such a change may reduce the risk of developing heart disease, and may include recommendations for dietary intake of total daily calories, total fat, saturated fat, polyunsaturated fat, monounsaturated fat, carbohydrates, protein, cholesterol, insoluble fiber, as well as recommendations. for physical activity.

Triglycerides or TG means a neutral fat or lipid consisting of glycerol combined with three fatty acid molecules.

Type 2 diabetes, (also known as type 2 diabetes mellitus or type 2 diabetes mellitus, and formerly type 2 diabetes mellitus, non-insulin dependent diabetes (NIDDM), obesity-related diabetes, or adult diabetes) is a metabolic disorder characterized primarily by insulin resistance, relative insulin deficiency, and hyperglycemia.

Treating refers to administering a pharmaceutical composition to an animal to effect an alteration or amelioration of a disease, disorder, or condition.

Unmodified nucleotide means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is a nucleotide of

RNA (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).

Certain realizations

Certain embodiments describe methods, compounds, and compositions for inhibiting PTP1B expression.

Certain embodiments describe antisense compounds targeted to a PTP1B nucleic acid. In certain embodiments, the PTP1B nucleic acid is any of the sequences set forth in GenBank Accession No. NM_002827.2 (incorporated herein as SEQ ID NO: 1), GenBank Accession No. NT_011362.9 truncated from the nucleotides 14178000 to 14256000 (incorporated herein as SEQ ID NO: 2); and a concatenation of the sequences of exons 1-9, intron 9, and exon 10 of the rhesus monkey PTP1B scaffold (incorporated herein as SEQ ID NO: 3).

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 10 to 30 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs. : 1-3.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3 .

In certain embodiments, the compounds or compositions described herein may consist of 10 to 30 nucleoside linkages and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 4-32 or 100-111.

In certain embodiments, the compounds or compositions described herein may consist of 10 to 30 nucleoside linkages and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 26 or 44.

In certain embodiments, the compounds or compositions described herein may consist of up to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13,

ES 2 634 450 T3

14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases from any of ISIS NOs: 404173, 410002, 438373, 438383,

438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions described herein may consist of 10 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases from ISIS NO: 404173.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 15 to 30 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs. : 1-3.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 15 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3 .

In certain embodiments, the compounds or compositions described herein may consist of 15 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 4-32. or 100-111.

In certain embodiments, the compounds or compositions described herein may consist of 15 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 26 or 44.

In certain embodiments, the compounds or compositions described herein may consist of 15 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases from any of ISIS NOs: 404173, 410002, 438373, 438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions described herein may consist of 15 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 1 3, 14, 15, 16, 17 , 18, 19, or 20 contiguous nucleobases of ISIS NO: 404173.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 18 to 21 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs. : 1-3.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 18 to 21 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, or 21 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions disclosed herein consist of 18 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 4-32. or 39-49.

In certain embodiments, the compounds or compositions disclosed herein consist of 18 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 26 or 44.

In certain embodiments, the compounds or compositions disclosed herein consist of 18 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from any of ISIS NOs: 404173, 410002, 438373, 438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions disclosed herein consist of 18 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from ISIS NO: 404173.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 20 to 35 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of the

SEQ ID NOs: 1-3.

ES 2 634 450 T3

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,

33, 34 or 35 contiguous nucleotide bases complementary to a portion of equal length of any of the

SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions described herein consist of 20 to 35 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32 or 50.

In certain embodiments, the compounds or compositions described herein consist of 20 to 35 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions described herein consist of 20 to 35 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from any of ISIS NOs: 404173, 410002, 438373, 438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions described herein consist of 20 to 35 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from ISIS NO: 404173.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 20 to 30 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs. : 1-3.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3 .

In certain embodiments, the compounds or compositions described herein consist of 20 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NO: 4-32 or 50.

In certain embodiments, the compounds or compositions described herein consist of 20 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions described herein consist of 20 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of any of ISIS NOs: 404173, 410002, 438383, 438445, 438454, 438463, or 438 472,

In certain embodiments, the compounds or compositions disclosed herein consist of 20 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of ISIS NO: 404173.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 to 25 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs. : 1-3.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 to 25 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions described herein consist of 20 to 25 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32.

ES 2 634 450 T3

In certain embodiments, the compounds or compositions described herein consist of 20 to 25 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15,

16, 17, 18, 19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions disclosed herein consist of 20 to 25 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from any of ISIS NOs: 404173, 410002, 438383, 438445, 438454, 438463, or 438 472.

In certain embodiments, the compounds or compositions described herein consist of 20 to 25 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from ISIS NO: 404173.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 20 to 24 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs. : 1-3.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 to 24 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, or 24 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions described herein consist of 20 to 24 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32.

In certain embodiments, the compounds or compositions described herein consist of 20 to 24 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions described herein consist of 20 to 24 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from any of ISIS NOs: 404173, 410002, 438373, 438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions described herein consist of 20 to 24 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from ISIS NO: 404173.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 20 to 23 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs. : 1-3.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 20 to 23 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions described herein consist of 20 to 23 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32.

In certain embodiments, the compounds or compositions described herein consist of 20 to 23 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions described herein consist of 20 to 23 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from any of ISIS NOs: 404173, 410002, 438373, 438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions described herein consist of 20 to 23 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15,

16, 17, 18, 19, or 20 contiguous nucleobases of ISIS NO: 404173.

ES 2 634 450 T3

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 20 to 22 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of the

SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 20 to 22 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, or 22 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions described herein consist of 20 to 22 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32.

In certain embodiments, the compounds or compositions described herein consist of 20 to 22 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions described herein consist of 20 to 22 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from any of ISIS NOs: 404173, 410002, 438373, 438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions described herein consist of 20 to 22 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from ISIS NO: 404173.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 20 to 21 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs. : 1-3.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 to 21 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, or 21 complementary contiguous nucleobases to an equal length portion of any of SEQ ID NOs: 1-3.

In certain embodiments, the compounds or compositions described herein consist of 20 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32.

In certain embodiments, the compounds or compositions described herein consist of 20 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions disclosed herein consist of 20 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from any of ISIS NOs: 404173, 410002, 438373, 438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions described herein consist of 20 to 21 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, or 20 contiguous nucleobases from ISIS NO: 404173.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1 -3.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19 or 20 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.

ES 2 634 450 T3

In certain embodiments, the compounds or compositions described herein will consist of 20 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15,

16, 17, 18, 19, or 20 contiguous nucleobases of SEQ ID NOs: 4-32.

In certain embodiments, the compounds or compositions described herein will consist of 20 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , or 20 contiguous nucleobases of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions described herein consist of any of ISIS NOs: 404173, 410002, 438373, 438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions described herein are comprised of ISIS NO: 404,173.

In certain embodiments, the compounds or compositions provided herein consist of SEQ ID NO: 26.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide salt.

In certain embodiments, the compounds or compositions provided herein further comprise a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to any of SEQ ID NOs: 1-3 measured on the entire modified oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a any of SEQ ID NO: 4-32 or 39-50. as measured over the entire modified oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with a any of SEQ ID NO: 26 or 44. measured over the entire modified oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with a any of ISIS NOs: 404173, 410002, 438373, 438383, 438445, 438454, 438463, or 438472 as measured over the entire modified oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to ISIS. NO: 404173 as measured over the entire modified oligonucleotide.

In certain embodiments, the compound provided herein consists of a modified single-stranded oligonucleotide.

In certain embodiments, the modified oligonucleotide consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 , 29, 30, 31, 32, 33, 34 or 35 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides.

In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. In certain embodiments, each internucleoside linkage is an internucleoside phosphorothioate linkage.

In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) 5 'wing segment consisting of linked nucleosides; and c) a 3 'wing segment consisting of linked nucleosides. The gap segment is positioned between the 5 'wing segment and the 3' wing segment and each nucleoside in each wing segment comprises a modified sugar.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5 'wing segment consisting of five nucleosides

ES 2 634 450 T3 linked, the 3 'wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a 2'-O-methoxyethyl modified sugar, each internucleoside bond is a phosphorothioate bond and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of eight linked deoxynucleosides, the 5 'wing segment consisting of six linked nucleosides, the 3' wing segment consisting of six linked nucleosides, Each nucleoside in each wing segment comprises a modified 2'-O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond, and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of thirteen linked deoxynucleosides, the 5 'wing segment consisting of two linked nucleosides, the 3' wing segment consisting of five linked nucleosides, Each nucleoside in each wing segment comprises a modified 2'-O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond, and each cytosine is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides, the gap segment consisting of eight linked deoxynucleosides, the 5 'wing segment consisting of five linked nucleosides, the 3' wing segment consisting of five linked nucleosides, Each nucleoside in each wing segment comprises a modified 2'-O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond, and each cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3, wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) 5 'wing segment consisting of five linked nucleosides; and c) a 3 'wing segment consisting of five linked nucleosides. The gap segment is positioned between the 3 'wing segment and the 5' wing segment, each nucleoside of each wing segment comprises a modified 2'-O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 18 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3, wherein the modified oligonucleotide comprises: a) a gap segment consisting of eight linked deoxynucleosides; b) 5 'wing segment consisting of six linked nucleosides; and c) a 3 'wing segment consisting of six linked nucleosides. The gap segment is positioned between the 5 'wing segment and the 3' wing segment, each nucleoside in each wing segment comprises a modified 2'O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond, and each cytosine residue it is a 5-methylcytosine.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 19 contiguous nucleobases of SEQ ID NOs: 4-32, wherein the oligonucleotide Modified comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) 5 'wing segment consisting of five linked nucleosides; and c) a 3 'wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5 'wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a modified 2'-O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond, and each residue of cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 19 contiguous nucleobases of SEQ ID NO: 26, wherein the modified oligonucleotide comprises : a) a gap segment consisting of ten linked deoxynucleosides; b) 5 'wing segment consisting of five linked nucleosides; and c) a 3 'wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5 'wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a modified 2'-O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond, and each residue of cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having the nucleobase sequence of the

SEQ ID NO: 26, wherein the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) 5 'wing segment consisting of five linked nucleosides; and c) a 3 'wing segment consisting of five linked nucleosides. The gap segment is positioned between wing segment 5 'and

ES 2 634 450 T3 the 3 'wing segment, each nucleoside of each wing segment comprises a 2'-O-methoxyethyl modified sugar, each internucleoside bond is a phosphorothioate bond, and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 19 contiguous nucleobases of SEQ ID NO: 26 or 44, wherein the oligonucleotide modified comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) 5 'wing segment consisting of five linked nucleosides; and c) a 3 'wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5 'wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a modified 2'-O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond, and each residue of cytosine is a 5-methylcytosine. In certain embodiments, the compound or composition comprises the compound of any of ISIS NOs: 404173, 410002, 438383, 438445, 438454, 438463, or 438472.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 20 contiguous nucleobases of SEQ ID NOs: 4-32, wherein the oligonucleotide modified comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) 5 'wing segment consisting of five linked nucleosides; and c) a 3 'wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5 'wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a modified 2'-O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond, and each residue of cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions described herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 20 contiguous nucleobases of SEQ ID NO: 26, wherein the modified oligonucleotide comprises : a) a gap segment consisting of ten linked deoxynucleosides; b) 5 'wing segment consisting of five linked nucleosides; and c) a 3 'wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5 'wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a modified 2'-O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond, and each residue of cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions provided herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 20 contiguous nucleobases of SEQ ID NO: 26, wherein the modified oligonucleotide comprises : a) a gap segment consisting of ten linked deoxynucleosides; b) 5 'wing segment consisting of five linked nucleosides; and c) a 3 'wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5 'wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a modified 2'-O-methoxyethyl sugar, each internucleoside bond is a phosphorothioate bond, and each residue of cytosine is a 5-methylcytosine. In certain embodiments, the compound or composition comprises compound ISIS NOs: 404,173.

Certain embodiments describe methods, compounds, and compositions for inhibiting PTP1B expression.

Certain embodiments describe a method of reducing PTP1B expression in an animal comprising administering a compound to the animal as described herein. In certain embodiments, the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 to 35 nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified 20 to 25 nucleoside-long-linked oligonucleotide targeted to PTP1B. In certain embodiments, the compound comprises a modified 20 to 24 nucleoside-long linked oligonucleotide targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 to 23 linked nucleosides in length targeting PTP1B. In certain embodiments, the compound comprises a modified 20 to 22 nucleoside-long linked oligonucleotide targeted to PTP1B. In certain embodiments, the compound comprises a modified oligonucleotide 20 to 21 nucleosides linked in length targeting PTP1B. In certain embodiments, the compound comprises a modified 20 nucleoside-long-linked oligonucleotide targeted to PTP1B.

Certain embodiments describe a method of preventing, ameliorating, or treating a metabolic disease in an animal which comprises administering to the animal a compound as described herein. In certain embodiments, the compound comprises a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to PTP1B. In certain embodiments, the compound comprises a modified 20 nucleoside-long-linked oligonucleotide targeted to PTP1B. Examples of metabolic diseases or disorders include, but are not limited to, obesity, diabetes, hyperglycemia, prediabetes, nonalcoholic fatty liver disease (NAFLD), metabolic syndrome, insulin resistance, diabetic dyslipidemia, or hypertriglyceridaemia or a combination thereof.

ES 2 634 450 T3

Certain embodiments provide a method of lowering glucose levels in an animal which comprises administering a compound to the animal as described herein. In certain embodiments, the compound comprises a modified oligonucleotide 10 to 30 nucleosides linked in length targeted to PTP1B. In certain embodiments, the compound comprises a modified 20 nucleoside-long-linked oligonucleotide targeted to PTP1B. In certain embodiments, lowering glucose levels in an animal prevents, ameliorates, or treats a metabolic disease. In certain embodiments, lowering glucose levels in an animal prevents, alleviates, or treats diabetes. In certain embodiments, lowering glucose levels in an animal prevents, alleviates, or treats obesity. In certain embodiments, lowering glucose levels in an animal prevents, alleviates, or treats metabolic syndrome. In certain embodiments, lowering glucose levels in an animal prevents, alleviates, or treats insulin resistance. In certain embodiments, lowering glucose levels in an animal prevents, alleviates, or treats hyperglycemia. In certain embodiments, lowering glucose levels in an animal prevents, ameliorates, or treats NAFLD. In certain embodiments, lowering glucose levels in an animal prevents, alleviates, or treats diabetic dyslipidemia. In certain embodiments, the glucose level is reduced by at least 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75. %, 80%, 85%, 90%, 95%, or 100%.

In certain embodiments, PTP1B has the sequence as set forth in any of the GenBank accession numbers Accession No. GENBANK NM_002827.2 (incorporated herein as SEQ ID NO: 1), accession No. GENBANK NT_011362.9 nucleotides 14,178,000-14256000 truncated (incorporated herein as SEQ ID NO: 2); and a concatenation of sequences of exons 1-9, intron 9, and exon 10 of the rhesus monkey PTP1B scaffold (incorporated herein as SEQ ID NO: 3). In certain embodiments, PTP1B has the human sequence as set forth in SEQ ID NOs: 1-2. In certain embodiments, PTP1B has the rhesus monkey sequence as set forth in SEQ ID NOs: 3).

In certain embodiments, the compounds or compositions provided herein comprise a salt thereof, and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence indicated in SEQ ID NOs: 4-32, 50 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 25 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleotide bases of a nucleobase sequence indicated in SEQ ID NOs: 4-32, 50 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleotide bases of a nucleobase sequence indicated in SEQ ID NO: 432, 50 or a salt thereof. and a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the compounds or compositions provided herein comprise a salt thereof, and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence indicated in SEQ ID NO: 26 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 25 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleotide bases of a nucleobase sequence indicated in SEQ ID NO: 26 or a salt thereof. and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleotide bases of a nucleobase sequence indicated in SEQ ID NO: 26 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the compounds or compositions described herein comprise a salt thereof, and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from the nucleobase sequences recited in ISIS NOs: 404173 , 410002, 438383, 438445, 438454, 438463, or 438472 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 25 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleotide bases of a nucleobase sequence selected from the nucleobase sequences recited in ISIS NOs: 404173, 410002, 438383, 438445, 438454, 438463, or 438472 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleotide bases from a nucleobase sequence selected from the nucleobase sequences recited in ISIS NOs: 404173, 410002, 438383, 438445, 438454, 438463, or 438472 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

ES 2 634 450 T3

In certain embodiments, the compounds or compositions described herein comprise a salt thereof, and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from the nucleobase sequences recited in ISIS NO: 404173 or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 to 25 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleotide bases from a nucleobase sequence selected from the nucleobase sequences recited in ISIS No. : 404173, or a salt thereof and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition comprises a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleotide bases of a nucleobase sequence selected from the nucleobase sequences recited in ISIS No: 404173 , or a salt thereof and a pharmaceutically acceptable carrier or diluent.

Certain embodiments describe a method for treating an animal with a disease or condition related to PTP1B or comprising: a) identifying said animal with the PTP1B-related disease or condition, and b) administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having at least one nucleobase sequence 90% complementary to any of SEQ ID NOs: 1-3 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the therapeutically effective amount of the compound administered to the animal treats or reduces the PTP1B-related disease or condition, or a symptom thereof, in the animal. In certain embodiments, the PTP1B-related disease or condition is diabetes.

Certain embodiments describe a method for treating an animal with a PTP1B-related disease or condition or comprising: a) identifying said animal with the PTP1B-related disease or condition, and b) administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence at least 100% complementary to any of SEQ ID NOs: 1-3, measured over the entirety of said modified oligonucleotide. In certain embodiments, the therapeutically effective amount of the compound administered to the animals treats or reduces the PTP1B-related disease or condition, or a symptom thereof, in the animal. In certain embodiments, the PTP1B-related disease or condition is diabetes.

Certain embodiments describe methods for treating, preventing, or ameliorating a metabolic disease. In certain embodiments, the metabolic disease is obesity, diabetes, hyperglycemia, prediabetes, non-alcoholic fatty liver disease (NAFLD), metabolic syndrome, insulin resistance, diabetic dyslipidemia, or hypertriglyceridaemia or a combination thereof.

Certain embodiments describe methods for treating, preventing, or ameliorating a hyperproliferative disorder.

Certain embodiments describe methods that comprise administering to an animal a compound as described herein to an animal. In certain embodiments, the method comprises administering to an animal a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence indicated in SEQ ID NOs: 4-32 or 50. Certain embodiments describe methods that comprise administering to an animal a compound as described herein to an animal. In certain embodiments, the method comprises administering to an animal a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleotide bases of a nucleobase sequence indicated in SEQ ID NO: 26.

Certain embodiments disclose methods that comprise administering to an animal a compound as described herein to an animal. In certain embodiments, the method comprises administering to an animal a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from the nucleobase sequences recited in ISIS NOs: 404173, 410002, 438383, 438445, 438454, 438463, or 438472.

Certain embodiments describe methods that comprise administering to an animal a compound as described herein to an animal. In certain embodiments, the method comprises administering to an animal a modified oligonucleotide consisting of 20 to 35 linked nucleosides and having a nucleobase sequence comprising at least 20 contiguous nucleobases of a nucleobase sequence selected from the nucleobase sequences recited in ISIS NO: 404173.

In certain embodiments, the animal is a human.

ES 2 634 450 T3

In certain embodiments, administration prevents, treats, alleviates, or delays the progression of a metabolic disease as described herein.

In certain embodiments, administration prevents, treats, ameliorates, or slows the progression of diabetes as described herein.

In certain embodiments, the compound is co-administered with a second agent.

In certain embodiments, the compound and the second agent are administered concomitantly.

In certain embodiments, the administration is parenteral administration.

Certain embodiments further disclose a method of reducing PTP1B mRNA or protein expression in an animal comprising administering to the animal a compound or composition as described herein to reduce PTP1B mRNA or protein expression in the animal. In certain embodiments, the animal is a human. In certain embodiments, reduction of PTP1B mRNA or protein expression prevents, treats, slows, or slows the progression of metabolic disease. In certain embodiments, the metabolic disease or condition is diabetes.

Certain embodiments describe a method for treating a human with a metabolic disease which comprises identifying the human with the disease and administering to the human a therapeutically effective amount of a compound or composition as described herein. In certain embodiments, the treatment reduces a symptom selected from the group consisting of metabolic syndrome, hyperglycemia, hypertriglyceridaemia, hypertension, increased glucose levels, increased insulin resistance, decreased insulin sensitivity, by above normal body weight, and / or above normal body fat or any combination thereof.

Certain embodiments describe a method for treating a human with diabetes which comprises identifying the human with the disease and administering to the human a therapeutically effective amount of a compound or composition as described herein. In certain embodiments, the treatment reduces a symptom selected from the group consisting of metabolic syndrome, hyperglycemia, hypertriglyceridaemia, hypertension, increased glucose levels, increased insulin resistance, decreased insulin sensitivity, by above normal body weight, and / or above normal body fat or any combination thereof.

Further described is a method of reducing or preventing metabolic disease which comprises administering to a human a therapeutically effective amount of compound or composition as described herein, thus reducing or preventing metabolic disease.

Further described is a method of reducing or preventing diabetes which comprises administering to a human a therapeutically effective amount of compound or composition as described herein, thereby reducing or preventing diabetes.

A method for ameliorating a symptom of metabolic disease is also described, which comprises administering to a human in need thereof a compound comprising a modified oligonucleotide consisting of 20 to 35 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes with SEQ ID NO: 1, 2, or 3, thereby ameliorating a symptom of metabolic disease in humans.

Furthermore, a method for ameliorating a diabetes symptom is described, which comprises administering to a human in need thereof a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes with SEQ ID NO: 1, 2, or 3, thereby improving a human diabetes symptom.

Furthermore, a method for ameliorating a diabetes symptom is described, which comprises administering to a human in need thereof a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes with SEQ ID NO: 1, 2, or 3, thereby ameliorating a symptom of diabetes in the human.

Furthermore, a method is described for reducing the rate of progression of a symptom associated with metabolic diseases, which comprises administering to a human in need thereof a compound comprising a modified oligonucleotide comprising 10 to 30 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1, 2, or 3, thus reducing the rate of progression of a symptom of metabolic disease in humans.

Furthermore, a method for reducing the rate of progression of a symptom associated with diabetes is described, which comprises administering to a human in need thereof a compound comprising an oligonucleotide

ES 2 634 450 T3 consisting of 20 to 35 linked nucleosides, wherein said modified oligonucleotide specifically hybridizes to SEQ ID NO: 1, 2, or 3, thus reducing the rate of progression of a diabetes symptom in the ser human.

Furthermore, a method is described for reducing the rate of progression of a symptom associated with diabetes, which comprises administering to a human in need thereof a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein said modified oligonucleotide is specifically hybridizes to SEQ ID NO: 1, 2, or 3, thus reducing the rate of progression of a diabetes symptom in humans.

Methods and compounds for the preparation of a medicament for the treatment, prevention, or amelioration of a metabolic disease are also described.

Methods and compounds for the preparation of a medicament for the treatment, prevention, or amelioration of diabetes are also described.

Certain embodiments describe the use of a compound as described herein in the manufacture of a medicament for treating, ameliorating, or preventing metabolic disease.

Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, ameliorating, or preventing diabetes.

Certain embodiments provide a compound as described herein for use in treating, preventing, or ameliorating metabolic diseases as described herein by combination therapy with an additional agent or therapy as described. described in this document. The agents or therapies can be co-administered or administered concomitantly.

Certain embodiments provide a compound as described herein for use in treating, preventing, or ameliorating diabetes as described herein by combination therapy with an additional agent or therapy as described in This document. The agents or therapies can be co-administered or administered concomitantly.

Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, preventing, or ameliorating metabolic diseases as described herein by combination therapy with an additional agent or therapy as described. in the present document. The agents or therapies can be co-administered or administered concomitantly.

Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, preventing, or ameliorating diabetes as described herein by combination therapy with an additional agent or therapy as described in This document. The agents or therapies can be co-administered or administered concomitantly.

Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, preventing, or ameliorating metabolic diseases as described herein in a patient who is subsequently administered an additional agent or therapy such as described here.

Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, preventing, or ameliorating diabetes as described herein in a patient who is subsequently administered an additional agent or therapy as described. described in this document.

Certain embodiments provide a kit for treating, preventing, or ameliorating metabolic diseases as described herein wherein the kit comprises:

(i) a compound as described herein; and, alternatively, (ii) an additional agent or therapy as described herein.

Certain embodiments provide a kit for treating, preventing, or ameliorating diabetes as described herein wherein the kit comprises:

(i) a compound as described herein; and, alternatively, (ii) an additional agent or therapy as described herein.

ES 2 634 450 T3

A kit as described herein may further include instructions for using the kit to treat, prevent, or ameliorate metabolic disease, as described herein by combination therapy as described herein. In certain embodiments, the metabolic disease is diabetes.

Antisense compounds

Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, analogs, oligonucleotides, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound may be antisense to a target nucleic acid, in the sense that it is capable of undergoing hybridization to a target nucleic acid via hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5 'to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is directed. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence which, when written in the 5 'to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is directed.

In certain embodiments, an antisense compound targeted to a PTP1B nucleic acid is 10 to 30 nucleotides in length. In other words, the antisense compounds are 10 to 30 nucleobases linked. In other embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8 to 80, 10 to 50, 15 to 30, 18 to 21, 20 to 80, 20 to 35, 20 to 30, 20 to 29, 20 to 28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, or 20 linked nucleobases. In certain such embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobase bonds in length, or a range defined by any two of the above values.

In certain embodiments, the antisense compound comprises a shortened or truncated modified oligonucleotide. The shortened or truncated modified oligonucleotide may have a single nucleoside deleted from the 5 'end (5' truncation), or alternatively from the 3 'end (3' truncation). A shortened or truncated oligonucleotide may have two nucleosides removed from the 5 'end, or, alternatively, it may have two subunits removed from the 3' end. Alternatively, the removed nucleosides can be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having a 5 'end deleted nucleoside and a 3' end deleted nucleoside.

When a single additional nucleoside is present in an elongated oligonucleotide, the additional nucleoside can be located at the 5 'or 3' end of the oligonucleotide. When two or more additional nucleosides are present, the additional nucleosides can be adjacent to each other, for example, in an oligonucleotide that has two nucleosides added to the 5 'end (5' addition), or alternatively to the 3 'end (3' addition) , of the oligonucleotide. Alternatively, the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having a nucleoside added to the 5 'end and a subunit added to the 3' end.

It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and / or introduce mismatch bases without eliminating the activity. For example, in Woolf et al. (Proc Natl Acad Sci USA 89: 7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. . The antisense oligonucleotides 25 nucleobases in length with 8 or 11 bases of mismatch near the ends of the antisense oligonucleotides were able to direct the specific cleavage of the target mRNA, although to a lesser extent than the antisense oligonucleotides that did not contain mismatches. Similarly, the specific goal of cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

Gautschi et al (J. Natl Cancer Inst. 93: 463-471, March 2001) demonstrated the ability of an oligonucleotide that has 100% complementarity with bcl-2 mRNA and that has 3 mismatches to bcl-xL mRNA to reduce the expression of both Bcl-2 and Bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent antitumor activity in vivo.

Maher and Dolnick (Nuc Acid Res 16: 3341-3358, 1988) examined a series of tandem 14 nucleobase antisense oligonucleotides, and 28 and 42 nucleobase antisense oligonucleotides composed of the sequence of two or three of the tandem antisense oligonucleotides, respectively. , for its ability to stop human DHFR translation in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was capable of inhibiting translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Antisense compound motifs

ES 2 634 450 T3

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer properties of antisense compounds such as improved inhibitory activity, increased binding affinity for a nucleic acid. target, or resistance to nuclease degradation in vivo.

Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cell uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of a chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNAse H, which cleaves the RNA strand of an RNA: DNA duplex.

Antisense compounds that have a gapmer motif are considered chimeric antisense compounds. An internal region having a plurality of nucleosides supporting cleavage RNAseH is positioned in a gapmer between the outer regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmeric motif, the gap segment generally serves as a substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer differ by the types of sugar moieties that each distinct region comprises. The types of sugar moieties that are used to differentiate regions of a gapmer may, in some embodiments, include β-Dribonucleosides, β-D-deoxyribonucleosides, 2 'modified nucleosides (e.g., 2' modified nucleosides can include 2 ' '-MOE and 2'-O-CH3, among others), and modified bicyclic sugar (such sugar-modified bicyclic nucleosides may include those with a constrained acetate). In certain embodiments, the wings can include various modified sugar moieties, including, for example, 2'-MOE and constrained ethyl. In certain embodiments, the wings can include various modified and unmodified sugar moieties. In certain embodiments, the wings can include various combinations of 2'-MOE nucleosides, limited ethyl nucleosides, and 2'-deoxynucleosides.

Each distinct region can comprise uniform sugar moieties, variant, or alternate sugar moieties. The wing-hollow-wing motif is often described as XYZ, where X represents the 5 'wing length, Y represents the gap length, and Z represents the 3' wing length. X and Z can comprise uniform, variant, or alternate sugar moieties. In certain embodiments, X and Y can include one or more 2'deoxynucleosides. Y can comprise 2'-deoxynucleosides. As used herein, a gamer described as XYZ has a configuration such that the gap is positioned immediately adjacent to each of the 5 'wing and 3' wing. Therefore, there are no intermediate nucleotides between the 5 'wing and the gap, or the gap and the 3' end of the wing. Any of the antisense compounds described herein may have a gapmeric motif. In certain embodiments, X and Z are the same, in other embodiments they are different. In certain embodiments, Y is between 8 and 15 nucleosides. X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleosides.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid possess a 5-10-5 gamer motif.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid possess a 6-8-6 gamer motif.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid possess a 5-8-5 gamer motif.

In certain embodiments, an antisense compound targeted to a PTP1B nucleic acid has a broadened gap motif.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid have a broadened gap 2-13-5 motif.

Target nucleic acids, target regions, and nucleotide sequences

In certain embodiments, the PTP1B nucleic acid is any of the sequences set forth in GenBank Accession No. NM_002827.2 (incorporated herein as SEQ ID NO: 1), GenBank Accession No. NT_011362.9 nucleotide truncated 14178000-14256000 (incorporated herein as SEQ ID NO: 2); and a concatenation of the sequences of exons 1-9, intron 9, and exon 10 of the rhesus monkey PTP1B scaffold (incorporated herein as SEQ ID NO: 3).

It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification of a sugar moiety, an internucleoside linkage, or a nucleotide base. As such, antisense compounds defined by SEQ ID NO may independently comprise one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleotide base. Compounds

ES 2 634 450 T3 antisense described by an Isis Number (Isis No.) indicate a combination of nucleobase sequence and motif.

In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region can span a 3 'UTR, a 5' UTR, an exon, an intron, an exon / intron junction, a coding region, a translation initiation region, a translation termination region, or any another defined nucleic acid region. Structurally defined regions for PTP1B can be obtained from sequence database accession numbers such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region may span the sequence from a 5 'target site of one target segment within the target region to a 3' target site of another target segment within the same target region.

Targeting includes determining at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in nucleic acid target mRNA levels. In certain embodiments, the desired effect is a reduction in levels of the protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

A target region can contain one or more target segments. Multiple target segments within a target region can be overlapping. Alternatively, they can be non-overlapping. In certain embodiments, the target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides, that is, it is approximately, it is not more than, it is not more than approximately, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides in the target nucleic acid, or is a range defined by any two of the foregoing values. In certain embodiments, the target segments within a target region are separated by no more than, or no more than about 5 nucleotides in the target nucleic acid. In certain embodiments, the target segments are contiguous. Target regions defined by a range having a starting nucleic acid that is any of the 5 'target sites or 3' target sites listed herein are contemplated.

Suitable target segments can be found within a 5 'UTR, a coding region, 3' UTR, an intron, an exon, or an exon / intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment can specifically exclude a certain structurally defined region as the start codon or stop codon.

Determination of suitable target segments may include a comparison of the sequence of a target nucleic acid with other sequences throughout the genome. For example, the BLAST algorithm can be used to identify regions of similarity between different nucleic acids. This comparison can prevent the selection of antisense compound sequences that can non-specifically hybridize to sequences other than a selected target nucleic acid (ie, non-target or off-target sequences).

There may be variation in the activity (eg, as defined by the percent reduction in target nucleic acid levels) of antisense compounds within an active target region. In certain embodiments, reductions in mRNA PTP1B levels are indicative of inhibition of PTP1B expression. Reductions in the levels of a PTP1B protein are also indicative of inhibition of target mRNA expression. Furthermore, phenotypic changes are indicative of inhibition of PTP1B expression. In certain embodiments, reduction in glucose levels, reduced lipid levels, and reduction in body weight may be indicative of inhibition of PTP1B expression. In certain embodiments, amelioration of symptoms associated with metabolic disease may be indicative of inhibition of PTP1B expression. In certain embodiments, amelioration of symptoms associated with diabetes may be indicative of inhibition of PTP1B expression. In certain embodiments, the reduction in insulin resistance is indicative of inhibition of PTP1B expression. In certain embodiments, the reduction in diabetes biomarkers may be indicative of inhibition of PTP1B expression.

Hybridization

In some embodiments, hybridization occurs between an antisense compound described herein and a PTP1B nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (eg, Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding) between complementary nucleobases of nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

ES 2 634 450 T3

Methods for determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable to a PTP1B nucleic acid.

Complementarity

An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition nucleic acid target, such as a PTP1B nucleic acid).

An antisense compound can hybridize to one or more segments of a PTP1B nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (eg, a loop structure, mismatch or hairpin structure).

In certain embodiments, the antisense compounds described herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a PTP1B nucleic acid, a target region, the target segment, or a specified part of the same. The percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.

For example, an antisense compound in which 18 out of 20 nucleobases of the antisense compound are complementary to a target region, and therefore would specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases can be grouped or interspersed with complementary nucleobases and do not need to be contiguous with each other or with complementary nucleobases. As such, an antisense compound that is 18 nucleobases in length that is 4 (four) non-complementary nucleobases that are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% complementarity overall with the target nucleic acid. and is described in this document. Percent complementarity of an antisense compound with a region of a target nucleic acid can be routinely determined using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990 , 215, 403 410; Zhang and Madden, Genome Res, 1997, 7, 649 656). Percent homology, sequence identity or complementarity can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), Using the default setting, which uses the Smith and Waterman algorithm (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (ie, 100% complementary) to a target nucleic acid, or a specified portion thereof. For example, the antisense compound can be fully complementary to a PTP1B nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, fully complementary means that each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases in length, provided there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and / or second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be fully complementary to a target sequence that is 400 nucleobases in length. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion in which each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The location of a non-complementary nucleobase can be at the 5 'end or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase (s) may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they can be contiguous (ie, joined) or non-contiguous. In one embodiment, a non-complementary nucleobase is found in the wing segment of a gamer antisense oligonucleotide.

In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18,

19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 nucleobase not complementary to a target nucleic acid, such as a PTP1B nucleic acid, or specified portion Of the same.

ES 2 634 450 T3

In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18,

19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise not more than 6, not more than 5, not more than 4, not more than 3, not more of 2, or no more than 1 nucleobase not complementary to a target nucleic acid, such as a PTP1B nucleic acid, or specified portion thereof.

Antisense compounds provided herein also include those that are complementary to a portion of a target nucleic acid. As used herein, "part" refers to a defined number of contiguous nucleobases (ie, linkages) within a region or segment of a target nucleic acid. A portion can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 16 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 17 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least an 18 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 19 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 20 nucleobase portion of a target segment. Antisense compounds that are complementary to at least a portion of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobases of a target segment, or range, are also contemplated. defined by any two of these values.

Identity

The antisense compounds provided herein may also have defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence described herein if it has the same nucleobase-pairing ability. For example, an RNA that contains uracil instead of thymidine in a described DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and elongated versions of the antisense compounds described herein, as well as compounds having bases not identical in relation to the antisense compounds provided herein are also contemplated. Non-identical bases can be adjacent to each other or dispersed throughout the antisense compound. The percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing with respect to the sequence to which it is being compared.

In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, described herein.

Modifications

A nucleoside is a base-sugar combination. The nucleobase (also known as the base) part of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently attached to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2 ', 3' or 5 'hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent bonding of adjacent nucleosides to each other, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly known as the formation of the oligonucleotide internucleoside linkages.

Modifications of antisense compounds comprise substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, improved cell uptake, increased affinity for the target nucleic acid, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides can also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with short antisense compounds having such chemically modified nucleosides.

ES 2 634 450 T3

Modified internucleoside linkages

The naturally occurring internucleoside linkage of RNA and DNA is a 3 'to 5' phosphodiester linkage. Antisense compounds having one or more modified internucleoside linkages, i.e. non-naturally occurring, more often antisense compounds having natural internucleoside linkages are selected due to desirable properties such as, for example, increased cellular uptake, higher affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides that have modified internucleoside linkages include internucleoside linkages that retain a phosphorous atom, as well as internucleoside linkages that do not have a phosphorous atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. The methods of preparing phosphorous-containing and non-phosphorous linkages are well known.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

Modified sugar leftovers

The antisense compounds provided herein may optionally contain one or more nucleosides in which the sugar group has been modified. Such modified sugar nucleosides can impart improved nuclease stability, increased binding affinity, or some other beneficial biological property to antisense compounds. In certain embodiments, the nucleosides comprise a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include, without limitation, the addition of substituent groups (including 5 'and 2' substituent groups); bridging non-geminal ring atoms to form bicyclic nucleic acids (BNAs); substitution of the oxygen atom of the ribosyl ring with S, N (R), or C (R1) (R) 2 (R = H, C1-C12 alkyl or a protecting group); and their combinations. Examples of chemically modified sugars include, 2'-F-5'-methyl substituted nucleoside (see, PCT international application WO2008 / 101157, published 8/21/08 for the other 5 ', 2'-bis substituted nucleosides), substitution of the oxygen atom of the ribosyl ring with S with additional substitution at position 2 (see, published United States patent application US2005 / 0130923, published June 16, 2005), or, alternatively, 5 'substitution of a BNA ( see, PCT International Application WO2007 / 134181, published 11/22/07, in which LNA is substituted with, for example, a 5'-methyl or 5'-vinyl group).

Examples of modified nucleosides having sugar moieties include, without limitation, nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH3 substituent groups, and 2'-O (CH2) 2OCH3. The substituent at the 2 'position can also be selected from allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, OCF3, O (CH2) 2SCH3, O (CH2) 2-ON (Rm) ( Rn), and O-CH2-C (= O) -N (Rm) (Rn), where each Rm and Rn is, independently, H or C1-C10 substituted or unsubstituted alkyl.

As used herein, "bicyclic nucleosides" refer to modified nucleosides that comprise a bicyclic sugar moiety. examples of bicyclic nucleosides include, without limitation, nucleosides that comprise a bridge between 4 'and 2' ribosyl ring atoms. In certain embodiments, the antisense compounds described herein include one or more bicyclic nucleosides in which the bridge comprises a 4 'to 2' bicyclic nucleoside. Examples of such 4 'to 2' bicyclic nucleosides include, but are not limited to, one of the formulas: 4 '- (CH2) -O-2' (LNA); 4 '- (CH2) -S-2'; 4 '- (CH2) 2-O-2' (ENA); 4'-CH (CH3) -O-2 'and 4'-CH (CH2OCH3) -O-2', and analogs thereof (see, US Patent 7,399,845, issued July 15, 2008) ; 4'-C (CH3) (CH3) -O-2 ', and analogues thereof (see, published PCT International Application WO2009 / 006478, published January 8, 2009); 4'-CH2-N (OCH3) -2 ', and analogues thereof (see, published PCT International Application WO2008 / 150729, published December 11, 2008); 4'-CH2-ON (CH3) -2 '(see, published United States Patent Application US2004 / 0171570, published September 2, 2004); 4'-CH2-N (R) -O-2 ', where R is H, C1C12 alkyl, or a protecting group (see, US Patent 7,427,672, issued September 23, 2008); 4'-CH2-C (H) (CH3) -2 '(see, Chattopadhyaya, et al, J. Org Chem, 2009, 74, 118-134); and 4'-CH2-C (= CH2) -2 ', and analogues thereof (see, published PCT International Application WO2008 / 154401, published December 8, 2008). Also see, for example: Singh et al, Chem. Commun, 1998, 4, 455-456 .; Koshkin et al, Tetrahedron, 1998, 54, 3,607-3,630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633 to 5638; Kumar et al., Bioorg. Medicine. Chem. Lett, 1998, 8, 2219-2222; Singh et al., J. Org. Chem, 1998, 63, from 10,03510,039; Srivastava et al., J. Am. Chem. Soc., 129 (26) 8362-8379 (Jul 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol, 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther, 2001, 3, 239-243; US Patent Nos. 6,670,461, 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133,

6,525,191, 7,399,845; Published PCT International Applications WO2004 / 106356, WO 94/14226,

WO2005 / 021570 and WO2007 / 134181; United States Patent Publication Nos. US2004 / 0171570, US2007 / 0287831 and US2008 / 0039618; and US Patent Serial Nos. 12 / 129,154, 60 / 989,574, 61 / 026,995, 61 / 026,998, 61 / 056,564, 61 / 086,231, 61 / 097,787 and 61 / 099,844; and PCT International Application Nos.

ES 2 634 450 T3

PCT / US2008 / 064591, PCT / US2008 / 066154, and PCT / US2008 / 068922. Each of the above bicyclic nucleosides can be prepared with one or more sugar stereochemical configurations including, for example, αL-ribofuranose and β-D-ribofuranose (see PCT International Application PCT / DK98 / 00393, published March 25, 1999 as WO 99/14226).

In certain embodiments, BNA nucleoside bicyclic sugar moieties include, but are not limited to, compounds having at least one bridge between the 4 'position and the 2' position of the pentofuranosyl sugar moiety wherein said bridges independently comprise 1 or 2 to 4 linked groups independently selected from - [C (Ra) (Rb)] n-, -C (Ra) = C (Rb) -, -C (Ra) = N-, -C (= NRa) -, -C (= O) -, -C (= S) -, -O-, Si (Ra) 2-, -S (= O) x-, and -N (Ra) -;

where:

x is 0, 1, or 2; n is 1, 2, 3, or 4;

each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, C1-C12 substituted alkyl, C2-C12 alkenyl, C2-C12 substituted alkenyl, C2-C12 alkynyl, C2-C12 substituted alkynyl, C5 -C20 aryl, C5-C20 substituted aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, C5-C7alicyclic substituted radical, halogen, C1, NJ1J2, SJ1, N3, COOJ1, acyl (C ( = O) -H), substituted acyl, CN, sulfonyl (S (= O) 2-J1), O sulfoxyl (S (= O) -J1); and each J1 and J2 is independently H, C1-C12 alkyl, C1-C12 substituted alkyl, C2-C12 alkenyl, C2-C12 substituted alkenyl, C2-C12 alkynyl, C2-C12 substituted alkynyl, C5-C20aryl, C5-C20aryl substituted, acyl (C (= O) H), substituted acyl, heterocycle, a substituted heterocycle radical, C1-C12 aminoalkyl, C1-C12 aminoalkyl substituted, or a Protecting group.

In certain embodiments, the bridge of a bicyclic sugar residue is - [C (Ra) (Rb)] n -, - [C (Ra) (Rb)] nO-, C (RaRb) -N (R) -O - or, -C (RaRb) -ON (R) -. In certain embodiments, the bridge is 4'-CH2-2 ', 4' - (CH2) 2-2 ', 4' - (CH2) 3-2 ', 4'CH2-O-2', 4 '- ( CH2) 2-O-2 ', 4'-CH2-ON (R) -2', and 4'-CH2-N (R) -O-2'-, wherein each Ris, independently, H, a protecting group, or C1-C12 alkyl.

In certain embodiments, the bicyclic nucleosides are further defined by the isomeric configuration. For example, a nucleoside comprising 4 '2' methyloene-oxy bridge may be in the α-L configuration or in the β-D configuration. Previously, α-L-methylohenoxy (4'-CH2-O-2 ') BNAs have been incorporated into antisense oligonucleotides showing antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6.365-6372).

In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L-methyloenoxy (4'-CH2-O-2 ') BNA, (b) β-D-Methyloenoxy (4'-CH2 -O-2 ') BNA, (C) Ethyleneoxy (4' - (CH2) 2-O-2 ') BNA, (D) Aminooxy (4'-CH2O- N (R) -2') BNA, (E ) Oxyamino (4'-CH2-N (R) -O-2 ') BNA, (F) Methyl (methyloenoxy) (4'-CH (CH3) -O-2') BNA, (G) methylenothio (4 ' -CH2-S-2 ') BNA, (H) methylene-amino (4'-CH2-N (R) -2') BNA, (i) carbocyclic methyl (4'-CH2-CH (CH3) 2 ') BNA, and carbocyclic (J) propyloene (4 '- (CH2) 3-2') BNA, as depicted below.

<img file="ES2634450T3_D0001.tif" />

wherein Bx is the base moiety and R is independently H, a protecting group, or C1-C12alkyl.

ES 2 634 450 T3

In certain embodiments, the bicyclic nucleoside has Formula I:

<img file="ES2634450T3_D0002.tif" />

where:

Bx is a heterocyclic base moiety;

-Qa -Qb-Qc- is -CH2-N (Rc) -CH2-, -C (= O) -N (Rc) -CH2-, -CH2-ON (Rc) -, -CH2-N (Rc) -O-, or -N (Rc) -O-CH2;

Rc is C1-C12 alkyl or an amino protecting group; Y

Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugated group, a phosphorous reactive group, a phosphorous moiety, or a covalent attachment to a support medium.

In certain embodiments, bicyclic nucleoside having Formula II:

<img file="ES2634450T3_D0003.tif" />

where:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugated group, a phosphorous reactive group, a phosphorous moiety, or a covalent bond to a support medium;

Za is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, acyl, substituted acyl, substituted amide, thiol, or substituted thio.

In one embodiment, each of the substituted groups is independently mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJc, NJcJd, SJc, N3, OC (= X) Jc and NJeC (= X) NJcJd, where each Jc, Jd, and Je is independently H, C1-C6 alkyl, or C1-C6 substituted alkyl and X is O or NJc.

In certain embodiments, bicyclic nucleoside having Formula III:

<img file="ES2634450T3_D0004.tif" />

ES 2 634 450 T3 where:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugated group, a phosphorous reactive group, a phosphorous moiety, or a covalent bond to a support medium;

Zb is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, or substituted acyl (C (= O) -).

In certain embodiments, bicyclic nucleoside having Formula IV:

<img file="ES2634450T3_D0005.tif" />

where:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugated group, a phosphorous reactive group, a phosphorous moiety, or a covalent bond to a support medium;

Rd is C1-C6 alkyl, C1-C6 substituted alkyl, C2-C6 alkenyl, C2-C6 substituted alkenyl, C2-C6 alkynyl, or C2-C6 substituted alkynyl;

each qa, qb, qc, and qd is, independently, H, halogen, C1-C6 alkyl, C1-C6 substituted alkyl, C2-C6 alkenyl, C2-C6 substituted alkenyl, C2-C6 alkynyl, or C2-C6 substituted alkynyl , C1-C6 alkoxy, substituted C1-C6 alkoxy, acyl, substituted acyl, C1-C6 aminoalkyl, or substituted C1-C6 aminoalkyl;

In certain embodiments, bicyclic nucleoside having Formula V:

<img file="ES2634450T3_D0006.tif" />

where:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugated group, a phosphorous reactive group, a phosphorous moiety, or a covalent bond to a support medium;

qa, 1b, qe and qf are each, independently, hydrogen, halogen, C1-C12 alkyl, C1-C12 substituted alkyl, C2-C12 alkenyl, C2-C12 substituted alkenyl, C2-C12 alkynyl, C2-C12 substituted alkynyl , C1-C12 alkoxy, C1-C12 substituted alkoxy, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C (= O) OJj, C (= O) NJjJk, C (= O) Jj, OC (= O) NJjJk, N (H) C (= NH) NJjJk, N (H) C (= O) NJjJk or N (H) C (= S) NJjJk;

or qe and qf together are = C (qg) (qh);

qg and qf are each, independently, H, halogen, C1-C12 alkyl, or C1-C12 substituted alkyl.

The synthesis and preparation of methyloenoxy (4'-CH2-O-2 ') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine, and uracil, together with their oligomerization and nucleic acid recognition properties have been described. (see, for example, Koshkin et al., Tetrahedron, 1998, 54, 3,607-3,630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.

ES 2 634 450 T3

The analogs of methyloenoxy (4'-CH2-O-2 ') BNA, methyloenoxy (4'-CH2-O-2') BNA, and 2'-thio-BNA, have also been prepared (see, for example, Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). The preparation of blocked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (see, for example, Wengel et al., WO 99/14226). Furthermore, the synthesis of 2'-amino-BNA, a novel conformationally restricted high affinity oligonucleotide analog, has been described in the art (see, eg, Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-amino- and 2'-methyloamino BNAs have been prepared and the thermal stability of their duplexes with complementary DNA and RNA strands has been previously reported.

In certain embodiments, bicyclic nucleoside having Formula VI:

<img file="ES2634450T3_D0007.tif" />

where:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugated group, a phosphorous reactive group, a phosphorous moiety, or a covalent bond to a support medium; each qi, qj, qk and ql is independently H, halogen, C1-C12 alkyl, C1-C12 substituted alkyl, C2-C12 alkenyl, C2-C12 substituted alkenyl, C2-C12 alkynyl, C2-C12 substituted alkynyl, C1 -C12 alkoxy, C1-C12 substituted alkoxy, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C (= O) OJj, C (= O) NJjJk, C (= O) Jj, OC (= O) NJjJk, N (H) C (= NH) NJjJk, N (H) C (= O) NJjJk, or N (H) C (= S) NJjJk; and q1 and qj or ql and qk together are = C (qg) (qh), where qg and qh are each, independently, H, halogen, C1-C12 alkyl, or C1-C12 substituted alkyl.

A carbocyclic bicyclic nucleoside having a 4 '- (CH2) 3-2' bridge and the alkenyl analog, 4'CH = CH-CH2-2 'bridge, have been described (see, for example, Freier et al., Nucleic Acids Research, 1997, 25 (22), 44294443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, for example, Srivastava et al., J. Am. Chem. Soc. 2007,129 (26), 8362-8379).

As used herein, 4'-2 'bicyclic nucleoside or 4' to 2 'bicyclic nucleoside refers to a bicyclic nucleoside comprising a furanose ring that comprises a bridge connecting the 2' carbon atom and carbon atom. carbon 4 '.

As used herein, "monocyclic nucleosides" refer to nucleosides that comprise modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analog, of a nucleoside can be modified or substituted at any position.

As used herein, 2 'modified sugar means a 2' modified furanosyl sugar. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and substituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2 'modifications are selected from substituents including, but not limited to: O [(CH2) nO] mCH3, O (CH2) nNH2, O (CH2) nCH3, O (CH2) nONH2, OCH2C (= O) N (H) CH3, and O (CH2) nON [(CH2) nCH3] 2, where n and m are from 1 to about 10. Other 2 'substituent groups can also be selected from: C1-C12 alkyl; substituted alkyl; alkenyl; alkynyl; alkaryl; aralkyl; O-alkaryl or O-aralkyl; SH; SCH3; OCN; Cl; Br; CN; CF3; OCF3; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleavage pool; an information group; an interposer; a group to improve pharmacokinetic properties; and a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, the modified nucleosides comprise a 2'-MOE side chain (see, eg, Baker et al., J. Biol. Chem., 1997, 272, 11,944-12,000). Said 2'-MOE substitution has been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2'-MOE substituent have also been

ES 2 634 450 T3 shown to be antisense inhibitors of gene expression with promising characteristics for use in vivo (see, for example, Martin, P., Helv Chim Acta, 1995, 78, 486-504 .; Altmann et al, Chimia, 1996, 50, 168-176; Altmann et al, Biochem Soc Trans, 1996, 24, 630-637; and Altmann et al, Nucleosides Nucleotides, 1997, 16, 917926).

As used herein, a modified tetrahydropyran nucleoside or modified THP nucleoside means a nucleoside having a six-membered sugar tetrahydropyran substituted for the pentofuranosyl residue in normal nucleosides (a sugar substitute). Modified THP nucleosides include, but are not limited to, what is known in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), mannitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. and Med. Chem (2002) 10: 841-854), fluoro HNA (F-HNA), or those compounds having Formula X:

<img file="ES2634450T3_D0008.tif" />

wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula X:

Bx is a heterocyclic base moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T3 and T4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other to T3 and T4 is H, a hydroxyl protecting group, a linked conjugated group, or a 5 'or 3 end group;

q1, q2, q3, q4, q5, q6, and q7 are each, independently, H, C1-C6 alkyl, C1-C6 substituted alkyl, C2-C6 alkenyl, C2-C6 substituted alkenyl, C2-C6 alkynyl, or C2 -C6 substituted alkynyl; constitute one of R1 and R2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, NJ3C (= X) NJ1J2 and CN , wherein X is O, S, or NJ1, and each J1, J2, and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, the modified THP nucleosides of formula X are provided wherein qm, qn, qp, qr, qs, qt and what are each H. In certain embodiments, at least one of qm, qn, qp, qr, qs, qt, and what is other than H. In certain embodiments, at least one of qm, qn, qp, qr, qs, qt, and what is methyl. In certain embodiments, the THP nucleosides of formula X are provided wherein one of R1 and R2 is F. In some embodiments, R1 is fluoro and R2 is H, R1 is methoxy and R2 is H, and R1 is methoxyethoxy and R2 is H.

As used herein, 2'-modified or 2'-substituted refers to a nucleoside comprising a sugar comprising a substituent at the 2 'position other than H or OH. Modified 2'-nucleosides, include, but are not limited to, bicyclic nucleosides in which the bridge connecting two carbon atoms of the sugar ring is connected from 2 'carbon and another carbon of the sugar ring and nucleosides with 2' substituents without bridge, such as allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, -OCF3, O- (CH2) 2-O-CH3, 2'O (CH2) 2SCH3, O- (CH2) 2-ON (Rm) (Rn), or O-CH2-C (= O) -N (Rm) (Rn), where each Rm and Rn is, independently, H or C1-C10 substituted or unsubstituted alkyl. 2 'modified nucleosides may further comprise other modifications, for example, at other positions on the sugar and / or at the nucleobase.

As used herein, 2'-F refers to a sugar comprising a fluoro group at the 2 'position.

As used herein, 2'-OMe or 2'-OCH3 or 2'-O-methyl each refers to a sugar comprising an -OCH3 group at the 2'-position of the sugar ring.

As used herein, "oligonucleotide" refers to a compound that comprises a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).

ES 2 634 450 T3

Many other bicyclic and tricyclic sugar substitute ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, for example, review article: Leumann, J. C , Bioorganic &amp; Medicinal Chemistry, 2002, 10, 841-854).

These ring systems can be subjected to various additional substitutions to improve activity.

Methods for modified sugar preparations are well known to those skilled in the art.

In nucleotides having modified sugar residues, the nucleobase residues (natural, modified, or a combination thereof) are retained for hybridization to an appropriate nucleic acid target.

In certain embodiments, the antisense compounds comprise one or more nucleotides that have modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the modified 2'-MOE nucleotides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a CET. In certain embodiments, the CET-modified nucleotides are arranged along the wings of a gapmer motif.

Modified nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, but functionally interchangeable with unmodified natural or synthetic nucleobases. Both natural and modified nucleobases are capable of hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity, or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 ° C (Sanghvi, YS, Crooke, ST and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil (-C = C-CH3) and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil ), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyloadenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-desazaguanine and 7-desazaadenine and 3-deazaguanine and 3-desazaadenine.

Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyloadenine, 5-propynyluracil, and 5-propynylcytosine.

In certain embodiments, antisense compounds targeted to a PTP1B nucleic acid comprise one or more modified nucleobases. In certain embodiments, widened gap antisense oligonucleotides targeted to a PTP1B nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Compositions and methods for the formulation of pharmaceutical compositions

The antisense oligonucleotides can be mixed with the pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, the route of administration, extent of the disease, or the dose to be administered.

The antisense compound targeting a PTP1B nucleic acid can be used in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate buffered saline (PBS). PBS is a suitable diluent for use in compositions for parenteral administration. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeting a PTP1B nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

ES 2 634 450 T3

Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the metabolite. biologically active or residue on this. Accordingly, for example, the disclosure is also derived from pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Pharmaceutically acceptable salts include, but are not limited to, potassium, sodium, and salts.

The pharmaceutically acceptable salts of the compounds described herein can be prepared by methods well known in the art. For a review of pharmaceutically acceptable salts, see Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley-VCH, Weinheim, Germany, 2002). Sodium salts of antisense oligonucleotides are useful and well accepted for therapeutic administration to humans. Accordingly, in one embodiment, the compounds described herein are in the form of a sodium salt.

A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound that are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Conjugated antisense compounds

Antisense compounds can be covalently linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the resulting antisense oligonucleotides. Typical conjugated groups include cholesterol moieties and lipid moieties. Additional conjugated groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both terminal ends of antisense compounds to improve properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can aid in delivery and / or localization within a cell. The cap may be present at the 5 'end (5'-cap), or at the 3' end (3'-cap), or it may be present at both terminal ends. Cap structures are well known in the art and include, for example, deoxy abasic inverted caps. Additionally 3 'and 5' stabilizing groups that can be used to limit one or both ends of an antisense compound to impart nuclease stability include those described in WO 03/004602 published January 16, 2003.

Cell culture and treatment of antisense compounds

The effects of antisense compounds on PTP1B nucleic acid level, activity, or expression can be tested in vitro in a variety of cell types. Cell types used for this type of analysis are available from commercial vendors (eg, American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, North Carolina; Clonetics Corporation, Walkersville, MD). and cells are cultured according to the supplier's instructions using commercially available reagents (eg, Invitrogen Life Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, primary hepatocytes, A549 cells, GM04281 fibroblasts, and LLC-MK2 cells.

In vitro testing of antisense oligonucleotides

Methods for treating cells with antisense oligonucleotides, which can be appropriately modified for treatment with other antisense compounds, are described herein.

In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluence in culture.

A commonly used reagent for introducing antisense oligonucleotides into cultured cells includes the cationic lipid LIPOFECTIN® transfection reagent (Invitrogen, Carlsbad, CA). The antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a concentration of LIPOFECTIN® that typically ranges from 2 to 12 ug / ml per 100 nM of antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes

LIPOFECTAMINE 2000® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with LIPOFECTAMINE

2000® in OPTI-MEM® 1 Reduced Serum Medium (Invitrogen, Carlsbad, CA) to achieve concentration

ES 2 634 450 T3 of antisense oligonucleotide and a LIPOFECTAMINE® concentration typically ranging from 2 to 12 ug / ml per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with Cytofectin® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired antisense oligonucleotide concentration and a Cytofectin® concentration that typically ranges from 2 to 12 ug / ml per 100 nM antisense oligonucleotide.

Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.

Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, in which RNA time or target nucleic acid protein levels are measured by methods known in the art and described herein. In general, when treatments are carried out in multiple replicates, the data is presented as the mean of the replicated treatments.

The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods for determining the optimal concentration of antisense oligonucleotides for a particular cell line are well known in the art. Antisense oligonucleotides are typically used in concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000®, Lipofectin, or Cytofectin. Antisense oligonucleotides are used in higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.

RNA isolation

RNA analysis can be carried out on total cellular RNA or poly (A) + mRNA. RNA isolation methods are well known in the art. RNA was prepared using methods well known in the art, for example, using TRIZOL® reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.

Analysis of inhibition of target levels or expression

Inhibition of the levels or expression of a PTP1B nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantified by, for example, Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be carried out on total cellular RNA or poly (A) + mRNA. RNA isolation methods are well known in the art. Northern blot analysis is also routine in the art. Real-time quantitative PCR can be conveniently performed using the commercially available ABI PRISM 7600, 7700, or 7900 Secuence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to the manufacturer's instructions.

Real-time quantitative PCR analysis of target RNA levels

Quantification of target RNA levels can be accomplished by real-time quantitative PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Quantitative real-time PCR methods are well known in the art.

Prior to real-time PCR, the isolated RNA undergoes a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for real-time PCR amplification. RT and real-time PCR reactions are carried out sequentially in the same sample well. Real-time RT and PCR reagents were obtained from Invitrogen (Carlsbad, CA). Real-time RT, PCR reactions are carried out by methods well known to those of skill in the art.

Target amounts of gene (or RNA) obtained by real-time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RiboGreen® (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real-time PCR, running simultaneously with the target, multiplexing, or separately. Total RNA was quantified using RIBOGREEN® RNA Quantitation Reagent (Invitrogen, Inc. Eugene, OR). RiboGreen® RNA quantification methods are taught in Jones, LJ, et al, (Analytical Biochemistry, 1998, 265, 368374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure RiboGreen® fluorescence.

The probes and primers are designed to hybridize to a PTP1B nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of PRIMER Express® Software (Applied Biosystems, Foster City, CA).

ES 2 634 450 T3

Analysis of protein levels

Antisense nucleic acid inhibition of PTP1B can be assessed by measuring PTP1B protein levels. PTP1B protein levels can be assessed or quantified in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, assays. protein activity (eg, caspase activity assays), immunohistochemistry, immunocytochemistry, or fluorescence activated cells (FACS). Targeted antibodies can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or they can be prepared via conventional monoclonal or polyclonal antibody generation methods. well known in the art. Antibodies useful for the detection of human and rat PTP1B are commercially available.

In vivo testing of antisense compounds

Antisense compounds, eg, antisense oligonucleotides, are tested in animals for their ability to inhibit PTP1B expression and produce phenotypic changes. The tests can be carried out in normal animals, or in experimental disease models. For administration to animals, the antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate buffered saline. Administration includes parenteral routes of management mode. Following a period of antisense oligonucleotide treatment, RNA is isolated from tissue and changes in PTP1B nucleic acid expression are measured. Changes in PTP1B protein levels were also measured.

Certain indications

In certain embodiments, described herein are methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has the metabolism-related disease.

As shown in the examples below, compounds targeting PTP1B, as described herein, have been shown to reduce the severity of physiological symptoms of metabolic-related diseases, including metabolic syndrome, diabetes mellitus, resistance to insulin, diabetic dyslipidemia, hypertriglyceridemia, obesity and weight gain. In some of the experiments, the compounds lowered blood glucose levels, for example, the animals continued to experience symptoms, but the symptoms were less severe compared to the untreated animals. In another experiment, however, the compounds appear to reduce the symptoms of diabetes; for example, animals treated for a longer period of time experienced less severe symptoms than those given the compounds for a shorter period of time. In another experiment, however, the compounds appear to inhibit weight gain; for example, animals treated for a longer period of time experienced less severe symptoms than those given the compounds for a shorter period of time. In another experiment, however, the compounds appear to inhibit hypertriglyceridemia; for example, animals treated for a longer period of time experienced less severe symptoms than those given the compounds for a shorter period of time. The ability of the compounds exemplified below to restore function, therefore, demonstrates that the symptoms of the disease can be reversed by treatment with a compound as described herein.

Diabetes mellitus is characterized by numerous physical and physiological symptoms. Any symptoms known to one of skill in the art to be associated with type 2 diabetes can be ameliorated or otherwise modulated as set forth above in the methods described above. In certain embodiments, the symptom is a physical symptom selected from the group consisting of increased glucose levels, increased weight gain, frequent urination, unusual thirst, extreme hunger, extreme fatigue, blurred vision, frequent infections, tingling. or numbness in the extremities, dry and itchy skin, weight loss, ulcers, swollen gums and slow healing.

In certain embodiments, the symptom is a physiological symptom selected from the group consisting of increased insulin resistance, increased glucose levels, increased fat mass, decreased metabolic rate, decreased glucose clearance. , decreased glucose tolerance, decreased insulin sensitivity, decreased liver sensitivity to insulin, increased fat tissue size and weight, increased body fat, and increased body weight.

In certain embodiments, the physical symptom is increased weight gain. In certain embodiments, the symptom is frequent urination. In certain embodiments, the symptom is unusual thirst. In certain embodiments, the symptom is extreme hunger. In certain embodiments, the symptom is extreme fatigue. In certain embodiments, the symptom is blurred vision. In certain embodiments, the symptom is frequent infections. In certain embodiments, the symptom is tingling or numbness in the extremities. In certain embodiments, the symptom is dry skin.

ES 2 634 450 T3 and itchy. In certain embodiments, the symptom is weight loss. In certain embodiments, the symptom is slowly healing ulcers. In certain embodiments, the symptom is inflammation of the gums. In certain embodiments, the symptom is increased insulin resistance. In certain embodiments, the symptom is an increase in fat mass. In certain embodiments, the symptom decreases the metabolic rate. In certain embodiments, the symptom is decreased glucose clearance. In certain embodiments, the symptom lowers glucose tolerance. In certain embodiments, the symptom decreases insulin sensitivity. In certain embodiments, the symptom decreases liver insulin sensitivity . In certain embodiments, the symptom increases fat tissue size and weight. In certain embodiments, the symptom increases body fat. In certain embodiments, the symptom increases body weight.

Liu and Chernoff have shown that PTP1B binds to and serves as a substrate for the epidermal growth factor receptor (EGFR) (Liu and Chernoff, Biochem. J., 1997, 327, 139-145). Furthermore, in A431 human squamous carcinoma cells, pT1b was found to be inactivated by the presence of H2O2 generated by the addition of EGF. These studies indicate that PTP1B can be downregulated by the oxidation state of the cell, which is often deregulated during tumorigenesis (Lee et al., J. Biol. Chem., 1998, 273, 153666-15372).

PTP1B overexpression has been demonstrated in malignant ovarian cancers and this correlation was accompanied by a concomitant increase in the expression of the associated growth factor receptor (Wiener et al., Am. J. Obstet. Gynecol., 1994, 170, 1177-1183).

PTP1B has been shown to suppress transformation in NIH3T3 cells induced by the neu oncogene (Brown-Shimer et al., Cancer Res., 1992, 52, 478-482), as well as in rat 3Y1 fibroblasts induced by v-srk , v-src, and v-ras (Liu et al., Mol. Cell. Biol., 1998, 18, 250-259) and from rat fibroblasts-1 induced by bcr-abl (LaMontagne et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 14,094-14,099). PTP1B has also been shown to promote the differentiation of K562 cells, a chronic myelogenous leukemia cell line, in a similar way as does an inhibitor of the oncogenic bcr-abl. These studies describe the possible role of PTP1B in controlling the pathogenesis of chronic myeloid leukemia (LaMontagne et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 14,094-14,099).

Accordingly, disclosed herein are methods of ameliorating a symptom associated with hyperproliferative disorders in a subject in need thereof. In certain embodiments, the hyperproliferative disorder is cancer. In certain embodiments, described herein are methods for ameliorating a symptom associated with cancer. In certain embodiments, a method of reducing the rate of occurrence of a symptom associated with hyperproliferative disorders is described. In certain embodiments, a method of reducing the rate of occurrence of a symptom associated with cancer is described. In certain embodiments, a method of reducing the severity of a symptom associated with hyperproliferative disorders is described. In certain embodiments, a method of reducing the severity of a symptom associated with cancer is described. In such embodiments, the methods comprise administering to an individual in need thereof a therapeutically effective amount of a compound targeting a PTP1B nucleic acid.

In certain embodiments, methods of treating an individual are described which comprise administering one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has the metabolism-related disease.

In certain embodiments, administration of an antisense compound targeting a PTP1B nucleic acid results in reduction of PTP1B expression by at least about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 , 65, 70, 75, 80, 85, 90, 95, or 99%, or a range defined by two of these values.

In certain embodiments, pharmaceutical compositions comprising a transthyretin-targeting antisense compound are used for the preparation of a medicament for treating a patient suffering from or susceptible to metabolism-related disease.

In certain embodiments, the methods described herein include administration of a compound comprising a modified oligonucleotide having a contiguous nucleobase portion as described herein of a sequence indicated in SEQ ID NO: 26 (ISIS 404173) .

Administration

In certain embodiments, the compounds and compositions as described herein can be administered in a number of ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be topical, pulmonary, for example, by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. The compounds and compositions as described herein can be administered directly to a tissue or organ.

ES 2 634 450 T3

In certain embodiments, the compounds and compositions described herein are administered parenterally. Parenteral administration refers to administration via injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, for example, intracerebral administration, intrathecal administration, intraventricular administration, ventricular administration, intracerebroventricular administration, cerebral intraventricular administration or ventricular administration. cerebral. Administration can be continuous or chronic, or short or intermittent.

In certain embodiments, parenteral administration is by injection. The injection can be given with a syringe or a pump. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to a tissue or organ.

In certain embodiments, the compounds and compositions described herein are administered parenterally.

In certain embodiments, parenteral administration is subcutaneous.

In additional embodiments, the formulation for administration is the compounds described herein and saline.

In certain embodiments, an antisense oligonucleotide is administered by injection or infusion once every month, every two months, every 90 days, every 3 months, every 6 months, twice a year, or once a year.

Certain combination therapies

In certain embodiments, one or more pharmaceutical compositions of the present invention are administered in conjunction with one or more other pharmaceutical agents. In certain embodiments, said one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions described herein. In certain embodiments, said one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition such as the one or more pharmaceutical compositions described herein. In certain embodiments, said one or more other pharmaceutical agents are designed to treat an unwanted side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, one or more pharmaceutical compositions are co-administered with another pharmaceutical agent to treat an unwanted effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions are administered in conjunction with another pharmaceutical agent to produce a combinatorial effect. In certain embodiments, one or more pharmaceutical compositions are administered in conjunction with another pharmaceutical agent to produce a synergistic effect.

In certain embodiments, a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.

In certain embodiments, the second compound is administered prior to administration of a pharmaceutical composition of the present invention. In certain embodiments, the second compound is administered after administration of a pharmaceutical composition of the present invention. In certain embodiments, the second compound is administered at the same time as a pharmaceutical composition of the present invention. In certain embodiments, the dose of a second compound co-administered is the same as the dose that would be administered if the second compound was administered alone. In certain embodiments, the dose of a co-administered second compound is less than the dose that would be administered if the second compound was administered alone. In certain embodiments, the dose of a co-administered second compound is greater than the dose that would be administered if the second compound was administered alone.

In certain embodiments, the co-administration of a second compound enhances the effect of a first compound, such that the co-administration of the compounds results in an effect that is greater than the effect of the administration of the first compound alone. In certain embodiments, co-administration results in effects that are additive to the effects of the compounds when administered alone. In certain embodiments, co-administration results in effects that are supraadditive to the effects of the compounds when administered alone. In certain embodiments, the first compound is an antisense compound. In certain embodiments, the second compound is an antisense compound.

In certain embodiments, the second agent includes, but is not limited to, a glucose lowering agent. The glucose lowering agent may include, but is not limited to, a therapeutic lifestyle change, PPAR agonist, a dipeptidyl (IV) peptidase inhibitor, a GLP-1 analog,

ES 2 634 450 T3 insulin or an insulin analog, an insulin secretagogue, an SGLT2 inhibitor, a human amylin analog, a biguanide, an alpha-glucosidase inhibitor, or a combination thereof. The glucose lowering agent may include, but is not limited to, metformin, sulfonylourea, rosiglitazone, meglitinide, thiazolidinedione, alpha-glucosidase inhibitor, or a combination thereof. The sulfonylourea can be acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, glipizide, glyburide, or gliclazide. The meglitinide can be nateglinide or repaglinide. The thiazolidinedione can be pioglitazone or rosiglitazone. The alpha-glucosidase can be acarbose or miglitol.

In some embodiments, the hypoglycemic therapy is a GLP-1 analog. In some embodiments, the GLP-1 analog is exendin-4 or liraglutide.

In other embodiments, the hypoglycemic therapy is a sulfonylourea. In some embodiments, the sulfonylurea is acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, glipizide, glyburide, or gliclazide.

In some embodiments, the hypoglycemic drug is a biguanide. In some embodiments, the biguanide is metformin, and in some embodiments, blood glucose levels are lowered with no increase in lactic acidosis compared to lactic acidosis seen after treatment with metformin alone.

In some embodiments, the hypoglycemic drug is a meglitinide. In some embodiments, the meglitinide is nateglinide or repaglinide.

In some embodiments, the hypoglycemic drug is a thiazolidinedione. In some embodiments, the thiazolidinedione is pioglitazone, rosiglitazone, or troglitazone. In some embodiments, blood glucose levels are lowered without greater weight gain than that seen with rosiglitazone treatment alone.

In some embodiments, the hypoglycemic drug is an alpha-glucosidase inhibitor. In some embodiments, the alpha-glucosidase inhibitor is acarbose or miglitol.

In a certain embodiment, a co-administered hypoglycemic agent is ISIS 113715.

In a certain embodiment, the hypoglycemic therapy is therapeutic lifestyle change.

In certain embodiments, the second agents include, but are not limited to, lipid-lowering agents. The lipid lowering agent may include, but is not limited to, atorvastatin, simvastatin, rosuvastatin, and ezetimibe. In certain such embodiments, the lipid-lowering agent is administered prior to administration of a pharmaceutical composition of the present invention. In certain such embodiments, the lipid-lowering agent is administered after administration of a pharmaceutical composition of the present invention. In certain such embodiments, the lipid-lowering agent is administered at the same time as a pharmaceutical composition of the present invention. In certain such embodiments, the dose of a co-administered lipid-lowering agent is the same as the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments, the dose of a co-administered lipid-lowering agent is less than the dose that would be administered if the lipid-lowering agent were administered alone. In certain such embodiments, the dose of a lipid-lowering agent that is co-administered is greater than the dose that would be administered if the lipid-lowering agent were administered alone.

In certain embodiments, a co-administered lipid-lowering agent is an HMGCoA reductase inhibitor. In certain such embodiments, the HMG-CoA reductase reductase inhibitor is a statin. In certain such embodiments, the statin is selected from atorvastatin, simvastatin, pravastatin, fluvastatin, and rosuvastatin.

In certain embodiments, a co-administered lipid-lowering agent is a cholesterol absorption inhibitor. In certain such embodiments, the cholesterol absorption inhibitor is ezetimibe.

In certain embodiments, a co-administered lipid-lowering agent is a co-formulated HMGCoA reductase inhibitor and cholesterol absorption inhibitor. In certain such embodiments, the co-formulated lipid-lowering agent is ezetimibe / simvastatin.

In certain embodiments, a co-administered lipid-lowering agent is a microsomal triglyceride transfer protein inhibitor (MTP inhibitor).

In certain embodiments, a co-administered lipid-lowering agent is an ApoB targeted oligonucleotide.

In certain embodiments, second agents include, but are not limited to, an anti-obesity drug or agent. Such anti-obesity agents include, but are not limited to Orlistat, Sibutramine, or Rimonabant, and can be administered as described above as adipose tissue or body weight lowering agents. In certain embodiments, the antisense compound can be co-administered with appetite suppressants.

ES 2 634 450 T3

Such appetite suppressants include, but are not limited to, diethylpropion tenuate, mazindol, orlistat, phendimetrazine, phentermine, and sibutramine and can be administered as described herein. In a certain embodiment, anti-obesity agents are CNS-based such as, but not limited to, sibutramine or based on

GLP-1 such as, but not limited to, liraglutide.

Formulations

The compounds provided herein may also be mixed, conjugated, or otherwise associated with other molecules, molecular structures, or mixtures of compounds, such as liposomes, targeting receptor molecules, or other formulations, to aid in absorption, distribution and / or absorption. Representative United States patents teaching the preparation of such uptake, dispensing and / or absorption aid formulations include, but are not limited to, US: 5,108,921; 5,354,844; 5,416,016;

5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756.

The antisense compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.

The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds provided herein: that is, salts that retain the desired biological activity of the parent compound and do not confer unwanted toxicological effects thereon. The term "pharmaceutically acceptable salt" includes a salt prepared from non-toxic pharmaceutically acceptable acids or bases, including inorganic or organic acids and bases. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in US Patent 6,287,860. Sodium salts have been shown to be suitable forms of oligonucleotide drugs.

The term "pharmaceutically acceptable derivative" encompasses, but is not limited to, pharmaceutically unacceptable salts, solvates, hydrates, esters, prodrugs, polymorphs, isomers, isotopically-labeled variants of the compounds described herein.

The present invention also includes pharmaceutical compositions and formulations that include the antisense compounds provided herein. The pharmaceutical compositions of the present invention can be administered in a number of ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; or intracranial, for example, intracerebral administration, intrathecal administration, intraventricular administration, ventricular administration, intracerebroventricular administration, cerebral intraventricular administration or cerebral ventricular administration.

Parenteral administration is preferred to target PTP1B expression in liver and plasma. Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, and the like may be necessary or desirable. Coated condoms, gloves, and the like can also be helpful.

The pharmaceutical formulations of the present invention, which may be conveniently presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of associating the active ingredients with the pharmaceutical carrier or excipient (s). In general, formulations are prepared by uniformly and intimately associating the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

The compositions of the present invention can be formulated in any of many possible dosage forms such as, but not limited to, tablets, capsules, gel caps, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, nonaqueous, or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol and / or dextran. The suspension can also contain stabilizers.

The pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foams, and formulations containing liposomes. Pharmaceutical compositions and formulations

ES 2 634 450 T3 of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.

Emulsions are normally heterogeneous systems of one liquid dispersed in another in the form of droplets, generally greater than 0.1 mm in diameter. The emulsions may contain additional components in addition to the dispersed phases and the active drug which may be present as a solution in the aqueous phase, the oil phase, or as a separate phase. Microemulsions are included as one embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in US Patent 6,287,860.

The formulations of the present invention include liposomal formulations. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be administered. Cationic liposomes are liposomes that are believed to interact with negatively charged DNA molecules to form a stable positively charged complex. Liposomes that are pH sensitive or negatively charged are believed to trap DNA rather than complex with it. Both cationic and non-cationic liposomes have been used to deliver DNA to cells.

Liposomes also include sterically stabilized liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids which, when incorporated into liposomes, result in improved circulation lifetimes relative to with liposomes lacking such specialized lipids. Liposomes and their uses are further described in US Patent 6,287,860.

In another embodiment, the formulations of the present invention include saline formulations. In certain embodiments, a formulation consists of the compounds described herein and saline. In certain embodiments, a formulation consists essentially of the compounds described herein and saline. In certain embodiments, the saline solution is a pharmaceutically acceptable grade saline solution. In certain embodiments, the saline solution is a buffered saline solution. In certain embodiments, the saline solution is phosphate buffered saline (PBS).

In certain embodiments, a formulation excludes liposomes. In certain embodiments, the formulation excludes sterically stabilized liposomes. In certain embodiments, a formulation excludes phospholipids. In certain embodiments, the formulation consists essentially of the compounds described herein and saline and excludes liposomes.

The pharmaceutical formulations and compositions of the present invention can also include surfactants. Surfactants and their uses are further described in US Patent 6,287,860.

In one embodiment, the present invention employs various penetration enhancers to affect the efficient rendering of nucleic acids, particularly oligonucleotides. Penetration enhancers and their uses are further described in US Patent 6,287,860.

One skilled in the art will recognize that formulations are routinely designed in accordance with their intended use, ie, the route of administration.

Formulations for topical administration include those in which the oligonucleotides provided herein are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Preferred lipids and liposomes include neutral (eg, dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearyolyphosphatidyl choline) negative (eg, dimyristoylphosphatidyl glycerol DMPG), and cationic ethanolamine DIMT (eg, Dymyristoylphosphatidyl DMPG), and cationic DIMMOT (eg etharytoyl DIMOT) ethanolaminepropylOTH dioleoylphosphatidyl).

Compositions and formulations for parenteral administration, including intravenous, subcutaneous, intraperitoneal, intra-arterial intramuscular injection or infusion, or intracranial may include sterile aqueous solutions that may also contain buffers, diluents, and other suitable additives such as, but not limited to, enhancers. of penetration, carrier compounds and other pharmaceutically acceptable vehicles or excipients.

Certain embodiments provided herein provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents that function by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, maphosphamide, ifosfamide, busnosulfomycin arabinosulfomycin, cytosphenic acid , actinomycin D, mithramycin, prednisone, hydroxyprogesterone,

ES 2634450 T3 testosterone, tamoxifen, dacarbazine, procarbazine, hexametilomelamina, pentametilomelamina, mitoxantrone, amsacrine, chlorambucil, metilociclohexilnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4hidroxiperoxiciclofosforamida, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin, and diethylstilbestrol (DES). When used with the compounds provided herein, such chemotherapeutic agents can be used individually (eg, 5-FU and oligonucleotide), sequentially (eg, 5-FU and oligonucleotide over a period of time followed by MTX and oligonucleotide) , or in combination with one or more other such chemotherapeutic agents (eg, 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotides). Anti-inflammatory drugs, including but not limited to non-steroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including, but not limited to, ribavirin, vidarabine, acyclovir, and ganciclovir, can also be combined in compositions provided herein. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more compounds in combination can be used together or sequentially.

In another related embodiment, the compositions provided herein may contain one or more antisense compounds, particularly oligonucleotides, targeting a first nucleic acid and one or more additional antisense compounds targeting a second target nucleic acid. Alternatively, the compositions provided herein may contain two or more antisense compounds that target different regions of the same target nucleic acid. Numerous examples of antisense compounds are known in the art. Two or more compounds in combination can be used together or sequentially.

Dosage

The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art. The dosage depends on the severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a decrease in the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the patient's body. Optimal dosages can vary depending on the relative potency of individual oligonucleotides, and can generally be estimated on the basis of EC50 which has been found to be effective in in vitro and in vivo animal models. In general, the dose is from 0.01 mg to 100 g per kg of body weight, and can be administered one or more times daily, weekly, monthly or annually, or at desired intervals. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent recurrence of the disease state, where the oligonucleotide is administered in maintenance doses, ranging from 0.01 mg to 100 g per kg of body weight, once or more a day.

Although the present invention has been specifically described in accordance with some of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the invention.

Certain compounds

Approximately two hundred and seventy-six newly designed antisense compounds of various lengths, motifs, and backbone composition were tested for their effect on human PTP1B mRNA in vitro in various cell types. The new compounds were compared with some five hundred previously designed compounds including ISIS 107772, ISIS 107831, ISIS 142025, ISIS 142026, ISIS 142027, ISIS 142028, ISIS 142082, ISIS 146908, and ISIS 146909, which have previously been determined as part of the compounds. more potent antisense in vitro (see, for example, US Patent US Publication No. 2003/0220282 published 11/27/2003 and PCT Patent Publication No. WO2007 / 131237 published 11/15 / 2007). Of the approximately two hundred and eighty five newly designed and predesigned antisense compounds, approximately eleven compounds were selected for further study based on in vitro potency. Selected compounds were tested for dose-dependent inhibition in HUVEC, HepG2, HUVEC, LLC-MK2, and cynomolgus primary hepatocytes. Additional oligonucleotides were designed based on microwalk from ISIS 409826, one of the selected compounds that showed a significant reduction in PTP1B mRNA in all cell lines tested. The oligonucleotides were tested in HUVEC cells (Example 5), along with gapmers from the previous screen (Example 1). Several antisense oligonucleotides were selected from the screen in Example 5 and tested for dose-dependent inhibition in HUVEC cells (Example 6) and HepG2 cells (Example 7). Furthermore, two oligonucleotides were designed as shortmers to ISIS 1,428,082, one of the selected compounds. These two shortmers (ISIS 446431 and ISIS 446432), as well as five ISIS oligonucleotides selected from the study described in Examples 6 and 7 were tested in HepG2 cells, LLC-MK2 cells, HUVEC cells, and primary cynomolgus hepatocytes (Examples 8-11). . ISIS oligonucleotides that demonstrated dose-dependent reduction of PTP1B mRNA in all cell lines were tested for in vivo tolerability. Two more oligonucleotides ISIS 446433 and ISIS 446434, designed as shortmers for ISIS 409826, were included in the in vivo tolerance studies as well.

ES 2 634 450 T3

The twelve gapmers chosen were tested in a mouse model (see Example 12) and a rat model (Example 13). By virtue of their complementary sequence, the compounds are complementary to regions 3291 to 3310, 989 to 1008, 3290 to 3309, 3,287 to 3,306, 3291 to 3310, 3288 to 3307, 3292 to 3309, 3293 to 3308, 3288 to 3305, and 3289-3304 of SEQ ID NO: 1. In in vivo models, body weights and organ weights, liver metabolic markers, such as alanine transaminase, aspartate transaminase and bilirubin, kidney metabolic markers, such as BUN and creatinine, glucose levels in plasma, cholesterol and triglyceride levels, and inflammatory cytokine levels. Of the twelve compounds tested, five compounds, ISIS 142082, ISIS 404173, ISIS 410003, ISIS 446431, ISIS 446432 were selected and their viscosity was measured (Example 14). All five oligonucleotides are considered optimal in their viscosity according to the criteria established for the study.

Final evaluation of these studies (Examples 12-14) led to the selection of four compounds that have a nucleobase sequence of a sequence indicated in SEQ ID NO: 27 (ISIS 142082), 46 (ISIS 446431), 26 (ISIS 404173 ), and 23 (ISIS 409826). By virtue of their complementary sequence, the compounds are complementary to regions 3291 to 3310, 3292 to 3309, 3290 to 3309, 3287 to 3306 of SEQ ID NO: 1. In certain embodiments, compounds targeted to the enumerated regions, as further described herein, comprise a modified oligonucleotide having a nucleobase portion of the sequence indicated in SEQ ID NOs, as further described herein. In certain embodiments, compounds that target the enumerated regions or that have a nucleobase portion of a sequence indicated in the listed SEQ ID NOs may be of various lengths, as further described herein, and may have one of several reasons, as further described in this document. In certain embodiments, a compound targeting a region or having a nucleobase portion of a sequence indicated in the listed SEQ ID NOs has the specific length and motif, as indicated by ISIS NOs: ISIS 142082, ISIS 446431, ISIS 404173, and ISIS 409826.

Three compounds having a nucleobase sequence of a sequence indicated in SEQ ID NO: 27 (ISIS 142082), 23 (ISIS 404173), and 46 (ISIS 446431), were further tested in a long-term, six-month tolerability study. in a mouse model (see Example 15). The half-life in the liver of CD1 mice of the four of the compounds having a nucleobase sequence of a sequence indicated in SEQ ID NOs: 53 (ISIS 409826), 27 (ISIS 142082), 26 (ISIS 404173), and 46 (ISIS 446431) was also evaluated (Example 16).

These four compounds were tested for efficacy, pharmacokinetic profile, and tolerability in cynomolgus monkeys (Example 17). Inhibition studies in these monkeys indicate that treatment with some of these compounds caused a reduction in PTP1B mRNA in liver and fat tissues. Specifically, treatment with ISIS 409826, ISIS 142082, ISIS 446431, and ISIS 404173 caused a 45%, 48%, 18, and 22% reduction of PTP1B mRNA in liver tissue, respectively, compared to the PBS control. Treatment with ISIS 409826, ISIS 142082, ISIS 446431 and ISIS 404173 caused a reduction of 21%, 28%, 12% and 31% of PTP1B mRNA in the fat tissue, respectively compared to the PBS control. It was observed that ISIS 404173 caused a similar reduction in PTP1B mRNA compared to ISIS 142082, despite the fact that the two oligonucleotides differ from each other by a single base pair change of their target region in SEQ ID NO: 1. A protein analysis of liver tissue was also carried out by Western blot analysis. PTP1B mRNA reduction using ISIS 409826, ISIS 142082, ISIS 446431 and ISIS 404173 was measured at a maximum dose of 40mgk / week for efficacy and at a lower dose of 8mgk / week for potency (see table 45). Protein analysis at a dose less than 8 mgk / week showed that ISIS 404173 caused a greater reduction (33%) of PTP1B protein than ISIS 142082 (20%) showing that ISIS 404173 was more potent than ISIS 142082 (see Table 47 and Figure 1). Protein analysis at the highest dose of 40 mg / week demonstrated that ISIS 404173 (60% protein reduction) was as effective as ISIS 142082 (65% protein reduction). Finally, treatment with ISIS 409826 and ISIS 142082 resulted in 22% CRP levels at 4.8 mg / L and 6.7 mg / L. Therefore, ISIS 404173 caused the smallest increase in CRP levels indicating that ISIS 404173 is extremely tolerable and non-pro-inflammatory. Organ weights were also measured to assess the tolerability of ISIS oligonucleotides by monkeys. Treatment with ISIS 142082 at a dose of 40 mg / L caused increases in kidney and liver weights of 21 g and 18 g, respectively, which is a two-fold increase over the control (kidney 10 g and liver 10.5 g ). Treatment with ISIS 409826 caused a two-fold increase in liver weight (18.5 g vs. 10.5 g of control) and a three-fold increase in spleen weight (6.0 g vs. 2.3 g of control). Treatment with ISIS 446431 caused a four-fold increase in spleen weight (9.6 g vs. 2.3 g control). Treatment with ISIS 404173 caused an increase of less than once in all organs (14.8 g kidney; liver 15.5 g; spleen 3.7 g) See (Figure 2). Therefore, treatment with ISIS 142082, ISIS 409826 and ISIS 446431 were not considered tolerable in monkeys, while treatment with ISIS 404173 was tolerable.

Treatment with ISIS 142082 caused organ weight gain and elevated CRP levels, indicating an inflammatory state. Treatment with ISIS 409826 also caused elevated levels of CRP and levels of

Low complement C3, indicating a disease state. Treatment with ISIS 404173 and ISIS 446431 is considered optimal in terms of their tolerability profiles in Javanese macaques. However, ISIS 446431 demonstrated less power compared to ISIS 404173.

ES 2 634 450 T3

In the case of the oligonucleotide pharmacokinetic profile studies in liver and kidney, none of the ISIS oligonucleotides demonstrated abnormal ratios in concentration in liver compared to kidney. ISIS 404173 was a better renal accumulator compared to ISIS 142082, as indicated in the results.

Therefore, in vivo studies, particularly in cynomolgus monkeys, indicate that ISIS 404173 was just as potent and considerably more tolerable compared to the other compounds. Studies show that ISIS 142082, although displaced from ISIS 407173 by only one nucleobase, was as effective but less potent and tolerable than ISIS 404173, as demonstrated by assays for metabolic and inflammatory markers. In general, ISIS 404173 was more potent and tolerable compared to any other compound.

Accordingly, antisense compounds with any one or more of the improved characteristics are provided herein. In certain embodiments, compounds comprising a modified oligonucleotide as further described herein directed at or specifically hybridizing to the nucleotide region of SEQ IDNO: 1 are described herein.

Accordingly, antisense compounds with any one or more of the improved characteristics are disclosed herein. In certain embodiments, described herein are compounds comprising a modified oligonucleotide as further described herein directed to or specifically hybridizing to the nucleotide region of SEQ ID NO: 2.

In certain embodiments, the compounds described herein are effective by virtue of having at least one of an in vitro IC50 of less than 0.4 μΜ, less than 0.35 μΜ, less than 0.3 μΜ, less than 2 , 5 µΜ, less than 2.0 µΜ, less than 1.5 µΜ, less than 1.0 µΜ, when administered to a hepatocyte cynomolgus monkey cell line by electroporation as described in Example 11. In certain embodiments, the compounds as described herein are highly tolerable, as demonstrated by having at least one of a no more than 4-fold, 3-fold, or 2-fold increase in ALT or AST value over solution-treated animals. saline; or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2%. EXAMPLES

Example 1: Antisense Inhibition of Human PTP1B mRNA in HUVEC Cells

Antisense oligonucleotides targeted to a human PTP1B nucleic acid were designed and examined for their effect on PTP1B RNA transcription in vitro. ISIS 107772, ISIS 107831, ISIS 142025, ISIS 142026, ISIS 142027, ISIS 142028, ISIS 142082, ISIS 146908, and ISIS 146909, claimed in a previous patent (BIOL001USP2) were included in this trial for comparison. HUVEC cells were cultured at a density of 5,000 cells per well and were transfected using LipofectAMINE 2000® with 2 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from cells and PTP1B mRNA levels were measured by quantitative real-time PCR. mRNA PTP1B levels were adjusted according to total RNA content, measured by RiboGreen®. Results are presented as percent inhibition of PTP1B mRNA levels, relative to untreated control cells.

The antisense oligonucleotides in Table 1 are 5-10-5 MOE gapmers or 2-13-5 MOE gapmers. The 510-5 MOE gapmers have a gap segment comprising ten 2'-deoxynucleosides and a two-wing segment comprising five 2'-MOE nucleosides. The 2-13-5 MOE gapmers have a gap segment comprising thirteen 2'-deoxynucleosides, a 5 'wing segment comprising two 2'-MOE nucleosides, and a 3' wing segment comprising three 2 'nucleosides -MOE. The long internucleoside linkages of each gamer are phosphorothioate linkages (P = S). All cytosine residues throughout each gapmer are 5-methylcytosines. 'Target start site' indicates the 5 'most nucleotide end to which the antisense oligonucleotide is directed in the human gene sequence. 'Target stop site' indicates the 3 'most nucleotide to which the antisense oligonucleotide is targeted in the human gene sequence. All antisense oligonucleotides listed in Table 1 target either the mRNA sequence, designated herein as SEQ ID NO: 1 (GenBank Accession No. NM_002827.2) or the genomic sequence, designated herein as SEQ ID NO: 2 (Accession No. of NT_011362.9 truncated from nucleotides 14178000 to 14256000), or both.

Some of the human oligonucleotides in Table 1 are also fully cross-reactive with rhesus monkey gene sequences. 'n / a' indicates that there were more than 3 base mismatches between the human oligonucleotide and the rhesus monkey gene sequence. The greater the complementarity between the human oligonucleotide and the rhesus monkey sequence, the more likely the human oligonucleotide can cross-react with the rhesus monkey sequence. The human oligonucleotides in Table 1 were compared to SEQ ID NO: 3 (exons 1-9, intron 9 and exon 10 of the rhesus monkey PTP1B scaffold). Rhesus monkey target start site indicates the 5 'end of nucleotides to which the gapmer is directed in the rhesus monkey gene sequence. Rhesus monkey target stop site indicates the 3 'nucleotide to which the gapmer is directed sequence of the rhesus monkey gene.

ES 2 634 450 T3

Table 1

<td colspan="8">Inhibition of human PTP1B RNA transcription in HUVEC cells by antisense oligonucleotides directed to SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3</td>

<td>ISIS Not</td><td>Sequence</td><td>Reason</td><td>% from inhibited on</td><td>Site of start in SEQ ID NO: 1</td><td>Start site in SEQ ID NO: 2</td><td>Site of start in SEQ ID NO: 3</td><td>I KNOW THAT ID NO</td>

<td> 142025</td><td>TTGTCGATCTGCTCGAACTC</td><td> 5-10-5</td><td> 43</td><td> 190</td><td> 1989</td><td> 197</td><td> 4</td>

<td> 142026</td><td>GACTTGTCGATCTGCTCGAA</td><td> 5-10-5</td><td> 59</td><td> 193</td><td> 1992</td><td> 989</td><td> 5</td>

<td> 107772</td><td>CCCGGACTTGTCGATCTGCT</td><td> 5-10-5</td><td> 66</td><td> 197</td><td> 1996</td><td> 3754</td><td> 6</td>

<td> 142027</td><td>GCTCCCGGACTTGTCGATCT</td><td> 5-10-5</td><td> 55</td><td> 200</td><td> 1999</td><td> 3759</td><td> 7</td>

<td> 142028</td><td>CCAGCTCCCGGACTTGTCGA</td><td> 5-10-5</td><td> 60</td><td> 203</td><td> 2002</td><td> 4498</td><td> 8</td>

<td> 373125</td><td>GGCACCTTCGATCACAGCCA</td><td> 5-10-5</td><td> 55</td><td> 989</td><td> 70726</td><td> 4487</td><td> 9</td>

<td> 113715</td><td>GCTCCTTCCACTGATCCTGC</td><td> 5-10-5</td><td> 50</td><td> 1035</td><td>n / a</td><td> 4500</td><td> 10</td>

<td> 107831</td><td>GGTCATGCACAGGCAGGTTG</td><td> 5-10-5</td><td> 70</td><td> 2360</td><td> 75039</td><td> 3753</td><td> 11</td>

<td> 409988</td><td>AGGTCATGCACAGGCAGGTT</td><td> 2-13-5</td><td> 83</td><td> 2361</td><td> 75040</td><td> 3759</td><td> 12</td>

<td> 409821</td><td>GATCAGGTCATGCACAGGCA</td><td> 5-10-5</td><td> 86</td><td> 2365</td><td> 75044</td><td> 3575</td><td> 13</td>

<td> 404176</td><td>TGATCAGGTCATGCACAGGC</td><td> 5-10-5</td><td> 87</td><td> 2366</td><td> 75045</td><td> 4493</td><td> 14</td>

<td> 146908</td><td>ACCCTTGGAATGTCTGAGTT</td><td> 5-10-5</td><td> 56</td><td> 2544</td><td> 75223</td><td> 3746</td><td> 15</td>

<td> 404169</td><td>CCCATACCCTTGGAATGTCT</td><td> 5-10-5</td><td> 77</td><td> 2549</td><td> 75228</td><td> 3756</td><td> 16</td>

<td> 409815</td><td>TCCCATACCCTTGGAATGTC</td><td> 5-10-5</td><td> 72</td><td> 2550</td><td> 75229</td><td> 3566</td><td> 17</td>

<td> 146909</td><td>TTCCCATACCCTTGGAATGT</td><td> 5-10-5</td><td> 43</td><td> 2551</td><td> 75230</td><td> 3569</td><td> 18</td>

<td> 409845</td><td>TATTCCATGGCCATTGTAAA</td><td> 5-10-5</td><td> 23</td><td> 3283</td><td> 75962</td><td> 4485</td><td> 19</td>

<td> 410030</td><td>TTATTCCATGGCCATTGTAA</td><td> 2-13-5</td><td> 24</td><td> 3284</td><td> 75963</td><td> 4486</td><td> 20</td>

<td> 409825</td><td>TTTATTCCATGGCCATTGTA</td><td> 5-10-5</td><td> 34</td><td> 3285</td><td> 75964</td><td> 192</td><td> 21</td>

<td> 409883</td><td>GTTTATTCCATGGCCATTGT</td><td> 3-14-3</td><td> 36</td><td> 3286</td><td> 75965</td><td> 198</td><td> 22</td>

<td> 409999</td><td>GGTTTATTCCATGGCCATTG</td><td> 2-13-5</td><td> 54</td><td> 3287</td><td> 75966</td><td> 190</td><td> 23</td>

<td> 409826</td><td>GGTTTATTCCATGGCCATTG</td><td> 5-10-5</td><td> 73</td><td> 3287</td><td> 75966</td><td> 201</td><td> 23</td>

<td> 410000</td><td>TGGTTTATTCCATGGCCATT</td><td> 2-13-5</td><td> 55</td><td> 3288</td><td> 75967</td><td> 194</td><td> 24</td>

<td> 404172</td><td>TGGTTTATTCCATGGCCATT</td><td> 5-10-5</td><td> 61</td><td> 3288</td><td> 75967</td><td> 192</td><td> 24</td>

<td> 410001</td><td>ATGGTTTATTCCATGGCCAT</td><td> 2-13-5</td><td> 51</td><td> 3289</td><td> 75968</td><td> 198</td><td> 25</td>

<td> 409827</td><td>ATGGTTTATTCCATGGCCAT</td><td> 5-10-5</td><td> 44</td><td> 3289</td><td> 75968</td><td> 195</td><td> 25</td>

<td> 410002</td><td>AATGGTTTATTCCATGGCCA</td><td> 2-13-5</td><td> 0</td><td> 3290</td><td> 75969</td><td> 204</td><td> 26</td>

<td> 404173</td><td>AATGGTTTATTCCATGGCCA</td><td> 5-10-5</td><td> 48</td><td> 3290</td><td> 75969</td><td> 201</td><td> 26</td>

<td> 410003</td><td>AAATGGTTTATTCCATGGCC</td><td> 2-13-5</td><td> 64</td><td> 3291</td><td> 75970</td><td> 193</td><td> 27</td>

<td> 142082</td><td>AAATGGTTTATTCCATGGCC</td><td> 5-10-5</td><td> 52</td><td> 3291</td><td> 75970</td><td> 190</td><td> 27</td>

<td> 410004</td><td>AAAATGGTTTATTCCATGGC</td><td> 2-13-5</td><td> 46</td><td> 3292</td><td> 75971</td><td> 196</td><td> 28</td>

<td> 409828</td><td>AAAATGGTTTATTCCATGGC</td><td> 5-10-5</td><td> 44</td><td> 3292</td><td> 75971</td><td> 194</td><td> 28</td>

<td> 409829</td><td>AAAAATGGTTTATTCCATGG</td><td> 5-10-5</td><td> 36</td><td> 3293</td><td> 75972</td><td> 198</td><td> 29</td>

<td> 404161</td><td>GGTCATTTCCATGGCCAGAG</td><td> 2-13-5</td><td> 78</td><td>n / a</td><td> 73855</td><td> 3746</td><td> 31</td>

<td> 409975</td><td>GGAGGTCATTTCCATGGCCA</td><td> 2-13-5</td><td> 85</td><td>n / a</td><td> 73858</td><td>n / a</td><td> 32</td>

<td> 409976</td><td>AGGAGGTCATTTCCATGGCC</td><td> 2-13-5</td><td> 85</td><td>n / A</td><td> 73859</td><td> 2379</td><td> 30</td>

Example 2: Dose-dependent antisense inhibition of human PTP1B mRNA in HUVEC cells

Various antisense oligonucleotides, which showed significant antisense inhibition of PTP1B mRNA in the study described in Example 1 were further tested in HUVEC cells at various doses. Cells were seeded at a density of 5,000 cells per well and transfected using LipofectAMINE 2000® with 0.9375 nM, 1.875 nM, 3.75 nM, 7.5 nM, 15 nM, and 30 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from cells and PTP1B mRNA transcription levels were measured by quantitative real-time PCR using the RTS3000 primer probe set (forward sequence CTGGTTTAACCTCCTATCCTTGGA, designated herein as SEQ ID NO: 33; reverse sequence CAGAGCAGCTCGCTACCTCTCT, designated herein as SEQ ID NO: 34, probe sequence CAGCTGGCTCTCCACCTTGTTACACATTATGT, designated herein as SEQ ID NO: 35). PTP1B mRNA levels were normalized to total RNA content, measured by RIBOGREEN®. The results are presented in Table 2 as percent inhibition of PTP1B mRNA, relative to untreated control cells.

ES 2 634 450 T3

Table 2

<td colspan="8">Dose-dependent antisense inhibition of human PTP1B in</td>

<td></td><td colspan="7">HUVEC cells</td>

<td>ISIS No</td><td>0.9375 nM</td><td>1,875 nM</td><td>3.75 nM</td><td>7.5 nM</td><td>15.0 nM</td><td>30.0 nM</td><td>CI₅₀(nM)</td>

<td> 113715</td><td> 0</td><td> 0</td><td> 2</td><td> 11</td><td> 23</td><td> 33</td><td> &gt; 30</td>

<td> 404161</td><td> 1</td><td> 0</td><td> 7</td><td> 29</td><td> 42</td><td> 57</td><td> 17</td>

<td> 404169</td><td> 0</td><td> 6</td><td> 17</td><td> 37</td><td> 57</td><td> 72</td><td> 7</td>

<td> 404176</td><td> 0</td><td> 0</td><td> 20</td><td> 38</td><td> 68</td><td> 79</td><td> 6</td>

<td> 409815</td><td> 0</td><td> 0</td><td> 7</td><td> 30</td><td> 48</td><td> 65</td><td> 12</td>

<td> 409821</td><td> 0</td><td> 1</td><td> 17</td><td> 41</td><td> 68</td><td> 82</td><td> 5</td>

<td> 409826</td><td> 0</td><td> 0</td><td> 10</td><td> 30</td><td> 47</td><td> 64</td><td> 12</td>

<td> 409975</td><td> 0</td><td> 0</td><td> 23</td><td> 50</td><td> 74</td><td> 86</td><td> 4</td>

<td> 409976</td><td> 0</td><td> 0</td><td> 21</td><td> 46</td><td> 65</td><td> 82</td><td> 5</td>

<td> 409988</td><td> 0</td><td> 0</td><td> 23</td><td> 49</td><td> 70</td><td> 83</td><td> 5</td>

<td> 410003</td><td> 0</td><td> 0</td><td> 4</td><td> 16</td><td> 28</td><td> 46</td><td> &gt; 30</td>

Example 3: dose-dependent antisense inhibition of PTP1B mRNA in LLC-MK2 cells

The antisense oligonucleotides from the study described in Example 2 are also cross-reactive with the rhesus monkey gene sequence (SEQ ID NO: 3) and were further tested in rhesus monkey LLC-MK2 cells at various doses. Cells were seeded at a density of 3,000 cells per well and transfected using Lipofectin with 3.125 nM, 6.25 nM, 12.5 nM, 25 nM, 50 nM, and 100 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using the RTS198 probe primer set (GGAGTTCGAGCAGATCGACAA leader sequence, designated herein as SEQ ID NO: 36; sequence reverse GGCCACTCTACATGGGAAGTC, designated herein as SEQ ID NO: 37, probe sequence AGCTGGGCGGCCATTTACCAGGAT, designated herein as SEQ ID NO: 38). PTP1B mRNA levels were normalized to total RNA content, measured by RIBOGREEN®. The results are presented in Table 3 as percent inhibition of PTP1B mRNA, relative to untreated control cells. The start and stop sites of each oligonucleotide in rhesus monkey SEQ ID NO: 3 (the concatenation of exons 1-9, intron 9 and exon 10 of the PTP1B rhesus scaffold (240 gene scaffold) are presented in Table 4.

Table 3 Dose-dependent antisense inhibition of PTP1B mRNA in LLC-MK2 cells

<td>ISIS No</td><td>3.125 nM</td><td>6.25 nM</td><td>12.5 nM</td><td>25.0 nM</td><td>50.0 nM</td><td>100.0 nM</td><td>IC50 (nM)</td>

<td> 113715</td><td> 9</td><td> 18</td><td> 18</td><td> 42</td><td> 71</td><td> 88</td><td> 12</td>

<td> 404161</td><td> 18</td><td> 26</td><td> 37</td><td> 49</td><td> 67</td><td> 79</td><td> 9</td>

<td> 404169</td><td> 9</td><td> 33</td><td> 36</td><td> 52</td><td> 70</td><td> 85</td><td> 8</td>

<td> 404176</td><td> 4</td><td> 21</td><td> 28</td><td> 52</td><td> 73</td><td> 85</td><td> 10</td>

<td> 409815</td><td> 19</td><td> 27</td><td> 32</td><td> 51</td><td> 67</td><td> 83</td><td> 9</td>

<td> 409821</td><td> 4</td><td> 20</td><td> 37</td><td> 53</td><td> 74</td><td> 85</td><td> 9</td>

<td> 409826</td><td> 7</td><td> 31</td><td> 63</td><td> 46</td><td> 62</td><td> 78</td><td> 8</td>

<td> 409975</td><td> 13</td><td> 20</td><td> 28</td><td> 43</td><td> 62</td><td> 74</td><td> 15</td>

<td> 409976</td><td> 12</td><td> 20</td><td> 37</td><td> 42</td><td> 65</td><td> 77</td><td> 12</td>

<td> 409988</td><td> 3</td><td> 20</td><td> 39</td><td> 56</td><td> 73</td><td> 86</td><td> 8</td>

<td> 410003</td><td> 16</td><td> 24</td><td> 36</td><td> 43</td><td> 65</td><td> 80</td><td> 11</td>

ES 2 634 450 T3

Table 4

<td colspan="3">PTP1B Targeted Antisense Oligonucleotide Target Sites in the Rhesus Monkey Gene Sequence (SEQ ID NO: 3)</td>

<td>ISIS No</td><td>Start site</td><td>Stop site</td>

<td> 113715</td><td> 1035</td><td> 1054</td>

<td> 404161</td><td> 2385</td><td> 2404</td>

<td> 409975</td><td> 2388</td><td> 2407</td>

<td> 409976</td><td> 2389</td><td> 2408</td>

<td> 409988</td><td> 3566</td><td> 3585</td>

<td> 409821</td><td> 3570</td><td> 3589</td>

<td> 404176</td><td> 3571</td><td> 3590</td>

<td> 404169</td><td> 3754</td><td> 3773</td>

<td> 409815</td><td> 3755</td><td> 3774</td>

<td> 409826</td><td> 4491</td><td> 4510</td>

<td> 410003</td><td> 4495</td><td> 4514</td>

Example 4: Dose-dependent antisense inhibition of PTP1B mRNA in primary cynomolgus hepatocytes

Some of the antisense oligonucleotides from the study described in Examples 1, 2 and 3 were further tested in cynomolgus primary hepatocytes at various doses. Cells were seeded at a density of 35,000 cells per well and transfected using Lipofectin with 6.25 nM, 12.5 nM, 25 nM, 50 nM, 100 nM, and 200 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using the RTS198 probe primer set. PTP1B mRNA levels were normalized to total RNA content, measured by RIBOGREEN®. The results are presented in Table 5 as percent inhibition of PTP1B mRNA, relative to untreated control cells.

Table 5

Dose-dependent antisense inhibition of PTP1B mRNA in cynomolgus primary hepatocytes

<td>ISIS No</td><td>6.25 nM</td><td>12.5 nM</td><td>25.0 nM</td><td>50.0 nM</td><td>100.0 nM</td><td>200.0 nM</td><td>IC50 (nM)</td>

<td> 373125</td><td> 16</td><td> 4</td><td> 13</td><td> 32</td><td> 48</td><td> 67</td><td> 104</td>

<td> 404161</td><td> 7</td><td> 3</td><td> 24</td><td> 40</td><td> 56</td><td> 77</td><td> 72</td>

<td> 404169</td><td> 0</td><td> 13</td><td> 27</td><td> 44</td><td> 57</td><td> 77</td><td> 67</td>

<td> 404176</td><td> 16</td><td> 17</td><td> 27</td><td> 42</td><td> 64</td><td> 76</td><td> 59</td>

<td> 409815</td><td> 0</td><td> 24</td><td> 26</td><td> 40</td><td> 57</td><td> 75</td><td> 69</td>

<td> 409821</td><td> 0</td><td> 9</td><td> 25</td><td> 37</td><td> 60</td><td> 73</td><td> 73</td>

<td> 409826</td><td> 8</td><td> 28</td><td> 10</td><td> 37</td><td> 56</td><td> 71</td><td> 82</td>

<td> 409975</td><td> 13</td><td> 19</td><td> 29</td><td> 38</td><td> 57</td><td> 75</td><td> 67</td>

<td> 409976</td><td> 2</td><td> 18</td><td> 13</td><td> 35</td><td> 60</td><td> 80</td><td> 70</td>

<td> 409988</td><td> 16</td><td> 22</td><td> 28</td><td> 41</td><td> 59</td><td> 77</td><td> 61</td>

<td> 410003</td><td> 17</td><td> 10</td><td> 37</td><td> 46</td><td> 60</td><td> 78</td><td> 56</td>

Example 5: Antisense inhibition of human PTP1B mRNA in HUVEC cells by microwalk-designed oligonucleotides

Additional gapmers were designed on the basis of ISIS 409826 which demonstrated significant inhibition of PTP1B in all cell lines tested. These gapmers were engineered by creating gapmers that move slightly upstream and downstream (i.e., microwalk) of ISIS 409826. The oligonucleotides were also created with various motifs, for example, 5-10-5 MOE, 5-8-5 MOE, 2-13-5 Moe, 6-8-6 MOE motifs, or were uniform oligonucleotides with deoxy and units of MOE. These gapmers were examined in vitro. Oligonucleotides ISIS 142082, ISIS 113715, ISIS 373125, ISIS 404161, ISIS 404172, ISIS 404173, ISIS 404176, ISIS 409825, ISIS 409827, ISIS 409828, ISIS 409829, ISIS 409845, ISIS 409998, ISIS 409999, ISIS 410000, ISIS 4100010000, ISIS 4100010000 410002, ISIS 410003, ISIS 410004, and ISIS 410030 (from Example 1), as well as ISIS 399038, ISIS 404159, ISIS 404174 and, from a previous application (CORE0061WO15), were also included in the assay for comparison. HUVEC cells were grown at a density of 20,000 cells per well and were transfected using electroporation with 2,000 nM antisense oligonucleotide. After a

ES 2 634 450 T3 treatment period of approximately 24 hours, RNA was isolated from cells and PTP1B mRNA levels were measured by quantitative real-time PCR. The established human probe primer set RTS3000 was used to measure PTP1B mRNA levels. mRNA PTP1B levels were adjusted according to total RNA content, measured by RIBOGREEN®. Results are presented as percent inhibition of PTP1B mRNA, relative to untreated control cells. The results are presented in Tables 6 and 7.

The 5-10-5 MOE gapmers are 20 nucleotides in length, in which the hollow central segment is composed of ten 2'-deoxynucleotides and is flanked on both sides (in the 5 'and 3' directions) by wings comprising five nucleotides each. The 5-8-5 MOE gapmers are 18 nucleotides long, in which the hollow central segment is composed of eight 2'-deoxynucleotides and is flanked on both sides (in the 5 'and 3' directions) by wings of five nucleotides. they understand. The 2-13-5 MOE gapmers are 20 nucleotides in length, in which the hollow central segment is composed of thirteen 2'-deoxynucleotides and is flanked in the 5 'and 3' directions with wings comprising two and five nucleotides. respectively. The 6-8-6 MOE gapmers are 18 nucleotides in length, in which the hollow central segment is made up of eight 2'-deoxynucleotides and is flanked on both sides (in the 5 'and 3' directions) by wings comprising six nucleotides . For each of the motifs (5-10-5, 5-8-5, 2-13-5 and 6-8-6), each nucleotide at the 5 'end of the wing segment and each nucleotide at the 3 end 'of the wing segment has a 2'-MOE modification. Uniform oligonucleotides have deoxy and Moe units distributed along the length of the oligonucleotide. The symbols for the various unit chemistries in the uniform oligonucleotide sequences are as follows: 'd' = 2'-deoxyribose; 'e' = 2'-O-methoxyethyl ribose. The internucleoside linkages throughout each gapmer are phosphorothioate linkages (P = S). All cytidine residues throughout each gapmer are 5-methylcytidines. Destination start site indicates nucleotides further 5 'of which the gamer is targeted. Target stop site indicates the 3 'most nucleotide to which the gapmer is targeted. Each gamer listed in Table 6 addresses SEQ ID NO: 1 (GenBank Accession No. NM_002827.2). All antisense oligonucleotides listed in Table 7 target SEQ ID NO: 2 (Accession No. NT_011362.9 truncated from nucleotides 14178000 to 14256000).

As shown in Tables 6 and 7, several of the gapmers exhibited at least 50% inhibition, including ISIS numbers: 113715, 142082, 373125, 399038, 404159, 404161, 404172, 404173, 404176,

409826, 409827, 409999, 410000, 410001, 410002, 410003, 410004, 438371, 438372, 438373, 438374, 438375,

438377, 438379, 438380, 438381, 438383, 438384, 438439, 438442, 438443, 438444, 438445, 438450, 438451,

438452, 438453, 438454, 438456, 438458, 438459, 438460, 438461, 438462, 438464, 438465, 438468, 438469,

438472, 438473, and 438474

Several of the gapmers exhibited at least 60% inhibition, including ISIS numbers: 113715, 142082, 373125, 404161, 404172, 404173, 404176, 409826, 409827, 409999, 410000, 410001, 410002, 410003, 438373, 438380 , 438381, 438382, 438442, 438444, 438445, 438450, 438451, 438452, 438453, 438459, 438460, 438 461, 438.462, 438.468, 438.469, 438.472, and 438474.

Several of the gapmers exhibited inhibition of at least 70%, including ISIS numbers: 142082, 373125, 399038, 404172, 404173, 404176, 409826, 409827, 409999, 410000, 410001, 410002, 410003, 438373, 438374, 438451, 438452 , 438453, 438460, 438461, 438462, 438468, 438469, 438472, and 438474.

Several of the gapmers exhibited inhibition of at least 80%, including ISIS numbers: 142082, 404161, 404173, 409826, 410000, 410001, 410002, 410003, 438451, 438452, 438460, 438461, and 438474.

Several of the gapmers exhibited at least 85% inhibition, including ISIS numbers: 142082,404161, 404173, 409826, 410001, 410002, and 410003.

Several of the gapmers exhibited inhibition of at least 90%, including ISIS numbers: 142,082, 404,161, and 409,826.

ES 2 634 450 T3

Table 6

<td colspan="7">Inhibition of human mRNA PTP1B levels by chimeric antisense oligonucleotides targeted to SEQ ID NO: 1</td>

<td>Site from beginning</td><td>Site from stop to</td><td>ISIS Not</td><td>Sequence</td><td>Reason</td><td>% from inhibition</td><td>I KNOW THAT ID NO</td>

<td> 989</td><td> 1008</td><td> 373125</td><td>GGCACCTTCGATCACAGCCA</td><td>5-10-5 MOE</td><td> 72</td><td> 9</td>

<td> 1035</td><td> 1054</td><td> 113715</td><td>GCTCCTTCCACTGATCCTGC</td><td>5-10-5 MOE</td><td> 68</td><td> 10</td>

<td> 2366</td><td> 2385</td><td> 404176</td><td>TGATCAGGTCATGCACAGGC</td><td>5-10-5 MOE</td><td> 89</td><td> 14</td>

<td> 3283</td><td> 3302</td><td> 409845</td><td>TATTCCATGGCCATTGTAAA</td><td>5-10-5 MOE</td><td> 32</td><td> 19</td>

<td> 3284</td><td> 3303</td><td> 404174</td><td>TTATTCCATGGCCATTGTAA</td><td>5-10-5 MOE</td><td> 47</td><td> 20</td>

ES 2 634 450 T3

<td> 328 4</td><td> 330 3</td><td> 4100 30</td><td>TTATTCCATGGCCATTGTAA</td><td>2-13-5 MOE</td><td> 47</td><td> 20</td>

<td> 328</td><td> 330</td><td> 4383</td><td>^Tand^Tand^TOd^Td^Td^Cand^Cand^TOd^Td^Gd^Gd^Cd^Cd^TOd^Td^Td^Gd^T</td><td>Units</td><td> 52</td><td> 20</td>

<td> 4</td><td> 3</td><td> 77</td><td>d^TOand^TOand</td><td>deoxy and MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>^T and^T eAdT dT dCdCdAdT dGeGeCdCdAdT dTdGdT dT dAeAe</td><td>Units</td><td> 53</td><td> 20</td>

<td> 4</td><td> 3</td><td> 39</td><td></td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>T eT eAeT dT dCdCdAdT dGdGdCdCdAdT dTdGdT dAeAe</td><td>Units</td><td> 34</td><td> 20</td>

<td> 4</td><td> 3</td><td> 48</td><td></td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>T eT eAeT dT dCdCdAeT dGdGdT eCdCdAdT dT dGdT dAeAe</td><td>Units</td><td> 35</td><td> 20</td>

<td> 4</td><td> 3</td><td> 57</td><td></td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>TTATTCCATGGCCATTGTAA</td><td> 6-8-6</td><td> 25</td><td> 20</td>

<td> 4</td><td> 3</td><td> 66</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4098</td><td>TTTATTCCATGGCCATTGTA</td><td> 5-10-5</td><td> 47</td><td> 21</td>

<td> 5</td><td> 4</td><td> 25</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4099</td><td>TTTATTCCATGGCCATTGTA</td><td> 2-13-5</td><td> 49</td><td> 21</td>

<td> 5</td><td> 4</td><td> 98</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4383</td><td>TATTCCATGGCCATTGTA</td><td> 5-8-5</td><td> 32</td><td> 39</td>

<td> 5</td><td> 2</td><td> 68</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4383</td><td>TeTeTdAdTdTdCdCdAdTdGdGdCdCdAdTdTdAe</td><td>Units</td><td> 46</td><td> 21</td>

<td> 5</td><td> 4</td><td> 78</td><td>Ae</td><td>deoxy and MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>TeTeTdAdTdTdCdCdAdTdGeGdCdCdAdTdTdG</td><td>Units</td><td> 30</td><td> 21</td>

<td> 5</td><td> 4</td><td> 40</td><td>dTdAe</td><td>deoxy and MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>TeTeTdAdTdTeCeCdAdTdGdGdCdCdAdTdTdG</td><td>Units</td><td> 43</td><td> 21</td>

<td> 5</td><td> 4</td><td> 49</td><td>eTdAe</td><td>deoxy and MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>TeTeTdAdTdTdCdCeAeTdGdGdCdCdAdTdTdG</td><td>Units</td><td> 53</td><td> 21</td>

<td> 5</td><td> 4</td><td> 58</td><td>eTdAe</td><td>deoxy and MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>TTTATTCCATGGCCATTGTA</td><td> 6-8-6</td><td> 33</td><td> 21</td>

<td> 5</td><td> 4</td><td> 67</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 3990</td><td>GTTTATTCCATGGCCATTGT</td><td> 5-10-5</td><td> 74</td><td> 22</td>

<td> 6</td><td> 5</td><td> 38</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4041</td><td>GTTTATTCCATGGCCATTGT</td><td> 2-13-5</td><td> 54</td><td> 22</td>

<td> 6</td><td> 5</td><td> 59</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4383</td><td>TTATTCCATGGCCATTGT</td><td> 5-8-5</td><td> 33</td><td> 40</td>

<td> 6</td><td> 3</td><td> 69</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4383</td><td>GeTdTdTdAdTeTeCdCdAdTreGdGdCdCdAdTdT</td><td>Units</td><td> 51</td><td> 22</td>

<td> 6</td><td> 5</td><td> 79</td><td>dGeTd</td><td>deoxy and MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>GeTdTdTdAdTdTdCdCdAeTdGdGdCdCdAdTdT</td><td>Units</td><td> 40</td><td> 22</td>

<td> 6</td><td> 5</td><td> 41</td><td>dGeTd</td><td>deoxy and MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>GeTeTeTreAdTeTeCdCdAdTreGdGdCdCdAdTre</td><td>Units</td><td> 64</td><td> 22</td>

<td> 6</td><td> 5</td><td> 50</td><td>TdGeTd</td><td>deoxy and MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>GeTeTeTreAdTdTdCdCdAdTreGdGdCdCdAdTre</td><td>Units</td><td> 68</td><td> 22</td>

<td> 6</td><td> 5</td><td> 59</td><td>TdGeTd</td><td>deoxy and MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>GTTTATTCCATGGCCATTGT</td><td> 6-8-6</td><td> 76</td><td> 22</td>

<td> 6</td><td> 5</td><td> 68</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4098</td><td>GGTTTATTCCATGGCCATTG</td><td> 5-10-5</td><td> 93</td><td> 23</td>

<td> 7</td><td> 6</td><td> 26</td><td></td><td>MOE</td><td></td><td></td>

ES 2 634 450 T3

<td> 328 7</td><td> 330 6</td><td> 4099 99</td><td>GGTTTATTCCATGGCCATTG</td><td>2-13-5 MOE</td><td> 75</td><td> 23</td>

<td> 328</td><td> 330</td><td> 4383</td><td>TTTATTCCATGGCCATTG</td><td> 5-8-5</td><td> 33</td><td> 41</td>

<td> 7</td><td> 4</td><td> 70</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4383</td><td>GeGeT dT dT dAeT eT dCdCdAdT dGdGdCdCdAdT dT eGe</td><td>Units</td><td> 63</td><td> 23</td>

<td> 7</td><td> 6</td><td> 80</td><td></td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>^GeGeT dT dT dAdT dT dCdCcAeT dGdGdCdCdAdT dT eGe</td><td>Units</td><td> 67</td><td> 23</td>

<td> 7</td><td> 6</td><td> 42</td><td></td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>^GeGeT dT dT dAeT eT dCdCdAdT dGdGdCdCdAdT eT eGe</td><td>Units</td><td> 83</td><td> 23</td>

<td> 7</td><td> 6</td><td> 51</td><td></td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>GeGeT dT dT dAdT dT dCeCdAdT dGdGdCdCdAdT eT eGe</td><td>Units</td><td> 82</td><td> 23</td>

<td> 7</td><td> 6</td><td> 60</td><td></td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>GGTTTATTCCATGGCCATTG</td><td> 6-8-6</td><td> 71</td><td> 23</td>

<td> 7</td><td> 6</td><td> 69</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4041</td><td>TGGTTTATTCCATGGCCATT</td><td> 5-10-5</td><td> 76</td><td> 24</td>

<td> 8</td><td> 7</td><td> 72</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4100</td><td>TGGTTTATTCCATGGCCATT</td><td> 2-13-5</td><td> 83</td><td> 24</td>

<td> 8</td><td> 7</td><td> 00</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4383</td><td>GTTTATTCCATGGCCATT</td><td> 5-8-5</td><td> 54</td><td> 42</td>

<td> 8</td><td> 5</td><td> 71</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4383</td><td>TdGeGdTdTdTdAeTdTdCdCdAdTdGdGdCdCdATeTe</td><td>Units</td><td> 69</td><td> 24</td>

<td> 8</td><td> 7</td><td> 81</td><td></td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>^T dGeGdT dT dT dAdT dT dCdCdAdT dGdGdCdCdAdT eT e</td><td>Units</td><td> 50</td><td> 24</td>

<td> 8</td><td> 7</td><td> 43</td><td></td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>TdGeGeTdTdTdAeTdTdCdCdAdTreGdGdCdC</td><td>Units</td><td> 82</td><td> 24</td>

<td> 8</td><td> 7</td><td> 52</td><td>dAeTeTe</td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>TdGeGeTdTdTdAdTeTeCdCdAdTdGdGdCdCd</td><td>Units</td><td> 81</td><td> 24</td>

<td> 8</td><td> 7</td><td> 61</td><td>AeTeTe</td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>TGGTTTATTCCATGGCCATT</td><td> 6-8-6</td><td> 46</td><td> 24</td>

<td> 8</td><td> 7</td><td> 70</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4098</td><td>ATGGTTTATTCCATGGCCAT</td><td> 5-10-5</td><td> 74</td><td> 25</td>

<td> 9</td><td> 8</td><td> 27</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4100</td><td>ATGGTTTATTCCATGGCCAT</td><td> 2-13-5</td><td> 85</td><td> 25</td>

<td> 9</td><td> 8</td><td> 01</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4383</td><td>GGTTTATTCCATGGCCAT</td><td> 5-8-5</td><td> 52</td><td> 43</td>

<td> 9</td><td> 6</td><td> 72</td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4383</td><td>AeTdGdGdTdTeTeAdTdTdCdCdAdTdGdGdCd</td><td>Units</td><td> 65</td><td> 25</td>

<td> 9</td><td> 8</td><td> 82</td><td>CdAeTd</td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>AeTdGdGdTdTdTdAdTdTeCeCdAdTdGdGdCd</td><td>Units</td><td> 72</td><td> 25</td>

<td> 9</td><td> 8</td><td> 44</td><td>CdAeTd</td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

<td> 328</td><td> 330</td><td> 4384</td><td>AeTdGeGdTreTeTeAdTdTdCdCdAdTdGdGdC</td><td>Units</td><td> 72</td><td> 25</td>

<td> 9</td><td> 8</td><td> 53</td><td>dCeAeTe</td><td>deoxy and</td><td></td><td></td>

<td></td><td></td><td></td><td></td><td>MOE</td><td></td><td></td>

ES 2 634 450 T3

<td> 3289</td><td> 3308</td><td> 438462</td><td>AeTdGeGdTdTdTreAeTdTreCdCdAdTreGdGddor eCdAeTd</td><td>Deoxy units and MOE</td><td> 70</td><td> 25</td>

<td> 3289</td><td> 3308</td><td> 438471</td><td>ATGGTTTATTCCATGGCCAT</td><td>6-8-6 MOE</td><td> 45</td><td> 25</td>

<td> 3290</td><td> 3309</td><td> 404173</td><td>AATGGTTTATTCCATGGCCA</td><td>5-10-5 MOE</td><td> 85</td><td> 26</td>

<td> 3290</td><td> 3309</td><td> 410002</td><td>AATGGTTTATTCCATGGCCA</td><td>2-13-5 MOE</td><td> 85</td><td> 26</td>

<td> 3290</td><td> 3307</td><td> 438373</td><td>TGGTTTATTCCATGGCCA</td><td>5-8-5 MOE</td><td> 70</td><td> 44</td>

<td> 3290</td><td> 3309</td><td> 438383</td><td>AeAeT reGdGdT eT eT reAdT dT dCdCdAdT reGdGdCdCeA and</td><td>Deoxy units and MOE</td><td> 54</td><td> 26</td>

<td> 3290</td><td> 3309</td><td> 438445</td><td>AeAeTdGdGdTdTdTdAdTeTeCdCdAdTdGdGdCd CdAe</td><td>Deoxy units and MOE</td><td> 66</td><td> 26</td>

<td> 3290</td><td> 3309</td><td> 438454</td><td>AeAeTdGdGdTeTeTdAdTdTdCdCdAdTdGdGdCd CdAe</td><td>Deoxy units and MOE</td><td> 52</td><td> 26</td>

<td> 3290</td><td> 3309</td><td> 438463</td><td>AeAeTdGdGdTdTdTdAeTdTdCdCdAdTdGdGdCd CdAe</td><td>Deoxy units and MOE</td><td> 39</td><td> 26</td>

<td> 3290</td><td> 3309</td><td> 438472</td><td>AATGGTTTATTCCATGGCCA</td><td>6-8-6 MOE</td><td> 73</td><td> 26</td>

<td> 3291</td><td> 3310</td><td> 142082</td><td>AAATGGTTTATTCCATGGCC</td><td>5-10-5 MOE</td><td> 90</td><td> 27</td>

<td> 3291</td><td> 3310</td><td> 410003</td><td>AAATGGTTTATTCCATGGCC</td><td>2-13-5 MOE</td><td> 86</td><td> 27</td>

<td> 3291</td><td> 3308</td><td> 438374</td><td>ATGGTTTATTCCATGGCC</td><td>5-8-5 MOE</td><td> 79</td><td> 45</td>

<td> 3291</td><td> 3310</td><td> 438384</td><td>AeAeAdTdGdGeTdTdTdAdTdTdCdCdAdTdGdGd CdCd</td><td>Deoxy units and MOE</td><td> 53</td><td> 27</td>

<td> 3291</td><td> 3310</td><td> 438446</td><td>AeAeAdTdGdGdTdTdTdAeTdTdCdCdAdTdGdGd CdCd</td><td>Deoxy units and MOE</td><td> 38</td><td> 27</td>

<td> 3291</td><td> 3310</td><td> 438455</td><td>AeAeAeTdGdGeTdTdTdAdTdTdCdCdAdTdGdGe CdCd</td><td>Deoxy units and MOE</td><td> 58</td><td> 27</td>

<td> 3291</td><td> 3310</td><td> 438464</td><td>AeAeAeTdGdGdTdTeTeAdTdTdCdCdAdTdGdGd CdCd</td><td>Deoxy units and MOE</td><td> 58</td><td> 27</td>

<td> 3291</td><td> 3310</td><td> 438473</td><td>AAATGGTTTATTCCATGGCC</td><td>6-8-6 MOE</td><td> 57</td><td> 27</td>

<td> 3292</td><td> 3311</td><td> 409828</td><td>AAAATGGTTTATTCCATGGC</td><td>5-10-5 MOE</td><td> 43</td><td> 28</td>

<td> 3292</td><td> 3311</td><td> 410004</td><td>AAAATGGTTTATTCCATGGC</td><td>2-13-5 MOE</td><td> 58</td><td> 28</td>

<td> 3292</td><td> 3309</td><td> 438375</td><td>AATGGTTTATTCCATGGC</td><td>5-8-5 MOE</td><td> 55</td><td> 46</td>

<td> 3292</td><td> 3311</td><td> 438385</td><td>AeAeAdAdTdGeGeTdTdTdAdTdTdCdCdAdTdGd GeCd</td><td>Deoxy units and MOE</td><td> 36</td><td> 28</td>

<td> 3292</td><td> 3311</td><td> 438447</td><td>AeAeAdAdTdGdGdTdTdTdAeTdTdCdCdAdTdGd GeCd</td><td>Deoxy units and MOE</td><td> 35</td><td> 28</td>

<td> 3292</td><td> 3311</td><td> 438456</td><td>AeAeAeAdTdGeGeTdTdTdAdTdTdCdCdAdTdGe GeCd</td><td>Deoxy units and MOE</td><td> 58</td><td> 28</td>

<td> 3292</td><td> 3311</td><td> 438465</td><td>AeAeAeAdTdGdGTeTeTdAdTdTdCdCdAdTdGeG eCd</td><td>Deoxy units and MOE</td><td> 51</td><td> 28</td>

<td> 3292</td><td> 3311</td><td> 438474</td><td>AAAATGGTTTATTCCATGGC</td><td>6-8-6 MOE</td><td> 82</td><td> 28</td>

<td> 3293</td><td> 3312</td><td> 409829</td><td>AAAAATGGTTTATTCCATGG</td><td>5-10-5 MOE</td><td> 42</td><td> 29</td>

<td> 3293</td><td> 3310</td><td> 438376</td><td>AAATGGTTTATTCCATGG</td><td>5-8-5 MOE</td><td> 36</td><td> 47</td>

ES 2 634 450 T3

Table 7

<td colspan="7">Inhibition of human mRNA PTP1B levels by chimeric antisense oligonucleotides directed to SEQ ID NO: 2</td>

<td>Start site</td><td>Stop site</td><td>ISIS No</td><td>Sequence</td><td>Reason</td><td>% from inhibition</td><td>SEQ ID NO</td>

<td> 70726</td><td> 70745</td><td> 373125</td><td>GGCACCTTCGATCACAGCCA</td><td>5-10-5 MOE</td><td> 72</td><td> 9</td>

<td> 73855</td><td> 73874</td><td> 404161</td><td>GGTCATTTCCATGGCCAGAG</td><td>2-13-5 MOE</td><td> 93</td><td> 31</td>

<td> 75045</td><td> 75064</td><td> 404176</td><td>TGATCAGGTCATGCACAGGC</td><td>5-10-5 MOE</td><td> 89</td><td> 14</td>

<td> 75962</td><td> 75981</td><td> 409845</td><td>TATTCCATGGCCATTGTAAA</td><td>5-10-5 MOE</td><td> 32</td><td> 19</td>

<td> 75963</td><td> 75982</td><td> 404174</td><td>TTATTCCATGGCCATTGTAA</td><td>5-10-5 MOE</td><td> 47</td><td> 20</td>

<td> 75963</td><td> 75982</td><td> 410030</td><td>TTATTCCATGGCCATTGTAA</td><td>2-13-5 MOE</td><td> 47</td><td> 20</td>

<td> 75963</td><td> 75982</td><td> 438377</td><td>TeTeAdTdTdCdCdAdTdGdGdCd CdAdTdTdGdTdAeAe</td><td>Deoxy units and MOE</td><td> 52</td><td> 20</td>

<td> 75963</td><td> 75982</td><td> 438439</td><td>TeTeAdTdTdCdCdAdTdGeGeCd CdAdTdTdGdTdAeAe</td><td>Deoxy units and MOE</td><td> 53</td><td> 20</td>

<td> 75963</td><td> 75982</td><td> 438448</td><td>TeTeAeTdTdCdCdAdTdGdGdCd CdAdTdTdGdTdAeAe</td><td>Deoxy units and MOE</td><td> 34</td><td> 20</td>

<td> 75963</td><td> 75982</td><td> 438457</td><td>TeTeAeTdTdCdCdAeTdGdGdCd CdAdTdTdGdTdAeAe</td><td>Deoxy units and MOE</td><td> 35</td><td> 20</td>

<td> 75963</td><td> 75982</td><td> 438466</td><td>TTATTCCATGGCCATTGTAA</td><td>6-8-6 MOE</td><td> 25</td><td> 20</td>

<td> 75964</td><td> 75983</td><td> 409825</td><td>TTTATTCCATGGCCATTGTA</td><td>5-10-5 MOE</td><td> 47</td><td> 21</td>

<td> 75964</td><td> 75983</td><td> 409998</td><td>TTTATTCCATGGCCATTGTA</td><td>2-13-5 MOE</td><td> 49</td><td> 21</td>

<td> 75964</td><td> 75981</td><td> 438368</td><td>TATTCCATGGCCATTGTA</td><td>5-8-5 MOE</td><td> 32</td><td> 39</td>

<td> 75964</td><td> 75983</td><td> 438378</td><td>TeTeTdAdTdTdCdCdAdTdGdGdC dCdAdTdTdGdTdAe</td><td>Deoxy units and MOE</td><td> 46</td><td> 21</td>

<td> 75964</td><td> 75983</td><td> 438440</td><td>TeTeTdAdTdTdCdCdAdTdGeGdC dCdAdTdTdGdTdAe</td><td>Deoxy units and MOE</td><td> 30</td><td> 21</td>

<td> 75964</td><td> 75983</td><td> 438449</td><td>TeTeTdAdTdTdCdCdAdTdGdGdC dCdAdTdTdGeTdAe</td><td>Deoxy units and MOE</td><td> 43</td><td> 21</td>

<td> 75964</td><td> 75983</td><td> 438458</td><td>TeTeTdAdTdTdCdCdAeTdGdGdC dCdAdTdTdGeTdAe</td><td>Deoxy units and MOE</td><td> 53</td><td> 21</td>

<td> 75964</td><td> 75983</td><td> 438467</td><td>TTTATTCCATGGCCATTGTA</td><td>6-8-6 MOE</td><td> 33</td><td> 21</td>

<td> 75965</td><td> 75984</td><td> 399038</td><td>GTTTATTCCATGGCCATTGT</td><td>5-10-5 MOE</td><td> 74</td><td> 22</td>

<td> 75965</td><td> 75984</td><td> 404159</td><td>GTTTATTCCATGGCCATTGT</td><td>2-13-5 MOE</td><td> 54</td><td> 22</td>

<td> 75965</td><td> 75982</td><td> 438369</td><td>TTATTCCATGGCCATTGT</td><td>5-8-5 MOE</td><td> 33</td><td> 40</td>

<td> 75965</td><td> 75984</td><td> 438379</td><td>GeTdTunTdAdTeTeCdCdAdTdGd GdCdCdAdTdTdGeTd</td><td>Deoxy units and MOE</td><td> 51</td><td> 22</td>

<td> 75965</td><td> 75984</td><td> 438441</td><td>GeTdTdTdAdTdTdCdCdAeTdGdG dCdCdAdTdTdGeTd</td><td>Deoxy units and MOE</td><td> 40</td><td> 22</td>

<td> 75965</td><td> 75984</td><td> 438450</td><td>GeTeTeTdAdTeTeCdCdAdTdGdG dCdCdAdTdTdGeTd</td><td>Deoxy units and MOE</td><td> 64</td><td> 22</td>

<td> 75965</td><td> 75984</td><td> 438459</td><td>GeTeTeTdAdTdTdCdCdAdTdGdG dCdCdAdTdTdGeTd</td><td>Deoxy units and MOE</td><td> 68</td><td> 22</td>

<td> 75965</td><td> 75984</td><td> 438468</td><td>GTTTATTCCATGGCCATTGT</td><td>6-8-6 MOE</td><td> 76</td><td> 22</td>

ES 2 634 450 T3

<td> 7596 6</td><td> 759 85</td><td> 4098 26</td><td>GGTTTATTCCATGGCCATTG</td><td>5-10-5 MOE</td><td> 93</td><td> 23</td>

<td> 7596</td><td> 759</td><td> 4099</td><td>GGTTTATTCCATGGCCATTG</td><td> 2-13-5</td><td> 75</td><td> 23</td>

<td> 6</td><td> 85</td><td> 99</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4383</td><td>TTTATTCCATGGCCATTG</td><td> 5-8-5</td><td> 33</td><td> 41</td>

<td> 6</td><td> 83</td><td> 70</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4383</td><td>GeGeTdTdTdAeTdTdCdCdAdTdGdGdCdCdAdTdTdGe</td><td>Units</td><td> 63</td><td> 23</td>

<td> 6</td><td> 85</td><td> 80</td><td></td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>^GeGeTdTdTdAdTdTdCdCdTdGdGdCdCdAdTdTdGe</td><td>Units</td><td> 67</td><td> 23</td>

<td> 6</td><td> 85</td><td> 42</td><td></td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>^GeGeT dT dT dAeT dT dCdCdAdT dGdGdCdCdAdT eT eGe</td><td>Units</td><td> 83</td><td> 23</td>

<td> 6</td><td> 85</td><td> 51</td><td></td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>GeGeT dT dT dAdT dT dCdCdAdT dGdGdCdCdAdT eT eGe</td><td>Units</td><td> 82</td><td> 23</td>

<td> 6</td><td> 85</td><td> 60</td><td></td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>GGTTTATTCCATGGCCATTG</td><td> 6-8-6</td><td> 71</td><td> 23</td>

<td> 6</td><td> 85</td><td> 69</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4041</td><td>TGGTTTATTCCATGGCCATT</td><td> 5-10-5</td><td> 76</td><td> 24</td>

<td> 7</td><td> 86</td><td> 72</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4100</td><td>TGGTTTATTCCATGGCCATT</td><td> 2-13-5</td><td> 83</td><td> 24</td>

<td> 7</td><td> 86</td><td> 00</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4383</td><td>GTTTATTCCATGGCCATT</td><td> 5-8-5</td><td> 54</td><td> 42</td>

<td> 7</td><td> 84</td><td> 71</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4383</td><td>TdGeGdTdTdTdAeTdTdCdCdAdTdGdGdCdCd</td><td>Units</td><td> 69</td><td> 24</td>

<td> 7</td><td> 86</td><td> 81</td><td>ATeTd</td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>TdGeGdTdTdTdAdTdTdCdCdAdTdGdGdCdCd</td><td>Units</td><td> 50</td><td> 24</td>

<td> 7</td><td> 86</td><td> 43</td><td>AdTeTe</td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>TdGeGeTdTdTdAeTdTdCdCdAdTdGdGdCdCd</td><td>Units</td><td> 82</td><td> 24</td>

<td> 7</td><td> 86</td><td> 52</td><td>AeTeTe</td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>TdGeGeTdTdTdAdTeTeCdCdAdTdGdGdCdCd</td><td>Units</td><td> 81</td><td> 24</td>

<td> 7</td><td> 86</td><td> 61</td><td>AeTeTe</td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>TGGTTTATTCCATGGCCATT</td><td> 6-8-6</td><td> 46</td><td> 24</td>

<td> 7</td><td> 86</td><td> 70</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4098</td><td>ATGGTTTATTCCATGGCCAT</td><td> 5-10-5</td><td> 74</td><td> 25</td>

<td> 8</td><td> 87</td><td> 27</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4100</td><td>ATGGTTTATTCCATGGCCAT</td><td> 2-13-5</td><td> 85</td><td> 25</td>

<td> 8</td><td> 87</td><td> 01</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4383</td><td>GGTTTATTCCATGGCCAT</td><td> 5-8-5</td><td> 52</td><td> 43</td>

<td> 8</td><td> 85</td><td> 72</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4383</td><td>AeTdGdGdTdTeTeAdTdTdCdCdAdTdGdGdCd</td><td>Units</td><td> 65</td><td> 25</td>

<td> 8</td><td> 87</td><td> 82</td><td>CdAeTd</td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>AeTdGdGdTdTdTdAdTdTdCdCdAdTdGdGdCd</td><td>Units</td><td> 72</td><td> 25</td>

<td> 8</td><td> 87</td><td> 44</td><td>CdAeTd</td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>AeTdGeGdTdTeTeAdTdTdCdCdAdTdGdGdCd</td><td>Units</td><td> 72</td><td> 25</td>

<td> 8</td><td> 87</td><td> 53</td><td>CdAeTd</td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>AeTdGeGdTdTdTdAeTdTdCdCdAdTdGdGdCd</td><td>Units</td><td> 70</td><td> 25</td>

<td> 8</td><td> 87</td><td> 62</td><td>CdAeTd</td><td>deoxy and MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4384</td><td>ATGGTTTATTCCATGGCCAT</td><td> 6-8-6</td><td> 45</td><td> 25</td>

<td> 8</td><td> 87</td><td> 71</td><td></td><td>MOE</td><td></td><td></td>

<td> 7596</td><td> 759</td><td> 4041</td><td>AATGGTTTATTCCATGGCCA</td><td> 5-10-5</td><td> 85</td><td> 26</td>

<td> 9</td><td> 88</td><td> 73</td><td></td><td>MOE</td><td></td><td></td>

ES 2 634 450 T3

<td> 75969</td><td> 75988</td><td> 410002</td><td>AATGGTTTATTCCATGGCCA</td><td>2-13-5 MOE</td><td> 85</td><td> 26</td>

<td> 75969</td><td> 75986</td><td> 438373</td><td>TGGTTTATTCCATGGCCA</td><td>5-8-5 MOE</td><td> 70</td><td> 44</td>

<td> 75969</td><td> 75988</td><td> 438383</td><td>AeAeTdGdGdTeTeTdAdTdTdCdCdAdTdGdGdCdCdAe</td><td>Deoxy units and MOE</td><td> 54</td><td> 26</td>

<td> 75969</td><td> 75988</td><td> 438445</td><td>AeAeT dGdGdT dT dT dAdT eT eCdCdAdT dGdGdCdCdAe</td><td>Deoxy units and MOE</td><td> 66</td><td> 26</td>

<td> 75969</td><td> 75988</td><td> 438454</td><td>AeAeTdGdGdTeTeTdAdTdTdCdCdAdTdGdGdCdCdAe</td><td>Deoxy units and MOE</td><td> 52</td><td> 26</td>

<td> 75969</td><td> 75988</td><td> 438463</td><td>AeAeT dGdGdT dT dT dAeT dT dCdCdAdT dGdGdCdCdAe</td><td>Deoxy units and MOE</td><td> 39</td><td> 26</td>

<td> 75969</td><td> 75988</td><td> 438472</td><td>AATGGTTTATTCCATGGCCA</td><td>6-8-6 MOE</td><td> 73</td><td> 26</td>

<td> 75970</td><td> 75989</td><td> 142082</td><td>AAATGGTTTATTCCATGGCC</td><td>5-10-5 MOE</td><td> 90</td><td> 27</td>

<td> 75970</td><td> 75989</td><td> 410003</td><td>AAATGGTTTATTCCATGGCC</td><td>2-13-5 MOE</td><td> 86</td><td> 27</td>

<td> 75970</td><td> 75987</td><td> 438374</td><td>ATGGTTTATTCCATGGCC</td><td>5-8-5 MOE</td><td> 79</td><td> 45</td>

<td> 75970</td><td> 75989</td><td> 438384</td><td>AeAeAdT dGdGeT dT dT dAdT dT dCdCdAdT dGdGdCdCd</td><td>Deoxy units and MOE</td><td> 53</td><td> 27</td>

<td> 75970</td><td> 75989</td><td> 438446</td><td>AeAeAdT dGdGdT dT dT dAeT dT dCdCdAdT dGdGdCdCd</td><td>Deoxy units and MOE</td><td> 38</td><td> 27</td>

<td> 75970</td><td> 75989</td><td> 438455</td><td>AeAeAeT dGdGeT dT dT dAdT dT dCdCdAdT dGdGeCdCd</td><td>Deoxy units and MOE</td><td> 58</td><td> 27</td>

<td> 75970</td><td> 75989</td><td> 438464</td><td>AeAeAeT dGdGdT dT eT eAdT dT dCdCdAdT dGdGeCd</td><td>Deoxy units and MOE</td><td> 58</td><td> 27</td>

<td> 75970</td><td> 75989</td><td> 438473</td><td>AAATGGTTTATTCCATGGCC</td><td>6-8-6 MOE</td><td> 57</td><td> 27</td>

<td> 75971</td><td> 75990</td><td> 409828</td><td>AAAATGGTTTATTCCATGGC</td><td>5-10-5 MOE</td><td> 43</td><td> 28</td>

<td> 75971</td><td> 75990</td><td> 410004</td><td>AAAATGGTTTATTCCATGGC</td><td>2-13-5 MOE</td><td> 58</td><td> 28</td>

<td> 75971</td><td> 75988</td><td> 438375</td><td>AATGGTTTATTCCATGGC</td><td>5-8-5 MOE</td><td> 55</td><td> 46</td>

<td> 75971</td><td> 75990</td><td> 438385</td><td>AeAeAdAdTdGeGeTdTdAdTdTdCdCdAdTdGdGeCd</td><td>Deoxy units and MOE</td><td> 36</td><td> 28</td>

<td> 75971</td><td> 75990</td><td> 438447</td><td>AeAeAdAdT dGdGdT dT dT dAeT dT dCdCdAdT dGdGeCd</td><td>Deoxy units and MOE</td><td> 35</td><td> 28</td>

<td> 75971</td><td> 75990</td><td> 438456</td><td>AeAeAeAdT dGeGeT dT dTdUN4T dT dCdCdAdT dGeGeCd</td><td>Deoxy units and MOE</td><td> 58</td><td> 28</td>

<td> 75971</td><td> 75990</td><td> 438465</td><td>AeAeAeAdT dGdGT eT eT dAdT dT dCdCdAdT dGeGeCd</td><td>Deoxy units and MOE</td><td> 51</td><td> 28</td>

<td> 75971</td><td> 75990</td><td> 438474</td><td>AAAATGGTTTATTCCATGGC</td><td>6-8-6 MOE</td><td> 82</td><td> 28</td>

<td> 75972</td><td> 75991</td><td> 409829</td><td>AAAAATGGTTTATTCCATGG</td><td>5-10-5 MOE</td><td> 42</td><td> 29</td>

<td> 75972</td><td> 75989</td><td> 438376</td><td>AAATGGTTTATTCCATGG</td><td>5-8-5 MOE</td><td> 36</td><td> 47</td>

ES 2 634 450 T3

Example 6: Dose-dependent antisense inhibition of human PTP1B mRNA in HUVEC cells

Several antisense oligonucleotides, which showed significant antisense inhibition of PTP1B mRNA in the study described in Example 5 were further tested in HUVEC cells at various doses. Cells were seeded at a density of 2,000 cells per well and transfected by electroporation with concentrations of 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1000 nM, 2000 nM, and 4000 nM of each oligonucleotide. antisense. After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using the RTS3000 probe primer set. PTP1B mRNA levels were normalized to total RNA content, measured by RIBOGREEN®. The results are presented in Table 8 as percent inhibition of PTP1B mRNA, relative to untreated control cells.

Table 8

<td colspan="10">Dose-dependent antisense inhibition of human PTP1B in HUVEC cells</td>

<td>ISIS No</td><td>31.25 nM</td><td>62.5 nM</td><td>125.0 nM</td><td>250.0 nM</td><td>500.0 nM</td><td>1000.0 nM</td><td>2000.0 nM</td><td>4000.0 nM</td><td>IC50 (MM)</td>

<td> 142082</td><td> 15</td><td> 30</td><td> 40</td><td> 42</td><td> 71</td><td> 84</td><td> 90</td><td> 94</td><td> 0,2</td>

<td> 404173</td><td> 15</td><td> 19</td><td> 33</td><td> 54</td><td> 69</td><td> 81</td><td> 86</td><td> 93</td><td> 0,2</td>

<td> 404176</td><td> 9</td><td> 26</td><td> 34</td><td> 34</td><td> 67</td><td> 80</td><td> 88</td><td> 94</td><td> 0,3</td>

<td> 409826</td><td> 17</td><td> 16</td><td> 28</td><td> 44</td><td> 60</td><td> 73</td><td> 85</td><td> 95</td><td> 0,3</td>

<td> 410002</td><td> 0</td><td> 0</td><td> 24</td><td> 52</td><td> 54</td><td> 77</td><td> 90</td><td> 96</td><td> 0,4</td>

<td> 410003</td><td> 9</td><td> 7</td><td> 19</td><td> 46</td><td> 60</td><td> 80</td><td> 91</td><td> 95</td><td> 0,4</td>

<td> 438374</td><td> 20</td><td> 22</td><td> 40</td><td> 44</td><td> 59</td><td> 70</td><td> 79</td><td> 85</td><td> 0,3</td>

<td> 438460</td><td> 14</td><td> 21</td><td> 23</td><td> 42</td><td> 62</td><td> 78</td><td> 85</td><td> 95</td><td> 0,3</td>

<td> 438474</td><td> 27</td><td> 0</td><td> 13</td><td> 34</td><td> 42</td><td> 68</td><td> 74</td><td> 86</td><td> 0,6</td>

Example 7: Dose-dependent antisense inhibition of human PTP1B mRNA in HepG2 cells

The antisense oligonucleotides, tested in the study described in Example 6, were further tested in HepG2 cells at various doses. The cells were seeded at a density of 20,000 cells per well and transfected by electroporation with concentrations 31.25 nM, 62, 5 nM, 125 nM, 250 nM, 500 nM, 1000 nM, 2000 nM and 4000 nM of each antisense oligonucleotide, after approximately 16 hours, RNA was isolated from the cells and the PTP1B mRNA levels were measured by quantitative real-time PCR using the RTS3000 probe primer set, the PTP1B mRNA levels were normalized to the total RNA content, measured by RIBOGREEN®, the Results are presented in Table 9 as percent inhibition of PTP1B mRNA, relative to untreated control cells, mRNA levels were also analyzed using the RTS198 mono rhesus probe primer set, and the results are presented in Table 10. The start and stop sites of each oligonucleotide in rhesus monkey SEQ ID NO: 3 are presented in Table 11,

Table 9

<td colspan="10">Analysis of dose-dependent antisense inhibition of human PTP1B in HepG2 cells using RTS3000</td>

<td>ISIS No</td><td>31.25 nM</td><td>62.5 nM</td><td>125.0 nM</td><td>250.0 nM</td><td>500.0 nM</td><td>1000.0 nM</td><td>2000.0 nM</td><td>4000.0 nM</td><td>^CIfifty (p.m)</td>

<td> 142082</td><td> 0</td><td> 0</td><td> 7</td><td> 0</td><td> 26</td><td> 38</td><td> 60</td><td> 82</td><td> 1,4</td>

<td> 404173</td><td> 2</td><td> 0</td><td> 1</td><td> 19</td><td> 0</td><td> 29</td><td> 47</td><td> 80</td><td> 1,9</td>

<td> 404176</td><td> 0</td><td> 0</td><td> 5</td><td> 13</td><td> 2</td><td> 33</td><td> 62</td><td> 79</td><td> 1,7</td>

<td> 409826</td><td> 0</td><td> 0</td><td> 0</td><td> 2</td><td> 15</td><td> 29</td><td> 46</td><td> 76</td><td> 1,9</td>

<td> 410002</td><td> 13</td><td> 6</td><td> 0</td><td> 11</td><td> 8</td><td> 28</td><td> 44</td><td> 75</td><td> 2,0</td>

<td> 410003</td><td> 0</td><td> 0</td><td> 9</td><td> 11</td><td> 22</td><td> 33</td><td> 30</td><td> 83</td><td> 1,9</td>

<td> 438374</td><td> 0</td><td> 0</td><td> 17</td><td> 11</td><td> 23</td><td> 38</td><td> 33</td><td> 61</td><td> 2,9</td>

<td> 438460</td><td> 4</td><td> 0</td><td> 10</td><td> 11</td><td> 9</td><td> 26</td><td> 52</td><td> 79</td><td> 1,8</td>

<td> 438474</td><td> 0</td><td> 0</td><td> 2</td><td> 11</td><td> 6</td><td> 20</td><td> 52</td><td> 54</td><td> 2,8</td>

ES 2 634 450 T3

Table 10

<td colspan="10">Analysis of dose-dependent antisense inhibition of human PTP1B in HepG2 cells using RTS198</td>

<td>ISIS No</td><td>31.25 nM</td><td>62.5 nM</td><td>125.0 nM</td><td>250.0 nM</td><td>500.0 nM</td><td>1000.0 nM</td><td>2000.0 nM</td><td>4000.0 nM</td><td>^CI50 (MM)</td>

<td> 142082</td><td> 14</td><td> 19</td><td> 2</td><td> 0</td><td> 80</td><td> 41</td><td> 63</td><td> 80</td><td> 1,5</td>

<td> 404173</td><td> 0</td><td> 0</td><td> 2</td><td> 0</td><td> 16</td><td> 26</td><td> 60</td><td> 83</td><td> 1,6</td>

<td> 404176</td><td> 0</td><td> 0</td><td> 0</td><td> 5</td><td> 0</td><td> 31</td><td> 59</td><td> 80</td><td> 1,9</td>

<td> 409826</td><td> 0</td><td> 0</td><td> 0</td><td> 16</td><td> 23</td><td> 10</td><td> 49</td><td> 72</td><td> 2,3</td>

<td> 410002</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 0</td><td> 40</td><td> 100</td><td> &gt; 4,0</td>

<td> 410003</td><td> 0</td><td> 1</td><td> 12</td><td> 0</td><td> 10</td><td> 41</td><td> 51</td><td> 82</td><td> 1,6</td>

<td> 438374</td><td> 0</td><td> 0</td><td> 0</td><td> 9</td><td> 43</td><td> 22</td><td> 49</td><td> 55</td><td> 2,8</td>

<td> 438460</td><td> 0</td><td> 0</td><td> 0</td><td> 9</td><td> 30</td><td> 42</td><td> 47</td><td> 81</td><td> 1,4</td>

<td> 438474</td><td> 2</td><td> 0</td><td> 9</td><td> 38</td><td> 19</td><td> 31</td><td> 49</td><td> 60</td><td> 2,5</td>

Table 11

<td colspan="4">PTP1B Targeted Antisense Oligonucleotide Target Sites in the Rhesus Monkey Gene Sequence (SEQ ID NO: 3)</td>

<td>OligoID</td><td>Start site</td><td>Stop site</td><td>SEQ ID NO</td>

<td> 142082</td><td> 4495</td><td> 4514</td><td> 27</td>

<td> 404173</td><td> 4494</td><td> 4513</td><td> 26</td>

<td> 404176</td><td> 3571</td><td> 3590</td><td> 14</td>

<td> 409826</td><td> 4491</td><td> 4510</td><td> 23</td>

<td> 410002</td><td> 4494</td><td> 4513</td><td> 26</td>

<td> 410003</td><td> 4495</td><td> 4514</td><td> 27</td>

<td> 438374</td><td> 4495</td><td> 4512</td><td> 45</td>

<td> 438460</td><td> 4491</td><td> 4510</td><td> 23</td>

<td> 438474</td><td> 4496</td><td> 4515</td><td> 28</td>

Example 8: Dose-dependent antisense inhibition of human PTP1B mRNA in HepG2 cells

Short antisense oligonucleotides to the ISIS 142082 target site were designed. The target sites, motifs, and sequence details of these shortmers are presented in Table 12. These antisense oligonucleotides were tested in HepG2 cells at various doses. Some of the antisense oligonucleotides from the study described in Example 7 were included in the assay for comparison. Cells were seeded at a density of 20,000 cells per well and transfected by electroporation with concentrations 78.125 nM, 156.25 nM, 312.5 nM, 625 nM, 1250 nM, 2500 nM, 5000 nM and 10,000 nM of each antisense oligonucleotide. . After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using the RTS3000 probe primer set. PTP1B mRNA levels were normalized to total RNA content, measured by RIBOGREEN®. The results are presented in Table 13 as the percent inhibition of PTP1B mRNA, relative to untreated control cells.

Table 12

<td colspan="6">Target sites of antisense oligonucleotides directed to SEQ ID NO: 1</td>

<td>ISIS No</td><td>Start site</td><td>Stop site</td><td>Sequence</td><td>Reason</td><td>SEQ ID NO</td>

<td> 142082</td><td> 3291</td><td> 3310</td><td>AAATGGTTTATTCCATGGCC</td><td> 5-10-5</td><td> 27</td>

<td> 446431</td><td> 3292</td><td> 3309</td><td>AATGGTTTATTCCATGGC</td><td> 4-10-4</td><td> 46</td>

<td> 446432</td><td> 3293</td><td> 3308</td><td>ATGGTTTATTCCATGG</td><td> 3-10-3</td><td> 48</td>

ES 2 634 450 T3

Table 13

Dose-dependent antisense inhibition of human PTP1B in HepG2 cells

<td rowspan="2">ISIS No</td><td> 78,125</td><td> 156,25</td><td> 312,5</td><td> 625,0</td><td> 1250,0</td><td> 2500,0</td><td> 5000,0</td><td> 10000,0</td><td rowspan="2">^CIfifty (p.m)</td>

<td>nM</td><td>nM</td><td>nM</td><td>nM</td><td>nM</td><td>nM</td><td>nM</td><td>nM</td>

<td> 113715</td><td> 6</td><td> 12</td><td> 17</td><td> 17</td><td> 16</td><td> 45</td><td> 61</td><td> 86</td><td> 3,3</td>

<td> 142082</td><td> 14</td><td> 34</td><td> 23</td><td> 47</td><td> 60</td><td> 81</td><td> 86</td><td> 90</td><td> 0,8</td>

<td> 404173</td><td> 8</td><td> 22</td><td> 29</td><td> 45</td><td> 60</td><td> 73</td><td> 83</td><td> 88</td><td> 0,8</td>

<td> 409826</td><td> 19</td><td> 18</td><td> 41</td><td> 56</td><td> 75</td><td> 84</td><td> 89</td><td> 91</td><td> 0,5</td>

<td> 410003</td><td> 0</td><td> 0</td><td> 19</td><td> 39</td><td> 55</td><td> 81</td><td> 91</td><td> 92</td><td> 1,0</td>

<td> 446431</td><td> 10</td><td> 24</td><td> 26</td><td> 38</td><td> 57</td><td> 74</td><td> 85</td><td> 92</td><td> 1,0</td>

<td> 446432</td><td> 0</td><td> 8</td><td> 10</td><td> 10</td><td> 10</td><td> 26</td><td> 40</td><td> 67</td><td> 6,0</td>

Example 9: Dose-dependent antisense inhibition of PTP1B mRNA in LLC-MK2 cells

The antisense oligonucleotides from the study described in Example 8 are also cross-reactive with the sequence of the rhesus monkey PTP1B gene (SEQ ID NO: 3) and were further tested in rhesus monkey LLC-MK2 cells at various doses. Cells were seeded at a density of 25,000 cells per well and transfected using electroporation with concentrations 78.125 nM, 156.25 nM, 312.5 nM, 625 nM, 1250 nM, 2500 nM, 5000 nM, and 10,000 nM of each oligonucleotide. antisense. After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using the RTS198 probe primer set. PTP1B mRNA levels were normalized to total RNA content, measured by RIBOGREEN®. The results are presented in Table 14 as the percent inhibition of PTP1B mRNA, relative to untreated control cells. The start and stop sites of each oligonucleotide in SEQ ID N °: 3 rhesus monkey are presented in Table 15.

Table 14

Dose-dependent antisense inhibition of PTP1B mRNA in LLC-MK2 cells

<td rowspan="2">ISIS No</td><td> 78,125</td><td> 156,25</td><td> 312,5</td><td> 625,0</td><td> 1250,0</td><td> 2500,0</td><td> 5000,0</td><td> 10000,0</td><td rowspan="2">^CI50 (MM)</td>

<td>nM</td><td>nM</td><td>nM</td><td>nM</td><td>nM</td><td>nM</td><td>nM</td><td>mM</td>

<td> 113715</td><td> 0</td><td> 0</td><td> 4</td><td> 13</td><td> 27</td><td> 53</td><td> 57</td><td> 70</td><td> 3.3</td>

<td> 142082</td><td> 2</td><td> 12</td><td> 31</td><td> 41</td><td> 69</td><td> 74</td><td> 80</td><td> 92</td><td> 0.9</td>

<td> 404173</td><td> 2</td><td> 0</td><td> 22</td><td> 29</td><td> 36</td><td> 61</td><td> 78</td><td> 84</td><td> 1.6</td>

<td> 409826</td><td> 12</td><td> 0</td><td> 19</td><td> 38</td><td> 66</td><td> 66</td><td> 82</td><td> 92</td><td> 1.2</td>

<td> 410003</td><td> 0</td><td> 0</td><td> 0</td><td> 26</td><td> 32</td><td> 65</td><td> 81</td><td> 91</td><td> 1.8</td>

<td> 446431</td><td> 0</td><td> 0</td><td> 9</td><td> 32</td><td> 45</td><td> 70</td><td> 79</td><td> 58</td><td> 1.4</td>

<td> 446432</td><td> 0</td><td> 0</td><td> 7</td><td> 16</td><td> 10</td><td> 20</td><td> 26</td><td> 43</td><td> 37.0</td>

Table 15

<td colspan="5">Target sites of antisense oligonucleotides directed to SEQ ID NO: 3</td>

<td>ISIS No</td><td>Site of beginning</td><td>Site of stop</td><td>Sequence</td><td>SEQ ID NO</td>

<td> 113715</td><td> 1035</td><td> 1054</td><td>GCTCCTTCCACTGATCCTGC</td><td> 10</td>

<td> 142082</td><td> 4495</td><td> 4514</td><td>AAATGGTTTATTCCATGGCC</td><td> 27</td>

<td> 404173</td><td> 4494</td><td> 4513</td><td>AATGGTTTATTCCATGGCCA</td><td> 26</td>

<td> 409826</td><td> 4491</td><td> 4510</td><td>GGTTTATTCCATGGCCATTG</td><td> 23</td>

<td> 410003</td><td> 4495</td><td> 4514</td><td>AAATGGTTTATTCCATGGCC</td><td> 27</td>

<td> 446431</td><td> 4496</td><td> 4513</td><td>AATGGTTTATTCCATGGC</td><td> 46</td>

<td> 446432</td><td> 4497</td><td> 4512</td><td>ATGGTTTATTCCATGG</td><td> 48</td>

Example 10: Dose-dependent antisense inhibition of human PTP1B mRNA in HUVEC cells

The antisense oligonucleotides, tested in the study described in Examples 8 and 9, were further tested in HUVEC cells at various doses. Cells were seeded at a density of 20,000 cells per well and transfected by electroporation with concentrations 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM,

ES 2 634 450 T3

1000 nM, 2000 nM and 4000 nM of each antisense oligonucleotide. After approximately 16 hours, it was isolated

Cell RNA and mRNA PTP1B levels were measured by quantitative real-time PCR using the RTS3000 probe primer set. PTP1B mRNA levels were normalized to total RNA content, measured by RIBOGREEN®. The results are presented in Table 16 as the percentage of inhibition of

PTP1B mRNA, relative to untreated control cells.

Table 16

<td colspan="10">Dose-dependent antisense inhibition of human PTP1B in HUVEC cells</td>

<td>ISIS No</td><td>31.25 nM</td><td>62.5 nM</td><td>125.0 nM</td><td>250.0 nM</td><td>500.0 nM</td><td>1000.0 nM</td><td>2000.0 nM</td><td>4000.0 nM</td><td>CIsü (MM)</td>

<td> 113715</td><td> 10</td><td> 0</td><td> 22</td><td> 24</td><td> 65</td><td> 86</td><td> 92</td><td> 98</td><td> 0,2</td>

<td> 142082</td><td> 52</td><td> 78</td><td> 89</td><td> 93</td><td> 95</td><td> 96</td><td> 98</td><td> 98</td><td> &lt;0,3</td>

<td> 404173</td><td> 35</td><td> 66</td><td> 80</td><td> 89</td><td> 95</td><td> 98</td><td> 97</td><td> 97</td><td> 0,05</td>

<td> 409826</td><td> 57</td><td> 72</td><td> 82</td><td> 64</td><td> 97</td><td> 98</td><td> 98</td><td> 98</td><td> &lt;0,3</td>

<td> 410003</td><td> 43</td><td> 47</td><td> 75</td><td> 84</td><td> 48</td><td> 95</td><td> 96</td><td> 91</td><td> 0,05</td>

<td> 446431</td><td> 33</td><td> 63</td><td> 75</td><td> 87</td><td> 96</td><td> 97</td><td> 98</td><td> 98</td><td> 0,05</td>

<td> 446432</td><td> 0</td><td> 11</td><td> 30</td><td> 45</td><td> 66</td><td> 79</td><td> 85</td><td> 76</td><td> 0,3</td>

Example 11: Dose-dependent antisense inhibition of PTP1B mRNA in primary cynomolgus hepatocytes

The study antisense oligonucleotides described in Examples 8-10 were further tested in cynomolgus primary hepatocytes at various doses. Cells were seeded at a density of 35,000 cells per well and transfected using electroporation with concentrations 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1,000 nM, 2,000 nM, and 4,000 nM of each oligonucleotide. antisense. After approximately 16 hours, RNA was isolated from the cells and PTP1B mRNA levels were measured by quantitative real-time PCR using the RTS198 probe primer set. PTP1B mRNA levels were normalized to total RNA content, measured by RIBOGREEN®. The results are presented in Table 17 as the percent inhibition of PTP1B mRNA, relative to untreated control cells.

Table 17

<td colspan="10">Dose-dependent antisense inhibition of PTP1B mRNA in cynomolgus primary hepatocytes</td>

<td>ISIS No</td><td>31.25 nM</td><td>62.5 nM</td><td>125.0 nM</td><td>250.0 nM</td><td>500.0 nM</td><td>1000.0 nM</td><td>2000.0 nM</td><td>4000.0 nM</td><td>^CI5ü (MM)</td>

<td> 113715</td><td> 4</td><td> 26</td><td> 25</td><td> 43</td><td> 46</td><td> 73</td><td> 82</td><td> 95</td><td> 0,4</td>

<td> 142082</td><td> 25</td><td> 37</td><td> 50</td><td> 67</td><td> 74</td><td> 87</td><td> 86</td><td> 88</td><td> 0,1</td>

<td> 404173</td><td> 18</td><td> 20</td><td> 43</td><td> 54</td><td> 67</td><td> 82</td><td> 85</td><td> 89</td><td> 0,2</td>

<td> 409826</td><td> 34</td><td> 47</td><td> 51</td><td> 65</td><td> 76</td><td> 87</td><td> 88</td><td> 90</td><td> 0,1</td>

<td> 410003</td><td> 8</td><td> 20</td><td> 44</td><td> 53</td><td> 68</td><td> 79</td><td> 80</td><td> 83</td><td> 0,2</td>

<td> 446431</td><td> 9</td><td> 14</td><td> 35</td><td> 54</td><td> 57</td><td> 79</td><td> 79</td><td> 88</td><td> 0,3</td>

<td> 446432</td><td> 4</td><td> 0</td><td> 1</td><td> 3</td><td> 0</td><td> 11</td><td> 6</td><td> 37</td><td> &gt; 4,0</td>

Example 12: The tolerability of antisense oligonucleotides targeting human PTP1B in a mouse model

ISIS oligonucleotides that demonstrated dose-dependent inhibition in the studies described in Examples 8-11 were evaluated for tolerability in a mouse model by monitoring changes in the levels of various metabolic markers in CD1 mice. Two additional oligonucleotides ISIS 446433 (4-10-4 MOE; 5'GTTTATTCCATGGCCATT-3 '(SEQ ID NO: 42); target start site in SEQ ID NO: 1 is 3288) and ISIS 446434 (310-3; 5 '-TTTATTCCATGGCCAT-3' (SEQ ID NO: 49); target start site in SEQ ID NO: 1 is 3289) were designed as shortmers to ISIS 409826 (target start site in SEQ ID NO: 1 is 3287) and also were evaluated in this study.

Treatment

CD1 mice (available from Jackson Labs, Bar Harbor, ME) were kept on a 12 hour light / dark cycle and fed normal laboratory chow ad libitum (Harlan Laboratories, Indianapolis, IN). The animals were acclimatized for at least 7 days in the research center before the start of the experiment. The antisense oligonucleotides were prepared in PBS and sterilized by filtration through a 0.2 micron filter.

The oligonucleotides were dissolved in 0.9% PBS for injection.

ES 2 634 450 T3

Groups of five CD1 mice were injected subcutaneously twice a week with 100 mg / kg of ISIS 142082, ISIS 373125, ISIS 404173, ISIS 409826, ISIS 410002, ISIS 410003, ISIS 438452, ISIS 438460, ISIS 446431, ISIS 446432 , ISIS 446433, or ISIS 446434 for 4 weeks. A group of five CD1 mice were injected subcutaneously twice a week with PBS for 4 weeks. This PBS group served as the control group. Blood samples were collected through tail cut. Two days after the last dose, body weights were taken, mice were sacrificed, and organs and plasma were collected for further analysis.

Body and organ weights

The body weights of the mice were measured weekly. Body weights are presented in Table 18. Liver, spleen and kidney weights were measured at the end of the study, and are presented in Table 19. The results demonstrate that none of the ISIS oligonucleotides had any adverse effect on the general health of the rats.

Table 18

<td colspan="2">Weekly antisense oligonucleotide body weights (g)</td><td>CD1 mice</td><td colspan="2">during the treatment of</td>

<td></td><td>Week 1</td><td>Week 2</td><td>Week 3</td><td>Week 4</td>

<td>PBS</td><td> 29</td><td> 31</td><td> 32</td><td> 34</td>

<td>ISIS 142082</td><td> 31</td><td> 34</td><td> 34</td><td> 36</td>

<td>ISIS 373125</td><td> 29</td><td> 31</td><td> 32</td><td> 35</td>

<td>ISIS 404173</td><td> 31</td><td> 33</td><td> 34</td><td> 36</td>

<td>ISIS 409826</td><td> 31</td><td> 34</td><td> 34</td><td> 37</td>

<td>ISIS 410002</td><td> 32</td><td> 35</td><td> 35</td><td> 36</td>

<td>ISIS 410003</td><td> 31</td><td> 34</td><td> 34</td><td> 37</td>

<td>ISIS 438452</td><td> 32</td><td> 35</td><td> 36</td><td> 39</td>

<td>ISIS 438460</td><td> 31</td><td> 34</td><td> 34</td><td> 37</td>

<td>ISIS 446431</td><td> 30</td><td> 33</td><td> 33</td><td> 36</td>

<td>ISIS 446432</td><td> 27</td><td> 30</td><td> 30</td><td> 33</td>

<td>ISIS 446433</td><td> 30</td><td> 33</td><td> 33</td><td> 37</td>

<td>ISIS 446434</td><td> 30</td><td> 33</td><td> 34</td><td> 37</td>

Table 19

Organ weights of CD1 mice after treatment with antisense oligonucleotides (g)

<td></td><td>Liver</td><td>Grease</td><td>Spleen</td><td>Kidney</td>

<td>PBS</td><td> 1,7</td><td> 0,45</td><td> 0,11</td><td> 0,53</td>

<td>ISIS 142082</td><td> 2,3</td><td> 0,33</td><td> 0,18</td><td> 0,52</td>

<td>ISIS 373125</td><td> 1,9</td><td> 0,38</td><td> 0,16</td><td> 0,53</td>

<td>ISIS 404173</td><td> 2,3</td><td> 0,41</td><td> 0,23</td><td> 0,59</td>

<td>ISIS 409826</td><td> 2,2</td><td> 0,37</td><td> 0,17</td><td> 0,54</td>

<td>ISIS 410002</td><td> 1,9</td><td> 0,22</td><td> 0,30</td><td> 0,76</td>

<td>ISIS 410003</td><td> 2,1</td><td> 0,44</td><td> 0,22</td><td> 0,60</td>

<td>ISIS 438452</td><td> 2,2</td><td> 0,42</td><td> 0,18</td><td> 0,55</td>

<td>ISIS 438460</td><td> 2,2</td><td> 0,34</td><td> 0,17</td><td> 0,52</td>

<td>ISIS 446431</td><td> 2,1</td><td> 0,34</td><td> 0,19</td><td> 0,53</td>

<td>ISIS 446432</td><td> 1,7</td><td> 0,31</td><td> 0,13</td><td> 0,46</td>

<td>ISIS 446433</td><td> 2,2</td><td> 0,35</td><td> 0,17</td><td> 0,53</td>

<td>ISIS 446434</td><td> 2,2</td><td> 0,36</td><td> 0,18</td><td> 0,56</td>

Liver function

To evaluate the effect of ISIS oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) are

ES 2 634 450 T3 measured twice a week. The results are presented in Tables 20 and 21, and indicate that most of the ISIS oligonucleotides were considered tolerable in mice, as demonstrated by their liver transaminase profile.

Table 20

<td colspan="4">Effect of antisense oligonucleotide treatment on ALT (IU / L) of CD1 mice</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td>

<td>PBS</td><td> 27</td><td> 26</td><td> 20</td>

<td>ISIS 142082</td><td> 38</td><td> 35</td><td> 105</td>

<td>ISIS 373125</td><td> 30</td><td> 27</td><td> 51</td>

<td>ISIS 404173</td><td> 30</td><td> 31</td><td> 124</td>

<td>ISIS 409826</td><td> 26</td><td> 34</td><td> 236</td>

<td>ISIS 410002</td><td> 27</td><td> 203</td><td> 219</td>

<td>ISIS 410003</td><td> 31</td><td> 29</td><td> 99</td>

<td>ISIS 438452</td><td> 32</td><td> 40</td><td> 217</td>

<td>ISIS 438460</td><td> 30</td><td> 40</td><td> 216</td>

<td>ISIS 446431</td><td> 29</td><td> 38</td><td> 114</td>

<td>ISIS 446432</td><td> 26</td><td> 27</td><td> 35</td>

<td>ISIS 446433</td><td> 25</td><td> 76</td><td> 115</td>

<td>ISIS 446434</td><td> 23</td><td> 44</td><td> 146</td>

Table 21

<td colspan="4">Effect of treatment with AST antisense oligonucleotide (IU / L) of CD1 mice</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td>

<td>PBS</td><td> 54</td><td> 62</td><td> 50</td>

<td>ISIS 142082</td><td> 75</td><td> 59</td><td> 103</td>

<td>ISIS 373125</td><td> 55</td><td> 57</td><td> 97</td>

<td>ISIS 404173</td><td> 52</td><td> 61</td><td> 117</td>

<td>ISIS 409826</td><td> 49</td><td> 59</td><td> 192</td>

<td>ISIS 410002</td><td> 51</td><td> 151</td><td> 417</td>

<td>ISIS 410003</td><td> 64</td><td> 47</td><td> 122</td>

<td>ISIS 438452</td><td> 59</td><td> 56</td><td> 157</td>

<td>ISIS 438460</td><td> 65</td><td> 56</td><td> 217</td>

<td>ISIS 446431</td><td> 56</td><td> 66</td><td> 140</td>

<td>ISIS 446432</td><td> 50</td><td> 51</td><td> 74</td>

<td>ISIS 446433</td><td> 54</td><td> 87</td><td> 121</td>

<td>ISIS 446434</td><td> 42</td><td> 64</td><td> 132</td>

Plasma glucose levels

To evaluate the effect of ISIS oligonucleotides on glucose metabolism, plasma glucose levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in Table 22, expressed in mg / dL. None of the ISIS oligonucleotides had any adverse effect on glucose metabolism in the mice.

ES 2 634 450 T3

Table 22

<td colspan="4">Effect of antisense oligonucleotide treatment on plasma glucose levels in CD1 mice</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td>

<td>PBS</td><td> 175</td><td> 188</td><td> 182</td>

<td>ISIS 142082</td><td> 195</td><td> 178</td><td> 161</td>

<td>ISIS 373125</td><td> 187</td><td> 201</td><td> 177</td>

<td>ISIS 404173</td><td> 185</td><td> 213</td><td> 168</td>

<td>ISIS 409826</td><td> 183</td><td> 187</td><td> 187</td>

<td>ISIS 410002</td><td> 183</td><td> 164</td><td> 137</td>

<td>ISIS 410003</td><td> 198</td><td> 218</td><td> 168</td>

<td>ISIS 438452</td><td> 168</td><td> 197</td><td> 175</td>

<td>ISIS 438460</td><td> 212</td><td> 203</td><td> 169</td>

<td>ISIS 446431</td><td> 192</td><td> 188</td><td> 148</td>

<td>ISIS 446432</td><td> 194</td><td> 193</td><td> 175</td>

<td>ISIS 446433</td><td> 216</td><td> 198</td><td> 151</td>

<td>ISIS 446434</td><td> 199</td><td> 189</td><td> 159</td>

Plasma lipids and triglyceride levels

To evaluate the effect of ISIS oligonucleotides on cholesterol and triglyceride metabolism, plasma levels of each were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in Tables 23 and 24, expressed in mg / dL. Most ISIS oligonucleotides have no adverse effect on lipid metabolism in mice.

Table 23

<td colspan="4">Effect of antisense oligonucleotide treatment on plasma cholesterol levels in CD1 mice</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td>

<td>PBS</td><td> 162</td><td> 145</td><td> 153</td>

<td>ISIS 142082</td><td> 156</td><td> 136</td><td> 126</td>

<td>ISIS 373125</td><td> 137</td><td> 106</td><td> 104</td>

<td>ISIS 404173</td><td> 162</td><td> 124</td><td> 154</td>

<td>ISIS 409826</td><td> 153</td><td> 142</td><td> 146</td>

<td>ISIS 410002</td><td> 136</td><td> 63</td><td> 47</td>

<td>ISIS 410003</td><td> 160</td><td> 131</td><td> 96</td>

<td>ISIS 438452</td><td> 143</td><td> 128</td><td> 121</td>

<td>ISIS 438460</td><td> 146</td><td> 140</td><td> 129</td>

<td>ISIS 446431</td><td> 139</td><td> 124</td><td> 116</td>

<td>ISIS 446432</td><td> 146</td><td> 135</td><td> 137</td>

<td>ISIS 446433</td><td> 152</td><td> 144</td><td> 145</td>

<td>ISIS 446434</td><td> 147</td><td> 147</td><td> 144</td>

ES 2 634 450 T3

Table 24

<td colspan="4">Effect of antisense oligonucleotide treatment on plasma triglyceride levels in CD1 mice</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td>

<td>PBS</td><td> 153</td><td> 153</td><td> 162</td>

<td>ISIS 142082</td><td> 170</td><td> 153</td><td> 114</td>

<td>ISIS 373125</td><td> 142</td><td> 116</td><td> 112</td>

<td>ISIS 404173</td><td> 195</td><td> 140</td><td> 107</td>

<td>ISIS 409826</td><td> 182</td><td> 120</td><td> 80</td>

<td>ISIS 410002</td><td> 137</td><td> 99</td><td> 51</td>

<td>ISIS 410003</td><td> 152</td><td> 138</td><td> 102</td>

<td>ISIS 438452</td><td> 123</td><td> 134</td><td> 93</td>

<td>ISIS 438460</td><td> 165</td><td> 146</td><td> 85</td>

<td>ISIS 446431</td><td> 131</td><td> 160</td><td> 123</td>

<td>ISIS 446432</td><td> 168</td><td> 194</td><td> 136</td>

<td>ISIS 446433</td><td> 186</td><td> 117</td><td> 133</td>

<td>ISIS 446434</td><td> 145</td><td> 101</td><td> 84</td>

Cytokine levels

To evaluate the effect of ISIS oligonucleotides on factors involved in inflammation, blood was collected after the end of the treatment period for measurement of cytokine levels. The samples were sent to Aushon Biosystems (Woburn, MA) for analysis. The levels of murine IL-6, Je, MIP-Ια, and TNF-α were measured using the murine antibodies. The results are presented in Table 25. Most of the ISIS oligonucleotides have no adverse effect on the cytokine levels of the mice.

Table 25

<td colspan="5">Effect of antisense oligonucleotide treatment on plasma cytokine levels in CD1 mice</td>

<td></td><td>mIL-6</td><td>MJE</td><td>mMIP-Ια</td><td>mTNF-α</td>

<td>PBS</td><td> 250</td><td> 20</td><td> 1</td><td> 4</td>

<td>ISIS 142082</td><td> 225</td><td> 145</td><td> 4</td><td> 23</td>

<td>ISIS 373125</td><td> 77</td><td> 91</td><td> 3</td><td> 17</td>

<td>ISIS 404173</td><td> 88</td><td> 155</td><td> 1</td><td> 24</td>

<td>ISIS 409826</td><td> 33</td><td> 112</td><td> 3</td><td> 15</td>

<td>ISIS 410002</td><td> 113</td><td> 225</td><td> 28</td><td> 84</td>

<td>ISIS 410003</td><td> 111</td><td> 138</td><td> 4</td><td> 24</td>

<td>ISIS 438452</td><td> 62</td><td> 148</td><td> 1</td><td> 15</td>

<td>ISIS 438460</td><td> 64</td><td> 184</td><td> 2</td><td> 9</td>

<td>ISIS 446431</td><td> 52</td><td> 170</td><td> 1</td><td> 15</td>

<td>ISIS 446432</td><td> 57</td><td> 75</td><td> 1</td><td> 3</td>

<td>ISIS 446433</td><td> 64</td><td> 138</td><td> 3</td><td> 61</td>

<td>ISIS 446434</td><td> 59</td><td> 127</td><td> 0</td><td> 21</td>

Example 13: The tolerability of antisense oligonucleotides targeting human PTP1B in a rat model

The ISIS oligonucleotides from the study described in Example 12 were further evaluated for tolerability in a rat model by monitoring changes in the levels of various metabolic markers in Sprague Dawley rats.

Treatment

Sprague Dawley rats were kept on a 12 hour light / dark cycle and were fed ad libitum on normal laboratory chow (Harlan Laboratories, Indianapolis, IN). The animals were acclimatized for at least 7 days in the research center before the start of the experiment. The antisense oligonucleotides are

ES 2 634 450 T3 prepared in PBS and sterilized by filtration through a 0.2 micron filter. The oligonucleotides were dissolved in 0.9% PBS for injection.

Groups of four rats each were injected subcutaneously twice a week with ISIS 142082, ISIS 373125, ISIS 404173, ISIS 409826, ISIS 410002, ISIS 410003, ISIS 438452, ISIS 438460, ISIS 446431, ISIS 446432, ISIS 446433 or ISIS 446434 at a dose of 50 mg / kg twice weekly for 4 weeks, followed by a dose of 30 mg / kg twice weekly for 8 weeks. A group of four rats was injected subcutaneously twice a week with PBS for 12 weeks. This PBS group served as the control group. Blood samples were collected through tail cut. Two days after the last dose, body weights were taken, rats were sacrificed, and organs and plasma were collected for further analysis.

Body and organ weights

The body weights of the rats were measured weekly. Body weights are presented in Table 26. Liver, spleen and kidney weights were measured at the end of the study, and are presented in Table 27. 'n / a' indicates that no data is available for that particular group in that particular moment because all the rats in the group have been euthanized before the moment.

Table 26

<td colspan="8">Biweekly Body Weights of Sprague Dawley Rats During Antisense Oligonucleotide Treatment (g)</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td><td>Week 6</td><td>Week 8</td><td>Week 10</td><td>Week 12</td>

<td>PBS</td><td> 288</td><td> 369</td><td> 405</td><td> 442</td><td> 463</td><td> 500</td><td> 495</td>

<td>ISIS 142082</td><td> 295</td><td> 348</td><td> 318</td><td> 345</td><td> 337</td><td> 347</td><td> 345</td>

<td>ISIS 373125</td><td> 304</td><td> 385</td><td> 399</td><td> 419</td><td> 427</td><td> 421</td><td> 448</td>

<td>ISIS 404173</td><td> 294</td><td> 346</td><td> 352</td><td> 377</td><td> 384</td><td> 391</td><td> 401</td>

<td>ISIS 409826</td><td> 292</td><td> 346</td><td> 350</td><td> 355</td><td> 356</td><td> 373</td><td> 356</td>

<td>ISIS 410002</td><td> 297</td><td> 333</td><td> 323</td><td> 324</td><td> 306</td><td> 335</td><td>n / a</td>

<td>ISIS 410003</td><td> 299</td><td> 341</td><td> 328</td><td> 320</td><td> 307</td><td> 305</td><td> 301</td>

<td>ISIS 438452</td><td> 301</td><td> 327</td><td> 335</td><td> 333</td><td> 327</td><td> 347</td><td> 332</td>

<td>ISIS 438460</td><td> 304</td><td> 345</td><td> 346</td><td> 347</td><td> 356</td><td> 377</td><td>n / a</td>

<td>ISIS 446431</td><td> 307</td><td> 376</td><td> 340</td><td> 357</td><td> 353</td><td> 357</td><td> 349</td>

<td>ISIS 446432</td><td> 287</td><td> 340</td><td> 344</td><td> 363</td><td> 372</td><td> 399</td><td> 404</td>

<td>ISIS 446433</td><td> 298</td><td> 331</td><td> 318</td><td> 354</td><td>n / A</td><td>n / A</td><td>n / A</td>

<td>ISIS 446434</td><td> 303</td><td> 366</td><td> 356</td><td>n / A</td><td>n / A</td><td>n / A</td><td>n / A</td>

Table 27

<td>Antisense oligonucleotide organ weights (g)</td><td colspan="4">Sprague Dawley rats during treatment of</td>

<td></td><td>Liver</td><td>Grease</td><td>Spleen</td><td>Kidney</td>

<td>PBS</td><td> 15,9</td><td> 2,1</td><td> 0,8</td><td> 3,6</td>

<td>ISIS 142082</td><td> 21,8</td><td> 0,7</td><td> 4,5</td><td> 5,2</td>

<td>ISIS 373125</td><td> 17,9</td><td> 1,1</td><td> 1,9</td><td> 3,4</td>

<td>ISIS 404173</td><td> 17,7</td><td> 1,1</td><td> 2,3</td><td> 4,3</td>

<td>ISIS 409826</td><td> 19,8</td><td> 0,5</td><td> 3,6</td><td> 4,4</td>

<td>ISIS 410003</td><td> 18,7</td><td> 0,5</td><td> 3,8</td><td> 3,5</td>

<td>ISIS 438452</td><td> 17,3</td><td> 0,6</td><td> 3,1</td><td> 3,8</td>

<td>ISIS 446431</td><td> 22,1</td><td> 0,4</td><td> 6,1</td><td> 5,3</td>

<td>ISIS 446432</td><td> 18,1</td><td> 1,2</td><td> 3,3</td><td> 3,8</td>

Liver function

To evaluate the effect of ISIS oligonucleotides on liver function, plasma transaminase levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) are

ES 2 634 450 T3 measured twice a week. Plasma bilirubin levels (mg / dL) were also measured using the same clinical chemistry analyzer. The results are presented in Tables 28, 29 and 30. 'n / a' indicates that no data is available for that particular group at that particular time point because all the rats in the group have been euthanized prior to the point of weather.

Table 28

<td colspan="8">Effect of antisense oligonucleotide treatment on ALT (IU / L) of Sprague Dawley rats</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td><td>Week 6</td><td>Week 8</td><td>Week 10</td><td>Week 12</td>

<td>PBS</td><td> 58</td><td> 68</td><td> 54</td><td> 48</td><td> 48</td><td> 46</td><td> 46</td>

<td>ISIS 142082</td><td> 54</td><td> 75</td><td> 40</td><td> 44</td><td> 49</td><td> 62</td><td> 57</td>

<td>ISIS 373125</td><td> 57</td><td> 61</td><td> 60</td><td> 48</td><td> 48</td><td> 45</td><td> 38</td>

<td>ISIS 404173</td><td> 49</td><td> 52</td><td> 53</td><td> 41</td><td> 51</td><td> 53</td><td> 42</td>

<td>ISIS 409826</td><td> 51</td><td> 59</td><td> 56</td><td> 50</td><td> 42</td><td> 37</td><td> 40</td>

<td>ISIS 410002</td><td> 46</td><td> 65</td><td> 75</td><td> 73</td><td> 103</td><td> 126</td><td>n / A</td>

<td>ISIS 410003</td><td> 49</td><td> 78</td><td> 62</td><td> 49</td><td> 61</td><td> 59</td><td> 66</td>

<td>ISIS 438452</td><td> 46</td><td> 57</td><td> 58</td><td> 53</td><td> 51</td><td> 52</td><td> 50</td>

<td>ISIS 438460</td><td> 49</td><td> 88</td><td> 162</td><td> 96</td><td> 114</td><td> 91</td><td>n / A</td>

<td>ISIS 446431</td><td> 51</td><td> 57</td><td> 45</td><td> 45</td><td> 40</td><td> 55</td><td> 49</td>

<td>ISIS 446432</td><td> 52</td><td> 59</td><td> 48</td><td> 43</td><td> 44</td><td> 49</td><td> 46</td>

<td>ISIS 446433</td><td> 53</td><td> 120</td><td> 65</td><td> 86</td><td>n / A</td><td>n / A</td><td>n / A</td>

<td>ISIS 446434</td><td> 53</td><td> 76</td><td> 161</td><td>n / A</td><td>n / A</td><td>n / A</td><td>n / A</td>

Table 29

<td colspan="8">Effect of treatment with AST antisense oligonucleotide (IU / L) of Sprague Dawley rats</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td><td>Week 6</td><td>Week 8</td><td>Week 10</td><td>Week 12</td>

<td>PBS</td><td> 84</td><td> 92</td><td> 86</td><td> 79</td><td> 91</td><td> 74</td><td> 81</td>

<td>ISIS 142082</td><td> 87</td><td> 89</td><td> 86</td><td> 126</td><td> 136</td><td> 154</td><td> 149</td>

<td>ISIS 373125</td><td> 79</td><td> 72</td><td> 93</td><td> 124</td><td> 111</td><td> 95</td><td> 81</td>

<td>ISIS 404173</td><td> 75</td><td> 69</td><td> 88</td><td> 75</td><td> 89</td><td> 96</td><td> 83</td>

<td>ISIS 409826</td><td> 75</td><td> 74</td><td> 96</td><td> 112</td><td> 108</td><td> 90</td><td> 106</td>

<td>ISIS 410002</td><td> 67</td><td> 87</td><td> 155</td><td> 173</td><td> 229</td><td> 245</td><td>n / A</td>

<td>ISIS 410003</td><td> 71</td><td> 95</td><td> 106</td><td> 136</td><td> 161</td><td> 160</td><td> 186</td>

<td>ISIS 438452</td><td> 70</td><td> 84</td><td> 104</td><td> 157</td><td> 164</td><td> 174</td><td> 167</td>

<td>ISIS 438460</td><td> 79</td><td> 122</td><td> 214</td><td> 287</td><td> 216</td><td> 172</td><td>n / A</td>

<td>ISIS 446431</td><td> 73</td><td> 79</td><td> 93</td><td> 137</td><td> 129</td><td> 158</td><td> 153</td>

<td>ISIS 446432</td><td> 80</td><td> 76</td><td> 86</td><td> 99</td><td> 96</td><td> 105</td><td> 102</td>

<td>ISIS 446433</td><td> 77</td><td> 151</td><td> 128</td><td> 234</td><td>n / a</td><td>n / a</td><td>n / a</td>

<td>ISIS 446434</td><td> 81</td><td> 137</td><td> 359</td><td>n / a</td><td>n / a</td><td>n / a</td><td>n / a</td>

ES 2 634 450 T3

Table 30

<td colspan="5">Effect of antisense oligonucleotide treatment on Dawley</td><td colspan="3">bilirubin (mg / dL) from Sprague rats</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td><td>Week 6</td><td>Week 8</td><td>Week 10</td><td>Week 12</td>

<td>PBS</td><td> 0,11</td><td> 0,15</td><td> 0,14</td><td> 0,16</td><td> 0,25</td><td> 0,16</td><td> 0,13</td>

<td>ISIS 142082</td><td> 0,12</td><td> 0,11</td><td> 0,18</td><td> 0,12</td><td> 0,12</td><td> 0,15</td><td> 0,15</td>

<td>ISIS 373125</td><td> 0,13</td><td> 0,13</td><td> 0,15</td><td> 0,36</td><td> 0,14</td><td> 0,15</td><td> 0,13</td>

<td>ISIS 404173</td><td> 0,11</td><td> 0,13</td><td> 0,14</td><td> 0,13</td><td> 0,13</td><td> 0,14</td><td> 0,10</td>

<td>ISIS 409826</td><td> 0,12</td><td> 0,12</td><td> 0,15</td><td> 0,12</td><td> 0,11</td><td> 0,10</td><td> 0,10</td>

<td>ISIS 410002</td><td> 0,11</td><td> 0,13</td><td> 0,18</td><td> 0,13</td><td> 0,19</td><td> 0,54</td><td>n / a</td>

<td>ISIS 410003</td><td> 0,12</td><td> 0,12</td><td> 0,14</td><td> 0,16</td><td> 0,14</td><td> 0,17</td><td> 0,14</td>

<td>ISIS 438452</td><td> 0,12</td><td> 0,13</td><td> 0,15</td><td> 0,13</td><td> 0,14</td><td> 0,13</td><td> 0,13</td>

<td>ISIS 438460</td><td> 0,11</td><td> 0,14</td><td> 0,22</td><td> 0,28</td><td> 0,15</td><td> 0,17</td><td>n / a</td>

<td>ISIS 446431</td><td> 0,14</td><td> 0,17</td><td> 0,19</td><td> 0,13</td><td> 0,10</td><td> 0,16</td><td> 0,16</td>

<td>ISIS 446432</td><td> 0,12</td><td> 0,14</td><td> 0,13</td><td> 0,12</td><td> 0,11</td><td> 0,14</td><td> 0,13</td>

<td>ISIS 446433</td><td> 0,12</td><td> 0,12</td><td> 0,18</td><td> 0,20</td><td>n / a</td><td>n / a</td><td>n / a</td>

<td>ISIS 446434</td><td> 0,12</td><td> 0,17</td><td> 0,20</td><td>n / a</td><td>n / a</td><td>n / a</td><td>n / a</td>

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, plasma blood urea nitrogen (BUN) levels and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in Tables 31 and 32, expressed in mg / dL. Total urine protein to creatinine ratio was also calculated and the results are presented in Table 33.

Table 31

<td colspan="8">Effect of treatment with BUN antisense oligonucleotide (mg / dl) of Sprague Dawley rats</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td><td>Week 6</td><td>Week 8</td><td>Week 10</td><td>Week 12</td>

<td>PBS</td><td> 17</td><td> 20</td><td> 20</td><td> 18</td><td> 26</td><td> 18</td><td> 16</td>

<td>ISIS 142082</td><td> 21</td><td> 23</td><td> 31</td><td> 23</td><td> 31</td><td> 24</td><td> 29</td>

<td>ISIS 373125</td><td> 21</td><td> 21</td><td> 24</td><td> 19</td><td> 31</td><td> 21</td><td> 21</td>

<td>ISIS 404173</td><td> 18</td><td> 19</td><td> 21</td><td> 19</td><td> 25</td><td> 21</td><td> 20</td>

<td>ISIS 409826</td><td> 20</td><td> 21</td><td> 24</td><td> 23</td><td> 28</td><td> 22</td><td> 26</td>

<td>ISIS 410002</td><td> 19</td><td> 22</td><td> 25</td><td> 23</td><td> 29</td><td> 32</td><td>n / a</td>

<td>ISIS 410003</td><td> 18</td><td> 20</td><td> 23</td><td> 23</td><td> 30</td><td> 29</td><td> 26</td>

<td>ISIS 438452</td><td> 19</td><td> 22</td><td> 27</td><td> 25</td><td> 29</td><td> 22</td><td> 24</td>

<td>ISIS 438460</td><td> 20</td><td> 23</td><td> 25</td><td> 26</td><td> 31</td><td> 24</td><td>n / a</td>

<td>ISIS 446431</td><td> 19</td><td> 21</td><td> 24</td><td> 23</td><td> 29</td><td> 24</td><td> 23</td>

<td>ISIS 446432</td><td> 20</td><td> 21</td><td> 24</td><td> 20</td><td> 29</td><td> 23</td><td> 19</td>

<td>ISIS 446433</td><td> 18</td><td> 21</td><td> 25</td><td> 53</td><td>n / a</td><td>n / a</td><td>n / a</td>

<td>ISIS 446434</td><td> 18</td><td> 23</td><td> 120</td><td>n / a</td><td>n / a</td><td>n / a</td><td>n / a</td>

ES 2 634 450 T3

Table 32

<td colspan="8">Effect of antisense oligonucleotide treatment on creatinine (mg / dL) of Sprague Dawley rats</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td><td>Week 6</td><td>Week 8</td><td>Week 10</td><td>Week 12</td>

<td>PBS</td><td> 0,2</td><td> 0,3</td><td> 0,4</td><td> 0,3</td><td> 0,5</td><td> 0,4</td><td> 0,3</td>

<td>ISIS 142082</td><td> 0,3</td><td> 0,3</td><td> 0,5</td><td> 0,4</td><td> 0,5</td><td> 0,5</td><td> 0,4</td>

<td>ISIS 373125</td><td> 0,3</td><td> 0,3</td><td> 0,6</td><td> 0,4</td><td> 0,6</td><td> 0,6</td><td> 0,4</td>

<td>ISIS 404173</td><td> 0,3</td><td> 0,3</td><td> 0,5</td><td> 0,4</td><td> 0,5</td><td> 0,6</td><td> 0,4</td>

<td>ISIS 409826</td><td> 0,3</td><td> 0,4</td><td> 0,6</td><td> 0,4</td><td> 0,5</td><td> 0,5</td><td> 0,4</td>

<td>ISIS 410002</td><td> 0,3</td><td> 0,3</td><td> 0,6</td><td> 0,4</td><td> 0,5</td><td> 0,5</td><td>n / a</td>

<td>ISIS 410003</td><td> 0,3</td><td> 0,3</td><td> 0,6</td><td> 0,4</td><td> 0,6</td><td> 0,6</td><td> 0,4</td>

<td>ISIS 438452</td><td> 0,3</td><td> 0,3</td><td> 0,6</td><td> 0,4</td><td> 0,5</td><td> 0,5</td><td> 0,4</td>

<td>ISIS 438460</td><td> 0,3</td><td> 0,4</td><td> 0,5</td><td> 0,3</td><td> 0,5</td><td> 0,5</td><td>n / a</td>

<td>ISIS 446431</td><td> 0,3</td><td> 0,3</td><td> 0,5</td><td> 0,4</td><td> 0,5</td><td> 0,5</td><td> 0,4</td>

<td>ISIS 446432</td><td> 0,3</td><td> 0,3</td><td> 0,6</td><td> 0,4</td><td> 0,5</td><td> 0,5</td><td> 0,4</td>

<td>ISIS 446433</td><td> 0,3</td><td> 0,3</td><td> 0,5</td><td> 0,4</td><td>n / a</td><td>n / a</td><td>n / a</td>

<td>ISIS 446434</td><td> 0,3</td><td> 0,4</td><td> 0,8</td><td>n / a</td><td>n / a</td><td>n / a</td><td>n / a</td>

Table 33

<td colspan="8">Effect of antisense oligonucleotide treatment of total urine protein on the ratio of creatinine in urine of Sprague Dawley rats</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td><td>Week 6</td><td>Week 8</td><td>Week 10</td><td>Week 12</td>

<td>PBS</td><td> 1,5</td><td> 1,4</td><td> 1,2</td><td> 1,6</td><td> 1,3</td><td> 1,2</td><td> 1,2</td>

<td>ISIS 142082</td><td> 1,2</td><td> 4,3</td><td> 4,0</td><td> 7,7</td><td> 6,6</td><td> 7,5</td><td> 7,4</td>

<td>ISIS 373125</td><td> 1,3</td><td> 3,9</td><td> 3,8</td><td> 6,7</td><td> 6,2</td><td> 8,8</td><td> 9,7</td>

<td>ISIS 404173</td><td> 1,1</td><td> 4,8</td><td> 5,5</td><td> 6,4</td><td> 7,4</td><td> 10,2</td><td> 11,9</td>

<td>ISIS 409826</td><td> 1,2</td><td> 3,7</td><td> 3,8</td><td> 5,9</td><td> 9,8</td><td> 28,8</td><td> 37,6</td>

<td>ISIS 410002</td><td> 1,2</td><td> 3,9</td><td> 4,1</td><td> 6,0</td><td> 9,7</td><td> 26,3</td><td>n / a</td>

<td>ISIS 410003</td><td> 1,3</td><td> 4,5</td><td> 5,3</td><td> 5,9</td><td> 7,6</td><td> 10,8</td><td> 18,0</td>

<td>ISIS 438452</td><td> 1,4</td><td> 3,3</td><td> 3,1</td><td> 5,1</td><td> 8,0</td><td> 9,2</td><td> 10,5</td>

<td>ISIS 438460</td><td> 1,3</td><td> 4,0</td><td> 4,5</td><td> 7,3</td><td> 16,0</td><td> 53,9</td><td>n / a</td>

<td>ISIS 446431</td><td> 1,2</td><td> 4,5</td><td> 5,0</td><td> 5,3</td><td> 7,2</td><td> 8,0</td><td> 8,8</td>

<td>ISIS 446432</td><td> 1,3</td><td> 4,2</td><td> 4,4</td><td> 6,2</td><td> 9,1</td><td> 7,6</td><td> 9,2</td>

<td>ISIS 446433</td><td> 1,1</td><td> 3,4</td><td> 5,7</td><td> 81,5</td><td>n / a</td><td>n / a</td><td>n / a</td>

<td>ISIS 446434</td><td> 1,1</td><td> 3,7</td><td> 25,8</td><td>n / a</td><td>n / a</td><td>n / a</td><td>n / a</td>

Plasma glucose levels

To evaluate the effect of ISIS oligonucleotides on glucose metabolism, plasma glucose levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in Table 34, expressed in mg / dL.

ES 2 634 450 T3

Table 34

<td colspan="8">Effect of antisense oligonucleotide treatment on plasma glucose levels in Sprague Dawley rats</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td><td>Week 6</td><td>Week 8</td><td>Week 10</td><td>Week 12</td>

<td>PBS</td><td> 150</td><td> 140</td><td> 155</td><td> 152</td><td> 163</td><td> 138</td><td> 144</td>

<td>ISIS 142082</td><td> 153</td><td> 137</td><td> 155</td><td> 145</td><td> 142</td><td> 130</td><td> 135</td>

<td>ISIS 373125</td><td> 153</td><td> 135</td><td> 136</td><td> 143</td><td> 133</td><td> 106</td><td> 135</td>

<td>ISIS 404173</td><td> 162</td><td> 138</td><td> 149</td><td> 152</td><td> 145</td><td> 144</td><td> 154</td>

<td>ISIS 409826</td><td> 155</td><td> 141</td><td> 150</td><td> 145</td><td> 143</td><td> 132</td><td> 135</td>

<td>ISIS 410002</td><td> 152</td><td> 139</td><td> 148</td><td> 151</td><td> 130</td><td> 124</td><td>n / a</td>

<td>ISIS 410003</td><td> 152</td><td> 138</td><td> 146</td><td> 140</td><td> 132</td><td> 126</td><td> 143</td>

<td>ISIS 438452</td><td> 166</td><td> 134</td><td> 162</td><td> 153</td><td> 135</td><td> 143</td><td> 147</td>

<td>ISIS 438460</td><td> 166</td><td> 140</td><td> 151</td><td> 156</td><td> 150</td><td> 130</td><td>n / a</td>

<td>ISIS 446431</td><td> 154</td><td> 143</td><td> 155</td><td> 147</td><td> 153</td><td> 139</td><td> 145</td>

<td>ISIS 446432</td><td> 159</td><td> 141</td><td> 155</td><td> 152</td><td> 152</td><td> 138</td><td> 153</td>

<td>ISIS 446433</td><td> 158</td><td> 138</td><td> 141</td><td> 118</td><td>n / a</td><td>n / a</td><td>n / a</td>

<td>ISIS 446434</td><td> 166</td><td> 149</td><td> 124</td><td>n / a</td><td>n / a</td><td>n / a</td><td>n / a</td>

Plasma lipid and triglyceride levels

To evaluate the effect of ISIS oligonucleotides on total cholesterol and triglyceride levels, plasma levels of each were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in Tables 35 and 36, expressed in mg / dL.

Table 35

<td colspan="8">Effect of antisense oligonucleotide treatment on plasma cholesterol levels (mg / dl) in Sprague Dawley rats</td>

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td><td>Week 6</td><td>Week 8</td><td>Week 10</td><td>Week 12</td>

<td>PBS</td><td> 55</td><td> 57</td><td> 64</td><td> 51</td><td> 73</td><td> 64</td><td> 53</td>

<td>ISIS 142082</td><td> 62</td><td> 41</td><td> 54</td><td> 62</td><td> 70</td><td> 64</td><td> 62</td>

<td>ISIS 373125</td><td> 73</td><td> 59</td><td> 66</td><td> 51</td><td> 66</td><td> 61</td><td> 39</td>

<td>ISIS 404173</td><td> 57</td><td> 41</td><td> 68</td><td> 62</td><td> 87</td><td> 85</td><td> 75</td>

<td>ISIS 409826</td><td> 57</td><td> 42</td><td> 79</td><td> 65</td><td> 86</td><td> 122</td><td> 110</td>

<td>ISIS 410002</td><td> 69</td><td> 57</td><td> 75</td><td> 65</td><td> 73</td><td> 96</td><td>n / a</td>

<td>ISIS 410003</td><td> 72</td><td> 44</td><td> 70</td><td> 67</td><td> 89</td><td> 76</td><td> 73</td>

<td>ISIS 438452</td><td> 63</td><td> 33</td><td> 53</td><td> 51</td><td> 71</td><td> 70</td><td> 61</td>

<td>ISIS 438460</td><td> 64</td><td> 40</td><td> 98</td><td> 81</td><td> 94</td><td> 146</td><td>n / a</td>

<td>ISIS 446431</td><td> 64</td><td> 41</td><td> 56</td><td> 54</td><td> 63</td><td> 68</td><td> 59</td>

<td>ISIS 446432</td><td> 62</td><td> 44</td><td> 70</td><td> 50</td><td> 80</td><td> 80</td><td> 65</td>

<td>ISIS 446433</td><td> 59</td><td> 63</td><td> 95</td><td> 139</td><td>n / a</td><td>n / a</td><td>n / a</td>

<td>ISIS 446434</td><td> 63</td><td> 48</td><td> 91</td><td>n / a</td><td>n / a</td><td>n / a</td><td>n / a</td>

ES 2 634 450 T3

Table 36

Effect of antisense oligonucleotide treatment on plasma triglyceride levels (mg / dl) in Sprague Dawley rats

<td></td><td>Week 0</td><td>Week 2</td><td>Week 4</td><td>Week 6</td><td>Week 8</td><td>Week 10</td>

<td>PBS</td><td> 66</td><td> 73</td><td> 82</td><td> 80</td><td> 98</td><td> 106</td>

<td>ISIS 142082</td><td> 92</td><td> 30</td><td> 71</td><td> 44</td><td> 25</td><td> 28</td>

<td>ISIS 373125</td><td> 66</td><td> 28</td><td> 20</td><td> 24</td><td> 24</td><td> 28</td>

<td>ISIS 404173</td><td> 48</td><td> 28</td><td> 28</td><td> 35</td><td> 31</td><td> 49</td>

<td>ISIS 409826</td><td> 68</td><td> 29</td><td> 28</td><td> 25</td><td> 31</td><td> 68</td>

<td>ISIS 410002</td><td> 71</td><td> 23</td><td> 23</td><td> 27</td><td> 71</td><td>n / a</td>

<td>ISIS 410003</td><td> 78</td><td> 22</td><td> 22</td><td> 37</td><td> 30</td><td> 64</td>

<td>ISIS 438452</td><td> 89</td><td> 33</td><td> 39</td><td> 34</td><td> 50</td><td> 35</td>

<td>ISIS 438460</td><td> 98</td><td> 20</td><td> 34</td><td> 35</td><td> 33</td><td>n / a</td>

<td>ISIS 446431</td><td> 72</td><td> 29</td><td> 38</td><td> 36</td><td> 35</td><td> 48</td>

<td>ISIS 446432</td><td>n / a</td><td> 41</td><td> 37</td><td> 31</td><td> 37</td><td> 53</td>

<td>ISIS 446433</td><td> 68</td><td> 21</td><td> 29</td><td> 129</td><td>n / a</td><td>n / a</td>

<td>ISIS 446434</td><td> 60</td><td> 27</td><td> 103</td><td>n / a</td><td>n / a</td><td>n / a</td>

Cytokine levels

To evaluate the effect of ISIS oligonucleotides on factors involved in inflammation, blood was collected after the end of the treatment period for measurement of cytokine levels. The samples were sent to Aushon Biosystems (Woburn, MA) for analysis. The levels of rat IL-6, MCp-1, MIP-1a, and TNF-α were measured with their respective antibodies. The results are presented in Table 37.

Table 37

<td colspan="5">Effect of antisense oligonucleotide treatment on plasma cytokine levels in Sprague Dawley rats</td>

<td></td><td>rIL-6</td><td>rMCP-1</td><td>rMIP-1a</td><td>rTNF-α</td>

<td>PBS</td><td> 315</td><td> 403</td><td> 6</td><td> 77</td>

<td>ISIS 142082</td><td> 74</td><td> 3082</td><td> 38</td><td> 697</td>

<td>ISIS 373125</td><td> &lt;25</td><td> 2215</td><td> 7</td><td> 15</td>

<td>ISIS 404173</td><td> 125</td><td> 2244</td><td> 60</td><td> 499</td>

<td>ISIS 409826</td><td> &lt;25</td><td> 6041</td><td> 52</td><td> 100</td>

<td>ISIS 410003</td><td> 245</td><td> 3315</td><td> 40</td><td> 444</td>

<td>ISIS 438452</td><td> 105</td><td> 4513</td><td> 26</td><td> 519</td>

<td>ISIS 446431</td><td> 924</td><td> 3104</td><td> 54</td><td> 402</td>

<td>ISIS 446432</td><td> 29</td><td> 2007</td><td> 46</td><td> 610</td>

Example 14: Viscosity Measurement of ISIS Antisense Oligonucleotides Targeted to Human PTP1B

The viscosity of antisense oligonucleotides selected from studies described in Examples 12 and 13 was measured with the aim of filtering out antisense oligonucleotides having a viscosity of more than 40 cP at a concentration of 165-185 mg / mL. Oligonucleotides having a viscosity greater than 40 cP would be too viscous to be administered to any subject.

ISIS oligonucleotides (32-35 mg) were weighed into a glass vial, 120 ml of water was added and the antisense oligonucleotide was dissolved in solution by heating the vial to 50 ° C. Part of the (75 ml) prewarmed sample was pipetted into a micro-viscometer (Cambridge). The micro-viscometer temperature was set at 25 ° C and the viscosity of the sample was measured. Another part (20 ml) of the preheated sample was pipetted into 10 ml of water for UV reading at 260 nm at 85 ° (Cary UV instrument) C. The results are presented in Table 38 and indicate that all antisense oligonucleotide solutions are optimal in their viscosity under the criteria indicated above.

ES 2 634 450 T3

Table 38

<td colspan="3">Viscosity and concentration of ISIS antisense oligonucleotides targeting human PTP1B</td>

<td>ISIS No.</td><td>Viscosity (cP)</td><td>Concentration (mg / ml)</td>

<td> 142082</td><td> 3,8</td><td> 188</td>

<td> 404173</td><td> 3,8</td><td> 163</td>

<td> 410003</td><td> 4,5</td><td> 176</td>

<td> 446431</td><td> 3,2</td><td> 180</td>

<td> 446432</td><td> 2,4</td><td> 175</td>

Example 15: Six-month tolerability study of antisense oligonucleotides targeting human PTP1B in a mouse model

ISIS oligonucleotides selected from the studies described in Examples 12-14 were evaluated for long-term tolerability in a mouse model by monitoring changes in the levels of various metabolic markers in CD1 mice.

Treatment

Male CD1 mice were kept on a 12 hour light / dark cycle and fed ad libitum normal laboratory chow (Harlan Laboratories, Indianapolis, IN). The animals were acclimatized for at least 7 days in the research center before the start of the experiment. The antisense oligonucleotides were prepared in PBS and sterilized by filtration through a 0.2 micron filter. The oligonucleotides were dissolved in 0.9% PBS for injection.

Groups of ten CD1 mice each were injected subcutaneously twice a week with 25 mg / kg of ISIS 142082, ISIS 404173, ISIS 446431 or for 24 weeks. A group of ten CD1 mice were injected subcutaneously twice a week with PBS for 24 weeks. This PBS group served as the control group. Blood samples were collected on days 140 through jaw bleeds. On day 168, blood was collected by terminal cardiac puncture under CO 2 anesthesia, the mice were sacrificed, and the organs were harvested for further analysis.

Plasma glucose levels

To evaluate the effect of ISIS oligonucleotides on glucose metabolism, plasma glucose levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in Table 39, expressed in mg / dL.

Table 39

<td colspan="2">Effect of antisense oligonucleotide treatment on plasma glucose levels at day 168</td>

<td></td><td>Glucose</td>

<td>PBS</td><td> 214</td>

<td>ISIS 142082</td><td> 177</td>

<td>ISIS 404173</td><td> 204</td>

<td>ISIS 446431</td><td> 191</td>

Liver function

To evaluate the effect of ISIS oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured on day 168. Plasma bilirubin levels (mg / dL) were also measured using the same clinical chemistry analyzer. Alkaline phosphatase, which is synthesized in increased amounts by damaged liver cells, is also a marker of liver disease (Narayanan, S. Ann Clin Lab Sci 21: 12-8, 1991) and was similarly measured. Albumin, which was normally decreased in liver disease (Oettl, K. et al, Biochim Biophys Acta 1782: 469-73, 2008), was also measured in a similar way. The results are presented in Table 40.

ES 2 634 450 T3

Table 40

<td colspan="6">Effect of liver metabolic marker antisense oligonucleotide treatment at day 168</td>

<td></td><td>ALT (UI / L)</td><td>AST (UI / L)</td><td>Bilirubin (mg / dL)</td><td>Alkaline phosphatase (IU / L)</td><td>Albumin (g / dL)</td>

<td>PBS</td><td> 50</td><td> 82</td><td> 0.2</td><td> 44</td><td> 2,5</td>

<td>ISIS 142082</td><td> 148</td><td> 197</td><td> 0.1</td><td> 56</td><td> 2,3</td>

<td>ISIS 404173</td><td> 68</td><td> 137</td><td> 0.1</td><td> 57</td><td> 2,5</td>

<td>ISIS 446431</td><td> 115</td><td> 173</td><td> 0.1</td><td> 42</td><td> 2,4</td>

Heart function

To assess the effect of ISIS oligonucleotides on cardiac function, plasma creatine phosphokinase (CPK) levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) on day 168. An increase in the level of this marker indicates cardiac muscle injury (Barohn, RJ In: Goldman L, Ausiello D, eds Cecil Medicine 23rd ed. Philadelphia, Pa: Saunders Elsevier; 2007: chapter 447). The results are presented in Table 41.

Table 41

<td colspan="2">Effect of antisense oligonucleotide treatment on cardiac marker CPK at day 168</td>

<td></td><td>CPK (IU / L)</td>

<td>PBS</td><td> 98</td>

<td>ISIS 142082</td><td> 120</td>

<td>ISIS 404173</td><td> 107</td>

<td>ISIS 446431</td><td> 159</td>

Pancreatic function

To evaluate the effect of ISIS oligonucleotides on pancreatic function, plasma amylase levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) on day 168. An increase in the level of this marker indicates acute pancreatitis (Sternby, B. et al., Mayo Clin Proc 71: 1138-1144, 1996). The results are presented in Table 42.

Table 42

<td colspan="2">Effect of treatment with marker pancreatic amylase antisense oligonucleotide on day 168</td>

<td></td><td>Amylase (IU / L)</td>

<td>PBS</td><td> 1101</td>

<td>ISIS 142082</td><td> 1374</td>

<td>ISIS 404173</td><td> 1280</td>

<td>ISIS 446431</td><td> 1232</td>

Kidney function

To assess the effect of ISIS oligonucleotides on kidney function, plasma blood urea nitrogen (BUN) levels and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in Table 43, expressed in mg / dL.

ES 2 634 450 T3

Table 43

<td colspan="3">Effect of kidney metabolic marker antisense oligonucleotide treatment at day 168</td>

<td></td><td>BUN</td><td>creatinine</td>

<td>PBS</td><td> 20</td><td> 0,3</td>

<td>ISIS 142082</td><td> 24</td><td> 0,2</td>

<td>ISIS 404173</td><td> 21</td><td> 0,2</td>

<td>ISIS 446431</td><td> 19</td><td> 0,3</td>

Example 16: Measurement of antisense oligonucleotide half-life in CD1 mouse liver

CD1 mice were treated with the ISIS antisense oligonucleotides selected from studies described in Example 14, and the oligonucleotide half-life as well as the elapsed time for oligonucleotide degradation and clearance from the liver was evaluated.

Treatment

Groups of ten CD1 mice each were injected subcutaneously twice a week for 2 weeks with 50 mg / kg of ISIS 142082, ISIS 446431, ISIS 404173 or ISIS 409826. Five mice from each group were sacrificed 3 days and 56 days later of the final dose. The livers were collected for analysis.

Measurement of oligonucleotide concentration

The concentration of the full-length oligonucleotide was measured. The method used is a modification of previously published methods (Leeds et al, 1996; Geary et al, 1999) that consist of a phenolchloroform extraction (liquid-liquid) followed by a solid phase extraction. An internal standard (ISIS 355868, a modified 27-mer 2'-O-methoxyethyl phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTT, designated herein as SEQ ID NO: 50) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantification (LLOQ) of approximately 1.14 mg / g. Half-lives were then calculated using WinNonlin software (Pharsight).

The results are presented in Table 44. Antisense oligonucleotides with half-lives within 11-34 days were chosen for further studies.

Table 44

Full-length oligonucleotide concentration (mg / g) and oligonucleotide half-life (days) in CD1 mouse liver

<td></td><td>Days</td><td>Full-body conc. (Mg / g)</td><td>Half life (days)</td>

<td rowspan="2"> 142082</td><td> 3</td><td> 265</td><td rowspan="2"> 19,8</td>

<td> 56</td><td> 42</td>

<td> 446431</td><td> 3</td><td> 293</td><td> 19,6</td>

<td></td><td> 56</td><td> 45</td><td></td>

<td rowspan="2"> 404173</td><td> 3</td><td> 281</td><td rowspan="2"> 14,8</td>

<td> 56</td><td> 24</td>

<td rowspan="2"> 409826</td><td> 3</td><td> 304</td><td rowspan="2"> 18,4</td>

<td> 56</td><td> 41</td>

Example 17: Effect of ISIS antisense oligonucleotides targeting human PTP1B in cynomolgus monkeys

Cynomolgus monkeys were treated with ISIS antisense oligonucleotides from the studies described in Examples 15 and 16. Efficacy and tolerability of antisense oligonucleotide, as well as its pharmacokinetic profile in liver and kidney, were evaluated.

Treatment

Prior to the study, the monkeys were kept in quarantine for a period of 30 days, during which the standard panels of serum chemistry and hematology, examination of stool samples for eggs and parasites, and a test of the tuberculosis, were carried out to exclude abnormal or diseased monkeys.

ES 2 634 450 T3

Six randomized groups of three male and two female cynomolgus monkeys were injected subcutaneously three times a week for the first week, and then once a week for the next 12 weeks, with either 8 mg / kg or 40 mg / kg of ISIS 142082, ISIS 446431 or ISIS 404173. A group of cynomolgus monkeys with three males and two females were injected subcutaneously three times a week for the first week, and then once a week for the next 12 weeks with 40 mg / kg of ISIS 409826. A group of Control cynomolgus monkeys with three males and two females were injected subcutaneously three times a week for the first week, and subsequently, once a week for the next 12 weeks with PBS. Terminal sacrifices of all groups were carried out 48 hours after the last dose, on day 93.

During the study period, the monkeys were observed daily for signs of illness or distress. Any animal showing adverse effects to treatment was withdrawn and referred to the veterinarian and Study Director.

Inhibition studies

RNA analysis

RNA was extracted from liver and abdominal adipose tissues for PTP1B real-time PCR analysis using probe primer set 1 (GACCAGCTGCGCTTCTCCTA leader sequence, designated herein as SEQ ID NO: 51; reverse sequence CAGAGGAGTCCCCCATGATG, designated herein as SEQ ID NO : 52; probe sequence TTGGCTGTGATCGAAGGTGCCAAA, designated herein as SEQ ID NO: 53) or probe primer set 2 (lead sequence GGGCCCTTTGCCTAACACA, designated herein as SEQ ID NO: 54; reverse sequence CGACACCCCTGCTTTTCTG, designated herein as SEQ ID NO: 55; probe sequence CGGTCACTTTTGGGAGATGGTGTGG, designated herein as SEQ ID NO: 56), each targeting different regions of the PTP1B mRNA. The results are presented as a percentage reduction of PTP1B mRNA, with respect to the PBS control, normalized with RIBOGREEN®. As shown in Table 45, treatment with ISIS antisense oligonucleotides resulted in a significant reduction in PTP1B mRNA compared to the PBS control. Treatment with ISIS 404173 caused a reduction in PTP1B mRNA levels similar to that of treatment with ISIS 142082.

Table 45

Inhibition of PTP1B mRNA in cynomolgus monkey liver and fat tissue relative to PBS control

<td>ISIS No.</td><td>Dose (mg / kg)</td><td>% inhibition in liver (probe set 1)</td><td>% inhibition in liver (probe set 2)</td><td>% inhibition in fat (probe set 1)</td><td>% inhibition in fat (probe set 2)</td>

<td> 409826</td><td> 40</td><td> 38</td><td> 45</td><td> 17</td><td> 21</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 12</td><td> 14</td><td> 13</td><td> 16</td>

<td> 40</td><td> 46</td><td> 48</td><td> 34</td><td> 28</td>

<td rowspan="2"> 446831</td><td> 8</td><td> 0</td><td> 8</td><td> 6</td><td> 1</td>

<td> 40</td><td> 8</td><td> 18</td><td> 14</td><td> 12</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 4</td><td> 13</td><td> 8</td><td> 4</td>

<td> 40</td><td> 26</td><td> 22</td><td> 38</td><td> 31</td>

Protein analysis

Tissue is harvested from the liver for measurement of PTP1B protein levels by western blot analysis. Specifically, PTP1B protein samples from monkeys treated with ISIS 404173 were compared to those treated with ISIS 142082. Results are presented in Tables 46, 47 and 48 expressed as percent reduction compared to control levels. PTP1B levels were normalized against total protein levels, as well as against a constitutively expressed protein, IR-β. Treatment with ISIS 404173 caused a greater reduction in liver protein PTP1B than treatment with ISIS 142082 at the lower dose of 8 mg / kg (Table 47).

Table 46

<td colspan="3">Reduction of PTP1B protein level after treatment with ISIS 404173 in cynomolgus monkey liver</td>

<td>Dose (mg / kg)</td><td>% inhibition (normalized to total protein)</td><td>% inhibition (normalized to IR-P)</td>

<td> 8</td><td> 49</td><td> 42</td>

<td> 40</td><td> 67</td><td> 66</td>

ES 2 634 450 T3

Table 47

<td colspan="3">Reduction in PTP1B protein level after treatment with ISIS 404173 or ISIS 142082 at 8 mg / kg in cynomolgus monkey liver</td>

<td>ISIS No</td><td>% inhibition (normalized to total protein)</td><td>% inhibition (normalized to IR-β)</td>

<td> 142082</td><td> 20</td><td> 4</td>

<td> 404173</td><td> 33</td><td> 27</td>

Table 48

<td colspan="3">Reduction of PTP1B protein level after treatment with ISIS 404173 or ISIS 142082 at 40 mg / kg in cynomolgus monkey liver</td>

<td>ISIS No</td><td>% inhibition (normalized to total protein)</td><td>% inhibition (normalized to IR-β)</td>

<td> 142082</td><td> 65</td><td> 63</td>

<td> 404173</td><td> 60</td><td> 56</td>

Tolerance studies

Body and organ weight measurements

To evaluate the effect of ISIS oligonucleotides on the general health of the animals, body and organ weights were measured after terminal sacrifice. Body weights were measured and compared to those of PBS control animals. Organ weights were measured and treatment group weights were compared to corresponding PBS control weights. The data are presented in Table 49. Treatment with ISIS 142082 caused increases in liver and kidney weights at the highest dose.

Table 49

Body weights and end organ weights in the cynomolgus monkey relative to control

<td></td><td>Dose (mg / kg)</td><td>Body weight (kg)</td><td>Kidney (g)</td><td>Liver (g)</td><td>Spleen (g)</td><td>Muscle gastrocnemius (g)</td><td>from</td>

<td>PBS</td><td> -</td><td> 2,2</td><td> 9,6</td><td> 10,5</td><td> 2,3</td><td colspan="2"> 10,6</td>

<td> 409826</td><td> 40</td><td> 2,3</td><td> 14,0</td><td> 18,5</td><td> 6,0</td><td colspan="2"> 8,8</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 2,3</td><td> 10,6</td><td> 13,0</td><td> 3,7</td><td colspan="2"> 9,5</td>

<td> 40</td><td> 2,2</td><td> 20,9</td><td> 17,7</td><td> 7,0</td><td colspan="2"> 9,0</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 2,3</td><td> 11,6</td><td> 12,7</td><td> 4,8</td><td colspan="2"> 10,2</td>

<td> 40</td><td> 2,3</td><td> 15,9</td><td> 16,1</td><td> 9,6</td><td colspan="2"> 7,7</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 2,3</td><td> 11,6</td><td> 12,8</td><td> 4,8</td><td colspan="2"> 11,1</td>

<td> 40</td><td> 2,2</td><td> 14,8</td><td> 15,5</td><td> 3,7</td><td colspan="2"> 8,7</td>

Liver function

To evaluate the effect of ISIS oligonucleotides on liver function, blood samples were collected from all study groups 7 days before the start of treatment, as well as on days 30, 58, and 93 of the treatment period. Blood samples were collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain the serum.

Transaminase levels were measured using a NEO Toshiba 200FR chemistry analyzer (Toshiba Co., Japan). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Tables 50 and 51, expressed in IU / L. Alkaline phosphatase, which is synthesized in increased amounts by damaged liver cells and is also a marker of liver disease and was similarly measured, and the data are presented in Table 52. AST, ALT, and phosphatase levels alkaline in all treatment groups were similar to those of the PBS control group.

C-reactive protein (CRP), which is synthesized in the liver and which serves as a marker of inflammation, was also measured in a similar way, and the data are presented in Table 53. Treatment with ISIS 142082 and ISIS 409826 in the highest dose resulted in high CRP levels, suggesting liver inflammation.

ES 2 634 450 T3

Bilirubin is also a liver metabolic marker and was measured in a similar way and is presented in Table 54, expressed in mg / dL. Bilurubin levels of all treatment groups were found to be similar to those of the PBS control group. Gamma-glutamyltransferase (GGT) is an enzyme produced in the liver and is a useful laboratory marker of early liver damage or cholestatic disease (Betro, MG et al, Am J. Clin Pathol 60: 672-8, 1973). GGT levels were measured and the results are presented in Table 55, and do not demonstrate any difference in the PBS control and treatment groups.

Table 50

Effect of antisense oligonucleotide treatment on ALT (IU / L) in cynomolgus monkey serum

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 37</td><td> 44</td><td> 42</td><td> 35</td>

<td> 409826</td><td> 40</td><td> 39</td><td> 51</td><td> 86</td><td> 74</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 37</td><td> 39</td><td> 45</td><td> 36</td>

<td> 40</td><td> 49</td><td> 62</td><td> 59</td><td> 69</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 52</td><td> 54</td><td> 67</td><td> 86</td>

<td> 40</td><td> 38</td><td> 58</td><td> 87</td><td> 99</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 34</td><td> 50</td><td> 41</td><td> 45</td>

<td> 40</td><td> 44</td><td> 50</td><td> 63</td><td> 73</td>

Table 51

Effect of treatment with AST antisense oligonucleotide (IU / L) on cynomolgus monkey serum

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td></td><td> 40</td><td> 49</td><td> 55</td><td> 44</td>

<td> 409826</td><td> 40</td><td> 48</td><td> 53</td><td> 73</td><td> 59</td>

<td> 142082</td><td> 8</td><td> 44</td><td> 45</td><td> 49</td><td> 42</td>

<td></td><td> 40</td><td> 54</td><td> 70</td><td> 72</td><td> 69</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 57</td><td> 43</td><td> 48</td><td> 50</td>

<td> 40</td><td> 41</td><td> 60</td><td> 63</td><td> 81</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 44</td><td> 53</td><td> 57</td><td> 59</td>

<td> 40</td><td> 46</td><td> 65</td><td> 71</td><td> 74</td>

Table 52

Effect of treatment with alkaline phosphatase antisense oligonucleotide (IU / L) in cynomolgus monkey serum

<td></td><td>Dose (mg / kg)</td><td>Day-7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 784</td><td> 834</td><td> 1021</td><td> 838</td>

<td> 409826</td><td> 40</td><td> 728</td><td> 883</td><td> 1178</td><td> 981</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 718</td><td> 739</td><td> 788</td><td> 688</td>

<td> 40</td><td> 666</td><td> 656</td><td> 711</td><td> 774</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 742</td><td> 745</td><td> 885</td><td> 908</td>

<td> 40</td><td> 778</td><td> 759</td><td> 768</td><td> 735</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 888</td><td> 957</td><td> 1135</td><td> 1155</td>

<td> 40</td><td> 931</td><td> 958</td><td> 1135</td><td> 1263</td>

ES 2 634 450 T3

Effect of PCR antisense oligonucleotide treatment (mg / l) in cynomolgus monkey plasma

Table 53

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td></td><td> 1,0</td><td> 1,8</td><td> 1,4</td><td> 1,2</td>

<td> 409826</td><td> 40</td><td> 1,0</td><td> 4,3</td><td> 4,8</td><td> 4,8</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 0,8</td><td> 1,2</td><td> 0,9</td><td> 1,0</td>

<td> 40</td><td> 0,8</td><td> 2,6</td><td> 3,4</td><td> 12,1</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 1,4</td><td> 1,4</td><td> 0,9</td><td> 1,1</td>

<td> 40</td><td> 0,8</td><td> 2,4</td><td> 2,2</td><td> 6,7</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 1,4</td><td> 1,9</td><td> 1,5</td><td> 1,8</td>

<td> 40</td><td> 3,1</td><td> 1,6</td><td> 1,2</td><td> 1,6</td>

Table 54

Effect of antisense oligonucleotide treatment on bilirubin (mg / dL) in cynomolgus monkey plasma

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 0,19</td><td> 0,20</td><td> 0,20</td><td> 0,17</td>

<td> 409826</td><td> 40</td><td> 0,17</td><td> 0,13</td><td> 0,13</td><td> 0,10</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 0,17</td><td> 0,18</td><td> 0,16</td><td> 0,14</td>

<td> 40</td><td> 0,16</td><td> 0,13</td><td> 0,13</td><td> 0,08</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 0,21</td><td> 0,17</td><td> 0,18</td><td> 0,15</td>

<td> 40</td><td> 0,19</td><td> 0,18</td><td> 0,15</td><td> 0,12</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 0,23</td><td> 0,19</td><td> 0,20</td><td> 0,16</td>

<td> 40</td><td> 0,22</td><td> 0,15</td><td> 0,14</td><td> 0,13</td>

Table 55

Effect of antisense oligonucleotide treatment on GGT (IU / l) in cynomolgus monkey plasma

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 65</td><td> 74</td><td> 79</td><td> 71</td>

<td> 409826</td><td> 40</td><td> 84</td><td> 86</td><td> 94</td><td> 87</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 63</td><td> 67</td><td> 68</td><td> 62</td>

<td> 40</td><td> 67</td><td> 72</td><td> 71</td><td> 61</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 60</td><td> 62</td><td> 62</td><td> 63</td>

<td> 40</td><td> 61</td><td> 58</td><td> 62</td><td> 60</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 57</td><td> 66</td><td> 66</td><td> 68</td>

<td> 40</td><td> 56</td><td> 63</td><td> 69</td><td> 79</td>

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, blood samples were collected from all study groups. Blood samples were collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. BUN and creatinine levels were measured 7 days before the start of treatment, as well as on days 30, 58 and 93 of the treatment period using a NEO Toshiba 200FR chemistry analyzer (Toshiba Co., Japan). The results are presented in Tables 56 and 57, expressed in mg / dL. Treatment with ISIS oligonucleotides had no adverse effects on either BUN or creatinine levels.

ES 2 634 450 T3

Effect of antisense oligonucleotide treatment on serum BUN levels (mg / dL) in cynomolgus monkeys

Table 56

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 28</td><td> 28</td><td> 25</td><td> 28</td>

<td> 409826</td><td> 40</td><td> 32</td><td> 30</td><td> 28</td><td> 32</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 26</td><td> 25</td><td> 24</td><td> 26</td>

<td> 40</td><td> 28</td><td> 28</td><td> 25</td><td> 25</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 28</td><td> 27</td><td> 25</td><td> 26</td>

<td> 40</td><td> 28</td><td> 27</td><td> 25</td><td> 28</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 28</td><td> 30</td><td> 24</td><td> 27</td>

<td> 40</td><td> 28</td><td> 24</td><td> 25</td><td> 23</td>

Table 57

Effect of antisense oligonucleotide treatment on serum creatinine levels (mg / dL) in cynomolgus monkeys

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td></td><td> 0,83</td><td> 0,88</td><td> 0,94</td><td> 0,78</td>

<td> 409826</td><td> 40</td><td> 0,77</td><td> 0,84</td><td> 0,92</td><td> 0,82</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 0,74</td><td> 0,78</td><td> 0,79</td><td> 0,71</td>

<td> 40</td><td> 0,72</td><td> 0,80</td><td> 0,86</td><td> 0,73</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 0,79</td><td> 0,75</td><td> 0,83</td><td> 0,71</td>

<td> 40</td><td> 0,76</td><td> 0,83</td><td> 0,88</td><td> 0,77</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 0,81</td><td> 0,91</td><td> 0,87</td><td> 0,82</td>

<td> 40</td><td> 0,76</td><td> 0,84</td><td> 0,92</td><td> 0,76</td>

Cholesterol and triglyceride levels

To evaluate the effect of ISIS oligonucleotides on lipid metabolism, blood samples were collected from all study groups. Blood samples were collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. Cholesterol and triglyceride concentrations were measured 7 days before the start of treatment, as well as on days 30, 58 and 93 of the treatment period using a NEO Toshiba 200FR chemistry analyzer (Toshiba Co., Japan). The results are presented in Tables 58 and 59, expressed in mg / dL. Treatment with ISIS oligonucleotides had no adverse effects on either cholesterol or triglyceride levels.

Table 58

Effect of antisense oligonucleotide treatment on serum cholesterol levels (mg / dL) in cynomolgus monkeys

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 135</td><td> 163</td><td> 162</td><td> 143</td>

<td> 409826</td><td> 40</td><td> 153</td><td> 150</td><td> 140</td><td> 116</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 116</td><td> 151</td><td> 159</td><td> 141</td>

<td> 40</td><td> 110</td><td> 140</td><td> 138</td><td> 128</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 125</td><td> 144</td><td> 141</td><td> 133</td>

<td> 40</td><td> 93</td><td> 99</td><td> 95</td><td> 81</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 123</td><td> 147</td><td> 149</td><td> 136</td>

<td> 40</td><td> 135</td><td> 135</td><td> 125</td><td> 124</td>

ES 2 634 450 T3

Effect of antisense oligonucleotide treatment on serum triglyceride levels (mg / dL) in cynomolgus monkeys

Table 59

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 47</td><td> 55</td><td> 45</td><td> 54</td>

<td> 409826</td><td> 40</td><td> 30</td><td> 29</td><td> 33</td><td> 42</td>

<td> 142082</td><td> 8</td><td> 23</td><td> 31</td><td> 37</td><td> 32</td>

<td></td><td> 40</td><td> 28</td><td> 28</td><td> 35</td><td> 42</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 24</td><td> 46</td><td> 34</td><td> 33</td>

<td> 40</td><td> 31</td><td> 44</td><td> 47</td><td> 56</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 28</td><td> 38</td><td> 25</td><td> 28</td>

<td> 40</td><td> 30</td><td> 38</td><td> 45</td><td> 34</td>

Hematology

To assess any inflammatory effect of ISIS oligonucleotides in cynomolgus monkeys, blood samples were approximately 0.5 ml of blood was collected from each of the available study animals in tubes containing the potassium salt of EDTA. Samples were analyzed for red blood cell (RBC), white blood cell (WBC) count, platelet count, and hemoglobin content, using an ADVIA120 hematology analyzer (Bayer, USA). The data are presented in Tables 60-63. Treatment with ISIS oligonucleotides did not significantly alter blood cell count or hemoglobin levels, compared to control.

Table 60

Effect of WBC antisense oligonucleotide treatment (x 10³/ μ ^ in cynomolgus monkeys

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 11,6</td><td> 12,6</td><td> 11,1</td><td> 8,9</td>

<td> 409826</td><td> 40</td><td> 12,4</td><td> 12,7</td><td> 15,3</td><td> 10,8</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 11,3</td><td> 15,2</td><td> 12,8</td><td> 9,7</td>

<td> 40</td><td> 11,9</td><td> 13,2</td><td> 12,5</td><td> 8,5</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 9,7</td><td> 13,4</td><td> 12,7</td><td> 9,3</td>

<td> 40</td><td> 10,7</td><td> 11,5</td><td> 11,9</td><td> 10,2</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 14,9</td><td> 18,9</td><td> 14,9</td><td> 11,8</td>

<td> 40</td><td> 11,1</td><td> 14,2</td><td> 12,9</td><td> 10,8</td>

Table 61

Effect of RBC antisense oligonucleotide treatment (x 10⁶/ Ml) in cynomolgus monkeys

<td></td><td>Dose (mg / kg)</td><td>Day-7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td></td><td> 5,5</td><td> 5,6</td><td> 5,8</td><td> 5,1</td>

<td> 409826</td><td> 40</td><td> 5,6</td><td> 5,8</td><td> 6,1</td><td> 5,6</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 5,4</td><td> 5,4</td><td> 5,6</td><td> 5,2</td>

<td> 40</td><td> 5,7</td><td> 5,6</td><td> 5,8</td><td> 5,5</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 5,5</td><td> 5,3</td><td> 5,5</td><td> 5,4</td>

<td> 40</td><td> 5,5</td><td> 5,4</td><td> 5,8</td><td> 5,3</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 5,9</td><td> 5,9</td><td> 6,1</td><td> 5,7</td>

<td> 40</td><td> 5,1</td><td> 5,4</td><td> 5,5</td><td> 5,5</td>

ES 2 634 450 T3

Effect of antisense oligonucleotide treatment on platelets (x 10³/ μ ^ in cynomolgus monkeys

Table 62

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 592</td><td> 555</td><td> 571</td><td> 516</td>

<td> 409826</td><td> 40</td><td> 536</td><td> 493</td><td> 400</td><td> 338</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 439</td><td> 477</td><td> 349</td><td> 284</td>

<td> 40</td><td> 461</td><td> 454</td><td> 401</td><td> 263</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 438</td><td> 397</td><td> 359</td><td> 282</td>

<td> 40</td><td> 516</td><td> 337</td><td> 369</td><td> 323</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 489</td><td> 491</td><td> 420</td><td> 355</td>

<td> 40</td><td> 520</td><td> 470</td><td> 389</td><td> 316</td>

Table 63

Effect of antisense oligonucleotide treatment on hemoglobin levels (g / dL) in cynomolgus monkeys

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 12,5</td><td> 12,8</td><td> 13,1</td><td> 11,9</td>

<td> 409826</td><td> 40</td><td> 12,6</td><td> 12,8</td><td> 13,3</td><td> 12,5</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 12,3</td><td> 12,5</td><td> 13,0</td><td> 12,2</td>

<td> 40</td><td> 12,1</td><td> 12,0</td><td> 12,1</td><td> 11,5</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 12,3</td><td> 12,1</td><td> 12,4</td><td> 12,6</td>

<td> 40</td><td> 12,7</td><td> 12,6</td><td> 13,3</td><td> 12,4</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 12,7</td><td> 13,0</td><td> 13,3</td><td> 12,7</td>

<td> 40</td><td> 11,6</td><td> 12,3</td><td> 12,4</td><td> 12,6</td>

Analysis of inflammation factors

To evaluate the effect of ISIS oligonucleotides for C3 complement analysis as a factor of inflammation, blood was collected from all available animals in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for 90 min and then centrifuged (3000 rpm for 10 min at room temperature) to obtain serum. Complement C3 was measured using an automated analyzer (Toshiba 200 FR NEO chemistry analyzer, Toshiba co., Japan). The data are presented in Table 64, expressed in mg / dL. Treatment with ISIS 409826 resulted in low levels of C3 complement, indicating a disease state.

Table 64

Effect of antisense oligonucleotide treatment on serum C3 levels (mg / dL) in cynomolgus monkeys

<td></td><td>Dose (mg / kg)</td><td>Day -7</td><td>Day 1</td><td>Day 30</td><td>Day 58</td><td>Day 93</td>

<td>PBS</td><td> -</td><td> 136</td><td> 138</td><td> 148</td><td> 149</td><td> 129</td>

<td> 409826</td><td> 40</td><td> 129</td><td> 131</td><td> 101</td><td> 101</td><td> 90</td>

<td> 142082</td><td> 8</td><td> 126</td><td> 135</td><td> 126</td><td> 127</td><td> 111</td>

<td></td><td> 40</td><td> 133</td><td> 134</td><td> 106</td><td> 121</td><td> 111</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 130</td><td> 144</td><td> 128</td><td> 132</td><td> 125</td>

<td> 40</td><td> 129</td><td> 130</td><td> 111</td><td> 117</td><td> 114</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 127</td><td> 136</td><td> 137</td><td> 136</td><td> 127</td>

<td> 40</td><td> 125</td><td> 134</td><td> 101</td><td> 103</td><td> 102</td>

Insulin levels analysis

To assess the effect of ISIS oligonucleotides on the thyroid gland, blood was collected on days 42, 84 and 91 from overnight fasted animals in EDTA-treated tubes. The tubes were kept in

ES 2 634 450 T3 ice and plasma was obtained after centrifugation (3000 rpm for 10 min at 4 ° C) within 30 min of blood collection. Insulin levels were measured using an automated analyzer (Toshiba 200 FR NEO chemistry analyzer, Toshiba co., Japan). The data are presented in Table 65, expressed in ng / mL.

Table 65

Effect of antisense oligonucleotide treatment on plasma insulin levels (ng / ml) in cynomolgus monkeys

<td></td><td>Dose (mg / kg)</td><td>Day 42</td><td>Day 84</td><td>Day 91</td>

<td>PBS</td><td> -</td><td> 29</td><td> 26</td><td> 26</td>

<td> 409826</td><td> 40</td><td> 14</td><td> 22</td><td> 15</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 8</td><td> 4</td><td> 8</td>

<td> 40</td><td> 8</td><td> 10</td><td> 10</td>

<td rowspan="2"> 404173</td><td> 8</td><td> 9</td><td> 10</td><td> 7</td>

<td> 40</td><td> 6</td><td> 3</td><td> 2</td>

Pharmacokinetic studies

Measurement of oligonucleotide concentration

The concentration of the full-length oligonucleotide was measured, as well as the concentration of the total oligonucleotide (including the degraded form). The method used is a modification of the previously published methods; consisting of a phenol-chloroform extraction (liquid-liquid) followed by a solid phase extraction (Leeds et al., 1996 Geary et al., 1999). An internal standard (ISIS 355868, a modified 27-mer 2'-O-methoxyethyl phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTT, designated herein as SEQ ID NO: 50) was added prior to extraction. Tissue sample concentrations are calculated using calibration curves, with a lower limit of quantification (LLOQ) of approximately 1.14 mg / g. The results are presented in Tables 66 and 67, expressed as mg / g of tissue. The ratio of the concentrations in the kidney compared to the liver was calculated. Treatment with ISIS oligonucleotides did not result in any abnormality in the relationship. The results indicate that ISIS 404173 is a better renal accumulator than ISIS 142082 at the highest dose.

Table 66

Total oligonucleotide concentration (mg / g) in cynomolgus monkey liver

<td>ISIS No.</td><td>Dose (mg / kg)</td><td>Kidney</td><td>Liver</td><td>Kidney / liver ratio</td>

<td> 409826</td><td> 40</td><td> 4424</td><td> 954</td><td> 4,64</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 1688</td><td> 1044</td><td> 1,62</td>

<td> 40</td><td> 6385</td><td> 1774</td><td> 3,60</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 1323</td><td> 641</td><td> 2,06</td>

<td> 40</td><td> 6662</td><td> 1159</td><td> 5,75</td>

<td> 404173</td><td> 8</td><td> 971</td><td> 712</td><td> 1,36</td>

<td></td><td> 40</td><td> 7180</td><td> 1464</td><td> 4,90</td>

Table 67

Full-length oligonucleotide concentration (mg / g) in cynomolgus monkey liver

<td>ISIS No.</td><td>Dose (mg / kg)</td><td>Kidney</td><td>Liver</td><td>Kidney / liver ratio</td>

<td> 409826</td><td> 40</td><td> 3472</td><td> 728</td><td> 4,77</td>

<td rowspan="2"> 142082</td><td> 8</td><td> 1232</td><td> 653</td><td> 1,89</td>

<td> 40</td><td> 4103</td><td> 1244</td><td> 3,30</td>

<td rowspan="2"> 446431</td><td> 8</td><td> 1204</td><td> 416</td><td> 2,89</td>

<td> 40</td><td> 5645</td><td> 846</td><td> 6,67</td>

<td> 404173</td><td> 8</td><td> 650</td><td> 424</td><td> 1,53</td>

<td></td><td> 40</td><td> 5039</td><td> 1094</td><td> 4,61</td>