Mutant citrobacter freundii phytase polypeptide

ES 2 394 908 T3

DESCRIPTION

Citrobacter freundii phytase and homologues

The present invention relates to phytases, nucleotide sequences therefor, phytase production processes and their use.

FIELD OF THE INVENTION

The present invention relates to the field of enzymes for feed additives. More specifically, the present invention relates to phytases that can be used to enhance phosphate digestion in animal feed and food.

TECHNICAL BACKGROUND AND PREVIOUS TECHNIQUE

Phytate is the main storage form of phosphorus in cereals and legumes. However, monogastric animals such as pigs, poultry and fish cannot metabolize or absorb phytate (or phytic acid) and therefore it is secreted leading to phosphorous pollution from areas of intense livestock production. Furthermore, phytic acid also acts as an antinutritive agent in monogastric animals by chelating metallic agents such as calcium, copper and zinc.

In order to provide sufficient phosphates for the growth and health of these animals, inorganic phosphate is added to their diets. Such an addition can be expensive and further increases pollution problems.

Phytate is converted by phytases which generally catalyze the hydrolysis of phytate to lower inositol phosphates and organic phosphate. Phytases are useful as additives for animal feed in which they improve the availability of organic phosphorus for the animal and decrease the phosphate pollution of the environment (Wodzinski RJ, Ullah AH. Adv Appl Microbiol. 42, 263-302 (1996)).

Several phytases of fungal origin have been described in the literature (Wyss M. et al. Appl. Environ. Microbiol. 65 (2), 367-373 (1999); Berka RM et al. Appl. Environ. Microbiol. 64 (11 ), 4423-4427 (1998), Lassen S. et al. Appl. Environ. Microbiol. 67 (10), 4701-4707 (2001)) and bacterial (Greiner R. et al. Arch. Biochem. Biophys. 303 ( 1), 107113 (1993); Kerovuo et al. Appl. Environ. Microbiol. 64 (6), 2079-2085 (1998); Kim HW et al. Biotechnol. Lett. 25, 1231-1234 (2003); Greiner R . et al. Arch. Biochem. Biophys. 341 (2), 201-206 (1997); Yoon SJ et al. Enzyme and microbial technol. 18, 449-454 (1996); Zinin NV et al. FEMS Microbiol. Lett. 236, 283-290 (2004))).

However, to date, none of these phytases have shown the properties required for effective use as a supplement to animal feed. In particular, fungal phytases tend to be proteolytically unstable (Igbasan FA et al. Arch. Anim. Nutr. 53,353-373 (2000)) and therefore susceptible to degradation, while most bacterial phytases have narrow substrate specificity for phytate alone and poorly degrade intermediate phosphorylation inositol phosphates (Greiner R. et al., Arch. Biochem. Biophys. 303 (1), 107-113 (1993); Kerovuo J et al. Biochem. J. 352, 623-628 (2000)).

Consequently, there is a need for improved phytases.

SUMMARY OF THE INVENTION

In a broad aspect, the present invention relates to bacterial derived phytases and modified forms thereof. In particular, the invention relates to natural phytases derived from the bacterium Citrobacter freundii and to variant / modified forms thereof which show improved characteristics over the natural enzyme.

The present invention is advantageous in that it provides novel phytases that have properties that make them particularly useful and efficient as feed enzymes. In particular, the invention relates to novel phytase polypeptide isolated and / or purified as described herein or functional fragments or variants or modified forms thereof. The invention also provides the nucleic acid and amino acid sequences encoding such phytases.

To be efficient as an enzyme additive for animal feed or feed, a phytase has to combine several different properties. In order to be able to degrade phytic acid in the acidic environment of an animal stomach it has to be active at low pH, preferably over a wide range of pH values. Furthermore, it has to have high specific activity and preferably high thermostability to allow the protein to withstand the high temperatures commonly used in the preparation of feed such as feed pellets.

It is also important that the enzyme has broad substrate specificity that allows not only phytate to be hydrolyzed, but also phytate degradation intermediates such as inositol pentaphosphates, tetraphosphates and triphosphates. Studies on the degradation of phytate in pigs show that these inositol oligophosphates

ES 2 394 908 T3 remain otherwise largely insoluble in the small and large intestine and therefore inaccessible to animal-produced alkaline phosphatases and intestinal microflora (Schlemmer U. et al. Arch. Anim. Nutr. 55, 255-280 (2001)). Variations in the substrate specificity profiles of different enzymes have been identified. For example, inositol triphosphates generated by the phytase of B. subtilis are essentially resistant to subsequent hydrolysis by this enzyme (Kerovuo J. et al. Biochem J. (200) 352, 623-628).

In another aspect of the invention there is provided a plasmid or vector system or a transformed or transgenic organism comprising a novel phytase as described herein or a modified form thereof.

In another aspect the present invention relates to transgenic organisms modified to express a novel phytase as described herein or a modified form thereof and which can therefore produce a phytase. The present invention further provides means and processes for the biotechnological production of phytases and their use as feed supplements.

Aspects of the present invention are presented in the claims and in the following comment.

For ease of reference, these and other aspects of the present invention are now discussed under appropriate section headings. However, the teachings under each section are not necessarily limited to each particular section.

As used with reference to the present invention, the terms "produce", "produce", "produced", "producible", "production" are synonymous with the respective terms "prepare", "preparing", "prepared", " preparation "," generated "," generation "and" preparable ".

As used with reference to the present invention, the terms "expression", "expresses", "expressed" and "expressible" are synonymous with the respective terms "transcription", "transcribe", "transcribed" and "transcribable".

As used in reference to the present invention, the terms "transformation" and "transfection" refer to a method of introducing nucleic acid sequences into hosts, host cells, tissues, or organs.

Other aspects regarding nucleotide sequences that can be used in the present invention include: a construct comprising the sequences of the present invention; a vector comprising the sequences for use in the present invention; a plasmid comprising the sequences for use in the present invention; a transformed cell comprising the sequences for use in the present invention; a transformed tissue comprising the sequences for use in the present invention; a transformed organ comprising the sequences for use in the present invention; a transformed host comprising the sequences for use in the present invention; a transformed organism comprising the sequences for use in the present invention. The present invention also encompasses nucleotide sequence expression methods for use in the present invention using the same, such as expression in a host cell; that include procedures to transfer it. The present invention further encompasses nucleotide sequence isolation procedures, such as host cell isolation.

Other aspects relating to amino acid sequences for use in the present invention include: a construct encoding amino acid sequences for use in the present invention; a vector encoding amino acid sequences for use in the present invention; a plasmid encoding amino acid sequences for use in the present invention; a transformed cell that expresses the amino acid sequences for use in the present invention; a transformed tissue expressing amino acid sequences for use in the present invention; a transformed organ that expresses amino acid sequences for use in the present invention; a transformed host that expresses the amino acid sequences for use in the present invention; a transformed organism that expresses amino acid sequences for use in the present invention. The present invention also encompasses methods of purification of amino acid sequences for use in the present invention using the same, such as expression in a host cell; which include procedures of transferring the same, and then purifying said sequences.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows SDS-PAGE analysis of C. freundii P3-42 recombinant phytase purified by DEAE-Sepharose chromatography. The figure presents the scan trace of a digital photographic image of the lane containing a sample of C. freundii phytase.

Figure 2 shows the pH profile of C. freundii P3-42 phytase

Figure 3 shows the substrate specificity of purified recombinant C. freundii P3-42 phytase with inositol phosphate fractions of different degree of phosphorylation and model substrates. Abbreviations: IP6 - phytic acid, IP5, IP4 and IP3 - mixtures of isomeric penta-, tetra- and inositol triphosphates, respectively. Fru P2 - 1.63

ES 2 394 908 T3 fructose diphosphate, Fru P1-6-fructose phosphate.

SEQ ID NO: 1 lists the sequence obtained for the identification of the bacterial strain.

SEQ ID NO: 2 lists the sequence comprising the C. freundii P3-42 phytase gene.

SEQ ID NO: 3 lists the amino acid sequence of the C. freundii P3-42 phytase gene.

DETAILED DISCLOSURE OF THE INVENTION

The present invention features an enzyme comprising the amino acid sequence corresponding to Citrobacter freundii phytase or a modified form, a variant, a functional equivalent or an effective fragment thereof.

The present invention is further described in the following numbered paragraphs:

1. An isolated phytase polypeptide comprising the amino acid sequence as shown in SEQ ID NO: 3 corresponding to Citrobacter freundii phytase or a sequence having at least 90% identity (homology) therewith; wherein said polypeptide comprises a combination of mutations selected from the group consisting of: R288M; K46E / Q82H / E168D / Q274L; Q82K / T1S4I / Q279E / N308T; Q82R / D112V / Q274H / T362A; DS3N / D57Y / T199I / P229S / R288M;

K46E / Q82H / N148D / T154I / T362I; D53N / D57Y / P229S / R288M / K358R; D53N / D57Y / T154I / P229S / R288M;

K46E / Q82H / N95D / D112V / K142R / D383V; D53N / D57Y / M152V / P229S / R288M / A393P;

D53K / D57Y / M152V / P229S / R288M / A393P; D53N / D57Y / F88Y / M152V / P229S / Q279E / N308T;

D53N / D57Y / M152V / E204V / P229S / R288M / A393P; D53N / D57Y / M152V / T154I / P229S / R288M / A393P;

D53N / D57Y / Q82H / G103E / M152V / P2295 / R288M / A393P;

K46E / D53N / D57Y / T143I / M152V / L176V / P229S / R288M / A393P;

Q82K / F88Y / N96P / Q97T / T98G / V105I / Q274H / Q279E / A393P; Q82R / F88Y / N95P / N96P / Q97T / Q279E / I384L / P386Q / A393P;

H18Q / D53N / D57Y / E75V / M152V / A170T / P229S / R288M / Q385R / A393P; Q82K / F88Y / N96P / T98G / Y136N / M152V / Y177F / T362I / I384F / A393P / D397N;

D53N / D57Y / F88Y / N95P / N96P / V105I / D112V / Y136N / N148D / N164D / Q274H / T362I / I384L / A393P; D53N / D57Y / Q82K / F88Y / N95P / P102L / V105I / Y136N / N148D / Y177F / Q274H / Q279E / T362I / A393P;

D53N / D57Y / Q82K / F88Y / N96P / T98G / V105I / D112V / Y177F / Q274L / G343A / T362I / I384L / A393P; E23K / K46E / Q82H;

K46E / Q82H / Q385R; D53N / D57Y / E75V / M152V / A170T / P229S / R288M / Q385R / A393P;

numbered according to the numbering in SEQ ID NO. 3, and wherein the isolated polypeptide has high thermostability compared to a polypeptide having the sequence set forth in SEQ ID NO: 3.

2. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide according to paragraph 1.

3. An isolated nucleic acid molecule according to paragraph 2 that encodes the isolated polypeptide or phytase as described in paragraph 1.

Four. A plasmid or vector system comprising a nucleic acid sequence encoding an isolated polypeptide or phytase as described in paragraph 1.

5. A plasmid or vector system as described in paragraph 4 comprising a nucleic acid sequence as described in any of paragraphs 2 to 3.

6. A plasmid or vector system as described in paragraphs 4 or 5 wherein said plasmid or vector system is an expression vector for the expression of the isolated polypeptide or phytase enzyme in a host cell or microorganism.

7. A host cell transformed or transfected with a plasmid or vector system as described in any of paragraphs 4 to 6.

8. A host cell as described in paragraph 7, wherein said host cell is derived from a microorganism including bacteria such as B. subtilis, E. coli, and fungi, including yeast such as H. polymorpha, S. pombe, S. cerevisiae.

9. A host cell as described in paragraph 8, wherein said microorganism is a prokaryotic bacterial cell and preferably E. coli.

10. A method of producing a phytase that comprises expressing an amino acid sequence as explained in SEQ ID NO: 3, or a sequence that has at least 90% homology therewith, in a cell

ES 2 394 908 T3 host and separate the phytase from the host cell culture medium, wherein said amino acid sequences comprise a mutation selected from the group explained in paragraph 1 or a combination of mutations selected from the group explained in paragraph 1 and wherein the phytase has high thermostability compared to a polypeptide having the sequence set forth in SEQ ID NO: 3.

eleven. An animal feed or feed composition comprising a polypeptide as defined in paragraph 1.

12. Use of a polypeptide or phytase as described in paragraph 11 in animal feed or feed.

13. A process for the production of animal food or feed comprising a step of spraying a polypeptide or phytase as described in paragraph 11 in liquid form on said animal feed or feed, and / or comprising a step of mixing the polypeptide or phytase as described in paragraph 11 as a dry product with said food or animal feed.

14. A method of screening for a variant of phytase enzyme, which method comprises:

a) selecting a parental phytase enzyme, wherein the parental phytase enzyme is a parental phytase enzyme with at least 90% homology with SEQ ID No. 3;

b) making at least one alteration in the parental phytase enzyme to obtain a phytase enzyme variant according to paragraph 1; Y

c) screening a variant of phytase enzyme that compared to the parental phytase enzyme has greater thermal stability and:

i. increased specific activity; and / or ii. greater proteolytic stability.

fifteen. A method of screening for a variant of phytase enzyme, which method comprises:

a) subjecting the DNA sequence encoding a parental phytase enzyme to mutagenesis to obtain a phytase enzyme variant according to paragraph 1, wherein the parental phytase enzyme is a parental phytase enzyme with at least 90% homology with SEQ ID No. 3;

b) expressing the mutated DNA sequence obtained in step a) in a host cell; Y

c) screening host cells that express a variant of phytase enzyme that compared to the parental phytase enzyme have greater thermal stability and:

i. increased specific activity; and / or ii. greater proteolytic stability.

16. A method of preparing a phytase enzyme variant, which method comprises:

a) selecting a parental phytase enzyme, wherein the parental phytase enzyme is a parental phytase enzyme with at least 90% homology with SEQ ID No. 3;

b) making at least one alteration in the parental phytase enzyme to obtain a phytase enzyme variant according to paragraph 1; Y

c) preparing the phytase enzyme variant.

17. A method of preparing a phytase enzyme variant, which method comprises:

a) subjecting the DNA sequence encoding a parental phytase enzyme to mutagenesis to obtain a phytase enzyme variant according to paragraph 1, wherein the parental phytase enzyme is a parental phytase enzyme with at least 90% homology with SEQ ID No. 3;

b) expressing the mutated DNA sequence obtained in step a) in a host cell; Y

c) preparing the phytase enzyme variant expressed by the host cell.

The term "phytase" means a protein or polypeptide that can catalyze the hydrolysis of phosphoric acid esters including phytate and release inorganic phosphate. Phytases can hydrolyze, in addition to phytate, at least some of the inositol phosphates of intermediate degrees of phosphorylation.

The term "corresponding to Citrobacter freundii phytase means that the enzyme need not have been obtained

ES 2 394 908 T3 from a source of Citrobacter freundii. Instead, the enzyme has to have essentially the same sequence or functional characteristics as Citrobacter freundii phytase.

The term "functional equivalent thereof" means that the enzyme has to have essentially the same functional characteristics as the natural Citrobacter freundii phytase. The term "modified form" or "variant" means that the enzyme has been modified from its original form, but retains essentially the same enzymatic functional characteristics as natural Citrobacter freundii phytase. In particular, the terms "variant" or "modified form" encompass phytase enzymes with an amino acid sequence derived from the amino acid sequence of the parent / natural phytase and having one or more amino acid substitutions, insertions and / or deletions, which together are called mutations. Modified or variant forms can be altered in the characteristics of the enzyme relative to the parent enzyme. Preferably, the modified or variant forms have high thermostability, high pepsin stability, high specific activity, broader substrate specificity, or other modifications that are beneficial for application of the enzyme. The term "functional" or "effective" fragment means a fragment or portion of Citrobacter freundii phytase that retains essentially the same enzymatic function or effect.

Preferably, the enzyme of this aspect of the present invention has the same sequence or a sequence that is at least 90% identical (homologous) to that of Citrobacter freundii phytase.

Suitably, the enzyme comprises the amino acid sequence as shown in SEQ ID NO: 3 or a sequence having at least 90% identity (homology) with it or a functional fragment thereof. In a preferred embodiment, the invention provides an isolated and / or purified polypeptide having the amino acid sequence set forth in SEQ ID NO: 3 or a sequence having at least 90% identity (homology) therewith. In another embodiment, the phytase is characterized in that it is derived from Citrobacter freundii strain P3-42 deposited under accession number NCIMB 41247.

In a preferred embodiment, the description refers to a phytase according to any embodiment of the first aspect of the invention that comprises one or more mutations in the following positions (numbering according to the numbering in SEQ ID No. 3): 22, 23, 24 , 28, 46, 53, 57, 67, 74, 75, 77, 78, 79, 82, 88, 95, 96, 97, 98, 101, 102, 103, 105,109,

112, 122, 126, 136, 140, 142, 143, 148, 151, 152, 154, 156, 160, 161, 164, 168, 170, 176, 177, 195, 199, 203,204,

205, 206, 207, 215, 224, 225, 229, 233, 235, 274, 279, 288, 301, 307, 308, 322, 343, 358, 360, 362, 365, 366,367,

370, 383, 384, 385, 386, 391, 393, 395, 397, 408 and 414.

These positions are characterized in that mutagenesis of the enzyme at these positions leads to an improvement in the desired enzyme characteristics.

Preferred mutations described herein include:

A22T, E23K, E23Q, E24D, M28L, K46E, K46R, D53K, D53N, D57Y, G67R, G74R, E75K, E75V, V77I, S78T, E79V, Q82H, Q82K, Q82R, F88Y, N95D, N9596S, N96P, N95D, N9596S, N96P N96Y, Q97T, T98G, T98P, S101F, P102L, G103E, V105I, A109T, D112V, D112Y, F122Y, L126I, Y136N, E140V, K142R, T143I, T143P, N148D, K151V, T151G, M1V, K151G, M1V1 K161N, N164D, E168D, A170T, L176Q, L176V, Y177F, S195T, T199I, T203I, T203L, T203S, T203W, E204A, E204G, E204H, E204I, E204N, E204R, T205204, K204R, S205204 T207S, L215F, D224H, N225D, N225B, P229S, S233C, S235A, Q274H, Q274L, Q279E, R288M, L301S, E307Y, N308D, N308T, A322V, G343A, K358N, T36266, T336266, K358N366, K358N366, T36266 Q370H, D383V, I384F, I384L, I384M, Q385R, P386Q, K391N, A393P, K395T, D397N, S408I, and L414I or conservative mutations at each position.

By "conservative mutations" is meant mutations to amino acid residues that are conservative in terms of amino acid characteristics with respect to the indicated amino acid residue. Amino acid characteristics include residue size, hydrophobicity, polarity, charge, pK value, and other amino acid characteristics known in the art and also described in more detail below.

In a particularly preferred embodiment of the disclosure, the mutations are in one or more of the following positions:

23, 46, 53, 75, 82, 88, 95, 96, 98, 112, 143, 152, 176, 177, 199, 203, 204, 205, 225, 229, 233, 274, 288, 307, 308, 362, 370, 384 and 385

Preferred mutations at these specific positions include:

E23K, E23Q, K46E, K46R, D53K, D53N, E75K, E75V, Q82H, Q82K, Q82R, F88Y, N95D, N95P, N96P, N96S, N96Y, T98G, D112V, D112Y, T143I, T143P, MQ152K, L176V, MQ152K, L176V, Y177F, T199I, T203I, T203L, T203S, T203W, E204A, E204G, E204H, E204I, E204N, E204R, E204V, K205P, K205R, N225D, N225E, P28927, Q233, Q230H, Q233C427, S233C427, S233C7 N308T, T362A, T362I, Q370H, I384F, I384L, I384M, and Q385R or conservative mutations at each position.

In one embodiment of the description a phytase is provided comprising a mutation selected from group 6

ES 2 394 908 T3 consisting of:

P229S; D112V; Q82R; Q274H; D112Y; F88Y; K46B; S233C; R288M; I384L; Q385R; Q274L; E307Y; T199I; Q82K and T203I.

In another preferred embodiment of the disclosure there is provided a phytase comprising a combination of mutations selected from the group consisting of:

K46E / Q82H; Q82K / V105I; N148D / T362I; K46E / L414I; F88Y / Y136N; T154I / P386Q; N95P / N96S; N95P / N96P; Q97T / T98G; D224H / N225E; Y177F / T199I; Q274L / Q370H; K46E / N96Y; N148D / L301S; E24D / R288M; E140V / A322V; K46E / S195T; E75K / N365D; T98P / S235A; L160F / L215F; Q274L / K395T; G67R / Q279R / N308T;

K161N / P229S / R288M; D53N / D57Y / M152V; F122Y / S156T / P229S; T199I / S206R / T207S; E23K / K46E / Q82H;

K46E / Q82H / Q385R; T203W / E204N / K205R; T203W / E204H / K205R; T203W / E204R / K205R; T203W / E204A / K205R; A22T / K151G / N308D; E23K / E75K / F88Y; M152K / N225D / L301S; S78T / Q274L / S408I; L176Q / TI99I / T366S;

K46E / V77I / T203S; K46R / T199I / D367N; G74R / E204G / ​​R288M; A22T / T199I / S206T / T207A; Q82R / F88Y / L126I / I384L; K46E / Q82H / E168D / Q274L; Q82K / T154I / Q279E / N308T; Q82R / D112V / Q274H / T362A; E24D / E79V / N95D / K360N; E23K / M28L / A109T / T143P / I384L; D53N / D57Y / T199I / P2295 / R288M; K46E / Q82H / N148D / T154I / T362I;

D53N / D57Y / P229S / R288M / K358R; D53N / D57Y / T154I / P229S / R288M; Y136N / T199I / T203L / E204I / K205P;

E23Q / S101F / Q274L / I384M / K391N; K46E / Q82H / N95D / D112V / K142R / D383V;

D53N / D57Y / M152V / P229S / R288M / A393P; D53K / D57Y / M152V / P229S / R288M / A393P;

D53N / D57Y / F88Y / M152V / P229S / Q279E / N308T; D53N / D57Y / M152V / E204V / P229S / R288M / A393P;

D53N / D57Y / M152V / T154I / P229S / R288M / A393P; D53N / D57Y / Q82H / G103E / M152V / P229S / R288M / A393P;

K46E / D53N / D57Y / T143I / M152V / L176V / P229S / R288M / A393P;

Q82K / F88Y / N96P / Q97T / T98G / V105I / Q274H / Q279E / A393P; Q82R / F88Y / N95P / N96P / Q97T / Q279E / I384L / P386Q / A393P; H18Q / D53N / D57Y / E75V / M152V / A170T / P229S / R288M / Q385R / A393P; Q82K / F88Y / N96P / T98G / Y136N / M152V / Y177F / T362I / I384F / A393P / D397N;

D53N / D57Y / F88Y / N95P / N96P / V105I / D112V / Y136N / N148D / N164D / Q274H / T362I / I384L / A393P;

D53N / D57Y / Q82K / F88Y / N95P / P102L / V105I / Y136N / N148D / Y177F / Q274H / Q279E / T362I / A393P and

D53N / D57Y / Q82K / F88Y / N96P / T98G / V105I / D112V / Y177F / Q274L / G343A / T362I / I384L / A393P.

In yet another preferred embodiment of the disclosure there is provided a phytase comprising a combination of mutations selected from the group consisting of:

D57Y / F88Y / N95P / Q97T / N148D / M152V / T154I / Y177F / Q274H / I384L;

D53N / D57Y / F88Y / N95P / N96P / Q97T / M152V / Y177F / Q274H / Q279E / T362I / I384L; D53N / Q82K / F88Y / N96P / T98G / V105I / N148D / T154I / Q274H / T362I / I384L / P386Q; Q82R / F88Y / N96P / T98G / V105I / D112V / Y136N / V148D / T154I / Y177F / P386Q / A393P D53N / Q82K / F88Y / N95P / N96P / T98G / Y136N / N148D / T154I / I386Q; D57Y / Q82K / F88Y / N96P / Q97T / T98G / V105I / N148D / T154I / Y177F / Q274H / I384L / P 386Q / A393P;

D53N / Q82K / F88Y / N95P / Q97T / T98G / D112V / Y136N / N148D / T154I / Q274H / Q279E / I384L / P386Q / A393P ^Y

D53N / D57Y / Q82R / F88Y / N95P / N96P / Q97T / T98G / V105I / Y136N / N148D / M152V / Y 177F / I384L / P386Q.

Accordingly, a preferred phytase according to the present disclosure is a variant consisting of the amino acid sequence listed as SEQ ID NO: 3 and having one or more of the amino acid mutations listed above or one of the combinations of mutations listed above. .

In these embodiments, the nomenclature indicates a phytase comprising the amino acid sequence explained in SEQ ID NO: 3 with the mutations indicated by reference to the amino acid positions in SEQ ID NO: 3. The nomenclature is described below in more detail.

Suitably, these variants show improved characteristics over any one of the following: temperature stability, pH range, pepsin stability, specific activity, substrate specificity. Suitable procedures for determining these characteristics are disclosed herein.

In particular, improvements in phytase characteristics refer to the stability of the enzyme under food and feed processing conditions, to the stability of the enzyme during stomach transit, and to the enzyme activity and stability in the stomach and / or human or animal intestinal tube which makes the improved variants particularly suitable for use as feed supplements. Therefore, such improvements include, among other parameters, the increase in stability at elevated temperatures, preferably at temperatures

ES 2 394 908 T3 above 65 ° C, the increase in stability against proteolytic digestion, preferably digestive tract protease, the increase in catalytic activity at low pH, preferably catalytic activity below pH 5.5, and the overall efficiency of releasing phosphate groups from phytate.

Suitably, in one embodiment, the phytase or functional equivalent of the present invention is characterized in that said phytase has a specific activity of 1000 U / mg or greater wherein said specific activity is determined by incubating said phytase in a solution containing 2 mM phytate. , 0.8 mM CaCl2 in 200 mM sodium acetate buffer at pH 3.5. In another embodiment, the phytase of the present invention or functional equivalent thereof can also be adequately characterized in that said phytase has two maximums of activity at approximately pH 3 and pH 4 4.5 wherein said activity is determined by incubating said phytase in a solution containing 2 mM phytate, 0.8 mM CaCl2 in 200 mM sodium acetate buffer.

In another embodiment, the disclosure provides a method of preparing a phytase enzyme variant, which method comprises:

a) Selecting a parental phytase enzyme, wherein the parental phytase enzyme is selected from

i. a parental phytase enzyme with at least 75% homology to SEQ ID NO: 3 ii. a parental phytase enzyme derived from Citrobacter spp.

b) Make at least one alteration that is an insertion, deletion or substitution of an amino acid residue in the parental phytase enzyme to obtain a phytase enzyme variant

c) Screen a phytase enzyme variant that in comparison to the parental phytase enzyme has:

i. greater thermal stability and / or ii. specific activity and / or iii. proteolytic stability and / or

d) Prepare the phytase enzyme variant

In another embodiment, the description provides a method of preparing a variant of phytase enzyme, which method comprises:

a) Subjecting the DNA sequence encoding a parental phytase enzyme to mutagenesis, in which the parental phytase enzyme is selected from

i. a parental phytase enzyme with at least 75% homology to SEQ ID NO: 3 ii. a parental phytase enzyme derived from Citrobacter spp.

b) Expressing the mutated DNA sequence obtained in step (A) in a host cell, and

c) Screen host cells that express a phytase enzyme variant that in comparison to the parental phytase enzyme has:

iv. greater thermal stability and / or

v. increased specific activity * and / or vi. greater proteolytic stability and / or

Prepare the host cell expressed phytase enzyme variant.

In the above embodiments of the disclosure, which relate to phytase enzyme variant preparation methods, the phytase enzyme variant is preferably screened for increased thermal stability.

In the above embodiments of the disclosure, which relate to phytase enzyme variant preparation methods, the phytase enzyme variant is preferably screened for higher thermal stability and higher proteolytic stability.

In the above embodiments of the disclosure, which relate to phytase enzyme variant preparation methods, the phytase enzyme variant is preferably screened for higher thermal stability and higher proteolytic stability and higher specific activity.

The parental phytase enzyme is preferably derived from Citrobacter freundii, more preferably P3-42 from

ES 2 394 908 T3

Citrobacter freundii.

In methods for the preparation of a variant phytase enzyme, a method comprising subjecting the DNA sequence encoding a parental phytase enzyme to mutagenesis, the DNA sequence encoding a parental phytase enzyme is preferentially subjected to random mutagenesis, more preferably prone PCR error, even more preferably error threshold PCR.

The preferred methods of mutagenesis of the DNA sequence encoding a parental phytase enzyme is error prone PCR, more preferably error threshold PCR, other mutagenesis procedures can be used both instead of error prone / threshold PCR and in conjunction with error prone / threshold PCR. See Example 12 which provides references for suitable error prone PCR and error threshold PCR procedures. Other procedures are revealed under the

The term 'expression in a host cell' when used in the context of embodiments relating to 'a method of preparing a phytase enzyme variant' is preferably defined as the production of the phytase enzyme variant in a living organism , organ, or cell as defined herein. However, it is considered that for the purpose of selection the phytase enzyme variants can also be produced by in vitro procedures using the transcription and translation machinery isolated from one or more cells isolated from one or more living organisms. Such in vitro production of phytase variants in the invention can also be used to screen for preferred variant phytases. In vitro expression can be suitably carried out using standard techniques. For reference please see the 'In vitro Expression Guide' available from Promega Inc (Part # BR053).

Definitions of variant phenotypes.

Variants with higher thermal stability (thermal stability difference) are preferably determined using the procedures disclosed in Example 12.

The variant phytase enzyme prepared by the method of preparing the phytase enzyme variants preferably has a thermal stability difference of at least 1.5, more preferably 2, 2.5, 3, 3.5, 4, 5, 6 , 7, 8, 9, most preferably at least 10.

Variants with higher proteolytic stability are preferably determined by the procedures disclosed in Example 12.

Preferably, the phytase enzyme variant of the invention has a proteolytic stability of at least 45%, preferably 50%, 55%, more preferably at least 60%.

Other variant realizations

In another embodiment, the description provides methods for the preparation of an animal feed comprising a variant of phytase enzyme.

a) Select a parental phytase enzyme, in which the parental phytase enzyme is selected from

i. a parental phytase enzyme with at least 75% homology to SEQ ID NO: 3 ii. a parental phytase enzyme derived from Citrobacter spp.

b) Make at least one alteration that is an insertion, deletion or substitution of an amino acid residue in the parental phytase enzyme to obtain a phytase enzyme variant

c) Screen a phytase enzyme variant that in comparison to the parental phytase enzyme has:

i. greater thermal stability and / or ii. specific activity and / or iii. proteolytic stability and / or

d) Prepare the phytase enzyme variant

e) Add the prepared phytase enzyme variant to an animal feed.

In another embodiment, the description provides methods for the preparation of an animal feed comprising a variant of phytase enzyme.

a) Subject the DNA sequence encoding a parental phytase enzyme to mutagenesis, in which the

ES 2 394 908 T3 parental phytase enzyme is selected from i¡¡. a parental phytase enzyme with at least 75% homology to SEQ ID NO: 3 iv. a parental phytase enzyme derived from Citrobacter spp.

b) Expressing the mutated DNA sequence obtained in step (A) in a host cell, and

c) Screen host cells that express a phytase enzyme variant that in comparison to the parental phytase enzyme has:

vii. greater thermal stability and / or viii. higher specific activity * and / or ix. greater proteolytic stability and / or

d) Prepare the host cell expressed phytase enzyme variant

f) Add the prepared phytase enzyme variant to an animal feed.

The preferred aspects of the method of preparing a phytase enzyme variant also apply to the above methods of preparing an animal feed comprising a phytase enzyme variant.

In another aspect, the invention provides an isolated and / or purified nucleic acid molecule or nucleotide sequence encoding the enzyme comprising the amino acid sequence corresponding to Citrobacter freundii phytase, or a homologue thereof. Suitably, said isolated and / or purified nucleic acid molecule encodes a polypeptide comprising the amino acid sequence as shown in SEQ ID NO: 3 or a sequence having at least 90% identity (homology) therewith. In one embodiment, the nucleic acid molecule encodes a polypeptide comprising SEQ ID NO: 3 and including mutations at the preferred positions listed herein or any of the specific mutations or combinations of mutations listed herein. Also described herein is an isolated and / or purified nucleic acid molecule comprising a nucleotide sequence that is the same as, or is complementary to, or contains any suitable codon substitution for any of those of SEQ ID NO. : 2 or comprises a sequence that has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with SEQ ID NO: 2.

In yet another aspect, a nucleotide sequence and the use of a nucleotide sequence shown as:

(a) the nucleotide sequence presented as SEQ ID NO. 2, (b) a nucleotide sequence that is a variant, homologous, derivative or fragment of the nucleotide sequence presented as SEQ ID NO. 2;

(c) a nucleotide sequence that is the complement of the nucleotide sequence explained in SEQ ID NO. 2;

(d) a nucleotide sequence that is the complement of a variant, homologue, derivative or fragment of the nucleotide sequence presented as SEQ ID NO: 2;

(e) a nucleotide sequence that can hybridize to the nucleotide sequence set forth in SEQ ID NO. 2;

(f) a nucleotide sequence that can hybridize to a variant, homologue, derivative or fragment of the nucleotide sequence presented as SEQ ID NO. 2;

(g) a nucleotide sequence that is the complement of a nucleotide sequence that can hybridize to the nucleotide sequence explained in SEQ ID NO. 2;

(h) a nucleotide sequence that is the complement of a nucleotide sequence that can hybridize to a variant, homologous, derivative or fragment of the nucleotide sequence presented as SEQ ID NO. 2;

(i) a nucleotide sequence that can hybridize to the complement of the nucleotide sequence set forth in SEQ ID NO. 2;

(j) a nucleotide sequence that can hybridize to the complement of a variant, homologous,

ES 2 394 908 T3 derivative or fragment of the nucleotide sequence presented as SEQ ID NO. 2.

The nucleotide sequence of the present invention may comprise sequences encoding SEQ ID NO. 3.

In particular, the invention provides a plasmid or vector system comprising a phytase as described herein. Preferably, the plasmid or vector system comprises a nucleic acid sequence as explained in SEQ ID NO: 2 or a sequence that is at least 75% homologous thereto. Suitably, the plasmid or vector system is an expression vector for the expression of any of the enzymes encoded by a nucleic acid sequence as set forth in any of SEQ ID NO: 2 or a sequence that is at least 75% homologous (identical) to it in a microorganism. Furthermore, the invention provides a plasmid or vector system for the expression of any of the modified enzymes or variants described herein. Suitable expression vectors are described herein.

In another aspect of the invention there is provided a host cell transformed or transfected with a nucleic acid encoding a phytase as described herein.

Suitably, the host cell according to this aspect of the invention comprises a phytase comprising an amino acid sequence as explained in SEQ ID NO: 3 or a sequence that is at least 90% homologous thereto.

In a preferred embodiment, said host cell produces a phytase.

In another aspect of the invention there is provided a host cell transformed or transfected with a nucleic acid encoding a phytase according to the invention. Preferably, the phytase is a Citrobacter freundii phytase as described herein or a homologue or derivative thereof. Suitably, said phytase enzyme comprises an amino acid sequence as explained in any of SEQ ID NO: 3 or a sequence that is at least 90% homologous (identical) thereto. Preferably, said host cell produces a phytase.

In one embodiment, the nucleotide sequence that can be used in the present invention is obtainable from (although it does not actually have to be obtained from) Citrobacter freundii, although it will be recognized that enzymes isolated and / or purified from equivalent strains can still be used.

Suitably, the host cell is derived from a microorganism that includes bacteria and fungi, including yeast. In a particularly preferred embodiment, the host cell is a prokaryotic bacterial cell. Suitable bacterial host cells include bacteria from different prokaryotic taxonomic groups including proteobacteria, including members of the alpha, beta, gamma, delta, and epsilon subdivision, Gram-positive bacteria such as Actinomycetes, Firmicutes, Clostridium, and relatives, flavobacteria, cyanobacteria, bacteria. sulfur greens, non-sulfur green bacteria and archaea. Enterobacteriaceae such as Escherichia coli proteobacteria belonging to the gamma subdivision and Gram-positive bacteria with low GC such as Bacillus are particularly preferred.

Suitable fungal host cells include yeast selected from the group consisting of Ascomycota including Saccharomycetes such as Pichia, Hansenula and Saccharomyces, Schizosaccharomycetes such as Schizosaccharomyces pombe and anamorphic Ascomycota including Aspergillus.

Other suitable eukaryotic host cells include insect cells such as SF9, SF21, Trichoplusia ni and M121 cells. For example, the polypeptides according to the invention can be advantageously expressed in insect cell systems. In addition to expression in cultured insect cells, phytase genes can be expressed in whole insect organisms. Vectors of viruses such as baculoviruses allow the infection of whole insects. Larger insects, such as silk moths, provide a high yield of heterologous protein. The protein can be extracted from the insects according to conventional extraction techniques. Suitable expression vectors for use in the invention include all vectors that can express foreign proteins in insect cell lines.

Other host cells include plant cells selected from the group consisting of protoplasts, cells, callus, tissues, organs, seeds, embryos, ovules, zygotes, etc. The invention also provides whole plants that have been transformed and comprise the recombinant DNA of the invention.

The term "plant" generally includes eukaryotic algae, embryophytes including Bryophyta, Pteridophyta, and Spermatophyta such as gymnosperms and angiosperms.

Preferably, said host cell is a microorganism. Preferred microorganisms include prokaryotic bacterial cells, preferably E. coli, B. subtilis and other species of the genus Bacillus, yeast, preferably Hansenula polymorpha and Schizosaccharomyces pombe.

Also provided herein is a Citrobacter freundii bacterial cell strain P3-42 deposited by Danisco Global Innovation, Sokeritehtaantie 20, FIN-02460 Kantvik, Finland, under the number of

ES 2 394 908 T3 access NCIMB 41247. Such a cell can be incorporated directly into feed.

In another aspect a method for the production of phytases is provided which comprises transfecting a host cell with an expression vector or plasmid according to the invention, cultivating said host cell under conditions for the expression of phytase and extracting said phytase from the culture medium of host cells.

Suitably, said process is for the production of a phytase that comprises expressing an amino acid sequence as explained in SEQ ID NO: 3 or a sequence that has at least 90% homology with it or an effective fragment thereof. into a host cell and extracting the secreted protein from the host cell culture medium.

Another aspect of the invention provides a feed composition comprising a phytase according to the invention. Preferably, the feed composition comprises a phytase at a concentration of 10-10000 U / kg of feed, preferably 200-2000U / kg of feed, more preferably 500-1000 U / kg of feed.

In one embodiment, the feed composition comprises a host cell according to the invention.

In another aspect the use of a phytase according to the invention in animal food or feed is provided.

PREFERRED ASPECTS

Preferable aspects are presented in the appended claims and in the following description and examples section.

ADDITIONAL ADVANTAGES

The present invention is advantageous in that it provides phytases that have various properties that make them particularly useful as additives for animal feed.

In particular, the phytases of the present invention are active at low pH and preferably in the range of pH 2 to 5.5 with maximum activity at about pH 3 and 4.5. Suitably, the phytases of the present invention are active at low pH in the stomach environment.

Furthermore, the phytases of the present invention are efficiently secreted both in the native host and during heterologous expression, thus leading to more efficient production and isolation for addition to feed.

Furthermore, the phytases of the present invention have broad substrate specificity including penta-, tetra-, tri- and di-phosphate substrates, thus increasing the total phosphate available to the animal. The phytases of the present invention also have a high specific activity in the region of 1000 U / mg +/- about 10%.

The products of the present invention can be used as additives / supplements to food and feed. The products can also be useful in the commercial production of various inositol phosphates.

PHYTATE / PHYTIC ACID / PHYTASES

Phytic acid (myo-inositol hexakisphosphate) is an important constituent in cereals, legumes, and oilseed crops. The salt form, phytate, is the main storage form of phosphorus in these plants.

Phytases catalyze the hydrolysis of phytic acid phosphate monoesters resulting in the staggered formation of myo-inositol pentakis-, tetrakis-, tris-, bis- and monophosphates, in addition to the release of inorganic phosphate.

The terms "natural phytase" or "natural" as used herein refer to a phytase enzyme with an amino acid sequence found in nature.

The terms "phytase variant" or "variant" or "modified form" refer to a phytase enzyme with an amino acid sequence derived from the amino acid sequence of a parent phytase that has one or more amino acid substitutions, insertions and / or deletions, which together are called "mutations."

The terms "parental phytase" or "parental enzyme" refer to a phytase enzyme from which a variant of phytase is derived. A parent phytase can be a natural phytase or another variant of phytase. In particular, in the present invention, a "parental phytase" can be derived from Citrobacterfreundii. Suitably, the "parental phytase" is derived from Citrobacter freundii strain P3-42 as described herein which preferably has the amino acid sequence set forth in SEQ ID NO: 3.

ISOLATED

In one aspect, preferably the nucleotide or amino acid sequence is in isolated form. The term "isolated" means that the sequence is at least substantially free of at least one other component with which it

ES 2 394 908 T3 sequence is naturally associated in nature and is found in nature.

Purified

In one aspect, preferably the nucleotide or amino acid sequence is in a purified form. The term "purified" means that the sequence is in a relatively pure state, eg, at least about 90% pure, or at least about 95% pure or at least about 98% pure.

NUCLEOTIDE SEQUENCE

The scope of the present invention encompasses nucleotide sequences encoding enzymes having the specific properties as defined herein.

The term "nucleotide sequence" as used herein refers to an oligonucleotide sequence, nucleic acid or polynucleotide sequence, and variants, homologues, fragments, and derivatives thereof (such as portions thereof). The nucleotide sequence can be of genomic or synthetic or recombinant origin, which can be double-stranded or single-stranded if it represents the coding or non-coding strand.

The term "nucleotide sequence" or "nucleic acid molecule" in relation to the present invention includes genomic DNA, cDNA, synthetic DNA, and RNA. Preferably it means DNA, more preferably cDNA sequence encoding the present invention.

In a preferred embodiment, the nucleotide sequence when it refers to and when encompassed by the scope by itself of the present invention does not include the native nucleotide sequence according to the present invention when it is in its natural environment and when it is linked to its ( s) naturally associated sequence (s) that is / are also in their natural environment. For ease of reference, the inventors call this preferred embodiment the "non-native nucleotide sequence". In this regard, the term "native nucleotide sequence" means an entire nucleotide sequence that is in its native environment and when operably linked to an entire promoter with which it is naturally associated, a promoter that is also in its native environment. However, the amino acid sequence encompassed by the scope of the present invention can be isolated and / or purified after expression of a nucleotide sequence in its native organism. Preferably, however, the amino acid sequence encompassed by the scope of the present invention may be expressed by a nucleotide sequence in its native organism, but in which the nucleotide sequence is not under the control of the promoter with which it is naturally associated. within that organism.

PREPARING A NUCLEOTIDE SEQUENCE

Typically, the nucleotide sequence encompassed by the scope of the present invention or nucleotide sequences for use in the present invention are prepared using recombinant DNA (ie, recombinant DNA) techniques. However, in an alternative embodiment of the invention, the nucleotide sequence could be synthesized, in whole or in part, using chemical procedures well known in the art (see Caruthers MH et al., (1980) Nuc Acids Res Symp Ser 215 -23 and Hom T et al. (1980) Nuc Acids Res Symp Ser 225232).

A nucleotide sequence that encodes both an enzyme that has the specific properties as defined herein and an enzyme that is suitable for modification can be identified and / or isolated and / or purified from any cell or organism that produces said enzyme. . Various procedures are well known in the art for the identification and / or isolation and / or purification of nucleotide sequences. By way of example, amplification by pCr techniques to prepare more than one sequence can be used once a suitable sequence has been identified and / or isolated and / or purified.

By way of another example, a genomic DNA and / or cDNA library can be constructed using chromosomal DNA or messenger RNA from the organism that produces the enzyme. If the amino acid sequence of the enzyme or a part of the amino acid sequence of the enzyme is known, labeled oligonucleotide probes can be synthesized and used to identify enzyme-encoding clones from the genomic library prepared from the organism. Alternatively, a labeled oligonucleotide probe containing sequences homologous to another known enzyme gene could be used to identify clones encoding enzymes. In the latter case, less stringent hybridization and wash conditions are used.

Alternatively, enzyme-encoding clones could be identified by inserting genomic DNA fragments into an expression vector, such as a plasmid, transforming enzyme-negative bacteria with the resulting genomic DNA library, and then seeding the transformed bacteria on agar plates containing a substrate for the enzyme (e.g. maltose for a glucosidase-producing enzyme (maltase)), thus allowing the clones to express the enzyme to be identified.

ES 2 394 908 T3

In still another alternative, the nucleotide sequence encoding the enzyme can be prepared synthetically by established standard procedures, for example, the phosphoramidite procedure described by Beucage SL et al., (1981) Tetrahedron Letters 22, p 1859-1869, or the procedure described by Matthes et al., (1984) EMBO J. 3, p 801-805. In the phosphoramidite method, oligonucleotides are synthesized, for example, on an automated DNA synthesizer, purified, hybridized, ligated, and cloned into appropriate vectors.

The nucleotide sequence may be of mixed genomic and synthetic origin, synthetic and mixed cDNA origin, or genomic and mixed cDNA origin, prepared by ligating the fragments of synthetic, genomic or cDNA origin (as appropriate) according to standard techniques. Each ligated fragment corresponds to various parts of the entire nucleotide sequence. The DNA sequence can also be prepared by polymerase chain reaction (PCR) using specific primers, for example, as described in US 4,683,202 or in Saiki RK et al., (Science (1988) 239, p. 487-491).

Due to degeneracy in the genetic code, nucleotide sequences can easily be produced in which the use of triplet codons, for some or all of the amino acids encoded by the original nucleotide sequence, has been changed, thus producing a nucleotide sequence with low homology to the original nucleotide sequence, but encoding the same amino acid sequence, or a variant, as that encoded by the original nucleotide sequence. For example, for most amino acids, the degeneracy of the genetic code is in the third position in the triplet codon (wobble position) (for reference see Stryer, Lubert, Biochemistry, 3rd edition, Freeman Press, ISBN 0-7167 -1920-7), therefore, a nucleotide sequence in which all triplet codons have been "wobbled" in the third position would be approximately 66% identical to the original nucleotide sequence; however, the corrected nucleotide sequence would encode the same primary amino acid sequence, or a variant, as the original nucleotide sequence.

Thus, the present invention further relates to any nucleotide sequence having alternative triplet codon usage for at least one amino acid encoding triplet codon, but encoding the same polypeptide sequence, or a variant, as the sequence of polypeptides encoded by the original nucleotide sequence.

Furthermore, specific organisms normally have a bias in that triplet codons are used to code for amino acids. Preferred codon usage tables are widely available and can be used to prepare codon optimized genes. Such codon optimization techniques are routinely used to optimize transgene expression in a heterologous host.

MOLECULAR EVOLUTION

Once an enzyme-encoding nucleotide sequence has been isolated and / or purified, or a putative enzyme-encoding nucleotide sequence has been identified, it may be desired to modify the desired nucleotide sequence, for example, it may be desired to mutate the sequence with the in order to prepare an enzyme having improved stability characteristics according to the present invention.

Mutations can be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites.

A suitable procedure is disclosed in Morinaga et al. (Biotechnology (1984) 2, p646-649). Another method of introducing mutations in nucleotide sequences encoding enzyme is described in Nelson and Long (Analytical Biochemistry (1989), 180, p 147-151).

Instead of site-directed mutagenesis, as described above, random mutations can be introduced, for example, using a commercial kit such as the Stratagene GeneMorph PCR Mutagenesis Kit, or the Diversify PCR Random Mutagenesis Kit. from Clontech.

A third method of obtaining novel sequences is to fragment non-identical nucleotide sequences, using both any number of restriction enzymes and an enzyme such as DNase I, and reassembling complete nucleotide sequences that encode functional proteins. Alternatively, one or more non-identical nucleotide sequences can be used and mutations introduced during reassembly of the complete nucleotide sequences.

Thus, it is possible to produce numerous site-directed or random mutations in a nucleotide sequence, both in vivo and in vitro, and subsequently screen for enhanced functionality of the encoded polypeptide by various means.

As a non-limiting example, mutations or wild-type variants of a polynucleotide sequence can be recombined with both wild-type mutations or other mutations and wild-type variants to produce new variants. Such new variants can also be screened to improve the functionality of the encoded polypeptide. The production of new preferred variants can be achieved by a variety of well-established procedures in the art, for example, error threshold mutagenesis (WO 92/18645), mediated random mutagenesis 14

ES 2 394 908 T3 by oligonucleotides (US 5,723,323), DNA shuffling (US 5,605,793), exo-mediated gene assembly (WO 0058517) or RCR® recombination chain reaction (EP 1230390 and US 6,821,758). Other suitable procedures are described, for example, in WO 0134835, WO 02/097130, WO 03/012100, WO03 / 057247, WO 2004/018674, US 6,303,344 and US 6,132,970.

The application of the aforementioned and similar molecular evolution procedures allows the identification and selection of variants of the enzymes of the present invention that have preferred characteristics without any prior knowledge of the structure or function of proteins, and allows the production of mutations or variants. not predictable, but beneficial. There are numerous examples of the application of molecular evolution in the art for the optimization or alteration of enzyme activity, such examples include, but are not limited to, one or more of the following: optimized expression and / or activity in a host cell or in vitro, elevated enzyme activity, altered substrate and / or product specificity, increased or decreased enzymatic or structural stability, altered enzyme activity / specificity under preferred environmental conditions, for example , temperature, pH, substrate

AMINO ACID SEQUENCES

The scope of the present invention also encompasses amino acid sequences of enzymes that have the specific properties defined herein.

As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein." In some cases, the term "amino acid sequence" is synonymous with the term "peptide". In some cases, the term "amino acid sequence" is synonymous with the term "enzyme".

The amino acid sequence can be prepared / isolated from a suitable source, or it can be prepared synthetically or it can be prepared using recombinant DNA techniques.

The enzyme encompassed in the present invention can be used in conjunction with other enzymes. Therefore, a combination of enzymes is also described herein in which the combination comprises the enzyme of the present invention and another enzyme, which may be another enzyme according to the present invention. This aspect is covered in a later section.

Preferably, the amino acid sequence when referred to and when encompassed by the scope of the present invention is not a native enzyme. In this regard, the term "native enzyme" means an entire enzyme that is in its native environment and when it has been expressed by its native nucleotide sequence.

VARIANTS / HOMOLOGIES / DERIVATIVES

The present invention also encompasses the use of variants, homologues and derivatives of any amino acid sequence of an enzyme or of any nucleotide sequence encoding such an enzyme.

Here, the term "homologous" means an entity that has a certain homology to amino acid sequences and nucleotide sequences. Here, the term "homology" can be equated with "identity." Suitably, "homologous" in this context refers to the percentage of sequence identity between two enzymes after their sequences are aligned using alignment algorithms as described in more detail below.

In the present context a homologous amino acid sequence is considered to include an amino acid sequence that may be at least 90% identical, preferably at least 95, 96, 97, 98 or 99% identical to the sequence. Typically, homologs will comprise the same active sites etc., for example, as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties / functions), it is preferred in the context of the present invention to express homology in terms of sequence identity.

By "functional fragment" is meant a fragment of the polypeptide that retains those characteristic properties of that polypeptide. In the context of the present invention, a functional fragment of a phytase enzyme is a fragment that retains the carotenoid cleavage capacity of the entire protein.

In the present context a homologous nucleotide sequence is considered to include a nucleotide sequence that may be at least 90% identical, preferably at least 95, 96, 97, 98 or 99% identical to a nucleotide sequence that encodes an enzyme of the present invention (the subject sequence). Typically, homologs will comprise the same sequences encoding active sites, etc., as the target sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties / functions), it is preferred in the context of the present invention to express homology in terms of sequence identity.

For amino acid sequences and nucleotide sequences, homology comparisons can be made by eye, or more normally, with the help of sequence comparison programs easily

ES 2 394 908 T3 available. These commercially available computer programs can calculate the% homology between two or more sequences.

% Homology can be calculated over contiguous sequences, that is, one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared to the corresponding amino acid in the other sequence, one residue at a time. This is called a "no gap" alignment. Typically, such gapless alignments are performed only on a relatively short number of residues.

Although this is a very simple and consistent procedure, it fails to take into account that, for example, in an otherwise identical pair of sequences, an insertion or deletion will cause the following amino acid residues to be pulled out of alignment, potentially producing a large reduction in% homology when performing a global alignment. Consequently, most sequence comparison procedures are designed to produce optimal alignments that take into account possible insertions and deletions without unduly penalizing the overall homology score. This is accomplished by inserting "gaps" into a sequence alignment to try to maximize local homology.

However, these more complex procedures assign "gap penalties" to each gap that occurs in an alignment such that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible, which reflects greater relationship Between the two sequences compared, it will score higher than one with many gaps. "Related gap costs" are typically used to charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimized alignments with fewer gaps. Most alignment programs allow you to modify gap penalties. However, it is preferred to use the default values ​​if such software is used for sequence comparisons. For example, if the GCG Wisconsin Bestfit package is used, the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

Therefore, the calculation of the maximum% homology first requires the production of an optimal alignment taking into account the gap penalties. A suitable computer program to carry out such an alignment is the GCG Wisconsin Bestfit package (Devereux et al. 1984 Nuc. Acids Research 12 p387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al., 1999 Short Protocols in Molecular Biology, 4^to ed - Chapter 18), FASTA (Altschul et al., 1990 J. Mol. Biol. 403-410) and the GENEWORKS set of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999, Short Protocols in Molecular Biology, pages 7-58 to 7-60).

However, for some applications, it is preferred to use the GCG Bestfit program. A new tool, called BLAST 2 Sequences, is also available to compare nucleotide and protein sequences (see FEMS Microbiol Lett 1999 174 (2): 247-50; FEMS Microbiol Lett 1999 177 (1): 187-8 and tatiana @ ncbi.nlm.nih.gov).

Although the final% homology can be measured in terms of identity, the alignment process itself is not normally based on an all or nothing pairwise comparison. Instead, a normalized similarity score matrix is ​​generally used that assigns scores to each matching comparison based on chemical similarity or evolutionary distance. An example of such a commonly used matrix is ​​the BLOSUM62 matrix, the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use both the public default values ​​and a custom symbol comparison table if supplied (see user manual for details). For some applications it is preferred to use the public default values ​​for the GCG package or, in the case of other software, the default matrix, such as BLOSUM62.

Alternatively, the percentage of homologies can be calculated using the feature of multiple alignments in DNASIS ™ (Hitachi Software), based on an algorithm, analogous to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73 (1), 237-244) .

Once the software has produced an optimal alignment it is possible to calculate% homology, preferably% sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

The sequences can also have deletions, insertions or substitutions of amino acid residues that produce a silent change and that produce a functionally equivalent substance. Deliberate amino acid substitutions can be made based on similarity in amino acid properties (such as polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or the amphipathic nature of the residues) and is therefore useful for grouping amino acids together in functional groups. Amino acids can be grouped together based on the properties of their side chain alone. However, it is also more useful to include mutation data. Thus, the sets of amino acids so derived are likely to be conserved for structural reasons. These sets can be described in the form of a Venn diagram (Livingstone CD and Barton GJ (1993) “Protein

ES 2 394 908 T3 sequence alignments: a strategy for the hierarchical analysis of residue conservation ”Comput. Appl Biosci. 9: 745756) (Taylor WR (1986) "The classification of amino acid conservation" J. Theor. Biol. 119; 205-218). Conservative substitutions can be made, for example, according to the following table which describes a generally accepted Venn diagram grouping amino acids.

<td>SET</td><td></td><td>SUBSET</td><td></td>

<td rowspan="2">Hydrophobe</td><td rowspan="2">FWYHKMILVAGC</td><td>Aromatic</td><td>FWYH</td>

<td>Aliphatic</td><td>SIL</td>

<td rowspan="3">Polar</td><td rowspan="3">WYHKREDCSTNQ</td><td>Loaded</td><td>HKRED</td>

<td>Positively charged</td><td>HKR</td>

<td>Negatively charged</td><td>ED</td>

<td>Little</td><td>VCAGSPTND</td><td>Tiny</td><td>AGS</td>

The present invention also encompasses conservative or homologous substitutions or mutations (substitution and replacement are both used herein to mean the exchange of an existing amino acid residue with an alternative residue) that may occur, ie, peer-to-peer substitution. Thus, the term "conservative mutation" refers to an amino acid mutation that one skilled in the art would consider conservative for a first mutation. "Conservative" in this context means conserve or invariant in terms of amino acid characteristics. If, for example, a mutation leads at a specific position to a substitution of an aromatic amino acid residue (for example, Tyr) with an aliphatic amino acid residue (for example, Leu), then a substitution at the same position with an amino acid Different aliphatic (eg, Ile or Val) is called a conservative mutation. Additionally, amino acid characteristics include residue size, hydrophobicity, polarity, charge, pK value, and other amino acid characteristics known in the art. Accordingly, a conservative mutation can include substitution such as basic with basic, acid with acid, polar with polar etc.

Non-conservative substitution can also occur, that is, from one class of residue to another or alternatively involving the inclusion of non-natural amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid-ornithine (hereinafter referred to as B) , norleucine-ornithine (hereinafter referred to as O), pyridylalanine, thienylalanine, naphthylalanine and phenylglycine.

Replacements can also be made with unnatural amino acids.

Variant amino acid sequences can include suitable spacer groups that can be inserted between any two amino acid residues in the sequence that include alkyl groups such as methyl, ethyl, or propyl groups, in addition to amino acid spacers such as glycine or β-alanine residues. Another form of variation involves the presence of one or more amino acid residues in peptoid form, it will be well understood by those skilled in the art. For the avoidance of doubt, "the peptoid form" is used to refer to variant amino acid residues in which the a-carbon substituent group is on the residue's nitrogen atom instead of the a-carbon. Procedures for preparing peptides in the peptoid form are known in the art, for example, Simon RJ et al., PNAS (1992) 89 (20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13 (4), 132-134.

Nomenclature

Conventional one letter and three letter codes for amino acid residues are used in the present invention. For ease of reference, mutations in enzyme variants are described using the following nomenclature: amino acid residue in the parent enzyme; position; substituted amino acid residue (s). According to this nomenclature, the substitution of, for example, an alanine residue with a glycine residue at position 20 is indicated as Ala20Gly or A20G. The alanine deletion in the same position is shown as Ala20 * or A20 *. The insertion of an additional amino acid residue (eg, a glycine) is indicated as Ala20AlaGly or A20AG. The deletion of a consecutive stretch of amino acid residues (eg, between alanine at position 20 and glycine at position 21) is indicated as A (Ala20-Gly21) or A (A20-G21). If a parent enzyme sequence contains a deletion compared to the enzyme sequence used for numbering, an insert at such a position (eg, an alanine at deleted position 20) is indicated as * 20Ala or * 20A. Multiple mutations are separated by a plus sign or a slash. For example, two mutations at positions 20 and 21 that replace alanine and glutamic acid with glycine and serine, respectively, are indicated as A20G + E21S or A20G / B21S. If an amino acid residue at a given position is substituted with two or more alternative amino acid residues, these residues are separated by a comma or slash. For example, substitution of alanine at position 30 with both glycine and glutamic acid is indicated as A20G, E or A20G / E, or A20G,

ES 2 394 908 T3

A20E. If a suitable position for modification is identified herein without any specific modification being suggested, it should be understood that any amino acid residue may be substituted with the amino acid residue present at the position. Thus, for example, if a modification of an alanine at position 20 is mentioned, but not specified, it should be understood that the alanine can be deleted or substituted with any other amino acid residue (i.e., any one of R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, V).

Nucleotide sequences for use in the present invention can include within them synthetic or modified nucleotides. Several different types of modification for oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones and / or the addition of acridine or polylysine chains at the 3 'and / or 5' ends of the molecule. For the purposes of the present invention it should be understood that the nucleotide sequences described herein may be modified by any method available in the art. Such modifications can be carried out in order to enhance the in vivo activity or duration of nucleotide sequences of the present invention.

Also described herein is the use of nucleotide sequences that are complementary to the sequences presented herein, or any derivative, fragment, or derivative thereof. If the sequence is complementary to a fragment of it, then that sequence can be used as a probe to identify similar coding sequences in other organisms, etc.

Polynucleotides that are not 100% homologous to the sequences of the present invention, but are within the scope of the invention, can be made in various ways. Other variants of the sequences described herein can be obtained, for example, by probing DNA libraries prepared from a series of individuals, for example, individuals from different populations. In addition, other homologs may be obtained and such homologs and fragments thereof may generally selectively hybridize to the sequences shown in the sequence listing herein. Such sequences can be obtained by probing cDNA libraries prepared from or genomic DNA libraries from other species, and probing such libraries with probes comprising all or part of any one of the sequences in the accompanying sequence listings under medium to high conditions. rigor. Similar considerations apply to obtaining species homologs and allelic variants of the polypeptide or nucleotide sequences of the invention.

Strain / species variants and homologs can also be obtained using degenerate PCR which will use primers designed for target sequences within variants and homologs that encode conserved amino acid sequences within the sequences of the present invention. Conserved sequences can be predicted, for example, by aligning the amino acid sequences of various variants / homologues. Sequence alignments can be performed using computer software known in the art. For example, the GCG Wisconsin PileUp program is widely used.

The primers used in degenerate PCR will contain one or more degenerate positions and will be used at lower stringency conditions than those used to clone sequences with single sequence primers against known sequences.

Alternatively, such polynucleotides can be obtained by site-directed mutagenesis of characterized sequences. This can be useful when, for example, silent codon sequence changes are required to optimize codon preferences for a particular host cell in which the polynucleotide sequences are being expressed. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites, or to alter the property or function of the polypeptides encoded by the polynucleotides.

The polynucleotides (nucleotide sequences) of the invention can be used to produce a primer, for example, a PCR primer, a primer for an alternative amplification reaction, a probe, for example, labeled with a telltale label by conventional means using labels radioactive or non-radioactive, or the polynucleotides can be cloned into vectors. Such primers, probes, and other fragments will be at least 15, preferably at least 20, eg, at least 25, 30, or 40 nucleotides in length, and are also encompassed by the term "polynucleotides of the invention" as used herein.

Polynucleotides such as DNA polynucleotides and probes according to the invention can be produced recombinantly, synthetically, or by any means available to those skilled in the art. They can also be cloned by conventional techniques.

In general, primers will be produced by synthetic means, which involves staggered manufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art.

Longer polynucleotides will generally be produced using recombinant means, for example using

ES 2 394 908 T3 cloning techniques by PCR (polymerase chain reaction). The primers can be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector.

BIOLOGICALLY ACTIVE

Preferably, the variant sequences, etc., are at least as biologically active as the sequences presented herein.

As used herein, "biologically active" refers to a sequence that has similar structural function (but not necessarily to the same degree) and / or similar regulatory function (but not necessarily to the same degree) and / or biochemical function. similar (but not necessarily to the same degree) of the sequence that occurs naturally.

In particular, the sequences of variants or modified forms thereof have an enzymatic profile similar to the profile of the phytase identified herein. This profile includes characteristics such as being a secreted protein that has an optimal pH in the range of pH 2 to 5.5, preferably 3.0 to 3.5, retaining at least 50% of the maximum activity with respect to the range of pH 2.0-5.5 and / or have a specific activity greater than 1000 U / mg.

HYBRIDIZATION

Also described herein are sequences that are complementary to the nucleic acid sequences of the present invention and sequences that can hybridize to both the sequences of the present invention and to sequences that are complementary thereto.

The term "hybridization" as used herein should include "the procedure by which a nucleic acid strand joins a complementary strand by base pairing", in addition to the amplification procedure as carried out in the technology. polymerase chain reaction (PCR).

The present description also discloses the use of nucleotide sequences that can hybridize to sequences that are complementary to the sequences presented herein, or any derivative, fragment, or derivative thereof.

The term "variant" also encompasses sequences that are complementary to sequences that can hybridize to the nucleotide sequences presented herein.

Preferably, the term "variant" encompasses sequences that are complementary to sequences that can hybridize under stringent conditions (eg 50 ° C and 0.2xSSC {IxSSC = 0.15 M NaCl, 0.015 M Na3citrate at pH 7.0}) with the nucleotide sequences presented herein.

More preferably, the term "variant" encompasses sequences that are complementary to sequences that can hybridize under high stringent conditions (eg 65 ° C and 0.1xSSC {1xSSC = 0.15 M NaCl, 0.015 M Na3citrate at pH 7.0} ) with the nucleotide sequences presented herein.

The description also describes nucleotide sequences that can hybridize to the nucleotide sequences of the present invention (including sequences complementary to those presented herein).

Also described herein are nucleotide sequences that are complementary to sequences that can hybridize to the nucleotide sequences of the present invention (including sequences complementary to those presented herein).

Also described herein are polynucleotide sequences that can hybridize to the nucleotide sequences presented herein under conditions of intermediate to maximum stringency.

Also described herein are nucleotide sequences that can hybridize to the nucleotide sequence of the present invention, or the complement thereof, under stringent conditions (eg, 50 ° C and 0.2xSSC).

Also described herein are nucleotide sequences that can hybridize to the nucleotide sequence of the present invention, or the complement thereof, under high stringent conditions (eg, 65 ° C and 0.1xSSC).

SITE-DIRECTED MUTAGENESIS

Once an enzyme-encoding nucleotide sequence has been isolated and / or purified, or a

In ES 2 394 908 T3 putative nucleotide sequence encoding enzyme, it may be desired to mutate the sequence in order to prepare an enzyme of the present invention.

Mutations can be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites.

A suitable procedure is disclosed in Morinaga et al. (Biotechnology (1984) 2, p646-649). Another method of introducing mutations in nucleotide sequences encoding enzyme is described in Nelson and Long (Analytical Biochemistry (1989), 180, p 147-151). Another procedure is described in Sarkar and Sommer (Biotechniques (1990), 8, p404-407 - "The megaprimer method of site directed mutagenesis").

RECOMBINING

In one aspect, the sequence for use in the present invention is a recombinant sequence, that is, a sequence that has been prepared using recombinant DNA techniques.

These recombinant DNA techniques are within the capabilities of one of ordinary skill in the art. Such techniques are explained in the literature, eg, J. Sambrook, EF Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press.

SYNTHETIC

In one aspect, the sequence for use in the present invention is a synthetic sequence, that is, a sequence that has been prepared by chemical or enzymatic synthesis in vitro. It includes, but is not limited to, sequences prepared with optimal codon usage for host organisms such as the methylotrophic yeasts Pichia and Hansenula.

ENZYME EXPRESSION

The nucleotide sequence for use in the present invention can be incorporated into a recombinant replicable vector. The vector can be used to replicate and express the nucleotide sequence, in enzyme form in and / or from a compatible host cell.

Expression can be controlled using control sequences, eg, regulatory sequences.

The enzyme produced by a recombinant host cell by expression of the nucleotide sequence can be secreted or can be contained intracellularly depending on the sequence and / or the vector used. The coding sequences can be designed with signal sequences that enhance direct secretion of the substance coding sequences through a particular prokaryotic or eukaryotic cell membrane.

Advantageously, the enzymes of the present invention are secreted.

EXPRESSION VECTOR

The terms "plasmid", "vector system" or "expression vector" mean a construct that can be expressed in vivo or in vitro. In the context of the present invention, these constructs can be used to introduce genes encoding enzymes into host cells. Suitably, the genes whose expression is introduced may be referred to as "expressible transgenes".

Preferably, the expression vector is incorporated into the genome of a suitable host organism. The term "incorporated" preferably covers stable incorporation into the genome.

The nucleotide sequences described herein that include the nucleotide sequence of the present invention may be present in a vector in which the nucleotide sequence is operably linked to regulatory sequences that can provide expression of the nucleotide sequence by a suitable host organism.

Vectors for use in the present invention can be transformed into a suitable host cell as described below to provide for expression of a polypeptide of the present invention.

The choice of vector, for example a plasmid, cosmid or phage vector will often depend on the host cell into which it is to be introduced.

Vectors for use in the present invention may contain one or more selectable marker genes such as a gene that confers resistance to antibiotics, eg, resistance to ampicillin, kanamycin, chloramphenicol or tetracycline. Alternatively, the selection can be carried out by co-transformation (as described in WO91 / 17243).

ES 2 394 908 T3

Vectors can be used in vitro, for example, for RNA production or used to transfect, transform, transduce, or infect a host cell.

Also described herein is a method of preparing nucleotide sequences of the present invention by introducing a nucleotide sequence of the present invention into a replicable vector, introducing the vector into a compatible host cell, and culturing the host cell under conditions that induce vector replication.

The vector may further comprise a nucleotide sequence that allows the vector to replicate in the host cell in question. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUB110, pE194, pAMB1, pU702 and pET11.

REGULATORY SEQUENCES

In some applications, the nucleotide sequence for use in the present invention is operably linked to a regulatory sequence that can provide for expression of the nucleotide sequence, such as by the chosen host cell. By way of example, the present invention covers a vector comprising the nucleotide sequence of the present invention operably linked to such a regulatory sequence, ie, the vector is an expression vector.

The term "operably linked" refers to a juxtaposition in which the described components are in a relationship that allows them to function as intended. A regulatory sequence "operably linked" to a coding sequence is linked in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.

The term "regulatory sequences" includes promoters and enhancers and other expression regulation signals.

The term "promoter" is used in the normal sense of the art, for example, an RNA polymerase binding site.

Enhanced expression of the nucleotide sequence encoding the enzyme of the present invention can also be achieved by selection of heterologous regulatory regions, eg, secretory promoter, leader, and terminator regions.

Preferably, the nucleotide sequence according to the present invention is operably linked to at least one promoter.

Examples of promoters suitable for directing nucleotide sequence transcription in a bacterial, fungal, or yeast host are well known in the art.

BUILDINGS

The term "construct", which is synonymous with terms such as "conjugate," "cassette," and "hybrid," includes a nucleotide sequence for use according to the present invention directly or indirectly linked to a promoter.

An example of an indirect attachment is the provision of a suitable spacer group such as an intron sequence, such as the Sh1 intron or the ADH intron, intermediate to the promoter and nucleotide sequence of the present invention. The same is true for the term "fused" in relation to the present invention, which includes direct or indirect bonding. In some cases, the terms do not cover the natural combination of the nucleotide sequence encoding the protein generally associated with the promoter of the natural gene and when both are in their natural environment.

The construct may even contain or express a marker, which allows selection of the genetic construct.

For some applications, preferably the construct of the present invention comprises at least the nucleotide sequence of the present invention operably linked to a promoter.

HOST CELLS

The term "host cell" in relation to the present invention includes any cell that comprises both the nucleotide sequence and an expression vector as described above and that is used in the recombinant production of an enzyme having the specific properties as described above. defined herein or in the methods of the present invention.

Thus, another embodiment of the present invention provides host cells transformed or transfected with a nucleotide sequence that expresses the enzymes described in the present invention. Cells to be chosen 21

ES 2 394 908 T3 to be compatible with said vector and can be, for example, prokaryotic (eg bacterial), fungal, yeast or plant cells. Preferably, the host cells are not human cells.

Examples of suitable bacterial host organisms are Gram-positive or Gram-negative species of bacteria.

Depending on the nature of the nucleotide sequence encoding the enzyme of the present invention, and / or the desirability of further processing the expressed protein, eukaryotic hosts such as yeast or other fungi may be preferred. Yeast cells are generally preferred over fungal cells because they are easier to manipulate. However, some proteins are both poorly secreted from the yeast cell, and in some cases not properly processed (eg, hyperglycosylation in yeast). In these cases a different fungal host organism should be selected.

The use of suitable host cells, such as yeast, fungal, and plant host cells, can provide post-translational modifications (eg, myristoylation, glycosylation, truncation, stoning, and tyrosine, serine, or threonine phosphorylation) as may be needed to confer Optical biological activity to recombinant expression products of the present invention.

The host cell can be a protease-deficient or protease-less strain.

The genotype of the host cell can be modified to improve expression.

Examples of host cell modifications include protease deficiency, rare tRNA supplementation, and modification of reducing potential in the cytoplasm to enhance disulfide bond formation.

For example, the host cell E. coli can overexpress rare tRNAs to enhance the expression of heterologous proteins as exemplified / described in Kane (Curr Opin Biotechnol (1995), 6, 494-500 “Effects of rare codon clusters on high -level expression of heterologous proteins in E. coli "). The host cell can be deficient in several reducing enzymes, thus favoring the formation of stable disulfide bonds as exemplified / described in Bessette (Proc Natl Acad Sci USA (1999), 96, 13703-13708 "Efficient folding of bonds with multiple disulphide in the Escherichia coli cytoplasm ”).

In one embodiment, host cells in the context of the present invention include those cells that can be added directly to animal feed.

ORGANISM

The term "organism" in relation to the present description includes any organism that can comprise the nucleotide sequence that encodes the enzymes described in the present invention and / or products obtained therefrom and / or in which a promoter it can allow the expression of the nucleotide sequence according to the present invention when it is present in the body.

Suitable organisms can include a prokaryote, fungus, yeast, or a plant.

The term "transgenic organism" in relation to the present description includes any organism that comprises the nucleotide sequence that encodes the enzymes described in the present invention and / or the products obtained therefrom, and / or in which a promoter can allow the expression of the nucleotide sequence according to the present invention within the body. Preferably, the nucleotide sequence is incorporated into the genome of the organism.

The term "transgenic organism" does not cover native nucleotide coding sequences in their natural environment when they are under the control of their native promoter that is also in their natural environment.

Thus, the transgenic organism of the present disclosure includes an organism that comprises any one of, or combinations of, the nucleotide sequence that encodes the enzymes described in the present invention, constructs according to the present invention, vectors according to the present invention , plasmids according to the present invention, cells according to the present invention, tissues according to the present invention, or the products thereof.

For example, the transgenic organism can also comprise the nucleotide sequence encoding the enzyme of the present invention under the control of a heterologous promoter.

HOST / ORGANISM CELL TRANSFORMATION

As indicated above, the host organism can be a prokaryotic or eukaryotic organism. Examples of suitable prokaryotic hosts include E. coli and Bacillus subtilis.

The teachings of prokaryotic host transformation are well documented in the art, for

ES 2 394 908 T3 example, see Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2^to edition, 1989, Cold Spring Harbor Laboratory Press). Other suitable procedures are explained in the examples herein. If a prokaryotic host is used, then the nucleotide sequence may need to be appropriately modified prior to transformation, such as by removing introns.

Filamentous fungal cells can be transformed using various procedures known in the art, such as a procedure involving the formation of protoplasts and transformation of the protoplasts, followed by regeneration of the cell wall in a known manner. The use of Aspergillus as a host microorganism is described in EP 0 238 023.

Another host organism can be a plant. A review of the general techniques used to transform plants can be found in articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42: 205-225) and Christou (Agro-Food-Industry Hi-Tech March / April 1994 17- 27). Other teachings on plant transformation can be found in EP-A-0449375.

General teachings on the transformation of fungi, yeasts and plants are presented in the following sections.

TRANSFORMED FUNGUS

A host organism can be a fungus, such as a filamentous fungus. Examples of such suitable hosts include any member belonging to the genera Thermomyces, Acremonium, Aspergillus, Penicillium, Mucor, Neurospora, Trichoderma, and the like.

The teachings on the transformation of filamentous fungi are reviewed in US-A-5741665 which states that conventional techniques for the transformation of filamentous fungi and the cultivation of the fungi are well known in the art. A comprehensive review of techniques as they apply to N. crassa is found, for example, in Davis and de Serres, Methods Enzymol (1971) 17A: 79-143.

Other teachings on the transformation of filamentous fungi are reviewed in US-A-5674707.

In one aspect, the host organism can be of the genus Aspergillus, such as Aspergillus niger.

A transgenic Aspergillus according to the present description can also be prepared following, for example, the teachings of Turner G. 1994 (Vectors for genetic manipulation. In: Martinelli SD, Kinghorn JR (Editors) Aspergillus: 50 years on. Progress in industrial microbiology vol 29 Elsevier Amsterdam 1994. pp. 641-666).

Gene expression in filamentous fungi has been reviewed in Punt et al. (2002) Trends Biotechnol 2002 May; 20 (5): 200-6, Archer &amp; Peberdy Crit Rev Biotechnol (1997) 17 (4): 273-306.

TRANSFORMED YEAST

In another embodiment, the transgenic organism can be a yeast.

A review of the principles of heterologous gene expression in yeast is provided in, for example, Methods Mol Biol (1995), 49: 341-54, and Curr Opin Biotechnol (1997) Oct; 8 (5): 554-60

In this regard, yeast, such as Saccharomyces cerevisiae or Pichia pastoris species (see FEMS Microbiol Rev (2000 24 (1): 45-66)), can be used as a vehicle for heterologous gene expression.

A review of the principles of heterologous gene expression in Saccharomyces cerevisiae and the secretion of gene products is provided by E Hinchcliffe E Kenny (1993, "Yeast as a vehicle for expression of the heterologous genes", Yeasts, vol 5, Anthony H Rose and J Stuart Harrison, eds, 2nd edition, Academic Press Ltd.).

For the transformation of yeast several transformation protocols have been developed. For example, a transgenic Saccharomyces according to the present disclosure can be prepared by the following teachings of Hinnen et al., (1978, Proceedings of the National Academy of Sciences of the Usa 75, 1929); Beggs, JD (1978, Nature, London, 275, 104); and Ito, H et al. (1983, J Bacteriology 153, 163-168).

Transformed yeast cells can be selected using various selective markers, such as auxotrophic markers of dominant antibiotic resistance markers.

PLANTS / PLANT CELLS TRANSFORMED

A suitable host organism for the present invention can be a plant. A review of general techniques can be found in articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42: 205-225) and Christou (Agro-Food-Industry Hi-Tech March / April 1994 17-27).

ES 2 394 908 T3

CULTIVATION AND PRODUCTION

Host cells transformed with the nucleotide sequence of the present invention can be cultured under conditions conducive to the production of the encoded enzyme and which facilitate recovery of the enzyme from cells and / or culture medium.

The medium used to cultivate the cells can be any conventional medium suitable for cultivating the host cell in question and obtaining expression of the enzyme.

The protein produced by a recombinant cell can be expressed on the surface of the cell.

The enzyme can be secreted from host cells and can be conveniently recovered from the culture medium using well known procedures.

SECRETION

It may be desirable for the enzyme to be secreted from the expression host into the culture medium from which the enzyme can more easily be recovered. According to the present invention, the secretion leader sequence can be selected based on the desired expression host. Hybrid signal sequences can also be used in the context of the present invention.

Typical examples of heterologous secretory leader sequences are those originating from the fungal amyloglucosidase (AG) gene (glaA - both the 18 and 24 amino acid versions, e.g. from Aspergillus), the factor a gene (yeast eg Saccharomyces, Kluyveromyces and Hansenula) or the α-amylase gene (Bacillus).

By way of example, the secretion of heterologous proteins in E. coli is reviewed in Methods Enzymol (1990) 182: 13243.

DETECTION

A variety of protocols for detecting and measuring amino acid sequence expression are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence-activated flow cytometry (FACS).

A wide variety of conjugation labels and techniques are known to those skilled in the art and can be used in various nucleic acid and amino acid assays.

Several companies such as Pharmacia Biotech (Piscataway, NJ), Promega (Madison, WI), and US Biochemical Corp (Cleveland, OH) supply commercial kits and protocols for these procedures.

Suitable reporter molecules or labels include those radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like. Patents teaching the use of such marks include US-A-3,817,837; US-A3,850,752; US-A-3,939,350; US-A-3,996,345; US-A-4,277,437; US-A-4,275,149 and US-A-4,366,241.

Thus, recombinant immunoglobulins can be produced as shown in US-A-4,816,567.

Other suitable assays for detecting phytase activity are known in the art and are exemplified herein.

FUSION PROTEINS

The amino acid sequence for use according to the present invention can be produced as a fusion protein, for example, to aid in extraction and purification. Examples of fusion protein components include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA-binding and / or transcriptional activation domains), and (β-galactosidase). It may also be desirable to include a proteolytic cleavage site between the fusion protein component and the protein sequence of interest to allow removal of the fusion protein sequences.

Preferably, the fusion protein will not hinder the activity of the protein sequence.

Gene fusion expression systems in E. coli have been reviewed in Curr Opin Biotechnol (1995) 6 (5): 501-6.

In another embodiment of the invention, the amino acid sequence can be linked to a heterologous sequence to encode a fusion protein. For example, to screen peptide libraries for agents that can affect the activity of the substance it may be useful to encode a chimeric substance that expresses a heterologous epitope that is recognized by a commercially available antibody.

ES 2 394 908 T3

ADDITIONAL SEQUENCES

The sequences for use according to the present invention can also be used in conjunction with one or more additional proteins of interest (POI) or nucleotide sequences of interest (NOI).

Non-limiting examples of POIs include: xylanase, lipases, acid phosphatases, and / or others. These include enzymes that, for example, modulate the viscosity of the feed. The NOI can even be an antisense sequence for any of those sequences.

POI can even be a fusion protein, for example to aid extraction and purification or to enhance phytate metabolism in vivo.

POI can even be fused with a secretion sequence.

Other sequences can also facilitate secretion or increase the yield of secreted POI. Such sequences could encode chaperone proteins such as, for example, the Aspergillus niger cyp B gene product described in GB patent application 9821198.0.

The NOI encoding POI can be manipulated in order to alter its activity for various reasons including, but not limited to, alterations that modify the processing and / or expression of the expression product thereof. By way of another example, the NOI can also be modified to optimize expression in a particular host cell. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites.

The NOI encoding POI may include within it synthetic or modified nucleotides such as methylphosphonate and phosphorothioate backbones.

The NOI encoding POI can be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of sequences flanking the 5 'and / or 3' ends of the molecule or the use of phosphorothioate or 2'-O-methyl instead of phosphodiesterase linkages within the backbone of the molecule. molecule.

ANTIBODIES - for reference only

One aspect of the present disclosure relates to amino acids that are immunologically reactive with the amino acid of SEQ ID NO. 3.

Antibodies can be produced by conventional techniques, such as by immunization with the substance of the invention or using a phage display library.

For the purposes of this description, the term "antibody", unless otherwise specified, includes, but is not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, fragments produced by a Fab expression library , in addition to mimetics of the same. Such fragments include whole antibody fragments that retain their binding activity for a target substance, Fv, F (ab '), and F (ab') 2 fragments, as well as single chain antibodies (scFv), fusion proteins, and other synthetic proteins that they comprise the antigen-binding site of the antibody. Furthermore, the antibodies and fragments thereof can be humanized antibodies. Neutralizing antibodies, that is, those that inhibit the biological activity of substance polypeptides, are especially preferred for diagnostics and therapeutics.

If polyclonal antibodies are desired, a selected mammal (eg, mouse, rabbit, goat, horse, etc.) is immunized with the sequence of the present invention (or a sequence comprising an immunological epitope thereof). Depending on the host species, various adjuvants can be used to enhance the immune response.

Serum from the immunized animal is collected and treated according to known procedures. If the serum containing polyclonal antibodies to the sequence of the present invention (or a sequence comprising an immunological epitope thereof) contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing polyclonal antisera are known in the art. In order that such antibodies can be prepared, the disclosure also provides polypeptides of the invention or fragments thereof haptenized with another polypeptide for use as immunogens in animals or humans.

Monoclonal antibodies directed against the sequence of the present invention (or a sequence comprising an immunological epitope thereof) can also be easily produced by one of ordinary skill in the art and include, but are not limited to, the hybridoma technique of Koehler and Milstein ( 1975 Nature 256: 495-497), the human B lymphocyte hybridoma technique (Kosbor et al., (1983) Immunol Today 4:72; Cote et al., (1983) Proc Natl Acad Sci 80: 2026-2030) and the EBV hybridoma technique (Cole et al., (1985) Monoclonal Antibodies and Cancer

ES 2 394 908 T3

Therapy, Alan Rickman Liss Inc, pp 77-96).

In addition, techniques developed for the production of "chimeric antibodies", splicing of mouse antibody genes to human antibody genes can be used to obtain a molecule with appropriate antigen specificity and biological activity (Morrison et al., (1984 ) Proc Natl Acad Sci 81: 6851-6855; Neuberger et al., (1984) Nature 312: 604-608; Takeda et al., (1985) Nature 314: 452-454).

Alternatively, the techniques described for the production of single chain antibodies (US Patent No. 4,946,779) can be adapted to produce the substance specific single chain antibodies.

Antibody fragments containing specific binding sites for the substance can also be generated. For example, such fragments include, but are not limited to, F (ab ') 2 fragments that can be produced by pepsin digestion of the antibody molecule and Fab fragments that can be generated by reducing the disulfide bridges of the F (ab') fragments. ab ') 2. Alternatively, Fab expression libraries can be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse WD et al., (1989) Science 256: 1275-128 1).

LARGE-SCALE APPLICATION

In a preferred embodiment of the present invention, the amino acid sequence encoding a phytase derived from C. freundii or the methods of the present invention are used for large-scale applications. In particular, the processes of the present invention can be used for the large-scale production of phytases for industrial use as additives / supplements for food or feed compositions.

Preferably, the amino acid sequence is produced in an amount of 5 g per liter to about 10 g per liter of the total cell culture volume after culturing the host organism.

Preferably, the amino acid sequence is produced in an amount from 100 mg per liter to about 900 mg per liter of the total cell culture volume after culturing the host organism.

Preferably, the amino acid sequence is produced in an amount of 250 mg per liter to about 500 mg per liter of the total cell culture volume after culturing the host organism.

USE OF PHYTASES

As stated above, the present invention also relates to the production of phytases as described herein.

In particular, the present description also relates to the use of amino acid sequences as disclosed herein in the production of organic and inorganic phosphate compounds.

Thus, the present invention further relates to the use of the nucleotide sequences encoding phytases in the generation of expression vectors or systems for the expression of phytases.

Furthermore, the present invention relates to the use of such expression vectors or systems in the generation of host cells expressing phytases.

The description further relates to the use of modified host cells in the generation of precursors of organic and inorganic phosphate compounds or in the generation of specific organic phosphate compounds.

Suitable inorganic and organic phosphate compounds include myo-inositol pentakis-, tetrakis-, tris-, bis- and monophosphates.

Suitably described herein is a process for the production of an organic phosphate compound which comprises treating the phytate with a phytase derived from Citrobacter freundii. Preferably, the method is characterized in that the enzyme comprises the amino acid sequences shown as SEQ ID NO: 3 or a sequence that has at least 75% identity (homology) with the same or an effective fragment, or modified form of the herself. Suitably the organic phosphate is phytate or all possible stereoisomers of myo-inositol di-, tri-, tetra- and pentaphosphates. Other suitable organic phosphates include inositol tetraphosphates and inositol oligophosphates. In a preferred embodiment, the process is an in vivo biotechnological process.

Such processes for producing an organic phosphate compound may suitably comprise the steps of:

a) providing a host cell comprising expressible transgenes comprising C. freundii phytase;

b) cultivating the transgenic organism under conditions suitable for the expression of the transgene; Y

ES 2 394 908 T3

c) recovering the organic phosphate compound from the culture.

The compounds can be used for various applications including assays for the characterization of phytases. Some inositol phosphates participate as signal molecules in intracellular regulation and research chemicals can be used.

In another aspect a process for the production of animal food or feed is provided. Animal feed is normally produced in feed mills in which starting materials are first ground to a suitable particle size and then mixed with appropriate additives. The feed can then be produced as a bran or pellets; the latter usually involves a process whereby the temperature is raised to a target level and then the feed is passed through a nozzle to produce granules of a particular size. Later liquid additives such as fat and enzyme can be added. The granules are allowed to cool before transport. The production of animal feed can also involve an additional step that includes extrusion or expansion before granulation.

Accordingly, the invention further provides the use of an amino acid sequence encoding a phytase or a host cell expressing a phytase to produce a phytase for use in the manufacture of a food or feed product. In one aspect there is provided a use of an amino acid sequence as described herein in the manufacture of a food or feed product. In another aspect there is provided a use of a host cell according to the invention in the manufacture of a food or feed product. In another aspect there is provided a use of an expression vector or system according to the invention in the manufacture of a food or feed product.

The present invention also covers using the enzymes as a component of combinations of feed with other components for administration to animals.

COMBINATION WITH OTHER COMPONENTS

The enzymes of the present invention can be used in combination with other components or carriers.

Suitable carriers for feed enzymes include wheat (coarsely ground). In addition, there are various encapsulation techniques including those based on fat / wax coverage, adding vegetable gums, etc.

Examples of other components include one or more of: thickeners, gelling agents, emulsifiers, binders, crystal modifiers, sweeteners (including artificial sweeteners), rheology modifiers, stabilizers, antioxidants, colorants, enzymes, supports, vehicles, excipients, diluents, lubricants , flavorings, coloring matter, suspending agents, disintegrants, granulation binders, etc. These other components can be natural. These other components can be prepared using chemical and / or enzymatic techniques.

As used herein, the term "thickener or gelling agent" as used herein refers to a product that prevents separation by slowing or preventing the movement of particles, both immiscible liquid droplets, air, and insoluble solids.

The term "stabilizer" as used herein is defined as an ingredient or combination of ingredients that prevents a product (eg, a food product) from changing over time.

The term "emulsifier" as used herein refers to an ingredient (eg, a food product ingredient) that prevents the separation of emulsions.

As used herein, the term "binder" refers to an ingredient (eg, a food ingredient) that is bound together with the product through a physical or chemical reaction.

The term "crystal modifier" as used herein refers to an ingredient (eg, a food ingredient) that affects the crystallization of both fat and water.

"Carriers" or "carriers" mean materials suitable for the administration of compounds and include any such material known in the art such as, for example, any liquid, gel, solvent, liquid diluent, solubilizer or the like, which is non-toxic and which it does not interact with any component of the composition in a harmful way.

Examples of nutritionally acceptable vehicles include, for example, grain, water, saline solutions, alcohol, silicone, waxes, petroleum jelly, vegetable oils, and the like.

Examples of excipients include one or more of: microcrystalline cellulose and other celluloses, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate, glycine, starch, milk sugar, and high molecular weight polyethylene glycols.

ES 2 394 908 T3

Examples of disintegrants include one or more of: starch (preferably corn, potato, or tapioca starch), sodium starch glycolate, croscarmellose sodium, and certain complex silicates.

Examples of granulation binders include one or more of: polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, maltose, gelatin, and acacia.

Examples of lubricants include one or more of: magnesium stearate, stearic acid, glyceryl behenate, and talc.

Examples of diluents include one or more of: water, ethanol, propylene glycol, and glycerin, and combinations thereof.

The other components can be used simultaneously (for example, when they are mixed together or even when administered by different routes) or sequentially (for example, they can be administered by different routes).

As used herein, the term "component suitable for animal or human consumption" means a compound that is or can be added to the composition of the present invention as a supplement that can be of nutritional benefit, a substitute for fiber, or have a generally beneficial effect on the consumer.

By way of example, the components can be prebiotics such as alginate, xanthan, pectin, locust bean gum (LBG), inulin, guar gum, galacto-oligosaccharide (GOS), fructo-oligosaccharide (FOS), lacto-sucrose, soybean oligosaccharides, palatinose, isomalto-oligosaccharides, gluco-oligosaccharides and xyl-oligosaccharides.

FOOD OR FEED SUBSTANCE

The compounds can be used as, or in the preparation of, a food or feed substance. Here, the term "food" is used in a broad sense and covers food and foodstuffs for human beings, as well as animal feed (ie, a feed). The term "feed" is used in reference to products that are fed to animals in livestock farming. In a preferred aspect, the food or feed is for consumption by monogastric animals such as pork, poultry, and fish.

The food or feed can be in the form of a solution or as a solid, depending on the use and / or the mode of application and / or the mode of administration.

INGREDIENTS AND FOOD AND FEED SUPPLEMENTS

The compounds can be used as a food or feed ingredient.

As used herein, the term "food or feed ingredient" includes a formulation that is or can be added to foods or edibles and includes formulations that can be used at low levels in a wide variety of products.

The food ingredient may be in the form of a solution or as a solid, depending on the use and / or the mode of application and / or the mode of administration.

The compounds can be, or can be added to, food supplements.

FOOD AND FEED COMPOSITIONS

Monogastric animal feed compositions typically include compositions comprising phytate-containing plant products. Such compositions include cornmeal, soybean meal, rapeseed meal, cottonseed meal, corn-based feed, wheat, barley, and sorghum.

The phytases described herein can be, or can be added to, food or feed compositions.

The present invention also provides a process for the preparation of a food or feed ingredient or supplement, which process comprises mixing phytases produced by the process of the present invention or the composition according to the present invention with another food ingredient. The process for preparing a food ingredient is also another aspect of the present invention. The procedures for preparing animal feed have been explained above. The enzyme can also be added in the form of a solid formulation, or as a feed additive, such as a premix. A solid form is usually added before or during the mixing step; and a liquid form is normally added after the granulating step.

ES 2 394 908 T3

PHARMACEUTICAL AGENTS - for reference only

The phytases of the present disclosure can also be used in pharmaceutical preparations or for combination in edibles in order to provide some pharmaceutical effect. For example, EP 1,389,915 describes the use of a phytase in a food or drink to increase the availability of calcium, iron and / or zinc from the food or drink for humans.

Furthermore, EP 1,392,353 describes a phytase-containing medicament or nutritional supplement that is useful for increasing the bioavailability of bioelements, for example calcium and iron, and for combating deficiency diseases.

Here, the term "pharmaceutical agent" is used in a broad sense and covers pharmaceuticals and / or nutritional products for humans, as well as pharmaceuticals and / or nutritional products for animals (ie, veterinary applications). In a preferred aspect, the pharmaceutical agent is for human use and / or for the livestock industry.

The pharmaceutical agent can be for therapeutic purposes, which can be curative or palliative or preventive in nature. The pharmaceutical agent can even be for diagnostic purposes.

When used as, or in the preparation of, a pharmaceutical agent, the product and / or compounds of the present disclosure may be used in conjunction with one or more of: a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, a pharmaceutically acceptable adjuvant, a pharmaceutically active ingredient.

The pharmaceutical agent may be in the form of a solution or as a solid, depending on the use and / or the mode of application and / or the mode of administration.

PHARMACEUTICAL COMPONENT - for reference only

The product and / or compounds of the present invention can be used as pharmaceutical components. Here, the product and / or composition of the present invention may be the only active component or it may be at least one of several (ie 2 or more) active components.

The pharmaceutical component may be in the form of a solution or as a solid, depending on the use and / or the mode of application and / or the mode of administration.

The pharmaceutical component may be in the form of an effervescent product to improve the dissolution properties of the pharmaceutical agent.

SHAPES

The product and / or compounds of the present invention can be used in any suitable form, whether alone or when present in a composition. Also, the phytases produced according to the present invention (ie ingredients such as food ingredients, functional food ingredients) can be used in any suitable way.

Suitable examples of forms include one or more of: tablets, pills, capsules, ovules, solutions or suspensions, which may contain flavorings or colorants for immediate, delayed, modified, sustained, pulsed or controlled release administrations.

By way of example, if the product and / or composition are used in a tablet form, such as for use as a functional ingredient, the tablets may also contain one or more of: excipients, disintegrants, granulation binders, or lubricants.

Examples of nutritionally acceptable carriers for use in preparing the forms include, for example, water, saline solutions, alcohol, silicone, waxes, petroleum jelly, and the like.

Preferred excipients for the forms include lactose, starch, a cellulose, milk sugar, or high molecular weight polyethylene glycols.

For aqueous suspensions and / or elixirs, the carotenoid cleavage compounds can be combined with various sweeteners or flavors, coloring or coloring matter, with emulsifiers and / or suspending agents, and with diluents such as water, ethanol, propylene glycol, and glycerin, and combinations thereof.

The forms can also include gelatin capsules; fiber capsules, fiber tablets, etc.

ES 2 394 908 T3

GENERAL RECOMBINANT DNA METHODOLOGY TECHNIQUES

The present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, and immunology that are within the capabilities of one of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, EF Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, FM et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, Chapters 9, 13 and 16, John Wiley &amp; Sons, New York, NY); B. Roe, J. Crabtree and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley &amp; Sons; MJ Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, IRL Press; and, DMJ Lilley and JE Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press.

EXAMPLES

The invention is now further illustrated in the following non-limiting examples.

Example 1. Phytase activity assay.

Phytase assays were carried out in microtiter plates. The reaction mixture (100 µl) contained: 2 mM phytate and 0.8 mM CaCl2 in 200 mM sodium acetate buffer, pH 3.5. The reaction was allowed to proceed for 1 hr at 37 ° C, after which time the released phosphate was measured by a modification of a known procedure (Heinonen JK, Lahti RJ. Anal Biochem. 113 (2), 313-317 (1981) ). Briefly, 200 µl of a freshly prepared AMM solution (7.5 N H2SO4, 15 mM ammonium molybdate and acetone - 1: 1: 2) was added to the 100 µl reaction mixture in each well of the microtiter plate. . The absorbance at 390 nm was measured no earlier than 10 min and no later than 30 min after the addition of the AMM reagent. The amount of phosphate was determined by forming a calibration curve with phosphate solutions of known concentrations. To test the phytase activity at different pH values, the following buffers were used (all 200 mM): glycine / HCl between pH 2.0 and 3.0, sodium acetate / acetic acid between pH 3.5 and 5.5, Tris / maleic acid between pH 6.0 and 7.5.

Example 2. Phytase-producing strain P3-42.

The bacterial strain P3-42 was originally isolated from a mass of fallen birch leaves collected from a humid forest in southern Finland. The strain can be grown aerobically at 30 ° C in many simple culture media, for example LB medium (1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.4) or low phosphate PP1 (1% peptone, 1% beef extract, 0.5% yeast extract, 0.2M CaCl2. The medium is adjusted to pH 11 with NaOH and boiled for 10 min. The precipitate is removed by filtration, the pH is readjusted to 5.5 and the medium is sterilized in an autoclave for 15 min at 121 ° C).

After growth in liquid PP1 medium, the strain was found to exhibit phytase activity at both pH 3.5 and 5.5 (tested as described in Example 1). The ratio of activities at 3.5 and 5.5 was approximately 1.5. Activity was also measured separately in cells and P342 culture supernatant. Based on these measurements, approximately 90% of all phytase activity was found in the supernatant. The strain was deposited with NCIMB on September 22, 2004 under accession number NCIMB 41247.

Example 3. Isolation of chromosomal DNA from strain P3-42.

Chromosomal DNA was prepared essentially by the standard procedure (Ausubel et al., Current Protocols in Molecular Biology, John Wiley &amp; Sons, New York, 1996). A 250 ml culture grown overnight at 30 ° C in LB medium was centrifuged at 10,000 rpm for 30 min, washed in 20 ml of 50 mM Tris-HCl, 5 mM EDTA at pH 8 and re-suspended at 10 ml of cold TES (50 mM Tris-HCl, 5 mM EDTA, 15% glucose at pH 8). Lysozyme was added at 10 mg / ml and the cell suspension was incubated at 37 ° C for 30 - 60 min until lysis occurred, determined by diluting 100 µl of the reaction mixture in 1 ml of 1% SDS and checking for a "slimy" consistency. At that time, SDS and proteinase K (Sigma) were added to a final concentration of 1% and 0.5 mg / ml, respectively. The reaction mixture was incubated for 30 min at 56 ° C, followed by the addition of 2 ml of 5 M NaCl and 1.4 ml of 10% cetyltrimethylammonium bromide (Sigma). Incubation continued for 15 min at 65 ° C. The solution was extracted once with chloroform / isoamyl alcohol (24: 1) and once with phenol / chloroform. After the extractions, the aqueous phase was mixed with 0.6 vol of isopropanol, the precipitated DNA was collected by centrifugation (10,000 rpm, 15 min), washed with 70% ethanol, dried under vacuum and re-suspended. in 2 ml of 10 mM Tris-HCl, 1 mM EDTA at pH 8.5, 5 pg / ml of RNAse.

Example 4. Taxonomic identification of the bacterial strain P3-42.

A 16S rRNA gene fragment from strain P3-42 was amplified by polymerase chain reaction (PCR) with Taq DNA polymerase (Roche) using primers 536f (CAGCMGCCGCGGTaAtWC) and 1392r (ACGGGCGGTGTGTRC) (Lane, DJ en Nucleic acid techniques in bacterial systematics, Stackbrandt, E. and Goodfellow, M. eds, John Wiley &amp; Sons, New York: pp. 115-117 (1991)). The following program was used: 1) stage 30

ES 2 394 908 T3 of initial DNA denaturation of 5 min at 95 ° C; 2) 30 cycles of 1 min at 94 ° C, 1 min at 55 ° C, 1 min at 72 ° C; 3) a final extension step of 70 ° C for 10 min. The PCR products, approximately 900 base pairs in size, were purified by electrophoresis on 0.8% agarose gel and extracted from the gel using a PCR purification kit (Qiagen) according to the manufacturer's instructions. The purified PCR products were sequenced by Medprobe (Norway) as a commercial service. The sequenced area is listed as SEQ ID No. 1. This sequence was compared to the DNA sequences in the GenBank database (http://www.ncbi.nlm.nih.gov/blast/). The highest match (823 out of 824 nucleotides, 99.9%) was found with the sequence of the 16S RNA gene of DSM 30039 from Citrobacter freundii. Thus, strain P3-42 can be taxonomically classified as Citrobacter freundii.

Example 5. Cloning of the C. freundii P3-42 phytase gene.

Chromosomal DNA from Citrobacter freundii strain P3-42 was partially digested with restriction endonuclease Sau3A and the digest was fractionated on 1% agarose gel. The 3 to 5 kb DNA fragments were isolated from the gel using a gel purification kit (Qiagen) and ligated with BamHI digested dephosphorylated λ-ZAP arms (Stratagene). Subsequent steps for library construction followed the instructions in Stratagene's ZAP Express Predigested Vector / Gigapack Cloning Kit. The phage form of the library was converted to a plasmid form by the "bulk excision" procedure as described by the manufacturer (Stratagene). Screening of the plasmid library was done similarly to previously published procedures for the detection of phytase activity in Petri dishes (Howson and Davis. Enzyme Microb. Technol. 5, 377-382 (1983); Chen JC Biotechnology techniques 12 (10) 751-761 (1998); Riccio ML et al., J. Appl. Microbiol. 82, 177-185 (1997)). Several phytase positive clones were isolated and purified by subcloning. These isolated strains were grown in liquid culture (LB medium at 30 ° C and 200 rpm for approximately 24 h) and the phytase activity (Example 1) was measured in the resulting cell suspensions. A clone that had the highest phytase activity (approximately 5 U / ml at pH 3.5) was selected for further characterization. Plasmid DNA was isolated from this clone, named pBK (P3-42), and characterized by partial DNA sequencing of the insert DNA (the sequencing service was obtained from Medprobe (Norway)). This sequence comprising the phytase gene is listed SEQ ID NO: 2. The deduced amino acid sequence of C. freundii phytase is listed SEQ ID NO: 3. Comparison of SEQ ID NO: 3 with the sequences in GenBank using the BLAST service provided by NCBI (http://www.ncbi.nlm.nih.gov/blastl) identifies E. coli phytase as the homolog most related known of C. freundii phytase. However, the level of homology is low, only about 62% of the amino acid residues are identical in both proteins.

Example 6. Amplification and expression of the C. freundii P3-42 phytase gene.

The phytase gene was amplified by PCR. Chromosomal DNA from C. freundii strain P3-42 was used as template and oligonucleotides o42-5 (GGAATTCATATGAGTACATTCATCATTCG) and o42-3 (GGAATTCGGATCCCTTATTCCGTAACTGCACAC) as primers. Amplification was carried out using the Expand High Fidelity PCR System kit (Roche). The following program was used: 1) initial DNA denaturation for 3 min at 94 ° C; 2) 35 cycles of 45 s at 94 ° C, 45 s at 55 ° C, 1 min at 68 ° C, 1 min at 72 ° C, 1 min at 74 ° C; 3) a final extension step of 10 min at 72 ° C. The resulting PCR product was purified by electrophoresis on 0.8% agarose gel followed by extraction of DNA from the gel using a gel purification kit (Qiagen). The purified PCR product was digested with the restriction enzymes NdeI and BamHI and isolated from the reaction mixture by the PCR purification kit (Qiagen). The plasmid vector pET11a (Novagen) was digested with restriction endonucleases NdeI and BamHI, dephosphorylated using shrimp alkaline phosphatase (Roche) and purified by electrophoresis on 0.8% agarose gel. The linearized plasmid DNA band was excised from the gel and purified using a gel purification kit (Qiagen). The two purified DNA fragments were ligated using T4 DNA ligase (Roche). The ligation reaction was precipitated with 70% ethanol, washed with ethanol, and resuspended directly in 50 µl of electrocompetent E. coli XL1-Blue MRF 'cells. The suspension was transferred to a 0.1 cm electroporation cuvette (BioRad) and electroporated using a Gene Pulser Xcell (BioRad) set at 1800 V, 25 pF and 200 Ω. Immediately after electroporation 1 ml of LB medium was added, the cell suspension was transferred to a 15 ml plastic tube (Falcon) and incubated at 37 ° C with shaking (200 rpm) for 1 h. The transformed cells were seeded on LB plates containing 100 pg / ml ampicillin and incubated overnight at 37 ° C. 24 transformants were grown in liquid culture and the cultures were used to test for phytase activity and isolation of plasmid DNA. A clone that produced the highest phytase activity and that generated the expected restriction pattern of plasmid DNA was selected. The plasmid contained by this clone named pET11 (P3-42) was used to transform the expression host strain BL21 (DE3) pLysS (Novagen). The transformed cell suspension was shaken for 1 h at 37 ° C in LB containing 2% glucose and inoculated into 50 ml of LB containing ampicillin (100 pg / ml) and glucose (2%) and cultured overnight at 30 ° C with stirring (200 rpm). The OD of the resulting culture was measured at 600 nm and the culture was used to inoculate 1 L of LB + ampicillin (100 pg / ml) at an OD600 of 0.04. Growth continued overnight at 30 ° C. Phytase activity in such cultures was normally 50-60 U / ml (measured at pH 3.5). Almost all of the phytase was secreted into the culture medium. The fact that C. freundii phytase is an efficiently secreted enzyme both in its native host and during heterologous expression in E. coli is a difference in the intracellular nature of a C. brakii phytase (Kim HW et al. Biotechnol. Lett. 25, 1231-1234 (2003)). The activity in culture of a control strain BL21 (DE3) pLysS

ES 2 394 908 T3 transformed with pET11 grown under the same conditions was less than 0.05 U / ml.

Example 7. Purification of C. freundii P3-42 recombinant phytase.

The culture of BL21 (DE3) pLysS transformed with pET11 (P3-42) was centrifuged to remove bacterial cells, concentrated using a rotary evaporator to approximately 1/10 of the original volume and dialyzed against water until the conductivity of the solution decreased below 250 pS / cm. The pH of the solution was adjusted to 8.0 with Tris base and applied to a column (3 x 20 cm) of DEAE Sepharose Fast Flow (Amersham Biosciences) equilibrated with 25 mM Tris-HCl, pH 8.0. The column was washed with the equilibration buffer at a flow rate of 3 ml / min for 30 min, followed by elution with three successive gradients of NaCl in 25 mM Tris-HCl, pH 8.0: 0-50 mM, 50 -150 mM and 150-500 mM. Each of the three gradients was programmed for 1 hr with a constant flow rate of 3 ml / min. 9 ml fractions were collected and assayed for phytase activity. A strong peak of activity was detected. The protein in the peak fraction was concentrated using Centriplus concentrators (Amicon) and analyzed by SDS-PAGE using 12% gel and the standard Laemmli plug system. The results of this analysis indicate that the recombinant C. freundii P3-42 phytase preparation obtained by DEAE Sepharose contains a single prominent protein component. The semi-quantitative analyzes based on the scanning of the digital image of the gel (Fig. 1) indicate purity of about 60-70%.

Example 8. pH profile of C. freundii P3-42 recombinant phytase.

The dependence of the C. freundii P3-42 phytase activity (purified according to Example 7) on the pH in buffers and under conditions described in Example 1 was studied. The enzyme was active in a wide area of ​​pH (2 -5.5) with two activity maxima of approximately pH 3 and 4-4.5 (Fig. 2).

Example 9. Substrate specificity of C. freundii P3-42 recombinant phytase.

Inositol phosphate fractions containing three, four or five phosphates per inositol residue were isolated by ion exchange chromatography from a partial hydrolyzate of phytic acid treated with fungal phytase (Natuphos). The production and purification of these preparations was a commercial service of BioChemis Ltd (Saint Petersburg, Russia). The contamination of each fraction with inositol phosphates having a different degree of phosphorylation was less than 5% as judged by HPLC (Sandberg AS, Ahderinne RJ Food Sci. 51 (3), 547-550). Commercial fructose 1,6-diphosphate and fructose 6-phosphate (Sigma) were used as model substrates to estimate the specificity of C. freundii P3-42 phytase towards di- and monophosphate substrates. The phytase activity of C. freundii purified according to Example 7 with different substrates was measured by the standard assay (Example 1) at pH 3.5 using 2 mM concentrations of substrates in the final reaction mixture. The results (Fig. 3) indicate that the enzyme has maximum activity with inositol pentaphosphate. The activities with inositol tri- and tetraphosphates, in addition to phytic acid, were quite similar whereas fructose 1,6-diphosphate was a rather poor substrate. The hydrolysis of fructose 6-phosphate was below the reliable detection limit.

Example 10. Specific activity of C. freundii P3-42 recombinant phytase.

The specific activity of C. freundii phytase was estimated using the purified preparation according to Example 7. The phytase activity was measured at pH 3.5 according to Example 1. The phytase concentration was calculated by measuring the total protein concentration with the BCA protein assay kit (Pierce) and correcting for phytase content estimated by SDS-PAGE (Example 7). According to these measurements, the specific activity of the recombinant phytase of C. freundii is approximately 1100 U / mg.

Example 11. Comparison of C. freundii P3-42 phytase with C. brakii YH-15 phytase.

The only phytase from a bacterium belonging to the Citrobacter family described above is the intracellular phytase of YH-15 from C. brakii (Kim HW et al. Biotechnol. Lett. 25, 1231-1234 (2003)). This enzyme shares some properties with the C. freundii secreted phytase of the present invention since both enzymes are acid phytases with high specific activity. Direct comparison of the amino acid sequences of the two enzymes is impossible because the sequence information regarding the C. brakii enzyme is limited to a 10 amino acid residue stretch. The deduced amino acid sequence of C. freundii phytase contains a fragment that shares 9 out of 10 residues with the C. brakii enzyme sequence. However, the comparison of such short sequence fragments does not allow any conclusion about the overall homology of the two enzymes to be prepared. The most striking difference between the two enzymes is in cell location: while the C. brakii enzyme is intracellular, the C. freundii phytase is clearly a secreted enzyme. The enzyme is secreted in its native host, its deduced amino acid sequence does not contain a signal peptide (as predicted by the Signal P algorithm: http: /www.cbs.dtu.dk/services/SignalP/), the enzyme is also secretes very efficiently from E. coli under its native signal peptide. In addition to this, there are several significant differences in the biochemical properties of the two enzymes (Table 1). Table 1

ES 2 394 908 T3

Comparison of C. freundii P3-42 phytase with C. brakii YH-15 phytase.

<td>Property</td><td>YH-15 phytase from C. brakii</td><td>Phytase from P3-42 from C. freundii</td>

<td>Location</td><td>Intracellular</td><td>Secreted</td>

<td>Specific activity</td><td>3457 U / mg (pH 4)</td><td>1100 U / mg (pH 3.5)</td>

<td>optimum pH</td><td> 4,0</td><td> 3,0, 5,0</td>

<td>Thermostability</td><td> 20%</td><td> 58%</td>

<td colspan="3">ⁿ Measured under conditions described by Kim et al. (Biotechnol. Lett. 25, 1231-1234 (2003)): treatment by heating in 100 mM Na acetate, pH 4, 60 ° C, 30 min followed by standard assay at 37 ° C.</td>

Example 12. Generation and characterization of phytase variants.

Phytase variants were constructed by mutagenesis of the sequence SEQ ID NO. 2 using mutagenesis procedures as listed above such as the procedures disclosed in Morinaga et al. (Biotechnology (1984) 2, p 646-649), or in Nelson and Long (Analytical Biochemistry (1989), 180, p. 147-151), or the error threshold mutagenesis protocol described in WO 92 / 18645.

Phytase enzyme variants were characterized after heterologous expression in one or more of the following expression hosts: Escherichia coli K12; Bacillus subtilis; Saccharomyces cerevisiae.

1. Thermostability

The thermostability of the variants was characterized by the inactivation temperature of the enzyme. The inactivation temperature was determined by measuring the residual activity of the enzyme in an enzyme assay as described in Example 1 after incubation for 10 min at different temperatures and subsequent cooling to room temperature. The inactivation temperature is the temperature at which the residual activity is 50% compared to the residual activity after incubation for the same duration under the same conditions at room temperature. When appropriate, interpolations and extrapolations are made of the measured activity data in order to determine the temperature corresponding to the 50% residual activity. The thermostability differences in ° C were calculated by subtracting the inactivation temperatures of two enzymes from each other (i.e. the thermostability difference (DT) is compared with the parental phytase (= inactivation temperature (variant) - inactivation temperature (parental )). Table 2 lists the thermostability differences for different variants:

TABLE 2: Thermostability differences for variants derived from the parental phytase P3-42 having the sequence shown in SEQ ID N ° 3.

<td>Variant</td><td>DT</td>

<td>P229S</td><td> 1,5</td>

<td>D112V</td><td> 1,5</td>

<td>Q82R</td><td> 1,5</td>

<td>Q274H</td><td> 1,0</td>

<td>D112Y</td><td> 2,5</td>

<td>F88Y</td><td> 1,5</td>

<td>K46E</td><td> 2,0</td>

<td>S233C</td><td> 2,0</td>

<td>R288M</td><td> 4,0</td>

<td>I384L</td><td> 1,0</td>

<td>Q385R</td><td> 1,5</td>

<td>Q274L</td><td> 2,0</td>

ES 2 394 908 T3

<td>Variant</td><td>DT</td>

<td>E307Y</td><td> 1,0</td>

<td>T199I</td><td> 2,0</td>

<td>Q82K</td><td> 2,0</td>

<td>T203I</td><td> 1,0</td>

<td>K46E / Q82H</td><td> 2,5</td>

<td>Q82K / V105I</td><td> 1,0</td>

<td>N148D / T362I</td><td> 1,5</td>

<td>K46E / L414I</td><td> 1,0</td>

<td>F88Y / Y136N</td><td> 1,0</td>

<td>N95P / N96S</td><td> 1,5</td>

<td>N95P / N96P</td><td> 2,0</td>

<td>Q97T / T98G</td><td> 1,0</td>

<td>Y177F / T199I</td><td> 2,5</td>

<td>Q274L / Q370H</td><td> 3,0</td>

<td>K46E / N96Y</td><td> 2,5</td>

<td>N148D / L301S</td><td> 1,5</td>

<td>E24D / R288M</td><td> 1,5</td>

<td>E140V / A322V</td><td> 2,0</td>

<td>K46E / S195T</td><td> 2,0</td>

<td>E75K / N365D</td><td> 1,5</td>

<td>T98P / S235A</td><td> 2,0</td>

<td>L160F / L215F</td><td> 1,0</td>

<td>Q274L / K395T</td><td> 1,5</td>

<td>G67R / Q279E / N308T</td><td> 2,0</td>

<td>K161N / P229S / R288M</td><td> 2,0</td>

<td>D53N / D57Y / M152V</td><td> 2,0</td>

<td>F122Y / S156T / P229S</td><td> 1,5</td>

<td>E23K / K46E / Q82H</td><td> 6,0</td>

<td>K46E / Q82H / Q385R</td><td> 5,0</td>

<td>T203W / E204N / K205R</td><td> 2,0</td>

<td>T203W / E204H / K205R</td><td> 3,0</td>

<td>T203W / E204R / K205R</td><td> 3,0</td>

<td>T203W / E204A / K205R</td><td> 3,0</td>

ES 2 394 908 T3

<td>Variant</td><td>DT</td>

<td>A22T / K151G / N308D</td><td> 2,0</td>

<td>E23K / E75K / F88Y</td><td> 2,0</td>

<td>M152K / N225D / L301S</td><td> 2,0</td>

<td>S78T / Q274L / S408I</td><td> 2,0</td>

<td>L176Q / T199I / T366S</td><td> 1,5</td>

<td>K46E / V77I / T203S</td><td> 3,0</td>

<td>K46R / T199I / D367N</td><td> 1,5</td>

<td>G74R / E204G / ​​R288M</td><td> 1,5</td>

<td>A22T / T199I / S206T / T207A</td><td> 1,5</td>

<td>Q82R / F88Y / L126I / I384L</td><td> 3,0</td>

<td>K46E / Q82H / E168D / Q274L</td><td> 5,0</td>

<td>Q82K / T154I / Q279E / N308T</td><td> 5,5</td>

<td>Q82R / D112V / Q274H / T362A</td><td> 5,0</td>

<td>E24D / E79V / N95D / K360N</td><td> 1,0</td>

<td>E23K / M28L / A109T / T143P / I384L</td><td> 2,0</td>

<td>D53N / D57Y / T199I / P229S / R288M</td><td> 6,0</td>

<td>K46E / Q82H / N148D / T154I / T362I</td><td> 7,0</td>

<td>D53N / D57Y / P229S / R288M / K358R</td><td> 5,5</td>

<td>D53N / D57Y / T154I / P229S / R288M</td><td> 7,0</td>

<td>Y136N / T199I / T203L / E204I / K205P</td><td> 3,0</td>

<td>E23Q / S101F / Q274L / I384M / K391N</td><td> 2,0</td>

<td>K46E / Q82H / N95D / D112V / K142R / D383V</td><td> 5,5</td>

<td>D53N / D57Y / M152V / P229S / R288M / A393P</td><td> 7,0</td>

<td>D53K / D57Y / M152V / P229S / R288M / A393P</td><td> 8,0</td>

<td>D53N / D57Y / F88Y / M152V / P229S / Q279E / N308T</td><td> 6,5</td>

<td>D53N / D57Y / M152V / E204V / P229S / R288M / A393P</td><td> 8,0</td>

<td>D53N / D57Y / M152V / T154I / P229S / R288M / A393P</td><td> 8,0</td>

<td>D53N / D57Y / Q82H / G103E / M152V / P229S / R288M / A393P</td><td> 8,5</td>

<td>K46E / D53N / D57Y / T143I / M152V / L176V / P229S / R288M / A393P</td><td> 8,0</td>

<td>Q82K / F88Y / N96P / Q97T / T98G / V105I / Q274H / Q279E / A393P</td><td> 9,0</td>

<td>Q82R / F88Y / N95P / N96P / Q97T / Q279E / IP386L / P386Q / A393P</td><td> 9,0</td>

<td>D53N / D57Y / E75V / M152V / A170T / P229S / R288M / Q385R / A393P</td><td> 7,5</td>

<td>Q82K / F88Y / N96P / T98G / Y136N / B4152V / Y177F / T362I / I384F / A393P / D397N</td><td> 10,0</td>