ES2336282T3

Recombinant proteins of a pakistani strain of hepatitis e and their use in diagnostic methods and vaccines.

Abstract

A LINEAGE OF THE HEPATITIS AND PAQUISTAN VIRUS (SAR55) INVOLVED IN HEPATITIS NO-A, NO-B TRANSMITTED EPIDEMIC OR ENTERICALLY, NOW CALLED HEPATITIS E. THE INVENTION REFERS TO THE EXPRESSION OF THE TOTAL STRUCTURAL REGION OF SAR- 55, DESIGNATED OPEN READING STRUCTURE 2 (ORF-2), IN A EUCARIOTIC EXPRESSION SYSTEM. THE EXPRESSED PROTEIN IS ABLE TO FORM PARTICULES LIKE VIRUS HEV THAT CAN SERVE AS ANTIGENS IN DIAGNOSTIC IMMUNOENSAYS AND AS AN IMMUNOGEN OR VACCINE TO PROTECT AGAINST HEPATITIS E INFECTION.

ES2336282T3, drawing sheet 1 — Sheet 1 of 19

Term

Term ended

Projected expiry passed 17 September 2013, 13 years ago.

5 claims: 2 independent, 3 dependent

1
ES 2 336 282 T3 REIVINDICACIONES 1. Un método para producir una proteína de hepatitis inmunogénica que comprende:cultivar una célula hospedante de insecto transformada o transfectada con un vector de expresión de baculovirus, comprendiendo dicho vector de expresión ADN, teniendo dicho ADN una secuencia, consistiendo dicha secuencia en los nucleótidos que codifican los aminoácidos 1 a 660 de la proteína de marco de lectura abierta 2 del virus de hepatitis E, en condiciones apropiadas para causar la producción de la proteína de hepatitis inmunogénica.
2
Un método de la reivindicación 1, en el que dicha secuencia de ADN consiste en:a) nucleótidos 5147 a 7126 de la SEQ ID N° 4, b) una secuencia de ADN que codifica la secuencia de aminoácidos de la SEQ ID N°: 2, ó c) la secuencia de ADN que codifica una secuencia de aminoácidos que tiene más del 90% de homología con la secuencia aminoacídica de la SEQ ID N°: 2.
3
Un vector de expresión de baculovirus que comprende ADN, teniendo dicho ADN una secuencia, consistiendo dicha secuencia en nucleótidos que codifican los aminoácidos 1 a 660 de una proteína de marco de lectura abierta 2 del virus de la hepatitis E.
4
El vector de expresión de la reivindicación 3, en el que dicha secuencia de ADN consiste en:a) nucleótidos 5147 a 7126 de la SEQ ID N°: 4 b) una secuencia de ADN que codifica la secuencia de aminoácidos de la SEQ ID N°: 2, ó c) una secuencia de ADN que codifica una secuencia de aminoácidos que tiene más del 90% de homología con la secuencia aminoacídica de la SEQ ID N°: 2
5
Una célula hospedante de insecto que comprende el vector de expresión de la reivindicación 3 ó 4.

Independent claims5

701 paragraphs in 101 sections, as filed

ES 2 336 282 T3

DESCRIPTION

Recombinant proteins from a Pakistani strain of hepatitis E and their use in diagnostic methods and vaccines.

The invention is in the field of hepatitis virology. More specifically, this invention relates to a method of producing an immunogenic hepatitis protein, namely, the expression of a sequence encoding the entire open reading frame 2 of the hepatitis E virus in a transformed or transfected insect host cell. with a baculovirus expression vector comprising said coding sequence, the baculovirus expression vector and the insect host cell.

Epidemics of hepatitis E, an enterically transmitted non-A / non-B hepatitis, has been documented in Asia, Africa, and Central America (Balayan, M. S, (1987), Soviet Medical Reviews, Section E, Virology Reviews, Zhdanov , VM (ed), Chur, Switzerland: Harwood Academic Publishers, vol. 2,235-261; Purcell, RH et al. (1988) in Zuckerman. AJ (ed), "Viral Hepatitis and Liver Disease", New York: Alan R. Liss , 131-137; Bradleay, DW (1990), British Medical Bulletin, 46; 442-461; Ticehurst, JR (1991) in Hollinger, FB, Lemon, SM, Margolis, HS (eds); "Viral Hepatitis and Liver disease", Williams and Wilkins, Baltimore, 501-513). Sporadic hepatitis cases, presumed to be hepatitis E, account for up to 90% of documented hepatitis in countries where the hepatitis E virus (HEV) is endemic. The need for the development of a serological assay for the detection of antiHEV antibodies in the serum of infected individuals is widely recognized in the field, but the very low concentration of HEV secreted by infected humans or animals made it impossible to use such HEV as a source of antigens for serological assays and although limited success has been documented in the spread of HEV in cell cultures (Huang, R. T et al. (1992), J. Gen. Virol., 73: 1143-1148), cell culture is currently too ineffective to produce the amounts of antigen required for serological assays.

Recently, major efforts around the world to identify viral genomic sequences associated with hepatitis E have resulted in the cloning of the genomes of a limited number of HEV strains (Tam, AW et al. (1991), Virology, 185: 120 -131; Tsarev, S. A et al. (1992), Proc. Natl. Acad. Sci. USA, 89: 559-563; Fry, KE et al. (1992), Virus Genes, 6: 173-185). DNA sequence analysis has led researchers to hypothesize that the HEV genome is organized into three open reading frames (ORFs) and to hypothesize that these ORFs encode intact HEV proteins.

A partial DNA sequence of the genome of a HEV strain from Burma (Myanmar) is described in Reyes et al. 1990 Science 247: 1335-1339. Tam et al., 1991, and Reyes et al., PCT patent application WO 91/15603 published October 17, 1991 describes the complete nucleotide sequence and a deduced amino acid sequence of the Burma strain of HEV. These authors hypothesized that three open reading frames (ORFs) are contained within the sequences of this strain.

Ichikawa et al., 1991, Microbiol. Immunol., 35: 535-543, describes the isolation of a series of clones 240-320 nucleotides in length after screening a lgt11 expression library with sera from HEV-infected cynomolgus monkeys. The recombinant protein expressed by one clone was expressed in E. Coli. This fusion protein is encoded by the 3 'region of ORF-2 of the Myanmar strain of HEV.

The expression of additional proteins encoded in the 3 'region of ORF-2 of a Mexican strain of HEV and a Burmese strain of HEV is described in Yarbough et al., 1991 J: Virology, 65: 5790-5797. This article describes the isolation of two HEV-derived cDNA clones. These clones encode the proteins in the 3 'region of ORF2. The clones were expressed in E. coli as fusion proteins.

Purdy et al., 1992, Archives of Virology, 123: 335-349, and Favorov et al., 1992. J. of Medical Virology, 36: 246-250, describe the expression of an ORF-2 protein fragment from the strain of Burma in E. Coli. These references, as well as those previously described, only describe the expression of a portion of the ORF-2 gene using bacterial expression systems. Successful expression of the full-length ORF-2 protein has not been described until the present invention.

Comparison of the genome organization and morphological structure of HEV with that of toroviruses revealed that HEV is more closely related to caliciviruses. Interestingly, calicivirus structural proteins are encoded by the 3 'portion of their genome (Neil, JD et al. (1991) J. Virol., 65: 5440-5447; and Carter, MJ et al. (1992), J. Arch. Virol., 122: 223-235) and although there is no direct evidence that the 3 'terminal part of the HEV genome also encodes structural proteins, expression of certain small portions of the 3' region of the genome in bacterial cells gave as a result the production of anti-HEV serum reactive proteins in ELISA and Western blots (Yarborough, et al., (1991); Ichikawa et al., (1991), Vavorov et al. (1992) and Dwason, G. J et al. ( 1992) J. Virol. Meth; 38: 175-186). However, the function of the ORF-2 protein as a structural protein was not demonstrated until the present invention.

Small proteins encoded by a portion of the ORF-2 gene have been used in immunoassays to detect antibodies to HEV in animal sera. The use of small proteins expressed in bacteria as antigens in serological immunoassays has several possible disadvantages. First, the expression of these small proteins in bacteria cells often results in solubility and cross-reactivity problems.

ES 2 336 282 T3 non-specific from patient sera with E. Coli proteins when crude E. Coli lysates are used as antigens in immunoassays (Purdy et al. (1992)). Second, the use of Western blots as serological assays of choice for anti-HEV antibodies in routine epidemiology is impractical due to time and cost constraints. An ELISA using small peptides derived from the 3 'terminal part of the HEV genome resulted in the detection of only 41% positives of diagnosed HEV infected patients. Third, it has been shown that for many viruses, including Picornaviridae which is the closest family to Caliciviridae, important antigenic and immunogenic epitopes are highly conformational (Lemon, SM et al. (1991), in Hollinger, FB, Lemon, SM, Margolis, HS (eds): "Viral Hepatitis and Liver Disease", Williams and Wilkins, Baltimore, 20-24). For this reason, it is believed that expression in a eukaryotic system of a complete ORF encoding an intact HEV gene would result in the production of a protein that could form HEV-viral-like particles. Such a complete ORF protein would have an immunological structure closer to that of a native capsid protein than the aforementioned smaller proteins that represent only portions of the HEV structural proteins. Therefore, these full-length ORF proteins would most likely serve as a more representative antigen and more efficient immunogen than the smaller proteins currently used.

The present invention relates to:

A method of producing an immunogenic hepatitis protein comprising:

Cultivating an insect host cell transformed or transfected with a baculovirus expression vector, said expression vector comprises DNA, said DNA has a sequence, said sequence consists of the nucleotides encoding amino acids 1 to 660 of a reading frame protein Hepatitis E virus open 2 under conditions appropriate to produce the immunogenic hepatitis protein.

Preferably, the present invention relates to the above method, wherein said DNA sequence consists of:

a) nucleotides 5147 to 7126 of SEQ ID N °: 4,

b) a DNA sequence encoding the amino acid sequence of SEQ ID N °: 2 or

c) a DNA sequence that encodes an amino acid sequence that has more than 90% homology with the amino acid sequence of SEQ ID N °: 2.

On the other hand, the present invention refers to a baculovirus expression vector comprising DNA, said DNA having a sequence, said sequence consisting of the nucleotides encoding amino acids 1 to 660 of the open reading frame protein 2 of the virus of hepatitis E.

Preferably the baculovirus expression vector is an expression vector, wherein said DNA sequence consists of:

a) nucleotides 5147 to 7126 of SEQ ID N °: 4,

b) a DNA sequence encoding the amino acid sequences of SEQ ID N °: 2, or

c) a sequence that encodes an amino acid sequence that has more than 90% homology with the amino acid sequence of SEQ ID N °: 2.

The present invention also relates to an insect host cell comprising the aforementioned expression vector.

This invention provides the use of synthetic nucleic acid sequences capable of directing the production of recombinant HEV proteins, as well as equivalent natural nucleic acid sequences. Such natural nucleic acid sequences can be isolated from cDNAs or genomic libraries from which genes capable of directing the synthesis of HEV proteins can be identified and isolated. For the purpose of this application, nucleic acid sequences refer to RNA, DNA, cDNA, or any synthetic variant thereof that code for proteins.

The invention also relates to isolated and partially purified HEV proteins and variants thereof encoded by the SAR-55 HEV genome or encoded by synthetic nucleic acid sequences and in particular to recombinant proteins encoded by at least one reading frame full open HEV as a result of the method of the present invention.

The invention also relates to the method of preparing recombinant HEV proteins derived from a genomic HEV sequence by cloning the nucleic acid and inserting the cDNA into an expression vector and expressing the recombinant protein in a host cell within the scope of the method of present invention.

ES 2 336 282 T3

Figure 1 shows the recombinant vector used to express the complete ORF-2 protein from the HEV SAR-55 strain genome.

Figures 2A and 2B are sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE) in which cell lysates of insect cells infected with wild baculovirus or recombinant baculovirus (containing the gene encoding ORF-2) were either stained with Coomassie blue (A) or Western blotted with serum from a HEV-infected chimpanzee (B).

Figures 3A and 3B show immunoelectronic micrographs (IEM) of viral-like particles of 30 and 20 nm respectively, which are formed as a result of the expression of the ORF-2 protein in recombinant infected insect cells.

Figure 4 shows the results of an ELISA using as antigen, recombinant ORF-2 that was expressed from insect cells containing the gene encoding the complete ORF-2. Serum antiHEV antibody levels were determined at various times after inoculation of cynomolgus monkeys with either the Mexican strain (Cyno-80A82, Cyno-9A97 and Cyno 83) or the Pakistani strain (Cyno-374) of HEV.

Figure 5A-D shows the results of an ELISA using as antigen, the recombinant ORF-2 that was expressed from insect cells containing the gene encoding the complete ORF-2. Serum anti-HEV IgG or IgM levels were determined over time after inoculation of two chimpanzees with HEV.

Figures 6A-J show a comparison of ELISA data obtained using the SAR-55 derived recombinant full length ORF-2 protein antigen as the antigen vs. a recombinant partial ORF-2 protein derived from the Burma strain of HEV (Genelabs).

The present invention relates to a method for producing an immunogenic hepatitis protein comprising: the culture of an insect host cell transformed or transfected with a baculovirus expression vector, said expression vector comprises DNA, said DNA has a sequence, said sequence consists of nucleotides encoding amino acids 1 to 660 of a framework protein of open reading 2 of the hepatitis E virus, under conditions appropriate to produce the immunogenic protein of hepatitis.

The present invention describes an isolated and substantially purified strain of the Pakistan hepatitis E virus (HEV), SAR-55. The present invention also describes the cloning of the viral genes encoding the HEV proteins and the expression of the recombinant proteins using an expression system. More specifically, the present invention describes the cloning and expression of SAR-55 derived HEV open reading structures (ORFs).

The present invention describes isolated HEV proteins. Preferably, the HEV proteins, as a result of the method of the present invention, are substantially homologous, and more preferably biologically equivalent, to the native HEV proteins. By "biologically equivalent" as used throughout the specification and claims, it is meant that the compositions are capable of forming like viral particles and are immunogenic. The HEV proteins of the present invention can also stimulate the production of protective antibodies after injection into a mammal that would serve to protect the mammal after challenge with a wild type HEV. By "substantially homologous" as used throughout the ensuing specification and claims, he refers to a degree of homology in the amino acid sequence with native HEV proteins. Preferably, the degree of homology is greater than 70%, preferably greater than 90%, with a particularly preferred group of proteins that are more than 99% homologous with native HEV proteins.

Preferred HEV proteins produced by the method of the present invention are those proteins that are encoded by the ORF genes including the ORF-2 gene. Of particular interest are the proteins encoded by the HEV ORF-2 gene and more particularly the proteins encoded by the ORF-2 gene of the HEV strain SAR-55. The proteins produced by the method of the present invention, encoded by the ORF-2 gene, form similar viral particles. The amino acid sequences of the ORF-1, ORF-2, and ORF-3 proteins are shown below as SEQ ID NO .: 1, SEQ ID NO .: 2, and SEQ ID NO .: 3, respectively;

ES 2 336 282 T3

<td></td><td>lie</td><td>Glu</td><td>Gln</td><td>To</td><td>To twenty</td><td>Leu</td><td>To</td><td>To</td><td>To</td><td>Asn 25</td><td>To be</td><td>To</td><td>Leu</td><td>To</td><td>Asn 30</td>

<td></td><td>Leu</td><td>lie</td><td>Asn</td><td>Leu</td><td>Met fifty</td><td>Gln</td><td>Pro</td><td>Arg</td><td>Gln</td><td>Leu 55</td><td>Val</td><td>Phe</td><td>Arg</td><td>Pro</td><td>Glu 60</td>

ES 2 336 282 T3

ES 2 336 282 T3

ES 2 336 282 T3

ES 2 336 282 T3

ES 2 336 282 T3

<td rowspan="2">Met 1</td><td rowspan="2">Arg</td><td colspan="2" rowspan="2">Pro Arg</td><td colspan="2" rowspan="2">(S&Q. Pro lie 5</td><td colspan="2">ID NO .:</td><td colspan="6" rowspan="2">2) Leu Leu Leu Met Phe Leu 10</td><td rowspan="2">Pro fifteen</td>

ES 2 336 282 T3

ES 2 336 282 T3

The three letter abbreviations follow the conventional short nomenclature for the twenty naturally occurring amino acids.

Recombinant HEV proteins can consist of at least one ORF protein but always include amino acids 1 to 660 of the hepatitis E virus open reading frame protein 2. Other recombinant proteins made of more than one of the same or different ORF proteins it can be made to alter the biological properties of the protein.

ES 2 336 282 T3

It is contemplated that additions, substitutions, or deletions of discrete amino acids or of discrete amino acid sequences can enhance the biological activity of HEV proteins.

The present invention may use a nucleic acid sequence that is capable of directing the production of the above-discussed HEV protein or proteins substantially homologous to HEV proteins. This nucleic acid sequence, designated SAR-55, is set forth below as SEQ ID N °: 4 and was deposited with the American Type Culture Collection (ATCC) on September 17, 1992.

AGGCAGACCA CATATGTGGT CGATGCCATG GAGGCCCATC AGTTTATCAA 50 GGCTCCTGGC ATCACTACTG CTATTGAGCA GGCTGCTCTA GCAGCGGCCA 100 ACTCTGCCCT TGCGAATGCT GTGGTAGTTA GGCCTTTTCT CTCTCACCAG 150 CAGATTGAGA TCCTTATTAA CCTAATGCAA CCTCGCCAGC TTGTTTTCCG 200 CCCCGAGGTT TTCTGGAACC ATCCCATCCA GCGTGTTATC CATAATGAGC 250 TGGAGCTTTA CTGTCGCGCC CGCTCCGGCC GCTGCCTCGA AATTGGTGCC 300 CACCCCCGCT CAATAAATGA CAATCCTAAT GTGGTCCACC GTTGCTTCCT 350 CCGTCCTGCC GGGCGTGATG TTCAGCGTTG GTATACTGCC CCTACCCGCG 400 GGCCGGCTGC TAATTGCCGG CGTTCCGCGC TGCGCGGGCT CCCCGCTGCT 450 GACCGCACTT ACTGCTTCGA CGGGTTTTCT GGCTGIAACT TTCCCGCCGA 500 GACGGGCATC GCCCTCTATT CTCTCCATGA TATGTCACCA TCTGATGTCG 550 CCGAGGCTAT GTTCCGCCAT GGTATGACGC GGCTTTACGC TGCCCTCCAC 600 CTCCCGCCTG AGGTCCTGTT GCCCCCTGGC ACATACCGCA CCGCGTCGTA 650 CTTGCTGATC CATGACGGCA GGCGCGTTGT GGTGACGTAT GAGGGTGACA 700 CTAGTGCTGG TTATAACCAC GATGTTTCCA ACCTGCGCTC CTGGATTAGA 750 ACCACTAAGG TTACCGGAGA CCACCCTCTC GTCATCGAGC GGGTTAGGGC 800 CATIGGCTGC CACTTTGTCC TTTTACTCAC GGCTGCTCCG GAGCCATCAC 850 CTATGCCCTA TGTCCCTTAC CCCCGGTCTA CCGAGGTCTA TGTCCGATCG 900 ATCTTCGGCC CGGGTGGCAC CCCCTCCCTA TTTCCAACCT CATGCTCCAC 950 CAAGTCGACC TTCCATGCTG TCCCTGCCCA TATTCGATGTAC TGTCGTCG CTCTCGATGTAC CGTCGTCG 1000 CCGTCGTA

ES 2 336 282 T3

<td rowspan="3"> 5</td><td rowspan="3">ACTTACCTCC CAATGAAGGC CCGCCTACCT TCTAAGGGGA ACGCCTCTAC</td><td colspan="3">GCGGCATTAG CTACAAGGTT ACTGTGGGCA</td><td rowspan="3">CCCTTGTTGC GTCATCACTG TCAGGCTATA AGTTTATAAC TATATCCCCG</td><td rowspan="3"> 1100 1150 1200 1250 1300</td>

<td colspan="2">TGGAACGCCT CTGAGGACGC TACCATCTGC CACCAGCGGT TGCGTCGCCT GGAGCGGGAG</td><td rowspan="2">TCTTACAGCT ACCTCCGCAC CATGCTCAGA CGGCCGTGAT</td>

<td>AGTTGGCTCT</td><td>TTGAGAAGTC</td>

<td> 10</td><td>GCCGTCAGTT</td><td>GGAGTTCTAC</td><td>GCTCAGTGTA</td><td>GGCGCTGGCT</td><td>CTCGGCCGGC</td><td> 1350</td>

<td></td><td>TTTCATCTTG</td><td>ACCCACGGGT</td><td>GTTGGTTTTT</td><td>GATGAGTCGG</td><td>CCCCCTGCCA</td><td> 1400</td>

<td></td><td>CTGTAGGACT</td><td>GCGATTCGTA</td><td>AGGCGGTCTC</td><td>AAAGTTTTGC</td><td>TGCTTTATGA</td><td> 1450</td>

<td> 15</td><td>AGTGGCTGGG</td><td>CCAGGAGTGC</td><td>ACCTGTTTTC</td><td>TACAACCTGC</td><td>AGAAGGCGTC</td><td> 1500</td>

<td></td><td>GTTGGCGACC</td><td>AGGGCCATGA</td><td>CAACGAGGCC</td><td>TATGAGGGGT</td><td>CTGATGTTGA</td><td> 1550</td>

<td></td><td>CCCTGCTGAA</td><td>TCCGCTATTA</td><td>GTGACATATC</td><td>TGGGTCCTAC</td><td>GTAGTCCCTG</td><td> 1600</td>

<td> 20</td><td>GCACTGCCCT</td><td>CCAACCGCTT</td><td>TACCAAGCCC</td><td>TTGACCTCCC</td><td>CGCTGAGATT</td><td> 1650</td>

<td></td><td>GTGGCTCGTG</td><td>CAGGCCGGCT</td><td>GACCGCCACA</td><td>GTAAAGGTCT</td><td>CCCAGGTCGA</td><td> 1700</td>

<td></td><td>CGGGCGGATC</td><td>GATTGTGAGA</td><td>CCCTTCTCGG</td><td>TAATAAAACC</td><td>TTCCGCACGT</td><td> 1750</td>

<td> 25</td><td>CGTTTGTTGA</td><td>CGGGGCGGTT</td><td>TTAGAGACTA</td><td>ATGGCCCAGA</td><td>GCGCCACAAT</td><td> 1800</td>

<td></td><td>CTCTCTTTTG</td><td>ATGCCAGTCA</td><td>GAGCACTATG</td><td>GCCGCCGGCC</td><td>CTTTCAGTCT</td><td> 1850</td>

<td></td><td>CACCTATGCC</td><td>GCCTCTGCTG</td><td>CTGGGCTGGA</td><td>GGTGCGCTAT</td><td>GTCGCCGCCG</td><td> 1900</td>

<td> 30</td><td>GGCTTGACCA</td><td>CCGGGCGGTT</td><td>TTTGCCCCCG</td><td>GCGTTTCACC</td><td>CCGGTCAGCC</td><td> 1950</td>

<td></td><td>CCTGGCGAGG</td><td>TCACCGCCTT</td><td>CTGTTCTGCC</td><td>CTATACAGGT</td><td>TTAATCGCGA</td><td> 2000</td>

<td></td><td>GGCCCAGCGC</td><td>CTTTCGCTGA</td><td>CCGGTAATTT</td><td>TTGGTTCCAT</td><td>CCTGAGGGGC</td><td> 2050</td>

<td> 35</td><td>TCCTTGGCCC</td><td>CTTTGCCCCG</td><td>TTTTCCCCCG</td><td>GGCATGTTTG</td><td>GGAGTCGGCT</td><td> 2100</td>

<td></td><td>AATCCATTCT</td><td>GTGGCGAGAG</td><td>CACACTTTAC</td><td>ACCCGCACTT</td><td>GGTCGGAGGT</td><td> 2150</td>

<td></td><td>TGATGCTGTT</td><td>CCTAGTCCAG</td><td>CCCAGCCCGA</td><td>CTTAGGTTTT</td><td>ACATCTGAGC</td><td> 2200</td>

<td> 40</td><td>CTTCTATACC</td><td>TAGTAGGGCC</td><td>GCCACACCTA</td><td>CCCCGGCGGC</td><td>CCCTCTACCC</td><td> 2250</td>

<td></td><td>CCCCCTGCAC</td><td>CGGATCCTTC</td><td>CCCTACTCTC</td><td>TCTGCTCCGG</td><td>CGCGTGGTGA</td><td> 2300</td>

<td></td><td>GCCGGCTCCT</td><td>GGCGCTACCG</td><td>CCAGGGCCCC</td><td>AGCCATAACC</td><td>CACCAGACGG</td><td> 2350</td>

<td> 45</td><td>CCCGGCATCG</td><td>CCGCCTGCTC</td><td>TTTACCTACC</td><td>CGGATGGCTC</td><td>TAAGGTGTTC</td><td> 2400</td>

<td></td><td>GCCGGCTCGC</td><td>TGTTTGAGTC</td><td>GACATGTACC</td><td>TGGCTCGTTA</td><td>ACGCGTCTAA</td><td> 2450</td>

<td></td><td>TGTTGACCAC</td><td>CGCCCTGGCG</td><td>GTGGGCTCTG</td><td>TCATGCATTT</td><td>TACCAGAGGT</td><td> 2500</td>

<td> 50</td><td>ACCCCGCCTC</td><td>CTTTGATGCT</td><td>GCCTCTTTTG</td><td>TGATGCGCGA</td><td>CGGCGCGGCC</td><td> 2550</td>

<td></td><td>GCCTACACAT</td><td>TAACCCCCCG</td><td>GCCAATAATT</td><td>CATGCCGTCG</td><td>CTCCTGATTA</td><td> 2600</td>

<td></td><td>TAGGTTGGAA</td><td>CATAACCCAA</td><td>AGAGGCTTGA</td><td>GGCTGCCTAC</td><td>CGGGAGACTT</td><td> 2650</td>

<td> 55</td><td>GCTCCCGCCT</td><td>CGGTACCGCT</td><td>GCATACCCAC</td><td>TCCTCGGGAC</td><td>CGGCATATAC</td><td> 2700</td>

<td></td><td>CAGGTGCCGA</td><td>TCGGTCCCAG</td><td>TTTTGACGCC</td><td>TGGGAGCGGA</td><td>ATCACCGCCC</td><td> 2750</td>

<td></td><td>CGGGGACGAG</td><td>TTGTACCTTC</td><td>CTGAGCTTGC</td><td>TGCCAGATGG</td><td>TTCGAGGCCA</td><td> 2800</td>

<td> 60</td><td>ATAGGCCGAC</td><td>CTGCCCAACT</td><td>CTCACTATAA</td><td>CTGAGGATGT</td><td>TGCGCGGACA</td><td> 2850</td>

ES 2 336 282 T3

GCAAATCTGG TGCCGGCTGT GTGTGCCTGG GTTGTCGTGG CTTCGCTGCT GGGTTGTCAT CACATGCAGC CCCAGCCATC ATTTGGCCCC GTATGTGAGC GGTCCTCCGG TGTTCACCCA GAGGCACAGG TGCTCGAGGC CGCGCCACAC GAGGTGGGCA CGAAATTGGC CCAATGTTGA TTCCATCAGT TGTTCTACCG AAGAACTCAC GTGCATTGTC GCTCGTGGGC CTGATGTTCG CAGGTTACAA GGGCCAGGAC TGTCCAGGAT GAGACCATCG GACCTTCTGT TCCTGGCCCT ACCGTCTTCT GAATGACTTT TAGAGTGTGC TTGTACCACC CCTGCGAGGG GGAATACTGT

CTATCGAACT CGAGTCACCC ATCCGGCAAG TCCCGACCCG TTCACCCCGC TGATGAGGCC GGGCCGCCAC GATTTTGAGC CACCTCCTGG TAATCCGCGG TCGTTGTTCT GGCGGCTAAG GCGCTACCTA CTCATTCAGT TGAGAAGTGC TCTCCGATGC CACCAGCGCC CACCTTGGCT TGGCTGAGGA CCCTGCCCTG CACCTGTGAT GTATGGCCGC CGTTATGGCC CGACTCTCTC CCTGTGAATT GGCTCCGCCG CACCTTCTTC CCCATGGTAA GCCCTTTTCG GCTCCCTCAG CGGCGGCTGT TCTGAGTTTG TATTATGGAG TTATAAGGTC TTTTGGAAGA CTGGAACATG

TGACTCAGCC CCGGCGTTGT TCCCGCTCTA GGAGTTGCGT ACACTGCGGC CCGTCCCTTC CGTCCACCTT ACGCCGGGCT TGGCATGTTA CGCATACCCT GGGGTGAGCC GCCGCCAACC CACAGAGACT CGTCCCGAGC GTCATCATTG AATCGTTAAT CATCTGTTAT GCCTTCCCGC GCTTGGCCAC AGCTTGAACA AGTGTCGTAA CCCGAGCCAG GCCGCACAAA GCCCGTTTTA GTACGAGCTA TCCTTGAGCT CAGAAAGATT AGTGGGCCAG GCCCCTGGTT GGTGTGTTTT GGCCGCAGCA ATTCCACCCA GAGTGTGGGA TGCGTGGATT AACACTCCGG GCCGTTATCA

ACAGACGTCG GCAGTACCAG TTACCCAAGC AATGCCTGGC TAGAGTCACC CCCCTCATTT CTTGGCGACC CGTTCCCGCC CCCATCGCTG ATGATTCAGA CGCCGTTGGG CCGGTTCAGT ACCATCATTG TCATGCCATT ACGCACCAGG AACTTTTTCC CCCTCGCGGC CGTCTTGCCA AGACCTGCCC GGGCCTTCTC CATTTGAATT CGCAAGGCCG GCTCTACAAT TCCCGGCCAT GTGGAGGCCA CGACCTTTGT GTAATAAATT GGCATTTCGG CCGTGCTATT ATGGGGATGC AAGGCATCCA GAATAATTTT TGCCGCAGTG CTGCAGGCCC TGAGCCCGGC CCCACTGTTA

GCCGGGCCTG TTTACCGCAG CGACGTGGAC GCCGCCGCGG CAGGGGCGCC GCTGCTGCTC CGAATCAGAT ATCAGGCCCG CCCTGCGGAT CCACTAGTCG CAGAAGCTAG GACGGTCCAT CCACGGCAGA GTTGCCTTGA CCTGCTTCGC TTGCTGGTGG AATCCTGACG GATTAGCGCC CTGTCGCGGC TACCTGCCCC AACAGATATT TGCTGTCCAC GCCTCCCACT TGGCCCCGTA TGGTCGAGAA AGCCGCGACG CACCACGGGG CCTGGAGTAA GAGAAGGCTA CTTTGATGAC TGGTGTTCGA TCCTTGGGCC GCTCATCCGC CGAAGGAGTC ACCCTTCTGT TGATTTCCGC

2900 2950 3000 3050 3100 3150 3200 3250 3300 3350 3400 3450 3500 3550 3600 3650 3700 3750 3800 3850 3900 3950 4000 4050 4100 4150 4200 4250 4300 4350 4400 4450 4500 4550 4600 4650

ES 2 336 282 T3

<td>GATCTGCAGG</td><td>TGGCTGCCTT</td><td>TAAAGGTGAT</td><td>GATTCGATAG</td><td>TGCTTTGCAG</td><td> 4700</td>

<td>TGAGTACCGT</td><td>CAGAGCCCAG</td><td>GGGCTGCTGT</td><td>CCTGATTGCT</td><td>GGCTGTGGCC</td><td> 4750</td>

<td>TAAAGTTGAA</td><td>GGTGGATTTC</td><td>CGTCCGATTG</td><td>GTCTGTATGC</td><td>AGGTGTTGTG</td><td> 4800</td>

<td>GTGGCCCCCG</td><td>GCCTTGGCGC</td><td>GCTTCCTGAT</td><td>GTCGTGCGCT</td><td>TCGCCGGTCG</td><td> 4850</td>

<td>GCTTACTGAG</td><td>AAGAATTGGG</td><td>GCCCTGGCCC</td><td>CGAGCGGGCG</td><td>GAGCAGCTCC</td><td> 4900</td>

<td>GCCTCGCTGT</td><td>GAGTGATTTT</td><td>CTCCGCAAGC</td><td>TCACGAATGT</td><td>AGCTCAGATG</td><td> 4950</td>

<td>TGTGTGGATG</td><td>TTGTCTCTCG</td><td>TGTTTATGGG</td><td>GTTTCCCCTG</td><td>GGCTCGTTCA</td><td> 5000</td>

<td>TAACCTGATT</td><td>GGCATGCTAC</td><td>AGGCTGTTGC</td><td>TGATGGCAAG</td><td>GCTCATTTCA</td><td> 5050</td>

<td>CTGAGTCAGT</td><td>GAAGCCAGTG</td><td>CTTGACCTGA</td><td>CAAATTCAAT</td><td>TCTGTGTCGG</td><td> 5100</td>

<td>GTGGAATGAA</td><td>TAACATGTCT</td><td>TTTGCTGCGC</td><td>CCATGGGTTC</td><td>GCGACCATGC</td><td> 5150</td>

<td>GCCCTCGGCC</td><td>TATTTTGCTG</td><td>TTGCTCCTCA</td><td>TGTTTCTGCC</td><td>TATGCTGCCC</td><td> 5200</td>

<td>GCGCCACCGC</td><td>CCGGTCAGCC</td><td>GTCTGGCCGC</td><td>CGTCGTGGGC</td><td>GGCGCAGCGG</td><td> 5250</td>

<td>CGGTTCCGGC</td><td>GGTGGTTTCT</td><td>GGGGTGACCG</td><td>GGTTGATTCT</td><td>CAGCCCTTCG</td><td> 5300</td>

<td>CAATCCCCTA</td><td>TATTCATCCA</td><td>ACCAACCCCT</td><td>TCGCCCCCGA</td><td>TGTCACCGCT</td><td> 5350</td>

<td>GCGGCCGGGG</td><td>CTGGACCTCG</td><td>TGTTCGCCAA</td><td>CCCGCCCGAC</td><td>CACTCGGCTC</td><td> 5400</td>

<td>CGCTTGGCGT</td><td>GACCAGGCCC</td><td>AGCGCCCCGC</td><td>CGCTGCCTCA</td><td>CGTCGTAGAC</td><td> 5450</td>

<td>CTACCACAGC</td><td>TGGGGCCGCG</td><td>CCGCTAACCG</td><td>CGGTCGCTCC</td><td>GGCCCATGAC</td><td> 5500</td>

<td>ACCCCGCCAG</td><td>TGCCTGATGT</td><td>TGACTCCCGC</td><td>GGCGCCATCC</td><td>TGCGCCGGCA</td><td> 5550</td>

<td>GTATAACCTA</td><td>TCAACATCTC</td><td>CCCTCACCTC</td><td>TTCCGTGGCC</td><td>ACCGGCACAA</td><td> 5600</td>

<td>ATTTGGTTCT</td><td>TTACGCCGCT</td><td>CCTCTTAGCC</td><td>CGCTTCTACC</td><td>CCTCCAGGAC</td><td> 5650</td>

<td>GGCACCAATA</td><td>CTCATATAAT</td><td>GGCTACAGAA</td><td>GCTTCTAATT</td><td>ATGCCCAGTA</td><td> 5700</td>

<td>CCGGGTTGCT</td><td>CGTGCCACAA</td><td>TTCGCTACCG</td><td>CCCGCTGGTC</td><td>CCCAACGCTG</td><td> 5750</td>

<td>TTGGTGGCTA</td><td>CGCTATCTCC</td><td>ATTTCGTTCT</td><td>GGCCACAGAC</td><td>CACCACCACC</td><td> 5800</td>

<td>CCGACGTCCG</td><td>TTGACATGAA</td><td>TTCAATAACC</td><td>TCGACGGATG</td><td>TCCGTATTTT</td><td> 5850</td>

<td>AGTCCAGCCC</td><td>GGCATAGCCT</td><td>CCGAGCTTGT</td><td>TATTCCAAGT</td><td>GAGCGCCTAC</td><td> 5900</td>

<td>ACTATCGCAA</td><td>CCAAGGTTGG</td><td>CGCTCTGTTG</td><td>AGACCTCCGG</td><td>GGTGGCGGAG</td><td> 5950</td>

<td>GAGGAGGCCA</td><td>CCTCTGGTCT</td><td>TGTCATGCTC</td><td>TGCATACATG</td><td>GCTCACCTGT</td><td> 6000</td>

<td>AAATTCTTAT</td><td>ACTAATACAC</td><td>CCTATACCGG</td><td>TGCCCTCGGG</td><td>CTGTTGGACT</td><td> 6050</td>

<td>TTGCCCTCGA</td><td>ACTTGAGTTC</td><td>CGCAACCTCA</td><td>CCCCCGGTAA</td><td>TACCAATACG</td><td> 6100</td>

<td>CGGGTCTCGC</td><td>GTTACTCCAG</td><td>CACTGCCCGT</td><td>CACCGCCTTC</td><td>GTCGCGGTGC</td><td> 6150</td>

<td>AGATGGGACT</td><td>GCCGAGCTCA</td><td>CCACCACGGC</td><td>TGCTACTCGC</td><td>TTCATGAAGG</td><td> 6200</td>

<td>ACCTCTATTT</td><td>TACTAGTACT</td><td>AATGGTGTTG</td><td>GTGAGATCGG</td><td>CCGCGGGATA</td><td> 6250</td>

<td>GCGCTTACCC</td><td>TGTTTAACCT</td><td>TGCTGACACC</td><td>CTGCTTGGCG</td><td>GTCTACCGAC</td><td> 6300</td>

<td>AGAATTGATT</td><td>TCGTCGGCTG</td><td>GTGGCCAGCT</td><td>GTTCTACTCT</td><td>CGCCCCGTCG</td><td> 6350</td>

<td>TCTCAGCCAA</td><td>TGGCGAGCCG</td><td>ACTGTTAAGC</td><td>TGTATACATC</td><td>TGTGGAGAAT</td><td> 6400</td>

<td>GCTCAGCAGG</td><td>ATAAGGGTAT</td><td>TGCAATCCCG</td><td>CATGACATCG</td><td>ACCTCGGGGA</td><td> 6450</td>

ES 2 336 282 T3

ATCCCGTGTA

GTTATTCAGG

ATTATGACAA

CCAACATGAG

CAGGACCGAC

CGACACCTTC

CCCAGCCCCA

TCGCGTCCTT

TTTCTGTCCT

CCGAGCTAAC

6550

GATGTGCTTT

GGCTTTCTCT

CACCGCTGCC

GAGTATGACC

AGTCCACTTA

6600

CGGCTCTTCG

ACCGGCCCAG

TCTATGTCTC

TGACTCTGTG

ACCTTGGTTA

6650

ATGTTGCGAC

CGGCGCGCAG

GCCGTTGCCC

GGTCACTCGA

CTGGACCAAG

6700

GTCACACTTG

ATGGTCGCCC

CCTTTCCACC

ATCCAGCAGT

ATTCAAAGAC

6750

CTTCTTTGTC

CTGCCGCTCC

GCGGTAAGCT

CTCCTTTTGG

GAGGCAGGAA

6800

CTACTAAAGC

CGGGTACCCT

TATAATTATA

ACACCACTGC

TAGTGACCAA

6850

CTGCTCGTTG

AGAATGCCGC

TGGGCATCGG

GTTGCTATTT

CCACCTACAC

6900

TACTAGCCTG

GGTGCTGGCC

CCGTCTCTAT

TTCCGCGGTT

GCTGTTTTAG

6950

HasACTC

TGTGCTAGCA

TTGCTTGAGG

ATACCATGGA

CTACCCTGCC

7000

CGCGCCCATA

CTTTCGATGA

CTTCTGCCCG

GAGTGCCGCC

CCCTTGGCCT

7050

CCAGGGTTGT gcttttcagt

CTACTGTCGC

TGAGCTTCAG

CGCCTTAAGA

7100

TGAAGGTGGG

TAAAACTCGG

GAGTTATAGT

TTATTTGCTT

GTGCCCCCCT

7150

TCTTTCTGTT

GCTTATTT

7168

The abbreviations used for nucleotides are those commonly used in the art.

In a preferred embodiment, the nucleic acid sequence used in the method of the present invention consists of nucleotides 5147 to 7126 of SEQ ID NO: 4.

The sequence in one direction has been designated by convention as the "plus" sequence since it is the strain that encodes the protein of RNA viruses and this is the sequence shown above as SEQ ID NO: 4.

The deduced amino acid sequences of the SAR-55 open reading frames having SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 ORF-1 starts at nucleotide 28 of SEQ ID NO. 4 and 5078 nucleotides are extended; ORF-2 starts at nucleotide 5147 of SEQ ID NO. 4 and spans 1979 nucleotides; and ORF3 starts at nucleotide 5106 of SEQ ID NO. 4 and spans 368 nucleotides.

Variations are contemplated in the DNA sequence that will result in a DNA sequence that is capable of directing the production of the ORF-2 protein analogs. It should be noted that the DNA sequence set forth above may represent one embodiment of the present invention. Due to the degeneracy of the genetic code, it should be understood that various nucleotide choices can be made so that they can lead to a DNA sequence capable of producing ORF proteins or their analogs, including ORF2 proteins. As such, DNA sequences that are functionally equivalent to the sequences set forth above or that are functionally equivalent to sequences that could direct the production of the ORF protein analogs produced according to the amino acid sequence set forth above are intended to be encompassed. within the present invention.

The present invention describes a method for detecting hepatitis E virus in biological samples based on the selective amplification of hepatitis E gene fragments. Preferably, this method uses a pair of single-stranded primers derived from non-homologous regions of the Opposite strands of a duplex DNA fragment, which in turn is derived from a hepatitis E virus whose genome contains a region homologous to the SAR-55 sequence shown in SEQ ID NO .: 4. These primers can be used in a method that follows the process for amplifying nucleic acid sequences as defined in US Patent No. 4,683,202.

The present invention also describes the use of single-stranded antisense poly or oligonucleotides derived from SAR-55 cDNA-like sequences to inhibit the expression of hepatitis E genes. These antisense poly or oligonucleotides can be either DNA or RNA. The target sequence is typically a messenger RNA and more preferably, a signal sequence required to process or translate the RNA. Antisense poly or oligonucleotides can be conjugated to a polycation such as a polylysine as described in Lemaitre, M. et al. (1989) Proc Natl Acad Sci USA 84: 648-652; and this conjugate can be administered to a mammal in an amount sufficient to hybridize with, and inhibit the function, of the messenger RNA.

ES 2 336 282 T3

The first invention includes a recombinant DNA method for the manufacture of HEV proteins, preferably a protein composed of at least one of the ORF proteins, including the ORF-2 protein, more preferably at least one ORF-2 protein. The recombination of the ORF protein can be composed of one ORF protein or a combination of the same or different ORF proteins, including the ORF-2 protein. A natural or synthetic nucleic acid sequence can be used to direct the production of HEV proteins.

In one embodiment, said method comprises:

(a) preparing a nucleic acid sequence capable of directing a host organism to produce a HEV protein; which includes the ORF-2 protein (b) cloning the nucleic acid sequence into a vector capable of being transferred into and replicated in a host organism, said vector containing operational elements for the nucleic acid sequence;

(c) transfer of the vector containing nucleic acids and operational elements into a host organism capable of expressing the protein;

(d) culturing the host organism under conditions appropriate for vector amplification and protein expression; and (e) culturing the protein.

In another embodiment of the invention the method for the synthesis of recombinant DNA of a protein that includes the ORF-2 protein encoded by HEV nucleic acids, preferably encoding at least one HEV ORF or a combination of the same or different proteins ORFs that include the ORF-2 protein, more preferably that encode at least one ORF-2 protein, comprise:

(a) culturing a transformed or transfected organism that contains a nucleic acid sequence capable of directing the host organism to produce a protein, under conditions such that the protein is produced, said protein exhibits substantial homology to an isolated native HEV protein of HEV having the amino acid sequence according to SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3, or the combination thereof, however, always includes the amino acid sequence according to SEQ ID NO. 2.

In one embodiment, the RNA sequence of the viral genome of the HEV SAR-55 strain was isolated and cloned into cDNA as follows. Viral RNA is extracted from a biological sample collected from cynomolgus monkeys infected with SAR-55 and viral RNA is then reverse transcribed and amplified by the polymerase chain reaction using primers complementary to the positive or negative strands of the genome. a strain of HEV from Burma (Tam et al.) or from the SAR-55 genome. The PCR fragments are subcloned into pBR322 or pGEM-3 and the double-stranded PCR fragments were sequenced.

Vectors contemplated for use in the present invention include a baculovirus expression vector into which a nucleic acid sequence as described above can be inserted, along with any required or preferred operational elements, and which vector can then be transferred. subsequently in a host organism and replicated in said organism. The vector used is one whose restriction sites have been well documented and which contain the preferred or required operational elements for transcription of the nucleic acid sequence.

The "operational elements" as described herein include at least one promoter, at least one operator, at least one leader sequence, at least one stop codon, and any other DNA sequences necessary or preferred for proper transcription and subsequent translation. nucleic acid vector. In particular, it is contemplated that said vectors will contain at least one origin of replication recognized by the host organism together with at least one selectable marker and at least one promoter sequence capable of initiating transcription of the nucleic acid sequence.

In constructing the cloning vector of the present invention, it should be further noted that multiple copies of the nucleic acid sequence and its expected operational elements can be inserted into each vector. In such an embodiment, the host organism would produce higher amounts per vector of the desired HEV protein. The number of multiple copies of the DNA sequence that can be inserted into the vector is limited only by the ability of the resulting vector due to its size, to be transferred into and replicated to and transcribed in an appropriate host microorganism.

In another embodiment, post-digestion restriction fragments containing a coding sequence for HEV proteins can be inserted into a suitable expression vector that functions in prokaryotic or eukaryotic cells. By "suitable" it is meant that the vector is capable of transporting and expressing a nucleic acid sequence.

ES 2 336 282 complete T3 encoding HEV proteins, preferably in at least one complete ORF protein. In the case of ORF2, the expressed protein should form viral-like particles. The expression vector is a baculovirus expression vector that functions in a eukaryotic cell, especially an insect cell. Reference is made to the baculovirus transfer vector, pBlueBac. Preferred vectors are p63-2, which contain the complete ORF-2 gene, and p59-4, which contains the complete ORF-2 and ORF-3 genes. These vectors were deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD 20852 USA on September 10, 1992. Example 1 illustrates the cloning of the ORF-2 gene into pBluebac to produce p63-2. This method includes digesting the HEV SAR-55 strain genome with the restriction enzymes NruI and BglII, inserting a polycloning site containing the BlnI and BglII sites into the unique NheI site of the vector and inserting the ORF-2 NruI fragment. -BglII in pBluebac BlnI-BglII using an adapter.

In another embodiment, the selected recombinant expression vector can then be transfected into a suitable eukaryotic cell system for the purpose of expressing the recombinant protein. A preferred eukaryotic cell system is Sf9 insect cells. A preferred method involves the use of the expression vector pBluebac where the SF9 insect cell line is co-transfected with the recombinant pBluebac and the AcMNPV baculovirus DNA by the Ca precipitation method.

The expressed recombinant protein can be detected by methods known in the art including Coomassie blue staining and Western blotting using serum containing the anti HEV antibody as shown in Example 2. Another method is the detection of viral-like particles by immunoelectron microscopy. as shown in Example 3.

Recombinant protein expressed by SF9 cells can be obtained as a crude lysate or can be purified by standard protein purification procedures known in the art which may include differential precipitation, molecular sieve chromatography, ion exchange chromatography, focussing. isoelectric, gel electrophoresis, affinity and immunoaffinity chromatography and the like. In the case of immunoaffinity chromatography, the recombinant protein can be purified by passage through a column containing a resin that has bound the same specific antibodies for the ORF protein.

The recombinant proteins expressed in this invention can be used in immunoassays for the diagnosis or prognosis of hepatitis E in a mammal including, but not limited to, humans, chimpanzees, old world monkeys, new world monkeys, other primates and Similar. In a preferred embodiment, the immunoassay is useful in the diagnosis of hepatitis E infection in humans. Immunoassays using HEV proteins, particularly ORF proteins, which include the ORF2 protein and especially ORF2 proteins, provide a highly specific, sensitive and reproducible method for the diagnosis of HEV infections, in contrast to immunoassays using the proteins. Partial ORFs.

The immunoassays mentioned in the present invention can be radioimmunoassays, Western blot assays, immunofluorescent assays, enzyme immunoassays, chemiluminescent assays, immunohistochemical assays, and the like. Standard techniques known in the art for ELISA are described in Methods in Immunodiagnosis, 2nd Edition, Rose and Bigazzi, eds., John Wiley and Sons, 1980 and Campbell et al., Methods of Immunology, WA Benjamin, Inc., 1964, both of which are incorporated herein by reference. Such assays can be non-competitive, competitive, indirect, or direct immunoassays as described in the art. (Oellerich, M. 1984. J. Clin. Chem. Clin. BioChem. 22: 895-904). Biological samples suitable for such screening assays include, but are not limited to, tissue biopsy extracts, whole blood, plasma, serum, cerebrospinal fluid, pleural fluid, urine, and the like.

The test serum is reacted with a solid phase reagent having a recombinant HEV protein bound to the surface as an antigen, preferably the ORF-2 protein or the combination of the different ORF proteins such as ORF-2 and ORF-3, however they always include ORF-2. More preferably, the HEV protein is an ORF-2 protein that forms viral-like particles. The solid surface reagent can be prepared by known techniques to bind the protein to the solid support material. These binding methods include non-specific adsorption of the protein for covalent or supportive binding of the protein to a reactive group on the support. After reaction of the antigen with an anti HEV antibody, the unbound serum components are washed away and the antibody-antigen complex is reactivated with a secondary antibody such as labeled anti-human antibody. The label can be an enzyme that is detected by incubation of the solid support in the presence of a suitable colorimetric or fluorimetric reagent. Other detectable labels can also be used, such as radiolabel or colloidal gold, and the like.

In a preferred embodiment, the protein expressed by the recombinant vector pBluebac containing the entire ORF-2 sequence of SAR-55 is used as a specific binding agent to detect anti-HEV antibodies, preferably IgG or IgM antibodies. Examples 4 and 5 show the results of an ELISA in which the solid phase reagent has a recombinant ORF-2 as the surface antigen. This protein, encoded by the entire ORF-2 nucleic acid sequence, is superior to the partial ORF-2 protein in that it is reactive with more antisera from the different HEV-infected primate species that are ORF-2 partial antigens. The protein of the present invention is also capable of detecting antibodies produced in response to the different strains of HEV but not to the Hepatitis A, B, C or D virus.

ES 2 336 282 T3

The HEV protein and the like can be prepared in the form of a kit, alone or in combination with other reagents such as secondary antibodies, for use in immunoassays.

Recombinant HEV proteins, which include an ORF-2 protein, preferably an ORF-2 protein or the combination of ORF proteins, and proteins substantially homologous and analogous to that of the invention can be used as a vaccine to protect mammals against the exposure to Hepatitis E. The vaccine, which acts as an immunogen, can be a cell, a cell lysate of cells transfected with a recombinant expression vector, or a supernatant culture containing the expressed protein. Alternatively, the immunogen is a substantially or partially purified recombinant protein. Although it is possible for the immunogen to be administered in a substantially pure or pure form, it is preferable to present it as a pharmaceutical preparation, formulation or composition.

The formulations described in the present invention, both for human and veterinary use, comprise an immunogen as described above, together with one or more pharmaceutically acceptable excipients and optionally other therapeutic ingredients. The excipient (s) may be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not detrimental to the container thereof. The formulations can be conveniently presented in unit dose form and can be prepared by any method well known in the art of pharmacy.

All methods include the step of bringing the active ingredient in association with the excipient that constitutes one or more accessory ingredients. In general, formulations are prepared for uniformity and are closely associated with the active ingredient with liquid excipients or finely divided solid excipients or both, and then, if necessary, shaping the product into the desired formulation.

Formulations suitable for intraperitoneal, subcutaneous, intramuscular or intravenous administration conveniently comprise sterile aqueous solutions of the active ingredient with solutions which are preferably isotonic with the blood of the recipient. Said formulations can be conveniently prepared by dissolving the solid active ingredient in water, containing physiologically compatible substances such as sodium chloride (for example, 0.1-2, OM), glycine and the like and having a buffered pH compatible with the physiological conditions for producing an aqueous solution and translating said sterile solution. These may be present in multidose units or containers, for example, sealed ampoules or vials.

The formulations described in the present invention may incorporate a stabilizer. Illustrative stabilizers are polyethylene glycol, proteins, saccharides, amino acids, inorganic acids, and organic acids that can be used either alone or as mixtures. These stabilizers are preferably incorporated in an amount of 0.1110,000 parts by weight per part by weight of the immunogen. If two or more stabilizers are to be used, their total amount is preferably within the range specified above. These stabilizers are used in aqueous solutions at the appropriate concentration and pH. The specific osmotic pressure of such aqueous solutions is generally in the range 0.1-3.0 osmoles, preferably in the range 0.8-1.2. The pH of the aqueous solution is adjusted to be within the range of 5.0-9.0, preferably within the range of 6-8. In the formulation of the immunogen described in the present invention, an anti-adsorption agent can be used.

Additional pharmaceutical methods can be employed to control the duration of action. Controlled release preparations can be achieved through the use of the polymer to complete or adsorb the proteins or their derivatives. Controlled delivery can be exercised by the selection of suitable macromolecules (for example polyester, polyamine acids, polyvinyl, pyrrolidone, ethylene vinyl acetate, methyl cellulose, carboxymethyl cellulose or protamine sulfate) and the concentration of macromolecules as well as the methods of incorporation to control the release . Another possible method of controlling the duration of action by controlled release preparations is to incorporate the proteins, protein analogs or their functional derivatives, in particles of a polymeric material such as polyesters, polyamine acids, hydrogels, poly (lactic acid) or ethylene vinyl acetate copolymers. Alternatively, instead of incorporating these agents into the polymeric particles, it is possible to entrap these materials in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxy methylcellulose or gelatin microcapsules and poly (microcapsules). methylmethacrylate), respectively or in colloidal drug delivery systems, e.g. liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules or in macroemulsions.

When oral preparations are desired, the compositions can be combined with typical excipients, such as lactose, sucrose, starch, talcum magnesium stearate, crystalline cellulose, methyl cellulose, carboxymethyl cellulose, glycerin, sodium alginate or acacia among others.

The proteins as a result of the method of the present invention can be supplied in the form of a kit, alone or in the form of a pharmaceutical composition as described above.

Vaccination can be conducted by conventional methods. For example, the immunogen can be used in a suitable diluent such as saline or water, or in complete or incomplete adjuvants. Furthermore, the immunogen may or may not be linked to an excipient to make the protein immunogenic. Examples of such excipient molecules include, but are not limited to, bovine serum albumin (BSA), keyhole limpet hemocyanin (KLH), tetanus toxoid, and the like. The immunogen can be administered by any appropriate route for production.

ES 2 336 282 T3 antibodies such as intravenous, intraperitoneal, intramuscular, subcutaneous and the like. The immunogen can be administered once or at periodic intervals until a significant concentration of anti-HEV antibodies is produced. The antibody can be detected in serum using an immunoassay.

Administration of the immunogen as a result of the method of the present invention can be either for a prophylactic or therapeutic purpose. When provided prophylactically, the immunogen is provided prior to any exposure to HEV or prior to any symptoms due to HEV infection. Prophylactic administration of the immunogen serves to prevent or attenuate any subsequent HEV infection in a mammal. When provided therapeutically, the immunogen is provided during (or shortly after) the onset of the infection or during the onset of any symptoms of the infection or disease caused by HEV. Therapeutic administration of the immunogen serves to attenuate the infection or disease.

A vaccine prepared using a recombinant ORF-2 protein expressed by the ORF-2 sequence of the HEV SAR-55 strain and the equivalents thereof is preferably mentioned. Since the recombinant ORF-2 protein has been shown to be reactive with a variety of HEV-positive sera, its utility in protecting against a variety of HEV strains is indicated.

In addition to being used as a vaccine, the compositions can be used to prepare antibodies against HEV virus-like particles. Antibodies can be used directly as antiviral agents. To prepare the antibodies, a host animal is immunized using the viral particles or, as appropriate, non-particulate antigens native to the virus particle are bound to an excipient as described above for vaccines. Host serum or plasma is collected following an appropriate time interval to provide a composition comprising antibodies reactive with the virus particle. The gamma globulin fraction or IgG antibodies can be obtained, for example, by the use of saturated ammonium sulfate or DEAE Sephadex, or other techniques known to those skilled in the art. Antibodies are substantially free of many of the adverse side effects that can be associated with other antiviral agents such as drugs.

Antibody compositions can be made even more compatible with the host system by minimizing potential adverse immune system responses. This is accomplished by removing all or a portion of the Fc portion of an antibody from a different species or by using an antibody from the same species as the host animal, eg, using human / human hybridoma antibodies. Humanized (ie, non-immunogenic in a human) antibodies can be produced, for example, by replacing an immunogenic portion of an antibody with a corresponding, but not an immunogenic portion (ie, chimeric antibodies). Such chimeric antibodies may contain the antigen-binding or reactive portion of an antibody of one species and the Fc portion of a (non-immunogenic) antibody of a different species. Examples of chimeric antibodies include, but are not limited to, non-human mammalian-human chimeras, rodent-human chimeras, murine-human and rat-human chimeras (Robinson et al., International Patent Application 184, 187; Taniguchi M. , European Patent Application 171,496; Morrison et al., European Patent Application 173,494; Neuberger et al., PCT Application WO 86/01533; Cabilly et al., 1987 Proc. Natl. Acad. Sci. USA 84: 3439; Nishimura et al., 1987 Canc. Res. 47: 999; Wood et al. 1985 Nature 314: 446; Shaw et al., 1988 J. Natl. Cancer Inst. 80: 15553, all incorporated herein by reference).

General reviews of "humanized" chimeric antibodies are provided by Morrison S. 1985 Science 229: 1202 and by Oi et al., 1986 Bio Techniques 4: 214.

Suitable "humanized" antibodies can alternatively be produced by CDR or CEA substitution (Jones et al., 1986 Nature 321: 552; Verhoeyan et al., 1988 Science 239: 1534; Biedler et al. 1988 J. Immunol. 141: 4053, all incorporated herein by reference).

The antibodies or antigens that bind the fragments can be produced by genetic engineering. The technology for the expression of both heavy and light chain genes in E. coli is the subject of PCT patent applications; the publication number of patent document WO 901443, WO 901443, and WO 9014424 and in Huse et al., 1989 Science 246: 1275-1281.

Antibodies can also be used as a means to enhance the immune response. Antibodies can be administered in amounts similar to those used for other therapeutic administrations of the antibody. For example, concentrated gamma globulin is administered at 0.02-0.1 ml / lb of body weight during the early incubation period of other viral diseases such as rabies, measles, and hepatitis B to interfere with viral entry into the cells. Thus, antibodies reactive with the HEV virus particle can be passively administered alone or in conjunction with another antiviral agent to a HEV-infected host to enhance the immune response and / or the effectiveness of an antiviral drug.

Alternatively, anti HEV antibodies can be induced by administration of anti idiotype antibodies as immunogens. Conveniently, a purified anti HEV antibody preparation prepared as described above is used to induce the anti idiotype antibody in an animal host. The composition is administered to the animal host in a suitable diluent. After administration, usually repeated administration, the host produces the anti idiotype antibody. To eliminate an immunogenic response against the Fc region, antibodies produced by the same species of the animal host can be used or the Fc region

ES 2 336 282 T3 of the administered antibodies can be eliminated. Following induction of the anti-idiotype antibody in the animal host, serum or plasma is withdrawn to provide an antibody composition. The composition can be purified as described above for anti HEV antibodies, or by affinity chromatography using anti HEV antibodies bound to the affinity matrix. The anti-idiotype antibodies produced are similar in conformation to the authentic HEV antigen and can be used to prepare a HEV vaccine instead of using a HEV particulate antigen.

When used as a means of inducing anti HEV virus antibodies in an animal, the manner of injecting the antibody is the same as for vaccination purposes, especially intramuscular, intraperitoneal, subcutaneous or the like in an effective concentration in a physiologically suitable diluent. or without adjuvant. One or more booster injections may be desired.

Proteins derived from HEV as a result of the method of the invention are also intended for use in the production of the antiserum designated for post or pre exposure prophylaxis. Here an HEV protein, or the mixture of proteins, is formulated with a suitable adjuvant and administered by injection to human volunteers, according to known methods for the production of human antiserum. The antibody response to the injected proteins is monitored, over a period of several weeks after immunization, by periodic serum sampling for the presence of anti-HEV serum antibodies, using an immunoassay as described herein.

Antiserum from immunized individuals can be administered as a pre-exposure prophylactic measure for individuals who are at risk of infection. The antiserum is also useful in the treatment of a post-exposed individual, analogous to the use of high-concentration antiserum against hepatitis B virus for post-exposure prophylaxis.

For both in vivo use of the antibodies in the HEV virus-like particles and the anti-idiotype proteins and antibodies and the diagnostic use, it may be preferable to use the monoclonal antibodies. Monoclonal anti-viral particles or anti-idiotype antibodies can be produced as follows. The spleen or lymphocytes of an immunized animal are removed and immortalized or used to prepare the hybridomas by methods known to those skilled in the art (Goding, JW 1983 Monoclonal Antibodies: Principles and Practice, Pladermic Press, Inc., NY, NY, pp. 56-97). To produce a human-human hybridoma, a human lymphocyte donor is selected. A donor who is known to be infected with HEV (where the infection has been shown for example by the presence of the antiviral antibodies in the blood or by culture of the virus) can serve as a suitable lymphocyte donor. Lymphocytes can be isolated from a peripheral blood sample or spleen cells can be used if the donor is undergoing splenectomy. Barr Epstein virus (EBV) can be used to immortalize human lymphocytes or a human fusion partner can be used to produce human-human hybridomas. Primary in vitro immunization with peptides can also be used in the generation of human monoclonal antibodies.

Antibodies secreted by immortalized cells are screened for clones that secrete antibodies of the desired specificity. For monoclonal anti-viral particles, the antibodies must bind to the HEV virus particles. For monoclonal anti-idiotype antibodies, the antibodies must bind to anti-viral particles. Cells that produce antibodies of the desired specificity are selected.

The antibodies described above and antigens that bind fragments thereof can be supplied in kit form alone or as a pharmaceutical composition for in vivo use. The antibodies can be used for therapeutic uses, diagnostic use in immunoassays or as an immunoaffinity agent to purify ORF proteins as described herein.

The materials used in the following Examples were as follows:

Primates Chimpanzee (Chimp) (Pan troglodytes). Old world monkeys: cynomolgus monkeys (Cyno) (Macaca fascicularis), Rhesus monkeys (Rhesus) (M. mulatta), pig monkeys (PT) (M. nemestrina), and African green monkeys (AGM) (Cercopithecus aethiops). New World monkeys: mustached tamarinds (Tam) (Saguinus mystax), squirrel monkeys (SQM) (Salmiri sciureus) and owl monkeys (OWL) (Aotus trivigatus). The primates were kept separately in biohazard containment conditions. The storage, maintenance and care of the animals met or exceeded all requirements for primate husbandry.

Most of the animals were inoculated intravenously with HEV, the SAR-55 strain contained in 0.5 ml of a fecal suspension diluted in fetal calf serum as described in Tsarev, SA et al. (1992), Proc. Natl. Acad. Sci USA, 89: 559-563; and Tsarev, SA et al. (1992), J. Infect. Dis. (Presented). Chimpanzees 1313 and 1310 were inoculated with a batch of stools collected from Pakistani 7 hepatitis E patients.

Serum samples were collected approximately twice a week before and after inoculation. Levels of liver enzyme serum alanine aminotransferase (ALT), isocitrate dehydrogenase (ICD), and gamma-glutamyl transferase (GGT) were assayed with commercially available assays (Medpath Inc., Rockville, MD). Serological tests were performed as described above.

ES 2 336 282 T3

Example 1

Identification of the DNA sequence of the SAR-55 HEV strain genome

Preparation of the RNA virus Template for PCR. Bile from a HEV-infected cynomolgus monkey (10 μl), 20% SDS (wt / vol) (at a final concentration of 1%), proteinase K (10 mg / ml; at a final concentration of 1 mg / ml), 1 µl of tRNA (10 mg / ml), and 3 µl of 0.5 M EDTA were mixed in a final volume of 250 µl and incubated for 30 min. at 55 ° C. Total nucleic acids were extracted from the bile twice with chloroform / phenol, 1: 1 (vol / vol), at 65 ° C and once with chloroform, then precipitated with ethanol, washed with 95% ethanol, and used to the RT-PCR. RT-PCR amplification of HEV RNA from stool and especially serum was more efficient when the RNA was more extensively purified. Serum (100 Jul) or 10% of a fecal suspension (200 // l) was treated as above with proteinase K. After 30 min of incubation, 300 µl of CHAOS buffer (4.2 M guanidine thiocyanate / 0.5 N-lauroylsarcosine / 0.025 M Tris-HCl, pH 8.0) were added. Nucleic acids were extracted twice with phenol / chloroform at 65 ° C followed by extraction of chloroform at room temperature. 7.5 M ammonium acetate (225 joule) was then added to the upper phase and the nucleic acids were precipitated with 0.68 ml of 2-propanol. The precipitation was dissolved in 300 µl of CHAOS buffer and 100 µl of H2O. The chloroform and 2-propanol precipitation extractions were repeated. The nucleic acids were dissolved in water, precipitated with ethanol, washed with 95% ethanol, and used for RT-PCR.

Primers. Ninety-four primers, 21-40 nucleotides (nt) long, and complementary to positive or negative strands of the genome of a HEV strain from Burma (BUR-121) (Tam, AW et al. (1991), Virology, 185: 120 -131) or the SAR-55 genome were synthesized using an Applied Biosystems model 391 DNA synthesizer.

(Table goes to next page)

ES 2 336 282 T3

The sequences of these 94 primers are shown below starting with SEQ. ID NO.5 and continuing with SEQ. ID NO. 98:

HEV primer list

Primer Region ORF Sequence

<td>D 3042 B</td><td> 1</td><td>ACATTTGAATTCACAGACAT TGTGC</td><td>(SEQ. ID. NO. 5)</td>

<td>R3043 B</td><td> 1</td><td>ACACAGATCTGAGCTACATT CGTGAG</td><td>(SEQ. ID. NO. 6)</td>

<td>D 3044 B</td><td> 1</td><td>AAAGGGATCCATGGTGTTTG AGAATGZ</td><td>(SEQ. ID. NO. 7)</td>

<td>R 3045 B</td><td> 1</td><td>ACTCACTGCAGAGCACTATC GAATC</td><td>(SEQ. ID. NO. 8)</td>

<td>R261 S</td><td> 1</td><td>CGGTAAACTGGTACTGCACA AC</td><td>(SEQ. ID. NO. 9)</td>

<td>D260S</td><td> 1</td><td>AAGTCCCGCTCTATTACCCA AG</td><td>(SEQ. ID. NO. 10)</td>

<td>D259S</td><td> 1</td><td>ACCCACGGGTGTTGGTTTTT G</td><td>(SEQ.ID.NO. 11)</td>

<td>R255S</td><td> 1</td><td>TTCTTGGGGCAGGTAGAGAA G</td><td>(SEQ. ID. NO. 12)</td>

<td>R254S</td><td> 2</td><td>TTATTGAATTCATGTCAACG GACGTC</td><td>(SEQ. ID. NO. 13)</td>

<td>D242 S</td><td> 1</td><td>AATAATTCATGCCGTCGCTC C</td><td>(SEQ. ID. NO. 14)</td>

<td>R241 S</td><td> 1</td><td>AAGCTCAGGAAGGTACAACT C</td><td>(SEQ. ID. NO. 15)</td>

<td>R231 S</td><td> 1</td><td>AAATCGATGGCTGGGATCTG ATTC</td><td>(SEQ. ID. NO. 16)</td>

<td>R230S</td><td> 1</td><td>GAGGCATTGTAGÁGCTTTGT G</td><td>(SEQ. ID. NO. 17)</td>

<td>D229 S</td><td> 1</td><td>GATGTTGCACGGACAGCAAA TC</td><td>(SEQ. ID. NO. 18)</td>

<td>D228 S</td><td> 1</td><td>ATCTCCGATGCAATCGTTAA TAAC</td><td>(SEQ. ID. NO. 19)</td>

<td>D227B</td><td> 1</td><td>TAATCCATTCTGTGGCGAGA G</td><td>(SEQ. ID. NO. 20)</td>

<td>R218 B</td><td> 2</td><td>AAGTGTGACCTTGGTCCAGT C</td><td>(SEQ. ID. NO. 21)</td>

<td>D217B</td><td> 2</td><td>TTGCTCGTGCCACAATTCGC TAC</td><td>(SEQ. ID. NO. 22)</td>

ES 2 336 282 T3

<td>Primer</td><td>ORF region</td><td>Sequence</td><td></td>

<td>D211 Β</td><td> 1</td><td>CATTTCACTGAGTCAGTGAA GZ</td><td>(SEQ. ID. NO. 23)</td>

<td>D202 Β</td><td> 2</td><td>TAATTATAACACCACTGCTA G</td><td>(SEQ. ID. NO. 24)</td>

<td>R 201 Β</td><td> 2</td><td>GATTGCAATACCCTTATCCT G</td><td>(SEQ. ID. NO. 25)</td>

<td>R 200 S</td><td> 1</td><td>ATTAAACCTGTATAGGGCAG AAC</td><td>(SEQ. ID. NO. 26)</td>

<td>R 199 S</td><td> 1</td><td>AAGTTCGATAGCCAGATTTG C</td><td>(SEQ. ID. NO. 27)</td>

<td>R 198 S</td><td> 2</td><td>TCATGTTGGTTGTCATAATC C</td><td>(SEQ. ID. NO. 28)</td>

<td>R 193 B</td><td> 1</td><td>GATGACGCACTTCTCAGTGT G</td><td>(SEQ. ID. NO. 29)</td>

<td>R 192 B</td><td colspan="2">1 AGAACAACGAACGGAGAAC</td><td>(SEQ. ID. NO. 30)</td>

<td>D 191 B</td><td> 1</td><td>AGATCCCAGCCATCGACTTT G</td><td>(SEQ. ID. NO. 31)</td>

<td>R 190 S</td><td> 2</td><td>TAGTAGTGTAGGTGGAAATA G</td><td>(SEQ. ID. NO. 32)</td>

<td>D 189 B</td><td> 2</td><td>GTGTGGTTATTCAGGATTAT G</td><td>(SEQ. ID. NO. 33)</td>

<td>D 188 B</td><td> 2</td><td>ACTCTGTGACCTTGGTTAAT G</td><td>(SEQ. ID. NO. 34)</td>

<td>R 187 S</td><td> 2</td><td>AACTCAAGTTCGAGGGCAAA G</td><td>(SEQ. ID. NO. 35)</td>

<td>D 186 S</td><td> 2</td><td>CGCTTACCCTGTTTAACCTT G</td><td>(SEQ. ID. NO. 36)</td>

<td>D 185 B</td><td> 2,3</td><td>ATCCCCTATATTCATCCAAC CAAC</td><td>(SEQ. ID. NO. 37)</td>

<td>D 184 S</td><td> 2,3</td><td>CTCCTCATGTTTCTGCCTAT G</td><td>(SEQ. ID. NO. 38)</td>

<td>R 181 S</td><td> 2</td><td>GCCAGAACGAAATGGAGATA GC</td><td>(SEQ. ID. NO. 39)</td>

ES 2 336 282 T3

Primer Region ORF Sequence

<td>R 180 B</td><td> 1</td><td>CTCAGACATAAAACCTAAGT C</td><td>(SEQ. ID. NO. 40)</td>

<td>D 179 S</td><td> 1</td><td>TGCCCTATACAGGTTTAATC G</td><td>(SEQ. ID. NO. 41)</td>

<td>D 178 B</td><td> 1</td><td>ACCGGCATATACCAGGTGC</td><td>(SEQ. ID. NO. 42 ')</td>

<td>D 177 B</td><td> 2</td><td>ACATGGCTCACTCGTAAATT C</td><td>(SEQ. ID. NO. 43)</td>

<td>R 174 B</td><td> 1</td><td>AACATTAGACGCGTTAACGA G</td><td>(SEQ. ID. NO. 44)</td>

<td>D 173 S</td><td> 1</td><td>CTCTTTTGATGCCAGTCAGA G</td><td>(SEQ. ID. NO. 45)</td>

<td>D 172 B</td><td> 1</td><td>ACCTACCCGGATGGCTCTAA GG</td><td>(SEQ. ID. NO. 46)</td>

<td>R 166 B</td><td> 2</td><td>TATGGGAATTCGTGCCGTCC TGAAG (EcoRI)</td><td>(SEQ. ID. NO. 47)</td>

<td>R 143 B</td><td> 1</td><td>AGTGGGAGCAGTATACCAGC G</td><td>(SEQ. ID. NO. 48)</td>

<td>D 141 B</td><td> 1</td><td>CTGCTATTGAGCAGGCTGCT C</td><td>(SEQ. ID. NO. 49)</td>

<td>R 142 S</td><td> 1</td><td>GGGCCATTAGTCTCTAAAAC C</td><td>(SEQ. ID. NO. 50)</td>

<td>D 135 B</td><td> 1</td><td>GAGGTTTTCTGGAATCATC</td><td>(SEQ. ID. NO. 51)</td>

<td>R 134 B</td><td> 1</td><td>GCATAGGTGAGACTG</td><td>(SEQ. ID. NO. 52)</td>

<td>R 133 B</td><td> 1</td><td>AGTTACAGCCAGAAAACC</td><td>(SEQ. ID. NO. 53)</td>

<td>D 132 S</td><td> 2,3</td><td>CCATGGATCCTCGGCCTATT TTGCTGTTGCTCC (Bam HI)</td><td>(SEQ. ID. NO. 54)</td>

<td>D 131 B</td><td>5'NC</td><td>AGGCAGACCACATATGTG</td><td>(SEQ. ID. NO. 55)</td>

<td>R 119 B</td><td> 1</td><td>GGTGCACTCCTGACCAAGCC</td><td>(SEQ. ID. NO. 56)</td>

<td>D 118 B</td><td> 1</td><td>ATTGGCTGCCACTTTGTTC</td><td>(SEQ. ID. NO. 57)</td>

<td>R 117 B</td><td> 1</td><td>ACCCTCATACGTCACCACAA C</td><td>(SEQ. ID. NO. 58)</td>

<td>R 116 B</td><td> 1</td><td>GCGGTGGACCACATTAGGAT TATC</td><td>(SEQ. ID. NO. 59)</td>

<td>D 115 B</td><td> 1</td><td>CATGATATGTCACCATCTG</td><td>(SEQ. ID. NO. 60)</td>

<td>D 114 B</td><td> 1</td><td>GTCATCCATAACGAGCTGG</td><td>(SEQ. ID. NO. 61)</td>

ES 2 336 282 T3

<td>Primer</td><td>ORF region</td><td colspan="2">Sequence</td>

<td>R 112 Β</td><td> 2</td><td>AGCGGAATTCGAGGGGCGGC ATAAAGAACCAGG (EcoRI)</td><td>(SEQ. ID. NO. 62)</td>

<td>R 111 Β</td><td> 2</td><td>GCGCTGAATTCGGATCACAA GCTCAGAGGCTATGCC (ECORI)</td><td>(SEQ. ID. NO. 63)</td>

<td>D 110 B</td><td> 2</td><td>GTATAACGGATCCACATCTC CCCTTACCTC (Bam HI)</td><td>(SEQ. ID. NO. 64)</td>

<td>D 109 B</td><td> 2</td><td>TAACCTGGATCCTTATGCCG CCCCTCTTAG (Bam HI)</td><td>(SEQ. ID. NO. 65)</td>

<td>D 108 B</td><td> 1</td><td>AAATTGGATCCTGTGTCGGG TGGAATGAATAACATGTC (BamHI)</td><td>(SEQ. ID. NO. 66)</td>

<td>R 107 B</td><td> 1</td><td>ATCGGCAGATCTGATAGAGC GGGGACTTGCCGGATCC</td><td>(SEQ. ID. NO. 67)</td>

<td>D 101 B</td><td> 2</td><td>TACCCTGCCCGCGCCCATAC TTTTGATG</td><td>(SEQ. ID. NO. 68)</td>

<td>R 100 B</td><td> 1</td><td>GGCTGAGATCTGGTTCGGGT CGCCAAGAAGGTG (Bgl II)</td><td>(SEQ. ID. NO. 69)</td>

<td>R 99 B</td><td> 2</td><td>TACAGATCTATACAACTTAA CAGTCGG (Bgl II)</td><td>(SEQ. ID. NO. 70)</td>

<td>R 98 B</td><td> 2</td><td>GCGGCAGATCTCACCGACAC CATTAGTAC (Bgl II)</td><td>(SEQ. ID. NO. 71)</td>

<td>D97S</td><td> 1</td><td>CCGTCGGATCCCAGGGGCTG CTGTCCTG (Bam HI)</td><td>(SEQ. ID. NO. 72)</td>

<td>R 96 B</td><td> 2</td><td>AAAGGAATTCAAGACCAGAG GTAGCCTCCTC (EcoRI)</td><td>(SEQ. ID. NO. 73)</td>

<td>D 95 B</td><td> 2</td><td>GTTGATATGAATTCAATAAC CTCGACGG</td><td>(SEQ. ID. NO. 74)</td>

<td>R 94 B</td><td>3'NC</td><td>TTTGGATCCTCAGGGAGCGC GGAACGCAGAAATGAG (BamHI)</td><td>(SEQ. ID. NO. 75)</td>

<td>D 90 B</td><td> 2</td><td>TCACTCGTGAATTCCTATAC TAATAC (EcoRI)</td><td>(SEQ. ID. NO. 76)</td>

ES 2 336 282 T3

<td>Primer</td><td>ORF region</td><td colspan="2">Sequence</td>

<td>R 89 Β</td><td>3'NC</td><td>TTTGGATCCTCAGGGAGCGC GGAACGCAGAAATG (BamHI)</td><td>(SEQ. ID. NO. 77)</td>

<td>R 88 Β</td><td> 1</td><td>TGATAGAGCGGGACTTGCCG GATCC (BamHI)</td><td>(SEQ. ID. NO. 78)</td>

<td>R 87 Β</td><td> 1</td><td>TTGCATTAGGTTAATGAGGA TCTC</td><td>(SEQ. ID. NO. 79)</td>

<td>D 86 Β</td><td> 1</td><td>ACCTGCTTCCTTCAGCCTGC AGAAG</td><td>(SEQ. ID. NO. 80)</td>

<td>R 81 Β</td><td> 1</td><td>GCGGTGGATCCGCTCCCAGG CGTCAAAAC (BamHI)</td><td>(SEQ. ID. NO. 81)</td>

<td>D 80 Β</td><td> 1</td><td>gggcggatcgaattcgagac CCTTCTTGG (ECORI)</td><td>(SEQ. ID. NO. 82)</td>

<td>R 79 Β</td><td> 1</td><td>AGGATGGATCCATAAGTTAC CGATCAG (BamHI)</td><td>(SEQ. ID. NO. 83)</td>

<td>D 78 Β</td><td> 1</td><td>GGCTGGAATTCCTCTGAGGA CGCCCTCAC (EcoRI)</td><td>(SEQ. ID. NO. 84)</td>

<td>R 77 Β</td><td> 1</td><td>GCCGAAGATCTATCGGACAT AGACCTC (Bgl II)</td><td>(SEQ. ID. NO. 85)</td>

<td>R 76 Β</td><td> 2</td><td>CAGACGACGGATCCCCTTGG ATATAGCCTG (BamHI)</td><td>(SEQ. ID. NO. 86)</td>

<td>D 75 Β</td><td>5'NC</td><td>GGCCGAATTCAGGCAGACCA CATATGTGGTCGATGCCATG (ECORI)</td><td>(SEQ. ID. NO. 87)</td>

<td>D 72 Β</td><td> 1</td><td>GCAGGTGTGCCTGGATCCGG CAAGT (BamHI)</td><td>(SEQ. ID. NO. 88)</td>

<td>R 71 Β</td><td> 1</td><td>GTTAGAATTCCGGCCCAGCT GTGGTAGGTC (EcoRI)</td><td>(SEQ. ID. NO. 89)</td>

<td>D 63 Β</td><td> 1</td><td>CCGTCCGATTGGTCTGTATG CAGG</td><td>(SEQ. ID. NO. 90)</td>

<td>D 61 Β</td><td> 1</td><td>TACCAGTTTACTG CAGGTGT GC</td><td>(SEQ. ID. NO. 91)</td>

<td>D 60 Β</td><td> 1</td><td>CAAGCCGATGTGGACGTTGT CG</td><td>(SEQ. ID. NO. 92)</td>

ES 2 336 282 T3

<td>Primer</td><td>ORF region</td><td colspan="2">Sequence</td>

<td>R 59 B</td><td> 2,3</td><td>GGCGCTGGGCCTGGTCACGC CAAG</td><td>(SEQ. ID. NO. 93)</td>

<td>D 50 B</td><td> 1</td><td>GCAGAAACTAGTGTTGACCC AG</td><td>(SEQ. ID. NO. 94)</td>

<td>R 49 B</td><td> 2</td><td>TAGGTCTACGACGTGAGGCA AC</td><td>(SEQ. ID. NO. 95)</td>

<td>R 48 B</td><td> 1</td><td>TACAATCTTTCAGGAAGAAG G</td><td>(SEQ. ID. NO. 96)</td>

<td>R 47 B</td><td> 1</td><td>CCCACACTCCTCCATAATAG C</td><td>(SEQ. ID. NO. 97)</td>

<td>D 46 B</td><td> 1</td><td>GATAGTGCTTTGCAGTGAGT ACCG</td><td>(SEQ. ID. NO. 98)</td>

The abbreviations to the left of the sequences represent the following: R and D refer to the reverse (R) and forward (D) primers, respectively; B and S refer to sequences derived from Hepatitis E strain Burma-121 and Hepatitis E strain SAR-55, respectively; 5'NC and 3'NC refer to the 5 prime and 3 prime non-coding regions of the HEV genome, respectively; and 1, 2 and 3 refer to sequences derived from open reading frames 1, 2 or 3, respectively. The symbol () to the right of some sequences indicates the insertion of an artificial restriction site into these sequences.

For cloning the PCR fragments, EcoRI, BamHI, or BglII preceded by 3-7 nts were added to the 5 'end of the primers.

RT-PCR. The 100 µl RT-PCR normal mix contained the template, 10 mM Tris-HCL (pH 8.4), 50 mM KCl, 2.5 mM MgCl2, the four primers dNTPs (each at 0.2 mM), 50 pmol of the forward primer, 50 pmol of the reverse primer, 40 units of RNasin (Promega), 16 units of avian myeloblastosis virus reverse transcriptasse (Promega), 4 units of AmpliTaq (Cetus), in 100 pl of light mineral oil. The mixture was incubated 1 h at 42 ° C and then amplified by 35 cycles of PCR; 1 min at 94 ° C, 1 min at 45 ° C, and 1 min at 72 ° C. The PCR products were analyzed on 1% agarose gels.

Cloning of the PCR fragments. The PCR fragments containing restriction sites at the ends were digested with restriction enzymes EcoRI and BamHI or EcoRI and BglII and cloned into pBR322 or pGEM-3Z (Promega) digested with EcoRI / BamHI. Alternatively, the PCR fragments were cloned into pCR1000 (Invitrogen) using the TA cloning kit (Invitrogen).

Sequencing of PCR fragments and plasmids. The PCR fragments were cut from Geneclean purified 1% agarose gels (Bio 101, La Jolla, CA). Double-stranded PCR fragments were sequenced using Sequenase (United States Biochemical) as described in Winship, PR (1984), Nucleic Acids Rev., 17: 1266. Purified double-stranded plasmids through CsCl gradients were sequenced with a Sequenase kit (United States Biochemical).

Computerized sequence analysis. The nucleotide sequences of the HEV strains were compared using the Genetics Computer Group (Madison, WI) software package (Devereaux, J. et al. (1984), Nucleic Acids Rev., 12: 387-395, version 7.5, in a VAX 8650 computer (at NCI National Cancer Institute, Frederick, MD)).

Example 2

Construction of a recombinant expression vector, p63-2

A plasmid containing the complete ORF-2 of the gene from the SAR-55 strain of HEV, Tsarev, SA et al. (1992). Proc. NatI. Acad Sci. USA, 89: 559-563), was used to obtain a NruI-BqlII restriction fragment. Short NruL

ES 2 336 282 T3 the HEV cDNA five nucleotides upstream of the ATG start codon of ORF-2. An artificial Bgl II site had previously been placed at the 3 'end of the HEV genome just before the polyA sequence (Tsarev, SA et al. (1992), Proc. Natl. Acad. Sci, USA 89: 559-563). To insert this fragment into the pBlue Bac Transfer vector (Invitrogen) a synthetic multiple cloning site was introduced into the unique NheI site in the vector. This multiple cloning site contained Bln I and Bgl II sites that are absent in both the HEV cDNA and the pBlueBac sequences. The NruI-BglII fragment was inserted into Bln I-BglII pBlue Back using an adapter as shown in Figure 1.

Example 3

Expression of p63-2 in SF9 insect cells

Baculovirus p63-2 DNA and AcMNPV (Invitrogen) were co-transfected into SF9 cells (Invitrogen) by the Ca precipitation method according to the Invitrogen protocol. Following this protocol: AcMNPV baculovirus DNA can produce a live intact baculovirus that can package p63-2 to form a recombinant baculovirus. This recombinant baculovirus was plaque purified 4 times. The resulting recombinant baculovirus 63-2-IV-2 was used to infect SF9 cells.

SDS-PAGE and Western blot. The insect cells were resuspended in loading buffer (50 mM TrisHCl, pH 6.8, 100 mM DTT, 2% SDS, 0.1% bromophenol blue and 10% glycerol) and gel was made in SDS-polyacrylamide as is. described, Laemmli, UK (1970), Nature, 227: 680. The gels were stained with Coomassie blue or the proteins were electroblotted on nitrocellulose BA-85 filters (Schleicher & Schell). After transfer, the nitrocellulose membranes were blocked in PBS containing 10% fetal calf serum and 0.5% gelatin. As the primary antibody, a 1: 1000 diluted chimpanzee-1313 hyperimmune serum was used. As a secondary antibody, phosphatase-labeled affinity purified goat antibody to human IgG (Kirkegaard and Perry Laboratories, Inc.) diluted 1: 2000 was used.

Filters were developed on Western blue stabilized substrate for alkaline phosphatase (Promega). All incubations were carried out in blocking solution, and the washes were with PBS with 0.05% Tween-20 (Sigma).

HEV ORF-2 expression. The main protein synthesized in SF9 cells infected with recombinant baculovirus 63-2-IV2 was a protein with an apparent molecular weight of 74KD (Fig. 2A). This size is slightly larger than predicted for the entire ORF-2 (71 KD). The difference in size could be due to glycosylation of the protein since there is at least one potential glycosylation site (Asn-Leu-Ser) in the N-terminal part. This protein was not detected in uninfected cells or in cells infected with non-recombinant wild-type baculovirus. In the latter case, the main protein detected was a polyhedral protein. When the same lysates were analyzed by Western blotting with chimpanzee-1313 serum (hyperimmunized with HEV), only proteins in the recombinant cell lysate reacted and the main band was also represented by a 74 KD protein (Fig. 2B). Smaller bands were also present on the Western blot. Some of these had molecular weights greater than 74 KD, which could be due to different extensions of glycosylation and some had lower molecular weights, which could reflect processing and / or degradation. Serum taken from Chimpanzee-1313 prior to inoculation with HEV did not react with any of the proteins by Western blotting.

Example 4

Immunoelectron Microscopy of Recombinant Infected SF9 Cells

5x106 Recombinant infected SF9 cells were sonicated in CsCl (1.30 g / ml) containing 10 mM Tris-HCl, pH 7.4.0, 3% sarcosyl and centrifuged for 68 h, at 40,000 rpm (SW60Ti). 50 µl of the fraction, which had the highest response by ELISA and a high density of 1.30 g / ml was diluted in 1 ml of PBS and 5 µl of chimpanzee1313 hyperimmune serum were added. The hyperimmune serum was prepared by giving another dose to a chimpanzee previously infected with a second strain of hepatitis E (Mexican HEV). The samples were incubated 1 h at room temperature and left overnight at 4 ° C. The immune complexes were precipitated using a SW60Ti rotor at 30,000 rpm, 42 ° C, 2 h. The precipitates were resuspended in distilled water, negatively stained with 3% PTA, placed on carbon grids, and examined at 40,000 magnification on an EM-10 electron microscope, Carl Zeiss, Oberkochen, Germany.

Detection of VLPs: Cell lysates from insect cells infected with wild-type or recombinant baculovirus 63-2-IV-2 were fractionated by density centrifugation in CsCl. When CsCl gradient fractions from recombinant infected insect cells were incubated with chimp-1313 hyperimmune serum, two types of antibody-coated viral-like particles (VLPs) were observed in the fraction with high density of 1, 30 g / ml: first (Figs. 3A-3A "), individual antibody-coated particles having the size (30 nm) and morphological structure suggested by HEV, second (Fig. 3B) aggregates of antibody-coated particles smaller than HEV (around 20 nm) but otherwise resembling HEV. Direct EM showed the presence of a very heterogeneous population of objects including some 30 and 20 nm in diameter respectively that look like viral particles but that in the absence of bound antibody, cannot be confirmed.

ES 2 336 282 T3 as HEV. A number of IEM experiments suggested that at least some of the protein (s) synthesized from the ORF-2 region of the HEV genome had assembled into a particulate structure. It was observed that insect cells in a late stage of infection, when the proportion of smaller proteins was higher, gave consistently better results in ELISA. Therefore, unfractionated lysates of recombinant insect cells from a late stage of infection were used with an antigen in ELISA in subsequent assays.

Example 5

Detection by an ELISA-based assay of antigen from insect cells expressing the complete ORF-2 of anti-HEV after infection with different strains of HEV

5x106 SF9 cells infected with virus 63-2-IV-2 were resuspended in 1 ml of 10 mM Tris-HCl, pH 7.5, 0.15 M NaCl were then frozen and thawed 3 times. 10 µl of this suspension was dissolved in 10 ml of carbonate buffer (pH 9.6) and used to cover a flexible microtiter assay plate (Falcon). Serum samples were diluted 1:20, 1: 400, and 1: 8000, or 1: 100, 1: 1000, and 1: 10000. The same blocking and washing solutions as those described for the Western blot were used in ELISA. As a secondary antibody, a peroxidase-conjugated goat IgG fraction against human IgG or peroxidase-labeled goat anti-monkey immunoglobulin old or new world was used. Results were determined by measuring optical density (OD) at 405 nM.

To determine whether antigen derived from insect cells representing a Pakistani strain of HEV could detect an anti-HEV antibody in cynomolgus monkeys infected with the Mexican strain of HEV, 3 monkeys were examined (Fig. 4). Two monkeys, cyno-80A82 and cyno-9A97, were infected with feces containing the strain HEV Mexico '86 (Ticehurst, J. et al. (1992), J. Infect. Dis., 165: 835-845) and the third monkey cyno-83 was infected with a second passage of the same strain. As a control, the cyno-374 serum samples, infected with the Pakistani HEV strain SAR55, were tested in the same experiment. All 3 monkeys infected with the Mexican serum strain converted to anti-HEV. The animals of the first passage serum converted in week 15 and those of the second passage in week 5. Interestingly, the highest anti-HEV concentration among the 4 animals was found in cyno-83, inoculated with those of the second passage. of the Mexican strain. The cynos inoculated with those of the first pass of the Mexican strain developed the lowest concentrations while those inoculated with those of the first pass of the Pakistani strain developed intermediate concentrations.

Example 6

Specificity of antigen-based anti-HEV ELISA from insect cells expressing complete ORF-2

To estimate whether the ELISA described here specifically detected anti-HEV excluding any other type of hepatitis-related antibody, chimpanzee serum samples were analyzed, in groups of 4, infected with the other known hepatitis viruses (Garci, P. et al. (1992), J. Infect Dis, 165: 1006-1011, Farci, P. et al. (1992), Science (in press), Ponzetto, A. et al. (1987) J infect. Dis., 155: 72-77; Rizzetto; my and others (1981) Hepatology 1: 567-574: reference for chimpanzees- 1413 „1373, 1442, 1551 (HAV); and for chimpanzees-982, 1442, 1420, 1410 (HBV), these are unpublished data from Purcel et al. (Table 1). Pre-inoculation and 5-week and 15-week post-inoculation serum samples were tested in HEV ELISA reacted in the ELISA for HEV antibody, but all 4 HEV-inoculated chimpanzees developed the IgM and IgG classes of anti-HEV.

(Table goes to next page)

ES 2 336 282 T3

TABLE 1

Serological test of anti-HEV antibody in chimpanzees infected with different hepatitis viruses (Hepatitis A, B, C, D, E)

<td colspan="2" rowspan="2">. Virus</td><td rowspan="4">Week of serum conversion to virus inoculated</td><td rowspan="3">pre-serum</td><td colspan="5">Weeks post inoculation</td>

<td rowspan="2">C / nimpance</td><td rowspan="2">inoculated</td>

<td>Chimp-</td><td>HAV</td><td> 5</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-</td><td>HAV</td><td> 7</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-</td><td>HAV</td><td> 5</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-</td><td>HAV</td><td> 5</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-982</td><td>HBV</td><td> 3</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-</td><td>HBV</td><td> 7</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td> - -</td>

<td>Chimp-</td><td>HBV</td><td> 9</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-</td><td>HBV</td><td> 5</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-51</td><td>HCV</td><td> 10</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-502</td><td>HCV</td><td> 12</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-105</td><td>HCV</td><td> 28</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-793</td><td>HCV</td><td> 13</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-904</td><td>HDV</td><td> 8</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-814</td><td>HDV</td><td> 7</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-800</td><td>HDV</td><td> 10</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td></td>

<td>Chimp-29</td><td>HDV</td><td> 10</td><td> - -</td><td> -</td><td> -</td><td> -</td><td> -</td><td> - -</td>

<td>Chimp-</td><td>HEV</td><td> 5</td><td> - -</td><td> 1:10000</td><td> 1:100</td><td> 1:1000</td><td> -</td><td></td>

<td>Chimp-</td><td>HEV</td><td> 5</td><td> - -</td><td> 1:10000</td><td> 1:100</td><td> 1:10000</td><td> -</td><td></td>

<td>Chimp-</td><td>HEV</td><td> 3</td><td> - -</td><td> 1:8000</td><td> -</td><td> 1:8000</td><td> -</td><td></td>

<td>Chimp-</td><td>HEV</td><td> 3</td><td> - -</td><td> 1:8000</td><td> 1:400</td><td> 1:400</td><td> -</td><td></td>

<td>Chimp-</td><td>HEV1st ° "</td><td> 5</td><td> - -</td><td> 1:10000</td><td> 1:1000</td><td> 1:1000</td><td> -</td><td></td>

<td>Chimp-</td><td>HEV2nd ° **</td><td> 0.5</td><td> 1:100 -</td><td> 1:10000</td><td> -</td><td> 1:10000</td><td> -</td><td></td>

<td colspan="8">* Chimp-1374 was positive for IgM anti-HEV three and four weeks post inoculation (Fig. 5)</td><td></td>

<td colspan="4">** Chimp-1313 was inoculated with HEV twice. 1to</td><td colspan="5">inoculation with pooled samples of 7</td>

<td colspan="8">Pakistani patients. 2to inoculation 45 months later with the Mexican strain of HEV.</td><td></td>

ES 2 336 282 T3

Example 7

Determination of the host range of HEV strain SAR-55 in non-human primates

Different primate species were inoculated with a standard stool suspension of HEV and serial serum samples were collected to monitor infection. Serum ALT levels were determined as an indicator of hepatitis while serum conversion was defined by detecting anti-HEV.

Both rhesus monkeys inoculated with HEV (Table 2) showed very prominent peaks of ALT activity as well as serum conversion. The first sign of increased ALT activity was observed on day 14 for both animals, and a definitive serum conversion took place on day 21. The maximum concentration of anti-HEV was achieved on day 29.

TABLE 2

Biochemical and serological profiles of HEV infection in 8 species of primates

<td rowspan="2">Species</td><td colspan="3">Alanine aminotranspheres</td><td colspan="2">IgG anti-HEV</td>

<td>first day elevated</td><td>peak value (U / L)</td><td>first day detected</td><td>initial concentration</td><td>maximum concentration</td>

<td>Rhesus-726</td><td> 14</td><td> 428</td><td> 21</td><td> 1:20</td><td> <1:8000</td>

<td>Rhesus-938</td><td> 14,47*</td><td> 189,165</td><td> 21</td><td> 1:400</td><td> <1:8000</td>

<td colspan="6">'' Bimodal or trimodal elevation of ALT; no = no elevation of ALT or anti-HEV antibody</td>

Both African green monkeys used in this study (Table 2) developed increased ALT and antiHEV activity. Although AGM-230 died seven weeks post-inoculation, signs of infection were observed prior to that time. AGM-74 showed a bimodal increase in ALT activity as has been documented for other species (Tsarev, SA et al. (1992), J. Infect. Dis. (In press)). Seroconversion for AGM-74 and AGM-230 was first observed on days 27 and 21, respectively.

Although both inoculated pig-tailed macaques demonstrated a slight increase in LAT activity, these increases were not as prominent as in the case of the previously described animals. However, both monkeys seroconverted on day 21 and the anti-HEV concentrations were equivalent to those of chimpanzees and other old world monkeys.

No inoculated tamarind monkeys in this study showed any increase in ALT activity or seroconversion to anti-HEV (Table 2). Squirrel monkeys responded with significantly lower levels of anti-HEV than chimps or old world monkeys (Table 2). The seroconversion time was also delayed compared to other animals. SQM-868 seroconverted at day 41, and SQM-869 seroconverted at day 35. Anti-HEV concentration did not

ES 2 336 282 T3 was greater than 1: 400 at no time during more than three months of monitoring and clearly decreased in both animals after reaching a peak value at days 47-54. However, the increases in ALT activity were rather prominent in both animals.

Owl monkeys responded to HEV infection about as well as Old World monkey species (Table 2). Both OWMs seroconverted on day 21 and on day 28 the anti-HEV concentrations reached a value of 1: 8000. ALT activity peaked at day 35 at OWM-924, but not until day 91 at OWM925.

Example 8

Detection of IgM and IgG anti HEV in Chimpanzees

In both chimpanzees, serum ALT levels increased about 4 weeks post-inoculation (Table 2, Fig. 5). Both chimpanzees seroconverted on or before the ALT enzyme was elevated (Fig. 5A, 5C). Anti-HEV IgM levels were also determined for chimpanzees. In chimp-1374, the antiHEV IgM concentration (Fig 5B) was not as high as that of the IgG concentration (Fig 5A) and decreased over two weeks. Although both IgG and IgM antibodies were first detected for this animal on day 20, the anti-HEV IgM concentration was the highest while the IgG concentration was the lowest that day, but then increased and remained at approximately the same level during more than three months. In Chimp-1375, only anti-HEV IgM was detected at day 20 (Fig. 5D). The concentration was higher than in chimp-1374 and IgM anti-HEV was detected during the entire period of monitoring. Anti-HEV IgG was first observed in this animal on day 27 (Fig. 5C) and remained at approximately the same level throughout the experiment.

Example 9

Comparison of ELISA based on the complete ORF-2 protein expressed in insect cells with that based on the structural protein fragments expressed in E. coli

To estimate whether the expression of the complete ORF-2 region of the HEV genome in eukaryotic cells had any advantage over the expression of structural protein fragments in E. Coli, the authors used the above antigen in ELISA to retest sera from cynomolgus monkeys that had previously discussed (Tsarev, SA et al. (1992), Proc. Natl. Acad, Sci USA, 89: 559-563, and Tsarev, SA et al. (1992) J. Infect. Dis (shipped)), using the bacterial expressed antigen fragments (Table 3).

TABLE 3

Comparison of ELISA based on antigen from insect cells expressing complete ORF-2 with that based on antigen from E. Coli expressing structural protein fragments

<td rowspan="3">Cyno #</td><td rowspan="2">bacterial cell derived antigen (portion of ORF-2) '</td><td colspan="3">insect cell derived antigen. (Full ORF-2)</td>

<td>first day of anti-HEV detection</td><td>first day detected</td><td>concentration</td><td>conc. Max.</td>

* The sera were also tested with less sensitive ORF-3 antigens [..] Tsarev, SA, et al. (1992), J. Infect. Dis. (in press)

For 3 of the 6 monkeys examined by ELISA, the antigen expressed in the insect cells detected earlier seroconversion than the antigen expressed in E. Coli. Using the antigen derived from insect cells, the authors were able to detect anti-HEV antibodies in sera from all six monkeys at the highest dilution tested (1: 8000). With the antigen derived from E. coli (Burma strain) no information was obtained about anti HEV concentrations, since all sera were tested only at a dilution of 1: 100 (Tsarev, SA et al. (1992) Proc. Nat. Acad. Sci. USA; 89: 559-563; Tsarev et al. (1992) J. Infect. Dis (submitted)).

ES 2 336 282 T3

In another study, the hepatitis E virus strain SAR-55 was serially diluted in increments of 10 and the 101 to 10-5 dilutions were inoculated into pairs of cynomolgus monkeys to assess virus concentration. Serum ALT levels were measured for hepatitis and serum antibodies to HEV were determined by the ELISA method of the present invention (data in figures) or by Genelab ELISA (data shown as positive (+) or negative ( -) in the lower part of figure 6 to g). All samples were tested in code.

The ELISA method of the present invention detected seroconversion to anti-HEV IgG in all inoculated cynos and in all dilutions of the virus.

In contrast, Genelab's results were surprisingly variable, as shown below

TABLE 4

Genelab ELISA virus dilution of the present invention

<td> 10'1</td><td>Not rehearsed</td><td>positive</td>

<td> 10‘2</td><td>positive for both animals, limited duration</td><td>positive</td>

<td> 10'3</td><td>negative for both animals</td><td>positive</td>

<td> 10·4</td><td>Cyno 389: positive for IgM and IgG</td><td>positive</td>

<td></td><td>Cyno 383: negative</td><td>positive</td>

<td> 10'5</td><td>Cyno 386: negative</td><td>positive</td>

<td></td><td>Cyno 385: positive</td><td>positive</td>

Since the Cyno 385 (10 5) was positive in ELISA assays of both Genelabs and the present invention, on 10-4 (ten times more virus inoculated) and 10 3 (100 times more virus inoculated) would have been expected to be positive as well.

The present invention detected them as positive, unlike the Genelab ELISA test that did not detect either of them as positive at 10-3 and 10 4 even though the ALT levels of Cyno 383 and 393 suggested active hepatitis. Therefore, the data support the advantages of the present ELISA method over prior art methods for detecting antibodies to HEV.

Example 10

Use of the complete ORF-2 protein as a vaccine

As previously described, the recombinant ORF-2 protein is immunoreactive. Additionally, it has been shown to react with a variety of sera taken from different species of animals infected with different strains of HEV. This supports the use of this recombinant protein as a vaccine to protect against a variety of HEV strains. Mammals are immunized with the purified or partially purified recombinant ORF-2 protein in an amount sufficient to stimulate the production of protective antibodies. Immunized animals inoculated with the wild strain of HEV are protected.

The content of all citations, ie journal articles, patents, and the like, are incorporated herein by reference.

It is understood that the examples and embodiments described herein are for illustrative purposes and that various modifications and changes in light thereof to persons skilled in the art are included within the spirit and scope of this application and scope of the appended claims. .

Contents101

59 members in 15 offices

This recordMember, by publication datePriority claim5 more offices are in the list below

Priority claims4

Priority claims
Document	Office	Kind	Date
94726392	United States of America	A	1992-09-18
94726392	United States of America	A	1992-09-18
93922703947263	–	–	–
US19920947263	–	–	–

Members59

Family members, oldest first
Document	Office	Kind
CA2144855A1	Canada	A1	1994-03-31
WO9406913A2	World Intellectual Property Organization (WIPO)	A2	1994-03-31
AU5162593A	Australia	A	1994-04-12
WO9406913A3	World Intellectual Property Organization (WIPO)	A3	1994-06-09
EP0662133A1	European Patent Office (EPO)	A1	1995-07-12
CA2201588A1	Canada	A1	1996-04-11
WO9610580A2	World Intellectual Property Organization (WIPO)	A2	1996-04-11
AU3830995A	Australia	A	1996-04-26
JPH08504096A	Japan	A	1996-05-07
WO9610580A3	World Intellectual Property Organization (WIPO)	A3	1996-05-23
ZA964447B	South Africa	B	1996-12-06
CA2226457A1	Canada	A1	1996-12-12
WO9639501A2	World Intellectual Property Organization (WIPO)	A2	1996-12-12
AU6300296A	Australia	A	1996-12-24
WO9639501A3	World Intellectual Property Organization (WIPO)	A3	1997-02-06
NO971529D0	Norway	D0	1997-04-03
NO971529L	Norway	L	1997-05-26
EP0784631A1	European Patent Office (EPO)	A1	1997-07-23
KR970706300A	Republic of Korea	A	1997-11-03
CN1168698A	China	A	1997-12-24
EP0832214A2	European Patent Office (EPO)	A2	1998-04-01
AU689447B2	Australia	B2	1998-04-02
AR002758A1	Argentina	A1	1998-04-29
JPH11500001A	Japan	A	1999-01-06
NZ295056A	New Zealand	A	1999-06-29
AU712901B2	Australia	B2	1999-11-18
EP0832214B1	European Patent Office (EPO)	B1	2000-12-27
AT198352T	Austria	T	2001-01-15
ATE198352T1	Austria	T1	2001-01-15
DE69611368D1	Germany	D1	2001-02-01
US6207416B1	United States of America	B1	2001-03-27
US2001010899A1	United States of America	A1	2001-08-02
DE69611368T2	Germany	T2	2001-08-09
US6287759B1	United States of America	B1	2001-09-11
KR100318516B1	Republic of Korea	B1	2001-12-22
KR100332602B1	Republic of Korea	B1	2002-05-09
US2002068820A1	United States of America	A1	2002-06-06
US6458940B2	United States of America	B2	2002-10-01
US6509149B2	United States of America	B2	2003-01-21
KR100359526B1	Republic of Korea	B1	2003-02-25
US2003055240A1	United States of America	A1	2003-03-20
US6696242B1	United States of America	B1	2004-02-24
US6706873B1	United States of America	B1	2004-03-16
CN1148450C	China	C	2004-05-05
US6787145B1	United States of America	B1	2004-09-07
JP2005013220A	Japan	A	2005-01-20
JP2006149393A	Japan	A	2006-06-15
JP3889808B2	Japan	B2	2007-03-07
CA2226457C	Canada	C	2008-08-05
CA2144855C	Canada	C	2008-09-09
NO326399B1	Norway	B1	2008-11-24
EP0662133B1	European Patent Office (EPO)	B1	2009-11-18
AT449178T	Austria	T	2009-12-15
ATE449178T1	Austria	T1	2009-12-15
DE69334299D1	Germany	D1	2009-12-31
ES2336282T3This record	Spain	T3	2010-04-09
EP0784631B1	European Patent Office (EPO)	B1	2011-08-03
AT518879T	Austria	T	2011-08-15
ATE518879T1	Austria	T1	2011-08-15