Bmp-11 compositions

ES 2 213 745 T3

DESCRIPTION

Compositions of BMP-11.

Background of the invention

The present invention refers to a new family of purified proteins called BPM-11, to the DNA molecules that encode them, as well as to procedures for obtaining them. The inventors have previously referred to the BMP-11 proteins as WC Activin. BPM-11 proteins may be useful to induce bone and / or cartilage formation and wound healing and tissue repair, or to increase the activity of other bone morphogenetic proteins. The BPM-11 proteins may also be useful for regulating follicular stimulating hormone production, for contraception, for promoting neuronal cell survival, for stimulating hematopoiesis, and for suppressing the development of gonadal tumors.

US Patent No. 4,798,885 disclosed DNA encoding the α and β chains of prepro inhibin. US Patent No. 5,071,834 discloses two betaB chain activin pharmaceutical compositions that are formulated in a pharmaceutically acceptable carrier.

US Patent No. 5,102,807 discloses a purified inhibin protein that suppresses FSH production without suppressing luteinizing hormone production.

Summary of the invention

The BMP-11 protein is a member of the TGF-β superfamily of proteins. The TGF-β superfamily includes the family of proteins known as bone morphogenetic proteins (BMPs), as well as a group of proteins called inhibin-β. As considered hereinafter, when dimerized with another BMP-11 (homodimer), the BMP-1 1 protein is expected to demonstrate BPM-1 1 activity, as described later herein. , and how it can be measured according to the tests described in the examples herein.

When dimerized as a heterodimer with inhibin-α proteins or with other inhibin-β proteins, the inhibin-β / ΒΜΡ-ΙΙ heterodimer is expected to demonstrate effects on follicular stimulating hormone (FSH) production, as described hereinafter. It is further expected that, in homodimeric or heterodimeric form with another member of the morphogenetic protein family, BMP-11 will exhibit BMP activity, ie, the ability to induce the formation of bone, cartilage, and / or other connective tissues. Thus, depending on the environment of BMP-11, it can form dimers that will demonstrate activin or inhibin activity, or bone, cartilage and / or other connective tissue inducing activity. Accordingly, BMP-1 1 activity is defined as the ability to regulate FSH production in the assay described in Example 8 herein, or the ability to induce the formation of bone, cartilage, and / other connective tissues in the tests described in Examples 5 to 7 herein.

Proteins called inhibins and activins are produced in the gonads and are found naturally in follicular fluid. These proteins act at the level of the anterior pituitary gland to either inhibit (inhibins) or stimulate (activins) the release of follicular stimulating hormone (FSH) [for reviews see, eg, Ying, SY, Endocr. Rev., 9: 267-293 (1988) or Ling, N. et al, Vitamins and Hormones, 44: 1-46 (Academic Press 1988)]. Briefly, dimeric proteins composed of an inhibin α chain and an inhibin β chain (β_Α or / IB) are called activins and are characterized by their ability to stimulate the release of follicular stimulating hormone (FSH), while other dimeric proteins composed of two chains of inhibin β (β_Α or / β_Β) are called activins and are characterized by their ability to stimulate the release of follicular stimulating hormone (FSH) [see, for example, Ling et al., Nature, 321: 779-782 (1986) or Vale, et al., Nature, 321, 776-779 (1986) or Mason et al., Nature, 318: 659-663 (1985) or Forage et al., Proc. Natl. Acad. Sci. USA, 83: 3091-3095 (1986)].

It is recognized that FSH stimulates the development of ovules in the mammalian ovaries (Ross et al., In Textbook of Endocrinology, ed. Williams, p. 355 (1981) and that excessive stimulation of the ovaries with FSH will lead to multiple ovulations FSH is also important in testicular function. Thus, BMP-1 1, in heterodimers with a member of the α inhibin family, may be useful as a contraceptive based on the ability of inhibins to decrease fertility in female mammals and decrease spermatogenesis in male mammals. . Administration of sufficient amounts of other inhibins can induce infertility in these mammals. BMP-11, as a homodimer or as a heterodimer with other protein subunits of the inhibin- /! Group, can be useful as a fertility-inducing drug, based on the ability of activin molecules to stimulate the release of FSH from cells of the anterior pituitary. See, for example, US Patent No. 4,798,885. BMP-1 1 may also be useful for advancing the onset of fertility in sexually immature mammals, so as to enhance the reproductive function of the life of domestic animals such as cows, sheep and pigs. It is further considered that BMP-11 may be useful in promoting neuronal cell survival [see, for example, Schubert et al., Nature, 344: 868-870) (1990)], modulation of hematopoiesis by inducing differentiation of red blood cells [see, for example, Broxmeyer et al., Proc. Natl. Acad. Sci. USA, 85: 9052-9056 (1988) or Eto et al, Biochem. Biophys. Beef. Comm., 142: 1095-1103 (1987)], to suppress the development of gonadal tumors [see, for example, Matzuk et al., Nature, 360: 313-319 (1992)] or to increase the activity

ES 2 213 745 T3 of bone morphogenetic proteins [see, for example, Ogawa et al., J. Biol. Chem, 267: 14233-14237 (1992)].

BMP-11 proteins can be further characterized by their ability to modulate follicular stimulating hormone (FSH) release in established in vitro bioassays using rat anterior pituitary cells as described [see, for example, Vale et al, Endocrinology, 91: 562-572 (1972); Ling et al., Nature, 321: 779782 (1986) or Vale et al, Nature, 321: 776-779 (1986)]. It is considered that the BMP-11 protein of the invention, when it is composed as a homodimer or as a heterodimer with other inhibin β chains, will show stimulatory effects on the release of follicular stimulating hormone (FSH) from anterior pituitary cells. , as described [Ling et al., Nature, 321: 779-782 (1986) or Vale et al, Nature, 321: 776-779 (1986)]. Furthermore, it is considered that the BMP-11 protein of the invention, when composed as a heterodimer with the inhibin α chain, will inhibit the release of follicular stimulating hormone (FSH) from anterior puituitary cells, such as as described [see, eg, Vale et al, Endocrinology, 91: 562-572 (1972)]. Therefore, depending on the particular composition, it is expected that the BMP-11 protein of the invention may have opposite and contrasting effects on the release of follicular stimulating hormone (FSH) from the anterior pituitary.

Activin A (the homodimeric composition of inhibin eA) has been shown to have erythropoietic stimulating activity [see for example Eto et al., Biochem. Biophys ,. Res. Commun., 42: 1095-1103 (1987) and Murata et al., Proc. Natl. Acad. Sci. USA, 85: 2434-2438 (1988) and Yu et al., Nature 330: 765-767 (1987)]. The BMP-11 protein of the invention is considered to have similar erythropoietic stimulating activity. This activity of the BMP-11 protein can be further characterized by its ability to demonstrate erythropoietic activity in the biological assay carried out using human K-562 cell line, as described by [Lozzio et al., Blood, 45: 321 -334 (1975) and US Patent No. 5,071,834].

The structures of several proteins, designated BMP-1 through BMP-9, have been previously elucidated. The exceptional inducing activities of these proteins, together with their presence in bone, suggest that they constitute important regulators of bone repair processes, and may be involved in the normal maintenance of bone tissue.The BMP-11 protein of the present invention is related to the aforementioned BMP proteins , and is expected to share BMP activities such as the ability to induce bone, cartilage and / or other connective tissues, such as tendons or ligaments, and the wound healing activities of BMPs. Furthermore, it is expected that the proteins of the invention can act in concert with, or perhaps synergistically with, other related proteins and growth factors. Other therapeutic methods and compositions of the invention therefore comprise a therapeutic amount of at least one BMP-11 protein of the invention, with a therapeutic amount of at least one of the other BMP proteins that have been given to learn about co-owned patents and applications described below. Said combinations can comprise separate molecules of the BMP proteins or heteromolecules formed by different BMP moieties. Furthermore, the BMP-11 proteins can be combined with other beneficial agents for the treatment of bone and / or cartilage abnormalities, wounds, or tissues in question. These agents include various growth factors such as epidermal growth factor (EGF), fibroblast development factor (FGF), platelet-derived growth factor (PDGF), transforming growth factors (TGF-α and TGF). -β), and k-fibroblast growth factor (kFGF), parathyroid hormone (PTH), leukemia inhibitory factor (LIF / HILDA / DIA), sinsulin-like growth factors (IGF-I and IGF -II). Parts of these agents can also be used in compositions of the present invention.

The bovine BMP-1 1 DNA sequence (SEQ ID NO: 1) and the amino acid sequence (SEQ ID: 2) and the human BMP-11 DNA sequence (SEQ ID NO: 10) and the amino acid sequence (SEQ ID n °: 1 1) are set forth in the Sequence Listing herein. Activin proteins are capable of regulating follicle-stimulating hormone (FSH) production, and thus, BMP-11 may be useful as a fertility-inducing or contraceptive therapeutics. In homodimeric form or in the heterodimers with proteins of the inhibin-β group, the purified BMP-11 protein is expected to show activin activity and can be used to stimulate FSH. Furthermore, it is expected that the purified BMP-11 protein may be useful for the induction of bone, cartilage and / or other connective tissue.

Bovine BMP-11 can be produced by culturing a transformed cell with a DNA sequence that includes nucleotides from # 375 to # 704 as shown in SEQ ID NO: 1 and recovering and purifying a characterized protein from the culture medium. by the amino acid sequence comprising from # 1 to # 109, as shown in SEQ ID NO: 2, substantially free of other proteinaceous materials with which it is co-produced.

Human BMP-11 is expected to be homologous to bovine BMP-11. The invention therefore includes procedures for obtaining DNA sequences encoding human BMP-11, the DNA sequences obtained by these procedures, and the human protein encoded by these DNA sequences. This procedure involves using the nucleotide sequence of bovine BMP-11 or parts of it to design probes to screen libraries in relation to the human gene or its fragments, using standard techniques. In the Sequence Listing, a DNA sequence encoding part of the human BMP-11 protein (SEQ ID no: 3) and the corresponding amiono acid sequence (SEQ ID no: 4) are disclosed. These sequences can also be used to design probes to obtain the entire human BMP-11 gene by standard techniques. Human BMP11 can be produced by culturing a transformed cell with the BMP-1 DNA sequence and recovering and purifying BMP-11 from the culture medium. The purified expressed protein is substantially free of other proteinaceous materials with which it is co-produced, as well as other contaminants.

ES 2 213 745 T3

The purified protein that is recovered is considered as a demonstration of the ability to regulate FSH production. The proteins of the invention can be further characterized by the ability to regulate follicular stimulating hormone (FSH) production in established in vitro bioassays, using anterior pituitary cells. BMP-11 proteins can also be characterized by the ability to induce bone, cartilage and / or other connective tissue formation, for example, in the rat bone formation assay, described below.

Another aspect of the invention provides pharmaceutical compositions containing a therapeutically effective amount of a BMP-11 protein in a therapeutically effective vehicle or carrier. The BMP-11 compositions of the invention may be useful for the regulation of follicle stimulating hormone, and may be useful in contraception. The compositions of the invention may further include at least one other therapeutically effective agent such as the BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7 proteins, which disclosed, for example, in US Patent Nos. 5,108,922; No. 5,013,649; No. 5,116,738; No. 5,106,748; No. 5,187,076; and 5,141,905; BMP-8, disclosed in PCT publication WO91 / 18098; and BMP-9, disclosed in PCT publication WO93 / 00432, and BMP-10, disclosed in pending patent application serial number 08 / 061,695, filed May 12, 1993. The BMP compositions -1 1 may also be useful for a variety of uses involving the regulation of follicle-stimulating hormone production, including contraception. These methods, according to the invention, involve the administration to a patient in need of said treatment, of an effective amount of BMP-11.

The compositions of the invention may comprise, in addition to a BMP-11 protein, other members of the inhibin-β group of proteins, or to the inhibin-α proteins, as well as other therapeutically useful agents that include growth factors such as the factor of epidermal growth factor (EGF), fibroblast growth factor (FGF), transforming growth factor (TGF-α and TGF-β), and insulin-like growth factor (IGF).

The BMP-11 compositions of the present invention may also be useful for the treatment of various bone and / or cartilage abnormalities, periodontal disease, and various types of wounds. These methods, according to the invention, involve the administration to a patient in need of said cartilage and / or bone formation, wound healing or tissue repair, of an effective amount of a BMP-11 protein. These procedures may also involve the administration of a protein of the invention at the same time as at least one of the new BMP proteins disclosed in the co-proprietary patents and in the applications described above. Furthermore, these procedures may also include the administration of a BMP-11 protein with other growth factors, including EGF, FGF, TGF-α, TGF-β, and IGF.

Yet another aspect of the invention is constituted by the DNA sequences that encode the expression of a BMP-1 1 protein. Said sequences include the nucleotide sequence from the 5 'end to the 3' end, shown in SEQ ID NO: 1, or DNA sequences that hybridize under stringent conditions to the DNA sequence of SEQ ID NO: 1 and encode a protein having BMP-11 activity. Finally, allelic or other variations of the sequences of SEQ ID No.: 1 are also included in the present invention, whether said nucleotide changes give rise to changes in the peptide sequence or not.

Still another aspect of the invention are the DNA sequences that encode the expression of a BMP11 protein. Said sequences include the nucleotide sequence in a 5 'to 3' sense that is illustrated in SEQ ID NO: 1 or in SEQ ID NO: 10, and DNA sequences that, except for the degeneracy of the genetic code , are identical to the DNA sequence of SEQ ID No: 1 or SEQ ID No: 10, and encode the protein of SEQ ID No: 2 or SEQ ID No: 11. Also included in the present invention are DNA sequences that hybridize under stringent conditions with the sequence of SEQ ID NO: 1, or SEQ ID NO: 10 and encode a protein that possesses BMP-11 activity. Finally, the present invention also includes allelic or other variations of the sequences of SEQ ID No.: 1 or of the sequence SEQ ID No.: 10, if said nucleotide changes give rise to changes in the peptide sequence or not. , but in which the peptide sequence still has BMP-11 activity.

Another aspect of the invention includes vectors comprising a DNA sequence as described above, operatively associated with an expression control sequence.

These vectors can be used in a new method for the production of a BMP-11 protein of the invention, in which a cell line transformed with a DNA sequence that encodes a BMP11 protein operatively associated with an expression control sequence, is cultured in an appropriate culture medium and, from there, a BMP-1 1 protein is recovered and purified. This method can use, as host cells for the expression of the polypeptide, various known cells, both prokaryotic and eukaryotic.

The present invention also includes the use of the DNA sequences and vectors of the invention in gene therapy applications. In such a case, the vectors can be transfected in vitro into the cells of a patient, and the cells can be reintroduced into the patient. Alternatively, the vectors can be introduced in vivo into a patient by targeted transfection.

Other aspects and advantages of the present invention will become apparent upon consideration of the following detailed description and its preferred embodiments.

ES 2 213 745 T3

Description of the sequences

SEQ ID NO: 1 is a partial nucleotide sequence of bovine BMP-11, encoding mature bovine BMP-11 polypeptide.

SEQ ID NO: 2 is the amino acid sequence of a partial propeptide and full mature bovine BMP-11 polypeptide, encoded by SEQ ID NO: 1.

SEQ ID NO: 3 is a partial nucleotide sequence of human BMP-11.

SEQ ID NO: 4 is a partial amino acid sequence for the human BMP-11 polypeptide encoded by SEQ ID NO: 3.

SEQ ID NO: 5 and 6 constitute primers for bovine BMP-11, used to isolate human BMP-11 or other BMP-11 proteins.

SEQ ID NO: 7 is a DNA sequence that is inserted into pMT2 CXM to add an XhoI recognition site near the SV40 origin of replication.

SEQ ID NO: 8 is a DNA sequence that is inserted into pMT21 to insert an XhoI recognition site above the DHFR gene.

SEQ ID NO: 9 is a DNA sequence that includes a part of the EMC virus leader sequence.

SEQ ID NO: 10 is a DNA sequence encoding a partial propeptide and the complete mature human BMP-11 protein.

SEQ ID NO: 11 is the amino acid sequence of a partial propeptide and of the complete mature human BMP-11 protein encoded by SEQ ID NO: 10.

Detailed description of the invention

BMP-11

The nucleotide sequence of bovine BMP-11 (SEQ ID NO: 1), the encoded amino acid sequence (SEQ ID NO: 2), the nucleotide sequence of human BMP-11 (SEQ ID NO: 10), and the encoded amino acid sequence (SEQ ID NO: 11) is shown in the Sequence Listings herein. The purified bovine BMP-11 proteins of the present invention are produced by culturing a transformed host cell with a DNA sequence comprising the DNA coding sequence of SEQ ID NO: 1 from nucleotide # 375 to # 704, or the coding sequence DNA of SEQ ID NO: 10 from nucleotide # 760 to # 1086 and the recovery and purification from the culture medium of a protein containing the amino acid sequence or a substantially homologous sequence, such as that represented by amino acids # 1 to # 109 of SEQ ID No.: 2, or amino acids 1 to 109 of SEQ ID No.: 11. For the production of BMP-11 proteins in cells of mammalian, the DNA sequence further comprises an appropriate propeptide linked in frame to the above DNA encoding sequences for BMP-11. The propeptide may be the parent propeptide of BMP-11 or a propeptide derived from another member of the TGF-β superfamily.

The human BMP-11 sequence of the present invention is obtained using all or fragments of the bovine BMP-11 DNA sequence, or the partial sequence of human BMP-11 of SEQ ID NO: 3, as a probe. Thus, the DNA sequence of human BMP-11 comprises the DNA sequence of nucleotides # 28 to # 185 of SEQ ID NO: 3. The human BMP-11 protein includes the amino acid sequence of amino acids # 1 to # 52 of SEQ ID NO: 4.

BMP-1 1, expressed by mammalian cells such as CHO cells, is expected to exist as a heterogeneous population of active BMP-11 protein types with varying N-termini. Active types are expected to include an amino acid sequence beginning at least with the cysteine ​​residue at amino acid # 6 of SEQ ID NO: 2 or SEQ ID NO: 11, or further in the direction N-terminal. Thus, it is expected that the DNA sequences encoding the active BMP-1 1 proteins will include nucleotides # 375 or # 390 to 701 of SEQ ID NO: 1, or nucleotides # 760 or # 775 to # 1086 of SEQ ID NO: 10, and may include an additional nucleotide sequence upstream of SEQ ID NO: 1 or SEQ ID NO: 10.

The N-terminus of human BMP-11 has been experimentally determined as follows by expression in E. coli of: [M] NLGLDXDEHSSE, in which X designates an amino acid residue without a clear signal, which agrees with the localization of cysteine ​​in this position. Thus, this type of BMP-11 is expected to have an N-terminus at amino acid # 1 of SEQ ID NO: 1 or of SEQ ID No.: 10, and that the DNA sequences encoding this species will include nucleotides # 375 to # 701 of SEQ ID No.: 1 (bovine) or nucleotides # 760 to 1086 of SEQ ID No. : 10 (human). The apparent molecular weight of the monomer of human BMP-11 was determined by SDS-PAGE to be approximately 12 kd. Human BMP-1 1 protein is found as a clear, discolored solution in 0.1% trifluoroacetic acid.

ES 2 213 745 T3

The BMP-11 proteins recovered from the culture medium were purified by isolating them from other proteinaceous materials from which they are co-produced, and from other contaminants that are present.

BMP-11 proteins can be characterized by their ability to regulate FSH production. BMP-11 proteins can be further characterized by their ability to modulate the release of follicle stimulating hormone (FSH) in established in vitro bioassays using anterior pituitary cells as described.

[see, for example, Vale et al, Endocrinology, 91: 562-572 (1972); Ling et al., Nature, 321: 779-782 (1986) or Vale et al., Nature, 321: 776-779 (1986)]. BMP-11 proteins can also be characterized by the ability to induce bone, cartilage and / or other connective tissue formation. Said tissue inducing activity of BMP-11 can be further characterized by the ability to induce bone, cartilage and / or other connective tissue formation in the tests described in the examples that follow.

The BMP-11 proteins provided herein include factors encoded by sequences similar to SEQ ID NO: 1 or SEQ ID NO: 10, but in which modifications occur naturally (e.g., allelic variations in nucleotide sequence that can lead to amino acid changes in the polypeptide), or are deliberately constructed. For example, synthetic polypeptides can fully or partially duplicate continuous sequences of amino acid residues of SEQ ID NO: 2 or SEQ ID NO: 11. These sequences, by virtue of the fact that they share primary, secondary or tertiary conformational and structural characteristics with the inhibin-β polypeptides of SEQ ID No: 2 or SEQ ID No: 11, may have BMP-11 activity in common with them. . Thus, they can be used as biologically active substitutes for naturally occurring BMP-11 polypeptides in therapeutic procedures.

Other specific mutations in the sequences of the BMP-11 proteins described herein involve modifications of glycosylation sites. These modifications can involve O or N- linked glycosylation sites. For example, the absence of glycosylation or only partial glycosylation results from the substitution or deletion of amino acids at the asparagine-linked glycosylation recognition sites. Asparagine-linked glycosylation recognition sites include tripeptide sequences that are specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequences are either asparagine-X-threonine, or asparagine-X-serine, where X is usually any amino acid. Different amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation recognition site (and / or the amino acid deletion at the second position) result in non-glycosylation in the modified tripeptide sequence. Furthermore, the expression of the BMP-11 protein in bacterial cells gives rise to a non-glycosylated protein, without alteration of the glycosylation recognition sites.

The present invention also encompasses new DNA sequences, free of association with DNA sequences encoding other proteinaceous materials, and encoding the expression of BMP-11 proteins. These DNA sequences include those shown in SEQ ID NO: 1 or SEQ ID NO: 10 in a 5 'to 3' direction and those sequences that hybridize to them under severe hybridization conditions, for example SSC 0.1, 0.1% SDS at 65 ° C [see, Maniatis et al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389] and encode a protein that possesses activity BMP-11. These DNA sequences also include those that comprise the DNA sequence of SEQ ID NO: 3 and those that hybridize under conditions under severe hybridization conditions and encode a protein having BMP-11 activity.

Similarly, the DNA sequences that encode BMP-11 proteins encoded by the sequences SEQ ID NO: 1 or SEQ ID NO: 10, but differ in codon sequence, due to degeneracy of the genetic code or Allelic variations (changes in the bases that occur naturally in the population of species that may or may not result in an amino acid change), also encode the new factors described herein. Variations in the DNA sequences of SEQ ID NO: 1 or SEQ ID NO: 10 that are caused by point mutations or by induced modifications (including insertion, deletion, and substitution) to increase activity, lifespan media or the production of the encoded polypeptides are also covered by the invention.

Another aspect of the present invention provides a novel process for producing BMP-11 proteins. The method of the present invention involves the cultivation of an appropriate cell line, which has been transformed with a DNA sequence encoding a BMP-11 protein of the invention, under the control of known regulatory sequences. The transformed host cells are cultured and the BMP-11 proteins are recovered and purified from the culture medium. The purified proteins are substantially free of other proteins with which they are co-produced, as well as other contaminants.

Appropriate cells or cell lines can be mammalian cells, such as Chinese Hamster Ovarian (CHO) cells. Selection of appropriate mammalian host cells and procedures for transformation, culture, amplification, screening, product production, and purification are known in the art. See, for example, Gething and Sambrook, Nature, 293: 620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol., 5 (7): 1750-1759 (1985) or Howley et al, US Patent No. 4,419,446. Another suitable mammalian cell line, which is described in the accompanying examples, is the monkey COS-1 cell line. Mammalian CV-1 cells may also be appropriate.

Bacterial cells can be appropriate hosts. For example, the various strains of E.coli (for example,

ES 2 213 745 T3

HB101, MC1061) are well known as host cells in the field of biotechnology. Various strains of B. subtilis, Pseudomonas, other bacilli, and the like can also be used in this procedure.

Many strains of yeast cells known to those of skill in the art may also be available as host cells for the expression of the polypeptides of the present invention. Additionally, if desired, in the method of the present invention, insect cells can be used as host cells. See, for example, Miller et al, Genetic Engineering, 8: 277-298 (Plenum Press 1986) and the references cited herein.

Another aspect of the present invention provides vectors for use in the process of expressing these new BMP-11 polypeptides. Preferably, the vectors contain the new complete DNA sequences described above that encode the new factors of the invention. Additionally, the vectors contain appropriate expression control sequences that allow the expression of BMP-11 protein sequences. Alternatively, vectors incorporating modified sequences as described above also constitute embodiments of the present invention. In addition, the sequence of SEQ ID NO: 1 or SEQ ID NO: 10 or other sequences encoding BMP-11 proteins could be manipulated to express mature BMP-11 by removing and replacing propeptide-encoding BMP-11 sequences. with sequences encoding the full length propeptides of other BMP proteins, activin proteins, or other members of the TGF-β superfamily.

Vectors can be used in the process of transforming cell lines and contain selected regulatory sequences operatively associated with the DNA coding sequences of the invention that are capable of directing replication and its expression in selected host cells. Regulatory sequences for such vectors are known to those of skill in the art and can be selected depending on the host cells. Such selection is routine and does not form part of the present invention.

For expression in mammalian host cells, the vector may comprise a coding sequence encoding a propeptide appropriate for host cell protein secretion, linked in an appropriate reading frame to the sequence encoding the mature BMP-11 protein. . Appropriate sequences encoding propeptides can be obtained from DNA encoding proteins of the TGF-β superfamily of proteins, including, for example, BMP-2 through BMP-9. See, for example, US Patent No. 5,168,150, the disclosure of which is incorporated herein by reference, in which a DNA encoding a precursor part of a mammalian protein other than BMP-2 is fused with DNA encoding a mature BMP-2 protein. Thus, the present invention includes hybrid DNA molecules that include a DNA sequence encoding a propeptide of a member of the TGF-β superfamily of proteins, which binds, in correct reading frame, to a DNA sequence. encoding a BMP-11 polypeptide. The term "hybrid" is used to indicate that the propeptide originates from a polypeptide other than BMP-11.

A protein of the present invention, which regulates the production of FSH, has a possible application in the increase of fertility, when it is expressed in a composition as a homodimer or as a heterodimer with other proteins of the inhibin-e family. The proteins of the present invention may also be useful for contraception, when expressed in a composition as a heterodimer with proteins of the inhibinα family.

A protein of the present invention, which induces the formation of cartilage and / or bone in circumstances where it is not formed normally, has application in the healing of bone fractures and cartilage abnormalities in man and other animals. Said preparation using a BMP-11 protein can have a prophylactic use in reducing open fractures as well as closed ones, and also in improving the fixation of artificial joints. Osteogenic agent-induced de novo bone formation contributes to the repair of oncoectomy-induced, trauma-induced, or congenital craniofacial abnormalities, and is also useful in cosmetic plastic surgery. A BMP-11 protein can be used in the treatment of periodontal disease, and in other dental repair procedures. Such agents can provide a means of attracting bone-forming cells, stimulating their growth, or inducing differentiation from their parents. The BMP-11 polypeptides of the invention may also be useful in the treatment of osteoporosis. Various bone, cartilaginous, and osteogenic inducing factors have been described. See, for example, European Patent Applications Nos. 148,155 and 169,016 for consideration.

The proteins of the invention can also be used in wound healing and related tissue repair. Types of wounds include, but are not limited to, burns, incisions, and ulcers. (See, for example, PCT Publication WO84 / 01106 for consideration of wound healing and related tissue repair).

Another aspect of the invention consists of a therapeutic procedure and a composition for the repair of fractures and other situations related to cartilaginous and / or bone abnormalities or periodontal diseases. The invention further comprises therapeutic methods and compositions for wound healing and tissue repair. Said compositions comprise a therapeutically effective amount of at least one of the BMP-11 proteins of the invention, mixed with a pharmaceutically acceptable carrier, a carrier or a matrix.

ES 2 213 745 T3

Said preparation, which uses a BMP-11 protein, can also increase neuronal survival and therefore be useful in transplantation and in the treatment of situations that show a decrease in neuronal survival.

It is expected that the BMP-11 proteins of the invention may act in concert, or perhaps synergistically, with other related proteins and growth factors. Other therapeutic procedures and compositions of the invention therefore comprise a therapeutic amount of at least one BMP-11 protein of the invention, with a therapeutic amount of at least one of the BMP proteins or other factors of growth, disclosed in the co-proprietary patents and applications described above. Such combinations can include separate molecules or heteromolecules made up of different fractions. For example, a method and composition of the invention may include a disulfide-linked dimer comprising a BMP-11 protein subunit and a subunit of an inhibin-α protein, an inhibin-β protein, or a BMP protein, such as from BMP-1. up to BMP-10. Agents useful with BMP-1 1 may include various growth factors such as epidermal growth factor (EGF), platelet-derived growth factor (PDGF), transforming growth factors (TGF-α and TGF-β), and insulin-like growth factor (IGF). Other therapeutic methods and compositions of the invention include a therapeutic amount of at least one BMP-11 protein of the invention with a therapeutic amount of at least one of the BMP proteins disclosed in the co-proprietary patents. and in the applications described above. Said compositions can include separate molecules of the BMP proteins or heteromolecules formed by different BMP moieties. For example, a method and composition of the invention may comprise a disulfide-linked dimer comprising a BMP-11 protein subunit and a subunit of one of the "BMP" proteins described above. Thus, the present invention includes a purified BMP-11 polypeptide that is a heterodimer, in which a subunit comprises at least the amino acid sequence from amino acid # 1 to amino acid # 109 of SEQ ID NO: 2 or of SEQ ID No: 11, and another subunit includes an amino acid sequence for a bone morphogenetic protein selected from the group consisting of BMP-1, BMP-2, BMP-3, BMP-4, BMP5, BMP-6, BMP-7, BMP-8 and BMP-9. Another embodiment may comprise a heterodimer of BMP-11 moieties. In addition, the BMP-11 proteins can be combined with other beneficial agents for the treatment of bone and / or cartilage abnormalities, wounds, or tissues in question. These agents include various growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), transforming growth factors (TGF-α and TGF). -β), and k-fibroblast growth factor (kFGF), parathyroid hormone (PTH), leukemic inhibitory factor (LIF / HILDA / DIA), insulin-like growth factors (IGF-I and IGF-II). Portions of these agents can also be used in the compositions of the present invention.

The BMP-11 proteins of the present invention can also be used in compositions that are combined with bone morphogenetic proteins. See, for example, Ogawa et al., WO92 / 14481 (1992); Ogawaetal., J. Biol. Chem., 267: 14233-14237 (1992). Useful bone morphogenetic proteins in such compositions include BMP1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, and BMP-7, which are disclosed, for example, in US Patent Nos. 5,108,922; No. 5,013,649; No. 5,116,738; No. 5,106,748; No. 5,187,076; and 5,141,905; BMP-8, disclosed in PCT publication WO91 / 18098; and BMP-9, disclosed in PCT publication WO93 / 00432, and BMP-10, disclosed in pending patent application serial number 08 / 061,695, filed on 12th May 1993.

The preparation and formulation of such physiologically acceptable protein compositions, properly relating them to pH, isotonicity, stability, and the like, are within the skill of the art. The therapeutic compositions are also currently valid for veterinary applications, due to the lack of specific specificities in the BMP and TGF proteins. Particularly domestic animals and thoroughbred horses, in addition to man, constitute desired patients for said treatment with the BMP-1 1 of the present invention.

The therapeutic procedure includes administration of the composition topically, systemically, or locally, as a graft or device. When administered, the therapeutic composition for use in the present invention is, of course, in a pyrogen-free, physiologically acceptable form. Furthermore, the composition may be desirably encapsulated or injected in viscous form for delivery to the site of bone, cartilage or tissue damage. Topical administration may be appropriate for wound healing and tissue repair. Therapeutically useful agents other than BMP-22 proteins that may also optionally be included in the composition as described above, may alternatively or additionally be administered simultaneously or sequentially with the BMP-1 composition in the methods of the invention. .

For the formation, preferably, of bone, cartilage or other connective tissues, the composition includes a matrix capable of delivering BMP-11 or other BMP proteins to the site of tissue damage in need of repair, providing a structure for the bone and cartilage. developing, which is optimally capable of being absorbed into the body. The matrix can provide the slow release of BMP-11 and / or other bone inducing protein, as well as the proper presentation and environment for cellular infiltration. Such matrices can be formed of materials that are currently used for other medical grafts to be implanted.

Matrix material selection is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance, and interphase properties. The particular application of the BMP-11 compositions will define the appropriate formulation. Potential matrices for the compositions can be biodegradable and chemically defined as calcium sulfate, tricalcium phosphate, hydroxyapatite, polylactic acid, and polyanhydrides. Others

Potential materials are biodegradable and biologically well defined, such as bone, tendons or dermal collagen. Other matrices are composed of pure proteins or extracellular matrix components. Other potential matrices are biodegradable and biologically well defined, such as sintered hydroxyapatite, bioglass, aluminates, or other ceramics. The matrices can be composed of combinations of any of the aforementioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalcium phosphate. Bioceramics can be altered in composition, such as calcium phosphate aluminate, and processing to alter pore size, particle size, particle shape, and biodegradability.

Progress can be monitored by periodically evaluating bone development and / or repair. Evolution can be monitored, for example, by X-rays, histomorphometric determinations and tetracycline labeling.

The dosage regimen will be determined by the attending physician considering various factors that modify the action of the BMP-11 protein, for example, the age, sex, and diet of the patient, the severity of any infection, time of administration, and other clinical factors. Dosage may vary with the type of BMP protein or growth factor found in the composition. The dose may also vary with the type of matrix used.

The following examples illustrate the practice of the present invention to recover and characterize bovine BMP11 protein and its use to recover human and other BMP-11 proteins by obtaining human proteins and expressing them by recombinant techniques.

Example 1

Bovine BPM-11

800,000 recombinants from a bovine genomic library constructed in the ..EMBL3 vector were seeded with a density of 8000 plaques of recombinant bacteriophages per plate on 100 plates. From these plates, duplicate nitrocellulose replicas of the recombinant bacteriophage plaques were obtained and amplified. A fragment of human BMP-7 DNA corresponding to nucleotides # 1081 to # 1403 (Figure 4, US Patent No. 5,141,905) is labeled with³²p by the random priming procedure of Feinberg et al [Anal. Biochem. 132: 6-13 (1983)] and hybridize to a set of filters in a standard hybridization buffer (SHB) (5x SSC, 0.170 SDS, 5x Denhardt, 100 μg / ml salmon sperm DNA) at 60 ° C for 2 to 3 days. Filters were washed under reduced stringency conditions (4X SSC, 0.1% SDS at 60 ° C). Multiple positively hybridizing recombinants were targeted. 52 positively hybridizing recombinant bacteriophage plaques were selected and secondarily reseeded. From these 52 secondary plaques, duplicate nitrocellulose replicates of the recombinant bacteriophageal plaques were obtained and amplified. A set of nitrocellulose filters was hybridized to the human BMP-7 DNA probe as described above, washing under the same stringent conditions. The other set of filters was hybridized to a mixture of probes consisting of BMP-5, BMP-6 and BMP-7 in SHB, at 65 ° C overnight, washing with 0.1X SSC, 0.1% SDS at 65 ° C (severe hybridization and washing conditions). The probe mix consisted of relatively equal amounts of DNA-labeled fragments.³²P including nucleotides # 1452 to # 2060 (Figure 4, US Patent No. 5,106,748) of the human BMP-5 sequence, nucleotides # 1395 to # 1698 (Figure 4, US Patent No. 5,187,076) of the human BMP6 sequence, and nucleotides # 1081 to # 1403 (Figure 4, US Patent No. 5,141,905) of the BMP-7 sequence. The BMP-7, BMP-6 and BMP-5 DNA fragments were labeled with³²P by the random priming procedure, combining equal numbers of counts per minute (cpms) of each probe and adding them to the SHB containing the other set of replicas of the 52 secondary plates on nitrocellulose filters. 14 Recombinants, which positively hybridized to the human BMP-7 probe under the low stringency conditions and exhibited weak or no hybridization to the BMP-5/6/7 probe mix under high stringency conditions, were selected for a subsequent analysis. All 14 recombinants that showed these hybridization characteristics were plaque purified and from each one, a bacteriophage DNA was prepared. The region that positively hybridized from one of the 14 recombinants exhibiting the hybridization characteristics described above, designated .λ7 r-30, was located for a SacIde0.5kb restriction fragment. This fragment was subcloned into a plasmid vector (pGEM3) and DNA sequence analysis was performed. The partial DNA sequence (SEQUENCE ID No. 1) and the derived amino acid sequence (SEQUENCE ID No. 2) of the clone, 17i'-30 are shown in the Sequence Listings.

Bacteriophage λ7 ^ 30 has been deposited with ATCC on April 7, 1993, under ATCC registration number 75439. This deposit meets the requirements of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for Patent Procedures and Standards by which it is governed.

This clone, t7r-30 encodes at least a part of the bovine protein BMP-11 of the present invention. The nucleotide sequence of the clone, t7r-30 contains an open reading frame of 456 nucleotides, from # 246 to 701 of SEQ ID NO: 1. The nucleotide sequence # 324 to # 701 of SEQ ID NO: 1 defines an open reading frame of 378 nucleotides, encoding at least 126 amino acids from the C-terminal end of a bovine BMP11 protein, determined by alignment with other BMP proteins. and other proteins belonging to the TGF-β family. The nucleotide sequence # 246 to # 323 defines an open reading frame, contiguous to the sequence encoding the BMP-11 peptide of 126 amino acids, but nevertheless, a reduced degree of amino acid identity of the peptide deduced from this region of the DNA sequence. (# 246 to # 323) with respect to other BMP proteins and other proteins of the TGFβ family, and the presence of multiple consensual acceptor splice sequences makes it difficult to define the limit of the

ES 2 213 745 T3 5 'end of this exon of the bovine BMP-11 gene. The presence of a stop codon in reading frame at nucleotide positions # 243 to # 245 indicates that the nucleotide sequence of clone / 17r-30 contains at least one exon / intron boundary of the bovine BMP-11 gene.

Based on knowledge of other proteins within the TGF-β family, it is predicted that the BMP-11 precursor polypeptide will fragment into the multibasic sequence ARG-SER-ARG-ARG according to a proposed ARG-XX-ARG sequence and consensual, proteolytic processing. Fragmentation of the BMP-11 precursor polypeptide is expected to generate a mature 109 amino acid peptide starting with amino acid ASN at position # 1. Processing of BMP-11 in the mature form is expected to involve dimerization and removal of the N-terminal region in a manner analogous to processing of the related protein TGF-β [Gentry et al., Molec. & Cell. Biol., 8: 4162 (1988); Deryncketal., Nature, 316: 701 (1985)].

Thus, mature active types of BMP-1 1 are considered to include a homodimer of two polypeptide subunits, each comprising amino acids # 1 to # 109 with a predicted molecular weight of about 12,000 dalts. Other active types are considered comprising amino acids # 6 to # 109, thereby including the first conserved cysteine ​​residue. As with other members of the TGF-β family of proteins, the carboxy-terminal region of the BMP-11 protein exhibits greater sequence conservation than the more amino-terminal part. The percent identity of the amino acids of the BMP-11 protein in the cysteine-rich C-terminal domain (amino acids # 6 to # 109) relative to the corresponding region of other proteins within the TGF-β family as follows: BMP -2.39%; BMP-3, 37%; BMP-4, 37%; BMP-5, 42%; BMP-6.45%; BMP-7.42%; BMP-8, 39%; BMP-9, 40%; Vg1, 39%; GDF-1, 34%; TGF- ^ 1,36%; TGF- ^ 2, 38%; TGF- ^ 3, 38%; inhibinβ (B), 41%; inhibin β (A), 39%.

Example 2

Human BMP-11

The human and bovine BMP-11 genes are thought to be significantly homologous, thus the bovine coding sequence or a part thereof is used as a probe to screen a human genomic library or as a probe to identify a human cell line or tissue that synthesize human analog protein. A human genomic library, such as Stratagene catalog # 944201, can be screened with such a probe, presumptive positives isolated and the DNA sequence obtained. The evidence that this recombinant encodes a portion of human BMP-11 rests on bovine / human protein and gene structure homologies.

Once a recombinant bacteriophage containing DNA encoding a part of the human BMP11 molecule is obtained, the human coding sequence can be used as a probe to identify a human or tissue cell line that synthesizes the BMP-11 mRNA. Alternatively, the bovine BMP-11 coding sequence can be used as a probe to identify such human tissue or cell line. Briefly described, RNA is extracted from a selected tissue or cellular source, being electrophoresed on an agarose-formaldehyde gel and transferred to nitrocellulose, or by reacting it with formaldehyde and spraying directly onto nitrocellulose. This is then hybridized to a probe derived from a bovine or human BMP-11 coding sequence. Alternatively, the bovine BMP-1 1 coding sequence was used to design oligonucleotide primers that will specifically amplify a part of the BMP-1 1 coding sequence located in the region between the primers used to carry out the specific reaction of amplification. It is considered that the sequences of bovine and human BMP-11 would make it possible to specifically amplify the coding sequences corresponding to human BMP-1 1 from mRNA, cDNA or genomic DNA matrices. Once a positive source was identified by one of the procedures described above, the mRNA was selected by oligo (dT) cellulose chromatography, the cDNA being synthesized and cloned into λgt10 or other λ bacteriophagic vectors known to those of skill in the art. (ie, λZAP) by established techniques (Toole et al., supra). It is also possible to directly carry out the oligonucleotide primer directed amplification reaction, described above, on a pre-established human cDNA or a genomic library cloned in a bacteriophageal λ vector. In such cases, a library that produces an amplified DNA product specifically encoding a portion of the human BMP-11 protein could be directly screened, using the amplified DNA fragment encoding BMP-11 as a probe.

Oligonucleotide primers designed based on the DNA sequence of genomic bovine BMP-11 clone / 17r-30 were predicted to allow specific amplification of human BMP11 coding sequences. The following oligonucleotide primer was designed based on nucleotides # 501 to # 521 of the DNA sequence disclosed in SEQ ID NO: 1 and synthesized on an automated DNA synthesizer.

Initiator C: TAGTCTAGATGCTCCGGCCAGTGCGAGTAC

The first nine nucleotides of primer C (underlined) comprise the recognition sequence for restriction endonuclease XbaI that can be used to facilitate manipulation of a specifically amplified DNA sequence encoding the BMP-11 protein of the invention, and therefore not is derived from the DNA sequence found in SEQ ID NO: 1.

The following oligonucleotide primer is designed based on nucleotides # 701 to # 678 of the DNA sequence

ES 2 213 745 T3 which is set forth in SEQ ID NO: 1 and which is synthesized with an automated DNA synthesizer.

Initiator D: TGCGGATCCGGAGCAGCCACAGCGATCCAC

The first nine nucleotides of primer D (underlined) comprise the recognition sequence for the restriction endonuclease BamHI that can be used to facilitate manipulation of a specifically amplified DNA sequence encoding the BMP-11 protein of the invention, and therefore not is derived from the DNA sequence found in SEQ ID NO: 1.

The standard symbols for the nucleotides in the primers identified above are: A, adenosine; C, cytosine, G, guanine; and T, thymine.

The primers C and D identified above are used as primers to allow the amplification of a specific nucleotide from human genomic DNA. The amplification reaction is carried out as follows:

Human genomic DNA (source: peripheral blood lymphocytes) was denatured at 100 ° C for five minutes, then chilled on ice, before adding it to a reaction mix containing 200 μM of each of the deoxynucleotide triphosphate (dATP, dGTP, dCTPydTTP), 10mM of Tris-HClpH8.3.50mMKCl, 1.5mMMgCl2, 0.001% gelatin, 1.25 units of TAq DNA polymerase, 100 pM of oligonucleotide C primer and 100 pM of oligonucleotide D primer. This reaction mixture is then subjected to thermal cycling as follows: 3 minutes at 94 ° C, 1 minute at 50 ° C, 1 minute at 72 ° C for one cycle, then 1 minute at 94 ° C, 1 minute at 50 ° C, 1 minute at 72 ° C for thirty-nine cycles.

DNA that was specifically amplified by this reaction was separated from excess oligonucleotide primers C and D that were used to initiate amplification, using a resin-based protocol for DNA purification under conditions suggested by the manufacturer. The resulting DNA product was digested with restriction endonucleases XbaI and BamHI, extracting with phenol and chloroform. Buffer exchange and removal of small DNA fragments resulting from the XbaI / BaHI restriction digest was carried out by diluting the digested DNA product in 10 mM Tris-Hcl pH 8.0, 1 MmEDTA followed by centrifugation using a microconcentrator. Centricon ^TM 30 (WR Grace & Co., Beverly, Ma; product # 4209). The resulting XbaI / BamHI-digested amplified DNA product was subcloned into a plasmid vector (pBluescript) between the XbaI and BamHI restriction sites of the polylinker region. DNA sequence analysis of the resulting subclones indicates that the specifically amplified DNA sequence product encodes a part of the human BMP-11 protein of the present invention. The DNA sequence (SEQ ID NO: 3) and the derived amino acid sequence (SEQ ID NO: 4) of this specifically amplified DNA fragment are set forth in the Sequence Listing.

Nucleotides # 1 to # 27 of this sequence comprise a part of the oligonucleotide primer C and nucleotides # 186a # 213 comprise a part of the oligonucleotide primer D used to carry out the specific amplification reaction. Due to the role of oligonucleotide primers C and D (named based on the DNA sequence of bovine BMP-11) in initiating the amplification reaction, they cannot exactly correspond to the actual sequence encoding a human BMP-11 and therefore they are not translated into the derivation of the above amino acid sequence. The DNA sequence, from nucleotide # 28 to # 185 of SEQ ID NO: 3, or parts thereof, especially amplified from the human genomic DNA matrix, can be used as a probe to identify additional coding sequences for BMP -11 human from human cDNA or human genomic libraries, using standard screening / hybridization techniques known to those skilled in the art.

One million two hundred thousand recombinants from a human fetal brain cDNA library (Stratagene catalog # 936206) constructed in the λZAPII vector were seeded at a density of 24,000 recombinant bacteriophageal plaques per plate on 50 plates. Duplicate nitrocellulose replicas of the recombinant bacteriophageal plaques were obtained from these plates. An oligonucleotide probe designed based on nucleotides # 53- # 82 of SEQ ID NO: 3, was synthesized on an automated DNA synthesizer. This oligonucleotide probe was radioactively labeled with and³²P-ATP and hybridized in SHB at 65 ° C to both sets of replicates in duplicate on nitrocellulose. Nine recombinants were scored that hybridized positively. One of these, designated λFB30.5, was plaque purified. Bacteriophageal plaque stocks were prepared from the λFB30.5 cDNA clones, and the bacteriophage DNA was then isolated. A bacterial plasmid designated FB30.5, generated by the in vivo excision protocol described by the supplier (Stratagene) and containing the entire insert of the bacteriophage cDNA clone λFB30.5, was deposited at ATCC, 12301 Parklawn Drive, Rockville, Maryland. , United States, under the requirements of the Budapest Treaty and was designated ATCC # 69619. A part of the DNA sequence of clone FB30.5 is disclosed in SEQ ID NO: 10.

One million recombinants from a human genomic library (Stratagene Catalog # 944201), constructed in the λFIX vector, were seeded at a density of 20,000 recombinant bacteriophage plaques per plate on 50 plates. Duplicate nitrocellulose replicas of recombinant bacteriophageal plaques were obtained from these plates. An oligonucleotide probe designed based on nucleotides # 57- # 86 of SEQ ID NO: 10, with the exception of an inadvertent substitution of CAC for GCG at nucleotides # 59- # 61 of SEQ ID NO: 10, it was synthesized on an automated DNA synthesizer. This oligonucleotide probe was radioactively labeled with and³²PATP and hybridized, in SHB at 65 ° C, to both sets of duplicate replicas in nitrocellulose. Five recombinants that hybridized positively were scored. One of these, designated 30GEN.4, was purified in plaque.

ES 2 213 745 T3

Bacteriophage plaque stocks were prepared from the 30GEN.4 genomic clones, and the bacteriophage DNA was then isolated. A bacteriophageal pool of this genomic clone was deposited at ATCC, 12301 Parklawn Drive, Rockville, Maryland, United States, under the requirements of the Budapest Treaty and was designated as ATCC # 75775. A part of the DNA sequence of clone 30GEN.4 is disclosed in SEQ ID NO: 10. A part of the DNA sequence of genomic clone 30GEN.4 was determined to be identical to a part of the DNA sequence of cDNA clone FB30.5. The degree of this overlap (nucleotides # 1- # 198) of SEQ ID NO: 10 was used as the basis for compiling the partial coding sequence of the BMP-10 protein. Genomic clone 30GEN.4 is expected to contain additional coding sequences for the 5 'end of human BMP-11 protein that are expected to encode the remainder of the BMP-11 precursor polypeptide, including the initiator methionine. The partial sequence of BMP-11 is presented in SEQ ID NO: 10 and it should be appreciated that nucleotides # 1-198 have been determined to be found in both genomic clone 30GEN.4 and clone FB30.5 of cDNA, while nucleotides # 199- # 1270 are derived entirely from cDNA clone FB30.5. SEQ ID NO: 10 advocates a human BMP-11 precursor protein of at least 362 amino acids. Based on the knowledge of other BMPs and other proteins belonging to the TGF-β family, it is predicted that the precursor polypeptide could be fragmented in the multibasic sequence ARG-SERARG-ARG (amino acids # -4 to # -1 of SEQ ID No. 11) according to the proposed consensus sequence ARG-X-XARG, of proteolytic processing. Fragmentation of the human BMP-11 precursor polypeptide at this location will generate a 109 amino acid mature peptide beginning with amino acid ASN at position # 1 of SEQ ID NO: 11. Processing of human BMP-11 into the mature form is expected to involve dimerization and removal of the N-terminal region in a manner analogous to processing of the related TGF-β protein [LE Gentry et al. Molec. & Cell. Biol. 8: 4162 (1988); R. Derynck, et al, Nature 316: 701 (1985). The mature active types of human BMP-11 are considered to comprise a homodimer of two polypeptide subunits, each including amino acids # -1- # 108 of SEQ ID NO: 11, with a predicted molecular weight of 12,000 daltons. Other active types are considered to comprise amino acids # 7- # 108 of SEQ ID NO: 11, thus including the first conserved cysteine ​​residue. Heterodimeric molecules comprising one subunit of BMP-11 and another from another member of the BMP / TGF-β superfamily are also considered.

Example 3

BMP-11 expression

In order to produce bovine, human, or other mammalian BMP-11 proteins, the DNA encoding them is transferred into an appropriate expression vector and introduced into the cells of mammalian or other preferred eukaryotic or prokaryotic hosts, by standard techniques of genetic engineering. The preferred expression system for biologically active recombinant human BMP-11 is considered to be stably transformed mammalian cells.

The person skilled in the art can construct mammalian expression vectors using the sequence of SEQ ID no: 1 or of SEQ ID no: 10, or other DNA sequences encoding BMP-11 proteins or other modified sequences and known vectors, such as pCD [Okayama et al., Mol. Cell. Biol., 2: 161-170 (1982)], pJL3, pJL4 [Gough et al., EMBO J., 4: 645-653 (1985)] and pMT2 CXM.

The mammalian expression vector pMT2 CXM is a derivative of p91023 (b) (Wong et al., Science, 228: 810815, 1985) that differs from p91023 in that it contains the ampicillin resistance gene instead of the resistance gene to tetracycline and also an XhoI site for the insertion of cDNA clones. The functional elements of pMT2 CXM have been described (Kaufman, RJ, 1985, Proc. Natl. Acad. Sci. USA 82: 689-693) and include the adenoviral VA genes, the SV40 origin of replication that includes the 72 base pair enhancer, the most important late promoter in adenovirus that includes a 5 'end splice site, and most of the tripartite leader sequence found in adenovirus late mRNAs, a 3 'end splice acceptor site, a DHFR insert, the SV40 early polyadenylation site (SV40), and the sequences of pBR322 necessary for propagation in E.coli.

Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF, which was deposited with the American Type Culture Collection (ATCC), Rockville, MD (USA) under accession number ATCC 67122. EcoRI digestion removes the insert of cDNA found in pMT2-VWF, giving rise to pMT2 in linear form that can be bound and used to transform E.coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by standard procedures. PMT2 CXM is then constructed using external / or internal loop mutagenesis [Morinaga et al., Biotechnology 84: 636 (1984). It deletes bases 1075 to 1145 relative to the Hind III site near the SV40 origin of replication and the enhancer sequences of pMT2. Also, insert the following sequence:

5 'PO-CATGGGCAGCTCGAG-3' at nucleotide 1145. This sequence contains the recognition site for restriction endonuclease Xho I. A derivative of pMT2CXM, designated pMT23, contains recognition sites for restriction endonucleases PstI, Eco RI, SalI and XhoI. Plasmid DNA pMT2 CXM and pMT23 can be prepared by standard procedures.

pHMC2 / 11 derived from pMT21 may also be suitable for carrying out the invention. pMT21 is derived

ES 2 213 745 T3 of pMT2 which is derived from pMT2-VWF. As described above, EcoRI digestion removes the cDNA insert found in pMT-VWF, yielding pMT2 in linear form that can be bound and used to transform E.coli HB 101 or DH-5 to resistance to ampicillin. Plasmid pMT2 DNA can be prepared by standard procedures.

pMT21 is derived from pMT2 by the following two modifications. First, 76 base pairs are deleted from the 5'-end untranslated region of the DHFR cDNA, including a 19-residue G-residue stretch from the addition of a G / C tail for cDNA cloning. In this procedure, an XhoI site is inserted to obtain the following sequence immediately above DHFR:

<img file="ES2213745T3_D0001.tif" />

Second, a single ClaI site is introduced by digestion with EcoRV and XbaI, treatment with the Klenow fragment of DNA polymerase I, and binding to a ClaI linker (CATCGATG). This deletes a 250 base pair fragment of the adenovirus associated RNA region (VAI), but does not interfere with VAI RNA gene expression or function. pMT21 is digested with EcoRI and XhoI, and is used to derive the vector pEMC2B1.

A part of the EMCV conductor is obtained from pMT2-ECAT1 [SKJung, et al, J.Virol63: 1651-1660 (1989)] by digestion with Eco RI and PstI, giving a 2752 base pair fragment. This fragment is digested with TaqI, giving rise to a 508 base pair Eco RI-TaqI fragment that is purified by electrophoresis on a low melting temperature agarose gel. A 68 base pair linker and its complementary strand are synthesized with a protruding 5 'end of TaqI and a protruding 3' end of XhoI, which has the following sequence:

5'-CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTT

Taql

GAAAAACACGATTGC-3 '

Xhol

This sequence pairs with the EMC virus leader sequence from nucleotide 763 to 827. It also changes the ATG at position 10 within the EMC virus leader sequence to an ATT and is followed by an Xhol site. The vector pEMC2j61 results from the tripartite union of the pMT21 Eco Rl-Xhol fragment, the EcoRITagI fragment of the EMC virus, and the 68 base pair oligonucleotide TaqI-XhoI adapter.

This vector contains the SV40 origin of replication and enhancer, the most important late promoter in adenovirus, a cDNA copy of the majority of the adenoviral tripartite leader sequence, a small intervening hybrid sequence, an SV40 polyadenylation signal, and the gene Adenovirus VA I, DHFR and j6-lactamase markers and an EMC sequence, appropriately related to direct high-level expression of the desired cDNA in mammalian cells.

Construction of vectors may involve modification of the BPM-11 DNA sequences. For example, the BMP-11 cDNA can be modified by deleting the noncoding nucleotides at the 5 'and 3' ends of the coding region. Deleted noncoding nucleotides may or may not be replaced by other sequences known to be beneficial for expression. These vectors are transformed into the appropriate host cells for the expression of the BMP-11 proteins. In addition, the sequences SEQ ID no: 1 or SEQ ID no: 10 or other sequences that encode BMP-1 1 proteins could be manipulated to express a mature BMP-1 1, deleting the propeptide sequences that encode BMP-1 1 and replacing them with sequences that encode the full length propeptides of other BMP proteins, activin proteins, or other members of the TGF-β superfamily.

One skilled in the art can manipulate the sequence SEQ ID no: 1 or SEQ ID no: 10, eliminating or replacing the regulatory sequences of mammals, which flank the coding sequence, with bacterial sequences, in order to create vectors bacterial cells for extracellular or intracellular expression by bacterial cells. For example, the coding sequences could be further manipulated (eg, by attaching them to other known linkers, or by modifying them by deleting their non-coding sequences or by altering nucleotides by other known techniques). The modified BMP-11 coding sequence could then be inserted into a known bacterial vector using procedures such as those described in T. Taniguchi et al., Proc. Natl. Acad. Sci. USA, 77: 5230-5233 (1980). This exemplary bacterial vector could then be transformed into bacterial host cells and thus express a BMP-1 1 protein. For strategies for the production of extracellular expression of BMP-11 proteins in bacterial cells, see, for example, European patent application EPA 177,343.

ES 2 213 745 T3

Similar manipulations can be carried out for the construction of an insect vector [See, for example, the procedures described in published European patent application 155,476] for expression in insect cells. Likewise, a yeast vector could be constructed that utilizes yeast regulatory sequences for intra-extracellular expression of the factors of the present invention by yeast cells. - [See, for example, the procedures described in the published PCT patent application, WO86 / 00639, and in the European patent application EPA 123,289].

A method for the production of high levels of a BMP-11 protein of the invention in mammalian cells may involve the construction of cells that contain multiple copies of the heterologous BMP-11 gene. The heterologous gene binds to a marker capable of being amplified, for example the dihydrofolate reductase (DHFR) gene for which cells containing increased copies of the gene can be selected to propagate in increasing concentrations of methotrexate. (MTX), according to the procedures of Kaufman and Sharp, J. Mol. Biol., 159: 601-629 (1992). This approach can be used with a number of different cell types.

For example, a plasmid that contains a DNA sequence for a BMP-11 of the invention, operatively associated with other plamid sequences that allow its expression, and the plasmid pAdA26SV (A) 3 that expresses DHFR [Kaufman and Sharp, Mol. Cell. Biol., 2: 1304 (1982)], can be co-introduced into DHFR deficient CHO cells, DUKX-BII, by various procedures including calcium phosphate coprecipitation and protoplastic transfection, electroporation or fusion. Transformants expressing DHFR are selected to grow in alpha medium with dialyzed fetal calf serum, then selected for amplification by growing in increasing concentrations of MTX (eg, sequential steps at 0.02, 0.2, 1 , 0 and 5 uM MTX), as described in Kaufman et al., Mol. Cell Biol., 5: 1750 (1983). The transformants are cloned, and the expression of the biologically active BMP-11 is monitored by one or more of the BMP11 activity assays described in Examples 5 to 8 below. The expression of BMP-11 will increase with increasing levels of resistance to MTX. BMP-11 polypeptides are characterized using standard techniques known in the art, such as pulse labeling of [35 S] methionine or cysteine ​​and polyacrylamide gel electrophoresis. Similar procedures can be followed to produce other BMP-11 related proteins.

Example 4

Biological activity of the BMP-11 that is expressed

To measure the biological activity of the BMP-11 proteins that are expressed, obtained in Example 3 above, said proteins are recovered from cell culture and purified by isolating them from other proteinaceous materials with which they are co-produced, thus also as from other pollutants. Purified proteins can be tested according to the assays for BMP-11 activity described in Examples 5 to 8 below.

Example 5

W-20 bioassays

A. Description of W-20 cells

The use of W-20 bone marrow stromal cells as an indicator cell line is based on the conversion of these cells to osteoblast-like cells after treatment with a BMP protein [Thies et al, Journal of Bone and Mineral Research, 5: 305 (1990); and Thies et al, Endocrinology, 130: 1318 (1992)]. Specifically, W-20 cells constitute a bone marrow stromal clonal cell line derived from adult mice by researchers in the laboratory of Dr. D. Nathan, Children's Hospital, Boston, MA. Treatment of W-20 cells with certain BMP proteins results in (1) increased alkaline phosphatase production, (2) induction of PTH-stimulated cAMP, and (3) induction of osteocalcin synthesis by cells. Although (1) and (2) represent characteristics associated with the osteoblastic phenotype, the ability to synthesize osteocalcin is a phenotypic property that is only exhibited by mature osteoblasts. Furthermore, to date, the conversion of W-20 stromal cells to osteoblastic-like cells has been observed only after treatment with the BMPs. In this way, the in vitro activities shown by the BMP-treated W-20 cells correlate with the in vivo bone-forming activity that BMPs are known to possess.

Two in vitro assays, useful in comparison with the BMP activities of new osteoinductive molecules, are described below.

B. Assay protocol for alkaline phosphatase in W-20 cells

W-20 cells were seeded in 96-well tissue culture plates, with a density of 10,000 cells per well, in 200 μl of DME medium with heat inactivated 10% fetal calf serum, 2 mM glutamine and 100 Units / ml of penicillin + 100 μg / ml of streptomycin. Cells were allowed to attach overnight in a 95% air atmosphere, in a 5% CO incubator.₂ at 37 ° C.

The 200 μl of medium was removed from each well with a multichannel pipet and replaced with a volume

The identical ES 2 213 745 T3 of the test sample, which had been supplied in DME with 10% heat inactivated fetal calf serum, 2 mM glutamine and 1% penicillin-streptomycin. The test substances were tested in triplicate.

The test and standard samples were allowed to incubate for 24 hours with the W-20 indicator cells.

After 24 hours, the plates were removed from the 37 ° C incubator and the assay media was removed from the cells.

The W-20 cell layers were washed 3 times with 200 µl per well of free magnesium / calcium phosphate buffered saline, discarding these washes.

µl of distilled water was added to each well, then the test plates were placed in an ethanol / dry ice bath to quickly freeze. Once frozen, the test plates were removed from the ethanol / dry ice bath and thawed at 37 ° C. This process was repeated 2 more times for a total of 3 freeze-thaw procedures. Once carried out, the membrane-bound alkaline phosphatase was ready for evaluation.

μl Assay Mix (50 mM Glycine, 0.05% Triton X-100, 4 mM MgCl₂, 5 mM pnitrophenol phosphate, pH = 10.3) was added to each test well and the test plates were then incubated for 30 minutes at 37 ° C in an aqueous bath with a shaking of 60 oscillations per minute.

At the end of the 30 minute incubation, the reaction was stopped by adding 100 µl of 0.2 N NaOH to each well, and placing the assay plates on ice.

The spectrophotometric absorbance for each well was read at a wavelength of 405 nanometers. These values ​​were then compared to known standards to estimate alkaline phosphatase activity in each sample. For example, using known amounts of p-nitrophenol phosphate, absorbance values ​​are generated. This is shown in Table 1.

TABLE I

<td colspan="2">Absorbance Values ​​for Known P-Nitrophenol Phosphate Standards</td>

<td>P-nitrophenol phosphate ointments</td><td>Mean Absorbance (405 nm)</td>

<td> 0,000</td><td> 0</td>

<td> 0,006</td><td> 0,261 +/- 0,024</td>

<td> 0,012</td><td> 0,521 +/- 0,031</td>

<td> 0,018</td><td> 0,797 +/- 0,063</td>

<td> 0,024</td><td> 1,074+/-0,061</td>

<td> 0,030</td><td> 1,305 +/. 0,083</td>

Absorbance values ​​for known amounts of BMPs can be determined and converted to µmoles of released p-nitrophenol phosphate per unit time, as shown in Table II.

TABLE II

<td colspan="3">Alkaline phosphatase values ​​for W-20 cells treated with BMP-2</td>

<td>BMP-2 concentration nq / ml</td><td>Mean Absorbance (405 nm)</td><td>umoles of substrate per hour</td>

<td> 0</td><td> 0,645</td><td> 0,024</td>

<td> 1,56</td><td> 0,696</td><td> 0,026</td>

<td> 3,12</td><td> 0,765</td><td> 0,029</td>

<td> 6,25</td><td> 0,923</td><td> 0,036</td>

<td> 12,50</td><td> 1,121</td><td> 0,044</td>

<td> 25,0</td><td> 1,457</td><td> 0,058</td>

<td> 50,0</td><td> 1,662</td><td> 0,067</td>

<td> 100,0</td><td> 1,977</td><td> 0,080</td>

ES 2 213 745 T3

These values ​​are then used to compare the activities of known amounts of BMP-11 to BMP-2.

C. RIA protocol for osteocalcin

W-20 cells were seeded at a rate of 10⁶ per well in 24-well multiwell tissue culture plates, in 2 mls of DME containing heat-inactivated 10% fetal calf serum and 2 mM of glutamine. Cells were allowed to attach overnight in an atmosphere of 95% air and 5% CO.₂, at 37 ° C.

The following day the medium was changed to DME containing 10% fetal calf serum, 2 mM glutamine and the test substance, in a total volume of 2 ml. Each test substance was administered to the wells in triplicate. The test substances were incubated with the W-20 cells for 96 hours in total, replacing them at 48 hours by the same test media.

After 96 hours, 50 µl of the assay media was removed from each well and assayed for osteocalcin production using a radioimmunoassay for murine osteocalcin. Details of the assay are described in equipment manufactured by Biomedical Technologies Inc., 378 Page Street, Stoughton, MA 02072. The reagents for the assay were found as product numbers BT-431 (Mouse Ostecalcin Standard), BT-432 (Goat Anti-Mouse Osteocalcin), BT-431R (Mouse Iodinated Osteocalcin), BT-415 (Normal Serum goat) and BT414 (anti-donkey goat IgG). The RIA for osteocalcin synthesized by W-20 cells in response to BMP treatment was carried out as described in the protocol provided by the manufacturer.

The values ​​obtained for the test samples were compared with the values ​​for known standards for murine osteocalcin and with the amount of osteocalcin produced by W-20 cells in response to stimulation with known amounts of BMP-2. Table III shows the values ​​of osteocalcin synthesis by W-20 cells induced by BMP-2.

TABLE III

<td colspan="2">Osteocalcin synthesis by W-20 cells</td>

<td>Concentration nq / ml of BMP-2</td><td>Osteocalcin synthesis nq / well</td>

<td> 0</td><td> 0,8</td>

<td> 2</td><td> 0,9</td>

<td> 4</td><td> 0,8</td>

<td> 8</td><td> 2,2</td>

<td> 16</td><td> 2,7</td>

<td> 31</td><td> 3,2</td>

<td> 62</td><td> 5,1</td>

<td> 125</td><td> 6,5</td>

<td> 250</td><td> 8,2</td>

<td> 500</td><td> 9,4</td>

<td> 1000</td><td> 10,0</td>

Example 6

Sampath-Reddi test modified by Rosen

A modified version of the rat bone formation assay described in Sampath and Reddi, Proc. Natl. Acad. Sci. USA, 80: 6591-6595 (1983), was used to evaluate the inductive activity of BMP-11 proteins on bone, cartilage and / or other connective tissues. This modified assay is referred to herein as the Rosen Modified Sampath-Reddi Assay. The ethanolic precipitation step of the Sampath-Reddi procedure is replaced by dialysis (if the composition is a solution) or filtration (if the composition is a suspension) the fraction to be tested, against water. The solution or suspension is then equilibrated to 0.1% TFA. 20 mg of rat matrix are added to the resulting solution. A mock rat matrix sample that is not treated with the protein serves as a control. This material is frozen and lyophilized and the resulting powder is enclosed in # 5 gelatin capsules. These are implanted subcutaneously in the abdominal thoracic area of ​​21-49 day old male Long Evans rats. The implants are removed in 7-14 days. Half of each implant is used for alkaline phosphatase analysis [see, Reddi et al, Proc. Natl. Acad. Sci. USA, 69: 1601 (1972)].

The other half of each implant is fixed and processed for histological analysis. 1 μιη sections in glycolmethacrylate are stained with Von Kossa and acid fuchsin to qualify the amount formed, by induction, of cartilage and bone,

ES 2 213 745 T3 that is present in each implant. The terms +1 to +5 represent the area of ​​each histological section of an implant occupied by new bone and / or cartilaginous cells and by the matrix. A rating of +5 indicates that more than 50% of the implant is new bone and / or cartilage produced as a direct result of the protein in the implant. A rating of +4, +3, +2, and +1 would indicate that more than 40%, 30%, 20%, and 10% of the implant, respectively, contains new cartilage and / or bone.

The BMP-11 proteins of the present invention can be assessed by activity in this assay.

Example 7

Biological activity of the BMP-11 that is expressed

To measure the biological activity of the BMP-11 proteins that are expressed, obtained in Example 3 above, the proteins are recovered from the cell culture and purified by isolating them from other proteinaceous materials with which they are co-produced, as well as from other pollutants. Purified proteins can be tested according to the rat bone formation assay described in Example 6.

Purification is carried out using standard techniques known to those of skill in the art.

Protein analysis is carried out using standard techniques such as acrylamide SDS-PAGE [Laemmli, Nature 227: 680 (1970)], silver staining [Oakley et al. Anal. Biochem. 105: 361 (1980)] and by immunoblotting [Towbin, et al. Proc. Natl. Acad. Sci. USA 76: 4350 (1979)].

The above-mentioned descriptions detail the presently preferred embodiments of the present invention. After considering such descriptions, it is expected that those skilled in the art will come up with numerous modifications and variations in their practice. These modifications and variations are believed to be part of the claims appended to the present invention.

Example 8

Assays to determine the activin activity of BMP-11

Purification is carried out using standard techniques known to those of skill in the art. It is considered, as with other proteins of the TGF-β superfamily, that purification may include the use of Heparin sepharose.

Protein analysis is carried out using standard techniques such as acrylamide SDS-PAGE [Laemmli, Nature 227: 680 (1970)], silver staining [Oakley et al. Anal. Biochem. 105: 361 (1980)] and by immunoblotting [Towbin, et al. Proc. Natl. Acad. Sci. USA 76: 4350 (1979)].

BMP-11 proteins can be further characterized by their ability to modulate the release of follicular stimulating hormone (FSH) in established in vitro bioassays using rat anterior pituitary cells as described in, for example, Vale et al. , Endocrinology, 91: 562-572 (1972); Ling et al., Nature, 321: 779-782 (1986) or Vale et al, Nature, 321: 776-779 (1986), the disclosures of which are incorporated herein by reference.

Alternatively, BMP-11 can be characterized by its ability to stimulate erythropoietic activity in human K-562 cell line, as described by Lozzioetal., Blood, 45: 321-334 (1975) and in US Patent No. 5,071,834, at column 15, the disclosures of which are incorporated herein by reference.

Furthermore, BMP-11 can be characterized by its activity in cell survival assays, as described in Schubert, Nature, 344: 868-870 (1990), the disclosure of which is incorporated by reference.

The above-mentioned descriptions detail the presently preferred embodiments of the present invention. After considering such descriptions, it is expected that those skilled in the art will come up with numerous modifications and variations in their practice. These modifications and variations are believed to be part of the claims appended to the present invention.