Recombinant antibodies for human therapy.

ES 2 196 002 T3

DESCRIPTION

Recombinant Antibodies for Human Therapy.

Field of Invention

The invention relates to recombinant antibodies useful for human therapy and to methods for the production of such antibodies. Background of the invention

Certain murine monoclonal antibodies are used in the diagnosis of human diseases and to solve basic biological research problems. These reagents are also used in clinical trials as therapeutic agents for both acute and chronic human diseases, including leukemias, lymphomas, solid tumors (eg, colon, breast, liver), AIDS, and autoimmune diseases.

Mouse / human chimeric antibodies have been created and have been shown to exhibit the main characteristics of the parental mouse antibody and effector functions associated with the human constant region. See, for example, Cabilly et al., US Patent 4,816,567; Shoemaker et al., US Patent 4,978,745; Beavers et al., US Patent 4,975,369; and Boss et al., US Patent 4,816,397. Generally, these chimeric antibodies are constructed by preparing a library of genoomic genes from DNA extracted from pre-existing murine hybridomas. Nishimura et al., 47 Cancer Research 999, 1987. The library is then screened for both heavy and light chain variable region genes that show the correct antibody fragment redistribution patterns. The cloned variable region genes are then linked to an expression vector containing cloned cassettes of the appropriate human heavy or light chain constant region gene. The chimeric genes are then expressed in a cell line of choice, usually a murine myeloma line.

Such chimeric antibodies have been used in human therapy. However, in several cases the human recipient has produced antibodies to these chimeric antibodies. Such anti-chimeric antibodies are detrimental to continued therapy with the chimeric antibody.

Erlich et al., 34 Clinical Chemistry 1681, 1988, Erlich et al., 7 Hybridoma 385, 1988, Erlich et al., 6 Hybridoma 151, 1987, and Erlich et al., 1 Human Antibody Hybridomas 23, 1990 (not supported as prior art in the present application) indicate that human monoclonal antibodies are expected to be an improvement over mouse monoclonal antibodies for human therapy in vivo. Furthermore, they postulate that non-human primate antibodies, eg, chimpanzee monoclonal antibodies, are tolerated in humans because they are structurally similar to human antibodies. Since human antibodies are not immunogenic in Rhesus monkeys (that is, they do not induce an antibody response), they predict that primate antibodies will not be immunogenic in humans. They indicate that the human antibody test is not necessary if a primate antibody has a constant-region structure identical to that of a human immunoglobulin or, at least, a structure that is no more different from a human immunoglobulin than the difference that exists. among human antibodies. Thus, they suggest that chimpanzee antibodies may be useful in human therapy. Summary of the invention

The invention is based on the discovery that evolutionarily distant monkeys (for example, baboons or macaques (including Cynomolgus and Rhesus monkeys)), unlike chimpanzees, are not only sufficiently different from humans to allow the induction of antibodies. against human antigens in these monkeys, even against relatively conserved human antigens, for example, CD4 and CD54, Rather, they are sufficiently similar to humans to have antibodies similar to human antibodies, so that a host anti-antibody immune response does not occur when such monkey antibodies, or recombinant antibodies derived therefrom, are introduced into a host. human being.

Accordingly, the invention provides a chimeric antibody that specifically binds to a human antigen, where the antibody is not immunogenic in a human, is not the same as a human or chimpanzee antibody, and comprises the entire variable region of a human body. immunoglobulin from an old world monkey selected from rhesus, cynomolgus and baboon monkeys and the constant regions of a human or chimpanzee immunoglobulin, where said chimeric antibody can be obtained by a method comprising the steps of:

induce an old world monkey antibody against a human target antigen in an old world monkey selected from rhesus monkeys, cynomolgus monkeys and baboons, isolate an old world monkey nucleic acid that encodes the entire variable region of said monkey antibody from the old world, provide a human or chimpanzee nucleic acid encoding a human constant region of a human antibody, joining said old world monkey nucleic acid and said human or chimpanzee nucleic acid to form a recombinant nucleic acid, and expressing said recombinant nucleic acid to produce said chimeric antibody.

The invention also provides a method for producing a chimeric antibody against a human target antigen, without said antibody being immunogenic in a human, comprising the steps of:

induce an old world monkey antibody against said antigen in an old world monkey selected from rhesus monkeys, cynomolgus monkeys and baboons, isolate an old world monkey nucleic acid encoding the entire variable region of said old world monkey antibody , provide a human nucleic acid encoding a human constant region of an an2

ES 2 196 002 T3 human body, joining said old world monkey nucleic acid and said human nucleic acid to form a recombinant nucleic acid, and expressing said recombinant nucleic acid to produce said chimearic antibody.

Unlike some prior antibodies used for human therapy, the antibodies of the present invention do not carry several drawbacks, for example, 1) immunogenicity and induction of an anti-human antibody (HAA) response after repeated administration necessary to treat conditions. chronic, 2) a relatively short half-life compared to human antibodies, and 3) lack of effector functions with human cells or complements.

The absence of these drawbacks is a significant advantage for human therapy with antibodies obtained by the present invention. For example, in the case of chronic human diseases, including autoimmune diseases, or any disease in which prolonged administration of an antibody is necessary, one of the main obstacles to repetitive antibody therapy is the host response against it. therapeutic antibody.

HAA responses often cannot be predicted from patient to patient. Such responses are predominantly, but not exclusively, directed against the constant region of the antibody molecule, and once they occur, they often impede or reduce the efficacy of any further therapy with that antibody or with another antibody of the same isotype.

Potentially, HAA problems can be avoided by the use of human monoclonal antibodies. This strategy, however, is affected by acetic, clan, and immunological limitations on the immunization of humans with many chosen antigens (e.g., human antigens, a phrase that includes antigenic or immunogenic portions of any protein, polypeptide, or its equivalent present in a human) for the generation of antibodies. Applicants' strategy to avoid this problem includes the generation of antibodies of the appropriate specificity and desired effector function and their use in the production of recombinant antibodies. These recombinant antibodies generally include an appropriate portion of the variable region of an antibody from an immunized monkey, and the constant region of an antibody from a human or chimpanzee. In this way, the specificities and high affinities of monoclonal antibodies are preserved, and the appropriate human or chimpanzee constant region exhibiting the desired effector functions can easily be chosen.

The present invention is further based on a method for the amplification of monkey immunoglobulin genes, for example, by the polymerase chain reaction (PCR), from RNA extracted from monkey lymphocytes using specific synthetic oligonucleotadic primers. heavy and light chain variable regioan gene families. The amplified genes or appropriate portions (for example, the complementarity determining regioan (CDR) - coding regions; see Winter, British Patent Application No. GB2188638A) are cloned into an expression vector containing a constant regioan gene of human or chimpanzee for the production of a recombinant monkey / human antibody. These antibodies represent immunotherapeutic agents capable of locating and / or destroying appropriate target cells (eg, tumor cells) after in vivo administration.

An antigen-recognizing portion of the variable region of a monkey antibody gene can be cloned to provide a nucleic acid, eg, monkey RNA, forming a cDNA for the RNA (using reverse transcriptase), providing a primer complementary to the RNA. cDNA sequence encoding a 5 'leader sequence of the antibody gene, contacting that cDNA and the primer to form a hybrid complex and amplifying the cDNA to produce a nucleic acid that encodes the variable region of the monkey antibody gene.

By "antibody-recognizing portion" is meant a portion of a variable region of a monkey antibody that is responsible for binding and / or recognition of the target antigen (or epatope or idiotype) of the antibody. For example, the integer variable region.

The expressions "variable region", "leader sequence", "constant region" and "structure" are used in the manner commonly recognized in the art, examples of which are provided later and in the technique cited above.

In preferred embodiments, the leader sequence is a human, chimpanzee, or monkey leader sequence of about 60 bases, examples of which are provided in FIG. 1.

Applicant has found that the monkey, chimpanzee and human variable region leader sequences are sufficiently similar that the primers constructed for one of them are suitable for amplification of the others. In the method, the RNA is amplified enough to produce enough nucleic acid to put that nucleic acid into a vector for subsequent cloning.

An antibody to a human antigen, which is not immunogenic in humans, can be produced by inducing a monkey antibody against human antigen in a monkey and isolating the monkey nucleic acid encoding an antigen-recognizing portion of a variable region of the antigen antibody. monkey. A human nucleic acid is provided which encodes a human constant region of an antibody and binds to the monkey nucleic acid to form a recombinant nucleic acid. This recombinant nucleic acid is then expressed to produce the desired antibody. Alternatively, a nucleic acid encoding the chimpanzee constant region can be used to form the recombinant antibody. There are few, if any, differences in the amino acid sequence of the human and chimpanzee constant regions (i.e., they are homologous), and the differences between humans and monkeys can be altered.

ES 2 196 002 T3 readily by conventional techniques if the nucleic acid encoding the monkey constant region is used to form a recombinant antibody. The only thing that is critical in the invention is that an antibody is produced that has less immunogenicity than the monkey constant region, so that a significant immune response does not occur when the recombinant antibody is introduced into a human. (In this document, such antibody regions are called homologous regions). In this way, the recombinant antibody is genetically engineered to be functionally the same as the human antibody in its amino acid sequence, that is, it has a constant region homologous to a human chimp antibody constant region. In summary, the antibody is as human an antibody as is necessary to reduce the likelihood of an unwanted immunological response against the antibody, and contains a binding portion to antigens of a monkey antibody.

By "non-immunogenic" is meant that the antibody does not induce an antibody response of sufficient magnitude to reduce the efficacy of continued antibody administration in most humans for a period of time sufficient to achieve therapeutic efficacy, for example. For example, compared to a murine or murinohuman chimeric antibody. Preferably, no antibody response is observed.

In preferred embodiments, the method includes immortalizing a monkey cell that is responsible for producing the monkey antibody, eg, by hybridoma fusion, herpes papian viral transformation, cloning of a single B cell (also called "transient immortalization" ), and production of a library of recombinant immunoglobulins. In other preferred embodiments, the method includes selecting a monkey B cell from peripheral blood leukocytes, the spleen, bone marrow, or a lymph node; selecting a clone that produces the appropriate antibody; rescuing the immunoglobulin genes encoding that antibody from the immortalized cell line; and re-expressing the genes in a producer cell line (ie, a cell line that causes sufficient production of the antibody useful for human therapy).

The invention relates to a recombinant antibody formed from a human or chimpanzee constant region and an antigen-recognizing portion of a monkey variable region.

The antibody of the invention may have an effector or reporter molecule attached to it. For example, an antibody of the invention may have a macrocycle, to chelate a heavy metal atom, or a toxin, such as ricin, bound thereto by a covalent bridging structure. Furthermore, the Fc fragment or the CH3 domain of a whole antibody molecule can be replaced by an enzyme or toxin molecule, and a part of the immunoglobulin chain can be linked with a polypeptide effect or reporter molecule. Bispecific antibodies can also be constructed by a conventional procedure.

In another aspect, the invention relates to pharmaceutical compositions in which antibodies of the present invention are provided for therapeutic or prophylactic uses. Such antibodies can also be provided as immunotoxins, that is, molecules that are characterized by two components and that are particularly useful for killing selected cells in vitro or in vivo. One component is a cytotaxic agent that is normally fatal to a cell when bound or absorbed. The second component, known as the "delivery vehicle" provides a means of delivering the toxic agent to a particular cell type, such as carcinoma cells. The two components are commonly chemically linked by any of a variety of well known genetic or chemical procedures. For example, when the cytotoxic agent is a protein and the second component is an intact immunoglobulin, binding can be accomplished by heterobifunctional crosslinks, eg, carbodiimide, glutaraldehyde, and the like. The production of various immunotoxins is well known in the art.

In another related aspect, the invention relates to a nucleic acid encoding a recombinant human / monkey antibody. In preferred embodiments, the nucleic acid encodes a human or chimpanzee constant region and an antigen-recognizing portion of the monkey variable region; and the nucleic acid is purified, that is, it is separated from the biological components with which it exists naturally, or more preferably it is provided as a homogeneous solution.

In a further aspect the invention relates to a method for treating a human having a particular antigen, for example one associated with a disease. The method includes administering a therapeutically effective amount of a recombinant antibody specific for the particular antigen, wherein the recombinant antibody is one having a human or chimpanzee constant region and an antigen-recognizing portion of a monkey variable region.

In preferred embodiments of the above aspects, the antigen is a tumor antigen, an antigen involved in an immune disorder, an antigen involved in an autoimmune response, a receptor expressed in a host cell, or an antigen selected from human antigens CD58, VLA4 , (integrin a4B1), CD2, LFA3, ELAM, LAM, CD25, CD4, CD19, CD20, human T cell receptor, CD3, CD8, CD23, CD41, CD44, CD45, CD71, TNFa, TNFe, Tn antigen, IL -1, IL-8, C5a, adhesion molecules, eg, VCAM, CD54, CD28, CD11a, CD11c, CD18 and CD11b, the product of the neu oncogene, MDR-1 (P-glycoprotein), TGFa and its receptor, and PDGF; and the recombinant antibody is active in reducing (destroying or eliminating) unwanted cells (eg, anti-CD4) through actuation with complement, or killer cells, or is active as a cytotaxic agent or in causing binding. to the Fc receptor by a phagocyte. Alternatively, the antibody blocks or stimulates functions

ES 2 196 002 T3 of the receptor or neutralizes soluble active products, such as one or more of the interleukins,

TNF and C5a.

In other aspects, the invention relates to pharmaceutical compositions of the above antibodies. The compositions or products according to the invention can conveniently be provided in the form of solutions suitable for parenteral, nasal or oral administration. Appropriate antibody preparations can be mixed with appropriate preparations of other agents, obtaining greater clinical utility.

Other features and advantages of the invention will be apparent from the following description of its preferred embodiments, and from the claims.

Description of preferred embodiments

The drawings will first be briefly described.

Drawings

FIG. 1 is a 20 codon table representation of nine different Ig heavy chain leader sequences and 10 monkey Ig heavy chain leader sequences;

FIG. 2 is a schematic representation of the structure of various Ig chains showing the relative position of the leader, variable and constant regions, with the positions of the restriction sites and the primers used for amplification;

FIG. 3 is a schematic representation of a heavy chain cassette vector for the expression of human or chimeric antibodies;

FIG. 4 is a schematic representation of a light chain cassette vector designed for the expression of human or chimeric antibodies;

FIGS. 5 and 6 are schematic representations of vectors designed for the expression of immunoglobulins from kappa or lambda light chain cDNA, respectively. In these vectors, the immunoglobulin genes are arranged in a tandem configuration using neomycin phosphotransferase as a selective marker;

FIGS. 7-1, 7-2, and 8 show the nucleic acid sequence of various leader sequence primers useful in the invention (these primers of FIG. 8 correspond to those listed in SEQ ID NO: 1-12 infra;

FIGS. 9A to 9H are comparisons of human and monkey regions in the sequences of VH1, VH2, VH3, VH4, and VH5, and in the sequences VKI and VKII, and VlambdaIII, respectively;

FIG. 10 is a comparison of human and monkey VH3 sequences, with a comparison to the human VH2 sequence;

FIG. 11 is a graphical representation of the binding of an antibody of the invention to a human CD4 antigen;

FIG. 12 is a graphical representation of the inhibition of 1F3 binding by the antibody shown in FIG. 10;

FIGS. 13 and 14 are portions of the nucleotide sequences of the antiCD4 VH and VL regions, respectively;

FIG. 15 is a graph showing anti-CD54 activity; and FIG. 16 is a histogram comparing the expression characteristics of plasmids.

Mono Antibodies

Old world monkeys include the so-called baboons and macaques (including the rhesus monkey and the cynomolgus monkey). This invention provides details of the use of the claimed invention with various monkey genes. These examples are not limiting of the invention and can be easily applied to other old world monkeys.

Referring to Fig. 2, the general structure of genes encoding immunoglobulin heavy chains, kappa light and lambda light chains is shown schematically. Each of these chains is formed with an ATG initiation elbow followed by a leader sequence of approximately 60 bases, a region that encodes a variable region of immunoglobulin, and a constant region of that immunoglobulin. In FIG. 1 Examples of different heavy chain leader sequences, or signal peptides, are shown. These sequences, and their mono equivalent, can be determined by standard techniques well known to one of ordinary skill in the art, and as described below.

The sequences shown in the lower portion of FIG. 1 are human leader sequences. Applicants have discovered that construction of primers complementary to these leader regions allows amplification of Ig genes from monkeys. Likewise, primers homologous to monkey leader sequences can be used (see, for example, top of FIG. 1) in the amplification of monkey immunoglobulin genes, and also for the amplification of human immunoglobulin genes.

Through the use of such primers in standard amplification procedures, genes encoding various monkey immunoglobulin genes can be easily isolated, and the sequences encoding the variable regions of antibodies can be determined. Examples of such procedures are provided below. The results of the analyzes provided below are presented in FIGS. 9A to 9H, and that in FIG. 10. Surprisingly, the Applicant discovered that, despite the ability to produce antibodies against relatively conserved human antigens in monkeys, the structural sequences of the variable region of the antibodies produced in this way could not be distinguished from those of human antibodies. That is, the amount of variability in the immunoglobulin sequence observed for monkeys was similar to that observed for humans, and it was impossible to determine which antibody came from a human or monkey without analyzing the source itself.

Thus, for example, in relation to FIG. 10, the amino acid sequence of the human VH3 region was compared to that of the monkey. Human antibodies showed a homology range between themselves of 83-98%, while monkey antibodies were 9095% homologous with the human VH3 region. In contrast, the human VH2 region was 60% homologous to human VH3. [In this drawing, like

ES 2 196 002 T3 than in the other drawings, the presence of the same amino acid at any location is shown by a dash, while the presence of a different amino acid is shown by a conventional letter code. Positions to which consensus amino acids cannot be assigned are shown as an X.] Also, homology for VH1, VH2, VH3, VH4 and VH5, and for VKI and VKII and Vlambda III is shown in FIGS. 9A9H, respectively. Once more, significant homology was observed between the monkey and human immunoglobulin regions in each variable region, including the sequences of the immunoglobulin J regions. Such high homology is similar to that observed among human antibodies.

Later, in the examples, the methodology by which the sequences were determined is presented. Those of ordinary skill in the art will recognize that these examples are not limiting on this invention and that equivalent results and monoclonal and chemoeric antibodies can be obtained by similar procedures well known to those of ordinary skill in the art. See, for example, US Patents 4,816,567; 4,978,745; 4,975,369; and 4,816,397, supra. For example, after a gene encoding a monkey variable region is cloned, such a gene is readily linked to one encoding a monkey or human constant region, and the fused genes are expressed in a producer cell line to produce the antibody. wanted. Examples of such procedures are provided below.

In the following examples, the first step of the method involves the isolation of total RNA from peripheral blood cells or monkey spleen cells. Immunized monkey B-cells can be obtained from peripheral blood or lymph nodes and can be used directly or preferentially expanded. Expansion may include transformation of herpes papian virus, fusion with a heteroologous myeloma cell with subsequent selection, or cloning of individual B cells under limiting dilution conditions in the presence of stimulated human T cells.

The total RNA is then converted to single-stranded (ss) cDNA by reverse transcriptase using non-specific (oligo-dT or random hexoamers) or specific (immunoglobulin CH1 or CK or Clambda constant region) primers. The single-stranded cDNA produced by this reaction is amplified using the polymerase chain reaction in which the ss cDNA, together with deoxynucleotide triphosphates, a DNA polymerase (e.g., a thermostable polymerase), and specific primers, are used to amplify genes of heavy or light chain variable region immunoglobulin. The primers used are single stranded synoetic oligonucleotides ranging from 20 to 40 bases, containing some degenerate bases that bind to the 5 'leader sequence of immunoglobulins. Six different 5 'leader sequence primers have been designed (see FIG. 7-1 incorporating a restriction enzyme site (eg, Salí) for amplification of monkey heavy chain variable region families based on their similarity to human heavy chain variable region gene families. With each of the six 5 'leader sequence primers, a specific 3' primer is used for the region constant domain of the relevant isotype (e.g., IgG, IgM, IgA, or IgE) that also incorporates a restriction enzyme site. (for example, Nheí). Also, for monkey kappa and lambda light chains, other primer pairs are used for amplification of the appropriate light chain variable region (Fig. 7-2).

Another set of primers can be used to incorporate different uonic restriction sites to allow directional cloning of the PCR amplified DNA into an appropriate expression vector possessing the same restriction site. A series of primers that bind to the 3 'end of the directing sequence of the antibody heavy chain that incorporates a MluI site can also be used, or a series of primers that bind to the first 23 bases of the structure, incorporating one of them an XhoI site, and are described in FIG. 7-1. Monkey immunoglobulin heavy and light chain variable region genes can be cloned into a shuttle vector directly after PCR amplification to allow additional molecular manipulations if necessary, or cloned directly into an expression vector containing constant region genes. human heavy or light chain. The molecular configuration of the immunoglobulin genes in the expression vector can be genoomic, in which immunoglobulin promoter / enhancer regions and other regulatory regions are present as well as donor / acceptor sequences at the introon / exoon junctions. Alternatively, chimeric immunoglobulin genes can be inserted into a cDNA setup using heteroologous viral promoter / enhancer sequences.

Example 1

Monkey Antibody Sequence

FIGS. 7 and 8 show the primers with or without restriction sites, respectively, used in the PCR amplification of immunoglobulin genes from monkey and / or human cDNA. Details of the procedures used are provided later. RNA was isolated from spleen cells, peripheral blood cells, and monkey lymph nodes using the standard guanidinium isothiocyanate method. Thereafter, the total RNA fraction isolated by this method was used as a template for subsequent amplification reactions. An aliquot of RNA was incubated in the presence of 200 units of Moloney murine leukemia virus reverse transcriptase and non-specific oligonucleotodic primers (random hexamer oligo-dTo) or specific (immunoglobulin IgG CH1 region or kappa chain constant CK region) (50-100picomoles) to generate a single strand of noncoding sense cDNA. The single-stranded cDNA produced by this reaction was then amplified using the polymerase chain reaction (PCR). An aliquot of the single-stranded cDNA was incubated together with deoxynucleootide triphosphates (20 μΜ), a thermostated DNA polymerase6

ES 2 196 002 T3 ble (2-5 units) and synthetic oligonucleotide primers derived from human (50 picomoles), to amplify heavy or light chain variable region immunoglobulin genes.

Using the primer pairs shown in FIG. 8, several representative cynomolgus immunoglobulin heavy and light chain variable region sequences were amplified from various gene families. These amplified sequences were cloned into the EcoRV site of the plasmid vector p-Bluescript (pBS, available from Stratagene, CA) and used to sequence the DNA. DNA sequencing was performed using the plasmed DNA containing the cloned insert as a double-stranded DNA template and the conventional chain-termination sequencing method.

Representative cynomolgus monkey immunoglobulin sequences are shown in FIGS 9A-9H. In FIGS. 9A-9H includes the consensus amino acid sequences for human variable region genes representing each of the major variable region gene families. The percentage homology of each of the monkey sequences with the human consensus sequence is shown, excluding the constant domain regions and the CDR regions. The level of homology between human and monkey sequences for a given family is as high as between two human sequences within that family. Therefore, it is impossible to distinguish between variable region immunoglobulin sequences from Old World monkeys and those from humans on the basis of sequence comparisons alone.

RNA isolation

Monkey antigen-specific B cells were obtained in several ways: by fusion of immunized monkey lymph node cells with the human heteromyeloma / ratane K5H6 / B5 fusion molecule cell line, and subsequently selecting the hybridoma lines, by virally transformed B cells, or by single cloning techniques In vitro B cell: In this last case, the growth of a single monkey B cell was supported in vitro by co-culture with human T cells that were stimulated by antibodies. A single B cell was placed in each well of a 96-well tissue culture plate with approximately 150,000 anti-CD3 stimulated mitomycin C-treated human T cells. After an incubation period of 2 weeks, the individual B cell expanded to at least 200 differentiated plasma cells. The culture supernatant from these wells was assayed for the presence of immunoglobulin by an ELISA technique using a goat anti-monkey immunoglobulin capture antibody.

Cells from antigen-specific virally transformed cells or hybridomas were grown to a sufficient number for RNA extraction. Wells from the in vitro B single cell cloning technique that were positive for immunoglobulin were removed, washed twice with cold phosphate buffered saline, pH 7.5, and centrifuged (1000 xg 10 minutes). The washed cells were suspended in 100 µ! of lysis solution (4 M guanidinium isothiocyanate, 25 mM sodium citrate, pH 7.0, 0.5% sodium sarcosine, 0.1 M 2-mercapto-ethanol). 100 μ! of 2M sodium acetate, pH 4.0 and mixed. The protein was removed by adding 100 μ! of phenol saturated with water, mixing and adding 20 μ! chloroform / isoamelic alcohol (49: 1). After vortexing and incubation on ice for 15 minutes, the samples were centrifuged at 10,000 xg for 20 minutes. The aqueous phase was transferred to a new tube, mixed with an equal volume of isopropanol and incubated for 1 hour at -20 C. The precipitate was collected by centrifugation at 10,000 xg for 15 minutes, washed with 70% ethanol, it was centrifuged again and the pellet was dried in a Speedivac (Savant). The dried RNA was redissolved a second time in 100 μ! lysis buffer. An equal volume of isopropanol was added and incubated at -20 ° C for one hour. The precipitate was collected by centrifugation at 10,000 xg for 15 minutes and washed with 70% ethanol. The sediment was dried in a Speedivac (Savant) and stored at -20^°Cenetanolal70% until use.

Synthesis of single-stranded cDNA

The total RNA extracted from the cells from a single well was dissolved in 32 μ! of doubly distilled water to which 1 μ! (50-100 picomoles) of primer (random hemeers, oligo dT or 3 'immunoglobulin specific primers) and 10 μ! of 5X reverse transcriptase buffer (0.25 Tris-HCl pH 8.3, 0.375 M KCl, 15 mM MgCl2, 50 mM dithiothreitol). The mixture heated up to 65^°C for 5 minutes, after which it was put on ice for 2 minutes. After heating, 1 µ! RNAsin (Promega), 5 μ! of deoxynucleotide triphosphates 5 mM and 1 μ! (200 units) of Moloney murine leukemia virus (BRL) reverse transcriptase, and the mixture was incubated at 37^°C for 1.5 hours. After completion of the reverse transcriptase reaction, the single-stranded cDNA / RNA mixture was phenol / chloroform extracted and passed through a 1 ml G-25 SEPHADEX rotary column. The material passed through this column was used as template ss cDNA for PCR amplification.

Amplification of ss cDNA

3-10 μ! ss cDNA with 10 μ! 10X PCR buffer (KCl 500 mM, Tris-HCl 100 mM pH 8.3, MgCl₂ 15 mM), 1.6 µ! of 1.25 mM deoxynucleotide triphosphates, 50 picomoles of specific immunoglobulin 5 'primer, 50 picomoles of specific immunoglobulin 3' primer and 2-5 units of thermostable DNA polymerase (Synthetic Genetics). The reaction volume was brought up to 100 µ! with water and covered with 100 μ! mineral oil. The reaction mixture was incubated at the following temperatures for the specified time periods.

94^°C for 1 minute 48^°C for 2 minutes 72^°C for 2 minutes.

This cycle was repeated 30-35 times. The amplified products were examined by agarose gel electrophoresis using an agarose gel.

ES 2 196 002 1.2% T3 and molecular weight standards. The amplified immunoglobulin variable region genes came out between markers of approximately 350-500 bp. The PCR amplified products were then used to be cloned into the appropriate plasmid vector.

Example 2

Cloning of Monkey Antibody Genes

As the monkey variable region gene sequences, at the cDNA level, cannot be distinguished from human members of the equivalent gene family, it is unlikely that the immune responses to monkey / human chemoeric antibodies, if any, will be different from those created. against human antibody molecules.

PCR technology can be used to introduce specific restriction enzyme sites, including (but not limited to) Salí, BglII, Kpnl and Nheí, into the old world variable region sequences during the PCR amplification reaction using primers based on the of FIG. 6. Pre-existing cloned genes were amplified from their specific vector using these primers to introduce the specific restriction site which was subsequently used to clone the gene into an expression vector. Alternatively, these primers were used for direct amplification from cellular RNA.

The expression vectors that have been constructed are of two types. The first (see FIGS. 3 and 4) allows cloned cDNA of monkey immunoglobulin variable regions to be inserted into a cassette vector, using uonic restriction sites, in which the immunoglobulin genic elements are arranged in a genoomic configuration. This type of vector incorporates an immunoglobulin promoter, the two exons that make up the immunoglobulin leader sequence, two SpeI and Nheí cloning sites, downstream splice donor sequences, an immunoglobulin enhancer region, a human constant region gene (heavy chain or light) and downstream polyadenylation signals. In addition, they include a bacterial origin of replication, a beta-lactamase gene for bacterial selection, and a neomycin phosphotransferase gene for G418 selection, or a xanthine-guanine phosphoribosyl transferase (gpt) gene for mycophenoolic acid selection in mammalian coells. The heavy and light chain expression vectors use neomycin phosphotransferase (Neo) and xanthine-guanine phosphoribosyl transferase (Gpt) genes respectively as a selective marker.

The second type of expression system (see Figures 5 and 6) uses immunoglobulin genes in a cDNA configuration. No introns or splice sites are present between the 5 'leader sequence and the 3' constant region sequences. This type of vector utilizes heteroologous enhancer / viral promoter sequences, targeting immunoglobulin heavy and light chain genes arranged in a tandem, polyadenylation sequences, and a selective mammalian cell marker (Neo). The Neo gene can be modified to weaken its translation, for example, by changing the codon upstream and adjacent to the gene initiation site from ACC to TCT. In addition, a dihydrofolate reductase (dhfr) gene was present for subsequent gene amplification with methotrexate. The monkey immunoglobulin variable region genes to be cloned into cDNA-configured expression vectors were amplified from pre-existing cloned sequences in the shuttle vector (PBS), or directly from RNA with primers containing the sites restriction Salí or Mluí and Nheí, for the heavy chain, or Bglíí and Kpní or BsiWí for kappa or lambda light chains. However, other potential uonic restriction sites are not excluded.

The chimeric heavy and light chain immunoglobulin genes were introduced separately or sequentially (for genoomically configured constructs), or into the same vector (for configured cDNA constructs), by electroporation into a producer cell line. Electroporation was used to introduce linearized DNA constructs into Chinese Hamster Ovary (CHO) cells or mouse myeloma cells, followed by single cell cloning of the transfectants into 96-well tissue culture plates. Electroporation conditions using a BTX-100 electroporation device (BTX, San Diego) and a 1 ml disposable plastic cuvette provided optimal numbers of transfectants from a given amount of vector DNA. In constructions containing viral regulatory elements, CHO cells were used that were adapted to grow in suspension in medium without serum (CHO-S SFM i minus hypoxanthine and thymidine, Gibco).

Subcloning of Ig variable region genes

The PCR reaction products were extracted with phenol / chloroform and passed through a 1 ml SEPHADEX G-25 rotary column. If the DNA fragment was to be cloned with blunt ends into a plasmid, 1 μl of 1 M MgCl2, 0.5 ml of 1.25 mM deoxynucleootide triphosphates and 1 μl of Klenow DNA polymerase (5 units) were added to the Total PCR reaction mix (100 µl) and the mix was incubated at 37 ° C for 15 minutes to fill in any 5 'overhang. Before blunt-ended cloning into a plaosmid, the 5 'ends were phosphorylated as follows; 5 µl of 10 mM ATP and 1 µl of T4 polynucleotide kinase (10 units) were added to the total reaction mixture and incubated at 37 ° C for 30 minutes. Amplified fragments containing internal restriction sites were first cut with the appropriate restriction enzyme and used directly for binding without phosphorylation. In both cases, the fragment to be cloned was phenol / chloroform extracted before binding to the appropriate vector.

For the binding reaction, 10% of the restriction enzyme-cut or phosphorylated PCR-amplified fragment was mixed with approximately 2 ng of the appropriate vector (total volume 8 μ ^, previously digested with the restriction enzyme (s). blunt end cloning, EcoRV digested pBluescript was used. For sticky end cloning, the vector TCAE 5.2 or 6.2 or pGenex-H was used

ES 2 196 002 T3 or pGenexL, cut with appropriate restriction enzymes. 1 μ was added! 10X binding buffer (500 mM Tri-HCl pH 7.6, 100 mM MgCl2,

10 mM ATP, 10 mM dithiothreitol), 1 μ! of T4 DNA ligase (1 unit), and the reaction was allowed to proceed at 14 ° C overnight. Bound material was used to transform competent E. coli HB101 cells using the standard calcium chloride transformation method. The transformed bacteria were selected by growth on agar plates containing ampicillin LB. Single colonies were picked and grown overnight in LB medium containing ampicillin and plasmodic DNA was extracted using the standard alkaline lysis method. After restriction analysis to determine clones containing immunoglobulin inserts, DNA for sequencing was prepared.

Cloned gene sequencing

Cloned immunoglobulin variable region genes were sequenced using a standard chain termination method. Double-stranded plasmodic DNA containing the cloned insert was used as the sequencing template. Before sequencing, the double-stranded DNA was chemically denatured. DNA was sequenced using T7 SEQUENASE DNA polymerase (United States Biochemical Corporation, Cleveland, OH), radiolabeled alpha deoxyATP, and the following sequencing primers: (5 'CAGAGCTGGGTACGTCCTCA 3') and (5 'GCCCCCAGAGGTGCTCTTGG 3') for variable region 3 '. immunoglobulin G heavy chain in the 5 'to 3' and 3 'to 5' directions respectively. (5 'CAGAGCTGGGTACGTGAACC 3') and (5 'GGCTTGAAGCTCCTCAGAGG 3') for the immunoglobulin lambda light chain variable region in the 5 'to 3' and 3 'to 5' directions, respectively. The reaction products were separated on 6% polyacrylamide gels and read.

The results of the sequencing of several old world monkey immunoglobulin heavy and light variable region genes are summarized in FIGS. 9A - 9H. The cloning and sequencing of immunoglobulin genes from cynomolgus monkeys has not been previously described in the literature. Therefore, it was also not possible to define the degree of homology between the human and cynomolgus monkey region V genes. The homology between a single chimpanzee variable lambda gene and its human genomic homolog has been described, showing a difference of only 2% in the structural regions. Transfection and selection

After sequencing cloned heavy and light chain variable region genes, they were subcloned into appropriate vectors for expression. AND^or These can be vectors constructed with immunoglobulin regulatory elements in a genoomic configuration (as shown in FIGS. 3 and 4), or with viral regulatory elements using a cDNA configuration (FIGS. 5 and 6). Appropriate restriction sites (Spel and Nhel) can be designed in the PCR amplification primers during the initial amplification step or, conversely, amplification primers containing restriction sites can be used to amplify immunoglobulin genes from the vectors. shuttle in which they have been cloned. Alternatively, immunoglobulin variable region genes can be cloned directly into expression vectors after PCR amplification from RNA, so that subcloning is not necessary. Electroporation

Electroporation was used to cotransfect genomic light and heavy chain constructs or sequentially transfect genomic light and heavy chain constructs into Sp2 / 0 cells. In sequential transfections, electroporation of the chimeric light chain construct was followed by selection in mycophenoolic acid. Selection of clone culture supernatants, grown in 96-well plates, for light chain production with antiserum against human light chain constant region using an ELISA technique, allowed the selection of clones with the highest chain expression. light. Subsequent electroporation of the light chain transfectants with a vector containing the monkey / human chimeric heavy chain immunoglobulin construct allowed the selection of transfectomas expressing chimeric antibody of the desired specificity and isotype.

The pGENX-L light chain construct (FIGS. 3 and 4) was used to transfect Sp2 / 0 murine myeloma cell line by electroporation as follows. SP2 / 0 cells were mixed at a concentration of 1 x 10⁷/ ml in transfection buffer (272 mM sucrose, 7 mM sodium phosphate pH 7.4, 1mM MgCl2) with 50 μg of pGENEX-L containing the appropriate cloned light chain gene, which had previously been linearized by digestion with the enzyme of PvulI restriction. Cells were placed in a 1 ml disposable plastic spectrophotometer cuvette and plate electrodes were inserted at a distance of 3.5 mm into the cuvette. Using a BTX100 transfection apparatus (BTX, Inc), the cells were pulsed with current for 500 microseconds such that approximately 50% of the cells were killed. This value was determined before transfection by pulsing the cells, in the absence of DNA, with increasing voltage and measuring the number of surviving cells 24 hours later. The voltage was plotted against cell viability and the voltage corresponding to 50% cell death was used for all subsequent electroporation experiments. Using the BTX-100 apparatus the optimal value was found to be a pulse at an amplitude of 200 for 500 microseconds. After pulsing the cells, they were allowed to recover on ice for 15 minutes before being transferred to 96-well tissue culture plates in Dulbecco's Modified Eagle's Medium (DMEM) containing 5% fetal calf serum. and 10% Sp2 / 0 conditioned medium. Cells were plated at a concentration at which cell growth was observed in approximately 1 of each

ES 2 196 002 T3 of the wells after selection with the appropriate drug. This parameter was determined for each electroporation experiment by culturing varying numbers of electroporated cells per well (1000-1000) and selecting cells that had incorporated the plaosmid. After 2-3 weeks of selection, the number of wells in each plate that showed cell growth was counted. In this way, the appropriate cell number that yielded 1 out of 3 positive wells was determined at a given concentration of a particular plasmid, for use in future experiments.

Directly after electroporation, the cells were placed in the medium without drug. Fresh medium was added two days after electroporation containing G418 or mycophenoolic acid for cells showing neomycin phosphotransferase activity or guanosine phosphotransferase activity, respectively. The cells were fed every other day for the first week and twice a week thereafter. The drug concentration to be used was determined by incubating the cells in the presence of increasing drug concentrations and monitoring cell viability. The drug concentration used was twice that which provided 100% destruction. For Sp2 / 0, approximately one microgram of microphenolic acid / ml was required and for G418 approximately 800 µg / ml was required.

Cells were electroporated in various ways, genomic light or heavy chain vectors (pGenex-H and pGenex-L) were co-electroporated, or light chain alone was electroporated. In the latter case, the clones were selected for high-level expression of the chimeric immunoglobulin light chain using an ELISA technique. These clones were then grown and electroporated with the vector containing the light chain. When genomic cDNA constructs were used in tandem, the expression vector (TCAE5.2 or TCAE6) was first linearized by digestion with the restriction enzyme Notí. A single electroporation was sufficient to achieve the integration of both heavy chain genes and light chain genes. After 2-3 weeks, the supernatants from the wells that continued to grow in the presence of the appropriate drug were assayed for secretion of the whole immunoglobulin or chimeric immunoglobulin light chain using an ELISA technique. Immunoglobulin genes in a cDNA configuration were electroporated into Sp2 / 0 cells, as described above, or Chinese hamster ovary (CHO) cells adapted to grow in suspension in serum-free medium. The CHO cells were subjected to electroporation using a BTX 600 electroporation apparatus, set to the conditions to achieve the highest number of colonies resistant to G418. These conditions were 210 volts, 400 μF, and 13 ohms. After electroporation, cells were counted, washed in transfection buffer, resuspended in the same buffer, and placed on ice for 15 minutes. Cells were adjusted to 1 x 10⁷ live cells / ml and 400 μ! of cell suspension in a sterile 0.4 ml disposable cuvette (BTX Inc.). 25 μg of Not 1 linearized TCAE 5.2 or TCAE 6 vector DNA, containing cloned macaque immunoglobulin variable region genes, was resuspended in TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) at 1 µg / ml and added to the cell suspension. Electroporation was performed by unloading the apparatus, using automatic charging and the pulse button. The cuvette was placed on ice for 15 minutes, the cells were diluted in 120 ml of serum-free medium and placed in six 96-well plates (200 µl per well containing approximately 6,667 electroporated cells or 3,333 live cells per well. ). For this cell line, independent electroporation parameters were established and the selection for G418 was carried out at 400 μg / ml.

Selection for antibody production

The presence of human, mono or chimeric antibodies secreted by transfectants was tested by an ELISA technique as follows: 96-well flat bottom platelets (Dynatech) were coated with goat anti-human IgG or kappa at 200 ng / well in coating buffer (0.8 mg / ml sodium carbonate, 1.55 mg / ml sodium bicarbonate, pH 9.6) and incubated for at least 16 hours at 4 ° C. The coating buffer was removed and the wells were blocked with 120 µ! of blocking buffer (1% bovine serum albumin in phosphate buffered saline containing 0.2% sodium azide) and incubated at 37^°C for 1 hour. Up to 125 µ was added! of cell culture supernatant to wells containing blocking buffer and incubated for 2 hours at 37^°C. The plates were then washed five times with PBS. 100 μ! horseradish peroxidase (or kappa) labeled goat anti-human IgG diluted 1: 1000-1: 5000 in dilution buffer (1% bovine serum albumin, 0.05% Tween-20, sodium azide 0.02% in PBS). Plates were incubated at 37^°C for 1 hour and then washed five times with PBS. The chimeric antibody was detected with 100 µ! of hydrogen peroxide and the substrate, 3,3 ', 5,5'-tetramethylbenzidine (1: 1 v / v) per well. The color reaction was terminated after 2 to 5 minutes with 100 µ! of 2M sulfuric acid per well.

Those of ordinary skill in the art can easily carry out methodologies equivalent to those described above. Examples of such technology include immortalization of selected B cells by hybridoma fusion, as described above, with the K5H6 / B5 cell line described by Carroll et al., 164 J. Experimental Medicine 1566, 1986, or an equivalent cell line. , such as SPAZ4 (available from Sandoz, see, Ehrlich et al., 34 Clin. Chem. 1681, 1988). Similar cell lines can be easily constructed by conventional techniques using publicly available methodology. Alternatively, immunoglobulin genes can be selected from: (a) cells immortalized by viral transformation with Herpes papio, as described by Markova et al., 30 Vopr

ES 2 196 002 T3

Virusol 549, 1985, or with an equivalent virus, (b) by cloning a single B cell to provide transient immortalization, as described by Amaroso and Lipske 145 J. Immunology 3155, 1990, or (c) by using recombinant immunoglobulin bacterioephage libraries, as described by Huse et al., 246 Science 1275, 1989 and McCafferty et al., 348 Nature 552, 1990. Selection of clones containing the appropriate antibodies can be accomplished by the techniques described above, or by equivalent techniques well known to those of ordinary skill in the art, and the desired immunoglobulin gene can be rescued from the immortalized cell line. Furthermore, the antibody produced by isolated monkey B cells can be used in human therapy, without manipulation to form a chimeric antibody.

The human region constant can be obtained by conventional techniques, with any desired isotype well known to those of ordinary skill in the art, and the variable region of a monkey antibody can be bound to the human region constant. Particularly useful chimeric antibodies against specific cell surface receptors that can be used in human immunotherapy include CD4, ICAM, CD19, CD20, CD8, CD11a, CD11b, CD28, CD18, CD45, CD71, and TCR. Example 3

Cloning and Expression of a Monkey / Human Chimeric Antibody with Specificity for

CD4

A specific example of the methods and antibodies of this invention is provided below.

Generation of Mono Immortalized B Cell Lines

An adult cynomolgus monkey (White Sands New Mexico Primate Center) was immunized intramuscularly, at multiple sites, with 150-300 μg of soluble CD4 (sCD4) or cell membranes (1 x 10⁸ cells) derived from the supT1 positive CD4 cell line using a conventional adjuvant. The immunization was repeated every 2-3 weeks for a total of six times. The monkey was boosted by injecting 100 µg of sCD4 into the inguinal region of one thigh, and a week later the draining lymph node was surgically removed from the same thigh. Lymphocytes were removed from the lymph node by cutting the tissue and rinsing with sterile DMEM medium. The cell suspension was passed through nylon gauze and collected by centrifugation at 1000 xg for 10 minutes.

Approximately 1 x 10 were suspended⁸ lymphocytes in Tris-ammonium chloride buffer (16 mM, pH 7.5) and heated at 37 ° C for 5 minutes to lyse erythrocytes. Lymphocytes were collected by centrifugation and resuspended in L-leucine methyl ether (LME) and incubated at 37 ° C for 45 minutes. The LME-treated cells were filtered through a nylon screen and centrifuged. 1 ml of fetal calf serum was added, cells were suspended and washed twice in RPMI without serum. Cells were counted and mixed in a single 50 ml coenic centrifuge tube along with an equal number of K6H6 / B5 heteromyeloma cells, pre-washed twice in serum-free medium. The cells were gently suspended in 1 ml of 50% PEG (polyethylene glycol) added slowly with gentle shaking over a period of 1 minute. The cells were then resuspended by adding 20 ml of serum-free medium for a period of 5 minutes, with gentle mixing to dilute the PEG. After washing twice with serum-free medium, the cells were resuspended at a concentration of 5 x 10⁵/ 0.1 ml in RPMI medium, containing 20% ​​fetal calf serum and gentamicin, and placed in 96-well tissue culture microplates at 0.1 ml per well. An equal volume of HAT medium (0.1 ml) was added to each well and the hybrids were allowed to grow for 14-17 days after selection.

Selection of Fused Cell Hybrids for Anti-CD4 Production

The assay to determine anti-CD4 specificity was as follows: ELISA plates were coated with recombinant sCD4 at a concentration of 100 ng per well and blocked with 1% bovine serum albumin in PBS. Aliquots of 50 µl were withdrawn! of hybridoma supernatant from each of the wells and allowed to incubate with the sCD4-coated plates for 60 minutes. The binding was detected by incubation with goat anti-monkey or goat anti-human Ig labeled with¹²⁵I for 60 minutes. After washing four times with distilled water, the wells were counted in a gamma counter. Positive wells were retested in duplicate and hybridoma cells from those wells were subcloned three times, first at 5 cells per well, and then twice at one cell per well. At this stage, anti-sCD4 positives were screened for the ability to bind to cell surface CD4. This was done by inhibiting the binding of a murine anti-CD4 monoclonal, called 1F3, with the supT1 positive CD4 cell line. In summary, this was done by co-incubating different amounts of monkey anti-CD4 and 10 ng of 1F3 labeled with¹²⁵I with 3 x 10⁵ supT1 cells / well in a 96-well plate. After incubating for 1 hour at room temperature (approximately 20-25 ° C), the cells were removed under vacuum on glass fiber filters. After extensive washing with PBS, the filters were counted in a gamma counter to determine the inhibition of 1F3 binding to supT1 cells by the monkey hybridoma supernatants.

A candidate clone was chosen that produced an antibody showing strong inhibition against 1F3. The clone we chose was isotyped using human isotyping reagents and was found to be an IgG2 possessing a lambda light chain. This cell line developed to higher numbers for the cloning of its immunoglobulin genes.

Cloning of Light and Heavy Chain Region Variable Genes from Immortalized B Cells of Monkeys

Total RNA was isolated from 1 x 10⁷ cells

ES 2 196 002 T3

B immortalized monkeys using the guanidinium isothiocyanate method described above. One tenth of the total RNA was used to obtain single stranded cDNA using an oligo-DT oligonucleotodic primer and reverse transcriptase, also as described above. One-tenth the amount of ss cDNA was used to set up the PCR reactions. Each of the six PCR reactions included one of six specific oligonucleotide primers of the 5 'VH family that contained a Sal I restriction site along with an IgG 3' constant region oligonucleotide that contained a Nhe I site, both shown in Figure 7-1. Likewise, five PCR reactions were performed, using one of five 5 'lambda leader oligonucleotodic primers containing a Bgl II site and a 3' lambda constant region primer containing an Avr II site. The reaction conditions were as described above. Each PCR reaction was performed in triplicate. The products of each of the heavy and light chain amplification reactions were run on 1.2% agarose gels. The VH4 heavy chain primer (SEQ ID, N^°: 13: 5 'ACTAAGTCGACATGAAACACCTGTGGTTCTT 3') and the lambda primer (SEQ ID, N^°: 14: (5 'ATCACAGATCTCTCACCATGACCTGCTCCCCTCTCCTCC 3') provided strong bands on agarose gel electrophoresis. The products of these reactions were used to be cloned into the TCAE 6 vector, which contains human lambda and human IgG1 constant region sequences.

The cloning of the two genes of variable region in the expression vector TCAE 6 were carried out sequentially. First, the heavy chain PCR product and TCAE 6 vector were digested with the restriction enzymes Sal I and Nhe I, the products were phenol / chloroform extracted and passed through a SEPHADEX G-25 rotary column. The PCR product was bound to the cut vector overnight at 14^°C in the presence of T4 DNA ligase. Approximately 500 mg of total DNA was bound in a volume of 10 µ! with an insert / vector molar ratio of 10: 1. Bound material was used to transform competent XL-1 Blue cells (Stratagene) and transformed cells were plated on LB agar plates containing 500 µg / ml ampicillin. Colonies of ampicillin resistant bacteria were selected and grown as 5 ml mini cultures. Plasmodic DNA was extracted from each of these cultures by a conventional alkaline lysis method cutting with the restriction enzymes Sal I and Nhe I, and the products were processed on a 1.2% agarose gel. Plasmids with inserts of approximately 450 bp were used as templates for the subsequent cloning of light chain variable regions. The light chain PCR reaction products as well as the plasmid containing the heavy chain insert were cut with the restriction enzymes Bgl II and Avr II and joined together. Plasmid minicultures were selected by cutting with Bgl II and Avr II. Digestions that provided an insert of approximately 400-450 bp were considered positive. Plasmids containing both Sal I / Nhe I inserts and Bgl II / Avr II inserts were grown in larger quantities for DNA sequencing.

The TCAE 5.2 and TCAE 6 toandem chimeric antibody expression vectors were derived from the CLDN vector, which is a derivative of the RLDN10b vector (253 Science 77-79, 1991). In turn, RLDN10b is a derivative of the TND expression vector (7 DNA 651-661, 1988).

RLDN10b differs from the TND vector in the following ways. The dihydrofolate reductase (DHFR) transcriptional cassette (promoter, cDNA and polyadenylation region) was placed between the tissue plasminogen activating cassette (t-Pa expression cassette) and the neomycin phosphotransferase (NEO) cassette, so that the three cassettes are in tandem and in the same transcriptional orientation. Furthermore, the DHFR gene promoter in CLDN has been replaced by the major mouse beta globin promoter (3 Mol. Cell Biol. 1246-54, 1983) and the t-PA cDNA has been replaced by a polylinker. The three eukaryotic transcriptional cassettes (Expression, DHFR, NEO) can be separated from bacterial plasmid DNA (derived from pUC9) by digestion with the restriction endonuclease Not I.

CLDN differs from RLDN10b in that the Rous LTR in front of the polylinker has been replaced by the promoter enhancer of the human cytomegalovirus immediate early gene (41 Cell, 521, 1985).

The expression vectors TCAE 5.2 and TCA 6 differ from CLDN in that:

1) contain four transcriptional cassettes (instead of three), in tandem order:

(a) A human immunoglobulin light chain constant region obtained by amplification of cDNA by a polymerase chain reaction. In TCAE 5.2, this is the human immunoglobulin light chain kappa constant region (Kabat amino acid numbering 108-214, allotype Km3), and in TCAE 6 the human immunoglobulin light chain lambda constant region (Kabat amino acid numbering 108-215, genotype Oz minus, Mcg minus, allotype Ke minus) (b) A human immunoglobulin heavy chain constant region; In both constructions, the human immunoglobulin heavy chain was a gamma 1 constant region (Kabat amino acid number 114-478, Gm1a allotype, Gm1z), which was obtained by amplification of cDNA by a polymerase chain reaction.

(c) DHFR; containing its own eukaryotic promoter and polyadenylation region.

(d) NEO; which also contain their own eukaryotic promoter and polyadenylation region.

3) Human immunoglobulin heavy and light chain cassettes contain synthetic signal sequences for the secretion of immunoglobulin chains.

4) Human immunoglobulin heavy and light chain cassettes contain specific DNA linkers that allow insertion of re12

ES 2 196 002 T3 variable gions of light and heavy immunoglobulin that maintain the translational reading frame and do not alter the amino acids normally found in immunoglobulin chains. The incorporation of the changes described, led to the construction of the vectors TCA 5.2 and TCA 6. Cloning of the immunoglobulin heavy and light chain variable region genes, from the anti-CD4 E9.1 heterohybridoma cell line, into TCAE 6 led to the construction that is deposited in the ATCC. The construct, which has been deposited, contains the cynomolgus monkey immunoglobulin heavy chain variable region and the cynomolgus monkey immunoglobulin light chain variable region, the sequences of which are shown in Figures 13 and 14 respectively, cloned from the lones of anti-CD4 E9.1 hybridoma cells. The heavy chain constant region is of human origin of the gamma 1 isotype and of the Gmla, Gmlz allotype. The lambda light chain constant region is also of human origin, of genotype Oz minus, mcg minus and allotype Ke minus. The immunoglobulin genes are cloned into the mammalian expression vector TCAE 6, shown in Figure 6, which, when electroporated into the line of mammalian CHO cells produced a monkey / human anti-CD4 chimeric antibody. The DNA construct described in this document has been used to transform the bacterial strain XL-1 Blue, selected on the antibiotic ampicillin and deposited as a suspension of bacterial cells in sterile LB medium containing 15% glycerol.

Another useful expression system is one in which the gene encoding a selective marker is modified to enhance the performance of recombinant systems encoding a desired sequence. For example, altering the onset of translation of a dominant selective marker produces fewer drug-resistant colonies compared to the unaltered vector, but each individual colony expresses significantly higher levels of bound genic product than in the unaltered vector. For example, the initiation of translation is the first stage in proteon synthesis. The translation start site of the neomycin phosphotransferase gene (G418 resistance gene) was changed from a consensus Kozak sequence (ccAccATGG sequence) to a deficient Kozak sequence (ccTccATGC-sequence). The alteration of the beginning of the translation of the resistance gene to G418 resulted in: 1) a significant reduction (5 times) of the number of colonies resistant to G418 obtained from the same amount of plasmodic DNA transfected per cell, and 2) a significant increase in the amount of bound product gene expressed in each clone. In clones containing the Kozak consensus sequence, 73% of the selected colonies produced less than 25 ng / ml, producing only 3% more than 100 ng / ml. For clones with the altered most deficient Kozak sequence, 8% of the selected colonies produced less than 25 ng / ml, compared to 63% of the colonies that produced more than 100 ng / ml. Specifically, referring to Fig. 16 (where TCAE 5.2 has a consensus Kozak sequence and TCAE 12 has a deficient Kozak sequence), 258 colonies were obtained from two electroporations of 25 mg of DNA containing a neomycin phosphotransferase gene with a consensus translation start site. (invariable). 201 of these colonies (78%) did not express any detectable genic product (ie, <25 ng / ml chimeric immunoglobulin), and only 8 colonies (3%) expressed more than 100 ng / ml. 98 colonies were obtained from 6 electroporations of 25 µg of DNA containing the neomycin phosphotransferase gene with an altered translation start site. 63% of these colonies were expressing more than 100 ng / ml, and only 8% of these colonies expressed less than 25 ng / ml.

DNA sequencing

Plasmodic DNA was prepared from 100 ml cultures. It was further purified by precipitation (1 volume) with a mixture of 2.5 M sodium chloride and 20% polyethylene glycol (6 volumes) on ice for 15 minutes. After centrifugation at 10,000 xg for 20 minutes, the pellet was washed with 70% ethanol, recentrifuged and dried in a Speedivac (Savant). The DNA pellet was resuspended in deionized water at a concentration of 150-250 µg / ml. Sequencing was performed on 5 µg of double-stranded DNA using the Sanger technique. Sequencing primers were used that were homoologous to sequences within the expression vector upstream and downstream of the light chain or heavy chain inserts. The inserts were sequenced in both the 5 'to 3' direction and the 3 'to 5' direction. Two anti-CD4 light chain clones and two anti-CD4 heavy chain clones, each generated from separate PCR reactions, were sequenced in parallel to determine whether any nucleotide change had been introduced during the PCR reaction. The two heavy chain clones and the two chosen light chain clones were found to be identical throughout their length, confirming that no errors had been introduced during the amplification process. The sequence of the anti-CD4 heavy and light chains are shown in Figures 13 and 14 and in the Sequence List numbering: 15 and 16.

Monkey / Human Chimeric Anti-CD4 Expression

The expression vectors TCAE 5.2 and TCAE 6 can not only be used for stable integrated expression in the cell lines Sp2 / 0 and CHO but, as they include the SV40 origin, they can also be expressed transiently in the cell line COS. The expression of the COS cells was carried out as follows: COS cells were seeded one day before transfection so that they had a confluence of 50-70% the next day. The culture medium was removed and the cells were washed twice with transfection buffer (TB - 140 mM NaCl, 25 mM Tris, 5 mM KCl, 0.5 mM Na2HPO4, 1mM MgCl2, CaCl₂ 1 mM). 30 μg of cesium chloride-purified TCAE 6 plasmid containing anti-CD4 monkey / human chimeric heavy and light immunoglobulin chains were mixed with

ES 2 196 002 T3 ml DEAE dextran per plate (1 mg / ml in TB). The DNA was allowed to incubate with the cells for 1 hour at 37 ° C. The DNA solution was removed and replaced with 3 ml of 20% glycerol for 1.5-2.5 minutes, after which the cells were washed twice with TB. The cells were incubated in 5 ml of fresh medium containing 100 µΜ chloroquine for 3-5 hours at 37 ° C, after which they were washed twice with medium and incubated with normal DMEM for 72 hours. The supernatant (100 µΐ) of the transfected COS cells was tested at various dilutions for the presence of antibody by an ELISA-based technique. Goat anti-human lambda was used to coat 96-well assay plates and a peroxidase-labeled goat anti-human IgG as the detection antibody, under standard ELISA conditions. COS cells were found to produce between 10 and 40 ng / ml of monkey / human chimeric antibody. 10-fold higher volumes of supernatant were concentrated and used in a direct binding RIA to supT1 CD4 positive cells. As positive and negative controls, respectively (Fig. 11), the parental whole monkey antibody and an irrelevant human immunoglobulin were used. In addition, monkey anti-CD4 and monkey / human chimeric antiCD4 were used to inhibit the binding of a high affinity mouse anti-CD4 (1F3) antibody (Fig. 12). It can be seen that the recombinant monkey / human antibody not only binds to CD4 positive cells, but is capable of inhibiting the binding of 1F3 to CD4 positive cells at approximately the same concentrations of either fully monkey or 1F3 itself.

An example of the methods and antibodies of this invention is presented below. Example 4

Generation of Monkey Antibodies Against Human Lymphocyte Antigens

An adult cynomolgus monkey (White Sands New Mexico Primate Center) was immunized intramuscularly, at multiple sites, with 5 x 10 ⁸ whole human CD54 positive lymphocytes. As an alternative, the cells used were SB cells (human B lymphoid lone) and activated human peripheral lymphocytes, activated by preincubation with a mixture of Phytolacca americana mitogen (2.5 mg / ml), phorbol monoacetate (40 nM) and phytohemagglutinin. (4 mg / well) with the inclusion of a conventional adjuvant. Immunization was repeated every 2-3 weeks for a period of 8 months. Sera from immunized animals were selected at various times for inhibition of the binding of a murine antibody, 84H10, which is known to bind ICAM1. A saturated amount of 84H10 was bound to Chinese hamster ovary (CHO) cells, previously transfected with an expression vector containing human CD54 c-DNA and selected for high cell surface expression of CD54, along with dilutions. monkey serum crescents. In FIG. fifteen 84H10 binding inhibition is shown.

Other murine monoclonal antibodies that recognize other human lymphocyte antigens were tested for inhibition using monkey serum obtained by the same immunization methods.

Use

Antibodies produced in the manner described above, or by equivalent techniques, can be purified by a combination of affinity chromatography and molecular exclusion for characterization in functional biological assays. These tests include the determination of specificity and binding affinity, as well as the effector function associated with the expressed isotype, eg, ADCC, or complement fixation. Such antibodies can be used as passive or active therapeutic agents against various human diseases, including B cell lymphoma, infectious diseases including AIDS, autoimmune and inflammatory diseases, and transplantation. Antibodies can be used in their native form, or as part of an antibody / chelate, antibody / drug, or antibody / toxin complex. Furthermore, whole antibodies can be used as imaging reagents or as potential vaccines or immunogens in an active immunotherapy for the generation of anti-idiotopic responses.

The amount of antibody useful to produce a therapeutic effect can be determined by standard techniques well known to those of ordinary skill in the art. Antibodies are generally provided by standard techniques within a pharmacoeutically acceptable buffer, and can be administered by any desired route. Due to the efficacy of the antibodies claimed herein and their tolerance by humans, it is possible to administer these antibodies repeatedly to combat various diseases or disease states within a human.

The recombinant anti-CD4 antibodies of this invention are also useful to induce immunosuppression, that is, to induce a suppression of the immune system of a human or an animal. Therefore, this invention refers to a method to induce immunosuppression prophylactically or therapeutically in a human being or in another animal that needs it, by means of the administration of an effective and non-toxic amount of such antibody of this invention to said be human or animal.

The ability of the compounds of this invention to induce immunosuppression can be demonstrated in conventional assays used for this purpose, for example, a mixed lymphocyte reaction assay or an assay that measures inhibition of T cell proliferation as measured by uptake of thymidine.

The fact that the antibodies of this invention have utility in the induction of immunosuppression means that they are useful in the treatment or prevention of resistance or rejection of transplanted organs or tissues (for example, kidney, heart, lung, bone marrow, skin , cornea etc); the treatment or prevention of autoimmune, inflammatory, proliferative and hyperproliferative diseases, and of cutaneous manifestations of diseases treated with drugs that affect the immune system (for example, rheumatoid arthritis, lupus erythema14

ES 2 196 002 T3 cough, systemic lupus erythematosus, Hashimoto's thyroiditis, multiple sclerosis, myasthenia gravis, type 1 diabetes, uveatis, nephraotic syndrome, psoriasis, atopic dermatitis, contact dermatitis and also eczematous dermatitis, seborrheic dermatitis, seborrheic dermatitis, sebum dermatitis pamphigus, bullous pemphigus, bullous epidermolysis, urticaria, angioedema, vasculitis, erythema, cutaneous eosinophilia, alopecia areata, etc); the treatment of reversible obstructive airway diseases, intestinal inflammations, and allergies (eg, celiac disease, proctitis, eosinophilia, gastroenteritis, mastocytosis, Crohn's disease, and ulcerative colitis) and food-related allergies (eg, migraine, rhinitis and eczema).

One skilled in the art will be able, through routine experimentation, to determine the effective and non-toxic amount of antibody for the purpose of inducing immunosuppression. However, in general, an effective dosage will be in the range of about 0.05 to 100 mg per kg of body weight per day.

The antibodies of this invention will also be useful for treating tumors in a mother. More specifically, they will be useful in reducing tumor size, inhibiting tumor growth, and / or prolonging the survival time of tumor-bearing animals. Accordingly, this invention also relates to a method of treating tumors in a human or other animal by administering to said human or animal an effective and non-toxic amount of an antibody. One skilled in the art will be able, through routine experimentation, to determine the effective and non-toxic amount of antibody necessary for the purpose of treating carcinogenic tumors. However, in general, an effective dosage is expected to be in the range of about 0.05 to 100 milligrams per kilogram of body weight per day.

The antibodies of the invention can be administered to a human or other animal according to the aforementioned treatment methods in an amount sufficient to produce such an effect to a therapeutic or prophylactic degree. Such antibodies of the invention can be administered to said human or other animal in a conventional dosage form prepared by combining the antibody of the invention with a conventional pharmaceutically acceptable carrier or diluent or according to known techniques. One skilled in the art will recognize that the shape and character of the pharmaceutically acceptable carrier or diluent is dictated by the amount of active ingredient with which it is combined, the route of administration, and other well-known variables.

The route of administration of the antibody of the invention can be oral, parenteral, by inhalation or topical. The term parenteral, as used herein, includes intravenous, intramuscular, subcutaneous, rectal, vaginal, or intraperitoneal administration. The subcutaneous and intramuscular forms of parenteral administration are generally preferred.

Daily oral and parenteral dosage regimens for employing the compounds of the invention to prophylactically or therapeutically induce immunosuppression, or to treat carcinogenic tumors, will generally be in the range of about 0.05 to 100, but preferably about 0.5 to 10 milligrams per kilogram of body weight per day.

The antibody of the invention can also be administered by inhalation. By "inhalation" is meant administration by intranasal and oral inhalation. Appropriate dosage forms for such administration, such as an aerosol formulation or a metered dose inhaler, can be prepared by conventional techniques. The preferred dosage amount of a compound of the invention to be employed generally is within the range of about 10 to 100 milligrams.

The antibody of the invention can also be administered topically. By topical administration is understood the non-systemic administration and includes the application of an antibody compound of the invention externally in the epidermis or in the oral cavity and the instillation of such antibody in the ear, eye and nose, and where it does not enter significantly into the blood stream. By systemic administration is meant oral, intravenous, intraperitoneal and intramuscular administration. The amount of an antibody necessary to achieve a therapeutic or prophylactic effect will, of course, vary with the antibody chosen, the nature and severity of the condition being treated and the animal undergoing treatment, and will ultimately be at the discretion of the physician. A suitable topical dose of an antibody of the invention will generally be within the range of about 1 to 100 milligrams per kilogram of body weight per day.

Formulations

Although it is possible for an antibody to be administered alone, it is preferable to present it as a pharmaceutical formulation. The active ingredient may constitute, for topical administration, from 0.001% to 10% w / w, for example, from 1% to 2% by weight of the formulation, although it may comprise up to 10% w / w , but preferably not more than 5% w / w and more preferably 0.1% to 1% w / w of the formulation.

The topical formulations of the present invention comprise an active ingredient together with one or more acceptable carriers therefor and optionally any other therapeutic ingredient. The carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not detrimental to the recipient thereof.

Formulations suitable for topical administration include liquid or semi-liquid preparations suitable for penetration through the skin to the site where treatment is required, such as liniments, lotions, creams, ointments or pastes, and drops suitable for administration in the eye, ear or nose.

Drops according to the present invention may comprise sterile aqueous or oily solutions or suspensions and may be prepared by dissolving the active ingredient in a suitable aqueous solution of a bacterial agent.

ES 2 196 002 T3 ricide and / or fungicide and / or any other suitable preservative, and preferably including a surfactant. The resulting solution can then be clarified by filtration, transferred to a suitable container which is then hermetically sealed and sterilized by autoclaving or holding at 90-100 ° C for half an hour. Alternatively, the solution can be sterilized by filtration and transferred to the container by aseptic technique. Examples of suitable bactericidal and fungicidal agents for droplet inclusions are phenylmerquaric nitrate or acetate (0.002%), benzalkonium chloride (0.01%), and chlorhexidine acetate (0.01%). Suitable solvents for the preparation of an oily solution include glycerol, dilute alcohol, and propylene glycol.

Lotions according to the present invention include those suitable for application to the skin or the eyes. An ophthalmic lotion may comprise a sterile aqueous solution optionally containing a bactericide and may be prepared by methods similar to those for the preparation of drops. Lotions or liniments for application to the skin may also include an agent to accelerate drying and cool the skin, such as an alcohol or acetone, and / or a moisturizer such as glycerol or an oil such as castor oil or oil. arachis.

Creams, ointments or pastes according to the present invention are semi-solid formulations of the active ingredient for external application. They can be obtained by mixing the active ingredient in finely divided or powder form, alone or in solution or suspension in an aqueous or non-aqueous fluid, with the aid of suitable machinery, with a fat or non-fat base. The base can comprise hydrocarbons such as hard, soft or liquid paraffin, glycerol, beeswax, a metallic soap; a mucilage; an oil of natural origin such as almond, corn, arachis, castor or olive oil; wool fat or its derivatives, or a fatty acid such as steaaric or oleic acid together with an alcohol such as propylene glycol or macrogols. The formulation may incorporate any suitable surfactant such as an anionic, cationic or non-ionic surfactant, such as sorbitan asters or polyoxyethylene derivatives thereof. Suspending agents such as natural gums, cellulose derivatives or inorganic materials such as siliceous salices and other ingredients such as lanolin can also be included.

One skilled in the art will recognize that the optimal amount and spacing of individual dosages of an antibody or fragment thereof of the invention will be determined by the nature and degree of the condition to be treated, the form, route and site of administration. , and the particular animal being treated, and that such optimal amounts can be determined by conventional techniques. It will also be appreciated by one of ordinary skill in the art that the optimal course of treatment, that is, the number of doses of an antibody of the invention administered per day for a defined number of days, can be ascertained by those skilled in the art using dose assays. determination of the conventional course of treatment.

It is believed that one skilled in the art can, without further elaboration, using the above description, utilize the present invention to its fullest extent. Therefore, the following examples should be considered merely illustrative examples and not limiting the scope of the present invention in any way.

Composition of Capsules

A pharmaceutical composition of this invention is prepared in the form of a capsule by filling a conventional two-piece hard gelatin capsule with 50 mg of an antibody of the invention, in powder form, 100 mg of lactose, 32 mg of talc and 8 mg. magnesium stearate. Injectable Parenteral Composition

A pharmaceutical composition of this invention is prepared in a form suitable for administration by injection by shaking 1.5% by weight of an antibody of the invention in 10% by volume of propylene glycol and water. The solution is sterilized by filtration.

Pomade composition

Antibody of the invention 1.0 g.

White soft paraffin up to 100.0 g.

The antibody of the invention is dispersed in a small volume of the vehicle to produce a uniform homogeneous product. Pressable metal tubes are then filled with dispersioan.

Topical Cream Composition

Antibody of the invention 1.0 g.

Polawax GP 200 20.0 g.

Anhydrous lanolin 2.0 g.

2.5 g white beeswax.

Methyl hydroxybenzoate 0.1 g.

Distilled water up to 100.0 g.

Polawax, beeswax and lanolin are heated together to 60 ° C. A methyl hydroxybenzoate solution is added and homogenization is achieved using high speed stirring. Then the temperature is allowed to drop to 50^°C. The antibody of the invention is then added and dispersed thoroughly, and the composition is allowed to cool with low speed agitation.

Composicioón by Locioón Tóopica

Antibody of the invention 1.0 g.

Sorbitan monolaurate 0.6 g.

Polysorbate 20 0.6 g.

Cetostearic alcohol 1.2 g.

Glycerin 6.0 g.

Methyl hydroxybenzoate 0.2 g.

Purified water BP up to 100.00 ml (BP = British Pharmacopoeia)

Methyl hydroxybenzoate and glycerin are dissolved in 70 ml of the water at 75^°C. Sorbitan monolaurate, polysorbate 20, and cetosteralic alcohol all melt together at 75^°Cy are added to the aqueous solution. The resulting emulsion is homogenized, allowed to cool with continuous stirring, and the antibody of the invention is added as a suspension in the remaining water. The entire suspension is stirred until homogenized.

Composition of Ophthalmic Drops

Antibody of the invention 0.5 g.

ES 2 196 002 T3

Methyl hydroxybenzoate 0.01 g.

Propyl hydroxybenzoate 0.04 g.

Purified water BP up to 100.00 ml.

The methyl and propyl hydroxybenzoates are dissolved in 70 ml of purified water at 75^°C and the resulting solution is allowed to cool. The antibody or its fragment of the invention is then added and the solution is sterilized by filtration through a membrane filter (pore size 0.022 µm) and aseptically packed in suitable sterile containers. Composition for Administration by Inhalation

For an aerosol container with a capacity of 15-20 ml: mix 10 mg of an antibody of the invention with 0.2-0.5% of a lubricating agent, such as polysorbate 85 or oleic acid, and disperse such mixture in a propellant such as freon, preferably in a combination of (1,2-dichlorotetrafluoroethane) and difluorochloromethane and put in an appropriate aerosol container adapted for administration by intranasal or oral inhalation.

Composition for Administration by Inhalation

For an aerosol container with a capacity of 15-20 ml: dissolve 10 mg of an antibody of the invention in ethanol (6-8 ml), add 0.1 to 0.2% of a lubricating agent such as polysorbate 85 or oleic acid; and dispersing the mixture in a propellant, such as phosphorous, preferably in combination of (1,2-dichlorotetrafluoroethane) and difluorochloromethane, and putting it in an appropriate aerosol container adapted for intranasal or oral administration.

The antibodies and pharmaceutical compositions of the invention are particularly useful for parenteral administration, that is, subcutaneously, intramuscularly or intravenously. Compositions for parenteral administration commonly comprise a solution of an antibody of the invention or a cocktail thereof dissolved in an acceptable vehicle, preferably an aqueous vehicle. A variety of aqueous vehicles can be employed, for example water, buffered water, 0.4% saline, 0.3% glycine, and the like. These solutions are sterile and generally free of particulate matter. These solutions can be sterilized by well known conventional sterilization techniques. The compositions may contain pharmacoeutically acceptable auxiliary substances when necessary to approximate physiological conditions, such as pH adjusting agents and buffers, etc. The concentration of the antibody or fragment thereof of the invention in such a pharmaceutical formulation can vary widely, that is, from less than about 0.5%, usually 1%, or at least this value, up to 15 or one percent. 20% by weight, and was selected mainly on the basis of fluid volumes, viscosities etc., according to the particular mode of administration selected.

In this way, a pharmaceutical composition of the invention for intramuscular injection could be prepared to contain 1 ml of sterile buffered water and 50 mg of an antibody or fragment thereof of the invention. Similarly, a pharmaceutical composition of the invention for intravenous infusion could be prepared to contain 250 ml of sterile Ringer's solution and 150 mg of an antibody or fragment thereof of the invention. Actual methods for preparing parenterally administrable compositions are well known or will be apparent to those skilled in the art, and are described in more detail, for example, in Remington's Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pennsylvania.

The antibodies of the invention can be lyophilized for storage and reconstituted in a suitable vehicle before use. This technique has been shown to be effective with conventional immunoglobulins, and lyophilization and reconstitution techniques known in the art can be employed.

Depending on the desired result, the pharmaceutical composition of the invention can be administered for prophylactic and / or therapeutic treatments. In therapeutic application, the compositions are administered to a patient already suffering from a disease, in an amount sufficient to cure or at least partially arrest the disease and its complications. In prophylactic applications, compositions containing the present antibodies or a cocktail thereof are administered to a patient not suffering from a disease state to improve the resistance of the patient.

Individual or multiple administrations of the pharmaceutical compositions can be carried out with dosage levels, the pattern being selected by the physician in charge of the case. In any event, the pharmaceutical composition of the invention must provide an amount of the altered antibodies of the invention sufficient to effectively treat the patient.

It should be noted that the antibodies of this invention can be used for the design and synthesis of peptide or non-peptide (mimetic) compounds that would be useful in the same therapy as the antibody. See, for example, Saragovi et al., Science, 253, 792-795 (1991).