Recombinant anti-CD4 antibodies for human therapy.
Abstract
Chimeric antibodies specific to human cd4 antigen, dna encoding, pharmaceutical compositions containing the and use thereof as therapeutic agents are taught. These chimeric antibodies contain old world monkey variable sequences and human constant domain sequences, preferably human gamma 1, gamma 4 ormutated forms thereof. These antibodies possess desirable therapeutic properties including low antigenicity, reduced (or absent)t cell depleting activity, good affinity to human cd4 and enhanced stability (in vivo half-life).

Term
No projected expiry on record.
- Priority
- Filed
- Granted
- Today
23 claims: 7 independent, 16 dependent
- 1A chimeric antibody specific to human CD4 , which substantially lacks T-cell depleting activity, which comprises the variable heavy and light chain antibody binding sequences as set forth in Figure 1 and Figure 2 of an Old World monkey monoclonal antibody produced against human CD4;and human constant heavy and light domain x*'/· sequences, wherein the human heavy constant domain sequences are selected from (1) unmodified human gamma 4 isotype constant domains;(2) gamma 4 isotype constant domains that have been modified by mutagenesis to reduce complement binding, Fcyl receptor binding and/or to enhance stability;and (3) gamma 4 isotype constant domains mutated at position 236 by the substitution of leucine for glutamic acid and/or at position 229 by the substitution of serine for proline.
- 4An anti-CD4 chimeric antibody which is selected from the group consisting of CE9y4, CE9y4XK, CE9y4E, and CE9y4PE.
- 9A method for producing a chimeric antibody specific to CD4 comprising expressing the recombinant DNA of ,<<) Claim 6 in a recombinant host cell.
- 10A method for producing a chimeric antibody specific to CD4 comprising expressing the recombinant DNA of Claim 7 in a recombinant host cell.
- 17disorder disease, systemic sclerosis The use of Claim 13, wherein said autoimmune is rheumatoid arthritis, inflammatory bowel psoriasis, insulin-dependent diabetes mellitus, lupus, erythematosus, cirrhosis, and multiple
- 18disorder The use of Claim 14, wherein said autoimmune is rheumatoid arthritis, inflammatory bowel BNSDOCID:<AP AP1193A I > APO01193 disease, psoriasis, insulin-dependent diabetes mellitus, systemic lupus, erythematosus, cirrhosis, and multiple sclerosis .
- 19disorder disease, systemic sclerosis The use of Claim 15, wherein said autoimmune is rheumatoid arthritis, inflammatory bowel psoriasis, insulin-dependent diabetes mellitus, lupus erythematosus, cirrhosis, and multiple
Independent claims7
1,581 paragraphs in 213 sections, as filed
RECOMBINANT ANTI-CD4 ANTIBODIES FOR HUMAN THERAPY
FIELD OF TEE INVENTION
This application is a continuation-in-part of U.S.
Serial No. 08/476,237 which is a continuation-in-part of
U.S. Serial No. 08/397,072, filed January 25, 1995, which is a continuation of U.S. Serial No. 07/912,292, filed July 10, 1992, which is a continuation-in-part of Newman et al., United States patent application Serial No. 07/856,281, filed March 23, 1992, which is a continuation-in-part of U.S. patent application Serial No. 07/735,064, filed July 25, .1991, the whole of which, including drawings, are hereby incorporated by reference. This invention relates to recombinant antibodies specific to CD4 which are useful for human therapy, and to methods for production of such antibodies .
f
OF TSE INVENTION
CD4 is a surface glycoprotein primarily expressed on cells of the T lymphocyte lineage including a majority of thymocytes and a subset of peripheral T cells. Low levels of CD4 are also expressed by some non-lymphoid cells although the functional significance of such divergent cellular distribution is unknown. On mature T cells, CD4 serves a co-recognition function through interaction with MHC Class II molecules expressed in antigen presenting cells. CD4* T cells constitute primarily the helper subset which regulates T and B cell functions during T-dependent responses to viral, bacterial, fungal and parasitic infections.
During the pathogenesis of autoimmune diseases, in particular when tolerance to self antigens breaks down, CD4<sup>+ </sup>T cells contribute to inflammatory responses which result in joint and tissue destruction. These processes are facilitated by the recruitment of inflammatory cells of the hematopoietic lineage, production of antibodies,
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
Λ**»
-2inflammatory cytokines and mediators, and by the activation of killer cells.
Rheumatoid arthritis (RA) , an inflammatory disease of the synovium, is one manifestation of an autoimmune phenomenon which results in erosion, deformity, and destruction of joints. Like most autoimmune diseases, the etiology of RA is not well defined. However, it is known that RA is characterized by elevated levels of activated CD4* T lymphocytes in the affected joints. Currently there is no cure for RA. First line therapy for RA is designed to provide relief for RA symptoms and to improve functional abilities over the short term. Second and third line immunosuppressors and steroids such as azathioprine, methotrexate .and prednisolone, targeted at the underlying disease, are administered in more severe cases and are either only mildly effective or exhibit unacceptable toxicity for chronic therapy. Also, they do not protect against joint destruction.
Apart from RA, CD4<sup>+</sup> cells have also been implicated in other chronic conditions including psoriasis, insulindependent diabetes mellitus, systemic lupus erythematosus and inflammatory bowel diseases. Moreover, it is probable that CD4 expression may be involved in other autoimmune diseases.
Given the involvement of T cells in the development and maintenance of autoimmune diseases, immunosuppression has become an important treatment strategy. Available immunosuppressive drugs such as cyclosporin A have been used successfully for the treatment of transplant rejection.
However, their toxic side effects renders them unacceptable for chronic therapy of autoimmune diseases.
Depletion of the entire T cell population, including the CD4<sup>+</sup> subset, in clinical settings, has been accomplished by methods including thoracic duct drainage, total lymphoid irradiation and lymphopheresis, resulting in clinical improvement in some patients. Current strategies are,
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
AP C 0 119 3
-3however, focused on more selective agents that block unwanted immune responses without causing solid organ toxicity or other major side effects. One way this potentially can be achieved is by selective removal or inactivation of disease mediating T cells with monoclonal antibodies (mAbs) . mAbs to CD4 represent one such strategy. In animal models of autoimmunity and transplantation, antiCD4 mAbs arrest or reverse disease progression when administered prophylactically or therapeutically. In addition, initial results from some clinical trials with anti-CD4 mAbs in RA, psoriasis, inflammatory bowel disease and systemic vasculitis have provided some preliminary evidence of potential therapeutic efficacy.
Essentially, the objective of anti-CD4 mAb therapy is to arrest the autodestructive activity of CD4<sup>+</sup> cells, particularly during acute phases of autoimmune disorder.
The ultimate therapeutic goal is to impose a state ο£ immunological unresponsiveness (anergy) or long-term tolerance to the insulting antigens (or specific tissues) that sustain the underlying disease, without compromising normal host defenses against opportunistic infections.
Apart from RA, CD4 mAbs may also be beneficial for the treatment of other autoimmune diseases, e.g., insulindependent diabetes mellitus, systemic lupus erythomatosis, psoriasis, inflammatory bowel disease, and multiple sclerosis .
Because of the potential importance of anti-CD4 mAbs as immunotherapeutics, numerous companies and research groups have reported anti-CD4 mAbs as potential therapeutic agents.
For example, Centocor has reported an anti-CD4 mAb referred to as Centara which is a chimeric murine mAb to CD4.
Further, Johnson & Johnson/Ortho has reported 0KT-4a, an anti-CD4 mAb, which is a humanized murine mAb. Still further, Burroughs Wellcome has reported an anti-CD4 mAb which is a humanized rat mAb to CD4. Also, both Sandoz and Medlmmune (in collaboration with Merck) have developed antiMWI 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-4CD4 murine-humanized mAbs specific to CD4. Still further, Becton Dickinson, Immunotech and Boehringer Mannheim have both developed anti-CD4 mAbs.
Apart from anti-CD4 mAbs, various immunomodulators and drugs have been disclosed to possess potential applicability for treatment of RA. Such immunomodulators and drugs include, e.g., cellular adhesion blockers, cytokine receptor blockers, immunotoxins and T cell receptor antagonists. Specific examples include gamma interferon, anti-ICAM-1 (a murine anti-CD54 mAh which blocks leukocyte trafficking, adhesion) , Campath-1K (rat-humanized anti-CDw52 mAb) IL-1 receptor, cA2 (a TNF-alpha chimeric mAh), CD? 571 (anti-TNF mAb) , anti-IL-2R (humanized-murine anti-CD25 mAh), SDZ CHH 380 (murine-human anti-CD7 mAb), DAB486 IL-2 (IL-2 fusion toxin, non-specific for CD4 and CD8 cells) , Antril (IL-IRA) , anti-TCR (mAb's and proteins which target T cell receptor subsets), and XomaZyme-CD5 (murine anti-CD5 toxin '<sup>r </sup>conjugate).
Also, other immunomodulators and immunosuppressors having potential application for treatment of autoimmune diseases include Rapamycin (oral immunosuppressive), Therafectin, Leflunomide (immunosuppressive predrug),
Tenidap (cytokine modulator/CO-inhibitor) , IMM-125 and RS61443 (an oral immunosuppressive) .
As noted, numerous monoclonal antibodies to CD4 having potential therapeutic applications have been reported. For the most part, these antibodies comprise murine mAbs, chimeric or murine-humanized anti-CD4 mAbs.
Murine monoclonal antibodies have potential utility in the diagnosis of human disease as well as in clinical trials as therapeutics for treatment of both acute and chronic human diseases, including leukaemias, lymphomas, solid tumors (e.g., colon, breast, hepatic tumors), AIDS and autoimmune diseases. However, murine antibodies are disadvantageous because they often result in an immune
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-5antibody response in the host against the murine monoclonal antibodies.
Mouse/human chimeric antibodies have also been reported. These antibodies comprise the binding characteristics of the parental mouse antibody and effector functions associated with the human constant region. See, e.g., Cabilly et al., U.S. Patent No. 4,815,557; Shoemaker et al., U.S. Patent No. 4,978,775; Beavers et al.,. U.S. patent No. 4,975,369; and Boss et al., U.S. Patent No.
4,816,397, all of which are incorporated by reference herein. Generally, these chimeric antibodies are constructed, in preparing a genomic gene library from DNA extracted from pre-existing murine hybridomas (Nishman et al., 47 Cancer Research. 999 (1987)). The library is then screened for variable regions genes from both heavy and light chains exhibiting the correct antibody fragment rearrangement patterns. The cloned variable region/genes are then ligated into an expression vector containing cloned cassettes of the appropriate heavy or light chain human constant region gene. The chimeric genes are then expressed in a cell line of choice, usually a murine myeloma line.
However, while such chimeric antibodies have been used in human therapy, they also are subject to some problems. Similar to murine monoclonal antibodies, human recipients may produce antibodies against the chimeric antibody. This is disadvantageous to the efficacy of continued therapy with the chimeric antibody.
As an improvement to conventional chimeric antibodies, some researchers have disclosed methods for the production of human monoclonal antibodies which should not be subject to such problems. See, e.g., Erlich et al., 34 Clinical Chemistry. 1681 (1988); Erlich et al., 7 Hvbridoma, 385 (1988); Erlich et al., 6 Hvbridoma. 151 (1987), and Erlich et al., 1 Human Antibody Hvbridomas. 23 (1990). These references also hypothesize that non-human primate antibodies·, e.g., chimpanzee monoclonal antibodies, should
AP/PZ 9 8 / 0 1 20 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-6be well tolerated in humans because of their structural similarity to human antibodies. However, the production of antibodies in humans has obvious ethical constraints.
Because human antibodies are non-immunogenic in Rhesus monkeys (i.e., do not induce an antibody response), Erlich et al. also predict that primate antibodies should be nonimmunogenic in humans. Erlich et al. (Id.) indicate that the testing of antibodies in humans is unnecessary if a primate antibody has a constant region identical to that of a human immunoglobulin or, at least, a structure no more different from a human immunoglobulin than different human antibodies differ from each other. Thus, they suggest that chimpanzee antibodies may be useful in human therapy.
As an improvement to known chimeric antibodies which are often antigenic in humans, related applications U.S. Serial No.: 08/476,237, filed June 7, 1995, Serial No.
f
08/347,072, filed January 25, 1995, and 07/912,212, filed July 10, 1992, 07/856,281, filed March 23, 1992, and 07/735,064, filed July 25, 1991, all incorporated by reference herein, describe the manufacture of Old World U.) monkey monoclonal antibodies and chimeric antibodies derived therefrom produced by recombinant methods which contain the variable domain of an Old World monkey antibody (e.g., baboon or macaque), fused to a cloned human, chimpanzee or other,monkey constant region or other monkey framework regions. These applications in particular describe the manufacture of such Old World monkey and chimeric antibodies derived therefrom against human antigens as well as the use of such chimeric recombinant antibodies as immunotherapeutic agents for the treatment of human disease.
These applications are based on the surprising discovery that evolutionarily distant monkeys (e.g., baboon or macaque monkeys (including cynomolgus and Rhesus monkeys)), unlike chimpanzees, are not only sufficiently different from humans to allow antibodies against human antigens to be raised in these monkeys even to relatively
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
AP Ο Ο 119 3
-7conserved human antigens, e.g., CD4 and CD54, but are sufficiently similar to humans to have antibodies that are structurally similar to human antibodies, so that no host anti-antibody response when such monkey antibodies, or recombinant chimeric antibodies derived therefrom, are introduced into a human.
These applications disclose that unlike some prior antibodies used for human therapy, including known chimeric antibodies, such chimeric antibodies do not suffer from i 10 several drawbacks, e.g., 1) immunogenicity and induction of human anti-antibody (HAA) response upon.repeated administration necessary to treat chronic conditions,
2) relatively short half-life compared to human antibodies, and 3) lack of effector functions with human cells or complement.
The lack of these drawbacks is a significant advantage for human therapy. For example, in the case of chronic human diseases, including autoimmune diseases, or any disease where prolonged administration of an antibody is necessary, one of the major obstacles to repetitive antibody .) therapy is the host response to the therapeutic antibody.
HAA responses are often unpredictable from one patient to another. Also, such responses are predominately, though not exclusively, directed against the constant region of the antibody molecule, and once they occur they often preclude, or reduce the effectiveness of therapy with that antibody, or another antibody of the same isotype. The recombinant chimeric antibodies described in the ab->vA-t-gfgrerK-ed applications will circumvent this problem and allow for the generation of antibodies of the appropriate specificity and desired effector function, and their use in production of recombinant antibodies .
* These recombinant antibodies generally include an appropriate portion of the variable region of an antibody derived from an immunized monkey, which is necessary for antigen binding, and the constant region of an antibody from
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
AP O 0 119 3
-8a human or chimpanzee. Therefore, this allows for maintaining specificities and high affinities of the monkey monoclonal antibodies, and desired effector functions by the appropriate selection of human or chimpanzee constant region.
Several of these related applications exemplify in particular a monkey/human chimeric antibody with specificity for CD4 , referred to as CE9.1, which contains the'heavy and light chain variable domain of an anti-CD4 monoclonal antibody produced in a cynomolgus monkey and the human immunoglobulin light chain lambda constant region and the human immunoglobulin heavy chain gamma l constant region. This antibody possesses some T cell depletion activity, but which is lower in comparison to previous CD4 monoclonal antibodies. However, it is desirable to produce antibodies which possess less or which are devoid of T ceil depleting activity because this would potentially enhance their therapeutic potential.
These applications further describe preferred vector systems for the production of such chimeric antibodies, in ' ) particular TCAE 5.2 and TCAE 6 which comprise the following:
. .. 1) Four transcriptional cassettes in tandem order:
(a) a human immunoglobulin light chain constant region. In TCAE 5.2 this is the human immunoglobulin Kappa light chain constant region (Rabat numbering amino acids 108-214, allotype Km 3) and in TCAE 6 the human immunoglobulin light chain lambda constant region (Rabat numbering amino acids 108-215, genotype Oz minus, Meg minus, Ke minus allotype).
(b) a human immunoglobulin heavy chain constant region; in both constructs the human immunoglobulin heavy chain is a gamma/constant region (Rabat numbering amino acids 114-478 allotype Gmla, Gm 12).
AP/P/ 9 8 / 0 1 20 9
BNSDOCID: <AP
AP1193A I >
APO01193
-9(c) DHFR; containing its own eukaryotic promoter and polyadenylation region; and (d) NEO; also containing its own eukaryotic promoter and polyadenylation region.
2) The human immunoglobulin light and heavy chain cassettes contain synthetic signal sequences for secretion of the immunoglobulin chains; and
3) The human immunoglobulin light and heavy-chain cassettes contain specific DNA links which allow for the insertion of light and heavy immunoglobulin variable regions which maintain the translational reading frame and do not alter the.amino acids normally found in immunoglobulin chains .
However, notwithstanding what has been previously described, there still exists a need in the art for improved antibodies which are specific to CD4, which possess low antigenicity in humans which may be used therapeutically, e.g., for the treatment of autoimmune diseases such as rheumatoid arthritis. In particular, there is a need for producing anti-CD4 antibodies which exhibit improved properties, e.g., longer half-life and/or which substantially lack or are devoid of depleting activity.
OBJECTS OF THE INVENTION
Toward this end, it is an object of the present invention to provide novel monoclonal and chimeric antibodies specific to CD4 having improved properties, e.g., longer half-life, low immunogenicity in humans and/or reduced or absence of T cell depleting activity. More specifically, it is an object of the invention to produce anti-CD4 chimeric antibodies which contain the antigenrecognition portion of an Old World money immunoglobulin specific to CD4 and human or monkey constant domain sequences, in particular human Kappa or lambda light chain
5 constant region and human gamma l or gamma 4 or a mutated gamma 4 human heavy chain constant region sequences with
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-10altered effector functions and improved stability over the gamma 4 isotype.
It is a more specific object of the present invention to provide novel monoclonal and chimeric antibodies containing the specific monkey anti-CD4 variable heavy sequence shown in Figure 1 and the monkey anti-CD4 variable light sequence shown in Figure 2, fused to monkey or human constant domain sequences, preferably the human Kappa or lambda light chain constant domain sequence and the human gamma 1 or gamma 4 constant domain sequence or a mutated gamma 4 heavy chain with altered effector functions and improved stability over the gamma 4 isotype.
It is another object of the present invention to provide DNA sequences which provide for the expression of such improved chimeric anti-CD4 antibodies and vectors and host cells which may be used for the expression of such chimeric anti-CD4 antibodies. Preferably, such vectors will comprise the expression vectors referenced in the applications which are incorporated by reference herein, and the host cells will preferably be CKO cells.
It is still another object of the present invention to provide pharmaceutical compositions for use in the treatment or prophylaxis of CD4 related disorders, in particular autoimmune diseases, which contain a prophylactically or therapeutically effective amount of the subject improved chimeric anti-CD4 antibodies in combination with a pharmaceutically acceptable carrier.
It is yet another object of the present invention to provide methods of treatment or prophylaxis of CD4 related disorders, in particular autoimmune diseases and other conditions wherein immunosuppression is desirable by the administration of a therapeutically or prophylactically effective amount of the subject novel chimeric anti-CD4 antibodies in combination with a pharmaceutically .acceptable carrier.
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
L
ARC’01 19 3
PC
-11BRIEF DESCRIPTION OF THE FIGURES
<td> Figure 1</td><td> depicts</td><td> the</td><td> amino</td><td> acid</td><td> and</td><td> DNA</td><td> sequence</td><td> of</td><td> the</td>
<td> light variable</td><td> domain</td><td> of</td><td> CE9.1.</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> Figure 2</td><td> depicts</td><td> the</td><td> amino</td><td> acid</td><td> and</td><td> DNA</td><td> sequence</td><td> of</td><td> the</td>
<td> heavy variable</td><td> domain</td><td> of</td><td> CE9.1.</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> Figure 3</td><td> depicts</td><td> the</td><td> amino</td><td> acid</td><td> and</td><td> DNA</td><td> s'equence</td><td> of</td><td> the</td>
human lambda variable and constant domains contained in CE9.1.
Figure 4 depicts the DNA and amino acid sequence encoding the heavy chain variable and constant gamma 4 sequence.
Figure 5-depicts the DNA and amino acid sequence encoding human heavy chain gamma 4 containing the E mutation.
Figure 6 depicts the DNA and amino acid sequence encoding human heavy chain gamma 4 containing the P and E / mutation.
Figures 7-1, 7-2 and 8 show the nucleic acid sequence of various leader sequences useful in the invention.
Figure 9 shows a scattergram of the binding of CE9.1 to ’ j fresh human PMNCs where Panel A top right quadrant shows lymphocytes doubly stained with CE9.1 and OKT3, Panel B top right quadrant shows population doubly stained with CE9.1 and OKT4, Panel C top right quadrant shows absence of cells doubly stained with CD8 and CE9.1, and Panel D control shows cells stained with normal and human IgG.
Figures 10a, 10b and 10c show a Fc receptor binding characteristics of CE9.1 where measurements show the agglutination of CD4<sup>+</sup>flow cytomeric histogram of the binding fibroblasts with a) ylFN induced fresh monocytes, where a negative control utilized F(ab')2 fragments of CE9.1, b) fresh monocytes with or without ylFN induction, and c) in • the presence of sCD4 or in the absence of antibody.
Figure 11 shows inhibition of a human mixed lymphocyte reaction by CE9.1 where a) fresh human PBLs were used as responders and mitomycin C-treated stimulator cells from an
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-12unrelated donor were used for testing the inhibitory properties of a range of concentrations of CE9.1 and inhibition was measured by the amount of thymidine incorporation of IL-2 production, and b) MLR using chimpanzee responders and unrelated chimpanzee stimulators, where Leu3a, a murine anti-human CD4, was used as a control.
Figure 12 shows the antibody dependent cellular cytotoxic properties of CE9.1 where lysis of SupT-18'target . cells in the presence of γ interferon stimulated effector > 10 cells and where 4D9 is a murine anti-CD4 monoclonal antibody
IgG2a.
Figure 13 shows a flow cytometric histogram of the binding of Clq to SupTl-18 cells in the presence and absence of CE9.1 where 10,000 events were recorded and the results expressed as a histogram, PRO945 are polyclonal antibodies from a monkey with high anti-CD4 serum titer, and the f
negative control was Clq plus anti-Clq in the absence of CE9.1.
Figure 14 shows the complement dependent cytotoxicity 20 assay of CS9.1 where lysis of SupT-18 cells in the presence .,/ of CE9.1 and rabbit complement, where 4D9 is a murine anti% CD4 control of the subclass IgG2a which is able to fix complement, and where PRO965 is a polyclonal mixture of antibodies from the serum of a cynomolgus monkey with a high anti-CD4 titer.
Figure 15 shows high dose pharmacological study in six chimpanzees, where CD4 , CL8 levels in peripheral blood expressed over a period of 150-300 days, CD3-CD8 curves · indicating the number of CD4 modulated cells are also shown;
top panel: Group 1 - chimpanzees counts monitored. Arrows indicate CE9.1 doses. (2) saline control group, Middle Panel: Group 2 - chimpanzees (2) receiving lOmg/kg CE9.l. Dosing was repeated when CD4 counts returned to within 30% of baseline. Lower Panel: Group 3 - chimpanzees (2) receiving 10 mg/kg CE9.1. Dosing was repeated when CD4 counts returned to within 70% of baseline.
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-13Figure 16 depicts suitable PCR primers for obtaining the human γ4 constant region.
Figure 17 depicts the CE9y4?E heavy chain sequence. Figure 18 depicts non-reducing SDS-polyacrylamide gel electrophoresis of CE9.1, CE9y4(G4), CE9y4E(G4E) and CE9yPE(G4PE). Halfmer molecule is seen at a molecular weight of approximately 80 kD.
Figure 19 contains data for the association and dissociation phases of the SPR progress curves.
Figure 20 shows the effect of CD4 mAb constructs in primary MLR.
Figure 21 shows the adhesion of IFN-γ induced monocytic cell line ΊΉΡ-1 to CD4<sup>+</sup> fibroblast transfectants.
Figure 22 depicts- FcR and CD4‘ mediated adhesion of
CE9.1, CE9y4, CE9y4E and ΟΕ9γ4γΚ.
Figure 23 shows CDC and ADCC results with CE9y4?E,
CE9.1 and a murine fixing mAb to HuCD4 . ,
Figure 24 shows plasma concentrations following 1 mg/kg in bolus of CE9y4E and CE9y4PE in mice Sprague-Dawley rats.
Figure 25 depicts the effect of treatment with mAbs in ovalbumin-specific antibody response in HUCD4 transgenic mice.
DETAILED DESCRIPTION OF TEE INVENTION
The present invention provides novel monoclonal chimeric antibodies specific to CD4 which contain the antigen-binding portion of a variable region of an Old World monkey anti-CD4 monoclonal antibody fused to desired monkey or human constant domain sequences, preferably the human gamma 1, gamma 4 or a mutated gamma 4 human heavy chain constant domain and human Kappa or lambda light chain constant domain sequence. These antibodies exhibit improved properties in relation to conventional anti-CD4 monoclonal antibodies, e.g., high affinity to human CD4 and have little or no immunogenicity in humans. The gamma 4 versions show reduced or absence of effector function, e.g., Fc receptor
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-14binding activity or complement fixation, and little or no T cell depleting activity.
Methods for obtaining Old World monkey monoclonal antibodies specific to CD4 and clones which produce Old
World monkey monoclonal antibodies specific to CD4 may be found in the afore-referenced related patent applications f· which are incorporated by reference herein.
In general, this comprises immunizing an Old .World monkey against human CD4 antigen under conditions such that the Old World monkey produces anti-CD4 antibodies;
immortalizing the cells of the monkey which are responsible for producing the anti-CD4 antibodies, e.g., by hvbridoma fusion, viral transformation with Heroes paoio, single 3cell cloning (also called transient immortalization), and production of a library of recombinant immunoglobulins. In preferred embodiments, this method includes selecting a Bcell from the monkey from either a peripheral blood/ leukocyte, the spleen, bone marrow or a lymph node; selecting a core which produces the appropriate antibody;
rescuing the immunoglobulin genes encoding that antibody from the immortalized cell line; and expressing the genes in a producer cell line (i.e., a cell line which enables sufficient -production of the antibody to be useful for human therapy) . As is defined in the above-referenced applications, Old World monkeys include baboons and macaque monkeys (including Rhesus monkey and cynomolgus monkey).
As discussed supra, in the preferred embodiment the subject chimeric antibodies will comprise the anti-CD4 Old World monkey variable heavy and variable light sequences shown in Figure 1 and Figure 2, fused to human constant domain sequences. Suitable means for obtaining these specific variable heavy and variable light domain sequences are described in detail in U.S. application Serial Nos. 08/476,237, filed June 7, 1990 and 08/397,072, filed
January 25, 1995, as well as 07/912,292, filed July 10,
1992, all of which are incorporated by reference in their
60210/86 Zd/dV
BNSDOCID: <AP
APU93A I >
APΟ 0 119 3
-ISentirety herein. These applications further disclose the entire nucleic acid and amino acid sequence cf these sequences.
These variable heavy and domain sequences may be fused 5 to any desired human constant domain sequences. The particular selection will affect the effector-function of the resultant chimeric anti-CD4 antibody. Preferably, the human heavy chain constant domain will comprise gamma 1, gamma 4 or a mutated gamma 4 constant domain referred to \ 10 herein as gamma 4E or a mutated gamma 4 referred to herein z
as gamma 4PE. The selection of gamma 4.is advantageous because it -has been found to result in chimeric antibodies lacking T cell or substantially lacking T cell depleting activity (80-100% relative to gamma 1). This is believed to be because the gamma 4 constant domain is unable to bind complement. The constant domain may also be mutated to enhance the properties of the resultant chimeric antibody, e.g., stability and/or to eliminate depleting activity. In particular, the P and E modifications of the gamma 4 domain, which are described infra, are modifications of the gamma 4 in the hinge region which confer activity enhanced stability and eliminate depleting activity. Moreover, it is expected that other modifications should also provide chimeric antibodies having enhanced properties.
The human light chain constant domain contained in the subject chimeric anti-CD4 antibodies will preferably be the human Kappa or lambda light chain constant region, more preferably the human lambda light chain constant region..
The amino acid and DNA sequences which encode human gamma 1, gamma 4, Kappa and lambda constant domains are known in the art. Also, the amino acid and nucleic acid sequences for human gamma 4 and E and PE mutants and lambda constant domain sequences may be found in Figures 4-6 and Figure 3, respectively.
The exemplified embodiments of the invention include a specific chimeric anti-CD4 monoclonal antibody referred to
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID; <AP
AP1193A I >
ΑΡ ο Ο 119 J
-16as CE9.1 which comprises the antigen binding domains obtained from human sCD4-immunized cynomolgus macaques (shown in Figures 1 and 2) , in combination with the constant domains of human IgGl, and monoclonal chimeric antibodies derived therefrom, e.g., CE9y4, CE9y4XK and CE9y4E, ΟΞ9γ4ΡΞ which have the same antigen binding domains of-CE9.1, but have been genetically engineered with a human IgG4 Fc binding domain framework. Monoclonal antibody CE9y4E contains a leucine to glutamic acid mutation (L236S) near i 10 the hinge region of the antibody (the E modification).
Monoclonal antibody ΟΞ9γ4ΡΕ contains the same leucine to glutamic aeia mutation plus a serine to proline mutation (S229P) (E and P modification) . The CE9y4KX antibody differs from CE9y4 by the replacement of its light chain constant region from a human K to a human λ subtype.
These constant domain switches and mutations were made because it is known chat the biological responses of IgG antibodies depends cn the composition of their carboxyterminal domains, i.e., their isotype. Thus, by altering the antibody isotype by protein engineering, it is 4 potentially possible to modify the biological response of an g IgG antibody, and more specifically the subject chimeric anti-CD4 monoclonal antibodies.
The desired outcome of this engineering strategy was that isotype switching of the Fc portion of the antibody would not diminish binding affinity of the CD4 antigen binding Fab regions. However, this was not known at the outset. It was possible that the change of the constant region or modification thereof could have adversely affected
CD4 binding. Therefore, the resultant antibodies were assayed to determine the effects of modification on antibody properties, in particular CD4 antigen binding. In order to measure the possible effects of constant domain switching on antigen binding, known assay methods may be used. In
5 particular, a study of the interaction between CD4 and CE9.1, CE9y4, CE9y4Xk, CE974E and CE9y4PE was made by
AP/P/ 9 8/01209
BNSDOCID: <AP
AP1193A I >
ΛΡΡ ?<sup>1</sup>1 ο $
-17Scatchard analysis and surface plasmon resonance (SPR). The results of these assays demonstrated that CD4 binding to each of the tested antibodies was equivalent. Equilibrium dissociation constants at 25°C for CD4 binding to the antibodies were all found by SPR to be approximately 1.0 nanomolar. The measurements further demonstrate,, that:
1) CD4 binding to the antibodies occurs by a two-site independent and identical binding model; and
2) the functional binding properties of the antigen '-.10 binding domains are independent of structural modifications made to the Fc portion of the antibody including the gamma 1, gamma 4 or mutated gamma 4 isotypes. Therefore, the present invention provides evidence that isotype switching between IgGl and IgG4 may be a useful strategy for engineering antibodies without loss of antigen binding affinity and more specifically, antibodies to CD4.
Also, as described infra, it was also found that/ the substitution of the gamma 1 constant domain with gamma 4 substantially reduced Fc receptor binding, complement fixation and T cell depleting activity and further that the j E and P modifications respectively further eliminate Fc ., receptor binding and T cell depleting activity and provide for enhanced antibody stability. Therefore, it is reasonable to assume that other chimeric antibodies produced according to the invention (engineered to contain the human gamma 4 constant domain or mutated forms thereof) may be selected with altered Fc effector function, which substantially lack or are totally devoid of T cell depleting activity, and/or which exhibit enhanced stability. Methods of assaying T cell depleting activity, Fc effector function, and antibody stability are known in the art.
Therefore, the present invention provides specific recombinant antibodies which are primate/human chimeric monoclonal antibodies which are directed against the human
CD4 antigen which exhibit improved properties, e.g., low T cell depleting activity and greater stability. Given these
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO O11<sub>93</sub>
-18properties, these recombinant antibodies have particular utility as immuno-modulators and are especially useful for the treatment of autoimmune diseases such as rheumatoid arthritis, psoriasis, systemic lupus erythematosus (SLE) as well as non-auto immune indications such as graft-versus host disease (GVHD) transplant rejection, asthma and HIV. Also, the subject antibodies possess utility as adjuncts in genetic therapy. In particular, the subject antibodies may be administered prior to, concurrent or after administration of a vector (containing a therapeutic DNA) to prevent or reduce the host humoral response to said vector. These diseases are-exemplary of CD4 related conditions.
As described in greater detail in the Examples, the CE9.1 recombinant antibody is generated by grafting the antigen binding variable Fv domains from cynomolgus macaque to human constant regions e.g., IgGl constant domains. More particularly, the CE9.1 antibody contains a human gamma 1 domain and the lambda constant domain. CE9y4, 0Ξ9γ4λΚ,
CE9y4E and CE9y4PE contain the gamma 4 constant domain or a mutated form thereof, and either the lambda or Kappa constant region. The resultant recombinant antibody sequences are indistinguishable from human immunoglobulin sequences. As a result, these antibodies, as well as the other CD4 antibodies produced by similar methods, upon in vivo administration in humans should exhibit reduced or no immunogenicity and slower serum clearance compared to similar murine monoclonal or mouse-human chimeric antibodies directed to CD4 .
The CE9.1 antibody binds to domain 1 of human, but not macaque, CD4, a region which is involved in the interaction with MHC Class II molecules on antigen presenting cells. Also, assays have demonstrated that the other exemplified antibodies comprise the same antigen binding properties as CE9.1.
Potent immunomodulatory activity has been observed with the CE9.1- antibody both in vitro and in vivo. Given these
AP/P/ 98/01209
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-19properties, i.e., reduced immunogenic!ty, slower serum clearance and potent immuno-moaulation, in comparison to other known anti-human CD4 mAbs that are murine cr rodent derived, this antibody as well as the other antibodies described herein should be particularly suitable for long term therapy of diseases where immunosuppression is desirable, e.g., autoimmune disorders and chronic inflammatory diseases such as rheumatoid arthritis.
However, it is expected that these antibodies should be ; 10 useful for the treatment of many other disease conditions including, by way of example, Hashimoto.'s thyroiditis, primary myxoedema, thyrotoxicosis/Graves disease, pernicious anaemia, autoimmune atrophic gastritis, autoimmune carditis, Addison's disease, premature menopause, type I-diabetes mellitus, Good pasture's syndrome, myasthenia gravis, multiple sclerosis, male infertility, pemphigus vulgaris, f
pemphigoid, sympathetic ophthalmia, phacogenic uveitis, autoimmune haemolytic anaemia, idiopathic thrombocytopenic purpura, idiopathic leucopenia, primary biliary cirrhosis, active chronic hepatitis (HEs Ag negative), cryptogenic ) cirrhosis, inflammatory bowel disease syndrome, Sjogren's '-j syndrome, psoriasis, rheumatoid arthritis; dermatomyositis, scleroderma, mixed tissue connective disease, discoid lupus erythematosus, systemic vasculitis, and systemic lupus erythematosus (SLE).
As discussed above, rheumatoid arthritis (RA) is an inflammatory disease of the synovium which comprises one manifestation of an autoimmune phenomenon which results in erosion, deformity, and destruction of joints. As is true with most autoimmune diseases, the etiology of RA is not well defined but is characterized by elevated levels cf activated CD4* T-lymphocytes in the affected joints. Currently there is no cure for RA and therapy for treatment of this debilitating disease is designed only to provide relief of symptoms and improvement in functional abilities over the short term. Moreover, second and third line
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-20immunosuppressants and steroids such as azathioprine, methotrexate and prednisolone aimed at the underlying disease are only given in more severe cases and are usually mildly effective or exhibit unacceptable toxicity when used for chronic therapy. By contrast, it is expected that the subject antibody will be suitable over prolonged and chronic administration given the fact that it exhibits reduced immunogenicity, longer half life and potent immunomodulatory activity as compared to other known anti-human j 10 CD4 mAbs that are murine or rodent derived.
Essentially, the exemplified recombinant anti-CD4 monoclonal antibodies described in this application or other antibodies produced according to the present invention and as described in- the above-referenced application (incorporated by reference) will likely mediate therapeutic activity by arresting or altering the destructive activity of CD4* cells, particularly during acute phases cf autoimmune disorders such as rheumatoid arthritis. Thus, administration of antibodies according to the invention will result in a state of immunological unresponsiveness (anergy) J .) or long term tolerance to the insulting antigens (or '·, specific tissues) that sustain the underlying disease without compromising normal host defenses against opportunistic infections. Apart from RA, CD4 monoclonal antibodies should be beneficial in the treatment of the above-identified diseases and afford particular application for the treatment of insulin-dependent diabetes mellitus, systemic lupus erythematosus, cirrhosis, inflammatory bowel disease, multiple sclerosis, as well as other auto-immune
0 diseases. They may also be useful in the treatment of nonautoimmune diseases such as leukemia lymphoma graft-versus- . host disease, transplant rejection, asthma and K1V.
Recombinant anti-CD4 monoclonal antibodies produced according to the invention should mediate the desired in
5 vivo therapeutic effect through one or more of the following mechanisms :
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-21- .10
i) blocking the interaction of CD4 with MHC class 2 molecules;
ii) down modulation of cell surface CD4 ; iii) causing anergy and/or apoptosis;
iv) depletion of CD4 cells; or v) induction of tolerance to autoantigens..
Although transient depletion of CD4’ cells results in immunosuppression and perhaps normalization of an otherwise hyperactive immune system, the main mechanism by which antiCD4 antibodies exhibit their in vivo effect is not necessarily dependent on T cell depletion. Rather, it is believed that. antibody binding to the CD4 molecule prevents helper T cell activation by antigens bound to T cell receptor leading to antigen-specific T cell anergy cr tolerance. For example, the CE9.1 antibody which comprises a human gamma 1 domain exhibits substantial immunosuppression activity. However, it only partially depletes CD4 cells in chimpanzees. Moreover, results in humans indicate that this antibody results in substantially less cell depletion compared to other monoclonal antibodies now in clinical trials.
Also, in in vivo experimental models,· allograft specific tolerance has been induced by non-depleting antiCD4 antibodies administered at the time of transplantation. The maintenance of the tolerance state did not require a depleting anti-CD4 antibody but does appear, however, to be dependent on the continued presence of antigen. Based or. these findings, it is expected that the subject recombinant antibodies or other recombinant anti-CD4 antibodies produced according to the invention should be suitable for treatment of autoimmune diseases. 3rief treatment schedules with anti-CD4 antibodies will interfere with helper T cell responses against auto antigens leading to long-lasting clinical improvements in the absence of generalized immunosuppression.
60210/86 /d/dV
BNSDOCID: <AP
AP1193A I >
APO Ο 119 j .20
-25. ii) absence of CD4 cell depletion should enhance the safety thereof;
iii) superior safety permits mAbs to be used earlier in the disease process;
iv) absence of CD4 cell depletion should improve efficacy; and
v) absence of CD4 cell depletion will obviate cr reduce the need to frequently monitor CD4 cell counts, thus increasing convenience and cost of the overall treatment.
This is supported by the fact that in a number of animal models, it has been shown that CO4* T cell depletion is not required for efficacy of CD4 mAbs. Thus, a nondepleting CD4 mAb would function like a classical receptor antagonist by:
i) blocking the interaction of CD4 with its counter receptor MHCII, ii) causing modulation of CD4 from the cell surface, or iii) causing T cell anergy and/or apoptosis.
Thereby, CD4* T cell responses that require the participation of the CD4 receptor would be altered or blocked.
Generally, T cell responses which are driven by strong or high affinity antigens appear to be independent of CD4co-receptor functions and thus would not be effectively blocked by CD4 mAbs. Conversely, T cell responses to weak antigens (such as autoantigens) require CD4- co-receptcr function and therefore would be inhibited by CD4 mAb. Normally, strongly autoreactive T cells (T cells with high affinity TCRs to self antigens) are removed in the thymus by clonal deletion and therefore never appear in the periphery. By contrast, T cells which drive the autoimmune response are believed to be weakly self-reactive cells which have escaped the normal mechanisms of peripheral tolerance. Such cells depend on the participation of co-receptors, such as CD4, for.the full elaboration of a response. Therefore,
AP/PZ 98/01209
BNSDOCID: <AP
AP1193A I >
ΑΡ ιύ1 1g <sub>3</sub>
-26blocking the co-receptors would deprive these T cells of crucial co-signaling functions which would result in partial activation or anergy. Also, as noted above, it is further desirable to produce chimeric antibodies specific to CD4 having greater stability (longer in vivo half-life).
Toward that end, various chimeric antibodies were synthesized which contain the gamma 4 human constant domain. This domain was selected because it apparently does not bind human complement or FCyl receptors. Therefore, it was hypothesized that chimeric antibodies containing this constant domain would lack or substantially lack T cell depleting activity. Also, several chimeric antibodies were made which contained known modifications of the gamma 4 constant domain. In particular, several contain the E modification which is described by Duncan et al., Nature. 332:563-564 (1988), and Winter et al., WO 88/07089 (1988), which modification has been disclosed to reduce complement and FCyl receptor binding. This modification comprises the change of leucine to glutamic acid at position 236 (248
Rabat numbering) to abate any residual Fc receptor binding. Also, several chimeric antibodies contain the P modification which is disclosed by Angal et al., Mol.
Immunol.. 30:105-8 (1993). This modification which comprises the change of a serine at position 229 (241 Rabat numbering) to a proline enhances stability (serum half-life) by stabilizing disulfide bonds between the heavy chains and has been reported to enhance improved tissue distribution relative to a chimeric IgG4 lacking the modification.
More specifically, the rationale for development of
CE9y4 was to abrogate complement fixing and decrease FcR binding activities. This antibody differs from CE9.1 in that it contains the human gamma 4 constant domain (not gamma 1) . However, while this was desired the outcome was not of a routine or predictable nature. Indeed, the present inventors found that chimeric antibodies containing unmodified γ9 had the same Fc receptor binding as the γ2
BNSDOCID: <AP
AP1193A I
Af»b O 1 1 9 3
-27antibody. By contrast, the rationale for making CE9y4XK was to enhance productivity of γ4 construct. This antibody differs from the CE9.1 in that it contains the human Kappa light chain rather than lambda. Assessment of CE9y4 in vitro by an Fc receptor binding assay which measures the binding of antibody to stimulated monocytes and monocytic cell lines, showed that CE9y4 still possessed signif-icant- p<sub>c </sub>receptor binding activity. Furthermore, in this assay system, CE9y4 binding was indistinguishable from CE9.1 (gamma 1). Thus, the rationale for manufacture of CE9yE was to completely abrogate any residual FcR. binding over chimeric antibodies containing unmodified γ4. CE9yE contains the gamma 4 constant domain modified at one site (E modification). Finally, the rationale for the manufacture of CE9y4PE was to enhance the stability over chimeric antibodies containing unmodified y4 or a mutation at one site (E modification). This antibody contains the gamma 4 constant domain modified at two sites (P and E . modification).
As discussed, the human γ4 constant domain was selected as the isotype for abrogation of effector functions, i.e., reactivity with human Fey receptors or Clq, and absence of depletion of CD4* cells in vivo. These four candidates were selected and expressed in CHO cells.
Two of these candidate monoclonal antibodies were selected for more extensive study, i.e., CE9y4E and CE9y4PE. As noted, both of these contain a glutamic acid substitution in the CH2 region introduced to eliminate residual FcR binding associated with γ4 constant region. In addition,
CE9y4PE contains a proline substitution in the hinge region, intended to enhanced the stability of the heavy chain disulfide bond interaction.
These antibodies were found to be indistinguishable in their affinity for CD4, molecular weight, stability to heat denaturation, suppression of MLR, absence of binding to FcR, and lack of'activity in ADCC and CDC. Thus, both of these
BNSDOCID: <AP
AP1193A I
AP uu 1 Ί 9 3
-28antibodies exhibit in vitro criteria for a high affinity CD4 mAb with no FcR and complement effector functions.
The properties of CE9.1 and CE9y4PE are compared in Table 1. Reduced Fc receptor binding is intended to refer to chimeric antibodies which bind to the Fc receptor less than 1 γΐ containing chimeric antibodies, preferably at least 30 to 80% reduced in comparison thereto and more preferably at least 50 to 80% reduced and most preferably totally abrogated. However, as evidenced by the results with the unmodified gamma 4 chimeric antibody the desired outcome was not of a predictable nature.
TABLE 1
<td rowspan="2"> 15</td><td colspan="3"> Comparison of Effector Functions of CE9.1 and CE9y4PE</td><td rowspan="2"> <·> O CM Y—</td>
<td> Activity</td><td> CE9.1</td><td> CE9y4PE</td>
<td></td><td> In vitro</td><td></td><td></td><td> c?</td>
<td> 20</td><td> MLR</td><td> Yes</td><td> Yes</td><td></td>
<td></td><td> Clq Binding</td><td> Weak</td><td> No</td><td> 00</td>
<td></td><td> CDC</td><td> No</td><td> No</td><td></td>
<td></td><td> ADCC</td><td> Yes</td><td> No</td><td> W7</td>
<td></td><td> FcR Binding</td><td> Yes</td><td> No</td><td></td>
<td> 25</td><td></td><td></td><td></td><td></td>
<td></td><td> In vivo (Chimpanzee)</td><td></td><td></td><td> Ο.</td>
<td></td><td> Depletion of CD4 Cells</td><td> Partial</td><td> No</td><td></td>
<td></td><td> CD4 Receptor Modulation</td><td> Yes</td><td> Yes</td><td></td>
<td> 30</td><td> In vivo (HuCD4* Transgenic mice)</td><td></td><td></td><td></td>
<td></td><td> Depletion of CD4 cells</td><td> Partial</td><td> No</td><td></td>
<td></td><td> CD4 Receptor Modulation</td><td> Yes</td><td> Yes</td><td></td>
<td></td><td> ADCC= Antibody Dependent Cellular Cytotoxicity</td><td></td><td></td><td></td>
<td> 35</td><td> CDC Complement Mediated Cellular Cytotoxicity</td><td></td><td></td><td></td>
<td></td><td> FcR Fc Receptor</td><td></td><td></td><td></td>
<td></td><td> MLR Mixed Lymphocyte Reaction</td><td></td><td></td><td></td>
<td> 40</td><td> Thus, these results confirm</td><td> that chimeric</td><td> antibodies</td><td></td>
may be produced according to the invention which bind human CD4, which lack certain effector functions by virtue of the selection of specific constant domain sequences.
BNSDOCID: <AP
AP1193A I >
AP OΟ 11g 3
-29In using the exemplified chimeric anti-CD4 antibodies or other chimeric antibodies produced according to the invention as immunosuppressants or CD4 modulators for the treatment of autoimmune disorders, including for example rheumatoid arthritis, such antibodies may be administered alone or in combination with other compounds suitable for treatment of the particular disease condition. For example, the subject antibody may be administered in combination with other proteins, for example monoclonal antibody soluble receptor proteins to TNF-alpha, monoclonal antibodies to IL2 i
receptor, monoclonal antibodies and receptor fusion proteins which antagonize the CD40/gp39 interaction and CTLA 4-Ig in monoclonal antibodies which antagonize the B7/CD28 interaction. Also, in the case of treatment of rheumatoid arthritis, the subject antibody may be administered in combination with other therapeutics, for example Rapamycin, Leflunomide, Tenidap, RS-61443 (Mycophenolate Mofeti'l) , Surenyl.(sodium Hyaluronate) , anti-TCR (V/317) peptide vaccine, Anerva X (anti-MHC vaccine), and extracorporeal protein A immunoabsorbents or combinations thereof.
j Additionally, the subject antibody may be administered in combination with other antibodies produced according to the invention or known in the art which are specific to human CD4. This may result in synergistic effects, for example, if these antibodies bind to different epitopes of the CD4 protein.
The following examples are presented to further describe the invention.
EXAMPLE 1
CLONING AND EXPRESSING A MONKEY/HUMAN
CHIMERIC ANTIBODY WITH SPECIFICITY FOR CD4
The following is a specific example of the methods and antibodies of this invention.
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APO 01193
-30Generation of Monkev Immortalized B-cell Lines
An adult cynomolgus monkey (White Sands New Mexico Primate Center) was immunized intramuscularly, at multiole sites, with 150-300/xg of soluble CD4 (sCD4) or cell mem5 branes (1 x 10<sup>s</sup> cells) from the CD4 positive cell line SudTI using a standard adjuvant. Immunization was repeated every 2-3 weeks a total of six times. The monkey was boosted by injection of 100/xg of sCD4 into the inguinal region of one thigh and one week later the draining lymph node from the same thigh surgically removed. Lymphocytes were removed from the lymph node by slicing the tissue and rinsing with sterile DMEM medium. The cell suspension was passed throuch a nylon gauze and collected by centrifugation at 1000 x g for 10 minutes.
Approximately 1 x 10<sup>8</sup> lymphocytes were suspended in
Tris-ammonium chloride buffer (16mM, pH 7.5) and warmed to 37°C for 5 minutes to lyse the erythrocytes. Lymphocytes were collected by centrifugation and resuspended in L-leucine methyl ester (LME) and incubated at 37°C for 45 minutes. The LME treated cells were filtered through a nylon screen and centrifuged. 1ml of fetal calf serum was added, the ..cells suspended and washed twice in serum-free RPMI. The cells were counted and mixed into a single 50ml conical centrifuge tube together with an equal number of
K6H6/B5 heteromyeloma cells, prewashed twice in serum free medium. Cells were gently suspended in 1 ml of 50% PEG (polyethylene glycol) added slowly with gentle stirring over a 1 minute period. The cells were then resuspended by the addition of 20ml of serum-free medium Oer a 5 minute
0 period, with gentle mixing to dilute out the PEG. After washing twice with serum-free medium cells were resuspended at a concentration of 5 X 10<sup>s</sup>/0.1 ml in RPMI medium, containing 20% fetal calf serum and gentamycin and placed into 96 well micro tissue culture plates at 0.1 ml per well.
An equal volume of HAT medium (0.1 ml) was added to each
0 2 10/86 /d/dV
BNSDOCID: <AP
AP1193A I >
AP Ο Ο 119 3
-31well and the hybrids allowed to grow for 14-17 days before screening.
Screening of Fused Cell Hybrids for the Production of
Anti-CD4
The assay to determine anti-CD4 specificity was as follows: ELISA plates were coated with recombinant sCD4 at a concentration of lOOng per well and blocked with 1% bovine serum albumin in PBS. 50 μΐ aliquots of hybridoma ' supernatant were removed from each well and allowed to incubate with the sCD4 coated plates for 60 minutes.
Binding was detected by incubation with <sup>12S</sup>I labeled goat anti-human or goat anti-monkey Ig for 60 minutes. After washing four times with distilled water, the wells were counted in a gamma counter. Positive wells were re-assayed in duplicate and the hybridoma cells from those wells subcloned three times, first at 5 cells per well then twice at 1 cell per well. At this stage anti-sCD4 positive's were screened for the ability to bind to cell surface CD4. This was done by inhibition of binding of an anti-CD4 murine monoclonal, termed 1F3, to the CD4 positive cell line supTl. Briefly this was done by co-incubating different amounts of monkey anti--CD4 and 10μg of <sup>12S</sup>I-labeled 1F3 with 3 x 10<sup>5 </sup>supTl cells/well in a 96 well plate. After incubation for 1 hour at room temperature (about 20-25°C) cells were removed by vacuum onto glass fiber filters. After extensive washing with PBS the filters were counted in a gamma counter to determine the inhibition of 1F3 binding to supTl cells by the monkey hybridoma supernatants.
A candidate clone was chosen which produced an antibody that showed strong inhibition against 1F3 . The clone was isotyped using human isotyping reagents and found to be an IgG2 possessing a lambda light chain. This cell line was grown up to larger numbers for cloning of its immunoglobulin genes.
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
Λ5 <sup>1</sup> 1 9 3
-32Clonina of Heaw and Light Chain Variable Region Genes from Monkev Immortalized B-cells
Total RNA was isolated from 1 x io<sup>7</sup> monkey immortalized B-cells using the guanidinium isothiocyanate method. One tenth of the total RNA was used to make single stranded cDNA using an oligo-dT oligonucleotide primer and reverse transcriptase. One tenth of the amount of single stranded cDNA was used to set up PCR reactions. The six PCR reactions each included one of six 5' V<sub>H</sub> family specific oligonucleotide primers containing a Sal I restriction site together with an IgG 3' constant region oligonucleotide containing an Nhe I site, both shown in Figure 7-1. Similarly, five PCR reactions, utilizing one of five 5' lambda leader sequence oligonucleotide primers containing a
Bel II site and· a 3 ' lambda constant region prime containing an Avr II site, were run. Reaction conditions were as described above. Each PCR reaction was run in triplicate. The products of each of the heavy chain and light chain amplification reactions were run on 1.2% agarose gels. The
VH4 heavy chain primer (5’- ACTAAGTCGACATGAAACACCTGTGGTTCTT 3') and lambda primer (5'
ATCACAGATCTCTCACCATGACCTGCTCCCCTCTCCTCC 3'.) gave strong ,~ί bands on agarose gel electrophoresis. The products of these reactions were used for cloning into the vector TCAE 6, which contains human IgGl and human lambda constant region sequences .
Cloning of the two variable region genes into the expression vector TCAE 6 was done sequentially. First, the heavy chain PCR product and the vector TCAE 6 were digested with the restriction enzymes Sal I and Nhe I, the products extracted with phenol/chloroform, and passed through a SEPEADEX G-25 spin column. The PCR product was ligated to the cut vector overnight at 14°C in the presence of T4 DNA ligase. Approximately 500ng total DNA was ligated in a volume of 10μ1 with an insert/vector molar ratio of- 10:1. Ligated material was used to transform XL-1 Blue competent
AP/P/ 9 8/01209
BNSDOCID; <AP
AP1193A I >
APO0 119 J
-33cells (Stratagene) and the transformed cells plated onto LB agar plates containing 50/ig/ml ampicillin. Colonies of ampicillin resistant bacteria were picked and grown as 5ml mini cultures. Plasmid DNA was extracted from each of these cultures by a standard alkaline lysis method, cut with the restriction enzymes Sal I and Nhe I and the products run on a 1.2% agarose gel. Plasmids with inserts of approximately 450bp were used as templates for the subsequent cloning of light chain variable regions. The products of the light chain PCR reaction as well the plasmid containing the heavy <sup>1</sup> chain insert were cut with the restriction enzymes Βσΐ II and Avr II-and ligated together. Plasmid minicultures were screened by cutting with Βσΐ II and Avr II. Digests giving an .insert of approximately 400-450 bp were scored positive.
Plasmids containing both Sal I/Nhe I and Bel 11 /Avr II inserts were grown up in larger quantities for DNA sequencing. '
The tandem chimeric antibody expression vectors TCAE 5.2 and TCAE 5 were derived from the vector CLDN, which itself is a derivative of the vector RLDNIOb (253 Science, 77-79 (1991)). RLDNIOb in turn is a derivative of the expression vector TND (7 DNA, 651-661 (1988)).
RLDNIOb differs from the vector TND in the following ways. The dihydrofolate reductase (DHFR) transcriptional cassette (promoter, cDNA, and polyadenylation region) was placed in between the tissue plasminogen activator cassette (t-PA expression cassette) and the neomycin phosphotransferase (NEO) cassette so that all three cassettes are in tandem and in the same transcriptional orientation. In addition,
0 the DHFR gene promoter in CLDN has been replaced by the mouse beta globin major promoter (3 Mol. Cell Biol. . 1246-54 (1983)) and the t-PA cDNA replaced by a polylinker. All three eukaryotic transcriptional cassettes (Expression,
DHFR, NEO) can be separated from the bacterial plasmid DNA <sup>4</sup> 35 (pUC9 derivative) by digestion with the restriction endonuclease NotI.
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-34CLDN differs from RLDNIOb because the Rous LTR in front of the polylinker has been replaced by the human cytomegalovirus immediate early gene promoter enhancer (41 Cell. 521 (1985)).
The expression vectors TCAE 5.2 and TCAE S differ from
CLDN in that:
1) They contain four transcriptional cassettes (instead of three), in tandem order:
(a) A human immunoglobulin light chain constant 10 region derived via amplification of cDNA by a polymerase chain reaction. In TCAE 5.2 this is the human immunoglobulin light chain kappa constant region (Rabat numbering amino acids 108-214, allotype Rm3), and in TCAE 6 the human immunoglobulin light chain lambda constant region (Rabat numbering amino acids 108-215, genotype Oz minus, Meg minus, Re minus allotype).
(b) A human immunoglobulin heavy chain constant region; in both constructs the human immunoglobulin heavy chain was a gamma 1 constant region (Rabat numbering amino acids 114-478 allotype Gmla, Gmlz), which was derived via amplification of cDNA by a polymerase chain reaction.
(c) DHFR; containing its own eukaryotic promoter and polyadenylation region.
(d) NEO; also containing its own eukaryotic 25 promoter and polyadenylation region.
2) The human immunoglobulin light and heavy chain cassettes contain synthetic signal sequences for secretion of the immunoglobulin chains
3) The human immunoglobulin light and heavy chain 30 cassettes contain specific DNA linkers which allow for insertion of light and heavy immunoglobulin variable regions which maintain the translational reading frame and do not alter the amino acids normally found in immunoglobulin chains. The incorporation of the changes described, led to the construction of the vectors TCAE 5.2 and TCAE 6. The cloning of the immunoglobulin light and heavy variable
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
AP O 0 119 3
-35region genes, from the anti-CD4 heterohybridoma cell line E9.1, into TCAE 6 led to the construct which is deposited in the ATCC. The construct, which has been deposited, and which encodes for the CE9.l antibody contains the cynomolgus monkey immunoglobulin heavy chain variable region and cynomolgus monkey immunoglobulin light chain variable region, whose sequences are shown in Figures 1 and 2, respectively, cloned from the anti-CD4 hybridoma cell - line E9.1. The heavy chain constant region is of human origin of the gamma 1 isotype and Gmla, Gmlz allotype. The lambda light chain constant region is also of human origin, of the Oz minus,'meg minus genotype and Ke minus allotype. The immunoglobulin genes are cloned into the mammalian expression vector TCAE 6, described in the afore-referenced applications incorporated by reference, which, when electroporated into the mammalian cell line CHO produced a monkey/human anti-CD4 chimeric antibody. The DNA construct described herein, has been used to transform the bacterial strain XL-1 Blue, selected in the antibiotic ampicillin and deposited as a bacterial cell suspension in sterile LB medium containing 15% glycerol.
DNA Sequencing
Plasmid DNA was prepared from 100ml cultures. It was further purified by precipitating (1 volume) with a mixture of 2.5M sodium chloride and 20% polyethylene glycol (6 volumes) on ice for 15 minutes. After centrifugation at 10,000 x g for 20 minutes, the pellet was washed with 70% ethanol, recentrifuged and dried in a Speedivac (Savant).
The pellet of DNA was resuspended in deionized water at a concentration of 150-250 ^g/ml. Sequencing was carried out on 5μσ of double stranded DNA using the technique of Sanger. Sequencing primers which were homologous to sequences within the expression vector upstream and downstream of either the light chain or heavy chain inserts were used. The inserts were sequenced in both 5' to 3’ and 3' to 5' directions.
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APOΟ 1193
-36Two clones of anti-CD4 light chain and two clones of antiCD4 heavy chain each generated from separate PCR reactions were sequenced in parallel in order to determine whether any nucleotide changes had been introduced during the PCR reaction. Both of the chosen heavy chain and both light chain clones were found to be identical over their entire length, confirming that no errors had been introduced during the amplification process. The sequence of the anti-CD4 heavy and light chains are shown in Figures 1 and 2.
Expression of Monkey/Human Chimeric Anti-CD4
The expression vector TCAE 5.2 and TCAE 6 are not only able to be used for stable integrated expression into the cell lines Sp2/0 and CHO but, because it includes the SV40 origin, is also, able to be expressed transiently in the cell line COS. COS cell expression was performed as follows: COS cells were seeded one day before the transfection so that they would be 50-70% confluent the following day. Culture medium was removed and the cells washed twice with
Transfection Buffer (TB - 140mM NaCI, 25mM Tris, 5mM KCl, 0.5mM Na<sub>2</sub>HPO<sub>4</sub> ImM MgCl<sub>2</sub>, ImM CaCl<sub>2</sub>) . 30 μσ of cesium chloride purified TCAE 6 plasmid containing the anti-CD4 monkey/human chimeric heavy and light immunoglobulin chains were mixed with 3ml of DEAE dextran per dish (1 mg/ml in
TB) . The DNA was allowed to incubate with the cells for 1 hour at 37°C. DNA solution was removed and replaced with 3ml of 20% glycerol for 1.5-2.5 minutes, after which the cells were twice washed with TB. Cells were incubated in 5ml of fresh medium containing lOOuM chloroquine for 3-5 hours at 37°C, after which they were washed twice with medium and incubated with normal DMEM for 72 hours. Supernatant (100μ1) from the transfected COS cells was assayed at various dilutions for the presence of antibody by an ELISA-based technique. Goat anti-human lambda was used to coat 96 well assay plates and a peroxidase-labeled goat anti-human'IgG as the detection antibody, under standard
AP/P/ 9 8 / 0 1 20 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-37ELISA conditions. COS cells were found to produce between 10 and 40 ng/ml of monkey/human chimeric antibody. Larger volumes of supernatant were concentrated 10 fold and used in a direct binding RIA to CD4 positive SupTl cells. The parental whole monkey antibody and an irrelevant human immunoglobulin were used as a positive and negative controls respectively. Also, the monkey anti-CD4 and the monkey/human chimeric anti-CD4 were used to inhibit the binding of a high affinity mouse anti-CD4 (1F3) antibody.
These results demonstrated that the monkey/human recombinant antibody (ATCC No. 6903 0) not only binds to CD4 positive cells but is able to inhibit the binding of 1F3 to CD4 positive cells in approximately the same concentrations of wholly monkey antibody or 1F3 itself.
EXAMPLE 2
This example relates to the in vi.tro functional f
characterization of CE9.1, including its effects on T cell proliferation and IL-2 production in MLR, its Fc receptor and complement binding properties, and its capacity to mediate ADCC and CDC responses. In addition, the in vivo effects on CD4 receptor mediation and lymphoid subsets in peripheral blood were analyzed. The following were analyzed. The following materials and methods were used in this example. [Anderson et al, In vitro and in vivo characterization of a primatized mAh to human CD4 : mAb causes CD4 receptor modulation but not CD4 T cell depletion in chimpanzees.]
Materials and Methods
Molecular Construction and Expression cf PRIMATIZED^ AntiCD*
Variable region immunoglobulin genes were amplified by PCR and cloned from a heterohybridoma derived from a monkey immunized with sCD4, as previously described [Newman, R.A. , et al, Primatization of recombinant antibodies for
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
AP O 9119 5
-38immunotherapy of human disease: a macaque/human chimeric antibody against human CD4, Biotechnology, 10:1455 (1992)]. Heavy and light chain variable region genes were inserted into a cassette expression vector, TCAE 6, in a tandem fashion and expressed as an IgGlX after stable integration into DHFR' CHO cells [Newman, supra] . Three rounds of amplification in increasing amounts of methotrexate allowed cell lines to be developed which expressed levels of . antibody in excess of 750ug/mL over 8 days. A production cell line was generated that was grown in suspension culture and progressively expanded before inoculation of a hollow fiber reactor [Evans et al, Large-scale production of murine monoclonal antibodies using hollow fiber bioreactors, BioTechniqu.es 6 (8):762 (1988)].
The mAb CE9.1, was purified by passing culture supernatant from the reactor through a Prosep A column (300 ml, Bioprocessing Inc.), previously equilibrated with phosphate buffered saline pH 7.2, at a rate of 125 ml/min. The column was washed with PBS until a baseline was established and bound antibody eluted with 5 column volumes of 0.2M acetic acid/0.1 M glycine buffer pH 4.0. Recovery was around .90%. The eluate was brought to pH 5.5 and passed t
through a Q-Sepharose column (Pharmacia). CE9.1 bound to the column which was washed with 25 MM Tris-HCl, pH 8.5.
Antibody was eluted with 50mM Tris-HCl, pH 6.5 containing lOOmM NaCl and concentrated by defiltraticn (Millipore Pellicon) against USP injectable normal saline. CE9.1 was finally filtered through a 0.04 urn Nylon<sub>ss</sub> NDP filter (Pall Filtration).
Binding Specificity; Binding of CE9.1 to CD4‘ SuoT-18 cell
Ninety-six well U-bottomed microliter plates (Corning) were preblocked for 1 hr. on ice with PBS containing 0.2% bovine serum albumin and 0.1% sodium azide. SupT-18 cells (l x 10<sup>s</sup>) , prewashed with the same buffer, were incubated for 30 min.· on ice with varying concentrations of CE9.1
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO ·» 1 1 9 3
-3 5(2.4pg/mL - lO^g/mL). Cells were washed twice and incubated for 30 min. on ice with a second layer antibody (FITClabeled goat anti-mouse Ig). Cells were washed twice, resuspended in fixation buffer (2% formaldehyde in PBS) and analyzed using a FACScan flow cytometer (Becton Dickinson).
Binding SOecificitv: Analysis bv flow of binding of CES. 1 tn human oerinheral blood leucocytes
Mononuclear cells were isolated from human peripheral blood using the standard Ficoll/Hypacrue centrifugation technique [Boyum, A., Separation cf blood leukocytes, granulocytes and lymphocytes, Tissue Antigens 4:269 (1974)]. The interface layer containing peripheral blood mononuclear cells (PMNC) were removed, washed with Hank's balanced salt solution (H3SS) and counted. 5 x 10<sup>s</sup> cells were incubated with 20μ1 cf CE5.1 (25 μσ/mL) , for 30 min. at 4°C. Cells were then washed with HSSS and incubated,with 20μ1 goat anti-human IGG-FITC (Fisher Scientific). After incubation on ice for an additional 3 0 minutes, cells were analyzed cn a Becton Dickinson FACScan instrument using auto comoensation and Dre-calibraticn with Calibrite beads.
)
Viable lymphocyte populations were identified by forward vs. right angle light scatter and the total lymphocyte population isolated by gating out all other events.
Subsequent fluorescent measurements reflected only gated lymphocyte events. mAbs used for quantification of doubly stained cells and subsequent studies on chimpanzee blood included, anti-human CD3 (Leu-4-FITC; Eecton Dickinson); fluorescein-conjugated anti-human CDS (Leu-2a-FITC; Becton
Dickinson) ; phvcoerythrin-conjugated anti-human CD8 (Leu-2aΡΞ; Becton Dickinson); phvcoerythrin-conjugated anti-human
CD20 (Leu-16-ΡΞ; Becton Dickinson); fluorescein-conjugated
- goat antihuman IgG F(ab')2 (Cappel); and phycoerythrinconjugated murine anti-CD4 (OKT4; Ortho Pharmaceuticals).
0 2 I 0 1 8 6 /d/dV
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-40Human Tissue Cross-Reactivity
CE9.1 was evaluated for cross-reactivity cn normal human tissues. Biotinylated CE9.1 was tested on cryostatcut frozen sections from 32 different tissues using the avidin-biotin immunoperoxidase technique [Wilchek, M. et al, The avidin-biotin complex in bioanalytical applications, Anal. Biochem., 171:1 (1983)]. SupTl cells (CD4*) were used as the positive control and SB cells (CD4-) as a negative control cell line. An irrelevant biotinylated mouse/human (IgGl) chimeric antibody was used as the negative antibody control.
For most tissues, three separate specimens were examined and reactivity with CE9.1 scored on a scale from 0 to 3*. In some tissues different structures within the tissue were scored separately. For example, in the liver, hepatocytes, bile ducts and Kupffer cells were scored independently.
Species Specificity
Peripheral blood from several common laboratory primates and non-primates was screened with CE9.1 for identification ..of possible cross reactivity of CD4 positive T cells. The group included chimpanzees, baboons, rhesus, cynomolgus and pig tail macaques rats, mice, rabbits and dogs. Blood cells were isolated from 1-5 mL of whole blood by centrifugation (1500 rpm for 5 min) at 4°C and washed by resuspension in equal volumes of PBS. The process was repeated once more and the cells resuspended in equal volumes of fetal bovine serum. Two-hundred microliters of the cell suspension from each species was placed into a 15 mL conical centrifuge tube with 20ul of CE9.1 (25 mg/mL) . The antibody and cells were mixed, placed on ice for 30 minutes then washed thoroughly with HBSS. 20ul of goat anti-human IgG-FITC (Fisher Scientific) were then added and the samples mixed. After incubation on ice for an additional 30 minutes, samples were removed from ice and 10
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APOO1193
-41mL of lysis buffer (0.01 M potassium bicarbonate, pH 7.4, containing 0.16 M ammonium chloride and 0.1 M sodium EDTA), prewarmed to 37°C, was added. Samples were incubated at room temperature for 15 min. followed by centrifugation at
1500 rpm for 5 min. Labeled cell pellets were washed two additional times in HBSS (pH 7.4) containing 1¾ bovine serum albumin and 0.05¾ sodium azide. The labeled ceils were fixed by resuspending in fixation buffer (0.5 M sodium chloride containing 1.0¾ formaldehyde; filtered through a
0.22 urn filter) . Samples were analyzed on a Becton
Dickinson FACScan instrument, as above..
In Vitro Functional Assays: One wav and three wav mixed lymphocyte reaction
Human or chimpanzee T cells (1.3 x 10<sup>s</sup>) were cultured with or without CE9.1 in flat bottomed microwells for seven days with mitomycin C-treated PBMCs (6.0 x 10<sup>4</sup>) obtained from an unrelated donor of human or chimpanzee origin respectively. luCi/well of tritiated thymidine was added to the culture during the last 18 hrs of culture. Microtiter plates were centrifuged, the cell pellets washed with HBSS and then counted in a liquid scintillation counter. Each sample was assayed in triplicate.
Human MLRs were conducted using three separate, unrelated donors as stimulator and responder mixes. This protocol was adopted to maximize the chances of a good response in the HLA-uncharacterized random samples of red cross buffy coat blood. In this protocol, none of the donor blood was treated with mitomycin C or irradiated.
THP-1 cell adhesion assay to measure Fc receptor binding activity of CE9.1.
This assay depends on the bridging of two cell lines, one expressing CD4 and the other Fc receptors, by an anti35 CD4 antibody. The CD4 expressing partner used was the adherent murine fibroblast cell line DAP which hadbeen
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-42transfected with human CD4 (DAP/CD4). The Fc receptor bearing cells were THP-l. DAP/CD4 cells were placed in 9S well flat bottom plates (lOOul/well; 25,000 cells/well) ana allowed to adhere overnight. THP-l cells were resuspended in 50mL of RPMI medium (1 x 10<sup>s</sup> cells/mL) and induced for 24 hrs. at 37°C by the addition of 50U/mL of yIFN.
yIFN-induced THP-l cells were loaded with calcine acetomethoxy ester (CAM, Molecular Probes) as follows; cells were washed with loading buffer (Dulbecco's P5S with Calcium and Magnesium and 0.1% bpvine serum albumin) and resuspended at 5 x 10<sup>s</sup> cells/mL in lOmL of the same .buffer. CAM (lmg/mL in DMSO) was., diluted (1:.5-0) with loading buffer and added to THP-l cell suspensions 1:1 v/v. After incubation for 20 min. at room temperature, 25mL of fresh loading buffer was added to each 4 mL of cell/CAM mixture and incubated a further 40 min. at room temperature. Cells were then washed twice with loading buffer and resuspended at 8 x 10<sup>s</sup><sub>f </sub>cells/mL. Serial dilutions of CE9.1 in PSS (without calcium, magnesium or ESA) were added to wells containing
CD4* DAP cells and incubated for 5 minutes at room temperature. 50ul of CAM loaded THP-l cell suspension was then added and the plates incubated at room temperature for 1 hr. in the dark. Control wells without DAP cells were also assayed. After incubation wells were washed 3 times with PBS. After the final wash, lOOul PBS was added per well, followed by lOul of 20% Triton X-100. After placing on a shaker for 10-15 seconds, plates were read in a Fluoroscan (MTX Lab systems Inc.).
Activated monocvte binding- assay to measure Fc receptor binding activity of CE9.1
The Fc receptor assay was set up as described for THP-l cells above except for the following differences. Monocytes were prepared from fresh human peripheral blood by standard
Ficoll/hypaque and Percoll gradient separation. Monocytes were stimulated with ylFN, as above, but for 48 hrs. Plates
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
AP 0 0 119 3
-43were coated with stimulated monocytes for 24 hrs. and, in this assay, the CD4* line supT-18 was loaded with CAM, described above. SupT-18 cells were then added to the plates coated with stimulated monocytes as described above.
The main difference in this assay is the CD4* cell line CAM loaded and added to the FcR bearing cell on the plate. in the above assay using THP-1 cells, the order was reversed.
Bindincr to FcyRII transfected murine fibroblasts
A murine fibroblast cell line (CDW32-L) , which had been transfected with human FCRH, was obtained from the ATCC. Direct binding of CE9.1 was determined by incubating the antibody in the presence and absence of sCD4. Binding cf CE9.1 was detected by incubation with goat anti-human Ic15 antibodies conjugated to horseradish peroxidase (Southern Biotech) . Fab fragments of CE9.1 were generated by enzymatic digestion and used as negative-controls. r Absorbance values obtained from CE9.1 (and Fab fragments) preincubated with cells in the presence of sCD4 were subtracted from absorbances obtained for the antibodies in absence of sCD4 .
ADCC Assav (lysis of suoTl cells)
Fresh heparinized human blood samples were collected and PMNCs isolated by standard centrifugation procedures on Ficoll/Hypaque. Red blood cells in the buffy coat were lysed with ammonium chloride buffer and the cells were washed twice in Hank's Balanced Salt Solution. Peripheral blood lymphocytes (PBLs) were stimulated with 10 units of
IL-2 per mL of RPMI/10% fetal calf serum (FCS) for 24 hours at 37°C, 5% CO<sub>2</sub>. After 24 hours, the PBLs were resusDended in RPMI/5% FCS.
SupTl-18 cells (1 x 10<sup>s</sup>) were labeled by incubating with 100 uCi <sup>51</sup>Cr for 1 hour at 3 7°C, 5% C0<sub>2</sub>. The cells were washed twice with RPMI/5% FCS and 1 x 10<sup>4</sup> cells were added to each well. Three lots of CB9 . l antibody were serially
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 01193
-44diluted 1:2 with RPMI/5% FCS and aliquots added in triplicate to the SUPT1-18 containing wells for 30 minutes at 37°C, 5% CO<sub>2</sub>. 100 uL of 1% Triton X-100 and 100 uL of media was used as maximal and spontaneous release controls respectively. The IL-2 stimulated PBLs (8 x 10<sup>3</sup> cells) were added to the wells. The plates were centrifuged for 3 minutes at 900 rpm and incubated for 16 hours at 37°C, 5% C0<sub>2</sub>. The supernatant from each well was collected and. the amount of radioactivity counted in a gamma counter. The . 10 assay was performed in triplicate. Percent cell lysis was determined using the following formula:.
% Lysis = (Sample count - Spontaneous) x 100 Maximal - Spontaneous
Cla binding assay
The Clq assay was performed using the SupTl-18 GD4 positive cell line in a suspension of 4 X 10<sup>s</sup> per mL. CE9.1 and control affinity purified monkey anti-CD4 antibody (50 ul) at equivalent concentrations of 20 ug/mL were added to 2 x 10<sup>s</sup> CD4 positive target cells. The cell suspension and antibodies were incubated for 1 hour on ice then washed ’ twice with 1% BSA in PBS. Fifty uL of human Clq (10 ug/mL) was added to each tube and incubated 1 hour on ice. Each tube was washed twice, then incubated (1 hour, cn ice, in the dark) with a 1:15 dilution of rabbit anti-human Clq FITC (50 uL) . Cells were washed again twice and fixed in 0.5 mL of 1% formaldehyde/PBS. The cells were analyzed on a Becton Dickinson FACScan flow cytometer using Consort 30 software for data acquisition and analysis.
Complement mediated, cytotoxicity assay
SupTl-18 cells (1 x 10<sup>6</sup>) were labeled by incubating with 100 uCi <sup>sl</sup>Cr for 1 hour at 37°C, 5% CO<sub>2</sub>. The cells were
5 washed twice with RPMI/5% FCS and 1 x 10* cells were added to each Well. CE9.1 and control anti-CD4 antibodies were
AP/P/ 98/01209
BNSDOCID: <AP
AP1193A I >
APOΟ 119 3
-45serially diluted 1:2 with RPMI/5% FCS and 50 ul aliquots added in triplicate to the SUPT1-18 containing wells. 100 uL of 1¾ Triton X-100 or 100 uL of media were added to wells to measure maximal and spontaneous release of <sup>sl</sup>Cr respectively. Following a 90 minute incubation at 37°c, 5¾ CO<sub>2</sub>, a 1:5 dilution of rabbit complement (Cappel) was added to the wells. The plates were incubated another 90 minutes at 37°C, 5% CO<sub>2</sub> and then centrifuged for 3 minutes at' 900 rpm. The supernatant from each well was collected and the amount of radioactivity counted on a gamma counter. The assay was performed in triplicate. Percent cell lysis was determined using the following formula:
% Lysis = (Sample count - Spontaneous) x 100
Maximal - Spontaneous
In vivo studies in chimpanzees '
Six chimpanzees were divided into three groups of two animals each: group I (saline control); group II (10.0 mg/kg
CE9.1 antibody) and, group III (10.0 mg/kg CES.l antibody).
Group II animals were retreated with lOmg/kg of CE9.1 after
3 0 days, providing their CD4* T cell counts had returned to
30% of baseline. Group III animals were retreated with 10.0 mg/kg after 3 0 days providing their CD4* T cell counts had returned to 70% of baseline. If these values were not achieved by day 30, the animals would be screened for CD3*, CD4‘, and CD8* T cell values at biweekly intervals until the CD4‘ T cell values attained the respective target value for that group. At this time the animals would again receive
10.0 mg/Kg of CE9.1 antibody intravenously, up to a maximum of three doses.
Baseline determinations of the total white blood cell count, lymphocyte and granulocyte values, and of the CD3*, CD4* and CD8* lymphocyte subpopulations were performed on day -6, on day 0 immediately prior to dosing and again at 24 hours and 14 days after dosing. Three treatment cycles each
AP/P/ 9 8 / 0 1 20-9
BNSDOCID: <AP
AP1193A I >
-46with 10 mg/kg doses were administered to the chimpanzees cn this study.
Results
Binding specificity of mAb CE9.1
Affinity measurements by SPR for the binding of CE9.1 to soluble CD4 show a Kd of 1.0 nM (Brigham-Burke et al. North American BIAsymposium 1995 (in press) ) . No binding was seen to CD4* cell lines and inhibition studies demonstrated that binding to CD4* cells could be completely abolished by soluble CD4 in a stoichiometric manner.
To determine the specificity of CE9.1 reactivity, binding to freshly isolated human PBMCs was determined by dual color flow cytometry analysis. Figure 9 shows that about 2/3 of the CD3* cells bind CE9.1. Within the lymphoid subpopulation, all cells which bound 0KT4 were also positive for CE9.1, while CD8* cells were all negative. Some' CD3cells also showed reactivity with CE9.1, although the nature of this reactivity has not been clearly determined.
Immunohistochemical analysis was conducted to determine tissue reactivity of CE9.1, including 32 different normal human tissues of lymphoid and non-lymphoid origin. Nonlymphoidal tissue included the major organs, brain, heart, skeletal muscle skin, liver, kidney, glandular and reproductive tissues. Such analysis showed no cross reactivity to any tissue other than those of lymphoid origin including lymph nodes, spleen, tonsil and peripheral blood (data not shown). Staining, confined to lymphoid aggregates was also observed in large intestine, lung, esophagus and skin.
σ>
o
CM
O
L
CL
Inhibition of human MLR bv CE9.1
The effect of CE9.1 on T cell responses was evaluated by human MLR, as IL-2 production or proliferative resoonses.
CE9.1 blocked both proliferation and IL-2 production with
BNSDOCID: <AP
AP1193A I ?
APO 0 119 3
Ο
Θ
-47IC<sub>SO</sub> of 10-30 ng/ml, with about 80% inhibition at 60 ng/ml (Figure 10).
Fc Receotor Binding Activity of CE9.1
CD4 and Fc receptor based cell-cell adhesion assays were developed to determine the reactivity of CE9.1 with Fc receptors on monocytic cells. In one assay configuration, monocytes were isolated from fresh PBMCs by percoll gradient centrifugation, seeded into microliter plates and stimulated with ylFN for 48 hours. After 48 hours, dye loaded CD4* SupTl cells were added to the activated, adherent monocytes in the presence or absence of CE9.1. In a second configuration of this adhesion assay, the monocytic, ncnadherent cell line, ΊΉΡ-1 was stimulated with yIFN. After 24 hours, the activated THP-1 cells were loaded with a marker dye and added, in the presence or absence of CES.i, to adherent, CD4*, fibroblast transfectants which had previously (24 hours earlier) been plated into microliter plates. In both cases, cell-cell adhesion is dependent on binding of the mAb to CD4 on one cell and Fc receptors on the other cell.
Data presented in Figures 10a, 10b and 10c, based γΙΓΝ activated fresh monocytes and the CD4* SupTl T cells, shows CE9.1 mediates cell-cell adhesion in a dose dependent manner, with an approximate ED<sub>S0</sub> of 20 ng/ml. Adhesion was completely blocked by sCD4, and could not be mediated by the F(ab')2 fragment of CE9.1. Monocytes not activated by γίρη were unable to bind CE9.1 9 (Figure 10b). Similar data was also obtained with the assay based on the THP-1 and CD4* fibroblast assay (data now shown) . Direct binding of CE9.1 to a murine fibroblast line transfected with human FCyRII receptors was also observed (data not shown).
Antibody Dependent Cell Mediated Cvtotoxicitv (ADCC)
Radiolabeled SupTl cells, used as targets in an ADCC assay were' shown to be specifically lysed by effector cells
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APOΡ1 1 9 3
-48in the presence of CE9.1. Maximal cytotoxicity was reached at approximately 6 ug/mL with a total specific lysis of around 50% (Figure 12). Asa positive control, a murine anti-CD4 of the IgG2a isotype (4D9) was used. This antibody behaved very similarly to CE9.1 giving the same level of total cell lysis. CE9.1 therefore was very effective in binding Fc receptors on effector cells and mediating the killing of CD4* target cell lines.
- > 10
<img file="AP1193A_D0001.tif" />
Complement fixation bv CE9.1
Binding of Clq was measured by flow cytometry, as described above (Materials and Methods). As shown in Figure 13, despite the fact that CE9.1 contained a human heavy chain constant region of the gamma 1 subtype, it showed only minimal binding of Clq (Figure 13). Affinity purified monkey anti-CD4 serum antibodies were effective in mediating Clq binding, suggesting that the lack of Clq binding by CE9.1 is a property specific to this antibody. The lack of Clq binding by CE9.1 is reflected in the inability to fix complement (Figure 14). Affinity purified anti-CD4 antibodies from monkey serum and a murine monoclonal IgG2a both produce significant lysis over the same concentration range .
AP/P/ 9 8 / 0 1 2 0 9
CE9.1 SOecies cross reactivity
Flow cytometry analysis of lymphocytes from different species showed that only chimpanzee and human cells bound CE9.1 strongly. Baboon was the only other species to show a weak reactivity with CE9.1 (10-fold lower than human).
Human and chimpanzee lymphocytes reacted equally well with the mAb (Table 2). This was reflected in a comparable inhibition of T cell proliferation and IL-2 production in chimpanzee MLR by CE9.1 antibody (data not shown).
BNSDOCID: <AP
AP1193A I >
APO ο 119 3
-49TABLE 2
<td></td><td> Species</td><td> Reactivity </td>
<td></td><td> Human</td><td></td>
<td></td><td> Chimp</td><td> +++</td>
<td> 5</td><td> Baboon</td><td> +</td>
<td></td><td> Rhesus</td><td> -</td>
<td></td><td> Cynomolgus</td><td> -</td>
<td></td><td> Pigtail macaque</td><td> -</td>
<td></td><td> Dog</td><td> -</td>
<td> 10</td><td> Rabbit</td><td> -</td>
<td></td><td> Rat</td><td> -</td>
<td></td><td> Mouse</td><td> -</td>
<img file="AP1193A_D0002.tif" />
Ί
In vivo study in 6 chimpanzees
Based on the lack of depletion of CD4 cells in the escalating dose study in a single chimpanzee, a dose of lOmg/kg was given to 4 chimpanzees (in addition 2 animals in a control group received saline) . As described in the
Materials and Methods, the two dose groups were each.given /
lOmg/kg on day 0 of the study. Figure 15 summarizes the effects on CD4 and CD8 counts in these animals. It can be seen that there was a decrease in cells expressing the CD4 receptor immediately following antibody administration. The reduction in CD4 counts was only seen immediately after each dose of antibody given. No similar change in CD4 counts was seen in the saline control group. CD8 counts remained unaffected throughout the course of treatment although variability on a daily basis was observed (Figure 15, left hand panel, open circles) . By examining the CD3’ - CD8* population, less dramatic drops in CD4 numbers were observed. The data suggest the appearance of CD3 CD8- T cell populations which may be the result of CD4 antigen modulation. The exact mechanism of modulation is unclear at this stage, but may include internalization or shedding cf CD4 molecules as a. result of cross-linking by Fc receptors expressed on other lymphoid or monocytic cells. Comparison of the cell numbers in Figure 15 show that some depletion of CD4* cells may be occurring although the major effect is due
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
AP O Ο 119 3
-50to CD4 receptor modulation. In most cases the modulatoryeffect appears to last for about 7-10 days directly following the administration of antibody, after which, CD4 expression returns to just below baseline levels.
The total CD4 counts remain depressed relative to the baseline time point by 10-50% but after cessation of treatment, return to the normal range. The chimpanzees were followed fcr a period of up to 150 days (groups 1 and 2) or
00 days (group 3) . The group 2 animals' CD4 counts had 10 returned to normal levels at 80 days post final treatment whereas the group three animals had returned to within 20% of baseline within the same time frame.
EXAMPLE 3
This example describes the genetic construction of the
DNA expression vector used in mammalian cells to produce ΟΕ9γ4ΡΕ which is a macaque/human chimeric anti-CD4 antibody containing a human γ4 isotype incorporating the P and E changes .
Construction of DNA Expression Vector i ) Human gamma 4 heavy chain gene was isolated by PCR from 'the cell line TPIT10.4 (obtained from S. Morrison, UCLA) using the 5' IDEC primer # 479 and the 3' IDEC primer # 462 (see Figure 16) which contained Nhe I and SamH I sites respectively. The entire cloned fragment of the human gamma has been sequenced and found to be identical to that described in Rabat et al (NIH Publication Fifth Edition No. 91-3242, U.S. Dept. of Health and Human Services (1991)) (see Figure 17). The Nhe I/BamK I fragment was cloned into an expression vector Anex 2. The entire light and heavy chain immunoglobulin genes from this plasmid were moved to another expression plasmid on a Bgl II to Sac I fragment. This plasmid was called anti-CD4 (G4,L,Oz-) in NEOSPLA3F.
PCR mutagenesis was used to change amino acids # 229 and 236 in the gamma 4 constant region. PCR was performed
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APOΗ 193
-Slus ing a 5' primer GE212 (Midland) and the 3' IDEC primer # 698 containing Nhe I and SspH I restriction sites respectively (see Figure 16) , and the fragment was cloned into the anti-CD4 (G4,L,Oz-) plasmid in a three part ligation and sequence plasmid was called anti-CD4 (G4(PE),L Oz-) in NEOSPLA3F.
EXAMPLE 4
EXPRESSION IN CHINESE HAMSTER OVARY (CHO) CELLS
Integration of plasmid and selection for antibody producing clones
CHO cells (DG44) (Urlauh et al., Som. Cell Mel, Genet.. 16:555-566 (1986)) were grown in CHO-S-SFM II media containing (GIBCO/BRL, CHO media) , 50 uM Hypoxanthine and 8 uM Thymidine (GIBCO/BRL, CHO media) . This media is called CHO media plus HT.
Five electroporations were performed with 4 x 10<sup>s</sup> cells and 5 ug of plasmid DNA [Anti-CD4 (γ4 (PE) , Lambda, OZ-) in NEOSPLA3F] using a BTX 600 electroporation device (BTX, San
Diego, CA) in 0.4 ml disposable cuvettes. Prior to electroporation the plasmid had been restricted with Pac I ) which separates the genes expressed in mammalian cells the j portion of the plasmid used to grow the plasmid in bacteria.
Conditions for electroporation were 230 volts, 400 25 microfaradays, 13 ohms. Each electroporation was plated into a single 96 well dish (about 40,000 cells/well) .
Dishes were fed with CHO media + HT containing G418 (Geneticin, GIBCO) , at 400 ug/ml active compound, two days following electroporation, and thereafter as needed until colonies arose. Supernatant from confluent colonies was assayed for the presence of chimeric immunoglobulin by an ELISA specific for human antibody. Twenty eight G418 resistant colonies arose on five plates (out of 4S0 wells). The G418 resistant colony expressing the most antibody, clone, 5C1 was confluent 30 days after electroporation.
Southern blot analysis shows that clone 5C1 is a single copy
AP/P/ 9 8 / 0 1 2 09
BNSDOCID: <AP
AP1193A I >
AP'C π 1 1 9 3
-52integrant (data not shown) . In a four day culture seeded at 10<sup>s</sup> cells/ml in a 125 ml spinner, this clone doubled every 28 hours, and had an antibody production rate of 0.5 pg/cell/day (0.9 mg/L).
ΑιώόΙ ifi ca. ti on r·
Clone 5C1 was scaled up and plated at various concentrations from 10<sup>s</sup> cells/plate to 3 x 10<sup>4</sup> cells/plate into 96 well dishes containing CHO media + 5 nM Methotrexate (MTX, Sigma (*) Amethopterin) . Twenty days later clone 5C15B9 became confluent on the 3 x 10<sup>s</sup> cells/plate (49 of the 96 wells grew -on this plate). This clone was scaled uo. In a four day culture seeded at 10<sup>s</sup> cells/ml in a T150, this clone doubled every 35.5 hours, and had an antibody reduction rate of 15.3 pg/cell/day (18 mg/L). Clone 5C1-5B9 was scaled up and plated at various concentrations from 10 0 cells/plate to 3 x 10<sup>4</sup> cells/plate into 96 well-dishes containing CHO media + 50 nM Methotrexate. Thirty six days later clone 5C1-5B9 50C1 became -60 % confluent on the 10<sup>s</sup> cells/plate (50 of the 96 wells grew on this plate). This clone was scaled up.
Cell Banks for Phase I Sumolies of CE9y4PE Parent Seed Stock (PSS)
A 50 nM MTX PSS of the clone 5C1-5B9-50C1 was frozen down. The cells were cultured in a 500 ml spinner containing CHO medium plus 50 nM MTX. At the time of the freezing, the culture had attained a density of l.l x 10<sup>6 </sup>cells/ml with a 96% viability and a doubling time cf 29.3 hours. Antibody production was determined by a sandwich ELISA to be approximately 27 pg/cell/day. The cells were centrifuged out of the medium and vialed ac a density of 2.0 x 10<sup>1</sup> cells/ml in 95% JRH Biosciences Fetal Bovine Serum and 5% Sigma this common master mixture, 1 ml of freeze medium with cells was vials frozen. The vials were frozen at -70°C and the following day placed in a liquid nitrogen tank.
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO01193
-53One 50 nM MTX PSS vial was thawed and seeded into a 100 ml spinner containing CHO medium plus 50 nM MTX. Three days later this spinner was split into 2 x 125 ml spinners at 2 x 10<sup>s</sup> cells/ml; one spinner containing CHO medium plus 50 nM
MTX and the other CHO medium only.
Three days later 15 mis of the cells and medium from the CHO medium only spinner were frozen and sent to Tektagen for Points to Consider Mycoplasma testing. Production runs both with and without MTX were continued for eight weeks.
Results from Tektagen showed Anti-CD4 (gamma 4(PE), Lambda, OZ-) NEOSPLA3F in CHO; clone 5C1-5B9-50C1 Parent Seed Stock to be Mycoplasma free. Ten vials of the of the 50 nM NM PSS were transferred for storage in liquid nitrogen.
Master Cell Bank (MCB)
Two 50 mM MTX PSS vials of clone 5C1-5B9-50C1 were thawed and seeded into a 100 mL spinner flask containing CHO medium, plus 50 nM MTX. The culture was expanded for six days into progressively larger spinner flasks until it had attained a volume of 2000 mL, with a density of 9.5 x 10<sup>s </sup>.and a viability of 98%. The cells were centrifuged out of the media and resuspended at a density of 2.0 x 10<sup>7</sup> cells/ml in 95% JRH Biosciences Fetal Bovine Serum, and 5% Sigma Hybrimax DMSO. The cell suspension in freezing medium was aliquoted (10 mL) into each of 80 cryovials designed as MCB G4PE50-M-A. The vials were frozen at -70°C. Twenty four hours later the cell bank was transferred for storage in liquid nitrogen.
EXAMPLE 5
Stability of CD4 mAbs
The physical and chemical stability of ΟΞ9γ4ΡΕ and
ΟΞ9γ4Ξ solutions are monitored over 3 months at 5°, 40°C, and diffused light by SDS-PAGE (reduced and non-reduced),
IEF, reverse phase-HPLC, size exclusion chromatograohy (SEC), and ELISA. Initial testing by RP-HPLC and nonAP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-54reduced SDS-PAGE suggests that CE9y4E is composed of two major soecies namely, the non-reduced whole molecule and a non-covalently associated molecule which, under the conditions of the analysis, breaks apart into two equal units labeled halfmers. Interestingly, no major differences in bio-analytical profiles of these two mAbs were observed by SEC, IE?, SDS-PAGE (reduced) and ELISA.
The amounts of halfmer in CE9y4PE are less than 1% by either RP-HPLC or SDS-PAGE (non-reduced) . Figure 18 shows the SDS-PAGE (non-reduced) analysis of monomer and halfmer in solutions of CE9y4PE and CE9y4E. The amount of halfmer in CE9γ4Ξ-remained constant relative to initial testing over the three months at any of the conditions tested. Halfmer content in CE9y4PE remained under 2% at all time conditions tested. No major differences in stability between CE9y4E and CE9y4PE were observed at 5° and 40°C). CE9y4E solution stored under diffused light is slightly less stable -than CE9y4PE. The data suggests that the halfmer in CE9y4E does not have a significant effect on the overall stability of the whole molecule. No major differences in the physical stability of CE9y4PE and CE9y4£ solutions were observed.
Affinity and Stoichiometry of CD4 mAbs bv Surface Plasmon
Resonance
The stoichiometry of binding of soluble CD4 to immobilized mAbs can be determined by saturation binding experiments on BIAcore (Pharmacia) . Data for the association and dissociation phases of the SPR progress (Figure 19) were analyzed directly using the integrated form of the rate equations as described in O'Shannessey et al. , Anal. Biochem., 212:467-463 (1993). A summary cf the binding data, expressed as moles CD4/mole mAb is presented in Table 3 . It can be seen from this data that in all cases, the stoichiometry of binding is greater than 1.5:1.
Given that BIAcore is a solid phase interaction system and that the immobilization protocol is random, these results
AP/P/ 9 8 / 0 1 209
BNSDOCID·. <AP
AP1193A 1 >
&PΟ 0 1 1 9 3 suggest that both antigen binding sites of each mAb are functional. Thus, the stoichiometry of CD4 binding was'the same for all mAbs and close to the theoretical value of 2.0. Furthermore, affinity measurements show the affinity to be the same for all mAb complexes, namely approximately l.o nM.
TABLE 3
Stoichiometry and Affinity of Binding 10 Measured by Surface Blasmon Resonance
<td> Antibody</td><td> BiAcore Stoichiometry</td><td> Affinity (nM 25°C)</td>
<td> CE9.1</td><td> 1.56</td><td> 0.99</td>
<td> CE9y4</td><td> 1.61</td><td> 1.34</td>
<td> CE9y4E</td><td> 1.72</td><td> 1.43</td>
<td> CE9y4XK</td><td> 1.67</td><td> 1.08</td>
<td> CE9y4PE</td><td></td><td> 1.09</td>
EXAMPLE 6
IN VITRO BIOLOGICAL EVALUATION OF CE9y4PE
Summary
CE9.1, CE9“4PE, and the other gamma 4 derivatives were compared for activity mediated by the Fab region (MLR) and the Fc domain (Fc receptor binding, ADCC, and CDC). Fab dependent activity (MLR) did not differ among the mAbs but they were distinguished in their Fc receptor binding properties. The unmodified gamma 4 derivative ΟΕ9γ4 showed • surprisingly strong binding to Fc receptors, but the Ξ mutation in CEy4E and CE9y4PE ablated this binding as well as ADCC activity.
Effect of mAbs on Mixed Lymnnccvte Responses (MLR)
A three way mixed lymphocyte response (MLR) assay was performed to determine the effect of the mAb constructs on allo-antigen driven T cell proliferation and EL-2 40 production. MLRs are dependent on the presence CD4* T cells, and a large proportion cf the response is dependent
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-55on the participation of the CD4 receptor through its interaction with MHC Class II molecules on antigen presenting cells. The MLR response is an in vitro correlate of aspects of transplant rejection in vivo. In terms of other pharmacological agents, MLRs are also blocked by immunosuppressive agents such as cyclosporin A.
All mAb constructs were equivalent in their ability to block MLR, read out both as proliferative response of T cells and IL-2 production (Figure 20 and Table 4) . Thus, grafting of V domains of CE9.1 onto human λ 4 structures, and the P & E substitutions in the hinge and CH2 domains did not affect the ability of the mAbs to block CD4-dependent T cell responses in vitro.
TABLE 4
Effect of mAbs on MLR - Summary
<td> Antibody</td><td> Proliferation (IC50)</td><td> IL-2 Production (IC50)</td>
<td> CE9.1</td><td> 20 ng/ml</td><td> 5 ng/ml</td>
<td> CE9y4</td><td> 20 ng/ml</td><td> 5 ng/ml</td>
<td> CE9y4E</td><td> 20 ng/ml</td><td> 10 ng/ml</td>
<td> CE9y4XK</td><td> 20 ng/ml</td><td> 20 ng/ml</td>
<td> CE9y4PE</td><td> 20 ng/ml</td><td> ND</td>
AP/P/ 98/01209
Conclusion
All mAbs are equivalent in the inhibition of MLR.
Fc Receptor Binding Properties of mAbs
Validation of Assay for Determination of Fc Receptor Binding
CE9y4PE was designed to be devoid cf FcR binding activities. To measure this activity, an assay was 3 5 developed based on FcR and CD4 mediated attachment of cells through bridging via mAbs. This assay measures the CD4 and
FcR binding functions of mAbs simultaneously, as an in vitro correlate of FcR and mAb-mediated depletion of CD4 cells in vivo.
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-57Figure 21 demonstrates that CE9.1 facilitates adhesion of FcR-expressing monocytic cells (IFN-γ-induced ΊΉΡ-1 cells) to 004’ fibroblasts (CD4 transfected fibroblast cell line) in an adhesion assay. Binding is dependent on the Fc5 domains of the mAb CE9.1, since the truncated F(ah')2 could not facilitate binding. Binding also requires, the antigen recognition site of the CZS.l because its occupation with sCD4 blocks cell-cell attachment.
Determination of Fc Receptor Binding Activities of mAbs mAbs CE9.1 (IgGl), CE9y4 (IgC-4) , CE9y4XK (IgG4 XK hybrid), ,CE9y4E (IgG4, Ξ mutant) and CE9y4PE (IgG4, ΡΞ mutant) were evaluated for their ability to bind, simultaneously, ceil surface CD4 and FcR.
As was hoped, CE9.1 had good binding activity in this assay. Surprisingly, the IgG4 constructs CE9y4 and CE9y4XK retained sufficient affinity for FcR that they were·' indistinguishable from CE9.1 in this assay. Activity in this assay was lost only when the E substitution was introduced as in CE9y4E and CE9y4PE (see Figure 22) .
In vitro Cla Binding Pronerties of CE9y4PE
The complement system contains, among its various functional components, the ability to interact with certain types of antibodies in a manner which leads to cell lysis and destruction. Human IgGl antibodies normally possess the capability to bind Clq and deplete target cells bearing surface antigens for which they have specificity. Other human isotypes such as IgG4 exhibit reduced ability to bind
Clq and thus would be unable to deplete target cells. The engineering of CE9y4PE in a gamma 4 construct would, in theory, achieve the objective of preventing complement fixation and allow the antibody to bind to CD4 target cells eliminating potential destructive side effects.
Comparison of CDC effector properties of CE9y4?E and
CE9.1 were accomplished using the classical method cf
AP/P/ 98/01209
BNSDOCID: <AP
AP1193A I >
APO01193
-58complement mediated cytolysis cf chromium labeled CD4’ SucTl cells in the presence of rabbit complement. In these studies, a murine complement fixing mAh to HuCD4, 4D9 (IgG2a), was used as a positive control. Both CE9.1 and ' 5 CE9y4PE were ineffective in fixing rabbit complement (Figure 23). It was noted earlier that CE9.1 binds Clq poorly and thus unable to fix human complement. These results show that both constructs are unable to promote cell lysis through complement effector mechanisms.
Γ) 10
In vitro ADCC Effector Properties cf CE9y4FE
Cells with cytotoxic potential that can bind mAbs via
FcR can mediate ADCC directed to antibody-coated target cells. Human.T helper cells expressing the CD4 molecule are recognized by mAb CE9.1 which triggers cytolytic attack by FcR-bearing killer cells, granulocytes and/or macrophages. The objective in the engineering of CE9y4PE was to remove the ability of the mAb to bind to FcRs, which would eliminate the ability of accessory cells to mediate depletion of CD4 target cells, while still allowing the mAb Λ to remain immunosuppressive.
' > Comparison of ADCC effector properties of CE9y4?E and
CE9.1 were accomplished using the classical method of cellmediated cytolysis of chromium labeled CD4* SupTl cells.
The murine CD4 mAb 4D9 (IgG2a,K) was chosen as a positive control. Effector cells were human peripheral blood leukocytes obtained from a huffy coat. Figure 12 shows the abilities of both mAbs 4D9 and CE9.1 to mediate specific lysis of CD4’ cells. Under identical conditions, CE9y4PE had very little effect.
These results show that CE9-f4?E is unable to mediate cell lysis through either FcR cr complement mechanisms.
AP/P/ 9 8 / 0 1 20 9
BNSDOCID: <AP
AP1193A I >
APO0 1 19 3
-59EXAMPLE 7
COMPARATIVE PK ANALYSIS OP CE9y4E AND CE9y4PE Comparative pharmacokinetics cf two lead X4 mAbs,
CE9y4E and CE9y4PE, was investigated in male Sprague-Dawley rats. ΟΞ9γ4Ε or CE9y4PE was administered as an iv bolus dose at 1 mg/kg (four animals per group), and blood samples were taken for 4 weeks post dose. Plasma ΟΕ9γ4Ε and ΟΞ9γ4ΡΕ concentrations were determined using a sCD4/anti-human IgG sandwich ELISA designed to confirm not only the presence of circulating human IgG, but also the ability to bind recombinant human soluble CD4.
Following a 1 mg/kg intravenous bolus administration of CD4 mAb, CE9y4E plasma concentrations declined in a triphasic manner, 'and CE9y4?E plasma concentrations declined in a biphasic manner (Figure 24) . For comparative purposes, and due to an insufficient number of data points to adequately describe the terminal phase for CE9y4E, a'll plasma concentration-time profiles were analyzed using a biphasic model. Small inter-subject variability was observed. The predominant secondary phase t<sub>1/2</sub> was approximately 4 days for CE9y4E, and 9 days for CE9y4PE, and accounted for 67% and 93%, respectively, of the total area under the plasma concentration-time curve. The apparent plasma clearance for CE9y4PE was low (6.4 ml/hr/kg), and was approximately half the clearance of CE974E· (1.0 ml/hr/kg). Thus, the pharmacokinetic characteristics of the PE mutant γ4 mAb, ΩΞ9γ4ΡΕ, are similar to other humanized γΐ mAbs in rats .
The long circulating half-life of functionally intact
CE9y4PE in the rat also suggests that CE9y4PE is likely to be effective over an extended period of time when administered to man.
These results confirm that the PE mutant CE5y4?E has a
2-fold lower plasma clearance and a longer half-life than
CE9yE mutant in the rat.
AP/F/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APC 0 119 3
-60TABLE5
Pharmacokinetic parameters (Mean ± SD) of CE9y4E and CE9-y4PE following a 1 mg/kg iv bolus to make Sprague-Dawley rats
<td> CD4 mAb</td><td> CL (ml/hr/kg)</td><td> AUC^ (ug X hr/ml)</td><td> MRT (hr)</td><td> •p -1 <sup>T</sup>l/2 (hr)</td><td> *r -2 *1/2 (hr)</td><td> SAUC, /·</td><td><sup>V</sup>SS (ml/kg)</td>
<td> CE5ME</td><td> 0.999±137</td><td> 1010±130</td><td> I09±12</td><td> 15.2±3.8</td><td> 97.7±29.5</td><td> 55.7±14.2</td><td> 109±14</td>
<td> CE9y4E</td><td> 1.32±0.30</td><td> 760±138</td><td> 79.5 ±16.0</td><td> 16.6±6.9</td><td> 95.3 ±30.8</td><td> 52.1 ±20.0</td><td> 1O3±18</td>
<td> CE9y4PE</td><td> 0.410±0.074</td><td> 2500±440</td><td> 295±43</td><td> 9.9±3.3</td><td> 224±33</td><td> 93.4 ±2.2</td><td> 119± 16</td>
Abbreviarions of pharmacoldneric parameters: CL = total plasma clearance; AUCq^ total area under the plasma concentration versus time curve: MRT =» mean residence time; Τ<sub>1Λ</sub>'* = apparent half-life in the initial phase: T<sub>1/2</sub>'<sup>2</sup> «· apparent half-life in the secondary phase: %AUC<sub>2</sub> = percentage of the area under the plasma concentration versus tune curve during the secondary phase; = volume of distribution at steady sate.
Based on these results, ΟΕ9γ4ΡΕ should be suitable for therapeutic use, e.g., by i.v. administration. Also, other routes of administration may also be suitable. ,
EXAMPLE 8
IN VIVO PHARMACOLOGICAL STUDIES IN HuCD4<sup>+</sup> TRANSGENIC MICE
Description of HuCD4 Transgenic Mice
Introduction ) The high decree of species specificity of CE9I and
CE9y4PE complicates assessment of efficacy in vivo. For CE9.1 pharmacological response could be readily monitored, in the chimp, through a dose-dependent depletion of CD4<sup>+</sup> cells. The expected absence of this activity in CE9y4PE induced us to use other means to assess efficacy. In particular, efficacy is being studied in HuCD4 transgenic mice. Studies in this system are described below.
5 HuCD4<sup>+</sup> Transcrenics
In the HuCD4 transgenic mice developed at UCSr (Killeen et al. , EMBO J., 12:1547-53 (1993)), the endogenous MuCD4 gene was disrupted by homologous recombination and a human CD4 mini - transgene was introduced under the regulation of
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 01193
-61the MuCD4 promoter. In these mice, which have now been cross-bred to homozygosity, HuCD4 substitutes for MuCD4. HuCD4 restores positive and negative selection in the thymus, leading the production of single positive peripheral
CD4<sup>+</sup> or CD8<sup>+</sup> T cells, at levels computable to those found in normal mice. Moreover, compared to the MuCD4 knockout parent, mature HuCD4 T cells demonstrate properties akin to their normal murine counterparts: (l) in vivo, serum IgG levels are restored to normal levels and (2) these animals show the appropriate MHC-dependent responses in in vitro NMR.
The genetic background of these mice is somewhat complex due to the need to use different strains of embryonic stem cells and mice and in the original knockout and transgenic experiments. The original knockout/transgenic mice were subsequently bred to homozygosity in the MHC locus, and the mice in current use at SB are of the H-2<sup>dd</sup> haplotype.
Results have shown that a good response to a foreign antigen, ovalbumin, is obtained in these HuCD4 mice, and initial studies have demonstrated in vivo activity for CE9y4PE.
Preliminary Evaluation of CS9y4PE in HuCD4 Transoenic Mice
Twelve HuCD4-transgenic mice (H-2<sup>dd</sup>) were received, and used to compare CE9y4PE with IF3 (murine anti-human CD4) and GK1.5. Mice were dosed on day -2, -1 and day 0 with 1 mg of antibody i.p. and immunized with OVA 3 hr following the last dose. Mice were sacrificed 2 weeks later and serum and cells evaluated for functional activity. The OVA-specific antibody response is shown in Figure 25. As expected the mAb to mouse CD4 (GK 1.5) had no effect on the humoral response, whereas both mAbs to HuCD4 blocked this response. CE9y4?E was the more dramatic of the two mAbs.
All groups of mice responded to Con A and LS, however, there was some variation in the response to ovalbumin and in
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 0 119J
-62the MLR. This may have been due to the fact that this batch of animals contained both male and female mice and were of different ages .
MuCD4 -/- (CD4 knockout) mice and HuCD4 +/+ (transgenic mice) were treated with CE9.1, CE9y4PE or saline. The study was carried out over a 28 day period, with samples taken at days 1, 3, 7, 14 and 28. Three color flow cytometric analysis of splenocytes from these mice were used to follow the fate of CD4<sup>+</sup> and CD8<sup>+</sup> T cells. To examine T cell ·· 10 levels, the following antibodies were used: CD3-PE, OKT4FITC, CD8-TC. To follow the fate of T and 3 cells in these mice the following antibodies were used: CD3-PE, CD2-FITC, CD45-TC. To follow the fate of CE9.1 cr CE9y4?E coated cells, the following mAh panel was used: OKT4-PE, Leu3a15 FITC, CD3-TC.
The data showed that in both CE9.1 and CE9y4PE treated transgenic mice (HuCD4 +/+), all CD4<sup>+</sup> cells were coated with antibody on day 1. Coating persisted for a few days and was no longer detectable by day 28. The total number of CD4<sup>+</sup> cells treated in CE9.1 treated mice was decreased • T) significantly, even at day 28. By contrast, CE9y4PE treated , mice showed no decreases in total CD4<sup>+</sup> cells. Both ' I antibodies showed evidence of CD4 receptor modulation. Although there was a reciprocal increase in the percentage of CD8<sup>+</sup> cells in the CE9.1 treated mice, there was no evidence that these absolute numbers had been significantly affected by the treatment. CD8<sup>+</sup> cell numbers were likewise unaffected in ΟΞ9γ4ΡΞ treated mice. In all experiments, with either antibody, the number of B cells remained constant.
In Vivo Studies in ChimOanzees
Six chimpanzees were examined for depletion of CD4<sup>+</sup> T cells and/or modulation of the CD4 receptor from the cell surface after infusions of increasing doses of antibody CE9y4PE, up’to 15 mg/kg. Peripheral blood samples were
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APOΟ 1193
-63taken from each chimpanzee three weeks and two weeks prior to the start of the study to establish baseline levels for CD4* T cells. In addition to CD4* cells, CD3* and CD8* cell levels were also measured by flow cytometry. The mAb OKT4, which binds to a different part of the CD4 molecule and does not compete for binding with CE9y4?E, was used as a control. By subtraction of CD8* counts from total CD3* counts a theoretical value for the number of CD4‘ T cells could be calculated. By comparing this value with the CD4* cells measured suing OKT4, CD4 receptor modulation could be distinguished from CD4’ cell depletion.
At the start of the study, each chimp received an i.v. infusion of saline. Blood samples were taken immediately following infusion and 3 and 14 days later. CE9y4?E (0.05mg/kg) was infused into each chimp and blood samples taken 3 and 14 days later. CD4* cells were monitored and if they were within the normal range, the next level dose of CE9y4PE was given. In all, each chimp received the following protocol: saline, 0.05mg/kg CE9y4PE, 1.5mg/kg
CE9y4PE, saline, 15mg/kg CE9y4PE.
No effects on CD4 levels were seen after infusions of saline or CE9y4PE at 0.05mg/kg. At 1.5mg/kg, CD4* cell coating was observed and a transient and partial modulation of CD4 receptors from the cells surface, although no CD4* cell depletion, was seen. At 15mg/ml of CE9y4PE, no CD4* cell depletion was observed in any of the animals, although significant modulation was seen in all animals. The modulatory effect was transient and recovered to baseline in 14-21 days. No adverse effects were seen in any animal.
CE9y4PE could be detected on the cell surface up to 2 days after administration and in the serum.
CE9y4PE was designed to be a non-depleting antibody and no depletion was observed in any animal, even at the relatively high dose of 15mg/kg. CE9y4PE was stable in the sera of chimpanzees and remained in circulation for uo to 21 days .
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
ΑΡο π ί 1 9 3
-64Use
Antibodies produced in the manner described above, or by equivalent techniques, can be purified by a combination of affinity and size exclusion chromatography for characterization in functional biological assays. These assays include determination of specificity and binding affinity as well as effector function associated with the expressed isotype, e.g., ADCC, or complement fixation. Such antibodies may be used as passive or active therapeutic / 10 agents against a number of human diseases which involve CD4 expression and T cells, including B cell lymphoma, infectious diseases including AIDS, autoimmune and inflammatory diseases, and transplantation. The antibodies can be used either in their native form, or as part of an antibody/chelate, antibody/drug or antibody/toxin complex. Additionally, whole antibodies or antibody fragments (Fab<sub>2</sub>, Fab, Fv) may be used as imaging reagents or as potential vaccines or immunogens in active immunotherapy for the generation of anti-idiotypic responses.
The amount of antibody useful to produce a therapeutic effect can be determined by standard techniques well known ) to those of ordinary skill in the art. The antibodies will generally be provided by standard technique within a pharmaceutically acceptable buffer, and may be administered by any desired route. Because of the efficacy of the presently claimed antibodies and their tolerance by humans it is possible to administer these antibodies repetitively in order to combat various diseases or disease states within a human.
The anti-CD4 recombinant antibodies (cr fragments thereof) of this invention are also useful for inducing immunomodulation, e.g., inducing suppression cf a human's or animal's immune system. This invention therefore relates to a method of prophylactically or therapeutically inducing immunomodulation in a human or other animal in need thereof
0 2 10/86 /J/dV
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-65by administering an effective, non-tcxic amount of such an antibody of this invention to such human or other animal.
The ability of the compounds of this invention to induce immunomodulation may be demonstrated in standard tests used for this purpose, for example, a mixed lymphocyte reaction test or a test measuring inhibition of T cell proliferation measured by thymidine uptake.
The fact that the antibodies of this invention have utility in inducing immunosuppression means that they are useful in the treatment or prevention of resistance to or rejection of transplanted organs or tissues (e.g., kidney, heart, lung, bone marrow, skin, cornea, etc.); the treatment or prevention of autoimmune, inflammatory, proliferative and hyperproliferative diseases, and of cutaneous manifestations of immunologically medicated diseases (e.g., rheumatoid arthritis, lupus erythematosus, systemic lupus f
erythematosus, Hashimotos thyroiditis, multiple sclerosis, myasthenia gravis, type 1 diabetes, uveitis, nephrotic syndrome, psoriasis, atopical dermatitis, contact dermatitis and further eczematous dermatitides, seborrheic dermatitis, Lichen planus, Pemplugus, bullous pemphicjus, Epidermolysis bullosa, urticaria, angioedemas, vasculitides, erythema, cutaneous eosinophilias, Alopecia areata, etc.); the treatment of reversible obstructive airways disease, intestinal inflammations and allergies (e.g., Coeliac disease, proctitis, eosinophilia gastroenteritis, mastocytosis, Crohn's disease and ulcerative colitis) and food-related allergies (e.g., migraine, rhinitis and eczema). Also, the subject antibodies have potential utility for treatment of non-aunoimmune conditions wherein immunomodulation is desirable, e.g., graft:-versus-host: disease (GVHD), transplant: rejection, asthma, HIV, leukemia, lymphoma, among ochers.
One skilled in the art would be able, by routine experimentation, to determine what an effective, non-toxic amount of antibody would be for the purpose of inducinc σ>
o
Osl «Ο ao on **-**
Cu
BNSDOCID: <AP
AP1193A I >
ΗΡΟ 0 119 3
-6610 immunosuppression. Generally, however, an effective iosace will be in the range of about 0.05 to 100 milligrams per kilogram body weight per day.
The antibodies (or fragments thereof) of this invention should also be useful for treating tumors in a mammal. More specifically, they should be useful for reducing tumor size, inhibiting tumor growth and/or prolonging the survival time of tumor-bearing animals. Accordingly, this invention also relates to a method of treating tumors in a human or other animal by administering to such human or animal an effective, non-toxic amount of an antibody. One skilled in the art would be able, by routine experimentation, to determine what an effective, non-toxic amount of antibody would be for the purpose of treating carcinogenic tumors. Generally, however, an effective dosage is expected to be in the range of about 0.05 to 100 milligrams per kilogram body Weight per day. '
The antibodies of the invention may be administered to a human or other animal in accordance with the aforementioned methods of treatment in an amount sufficient to produce such effect to a therapeutic or prophylactic degree. Such antibodies of the invention can be administered to such human or other animal in a conventional dosage form prepared by combining the antibody of the invention with a conventional pharmaceutically acceptable carrier or diluent according to known techniques. It will be recognized by one cf skill in the art that the form and character of the pharmaceutically acceptable carrier or diluent is dictated by the amount of active ingredient with which it is to be combined, the route of administration and other well-known variables.
The route of administration of the antibody (or fragment thereof) of the invention may be oral, parenteral, by inhalation or topical. The term parenteral as used herein includes intravenous, intramuscular, subcutaneous, rectal, vaginal or intraperitoneal administration. The
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
Ape 9 119 3
-67subcutaneous and intramuscular forms of parenteral administration are generally preferred.
The daily parenteral and oral dosage regimens for employing compounds of the invention to prophylactically or therapeutically induce immunosuppression, or to therapeutically treat carcinogenic tumors will generally be in the range of about 0.05 to 100, but preferably about 0.5 to 10, milligrams per kilogram body weight per day.
The antibody of the invention may also be administered 10 by inhalation. By inhalation is meant intranasal and oral inhalation administration. Appropriate.dosage forms for such administration, such as an aerosol formulation or a metered dose inhaler, may be prepared by conventional techniques. The preferred dosage amount of a compound of the invention to be employed is generally within the range of about 10 to 100 milligrams.
The antibody of the invention may also be administered topically. By topical administration is meant non-systemic administration and includes the application of an antibody {or fragment thereof) compound of the invention externally to the epidermis, to the buccal cavity and instillation of such an antibody into the ear, eye and nose, and where it does net significantly enter the blood stream. By systemic administration is meant oral, intravenous, intraperitoneal and intramuscular administration. The amount of an antibody required for therapeutic or prophylactic effect will, of course, vary with the antibody chosen, the nature and severity of the condition being treated and the animal undergoing treatment, and is ultimately at the discretion of the physician. A suitable topical dose of an antibody of the invention will generally be within the range of about 1 to 100 milligrams per kilogram body weight daily.
Formulations
While it is possible for an antibody or fragment thereof to be administered alone, it is preferable to present it as a pharmaceutical formulation. The active
AP/P/ 9 8 / 0 1 2 09
BNSDOCID: <AP
AP1193A I >
APOO1193
Ρ·
-68ingredient may comprise, for topical administration, from 0.001% to 10% w/w, e.g., from 1% to 2% by weight of the formulation, although it may comprise as much as 10% w/w but preferably not in excess of 5% w/w and more preferably from
0.1% to 1% w/w of the formulation.
The topical formulations of the present invention, comprise an active ingredient together with one or more acceptable carrier(s) therefor'and optionally any other therapeutic ingredients(s). The carrier(s) must be acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
Formulations suitable for topical administration include liquid or semi-liquid preparations suitable for penetration through the skin to the site of where treatment is required, such as liniments, lotions, creams, ointments f
or pastes, and drops suitable for administration to the eye, ear or nose.
Drops according to the present invention may comprise sterile aqueous or oily solutions or suspensions and may be prepared by dissolving the active ingredient in a suitable aqueous solution of a bactericidal and/or fungicidal agent and/or any other suitable preservative, and preferably including a surface active agent. The resulting solution may then be clarified by filtration, transferred to a suitable container which is then sealed and sterilized by autoclaving or maintaining at 90°-100°C for half an hour. Alternatively, the solution may be sterilized by filtration and transferred to the container by an aseptic technique.
Examples of bactericidal and fungicidal agents suitable for inclusion in the drops are phenylmercurie nitrate or acetate (0.002%), benzalkonium chloride (0.01%) and chlorhexidine acetate (0.01%). Suitable solvents for the preparation of an oily solution include glycerol, diluted alcohol and propylene glycol.
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APOΟ 1193
-69Lotions according to the present invention include those suitable for application to the skin or eye. An eye lotion may comprise a sterile aqueous solution optionally containing a bactericide and may be prepared by methods similar to those for the preparation of drops. Lotions or liniments for application to the skin may also include an agent to hasten drying and to cool the skin, such as an alcohol or acetone, and/or a moisturizer such as glycerol or an oil such as castor oil or arachis oil.
Creams, ointments or pastes according to the present invention are semi-solid formulations of the active ingredient for external application. They may be made by mixing the active ingredient in finely-divided or powdered form, alone or in solution or suspension in an aqueous or non-aqueous fluid, with the aid of suitable machinery, with a greasy or non-greasy basis. The basis may comprise hydrocarbons such as hard, soft or liquid paraffin, glycerol, beeswax, a metallic soap; a mucilage; an oil of natural origin such as almond, com, arachis, castor or olive oil; wool fat or its derivatives, or a fatty acid such as stearic or oleic acid together with an alcohol such as propylene-glycol or macrogols. The formulation may incorporate any suitable surface active agent such as an anionic, cationic or non-ionic surface active such as sorbitan esters or polyoxyethylene derivatives thereof. Suspending agents such as natural gums, cellulose derivatives or inorganic materials such as silicaceous silicas, and other ingredients such as lanolin, may also be included.
It will be recognized by one of skill in the art that the optimal quantity and spacing of individual dosages of an antibody or fragment thereof of the invention will be determined by the nature and extent of the condition being treated, the form, route and site of administration, and the particular animal being treated, and that such optimums can be determined by conventional techniques. It will also be
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APOο 1193
-70appreciated by one of skill in the art that the optimal course of treatment, i.e., the number of doses of an antibody or fragment thereof of the invention given per day for a defined number of days, can be ascertained by those skilled in the art using conventional course of treatment determination tests.
Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The following are, therefore, to be construed as merely illustrative examples and not a limitation of the scope of the present invention in any way.
Caosule Composition
A pharmaceutical composition of this invention in the form of a capsule is prepared by filling a standard twopiece hard gelatin capsule with 50 mg. of an antibody or fragment thereof of the invention, in powdered form'/ 100 mg. of lactose, 32 mg. of talc and 8 mg. of magnesium stearate.
Injectable Parenteral Composition
A pharmaceutical composition of this invention in a form suitable for administration by injection is prepared by stirring 1.5% by weight of an antibody or fragment thereof of the invention in 10% by volume propylene glycol and water. The solution is sterilized by filtration.
Qin tmen t Compos i ti on
Antibody or fragment thereof of the invention 1.0 g. White soft paraffin tc 100.0 g.
The antibody or fragment thereof of the invention is dispersed in a small volume of the vehicle to produce a smooth, homogeneous product. Collapsible metal tubes are then filled with the dispersion.
Topical Cream Composition
Antibody or fragment thereof of the invention 1.0 g. Polawax GP 200 20.0 g.
Lanolin Anhydrous 2.0 g.
White Beeswax 2.5 g.
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APOO1 19 3
-71Methyl hydroxybenzoate 0.1 g.
Distilled Water to 100.0 g.
The polawax, beeswax and lanolin are heated together at 60°C. A solution of methyl hydroxybenzoate is added and homogenization is achieved using high speed stirring. The temperature is then allowed to fall to 50°C. -The antibody or fragment thereof of the invention is then added and dispersed throughout, and the composition is allowed' to cool with slow speed stirring.
Topical Lotion Composition
Antibody or fragment thereof of the invention 1.0 g. Sorbitan Monolaurate 0.6 g. Polysorbate 20 0.6 g. Cetostearyl Alcohol 1.2 g. Glycerin 6.0 g.
Methyl Hydroxybenzoate 0.2 g.
Purified Water B.P. to 100.00 ml. (B.P. = British
Pharmacopeia)
The methyl hydroxybenzoate and glycerin are dissolved in 70 ml. of the water at 75°C. The sorbitan monolaurate, polysorbate 20 and cetostearyl alcohol are melted together at 75°C and added to the aqueous solution. The resulting emulsion is homogenized, allowed to cool with continuous stirring and the antibody or fragment thereof of the invention is added as a suspension in the remaining water. The whole suspension is stirred until homogenized.
Eve Drop Composition
Antibody or fragment thereof of the invention 0.5 g. Methyl Hydroxybenzoate 0.01 g.
Propyl Hydroxybenzoate 0.04 g.
Purified Water B.P. to 100.00 ml.
The methyl and propyl hydroxybenzoates are dissolved in ml. purified water at 75°C and the resulting solution is allowed to cool. The antibody or fragment thereof of the invention is then added, and the solution is sterilized by filtration through a membrane filter (0.022 gm pore size), . and packed aseptically into suitable sterile containers.
AP/P/ 9 8/01209
BNSDOCID: <AP
AP1193A I >
ΛΡΟ ? f19 3
')
-72Comoosition for Administration bv Inhalation
For an aerosol container with a capacity of 15-20 ml: mix 10 mg. of an antibody cr fragment thereof of the invention with 0.2-0.5% of a lubricating agent, such as polysorbate 85 or oleic acid, and disperse such mixture in a propellant, such as freon, preferably in a combination of (1,2 dichlorotetrafluoroethane) and difluorochloromethane and put into an appropriate aerosol container adapted for either intranasal or oral inhalation administration. Composition for Administration by Inhalation For an aerosol container with a capacity cf 15-20 ml: dissolve 10 mg. of an antibody or fragment thereof cf the invention in ethanol (58 ml.), add 0.1-0.2% of a lubricating agent, such as polysorbate 85 or oleic acid; and disperse such in a propellant, such as freon, preferably in combination of (1.2 dichlorotetraf luoroethane) and dif luorochloromethane, and put into an appropriate aerosol container adapted for either intranasal or oral inhalation administration.
The antibodies and pharmaceutical compositions of the invention are particularly useful for parenteral administration, i.e., subcutaneously, intramuscularly or intravenously. The compositions for parenteral administration will commonly comprise a solution of an antibody or fragment thereof of the invention or a cocktail thereof dissolved in an acceptable carrier, preferably an aqueous carrier. A variety of aqueous carriers may be employed, e.g., water, buffered water, 0.4% saline, 0.3% glycine, and the like. These solutions are sterile and generally free of particulate matter. These solutions may be sterilized by conventional, well-known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pK adjusting and buffering agents, etc. The concentration of the antibody or· fragment thereof of the invention in such pharmaceutical formulation can vary widely, i.e., from less than about 0.5%, usually at
0 Z I· 0 / 8 6 /d/dV
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
-73or at least about 1% to as much as 15 or 20% by weight, and will be selected primarily based on fluid volumes, viscosities, etc., according to the particular mode of administration selected.
Thus, a pharmaceutical composition of the invention for intramuscular injection could be prepared to contain l mL sterile buffered water, and 50 mg. of an antibody or fragment thereof of the invention. Similarly, a pharmaceutical composition of the invention for intravenous infusion could be made up to contain 250 ml. of sterile Ringer's solution, and 150 mg. of an antibody or fragment thereof of the invention. Actual methods for preparing parenterally administrable compositions are well-known or will be apparent to those skilled in the art, and are described in more detail in, for example, Remington's
Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pennsylvania, hereby incorporated by reference herein.
The antibodies (or fragments thereof) of the invention can be lyophilized for storage and reconstituted in a suitable carrier prior to use. This technique has been shown to be effective with conventional immune globulins and art-known lyophilization and reconstitution techniques can be employed.
Depending on the intended result, the pharmaceutical composition of the invention can be administered for prophylactic and/or therapeutic treatments. In therapeutic application, compositions are administered to a patient already suffering from a disease, in an amount sufficient to cure or at least partially arrest the disease and its complications. In prophylactic applications, compositions containing the present antibodies or a cocktail thereof are administered to a patient not already in a disease state to enhance the patient's resistance.
Single or multiple administrations of the pharmaceutical compositions can be carried out with dose
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APO 0 119 3 levels and paccsrr. ceinc selected by tbs treating phvsioi πη In any event, the pharmaceutical composition cf the invention should provide a quantity cf the altered antibodies (or fragments thereof) ct the invention sufficient to effectively treat the patient.
z·
It should also be noted that the antihcdies cf rh5 invention may be used for the design and synthesis of either peptide or non-peptide compounds (mimetics) which would be useful in the same therapy as the antibody. See, e.g.,
Saragcvi et al., Science, 253:752-795 (1991).
Dsccsi~
Strain XL1 Slue, Anti-04 in TCAZo which expresses CZ9.1 has been. deposited with the ATCC and assigned number
69030. This deposit was made cn July 5, 1992.
Applicants' and their assignees acknowledge their responsibility to replace these cultures should they dis before the end cf the term cf a patent issued hereon, 5 years after the last request for a culture, or 3 0 years, whichever is the longer, and its responsibility to notify the depositary of the issuance of such a patent, at which time the deposit will be made irrevocably available to the • ' j public. Until that time the deposit will be made available to che Commissioner, cf Patents under the terms of 37 C.P.R.
Section 1-14 and 3 5 U.S.C. Section 112.
Other embodiments are within the following claims.
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
ΑΡθ 0 119 3
SEQUENCE LISTING (1) GENERAL INFORMATION:
(i) APPLICANT: Hanna, Nabil
Newman, Roland A.
Reff, Mitchell Ξ.
(ii) TITLE OF INVENTION: Recombinant Anti-CD4 Antibodies for Human Therapy (iii) NUMBER OF SEQUENCES: 59 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: BURNS, DOANE, SWECKER & MATHIS (3) STREET: 699 Prince Street (C) CITY: Alexandria (D) STATE: VA (E) COUNTRY: USA (F) ZIP: 22314-3187 (V) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/523,894 (B) FILING DATE: 06-ΞΕΡ-1995 (C) CLASSIFICATION:
(viii) ATTORNEY/AGENT'INFORMATION:
(A) NAME: Teskin, Robin L.
(B) REGISTRATION NUMBER: 35,030 (C) REFERENCE/DOCKET NUMBER: 012712-165 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 703-836-6620 (B) TELEFAX: 703-836-2021
AP/P/ 9 8 / 0 1 2 0 9 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 420 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Monkey
BNSDOCID: <AP
AP1193A I >
Λ<sup>ρ</sup> 5 <sup>η</sup> * 1 9 3 (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: light variable domain of CE9.1 (ix) FEATURE:
(A) NAME/KEY: CDS (3) LOCATION: 4..420 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 61..420 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
<td colspan="2"> GAC ATG</td><td colspan="2"> AAA CAC</td><td colspan="2" rowspan="2"> CTG TGG Leu Trp -15</td><td colspan="2"> TTC TTC</td><td colspan="2" rowspan="2"> CTC CTC Leu Leu</td><td rowspan="2"> CTG Leu -10</td><td rowspan="2"> GTG Val</td><td colspan="2" rowspan="2"> GCA GCC Ala Ala</td><td colspan="2" rowspan="2"> CCC AGA Pro Arg “ 3</td><td rowspan="2"> 48</td>
<td></td><td> Met -19</td><td> Lys</td><td> His</td><td> Phe</td><td> Phe</td>
<td> TGG</td><td> GTC</td><td> TTG</td><td> TCC</td><td> CAG</td><td> GTG</td><td> CAG</td><td> CTG</td><td> CAG</td><td> GAG</td><td> GCG</td><td> GGC</td><td> CCA</td><td> GGA</td><td> CTG.</td><td> GTG</td><td rowspan="2"> 96</td>
<td> Trp</td><td> Val</td><td> Leu</td><td> Ser</td><td> Gin</td><td> Val</td><td> Gin</td><td> Leu</td><td> Gin</td><td> Glu</td><td> Ala</td><td> Gly</td><td> Pro</td><td> Gly</td><td> Leu</td><td> Val</td>
<td></td><td></td><td></td><td></td><td> 1</td><td></td><td></td><td></td><td> 5</td><td></td><td></td><td></td><td></td><td> 10</td><td></td><td></td><td></td>
<td> AAG</td><td> CCT</td><td> TCG<sub>Z</sub></td><td> GAG</td><td> ACC</td><td> CTG</td><td> TCC</td><td> CTC</td><td> ACC</td><td> TGC</td><td> AGT</td><td> GTC</td><td> TCT</td><td> GGT</td><td> GGC</td><td> TCC</td><td rowspan="2"> 144</td>
<td> Lys</td><td> Pro</td><td> Ser</td><td> Glu</td><td> Thr</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Ser</td><td> Val</td><td> Ser</td><td> Gly</td><td rowspan="2"> Gly</td><td> Ser</td>
<td></td><td></td><td> 15</td><td></td><td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td>
<td> ATC</td><td> AGC</td><td> GGT</td><td> GAC</td><td> TAT</td><td> TAT</td><td> TGG</td><td> TTC</td><td> TGG</td><td> ATC</td><td> CGC</td><td> CAG</td><td> TCC</td><td> CCA</td><td> GGG</td><td> AAG</td><td> 192</td>
<td> lie</td><td> Ser</td><td> Gly</td><td> Asp</td><td> Tyr</td><td> Tyr</td><td> Trp</td><td> Phe</td><td> Trp</td><td> He</td><td> Arg</td><td> Gin</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Lys</td><td></td>
<td></td><td> 30</td><td></td><td></td><td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td></td>
<td> GGA</td><td> CTG</td><td> GAG</td><td> TGG</td><td> ATC</td><td> GGC</td><td> TAC</td><td> ATC</td><td> TAT</td><td> GGC</td><td> AGT</td><td> GGT</td><td> GGG</td><td> GGC</td><td> ACC</td><td> AAT</td><td> 240</td>
<td> Gly</td><td> Leu</td><td> Glu</td><td> Trp</td><td> He</td><td> Gly</td><td> Tyr</td><td> lie</td><td> Tyr</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Asn</td><td></td>
<td> 45</td><td></td><td></td><td></td><td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td>
<td> TAC</td><td> AAT</td><td> CCC</td><td> TCC</td><td> CTC</td><td> AAC</td><td> AAT</td><td> CGA</td><td> GTC</td><td> TCC</td><td> ATT</td><td> TCA</td><td> ATA</td><td> GAC</td><td> ACG</td><td> TCC</td><td> 288</td>
<td> Tyr</td><td> Asn</td><td> Pro</td><td> Ser</td><td> Leu</td><td> Asn</td><td> Asn</td><td> Arg</td><td> Val</td><td> Ser</td><td> He</td><td> Ser</td><td> He</td><td> Asp</td><td> Thr</td><td> Ser</td><td></td>
<td></td><td></td><td></td><td></td><td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td>
<td> AAG</td><td> AAC</td><td> CTC</td><td> TTC</td><td> TCC</td><td> CTG</td><td> AAA</td><td> CTG</td><td> AGG</td><td> TCT</td><td> GTG</td><td> ACC</td><td> GCC</td><td> GCG</td><td> GAC</td><td> ACG</td><td> 336</td>
<td> Lys</td><td> Asn</td><td> Leu</td><td> Phe</td><td> Ser</td><td> Leu</td><td> Lys</td><td> Leu</td><td> Arg</td><td> Ser</td><td> Val</td><td> Thr</td><td> Ala</td><td> Ala</td><td rowspan="2"> Asp</td><td> Thr</td><td></td>
<td></td><td></td><td></td><td> 80</td><td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td>
<td> GCC</td><td> GTC</td><td> TAT</td><td> TAC</td><td> TGT</td><td> GCG</td><td> AGT</td><td> AAT</td><td> ATA</td><td> TTG</td><td> AAA</td><td> TAT</td><td> CTT</td><td> CAC</td><td> TGG</td><td> TTA</td><td> 384</td>
<td> Ala</td><td> Val</td><td> Tyr</td><td> Tyr</td><td> Cys</td><td> Ala</td><td> Ser</td><td> Asn</td><td> He</td><td> Leu</td><td> Lys</td><td> Tyr</td><td> Leu</td><td> His</td><td> Trp</td><td> Leu</td><td></td>
<td></td><td></td><td> 95</td><td></td><td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td>
<td> TTA</td><td> TAC</td><td> TGG</td><td> GGC</td><td> CAG</td><td> GGA</td><td> GTC</td><td> CTG</td><td> GTC</td><td> ACC</td><td> GTC</td><td> TCC</td><td></td><td></td><td></td><td></td><td> 420</td>
<td> Leu</td><td> Tyr</td><td> Trp</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Val</td><td> Leu</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td></td><td></td><td></td><td></td><td></td>
110 115 120
AP/P/ 9 8/01209 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 139 amino acids (B) TYPE: amino acid
BNSDOCID: <AP
AP1193A I >
APO 0 119 3 (D) TOPOLOGY: linear
<td colspan="3"> (ii) MOLECULE TYPE: protein</td>
<td></td><td> (Xi) SEQUENCE</td><td> DESCRIPTION: SEQ ID NO:2:</td>
<td> Met</td><td> Lys His Leu Trp</td><td> Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp</td>
<td> -19</td><td> -15</td><td> -10 -5</td>
<td> Val</td><td> Leu Ser Gin Val</td><td> Gin Leu Gin Glu Ala Gly Pro Gly Leu Val Lys</td>
<td></td><td> 1</td><td> 5 10</td>
<td> Pro</td><td> Ser Glu Thr Leu</td><td> Ser Leu Thr Cys Ser Val Ser Gly Gly Ser lie</td>
<td></td><td> 15</td><td> 20 25</td>
<td> Ser</td><td> Gly Asp Tyr Tyr</td><td> Trp Phe Trp lie Arg Gin Ser Pro Gly Lvs Gly</td>
<td> 30</td><td></td><td> 35 40 * 45</td>
<td> Leu</td><td> Glu Trp lie Gly</td><td> Tyr lie Tyr Gly Ser Gly Gly Gly Thr Asn Tyr</td>
<td></td><td> 50</td><td> 55 60</td>
<td> Asn</td><td> Pro Ser Leu Asn</td><td> Asn Arg Val Ser He Ser lie Asp Thr Ser Lys</td>
<td></td><td> 65</td><td> 70 75</td>
<td> Asn</td><td> X. Leu Phe Ser Leu</td><td> Lys Leu Arg Ser Val Thr Ala Ala Asd Thr Ala</td>
<td></td><td> 80</td><td> 85 90</td>
<td> Val</td><td> Tyr Tyr Cys Ala</td><td> Ser Asn lie Leu Lys Tyr Leu His Trp Leu Leu</td>
<td></td><td> 95</td><td> 100 105</td>
<td> Tyr</td><td> Trp Gly Gin Gly</td><td> Val Leu Val Thr Val Ser</td>
<td> 110</td><td></td><td> 115 120</td>
<td> (2)</td><td> INFORMATION FOR</td><td> SEQ ID NO:3:</td>
AP/P/ 9 8 / 0 1 2 0 9 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 387 base pairs •(B). TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: heavy variable domain of CE9. l (ix) FEATURE:
(A) NAME/KEY: CDS (B) LOCATION: 4..387 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: SI..387
BNSDOCID: <AP
AP1193A I ?
APO 0 119 3
<td colspan="3"> Pro Gly Gin</td><td rowspan="2"> Thr</td><td rowspan="2"> Ala</td><td rowspan="2"> Gly</td><td rowspan="2"> Phe</td><td rowspan="2"> Thr 40</td><td rowspan="2"> Cys</td><td rowspan="2"> Gly</td><td rowspan="2"> Gly</td><td rowspan="2"> Asp</td><td rowspan="2"> Asn 45</td><td rowspan="2"> Val</td><td rowspan="2"> Gly</td><td colspan="2" rowspan="2"> Arg</td>
<td></td><td colspan="2"> 35</td>
<td> AAA</td><td> AGT</td><td> GTA</td><td> CAG</td><td> TGG</td><td> TAC</td><td> CAG</td><td> CAG</td><td> AAG</td><td> CCA</td><td> CCG</td><td> CAG</td><td> GCC</td><td> CCT</td><td> GTG</td><td> CTG</td><td> 192</td>
<td> Lys</td><td> Ser</td><td> Val</td><td> Gin</td><td> Trp</td><td> Tyr</td><td> Gin</td><td> Gin</td><td> Lys</td><td> Pro</td><td> Pro</td><td> Gin</td><td> Ala</td><td> Pro</td><td> Val</td><td> Leu</td><td></td>
<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td><td></td>
<td> GTC</td><td> ATC</td><td> TAT</td><td> GCT</td><td> GAC</td><td> AGC</td><td> GAA</td><td> CGG</td><td> CCC</td><td> TCA</td><td> GGG</td><td> ATC</td><td> CCT</td><td> GCG</td><td> CGA</td><td> TTC</td><td> 240</td>
<td> Val</td><td> He</td><td> Tyr</td><td> Ala</td><td> Asp</td><td> Ser</td><td> Glu</td><td> Arg</td><td> Pro</td><td> Ser</td><td> Gly</td><td> lie</td><td> Pro</td><td> Ala</td><td> Arg</td><td> Phe</td><td></td>
<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td><td></td>
<td> TCT</td><td> GGC</td><td> TCC</td><td> AAC</td><td> TCA</td><td> GGG</td><td> AAC</td><td> ACC</td><td> GCC</td><td> ACC</td><td> CTG</td><td> ACC</td><td> ATC</td><td> AGC</td><td> GGG</td><td> GTC</td><td> 288</td>
<td> Ser</td><td> Gly</td><td> Ser</td><td> Asn</td><td> Ser</td><td> Gly</td><td> Asn</td><td> Thr</td><td> Ala</td><td> Thr</td><td> Leu.</td><td> Thr</td><td> He</td><td> Ser</td><td> Gly</td><td> Val</td><td></td>
<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td>
<td> GAG</td><td> GCC</td><td> GGG</td><td> GAT</td><td> GAG</td><td> GCT</td><td> GAC</td><td> TAT</td><td> TAC</td><td> TGT</td><td> CAG</td><td> GTG</td><td> TGG</td><td> GAC</td><td> AGT</td><td> ACT</td><td> 336</td>
<td> Glu</td><td> Ala</td><td> Gly</td><td> Asp</td><td> Glu</td><td> Ala</td><td> Asp</td><td> Tyr</td><td> Tvr</td><td> Cys</td><td> Gin</td><td> Val</td><td> Tr?</td><td> Asp</td><td> Ser</td><td> Thr</td><td></td>
<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td>
<td> GCT</td><td> GAT</td><td> CAT</td><td> TGG</td><td> GTC</td><td> TTC</td><td> GGC</td><td> GGA</td><td> GGG</td><td> ACC</td><td> CGG</td><td> CTG</td><td> ACC</td><td> GTC</td><td> CTA</td><td> GGT</td><td> 384</td>
<td> Ala</td><td> Asp</td><td> His</td><td> Trp</td><td> Val</td><td> Phe</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Arg</td><td> Leu</td><td> my, —</td><td> Val</td><td> Leu</td><td> Gly</td><td></td>
<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td><td></td>
<td> CAG</td><td> ccc</td><td> AAG.</td><td> GCT</td><td> GCC</td><td> CCC</td><td> TCG</td><td> GTC</td><td> ACT</td><td> CTG</td><td> TTC</td><td> CCG</td><td> CCC</td><td> TCC</td><td> TCT</td><td> GAG</td><td> 432</td>
<td> Gin</td><td> Pro</td><td> Lys</td><td> Ala</td><td> Ala</td><td> Pro</td><td> Ser</td><td> Val</td><td> Thr</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Ser</td><td> Ser</td><td> Glu</td><td></td>
<td></td><td> 13 0</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td></td>
<td> GAG</td><td> CTT</td><td> CAA</td><td> GCC</td><td> AAC</td><td> AAG</td><td> GCC</td><td> ACA</td><td> CTG</td><td> GTG</td><td> TGT</td><td> CTC</td><td> ATA</td><td> AGT</td><td> GAC</td><td> TTC</td><td> 480</td>
<td> Glu</td><td> Leu</td><td> Gin</td><td> Ala</td><td> Asn</td><td> Lys</td><td> Ala</td><td> Thr</td><td> Leu</td><td> Val</td><td> Cys</td><td> Leu</td><td> He</td><td> Ser</td><td> Asp</td><td> Phe</td><td></td>
<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td>
<td> TAC</td><td> CCG</td><td> GGA</td><td> GCC</td><td> GTG</td><td> ACA</td><td> GTG</td><td> GCC</td><td> TGG</td><td> AAG</td><td> GCA</td><td> GAT</td><td> AGC</td><td> AGC</td><td> CCC</td><td> GTC</td><td> 528</td>
<td> Tyr</td><td> Pro</td><td> dy</td><td> Ala</td><td> Val</td><td> Thr</td><td> Val</td><td> Ala</td><td> Trp</td><td> Lys</td><td> Ala</td><td> Asp</td><td> Ser</td><td> Ser</td><td> Pro</td><td> Val</td><td></td>
<td></td><td></td><td></td><td></td><td> 1S5</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td>
<td> AAG</td><td> GCG</td><td> GGA</td><td> GTG</td><td> GAG</td><td> ACC</td><td> ACC</td><td> ACA</td><td> CCC</td><td> TCC</td><td> AAA</td><td> CAA</td><td> AGC</td><td> AAC</td><td> AAC</td><td> AAG</td><td> 576</td>
<td> Lys</td><td> Ala</td><td> Gly</td><td> Val</td><td> Glu</td><td> Thr</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Ser</td><td> Lys</td><td> Gin</td><td> Ser</td><td> Asn</td><td> Asn</td><td> Lys</td><td></td>
<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td>
<td> TAC</td><td> GCG</td><td> GCC</td><td> AGC</td><td> AGC</td><td> TAC</td><td> CTG</td><td> AGC</td><td> CTG</td><td> ACG</td><td> CCT</td><td> GAG</td><td> CAG</td><td> TGG</td><td> AAG</td><td> TCC</td><td> 624</td>
<td> Tyr</td><td> Ala</td><td> Ala</td><td> Ser</td><td> Ser</td><td> Tyr</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Pro</td><td> Glu</td><td> C-ln</td><td> Trp</td><td> Lys</td><td> Ser</td><td></td>
<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td>
<td> CAC</td><td> AGA</td><td> AGC</td><td> TAC</td><td> AGC</td><td> TGC</td><td> CAG</td><td> GTC</td><td> ACG</td><td> CAT</td><td> GAA</td><td> GGG</td><td> AGC</td><td> ACC</td><td> GTG</td><td> GAG</td><td> 672</td>
<td> His</td><td> Arg</td><td> Ser</td><td> Tyr</td><td> Ser</td><td> Cys</td><td> Gin</td><td> Val</td><td> Thr</td><td> His</td><td> Glu</td><td> Gly</td><td> Ser</td><td> Thr</td><td> Val</td><td> Glu</td><td></td>
<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td></td>
<td> AAG</td><td> ACA</td><td> GTG</td><td> GCC</td><td> CCT</td><td> ACA</td><td> GAA</td><td> TGT</td><td> TCA</td><td> TGA</td><td></td><td></td><td></td><td></td><td></td><td></td><td> 702</td>
<td> Lys</td><td> Thr</td><td> Val</td><td> Ala</td><td> Pro</td><td> Thr</td><td> Glu</td><td> Cys</td><td> Ser</td><td> X</td><td></td><td></td><td></td><td></td><td></td><td></td><td></td>
225 230 (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 234 amino acids
BNSDOCID: <AP
AP1193A I >
AP '391193 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
<td colspan="3"> Met Ala Trp 1</td><td> Ala</td><td> Leu 5</td><td> Leu</td><td> Leu</td><td colspan="2"> Leu Gly</td><td> Leu 10</td><td colspan="2"> Leu Ala</td><td> His</td><td> Phe</td><td> Thr 15</td><td> Asp</td>
<td> Ser</td><td> Ala</td><td> Ala</td><td> Ser</td><td> Tyr</td><td> Glu</td><td> Leu</td><td> Ser</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Ser</td><td> Val</td><td> Ser</td><td> Val</td><td> Ser</td>
<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td><td></td>
<td> Pro</td><td> Gly</td><td> Gin</td><td> Thr</td><td> Ala</td><td> Gly</td><td> Phe</td><td> Thr</td><td> Cys</td><td> Gly</td><td> Gly</td><td> Asp</td><td> Asn</td><td> Val</td><td> Gly</td><td> Arg</td>
<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>
<td rowspan="2"> Lys</td><td> Ser</td><td> Val</td><td> Gin</td><td> Trp</td><td> Tyr</td><td> Gin</td><td> Gin</td><td> Lys</td><td> Pro</td><td> Pro</td><td> Gin</td><td> Ala</td><td> Pro</td><td> Val</td><td> Leu</td>
<td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>
<td> Val</td><td> He</td><td> Tyr</td><td> Ala</td><td> Asp</td><td> Ser</td><td> Glu</td><td> Arg</td><td> Pro</td><td> Ser</td><td> Gly</td><td> lie</td><td> Pro</td><td> Ala</td><td> Arg</td><td> Phe</td>
<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>
<td> Ser</td><td> Gly</td><td> Ser</td><td> Asn</td><td> Ser</td><td> Gly</td><td> Asn</td><td> Thr</td><td> Ala</td><td> Thr</td><td> Leu</td><td> Thr</td><td> He</td><td> Ser</td><td> Gly</td><td> Val</td>
<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 55</td><td></td>
<td> Glu</td><td> Ala</td><td> Gly</td><td> Asp</td><td> Glu</td><td> Ala</td><td> Asp</td><td> Tyr</td><td> Tyr</td><td> Cys</td><td> Gin</td><td> Val</td><td> Trp</td><td> Asp</td><td> Ser</td><td> Thr</td>
<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>
<td> Ala</td><td> Asp</td><td> His</td><td> Trp</td><td> Val</td><td> Phe</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Arg</td><td> Leu</td><td> Thr</td><td> Val</td><td> Leu</td><td> Gly</td>
<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>
<td> Gin</td><td> Pro</td><td> Lys</td><td> Ala</td><td> Ala</td><td> Pro</td><td> Ser</td><td> Val</td><td> Thr</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Ser</td><td> Ser</td><td> Glu</td>
<td></td><td> 13 0</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>
<td> Glu</td><td> Leu</td><td> Gin</td><td> Ala</td><td> Asn</td><td> Lys</td><td> Ala</td><td> Thr</td><td> Leu</td><td> Val</td><td> Cys</td><td> Leu</td><td> He</td><td> Ser</td><td rowspan="2"> Asp</td><td> Phe</td>
<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td> 160</td>
<td> Tyr</td><td> Pro</td><td> Gly</td><td> Ala</td><td> Val</td><td> Thr</td><td> Val</td><td> Ala</td><td> Trp</td><td> Lys</td><td> Ala</td><td> Asp</td><td> Ser</td><td> Ser</td><td> Pro</td><td> Val</td>
<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td>
<td> Lys</td><td> Ala</td><td> Gly</td><td> Val</td><td> Glu</td><td> Thr</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Ser</td><td> Lys</td><td> Gin</td><td> Ser</td><td> Asn</td><td> Asn</td><td rowspan="2"> Lys</td>
<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td>
<td> Tyr</td><td> Ala</td><td> Ala</td><td> Ser</td><td> Ser</td><td> Tyr</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Pro</td><td> Glu</td><td> Gin</td><td rowspan="2"> Trp</td><td rowspan="2"> Lys</td><td> Ser</td>
<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td>
<td> His</td><td> Arg</td><td> Ser</td><td> Tyr</td><td> Ser</td><td> Cys</td><td> Gin</td><td> Val</td><td> Thr</td><td> His</td><td> Glu</td><td> Gly</td><td> Ser</td><td> Thr</td><td> Val</td><td> Glu</td>
<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>
<td> Lys</td><td> Thr</td><td> Val</td><td> Ala</td><td> Pro</td><td> Thr</td><td> Glu</td><td> Cys</td><td> Ser</td><td> A</td><td></td><td></td><td></td><td></td><td></td><td></td>
AP/P/ 9 8 / 0 1 2 09
225 230 (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE· CHARACTERISTICS:
(A) .LENGTH: 1404 base pairs
BNSDOCID: <AP
AP1193A I >
AP ο Ο 1 1 9 3 (Β) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: heavy chain variable and constant gamma 4 (ix) FEATURE:
(A) NAME/KEY: CDS (B) LOCATION: 1..1404 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 1..1404 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
<td colspan="4"> ATG AAA CAC CTG</td><td rowspan="2"> TGG Trp 5</td><td rowspan="2"> TTC Phe</td><td rowspan="2"> TTC Phe</td><td rowspan="2"> CTC Leu</td><td rowspan="2"> CTC Leu</td><td rowspan="2"> CTG Leu 10</td><td rowspan="2"> GTG Val</td><td rowspan="2"> GCA Ala</td><td rowspan="2"> GCC Ala</td><td colspan="3"> CCC AGA TGG</td><td rowspan="2"> 48</td>
<td> Met 1</td><td> Lys</td><td> His</td><td> Leu /.</td><td> Pro</td><td> Arg 15</td><td> Trp</td>
<td> GTC</td><td> TTG</td><td> TCC</td><td> CAG</td><td> GTG</td><td> CAG</td><td> CTG</td><td> CAG</td><td> GAG</td><td> TCG</td><td> GGC</td><td> CCA</td><td> GGA</td><td> CTG</td><td> GTG</td><td> AAG</td><td> 96</td>
<td> Val</td><td> Leu</td><td> Ser</td><td> Gin 20</td><td> Val</td><td> Gin</td><td> Leu</td><td> Gin</td><td> Glu 25</td><td> Ser</td><td> Gly</td><td> Pro</td><td> Gly</td><td> Leu 30</td><td> Val</td><td> Lys</td><td></td>
<td> CCT</td><td> TCG</td><td> GAG</td><td> ACC</td><td> CTG</td><td> TCC</td><td> CTC</td><td> ACC</td><td> TGC</td><td> AGT</td><td> GTC</td><td> TCT</td><td> GGT</td><td> GGC</td><td> TCC</td><td> ATC</td><td> 144</td>
<td> Pro</td><td> Ser</td><td> Glu 35</td><td> Thr</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Thr 40</td><td> Cys</td><td> Ser</td><td> Val</td><td> Ser</td><td> C-ly 45</td><td> C-ly</td><td> Ser</td><td> He</td><td></td>
<td> AGC</td><td> GGT</td><td> GAC</td><td> TAT</td><td> TAT</td><td> TGG</td><td> TTC</td><td> TGG</td><td> ATC</td><td> CGC</td><td> CAG</td><td> TCC</td><td> CCA</td><td> GGG</td><td> AAG</td><td> GGA</td><td> 192</td>
<td> Ser</td><td> Gly 50</td><td> Asp</td><td> Tyr</td><td> Tyr</td><td> Trp</td><td> Phe 55</td><td> Trp</td><td> lie</td><td> Arg</td><td> Gin</td><td> Ser 60</td><td> Pro</td><td> Gly</td><td> Lys</td><td> Gly</td><td></td>
<td> CTG</td><td> GAG</td><td> TGG</td><td> ATC</td><td> GGC</td><td> TAC</td><td> ATC</td><td> TAT</td><td> GGC</td><td> AGT</td><td> GGT</td><td> GGG</td><td> GGC</td><td> ACC</td><td> AAT</td><td> TAC</td><td> 240</td>
<td> Leu 65</td><td> Glu</td><td> Trp</td><td> lie</td><td> Gly</td><td> Tyr 70</td><td> He</td><td> Tyr</td><td> Gly</td><td> Ser</td><td> Gly 75</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Asn</td><td> Tyr 80</td><td></td>
<td> AAT</td><td> CCC</td><td> TCC</td><td> CTC</td><td> AAC</td><td> AAT</td><td> CGA</td><td> GTC</td><td> TCC</td><td> ATT</td><td> TCA</td><td> ATA</td><td> GAC</td><td> ACG</td><td> TCC</td><td> AAG</td><td> 288</td>
<td> Asn</td><td> Pro</td><td> Ser</td><td> Leu</td><td> Asn 85</td><td> Asn</td><td> Arg</td><td> Val</td><td> Ser</td><td> He <sup>90</sup></td><td> Ser</td><td> He</td><td> Asp</td><td> Thr</td><td> Ser 95</td><td> Lys</td><td></td>
<td> AAC</td><td> CTC</td><td> TTC</td><td> TCC</td><td> CTG</td><td> AAA</td><td> CTG</td><td> AGG</td><td> TCT</td><td> GTG</td><td> ACC</td><td> GCC</td><td> GCG</td><td> GAC</td><td> ACG</td><td> GCC</td><td> 336</td>
<td> Asn</td><td> Leu</td><td> Phe</td><td> Ser 100</td><td> Leu</td><td> Lys</td><td> Leu</td><td> Arg</td><td> Ser 105</td><td> Val</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Asp no</td><td> Thr</td><td> Ala</td><td></td>
<td> GTC</td><td> TAT</td><td> TAC</td><td> TGT</td><td> GCG</td><td> AGT</td><td> AAT</td><td> ATA</td><td> TTG</td><td> AAA</td><td> TAT</td><td> CTT</td><td> CAC</td><td> TGG</td><td> TTA</td><td> TTA</td><td> 384</td>
<td> Val</td><td> Tyr</td><td> Tyr 115</td><td> Cys</td><td> Ala</td><td> Ser</td><td> Asn</td><td> lie 120</td><td> Leu</td><td> Lys</td><td> Tyr</td><td> Leu</td><td> His 125</td><td> Trp</td><td> Leu</td><td> Leu</td><td></td>
<td> TAC</td><td> TGG</td><td> GGC</td><td> CAG</td><td> GGA</td><td> GTC</td><td> CTG</td><td> GTC</td><td> ACC</td><td> GTC</td><td> TCC</td><td> TCA</td><td> GCT</td><td> AGC</td><td> ACC</td><td> AAG</td><td> 432</td>
<td> Tyr</td><td> Trp</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Val</td><td> Leu</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser</td><td> Ala</td><td> Ser</td><td> Thr</td><td> Lys</td><td></td>
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I
APO Ο 1 1 9.3
<td colspan="6"> 130</td><td colspan="3"> 135</td><td colspan="8"> 140</td>
<td> GGC</td><td> CCA</td><td> TCC</td><td> GTC</td><td> TTC</td><td> CCC</td><td> CTG</td><td> GCG</td><td> CCC</td><td> TGC</td><td> TCC</td><td> AGG</td><td> AGC</td><td> ACC</td><td> TCC</td><td> GAG</td><td> 480</td>
<td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Pro</td><td> Leu</td><td> Ala</td><td> Pro</td><td> Cys</td><td> Ser</td><td> Arg</td><td> Ser</td><td> Thr</td><td> Ser</td><td> Glu</td><td></td>
<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td>
<td> AGC</td><td> ACA</td><td> GCC</td><td> GCC</td><td> CTG</td><td> GGC</td><td> TGC</td><td> CTG</td><td> GTC</td><td> AAG</td><td> GAC</td><td> TAC</td><td></td><td> CCC</td><td> GAA</td><td> CCG</td><td> 528</td>
<td> Ser</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Leu</td><td> Gly</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Asp</td><td> Tyr</td><td> Phe</td><td> Pro</td><td> Glu</td><td> Pro</td><td></td>
<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td><td></td>
<td> GTG</td><td> ACG</td><td> GTG</td><td> TCG</td><td> TGG</td><td> AAC</td><td> TCA</td><td> GGC</td><td> GCC</td><td> CTG</td><td> ACC</td><td> AGC</td><td> GGC</td><td> GTG</td><td> CAC</td><td> ACC</td><td> 576</td>
<td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Trp</td><td> Asn</td><td> Ser</td><td> Gly</td><td> Ala</td><td> Leu</td><td> Thr</td><td> Ser</td><td> Gly</td><td> Val</td><td> His</td><td> Thr</td><td></td>
<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td>
<td> TTC</td><td> CCG</td><td> GCT</td><td> GTC</td><td> CTA</td><td> CAG</td><td> TCC</td><td> TCA</td><td> GGA</td><td> CTC</td><td> TAC</td><td> TCC</td><td> CTC</td><td> AGC</td><td> AGC</td><td> GTG</td><td> 624</td>
<td> Phe</td><td> Pro</td><td> Ala</td><td> Val</td><td> Leu</td><td> Gin</td><td> Ser</td><td> Ser</td><td> Gly</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Ser</td><td> Val</td><td></td>
<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td>
<td> GTG</td><td> ACC</td><td> GTG</td><td> CCC</td><td> TCC</td><td> AGC</td><td> AGC</td><td> TTG</td><td> GGC</td><td> ACG</td><td> AAG</td><td> ACC</td><td> TAC</td><td> ACC</td><td> TGC</td><td> AAC</td><td> 672</td>
<td> Val</td><td> Thr</td><td> Val</td><td> Pro</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Thr</td><td> Tyr</td><td> Thr</td><td> Cys</td><td> Asn</td><td></td>
<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td></td>
<td> GTA</td><td> GAT</td><td> CAC</td><td> AAG</td><td> CCC</td><td> AGC</td><td> AAC</td><td> ACC</td><td> AAG</td><td> GTG</td><td> GAC</td><td> AAG</td><td> AGA</td><td> GTT</td><td> GAG</td><td> TCC</td><td> 720</td>
<td> Val</td><td> Asp</td><td> His</td><td> Lys</td><td> Pro</td><td> Ser</td><td> Asn</td><td> Thr</td><td> Lys</td><td> Val</td><td> Asp</td><td> Lys</td><td> Arg</td><td> Val</td><td> Glu</td><td> Ser</td><td></td>
<td> 225</td><td></td><td> <</td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td><td></td>
<td> AAA</td><td> TAT</td><td> GGT</td><td> CCC</td><td> CCA</td><td> TGC</td><td> CCA</td><td> TCA</td><td> TGC</td><td> CCA</td><td> GCA</td><td> CCT</td><td> GAG</td><td> TTC</td><td> CTG</td><td> GGG</td><td> 768</td>
<td> Lys</td><td> Tyr</td><td> Gly</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Ser</td><td> Cys</td><td> Pro</td><td> Ala</td><td> Pro</td><td> Glu</td><td> Phe</td><td> Leu</td><td> Gly</td><td></td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td><td></td>
<td> GGA</td><td> CCA</td><td> TCA</td><td> GTC</td><td> TTC</td><td> CTG</td><td> TTC</td><td> CCC</td><td> CCA</td><td> AAA</td><td> CCC</td><td> AAG</td><td> GAC</td><td> ACT</td><td> CTC</td><td> ATG</td><td> 816</td>
<td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys</td><td> Pro</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu</td><td> Met</td><td></td>
<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td><td></td>
<td> . ATC</td><td> TCC</td><td> CGG</td><td> ACC</td><td> CCT</td><td> 'GAG'</td><td> GTC</td><td> ACG</td><td> TGC</td><td> GTG</td><td> GTG</td><td> GTG</td><td> GAC</td><td> GTG</td><td> AGC</td><td> CAG</td><td> 864</td>
<td> He</td><td> Ser</td><td> Arg</td><td> Thr</td><td> Pro</td><td> Glu</td><td> Val</td><td> Thr</td><td> Cys</td><td> Val</td><td> Val</td><td> Val</td><td> Asd</td><td> Val</td><td> Ser</td><td> Gin</td><td></td>
<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td><td></td><td></td><td></td><td></td>
<td> GAA</td><td> GAC</td><td> CCC</td><td> GAG</td><td> GTC</td><td> CAG</td><td> TTC</td><td> AAC</td><td> TGG</td><td> TAC</td><td> GTG</td><td> GAT</td><td> GGC</td><td> GTG</td><td> GAG</td><td> GTG</td><td> 912</td>
<td> Glu</td><td> Asp</td><td> Pro</td><td> Glu</td><td> Val</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Trp</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td><td> Val</td><td> Glu</td><td> Val</td><td></td>
<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td><td></td>
<td> CAT</td><td> AAT</td><td> GCC</td><td> AAG</td><td> ACA</td><td> AAG</td><td> CCG</td><td> CGG</td><td> GAG</td><td> GAG</td><td> CAG</td><td> TTC</td><td> AAC</td><td> AGC</td><td> ACG</td><td> TAC</td><td> 960</td>
<td> His</td><td> Asn</td><td> Ala</td><td> Lys</td><td> Thr</td><td> Lys</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr</td><td></td>
<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td><td></td>
<td> CGT</td><td> GTG</td><td> GTC</td><td> AGC</td><td> GTC</td><td> CTC</td><td> ACC</td><td> GTC</td><td> CTG</td><td> CAC</td><td> CAG</td><td> GAC</td><td> TGG</td><td> CTG</td><td> AAC</td><td> GGC</td><td> 1008</td>
<td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val</td><td> Leu</td><td> Thr</td><td> Val</td><td> Leu</td><td> His</td><td> Gin</td><td> Asp</td><td> Trp</td><td> Leu</td><td> Asn</td><td> Gly</td><td></td>
<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td><td></td>
<td> AAG</td><td> GAG</td><td> TAC</td><td> AAG</td><td> TGC</td><td> AAG</td><td> GTC</td><td> TCC</td><td> AAC</td><td> AAA</td><td> GGC</td><td> CTC</td><td> CCG</td><td> TCC</td><td> TCC</td><td> ATC</td><td> 1056</td>
<td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> Cys</td><td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Lys</td><td> Gly</td><td> Leu</td><td> Pro</td><td> Ser</td><td> Ser</td><td> He</td><td></td>
<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td><td></td>
<td> GAG</td><td> AAA</td><td> ACC</td><td> ATC</td><td> TCC</td><td> AAA</td><td> GCC</td><td> AAA</td><td> GGG</td><td> CAG</td><td> CCC</td><td> CGA</td><td> GAG</td><td> CCA</td><td> CAG</td><td> GTG</td><td> 1104</td>
<td> Glu</td><td> Lys</td><td> Thr</td><td> lie</td><td> Ser</td><td> .Lys</td><td> Ala</td><td> Lys</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> C-ln</td><td> Val</td><td></td>
AP/P! 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO01193
1152
<td> 355</td><td> 360</td><td> 365</td>
<td> TAC ACC. CTG CCC CCA TCC CAG</td><td> GAG GAG ATG</td><td> ACC AAG AAC CAG GTC AGC</td>
<td> Tyr Thr Leu Pro Pro Ser Gin</td><td> Glu Glu Met</td><td> Thr Lys Asn Gin Val Ser</td>
<td> 370 375</td><td></td><td> 380</td>
<td> CTG ACC TGC CTG GTC AAA GGC</td><td> TTC TAC CCC</td><td> AGC GAC ATC GCO GTG GAG</td>
<td> Leu Thr Cys Leu Val Lys Gly</td><td> Phe Tyr Pro</td><td> Ser Asp He Ala Val Glu</td>
<td> 385 390</td><td></td><td> 395 400</td>
<td> TGG GAG AGC AAT GGG CAG CCG</td><td> GAG AAC AAC</td><td> TAC AAG ACC ACG CCT CCC</td>
<td> Trp Glu Ser Asn Gly Gin Pro</td><td> Glu Asn Asn</td><td> Tyr Lys Thr Thr Pro Pro</td>
<td> 405</td><td> 410</td><td> 415</td>
<td> GTG CTG GAC TCC GAC GGC TCC</td><td> TTC TTC CTC</td><td> TAC AGC AGG CTA ACC GTG</td>
<td> Val Leu Asp Ser Asp. Gly Ser</td><td> Phe Phe Leu</td><td> Tyr Ser Arg Leu Thr Val</td>
<td> 420</td><td> 425</td><td> 430</td>
<td> GAC AAG AGC AGG TGG CAG GAG</td><td> GGG AAT GTC</td><td> TTC TCA TGC TCC GTG ATG</td>
<td> Asp Lys Ser Arg Trp Gin Glu</td><td> Gly Asn Val</td><td> Phe Ser Cys Ser Val Met</td>
<td> 435</td><td> 440</td><td> 445</td>
<td> CAT GAG GCT CTG CAC AAC CAC</td><td> TAC ACA CAG</td><td> AAG AGC CTC TCC CTG TCT</td>
<td> His Glu Ala Leu His Asn His</td><td> Tyr Thr Gin</td><td> Lys Ser Leu Ser Leu Ser</td>
<td> 450 455</td><td></td><td> 460</td>
<td> CTG GGT AAA TGA</td><td></td><td></td>
<td> Leu Gly Lys *</td><td></td><td></td>
<td> 465</td><td></td><td></td>
<td colspan="2"> (2) INFORMATION FOR SEQ ID NO:8:</td><td></td>
<td colspan="2"> (i) SEQUENCE CHARACTERISTICS:</td><td></td>
<td colspan="3"> (A) LENGTH: 468 amino acids</td>
<td colspan="2"> (B) TYPE: amino acid</td><td></td>
<td colspan="2"> (D) TOPOLOGY: linear</td><td></td>
<td colspan="2"> (ii) MOLECULE TYPE: protein</td><td></td>
<td colspan="2"> (Xi) SEQUENCE DESCRIPTION: SEQ ID</td><td> NO :8 :</td>
<td> Met Lys His Leu Trp Phe Phe</td><td> Leu Leu Leu</td><td> Val Ala Ala Pro Arg Trp</td>
<td> 1 5</td><td> 10</td><td> 15</td>
<td> Val Leu Ser Gin Val Gin Leu</td><td> Gin Glu Ser</td><td> Gly Pro Gly Leu Val Lys</td>
<td> 20</td><td> 25</td><td> 30</td>
<td> Pro Ser Glu Thr Leu Ser Leu</td><td> Thr Cys Ser</td><td> Val Ser Gly Gly Ser Ils</td>
<td> 35</td><td> 40</td><td> 4 5</td>
<td> Ser Gly Asp Tyr Tyr Trp Phe</td><td> Trp lie Arg</td><td> Gin Ser Pro Gly Lys Gly</td>
<td> 50 55</td><td></td><td> 60</td>
<td> Leu Glu Trp lie Gly Tyr He</td><td> Tyr Gly Ser</td><td> Gly Gly Gly Thr Asn Tyr</td>
<td> 65 70</td><td></td><td> 75 80</td>
1200
1248
1296
1344
1392
1404
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
<td> Asn</td><td> Pro</td><td colspan="2"> Ser Leu</td><td> Asn 85</td><td> Asn</td><td colspan="2"> Arg Val</td><td> Ser</td><td> lie 90</td><td> Ser</td><td> lie</td><td> Asp</td><td> Thr</td><td> Ser 95</td><td> Lys</td>
<td> Asn</td><td> Leu</td><td> Phe</td><td> Ser</td><td> Leu</td><td> Lys</td><td> Leu</td><td> Arg</td><td> Ser</td><td> Val</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Asp</td><td> Thr</td><td> Ala</td>
<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>
<td> Val</td><td rowspan="2"> Tyr</td><td> Tyr</td><td> Cys</td><td> Ala</td><td> Ser</td><td> Asn</td><td> lie</td><td> Leu</td><td> Lys</td><td> Tyr</td><td> Leu</td><td> His</td><td> Tro *</td><td> Leu</td><td> Leu</td>
<td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td>
<td> Tyr</td><td> Trp</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Val</td><td> Leu</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser</td><td> Ala</td><td> Ser</td><td> Thr</td><td> Lys</td>
<td></td><td> 13 0</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>
<td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Pro</td><td> Leu</td><td> Ala</td><td> Pro</td><td> Cys</td><td> Ser</td><td> Arg</td><td> Ser</td><td> Thr</td><td> Ser</td><td> Glu</td>
<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td>
<td> Ser</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Leu</td><td> Gly</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Asp</td><td> Tyr</td><td> Phe</td><td> Pro</td><td> Glu</td><td> Pro</td>
<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td>
<td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Trp</td><td> Asn</td><td> Ser</td><td> Gly</td><td> Ala</td><td> Leu</td><td> Thr</td><td> Ser</td><td> Gly</td><td> Val</td><td> His</td><td> Thr</td>
<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td>
<td> Phe</td><td> Pro</td><td> Ala</td><td> Val</td><td> Leu</td><td> Gin</td><td> Ser</td><td> Ser</td><td> Gly</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Ser</td><td> Val</td>
<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>
<td> Val</td><td> Thr</td><td> Val</td><td> Pro</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Thr</td><td> Tyr</td><td> Thr</td><td> Cys</td><td> Asn</td>
<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td> /</td>
<td> Val</td><td> Asp</td><td> His</td><td> Lys</td><td> Pro</td><td> Ser</td><td> Asn</td><td> Thr</td><td> Lys</td><td> Val</td><td> Asp</td><td> Lys</td><td> Arg</td><td> Val</td><td> Glu</td><td> Ser</td>
<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>
<td> Lys</td><td> Tyr</td><td> Gly</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Ser</td><td> Cys</td><td> Pro</td><td> Ala</td><td> Pro</td><td> Glu</td><td> Phe</td><td> Leu</td><td> Gly</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td>
<td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys</td><td> Pro</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu</td><td> Met</td>
<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td>
<td> He</td><td> Ser</td><td> Arg</td><td> Thr</td><td> Pro</td><td> Glu</td><td> Val</td><td> Thr</td><td> Cys</td><td> Val</td><td> Val</td><td> Val</td><td> Asp</td><td> Val</td><td> Ser</td><td> Gin</td>
<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td><td></td><td></td><td></td>
<td> Glu</td><td> Asp</td><td> Pro</td><td> Glu</td><td> Val</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Trp</td><td> Tyr</td><td> Val</td><td> Asp</td><td rowspan="2"> Gly</td><td> Val</td><td> Glu</td><td> Val</td>
<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td>
<td> His</td><td> Asn</td><td> Ala</td><td> Lys</td><td> Thr</td><td> Lys</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr</td>
<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td>
<td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val</td><td> Leu</td><td> Thr</td><td> Val</td><td> Leu</td><td> His</td><td> Gin</td><td rowspan="2"> Asp</td><td rowspan="2"> Trp</td><td> Leu</td><td> Asn</td><td rowspan="2"> Gly</td>
<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td> 335</td>
<td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> cvs</td><td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Lys</td><td> Gly</td><td> Leu</td><td> Pro</td><td> Ser</td><td> Ser</td><td> lie</td>
<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>
<td> Glu</td><td> Lys</td><td> Thr</td><td> lie</td><td> Ser</td><td> Lys</td><td> Ala</td><td> Lys</td><td> Gly</td><td> Gin</td><td> Pro</td><td rowspan="2"> Arg</td><td> Glu</td><td> Pro</td><td> Gin</td><td> Val</td>
<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>
<td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro</td><td> Pro</td><td> Ser</td><td> Gin</td><td> Glu</td><td> Glu</td><td> Met</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Val</td><td rowspan="2"> Ser</td>
<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td>
AP/F/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
>
<td> Leu 385</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys 390</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser 395</td><td> Asp</td><td> lie</td><td> Ala</td><td> Val</td><td> Glu 400</td>
<td> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td><td> Gly 405</td><td> Gin</td><td> Pro</td><td> Glu</td><td> Asn</td><td> Asn 410</td><td> Tyr</td><td> Lys</td><td> Thr</td><td> Thr</td><td> Pro 415</td><td> Pro</td>
<td> Val</td><td> Leu</td><td> Asp</td><td> Ser 420</td><td> Asp</td><td> Gly</td><td> Ser</td><td> Phe</td><td> Phe 425</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Arg</td><td> Leu 430</td><td> Thr</td><td> Val</td>
<td> Asp</td><td> Lys</td><td> Ser 435</td><td> Arg</td><td> Trp</td><td> Gin</td><td> Glu</td><td> Gly 440</td><td> Asn</td><td> Val</td><td> Phe</td><td> Ser</td><td> Cys 445</td><td> Ser</td><td> Val</td><td> Met</td>
<td> His</td><td> Glu 450</td><td> Ala</td><td> Leu</td><td> His</td><td> Asn</td><td> His 455</td><td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td><td> Ser 460</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Ser</td>
Leu Gly Lys * 465 (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1404 base pairs (B) TYPE: nucleic acid (fc) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (Vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens
KPIPI 9 8 / 0 1 2 0 9 (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: heavy chain gamma 4 with the E (ix) FEATURE:
(A) NAME/KEY: CDS (B) LOCATION: 1..1404 mutation (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 1..1404 (XI SEQUENCE DESCRIPTION: SEQ ID NO:9:
<td> ATG</td><td> AAA</td><td> CAC</td><td> CTG</td><td> TGG</td><td> TTC</td><td> TTC</td><td> CTC</td>
<td> Met 1</td><td> Lys</td><td> His</td><td> Leu</td><td> Trp 5</td><td> Phe</td><td> Phe</td><td> Leu</td>
<td> GTC</td><td> TTG</td><td> TCC</td><td> CAG</td><td> GTG</td><td> CAG</td><td> CTG</td><td> CAG</td>
<td> Val</td><td> Leu</td><td> Ser</td><td> Gin 20</td><td> Val</td><td> Gin</td><td> Leu</td><td> Gin</td>
<td> CCT</td><td> TCG</td><td> GAG</td><td> ACC</td><td> CTG</td><td> TCC</td><td> CTC</td><td> ACC</td>
<td> Pro</td><td> Ser</td><td> Glu 35</td><td> Thr</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Thr 40</td>
<td> CTC</td><td> CTG</td><td> GTG</td><td> GCA</td><td> GCC</td><td> CCC</td><td> AGA</td><td> TGG</td>
<td> Leu</td><td> Leu 10</td><td> Val</td><td> Ala</td><td> Ala</td><td> Pro</td><td> Arg 15</td><td> Trp</td>
<td> GAG</td><td> TCG</td><td> GGC</td><td> CCA</td><td> GGA</td><td> CTG</td><td> GTG</td><td> AAG</td>
<td> Glu 25</td><td> Ser</td><td> Gly</td><td> Pro</td><td> Gly</td><td> Leu 30</td><td> Val</td><td> Lys</td>
<td> TGC</td><td> AGT</td><td> GTC</td><td> TCT</td><td> GGT</td><td> GGC</td><td> TCC</td><td> ATC</td>
<td> Cys</td><td> Ser</td><td> Val</td><td> Ser</td><td> Gly 45</td><td> Gly</td><td> Ser</td><td> lie</td>
144
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
<td rowspan="2"> AGC Ser</td><td rowspan="2"> GGT Gly 50</td><td rowspan="2"> GAC Asp</td><td rowspan="2"> TAT Tyr</td><td colspan="2"> TAT TGG</td><td rowspan="2"> TTC Phe 55</td><td rowspan="2"> TGG Tr?</td><td rowspan="2"> ATC lie</td><td rowspan="2"> CGC Arg</td><td rowspan="2"> CAG Gin</td><td rowspan="2"> TCC Ser 60</td><td rowspan="2"> CCA Pro</td><td rowspan="2"> GGG Gly</td><td rowspan="2"> AAG Lys</td><td rowspan="2"> GGA Gly</td><td rowspan="2"> 192</td>
<td> Tyr</td><td> Trp</td>
<td> CTG</td><td> GAG</td><td> TGG</td><td> ATC</td><td> GGC</td><td> TAC</td><td> ATC</td><td> TAT</td><td> GGC</td><td> AGT</td><td> GGT</td><td> GGG</td><td> fr·/’·' (JUU</td><td> ACC</td><td> AAT</td><td> TAC</td><td> 240</td>
<td> Leu</td><td> Glu</td><td> Trp</td><td> lie</td><td> Gly</td><td> Tyr</td><td> lie</td><td> Tyr</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Asn</td><td> Tyr</td><td></td>
<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td><td></td>
<td> AAT</td><td> CCC</td><td> TCC</td><td> CTC</td><td> AAC</td><td> AAT</td><td> CGA</td><td> GTC</td><td> TCC</td><td> ATT</td><td> TCA</td><td> ATA</td><td> GAC</td><td> ACG</td><td> TCC</td><td> AAG</td><td> 288</td>
<td> Asn</td><td> Pro</td><td> Ser</td><td> Leu</td><td> Asn</td><td> Asn</td><td> Arg</td><td> Val</td><td> Ser</td><td> He</td><td> Ser</td><td> lie</td><td> Asp</td><td> Thr</td><td> Ser</td><td> Lys</td><td></td>
<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td><td></td><td></td>
<td> AAC</td><td> CTC</td><td> TTC</td><td> TCC</td><td> CTG</td><td> AAA</td><td> CTG</td><td> AGG</td><td> TCT</td><td> GTG</td><td> ACC</td><td> GCC</td><td> GCG</td><td> GAC</td><td> ACG</td><td> GCC</td><td> 336</td>
<td> Asn</td><td> Leu</td><td> Phe</td><td> Ser</td><td> Leu</td><td> Lys</td><td> Leu</td><td> Arg</td><td> Ser</td><td> Val</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Asp</td><td> Thr</td><td> Ala</td><td></td>
<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td><td></td>
<td> GTC</td><td> TAT</td><td> TAC</td><td> TGT</td><td> GCG</td><td> AGT</td><td> AAT</td><td> ATA</td><td> TTG</td><td> AAA</td><td> TAT</td><td> CTT</td><td> CAC</td><td> TGG</td><td> TTA</td><td> TTA</td><td> 384</td>
<td> Val</td><td> Tyr</td><td> Tyr</td><td> Cys</td><td> Ala</td><td> Ser</td><td> Asn</td><td> lie</td><td> Leu</td><td> Lys</td><td> Tyr</td><td> Leu</td><td> His</td><td> Trp</td><td> Leu</td><td> Leu</td><td></td>
<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td><td></td><td></td>
<td> TAC</td><td> TGG</td><td> GGC</td><td> CAG</td><td> GGA</td><td> GTC</td><td> CTG</td><td> GTC</td><td> ACC</td><td> GTC</td><td> TCC</td><td> TCA</td><td> GCT</td><td> AGC</td><td> ACC</td><td> AAG</td><td> 432</td>
<td> Tyr</td><td> Trp</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Val</td><td> Leu</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser</td><td> Ala</td><td> Ser</td><td> Thr</td><td> Lys</td><td></td>
<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td><td></td>
<td> GGG</td><td> CCA</td><td> ✓ . TCC</td><td> GTC</td><td> TTC</td><td> CCC</td><td> CTG</td><td> GCG</td><td> CCC</td><td> TGC</td><td> TCC</td><td> AGG</td><td> AGC</td><td> ACC</td><td> TCC</td><td> GAG</td><td> 480</td>
<td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Pro</td><td> Leu</td><td> Ala</td><td> Pro</td><td> Cys</td><td> Ser</td><td> Arg</td><td> Ser</td><td> Thr</td><td> Ser</td><td> Glu</td><td></td>
<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td><td></td>
<td> AGC</td><td> ACA</td><td> GCC</td><td> GCC</td><td> CTG</td><td> GGC</td><td> TGC</td><td> CTG</td><td> GTC</td><td> AAG</td><td> GAC</td><td> TAC</td><td> TTC</td><td> CCC</td><td> GAA</td><td> CCG</td><td> 528</td>
<td> Ser</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Leu</td><td> Gly</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Asp</td><td> Tyr</td><td> Phe</td><td> Pro</td><td> Glu</td><td> Pro</td><td></td>
<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 17 5</td><td></td><td></td>
<td> GTG</td><td> ACG</td><td> GTG</td><td> TCG</td><td> TGG</td><td> AAC</td><td> TCA</td><td> GGC</td><td> GCC</td><td> CTG</td><td> ACC</td><td> AGC</td><td> GGC</td><td> GTG</td><td> CAC</td><td> ACC</td><td> 576</td>
<td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Irp</td><td> Asn</td><td> Ser</td><td> Gly</td><td> Ala</td><td> Leu</td><td> Thr</td><td> Ser</td><td> Gly</td><td> Val</td><td> His</td><td> Thr</td><td></td>
<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td></td><td> 190</td><td></td><td></td><td></td>
<td> TTC</td><td> CCG</td><td> GCT</td><td> GTC</td><td> CTA</td><td> CAG</td><td> TCC</td><td> TCA</td><td> GGA</td><td> CTC</td><td> TAC</td><td> TCC</td><td> CTC</td><td> AGC</td><td> AGC</td><td> GTG</td><td> 624</td>
<td> Phe</td><td> Pro</td><td> Ala</td><td> Val</td><td> Leu</td><td> Gin</td><td> Ser</td><td> Ser</td><td> Gly</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Ser</td><td> Val</td><td></td>
<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td>
<td> GTG</td><td> ACC</td><td> GTG</td><td> CCC</td><td> TCC</td><td> AGC</td><td> AGC</td><td> TTG</td><td> GGC</td><td> ACG</td><td> AAG</td><td> ACC</td><td> TAC</td><td> ACC</td><td> TGC</td><td> AAC</td><td> 672</td>
<td> Val</td><td> Thr</td><td> Val</td><td> Pro</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Thr</td><td> Tyr</td><td> Thr</td><td> Cys</td><td> Asn</td><td></td>
<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td></td>
<td> GTA</td><td> GAT</td><td> CAC</td><td> AAG</td><td> CCC</td><td> AGC</td><td> AAC</td><td> ACC</td><td> AAG</td><td> GTG</td><td> GAC</td><td> AAG</td><td> AGA</td><td> GTT</td><td> GAG</td><td> TCC</td><td> 720</td>
<td> Val</td><td> Asp</td><td> His</td><td> Lys</td><td> Pro</td><td> Ser</td><td> Asn</td><td> Thr</td><td> Lys</td><td> Val</td><td> Asd</td><td> Lys</td><td> Arg</td><td> Val</td><td> Glu</td><td> Ser</td><td></td>
<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 23*5</td><td></td><td></td><td></td><td></td><td> 240</td><td></td>
<td> AAA</td><td> TAT</td><td> GGT</td><td> CCC</td><td> CCA</td><td> TGC</td><td> CCA</td><td> TCA</td><td> TGC</td><td> CCA</td><td> C-CA</td><td> CCT</td><td> GAG</td><td> TTC</td><td> GAG</td><td> GGG</td><td> 768</td>
<td> Lys</td><td> Tyr</td><td> Gly</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Ser</td><td> CVS</td><td> Pro</td><td> Ala</td><td> Pro</td><td> Glu</td><td> Phe</td><td> Glu</td><td> Gly</td><td></td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td><td></td>
<td> GGA</td><td> CCA</td><td> TCA</td><td> GTC</td><td> TTC</td><td> CTG</td><td> TTC</td><td> CCC</td><td> CCA</td><td> AAA</td><td> CCC</td><td> AAG</td><td> GAC</td><td> ACT</td><td> CTC</td><td> ATG</td><td> 816</td>
<td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys</td><td> Pro</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu</td><td> Met</td><td></td>
<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td><td></td>
AP/P/ 9 8 / 0 1 209
BNSDOCID: <AP
AP1193A I >
APOO1193
864
<td> ATC</td><td> TCC</td><td> CGG</td><td> ACC</td><td> CCT</td><td> GAG</td><td> GTC</td><td> ACG</td><td> TGC</td><td> GTG</td><td> GTG</td><td> GTG</td><td> GAC</td><td> GTG</td><td> AGC</td><td> CAG</td>
<td> lie</td><td> Ser</td><td> Arg 275</td><td> Thr</td><td> Pro</td><td> Glu</td><td> Val</td><td> Thr 280</td><td> Cys</td><td> Val</td><td> Val</td><td> Val</td><td> Asp 285</td><td> Val</td><td> Ser</td><td> Gin</td>
<td> GAA</td><td> GAC</td><td> CCC</td><td> GAG</td><td> GTC</td><td> CAG</td><td> TTC</td><td> AAC</td><td> r· iuv</td><td> TAC</td><td> GTG</td><td> GAT</td><td> GGC</td><td> GTG</td><td> GAG</td><td> GTG</td>
<td> Glu</td><td> Asp 290</td><td> Pro</td><td> Glu</td><td> Val</td><td> Gin</td><td> Phe 295</td><td> Asn</td><td> Trp</td><td> Tyr</td><td> Val</td><td> Asp 3 0*0</td><td> Gly</td><td> Val</td><td> Glu</td><td> Val</td>
<td> CAT</td><td> AAT</td><td> GCC</td><td> AAG</td><td> ACA</td><td> AAG</td><td></td><td> CGG</td><td> GAG</td><td> GAG</td><td> CAG</td><td> TTC</td><td> AAC</td><td> AGC</td><td> ACG</td><td> TAC</td>
<td> His 305</td><td> Asn</td><td> Ala</td><td> Lys</td><td> Thr</td><td> Lys 310</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin 315</td><td> Phe</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr 320</td>
<td> CGT</td><td> GTG</td><td> GTC</td><td> AGC</td><td> GTC</td><td> CTC</td><td> ACC</td><td> GTC</td><td> CTG</td><td> CAC</td><td> CAG</td><td> GAC</td><td> TGG</td><td> CTG</td><td> AAC</td><td> GGC</td>
<td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val 325</td><td> Leu</td><td> Thr</td><td> Val</td><td> Leu</td><td> His 330</td><td> Gin</td><td> Asp</td><td> Trp</td><td> Leu</td><td> Asn 335</td><td> Gly</td>
<td> AAG</td><td> GAG</td><td> TAC</td><td> AAG</td><td> TGC</td><td> AAG</td><td> GTC</td><td> TCC</td><td> AAC</td><td> AAA</td><td> GGC</td><td> CTC</td><td> CCG</td><td> TCC</td><td> TCC</td><td> ATC</td>
<td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys 340</td><td> Cys</td><td> Lys</td><td> Val</td><td> Ser</td><td> Asn 345</td><td> Lys</td><td> Gly</td><td> Leu</td><td> Pro</td><td> Ser 350</td><td> Ser</td><td> He</td>
<td> GAG</td><td> AAA</td><td> ACC</td><td> ATC</td><td> TCC</td><td> AAA</td><td> GCC</td><td> AAA</td><td> GGG</td><td> CAG</td><td> CCC</td><td> CGA</td><td> GAG</td><td> CCA</td><td> CAG</td><td> GTG</td>
<td> Glu</td><td> Lys</td><td> Thr 35¾</td><td> He</td><td> Ser</td><td> Lys</td><td> Ala</td><td> Lys 360</td><td> C-ly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu 365</td><td> Pro</td><td> Gin</td><td> Val</td>
<td> TAC</td><td> ACC</td><td> CTG</td><td> CCC</td><td> CCA</td><td> TCC</td><td> CAG</td><td> GAG</td><td> GAG</td><td> ATG</td><td> ACC</td><td> AAG</td><td> AAC</td><td> CAG</td><td> GTC</td><td> AGC</td>
<td> Tyr</td><td> Thr 370</td><td> Leu</td><td> Pro</td><td> Pro</td><td> Ser</td><td> Gin '375</td><td> Glu</td><td> Glu</td><td> Met</td><td> Thr</td><td> Lys 380</td><td> Asn</td><td> Gin</td><td> Val</td><td> Ser</td>
<td> CTG</td><td> ACC</td><td> TGC</td><td> CTG</td><td> GTC</td><td> AAA</td><td> GGC</td><td> TTC</td><td> TAC</td><td> CCC</td><td> AGC</td><td> GAC</td><td> ATC</td><td> GCC</td><td> GTG</td><td> GAG</td>
<td> Leu 385</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys 390</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser 395</td><td> Asp</td><td> lie</td><td> Ala</td><td> Val</td><td> Glu 400</td>
<td> TGG</td><td> GAG</td><td> AGC</td><td> AAT</td><td> GGG</td><td> CAG</td><td> CCG</td><td> GAG</td><td> AAC</td><td> AAC</td><td> TAC</td><td> AAG</td><td> ACC</td><td> ACG</td><td> CCT</td><td> CCC</td>
<td> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td><td> Gly 405</td><td> Gin</td><td> Pro</td><td> Glu</td><td> Asn</td><td> Asn 410</td><td> Tyr</td><td> Lys</td><td> Thr</td><td> Thr</td><td> Pro 415</td><td> Pro</td>
<td> GTG</td><td> CTG</td><td> GAC</td><td> TCC</td><td> GAC</td><td> GGC</td><td> TCC</td><td> TTC</td><td> TTC</td><td> CTC</td><td> TAC</td><td> AGC</td><td> AGG</td><td> CTA</td><td> ACC</td><td> GTG</td>
<td> Val</td><td> Leu</td><td> Asp</td><td> Ser 420</td><td> Asp</td><td> Gly</td><td> Ser</td><td> Phe</td><td> Phe 425</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Arg</td><td> Leu 430</td><td> Thr</td><td> Val</td>
<td> GAC</td><td> AAG</td><td> AGC</td><td> AGG</td><td> TGG</td><td> CAG</td><td> GAG</td><td> GGG</td><td> AAT</td><td> GTC</td><td> TTC</td><td> TCA</td><td> TGC</td><td> TCC</td><td> GTG</td><td> ATG</td>
<td> Asp</td><td> Lys</td><td> Ser 435</td><td> Arg</td><td> Trp</td><td> Gin</td><td> Glu</td><td> Gly 440</td><td> Asn</td><td> Val</td><td> Phe</td><td> Ser</td><td> Cys 445</td><td> Ser</td><td> Val</td><td> Met</td>
<td> CAT</td><td> GAG</td><td> GCT</td><td> CTG</td><td> CAC</td><td> AAC</td><td> CAC</td><td> TAC</td><td> ACA</td><td> CAG</td><td> AAG</td><td> AGC</td><td> CTC</td><td> TCC</td><td> CTG</td><td> TCT</td>
<td> His</td><td> Glu 450</td><td> Ala</td><td> Leu</td><td> His</td><td> Asn</td><td> His 455</td><td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td><td> Ser 460</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Ser</td>
912
960
1008
1056
1104
1152
1200
1248
1296
1344
1392
CTG GGT AAA TGA Leu Gly Lys * 465 (2) INFORMATION FOR SEQ ID NO :10:
(i) SEQUENCE CHARACTERISTICS:
PIPI 9 8 / 0 1 2 09
1404
BNSDOCID: <AP
AP1193A I >
APO01193 (A) LENGTH: 468 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
<td> Met 1</td><td colspan="2"> Lys His</td><td colspan="2"> Leu Trp 5</td><td colspan="2"> Phe Phe</td><td colspan="2"> Leu Leu</td><td colspan="4"> Leu Val Ala Ala 10</td><td> Pro</td><td> Arg 15</td><td> Trp</td>
<td> Val</td><td> Leu</td><td> Ser</td><td> Gin</td><td> Val</td><td> Gin</td><td> Leu</td><td> Gin</td><td> Glu</td><td> Ser</td><td> Gly</td><td> Pro</td><td> Gly</td><td> Leu</td><td> Val</td><td rowspan="2"> Lys</td>
<td></td><td></td><td></td><td> 20</td><td></td><td></td><td></td><td></td><td> 25</td><td></td><td></td><td></td><td></td><td> 30</td><td></td>
<td> Pro</td><td> Ser</td><td> Glu</td><td> Thr</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Thr</td><td> Cys</td><td> Ser</td><td> Val</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Ser</td><td> He</td>
<td></td><td></td><td> 35</td><td></td><td></td><td></td><td></td><td> 40</td><td></td><td></td><td></td><td></td><td> 45</td><td></td><td></td><td></td>
<td> Ser</td><td> Gly</td><td> Asp</td><td> Tyr</td><td> Tyr</td><td> Trp</td><td> Phe</td><td> Trp</td><td> He</td><td> Arg</td><td> Gin</td><td> Ser</td><td> Pro</td><td> Gly</td><td> Lys</td><td> Gly</td>
<td></td><td> 50</td><td></td><td></td><td></td><td></td><td> 55</td><td></td><td></td><td></td><td></td><td> 60</td><td></td><td></td><td></td><td></td>
<td> Leu</td><td> Glu</td><td> Trp</td><td> lie</td><td> Gly</td><td> Tyr</td><td> lie</td><td> Tyr</td><td> Gly</td><td> Ser</td><td> Gly</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Asn</td><td> Tyr</td>
<td> 65</td><td></td><td></td><td></td><td></td><td> 70</td><td></td><td></td><td></td><td></td><td> 75</td><td></td><td></td><td></td><td></td><td> 80</td>
<td> Asn</td><td> Pro</td><td> i. Ser</td><td> Leu</td><td> Asn</td><td> Asn</td><td> Arg</td><td> Val</td><td> Ser</td><td> lie</td><td> Ser</td><td> He</td><td> Asp</td><td> Thr</td><td> Ser</td><td rowspan="2"> Lys</td>
<td></td><td></td><td></td><td></td><td> 85</td><td></td><td></td><td></td><td></td><td> 90</td><td></td><td></td><td></td><td></td><td> 95</td>
<td> Asn</td><td> Leu</td><td> Phe</td><td> Ser</td><td> Leu</td><td> Lys</td><td> Leu</td><td> Arg</td><td> Ser</td><td> Val</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Asp</td><td> Thr</td><td> Ala</td>
<td></td><td></td><td></td><td> 100</td><td></td><td></td><td></td><td></td><td> 105</td><td></td><td></td><td></td><td></td><td> 110</td><td></td><td></td>
<td> Val</td><td> Tyr</td><td> Tyr</td><td> Cys</td><td> Ala</td><td> Ser</td><td> Asn</td><td> lie</td><td> Leu</td><td> Lys</td><td> Tyr</td><td> Leu</td><td> His</td><td rowspan="2"> Trp</td><td> Leu</td><td> Leu</td>
<td></td><td></td><td> 115</td><td></td><td></td><td></td><td></td><td> 120</td><td></td><td></td><td></td><td></td><td> 125</td><td></td><td></td>
<td> Tyr</td><td> Trp</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Val</td><td> Leu</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser</td><td> Ala</td><td> Ser</td><td> Thr</td><td> Lys</td>
<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 13 5</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>
<td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Pro</td><td> Leu</td><td> Ala</td><td> Pro</td><td> Cys</td><td> Ser</td><td rowspan="2"> Arg</td><td> Ser</td><td> Thr</td><td> Ser</td><td> Glu</td>
<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td> 160</td>
<td> Ser</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Leu</td><td> Gly</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Asp</td><td rowspan="2"> Tyr</td><td> Phe</td><td> Pro</td><td> Glu</td><td> Pro</td>
<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td> 175</td><td></td>
<td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Trp</td><td> Asn</td><td> Ser</td><td> Gly</td><td> Ala</td><td> Leu</td><td> Thr</td><td> Ser</td><td rowspan="2"> Gly</td><td> Val</td><td> His</td><td> Thr</td>
<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td> 190</td><td></td><td></td>
<td> Phe</td><td> Pro</td><td> Ala</td><td> Val</td><td> Leu</td><td> C-ln</td><td> Ser</td><td> Ser</td><td> Gly</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Ser</td><td> Val</td>
<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>
<td> Val</td><td> Thr</td><td> Val</td><td> Pro</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Thr</td><td rowspan="2"> Tyr</td><td> Thr</td><td rowspan="2"> Cys</td><td> Asn</td>
<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td>
<td> Val</td><td> Asp</td><td> His</td><td> Lys</td><td> Pro</td><td> Ser</td><td> Asn</td><td> Thr</td><td> Lys</td><td> Val</td><td> Asp</td><td rowspan="2"> Lys</td><td> Arg</td><td> Val</td><td> Glu</td><td> Ser</td>
<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td> 240</td>
<td> Lys</td><td> .Tyr</td><td> Gly</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Ser</td><td> Cys</td><td> Pro</td><td> Ala</td><td> Pro</td><td> Glu</td><td> Phe</td><td> Glu</td><td rowspan="2"> Gly</td>
<td></td><td></td><td></td><td></td><td> 245'</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td>
AP/P/ 9 8/01209
BNSDOCID: <AP
AP1193A I >
APC 0 119 3 .
<td colspan="2"> Gly Pro</td><td> Ser</td><td colspan="2"> Val Phe 260</td><td colspan="4"> Leu Phe Pro Pro 265</td><td> Lys</td><td> Pro</td><td> Lys</td><td colspan="3"> Asp Thr Leu 270</td><td> Met</td>
<td> He</td><td> Ser</td><td> Arg</td><td> Thr</td><td> Pro</td><td> Glu</td><td> Val</td><td> Thr</td><td> Cys</td><td> Val</td><td> Val</td><td> Val</td><td> Aso</td><td> Val</td><td> Ser</td><td> Gin</td>
<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td><td></td><td></td><td></td>
<td> Glu</td><td> Asp</td><td> Pro</td><td> Glu</td><td> Val</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Trp</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td><td> Val</td><td> Glu</td><td> Val</td>
<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td>
<td> His</td><td> Asn</td><td> Ala</td><td> Lys</td><td> Thr</td><td> Lys</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr</td>
<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td>
<td rowspan="2"> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val</td><td> Leu</td><td> Thr</td><td> Val</td><td> Leu</td><td> His</td><td> Gin</td><td> Asp</td><td> Trp</td><td> Leu</td><td> Asn</td><td rowspan="2"> Gly</td>
<td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td>
<td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> Cys</td><td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Lys</td><td> Gly</td><td> Leu</td><td> Pro</td><td> Ser</td><td> Ser</td><td> lie</td>
<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>
<td> Glu</td><td> Lys</td><td> Thr</td><td> lie</td><td> Ser</td><td> Lys</td><td> Ala</td><td> Lys</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> Gin</td><td> Val</td>
<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>
<td rowspan="2"> Tyr</td><td> Thr</td><td> Leu</td><td> Pro</td><td> Pro</td><td> Ser</td><td> Gin</td><td> Glu</td><td> Glu</td><td> Met</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Val</td><td> Ser</td>
<td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td><td></td>
<td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td><td> He</td><td> Ala</td><td> Val</td><td> Glu</td>
<td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td><td></td><td></td><td></td><td> 395</td><td></td><td></td><td></td><td></td><td> 400</td>
<td rowspan="2"> Trp</td><td> Glu</td><td> Ser</td><td> Asn</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Glu</td><td> Asn</td><td> Asn</td><td> Tyr</td><td> Lys</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Pro</td>
<td></td><td></td><td></td><td> 405</td><td></td><td></td><td></td><td></td><td> 410</td><td></td><td></td><td></td><td></td><td> 415</td><td></td>
<td> Val</td><td> Leu</td><td> Asp</td><td> Ser</td><td> Asp</td><td> Gly</td><td> Ser</td><td> Phe</td><td> Phe</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Arg</td><td> Leu</td><td> Thr</td><td> Val</td>
<td></td><td></td><td></td><td> 420</td><td></td><td></td><td></td><td></td><td> 425</td><td></td><td></td><td></td><td></td><td> 430</td><td></td><td></td>
<td> Asp</td><td> Lys</td><td> Ser</td><td colspan="2"> Arg Trp</td><td> Gin</td><td> Glu</td><td> Gly</td><td> Asn</td><td> Val</td><td> Phe</td><td> Ser</td><td> Cys</td><td> Ser</td><td> Val</td><td> Met</td>
<td></td><td></td><td> 435</td><td></td><td></td><td></td><td></td><td> 440</td><td></td><td></td><td></td><td></td><td> 445</td><td></td><td></td><td></td>
<td> His</td><td> Glu</td><td> Ala</td><td> Leu</td><td> His</td><td> Asn</td><td> His</td><td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Ser</td>
<td></td><td> 450</td><td></td><td></td><td></td><td></td><td> 455</td><td></td><td></td><td></td><td></td><td> 460</td><td></td><td></td><td></td><td></td>
Leu Gly Lys *
ΑΡίΡΙ 9 8 / 0 1 2 0 9 (2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1404 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (Viii) POSITION IN GENOME:
BNSDOCID: <AP
AP1193A I >
APC 0 119 3 (A) CHROMOSOME/SEGMENT: heavy chain gamma 4 with the P and E mutation (ix) FEATURE:
(A) NAME/KEY: CDS (B) LOCATION: 1..1404 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 1..1404 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
<td> ATG</td><td> AAA</td><td> CAC</td><td> CTG</td><td> TGG</td><td> TTC</td><td> TTC</td><td> CTC</td><td> CTC</td><td> CTG</td><td> GTG</td><td> GCA</td><td> GCC</td><td> CCC</td><td> AGA</td><td> TGG</td><td> 48</td>
<td> Met 1</td><td> Lys</td><td> His</td><td> Leu</td><td> Trp 5</td><td> Phe</td><td> Phe</td><td> Leu</td><td> Leu</td><td> Leu 10</td><td> Val</td><td> Ala</td><td> Ala</td><td> Pro</td><td> Arg 15</td><td> Trp</td><td></td>
<td> GTC</td><td> TTG</td><td> TCC</td><td> CAG</td><td> GTG</td><td> CAG</td><td> CTG</td><td> CAG</td><td> GAG</td><td> TCG</td><td> GGC</td><td> CCA</td><td> GGA</td><td> CTG</td><td> GTG</td><td> AAG</td><td> 96</td>
<td> Val</td><td> Leu</td><td> Ser</td><td> Gin 20</td><td> Val</td><td> Gin</td><td> Leu</td><td> Gin</td><td> Glu 25</td><td> Ser</td><td> Gly</td><td> Pro</td><td> Gly</td><td> Leu 30</td><td> Val</td><td> Lys</td><td></td>
<td> CCT</td><td> TCG</td><td> GAG</td><td> ACC</td><td> CTG</td><td> TCC</td><td> CTC</td><td> ACC</td><td> TGC</td><td> AGT</td><td> GTC</td><td> TCT</td><td> GGT</td><td> GGC</td><td> TCC</td><td> ATC</td><td> 144</td>
<td> Pro</td><td> Ser</td><td> Glu' 35</td><td> Thr</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Thr 40</td><td> Cys</td><td> Ser</td><td> Val</td><td> Ser</td><td> Gly 45</td><td> Gly</td><td> Ser</td><td> lie</td><td></td>
<td> AGC</td><td> GGT</td><td> GAC</td><td> TAT</td><td> TAT</td><td> TGG</td><td> TTC</td><td> TGG</td><td> ATC</td><td> CGC</td><td> CAG</td><td> TCC</td><td> CCA</td><td> GGG</td><td> AAG</td><td> GGA</td><td> 192</td>
<td> Ser</td><td> Gly 50</td><td> Asp</td><td> Tyr</td><td> Tyr</td><td> Trp</td><td> Phe 55</td><td> Trp</td><td> He</td><td> Arg</td><td> Gin</td><td> Ser 60</td><td> Pro</td><td> Gly</td><td> Lys</td><td> Gly</td><td></td>
<td> CTG</td><td> GAG</td><td> TGG</td><td> ATC</td><td> GGC</td><td> TAC</td><td> ATC</td><td> TAT</td><td> GGC</td><td> AGT</td><td> GGT</td><td> GGG</td><td> GGC</td><td> ACC</td><td> AAT</td><td> TAC</td><td> 240</td>
<td> Leu 65</td><td> Glu</td><td> Trp</td><td> He</td><td> Gly</td><td> Tyr 70</td><td> lie</td><td> Tyr</td><td> Gly</td><td> Ser</td><td> Gly 75</td><td> Gly</td><td> Gly</td><td> Thr</td><td> Asn</td><td> Tyr 80</td><td></td>
<td> AAT</td><td> CCC</td><td> TCC</td><td> CTC</td><td> AAC</td><td> AAT</td><td> CGA</td><td> GTC</td><td> TCC</td><td> ATT</td><td> TCA</td><td> ATA</td><td> GAC</td><td> ACG</td><td> TCC</td><td> AAG</td><td> 288</td>
<td> Asn</td><td> Pro</td><td> Ser</td><td> Leu</td><td> Asn 85</td><td> Asn</td><td> Arg</td><td> Val</td><td> Ser</td><td> He 90</td><td> Ser</td><td> He</td><td> Asp</td><td> Thr</td><td> Ser 95</td><td> Lys</td><td></td>
<td> AAC</td><td> CTC</td><td> TTC</td><td> TCC</td><td> CTG</td><td> AAA</td><td> CTG</td><td> AGG</td><td> TCT</td><td> GTG</td><td> ACC</td><td> GCC</td><td> GCG</td><td> GAC</td><td> ACG</td><td> GCC</td><td> 336</td>
<td> Asn</td><td> Leu</td><td> Phe</td><td> Ser 100</td><td> Leu</td><td> Lys</td><td> Leu</td><td> Arg</td><td> Ser 105</td><td> Val</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Asp lio</td><td> Thr</td><td> Ala</td><td></td>
<td> GTC</td><td> TAT</td><td> TAC</td><td> TGT</td><td> GCG</td><td> AGT</td><td> AAT</td><td> ATA</td><td> TTG</td><td> AAA</td><td> TAT</td><td> CTT</td><td> CAC</td><td> TGG</td><td> TTA</td><td> TTA</td><td> 384</td>
<td> Val</td><td> Tyr</td><td> Tyr 115</td><td> Cys</td><td> Ala</td><td> Ser</td><td> Asn</td><td> lie 120</td><td> Leu</td><td> Lys</td><td> Tyr</td><td> Leu</td><td> His 125</td><td> Trp</td><td> Leu</td><td> Leu</td><td></td>
<td> TAC</td><td> TGG</td><td> GGC</td><td> CAG</td><td> GGA</td><td> GTC</td><td> CTG</td><td> GTC</td><td> ACC</td><td> GTC</td><td> TCC</td><td> TCA</td><td> GCT</td><td> AGC</td><td> ACC</td><td> AAG</td><td> 432</td>
<td> Tyr</td><td> Trp 130</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Val</td><td> Leu 135</td><td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Ser 140</td><td> Ala</td><td> Ser</td><td> Thr</td><td> Lys</td><td></td>
<td> GGG</td><td> CCA</td><td> TCC</td><td> GTC</td><td> TTC</td><td> CCC</td><td> CTG</td><td> GCG</td><td> CCC</td><td> TGC</td><td> TCC</td><td> AGG</td><td> AGC</td><td> ACC</td><td> TCC</td><td> GAG</td><td> 480</td>
<td> Gly 145</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Pro 150</td><td> Leu</td><td> Ala</td><td> Pro</td><td> Cys</td><td> Ser 155</td><td> Arg</td><td> Ser</td><td> Thr</td><td> Ser</td><td> Glu 160</td><td></td>
<td> AGC</td><td> ACA</td><td> GCC</td><td> GCC</td><td> CTG</td><td> ,GGC</td><td> TGC</td><td> CTG</td><td> GTC</td><td> AAG</td><td> GAC</td><td> TAC</td><td> TTC</td><td> CCC</td><td> GAA</td><td> CCG</td><td> 528</td>
<td> Ser</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Leu</td><td> Gly</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Asp</td><td> Tyr</td><td> Phe</td><td> Pro</td><td> Glu</td><td> Pro</td><td></td>
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APC' 0 119 3
165 170 175
<td colspan="2"> GTG ACG</td><td colspan="3"> GTG TCG TGG</td><td colspan="2"> AAC TCA</td><td colspan="2" rowspan="2"> /··<·/* n* Gly Ala 185</td><td rowspan="2"> CTG Leu</td><td rowspan="2"> ACC Thr</td><td rowspan="2"> AGC Ser</td><td rowspan="2"> GGC Gly</td><td rowspan="2"> GTG Val 190</td><td rowspan="2"> CAC His</td><td rowspan="2"> ACC Thr</td><td colspan="2" rowspan="2"> 576</td>
<td> Val</td><td> Thr</td><td> Val</td><td> Ser 180</td><td> Trp</td><td> Asn</td><td> Ser</td>
<td> TTC</td><td> CCG</td><td> GCT</td><td> GTC</td><td> CTA</td><td> CAG</td><td> TCC</td><td> TCA</td><td> GGA</td><td> CTC</td><td> TAC</td><td> TCC</td><td> CTC</td><td> AGC.</td><td> AGC</td><td> GTG</td><td> 624</td><td></td>
<td> Phe</td><td> Pro</td><td> Ala</td><td> Val</td><td> Leu</td><td> Gin</td><td> Ser</td><td> Ser</td><td> Gly</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Ser</td><td> Val</td><td></td><td></td>
<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td><td></td><td></td>
<td> GTG</td><td> ACC</td><td> GTG</td><td> CCC</td><td> TCC</td><td> AGC</td><td> AGC</td><td> TTG</td><td> GGC</td><td> ACG</td><td> AAG</td><td> ACC</td><td> TAC</td><td> ACC</td><td> TGC</td><td> AAC</td><td> 672</td><td></td>
<td> Val</td><td> Thr</td><td> Val</td><td> Pro</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Thr</td><td> Tyr</td><td> Thr</td><td> Cys</td><td> Asn</td><td></td><td></td>
<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> GTA</td><td> GAT</td><td> CAC</td><td> AAG</td><td> CCC</td><td> AGC</td><td> AAC</td><td> ACC</td><td> AAG</td><td> GTG</td><td> GAC</td><td> AAG</td><td> AGA</td><td> GTT</td><td> GAG</td><td> TCC</td><td> 720</td><td> σ></td>
<td> Val</td><td> Asp</td><td> His</td><td> Lys</td><td> Pro</td><td> Ser</td><td> Asn</td><td> Thr</td><td> Lys</td><td> Val</td><td> Asd</td><td> Lys</td><td> Arg</td><td> Val</td><td> Glu</td><td> Ser</td><td></td><td> o</td>
<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td><td></td><td> CM</td>
<td> AAA</td><td> TAT</td><td> GGT</td><td> CCC</td><td> CCA</td><td> TGC</td><td> CCA</td><td> CCA</td><td> TGC</td><td> CCA</td><td> GCA</td><td> CCT</td><td> GAG</td><td> TTC</td><td> GAG</td><td> GGG</td><td> 768</td><td></td>
<td> Lys</td><td> Tyr</td><td> Gly</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Ala</td><td> Pro</td><td> Glu</td><td> Phe</td><td> Glu</td><td> Gly</td><td></td><td> o</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td><td></td><td></td><td></td>
<td> GGA</td><td> CCA</td><td> TC£</td><td> GTC</td><td> TTC</td><td> CTG</td><td> TTC</td><td> CCC</td><td> CCA</td><td> AAA</td><td> CCC</td><td> AAG</td><td> GAC</td><td> ACT</td><td> CTC</td><td> ATG</td><td> 816</td><td> 00 '«fc.</td>
<td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys</td><td> Pro</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu</td><td> Met</td><td></td><td></td>
<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td><td></td><td> t* 1 *</td>
<td> ATC</td><td> TCC</td><td> CGG</td><td> ACC</td><td> CCT</td><td> GAG</td><td> GTC</td><td> ACG</td><td> TGC</td><td> GTG</td><td> GTG</td><td> GTG</td><td> GAC</td><td> GTG</td><td> AGC</td><td> CAG</td><td> 864</td><td></td>
<td> He</td><td> Ser</td><td> Arg</td><td> Thr</td><td> Pro</td><td> Glu</td><td> Val</td><td> Thr</td><td> Cys</td><td> Val</td><td> Val</td><td> Val</td><td> Asp</td><td> Val</td><td> Ser</td><td> Gin</td><td></td><td></td>
<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 28*5</td><td></td><td></td><td></td><td></td><td></td>
<td> GAA</td><td> GAC</td><td> CCC</td><td> GAG</td><td> GTC</td><td> CAG</td><td> TTC</td><td> AAC</td><td> TGG</td><td> TAC</td><td> GTG</td><td> GAT</td><td> GGC</td><td> GTG</td><td> GAG</td><td> GTG</td><td> 912</td><td></td>
<td> Glu</td><td> Aso</td><td> Pro</td><td> Glu</td><td> Val</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Trp</td><td> Tyr</td><td> Val</td><td> Asa</td><td> Gly</td><td> Val</td><td> Glu</td><td> Val</td><td></td><td></td>
<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 30*0</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> CAT</td><td> AAT</td><td> GCC</td><td> AAG</td><td> ACA</td><td> AAG</td><td> CCG</td><td> CGG</td><td> GAG</td><td> GAG</td><td> CAG</td><td> TTC</td><td> AAC</td><td> AGC</td><td> ACG</td><td> TAC</td><td> 960</td><td></td>
<td> His</td><td> Asn</td><td> Ala</td><td> Lys</td><td> Thr</td><td> Lys</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr</td><td></td><td></td>
<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td><td></td><td></td>
<td> CGT</td><td> GTG</td><td> GTC</td><td> AGC</td><td> GTC</td><td> CTC</td><td> ACC</td><td> GTC</td><td> CTG</td><td> CAC</td><td> CAG</td><td> GAC</td><td> TGG</td><td> CTG</td><td> AAC</td><td> GGC</td><td> 1008</td><td></td>
<td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val</td><td> Leu</td><td> Thr</td><td> Val</td><td> Leu</td><td> His</td><td> Gin</td><td> Asp</td><td> Trp</td><td> Leu</td><td> Asn</td><td> Gly</td><td></td><td></td>
<td></td><td></td><td></td><td></td><td> 325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td></td><td> 335</td><td></td><td></td><td></td>
<td> AAG</td><td> GAG</td><td> TAC</td><td> AAG</td><td> TGC</td><td> AAG</td><td> GTC</td><td> TCC</td><td> AAC</td><td> AAA</td><td> GGC</td><td> CTC</td><td> CCG</td><td> TCC</td><td> TCC</td><td> ATC</td><td> 1056</td><td></td>
<td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> Cys</td><td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Lys</td><td> Gly</td><td> Leu</td><td> Pro</td><td> Ser</td><td> Ser</td><td> He</td><td></td><td></td>
<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td><td></td><td></td>
<td> GAG</td><td> AAA</td><td> ACC</td><td> ATC</td><td> TCC</td><td> AAA</td><td> GCC</td><td> AAA</td><td> GGG</td><td> CAG</td><td> CCC</td><td> CGA</td><td> GAG</td><td> CCA</td><td> CAG</td><td> GTG</td><td> 1104</td><td></td>
<td> Glu</td><td> Lys</td><td> Thr</td><td> lie</td><td> Ser</td><td> Lys</td><td> Ala</td><td> Lys</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> Gin</td><td> Val</td><td></td><td></td>
<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td><td></td><td></td>
<td> TAC</td><td> ACC</td><td> CTG</td><td> CCC</td><td> CCA</td><td> TCC</td><td> CAG</td><td> GAG</td><td> GAG</td><td> ATG</td><td> ACC</td><td> AAG</td><td> AAC</td><td> CAG</td><td> GTC</td><td> AGC</td><td> 1152</td><td></td>
<td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro</td><td> Pro</td><td> Ser</td><td> Gin</td><td> Glu</td><td> Glu</td><td> Met</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Val</td><td> Ser</td><td></td><td></td>
<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 3S0</td><td></td><td></td><td></td><td></td><td></td><td></td>
<td> CTG</td><td> ACC</td><td> TGC</td><td> CTG</td><td> GTC</td><td> AAA</td><td> GGC</td><td> TTC</td><td> TAC</td><td> CCC</td><td> AGC</td><td> GAC</td><td> ATC</td><td> GCC</td><td> GTG</td><td> GAG</td><td> 1200</td><td></td>
<td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td><td> lie</td><td> Ala</td><td> Val</td><td> Glu</td><td></td><td></td>
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
<td> 385</td><td> 390</td><td> 395</td><td> 400</td>
<td> TGG GAG</td><td> AGC AAT GGG CAG CCG GAG AAC AAC</td><td> TAC AAG ACC ACG</td><td> CCT CCC 1248</td>
<td> Trp Glu</td><td> Ser Asn Gly Gin Pro Glu Asn Asn 405 410</td><td> Tyr Lys Thr Thr</td><td> Pro Pro 415</td>
<td> GTG CTG</td><td> GAC TCC GAC GGC TCC TTC TTC CTC</td><td> TAC AGC AGG CTA</td><td> ACC GTG 1296</td>
<td> Val Leu</td><td> Aso Ser Asn Gly Ser Phe Phe Leu 420 * 425</td><td> Tyr Ser Arg Leu 430</td><td> Thr Val</td>
<td> GAC AAG</td><td> AGC AGG TGG CAG GAG GGG AAT GTC</td><td> TTC TCA TGC TCC</td><td> GTG ATG 1344</td>
<td> Asp Lys</td><td> Ser Arg Trp Gin Glu Gly Asn Val 435 440</td><td> Phe Ser Cys Ser 445</td><td> Val Met</td>
<td> CAT GAG</td><td> GCT CTG CAC AAC CAC TAC ACA CAG</td><td> AAG AGC CTC TCC</td><td> CTG TCT 1392</td>
<td colspan="3"> His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser 450 455 460 CTG GGT AAA TGA Leu Gly Lys * 465 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 468 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO :12: '</td><td> Leu Ser 1404</td>
<td> Met Lys 1</td><td> His Leu Trp Phe Phe Leu Leu Leu 5 10</td><td> Val Ala Ala Pro</td><td> Arg Trp 15</td>
<td> Val Leu</td><td> Ser Gin Val Gin Leu Gin Glu Ser 20 25</td><td> Gly Pro Gly Leu 30</td><td> Val Lys</td>
<td> Pro Ser</td><td> Glu Thr Leu Ser Leu Thr Cys Ser 35 40</td><td> Val Ser Gly Gly 45</td><td> Ser lie</td>
<td> Ser Gly 50</td><td> Asp Tyr Tyr Trp Phe Trp lie Arg 55</td><td> Gin Ser Pro Gly 60</td><td> Lys Gly</td>
<td> Leu Glu 65</td><td> Trp lie Gly Tyr lie Tyr Gly Ser 70</td><td> Gly Gly Gly Thr 75</td><td> Asn Tyr 80</td>
<td> Asn Pro</td><td> Ser Leu Asn Asn Arg Val Ser lie 85 90</td><td> Ser lie Asp Thr</td><td> Ser Lys 9 5</td>
<td> Asn Leu</td><td> Phe Ser Leu Lys Leu Arg Ser Val 100 105</td><td> Thr Ala Ala Asp 110</td><td> Thr Ala</td>
<td> Val Tyr</td><td> Tyr Cys Ala 'Ser Asn lie Leu Lys</td><td> Tyr Leu His Trp</td><td> Leu Leu</td>
AP/?/ » 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
APC 0 119 3
<td colspan="16"> 94</td>
<td></td><td colspan="4"> 115</td><td colspan="4"> 120</td><td colspan="7"> 125</td>
<td> Tyr</td><td> Trp</td><td> Gly</td><td> Gin</td><td> Gly</td><td> Val</td><td> Leu</td><td> Val</td><td> Thr</td><td> Val</td><td> ser</td><td> Ser</td><td> Ala</td><td> Ser</td><td> Thr</td><td> Lys</td>
<td></td><td> 130</td><td></td><td></td><td></td><td></td><td> 135</td><td></td><td></td><td></td><td></td><td> 140</td><td></td><td></td><td></td><td></td>
<td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Pro</td><td> Leu</td><td> Ala</td><td> Pro</td><td> Cys</td><td> Ser</td><td> Arg</td><td> Ser</td><td> Thr</td><td> Ser</td><td> Glu</td>
<td> 145</td><td></td><td></td><td></td><td></td><td> 150</td><td></td><td></td><td></td><td></td><td> 155</td><td></td><td></td><td></td><td></td><td> 160</td>
<td> Ser</td><td> Thr</td><td> Ala</td><td> Ala</td><td> Leu</td><td> Gly</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Asp</td><td> Tyr</td><td> Phe</td><td> Pro</td><td> Glu</td><td> Pro</td>
<td></td><td></td><td></td><td></td><td> 165</td><td></td><td></td><td></td><td></td><td> 170</td><td></td><td></td><td></td><td></td><td> 175</td><td></td>
<td> Val</td><td> Thr</td><td> Val</td><td> Ser</td><td> Trp</td><td> Asn</td><td> Ser</td><td> Gly</td><td> Ala</td><td> Leu</td><td> Thr</td><td> Ser</td><td rowspan="2"> Gly</td><td> Val</td><td> His</td><td> Thr</td>
<td></td><td></td><td></td><td> 180</td><td></td><td></td><td></td><td></td><td> 185</td><td></td><td></td><td></td><td> 190</td><td></td><td></td>
<td> Phe</td><td> Pro</td><td> Ala</td><td> Val</td><td> Leu</td><td> Gin</td><td> Ser</td><td> Ser</td><td> Gly</td><td> Leu</td><td> Tyr</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Ser</td><td> Val</td>
<td></td><td></td><td> 195</td><td></td><td></td><td></td><td></td><td> 200</td><td></td><td></td><td></td><td></td><td> 205</td><td></td><td></td><td></td>
<td> Val</td><td> Thr</td><td> Val</td><td> Pro</td><td> Ser</td><td> Ser</td><td> Ser</td><td> Leu</td><td> Gly</td><td> Thr</td><td> Lys</td><td> Thr</td><td> Tyr</td><td> Thr</td><td> Cys</td><td> Asn</td>
<td></td><td> 210</td><td></td><td></td><td></td><td></td><td> 215</td><td></td><td></td><td></td><td></td><td> 220</td><td></td><td></td><td></td><td></td>
<td> Val</td><td> Asp</td><td> His</td><td> Lys</td><td> Pro</td><td> Ser</td><td> Asn</td><td> Thr</td><td> Lys</td><td> Val</td><td> Asp</td><td> Lys</td><td> Arg</td><td> Val</td><td> Glu</td><td> Ser</td>
<td> 225</td><td></td><td></td><td></td><td></td><td> 230</td><td></td><td></td><td></td><td></td><td> 235</td><td></td><td></td><td></td><td></td><td> 240</td>
<td> Lys</td><td> Tyr</td><td> Gly</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Pro</td><td> Cys</td><td> Pro</td><td> Ala</td><td> Pro</td><td> Glu</td><td> Phe</td><td> Glu</td><td rowspan="2"> Gly</td>
<td></td><td></td><td></td><td></td><td> 245</td><td></td><td></td><td></td><td></td><td> 250</td><td></td><td></td><td></td><td></td><td> 255</td>
<td> Gly</td><td> Pro</td><td> Ser</td><td> Val</td><td> Phe</td><td> Leu</td><td> Phe</td><td> Pro</td><td> Pro</td><td> Lys</td><td> Pro</td><td> Lys</td><td> Asp</td><td> Thr</td><td> Leu</td><td> Met</td>
<td></td><td></td><td></td><td> 260</td><td></td><td></td><td></td><td></td><td> 265</td><td></td><td></td><td></td><td></td><td> 270</td><td></td><td></td>
<td> lie</td><td> Ser</td><td> Arg</td><td> Thr</td><td> Pro</td><td> Glu</td><td> Val</td><td> Thr</td><td> Cys</td><td> Val</td><td> Val</td><td> Val</td><td> Asp</td><td> Val</td><td> Ser</td><td> Gin</td>
<td></td><td></td><td> 275</td><td></td><td></td><td></td><td></td><td> 280</td><td></td><td></td><td></td><td></td><td> 285</td><td></td><td></td><td></td>
<td> Glu</td><td> Asp</td><td> Pro</td><td> Glu</td><td> Val</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Trp</td><td> Tyr</td><td> Val</td><td> Asp</td><td> Gly</td><td> Val</td><td> Glu</td><td> Val</td>
<td></td><td> 290</td><td></td><td></td><td></td><td></td><td> 295</td><td></td><td></td><td></td><td></td><td> 300</td><td></td><td></td><td></td><td></td>
<td> His</td><td> Asn</td><td> Ala</td><td> Lys</td><td> Thr</td><td> Lys</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Glu</td><td> Gin</td><td> Phe</td><td> Asn</td><td> Ser</td><td> Thr</td><td> Tyr</td>
<td> 305</td><td></td><td></td><td></td><td></td><td> 310</td><td></td><td></td><td></td><td></td><td> 315</td><td></td><td></td><td></td><td></td><td> 320</td>
<td> Arg</td><td> Val</td><td> Val</td><td> Ser</td><td> Val</td><td> Leu</td><td> Thr</td><td> Val</td><td> Leu</td><td> His</td><td> Gin</td><td> Asp</td><td rowspan="2"> Trp</td><td> Leu</td><td> Asn</td><td rowspan="2"> Gly</td>
<td></td><td></td><td></td><td></td><td> .325</td><td></td><td></td><td></td><td></td><td> 330</td><td></td><td></td><td></td><td> 335</td>
<td> Lys</td><td> Glu</td><td> Tyr</td><td> Lys</td><td> Cys</td><td> Lys</td><td> Val</td><td> Ser</td><td> Asn</td><td> Lys</td><td> Gly</td><td> Leu</td><td> Pro</td><td> Ser</td><td> Ser</td><td> He</td>
<td></td><td></td><td></td><td> 340</td><td></td><td></td><td></td><td></td><td> 345</td><td></td><td></td><td></td><td></td><td> 350</td><td></td><td></td>
<td> Glu</td><td> Lys</td><td> Thr</td><td> lie</td><td> Ser</td><td> Lys</td><td> Ala</td><td> Lys</td><td> Gly</td><td> Gin</td><td> Pro</td><td> Arg</td><td> Glu</td><td> Pro</td><td> Gin</td><td> Val</td>
<td></td><td></td><td> 355</td><td></td><td></td><td></td><td></td><td> 360</td><td></td><td></td><td></td><td></td><td> 365</td><td></td><td></td><td></td>
<td> Tyr</td><td> Thr</td><td> Leu</td><td> Pro</td><td> Pro</td><td> Ser</td><td> Gin</td><td> Glu</td><td> Qlu</td><td> Met</td><td> Thr</td><td> Lys</td><td> Asn</td><td> Gin</td><td> Val</td><td> Ser</td>
<td></td><td> 370</td><td></td><td></td><td></td><td></td><td> 375</td><td></td><td></td><td></td><td></td><td> 380</td><td></td><td></td><td></td><td></td>
<td> Leu</td><td> Thr</td><td> Cys</td><td> Leu</td><td> Val</td><td> Lys</td><td> Gly</td><td> Phe</td><td> Tyr</td><td> Pro</td><td> Ser</td><td> Asp</td><td> He</td><td> Ala</td><td> Val</td><td> Glu</td>
<td> 385</td><td></td><td></td><td></td><td></td><td> 390</td><td></td><td></td><td></td><td></td><td> 395</td><td></td><td></td><td></td><td></td><td> 400</td>
<td> Trp</td><td> .Glu</td><td> Ser</td><td> Asn</td><td> •Gly</td><td> Gin</td><td> Pro</td><td> Glu</td><td> Asn</td><td> Asn</td><td> Tyr</td><td> Lys</td><td> Thr</td><td> Thr</td><td> Pro</td><td> Pro</td>
<td></td><td></td><td></td><td></td><td> 405'</td><td></td><td></td><td></td><td></td><td> 410</td><td></td><td></td><td></td><td></td><td> 415</td><td></td>
AP/P/ 9 8/01209
BNSDOCID: <AP
AP1193A I >
APC 0 119 3
<td> Val</td><td> Leu</td><td> Asp</td><td> Ser 420</td><td> Asp</td><td> Gly</td><td> Ser</td><td> Phe</td><td colspan="2"> Phe Leu 425</td><td> Tyr</td><td> Ser</td><td> Arg</td><td> Leu 430</td><td> Thr</td><td> Val</td>
<td rowspan="2"> Asp</td><td rowspan="2"> Lys</td><td> Ser</td><td> Arg</td><td> Trp</td><td> Gin</td><td> Glu</td><td> Gly</td><td> Asn</td><td> Val</td><td> Phe</td><td> Ser</td><td> Cys</td><td> Ser</td><td> Val</td><td> Met</td>
<td> 435</td><td></td><td></td><td></td><td></td><td> 440</td><td></td><td></td><td></td><td></td><td> 445</td><td></td><td></td><td></td>
<td> His</td><td> Glu</td><td> Ala</td><td> Leu</td><td> His</td><td> Asn</td><td> His</td><td> Tyr</td><td> Thr</td><td> Gin</td><td> Lys</td><td> Ser</td><td> Leu</td><td> Ser</td><td> Leu</td><td> Ser</td>
<td></td><td> 450</td><td></td><td></td><td></td><td></td><td> 455</td><td></td><td></td><td></td><td></td><td> 460</td><td></td><td></td><td></td><td></td>
Leu Gly Lys *
465 (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH1 leader sequence
ΑΡ/Γ/ 9 8/01209 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
ACTAAGTCGA CATGGACTGG ACCTGG (2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH2 leader sequence
BNSDOCID: <AP
AP1193A I >
APC 0 119 3 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
ACTAAGTCGA CATGGACATA CTTTGTTCCA C (2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii). MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (Vi) ORIGINAL' SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH3 leader sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
ACTAAGTCGA CATGGAGTTT GGGCTGAGC (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH4 leader sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
ACTAAGTCGA CATGAAACAC CTGTGGTTCT T (2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID; <AP
AP1193A I >
APC 0 119 3 (3) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH5 leader sequence (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
ACTAAGTCGA CATGGGGTCA ACCGCCATCC T 31 (2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH6 leader sequence
AP/P/ 98/01209 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
ACTAAGTCGA CATGTCTGTC TCCTTCCTCA T 31 (2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO
BNSDOCID: <AP
AP1193A I >
APO 01193 (Vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH1 leader sequence with Mlul site (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:
GGCAGCAGCY ACGCGTGCCC ACTCCGAGGT (2) INFORMATION FOR SEQ ID NO :20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO /.
(VX) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH2 leader sequence with Mlul site
ΑΡ/Γ/ 98/01209 (Xi) SEQUENCE .DESCRIPTION: SEQ ID N0:20:
GACCGTCCCG ACGCGTGTYT TGTCCCAGGT (2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (XV) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH3 leader sequence with Mlul site
BNSDOCID: <AP
AP1193A I >
ΑΡ ύ Ο 119 3
100 (Β) TYPE: nucleic acid (C) STRANDEDNESS : single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (cenomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VHl,3a,5 primer with Xho I site (Xi) SEQUENCE . DESCRIPTION : SEQ ID NO:24:
CAGGTGCAGC TGCTCGAGTC TGG 23 (2) INFORMATION FOR SEQ ID NO :25:
(i) SEQUENCE CHARACTERISTICS:
JA) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMO SOME/SEGMENT: VH2 primer with Xho I site (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
CAGGTCAACT TACTCGAGTC TGG 23 (2) INFORMATION FOR SEQ ID NO: 26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
101 (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH3b primer with Xhol site (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
GAGGTGCAGC TGCTCGAGTC TGG (2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (3) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO
O
CM (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH4 primer with Xhol site (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
- CAGGTGCAGC TGCTCGAGTC GGG
--' (2) INFORMATION FOR SEQ ID NO: 28 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) 'TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH6 primer with Xhol site
OO ί
(xi) SEQUENCE.DESCRIPTION: SEQ ID NO:28:
BNSDOCID: <AP
AP1193A I >
APC 0 119 3
102
CAGGTACAGC TGCTCGAGTC AGG (2) INFORMATION FOR SEQ ID NO :29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: IgGl-4 primer with Nhel site (Xi) SEQUENCE DESCRIPTION: SEQ ID NO :29:
GGCGGATGCG 'CTAGCTGAGG AGACGG 2 6 (2) INFORMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (Vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: kappa light chain primer with Sgl II site
AP/P/ 9 8 / 0 1 2 0 9 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
ATCACAGATC TCTCACCATG GTGTTGCAGA CCCAGGTC 38 (2) INFORMATION FOR SEQ ID NO: 31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single
BNSDOCID: <AP
AP1193A I >
APC 0 119 3
103 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: kappa light chain primer with 3gl II site (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:
J ATCACAGATC TCTCACCATG GRGWCCCCWG CKCAGCT 37 (2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear / (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
< ) (A) CHROMOSOME/SEGMENT: kapoa light chain primer with Bgl II site
Ό (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:
ATCACAGATC TCTCACCATG GACATGAGGG TCCCCGCTCA G 41 (2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IIT GENOME:
AP/P/ 9 8 / 0 1 2 0 9
BNSDOCID: <AP
AP1193A I >
104 (A) CHROMOSOME/SEGMENT: kappa light chain primer with Bgl II site (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
ATCACAGATC TCTCACCATG GACACVAGGG CCCCCACTCA G <sub>4</sub> (2) INFORMATION FOR SEQ ID NO:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: lambda light chain primer w'ith Bgl n site
AP/P/ 9 8 / 0 1 2 09 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:
ATCACAGATC TCTCACCATG GCCTGGGCTC TGCTGCTCC (2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (Xi) SEQUENCE .DESCRIPTION: SEQ ID NO:35:
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: lambda light chain primer with Bgl II site
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
105
ATCACAGATC TCTCACCATG GCCTGGGCTC CACTACTTC 39 (2) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (Vi) ORIGINAL SOURCE:
'(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME: <sup>0</sup> (A) CHROMOSOME/SEGMENT: lambda light chain primer with Bgl II CM site t— (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:
ATCACAGATC TCTCACCATG ACCTGCTCCC CTCTCCTCC 39 (2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN-GENOME:
(A) CHROMOSOME/SEGMENT: lambda light chain primer with Bgl II site
OO o>
cC
CL <
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:
ATCACAGATC TCTCACCATG GCCTGGACTC CTCTCTTTC 39 (2) INFORMATION FOR SEQ ID NO:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
106 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: lambda light chain primer with Bgl II site (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:
ATCACAGATC TCTCACCATG ACTTGGACCC CACTCCTC (2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS: ,<sub>f</sub> (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: kappa light chain primer with Kpnl and BsiWi sites
AP/P/ 9 8 / 0 1 2 0 9 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:
CCGTTTGATT TCCAGCTTGG TACCTCCACC GAACGT 36 (2) INFORMATION FOR SEQ ID NO:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE- TYPE: DNA (genomic)
BNSDOCID: <AP
AP1193A I τ
APOO 1193
107 (iv) ANTI-SENSE: YES (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: kappa light chain primer with Kpni and BsiWl sites (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:
TGCAGCATCC GTACGTTTGA TTTCCAGCTT
J (2) INFORMATION FOR SEQ ID NO: 41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES ' (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: lambda light chain primer with Hindlll and Kpnl sites
AP/P/ 9 8 / 0 1 2 0 9 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:.
ACCTAGGACG GTAAGCTTGG TACCTCCGCC (2) INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES (vi) ORIGINAL SOURCE:
(A) ORGANISM: Human or Monkey (viii) POSITION IN GENOME:
BNSDOCID: <AP
AP1193A I >
APOO1193
108
<td> (xi)</td><td> (A) CHROMOSOME/SEGMENT: lambda light chain primer with Kpn 1 SEQUENCE DESCRIPTION: SEQ ID NO:42:</td>
ACCTAGGACG GTCASSTTGG TACCTCCGCC GAACAC 36 (2) INFORMATION FOR SEQ ID NO:43:
<td> (i)</td><td> SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid</td>
<td></td><td> (C) STRANDEDNESS: single (D) TOPOLOGY: linear</td>
<td> (ii)</td><td> MOLECULE TYPE: DNA (genomic) O</td>
<td> (iv)</td><td> CM ANTI-SENSE: YES</td>
<td> (vi)</td><td> ORIGINAL SOURCE: ° (A) ORGANISM: Human or Monkey</td>
<td> (viii)</td><td> 00 POSITION IN GENOME: (A) CHROMOSOME/SEGMENT: lambda light chain primer with Avril site</td>
<td> (xi)</td><td> Π. SEQUENCE DESCRIPTION: SEQ ID NO:43:</td>
CTTGGGCTGA CCTAGGACGG TCAGCCG 27 (2) INFORMATION FOR SEQ ID NO :44:
<td> 'j (i)</td><td> SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear</td>
<td> (ii)</td><td> MOLECULE TYPE: DNA (genomic)</td>
<td> (iv)</td><td> ANTI-SENSE: NO</td>
<td> (viii)</td><td> POSITION IN GENOME: (A) CHROMOSOME/SEGMENT: VH1 heavy chain variable region</td>
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:
CCATGGACTG GACCTGG 17 (2) INFORMATION FOR SEQ ID NO:45:
BNSDOCID: <AP
AP1193A I >
APO01193
109 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH2 heavy chain variable region (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45: ATGGACATAC TTTGTTCCAC (2) INFORMATION FOR SEQ ID NO:46:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (viii) POSITION IN GENOME:.
(A) CHROMOSOME/SEGMENT: VH3 heavy chain variable region (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:
CCATGGAGTT TGGGCTGAGC (2) INFORMATION FOR SEQ ID NO:47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO
API?! 9 8 / 0 1 2 0 9 (viii) POSITION IN GENOME:
BNSDOCID: <AP
AP1193A I >
APC 01193
110 (A) CHROMOSOME/SEGMENT: VH4 heavy chain variable region (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:
ATGAAACACC TGTGGTTCTT (2) INFORMATION FOR SEQ ID NO:48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (Viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH5 heavy chain variable region
AP/P/ 9 8 / 0 1 2 0 9 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:
ATGGGGTCAA CCGCCATCCT 20 (2) INFORMATION FOR SEQ ID NO :49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: NO (Viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: VH6 heavy chain variable region (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:49: ATGTCTGTCT CCTTCCTCAT (2) INFORMATION FOR SEQ ID NO:50:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: IS base pairs
BNSDOCID: <AP
AP1193A I >
ν.ϊ
APO01193
111 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: IgM heavy chain constant region (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:
TTGGGGCGGA TGCACT (2) INFORMATION FOR SEQ ID NO:51:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: IgGl-4 heavy chain constant region
AP/P/ 9 8 / 0 1 2 09 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:
GATGGGCCCT TGGTGGA (2) INFORMATION FOR SEQ ID NO: 52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: Kappa light chain variable region
BNSDOCID·. <AP
AP1193A I >
APC01193
112 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:
GATGACCCAG TCTCCAKCCT C 21 (2) INFORMATION FOR SEQ ID NO :53:
(i) SEQUENCE CHARACTERISTICS :
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: Lambda light chain variable region (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:
CTCAYTYRCT GCMCAGGGTC C (2) INFORMATION FOR SEQ ID NO:54:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear , (ii) MOLECULE TYPE: DNA (genomic) j (iv) ANTI-SENSE: YES
AP/P/ 9 8 / 0 1 2 09 (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: kappa light chain constant region (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:
AAGACAGATG GTGCAGCCA (2) INFORMATION FOR SEQ ID NO :55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
113 (iv) ANTI-SENSE: YES (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: lambda light chain constant region (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55: GGAACAGAGT GACCGAGGGG (2) INFORMATION FOR SEQ ID NO:56:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: PCR primer for human gamma 4 constant region '<sup>f</sup> (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:
AP/P/ 98 / 01209
GGGGGGATCC TCATTTACCC AGAGACAGGG (2)
INFORMATION .EOR SEQ ID NO :57:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (Viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: PCR primer for Human gamma 4 constant region (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:
GGGGGCTAGC ACCAAGGGCC CATCCGTCTT C 31 (2) INFORMATION FOR SEQ ID NO :58:
BNSDOCID: <AP
AP1193A I >
APO 0 119 3
114 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 96 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: PCR mutagenesis of human gA-mm? 4 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:
CCGGGAGATC ATGAGAGTGT 'CCTTGGGTTT TGGGGGGAAC AGGAAGACTG ATGGTCCCCC
CTCGAACTCA GGTGCTGGGC ATGGTGGGCA TGGGGG (2) INFORMATION FOR SEQ ID NO: 59:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid / (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)
AP/P/ 9 8 / 0 1 2 0 9 (viii) POSITION IN GENOME:
(A) CHROMOSOME/SEGMENT: PCR mutagenesis of. human gamma 4 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:59: TCCTCAGCTA GCACCAAGGG GCCATCC
BNSDOCID: <AP
Contents213
30 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30
Every citation, both waysCites: the store holds 1 of 2
| Document | Relation | Office | Cited during |
|---|---|---|---|
| EP0451216A1 | Cites | European Patent Office (EPO) | Search report |
117 members in 34 offices
Priority claims8
| Document | Office | Kind | Date |
|---|---|---|---|
| 52389495 | United States of America | A | |
| 52389495 | United States of America | A | |
| 9614324 | United States of America | W | |
| 9614324 | United States of America | W | |
| 08523894 | – | – | – |
| PCTUS9614324 | – | – | – |
| US19950523894 | – | – | – |
| WO1996US14324 | – | – | – |
Members117
| Document | Office | Kind | |
|---|---|---|---|
| AP9200413A0 | African Regional Intellectual Property Organization (ARIPO) | A0 | |
| IL102640A0 | Israel | A0 | |
| IL102640D0 | Israel | D0 | |
| IE922437A1 | Ireland | A1 | |
| CA2114015A1 | Canada | A1 | |
| WO9302108A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU2425592A | Australia | A | |
| MX9204374A | Mexico | A | |
| ZA925615B | South Africa | B | |
| MA22837A1 | Morocco | A1 | |
| PT100735A | Portugal | A | |
| NO940219D0 | Norway | D0 | |
| FI940336A0 | Finland | A0 | |
| AP307A | African Regional Intellectual Property Organization (ARIPO) | A | |
| FI940336A | Finland | A | |
| FI940336L | Finland | L | |
| NO940219L | Norway | L | |
| HU9400201D0 | Hungary | D0 | |
| CZ14994A3 | Czechia | A3 | |
| EP0605442A1 | European Patent Office (EPO) | A1 | |
| NZ243706A | New Zealand | A | |
| SK8894A3 | Slovakia | A3 | |
| OA09879A | African Intellectual Property Organization (OAPI) | A | |
| JPH06509708A | Japan | A | |
| BG98411A | Bulgaria | A | |
| BR9206313A | Brazil | A | |
| EP0605442A4 | European Patent Office (EPO) | A4 | |
| HUT70272A | Hungary | A | |
| HU211881A9 | Hungary | A9 | |
| AU673499B2 | Australia | B2 | |
| CA2231182A1 | Canada | A1 | |
| WO9709351A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU6916296A | Australia | A | |
| US5658570A | United States of America | A | |
| US5681722A | United States of America | A | |
| US5693780A | United States of America | A | |
| NO980915D0 | Norway | D0 | |
| AP9801209A0 | African Regional Intellectual Property Organization (ARIPO) | A0 | |
| KR0137806B1 | Republic of Korea | B1 | |
| NO980915L | Norway | L | |
| US5750105A | United States of America | A | |
| US5756096A | United States of America | A | |
| EP0854885A1 | European Patent Office (EPO) | A1 | |
| CZ58698A3 | Czechia | A3 | |
| MX9801732A | Mexico | A | |
| IL123447A0 | Israel | A0 | |
| IL123447D0 | Israel | D0 | |
| SK27998A3 | Slovakia | A3 | |
| CN1200737A | China | A | |
| HU9802212A2 | Hungary | A2 | |
| HUP9802212A2 | Hungary | A2 | |
| BG102343A | Bulgaria | A | |
| KR19990044436A | Republic of Korea | A | |
| BR9610404A | Brazil | A | |
| PT100735B | Portugal | B | |
| NZ316835A | New Zealand | A | |
| SG67924A1 | Singapore | A1 | |
| HK1016995A | Hong Kong, China | A | |
| HK1016995A1 | Hong Kong, China | A1 | |
| JPH11514216A | Japan | A | |
| AU717674B2 | Australia | B2 | |
| BG62656B1 | Bulgaria | B1 | |
| JP3048640B2 | Japan | B2 | |
| TW393489B | Taiwan Province of China | B | |
| US6136310A | United States of America | A | |
| RO116404B1 | Romania | B1 | |
| HU9802212A3 | Hungary | A3 | |
| HUP9802212A3 | Hungary | A3 | |
| RU2170256C2 | Russian Federation | C2 | |
| CZ289472B6 | Czechia | B6 | |
| HU221351B1 | Hungary | B1 | |
| US2002150580A1 | United States of America | A1 | |
| OA10671A | African Intellectual Property Organization (OAPI) | A | |
| EP0854885A4 | European Patent Office (EPO) | A4 | |
| CA2114015C | Canada | C | |
| CZ291036B6 | Czechia | B6 | |
| EP1266965A2 | European Patent Office (EPO) | A2 | |
| EP1266965A3 | European Patent Office (EPO) | A3 | |
| EP0605442B1 | European Patent Office (EPO) | B1 | |
| US2003077275A1 | United States of America | A1 | |
| AT237638T | Austria | T | |
| ATE237638T1 | Austria | T1 | |
| DE69233011D1 | Germany | D1 | |
| AP1193AThis record | African Regional Intellectual Property Organization (ARIPO) | A | |
| DK0605442T3 | Denmark | T3 | |
| DE69233011T2 | Germany | T2 | |
| ES2196002T3 | Spain | T3 | |
| RU2232773C2 | Russian Federation | C2 | |
| NO318097B1 | Norway | B1 | |
| JP3619866B2 | Japan | B2 | |
| RO120198B1 | Romania | B1 | |
| BG64651B1 | Bulgaria | B1 | |
| MY121185A | Malaysia | A | |
| KR100491222B1 | Republic of Korea | B1 | |
| SK285046B6 | Slovakia | B6 | |
| EP1266965B1 | European Patent Office (EPO) | B1 | |
| AT327331T | Austria | T | |
| ATE327331T1 | Austria | T1 | |
| DE69233628D1 | Germany | D1 | |
| DK1266965T3 | Denmark | T3 |
Numbers
- Publication
- AP 1193
- Publication, DOCDB
- 1193
- Publication, EPODOC
- AP1193
- Application
- 1998001209
- Application, DOCDB
- 9801209
- Application, EPODOC
- AP19980001209
Titles
- English
- Recombinant anti-CD4 antibodies for human therapy.
Classification
- CPC, 22
- C07K16/00
- A61K38/00
- A61K2039/505
- C07K16/28
- C07K16/2812
- C07K16/2821
- C07K16/461
- C07K16/462
- C07K2317/21
- C07K2317/24
- C07K2317/732
- C07K2317/734
- C07K2319/00
- A61P11/00
- A61P11/06
- A61P17/06
- A61P29/00
- A61P35/00
- A61P35/02
- A61P37/00
- A61P37/02
- A61P3/10
- IPC, 17
- C12N15 09
- A61K31 00
- A61K38 00
- A61K39 395
- A61P11 00
- A61P11 06
- A61P29 00
- A61P35 00
- A61P35 02
- A61P37 00
- A61P37 02
- C07K16 00
- C07K16 28
- C07K16 46
- C12N15 00
- C12N15 13
- C12P21 08