Amplifying the expression of recombinant DNA products.

DESCRIPTION

The present invention relates to a method for amplifying the expression of recombinant DNA in guests expressing protease that cleaves multibasic amino acid residues and the use of this method together with a colony stimulating factor (hereinafter "CSF") and , more particularly, the human granulocyte-macrophage colony stimulating factor ("GM-CSF").

Background of the invention

CSF refers to a family of lymphokines that induce the differentiation of progenitor cells found in the bone marrow into specific types of mature blood cells. The particular type of mature blood cell that comes from a progenitor cell depends on the type of CSF present. For example, it is believed that erythropoietin causes maturation of progenitor cells in erythrocytes, while thrombopoietin is thought to lead to progenitor cells along the thrombotic pathway. Similarly, the formation of granulocyte-macroophage colonies depends on the presence of GM-CSF. The present invention relates to a human GM-CSF analog.

CSF, including human GM-CSF, is produced only in very small quantities in vivo. Factors similar to CSF ​​have been extracted from body organs, Sheridan and Stanley, J. Cell. Physiol 78., 451-459 (1971), and have been detected in serum and urine, Robinson et al., J. Cell. Physiol 690: 83-92 (1967); Stanley et al., J. Lab. Clin. Med. 79. 657-668 (1972). Some researchers have reported the isolation of low-titer CSF analogous factor from human peripheral blood cells that appear to be macrophages or monocytes, Moore and Williams, J. Cell. Physiol 80: 195-206 (1972); Golde and Kline, J. Clin. Invest. 51: 2,981-2,983 (1972): Moore et al., J. Natl. Cancer Inst. 50: 591-601 (1973).

Although the factors identified by the previous researchers have been disclosed as CSF, until now sufficient quantities of homogeneous human CSF, including GM-CSF, have not been available to perfectly investigate their biochemistry and biology. The availability of adequate amounts of homogeneous human GM-CSF would be of great value in Investigations and possible treatment of proliferative blood diseases, such as certain leukemias and anemias. Likewise, the human GM-CSF of greater purity and in larger quantities than those available to date could be useful to achieve a successful bone marrow transplant after chemotherapy of the canon.

A potential method to provide larger amounts of homogeneous polypeptides including human GM-CSF than those available to date is to employ recombinant DNA techniques. The recombinant DNA techniques have been developed to economically produce a desired protein once the protein coding gene has been isolated and identified. A discussion of such recombinant DNA techniques for protein production is described in the editorial and other supporting papers in Sciencie volume 196 (April 1977).

Compendium of the invention

Genes encoding several protein products have been isolated and cloned for the expression of a functional protein product in yeast expression systems using the promoter and leader sequence for the pre-pro-α pairing factor ("α-factor"). Although larger amounts of homogeneous, mature protein product have been achieved through the yeast expression system than those produced so far, applicants have relied on the hypothesis that the level of protein product that is recovering is possibly somewhat limited. by the existence of a potential cleavage site for the protease encoded by the KEX 2 gene of the Saccharomyces cerevisiae yeast ("S. cerevisiae"). It has been found that this secretory pathway produces an enzyme that cleaves into "doubly basal amino acid residues," that is, two adjacent bazoic amino acid residues located along the amino acid sequence of the protein product. In an attempt to raise the levels of mature protein product recovered in yeast systems, the applicants attempted to alter wild-type genes to eliminate "multibabic amino acid residues," that is, two or more adjacent baosic amino acid residues along the sequence. of amino acids of the protein product, by substitution or suppression of codons coding for multibabic moieties.

The present invention has been carried out with respect to GM-CSF. The different types of CSF including GMCSF have been discussed above. Although a substantial part of the rest of the application discussed the present invention with respect to GM-CSF, it should be understood that the present invention was not limited to GM-GSF but also. all protein products that are naturally composed of multibasic amino acids can be used together with proactively. In addition, the present invention is not limited to the use of yeast cells as guests, but is applicable to any guest expressing a protease that cleaves precursor protein products into doubly basal amino acid residues during the expression modem.

An analogous GM-CSF is produced by altering the wild-type gene for GM-CSF by replacing the applicable codons that encode bathic amino acids to eliminate multibasic amino acids. A possible and preferred technique for making this substitution is by site-specific mutagenesis of a site, for example, as described by Craik in Biotechniques, January 1985, 12-19. In this procedure, the human GMCSF coding gene is ligated into an M13 single strand filament phage vector which is then used to transform a suitable host to produce replicated single strand DNA templates. Single strand DNA templates mate with portions of a complementary M13 strand to form a nicked heteroduplex. An oligonucleotide synthesized by mutagenesis constructed with the codon al2

000 388 strained / replaced, it is paired with the corresponding part of the wild-type GM-CSF gene disposed in the single strand region of the indented heteroduplex. The indentations between the ends of the mutant oligonucleotide and the complementary M13 strand are enzymatically repaired to form a double stranded structure which is then used to transform an appropriate host. The mutagenized genes are conveniently detected using a radiolabeled oligonucleotide probe having the same structure as the mutagenesis oligonucleootide.

Then, the nucleotide sequence of the candidates identified with the radiolabelled probe is determined to verify that the desired genotic construct has been achieved. Next, the altered gene was transferred from the M13 vector to a yeast expression vector used to transform S. cerevisiae for the expression of mature, analogous CM-CSF. Biological tests were carried out to confirm that the anabolic GM-CSF exhibits substantially the same activity as the natural GM-CSF product.

An anaologous GM-CSF is also produced by altering the wild-type gene that encodes GM-CSF by eliminating the applicable codons encoding basic amino acids to eliminate the appearance of multibasic amino acid residues. As an illustrative but not limiting example, the applicable codons can be deleted from the wild-type gene by the same technique of specific in vitro mutagenesis of a site discussed above with respect to the replacement of codons coding for basic amino acid residues. In this procedure, the composition of the oligonucleotide synthesized by mutagenesis is the same as that of the corresponding portion of the wild-type gene, however, with the applicable codon or codons coding for the amino acid or the suppressed basal amino acids. With this exception, the procedures for the preparation of recombinant DNA coding for the anabolic GM-CSF, for the expression of the analogous product and for the biological test to confirm the functionality of the GMCSF analog are the same as described above.

Brief description of the graphic examples

The details of the topical embodiments of the present invention will be described in relation to the accompanying graphic examples, in which:

Figure 1A illustrates the amino acid and nucleotide sequences of the wild-type human GM-CSF gene, including the 3 'non-coding region part of the gene;

Figure 18 illustrates the amino acid and nucleootide sequences of a mutant human GM-CSF gene in which at least one codon coding for a bathymal amino acid residue has been replaced by a codon coding for a non-basic amino acid residue. that the anabolic GM-CSF encoded by the mutant gene was devoid of multibabic residues;

The 1C chart illustrates the amino acid and nucleootide sequences of a mutant human GM-CSF gene in which at least one codon coding for a basal amino acid residue has been suppressed so that the anomalous GM-CSF encoded by the mutant gene it was devoid of multibasic amino acid residues;

Figure 2 illustrates the plasmid pYafGM-2 used to direct the expression of the wild-type GM-CSF in yeast guests;

Figure 3 illustrates the strategy used to generate the gene with the substituted, mutated codon, M13HuGMLeu23, encoder of human analog GM-CSF;

Figure 4 illustrates the expression plasmid pYafHuGMLeu23 with the coding region of the mutated GM-CSF gene, M13HuGMLeu23, inserted in oil for use in the transformation of human host cells for the amplified expression of functional analogous human GM-CSF;

Figure 5 illustrates the strategy used to generate the gene with the deleted, mutated codon, M13HuGMΔArg23 encoding the GM-CSF analog; Y

Figure 6 illustrates the expression plasmid pYαfHuGMΔArg23 with the coding region of the mutated GM-CSF gene, M13HuGMΔArg23, inserted in oil for use in the transformation of human host cells for the amplified expression of functional anomalous GM-CSF.

Description of the invention

Isolation of the wild-type human GM-CSF gene

The wild-type gene encoding human GMCSF has been isolated and characterized. The nucleic acid sequence of the gene is given in graph 1. The wild-type gene, inserted into a cloning plasmid, designated as pHG23 and then transformed into E. coli, was deposited with the American type culture collection (“ATCC ”), 12,301 Parklawn Drive, Rockville, Maryland 20,852, USA, under the accession number 39,900. Likewise, the wild-type gene inserted into a yeast expression plasmid, designated pYafGM-2, as indicated in Figure 2, is deposited with the ATCC under the accession number 53,157.

In short, the wild-type human GMCSF coding gene has been isolated from a cDNA bank with a cDNA probe translated into nicks. The probe has been isolated from a murine GM-CSF cDNA bank using a synthetic oligonucleotide probe corresponding to a part of the murine GM-CSF nucleotodic sequence. Total human RNA has been extracted from the HUT-102 lymphoma T cell and peripheral blood T lymphoma cells, and then the polyadenylated mRNA has been isolated from the total RNA extract. A cDNA bank has been constructed by reverse transcription of the polyadenylated mRNA with the enzyme reverse transcriptase. The DNA has been converted to double-stranded DNA with DNA polymerase I and inserted into an appropriate cloning vector. Recombinant cloning vectors have been used to transform an appropriate host.

The transformed guests were identified and grouped into sets. Plasmid DNA prepared from these sets was hybridized with the murine cDNA probe that had been radiolabelled. Clone sets that gave a positive signal on the probe were identified and then the assumed sets were subdivided.

000 388 and a new selection was repeated by hybridization. Eventually, a single transponder corresponding to the wild-type human GM-CSF gene was eventually identified. Plasmid DNA was prepared from that transformant and characterized by DNA sequencing. The wild-type human GM-CSF gene coding region was used to construct an expression plasmid designated pYafGM-2 and illustrated in Figure 2, for use in a humble-yeast system to express mature GM-CSF. The expression plasmid was constructed with the pre-pro-α yeast mating factor ("α-factor") as an efficient promoter along with leader sequences to direct GM-CSF synthesis and secretion in yeast. A synthesized oligonucleotide, defined in graph 2, which contained a 5 'cohesive end and a second factorα manufacturing site was coupled to the 5' end of the GM-CSF gene to facilitate the construction of the plasmid and improve expression levels. After this, biological tests were carried out confirming that the expressed protein product is GM-CSF. The trial clarified the ability of GM-CSF to direct the formation of granulocyte, macroophage and mixed colonies from human bone modem cellulas. It was found that GM-CSF directed the synthesis of GM-CSF activity in the test of colonies in the bone marrow at a level of approximately 1.25x10⁶, colony forming units ("CFU") per ml of culture supernatant.

Cloning of the GM-CSF gene mutated by codon substitution

In accordance with one aspect of the present invention, a mutated human GM-CSF gene is prepared by replacing codons encoding basal amino acid residues with codons encoding non-basic amino acid residues. The mutated gene is cloned for use in the expression of a GM anabolic GM-CSF that is devoid of multibasic amino acid residues. In a specific form of the present invention, the codon coding for the rest of the amino acid amino acid 23, arginine, in the wild-type gene has been replaced with a codon that encodes a non-basal amino acid residue with which the arginine multibaotic sequence is eliminated. -arginine in the amino acid residues 23 and 24 of GM-CSF, graph 1A. The substituent moiety may be composed of any non-basic amino acid residue; however, the substituent moiety chosen would not result in the creation of an enzymatic cleavage site that causes undesirable rupture of the GM-CSF expression product. Preferably, the substituent amino acid residue may be leucine or any other amino acid except lysine. Ideally, the amino acid substituent is leucine.

It should be understood that in addition to replacing the arginine in the rest of the amino acid amino acid 23 with a non-basic residue, it is also included in the scope of the present invention to change the arginine in the rest of the amino acid amino acid 24 instead with a non-amino acid amino acid appropriate, for example, with one of the amino acids given above. In addition, the two arginine moieties 23 and 24 can be replaced with non-bazoic amino acid residues. An essential criterion with respect to the particular amino acid residues that are replaced is that the exchange results in the elimination of multibasic amino acids while substantially maintaining the biological activity of GM-CSF.

Ideally, the codon encoding the rest of the non-baseline amino acid is selected for maximum genomic expression by host cells. It is known that S. cerevisiae products encoded by genes composed of specific codon compositions are expressed more highly than products encoded by the same gene with an alternative codon composition for a particular amino acid residue. As a specific example, genes highly expressed in S. cerevisiae contain the codon TTG 92% of the time when encoding a leucine residue, and the other five codons encoding leucine are only contained 8% of the time. Therefore, in GM-CSF if the substituent moiety is leucine, the codon TTG was ideally used.

The GM-CSF analog of the present invention is preferably produced by recombinant DNA methods using a mutated GM-CSF gene encoding the analog protein product. In a preferred form of the present invention, the mutated gene is produced by substituting codons coding for the non-baseline amino acid residues instead of codons coding for the basement amino acid residues objects. Various site-specific mutagenesis procedures can be employed to make this substitution including the techniques of site-specific mutagenesis directed by an oligonucleotide, described generally by Craik, supra. A method uses a sequence defined by synthetic oligonucleotides that is complementary to the region of the cloned DNA molecule except one or several desired nucleotodic mismatches. The synthesized oligonucleootide is paired with a single-stranded (+) single-stranded clone of the original DNA molecule (wild type) carried by the phage vector. Even though the synthesized oligonucleootide does not correspond perfectly with the single-stranded template clone, it mated under appropriate (non-stringent) hybridization conditions, especially if the mismatches were located or near the center of the oligonucleootide instead of at one end. . The poorly matched oligonucleootide acted as a primer for DNA polymerase to synthesize the rest of the complementary (-) strand, giving rise to a double stranded molecule that is used to transform a suitable host for the repair of the mismatches and the production of mutant genes. and wild type.

A somewhat modified and preferred technique is to match the single-stranded (+) template of DNA with portions of a complementary phage (-) strand together with the oligonucleootide synthesized by mutagenesis, which results in nicks between the ends of the oligonucleotide and the complementary (-) strand fragment. These nicks complement each other enzymatically and then the duplex DNA with the completed nicks becomes a suitable host for replication of the mutant gene.

You can also use other techniques of

000 388 site-specific mutagenesis together with the present invention to substitute codons coding for multibasic amino acids in the GM-CSF gene. For example, methods have been developed to generate single-stranded regions in double-stranded DNA molecules to allow the pairing of a mutant oligonucleotide with the sequence of interest. One of these techniques involves making a single-strand notch in the plasmid DNA with a restriction endonuclease in the presence of ethidium bromide and then extending the notch to a dent with Micrococcus luteus DNA polymerase. Shortle et al., Proc. Nat. Acad. Sci. (USA) 79: 1,588-1,592 (1982). Next, a mutated oligonucleotide can be matched to the single stranded portion of the plasmid and the nicks at the ends of the oligonucleotide are enzymatically repaired.

Another alternative is to prepare "indented duplexes" from double-stranded DNA molecules by controlled digestion of a notched plasmid or linsarized with exonuclease III. Wallace et al., Nucl. Acids Res. 9: 3,647-3,658 (1981); and Dalbadie -McFarland et al., Proc. Nat. Acid. Sci (USA) 79: 6,409-6,413 (1982). Preparation of single stranded DNA template

Single-stranded DNA templates corresponding to the wild-type GM-CSF gene are prepared by cloning the wild-type gene into phage vectors capable of producing a single-stranded DNA molecular product when used as a cloning vector. Replicative form of double stranded DNA. One of these phage strands is M13. See Hu and Messing, Gene, 17: 271-277; and Messing, Methods in Enzymology, 101: 20-78 (1983). The DNA phage cloning vector in the replicative form is preferably constructed with duplex oligonucleotides attached to the 5 'end of the GMCSF gene for use in the GM-CSF gene binding mutated to the α-factor promoter and to the leader sequences contained in the expression plasmid used to express the mutated GM-CSF gene as discussed below. An example of these duplex oligonucleotides is shown in figure 3. Ideally, the duplex oligonucleotides together form a second α-factor manufacturing site at the 3 'end of the oligonucleotide adjacent to the 5' end of the GM-CSF gene to improve expression levels.

The phage vector, with the duplex unioén oligonucleotide and the wild-type GM-CSF gene inserted therein, is used to transfect an appropriate bacterial host, such as several strains of E. coli. The topical E. coli strains that can be used in conjunction with the present invention are strains JM101, JM103, JM105 and JM107 of E. coli K12 (Bethesda Research Laboratories, Bethesda, Maryland).

Oligonucleotide preparation

The oligonucleotide containing the desired codon substitution of the wild-type GM-CSF gene can be easily synthesized by well-known techniques, such as phospholyester or triester methods. The details of the triester synthesis technique are described, for example, in Sood et al., Nucl. Acid Res. 4: 2,557 (1977); and Hirose et al., Tet. Lett. 28. 2,449 (1978).

Preferably, the substituted codon is located approximately in the center of the oligonucleotide and the oligonucleotide is long enough to easily hybridize to single stranded DNA prepared earlier, while it is short enough to be synthesized with relative ease. As a illustrative but not limiting example, if, as stated above, the rest of the arginine amino acid number 23 of the wild-type GM-CSF gene is substituted with leucine, then the oligonucleotide, designated MCDS27, may have the following composition: 5'CATCCAGGAGGCCTTGCGTCTCCTGAA3 '. In this construction of the oligonucleotide the codon corresponding to leucine, TTG, underlined, is located near the center of the oligonucleotide. As already indicated, this particular composition of the codon leucine codon is chosen to maximize the expression of the analogous GM-CSF. It should be understood that a larger or smaller number of flanking nucleotides can be used and that the replacement codon does not necessarily have to be located in this position of the oligonucleotide.

Cloning of the mutated gene

Referring to graph 3, for use in the formation of heteroduplex DNA, wild-type double-stranded M13 DNA is prepared, Ideally, but not necessarily, from the same strain used to form the single-stranded template. Preferably the double stranded DNA substantially overlaps the strand (+) of the entire template except in the region of the substituted codon.

The portion of wild-type M13 DNA and the oligonucleotide are paired with the strand (+) of the template by conventional methods well known to form the indented duplex structure. The nicks between the ends of the oligonucleotide and the corresponding ends of the complementary (-) strand are completed by conventional techniques using E. coli DNA polymerase ("Klenow" fragment) and T4 DNA ligase. After this, the covalently closed heteroduplex is used to transform a suitable host, such as a strain of E. coli. By transfecting the host and replicating the heteroduplex, mixed progeny is produced that contains the mutant or wild-type copies of the GM-CSF gene. Selection of cloned DNA molecules

Plates that come from the host's transfection are hybridized with a radiolabeled oligonucleotide probe, ideally of the same composition as the mutant oligonucleotide, to give mutant DNA molecules directed by the oligonucleotide. Although the oligonucleotide probe may be radiolabeled by many different techniques and with many different isotopes, preferably the probe is radiolabeled with T4 and P polynucleotide kinase.³²-ATP. A conventional protocol for the marking procedure is described by Maniatis et al., In Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring, New York (1982).

Assumed plates are collected and hybridized with the P32-labeled oligonucleotide probe. The collected plates are used to inoculate microtiter wells containing YT medium.

000 388

After a suitable growth period, the candidate cultures are punctured on nitrocellulose filters placed on YT plates. After another proliferation, DNA is released and fixed to the nitrocellulose filter. The fixed DNA is hybridized with the labeled oligonucleotide probe. Specific DNA fragments that hybridize to the probe are identified by autoradiography. This method identifies candidates that contain site-specific mutation. DNA is prepared in the double stranded and single stranded phage replicative form that contains the site-specific mutation, designated M13HuGMLeu23.

Characterization of the mutation in selected GM-CSF

The single stranded phage DNA prepared before is sequenced using conventional chain termination methods. This technique of nucleotide sequencing has been originated by Sanger et al., Proc. Nattl Sci. (USA) 70. 5,463 (1977). See U.S. Patent No. 4,322,499. The methods for determining the chain termination sequence are described in the titled Amersham Handbook, M13 Cloning and Sequencing, Blenheim Cresent, London (1983) (hereafter "Amersham Handbook"); Messing, 2 Recombinant DNA Technical, NIH Publication No. 79-99, 2. 43-48 (1979); Norrander et al., Gene 26: 101 (1983); Cerretti et al., Nucl. Acids Res. 11: 2,599 (1983); and Biggin et al., Proc. Natl. Acad. Sci. (USA) 80: 3,963 (1983).

In the chain termination sequencing method, single-stranded mold molecules are primed with a short universal primer strand having a free 3 'hydroxyl group and then using polymerase DNA (Klenow fragment) to copy the template strand into a reaction of chain extension using the four deoxyribonucleoitide triphosphates, that is, dATP, dCTP, dGTP and dTTP (referred to collectively as "dNTPS"), one of the radiolabeled dNTPS being. In the synthesis reaction, a specific chain terminator is used for a nucleotide that lacks a 3'-hydroxyl end, for example, a 2 ', 3'-dideoxynucleoitide triphosphate (ddNTP "), to produce a series of extensions of the chain of different lengths. The terminator has a normal 5 'end so that it can be incorporated into a developing DNA chain, but it lacks a 3'-hydroxyl end. Once the terminator has been integrated into a DNA chain, my deoxynucleotide triphosphates cannot be added so that for the chain growth. Four synthesis reactions were performed separately, each having a ddNTP of one of the four nucleoitides dNPTs, that is, dATP, dCTP, dGTP and dTTP. One of the normal dNPTs is radiolabelled so that the synthesized strands, after being sized by size on a polyacrylamide gel, can be autoradiographed. The extensions of the chain of the four reactions are placed side by side in separate goal bands so that the model of the autoradiography fragments corresponds to the nucleic acid sequence of the cloned DNA.

Graph 1B illustrates the nucleotide sequence of the mutated human GM-CSF gene contained in the plasmid DNA M13HuGMLeu23. The corresponding amino acid composition of the coding region of the mutant gene is also illustrated in chart 1B, starting from the rest of wing Nu 1 (nucleotide numbered 14) and extending to the remainder Glu, number 127 (nucleotide numbered 394). As expected, the M13HuGMLeu23 mutant differs from the wild-type, graphical 1A gene, only in codon 23 in which the altered gene contains the TTG (Leu) sequence instead of CCG (Arg). In the 1B chart, the 5 'nucleotides of the region coding for the mutant gene make up the second manufacturing site of the α-factor and a 5' HindlII cohesive end (nucleotide nucleotides 6 to 13).

It should be understood that instead of using the chain termination technique mentioned above, other methods can be used to sequence cloned human cDNA inserts without departing from the spirit or scope of the invention. For example, the chemical degradation method of Maxam and Gilbert described in Proc can be used. Natl. Acad. Sci. (USA) 74: 560 (1977).

GM-CSF analog expression

The M13HuGMLeu23 cDNA fragment Indicated in Figure 1B, from the HindIII restriction site (nucleic acid nucleus -6) to the NcoI restriction site (nucleic acid nucleic acid 502) is inserted into an expression vector (see graphical 4) designated to direct the synthesis and secretion of the mature form of GM-CSF analogous of hostile yeast cells. The expression vector, for example, pYafHuGMLeu23, preferably contains sequences derived from plasmid pBR 322 containing an origin of replication and the ampicillin resistance gene (Amp ') (coarse line portion in graph 4). Preferably, the expression vector also includes yeast sequences, for example, the tryptophan-1 gene (Trp-1) as a selectable marker and the origin of 2 μ yeast replication (thin line portion of graph 3). Ideally, the expression vector also includes yeast factor-α (eg, dotted cove portion) as an efficient promoter together with leader sequences to direct GM-CSF synthesis and secretion in yeast guests, followed by the second site. of elaboration of the α-factor (open box portion) derived from the duplex binding oligonucleotide and then the sequence for the GM-CSF coding region (shaded box portion). The structure of the α-factor gene is described by Kuqan and Herskowitz, Cell. 30: 933-943 (1982).

The expression plasmid pYafHuGMLeu23 is transformed into an appropriate S. cerevisiae strain. Preferred strains include, but are not limited to, yeast strains 79, X2181-1B. DBY746, YNN282, 20B-12. These strains are all α, Trp 1 for compatibility with the α-factor promoter and for the selection of Trp transformants.⁺ . These strains are very affordable, for example, strain 79 can be obtained from the yeast genetic storage center, Department of Biophysics and Medical Physics, Univer6

000 388 California, Berkeley, California 94072.

The transformation of the yeast host with the recombinant expression plasmid containing the mutated GM-CSF gene is conducted following well-known procedures where spheroplasts are formed and then washed before capturing the plasmid. The protocols standardized by this procedure have been this. See Begas, Nature (London) 275: 104 (1978); Hinnen et al., Proc. Natl. Acad. Sci (USA) 75: 1,929 (1978).

Supernatants from yeast culture are tested for biological activity through their ability to direct the formation of granulocytic and macroophage-like and mixed colonies of human bone modem cellulas. As a control, the PYaf plasmid, of the same construction as pYafHuGMLeu23 but lacking GM-CSF sequences, is also transformed into a yeast host and the biological activity of the culture supernatant is tested. It is found that the supernatant of pYafHuGMLeu23 directs the synthesis of high levels of GM-CSF activity in the bone modem colonies assay (7.2x10⁶ CFU-C / ml): while no activity is detected with the supernatant obtained from the pYaf control plasmid.

Cloning, selection and characterization of the GM-CSF gene mutated by deletion of the codon and expression of the anaerobic GM-CSF with the mutated gene

Following another aspect of the present invention, a mutated human GM-CSF gene is prepared by deletion of the codons coding for basal amino acid residues and the mutated gene is cloned for the expression of the anomalous GM-CSF which is devoid of amino acid residues. multibasic In a specific form of this aspect of the present invention, the codon coding for the rest of amino acid amino acid 23, arginine, in the wild-type gene is suppressed thereby eliminating the multibasic sequence argininearginine in the remains of nucleo amino acids 23 and 24 of GM-CSF, graph 1A. It should be understood that instead of suppressing the arginine from the rest of the amino acid amino acid 23, it was also within the scope of the present invention to suppress the arginine from the rest of the amino acid amino acid 24, or to suppress both arginine residues in the numbered moieties 23 and 24. An essential criterion with respect to the particular amino acid residues suppressed is that the suppression results in the elimination of multibabic amino acids while maintaining the biological activity of GM-CSF.

As in the GM-CSF gene discussed above mutated by codon substitution, the GM-CSF analog using the GM-CSF gene mutated by codon suppression is preferably produced by recombinant DNA methods. In a proffered form of the present invention, the mutated gene that has one or several suppressed codons is produced by the same technique specific to a mutagenesis specific to a site discussed above with respect to the GM-CSF gene mutated by codon substitution, with the exception that instead of synthesizing the oligonucleotide with a substituted non-baseline amino acid codon, The oligonucleotide is prepared by suppressing one or more of the object codons coding for the deleted basic amino acid residues. With this exception, the same procedure discussed above is used to prepare the mutant gene by codon substitution to prepare the mutant gene by codon suppression. In the process, the single-stranded (+) DNA template corresponding to the wild-type GM-CSF gene is prepared by cloning the wild-type gene into phage vectors capable of producing a single-stranded DNA product. when DNA is used as a cloning vector in a double stranded replicative form. The single-stranded DNA template is paired with portions of a complementary (-) phage of a strand together with the mutagenesis oligonucleotide with the suppressed, synthesized codon, resulting in nicks between the ends of the oligonucleootide and the fragment of the complementary (-) thread. These nicks are filled enzymatically and then the duplex DNA with the filled nicks becomes an appropriate host for the replication of the mutant gene with the deleted codon.

As discussed above, the oligonucleotide containing the desired codon suppression from the wild-type GM-CSF gene is synthesized by well-known techniques, such as phosphodiester or trioster methods. Preferably the codon suppression is located approximately in the center of the oligonucleotide and the oligonucleootide is long enough to easily hybridize to the single stranded DNA template while it is short enough to be synthesized with relative ease. As an illustrative but not limiting example, if, as discussed above, the rest of the arginine amino acid amino acid 23 of the wild-type GM-CSF gene is suppressed, then the oligonucleotide, designated MCD524, could have the following composition: 5 ' CATCCAGGAGGCCCGTCTCCTGAA-3 '. It should be understood that a larger or smaller number of flanking nucleootides can be used on each side of the location of the deleted codon.

The GM-CSF gene mutated by codon suppression is cloned and selected in the same manner as discussed above with respect to the mutated gene by codon substitution. Likewise, the plasmid DNA designated M13HuGMΔArg23, which contains the rest of arginine suppressed in the numbered position 23, is sequenced using standardized chain termination methods discussed earlier at the end of page 5. The 1 C chart illustrates the nucleotodic sequence of the mutated GM-CSF gene contained in the plasmatic DNA M13HuGMΔArg23. The corresponding amino acid composition of the coding region of the mutated gene is also illustrated in graph 1C, beginning with the residue Ala (number 1) (nucleotide number 14) and extending to the remainder Glu, number 126 (nucleotide number 391 ). As indicated in graph 1C, the M13HuGM ΔΆ ^ 23 differs from the wild-type gene, graph 1A, only in codon 23 that is omitted in the altered gene. The 5 'nucleotides of the region coding for the mutant gene are composed of the site of production of the α-factor and the 5'cohesive end HindIII, as illustrated in graph 1C (nucleootide nuances -6 to 13).

000 388

The analog GM-CSF is expressed with the mutant M13HuGMArg23 gene using the same procedure used to express analogous GM-CSF using the mutant gene M13HuGMLeu23 discussed above from page 6. Likewise, the expressed protein product is tested for biological activity using the same bone marrow test discussed before.

The methods and products of the present invention are further illustrated by the following examples.

Example 1

Preparation of a single strand DNA template

As shown in graph 3, the plasmid pHG23 is isolated by digestion with the restriction enzymes SfaNI and Nool, a 487 base pair DNA fragment containing the coding regioan and a portion of the 3 'flanking region of the gene from Human GM-CSF (extending from nucleotide number 16 to nucleotide number 502 in figure 1A). T4 DNA polymerase is used to terminate the NcoI site of the genetic fragment. The digestion of the plasmid pHG23 with SfaNI results in the elimination of the first two nucleotides of the region coding for the GM-CSF gene. A duplex junction oligonucleotide of the composition given below is synthesized in Table 1 to add the two nucleotides of the initial Ala amino acid and also provides a second manufacturing site of the α-factor for use in the subsequent high-level expression of the gene of GM-CSF mutated in yeast guests, as described in more detail in Example 6. As seen in Table 1, the duplex oligonucleotide is constructed with a cohesive 5'HindIII end.

TABLE 1

5'- AGCT TCT TTG GAT AAA AGA GC -3 '

3'- AGA AAC CTA TTT TCT t CGT GGG -5 '

Be Leu Asp Lys Arg | Pro wing

HindIII factor development

The isolated GM-CSF gene fragment, together with the individual oligonucleotides that make up the duplex given in Table 1, are ligated into strain mp10 of phage vector M13 (Amersham, Arlington Heights, Illinois), which has previously been digested with HindIII and Smal restriction enzymes. The ligand is made in a reaction mixture composed of 20 nanograms (ng) of linearized mp10M13, 50 ng of the mutated GM-CSF gene fragment, 5 ng of synthetic oligonucleoatide, a unit of T4 DNA ligase and sufficient ligase buffer of T4 (0.4 M Tris (pH 7.4), 0.1 M MgCl2, 0.1 M dititreitol, 10 mM spermidine, 10 mM ATP and 1 mg / microliter (“μ!”) Of ASB) to form a reaction volume of 20 gl. The reaction is carried out by incubation at 25 ^ C for 15 hours.

The M13mp10 vector with the inserted DNA fragment, designated M13HuGM, is used to transfect by a standardized E. coli protocol JM103 from strain K12 (Bethesda Research Laboratories, Betheda, Maryland) to produce an E. coli strain that actively excretes the phage M13HuGM condemning single stranded DNA. The phage is collected from the culture supernatant after 4 hours of propagation at 37 C by precipitation with polyethylene glycol. Single strand phage DNA is isolated by extracting with phenol: chloroform follows the conventional protocol detailed in the Amersham Handbook.

Example 2

Synthesis of oligonucleotide and radiolabeled

The oligonucleotide used for site-directed mitogenesis of the GMCSF gene by codon substitution is chemically synthesized by the conventional triaester method, detailed by Sood et al., Supra and Hirose et al., Supra. The oligonucleoatid, designated MCD5-27, will consist of the following sequence: 5'-CATCCAGGAGGCCTTGCGTCTCCTGAA-3 '. The oligonucleoatide is unlocked and purified by chromatography on Sephadex G-50 (Pharmacia Find Chemicals) and then subjected to preparative gel electrophoresis.

The oligonucleotide is radiolabelled terminal with P³² for use as a selection probe. To facilitate the radiolabeling, the 5 'ends of the oligonucleoatides with OH ends are synthesized, thereby terminating the phosphatase treatment, which should be used tactically with marker DNA fragments. The labeling protocol includes the addition of 1 00 ng in a volume of 1 gl of the synthetic oligonucleotide to 16 gl of P³²-ATP (7,000 Ci / mM), 1 gl (10 U) of T4 polynucleotide kinase and 2 gl of 10xtampran kinase I (0.5 M Tris-Cl (pH 7.0), 0.1 mM MgCl2, dithiothreitol 50 mM, 1 mM spermidine and 1 mM ETDA). The reaction is carried out at 37 ^ C for 30 minutes and then the P-labeled oligonucleotides³² and the P³²-ATP not incorporated are separated by chromatography on Sphadex G-50 (Pharmacia Fine Chemicals). Example 3

Directed mutagenesis at the GM-CSF site by codon substitution

As illustrated in graph 3, for use in the formation of the indented heteroduplex structure, strain mp 1 8 of phage vector M13 is digested with the restriction enzymes EcoRI and HindIII by conventional techniques. The resulting main fragment and the oligonucleotide of MCD5-27 mutagenesis are paired to the single-stranded M13HuGM template containing the wild-type GMCSF gene following the procedure detailed below. 1 microgram ("gg") of the double-stranded digested M13mp18 is mixed with 0.5 gg of the single-stranded M13HuGM template DNA in 30 gl of 100 mM NaCl, 40 mM Tris-HCI (pH 7.5), 20 mM MgCl2, 2.0 mM β-mercaptoethanol. The mixture of the single-strand mold with the M13mp18 fragment in the form of a double strand is denatured by heating to 100^◦ C for 3 minutes and allowed to cool for 20 minutes at 65 ^◦C. MCD5-27 oligonucleoatide containing a 5'-phosphate (50.0 pmoles) is added and the mixture is slowly cooled to 30 C and then placed on ice for 15 minutes. Then, the following is added to the mixture: 70 gl of 22 mM Tris-HCI (pH 7.5), MgCl₂ 11 mM, 1.0 mM β-mercaptoethanol, dATP

000 388

0.83mM, dCTP0.83mM, dGTP0.83mM, dTTP 0.83mM, 0.4mM rATP, 0.5 units of E. coli DNA polymerase (Klenow fragment) (Boehringer Mannheim Biochemicals), and 0.5 units T4 DNA ligase (Bethesda Research Laboratories). After an additional 30 minutes at 0 ° C, this primary extension mixture is incubated at 14.5 ° C for 20 hours.

Example 4

Selection of the mutated gene

The duplex structure of filled nicks of Example 3 is used to transfect competent E. coli JM105 (Bethesda Research Laboratories, Bethesda, Maryland) cells by conventional techniques, such as those described in Amersham Handbook, supra. Transfected JM105 cells are plated immediately after a heat shock on clean YT plates in upper agar.

94 of the resulting plates are collected and hybridized with the radiolabeled MCD527 oligonucleotide probe, prepared in Example 2. The recombinant (white) plates are collected with a sterile loop and used to inoculate microtiter plate wells containing 100 μ ! of medium YT. After about 5-7 hours of propagation at 37^°C, a 96-well replicator is used to stain the candidate cultures on nitrocellulose filters placed on YT plates, in duplicate. After a night of propagation a37^°C, the filters are removed from the petri dishes. The DNA is released using alkaline and neutralizing solutions by the general method described by Maniatus et al., Supra. After the transfer procedure the filter is air dried and cooked for about 2 hours at about 80^°C to bind single stranded DNA to nitrocellulose.

The bound DNA is then hybridized with the labeled oligonucleootide probe. Briefly, cooked nitrocellulose is incubated at 68^°C for 2-4 hours in prehybridization pad consisting of: 6X normalized saline citrate ("SSC") (1xSSC is 0.15M NaCl, 0.015M NaCitrate, pH 7.0); and 5X Denhardt's solution (0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.2% bovine serum albumin). Then the liter is incubated for 16 hours at 55^°C with the P-labeled oligonucleotide probe³² (10⁶ cpm / ml, from example 2) in hybridization buffer as before. After hybridizing, the filter is washed extensively under very stringent conditions first with 6X SSC at room temperature and then for 1 hour at 68^°C in 0.8X SSC. After air drying, the filter is autoradiographed at -70^°C. This method results in a clear identification of the candidates that contain the mutant GM-CSF gene, designated M13HuGMLeu23.

Example 5

Characterization of the selected mutagenized gene

DNA templates are prepared from the candidates identified in example 4 and sequenced by the conventional chain termination method described in the Amersham Handbook, supra. The universal synthetic primer: 5'CCCAGTCAC -GACGTT-3 '(PL Biochemicals, Milwaukee, WI), is paired to single-stranded DNA templates and used to prime DNA synthesis as described earlier in the page

10. Then, the extension fragments are separated by sizes by gel electrophoresis and autoradiographed, thereby deducing the nucleotodic sequences of the fragments.

5 'is used (a [S³⁵] uncle) deoxyadenosine triphosphate (hereafter “dATP [α-S³⁶] ”) As a radioactive marker in dideoxy sequencing reactions. In addition, instead of using the gel indicated in page 36 of the Amersham Handbook, a 6% polyacrylamide gel (6% polyacrylamide gel, 0.4 mm thick, containing 7 M urea, Tris borate 100 is used mM (PH 8.0), and 2 mM EDTA).

As indicated above, the nucleotodic sequence of the mutant GM-CSF gene, M13HuGMLeu23, is illustrated in graph 1B, starting at (*) the mature protein. The corresponding amino acid composition of the mature protein is given below the corresponding codons, starting from the Ala residue, number 1 (nucleotide number 14) and extending to the residue Glu, number 127 (nucleotide number 394). As expected, this mutant gene differs from the wild-type gene only in codon 23 in which the mutant gene contains the lucin TTG sequence, instead of the arginine coding CGT sequence. The 5 'nucleootides of the mature gene constitute the second factor site and a 5' HindIII cohesive end, as illustrated in Figure 3.

Example 6

GM-CSF Anaologist Expression

The coding region, together with a portion of the 3 'flanking region of the mutant GMCSF gene exposed in graph 1B (nucleotides 14 to 502), and also together with the second site of development of the α-factor and the cohesive end HindIII 5 'coupled to the 5' end of the analogous GM-CSF gene, is removed from the mutagasonis vector and used to form a recombinant expression plasmid, designated pYafHuGMLeu23 to direct the expression of GMCSF analog in yeast guest cells. As can be seen in figure 4, the expression plasmid pYafHuGMLeu23 includes an origin of replication and an ampicillin resistance gene of the plasmid pBR322 (coarse porcine portion). The expression plasmid also includes the origin of replication 2u of yeast and the Trp 1 gene for the selection of transformed yeast guests (TRP [Trp -auxotrophs], portion of fine lone in the graph 4). The expression plasmid also includes the α-factor promoter and the leader sequences used for direct transcription and the secretion of the anaologous GM-CSF (dotted box portion). The analog GM-CSF sequences are shown in the striped portion of the box in graph 4, while the maturity site similar to Cathepsin-B that functions as a second factor-α-manufacturing site is represented as a box part open in graph 4, giving its sequence also in the graph

4.

The 5 'leader sequence, the coding region and

000 388 a portion of the 3 'flanking region of the mutant GMCSF gene, from nucleotide numbered -6 to numbered 502, is removed from the mutagenesis vector M13HuGMLeu23 and inserted into the expression vector pYafHuGMLeu23 by digestion with the restriction enzyme Ncol and desputed It is treated with T4 DNA polymerase to complete the 3'-empty end at the NcoI site with deoxynucleotides. Next, the cleaved vector is treated with HindIII and the resulting 508 bp M13HuGMLeu23 DNA fragment is isolated by gel electrophoresis with the 5 'sequencer attached to oil. This DNA fragment is ligated into the pYaf vector that has been previously prepared by removal of the HindIII-Stul / Ncol section of the expression plasmid pYafGM-2 (graph 2) (ATCC number 53,157) by conventional techniques.

The expression plasmid pYafHuGMLeu23 is transformed into a yeast strain 79 (a, Trp 1-1, Leu 2-1) of S. cerevisiae for selection of Trp + transformants by standard techniques. Before transformation, strain 79 is propagated in culture in YEPD medium (1% w / v yeast extract, 2% w / v peptone, 2% w / v glucose), at a density of 2x10⁷ Cells / ml. The coelulas are collected by centrifugation at 1,000 xg for 5 minutes at 22 ° C, and then the resulting granule is washed with sterile distilled water.

The yeast cells are concentrated by resuspended in 1/10 volumes of SED (1 M sorbitol, 25 mM ADTA (pH 8.0) and 50 mM dithiothreitol) and incubated for 10 minutes at 30^°C. Thereafter, the cell-tampoon mixture was centrifuged for 5 minutes at 300 x g. The grain is washed once with 1/10 volumes of 1 M sorbitol and the cells are resuspended in 20 ml of SCE (1 M sorbitol, 0.1 M sodium citrate (pH 5.8), 0.01 M EDTA) . Glusulase is added, to break the walls of the coelulas, in an amount of 10^-3volumes, and then the solution is incubated at 30^°C for 30 minutes with occasional gentle shaking. The presence of spheroplasts is tested by diluting 10 microliters of the yeast cells in a drop of 5% SDS (w / v) on a microscope plate to observe "images" at a 400 x phase contrast. Then the coelula mixture was centrifuged at 300 xg for 3 minutes. The resulting grain is washed twice with 1/100 volumes of 1 M sorbitol. The grain is washed once in CaS (1 M sorbitol, 10 mM MaCl 2).

The yeast spheroplasts are then transformed with the expression vector previously prepared in a procedure adapted from Beggs, supra. The granulated spheroplasts are suspended in 1/2 volumes of CaS and then divided into 100 microliter aliquots in 1.5 ml Eppendorf tubes. Then they are added to each aliquot of 1 to 10 μ! of plasmid DNA (0.5 to 5 μg). The mixture is incubated at room temperature for 10 minutes and then 1 ml of PEG (20% PEG 4,000, 10 mM CaCl2, 10 mM Tris-HCl (pH 7.4)) is added to each aliquot to promote DNA uptake . After 10 minutes at room temperature the mixture was centrifuged for 5 minutes at 350 x g. The resulting grain is resuspended in 150 μ! of SOS (10 ml of 2M sorbitol, 6.7 ml of YEPD medium, 0.13 ml of CaCl2 1

M, 27 μ! of 1% tryptophan and 3.7 ml of water). This mixture is incubated for 20 minutes at 30^°C. Then the coelulas are plated.

Before plating the protoplast / DNA mixture, selective plates are pre-incubated at 37^°C. Then 3 ml of molten upper agar is added to each aliquot of transformed coelulas (45^°C), composed of 18.2 ml of sorbitol, 2 g of agar, 0.6 g of nitrogenous base of Difco yeast (without amino acids), 2 g of glucose, 0.1 ml of 1% adenine, 0.4 ml of 1% uracil and the amino acids in the necessary amount, and the contents of the tube are poured into the selective plates. Plates are incubated 2 to 4 days at 30^°C. Colonies that develop in the least Trp medium contain plasmids that have the Trp 1 gene, that is, those that transform.

Before the biological test, the transformants are propagated in 20-50 ml of YEPD at 30^°Cafase stationary. At the time of harvest, the phenylmethylsulfonyl fluoride (PMSF) and Pepstatin A protease inhibitors are added to a final concentration of 1 mM and 10 μΗ, respectively. Then the coelulas are separated by centrifugation at 400 xg and the medium is filtered through a 0.45 micron cellulose acetate filter.

Example 7

Colony test

The presence of analogous GM-CSF collected from yeast cultures in example 6 is confirmed by testing the ability of a supernatant to stimulate the propagation of colonies of human bone marrow in agar. For use in the assay, a human donor modem from the iliac crest of healthy donors is collected in a heparinized syringe. The model is diluted 1: 3 with phosphate buffered saline (PBS) at room temperature and layered in a 54% percoll solution (Pharmacia Fine Chemicals). After centrifuging at 500 xga at room temperature for 20 minutes, the interface is collected and washed with 20 volumes of PBS. Next, the suspension is centrifuged at 250 xg for 10 minutes at room temperature. Afterwards, the coelulas are resuspended in 10 ml of essential monophonic medium with nucleotides (a-Mem, Gibco) for the cell count and the determination of viability. FCS is then added and the cell suspension is stored on ice until the test is performed.

In the assay, the bone marrow cellulas prepared before are added to a final concentration of 1x10⁵/ ml to an incubation medium consisting of: (a) seven deliveries of a solution containing 28.1% FCS, 0.7 x 10 mercaptoethanol^-4 M, 0.12 mg / ml asparagine, 0.7 mg / ml glutamine, 150 units of penicillin G, 150 units of streptomycin, 1,1x-MEM with nucleotides, and 2,2xvitamins (Gibco); and (b) three parts of a 1.4% bactoagar solution (Difco). The cultures are incubated in a humidified atmosphere at 37^°C in the presence of 5% CO2. After seven to fourteen days of cultivation, the number and types of colonies are determined, whether granulocytes, macrophages or mixed granulocytes macrophages. Applicants have found10

000 388 brought the GM-CSF gene of the pYafHuGMLeu23 clones to direct the synthesis of GM-CSF activity at a high level of 7.2x10⁶ colony forming units ("CFU") per milliliter. This level of activity is determined by multiplying the inverse of the dilution by 50, which gives 50% of the number of maximum colonies. Applicants have found that the average number of colonies from 1x10⁵ bone marrow cellula is 73 ± 16. Colonies formed at 14 days by recombinant GM-CSF are well defined and are of three types: approximately 1/3 of mixed granulocyte-macrophage colonies, approximately 113 of compact granulocyte colonies and approximately 113 of dispersed macroophage colonies.

As a control for the expression system of the present invention, a plasmid suitable for pYafHufMLeu23 is also transformed into yeast strain 79, but lacks GM-CSF sequences. The yeast culture supernatant does not produce any GMCSF activity in the bony modem colonies test. Example 8

GM-CSF gene mutated by codon suppression

The oligonucleotides used for site-directed mutagenesis of GMCSF gene by codon replacement are chemically synthesized by the conventional trioster method, detailed by Sood et al., Supra and Herose et al., Supra. The oligonucleototide, designated MCD5-24, was composed of the following sequence: 5'-CATCCAGGAGGCCCGTCTCCTGAA-3 '. The oligonucleootide is unlocked and purified by chromatography on Sephadex G50 (Pharmacia Fine Chemicals) and then by electrophoresis the preparative gel. Then the oligonucleotide is radiolabelled terminal with P³²for use as a selection probe using the procedure described above in example 2.

As indicated in figure 5, the MCDS-24 oligonucleotide is used together with the single-stranded template containing the wild-type GMCSF gene prepared in example 1 and with the phage vector M13HuGM of Example 3 above to produce a indented heteroduplex structure similar to that illustrated in graph 3 using the methods described in example 3. Next, the duplex structure with the filled nicks is used to transfect E. cells. Competent JM105 coli (Bethesda Research Laboratories, Bethesda, MD) by conventional techniques, as indicated in the Amersham Handbook, supra. The selection of the mutated gene in the transfected JM 105 cells was made using the procedure given in Example 4, and the Nucleic acid sequence of the selected mutated gene, designated M13HuGMΔArg23 is guessed using the chain termination method described in example 5.

The analogous GM-CSF is expressed using the procedure given in example 6 where the 5 'leader sequence, the coding region and a part of the 3' flanking region of the mutant GMCSF gene (between nucleotide numbered 6 and 502), are taken from the mutagenesis vector

M13HuGMΔAg23 by digestion with an Ncol restriction enzyme and then treated with T4 DNA polymerase and cleaved with HindIII. The resulting 505 bp M13HuGMΔArg23 DNA fragment with the 5 'leader sequence attached to the oil is isolated by gel electrophoresis and then ligated into the pYaf vector prepared by removal of the Hind 3-Stul / Ncol section of the expression plasmid pYafGM- 2 (graph 5) (ATCC number 53.157) by conventional techniques. The resulting expression plasmid pYαfHuGMΔArg23 (graph 6) is transformed into yeast strain 79 as detailed in example 6 and then the expressed recombinant GM-CSF product is tested to see the biological activity using the exposed bone marrow colony assay in example 7.

It will be evident to those skilled in the art to whom the invention is directed, that the present invention can be carried out in ways other than those described here specifically without departing from the spirit or the essential features of the invention. The particular embodiments of the present invention, described above, are therefore considered in all aspects as illustrative and not limiting. The scope of the present invention is set forth in the appended claims instead of being limited to the examples contained in the previous description.

Translation legends of the drawings Figure 1A

a) Nucleotodic sequence of the wild-type (superior lone) gene coding for the human granulocyte macrophage colony stimulating factor. The corresponding amino acid sequence is shown on the lower line. The mature protein begins in the asterisk (*).

Figure 1B

b) Nucleotodic sequence of the mutated gene with substituted sites M13HuGMLeu (superior lone) encoding the granulocyte-macrophage colony stimulating factor analogous human. The corresponding amino acid sequence is given in the lower line. The mature human protein begins in the asterisk (*).

Figure 1C

c) Nucleotodic sequence of the mutated gene with suppressed sites M13HuGMΔArg23 (upper line) coding for the granulocyte-macrophage colony stimulating factor anaologous. The corresponding amino acid sequence is given in the lower line. The mature human protein begins in the asterisk (*).

Figure 2

a) Development of the α factor.

Figures 3 and 5

a) Join oligo.

000 388

b) Transfect layer JM103.

c) GM-CSF gene.

d) Denaturalize mating.

e) Unioán oligo terminal.

f) Oligonucleoatid.

g) Nicked.

h) C. Coli DNA polymerase and T4 DNA ligase.

j) Disrupted.

k) T4 DNA polymerase.

l) Transfect layer JM 105.

m) Progeny.

Figures 4 and 6

a) GM-CSF mutant gene.

b) Development of the α factor.

In summary, the patent of invention that is requested will fall on the following:

000 388