Mesoporous silica compositions for modulating immune responses
15 claims: 7 independent, 8 dependent
- 1A composition comprising:mesoporous silica rods, wherein the rods have a length of 5 µm to 500 µm, and wherein the rods comprise pores of between 2-50 nm in diameter;and a cytokine that recruits an immune cell to the mesoporous silica rods, wherein the cytokine is loaded into the mesoporous silica rods and is released from the mesoporous silica rods upon administration to a subject, and wherein the mesoporous silica rods are capable of self-assembly in vivo into a three-dimensional scaffold that allows for immune cell infiltration .
- 4The composition of any one of claims 1-3, wherein the mesoporous silica rods are modified;optionally, wherein the mesoporous silica rods are modified with a functional group selected from the group consisting of amine, thiol, chloro and phosphonate;and optionally wherein the mesoporous silica rods are modified with glycolic acid or lactic acid.
- 8The composition of any one of claims 5-7, wherein the rods comprise an immune cell activation compound; optionally, wherein the immune cell activation compound comprises a TLR agonist; optionally, wherein the TLR agonist is a nucleic acid or a lipid; is selected from the group consisting of a TLR3 agonist and a TLR9 agonist; or is selected from the group consisting of monophosphoryl lipid A (MPLA), lipopolysaccharide (LPS), cytosine-guanosine oligonucleotide (CpG-ODN), poly(ethylenimine)-condensed CpG-ODN (PEI-CpG-ODN), polyinosine-polycytidylic acid (poly I:C), PEI-poly (I:C), polyadenylic-polyuridylic acid (poly (A:U)), and PEI-poly (A:U).
- 14The composition of any one of claims 5, 7 and 8 for use in inducing a systemic antigen-specific immune response to said vaccine antigen or inducing homing of vaccine antigen-specific immune cells to a lymph node, wherein the composition comprises mesoporous silica rods comprising a cytokine, an immune cell activation compound, and a vaccine antigen;and wherein the rods have a length of 5 µm to 500 µm.
- 15A method of making a composition that induces an immune response in a subject, comprising providing a suspension of mesoporous silica rods, and contacting the rods with at least one of a vaccine antigen, a cytokine, and an immune cell activation compound, wherein said rods have a length of 5 µm to 500 µm;optionally, wherein said recruitment compound comprises GM-CSF, and wherein said activation compound comprises CpG ODN;or optionally, wherein the rods are modified with glycolic acid or lactic acid prior to contacting the rods with the vaccine antigen, the cytokine, or the activation compound.
Independent claims7
68 paragraphs in 6 sections, as filed
FIELD OF THE INVENTION
0001This invention relates to biocompatible injectable compositions.
BACKGROUND OF THE INVENTION
0002Vaccines that require <i>ex vivo</i> manipulation of cells, such as most cell based therapy, lead to poor lymph node homing and limited efficiency.
0003<nplcit id="ncit0001" npl-type="s"><text>Cancer Research, vol. 71, no. 24 Supplement, P1-01-12</text></nplcit> relates to mesoporous silicon particles for the presentation of tumor antigens and adjuvant for anti-cancer immunity. The document discloses that tests were performed on the ability of mesoporous silicon particles (pSi) to function as substrates for dendritic cells (DC) and to activate cells via engagement of surface toll-like receptors (TLR). The impact of a cytokine cocktail on DC maturation and its impact on particle uptake were also examined.
0004<patcit id="pcit0001" dnum="WO2007030901A"><text>WO 2007/030901</text></patcit> relates to an immunogenic complex formed by vaccinal antigens encapsulated by nanostructured mesoporous silica. The document discloses that an immunogenic complex is constituted by antigens of several natures, encapsulated by highly ordered nanostructured mesoporous silicas that act as adjuvants.
0005<patcit id="pcit0002" dnum="WO2011130753A"><text>WO 2011/130753</text></patcit> relates to functionalized nano- and micro-materials for medical therapies. Mesoporous silica supports having a functionalized surface are disclosed.
0006<nplcit id="ncit0002" npl-type="s"><text>Journal of Materials Science, vol. 44, no. 24, pages 6453-6462</text></nplcit> relates to morphological control on SBA-15 mesoporous silicas via a slow self-assembling rate. SEM images of the mesoporous silica products under stirring are shown.
SUMMARY OF THE INVENTION
0007The invention provides a solution to problems and drawbacks associated with earlier approaches. Accordingly, the invention features a composition comprising mesoporous silica (MPS) rods, wherein the rods ranges have a length of 5 µm to 500 µm, and wherein the rods comprise pores of between 2-50 nm in diameter; and a cytokine that recruits an immune cell to the mesoporous silica rods, wherein the cytokine is loaded into the mesoporous silica rods and is released from the mesoporous silica rods upon administration to a subject, and wherein the mesoporous silica rods are capable of self-assembly <i>in vivo</i> into a three-dimensional scaffold that allows for immune cell infiltration.
0008Preferably, the rods comprise pores of between 5-25 nm in diameter or pores of between 5-10 nm in diameter. In preferred embodiments, the rods comprise pores of approximately 8 nm in diameter. In one example, the rods comprise a length of 5-25 µm, e.g., 10-20 µm. In other examples, the rods comprise length of 50 µm to 250 µm. Robust recruitment of cells was achieved with MPS microparticle compositions characterized as having a higher aspect ratio, e.g., with rods comprising a length of 80 µm to 120 µm.
0009Exemplary cytokines includes granulocyte macrophage-colony stimulating factor (GM-CSF). Other examples of recruitment compounds described herein include chemokines, e.g., a chemokine selected from the group consisting of chemokine (C-C motif) ligand 21 (CCL-21, GenBank Accession Number: (aa) CAG29322.1 (GI:47496599), (na) EF064765.1 (GI:117606581), chemokine (C-C motif) ligand 19 (CCL-19, GenBank Accession Number: (aa) CAG33149.1 (GI:48145853), (na) NM_006274.2 (GI:22165424), as well as FMS-like tyrosine kinase 3 ligand (Flt3) ligand; GenBank Accession Number: (aa) AAI44040 (GI:219519004), (na) NM_ 004119 (GI: GI: 121114303).
0010Immune cell activating compounds include TLR agonists. Such agonists include pathogen associated molecular patterns (PAMPs), e.g., an infection-mimicking composition such as a bacterially-derived immunomodulator (a.k.a., danger signal). TLR agonists include nucleic acid or lipid compositions [e.g., monophosphoryl lipid A (MPLA)]. In one example, the TLR agonist comprises a TLR9 agonist such as a cytosine-guanosine oligonucleotide (CpG-ODN), a poly(ethylenimine) (PEI)-condensed oligonucleotide (ODN) such as PEI-CpG-ODN, or double stranded deoxyribonucleic acid (DNA). For example, the device comprises 5 µg. 10µg, 25µg, 50 µg, 100 µg, 250µg, or 500 µg of CpG-ODN. In another example, the TLR agonist comprises a TLR3 agonist such as polyinosine-polycytidylic acid (poly I:C), PEI-poly (I:C), polyadcnylic-polyuridylic acid (poly (A:U)), PEI-poly (A:U), or double stranded ribonucleic acid (RNA). Lipopolysaccharide (LPS) is also useful for this purpose.
0011To generate an immune response, the composition comprises an antigen to which the immune response is desired. For example, the composition comprises a tumor antigen. In preferred embodiments, the antigen comprises a tumor cell lysate (e.g., from a tumor biopsy sample that was taken from the subject to be treated). The subject is preferably a human patient, but the compositions/systems are also used for veterinary use, e.g., for treatment of companion animals such as dogs and cats as well as performance animals such as horses and livestock such as cattle, oxen, sheep, goats, and the like.
0012Antigen presenting cells such as dendritic cells (DC's) traffick through the MPS device, i.e., the cells do not stay in the device permanently. The immune cells are recruited to the device and are present in the device temporarily while they encounter antigen and are activated. Immune cells such as DC's then home to a lymph node. They accumulate in a lymph node, e.g., a draining lymph node, not in the MPS device. The accumulated cells in the lymph node further augment the immune response to the vaccine antigen resulting in a strong cellular and humoral response to the antigen.
0013Thus, a method of inducing a systemic antigen-specific immune response to a vaccine antigen, comprises administering to a subject the MPS composition described above. The composition is loaded into a syringe and injected into the body of the recipient. For example, a small amount (e.g., 50-500 µl, e.g.., 150 µl) is administered subcutaneously. Typically, the device (MPS composition) is infiltrated with cells by Day 2 post-administration, and by Day 5-7, a draining lymph node is swollen with cells that have migrated out of the device and to the lymph node tissue, where they accumulate and further propagate an antigen-specific response. The compositions are therefore useful to induce homing of immune cells to a lymph node. The MPS composition need not be removed after vaccination therapy. The composition may remain in the body at the site of administration, where it degrades. For example, the MPS particles are consumed by macrophages over time and then cleared from the body.
0014A method of making a vaccine comprises providing a suspension of mesoporous silica rods, contacting the rods with a vaccine antigen, an immune cell recruitment compound, and an immune cell activation compound. The vaccine antigen comprises a tumor cell lysate, the recruitment compound comprises GM-CSF, and the activation compound comprises CpG ODN. In some cases, the rods are modified with glycolic acid or lactic acid prior to contacting the rods with one or more of the following compounds: vaccine antigen, recruitment compound, or activation compound. Optionally, the MPS composition/device is fabricated with MPS rods, an immune cell recruitment compound, and an immune cell activation compound (optionally, with glycolic or lactic acid modification), stored, and/or shipped to the site of use, whereupon the patient-specific tumor antigen preparation or lysate is added to the rod suspension prior to administration, e.g., 1, 2, 6, 12, 24, or 48 hours, prior to administration to the patient.
0015The compounds that are loaded into the MPS compostion are processed or purified. For example, polynucleotides, polypeptides, or other agents are purified and/or isolated. Specifically, as used herein, an "isolated" or "purified" nucleic acid molecule, polynucleotide, polypeptide, or protein, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. Purified compounds are at least 60% by weight (dry weight) the compound of interest. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight the compound of interest. For example, a purified compound is one that is at least 90%, 91%, 92%, 93%, 94%, 95%, 98%, 99%, or 100% (w/w) of the desired compound by weight. Purity is measured by any appropriate standard method, for example, by column chromatography, thin layer chromatography, or high-performance liquid chromatography (HPLC) analysis. A purified or isolated polynucleotide (ribonucleic acid (RNA) or deoxyribonucleic acid (DNA)) is free of the genes or sequences that flank it in its naturally-occurring state. Purified also defines a degree of sterility that is safe for administration to a human subject, <i>e.g.,</i> lacking infectious or toxic agents. In the case of tumor antigens, the antigen may be purified or a processed preparation such as a tumor cell lysate.
0016Similarly, by "substantially pure" is meant a nucleotide or polypeptide that has been separated from the components that naturally accompany it. Typically, the nucleotides and polypeptides are substantially pure when they are at least 60%, 70%, 80%, 90%, 95%, or even 99%, by weight, free from the proteins and naturally-occurring organic molecules with they are naturally associated.
0017A small molecule is a compound that is less than 2000 daltons in mass. The molecular mass of the small molecule is preferably less than 1000 daltons, more preferably less than 600 daltons, <i>e.g.</i>, the compound is less than 500 daltons, 400 daltons, 300 daltons, 200 daltons, or 100 daltons.
0018The transitional term "comprising," which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. By contrast, the transitional phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. The transitional phrase "consisting essentially of" limits the scope of a claim to the specified materials or steps "and those that do not materially affect the basic and novel characteristic(s)" of the claimed invention.
0019Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below.
BRIEF DESCRIPTION OF THE DRAWINGS
0020<ul id="ul0001" list-style="none" compact="compact"><li><figref idref="f0001">Figure 1</figref> is an SEM image of the MPS rods. The random stacking and self assembly of these rods generate a 3D space that allows for cell infiltration.</li><li><figref idref="f0001">Figure 2</figref> is a bar graph showing surface marker expression dependent on MPS rods of different lengths. 100 µg of the MPS rods of different lengths were incubated with bone marrow derived dendritic cells for 18 hour. As a marker of inflammation, the percentage of activated cells was determined by staining for cell surface receptors CD11c (DC marker), MHCII (antigen presentation marker) and CD86 (costimulatory receptor). The inflammatory property of the rods increased with increasing length. Since a desired scaffold exhibits inflammatory properties (similar to the PLG scaffold control), rods between 30 and 100 µm or 120 µm were used in subsequent experiments.</li><li><figref idref="f0002 f0003">Figure 3</figref> is a series of images showing the effect of MPS rods in a mouse. <figref idref="f0002">Figure 3A</figref> is a picture depicting a scaffold injection site excised after 7 days after mg of rhodamine labeled MPS rod was injected subcutaneously into a C57bl/6j mouse. The subcutaneous pocket indicates that the rods were localized and have self-assembled to create a 3D microenvironment. <figref idref="f0003">Figure 3B</figref> is an SEM image of the excised scaffold site demonstrating cell infiltration into the scaffold site. <figref idref="f0003">Figure 3C</figref> depicts live/dead imaging of the cells detached from the MPS scaffold, demonstrating the recruitment of living cells.</li><li><figref idref="f0004">Figure 4A</figref> is a line graph showing GM-CSP release from MPS rods. 1 µg of GM-CSP was loaded into the MPS rods and incubated in 0.1%BSA/PBS. Supernatant was collected periodically and measured for GM-CSF using ELISA (R&D). GM-CSF is being continuously released from the MPS rods. <figref idref="f0004">Figure 4B</figref> is a bar graph showing surface marker expression in an in vitro bone marrow derived dendritic cell (BMDC) co-culture with MPS. 100µg of the unmodified, amine-, thiol-, chloro- and phosphonate- modified MPS rods were incubated with 10<sup>6</sup>/ml BMDCs for 18 hours. The cells were then analyzed for the expression of MHC class-II and the costimulatory molecule CD86. An increased expression of MHCII and CD86 of the BMDCs stimulated by MPS indicates that the MPS rods arc inflammatory, and this property was modulated by surface-modifying the MPS rods.</li><li><figref idref="f0005">Figure 5A</figref> is a bar graph depicting recruitment of CDs by GM-CSF loaded MPS rods. 5 mg/mouse of MPS rods loaded with or without 1 µg/mouse GM-CSF were injected subcutaneously. Cells from the scaffold site were retrieved and stained for the CD11c receptor (DC marker). The MPS scaffold loaded with GM-CSF was capable of recruiting more DCs than the blank MPS scaffold. <figref idref="f0005">Figure 5B</figref> is a bar graph depicting surface marker expression of DCs. The MPS scaffold loaded with GM-CSF and CpG-ODN activated more DCs than without CpG-ODN.</li><li><figref idref="f0006">Figures 6A-B</figref> are bar graphs showing (<figref idref="f0006">Figure 6A</figref>) percentage of B220+ cells or (<figref idref="f0006">Figure 6B</figref>) total number of B220+ cells at the scaffold site. 5 mg/mouse of MPS rods loaded with or without 1 µg/mouse GM-CSF, 100 µg CpG-ODN and 130 µg ovalbumin were injected subcutaneously. Cells from the scaffold site were retrieved periodically and stained for the B220 receptor (B cell marker). The MPS scaffold loaded with GM-CSF, CpG-ODN and Ova was capable of recruiting more B cells by day 3.</li><li><figref idref="f0007 f0008">Figures 7A-C</figref> are flow cytometry scatterplots (<figref idref="f0007">Figure 7A</figref>) and bar graphs (<figref idref="f0008">Figures 7B-C</figref>) depicting the presence of the MHC-I-SIINFEKL (SEQ ID NO:1) marker on the surface of DCs. The MPS scaffold loaded with GM-CSF, CpG-ODN and the model antigen ovalbumin induced the expansion of antigen specific DCs homed to the draining lymph node (dLN). dLN cells are stained with the dendritic marker CD11c and the marker MHC-1-SIINFEKL, which indicates that a part of the ovalbumin protein, the peptide sequence SIINFEKL, is being presented on the surface of the cell in the MHC-I complex.</li><li><figref idref="f0009">Figures 8A-B</figref> are bar graphs showing formation of the germinal center due to the MPS scaffold. The MPS scaffold loaded with GM-CSF, CpG-ODN and the model antigen ovalbumin was able to induce the germinal center, home to activated and antigen primed B cells, in the dLN. The dLN cells are stained with B220 (B cell marker) and GL7 (germinal center marker) to investigate the formation of the germinal center, which hosts only B cells that are activated and in the process of somatic hypermutation and isotype switching.</li><li><figref idref="f0010">Figures 9A-B</figref> are bar graphs depicting that the MPS scaffold loaded with GM-CSF, CpG-ODN and the model antigen ovalbumin was able to induce the expansion of CD8<sup>+</sup> cytotoxic T lymphocytes (CTLs) that can specifically recognize the model antigen. Splenocytes were stained for CD8 (killer T cell marker) and with a MHCI-tetramer-SIINFEKL antibody, which indicates whether a T cell is able to recognize a specific antigen presented on the MHCI complex.</li><li><figref idref="f0011">Figures 10A-C</figref> are histograms showing that the MPS scaffold loaded with GM-CSF, CpG-ODN and the model antigen ovalbumin was able to induce the clonal expansion of antigen specific CD8+ CTLs in the dLN and the spleen. Injected splenocytes from the OT-I mouse were stained the cell tracker dye CFSE, whose fluorescence halves every time a cell divides. The lower fluorescence in the CFSF stained splenocytes in the spleen and the dLN in the fully loaded vaccine group indicates ova-specific CTL proliferation.</li><li><figref idref="f0012">Figures 11 A-C</figref> are histograms showing that the MPS scaffold loaded with GM-CSF, CpG-ODN and the model antigen ovalbumin was able to induce the clonal expansion of antigen specific CD4+ THs in the dLN and the spleen. Injected splenocytes from the OT-II mouse were stained the cell tracker dye CFSE, whose fluorescence halves every time a cell divides. The lower fluorescence in the CFSE stained splenocytes in the spleen and the dLN in the fully loaded vaccine group and the MPS loaded with only the antigen group indicates ova-specific CD4+ TH cell proliferation.</li><li><figref idref="f0013">Figures 12 A-B</figref> are histograms showing that antibody titer is defined as the degree to which the antibody-serum solution can be diluted and still contain a detectable amount of the antibody. The anti-ovalbumin serum antibodies were titrated. The MPS scaffold loaded with GM-CSF, CpG-ODN and ova elicited a strong and durable TH1 and TH2 antibody response. MPS loaded with OVA alone can elicit a strong TH2 response, indicating the adjuvant potential of the MPS material itself.</li><li><figref idref="f0014">Figures 13 A- B</figref> are line graphs showing that GM-CSF is released from the MPS microparticles in a controlled and sustained manner. A) 1µg of GM-CSF was loaded into 5mg of MPS rods and incubated in 0.1%BSA/PBS. Supernatant was collected periodically and measured for GM-CSF using ELISA (R&D). GM-CSF was continuously released from the MPS rods, although in small quantities. B) 1µg of GM-CSF was loaded into 5mg of MPS containing OVA and CpG. It was then injected subcutaneously into C57BL/6j mice. At various time points, the tissue surrounding the injected particle scaffold was harvested and analyzed for GM-CSF level. The level of GM-CSF was maintained throughout a week.</li><li><figref idref="f0015 f0016">Figures 14 A-B</figref> are photographs, and <figref idref="f0016">Figure 14C</figref> is a bar graph. Higher aspect ratio MPS microparticles recruit more cells. <figref idref="f0015">Figure 14A</figref> shows SEM images of MPS microparticles either between 10µm and 20 µm or between 80µm and 120µm in length. The longer rods resulted in a composition with greater area of space between the rods. <figref idref="f0016">Figure 14B</figref> shows MPS compositions that was harvested from mice. 5µg of MPS microparticles were injected subcutaneously into mice, and the scaffold site was harvested on day 7 post injection. <figref idref="f0016">Figure 14 C</figref> is a bar graph showing enumeration of cells that were isolated from the scaffold. MPS microparticles of higher aspect ratio recruited more cells.</li><li><figref idref="f0017">Figures 15 A- B</figref> are bar graphs. Dendritic cells (DCs) are recruited to the MPS microparticle as a response to GM-CSF. MPS microparticles were loaded with GM-CSF (0ng, 500ng, 1000ng, 3000ng) and injected subcutaneously into mice. On day 7 post injection, the scaffold was harvested and analyzed using flow cytometry. <figref idref="f0017">Figure 15A</figref> shows that recruited CD11c+ CD11b+ DCs increases with increasing GM-CSF dose. <figref idref="f0017">Fig. 15B</figref> shows that recruited mature CD11c+ MHCII+ DCs also DCs increases with increasing GM-CSF dose.</li><li><figref idref="f0018">Figure 16</figref> is a bar graph showing that GM-CSF increases recruited DC trafficking to the draining LN. MPS microparticles were loaded with Alexa 647 labeled ovalbumin (OVA), or Alexa 647 labeled OVA with 1µg GM-CSF, and injected subcutaneously into mice. On day 7 post injection, the draining lymph node (dLN) was harvested and analyzed using flow cytometry. With the addition of antigen (OVA), there is a modest increase of Alexa 647+ CD11c+ DCs that have trafficked to the scaffold and up-taken the OVA. However, the addition of GM-CSF drastically increases DC trafficking from the scaffold to the dLN.</li><li><figref idref="f0019">Figures 17 A-C</figref> are scatterplots and <figref idref="f0020">Figure 17D</figref> is a bar graph. Local delivery of CpG-ODN from the MPS microparticle scaffold increases circulation of activated DCs. MPS microparticles were loaded with 1µg of GM-CSF, 300ug of OVA and 100µg of CpG-ODN. They were then injected subcutaneously into mice. The dLNs were harvested and analyzed after 7 days post injection. LN cells were stained with CD11c and CD86. The addition of CpG-ODN, which is locally released from the MPS scaffold, further increases the percentage and number of activated, mature DCs in the dLN.</li><li><figref idref="f0021">Figures 18 A-C</figref> are photographs and <figref idref="f0022">Figure 18 D</figref> is a bar graph. Proteins are released from the MPS microparticle scaffold in a controlled and sustained manner. Alexa 647 labeled ovalbumin was injected subcutaneously into the flank of a mouse either in a buffer solution or loaded onto the MPS microparticles. Relative fluorescence was measured using the IVIS at various time points. If injected in a buffer solution, the protein diffuses away from the injection site in less than 1 day. However, if loaded onto the MPS microparticles, the protein is released from the local scaffold site in a sustained manner, e.g., over the course of a week (2, 3, 4, 5, 7 or more days).</li><li><figref idref="f0023">Figures 19 A-B</figref> are line graphs showing antibody titers. Antibody titer is defined as the degree to which the antibody-serum solution can be diluted and still contain a detectable amount of the antibody. Mice were vaccinated with 300pg OVA, 100µg CpG-ODN and lpg GM-CSF in the soluble form or loaded in 5mg of MPS microparticles. The anti-ovalbumin serum antibodies are titrated. The MPS scaffold loaded with GM-CSF, CpG-ODN and ova can elicit a strong and durable TH1 and TH2 antibody response, as indicated by a high titer of the IgG2a and IgG1 antibody, respectively. More impressively, this response is evident beyond 200 days after vaccination with a single injection. This response was compared to OVA delivered using aluminum hydroxide, the only adjuvant approved for human use in the US. While the MPS vaccine is capable of inducing both TH1 and TH2 antibody responses, due to its capability to load small cytokines, proteins and DNAs, the response induced by alum is completely TH2 biased. The MPS vaccine is very versatile and is readily fine tuned and controlled to induce specific immune responses.</li><li><figref idref="f0024 f0025">Figures 20 A-D</figref> are scatterplots showing that vaccination with the MPS vaccine induces the expansion of T follicular helper cells. OT-II splenocytes were stained with CFSE and adoptively transferred into Thy1.1+ recipient mice. The recipient mice were then vaccinated with MPS and lysozyme, MPS and OVA, and the full form of the vaccine containing GM-CSF and CpG. Three days after vaccination, dLN were harvested and the adoptively transferred cells were analyzed. It is shown here that mice that were vaccinated with MPS and ova, and the full form of the vaccine, generated a strong population of follicular T helper cells, which are the cells directly responsible for "helping" B cells to differentiate and mature into full, functional antigen specific antibody secreting plasma cells.</li><li><figref idref="f0026">Figures 21 A-D</figref> are line graphs showing that vaccination with the MPS vaccine induces the clonal expansion of CD4+ T helper cells. OT-II splenocytes were stained with CFSE and adoptively transferred into Thy1.1+ recipient mice. The recipient mice were then vaccinated with MPS and lysozyme, MPS and OVA, and the full form of the vaccine containing GM-CSF and CpG. Three days after vaccination, dLN were harvested and the adoptively transferred cells were analyzed. It is shown here that both MPS and OVA, and the full vaccine, induced strong clonal expansion of the CD4+ T helper cells, indicating a systemic antigen specific response.</li><li><figref idref="f0027">Figure 22 A-B</figref> are line graphs showing that glycolic acid and lactic acid modification of the MPS microparticles aids the release of bioactive GM-CSF. 1µg of GM-CSF was loaded into 5mg of glycolic acid or lactic acid modified MPS rods and incubated in 0.1%BSA/PBS. Supernatant was collected periodically and measured for GM-CSF using ELISA (R&D). Compared to GM-CSF released from unmodified MPS microparticles, glycolic acid and lactic acid modification increasecumulative release of bioactive GM-CSF by more than 20 fold.</li><li><figref idref="f0028">Figures 23 A-D</figref> are scatterplots showing that glycolic acid modified MPS increases the percentage of recruited DCs and mature DCs. 5mg of unmodified or glycolic acid modified MPS microparticles were loaded with 1µg of GM-CSF for 1 hour at 37C, and injected subcutaneously into mice. The scaffold was harvested at day 7 and analyzed. It is evident here that the modified MPS almost doubles the percentage of recruited CD1 lc+ CD11b+ DCs, and more drastically increases the percentage of CD11c+ CD86+ mature DCs. These results indicate that the great surface modification potential of the MPS microparticles permit further manipulation of the phenotype of recruited cells to induce more potent immune responses.</li></ul>
DETAILED DESCRIPTION
0021Injectable MPS-based micro-rods randomly self-assemble to form 3D scaffold <i>in vivo.</i> This system is designed such that it releases a cytokine to recruit and transiently house immune cells, present them with an antigen, and activate them with a danger signal. After recruitment and temporary housing or presence of the cells in the structure, these immune cells migrate out of the device structure and homed to a lymph node. Thus, the composition is one in which cells traffic/circulate in and out of, their status of immune activation being altered/modulated as a result of the trafficking through the device..
0022A markedly expanded population of antigen specific dendritic cells was found in the lymph node as well as the formation of the germinal center, which is aided by the involvement of follicular T helper cells in the lymph node as a result of the administration of the device. A population of antigen-recognizing CD8+ CTLs in the spleen was also found to be significantly enhanced. The system also induces the clonal expansion of both antigen specific CD4 and CD8 T cells. In addition to the significant amplification of the cellular immune response, a high and durable antibody production and a balanced T<sub>H</sub>1/T<sub>H</sub>2 response was detected.
0023Key elements of the injectable mesoporous silica micro-rod based scaffold system for modulating immune cell trafficking and reprogramming include: <ul id="ul0002" list-style="bullet" compact="compact"><li>Aspect ratio of the MPS micro rods (10 nm cross sectional area by 100 micron length) prevents their uptake and therefore allows for local formation of a 3D structure.</li><li>8 nm pore size allows for adsorption of small molecules that can be delivered via diffusion in a controlled and continuous manner.</li><li>High surface area to volume ratio allows for the control of the loading of various cytokines, danger signal and antigen.</li><li>Inflammatory property of the MPS micro rods promotes immune cell recruitment without the need of other inflammatory cytokines.</li><li>Versatility in ability of surface chemical modification of the MPS rods that modulate properties of the rods and ways that proteins are bound to the rods.</li><li>Controlled release of GM-CSF can modulate the trafficking of immune cells to the site of the scaffold.</li><li>Controlled release of CpG-ODN activates the recruited dendritic cells.</li><li>Anchored protein antigens are taken up by the recruited immune cells at the site of the scaffold.</li></ul>
0024A pore size of approximately 5-10, e.g., 8 nm, was found to be optimal for loading efficiency for small molecules as well as larger proteins, e.g., GM-CSF (which molecule is about 3 nm in diameter).
0025Upon subcutaneous injection of the micro rods suspended in a buffer, the rods randomly stack into a 3D structure; the ends of the rods form physical contact with each other, and a micro space is formed between the contacts.
MPS
0026Mesoporous silica nanoparticles are synthesized by reacting tetraethyl orthosilicate with a template made of micellar rods. The result is a collection of nano-sized spheres or rods that are filled with a regular arrangement of pores. The template can then be removed by washing with a solvent adjusted to the proper pH. In another technique, the mesoporous particle could be synthesized using a simple sol-gel method or a spray drying method. Tetraethyl orthosilicate is also used with an additional polymer monomer (as a template). Other methods include those described in <patcit id="pcit0003" dnum="US20120264599A"><text>U.S. Patent Publications 20120264599 </text></patcit>and <patcit id="pcit0004" dnum="US20120256336A"><text>20120256336</text></patcit>.
Granulocyte Macrophage Colony Stimulating Factor (GM-CSF)
0027Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a protein secreted by macrophages, T cells, mast cells, endothelial cells and fibroblasts. Specifically, GM-CSF is a cytokine that functions as a white blood cell growth factor. GM-CSF stimulates stem cells to produce granulocytes and monocytes. Monocytes exit the blood stream, migrate into tissue, and subsequently mature into macrophages.
0028Scaffold devices described herein comprise and release GM-CSF polypeptides to attract host DCs to the device. Contemplated GM-CSF polypeptides are isolated from endogenous sources or synthesized <i>in vivo</i> or <i>in vitro.</i> Endogenous GM-CSF polypeptides are isolated from healthy human tissue. Synthetic GM-CSF polypeptides are synthesized in vivo following transfection or transformation of template DNA into a host organism or cell, e.g. a mammal or cultured human cell line. Alternatively, synthetic GM-CSF polypeptides are synthesized <i>in vitro</i> by polymerase chain reaction (PCR) or other art-recognized methods <nplcit id="ncit0003" npl-type="b"><text>Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY, Vol. 1, 2, 3 (1989</text></nplcit>).
0029GM-CSF polypeptides are modified to increase protein stability in vivo. Alternatively, GM-CSF polypeptides are engineered to be more or less immunogenic. Endogenous mature human GM-CSF polypeptides are glycosylated, reportedly, at amino acid residues 23 (leucine), 27 (asparagine), and 39 (glutamic acid) (see <patcit id="pcit0005" dnum="US5073627A"><text>US Patent No. 5,073,627</text></patcit>). GM-CSF polypeptides of the present invention are modified at one or more of these amino acid residues with respect to glycosylation state.
0030GM-CSF polypeptides are recombinant. Alternatively GM-CSF polypeptides are humanized derivatives of mammalian GM-CSF polypeptides. Exemplary mammalian species from which GM-CSF polypeptides are derived include, but are not limited to, mouse, rat, hamster, guinea pig, ferret, cat, dog, monkey, or primate. In a preferred embodiment, GM-CSF is a recombinant human protein (PeproTech, Catalog # 300-03). Alternatively, GM-CSF is a recombinant murine (mouse) protein (PeproTech, Catalog #315-03) . Finally, GM-CSF is a humanized derivative of a recombinant mouse protein.
0031Human Recombinant GM-CSF (PeproTech, Catalog # 300-03) is encoded by the following polypeptide sequence (SEQ ID NO:2): <img file="EP3662896B1_D0001.tif" />
0032Murine Recombinant GM-CSF (PeproTech, Catalog # 315-03) is encoded by the following polypeptide sequence (SEQ ID NO: 3): <img file="EP3662896B1_D0002.tif" />
0033Human Endogenous GM-CSF is encoded by the following mRNA sequence (NCBI Accession No. NM_000758 and SEQ ID NO: 4): <img file="EP3662896B1_D0003.tif" />
0034Human Endogenous GM-CSF is encoded by the following amino acid sequence (NCBI Accession No. NP_000749.2 and SEQ ID NO: 5): <img file="EP3662896B1_D0004.tif" />
Cytosine-Guanosine (CpG) Oligonucleotide (CpG-ODN) Sequences
0035CpG sites are regions of deoxyribonucleic acid (DNA) where a cysteine nucleotide occurs next to a guanine nucleotide in the linear sequence of bases along its length (the "p" represents the phosphate linkage between them and distinguishes them from a cytosine-guanine complementary base pairing). CpG sites play a pivotal role in DNA methylation, which is one of several endogenous mechanisms cells use to silence gene expression. Methylation of CpG sites within promoter elements can lead to gene silencing. In the case of cancer, it is known that tumor suppressor genes are often silenced while oncogenes, or cancer-inducing genes, are expressed. CpG sites in the promoter regions of tumor suppressor genes (which prevent cancer formation) have been shown to be methylated while CpG sites in the promoter regions of oncogenes are hypomethylated or unmethylated in certain cancers. The TLR-9 receptor binds unmethylated CpG sites in DNA.
0036The vaccine composition described herein comprises CpG oligonucleotides. CpG oligonucleotides are isolated from endogenous sources or synthesized in vivo or in vitro. Exemplary sources of endogenous CpG oligonucleotides include, but are not limited to, microorganisms, bacteria, fungi, protozoa, viruses, molds, or parasites. Alternatively, endogenous CpG oligonucleotides are isolated from mammalian benign or malignant neoplastic tumors. Synthetic CpG oligonucleotides are synthesized in vivo following transfection or transformation of template DNA into a host organism. Alternatively, Synthetic CpG oligonucleotides are synthesized in vitro by polymerase chain reaction (PCR) or other art-recognized methods (<nplcit id="ncit0004" npl-type="b"><text>Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY, Vol. 1, 2, 3 (1989</text></nplcit>)).
0037CpG oligonucleotides are presented for cellular uptake by dendritic cells. For example, naked CpG oligonucleotides are used. The term "naked" is used to describe an isolated endogenous or synthetic polynucleotide (or oligonucleotide) that is free of additional substituents. In another embodiment, CpG oligonucleotides are bound to one or more compounds to increase the efficiency of cellular uptake. Alternatively, or in addition, CpG oligonucleotides are bound to one or more compounds to increase the stability of the oligonucleotide within the scaffold and/or dendritic cell. CpG oligonucleotides are optionally condensed prior to cellular uptake. For example, CpG oligonucleotides are condensed using polyethylimine (PEI), a cationic polymer that increases the efficiency of cellular uptake into dendritic cells.
0038CpG oligonucleotides can be divided into multiple classes. For example, exemplary CpG-ODNs encompassed by compositions, methods and devices of the present invention are stimulatory, neutral, or suppressive. The term "stimulatory" describes a class of CpG-ODN sequences that activate TLR9. The term "neutral" describes a class of CpG-ODN sequences that do not activate TLR9. The term "suppressive" describes a class of CpG-ODN sequences that inhibit TLR9. The term "activate TLR9" describes a process by which TLR9 initiates intracellular signaling.
0039Stimulatory CpG-ODNs can further be divided into three types A, B and C, which differ in their immune-stimulatory activities. Type A stimulatory CpG ODNs are characterized by a phosphodiester central CpCi-containing palindromic motif and a phosphorothioate 3' poly-G string. Following activation of TLR9, these CpG ODNs induce high IFN-α production from plasmacytoid dendritic cells (pDC). Type A CpG ODNs weakly stimulate TLR9-dependent NF-κB signaling.
0040Type B stimulatory CpG ODNs contain a full phosphorothioate backbone with one or more CpG dinucleotides. Following TLR9 activation, these CpG-ODNs strongly activate B cells. In contrast to Type A CpG-ODNs, Type B CpG-ODNS weakly stimulate IFN-α secretion.
0041Type C stimulatory CpG ODNs comprise features of Types A and B. Type C CpG-ODNs contain a complete phosphorothioate backbone and a CpG containing palindromic motif. Similar to Type A CpG ODNs, Type C CpG ODNs induce strong IFN-α production from pDC. Simlar to Type B CpG ODNs, Type C CpG ODNs induce strong B cell stimulation.
0042Exemplary stimulatory CpG ODNs comprise, but are not limited to, ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2006-G5, ODN 2216, ODN 2336, ODN 2395, ODN M362 (all InvivoGen). The present invention also encompasses any humanized version of the preceding CpG ODNs. In one preferred embodiment, compositions, methods, and devices of the present invention comprise ODN 1826 (the sequence of which from 5' to 3' is tccatgacgttcctgacgtt, wherein CpG elements are bolded, SEQ ID NO: 6).
0043Neutral, or control, CpG ODNs that do not stimulate TLR9 are encompassed by the present invention. These ODNs comprise the same sequence as their stimulatory counterparts but contain CpC dinucleotides in place of CpG dinucleotides.
0044Exemplary neutral, or control, CpG ODNs encompassed by the present invention comprise, but are not limited to, ODN 1585 control, ODN 1668 control, ODN 1826 control, ODN 2006 control, ODN 2216 control, ODN 2336 control, ODN 2395 control, ODN M362 control (all InvivoGen). The present invention also encompasses any humanized version of the preceding CpG ODNs.
Antigens
0045Compositions, methods, and devices described herein comprise tumor antigens or other antigens. Antigens elicit protective immunity or generate a therapeutic immune response in a subject to whom such a device was administered. Preferred tumor antigens are tumor cell lysates (see, e.g., <nplcit id="ncit0005" npl-type="s"><text>Ali et. Al., 2009, Nature Materials 8, 151 - 158</text></nplcit>; hereby incorporated by reference). For example, a whole tumor or tumor biopsy sample is extracted from a human patient (or non-human animal), and digested using collagenase to degrade the extra cellular matrix. Then the tumor cells then undergo three cycles of the freeze thaw process, in which the cells are frozen in liquid N<sub>2</sub> and then thawed in a water bath. This process generates the tumor antigens, which are then loaded onto the MPS particles at the same time with GM-CSF and CpG ODN. For example, a vaccine dose of tumor cell lysate antigen is the amount obtained from 1 × 10<sup>6</sup> tumor cells. After fabrication of the MPS particles, the particles are suspended in a physiologically accepted buffer, e.g., PBS, and the recruitment compound (e.g., GM-CSF), activating compound (e.g., CpG), and antigen added to the suspension of rods. The mixture is shaken at room temperature overnight and then lyophilized for about 4 hours. Prior to administration, the rods are again suspended in buffer and the suspension loaded into a 1 ml syringe (18 gauge needle). A typical vaccine dose is 150 µl of the mixture per injection.
0046Exemplary cancer antigens encompassed by the compositions, methods, and devices of the present invention include, but are not limited to, tumor lysates extracted from biopsies, irradiated tumor cells, MAGE series of antigens (MAGE-1 is an example), MART-1/melana, tyrosinase, ganglioside, gp100, GD-2, O-acetylated GD-3, GM-2, MUC-1, Sos1, Protein kinase C-binding protein, Reverse transcriptase protein, AKAP protein, VRK1, KIAA1735, T7-1, T11-3, T11-9, Homo Sapiens telomerase ferment (hTRT), Cytokeratin-19 (CYFRA21-1), SQUAMOUS CELL CARCINOMA ANTIGEN 1 (SCCA-1), (PROTEIN T4-A), SQUAMOUS CELL CARCINOMA ANTIGEN 2 (SCCA-2), Ovarian carcinoma antigen CA125 (1A1-3B) (KIAA0049), MUCIN 1 (TUMOR-ASSOCIATED MUCIN), (CARCINOMA-ASSOCIATED MUCIN), (POLYMORPHIC EPITHELIAL MUCIN),(PEM),(PEMT),(EPISIALIN), (TIJMOR-ASSOCIATED EPITHELIAL MEMBRANE ANTIGEN),(EMA),(H23AG), (PEANUT-REACTIVE URINARY MUCIN), (PUM), (BREAST CARCINOMA- ASSOCIATED ANTIGEN DF3), CTCL tumor antigen se1-1, CTCL tumor antigen se14-3, CTCL tumor antigen se20-4, CTCL tumor antigen se20-9, CTCL tumor antigen se33-1, CTCL tumor antigen se37-2, CTCL tumor antigen se57-1, CTCL tumor antigen se89-1, Prostate-specific membrane antigen, 5T4 oncofetal trophoblast glycoprotein, Orf73 Kaposi's sarcoma-associated herpesvirus, MAGE-C1 (cancer/testis antigen CT7), MAGE-B1 ANTIGEN (MAGE-XP ANTIGEN) (DAM10), MAGE-B2 ANTIGEN (DAM6), MAGE-2 ANTIGEN, MAGE-4a antigen, MAGE-4b antigen, Colon cancer antigen NY-CO-45, Lung cancer antigen NY-LU-12 variant A, Cancer associated surface antigen, Adenocarcinoma antigen ART1, Paraneoplastic associated brain-testis-cancer antigen (onconeuronal antigen MA2; paraneoplastic neuronal antigen), Neuro-oncological ventral antigen 2 (NOVA2), Hepatocellular carcinoma antigen gene 520, TUMOR-ASSOCIATED ANTIGEN CO-029, Tumor-associated antigen MAGE-X2, Synovial sarcoma, X breakpoint 2, Squamous cell carcinoma antigen recognized by T cell, Serologically defined colon cancer antigen 1, Serologically defined breast cancer antigen NY-BR-15, Serologically defined breast cancer antigen NY-BR-16, Chromogranin A; parathyroid secretory protein 1, DUPAN-2, CA 19-9, CA 72-4, CA 195, Carcinoembryonic antigen (CEA). Purified tumor antigens are used alone or in combination with one another.
0047The system is also useful to generate an immune response to other antigens such as microbial pathogens (e.g., bacteria, viruses, fungi).
0048The following materials and methods were used to generate the data described herein.
MPS scaffold fabrication
0049The Pluronic P-123 (Sigma-Aldrich) surfactant was dissolved in 1.6M HCl at room temperature, and heated 40 degrees C. 42 mmol of Tetraethyl orthosilicate (TEOS) (Sigma-Aldrich) was added and heated for 20 hours at 40 degrees C under stirring (600 rpm). The composition was then heated to 100 degrees C for 24 hours. The rod particles were collected by filtration and air dried at room temperature. The particles were extracted in ethanol/HCl (5 parts HCl to 500 parts EtOH) overnight at 80 degrees C. Alternatively, the particles were calcined at 550 degrees C for 4 hours in 100% ethanol. The MPS composition may be stored and shipped for use before or after adding recruitment and/or activation compounds and before or after adding antigen. For example, if antigen is a tumor cells lysate made from a biopsy sample taken from a patient, it may be processed and added to MPS particles shortly before administration to the patient.
0050For full vaccine composition, 1 µg/mouse GM-CSF, 100 µg/mouse CpG-ODN and 130 µg/mouse of the ovalbumin protein were incubated with 5 mg/mouse MPS in dH<sub>2</sub>O for 12 hours, lyophilized for 12 hours, resuspended in 150 µl/mouse PBS and injected subcutaneously using a 18G needle.
0051To determine the release kinetics of GM-CSF, and CpG-ODN from the MPS rods, radioactive I-labeled recombinant human GM-CSF was used as a tracer, and standard release studies were carried out. Similarly, the amount of CpG-ODN released into PBS was determined by the absorbance readings using a Nanodrop instrument (ND1000, Nanodrop Technologies).
Modification of MPS microparticles
0052Standard 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) chemistry is used to activate a carboxylic acid on glycolic acid or lactic acid. The MPS particles are amine modified using amine propyl silane. The two components are then mixed together at room temperature overnight to react. The particles are then allowed to air dry. The resulting glycolic acid and/or lactic acid modified particles are then contacted with GM-CSF or other compounds as described above.
<i>In vitro</i> DC activation assay
0053Murine Dendritic Cells (DCs) were differentiated from the bone marrow cells using 20 ng/ml GM-CSF. Differentiated DCs, at 10<sup>6</sup>/ml, were incubated with 100 ug/ml of the MPS particles for 18 hours, and analyzed for the expression of CD11c (ebiosciences, San Diego, CA), CD86 (ebiosciences, San Diego, CA) and MHC class-II (ebiosciences, San Diego, CA) using flow cytometry.
Analysis of DC recruitment to MPS scaffold and emigration to lymph nodes
0054The MPS scaffold was retrieved from the animal and digested by mechanically separating the cells from the rods. APC conjugated CD11c (dendritic cell marker), FITC conjugated MHC class-II, and PE conjugated CD86 (B7, costimulatory molecule) stains were used for DC and leukocyte recruitment analysis. Cells were gated according to positive fluorescein isothiocyanate (FITC), Allophycocyanin (APC) and phycoerythrin (PE) using isotype controls, and the percentage of cells staining positive for each surface antigen was recorded.
0055To determine the presence of antigen specific DCs in the lymph nodes, the draining lymph node (dLN) was harvested and analyzed using APC conjugated CD11c and PE conjugated SIINFEKL-MHC class-I (ebiosciences, San Diego, CA).
Analysis of antigen specific CD8+ spleen T cells
0056The spleen was harvested and digested. After lysing the red blood cells, the splenocytes were analyzed using PE-CY7 conjugated CD3 (ebiosciences, San Diego, CA), APC conjugated CD8 (ebiosciences, San Diego, CA) and the PE conjugated SIINFEKL (SEQ ID NO: 1) MHC class-I tetramer (Beckman Coulter). SIINFEKL is an ovalbumin derived peptide [OVA(257-264)].
Analysis of CD4+ or CD8+ T cell clonal expansion
0057The spleens from the OT-II (for CD4) or OT-I (for CD8) transgenic C57bl/6 mice (Jackson Laboratories) were harvested, digested, pooled and stained with the cell tracer Carboxyfluorescein succinimidyl ester (CFSE). 20×10<sup>6</sup> stained splenocytes/mouse were IV injected into the C57bl/6 (Jackson Laboratories) mice two days post immunization. The dLNs and spleens were retrieved after four days post IV injection and analyzed using PE conjugated CD8 or CD4 marker.
Characterization of anti-OVA humoral response
0058Blood sera were analyzed for IgGl, and IgG2a antibodies by ELISA using ovalbumin-coated plates. Antibody titration was defined as the lowest serum dilution at which the ELISA OD reading is >0.3 (blank).
Contents6
32 sheets
Sheet 1 Sheet 2 Sheet 3 Sheet 4 Sheet 5 Sheet 6 Sheet 7 Sheet 8 Sheet 9 Sheet 10 Sheet 11 Sheet 12 Sheet 13 Sheet 14 Sheet 15 Sheet 16 Sheet 17 Sheet 18 Sheet 19 Sheet 20 Sheet 21 Sheet 22 Sheet 23 Sheet 24 Sheet 25 Sheet 26 Sheet 27 Sheet 28 Sheet 29 Sheet 30 Sheet 31 Sheet 32
Every citation, both ways
| Document | Relation | Office | Cited during |
|---|---|---|---|
| WO2007030901A1 | Cites | World Intellectual Property Organization (WIPO) | – |
| WO2011130753A2 | Cites | World Intellectual Property Organization (WIPO) | – |
| MERAZ, I.M. ET AL.: "Mesoporous Silicon Particles for the Presentation of Tumor Antigens and Adjuvant for Anti-Cancer Immunity.", CANCER RESEARCH, vol. 71, no. 24 Supplement, P1-01-12, 15 December 2011 (2011-12-15), XP002698593, | Non-patent | – | – |
| CHAO MAN-CHIEN ET AL: "Morphological control on SBA-15 mesoporous silicas via a slow self-assembling rate", JOURNAL OF MATERIALS SCIENCE, KLUWER ACADEMIC PUBLISHERS, DORDRECHT, vol. 44, no. 24, 1 December 2009 (2009-12-01), pages 6453-6462, XP036666562, ISSN: 0022-2461, DOI: 10.1007/S10853-009-3610-9 [retrieved on 2009-12-01] | Non-patent | – | – |
| CARVALHO L V ET AL: "Immunological parameters related to the adjuvant effect of the ordered mesoporous silica SBA-15", VACCINE, ELSEVIER, AMSTERDAM, NL, vol. 28, no. 50, 23 November 2010 (2010-11-23), pages 7829-7836, XP027509021, ISSN: 0264-410X, DOI: 10.1016/J.VACCINE.2010.09.087 [retrieved on 2010-11-19] | Non-patent | – | – |
| CARVALHO L V ET AL: "Immunological parameters related to the adjuvant effect of the ordered mesoporous silica SBA-15", VACCINE, ELSEVIER, AMSTERDAM, NL, vol. 28, no. 50, 23 November 2010 (2010-11-23), pages 7829 - 7836, XP027509021, ISSN: 0264-410X, [retrieved on 20101119], DOI: 10.1016/J.VACCINE.2010.09.087 | Non-patent | – | Examiner |
39 members in 17 offices
Members39
| Document | Office | Kind | |
|---|---|---|---|
| CA2870309A1 | Canada | A1 | |
| WO2013158673A1 | World Intellectual Property Organization (WIPO) | A1 | |
| AU2013249366A1 | Australia | A1 | |
| CN104244929A | China | A | |
| EP2838515A1 | European Patent Office (EPO) | A1 | |
| US2015072009A1 | United States of America | A1 | |
| JP2015516398A | Japan | A | |
| HK1207320A1 | Hong Kong, China | A1 | |
| CN104244929B | China | B | |
| CN107137357A | China | A | |
| JP6199957B2 | Japan | B2 | |
| AU2013249366B2 | Australia | B2 | |
| JP2018048116A | Japan | A | |
| US9937249B2 | United States of America | B2 | |
| AU2018202973A1 | Australia | A1 | |
| US2018344821A1 | United States of America | A1 | |
| JP2019006831A | Japan | A | |
| JP6500061B2 | Japan | B2 | |
| EP2838515B1 | European Patent Office (EPO) | B1 | |
| DK2838515T3 | Denmark | T3 | |
| PT2838515T | Portugal | T | |
| LT2838515T | Lithuania | T | |
| HUE047973T2 | Hungary | T2 | |
| AU2018202973B2 | Australia | B2 | |
| EP3662896A1 | European Patent Office (EPO) | A1 | |
| PL2838515T3 | Poland | T3 | |
| ES2773895T3 | Spain | T3 | |
| SI2838515T1 | Slovenia | T1 | |
| HRP20200239T1 | Croatia | T1 | |
| JP2020172542A | Japan | A | |
| CN107137357B | China | B | |
| JP6800195B2 | Japan | B2 | |
| CY1122699T1 | Cyprus | T1 | |
| US11278604B2 | United States of America | B2 | |
| JP7092393B2 | Japan | B2 | |
| JP2022111336A | Japan | A | |
| US2023000961A1 | United States of America | A1 | |
| CA2870309C | Canada | C | |
| EP3662896B1This record | European Patent Office (EPO) | B1 |
97 legal events, as 10 offices reported them to INPADOC
Over the term
Point at a mark for the eventEvents
| Event | Code | Office | |
|---|---|---|---|
| Full renewal or maintenance fee paidST27 STATUS EVENT CODE: U-0-0-U10-U11 (AS PROVIDED BY THE NATIONAL OFFICE)U11 | U11 | CH | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Annual fee paid to national office [announced via postgrant information from national office to epo]GrantedPGFP | PGFP | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| No opposition filedOpposition26N | 26N | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| No opposition filed within time limitOppositionORIGINAL CODE: 0009261PLBE | PLBE | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: NO OPPOSITION FILED WITHIN TIME LIMITSTAA | STAA | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed because of non-payment of the annual feeLapsedMM | MM | BE | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| No opposition filed against granted patent, or epo opposition proceedings concluded without decisionGrantedR097 | R097 | DE | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Change of representativeR082 | R082 | DE | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Deletion acc. to par. 5 (withdrawal of the translation of the ep patent)MK05 | MK05 | AT | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Patent invalid in the netherlands as no translation has been filedMP | MP | NL | |
| Lapsed in a contracting state [announced via postgrant information from national office to epo]LapsedPG25 | PG25 | EP | |
| Invalidation of extension of european patentsMG9D | MG9D | LT | |
| European patents granted designating irelandGrantedFG4D | FG4D | IE | |
| Dpma publication of mentioned ep patent grantGrantedR096 | R096 | DE | |
| European patent takes effect as a national patent in ch/liEP | EP | CH | |
| Divisional application: reference to earlier applicationAC | AC | EP | |
| Designated contracting statesAK | AK | EP | |
| European patent grantedGrantedFG4D | FG4D | GB | |
| Opt-out of the competence of the unified patent court (upc) registeredP01 | P01 | EP | |
| (expected) grantORIGINAL CODE: 0009210GRAA | GRAA | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: THE PATENT HAS BEEN GRANTEDSTAA | STAA | EP | |
| Grant fee paidORIGINAL CODE: EPIDOSNIGR3GRAS | GRAS | EP | |
| Intention to grant announcedINTG | INTG | EP | |
| Despatch of communication of intention to grant a patentORIGINAL CODE: EPIDOSNIGR1GRAP | GRAP | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: GRANT OF PATENT IS INTENDEDSTAA | STAA | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Information provided on ipc code assigned before grantRIC1 | RIC1 | EP | |
| Amendment of ipc main classPREVIOUS MAIN CLASS: A61K0009160000R079 | R079 | DE | |
| Amendment of ipc main classPREVIOUS MAIN CLASS: A61K0009160000R079 | R079 | DE | |
| First examination report despatched17Q | 17Q | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: EXAMINATION IS IN PROGRESSSTAA | STAA | EP | |
| Request for examination filed17P | 17P | EP | |
| Designated contracting states (corrected)RBV | RBV | EP | |
| Requests to designate patent in hong kongDE | DE | HK | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: REQUEST FOR EXAMINATION WAS MADESTAA | STAA | EP | |
| Divisional application: reference to earlier applicationAC | AC | EP | |
| Designated contracting statesAK | AK | EP | |
| Public reference made under article 153(3) epc to a published international application that has entered the european phaseORIGINAL CODE: 0009012PUAI | PUAI | EP | |
| Information on the status of an ep patent application or granted ep patentGrantedSTATUS: THE APPLICATION HAS BEEN PUBLISHEDSTAA | STAA | EP |
Numbers
- Publication
- 3662896
- Application
- 192095198
Titles3
- German
- MESOPORÖSE SILICIUMDIOXIDZUSAMMENSETZUNGEN ZUR MODULIERUNG VON IMMUNREAKTIONEN
- English
- MESOPOROUS SILICA COMPOSITIONS FOR MODULATING IMMUNE RESPONSES
- French
- COMPOSITIONS DE SILICE MÉSOPOREUSE POUR MODULER LES RÉPONSES IMMUNITAIRES
Classification
- CPC, 25
- A61K9/1611
- A61K38/18
- A61K9/0019
- A61K38/193
- A61K39/0011
- A61K39/39
- A61K2039/55561
- A61K2039/55555
- A61K2039/55522
- A61K39/001102
- A61K39/001191
- A61K39/001184
- A61K39/001192
- A61K2039/80
- A61K39/00118
- A61K39/001182
- A61K39/001171
- A61K39/001156
- A61K39/001162
- A61K39/00117
- A61K39/001186
- A61P35/00
- A61P37/04
- A61P43/00
- Y02A50/30
- IPC, 9
- A61K9 00
- A61K9 16
- A61K38 18
- A61K38 19
- A61K39 00
- A61K39 39
- A61P35 00
- A61P37 04
- A61P43 00
Designated states38
- Contracting states, 38
- Albania
- Austria
- Belgium
- Bulgaria
- Switzerland
- Cyprus
- Czechia
- Germany
- Denmark
- Estonia
- Spain
- Finland
- France
- United Kingdom
- Greece
- Croatia
- Hungary
- Ireland
- Iceland
- Italy
- Liechtenstein
- Lithuania
- Luxembourg
- Latvia
and 14 moreShow fewer
- Monaco
- North Macedonia
- Malta
- Netherlands (Kingdom of the)
- Norway
- Poland
- Portugal
- Romania
- Serbia
- Sweden
- Slovenia
- Slovakia
- San Marino
- Türkiye
